SPLICE MODULATING OLIGONUCLEOTIDES AND METHODS OF USE THEREOF

Abstract

A splice modulating oligonucleotide (SMO), is provided having a sequence designed to modulate the splicing of a SCN8A pre-mRNA, wherein the SMO sequence specifically binds to a sequence in the SCN8A pre-mRNA. Certain embodiments of the invention provide methods of using the SMOs described herein, including methods of treating or preventing epilepsy or a Dravet Spectrum disorder in subject (e.g., a mammal, e.g., a human), including the administration of an SMO or composition described herein to the subject. A method of using the SMOs is described herein to treat spinal cord injury, cancer, amyotrophic lateral sclerosis, Alzheimer's disease, traumatic brain injury, autism, hemiplegic migraine, multiple sclerosis, CNS infections, Parkinson's and Huntington's disease, or other neurological diseases or disorders in which excitotoxicity or hyperexcitability contributes to the pathology.

Description

RELATED APPLICATIONS

[0001] This application claims priority benefit of U.S. Provisional Application Ser. No. 62/039,819 filed Aug. 20, 2014; the contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] The present invention in general relates in general to therapeutic compositions, and in particular to a sequence designed to modulate the splicing of a SCN8A pre-mRNA.

BACKGROUND

[0003] A unified "loss-of-function hypothesis" for the spectrum of pediatric epilepsies caused by SCN1A mutations has recently been proposed (Catterall et. al., 2010). These Dravet Spectrum disorders resulting from SCN1A loss-of-function mutations include febrile seizures, generalized epilepsy with febrile seizure plus (GEFS+), and Dravet syndrome (severe myoclonic epilepsy of infancy or SMEI), in order of increasing severity (Meisler and Kearney 2005). GEFS+ patients typically exhibit febrile seizures and mild cognitive impairment in childhood; seizures can either spontaneously resolve or progress to generalized epilepsy over time (Singh et. al., 1999). SMEI is a relatively rare but catastrophic form of childhood epilepsy characterized by the development of seizures in previously healthy infants that advance to include multiple seizure types such as myoclonus, partial seizures, febrile induced, and the absence episodes by age 2. Progressive developmental and behavioral impairments manifest along with the recurrent and varied seizure episodes that are typically unresponsive to currently available antiepileptic drugs (Dravet et. al., 2005). Additionally, motor abnormalities occur in 20-60% SMEI children (Dravet et. al., 2005). Greater availability of genetic testing and advances in mutational screening now allow for better detection and earlier diagnosis of this severe childhood epilepsy, making early intervention and cure a possibility. Thus, there is a significant and urgent need for the development of novel therapeutic approaches in these patients.

[0004] De novo loss-of-function mutations in various sites within the SCN1A gene account for about 70% of SMEI (De 2011) and 10% of GEFS+ (Catterall et. al., 2010). The SCN1gene encodes the a subunit for a voltage-gated sodium (VGS or Nav) channel (Nav1.1), one of a family of 10 paralogous pore-forming alpha subunits (SCN) expressed in the human central nervous system (CNS)), peripheral nerves, and other areas of the body such as the heart. The alpha subunits; SCN1A (Nav1.1), SCN2A (Nav1.2), SCN3A (Nav1.3), SCN4A (Nav1.4), SCN5A (Nav1.5), SCN6/7A, SCN8A (Nav1.6), SCN9A (Nav1.7), SCN10A (Nav1.8), and SCN11/12A (Nav 1.9) as a component of their respective VSG channels, which are critical regulators of neuronal excitability. SCN8A is a VGS channel subunit which functionally opposes the currents produced by SCN1A containing channels. SCN8A-containing (Nav1.6) channels are highly expressed in excitatory neurons (including hippocampal and purkinje neurons), and function to drive excitatory neuron repetitive firing (Chen et. al., 2008; Raman et. al., 1997). Conversely, the majority of SCN1A-containing sodium channels are expressed in GABAergic inhibitory neurons, particularly in hippocampal (Yu et. al., 2006) and purkinje interneurons (Raman et. al., 1997). In SCN1A R168H mutant mice, a GEFS+ model, sodium channel activity in interneurons is impaired, leading to decreased GABAergic inhibition, and the overall effect of the mutation is hyperexcitability and increased seizure susceptibility (Martin et. al., 2010; Tang et. al., 2009). Similarly, SCN1A knockout (KO) SMEI mice exhibit significantly reduced firing and sodium current density in cortical and hippocampal interneurons, with no change in excitatory pyramidal neurons (Ogiwara et. al., 2007; Yu et. al., 2006), suggesting a common lack of inhibitory balance as the cause of SMEI and GEFS+. Interestingly, reducing SCN8A function can "rescue" pro-seizure phenotypes in both SCN1A R168H and SCN1A knockout mice (Hawkins et. al., 2011; Martin et. al., 2007; Meister et. al., 2010). SCN8A partial loss-of-function mutations alone cause ataxia and neuromuscular degeneration, but increased kainate- and flurothyl-induced seizure thresholds in mice (Martin et. al., 2007). However, crossing either SCN1A knockouts or SCN1A R168H mutant mice with an SCN8A partial loss-of-function mutant mouse, normalized flurothyl-induced seizure thresholds and extended lifespan in both lines (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010). Thus, it appears from these studies that reducing SCN8A levels to diminish SCN8A-mediated excitation therapeutically rebalances inhibitory deficits caused by loss-of-function SCN1A mutations.

[0005] The VGS channel a subunits undergo several alternative pre-mRNA splicing events, some of these splicing events regulate the inhibitory and excitatory balance of sodium currents in the CNS. Importantly, SCN8A pre-mRNA undergoes mutually exclusive alternative splicing at both exon 5 and exon 18 during development to form 5N (neonatal), or 5A (adult) and 18N (neonatal), or 18A (adult) isoforms, respectively. Inclusion of the 18N exon introduces a premature stop codon into the transcript to yield a nonfunctional truncated SCN8A 18N isoform (Plummer et. al., 1997), whereas inclusion of 5N leads to lower gain SCNA channels and reduced neuronal excitability (Fletcher et. al., 2011; Gazina et. al., 2010; Xu et. al., 2007). Evaluation in a heterologous expression system, revealed that channels formed from SCN2A 5N isoforms are less excitable than those containing the 5A isoform leading to the hypothesis that exon 5A/N alternative splicing across VGS channels subunits (particularly SCN1A, SCN2A, SCN3A and SCN8A) determines neuronal excitability and seizure susceptibility in human infants (Xu et. al., 2007). Such splicing has been proposed as one mechanism that counters the normally high excitability of neonatal neurons and helps to reduce seizure susceptibility in normal human infants. A single nucleotide polymorphism (SNP) in the exon 5N splice site donor region (IVS5N+5 G>A) is responsible for the wide variation of the proportion of SCN1A 5N expression in the adult human brain (Heinzen et. al., 2007). In samples from human temporal cortex, it was demonstrated that the "A" SNP disrupts exon 5N splicing, such that individuals with the "AA" genotype are reduced to 0.7% of total SCN1A mRNA expression in the 5N isoform, in contrast to the "GG" genotype which averages 41% 5N expression (Heinzen et. al., 2007). Importantly, the SCN1A IVS5N+ 5 G>A polymorphism "AA" genotype which reduces 5N and increases 5A isoform expression also confers a 3-fold greater risk of febrile seizures in childhood (as occurs in Dravet Spectrum epilepsies) over the "GG" genotype providing functional evidence that exon 5 splicing confers changes in neuronal excitability (Schlachter et. al., 2009).

[0006] For the four major voltage-gated sodium channel alpha subunits in the CNS (SCN1A, SCN2A, SCN3A and SCN8A) it has been shown that 18A levels begin to rise between P7.5-P10 and that expression levels of both the 18A and 18N isoforms near adult levels and complete the developmental switch between P20-P30 in mice (Bender et. al., 2012; Plummer et. al., 1997). The change from predominantly 5N to 5A isoform expression for SCN8A is also developmentally regulated. The 5A/5N expression ratio in fetal cynolomous monkey was demonstrated to be only 1.44, while the expression ration in adult cynolomous monkey brain was 8.52 (Raymond et. al., 2004), indicating that there is a significant reversal in the expression pattern over the neonatal period to decrease 5N expression in favor of 5A isoform expression. These developmental switches in SCN8A and SCN1A isoform expression in rodents coincides with the reduced survival and increased susceptibility to seizures seen in GEFS+/SMEI mice (Martin et. al., 2010; Oakley et. al., 2009; Yu et. al., 2006) and correspond well with both the peak in human SCN1A expression at 7-9 months of age (Wang et. al., 2011) and the onset of seizures in GEFS+/SMEI patients (Bender et. al., 2012).

[0007] SCN1A is a member of a family of voltage gated Na+ (VGS) channel a, subunits, and is expressed largely in inhibitory GABAergic interneurons of the central nervous system (CNS). SCN8 channels, conversely, are expressed on excitatory neurons, and thus these two VGS channel subunits reciprocally regulate network excitation. Accordingly, partial loss of

[0008] SCN8A function can "rescue" pro-febrile seizure phenotypes in both SCN1A R168H mutant mice and SCN1A knockout mice (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010).

[0009] In spite of the advances in understanding clinical manifestations of SCN channel pathways and variants, there exists a need for compositions and treatments based on those compositions for treating of diseases and disorders associated with SCN channels, such as neurological disorders or cancer In particular, there is a need for treatments for Dravet Spectrum disorders.

SUMMARY

[0010] Accordingly, certain embodiments of the invention provide a splice modulating oligonucleotide (SMO), comprising a sequence designed to modulate the splicing of a SCN8A pre-mRNA, wherein the SMO sequence specifically binds to a sequence in the SCN8A pre-mRNA.

[0011] Certain embodiments of the invention provide a composition comprising an SMO described herein.

[0012] Certain embodiments of the invention provide a pharmaceutical composition comprising an SMO described herein and a pharmaceutically acceptable carrier.

[0013] Certain embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA comprising contacting a cell with an effective amount of an SMO or a composition described herein.

[0014] Certain embodiments of the invention provide a method of treating or preventing a disease, disorder or condition in subject (e.g., a mammal, e.g., a human), comprising administering an SMO or composition as described herein to the subject.

[0015] Certain embodiments of the invention provide an SMO or a composition as described herein for the prophylactic or therapeutic treatment of a disease, disorder or condition in a subject.

[0016] Certain embodiments of the invention provide the use of an SMO or a composition as described herein to prepare a medicament for treating disease, disorder or condition in a subject.

[0017] Certain embodiments of the invention provide an SMO or a composition as described herein for use in medical therapy.

[0018] Certain embodiments of the invention provide an SMO or a composition as described herein for use in treating a disease, disorder or condition.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1A. Bilateral ICV injections of GR1 and GR3 (2 .mu.g per ventricle) in separate groups of mice (n=5 mice per group) produced nearly 100% reduction in GluA1-flip and GluA3-flip transcripts, respectively, without significant effect on other GluA flip or flop transcript (dotted line shows saline control in all panels). For each subset, LSP-GR1 is shown on the left as a dark grey bar and LSP-GR3 is shown on the right as a light grey bar.

[0020] FIG. 1B. A single bilateral ICV injection of LSP-GR1 in 10 d old mice (2 .mu.g per ventricle) produced a 60-80% reduction in GluA1-flip transcripts that was sustained for 2 months after the injection (n=4-5 mice per group; p<0.001). For each subset, the bar representing the cortex is shown on the left as a light grey bar and the bar representing the hippocampus is shown on the right as a dark grey bar.

[0021] FIG. 1C. Initial evaluation of 2 candidate SCN8A-18A targeting SMOs: E18A-1 (5' g uuu cca cug gca ugc aga agg 3': SEQ ID #878 with n =3 cortex only (dark grey bar); and E18A-2 (5' AGGGUCUCAAAGCUCUUAGGGUC 3': SEQ ID #1324), cortex and hippocampus, n =6 (light grey bars) in P10 pups after P3, P5, and P7 ICV injection (4 .mu.g/ventricle) showed significant reduction in 18A isoform levels. (* denotes p<0.05).

[0022] FIGS. 1D-F. ICV injection of LSP-GR1 (GR1) protected neonatal mice from KA-induced seizures, and prevented status epilepticus (SE)-induced increase in AMPA-R (a)EPSCs. FIG. 1D. Fewer mice progressed to severe seizure stages after a single KA dose (3 mg/kg) at P10 when pre-treated with 2 .mu.g of LSP-GR1 at P1, P3, and P5 (n=11 per group; p <0.001). FIG. 1E. "Second hit" KA dose required to reach SE at P12 in mice given 4 ng of LSP-GR1 2hr post-SE at P10, was 40% greater than for saline (p<0.05), and 20% greater than in naive (no SE) mice (p<0.05; n=7 per group). FIG. 2 C. Whole-cell patch-clamp recordings of aEPSCs from CA1 pyramidal neurons in P12 mice. SE induction at P10, followed 2 hr later by ICV injection of saline, produced a large increase in aEPSC amplitude compared to naive (no SE) mice (p<0.001). SE-induced potentiation of aEPSCs was completely prevented by injection of 4 .mu.g of LSP-GR1 at 2 hrs post-SE (n=5-7 mice per group), suggesting that LSP-GR1 treatment could prevent epileptogenesis. Asterisks in FIG. 1E and FIG. IF indicate significance compared to saline-treated SE-experienced group.

[0023] FIGS. 2A-D. Comparison of top candidate SCN8A exon 18A skipping SMOs. FIG. 2A. Ten SMOs were tested in vivo for ability to direct SCN8A exon 18A skipping via paradigms involving 1, 2, or 3 bilateral ICV injections at doses of 2 or 4 .mu.g per ventricle in neonatal pups between the ages of P3-7. Several SMOs demonstrated statistically significant exon 18A skipping; 18A-2 (SEQ ID: 1324), 18A-3 (SEQ ID: 1327), 18A-4 (SEQ ID: 1317), 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541), at the doses tested.

[0024] FIG. 2B. A single submaximal dose (2 .mu.g bilateral-4 .mu.g total) was given by ICV injection in P3-5 neonatal mouse pups for each candidate compound to examine small differences in splicing efficiency for the most potent of the compounds during initial screening, relative to saline (negative control, dotted line at 1.0) and compared to LSP-GR1 (positive control). The 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) SMOs all showed similar on target splicing efficacy. While 18A-5 (SEQ ID: 1306), seemed to produce greatest splicing in the hippocampus, there was proportionally less splicing in the cortex. Thus, the 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) SMOs all showed similar on target splicing efficacy at a low dose, providing several SMO options to select from as therapeutics. FIG. 2C. Dose-response comparison after high dose (50 .mu.g) intrathecal delivery in adult mice shows that 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) produce equivalent or slightly better splicing than LSP-GR1 in the cervical and lumbar spinal cord.

[0025] Target transcript mRNA is SCN8A exon 18A of 18A SMO and GluA1-flip for LSP-GR1. Duration of action of high single dose SCN8A-18A-9 SMO. FIG. 2D. C57BL/6 mice were harvested at P6, P15, P28, and P42 after a single 4.mu.g bilateral ICV injection of SCN8A-18A-9 ((SEQ ID: 1422, 8.mu.g total) at P3-5. The 18A-9 (SEQ ID: 1422) SMO splicing effect was maintained out to 28 days without decrement though significant exon 18A skipping is still present at P42. SCN8A-18A transcript expression is normalized to saline controls (line=1.0)

[0026] FIGS. 2E-F. Comparison of candidate SCN8A exon 5A skipping SMOs. FIG. 2E. Seven SMOs were tested in vivo for ability to direct SCN8A exon 5A skipping via paradigms involving 1 or 2 bilateral ICV injections at doses of 2 or 4 .mu.g per ventricle in neonatal pups between the ages of P3-5. Only SCN8A-5A-2 (SEQ ID: 33), and 5A-7 (SEQ ID: 26) showed statistically significant exon 5A skipping at the doses tested. FIG. 2F. Dose-response of the candidate exon 5A splicing SMO, SCN8A-5A-2 (SEQ ID: 33), was measured after bilateral ICV injection (n =4 - 6 per dose); single 2 .mu.g/ventricle dose (4 .mu.g total), 2.times.4 .mu.g/ventricle dose (16 .mu.g total), and 3.times.4 .mu.g/ventricle dose (24 .mu.g total) between ages P3-P10 in neonatal mouse pups. SCN8A-5A transcript expression is normalized to saline controls (line=1.0). Significance determined by students t-test with * p<0.05, ** p<0.005 after Bonferoni correction for multiple measures.

[0027] FIGS. 3A-K. SCN8A E5A Splicing SMOs. FIG. 3A. Human SCN8A target sequences for ESA splicing: 7nt of the Intron 5' to Exon 5A + entire 92 nt of Exon 5A+5nt of Intron 5. FIG. 3B. SCN8A E5A 24 mer SMO sequences. FIG. 3C. SCN8A ESA 23 mer SMO sequences. FIG. 3 D. SCN8A E5A 22 mer SMO sequences. FIG. 3E. SCN8A E5A 21 mer SMO sequences. FIG. 3F. SCN8A ESA 20 mer SMO sequences. FIG. 3G. SCN8A E5A 19 mer SMO sequences. FIG. 3H. SCN8A ESA 18 mer SMO sequences. FIG. 3I. SCN8A ESA 17 mer SMO sequences. FIG. 3J. SCN8A E5A 16 mer SMO sequences. FIG. 3K. SCN8A ESA 15 mer SMO sequences.

[0028] FIGS. 4A-D. SCN8A E18A Splicing SMOs. FIG. 4A. Human SCN8A target sequences internal to Intron 18 near the 5' splice site, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. FIG. 4B. Human SCN8A target sequences at the 5' splice site, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. The entire target sequence covers 5' splice site, and is 100% conserved between mouse and human. It is noted that the 5' splice site cannot be targeted while being specific for SCN8A because of too much identity with SCN1A. FIG. 4C. Human SCN8A target sequences within Exon 18A, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. The entire target sequence is exonic, and is 100% conserved between mouse and human. FIG. 4D. SCN8A target sequences from human and SMO sequences for skipping Exon 18A, at 3' ss.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] The present invention has utility as a medical treatment of seizure disorders, neurological disorders, and cancers; as well as novel compositions for the detection of susceptibility thereto. SCN1A loss-of-function mutations are the major cause of Dravet spectrum pediatric epilepsies, including generalized epilepsy with febrile seizure plus (GEFS+) and severe myoclonic epilepsy of infancy (SMEI) or Dravet syndrome (Claes et. al., 2001). The major therapeutic indication for modulating the splicing of SCN8A is to correct the excitatory/inhibitory imbalance in the brain caused by loss-of-function mutations in SCN1A. The relationship of SCN1A and SCN8A can to be thought of as opposing aspects that must balance exactly for normal brain function. If the amount of normal SCN1A function is reduced due to a mutation, then the present invention serves to reduce SCN8A function, to rebalance the scale. An inventive process to control SCN8A function is by controlling the mRNA splicing to code for an alpha subunit protein that either doesn't allow the resulting VGS channel to function as a sodium channel or exhibits reduced sodium channel kinetics.

[0030] Based on SCN1A knock out mouse studies, reducing SCN8 mediated excitation is a logical strategy for rebalancing the reduced inhibitory input caused by SCN1A mutations. However, general sodium channel blockers are largely ineffective at treating Dravet Syndrome due to non-specific effects on Nav sodium channel function, thus there is a need to develop compounds which can specifically and precisely modulate the contributions of the SCN8A subunit to sodium channel function. A novel approach to achieving the needed target specificity is through the development of splice modulating oligonucleotides (SMOs). SCN8A subunits are naturally alternatively spliced at two specific sites of interest. Exon 18 is alternatively spliced to form 18N (neonatal) and 18A (adult) isoforms. Inclusion of the 18N exon yields a truncated nonfunctional SCN8A-18N (Plummer et. al., 1997). Directing splicing to exclude (skip) exon 18A of SCN8A will result in inclusion of the desired 18N isoform. Similarly, there are two alternate exons (5N/5A) which are present in SCN8A pre-mRNA. This splicing event also occurs in related SCN genes and is known to control sodium channel kinetics. Based on similarities in amino acid composition to other SCN genes, the SCN8A 5N-containing mRNA is predicted to yield a lower gain sodium channel and the 5A isoform a higher gain sodium channel (Gazina et. al., 2010; Xu et. al., 2007). Thus, as described herein, reduction of the 18A isoform to favor production of the 18N isoform could be used as a strategy to ameliorate the effects of SCN1A mutations. Similarly, reducing expression of the SCN8A 5A isoform will decrease sodium currents, with a milder and more controlled modulation of channel properties versus creating non-functional isoforms. SMOs are designed to overcome several barriers to successful drug development. In contrast to classic antisense compounds and siRNAs, SMOs do not recruit degradation enzymes (RNAseH, dicer) and therefore do not cause off-target degradation of transcripts. SMOs bind to their targets with exceptional potency, specificity, and negligible off-target effects (Eckstein 2007).

[0031] As a major advantage, our proposed SMOs will be designed for complete selectivity in targeting SCN8A isoform expression without affecting any other highly related VGS channel subunits. Additionally, regulation of SCN8A exon 18A splicing is differentially controlled in non-neuronal cells, thus SMOs can be designed specifically to modulate splicing in the CNS such that release from the CNS during normal metabolism is unlikely to have on-target effects outside of the CNS (Zubovic et. al., 2012), and vice versa. Moreover, the SCN8A gene is nearly 100% conserved between mouse and human surrounding the SMO target sites, such that SMOs validated in the mouse model will be directly applicable to the clinic. The strategy of specifically reducing function only of the Na+ channel subunit that counterbalances SCN1A input (SCN8A) should be more effective with fewer adverse effects than non-selective VGS channel blockers. Further, by changing alternative splicing, an SMO directed against exon 5A will specifically reduce excitatory channel properties, rather than simply decreasing overall Nav1.6 channel function. In addition to treating Dravet spectrum epilepsies, the modulation of SCN8A pre-mRNA splicing may also be used to treat a variety of diseases and disorders. Specifically, the SMOs described herein, which target SCN8A pre-mRNA, may also be used to treat certain neurological disorders and cancer as described below.

[0032] Accordingly, the present invention encompasses a class of compounds known as splice modulating oligonucleotides (SMOs) that modulate pre-mRNA splicing, thereby affecting expression and functionality of a specific protein in a cell; where the pre-mRNA is SCN8A and the protein is Nav1.6. An SMO specifically binds to a complementary sequence on a pre-mRNA at an exon or intron splice suppressor or splice enhancer site, or at an intron-exon splice site, or at a variety of sites on the pre-mRNA containing various other motifs that are predicted to affect splicing. For example, when an SMO specifically binds to a splice enhancer site, or an intron-exon splice site, the adjacent exon is excluded from the resulting mRNA. Additionally, an SMO may specifically bind to a splice suppressor site or an intron-exon site and the adjacent exon is included in the resulting mRNA. Finally, an SMO may specifically bind to a splice enhancer site or an intron-exon splice site and shift the reading frame of the pre-mRNA so that the resulting protein is truncated. In some cases, the resulting protein is a limited-function, or non-functional protein relative to the native protein. The location of an exonic or intronic splice enhancer or suppressor motif may be found anywhere within the exon and the flanking introns. Similarly, an SMO may either fully or partially overlap a predicted exonic or intronic splice enhancer or suppressor site in proximity to an intron-exon boundary and/or be complementary to the predicted 3' or 5' splice Sites.

[0033] Splice Modulating Oligonucleotides and Compositions Thereof

[0034] The present invention is directed, in specific embodiments to oligonucleotides referred to herein as splice modulating oligonucleotides (SMOs), suitable for use in modulating splicing of a target transcript pre-mRNA. Here, SCN8A pre-mRNA splicing is modulated to correct the excitatory/inhibitory imbalance in the brain caused by loss-of-function mutations in SCN1A. Further SCN8A pre-mRNA splicing is modulated to treat any disease or disorder to which reducing or increasing input from SCN8A containing voltage gated sodium channels is therapeutic. SCN8A pre-mRNA splicing is also modulated as a tool for studying SCN8A both in vitro and in vivo.

[0035] It is appreciated that such SMOs are operative as therapeutics, gene therapy, genotyping a subject, and as part of a business method in which any of the aforementioned tasks are accomplished in exchange for financial remuneration. For example, certain embodiments of the invention provide an SMO based on the consensus sequence of sodium channel, voltage-gated, type VIII (Nav1.6), alpha subunit (SCN8A) (OMIM: 600702; Genbank AB027567.1), including upstream and downstream nucleotides (see, e.g., FIGS. 3A-K. and 4A-D). The present invention also includes a pharmaceutical composition including an SMO suitable for modulating splicing of a target pre-mRNA both in vitro and in vivo (e.g., SCN8A pre-mRNA). For example, these SMOs are used according to the methods of the invention to modulate splicing of SCN8A pre-mRNA. In one embodiment, these SMOs are used according to the methods of the invention to modulate splicing of SCN8A pre-mRNA to exclude exon 5A or exon 18A or a combination thereof. In vivo methodologies are useful for both general splice site modulatory purposes, as well as in therapeutic applications in which modulating splicing of a target pre-mRNA is desirable (e.g., to modulate the splicing of SCN8A to treat a disorder such as Dravet spectrum epilepsy).

[0036] (FIGS. 3A-K and 4A-D) depict exemplary SMOs useful for modulating splicing of SCN8A pre-mRNA (e.g., to exclude exon 5A or exon 18A).

[0037] Accordingly, certain embodiments of the invention provide a splice modulating oligonucleotide (SMO) that specifically binds to a SCN8A pre-mRNA (i.e., a pre-mRNA that undergoes splicing to form an mRNA encoding a SCN8A protein).

[0038] In certain embodiments, the inventive SMO specifically binds a complementary sequence of the SCN8A pre-mRNA.

[0039] In certain embodiments, the SMO includes a sequence designed to modulate the splicing of an SCN8A pre-mRNA. In certain embodiments, the SMO includes a sequence that specifically binds to an exon, an intron, a 5' untranslated region (UTR), a 3' UTR, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), an intronic splicing silencer (ISS), an intronic splicing enhancer (ISE), or a combination of any of the aforementioned in the SCN8A pre-mRNA. In certain embodiments, the SMO includes a sequence that specifically binds to exon 5A, exon 5N, exon 18A, exon 18N, intron 4, intron 5, intron 4A, intron 4N, intron 5A, intron 5N, intron 17, intron 18, intron 17A, intron 17N, intron 18A , intron 18N or a combination of any of the aforementioned of the SCN8A pre-mRNA (see, e.g., Example 1 and FIGS. 3A-K. and 4A-D).

[0040] With respect to an inventive SMO, the term "hybridizing" refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art. In particular, the term refers to hybridization of an SMO with a substantially complementary sequence contained within a complementary sequence of a target complementary sequence of the SCN8A pre-mRNA molecule, to the substantial exclusion of hybridization of the SMO with a pre-mRNA that has a non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art. It is appreciated that these conditions are largely dictated by cellular conditions for in vivo applications.

[0041] With respect to the inventive SMO, the term "complementary" or "complementarity" refers to a degree of antiparallel relationship between a strand of SMO and a pre-mRNA molecule In some instances, the complementarity between an inventive SMO and a pre-mRNA is between 80 and 99.9%., while in other instance, the complementarity to a pre-mRNA by an inventive SMO is 100%.

[0042] The SMO of the invention may be defined generally as a nucleotide sequence (or oligonucleotide) a portion of which is capable of hybridizing with the target nucleic acid to exact an antisense activity on the target nucleic acid.

[0043] Alternatively, the inventive SMO may be defined functionally as a nucleotide sequence (or oligonucleotide) a portion of which is complementary to and capable of hybridizing with the target nucleic acid sequence to exact a splice modulation in the target RNA of at least 10% for a given subject as measured by target RNA levels. In a preferred embodiment, the target nucleic acid an SCN8A pre-mRNA.

[0044] With respect to the inventive SMO, the term "splice modulation" refers to molecular manipulation of pre-mRNA splicing to direct the final composition of the mRNA transcript. It is appreciated that complementarity to the target pre-mRNA alone is not sufficient to produce an inventive SMO. The location of SMO binding (ie blocking splicing motifs in the pre-mRNA, and thermodynamics of binding at that site, as well as secondary structure of the pre-mRNA are among the factors that determine whether splice modulation occurs and the magnitude thereof.

[0045] For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al., Molecular Cloning Manual #1, 1989):

Tm=81.5.degree. C.+16.6 Log [Na+]+0.41(% G+C)-0.63(% formamide)-600/#bp in duplex

[0046] As an illustration of the above formula, using [Na+]=[0.368] and 50% formamide, with GC content of 42% and an, average probe size of 200 bases, the Tm is 57.degree. C. The Tm of a DNA duplex decreases by 1-1.5.degree. C. with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42.degree. C. Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.

[0047] The stringency of the ex vivo hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the SMO with a target therefor, the hybridization is usually carried out at salt and temperature conditions that are 20-25.degree. C. below the calculated Tm of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20.degree. C. below the Tm of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6.times.SSC, 5.times.Denhardt's solution, 0.5% SDS and 100 .mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in 2.times.SSC and 0.5% SDS at 55.degree. C. for 15 minutes. A high stringency hybridization is defined as hybridization in 6.times.SSC, 5.times..Denhardt's solution, 0.5% SDS and 100 .mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in 1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes. A very high stringency hybridization is defined as hybridization in 6.times.SSC, 5.times..Denhardt's solution, 0.5% SDS and 100 .mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in 0.1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes.

[0048] Examples of additional conditions under which a nucleotide sequence (or oligonucleotide or SMO sequence) is capable of hybridizing with the target RNA, include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. hybridization for 12-16 hours; followed by washing) and hybridization at 70.degree. C. in 1.times.SSC or 50.degree. C. in 1.times.SSC, 50% formamide followed by washing at 70.degree. C. in 0.3.times.SSC or hybridization at 70.degree. C. in 4.times.SSC or 50.degree. C. in 4.times.SSC, 50% formamide followed by washing at 67.degree. C. in 1.times.SSC. The hybridization temperature for hybrids less than 50 base pairs in length should be 5-10.degree. C. less than the melting temperature (Tm) of the hybrid, as determined according to the following equations. At less than 18 base pairs in length, Tm (.degree. C.)=2 (number of A+T bases)+4 (number of G+C bases). Between 18 and 49 base pairs in length, Tm (.degree. C.)=81.5+16.6 (log 10 [Na+])+0.41 (% G+C)-(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1.times.SSC=0.165 M).

[0049] In certain inventive embodiments, the SMO includes a sequence designed to modulate the splicing of an SCN8A pre-mRNA (e.g., to exclude exon 5A or exon 18A), wherein the SMO has at least about 60% (e.g., about 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%) complementarity to an SCN8A pre-mRNA, and wherein the SMO sequence is 14 to 26 nucleotides long (e.g., about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long).

[0050] In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and modulate the splicing of exon 5A/5N in the SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and exclude exon 5A from a resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and include exon 5N in a resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to a 3' or 5' splice site of SCN8A exon 5A. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5A exonic splice enhancer (ESE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5A intronic splice enhancer (ISE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5N intronic splice silencer (ISS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5N exonic splice silencer (ESS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to exon 5A of the SCN8A pre-mRNA (e.g., binds to a complementary sequence in exon 5A (either partially or wholly within exon 5A)).

[0051] In certain inventive embodiments, the SMO includes a sequence designed to modulate the splicing of exon 18A/18N in the SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and exclude exon 18A from the resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and include exon 18N in a resulting SCN8A mRNA. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to a 3' or 5' splice site of SCN8A exon 18A. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to an exon 18A exonic splice enhancer (ESE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to an exon 18A intronic splice enhancer (ISE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 18N intronic splice silencer (ISS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon. 18N exonic splice silencer (ESS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to exon 18A of the SCN8A pre-mRNA (e.g., binds to a complementary sequence in exon 18A (either partially or wholly within exon 18A)).

[0052] In certain inventive embodiments, the SMO includes a sequence that has at least about 60% complementarity with a SCN8A pre-mRNA sequence. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity with a SCN8A pre-mRNA sequence.

[0053] In certain inventive embodiments, the SMO includes a sequence that has at least about 60% complementarity with SEQ ID NO:1, 858, 965, 1252, or 1859. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity with SEQ ID NO:1, 858, 965, 1252, or 1859.

[0054] In certain inventive embodiments, the SMO includes a sequence that has at least about 60% sequence identity with SEQ ID NOs:2, 859, 966, 1253, or 1860. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with SEQ ID NOs: 2, 859, 966, 1253, or 1860.

[0055] In certain inventive embodiments, the SMO sequence is about 14 to about 26 nucleotides long (e.g., about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long). In certain inventive embodiments, the SMO is about 15 to about 24 nucleotides long.

[0056] In certain inventive embodiments, the SMO is about 14 to about 26 nucleotides and includes between about 6 and 24 contiguous nucleotides (i.e., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides) of any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the SMO includes between about 10 to about 24 contiguous nucleotides of any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the SMO includes about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides of any one of SEQ ID NOs: 3-857.

[0057] In certain inventive embodiments, the SMO is about 14 to about 26 nucleotides and includes between about 6 and 24 contiguous nucleotides (i.e., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides) of any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the SMO includes between about 10 to 24 contiguous nucleotides of any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the SMO includes about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides of any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

[0058] In certain inventive embodiments, the SMO includes a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 3-857.

[0059] In certain inventive embodiments, the SMO is a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 3-857.

[0060] In certain inventive embodiments, the SMO includes a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

[0061] In certain inventive embodiments, the SMO has a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity with any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

[0062] In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964.

[0063] In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 967-1251.

[0064] In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 1254-1858. In certain inventive embodiments, the sequence is SEQ ID NO: 1324.

[0065] In certain inventive embodiments, the sequence is selected from any one of SEQ ID

[0066] NOs: 1861-2140.

[0067] Certain inventive embodiments of the invention provide a composition including an SMO described herein. In certain inventive embodiments, the composition is a pharmaceutical composition. In certain inventive embodiments, the pharmaceutical composition includes a pharmaceutically acceptable carrier.

[0068] The route of SMO administration is oral, rectal, intraventricular, intracranial, intratumoral, intrathecal, intracisternal, epidural, intravaginal, parenteral, intravenous, intramuscular, subcutaneous, local, intraperitoneal, transdermal, by inhalation or as a buccal or nasal spray. The exact amount of SMO required will vary from subject to subject, depending on the age, weight and general condition of the subject, the severity of the disease that is being treated, the mode of administration, and the like. An appropriate amount may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.

[0069] Depending on the intended mode of administration or delivery, the SMO can be in pharmaceutical compositions in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include an effective amount of the selected SMO in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, or diluents. By "pharmaceutically acceptable" is meant a material that is not biologically, or otherwise undesirable, which can be administered to a subject along with the selected SMO without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

[0070] Compositions suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols, suitable mixtures thereof, vegetable oils and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

[0071] These compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0072] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is admixed with at least one inert customary excipient such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants; as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

[0073] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols, and the like.

[0074] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others well known in the art. They may contain opacifying agents, and can also be of such composition that they release the SMO in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions which can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0075] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, as for example, ethyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofiirfuryl alcohol, polyethyleneglycols and fatty acid esters of sorbitan or mixtures of these substances, and the like.

[0076] Besides such inert diluents, the compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0077] Suspensions, in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.

[0078] Compositions for rectal administrations are preferably suppositories which can be prepared by mixing the compounds of the present invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt in the rectum or vaginal cavity and release the active component.

[0079] Dosage forms for topical administration of a compound of this invention include ointments, powders, sprays, and inhalants. The active component is admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, eye ointments, powders, and solutions are also contemplated as being within the scope of this invention.

Synthesis of SMOs

[0080] An oligonucleotide of the invention, i.e. the SMO, can be synthesized using any procedure known in the art, including chemical synthesis, enzymatic ligation, organic synthesis, and biological synthesis.

[0081] In one embodiment, an RNA molecule, e.g., an SMO, is prepared chemically. Methods of synthesizing RNA and DNA molecules are known in the art, in particular, the chemical synthesis methods as described in Verma and Eckstein (1998) Annul Rev. Biochem. 67:99-134. RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.

[0082] Alternatively, the RNA may be used with no or a minimum of purification to avoid losses due to sample processing.

Modifications of SMOs

[0083] In certain inventive embodiments, the oligonucleotides of the present invention (i.e. SMOs) are modified to improve stability in serum or growth medium for cell cultures, or otherwise to enhance stability during delivery to subjects and/or cell cultures. In order to enhance the stability, the 3'-residues may be stabilized against degradation, e.g., they may be selected such that they include only purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2'-deoxythymidine, or cytosine by 5'-methylcytosine, can be tolerated without affecting the efficiency of oligonucleotide reagent-induced modulation of splice site selection. For example, the absence of a 2' hydroxyl may significantly enhance the nuclease resistance of the oligonucleotides in tissue culture medium.

[0084] In an embodiment of the present invention, the oligonucleotides, e.g., SMOs, may contain at least one modified nucleotide analogue at any position within the sequence, including the entirety of the SMO sequence. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the splice modulating activity is not substantially effected, e.g., in a region at the 5'-end and/or the 3'-end of the oligonucleotide molecule, or a combination of such sites to increase stability against enzymatic degradation while preserving functionality compared to a base SMO containing only nucleotides naturally occurring in the host. Particularly, the ends may be stabilized by incorporating modified nucleotide analogues.

[0085] Specific nucleotide analogues operative herein include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides, the phosphodiester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphorothioate group. In preferred sugar-modified ribonucleotides, the 2' OH-group is replaced by a group of CH.sub.3, H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2 or ON, where R is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl or C.sub.2-C.sub.6 alkynyl and halo is F, Cl, Br or I. In a preferred embodiment, the 2' OH-group is replaced by O--CH.sub.3 also known as 2'O-methyl modification

[0086] Other specific nucleotide analogues include nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to phosphorothioate derivatives and acridine substituted nucleotides, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluraci I.sub.5 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine, uridine and/or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine. It should be noted that the above modifications may be combined. Oligonucleotides of the invention also may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the oligonucleotides. Within the oligonucleotides (e.g., oligoribonucleotides) of the invention, as few as one and as many as all nucleotides of the oligonucleotide can be modified. For example, a 20-mer oligonucleotide (e.g., oligoribonucleotide) of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 modified nucleotides. In preferred embodiments, the modified oligonucleotides (e.g., oligoribonucleotides) of the invention will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and/or bio-accessibility while maintaining cost effectiveness. SMOs of the invention include oligonucleotides synthesized to include any combination of modified bases disclosed herein in order to optimize function. In one embodiment, an SMO of the invention includes at least two different modified bases. In another embodiment, an SMO of the invention may include alternating 2' O-methyl substitutions and LNA bases or constrained ethyl nucleic acid (cEt) bases.

[0087] An oligonucleotide of the invention can be an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al., 1987, Nucleic Acids Res. 15:6625-6641). The oligonucleotide can also include a 2'-O-methylribonucleotide (Inoue et al., 1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).

[0088] In various embodiments, the oligonucleotides of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al., 1996, Bioorganic & Medicinal Chemistry 4(1): 5-23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al.

[0089] (1996) Proc. Natl. Acad. Sci. USA 93:14670-675. In another embodiment, PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al, 1989, Nucleic Acids Res. 17:5973-88). PNA monomers are then coupled in a step-wise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al., 1996, Nucleic Acids Res. 24(17): 3357-63). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al., 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).

[0090] The oligonucleotides of the invention can also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide is converted to a morpholine moiety (morpholine C.sub.4H9NO; refer to Heasman, J. 2002 Developmental Biology 243, 209-214, the entire contents of which are incorporated herein by reference).

[0091] In certain inventive embodiments, an operative SMO has an oligonucleotide modification that includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (.about.CH.sub.2.about.).sub.n group (such as an ethyl or methoxymethyl group) bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226, the entire contents of which arc incorporated by reference herein. In other embodiments, the oligonucleotide can include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al., 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

[0092] The invention also includes molecular beacon nucleic acid molecules having at least one region which is complementary to a nucleic acid molecule of the invention, such that the molecular beacon is useful for quantitating the presence of the nucleic acid molecule of the invention in a sample. A "molecular beacon" nucleic acid is a nucleic acid molecule including a pair of complementary regions and having a fluorophore and a fluorescent quencher associated therewith. The fluorophore and quencher are associated with different portions of the nucleic acid in such an orientation that when the complementary regions arc annealed with one another, fluorescence of the fluorophore is quenched by the quencher. When the complementary regions of the nucleic acid molecules are not annealed with one another, fluorescence of the fluorophore is quenched to a lesser degree. Molecular beacon nucleic acid molecules are described, for example, in U.S. Pat. No. 5,876,930.

[0093] In certain inventive embodiments, the SMO includes at least one nucleotide that contains a non-naturally occurring modification including at least one of a chemical composition of phosphorothioate 2'-O-methyl, phosphorothioate 2'-MOE, locked nucleic acid (LNA) peptide nucleic acid (PNA), phosphorodiamidate morpholino, or any combination thereof.

[0094] In certain inventive embodiments, the SMO includes at least one 2'-O-methyl nucleotide. In certain inventive embodiments, the SMO includes at least two 2'-O-methyl nucleotides. In certain inventive embodiments, the SMO includes at least three 2'-O-methyl nucleotides. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides are 2'-O-methyl modified.

[0095] In certain inventive embodiments, the SMO includes at least one nucleotide with a phosphorothioate linkage. In certain inventive embodiments, the SMO includes at least two nucleotides with phosphorothioate linkages. In certain inventive embodiments, the SMO includes at least three nucleotides with phosphorothioate linkages. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides include phosphorothioate linkages.

