PEPTIDE TARGETING MYCOBACTERIUM TUBERCULOSIS TOXIN-ANTITOXIN SYSTEM AND USE THEREOF

Abstract

The present invention relates to a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a use thereof. Specifically, the antibiotic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting an active site of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the antibiotic peptide can be usefully used as an antibiotic composition against Mycobacterium tuberculosis.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

[0001] The present invention relates to a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a use thereof.

2. Description of the Related Art

[0002] Tuberculosis is an acute and chronic disease which is infectious and contagious that can occur anywhere in the body. It is a terrible disease that can even lead to death. Approximately 85% of tuberculosis is developed in the lung and can be spread to any organ in the body through blood stream or lymph nodes. Tuberculosis is transmitted through the air from cough, runny nose and sputum of a patient. Approximately 9 million people were infected with tuberculosis in 2013, among which about 1.5 million people were dead. In addition, because of the emergence of multidrug-resistant tuberculosis and even fully resistant tuberculosis, it is requested to develop a novel antimicrobial agent to treat Mycobacterium tuberculosis.

[0003] A toxin-antitoxin gene was first known to play a certain role in maintaining E. coli plasmid. When the plasmid containing the toxin-antitoxin gene is lost, the toxin with a stable structure is retained, but the antitoxin protein with an unstable structure is degraded, leading to the destruction of E. coli eventually. Since the toxin-antitoxin gene was first identified, it has been found that the toxin-antitoxin gene is present not only in the plasmid but also in the chromosome of E. coli. It is known that the gene above is involved in multidrug resistance, biofilm formation and growth inhibition under stress situations.

[0004] Toxin-antitoxin systems can be largely divided into three types (Type I, II and III). In type I system, an antitoxin in the form of RNA binds to a toxin in the form of RNA to eliminate the toxicity. In type II system, an antitoxin in the form of protein binds to a toxin in the form of protein to eliminate the toxicity. In type III systems, an antitoxin in the form of RNA binds to a toxin in the form of protein to eliminate the toxicity.

[0005] Among these three types, type II system has been most studied. In type II system, toxin and antitoxin genes are coded through operon. Under the difficult external conditions for bacteria, such as elevated temperature or depletion of nutrients, unstable antitoxins are decomposed by stress-inducing proteolytic enzymes and accordingly cannot neutralize the toxin's toxicity, resulting in cell death. The largest part of type II system is VapBC family, and the toxin portion (VapC) of the VapBC family is known to inhibit cell growth based on the RNase activity thereof.

[0006] If the formation of the toxin-antitoxin complex can be artificially inhibited, the toxic toxin would not be neutralized and therefore cell would be eventually dead. Thus, the toxin-antitoxin system is an attractive target for the development of novel antibiotics.

[0007] In Mycobacterium tuberculosis, more than half of the toxin-antitoxin systems are found to belong to VapBC family. Such VapBC family is involved in the extreme incubation period and drug resistance of Mycobacterium tuberculosis.

[0008] Thus, the present inventors tried to develop a therapeutic agent for tuberculosis targeting the toxin-antitoxin protein complex. In the course of our study, the inventors identified the structure of the VapBC26 complex of Mycobacterium tuberculosis, based on which the inventors designed a peptide that can obstruct the formation of a toxin-antitoxin protein complex and confirmed that the peptide was able to inhibit the formation of the toxin-antitoxin protein complex in vitro successfully, leading to the completion of the present invention.

SUMMARY OF THE INVENTION

[0009] It is an object of the present invention to provide a peptide targeting a toxin-antitoxin system of Mycobacterium tuberculosis and a composition comprising the same as an active ingredient.

[0010] To achieve the above object, the present invention provides an antibiotic peptide that inhibits the binding of an antitoxin protein to any one or more residues selected from the group consisting of .alpha.3 and .alpha.4 of a Mycobacterium tuberculosis toxin protein.

[0011] The present invention also provides an antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0012] The present invention also provides an antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0013] The present invention also provides an antibiotic external preparation against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0014] The present invention also provides a method for preventing, ameliorating or treating Mycobacterium tuberculosis comprising a step of administering the antibiotic peptide to a subject.

[0015] In addition, the present invention provides a use of the antibiotic peptide for the preparation of antibiotics against Mycobacterium tuberculosis.

Advantageous Effect

[0016] The antibiotic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting an active site of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the antibiotic peptide can be usefully used as an antibiotic composition against Mycobacterium tuberculosis.

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIGS. 1a and 1b are diagrams showing the results of multi-angle light scattering (MALS) combined with size exclusion chromatography performed to determine the structures of VapB26 and VapBC26.

[0018] FIGS. 2a.about.2d are schematic diagrams showing the structure of the VapBC26 complex.

[0019] FIGS. 3a.about.3d are diagrams showing the shapes of VapBC26 hetero-octamer, VapC26 dimer, VapB26 dimer and VapBC26 hetero-dimer from various aspects.

[0020] FIG. 4 is a diagram showing the interface of the hetero-dimer formed between VapB26 and VapC26.

[0021] FIGS. 5a.about.5d are diagrams showing the hydrophobic interface and active site of the homozygous dimer formed between two VapC26s.

[0022] FIGS. 6a.about.6d are diagrams showing the interface of the homo-dimer formed between two VapB26s.

[0023] FIGS. 7a and 7b are diagrams showing the structures of the VapBC26 complex and VapB proteins compared to their homologs.

[0024] FIG. 8 is a diagram showing the comparison of the nucleotide sequences of VapC proteins of Mycobacterium tuberculosis, Shigella flexneri and Rickettsia felis strains.

[0025] FIGS. 9a.about.9d are diagrams showing the ribonuclease activity of VapC26 measured using a mimetic peptide to VapC26 .alpha.4 (9a, 9b (mimetic peptide concentration fixation)), the ribonuclease activity measured using the VapBC26 complex and the mutant complex thereof (9c) and the results of size exclusion chromatography performed using the same (9d).

[0026] FIG. 10 is a diagram showing the ribonuclease activity of VapBC26 measured when the mimetic peptides .alpha.3 and .alpha.4 were added respectively or together.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] Hereinafter, the present invention is described in detail.

[0028] The present invention provides an antibiotic peptide that inhibits the binding of an antitoxin protein to any one or more residues selected from the group consisting of .alpha.3 and .alpha.4 of a Mycobacterium tuberculosis toxin protein.

[0029] The said peptide can be synthesized by the conventional chemical synthesis method in the art (W. H. Freeman and Co., Proteins; structures and molecular principles, 1983). Particularly, the peptide can be synthesized by solution phase peptide synthesis, solid-phase peptide syntheses, fragment condensation, and F-moc or T-BOC chemical method, and more particularly, it can be synthesized by solid-phase peptide synthesis.

