RECOMBINANT BI-FUNCTIONAL FUSION PROTEINS BINDING CD47 AND FC GAMMA RECEPTOR, PREPARATION AND USE THEREOF

Abstract

The present invention provides a recombinant fusion protein containing a first extracellular Ig-like domain of a signal-regulator protein alpha (SIRP.alpha.), linked to an Fc fragment of a human IgG1. The present invention also provides a polynucleotide encoding the recombinant fusion protein, an expression vector containing the polynucleotide, a method for producing the recombinant protein and a method for treating a disease caused by over expression of CD47.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application is a continuation of U.S. application Ser. No. 16/905,262 filed Jun. 18, 2020 which is a is a divisional of U.S. application Ser. No. 15/566,724 filed Oct. 16, 2017, now U.S. Pat. No. 10,800,821, which is a U.S. National Stage Application of PCT/CN2015/094739 filed Nov. 16, 2015, which claims priority to Chinese patent application Serial No. CN201510203619.7 filed Apr. 24, 2015, the entire specification of each being incorporated herein by reference.

SEQUENCE STATEMENT

[0002] The instant application contains a Sequence Listing which has been submitted electronically and is hereby incorporated by reference in its entirety. Said ASCII copy, is named 00025SL.txt and is 22.7 kbytes in size.

FIELD OF THE INVENTION

[0003] The invention relates to a recombinant bi-functional fusion protein, preparation and use thereof, especially its use in tumor therapies.

BACKGROUND OF THE INVENTION

[0004] Cancer cells have developed some mechanisms to evade a host's immune surveillance so that they can grow faster. Among the mechanisms, the following three are well known. 1) To evade immune surveillance by T-lymphocytes. The cancer cells usually express a high level of membrane protein PD-L1 and PD-L2, both of which bind to PD-1 on the surface of T-cell, inducing T-cell apoptosis. 2) To evade immune surveillance by natural killer (NK) cells. The NKG2D protein on the surface of NK cells, upon binding to the MICA/MICB proteins on the surface of the cancer cells, can activate NK cells to kill the cancer cells. However, cancer cells have developed a mechanism that promotes the detachment of MICA/MICB from the cell membranes. The detached MICA/MICB binds to the NKG2D on the surface of NK cells, blocking the binding of NKG2D to MICA/MICB on the surface of cancer cells. 3) To evade the immune surveillance by macrophages (M.PHI.). Almost all cancer cells express on their surfaces a high level of CD47, which binds to the signal regulatory protein (SIRP.alpha.) on the surface of M.PHI., thereby inducing the production of an inhibitory signal, which inhibits the phagocytosis of cancer cells by M.PHI.. It can be seen that the cancer cells are quite "smart" and reproduce quickly depending on their developed evasion mechanisms. Accordingly, development of effective anti-cancer drugs for killing all the cancer cells needs to target these mechanisms.

[0005] The present invention is directed to the signal regulatory protein SIRP.alpha.. The signal regulatory protein (SIRP) is a transmembrane glycoprotein, including three family members, SIRP.alpha. (CD172a), SIRP.beta. (CD172b) and SIRP.gamma. (CD172g). The three proteins have similar extracellular regions but distinct cytoplasmic regions (FIG. 1A). The extracellular region contains three immunoglobulin (Ig) domains--one IgV-set and two IgC-set domains. The cytoplasmic region of SIRP.alpha. (CD172a) contains two domains which transmit inhibitory signals to inhibit the corresponding function(s) of the cell. SIRP.beta. (CD172b) and SIRP.gamma. (CD172g) have very short cytoplasmic regions without any signal-transmitting domain. However, SIRP.beta. (CD172b) may transmit the activating signals through its association with the adaptor proteins such as DAP12 (FIG. 1). SIRPs are mainly expressed in macrophages (M.PHI.), dendritic cells (DCs) and neurons.

[0006] CD47 is also a transmembrane glycoprotein belonging to the immunoglobulin superfamily, and is expressed on the surface of all cell types including red blood cells. Ligands for CD47 include integrins, thrombospondin-1 and SIRPs. CD47 has many biological functions, including in cell migration, activation of T-cells and DCs, and axon development. In addition, CD47, by interacting with SIRP.alpha., can inhibit the phagocytosis by macrophages. By emitting a "don't eat me" signal, CD47 protects normal cells, such as blood cells, from being attacked by macrophages.