[0096] In certain inventive embodiments, the SMO includes at least one phosphorothioate 2'-O-methyl modified nucleotide. In certain inventive embodiments, the SMO includes at least two phosphorothioate 2'-O-methyl modified nucleotides. In certain inventive embodiments, the SMO includes at least three phosphorothioate 2'-O-methyl modified nucleotides. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides are phosphorothioate 2'-O-methyl modified.

[0097] In certain inventive embodiments, modifications include a bicyclic sugar moiety similar to the LNA has also been described (see U.S. Pat. No. 6,043,060) where the bridge is a single methylene group which connect the 3'-hydroxyl group to the 4' carbon atom of the sugar ring thereby forming a 3'-C,4'-C-oxymethylene linkage. In certain inventive embodiments oligonucleotide modifications include cyclohexene nucleic acids (CeNA), in which the furanose ring of a DNA or RNA molecule is replaced with a cyclohexenyl ring to increase stability of the resulting complexes with RNA and DNA complements (Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602). In certain inventive embodiments other bicyclic and tricyclic nucleoside analogs are included in the SMO.

[0098] The target RNA (e.g., pre-mRNA, e.g., SCN8A pre-mRNA) splice-modifying interaction guided by oligonucleotides of the invention is highly sequence specific. In general, oligonucleotides containing nucleotide sequences perfectly complementary, having 100% complementarity to a portion of the target RNA are exposed to target RNA for blocking of sequence elements within the target RNA. However, it is appreciated that 100% sequence complementarity between the oligonucleotide and the target RNA is not required to practice the present invention. Thus, the invention may tolerate sequence variations that might be expected due to genetic mutation, wobble base pairing, strain polymorphism, or evolutionary divergence. In wobble base pairing non-Watson-Crick nucleotide pairing occurs in which U can pair with both A and G, so A can be substituted with G, and inosine (I) can pair with any base. For example, oligonucleotide sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for SMO-mediated splice modulation. Alternatively, oligonucleotide sequences with nucleotide analog substitutions or insertions can be effective for splice modulation. Greater than 70% sequence identity (or complementarity), e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity, and any and all whole or partial increments there between the oligonucleotide and the target RNA, e.g., target pre-mRNA, is preferred.

[0099] It is further understood in the art that incorporation of nucleotide affinity modifications may allow for a greater number of mismatches compared to an unmodified compound. Certain oligonucleotide (SMO) sequences may be more tolerant to mismatches than other oligonucleotide sequences. One of ordinary skill in the art is capable of determining an appropriate number of mismatches between oligonucleotides, between an SMO and a target nucleic acid, such as by determining melting temperature (Tm) and evaluating the effect of chemical modifications on the Tm and hybridization stringency. Tm can be calculated by techniques that are familiar to one of ordinary skill in the art.

[0100] Techniques and calculations as described in Freier et at (Nucleic Acids Research, 1997, 25, 22: 4429-4443) allow one of ordinary skill in the art to evaluate nucleotide modifications for their ability to increase the Tm of an RNA: RNA or an RNA: DNA duplex.

[0101] In certain inventive embodiments, "sequence identity" or "identity" in the context of two nucleic acid sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned by sequence comparison algorithms or by visual inspection. For example, sequence identity may be used to reference a specified percentage of residues that are the same across the entirety of the two sequences when aligned.

[0102] In certain inventive embodiments, the term "substantial identity" of polynucleotide sequences means that a polynucleotide includes a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%; at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%; at least 90%, 91%, 92%, 93%, or 94%; or even at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.

[0103] Sequence identity, including determination of sequence complementarity or homology for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology =number of identical positions/total number of positions.times.100), optionally penalizing the score for the number of gaps introduced and/or length of gaps introduced. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0104] In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0105] [NL: This is not the definition of sequence identity that we want to use because it is too narrow, but my understanding from our discussions is

[0106] that we should not remove it? As long as we describe sequence identity more broadly below, does that still cover us?] In another embodiment, the sequence identity for two sequences is based on the greatest number of consecutive identical, nucleotides between the two sequences (without inserting gaps). For example, the percent sequence identity between Sequence A and B below would be 87.5% (Sequence B is 14/16 identical to Sequence A), whereas the percent sequence identity between Sequence A and C would be 25% (Sequence C is 4/16 identical to Sequence A).

TABLE-US-00001 Example Sequence A: GCATGCATGCATGCAT Example Sequence B: GCATGCATGCATGC Example Sequence C: GCATTTGCAGCAGC

[0107] In yet another embodiment, nucleic acids, oligonucleotides, SMOs, or a portion thereof, may have a defined percent identity to a SEQ ID NO, or a another LifeSplice compound. As used herein, a sequence is identical to the SMO sequence disclosed herein if it has the same nucleobase pairing ability. This identity may be over the entire length of the nucleotide sequence, or in a portion of the nucleotide sequence e.g., nucleobases 1-20 of a 300-mer may be compared to a 20-mer to determine percent identity of the nucleic acid to the SEQ ID NO described herein. Percent identity is calculated according to the number of nucleotide bases that have identical base pairing corresponding to the SEQ ID NO or SMO compound to which it is being compared. The non-identical bases may be adjacent to each other, dispersed throughout the nucleotide sequence, or both. For example, a 18-mer having the same sequence as nucleobases 3-20 of a 24-mer SMO is 75% identical to the 24-mer SMO. Alternatively, a 24-mer containing six nucleobases not identical to another 24-mer is also 75% identical to the 24-mer. Similarly a 15-mer having the same sequence as nucleobases 1-15 of a 100-mer is 15% identical to the 100-mer. Such calculations are well within the ability of those skilled in the art.

[0108] It is further understood by those skilled in the art that a nucleic acid sequence need not have an identical sequence to those described herein to function similarly to the SMO compound described herein. Shortened versions of SMO compounds taught herein, or non-identical versions of the SMO compounds taught herein, are also provided. Non-identical versions can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T), wobble base pairing, or sequences are those wherein each base does not have the same pairing activity (e.g. by the nucleic acid sequence being shorter or having at least one abasic site) as the SMOs disclosed herein.

[0109] Alternatively, the oligonucleotide may be defined functionally as a nucleotide sequence (or oligonucleotide sequence) a portion of which is capable of hybridizing with the target RNA (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. hybridization for 12-16 hours; followed by washing). Additional preferred hybridization conditions include hybridization at 70.degree. C. in IX SSC or 50.degree. C. in IX SSC, 50% formamide followed by washing at 70.degree. C. in 0.3.times.SSC or hybridization at 70.degree. C. in 4.times.SSC or 50.degree. C. in 4X SSC, 50% formamide followed by washing at 67.degree. C. in IX SSC. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10.degree. C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 1 8 base pairs in length, Tm(.degree. C).=2(number of A+T bases)+4(number of G+ C bases). For hybrids between 18 and 49 base pairs in length, Tm(.degree. C)=81.5+16.6(log 10[Na.sup.+])+0.41(% G+C)-(600/N), where N is the number of bases in the hybrid, and [Na.sup.+] is the concentration of sodium ions in the hybridization buffer ([Na.sup.+] for IX SSC=0.165 M). Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., chapters 9 and 1 1, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference. The length of the identical nucleotide sequences may be at least about 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45, 47 or 50 bases.

Methods of Use

[0110] Methods of Modulating SCN8A pre-mRNA Splicing

[0111] The present invention provides compositions and methods for modulating SCN8A pre-mRNA splicing using an SMO of the invention (e.g., to abrogate disease-causing mutations in a protein, such as SCN1A). For example, an SMO may modulate pre-mRNA splicing by removing an exon (e.g., exon 5A or exon 18A) or including an exon (e.g., exon 5N or exon 18N) in order to alter protein isoform expression (e.g., to enhance expression of isoforms with reduced excitatory function). For example, an SMO as described herein may modulate SCN8A pre-mRNA by excluding exon 5A in the resulting SCN8A mRNA. These

[0112] SMOs may be used to modify SCN8A channel properties, i.e., to reduce sodium currents. In other embodiments, an SMO described herein may modulate SCN8A pre-mRNA by excluding exon 18A in the resulting SCN8A mRNA. These SMOs may be used to generate a truncated SCN8A protein that is non-functional as a sodium channel, or that is not even translated into a SCN8 protein.

[0113] Accordingly, certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA, either in vitro or in vivo including contacting a cell with an effective amount of an SMO or composition described herein. In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence (e.g., at an intron/exon splice site, ESE and/or ISE), thereby excluding exon 5A or exon 18A from a resulting SCN8A mRNA.

[0114] Certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA including contacting a cell with an effective amount of an SMO that specifically binds to a complementary sequence on the pre-mRNA at a intron-exon splice site, ESE and/or ISE, wherein when the SMO specifically binds to the complementary sequence, exon-18A or exon-5A is excluded from the resulting mRNA, and wherein the resulting mRNA encodes an SCN8A protein.

[0115] Certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA including contacting a cell with an effective amount of an SMO that specifically binds to a complementary sequence on the pre-mRNA at a intron-exon splice site, ESE and/or ISE, wherein when the SMO specifically binds to the complementary sequence, exon-18N or exon-5N is included in the resulting mRNA, and wherein the resulting mRNA encodes an SCN8A protein.

[0116] Certain inventive embodiments of the invention provide a method of reducing neuronal excitability including contacting a cell with an effective amount of an SMO or composition described herein.

Methods of Treating Diseases and Disorders

[0117] The relationship between SCN8A pre-mRNA splicing and the Dravet spectrum epilepsies is described above; however, SCN8A dysregulation or dysfunction is also associated with other diseases and disorders as described below.

[0118] Hyperexcitability Including other Epilepsies. SCN8A loss-of function mutation or knockout results in increased seizure threshold to chemoconvulsant induced seizures (Martin et. al., 2007), thus the SMOs that modulate SCN8A isoform expression (e.g., decrease E5A or E18A; FIGS. 3A-K. and 4A-D) are viable therapeutics for other types of refractory pediatric and adult epilepsies; some that have dysfunctional SCN1A and others that do not. More broadly, these SMOs have the potential be treat various diseases or disorders in which CNS hyperexcitability and/or excitotoxicity have been implicated as having a significant contribution to disease pathology through dysfunction of SCN1A or SCN8A. Additionally, there are hundreds of SCN1A and SCN8A mutations attributed to a variety of epilepsy syndromes aside from the Dravet spectrum epilepsies (Oliva et. al., 2012).

[0119] Further it has recently been demonstrated that selective reduction of, SCN8A expression in the hippocampus is responsible for the anti-seizure effect of SCN8A reduction (Makinson et. al., 2014) and is a strategy that could be accomplished in humans with intractable epilepsies. While complete SCN8A KO causes a severe phenotype in mice including motor system degeneration and early lethality (Martin et. al., 2007; Meisler et. al., 2004), loss of function mutations have been found in humans with only mild impact on cognition (Trudeau et. al., 2006).

[0120] Additionally, pathogenic SCN8A gain-of-function mutations have been found in patients with epileptic encephalopathy (Estacion et. al., 2014; Ohba et. al., 2014; Vaher et. al., 2013; Veeramah et. al., 2012). Epileptic encephalopathy is characterized by onset of variable types of seizures in infancy including generalized tonic-clonic, atypical absence, partial, apneic attack, febrile convulsion, and loss of tone and consciousness, which are refractory to typical anti-seizure drugs (Ohba et. al., 2014) and (SUDEP) sudden unexplained death of epilepsy (Oliva et. al., 2012; Veeramah et. al., 2012). Patients may also exhibit developmental delay or regression in infancy, resulting in severe intellectual disability, cerebellar and cerebral atrophy (Ohba et. al., 2014) and movement disorders (Vaher et. al., 2013). Thus, the use of SMOs to reduce expression of either the SCN8A 18A or 5A isoforms could mitigate the disease causing effects of SCN8A gain-of-function mutations. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection as infrequently as every 1-6 months or by continuous infusion via pump (ie Omaya Reservoir) directly into the hippocampus. Dosing for peripheral indications (ie SUDEP from cardiac arrythmia) can be achieved through subcutaneous or intravenous injections as infrequently as every 1-6 months, or a multiple loading dose strategy could also be used.

[0121] Spinal Cord Injury. Blockade of continuous post-traumatic SCN channel activation in general prevents the neuronal acidosis, swelling, and Ca2+ excitotoxicity that contributes to spinal cord injury (Wilson and Fehlings 2014). Thus, SMOs in the present invention that mediate splice modulation of SCN8A channel alpha subunits to reduce functional channel expression (E18A) or modulate channel properties (ESA) are strong therapeutic candidates. SMO dosing for spinal cord injury can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, or as otherwise necessary.

[0122] Cancer. Voltage-gated sodium channels are also expressed in non-excitable cells such as macrophages and neoplastic cells. A functional splice variant containing E18A of SCN8A, is required for podosome and invadopodia formation in macrophages. SCN8A is as the alpha subunit of NaV1.6. Absence of functional NaV1.6 through a naturally occurring mutation (med) in mouse peritoneal macrophages inhibited podosome formation (Carrithers et. al., 2009). Invasion of the extracellular matrix by differentiated THP-1 cells, an invasive melanoma cell line, also was inhibited by knockdown of SCN8A, thus SCN8A and by extension, NaV1.6,participates in the control of podosome and invadopodia formation (Carrithers et. al., 2009). Similarly, reduction in SCN8A 18A isoform expression via an SMO-mediated splice modulation should help prevent metastatic ability of even non-neuronal cancer cells. Depending on the location of said cancer, SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, continuous ICV infusion via pump (ie Omaya Reservoir), or bolus delivery (ie Omaya Reservoir) directly into the tumor vasculature. Dosing for peripheral indications can be achieved through monthly subcutaneous injections.

[0123] Amyotrophic Lateral Sclerosis (ALS). Riluzole, the only drug approved to treat ALS (albeit with very modest efficacy), is thought to work in part by antagonizing SCN channel alpha subunits, particularly SCN8A (Nutini et. al., 2011; Sierra et. al., 2012). Thus, the specific modulation of SCN8A properties conferred by the SMOs in the instant invention is expected to provide neuroprotection to a-motor neurons that are selectively lost is this fatal neurodegenerative disease. Importantly, the SMOs recited herein that reduce SCN8A 5A and 18A isoforms also are expected to provide a potent anti-inflammatory response in the CNS (see Section 10 below), and therefore are expected to provide therapeutic benefit to ALS patients via a dual mechanism. SMO dosing for ALS can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

[0124] Alzheimer's disease (AD). Reduced SCN1A (the alpha subunit of Nav1.1) expression in inhibitory interneurons and parvalbumin cells are found both in mouse models of AD and AD patients (Verret et. al., 2012). Similarly, restoring normal levels of SCN1A in the brain of AD mice reduced epileptiform discharges, memory deficits, and increased survival. Thus, among the serious maladies in AD, neuronal network excitatory imbalance produces debilitating brain pathology. An innovative SMO-based therapeutic approach to rebalance the net inhibitory plus excitatory synaptic drive from reduced SCN1A expression in AD, is to reduce the counterbalancing SCN8A synaptic drive using optimal SMOs that reduce either SCN8A E18A (FIGS. 4A-D) or the SCN8A E5A (FIG. 3A-K) isoform expression, reducing overall synaptic input from the SCN8A-containing VGS channels. There is strong literature-based rationale from Dravet syndrome mouse models that reduced inhibitory drive as a result of diminished SCN1A-containing VGS channels may be mitigated by concurrently reducing SCN8A excitatory drive with minimal adverse effects. In the case of the present invention, this strategy may feasibly be accomplished via reducing SCN8A E5A- or E18A-containing isoforms of SCN8A. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

[0125] Traumatic Brain injury (TBI). Depolarization of voltage-gated sodium (VGS) channels and the resultant increased neuronal Na+ influx are critical early events in the initiation of deleterious cellular changes after TBI (Mao et. al., 2010). In particular NaV1.6 (SCN8A) expression is upregulated within hours of percussive TBI insult (Mao et. al., 2010). Thus, a rational and innovative strategy to prevent subsequent cellular damage in the acute post-injury period is to reduce the excessive Na+ influx through SCN8A-containing VGS channels by SMO-mediated skipping of exon 5A (FIG. 3A-K) or 18A (FIG. 4A-D). SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

[0126] Autism. Autism has been linked to de novo SCN1A mutations (O'Roak et. al., 2011; O'Roak et. al., 2012). Not surprisingly, patients with Dravet spectrum epilepsies may also exhibit austistic behaviors due to SCN1A mutations (Han et. al., 2012), thus rebalancing the excitatory and inhibitory inputs in the brain can be accomplished through reducing SCN8A E18A or ESA expression which could provide therapeutic benefit to autistic patients. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

[0127] Hemiplegic migraine. Familial Hemiplegic Migraine (FHM) has been linked in some families to missense mutations in the SCN1A gene, leading to alterations in SCN1A-containing VGS channel function (Gargus and Toumay 2007; Silberstein and Dodick 2013), which may be corrected by reducing Na+ currents through the counterbalancing SCN8A-containing VGS channels. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

[0128] Multiple Sclerosis. SCN8A-containing VGS channels in demyelinated axons (a hallmark of multiple sclerosis; MS) activates a Na+-Ca2+ exchanger that imports Ca2+ into the axon, leading to axonal injury and eventually axonal degeneration (Waxman 2006). SCN8A is upregulated in microglia of MS patients and in animal models of MS (Black and Waxman 2012). Thus, reducing SCN8A function with SMOs (see, e.g., FIG. 3A-K. and 4A-D), would both reduce microglial activation and axonal injury/degeneration; providing therapeutic benefit to MS patients via two distinct mechanisms. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

[0129] Peripheral neuropathic pain (including post-herpetic neuralgia and diabetic neuropathy): There is indirect evidence of increased persistent Na.sup.+ currents at nodes of Ranvier due to changes in expression of Na.sub.v1.6 in diabetic neuropathy (Morris et. al., 2012).

[0130] Development of neuropathic pain depends on axonal hyperexcitability due to increased nodal Na.sup.+ currents, which is potentiated by lack of glycemic control, and this cascade is suggested to be responsible for neuropathic pain/paresthesia in diabetic neuropathy (Misawa et. al., 2009). Post-herpetic neuralgia (PHN) results from reactivation of the dormant varicella zoster (chickenpox) virus in the dorsal root ganglion (DRG) years after initial infection, and is often unresponsive to current to analgesics and current anti-virals (Garry et. al., 2005). Varicella zoster virus infection is associated with a significant increase in Na.sub.v 1.6 mRNA, which significantly increased Na+ current amplitude (Kennedy et. al., 2013). Therefore, reduction of sodium current through Na.sub.v 1.6 channels and corresponding SCN8A subunit via SMO-mediated splice direction specifically to reduce expression of 18A and 5A containing isoforms could be therapeutic for peripheral neuropathic pain. Dosing for peripheral indications can be achieved through monthly subcutaneous injections. SMO dosing may also be accomplished by direct bolus intrathecal injection or epidural injection at the affected spinal level at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

[0131] Carpal tunnel: In carpal tunnel syndrome, persistent Na+ current becomes altered across the carpal tunnel region leading to injury, inflammation, and ectopic impulse generation (Kuwabara et. al., 2006). Nav1.6 (and SCN8A) is highly expressed in the peripheral nodes of Ranvier (Morris et. al., 2012). Sodium channel blockers such as Mexiletine, have been sown to be useful, thus SMO treatment to alter splicing of SCN8A, specifically to reduce expression of 18A or 5A containing isoforms individually or in combination may produce long term relief of symptoms or prevent need for surgery. Dosing for peripheral indications can be achieved through monthly local subcutaneous, intramuscular, or intracapsular injections. SMO dosing may also be accomplished by epidural injection at the affected spinal level at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

[0132] Cardiovascular disease or disorder (e.g., hypertension, congestive heart failure, ischemia/reperfusion, arrhythmias): Arrhythmia and Ischemia and reperfusion injury: It is thought that ventricular and atrial expression of Nav1.6, in part, allows for a slow persistent Na+ current based Na.sub.v channel leak leading to arrhythmia or contributing to ischemia and reperfusion injury (Morris et. al., 2012). However, current sodium channel blocking strategies to ameliorate cardiac ischemic and reperfusion damage, including block of the Na+/H+ exchanger, have so far been therapeutically ineffective (Weiss et. al., 2010) necessitating novel therapeutic approaches. Riluzole, through preferential block of persistent Na+ current, was shown to provide dose-dependent protection against cardiac ischemia and reperfusion injury in animal models, suggesting block of the SCN8A/Nav 1.6 mediate persistent sodium current would be a viable method of ameliorating cardiac ischemic/reperfusion damage (Weiss et. al., 2010). Through inhibition of Na+ current in the ventricles even in patients with structurally compromised hearts, Ranolazine, an FDA-approved anti-anginal agent, can suppress arrhythmias associated with acute coronary syndrome, long QT syndrome heart failure, ischemia/reperfusion in the ventricles and also suppress atrial tachyarrhythmias and atrial fibrillation (Antzclevitch et. al., 2011).Thus, reducing persistent or late Na+ current specifically in cardiomyocytes through splice-modulation of SCN8A E18A/N or ESA/N, could allow for greater Na+ channel modulation and provide long-term antiarrhythmic therapy for intractable cases, and acutely prevent ischemia-reperfusion injury after heart attack. SMO dosing for cardiac indications can be achieved through monthly subcutaneous injections, or as otherwise necessary for efficacy and patient compliance.

[0133] Other diseases with a neuroinflammatory component. SCN8A expression is upregulated in activated microglia, and blocking SCN8A activity with nonselective Na+ channel blockers prevents microglia activation (Black and Waxman 2012). Thus, many neurological diseases/disorders with a neuroinflammatory component, including but not limited to CNS infections, stroke, ALS, Alzheimer's disease, Parkinson's disease, Huntington's disease (Fernandes et. al., 2014), and aging and age-related disorders (Norden and Godbout 2013) may be treatable using the highly selective SCN8A SMOs (FIGS. 3A-K. and 4A-D) of the present invention.

[0134] Accordingly, the present invention also provides compositions and methods of treating a subject at risk of, susceptible to, or having a disease, disorder, or condition associated with SCN8A pre-mRNA expression or SCN8A protein expression or function. In one embodiment, a SCN8A pre-mRNA may be an alternatively spliced, aberrantly spliced, overexpressed or unwanted pre-mRNA (e.g., a SCN8A pre-mRNA including exon 5A or exon 18A) that encodes a protein that results in, causes, produces, or pre-disposes a subject to a disease or disorder. In another embodiment, splicing of a SCN8A pre-mRNA is not a cause of a disease or disorder, but modulation of the splicing of the SCN8A pre-mRNA reduces at least one symptom of the disease or disorder.

[0135] In another embodiment, the invention provides a method of preventing in a subject, a disease, disorder, or condition associated with SCN8A pre-mRNA splicing, the method including administering to the subject an SMO or composition described, or vector, or transgene encoding same.

[0136] Accordingly, certain inventive embodiments of the invention provide a method of treating or preventing a disease, disorder or condition in subject (e.g., a mammal, e.g., a human), including administering an SMO or composition described herein to the subject.

[0137] In certain inventive embodiments, the disease, disorder or condition is a neurological disease, disorder or condition. For example, in certain inventive embodiments, the neurological disease, disorder or condition is epilepsy (e.g., a Dravet spectrum epilepsy), a disease or disorder associated with CNS hyperexcitability and/or excitotoxicity, a spinal cord injury, amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), traumatic brain injury (TBI), autism, hemiplegic migraine, multiple sclerosis or a neuroinflammatory associated disease or disorder. In certain inventive embodiments, the neuroinflammatory associated disease or disorder is a CNS infection, stroke, ALS, AD, Parkinson's disease, Huntington's disease, aging or aging related disorders.

[0138] In certain inventive embodiments, the disease, disorder or condition is pain mediated by SCN8A regulation. For example, in certain inventive embodiments the pain mediated disease, disorder or condition is peripheral neuropathic pain or carpal tunnel syndrome.

[0139] In certain inventive embodiments, the disease, disorder or condition is cardiovascular mediated by SCN8A regulation. For example, in certain inventive embodiments the cardiovascular mediated disease, disorder or condition is hypertension, congestive heart failure, ischemia/reperfusion, or arrhythmia.

[0140] In certain inventive embodiments, the disease, disorder or condition is cancer mediated by SCN8A regulation. In certain inventive embodiments, the cancer is brain cancer mediated by SCN8A regulation.

[0141] Certain inventive embodiments of the invention provide a method of treating or preventing epilepsy or a Dravet Spectrum disorder in subject (e.g., a mammal, e.g., a human), including administering an SMO or composition described herein to the subject.

[0142] In certain inventive embodiments, the Dravet Spectrum disorder is caused by a SCN1A mutation. In certain inventive embodiments, the Dravet Spectrum disorder is febrile seizures, generalized epilepsy with febrile seizure plus (GEFS+) or Dravet syndrome (severe myoclonic epilepsy of infancy or SMEI).

[0143] In certain inventive embodiments, the administration reduces SCN8A excitatory function.

[0144] In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence, wherein when the SMO specifically binds to the SCN8A pre-mRNA sequence, exon 5A is excluded in the resulting SCN8A mRNA, and wherein the resulting mRNA encodes a SCN8A protein.

[0145] In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence, wherein when the SMO specifically binds to the SCN8A pre-mRNA sequence, exon 18A is excluded in the resulting SCN8A mRNA, and wherein the resulting mRNA encodes a SCN8A protein.

[0146] In certain inventive embodiments, the SCN8A protein has reduced excitatory function.

[0147] Certain inventive embodiments of the invention provide an SMO as described herein for the prophylactic or therapeutic treatment of a disease or disorder in a subject mediated by SCN8A regulation.

[0148] Certain inventive embodiments of the invention provide the use of an SMO as described herein to prepare a medicament for treating a disease or disorder in a subject mediated by SCN8A regulation.

[0149] Certain inventive embodiments of the invention provide an SMO as described herein for use in medical therapy.

[0150] Certain inventive embodiments of the invention provide an SMO as described herein for use in treating a disease or disorder mediated by SCN8A regulation.

Methods of Administration

[0151] Examples of methods for introducing oligonucleotides into cells encompass in vivo and ex vivo methods. The oligonucleotides of the invention, i.e. SMOs, are typically administered to a subject or generated in situ such that they hybridize with or bind to SCN8A pre-mRNA. In one embodiment, the SMO enhances exclusion of exon 5A or enhances inclusion of exon 5N during splicing of a SCN8A pre-mRNA. In still other embodiments, the SMO enhances exclusion of exon 5N or enhances inclusion of exon 5A during splicing of a SCN8A pre-mRNA. .In another embodiment, the SMO enhances exclusion of exon 18A or enhances inclusion of exon 18A during splicing of a SCN8A pre-mRNA. In still other embodiments, the SMO enhances exclusion of exon 18N or enhances inclusion of exon18A during splicing of a SCN8A pre-mRNA.

[0152] The hybridization can be by conventional Watson-Crick base pairing by nucleotide complementarity and/or wobble pairing of U-G nucleic acids to form a stable duplex. Wobble base pairing can also be accomplished with Inosine (I-A, I-U, I-C, I-G), where I is inosine. Hybridization can also occur, for example, in the case of an oligonucleotide which binds to DNA duplexes, through specific interactions in the major groove of the double helix.

[0153] Conjugation of an SMO to anthraquinones, acridines, biotin carbohydrates, chitosans, cholesterol, phospholipids, dendrimers, or other lipid and liposomal moieties, colloidal polymeric particles, coumarins, dyes (such as fluoresceins and rhodamines), folate, peptides, phenanthridine, and phenazines, as well as other means known in the art may be used to deliver the oligonucleotides to a cell. The method of delivery selected will depend at least on the cells to be treated and the location of the cells and will be known to those skilled in the art. Localization can be achieved by liposomes, having specific markers on the surface for directing the liposome, by having injection directly into the tissue containing the target cells, by having depot associated in spatial proximity with the target cells, specific receptor mediated uptake, or the like.

[0154] As described elsewhere herein and in the art, oligonucleotides may be delivered using, e.g., methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-O permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated in its entirety herein by reference). Methods of delivery may also include the following.

[0155] Cationic Lipids: Naked nucleic acids (e.g., DNA/RNA) can be introduced into cells in vivo by complexing the nucleic acid with cationic lipids or encapsulating the nucleic acid in cationic liposomes. Examples of suitable cationic lipid formulations include N-[-1-(2,3-dioleoyloxy)propyl]N,N,N-triethylarnmonium chloride (DOTMA) and a 1:1 molar ratio of 1,2-dimyristyloxy-propyl-3-dimethylhydroxyethylammonium bromide (DMRIE) and dioleoyl phosphatidylethanolamine (DOPE) (see e.g., Logan, J. J. et al. (1995) Gene Therapy 2:38-49; San, H. et al. (1993) Human Gene Therapy 4:781-788).

[0156] Receptor-Mediated DNA Uptake: Naked nucleic acids can also be introduced into cells in vivo by complexing the nucleic acid to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem. 263:14621; Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Pat. No. 5,166,320). Binding of the nucleic acid-ligand complex to the receptor facilitates uptake of the nucleic acid by receptor-mediated endocytosis. A nucleic acid-ligand complex linked to adenovirus capsids which naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci. USA 90:2122-2126). Carrier mediated SMO delivery may also involve the use of lipid-based compounds which are not liposomes. For example, lipofectins and cytofectins are lipid-based positive ions that bind to negatively charged nucleic acids and form a complex that can ferry the nucleic acid across a cell membrane. Another method of carrier mediated transfer involves receptor-based endocytosis. In this method, a ligand (specific to a cell surface receptor) is made to form a complex with a nucleic acid or SMO of interest and then delivered to the bodyTarget cells that have the cell surface receptor will specifically bind the ligand and transport the ligand-DNA complex into the cell.

[0157] Oligonucleotides may be directly introduced into the cell (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the RNA using methods known in the art for introducing nucleic acid (e.g., DNA) into cells in vivo. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the RNA may be introduced.

[0158] The oligonucleotides of the invention can be delivered to a subject by any art-recognized method. For example, peripheral blood injection of the oligonucleotides of the invention can be used to deliver the reagents via diffusive and/or active means. Alternatively, the oligonucleotides of the invention can be modified to promote crossing of the blood-brain-barrier (BBB) to achieve delivery of said reagents to neuronal cells of the central nervous system (CNS). Specific recent advancements in oligonucleotide technology and delivery strategies have broadened the scope of oligonucleotide usage for neuronal disorders (Forte, A., et al. 2005. Curr. Drug Targets 6:21-29; Jaeger, L. B., and W. A. Banks. 2005. Methods Mol. Med. 106:237-251 ; Vinogradov, S. V., et al. 2004. Bioconjug. Chem. 5:50-60; the preceding are incorporated herein in their entirety by reference).

[0159] In certain inventive embodiments, the oligonucleotides of the invention can be delivered by transdermal methods (e.g., via incorporation of the oligonucleotide reagent(s) of the invention into, e.g., emulsions, with such oligonucleotides optionally packaged into liposomes). Such transdermal and emulsion/liposome-mediated methods of delivery are described for delivery of antisense oligonucleotides in the art, e.g., in U.S. Pat. No. 6,965,025, the contents of which are incorporated in their entirety by reference herein.

[0160] The oligonucleotides of the invention may also be delivered via an implantable device (e.g., an infusion pump or other such implantable device). Design of such a device is an art-recognized process.

[0161] In another embodiment the SMO is delivered parenterally, for example by intravenous or subcutaneous injections.

[0162] In one embodiment, an SMO is delivered directly into the cerebral spinal fluid (CSF) of a subject. Delivery of an SMO into the CSF of a subject may be accomplished by any means known in the art, including, but not limited to, epidural injection or intrathecal injection or intrathecal injection using an infusion pump, or direct brain delivery with a pump or other device.

[0163] In one embodiment, SMOs are conjugated to a peptide to facilitate delivery of the SMO across the blood brain barrier (BBB) following parenteral administration to a subject.

[0164] The SMO may be either directly conjugated to the peptide or indirectly conjugated to the peptide via a linker molecule such as a poly amino acid linker, or by electrostatic interaction. Peptides useful in delivering SMOs across the BBB include, but are not limited to, peptides derived from the rabies virus glycoprotein (RVG) that specifically bind to the nicotinic acetylcholine receptor (AchR) present on neurons and the vascular endothelium of the BBB thereby allowing transvascular delivery, probably by receptor-mediated transcytosis (Kumar et al., 2007, Nature 448:39-43, encompassed by reference in its entirety); Kunitz domain-derived peptides called angiopeps (Demeule et al., 2008, J. Neurochem. 106: 1534-1544; Demeule et al., 2008, J. Pharmacol. Exp. Ther. 324: 1064-1072). Recombinant methods known in the art can also be used to achieve oligonucleotide reagent-induced modulation of splicing in a target nucleic acid. For example, vectors containing oligonucleotides can be employed to express, e.g., an antisense oligonucleotide to modulate splicing of an exon of a targeted pre-mRNA.

[0165] For oligonucleotide reagent-mediated modulation of an RNA in a cell line or whole organism, gene expression may be assayed by use of a reporter or drug resistance gene whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Depending on the assay, quantitation of the amount of gene expression allows one to determine a degree of modulation which is greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell not treated according to the present invention. Lower doses of injected material and longer times after administration of oligonucleotides may result in modulation in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells). Quantitation of gene expression in a cell may show similar amounts of modulation at the level of accumulation of target mRNA or translation of target protein. As an example, the efficiency of modulation may be determined by assessing the amount of gene product in the cell; pre-mRNA or mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the oligonucleotide reagent, or translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.

Pharmaceutical Compositions and Therapies

[0166] An SMO of the invention may be administered to a subject in a pharmaceutical composition. As used herein the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions can be prepared as described below. Depending on the particular target SCN8A RNA sequence and the dose of oligonucleotide material delivered, this process may modulate SCN8A splicing and the expression or function of resulting SCN8A protein. In one embodiment of the instant invention, exon 5N-containing SCN8A protein production is enhanced in a treated cell, cell extract, organism or patient, with an enhancement of exon 5N-containing SCN8A protein levels of at least about 1.1-, 1.2-, 1.5-, 2-, 3-, 4-, 5-, 7-, 10-, 20-, 100-fold and higher values being exemplary. In another embodiment of the invention, exon 18N-containing SCN8A protein production is enhanced in a treated cell, cell extract, organism or patient, with an enhancement of exon 18N-containing SCN8A protein levels of at least about 1.1-, 1.2-, 1.5-, 2-, 3-, 4-, 5-, 7-, 10-, 20-, 100-fold and higher values being exemplary. Enhancement of gene expression refers to the presence (or observable increase) in the level of protein and/or mRNA product from a target RNA. Specificity refers to the ability to act on the target RNA without manifest effects on other genes of the cell. The consequences of modulation of the target RNA can be confirmed by examination of the outward properties of the cell or organism (see, e.g., Example 1) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).

[0167] The oligonucleotide, i.e. the SMO, may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of material may yield more effective modulation; lower doses may also be useful for specific applications.

[0168] Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

[0169] Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, parenteral, intranasal, buccal, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.

[0170] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" is discrete amount of the pharmaceutical composition including a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may include between 0.1% and 100% (w/w) active ingredient.

[0171] In addition to the active ingredient, a pharmaceutical composition of the invention may further include one or more additional pharmaceutically active agents.

[0172] Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology. As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, intratumoral, and kidney dialytic infusion techniques. Formulations of a pharmaceutical composition suitable for parenteral administration include the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further include one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

[0173] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may include, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.

[0174] Other parentally-administrable formulations which are useful include those which include the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may include pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

[0175] Formulations suitable for nasal administration may, for example, include from about as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient, and may further include one or more of the additional ingredients described herein. A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance including an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may include a powder or an aerosolized or atomized solution or suspension including the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further include one or more of the additional ingredients described herein. As used herein, "additional ingredients" include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents;

[0176] lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" which may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, Pa.), which is incorporated herein by reference.

[0177] The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions including a splice modifying oligonucleotide of the invention to practice the methods of the invention. The precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration.

[0178] The compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc. The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.

Kits

[0179] Kits for practicing the methods of the invention are further provided. By "kit" is intended any manufacture (e.g., a package or a container) including at least one reagent, e.g., at least one SMO for specifically enhancing inclusion of exon 5N in SCN8A protein (i.e., for enhancing the exclusion of exon 5A), for the treatment of a disease, disorder or condition, e.g., a Dravet Spectrum Epilepsy. In one embodiment of the invention, the kit includes at least one SMO for specifically enhancing the inclusion of exon 18N in SCN8A protein (i.e., for enhancing the exclusion of exon 18A), for the treatment of a disease, disorder or condition, e.g., a Dravet Spectrum Epilepsy. The kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention. Additionally, the kits may contain a package insert describing the kit and including instructional material for its use.

[0180] Positive, negative, and/or comparator controls may be included in the kits to validate the activity and correct usage of reagents employed in accordance with the invention. Controls may include samples, such as tissue sections, cells fixed on glass slides, etc., known to be either positive or negative for the presence of the biomarker of interest. The design and use of controls is standard and well within the routine capabilities of those of ordinary skill in the art.

General Terminology

[0181] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are well known and commonly employed in the art.

[0182] Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art and various general references (e.g., Sambrook and Russell, 2001 , Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, NY, and Ausubel et al., 2002, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

[0183] The nomenclature used herein and the laboratory procedures used in analytical chemistry and organic syntheses described below are well known and commonly employed in the art. Standard techniques or modifications thereof, are used for chemical syntheses and chemical analyses.

[0184] As used herein, each of the following terms has the meaning associated with it in this section.

[0185] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0186] The term "about" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which it is used.

[0187] "Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a change in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

[0188] "Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, SMOs, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds. Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy/steric block based mechanisms, including, without limitation uniform modified oligonucleotides. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.

[0189] "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

[0190] A "disease" is a state of health of subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated then the subject's health continues to deteriorate. In contrast, a "disorder" in an subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject's state of health. In preferred embodiments, the subject is an animal. In more preferred embodiments, the subject is a mammal. In most preferred embodiments, the subject is a human.

[0191] A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, or the frequency with which such a symptom is experienced by a subject, or both, is reduced.

[0192] The terms "effective amount" and "pharmaceutically effective amount" refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

[0193] As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.

[0194] As used herein, the term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system.

[0195] The term "expression" as used herein is defined as the transcription and/or translation of a particular nucleotide sequence. The term "exonic regulatory elements" as used herein refers to sequences present on pre-mRNA that enhance or suppress splicing of an exon. An exonic regulatory element that enhances splicing of an exon is an exonic splicing enhancer (ESE). An exonic regulatory element that suppresses splicing of an exon is an exonic splicing suppressor (ESS). An intronic regulatory element that enhances splicing of an exon is an intronic splicing enhancer (ISE). An intronic regulatory element that suppresses splicing of an exon is called an intronic splicing suppressor (ISS).

[0196] "Instructional material," as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition and/or compound of the invention in a kit. The instructional material of the kit may, for example, be affixed to a container that contains the compound and/or composition of the invention or be shipped together with a container which contains the compound and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively. Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website.

[0197] By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term also includes other modified nucleic acids as described herein. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). The term "nucleic acid" typically refers to large polynucleotides.

[0198] Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.

[0199] The terms "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene, e.g., genomic DNA, and even synthetic DNA sequences. The term also includes sequences that include any of the known base analogs of DNA and RNA.

[0200] "Messenger RNA" or "mRNA" is any RNA that specifies the order of amino acids in a protein. It is produced by transcription of DNA by RNA polymerase. In eukaryotes, the initial RNA product (primary transcript, including introns and exons) undergoes processing to yield a functional mRNA (i.e., a mature mRNA), which is then transported to the cytoplasm for translation. "Precursor mRNA" or "pre-mRNA" includes the primary transcript and RNA processing intermediates; the spliceosome assembles on a pre-mRNA and carries out RNA splicing.

[0201] By "fragment" or "portion" is meant a full length or less than full length of the nucleotide sequence.

[0202] A "variant" of a molecule is a sequence that is substantially similar to the sequence of the native molecule. For nucleotide sequences, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis that encode the native protein, as well as those that encode a polypeptide having amino acid substitutions. The terms splice variant and splice isoform may be used interchangeably to denote different mRNAs which are a product of which may or may not encode the same protein, but are a result of differential splicing from the same initial pre-mRNA sequence. Specifically SCN8A exon 18A inclusion generates the SCN8A 18A mRNA transcript variant, while SCN8A exon 18N inclusion generates the SCN8A 18N mRNA transcript variant. Similarly, SCN8A exon 5A inclusion generates the SCN8A 5A mRNA transcript variant, while SCN8A exon 5N inclusion generates the SCN8A 5N mRNA transcript variant. Generally, nucleotide sequence variants of the invention will have in at least one embodiment 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the native (endogenous) nucleotide sequence.

[0203] The terms "isolated and/or purified" refer to in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural cellular environment, and from association with other components of the cell or test solution (e.g. RNA pool), such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed. Thus, the RNA or DNA is "isolated" in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and is preferably substantially free of any other mammalian RNA or DNA. The phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a vector or plasmid.

[0204] Nucleic acid molecules having base substitutions (i.e., variants) are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of the nucleic acid molecule.

[0205] "As used herein, the term "derived" or "directed to" with respect to a nucleotide molecule means that the molecule has complementary sequence identity to a particular molecule of interest.

[0206] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction.

[0207] The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."

[0208] The terms "protein," "peptide" and "polypeptide" are used interchangeably herein.

[0209] By "variant" polypeptide is intended a polypeptide derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Such variants may results form, for example, genetic polymorphism or from human manipulation. Methods for such manipulations are generally known in the art.

[0210] "Polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term "protein" typically refers to large polypeptides.

[0211] The term "peptide" typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus. A "polynucleotide" means a single strand or parallel and anti-parallel strands of a nucleic acid.

