COMPOSITIONS AND METHODS FOR TREATING COVID-19

Abstract

This disclosure is directed to inhibitory oligonucleotides, inhibitory peptides, compositions and methods for preventing or treating Coronavirus disease 2019 (COVID-19). In one aspect, the disclosure is directed to compositions that comprise inhibitory oligonucleotides against one or more SARS-CoV-2 virus genes. In another aspect, the disclosure is directed to compositions that comprise inhibitory peptides that inhibit SARS-COV-2 entry into cells. Another aspect of the disclosure is directed to gene therapy methods for treating COVID-19, and vectors for carrying out the same. Finally, the disclosure provides nutritional supplements to support human immunity and prevent or inhibit viral infections.

Description

CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority from U.S. Provisional Application No. 63/041,587, filed Jun. 19, 2020, the entire contents of which are incorporated herein by reference.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The Sequence Listing in an ASCII text file, named as 38534_SequenceListing.txt of 114 KB, created on Jun. 7, 2021, and submitted to the United States Patent and Trademark Office via EFS-Web, is incorporated herein by reference.

BACKGROUND

[0003] The novel coronavirus disease (COVID-19) is caused by the SARS-Cov-2 virus and is known for inducing multisystem organ dysfunction associated with significant morbidity and mortality. Despite several available vaccines, effective therapeutics targeted specifically to the virus are still lacking. Specifically, effective prophylactics with a few side-effects and therapeutics targeted specifically towards SARS-CoV-2 are needed since some of the current vaccines have been found some serious side-effects, e.g., blood clotting or increasing the heart myocarditis. It has also been observed that IgG antibodies, while abundantly present in the vasculature, are present at a much lesser extent in mucosal tissues, such as epithelial cells of nasal and lung, where most ACE2-expressing cells (i.e., targets of SARS-CoV-2). This means that IgG antibodies against SARS-CoV-2, either induced by vaccination or exogenously provided, may not effectively protect ACE2-expressing cells on the mucosal tissues from a SARS-CoV2 infection.

SUMMARY OF THE DISCLOSURE

[0004] An aspect of the disclosure is directed to a composition comprising a plurality of inhibitory oligonucleotides, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

[0005] In some embodiments, the plurality of inhibitory oligonucleotides targets all of the ORF1ab, RdRp, S-protein, N-protein and E protein genes. In some embodiments, a selected SARS-CoV-2 gene is targeted by at least two inhibitory oligonucleotides.

[0006] In some embodiments, the inhibitory oligonucleotides are selected from an antisense oligonucleotide, a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), and a microRNA.

[0007] In some embodiments, the plurality of inhibitory oligonucleotides comprises at least two oligonucleotides which comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 9-16 and modified forms of SEQ ID NOS: 9-16.

[0008] In some embodiments, the plurality of inhibitory oligonucleotides comprises eight oligonucleotides as shown in SEQ ID NOS: 9-16 or modified forms of SEQ ID NOS: 9-16.

[0009] In some embodiments, the plurality of inhibitory oligonucleotides comprises at least two pairs of Dicer-substrate RNAs (DsiRNAs) selected from the group consisting of DsiRNA pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

[0010] In some embodiments, the plurality of inhibitory oligonucleotides comprises Dicer-substrate RNA (DsiRNA) pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

[0011] In some embodiments, the inhibitory oligonucleotides are modified oligonucleotides.

[0012] In some embodiments, the modified inhibitory oligonucleotides are 2'-Deoxy, 2'-Fluoroarabino Nucleic Acid (FANA)-modified antisense oligonucleotides.

[0013] In some embodiments, the modified inhibitory oligonucleotides are 2' 0-Methyl RNA modified antisense oligonucleotides selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40.

[0014] In some embodiments, at least one inhibitory oligonucleotide within the plurality of oligonucleotides comprises a detectable label.

[0015] In some embodiments, the label is a fluorescent label.

[0016] In some embodiments, the plurality of inhibitory oligonucleotides is provided in one or more nucleic acid vectors.

[0017] In some embodiments, the nucleic acid vectors are selected from a viral vector, a non-viral vector, an integrative vector, or a non-integrative vector.

[0018] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles to which the plurality of inhibitory oligonucleotides is conjugated.

[0019] Another aspect of the specification is directed to a composition comprising at least one peptide mimicking a portion of the ligand binding domain (LBD) of human ACE2 protein, wherein the at least one peptide prevents binding of the S-protein of SARS-CoV-2 to the human ACE2 protein.

[0020] In some embodiments, the LBD of human ACE2 comprises the amino acid sequence of SEQ ID NO: 56.

[0021] In some embodiments, the composition comprises a plurality of peptides, each mimicking a different portion of the ligand binding domain (LBD) of human ACE2 protein.

[0022] In some embodiments, the at least one peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82.

[0023] In some embodiments, the composition comprises a plurality of peptides comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82.

[0024] In some embodiments, the composition comprises at least five peptides, wherein the at least five peptides are selected from peptides comprising an amino acid sequence as shown in SEQ ID NOS: 41-44, 54, and 63-82.

[0025] Another aspect of the disclosure is directed to a composition comprising a peptide mimicking a portion of the receptor binding domain (RBD) of the S-Protein of SARS-CoV-2, wherein the peptide prevents binding of the S-protein of SARS-CoV-2 to a human ACE2 protein.

[0026] In some embodiments, the RBD of the S protein of SARS-CoV-2 comprises SEQ ID NO: 62.

[0027] In some embodiments, the peptide comprises an amino acid sequence as shown in SEQ ID NO: 45.

[0028] In some embodiments, the at least one peptide comprises a label or is conjugated with a probe, a nucleic acid or a chemical molecule. In some embodiments, the label is a fluorescent label.

[0029] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles to which the at least one peptide is conjugated.

[0030] Another aspect of the disclosure is directed to a dietary supplement comprising a composition as described herein. In some embodiments, the dietary supplement further comprises at least one additional nutrient selected from Vitamin C, Vitamin B6, Vitamin B12, Vitamin D, Zinc, polypeptides, nucleotide, L-arginine or peppermint oil. In some embodiments, the dietary supplement is formulated for oral, nasal, eye, ear, or topical application.

[0031] Another aspect of the disclosure is directed to a method comprising expressing a plurality of inhibitory oligonucleotides in a target cell, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene and the E protein gene (aka. the "viral infective functional group"). In some embodiments, a selected SARS-CoV-2 gene is targeted by at least two inhibitory oligonucleotides. In some embodiments, the plurality of inhibitory oligonucleotides targets all of ORF1ab, RdRp, S-protein, N-proteins and E protein genes. In some embodiments, the inhibitory oligonucleotides are selected from an antisense oligonucleotide, a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), or a microRNA.

[0032] In some embodiments, the plurality of inhibitory oligonucleotides comprises at least two oligonucleotides which comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 9-16.

[0033] In some embodiments, the plurality of inhibitory oligonucleotides comprises eight oligonucleotides as shown in SEQ ID NOS: 9-16.

[0034] In some embodiments, the target cell is a human cell. In some embodiments, the target cell is a lung epithelial cell. In some embodiments, the target cell is selected from the group consisting of a small airway epithelial cell, a bronchial/tracheal epithelial cell, and a nasal epithelial cell.

[0035] In some embodiments, the plurality of inhibitory oligonucleotides are expressed from at least one vector. In some embodiments, the at least one vector is selected from a viral vector, or a non-viral vector, an integrative vector, or a non-integrative vector.

[0036] In some embodiments, the at least one vector is delivered to a subject in need via oral, nasal, intravenous (i.v.) injection or topical administration routes.

[0037] Another aspect of the disclosure is directed to a nucleic acid vector encoding a plurality of inhibitory oligonucleotides that targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

[0038] Another aspect of the disclosure is directed to a combination of nucleic acid vectors, wherein each nucleic acid vector encodes an inhibitory oligonucleotide that targets at least one SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene, and wherein the combination of nucleic acid vectors target at least two SARS-CoV-2 genes.

[0039] In some embodiments, the nucleic acid vector is a viral vector.

[0040] In some embodiments, the combination of nucleic acid vectors of claim 49, wherein the nucleic acid comprises an AAV-based vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13 and AAV14.

[0041] In some embodiments, wherein the nucleic acid vector is a non-viral vector.

[0042] Another aspect of the disclosure is directed to a method of treating a SARS-CoV-2 infection in a subject in need thereof, comprising administering a subject an effective amount of a nucleic acid vector or a combination of nucleic acid vectors according to any one of claims 48-52.

[0043] Another aspect of the disclosure is directed to a method for treating a SARS-CoV-2 infection comprising administering to a subject an effective amount of a composition described herein.

[0044] Another aspect of the disclosure is directed to a method for treating a SARS-CoV-2 infection comprising administering to a subject an effective amount of a first composition as described herein and a second (different) composition as described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0046] FIG. 1. Experiments designed for investigating cell penetration and therapeutic effects of ASO(s) and siRNA on human primary small airway epithelial cells transfected with viral protein of SARS-CoV-2. The human lung small airway epithelial cells were cultured in the 24 well-dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were into the cells for 24-48 hours before analysis with fluorescent microscope. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 label shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 label shown in Table 3. A1&A2: No treatment as control; A3&A4: Overexpression of both COVID-19 N-protein and the VS_ASO_1-FANA using lipofectamine reagent; A5&A6: Overexpression of both COVID-19 N-protein and the VS_ASO_1-FANA without any regents; B1&B2: No treatment as control; B3&B4: Overexpression of both COVID-19 N-protein and the VS_DsiRNA-Cy5 using lipofectamine reagent; B5&B6: Overexpression of both COVID-19 N-protein and the VS_DsiRNA-Cy5 using Poly-arginine (5 .mu.l/well) only; C1&C2: No treatment as control; C3&C4: Overexpression of both COVID-19 N-protein and the VS_ASO_2-Cy3 using lipofectamine reagent; C5&C6: Overexpression of both COVID-19 N-protein and the VS_ASO_2-Cy3 using Poly-arginine (5 .mu.l/well) only.

[0047] FIGS. 2A-2F. Microscopic analysis showing entry of VS_ASO_1-FANA-FITC into the primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the FITC florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well A3 & A4 (as shown in FIG. 1), (B) and (E) were taken in well A5 & A6 (as shown in FIG. 1), and (C) and (F) were taken in well A1 & A2 (as shown in FIG. 1).

[0048] FIGS. 3A-3F. Microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung small airway epithermal cells (10.times.). (A)-(C) were captured under the FITC florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well A3 & A4 (as shown in FIG. 1), (B) and (E) were taken in well A5 & A6 (as shown in FIG. 1), and (C) and (F) were taken in well A1 & A2 (as shown in FIG. 1).

[0049] FIGS. 4A-4F. Microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 1), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 1), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 1).

[0050] FIGS. 5A-5F. Microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung small airway epithermal cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright field images (10.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 1), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 1), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 1).

[0051] FIGS. 6A-6F. Microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well C3 & C4 (as shown in FIG. 1), (B) and (E) were taken in well C5 & C6 (as shown in FIG. 1), and (C) and (F) were taken in well C1 & C2 (as shown in FIG. 1).

[0052] FIGS. 7A-7F. Microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung small airway epithermal cells (10.times.). The (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (10.times.). (A) and (D) were taken in well C3 & C4 (as shown in FIG. 1), (B) and (E) were taken in well C5 & C6 (as shown in FIG. 1), and (C) and (F) were taken in well C1 & C2 (as shown in FIG. 1).

[0053] FIG. 8. Experimental design for FACS detection of intercellular delivery of oligos in the human primary lung small airway epithelial cells (HSAEC). The human lung small airway epithelial cells were cultured in the 6-well dish, and the genes encoding the viral proteins of SARS-CoV-2 were delivered by transfection or arginine delivery. The siRNA or ASO were added into the cells for 24-48 hours before analysis with FACS. The VS_ASO_1-FANA-FITC designed with labeled with FITC shown in the Table 1, and VS_ASO_2-Cy3 with modification shown in the Table 2; and VS_DsiRNA-Cy5 shown in Table 3. A1: No treatment as control; A2: Overexpression of N-protein+VS_ASO_1-FANA-FITC without lipofectamine or arginine; A3: Overexpression of N-protein+VS_DsiRNA-Cy5 with lipofectamine; B1: Overexpression of N-protein+VS_DsiRNA-Cy5 with Arginine (10 .mu.l/well); B2: Overexpression of N-protein+VS_ASO_2-Cy3 with lipofectamine; B3: Overexpression of N-protein+VS_ASO_2-Cy3 with Arginine (10 .mu.l/well).

[0054] FIGS. 9A-9C. FACS analysis of in vitro treatment with VS_ASO_1-FANA-FITC without lipofectamine or Arginine in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_ASO_1-FANA-FITC (excitation: 488 nm, emission band pass filter: 530/30, Total event: 20,000). (A) no-treatment control, (B) VS_ASO_1-FANA-FITC and (C) Merge. The FACS data indicate that the intensities of FITC signals were significantly stronger with shifting to the right (B: FL1-H:FITC) when compared with the control (A) in the cells after treated with the VS_ASO_1-FANA-FITC without lipofectamine or Arginine reagents (B). The (C) is the merged figures of (A) and (B).

[0055] FIGS. 10A-10B. FACS analysis of in vitro treatment with VS_DsiRNA-Cy5 with lipofectamine (A) or Arginine only (B) in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_DsiRNA-Cy5 (excitation: 635 nm, emission band pass filter: 661/16, Total event: 20,000). Left to right panel: no-treatment control, VS_DsiRNA-Cy5 and merge. The FACS data indicates that the intensities of Cy5 signals were significantly higher with shifting to the right (middle panel: FL4-H:Cy5) in both of panel (A) and (B), it also shown that there are more cells with intercellular signals of the oligos in the presence of 10 .mu.l/well Arginine (panel B) when compared with the lipofectamine (panel A).

[0056] FIGS. 11A-11B. FACS analysis of in vitro treatment with VS_ASO_2-Cy3 with lipofectamine (A) or Arginine only (B) in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_VS_ASO-Cy3 (excitation: 488 nm, emission band pass filter: 585/42, Total event: 20,000). Left to right panel: no-treatment control, VS_ASO_2-Cy3 and merge. The FACS data indicates that the intensities of Cy3 signals were significantly higher with shifting to the right (middle panel: FL2-H:Cy3) in both of (A) and (B), it also shown that there are more cells with intercellular signals of the oligos in the presence of 10 .mu.l/well Arginine (panel B) when compared with the lipofectamine (panel A).

[0057] FIG. 12. Experimental design for detection of SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human lung small airway epithelial cells were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 modification shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 modification shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA_Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without any reagents.

[0058] FIG. 13. Detection of SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with VS-Nucleotides. Significant down-regulation was observed: about 5-fold in group treated by VS_DsiRNA-Cy5 oligos (p<0.005); about 1.5 fold in the group treated by VS_ASO_2-cy3 oligo (p<0.01), and about 6 fold in the group treated by the VS_ASO_1-FANA-FITC oligo (p<0.005); when compared with the group with SARS-CoV-2 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0059] FIG. 14. Experimental design for detection of SARS-CoV-2 S-protein expressed in the primary human lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 24 well-dish, and the cells were transfected with the genes encoding the viral protein (S-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 3) designed shown in the Table 1, and VS_ASO_2 (oligo 3) shown in the Table 2; and VS_DsiRNA (oligo 3) shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 S-protein, A5&A6: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA (oligo 3) with lipofectamine, B1&B2: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA (oligo 3) with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2 (oligo 3) with lipofectamine, B5&B6: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2 (oligo 3) with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 S-protein+/treated by VS_ASO_1-FANA (oligo 3) without any reagents.

[0060] FIG. 15. Detection of SARS-CoV-2 S-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with VS-Nucleotides. Significant down-regulation was observed: about 4 fold in group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.8 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 4 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 4 fold in the in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.5 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 S-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0061] FIG. 16. Experimental design for detection of both of SARS-CoV-2 ORF1ab and RdRp expressed in the primary human lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 24 well-dish, and the cells were transfected with the genes encoding both ORF1ab and RdRp of SARS-CoV-2 viral protein. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 1, 2, 5 and 6) designed shown in the Table 1, and VS_ASO_2 (oligo 1, 2, 5 and 6) shown in the Table 2; and the VS_DsiRNA (oligo 1, 2, 5 and 6) shown in Table 4. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 viral genes encoding both ORF1ab and RdRp, A5&A6: Overexpression of both ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with lipofectamine, B1&B2: Overexpression of both ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), B3&B4: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with lipofectamine, B5&B6: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), C1&C2: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_1-FANA (oligo 1, 2, 5 and 6) without any reagents.

[0062] FIG. 17. Detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 3.5 fold in group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.2 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 4.5 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 2.1 fold in the in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.8 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 ORF1ab and RdRp overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0063] FIG. 18. Experimental design for detection of SARS-CoV-2 N-protein expressed in the primary human lung small airway epithelial cells (HSAEC) by Western Blot after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 6 well-dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with Western Blot. The VS_ASO_2 (oligo 4 & 8) shown in the Table 2; and VS_DsiRNA (oligo 4 & 8) shown in Table 4. A1: No treatment as control, A2: Overexpression of COVID-19 N-protein, A3: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA (oligo 4 and 8) with lipofectamine, B1: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2 (oligo 4 and 8) with lipofectamine.

[0064] FIG. 19. Detection of SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by Western Blot after treatment with inhibitory oligonucleotides: Lane-1: no treatment; Lane-2: SARS-CoV-2 N-protein overexpression (OE); Lane-3: SARS-CoV-2 N-protein OE+/treated by VS_DsiRNA (oligo 4 & 8); Lane-4: SARS-CoV-2 N-protein OE+/treated by the VS_ASO_2 (oligo 4 & 8). The 10 ug total cell-lysis were added into each well. primary antibody: 1 .mu.g/mL anti-SARS-CoV-2-N-protein antibody (ProSci, 3857) and anti-GAPDH antibody (Novus Biologicals, NBP2-27103) with 1:1000 dilution. The secondary antibody: goat-anti-rabbit HRP-conjugated Antibody (R&D System, HAF008) with 1:1000 dilution and goat-anti-mouse IgG HRP-conjugated Antibody (R&D System, HAF007) with 1:1000 dilution. The detection was done using horseradish peroxidase-labeled secondary antibodies and enhanced chemiluminescence detection reagent.

[0065] FIG. 20. Experiments designed for investigating cell penetration and therapeutic effects of VS-Nucleotides (inhibitory oligonucleotides) on human primary bronchial/tracheal epithelial cells (HBTEC) transfected with viral protein of SARS-CoV-2 after treatment. The primary human bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were added into the cells for 24-48 hours before analysis with fluorescent microscope. VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 label shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 label shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA-FITC without lipofectamine or/and Poly-arginine, B1&B2: No treatment as control, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNAi-Cy5 with arginine (5 .mu.l/well), C1&C2: No treatment as control, C3&C4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, C5&C6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with arginine (5 .mu.l/well).

[0066] FIGS. 21A-21D. Microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung bronchial/tracheal epithelial cells (20.times.). (A)-(B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 20), (B) and (E) were taken in well A3 & A4 (as shown in FIG. 20), and (B) and (D) were taken in well A1 & A2 (as shown in FIG. 20).

[0067] FIGS. 22A-22D. Microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung bronchial/tracheal epithelial cells (10.times.). (A)-(B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (10.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 20), (B) and (E) were taken in well A3 & A4 (as shown in FIG. 20), and (B) and (D) were taken in well A1 & A2 (as shown in FIG. 20).

[0068] FIGS. 23A-23F. Microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung bronchial/tracheal epithermal cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0069] FIGS. 24A-24F. Microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung bronchial/tracheal epithermal cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0070] FIGS. 25A-25F. Microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung bronchial/tracheal epithermal cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0071] FIGS. 26A-26F. Microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung bronchial/tracheal epithermal cells (10.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0072] FIG. 27. Experimental design for detection of SARS-CoV-2 N-protein expressed on human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 modification shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 modification shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_Dsi RNA-Cy3 with lipofectamine, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without any reagents.

[0073] FIG. 28. Detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 4 fold in the group treated by VS_DsiRNA-Cy5 oligos (p<0.005); about 6 fold in the group treated by VS_ASO_2-cy3 oligo (p<0.01), and about 8 fold in the group treated by the VS_ASO_1-FANA-FITC oligo (p<0.005); when compared with the group with SARS-CoV-2 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0074] FIG. 29. Experimental design for detection of SARS-CoV-2 S-protein expressed in human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (S-protein) of SARS-CoV-2. The siRNA or ASO were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 3) designed is shown in the Table 1, VS_ASO_2 (oligo 3) is shown in the Table 2; and VS_DsiRNA (oligo 3) is shown in Table 3. A1&A2: No treatment, A3&A4: Overexpression of COVID-19 S-protein, A5&A6: Overexpression of COVID-19 S-protein+/treated by DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA-Cy5 with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 S-protein+/treated by the VS_ASO_2-Cy3 with lipofectamine, B5&B6: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2-Cy3 with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 S-protein+/treated by VS_ASO_1-FANA without any reagents.

[0075] FIG. 30. Detection of SARS-CoV-2 S-protein expressed in the human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 8 fold in the group treated by VS-DsiRNA oligo (purple/L: p<0.01), but about 16.3 fold in presence of Poly-arginine only (yellow/p<0.001); about 15.8 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001), but about 16.6 fold in presence of Poly-arginine only (orange/A: p<0.001); about 11.7 fold in the group treated by the VS_ASO_1 oligo (green/p<0.001); when compared with the group with SARS-CoV-2 S-protein overexpression only (1). The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0076] FIG. 31. Experimental design for detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) detected by qRT-PCR after treatment. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in the 24 well-dish, and the cells were transfected with the genes encoding the viral protein (ORF1ab and RdRp) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. VS_ASO_1-FANA (oligo 1, 2, 5 and 6) designed is shown in the Table 1, VS_ASO_2 (oligo 1, 2, 5 and 6) is shown in the Table 2; and the VS_DsiRNA (oligo 1, 2, 5 and 6) is shown in Table 4. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 viral genes encoding both ORF1ab and RdRp, A5&A6: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with lipofectamine, B1&B2: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with lipofectamine, B5&B6: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_1-FANA (oligo 1, 2, 5 and 6) without any reagents.

[0077] FIG. 32. Detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) detected by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 3 fold in the group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.6 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 6.4 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 4.5 fold in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.9 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 ORF1ab and RdRp overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0078] FIG. 33. Experimental design for detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by Western Blot after treatment. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 6-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with Western Blot. The VS_ASO_2 (oligo 4 & 8) is shown in the Table 2; and VS_DsiRNA (oligo 4 & 8) is shown in Table 4. A1: No treatment as control, A2: Overexpression of COVID-19 N-protein, A3: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA (oligo 4 and 8) with lipofectamine, B1: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2 (oligo 4 and 8) with lipofectamine.

[0079] FIG. 34. Detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by Western Blot after treatment with inhibitory oligonucleotides. Lane 1: no treatment, Lane 2: SARS-CoV-2 N-protein overexpression (OE); Lane 3: SARS-CoV-2 N-protein OE+VS_DsiRNA (oligo 4 & 8); Lane 4: SARS-CoV-2 N-protein OE+VS_ASO_2 (oligo 4 & 8). 10 .mu.g total cell lysis were added into each well and blotted with primary antibody (1 .mu.g/mL anti-SARS-CoV-2-N-protein antibody (ProSci, 3857)) or anti-GAPDH antibody (Novus Biologicals, NBP2-27103) (1:1000 dilution). The secondary antibodies were goat-anti-rabbit HRP-conjugated Antibody (R&D System, HAF008) (1:1000) dilution and goat-anti-mouse IgG HRP-conjugated Antibody (R&D System, HAF007) (1:1000) dilution. The detection was done using horseradish peroxidase-labeled secondary antibodies and an enhanced chemiluminescence detection reagent.

[0080] FIG. 35. Experiments designed for investigating cell penetration and therapeutic effects of ASO(s) and DsiRNA on human primary nasal epithelial cells (HNEpC) transfected with viral protein of SARS-CoV-2 after treatment. The human primary nasal epithelial cells (HNEpC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were delivered into the cells for 24-48 hours before analysis with fluorescent microscope. The VS_ASO_1-FANA-FITC was FITC labeled (see Table 1), and VS_ASO_2-Cy3 was Cy3 labeled (See Table 2); and VS_DsiRNA-Cy5 was Cy5 labeled (see Table 3). A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without lipofectamine or arginine, B1&B2: No treatment as control, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with poly-arginine (5 .mu.l/well), C1&C2: No treatment as control, C3&C4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, C5&C6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with poly-arginine (5 .mu.l/well).

[0081] FIGS. 36A-36D. Microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_ASO_1-FANA-FITC can enter epithelial cells (20.times.). (A) and (B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 35), (B) and (D) were taken in well A1 & A2 (as shown in FIG. 35).

[0082] FIGS. 37A-37D. Microscopic analysis of Human Primary Nasal Epithelial Cells at 10.times.. This analysis showed that VS_ASO_1-FANA-FITC can enter epithelial cells (10.times.). (A) and (B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 35), (B) and (D) were taken in well A1 & A2 (as shown in FIG. 35).

[0083] FIGS. 38A-38F. Microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_DsiRNA-Cy5 can enter epithelial cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0084] FIGS. 39A-39F. Microscopic analysis of Human Primary Nasal Epithelial Cells at 10.times.. This analysis showed that VS_DsiRNA-Cy5 can enter epithelial cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0085] FIGS. 40A-40F. Microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_ASO_2-Cy3 can enter epithelial cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0086] FIGS. 41A-41F. Microscopic analysis of Human Primary Nasal Epithelial Cells at 10.times.. This analysis showed that VS_ASO_2-Cy3 can enter epithelial cells (10.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (10.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0087] FIG. 42. Experimental design for detection of SARS-CoV-2 N-protein expressed on human primary nasal epithelial cells (HNEpC) by qRT-PCR. The human primary nasal epithelial cells (HNEpC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. VS_ASO_1-FANA-FITC was labeled with FITC as shown in the Table 1, and VS_ASO_2-Cy3 was labeled with Cy3 as shown in Table 2; and VS_DsiRNA-Cy5 was labeled with Cy5 as shown in Table 3. A1&A2: No treatment, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA-FITC without any reagents.

[0088] FIG. 43. Detection of SARS-CoV-2 N-protein expressed in the human primary nasal epithelial cells (HNEpC) by qRT-PCR after treatment with siRNA or ASO. Significant down-regulation was observed: about 90 fold in the group treated by VS_DsiRNA-Cy5 oligo (2: p<0.01); about 15 fold in the group treated by VS_ASO_2-Cy3 oligo (p<0.01), and about 350 fold of down-regulation in the group treated by the VS_ASO_1-FANA-FITC oligo (3: p<0.001); when compared with the group with COVID-19 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0089] FIG. 44. Experimental design for inhibiting viral infections using inhibitory nucleotides. WV=Wild-type of pseud-COVID-19 virus, 5 .mu.l (titer: 10.sup.5 TU/ml) of the virus added into each well (C1 to C9). MV=Mutant form of pseud-COVID-19 virus, 5 .mu.l (titer: 10.sup.5 TU/ml) of the virus added into each well (D1 to D9). N 1=VS_ASO_3 oligo (targeting on S-protein of COVID-19), N 2=VS_siRNA/RNAi_3 oligo (targeting on S-protein of COVID-19, Control-1=Scramble nucleotide oligo (SN) only.

[0090] FIGS. 45A-45F. Experimental data of inhibitions of wild-type viral infections by inhibitory nucleotides. (A) Brightfield image of VS_ASO_3-treated cells. (B) Brightfield image of VS_RNAi_3-treated cells. (C) Brightfield image of scramble-treated cells. (D) Fluorescence image of VS_ASO_3-treated cells. (E) Fluorescence image of VS_RNAi_3-treated cells. (F) Fluorescence image of scramble-treated cells. There were no significant GFP expressions found in those cells treated by VS_ASO_3 and VS_RNAi_3 oligos, detected under the confocal microscope; but the inventors were able to see the GFP expressions in the control group of the cells treated with the scramble nucleotide only. This data thus indicated that the VS_ASO_3 and VS_RNAi_3 have inhibited the wild-type of the viruses coupled with eGFP (WV) inside the cells; but not in the group treated with the scramble nucleotide.

[0091] FIGS. 46A-46F. Experimental data of inhibitions of mutant viral infections by inhibitory nucleotides. (A) Brightfield image of VS_ASO_3-treated cells. (B) Brightfield image of VS_RNAi_3-treated cells. (C) Brightfield image of scramble-treated cells. (D) Fluorescence image of VS_ASO_3-treated cells. (E) Fluorescence image of VS_RNAi_3-treated cells. (F) Fluorescence image of scramble-treated cells. There was no significant GFP expressions found in those cells treated by VS_ASO_3 and VS_RNAi_3, detected under the confocal microscope; but the inventors were able to see the GFP expressions in the control group of the cells treated with the scramble nucleotide only. This data thus indicated that the VS_ASO_3 and VS_RNAi_3 have also inhibited the mutant viruses coupled with eGFP (MV) inside the cells; but not in the group treated with the scramble nucleotide.

[0092] FIG. 47. Analysis of the amino acid sequence of SARS-CoV-2 Spike protein (S-protein) (GenBank ID: QHD43416.1, SEQ ID NO: 61). The region of the sequence highlighted in red represents the predicted sequences of ACE2 binding sequences/motifs (aka. the Ligand binding Domain).

[0093] FIGS. 48A-48B. Analysis of the amino acid sequence of the BD motifs. (A) 3D interaction between the SARS-CoV-2 Spike protein and human ACE2. (B) Analysis of the amino acids of the RBD motifs in 3D structure between the SARS-CoV-2 Spike protein (B: K417 to Y505) and human ACE2 (B: Q24 to R393) was used to order to locate which regions of the sequences contribute to the protein-protein interaction, and to design peptides that mimic the RBD sequences (mimics act like a human ACE 2 and prevent or block the binding activities for the SARS-CoV-2 on the real ACE2 in the cells).

[0094] FIG. 49. Experimental design. A1&A2: No treatment as control, A3&A4: peptide 5-FITC, A5&A6: peptide 5-FITC+/treated by the peptide 1 (low dosage), B1&B2: peptide 5-FITC+/treated by the peptide 1 (high dosage), B3&B4: peptide 5-FITC+/treated by the peptide 2 (low dosage), B5&B6: peptide 5-FITC+/treated by the peptide 2 (high dosage), 1&C2: peptide 5-FITC+/treated by the peptide 3 (low dosage), C3&C4: peptide 5-FITC+/treated by the peptide 3 (high dosage), C5&C6: peptide 5-FITC+/treated by the peptide 4 (low dosage), D1&D2: peptide 5-FITC+/treated by the peptide 4 (high dosage), D3&D4: peptide 5-FITC+/treated by the peptide 1 (high dosage)+peptide 2 (high dosage)+peptide 3 (high dosage)+peptide 4 (high dosage), The dosage-1=1 .mu.g per 10.sup.5 cells; and the dosage-2=10 .mu.g per 10.sup.5 cells.

[0095] FIGS. 50A-50H. Cells infected with wild-type SARS-COV-2 virus (WV) in the presence of inhibitory peptides. (A) Brightfield image of cells treated with Peptide 1 (P1). (B) Brightfield image of cells treated with Peptide 2 (P2). (C) Brightfield image of cells treated with Peptide 3 (P3). (D) Brightfield image of cells treated with normal human serum (NHS). (E) Fluorescence (GFP) image cells treated with Peptide 1 (P1). (F) Fluorescence (GFP) image of cells treated with Peptide 2 (P2). (G) Fluorescence (GFP) image of cells treated with Peptide 3 (P3). (H) Fluorescence (GFP) image of cells treated with normal human serum (NHS).