[0007] Studies have shown that many tumor or cancer cells over-express CD47, which, by binding to the SIRP.alpha. on the cell surface of macrophages, prevent phagocytosis of the cancer cells by macrophages. This is deemed as one of the mechanisms adopted by tumors to evade the host's immune surveillance. Cancers that over-express CD47 include acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), non- hodgkins lymphoma (NHL), multiple myeloma (MM), bladder cancer, ovarian cancer, prostate cancer, lung cancer, colon cancer, breast cancer, and pancreatic cancer.

[0008] Other studies showed that injection of CD-47 specific antibody that blocks the binding of CD47 to SIRP.alpha. can significantly inhibit tumor growth in tumor-bearing mice. Tumor or cancer cells were eliminated completely when the same antibody was injected into the mice carrying human leukemia cells (Theocharides A P A, et al., 2012).

[0009] An Fc receptor is a protein found on the surface of certain cells, including B lymphocytes, follicular dendritic cells, natural killer cells, macrophages, neutrophils, eosinophils, basophils, and mast cells. These cells contribute to the protective functions of the immune system. The Fc receptor binds to antibodies that are attached to infected cells, invading pathogens or cancer cells, and stimulates phagocytic or cytotoxic cells to destroy microbes, infected cells or cancer cells by antibody-mediated phagocytosis or antibody-dependent cell-mediated cytotoxicity.

[0010] The binding activity of SIRP.alpha.-Fc or SIRP.alpha.D1-Fc to CD47 has been reported (Lee W Y et al., 2007), but both having insufficient affinity to CD47.

SUMMARY OF THE INVENTION

[0011] The present invention discloses a recombinant fusion protein capable of eliminating tumors by i) blocking tumor cell induced production of inhibitory signals to macrophages, and ii) directly stimulating phagocytosis by macrophages. The fusion protein comprises a first extracellular Ig-like domain of human Signal-regulatory protein alpha (SIRP.alpha.) (SIRP.alpha.D1) linked to an Fc fragment of human IgG1 (SIRP.alpha.D1-Fc). The fusion protein is a homodimer having a molecular weight of 90 kDa, consisting of a first extracellular domain (Domain 1, D1) of SIRP.alpha. linked to an Fc fragment of human IgG (SIRP.alpha.D1-Fc). The fusion protein has a better binding activity to targets, compared to a recombinant protein containing the entire extracellular region of SIRP.alpha. (SIRP.alpha.-Fc). The present inventors have further discovered that the binding activity to targets can be further improved when the site for glycosylation in SIRP.alpha.D1 is removed (N89A); and the binding activity of Fc to Fc receptors may significantly improve SIRP.alpha.D1-Fc's anti-tumor activity.

[0012] A stably-expressing cell line of Chinese hamster ovary (CHO) cells has been obtained by screening, and proteins are produced by culturing the cell line in a shaking bed. In vitro experiments have shown that the protein of the present invention may bind to CD47 with an evidently improved binding activity compared to SIRP.alpha.-Fc. If the site for glycosylation "NIT" in SIRP.alpha.D1 is removed by genetic engineering (N89A) (SIRP.alpha.D1-Fc (N89A), designated as HY03M), the binding activity to CD47 is improved. In another aspect, when the 192.sup.th amino acid residue in the Fc region is converted from aspartic acid to alanine (D192A) (SIRP.alpha.D1-Fc (N89A/D192A), designated as HY03MM), the binding activity to Fc receptors (CD16a, CD32, CD64) is evidently decreased. The in vivo anti-tumor effect of HY03M has been studied using human acute lymphoblastic leukemia and acute promyelocytic leukemia-carrying mouse models, indicating that HY03M has extremely good anti-tumor activity. Tumor growth is completely inhibited in mice treated by HY03M, and tumor is no longer detected in some mice. To confirm Fc's contribution to the anti-tumor activity, the in vivo therapeutic effects of HY03M and HY03MM have been tested in mice carrying human lymphoma in comparison to Rituximab. It turns out that HY03M has an evident anti-tumor effect compared to the negative control group, and its effect is also much better than Rituximab. Despite of a good inhibitory effect on tumor growth, HY03MM's activity is inferior to HY03M, suggesting that the Fc region is involved in tumor inhibition by binding to Fc receptors on macrophages.

[0013] In one embodiment, the recombinant protein of the present invention is HY03M (SEQ ID NO.: 5, SEQ ID NO.: 6). HY03M has a high anti-tumor activity, and inhibits tumor growth by i) blocking interaction between CD47 and SIRP.alpha.; and/or ii) activating macrophages by binding Fc to Fc receptors. HY03M may treat various CD47+ tumors.