[0212] Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid. In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0213] The term "oligonucleotide" typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T." The term "recombinant DNA" as used herein is defined as DNA produced by joining pieces of DNA from different sources.

[0214] The term "recombinant polypeptide" as used herein is defined as a polypeptide produced by using recombinant DNA methods.

[0215] By the term "specifically binds," as used herein, is meant a molecule, such as an SMO, which recognizes and binds to another molecule or feature (i.e., the target pre-mRNA), but does not substantially recognize or bind other molecules or features in a sample (i.e.., other non-target pre-mRNAs). Two nucleic acids substantially recognize or bind to each other when at least about 50%, preferably at least about 60% and more preferably at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T, A:U and G:C nucleotide pairs). Most preferably, two nucleic acids substantially recognize or bind to each other when at least about 90%-100% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T, A:U and G:C nucleotide pairs). In another embodiment, the molecule may be an antibody. Chemical modification of the nucleic acid in part determines hybridization energy and thus how many base pairs are required for specific binding of the SMO nucleic acid sequence and a target nucleic acid sequences. Such calculations are well within the ability ofthose skilled in the art.

[0216] By the term "splice defect of a protein", as used herein, is meant a defective protein resulting from a defect in the splicing of an RNA encoding a protein.

[0217] The term "treatment," as used herein, refers to reversing, alleviating, delaying the onset of, inhibiting the progress of and/or preventing a disease or disorder, or one or more symptoms thereof, to which the term is applied in a subject. In some embodiments, treatment may be applied after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered prior to symptoms (e.g., in light of a history of symptoms and/or one or more

[0218] Other susceptibility factors), or after symptoms have resolved, for example to prevent or delay their reoccurrence.

[0219] Throughout this disclosure, various aspects of this invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual and partial numbers within that range, for example, 1, 2, 3, 4, 5, 5.5 and 6. This applies regardless of the breadth of the range.

[0220] The invention will now be illustrated by the following non-limiting Example(s).

EXAMPLE 1

[0221] As described herein, novel SMOs were designed to specifically and potently skip selected alternatively spliced exons in SCN8A and the efficacy of these SMOs was subsequently validated in mouse models of epilepsy.

[0222] Previously, novel SMOs were developed to modulate alternative splicing of the flip/flop cassette exons of AMPA receptor (AMPA-R) subunits GluA1 and GluA3 as drug candidates for treating intractable epilepsies and amyotrophic lateral sclerosis (ALS). AMPA-Rs are the major excitatory neurotransmitter receptors in the CNS. The well-validated mechanism for reducing network hyperexcitability and excitotoxicity is that reducing GluA-flip exon expression produce AMPA-Rs with much lower sensitivity to glutamate, greatly increased desensitization, and reduced Ca.sup.2+ permeability. Using the SMO design strategy outlined below, two novel phosphorothioate 2'-O-methyl SMOs, LSP-GR1 and LSP-GR3 (GR1 and GR3) were developed, which potently and very specifically reduced expression of GluA1-flip and GluA3-flip, respectively. The efficacy and specificity of these SMOs was determined by real-time PCR (QPCR) after ICV bolus delivery in neonatal mice. Both GR1 and GR3 showed extraordinary specificity and potency in reducing the expression of their targeted GluA-flip isoforms, without significantly altering other closely related GluA-flip or GluA-flop isoforms (FIG. 1A).

[0223] Extraordinary longevity of SMO activity was shown after one bilateral ICV bolus injection of the GR1 at P10 (FIG. 1B). Potent reduction of G1uA1-flip expression was observed in the brains of mice 60 d after a single ICV injection. Importantly, mice tested 20 days after P10 injection (at P30), showed no motor deficits or impairment in the Y-maze, a GluA1-dependent working memory task (Sanderson et. al., 2008)(not shown). Remarkably, GR1 activity was demonstrated out to 24 weeks after a single 50 .mu.g spinal intrathecal injection (not shown). Thus drug dosing in humans should be much less frequent than for short-lived small molecules. LSP-GR1 effects on seizure thresholds were examined and it was found that GR1-treated neonatal mice exhibited significantly less severe seizures in response to the convulsant kainate (KA), and none of the GR1-treated mice progressed to status epilepticus (SE) (FIG. 1D). Mice treated with GR1 required 77% more KA to reach SE at P10 (not shown). Injection of GR1 90 min post-seizure at P10 prevented the SE-induced reduction in seizure thresholds at P12 whereas naive and GR1-treated mice required significantly more KA respectively to reach SE than saline control SE-experienced mice (FIG. 1E). Whole-cell patch-clamp studies confirmed that GR1 greatly reduced AMPA excitatory post-synaptic currents (aEPSCs) (FIG. 1F). Thus GR1 is a highly potent, specific, and long lasting modulator of GluA1 alternative splicing that provides robust neonatal anti-seizure activity.

SMOs for Targeting SCN8A

[0224] Preliminary in vivo analysis of two candidate SMOs for targeting SCN8A exon 18A, showed that ICV injection of the 18A-2 SMO achieved .about.55% exon 18A skipping which is already greater than the 50% reduction expected to be therapeutic (FIG. 1C). SMOs have a significant therapeutic advantage over traditional small molecule inhibitors in that they can precisely target SCN8A splicing, allowing for a highly specific mechanism of action. The strategy of specifically reducing only the Na+ channel that counterbalances SCN1A input (SCN8A) should be a far more effective strategy and cause fewer adverse effects than using sodium channel blockers which antagonize multiple VGS channels. Further, by regulating alternative splicing, an SMO directed against exon 5A specifically reduces excitatory channel properties, rather than simply downregulating overall expression. Additionally, splice regulation of 18A is known to be differentially controlled in non-neuronal cells, thus SMO that escapes from the CNS in active form during normal metabolism is unlikely to affect splicing, or have on-target effects outside of the CNS (Zubovic et. al., 2012). In contrast to classic antisense compounds and siRNAs, SMOs do not recruit degradation enzymes (RNAseH, dicer) and therefore do not cause off-target degradation of transcripts. SMOs bind to their targets with exceptional potency, specificity, and negligible off-target effects (Eckstein 2007). Two SMOs are showing great promise in clinical trials for treating Duchene muscular dystrophy and Spinal muscular atrophy (Disterer et. al., 2014; Porensky and Burghes 2013).

[0225] Currently, there are no drugs in clinical use that specifically modulate SCN8 channel/SCN8A subunit properties or expression. The SMOs described herein can be used to treat, e.g., Dravet spectrum epilepsies refractory to current therapies. SMOs are designed for complete selectivity in targeting SCN8A isoform expression without affecting any other highly related VGS channel subunits. Moreover, the SCN8A gene is nearly 100% conserved between mouse and human surrounding the SMO target sites, such that SMOs validated in the mouse model is directly applicable to humans. It has been clearly documented that SMOs are widely distributed and biologically active throughout the CNS after direct delivery to CSF without the necessity of a carrier (Smith et. al., 2006; Williams et. al., 2009) (also see FIG. 1B). However, SMOs alone do not cross the blood-brain barrier when taken orally or parenterally. Clinically, SMOs are administered intrathecally, intracerebroventricularly (ICV), or potentially intranasally (via aerosolized nose spray). Intrathecal osmotic pumps are currently used in over 500,000 patients to treat chronic pain and spasticity, and are well-tolerated. SMOs delivered via spinal intrathecal injections have been shown to reach the brain in rodents and non-human primates (Hua et. al., 2010; Kordasiewicz et. al., 2012; Smith et. al., 2006; Williams et. al., 2009) and have been shown to be well-tolerated in clinical trials in infants and children with SMA. Additionally, implantation of the Omaya reservoir for direct brain/CNS delivery has been used in children as young as 9 months of age (Stephan et. al., 1992). Thus, no further formulation of SMOs is necessary to enable their clinical usage. The highly negative prognosis of uncontrolled seizures in SMEI patients warrants the more invasive delivery system currently necessary for SMO therapy. However, brain delivery of SMOs and other antisense technologies via non-invasive intranasal administration is preferential (Hashizume et. al., 2008; Lee et. al., 2012).

[0226] The studies described herein provide the first evidence that SMO-mediated direction of alternative splicing of SCN8A is therapeutic for pediatric seizure disorders, specifically Dravet and related syndromes, in addition to other forms of epilepsy.

[0227] Novel drug candidates called Splice Modulating Oligonucleotides (SMOs) will specifically and potently decrease splicing of 1) the SCN8A 18A isoform, resulting in less fully-functional SCN8A and 2) the 5A isoform, modulating channel kinetics to reduce sodium currents. SMOs are developed that decrease expression of SCN8A 5A and 18A isoforms. Also, the dose-response profiles of the top 5A and 18AN SMOs will be determined for increasing seizure threshold to flurothyl in 5-6 week old wild type mice. Further, the efficacy of the top 5A and 18AN SMOs will be evaluated in decreasing susceptibility to febrile seizures and increasing survival in a mutant SCN1A mouse model. Together, these experiments are expected to establish 5A and/or an 18AN SMO as potential drugs for the treatment of children with Dravet Spectrum epilepsies for which there is a significant unmet need. An SMO is currently in clinical trials to treat spinal muscular atrophy (SMA), a devastating neurological disorder of infancy, and thus far, is showing efficacy, safety, and tolerability when delivered by intrathecal injection directly into the CNS (Disterer et. al., 2014).

[0228] Design of Splice Modulating Oligonucleotides (SMOs) [Splice modulating oligonucleotides (SMOs) are designed and validated that specifically and potently modulate SCN8A pre-mRNA splicing to decrease expression of the 18A and 5A isoforms and determine the dose-response profile of the top 2 SMOs (one each for 18A and 5A skipping) in normal mice. Candidate SMOs are developed that target splicing of both human and mouse SCN8A pre-mRNA to reduce expression of the 18A and 5A isoforms. A proven set of molecular engineering tools are used to identify ranked panels of SMOs that decrease the expression of the SCN8 exon 18A and 5A isoforms. The process is refined iteratively to select the most potent SMO candidates for further testing.

[0229] SMOs are developed to facilitate specific skipping of exons 5A and 18A, resulting in significantly reduced excitatory function of SCN8 channels. 2'OMe steric block oligomers modulate pre-mRNA splicing through high affinity binding to complementary sequences containing specific splicing elements, resulting in potent and efficient skipping of the targeted exon (Aartsma-Rus et. al., 2005; Aartsma-Rus et. al., 2006; Buvoli et. al., 2007; Wheeler et. al., 2007) (see, FIG. 1C). Pre-mRNA splicing is controlled by the spliceosome, a large ribonucleoprotein (RNP) complex with many auxiliary proteins and small non-coding RNAs. These factors bind to specific splice enhancer and suppressor sequences (motifs) on pre-mRNAs near intron-exon boundaries and coordinate the splicing of pre-mRNA to mRNA. Exons 18A/18N and exons 5A/5N are mutually exclusive cassette exons. Steric blocking of intronic/exonic splice enhancers (ISE/ESEs) and/or 3' and 5' splice sites, while avoiding intronic/exonic splice silencer (ISS/ESS) motifs, prevents spliceosomal recognition of the exon. Thus, when critical splice recognition sequences of an exon are masked by an SMO, the entire intron-exon-intron sequence is treated as a single intron, and the targeted exon is excluded from the resultant mRNA.

[0230] To minimize the number of SCN1A knock-in mice needed, the dosing strategy is optimized in normal mice. C57/BL6 mice are used as they are the background strain of the SCN1A mutant GEFS+ mice to be tested below. While complete SCN8A KO causes a severe phenotype in mice including motor system degeneration and early lethality (Martin et. al., 2007; Meisler et. al., 2004) and haplosinsufficient SCN8A mice exhibit spike wave discharges characteristic of absence seizures (Papale et. al., 2009), similar mutations have been found in humans with only mild impact on cognition (Trudeau et. al., 2006). SCN8A haploinsufficiency is adequate to modify the Dravet's phenotype of SCN1A mutant mice, without causing an adverse phenotype (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010), however adverse effects may limit SMO dosing in WT mice. All mice are monitored daily for gross signs of toxicity including weight loss, paralysis, and tremor. For all studies described herein, groups are weight, sex, and litter-matched to reduce phenotypic variability.

[0231] Design of phosphorothioate 2'-O-methyl modified SMOs which targets splicing of both human and mouse SCN8A pre-mRNA to reduce expression of the 18A and 5A isoforms. This process first requires in silico prediction of critical splicing motifs, which encompasses the use of the most advanced RNA and oligo analysis tools. SMOs targeting SCN8A alternative splicing is designed to target either the 3' or 5' splice sites and/or sequences corresponding to predicted ESE/ISE clusters near the splice junctions of exons 5A and 18A. The following summarizes the SMO design process:

[0232] Step 1. Identification of conservation between human and mouse SCN8A sequences. Alignments of the highly conserved SCN1-11A gene sequences have been performed to ensure specificity of SMO sites targeting SCN8A splicing, and complete conservation between mouse and human. Thus, SMOs developed and tested in mice can be translated directly to human use.

[0233] Sten 2. Identification of ESE/ESS/ISE motifs surrounding the 3' and 5' splice sites of alternatively spliced exons in SCN8A pre-mRNA. Splice modulation sites for SCN8A exons 5A and 18A have completely conserved regulatory motifs between mouse and human. ESE motifs were defined using ESE Finder (Cartegni et. al., 2003) RESCUE-ESE (Dravet et. al., 2011; Fairbrother et. al., 2002) and PESX (Zhang and Chasin 2004). ESS elements were predicted by PESX, and the two hexamer data set analysis by FAS-ESS (Wang et. al., 2004) tool. Finally, ISE motifs are predicted using the ACESCAN2 application (Yeo et. al., 2005; Yeo et. al., 2007).

[0234] Step 3. RNA Structure and Thermodynamics of SCN8A target sequences. The RNA Structure program (Mathews et. al., 2004) predicts secondary structure of target sequences and thermodynamic properties of all potential SMOs targeting SCN8A. Additionally, sequence motifs and structures known or predicted to cause immune stimulation or other toxicities, are screened for, and avoided.

[0235] Step 4. BLAST analysis of potential off-target hybridization. All candidate SMOs are screened using BLASTN analysis for potential hybridization to off-target sites in the human/mouse genomes. SMOs with greater than 85% off-target hybridization to any other known gene product are not considered.

[0236] Step 5. Prioritization of SMOs based on combined properties. Thermodynamic properties between SMOs and their target, and self-self binding energies of SMOs, splice site strength, and splicing motifs are combined to establish top candidate SMOs for empirical evaluation of splicing specificity and efficiency. These parameters used to predict top candidate SMOs are all contained in the above referenced oligonucleotide and RNA structure predictive software.

In vivo Splicing Efficacy

[0237] In vivo splicing efficacy of top candidate SMOs are tested in neonatal pups. Splicing efficacy of the top ranked SMOs determined above are validated using well-established in vivo screening protocol in neonatal mice by ICV delivery, and measuring transcript levels with real-time PCR. This testing determines the most effective SMOs (one each targeting SCN8A 5A and 18A exons). Dose-response and dose-timing profile of lead SMOs in reducing SCN8A 5A and 18A expression, respectively, are performed in normal mice and examined at P15, and P42 (6 weeks of age). Dose-response measures both mRNA expression by QPCR and protein expression by Western blot.

[0238] Test of in vivo splicing efficacy of top candidate SMOs in neonatal pups. The in silico splice prediction technology allows bypassing costly and time consuming high through-put oligonucleotide screening. SMO development requires an iterative process of SMO evaluation and optimization, where splicing efficacy of the top 2 ranked SMOs is evaluated, and the results used to strategically select the next top candidate SMOs. For example, 10 SMOs may be used to fully optimize splicing efficiency (see, e.g., Table 1).

TABLE-US-00002 TABLE 1 Testing candidate SMOs Groups Treatment Dose (pg) 1-10 18A SMOs #1-10 4 .mu.g bilateral 11 Saline N/A 2-21 5A SMOs #1-10 4 .mu.g bilateral 22 Saline N/A

[0239] Although complete reduction of 18A expression is not desirable, increased SMO potency increases the therapeutic index. Specificity of SMOs that pass the initial screen for potency are confirmed against other highly conserved SCN subunits using QPCR (as done for GR1; FIG. 1A). For all in vivo studies, treated and control animals are litter-matched to reduce variability. FVBs are the preferred strain for SMO screening because of their large litter size, and good maternal care. FVB neonatal mice are given free-hand bilateral injections of SMO on post-natal (P)1, P3, and P5 into the lateral ventricles and brain tissues are harvested at P10 as previously described (Williams et. al., 2009). Cortex and hippocampus are rapidly dissected; RNA isolated, converted cDNA using Multiscribe with random hexamer primers. Custom TaqMan QPCR assays have been designed to specifically detect 5A and 18A isoforms and validated for efficiency over 5 logs of cDNA concentration (not shown). Expression of 5A and 18A transcripts are evaluated by the .DELTA..DELTA.CT method (Livak and Schmittgen 2001) relative to endogenous control (.beta.-Actin). Saline mice are used as controls for multiple SMOs within litter (n=3 mice per SMO; up to 30 SMO-treated or saline mice for 18A and 5A).

[0240] We designed and validated splice modulating oligonucleotides (SMOs) that specifically and potently modulate SCN8A pre-mRNA splicing to decrease expression of either the 18A and 5A isoforms. Ten candidate SMO sequences selected by iterative in silico analysis were tested in vivo with bilateral ICV injection in neonatal mouse pups for the ability to direct skipping of SCN8A exon 18A at various doses and dose frequencies. Based on this initial screening, change in splicing for the highest dose tested for each candidate SMO are shown (FIG. 2A) The most potent candidate SMOs after a single 4.mu.g/bilateral ICV dose were compared to LSP-GR1 for relative efficacy at directing targeted exon skipping (FIG. 2B). Preliminary CNS distribution and assessment of the adverse effects profile of the top 4

[0241] SMOs (SCN8A-18A-5-SEQ ID: 1306, 18A-8-SEQ ID: 1307, 18A-9- SEQ ID: 1422, and 18A-10-SEQ ID: 1541) at a maximal intrathecal (IT) dose of 50 .mu.g/5 .mu.L/3 min in adult mice was used to further screen the candidate SMOs the top candidate SMOs (FIG. 2C). SCN8A-18A-9 (18A-9-SEQ ID: 1422) was initially selected for additional testing.

[0242] Seven candidate SMO sequences selected by iterative in silico analysis were tested in vivo with bilateral ICV injection in neonatal mouse pups for the ability to direct skipping of SCN8A exon 5A at various doses and dose frequencies. Based on this initial screening, change in splicing for the highest dose tested for each candidate SMO are shown (FIG. 2E). However, SCN8A-5A-2 (5A-2-SEQ ID: 33) produced the most potent splicing response thus far, an effect which is statistically significant at all measures and dose-responsive, such that exon 5A skipping continues to increase with increasing total SMO dose from 4-24 .mu.g (FIG. 2F).

Dose-response and Timing Profile

[0243] Dose-response and timing profile of two lead SMOs in reducing SCN8A 5A and 18A expression. A similar injection regimen and QPCR analysis protocol as described above are used, with harvest at two time points, P15 and P42 (6 weeks), to find dosing paradigms that give 25, 50, and 75% knockdown at P15 and last out to 6 weeks. These paradigms are used test lead 5A and 18A SMOs in normal and SCN1A.sup.RH/RH mice seizure and longevity studies. Based on the real-time PCR results SMO-mediated reduction of the 18A and 5A isoforms as our index of splicing efficacy is calculated at the various doses. Additionally for 18A SMO treatment, western blot is used to determine correlation between mRNA production and protein expression, as described previously (Martin et. al., 2010). Antibodies are not available to distinguish between SCN8A 5A and 5N isoforms. The experimental groups are defined in Table 2.

TABLE-US-00003 TABLE 2 Dose-response profile of lead SMOs Groups Treatment Dose (.mu.g) Total mice 1 18A SMO 6, 4, 2 60 2 5A SMO 6, 4, 2 60 3 saline N/A Up to 60

[0244] Freehand ICV injections may be performed as frequently as every other day from P1-P12, however based on previous experiments, only 1-2 doses are likely necessary to achieve optimal splicing efficacy (see, FIG. 1B). As expected, a single 4.mu.g 18A-9 (SEQ ID: 1422) SMO dose in neonatal (P3-5) C57BL/6 mice produced lasting exon 18A skipping out to P28 without any decrement in splicing activity (FIG. 2A). Although significant SCN8A exon 18A splicing remains at P42, the effect is not as robust as seen at earlier time points, suggesting multiple doses or a different dosing timing may be necessary to maintain effect out to 6 weeks (see, FIG. 2D).

Determination of Efficacy of SMOs

[0245] The threshold to flurothyl-induced seizures in normal mice after optimized dosing of the SMOs is determined, as SCN8A loss-of-function mutations increase seizure thresholds to flurothyl (Martin et. al., 2007). Also, the efficacy of SMOs is determined (skipping SCN8A 5A and 18A exons) at extending lifespan and reducing spontaneous seizures in a mouse model of GEFS+ (SCN1A R1648H).

[0246] The effect of SMO treatment on seizure threshold in normal mice is determined. Based on the dose-response data determined above, three SMO doses (25, 50, 75% splicing) are selected for testing in P15 and 5-6 week old mice to examine seizure threshold responses to flurothyl induced seizures. SMO potency and efficacy determines dosing for further experimentation.

[0247] The two top SMOs (18A and 5A) are assessed for efficacy in reducing the number of spontaneous seizures in SCN1A.sup.RH/RH mice (Martin et. al., 2010), as a correlative measure to survival.

[0248] The efficacy of the two top SMOs (18A and 5A) are evaluated for ability to extend lifespan in SCN1A.sup.RH/RH mice, which die by P16-26 without treatment (Martin et. al., 2010).

[0249] Directing splicing of SCN8A to skip the 18A or 5A exon (favoring production of the 18N or 5N containing isoforms) diminishes SCN8A-mediated excitation and ameliorates the effects of SCN1A mutations, as when SCN1A and SCN8A loss-of-function mutations occur together (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010).

[0250] To accomplish this novel targeting strategy, alternative splicing of the SCN8A channel is directed in order to control channel properties by developing compounds called splice modulating oligonucleotides (SMOs). SMOs are a class of synthetic RNA based compounds that bind directly to a complementary sequence on pre-mRNA and function by sterically blocking or weakening interactions between elements of the splice machinery and the pre-mRNA. The 18A and 18N exons are mutually exclusive cassette exons such that when one exon is excluded the other exon is included. Thus, directing splicing to exclude (skip) the SCN8A exon 18A results in inclusion of exon 18N (truncated isoform) and thereby effectively reduces expression of the full length functional 18A isoform. Similarly, the 5A/5N exons are also mutually exclusive cassette exons, and directing splicing to skip SCN8A exon 5A result in inclusion of exon 5N (decreased gain isoform) and to reduce expression of the undesirable increased gain 5A isoform.

[0251] Mice with the SCN8A.sup.med/+ mutation (resulting in partial SCN8A loss of function) exhibit resistance to flurothyl induced seizure by 5-6 weeks of age (Martin et. al., 2007). The SMO-mediated reduction of SCN8A 18A or 5A isoform expression modulates SCN8A-mediated sodium current in a similar manner to the SCN8A "med" mutation. Thus, the optimal injection frequency as determined above to maintain effect from P15 to 6 weeks in WT mice is used for testing a range of SMO doses in increasing flurothyl seizure threshold in P15 and 5-6 week old WT mice, as physiological validation of our SMO strategy. The most effective dose and injection paradigm that causes seizure resistance in normal mice is used to determine if reducing SCN8A 18A or 5A isoforms can increase lifespan and ameliorate seizure susceptibility in SCN1A R1648H knock-in mice. Similar to SCN1A KO mice, homozygous R1648H (SCN1A.sup.RH/RH) mice exhibit weight loss, spontaneous seizures, and susceptibility to febrile seizures starting at P14-16 and lethality by P16-26 (Martin et. al., 2010). However, heterozygous SCN1A.sup.RH/+ mutant mice show a less severe phenotype than SCN1A.sup.+/- knockout mice with only .about.15% exhibiting spontaneous seizures in adulthood, but do have increased susceptibility to flurothyl and hyperthermia induced seizures by 5-6 weeks of age (Martin et. al., 2010). SCN1A R1648H mutant mice are raised in-house on a C57BL/6 background with care, husbandry, and genotyping performed as described previously (Martin et. al., 2010).

[0252] Effect of SMO treatment on seizure threshold in normal mice. The effect of optimized SMO treatment on flurothyl-induced seizure threshold is determined first in P15 and then in 5-6 week old WT mice. The dose-response data (Table 2) is used to select 3 doses with .about.25, 50, and 75% efficacy at reducing 18A and 5A expression for functional studies at each time point. C57/BL6 mice are given ICV injection with SMO or saline (Table 3, 18A SMO or 5A SMO for both the P15 and 5-6 week time points).

TABLE-US-00004 TABLE 3 Pre-seizure treatment with two lead SMOs Group Treatment SMO Doses (.mu.g) Total Mice 1 18A SMO TBD* 25, 50, 75% 24 2 5A SMO TBD* 25, 50, 75% 24 3 Saline N/A 48 Injection schedule is modified to achieve the indicated level of splicing. 8 mice/group.

[0253] Flurothyl seizures are performed as previously described, and outcome measures include latency to initial myoclonic jerk (MJ) and generalized tonic-clonic seizure (GTCS) (Martin et. al., 2007).

[0254] SMO efficacy in reducing in spontaneous seizures in SCN1A.sup.RH/RH mice. Starting at P15, SCN1A.sup.RH/RH mice are evaluated for 4hrs daily on 3 consecutive days with number of observed behavioral seizures recorded. Efficacy of the two top SMOs (18A and 5A SMOs) are determined by reduction in number of spontaneous seizures in the SCN1A.sup.RH/RH mice (Martin et. al., 2010) as compared to saline littermate controls (Table 4).

TABLE-US-00005 TABLE 4 SCN1A mutant mouse seizure studies Group Treatment SMO Dose (.mu.g) Total Mice 1 18A SMO TBD* 12 2 5A SMO TBD* 12 3 Saline Control N/A 12 *TBD: dose which showed maximal efficacy and overt tolerability in normal mice in Aim 1 Experiment 3. 12 mice/dose/group, each for Aim 2 Experiments 2 and 3.

[0255] This assesses whether any increased in survival seen with SMO treatment is mediated by decreasing seizure activity.

[0256] Efficacy of treatment with the two top SMOs (18A and 5A) is evaluated by survival in SCN1A.sup.RH/RH mice. SCN1A.sup.RH/RH mice exhibit weight-loss starting at .about.P15 corresponding to the onset of spontaneous seizures, and die at .about.P18.5 without treatment (Martin et. al., 2010). The SCN1A.sup.RH/RH mice treated with 18A or 5A SMO are also assessed daily for righting reflex, body weight, and survival compared to litter matched saline controls (Table 4).

[0257] Reduction of full length functional SCN8A (18A SMO) or reduction of "high gain" SCN8A (5A SMO) produces increased resistance to fluorothyl-induced seizures in P15 and 5-6 week old normal mice.

[0258] Reduction of sodium current through SCN8 channels, either by reducing full length functional channels (18A SMO) or by altering channel kinetics to a lower gain (5A SMO), reduces seizure frequency and increases survival in mutant SCN1A.sup.RH/RH mice. The SCN1A.sup.RH/RH mouse model was chosen in this application, rather than SCN1A mouse model, due to lack of success in transferring the highly fragile SCN1A knockout breeders from their home colony. Although SCN1A.sup.RH/+ mice are a model of GEFS+, a less severe Dravet spectrum epilepsy, homozygous SCN1A.sup.RH/RH mice present a severe, Dravet-like phenotype.

[0259] Statistical Analysis: General statistical measures are performed using GraphPad or StatistiXL. Overall seizure scoring and real-time PCR results are evaluated by student's t-test with Bonferoni correction for multiple comparisons when appropriate. Longevity is analyzed using the Kaplan-Meier survival test. For all data analysis, statistical significance isset at (p<0.05).

Reference List

[0260] Aartsma-Rus, A. et.al., "Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites", Oligonucleotides., 15 (4), 284-297 (2005).

[0261] Aartsma-Rus, A. et.al., "Therapeutic modulation of DMD splicing by blocking exonic splicing enhancer sites with antisense oligonucleotides", Ann.N.Y.Acad.Sci., 1082 74-76 (2006).

[0262] Antzelevitch, C. et.al., "Electrophysiologic basis for the antiarrhythmic actions of ranolazine", Heart Rhythm., 8 (8), 1281-1290 (2011).

[0263] Bender, A. C. et.al., "SCN1A mutations in Dravet syndrome: Impact of interneuron dysfunction on neural networks and cognitive outcome", Epilepsy Behay., (2012).

[0264] Black, J. A. and Waxman, S. G. "Sodium channels and microglial function", Exp.Neurol., 234 (2), 302-315 (2012).

[0265] Buvoli, M. et.al., "Interplay between exonic splicing enhancers, mRNA processing, and mRNA surveillance in the dystrophic Mdx mouse", PLoS.ONE., 2 (5), e427-(2007).

[0266] Carrithers, M. D. et.al., "Regulation of podosome formation in macrophages by a splice variant of the sodium channel SCN8A", J.Biol.Chem., 284 (12), 8114-8126 (2009).

[0267] Cartegni, L. et.al., "ESEfinder: A web resource to identify exonic splicing enhancers", Nucleic Acids Res., 31 (13), 3568-3571 (2003).

[0268] Catterall, W. A. et.al., "NaV1.1 channels and epilepsy", J.Physiol, 588 (Pt 11), 1849-1859 (2010).

[0269] Chen, Y. et.al., "Functional properties and differential neuromodulation of Na(v)1.6 channels", Mol.Cell Neurosci., 38 (4), 607-615 (2008).

[0270] Claes, L. et.al., "De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy", Am.J.Hum.Genet., 68 (6), 1327-1332 (2001).

[0271] De, Jonghe P. "Molecular genetics of Dravet syndrome", Dev.Med.Child Neurol., 53 Suppl 2 7-10 (2011).

[0272] Disterer, P. et.al., "Development of therapeutic splice-switching oligonucleotides", Hum.Gene Ther., 25 (7), 587-598 (2014).

[0273] Dravet, C. et.al., "Severe myoclonic epilepsy in infancy (Dravet syndrome) 30 years later", Epilepsia, 52 Suppl 2 1-2 (2011).

[0274] Dravet, C. et.al., "Severe myoclonic epilepsy in infancy Dravet syndrome", Adv.Neurol., 95 71-102 (2005).

[0275] Eckstein, F. "The versatility of oligonucleotides as potential therapeutics", Expert.Opin.Biol.Ther., 7 (7), 1021-1034 (2007).

[0276] Estacion, M. et.al., "A novel de novo mutation of SCN8A (Nav1.6) with enhanced channel activation in a child with epileptic encephalopathy", Neurobiol.Dis., 69 117-123 (2014).

[0277] Fairbrother, W. G. et.al., "Predictive identification of exonic splicing enhancers in human genes", Science, 297 (5583), 1007-1013 (2002).

[0278] Fernandes, A. et.al., "Microglia and inflammation: conspiracy, controversy or control?", Cell Mol.Life Sci., (2014).

[0279] Fletcher, E. V. et.al., "Alternative splicing modulates inactivation of type 1 voltage-gated sodium channels by toggling an amino acid in the first S3-S4 linker", J.Biol.Chem., 286 (42), 36700-36708 (2011).

[0280] Gargus, J. J. and Tournay, A. "Novel mutation confirms seizure locus SCN1A is also familial hemiplegic migraine locus FHA/13", Pediatr.Neurol., 37 (6), 407-410 (2007).

[0281] Garry, E. M. et.al., "Varicella zoster virus induces neuropathic changes in rat dorsal root ganglia and behavioral reflex sensitisation that is attenuated by gabapentin or sodium channel blocking drugs", Pain, 118 (1-2), 97-111 (2005).

[0282] Gazina, E. V. et.al., "Differential expression of exon 5 splice variants of sodium channel alpha subunit mRNAs in the developing mouse brain", Neuroscience, 166 (1), 195-200 (2010).

[0283] Han, S. et.al., "Autistic-like behaviour in Scn1a+/- mice and rescue by enhanced GABA-mediated neurotransmission", Nature, 489 (7416), 385-390 (2012).

[0284] Hashizume, R. et.al., "New therapeutic approach for brain tumors: Intranasal delivery of telomerase inhibitor GRN163", Neuro.Oncol., 10 (2), 112-120 (2008).

[0285] Hawkins, N. A. et.al., "Neuronal voltage-gated ion channels are genetic modifiers of generalized epilepsy with febrile seizures plus", Neurobiol.Dis., 41 (3), 655-660 (2011).

[0286] Heinzen, E. L. et.al., "Nova2 interacts with a cis-acting polymorphism to influence the proportions of drug-responsive splice variants of SCN1A", Am.J.Hum.Genet., 80 (5), 876-883 (2007).

[0287] Hua, Y. et.al., "Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model", Genes Dev., 24 (15), 1634-1644 (2010).

[0288] Kennedy, P. G. et.al., "Varicella-zoster viruses associated with post-herpetic neuralgia induce sodium current density increases in the ND7-23 Nav-1.8 neuroblastoma cell line", PLoS.ONE., 8 (1), e51570-(2013).

[0289] Kordasiewicz, H. B. et.al., "Sustained therapeutic reversal of Huntington's disease by transient repression of huntingtin synthesis", Neuron, 74 (6), 1031-1044 (2012).

[0290] Kuwabara, S. et.al., "Latent addition in human motor and sensory axons: different site-dependent changes across the carpal tunnel related to persistent Na+ currents", Clin.Neurophysiol., 117 (4), 810-814 (2006).

[0291] Lee, S. T. et.al., "miR-206 regulates brain-derived neurotrophic factor in Alzheimer disease model", Ann.Neurol., 72 (2), 269-277 (2012).

[0292] Licatalosi, D. D. et.al., "HITS-CLIP yields genome-wide insights into brain alternative RNA processing", Nature, 456 (7221), 464-469 (2008).

[0293] Livak, K. J. and Schmittgen, T. D. "Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method", Methods, 25 402-408 (2001).

[0294] Makinson, C. D. et.al., "Role of the hippocampus in Nav1.6 (Scn8a) mediated seizure resistance", Neurobiol.Dis., 68 16-25 (2014).

[0295] Mao, Q. et.al., "The up-regulation of voltage-gated sodium channel Nav1.6 expression following fluid percussion traumatic brain injury in rats", Neurosurgery, 66 (6), 1134-1139 (2010).

[0296] Martin, M. S. et.al., "Altered function of the SCN1A voltage-gated sodium channel leads to gamma-aminobutyric acid-ergic (GABAergic) interneuron abnormalities", J.Biol.Chem., 285 (13), 9823-9834 (2010).

[0297] Martin, M. S. et.al., "The voltage-gated sodium channel Scn8a is a genetic modifier of severe myoclonic epilepsy of infancy", Hum.Mol.Genet., 16 (23), 2892-2899 (2007).

[0298] Mathews, D. H. et.al., "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc.Natl.Acad.Sci.U.S.A, 101 (19), 7287-7292 (2004).

[0299] Meister, M. H. and Kearney, J. A. "Sodium channel mutations in epilepsy and other neurological disorders", J.Clin.Invest, 115 (8), 2010-2017 (2005).

[0300] Meister, M. H. et.al., "Sodium channel gene family: epilepsy mutations, gene interactions and modifier effects", J.Physiol, 588 (Pt 11), 1841-1848 (2010)

[0301] Meisler, M. H. et.al., "Allelic mutations of the sodium channel SCN8A reveal multiple cellular and physiological functions", Genetica, 122 (1), 37-45 (2004).

[0302] Norden, D. M. and Godbout, J. P. "Review: microglia of the aged brain: primed to be activated and resistant to regulation", Neuropathol.Appl.Neurobiol., 39 (1), 19-34 (2013).

[0303] Nutini, M. et.al., "Increased expression of the beta3 subunit of voltage-gated Na+ channels in the spinal cord of the SOD1G93A mouse", Mol.Cell Neurosci., 47 (2), 108-118 (2011).

[0304] O'Roak, B. J. et.al., "Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations", Nat.Genet., 43 (6), 585-589 (2011).

[0305] O'Roak, B. J. et.al., "Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations", Nature, 485 (7397), 246-250 (2012).

[0306] Oakley, J. C. et.al., "Temperature- and age-dependent seizures in a mouse model of severe myoclonic epilepsy in infancy", Proc.Natl.Acad.Sci.U.S.A, 106 (10), 3994-3999 (2009).

[0307] Ogiwara, I. et. al., "Nav1.1 localizes to axons of parvalbumin-positive inhibitory interneurons: a circuit basis for epileptic seizures in mice carrying an Scnla gene mutation", J.Neurosci., 27 (22), 5903-5914 (2007).

[0308] Ohba, C. et.al., "Early onset epileptic encephalopathy caused by de novo SCN8A mutations", Epilepsia, 55 (7), 994-1000 (2014).

[0309] Oliva, M. et.al., "Sodium channels and the neurobiology of epilepsy", Epilepsia, 53 (11), 1849-1859 (2012).

[0310] Papale, L. A. et.al., "Heterozygous mutations of the voltage-gated sodium channel SCN8A are associated with spike-wave discharges and absence epilepsy in mice", Hum.Mol.Genet., 18 (9), 1633-1641 (2009).

[0311] Plummer, N. W. et.al., "Alternative splicing of the sodium channel SCN8A predicts a truncated two-domain protein in fetal brain and non-neuronal cells", J.Biol.Chem., 272 (38), 24008-24015 (1997).

[0312] Porensky, P. N. and Burghes, A. H. "Antisense oligonucleotides for the treatment of spinal muscular atrophy", Hum.Gene Ther., 24 (5), 489-498 (2013).

[0313] Raman, I. M. et.al., "Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice", Neuron, 19 (4), 881-891 (1997).

[0314] Raymond, C. K. et.al., "Expression of alternatively spliced sodium channel alpha-subunit genes. Unique splicing patterns are observed in dorsal root ganglia", J.Biol.Chem., 279 (44), 46234-46241 (2004).

[0315] Sanderson, D. J. et.al., "The role of the GluR-A (GluR1) AMPA receptor subunit in learning and memory", Prog.Brain Res., 169 159-178 (2008).

[0316] Schlachter, K. et.al., "A splice site variant in the sodium channel gene SCN1A confers risk of febrile seizures", Neurology, 72 (11), 974-978 (2009).

[0317] Sierra, Bello O. et.al., "In silico docking reveals possible Riluzole binding sites on Nav1.6 sodium channel: implications for amyotrophic lateral sclerosis therapy", J.Theor.Biol., 315 53-63 (2012).

[0318] Silberstein, S. D. and Dodick, D. W. "Migraine genetics: Part II", Headache, 53 (8), 1218-1229 (2013).

[0319] Singh, R. et.al., "Generalized epilepsy with febrile seizures plus: a common childhood-onset genetic epilepsy syndrome", Ann.Neurol., 45 (1), 75-81 (1999).

[0320] Smith, R. A. et.al., "Antisense oligonucleotide therapy for neurodegenerative disease", J.Clin.Invest, 116 (8), 2290-2296 (2006).

[0321] Stephan, J. L. et.al., "Treatment of central nervous system B lymphoproliferative syndrome by local infusion of a B cell-specific monoclonal antibody", Transplantation, 54 (2), 246-249 (1992).

[0322] Tang, B. et.al., "A BAC transgenic mouse model reveals neuron subtype-specific effects of a Generalized Epilepsy with Febrile Seizures Plus (GEFS+) mutation", Neurobiol.Dis., 35 (1), 91-102 (2009).

[0323] Trudeau, M. M. et.al., "Heterozygosity for a protein truncation mutation of sodium channel SCN8A in a patient with cerebellar atrophy, ataxia, and mental retardation", J.Med.Genet., 43 (6), 527-530 (2006).

[0324] Vaher, U. et.al., "De Novo SCN8A Mutation Identified by Whole-Exome Sequencing in a Boy With Neonatal Epileptic Encephalopathy, Multiple Congenital Anomalies, and Movement Disorders", J.Child Neurol., (2013).

[0325] Veeramah, K. R. et.al., "De Novo Pathogenic SCN8A Mutation Identified by Whole-Genome Sequencing of a Family Quartet Affected by Infantile Epileptic Encephalopathy and SUDEP", Am.J.Hum.Genet., 90 (3), 502-510 (2012).

[0326] Verret, L. et.al., "Inhibitory interneuron deficit links altered network activity and cognitive dysfunction in Alzheimer model", Cell, 149 (3), 708-721 (2012).

[0327] Wang, W. et.al., "The developmental changes of Na(v)1.1 and Na(v)1.2 expression in the human hippocampus and temporal lobe", Brain Res., 1389 61-70 (2011).

[0328] Wang, Z. et.al., "Systematic identification and analysis of exonic splicing silencers", Cell, 119 (6), 831-845 (2004).

[0329] Waxman, S. G. "Axonal conduction and injury in multiple sclerosis: the role of sodium channels", Nat.Rev.Neurosci., 7 (12), 932-941 (2006).

[0330] Weiss, S. et.al., "Riluzole protects against cardiac ischaemia and reperfusion damage via block of the persistent sodium current", Br.J.Pharmacol., 160 (5), 1072-1082 (2010).

[0331] Wheeler, T. M. et.al., "Correction of CIC-1 splicing eliminates chloride channelopathy and myotonia in mouse models of myotonic dystrophy", J.Clin.Invest, 117 (12), 3952-3957 (2007).

[0332] Williams, J. H. et.al., "Oligonucleotide-mediated survival of motor neuron protein expression in CNS improves phenotype in a mouse model of spinal muscular atrophy", J.Neurosci., 29 (24), 7633-7638 (2009).