[0096] FIGS. 51A-51H. Cells infected with mutant SARS-COV-2 virus (MV) in the presence of inhibitory peptides. (A) Brightfield image of cells treated with Peptide 1 (P1). (B) Brightfield image of cells treated with Peptide 2 (P2). (C) Brightfield image of cells treated with Peptide 3 (P3). (D) Brightfield image of cells treated with normal human serum (NHS). (E) Fluorescence (GFP) image cells treated with Peptide 1 (P1). (F) Fluorescence (GFP) image of cells treated with Peptide 2 (P2). (G) Fluorescence (GFP) image of cells treated with Peptide 3 (P3). (H) Fluorescence (GFP) image of cells treated with normal human serum (NHS).

[0097] FIG. 52A-52H. Microscope analysis of human primary small airway epithelial cells treated with inhibitory peptides (VS-peptides). (A), and (E) were captured under the FITC florescent filter, (B) and (E) were captured in brightfield (20.times.). (C) shows the merge of (A) and (B). (G) is a merge photo of (E) and (F). The white dots indicate the box that was enlarged as shown in (D). The yellow dots indicate the box that was enlarged as shown in (H). White arrows suggested peptide 5-FITC internalized into cells cytoplasm and nucleus, while the yellow arrows suggested the VS-peptides combination can block the peptide 5-FITC from internalization, staying outside of cells.

[0098] FIG. 53. Gene therapy vector AAV-U6-A1-H1-A2-SV40-eGFP. This AAV vector expresses two transgenes (namely ASO1 (A1) and ASO2 (A2)) simultaneously in one cell. U6=The 1st promoter that controls the expression of A1 gene in the mammalian cells, H1=The 2nd promoter that controls the expression of A2 gene in the mammalian cells, SV=The 3rd promoter that controls the expression of GFP gene in the mammalian cells. Full sequence of AAV-U6-A1-H1-A2 SV40 GFP is shown by SEQ ID NO: 46.

[0099] FIG. 54. Gene therapy vector AAV-U6-A3-H1-A4-SV40-eGFP. This AAV vector expresses two transgenes (namely A503 (A3) and A504 (A4)) simultaneously in one cell. U6=The 1st promoter that controls the expression of A3 gene in the mammalian cells, H1=The 2nd promoter that controls the expression of A4 gene in the mammalian cells SV40=The 3rd promoter that controls the expression of GFP gene in the mammalian cells. Full sequence of AAV-U6-A1-H1-A2-SV40-eGFP is shown by SEQ ID NO: 47.

[0100] FIG. 55. Gene therapy vector AAV-U6-shRNA1-CMV-eGFP. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA1 gene in the mammalian cells, CMV=the 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence is shown by SEQ ID NO: 48 of AAV-U6-shRNA1-eGFP.

[0101] FIG. 56. Gene therapy vector AAV-U6-shRNA2-CMV-eGFP. This AAV vector expresses the transgene shRNA1 in one cell: U6=The 1st promoter that controls the expression of shRNA2 gene in the mammalian cells, CMV=the 2.sup.nd promoter that controls the expression of eGFP gene in the mammalian cells. The sequence of AAV-U6-shRNA2-eGFP is shown by SEQ ID NO: 49.

[0102] FIG. 57. Gene therapy vector AAV-U6-shRNA3-CMV-eGFP. A. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA3 gene in the mammalian cells, CMV=The 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence of AAV-U6-shRNA3-eGFP is shown by SEQ ID NO: 50.

[0103] FIG. 58. Gene therapy vector AAV-U6-shRNA4-CMV-eGFP. A. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA4 gene in the mammalian cells, CMV=The 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence of AAV-U6-shRNA4-eGFP is shown by SEQ ID NO: 51.

[0104] FIGS. 59A-59B. These experiments were designed as plates A and B as follows: (A) Plate A: #1 vector: AAV-U6-shRNA1-GFP (ORF1ab), #2 vector: AAV-U6-shRNA2-GFP (RdRp), #3 vector: AAV-U6-shRNA3-GFP (S), #4 vector: AAV-U6-shRNA4-GFP (N), #5 vector: AAV-U6-ASO1-H1-A502-GFP (ORF1ab&RdRp), #6 vector: AAV-U6-A503-H1-ASO4-GFP (S & N). (B) Plate B: No treatment: Mock transfections, and Positive control: Cells transfected with COVID19 plasmids, but no gene therapy vectors.

[0105] FIGS. 60A-60D. Data analysis by qRT-PCR. (A) Nasal-epithelial cells transfected with designed COVID-19 plasmid encoding N protein. (B) Nasal-epithelial cells transfected with designed COVID-19 plasmid encoding ORF1ab. (C) Nasal-epithelial cells transfected with designed COVID-19 plasmid encoding S protein. (D) Nasal-epithelial cells transfected with designed COVID-19 plasmid encoding RdRp. The cells were transfected with designed vectors with COVID-19 plasmids (S, N, RdRp and ORF1ab), and also the gene therapy vectors (#1 to #6) after 24 hours post-seeding. At the 48 hours post-transfection, the cells were then harvested, and their total RNA were extracted with including the DNase digestion before PCR assays. S proteins were conducted with TaqMan-probe assay kit (Thermofisher, A47532). The N protein, ORF1ab and RdRp proteins were determined by the GenScript kits (SARS-CoV-2PCR detection assay kit). The data indicated that the treatments by using the gene vectors have significant therapeutic effects to inhibit the expressions of the viral proteins. Synergic enhanced effects were observed when more than one peptide was used (see, #1 to 4 and #5 to 6).

[0106] FIGS. 61A-61B. (A) Western blot analysis of S-protein expression. (B) Quantification of (A). The cells were seed onto 6 well-plates. At 24 hours post-seeding, cells were transfected by the gene therapy vectors (#1 to #6) with including the plasmids encoding the COVID-19 S-proteins. After 48 hours post-transfection, cells were harvested and lysed. The primary antibody is SARS-CoV-2 Spike with 1 .mu.g/mL (ProSc, Inc), and the secondary antibody is Goat-anti-Rabbit HRP conjugated antibody by 1:1000 dilution (R&D System). The data indicated that the treatments by using the gene vectors have significant therapeutic effects to block the expression of viral proteins. Synergic enhanced effects were observed when more than one peptide was used (see, #1 to 4 and #5 to 6).

[0107] FIG. 62. Experimental design of in vitro gene therapy on inhibitions of the viral infections. WV=Wild-type of pseud-COVID-19 virus, 5 ul (titer: 10.sup.5 TU/ml) of the virus added into each well (E1 to E9). MV=Mutant form of pseud-COVID-19 virus, 5 ul (titer: 10.sup.5 TU/ml) of the virus added into each well (F1 to F9). V1=AAV-U6-A3_H1-A4-GFP, V2=AAV-U6-shRNA3-GFP, Control-1=irrelevant vector plasmid, Control-2=AAV-U6-A3_H1-A4-GFP (without virus added), Control-3=AAV-U6-shRNA3-GFP (without virus added).

[0108] FIGS. 63A-63F. In vitro gene therapy inhibits WV viral infections. ASO (V1) and RNAi (V2) were delivered by gene vectors into mammalian cells that express ACE2 proteins, in order to inhibit the WV viral infections (WV=wild-type pseudo-virus of COVID-19). (A) Brightfield image of cells treated with ASO (V1). (B) Brightfield image of cells treated with RNAi (V2). (C) Brightfield image of cells treated with control. (D) Fluorescence image of cells treated with ASO (V1). (E) Fluorescence image of cells treated with RNAi (V2). (F) Fluorescence image of cells treated with control.

[0109] FIGS. 64A-64F. In vitro gene therapy inhibits MV viral infections. ASO (V1) and RNAi (V2) were delivered by gene vectors into mammalian cells that express ACE2 proteins, in order to inhibit the MV viral infections (MV=mutant pseudo-virus of COVID-19). (A) Brightfield image of cells treated with ASO (V1). (B) Brightfield image of cells treated with RNAi (V2). (C) Brightfield image of cells treated with control. (D) Fluorescence image of cells treated with ASO (V1). (E) Fluorescence image of cells treated with RNAi (V2). (F) Fluorescence image of cells treated with control.

[0110] FIGS. 65A-65D. In vitro delivery of gene vectors into living cells. ASO (V1) and RNAi (V2) were delivered by using the gene vectors into mammalian cells that express ACE2 proteins, the cells were not incubated with any viruses, which were served as background controls. The concentrations of the vectors encoding the ASO (control-2) or/and RNAi (control-3) were the same used in the FIGS. 61A-61B and 62. (A) Brightfield image of cells treated with ASO control. (B) Brightfield image of cells treated with RNAi control. (C) Fluorescence image of cells treated with ASO control. (D) Fluorescence image of cells treated with RNAi control.

[0111] FIGS. 66A-66B (A) Wild-type pseudo-virus experiment results and (B) mutant pseudo-virus experiment results. Since both gene vectors, encoding ASO and shRNA, also contain marker gene of GFP, normalized data was calculated based on control-2 and control-3 constructs (also see FIG. 62). The data analysis confirmed that ASO or shRNA vector expressing cells showed very little GFP signal, when compared with the control group-1. This data indicates that the gene vectors carrying either ASO or shRNA (inhibitory oligonucleotides) suppress viral infection and propagation in both wild-type and mutant viruses of COVID-19, pseudo-typed by lentiviruses.

[0112] FIG. 67. Experimental design for detection of apoptosis/cytotoxicity of VS-nutrition in human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in the 24 well-dish, and the cells were treated with VS-nutrition with designated dilution (1:1, 1:300 and 1:500) for 5 days (in every day, refresh cell culture medium and added new VS-nutrition with same composition and ratio) before analysis by qRT-PCR.

[0113] FIG. 68. Detection of on apoptosis/cytotoxicity of VS-nutrition in the human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment. Detection of apoptosis/cytotoxicity of VS-nutrition in the human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with VS-nutrition. There are no significant up or down-regulation of BAX/BCL2 ratio in group treated by VS-nutrition when compared with the normal cells with no-treatment (p>0.05).

[0114] FIG. 69. Experimental design for detection of apoptosis/cytotoxicity of VS-nutrition in Human Primary Nasal Epithelial Cells (HNEpC) by qRT-PCR. The human primary nasal epithelial cells (HNEpC) were cultured in the 24 well-dish, and the cells were treated with VS-nutrition with designated dilution (1:1, 1:300 and 1:500) for 5 days (in every day, refresh cell culture medium and added new VS-nutrition with same composition and ratio) before analysis by qRT-PCR.

[0115] FIG. 70. Detection of on apoptosis/cytotoxicity of VS-nutrition in the human primary nasal epithelial cells (HNEpC) by qRT-PCR after treatment. Detection of apoptosis/cytotoxicity of VS-nutrition in the human primary nasal epithelial cells by RT-PCR after treatment with VS-nutrition. There are no significant up or down-regulation of BAX/BCL2 ratio in group treated by VS-nutrition when compared with the normal cells with no-treatment (p>0.05).

[0116] FIGS. 71A-71B. Oral intake formulations of VS product (nutritional supplement). Bottle product (10-15 ml) with (A) 1.5 ml spoon or (B) 1.0 ml drop.

[0117] FIGS. 72A-72C. Nasal (liquid) spray. Spray product with 10-15 ml bottle nasal spray. (A) composition and size of the product. (B) & (C) usage example.

[0118] FIGS. 73A-73B. (A) The alignment of all ASO (ASO_1 and ASO_2) and all oligos in Tables 1, 2 and 4 showed that the designed inhibitory oligonucleotides specifically target the SARS-COV-2 virus genes. The alignment did not show any significant match to any human genes (thereby, avoiding potential side-effects when applied in human). (B): The analysis of all DsiRNA indicated all oligos (in Tables 1, 2 and 4) specifically target the SARS-COV-2 virus genes. The alignment did not show any significant match to any human genes (thereby, avoiding potential side-effects when applied in human)

[0119] FIGS. 74A-74C. Peptide ELISA assays. (A) Schematic of ELISA assays. (B) Analysis of inhibitions of COVID-19 Spike Protein Receptor Binding Domain (S-RBD)-ACE2 binding by inhibitory peptides. (C) Table of p-values of the results in (A) and the number of amino acids participating in S-RBD/ACE2 interaction. These results indicated that the peptides could compete with ACE2 proteins and prevent S-RBD binding to ACE2. When the designed inhibitory peptides contained more amino acids interacting with S-RBD, stronger affinities were measured.

[0120] FIGS. 75A-75B. (A) Inhibition rate of S-RBD binding to ACE2 using VS peptides. (B) S-RBD signal rate. The data were converted and calculated as inhibition/suppression rates of the peptides based on the intensities of the S-RBD signals after treatment with the peptides compared with the control groups (B). All peptides have shown their dosage-responses in the ELISA reactions, and indicated their strong biological affinities to bind with the S-RBD.

[0121] FIGS. 76A-76J. VS-peptides (VS-peptides 1, 2, 3, 4 and 5) block COVID-19 S-RBD-FITC from entering living mammalian cells expressing ACE2 receptors, as determined by FACS analysis. (A) Negative control (no peptide or FITC). (B) Positive control (FITC added, no peptide). (C) Human normal serum control (FITC added, no peptide). (D) VS-Peptide 1. (E) VS-Peptide 1. (F) VS-Peptide 1. (G) VS-Peptide 1. (H) VS-Peptide 1. (I) VS-Peptide 1. (J) Schematic of the experiment. Without a VS peptide, S-RBD (which is conjugated to FITC) binds to ACE2 and results the HeLa-ACE2 cells giving a FITC signal. When incubated with a VS peptide, S-RBD (conjugated to FITC) binds to VSB peptide instead of HeLa-ACE2 cells. In this case, HeLa-ACE2 cells have no FITC signal.

[0122] FIG. 77. ELISA results of S-RBD inhibition by inhibitory peptides derived from VS-Peptides 1-5 (P1 to P20--see Table 6 for sequences shown by SEQ ID NOS: 63-82). The competitive ELISA was performed as depicted in FIG. 74A. P1: VS-Peptide 1-a, P2: VS-Peptide 1-b, P3: VS-Peptide 1-c, P4: VS-Peptide 1-d, P5: VS-Peptide 2-a, P6: VS-Peptide 2-b, P7: VS-Peptide 2-c, P8: VS-Peptide 2-d, P9: VS-Peptide 3-a, P10: VS-Peptide 3-b, P11: VS-Peptide 3-c, P12: VS-Peptide 3-d, P13: VS-Peptide 4-a, P14: VS-Peptide 4-b, P15: VS-Peptide 4-c, P16: VS-Peptide 4-d, P17: VS-Peptide 5-a, P18: VS-Peptide 5-b, P19: VS-Peptide 5-c, P20: VS-Peptide 5-d. The data indicated that the derivative inhibitory peptides are capable of targeting the S-RBD of SARS-CoV-2 significantly to prevent viral binding on the human ACE2 receptors (p<0.05).

DETAILED DESCRIPTION

[0123] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0124] This disclosure is directed to compositions and methods for treating Coronavirus disease 2019 (COVID-19).

[0125] The term "COVID-19 treatment" (or "treating COVID-19"), refers to reduction, alleviation, or elimination of one or more of the COVID-19 disease symptoms, or prevention or inhibition of the onset of one or more COVID-19 disease or disease symptoms. Documented symptoms of include, for example, fever, dry cough, tiredness, aches and pains, sore throat, diarrhea, conjunctivitis, headache, loss of taste, loss of smell, a rash on skin, discoloration of fingers or toes, difficulty breathing, shortness of breath, chest pain or pressure, loss of speech, and loss of movement.

[0126] The compositions and methodologies described herein are effective to treat COVID-19 caused by infection of SARS-CoV2, including the originally or earlier isolated viral strains of SARS-CoV2, as well as variants of the original or earlier SARS-CoV2 viral isolates. In some embodiments, a SARS-CoV2 variant has a mutation in the spike protein. In some embodiments, the mutations comprise at least one amino acid deletion or substitution. In a specific embodiment, the SARS-CoV2 variant is the viral isolate known as B.1.1.7. In a specific embodiment, the B.1.1.7 has deletions of H69, V70 and Y144 of the spike protein as shown by SEQ ID NO: 61, and also has the following amino acid substitutions N501Y, A570D, D614G, P681H, T7161, S982A, and D118H of the spike protein as shown by SEQ ID NO: 61. All known variants of SARS-CoV2 cause similar and overlapping disease symptoms, as described above.

[0127] In one aspect, the compositions and the methods disclosed herein are directed towards targeting a plurality of selected target genes in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) genome by employing a plurality of inhibitory oligonucleotides. In some embodiments, a selected target gene is targeted with a plurality of inhibitory oligonucleotides. The inhibitory oligonucleotides can be used directly in a composition formulated as a dietary supplement or a pharmaceutical composition (e.g., in the form of nanoparticles or liposomes) for administration to a subject; or alternatively, can be placed in one or more nucleic acid vectors which are administered to a subject.

[0128] This approach developed by the inventors has several advantages. RNA viruses have a tendency to mutate and a recent study suggests that mutations could make coronavirus more infectious. The genes selected to be targeted herein are essential to the function of the SARS-CoV-2 virus. Therefore, by providing a plurality of inhibitory oligonucleotides targeting multiple genes, inhibition of the viral function is accomplished even if one of the target genes has mutated. Further, the inhibitory oligonucleotides are small in size, which permits effective cell penetration including penetration of infected cells, an advantage not provided by vaccines or antibodies against SARS-CoV-2 proteins which are not effective once the virus has entered into host cells.

[0129] In another aspect, the compositions and the methods disclosed herein are directed towards inhibiting the interactions between the SARS-CoV-2 virus and the Angiotensin-converting enzyme 2 (ACE2) receptor by one or more inhibitory peptides that mimic either the binding surface of ACE2 ligand binding domain (LBD) or the binding surface of the SARS-CoV-2 S-protein receptor binding domain (RBD). The inhibitory peptides can be included in a composition formulated as a dietary supplement or a pharmaceutical composition (e.g., in the form of nanoparticles or liposomes) for administration to a subject.

[0130] In a further aspect, the compositions and the methods disclosed herein are based on a combination of a plurality of inhibitory oligonucleotides and inhibitory peptides.

[0131] In some embodiments, the gene vectors described herein, encoding the inhibitory oligonucleotides and peptides described herein, can target viral infective functional group genes that have been integrated into the host cell (e.g., a human cell) genome (see, Zhang, L., et al., PNAS, 118.21 (2021), incorporated herein in its entirety).

SARS-CoV-2 Genes

[0132] In some embodiments, the entire SARS-CoV-2 cDNA sequence is shown under GenBank Accession No: NC_045512.2 (SEQ ID NO: 52). The individual SARS-CoV-2 genes are as follows:

ORF1ab: The open reading frame for starting transcriptional genes of SARS-CoV-2, 1ab, and is between nucleotide numbers 266 and 21555 of SEQ ID NO: 52; N-protein gene: encodes the Nucleocapsid Protein of SARS-CoV-2 (which is a structural protein that binds to the coronavirus RNA genome, thus creating a shell), and is between nucleotide numbers 28274 and 29533 of SEQ ID NO: 52; S-protein gene: encodes the spike protein of SARS-CoV-2 (which binds to the host cell receptors, i.e., ACE2 to enter the host cells, and is between nucleotide numbers 21563 and 25384 of SEQ ID NO: 52; E-protein gene: encodes envelope protein of SARS-CoV-2 (which is a small membrane protein that has an important role in the assembly of virions), and is between nucleotide numbers 26245 and 26472 of SEQ ID NO: 52; RdRp: encodes the RNA-dependent RNA polymerase of SARS-CoV-2 (an enzyme that catalyzes the replication of RNA from a viral RNA template) and is between nucleotide numbers 13442 and 16236 of SEQ ID NO: 52.

Targeting/Target Site

[0133] As used herein, the term "targeting" refers to the action of an inhibitory oligonucleotide binding or hybridizing to a target site in a nucleic acid that results in inhibition of the expression of the nucleic acid.

[0134] As used herein, a "target site" refers to a stretch of nucleotides on an mRNA of a target gene to which an inhibitory oligonucleotide binds, which ultimately leads to inhibition of the function of the mRNA and thus the expression of the gene. In some embodiments, a target site comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, a target site comprises not more than 50, 45, 40 or 35 nucleotides. In some embodiments, a target site comprises between 15-30, 18-28, 20-25, or 30-35 nucleotides. Selected target sites are unique to the virus with minimal or no overlap with mRNA sequences found in human, so that the oligonucleotides are specific in their inhibition of the viral mRNA, with minimal side effects/off-target effects. In specific embodiments, a target site comprises the nucleotide sequence of one of SEQ ID NOS: 1-8; for example, a target site may have a nucleotide sequence that includes one of SEQ ID NOS: 1-8 and additional nucleotide(s) (e.g., 1, 2, 3, 4, or 5 nucleotides) on either 5' or 3' of the selected sequence.

Inhibitory Oligonucleotides

[0135] As used herein, the phrase "inhibitory oligonucleotide" refers to an oligonucleotide that can inhibit expression of a target SARS-CoV-2 gene. In some embodiments, an inhibitory oligonucleotide binds to a target site in a nucleic acid (e.g., a selected SARS-CoV-2 mRNA). In some embodiments, an inhibitory oligonucleotide comprises the reverse complementary sequence of a target site. In some embodiments, an inhibitory oligonucleotide comprises a nucleotide sequence that is substantially complementary to the sequence of a target site and capable of binding to the target site. "Substantially complementary" means that the oligonucleotide may be identical to the reverse complementary sequence of a target site, or may differ from the reverse complementary sequence of a target site in one or more (e.g., 1, 2, or 3) nucleotide positions via substitution, addition or deletion of one or more nucleotides.

[0136] The inhibitory oligonucleotides disclosed herein have the following features:

[0137] (i) The inhibitory oligonucleotides can specifically target multiple target sites of SARS-CoV-2 RNA directly.

[0138] (ii) The inhibitory oligonucleotides can cross the cell membrane and interact with the viral RNA inside cellular cytoplasm.

[0139] (iii) Since the oligonucleotide compositions of the disclosure can target the multiple-target sites in the viral RNA, this approach is able to circumvent mutations which often occur in RNA viruses.

[0140] (iv) The inhibitory oligonucleotides can be easily, quickly and economically manipulated, and different kinds of viral infections (including, but not limited to, different strains of SARS-CoV-2) can be treated.

[0141] (v) Nucleotides provide nutrition for supporting on metabolism and health of the human body.

[0142] In some embodiments, the inhibitory oligonucleotides of this disclosure comprise at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the inhibitory oligonucleotides comprise not more than 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, or 31 nucleotides. In some embodiments, the inhibitory oligonucleotides comprise between 15-20, 15-25, 15-30, 16-20, 16-25, 16-27, 16-30, 17-20, 17-25, 17-27, 17-30, 18-20, 18-25, 18-28, 18-30, 19-20, 19-25, 19-28, 19-30, 20-22, 20-25, 20-28, 20-30, 21-22, 21-25, 21-28, 21-30, 21-25, 21-28, 21-30, or 25-30 nucleotides.

[0143] In some embodiments, the inhibitory oligonucleotides are selected from the group consisting of an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), and a microRNA.

[0144] In some embodiments, the inhibitory oligonucleotide is an ASO selected from SEQ ID NOS: 9-16, and 33-40. In some embodiments, the inhibitory oligonucleotide comprises a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to a nucleotide sequence selected from SEQ ID NOS: 9-16 and 33-40.

[0145] In some embodiments, the inhibitory oligonucleotide is an ASO targeting SARS-CoV2 ORF1ab gene. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 9 or SEQ ID NO: 33. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 13 or SEQ ID NO: 37.

[0146] In some embodiments, the inhibitory oligonucleotide is an ASO targeting SARS-CoV2 RdRp gene. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 10 or SEQ ID NO: 34. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 14 or SEQ ID NO: 38.

[0147] In some embodiments, the inhibitory oligonucleotide is an ASO targeting SARS-CoV2 S-protein gene. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 11 or SEQ ID NO: 35.

[0148] In some embodiments, the inhibitory oligonucleotide is an ASO targeting SARS-CoV2 N-protein gene. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 12 or SEQ ID NO: 36. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 16 or SEQ ID NO: 40.

[0149] In some embodiments, the inhibitory oligonucleotide is an ASO targeting SARS-CoV2 E-protein gene. In a specific embodiment, the ASO comprises a sequence as shown in SEQ ID NO: 15 or SEQ ID NO: 39.

[0150] In some embodiments, the inhibitory oligonucleotide comprises a pair of Dicer-substrate RNAs (DsiRNAs) selected from the group consisting of DsiRNA pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32. In some embodiments, the plurality of inhibitory oligonucleotides comprise Dicer-substrate RNA (DsiRNA) pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

[0151] In some embodiments, the inhibitory oligonucleotide is a pair of DsiRNAs targeting SARS-CoV2 ORF1ab gene. In a specific embodiment, the pair of DsiRNAs comprises SEQ ID NOs: 17 & 18 or SEQ ID NOs: 25 & 26.

[0152] In some embodiments, the inhibitory oligonucleotide is a pair of DsiRNAs targeting SARS-CoV2 RdRb gene. In some embodiments, the pair of DsiRNAs comprises a pair of nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NOs: 19 & 20 or SEQ ID NOs: 27 & 28. In a specific embodiment, the pair of DsiRNAs comprises SEQ ID NOs: 19 & 20 or SEQ ID NOs: 27 & 28.

[0153] In some embodiments, the inhibitory oligonucleotide is a pair of DsiRNAs targeting SARS-CoV2 S-protein gene. In some embodiments, the pair of DsiRNAs comprises a pair of nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NOs: 21 & 22. In a specific embodiment, the pair of DsiRNAs comprises SEQ ID NOs: 21 & 22.

[0154] In some embodiments, the inhibitory oligonucleotide is a pair of DsiRNAs targeting SARS-CoV2 N-protein gene. In some embodiments, the pair of DsiRNAs comprises a pair of nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NOs: 23 & 24 or SEQ ID NOs: 31 & 32. In a specific embodiment, the pair of DsiRNAs comprises SEQ ID NOs: 23 & 24 or SEQ ID NOs: 31 & 32.

[0155] In some embodiments, the inhibitory oligonucleotide is a pair of DsiRNAs targeting SARS-CoV2 E-protein gene. In some embodiments, the pair of DsiRNAs comprises a pair of nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NOs: 29 & 30. In a specific embodiment, the pair of DsiRNAs comprises SEQ ID NOs: 29 & 30.

[0156] In some embodiments, the inhibitory oligonucleotides are modified. As used herein the term "modified" or "modification" refers to a change in chemical structure of one or more nucleotides of an oligonucleotide, while leaving the sequence of the oligonucleotide unchanged as compared to the sequence before the modification. In some embodiments, the modification results in improved in vivo stability of the inhibitory oligonucleotides (e.g., by preventing degradation by cellular enzymes). In some embodiments, the modification results in improved entry of the inhibitory oligonucleotides into a cell (e.g., by improving cell membrane crossing properties). In a specific embodiment, the inhibitory oligonucleotides are 2'-Deoxy, 2'-Fluoroarabino Nucleic Acid (FANA)-modified antisense oligonucleotides. In a specific embodiment, the inhibitory oligonucleotides are 2' 0-Methyl RNA modified antisense oligonucleotides.

[0157] In some embodiments, the inhibitory oligonucleotides of the disclosure comprise at least one detectable label. Non-limiting examples of detectable labels include, but are not limited to, Alexa 405, Pacific Blue, Pacific Green, Alexa 488, Alexa 532, Alexa 546, Rhodamine Red X, Alexa 610, Alexa 647, DyLight-510-LS, Hydroxycoumarin, methoxycoumarin, Cy2, FAM, Flourescein FITC, Alexa 430, R-phycoerythrin (PE), Tamara, Cy3.5 581, Rox, Alexa fluor 568, Red 613, Texas Red, Alexa fluor 594, Alexa fluor 633, Alexa fluor 660, Alexa fluor 680, Cy5, Cy 5.5, Cy 7, and Allophycocyanin.

Compositions Comprising Inhibitory Oligonucleotides

[0158] One aspect of the disclosure is directed to a composition comprising at least one inhibitory oligonucleotide as described herein, wherein the at least one inhibitory oligonucleotide targets a SARS-CoV-2 gene selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

[0159] In some embodiments, the composition comprises at least one inhibitory oligonucleotide, wherein the at least one inhibitory oligonucleotide is selected from the group consisting of an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), and a microRNA.

[0160] In some embodiments, the composition comprises at least one ASO selected from SEQ ID NOS: 9-16, and 33-40.

[0161] In some embodiments, the composition comprises at least one pair of Dicer-substrate RNAs (DsiRNAs) selected from the group consisting of DsiRNA pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32. In some embodiments, the plurality of inhibitory oligonucleotides comprise Dicer-substrate RNA (DsiRNA) pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

[0162] In one aspect, the disclosure is directed to a composition comprising a plurality of inhibitory oligonucleotides, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene. In some embodiments, the plurality of inhibitory oligonucleotides targets all of the ORF1ab, RdRp, S-protein, N-protein and E protein genes.

[0163] In some embodiments, a selected SARS-CoV-2 gene is targeted by at least two inhibitory oligonucleotides. In some embodiments, a selected SARS-CoV-2 gene is targeted by two, three, four, five, or six different, e.g., non-overlapping, inhibitory oligonucleotides. In some embodiments, the at least two inhibitory oligonucleotides simultaneously target at least two different sites on at least two SARS-CoV-2 genes.

[0164] In some embodiments, the plurality of inhibitory oligonucleotides comprises at least two, at least three, at least four, at least five, at least six, at least seven, or more oligonucleotides which comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 9-16 and modified forms of SEQ ID NOS: 9-16 (e.g., SEQ ID NOS: 33-40). In some embodiments, the plurality of inhibitory oligonucleotides comprises all eight oligonucleotides as shown in SEQ ID NOS: 9-16 or modified forms of SEQ ID NOS: 9-16 (e.g., SEQ ID NOS: 33-40), respectively.

[0165] In some embodiments, the plurality of inhibitory oligonucleotides comprise at least two, at least three, at least four, at least five, at least six, at least seven, or more pairs of Dicer-substrate RNAs (DsiRNAs) selected from the group consisting of DsiRNA pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32). In some embodiments, the plurality of inhibitory oligonucleotides comprise Dicer-substrate RNA (DsiRNA) pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

[0166] In some embodiments, the plurality of inhibitory oligonucleotides are expressed from at least one nucleic acid vector (i.e., one or more vectors). In some embodiments, the at least one nucleic acid vector is selected from a viral vector, a non-viral vector, an integrative vector, or a non-integrative vector. In some embodiments, the plurality of inhibitory oligonucleotides are expressed from one nucleic acid vector.

[0167] In some embodiments, the inhibitory oligonucleotides are 2' 0-Methyl RNA modified antisense oligonucleotides and have a nucleotide sequence selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40.

[0168] In some embodiments, the inhibitory oligonucleotides are in modified forms that comprise phosphorothioate bonds that render them resistant to nucleases.

[0169] In some embodiment, the inhibitory oligonucleotides comprise a 5-methyl dC modification at the in 5' ends.

[0170] In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles (e.g., lipid-based delivery vehicles such as lipofectamine and oligofectamine) to which the plurality of inhibitory oligonucleotides is conjugated.

Compositions Comprising Inhibitory Peptides

[0171] ACE2 is an enzyme that plays a critical role in human biology and metabolism. ACE2 also functions as the receptor for the SARS-CoV-2 for its cellular entry. Disclosed herein are peptides designed to block SARS-CoV-2 S-protein receptor binding domain (RBD) from interacting with ACE2 ligand binding domain (LBD), thereby preventing viral entry.