[0014] The present invention also provides a nucleic acid molecule encoding the recombinant bi-functional fusion protein and an expression vector expressing the protein, a method for producing the protein and a method for treating a disease over-expressing CD47.

[0015] In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an extracellular Ig-like domain of Signal-regulatory protein (SIRP), linked to an Fc fragment of human IgG1, wherein the protein binds to CD47 to block the binding of CD47 to SIRP on the surface of macrophages so as to stimulate phagocytosis of tumor cells by macrophages.

[0016] In one embodiment, the signal-regulatory protein in the recombinant bi-functional fusion protein is SIRP.alpha., and the extracellular Ig-like domain of the signal-regulatory protein is SIRP.alpha.D1.

[0017] In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an Fc fragment, a part of an immunoglobulin molecule. Although an Fc fragment does not have any antigen-binding site, but does stimulate effector functions. For example, the Fc fragment facilitates the binding of the antibody with Fc receptors or complement proteins. In one embodiment, the Fc fragment is an Fc fragment of IgG1.

[0018] In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an amino acid sequence having at least 95% identity to SEQ ID NO.: 6. In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an amino acid sequence having at least 98% identity to SEQ ID NO.: 6. In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an amino acid sequence having at least 99% identity to SEQ ID NO.: 6. In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises an amino acid sequence set forth in SEQ ID NO.: 6.

[0019] In one embodiment, the present invention provides a polynucleotide molecule encoding the recombinant bi-functional fusion protein of the present invention, wherein the recombinant bi-functional fusion protein comprises an extracellular Ig-like domain of signal-regulatory protein (SIRP), linked to an Fc fragment of human IgG1, wherein the protein binds to CD47 to block the binding of CD47 to SIRP on the surface of macrophages so as to stimulate phagocytosis of tumor cells by macrophages.

[0020] In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein comprising SIRP.alpha., preferably SIRP.alpha.D1.

[0021] In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein comprising an Fc fragment of an Immunoglobulin, preferably an Fc fragment of human IgG1.

[0022] In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein having an amino acid sequence that is at least 95% identical to SEQ ID NO.: 6. In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein having an amino acid sequence that is at least 98% identical to SEQ ID NO.: 6. In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein having an amino acid sequence that is at least 99% identical to SEQ ID NO.: 6. In one embodiment, the polynucleotide molecule of the present invention encodes a recombinant bi-functional fusion protein having an amino acid sequence set forth in SEQ ID NO.: 6.

[0023] In one embodiment, the present invention provides an expression vector comprising the polynucleotide molecule of the present invention, the polynucleotide molecule encoding a recombinant bi-functional fusion protein.

[0024] In one embodiment, the present invention provides a host cell comprising the expression vector of the present invention.

[0025] In one embodiment, the present invention provides a pharmaceutical composition, comprising the recombinant bi-functional fusion protein of the present invention, and at least one adjuvant.

[0026] In one embodiment, the present invention provides a method for treating a disease caused by over-expression of CD47, comprising administering to a patient or a subject a therapeutically effective amount of the pharmaceutical composition of the present invention. In one embodiment, the present invention provides the use of the recombinant bi-functional fusion protein in the manufacture of a pharmaceutical composition for treatment of a disease caused by over-expression of CD47.

[0027] In one embodiment, the method of the present invention is for treating a disease selected from the group consisting of acute myelocytic leukemia (AML), chronic myelocytic leukemia (CML), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), multiple myeloma (MM), Bladder cancer, ovarian cancer, prostate cancer, lung cancer, colon cancer, breast cancer, pancreatic cancer, and renal cell carcinoma. In one embodiment, the present invention provides a method for treating Crohn's disease, allergic asthma and rheumatoid arthritis.

[0028] DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1A-1D is a schematic diagram of the structures and mechanism of action of SIRPs and SIRP.alpha.D1.

[0030] FIG. 2A-2B shows nucleic acid sequence and amino acid sequence of SIRP.alpha.-Fc.

[0031] FIG. 3A-3B shows nucleic acid sequence and amino acid sequence of SIRP.alpha.D1 -Fc.

[0032] FIG. 4A-4B shows nucleic acid sequence and amino acid sequence of HY03M.

[0033] FIG. 5A-5B shows nucleic acid sequence and amino acid sequence of HY03MM.

[0034] FIG. 6A-6D shows SDS-PAGE analysis of four fusion proteins.