[0333] Wilson, J. R. and Fehlings, M. G. "Riluzole for acute traumatic spinal cord injury: a promising neuroprotective treatment strategy", World Neurosurg., 81 (5-6), 825-829 (2014).

[0334] Xu, R. et.al., "A childhood epilepsy mutation reveals a role for developmentally regulated splicing of a sodium channel", Mol.Cell Neurosci., 35 (2), 292-301 (2007).

[0335] Yeo, G. W. et.al., "Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements", PLoS.Genet., 3 (5), e85-(2007).

[0336] Yeo, G. W. et.al., "Identification and analysis of alternative splicing events conserved in human and mouse", Proc.Natl.Acad.Sci.U.S.A, 102 (8), 2850-2855 (2005).

[0337] Yu, F. H. et.al., "Reduced sodium current in GABAergic interneurons in a mouse model of severe myoclonic epilepsy in infancy", Nat.Neurosci., 9 (9), 1142-1149 (2006).

[0338] Zhang, X. H. and Chasin, L. A. "Computational definition of sequence motifs governing constitutive exon splicing", Genes Dev., 18 (11), 1241-1250 (2004).

[0339] Zubovic, L. et.al., "Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands", Nucleic Acids Res., 40 (13), 6255-6269 (2012).

[0340] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

[0341] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "including," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

[0342] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0343] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Sequence CWU 1

1

21401104DNAHomo sapiens 1gagtggacct taatgtctct atcaaaagtt tcgagcctct tgggacttac aagagtcgcg 60actctgtaac gggtccaggt gtttgagaca gtgtatagac atca 1042104RNAHomo sapiens 2cucaccugga auuacagaga uaguuuucaa agcucggaga acccugaaug uucucagcgc 60ugagacauug cccaggucca caaacucugu cacauaucug uagu 104324RNAArtificial SequenceSynthetic Construct 3cucaccugga auuacagaga uagu 24424RNAArtificial SequenceSynthetic Construct 4ucaccuggaa uuacagagau aguu 24524RNAArtificial SequenceSynthetic Construct 5caccuggaau uacagagaua guuu 24624RNAArtificial SequenceSynthetic Construct 6accuggaauu acagagauag uuuu 24724RNAArtificial SequenceSynthetic Construct 7ccuggaauua cagagauagu uuuc 24824RNAArtificial SequenceSynthetic Construct 8cuggaauuac agagauaguu uuca 24924RNAArtificial SequenceSynthetic Construct 9uggaauuaca gagauaguuu ucaa 241024RNAArtificial SequenceSynthetic Construct 10ggaauuacag agauaguuuu caaa 241124RNAArtificial SequenceSynthetic Construct 11gaauuacaga gauaguuuuc aaag 241224RNAArtificial SequenceSynthetic Construct 12aauuacagag auaguuuuca aagc 241324RNAArtificial SequenceSynthetic Construct 13auuacagaga uaguuuucaa agcu 241424RNAArtificial SequenceSynthetic Construct 14uuacagagau aguuuucaaa gcuc 241524RNAArtificial SequenceSynthetic Construct 15uacagagaua guuuucaaag cucg 241624RNAArtificial SequenceSynthetic Construct 16acagagauag uuuucaaagc ucgg 241724RNAArtificial SequenceSynthetic Construct 17cagagauagu uuucaaagcu cgga 241824RNAArtificial SequenceSynthetic Construct 18agagauaguu uucaaagcuc ggag 241924RNAArtificial SequenceSynthetic Construct 19gagauaguuu ucaaagcucg gaga 242024RNAArtificial SequenceSynthetic Construct 20agauaguuuu caaagcucgg agaa 242124RNAArtificial SequenceSynthetic Construct 21gauaguuuuc aaagcucgga gaac 242224RNAArtificial SequenceSynthetic Construct 22auaguuuuca aagcucggag aacc 242324RNAArtificial SequenceSynthetic Construct 23uaguuuucaa agcucggaga accc 242424RNAArtificial SequenceSynthetic Construct 24aguuuucaaa gcucggagaa cccu 242524RNAArtificial SequenceSynthetic Construct 25guuuucaaag cucggagaac ccug 242624RNAArtificial SequenceSynthetic Construct 26uuuucaaagc ucggagaacc cuga 242724RNAArtificial SequenceSynthetic Construct 27uuucaaagcu cggagaaccc ugaa 242824RNAArtificial SequenceSynthetic Construct 28uucaaagcuc ggagaacccu gaau 242924RNAArtificial SequenceSynthetic Construct 29ucaaagcucg gagaacccug aaug 243024RNAArtificial SequenceSynthetic Construct 30caaagcucgg agaacccuga augu 243124RNAArtificial SequenceSynthetic Construct 31aaagcucgga gaacccugaa uguu 243224RNAArtificial SequenceSynthetic Construct 32aagcucggag aacccugaau guuc 243324RNAArtificial SequenceSynthetic Construct 33agcucggaga acccugaaug uucu 243424RNAArtificial SequenceSynthetic Construct 34gcucggagaa cccugaaugu ucuc 243524RNAArtificial SequenceSynthetic Construct 35cucggagaac ccugaauguu cuca 243624RNAArtificial SequenceSynthetic Construct 36ucggagaacc cugaauguuc ucag 243724RNAArtificial SequenceSynthetic Construct 37cggagaaccc ugaauguucu cagc 243824RNAArtificial SequenceSynthetic Construct 38ggagaacccu gaauguucuc agcg 243924RNAArtificial SequenceSynthetic Construct 39gagaacccug aauguucuca gcgc 244024RNAArtificial SequenceSynthetic Construct 40agaacccuga auguucucag cgcu 244124RNAArtificial SequenceSynthetic Construct 41gaacccugaa uguucucagc gcug 244224RNAArtificial SequenceSynthetic Construct 42aacccugaau guucucagcg cuga 244324RNAArtificial SequenceSynthetic Construct 43acccugaaug uucucagcgc ugag 244424RNAArtificial SequenceSynthetic Construct 44cccugaaugu ucucagcgcu gaga 244524RNAArtificial SequenceSynthetic Construct 45ccugaauguu cucagcgcug agac 244624RNAArtificial SequenceSynthetic Construct 46cugaauguuc ucagcgcuga gaca 244724RNAArtificial SequenceSynthetic Construct 47ugaauguucu cagcgcugag acau 244824RNAArtificial SequenceSynthetic Construct 48gaauguucuc agcgcugaga cauu 244924RNAArtificial SequenceSynthetic Construct 49aauguucuca gcgcugagac auug 245024RNAArtificial SequenceSynthetic Construct 50auguucucag cgcugagaca uugc 245124RNAArtificial SequenceSynthetic Construct 51uguucucagc gcugagacau ugcc 245224RNAArtificial SequenceSynthetic Construct 52guucucagcg cugagacauu gccc 245324RNAArtificial SequenceSynthetic Construct 53uucucagcgc ugagacauug ccca 245424RNAArtificial SequenceSynthetic Construct 54ucucagcgcu gagacauugc ccag 245524RNAArtificial SequenceSynthetic Construct 55cucagcgcug agacauugcc cagg 245624RNAArtificial SequenceSynthetic Construct 56ucagcgcuga gacauugccc aggu 245724RNAArtificial SequenceSynthetic Construct 57cagcgcugag acauugccca gguc 245824RNAArtificial SequenceSynthetic Construct 58agcgcugaga cauugcccag gucc 245924RNAArtificial SequenceSynthetic Construct 59gcgcugagac auugcccagg ucca 246024RNAArtificial SequenceSynthetic Construct 60cgcugagaca uugcccaggu ccac 246124RNAArtificial SequenceSynthetic Construct 61gcugagacau ugcccagguc caca 246224RNAArtificial SequenceSynthetic Construct 62cugagacauu gcccaggucc acaa 246324RNAArtificial SequenceSynthetic Construct 63ugagacauug cccaggucca caaa 246424RNAArtificial SequenceSynthetic Construct 64gagacauugc ccagguccac aaac 246524RNAArtificial SequenceSynthetic Construct 65agacauugcc cagguccaca aacu 246624RNAArtificial SequenceSynthetic Construct 66gacauugccc agguccacaa acuc 246724RNAArtificial SequenceSynthetic Construct 67acauugccca gguccacaaa cucu 246824RNAArtificial SequenceSynthetic Construct 68cauugcccag guccacaaac ucug 246924RNAArtificial SequenceSynthetic Construct 69auugcccagg uccacaaacu cugu 247024RNAArtificial SequenceSynthetic Construct 70uugcccaggu ccacaaacuc uguc 247124RNAArtificial SequenceSynthetic Construct 71ugcccagguc cacaaacucu guca 247224RNAArtificial SequenceSynthetic Construct 72gcccaggucc acaaacucug ucac 247324RNAArtificial SequenceSynthetic Construct 73cccaggucca caaacucugu caca 247424RNAArtificial SequenceSynthetic Construct 74ccagguccac aaacucuguc acau 247524RNAArtificial SequenceSynthetic Construct 75cagguccaca aacucuguca caua 247624RNAArtificial SequenceSynthetic Construct 76agguccacaa acucugucac auau 247724RNAArtificial SequenceSynthetic Construct 77gguccacaaa cucugucaca uauc 247824RNAArtificial SequenceSynthetic Construct 78guccacaaac ucugucacau aucu 247924RNAArtificial SequenceSynthetic Construct 79uccacaaacu cugucacaua ucug 248024RNAArtificial SequenceSynthetic Construct 80ccacaaacuc ugucacauau cugu 248124RNAArtificial SequenceSynthetic Construct 81cacaaacucu gucacauauc ugua 248224RNAArtificial SequenceSynthetic Construct 82acaaacucug ucacauaucu guag 248324RNAArtificial SequenceSynthetic Construct 83caaacucugu cacauaucug uagu 248423RNAArtificial SequenceSynthetic Construct 84cucaccugga auuacagaga uag 238523RNAArtificial SequenceSynthetic Construct 85ucaccuggaa uuacagagau agu 238623RNAArtificial SequenceSynthetic Construct 86caccuggaau uacagagaua guu 238723RNAArtificial SequenceSynthetic Construct 87accuggaauu acagagauag uuu 238823RNAArtificial SequenceSynthetic Construct 88ccuggaauua cagagauagu uuu 238923RNAArtificial SequenceSynthetic Construct 89cuggaauuac agagauaguu uuc 239023RNAArtificial SequenceSynthetic Construct 90uggaauuaca gagauaguuu uca 239123RNAArtificial SequenceSynthetic Construct 91ggaauuacag agauaguuuu caa 239223RNAArtificial SequenceSynthetic Construct 92gaauuacaga gauaguuuuc aaa 239323RNAArtificial SequenceSynthetic Construct 93aauuacagag auaguuuuca aag 239423RNAArtificial SequenceSynthetic Construct 94auuacagaga uaguuuucaa agc 239523RNAArtificial SequenceSynthetic Construct 95uuacagagau aguuuucaaa gcu 239623RNAArtificial SequenceSynthetic Construct 96uacagagaua guuuucaaag cuc 239723RNAArtificial SequenceSynthetic Construct 97acagagauag uuuucaaagc ucg 239823RNAArtificial SequenceSynthetic Construct 98cagagauagu uuucaaagcu cgg 239923RNAArtificial SequenceSynthetic Construct 99agagauaguu uucaaagcuc gga 2310023RNAArtificial SequenceSynthetic Construct 100gagauaguuu ucaaagcucg gag 2310123RNAArtificial SequenceSynthetic Construct 101agauaguuuu caaagcucgg aga 2310223RNAArtificial SequenceSynthetic Construct 102gauaguuuuc aaagcucgga gaa 2310323RNAArtificial SequenceSynthetic Construct 103auaguuuuca aagcucggag aac 2310423RNAArtificial SequenceSynthetic Construct 104uaguuuucaa agcucggaga acc 2310523RNAArtificial SequenceSynthetic Construct 105aguuuucaaa gcucggagaa ccc 2310623RNAArtificial SequenceSynthetic Construct 106guuuucaaag cucggagaac ccu 2310723RNAArtificial SequenceSynthetic Construct 107uuuucaaagc ucggagaacc cug 2310823RNAArtificial SequenceSynthetic Construct 108uuucaaagcu cggagaaccc uga 2310923RNAArtificial SequenceSynthetic Construct 109uucaaagcuc ggagaacccu gaa 2311023RNAArtificial SequenceSynthetic Construct 110ucaaagcucg gagaacccug aau 2311123RNAArtificial SequenceSynthetic Construct 111caaagcucgg agaacccuga aug 2311223RNAArtificial SequenceSynthetic Construct 112aaagcucgga gaacccugaa ugu 2311323RNAArtificial SequenceSynthetic Construct 113aagcucggag aacccugaau guu 2311423RNAArtificial SequenceSynthetic Construct 114agcucggaga acccugaaug uuc 2311523RNAArtificial SequenceSynthetic Construct 115gcucggagaa cccugaaugu ucu 2311623RNAArtificial SequenceSynthetic Construct 116cucggagaac ccugaauguu cuc 2311723RNAArtificial SequenceSynthetic Construct 117ucggagaacc cugaauguuc uca 2311823RNAArtificial SequenceSynthetic Construct 118cggagaaccc ugaauguucu cag 2311923RNAArtificial SequenceSynthetic Construct 119ggagaacccu gaauguucuc agc 2312023RNAArtificial SequenceSynthetic Construct 120gagaacccug aauguucuca gcg 2312123RNAArtificial SequenceSynthetic Construct 121agaacccuga auguucucag cgc 2312223RNAArtificial SequenceSynthetic Construct 122gaacccugaa uguucucagc gcu 2312323RNAArtificial SequenceSynthetic Construct 123aacccugaau guucucagcg cug 2312423RNAArtificial SequenceSynthetic Construct 124acccugaaug uucucagcgc uga 2312523RNAArtificial SequenceSynthetic Construct 125cccugaaugu ucucagcgcu gag 2312623RNAArtificial SequenceSynthetic Construct 126ccugaauguu cucagcgcug aga 2312723RNAArtificial SequenceSynthetic Construct 127cugaauguuc ucagcgcuga gac 2312823RNAArtificial SequenceSynthetic Construct 128ugaauguucu cagcgcugag aca 2312923RNAArtificial SequenceSynthetic Construct 129gaauguucuc agcgcugaga cau 2313023RNAArtificial SequenceSynthetic Construct 130aauguucuca gcgcugagac auu 2313123RNAArtificial SequenceSynthetic Construct 131auguucucag cgcugagaca uug 2313223RNAArtificial SequenceSynthetic Construct 132uguucucagc gcugagacau ugc 2313323RNAArtificial SequenceSynthetic Construct 133guucucagcg cugagacauu gcc 2313423RNAArtificial SequenceSynthetic Construct 134uucucagcgc ugagacauug ccc 2313523RNAArtificial SequenceSynthetic Construct 135ucucagcgcu gagacauugc cca 2313623RNAArtificial SequenceSynthetic Construct 136cucagcgcug agacauugcc cag 2313723RNAArtificial SequenceSynthetic Construct 137ucagcgcuga gacauugccc agg 2313823RNAArtificial SequenceSynthetic Construct 138cagcgcugag acauugccca ggu 2313923RNAArtificial SequenceSynthetic Construct 139agcgcugaga cauugcccag guc 2314023RNAArtificial SequenceSynthetic Construct 140gcgcugagac auugcccagg ucc 2314123RNAArtificial SequenceSynthetic Construct 141cgcugagaca uugcccaggu cca 2314223RNAArtificial SequenceSynthetic Construct 142gcugagacau ugcccagguc cac 2314323RNAArtificial SequenceSynthetic Construct 143cugagacauu gcccaggucc aca 2314423RNAArtificial SequenceSynthetic Construct 144ugagacauug cccaggucca caa 2314523RNAArtificial SequenceSynthetic Construct 145gagacauugc ccagguccac aaa 2314623RNAArtificial SequenceSynthetic Construct 146agacauugcc cagguccaca aac 2314723RNAArtificial SequenceSynthetic Construct 147gacauugccc agguccacaa acu 2314823RNAArtificial SequenceSynthetic

Construct 148acauugccca gguccacaaa cuc 2314923RNAArtificial SequenceSynthetic Construct 149cauugcccag guccacaaac ucu 2315023RNAArtificial SequenceSynthetic Construct 150auugcccagg uccacaaacu cug 2315123RNAArtificial SequenceSynthetic Construct 151uugcccaggu ccacaaacuc ugu 2315223RNAArtificial SequenceSynthetic Construct 152ugcccagguc cacaaacucu guc 2315323RNAArtificial SequenceSynthetic Construct 153gcccaggucc acaaacucug uca 2315423RNAArtificial SequenceSynthetic Construct 154cccaggucca caaacucugu cac 2315523RNAArtificial SequenceSynthetic Construct 155ccagguccac aaacucuguc aca 2315623RNAArtificial SequenceSynthetic Construct 156cagguccaca aacucuguca cau 2315723RNAArtificial SequenceSynthetic Construct 157agguccacaa acucugucac aua 2315823RNAArtificial SequenceSynthetic Construct 158gguccacaaa cucugucaca uau 2315923RNAArtificial SequenceSynthetic Construct 159guccacaaac ucugucacau auc 2316023RNAArtificial SequenceSynthetic Construct 160uccacaaacu cugucacaua ucu 2316123RNAArtificial SequenceSynthetic Construct 161ccacaaacuc ugucacauau cug 2316223RNAArtificial SequenceSynthetic Construct 162cacaaacucu gucacauauc ugu 2316323RNAArtificial SequenceSynthetic Construct 163acaaacucug ucacauaucu gua 2316423RNAArtificial SequenceSynthetic Construct 164caaacucugu cacauaucug uag 2316523RNAArtificial SequenceSynthetic Construct 165aaacucuguc acauaucugu agu 2316622RNAArtificial SequenceSynthetic Construct 166cucaccugga auuacagaga ua 2216722RNAArtificial SequenceSynthetic Construct 167ucaccuggaa uuacagagau ag 2216822RNAArtificial SequenceSynthetic Construct 168caccuggaau uacagagaua gu 2216922RNAArtificial SequenceSynthetic Construct 169accuggaauu acagagauag uu 2217022RNAArtificial SequenceSynthetic Construct 170ccuggaauua cagagauagu uu 2217122RNAArtificial SequenceSynthetic Construct 171cuggaauuac agagauaguu uu 2217222RNAArtificial SequenceSynthetic Construct 172uggaauuaca gagauaguuu uc 2217322RNAArtificial SequenceSynthetic Construct 173ggaauuacag agauaguuuu ca 2217422RNAArtificial SequenceSynthetic Construct 174gaauuacaga gauaguuuuc aa 2217522RNAArtificial SequenceSynthetic Construct 175aauuacagag auaguuuuca aa 2217622RNAArtificial SequenceSynthetic Construct 176auuacagaga uaguuuucaa ag 2217722RNAArtificial SequenceSynthetic Construct 177uuacagagau aguuuucaaa gc 2217822RNAArtificial SequenceSynthetic Construct 178uacagagaua guuuucaaag cu 2217922RNAArtificial SequenceSynthetic Construct 179acagagauag uuuucaaagc uc 2218022RNAArtificial SequenceSynthetic Construct 180cagagauagu uuucaaagcu cg 2218122RNAArtificial SequenceSynthetic Construct 181agagauaguu uucaaagcuc gg 2218222RNAArtificial SequenceSynthetic Construct 182gagauaguuu ucaaagcucg ga 2218322RNAArtificial SequenceSynthetic Construct 183agauaguuuu caaagcucgg ag 2218422RNAArtificial SequenceSynthetic Construct 184gauaguuuuc aaagcucgga ga 2218522RNAArtificial SequenceSynthetic Construct 185auaguuuuca aagcucggag aa 2218622RNAArtificial SequenceSynthetic Construct 186uaguuuucaa agcucggaga ac 2218722RNAArtificial SequenceSynthetic Construct 187aguuuucaaa gcucggagaa cc 2218822RNAArtificial SequenceSynthetic Construct 188guuuucaaag cucggagaac cc 2218922RNAArtificial SequenceSynthetic Construct 189uuuucaaagc ucggagaacc cu 2219022RNAArtificial SequenceSynthetic Construct 190uuucaaagcu cggagaaccc ug 2219122RNAArtificial SequenceSynthetic Construct 191uucaaagcuc ggagaacccu ga 2219222RNAArtificial SequenceSynthetic Construct 192ucaaagcucg gagaacccug aa 2219322RNAArtificial SequenceSynthetic Construct 193caaagcucgg agaacccuga au 2219422RNAArtificial SequenceSynthetic Construct 194aaagcucgga gaacccugaa ug 2219522RNAArtificial SequenceSynthetic Construct 195aagcucggag aacccugaau gu 2219622RNAArtificial SequenceSynthetic Construct 196agcucggaga acccugaaug uu 2219722RNAArtificial SequenceSynthetic Construct 197gcucggagaa cccugaaugu uc 2219822RNAArtificial SequenceSynthetic Construct 198cucggagaac ccugaauguu cu 2219922RNAArtificial SequenceSynthetic Construct 199ucggagaacc cugaauguuc uc 2220022RNAArtificial SequenceSynthetic Construct 200cggagaaccc ugaauguucu ca 2220122RNAArtificial SequenceSynthetic Construct 201ggagaacccu gaauguucuc ag 2220222RNAArtificial SequenceSynthetic Construct 202gagaacccug aauguucuca gc 2220322RNAArtificial SequenceSynthetic Construct 203agaacccuga auguucucag cg 2220422RNAArtificial SequenceSynthetic Construct 204gaacccugaa uguucucagc gc 2220522RNAArtificial SequenceSynthetic Construct 205aacccugaau guucucagcg cu 2220622RNAArtificial SequenceSynthetic Construct 206acccugaaug uucucagcgc ug 2220722RNAArtificial SequenceSynthetic Construct 207cccugaaugu ucucagcgcu ga 2220822RNAArtificial SequenceSynthetic Construct 208ccugaauguu cucagcgcug ag 2220922RNAArtificial SequenceSynthetic Construct 209cugaauguuc ucagcgcuga ga 2221022RNAArtificial SequenceSynthetic Construct 210ugaauguucu cagcgcugag ac 2221122RNAArtificial SequenceSynthetic Construct 211gaauguucuc agcgcugaga ca 2221222RNAArtificial SequenceSynthetic Construct 212aauguucuca gcgcugagac au 2221322RNAArtificial SequenceSynthetic Construct 213auguucucag cgcugagaca uu 2221422RNAArtificial SequenceSynthetic Construct 214uguucucagc gcugagacau ug 2221522RNAArtificial SequenceSynthetic Construct 215guucucagcg cugagacauu gc 2221622RNAArtificial SequenceSynthetic Construct 216uucucagcgc ugagacauug cc 2221722RNAArtificial SequenceSynthetic Construct 217ucucagcgcu gagacauugc cc 2221822RNAArtificial SequenceSynthetic Construct 218cucagcgcug agacauugcc ca 2221922RNAArtificial SequenceSynthetic Construct 219ucagcgcuga gacauugccc ag 2222022RNAArtificial SequenceSynthetic Construct 220cagcgcugag acauugccca gg 2222122RNAArtificial SequenceSynthetic Construct 221agcgcugaga cauugcccag gu 2222222RNAArtificial SequenceSynthetic Construct 222gcgcugagac auugcccagg uc 2222322RNAArtificial SequenceSynthetic Construct 223cgcugagaca uugcccaggu cc 2222422RNAArtificial SequenceSynthetic Construct 224gcugagacau ugcccagguc ca 2222522RNAArtificial SequenceSynthetic Construct 225cugagacauu gcccaggucc ac 2222622RNAArtificial SequenceSynthetic Construct 226ugagacauug cccaggucca ca 2222722RNAArtificial SequenceSynthetic Construct 227gagacauugc ccagguccac aa 2222822RNAArtificial SequenceSynthetic Construct 228agacauugcc cagguccaca aa 2222922RNAArtificial SequenceSynthetic Construct 229gacauugccc agguccacaa ac 2223022RNAArtificial SequenceSynthetic Construct 230acauugccca gguccacaaa cu 2223122RNAArtificial SequenceSynthetic Construct 231cauugcccag guccacaaac uc 2223222RNAArtificial SequenceSynthetic Construct 232auugcccagg uccacaaacu cu 2223322RNAArtificial SequenceSynthetic Construct 233uugcccaggu ccacaaacuc ug 2223422RNAArtificial SequenceSynthetic Construct 234ugcccagguc cacaaacucu gu 2223522RNAArtificial SequenceSynthetic Construct 235gcccaggucc acaaacucug uc 2223622RNAArtificial SequenceSynthetic Construct 236cccaggucca caaacucugu ca 2223722RNAArtificial SequenceSynthetic Construct 237ccagguccac aaacucuguc ac 2223822RNAArtificial SequenceSynthetic Construct 238cagguccaca aacucuguca ca 2223922RNAArtificial SequenceSynthetic Construct 239agguccacaa acucugucac au 2224022RNAArtificial SequenceSynthetic Construct 240gguccacaaa cucugucaca ua 2224122RNAArtificial SequenceSynthetic Construct 241guccacaaac ucugucacau au 2224222RNAArtificial SequenceSynthetic Construct 242uccacaaacu cugucacaua uc 2224322RNAArtificial SequenceSynthetic Construct 243ccacaaacuc ugucacauau cu 2224422RNAArtificial SequenceSynthetic Construct 244cacaaacucu gucacauauc ug 2224522RNAArtificial SequenceSynthetic Construct 245acaaacucug ucacauaucu gu 2224622RNAArtificial SequenceSynthetic Construct 246caaacucugu cacauaucug ua 2224722RNAArtificial SequenceSynthetic Construct 247aaacucuguc acauaucugu ag 2224822RNAArtificial SequenceSynthetic Construct 248aacucuguca cauaucugua gu 2224921RNAArtificial SequenceSynthetic Construct 249cucaccugga auuacagaga u 2125021RNAArtificial SequenceSynthetic Construct 250ucaccuggaa uuacagagau a 2125121RNAArtificial SequenceSynthetic Construct 251caccuggaau uacagagaua g 2125221RNAArtificial SequenceSynthetic Construct 252accuggaauu acagagauag u 2125321RNAArtificial SequenceSynthetic Construct 253ccuggaauua cagagauagu u 2125421RNAArtificial SequenceSynthetic Construct 254cuggaauuac agagauaguu u 2125521RNAArtificial SequenceSynthetic Construct 255uggaauuaca gagauaguuu u 2125621RNAArtificial SequenceSynthetic Construct 256ggaauuacag agauaguuuu c 2125721RNAArtificial SequenceSynthetic Construct 257gaauuacaga gauaguuuuc a 2125821RNAArtificial SequenceSynthetic Construct 258aauuacagag auaguuuuca a 2125921RNAArtificial SequenceSynthetic Construct 259auuacagaga uaguuuucaa a 2126021RNAArtificial SequenceSynthetic Construct 260uuacagagau aguuuucaaa g 2126121RNAArtificial SequenceSynthetic Construct 261uacagagaua guuuucaaag c 2126221RNAArtificial SequenceSynthetic Construct 262acagagauag uuuucaaagc u 2126321RNAArtificial SequenceSynthetic Construct 263cagagauagu uuucaaagcu c 2126421RNAArtificial SequenceSynthetic Construct 264agagauaguu uucaaagcuc g 2126521RNAArtificial SequenceSynthetic Construct 265gagauaguuu ucaaagcucg g 2126621RNAArtificial SequenceSynthetic Construct 266agauaguuuu caaagcucgg a 2126721RNAArtificial SequenceSynthetic Construct 267gauaguuuuc aaagcucgga g 2126821RNAArtificial SequenceSynthetic Construct 268auaguuuuca aagcucggag a 2126921RNAArtificial SequenceSynthetic Construct 269uaguuuucaa agcucggaga a 2127021RNAArtificial SequenceSynthetic Construct 270aguuuucaaa gcucggagaa c 2127121RNAArtificial SequenceSynthetic Construct 271guuuucaaag cucggagaac c 2127221RNAArtificial SequenceSynthetic Construct 272uuuucaaagc ucggagaacc c 2127321RNAArtificial SequenceSynthetic Construct 273uuucaaagcu cggagaaccc u 2127421RNAArtificial SequenceSynthetic Construct 274uucaaagcuc ggagaacccu g 2127521RNAArtificial SequenceSynthetic Construct 275ucaaagcucg gagaacccug a 2127621RNAArtificial SequenceSynthetic Construct 276caaagcucgg agaacccuga a 2127721RNAArtificial SequenceSynthetic Construct 277aaagcucgga gaacccugaa u 2127821RNAArtificial SequenceSynthetic Construct 278aagcucggag aacccugaau g 2127921RNAArtificial SequenceSynthetic Construct 279agcucggaga acccugaaug u 2128021RNAArtificial SequenceSynthetic Construct 280gcucggagaa cccugaaugu u 2128121RNAArtificial SequenceSynthetic Construct 281cucggagaac ccugaauguu c 2128221RNAArtificial SequenceSynthetic Construct 282ucggagaacc cugaauguuc u 2128321RNAArtificial SequenceSynthetic Construct 283cggagaaccc ugaauguucu c 2128421RNAArtificial SequenceSynthetic Construct 284ggagaacccu gaauguucuc a 2128521RNAArtificial SequenceSynthetic Construct 285gagaacccug aauguucuca g 2128621RNAArtificial SequenceSynthetic Construct 286agaacccuga auguucucag c 2128721RNAArtificial SequenceSynthetic Construct 287gaacccugaa uguucucagc g 2128821RNAArtificial SequenceSynthetic Construct 288aacccugaau guucucagcg c 2128921RNAArtificial SequenceSynthetic Construct 289acccugaaug uucucagcgc u 2129021RNAArtificial SequenceSynthetic Construct 290cccugaaugu ucucagcgcu g 2129121RNAArtificial SequenceSynthetic Construct 291ccugaauguu cucagcgcug a

2129221RNAArtificial SequenceSynthetic Construct 292cugaauguuc ucagcgcuga g 2129321RNAArtificial SequenceSynthetic Construct 293ugaauguucu cagcgcugag a 2129421RNAArtificial SequenceSynthetic Construct 294gaauguucuc agcgcugaga c 2129521RNAArtificial SequenceSynthetic Construct 295aauguucuca gcgcugagac a 2129621RNAArtificial SequenceSynthetic Construct 296auguucucag cgcugagaca u 2129721RNAArtificial SequenceSynthetic Construct 297uguucucagc gcugagacau u 2129821RNAArtificial SequenceSynthetic Construct 298guucucagcg cugagacauu g 2129921RNAArtificial SequenceSynthetic Construct 299uucucagcgc ugagacauug c 2130021RNAArtificial SequenceSynthetic Construct 300ucucagcgcu gagacauugc c 2130121RNAArtificial SequenceSynthetic Construct 301cucagcgcug agacauugcc c 2130221RNAArtificial SequenceSynthetic Construct 302ucagcgcuga gacauugccc a 2130321RNAArtificial SequenceSynthetic Construct 303cagcgcugag acauugccca g 2130421RNAArtificial SequenceSynthetic Construct 304agcgcugaga cauugcccag g 2130521RNAArtificial SequenceSynthetic Construct 305gcgcugagac auugcccagg u 2130621RNAArtificial SequenceSynthetic Construct 306cgcugagaca uugcccaggu c 2130721RNAArtificial SequenceSynthetic Construct 307gcugagacau ugcccagguc c 2130821RNAArtificial SequenceSynthetic Construct 308cugagacauu gcccaggucc a 2130921RNAArtificial SequenceSynthetic Construct 309ugagacauug cccaggucca c 2131021RNAArtificial SequenceSynthetic Construct 310gagacauugc ccagguccac a 2131121RNAArtificial SequenceSynthetic Construct 311agacauugcc cagguccaca a 2131221RNAArtificial SequenceSynthetic Construct 312gacauugccc agguccacaa a 2131321RNAArtificial SequenceSynthetic Construct 313acauugccca gguccacaaa c 2131421RNAArtificial SequenceSynthetic Construct 314cauugcccag guccacaaac u 2131521RNAArtificial SequenceSynthetic Construct 315auugcccagg uccacaaacu c 2131621RNAArtificial SequenceSynthetic Construct 316uugcccaggu ccacaaacuc u 2131721RNAArtificial SequenceSynthetic Construct 317ugcccagguc cacaaacucu g 2131821RNAArtificial SequenceSynthetic Construct 318gcccaggucc acaaacucug u 2131921RNAArtificial SequenceSynthetic Construct 319cccaggucca caaacucugu c 2132021RNAArtificial SequenceSynthetic Construct 320ccagguccac aaacucuguc a 2132121RNAArtificial SequenceSynthetic Construct 321cagguccaca aacucuguca c 2132221RNAArtificial SequenceSynthetic Construct 322agguccacaa acucugucac a 2132321RNAArtificial SequenceSynthetic Construct 323gguccacaaa cucugucaca u 2132421RNAArtificial SequenceSynthetic Construct 324guccacaaac ucugucacau a 2132521RNAArtificial SequenceSynthetic Construct 325uccacaaacu cugucacaua u 2132621RNAArtificial SequenceSynthetic Construct 326ccacaaacuc ugucacauau c 2132721RNAArtificial SequenceSynthetic Construct 327cacaaacucu gucacauauc u 2132821RNAArtificial SequenceSynthetic Construct 328acaaacucug ucacauaucu g 2132921RNAArtificial SequenceSynthetic Construct 329caaacucugu cacauaucug u 2133021RNAArtificial SequenceSynthetic Construct 330aaacucuguc acauaucugu a 2133121RNAArtificial SequenceSynthetic Construct 331aacucuguca cauaucugua g 2133221RNAArtificial SequenceSynthetic Construct 332acucugucac auaucuguag u 2133320RNAArtificial SequenceSynthetic Construct 333cucaccugga auuacagaga 2033420RNAArtificial SequenceSynthetic Construct 334ucaccuggaa uuacagagau 2033520RNAArtificial SequenceSynthetic Construct 335caccuggaau uacagagaua 2033620RNAArtificial SequenceSynthetic Construct 336accuggaauu acagagauag 2033720RNAArtificial SequenceSynthetic Construct 337ccuggaauua cagagauagu 2033820RNAArtificial SequenceSynthetic Construct 338cuggaauuac agagauaguu 2033920RNAArtificial SequenceSynthetic Construct 339uggaauuaca gagauaguuu 2034020RNAArtificial SequenceSynthetic Construct 340ggaauuacag agauaguuuu 2034120RNAArtificial SequenceSynthetic Construct 341gaauuacaga gauaguuuuc 2034220RNAArtificial SequenceSynthetic Construct 342aauuacagag auaguuuuca 2034320RNAArtificial SequenceSynthetic Construct 343auuacagaga uaguuuucaa 2034420RNAArtificial SequenceSynthetic Construct 344uuacagagau aguuuucaaa 2034520RNAArtificial SequenceSynthetic Construct 345uacagagaua guuuucaaag 2034620RNAArtificial SequenceSynthetic Construct 346acagagauag uuuucaaagc 2034720RNAArtificial SequenceSynthetic Construct 347cagagauagu uuucaaagcu 2034820RNAArtificial SequenceSynthetic Construct 348agagauaguu uucaaagcuc 2034920RNAArtificial SequenceSynthetic Construct 349gagauaguuu ucaaagcucg 2035020RNAArtificial SequenceSynthetic Construct 350agauaguuuu caaagcucgg 2035120RNAArtificial SequenceSynthetic Construct 351gauaguuuuc aaagcucgga 2035220RNAArtificial SequenceSynthetic Construct 352auaguuuuca aagcucggag 2035320RNAArtificial SequenceSynthetic Construct 353uaguuuucaa agcucggaga 2035420RNAArtificial SequenceSynthetic Construct 354aguuuucaaa gcucggagaa 2035520RNAArtificial SequenceSynthetic Construct 355guuuucaaag cucggagaac 2035620RNAArtificial SequenceSynthetic Construct 356uuuucaaagc ucggagaacc 2035720RNAArtificial SequenceSynthetic Construct 357uuucaaagcu cggagaaccc 2035820RNAArtificial SequenceSynthetic Construct 358uucaaagcuc ggagaacccu 2035920RNAArtificial SequenceSynthetic Construct 359ucaaagcucg gagaacccug 2036020RNAArtificial SequenceSynthetic Construct 360caaagcucgg agaacccuga 2036120RNAArtificial SequenceSynthetic Construct 361aaagcucgga gaacccugaa 2036220RNAArtificial SequenceSynthetic Construct 362aagcucggag aacccugaau 2036320RNAArtificial SequenceSynthetic Construct 363agcucggaga acccugaaug 2036420RNAArtificial SequenceSynthetic Construct 364gcucggagaa cccugaaugu 2036520RNAArtificial SequenceSynthetic Construct 365cucggagaac ccugaauguu 2036620RNAArtificial SequenceSynthetic Construct 366ucggagaacc cugaauguuc 2036720RNAArtificial SequenceSynthetic Construct 367cggagaaccc ugaauguucu 2036820RNAArtificial SequenceSynthetic Construct 368ggagaacccu gaauguucuc 2036920RNAArtificial SequenceSynthetic Construct 369gagaacccug aauguucuca 2037020RNAArtificial SequenceSynthetic Construct 370agaacccuga auguucucag 2037120RNAArtificial SequenceSynthetic Construct 371gaacccugaa uguucucagc 2037220RNAArtificial SequenceSynthetic Construct 372aacccugaau guucucagcg 2037320RNAArtificial SequenceSynthetic Construct 373acccugaaug uucucagcgc 2037420RNAArtificial SequenceSynthetic Construct 374cccugaaugu ucucagcgcu 2037520RNAArtificial SequenceSynthetic Construct 375ccugaauguu cucagcgcug 2037620RNAArtificial SequenceSynthetic Construct 376cugaauguuc ucagcgcuga 2037720RNAArtificial SequenceSynthetic Construct 377ugaauguucu cagcgcugag 2037820RNAArtificial SequenceSynthetic Construct 378gaauguucuc agcgcugaga 2037920RNAArtificial SequenceSynthetic Construct 379aauguucuca gcgcugagac 2038020RNAArtificial SequenceSynthetic Construct 380auguucucag cgcugagaca 2038120RNAArtificial SequenceSynthetic Construct 381uguucucagc gcugagacau 2038220RNAArtificial SequenceSynthetic Construct 382guucucagcg cugagacauu 2038320RNAArtificial SequenceSynthetic Construct 383uucucagcgc ugagacauug 2038420RNAArtificial SequenceSynthetic Construct 384ucucagcgcu gagacauugc 2038520RNAArtificial SequenceSynthetic Construct 385cucagcgcug agacauugcc 2038620RNAArtificial SequenceSynthetic Construct 386ucagcgcuga gacauugccc 2038720RNAArtificial SequenceSynthetic Construct 387cagcgcugag acauugccca 2038820RNAArtificial SequenceSynthetic Construct 388agcgcugaga cauugcccag 2038920RNAArtificial SequenceSynthetic Construct 389gcgcugagac auugcccagg 2039020RNAArtificial SequenceSynthetic Construct 390cgcugagaca uugcccaggu 2039120RNAArtificial SequenceSynthetic Construct 391gcugagacau ugcccagguc 2039220RNAArtificial SequenceSynthetic Construct 392cugagacauu gcccaggucc 2039320RNAArtificial SequenceSynthetic Construct 393ugagacauug cccaggucca 2039420RNAArtificial SequenceSynthetic Construct 394gagacauugc ccagguccac 2039520RNAArtificial SequenceSynthetic Construct 395agacauugcc cagguccaca 2039620RNAArtificial SequenceSynthetic Construct 396gacauugccc agguccacaa 2039720RNAArtificial SequenceSynthetic Construct 397acauugccca gguccacaaa 2039820RNAArtificial SequenceSynthetic Construct 398cauugcccag guccacaaac 2039920RNAArtificial SequenceSynthetic Construct 399auugcccagg uccacaaacu 2040020RNAArtificial SequenceSynthetic Construct 400uugcccaggu ccacaaacuc 2040120RNAArtificial SequenceSynthetic Construct 401ugcccagguc cacaaacucu 2040220RNAArtificial SequenceSynthetic Construct 402gcccaggucc acaaacucug 2040320RNAArtificial SequenceSynthetic Construct 403cccaggucca caaacucugu 2040420RNAArtificial SequenceSynthetic Construct 404ccagguccac aaacucuguc 2040520RNAArtificial SequenceSynthetic Construct 405cagguccaca aacucuguca 2040620RNAArtificial SequenceSynthetic Construct 406agguccacaa acucugucac 2040720RNAArtificial SequenceSynthetic Construct 407gguccacaaa cucugucaca 2040820RNAArtificial SequenceSynthetic Construct 408guccacaaac ucugucacau 2040920RNAArtificial SequenceSynthetic Construct 409uccacaaacu cugucacaua 2041020RNAArtificial SequenceSynthetic Construct 410ccacaaacuc ugucacauau 2041120RNAArtificial SequenceSynthetic Construct 411cacaaacucu gucacauauc 2041220RNAArtificial SequenceSynthetic Construct 412acaaacucug ucacauaucu 2041320RNAArtificial SequenceSynthetic Construct 413caaacucugu cacauaucug 2041420RNAArtificial SequenceSynthetic Construct 414aaacucuguc acauaucugu 2041520RNAArtificial SequenceSynthetic Construct 415aacucuguca cauaucugua 2041620RNAArtificial SequenceSynthetic Construct 416acucugucac auaucuguag 2041720RNAArtificial SequenceSynthetic Construct 417cucugucaca uaucuguagu 2041819RNAArtificial SequenceSynthetic Construct 418cucaccugga auuacagag 1941919RNAArtificial SequenceSynthetic Construct 419ucaccuggaa uuacagaga 1942019RNAArtificial SequenceSynthetic Construct 420caccuggaau uacagagau 1942119RNAArtificial SequenceSynthetic Construct 421accuggaauu acagagaua 1942219RNAArtificial SequenceSynthetic Construct 422ccuggaauua cagagauag 1942319RNAArtificial SequenceSynthetic Construct 423cuggaauuac agagauagu 1942419RNAArtificial SequenceSynthetic Construct 424uggaauuaca gagauaguu 1942519RNAArtificial SequenceSynthetic Construct 425ggaauuacag agauaguuu 1942619RNAArtificial SequenceSynthetic Construct 426gaauuacaga gauaguuuu 1942719RNAArtificial SequenceSynthetic Construct 427aauuacagag auaguuuuc 1942819RNAArtificial SequenceSynthetic Construct 428auuacagaga uaguuuuca 1942919RNAArtificial SequenceSynthetic Construct 429uuacagagau aguuuucaa 1943019RNAArtificial SequenceSynthetic Construct 430uacagagaua guuuucaaa 1943119RNAArtificial SequenceSynthetic Construct 431acagagauag uuuucaaag 1943219RNAArtificial SequenceSynthetic Construct 432cagagauagu uuucaaagc 1943319RNAArtificial SequenceSynthetic Construct 433agagauaguu uucaaagcu 1943419RNAArtificial SequenceSynthetic Construct 434gagauaguuu ucaaagcuc 1943519RNAArtificial