[0030] The peptide of the present invention can also be prepared by the following genetic engineering method. First, a DNA sequence encoding the peptide is constructed according to the conventional method. The DNA sequence can be prepared by PCR amplification using appropriate primers. Alternatively, the DNA sequence can be synthesized by the standard method known in the art, such as using automated DNA synthesizers (eg, products of Biosearch or Applied Biosystems).

[0031] The DNA sequence is inserted into a vector comprising one or more expression control sequences (eg, promoters, enhancers, etc.) that are operably linked thereto to regulate the DNA sequence expression. The host cell is transformed with the recombinant expression vector formed therefrom, and the resulting transformant is cultured under the appropriate media and conditions to allow the DNA sequence to be expressed. Then, the substantially pure peptide encoded by the DNA sequences is recovered from the culture product using the method known in the art (eg, chromatography). The genetic engineering method for the peptide synthesis of the present invention can be referred to the following literature: Maniatis et al., Molecular Cloning; A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., Second (1998) and Third (2000) Edition; Gene Expression Technology, Method in Enzymology, Genetics and Molecular Biology, Method in Enzymology, Guthrie & Fink (eds.), Academic Press, San Diego, Calif., 1991; and Hitzeman et al., J. Biol. Chem., 255:12073-12080, 1990.

[0032] The toxin protein can be composed of the amino acid sequence represented by SEQ. ID. NO: 15.

[0033] The said .alpha.3 and .alpha.4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, .alpha.3 can be composed of the 37.sup.th to 52.sup.nd amino acid sequence of VapC26. In addition, .alpha.4 can be composed of the 54.sup.th to 65.sup.th amino acid sequence of VapC26.

[0034] The peptide can include a polypeptide consisting of any sequence known in the art. In an embodiment of the present invention, the peptide can be composed of any one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 11.about.13. More particularly, the peptide can be a peptide consisting of the amino acid sequence represented by SEQ ID NO: 12.

[0035] The peptide can be a variant of an amino acid sequence having a different sequence formed by deletion, insertion, substitution, or a combination thereof of amino acid residues within a range that does not affect the function of the protein. Amino acid exchange in proteins or peptides that does not alter the activity of the molecule as a whole is known in the art. In some cases, it can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. Therefore, the present invention can include a polypeptide having an amino acid sequence substantially identical to a polypeptide having an amino acid sequence represented by any one or more sequences selected from the group consisting of SEQ ID NOs: 11.about.13, and a variant or a fragment thereof. The said substantially identical polypeptide can have homology with at least 80%, specifically at least 90% and more specifically at least 95% with the polypeptide of the present invention. In addition, the peptide does not affect the activity of the toxin.

[0036] In a preferred embodiment of the present invention, the present inventors identified the structure of VapBC26 to synthesize an antibiotic peptide that can inhibit toxin-antitoxin binding. To do so, the VapBC26 protein complex, toxin (VapC26) and antitoxin (VapB26) proteins of Mycobacterium tuberculosis were isolated and purified. Then, the molecular weight of the VapBC26 protein complex was confirmed almost similar to the theoretical molecular weight of the VapBC26 hetero-octamer model by performing the experiments such as multi-angle light scattering and sitting-drop vapor diffusion, and the specific structure was determined (see FIGS. 1.about.7).

[0037] According to the structure confirmed above, seven peptides were designed that mimic the binding region of the toxin without affecting the toxin. When they were treated with the VapBC26 protein complex, the formation of the protein complex was inhibited (see FIGS. 9 and 10). By further experiments, it was confirmed that the Tyr51 region of VapB26 played the most important role in the interaction between VapB26 and VapC26 (see FIG. 9).

[0038] Thus, the synthetic peptide of the present invention inhibited the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin, thereby inducing the death of Mycobacterium tuberculosis by means of a separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic peptide against Mycobacterium tuberculosis.

[0039] The present invention also provides an antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0040] The antibiotic composition against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of .alpha.3 and .alpha.4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

[0041] The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The .alpha.3 and .alpha.4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, .alpha.3 can be composed of the 37.sup.th to 52.sup.nd amino acid sequence of VapC26. In addition, .alpha.4 can be composed of the 54.sup.th to 65.sup.th amino acid sequence of VapC26.

[0042] The peptide can include a polypeptide consisting of any sequence known in the art. In an embodiment of the present invention, the peptide can be composed of any one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 11.about.13. More particularly, the peptide can be a peptide consisting of the amino acid sequence represented by SEQ ID NO: 12.

[0043] The peptide can be a variant of an amino acid sequence having a different sequence formed by deletion, insertion, substitution, or a combination thereof of amino acid residues within a range that does not affect the function of the protein. Amino acid exchange in proteins or peptides that does not alter the activity of the molecule as a whole is known in the art. In some cases, it can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. Therefore, the present invention can include a polypeptide having an amino acid sequence substantially identical to a polypeptide having an amino acid sequence represented by any one or more sequences selected from the group consisting of SEQ ID NOs: 11.about.13, and a variant or a fragment thereof. The said substantially identical polypeptide can have homology with at least 80%, specifically at least 90% and more specifically at least 95% with the polypeptide of the present invention. In addition, the peptide does not affect the activity of the toxin.

[0044] The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the peptide can be effectively used as an antibiotic composition against Mycobacterium tuberculosis.

[0045] The antibiotic composition comprising the antibiotic peptide of the present invention preferably contains the antibiotic peptide at the amount of 0.1 to 50 weight % by the total weight of the composition, but not always limited thereto.

[0046] The composition of the present invention can further include suitable carriers, excipients and diluents commonly used in the preparation of a medicine.

[0047] The composition of the present invention can be formulated for oral administration, for example powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and for parenteral administration, for example external use, suppositories and sterile injections, etc. The carriers, excipients and diluents are exemplified by lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Formulations can be prepared by using generally used excipients or diluents such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactant. Solid formulations for oral administration are tablets, pills, powders, granules and capsules. These solid formulations are prepared by mixing one or more suitable excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. Except for the simple excipients, lubricants, for example magnesium stearate, talc, etc, can be used. Liquid formulations for oral administrations are suspensions, solutions, emulsions and syrups, and the above-mentioned formulations can contain various excipients such as wetting agents, sweeteners, aromatics and preservatives in addition to generally used simple diluents such as water and liquid paraffin. Formulations for parenteral administration are sterilized aqueous solutions, water-insoluble excipients, suspensions, emulsions, lyophilized preparations, suppositories and injections. Water insoluble excipients and suspensions can contain, in addition to the active compound or compounds, propylene glycol, polyethylene glycol, vegetable oil like olive oil, injectable ester like ethylolate, etc. Suppositories can contain, in addition to the active compound or compounds, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, etc.