[0035] FIG. 7A-7B shows the binding activities of SIRP.alpha.-Fc and SIRP.alpha.D1-Fc to the targets on PC-3 cells, respectively.

[0036] FIG. 8 shows the blockade of fluorescently labeled targets by unlabeled proteins.

[0037] FIG. 9A-9B shows the binding activity to Fc receptors and the induced phagocytosis of tumor cells by macrophages.

[0038] FIG. 10A-10B shows the in vivo therapeutic efficacies of four fusion proteins on tumors, respectively.

DETAILED DESCRIPTION OF THE INVENTION

[0039] The present invention is directed to a recombinant fusion protein, which can eliminate tumors via two approaches, i.e., to block tumor cell induced production of inhibitory signals to macrophages, and to directly stimulate the phagocytosis by macrophages. The protein consists of a first extracellular Ig-like domain of human Signal-regulatory protein alpha (SIRP.alpha.) (SIRP.alpha.D1) linked to an Fc fragment of human IgG1(SIRP.alpha.D1-Fc). The fusion protein is a homodimer having a molecular weight of 90 kDa. A stably-expressing cell line of Chinese hamster ovary (CHO) cells has been obtained by screening, and 100 mg of the proteins are produced by culturing the cell line in a shaking bed. In vitro experiments have shown that the proteins may bind to CD47 with an evidently improved binding activity compared to SIRP.alpha.-Fc. If the site for glycosylation ("NIT") in SIRP.alpha.D1 is removed by genetic engineering (N89A) (SIRP.alpha.D1-Fc (N89A), designated as HY03M), the binding activity to CD47 will be improved. In another aspect, when the 211.sup.th amino acid residue in the Fc region is converted from aspartic acid to alanine (D192A) (SIRP.alpha.D1-Fc (N89A/D192A), designated as HY03MM), the binding activity to Fc receptors (CD16a, CD32, CD64) is evidently decreased. The in vivo anti-tumor effect of HY03M has been studied using human acute lymphoblastic leukemia and acute promyelocytic leukemia-carrying mouse models, indicating that HY03M has extremely good anti-tumor activity. Tumor growth is completely inhibited in mice treated by HY03M, and tumor is no longer detected in some mice. To confirm Fc's contribution to the anti-tumor activity, in vivo therapeutic efficacies of HY03M and HY03MM have been tested in mice carrying human lymphoma in comparison to Rituximab. It turns out that HY03M has an evident anti-tumor effect compared to the negative control group, and its effect is also much better than Rituximab. Despite of a good inhibitory effect on tumor growth, HY03MM's activity is inferior to HY03M, suggesting that the Fc region is involved in tumor inhibition by binding to Fc receptors distributed on macrophages.

[0040] The fusion protein of the present invention contains two fragments, i.e., the target-binding fragment (SIRP.alpha.D1) and the Fc fragment.

[0041] The recombinant bi-functional fusion protein of the present invention may further bind to non-polypeptide molecules for the purpose of conferring desired properties such as reducing degradation and/or increasing half-life, reducing toxicity, reducing immunogenicity, and/or increasing the biological activity. Exemplary molecules include but are not limited to polymers such as polyethylene glycol (PEG), polylysine, a dextran; a lipid; a cholesterol group (such as a steroid); a carbohydrate, or an oligosaccharide molecule.

[0042] The Fc fragment may be 232 amino acids in size, and comprises a cystein in the hinge region, two cysteins in the CH2 region and two cysteins in the CH3 region. The cystein in the hinge region contributes to the formation of disulfide bond between two monomers, thereby generating a homodimer, while the cysteins in the CH2 and CH3 regions can form intrachain disulfide bonds to stabilize the protein.

[0043] For example, the extracellular Ig domain of SIRP (SIRP.alpha., SIRP.gamma.) capable of binding CD47 can be used in the fusion protein.

[0044] Preferably, human-derived sequences may be used in human cancer therapies, as the strong immunogenicity of the proteins or peptides from non-human animals may lead to allergy and other adverse effects. However, other animal proteins or peptides may also be used in the present invention based on different application purposes.

[0045] In one embodiment, the signal-regulatory protein in the recombinant bi-functional fusion protein of the present invention is SIRP.alpha.. The extracellular Ig-like domain of the signal-regulatory protein is SIRP.alpha.D1.