SequenceSynthetic Construct 435agauaguuuu caaagcucg 1943619RNAArtificial SequenceSynthetic Construct 436gauaguuuuc aaagcucgg 1943719RNAArtificial SequenceSynthetic Construct 437auaguuuuca aagcucgga 1943819RNAArtificial SequenceSynthetic Construct 438uaguuuucaa agcucggag 1943919RNAArtificial SequenceSynthetic Construct 439aguuuucaaa gcucggaga 1944019RNAArtificial SequenceSynthetic Construct 440guuuucaaag cucggagaa 1944119RNAArtificial SequenceSynthetic Construct 441uuuucaaagc ucggagaac 1944219RNAArtificial SequenceSynthetic Construct 442uuucaaagcu cggagaacc 1944319RNAArtificial SequenceSynthetic Construct 443uucaaagcuc ggagaaccc 1944419RNAArtificial SequenceSynthetic Construct 444ucaaagcucg gagaacccu 1944519RNAArtificial SequenceSynthetic Construct 445caaagcucgg agaacccug 1944619RNAArtificial SequenceSynthetic Construct 446aaagcucgga gaacccuga 1944719RNAArtificial SequenceSynthetic Construct 447aagcucggag aacccugaa 1944819RNAArtificial SequenceSynthetic Construct 448agcucggaga acccugaau 1944919RNAArtificial SequenceSynthetic Construct 449gcucggagaa cccugaaug 1945019RNAArtificial SequenceSynthetic Construct 450cucggagaac ccugaaugu 1945119RNAArtificial SequenceSynthetic Construct 451ucggagaacc cugaauguu 1945219RNAArtificial SequenceSynthetic Construct 452cggagaaccc ugaauguuc 1945319RNAArtificial SequenceSynthetic Construct 453ggagaacccu gaauguucu 1945419RNAArtificial SequenceSynthetic Construct 454gagaacccug aauguucuc 1945519RNAArtificial SequenceSynthetic Construct 455agaacccuga auguucuca 1945619RNAArtificial SequenceSynthetic Construct 456gaacccugaa uguucucag 1945719RNAArtificial SequenceSynthetic Construct 457aacccugaau guucucagc 1945819RNAArtificial SequenceSynthetic Construct 458acccugaaug uucucagcg 1945919RNAArtificial SequenceSynthetic Construct 459cccugaaugu ucucagcgc 1946019RNAArtificial SequenceSynthetic Construct 460ccugaauguu cucagcgcu 1946119RNAArtificial SequenceSynthetic Construct 461cugaauguuc ucagcgcug 1946219RNAArtificial SequenceSynthetic Construct 462ugaauguucu cagcgcuga 1946319RNAArtificial SequenceSynthetic Construct 463gaauguucuc agcgcugag 1946419RNAArtificial SequenceSynthetic Construct 464aauguucuca gcgcugaga 1946519RNAArtificial SequenceSynthetic Construct 465auguucucag cgcugagac 1946619RNAArtificial SequenceSynthetic Construct 466uguucucagc gcugagaca 1946719RNAArtificial SequenceSynthetic Construct 467guucucagcg cugagacau 1946819RNAArtificial SequenceSynthetic Construct 468uucucagcgc ugagacauu 1946919RNAArtificial SequenceSynthetic Construct 469ucucagcgcu gagacauug 1947019RNAArtificial SequenceSynthetic Construct 470cucagcgcug agacauugc 1947119RNAArtificial SequenceSynthetic Construct 471ucagcgcuga gacauugcc 1947219RNAArtificial SequenceSynthetic Construct 472cagcgcugag acauugccc 1947319RNAArtificial SequenceSynthetic Construct 473agcgcugaga cauugccca 1947419RNAArtificial SequenceSynthetic Construct 474gcgcugagac auugcccag 1947519RNAArtificial SequenceSynthetic Construct 475cgcugagaca uugcccagg 1947619RNAArtificial SequenceSynthetic Construct 476gcugagacau ugcccaggu 1947719RNAArtificial SequenceSynthetic Construct 477cugagacauu gcccagguc 1947819RNAArtificial SequenceSynthetic Construct 478ugagacauug cccaggucc 1947919RNAArtificial SequenceSynthetic Construct 479gagacauugc ccaggucca 1948019RNAArtificial SequenceSynthetic Construct 480agacauugcc cagguccac 1948119RNAArtificial SequenceSynthetic Construct 481gacauugccc agguccaca 1948219RNAArtificial SequenceSynthetic Construct 482acauugccca gguccacaa 1948319RNAArtificial SequenceSynthetic Construct 483cauugcccag guccacaaa 1948419RNAArtificial SequenceSynthetic Construct 484auugcccagg uccacaaac 1948519RNAArtificial SequenceSynthetic Construct 485uugcccaggu ccacaaacu 1948619RNAArtificial SequenceSynthetic Construct 486ugcccagguc cacaaacuc 1948719RNAArtificial SequenceSynthetic Construct 487gcccaggucc acaaacucu 1948819RNAArtificial SequenceSynthetic Construct 488cccaggucca caaacucug 1948919RNAArtificial SequenceSynthetic Construct 489ccagguccac aaacucugu 1949019RNAArtificial SequenceSynthetic Construct 490cagguccaca aacucuguc 1949119RNAArtificial SequenceSynthetic Construct 491agguccacaa acucuguca 1949219RNAArtificial SequenceSynthetic Construct 492gguccacaaa cucugucac 1949319RNAArtificial SequenceSynthetic Construct 493guccacaaac ucugucaca 1949419RNAArtificial SequenceSynthetic Construct 494uccacaaacu cugucacau 1949519RNAArtificial SequenceSynthetic Construct 495ccacaaacuc ugucacaua 1949619RNAArtificial SequenceSynthetic Construct 496cacaaacucu gucacauau 1949719RNAArtificial SequenceSynthetic Construct 497acaaacucug ucacauauc 1949819RNAArtificial SequenceSynthetic Construct 498caaacucugu cacauaucu 1949919RNAArtificial SequenceSynthetic Construct 499aaacucuguc acauaucug 1950019RNAArtificial SequenceSynthetic Construct 500aacucuguca cauaucugu 1950119RNAArtificial SequenceSynthetic Construct 501acucugucac auaucugua 1950219RNAArtificial SequenceSynthetic Construct 502cucugucaca uaucuguag 1950319RNAArtificial SequenceSynthetic Construct 503ucugucacau aucuguagu 1950418RNAArtificial SequenceSynthetic Construct 504cucaccugga auuacaga 1850518RNAArtificial SequenceSynthetic Construct 505ucaccuggaa uuacagag 1850618RNAArtificial SequenceSynthetic Construct 506caccuggaau uacagaga 1850718RNAArtificial SequenceSynthetic Construct 507accuggaauu acagagau 1850818RNAArtificial SequenceSynthetic Construct 508ccuggaauua cagagaua 1850918RNAArtificial SequenceSynthetic Construct 509cuggaauuac agagauag 1851018RNAArtificial SequenceSynthetic Construct 510uggaauuaca gagauagu 1851118RNAArtificial SequenceSynthetic Construct 511ggaauuacag agauaguu 1851218RNAArtificial SequenceSynthetic Construct 512gaauuacaga gauaguuu 1851318RNAArtificial SequenceSynthetic Construct 513aauuacagag auaguuuu 1851418RNAArtificial SequenceSynthetic Construct 514auuacagaga uaguuuuc 1851518RNAArtificial SequenceSynthetic Construct 515uuacagagau aguuuuca 1851618RNAArtificial SequenceSynthetic Construct 516uacagagaua guuuucaa 1851718RNAArtificial SequenceSynthetic Construct 517acagagauag uuuucaaa 1851818RNAArtificial SequenceSynthetic Construct 518cagagauagu uuucaaag 1851918RNAArtificial SequenceSynthetic Construct 519agagauaguu uucaaagc 1852018RNAArtificial SequenceSynthetic Construct 520gagauaguuu ucaaagcu 1852118RNAArtificial SequenceSynthetic Construct 521agauaguuuu caaagcuc 1852218RNAArtificial SequenceSynthetic Construct 522gauaguuuuc aaagcucg 1852318RNAArtificial SequenceSynthetic Construct 523auaguuuuca aagcucgg 1852418RNAArtificial SequenceSynthetic Construct 524uaguuuucaa agcucgga 1852518RNAArtificial SequenceSynthetic Construct 525aguuuucaaa gcucggag 1852618RNAArtificial SequenceSynthetic Construct 526guuuucaaag cucggaga 1852718RNAArtificial SequenceSynthetic Construct 527uuuucaaagc ucggagaa 1852818RNAArtificial SequenceSynthetic Construct 528uuucaaagcu cggagaac 1852918RNAArtificial SequenceSynthetic Construct 529uucaaagcuc ggagaacc 1853018RNAArtificial SequenceSynthetic Construct 530ucaaagcucg gagaaccc 1853118RNAArtificial SequenceSynthetic Construct 531caaagcucgg agaacccu 1853218RNAArtificial SequenceSynthetic Construct 532aaagcucgga gaacccug 1853318RNAArtificial SequenceSynthetic Construct 533aagcucggag aacccuga 1853418RNAArtificial SequenceSynthetic Construct 534agcucggaga acccugaa 1853518RNAArtificial SequenceSynthetic Construct 535gcucggagaa cccugaau 1853618RNAArtificial SequenceSynthetic Construct 536cucggagaac ccugaaug 1853718RNAArtificial SequenceSynthetic Construct 537ucggagaacc cugaaugu 1853818RNAArtificial SequenceSynthetic Construct 538cggagaaccc ugaauguu 1853918RNAArtificial SequenceSynthetic Construct 539ggagaacccu gaauguuc 1854018RNAArtificial SequenceSynthetic Construct 540gagaacccug aauguucu 1854118RNAArtificial SequenceSynthetic Construct 541agaacccuga auguucuc 1854218RNAArtificial SequenceSynthetic Construct 542gaacccugaa uguucuca 1854318RNAArtificial SequenceSynthetic Construct 543aacccugaau guucucag 1854418RNAArtificial SequenceSynthetic Construct 544acccugaaug uucucagc 1854518RNAArtificial SequenceSynthetic Construct 545cccugaaugu ucucagcg 1854618RNAArtificial SequenceSynthetic Construct 546ccugaauguu cucagcgc 1854718RNAArtificial SequenceSynthetic Construct 547cugaauguuc ucagcgcu 1854818RNAArtificial SequenceSynthetic Construct 548ugaauguucu cagcgcug 1854918RNAArtificial SequenceSynthetic Construct 549gaauguucuc agcgcuga 1855018RNAArtificial SequenceSynthetic Construct 550aauguucuca gcgcugag 1855118RNAArtificial SequenceSynthetic Construct 551auguucucag cgcugaga 1855218RNAArtificial SequenceSynthetic Construct 552uguucucagc gcugagac 1855318RNAArtificial SequenceSynthetic Construct 553guucucagcg cugagaca 1855418RNAArtificial SequenceSynthetic Construct 554uucucagcgc ugagacau 1855518RNAArtificial SequenceSynthetic Construct 555ucucagcgcu gagacauu 1855618RNAArtificial SequenceSynthetic Construct 556cucagcgcug agacauug 1855718RNAArtificial SequenceSynthetic Construct 557ucagcgcuga gacauugc 1855818RNAArtificial SequenceSynthetic Construct 558cagcgcugag acauugcc 1855918RNAArtificial SequenceSynthetic Construct 559agcgcugaga cauugccc 1856018RNAArtificial SequenceSynthetic Construct 560gcgcugagac auugccca 1856118RNAArtificial SequenceSynthetic Construct 561cgcugagaca uugcccag 1856218RNAArtificial SequenceSynthetic Construct 562gcugagacau ugcccagg 1856318RNAArtificial SequenceSynthetic Construct 563cugagacauu gcccaggu 1856418RNAArtificial SequenceSynthetic Construct 564ugagacauug cccagguc 1856518RNAArtificial SequenceSynthetic Construct 565gagacauugc ccaggucc 1856618RNAArtificial SequenceSynthetic Construct 566agacauugcc caggucca 1856718RNAArtificial SequenceSynthetic Construct 567gacauugccc agguccac 1856818RNAArtificial SequenceSynthetic Construct 568acauugccca gguccaca 1856918RNAArtificial SequenceSynthetic Construct 569cauugcccag guccacaa 1857018RNAArtificial SequenceSynthetic Construct 570auugcccagg uccacaaa 1857118RNAArtificial SequenceSynthetic Construct 571uugcccaggu ccacaaac 1857218RNAArtificial SequenceSynthetic Construct 572ugcccagguc cacaaacu 1857318RNAArtificial SequenceSynthetic Construct 573gcccaggucc acaaacuc 1857418RNAArtificial SequenceSynthetic Construct 574cccaggucca caaacucu 1857518RNAArtificial SequenceSynthetic Construct 575ccagguccac aaacucug 1857618RNAArtificial SequenceSynthetic Construct 576cagguccaca aacucugu 1857718RNAArtificial SequenceSynthetic Construct 577agguccacaa acucuguc 1857818RNAArtificial SequenceSynthetic Construct 578gguccacaaa cucuguca

1857918RNAArtificial SequenceSynthetic Construct 579guccacaaac ucugucac 1858018RNAArtificial SequenceSynthetic Construct 580uccacaaacu cugucaca 1858118RNAArtificial SequenceSynthetic Construct 581ccacaaacuc ugucacau 1858218RNAArtificial SequenceSynthetic Construct 582cacaaacucu gucacaua 1858318RNAArtificial SequenceSynthetic Construct 583acaaacucug ucacauau 1858418RNAArtificial SequenceSynthetic Construct 584caaacucugu cacauauc 1858518RNAArtificial SequenceSynthetic Construct 585aaacucuguc acauaucu 1858618RNAArtificial SequenceSynthetic Construct 586aacucuguca cauaucug 1858718RNAArtificial SequenceSynthetic Construct 587acucugucac auaucugu 1858818RNAArtificial SequenceSynthetic Construct 588cucugucaca uaucugua 1858918RNAArtificial SequenceSynthetic Construct 589ucugucacau aucuguag 1859018RNAArtificial SequenceSynthetic Construct 590cugucacaua ucuguagu 1859117RNAArtificial SequenceSynthetic Construct 591cucaccugga auuacag 1759217RNAArtificial SequenceSynthetic Construct 592ucaccuggaa uuacaga 1759317RNAArtificial SequenceSynthetic Construct 593caccuggaau uacagag 1759417RNAArtificial SequenceSynthetic Construct 594accuggaauu acagaga 1759517RNAArtificial SequenceSynthetic Construct 595ccuggaauua cagagau 1759617RNAArtificial SequenceSynthetic Construct 596cuggaauuac agagaua 1759717RNAArtificial SequenceSynthetic Construct 597uggaauuaca gagauag 1759817RNAArtificial SequenceSynthetic Construct 598ggaauuacag agauagu 1759917RNAArtificial SequenceSynthetic Construct 599gaauuacaga gauaguu 1760017RNAArtificial SequenceSynthetic Construct 600aauuacagag auaguuu 1760117RNAArtificial SequenceSynthetic Construct 601auuacagaga uaguuuu 1760217RNAArtificial SequenceSynthetic Construct 602uuacagagau aguuuuc 1760317RNAArtificial SequenceSynthetic Construct 603uacagagaua guuuuca 1760417RNAArtificial SequenceSynthetic Construct 604acagagauag uuuucaa 1760517RNAArtificial SequenceSynthetic Construct 605cagagauagu uuucaaa 1760617RNAArtificial SequenceSynthetic Construct 606agagauaguu uucaaag 1760717RNAArtificial SequenceSynthetic Construct 607gagauaguuu ucaaagc 1760817RNAArtificial SequenceSynthetic Construct 608agauaguuuu caaagcu 1760917RNAArtificial SequenceSynthetic Construct 609gauaguuuuc aaagcuc 1761017RNAArtificial SequenceSynthetic Construct 610auaguuuuca aagcucg 1761117RNAArtificial SequenceSynthetic Construct 611uaguuuucaa agcucgg 1761217RNAArtificial SequenceSynthetic Construct 612aguuuucaaa gcucgga 1761317RNAArtificial SequenceSynthetic Construct 613guuuucaaag cucggag 1761417RNAArtificial SequenceSynthetic Construct 614uuuucaaagc ucggaga 1761517RNAArtificial SequenceSynthetic Construct 615uuucaaagcu cggagaa 1761617RNAArtificial SequenceSynthetic Construct 616uucaaagcuc ggagaac 1761717RNAArtificial SequenceSynthetic Construct 617ucaaagcucg gagaacc 1761817RNAArtificial SequenceSynthetic Construct 618caaagcucgg agaaccc 1761917RNAArtificial SequenceSynthetic Construct 619aaagcucgga gaacccu 1762017RNAArtificial SequenceSynthetic Construct 620aagcucggag aacccug 1762117RNAArtificial SequenceSynthetic Construct 621agcucggaga acccuga 1762217RNAArtificial SequenceSynthetic Construct 622gcucggagaa cccugaa 1762317RNAArtificial SequenceSynthetic Construct 623cucggagaac ccugaau 1762417RNAArtificial SequenceSynthetic Construct 624ucggagaacc cugaaug 1762517RNAArtificial SequenceSynthetic Construct 625cggagaaccc ugaaugu 1762617RNAArtificial SequenceSynthetic Construct 626ggagaacccu gaauguu 1762717RNAArtificial SequenceSynthetic Construct 627gagaacccug aauguuc 1762817RNAArtificial SequenceSynthetic Construct 628agaacccuga auguucu 1762917RNAArtificial SequenceSynthetic Construct 629gaacccugaa uguucuc 1763017RNAArtificial SequenceSynthetic Construct 630aacccugaau guucuca 1763117RNAArtificial SequenceSynthetic Construct 631acccugaaug uucucag 1763217RNAArtificial SequenceSynthetic Construct 632cccugaaugu ucucagc 1763317RNAArtificial SequenceSynthetic Construct 633ccugaauguu cucagcg 1763417RNAArtificial SequenceSynthetic Construct 634cugaauguuc ucagcgc 1763517RNAArtificial SequenceSynthetic Construct 635ugaauguucu cagcgcu 1763617RNAArtificial SequenceSynthetic Construct 636gaauguucuc agcgcug 1763717RNAArtificial SequenceSynthetic Construct 637aauguucuca gcgcuga 1763817RNAArtificial SequenceSynthetic Construct 638auguucucag cgcugag 1763917RNAArtificial SequenceSynthetic Construct 639uguucucagc gcugaga 1764017RNAArtificial SequenceSynthetic Construct 640guucucagcg cugagac 1764117RNAArtificial SequenceSynthetic Construct 641uucucagcgc ugagaca 1764217RNAArtificial SequenceSynthetic Construct 642ucucagcgcu gagacau 1764317RNAArtificial SequenceSynthetic Construct 643cucagcgcug agacauu 1764417RNAArtificial SequenceSynthetic Construct 644ucagcgcuga gacauug 1764517RNAArtificial SequenceSynthetic Construct 645cagcgcugag acauugc 1764617RNAArtificial SequenceSynthetic Construct 646agcgcugaga cauugcc 1764717RNAArtificial SequenceSynthetic Construct 647gcgcugagac auugccc 1764817RNAArtificial SequenceSynthetic Construct 648cgcugagaca uugccca 1764917RNAArtificial SequenceSynthetic Construct 649gcugagacau ugcccag 1765017RNAArtificial SequenceSynthetic Construct 650cugagacauu gcccagg 1765117RNAArtificial SequenceSynthetic Construct 651ugagacauug cccaggu 1765217RNAArtificial SequenceSynthetic Construct 652gagacauugc ccagguc 1765317RNAArtificial SequenceSynthetic Construct 653agacauugcc caggucc 1765417RNAArtificial SequenceSynthetic Construct 654gacauugccc aggucca 1765517RNAArtificial SequenceSynthetic Construct 655acauugccca gguccac 1765617RNAArtificial SequenceSynthetic Construct 656cauugcccag guccaca 1765717RNAArtificial SequenceSynthetic Construct 657auugcccagg uccacaa 1765817RNAArtificial SequenceSynthetic Construct 658uugcccaggu ccacaaa 1765917RNAArtificial SequenceSynthetic Construct 659ugcccagguc cacaaac 1766017RNAArtificial SequenceSynthetic Construct 660gcccaggucc acaaacu 1766117RNAArtificial SequenceSynthetic Construct 661cccaggucca caaacuc 1766217RNAArtificial SequenceSynthetic Construct 662ccagguccac aaacucu 1766317RNAArtificial SequenceSynthetic Construct 663cagguccaca aacucug 1766417RNAArtificial SequenceSynthetic Construct 664agguccacaa acucugu 1766517RNAArtificial SequenceSynthetic Construct 665gguccacaaa cucuguc 1766617RNAArtificial SequenceSynthetic Construct 666guccacaaac ucuguca 1766717RNAArtificial SequenceSynthetic Construct 667uccacaaacu cugucac 1766817RNAArtificial SequenceSynthetic Construct 668ccacaaacuc ugucaca 1766917RNAArtificial SequenceSynthetic Construct 669cacaaacucu gucacau 1767017RNAArtificial SequenceSynthetic Construct 670acaaacucug ucacaua 1767117RNAArtificial SequenceSynthetic Construct 671caaacucugu cacauau 1767217RNAArtificial SequenceSynthetic Construct 672aaacucuguc acauauc 1767317RNAArtificial SequenceSynthetic Construct 673aacucuguca cauaucu 1767417RNAArtificial SequenceSynthetic Construct 674acucugucac auaucug 1767517RNAArtificial SequenceSynthetic Construct 675cucugucaca uaucugu 1767617RNAArtificial SequenceSynthetic Construct 676ucugucacau aucugua 1767717RNAArtificial SequenceSynthetic Construct 677cugucacaua ucuguag 1767817RNAArtificial SequenceSynthetic Construct 678ugucacauau cuguagu 1767916RNAArtificial SequenceSynthetic Construct 679cucaccugga auuaca 1668016RNAArtificial SequenceSynthetic Construct 680ucaccuggaa uuacag 1668116RNAArtificial SequenceSynthetic Construct 681caccuggaau uacaga 1668216RNAArtificial SequenceSynthetic Construct 682accuggaauu acagag 1668316RNAArtificial SequenceSynthetic Construct 683ccuggaauua cagaga 1668416RNAArtificial SequenceSynthetic Construct 684cuggaauuac agagau 1668516RNAArtificial SequenceSynthetic Construct 685uggaauuaca gagaua 1668616RNAArtificial SequenceSynthetic Construct 686ggaauuacag agauag 1668716RNAArtificial SequenceSynthetic Construct 687gaauuacaga gauagu 1668816RNAArtificial SequenceSynthetic Construct 688aauuacagag auaguu 1668916RNAArtificial SequenceSynthetic Construct 689auuacagaga uaguuu 1669016RNAArtificial SequenceSynthetic Construct 690uuacagagau aguuuu 1669116RNAArtificial SequenceSynthetic Construct 691uacagagaua guuuuc 1669216RNAArtificial SequenceSynthetic Construct 692acagagauag uuuuca 1669316RNAArtificial SequenceSynthetic Construct 693cagagauagu uuucaa 1669416RNAArtificial SequenceSynthetic Construct 694agagauaguu uucaaa 1669516RNAArtificial SequenceSynthetic Construct 695gagauaguuu ucaaag 1669616RNAArtificial SequenceSynthetic Construct 696agauaguuuu caaagc 1669716RNAArtificial SequenceSynthetic Construct 697gauaguuuuc aaagcu 1669816RNAArtificial SequenceSynthetic Construct 698auaguuuuca aagcuc 1669916RNAArtificial SequenceSynthetic Construct 699uaguuuucaa agcucg 1670016RNAArtificial SequenceSynthetic Construct 700aguuuucaaa gcucgg 1670116RNAArtificial SequenceSynthetic Construct 701guuuucaaag cucgga 1670216RNAArtificial SequenceSynthetic Construct 702uuuucaaagc ucggag 1670316RNAArtificial SequenceSynthetic Construct 703uuucaaagcu cggaga 1670416RNAArtificial SequenceSynthetic Construct 704uucaaagcuc ggagaa 1670516RNAArtificial SequenceSynthetic Construct 705ucaaagcucg gagaac 1670616RNAArtificial SequenceSynthetic Construct 706caaagcucgg agaacc 1670716RNAArtificial SequenceSynthetic Construct 707aaagcucgga gaaccc 1670816RNAArtificial SequenceSynthetic Construct 708aagcucggag aacccu 1670916RNAArtificial SequenceSynthetic Construct 709agcucggaga acccug 1671016RNAArtificial SequenceSynthetic Construct 710gcucggagaa cccuga 1671116RNAArtificial SequenceSynthetic Construct 711cucggagaac ccugaa 1671216RNAArtificial SequenceSynthetic Construct 712ucggagaacc cugaau 1671316RNAArtificial SequenceSynthetic Construct 713cggagaaccc ugaaug 1671416RNAArtificial SequenceSynthetic Construct 714ggagaacccu gaaugu 1671516RNAArtificial SequenceSynthetic Construct 715gagaacccug aauguu 1671616RNAArtificial SequenceSynthetic Construct 716agaacccuga auguuc 1671716RNAArtificial SequenceSynthetic Construct 717gaacccugaa uguucu 1671816RNAArtificial SequenceSynthetic Construct 718aacccugaau guucuc 1671916RNAArtificial SequenceSynthetic Construct 719acccugaaug uucuca 1672016RNAArtificial SequenceSynthetic Construct 720cccugaaugu ucucag 1672116RNAArtificial SequenceSynthetic Construct 721ccugaauguu cucagc

1672216RNAArtificial SequenceSynthetic Construct 722cugaauguuc ucagcg 1672316RNAArtificial SequenceSynthetic Construct 723ugaauguucu cagcgc 1672416RNAArtificial SequenceSynthetic Construct 724gaauguucuc agcgcu 1672516RNAArtificial SequenceSynthetic Construct 725aauguucuca gcgcug 1672616RNAArtificial SequenceSynthetic Construct 726auguucucag cgcuga 1672716RNAArtificial SequenceSynthetic Construct 727uguucucagc gcugag 1672816RNAArtificial SequenceSynthetic Construct 728guucucagcg cugaga 1672916RNAArtificial SequenceSynthetic Construct 729uucucagcgc ugagac 1673016RNAArtificial SequenceSynthetic Construct 730ucucagcgcu gagaca 1673116RNAArtificial SequenceSynthetic Construct 731cucagcgcug agacau 1673216RNAArtificial SequenceSynthetic Construct 732ucagcgcuga gacauu 1673316RNAArtificial SequenceSynthetic Construct 733cagcgcugag acauug 1673416RNAArtificial SequenceSynthetic Construct 734agcgcugaga cauugc 1673516RNAArtificial SequenceSynthetic Construct 735gcgcugagac auugcc 1673616RNAArtificial SequenceSynthetic Construct 736cgcugagaca uugccc 1673716RNAArtificial SequenceSynthetic Construct 737gcugagacau ugccca 1673816RNAArtificial SequenceSynthetic Construct 738cugagacauu gcccag 1673916RNAArtificial SequenceSynthetic Construct 739ugagacauug cccagg 1674016RNAArtificial SequenceSynthetic Construct 740gagacauugc ccaggu 1674116RNAArtificial SequenceSynthetic Construct 741agacauugcc cagguc 1674216RNAArtificial SequenceSynthetic Construct 742gacauugccc aggucc 1674316RNAArtificial SequenceSynthetic Construct 743acauugccca ggucca 1674416RNAArtificial SequenceSynthetic Construct 744cauugcccag guccac 1674516RNAArtificial SequenceSynthetic Construct 745auugcccagg uccaca 1674616RNAArtificial SequenceSynthetic Construct 746uugcccaggu ccacaa 1674716RNAArtificial SequenceSynthetic Construct 747ugcccagguc cacaaa 1674816RNAArtificial SequenceSynthetic Construct 748gcccaggucc acaaac 1674916RNAArtificial SequenceSynthetic Construct 749cccaggucca caaacu 1675016RNAArtificial SequenceSynthetic Construct 750ccagguccac aaacuc 1675116RNAArtificial SequenceSynthetic Construct 751cagguccaca aacucu 1675216RNAArtificial SequenceSynthetic Construct 752agguccacaa acucug 1675316RNAArtificial SequenceSynthetic Construct 753gguccacaaa cucugu 1675416RNAArtificial SequenceSynthetic Construct 754guccacaaac ucuguc 1675516RNAArtificial SequenceSynthetic Construct 755uccacaaacu cuguca 1675616RNAArtificial SequenceSynthetic Construct 756ccacaaacuc ugucac 1675716RNAArtificial SequenceSynthetic Construct 757cacaaacucu gucaca 1675816RNAArtificial SequenceSynthetic Construct 758acaaacucug ucacau 1675916RNAArtificial SequenceSynthetic Construct 759caaacucugu cacaua 1676016RNAArtificial SequenceSynthetic Construct 760aaacucuguc acauau 1676116RNAArtificial SequenceSynthetic Construct 761aacucuguca cauauc 1676216RNAArtificial SequenceSynthetic Construct 762acucugucac auaucu 1676316RNAArtificial SequenceSynthetic Construct 763cucugucaca uaucug 1676416RNAArtificial SequenceSynthetic Construct 764ucugucacau aucugu 1676516RNAArtificial SequenceSynthetic Construct 765cugucacaua ucugua 1676616RNAArtificial SequenceSynthetic Construct 766ugucacauau cuguag 1676716RNAArtificial SequenceSynthetic Construct 767gucacauauc uguagu 1676815RNAArtificial SequenceSynthetic Construct 768cucaccugga auuac 1576915RNAArtificial SequenceSynthetic Construct 769ucaccuggaa uuaca 1577015RNAArtificial SequenceSynthetic Construct 770caccuggaau uacag 1577115RNAArtificial SequenceSynthetic Construct 771accuggaauu acaga 1577215RNAArtificial SequenceSynthetic Construct 772ccuggaauua cagag 1577315RNAArtificial SequenceSynthetic Construct 773cuggaauuac agaga 1577415RNAArtificial SequenceSynthetic Construct 774uggaauuaca gagau 1577515RNAArtificial SequenceSynthetic Construct 775ggaauuacag agaua 1577615RNAArtificial SequenceSynthetic Construct 776gaauuacaga gauag 1577715RNAArtificial SequenceSynthetic Construct 777aauuacagag auagu 1577815RNAArtificial SequenceSynthetic Construct 778auuacagaga uaguu 1577915RNAArtificial SequenceSynthetic Construct 779uuacagagau aguuu 1578015RNAArtificial SequenceSynthetic Construct 780uacagagaua guuuu 1578115RNAArtificial SequenceSynthetic Construct 781acagagauag uuuuc 1578215RNAArtificial SequenceSynthetic Construct 782cagagauagu uuuca 1578315RNAArtificial SequenceSynthetic Construct 783agagauaguu uucaa 1578415RNAArtificial SequenceSynthetic Construct 784gagauaguuu ucaaa 1578515RNAArtificial SequenceSynthetic Construct 785agauaguuuu caaag 1578615RNAArtificial SequenceSynthetic Construct 786gauaguuuuc aaagc 1578715RNAArtificial SequenceSynthetic Construct 787auaguuuuca aagcu 1578815RNAArtificial SequenceSynthetic Construct 788uaguuuucaa agcuc 1578915RNAArtificial SequenceSynthetic Construct 789aguuuucaaa gcucg 1579015RNAArtificial SequenceSynthetic Construct 790guuuucaaag cucgg 1579115RNAArtificial SequenceSynthetic Construct 791uuuucaaagc ucgga 1579215RNAArtificial SequenceSynthetic Construct 792uuucaaagcu cggag 1579315RNAArtificial SequenceSynthetic Construct 793uucaaagcuc ggaga 1579415RNAArtificial SequenceSynthetic Construct 794ucaaagcucg gagaa 1579515RNAArtificial SequenceSynthetic Construct 795caaagcucgg agaac 1579615RNAArtificial SequenceSynthetic Construct 796aaagcucgga gaacc 1579715RNAArtificial SequenceSynthetic Construct 797aagcucggag aaccc 1579815RNAArtificial SequenceSynthetic Construct 798agcucggaga acccu 1579915RNAArtificial SequenceSynthetic Construct 799gcucggagaa cccug 1580015RNAArtificial SequenceSynthetic Construct 800cucggagaac ccuga 1580115RNAArtificial SequenceSynthetic Construct 801ucggagaacc cugaa 1580215RNAArtificial SequenceSynthetic Construct 802cggagaaccc ugaau 1580315RNAArtificial SequenceSynthetic Construct 803ggagaacccu gaaug 1580415RNAArtificial SequenceSynthetic Construct 804gagaacccug aaugu 1580515RNAArtificial SequenceSynthetic Construct 805agaacccuga auguu 1580615RNAArtificial SequenceSynthetic Construct 806gaacccugaa uguuc 1580715RNAArtificial SequenceSynthetic Construct 807aacccugaau guucu 1580815RNAArtificial SequenceSynthetic Construct 808acccugaaug uucuc 1580915RNAArtificial SequenceSynthetic Construct 809cccugaaugu ucuca 1581015RNAArtificial SequenceSynthetic Construct 810ccugaauguu cucag 1581115RNAArtificial SequenceSynthetic Construct 811cugaauguuc ucagc 1581215RNAArtificial SequenceSynthetic Construct 812ugaauguucu cagcg 1581315RNAArtificial SequenceSynthetic Construct 813gaauguucuc agcgc 1581415RNAArtificial SequenceSynthetic Construct 814aauguucuca gcgcu 1581515RNAArtificial SequenceSynthetic Construct 815auguucucag cgcug 1581615RNAArtificial SequenceSynthetic Construct 816uguucucagc gcuga 1581715RNAArtificial SequenceSynthetic Construct 817guucucagcg cugag 1581815RNAArtificial SequenceSynthetic Construct 818uucucagcgc ugaga 1581915RNAArtificial SequenceSynthetic Construct 819ucucagcgcu gagac 1582015RNAArtificial SequenceSynthetic Construct 820cucagcgcug agaca 1582115RNAArtificial SequenceSynthetic Construct 821ucagcgcuga gacau 1582215RNAArtificial SequenceSynthetic Construct 822cagcgcugag acauu 1582315RNAArtificial SequenceSynthetic Construct 823agcgcugaga cauug 1582415RNAArtificial SequenceSynthetic Construct 824gcgcugagac auugc 1582515RNAArtificial SequenceSynthetic Construct 825cgcugagaca uugcc 1582615RNAArtificial SequenceSynthetic Construct 826gcugagacau ugccc 1582715RNAArtificial SequenceSynthetic Construct 827cugagacauu gccca 1582815RNAArtificial SequenceSynthetic Construct 828ugagacauug cccag 1582915RNAArtificial SequenceSynthetic Construct 829gagacauugc ccagg 1583015RNAArtificial SequenceSynthetic Construct 830agacauugcc caggu 1583115RNAArtificial SequenceSynthetic Construct 831gacauugccc agguc 1583215RNAArtificial SequenceSynthetic Construct 832acauugccca ggucc 1583315RNAArtificial SequenceSynthetic Construct 833cauugcccag gucca 1583415RNAArtificial SequenceSynthetic Construct 834auugcccagg uccac 1583515RNAArtificial SequenceSynthetic Construct 835uugcccaggu ccaca 1583615RNAArtificial SequenceSynthetic Construct 836ugcccagguc cacaa 1583715RNAArtificial SequenceSynthetic Construct 837gcccaggucc acaaa 1583815RNAArtificial SequenceSynthetic Construct 838cccaggucca caaac 1583915RNAArtificial SequenceSynthetic Construct 839ccagguccac aaacu 1584015RNAArtificial SequenceSynthetic Construct 840cagguccaca aacuc 1584115RNAArtificial SequenceSynthetic Construct 841agguccacaa acucu 1584215RNAArtificial SequenceSynthetic Construct 842gguccacaaa cucug 1584315RNAArtificial SequenceSynthetic Construct 843guccacaaac ucugu 1584415RNAArtificial SequenceSynthetic Construct 844uccacaaacu cuguc 1584515RNAArtificial SequenceSynthetic Construct 845ccacaaacuc uguca 1584615RNAArtificial SequenceSynthetic Construct 846cacaaacucu gucac 1584715RNAArtificial SequenceSynthetic Construct 847acaaacucug ucaca 1584815RNAArtificial SequenceSynthetic Construct 848caaacucugu cacau 1584915RNAArtificial SequenceSynthetic Construct 849aaacucuguc acaua 1585015RNAArtificial SequenceSynthetic Construct 850aacucuguca cauau 1585115RNAArtificial SequenceSynthetic Construct 851acucugucac auauc 1585215RNAArtificial SequenceSynthetic Construct 852cucugucaca uaucu 1585315RNAArtificial SequenceSynthetic Construct 853ucugucacau aucug 1585415RNAArtificial SequenceSynthetic Construct 854cugucacaua ucugu 1585515RNAArtificial SequenceSynthetic Construct 855ugucacauau cugua 1585615RNAArtificial SequenceSynthetic Construct 856gucacauauc uguag 1585715RNAArtificial SequenceSynthetic Construct 857ucacauaucu guagu 1585829DNAHomo sapiens 858ttgtcaaagg tgaccgtacg tcttcctag 2985929RNAHomo sapiens 859aacaguuucc acuggcaugc agaaggauc 2986024RNAArtificial SequenceSynthetic Construct 860aacaguuucc acuggcaugc agaa 2486124RNAArtificial SequenceSynthetic Construct 861acaguuucca cuggcaugca gaag 2486224RNAArtificial SequenceSynthetic Construct 862caguuuccac uggcaugcag aagg 2486324RNAArtificial SequenceSynthetic Construct 863aguuuccacu ggcaugcaga agga 2486424RNAArtificial SequenceSynthetic Construct 864guuuccacug gcaugcagaa ggau 2486524RNAArtificial SequenceSynthetic Construct 865uuuccacugg caugcagaag gauc

