NUCLEIC ACID CONSTRUCTS AND GENE THERAPY VECTORS FOR USE IN THE TREATMENT OF WILSON DISEASE

Abstract

The invention relates to nucleic acid constructs and gene therapy vectors that comprise an ATP7B variant for use in the treatment of conditions associated with a deficiency or dysfunction of Copper-transporting ATPase 2, and particularly of Wilson's disease. An AAV vector devised according to the invention significantly reduced urine Cu excretion, and liver Cu content in Wilson's disease mice treated with the vector, while ceruloplasmin activity was significantly restored. On the other hand, the administration of the vector resulted in the normalization of serum transaminases' levels and of liver histology, together with a marked reduction of the inflammatory infiltrate.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This is a Division of application Ser. No. 15/537,781 filed Jun. 19, 2017, which in turn is a national stage entry of PCT/EP2015/080357 filed Dec. 17, 2015, which claims priority to EP 14382531.3 filed Dec. 17, 2014. The disclosure of the prior applications is hereby incorporated by reference herein in its entirety.

FIELD OF THE INVENTION

[0002] The present invention relates to nucleic acid constructs and gene therapy vectors for use in the treatment of Wilson's disease and other conditions.

BACKGROUND ART

[0003] The state of the art regarding gene therapy of Wilson's disease was reviewed by Merle et al. (Current Gene Therapy 2007; 7: 217-220) and is here summarized and completed with later disclosed references.

[0004] Wilson's disease (WD) is an autosomal recessively inherited disorder of copper metabolism with an average prevalence of 1:30,000. WD is caused by mutations of the ATP7B gene coding for a P-type copper transporting ATPase, which is located on chromosome 13. ATP7B is expressed mainly in hepatocytes and functions in the transmembrane transport of copper. Absent or reduced function of ATP7B protein leads to decreased hepatocellular excretion of copper into bile and results in copper accumulation primarily in the liver and subsequently in the neurologic system and other tissues. Failure to incorporate copper into ceruloplasmin is an additional consequence of the loss of functional ATP7B protein.

[0005] WD can present clinically as liver disease, as a progressive neurologic disorder, or as psychiatric illness. Patients with hepatic WD usually present in late childhood or adolescence, and exhibit features of acute hepatitis, fulminant hepatic failure, or progressive chronic liver disease. Neurologic manifestations of WD typically present later than the liver disease, most often in the second or third decade and include extrapyramidal, cerebellar and cerebral-related symptoms.

[0006] The aim of medical treatment of WD is to remove the toxic deposit of copper from the body and to prevent its reaccumulation. Three anti-copper drugs are currently approved for WD: D-penicillamine, trientine, and zinc salts. Medical therapy is effective in most, but not all patients with WD. Liver transplantation is a therapeutic option in WD patients presenting with fulminant liver failure or progressive liver failure. It has been shown to correct the WD phenotype and provides excellent long-term survival.

[0007] However, an interruption of therapy or inadequate treatment can lead to fatalities within few months. Because WD medication has to be taken regularly, adherence to treatment in some patients, especially in adolescent WD patients, is poor.

[0008] Under therapy residual neurological symptoms are relatively common and even progressive symptoms can occur. Because current medical treatment options are not in all WD patients effective and adherence to therapy is a problem, a more comprehensive solution could involve gene therapy.

[0009] Theoretically, expression of wild type ATP7B in hepatocytes would reverse all disease-related abnormalities and rescue the liver and the neurological symptoms. The ultimate goal of an ideal gene therapy for WD would be to deliver ATP7B, in sufficient quantity, specifically to hepatocytes for a lifelong duration.

[0010] All published studies on adenoviral gene transfer for WD have used early-generation adenoviral vectors producing only transient transgene expression. Terada et al. [Terada et al. J. Biol. Chem. 1998; 273:1815-1820; Terada et al. FEBS Lett. 1999; 448: 53-56] demonstrated successful gene transfer by adenovirus mediated gene delivery in the LEC rat model. Restoration of holoceruloplasmin synthesis, of serum ceruloplasmin oxidase activity, and of copper excretion in bile was shown, indicating a therapeutic effect of the gene transfer. These effects were of a very limited duration, with a maximum level at day three and a decline thereafter. Ha-Hao et al. [Z. Gastroenterol. 2002; 40: 209-216] also demonstrated an increased copper content in stool of LEC rats after adenovirus-mediated ATP7B gene transfer, indicating increased copper excretion into the bile. The therapeutic effect was in addition demonstrated by restoration of holoceruloplasmin and of its ferroxidase activity. However, once again the duration of the therapeutic effect in these experiments was only transient with a limited duration of a few days.

[0011] Gutless adenoviral vectors have not been tested for this application so far.

[0012] Other commonly used non-integrating viral vector system, the adeno-associated virus (AAV), has neither been tested for WD so far, mainly because the ATP7B gene (approximately 4.4 kb large) leaves minimum space for allocating the rest of required sequences (e.g. promoter, poly A signal sequence, etc) within the AAV vector, whose packaging capacity is 4.4-4.7 kb. German patent application DE 100156121A1 (published 2003) proposed a recombinant adeno-associated viral vector for the gene therapy of WD that possesses a shortened metal-sensitive promoter (metallothionein-I promoter) to produce copper or zinc inducible expression of ATP7B transgene. Nevertheless, this document does not provide, nor has been later disclosed, any information regarding the therapeutic efficiency and performance of the vector.

[0013] On the other hand, several lentiviral vectors carrying wild type ATP7B have been tested in animal models of WD. Merle et al. [Scan. J. Gastroenterol. 2006; 41: 974-982] reported systemic gene therapy in LEC rats with lentiviral vectors expressing ATP7B under the control of a phosphoglycerokinase promoter. Twenty-four weeks after gene transfer liver copper content was lowered significantly and liver histology improved in treated rats compared to untreated controls, but the effect was only partial. Serum ceruloplasmin oxidase activity was increased two weeks after gene transfer when compared to controls, however, it declined to lower levels 24 weeks after treatment. More recently, Roybal et al. [Gene Therapy 2012; 19: 1085-1094] have reported early gestational gene transfer in ATP7B.sup.-/- mice with a lentivirus carrying human ATP7B under transcriptional control of a liver-specific promoter which contained element of apolipoprotein E and alpha-1 antitrypsin. In utero administration of the vector provided a decrease in liver copper levels, preservation of normal hepatic histology, restoration of copper incorporation into ceruloplasmin and improved cholesterol biosynthesis. However, the efficiency of the treatment was very variable from mice to mice and declined with time and never reached full correction of the different pathologically altered parameters.

SUMMARY OF THE INVENTION

[0014] The inventors have engineered and tested several viral vectors carrying transgenes encoding different truncated forms of the enzyme ATP7B: e.g. vector AAV2/8-AAT-ATP7B(d223-366), encoding ATP7B(d223-366) [ATP7B-T1]; and vector AAV2/8-AAT-ATP7B(d57-486), encoding ATP7B(d57-486) [ATP7B-T2]. When administered to ATP7B knockout mice (a recognized animal model of Wilson's disease), the AAV vector carrying ATP7B-T2 corrected main Wilson's disease pathological characteristics for at least 24 weeks after treatment while the AAV vector carrying ATP7B-T1 had only a partial effect. Cu excretion (Cu urine content), and liver Cu content were significantly reduced in Wilson's disease mice treated with the AAV2/8-AAT-ATP7B(d57-486) vector, and ceruloplasmin activity was significantly restored. On the other hand, the administration of the vector resulted in the normalization of serum transaminases levels and of liver histology, together with a marked reduction of the inflammatory infiltrate, biliary duct proliferation and fibrosis.

[0015] Furthermore, a dose of 1.times.10.sup.10 vg/mouse of the AAV2/8-AAT-wtATP7B vector was shown to be a "suboptimal dose" for the wt construct both for the obtaining of a normalization of the serum ceruloplasmin activity and a reduction of Cu accumulation in the liver (FIGS. 10A and 11A); whereas the vector carrying the truncated form was shown to provide statistically significant therapeutic effects (vs untreated) at said suboptimal dose (FIGS. 10B and 11B). Moreover, the observed difference in activity between the full length ATP7B and T2 constructs at a dose of 1.times.10.sup.10 vg/mouse was also shown to be statistically significant for these two therapeutic effects (FIG. 12 and FIG. 14).

[0016] These observations indicated that both a nucleic acid construct encoding the truncated form ATP7B(d57-486) and vectors that carry it, in particular AAV vectors, enable to overcome the most relevant pathological effects of an accumulation of copper linked to a deficiency or dysfunction of ATP7B and thus can be very suitable for gene therapy applied to a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2, such as Wilson's disease, or a disease and/or condition associated with a decrease of ATP7B-dependent lysosomal exocytosis and copper accumulation. Moreover, unexpectedly the truncated form ATP7B(d57-486) and vectors that carry it, were shown to achieve normalization of some of these pathological manifestations of the disease at dosages where the full length ATP7B protein and vectors encoding the same proved to be less effective.

[0017] Therefore, in a first aspect the invention relates to a nucleic acid construct (hereinafter also referred as "nucleic acid construct of the invention"), that comprises: a) a nucleotide sequence of an eukaryotic promoter; b) a nucleotide sequence encoding a truncated Copper-transporting ATPase 2 (ATP7B) in which the N-terminal heavy metal associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are totally deleted and HMA 5 and HMA 6 remain undeleted; and c) a polyadenylation signal sequence.

[0018] In another aspect, the invention relates to an expression vector (hereinafter also referred as "expression vector of the invention"), that comprises a nucleic acid construct of the invention.

[0019] In another aspect, the invention relates to a host cell comprising a nucleic acid construct or an expression vector of the invention.

[0020] In another aspect, the invention relates to a viral particle (hereinafter also referred as "viral particle of the invention"), that comprises a nucleic construct or an expression vector of the invention. Preferably, the nucleic acid construct constitutes the genomic sequence of the viral vector.

[0021] In another aspect, the invention relates to a pharmaceutical composition that comprises a product of the invention, i.e. a product that comprises a nucleic acid construct of the invention, and a pharmaceutically acceptable carrier. The term "product of the invention" as used herein refers to and indistinctively covers any of: a) the nucleic acid construct of the invention; b) the expression vector of the invention, c) the host cell of the invention and d) the viral particle of the invention.

[0022] In another aspect, the invention further relates to a kit comprising a nucleic acid construct, vector, host cell, viral particle or pharmaceutical composition of the invention in one or more containers.

[0023] In another aspect, the invention relates to a product of the invention for use in medicine (as a medicament or medicinal composition). This use in medicine includes the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2. Said another way, the invention relates to: the use of a product of the invention in the preparation of a medicament for use in the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2; and to a method for the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2 in a subject or a patient, that comprises administering to the subject or patient a therapeutically effective amount of a product of the invention. In a more particular aspect, the product of the invention is used for the treatment of Wilson's disease.

[0024] In another aspect, the invention further relates to a pharmaceutical composition comprising a product of the invention as described above, for the proposed uses in medicine and therapeutic methods herein described.

[0025] In an even further aspect, the invention relates to a process of producing viral particles of the invention comprising the steps of:

[0026] a) culturing a host cell containing a nucleic acid construct or expression vector of the invention in a culture medium; and

[0027] b) harvesting the viral particles in the cell culture supernatant and/or inside the cells.

[0028] In a related aspect, the present invention relates to the use of the nucleic acid construct of the invention or the expression vector of the invention for the production of viral particles.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1: Schematic representation of the nucleic acid construct of vector AAV2/8-AAT-wtATP7B which carries human ATP7B; vector AAV2/8-AAT-ATP7B(d223-366) which carries truncated form ATP7B(d223-366) [ATP7B-T1]; and vector AAV2/8-AAT-ATP7B(d57-486) which carries truncated ATP7B(d57-486) [ATP7B-T2]. The elements of the constructs are: a) alpha-1-antitrypsin gene promoter (AAT); b) nucleotide sequence encoding respectively human ATP7B, ATP7B-T1, or ATP7B-T2; c) the polyadenylation signal (pA), and flanking the vector genome d) the inverted terminal repeat sequences of AAV2 (ITRs).

[0030] FIG. 2: Serum alanine transaminase (ALT) levels in wild type male mice [WT], ATP7B deficient male mice [Wilson's Disease mice, WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD AAV-T2]. A vector dose of 3.times.10.sup.10 vg/mouse was administered when the animals were 6 weeks old. ALT levels were measured 4, 9, 14 and 24 weeks after treatment [Weeks] and is expressed as IU/L (IU: international units). ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0031] FIG. 3: Total urine copper content in wild type male mice [WT], Wilson's Disease male mice [WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD ATP7B-T2]. Vector dose: 3.times.10.sup.10 vg/mouse. Copper content was measured 4, 9, 14 and 24 weeks after treatment [Weeks] in 24 hours urine and expressed as nanograms of Cu (ngr/24 h).

[0032] FIG. 4: Serum ceruloplasmin activity in wild type male mice [WT], Wilson's Disease male mice [WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD ATP7B-T2]. Vector dose: 3.times.10.sup.10 vg/mouse. Ceruloplasmin activity was measured 4 weeks after treatment and expressed as the absorbance measured at 570 nm of wave-length [Abs (570 nm)]. ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0033] FIG. 5. Liver Cu content in wild type male mice [WT], Wilson's Disease male mice [WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD ATP7B-T2]. Vector dose: 3.times.10.sup.10 vg/mouse. Cupper content was determined after sacrificing the animals 24 weeks after treatment by atomic absorption spectroscopy; and expressed as .mu.g/g (Cu .mu.g/g of dry liver tissue). ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0034] FIG. 6: Histological images of livers of wild type animals male mice [WT], Wilson's Disease male mice [WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD ATP7B-T2]. Vector dose: 3.times.10.sup.10 vg/mouse. Images were taken after sacrificing the animals (30 weeks of age). A: Images of liver sections stained with hematoxylin and eosin. B: Images of histological samples stained by Timm's sulphide silver technique for detection of copper deposits.

[0035] FIG. 7: Analysis of liver inflammation, Bile duct proliferation and fibrosis. Images of livers of wild type male mice [WT], Wilson's Disease male mice [WD], and WD male mice treated with the vectors AAV2/8-AAT-wtATP7B [WD AAV-ATP7B], AAV2/8-AAT-ATP7B(d223-366) [WD AAV-T1]; or AAV2/8-AAT-ATP7B(d57-486) [WD ATP7B-T2]. Vector dose: 3.times.10.sup.10 vg/mouse. Analysis was performed after sacrificing the animals (30 weeks of age). CD45: Images of liver sections immunostained with anti-CD45 for detecting liver inflammatory infiltrates. PANCK: Images of liver sections immunostained with anti-PANCK for detecting bile duct proliferation. SR: Images of liver sections stained with Sirius red for detecting fibrosis.

[0036] FIG. 8: Serum alanine transaminase (ALT) levels in wild type female mice [WT], WD female mice [WD], and WD female mice treated with the vector AAV2/8-AAT-ATP7B(d57-486) [WD AAV-T2]. Different groups of 6 weeks old WD female mice were administered different doses of the vectors (respectively 1.times.10.sup.10, 3.times.10.sup.10, 1.times.10.sup.11 vg/mouse). ALT levels were measured 4, 9, 14 and 24 weeks after treatment [Weeks] and is expressed as IU/L. ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0037] FIG. 9: Urinary Cu Content levels in wild type female mice [WT], WD female mice [WD], and WD female mice treated with the vector AAV2/8-AAT-ATP7B(d57-486) [WD AAV-T2]. Different groups of 6 weeks old WD female mice were administered different doses of the vector (respectively 1.times.10.sup.10, 3.times.10.sup.10, 1.times.10.sup.11 vg/mouse). Urinary copper levels were measured 4, 9, 14 and 24 weeks after treatment [Weeks] and is expressed as ngr of Cu in 24 hours urine (ngr/24 h). ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0038] FIG. 10: Ceruloplasmin activity in serum was measured in wild type female mice [WT], WD female mice [WD], and WD female mice treated with the vector AAV2/8-AAT-ATP7B(d57-486) [WD+AAV-T2] or the vector AAV2/8-AAT-wtATP7B [WD+AAV-ATP7B]. For each experimental group, different groups of 6 weeks old WD female mice were administered different doses of the vector (respectively 1.times.10.sup.10, 3.times.10.sup.10, 1.times.10.sup.11 vg/mouse). Ceruloplasmin activity was measured 4 weeks after treatment and is expressed as the absorbance measured at 570 nm of wave-length [Abs (570 nm)]. ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0039] FIG. 11: Liver Cu Content was measured in wild type female mice [WT], WD mice [WD], and WD female mice treated with the vector AAV2/8-AAT-wtATP7B [WD AAV ATP7B] or the vector AAV2/8-AAT-ATP7B(d57-486) [WD AAV T2]. For each experimental group, different groups of 6 weeks old WD female mice were administered different doses of the vector (respectively 1.times.10.sup.10, 3.times.10.sup.10, 1.times.10.sup.11 vg/mouse). Copper concentration was measured 24 weeks after treatment and is expressed as .mu.g/g of dry tissue ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0040] FIG. 12: Liver Cu Content in wild type male mice [WT, n=15], WD male mice [WD; n=25], and WD male mice treated with the vector AAV2/8-AAT-wtATP7B [WD AAV ATP7B; n=7] or the vector AAV2/8-AAT-ATP7B(d57-486) [WD AAV T2; n=7]. For each experimental group, WD mice were administered a suboptimal dose of the vector (1.times.10.sup.10 vg/mouse) when the animals were 6 weeks old. Copper concentration was measured 24 weeks after treatment and is expressed as .mu.g/g of dry tissue ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0041] FIG. 13: Liver Cu Content in wild type male mice [WT, n=15], WD male mice [WD; n=25], and WD male mice treated with the vector AAV2/8-AAT-ATP7B(d57-486) [WD AAV T2; n=13] or the vector AAV2/8-AAT-coATP7B(d57-486) [WD AAV coT2; n=4]. For each experimental group, 6 weeks old WD male mice were administered a suboptimal dose of the vector (1.times.10.sup.10 vg/mouse). Copper concentration was measured 24 weeks after treatment and is expressed as .mu.g/g of dry tissue ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

[0042] FIG. 14: Ceruloplasmin activity in serum of wild type male mice [WT, n=15], WD male mice [WD; n=25], and WD male mice groups treated with one of the vectors AAV2/8-AAT-wtATP7B [WD AAV ATP7B; n=10], AAV2/8-AAT-coATP7B [WD AAV coATP7B; n=8], AAV2/8-AAT-ATP7B(d57-486) [WD AAV T2; n=13] and AAV2/8-AAT-coATP7B(d57-486) [WD AAV coT2; n=4]. For each experimental group, 6 weeks old WD male mice were administered a suboptimal dose of the vector (1.times.10.sup.10 vg/mouse). Oxidase activity of ceruloplasmin was measured 4 weeks after treatment and is expressed as the absorbance measured at 570 nm of wave-length [Abs (570 nm)]. ns: no significant; *: p<0.05, **: p<0.01; ***: p<0.001 [Mann-Whitney unpaired test].

DETAILED DESCRIPTION OF THE INVENTION

[0043] All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly through-out the specification and claims unless an otherwise expressly set out definition provides a broader definition.

[0044] The terms "nucleic acid sequence" and "nucleotide sequence" may be used interchangeably to refer to any molecule composed of or comprising monomeric nucleotides. A nucleic acid may be an oligonucleotide or a polynucleotide. A nucleotide sequence may be a DNA or RNA. A nucleotide sequence may be chemically modified or artificial. Nucleotide sequences include peptide nucleic acids (PNA), morpholines and locked nucleic acids (LNA), as well as glycol nucleic acids (GNA) and threose nucleic acid (TNA). Each of these sequences is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule. Also, phosphorothioate nucleotides may be used. Other deoxynucleotide analogs include methylphosphonates, phosphoramidates, phosphorodithioates, N3'P5'-phosphoramidates and oligoribonucleotide phosphorothioates and their 2'-0-allyl analogs and 2'-0-methylribonucleotide methylphosphonates which may be used in a nucleotide of the invention.

[0045] The term "nucleic acid construct" as used herein refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. A nucleic acid construct is a nucleic acid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids sequences, which are combined and juxtaposed in a manner, which would not otherwise exist in nature. A nucleic acid construct usually is a "vector", i.e. a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.

[0046] The term "expression vector" or "vector" as used herein refers to a recombinant nucleotide sequence that is capable of effecting expression of a gene (transgene) in host cells or host organisms compatible with such sequences. Together with the transgene, expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements able to respond to a precise inductive signal (endogenous or chimeric transcription factors) or specific for certain cells, organs or tissues.

[0047] The term "subject" or "patient" as used herein, refers to mammals. Mammalian species that can benefit from the disclosed methods of treatment include, but are not limited to, humans, non-human primates such as apes; chimpanzees; monkeys, and orangutans, domesticated animals, including dogs and cats, as well as livestock such as horses, cattle, pigs, sheep, and goats, or other mammalian species including, without limitation, mice, rats, guinea pigs, rabbits, hamsters, and the like.