[0046] In the present invention, the Fc fragment from any immunoglobulin can be used. Immunoglobulins include IgG, IgA, IgM, IgD and IgA, among which IgG is the most abundant and relatively stable. The Fc fragment of IgG, the Fc fragment of IgG1 and the Fc fragment of human IgG1 are preferred in the present invention as these Fc fragments exhibit the highest binding activity with staphylococcus Protein A and therefore can be easily purified.

[0047] In one embodiment, the recombinant bi-functional fusion protein of the present invention comprises a first extracellular Ig-like domain of human SIRP.alpha., linked to an Fc fragment of human IgG1.

[0048] In one embodiment, the amino acid sequence of the recombinant bi-functional fusion protein of the present invention is shown in FIG. 4B (SEQ ID NO.: 6). In another embodiment, the polypeptide has an amino acid sequence set forth in SEQ ID NO.: 6. In another embodiment, the polypeptide has an amino acid sequence with at least 80%, 85%, 90%, 95%, 98% or 99% identity to SEQ ID NO.: 6, wherein the polypeptide is capable of binding to CD47 and is able to inhibit tumor cell growth.

[0049] In another aspect, the present invention provides an isolated nucleic acid molecule comprising a polynucleotide encoding a recombinant bi-functional fusion protein, wherein, the recombinant bi-functional fusion protein comprises a polypeptide having the sequence set forth in SEQ ID NO.: 6. In one embodiment, the polypeptide has an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99% identity to SEQ ID NO.: 6, wherein the polypeptide is capable of binding to CD47 and is able to inhibit tumor cell growth.

[0050] The present invention also discloses a pharmaceutical composition comprising the aforementioned recombinant bi-functional fusion protein, and at least one pharmaceutically acceptable excipient. If needed, one or more pharmaceutically acceptable carriers or excipients may also be included in the pharmaceutical composition. The carriers include diluents, excipients, bulking agents, bonding agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, sorption carriers, lubricants and the like ordinary in the pharmaceutics.

[0051] Such compositions comprise a therapeutically or prophylactically effective amount of the polypeptide or protein in admixture with pharmaceutically acceptable materials, and physiologically acceptable formulation materials. The pharmaceutical composition may contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolarity, viscosity, clarity, color, odor, sterility, isotonicity, stability, rate of dissolution or release, adsorption or penetration of the composition. Suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen-sulfite); buffers (such as borate, ammonium bicarbonate, Tris-HCl, citrates, phosphates, and other organic acids); bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediamtne tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin); fillers; monosaccharides; disaccharides and other carbohydrates (such as glucose, mannose, or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring agents; flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as PLURONICS.RTM. or poloxamers, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, TRITON.RTM. X (Polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether), tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and/or pharmaceutical adjuvants.

[0052] The optimal pharmaceutical composition will be determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format, and desired dosage. See for example, Remington's Pharmaceutical Sciences, supra. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the polypeptide. For example, suitable compositions may be water for injection and physiological saline solution.

[0053] The primary vehicle or carrier in a pharmaceutical composition may be either aqueous or non-aqueous in nature. For example, a suitable vehicle or carrier may be water for injection, physiological saline solution or artificial cerebrospinal fluid, possibly supplemented with other materials common in injection. For example, the vehicle or carrier may be neutral buffered saline or saline mixed with serum albumin. Other exemplary pharmaceutical compositions comprise Tris buffers, or acetate buffers, which may further include sorbitol or a suitable substitute thereof. In one embodiment of the present invention, compositions may be prepared for storage by mixing the selected composition having the desired degree of purity with optional formulation agents (Remington's Pharmaceutical Sciences, supra) in the form of a lyophilized cake or an aqueous solution. Further, the therapeutic composition may be formulated as a lyophilizate using appropriate excipients such as sucrose.

[0054] The formulations can be delivered in a variety of methods, for example, by inhalation therapy, orally, or by injection. When parenteral administration is contemplated, the therapeutic compositions for use in this invention may be in the form of a parenterally acceptable aqueous solution comprising the desired polypeptide in a pharmaceutically acceptable vehicle. A particularly suitable vehicle for parenteral injection is sterile distilled water in which a polypeptide is formulated as a sterile, isotonic solution, properly preserved. Yet another preparation can involve the formulation of the desired molecule with an agent, such as injectable microspheres, bio-erodible particles, polymeric compounds (polylactic acid, polyglycolic acid), beads, or liposomes, that provides for the controlled or sustained release of the product which may then be delivered via a depot injection. Hyaluronic acid may also be used, and this may have the effect of promoting sustained duration in the circulation. Other suitable means for the introduction of the desired molecule include implantable drug delivery devices.