2486623RNAArtificial SequenceSynthetic Construct 866aacaguuucc acuggcaugc aga 2386723RNAArtificial SequenceSynthetic Construct 867acaguuucca cuggcaugca gaa 2386823RNAArtificial SequenceSynthetic Construct 868caguuuccac uggcaugcag aag 2386923RNAArtificial SequenceSynthetic Construct 869aguuuccacu ggcaugcaga agg 2387023RNAArtificial SequenceSynthetic Construct 870guuuccacug gcaugcagaa gga 2387123RNAArtificial SequenceSynthetic Construct 871uuuccacugg caugcagaag gau 2387223RNAArtificial SequenceSynthetic Construct 872uuccacuggc augcagaagg auc 2387322RNAArtificial SequenceSynthetic Construct 873aacaguuucc acuggcaugc ag 2287422RNAArtificial SequenceSynthetic Construct 874acaguuucca cuggcaugca ga 2287522RNAArtificial SequenceSynthetic Construct 875caguuuccac uggcaugcag aa 2287622RNAArtificial SequenceSynthetic Construct 876aguuuccacu ggcaugcaga ag 2287722RNAArtificial SequenceSynthetic Construct 877aguuuccacu ggcaugcaga ag 2287822RNAArtificial SequenceSynthetic Construct 878guuuccacug gcaugcagaa gg 2287922RNAArtificial SequenceSynthetic Construct 879uuccacuggc augcagaagg au 2288022RNAArtificial SequenceSynthetic Construct 880uccacuggca ugcagaagga uc 2288121RNAArtificial SequenceSynthetic Construct 881aacaguuucc acuggcaugc a 2188221RNAArtificial SequenceSynthetic Construct 882acaguuucca cuggcaugca g 2188321RNAArtificial SequenceSynthetic Construct 883caguuuccac uggcaugcag a 2188421RNAArtificial SequenceSynthetic Construct 884aguuuccacu ggcaugcaga a 2188521RNAArtificial SequenceSynthetic Construct 885guuuccacug gcaugcagaa g 2188621RNAArtificial SequenceSynthetic Construct 886uuuccacugg caugcagaag g 2188721RNAArtificial SequenceSynthetic Construct 887uuccacuggc augcagaagg a 2188821RNAArtificial SequenceSynthetic Construct 888uccacuggca ugcagaagga u 2188921RNAArtificial SequenceSynthetic Construct 889ccacuggcau gcagaaggau c 2189020RNAArtificial SequenceSynthetic Construct 890aacaguuucc acuggcaugc 2089120RNAArtificial SequenceSynthetic Construct 891acaguuucca cuggcaugca 2089220RNAArtificial SequenceSynthetic Construct 892caguuuccac uggcaugcag 2089320RNAArtificial SequenceSynthetic Construct 893aguuuccacu ggcaugcaga 2089420RNAArtificial SequenceSynthetic Construct 894guuuccacug gcaugcagaa 2089520RNAArtificial SequenceSynthetic Construct 895uuuccacugg caugcagaag 2089620RNAArtificial SequenceSynthetic Construct 896uuccacuggc augcagaagg 2089720RNAArtificial SequenceSynthetic Construct 897uccacuggca ugcagaagga 2089820RNAArtificial SequenceSynthetic Construct 898ccacuggcau gcagaaggau 2089920RNAArtificial SequenceSynthetic Construct 899cacuggcaug cagaaggauc 2090019RNAArtificial SequenceSynthetic Construct 900aacaguuucc acuggcaug 1990119RNAArtificial SequenceSynthetic Construct 901acaguuucca cuggcaugc 1990219RNAArtificial SequenceSynthetic Construct 902caguuuccac uggcaugca 1990319RNAArtificial SequenceSynthetic Construct 903aguuuccacu ggcaugcag 1990419RNAArtificial SequenceSynthetic Construct 904guuuccacug gcaugcaga 1990519RNAArtificial SequenceSynthetic Construct 905uuuccacugg caugcagaa 1990619RNAArtificial SequenceSynthetic Construct 906uuccacuggc augcagaag 1990719RNAArtificial SequenceSynthetic Construct 907uccacuggca ugcagaagg 1990819RNAArtificial SequenceSynthetic Construct 908ccacuggcau gcagaagga 1990919RNAArtificial SequenceSynthetic Construct 909cacuggcaug cagaaggau 1991019RNAArtificial SequenceSynthetic Construct 910acuggcaugc agaaggauc 1991118RNAArtificial SequenceSynthetic Construct 911aacaguuucc acuggcau 1891218RNAArtificial SequenceSynthetic Construct 912acaguuucca cuggcaug 1891318RNAArtificial SequenceSynthetic Construct 913caguuuccac uggcaugc 1891418RNAArtificial SequenceSynthetic Construct 914aguuuccacu ggcaugca 1891518RNAArtificial SequenceSynthetic Construct 915guuuccacug gcaugcag 1891618RNAArtificial SequenceSynthetic Construct 916uuuccacugg caugcaga 1891718RNAArtificial SequenceSynthetic Construct 917uuccacuggc augcagaa 1891818RNAArtificial SequenceSynthetic Construct 918uccacuggca ugcagaag 1891918RNAArtificial SequenceSynthetic Construct 919ccacuggcau gcagaagg 1892018RNAArtificial SequenceSynthetic Construct 920cacuggcaug cagaagga 1892118RNAArtificial SequenceSynthetic Construct 921acuggcaugc agaaggau 1892218RNAArtificial SequenceSynthetic Construct 922cuggcaugca gaaggauc 1892317RNAArtificial SequenceSynthetic Construct 923aacaguuucc acuggca 1792417RNAArtificial SequenceSynthetic Construct 924acaguuucca cuggcau 1792517RNAArtificial SequenceSynthetic Construct 925caguuuccac uggcaug 1792617RNAArtificial SequenceSynthetic Construct 926aguuuccacu ggcaugc 1792717RNAArtificial SequenceSynthetic Construct 927guuuccacug gcaugca 1792817RNAArtificial SequenceSynthetic Construct 928uuuccacugg caugcag 1792917RNAArtificial SequenceSynthetic Construct 929uuccacuggc augcaga 1793017RNAArtificial SequenceSynthetic Construct 930uccacuggca ugcagaa 1793117RNAArtificial SequenceSynthetic Construct 931ccacuggcau gcagaag 1793217RNAArtificial SequenceSynthetic Construct 932cacuggcaug cagaagg 1793317RNAArtificial SequenceSynthetic Construct 933acuggcaugc agaagga 1793417RNAArtificial SequenceSynthetic Construct 934cuggcaugca gaaggau 1793517RNAArtificial SequenceSynthetic Construct 935uggcaugcag aaggauc 1793616RNAArtificial SequenceSynthetic Construct 936aacaguuucc acuggc 1693716RNAArtificial SequenceSynthetic Construct 937acaguuucca cuggca 1693816RNAArtificial SequenceSynthetic Construct 938caguuuccac uggcau 1693916RNAArtificial SequenceSynthetic Construct 939aguuuccacu ggcaug 1694016RNAArtificial SequenceSynthetic Construct 940guuuccacug gcaugc 1694116RNAArtificial SequenceSynthetic Construct 941uuuccacugg caugca 1694216RNAArtificial SequenceSynthetic Construct 942uuccacuggc augcag 1694316RNAArtificial SequenceSynthetic Construct 943uccacuggca ugcaga 1694416RNAArtificial SequenceSynthetic Construct 944ccacuggcau gcagaa 1694516RNAArtificial SequenceSynthetic Construct 945cacuggcaug cagaag 1694616RNAArtificial SequenceSynthetic Construct 946acuggcaugc agaagg 1694716RNAArtificial SequenceSynthetic Construct 947cuggcaugca gaagga 1694816RNAArtificial SequenceSynthetic Construct 948uggcaugcag aaggau 1694916RNAArtificial SequenceSynthetic Construct 949ggcaugcaga aggauc 1695015RNAArtificial SequenceSynthetic Construct 950aacaguuucc acugg 1595115RNAArtificial SequenceSynthetic Construct 951acaguuucca cuggc 1595215RNAArtificial SequenceSynthetic Construct 952caguuuccac uggca 1595315RNAArtificial SequenceSynthetic Construct 953aguuuccacu ggcau 1595415RNAArtificial SequenceSynthetic Construct 954guuuccacug gcaug 1595515RNAArtificial SequenceSynthetic Construct 955uuuccacugg caugc 1595615RNAArtificial SequenceSynthetic Construct 956uuccacuggc augca 1595715RNAArtificial SequenceSynthetic Construct 957uccacuggca ugcag 1595815RNAArtificial SequenceSynthetic Construct 958ccacuggcau gcaga 1595915RNAArtificial SequenceSynthetic Construct 959cacuggcaug cagaa 1596015RNAArtificial SequenceSynthetic Construct 960acuggcaugc agaag 1596115RNAArtificial SequenceSynthetic Construct 961cuggcaugca gaagg 1596215RNAArtificial SequenceSynthetic Construct 962uggcaugcag aagga 1596315RNAArtificial SequenceSynthetic Construct 963ggcaugcaga aggau 1596415RNAArtificial SequenceSynthetic Construct 964gcaugcagaa ggauc 1596547DNAHomo sapiens 965agaatgggag tagggaagtt tagcactatt ccgagaattc ccagagt 4796647RNAHomo sapiens 966ucuuacccuc aucccuucaa aucgugauaa ggcucuuaag ggucuca 4796724RNAArtificial SequenceSynthetic Construct 967ucuuacccuc aucccuucaa aucg 2496824RNAArtificial SequenceSynthetic Construct 968cuuacccuca ucccuucaaa ucgu 2496924RNAArtificial SequenceSynthetic Construct 969uuacccucau cccuucaaau cgug 2497024RNAArtificial SequenceSynthetic Construct 970uacccucauc ccuucaaauc guga 2497124RNAArtificial SequenceSynthetic Construct 971acccucaucc cuucaaaucg ugau 2497224RNAArtificial SequenceSynthetic Construct 972cccucauccc uucaaaucgu gaua 2497324RNAArtificial SequenceSynthetic Construct 973ccucaucccu ucaaaucgug auaa 2497424RNAArtificial SequenceSynthetic Construct 974cucaucccuu caaaucguga uaag 2497524RNAArtificial SequenceSynthetic Construct 975ucaucccuuc aaaucgugau aagg 2497624RNAArtificial SequenceSynthetic Construct 976caucccuuca aaucgugaua aggc 2497724RNAArtificial SequenceSynthetic Construct 977aucccuucaa aucgugauaa ggcu 2497824RNAArtificial SequenceSynthetic Construct 978ucccuucaaa ucgugauaag gcuc 2497924RNAArtificial SequenceSynthetic Construct 979cccuucaaau cgugauaagg cucu 2498024RNAArtificial SequenceSynthetic Construct 980ccuucaaauc gugauaaggc ucuu 2498124RNAArtificial SequenceSynthetic Construct 981cuucaaaucg ugauaaggcu cuua 2498224RNAArtificial SequenceSynthetic Construct 982uucaaaucgu gauaaggcuc uuaa 2498324RNAArtificial SequenceSynthetic Construct 983ucaaaucgug auaaggcucu uaag 2498424RNAArtificial SequenceSynthetic Construct 984caaaucguga uaaggcucuu aagg 2498524RNAArtificial SequenceSynthetic Construct 985aaaucgugau aaggcucuua aggg 2498624RNAArtificial SequenceSynthetic Construct 986aaucgugaua aggcucuuaa gggu 2498724RNAArtificial SequenceSynthetic Construct 987aucgugauaa ggcucuuaag gguc 2498824RNAArtificial SequenceSynthetic Construct 988ucgugauaag gcucuuaagg gucu 2498924RNAArtificial SequenceSynthetic Construct 989cgugauaagg cucuuaaggg ucuc 2499024RNAArtificial SequenceSynthetic Construct 990gugauaaggc ucuuaagggu cuca 2499123RNAArtificial SequenceSynthetic Construct 991ucuuacccuc aucccuucaa auc 2399223RNAArtificial SequenceSynthetic Construct 992cuuacccuca ucccuucaaa ucg 2399323RNAArtificial SequenceSynthetic Construct 993uuacccucau cccuucaaau cgu 2399423RNAArtificial SequenceSynthetic Construct 994uacccucauc ccuucaaauc gug 2399523RNAArtificial SequenceSynthetic Construct 995acccucaucc cuucaaaucg uga 2399623RNAArtificial SequenceSynthetic Construct 996cccucauccc uucaaaucgu gau 2399723RNAArtificial SequenceSynthetic Construct 997ccucaucccu ucaaaucgug aua 2399823RNAArtificial SequenceSynthetic Construct 998cucaucccuu caaaucguga uaa 2399923RNAArtificial SequenceSynthetic Construct 999ucaucccuuc aaaucgugau aag 23100023RNAArtificial SequenceSynthetic Construct 1000caucccuuca aaucgugaua agg 23100123RNAArtificial SequenceSynthetic Construct 1001aucccuucaa aucgugauaa ggc 23100223RNAArtificial SequenceSynthetic Construct 1002ucccuucaaa ucgugauaag gcu 23100323RNAArtificial SequenceSynthetic Construct 1003cccuucaaau cgugauaagg cuc 23100423RNAArtificial SequenceSynthetic Construct 1004ccuucaaauc gugauaaggc ucu 23100523RNAArtificial SequenceSynthetic Construct 1005cuucaaaucg ugauaaggcu cuu 23100623RNAArtificial SequenceSynthetic Construct 1006uucaaaucgu gauaaggcuc uua 23100723RNAArtificial SequenceSynthetic Construct 1007ucaaaucgug auaaggcucu uaa 23100823RNAArtificial SequenceSynthetic Construct 1008caaaucguga uaaggcucuu aag

23100923RNAArtificial SequenceSynthetic Construct 1009aaaucgugau aaggcucuua agg 23101023RNAArtificial SequenceSynthetic Construct 1010aaucgugaua aggcucuuaa ggg 23101123RNAArtificial SequenceSynthetic Construct 1011aucgugauaa ggcucuuaag ggu 23101223RNAArtificial SequenceSynthetic Construct 1012ucgugauaag gcucuuaagg guc 23101323RNAArtificial SequenceSynthetic Construct 1013cgugauaagg cucuuaaggg ucu 23101423RNAArtificial SequenceSynthetic Construct 1014gugauaaggc ucuuaagggu cuc 23101523RNAArtificial SequenceSynthetic Construct 1015ugauaaggcu cuuaaggguc uca 23101622RNAArtificial SequenceSynthetic Construct 1016ucuuacccuc aucccuucaa au 22101722RNAArtificial SequenceSynthetic Construct 1017cuuacccuca ucccuucaaa uc 22101822RNAArtificial SequenceSynthetic Construct 1018uuacccucau cccuucaaau cg 22101922RNAArtificial SequenceSynthetic Construct 1019uacccucauc ccuucaaauc gu 22102022RNAArtificial SequenceSynthetic Construct 1020uacccucauc ccuucaaauc gu 22102122RNAArtificial SequenceSynthetic Construct 1021acccucaucc cuucaaaucg ug 22102222RNAArtificial SequenceSynthetic Construct 1022ccucaucccu ucaaaucgug au 22102322RNAArtificial SequenceSynthetic Construct 1023cucaucccuu caaaucguga ua 22102422RNAArtificial SequenceSynthetic Construct 1024ucaucccuuc aaaucgugau aa 22102522RNAArtificial SequenceSynthetic Construct 1025caucccuuca aaucgugaua ag 22102622RNAArtificial SequenceSynthetic Construct 1026aucccuucaa aucgugauaa gg 22102722RNAArtificial SequenceSynthetic Construct 1027ucccuucaaa ucgugauaag gc 22102822RNAArtificial SequenceSynthetic Construct 1028cccuucaaau cgugauaagg cu 22102922RNAArtificial SequenceSynthetic Construct 1029ccuucaaauc gugauaaggc uc 22103022RNAArtificial SequenceSynthetic Construct 1030cuucaaaucg ugauaaggcu cu 22103122RNAArtificial SequenceSynthetic Construct 1031uucaaaucgu gauaaggcuc uu 22103222RNAArtificial SequenceSynthetic Construct 1032ucaaaucgug auaaggcucu ua 22103322RNAArtificial SequenceSynthetic Construct 1033caaaucguga uaaggcucuu aa 22103422RNAArtificial SequenceSynthetic Construct 1034aaaucgugau aaggcucuua ag 22103522RNAArtificial SequenceSynthetic Construct 1035aaucgugaua aggcucuuaa gg 22103622RNAArtificial SequenceSynthetic Construct 1036aucgugauaa ggcucuuaag gg 22103722RNAArtificial SequenceSynthetic Construct 1037ucgugauaag gcucuuaagg gu 22103822RNAArtificial SequenceSynthetic Construct 1038cgugauaagg cucuuaaggg uc 22103922RNAArtificial SequenceSynthetic Construct 1039gugauaaggc ucuuaagggu cu 22104022RNAArtificial SequenceSynthetic Construct 1040ugauaaggcu cuuaaggguc uc 22104122RNAArtificial SequenceSynthetic Construct 1041gauaaggcuc uuaagggucu ca 22104221RNAArtificial SequenceSynthetic Construct 1042ucuuacccuc aucccuucaa a 21104321RNAArtificial SequenceSynthetic Construct 1043cuuacccuca ucccuucaaa u 21104421RNAArtificial SequenceSynthetic Construct 1044uuacccucau cccuucaaau c 21104521RNAArtificial SequenceSynthetic Construct 1045uacccucauc ccuucaaauc g 21104621RNAArtificial SequenceSynthetic Construct 1046acccucaucc cuucaaaucg u 21104721RNAArtificial SequenceSynthetic Construct 1047cccucauccc uucaaaucgu g 21104821RNAArtificial SequenceSynthetic Construct 1048ccucaucccu ucaaaucgug a 21104921RNAArtificial SequenceSynthetic Construct 1049cucaucccuu caaaucguga u 21105021RNAArtificial SequenceSynthetic Construct 1050ucaucccuuc aaaucgugau a 21105121RNAArtificial SequenceSynthetic Construct 1051caucccuuca aaucgugaua a 21105221RNAArtificial SequenceSynthetic Construct 1052aucccuucaa aucgugauaa g 21105321RNAArtificial SequenceSynthetic Construct 1053ucccuucaaa ucgugauaag g 21105421RNAArtificial SequenceSynthetic Construct 1054cccuucaaau cgugauaagg c 21105521RNAArtificial SequenceSynthetic Construct 1055ccuucaaauc gugauaaggc u 21105621RNAArtificial SequenceSynthetic Construct 1056cuucaaaucg ugauaaggcu c 21105721RNAArtificial SequenceSynthetic Construct 1057uucaaaucgu gauaaggcuc u 21105821RNAArtificial SequenceSynthetic Construct 1058ucaaaucgug auaaggcucu u 21105921RNAArtificial SequenceSynthetic Construct 1059caaaucguga uaaggcucuu a 21106021RNAArtificial SequenceSynthetic Construct 1060aaaucgugau aaggcucuua a 21106121RNAArtificial SequenceSynthetic Construct 1061aaucgugaua aggcucuuaa g 21106221RNAArtificial SequenceSynthetic Construct 1062aucgugauaa ggcucuuaag g 21106321RNAArtificial SequenceSynthetic Construct 1063ucgugauaag gcucuuaagg g 21106421RNAArtificial SequenceSynthetic Construct 1064cgugauaagg cucuuaaggg u 21106521RNAArtificial SequenceSynthetic Construct 1065gugauaaggc ucuuaagggu c 21106621RNAArtificial SequenceSynthetic Construct 1066ugauaaggcu cuuaaggguc u 21106721RNAArtificial SequenceSynthetic Construct 1067gauaaggcuc uuaagggucu c 21106821RNAArtificial SequenceSynthetic Construct 1068auaaggcucu uaagggucuc a 21106920RNAArtificial SequenceSynthetic Construct 1069ucuuacccuc aucccuucaa 20107020RNAArtificial SequenceSynthetic Construct 1070cuuacccuca ucccuucaaa 20107120RNAArtificial SequenceSynthetic Construct 1071uuacccucau cccuucaaau 20107220RNAArtificial SequenceSynthetic Construct 1072uacccucauc ccuucaaauc 20107320RNAArtificial SequenceSynthetic Construct 1073acccucaucc cuucaaaucg 20107420RNAArtificial SequenceSynthetic Construct 1074cccucauccc uucaaaucgu 20107520RNAArtificial SequenceSynthetic Construct 1075ccucaucccu ucaaaucgug 20107620RNAArtificial SequenceSynthetic Construct 1076cucaucccuu caaaucguga 20107720RNAArtificial SequenceSynthetic Construct 1077ucaucccuuc aaaucgugau 20107820RNAArtificial SequenceSynthetic Construct 1078caucccuuca aaucgugaua 20107920RNAArtificial SequenceSynthetic Construct 1079aucccuucaa aucgugauaa 20108020RNAArtificial SequenceSynthetic Construct 1080ucccuucaaa ucgugauaag 20108120RNAArtificial SequenceSynthetic Construct 1081cccuucaaau cgugauaagg 20108220RNAArtificial SequenceSynthetic Construct 1082ccuucaaauc gugauaaggc 20108320RNAArtificial SequenceSynthetic Construct 1083cuucaaaucg ugauaaggcu 20108420RNAArtificial SequenceSynthetic Construct 1084uucaaaucgu gauaaggcuc 20108520RNAArtificial SequenceSynthetic Construct 1085ucaaaucgug auaaggcucu 20108620RNAArtificial SequenceSynthetic Construct 1086caaaucguga uaaggcucuu 20108720RNAArtificial SequenceSynthetic Construct 1087aaaucgugau aaggcucuua 20108820RNAArtificial SequenceSynthetic Construct 1088aaucgugaua aggcucuuaa 20108920RNAArtificial SequenceSynthetic Construct 1089aucgugauaa ggcucuuaag 20109020RNAArtificial SequenceSynthetic Construct 1090ucgugauaag gcucuuaagg 20109120RNAArtificial SequenceSynthetic Construct 1091cgugauaagg cucuuaaggg 20109220RNAArtificial SequenceSynthetic Construct 1092gugauaaggc ucuuaagggu 20109320RNAArtificial SequenceSynthetic Construct 1093ugauaaggcu cuuaaggguc 20109420RNAArtificial SequenceSynthetic Construct 1094gauaaggcuc uuaagggucu 20109520RNAArtificial SequenceSynthetic Construct 1095auaaggcucu uaagggucuc 20109620RNAArtificial SequenceSynthetic Construct 1096uaaggcucuu aagggucuca 20109719RNAArtificial SequenceSynthetic Construct 1097ucuuacccuc aucccuuca 19109819RNAArtificial SequenceSynthetic Construct 1098cuuacccuca ucccuucaa 19109919RNAArtificial SequenceSynthetic Construct 1099uuacccucau cccuucaaa 19110019RNAArtificial SequenceSynthetic Construct 1100uacccucauc ccuucaaau 19110119RNAArtificial SequenceSynthetic Construct 1101acccucaucc cuucaaauc 19110219RNAArtificial SequenceSynthetic Construct 1102cccucauccc uucaaaucg 19110319RNAArtificial SequenceSynthetic Construct 1103ccucaucccu ucaaaucgu 19110419RNAArtificial SequenceSynthetic Construct 1104cucaucccuu caaaucgug 19110519RNAArtificial SequenceSynthetic Construct 1105ucaucccuuc aaaucguga 19110619RNAArtificial SequenceSynthetic Construct 1106caucccuuca aaucgugau 19110719RNAArtificial SequenceSynthetic Construct 1107aucccuucaa aucgugaua 19110819RNAArtificial SequenceSynthetic Construct 1108ucccuucaaa ucgugauaa 19110919RNAArtificial SequenceSynthetic Construct 1109cccuucaaau cgugauaag 19111019RNAArtificial SequenceSynthetic Construct 1110ccuucaaauc gugauaagg 19111119RNAArtificial SequenceSynthetic Construct 1111cuucaaaucg ugauaaggc 19111219RNAArtificial SequenceSynthetic Construct 1112uucaaaucgu gauaaggcu 19111319RNAArtificial SequenceSynthetic Construct 1113ucaaaucgug auaaggcuc 19111419RNAArtificial SequenceSynthetic Construct 1114caaaucguga uaaggcucu 19111519RNAArtificial SequenceSynthetic Construct 1115aaaucgugau aaggcucuu 19111619RNAArtificial SequenceSynthetic Construct 1116aaucgugaua aggcucuua 19111719RNAArtificial SequenceSynthetic Construct 1117aucgugauaa ggcucuuaa 19111819RNAArtificial SequenceSynthetic Construct 1118ucgugauaag gcucuuaag 19111919RNAArtificial SequenceSynthetic Construct 1119cgugauaagg cucuuaagg 19112019RNAArtificial SequenceSynthetic Construct 1120gugauaaggc ucuuaaggg 19112119RNAArtificial SequenceSynthetic Construct 1121ugauaaggcu cuuaagggu 19112219RNAArtificial SequenceSynthetic Construct 1122gauaaggcuc uuaaggguc 19112319RNAArtificial SequenceSynthetic Construct 1123auaaggcucu uaagggucu 19112419RNAArtificial SequenceSynthetic Construct 1124uaaggcucuu aagggucuc 19112519RNAArtificial SequenceSynthetic Construct 1125aaggcucuua agggucuca 19112618RNAArtificial SequenceSynthetic Construct 1126ucuuacccuc aucccuuc 18112718RNAArtificial SequenceSynthetic Construct 1127cuuacccuca ucccuuca 18112818RNAArtificial SequenceSynthetic Construct 1128uuacccucau cccuucaa 18112918RNAArtificial SequenceSynthetic Construct 1129uacccucauc ccuucaaa 18113018RNAArtificial SequenceSynthetic Construct 1130acccucaucc cuucaaau 18113118RNAArtificial SequenceSynthetic Construct 1131cccucauccc uucaaauc 18113218RNAArtificial SequenceSynthetic Construct 1132ccucaucccu ucaaaucg 18113318RNAArtificial SequenceSynthetic Construct 1133cucaucccuu caaaucgu 18113418RNAArtificial SequenceSynthetic Construct 1134ucaucccuuc aaaucgug 18113518RNAArtificial SequenceSynthetic Construct 1135caucccuuca aaucguga

18113618RNAArtificial SequenceSynthetic Construct 1136aucccuucaa aucgugau 18113718RNAArtificial SequenceSynthetic Construct 1137ucccuucaaa ucgugaua 18113818RNAArtificial SequenceSynthetic Construct 1138cccuucaaau cgugauaa 18113918RNAArtificial SequenceSynthetic Construct 1139ccuucaaauc gugauaag 18114018RNAArtificial SequenceSynthetic Construct 1140cuucaaaucg ugauaagg 18114118RNAArtificial SequenceSynthetic Construct 1141uucaaaucgu gauaaggc 18114218RNAArtificial SequenceSynthetic Construct 1142ucaaaucgug auaaggcu 18114318RNAArtificial SequenceSynthetic Construct 1143caaaucguga uaaggcuc 18114418RNAArtificial SequenceSynthetic Construct 1144aaaucgugau aaggcucu 18114518RNAArtificial SequenceSynthetic Construct 1145aaucgugaua aggcucuu 18114618RNAArtificial SequenceSynthetic Construct 1146aucgugauaa ggcucuua 18114718RNAArtificial SequenceSynthetic Construct 1147ucgugauaag gcucuuaa 18114818RNAArtificial SequenceSynthetic Construct 1148cgugauaagg cucuuaag 18114918RNAArtificial SequenceSynthetic Construct 1149gugauaaggc ucuuaagg 18115018RNAArtificial SequenceSynthetic Construct 1150ugauaaggcu cuuaaggg 18115118RNAArtificial SequenceSynthetic Construct 1151gauaaggcuc uuaagggu 18115218RNAArtificial SequenceSynthetic Construct 1152auaaggcucu uaaggguc 18115318RNAArtificial SequenceSynthetic Construct 1153uaaggcucuu aagggucu 18115418RNAArtificial SequenceSynthetic Construct 1154aaggcucuua agggucuc 18115518RNAArtificial SequenceSynthetic Construct 1155aggcucuuaa gggucuca 18115617RNAArtificial SequenceSynthetic Construct 1156ucuuacccuc aucccuu 17115717RNAArtificial SequenceSynthetic Construct 1157cuuacccuca ucccuuc 17115817RNAArtificial SequenceSynthetic Construct 1158uuacccucau cccuuca 17115917RNAArtificial SequenceSynthetic Construct 1159uacccucauc ccuucaa 17116017RNAArtificial SequenceSynthetic Construct 1160acccucaucc cuucaaa 17116117RNAArtificial SequenceSynthetic Construct 1161cccucauccc uucaaau 17116217RNAArtificial SequenceSynthetic Construct 1162ccucaucccu ucaaauc 17116317RNAArtificial SequenceSynthetic Construct 1163cucaucccuu caaaucg 17116417RNAArtificial SequenceSynthetic Construct 1164ucaucccuuc aaaucgu 17116517RNAArtificial SequenceSynthetic Construct 1165caucccuuca aaucgug 17116617RNAArtificial SequenceSynthetic Construct 1166aucccuucaa aucguga 17116717RNAArtificial SequenceSynthetic Construct 1167ucccuucaaa ucgugau 17116817RNAArtificial SequenceSynthetic Construct 1168cccuucaaau cgugaua 17116917RNAArtificial SequenceSynthetic Construct 1169ccuucaaauc gugauaa 17117017RNAArtificial SequenceSynthetic Construct 1170cuucaaaucg ugauaag 17117117RNAArtificial SequenceSynthetic Construct 1171uucaaaucgu gauaagg 17117217RNAArtificial SequenceSynthetic Construct 1172ucaaaucgug auaaggc 17117317RNAArtificial SequenceSynthetic Construct 1173caaaucguga uaaggcu 17117417RNAArtificial SequenceSynthetic Construct 1174aaaucgugau aaggcuc 17117517RNAArtificial SequenceSynthetic Construct 1175aaucgugaua aggcucu 17117617RNAArtificial SequenceSynthetic Construct 1176aucgugauaa ggcucuu 17117717RNAArtificial SequenceSynthetic Construct 1177ucgugauaag gcucuua 17117817RNAArtificial SequenceSynthetic Construct 1178cgugauaagg cucuuaa 17117917RNAArtificial SequenceSynthetic Construct 1179gugauaaggc ucuuaag 17118017RNAArtificial SequenceSynthetic Construct 1180ugauaaggcu cuuaagg 17118117RNAArtificial SequenceSynthetic Construct 1181gauaaggcuc uuaaggg 17118217RNAArtificial SequenceSynthetic Construct 1182auaaggcucu uaagggu 17118317RNAArtificial SequenceSynthetic Construct 1183uaaggcucuu aaggguc 17118417RNAArtificial SequenceSynthetic Construct 1184aaggcucuua agggucu 17118517RNAArtificial SequenceSynthetic Construct 1185aggcucuuaa gggucuc 17118617RNAArtificial SequenceSynthetic Construct 1186ggcucuuaag ggucuca 17118716RNAArtificial SequenceSynthetic Construct 1187ucuuacccuc aucccu 16118816RNAArtificial SequenceSynthetic Construct 1188cuuacccuca ucccuu 16118916RNAArtificial SequenceSynthetic Construct 1189uuacccucau cccuuc 16119016RNAArtificial SequenceSynthetic Construct 1190uacccucauc ccuuca 16119116RNAArtificial SequenceSynthetic Construct 1191acccucaucc cuucaa 16119216RNAArtificial SequenceSynthetic Construct 1192cccucauccc uucaaa 16119316RNAArtificial SequenceSynthetic Construct 1193ccucaucccu ucaaau 16119416RNAArtificial SequenceSynthetic Construct 1194cucaucccuu caaauc 16119516RNAArtificial SequenceSynthetic Construct 1195ucaucccuuc aaaucg 16119616RNAArtificial SequenceSynthetic Construct 1196caucccuuca aaucgu 16119716RNAArtificial SequenceSynthetic Construct 1197aucccuucaa aucgug 16119816RNAArtificial SequenceSynthetic Construct 1198ucccuucaaa ucguga 16119916RNAArtificial SequenceSynthetic Construct 1199cccuucaaau cgugau 16120016RNAArtificial SequenceSynthetic Construct 1200ccuucaaauc gugaua 16120116RNAArtificial SequenceSynthetic Construct 1201cuucaaaucg ugauaa 16120216RNAArtificial SequenceSynthetic Construct 1202uucaaaucgu gauaag 16120316RNAArtificial SequenceSynthetic Construct 1203ucaaaucgug auaagg 16120416RNAArtificial SequenceSynthetic Construct 1204caaaucguga uaaggc 16120516RNAArtificial SequenceSynthetic Construct 1205aaaucgugau aaggcu 16120616RNAArtificial SequenceSynthetic Construct 1206aaucgugaua aggcuc 16120716RNAArtificial SequenceSynthetic Construct 1207aucgugauaa ggcucu 16120816RNAArtificial SequenceSynthetic Construct 1208ucgugauaag gcucuu 16120916RNAArtificial SequenceSynthetic Construct 1209cgugauaagg cucuua 16121016RNAArtificial SequenceSynthetic Construct 1210gugauaaggc ucuuaa 16121116RNAArtificial SequenceSynthetic Construct 1211ugauaaggcu cuuaag 16121216RNAArtificial SequenceSynthetic Construct 1212gauaaggcuc uuaagg 16121316RNAArtificial SequenceSynthetic Construct 1213auaaggcucu uaaggg 16121416RNAArtificial SequenceSynthetic Construct 1214uaaggcucuu aagggu 16121516RNAArtificial SequenceSynthetic Construct 1215aaggcucuua aggguc 16121616RNAArtificial SequenceSynthetic Construct 1216aggcucuuaa gggucu 16121716RNAArtificial SequenceSynthetic Construct 1217ggcucuuaag ggucuc 16121816RNAArtificial SequenceSynthetic Construct 1218gcucuuaagg gucuca 16121915RNAArtificial SequenceSynthetic Construct 1219ucuuacccuc auccc 15122015RNAArtificial SequenceSynthetic Construct 1220cuuacccuca ucccu 15122115RNAArtificial SequenceSynthetic Construct 1221uuacccucau cccuu 15122215RNAArtificial SequenceSynthetic Construct 1222uacccucauc ccuuc 15122315RNAArtificial SequenceSynthetic Construct 1223acccucaucc cuuca 15122415RNAArtificial SequenceSynthetic Construct 1224cccucauccc uucaa 15122515RNAArtificial SequenceSynthetic Construct 1225ccucaucccu ucaaa 15122615RNAArtificial SequenceSynthetic Construct 1226cucaucccuu caaau 15122715RNAArtificial SequenceSynthetic Construct 1227ucaucccuuc aaauc 15122815RNAArtificial SequenceSynthetic Construct 1228caucccuuca aaucg 15122915RNAArtificial SequenceSynthetic Construct 1229aucccuucaa aucgu 15123015RNAArtificial SequenceSynthetic Construct 1230ucccuucaaa ucgug 15123115RNAArtificial SequenceSynthetic Construct 1231cccuucaaau cguga 15123215RNAArtificial SequenceSynthetic Construct 1232ccuucaaauc gugau 15123315RNAArtificial SequenceSynthetic Construct 1233cuucaaaucg ugaua 15123415RNAArtificial SequenceSynthetic Construct 1234uucaaaucgu gauaa 15123515RNAArtificial SequenceSynthetic Construct 1235ucaaaucgug auaag 15123615RNAArtificial SequenceSynthetic Construct 1236caaaucguga uaagg 15123715RNAArtificial SequenceSynthetic Construct 1237aaaucgugau aaggc 15123815RNAArtificial SequenceSynthetic Construct 1238aaucgugaua aggcu 15123915RNAArtificial SequenceSynthetic Construct 1239aucgugauaa ggcuc 15124015RNAArtificial SequenceSynthetic Construct 1240ucgugauaag gcucu 15124115RNAArtificial SequenceSynthetic Construct 1241cgugauaagg cucuu 15124215RNAArtificial SequenceSynthetic Construct 1242gugauaaggc ucuua 15124315RNAArtificial SequenceSynthetic Construct 1243ugauaaggcu cuuaa 15124415RNAArtificial SequenceSynthetic Construct 1244gauaaggcuc uuaag 15124515RNAArtificial SequenceSynthetic Construct 1245auaaggcucu uaagg 15124615RNAArtificial SequenceSynthetic Construct 1246uaaggcucuu aaggg 15124715RNAArtificial SequenceSynthetic Construct 1247aaggcucuua agggu 15124815RNAArtificial SequenceSynthetic Construct 1248aggcucuuaa ggguc 15124915RNAArtificial SequenceSynthetic Construct 1249ggcucuuaag ggucu 15125015RNAArtificial SequenceSynthetic Construct 1250gcucuuaagg gucuc 15125115RNAArtificial SequenceSynthetic Construct 1251cucuuaaggg ucuca 15125279DNAHomo sapiens 1252actattccga gaattcccag agtttcgaga atcccaggat tccctgaaat accgtggatc 60aaggctcatc gggtcccgt 79125379RNAHomo sapiens 1253ugauaaggcu cuuaaggguc ucaaagcucu uaggguccua agggacuuua uggcaccuag 60uuccgaguag cccagggca 79125424RNAArtificial SequenceSynthetic Construct 1254ugauaaggcu cuuaaggguc ucaa 24125524RNAArtificial SequenceSynthetic Construct 1255gauaaggcuc uuaagggucu caaa 24125624RNAArtificial SequenceSynthetic Construct 1256auaaggcucu uaagggucuc aaag 24125724RNAArtificial SequenceSynthetic Construct 1257uaaggcucuu aagggucuca aagc 24125824RNAArtificial SequenceSynthetic Construct 1258aaggcucuua agggucucaa agcu 24125924RNAArtificial SequenceSynthetic Construct 1259aggcucuuaa gggucucaaa gcuc 24126024RNAArtificial SequenceSynthetic Construct 1260ggcucuuaag ggucucaaag cucu 24126124RNAArtificial SequenceSynthetic Construct 1261gcucuuaagg gucucaaagc ucuu 24126224RNAArtificial SequenceSynthetic Construct 1262cucuuaaggg ucucaaagcu cuua 24126324RNAArtificial SequenceSynthetic Construct 1263ucuuaagggu cucaaagcuc uuag 24126424RNAArtificial SequenceSynthetic Construct 1264cuuaaggguc ucaaagcucu uagg 24126524RNAArtificial SequenceSynthetic Construct 1265uuaagggucu caaagcucuu aggg 24126624RNAArtificial SequenceSynthetic Construct 1266uaagggucuc aaagcucuua gggu 24126724RNAArtificial SequenceSynthetic Construct 1267aagggucuca aagcucuuag gguc 24126824RNAArtificial SequenceSynthetic Construct 1268agggucucaa agcucuuagg gucc 24126924RNAArtificial SequenceSynthetic Construct 1269gggucucaaa gcucuuaggg uccu 24127024RNAArtificial SequenceSynthetic Construct 1270ggucucaaag cucuuagggu ccua 24127124RNAArtificial SequenceSynthetic Construct 1271gucucaaagc ucuuaggguc cuaa 24127224RNAArtificial SequenceSynthetic Construct 1272ucucaaagcu cuuagggucc uaag 24127324RNAArtificial SequenceSynthetic Construct 1273cucaaagcuc uuaggguccu aagg 24127424RNAArtificial SequenceSynthetic Construct 1274ucaaagcucu uaggguccua aggg 24127524RNAArtificial SequenceSynthetic Construct 1275caaagcucuu