[0048] The term "packaging cells" as used herein, refers to a cell or cell line which may be transfected with a helper vector or virus or a DNA construct, and provides in trans all the missing functions which are required for the complete replication and packaging of a viral vector. Typically, the packaging cells express in a constitutive or inducible manner one or more of said missing viral functions.

A Nucleic Acid Construct of the Invention

Nucleotide Sequence of Eukaryotic Promoter

[0049] As used herein, the term "eukaryotic promoter" refers to a DNA sequence region that initiates transcription of a particular gene, or one or more coding sequences, in eukaryotic cells. A promoter can work in concert with other regulatory regions or elements to direct the level of transcription of the gene or coding sequence/s. These regulatory elements include, without limitation, transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter, including e.g. attenuators, enhancers, and silencers. The promoter is located near the transcription start site of the gene or coding sequence to which is operably linked, on the same strand and upstream of the DNA sequence (towards the 5' region of the sense strand). A promoter can be about 100-1000 base pairs long. Positions in a promoter are designated relative to the transcriptional start site for a particular gene (i.e., positions upstream are negative numbers counting back from -1, for example -100 is a position 100 base pairs upstream).

[0050] The term "core promoter" or "minimal promoter" refers to the minimal portion of a promoter sequence required to properly initiate transcription. It includes the transcription start site (TSS) and elements directly upstream; a binding site for RNA polymerase (RNA polymerase II); and general transcription factors binding sites. Commonly a promoter also comprises a proximal promoter sequence (upstream of the core promoter), that contains other primary regulatory elements (such as enhancers, silencers, boundary elements/insulators); and a distal promoter sequence (downstream of core promoter), that may contain additional regulatory elements, normally with a weaker influence on the level of transcription of the gene.

[0051] According to the invention, the eukaryotic promoter sequence is operably linked to the nucleotide sequence encoding the truncated Copper-transporting ATPase 2. As used herein, the term "operably linked" refers to a linkage of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous; where it is necessary to join two protein encoding regions, they are contiguous and in reading frame.

[0052] According to the invention, the eukaryotic promoter sequence of the nucleic acid construct comprises at least the core promoter and, optionally other regulatory regions or elements of the same gene or of different genes (i.e. hybrid or chimeric promoters).

[0053] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the eukaryotic promoter is a constitutive promoter, a tissue specific promoter, or an inducible promoter.

[0054] As used herein, a "constitutive" promoter is a promoter that is active in most eukaryotic tissues under most physiological and developmental conditions.

[0055] A "tissue specific promoter" is a promoter only active in specific types of tissues or cells. That is to say a tissue specific promoter, in the context of this invention, is one which is more active in one or several particular tissues (for example two, three or four) than in other tissues (i.e. the promoter is capable of driving a higher expression of the coding sequence to which it is operably linked in the tissue(s) for which it is specific than in the others). Typically, the gene down-stream of a "tissue specific" promoter is active to a much higher degree in the tissue(s) for which the promoter is specific than in any other tissue(s). In this case, there may be little or substantially no activity of the promoter in any tissue other than the one(s) for which it is specific.

[0056] An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer.

[0057] Many promoters are known in the art [Sambrook and Russell (Molecular Cloning: a Laboratory Manual; Third Edition; 2001 Cold Spring Harbor Laboratory Press); and Green and Sambrook (Molecular Cloning: a Laboratory Manual, cuarta edicion, 2012 Cold Spring Harbor Laboratory Press)].

[0058] Suitable tissue specific promoters may be found in the Tissue-Specific Promoter Database, TiProD (Nucleic Acids Research 2006; J4: D104-D107).

[0059] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the eukaryotic promoter is a liver specific promoter. In the context of this invention, a "liver specific promoter" is a promoter which is more active in the liver than in any other tissue of the body. Typically, the activity of a liver specific promoter will be considerably greater in the liver than in other tissues. For example, such a promoter may be at least 2, at least 3, at least 4, at least 5 or at least 10 times more active (for example as determined by its ability to drive the expression in a given tissue in comparison to its ability to drive the expression in other cells or tissues). Accordingly, a liver specific promoter allows an active expression in the liver of the gene linked to it and prevents its expression in other cells or tissues.

[0060] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the eukaryotic promoter is a nucleotide sequence of the al-antitrypsin gene promoter (AAT), or a chimeric promoter sequence EalbPa1AT that comprises an al-antitrypsin gene promoter sequence (AAT or Pa1AT) combined with an albumin gene enhancer element (Ealb). Both promoter sequences have properties of liver specific promoters.

[0061] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the eukaryotic promoter sequence is the sequence delimited by bases 156..460 of SEQ.ID.NO.1 (AAT); or SEQ.ID.NO.5 (EalbPa1AT).

Truncated Copper-Transporting ATPase 2 (ATP7B)

[0062] Copper-transporting ATPase 2 (ATP7B) is a P-type cation transport ATPase that functions exporting copper out of the cells.

[0063] The gene that encodes human enzyme is located at chromosome 13 (chromosome location 13q14.3; gene name ATP7B). Information on human ATP7B polypeptide (amino acid sequences, structure, domains and other features) is for example available at Uniprot with Accession number: P35670 (http://www.uniprot.org/uniprot/P35670; Entry version 168 (3 Sep. 2014), Sequence version 4 (16 Jun. 2009)). Information on the ATP7B gene encoding this enzyme is available at Entrez with accession number Gene ID: 540 (http://www.ncbi.nlm.nih.gov/gene/540; updated on 19 Sep. 2014). 4 isoforms produced by alternative splicing have been described for ATP7B; isoform 1 (identifier P35670-1, 1465 amino acids long) is chosen as the canonical sequence.

[0064] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide acid construct of the invention comprises a nucleotide sequence that encodes a truncated form of a human ATP7B, preferably a human ATP7B whose amino acid sequence is the canonical sequence (SEQ.ID.NO.2), herein also referred to as wtATP7B.

[0065] Several conserved motifs are present in ATP7B that are characteristic for the P-type ATPase protein family. These motifs are required for ATP catalysis and include the nucleotide binding domain (N-domain), the phosphorylation domain (P-domain) and the actuator domain (A-domain). Highly conserved signature residues are present in these motifs; SEHPL in the N-domain, DKTG in the P-domain, and TGE in the A-domain. The amino terminal tail of human ATP7B contains "six metal binding sites" (MBS), also indistinctively named as "heavy metal associated (HMA)" sites or domains, each containing the core sequence MxCxxC. These HMA bind Cu(I) in a stoichiometry of one atom of Cu(I) per HMA. These amino-terminal HMAs of ATP7B are required for several aspects of its function, including copper translocation, incorporation of copper in cuproenzymes, ATPase activity, localization and trafficking, and protein-protein interactions. The HMA sites are identified starting at the amino end, as domains HMA 1 (amino acids 59-125 in the canonical sequence), HMA 2 (amino acids 144-210), HMA 3 (258-327), HMA 4 (360-426), HMA 5 (489-555), and HMA 6 (565-631).

[0066] According to the invention, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct comprises a nucleotide sequence that encodes a truncated ATP7B in which the N-terminal heavy metal associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are totally or partially deleted.

[0067] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide sequence that encodes truncated ATP7B keeps the 56 amino acids of N-terminal signal sequence of ATP7B.

[0068] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the deletion in truncated ATP7B comprises amino acids 57 to 486 of the canonical sequence.

[0069] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide sequence encodes a truncated ATP7B whose amino acids sequence is SEQ.ID.NO.7.

[0070] Because of the codons redundancy, there are numerous nucleotide sequences that can be generated encoding ATP7B polypeptides with same amino acids sequence.

[0071] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide sequence encoding the truncated Copper-transporting ATPase 2 is the coding sequence CDS of SEQ.ID.NO.6, bases 473 . . . 3580.

[0072] In another embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide sequence encoding the truncated Copper-transporting ATPase 2 is SEQ.ID.NO.8, a sequence with an optimized codon usage bias for the human cells.

[0073] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleotide sequence encoding the truncated Copper-transporting ATPase 2 is a sequence wherein at least 827, at least 879, at least 931, or at least 983 of the codons encoding truncated Copper-transporting ATPase 2 are identical to the codons of coding sequence SEQ.ID.NO.8.

Polyadenylation Signal Sequence

[0074] As used herein, the term "polyadenylation signal" or "poly(A) signal" refers to a specific recognition sequence within 3' untranslated region (3' UTR) of the gene, which is transcribed into precursor mRNA molecule and guides the termination of the gene transcription. Poly(A) signal acts as a signal for the endonucleolytic cleavage of the newly formed precursor mRNA at its 3'-end, and for the addition to this 3'-end of a RNA stretch consisting only of adenine bases (polyadenylation process; poly(A) tail). Poly(A) tail is important for the nuclear export, translation, and stability of mRNA. In the context of the invention, the polyadenylation signal is a recognition sequence that can direct polyadenylation of mammalian genes and/or viral genes, in mammalian cells.

[0075] Poly(A) signals typically consist of a) a consensus sequence AAUAAA, which has been shown to be required for both 3'-end cleavage and polyadenylation of premessenger RNA (pre-mRNA) as well as to promote downstream transcriptional termination, and b) additional elements upstream and downstream of AAUAAA that control the efficiency of utilization of AAUAAA as a poly(A) signal. There is considerable variability in these motifs in mammalian genes.

[0076] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the polyadenylation signal sequence of the nucleic acid construct of the invention is a polyadenylation signal sequence of a mammalian gene or a viral gene. Suitable polyadenylation signals include, among others, a SV40 early polyadenylation signal, a SV40 late polyadenylation signal, a HSV thymidine kinase polyadenylation signal, a protamine gene polyadenylation signal, an adenovirus 5 EIb polyadenylation signal, a growth hormone polydenylation signal, a PBGD polyadenylation signal, in silico designed polyadenylation signal (synthetic) and the like.

[0077] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the polyadenylation signal sequence of the nucleic acid construct is a synthetic poly(A) signal sequence which is also capable of directing and effecting the endonucleolytic cleavage and polyadenylation of the precursor mRNA resulting from the transcription of nucleotide sequence coding for truncated ATP7B.

[0078] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the polyadenylation signal sequence of the nucleic acid construct is the synthetic poly(A) signal sequence delimited by bases 4877..4932 of SEQ.ID.NO.1.

Other Nucleotide Elements

[0079] In one embodiment, the nucleic acid construct of the invention constitutes the recombinant genome of an expression vector for gene therapy, the expression vector of the invention; and more particularly of a viral vector for gene therapy.

[0080] Thus, in one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct of the invention further comprises a 5'ITR and a 3'ITR of a virus.

[0081] As used herein the term "inverted terminal repeat (ITR)" refers to a nucleotide sequence located at the 5'-end (5' ITR) and a nucleotide sequence located at the 3'-end (3'ITR) of a virus, that contain palindromic sequences and that can fold over to form T-shaped hairpin structures that function as primers during initiation of DNA replication. They are also needed for viral genome integration into host genome; for the rescue from the host genome; and for the encapsidation of viral nucleic acid into mature virions. The ITRs are required in cis for the vector genome replication and its packaging into the viral particles.

[0082] In one embodiment, the nucleic acid construct comprises a 5'ITR, a w packaging signal, and a 3'ITR of a virus. ".psi. packaging signal" is a cis-acting nucleotide sequence of the virus genome, which in some viruses (e.g. adenoviruses, lentiviruses . . . ) is essential for the process of packaging the virus genome into the viral capsid during replication.

[0083] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct comprises a 5'ITR and a 3'ITR of a virus selected from the group consisting of parvoviruses (in particular adeno-associated viruses), adenoviruses, alphaviruses, retroviruses (in particular gamma retroviruses, and lentiviruses), herpesviruses, and SV40; in a preferred embodiment the virus is an adeno-associated virus (AAV), an adenovirus (Ad), or a lentivirus.

[0084] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct comprises a 5'ITR and a 3'ITR of an AAV.

[0085] The AAV genome is composed of a linear, single-stranded DNA molecule which contains 4681 bases (Berns and Bohenzky, (1987) Advances in Virus Research (Academic Press, Inc.) 32:243-307). The genome includes inverted terminal repeats (ITRs) at each end which function in cis as origins of DNA replication and as packaging signals for the virus. The ITRs are approximately 145 bp in length. The internal non-repeated portion of the genome includes two large open reading frames, known as the AAV rep and cap genes, respectively. These genes code for the viral proteins involved in replication and packaging of the virion. In particular, at least four viral proteins are synthesized from the AAV rep gene, Rep 78, Rep 68, Rep 52 and Rep 40, named according to their apparent molecular weight. The AAV cap gene encodes at least three proteins, VP1, VP2 and VP3. For a detailed description of the AAV genome, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129.

[0086] The construction of recombinant AAV virions is generally known in the art and has been described for instance in U.S. Pat. Nos. 5,173,414 and 5,139,941; WO 92/01070, WO 93/03769, (Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, R. M. (1994) Human Gene Therapy 5:793-801.

[0087] The invention may be carried out by using ITRs of any AAV serotype, including AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV serotype now known or later discovered.

[0088] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct comprises a 5'ITR and a 3'ITR of an AAV of a serotype selected from the group consisting of an AAV1, an AAV2, and an AAV4. In a preferred embodiment the nucleic acid construct comprises the ITR sequences delimited by bases 1..141, and bases 4968..5107 of SEQ.ID.NO.1, that are the ITRs sequences of an AAV2.

[0089] The ITRs are the only AAV viral elements which are required in cis for the AAV genome replication and its packaging into the viral particles.

[0090] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct comprises a 5'ITR, a w packaging signal, and a 3'ITR of an adenovirus of any of the serotypes within any of the classification sub-groups (A-F). In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, these 5'ITR, w signal, and 3'ITR sequences come from a sub-group C adenovirus, more preferably from an adenovirus of serotype 2 (Ad2) or serotype 5 (Ad5).

[0091] On the other hand, in other embodiments the invention can be carried out by using synthetic 5'ITR and/or 3'ITR; and also by using a 5'ITR and a 3'ITR which come from viruses of different serotype.

[0092] All other viral genes required for viral vector replication can be provided in trans within the virus-producing cells (packaging cells) as described below. Therefore, their inclusion in the nucleic acid construct of a viral vector genome according to the invention is optional.

[0093] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the expression vector is an AAV vector.

[0094] In a particular embodiment, the nucleic acid construct of the invention constitutes an AAV vector selected from the group of combinations consisting of

[0095] a) a vector that comprises a 5'ITR and a 3'ITR nucleotide sequences of an AAV2, an AAT promoter sequence, and a nucleotide sequence encoding truncated human ATP7B(d57-486);

[0096] b) a vector that comprises a 5'ITR and a 3'ITR nucleotide sequences of an AAV2, an AAT promoter sequence, and the codon optimized nucleotide sequence SEQ.ID.NO.8 encoding truncated human ATP7B(d57-486);

[0097] c) a vector that comprises a 5'ITR and a 3'ITR nucleotide sequences of an AAV2, an EalbPa1AT hybrid promoter sequence, and a nucleotide sequence encoding truncated human ATP7B(d57-486); and

[0098] d) a vector that comprises a 5'ITR and a 3'ITR nucleotide sequences of an AAV2, an EalbPa1AT hybrid promoter sequence, and a codon optimized nucleotide sequence SEQ.ID.NO.8 encoding truncated human ATP7B(d57-486).

[0099] Each of these AAV vector embodiments also includes a polyadenylation signal sequence, such as synthetic poly(A) signal sequence of SEQ.ID.NO.1 or any other suitable poly(A) signal; together or not with other optional nucleotide elements.

[0100] In another embodiment, optionally in combination with one or more features of the various embodiments described above or below, the expression vector is an adenoviral vector. This adenoviral vector according to the invention can be, in particular, a first-, second-, or third-generation adenovirus [see Adenovirus. Methods and Protocols. Chillon M. and Bosch A. (Eds); third Edition; 2014 Springer], or any other adenoviral vector system already known or later described.

[0101] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the viral vector of the invention is a "third generation adenovirus", which may also be referred to as "gutless adenovirus", "helper-dependent adenovirus (HD-Ad)", or "high capacity adenovirus (HC-Ad)". A third generation adenovirus has all viral coding regions removed (gutless); it depends on a helper adenovirus to replicate (helper-dependent); and it can carry and deliver into the host cell up to 36 Kbp inserts of foreign genetic material (high-capacity). A gutless adenovirus keeps the inverted terminal repeats ITRs (5' and 3') and the packaging signal (.psi.).

[0102] The nucleic acid construct and expression vector of the invention herein described can be prepared and obtained by conventional methods known to those skilled in the art: Sambrook and Russell (Molecular Cloning: a Laboratory Manual; Third Edition; 2001 Cold Spring Harbor Laboratory Press); and Green and Sambrook (Molecular Cloning: a Laboratory Manual; Fourth Edition; 2012 Cold Spring Harbor Laboratory Press).

A Viral Particle of the Invention for Gene Therapy

[0103] The terms "viral particle", and "virion" are used herein interchangeably and relate to an infectious and typically replication-defective virus particle comprising the viral genome (i.e. the nucleic acid construct of the expression viral vector) packaged within a capsid and, as the case may be, a lipidic envelope surrounding the capsid.

[0104] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the virion of the invention is a "recombinant AAV virion" or "rAAV virion" obtained by packaging of a nucleic acid construct of an AAV vector according to the invention in a protein shell.

[0105] Proteins of the viral capsid of an adeno-associated virus (capsid proteins VP1, VP2, and VP3) are generated from a single viral gene (cap gene). Differences among the capsid protein sequences of the various AAV serotypes result in the use of different cell surface receptors for cell entry. In combination with alternative intracellular processing pathways, this gives rise to distinct tissue tropisms for each AAV serotype.

[0106] In a particular embodiment, a recombinant AAV virion according to the invention may be prepared by encapsidating the nucleic acid construct of an AAV vector/genome derived from a particular AAV serotype on a viral particle formed by natural Cap proteins corresponding to an AAV of the same particular serotype. Nevertheless, several techniques have been developed to modify and improve the structural and functional properties of naturally occurring AAV viral particles (Bunning H et al. J Gene Med 2008; 10: 717-733). Thus, in another AAV viral particle according to the invention the nucleotide construct of the viral vector flanked by ITR(s) of a given AAV serotype can be packaged, for example, into: a) a viral particle constituted of capsid proteins derived from the same or different AAV serotype [e.g. AAV2 ITRs and AAV5 capsid proteins; AAV2 ITRs and AAV8 capsid proteins; etc]; b) a mosaic viral particle constituted of a mixture of capsid proteins from different AAV serotypes or mutants [e.g. AAV2 ITRs with AAV1 and AAV5 capsid proteins]; c) a chimeric viral particle constituted of capsid proteins that have been truncated by domain swapping between different AAV serotypes or variants [e.g. AAV2 ITRs with AAV5 capsid proteins with AAV3 domains]; or d) a targeted viral particle engineered to display selective binding domains, enabling stringent interaction with target cell specific receptors [e.g. AAV4 ITRs with AAV2 capsid proteins genetically truncated by insertion of a peptide ligand; or AAV2 capsid proteins non-genetically modified by coupling of a peptide ligand to the capsid surface].

[0107] The skilled person will appreciate that the AAV virion according to the invention may comprise capsid proteins from any AAV serotype. In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the viral particle comprises capsid proteins of an AAV. In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the AAV viral particle comprises capsid proteins from a serotype selected from the group consisting of an AAV1, an AAV5, an AAV7, an AAV8, and an AAV9 which are more suitable for delivery to the liver cells (Nathwani et al. Blood 2007; 109: 1414-1421; Kitajima et al. Atherosclerosis 2006; 186:65-73). In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the viral particle comprises a nucleic acid construct of invention wherein the 5'ITR and 3'ITR sequences of the nucleic acid construct are of an AAV2 serotype and the capsid proteins are of an AAV8 serotype.

[0108] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the AAV viral particle comprises capsid proteins from Anc80, a predicted ancestor of viral AAVs serotypes 1, 2, 8, and 9 that behaves as a highly potent gene therapy vector for targeting liver, muscle and retina (Zinn et al. Cell Reports 2015; 12:1-13). In a more particular embodiment, the viral particle comprises the Anc80L65 VP3 capsid protein (Genbank accession number: KT235804).

[0109] Viral-glycan interactions are critical determinants of host cell invasion. In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the AAV viral particle comprises capsid proteins comprising one or more amino acids substitutions, wherein the substitutions introduce a new glycan binding site into the AAV capsid protein. In a more particular embodiment, the amino acid substitutions are in amino acid 266, amino acids 463-475 and amino acids 499-502 in AAV2 or the corresponding amino acid positions in AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV 8, AAV9, AAV10 or any other AAV serotype, also included Anc80 and Anc80L65.