[0055] In another aspect, pharmaceutical formulations suitable for injectable administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate, triglycerides, or liposomes. Non-lipid polycationic amino polymers may also be used for delivery. Optionally, the suspension may also contain suitable stabilizers or agents to increase the solubility of the compounds and allow for the preparation of highly concentrated solutions. In another embodiment, a pharmaceutical composition may be formulated for inhalation. Inhalation solutions may also be formulated with a propeilant for aerosol delivery, in yet another embodiment, solutions may be nebulized. Pulmonary administration is further described in PCT Application No. PCT/US94/001875, which describes pulmonary delivery of chemically modified proteins.

[0056] It is also contemplated that certain formulations may be administered orally. In one embodiment of the present invention, molecules that are administered in this fashion can be formulated with or without those carriers customarily used in the compounding of solid dosage forms such as tablets and capsules. For example, a capsule may be designed to release the active portion of the formulation at the point in the gastrointestinal tract when bioavailability is maximized and pre-systemic degradation is minimized. Additional agents can be included to facilitate absorption of the therapeutic molecule. Diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents, and binders may also be employed. Pharmaceutical compositions for oral administration can also be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

[0057] Pharmaceutical preparations for oral use can be obtained through combining active compounds with solid excipient and processing the resultant mixture of granules (optionally, after grinding) to obtain tablets or dragee cores. Suitable auxiliaries can be added, if desired. Suitable excipients include carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, and sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums, including arable and tragacanth; and proteins, such as gelatin and collagen. If desired, disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, and alginic acid or a salt thereof, such as sodium alginate.

[0058] Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.

[0059] Pharmaceutical preparations that can be used orally also include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with fillers or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

[0060] Additional pharmaceutical compositions will be evident to those skilled in the art, including formulations involving polypeptides in sustained- or controlled-delivery formulations. Techniques for formulating a variety of other sustained- or controlled-delivery means, such as liposome carriers, bio-erodible micro-particles or porous beads and depot injections, are also known to those skilled in the art. See for example, PCT/US93/00829 that describes controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions. Additional examples of sustained-release preparations include semipermeable polymer matrices in the form of shaped articles, e.g. films, or microcapsules. Sustained release matrices may include polyesters, hydrogels, polylactides (Langer et al, J. Biomed. Mater. Res., 15: 167-277, (1981); Langer et al., Chem. Tech., 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., supra) or poly-D(-)-3-hydroxybutyri.c acid (EP 133,988). Sustained-release compositions also include liposomes, which can be prepared by any of several methods known in the art. See e.g., Eppstein et al., PNAS (USA), 82:3688 (1985); EP 36,676; EP 88,046; EP 143,949.

[0061] The pharmaceutical composition to be used for in vivo administration typically must be sterile. This may be accomplished by filtration through sterile filtration membranes. Where the composition is lyophilized, sterilization using this method may be conducted either prior to or following lyophilization and reconstitution. The composition for parenteral administration may be stored in lyophilized form or in solution. In addition, parenteral compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

[0062] Once the pharmaceutical composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or a dehydrated or lyophilized powder. Such formulations may be stored either in a ready-to-use form or in a form (e.g., lyophilized) requiring reconstitution prior to administration.

[0063] In a specific embodiment, the present invention is directed to kits for producing a single-dose administration unit. The kits may each contain both a first container having a dried protein and a second container having an aqueous formulation. Also included within the scope of this invention are kits containing single and multi-chambered pre-filled syringes (e.g., liquid syringes and lyosyringes).

[0064] An effective amount of a pharmaceutical composition to be employed therapeutically will depend, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment will thus vary depending, in part, upon the molecule delivered, the indication for which the polypeptide is being used, the route of administration, and the size (body weight, body surface or organ size) and condition (the age and general health) of the patient. Accordingly, the clinician may titer the dosage and modify the route of administration to obtain the optimal therapeutic effect. A typical dosage may range from about 0.1 mg/kg to up to about 100 mg/kg or more, depending on the factors mentioned above. Polypeptide compositions may be preferably injected or administered intravenously. Long-acting pharmaceutical compositions may be administered every three to four days, every week, or biweekly depending on the half-life and clearance rate of the particular formulation. The frequency of dosing will depend upon the pharmacokinetic parameters of the polypeptide in the formulation used. Typically, a composition is administered until a dosage is reached that achieves the desired effect. Tine composition may therefore be administered as a single dose, or as multiple doses (at the same or different concentrations/dosages) over time, or as a continuous infusion. Further refinement of the appropriate dosage is routinely made. Appropriate dosages may be ascertained through use of appropriate dose-response data.