[0172] The inventors recognized that if a peptide that is too long is used to treat the disease, that peptide's effect would be limited because of folding of the 3D structure during the binding on SARS-CoV-2. Therefore, the inventors designed peptides that are long enough to prevent ACE2 LBD and SARS-CoV-2 RBD interaction, but short enough to not require secondary structures to work. In some embodiments, the length of a peptide is about 15 amino acids, about 16 amino acids, about 17 amino acids, about 18 amino acids, about 19 amino acids, about 20 amino acids, about 21 amino acids, about 22 amino acids, about 23 amino acids, about 24 amino acids, about 25 amino acids, about 26 amino acids, about 27 amino acids, about 28 amino acids, about 29 amino acids, about 30 amino acids, about 31 amino acids, about 32 amino acids, about 33 amino acids, about 34 amino acids, or about 35 amino acids. In some embodiments, the length of a peptide is not more than 50 amino acids, not more than 49 amino acids, not more than 48 amino acids, not more than 47 amino acids, not more than 46 amino acids, not more than 45 amino acids, not more than 44 amino acids, not more than 43 amino acids, not more than 42 amino acids, not more than 41 amino acids, not more than 40 amino acids, not more than 39 amino acids, not more than 38 amino acids, not more than 37 amino acids, not more than 36 amino acids, not more than 37 amino acids, not more than 36 amino acids, not more than 35 amino acids, not more than 34 amino acids, not more than 33 amino acids, not more than 32 amino acids, not more than 31 amino acids, or not more than 30 amino acids in length. As used herein, the term "about" refers to .+-.10% of any given value. The inhibitory peptides bind to ACE2 LBD or SARS-CoV-2 RBD by mimicking a portion of ACE2 LBD or a portion of SARS-CoV-2 RBD. A "portion" means a contiguous peptide sequence of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 amino acids.

[0173] In some embodiments, the inhibitory peptides of the instant disclosure comprise modifications to a peptide of a naturally occurring protein, e.g., by adding, substituting or removing one or more amino acids in a peptide of a naturally occurring protein (e.g., at the N-terminus, the C-terminus or within the peptide) such that the modified peptide differs in sequence from the peptide of a naturally occurring protein; by including one or more non-natural amino acids in the peptide, by making a modification (e.g., a label or a tag) to the side chain of an amino acid in the peptide.

[0174] The inhibitory peptides disclosed herein can also serve as antigens for generation of antibodies against these peptides. The generated antibodies can bind to the RBD domain of the S protein of SARS-CoV-2, or to the LBD of human ACE2, thereby blocking the interaction between the S protein and human ACE receptor. Thus, the inhibitory peptides can be administered to a subject and antibodies can be generated in the subject; or alternatively, the inhibitory peptides, especially peptides that mimic the binding surface of the RBD domain of the S protein of SARS-CoV-2 (such as peptide 6 in Table 5, SEQ ID NO: 45), can be used to produce antibodies in vitro or in a host animal, which antibodies are then administered to a subject.

[0175] In one aspect, the disclosure is directed to a composition comprising at least one peptide mimicking the ligand binding domain (LBD) of human Angiotensin-converting Enzyme 2 (ACE2) protein, wherein the at least one peptide prevents binding of the S-protein of SARS-CoV-2 to the human ACE2 protein. The amino acid sequence of the human ACE2 protein is shown in SEQ ID NO: 55. The nucleotide sequence of the human ACE2 gene is shown in GenBank Accession Number: AB046569.1. The amino acids in the ACE2 protein that directly interact with SARS-CoV-2 S-protein are as follows: Q24, T27, F28, D30, K31, H34, E35, E37, D38, Y41, Q42, L79, M82, Y83, N330, K353, G354, D355, R357 and R393 of SEQ ID NO: 55.

[0176] In some embodiments, the LBD of human ACE2 is as defined in Lan, Jun et al. (Nature, vol. 581, 7807 (2020): 215-220, Extended Data Table 2 | Contact residues of the SARS-CoV-2 RBD-ACE2 and SARS-CoV RBD-ACE2 interfaces), which is incorporated herein in its entirety. In some embodiments, the LBD of human ACE2 comprises the amino acid sequence of any one of SEQ ID NOS: 41-44, 54, and 63-82. In some embodiments, the LBD of human ACE2 comprises the amino acid sequence shown by SEQ ID NO: 56, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 56.

[0177] In some embodiments, the composition comprises at least one peptide. In some embodiments, the at least one peptide is between 15 and 30 amino acids in length (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length).

[0178] In some embodiments, the peptide is an LBD mimic peptide (e.g., a peptide that correspond to a region/segment of the LBD).

[0179] In some embodiments, the LBD mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 63, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 63. In some embodiments, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 63 and has a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 64, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 64. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 41, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 41. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 65, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 65. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 66, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 66.

[0180] In some embodiments, the LBD mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 67, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 67. In some embodiments, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 67 and has a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 42, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 42. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 68, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 68. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 69, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 69. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 70, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 70.

[0181] In some embodiments, the LBD mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 71, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 71. In some embodiments, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 71 and has a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 43, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 43. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 72, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 72. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 73, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 73. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 74, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 74.

[0182] In some embodiments, the LBD mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 75, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 75. In some embodiments, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 75 and has a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 44, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 44. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 76, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 76. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 77, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 77. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 78, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 78.

[0183] In some embodiments, the LBD mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 79, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 79. In some embodiments, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 79 and has a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 54, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 54. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 80, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 80. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 81, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 81. In a specific embodiment, the LBD mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 82, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 82.

[0184] In a specific embodiment, the composition comprises a plurality of LBD mimic peptides (e.g., peptides that correspond to different regions/segments of the LBD). In some embodiments, the composition comprises LBD mimic peptides that comprise an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82. In some embodiments, the composition comprises a plurality of peptides comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82. In some embodiments, the composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 or 25 peptides, and each peptide in the composition is selected from the group of peptides comprising an amino acid sequence as shown in SEQ ID NOS: 41-44, 54, and 63-82, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82.

[0185] Another aspect of the disclosure is directed to a composition comprising a peptide mimicking the receptor binding domain (RBD) of the S-Protein of SARS-CoV-2 (an RBD mimic peptide), wherein the peptide prevents binding of the S-protein of SARS-CoV-2 to the human ACE2 protein. In some embodiments, the full-length S-protein of SARS-CoV-2 comprises an amino acid sequence as shown in SEQ ID NO: 62 (GenBank Accession No: QHD43416.1), or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 62.

[0186] In some embodiments, the RBD-mimic peptide comprises a core amino acid sequence as shown in SEQ ID NO: 45, or an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO: 45. In a specific embodiment, the RBD-mimic peptide comprises an amino acid sequence as shown in SEQ ID NO: 45 and has a length of at least 23, 24, 25, 26, 27, 28, 29, or 30 amino acids, wherein the additional amino acids are selected from the amino acids immediate N or C terminal of the SEQ ID NO: 45 core sequence in the full length S-protein as shown by SEQ ID NO: 62. SEQ ID NO: 45 corresponds to amino acids 17-39 of SEQ ID NO: 69. In some embodiments, the RBD-mimic peptide comprises a sequence between amino acids 10-39 and 17-46 of SEQ ID NO: 62, and has a length of at least 23, 24, 25, 26, 27, 28, 29, or 30 amino acids (e.g., amino acids 10-39, 11-39, 11-40, 12-39, 12-40, 12-41, 13-39, 13-40, 13-41, 13-42, 14-39, 14-40, 14-41, 14-42, 14-43, 15-39, 15-40, 15-41, 15-42, 15-43, 15-44, 16-39, 16-40, 16-41, 16-42, 16-43, 16-44, 16-45, 17-39 (SEQ ID NO:42), 17-40, 17-41, 17-42, 17-43, 17-44, 17-45, or 17-46 of SEQ ID NO: 62).

[0187] In some embodiments, the composition comprises a plurality of LBD and/or RBD mimic peptides (e.g., peptides that correspond to different regions/segments of the LBD and/or at least one peptide that corresponds to different regions/segments of the RBD).

[0188] In some embodiments, the at least one peptide is labeled. In some embodiment the label is a fluorescent label. In some exemplary embodiments, the fluorescent label is selected from the group consisting of Alexa 405, Pacific Blue, Pacific Green, Alexa 488, Alexa 532, Alexa 546, Rhodamine Red X, Alexa 610, Alexa 647, DyLight-510-LS, Hydroxycoumarin, methoxycoumarin, Cy2, FAM, Flourescein FITC, Alexa 430, R-phycoerythrin (PE), Tamara, Cy3.5 581, Rox, Alexa fluor 568, Red 613, Texas Red, Alexa fluor 594, Alexa fluor 633, Alexa fluor 660, Alexa fluor 680, FAM (6-carboxyfluorescein), Cy 5.5, Cy 7, and Allophycocyanin

[0189] In some embodiments, the composition comprises a pharmaceutically acceptable carrier as described herein. In some embodiments, the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles (e.g., lipid-based carriers such as lipofectamine, oligofectamine, etc.) to which the at least one peptide is conjugated.

Dietary Supplements

[0190] The instant disclosure is also directed to dietary supplements compositions that are capable of supporting the immune system and helping with viral infection, such as SARS-CoV-2.

[0191] Inventors of the instant disclosure have formulated dietary supplements that comprise at least one of the compositions (comprising inhibitory oligonucleotides, inhibitory peptides, or a combination thereof) described above.

[0192] In some embodiments, a dietary supplement comprises inhibitory oligonucleotides at an amount between about 0.1 microgram (mcg) and about 1 milligram (mg) per serving of the dietary supplement. In some embodiments, a dietary supplement comprises about 0.1 mcg, 0.5 mcg, 1 mcg., 1.5 mcg, 2 mcg, 2.5 mcg, 5 mcg, 8 mcg, 9 mcg, 10 mcg, 15 mcg, 20 mcg, 25 mcg, 30 mcg, 50, mcg, 100 mcg, 150 mcg, 200 mcg, 250 mcg, 300 mcg, 350 mcg, 400 mcg, 450 mcg, 500 mcg, 550 mcg, 600 mcg, 650 mcg, 700 mcg, 750 mcg, 800 mcg, 850 mcg, 900 mcg, 950 mcg or 1000 mcg (1 mg) of inhibitory oligonucleotides per serving of the dietary supplement. As used herein, a "serving of a dietary supplement" refers to the maximum amount recommended, as appropriate, for consumption per eating occasion, or in the absence of recommendations, 1 unit (e.g., tablet, capsule, packet, teaspoonful, etc.). For example, if the directions on the label say to take 1-3 tablets with breakfast, the serving size would be 3 tablets. If the dietary supplement is a liquid, a serving may be measured in milliliters (ml) (e.g., 0.5 ml, 1 ml, 2 ml, etc.) or teaspoons.

[0193] In some embodiments, a dietary supplement comprises inhibitory peptides at an amount between about 0.1 microgram (mcg) and about 10 milligram (mg) per serving of the dietary supplement. In some embodiments, a dietary supplement comprises about 0.1 mcg, 0.5 mcg, 1 mcg., 1.5 mcg, 2 mcg, 2.5 mcg, 5 mcg, 8 mcg, 9 mcg, 10 mcg, 15 mcg, 20 mcg, 25 mcg, 30 mcg, 50, mcg, 100 mcg, 150 mcg, 200 mcg, 250 mcg, 300 mcg, 350 mcg, 400 mcg, 450 mcg, 500 mcg, 550 mcg, 600 mcg, 650 mcg, 700 mcg, 750 mcg, 800 mcg, 850 mcg, 900 mcg, 950 mcg, 1000 mcg (1 mg), 1.5 mg, 2 mg, 2.5 mg, 3 mg, 3.5 mg, 4 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 7 mg, 7.5 mg, 8 mg, 8.5 mg, 9 mg, 9.5 mg or 10 mg of inhibitory peptides per serving of the dietary supplement.

[0194] In some embodiments, the dietary supplement comprises a composition comprising a plurality of inhibitory oligonucleotides as described herein, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

[0195] In some embodiments, the dietary supplement comprises a composition as described herein comprising at least one peptide mimicking the ligand binding domain (LBD) of human ACE2 protein, wherein the at least one peptide prevents binding of the S-protein of SARS-CoV-2 to the human ACE2 protein.

[0196] In some embodiments, the dietary supplement comprises both a composition comprising a plurality of inhibitory oligonucleotides and a composition comprising at least one peptide, as described herein. In some embodiments, the dietary supplement comprises a composition comprising a plurality of inhibitory oligonucleotides and at least one peptide, as described herein.

[0197] In some embodiments, the dietary supplement the disclosure further comprises at least one additional nutrient selected from Vitamin C, Vitamin B6, Vitamin B12, Vitamin D, Zinc, polypeptides, nucleotide, L-arginine or peppermint oil.

[0198] In some embodiments, the dietary supplement of the disclosure is formulated for oral (e.g., pills, tablets, capsules, inhalers, liquid formulations), nasal (e.g., nasal sprays), ocular (e.g. eye drops), ear (e.g. ear drops), or topical (e.g., cream, lotion, shampoo, paper towels, wet wipes) application.

[0199] In some embodiments, in addition to at least one of the compositions (comprising inhibitory oligonucleotides, inhibitory peptides, or a combination thereof) described herein, an oral tablet comprises:

1) Vitamin C, 1-1000 mg

2) Vitamin B-mix (B6 and B12), 0.1-0.6 mg B6/1-2.4 mcg B12

3) Vitamin D, 1-800 IU

[0200] 4) Zinc supplement, 1-50 mg

5) Polypeptides, 1-1000 mcg

6) L-Arginine, 1-10 mg

[0201] 7) Peppermint oil, 1-2 mg.

[0202] In some embodiments, an oral drop/spray/tablet formula comprises Inhibitory Polypeptides (0.1 mcg-10 mg) and/or Inhibitory Nucleotides (0.1 mcg-1 mg) and one or more of:: N-Acetyl Cysteine (1-100 mg), L-Arginine (1-10 mg), Glutathione (0.1-10 mg), Vitamin D3 (1-5000 IU), Vitamin C (1-1000 mg), Zinc (1 mcg-50 mg), Vitamin B6 (1 mcg-800 mcg), Vitamin B12 (0.1-10 mcg), Peppermint (leaf powder or oil) (10 mcg-5 mg), DHA (Docosahexaenoic acid) or EPA (Eicosapentaenoic acid) (5 mg) and other ingredients such as sweeteners (e.g., sugar, stevia), preservatives (e.g., potassium sorbate), glycerin and/or sorbic acid (amounts in parentheses are per serving (e.g., 0.5 ml Droplet for liquid)).

[0203] In a specific embodiment, an oral drop/spray/tablet formula comprises Inhibitory Polypeptides (50 mcg) and/or Inhibitory Nucleotides (2.5 mcg), and one or more of: N-Acetyl Cysteine (25 mg), L-Arginine (2.5 mg), Glutathione (2.5 mg), Vitamin D3 (500 IU), Vitamin C (50 mg), Zinc (65 mcg), Vitamin B6 (30 mcg), Vitamin B12 (0.5 mcg), Peppermint (leaf powder or oil) (0.1 mg), DHA (Docosahexaenoic acid) or EPA (Eicosapentaenoic acid) (5 mg) and other ingredients such as sweeteners (e.g., sugar, stevia), preservatives (e.g., potassium sorbate), glycerin and/or sorbic acid (amounts in parentheses are per serving (e.g., 0.5 ml droplet)).

[0204] In some embodiments, a nasal spray formula comprises: N-Acetyl Cysteine (1-100 mg), Glutathione (0.1-10 mg), Vitamin C (1-1000 mg), Vitamin B6 (1 mcg-800 mcg), Vitamin B12 (0.1-10 mcg), Inhibitory Polypeptides (0.1 mcg-10 mg), Inhibitory Nucleotides (0.1 mcg-1 mg), Xylitol (0.1 mg-50 mg) and saline (amounts in parentheses are per serving (e.g., 0.5 ml Droplet for liquid)).

[0205] In a specific embodiment, a nasal spray formula comprises: N-Acetyl Cysteine (2.5 mg), Glutathione (1 mg), Vitamin C (5 mg), Vitamin B6 (5 mcg), Vitamin B12 (0.5 mcg), Inhibitory Polypeptides (20 mcg), Inhibitory Nucleotides (5 mcg), Xylitol (0.25 mg) and saline (amounts in parentheses are per serving (e.g., 0.5 ml Droplet for liquid)).

[0206] In some embodiments, a nasal spray formula comprises:

1) Vitamin C, 1-1000 mg

[0207] 2) Vitamin B-mix (B6 and B12), 0.1-0.6 mg/1-2.4 ug

3) Vitamin D, 1-800 IU

[0208] 4) Zinc supplement, 1-50 mg

5) Polypeptides, 1-1000 ug

6) L-Arginine, 1-10 mg

[0209] 7) Peppermint oil, 1-2 mg

[0210] In some embodiments, a dietary supplement is formulated for kids (ages between 5-12) or teens (ages between 13-19). In some embodiments, a kid/teen formula comprises Inhibitory Polypeptides (0.1 mcg-10 mg) and/or Inhibitory Nucleotides (0.1 mcg-1 mg) and one or more of Vitamin A (0.1-10 mg), Vitamin C (1-1000 mg), Vitamin D (0.1 mcg, 1 mg), Vitamin E (1 mg-100 mg), Vitamin K (0.1 mcg-1 mg), Vitamin B6 (1 mcg-5 mg), Vitamin B12 (0.1 mcg-10 mcg), Zinc (0.1 mg-50 mg) and other ingredients (calcium (1 mg-500 mg), Iron (0.1 mg-15 mg), sweetener (sugar or stevia--0.1 g-3 g) (amounts in parentheses are per serving (e.g., 1 pellet or gummy per day)). It is understood that

[0211] In a specific embodiment, a teen formula comprises: Vitamin A (1.5 mg), Vitamin C (80 mg), Vitamin D (20 mcg), Vitamin E (27 mg), Vitamin K (20 mg), Vitamin B6 (1.4 mg), Vitamin B12 (3 mcg), Inhibitory Polypeptides (200 mcg), Inhibitory Nucleotides (5 mcg), Zinc (0.5 mg) and other ingredients (calcium (120 mg), Iron (9 mg), sweetener (sugar or stevia--0.5 g) (amounts in parentheses are per serving (e.g., 1 pellet or gummy per day)).

[0212] In a specific embodiment, a kid formula comprises: Vitamin A (0.3 mg), Vitamin C (40 mg), Vitamin D (10 mcg), Vitamin E (6 mg), Vitamin K (10 mg), Vitamin B6 (0.7 mg), Vitamin B12 (2 mcg), Inhibitory Polypeptides (50 mcg), Inhibitory Nucleotides (2.5 mcg), Zinc (0.1 mg) and other ingredients (calcium (25 mg), Iron (1 mg), sweetener (sugar or stevia--0.5 g) (amounts in parentheses are per serving (e.g., 1 pellet or gummy per day)).

[0213] In some embodiments, the dietary supplement is formulated for oral (e.g., pills, tablets, capsules, inhalers, liquid formulations), nasal (e.g., nasal sprays), eye (eye drop or ointment), ear (ear drop), or topical (e.g., cream, lotion, shampoo, paper towels, wet wipes) application.

Nucleic Acid Vectors

[0214] Another aspect of the disclosure is directed to a nucleic acid vector encoding at least one inhibitory oligonucleotides disclosed herein. In some embodiments, the disclosure is directed to a nucleic acid vector encoding a plurality of inhibitory oligonucleotides disclosed herein.

[0215] In some embodiments, a nucleic acid vector encodes at least two inhibitory oligonucleotides. In some embodiments, a nucleic acid vector encodes for at least two inhibitory oligonucleotides of different types (e.g., at least two inhibitory oligonucleotides selected from an antisense oligonucleotide, a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), and a microRNA).

[0216] In some embodiments, each nucleic acid vector encodes only one inhibitory oligonucleotide, and a combination of such nucleic acid vectors are provided.

[0217] In some embodiments, the nucleic acid vectors are suitable for delivery to a subject and capable of expression of the encoded inhibitory oligonucleotides in the subject.

[0218] In some embodiments, the nucleic acid vector is an integrative vector, i.e., a vector that integrates into the genome of a host cell. In some embodiments, the nucleic acid vector is a non-integrative vector. In some embodiments, the nucleic acid vector is viral vector, e.g., an Adeno-Associated Virus (AAV)-based vector, or a lentiviral vector. In some embodiments, the nucleic acid vector is a non-viral vector.

[0219] In some embodiments, the AAV-based vector is selected from AAV1, AAV2, AAV3, VAAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13 and AAV14. In some embodiments, the AAV-derived vector is one of the vectors described in Lykken, Erik Allen, et al., Journal of Neurodevelopmental Disorders 10.1 (2018): 16, incorporated herein in its entirety.

[0220] In some embodiments, the nucleic acid vector has the ability to integrate into the genome of a cell (i.e., is an integrative vector). In some embodiments, the nucleic acid vector does not have the ability to integrate into the genome of a cell (i.e., is a non-integrative vector).

[0221] In some embodiments, the nucleic acid vector is a lentiviral vector. In some embodiments, lentiviral vector has the ability to integrate into the genome of a cell. In some embodiments, the lentiviral vector does not have the ability to integrate into the genome of a cell (e.g., as described in Philippe, Stephanie, et al. PNAS, 103.47 (2006): 17684-17689, and Lai et al., PNAS 97 (21), (2000): 11297-11302, both of which are incorporated herein in their entirety). In some embodiments, the lentiviral vector has a defective (i.e., nonfunctional) integrase (which prevents its genome integration).

Methods for Gene Therapy

[0222] Another aspect of the disclosure is directed at a method of treating or preventing a SARS-CoV-2 infection comprising expressing a plurality of inhibitory oligonucleotides in a target cell, wherein the plurality of inhibitory oligonucleotides are those disclosed herein.

[0223] In some embodiments, the target cell is a mammalian cell expressing an ACE2 receptor. In some embodiments, the target cell is a human cell. In some embodiments, the target cell is a lung epithelial cell. In some embodiments, the target cell is selected from the group consisting of a small airway epithelial cell, a bronchial/tracheal epithelial cell, and a nasal epithelial cell.

[0224] In some embodiments, the plurality of inhibitory oligonucleotides are expressed from at least one nucleic acid vector (i.e., one or more vectors) disclosed herein.

[0225] In some embodiments, the at least one vector is administered to a subject in need via oral (e.g., pills, tablets, capsules, inhalers, liquid formulations), nasal (e.g., nasal sprays), ocular (e.g., eye drops), ear (e.g., ear drops), intravenous (i.v.) injection or topical (e.g., cream, lotion, shampoo) routes.

[0226] In some embodiments, the at least one vector is selected from a viral vector, (e.g., an Adeno-Associated Virus (AAV)-based vector, or a lentiviral vector), or a non-viral vector (e.g., lipid, carbon, metal, or polymer nanoparticles), an integrative vector, or a non-integrative vector (e.g., a lentiviral vector with a defective integrase).

[0227] In some embodiments, combinations of gene therapy application include the following gene therapy vectors described herein:

1) AAV-ASO (A1 to A8): 1) AAV-U6-A1_H1-A2_CMV/EF-A3-E2A-A4; 2) AAV-U6-A5_H1-A6_CMV/EF-A7-E2A-A8.

[0228] 2) AAV-shRNA (siRNA1 to siRNA8): 1) AAV-US-shRNA1_H1-shRNA2_CMV-shRNA3_EF-shRNA4; 2) AAV-US-shRNA5_H1-shRNA6_CMV-shRNA7_EF-shRNA8.

Methods for Treatment

[0229] Another aspect of the disclosure is directed to a method for treating a SARS-CoV-2 infection comprising administering to a subject an effective amount of; 1) a composition; 2) a nucleic acid vector; 3) combination of nucleic acid vectors; or 4) a combination thereof. The compositions (comprising inhibitory oligonucleotides, peptides, or a combination thereof), nucleic acid vectors, and combination of nucleic acid vectors are described above.

Pharmaceutical Carriers and Administration

[0230] A "pharmaceutically-acceptable carrier" includes any of the standard pharmaceutical carriers. Examples of suitable carriers are well known in the art and may include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution and various wetting agents. Other carriers may include additives used in tablets, granules and capsules, and the like. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gum, glycols or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well-known conventional methods.

[0231] In some embodiments, the pharmaceutically acceptable carrier of the present disclosure comprises non-viral delivery vehicles such as nanoparticles (as described in Jin, Sha, and Kaiming Ye., (2007), Biotechnology Progress, 23.1: 32-41; Z. Liu, et al., Advanced Drug Delivery Reviews, vol. 60, no. 15, 2008, pp. 1650-1662; and Saravanakumar G. et al., Curr. Med. Chem., 19(19), 2012, pp. 3212-3229, all of which are herein incorporated by reference in their entirety). In some embodiments, the nanoparticles are lipid nanoparticles (as described in WO2017218704A1, which is incorporated by reference in its entirety). In some embodiments, the nanoparticles are lipid nanoparticles, carbon nanoparticles, metal nanoparticles (e.g., iron nanoparticles), or polymer nanoparticles.

[0232] In some embodiments, the pharmaceutically acceptable carrier of the present disclosure comprises lipid-based delivery vehicles such as liposomes (as described in U.S. Ser. No. 10/258,629B2; Gabizon, A. et al. J Control Release 1998, 53 (1-3), 275-9; Bomgaars, L. et al., J Clin. Oncol. 2004, 22 (19), 3916-21; Drummond, D. C. et al, Pharmacol. Rev. 1999, 51 (4), 691-743; Allen, T. M.; Cullis, P. R., Science 2004, 303 (5665), 1818-22, which are incorporated by reference in their entirety).

[0233] The pharmaceutical preparations of the present disclosure can be made up in any conventional form including, inter alia, (a) a solid form for oral administration such as tablets, capsules (e.g., hard or soft gelatin capsules), pills, cachets, powders, granules, and the like; (b) preparations for topical administrations such as solutions, suspensions, ointments, creams, gels, micronized powders, sprays, aerosols and the like. The pharmaceutical preparations may be sterilized and/or may contain adjuvants such as preservatives, stabilizers, wetting agents, emulsifiers, salts for varying the osmotic pressure and/or buffers.

[0234] The pharmaceutical compositions of the present disclosure can be used in liquid, solid, tablet, capsule, pill, ointment, cream, nebulized or other forms as explained below. In some embodiments, the composition of the present disclosure can be administered by different routes of administration such as oral, oronasal, parenteral or topical.

[0235] "Oral" or "peroral" administration refers to the introduction of a substance into a subject's body through or by way of the mouth and involves swallowing or transport through the oral mucosa (e.g., sublingual or buccal absorption) or both.

[0236] "Oronasal" administration refers to the introduction of a substance into a subject's body through or by way of the nose and the mouth, as would occur, for example, by placing one or more droplets in the nose. Oronasal administration involves transport processes associated with oral and intranasal administration.

[0237] "Parenteral administration" refers to the introduction of a substance into a subject's body through or by way of a route that does not include the digestive tract. Parenteral administration includes subcutaneous administration, intramuscular administration, transcutaneous administration, intradermal administration, intraperitoneal administration, intraocular administration, and intravenous administration. For the purposes of this disclosure, parenteral administration excludes administration routes that primarily involve transport of the substance through mucosal tissue in the mouth, nose, trachea, and lungs.

Abbreviations Used in this Disclosure

[0238] ASO/Antisense Oligos: A sequence of nucleotides complementary to (and hence capable of binding to) a coding sequence of a messenger RNA molecule.