[0110] The introduced new glycan binding site can be a hexose binding site [e.g. a galactose (Gal), a mannose (Man), a glucose (Glu) or a fucose (fuc) binding site]; a sialic acid (Sia) binding site [e.g. a Sia residue such as is N-acetylneuraminic acid (NeuSAc) or N-Glycolylneuraminic acid (NeuSGc)]; or a disaccharide binding site, wherein the disaccharide is a sialic acid linked to galactose, for instance in the form of Sia(alpha2,3)Gal or Sia(alpha2,6)Gal. Detailed guidance to introduce a new binding site from an AAV serotype into a capsid protein of an AAV of another serotype is given on international patent publication WO2014144229 and in Shen et al. (J. Biol. Chem. 2013; 288(40):28814-28823). In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the Gal binding site from AAV9 is introduced into the AAV2 VP3 backbone resulting in a dual glycan-binding AAV strain which is able to use both HS and Gal receptors for cell entry. Preferably, said dual glycan-binding AAV strain is AAV2G9. Shen et al. generated AAV2G9 by substituting amino acid residues directly involved and immediately flanking the Gal recognition site on the AAV9 VP3 capsid protein subunit onto corresponding residues on the AAV2 VP3 subunit coding region (AAV2 VP3 numbering Q464V, A467P, D469N, I470M, R471A, D472V, S474G, Y500F, and S501A).

[0111] In another embodiment, optionally in combination with one or more features of the various embodiments described above or below, the virion of the invention is an adenoviral virion, such as an Ad5 virion. As it is the case for AAV virions, capsid proteins of Ad virions can also be engineered to modify their tropism and cellular targeting properties, alternative adenoviral serotypes can also be employed.

[0112] Production of Viral Particles

[0113] Production of viral particles carrying the nucleic acid construct of the expression viral vector of the invention can be performed by means of conventional methods and protocols, which are selected having into account the structural features chosen for the actual embodiment of the nucleic acid construct and viral particle of the vector to be produced.

[0114] Briefly, viral particles can be produced in a specific virus-producing cell (packaging cell) which is transfected with the nucleic acid construct of the vector to be packaged, in the presence of a helper vector or virus or other DNA construct(s).

[0115] Accordingly, in one aspect the invention concerns the use of the nucleic acid construct or expression vector of the invention for the production of viral particles.

[0116] In a related aspect, the invention concerns a process of producing viral particles of the invention comprising the steps of:

[0117] a) culturing a host cell comprising a nucleic acid construct or expression vector of the invention in a culture medium; and

[0118] b) harvesting the viral particles from the cell culture supernatant and/or inside the cells.

[0119] Preferably, said host cell is a packaging cell, as described below. Suitable culture media will be known to a person skilled in the art. The ingredients that compose such media may vary depending on the type of cell to be cultured. In addition to nutrient composition, osmolarity and pH are considered important parameters of culture media. The cell growth medium comprises a number of ingredients well known by the person skilled in the art, including amino acids, vitamins, organic and inorganic salts, sources of carbohydrate, lipids, trace elements (CuSO4, FeSO4, Fe(NO3)3, ZnSO4 . . . ), each ingredient being present in an amount which supports the cultivation of a cell in vitro (i.e., survival and growth of cells). Ingredients may also include different auxiliary substances, such as buffer substances (like sodium bicarbonate, Hepes, Tris . . . ), oxidation stabilizers, stabilizers to counteract mechanical stress, protease inhibitors, animal growth factors, plant hydrolyzates, anti-clumping agents, anti-foaming agents. Characteristics and compositions of the cell growth media vary depending on the particular cellular requirements. Examples of commercially available cell growth media are: MEM (Minimum Essential Medium), BME (Basal Medium Eagle) DMEM (Dulbecco's modified Eagle's Medium), Iscoves DMEM (Iscove's modification of Dulbecco's Medium), GMEM, RPMI 1640, Leibovitz L-15, CHO, McCoy's, Medium 199, HEK293, Ham (Ham's Media) F10 and derivatives, Ham F12, DMEM/F12, etc.

A Host Cell of the Invention

[0120] In another aspect, the invention relates to a host cell comprising a nucleic acid construct or expression vector of the invention.

[0121] The term "host cell" as used herein refers to any cell line that is susceptible to infection by a virus of interest, and amenable to culture in vitro.

[0122] The host cell of the invention may be used for ex vivo gene therapy purposes. In such embodiments, the cells are transfected with the nucleic acid construct or viral vector of the invention and subsequently transplanted to the patient or subject. Transplanted cells can have an autologous, allogenic or heterologous origin. For clinical use, cell isolation will generally be carried out under Good Manufacturing Practices (GMP) conditions. Before transplantation, cell quality and absence of microbial or other contaminants is typically checked and liver preconditioning, such as with radiation and/or an immunosuppressive treatment, may be carried out. Furthermore, the host cells may be transplanted together with growth factors to stimulate cell proliferation and/or differentiation, such as Hepatocyte Growth Factor (HGF).

[0123] In a particular embodiment, the host cell is used for ex vivo gene therapy into the liver. Preferably, said cells are eukaryotic cells such as mammalian cells, these include, but are not limited to, humans, non-human primates such as apes; chimpanzees; monkeys, and orangutans, domesticated animals, including dogs and cats, as well as livestock such as horses, cattle, pigs, sheep, and goats, or other mammalian species including, without limitation, mice, rats, guinea pigs, rabbits, hamsters, and the like. A person skilled in the art will choose the more appropriate cells according to the patient or subject to be transplanted.

[0124] Said host cell may be a cell with self-renewal and pluripotency properties, such as stem cells or induced pluripotent stem cells. Stem cells are preferably mesenchymal stem cells. Mesenchymal stem cells (MSCs) are capable of differentiating into at least one of an osteoblast, a chondrocyte, an adipocyte, or a myocyte and may be isolated from any type of tissue. Generally MSCs will be isolated from bone marrow, adipose tissue, umbilical cord, or peripheral blood. Methods for obtaining thereof are well known to a person skilled in the art. Induced pluripotent stem cells (also known as iPS cells or iPSCs) are a type of pluripotent stem cell that can be generated directly from adult cells. Yamanaka et al. induced iPS cells by transferring the Oct3/4, Sox2, Klf4 and c-Myc genes into mouse and human fibroblasts, and forcing the cells to express the genes (WO 2007/069666). Thomson et al. subsequently produced human iPS cells using Nanog and Lin28 in place of Klf4 and c-Myc (WO 2008/118820).

[0125] Said host cells may also be hepatocytes. Hepatocyte transplantation procedures, including cell isolation and subsequent transplantation into a human or mice recipient is described for instance in Filippi and Dhawan, Ann NY Acad Sci. 2014, 1315 50-55; Yoshida et al., Gastroenterology 1996, 111: 1654-1660; Irani et al. Molecular Therapy 2001, 3:3, 302-309; and Vogel et al. J Inherit Metab Dis 2014, 37:165-176. A method for ex vivo transduction of a viral vector into hepatocytes is described for instance in Merle et al., Scandinavian Journal of Gastroenterology 2006, 41:8, 974-982.

[0126] In another particular embodiment, the host cell is a packaging cell. Said cells can be adherent or suspension cells. The packaging cell, and helper vector or DNA constructs provide together in trans all the missing functions which are required for the complete replication and packaging of the viral vector.

[0127] Preferably, said packaging cells are eukaryotic cells such as mammalian cells, including simian, human, dog and rodent cells. Examples of human cells are PER.C6 cells (WO01/38362), MRC-5 (ATCC CCL-171), WI-38 (ATCC CCL-75), HEK-293 cells (ATCC CRL-1573), HeLa cells (ATCC CCL2), and fetal rhesus lung cells (ATCC CL-160). Examples of non-human primate cells are Vero cells (ATCC CCL81), COS-1 cells (ATCC CRL-1650) or COS-7 cells (ATCC CRL-1651). Examples of dog cells are MDCK cells (ATCC CCL-34). Examples of rodent cells are hamster cells, such as BHK21-F, HKCC cells, or CHO cells.

[0128] As an alternative to mammalian sources, cell lines for use in the invention may be derived from avian sources such as chicken, duck, goose, quail or pheasant. Examples of avian cell lines include avian embryonic stem cells (WO01/85938 and WO03/076601), immortalized duck retina cells (WO2005/042728), and avian embryonic stem cell derived cells, including chicken cells (WO2006/108846) or duck cells, such as EB66 cell line (WO2008/129058 & WO2008/142124).

[0129] In another embodiment, said host cell are insect cells, such as SF9 cells (ATCC CRL-1711), Sf21 cells (IPLB-Sf21), MG1 cells (BTI-TN-MG1) or High Five.TM. cells (BTI-TN-5B1-4).

[0130] Accordingly, in a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the host cell comprises:

[0131] a) a nucleic acid construct or expression vector of the invention (i.e., the recombinant AAV genome), generally as a plasmid;

[0132] b) a nucleic acid construct, generally a plasmid, encoding AAV rep and/or cap genes which does not carry the ITR sequences; and/or

[0133] c) a nucleic acid construct, generally a plasmid or virus, comprising viral helper genes.

[0134] Viral genes necessary for AAV replication are referred herein as viral helper genes. Typically, said genes necessary for AAV replication are adenoviral helper genes, such as E1A, E1B, E2a, E4, or VA RNAs. Preferably, the adenoviral helper genes are of the Ad5 or Ad2 serotype.

[0135] Conventional methods can be used to produce viral particles of the AAV vector, which consist on transient cell co-transfection with nucleic acid construct (e.g. a plasmid) carrying the recombinant AAV vector/genome of the invention; a nucleic acid construct (e.g., an AAV helper plasmid) that encodes rep and cap genes, but does not carry ITR sequences; and with a third nucleic acid construct (e.g., a plasmid) providing the adenoviral functions necessary for AAV replication.

[0136] Thus, in a particular embodiment, optionally in combination with one or more of the features of the various embodiments described above or below, said host cell is characterized by comprising:

[0137] i) a nucleic acid construct or an expression vector of the invention (i.e., the recombinant AAV genome);

[0138] ii) a nucleic acid construct encoding AAV rep and cap genes which does not carry the ITR sequences; and

[0139] iii) a nucleic acid construct comprising adenoviral helper genes.

[0140] Alternatively, the rep, cap, and adenoviral helper genes can be combined on a single plasmid (Blouin V et. al.. J Gene Med. 2004; 6(suppl): S223-S228; Grimm D. et al. Hum. Gene Ther. 2003; 7: 839-850). Thus, in another particular embodiment, optionally in combination with one or more of the features of the various embodiments described above or below, said host cell is characterized by comprising:

[0141] i) a nucleic acid construct or an expression vector of the invention (i.e., the recombinant AAV genome); and

[0142] ii) a plasmid encoding AAV rep and cap genes which does not carry the ITR sequences and further comprising adenoviral helper genes.

[0143] In a further particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the host cell comprises:

[0144] a) a nucleic acid construct or an expression vector of the invention (i.e., the recombinant AAV genome);

[0145] b) a plasmid encoding AAV rep and cap genes which does not carry the ITR sequences; and

[0146] c) a plasmid comprising adenoviral helper genes E2a, E4, and VA RNAs, wherein co-transfection is performed in cells, preferably mammalian cells, that constitutively express and transcomplement the adenoviral E1 gene, like HEK-293 cells (ATCC CRL-1573).

[0147] Large-scale production of AAV vectors according to the invention can also be carried out for example by infection of insect cells with a combination of recombinant baculoviruses (Urabe et al. Hum. Gene Ther. 2002; 13: 1935-1943). SF9 cells are co-infected with three baculovirus vectors respectively expressing AAV rep, AAV cap and the AAV vector to be packaged. The recombinant baculovirus vectors will provide the viral helper gene functions required for virus replication and/or packaging.

[0148] By using helper plasmids encoding the rep ORF (open reading frame) of an AAV serotype and cap ORF of a different serotype AAV, it is feasible packaging a vector flanked by ITRs of a given AAV serotype into virions assembled from capsid structural proteins of a different serotype. It is also possible by this same procedure packaging mosaic, chimeric or targeted vectors.

[0149] On the other hand, the production of HC-Ad vectors according to the invention can be carried out by means of mammalian cells that constitutively express and transcomplement the adenoviral E1 gene, and also Cre recombinase (e.g. 293Cre cells). These cells are transfected with the HC-Ad vector genome and infected with a first-generation adenoviral helper virus (E1-deleted) in which the packaging signal is flanked by loxP sequences. [Parks R J et al. Proc. Natl. Acad. Sci. USA 1996; 13565-13570; for 293Cre cells, see Palmer and Engel. Mol. Ther. 2003; 8:846-852]. Several Cre/loxP-based helper virus systems have been described that can be used for packaging HC-Ad vectors, such as AdAdLC8cluc, or the optimized self-inactivating AdTetCre helper virus (EP2295591; Gonzalez-Aparicio et al. Gene Therapy 2011; 18: 1025-1033).

[0150] Further guidance for the construction and production of viral vectors for gene therapy according to the invention can be found in:

[0151] Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology, Vol. 737. Merten and Al-Rubeai (Eds.); 2011 Humana Press (Springer).

[0152] Gene Therapy. M. Giacca. 2010 Springer-Verlag.

[0153] Heilbronn R. and Weger S. Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics. In: Drug Delivery, Handbook of Experimental Pharmacology 197; M. Schafer-Korting (Ed.). 2010 Springer-Verlag; pp. 143-170.

[0154] Adeno-Associated Virus: Methods and Protocols. R. O. Snyder and P. Moulllier (Eds). 2011 Humana Press (Springer).

[0155] Bunning H. et al. Recent developments in adeno-associated virus technology. J. Gene Med. 2008; 10:717-733.

[0156] Adenovirus: Methods and Protocols. M. Chillon and A. Bosch (Eds.); Third Edition. 2014 Humana Press (Springer).

Therapeutic Uses

[0157] In a further aspect, the invention relates to the product of the invention as defined within the Summary of the invention for use as a medicament.

[0158] In an additional aspect, the invention relates to the product of the invention as defined within the Summary of the invention for use in the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2, and of any other conditions and illnesses in which an upregulation of Copper-transporting ATPase 2 expression and activity may produce a therapeutic benefit or improvement, in particular a disease or condition associated with a decrease of ATP7B-dependent lysosomal exocytosis and accumulation of copper in lysosomes, such as choleostatic disorders, Alzheimer disease and/or cancer (Polishchuck et al. Dev Cell. 2014, 29(6), 686-700; Gupta and Lutsenko, Future Med. Chem. 2009, 1, 1125-1142).

[0159] The subject to be treated can be a mammal, and in particular a human patient.

[0160] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the condition caused by a deficiency or dysfunction of Copper-transporting ATPase is Wilson's disease (WD, Online Mendelian Inheritance in Man catalog accession number OMIN 277900; http://www.omim.org/entry/277900).

[0161] In a related aspect, the invention pertains to the use of the product of the invention, as defined within the Summary of the invention, in the preparation of a medicament for use in the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2, and of any other conditions and illnesses in which an upregulation of Copper-transporting ATPase 2 expression and activity may produce a therapeutic benefit or improvement, preferably for use in the treatment of Wilson's disease.

[0162] In a further aspect, the invention relates to the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2, and of any other conditions and illnesses in which an upregulation of Copper-transporting ATPase 2 expression and activity may produce a therapeutic benefit or improvement, preferably for use in the treatment of Wilson's disease, in a patient that comprises administering to the patient a therapeutically effective amount of a nucleic acid construct, an expression vector, a host cell, a viral particle or a pharmaceutical composition of the invention.

[0163] The treatment with a product of the invention may alleviate, ameliorate, or reduce the severity of one or more symptoms of WD. For example, treatment may increase and/or restore holoceruplasmin synthesis, ceruloplasmin oxidase activity, and/or copper excretion in the bile (thus reducing copper accumulation in serum, liver, brain and urine); and as a consequence may alleviate, ameliorate, or reduce the severity of abdominal pain, fatigue, jaundice, frequency of uncontrolled movements, muscle stiffness, problems with speech, swallowing or physical coordination.

[0164] The product of the invention will be typically included in a pharmaceutical composition or medicament, optionally in combination with a pharmaceutical carrier, diluent and/or adjuvant. Such composition or medicinal product comprises the product of the invention in an effective amount, sufficient to provide a desired therapeutic effect, and a pharmaceutically acceptable carrier or excipient.

[0165] Accordingly, in a further aspect, the invention relates to a pharmaceutical composition that comprises a nucleic acid construct, an expression vector, a host cell or a viral particle of the invention, and a pharmaceutically acceptable carrier.

[0166] Any suitable pharmaceutically acceptable carrier or excipient can be used in the preparation of a pharmaceutical composition according to the invention (See e.g., Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (Editor) Mack Publishing Company, April 1997). Pharmaceutical compositions are typically sterile and stable under the conditions of manufacture and storage. Pharmaceutical compositions may be formulated as solutions (e.g. saline, dextrose solution, or buffered solution, or other pharmaceutically acceptable sterile fluids), microemulsions, liposomes, or other ordered structure suitable to accommodate a high product concentration (e.g. microparticles or nanoparticles). The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin. The product of the invention may be administered in a controlled release formulation, for example in a composition which includes a slow release polymer or other carriers that protect the product against rapid release, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers may for example be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic/polyglycolic copolymers (PLG). Preferably, said pharmaceutical composition is formulated as a solution, more preferably as an optionally buffered saline solution.

[0167] Supplementary active compounds can also be incorporated into the pharmaceutical compositions of the invention. Guidance on co-administration of additional therapeutics can for example be found in the Compendium of Pharmaceutical and Specialties (CPS) of the Canadian Pharmacists Association.

[0168] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the pharmaceutical composition of the invention is a parenteral pharmaceutical composition, including a composition suitable for intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular administration. These pharmaceutical compositions are exemplary only and do not limit the pharmaceutical compositions suitable for other parenteral and non-parenteral administration routes.

[0169] In the context of the invention, an "effective amount" means a therapeutically effective amount.

[0170] As used herein a "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary to achieve the desired therapeutic result, such as an elevation of copper translocation activity, thus increasing copper in bile and reducing copper in serum, liver, brain and urine. The therapeutically effective amount of the product of the invention, or pharmaceutical composition that comprises it may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the product or pharmaceutical composition to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also typically one in which any toxic or detrimental effect of the product or pharmaceutical composition is outweighed by the therapeutically beneficial effects.

[0171] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the pharmaceutical composition carrying the product of the invention is administered to the subject or patient by a parenteral route.

[0172] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the pharmaceutical composition is administered by intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular route.

[0173] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the pharmaceutical composition comprising a product of the invention is administered by interstitial route, i.e. by injection to or into the interstices of a tissue. The tissue target may be specific, for example the liver tissue, or it may be a combination of several tissues, for example the muscle and liver tissues. Exemplary tissue targets may include liver, skeletal muscle, heart muscle, adipose deposits, kidney, lung, vascular endothelium, epithelial and/or hematopoietic cells. In a preferred embodiment, optionally in combination with one or more features of the various embodiments described above or below, it is administered by intrahepatic injection, i.e. injection into the interstitial space of hepatic tissue.

[0174] The amount of product of the invention that is administered to the subject or patient may vary depending on the particular circumstances of the individual subject or patient including, age, sex, and weight of the individual; the nature and stage of the disease, the aggressiveness of the disease; the route of administration; and/or concomitant medication that has been prescribed to the subject or patient. Dosage regimens may be adjusted to provide the optimum therapeutic response.

[0175] For any particular subject, specific dosage regimens may be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the administration of the compositions. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners.

[0176] In one embodiment, an AAV vector according to the invention can be administered to the subject or patient for the treatment of Wilson's disease in an amount or dose comprised within a range of 5.times.10.sup.11 to 1.times.10.sup.14 vg/kg (vg: viral genomes; kg: subject's or patient's body weight). In a more particular embodiment, the AAV vector is administered in an amount comprised within a range of 1.times.10.sup.12 to 1.times.10.sup.13 vg/kg.

[0177] In another embodiment, a HC-Ad vector according to the invention can be administered to the subject or patient for the treatment of Wilson's disease in an amount or dose comprised within a range of 1.times.10.sup.9 to 1.times.10.sup.11 iu/kg (iu: infective units of the vector).

[0178] In another aspect, the invention further relates to a kit comprising a nucleic acid construct, vector, host cell, viral particle or pharmaceutical composition of the invention in one or more containers. A kit of the invention may include instructions or packaging materials that describe how to administer a nucleic acid construct, vector, host cell or viral particle of the invention contained within the kit to a patient. Containers of the kit can be of any suitable material, e.g., glass, plastic, metal, etc., and of any suitable size, shape, or configuration. In certain embodiments, the kits may include one or more ampoules or syringes that contain a nucleic acid construct, vector, host cell, viral particle or pharmaceutical composition of the invention in a suitable liquid or solution form.

[0179] Throughout the description and claims the word "comprise" and variations of thereof, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of". Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

EXAMPLES

Example 1. Construction of Recombinant Expression Vectors

[0180] Five different AAV vectors that carry and express human ATP7B, or a truncated form of human ATP7B, were designed and produced for conducting gene therapy of Wilson's Disease (WD): AAV2/8-AAT-wtATP7B, AAV2/8-AAT-coATP7B, AAV2/8-AAT-ATP7B(d223-366), AAV2/8-AAT-ATP7B(d57-486), and AAV2/8-AAT-coATP7B(d57-486).