[0048] The present invention also provides an antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0049] The antibiotic quasi-drug against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of .alpha.3 and .alpha.4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

[0050] The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The .alpha.3 and .alpha.4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, .alpha.3 can be composed of the 37.sup.th to 52.sup.nd amino acid sequence of VapC26. In addition, .alpha.4 can be composed of the 54.sup.th to 65.sup.th amino acid sequence of VapC26. The peptide does not affect the activity of the toxin.

[0051] The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic quasi-drug against Mycobacterium tuberculosis.

[0052] When the composition of the present invention is used as a quasi-drug additive, the peptide can be added as it is, or used together with other quasi-drugs or quasi-drug components, and can be appropriately used according to the conventional method. The mixing amount of the active ingredient can be appropriately determined according to the purpose of use.

[0053] The quasi-drug composition of the present invention is preferably disinfectant cleaner, shower foam, gagreen, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, patch or filter filler, but not always limited thereto.

[0054] The present invention also provides an antibiotic external preparation against Mycobacterium tuberculosis comprising the antibiotic peptide as an active ingredient.

[0055] The antibiotic external preparation against Mycobacterium tuberculosis can inhibit any one or more residues selected from the group consisting of .alpha.3 and .alpha.4 of a Mycobacterium tuberculosis toxin protein from binding to an antitoxin protein. Therefore, it is possible to suppress the formation of the VapBC26 complex, which is a conjugate of toxin-antitoxin of Mycobacterium tuberculosis.

[0056] The toxin protein can be composed of the amino acid sequence represented by SEQ ID NO: 15. The .alpha.3 and .alpha.4 can be the residues involved in binding of VapC26 and VapB26. Particularly, in an embodiment of the present invention, .alpha.3 can be composed of the 37.sup.th to 52.sup.nd amino acid sequence of VapC26. In addition, .alpha.4 can be composed of the 54.sup.th to 65.sup.th amino acid sequence of VapC26. The peptide does not affect the activity of the toxin.

[0057] The synthetic peptide of the present invention inhibits the formation of a toxin-antitoxin protein complex of Mycobacterium tuberculosis without affecting the activity of the toxin (see FIGS. 9 and 10), thereby inducing the death of Mycobacterium tuberculosis by means of the separated toxin. Therefore, the synthetic peptide can be effectively used as an antibiotic external preparation against Mycobacterium tuberculosis.

[0058] The present invention also provides a method for preventing, ameliorating or treating Mycobacterium tuberculosis comprising a step of administering the antibiotic peptide to a subject.

[0059] The antibiotic peptide of the present invention can have the characteristics as described above. The subject may be a mammal, specifically a human.

[0060] The composition of the present invention can be administered orally or parenterally, and any parenteral administration can be used. At this time, systemic or topical administration is possible, but systemic administration is more preferred, and intravenous administration is most preferred.

[0061] The effective dosage of the composition of the present invention can be determined according to condition and weight of a patient, severity of a disease, form of a drug, administration pathway and duration by those skilled in the art. However, for the desired effect, the effective dosage of the antibiotic peptide of the present invention is 1-2 mg/kg, preferably 0.5-1 mg/kg, and can be administered 1 to 3 times a day.

[0062] The antibiotic composition of the present invention can be administered to a patient in the form of bolus, by single dose having relatively short period of infusion or by multiple dose of fractionated treatment protocol for a long term.

[0063] In addition, the present invention provides a use of the antibiotic peptide for the preparation of antibiotics against Mycobacterium tuberculosis.

[0064] The antibiotic peptide of the present invention can have the characteristics as described above.

[0065] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

[0066] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

<Example 1> Expression and Purification of Toxin (VapC26) and Antitoxin (VapB26) Protein

[0067] The present inventors performed the following process to obtain Mycobacterium tuberculosis toxin (VapC26), antitoxin (VapB26) and a toxin-antitoxin (VapBC26) protein complex.

[0068] <1-1> Cloning and Transformation of Toxin and Antitoxin Genes

[0069] First, the gene Rv0582 (Bioneer Innovation, Korea) encoding the toxin protein VapC26 of Mycobacterium tuberculosis and the gene Rv0581 (Bioneer Innovation, Korea) encoding the antitoxin protein VapB26 were amplified by PCR (polymerase chain reaction). The sequence of each primer used for PCR is as follows.

TABLE-US-00001 TABLE 1 SEQ. ID. Gene Primer NO: VapC26 5'-GGAA TTC CAT ATG ATC GAC ACG SEQ. ID. AGT GCG-3'(forward) NO: 1 5'-CCG CTC GAG TTA CGG AAT GAC SEQ. ID. GGT GAA CGC CCC-3'(reverse) NO: 2 VapB26 5'-G GAA TTC CAT ATG GAC AAG ACG SEQ. ID. ACG GTC-3'(forward) NO: 3 5'-TTA CCG CTC GAG CCG CTC SEQ. ID. ACCGAAGCCAGC CAG-3'(reverse) NO: 4 VapB26 5'- SEQ. ID. (for GGCGGGGCCTGGGAGATGGCCAACTGCGGT NO: 5 muta- GCC-3'(forward) tion) 5'- SEQ. ID. GGCACCGCAGTTGGCCATCTCCCAGGCCCC NO: 6 GCC-3'(reverse)

[0070] VapC26 was obtained by performing size exclusion chromatography using HiLoad 16/60 Superdex 75 prep-grade column (GE Healthcare) under the same buffer condition as used in the purification of apBC26.

<Example 2> Multi-Angle Light Scattering Combined with Size Exclusion Chromatography

[0071] Multi-angle light scattering (MALS) was performed to determine the oligomer structures of VapB26 and VapBC26.

[0072] Size exclusion chromatography was performed by using 1260 Infinity HPLC system (Agilent Technologies) with BioSep SEC-s3000 column (Phenomenex). Scattering data were obtained from the miniDAWN-TREOS line (Wyatt Technology) at 657.4 nm for emission and analyzed with ASTRA 6.0.1.10 software (Wyatt Technology). For the experiment, 100 .mu.M of VapB26 and VapBC26 were used. VapB26 was analyzed in a buffer containing 20 mM MES (pH 6) and 50 mM NaCl, which was the condition of NMR experiment, and VapBC26 was analyzed in a buffer containing 50 mM Tris-HCl (pH 7.9), 500 mM NaCl and 250 mM imidazole, which was the condition of protein crystallization experiment. All experiments were performed at room temperature.

[0073] As a result, as shown in FIGS. 1a and 1b, it was confirmed that the molecular weight of the VapBC26 protein complex was 97.5.+-.1.6 kDa, which was almost similar to the theoretical molecular weight (97.0 kDa) of the hetero-octamer model of VapBC26 (FIGS. 1a and 1b).