FANA: 2'-deoxy-2'-fluoroarabinonucleotide (FANA) modified, a technology to induce oligos self delivery siRNA: Small interfering RNA/Short interfering RNA or Silencing RNA, siRNA therapy: The siRNA interferes with specific genes. This may be used to turn off overactive genes within the human body or turn off genes from foreign invaders, such as virtues in the body to cure disease. Antisense therapy is a form of treatment for genetic disorders or infections. When the genetic sequence of a particular gene is known to cause a particular disease, it is possible to synthesize a strand of nucleic acid (DNA, RNA or a chemical analogue) that will bind to the messenger RNA (mRNA) produced by that gene and inactivate. VS_ASO_1-FANA: ASO designed by the inventors with 2'-deoxy-T-fluoroarabinonucleotide (FANA) modified, including Table 1: oligos 1, 2, 3, 4, 5, 6, 7 and 8 VS_ASO_1-FANA-FITC: VS_ASO_1-FANA oligo 9 (FITC labeled) (Table 1) VS_ASO_2: ASO designed by the inventors including Table 2: oligo 1, 2, 3, 4, 5, 6, 7, 8 and 9 1, 2, 3, 4, 5, 6, 7 and 8 VS_ASO_2-Cy3: VS_ASO_2 oligo 9 (Cy3 labeled) (Table 2) VS_DsiRNA: siRNA designed by the inventors with DsiRNA technology including table 3: oligo 1, 2, 3, 4, 5, 6, 7 and 8 VS_DsiRNA-Cy5: VS_DsiRNA oligo 9 (Cy5 labeled) (Table 3) N-Protein: Nucleocapsid Protein of SARS-CoV-2, which is a structural protein that binds to the coronavirus RNA genome, thus creating a capsid. S-Protein: The spike protein of SARS-CoV-2, which bind to the host cell receptors, i.e., ACE2, to enter the host cells. RdRp: The RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2, which is an enzyme that catalyzes the replication of RNA from a viral RNA template. E-Protein: The envelope protein of SARS-CoV-2, which is a small membrane protein that has an important role in the assembly of virions. ORF1ab: The open reading frame for starting transcriptional genes of SARS-CoV-2, 1ab. VS-nutrition: The inventors designed nutrition with Inhibitory oligonucleotides and polypeptides. FACS: Fluorescence-activated cell sorting (a cell-based fluorescent analysis technique used in biological experiment to detect and analyze fluorescent signal in every single cell). Cycle threshold: Real-Time PCR calculation parameter used to quantify specific gene expression level. Cycle threshold refers to the cycle number in an RT-PCR reaction when the specific amplification signal rises above a predetermined level (e.g., above the background noise). As used herein, cycle threshold is a value that ranges from 0 to 40. Genes with high expression have lower cycle thresholds (e.g., between 0 and 20), and genes with low expression have high cycle thresholds (e.g., between 21 and 40). Inhibitory oligonucleotides: ASO (VS_ASO_1-FANA and VS_ASO_2), and siRNA (VS_DsiRNA) designed and produced by VS qRT-PCR: Real-Time Quantitative Reverse Transcription PCR AAV: Adeno-associated viral vector U6: Human U6 promoter H1: Human H1 promoter SV40: Simian Virus 40 promoter A1: The gene encoding the Antisense 1 (ASO1) which binds to a target sequence on the SARS-CoV-2 ORF1ab protein. A2: The gene encoding the Antisense 2 (A502) which binds to a target sequence on the SARS-CoV-2 RdRp protein A3: The gene encoding the Antisense 3 (A503) which binds to a target sequence on the SARS-CoV-2 S-protein A4: The gene encoding the Antisense 4 (A504) which binds to a target sequence on the SARS-CoV-2 N-protein A5: The gene encoding the Antisense 5 (A505) which binds to a target sequence on the SARS-CoV-2 ORF1ab protein (but in a different region from the region that ASO1 binds) A6: The gene encoding the Antisense 6 (A506) which binds to a target sequence on the SARS-CoV-2 RdRp protein (but in a different region from the region that A502 binds) A7: The gene encoding the Antisense 7 (A507) which binds to a target sequence on the SARS-CoV-2 E-protein A8: The gene encoding the Antisense 8 (A508) which binds to a target sequence on the SARS-CoV-2 N-proteins (but in a different region from the region that A504 binds) eGFP: Enhanced green fluorescent protein hGHpA: Human grown hormone poly-A ITR: The inverted terminal repeat (ITR) CMV promoter: Human cytomegalovirus (CMV) promoter EF promoter: Human elongation factor promoter E2A: 2A peptide with 19 amino acids derived from equine rhinitis A virus

TABLE-US-00001 TABLE 1 The VS_ASO_1-FANA designed, and all the ASO sequences are included in the Table; but the sequence of oligo 4 is same as olgo 9 with its fluorescent probe labeled for studying on its intercellular delivering capacity. The FANA: 2'-deoxy-2'-fluoroarabinonucleotide (FANA) modified, a technology to make the oligos with self-delivery into the mammalian cells. VS_ASO_1- Target FANA on SEQ oligos ASO_1 Sequences SARS- ID Fluo- numbers (from 5' to 3') COV-2 NO rescence 1 AAGAACCTTGCGGTA ORFlab 9 None AGCCAC 2 ATACGACATCAGTAC RdRp 10 None TAGTGC 3 ATAAGTAGGGACTGG S-protein 11 None GTCTTC 4 TGTTAATTGGAACGC N-protein 12 None CTTGTC 5 AGTTGTGCGTAATAT ORFlab 13 None CGTGCC 6 AAGTCTAGAGCTATG RdRp 14 None TAAGTT 7 TATTAACGTACCTGT E-protein 15 None CTCTTC 8 TGTCTGATTAGTTCC N-protein 16 None TGGTCC 9 TGTTAATTGGAACGC N-protein 12 FITC CTTGTC

TABLE-US-00002 TABLE 2 The VS_ASO_2 designed, and all the ASO sequences are included in the Table, which are the same DNA sequences as VS_ASO_1, but their structures were modified by another different technique (see Table 3). The sequence of oligo 4 is same as oligo 9 with its fluorescent probe labeled for studying on its intercellular delivering capacity. Target VS_ASO_2 on SEQ oligos ASO_2 sequences SARS- ID Fluo- numbers (from 5' to 3') COV-2 NO rescence 1 AAGAACCTTGCGGTA ORFlab 9 None AGCCAC 2 ATACGACATCAGTAC RdRp 10 None TAGTGC 3 ATAAGTAGGGACTGG S-protein 11 None GTCTTC 4 TGTTAATTGGAACGC N-protein 12 None CTTGTC 5 AGTTGTGCGTAATAT ORFlab 13 None CGTGCC 6 AAGTCTAGAGCTATG RdRp 14 None TAAGTT 7 TATTAACGTACCTGT E-protein 15 None CTCTTC 8 TGTCTGATTAGTTCC N-protein 16 None TGGTCC 9 TGTTAATTGGAACGC N-protein 12 Cy3 CTTGTC

TABLE-US-00003 TABLE 3 The structure of VS_ASO_2 molecules modified: The ASO molecules modified as shown: (1) *: Phosphorothioate-bond in all base pairs to provide resistance to exonuclease degradation; (2) m: 2' O-Methyl RNA modified in those pb, to increases both nuclease stability and affinity of the antisense oligo to the target RNA; (3) 5-methyl dC in 5' end of the oligos (ASO), it can also reduce the chance of adverse immune response to Toll-like receptor 9 (TLR9). The middle region is a "gapmer" designed. /5Me-dC/mA*mA*mG*mA*mA*C*C*T*T*G*C*G*G*T*A*mA* mG*mC*mC*mA*C (SEQ ID NO: 33) Oligo-1 (Table 2) /5Me-dC/mA*mU*mA*mC*mG*A*C*A*T*C*A*G*T*A*C*mU* mA*mG*mU*mG*C (SEQ ID NO: 34) Oligo-2 (Table 2) /5Me-dC/mA*mU*mA*mA*mG*T*A*G*G*G*A*C*T*G*G*mG* mU*mC*mU*mU*C (SEQ ID NO: 35) Oligo-3 (Table 2) /5Me-dC/mU*mG*mU*mU*mA*A*T*T*G*G*A*A*C*G*C*mC* mU*mU*mG*T*C (SEQ ID NO: 36) Oligo-4 (Table 2) /5Me-dC/mA*mG*mU*mU*mG*T*G*C*G*T*A*A*T*A*T*mC* mG*mU*mG*mC*C (SEQ ID NO: 37) Oligo-5 (Table 2) /5Me-dC/mA*mA*mG*mU*mC*T*A*G*A*G*C*T*A*T*G*mU* mA*mA*mG*mU*T (SEQ ID NO: 38) Oligo-6 (Table 2) /5Me-dC/mU*mA*mU*mU*mA*A*C*G*T*A*C*C*T*G*T*mC* mU*mC*mU*mU*C (SEQ ID NO: 39) Oligo-7 (Table 2) /5Me-dC/mU*mG*mU*mC*mU*G*A*T*T*A*G*T*T*C*C*mU* mG*mG*mU*mC*C (SEQ ID NO: 40) Oligo-8 (Table 2)

TABLE-US-00004 TABLE 4 The VS_DsiRNA-Cy5 designed, all their sequences shown in the table. The sequence of oligo 4 is same as oligo 9 with its fluorescent probe labeled for studying on its intercellular delivering capacity. The "r"s in SEQ ID NOS: 17-32 in the table below denote "ribonucleic acid" nucleotides in the sequences. If there is no "r" before a nucleotide, that nucleotide is a deoxyribonucleic acid. VS_DsiRNA SEQ ID oligos # Sequences (from 5' to 3') Target NO: Tag 1 5' rGrCrCrUrUrGrUrCrCrCrUrGrGrUrUrUrCrArArCrGrArGAA 3' ORFlab 17 None 5'rUrUrCrUrCrGrUrUrGrArArArCrCrArGrGrGrArCrArArGrGrCrUrC3' 18 2 5' rCrArGrCrUrGrArUrGrCrArCrArArUrCrGrUrUrUrUrUrAAA 3' RdRp 19 None 5'rUrUrUrArArArArArCrGrArUrUrGrUrGrCrArUrCrArGrCrUrGrArC3' 20 3 5' rCrUrArGrUrCrArGrUrGrUrGrUrUrArArUrCrUrUrArCrAAC 3' S-protein 21 None 5'rGrUrUrGrUrArArGrArUrUrArArCrArCrArCrUrGrArCrUrArGrArG3' 22 4 5' rArArArCrUrArArArArUrGrUrCrUrGrArUrArArUrGrGrACC 3' N-protein 23 None 5'rGrGrUrCrCrArUrUrArUrCrArGrArCrArUrUrUrUrArGrUrUrUrGrU3' 24 5 5' rGrGrUrArGrUrUrArUrArCrUrArArUrGrArCrArArArGrCTT 3' ORFlab 25 None 5'rArArGrCrUrUrUrGrUrCrArUrUrArGrUrArUrArArCrUrArCrCrArC3' 26 6 5' rCrUrUrCrUrGrGrUrArArUrCrUrArUrUrArCrUrArGrArUAA 3' RdRp 27 None 5'rUrUrArUrCrUrArGrUrArArUrArGrArUrUrArCrCrArGrArArGrCrA3' 28 7 5' rGrGrArArGrArGrArCrArGrGrUrArCrGrUrUrArArUrArGTT 3' E-protein 29 None 5'rArArCrUrArUrUrArArCrGrUrArCrCrUrGrUrCrUrCrUrUrCrCrGrA3' 30 8 5' rGrGrCrCrArArArCrUrGrUrCrArCrUrArArGrArArArUrCTG 3' N-protein 31 None 5'rCrArGrArUrUrUrCrUrUrArGrUrGrArCrArGrUrUrUrGrGrCrCrUrU3' 32 9 5' rArArArCrUrArArArArUrGrUrCrUrGrArUrArArUrGrGrACC 3' N-protein 23 Cy5 5'rGrGrUrCrCrArUrUrArUrCrArGrArCrArUrUrUrUrArGrUrUrUrGrU3' 24

TABLE-US-00005 TABLE 5 Sequences of VS-Peptides 1-6. Name Sequence SEQ ID NO Peptide 1 EEQAKTFLDKFNHEAEDLFYQSS 41 Peptide 2 FLKEQSTLAQMYPLQEIQNL 42 Peptide 3 LPNMTQGFWENSMLTDPGNVQ 43 Peptide 4 HPTAWDLGKGDFRILMCTKV 44 Peptide 5 MAYAAQPFLLRNGANEGFHEA 54 Peptide 6 GNYNYLYRLFRKSNLKPFERDIS 45

[0239] The sequences for the peptides of 1, 2, 3, 4 and 5 were designed based on the RBD amino acids of human ACE2, a receptor for COVID-19 entering the cells (see FIG. 47 through FIGS. 52A-52H); which are capable to bind on the S-protein of COVID-19, in order to protect the human ACE 2 receptors by blocking the binding sites of the S-protein to elicit their therapeutic effects. However, the AA sequences of peptide 6 was designed to mimic the BD of S-Protein (see, FIG. 49), which was labelled by FITC; this peptide 5 could also be served as a pre-blocker on the RBD of ACE2 to prevent the COVID-19 infection as well.

TABLE-US-00006 TABLE 6 Alternative peptides based on VS Peptide 1-5 SEQ Name Length Sequence ID NO VS-Peptide 1 23 EEQAKTFLDKFNHEAED 41 LFYQSS VS-Peptide 1-a 15 TFLDKFNHEAEDLFY 63 VS-Peptide 1-b 20 QAKTFLDKFNHEAEDLF 64 YQS VS-Peptide 1-c 25 TIEEQAKTFLDKFNHEA 65 EDLFYQSSL VS-Peptide 1-d 30 QSTIEEQAKTFLDKFNH 66 EAEDLFYQSSLAS VS-Peptide 2 20 FLKEQSTLAQMYPLQEI 42 QNL VS-Peptide 2-a 15 EQSTLAQMYPLQEIQ 67 VS-Peptide 2-b 20 LKEQSTLAQMYPLQEIQ 68 NLT VS-Peptide 2-c 25 WSAFLKEQSTLAQMYPL 69 QEIQNLTV VS-Peptide 2-d 30 DKWSAFLKEQSTLAQMY 70 PLQEIQNLTVKLQ VS-Peptide 3 21 LPNMTQGFWENSMLTDP 43 GNVQ VS-Peptide 3-a 15 TQGFW ENSML TDPGN 71 VS-Peptide 3-b 20 LPNMT QGFWE NSMLT 72 DPGNV VS-Peptide 3-c 25 VGLPN MTQGF WENSM 73 LTDPG NVQKA VS-Peptide 3-d 30 VSVGL PNMTQ GFWEN 74 SMLTD PGNVQ KAVCH VS-Peptide 4 20 HPTAWDLGKGDFRILMC 44 TKV VS-Peptide 4-a 15 WDLGKGDFRILMCTK 75 VS-Peptide 4-b 20 PTAWDLGKGDFRILMCT 76 KVT VS-Peptide 4-c 25 VCHPTAWDLGKGDFRIL 77 MCTKVTMD VS-Peptide 4-d 30 KAVCHPTAWDLGKGDFR 78 ILMCTKVTMDDFL VS-Peptide 5 21 MAYAAQPFLLRNGANEG 54 FHEA VS-Peptide 5-a 15 AQPFLLRNGANEGFH 79 VS-Peptide 5-b 20 AYAAQPFLLRNGANEGF 80 HEA VS-Peptide 5-c 25 YDMAYAAQPFLLRNGAN 81 EGFHEAVG VS-Peptide 5-d 30 IQYDMAYAAQPFLLRNG 82 ANEGFHEAVGEIMS

[0240] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0241] The present disclosure is further illustrated by the following non-limiting examples.

EXAMPLES

Example 1: Materials and Methods

Tissue Culture

[0242] Human Normal Primary Small Airway Epithelial Cells (HSAEC) (ATCC Number: PCS-301-010) and Human Normal Primary Bronchial/Tracheal Epithelial Cells (HBTEC) (ATCC Number: PCS-300-010) were purchased from American Type Culture Collection (ATCC) (Manassas, Va.). Human Nasal Epithelial Cells (HNEpC) were purchased from PromoCell (Catalog Number: C-12621) (Heidelberg, Germany). HSAEC and HBTEC were grown Airway Epithelial Cell Basal Medium supplement with Bronchial Epithelial Cell Growth Kit (ATCC, PCS-300-030 and PCS-300-040). HNEpC were grown in Airway/Nasal Epithelial Cell Grow Medium (PromoCell, C-21060)). Cells were maintained in a humidified atmosphere with 5% CO.sub.2 at 37.degree. C.

RNAi, ASO Delivery

Transfection

[0243] HSAEC, HBTEC and HNEpC were seeded into 6-well tissue-culture plate (VWR-USA, 10062-892), and transfected with lipofectamine 3000 (Thermo Fisher Scientific, L3000001) per manufacturer's protocol.

[0244] "Untreated": medium

[0245] "Treated": SARS-CoV-2 viral protein expression vectors (S-protein, E-protein, N-protein, RdRp and ORF1ab) or SARS-CoV-2 viral protein expression vectors (S-protein, E-protein, N-protein, RdRp and ORF1ab)+VS-vector.

"Overexpression vector": N-protein: MC_0101137, GenScript, S-protein: MC_0101080, GenScript

E-protein: MC_0101135, GenScript

ORF1ab: MC_0101079, GenScript

RdRP: MC_0101076, GenScript"

Arginine Delivery

[0246] HSAEC, HBTEC and HNEpC were seeded into tissue-culture plate (VWR-USA, 10062-892). The cells were either left untreated, or treated with the following mixture: 10 .mu.L arginine (200 mg/mL), SARS-CoV-2 N, S and E protein overexpression vector, and VS-vector (VS-RNAi or VS-ASO).

[0247] "Untreated": medium

[0248] "Treated": COVID-19 viral protein expression vectors (S-protein, E-protein, N-protein, RdRp and ORF1ab) or COVID-19 viral protein expression vectors (S-protein, E-protein, N-protein, RdRp and ORF1ab)+VS-vector.

[0249] "Overexpression vector": N-protein: MC_0101137, GenScript; S-protein: MC_0101080, GenScript; E-protein: MC_0101135, GenScript; ORF1ab: MC_0101079, GenScript; RdRP: MC_0101076, GenScript.

Confocal Microscopy

[0250] Untreated or VS-vector treated HSAEC, HBTEC and HNEpC were washed twice in phosphate buffered solution (PBS, pH 7.4). The cells were then observed under confocal microscope (BD pathway 855) with four channels: transmitted, FITC (excitation filter: 488/10, emission: 515LP), Cy3 (excitation filter: 548/20, emission filter: 84101) and Cy5 (excitation filter: 635/20, emission filter: 84101) respectively.

Western Blot Analysis

[0251] Untreated or VS-vector treated HSAEC, HBTEC and HNEpC were washed twice in phosphate buffered solution (PBS, pH 7.4), scraped into 15-mL conical tubes, and centrifuged at 1,000.times.g at 4.degree. C. for 5 minutes. Cell extracts were prepared by lysis in NET buffer [50 mmol/L Tris-HCl, (pH 7.4), 150 mmol/L NaCl, 0.1% NP40, 1 mmol/L EDTA, 0.25% gelatin, 0.02% sodium azide, 1 mmol/L phenylmethylsulfonyl fluoride, and 1% aprotinin]. The lysates were centrifuged at 15,000.times.g for 30 minutes at 4.degree. C. The protein concentrations in the supernatant fractions were determined by Bicinchoninic Acid assay (Thermo Fisher Scientific, 23255).

[0252] Ten micrograms of total HSAEC protein extracts were resolved by 10% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked with 5% nonfat dry milk in PBS/Tween 20 (0.05%) for 1 hour, followed by overnight incubation with 1 .mu.g/mL anti-COVID19-Spike-protein antibody (ProSci, 3223) in 10% milk/PBS-T and 1 .mu.g/mL anti-COVID19-N-protein antibody (ProSci, 3857) in 10% milk/PBS-T. Loading control antibody used rabbit anti-GAPDH antibody (Novus Biologicals, NB100-56875) with 1:1000 dilution or mouse anti-GAPDH antibody (Novus Biologicals, NBP2-27103). Secondary antibody: rabbit IgG HRP-conjugated Antibody (R&D System, HAF008) with 1:1000 dilution and mouse IgG HRP-conjugated Antibody (R&D System, HAF007) with 1:1000 dilution. The detection was done using horseradish peroxidase-labeled secondary antibodies and enhanced chemiluminescence detection reagent.

S-Protein, N-Protein, E-Protein, ORF1ab and RdRP Detection by Quantitative Real-Time PCR (qRT-PCR)

[0253] Untreated or treated HSAEC, HBTEC and HNEpC were washed twice in PBS. RNA was extracted from cells per manufacturer's protocol using Qiagen RNA extraction kit (Qiagen, 74104). One-step RT-PCR was conducted by StepOne Real-Time PCR System (Thermo Fisher Scientific, CA): 5 .mu.l extracted RNA (300 ng/.mu.l) samples were added to a mixture of 6.25 .mu.l Taqman-Master-Mix (Thermo Fisher Scientific, 4444432), 11.25 .mu.l PCR-grade water (Thermo Fisher Scientific, AM9916) and 1.25 FAM Probe (information as following):

For SARS-CoV-2 S-protein: Thermo Fisher Scientific, A47532

For SARS-CoV-2 N-protein: Thermo Fisher Scientific, A47532

For SARS-CoV-2 ORF1ab: Thermo Fisher Scientific, A47532

[0254] For RNAse P (internal control): Thermo Fisher Scientific, A47532 For SARS-CoV-2 E protein: GenScript, E_Sarbeco_P1

TABLE-US-00007 (SEQ ID NO: 53) (ACACTAGCCATCCTTACTGCGCTTCG).

Apoptosis Analysis by qRT-PCR

[0255] Untreated or treated HSAEC, HBTEC and HNEpC were washed twice in PBS. RNA was extracted from cells per manufacturer's protocol using Qiagen RNA extraction kit (Qiagen, 74104). Total RNA was reverse-transcribed to cDNA according to manufacturer's protocol (Thermo Fisher Scientific, 18091050). The cDNA concentration was determined by NanoDrop 1000 (Thermo Scientific). Real-Time PCR was conducted by StepOne Real-Time PCR System (Thermo Fisher Scientific, CA): 3 .mu.l cDNA (300 ng/ul) samples were added to a mixture of 10 .mu.l Taqman-Master-Mix (Thermo Fisher Scientific, 4444557), 5 .mu.l of PCR-grade water (Thermo Fisher Scientific, AM9916) and 2 .mu.l FAM Probe (information as following):

For BCL2: Thermo Fisher Scientific, Hs04986394_s1

For BAX: Thermo Fisher Scientific, Hs00180269_m1

[0256] For GAPDH (internal control): Hs02786624_g1

Fluorescence Signal Detection by Flow Cytometry

[0257] Untreated or treated HSAEC, HBTEC and HNEpC were washed twice in PBS (pH 7.4), scraped into 15-mL conical tubes, and centrifuged at 1,000.times.g at 4.degree. C. for 5 minutes. Cells were resuspended into 0.5 mL PBS/BSA (0.5%). Fluorescence signal detection was carried out on BD FacsCalibur (BD Biosciences) with excitation laser (485 nm, 635 nm) and emission channel (530/30, 585/42, 670/LP and 661/16). 10,000 cells (or event) were collected for analysis.

Cytotoxicity by MTT Assay

[0258] Cells were seeded in 96-well plates (100 .mu.L per well of 1.times.10.sup.5 cells/mL). The cells were left undisturbed until they adhered to the plate. The cells were then treated with culture medium (control) or VS-vectors. After the cells were incubated with MTT dye (Sigma) for another 4 h at 37.degree. C., the medium was removed and the crystal formazan dye was solubilized in 150 .mu.L dimethyl sulphoxide (DMSO; Sigma). Absorbance was measured at 570 nm by using the Bio-Tek Powerwave X microplate reader (BioTek Instruments).

Cell Cycle and Cell Apoptosis Rate Analysis

[0259] HSAEC, HTBEC and HNEpC were seeded in 25-mL culture flasks at a density of 5.times.10.sup.5 cell/mL and cultured in recommended medium until the cells adhered to the flasks. The cells were then treated with culture medium (control) or VS-vector for 24 h. Cells were harvested by scrapping, and aliquots of 1.times.10.sup.6 cell/mL were prepared for analysis. The cells were washed with PBS twice (centrifuged at 300 g with 5 min and resuspended in PBS), fixed with ice-chilled 70% ethanol for 24 h, and then treated with 20 mg/L RNase for 30 min. Propidium iodide (Sigma) was added to a final concentration of 20 mg/L. DNA contents of the samples were analyzed on a BD FacsCalibur (BD Biosciences), and the number of cells in every phase was calculated using FlowJo.

VS-Peptide In Vitro Fluorescent Observation and Detection

[0260] HSAEC, HBTEC and HNEpC were seeded into 24-well tissue-culture plate (VWR-USA, 10062-896), and transfected (Thermo Fisher Scientific, L3000001) with CMV-human ACE2-vector by lipofectamine 3000 (Thermo Fisher Scientific, L3000001) per manufacturer's protocol. After 24 hours, peptides were added into 24-well tissue-culture plate as follows:

Untreated: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-1-dosage-1: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-1 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-1-dosage-2: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-1 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-2-dosage-1: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-2 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-2-dosage-2: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-2 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-3-dosage-1: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-3 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-3-dosage-2: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-3 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-4-dosage-1: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-4 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-4-dosage-2: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-4 (final concentration: 1 ug per 1.times.10.sup.5 cells) VS-peptide-combination: SARS-CoV-2-S-Protein-peptide-FITC (final concentration: 1 ug per 1.times.10.sup.5 cells)+VS-peptide-1+VS-peptide-2+VS-peptide-3+VS-peptide-4 (final concentration: 1 ug per 1.times.10.sup.5 cells)

[0261] Observed under confocal microscope (BD pathway 855) with channel: transmitted, FITC (excitation: 488/10, emission: 515LP) and detected FITC intensity via fluorescent microplate reader (BIO-TEK Synergy HT) in each well.

Inhibitions of Nucleotides on the Viral Infections from Both Pseudo-Viruses of Wild-Type and Mutant Forms of the COVID-19

[0262] 5000 HELA cells were seeded per well in 96-well-plate. Co-transfections of ACE-2 (50 ng) and nucleosides (500 nM). For control-1, transfection of ACE-2 (50 ng) in the cells, and the scramble nucleotides (500 nM) was added.

[0263] 24 hr-post transfection, add 4 ul of the wild-type virus of SARS-CoV-2 Spike pseudo-typed in the lentivirus, (WV: titer 10.sup.5 TU/ml, eGFP reporter with catalog: 79981, BPS Bioscience) or/and 4 ul of the mutant virus of SARS-CoV-2 Spike (MV: B.1.1.7 mutant variant virus from UK/England) pseudo-typed in the lentivirus (titer 10.sup.5 TU/ml, eGFP reporter with catalog: 78158, BPS Bioscience), and the polybrene was added into each well, as its final concentration of 5 ug/ml.

[0264] Observation on the GFP expression in the transduced cells under the confocal microscope in 48-72 hrs after viruses added into the wells.

ELISA Assays

[0265] A 96 well dish was coated with the ACE2 protein (Cat #: 10-014, ProSci, Inc) at the concentration of 10 ng/well at 4.degree. C. overnight. After overnight, washed 3 times (400 ul/well/time) by 1.times. washing buffer (Cat #: DY008, R&D System). Later, it was blocked by 3% BSA for 1 hr RT, and washing 3 times (400 ul/well/time) by 1.times. washing buffer (Cat #: DY008, R&D System). VS Peptides of 1 to 4 (see Table 1) were diluted into two concentrations of 100 ug/well and 50 ug/well, and then mixed with the Receptor-Binding Domain (RBD) of Covid-19 viral Spike recombinant protein (S-RBD) (Cat #: 10-303, ProSci, Inc) at the concentration of 3000 ng/well for 30 min at 37.degree. C. before adding onto each well. After adding the mixture solution of peptides and S-RBD, the specific anti-S-RBD antibody (Cat #: 9087, ProSci, Inc) was added onto each well at a concentration of 1000 ng/well at 37.degree. C. for 30 min at a tissue-culture incubator. After the incubation, wells were washed by 1.times. washing buffer for 3 times (300 ul/well/time). The secondary HRP (Horseradish Peroxidase) antibody (Cat #: HAF008, R&D System), that binds to the primary antibody, was then added onto each well (1:30000) 100 ul/well for 30 min in RT. After the incubation, the well was washed by 1.times. washing buffer for 3 times (300 ul/well/time) (Cat #: DY008, R&D System). 100 ul color substrate (Cat #: DY008, R&D System) was added to each well for 20 min at RT to show the color. Finally, 50 ul of stop solution was added to each well (Cat #: DY008, R&D System). The 96-well plate was placed inside the Microplate Reader (Model: Bio-TEK Synergy HT) and read the wavelength signal autumnally by the computer program. The signals of intensities from the "yellow-like" color, called as TMB signals, were scanned and read at a wave-length of 450 nm by the Microplate Reader, and recorded and calculated by its computer software automatedly (see the FIG. 1S: the table at the left-bottom), the 570 nm was measured as the background signals that was subtracted out from the final data analysis.

Example 2: VS-Nucleotide Treatment of Human Primary Small Airway Epithelial Cells (HSAEC) Transfected with COVID-19 Viral Proteins

[0266] FIG. 1 shows experimental designs of investigating on delivery capable and therapeutic effects of ASO(s) and siRNA on human primary small airway epithelial cells transfected with viral protein of SARS-CoV-2. The human lung small airway epithelial cells were cultured in the 24 well-dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were into the cells for 24-48 hours before analysis with fluorescent microscope. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 label shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 label shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of both COVID-19 N-protein and the VS_ASO_1-FANA using lipofectamine reagent, A5&A6: Overexpression of both COVID-19 N-protein and the VS_ASO_1-FANA without any regents; B1&B2: No treatment as control, B3&B4: Overexpression of both COVID-19 N-protein and the VS_DsiRNA-Cy5 using lipofectamine reagent, B5&B6: Overexpression of both COVID-19 N-protein and the VS_DsiRNA-Cy5 using Poly-arginine (5 .mu.l/well) only; C1&C2: No treatment as control, C3&C4: Overexpression of both COVID-19 N-protein and the VS_ASO_2-Cy3 using lipofectamine reagent, C5&C6: Overexpression of both COVID-19 N-protein and the VS_ASO_2-Cy3 using Poly-arginine (5 .mu.l/well) only.

[0267] FIGS. 2A-2F show microscopic analysis showing entry of VS_ASO_1-FANA-FITC into the primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the FITC florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well A3 & A4 (as shown in FIG. 1), (B) and (E) were taken in well A5 & A6 (as shown in FIG. 1), and (C) and (F) were taken in well A1 & A2 (as shown in FIG. 1).

[0268] FIGS. 3A-3F show microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung small airway epithermal cells (10.times.). (A)-(C) were captured under the FITC florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well A3 & A4 (as shown in FIG. 1), (B) and (E) were taken in well A5 & A6 (as shown in FIG. 1), and (C) and (F) were taken in well A1 & A2 (as shown in FIG. 1).

[0269] FIGS. 4A-4F show microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 1), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 1), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 1).

[0270] FIGS. 5A-5F show microscopic analysis entry of VS_DsiRNA-Cy5 into primary human lung small airway epithermal cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright field images (10.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 1), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 1), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 1).

[0271] FIGS. 6A-6F show microscopic analysis entry of VS_ASO_2-Cy3 into primary human lung small airway epithermal cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well C3 & C4 (as shown in FIG. 1), (B) and (E) were taken in well C5 & C6 (as shown in FIG. 1), and (C) and (F) were taken in well C1 & C2 (as shown in FIG. 1).

[0272] FIGS. 7A-7F show microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung small airway epithermal cells (10.times.). The (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (10.times.). (A) and (D) were taken in well C3 & C4 (as shown in FIG. 1), (B) and (E) were taken in well C5 & C6 (as shown in FIG. 1), and (C) and (F) were taken in well C1 & C2 (as shown in FIG. 1).

Example 3: Intercellular Delivery of Inhibitory Oligonucleotides in Human Primary Lung Small Airway Epithelial Cells (HSAEC)

[0273] FIG. 8 shows experimental design for FACS detection of intercellular delivery of oligos in the human primary lung small airway epithelial cells (HSAEC). The human lung small airway epithelial cells were cultured in the 6-well dish, and the genes encoding the viral proteins of SARS-CoV-2 were delivered by transfection or arginine delivery. The siRNA or ASO were added into the cells for 24-48 hours before analysis with FACS. The VS_ASO_1-FANA-FITC designed with labeled with FITC shown in the Table 1, and VS_ASO_2-Cy3 with modification shown in the Table 2; and VS_DsiRNA-Cy5 shown in Table 3. A1: No treatment as control; A2: Overexpression of N-protein+VS_ASO_1-FANA-FITC without lipofectamine or arginine; A3: Overexpression of N-protein+VS_DsiRNA-Cy5 with lipofectamine; B1: Overexpression of N-protein+VS_DsiRNA-Cy5 with Arginine (10 .mu.l/well); B2: Overexpression of N-protein+VS_ASO_2-Cy3 with lipofectamine; B3: Overexpression of N-protein+VS_ASO_2-Cy3 with Arginine (10 .mu.l/well).

[0274] FIGS. 9A-9C show FACS analysis of in vitro treatment with VS_ASO_1-FANA-FITC without lipofectamine or Arginine in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_ASO_1-FANA-FITC (excitation: 488 nm, emission band pass filter: 530/30, Total event: 20,000). (A) no-treatment control, (B) VS_ASO_1-FANA-FITC and (C) Merge. The FACS data indicate that the intensities of FITC signals were significantly stronger with shifting to the right (B: FL1-H:FITC) when compared with the control (A) in the cells after treated with the VS_ASO_1-FANA-FITC without lipofectamine or Arginine reagents (B). The (C) is the merged figures of (A) and (B).

[0275] FIGS. 10A-10B show FACS analysis of in vitro treatment with VS_DsiRNA-Cy5 with lipofectamine (A) or Arginine only (B) in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_DsiRNA-Cy5 (excitation: 635 nm, emission band pass filter: 661/16, Total event: 20,000). Left to right panel: no-treatment control, VS_DsiRNA-Cy5 and merge. The FACS data indicates that the intensities of Cy5 signals were significantly higher with shifting to the right (middle panel: FL4-H:Cy5) in both of panel (A) and (B), it also shown that there are more cells with intercellular signals of the oligos in the presence of 10 .mu.l/well Arginine (panel B) when compared with the lipofectamine (panel A).

[0276] FIGS. 11A-11B show FACS analysis of in vitro treatment with VS_ASO_2-Cy3 with lipofectamine (A) or Arginine only (B) in human primary lung small airway epithelial cells (HSAEC). FACS analysis of HSAEC treated by VS_VS_ASO-Cy3 (excitation: 488 nm, emission band pass filter: 585/42, Total event: 20,000). Left to right panel: no-treatment control, VS_ASO_2-Cy3 and merge. The FACS data indicates that the intensities of Cy3 signals were significantly higher with shifting to the right (middle panel: FL2-H:Cy3) in both of (A) and (B), it also shown that there are more cells with intercellular signals of the oligos in the presence of 10 .mu.l/well Arginine (panel B) when compared with the lipofectamine (panel A).

Example 4: SARS-CoV-2 N-Protein Expression is Reduced in Human Primary Lung Small Airway Epithelial Cells (HSAEC) after Treatment by VS-Oligonucleotides

[0277] FIG. 12 shows the experimental design for detecting SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human lung small airway epithelial cells were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 modification shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 modification shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA_Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without any reagents.

[0278] FIG. 13 shows detection of SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with VS-Nucleotides. Significant down-regulation was observed: about 5-fold in group treated by VS_DsiRNA-Cy5 oligos (p<0.005); about 1.5 fold in the group treated by VS_ASO_2-cy3 oligo (p<0.01), and about 6 fold in the group treated by the VS_ASO_1-FANA-FITC oligo (p<0.005); when compared with the group with SARS-CoV-2 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0279] FIG. 14 shows experimental design for detection of SARS-CoV-2 S-protein expressed in the primary human lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 24 well-dish, and the cells were transfected with the genes encoding the viral protein (S-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 3) designed shown in the Table 1, and VS_ASO_2 (oligo 3) shown in the Table 2; and VS_DsiRNA (oligo 3) shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 S-protein, A5&A6: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA (oligo 3) with lipofectamine, B1&B2: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA (oligo 3) with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2 (oligo 3) with lipofectamine, B5&B6: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2 (oligo 3) with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 S-protein+/treated by VS_ASO_1-FANA (oligo 3) without any reagents.