1.1 Vector AAV2/8-AAT-wtATP7B [Herein Also Named as AAV-wtATP7B1

[0181] Genomic sequence of this vector is identified as SEQ.ID.NO.1.

[0182] Firstly, the plasmid pUC-ATP7B was assembled at request (GenScript) by cloning nucleic acid construct into a pUC57 plasmid. Nucleic acid construct contained cDNA sequence encoding human ATP7B (transgene) together with a synthetic polyadenylation signal sequence (Levitt N. et al. Genes & Development 1989; 3(7):1019-1025) downstream of the transgene.

[0183] Next, the minimal promoter of alpha1 anti-trypsin gene (AAT) was introduced into the plasmid pUC-ATP7B, upstream the ATP7B gene. The minimal promoter consists on the sequence from nucleotide -261 to nucleotide +44 relative to cap site of the AAT promoter (Kramer M. G. et al. Mol. Therapy 2003; 7(3): 375-385) and contains the tissue-specific element (TSE), required for liver function, and the distal region (DRI) required for whole promoter activity. The AAT promoter was obtained by PCR amplification using as template the pEnhAlbAAT-luciferase plasmid (provided by M. G. Kramer) and the following primers

TABLE-US-00001 Primer AAT-Forward (SEQ. ID. NO. 10) 5' CTGGTCTAGAACGCGTCGCCACCCCCTCCACCTTGG 3'; and Primer AAT-reverse (SEQ. ID. NO. 11) 5' ATCATGATGCGGCCGCTTCACTGTCCCAGGTCAGTG 3'.

[0184] The AAT-Forward primer has a restriction site for XbaI and MluI and the 3' AAT-reverse primer has a restriction site for NotI.

[0185] Therefore, in order to obtain plasmid pUC-AAT-ATP7B, the plasmid pUC-ATP7B was digested with XbaI and NotI and ligated to AAT promoter previously digested with the same enzymes.

[0186] The expression cassette was subsequently subcloned into the AAV transfer plasmid pAAV-MCS (Agilent technologies) by digestion with restriction enzymes PmlI and MluI, thus producing the plasmid pAAV2-AAT-wtATP7B.

[0187] Once the plasmid had been constructed, the AAV vector was made by double transfection into 293 cells of the plasmid pAAV2-AAT-ATP7B and of the plasmid pDP8 (obtained from PlasmidFactory, Bielefeld, Germany; plasmid pDP8 expresses AAV8 capsid protein, AAV2 rep protein and the adenoviral molecules required for production and packaging of AAV).

[0188] The vector was finally purified by iodixanol gradient and titrated by quantitative PCR.

1.2 Vector AAV2/8-AAT-coATP7B [Herein Also Named as AAV-coATP7B]

[0189] Genomic sequence of this vector is identified as SEQ.ID.NO.3.

[0190] To obtain the AAV vector expressing a codon optimized version of the ATP7B gene (coATP7B), the plasmid pUC-coATP7B was firstly assembled at request (GenScript) by cloning nucleic acid construct into a pUC57 plasmid. Next the coATP7B was excised from the pUC-coATP7B by digestion with the restriction enzymes NotI and KpnI and subcloned into the pAAV2-AAT-wtATP7B plasmid previously digested with the same enzymes, NotI and KpnI, to obtain the plasmid pAAV2-AAT-coATP7B.

[0191] Once the plasmid had been constructed, the production of vector genome and packaging of viral particles was performed as has been described previously for the vector AAV2/8-AAT-wtATP7B: double transfection of previously obtained plasmid pAAV2-AAT-coATP7B with plasmid pDP8, purification (iodixanol gradient) and titration.

1.3 Vector AAV2/8-AAT-ATP7B(d223-366) [Herein Also Named as AAV-T1]

[0192] This vector carries as the transgene a nucleic acid sequence (SEQ.ID.NO.12) encoding ATP7B(d223-366), a truncated form of human ATP7B in which amino acids 223 to 366 have been deleted. The deleted sequence includes HMA 3 domain and seven amino acids of the HMA 4 domain.

[0193] To obtain the vector, the plasmid pUC57-wtATP7B was digested with the restriction enzymes MfeI and Nae I, to obtain the plasmid pUC57-ATP7B-T1. This way, the size of the codifying region was reduced in 432 nucleotides and the size of the protein in 144 amino acids.

[0194] Once the plasmid pUC57-ATP7B-T1 had been constructed, the production of vector genome and packaging of viral particles was performed as described previously for the vector AAV2/8-AAT-wtATP7B: ligation to AAT promoter, subcloning into plasmid pAAV-MCS, double transfection of previously obtained plasmid pAAV2-AAT-T1 with plasmid pDP8, virus purification (iodixanol gradient) and titration.

1.4 Vector AAV2/8-AAT-ATP7B(d57-486) [Herein Also Named as AAV-T2]

[0195] Genomic sequence of this vector is identified as SEQ.ID.NO.6.

[0196] This vector carries as the transgene a nucleic acid sequence encoding ATP7B(d57-486) [also named as ATP7B-T2], a truncated form of human ATP7B in which amino acids 57 to 486 have been deleted. This way, the first 4 HMA domains have been eliminated while maintaining the signal sequence that comprises the 56 amino acids of the amino terminal region, reducing the size of the codifying region in 1.29 Kb and the protein in 430 amino acids.

[0197] The nucleotide sequence of ATP7B(d57-486) was obtained by PCR amplification using the pUC57-wtATP7B as template and two sets of primers;

a first set of primers amplifying the amino terminal sequence:

TABLE-US-00002 Primer F1: (SEQ. ID. NO. 14) 5' CTAGATGCGGCCGCCACCATGCCTG 3', and Primer R1: (SEQ. ID. NO. 15) 5' CTGAGAAGAAGGGCCCAGGCC 3'; and

a second set of primers amplifying the carboxy terminal region:

TABLE-US-00003 Primer F2: (SEQ. ID. NO. 16) 5' GGCCCTTCTTCTCAGCCGCAGAAGTGCTTCTTACAG 3', and Primer R2: (SEQ. ID. NO. 17) 5' ACCAAAATCGATAAAACCGATTACAATCC 3'.

[0198] The 5' terminal sequences of primers R1 and F2 are complementary. Using equimolecular amounts of the two PCR purified fragments as template, and primers F1 and R2, PCR was performed to obtain nucleotide sequence encoding ATP7B(d57-486). The PCR product was then digested with NotI and ClaI and cloned into the pUC57-AAT-wtATP7B plasmid previously digested with both enzymes obtaining the plasmid pUC57-ATP7B-T2.

[0199] Once the plasmid pUC57-ATP7B-T2 had been constructed, the production of vector genome and packaging of viral particles was performed as described previously for the vector AAV2/8-AAT-wtATP7B: ligation to AAT promoter, subcloning into plasmid pAAV-MCS, double transfection of previously obtained plasmid pAAV2-AAT-T2 with plasmid pDP8, purification (iodixanol gradient) and titration.

1.5 Vector AAV2/8-AAT-coATP7B(d57-486) [Herein Also Named as AAV-AAT-coT2]

[0200] This vector carries as transgene a codon optimized nucleic acid sequence [SEQ.ID.NO.8; coATP7B(d57-486) or coATP7B-T2] that also encodes ATP7B(d57-486).

[0201] The nucleotide sequence of coATP7B(d57-486) was obtained by PCR amplification using the pUC57-coATP7B as template and two sets of primers;

a first set of primers amplifying the amino terminal sequence:

TABLE-US-00004 Primer F3: (SEQ. ID. NO. 18) 5' ACGCGTGCGGCCGCCACCATGCCAG 3', and Primer R3: (SEQ. ID. NO. 19) 5' CTGGGAGCTAGGTCCCAGTCC 3';

and A second set of primers amplifying the carboxy terminal region:

TABLE-US-00005 Primer F4: (SEQ. ID. NO. 20) 5' GGACCTAGCTCCCAGCCTCAGAAGTGTTTTCTGCAG 3', and Primer R4: (SEQ. ID. NO. 21) 5' TGTTCCTCGCGAATGATCAGGTTGTCCTC 3'.

[0202] The 5' terminal sequences or primers R3 and F4 are complementary. Using equimolecular amounts of the two PCR purified fragments as template, and primers F3 and R4, PCR was performed to obtain codon optimized nucleotide sequence encoding ATP7B(d57-486). The PCR product was then digested with NotI and NruI and cloned into the pUC57-AAT-wtATP7B plasmid previously digested with both enzymes obtaining the plasmid pUC57-coATP7B-T2.

[0203] Once the plasmid pUC57-coATP7B-T2 had been constructed, the production of vector genome and packaging of viral particles was performed as described previously for the vector AAV2/8-AAT-wtATP7B: ligation to AAT promoter, subcloning into plasmid pAAV-MCS, double transfection of previously obtained plasmid pAAV2-AAT-coT2 with plasmid pDP8, virus purification (iodixanol gradient) and titration.

Example 2. Wilson's Disease Animal Model: ATP7B KO

[0204] The therapeutic performance of the vectors AAV2/8-AAT-ATP7B-T1 and AAV2/8-AAT-ATP7B-T2 was tested in ATP7B knockout mice (ATP7B KO, ATP7B.sup.-/- or WD mice) which are a representative animal model of WD. This animal model was developed by Buiakova et al., by introducing an early termination codon in the mouse ATP7B mRNA by engineering the substitution of a portion of ATP7B exon 2 with a neomycin cassette oriented in the opposite transcriptional frame (Buikova O. I. et al. Human Molecular Genetics 1999; 8(9): 1665-1671). ATP7B knockout mice show no ATP7B expression in the liver and high Cu excretion in the urine, low holoceruloplasmin levels in serum, high transaminase levels, high Cu concentration in the liver and a pathologic liver histology. These mice exhibit the typical biochemical characteristics of human Wilson's disease except for the neurological affectation (Lutsenko S. Biochemical Society Transactions 2008; 36(Pt 6): 1233-1238).

Example 3. Determination of the Therapeutic Effect of Viral Vectors AAV2/8-AAT-ATP7B-T1 and AAV2/8-AAT-ATP7B-T2 in Wilson's Disease Mice

[0205] Six weeks (6 w) old male ATP7B-/- mice were divided in 4 groups of 5 mice each: 1 of the groups were treated intravenously with the vector AAV2/8-AAT-wtATP7B at a dose of 3.times.10.sup.10 vg/mouse (vg: viral genomes); a second group with the same dose of the vector AAV2/8-AAT-ATP7B-T1; a third group with the same dose of the vector AAV2/8-AAT-ATP7B-T2; and a fourth group was left untreated. An additional group of wild type mice was kept untreated as a control group (control). Animals were sacrificed twenty-four weeks after vector administration (w30).

[0206] Four weeks after vector administration and every five weeks after that up to week 30; serum transaminases (ALT) levels and urine Cu content were determined in all the groups. Serum ceruloplasmin activity was measured 4 weeks after treatment.

[0207] Serum transaminases (ALT) levels were determined by the DGKC method (Roche Diagnostics, Mannheim, Germany) using a Hitachi 747 Clinical Analyzer (Hitachi, Tokyo, Japan).

[0208] Serum ceruloplasmin activity was determined with o-dianisidine dihydrochloride (4, 4'-diamino-3,3'-dimethoxy-biphenyl) as substrate (Sigma-Aldrich, San Louis, Mo., United States) as described by Schosinsky and cols. (Clinical Chemistry 1974; 20(12): 1556-1563). Absorbance was measured at 540 nm in a spectrophotometer.

[0209] Urine copper content was determined by atomic absorption spectroscopy (SIMAA 6000, from Perkin-Elmer GmbH, Bodenseewerk).

[0210] After the sacrifice the liver was excised for histological analyses.

[0211] Hepatic copper content was determined in dry liver tissue by atomic absorption spectroscopy (SIMAA 6000, from Perkin-Elmer GmbH, Bodenseewerk), and by Timm's sulphide silver staining (Danscher G. and Zimmer J. Histochemistry 1978; 55(1): 27-40).

[0212] Liver structure was assessed in sections stained with hematoxylin and eosin.

[0213] Immunohistochemistry with anti-mouse CD45 antibody (BioLegend, San Diego, USA; Catalog Number 103102) was performed to detect inflammatory infiltration in the liver.

[0214] Immunohistochemistry with anti-mouse PanCk antibody (Invitrogen/Life Technologies, 18-0132, clon AE1/AE3) was also performed to detect biliary cells.

[0215] To determine fibrosis we used conventional Sirius Red staining as a method for collagen determination.

[0216] As shown in FIG. 2, transaminase levels were normalized in the mice receiving AAV2/8-AAT-wtATP7B or AAV2/8-AAT-ATP7B-T2 but no in animals treated with AAV2/8-AAT-ATP7B-T1. Furthermore, the concentration of Cu in urine was significantly lower in the animals that received AAV2/8-AAT-wtATP7B, AAV2/8-AAT-ATP7B-T1, or AAV2/8-AAT-ATP7B-T2; however AAV2/8-AAT-ATP7B-T1 was less efficient in reducing Cu concentration in urine (FIG. 3). Ceruloplasmin activity was restored four weeks after treatment in the animals receiving AAV2/8-AAT-wtATP7B or AAV2/8-AAT-ATP7B-T2 but no in animal treated with AAV2/8-AAT-ATP7B-T1 (FIG. 4). This result was corroborated by western blot analysis. Holoceruloplasmin was detected in mice treated with AAV2/8-AAT-wtATP7B or AAV2/8-AAT-ATP7B-T2 but no in animals treated with AAV2/8-AAT-ATP7B-T1 where as in untreated WD mice only the apoceruloplasmin form could be detected.

[0217] On the other hand, the administration of the AAV2/8-AAT-wtATP7B, AAV2/8-AAT-ATP7B-T1, or AAV2/8-AAT-ATP7B-T2 significantly reduced Cu content in the liver; however, AAV2/8-AAT-ATP7B-T1 was less efficient in reducing Cu concentration in the liver (FIG. 5). The results were confirmed in the image obtained after Timm's staining (FIG. 6B). Regarding liver histology, untreated animals showed an abnormal hepatic architecture with huge hepatocytes containing enormous nuclei. The administration of the vectors AAV2/8-AAT-wtATP7B or AAV2/8-AAT-ATP7B-T2 but no AAV2/8-AAT-ATP7B-T1 resulted in the normalization of liver histology (FIG. 6A). Furthermore, WD animals presented a strong liver infiltrate mainly composed by CD45 positive cells; infiltration disappeared after treatment with the recombinant viral vectors (FIG. 7). Thus, the administration of AAV vector resulted in a marked reduction of the inflammatory infiltrate. Furthermore, biliary duct proliferation and liver fibrosis were also significantly reduced in AAV2/8-AAT-wtATP7B, AAV2/8-AAT-ATP7B-T2, and AAV2/8-AAT-ATP7B-T1-treated WD mice (FIG. 7).

Example 4. Therapeutic Effect of Viral Vector AAV2/8-AAT-ATP7B(d57-486) in Wilson's Disease Female Mice

[0218] Six weeks (6 w) old female ATP7B-/- mice were divided in 4 groups of 5 mice each: animals of the groups 1-3 were treated intravenously with the viral vector AAV2/8-AAT-ATP7B(d57-486), each group receiving a different dose (respectively 1.times.10.sup.10, 3.times.10.sup.10, and 1.times.10.sup.11 vg/mouse); a fourth group were left untreated. An additional group of wild type mice was kept untreated as a control group (WT).

[0219] Four weeks after vector administration and every five weeks after that up to 24 weeks after treatment (when the mice were 30 weeks old), serum transaminases (ALT) levels and urine Cu concentration were determined in all the groups, by the same methods as described in Example 3.

[0220] As shown in FIG. 8, AAV2/8-AAT-ATP7B(d57-486) normalized transaminase levels in WD female mice at the two highest doses (3.times.10.sup.10, and 1.times.10.sup.11 vg/mouse); the lowest dose 1.times.10.sup.10 vg/mouse significantly reduced transaminase levels but failed to eliminate liver damage. However, treatment with the three different doses significantly reduced Cu urinary excretion reaching the levels found in WT mice (FIG. 9).

Example 5. Comparison of the Therapeutic Effect of Viral Vectors AAV2/8-AAT-wtATP7B and AAV2/8-AAT-ATP7B(d57-486) in Wilson's Disease Female Mice

[0221] Two experimental groups were established. For each experimental group, six weeks (6 w) old female ATP7B-/- mice were divided in 4 groups of 5 mice each: 3 of the groups were treated intravenously with a viral vector to be tested, each group receiving a different dose (respectively 1.times.10.sup.10, 3.times.10.sup.10, and 1.times.10.sup.11 vg/mouse; a fourth group were left untreated. An additional group of wild type mice were kept untreated as a control group (WT).

[0222] In first experimental group (experimental group 1), WD mice receiving treatment were administered with the vector AAV2/8-AAT-wtATP7B; in second experimental group (experimental group 2) they were administered with the vector AAV2/8-AAT-ATP7B(d57-486).

[0223] Serum ceruloplasmin activity determined 4 weeks after treatment, and hepatic Cu content determined 24 weeks after treatment, were measured by the same methods as described in example 3.

[0224] Serum Ceruloplasmin Activity

[0225] Serum ceruloplasmin activity was corrected only by the administration of the highest dose of the AAV2/8-AAT-wtATP7B vector (FIG. 10A experimental group 1); no effect being observed after the administration of the two lowest doses.

[0226] Conversely, the AAV2/8-AAT-ATP7B(d57-486) vector significantly increased ceruloplasmin levels at the lowest dose of 1.times.10.sup.10 vg/mouse; the administration of the medium dose of vector normalized ceruloplasmin levels and the highest dose increased ceruloplasmin activity over the normal levels (FIG. 10B experimental group 2).

[0227] Cu Concentration in the Liver

[0228] Besides, Cu concentration in the liver was reduced but not normalized by the administration of the two highest doses of AAV2/8-AAT-wtATP7B; and no effect was observed at the lowest dose (FIG. 11A experimental group 1). On the contrary, Cu concentration was shown to be reduced after administration of the AAV2/8-AAT-ATP7B(d57-486) vector at all the tested doses, and at the highest dose the levels were close to normal (FIG. 11B experimental group 2).

[0229] Accordingly, a dose of 1.times.10.sup.10 vg/mouse of the AAV2/8-AAT-wtATP7B vector was shown to be a "suboptimal dose" for the wt construct both for the obtaining of a normalization of the serum ceruloplasmin activity and a reduction of Cu accumulation in the liver; whereas the vector carrying the truncated form unexpectedly provided statistically significant therapeutic effects at said suboptimal dose.

Example 6. Comparison of the Therapeutic Effect of Viral Vectors AAV2/8-AAT-wtATP7B and AAV2/8-AAT-ATP7B(d57-486) in WD Mice

[0230] Six weeks (6 w) old male ATP7B-/- mice were divided in 3 groups of mice: 2 groups of animals were respectively treated with a suboptimal intravenous dose (1.times.10.sup.10 vg/mouse) of the vector AAV2/8-AAT-wtATP7B or the vector AAV2/8-AAT-ATP7B(d57-486); a third group were left untreated. An additional group of wild type mice were kept untreated as a control group (WT).

[0231] Hepatic Cu content was measured by the same method as described in example 3.

[0232] As it is shown in FIG. 12, although both AAV2/8-AAT-wtATP7B and AAV2/8-AAT-ATP7B(d57-486) vectors given at a suboptimal dose reduced accumulation of copper in the liver of WD mice, AAV2/8-AAT-ATP7B(d57-486) provided a reduction of hepatic copper content that was significantly greater than the reduction provided by AAV2/8-AAT-wtATP7B.

Example 7. Comparison of the Therapeutic Effect of Viral Vectors AAV2/8-AAT-ATP7B(d57-486) and AAV-AAT-coATP7B(d57-486) in WD Mice

[0233] Six weeks (6 w) old male ATP7B-/- mice were divided in 3 groups of mice: 2 groups of animals were respectively treated with a suboptimal intravenous dose (1.times.10.sup.10 vg/mouse) of the vector AAV2/8-AAT-ATP7B(d57-486) and AAV-AAT-coATP7B(d57-486); a third group were left untreated. An additional group of wild type mice were kept untreated as a control group (WT).

[0234] Hepatic Cu content was measured by the same method as described in example 3.

[0235] As it is shown in FIG. 13, although both AAV2/8-AAT-ATP7B(d57-486) and AAV2/8-AAT-coATP7B(d57-486)vectors given at a suboptimal dose reduced accumulation of copper in the liver of WD mice, AAV2/8-AAT-coATP7B(d57-486) provided a reduction of hepatic copper content that was significantly greater than the reduction provided by AAV2/8-AAT-ATP7B(d57-486).