aggguccuaa ggga 24127624RNAArtificial SequenceSynthetic Construct 1276aaagcucuua ggguccuaag ggac 24127724RNAArtificial SequenceSynthetic Construct 1277aagcucuuag gguccuaagg gacu 24127824RNAArtificial SequenceSynthetic Construct 1278agcucuuagg guccuaaggg acuu 24127924RNAArtificial SequenceSynthetic Construct 1279gcucuuaggg uccuaaggga cuuu 24128024RNAArtificial SequenceSynthetic Construct 1280cucuuagggu ccuaagggac uuua 24128124RNAArtificial SequenceSynthetic Construct 1281ucuuaggguc cuaagggacu uuau 24128224RNAArtificial SequenceSynthetic Construct 1282cuuagggucc uaagggacuu uaug 24128324RNAArtificial SequenceSynthetic Construct 1283uuaggguccu aagggacuuu augg 24128424RNAArtificial SequenceSynthetic Construct 1284uaggguccua agggacuuua uggc 24128524RNAArtificial SequenceSynthetic Construct 1285aggguccuaa gggacuuuau ggca 24128624RNAArtificial SequenceSynthetic Construct 1286ggguccuaag ggacuuuaug gcac 24128724RNAArtificial SequenceSynthetic Construct 1287gguccuaagg gacuuuaugg cacc 24128824RNAArtificial SequenceSynthetic Construct 1288guccuaaggg acuuuauggc accu 24128924RNAArtificial SequenceSynthetic Construct 1289uccuaaggga cuuuauggca ccua 24129024RNAArtificial SequenceSynthetic Construct 1290ccuaagggac uuuauggcac cuag 24129124RNAArtificial SequenceSynthetic Construct 1291cuaagggacu uuauggcacc uagu 24129224RNAArtificial SequenceSynthetic Construct 1292uaagggacuu uauggcaccu aguu 24129324RNAArtificial SequenceSynthetic Construct 1293aagggacuuu auggcaccua guuc 24129424RNAArtificial SequenceSynthetic Construct 1294agggacuuua uggcaccuag uucc 24129524RNAArtificial SequenceSynthetic Construct 1295gggacuuuau ggcaccuagu uccg 24129624RNAArtificial SequenceSynthetic Construct 1296ggacuuuaug gcaccuaguu ccga 24129724RNAArtificial SequenceSynthetic Construct 1297gacuuuaugg caccuaguuc cgag 24129824RNAArtificial SequenceSynthetic Construct 1298acuuuauggc accuaguucc gagu 24129924RNAArtificial SequenceSynthetic Construct 1299cuuuauggca ccuaguuccg agua 24130024RNAArtificial SequenceSynthetic Construct 1300uuuauggcac cuaguuccga guag 24130124RNAArtificial SequenceSynthetic Construct 1301uuauggcacc uaguuccgag uagc 24130224RNAArtificial SequenceSynthetic Construct 1302uauggcaccu aguuccgagu agcc 24130324RNAArtificial SequenceSynthetic Construct 1303auggcaccua guuccgagua gccc 24130424RNAArtificial SequenceSynthetic Construct 1304uggcaccuag uuccgaguag ccca 24130524RNAArtificial SequenceSynthetic Construct 1305ggcaccuagu uccgaguagc ccag 24130624RNAArtificial SequenceSynthetic Construct 1306gcaccuaguu ccgaguagcc cagg 24130724RNAArtificial SequenceSynthetic Construct 1307caccuaguuc cgaguagccc aggg 24130824RNAArtificial SequenceSynthetic Construct 1308accuaguucc gaguagccca gggc 24130924RNAArtificial SequenceSynthetic Construct 1309ccuaguuccg aguagcccag ggca 24131023RNAArtificial SequenceSynthetic Construct 1310ugauaaggcu cuuaaggguc uca 23131123RNAArtificial SequenceSynthetic Construct 1311gauaaggcuc uuaagggucu caa 23131223RNAArtificial SequenceSynthetic Construct 1312auaaggcucu uaagggucuc aaa 23131323RNAArtificial SequenceSynthetic Construct 1313uaaggcucuu aagggucuca aag 23131423RNAArtificial SequenceSynthetic Construct 1314aaggcucuua agggucucaa agc 23131523RNAArtificial SequenceSynthetic Construct 1315aggcucuuaa gggucucaaa gcu 23131623RNAArtificial SequenceSynthetic Construct 1316ggcucuuaag ggucucaaag cuc 23131723RNAArtificial SequenceSynthetic Construct 1317gcucuuaagg gucucaaagc ucu 23131823RNAArtificial SequenceSynthetic Construct 1318cucuuaaggg ucucaaagcu cuu 23131923RNAArtificial SequenceSynthetic Construct 1319ucuuaagggu cucaaagcuc uua 23132023RNAArtificial SequenceSynthetic Construct 1320cuuaaggguc ucaaagcucu uag 23132123RNAArtificial SequenceSynthetic Construct 1321uuaagggucu caaagcucuu agg 23132223RNAArtificial SequenceSynthetic Construct 1322uaagggucuc aaagcucuua ggg 23132323RNAArtificial SequenceSynthetic Construct 1323aagggucuca aagcucuuag ggu 23132423RNAArtificial SequenceSynthetic Construct 1324agggucucaa agcucuuagg guc 23132523RNAArtificial SequenceSynthetic Construct 1325gggucucaaa gcucuuaggg ucc 23132623RNAArtificial SequenceSynthetic Construct 1326ggucucaaag cucuuagggu ccu 23132723RNAArtificial SequenceSynthetic Construct 1327gucucaaagc ucuuaggguc cua 23132823RNAArtificial SequenceSynthetic Construct 1328ucucaaagcu cuuagggucc uaa 23132923RNAArtificial SequenceSynthetic Construct 1329cucaaagcuc uuaggguccu aag 23133023RNAArtificial SequenceSynthetic Construct 1330ucaaagcucu uaggguccua agg 23133123RNAArtificial SequenceSynthetic Construct 1331caaagcucuu aggguccuaa ggg 23133223RNAArtificial SequenceSynthetic Construct 1332aaagcucuua ggguccuaag gga 23133323RNAArtificial SequenceSynthetic Construct 1333aagcucuuag gguccuaagg gac 23133423RNAArtificial SequenceSynthetic Construct 1334agcucuuagg guccuaaggg acu 23133523RNAArtificial SequenceSynthetic Construct 1335gcucuuaggg uccuaaggga cuu 23133623RNAArtificial SequenceSynthetic Construct 1336cucuuagggu ccuaagggac uuu 23133723RNAArtificial SequenceSynthetic Construct 1337ucuuaggguc cuaagggacu uua 23133823RNAArtificial SequenceSynthetic Construct 1338cuuagggucc uaagggacuu uau 23133923RNAArtificial SequenceSynthetic Construct 1339uuaggguccu aagggacuuu aug 23134023RNAArtificial SequenceSynthetic Construct 1340uaggguccua agggacuuua ugg 23134123RNAArtificial SequenceSynthetic Construct 1341aggguccuaa gggacuuuau ggc 23134223RNAArtificial SequenceSynthetic Construct 1342ggguccuaag ggacuuuaug gca 23134323RNAArtificial SequenceSynthetic Construct 1343gguccuaagg gacuuuaugg cac 23134423RNAArtificial SequenceSynthetic Construct 1344guccuaaggg acuuuauggc acc 23134523RNAArtificial SequenceSynthetic Construct 1345uccuaaggga cuuuauggca ccu 23134623RNAArtificial SequenceSynthetic Construct 1346ccuaagggac uuuauggcac cua 23134723RNAArtificial SequenceSynthetic Construct 1347cuaagggacu uuauggcacc uag 23134823RNAArtificial SequenceSynthetic Construct 1348uaagggacuu uauggcaccu agu 23134923RNAArtificial SequenceSynthetic Construct 1349aagggacuuu auggcaccua guu 23135023RNAArtificial SequenceSynthetic Construct 1350agggacuuua uggcaccuag uuc 23135123RNAArtificial SequenceSynthetic Construct 1351gggacuuuau ggcaccuagu ucc 23135223RNAArtificial SequenceSynthetic Construct 1352ggacuuuaug gcaccuaguu ccg 23135323RNAArtificial SequenceSynthetic Construct 1353gacuuuaugg caccuaguuc cga 23135423RNAArtificial SequenceSynthetic Construct 1354acuuuauggc accuaguucc gag 23135523RNAArtificial SequenceSynthetic Construct 1355cuuuauggca ccuaguuccg agu 23135623RNAArtificial SequenceSynthetic Construct 1356uuuauggcac cuaguuccga gua 23135723RNAArtificial SequenceSynthetic Construct 1357uuauggcacc uaguuccgag uag 23135823RNAArtificial SequenceSynthetic Construct 1358uauggcaccu aguuccgagu agc 23135923RNAArtificial SequenceSynthetic Construct 1359auggcaccua guuccgagua gcc 23136023RNAArtificial SequenceSynthetic Construct 1360uggcaccuag uuccgaguag ccc 23136123RNAArtificial SequenceSynthetic Construct 1361ggcaccuagu uccgaguagc cca 23136223RNAArtificial SequenceSynthetic Construct 1362gcaccuaguu ccgaguagcc cag 23136323RNAArtificial SequenceSynthetic Construct 1363caccuaguuc cgaguagccc agg 23136423RNAArtificial SequenceSynthetic Construct 1364accuaguucc gaguagccca ggg 23136523RNAArtificial SequenceSynthetic Construct 1365ccuaguuccg aguagcccag ggc 23136623RNAArtificial SequenceSynthetic Construct 1366cuaguuccga guagcccagg gca 23136722RNAArtificial SequenceSynthetic Construct 1367ugauaaggcu cuuaaggguc uc 22136822RNAArtificial SequenceSynthetic Construct 1368gauaaggcuc uuaagggucu ca 22136922RNAArtificial SequenceSynthetic Construct 1369auaaggcucu uaagggucuc aa 22137022RNAArtificial SequenceSynthetic Construct 1370uaaggcucuu aagggucuca aa 22137122RNAArtificial SequenceSynthetic Construct 1371aaggcucuua agggucucaa ag 22137222RNAArtificial SequenceSynthetic Construct 1372aggcucuuaa gggucucaaa gc 22137322RNAArtificial SequenceSynthetic Construct 1373ggcucuuaag ggucucaaag cu 22137422RNAArtificial SequenceSynthetic Construct 1374gcucuuaagg gucucaaagc uc 22137522RNAArtificial SequenceSynthetic Construct 1375cucuuaaggg ucucaaagcu cu 22137622RNAArtificial SequenceSynthetic Construct 1376ucuuaagggu cucaaagcuc uu 22137722RNAArtificial SequenceSynthetic Construct 1377cuuaaggguc ucaaagcucu ua 22137822RNAArtificial SequenceSynthetic Construct 1378uuaagggucu caaagcucuu ag 22137922RNAArtificial SequenceSynthetic Construct 1379uaagggucuc aaagcucuua gg 22138022RNAArtificial SequenceSynthetic Construct 1380aagggucuca aagcucuuag gg 22138122RNAArtificial SequenceSynthetic Construct 1381agggucucaa agcucuuagg gu 22138222RNAArtificial SequenceSynthetic Construct 1382gggucucaaa gcucuuaggg uc 22138322RNAArtificial SequenceSynthetic Construct 1383ggucucaaag cucuuagggu cc 22138422RNAArtificial SequenceSynthetic Construct 1384gucucaaagc ucuuaggguc cu 22138522RNAArtificial SequenceSynthetic Construct 1385ucucaaagcu cuuagggucc ua 22138622RNAArtificial SequenceSynthetic Construct 1386cucaaagcuc uuaggguccu aa 22138722RNAArtificial SequenceSynthetic Construct 1387ucaaagcucu uaggguccua ag 22138822RNAArtificial SequenceSynthetic Construct 1388caaagcucuu aggguccuaa gg 22138922RNAArtificial SequenceSynthetic Construct 1389aaagcucuua ggguccuaag gg 22139022RNAArtificial SequenceSynthetic Construct 1390aagcucuuag gguccuaagg ga 22139122RNAArtificial SequenceSynthetic Construct 1391agcucuuagg guccuaaggg ac 22139222RNAArtificial SequenceSynthetic Construct 1392gcucuuaggg uccuaaggga cu 22139322RNAArtificial SequenceSynthetic Construct 1393cucuuagggu ccuaagggac uu 22139422RNAArtificial SequenceSynthetic Construct 1394ucuuaggguc cuaagggacu uu 22139522RNAArtificial SequenceSynthetic Construct 1395cuuagggucc uaagggacuu ua 22139622RNAArtificial SequenceSynthetic Construct 1396uuaggguccu aagggacuuu au 22139722RNAArtificial SequenceSynthetic Construct 1397uaggguccua agggacuuua ug 22139822RNAArtificial SequenceSynthetic Construct 1398aggguccuaa gggacuuuau gg 22139922RNAArtificial SequenceSynthetic Construct 1399ggguccuaag ggacuuuaug gc 22140022RNAArtificial SequenceSynthetic Construct 1400gguccuaagg gacuuuaugg ca

22140122RNAArtificial SequenceSynthetic Construct 1401guccuaaggg acuuuauggc ac 22140222RNAArtificial SequenceSynthetic Construct 1402uccuaaggga cuuuauggca cc 22140322RNAArtificial SequenceSynthetic Construct 1403ccuaagggac uuuauggcac cu 22140422RNAArtificial SequenceSynthetic Construct 1404cuaagggacu uuauggcacc ua 22140522RNAArtificial SequenceSynthetic Construct 1405uaagggacuu uauggcaccu ag 22140622RNAArtificial SequenceSynthetic Construct 1406aagggacuuu auggcaccua gu 22140722RNAArtificial SequenceSynthetic Construct 1407agggacuuua uggcaccuag uu 22140822RNAArtificial SequenceSynthetic Construct 1408gggacuuuau ggcaccuagu uc 22140922RNAArtificial SequenceSynthetic Construct 1409ggacuuuaug gcaccuaguu cc 22141022RNAArtificial SequenceSynthetic Construct 1410gacuuuaugg caccuaguuc cg 22141122RNAArtificial SequenceSynthetic Construct 1411acuuuauggc accuaguucc ga 22141222RNAArtificial SequenceSynthetic Construct 1412cuuuauggca ccuaguuccg ag 22141322RNAArtificial SequenceSynthetic Construct 1413uuuauggcac cuaguuccga gu 22141422RNAArtificial SequenceSynthetic Construct 1414uuauggcacc uaguuccgag ua 22141522RNAArtificial SequenceSynthetic Construct 1415uauggcaccu aguuccgagu ag 22141622RNAArtificial SequenceSynthetic Construct 1416auggcaccua guuccgagua gc 22141722RNAArtificial SequenceSynthetic Construct 1417uggcaccuag uuccgaguag cc 22141822RNAArtificial SequenceSynthetic Construct 1418ggcaccuagu uccgaguagc cc 22141922RNAArtificial SequenceSynthetic Construct 1419gcaccuaguu ccgaguagcc ca 22142022RNAArtificial SequenceSynthetic Construct 1420caccuaguuc cgaguagccc ag 22142122RNAArtificial SequenceSynthetic Construct 1421accuaguucc gaguagccca gg 22142222RNAArtificial SequenceSynthetic Construct 1422ccuaguuccg aguagcccag gg 22142322RNAArtificial SequenceSynthetic Construct 1423cuaguuccga guagcccagg gc 22142422RNAArtificial SequenceSynthetic Construct 1424uaguuccgag uagcccaggg ca 22142521RNAArtificial SequenceSynthetic Construct 1425ugauaaggcu cuuaaggguc u 21142621RNAArtificial SequenceSynthetic Construct 1426gauaaggcuc uuaagggucu c 21142721RNAArtificial SequenceSynthetic Construct 1427auaaggcucu uaagggucuc a 21142821RNAArtificial SequenceSynthetic Construct 1428uaaggcucuu aagggucuca a 21142921RNAArtificial SequenceSynthetic Construct 1429aaggcucuua agggucucaa a 21143021RNAArtificial SequenceSynthetic Construct 1430aggcucuuaa gggucucaaa g 21143121RNAArtificial SequenceSynthetic Construct 1431ggcucuuaag ggucucaaag c 21143221RNAArtificial SequenceSynthetic Construct 1432gcucuuaagg gucucaaagc u 21143321RNAArtificial SequenceSynthetic Construct 1433cucuuaaggg ucucaaagcu c 21143421RNAArtificial SequenceSynthetic Construct 1434ucuuaagggu cucaaagcuc u 21143521RNAArtificial SequenceSynthetic Construct 1435cuuaaggguc ucaaagcucu u 21143621RNAArtificial SequenceSynthetic Construct 1436uuaagggucu caaagcucuu a 21143721RNAArtificial SequenceSynthetic Construct 1437uaagggucuc aaagcucuua g 21143821RNAArtificial SequenceSynthetic Construct 1438aagggucuca aagcucuuag g 21143921RNAArtificial SequenceSynthetic Construct 1439agggucucaa agcucuuagg g 21144021RNAArtificial SequenceSynthetic Construct 1440gggucucaaa gcucuuaggg u 21144121RNAArtificial SequenceSynthetic Construct 1441ggucucaaag cucuuagggu c 21144221RNAArtificial SequenceSynthetic Construct 1442gucucaaagc ucuuaggguc c 21144321RNAArtificial SequenceSynthetic Construct 1443ucucaaagcu cuuagggucc u 21144421RNAArtificial SequenceSynthetic Construct 1444cucaaagcuc uuaggguccu a 21144521RNAArtificial SequenceSynthetic Construct 1445ucaaagcucu uaggguccua a 21144621RNAArtificial SequenceSynthetic Construct 1446caaagcucuu aggguccuaa g 21144721RNAArtificial SequenceSynthetic Construct 1447aaagcucuua ggguccuaag g 21144821RNAArtificial SequenceSynthetic Construct 1448aagcucuuag gguccuaagg g 21144921RNAArtificial SequenceSynthetic Construct 1449agcucuuagg guccuaaggg a 21145021RNAArtificial SequenceSynthetic Construct 1450gcucuuaggg uccuaaggga c 21145121RNAArtificial SequenceSynthetic Construct 1451cucuuagggu ccuaagggac u 21145221RNAArtificial SequenceSynthetic Construct 1452ucuuaggguc cuaagggacu u 21145321RNAArtificial SequenceSynthetic Construct 1453cuuagggucc uaagggacuu u 21145421RNAArtificial SequenceSynthetic Construct 1454uuaggguccu aagggacuuu a 21145521RNAArtificial SequenceSynthetic Construct 1455uaggguccua agggacuuua u 21145621RNAArtificial SequenceSynthetic Construct 1456aggguccuaa gggacuuuau g 21145721RNAArtificial SequenceSynthetic Construct 1457ggguccuaag ggacuuuaug g 21145821RNAArtificial SequenceSynthetic Construct 1458gguccuaagg gacuuuaugg c 21145921RNAArtificial SequenceSynthetic Construct 1459guccuaaggg acuuuauggc a 21146021RNAArtificial SequenceSynthetic Construct 1460uccuaaggga cuuuauggca c 21146121RNAArtificial SequenceSynthetic Construct 1461ccuaagggac uuuauggcac c 21146221RNAArtificial SequenceSynthetic Construct 1462cuaagggacu uuauggcacc u 21146321RNAArtificial SequenceSynthetic Construct 1463uaagggacuu uauggcaccu a 21146421RNAArtificial SequenceSynthetic Construct 1464aagggacuuu auggcaccua g 21146521RNAArtificial SequenceSynthetic Construct 1465agggacuuua uggcaccuag u 21146621RNAArtificial SequenceSynthetic Construct 1466gggacuuuau ggcaccuagu u 21146721RNAArtificial SequenceSynthetic Construct 1467ggacuuuaug gcaccuaguu c 21146821RNAArtificial SequenceSynthetic Construct 1468gacuuuaugg caccuaguuc c 21146921RNAArtificial SequenceSynthetic Construct 1469acuuuauggc accuaguucc g 21147021RNAArtificial SequenceSynthetic Construct 1470cuuuauggca ccuaguuccg a 21147121RNAArtificial SequenceSynthetic Construct 1471uuuauggcac cuaguuccga g 21147221RNAArtificial SequenceSynthetic Construct 1472uuauggcacc uaguuccgag u 21147321RNAArtificial SequenceSynthetic Construct 1473uauggcaccu aguuccgagu a 21147421RNAArtificial SequenceSynthetic Construct 1474auggcaccua guuccgagua g 21147521RNAArtificial SequenceSynthetic Construct 1475uggcaccuag uuccgaguag c 21147621RNAArtificial SequenceSynthetic Construct 1476ggcaccuagu uccgaguagc c 21147721RNAArtificial SequenceSynthetic Construct 1477gcaccuaguu ccgaguagcc c 21147821RNAArtificial SequenceSynthetic Construct 1478caccuaguuc cgaguagccc a 21147921RNAArtificial SequenceSynthetic Construct 1479accuaguucc gaguagccca g 21148021RNAArtificial SequenceSynthetic Construct 1480ccuaguuccg aguagcccag g 21148121RNAArtificial SequenceSynthetic Construct 1481cuaguuccga guagcccagg g 21148221RNAArtificial SequenceSynthetic Construct 1482uaguuccgag uagcccaggg c 21148321RNAArtificial SequenceSynthetic Construct 1483aguuccgagu agcccagggc a 21148420RNAArtificial SequenceSynthetic Construct 1484ugauaaggcu cuuaaggguc 20148520RNAArtificial SequenceSynthetic Construct 1485gauaaggcuc uuaagggucu 20148620RNAArtificial SequenceSynthetic Construct 1486auaaggcucu uaagggucuc 20148720RNAArtificial SequenceSynthetic Construct 1487uaaggcucuu aagggucuca 20148820RNAArtificial SequenceSynthetic Construct 1488aaggcucuua agggucucaa 20148920RNAArtificial SequenceSynthetic Construct 1489aggcucuuaa gggucucaaa 20149020RNAArtificial SequenceSynthetic Construct 1490ggcucuuaag ggucucaaag 20149120RNAArtificial SequenceSynthetic Construct 1491gcucuuaagg gucucaaagc 20149220RNAArtificial SequenceSynthetic Construct 1492cucuuaaggg ucucaaagcu 20149320RNAArtificial SequenceSynthetic Construct 1493ucuuaagggu cucaaagcuc 20149420RNAArtificial SequenceSynthetic Construct 1494cuuaaggguc ucaaagcucu 20149520RNAArtificial SequenceSynthetic Construct 1495uuaagggucu caaagcucuu 20149620RNAArtificial SequenceSynthetic Construct 1496uaagggucuc aaagcucuua 20149720RNAArtificial SequenceSynthetic Construct 1497aagggucuca aagcucuuag 20149820RNAArtificial SequenceSynthetic Construct 1498agggucucaa agcucuuagg 20149920RNAArtificial SequenceSynthetic Construct 1499gggucucaaa gcucuuaggg 20150020RNAArtificial SequenceSynthetic Construct 1500ggucucaaag cucuuagggu 20150120RNAArtificial SequenceSynthetic Construct 1501gucucaaagc ucuuaggguc 20150220RNAArtificial SequenceSynthetic Construct 1502ucucaaagcu cuuagggucc 20150320RNAArtificial SequenceSynthetic Construct 1503cucaaagcuc uuaggguccu 20150420RNAArtificial SequenceSynthetic Construct 1504ucaaagcucu uaggguccua 20150520RNAArtificial SequenceSynthetic Construct 1505caaagcucuu aggguccuaa 20150620RNAArtificial SequenceSynthetic Construct 1506aaagcucuua ggguccuaag 20150720RNAArtificial SequenceSynthetic Construct 1507aagcucuuag gguccuaagg 20150820RNAArtificial SequenceSynthetic Construct 1508agcucuuagg guccuaaggg 20150920RNAArtificial SequenceSynthetic Construct 1509gcucuuaggg uccuaaggga 20151020RNAArtificial SequenceSynthetic Construct 1510cucuuagggu ccuaagggac 20151120RNAArtificial SequenceSynthetic Construct 1511ucuuaggguc cuaagggacu 20151220RNAArtificial SequenceSynthetic Construct 1512cuuagggucc uaagggacuu 20151320RNAArtificial SequenceSynthetic Construct 1513uuaggguccu aagggacuuu 20151420RNAArtificial SequenceSynthetic Construct 1514uaggguccua agggacuuua 20151520RNAArtificial SequenceSynthetic Construct 1515aggguccuaa gggacuuuau 20151620RNAArtificial SequenceSynthetic Construct 1516ggguccuaag ggacuuuaug 20151720RNAArtificial SequenceSynthetic Construct 1517gguccuaagg gacuuuaugg 20151820RNAArtificial SequenceSynthetic Construct 1518guccuaaggg acuuuauggc 20151920RNAArtificial SequenceSynthetic Construct 1519uccuaaggga cuuuauggca 20152020RNAArtificial SequenceSynthetic Construct 1520ccuaagggac uuuauggcac 20152120RNAArtificial SequenceSynthetic Construct 1521cuaagggacu uuauggcacc 20152220RNAArtificial SequenceSynthetic Construct 1522uaagggacuu uauggcaccu 20152320RNAArtificial SequenceSynthetic Construct 1523aagggacuuu auggcaccua 20152420RNAArtificial SequenceSynthetic Construct 1524agggacuuua uggcaccuag 20152520RNAArtificial SequenceSynthetic Construct 1525gggacuuuau ggcaccuagu 20152620RNAArtificial SequenceSynthetic Construct 1526ggacuuuaug

gcaccuaguu 20152720RNAArtificial SequenceSynthetic Construct 1527gacuuuaugg caccuaguuc 20152820RNAArtificial SequenceSynthetic Construct 1528acuuuauggc accuaguucc 20152920RNAArtificial SequenceSynthetic Construct 1529cuuuauggca ccuaguuccg 20153020RNAArtificial SequenceSynthetic Construct 1530uuuauggcac cuaguuccga 20153120RNAArtificial SequenceSynthetic Construct 1531uuauggcacc uaguuccgag 20153220RNAArtificial SequenceSynthetic Construct 1532uauggcaccu aguuccgagu 20153320RNAArtificial SequenceSynthetic Construct 1533auggcaccua guuccgagua 20153420RNAArtificial SequenceSynthetic Construct 1534uggcaccuag uuccgaguag 20153520RNAArtificial SequenceSynthetic Construct 1535ggcaccuagu uccgaguagc 20153620RNAArtificial SequenceSynthetic Construct 1536gcaccuaguu ccgaguagcc 20153720RNAArtificial SequenceSynthetic Construct 1537caccuaguuc cgaguagccc 20153820RNAArtificial SequenceSynthetic Construct 1538accuaguucc gaguagccca 20153920RNAArtificial SequenceSynthetic Construct 1539ccuaguuccg aguagcccag 20154020RNAArtificial SequenceSynthetic Construct 1540cuaguuccga guagcccagg 20154120RNAArtificial SequenceSynthetic Construct 1541uaguuccgag uagcccaggg 20154220RNAArtificial SequenceSynthetic Construct 1542aguuccgagu agcccagggc 20154320RNAArtificial SequenceSynthetic Construct 1543guuccgagua gcccagggca 20154419RNAArtificial SequenceSynthetic Construct 1544ugauaaggcu cuuaagggu 19154519RNAArtificial SequenceSynthetic Construct 1545gauaaggcuc uuaaggguc 19154619RNAArtificial SequenceSynthetic Construct 1546auaaggcucu uaagggucu 19154719RNAArtificial SequenceSynthetic Construct 1547uaaggcucuu aagggucuc 19154819RNAArtificial SequenceSynthetic Construct 1548aaggcucuua agggucuca 19154919RNAArtificial SequenceSynthetic Construct 1549aggcucuuaa gggucucaa 19155019RNAArtificial SequenceSynthetic Construct 1550ggcucuuaag ggucucaaa 19155119RNAArtificial SequenceSynthetic Construct 1551gcucuuaagg gucucaaag 19155219RNAArtificial SequenceSynthetic Construct 1552cucuuaaggg ucucaaagc 19155319RNAArtificial SequenceSynthetic Construct 1553ucuuaagggu cucaaagcu 19155419RNAArtificial SequenceSynthetic Construct 1554cuuaaggguc ucaaagcuc 19155519RNAArtificial SequenceSynthetic Construct 1555uuaagggucu caaagcucu 19155619RNAArtificial SequenceSynthetic Construct 1556uaagggucuc aaagcucuu 19155719RNAArtificial SequenceSynthetic Construct 1557aagggucuca aagcucuua 19155819RNAArtificial SequenceSynthetic Construct 1558agggucucaa agcucuuag 19155919RNAArtificial SequenceSynthetic Construct 1559gggucucaaa gcucuuagg 19156019RNAArtificial SequenceSynthetic Construct 1560ggucucaaag cucuuaggg 19156119RNAArtificial SequenceSynthetic Construct 1561gucucaaagc ucuuagggu 19156219RNAArtificial SequenceSynthetic Construct 1562ucucaaagcu cuuaggguc 19156319RNAArtificial SequenceSynthetic Construct 1563cucaaagcuc uuagggucc 19156419RNAArtificial SequenceSynthetic Construct 1564ucaaagcucu uaggguccu 19156519RNAArtificial SequenceSynthetic Construct 1565caaagcucuu aggguccua 19156619RNAArtificial SequenceSynthetic Construct 1566aaagcucuua ggguccuaa 19156719RNAArtificial SequenceSynthetic Construct 1567aagcucuuag gguccuaag 19156819RNAArtificial SequenceSynthetic Construct 1568agcucuuagg guccuaagg 19156919RNAArtificial SequenceSynthetic Construct 1569gcucuuaggg uccuaaggg 19157019RNAArtificial SequenceSynthetic Construct 1570cucuuagggu ccuaaggga 19157119RNAArtificial SequenceSynthetic Construct 1571ucuuaggguc cuaagggac 19157219RNAArtificial SequenceSynthetic Construct 1572cuuagggucc uaagggacu 19157319RNAArtificial SequenceSynthetic Construct 1573uuaggguccu aagggacuu 19157419RNAArtificial SequenceSynthetic Construct 1574uaggguccua agggacuuu 19157519RNAArtificial SequenceSynthetic Construct 1575aggguccuaa gggacuuua 19157619RNAArtificial SequenceSynthetic Construct 1576ggguccuaag ggacuuuau 19157719RNAArtificial SequenceSynthetic Construct 1577gguccuaagg gacuuuaug 19157819RNAArtificial SequenceSynthetic Construct 1578guccuaaggg acuuuaugg 19157919RNAArtificial SequenceSynthetic Construct 1579uccuaaggga cuuuauggc 19158019RNAArtificial SequenceSynthetic Construct 1580ccuaagggac uuuauggca 19158119RNAArtificial SequenceSynthetic Construct 1581cuaagggacu uuauggcac 19158219RNAArtificial SequenceSynthetic Construct 1582uaagggacuu uauggcacc 19158319RNAArtificial SequenceSynthetic Construct 1583aagggacuuu auggcaccu 19158419RNAArtificial SequenceSynthetic Construct 1584agggacuuua uggcaccua 19158519RNAArtificial SequenceSynthetic Construct 1585gggacuuuau ggcaccuag 19158619RNAArtificial SequenceSynthetic Construct 1586ggacuuuaug gcaccuagu 19158719RNAArtificial SequenceSynthetic Construct 1587gacuuuaugg caccuaguu 19158819RNAArtificial SequenceSynthetic Construct 1588acuuuauggc accuaguuc 19158919RNAArtificial SequenceSynthetic Construct 1589cuuuauggca ccuaguucc 19159019RNAArtificial SequenceSynthetic Construct 1590uuuauggcac cuaguuccg 19159119RNAArtificial SequenceSynthetic Construct 1591uuauggcacc uaguuccga 19159219RNAArtificial SequenceSynthetic Construct 1592uauggcaccu aguuccgag 19159319RNAArtificial SequenceSynthetic Construct 1593auggcaccua guuccgagu 19159419RNAArtificial SequenceSynthetic Construct 1594uggcaccuag uuccgagua 19159519RNAArtificial SequenceSynthetic Construct 1595ggcaccuagu uccgaguag 19159619RNAArtificial SequenceSynthetic Construct 1596gcaccuaguu ccgaguagc 19159719RNAArtificial SequenceSynthetic Construct 1597caccuaguuc cgaguagcc 19159819RNAArtificial SequenceSynthetic Construct 1598accuaguucc gaguagccc 19159919RNAArtificial SequenceSynthetic Construct 1599ccuaguuccg aguagccca 19160019RNAArtificial SequenceSynthetic Construct 1600cuaguuccga guagcccag 19160119RNAArtificial SequenceSynthetic Construct 1601uaguuccgag uagcccagg 19160219RNAArtificial SequenceSynthetic Construct 1602aguuccgagu agcccaggg 19160319RNAArtificial SequenceSynthetic Construct 1603guuccgagua gcccagggc 19160419RNAArtificial SequenceSynthetic Construct 1604uuccgaguag cccagggca 19160518RNAArtificial SequenceSynthetic Construct 1605ugauaaggcu cuuaaggg 18160618RNAArtificial SequenceSynthetic Construct 1606gauaaggcuc uuaagggu 18160718RNAArtificial SequenceSynthetic Construct 1607auaaggcucu uaaggguc 18160818RNAArtificial SequenceSynthetic Construct 1608uaaggcucuu aagggucu 18160918RNAArtificial SequenceSynthetic Construct 1609aaggcucuua agggucuc 18161018RNAArtificial SequenceSynthetic Construct 1610aggcucuuaa gggucuca 18161118RNAArtificial SequenceSynthetic Construct 1611ggcucuuaag ggucucaa 18161218RNAArtificial SequenceSynthetic Construct 1612gcucuuaagg gucucaaa 18161318RNAArtificial SequenceSynthetic Construct 1613cucuuaaggg ucucaaag 18161418RNAArtificial SequenceSynthetic Construct 1614ucuuaagggu cucaaagc 18161518RNAArtificial SequenceSynthetic Construct 1615cuuaaggguc ucaaagcu 18161618RNAArtificial SequenceSynthetic Construct 1616uuaagggucu caaagcuc 18161718RNAArtificial SequenceSynthetic Construct 1617uaagggucuc aaagcucu 18161818RNAArtificial SequenceSynthetic Construct 1618aagggucuca aagcucuu 18161918RNAArtificial SequenceSynthetic Construct 1619agggucucaa agcucuua 18162018RNAArtificial SequenceSynthetic Construct 1620gggucucaaa gcucuuag 18162118RNAArtificial SequenceSynthetic Construct 1621ggucucaaag cucuuagg 18162218RNAArtificial SequenceSynthetic Construct 1622gucucaaagc ucuuaggg 18162318RNAArtificial SequenceSynthetic Construct 1623ucucaaagcu cuuagggu 18162418RNAArtificial SequenceSynthetic Construct 1624cucaaagcuc uuaggguc 18162518RNAArtificial SequenceSynthetic Construct 1625ucaaagcucu uagggucc 18162618RNAArtificial SequenceSynthetic Construct 1626caaagcucuu aggguccu 18162718RNAArtificial SequenceSynthetic Construct 1627aaagcucuua ggguccua 18162818RNAArtificial SequenceSynthetic Construct 1628aagcucuuag gguccuaa 18162918RNAArtificial SequenceSynthetic Construct 1629agcucuuagg guccuaag 18163018RNAArtificial SequenceSynthetic Construct 1630gcucuuaggg uccuaagg 18163118RNAArtificial SequenceSynthetic Construct 1631cucuuagggu ccuaaggg 18163218RNAArtificial SequenceSynthetic Construct 1632ucuuaggguc cuaaggga 18163318RNAArtificial SequenceSynthetic Construct 1633cuuagggucc uaagggac 18163418RNAArtificial SequenceSynthetic Construct 1634uuaggguccu aagggacu 18163518RNAArtificial SequenceSynthetic Construct 1635uaggguccua agggacuu 18163618RNAArtificial SequenceSynthetic Construct 1636aggguccuaa gggacuuu 18163718RNAArtificial SequenceSynthetic Construct 1637ggguccuaag ggacuuua 18163818RNAArtificial SequenceSynthetic Construct 1638gguccuaagg gacuuuau 18163918RNAArtificial SequenceSynthetic Construct 1639guccuaaggg acuuuaug 18164018RNAArtificial SequenceSynthetic Construct 1640uccuaaggga cuuuaugg 18164118RNAArtificial SequenceSynthetic Construct 1641ccuaagggac uuuauggc 18164218RNAArtificial SequenceSynthetic Construct 1642cuaagggacu uuauggca 18164318RNAArtificial SequenceSynthetic Construct 1643uaagggacuu uauggcac 18164418RNAArtificial SequenceSynthetic Construct 1644aagggacuuu auggcacc 18164518RNAArtificial SequenceSynthetic Construct 1645agggacuuua uggcaccu 18164618RNAArtificial SequenceSynthetic Construct 1646gggacuuuau ggcaccua 18164718RNAArtificial SequenceSynthetic Construct 1647ggacuuuaug gcaccuag 18164818RNAArtificial SequenceSynthetic Construct 1648gacuuuaugg caccuagu 18164918RNAArtificial SequenceSynthetic Construct 1649acuuuauggc accuaguu 18165018RNAArtificial SequenceSynthetic Construct 1650cuuuauggca ccuaguuc 18165118RNAArtificial SequenceSynthetic Construct 1651uuuauggcac cuaguucc 18165218RNAArtificial SequenceSynthetic Construct 1652uuauggcacc uaguuccg 18165318RNAArtificial SequenceSynthetic Construct 1653uauggcaccu aguuccga 18165418RNAArtificial SequenceSynthetic Construct 1654auggcaccua guuccgag 18165518RNAArtificial SequenceSynthetic Construct 1655uggcaccuag uuccgagu 18165618RNAArtificial SequenceSynthetic Construct 1656ggcaccuagu uccgagua 18165718RNAArtificial SequenceSynthetic Construct 1657gcaccuaguu ccgaguag 18165818RNAArtificial SequenceSynthetic Construct 1658caccuaguuc cgaguagc

18165918RNAArtificial SequenceSynthetic Construct 1659accuaguucc gaguagcc 18166018RNAArtificial SequenceSynthetic Construct 1660ccuaguuccg aguagccc 18166118RNAArtificial SequenceSynthetic Construct 1661cuaguuccga guagccca 18166218RNAArtificial SequenceSynthetic Construct 1662uaguuccgag uagcccag 18166318RNAArtificial SequenceSynthetic Construct 1663aguuccgagu agcccagg 18166418RNAArtificial SequenceSynthetic Construct 1664guuccgagua gcccaggg 18166518RNAArtificial SequenceSynthetic Construct 1665uuccgaguag cccagggc 18166618RNAArtificial SequenceSynthetic Construct 1666uccgaguagc ccagggca 18166717RNAArtificial SequenceSynthetic Construct 1667ugauaaggcu cuuaagg 17166817RNAArtificial SequenceSynthetic Construct 1668gauaaggcuc uuaaggg 17166917RNAArtificial SequenceSynthetic Construct 1669auaaggcucu uaagggu 17167017RNAArtificial SequenceSynthetic Construct 1670uaaggcucuu aaggguc 17167117RNAArtificial SequenceSynthetic Construct 1671aaggcucuua agggucu 17167217RNAArtificial SequenceSynthetic Construct 1672aggcucuuaa gggucuc 17167317RNAArtificial SequenceSynthetic Construct 1673ggcucuuaag ggucuca 17167417RNAArtificial SequenceSynthetic Construct 1674gcucuuaagg gucucaa 17167517RNAArtificial SequenceSynthetic Construct 1675cucuuaaggg ucucaaa 17167617RNAArtificial SequenceSynthetic Construct 1676ucuuaagggu cucaaag 17167717RNAArtificial SequenceSynthetic Construct 1677cuuaaggguc ucaaagc 17167817RNAArtificial SequenceSynthetic Construct 1678uuaagggucu caaagcu 17167917RNAArtificial SequenceSynthetic Construct 1679uaagggucuc aaagcuc 17168017RNAArtificial SequenceSynthetic Construct 1680aagggucuca aagcucu 17168117RNAArtificial SequenceSynthetic Construct 1681agggucucaa agcucuu 17168217RNAArtificial SequenceSynthetic Construct 1682gggucucaaa gcucuua 17168317RNAArtificial SequenceSynthetic Construct 1683ggucucaaag cucuuag 17168417RNAArtificial SequenceSynthetic Construct 1684gucucaaagc ucuuagg 17168517RNAArtificial SequenceSynthetic Construct 1685ucucaaagcu cuuaggg 17168617RNAArtificial SequenceSynthetic Construct 1686cucaaagcuc uuagggu 17168717RNAArtificial SequenceSynthetic Construct 1687ucaaagcucu uaggguc 17168817RNAArtificial SequenceSynthetic Construct 1688caaagcucuu agggucc 17168917RNAArtificial SequenceSynthetic Construct 1689aaagcucuua ggguccu 17169017RNAArtificial SequenceSynthetic Construct 1690aagcucuuag gguccua 17169117RNAArtificial SequenceSynthetic Construct 1691agcucuuagg guccuaa 17169217RNAArtificial SequenceSynthetic Construct 1692gcucuuaggg uccuaag 17169317RNAArtificial SequenceSynthetic Construct 1693cucuuagggu ccuaagg 17169417RNAArtificial SequenceSynthetic Construct 1694ucuuaggguc cuaaggg 17169517RNAArtificial SequenceSynthetic Construct 1695cuuagggucc uaaggga 17169617RNAArtificial SequenceSynthetic Construct 1696uuaggguccu aagggac 17169717RNAArtificial SequenceSynthetic Construct 1697uaggguccua agggacu 17169817RNAArtificial SequenceSynthetic Construct 1698aggguccuaa gggacuu 17169917RNAArtificial SequenceSynthetic Construct 1699ggguccuaag ggacuuu 17170017RNAArtificial SequenceSynthetic Construct 1700gguccuaagg gacuuua 17170117RNAArtificial SequenceSynthetic Construct 1701guccuaaggg acuuuau 17170217RNAArtificial SequenceSynthetic Construct 1702uccuaaggga cuuuaug 17170317RNAArtificial SequenceSynthetic Construct 1703ccuaagggac uuuaugg 17170417RNAArtificial SequenceSynthetic Construct 1704cuaagggacu uuauggc 17170517RNAArtificial SequenceSynthetic Construct 1705uaagggacuu uauggca 17170617RNAArtificial SequenceSynthetic Construct 1706aagggacuuu auggcac 17170717RNAArtificial SequenceSynthetic Construct 1707agggacuuua uggcacc 17170817RNAArtificial SequenceSynthetic Construct 1708gggacuuuau ggcaccu 17170917RNAArtificial SequenceSynthetic Construct 1709ggacuuuaug gcaccua 17171017RNAArtificial SequenceSynthetic Construct 1710gacuuuaugg caccuag 17171117RNAArtificial SequenceSynthetic Construct 1711acuuuauggc accuagu 17171217RNAArtificial SequenceSynthetic Construct 1712cuuuauggca ccuaguu 17171317RNAArtificial SequenceSynthetic Construct 1713uuuauggcac cuaguuc 17171417RNAArtificial SequenceSynthetic Construct 1714uuauggcacc uaguucc 17171517RNAArtificial SequenceSynthetic Construct 1715uauggcaccu aguuccg 17171617RNAArtificial SequenceSynthetic Construct 1716auggcaccua guuccga 17171717RNAArtificial SequenceSynthetic Construct 1717uggcaccuag uuccgag 17171817RNAArtificial SequenceSynthetic Construct 1718ggcaccuagu uccgagu 17171917RNAArtificial SequenceSynthetic Construct 1719gcaccuaguu ccgagua 17172017RNAArtificial SequenceSynthetic Construct 1720caccuaguuc cgaguag 17172117RNAArtificial SequenceSynthetic Construct 1721accuaguucc gaguagc 17172217RNAArtificial SequenceSynthetic Construct 1722ccuaguuccg aguagcc 17172317RNAArtificial SequenceSynthetic Construct 1723cuaguuccga guagccc 17172417RNAArtificial SequenceSynthetic Construct 1724uaguuccgag uagccca 17172517RNAArtificial SequenceSynthetic Construct 1725aguuccgagu agcccag 17172617RNAArtificial SequenceSynthetic Construct 1726guuccgagua gcccagg 17172717RNAArtificial SequenceSynthetic Construct 1727uuccgaguag cccaggg 17172817RNAArtificial SequenceSynthetic Construct 1728uccgaguagc ccagggc 17172917RNAArtificial SequenceSynthetic Construct 1729ccgaguagcc cagggca 17173016RNAArtificial SequenceSynthetic Construct 1730ugauaaggcu cuuaag 16173116RNAArtificial SequenceSynthetic Construct 1731gauaaggcuc uuaagg 16173216RNAArtificial SequenceSynthetic Construct 1732auaaggcucu uaaggg 16173316RNAArtificial SequenceSynthetic Construct 1733uaaggcucuu aagggu 16173416RNAArtificial SequenceSynthetic Construct 1734aaggcucuua aggguc 16173516RNAArtificial SequenceSynthetic Construct 1735aggcucuuaa gggucu 16173616RNAArtificial SequenceSynthetic Construct 1736ggcucuuaag ggucuc 16173716RNAArtificial SequenceSynthetic Construct 1737gcucuuaagg gucuca 16173816RNAArtificial SequenceSynthetic Construct 1738cucuuaaggg ucucaa 16173916RNAArtificial SequenceSynthetic Construct 1739ucuuaagggu cucaaa 16174016RNAArtificial SequenceSynthetic Construct 1740cuuaaggguc ucaaag 16174116RNAArtificial SequenceSynthetic Construct 1741uuaagggucu caaagc 16174216RNAArtificial SequenceSynthetic Construct 1742uaagggucuc aaagcu 16174316RNAArtificial SequenceSynthetic Construct 1743aagggucuca aagcuc 16174416RNAArtificial SequenceSynthetic Construct 1744agggucucaa agcucu 16174516RNAArtificial SequenceSynthetic Construct 1745gggucucaaa gcucuu 16174616RNAArtificial SequenceSynthetic Construct 1746ggucucaaag cucuua 16174716RNAArtificial SequenceSynthetic Construct 1747gucucaaagc ucuuag 16174816RNAArtificial SequenceSynthetic Construct 1748ucucaaagcu cuuagg 16174916RNAArtificial SequenceSynthetic Construct 1749cucaaagcuc uuaggg 16175016RNAArtificial SequenceSynthetic Construct 1750ucaaagcucu uagggu 16175116RNAArtificial SequenceSynthetic Construct 1751caaagcucuu aggguc 16175216RNAArtificial SequenceSynthetic Construct 1752aaagcucuua gggucc 16175316RNAArtificial SequenceSynthetic Construct 1753aagcucuuag gguccu 16175416RNAArtificial SequenceSynthetic Construct 1754agcucuuagg guccua 16175516RNAArtificial SequenceSynthetic Construct 1755gcucuuaggg uccuaa 16175616RNAArtificial SequenceSynthetic Construct 1756cucuuagggu ccuaag 16175716RNAArtificial SequenceSynthetic Construct 1757ucuuaggguc cuaagg 16175816RNAArtificial SequenceSynthetic Construct 1758cuuagggucc uaaggg 16175916RNAArtificial SequenceSynthetic Construct 1759uuaggguccu aaggga 16176016RNAArtificial SequenceSynthetic Construct 1760uaggguccua agggac 16176116RNAArtificial SequenceSynthetic Construct 1761aggguccuaa gggacu 16176216RNAArtificial SequenceSynthetic Construct 1762ggguccuaag ggacuu 16176316RNAArtificial SequenceSynthetic Construct 1763gguccuaagg gacuuu 16176416RNAArtificial SequenceSynthetic Construct 1764guccuaaggg acuuua 16176516RNAArtificial SequenceSynthetic Construct 1765uccuaaggga cuuuau 16176616RNAArtificial SequenceSynthetic Construct 1766ccuaagggac uuuaug 16176716RNAArtificial SequenceSynthetic Construct 1767cuaagggacu uuaugg 16176816RNAArtificial SequenceSynthetic Construct 1768uaagggacuu uauggc 16176916RNAArtificial SequenceSynthetic Construct 1769aagggacuuu auggca 16177016RNAArtificial SequenceSynthetic Construct 1770agggacuuua uggcac 16177116RNAArtificial SequenceSynthetic Construct 1771gggacuuuau ggcacc 16177216RNAArtificial SequenceSynthetic Construct 1772ggacuuuaug gcaccu 16177316RNAArtificial SequenceSynthetic Construct 1773gacuuuaugg caccua 16177416RNAArtificial SequenceSynthetic Construct 1774acuuuauggc accuag 16177516RNAArtificial SequenceSynthetic Construct 1775cuuuauggca ccuagu 16177616RNAArtificial SequenceSynthetic Construct 1776uuuauggcac cuaguu 16177716RNAArtificial SequenceSynthetic Construct 1777uuauggcacc uaguuc 16177816RNAArtificial SequenceSynthetic Construct 1778uauggcaccu aguucc 16177916RNAArtificial SequenceSynthetic Construct 1779auggcaccua guuccg 16178016RNAArtificial SequenceSynthetic Construct 1780uggcaccuag uuccga 16178116RNAArtificial SequenceSynthetic Construct 1781ggcaccuagu uccgag 16178216RNAArtificial SequenceSynthetic Construct 1782gcaccuaguu ccgagu 16178316RNAArtificial SequenceSynthetic Construct 1783caccuaguuc cgagua 16178416RNAArtificial SequenceSynthetic Construct 1784accuaguucc gaguag 16178516RNAArtificial SequenceSynthetic Construct 1785ccuaguuccg aguagc 16178616RNAArtificial SequenceSynthetic Construct 1786cuaguuccga guagcc 16178716RNAArtificial SequenceSynthetic Construct 1787uaguuccgag uagccc 16178816RNAArtificial SequenceSynthetic Construct 1788aguuccgagu agccca 16178916RNAArtificial SequenceSynthetic Construct 1789guuccgagua gcccag 16179016RNAArtificial SequenceSynthetic Construct 1790uuccgaguag cccagg 16179116RNAArtificial SequenceSynthetic Construct 1791uccgaguagc ccaggg 16179216RNAArtificial SequenceSynthetic Construct 1792ccgaguagcc cagggc 16179316RNAArtificial SequenceSynthetic Construct 1793cgaguagccc agggca 16179415RNAArtificial SequenceSynthetic Construct 1794ugauaaggcu cuuaa 15179515RNAArtificial SequenceSynthetic Construct 1795gauaaggcuc uuaag 15179615RNAArtificial SequenceSynthetic Construct 1796auaaggcucu uaagg 15179715RNAArtificial SequenceSynthetic Construct 1797uaaggcucuu aaggg 15179815RNAArtificial SequenceSynthetic Construct 1798aaggcucuua agggu 15179915RNAArtificial SequenceSynthetic Construct 1799aggcucuuaa ggguc 15180015RNAArtificial SequenceSynthetic Construct 1800ggcucuuaag ggucu 15180115RNAArtificial SequenceSynthetic Construct 1801gcucuuaagg gucuc 15180215RNAArtificial