[0280] FIG. 15 shows detection of SARS-CoV-2 S-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with VS-Nucleotides. Significant down-regulation was observed: about 4 fold in group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.8 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 4 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 4 fold in the in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.5 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 S-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0281] FIG. 16 shows the experimental design for detection of both of SARS-CoV-2 ORF1ab and RdRp expressed in the primary human lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 24-well dish, and the cells were transfected with the genes encoding both ORF1ab and RdRp of SARS-CoV-2 viral protein. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 1, 2, 5 and 6) designed shown in the Table 1, and VS_ASO_2 (oligo 1, 2, 5 and 6) shown in the Table 2; and the VS_DsiRNA (oligo 1, 2, 5 and 6) shown in Table 4. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 viral genes encoding both ORF1ab and RdRp, A5&A6: Overexpression of both ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with lipofectamine, B1&B2: Overexpression of both ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), B3&B4: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with lipofectamine, B5&B6: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), C1&C2: Overexpression of both ORF1ab and RdRp+/treated by VS_ASO_1-FANA (oligo 1, 2, 5 and 6) without any reagents.

[0282] FIG. 17 shows detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary lung small airway epithelial cells (HSAEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 3.5 fold in group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.2 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 4.5 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 2.1 fold in the in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.8 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 ORF1ab and RdRp overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

Example 5: SARS-CoV-2 N-Protein Levels are Decreased in Human Primary Lung Small Airway Epithelial Cells (HSAEC) after Treatment by Inhibitory Oligonucleotides

[0283] FIG. 18 shows the experimental design for detection of SARS-CoV-2 N-protein expressed in the primary human lung small airway epithelial cells (HSAEC) by Western Blot after treatment. The human primary lung small airway epithelial cells (HSAEC) were cultured in the 6-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with Western Blot. The VS_ASO_2 (oligo 4 & 8) shown in the Table 2; and VS_DsiRNA (oligo 4 & 8) shown in Table 4. A1: No treatment as control, A2: Overexpression of COVID-19 N-protein, A3: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA (oligo 4 and 8) with lipofectamine, B1: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2 (oligo 4 and 8) with lipofectamine.

[0284] FIG. 19 shows detection of SARS-CoV-2 N-protein expressed in the human primary lung small airway epithelial cells (HSAEC) by Western Blot after treatment with inhibitory oligonucleotides: Lane-1: no treatment; Lane-2: SARS-CoV-2 N-protein overexpression (OE); Lane-3: SARS-CoV-2 N-protein OE+/treated by VS_DsiRNA (oligo 4 & 8); Lane-4: SARS-CoV-2 N-protein OE+/treated by the VS_ASO_2 (oligo 4 & 8). The 10 ug total cell-lysis were added into each well. primary antibody: 1 .mu.g/mL anti-SARS-CoV-2-N-protein antibody (ProSci, 3857) and anti-GAPDH antibody (Novus Biologicals, NBP2-27103) with 1:1000 dilution. The secondary antibody: goat-anti-rabbit HRP-conjugated Antibody (R&D System, HAF008) with 1:1000 dilution and goat-anti-mouse IgG HRP-conjugated Antibody (R&D System, HAF007) with 1:1000 dilution. The detection was done using horseradish peroxidase-labeled secondary antibodies and enhanced chemiluminescence detection reagent.

Example 6: Inhibitory Oligonucleotide Treatment of Human Primary Bronchial/Tracheal Epithelial (HBTEC) Cells Transfected with Viral Proteins of SARS-CoV-2

[0285] FIG. 20 shows experiments designed for investigating cell penetration and therapeutic effects of VS-Nucleotides (inhibitory oligonucleotides) on human primary bronchial/tracheal epithelial cells (HBTEC) transfected with viral protein of SARS-CoV-2 after treatment. The primary human bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were added into the cells for 24-48 hours before analysis with fluorescent microscope. VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 label shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 label shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA-FITC without lipofectamine or/and Poly-arginine, B1&B2: No treatment as control, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNAi-Cy5 with arginine (5 .mu.l/well), C1&C2: No treatment as control, C3&C4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, C5&C6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with arginine (5 .mu.l/well).

[0286] FIGS. 21A-21D shows microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung bronchial/tracheal epithelial cells (20.times.). (A)-(B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 20), (B) and (E) were taken in well A3 & A4 (as shown in FIG. 20), and (B) and (D) were taken in well A1 & A2 (as shown in FIG. 20).

[0287] FIGS. 22A-22D shows microscopic analysis showing entry of VS_ASO_1-FANA-FITC into primary human lung bronchial/tracheal epithelial cells (10.times.). (A)-(B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (10.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 20), (B) and (E) were taken in well A3 & A4 (as shown in FIG. 20), and (B) and (D) were taken in well A1 & A2 (as shown in FIG. 20).

[0288] FIGS. 23A-23F shows microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung bronchial/tracheal epithermal cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0289] FIGS. 24A-24F shows microscopic analysis showing entry of VS_DsiRNA-Cy5 into primary human lung bronchial/tracheal epithermal cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0290] FIGS. 25A-25F shows microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung bronchial/tracheal epithermal cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

[0291] FIGS. 26A-26F shows microscopic analysis showing entry of VS_ASO_2-Cy3 into primary human lung bronchial/tracheal epithermal cells (10.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 20), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 20), and (C) and (F) were taken in well B1 & B2 (as shown in FIG. 20).

Example 7: SARS-CoV-2 N-Protein Expression is Decreased Upon Treatment by the Inhibitory Oligonucleotides

[0292] FIG. 27 shows the experimental design for detection of SARS-CoV-2 N-protein expressed on human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA-FITC designed with FITC labeled shown in the Table 1, and VS_ASO_2-Cy3 with Cy3 modification shown in the Table 2; and VS_DsiRNA-Cy5 with Cy5 modification shown in Table 3. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_Dsi RNA-Cy3 with lipofectamine, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without any reagents.

[0293] FIG. 28 shows detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 4 fold in the group treated by VS_DsiRNA-Cy5 oligos (p<0.005); about 6 fold in the group treated by VS_ASO_2-cy3 oligo (p<0.01), and about 8 fold in the group treated by the VS_ASO_1-FANA-FITC oligo (p<0.005); when compared with the group with SARS-CoV-2 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0294] FIG. 29 shows the experimental design for detection of SARS-CoV-2 S-protein expressed in human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (S-protein) of SARS-CoV-2. The siRNA or ASO were added into the cells for 24-48 hours before analysis with RT-PCR. The VS_ASO_1-FANA (oligo 3) designed is shown in the Table 1, VS_ASO_2 (oligo 3) is shown in the Table 2; and VS_DsiRNA (oligo 3) is shown in Table 3. A1&A2: No treatment, A3&A4: Overexpression of COVID-19 S-protein, A5&A6: Overexpression of COVID-19 S-protein+/treated by DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 S-protein+/treated by VS_DsiRNA-Cy5 with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 S-protein+/treated by the VS_ASO_2-Cy3 with lipofectamine, B5&B6: Overexpression of COVID-19 S-protein+/treated by VS_ASO_2-Cy3 with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 S-protein+/treated by VS_ASO_1-FANA without any reagents.

[0295] FIG. 30 shows detection of SARS-CoV-2 S-protein expression in the human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 8 fold in the group treated by VS-DsiRNA oligo (purple/L: p<0.01), but about 16.3 fold in presence of Poly-arginine only (yellow/p<0.001); about 15.8 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001), but about 16.6 fold in presence of Poly-arginine only (orange/A: p<0.001); about 11.7 fold in the group treated by the VS_ASO_1 oligo (green/p<0.001); when compared with the group with SARS-CoV-2 S-protein overexpression only (1). The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

Inhibitory Peptide--ACE2 Protein Competition Assays

[0296] Inhibitory peptide (VS-peptide)--ACE2 protein Competition Assays prove the VSB peptides' therapeutic efficiency (blocking/interfere S-RBD binding to ACE2) in live cell condition. HeLa cells were transfected with ACE2 plasmid to express ACE2 (HeLa cells do not have endogenous ACE2 expression). Without VSB peptide, S-RBD (conjugated with FITC) will bind to ACE2 and resulting the HeLa-ACE2 cell with FITC (green) signal. In the presence of a VSB peptide, the S-RBD (conjugated with FITC) binds to VSB peptide instead of HeLa-ACE2 cells. In this case, HeLa-ACE2 cells has no FITC signal.

Example 8: SARS-CoV-2 ORF1ab and RdRp Expression is Decreased Upon Treatment by Inhibitory Oligonucleotides

[0297] FIG. 31 shows the experimental design for detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) detected by qRT-PCR after treatment. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in the 24-well dish, and the cells were transfected with the genes encoding the viral protein (ORF1ab and RdRp) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. VS_ASO_1-FANA (oligo 1, 2, 5 and 6) designed is shown in the Table 1, VS_ASO_2 (oligo 1, 2, 5 and 6) is shown in the Table 2; and the VS_DsiRNA (oligo 1, 2, 5 and 6) is shown in Table 4. A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 viral genes encoding both ORF1ab and RdRp, A5&A6: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with lipofectamine, B1&B2: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_DsiRNA (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with lipofectamine, B5&B6: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_2 (oligo 1, 2, 5 and 6) with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 ORF1ab and RdRp+/treated by VS_ASO_1-FANA (oligo 1, 2, 5 and 6) without any reagents.

[0298] FIG. 32 shows detection of SARS-CoV-2 ORF1ab and RdRp expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) detected by qRT-PCR after treatment with inhibitory oligonucleotides. Significant down-regulation was observed: about 3 fold in the group treated by VS_DsiRNA oligo (purple/L: p<0.01) and about 2.6 fold in the presence of poly-Arginine only (yellow/A: p<0.001); about 6.4 fold in the group treated by VS_ASO_2 oligo (red/L: p<0.001) and about 4.5 fold in the presence of poly-Arginine only (orange/A: p<0.001); and about 11.9 fold in the group treated by the VS_ASO_1-FANA oligo (green/p<0.001); when compared with the group with SARS-CoV-2 ORF1ab and RdRp overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

Example 9: SARS-CoV-2 N-Protein Levels are Down after Treatment by the Inhibitory Oligonucleotides

[0299] FIG. 33 shows the experimental design for detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by Western Blot after treatment. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in a 6-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with Western Blot. The VS_ASO_2 (oligo 4 & 8) is shown in the Table 2; and VS_DsiRNA (oligo 4 & 8) is shown in Table 4. A1: No treatment as control, A2: Overexpression of COVID-19 N-protein, A3: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA (oligo 4 and 8) with lipofectamine, B1: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2 (oligo 4 and 8) with lipofectamine.

[0300] FIG. 34 shows detection of SARS-CoV-2 N-protein expressed in the human primary bronchial/tracheal epithelial cells (HBTEC) by Western Blot after treatment with inhibitory oligonucleotides. Lane 1: no treatment, Lane 2: SARS-CoV-2 N-protein overexpression (OE); Lane 3: SARS-CoV-2 N-protein OE+VS_DsiRNA (oligo 4 & 8); Lane 4: SARS-CoV-2 N-protein OE+VS_ASO_2 (oligo 4 & 8). 10 .mu.g total cell lysis were added into each well and blotted with primary antibody (1 .mu.g/mL anti-SARS-CoV-2-N-protein antibody (ProSci, 3857)) or anti-GAPDH antibody (Novus Biologicals, NBP2-27103) (1:1000 dilution). The secondary antibodies were goat-anti-rabbit HRP-conjugated Antibody (R&D System, HAF008) (1:1000) dilution and goat-anti-mouse IgG HRP-conjugated Antibody (R&D System, HAF007) (1:1000) dilution. The detection was done using horseradish peroxidase-labeled secondary antibodies and an enhanced chemiluminescence detection reagent.

[0301] FIG. 35 shows the experimental designs for investigating cell penetration and therapeutic effects of ASO(s) and DsiRNA on human primary nasal epithelial cells (HNEpC) transfected with viral protein of SARS-CoV-2 after treatment. The human primary nasal epithelial cells (HNEpC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral proteins of SARS-CoV-2. The VS_ASO_1-FANA-FITC, VS_DsiRNA-Cy5 and VS_ASO_2-Cy3 were delivered into the cells for 24-48 hours before analysis with fluorescent microscope. The VS_ASO_1-FANA-FITC was FITC labeled (see Table 1), and VS_ASO_2-Cy3 was Cy3 labeled (See Table 2); and VS_DsiRNA-Cy5 was Cy5 labeled (see Table 3). A1&A2: No treatment as control, A3&A4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA without lipofectamine or arginine, B1&B2: No treatment as control, B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with poly-arginine (5 .mu.l/well), C1&C2: No treatment as control, C3&C4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, C5&C6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with poly-arginine (5 .mu.l/well).

[0302] FIGS. 36A-36D show the microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_ASO_1-FANA-FITC can enter epithelial cells (20.times.). (A) and (B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 35), (B) and (D) were taken in well A1 & A2 (as shown in FIG. 35).

[0303] FIGS. 37A-37D show the microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_ASO_1-FANA-FITC can enter epithelial cells (10.times.). (A) and (B) were captured under FITC florescent filter, and (C) and (D) were captured in the same view of bright fields (20.times.). (A) and (C) were taken in well A3 & A4 (as shown in FIG. 35), (B) and (D) were taken in well A1 & A2 (as shown in FIG. 35).

[0304] FIGS. 38A-38F show the microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_DsiRNA-Cy5 can enter epithelial cells (20.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0305] FIGS. 39A-39F show the microscopic analysis of Human Primary Nasal Epithelial Cells at 10.times.. This analysis showed that VS_DsiRNA-Cy5 can enter epithelial cells (10.times.). (A)-(C) were captured under the Cy5 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0306] FIGS. 40A-40F show the microscopic analysis of Human Primary Nasal Epithelial Cells at 20.times.. This analysis showed that VS_ASO_2-Cy3 can enter epithelial cells (20.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (20.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

[0307] FIGS. 41A-41F show the microscopic analysis of Human Primary Nasal Epithelial Cells at 10.times.. This analysis showed that VS_ASO_2-Cy3 can enter epithelial cells (10.times.). (A)-(C) were captured under the Cy3 florescent filter, and (D)-(F) were captured in the same view of bright fields (10.times.). (A) and (D) were taken in well B3 & B4 (as shown in FIG. 35), (B) and (E) were taken in well B5 & B6 (as shown in FIG. 35), (C) and (F) were taken in well B1 & B2 (as shown in FIG. 35).

Example 10: SARS-CoV-2 N-Gene Expression is Reduced after Treatment by the Inhibitory Oligonucleotides in HNEpCs

[0308] FIG. 42. show the experimental design for detection of SARS-CoV-2 N-protein expressed on human primary nasal epithelial cells (HNEpC) by qRT-PCR. The human primary nasal epithelial cells (HNEpC) were cultured in a 24-well dish, and the cells were transfected with the genes encoding the viral protein (N-protein) of SARS-CoV-2. The inhibitory oligonucleotides were added into the cells for 24-48 hours before analysis with RT-PCR. VS_ASO_1-FANA-FITC was labeled with FITC as shown in the Table 1, and VS_ASO_2-Cy3 was labeled with Cy3 as shown in Table 2; and VS_DsiRNA-Cy5 was labeled with Cy5 as shown in Table 3. A1&A2: No treatment, A3&A4: Overexpression of COVID-19 N-protein, A5&A6: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with lipofectamine, B1&B2: Overexpression of COVID-19 N-protein+/treated by VS_DsiRNA-Cy5 with Arginine (5 .mu.l/well), B3&B4: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with lipofectamine, B5&B6: Overexpression of COVID-19 N-protein+/treated by VS_ASO_2-Cy3 with Arginine (5 .mu.l/well), C1&C2: Overexpression of COVID-19 N-protein+/treated by VS_ASO_1-FANA-FITC without any reagents.

[0309] FIG. 43 shows detection of SARS-CoV-2 N-protein expressed in the human primary nasal epithelial cells (HNEpC) by qRT-PCR after treatment with siRNA or ASO. Significant down-regulation was observed: about 90 fold in the group treated by VS_DsiRNA-Cy5 oligo (2: p<0.01); about 15 fold in the group treated by VS_ASO_2-Cy3 oligo (p<0.01), and about 350 fold of down-regulation in the group treated by the VS_ASO_1-FANA-FITC oligo (3: p<0.001); when compared with the group with COVID-19 N-protein overexpression only. The cycle threshold of no-treatment is non-detectable, but in this case for calculation purposes, the number "40" was used as the cycle threshold for a base-line control.

[0310] FIG. 44 shows experimental design for inhibiting viral infections using inhibitory nucleotides. WV=Wild-type of pseud-COVID-19 virus, 5 .mu.l (titer: 10.sup.5 TU/ml) of the virus added into each well (C1 to C9). MV=Mutant form of pseud-COVID-19 virus, 5 .mu.l (titer: 10.sup.5 TU/ml) of the virus added into each well (D1 to D9). N 1=VS_ASO_3 oligo (targeting on S-protein of COVID-19), N 2=VS_siRNA/RNAi_3 oligo (targeting on S-protein of COVID-19, Control-1=Scramble nucleotide oligo (SN) only.

[0311] FIGS. 45A-45F show experimental data of inhibitions of wild-type viral infections by inhibitory nucleotides. (A) Brightfield image of VS_ASO_3-treated cells. (B) Brightfield image of VS_RNAi_3-treated cells. (C) Brightfield image of scramble-treated cells. (D) Fluorescence image of VS_ASO_3-treated cells. (E) Fluorescence image of VS_RNAi_3-treated cells. (F) Fluorescence image of scramble-treated cells. There were no significant GFP expressions found in those cells treated by VS_ASO_3 and VS_RNAi_3 oligos, detected under the confocal microscope; but the inventors were able to see the GFP expressions in the control group of the cells treated with the scramble nucleotide only. This data thus indicated that the VS_ASO_3 and VS_RNAi_3 have inhibited the wild-type pseudoviruses coupled with eGFP (WV) inside the cells; but not in the group treated with the scramble nucleotide. The pseudo-type of COVID-19 virus (both the wild-type virus (WV) and the mutant virus (MV)) used in these experiments is an RNA virus like SARS-CoV-2. Without being bound to a particular theory, the inhibitory nucleotides of the disclosure are believed to inhibit viral infection by blocking the transcription of the spike protein; and also by disrupting the RNA transcription of the pseudo-type of COVID-19 viral genes.

[0312] FIGS. 46A-46F show experimental data of inhibitions of mutant viral infections by inhibitory nucleotides. (A) Brightfield image of VS_ASO_3-treated cells. (B) Brightfield image of VS_RNAi_3-treated cells. (C) Brightfield image of scramble-treated cells. (D) Fluorescence image of VS_ASO_3-treated cells. (E) Fluorescence image of VS_RNAi_3-treated cells. (F) Fluorescence image of scramble-treated cells. There was no significant GFP expressions found in those cells treated by VS_ASO_3 and VS_RNAi_3, detected under the confocal microscope; but the inventors were able to see the GFP expressions in the control group of the cells treated with the scramble nucleotide only. This data thus indicated that the VS_ASO_3 and VS_RNAi_3 have also inhibited the mutant pseudo viruses coupled with eGFP (MV) inside the cells; but not in the group treated with the scramble nucleotide. The pseudo-type of COVID-19 virus (both the wild-type virus (WV) and the mutant virus (MV)) used in these experiments is an RNA virus like SARS-CoV-2. Without being bound to a particular theory, the inhibitory nucleotides of the disclosure are believed to inhibit viral infection by blocking the transcription of the spike protein; and also by disrupting the RNA transcription of the pseudo-type of COVID-19 viral genes.

[0313] The designed nucleotides of VS_ASO and VS_RNAi (see Table 1) were able to inhibit viral infections and propagations with both the wild-type (WV) and mutant (MV) viruses of the pseudo COVID-19 in the living mammalian cells expressed ACE2 proteins.

Example 11: Inhibitory Peptides Block RBD Derived from the S-Protein of SARS-CoV-2

[0314] FIG. 47 shows the analysis of the amino acid sequence of SARS-CoV-2 Spike protein (S-protein) (GenBank ID: QHD43416.1, SEQ ID NO: 61). The region of the sequence highlighted in red represents the predicted sequences of ACE2 binding sequences/motifs (aka. the Ligand binding Domain).

[0315] FIGS. 48A-48B show the analysis of the amino acid sequence of the BD motifs. (A) 3D interaction between the SARS-CoV-2 Spike protein and human ACE2. (B) Analysis of the amino acids of the RBD motifs in 3D structure between the SARS-CoV-2 Spike protein (B: K417 to Y505) and human ACE2 (B: Q24 to R393) was used to order to locate which regions of the sequences contribute to the protein-protein interaction, and to design peptides that mimic the RBD sequences (mimics act like a human ACE 2 and prevent or block the binding activities for the SARS-CoV-2 on the real ACE2 in the cells).

[0316] FIG. 49 shows the experimental design. A1&A2: No treatment as control, A3&A4: peptide 5-FITC, A5&A6: peptide 5-FITC+/treated by the peptide 1 (low dosage), B1&B2: peptide 5-FITC+/treated by the peptide 1 (high dosage), B3&B4: peptide 5-FITC+/treated by the peptide 2 (low dosage), B5&B6: peptide 5-FITC+/treated by the peptide 2 (high dosage), 1&C2: peptide 5-FITC+/treated by the peptide 3 (low dosage), C3&C4: peptide 5-FITC+/treated by the peptide 3 (high dosage), C5&C6: peptide 5-FITC+/treated by the peptide 4 (low dosage), D1&D2: peptide 5-FITC+/treated by the peptide 4 (high dosage), D3&D4: peptide 5-FITC+/treated by the peptide 1 (high dosage)+peptide 2 (high dosage)+peptide 3 (high dosage)+peptide 4 (high dosage), The dosage-1=1 .mu.g per 10.sup.5 cells; and the dosage-2=10 .mu.g per 10.sup.5 cells.

[0317] FIGS. 50A-50H show cells infected with wild-type SARS-COV-2 virus (WV) in the presence of inhibitory peptides. (A) Brightfield image of cells treated with Peptide 1 (P1). (B) Brightfield image of cells treated with Peptide 2 (P2). (C) Brightfield image of cells treated with Peptide 3 (P3). (D) Brightfield image of cells treated with normal human serum (NHS). (E) Fluorescence (GFP) image cells treated with Peptide 1 (P1). (F) Fluorescence (GFP) image of cells treated with Peptide 2 (P2). (G) Fluorescence (GFP) image of cells treated with Peptide 3 (P3). (H) Fluorescence (GFP) image of cells treated with normal human serum (NHS).

[0318] FIGS. 51A-51H show cells infected with mutant SARS-COV-2 virus (MV) in the presence of inhibitory peptides. (A) Brightfield image of cells treated with Peptide 1 (P1). (B) Brightfield image of cells treated with Peptide 2 (P2). (C) Brightfield image of cells treated with Peptide 3 (P3). (D) Brightfield image of cells treated with normal human serum (NHS). (E) Fluorescence (GFP) image cells treated with Peptide 1 (P1). (F) Fluorescence (GFP) image of cells treated with Peptide 2 (P2). (G) Fluorescence (GFP) image of cells treated with Peptide 3 (P3). (H) Fluorescence (GFP) image of cells treated with normal human serum (NHS).

[0319] FIGS. 52A-52H show microscopic analysis of human primary small airway epithelial cells treated with inhibitory peptides (VS-peptides). (A), and (E) were captured under the FITC florescent filter, (B) and (E) were captured in brightfield (20.times.). (C) shows the merge of (A) and (B). (G) is a merge photo of (E) and (F). The white dots indicate the box that was enlarged as shown in (D). The yellow dots indicate the box that was enlarged as shown in (H). White arrows suggested peptide 5-FITC internalized into cells cytoplasm and nucleus, while the yellow arrows suggested the VS-peptides combination can block the peptide 5-FITC from internalization, staying outside of cells.

[0320] FIGS. 73A-73B. show alignments of inhibitory oligonucleotides. (A) The alignment of all ASO (ASO_1 and ASO_2) and all oligos in Tables 1, 2 and 4 showed that the designed inhibitory oligonucleotides specifically target the SARS-COV-2 virus genes. The alignment did not show any significant match to any human genes (thereby, avoiding potential side-effects when applied in human). (B): The analysis of all DsiRNA indicated all oligos (in Tables 1, 2 and 4) specifically target the SARS-COV-2 virus genes. The alignment did not show any significant match to any human genes (thereby, avoiding potential side-effects when applied in human).

Inhibitory Peptides Block COVID-19 Spike Protein In Vitro

[0321] FIGS. 74A-74C show peptide ELISA assays. (A) Schematic of ELISA assays. (B) Analysis of inhibitions of COVID-19 Spike Protein Receptor Binding Domain (S-RBD)-ACE2 binding by inhibitory peptides. (C) Table of p-values of the results in (A) and the number of amino acids participating in S-RBD/ACE2 interaction. These results indicated that the peptides could compete with ACE2 proteins and prevent S-RBD binding to ACE2. When the designed inhibitory peptides contained more amino acids interacting with S-RBD, stronger affinities were measured.

[0322] FIGS. 75A-75B show peptide inhibition data. (A) Inhibition rate of S-RBD binding to ACE2 using VS peptides. (B) S-RBD signal rate. The data were converted and calculated as inhibition/suppression rates of the peptides based on the intensities of the S-RBD signals after treatment with the peptides compared with the control groups (B). All peptides have shown their dosage-responses in the ELISA reactions, and indicated their strong biological affinities to bind with the S-RBD.

Inhibitory Peptides Block COVID-19 S-RBD-FITC Entry to Living Mammalian Cells

[0323] The HeLa-ACE2 cell were harvested after 48 hr post-transfection when ACE2 receptors were expressed on the cell membranes; and suspended in FACS running buffer (0.1% BSA in PBS) with final concentration in 1.times.106 cells/mL. Divided into 9 tubes (each tube has about 1 million cells). The above cells in each tube were incubated at RT in the dark for 30 min and subsequently subjected to run the FACS analysis BD FACSCalibur (total event: 10k). The figures were generated and analyzed by a computer program of FlowJo, which were shown as the format of "Scatter-plot." The data indicated that all peptides could target/bind on the S-RBD-FITC to prevent viral RBD entry the cells expressed the ACE2 receptors. See FIGS. 76A-761. The peptides 1 (FIG. 76D), 2 (FIG. 76E), 4 (FIG. 76G), 5 (FIG. 76H) and mixture showed significant strongest therapeutic effects, but peptides 3 (FIG. 76F) was weak; when compared with the control groups of "HNS/Tube-9" (FIG. 76C), "Positive control/Tube-8" (FIG. 76B) and "Negative control/Tube-7" (FIG. 76A).

Derivatives of Inhibitory Peptides can Also Inhibit S-RBD as Measured by ELISA Assays

[0324] Inventors have developed variants of original inhibitory peptides VS-Peptides 1-5 (see Table 6). FIG. 77 shows ELISA results of S-RBD inhibition by inhibitory peptides derived from VS-Peptides 1-5 (P1 to P20--corresponding to SEQ ID NOS: 63-82, respectively). The data indicated that the derivative inhibitory peptides are also capable of targeting the S-RBD of SARS-CoV-2 significantly to prevent viral binding on the human ACE2 receptors (p<0.05) (FIG. 77).

Example 12: Gene Therapy

[0325] FIG. 53 shows the gene therapy vector AAV-U6-A1-H1-A2-SV40-eGFP. This AAV vector expresses two transgenes (namely ASO1 (A1) and ASO2 (A2)) simultaneously in one cell. U6=The 1st promoter that controls the expression of A1 gene in the mammalian cells, H1=The 2nd promoter that controls the expression of A2 gene in the mammalian cells, SV=The 3rd promoter that controls the expression of GFP gene in the mammalian cells. Full sequence of AAV-U6-A1-H1-A2 SV40 GFP is shown by SEQ ID NO: 46.

[0326] FIG. 54 shows the gene therapy vector AAV-U6-A3-H1-A4-SV40-eGFP. This AAV vector expresses two transgenes (namely ASO3 (A3) and ASO4 (A4)) simultaneously in one cell. U6=The 1st promoter that controls the expression of A3 gene in the mammalian cells, H1=The 2nd promoter that controls the expression of A4 gene in the mammalian cells SV40=The 3rd promoter that controls the expression of GFP gene in the mammalian cells. Full sequence of AAV-U6-A1-H1-A2-SV40-eGFP is shown by SEQ ID NO: 47.

[0327] FIG. 55 shows the gene therapy vector AAV-U6-shRNA1-CMV-eGFP. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA1 gene in the mammalian cells, CMV=the 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence is shown by SEQ ID NO: 48 of AAV-U6-shRNA1-eGFP.

[0328] FIG. 56 shows the gene therapy vector AAV-U6-shRNA2-CMV-eGFP. This AAV vector expresses the transgene shRNA1 in one cell: U6=The 1st promoter that controls the expression of shRNA2 gene in the mammalian cells, CMV=the 2.sup.nd promoter that controls the expression of eGFP gene in the mammalian cells. The sequence of AAV-U6-shRNA2-eGFP is shown by SEQ ID NO: 49.

[0329] FIG. 57 shows the gene therapy vector AAV-U6-shRNA3-CMV-eGFP. A. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA3 gene in the mammalian cells, CMV=The 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence of AAV-U6-shRNA3-eGFP is shown by SEQ ID NO: 50.

[0330] FIG. 58 shows the gene therapy vector AAV-U6-shRNA4-CMV-eGFP. A. This AAV vector expresses the transgene shRNA1. U6=The 1st promoter that controls the expression of shRNA4 gene in the mammalian cells, CMV=The 2nd promoter that controls the expression of eGFP gene in the mammalian cells. The full DNA sequence of AAV-U6-shRNA4-eGFP is shown by SEQ ID NO: 51.

[0331] FIGS. 59A-59B show the experimental design of plates A and B.

[0332] FIGS. 60A-60D show fold change of exogenously-expressed COVID-19 proteins with gene therapy treatment. The cells were transfected with designed vectors with COVID-19 plasmids (S, N, RdRp and ORF1ab), and also the gene therapy vectors (#1 to #6) after 24 hours post-seeding. At the 48 hours post-transfection, the cells were then harvested, and their total RNA were extracted with including the DNase digestion before PCR assays. S proteins were conducted with TaqMan-probe assay kit (Thermofisher, A47532). The N protein, ORF1ab and RdRp proteins were determined by the GenScript kits (SARS-CoV-2PCR detection assay kit). The data indicated that the treatments by using the gene vectors have significant therapeutic effects to inhibit the expressions of the viral proteins. Synergic enhanced effects were observed when more than one peptide was used (see, #1 to 4 and #5 to 6)

[0333] FIGS. 61A-61B show western blot analysis of S-protein expression. FIG. 61B shows quantification of FIG. 61A. The cells were seed onto 6 well-plates. At 24 hours post-seeding, cells were transfected by the gene therapy vectors (#1 to #6) with including the plasmids encoding the COVID-19 S-proteins. After 48 hours post-transfection, cells were harvested and lysed. The primary antibody is SARS-CoV-2 Spike with 1 .mu.g/mL (ProSc, Inc), and the secondary antibody is Goat-anti-Rabbit HRP conjugated antibody by 1:1000 dilution (R&D System). The data indicated that the treatments by using the gene vectors have significant therapeutic effects to block the expression of viral proteins. Synergic enhanced effects were observed when more than one peptide was used (see, #1 to 4 and #5 to 6).

[0334] FIG. 62 shows the experimental design of in vitro gene therapy on inhibitions of the viral infections.