<Example 3> Structural Analysis of Toxin and Antitoxin Proteins

[0074] <3-1> Formation of Toxin-Antitoxin (VapBC26) Protein Complex Crystal and Data Analysis

[0075] Sitting-drop vapor diffusion was performed to confirm the crystal structure of the VapBC26 protein complex purified in Example 1.

[0076] Samples were prepared by mixing 1 of the VapBC26 protein complex solution dissolved in 50 mM Tris-HCl at the concentration of 5 mg/ with 250 mM imidazole containing 1 of reservoir solution. Initial crystal screening with the VapBC26 protein complex was performed using crystal screening 1, 2 and Index 1, 2 kit (Hamton Research). Crystals of the VapBC26 complex were grown at 4.degree. C., and 25% Taximate (pH 7.0) was used as a crystallization solution. The crystals were frozen immediately with liquid nitrogen because severe cracking damage occurred when they were contacted with glycerol containing a cryoprotectant.

[0077] Data were collected using beamline 7A and ADSC Quantum Q270 CCD detector in Pohang Accelerator Center (Korea). As a result, as shown in Table 2, the unit cell parameters of the crystals of the native VapBC26 complex were as follows: a=64.35 .ANG., b=64.35 .ANG., c=216.96 .ANG. and .alpha.=.beta.=.gamma.=90.degree.. The unit cell parameters of the crystals of the VapBC26 substituted with selenomethionine (SeMet) were as follows: a=64.22 .ANG., b=64.22 .ANG., c=216.13 .ANG. and .alpha.=.beta.=.gamma.=90.degree.. Both proteins belonged to the square space group P41. On the other hand, the calculated total mass of the protein complex containing His-6 tag at N terminus was 24,116.3 Da. At this time, all data were processed using HKL2000 software. The structure of the VapBC26 complex of Mycobacterium tuberculosis was analyzed at 2.65 .ANG. resolution by single wavelength anomalous dispersion using SeMet (2.55 .ANG. to the native complex crystals) (Table 2a).

[0078] In addition, the mutation of Met50 did not affect the folding of the protein, the structures of the two complexes were almost the same, and the pattern of protein-protein interaction was also the same (Table 2b). The native complex crystals showed slightly better resolution. However, the selenomethionine-substituted crystals were analyzed as with the native complex, and the crystallization conditions and spatial groups were the same, so further analysis was performed using the data of SeMet.

TABLE-US-00002 TABLE 2 Data Collection Se-Met Native (a) Data Collection X-ray source 7A beamline of 7A beamline of PLS PLS X-ray wavelength(.ANG.) 0.9794 0.9795 Space group P4.sub.1 P4.sub.1 Unit cell parameters/a, 64.22, 64.22, 64.35, 64.35, b, c(.ANG.) 216.13 216.96 Unit cell parameters .alpha., c = 233.03 c = 232.79 .beta., .gamma.(.degree.) Resolution range(.ANG.) 30-2.65 50-2.65 molecules per ASU 4 VapBC26 4 VapBC26 heterodimers heterodimers observed reflections(>1.sigma.) 619653 105433 unique reflections 25229 27340 Completeness(%) 99.8(100).sup.e 94.9(99.1).sup.e <I/.sigma.(I)> 70.20(10.87).sup.e 34.98(3.93).sup.e multiplicity.sup.a 24.6(25.4).sup.e 3.9(4.2).sup.e R.sub.merge.sup.b 11.3(54.3).sup.e 7.8(67).sup.e (b) Additional Analysis R.sub.work.sup.c 20.8 22.8 R.sub.free.sup.d 23.9 28.4 No. of atoms/average B-factor(.ANG..sup.2) Protein 6170/61.0 5978/79.8 Water oxygen 65/47.9 54/83.1 RMSD.sup.f from ideal geometry Bond distance(.ANG.) 0.006 0.007 Bond angle(.degree.) 1.25 1.27 Ramachandran statistics Most favored 96.2 95.5 regions(%) Additional allowed 3.7 4.4 regions(%) Residues in disallowed 0.1 0.1 regions(%) .sup.aN.sub.obs/Nu.sub.nique .sup.bR.sub.merge = .SIGMA.(I - <I>)I .SIGMA.<I> .sup.cR.sub.work = .SIGMA..sub.hkl||F.sub.obs| - k|F.sub.calc||/.SIGMA..sub.hkl|F.sub.obs| .sup.dR.sub.work value was calculated at the remaining reflection. .sup.eThe value in the insert is the highest resolution shell value. .sup.fRMSD(Root mean square deviation) was obtained using REFMAC .TM..

[0079] <3-2> Confirmation of Toxin-Antitoxin (VapBC26) Protein Complex Structure

[0080] The crystal structure of the VapBC26 protein complex of Mycobacterium tuberculosis was confirmed based on the data obtained in Example <3-1>.

[0081] The asymmetric unit of the VapBC26 protein complex crystal included four VapB26 and four VapC26 proteins in a hetero-octameric assembly. Four of the heterodimeric VapBC26 protein complexes were included in the asymmetric unit. A VapB26 dimer was bound to two VapC26 monomers, and the two VapB2C2 complexes were linked to each other by a double axis. A flexible hinge loop of the antitoxin was confirmed to envelope the toxin protein by a hook known as the looped arm shape (FIGS. 2a.about.2d and FIGS. 3a.about.3d).

[0082] In the structure of the VapBC26 protein complex heterodimer, VapB26 was linked to VapC26 through the deep valley formed by four .alpha.-helices (.alpha.1-4) of VapC26 (FIG. 4). At this time, two C-terminal segments of VapB26, Arg59-Val61 and Phe68-Glu70 rotated at the binding interface, and the residues of Asp62, Glu63 and Leu64 formed 310-helix. The long loop between .alpha.2- and .alpha.3-helices of VapB26 contributed to the binding to VapC26 through hydrophobic interactions involving the following VapB26 residues: Pro44, Pro46, Tyr51, Ala52, Pro56, Ile57 and Ala58 of the loop between .alpha.2- and .alpha.3-helices; Val61, Leu64 and Leu65 of .alpha.3-helix; and Phe68 (FIG. 4).

[0083] On the other hand, the following residues were involved in binding in VapC26: Leu9, Ala10, Tyr11 and Phe12 of .alpha.1-helix; Tyr45, Leu46, Val47, Val51, Ala58 and Val59 of .alpha.3- and .alpha.4-helices; and Ala15, Pro17, Ile26, Leu33, Ala41, Ala67, Trp68 and Leu115 the loop between .alpha.4- and .alpha.5-helices.

[0084] Aromatic residues were involved in the formation of the VapB26 and VapC26 dimers as well as in the arrangement of the catalytic sites of VapC26 (FIG. 4). In addition, the interface of the VapBC26 protein complex was composed of the regions of 1174.1 .ANG..sup.2 (chains A and B), 1246 .ANG..sup.2 (chains C and D), 998.9 .ANG..sup.2 (chains E and F) and 1080.1 .ANG..sup.2 (chains G and H) (FIG. 4).