[0065] The route of administration of the pharmaceutical composition is in accord with known methods, e.g. orally, through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebro ventricular, intramuscular, intra-ocu ar, intraarterial, intraportal, intralesional routes, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, or intraperitoneal; as well as intranasal, enteral, topical, sublingual, urethral, vaginal, or rectal means, by sustained release systems or by implantation devices. Where desired, the compositions may be administered by bolus injection or continuously by infusion, or by implantation device. Alternatively or additionally, the composition may be administered locally via implantation of a membrane, sponge, or another appropriate material on to which the desired molecule has been absorbed or encapsulated. Where an implantation device is used, the device may be implanted into any suitable tissue or organ, and delivery of the desired molecule may be via diffusion, timed-release bolus, or continuous administration.

[0066] In some cases, the bi-functional fusion protein of the present invention can be delivered by implanting certain cells that have been genetically engineered, using methods such as those described herein, to express and secrete the polypeptide. Such cells may be animal or human cells, and may be autologous, heterologous, or xenogeneic. Optionally, the cells may be immortalized. In order to decrease the chance of an immunological response, the cells may be encapsulated to avoid infiltration of surrounding tissues. The encapsulation materials are typically biocompatible, semi-permeable polymeric enclosures or membranes that allow the release of the polypeptide product(s) but prevent the destruction of the cells by the patient's immune system or by other detrimental factors from the surrounding tissues.

[0067] A gene therapy in vivo is also envisioned wherein a nucleic acid molecule encoding the bi-functional fusion protein of the present invention, or a derivative thereof is introduced directly into the subject. For example, a nucleic acid sequence encoding a bi-functional fusion protein of the present invention is introduced into target cells via local injection of a nucleic acid construct with or without an appropriate delivery vector, such as an adeno-associated virus vector. Alternative viral vectors include, but are not limited to, retroviruses, adenovirus, herpes simplex vims and papilloma virus vectors. Physical transfer of the virus vector may be achieved in vivo by local injection of the desired nucleic acid construct or other appropriate delivery vector containing the desired nucleic acid sequence, liposome-mediated transfer, direct injection (naked DNA), or microparticle bombardment (gene-gun).

[0068] The compositions of the present disclosure may be used alone or in combination with other therapeutic agents to enhance their therapeutic effects or decrease potential side effects.

[0069] Another object of the present invention is to provide a method for preparing the above recombinant bi-functional fusion protein and the pharmaceutical composition comprising the same. In one embodiment, the method comprises (1) providing an protein-encoding polynucleotide molecule; (2) constructing an expression vector comprising the polynucleotide molecule of (1); (3) transfecting or transforming suitable host cells with the expression vector of (2) and cultivating the host cells to express the protein; and (4) purifying the protein. The preparation may be carried out with well-known technologies by an ordinarily skilled artisan.

[0070] Another object of the present invention is to provide a method of treating cancer using the pharmaceutical composition of the present invention, comprising administrating an effective amount of the aforementioned pharmaceutical composition to the patients or subjects in need thereof. In one embodiment, the pharmaceutical composition is used to treat CD47-overexpressing tumors or cancers, including but not limited to acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), non-hodgkins lymphoma (NHL), multiple myeloma (MM), bladder cancer, ovarian cancer, prostate cancer, lung cancer, colon cancer, breast cancer, pancreatic cancer and renal cancer.

[0071] In one embodiment, the diseases related to over-expression of CD47 include but are not limited to Crohn's disease, allergic asthma, and rheumatoid arthritis.

[0072] Also, the present invention provides a polynucleotide molecule encoding the recombinant bi-functional fusion protein and an expression vector expressing the recombinant bi-functional fusion protein. Examples of vectors include but are not limited to plasmids, viral vectors, yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), transformation-competent artificial chromosomes (TACs), mammalian artificial chromosomes (MACs) and human artificial episomal chromosomes (HAECs).

[0073] The present invention provides host cells comprising the above expression vectors. The host cells may be transformed or transfected with the expression vectors. Suitable host cells include Escherichia coli, yeasts and other eukaryotes. Preferably, Escherichia coli, yeast or mammalian cell lines (such as COS or CHO) are used.

[0074] The present invention is now further described with the non-limiting examples below.