[0335] FIGS. 63A-63F show in vitro gene therapy inhibits WV viral infections. ASO (V1) and RNAi (V2) were delivered by gene vectors into mammalian cells that express ACE2 proteins, in order to inhibit the WV viral infections (WV=wild-type pseudo-virus of COVID-19). (A) Brightfield image of cells treated with ASO (V1). (B) Brightfield image of cells treated with RNAi (V2). (C) Brightfield image of cells treated with control. (D) Fluorescence image of cells treated with ASO (V1). (E) Fluorescence image of cells treated with RNAi (V2). (F) Fluorescence image of cells treated with control.

[0336] FIGS. 64A-64F show in vitro gene therapy inhibits MV viral infections. ASO (V1) and RNAi (V2) were delivered by gene vectors into mammalian cells that express ACE2 proteins, in order to inhibit the MV viral infections (MV=mutant pseudo-virus of COVID-19). (A) Brightfield image of cells treated with ASO (V1). (B) Brightfield image of cells treated with RNAi (V2). (C) Brightfield image of cells treated with control. (D) Fluorescence image of cells treated with ASO (V1). (E) Fluorescence image of cells treated with RNAi (V2). (F) Fluorescence image of cells treated with control.

[0337] FIG. 65A-65D show in vitro delivery of gene vectors into living cells. ASO (V1) and RNAi (V2) were delivered by using the gene vectors into mammalian cells that express ACE2 proteins, the cells were not incubated with any viruses, which were served as background controls. The concentrations of the vectors encoding the ASO (control-2) or/and RNAi (control-3) were the same used in the FIGS. 61A-61B and 62. (A) Brightfield image of cells treated with ASO control. (B) Brightfield image of cells treated with RNAi control. (C) Fluorescence image of cells treated with ASO control. (D) Fluorescence image of cells treated with RNAi control.

[0338] FIGS. 66A-66B show analysis of (A) Wild-type pseudovirus experiment results and (B) mutant pseudovirus experiment results. Since both gene vectors, encoding ASO and shRNA, also contain marker gene of GFP, normalized data was calculated based on control-2 and control-3 constructs (also see FIG. 62). The data analysis confirmed that ASO or shRNA vector expressing cells showed very little GFP signal, when compared with the control group-1. This data indicates that the gene vectors carrying either ASO or shRNA (inhibitory oligonucleotides) suppress viral infection and propagation in both wild-type and mutant pseudoviruses of COVID-19, pseudo-typed by lentiviruses. The pseudo-type of COVID-19 virus (both the wild-type virus (WV) and the mutant virus (MV)) used in these experiments is an RNA virus like SARS-CoV-2. Without being bound to a particular theory, the inhibitory nucleotides expressed by the genes vectors of the instant disclosure are believed to inhibit viral infection by blocking the transcription of the spike protein; and also by disrupting the RNA transcription of the pseudo-type of COVID-19 viral genes.

Example 13: Nutrition/Dietary Supplements

[0339] FIG. 67 shows experimental design for detection of apoptosis/cytotoxicity of VS-nutrition in human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR. The human primary bronchial/tracheal epithelial cells (HBTEC) were cultured in the 24 well-dish, and the cells were treated with VS-nutrition with designated dilution (1:1, 1:300 and 1:500) for 5 days (in every day, refresh cell culture medium and added new VS-nutrition with same composition and ratio) before analysis by qRT-PCR.

[0340] FIG. 68 shows detection of on apoptosis/cytotoxicity of VS-nutrition in the human bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment. Detection of apoptosis/cytotoxicity of VS-nutrition in the human primary bronchial/tracheal epithelial cells (HBTEC) by qRT-PCR after treatment with VS-nutrition. There are no significant up or down-regulation of BAX/BCL2 ratio in group treated by VS-nutrition when compared with the normal cells with no-treatment (p>0.05).

[0341] FIG. 69 shows the experimental design for detection of apoptosis/cytotoxicity of VS-nutrition in Human Primary Nasal Epithelial Cells (HNEpC) by qRT-PCR. The human primary nasal epithelial cells (HNEpC) were cultured in the 24 well-dish, and the cells were treated with VS-nutrition with designated dilution (1:1, 1:300 and 1:500) for 5 days (in every day, refresh cell culture medium and added new VS-nutrition with same composition and ratio) before analysis by qRT-PCR.

[0342] FIG. 70 shows detection on apoptosis/cytotoxicity of VS-nutrition in the human primary nasal epithelial cells (HNEpC) by qRT-PCR after treatment. Detection of apoptosis/cytotoxicity of VS-nutrition in the human primary nasal epithelial cells by RT-PCR after treatment with VS-nutrition. There are no significant up or down-regulation of BAX/BCL2 ratio in group treated by VS-nutrition when compared with the normal cells with no-treatment (p>0.05).

[0343] FIGS. 71A-71B show oral intake formulations of VS product (nutritional supplement). Bottle product (10-15 ml) with (A) 1.5 ml spoon or (B) 1.0 ml drop.

[0344] FIGS. 72A-72C show an exemplary nasal (liquid) spray. Spray product with 10-15 ml bottle nasal spray. (A) composition and size of the product. (B) & (C) usage example.

Sequence CWU 1

1

82121RNAArtificial SequenceOligonucleotide 1guggcuuacc gcaagguucu u 21221RNAArtificial SequenceOligonucleotide 2gcacuaguac ugaugucgua u 21321RNAArtificial SequenceOligonucleotide 3gaagacccag ucccuacuua u 21421RNAArtificial SequenceOligonucleotide 4gacaaggcgu uccaauuaac a 21521RNAArtificial SequenceOligonucleotide 5ggcacgauau uacgcacaac u 21621RNAArtificial SequenceOligonucleotide 6aacuuacaua gcucuagacu u 21721RNAArtificial SequenceOligonucleotide 7gaagagacag guacguuaau a 21821RNAArtificial SequenceOligonucleotide 8ggaccaggaa cuaaucagac a 21921DNAArtificial SequenceOligonucleotide 9aagaaccttg cggtaagcca c 211021DNAArtificial SequenceOligonucleotide 10atacgacatc agtactagtg c 211121DNAArtificial SequenceOligonucleotide 11ataagtaggg actgggtctt c 211221DNAArtificial SequenceOligonucleotide 12tgttaattgg aacgccttgt c 211321DNAArtificial SequenceOligonucleotide 13agttgtgcgt aatatcgtgc c 211421DNAArtificial SequenceOligonucleotide 14aagtctagag ctatgtaagt t 211521DNAArtificial SequenceOligonucleotide 15tattaacgta cctgtctctt c 211621DNAArtificial SequenceOligonucleotide 16tgtctgatta gttcctggtc c 211725DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 17gccuuguccc ugguuucaac gagaa 251827RNAArtificial SequenceOligonucleotide 18uucucguuga aaccagggac aaggcuc 271925RNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 19cagcugaugc acaaucguuu uuaaa 252027RNAArtificial SequenceOligonucleotide 20uuuaaaaacg auugugcauc agcugac 272125DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 21cuagucagug uguuaaucuu acaac 252227RNAArtificial SequenceOligonucleotide 22guuguaagau uaacacacug acuagag 272325DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 23aaacuaaaau gucugauaau ggacc 252427RNAArtificial SequenceOligonucleotide 24gguccauuau cagacauuuu aguuugu 272525DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 25gguaguuaua cuaaugacaa agctt 252627RNAArtificial SequenceOligonucleotide 26aagcuuuguc auuaguauaa cuaccac 272725DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 27cuucugguaa ucuauuacua gauaa 252827RNAArtificial SequenceOligonucleotide 28uuaucuagua auagauuacc agaagca 272925DNAArtificial SequenceOligonucleotidemisc_feature(1)..(23)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 29ggaagagaca gguacguuaa uagtt 253027RNAArtificial SequenceOligonucleotide 30aacuauuaac guaccugucu cuuccga 273125DNAArtificial SequenceOligonucleotidemisc_feature(1)..(24)ribonucleotidemisc_feature(24- )..(25)Deoxyribonucleotide 31ggccaaacug ucacuaagaa auctg 253227RNAArtificial SequenceOligonucleotide 32cagauuucuu agugacaguu uggccuu 273321DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 33aagaaccttg cggtaagcca c 213421DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 34auacgacatc agtacuagug c 213521DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 35auaagtaggg actgggucuu c 213621DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 36uguuaattgg aacgccuugt c 213721DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 37aguugtgcgt aatatcgugc c 213821DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 38aaguctagag ctatguaagu t 213921DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 39uauuaacgta cctgtcucuu c 214021DNAArtificial SequenceOligonucleotidemisc_feature(1)..(5)2' O-Methyl RNAmisc_feature(6)..(15)Deoxyribonucleotidemisc_feature(16)..(20- )2' O-Methyl RNAmisc_feature(21)..(21)Deoxyribonucleotide 40ugucugatta gttccugguc c 214123PRTArtificial SequenceOligopeptide 41Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu1 5 10 15Asp Leu Phe Tyr Gln Ser Ser 204220PRTArtificial SequenceOligopeptide 42Phe Leu Lys Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro Leu Gln Glu1 5 10 15Ile Gln Asn Leu 204321PRTArtificial SequenceOligopeptide 43Leu Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp1 5 10 15Pro Gly Asn Val Gln 204420PRTArtificial SequenceOligopeptide 44His Pro Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe Arg Ile Leu Met1 5 10 15Cys Thr Lys Val 204523PRTArtificial SequenceOligopeptide 45Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys1 5 10 15Pro Phe Glu Arg Asp Ile Ser 20465034DNAArtificial SequenceOligonucleotide 46cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120aggggttcct gcggccgccc tagggagggc ctatttccca tgattccttc atatttgcat 180atacgataca aggctgttag agagataatt agaattaatt tgactgtaaa cacaaagata 240ttagtacaaa atacgtgacg tagaaagtaa taatttcttg ggtagtttgc agttttaaaa 300ttatgtttta aaatggacta tcatatgctt accgtaactt gaaagtattt cgatttcttg 360ggtttatata tcttgtggaa aggacgaaga accttgcggt aagccacttt tttcgcaatt 420cgaacgctga cgtcatcaac ccgctccaag gaatcgcggg cccagtgtca ctaggcggga 480acacccagcg cgcgtgcgcc ctggcaggaa gatggctgtg agggacaggg gagtggcgcc 540ctgcaatatt tgcatgtcgc tatgtgttct gggaaatcac cataaacgtg aaatgtcttt 600ggatttggga atcttataag ttctgtatga gaccacagat ctagatacga catcagtact 660agtgcttttt tctcgagcgt cccagactac gcttgagttt aaacacgcgt ggtgtggaaa 720gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac 780caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 840ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag 900ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc 960cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag gccgccacca 1020tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg 1080gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg 1140gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc 1200tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc 1260agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct 1320tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg 1380tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca 1440agctggagta caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg 1500gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg 1560accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact 1620acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc 1680tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagtgac 1740ttaaggggtg gcatccctgt gacccctccc cagtgcctct cctggccctg gaagttgcca 1800ctccagtgcc caccagcctt gtcctaataa aattaagttg catcattttg tctgactagg 1860tgtccttcta taatattatg gggtggaggg gggtggtatg gagcaagggg caagttggga 1920agacaacctg tagggcctgc ggggtctatt gggaaccaag ctggagtgca gtggcacaat 1980cttggctcac tgcaatctcc gcctcctggg ttcaagcgat tctcctgcct cagcctcccg 2040agttgttggg attccaggca tgcatgacca ggctcagcta atttttgttt ttttggtaga 2100gacggggttt caccatattg gccaggctgg tctccaactc ctaatctcag gtgatctacc 2160caccttggcc tcccaaattg ctgggattac aggcgtgaac cactgctccc ttccctgtcc 2220ttcacgtgcg gaccgagcgg ccgcaggaac ccctagtgat ggagttggcc actccctctc 2280tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg 2340cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct gcaggggcgc ctgatgcggt 2400attttctcct tacgcatctg tgcggtattt cacaccgcat acgtcaaagc aaccatagta 2460cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 2520tacacttgcc agcgccttag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 2580gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 2640tgctttacgg cacctcgacc ccaaaaaact tgatttgggt gatggttcac gtagtgggcc 2700atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 2760actcttgttc caaactggaa caacactcaa ctctatctcg ggctattctt ttgatttata 2820agggattttg ccgatttcgg tctattggtt aaaaaatgag ctgatttaac aaaaatttaa 2880cgcgaatttt aacaaaatat taacgtttac aattttatgg tgcactctca gtacaatctg 2940ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg 3000acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg 3060catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agccgggagc tgcatgtgtc 3120agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat 3180ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg 3240gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 3300tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta 3360ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg 3420ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg 3480gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac 3540gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg 3600acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt 3660actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg 3720ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac 3780cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt 3840gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag 3900caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc 3960aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc 4020ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta 4080tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg 4140ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga 4200ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac 4260ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 4320tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 4380cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 4440taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 4500gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc 4560acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 4620ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 4680ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 4740cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 4800aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 4860gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 4920gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 4980gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgt 5034475034DNAArtificial SequenceOligonucleotide 47cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120aggggttcct gcggccgccc tagggagggc ctatttccca tgattccttc atatttgcat 180atacgataca aggctgttag agagataatt agaattaatt tgactgtaaa cacaaagata 240ttagtacaaa atacgtgacg tagaaagtaa taatttcttg ggtagtttgc agttttaaaa 300ttatgtttta aaatggacta tcatatgctt accgtaactt gaaagtattt cgatttcttg 360ggtttatata tcttgtggaa aggacgataa gtagggactg ggtcttcttt tttcgcaatt 420cgaacgctga cgtcatcaac ccgctccaag gaatcgcggg cccagtgtca ctaggcggga 480acacccagcg cgcgtgcgcc ctggcaggaa gatggctgtg agggacaggg gagtggcgcc 540ctgcaatatt tgcatgtcgc tatgtgttct gggaaatcac cataaacgtg aaatgtcttt 600ggatttggga atcttataag ttctgtatga gaccacagat ctagtgttaa ttggaacgcc 660ttgtcttttt tctcgagcgt cccagactac gcttgagttt aaacacgcgt ggtgtggaaa 720gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac 780caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 840ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag 900ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc 960cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag gccgccacca 1020tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg 1080gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg 1140gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc 1200tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc 1260agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct 1320tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg 1380tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca 1440agctggagta caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg 1500gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg 1560accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact 1620acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc 1680tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagtgac 1740ttaaggggtg gcatccctgt gacccctccc cagtgcctct cctggccctg gaagttgcca 1800ctccagtgcc caccagcctt gtcctaataa aattaagttg catcattttg tctgactagg 1860tgtccttcta taatattatg gggtggaggg gggtggtatg gagcaagggg caagttggga 1920agacaacctg tagggcctgc ggggtctatt gggaaccaag ctggagtgca gtggcacaat 1980cttggctcac tgcaatctcc gcctcctggg ttcaagcgat tctcctgcct cagcctcccg 2040agttgttggg attccaggca tgcatgacca ggctcagcta atttttgttt ttttggtaga 2100gacggggttt caccatattg gccaggctgg tctccaactc ctaatctcag gtgatctacc 2160caccttggcc tcccaaattg ctgggattac aggcgtgaac cactgctccc ttccctgtcc 2220ttcacgtgcg gaccgagcgg ccgcaggaac ccctagtgat ggagttggcc actccctctc 2280tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg 2340cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct gcaggggcgc ctgatgcggt 2400attttctcct tacgcatctg tgcggtattt cacaccgcat acgtcaaagc aaccatagta 2460cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 2520tacacttgcc agcgccttag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 2580gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 2640tgctttacgg cacctcgacc ccaaaaaact tgatttgggt gatggttcac gtagtgggcc 2700atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 2760actcttgttc caaactggaa caacactcaa ctctatctcg ggctattctt ttgatttata 2820agggattttg ccgatttcgg tctattggtt aaaaaatgag ctgatttaac aaaaatttaa 2880cgcgaatttt aacaaaatat taacgtttac aattttatgg tgcactctca gtacaatctg 2940ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg 3000acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg 3060catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agccgggagc tgcatgtgtc 3120agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat 3180ttttataggt taatgtcatg ataataatgg tttcttagac

gtcaggtggc acttttcggg 3240gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 3300tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta 3360ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg 3420ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg 3480gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac 3540gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg 3600acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt 3660actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg 3720ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac 3780cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt 3840gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag 3900caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc 3960aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc 4020ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta 4080tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg 4140ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga 4200ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac 4260ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 4320tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 4380cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 4440taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 4500gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc 4560acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 4620ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 4680ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 4740cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 4800aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 4860gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 4920gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 4980gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgt 5034484104DNAArtificial SequenceOligonucleotide 48ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 60gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 120cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 180aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 240aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 300tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 360ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 420gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc 480actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg 540agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta 600atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggta 660cgtccaaggt cgggcaggaa gagggcctat ttcccatgat tccttcatat ttgcatatac 720gatacaaggc tgttagagag ataattagaa ttaatttgac tgtaaacaca aagatattag 780tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat 840gttttaaaat ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt 900tatatatctt gtggaaagga caaaaagcct tgtccctggt ttcaacgaga attcaagaga 960ttctcgttga aaccagggac aaggcttttt tggtaccaat tgtagtaatc aattacgggg 1020tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg 1080cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata 1140gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc 1200cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac 1260ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg 1320cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg gcagtacatc 1380aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc 1440aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taacaactcc 1500gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct 1560ggtttagtga accgtcaggg taccggatcc cttaagtgaa caactagtgc caccatggtg 1620agcaagggcg aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac 1680gtaaacggcc acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag 1740ctgaccctga agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg 1800accaccctga cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac 1860gacttcttca agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag 1920gacgacggca actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac 1980cgcatcgagc tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg 2040gagtacaact acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc 2100aaggtgaact tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac 2160taccagcaga acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccactacctg 2220agcacccagt ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg 2280gagttcgtga ccgccgccgg gatcactctc ggcatggacg agctgtacaa ggaattcgga 2340agcgggcagt gcaccaacta cgccctgctg aagctggccg gcgacgtgga gagcaacccc 2400ggccccggat ccatggccac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac 2460gtcccccggg ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac 2520accgtcgacc cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg 2580cgcgtcgggc tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc 2640tggaccacgc cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg ctcgcgcatg 2700gccgagttga gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg 2760caccggccca aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag 2820ggcaagggtc tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgctggg 2880gtgcccgcct tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc 2940ttcaccgtca ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc 3000aagcccggtg cctgaacgcg tcttaaggcg atcgcagaca tgataagata cattgatgag 3060tttggacaaa ccacaactag aatgcagtga aaaaaatgct ttatttgtga aatttgtgat 3120gctattgctt tatttgtaac cattataagc tgcaataaac aagttaataa caacaattcc 3180attcatttta tgtttcaggt tcagggggag atgtgggagg ttttttaaag caagtaaaac 3240ctctacaaat gtggtagtcg aaattcccga taaggatctt cctagagcat ggctacgtag 3300ataagtagca tggcgggtta atcattaact acaaggaacc cctagtgatg gagttggcca 3360ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc 3420cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagggatccc ggtgtgaaat 3480accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 3540tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3600aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3660gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3720ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3780ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3840gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3900ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 3960cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4020cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4080gaggtatgta ggcggtgcta caga 4104494118DNAArtificial SequenceOligonucleotide 49ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 60gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 120cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 180aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 240aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 300tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 360ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 420gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc 480actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg 540agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta 600atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctagggt 660accaaaaaat atcagaggca cgtcaacatc ttaatctctt gaattaagat gttgacgtgc 720ctctgatact ttttttggtg tttcgtggtc tcatacagaa cttataagat tcccaaatcc 780aaagacattt cacgtttatg gtgatttccc agaacacata gcgacatgca aatattgcag 840ggcgccactc ccctgtccct cacagccatc ttcctgccag ggcgcacgcg cgctgggtgt 900tcccgcctag tgacactggg cccgcgattc cttggagcgg gttgatgacg tcagcgttct 960caattgtagt aatcaattac ggggtcatta gttcatagcc catatatgga gttccgcgtt 1020acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg 1080tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg 1140gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt 1200acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg 1260accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg 1320gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 1380ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa tcaacgggac 1440tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg 1500tgggaggtct atataagcag agctggttta gtgaaccgtc agggtaccgg atcccttaag 1560tgaacaacta gtgccaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 1620atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 1680gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg 1740cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc 1800taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 1860caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 1920ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 1980ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg 2040gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac 2100ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 2160ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag 2220aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 2280gacgagctgt acaaggaatt cggaagcggg cagtgcacca actacgccct gctgaagctg 2340gccggcgacg tggagagcaa ccccggcccc ggatccatgg ccaccgagta caagcccacg 2400gtgcgcctcg ccacccgcga cgacgtcccc cgggccgtac gcaccctcgc cgccgcgttc 2460gccgactacc ccgccacgcg ccacaccgtc gacccggacc gccacatcga gcgggtcacc 2520gagctgcaag aactcttcct cacgcgcgtc gggctcgaca tcggcaaggt gtgggtcgcg 2580gacgacggcg ccgcggtggc ggtctggacc acgccggaga gcgtcgaagc gggggcggtg 2640ttcgccgaga tcggctcgcg catggccgag ttgagcggtt cccggctggc cgcgcagcaa 2700cagatggaag gcctcctggc gccgcaccgg cccaaggagc ccgcgtggtt cctggccacc 2760gtcggcgtct cgcccgacca ccagggcaag ggtctgggca gcgccgtcgt gctccccgga 2820gtggaggcgg ccgagcgcgc tggggtgccc gccttcctgg agacctccgc gccccgcaac 2880ctccccttct acgagcggct cggcttcacc gtcaccgccg acgtcgaggt gcccgaagga 2940ccgcgcacct ggtgcatgac ccgcaagccc ggtgcctgaa cgcgtcttaa ggcgatcgca 3000gacatgataa gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa 3060tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat 3120aaacaagtta ataacaacaa ttccattcat tttatgtttc aggttcaggg ggagatgtgg 3180gaggtttttt aaagcaagta aaacctctac aaatgtggta gtcgaaattc ccgataagga 3240tcttcctaga gcatggctac gtagataagt agcatggcgg gttaatcatt aactacaagg 3300aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc actgaggccg 3360ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg agcgagcgag 3420cgcgcaggga tcccggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag 3480gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 3540ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 3600aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 3660ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 3720gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 3780cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 3840gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 3900tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 3960cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 4020cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 4080gtggcctaac tacggctaca ctagaaggac agtatttg 4118504121DNAArtificial SequenceOligonucleotide 50ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 60gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 120cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 180aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 240aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 300tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 360ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 420gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc 480actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg 540agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta 600atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggta 660cgtccaaggt cgggcaggaa gagggcctat ttcccatgat tccttcatat ttgcatatac 720gatacaaggc tgttagagag ataattagaa ttaatttgac tgtaaacaca aagatattag 780tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat 840gttttaaaat ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt 900tatatatctt gtggaaagga caaaaacagg cactagtact gatgtcgtat attcaagaga 960tatacgacat cagtactagt gcctgttttt tggtaccaat tgtagtaatc aattacgggg 1020tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg 1080cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata 1140gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc 1200cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac 1260ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg 1320cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg gcagtacatc 1380aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc 1440aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taacaactcc 1500gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct 1560ggtttagtga accgtcaggg taccggatcc cttaagtgaa caactagtgc caccatggtg 1620agcaagggcg aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac 1680gtaaacggcc acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag 1740ctgaccctga agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg 1800accaccctga cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac 1860gacttcttca agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag 1920gacgacggca actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac 1980cgcatcgagc tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg 2040gagtacaact acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc 2100aaggtgaact tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac 2160taccagcaga acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccactacctg 2220agcacccagt ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg 2280gagttcgtga ccgccgccgg gatcactctc ggcatggacg agctgtacaa ggaattcgga 2340agcgggcagt gcaccaacta cgccctgctg aagctggccg gcgacgtgga gagcaacccc 2400ggccccggat ccatggccac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac 2460gtcccccggg ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac 2520accgtcgacc cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg 2580cgcgtcgggc tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc 2640tggaccacgc cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg ctcgcgcatg 2700gccgagttga gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg 2760caccggccca aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag 2820ggcaagggtc tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgctggg 2880gtgcccgcct tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc 2940ttcaccgtca ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc 3000aagcccggtg cctgaacgcg tcttaaggcg atcgcagaca tgataagata cattgatgag 3060tttggacaaa ccacaactag aatgcagtga aaaaaatgct ttatttgtga aatttgtgat 3120gctattgctt tatttgtaac cattataagc tgcaataaac aagttaataa caacaattcc 3180attcatttta tgtttcaggt tcagggggag atgtgggagg ttttttaaag caagtaaaac 3240ctctacaaat gtggtagtcg aaattcccga taaggatctt cctagagcat ggctacgtag 3300ataagtagca tggcgggtta atcattaact acaaggaacc cctagtgatg gagttggcca 3360ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc 3420cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagggatccc ggtgtgaaat 3480accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 3540tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3600aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3660gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3720ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3780ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3840gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3900ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 3960cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4020cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4080gaggtatgta ggcggtgcta cagagttctt gaagtggtgg c 4121514104DNAArtificial SequenceOligonucleotide 51ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 60gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 120cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 180aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 240aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 300tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 360ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 420gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc 480actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg 540agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta 600atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggta

660cgtccaaggt cgggcaggaa gagggcctat ttcccatgat tccttcatat ttgcatatac 720gatacaaggc tgttagagag ataattagaa ttaatttgac tgtaaacaca aagatattag 780tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat 840gttttaaaat ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt 900tatatatctt gtggaaagga caaaaaaaac taaaatgtct gataatggac cttcaagaga 960ggtccattat cagacatttt agtttttttt tggtaccaat tgtagtaatc aattacgggg 1020tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg 1080cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata 1140gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc 1200cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac 1260ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg 1320cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg gcagtacatc 1380aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc 1440aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taacaactcc 1500gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct 1560ggtttagtga accgtcaggg taccggatcc cttaagtgaa caactagtgc caccatggtg 1620agcaagggcg aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac 1680gtaaacggcc acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag 1740ctgaccctga agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg 1800accaccctga cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac 1860gacttcttca agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag 1920gacgacggca actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac 1980cgcatcgagc tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg 2040gagtacaact acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc 2100aaggtgaact tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac 2160taccagcaga acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccactacctg 2220agcacccagt ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg 2280gagttcgtga ccgccgccgg gatcactctc ggcatggacg agctgtacaa ggaattcgga 2340agcgggcagt gcaccaacta cgccctgctg aagctggccg gcgacgtgga gagcaacccc 2400ggccccggat ccatggccac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac 2460gtcccccggg ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac 2520accgtcgacc cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg 2580cgcgtcgggc tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc 2640tggaccacgc cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg ctcgcgcatg 2700gccgagttga gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg 2760caccggccca aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag 2820ggcaagggtc tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgctggg 2880gtgcccgcct tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc 2940ttcaccgtca ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc 3000aagcccggtg cctgaacgcg tcttaaggcg atcgcagaca tgataagata cattgatgag 3060tttggacaaa ccacaactag aatgcagtga aaaaaatgct ttatttgtga aatttgtgat 3120gctattgctt tatttgtaac cattataagc tgcaataaac aagttaataa caacaattcc 3180attcatttta tgtttcaggt tcagggggag atgtgggagg ttttttaaag caagtaaaac 3240ctctacaaat gtggtagtcg aaattcccga taaggatctt cctagagcat ggctacgtag 3300ataagtagca tggcgggtta atcattaact acaaggaacc cctagtgatg gagttggcca 3360ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc 3420cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagggatccc ggtgtgaaat 3480accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 3540tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3600aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3660gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3720ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3780ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3840gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3900ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 3960cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4020cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4080gaggtatgta ggcggtgcta caga 41045229903DNAArtificial SequenceSARS-COV-2 52attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct 60gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact 120cacgcagtat aattaataac taattactgt cgttgacagg acacgagtaa ctcgtctatc 180ttctgcaggc tgcttacggt ttcgtccgtg ttgcagccga tcatcagcac atctaggttt 240cgtccgggtg tgaccgaaag gtaagatgga gagccttgtc cctggtttca acgagaaaac 300acacgtccaa ctcagtttgc ctgttttaca ggttcgcgac gtgctcgtac gtggctttgg 360agactccgtg gaggaggtct tatcagaggc acgtcaacat cttaaagatg gcacttgtgg 420cttagtagaa gttgaaaaag gcgttttgcc tcaacttgaa cagccctatg tgttcatcaa 480acgttcggat gctcgaactg cacctcatgg tcatgttatg gttgagctgg tagcagaact 540cgaaggcatt cagtacggtc gtagtggtga gacacttggt gtccttgtcc ctcatgtggg 600cgaaatacca gtggcttacc gcaaggttct tcttcgtaag aacggtaata aaggagctgg 660tggccatagt tacggcgccg atctaaagtc atttgactta ggcgacgagc ttggcactga 720tccttatgaa gattttcaag aaaactggaa cactaaacat agcagtggtg ttacccgtga 780actcatgcgt gagcttaacg gaggggcata cactcgctat gtcgataaca acttctgtgg 840ccctgatggc taccctcttg agtgcattaa agaccttcta gcacgtgctg gtaaagcttc 900atgcactttg tccgaacaac tggactttat tgacactaag aggggtgtat actgctgccg 960tgaacatgag catgaaattg cttggtacac ggaacgttct gaaaagagct atgaattgca 1020gacacctttt gaaattaaat tggcaaagaa atttgacacc ttcaatgggg aatgtccaaa 1080ttttgtattt cccttaaatt ccataatcaa gactattcaa ccaagggttg aaaagaaaaa 1140gcttgatggc tttatgggta gaattcgatc tgtctatcca gttgcgtcac caaatgaatg 1200caaccaaatg tgcctttcaa ctctcatgaa gtgtgatcat tgtggtgaaa cttcatggca 1260gacgggcgat tttgttaaag ccacttgcga attttgtggc actgagaatt tgactaaaga 1320aggtgccact acttgtggtt acttacccca aaatgctgtt gttaaaattt attgtccagc 1380atgtcacaat tcagaagtag gacctgagca tagtcttgcc gaataccata atgaatctgg 1440cttgaaaacc attcttcgta agggtggtcg cactattgcc tttggaggct gtgtgttctc 1500ttatgttggt tgccataaca agtgtgccta ttgggttcca cgtgctagcg ctaacatagg 1560ttgtaaccat acaggtgttg ttggagaagg ttccgaaggt cttaatgaca accttcttga 1620aatactccaa aaagagaaag tcaacatcaa tattgttggt gactttaaac ttaatgaaga 1680gatcgccatt attttggcat ctttttctgc ttccacaagt gcttttgtgg aaactgtgaa 1740aggtttggat tataaagcat tcaaacaaat tgttgaatcc tgtggtaatt ttaaagttac 1800aaaaggaaaa gctaaaaaag gtgcctggaa tattggtgaa cagaaatcaa tactgagtcc 1860tctttatgca tttgcatcag aggctgctcg tgttgtacga tcaattttct cccgcactct 1920tgaaactgct caaaattctg tgcgtgtttt acagaaggcc gctataacaa tactagatgg 1980aatttcacag tattcactga gactcattga tgctatgatg ttcacatctg atttggctac 2040taacaatcta gttgtaatgg cctacattac aggtggtgtt gttcagttga cttcgcagtg 2100gctaactaac atctttggca ctgtttatga aaaactcaaa cccgtccttg attggcttga 2160agagaagttt aaggaaggtg tagagtttct tagagacggt tgggaaattg ttaaatttat 2220ctcaacctgt gcttgtgaaa ttgtcggtgg acaaattgtc acctgtgcaa aggaaattaa 2280ggagagtgtt cagacattct ttaagcttgt aaataaattt ttggctttgt gtgctgactc 2340tatcattatt ggtggagcta aacttaaagc cttgaattta ggtgaaacat ttgtcacgca 2400ctcaaaggga ttgtacagaa agtgtgttaa atccagagaa gaaactggcc tactcatgcc 2460tctaaaagcc ccaaaagaaa ttatcttctt agagggagaa acacttccca cagaagtgtt 2520aacagaggaa gttgtcttga aaactggtga tttacaacca ttagaacaac ctactagtga 2580agctgttgaa gctccattgg ttggtacacc agtttgtatt aacgggctta tgttgctcga 2640aatcaaagac acagaaaagt actgtgccct tgcacctaat atgatggtaa caaacaatac 2700cttcacactc aaaggcggtg caccaacaaa ggttactttt ggtgatgaca ctgtgataga 2760agtgcaaggt tacaagagtg tgaatatcac ttttgaactt gatgaaagga ttgataaagt 2820acttaatgag aagtgctctg cctatacagt tgaactcggt acagaagtaa atgagttcgc 2880ctgtgttgtg gcagatgctg tcataaaaac tttgcaacca gtatctgaat tacttacacc 2940actgggcatt gatttagatg agtggagtat ggctacatac tacttatttg atgagtctgg 3000tgagtttaaa ttggcttcac atatgtattg ttctttctac cctccagatg aggatgaaga 3060agaaggtgat tgtgaagaag aagagtttga gccatcaact caatatgagt atggtactga 3120agatgattac caaggtaaac ctttggaatt tggtgccact tctgctgctc ttcaacctga 3180agaagagcaa gaagaagatt ggttagatga tgatagtcaa caaactgttg gtcaacaaga 3240cggcagtgag gacaatcaga caactactat tcaaacaatt gttgaggttc aacctcaatt 3300agagatggaa cttacaccag ttgttcagac tattgaagtg aatagtttta gtggttattt 3360aaaacttact gacaatgtat acattaaaaa tgcagacatt gtggaagaag ctaaaaaggt 3420aaaaccaaca gtggttgtta atgcagccaa tgtttacctt aaacatggag gaggtgttgc 3480aggagcctta aataaggcta ctaacaatgc catgcaagtt gaatctgatg attacatagc 3540tactaatgga ccacttaaag tgggtggtag ttgtgtttta agcggacaca atcttgctaa 3600acactgtctt catgttgtcg gcccaaatgt taacaaaggt gaagacattc aacttcttaa 3660gagtgcttat gaaaatttta atcagcacga agttctactt gcaccattat tatcagctgg 3720tatttttggt gctgacccta tacattcttt aagagtttgt gtagatactg ttcgcacaaa 3780tgtctactta gctgtctttg ataaaaatct ctatgacaaa cttgtttcaa gctttttgga 3840aatgaagagt gaaaagcaag ttgaacaaaa gatcgctgag attcctaaag aggaagttaa 3900gccatttata actgaaagta aaccttcagt tgaacagaga aaacaagatg ataagaaaat 3960caaagcttgt gttgaagaag ttacaacaac tctggaagaa actaagttcc tcacagaaaa 4020cttgttactt tatattgaca ttaatggcaa tcttcatcca gattctgcca ctcttgttag 4080tgacattgac atcactttct taaagaaaga tgctccatat atagtgggtg atgttgttca 4140agagggtgtt ttaactgctg tggttatacc tactaaaaag gctggtggca ctactgaaat 4200gctagcgaaa gctttgagaa aagtgccaac agacaattat ataaccactt acccgggtca 4260gggtttaaat ggttacactg tagaggaggc aaagacagtg cttaaaaagt gtaaaagtgc 4320cttttacatt ctaccatcta ttatctctaa tgagaagcaa gaaattcttg gaactgtttc 4380ttggaatttg cgagaaatgc ttgcacatgc agaagaaaca cgcaaattaa tgcctgtctg 4440tgtggaaact aaagccatag tttcaactat acagcgtaaa tataagggta ttaaaataca 4500agagggtgtg gttgattatg gtgctagatt ttacttttac accagtaaaa caactgtagc 4560gtcacttatc aacacactta acgatctaaa tgaaactctt gttacaatgc cacttggcta 4620tgtaacacat ggcttaaatt tggaagaagc tgctcggtat atgagatctc tcaaagtgcc 4680agctacagtt tctgtttctt cacctgatgc tgttacagcg tataatggtt atcttacttc 4740ttcttctaaa acacctgaag aacattttat tgaaaccatc tcacttgctg gttcctataa 4800agattggtcc tattctggac aatctacaca actaggtata gaatttctta agagaggtga 4860taaaagtgta tattacacta gtaatcctac cacattccac ctagatggtg aagttatcac 4920ctttgacaat cttaagacac ttctttcttt gagagaagtg aggactatta aggtgtttac 4980aacagtagac aacattaacc tccacacgca agttgtggac atgtcaatga catatggaca 5040acagtttggt ccaacttatt tggatggagc tgatgttact aaaataaaac ctcataattc 5100acatgaaggt aaaacatttt atgttttacc taatgatgac actctacgtg ttgaggcttt 5160tgagtactac cacacaactg atcctagttt tctgggtagg tacatgtcag cattaaatca 5220cactaaaaag tggaaatacc cacaagttaa tggtttaact tctattaaat gggcagataa 5280caactgttat cttgccactg cattgttaac actccaacaa atagagttga agtttaatcc 5340acctgctcta caagatgctt attacagagc aagggctggt gaagctgcta acttttgtgc 5400acttatctta gcctactgta ataagacagt aggtgagtta ggtgatgtta gagaaacaat 5460gagttacttg tttcaacatg ccaatttaga ttcttgcaaa agagtcttga acgtggtgtg 5520taaaacttgt ggacaacagc agacaaccct taagggtgta gaagctgtta tgtacatggg 5580cacactttct tatgaacaat ttaagaaagg tgttcagata ccttgtacgt gtggtaaaca 5640agctacaaaa tatctagtac aacaggagtc accttttgtt atgatgtcag caccacctgc 5700tcagtatgaa cttaagcatg gtacatttac ttgtgctagt gagtacactg gtaattacca 5760gtgtggtcac tataaacata taacttctaa agaaactttg tattgcatag acggtgcttt 5820acttacaaag tcctcagaat acaaaggtcc tattacggat gttttctaca aagaaaacag 5880ttacacaaca accataaaac cagttactta taaattggat ggtgttgttt gtacagaaat 5940tgaccctaag ttggacaatt attataagaa agacaattct tatttcacag agcaaccaat 6000tgatcttgta ccaaaccaac catatccaaa cgcaagcttc gataatttta agtttgtatg 6060tgataatatc aaatttgctg atgatttaaa ccagttaact ggttataaga aacctgcttc 6120aagagagctt aaagttacat ttttccctga cttaaatggt gatgtggtgg ctattgatta 6180taaacactac acaccctctt ttaagaaagg agctaaattg ttacataaac ctattgtttg 6240gcatgttaac aatgcaacta ataaagccac gtataaacca aatacctggt gtatacgttg 6300tctttggagc acaaaaccag ttgaaacatc aaattcgttt gatgtactga agtcagagga 6360cgcgcaggga atggataatc ttgcctgcga agatctaaaa ccagtctctg aagaagtagt 6420ggaaaatcct accatacaga aagacgttct tgagtgtaat gtgaaaacta ccgaagttgt 6480aggagacatt atacttaaac cagcaaataa tagtttaaaa attacagaag aggttggcca 6540cacagatcta atggctgctt atgtagacaa ttctagtctt actattaaga aacctaatga 6600attatctaga gtattaggtt tgaaaaccct tgctactcat ggtttagctg ctgttaatag 6660tgtcccttgg gatactatag ctaattatgc taagcctttt cttaacaaag ttgttagtac 6720aactactaac atagttacac ggtgtttaaa ccgtgtttgt actaattata tgccttattt 6780ctttacttta ttgctacaat tgtgtacttt tactagaagt acaaattcta gaattaaagc 6840atctatgccg actactatag caaagaatac tgttaagagt gtcggtaaat tttgtctaga 6900ggcttcattt aattatttga agtcacctaa tttttctaaa ctgataaata ttataatttg 6960gtttttacta ttaagtgttt gcctaggttc tttaatctac tcaaccgctg ctttaggtgt 7020tttaatgtct aatttaggca tgccttctta ctgtactggt tacagagaag gctatttgaa 7080ctctactaat gtcactattg caacctactg tactggttct ataccttgta gtgtttgtct 7140tagtggttta gattctttag acacctatcc ttctttagaa actatacaaa ttaccatttc 7200atcttttaaa tgggatttaa ctgcttttgg cttagttgca gagtggtttt tggcatatat 7260tcttttcact aggtttttct atgtacttgg attggctgca atcatgcaat tgtttttcag 7320ctattttgca gtacatttta ttagtaattc ttggcttatg tggttaataa ttaatcttgt 7380acaaatggcc ccgatttcag ctatggttag aatgtacatc ttctttgcat cattttatta 7440tgtatggaaa agttatgtgc atgttgtaga cggttgtaat tcatcaactt gtatgatgtg 7500ttacaaacgt aatagagcaa caagagtcga atgtacaact attgttaatg gtgttagaag 7560gtccttttat gtctatgcta atggaggtaa aggcttttgc aaactacaca attggaattg 7620tgttaattgt gatacattct gtgctggtag tacatttatt agtgatgaag ttgcgagaga 7680cttgtcacta cagtttaaaa gaccaataaa tcctactgac cagtcttctt acatcgttga 7740tagtgttaca gtgaagaatg gttccatcca tctttacttt gataaagctg gtcaaaagac 7800ttatgaaaga cattctctct ctcattttgt taacttagac aacctgagag ctaataacac 7860taaaggttca ttgcctatta atgttatagt ttttgatggt aaatcaaaat gtgaagaatc 7920atctgcaaaa tcagcgtctg tttactacag tcagcttatg tgtcaaccta tactgttact 7980agatcaggca ttagtgtctg atgttggtga tagtgcggaa gttgcagtta aaatgtttga 8040tgcttacgtt aatacgtttt catcaacttt taacgtacca atggaaaaac tcaaaacact 8100agttgcaact gcagaagctg aacttgcaaa gaatgtgtcc ttagacaatg tcttatctac 8160ttttatttca gcagctcggc aagggtttgt tgattcagat gtagaaacta aagatgttgt 8220tgaatgtctt aaattgtcac atcaatctga catagaagtt actggcgata gttgtaataa 8280ctatatgctc acctataaca aagttgaaaa catgacaccc cgtgaccttg gtgcttgtat 8340tgactgtagt gcgcgtcata ttaatgcgca ggtagcaaaa agtcacaaca ttgctttgat 8400atggaacgtt aaagatttca tgtcattgtc tgaacaacta cgaaaacaaa tacgtagtgc 8460tgctaaaaag aataacttac cttttaagtt gacatgtgca actactagac aagttgttaa 8520tgttgtaaca acaaagatag cacttaaggg tggtaaaatt gttaataatt ggttgaagca 8580gttaattaaa gttacacttg tgttcctttt tgttgctgct attttctatt taataacacc 8640tgttcatgtc atgtctaaac atactgactt ttcaagtgaa atcataggat acaaggctat 8700tgatggtggt gtcactcgtg acatagcatc tacagatact tgttttgcta acaaacatgc 8760tgattttgac acatggttta gccagcgtgg tggtagttat actaatgaca aagcttgccc 8820attgattgct gcagtcataa caagagaagt gggttttgtc gtgcctggtt tgcctggcac 8880gatattacgc acaactaatg gtgacttttt gcatttctta cctagagttt ttagtgcagt 8940tggtaacatc tgttacacac catcaaaact tatagagtac actgactttg caacatcagc 9000ttgtgttttg gctgctgaat gtacaatttt taaagatgct tctggtaagc cagtaccata 9060ttgttatgat accaatgtac tagaaggttc tgttgcttat gaaagtttac gccctgacac 9120acgttatgtg ctcatggatg gctctattat tcaatttcct aacacctacc ttgaaggttc 9180tgttagagtg gtaacaactt ttgattctga gtactgtagg cacggcactt gtgaaagatc 9240agaagctggt gtttgtgtat ctactagtgg tagatgggta cttaacaatg attattacag 9300atctttacca ggagttttct gtggtgtaga tgctgtaaat ttacttacta atatgtttac 9360accactaatt caacctattg gtgctttgga catatcagca tctatagtag ctggtggtat 9420tgtagctatc gtagtaacat gccttgccta ctattttatg aggtttagaa gagcttttgg 9480tgaatacagt catgtagttg cctttaatac tttactattc cttatgtcat tcactgtact 9540ctgtttaaca ccagtttact cattcttacc tggtgtttat tctgttattt acttgtactt 9600gacattttat cttactaatg atgtttcttt tttagcacat attcagtgga tggttatgtt 9660cacaccttta gtacctttct ggataacaat tgcttatatc atttgtattt ccacaaagca 9720tttctattgg ttctttagta attacctaaa gagacgtgta gtctttaatg gtgtttcctt 9780tagtactttt gaagaagctg cgctgtgcac ctttttgtta aataaagaaa tgtatctaaa 9840gttgcgtagt gatgtgctat tacctcttac gcaatataat agatacttag ctctttataa 9900taagtacaag tattttagtg gagcaatgga tacaactagc tacagagaag ctgcttgttg 9960tcatctcgca aaggctctca atgacttcag taactcaggt tctgatgttc tttaccaacc 10020accacaaacc tctatcacct cagctgtttt gcagagtggt tttagaaaaa tggcattccc 10080atctggtaaa gttgagggtt gtatggtaca agtaacttgt ggtacaacta cacttaacgg 10140tctttggctt gatgacgtag tttactgtcc aagacatgtg atctgcacct ctgaagacat 10200gcttaaccct aattatgaag atttactcat tcgtaagtct aatcataatt tcttggtaca 10260ggctggtaat gttcaactca gggttattgg acattctatg caaaattgtg tacttaagct 10320taaggttgat acagccaatc ctaagacacc taagtataag tttgttcgca ttcaaccagg 10380acagactttt tcagtgttag cttgttacaa tggttcacca tctggtgttt accaatgtgc 10440tatgaggccc aatttcacta ttaagggttc attccttaat ggttcatgtg gtagtgttgg 10500ttttaacata gattatgact gtgtctcttt ttgttacatg caccatatgg aattaccaac 10560tggagttcat gctggcacag acttagaagg taacttttat ggaccttttg ttgacaggca 10620aacagcacaa gcagctggta cggacacaac tattacagtt aatgttttag cttggttgta 10680cgctgctgtt ataaatggag acaggtggtt tctcaatcga tttaccacaa ctcttaatga 10740ctttaacctt gtggctatga agtacaatta tgaacctcta acacaagacc atgttgacat 10800actaggacct ctttctgctc aaactggaat tgccgtttta gatatgtgtg cttcattaaa 10860agaattactg caaaatggta tgaatggacg taccatattg ggtagtgctt tattagaaga 10920tgaatttaca ccttttgatg ttgttagaca atgctcaggt gttactttcc aaagtgcagt 10980gaaaagaaca atcaagggta cacaccactg gttgttactc acaattttga cttcactttt 11040agttttagtc cagagtactc aatggtcttt gttctttttt ttgtatgaaa atgccttttt 11100accttttgct atgggtatta ttgctatgtc tgcttttgca atgatgtttg tcaaacataa 11160gcatgcattt ctctgtttgt ttttgttacc ttctcttgcc actgtagctt attttaatat 11220ggtctatatg cctgctagtt gggtgatgcg tattatgaca tggttggata tggttgatac 11280tagtttgtct ggttttaagc taaaagactg tgttatgtat gcatcagctg tagtgttact 11340aatccttatg acagcaagaa ctgtgtatga tgatggtgct aggagagtgt ggacacttat 11400gaatgtcttg acactcgttt ataaagttta ttatggtaat gctttagatc aagccatttc 11460catgtgggct cttataatct ctgttacttc taactactca ggtgtagtta caactgtcat 11520gtttttggcc agaggtattg

tttttatgtg tgttgagtat tgccctattt tcttcataac 11580tggtaataca cttcagtgta taatgctagt ttattgtttc ttaggctatt tttgtacttg 11640ttactttggc ctcttttgtt tactcaaccg ctactttaga ctgactcttg gtgtttatga 11700ttacttagtt tctacacagg agtttagata tatgaattca cagggactac tcccacccaa 11760gaatagcata gatgccttca aactcaacat taaattgttg ggtgttggtg gcaaaccttg 11820tatcaaagta gccactgtac agtctaaaat gtcagatgta aagtgcacat cagtagtctt 11880actctcagtt ttgcaacaac tcagagtaga atcatcatct aaattgtggg ctcaatgtgt 11940ccagttacac aatgacattc tcttagctaa agatactact gaagcctttg aaaaaatggt 12000ttcactactt tctgttttgc tttccatgca gggtgctgta gacataaaca agctttgtga 12060agaaatgctg gacaacaggg caaccttaca agctatagcc tcagagttta gttcccttcc 12120atcatatgca gcttttgcta ctgctcaaga agcttatgag caggctgttg ctaatggtga 12180ttctgaagtt gttcttaaaa agttgaagaa gtctttgaat gtggctaaat ctgaatttga 12240ccgtgatgca gccatgcaac gtaagttgga aaagatggct gatcaagcta tgacccaaat 12300gtataaacag gctagatctg aggacaagag ggcaaaagtt actagtgcta tgcagacaat 12360gcttttcact atgcttagaa agttggataa tgatgcactc aacaacatta tcaacaatgc 12420aagagatggt tgtgttccct tgaacataat acctcttaca acagcagcca aactaatggt 12480tgtcatacca gactataaca catataaaaa tacgtgtgat ggtacaacat ttacttatgc 12540atcagcattg tgggaaatcc aacaggttgt agatgcagat agtaaaattg ttcaacttag 12600tgaaattagt atggacaatt cacctaattt agcatggcct cttattgtaa cagctttaag 12660ggccaattct gctgtcaaat tacagaataa tgagcttagt cctgttgcac tacgacagat 12720gtcttgtgct gccggtacta cacaaactgc ttgcactgat gacaatgcgt tagcttacta 12780caacacaaca aagggaggta ggtttgtact tgcactgtta tccgatttac aggatttgaa 12840atgggctaga ttccctaaga gtgatggaac tggtactatc tatacagaac tggaaccacc 12900ttgtaggttt gttacagaca cacctaaagg tcctaaagtg aagtatttat actttattaa 12960aggattaaac aacctaaata gaggtatggt acttggtagt ttagctgcca cagtacgtct 13020acaagctggt aatgcaacag aagtgcctgc caattcaact gtattatctt tctgtgcttt 13080tgctgtagat gctgctaaag cttacaaaga ttatctagct agtgggggac aaccaatcac 13140taattgtgtt aagatgttgt gtacacacac tggtactggt caggcaataa cagttacacc 13200ggaagccaat atggatcaag aatcctttgg tggtgcatcg tgttgtctgt actgccgttg 13260ccacatagat catccaaatc ctaaaggatt ttgtgactta aaaggtaagt atgtacaaat 13320acctacaact tgtgctaatg accctgtggg ttttacactt aaaaacacag tctgtaccgt 13380ctgcggtatg tggaaaggtt atggctgtag ttgtgatcaa ctccgcgaac ccatgcttca 13440gtcagctgat gcacaatcgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca 13500ccgtgcggca caggcactag tactgatgtc gtatacaggg cttttgacat ctacaatgat 13560aaagtagctg gttttgctaa attcctaaaa actaattgtt gtcgcttcca agaaaaggac 13620gaagatgaca atttaattga ttcttacttt gtagttaaga gacacacttt ctctaactac 13680caacatgaag aaacaattta taatttactt aaggattgtc cagctgttgc taaacatgac 13740ttctttaagt ttagaataga cggtgacatg gtaccacata tatcacgtca acgtcttact 13800aaatacacaa tggcagacct cgtctatgct ttaaggcatt ttgatgaagg taattgtgac 13860acattaaaag aaatacttgt cacatacaat tgttgtgatg atgattattt caataaaaag 13920gactggtatg attttgtaga aaacccagat atattacgcg tatacgccaa cttaggtgaa 13980cgtgtacgcc aagctttgtt aaaaacagta caattctgtg atgccatgcg aaatgctggt 14040attgttggtg tactgacatt agataatcaa gatctcaatg gtaactggta tgatttcggt 14100gatttcatac aaaccacgcc aggtagtgga gttcctgttg tagattctta ttattcattg 14160ttaatgccta tattaacctt gaccagggct ttaactgcag agtcacatgt tgacactgac 14220ttaacaaagc cttacattaa gtgggatttg ttaaaatatg acttcacgga agagaggtta 14280aaactctttg accgttattt taaatattgg gatcagacat accacccaaa ttgtgttaac 14340tgtttggatg acagatgcat tctgcattgt gcaaacttta atgttttatt ctctacagtg 14400ttcccaccta caagttttgg accactagtg agaaaaatat ttgttgatgg tgttccattt 14460gtagtttcaa ctggatacca cttcagagag ctaggtgttg tacataatca ggatgtaaac 14520ttacatagct ctagacttag ttttaaggaa ttacttgtgt atgctgctga ccctgctatg 14580cacgctgctt ctggtaatct attactagat aaacgcacta cgtgcttttc agtagctgca 14640cttactaaca atgttgcttt tcaaactgtc aaacccggta attttaacaa agacttctat 14700gactttgctg tgtctaaggg tttctttaag gaaggaagtt ctgttgaatt aaaacacttc 14760ttctttgctc aggatggtaa tgctgctatc agcgattatg actactatcg ttataatcta 14820ccaacaatgt gtgatatcag acaactacta tttgtagttg aagttgttga taagtacttt 14880gattgttacg atggtggctg tattaatgct aaccaagtca tcgtcaacaa cctagacaaa 14940tcagctggtt ttccatttaa taaatggggt aaggctagac tttattatga ttcaatgagt 15000tatgaggatc aagatgcact tttcgcatat acaaaacgta atgtcatccc tactataact 15060caaatgaatc ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc 15120tctatctgta gtactatgac caatagacag tttcatcaaa aattattgaa atcaatagcc 15180gccactagag gagctactgt agtaattgga acaagcaaat tctatggtgg ttggcacaac 15240atgttaaaaa ctgtttatag tgatgtagaa aaccctcacc ttatgggttg ggattatcct 15300aaatgtgata gagccatgcc taacatgctt agaattatgg cctcacttgt tcttgctcgc 15360aaacatacaa cgtgttgtag cttgtcacac cgtttctata gattagctaa tgagtgtgct 15420caagtattga gtgaaatggt catgtgtggc ggttcactat atgttaaacc aggtggaacc 15480tcatcaggag atgccacaac tgcttatgct aatagtgttt ttaacatttg tcaagctgtc 15540acggccaatg ttaatgcact tttatctact gatggtaaca aaattgccga taagtatgtc 15600cgcaatttac aacacagact ttatgagtgt ctctatagaa atagagatgt tgacacagac 15660tttgtgaatg agttttacgc atatttgcgt aaacatttct caatgatgat actctctgac 15720gatgctgttg tgtgtttcaa tagcacttat gcatctcaag gtctagtggc tagcataaag 15780aactttaagt cagttcttta ttatcaaaac aatgttttta tgtctgaagc aaaatgttgg 15840actgagactg accttactaa aggacctcat gaattttgct ctcaacatac aatgctagtt 15900aaacagggtg atgattatgt gtaccttcct tacccagatc catcaagaat cctaggggcc 15960ggctgttttg tagatgatat cgtaaaaaca gatggtacac ttatgattga acggttcgtg 16020tctttagcta tagatgctta cccacttact aaacatccta atcaggagta tgctgatgtc 16080tttcatttgt acttacaata cataagaaag ctacatgatg agttaacagg acacatgtta 16140gacatgtatt ctgttatgct tactaatgat aacacttcaa ggtattggga acctgagttt 16200tatgaggcta tgtacacacc gcatacagtc ttacaggctg ttggggcttg tgttctttgc 16260aattcacaga cttcattaag atgtggtgct tgcatacgta gaccattctt atgttgtaaa 16320tgctgttacg accatgtcat atcaacatca cataaattag tcttgtctgt taatccgtat 16380gtttgcaatg ctccaggttg tgatgtcaca gatgtgactc aactttactt aggaggtatg 16440agctattatt gtaaatcaca taaaccaccc attagttttc cattgtgtgc taatggacaa 16500gtttttggtt tatataaaaa tacatgtgtt ggtagcgata atgttactga ctttaatgca 16560attgcaacat gtgactggac aaatgctggt gattacattt tagctaacac ctgtactgaa 16620agactcaagc tttttgcagc agaaacgctc aaagctactg aggagacatt taaactgtct 16680tatggtattg ctactgtacg tgaagtgctg tctgacagag aattacatct ttcatgggaa 16740gttggtaaac ctagaccacc acttaaccga aattatgtct ttactggtta tcgtgtaact 16800aaaaacagta aagtacaaat aggagagtac acctttgaaa aaggtgacta tggtgatgct 16860gttgtttacc gaggtacaac aacttacaaa ttaaatgttg gtgattattt tgtgctgaca 16920tcacatacag taatgccatt aagtgcacct acactagtgc cacaagagca ctatgttaga 16980attactggct tatacccaac actcaatatc tcagatgagt tttctagcaa tgttgcaaat 17040tatcaaaagg ttggtatgca aaagtattct acactccagg gaccacctgg tactggtaag 17100agtcattttg ctattggcct agctctctac tacccttctg ctcgcatagt gtatacagct 17160tgctctcatg ccgctgttga tgcactatgt gagaaggcat taaaatattt gcctatagat 17220aaatgtagta gaattatacc tgcacgtgct cgtgtagagt gttttgataa attcaaagtg 17280aattcaacat tagaacagta tgtcttttgt actgtaaatg cattgcctga gacgacagca 17340gatatagttg tctttgatga aatttcaatg gccacaaatt atgatttgag tgttgtcaat 17400gccagattac gtgctaagca ctatgtgtac attggcgacc ctgctcaatt acctgcacca 17460cgcacattgc taactaaggg cacactagaa ccagaatatt tcaattcagt gtgtagactt 17520atgaaaacta taggtccaga catgttcctc ggaacttgtc ggcgttgtcc tgctgaaatt 17580gttgacactg tgagtgcttt ggtttatgat aataagctta aagcacataa agacaaatca 17640gctcaatgct ttaaaatgtt ttataagggt gttatcacgc atgatgtttc atctgcaatt 17700aacaggccac aaataggcgt ggtaagagaa ttccttacac gtaaccctgc ttggagaaaa 17760gctgtcttta tttcacctta taattcacag aatgctgtag cctcaaagat tttgggacta 17820ccaactcaaa ctgttgattc atcacagggc tcagaatatg actatgtcat attcactcaa 17880accactgaaa cagctcactc ttgtaatgta aacagattta atgttgctat taccagagca 17940aaagtaggca tactttgcat aatgtctgat agagaccttt atgacaagtt gcaatttaca 18000agtcttgaaa ttccacgtag gaatgtggca actttacaag ctgaaaatgt aacaggactc 18060tttaaagatt gtagtaaggt aatcactggg ttacatccta cacaggcacc tacacacctc 18120agtgttgaca ctaaattcaa aactgaaggt ttatgtgttg acatacctgg catacctaag 18180gacatgacct atagaagact catctctatg atgggtttta aaatgaatta tcaagttaat 18240ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt 18300ggcttcgatg tcgaggggtg tcatgctact agagaagctg ttggtaccaa tttaccttta 18360cagctaggtt tttctacagg tgttaaccta gttgctgtac ctacaggtta tgttgataca 18420cctaataata cagatttttc cagagttagt gctaaaccac cgcctggaga tcaatttaaa 18480cacctcatac cacttatgta caaaggactt ccttggaatg tagtgcgtat aaagattgta 18540caaatgttaa gtgacacact taaaaatctc tctgacagag tcgtatttgt cttatgggca 18600catggctttg agttgacatc tatgaagtat tttgtgaaaa taggacctga gcgcacctgt 18660tgtctatgtg atagacgtgc cacatgcttt tccactgctt cagacactta tgcctgttgg 18720catcattcta ttggatttga ttacgtctat aatccgttta tgattgatgt tcaacaatgg 18780ggttttacag gtaacctaca aagcaaccat gatctgtatt gtcaagtcca tggtaatgca 18840catgtagcta gttgtgatgc aatcatgact aggtgtctag ctgtccacga gtgctttgtt 18900aagcgtgttg actggactat tgaatatcct ataattggtg atgaactgaa gattaatgcg 18960gcttgtagaa aggttcaaca catggttgtt aaagctgcat tattagcaga caaattccca 19020gttcttcacg acattggtaa ccctaaagct attaagtgtg tacctcaagc tgatgtagaa 19080tggaagttct atgatgcaca gccttgtagt gacaaagctt ataaaataga agaattattc 19140tattcttatg ccacacattc tgacaaattc acagatggtg tatgcctatt ttggaattgc 19200aatgtcgata gatatcctgc taattccatt gtttgtagat ttgacactag agtgctatct 19260aaccttaact tgcctggttg tgatggtggc agtttgtatg taaataaaca tgcattccac 19320acaccagctt ttgataaaag tgcttttgtt aatttaaaac aattaccatt tttctattac 19380tctgacagtc catgtgagtc tcatggaaaa caagtagtgt cagatataga ttatgtacca 19440ctaaagtctg ctacgtgtat aacacgttgc aatttaggtg gtgctgtctg tagacatcat 19500gctaatgagt acagattgta tctcgatgct tataacatga tgatctcagc tggctttagc 19560ttgtgggttt acaaacaatt tgatacttat aacctctgga acacttttac aagacttcag 19620agtttagaaa atgtggcttt taatgttgta aataagggac actttgatgg acaacagggt 19680gaagtaccag tttctatcat taataacact gtttacacaa aagttgatgg tgttgatgta 19740gaattgtttg aaaataaaac aacattacct gttaatgtag catttgagct ttgggctaag 19800cgcaacatta aaccagtacc agaggtgaaa atactcaata atttgggtgt ggacattgct 19860gctaatactg tgatctggga ctacaaaaga gatgctccag cacatatatc tactattggt 19920gtttgttcta tgactgacat agccaagaaa ccaactgaaa cgatttgtgc accactcact 19980gtcttttttg atggtagagt tgatggtcaa gtagacttat ttagaaatgc ccgtaatggt 20040gttcttatta cagaaggtag tgttaaaggt ttacaaccat ctgtaggtcc caaacaagct 20100agtcttaatg gagtcacatt aattggagaa gccgtaaaaa cacagttcaa ttattataag 20160aaagttgatg gtgttgtcca acaattacct gaaacttact ttactcagag tagaaattta 20220caagaattta aacccaggag tcaaatggaa attgatttct tagaattagc tatggatgaa 20280ttcattgaac ggtataaatt agaaggctat gccttcgaac atatcgttta tggagatttt 20340agtcatagtc agttaggtgg tttacatcta ctgattggac tagctaaacg ttttaaggaa 20400tcaccttttg aattagaaga ttttattcct atggacagta cagttaaaaa ctatttcata 20460acagatgcgc aaacaggttc atctaagtgt gtgtgttctg ttattgattt attacttgat 20520gattttgttg aaataataaa atcccaagat ttatctgtag tttctaaggt tgtcaaagtg 20580actattgact atacagaaat ttcatttatg ctttggtgta aagatggcca tgtagaaaca 20640ttttacccaa aattacaatc tagtcaagcg tggcaaccgg gtgttgctat gcctaatctt 20700tacaaaatgc aaagaatgct attagaaaag tgtgaccttc aaaattatgg tgatagtgca 20760acattaccta aaggcataat gatgaatgtc gcaaaatata ctcaactgtg tcaatattta 20820aacacattaa cattagctgt accctataat atgagagtta tacattttgg tgctggttct 20880gataaaggag ttgcaccagg tacagctgtt ttaagacagt ggttgcctac gggtacgctg 20940cttgtcgatt cagatcttaa tgactttgtc tctgatgcag attcaacttt gattggtgat 21000tgtgcaactg tacatacagc taataaatgg gatctcatta ttagtgatat gtacgaccct 21060aagactaaaa atgttacaaa agaaaatgac tctaaagagg gttttttcac ttacatttgt 21120gggtttatac aacaaaagct agctcttgga ggttccgtgg ctataaagat aacagaacat 21180tcttggaatg ctgatcttta taagctcatg ggacacttcg catggtggac agcctttgtt 21240actaatgtga atgcgtcatc atctgaagca tttttaattg gatgtaatta tcttggcaaa 21300ccacgcgaac aaatagatgg ttatgtcatg catgcaaatt acatattttg gaggaataca 21360aatccaattc agttgtcttc ctattcttta tttgacatga gtaaatttcc ccttaaatta 21420aggggtactg ctgttatgtc tttaaaagaa ggtcaaatca atgatatgat tttatctctt 21480cttagtaaag gtagacttat aattagagaa aacaacagag ttgttatttc tagtgatgtt 21540cttgttaaca actaaacgaa caatgtttgt ttttcttgtt ttattgccac tagtctctag 21600tcagtgtgtt aatcttacaa ccagaactca attaccccct gcatacacta attctttcac 21660acgtggtgtt tattaccctg acaaagtttt cagatcctca gttttacatt caactcagga 21720cttgttctta cctttctttt ccaatgttac ttggttccat gctatacatg tctctgggac 21780caatggtact aagaggtttg ataaccctgt cctaccattt aatgatggtg tttattttgc 21840ttccactgag aagtctaaca taataagagg ctggattttt ggtactactt tagattcgaa 21900gacccagtcc ctacttattg ttaataacgc tactaatgtt gttattaaag tctgtgaatt 21960tcaattttgt aatgatccat ttttgggtgt ttattaccac aaaaacaaca aaagttggat 22020ggaaagtgag ttcagagttt attctagtgc gaataattgc acttttgaat atgtctctca 22080gccttttctt atggaccttg aaggaaaaca gggtaatttc aaaaatctta gggaatttgt 22140gtttaagaat attgatggtt attttaaaat atattctaag cacacgccta ttaatttagt 22200gcgtgatctc cctcagggtt tttcggcttt agaaccattg gtagatttgc caataggtat 22260taacatcact aggtttcaaa ctttacttgc tttacataga agttatttga ctcctggtga 22320ttcttcttca ggttggacag ctggtgctgc agcttattat gtgggttatc ttcaacctag 22380gacttttcta ttaaaatata atgaaaatgg aaccattaca gatgctgtag actgtgcact 22440tgaccctctc tcagaaacaa agtgtacgtt gaaatccttc actgtagaaa aaggaatcta 22500tcaaacttct aactttagag tccaaccaac agaatctatt gttagatttc ctaatattac 22560aaacttgtgc ccttttggtg aagtttttaa cgccaccaga tttgcatctg tttatgcttg 22620gaacaggaag agaatcagca actgtgttgc tgattattct gtcctatata attccgcatc 22680attttccact tttaagtgtt atggagtgtc tcctactaaa ttaaatgatc tctgctttac 22740taatgtctat gcagattcat ttgtaattag aggtgatgaa gtcagacaaa tcgctccagg 22800gcaaactgga aagattgctg attataatta taaattacca gatgatttta caggctgcgt 22860tatagcttgg aattctaaca atcttgattc taaggttggt ggtaattata attacctgta 22920tagattgttt aggaagtcta atctcaaacc ttttgagaga gatatttcaa ctgaaatcta 22980tcaggccggt agcacacctt gtaatggtgt tgaaggtttt aattgttact ttcctttaca 23040atcatatggt ttccaaccca ctaatggtgt tggttaccaa ccatacagag tagtagtact 23100ttcttttgaa cttctacatg caccagcaac tgtttgtgga cctaaaaagt ctactaattt 23160ggttaaaaac aaatgtgtca atttcaactt caatggttta acaggcacag gtgttcttac 23220tgagtctaac aaaaagtttc tgcctttcca acaatttggc agagacattg ctgacactac 23280tgatgctgtc cgtgatccac agacacttga gattcttgac attacaccat gttcttttgg 23340tggtgtcagt gttataacac caggaacaaa tacttctaac caggttgctg ttctttatca 23400ggatgttaac tgcacagaag tccctgttgc tattcatgca gatcaactta ctcctacttg 23460gcgtgtttat tctacaggtt ctaatgtttt tcaaacacgt gcaggctgtt taataggggc 23520tgaacatgtc aacaactcat atgagtgtga catacccatt ggtgcaggta tatgcgctag 23580ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat 23640tgcctacact atgtcacttg gtgcagaaaa ttcagttgct tactctaata actctattgc 23700catacccaca aattttacta ttagtgttac cacagaaatt ctaccagtgt ctatgaccaa 23760gacatcagta gattgtacaa tgtacatttg tggtgattca actgaatgca gcaatctttt 23820gttgcaatat ggcagttttt gtacacaatt aaaccgtgct ttaactggaa tagctgttga 23880acaagacaaa aacacccaag aagtttttgc acaagtcaaa caaatttaca aaacaccacc 23940aattaaagat tttggtggtt ttaatttttc acaaatatta ccagatccat caaaaccaag 24000caagaggtca tttattgaag atctactttt caacaaagtg acacttgcag atgctggctt 24060catcaaacaa tatggtgatt gccttggtga tattgctgct agagacctca tttgtgcaca 24120aaagtttaac ggccttactg ttttgccacc tttgctcaca gatgaaatga ttgctcaata 24180cacttctgca ctgttagcgg gtacaatcac ttctggttgg acctttggtg caggtgctgc 24240attacaaata ccatttgcta tgcaaatggc ttataggttt aatggtattg gagttacaca 24300gaatgttctc tatgagaacc aaaaattgat tgccaaccaa tttaatagtg ctattggcaa 24360aattcaagac tcactttctt ccacagcaag tgcacttgga aaacttcaag atgtggtcaa 24420ccaaaatgca caagctttaa acacgcttgt taaacaactt agctccaatt ttggtgcaat 24480ttcaagtgtt ttaaatgata tcctttcacg tcttgacaaa gttgaggctg aagtgcaaat 24540tgataggttg atcacaggca gacttcaaag tttgcagaca tatgtgactc aacaattaat 24600tagagctgca gaaatcagag cttctgctaa tcttgctgct actaaaatgt cagagtgtgt 24660acttggacaa tcaaaaagag ttgatttttg tggaaagggc tatcatctta tgtccttccc 24720tcagtcagca cctcatggtg tagtcttctt gcatgtgact tatgtccctg cacaagaaaa 24780gaacttcaca actgctcctg ccatttgtca tgatggaaaa gcacactttc ctcgtgaagg 24840tgtctttgtt tcaaatggca cacactggtt tgtaacacaa aggaattttt atgaaccaca 24900aatcattact acagacaaca catttgtgtc tggtaactgt gatgttgtaa taggaattgt 24960caacaacaca gtttatgatc ctttgcaacc tgaattagac tcattcaagg aggagttaga 25020taaatatttt aagaatcata catcaccaga tgttgattta ggtgacatct ctggcattaa 25080tgcttcagtt gtaaacattc aaaaagaaat tgaccgcctc aatgaggttg ccaagaattt 25140aaatgaatct ctcatcgatc tccaagaact tggaaagtat gagcagtata taaaatggcc 25200atggtacatt tggctaggtt ttatagctgg cttgattgcc atagtaatgg tgacaattat 25260gctttgctgt atgaccagtt gctgtagttg tctcaagggc tgttgttctt gtggatcctg 25320ctgcaaattt gatgaagacg actctgagcc agtgctcaaa ggagtcaaat tacattacac 25380ataaacgaac ttatggattt gtttatgaga atcttcacaa ttggaactgt aactttgaag 25440caaggtgaaa tcaaggatgc tactccttca gattttgttc gcgctactgc aacgataccg 25500atacaagcct cactcccttt cggatggctt attgttggcg ttgcacttct tgctgttttt 25560cagagcgctt ccaaaatcat aaccctcaaa aagagatggc aactagcact ctccaagggt 25620gttcactttg tttgcaactt gctgttgttg tttgtaacag tttactcaca ccttttgctc 25680gttgctgctg gccttgaagc cccttttctc tatctttatg ctttagtcta cttcttgcag 25740agtataaact ttgtaagaat aataatgagg ctttggcttt gctggaaatg ccgttccaaa 25800aacccattac tttatgatgc caactatttt ctttgctggc atactaattg ttacgactat 25860tgtatacctt acaatagtgt aacttcttca attgtcatta cttcaggtga tggcacaaca 25920agtcctattt ctgaacatga ctaccagatt ggtggttata ctgaaaaatg ggaatctgga 25980gtaaaagact gtgttgtatt acacagttac ttcacttcag actattacca gctgtactca 26040actcaattga gtacagacac tggtgttgaa catgttacct tcttcatcta caataaaatt 26100gttgatgagc ctgaagaaca tgtccaaatt cacacaatcg acggttcatc cggagttgtt 26160aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220gcacaagctg atgagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280atagttaata gcgtacttct ttttcttgct ttcgtggtat tcttgctagt tacactagcc 26340atccttactg cgcttcgatt gtgtgcgtac tgctgcaata ttgttaacgt gagtcttgta 26400aaaccttctt tttacgttta ctctcgtgtt aaaaatctga attcttctag agttcctgat 26460cttctggtct aaacgaacta aatattatat tagtttttct gtttggaact ttaattttag 26520ccatggcaga ttccaacggt actattaccg ttgaagagct taaaaagctc cttgaacaat 26580ggaacctagt aataggtttc