[0085] <3-3> Confirmation of Toxin (VapC26) Protein Structure

[0086] The structure of VapC26, a toxin protein of Mycobacterium tuberculosis, was confirmed based on the data obtained in Example <3-1>.

[0087] As a result, it was confirmed that VapC26 contained 7 .alpha.-helices and 5 .beta.-helices. In addition, as shown in FIG. 3, it was composed of the .alpha./.beta./.alpha. sandwich folded shape consisting of 5 .beta.-helices and 7 .alpha.-helices: .beta.1 (residues 1-4), .alpha.1 (residues 5-13), .alpha.2 (residues 18-27), .beta.2 (residues 33-36), .alpha.3 (residues 37-52), .alpha.4 (residues 54-65), .beta.3 (residues 68-71), .alpha.5 (residues 74-92), .alpha.6 (residues 94-108), .beta.4 (residues 110-114), .alpha.7 (residues 116-124) and .beta.5 (residues 129-134) (FIG. 3). On the other hand, four-stranded parallel sheets (.beta.2-.beta.1-.beta.4-.beta.5) were surrounded by 5 .alpha.-helices with two remaining .alpha.-helices (.alpha.3 and .alpha.4) located outward of the structure.

[0088] In VapC26, .alpha.5-helix of one monomer was in contact with .alpha.3- and .beta.4-helices of another adjacent monomer and .alpha.3-helices formed homodimers through partial hydrophobic interactions in the middle of the interface. In particular, Pro37, Tyr38, Val40 and Ala41 residues were involved in the contact of .alpha.3-.alpha.3 and Leu57, Leu60 and Ala64 residues of .alpha.4-helix were interacted with Ala75, Ile78, Ala82 and Val85 of .alpha.5-helix (FIG. 5a). Among them, Ile78 played an important role in dimerization of VapC26 by participating in hydrophobic interactions with Val40, Leu60, Ala64 and Leu70. In addition, Ile95 of .alpha.6-helix was involved in the hydrophobic interaction associated dimerization with Val40, Ala41 and Leu60 (FIG. 5b). That is, more than 30 residues in total were involved in the formation of dimmers (FIG. 5A). The interface of the VapC26 homodimer had an average area of about 1085 .ANG..sup.2 (1065.1 .ANG..sup.2 between chains B and H; and 1104.8 .ANG..sup.2 between chains D and F). The active site of VapC26 was formed by .beta.1-.alpha.1 loops, .alpha.3, .alpha.6, .beta.3 and .beta.7 loops. The metal coordination site of VapC26 was surrounded by the carboxylic acid oxygen atoms located at four well-conserved residues of Asp4 (N terminus of .alpha.1-helix), Glu42 (.alpha.3-helix), Asp97 (.alpha.6-helix) and Asp116 (.alpha.7-helix) (FIG. 5c). In addition, these four acidic residues were composed of negatively charged pockets at the active site (FIG. 5d).

[0089] <3-4> Confirmation of Antitoxin (VapB26) Protein Structure

[0090] The structure of VapB26, an antitoxin protein of Mycobacterium tuberculosis, was confirmed based on the data obtained in Example <3-1>.

[0091] As a result, it was confirmed that VapB26 contained 3 .alpha.-helices and one .beta.-strand having .beta.1-.alpha.1-.beta.2-.beta.3 status. The four secondary structural elements corresponded to residues 3-6 (R1), residues 10-23 (.alpha.1), residues 27-39 (.alpha.2) and residues 60-65 (.alpha.3) of chain A, and to residues 4-7 (R1), residues 10-23 (.alpha.1), residues 27-39 (.alpha.2) and residues 60-65 (.alpha.3) of chain C. The structure of VapB26 was characterized by an N-terminal sheet, two adjacent helices and a small C-terminal .alpha.-helix with a long hinge loop between .alpha.2- and .beta.-helices (FIGS. 3a.about.3d). Three consecutive prolines (Pro44, Pro45 and Pro46) were located between .alpha.2-helix and the long loop. On the other hand, Gly24 located in the short loop region between .alpha.1- and .alpha.2-helices generated a turn shape by forming hydrogen bonds with the adjacent residues.

[0092] In addition, two VapB26 dimers interacted with each other through the N-terminal .beta.-strand to form a homodimer. The calculated molecular weight of VapB26 was 19.0.+-.0.4 kDa, which was almost same to the theoretical molecular weight of the VapB26 dimer (19.2 kDa) (FIGS. 1a and 1b). The N-terminal domain of the dimer had the RHH motif and the dimer interface showed an average area of about 1372.3 .ANG..sup.2 (1332.2 .ANG..sup.2 between chains E and G; and 1412.4 .ANG..sup.2 between chains A and C). More than 30 residues of each VapB26 were involved in dimerization, and the most notable difference between the two VapB26 structures was observed in the N-terminal domain. In addition, the N-terminal domains of the chains A and C were structurally well aligned, but the N-terminal domains of the chains E and G were not well folded.

[0093] In the VapB26 dimer comprising Asp2-Leu8 and Thr4-Val6, the residue pairs on two .beta.1 strands formed antiparallel .beta.-sheets through hydrogen bonds between their skeletal atoms (FIG. 6a). The main chain 0 atom of Tyr7 acted as an acceptor at the hydrogen bond with the N.epsilon. and NH.sub.2 atoms of Arg32 located at .alpha.2-helix. In addition, Glu11 located at .alpha.1-helix and Arg36 located at .alpha.2-helix played an important role in cross-stabilization between .alpha.1- and .alpha.2-helices by participating in hydrogen bonds through the side chains NH and Os to help dimerization (FIG. 6b). In addition to the hydrogen bonds, nonpolar residues contributed to the formation of the dimerization interface, and residues of .alpha.2-helix including Val30, VaIle31, Ile35 and Val39 interacted with the corresponding residues in the .alpha.2-helix of the adjacent VapB26 (FIG. 6c). Ile35 and Val39 played an important role in the interaction with Leu12, Ala15, Val16 and Ala19 located at .alpha.1-helix of the adjacent VapB26 monomer. In addition, Ala28, Ile31 and Ile35 hydrophobically interacted with Val6 located at .beta.1 hydrophobicity, and Leu8 located at .beta.1-.alpha.1 loop interacted with Ile31 and Ile35 of VapB26 (FIG. 6d).

<Example 4> Analysis of Characteristics of Toxin-Antitoxin (VapBC26) Protein Complex

[0094] To analyze the structural similarity of the VapBC26 protein complex, structural homologs of VapBC26 were screened using DALI server, a three-dimensional mapping program, to identify the structural differences between the VapBC26 protein complex and VapB5, VapB15 and VapB30.