SequenceSynthetic Construct 1802cucuuaaggg ucuca 15180315RNAArtificial SequenceSynthetic Construct 1803ucuuaagggu cucaa 15180415RNAArtificial SequenceSynthetic Construct 1804cuuaaggguc ucaaa 15180515RNAArtificial SequenceSynthetic Construct 1805uuaagggucu caaag 15180615RNAArtificial SequenceSynthetic Construct 1806uaagggucuc aaagc 15180715RNAArtificial SequenceSynthetic Construct 1807aagggucuca aagcu 15180815RNAArtificial SequenceSynthetic Construct 1808agggucucaa agcuc 15180915RNAArtificial SequenceSynthetic Construct 1809gggucucaaa gcucu 15181015RNAArtificial SequenceSynthetic Construct 1810ggucucaaag cucuu 15181115RNAArtificial SequenceSynthetic Construct 1811gucucaaagc ucuua 15181215RNAArtificial SequenceSynthetic Construct 1812ucucaaagcu cuuag 15181315RNAArtificial SequenceSynthetic Construct 1813cucaaagcuc uuagg 15181415RNAArtificial SequenceSynthetic Construct 1814ucaaagcucu uaggg 15181515RNAArtificial SequenceSynthetic Construct 1815caaagcucuu agggu 15181615RNAArtificial SequenceSynthetic Construct 1816aaagcucuua ggguc 15181715RNAArtificial SequenceSynthetic Construct 1817aagcucuuag ggucc 15181815RNAArtificial SequenceSynthetic Construct 1818agcucuuagg guccu 15181915RNAArtificial SequenceSynthetic Construct 1819gcucuuaggg uccua 15182015RNAArtificial SequenceSynthetic Construct 1820cucuuagggu ccuaa 15182115RNAArtificial SequenceSynthetic Construct 1821ucuuaggguc cuaag 15182215RNAArtificial SequenceSynthetic Construct 1822cuuagggucc uaagg 15182315RNAArtificial SequenceSynthetic Construct 1823uuaggguccu aaggg 15182415RNAArtificial SequenceSynthetic Construct 1824uaggguccua aggga 15182515RNAArtificial SequenceSynthetic Construct 1825aggguccuaa gggac 15182615RNAArtificial SequenceSynthetic Construct 1826ggguccuaag ggacu 15182715RNAArtificial SequenceSynthetic Construct 1827gguccuaagg gacuu 15182815RNAArtificial SequenceSynthetic Construct 1828guccuaaggg acuuu 15182915RNAArtificial SequenceSynthetic Construct 1829uccuaaggga cuuua 15183015RNAArtificial SequenceSynthetic Construct 1830ccuaagggac uuuau 15183115RNAArtificial SequenceSynthetic Construct 1831cuaagggacu uuaug 15183215RNAArtificial SequenceSynthetic Construct 1832uaagggacuu uaugg 15183315RNAArtificial SequenceSynthetic Construct 1833aagggacuuu auggc 15183415RNAArtificial SequenceSynthetic Construct 1834agggacuuua uggca 15183515RNAArtificial SequenceSynthetic Construct 1835gggacuuuau ggcac 15183615RNAArtificial SequenceSynthetic Construct 1836ggacuuuaug gcacc 15183715RNAArtificial SequenceSynthetic Construct 1837gacuuuaugg caccu 15183815RNAArtificial SequenceSynthetic Construct 1838acuuuauggc accua 15183915RNAArtificial SequenceSynthetic Construct 1839cuuuauggca ccuag 15184015RNAArtificial SequenceSynthetic Construct 1840uuuauggcac cuagu 15184115RNAArtificial SequenceSynthetic Construct 1841uuauggcacc uaguu 15184215RNAArtificial SequenceSynthetic Construct 1842uauggcaccu aguuc 15184315RNAArtificial SequenceSynthetic Construct 1843auggcaccua guucc 15184415RNAArtificial SequenceSynthetic Construct 1844uggcaccuag uuccg 15184515RNAArtificial SequenceSynthetic Construct 1845ggcaccuagu uccga 15184615RNAArtificial SequenceSynthetic Construct 1846gcaccuaguu ccgag 15184715RNAArtificial SequenceSynthetic Construct 1847caccuaguuc cgagu 15184815RNAArtificial SequenceSynthetic Construct 1848accuaguucc gagua 15184915RNAArtificial SequenceSynthetic Construct 1849ccuaguuccg aguag 15185015RNAArtificial SequenceSynthetic Construct 1850cuaguuccga guagc 15185115RNAArtificial SequenceSynthetic Construct 1851uaguuccgag uagcc 15185215RNAArtificial SequenceSynthetic Construct 1852aguuccgagu agccc 15185315RNAArtificial SequenceSynthetic Construct 1853guuccgagua gccca 15185415RNAArtificial SequenceSynthetic Construct 1854uuccgaguag cccag 15185515RNAArtificial SequenceSynthetic Construct 1855uccgaguagc ccagg 15185615RNAArtificial SequenceSynthetic Construct 1856ccgaguagcc caggg 15185715RNAArtificial SequenceSynthetic Construct 1857cgaguagccc agggc 15185815RNAArtificial SequenceSynthetic Construct 1858gaguagccca gggca 15185951DNAHomo sapiens 1859gatcaaggct catcgggtcc cgtaatcgat attccgactg atttctctga t 51186051RNAHomo sapiens 1860cuaguuccga guagcccagg gcauuagcua uaaggcugac uaaagagacu a 51186124RNAArtificial SequenceSynthetic Construct 1861cuaguuccga guagcccagg gcau 24186224RNAArtificial SequenceSynthetic Construct 1862uaguuccgag uagcccaggg cauu 24186324RNAArtificial SequenceSynthetic Construct 1863aguuccgagu agcccagggc auua 24186424RNAArtificial SequenceSynthetic Construct 1864guuccgagua gcccagggca uuag 24186524RNAArtificial SequenceSynthetic Construct 1865uuccgaguag cccagggcau uagc 24186624RNAArtificial SequenceSynthetic Construct 1866uccgaguagc ccagggcauu agcu 24186724RNAArtificial SequenceSynthetic Construct 1867ccgaguagcc cagggcauua gcua 24186824RNAArtificial SequenceSynthetic Construct 1868cgaguagccc agggcauuag cuau 24186924RNAArtificial SequenceSynthetic Construct 1869gaguagccca gggcauuagc uaua 24187024RNAArtificial SequenceSynthetic Construct 1870aguagcccag ggcauuagcu auaa 24187124RNAArtificial SequenceSynthetic Construct 1871guagcccagg gcauuagcua uaag 24187224RNAArtificial SequenceSynthetic Construct 1872uagcccaggg cauuagcuau aagg 24187324RNAArtificial SequenceSynthetic Construct 1873agcccagggc auuagcuaua aggc 24187424RNAArtificial SequenceSynthetic Construct 1874gcccagggca uuagcuauaa ggcu 24187524RNAArtificial SequenceSynthetic Construct 1875cccagggcau uagcuauaag gcug 24187624RNAArtificial SequenceSynthetic Construct 1876ccagggcauu agcuauaagg cuga 24187724RNAArtificial SequenceSynthetic Construct 1877cagggcauua gcuauaaggc ugac 24187824RNAArtificial SequenceSynthetic Construct 1878agggcauuag cuauaaggcu gacu 24187924RNAArtificial SequenceSynthetic Construct 1879gggcauuagc uauaaggcug acua 24188024RNAArtificial SequenceSynthetic Construct 1880ggcauuagcu auaaggcuga cuaa 24188124RNAArtificial SequenceSynthetic Construct 1881gcauuagcua uaaggcugac uaaa 24188224RNAArtificial SequenceSynthetic Construct 1882cauuagcuau aaggcugacu aaag 24188324RNAArtificial SequenceSynthetic Construct 1883auuagcuaua aggcugacua aaga 24188424RNAArtificial SequenceSynthetic Construct 1884uuagcuauaa ggcugacuaa agag 24188524RNAArtificial SequenceSynthetic Construct 1885uagcuauaag gcugacuaaa gaga 24188624RNAArtificial SequenceSynthetic Construct 1886agcuauaagg cugacuaaag agac 24188724RNAArtificial SequenceSynthetic Construct 1887gcuauaaggc ugacuaaaga gacu 24188824RNAArtificial SequenceSynthetic Construct 1888cuauaaggcu gacuaaagag acua 24188923RNAArtificial SequenceSynthetic Construct 1889uaguuccgag uagcccaggg cau 23189023RNAArtificial SequenceSynthetic Construct 1890aguuccgagu agcccagggc auu 23189123RNAArtificial SequenceSynthetic Construct 1891guuccgagua gcccagggca uua 23189223RNAArtificial SequenceSynthetic Construct 1892uuccgaguag cccagggcau uag 23189323RNAArtificial SequenceSynthetic Construct 1893uccgaguagc ccagggcauu agc 23189423RNAArtificial SequenceSynthetic Construct 1894ccgaguagcc cagggcauua gcu 23189523RNAArtificial SequenceSynthetic Construct 1895cgaguagccc agggcauuag cua 23189623RNAArtificial SequenceSynthetic Construct 1896gaguagccca gggcauuagc uau 23189723RNAArtificial SequenceSynthetic Construct 1897aguagcccag ggcauuagcu aua 23189823RNAArtificial SequenceSynthetic Construct 1898guagcccagg gcauuagcua uaa 23189923RNAArtificial SequenceSynthetic Construct 1899uagcccaggg cauuagcuau aag 23190023RNAArtificial SequenceSynthetic Construct 1900agcccagggc auuagcuaua agg 23190123RNAArtificial SequenceSynthetic Construct 1901gcccagggca uuagcuauaa ggc 23190223RNAArtificial SequenceSynthetic Construct 1902cccagggcau uagcuauaag gcu 23190323RNAArtificial SequenceSynthetic Construct 1903ccagggcauu agcuauaagg cug 23190423RNAArtificial SequenceSynthetic Construct 1904cagggcauua gcuauaaggc uga 23190523RNAArtificial SequenceSynthetic Construct 1905agggcauuag cuauaaggcu gac 23190623RNAArtificial SequenceSynthetic Construct 1906gggcauuagc uauaaggcug acu 23190723RNAArtificial SequenceSynthetic Construct 1907ggcauuagcu auaaggcuga cua 23190823RNAArtificial SequenceSynthetic Construct 1908gcauuagcua uaaggcugac uaa 23190923RNAArtificial SequenceSynthetic Construct 1909cauuagcuau aaggcugacu aaa 23191023RNAArtificial SequenceSynthetic Construct 1910auuagcuaua aggcugacua aag 23191123RNAArtificial SequenceSynthetic Construct 1911uuagcuauaa ggcugacuaa aga 23191223RNAArtificial SequenceSynthetic Construct 1912uagcuauaag gcugacuaaa gag 23191323RNAArtificial SequenceSynthetic Construct 1913agcuauaagg cugacuaaag aga 23191423RNAArtificial SequenceSynthetic Construct 1914gcuauaaggc ugacuaaaga gac 23191523RNAArtificial SequenceSynthetic Construct 1915cuauaaggcu gacuaaagag acu 23191623RNAArtificial SequenceSynthetic Construct 1916uauaaggcug acuaaagaga cua 23191722RNAArtificial SequenceSynthetic Construct 1917aguuccgagu agcccagggc au 22191822RNAArtificial SequenceSynthetic Construct 1918guuccgagua gcccagggca uu 22191922RNAArtificial SequenceSynthetic Construct 1919guuccgagua gcccagggca uu 22192022RNAArtificial SequenceSynthetic Construct 1920uuccgaguag cccagggcau ua 22192122RNAArtificial SequenceSynthetic Construct 1921ccgaguagcc cagggcauua gc 22192222RNAArtificial SequenceSynthetic Construct 1922cgaguagccc agggcauuag cu 22192322RNAArtificial SequenceSynthetic Construct 1923gaguagccca gggcauuagc ua 22192422RNAArtificial SequenceSynthetic Construct 1924aguagcccag ggcauuagcu au 22192522RNAArtificial SequenceSynthetic Construct 1925guagcccagg gcauuagcua ua 22192622RNAArtificial SequenceSynthetic Construct 1926uagcccaggg cauuagcuau aa 22192722RNAArtificial SequenceSynthetic Construct 1927agcccagggc auuagcuaua ag 22192822RNAArtificial SequenceSynthetic Construct 1928gcccagggca uuagcuauaa gg 22192922RNAArtificial SequenceSynthetic Construct 1929cccagggcau uagcuauaag gc 22193022RNAArtificial SequenceSynthetic Construct 1930ccagggcauu agcuauaagg cu 22193122RNAArtificial SequenceSynthetic Construct 1931cagggcauua gcuauaaggc ug 22193222RNAArtificial SequenceSynthetic Construct 1932agggcauuag cuauaaggcu ga 22193322RNAArtificial SequenceSynthetic Construct 1933gggcauuagc uauaaggcug ac 22193422RNAArtificial SequenceSynthetic Construct 1934ggcauuagcu auaaggcuga cu 22193522RNAArtificial SequenceSynthetic Construct 1935gcauuagcua

uaaggcugac ua 22193622RNAArtificial SequenceSynthetic Construct 1936cauuagcuau aaggcugacu aa 22193722RNAArtificial SequenceSynthetic Construct 1937auuagcuaua aggcugacua aa 22193822RNAArtificial SequenceSynthetic Construct 1938uuagcuauaa ggcugacuaa ag 22193922RNAArtificial SequenceSynthetic Construct 1939uagcuauaag gcugacuaaa ga 22194022RNAArtificial SequenceSynthetic Construct 1940agcuauaagg cugacuaaag ag 22194122RNAArtificial SequenceSynthetic Construct 1941gcuauaaggc ugacuaaaga ga 22194222RNAArtificial SequenceSynthetic Construct 1942cuauaaggcu gacuaaagag ac 22194322RNAArtificial SequenceSynthetic Construct 1943uauaaggcug acuaaagaga cu 22194422RNAArtificial SequenceSynthetic Construct 1944auaaggcuga cuaaagagac ua 22194521RNAArtificial SequenceSynthetic Construct 1945guuccgagua gcccagggca u 21194621RNAArtificial SequenceSynthetic Construct 1946uuccgaguag cccagggcau u 21194721RNAArtificial SequenceSynthetic Construct 1947uccgaguagc ccagggcauu a 21194821RNAArtificial SequenceSynthetic Construct 1948ccgaguagcc cagggcauua g 21194921RNAArtificial SequenceSynthetic Construct 1949cgaguagccc agggcauuag c 21195021RNAArtificial SequenceSynthetic Construct 1950gaguagccca gggcauuagc u 21195121RNAArtificial SequenceSynthetic Construct 1951aguagcccag ggcauuagcu a 21195221RNAArtificial SequenceSynthetic Construct 1952guagcccagg gcauuagcua u 21195321RNAArtificial SequenceSynthetic Construct 1953uagcccaggg cauuagcuau a 21195421RNAArtificial SequenceSynthetic Construct 1954agcccagggc auuagcuaua a 21195521RNAArtificial SequenceSynthetic Construct 1955gcccagggca uuagcuauaa g 21195621RNAArtificial SequenceSynthetic Construct 1956cccagggcau uagcuauaag g 21195721RNAArtificial SequenceSynthetic Construct 1957ccagggcauu agcuauaagg c 21195821RNAArtificial SequenceSynthetic Construct 1958cagggcauua gcuauaaggc u 21195921RNAArtificial SequenceSynthetic Construct 1959agggcauuag cuauaaggcu g 21196021RNAArtificial SequenceSynthetic Construct 1960gggcauuagc uauaaggcug a 21196121RNAArtificial SequenceSynthetic Construct 1961ggcauuagcu auaaggcuga c 21196221RNAArtificial SequenceSynthetic Construct 1962gcauuagcua uaaggcugac u 21196321RNAArtificial SequenceSynthetic Construct 1963cauuagcuau aaggcugacu a 21196421RNAArtificial SequenceSynthetic Construct 1964auuagcuaua aggcugacua a 21196521RNAArtificial SequenceSynthetic Construct 1965uuagcuauaa ggcugacuaa a 21196621RNAArtificial SequenceSynthetic Construct 1966uagcuauaag gcugacuaaa g 21196721RNAArtificial SequenceSynthetic Construct 1967agcuauaagg cugacuaaag a 21196821RNAArtificial SequenceSynthetic Construct 1968gcuauaaggc ugacuaaaga g 21196921RNAArtificial SequenceSynthetic Construct 1969cuauaaggcu gacuaaagag a 21197021RNAArtificial SequenceSynthetic Construct 1970uauaaggcug acuaaagaga c 21197121RNAArtificial SequenceSynthetic Construct 1971auaaggcuga cuaaagagac u 21197221RNAArtificial SequenceSynthetic Construct 1972uaaggcugac uaaagagacu a 21197320RNAArtificial SequenceSynthetic Construct 1973uuccgaguag cccagggcau 20197420RNAArtificial SequenceSynthetic Construct 1974uccgaguagc ccagggcauu 20197520RNAArtificial SequenceSynthetic Construct 1975ccgaguagcc cagggcauua 20197620RNAArtificial SequenceSynthetic Construct 1976cgaguagccc agggcauuag 20197720RNAArtificial SequenceSynthetic Construct 1977gaguagccca gggcauuagc 20197820RNAArtificial SequenceSynthetic Construct 1978aguagcccag ggcauuagcu 20197920RNAArtificial SequenceSynthetic Construct 1979guagcccagg gcauuagcua 20198020RNAArtificial SequenceSynthetic Construct 1980uagcccaggg cauuagcuau 20198120RNAArtificial SequenceSynthetic Construct 1981agcccagggc auuagcuaua 20198220RNAArtificial SequenceSynthetic Construct 1982gcccagggca uuagcuauaa 20198320RNAArtificial SequenceSynthetic Construct 1983cccagggcau uagcuauaag 20198420RNAArtificial SequenceSynthetic Construct 1984ccagggcauu agcuauaagg 20198520RNAArtificial SequenceSynthetic Construct 1985cagggcauua gcuauaaggc 20198620RNAArtificial SequenceSynthetic Construct 1986agggcauuag cuauaaggcu 20198720RNAArtificial SequenceSynthetic Construct 1987gggcauuagc uauaaggcug 20198820RNAArtificial SequenceSynthetic Construct 1988ggcauuagcu auaaggcuga 20198920RNAArtificial SequenceSynthetic Construct 1989gcauuagcua uaaggcugac 20199020RNAArtificial SequenceSynthetic Construct 1990cauuagcuau aaggcugacu 20199120RNAArtificial SequenceSynthetic Construct 1991auuagcuaua aggcugacua 20199220RNAArtificial SequenceSynthetic Construct 1992uuagcuauaa ggcugacuaa 20199320RNAArtificial SequenceSynthetic Construct 1993uagcuauaag gcugacuaaa 20199420RNAArtificial SequenceSynthetic Construct 1994agcuauaagg cugacuaaag 20199520RNAArtificial SequenceSynthetic Construct 1995gcuauaaggc ugacuaaaga 20199620RNAArtificial SequenceSynthetic Construct 1996cuauaaggcu gacuaaagag 20199720RNAArtificial SequenceSynthetic Construct 1997uauaaggcug acuaaagaga 20199820RNAArtificial SequenceSynthetic Construct 1998auaaggcuga cuaaagagac 20199920RNAArtificial SequenceSynthetic Construct 1999uaaggcugac uaaagagacu 20200020RNAArtificial SequenceSynthetic Construct 2000aaggcugacu aaagagacua 20200119RNAArtificial SequenceSynthetic Construct 2001uccgaguagc ccagggcau 19200219RNAArtificial SequenceSynthetic Construct 2002ccgaguagcc cagggcauu 19200319RNAArtificial SequenceSynthetic Construct 2003cgaguagccc agggcauua 19200419RNAArtificial SequenceSynthetic Construct 2004gaguagccca gggcauuag 19200519RNAArtificial SequenceSynthetic Construct 2005aguagcccag ggcauuagc 19200619RNAArtificial SequenceSynthetic Construct 2006guagcccagg gcauuagcu 19200719RNAArtificial SequenceSynthetic Construct 2007uagcccaggg cauuagcua 19200819RNAArtificial SequenceSynthetic Construct 2008agcccagggc auuagcuau 19200919RNAArtificial SequenceSynthetic Construct 2009gcccagggca uuagcuaua 19201019RNAArtificial SequenceSynthetic Construct 2010cccagggcau uagcuauaa 19201119RNAArtificial SequenceSynthetic Construct 2011ccagggcauu agcuauaag 19201219RNAArtificial SequenceSynthetic Construct 2012cagggcauua gcuauaagg 19201319RNAArtificial SequenceSynthetic Construct 2013agggcauuag cuauaaggc 19201419RNAArtificial SequenceSynthetic Construct 2014gggcauuagc uauaaggcu 19201519RNAArtificial SequenceSynthetic Construct 2015ggcauuagcu auaaggcug 19201619RNAArtificial SequenceSynthetic Construct 2016gcauuagcua uaaggcuga 19201719RNAArtificial SequenceSynthetic Construct 2017cauuagcuau aaggcugac 19201819RNAArtificial SequenceSynthetic Construct 2018auuagcuaua aggcugacu 19201919RNAArtificial SequenceSynthetic Construct 2019uuagcuauaa ggcugacua 19202019RNAArtificial SequenceSynthetic Construct 2020uagcuauaag gcugacuaa 19202119RNAArtificial SequenceSynthetic Construct 2021agcuauaagg cugacuaaa 19202219RNAArtificial SequenceSynthetic Construct 2022gcuauaaggc ugacuaaag 19202319RNAArtificial SequenceSynthetic Construct 2023cuauaaggcu gacuaaaga 19202419RNAArtificial SequenceSynthetic Construct 2024uauaaggcug acuaaagag 19202519RNAArtificial SequenceSynthetic Construct 2025auaaggcuga cuaaagaga 19202619RNAArtificial SequenceSynthetic Construct 2026uaaggcugac uaaagagac 19202719RNAArtificial SequenceSynthetic Construct 2027aaggcugacu aaagagacu 19202819RNAArtificial SequenceSynthetic Construct 2028aggcugacua aagagacua 19202918RNAArtificial SequenceSynthetic Construct 2029ccgaguagcc cagggcau 18203018RNAArtificial SequenceSynthetic Construct 2030cgaguagccc agggcauu 18203118RNAArtificial SequenceSynthetic Construct 2031gaguagccca gggcauua 18203218RNAArtificial SequenceSynthetic Construct 2032aguagcccag ggcauuag 18203318RNAArtificial SequenceSynthetic Construct 2033guagcccagg gcauuagc 18203418RNAArtificial SequenceSynthetic Construct 2034uagcccaggg cauuagcu 18203518RNAArtificial SequenceSynthetic Construct 2035agcccagggc auuagcua 18203618RNAArtificial SequenceSynthetic Construct 2036gcccagggca uuagcuau 18203718RNAArtificial SequenceSynthetic Construct 2037cccagggcau uagcuaua 18203818RNAArtificial SequenceSynthetic Construct 2038ccagggcauu agcuauaa 18203918RNAArtificial SequenceSynthetic Construct 2039cagggcauua gcuauaag 18204018RNAArtificial SequenceSynthetic Construct 2040agggcauuag cuauaagg 18204118RNAArtificial SequenceSynthetic Construct 2041gggcauuagc uauaaggc 18204218RNAArtificial SequenceSynthetic Construct 2042ggcauuagcu auaaggcu 18204318RNAArtificial SequenceSynthetic Construct 2043gcauuagcua uaaggcug 18204418RNAArtificial SequenceSynthetic Construct 2044cauuagcuau aaggcuga 18204518RNAArtificial SequenceSynthetic Construct 2045auuagcuaua aggcugac 18204618RNAArtificial SequenceSynthetic Construct 2046uuagcuauaa ggcugacu 18204718RNAArtificial SequenceSynthetic Construct 2047uagcuauaag gcugacua 18204818RNAArtificial SequenceSynthetic Construct 2048agcuauaagg cugacuaa 18204918RNAArtificial SequenceSynthetic Construct 2049gcuauaaggc ugacuaaa 18205018RNAArtificial SequenceSynthetic Construct 2050cuauaaggcu gacuaaag 18205118RNAArtificial SequenceSynthetic Construct 2051uauaaggcug acuaaaga 18205218RNAArtificial SequenceSynthetic Construct 2052auaaggcuga cuaaagag 18205318RNAArtificial SequenceSynthetic Construct 2053uaaggcugac uaaagaga 18205418RNAArtificial SequenceSynthetic Construct 2054aaggcugacu aaagagac 18205518RNAArtificial SequenceSynthetic Construct 2055aggcugacua aagagacu 18205618RNAArtificial SequenceSynthetic Construct 2056ggcugacuaa agagacua 18205717RNAArtificial SequenceSynthetic Construct 2057cgaguagccc agggcau 17205817RNAArtificial SequenceSynthetic Construct 2058gaguagccca gggcauu 17205917RNAArtificial SequenceSynthetic Construct 2059aguagcccag ggcauua 17206017RNAArtificial SequenceSynthetic Construct 2060guagcccagg gcauuag 17206117RNAArtificial SequenceSynthetic Construct 2061uagcccaggg cauuagc 17206217RNAArtificial SequenceSynthetic Construct 2062agcccagggc auuagcu 17206317RNAArtificial SequenceSynthetic Construct 2063gcccagggca uuagcua 17206417RNAArtificial SequenceSynthetic Construct 2064cccagggcau uagcuau 17206517RNAArtificial SequenceSynthetic Construct 2065ccagggcauu agcuaua

17206617RNAArtificial SequenceSynthetic Construct 2066cagggcauua gcuauaa 17206717RNAArtificial SequenceSynthetic Construct 2067agggcauuag cuauaag 17206817RNAArtificial SequenceSynthetic Construct 2068gggcauuagc uauaagg 17206917RNAArtificial SequenceSynthetic Construct 2069ggcauuagcu auaaggc 17207017RNAArtificial SequenceSynthetic Construct 2070gcauuagcua uaaggcu 17207117RNAArtificial SequenceSynthetic Construct 2071cauuagcuau aaggcug 17207217RNAArtificial SequenceSynthetic Construct 2072auuagcuaua aggcuga 17207317RNAArtificial SequenceSynthetic Construct 2073uuagcuauaa ggcugac 17207417RNAArtificial SequenceSynthetic Construct 2074uagcuauaag gcugacu 17207517RNAArtificial SequenceSynthetic Construct 2075agcuauaagg cugacua 17207617RNAArtificial SequenceSynthetic Construct 2076gcuauaaggc ugacuaa 17207717RNAArtificial SequenceSynthetic Construct 2077cuauaaggcu gacuaaa 17207817RNAArtificial SequenceSynthetic Construct 2078uauaaggcug acuaaag 17207917RNAArtificial SequenceSynthetic Construct 2079auaaggcuga cuaaaga 17208017RNAArtificial SequenceSynthetic Construct 2080uaaggcugac uaaagag 17208117RNAArtificial SequenceSynthetic Construct 2081aaggcugacu aaagaga 17208217RNAArtificial SequenceSynthetic Construct 2082aggcugacua aagagac 17208317RNAArtificial SequenceSynthetic Construct 2083ggcugacuaa agagacu 17208417RNAArtificial SequenceSynthetic Construct 2084gcugacuaaa gagacua 17208516RNAArtificial SequenceSynthetic Construct 2085gaguagccca gggcau 16208616RNAArtificial SequenceSynthetic Construct 2086aguagcccag ggcauu 16208716RNAArtificial SequenceSynthetic Construct 2087guagcccagg gcauua 16208816RNAArtificial SequenceSynthetic Construct 2088uagcccaggg cauuag 16208916RNAArtificial SequenceSynthetic Construct 2089agcccagggc auuagc 16209016RNAArtificial SequenceSynthetic Construct 2090gcccagggca uuagcu 16209116RNAArtificial SequenceSynthetic Construct 2091cccagggcau uagcua 16209216RNAArtificial SequenceSynthetic Construct 2092ccagggcauu agcuau 16209316RNAArtificial SequenceSynthetic Construct 2093cagggcauua gcuaua 16209416RNAArtificial SequenceSynthetic Construct 2094agggcauuag cuauaa 16209516RNAArtificial SequenceSynthetic Construct 2095gggcauuagc uauaag 16209616RNAArtificial SequenceSynthetic Construct 2096ggcauuagcu auaagg 16209716RNAArtificial SequenceSynthetic Construct 2097gcauuagcua uaaggc 16209816RNAArtificial SequenceSynthetic Construct 2098cauuagcuau aaggcu 16209916RNAArtificial SequenceSynthetic Construct 2099auuagcuaua aggcug 16210016RNAArtificial SequenceSynthetic Construct 2100uuagcuauaa ggcuga 16210116RNAArtificial SequenceSynthetic Construct 2101uagcuauaag gcugac 16210216RNAArtificial SequenceSynthetic Construct 2102agcuauaagg cugacu 16210316RNAArtificial SequenceSynthetic Construct 2103gcuauaaggc ugacua 16210416RNAArtificial SequenceSynthetic Construct 2104cuauaaggcu gacuaa 16210516RNAArtificial SequenceSynthetic Construct 2105uauaaggcug acuaaa 16210616RNAArtificial SequenceSynthetic Construct 2106auaaggcuga cuaaag 16210716RNAArtificial SequenceSynthetic Construct 2107uaaggcugac uaaaga 16210816RNAArtificial SequenceSynthetic Construct 2108aaggcugacu aaagag 16210916RNAArtificial SequenceSynthetic Construct 2109aggcugacua aagaga 16211016RNAArtificial SequenceSynthetic Construct 2110ggcugacuaa agagac 16211116RNAArtificial SequenceSynthetic Construct 2111gcugacuaaa gagacu 16211216RNAArtificial SequenceSynthetic Construct 2112cugacuaaag agacua 16211315RNAArtificial SequenceSynthetic Construct 2113aguagcccag ggcau 15211415RNAArtificial SequenceSynthetic Construct 2114guagcccagg gcauu 15211515RNAArtificial SequenceSynthetic Construct 2115uagcccaggg cauua 15211615RNAArtificial SequenceSynthetic Construct 2116agcccagggc auuag 15211715RNAArtificial SequenceSynthetic Construct 2117gcccagggca uuagc 15211815RNAArtificial SequenceSynthetic Construct 2118cccagggcau uagcu 15211915RNAArtificial SequenceSynthetic Construct 2119ccagggcauu agcua 15212015RNAArtificial SequenceSynthetic Construct 2120cagggcauua gcuau 15212115RNAArtificial SequenceSynthetic Construct 2121agggcauuag cuaua 15212215RNAArtificial SequenceSynthetic Construct 2122gggcauuagc uauaa 15212315RNAArtificial SequenceSynthetic Construct 2123ggcauuagcu auaag 15212415RNAArtificial SequenceSynthetic Construct 2124gcauuagcua uaagg 15212515RNAArtificial SequenceSynthetic Construct 2125cauuagcuau aaggc 15212615RNAArtificial SequenceSynthetic Construct 2126auuagcuaua aggcu 15212715RNAArtificial SequenceSynthetic Construct 2127uuagcuauaa ggcug 15212815RNAArtificial SequenceSynthetic Construct 2128uagcuauaag gcuga 15212915RNAArtificial SequenceSynthetic Construct 2129agcuauaagg cugac 15213015RNAArtificial SequenceSynthetic Construct 2130gcuauaaggc ugacu 15213115RNAArtificial SequenceSynthetic Construct 2131cuauaaggcu gacua 15213215RNAArtificial SequenceSynthetic Construct 2132uauaaggcug acuaa 15213315RNAArtificial SequenceSynthetic Construct 2133auaaggcuga cuaaa 15213415RNAArtificial SequenceSynthetic Construct 2134uaaggcugac uaaag 15213515RNAArtificial SequenceSynthetic Construct 2135aaggcugacu aaaga 15213615RNAArtificial SequenceSynthetic Construct 2136aggcugacua aagag 15213715RNAArtificial SequenceSynthetic Construct 2137ggcugacuaa agaga 15213815RNAArtificial SequenceSynthetic Construct 2138gcugacuaaa gagac 15213915RNAArtificial SequenceSynthetic Construct 2139cugacuaaag agacu 15214015RNAArtificial SequenceSynthetic Construct 2140ugacuaaaga gacua 15

Claims

1. A method of modulating splicing of an SCN8A pre-mRNA comprising: contacting a plurality of cells with splice modulating oligonucleotide (SMO) that specifically binds a complementary sequence of a pre-mRNA that undergoes splicing to form an mRNA encoding the voltage gated sodium channel subunit SCN8A , wherein the SMO sequence directs exclusion of exon 5A or exon 18A in the SCN8A pre-mRNA; in the plurality of cells expressing SCN8A pre-mRNA.

2. The method of claim 1 wherein the plurality of cells are in vitro.

3. The method of claim 1 wherein the plurality of cells are in vivo.

4. The method of claim 1 wherein the SMO specifically binds to a complementary sequence on a pre-mRNA in at least one of the group consisting of an intron-exon splice site, an exonic splice enhancer (ESE) site, and an intronic splice enhancer (ISE) site, in the plurality of cells to produce at least a 5 percent decrease in exon 18A inclusion in an SCN8A RNA compared to baseline untreated cells and alters expression of SCN8A or one or more isoforms thereof.

5. The method of claim 1 wherein the SMO specifically binds to a complementary sequence on a pre-mRNA in at least one of the group consisting of an intron-exon splice site, an exonic splice enhancer (ESE) site, and an intronic splice enhancer (ISE) site, in the plurality of cells to produce at least a 5 percent decrease in exon 5A inclusion in an SCN8A RNA compared to baseline untreated cells and alters expression of SCN8A or one or more isoforms thereof.

6. The method of claim 1 wherein the plurality of cells are in vivo and the SMO sequence is administered into a subject and into contact with the plurality of cells through a route of oral, rectal, intracerebroventricular, intracranial, intratumoral, intrathecal, intracisternal, epidural, intravaginal, parenteral, intravenous, intramuscular, subcutaneous, local, intraperitoneal, transdermal, or by inhalation or as a buccal or nasal spray.

7. The method of claim 6 wherein the subject has a disorder with symptoms, the symptoms being reduced by reduced excitation functionality of an SCN8A protein encoded by the SCN8A RNA.

8. The method of any one of claims 1 to 5 wherein the splice modulating oligonucleotide (SMO) sequence is completely selective towards the SCN8A pre-mRNA relative to highly related voltage gated sodium channel subunits.

9. The method of any one of claims 1 to 5 wherein the plurality of cells are human cells.

10. The method of any one of claims 1 to 5 wherein the plurality of cells are mouse cells.

11. The method of any one of claims 1 to 5 wherein the plurality of cells are rat cells.

12. The method of any one of claims 1 to 5 wherein the plurality of cells are non-human primate cells.

13. A composition for performing the method of claim 1 comprising: a splice modulating oligonucleotide (SMO) sequence consisting of 15 to 24 nucleotides that are complementary to an exonic or intronic sequence within intron 4, exon 5A, exon 5N, intron 5A, or intron 5N, intron 17, exon 18A, exon 18N, intron 18A, or intron 18N an SCN8A pre-mRNA and an optional one or two additional nucleotides; and a carrier for delivery of the SMO sequence to a plurality of cells.

14. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.: 26, 33, or 40.

15. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.: 1306, 1307, 1324, 1327, 1422, or 1541.

16. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.: 4-39, 86-120, 169-202, 253-285, 338-369, 424-454, 511-540, 599-627, 688-715, or 778-804.

17. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 295-1309, 1352-1356, 1410-1424, 1469-1483, 1529-1543, 1590-1604, 1652-1666, 1715-1729, 1779-1793, 1844-1858, 1861-1869, 1889-1896, 1917-1923, 1945-1950, 1973-1977, 2001-2004, 2029-2031, 2057-2058, or 2085.

18. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 4-60, 86-142, 169-225, 253-309, 338-394, 424-480, 511-567, 599-655, 688-744, or 778-834.

19. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 860-964, 1261-1275, 1295-1309, 1317-1332, 1352-1356, 1374-1390, 1410-1424, 1432-1449, 1469-1483, 1491-1509, 1529-1543, 1551-1570, 1590-1604, 1612-1632, 1652-1666, 1674-1695, 1715-1729, 1737-1759, 1779-1793, 1801-1824, 1844-1858 1861-1869, 1889-1896, 1917-1923, 1945-1950, 1973-1977, 2001-2004, 2029-2031, 2057-2058, or 2085.

20. The composition of claims 13 to 19 wherein at least one nucleotide in said SMO contains a non-naturally occurring modification comprising at least one of a chemical composition of phosphorothioate 2'-O-methyl, phosphorothioate 2'-MOE, locked nucleic acid (LNA) including a constrained ethyl nucleic acid (cEt), peptide nucleic acid (PNA), phosphorodiamidate morpholino, cholesterol modified or any combination thereof.

21. The composition of any one of claims 13 to 19 wherein at least one of the 15 to 24 nucleotides is a phosphorothioate 2'-O-methyl modified nucleotide.