ctattcctta catggatttg tcttctacaa tttgcctatg 26640ccaacaggaa taggtttttg tatataatta agttaatttt cctctggctg ttatggccag 26700taactttagc ttgttttgtg cttgctgctg tttacagaat aaattggatc accggtggaa 26760ttgctatcgc aatggcttgt cttgtaggct tgatgtggct cagctacttc attgcttctt 26820tcagactgtt tgcgcgtacg cgttccatgt ggtcattcaa tccagaaact aacattcttc 26880tcaacgtgcc actccatggc actattctga ccagaccgct tctagaaagt gaactcgtaa 26940tcggagctgt gatccttcgt ggacatcttc gtattgctgg acaccatcta ggacgctgtg 27000acatcaagga cctgcctaaa gaaatcactg ttgctacatc acgaacgctt tcttattaca 27060aattgggagc ttcgcagcgt gtagcaggtg actcaggttt tgctgcatac agtcgctaca 27120ggattggcaa ctataaatta aacacagacc attccagtag cagtgacaat attgctttgc 27180ttgtacagta agtgacaaca gatgtttcat ctcgttgact ttcaggttac tatagcagag 27240atattactaa ttattatgag gacttttaaa gtttccattt ggaatcttga ttacatcata 27300aacctcataa ttaaaaattt atctaagtca ctaactgaga ataaatattc tcaattagat 27360gaagagcaac caatggagat tgattaaacg aacatgaaaa ttattctttt cttggcactg 27420ataacactcg ctacttgtga gctttatcac taccaagagt gtgttagagg tacaacagta 27480cttttaaaag aaccttgctc ttctggaaca tacgagggca attcaccatt tcatcctcta 27540gctgataaca aatttgcact gacttgcttt agcactcaat ttgcttttgc ttgtcctgac 27600ggcgtaaaac acgtctatca gttacgtgcc agatcagttt cacctaaact gttcatcaga 27660caagaggaag ttcaagaact ttactctcca atttttctta ttgttgcggc aatagtgttt 27720ataacacttt gcttcacact caaaagaaag acagaatgat tgaactttca ttaattgact 27780tctatttgtg ctttttagcc tttctgctat tccttgtttt aattatgctt attatctttt 27840ggttctcact tgaactgcaa gatcataatg aaacttgtca cgcctaaacg aacatgaaat 27900ttcttgtttt cttaggaatc atcacaactg tagctgcatt tcaccaagaa tgtagtttac 27960agtcatgtac tcaacatcaa ccatatgtag ttgatgaccc gtgtcctatt cacttctatt 28020ctaaatggta tattagagta ggagctagaa aatcagcacc tttaattgaa ttgtgcgtgg 28080atgaggctgg ttctaaatca cccattcagt acatcgatat cggtaattat acagtttcct 28140gtttaccttt tacaattaat tgccaggaac ctaaattggg tagtcttgta gtgcgttgtt 28200cgttctatga agacttttta gagtatcatg acgttcgtgt tgttttagat ttcatctaaa 28260cgaacaaact aaaatgtctg ataatggacc ccaaaatcag cgaaatgcac cccgcattac 28320gtttggtgga ccctcagatt caactggcag taaccagaat ggagaacgca gtggggcgcg 28380atcaaaacaa cgtcggcccc aaggtttacc caataatact gcgtcttggt tcaccgctct 28440cactcaacat ggcaaggaag accttaaatt ccctcgagga caaggcgttc caattaacac 28500caatagcagt ccagatgacc aaattggcta ctaccgaaga gctaccagac gaattcgtgg 28560tggtgacggt aaaatgaaag atctcagtcc aagatggtat ttctactacc taggaactgg 28620gccagaagct ggacttccct atggtgctaa caaagacggc atcatatggg ttgcaactga 28680gggagccttg aatacaccaa aagatcacat tggcacccgc aatcctgcta acaatgctgc 28740aatcgtgcta caacttcctc aaggaacaac attgccaaaa ggcttctacg cagaagggag 28800cagaggcggc agtcaagcct cttctcgttc ctcatcacgt agtcgcaaca gttcaagaaa 28860ttcaactcca ggcagcagta ggggaacttc tcctgctaga atggctggca atggcggtga 28920tgctgctctt gctttgctgc tgcttgacag attgaaccag cttgagagca aaatgtctgg 28980taaaggccaa caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcttctaa 29040gaagcctcgg caaaaacgta ctgccactaa agcatacaat gtaacacaag ctttcggcag 29100acgtggtcca gaacaaaccc aaggaaattt tggggaccag gaactaatca gacaaggaac 29160tgattacaaa cattggccgc aaattgcaca atttgccccc agcgcttcag cgttcttcgg 29220aatgtcgcgc attggcatgg aagtcacacc ttcgggaacg tggttgacct acacaggtgc 29280catcaaattg gatgacaaag atccaaattt caaagatcaa gtcattttgc tgaataagca 29340tattgacgca tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaagaaggc 29400tgatgaaact caagccttac cgcagagaca gaagaaacag caaactgtga ctcttcttcc 29460tgctgcagat ttggatgatt tctccaaaca attgcaacaa tccatgagca gtgctgactc 29520aactcaggcc taaactcatg cagaccacac aaggcagatg ggctatataa acgttttcgc 29580ttttccgttt acgatatata gtctactctt gtgcagaatg aattctcgta actacatagc 29640acaagtagat gtagttaact ttaatctcac atagcaatct ttaatcagtg tgtaacatta 29700gggaggactt gaaagagcca ccacattttc accgaggcca cgcggagtac gatcgagtgt 29760acagtgaaca atgctaggga gagctgccta tatggaagag ccctaatgtg taaaattaat 29820tttagtagtg ctatccccat gtgattttaa tagcttctta ggagaatgac aaaaaaaaaa 29880aaaaaaaaaa aaaaaaaaaa aaa 299035326DNAArtificial SequenceOligonucleotide 53acactagcca tccttactgc gcttcg 265421PRTArtificial SequenceOligopeptide 54Met Ala Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu1 5 10 15Gly Phe His Glu Ala 2055805PRTHomo sapiens 55Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala1 5 10 15Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe 20 25 30Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp 35 40 45Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn 50 55 60Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala65 70 75 80Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln 85 90 95Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys 100 105 110Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser 115 120 125Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu 130 135 140Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu145 150 155 160Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu 165 170 175Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg 180 185 190Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu 195 200 205Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu 210 215 220Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu225 230 235 240His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile 245 250 255Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly 260 265 270Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys 275 280 285Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala 290 295 300Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu305 310 315 320Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro 325 330 335Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly 340 345 350Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp 355 360 365Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala 370 375 380Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe385 390 395 400His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys 405 410 415His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn 420 425 430Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly 435 440 445Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe 450 455 460Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met465 470 475 480Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr 485 490 495Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe 500 505 510Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala 515 520 525Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile 530 535 540Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu545 550 555 560Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala 565 570 575Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe 580 585 590Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr 595 600 605Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu 610 615 620Lys Ser Ala Leu Gly Asp Arg Ala Tyr Glu Trp Asn Asp Asn Glu Met625 630 635 640Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala Met Arg Gln Tyr Phe Leu 645 650 655Lys Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val 660 665 670Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro 675 680 685Lys Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile 690 695 700Arg Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn705 710 715 720Ser Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln 725 730 735Pro Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val 740 745 750Ile Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg 755 760 765Lys Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile 770 775 780Asp Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp785 790 795 800Val Gln Thr Ser Phe 80556385PRTHomo sapiens 56Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu1 5 10 15Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp Asn Tyr Asn Thr Asn 20 25 30Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn Ala Gly Asp Lys Trp 35 40 45Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro Leu 50 55 60Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln Leu Gln Ala Leu Gln65 70 75 80Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys Ser Lys Arg Leu Asn 85 90 95Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser Thr Gly Lys Val Cys 100 105 110Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu Glu Pro Gly Leu Asn 115 120 125Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu Arg Leu Trp Ala Trp 130 135 140Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu Arg Pro Leu Tyr Glu145 150 155 160Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg Ala Asn His Tyr Glu 165 170 175Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu Val Asn Gly Val Asp 180 185 190Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu Asp Val Glu His Thr 195 200 205Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu His Ala Tyr Val Arg 210 215 220Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile Ser Pro Ile Gly Cys225 230 235 240Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly Arg Phe Trp Thr Asn 245 250 255Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys Pro Asn Ile Asp Val 260 265 270Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala Gln Arg Ile Phe Lys 275 280 285Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu Pro Asn Met Thr Gln 290 295 300Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro Gly Asn Val Gln Lys305 310 315 320Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe Arg 325 330 335Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp Phe Leu Thr Ala His 340 345 350His Glu Met Gly His Ile Gln Tyr Asp Met Ala Tyr Ala Ala Gln Pro 355 360 365Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe His Glu Ala Val Gly 370 375 380Glu3855765DNAArtificial SequenceOligonucleotide 57gccttgtccc tggtttcaac gagaattcaa gagattctcg ttgaaaccag ggacaaggct 60ttttt 655865DNAArtificial SequenceOligonucleotide 58aaaaaatatc agaggcacgt caacatctta atctcttgaa ttaagatgtt gacgtgcctc 60tgata 655965DNAArtificial SequenceOligonucleotide 59caggcactag tactgatgtc gtatattcaa gagatatacg acatcagtac tagtgcctgt 60ttttt 656071DNAArtificial SequenceOligonucleotide 60aaactaaaat gtctgataat ggaccttcaa gagaggtcca ttatcagaca ttttagtttt 60tttttggtac c 71611273PRTArtificial SequenceSARS-COV-2 61Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val1 5 10 15Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe 20 25 30Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu 35 40 45His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp 50 55 60Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp65 70 75 80Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu 85 90 95Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser 100 105 110Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile 115 120 125Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr 130 135 140Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr145 150 155 160Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu 165 170 175Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe 180 185 190Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr 195 200 205Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu 210 215 220Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr225 230 235 240Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser 245 250 255Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro 260 265 270Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala 275 280 285Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys 290 295 300Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val305 310 315 320Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys 325 330 335Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala 340 345 350Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu 355 360 365Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro 370 375 380Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe385 390 395 400Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly 405 410 415Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys 420 425 430Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn 435 440 445Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe 450 455 460Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys465 470 475 480Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly 485 490 495Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val 500 505 510Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys 515 520 525Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn 530 535 540Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu545 550 555 560Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val 565 570

575Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe 580 585 590Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val 595 600 605Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile 610 615 620His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser625 630 635 640Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val 645 650 655Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala 660 665 670Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala 675 680 685Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser 690 695 700Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile705 710 715 720Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val 725 730 735Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu 740 745 750Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr 755 760 765Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln 770 775 780Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe785 790 795 800Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser 805 810 815Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly 820 825 830Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp 835 840 845Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu 850 855 860Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly865 870 875 880Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile 885 890 895Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr 900 905 910Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn 915 920 925Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala 930 935 940Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn945 950 955 960Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val 965 970 975Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln 980 985 990Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val 995 1000 1005Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn 1010 1015 1020Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys 1025 1030 1035Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro 1040 1045 1050Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val 1055 1060 1065Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His 1070 1075 1080Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn 1085 1090 1095Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln 1100 1105 1110Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val 1115 1120 1125Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro 1130 1135 1140Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn 1145 1150 1155His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn 1160 1165 1170Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu 1175 1180 1185Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu 1190 1195 1200Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile Trp Leu 1205 1210 1215Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Met 1220 1225 1230Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys 1235 1240 1245Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro 1250 1255 1260Val Leu Lys Gly Val Lys Leu His Tyr Thr 1265 12706215PRTArtificial SequenceSARS-COV-2 62Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu Asp Leu Phe Tyr1 5 10 156315PRTArtificial SequenceOligopeptide 63Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu Asp Leu Phe Tyr1 5 10 156420PRTArtificial SequenceOligopeptide 64Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu Asp Leu1 5 10 15Phe Tyr Gln Ser 206526PRTArtificial SequenceOligopeptide 65Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn His Glu1 5 10 15Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu 20 256630PRTArtificial SequenceOligopeptide 66Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn1 5 10 15His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser 20 25 306715PRTArtificial SequenceOligopeptide 67Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro Leu Gln Glu Ile Gln1 5 10 156820PRTArtificial SequenceOligopeptide 68Leu Lys Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro Leu Gln Glu Ile1 5 10 15Gln Asn Leu Thr 206925PRTArtificial SequenceOligopeptide 69Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro1 5 10 15Leu Gln Glu Ile Gln Asn Leu Thr Val 20 257030PRTArtificial SequenceOligopeptide 70Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala Gln Met1 5 10 15Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln 20 25 307115PRTArtificial SequenceOligopeptide 71Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro Gly Asn1 5 10 157220PRTArtificial SequenceOligopeptide 72Leu Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp1 5 10 15Pro Gly Asn Val 207325PRTArtificial SequenceOligopeptide 73Val Gly Leu Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu1 5 10 15Thr Asp Pro Gly Asn Val Gln Lys Ala 20 257430PRTArtificial SequenceOligopeptide 74Val Ser Val Gly Leu Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser1 5 10 15Met Leu Thr Asp Pro Gly Asn Val Gln Lys Ala Val Cys His 20 25 307515PRTArtificial SequenceOligopeptide 75Trp Asp Leu Gly Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys1 5 10 157620PRTArtificial SequenceOligopeptide 76Pro Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe Arg Ile Leu Met Cys1 5 10 15Thr Lys Val Thr 207725PRTArtificial SequenceOligopeptide 77Val Cys His Pro Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe Arg Ile1 5 10 15Leu Met Cys Thr Lys Val Thr Met Asp 20 257830PRTArtificial SequenceOligopeptide 78Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe1 5 10 15Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp Phe Leu 20 25 307915PRTArtificial SequenceOligopeptide 79Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe His1 5 10 158020PRTArtificial SequenceOligopeptide 80Ala Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly1 5 10 15Phe His Glu Ala 208125PRTArtificial SequenceOligopeptide 81Tyr Asp Met Ala Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala1 5 10 15Asn Glu Gly Phe His Glu Ala Val Gly 20 258231PRTArtificial SequenceOligopeptide 82Ile Gln Tyr Asp Met Ala Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn1 5 10 15Gly Ala Asn Glu Gly Phe His Glu Ala Val Gly Glu Ile Met Ser 20 25 30

Claims

1. A composition comprising a plurality of inhibitory oligonucleotides, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

2. The composition of claim 1, wherein the plurality of inhibitory oligonucleotides targets all of the ORF1ab, RdRp, S-protein, N-protein and E protein genes.

3. The composition of claim 1, wherein a selected SARS-CoV-2 gene is targeted by at least two inhibitory oligonucleotides.

4. The composition of any of the preceding claims, wherein the inhibitory oligonucleotides are selected from an antisense oligonucleotide, a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), and a microRNA.

5. The composition of claim 1, wherein the plurality of inhibitory oligonucleotides comprises at least two oligonucleotides which comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 9-16 and modified forms of SEQ ID NOS: 9-16.

6. The composition of claim 1, wherein the plurality of inhibitory oligonucleotides comprises eight oligonucleotides as shown in SEQ ID NOS: 9-16 or modified forms of SEQ ID NOS: 9-16.

7. The composition of claim 1, wherein the plurality of inhibitory oligonucleotides comprises at least two pairs of Dicer-substrate RNAs (DsiRNAs) selected from the group consisting of DsiRNA pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

8. The composition of claim 1, wherein the plurality of inhibitory oligonucleotides comprises Dicer-substrate RNA (DsiRNA) pair 1 (SEQ ID NOs: 17 & 18), DsiRNA pair 2 (SEQ ID NOs: 19 & 20), DsiRNA pair 3 (SEQ ID NOs: 21 & 22), DsiRNA pair 4 (SEQ ID NOs: 23 & 24), DsiRNA pair 5 (SEQ ID NOs: 25 & 26), DsiRNA pair 6 (SEQ ID NOs: 27 & 28), DsiRNA pair 7 (SEQ ID NOs: 29 & 30), and DsiRNA pair 8 (SEQ ID NOs: 31 & 32).

9. The composition of any of the preceding claims, wherein the inhibitory oligonucleotides are modified oligonucleotides.

10. The composition of claim 9, wherein the modified inhibitory oligonucleotides are 2'-Deoxy, 2'-Fluoroarabino Nucleic Acid (FANA)-modified antisense oligonucleotides.

11. The composition of claim 9, wherein the modified inhibitory oligonucleotides are 2' 0-Methyl RNA modified antisense oligonucleotides selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40.

12. The composition of any of the preceding claims, wherein at least one inhibitory oligonucleotide within the plurality of oligonucleotides comprises a detectable label.

13. The composition of claim 12, wherein the label is a fluorescent label.

14. The composition of any of claims 1-8, wherein the plurality of inhibitory oligonucleotides is provided in one or more nucleic acid vectors.

15. The composition of claim 14, wherein the nucleic acid vectors are selected from a viral vector, a non-viral vector, an integrative vector, or a non-integrative vector.

16. The composition of any of the preceding claims, further comprising a pharmaceutically-acceptable carrier.

17. The composition of claim 16, wherein the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles to which the plurality of inhibitory oligonucleotides is conjugated.

18. A composition comprising at least one peptide mimicking a portion of the ligand binding domain (LBD) of human ACE2 protein, wherein the at least one peptide prevents binding of the S-protein of SARS-CoV-2 to the human ACE2 protein.

19. The composition of claim 18, wherein the LBD of human ACE2 comprises the amino acid sequence of SEQ ID NO: 56.

20. The composition of claim 18, wherein the composition comprises a plurality of peptides, each mimicking a different portion of the ligand binding domain (LBD) of human ACE2 protein.

21. The composition of claim 18, wherein the at least one peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82.

22. The composition of claim 18, wherein the composition comprises a plurality of peptides comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-44, 54, and 63-82.

23. The composition of claim 22, wherein the composition comprises at least five peptides, wherein the at least five peptides are selected from peptides comprising an amino acid sequence as shown in SEQ ID NOS: 41-44, 54, and 63-82.

24. A composition comprising a peptide mimicking a portion of the receptor binding domain (RBD) of the S-Protein of SARS-CoV-2, wherein the peptide prevents binding of the S-protein of SARS-CoV-2 to a human ACE2 protein.

25. The composition of claim 24, wherein the RBD of the S protein of SARS-CoV-2 comprises SEQ ID NO: 62.

26. The composition of claim 24, wherein the peptide comprises an amino acid sequence as shown in SEQ ID NO: 45.

27. The composition of any of claims 18-26, wherein the at least one peptide comprises a label or is conjugated with a probe, a nucleic acid or a chemical molecule.

28. The composition of claim 27, wherein the label is a fluorescent label.

29. The composition of claims 18-28, further comprising a pharmaceutically-acceptable carrier.

30. The composition of claim 29, wherein the pharmaceutically acceptable carrier comprises nanoparticles or other delivery vehicles to which the at least one peptide is conjugated.

31. A dietary supplement comprising a composition according to any one of claims 1-17.

32. A dietary supplement comprising a composition according to any one of claims 18-30.

33. A dietary supplement comprising a composition according to any one of claims 1-17, and a composition according to any one of claims 18-30.

34. The dietary supplement of any of claims 31-33, further comprising at least one additional nutrient selected from Vitamin C, Vitamin B6, Vitamin B12, Vitamin D, Zinc, polypeptides, nucleotide, L-arginine or peppermint oil.

35. The dietary supplement of any of claims 31-34, wherein the dietary supplement is formulated for oral, nasal, eye, ear, or topical application.

36. A method comprising expressing a plurality of inhibitory oligonucleotides in a target cell, wherein the plurality of inhibitory oligonucleotides targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene and the E protein gene.

37. The method of claim 36, wherein a selected SARS-CoV-2 gene is targeted by at least two inhibitory oligonucleotides.

38. The method of claim 36, wherein the plurality of inhibitory oligonucleotides targets all of ORF1ab, RdRp, S-protein, N-proteins and E protein genes.

39. The method of any of claims 36-38, wherein the inhibitory oligonucleotides are selected from an antisense oligonucleotide, a small interfering RNA (siRNA), a Dicer-substrate RNA (DsiRNA), or a microRNA.

40. The method of claim 36, wherein the plurality of inhibitory oligonucleotides comprises at least two oligonucleotides which comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 9-16.

41. The method of claim 36, wherein the plurality of inhibitory oligonucleotides comprises eight oligonucleotides as shown in SEQ ID NOS: 9-16.

42. The method of claim 36, wherein the target cell is a human cell.

43. The method of claim 42, wherein the target cell is a lung epithelial cell.

44. The method of claim 42, wherein the target cell is selected from the group consisting of a small airway epithelial cell, a bronchial/tracheal epithelial cell, and a nasal epithelial cell.

45. The method of any of claims 36-44, wherein the plurality of inhibitory oligonucleotides are expressed from at least one vector.

46. The method of claim 45, wherein the at least one vector is selected from a viral vector, or a non-viral vector, an integrative vector, or a non-integrative vector.

47. The method of claim 45, wherein the at least one vector is delivered to a subject in need via oral, nasal, i.v. injection or topical administration routes.

48. A nucleic acid vector encoding a plurality of inhibitory oligonucleotides that targets at least two SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene.

49. A combination of nucleic acid vectors, wherein each nucleic acid vector encodes an inhibitory oligonucleotide that targets at least one SARS-CoV-2 genes selected from the group consisting of ORF1ab, RdRp, the S-protein gene, the N-protein gene, and the E protein gene, and wherein the combination of nucleic acid vectors target at least two SARS-CoV-2 genes.

50. The nucleic acid vector of claim 48 or the combination of nucleic acid vectors of claim 49, wherein the nucleic acid vector is a viral vector.

51. The nucleic acid vector of claim 48 or the combination of nucleic acid vectors of claim 49, wherein the nucleic acid comprises an AAV-based vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13 and AAV14.

52. The nucleic acid vector of claim 48 or the combination of nucleic acid vectors of claim 49, wherein the nucleic acid vector is a non-viral vector.

53. A method of treating a SARS-CoV-2 infection in a subject in need thereof, comprising administering a subject an effective amount of a nucleic acid vector or a combination of nucleic acid vectors according to any one of claims 48-52.

54. A method for treating a SARS-CoV-2 infection comprising administering to a subject an effective amount of a composition according to any one of claims 1-17, or a composition according to any one of claims 18-30.

55. A method for treating a SARS-CoV-2 infection comprising administering to a subject an effective amount of a composition according to any one of claims 1-17 and an effective amount of a composition according to any one of claims 18-30.