[0095] As a result, in the structural homologs, it was confirmed that the binding region of the toxin to the antitoxin was mainly composed of one or two .alpha.-helices, but the binding region of the antitoxin to the toxin was composed of .alpha.-helix and four antiparallel .beta. sheets. In addition, the structures of VapB5, VapB15 and VapB30 included only one .alpha.-helix (VapB30) or two .alpha.-helices (VapB5 and VapB15). The VapBs protein of Shigella flexneri and Rickettsia felis strains contained only one .alpha.-helix (.alpha.2) in the binding region of the toxin. VapB3 of Mycobacterium tuberculosis showed a complete electron density map at the N-terminus due to the presence of the elongated .alpha.-helix (.alpha.3), but VapB26 did not contain specific helices in the binding region, except for the short .alpha.-helix at the C-terminus (.alpha.3) of chains A and C. VapB26 formed a flexible hinge loop without secondary structure in the binding groove formed by .alpha.-helix of VapC26 (FIG. 7a). Interestingly, VapB26 did not share the important structural similarities with other VapB proteins except VapB3. The VapB protein did not have the same DNA binding domain, so only a few VapB proteins with the structures similar to VapB26 were determined to be complete. In addition, DNA binding domains of other VapB proteins were generally located in the N-terminal region, but VapB5, VapB15 and VapB30 of Mycobacterium tuberculosis did not have the N-terminal structure, so that the structure of the DNA binding site of these proteins could not be confirmed. Among the VapB proteins whose structures were determined, only VapB3 of Mycobacterium tuberculosis shared the same RHH DNA binding site as VapB26. However, in general, VapBC3 of Mycobacterium tuberculosis did not have high structural similarity to VapBC26, and the structural similarity was observed only between the antitoxin VapB proteins (FIG. 7b).

[0096] In addition, the VapC toxin generally contained the N-terminal (PIN) domain of PilT, which exhibited the ribonuclease activity against cellular mRNA, wherein VapC26 of Mycobacterium tuberculosis had a structural feature similar to the PIN domain motif. Despite the low level of sequence similarity of about 16-25%, the secondary structures of the VapC protein were largely similar to each other (FIG. 8). VapC included conserved acidic residues as well as other conserved residues that support the active site (FIG. 8).

<Experimental Example 1> Changes in Ribonuclease Activity of Toxin Protein by Addition of Peptide Imitating Binding Region

[0097] The following experiment was performed in order to investigate the changes in ribonuclease (RNAse) activity by the peptides imitating the binding regions of VapB26 and toxin VapC26.

[0098] First, 7 short peptides were designed to imitate the binding regions of VapB26 and VapC26 and their sequences are shown in Table 3 below. Among these peptides, the peptides consisting of the amino acid sequences represented by SEQ. ID. NOs: 8 and 9 were designed to imitate the binding region of VapB26, and the peptides consisting of the amino acid sequences represented by SEQ ID NOs: 10, 11, 12 and 13 were designed to imitate the binding region of VapC26. Then, by adding these peptides to the complex, it was confirmed whether the formation of the toxin-antitoxin protein complex was inhibited. When the peptide binds to the complex with high affinity, the activity of VapC26 isolated from the complex becomes more prevalent, and thereby the ribonuclease activity increases, which can be monitored by fluorescence quenching.

TABLE-US-00003 TABLE 3 SEQ. ID. Protein Amino acid sequence NO: Mimetic peptide PPPRGGLYAGSEPIA(44-58) SEQ. for VapB26 Coil ID. between .alpha.2 and .alpha.3 NO: 8 Mimetic peptide VDELLAGF(61-68) SEQ. for VapB26 .alpha.3 ID. NO: 9 Mimetic peptide ALLAYFDAAEP(7-17) SEQ. for VapC26 .alpha.1 ID. NO: 10 Mimetic peptide PYVVAELDYLVATRVG(37-52) SEQ. for VapC26 .alpha.3 ID. NO: 11 Mimetic peptide DAELAVLRELAG(54-65) SEQ. for VapC26 .alpha.4 ID. NO: 12 Mimetic peptide YLVATRVGVDAELAV(45-59) SEQ. for VapC2 partial ID. motif between .alpha.3 NO: 13 and .alpha.4 Mimetic peptide PYVVAELDYLVATRVGVDAELAV SEQ. for VapC26 whole LRELAG(37-65) ID. .alpha.3 and .alpha.4 NO: 14 VapC26 MIIDTSALLA YFDAAEPDHA SEQ. AVSECIDSSA DALVVSPYVV ID. AELDYLVATR VGVDAELAVL NO: 15 RELAGGAWEL ANCGAAEIEQ AARIVTKYQD QRIGIADAAN VVLADRYRTR TILTLDRRHF SALRPIGGGR FTVIP

[0099] As a result, as shown in FIG. 9a, the ribonuclease activity of the VapBC26 protein complex itself of Mycobacterium tuberculosis was weaker than the ribonuclease activity of VapC26 itself. In the presence of 2.5 .mu.M of VapBC26, the ribonuclease activity was increased by competing with the peptide. In addition, the mimetic peptide for VapC26 .alpha.3 (SEQ. ID. NO: 11), the mimetic peptide for VapC26 .alpha.4 (SEQ. ID. NO: 12) and the mimetic peptide for VapC26 partial motif between .alpha.3 and .alpha.4 (SEQ. ID. NO: 13) acted as a VapBC26 binding inhibitor (FIGS. 9a and 10). Compared with when the mimetic peptide represented by SEQ. ID. NO: 11 and the mimetic peptide represented by SEQ. ID. NO: 13 were added, the ribonuclease activity of VapBC26 was more increased when the mimetic represented by SEQ. ID. NO: 12 was added (FIG. 10).

[0100] Next, the concentration of the mimetic peptide for VapC26 .alpha.4 was fixed at 2.5 .mu.M and the additional experiment was performed with increasing the concentration of VapBC26 from 0.625 to 20 .mu.M. As a result, as shown in FIG. 9b, from the concentration of VapBC26 of 10 .mu.M, the results of RFU were similar (FIG. 9b).

<Experimental Example 2> Changes in Ribonuclease Activity by Mutation

[0101] First, mutations were induced in VapB26 using EZchange.TM. site-directed mutation kit (Enzynomics, Korea) according to the manufacturer's protocol. Through this process, Pro46 and Tyr51 of VapB26 and Leu46 of VapC26 involved in hydrophobic binding were replaced with alanine or glutamate to reduce or eliminate hydrophobicity. Key binding residues were identified by adding 10 .mu.M of the mimetic peptide for VapC26 .alpha.4 to the prepared mutations. The sequences of the primers used for inducing the mutations are shown in Table 1 (SEQ. ID. NOs: 5 and 6).