Example 8. Therapeutic Effect of Codon Optimized Viral Vector AAV2/8-AAT-coATP7B(d57-486) in WD Mice

[0236] Six weeks (6 w) old male ATP7B-/- mice were divided in 5 groups of mice: 4 groups of animals were respectively treated with a suboptimal intravenous dose (1.times.10.sup.10 vg/mouse) of the vectors AAV2/8-AAT-wtATP7B, AAV2/8-AAT-coATP7B, AAV2/8-AAT-ATP7B(d57-486) or AAV2/8-AAT-coATP7B(d57-486); a fifth group were left untreated. An additional group of wild type mice were kept untreated as a control group (WT).

[0237] Serum ceruloplasmin activity was measured by the same method as described in example 3.

[0238] As it is shown in FIG. 14, the two vectors carrying nucleotide sequence of truncated ATP7B-T2 restored ceruloplasmin oxidase activity when administered to WD mice at the suboptimal dose, while vectors carrying nucleotide sequences encoding complete human ATP7B did not provide any significant improvement of ceruloplasmin activity when administered at the same treatment conditions.

Sequence CWU 1

1

2115107DNAArtificial SequenceNucleic acid construct of expression vector AAV2-AAT-wtATP7Brepeat_region(1)..(141)/note="5' ITR of adeno-associated virus serotype 2"promoter(156)..(460)/note="alpha 1 antitrypsin"CDS(473)..(4870)/note="Sequence encoding ATP7B (Copper transporting ATPase 2)" /transl_table=1polyA_signal(4877)..(4932)repeat_region(4968)..(5107)/stan- dard_name="3' ITR of adeno-associated virus serotype 2" 1cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120actccatcac taggggttcc tgcggccgca cgcgtcgcca ccccctccac cttggacaca 180ggacgctgtg gtttctgagc caggtacaat gactcctttc ggtaagtgca gtggaagctg 240tacactgccc aggcaaagcg tccgggcagc gtaggcgggc gactcagatc ccagccagtg 300gacttagccc ctgtttgctc ctccgataac tggggtgacc ttggttaata ttcaccagca 360gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca gggccctgtc 420tcctcagctt caggcaccac cactgacctg ggacagtgaa gcggccgcca cc atg cct 478 Met Pro 1gag cag gag aga cag atc aca gcc aga gaa ggg gcc agt cgg aaa atc 526Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg Lys Ile 5 10 15tta tct aag ctt tct ttg cct acc cgt gcc tgg gaa cca gca atg aag 574Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala Met Lys 20 25 30aag agt ttt gct ttt gac aat gtt ggc tat gaa ggt ggt ctg gat ggc 622Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu Asp Gly35 40 45 50ctg ggc cct tct tct cag gtg gcc acc agc aca gtc agg atc ttg ggc 670Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile Leu Gly 55 60 65atg act tgc cag tca tgt gtg aag tcc att gag gac agg att tcc aat 718Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile Ser Asn 70 75 80ttg aaa ggc atc atc agc atg aag gtt tcc ctg gaa caa ggc agt gcc 766Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly Ser Ala 85 90 95act gtg aaa tat gtg cca tcg gtt gtg tgc ctg caa cag gtt tgc cat 814Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val Cys His 100 105 110caa att ggg gac atg ggc ttc gag gcc agc att gca gaa gga aag gca 862Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly Lys Ala115 120 125 130gcc tcc tgg ccc tca agg tcc ttg cct gcc cag gag gct gtg gtc aag 910Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val Val Lys 135 140 145ctc cgg gtg gag ggc atg acc tgc cag tcc tgt gtc agc tcc att gaa 958Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser Ile Glu 150 155 160ggc aag gtc cgg aaa ctg caa gga gta gtg aga gtc aaa gtc tca ctc 1006Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val Ser Leu 165 170 175agc aac caa gag gcc gtc atc act tat cag cct tat ctc att cag ccc 1054Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile Gln Pro 180 185 190gaa gac ctc agg gac cat gta aat gac atg gga ttt gaa gct gcc atc 1102Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala Ala Ile195 200 205 210aag agc aaa gtg gct ccc tta agc ctg gga cca att gat att gag cgg 1150Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile Glu Arg 215 220 225tta caa agc act aac cca aag aga cct tta tct tct gct aac cag aat 1198Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn Gln Asn 230 235 240ttt aat aat tct gag acc ttg ggg cac caa gga agc cat gtg gtc acc 1246Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val Val Thr 245 250 255ctc caa ctg aga ata gat gga atg cat tgt aag tct tgc gtc ttg aat 1294Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val Leu Asn 260 265 270att gaa gaa aat att ggc cag ctc cta ggg gtt caa agt att caa gtg 1342Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile Gln Val275 280 285 290tcc ttg gag aac aaa act gcc caa gta aag tat gac cct tct tgt acc 1390Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser Cys Thr 295 300 305agc cca gtg gct ctg cag agg gct atc gag gca ctt cca cct ggg aat 1438Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro Gly Asn 310 315 320ttt aaa gtt tct ctt cct gat gga gcc gaa ggg agt ggg aca gat cac 1486Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr Asp His 325 330 335agg tct tcc agt tct cat tcc cct ggc tcc cca ccg aga aac cag gtc 1534Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn Gln Val 340 345 350cag ggc aca tgc agt acc act ctg att gcc att gcc ggc atg acc tgt 1582Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met Thr Cys355 360 365 370gca tcc tgt gtc cat tcc att gaa ggc atg atc tcc caa ctg gaa ggg 1630Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu Glu Gly 375 380 385gtg cag caa ata tcg gtg tct ttg gcc gaa ggg act gca aca gtt ctt 1678Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr Val Leu 390 395 400tat aat ccc tct gta att agc cca gaa gaa ctc aga gct gct ata gaa 1726Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala Ile Glu 405 410 415gac atg gga ttt gag gct tca gtc gtt tct gaa agc tgt tct act aac 1774Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser Thr Asn 420 425 430cct ctt gga aac cac agt gct ggg aat tcc atg gtg caa act aca gat 1822Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr Thr Asp435 440 445 450ggt aca cct aca tct gtg cag gaa gtg gct ccc cac act ggg agg ctc 1870Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly Arg Leu 455 460 465cct gca aac cat gcc ccg gac atc ttg gca aag tcc cca caa tca acc 1918Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln Ser Thr 470 475 480aga gca gtg gca ccg cag aag tgc ttc tta cag atc aaa ggc atg acc 1966Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly Met Thr 485 490 495tgt gca tcc tgt gtg tct aac ata gaa agg aat ctg cag aaa gaa gct 2014Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys Glu Ala 500 505 510ggt gtt ctc tcc gtg ttg gtt gcc ttg atg gca gga aag gca gag atc 2062Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala Glu Ile515 520 525 530aag tat gac cca gag gtc atc cag ccc ctc gag ata gct cag ttc atc 2110Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln Phe Ile 535 540 545cag gac ctg ggt ttt gag gca gca gtc atg gag gac tac gca ggc tcc 2158Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala Gly Ser 550 555 560gat ggc aac att gag ctg aca atc aca ggg atg acc tgc gcg tcc tgt 2206Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala Ser Cys 565 570 575gtc cac aac ata gag tcc aaa ctc acg agg aca aat ggc atc act tat 2254Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile Thr Tyr 580 585 590gcc tcc gtt gcc ctt gcc acc agc aaa gcc ctt gtt aag ttt gac ccg 2302Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe Asp Pro595 600 605 610gaa att atc ggt cca cgg gat att atc aaa att att gag gaa att ggc 2350Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu Ile Gly 615 620 625ttt cat gct tcc ctg gcc cag aga aac ccc aac gct cat cac ttg gac 2398Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His Leu Asp 630 635 640cac aag atg gaa ata aag cag tgg aag aag tct ttc ctg tgc agc ctg 2446His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys Ser Leu 645 650 655gtg ttt ggc atc cct gtc atg gcc tta atg atc tat atg ctg ata ccc 2494Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu Ile Pro 660 665 670agc aac gag ccc cac cag tcc atg gtc ctg gac cac aac atc att cca 2542Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile Ile Pro675 680 685 690gga ctg tcc att cta aat ctc atc ttc ttt atc ttg tgt acc ttt gtc 2590Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr Phe Val 695 700 705cag ctc ctc ggt ggg tgg tac ttc tac gtt cag gcc tac aaa tct ctg 2638Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys Ser Leu 710 715 720aga cac agg tca gcc aac atg gac gtg ctc atc gtc ctg gcc aca agc 2686Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala Thr Ser 725 730 735att gct tat gtt tat tct ctg gtc atc ctg gtg gtt gct gtg gct gag 2734Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val Ala Glu 740 745 750aag gcg gag agg agc cct gtg aca ttc ttc gac acg ccc ccc atg ctc 2782Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro Met Leu755 760 765 770ttt gtg ttc att gcc ctg ggc cgg tgg ctg gaa cac ttg gca aag agc 2830Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala Lys Ser 775 780 785aaa acc tca gaa gcc ctg gct aaa ctc atg tct ctc caa gcc aca gaa 2878Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala Thr Glu 790 795 800gcc acc gtt gtg acc ctt ggt gag gac aat tta atc atc agg gag gag 2926Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg Glu Glu 805 810 815caa gtc ccc atg gag ctg gtg cag cgg ggc gat atc gtc aag gtg gtc 2974Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys Val Val 820 825 830cct ggg gga aag ttt cca gtg gat ggg aaa gtc ctg gaa ggc aat acc 3022Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly Asn Thr835 840 845 850atg gct gat gag tcc ctc atc aca gga gaa gcc atg cca gtc act aag 3070Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val Thr Lys 855 860 865aaa ccc gga agc act gta att gcg ggg tct ata aat gca cat ggc tct 3118Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His Gly Ser 870 875 880gtg ctc att aaa gct acc cac gtg ggc aat gac acc act ttg gct cag 3166Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu Ala Gln 885 890 895att gtg aaa ctg gtg gaa gag gct cag atg tca aag gca ccc att cag 3214Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro Ile Gln 900 905 910cag ctg gct gac cgg ttt agt gga tat ttt gtc cca ttt atc atc atc 3262Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile Ile Ile915 920 925 930atg tca act ttg acg ttg gtg gta tgg att gta atc ggt ttt atc gat 3310Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe Ile Asp 935 940 945ttt ggt gtt gtt cag aga tac ttt cct aac ccc aac aag cac atc tcc 3358Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His Ile Ser 950 955 960cag aca gag gtg atc atc cgg ttt gct ttc cag acg tcc atc acg gtg 3406Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile Thr Val 965 970 975ctg tgc att gcc tgc ccc tgc tcc ctg ggg ctg gcc acg ccc acg gct 3454Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro Thr Ala 980 985 990gtc atg gtg ggc acc ggg gtg gcc gcg cag aac ggc atc ctc atc 3499Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu Ile995 1000 1005aag gga ggc aag ccc ctg gag atg gcg cac aag ata aag act gtg 3544Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val1010 1015 1020atg ttt gac aag act ggc acc att acc cat ggc gtc ccc agg gtc 3589Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val1025 1030 1035atg cgg gtg ctc ctg ctg ggg gat gtg gcc aca ctg ccc ctc agg 3634Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg1040 1045 1050aag gtt ctg gct gtg gtg ggg act gcg gag gcc agc agt gaa cac 3679Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His1055 1060 1065ccc ttg ggc gtg gca gtc acc aaa tac tgt aaa gag gaa ctt gga 3724Pro Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly1070 1075 1080aca gag acc ttg gga tac tgc acg gac ttc cag gca gtg cca ggc 3769Thr Glu Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly1085 1090 1095tgt gga att ggg tgc aaa gtc agc aac gtg gaa ggc atc ctg gcc 3814Cys Gly Ile Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu Ala1100 1105 1110cac agt gag cgc cct ttg agt gca ccg gcc agt cac ctg aat gag 3859His Ser Glu Arg Pro Leu Ser Ala Pro Ala Ser His Leu Asn Glu1115 1120 1125gct ggc agc ctt ccc gca gaa aaa gat gca gtc ccc cag acc ttc 3904Ala Gly Ser Leu Pro Ala Glu Lys Asp Ala Val Pro Gln Thr Phe1130 1135 1140tct gtg ctg att gga aac cgt gag tgg ctg agg cgc aac ggt tta 3949Ser Val Leu Ile Gly Asn Arg Glu Trp Leu Arg Arg Asn Gly Leu1145 1150 1155acc att tct agc gat gtc agt gac gct atg aca gac cac gag atg 3994Thr Ile Ser Ser Asp Val Ser Asp Ala Met Thr Asp His Glu Met1160 1165 1170aaa gga cag aca gcc atc ctg gtg gct att gac ggt gtg ctc tgt 4039Lys Gly Gln Thr Ala Ile Leu Val Ala Ile Asp Gly Val Leu Cys1175 1180 1185ggg atg atc gca atc gca gac gct gtc aag cag gag gct gcc ctg 4084Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln Glu Ala Ala Leu1190 1195 1200gct gtg cac acg ctg cag agc atg ggt gtg gac gtg gtt ctg atc 4129Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val Val Leu Ile1205 1210 1215acg ggg gac aac cgg aag aca gcc aga gct att gcc acc cag gtt 4174Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr Gln Val1220 1225 1230ggc atc aac aaa gtc ttt gca gag gtg ctg cct tcg cac aag gtg 4219Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys Val1235 1240 1245gcc aag gtc cag gag ctc cag aat aaa ggg aag aaa gtc gcc atg 4264Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala Met1250 1255 1260gtg ggg gat ggg gtc aat gac tcc ccg gcc ttg gcc cag gca gac 4309Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala Asp1265 1270 1275atg ggt gtg gcc att ggc acc ggc acg gat gtg gcc atc gag gca 4354Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala1280 1285 1290gcc gac gtc gtc ctt atc aga aat gat ttg ctg gat gtg gtg gct 4399Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala1295 1300 1305agc att cac ctt tcc aag agg act gtc cga agg ata cgc atc aac 4444Ser Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn1310 1315 1320ctg gtc ctg gca ctg att tat aac ctg gtt ggg ata ccc att gca 4489Leu Val Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala1325 1330 1335gca ggt gtc ttc atg ccc atc ggc att gtg ctg cag ccc tgg atg 4534Ala Gly Val Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp Met1340 1345 1350ggc tca gcg gcc atg gca gcc tcc tct gtg tct gtg gtg ctc tca 4579Gly Ser Ala Ala Met Ala Ala Ser Ser Val Ser Val Val Leu Ser1355 1360 1365tcc ctg cag ctc aag tgc tat aag aag cct gac ctg gag agg tat 4624Ser Leu Gln Leu Lys Cys Tyr Lys Lys Pro Asp Leu Glu Arg Tyr1370 1375 1380gag gca cag gcg cat ggc cac atg aag ccc ctg acg gca tcc cag 4669Glu Ala Gln Ala His Gly His Met Lys Pro Leu Thr Ala Ser Gln1385 1390 1395gtc agt gtg cac ata ggc atg gat gac agg tgg cgg gac tcc ccc 4714Val Ser Val His Ile Gly Met Asp Asp Arg Trp Arg Asp Ser Pro1400 1405 1410agg gcc aca cca tgg gac cag gtc agc tat gtc agc cag gtg tcg 4759Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr Val Ser Gln Val Ser1415 1420 1425ctg tcc tcc ctg acg tcc gac aag cca tct cgg cac agc gct gca

4804Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg His Ser Ala Ala1430 1435 1440gca gac gat gat ggg gac aag tgg tct ctg ctc ctg aat ggc agg 4849Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu Asn Gly Arg1445 1450 1455gat gag gag cag tac atc tga ggtaccaata aagacctctt attttcattc 4900Asp Glu Glu Gln Tyr Ile1460 1465atcaggtgtg gttggttttt ttgtgtgggg gcggatccat cggatcccgt gcggaccgag 4960cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 5020actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 5080agcgagcgag cgcgcagctg cctgcag 510721465PRTArtificial SequenceSynthetic Construct 2Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45Asp Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile 50 55 60Leu Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile65 70 75 80Ser Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly 85 90 95Ser Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val 100 105 110Cys His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly 115 120 125Lys Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val 130 135 140Val Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser145 150 155 160Ile Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val 165 170 175Ser Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile 180 185 190Gln Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala 195 200 205Ala Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile 210 215 220Glu Arg Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn225 230 235 240Gln Asn Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val 245 250 255Val Thr Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val 260 265 270Leu Asn Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile 275 280 285Gln Val Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser 290 295 300Cys Thr Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro305 310 315 320Gly Asn Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr 325 330 335Asp His Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn 340 345 350Gln Val Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met 355 360 365Thr Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu 370 375 380Glu Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr385 390 395 400Val Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala 405 410 415Ile Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser 420 425 430Thr Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr 435 440 445Thr Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly 450 455 460Arg Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln465 470 475 480Ser Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly 485 490 495Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys 500 505 510Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala 515 520 525Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln 530 535 540Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala545 550 555 560Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala 565 570 575Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile 580 585 590Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe 595 600 605Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu 610 615 620Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His625 630 635 640Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys 645 650 655Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu 660 665 670Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile 675 680 685Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr 690 695 700Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys705 710 715 720Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala 725 730 735Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val 740 745 750Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro 755 760 765Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala 770 775 780Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala785 790 795 800Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg 805 810 815Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys 820 825 830Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly 835 840 845Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val 850 855 860Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His865 870 875 880Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu 885 890 895Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro 900 905 910Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile 915 920 925Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe 930 935 940Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His945 950 955 960Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile 965 970 975Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro 980 985 990Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu 995 1000 1005Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr 1010 1015 1020Val Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg 1025 1030 1035Val Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu 1040 1045 1050Arg Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu 1055 1060 1065His Pro Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu 1070 1075 1080Gly Thr Glu Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro 1085 1090 1095Gly Cys Gly Ile Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu 1100 1105 1110Ala His Ser Glu Arg Pro Leu Ser Ala Pro Ala Ser His Leu Asn 1115 1120 1125Glu Ala Gly Ser Leu Pro Ala Glu Lys Asp Ala Val Pro Gln Thr 1130 1135 1140Phe Ser Val Leu Ile Gly Asn Arg Glu Trp Leu Arg Arg Asn Gly 1145 1150 1155Leu Thr Ile Ser Ser Asp Val Ser Asp Ala Met Thr Asp His Glu 1160 1165 1170Met Lys Gly Gln Thr Ala Ile Leu Val Ala Ile Asp Gly Val Leu 1175 1180 1185Cys Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln Glu Ala Ala 1190 1195 1200Leu Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val Val Leu 1205 1210 1215Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr Gln 1220 1225 1230Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys 1235 1240 1245Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala 1250 1255 1260Met Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala 1265 1270 1275Asp Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu 1280 1285 1290Ala Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val 1295 1300 1305Ala Ser Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile 1310 1315 1320Asn Leu Val Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile 1325 1330 1335Ala Ala Gly Val Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp 1340 1345 1350Met Gly Ser Ala Ala Met Ala Ala Ser Ser Val Ser Val Val Leu 1355 1360 1365Ser Ser Leu Gln Leu Lys Cys Tyr Lys Lys Pro Asp Leu Glu Arg 1370 1375 1380Tyr Glu Ala Gln Ala His Gly His Met Lys Pro Leu Thr Ala Ser 1385 1390 1395Gln Val Ser Val His Ile Gly Met Asp Asp Arg Trp Arg Asp Ser 1400 1405 1410Pro Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr Val Ser Gln Val 1415 1420 1425Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg His Ser Ala 1430 1435 1440Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu Asn Gly 1445 1450 1455Arg Asp Glu Glu Gln Tyr Ile 1460 146535107DNAArtificial SequenceNucleic acid construct of expression vector AAV2-AAT-coATP7Brepeat_region(1)..(141)/note="5' ITR of adeno-associated virus serotype 2"promoter(156)..(460)/note="alpha 1 antitrypsin"CDS(473)..(4870)/note="Codon optimized sequence encoding ATP7B" /transl_table=1polyA_signal(4877)..(4932)repeat_region(4968)..(5107)/note- ="3' ITR of adeno-associated virus serotype 2" 3cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120actccatcac taggggttcc tgcggccgca cgcgtcgcca ccccctccac cttggacaca 180ggacgctgtg gtttctgagc caggtacaat gactcctttc ggtaagtgca gtggaagctg 240tacactgccc aggcaaagcg tccgggcagc gtaggcgggc gactcagatc ccagccagtg 300gacttagccc ctgtttgctc ctccgataac tggggtgacc ttggttaata ttcaccagca 360gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca gggccctgtc 420tcctcagctt caggcaccac cactgacctg ggacagtgaa gcggccgcca cc atg cca 478 Met Pro 1gaa cag gaa cgc cag atc aca gca aga gag gga gca agt cgg aaa atc 526Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg Lys Ile 5 10 15ctg agc aaa ctg agc ctg cca acc aga gca tgg gaa ccc gca atg aag 574Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala Met Lys 20 25 30aaa agc ttc gcc ttt gac aac gtg gga tac gag gga ggg ctg gat gga 622Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu Asp Gly35 40 45 50ctg gga cct agc tcc cag gtg gcc acc tct aca gtc cga atc ctg ggc 670Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile Leu Gly 55 60 65atg act tgc cag agt tgc gtg aaa tca att gaa gac cgg atc agt aat 718Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile Ser Asn 70 75 80ctg aag gga atc att agc atg aaa gtg tcc ctg gag cag ggc tca gcc 766Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly Ser Ala 85 90 95acc gtg aag tat gtc cct agc gtg gtc tgc ctg cag cag gtg tgc cac 814Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val Cys His 100 105 110cag atc ggc gat atg ggg ttc gag gcc tcc att gct gaa ggg aaa gcc 862Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly Lys Ala115 120 125 130gct tct tgg cct agc cgg tcc ctg cca gca cag gaa gca gtg gtc aag 910Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val Val Lys 135 140 145ctg aga gtg gag gga atg aca tgc cag agc tgc gtg agc agt atc gaa 958Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser Ile Glu 150 155 160gga aag gtc cga aaa ctg cag ggc gtg gtc cgg gtg aag gtc tct ctg 1006Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val Ser Leu 165 170 175agt aac cag gag gcc gtg att acc tac cag ccc tat ctg atc cag cct 1054Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile Gln Pro 180 185 190gaa gac ctg agg gat cac gtg aat gac atg ggc ttc gag gca gcc atc 1102Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala Ala Ile195 200 205 210aag tcc aaa gtg gcc cca ctg tct ctg ggg ccc att gat atc gaa aga 1150Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile Glu Arg 215 220 225ctg cag tcc acc aac cca aag agg ccc ctg tca agc gcc aac cag aac 1198Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn Gln Asn 230 235 240ttc aac aat agt gag acc ctg gga cac cag ggc tca cat gtg gtc aca 1246Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val Val Thr 245 250 255ctg cag ctg agg att gac ggc atg cac tgc aag tct tgc gtg ctg aac 1294Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val Leu Asn 260 265 270att gag gaa aat atc ggc cag ctg ctg ggg gtg cag tct atc cag gtc 1342Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile Gln Val275 280 285 290agt ctg gag aac aag act gct cag gtg aaa tac gat cct tca tgc acc 1390Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser Cys Thr 295 300 305agc cca gtg gca ctg cag cgc gct atc gaa gca ctg ccc cct gga aat 1438Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro Gly Asn 310 315 320ttc aag gtg agc ctg cct gac gga gca gag gga tcc gga acc gat cac 1486Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr Asp His 325 330 335agg tcc tct agt tca cat tcc cca ggg tct cca cca cga aac cag gtg 1534Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn Gln Val 340 345 350cag gga aca tgt tcc acc aca ctg att gca atc gcc ggc atg act tgc 1582Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met Thr Cys355 360 365 370gcc tca tgc gtg cac agc att gaa ggg atg atc tct cag ctg gag gga 1630Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu Glu Gly 375 380 385gtg cag cag atc tca gtc agc ctg gcc gag ggc act gct acc gtg ctg 1678Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr Val Leu 390 395 400tac aat ccc agt gtc atc tca cct gag gaa ctg cgg gct gca att gag 1726Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala Ile Glu 405 410 415gac atg ggg ttc gaa gct tcc gtg gtc tcc gaa tct tgc agt acc aac 1774Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser Thr Asn 420 425 430ccc ctg ggg aat cat tcc gcc gga aac tct atg gtg cag act acc gac 1822Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr Thr Asp435 440 445 450ggg aca cct act tct gtg cag gag gtc gca cca cac aca gga cgc ctg