[0102] As a result, as shown in FIG. 9c, it was confirmed that Tyr51 of VapB26 played the most important role in the interaction between VapB26 and VapC26 (FIG. 9c).

[0103] In addition, to support the results above, not only VapB26, VapC26, and the native VapB26 protein complex, but also the VapBC26 protein complex containing Y51E prepared by mutating the 51.sup.st Tyr residue of VapB26 with Glu and the VapC26 .alpha.4 mimetic peptide supposed to be added to each complex were filled in Superdex 75 10/300 prepacked column (GE Healthcare) with the combinations shown in FIG. 9d, followed by size exclusion chromatography. The results are shown as UV absorbance at 280 nm according to the elution volume.

[0104] As a result, as shown in FIG. 9d, the mimic peptides added with the VapBC26 protein complex showed peaks at different positions from the original peaks corresponding to VapB26 and VapC26, and the mimetic peptide added with the protein complex containing Y51E included more degraded proteins compared to the mimetic peptide added with the native protein complex (FIG. 9d). The calculated area corresponding to VapC26 in the mimetic peptide added with the protein complex comprising Y51E was larger by 15.42% than that of the mimetic peptide added with the native protein complex. As shown in FIG. 9C, this is almost consistent with the fluorescence increase of 15.07% in Y51E. Therefore, it was confirmed that Tyr51 of VapB26 played the most important role in the interaction between VapB26 and VapC26 (FIGS. 9c and 9d).

Sequence CWU 1

1

21128DNAArtificial SequenceVapC26 F 1ggaattccat atgatcgaca cgagtgcg 28233DNAArtificial SequenceVapC26 R 2ccgctcgagt tacggaatga cggtgaacgc ccc 33328DNAArtificial SequenceVapB26 F 3ggaattccat atggacaaga cgacggtc 28433DNAArtificial SequenceVapB26 R 4ttaccgctcg agccgctcac cgaagccagc cag 33533DNAArtificial Sequencemutated VapB26 F 5ggcggggcct gggagatggc caactgcggt gcc 33633DNAArtificial Sequencemutated VapB26 R 6ggcaccgcag ttggccatct cccaggcccc gcc 33719PRTArtificial SequencepET28b N-terminal tag 7Met Gly Ser Ser His His His His His Ser Ser Gly Leu Val Pro Arg1 5 10 15Gly Ser His815PRTArtificial Sequencemimicked VapB26 protein coil alpha 2 between alpha 3 8Pro Pro Pro Arg Gly Gly Leu Tyr Ala Gly Ser Glu Pro Ile Ala1 5 10 1598PRTArtificial Sequencemimicked VapB26 protein alpha 3 9Val Asp Glu Leu Leu Ala Gly Phe1 51011PRTArtificial Sequencemimicked VapC26 protein alpha 1 10Ala Leu Leu Ala Tyr Phe Asp Ala Ala Glu Pro1 5 101116PRTArtificial Sequencemimicked VapC26 protein alpha 3 11Pro Tyr Val Val Ala Glu Leu Asp Tyr Leu Val Ala Thr Arg Val Gly1 5 10 151212PRTArtificial Sequencemimicked VapC26 protein alpha 4 12Asp Ala Glu Leu Ala Val Leu Arg Glu Leu Ala Gly1 5 101315PRTArtificial Sequencemimicked VapC26 protein some motifs of alpha3 and alpha 4 13Tyr Leu Val Ala Thr Arg Val Gly Val Asp Ala Glu Leu Ala Val1 5 10 151429PRTArtificial Sequencemimicked VapC26 protein whole alpha3 and alpha 4 14Pro Tyr Val Val Ala Glu Leu Asp Tyr Leu Val Ala Thr Arg Val Gly1 5 10 15Val Asp Ala Glu Leu Ala Val Leu Arg Glu Leu Ala Gly 20 2515135PRTArtificial SequenceM.tuberculosis VapC26 15Met Ile Ile Asp Thr Ser Ala Leu Leu Ala Tyr Phe Asp Ala Ala Glu1 5 10 15Pro Asp His Ala Ala Val Ser Glu Cys Ile Asp Ser Ser Ala Asp Ala 20 25 30Leu Val Val Ser Pro Tyr Val Val Ala Glu Leu Asp Tyr Leu Val Ala 35 40 45Thr Arg Val Gly Val Asp Ala Glu Leu Ala Val Leu Arg Glu Leu Ala 50 55 60Gly Gly Ala Trp Glu Leu Ala Asn Cys Gly Ala Ala Glu Ile Glu Gln65 70 75 80Ala Ala Arg Ile Val Thr Lys Tyr Gln Asp Gln Arg Ile Gly Ile Ala 85 90 95Asp Ala Ala Asn Val Val Leu Ala Asp Arg Tyr Arg Thr Arg Thr Ile 100 105 110Leu Thr Leu Asp Arg Arg His Phe Ser Ala Leu Arg Pro Ile Gly Gly 115 120 125Gly Arg Phe Thr Val Ile Pro 130 13516135PRTArtificial SequenceM.tuberculosis VapC30 16Met Ile Ile Asp Thr Ser Ala Leu Leu Ala Tyr Phe Asp Ala Ala Glu1 5 10 15Pro Asp His Ala Ala Val Ser Glu Cys Ile Asp Ser Ser Ala Asp Ala 20 25 30Leu Val Val Ser Pro Tyr Val Val Ala Glu Leu Asp Tyr Leu Val Ala 35 40 45Thr Arg Val Gly Val Asp Ala Glu Leu Ala Val Leu Arg Glu Leu Ala 50 55 60Gly Gly Ala Trp Glu Leu Ala Asn Cys Gly Ala Ala Glu Ile Glu Gln65 70 75 80Ala Ala Arg Ile Val Thr Lys Tyr Gln Asp Gln Arg Ile Gly Ile Ala 85 90 95Asp Ala Ala Asn Val Val Leu Ala Asp Arg Tyr Arg Thr Arg Thr Ile 100 105 110Leu Thr Leu Asp Arg Arg His Phe Ser Ala Leu Arg Pro Ile Gly Gly 115 120 125Gly Arg Phe Thr Val Ile Pro 130 13517132PRTArtificial SequenceS.flexneri VapC 17Met Leu Lys Phe Met Leu Asp Thr Asn Ile Cys Ile Phe Thr Ile Lys1 5 10 15Asn Lys Pro Ala Ser Val Arg Glu Arg Phe Asn Leu Asn Gln Gly Lys 20 25 30Met Cys Ile Ser Ser Val Thr Leu Met Glu Leu Ile Tyr Gly Ala Glu 35 40 45Lys Ser Gln Met Pro Glu Arg Asn Leu Ala Val Ile Glu Gly Phe Val 50 55 60Ser Arg Ile Asp Val Leu Asp Tyr Asp Ala Ala Ala Ala Thr His Thr65 70 75 80Gly Gln Ile Arg Ala Glu Leu Ala Arg Gln Gly Arg Pro Val Gly Pro 85 90 95Phe Asp Gln Met Ile Ala Gly His Ala Arg Ser Arg Gly Leu Ile Ile 100 105 110Val Thr Asn Asn Thr Arg Glu Phe Glu Arg Val Gly Gly Leu Arg Thr 115 120 125Glu Asp Trp Ser 13018132PRTArtificial SequenceM.tuberculosis VapC15 18Met Ile Val Asp Thr Ser Val Trp Ile Ala Tyr Leu Ser Thr Ser Glu1 5 10 15Ser Leu Ala Ser Arg Trp Leu Ala Asp Arg Ile Ala Ala Asp Ser Thr 20 25 30Val Ile Val Pro Glu Val Val Met Met Glu Leu Leu Ile Gly Lys Thr 35 40 45Asp Glu Asp Thr Ala Ala Leu Arg Arg Arg Leu Leu Gln Arg Phe Ala 50 55 60Ile Glu Pro Leu Ala Pro Val Arg Asp Ala Glu Asp Ala Ala Ala Ile65 70 75 80His Arg Arg Cys Arg Arg Gly Gly Asp Thr Val Arg Ser Leu Ile Asp 85 90 95Cys Gln Val Ala Ala Met Ala Leu Arg Ile Gly Val Ala Val Ala His 100 105 110Arg Asp Arg Asp Tyr Glu Ala Ile Arg Thr His Cys Gly Leu Arg Thr 115 120 125Glu Pro Leu Phe 13019134PRTArtificial SequenceR.felis VapC 19Met Ile Tyr Met Leu Asp Thr Asn Ile Cys Val Tyr Ala Ile Asn Lys1 5 10 15His Pro Asp Ser Tyr Tyr Asn Asn Leu Glu Leu Leu Ala Lys Asn Asn 20 25 30Thr Ile Ala Ile Ser Ser Ile Val Leu Ala Glu Leu Gln Tyr Gly Val 35 40 45Ser Lys Ser Lys Lys Lys Glu Gln Asn Gln Ser Lys Leu Asp Ile Phe 50 55 60Leu Ser Arg Leu Glu Ile Ile Asp Phe Ser Ala Lys Cys Thr Phe Tyr65 70 75 80Tyr Gly Glu Leu Arg Thr Glu Leu Glu Gln Lys Gly Leu Ile Ile Gly 85 90 95Asn Asn Asp Leu Leu Ile Ala Ser His Ala Ile Ala Glu Asn Ala Thr 100 105 110Leu Val Thr Asn Asn Ile Lys Glu Phe Lys Arg Ile Pro Asn Leu Ile 115 120 125Leu Glu Asn Trp Asp Lys 13020141PRTArtificial SequenceM.tuberculosis VapC3 20Met Thr Asp Gln Arg Trp Leu Ile Asp Lys Ser Ala Leu Val Arg Leu1 5 10 15Thr Asp Ser Pro Asp Met Glu Ile Trp Ser Asn Arg Ile Glu Arg Gly 20 25 30Leu Val His Ile Thr Gly Val Thr Arg Leu Glu Val Gly Phe Ser Ala 35 40 45Glu Cys Gly Glu Ile Ala Arg Arg Glu Phe Arg Glu Pro Pro Leu Ser 50 55 60Ala Met Pro Val Glu Tyr Leu Thr Pro Arg Ile Glu Asp Arg Ala Leu65 70 75 80Glu Val Gln Thr Leu Leu Ala Asp Arg Gly His His Arg Gly Pro Ser 85 90 95Ile Pro Asp Leu Leu Ile Ala Ala Thr Ala Glu Leu Ser Gly Leu Thr 100 105 110Val Leu His Val Asp Lys Asp Phe Asp Ala Ile Ala Ala Leu Thr Gly 115 120 125Gln Lys Thr Glu Arg Leu Thr His Arg Pro Pro Ser Ala 130 135 14021135PRTArtificial SequenceM.tuberculosis VapC5 21Met Ser Thr Thr Pro Ala Ala Gly Val Leu Asp Thr Ser Val Phe Ile1 5 10 15Ala Thr Glu Ser Gly Arg Gln Leu Asp Glu Ala Leu Ile Pro Asp Arg 20 25 30Val Ala Thr Thr Val Val Thr Leu Ala Glu Leu Arg Val Gly Val Leu 35 40 45Ala Ala Ala Thr Thr Asp Ile Arg Ala Gln Arg Leu Ala Thr Leu Glu 50 55 60Ser Val Ala Asp Met Glu Thr Leu Pro Val Asp Asp Asp Ala Ala Arg65 70 75 80Met Trp Ala Arg Leu Arg Ile His Leu Ala Glu Ser Gly Arg Arg Val 85 90 95Arg Ile Asn Asp Leu Trp Ile Ala Ala Val Ala Ala Ser Arg Ala Leu 100 105 110Pro Val Ile Thr Gln Asp Asp Asp Phe Ala Ala Leu Asp Gly Ala Ala 115 120 125Ser Val Glu Ile Ile Arg Val 130 135