1870Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly Arg Leu 455 460 465cca gcc aat cat gct ccc gat atc ctg gcc aaa agc ccc cag tcc act 1918Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln Ser Thr 470 475 480cga gct gtg gca cct cag aag tgt ttt ctg cag atc aaa ggc atg acc 1966Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly Met Thr 485 490 495tgc gcc tct tgc gtg agc aac att gag cgg aat ctg cag aag gaa gct 2014Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys Glu Ala 500 505 510ggg gtg ctg agc gtg ctg gtc gca ctg atg gcc gga aag gct gag atc 2062Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala Glu Ile515 520 525 530aag tac gac cct gaa gtg atc cag cca ctg gag att gcc cag ttc atc 2110Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln Phe Ile 535 540 545cag gat ctg ggc ttt gag gcc gct gtg atg gaa gac tat gct ggg agc 2158Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala Gly Ser 550 555 560gat gga aac att gaa ctg acc atc acc gga atg act tgt gcc tct tgc 2206Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala Ser Cys 565 570 575gtg cac aac atc gag agt aaa ctg act aga acc aat ggg att acc tac 2254Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile Thr Tyr 580 585 590gcc agt gtg gcc ctg gct aca tca aag gct ctg gtg aaa ttc gac ccc 2302Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe Asp Pro595 600 605 610gag atc att gga cct agg gat atc att aag atc att gag gaa atc ggc 2350Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu Ile Gly 615 620 625ttt cac gca agc ctg gcc cag cgc aac cca aat gcc cac cat ctg gac 2398Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His Leu Asp 630 635 640cat aag atg gag atc aag cag tgg aag aaa agt ttc ctg tgc tca ctg 2446His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys Ser Leu 645 650 655gtg ttt gga atc ccc gtc atg gcc ctg atg atc tac atg ctg atc cct 2494Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu Ile Pro 660 665 670agc aac gag cca cac cag tcc atg gtg ctg gat cat aac atc att cct 2542Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile Ile Pro675 680 685 690ggc ctg tcc atc ctg aat ctg att ttc ttt atc ctg tgc aca ttc gtg 2590Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr Phe Val 695 700 705cag ctg ctg gga ggc tgg tac ttt tat gtg cag gca tat aaa tca ctg 2638Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys Ser Leu 710 715 720cga cac cgg agc gcc aat atg gac gtg ctg att gtc ctg gca acc tct 2686Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala Thr Ser 725 730 735atc gcc tac gtg tat agt ctg gtc atc ctg gtg gtc gca gtg gca gag 2734Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val Ala Glu 740 745 750aag gca gaa cgg agc cca gtg act ttc ttt gat acc cct cca atg ctg 2782Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro Met Leu755 760 765 770ttc gtg ttt atc gct ctg ggc aga tgg ctg gaa cat ctg gca aag tca 2830Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala Lys Ser 775 780 785aaa acc agc gag gct ctg gca aag ctg atg agc ctg cag gct acc gaa 2878Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala Thr Glu 790 795 800gca aca gtg gtc act ctg gga gag gac aac ctg atc att cgc gag gaa 2926Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg Glu Glu 805 810 815cag gtg cct atg gaa ctg gtc cag cga ggc gat atc gtg aag gtg gtc 2974Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys Val Val 820 825 830cca ggg gga aaa ttc ccc gtg gac ggc aag gtc ctg gag ggg aat act 3022Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly Asn Thr835 840 845 850atg gcc gat gaa tcc ctg atc acc ggc gag gct atg cct gtg aca aag 3070Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val Thr Lys 855 860 865aaa cca gga tca act gtc att gct ggc agc atc aac gca cac ggg tcc 3118Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His Gly Ser 870 875 880gtg ctg atc aag gcc aca cat gtc ggg aat gac aca act ctg gct cag 3166Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu Ala Gln 885 890 895att gtg aaa ctg gtc gag gaa gcc cag atg tcc aag gct cct atc cag 3214Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro Ile Gln 900 905 910cag ctg gcc gat cgg ttc tcc ggc tac ttc gtg ccc ttc atc att atc 3262Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile Ile Ile915 920 925 930atg tct aca ctg act ctg gtg gtc tgg att gtg atc gga ttc att gac 3310Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe Ile Asp 935 940 945ttt ggc gtg gtc cag aga tat ttt ccc aac cct aat aag cac atc agc 3358Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His Ile Ser 950 955 960cag acc gaa gtg atc atc agg ttc gca ttt cag acc agt att aca gtg 3406Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile Thr Val 965 970 975ctg tgc atc gcc tgc cca tgt tca ctg ggg ctg gct acc ccc aca gca 3454Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro Thr Ala 980 985 990gtg atg gtc gga aca gga gtg gca gca cag aac gga att ctg atc 3499Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu Ile995 1000 1005aag ggc ggg aaa ccc ctg gag atg gcc cac aag atc aaa act gtg 3544Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val1010 1015 1020atg ttt gac aaa act ggg acc att aca cat gga gtg ccc cgc gtc 3589Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val1025 1030 1035atg cga gtg ctg ctg ctg ggc gat gtg gca acc ctg cct ctg aga 3634Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg1040 1045 1050aag gtc ctg gca gtg gtc gga aca gca gag gct agc tcc gaa cac 3679Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His1055 1060 1065cca ctg ggg gtg gcc gtc aca aag tac tgc aaa gag gaa ctg ggc 3724Pro Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly1070 1075 1080act gag acc ctg ggg tat tgt act gac ttc cag gca gtg ccc gga 3769Thr Glu Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly1085 1090 1095tgc gga atc gga tgt aaa gtc tct aac gtg gaa ggg att ctg gct 3814Cys Gly Ile Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu Ala1100 1105 1110cac agt gag cgg ccc ctg agc gca cct gca tcc cat ctg aat gaa 3859His Ser Glu Arg Pro Leu Ser Ala Pro Ala Ser His Leu Asn Glu1115 1120 1125gca gga agc ctg cca gca gag aag gac gct gtg cct cag acc ttt 3904Ala Gly Ser Leu Pro Ala Glu Lys Asp Ala Val Pro Gln Thr Phe1130 1135 1140tcc gtc ctg atc ggc aac aga gaa tgg ctg cgg aga aat ggg ctg 3949Ser Val Leu Ile Gly Asn Arg Glu Trp Leu Arg Arg Asn Gly Leu1145 1150 1155aca att tct agt gac gtg tcc gat gcc atg aca gat cac gag atg 3994Thr Ile Ser Ser Asp Val Ser Asp Ala Met Thr Asp His Glu Met1160 1165 1170aaa ggc cag act gca att ctg gtg gcc atc gac gga gtc ctg tgc 4039Lys Gly Gln Thr Ala Ile Leu Val Ala Ile Asp Gly Val Leu Cys1175 1180 1185ggc atg att gct atc gca gat gcc gtg aag cag gag gct gca ctg 4084Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln Glu Ala Ala Leu1190 1195 1200gcc gtc cat acc ctg cag tct atg ggc gtg gac gtg gtc ctg atc 4129Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val Val Leu Ile1205 1210 1215acc ggg gat aac cgg aaa aca gct aga gca att gcc act caa gtg 4174Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr Gln Val1220 1225 1230ggc atc aat aag gtg ttc gct gaa gtc ctg cct agc cac aag gtc 4219Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys Val1235 1240 1245gca aaa gtg cag gag ctg cag aac aag ggc aag aaa gtc gcc atg 4264Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala Met1250 1255 1260gtg gga gac ggc gtg aat gat agc cca gct ctg gca cag gca gac 4309Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala Asp1265 1270 1275atg gga gtc gct att ggg aca gga act gac gtg gca atc gag gcc 4354Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala1280 1285 1290gct gat gtg gtc ctg att agg aat gac ctg ctg gat gtg gtc gct 4399Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala1295 1300 1305tct att cat ctg agt aag agg aca gtg agg cgc att cgc atc aac 4444Ser Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn1310 1315 1320ctg gtg ctg gcc ctg atc tac aat ctg gtg gga att cca atc gca 4489Leu Val Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala1325 1330 1335gcc ggc gtg ttt atg cca att ggg atc gtc ctg cag ccc tgg atg 4534Ala Gly Val Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp Met1340 1345 1350ggc tca gct gca atg gcc gct tca agc gtg agc gtg gtc ctg tcc 4579Gly Ser Ala Ala Met Ala Ala Ser Ser Val Ser Val Val Leu Ser1355 1360 1365tct ctg cag ctg aaa tgc tac aag aaa cca gac ctg gag cgg tac 4624Ser Leu Gln Leu Lys Cys Tyr Lys Lys Pro Asp Leu Glu Arg Tyr1370 1375 1380gaa gct cag gca cac gga cat atg aag ccc ctg acc gct tcc cag 4669Glu Ala Gln Ala His Gly His Met Lys Pro Leu Thr Ala Ser Gln1385 1390 1395gtg tct gtc cac atc ggc atg gac gat aga tgg agg gac agc cca 4714Val Ser Val His Ile Gly Met Asp Asp Arg Trp Arg Asp Ser Pro1400 1405 1410agg gcc act cca tgg gat cag gtc agt tac gtg agc cag gtc agc 4759Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr Val Ser Gln Val Ser1415 1420 1425ctg agt tca ctg acc agc gac aag ccc tcc cgc cat tct gca gcc 4804Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg His Ser Ala Ala1430 1435 1440gct gat gac gac ggg gac aag tgg agc ctg ctg ctg aac gga agg 4849Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu Asn Gly Arg1445 1450 1455gac gaa gaa cag tat atc taa ggtaccaata aagacctctt attttcattc 4900Asp Glu Glu Gln Tyr Ile1460 1465atcaggtgtg gttggttttt ttgtgtgggg gcggatccat cggatcccgt gcggaccgag 4960cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 5020actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 5080agcgagcgag cgcgcagctg cctgcag 510741465PRTArtificial SequenceSynthetic Construct 4Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45Asp Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile 50 55 60Leu Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile65 70 75 80Ser Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly 85 90 95Ser Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val 100 105 110Cys His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly 115 120 125Lys Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val 130 135 140Val Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser145 150 155 160Ile Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val 165 170 175Ser Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile 180 185 190Gln Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala 195 200 205Ala Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile 210 215 220Glu Arg Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn225 230 235 240Gln Asn Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val 245 250 255Val Thr Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val 260 265 270Leu Asn Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile 275 280 285Gln Val Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser 290 295 300Cys Thr Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro305 310 315 320Gly Asn Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr 325 330 335Asp His Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn 340 345 350Gln Val Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met 355 360 365Thr Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu 370 375 380Glu Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr385 390 395 400Val Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala 405 410 415Ile Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser 420 425 430Thr Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr 435 440 445Thr Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly 450 455 460Arg Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln465 470 475 480Ser Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly 485 490 495Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys 500 505 510Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala 515 520 525Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln 530 535 540Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala545 550 555 560Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala 565 570 575Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile 580 585 590Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe 595 600 605Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu 610 615 620Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His625 630 635 640Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys 645 650 655Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu 660 665 670Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile 675 680 685Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr 690 695 700Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys705 710 715 720Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala 725 730 735Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val 740 745 750Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro 755 760 765Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala 770 775 780Lys Ser Lys Thr Ser Glu Ala Leu

Ala Lys Leu Met Ser Leu Gln Ala785 790 795 800Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg 805 810 815Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys 820 825 830Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly 835 840 845Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val 850 855 860Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His865 870 875 880Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu 885 890 895Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro 900 905 910Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile 915 920 925Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe 930 935 940Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His945 950 955 960Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile 965 970 975Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro 980 985 990Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu 995 1000 1005Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr 1010 1015 1020Val Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg 1025 1030 1035Val Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu 1040 1045 1050Arg Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu 1055 1060 1065His Pro Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu 1070 1075 1080Gly Thr Glu Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro 1085 1090 1095Gly Cys Gly Ile Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu 1100 1105 1110Ala His Ser Glu Arg Pro Leu Ser Ala Pro Ala Ser His Leu Asn 1115 1120 1125Glu Ala Gly Ser Leu Pro Ala Glu Lys Asp Ala Val Pro Gln Thr 1130 1135 1140Phe Ser Val Leu Ile Gly Asn Arg Glu Trp Leu Arg Arg Asn Gly 1145 1150 1155Leu Thr Ile Ser Ser Asp Val Ser Asp Ala Met Thr Asp His Glu 1160 1165 1170Met Lys Gly Gln Thr Ala Ile Leu Val Ala Ile Asp Gly Val Leu 1175 1180 1185Cys Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln Glu Ala Ala 1190 1195 1200Leu Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val Val Leu 1205 1210 1215Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr Gln 1220 1225 1230Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys 1235 1240 1245Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala 1250 1255 1260Met Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala 1265 1270 1275Asp Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu 1280 1285 1290Ala Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val 1295 1300 1305Ala Ser Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile 1310 1315 1320Asn Leu Val Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile 1325 1330 1335Ala Ala Gly Val Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp 1340 1345 1350Met Gly Ser Ala Ala Met Ala Ala Ser Ser Val Ser Val Val Leu 1355 1360 1365Ser Ser Leu Gln Leu Lys Cys Tyr Lys Lys Pro Asp Leu Glu Arg 1370 1375 1380Tyr Glu Ala Gln Ala His Gly His Met Lys Pro Leu Thr Ala Ser 1385 1390 1395Gln Val Ser Val His Ile Gly Met Asp Asp Arg Trp Arg Asp Ser 1400 1405 1410Pro Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr Val Ser Gln Val 1415 1420 1425Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg His Ser Ala 1430 1435 1440Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu Asn Gly 1445 1450 1455Arg Asp Glu Glu Gln Tyr Ile 1460 14655695DNAArtificial SequenceHybrid promoter EalbPa1ATenhancer(1)..(382)/note="Albumin gene enhancer"promoter(391)..(695)/note="Alpha 1 antitrypsin promoter" 5ctcgaggttc ctagattaca ttacacattc tgcaagcata gcacagagca atgttctact 60ttaattactt tcattttctt gtatcctcac agcctagaaa ataacctgcg ttacagcatc 120cactcagtat cccttgagca tgaggtgaca ctacttaaca tagggacgag atggtacttt 180gtgtctcctg ctctgtcagc agggcacagt acttgctgat accagggaat gtttgttctt 240aaataccatc attccggacg tgtttgcctt ggccagtttt ccatgtacat gcagaaagaa 300gtttggactg atcaatacag tcctctgcct ttaaagcaat aggaaaaggc caacttgtct 360acgtttagta tgtggctgta gatctgtacc cgccaccccc tccaccttgg acacaggacg 420ctgtggtttc tgagccaggt acaatgactc ctttcggtaa gtgcagtgga agctgtacac 480tgcccaggca aagcgtccgg gcagcgtagg cgggcgactc agatcccagc cagtggactt 540agcccctgtt tgctcctccg ataactgggg tgaccttggt taatattcac cagcagcctc 600ccccgttgcc cctctggatc cactgcttaa atacggacga ggacagggcc ctgtctcctc 660agcttcaggc accaccactg acctgggaca gtgaa 69563817DNAArtificial SequenceNucleic acid construct of expression vector AAV2-AAT-ATP7B(d57-486)repeat_region(1)..(141)/note="5' ITR of adeno-associated virus serotype 2"promoter(156)..(460)/note="alpha 1 antitrysin"CDS(473)..(3580)/note="Truncated ATP7B (Copper-transporting ATPase 2)"/note="Sequence encoding a truncated ATP7B (Copper transporting ATPase 2), carrying a deletion of amino acids 57.. 486"/transl_table=1polyA_signal(3587)..(3642)repeat_region(3678)..(3817)/- note="3' ITR of adeno-associated virus serotype 2" 6cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120actccatcac taggggttcc tgcggccgca cgcgtcgcca ccccctccac cttggacaca 180ggacgctgtg gtttctgagc caggtacaat gactcctttc ggtaagtgca gtggaagctg 240tacactgccc aggcaaagcg tccgggcagc gtaggcgggc gactcagatc ccagccagtg 300gacttagccc ctgtttgctc ctccgataac tggggtgacc ttggttaata ttcaccagca 360gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca gggccctgtc 420tcctcagctt caggcaccac cactgacctg ggacagtgaa gcggccgcca cc atg cct 478 Met Pro 1gag cag gag aga cag atc aca gcc aga gaa ggg gcc agt cgg aaa atc 526Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg Lys Ile 5 10 15tta tct aag ctt tct ttg cct acc cgt gcc tgg gaa cca gca atg aag 574Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala Met Lys 20 25 30aag agt ttt gct ttt gac aat gtt ggc tat gaa ggt ggt ctg gat ggc 622Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu Asp Gly35 40 45 50ctg ggc cct tct tct cag ccg cag aag tgc ttc tta cag atc aaa ggc 670Leu Gly Pro Ser Ser Gln Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly 55 60 65atg acc tgt gca tcc tgt gtg tct aac ata gaa agg aat ctg cag aaa 718Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys 70 75 80gaa gct ggt gtt ctc tcc gtg ttg gtt gcc ttg atg gca gga aag gca 766Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala 85 90 95gag atc aag tat gac cca gag gtc atc cag ccc ctc gag ata gct cag 814Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln 100 105 110ttc atc cag gac ctg ggt ttt gag gca gca gtc atg gag gac tac gca 862Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala115 120 125 130ggc tcc gat ggc aac att gag ctg aca atc aca ggg atg acc tgc gcg 910Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala 135 140 145tcc tgt gtc cac aac ata gag tcc aaa ctc acg agg aca aat ggc atc 958Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile 150 155 160act tat gcc tcc gtt gcc ctt gcc acc agc aaa gcc ctt gtt aag ttt 1006Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe 165 170 175gac ccg gaa att atc ggt cca cgg gat att atc aaa att att gag gaa 1054Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu 180 185 190att ggc ttt cat gct tcc ctg gcc cag aga aac ccc aac gct cat cac 1102Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His195 200 205 210ttg gac cac aag atg gaa ata aag cag tgg aag aag tct ttc ctg tgc 1150Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys 215 220 225agc ctg gtg ttt ggc atc cct gtc atg gcc tta atg atc tat atg ctg 1198Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu 230 235 240ata ccc agc aac gag ccc cac cag tcc atg gtc ctg gac cac aac atc 1246Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile 245 250 255att cca gga ctg tcc att cta aat ctc atc ttc ttt atc ttg tgt acc 1294Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr 260 265 270ttt gtc cag ctc ctc ggt ggg tgg tac ttc tac gtt cag gcc tac aaa 1342Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys275 280 285 290tct ctg aga cac agg tca gcc aac atg gac gtg ctc atc gtc ctg gcc 1390Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala 295 300 305aca agc att gct tat gtt tat tct ctg gtc atc ctg gtg gtt gct gtg 1438Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val 310 315 320gct gag aag gcg gag agg agc cct gtg aca ttc ttc gac acg ccc ccc 1486Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro 325 330 335atg ctc ttt gtg ttc att gcc ctg ggc cgg tgg ctg gaa cac ttg gca 1534Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala 340 345 350aag agc aaa acc tca gaa gcc ctg gct aaa ctc atg tct ctc caa gcc 1582Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala355 360 365 370aca gaa gcc acc gtt gtg acc ctt ggt gag gac aat tta atc atc agg 1630Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg 375 380 385gag gag caa gtc ccc atg gag ctg gtg cag cgg ggc gat atc gtc aag 1678Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys 390 395 400gtg gtc cct ggg gga aag ttt cca gtg gat ggg aaa gtc ctg gaa ggc 1726Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly 405 410 415aat acc atg gct gat gag tcc ctc atc aca gga gaa gcc atg cca gtc 1774Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val 420 425 430act aag aaa ccc gga agc act gta att gcg ggg tct ata aat gca cat 1822Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His435 440 445 450ggc tct gtg ctc att aaa gct acc cac gtg ggc aat gac acc act ttg 1870Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu 455 460 465gct cag att gtg aaa ctg gtg gaa gag gct cag atg tca aag gca ccc 1918Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro 470 475 480att cag cag ctg gct gac cgg ttt agt gga tat ttt gtc cca ttt atc 1966Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile 485 490 495atc atc atg tca act ttg acg ttg gtg gta tgg att gta atc ggt ttt 2014Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe 500 505 510atc gat ttt ggt gtt gtt cag aga tac ttt cct aac ccc aac aag cac 2062Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His515 520 525 530atc tcc cag aca gag gtg atc atc cgg ttt gct ttc cag acg tcc atc 2110Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile 535 540 545acg gtg ctg tgc att gcc tgc ccc tgc tcc ctg ggg ctg gcc acg ccc 2158Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro 550 555 560acg gct gtc atg gtg ggc acc ggg gtg gcc gcg cag aac ggc atc ctc 2206Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu 565 570 575atc aag gga ggc aag ccc ctg gag atg gcg cac aag ata aag act gtg 2254Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val 580 585 590atg ttt gac aag act ggc acc att acc cat ggc gtc ccc agg gtc atg 2302Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val Met595 600 605 610cgg gtg ctc ctg ctg ggg gat gtg gcc aca ctg ccc ctc agg aag gtt 2350Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg Lys Val 615 620 625ctg gct gtg gtg ggg act gcg gag gcc agc agt gaa cac ccc ttg ggc 2398Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro Leu Gly 630 635 640gtg gca gtc acc aaa tac tgt aaa gag gaa ctt gga aca gag acc ttg 2446Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu Thr Leu 645 650 655gga tac tgc acg gac ttc cag gca gtg cca ggc tgt gga att ggg tgc 2494Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile Gly Cys 660 665 670aaa gtc agc aac gtg gaa ggc atc ctg gcc cac agt gag cgc cct ttg 2542Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg Pro Leu675 680 685 690agt gca ccg gcc agt cac ctg aat gag gct ggc agc ctt ccc gca gaa 2590Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro Ala Glu 695 700 705aaa gat gca gtc ccc cag acc ttc tct gtg ctg att gga aac cgt gag 2638Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn Arg Glu 710 715 720tgg ctg agg cgc aac ggt tta acc att tct agc gat gtc agt gac gct 2686Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser Asp Ala 725 730 735atg aca gac cac gag atg aaa gga cag aca gcc atc ctg gtg gct att 2734Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val Ala Ile 740 745 750gac ggt gtg ctc tgt ggg atg atc gca atc gca gac gct gtc aag cag 2782Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln755 760 765 770gag gct gcc ctg gct gtg cac acg ctg cag agc atg ggt gtg gac gtg 2830Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val 775 780 785gtt ctg atc acg ggg gac aac cgg aag aca gcc aga gct att gcc acc 2878Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr 790 795 800cag gtt ggc atc aac aaa gtc ttt gca gag gtg ctg cct tcg cac aag 2926Gln Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys 805 810 815gtg gcc aag gtc cag gag ctc cag aat aaa ggg aag aaa gtc gcc atg 2974Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala Met 820 825 830gtg ggg gat ggg gtc aat gac tcc ccg gcc ttg gcc cag gca gac atg 3022Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala Asp Met835 840 845 850ggt gtg gcc att ggc acc ggc acg gat gtg gcc atc gag gca gcc gac 3070Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala Ala Asp 855 860 865gtc gtc ctt atc aga aat gat ttg ctg gat gtg gtg gct agc att cac 3118Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser Ile His 870 875 880ctt tcc aag agg act gtc cga agg ata cgc atc aac ctg gtc ctg gca 3166Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val Leu Ala 885 890 895ctg att tat aac ctg gtt ggg ata ccc att gca gca ggt gtc ttc atg 3214Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val Phe Met 900 905 910ccc atc ggc att gtg ctg cag ccc tgg atg ggc tca gcg gcc atg gca 3262Pro Ile Gly Ile Val