Claims

1. An antibiotic peptide that inhibits the binding of an antitoxin to one or more .alpha.3 residues or .alpha.4 residues of a Mycobacterium tuberculosis toxin protein.

2. The antibiotic peptide according to claim 1, wherein the toxin protein comprises the amino acid sequence represented by SEQ ID NO: 15.

3. The antibiotic peptide according to claim 1, wherein the .alpha.3 residues consist of the 37.sup.th to 52.sup.nd amino acid sequence of VapC26.

4. The antibiotic peptide according to claim 1, wherein the .alpha.4 residues consist of the 54.sup.th to 65.sup.th amino acid sequence of VapC26.

5. The antibiotic peptide according to claim 1, wherein the peptide comprises one or more of the amino acid sequences represented by SEQ ID NOs: 11-13.

6. The antibiotic peptide according to claim 1, wherein the peptide does not affect activity of a toxin.

7. An antibiotic composition against Mycobacterium tuberculosis comprising the antibiotic peptide of claim 1 and a carrier.

8. The antibiotic composition against Mycobacterium tuberculosis according to claim 7, wherein the antibiotic peptide comprises one or more of the amino acid sequence represented by SEQ ID NOs: 11-13.

9. An antibiotic quasi-drug against Mycobacterium tuberculosis comprising the antibiotic peptide of claim 1.

10. The antibiotic composition against Mycobacterium tuberculosis of claim 1, formulated for external application to a subject.

11. A method for ameliorating or treating a Mycobacterium tuberculosis infection in a subject, comprising a step of: administering the antibiotic peptide of claim 1 to the subject, thereby ameliorating or treating the Mycobacterium tuberculosis infection of the subject.

12. (canceled)