Leu Gln Pro Trp Met Gly Ser Ala Ala Met Ala915 920 925 930gcc tcc tct gtg tct gtg gtg ctc tca tcc ctg cag ctc aag tgc tat 3310Ala Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys Cys Tyr 935 940 945aag aag cct gac ctg gag agg tat gag gca cag gcg cat ggc cac atg 3358Lys Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly His Met 950 955 960aag ccc ctg acg gca tcc cag gtc agt gtg cac ata ggc atg gat gac 3406Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met Asp Asp 965 970 975agg tgg cgg gac tcc ccc agg gcc aca cca tgg gac cag gtc agc tat 3454Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr 980 985 990gtc agc cag gtg tcg ctg tcc tcc ctg acg tcc gac aag cca tct 3499Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser995 1000 1005cgg cac agc gct gca gca gac gat gat ggg gac aag tgg tct ctg 3544Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu1010 1015 1020ctc ctg aat ggc agg gat gag gag cag tac atc tga ggtaccaata 3590Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile1025 1030 1035aagacctctt attttcattc atcaggtgtg gttggttttt ttgtgtgggg gcggatccat 3650cggatcccgt gcggaccgag cggccgcagg aacccctagt gatggagttg gccactccct 3710ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct 3770ttgcccgggc ggcctcagtg agcgagcgag cgcgcagctg cctgcag 381771035PRTArtificial SequenceSynthetic Construct 7Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45Asp Gly Leu Gly Pro Ser Ser Gln Pro Gln Lys Cys Phe Leu Gln Ile 50 55 60Lys Gly Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu65 70 75 80Gln Lys Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly 85 90 95Lys Ala Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile 100 105 110Ala Gln Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp 115 120 125Tyr Ala Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr 130 135 140Cys Ala Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn145 150 155 160Gly Ile Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val 165 170 175Lys Phe Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile 180 185 190Glu Glu Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala 195 200 205His His Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe 210 215 220Leu Cys Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr225 230 235 240Met Leu Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His 245 250 255Asn Ile Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu 260 265 270Cys Thr Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala 275 280 285Tyr Lys Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val 290 295 300Leu Ala Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val305 310 315 320Ala Val Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr 325 330 335Pro Pro Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His 340 345 350Leu Ala Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu 355 360 365Gln Ala Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile 370 375 380Ile Arg Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile385 390 395 400Val Lys Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu 405 410 415Glu Gly Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met 420 425 430Pro Val Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn 435 440 445Ala His Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr 450 455 460Thr Leu Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys465 470 475 480Ala Pro Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro 485 490 495Phe Ile Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile 500 505 510Gly Phe Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn 515 520 525Lys His Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr 530 535 540Ser Ile Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala545 550 555 560Thr Pro Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly 565 570 575Ile Leu Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys 580 585 590Thr Val Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg 595 600 605Val Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg 610 615 620Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro625 630 635 640Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu 645 650 655Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile 660 665 670Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg 675 680 685Pro Leu Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro 690 695 700Ala Glu Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn705 710 715 720Arg Glu Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser 725 730 735Asp Ala Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val 740 745 750Ala Ile Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val 755 760 765Lys Gln Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val 770 775 780Asp Val Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile785 790 795 800Ala Thr Gln Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser 805 810 815His Lys Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val 820 825 830Ala Met Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala 835 840 845Asp Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala 850 855 860Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser865 870 875 880Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val 885 890 895Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val 900 905 910Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala 915 920 925Met Ala Ala Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys 930 935 940Cys Tyr Lys Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly945 950 955 960His Met Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met 965 970 975Asp Asp Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val 980 985 990Ser Tyr Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro 995 1000 1005Ser Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser 1010 1015 1020Leu Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile1025 1030 103583108DNAArtificial SequenceCodon optimized sequence coATP7B(d57-486) encoding truncated ATP7B, with deletion of amino acids 57-486CDS(1)..(3108)/transl_table=1 8atg cca gaa cag gaa cgc cag atc aca gca aga gag gga gca agt cgg 48Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15aaa atc ctg agc aaa ctg agc ctg cca acc aga gca tgg gaa ccc gca 96Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30atg aag aaa agc ttc gcc ttt gac aac gtg gga tac gag gga ggg ctg 144Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45gat gga ctg gga cct agc tcc cag cct cag aag tgt ttt ctg cag atc 192Asp Gly Leu Gly Pro Ser Ser Gln Pro Gln Lys Cys Phe Leu Gln Ile 50 55 60aaa ggc atg acc tgc gcc tct tgc gtg agc aac att gag cgg aat ctg 240Lys Gly Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu65 70 75 80cag aag gaa gct ggg gtg ctg agc gtg ctg gtc gca ctg atg gcc gga 288Gln Lys Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly 85 90 95aag gct gag atc aag tac gac cct gaa gtg atc cag cca ctg gag att 336Lys Ala Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile 100 105 110gcc cag ttc atc cag gat ctg ggc ttt gag gcc gct gtg atg gaa gac 384Ala Gln Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp 115 120 125tat gct ggg agc gat gga aac att gaa ctg acc atc acc gga atg act 432Tyr Ala Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr 130 135 140tgt gcc tct tgc gtg cac aac atc gag agt aaa ctg act aga acc aat 480Cys Ala Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn145 150 155 160ggg att acc tac gcc agt gtg gcc ctg gct aca tca aag gct ctg gtg 528Gly Ile Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val 165 170 175aaa ttc gac ccc gag atc att gga cct agg gat atc att aag atc att 576Lys Phe Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile 180 185 190gag gaa atc ggc ttt cac gca agc ctg gcc cag cgc aac cca aat gcc 624Glu Glu Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala 195 200 205cac cat ctg gac cat aag atg gag atc aag cag tgg aag aaa agt ttc 672His His Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe 210 215 220ctg tgc tca ctg gtg ttt gga atc ccc gtc atg gcc ctg atg atc tac 720Leu Cys Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr225 230 235 240atg ctg atc cct agc aac gag cca cac cag tcc atg gtg ctg gat cat 768Met Leu Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His 245 250 255aac atc att cct ggc ctg tcc atc ctg aat ctg att ttc ttt atc ctg 816Asn Ile Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu 260 265 270tgc aca ttc gtg cag ctg ctg gga ggc tgg tac ttt tat gtg cag gca 864Cys Thr Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala 275 280 285tat aaa tca ctg cga cac cgg agc gcc aat atg gac gtg ctg att gtc 912Tyr Lys Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val 290 295 300ctg gca acc tct atc gcc tac gtg tat agt ctg gtc atc ctg gtg gtc 960Leu Ala Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val305 310 315 320gca gtg gca gag aag gca gaa cgg agc cca gtg act ttc ttt gat acc 1008Ala Val Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr 325 330 335cct cca atg ctg ttc gtg ttt atc gct ctg ggc aga tgg ctg gaa cat 1056Pro Pro Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His 340 345 350ctg gca aag tca aaa acc agc gag gct ctg gca aag ctg atg agc ctg 1104Leu Ala Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu 355 360 365cag gct acc gaa gca aca gtg gtc act ctg gga gag gac aac ctg atc 1152Gln Ala Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile 370 375 380att cgc gag gaa cag gtg cct atg gaa ctg gtc cag cga ggc gat atc 1200Ile Arg Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile385 390 395 400gtg aag gtg gtc cca ggg gga aaa ttc ccc gtg gac ggc aag gtc ctg 1248Val Lys Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu 405 410 415gag ggg aat act atg gcc gat gaa tcc ctg atc acc ggc gag gct atg 1296Glu Gly Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met 420 425 430cct gtg aca aag aaa cca gga tca act gtc att gct ggc agc atc aac 1344Pro Val Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn 435 440 445gca cac ggg tcc gtg ctg atc aag gcc aca cat gtc ggg aat gac aca 1392Ala His Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr 450 455 460act ctg gct cag att gtg aaa ctg gtc gag gaa gcc cag atg tcc aag 1440Thr Leu Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys465 470 475 480gct cct atc cag cag ctg gcc gat cgg ttc tcc ggc tac ttc gtg ccc 1488Ala Pro Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro 485 490 495ttc atc att atc atg tct aca ctg act ctg gtg gtc tgg att gtg atc 1536Phe Ile Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile 500 505 510gga ttc att gac ttt ggc gtg gtc cag aga tat ttt ccc aac cct aat 1584Gly Phe Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn 515 520 525aag cac atc agc cag acc gaa gtg atc atc agg ttc gca ttt cag acc 1632Lys His Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr 530 535 540agt att aca gtg ctg tgc atc gcc tgc cca tgt tca ctg ggg ctg gct 1680Ser Ile Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala545 550 555 560acc ccc aca gca gtg atg gtc gga aca gga gtg gca gca cag aac gga 1728Thr Pro Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly 565 570 575att ctg atc aag ggc ggg aaa ccc ctg gag atg gcc cac aag atc aaa 1776Ile Leu Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys 580 585 590act gtg atg ttt gac aaa act ggg acc att aca cat gga gtg ccc cgc 1824Thr Val Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg 595 600 605gtc atg cga gtg ctg ctg ctg ggc gat gtg gca acc ctg cct ctg aga 1872Val Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg 610 615 620aag gtc ctg gca gtg gtc gga aca gca gag gct agc tcc gaa cac cca 1920Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro625 630 635 640ctg ggg gtg gcc gtc aca aag tac tgc aaa gag gaa ctg ggc act gag 1968Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu 645 650 655acc ctg ggg tat tgt act gac ttc cag gca gtg ccc gga tgc gga atc 2016Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile 660 665 670gga tgt aaa gtc tct aac gtg gaa ggg att ctg gct cac agt gag cgg 2064Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg 675 680 685ccc ctg agc gca cct gca tcc cat ctg aat gaa gca gga agc ctg cca 2112Pro Leu Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro 690 695 700gca gag aag gac gct gtg cct cag acc ttt tcc gtc ctg atc ggc aac 2160Ala Glu Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn705 710 715 720aga gaa tgg ctg cgg aga aat ggg ctg aca att tct agt gac gtg tcc 2208Arg Glu Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser 725

730 735gat gcc atg aca gat cac gag atg aaa ggc cag act gca att ctg gtg 2256Asp Ala Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val 740 745 750gcc atc gac gga gtc ctg tgc ggc atg att gct atc gca gat gcc gtg 2304Ala Ile Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val 755 760 765aag cag gag gct gca ctg gcc gtc cat acc ctg cag tct atg ggc gtg 2352Lys Gln Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val 770 775 780gac gtg gtc ctg atc acc ggg gat aac cgg aaa aca gct aga gca att 2400Asp Val Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile785 790 795 800gcc act caa gtg ggc atc aat aag gtg ttc gct gaa gtc ctg cct agc 2448Ala Thr Gln Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser 805 810 815cac aag gtc gca aaa gtg cag gag ctg cag aac aag ggc aag aaa gtc 2496His Lys Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val 820 825 830gcc atg gtg gga gac ggc gtg aat gat agc cca gct ctg gca cag gca 2544Ala Met Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala 835 840 845gac atg gga gtc gct att ggg aca gga act gac gtg gca atc gag gcc 2592Asp Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala 850 855 860gct gat gtg gtc ctg att agg aat gac ctg ctg gat gtg gtc gct tct 2640Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser865 870 875 880att cat ctg agt aag agg aca gtg agg cgc att cgc atc aac ctg gtg 2688Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val 885 890 895ctg gcc ctg atc tac aat ctg gtg gga att cca atc gca gcc ggc gtg 2736Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val 900 905 910ttt atg cca att ggg atc gtc ctg cag ccc tgg atg ggc tca gct gca 2784Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala 915 920 925atg gcc gct tca agc gtg agc gtg gtc ctg tcc tct ctg cag ctg aaa 2832Met Ala Ala Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys 930 935 940tgc tac aag aaa cca gac ctg gag cgg tac gaa gct cag gca cac gga 2880Cys Tyr Lys Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly945 950 955 960cat atg aag ccc ctg acc gct tcc cag gtg tct gtc cac atc ggc atg 2928His Met Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met 965 970 975gac gat aga tgg agg gac agc cca agg gcc act cca tgg gat cag gtc 2976Asp Asp Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val 980 985 990agt tac gtg agc cag gtc agc ctg agt tca ctg acc agc gac aag ccc 3024Ser Tyr Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro 995 1000 1005tcc cgc cat tct gca gcc gct gat gac gac ggg gac aag tgg agc 3069Ser Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser 1010 1015 1020ctg ctg ctg aac gga agg gac gaa gaa cag tat atc taa 3108Leu Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile 1025 1030 103591035PRTArtificial SequenceSynthetic Construct 9Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45Asp Gly Leu Gly Pro Ser Ser Gln Pro Gln Lys Cys Phe Leu Gln Ile 50 55 60Lys Gly Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu65 70 75 80Gln Lys Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly 85 90 95Lys Ala Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile 100 105 110Ala Gln Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp 115 120 125Tyr Ala Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr 130 135 140Cys Ala Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn145 150 155 160Gly Ile Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val 165 170 175Lys Phe Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile 180 185 190Glu Glu Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala 195 200 205His His Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe 210 215 220Leu Cys Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr225 230 235 240Met Leu Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His 245 250 255Asn Ile Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu 260 265 270Cys Thr Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala 275 280 285Tyr Lys Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val 290 295 300Leu Ala Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val305 310 315 320Ala Val Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr 325 330 335Pro Pro Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His 340 345 350Leu Ala Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu 355 360 365Gln Ala Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile 370 375 380Ile Arg Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile385 390 395 400Val Lys Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu 405 410 415Glu Gly Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met 420 425 430Pro Val Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn 435 440 445Ala His Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr 450 455 460Thr Leu Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys465 470 475 480Ala Pro Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro 485 490 495Phe Ile Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile 500 505 510Gly Phe Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn 515 520 525Lys His Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr 530 535 540Ser Ile Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala545 550 555 560Thr Pro Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly 565 570 575Ile Leu Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys 580 585 590Thr Val Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg 595 600 605Val Met Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg 610 615 620Lys Val Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro625 630 635 640Leu Gly Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu 645 650 655Thr Leu Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile 660 665 670Gly Cys Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg 675 680 685Pro Leu Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro 690 695 700Ala Glu Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn705 710 715 720Arg Glu Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser 725 730 735Asp Ala Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val 740 745 750Ala Ile Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val 755 760 765Lys Gln Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val 770 775 780Asp Val Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile785 790 795 800Ala Thr Gln Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser 805 810 815His Lys Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val 820 825 830Ala Met Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala 835 840 845Asp Met Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala 850 855 860Ala Asp Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser865 870 875 880Ile His Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val 885 890 895Leu Ala Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val 900 905 910Phe Met Pro Ile Gly Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala 915 920 925Met Ala Ala Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys 930 935 940Cys Tyr Lys Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly945 950 955 960His Met Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met 965 970 975Asp Asp Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val 980 985 990Ser Tyr Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro 995 1000 1005Ser Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser 1010 1015 1020Leu Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile1025 1030 10351036DNAArtificial SequencePrimer AAT-Forward 10ctggtctaga acgcgtcgcc accccctcca ccttgg 361136DNAArtificial SequencePrimer AAT-Reverse 11atcatgatgc ggccgcttca ctgtcccagg tcagtg 36123966DNAArtificial SequenceSequence encoding truncated ATP7B(d223-366) that encodes ATP7B with a deletion of amino acids 223..366CDS(1)..(3966)/transl_table=1 12atg cct gag cag gag aga cag atc aca gcc aga gaa ggg gcc agt cgg 48Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15aaa atc tta tct aag ctt tct ttg cct acc cgt gcc tgg gaa cca gca 96Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30atg aag aag agt ttt gct ttt gac aat gtt ggc tat gaa ggt ggt ctg 144Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45gat ggc ctg ggc cct tct tct cag gtg gcc acc agc aca gtc agg atc 192Asp Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile 50 55 60ttg ggc atg act tgc cag tca tgt gtg aag tcc att gag gac agg att 240Leu Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile65 70 75 80tcc aat ttg aaa ggc atc atc agc atg aag gtt tcc ctg gaa caa ggc 288Ser Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly 85 90 95agt gcc act gtg aaa tat gtg cca tcg gtt gtg tgc ctg caa cag gtt 336Ser Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val 100 105 110tgc cat caa att ggg gac atg ggc ttc gag gcc agc att gca gaa gga 384Cys His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly 115 120 125aag gca gcc tcc tgg ccc tca agg tcc ttg cct gcc cag gag gct gtg 432Lys Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val 130 135 140gtc aag ctc cgg gtg gag ggc atg acc tgc cag tcc tgt gtc agc tcc 480Val Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser145 150 155 160att gaa ggc aag gtc cgg aaa ctg caa gga gta gtg aga gtc aaa gtc 528Ile Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val 165 170 175tca ctc agc aac caa gag gcc gtc atc act tat cag cct tat ctc att 576Ser Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile 180 185 190cag ccc gaa gac ctc agg gac cat gta aat gac atg gga ttt gaa gct 624Gln Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala 195 200 205gcc atc aag agc aaa gtg gct ccc tta agc ctg gga cca att ggc atg 672Ala Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Gly Met 210 215 220acc tgt gca tcc tgt gtc cat tcc att gaa ggc atg atc tcc caa ctg 720Thr Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu225 230 235 240gaa ggg gtg cag caa ata tcg gtg tct ttg gcc gaa ggg act gca aca 768Glu Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr 245 250 255gtt ctt tat aat ccc tct gta att agc cca gaa gaa ctc aga gct gct 816Val Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala 260 265 270ata gaa gac atg gga ttt gag gct tca gtc gtt tct gaa agc tgt tct 864Ile Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser 275 280 285act aac cct ctt gga aac cac agt gct ggg aat tcc atg gtg caa act 912Thr Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr 290 295 300aca gat ggt aca cct aca tct gtg cag gaa gtg gct ccc cac act ggg 960Thr Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly305 310 315 320agg ctc cct gca aac cat gcc ccg gac atc ttg gca aag tcc cca caa 1008Arg Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln 325 330 335tca acc aga gca gtg gca ccg cag aag tgc ttc tta cag atc aaa ggc 1056Ser Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly 340 345 350atg acc tgt gca tcc tgt gtg tct aac ata gaa agg aat ctg cag aaa 1104Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys 355 360 365gaa gct ggt gtt ctc tcc gtg ttg gtt gcc ttg atg gca gga aag gca 1152Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala 370 375 380gag atc aag tat gac cca gag gtc atc cag ccc ctc gag ata gct cag 1200Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln385 390 395 400ttc atc cag gac ctg ggt ttt gag gca gca gtc atg gag gac tac gca 1248Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala 405 410 415ggc tcc gat ggc aac att gag ctg aca atc aca ggg atg acc tgc gcg 1296Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala 420 425 430tcc tgt gtc cac aac ata gag tcc aaa ctc acg agg aca aat ggc atc 1344Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile 435 440 445act tat gcc tcc gtt gcc ctt gcc acc agc aaa gcc ctt gtt aag ttt 1392Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe 450 455 460gac ccg gaa att atc ggt cca cgg gat att atc aaa att att gag gaa 1440Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu465 470 475 480att ggc ttt cat gct tcc ctg gcc cag aga aac ccc aac gct cat cac 1488Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His 485 490 495ttg gac cac aag atg gaa ata aag cag tgg aag aag tct ttc ctg tgc 1536Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys 500 505 510agc ctg gtg ttt ggc atc cct gtc atg gcc tta atg atc tat atg ctg 1584Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu 515 520 525ata ccc agc aac gag ccc cac cag tcc atg gtc ctg gac cac aac atc 1632Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile 530 535 540att cca gga ctg tcc att cta aat ctc atc ttc ttt atc ttg tgt acc

1680Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr545 550 555 560ttt gtc cag ctc ctc ggt ggg tgg tac ttc tac gtt cag gcc tac aaa 1728Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys 565 570 575tct ctg aga cac agg tca gcc aac atg gac gtg ctc atc gtc ctg gcc 1776Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala 580 585 590aca agc att gct tat gtt tat tct ctg gtc atc ctg gtg gtt gct gtg 1824Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val 595 600 605gct gag aag gcg gag agg agc cct gtg aca ttc ttc gac acg ccc ccc 1872Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro 610 615 620atg ctc ttt gtg ttc att gcc ctg ggc cgg tgg ctg gaa cac ttg gca 1920Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala625 630 635 640aag agc aaa acc tca gaa gcc ctg gct aaa ctc atg tct ctc caa gcc 1968Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala 645 650 655aca gaa gcc acc gtt gtg acc ctt ggt gag gac aat tta atc atc agg 2016Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg 660 665 670gag gag caa gtc ccc atg gag ctg gtg cag cgg ggc gat atc gtc aag 2064Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys 675 680 685gtg gtc cct ggg gga aag ttt cca gtg gat ggg aaa gtc ctg gaa ggc 2112Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly 690 695 700aat acc atg gct gat gag tcc ctc atc aca gga gaa gcc atg cca gtc 2160Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val705 710 715 720act aag aaa ccc gga agc act gta att gcg ggg tct ata aat gca cat 2208Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His 725 730 735ggc tct gtg ctc att aaa gct acc cac gtg ggc aat gac acc act ttg 2256Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu 740 745 750gct cag att gtg aaa ctg gtg gaa gag gct cag atg tca aag gca ccc 2304Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro 755 760 765att cag cag ctg gct gac cgg ttt agt gga tat ttt gtc cca ttt atc 2352Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile 770 775 780atc atc atg tca act ttg acg ttg gtg gta tgg att gta atc ggt ttt 2400Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe785 790 795 800atc gat ttt ggt gtt gtt cag aga tac ttt cct aac ccc aac aag cac 2448Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His 805 810 815atc tcc cag aca gag gtg atc atc cgg ttt gct ttc cag acg tcc atc 2496Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile 820 825 830acg gtg ctg tgc att gcc tgc ccc tgc tcc ctg ggg ctg gcc acg ccc 2544Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro 835 840 845acg gct gtc atg gtg ggc acc ggg gtg gcc gcg cag aac ggc atc ctc 2592Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu 850 855 860atc aag gga ggc aag ccc ctg gag atg gcg cac aag ata aag act gtg 2640Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val865 870 875 880atg ttt gac aag act ggc acc att acc cat ggc gtc ccc agg gtc atg 2688Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val Met 885 890 895cgg gtg ctc ctg ctg ggg gat gtg gcc aca ctg ccc ctc agg aag gtt 2736Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg Lys Val 900 905 910ctg gct gtg gtg ggg act gcg gag gcc agc agt gaa cac ccc ttg ggc 2784Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro Leu Gly 915 920 925gtg gca gtc acc aaa tac tgt aaa gag gaa ctt gga aca gag acc ttg 2832Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu Thr Leu 930 935 940gga tac tgc acg gac ttc cag gca gtg cca ggc tgt gga att ggg tgc 2880Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile Gly Cys945 950 955 960aaa gtc agc aac gtg gaa ggc atc ctg gcc cac agt gag cgc cct ttg 2928Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg Pro Leu 965 970 975agt gca ccg gcc agt cac ctg aat gag gct ggc agc ctt ccc gca gaa 2976Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro Ala Glu 980 985 990aaa gat gca gtc ccc cag acc ttc tct gtg ctg att gga aac cgt gag 3024Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn Arg Glu 995 1000 1005tgg ctg agg cgc aac ggt tta acc att tct agc gat gtc agt gac 3069Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser Asp 1010 1015 1020gct atg aca gac cac gag atg aaa gga cag aca gcc atc ctg gtg 3114Ala Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val 1025 1030 1035gct att gac ggt gtg ctc tgt ggg atg atc gca atc gca gac gct 3159Ala Ile Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala 1040 1045 1050gtc aag cag gag gct gcc ctg gct gtg cac acg ctg cag agc atg 3204Val Lys Gln Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met 1055 1060 1065ggt gtg gac gtg gtt ctg atc acg ggg gac aac cgg aag aca gcc 3249Gly Val Asp Val Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala 1070 1075 1080aga gct att gcc acc cag gtt ggc atc aac aaa gtc ttt gca gag 3294Arg Ala Ile Ala Thr Gln Val Gly Ile Asn Lys Val Phe Ala Glu 1085 1090 1095gtg ctg cct tcg cac aag gtg gcc aag gtc cag gag ctc cag aat 3339Val Leu Pro Ser His Lys Val Ala Lys Val Gln Glu Leu Gln Asn 1100 1105 1110aaa ggg aag aaa gtc gcc atg gtg ggg gat ggg gtc aat gac tcc 3384Lys Gly Lys Lys Val Ala Met Val Gly Asp Gly Val Asn Asp Ser 1115 1120 1125ccg gcc ttg gcc cag gca gac atg ggt gtg gcc att ggc acc ggc 3429Pro Ala Leu Ala Gln Ala Asp Met Gly Val Ala Ile Gly Thr Gly 1130 1135 1140acg gat gtg gcc atc gag gca gcc gac gtc gtc ctt atc aga aat 3474Thr Asp Val Ala Ile Glu Ala Ala Asp Val Val Leu Ile Arg Asn 1145 1150 1155gat ttg ctg gat gtg gtg gct agc att cac ctt tcc aag agg act 3519Asp Leu Leu Asp Val Val Ala Ser Ile His Leu Ser Lys Arg Thr 1160 1165 1170gtc cga agg ata cgc atc aac ctg gtc ctg gca ctg att tat aac 3564Val Arg Arg Ile Arg Ile Asn Leu Val Leu Ala Leu Ile Tyr Asn 1175 1180 1185ctg gtt ggg ata ccc att gca gca ggt gtc ttc atg ccc atc ggc 3609Leu Val Gly Ile Pro Ile Ala Ala Gly Val Phe Met Pro Ile Gly 1190 1195 1200att gtg ctg cag ccc tgg atg ggc tca gcg gcc atg gca gcc tcc 3654Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala Met Ala Ala Ser 1205 1210 1215tct gtg tct gtg gtg ctc tca tcc ctg cag ctc aag tgc tat aag 3699Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys Cys Tyr Lys 1220 1225 1230aag cct gac ctg gag agg tat gag gca cag gcg cat ggc cac atg 3744Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly His Met 1235 1240 1245aag ccc ctg acg gca tcc cag gtc agt gtg cac ata ggc atg gat 3789Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met Asp 1250 1255 1260gac agg tgg cgg gac tcc ccc agg gcc aca cca tgg gac cag gtc 3834Asp Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val 1265 1270 1275agc tat gtc agc cag gtg tcg ctg tcc tcc ctg acg tcc gac aag 3879Ser Tyr Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys 1280 1285 1290cca tct cgg cac agc gct gca gca gac gat gat ggg gac aag tgg 3924Pro Ser Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp 1295 1300 1305tct ctg ctc ctg aat ggc agg gat gag gag cag tac atc tga 3966Ser Leu Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile 1310 1315 1320131321PRTArtificial SequenceSynthetic Construct 13Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg1 5 10 15Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala 20 25 30Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu 35 40 45Asp Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile 50 55 60Leu Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile65 70 75 80Ser Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly 85 90 95Ser Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val 100 105 110Cys His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly 115 120 125Lys Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val 130 135 140Val Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser145 150 155 160Ile Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val 165 170 175Ser Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile 180 185 190Gln Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala 195 200 205Ala Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Gly Met 210 215 220Thr Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu225 230 235 240Glu Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr 245 250 255Val Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala 260 265 270Ile Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser 275 280 285Thr Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr 290 295 300Thr Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly305 310 315 320Arg Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln 325 330 335Ser Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly 340 345 350Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys 355 360 365Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala 370 375 380Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln385 390 395 400Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala 405 410 415Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala 420 425 430Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile 435 440 445Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe 450 455 460Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu465 470 475 480Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His 485 490 495Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys 500 505 510Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu 515 520 525Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile 530 535 540Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr545 550 555 560Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys 565 570 575Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala 580 585 590Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val 595 600 605Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro 610 615 620Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala625 630 635 640Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala 645 650 655Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg 660 665 670Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys 675 680 685Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly 690 695 700Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val705 710 715 720Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His 725 730 735Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu 740 745 750Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro 755 760 765Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile 770 775 780Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe785 790 795 800Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His 805 810 815Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile 820 825 830Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro 835 840 845Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu 850 855 860Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val865 870 875 880Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val Met 885 890 895Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg Lys Val 900 905 910Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro Leu Gly 915 920 925Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu Thr Leu 930 935 940Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile Gly Cys945 950 955 960Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg Pro Leu 965 970 975Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro Ala Glu 980 985 990Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn Arg Glu 995 1000 1005Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser Asp 1010 1015 1020Ala Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val 1025 1030 1035Ala Ile Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala 1040 1045 1050Val Lys Gln Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met 1055 1060 1065Gly Val Asp Val Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala 1070 1075 1080Arg Ala Ile Ala Thr Gln Val Gly Ile Asn Lys Val Phe Ala Glu 1085 1090 1095Val Leu Pro Ser His Lys Val Ala Lys Val Gln Glu Leu Gln Asn 1100 1105 1110Lys Gly Lys Lys Val Ala Met Val Gly Asp Gly Val Asn Asp Ser 1115 1120 1125Pro Ala Leu Ala Gln Ala Asp Met Gly Val Ala Ile Gly Thr Gly 1130 1135 1140Thr Asp Val Ala Ile Glu Ala Ala Asp Val Val Leu Ile Arg Asn 1145 1150 1155Asp Leu Leu Asp Val Val Ala Ser Ile His Leu Ser Lys Arg Thr 1160 1165 1170Val Arg Arg Ile Arg Ile Asn Leu Val Leu Ala Leu Ile Tyr Asn 1175 1180 1185Leu Val Gly Ile Pro Ile Ala Ala Gly Val Phe Met Pro Ile Gly 1190 1195

1200Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala Met Ala Ala Ser 1205 1210 1215Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys Cys Tyr Lys 1220 1225 1230Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly His Met 1235 1240 1245Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met Asp 1250 1255 1260Asp Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val 1265 1270 1275Ser Tyr Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys 1280 1285 1290Pro Ser Arg His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp 1295 1300 1305Ser Leu Leu Leu Asn Gly Arg Asp Glu Glu Gln Tyr Ile 1310 1315 13201425DNAArtificial SequencePrimer F1 14ctagatgcgg ccgccaccat gcctg 251521DNAArtificial SequencePrimer R1 15ctgagaagaa gggcccaggc c 211636DNAArtificial SequencePrimer F2 16ggcccttctt ctcagccgca gaagtgcttc ttacag 361729DNAArtificial SequencePrimer R2 17accaaaatcg ataaaaccga ttacaatcc 291825DNAArtificial SequencePrimer F3 18acgcgtgcgg ccgccaccat gccag 251921DNAArtificial SequencePrimer R3 19ctgggagcta ggtcccagtc c 212036DNAArtificial SequencePrimer F4 20ggacctagct cccagcctca gaagtgtttt ctgcag 362129DNAArtificial SequencePrimer R4 21tgttcctcgc gaatgatcag gttgtcctc 29

Claims

1. A method for the treatment of a condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2 in a patient that comprises administering to the patient a therapeutically effective amount of an expression vector comprising a nucleic acid construct, and a pharmaceutically acceptable carrier, wherein the nucleic acid construct comprises: a) a nucleotide sequence of a eukaryotic promoter; b) a nucleotide sequence encoding a truncated Copper-transporting ATPase 2 in which the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are not present and wherein HMA 5 and HMA 6 are present; and c) a polyadenylation signal sequence.

2. The method according to claim 1, wherein the condition caused by a deficiency or dysfunction of Copper-transporting ATPase 2 is Wilson disease.

3. The method according to claim 1, wherein the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 comprise amino acids 57 to 486 of SEQ ID NO:2.

4. The method according to claim 1, wherein the truncated Copper-transporting ATPase2 comprises the amino acid sequence of SEQ ID NO:7.

5. The method according to claim 1, wherein the nucleic acid construct further comprises 5'ITR and 3'ITR sequences of a virus.

6. The method according to claim 5, wherein the 5'ITR and 3'ITR sequences are of an adeno-associated virus (AAV).

7. The method according to claim 6, wherein the 5'ITR and 3'ITR sequences of an AAV are of a serotype selected from the group consisting of AAV1, AAV2, and AAV4.

8. The method according to claim 1, wherein the expression vector is comprised within a recombinant AAV virion (rAAV).

9. The method according to claim 1, wherein the nucleotide sequence encoding the truncated Copper-transporting ATPase 2 is selected from the group consisting of: a) nucleotides 473 through 3580 of the nucleotide sequence of SEQ ID NO:6; b) the nucleotide sequence of SEQ ID NO:8; c) a nucleotide sequence wherein at least 827 of the codons encoding the truncated Copper-transporting ATPase 2 are identical to the codons of SEQ ID NO:8; and d) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7.

10. The method according to claim 1, wherein the nucleotide sequence of the eukaryotic promoter is a nucleotide sequence of the .alpha.1-antitrypsin gene promoter, or a chimeric promoter sequence that comprises an al-antitrypsin gene promoter sequence combined with an albumin gene enhancer element.

11. The method according to claim 1, wherein the nucleotide sequence of the eukaryotic promoter consists of nucleotides 156 through 460 of SEQ ID NO:1 (AAT), or consists of the nucleotide sequence of SEQ ID NO:5 (EalbPa1AT).

12. The method according to claim 1, wherein the expression vector comprises a nucleic acid construct comprising: a) a nucleotide sequence of a eukaryotic promoter, consisting of: nucleotides 156 through 460 of SEQ ID NO:1 (AAT), or the nucleotide sequence of SEQ ID NO:5 (EalbPa1AT); b) a nucleotide sequence encoding a truncated Copper-transporting ATPase 2 in which the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are not present and wherein HMA 5 and HMA 6 are present; c) a polyadenylation signal sequence; and d) a 5' ITR sequence and a 3' ITR sequence of an adeno-associated virus (AAV).

13. The method according to claim 1, wherein the expression vector comprises a nucleic acid construct comprising: a) a nucleotide sequence of a eukaryotic promoter; b) a nucleotide sequence encoding a truncated Copper-transporting ATPase 2 in which the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are not present and wherein HMA 5 and HMA 6 are present, wherein the nucleotide sequence encoding the Copper-transporting ATPase 2 is a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7; c) a polyadenylation signal sequence; and d) a 5' ITR sequence and a 3' ITR sequence of an adeno-associated virus (AAV).

14. The method according to claim 1, wherein the therapeutically effective amount of the expression vector is administrated intravenously or by intrahepatic injection.

15. The method according to claim 8, wherein the rAAV virion is administered to the patient in an amount of or at a dose of 5.times.10.sup.11 to 1.times.10.sup.14 viral genomes/kg.

16. The method according to claim 1, wherein the expression vector is comprised within a recombinant AAV virion (rAAV) comprising a capsid protein of an AAV.

17. The method according to claim 16, wherein the capsid protein of the AAV is of a serotype selected from the group consisting of AAV1, AAV3, AAVS, AAV7, AAV8, AAV9 and AAV10.

18. The method according to claim 16, wherein the rAAV virion comprises a capsid protein of an AAV8 or AAV3 serotype.

19. The method according to claim 16, wherein the rAAV virion comprises a capsid protein of an AAV3 serotype.

20. The method according to claim 16, wherein the rAAV virion comprises a capsid protein of an AAV3B serotype.

21. The method according to claim 16, wherein the 5' ITR and 3' ITR sequences of the nucleic acid construct are of an AAV2 serotype and the capsid protein is of an AAV3 serotype.

22. The method according to claim 16, wherein the rAAV virion comprises: a nucleic acid construct comprising: a) a nucleotide sequence of an al-antitrypsin gene promoter consisting of nucleotides 156 through 460 of SEQ ID NO:1; b) a nucleotide sequence encoding a truncated Copper-transporting ATPase 2 in which the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 are not present and HMA 5 and HMA 6 are present, and wherein the N-terminal Heavy-Metal-Associated sites HMA 1, HMA 2, HMA 3, and HMA 4 comprise amino acids 57 to 486 of SEQ ID NO:2; c) a polyadenylation signal sequence; and d) a 5' ITR sequence and a 3' ITR sequence of AAV2; and a capsid protein of AAV3B.

23. The method according to claim 16, wherein the rAAV virion comprises: a nucleic acid construct comprising: a) a nucleotide sequence of an .alpha.1-antitrypsin gene promoter consisting of nucleotides 156 through 460 of SEQ ID NO:1; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7; c) a polyadenylation signal sequence; and d) a 5' ITR sequence and a 3' ITR sequence of AAV2; and a capsid protein of AAV3B.

24. The method according to claim 23, wherein the rAAV virion is administered to the patient in an amount of or at a dose of 5.times.10.sup.11 to 1.times.10.sup.14 viral genomes/kg.