EXAMPLES

Example 1

[0075] Method and Material

[0076] 1.1 Construction of Vectors Expressing SIRP.alpha.-Fc and SIRP.alpha.D1-Fc Respectively

[0077] Plg-Tail (R&D Systems) was employed as the expression vector. The coding sequences of extracellular domains of SIRP.alpha. and SIRP.alpha.D1 were amplified from THP-1 (ATCC.RTM.TIB-202.TM.) cells, respectively, using primer 1 (SEQ ID NO.: 9) with primer 2 (SEQ ID NO.:10), and primer 1 (SEQ ID NO.: 9) with primer 3 (SEQ ID NO.: 11). The PCR products were cloned into HindIII/EcoRI site in an engineered Plg-Tail, thus generating pSIRP.alpha.-Fc and pSIRP.alpha.D1-Fc expression vectors.

[0078] 1.2 Construction of Vectors Expressing HY03M and HY03MM Respectively

[0079] The coding sequence of SIRP.alpha.D1 having N89A mutation was synthesized by Nanjing Jinsirui biotechnology Co., Ltd (Program NO.: 7009323-1) and then cloned into HindIII/EcoRI site of Plg-Tail vector to generate an HY03M expression vector. Using primer 4 (SEQ ID NO.: 12) and primer 5 (SEQ ID NO.: 13), the nucleotide sequence (GAC) encoding aspartic acid, the 192th amino acid residue of HY03M at the Fc terminus, was mutated to encode alanine (GCC) through site-directed mutagenesis, thus generating an HY03MM expression vector.

TABLE-US-00001 TABLE 1 PCR primers Primer No. Primer sequences (5'-3') Gene Endonuclease Primer 1: CCCAAGCTTGGGGCCACC SIRP.sub..alpha. HindIII (SEQ ID No.: 9) Primer 2: CGGAATTC SIRP.sub..alpha. EcoRI (SEQ ID No.: 10) Primer 3: CGGAATT SIRP.sub..alpha. EcoRI (SEQ ID No.: 11) Primer 4: GAGGTCACATGCGTGGTGGTGGCCGTGAGCCACGAAGACCCTG (SEQ ID No.: 12) hIgG1-Fc Primer 5: CACCACCACG CATGTGACCTCAGGGGTCCG GGAGATCATG hIgG1-Fc (SEQ ID No.: 13) Notes: Gene specific sequences were shown in italic, and endonuclease recognition sites were underlined.

[0080] 2. Protein Expression and Purification

[0081] The complete cell culture media DMEM (with 10% FBS) containing CHO cells was added into a 24-well plate, 0.5 ml per well, and the plate was kept in an incubator for 24 hours. For transfection, 0.5 .mu.g of plasmid DNA and 2 .mu.l of LIPOFECTAMINE.TM. 2000 (Cat#11668-027, invitrogen) were separately dissolved in 50 .mu.l of serum-free culture media, which were then combined and left still at room temperature for 20 minutes. Thereafter, the medium was slowly poured into wells of the plate, and the plate was placed in the incubator for 24 hours. On the next day, 100 .mu.l of supernatant was taken and tested for protein expression by enzyme-linked immunosorbent assay (ELISA).

[0082] 3. Protein Expression Assay

[0083] Protein expression was tested by ELISA. In particular, an goat anti-human IgG antibody, F(ab')2 fragment (Biosource international inc) was dissolved in PBS buffer, which was then added into a 96-well ELISA plate, 20 ng per well. The ELISA plate was placed in a refrigerator at 4.degree. C. overnight. Upon testing, the plate was blocked with blocking solution (PBS, 0.05% TWEEN.RTM.20 (polysorbate 20), 3% skim milk) for 1 hour, and then added with diluted serum and incubated for 1 hour at room temperature. After washed with a washing solution (PBS, 0.05% TWEEN.RTM.20 (polysorbate 20)) for 5 times, the plate was added with horse radish peroxidase (HRP) labeled rabbit anti-human IgG antibody (Jackson ImmunoResearch Lab) and was incubated at room temperature for 1 hour. After washed for 5 times, the substrate for HRP was added. Two minutes later, the solution (1N H.sub.2SO.sub.4) for stopping color development was used to terminate the chromogenic reaction. The optical density was measured at 450 nm.

[0084] 4. Screening for Stably-Expressing Cell Line

[0085] Transfected cells were subjected to concentration-increasing antibiotic screening (GENETICIN.RTM. (G-418), Cat#10131035, Invitrogen). The unstable cells were killed gradually, and survived cells were diluted and put into five 96-well plates, 0.5 to 1 cell per well. The plates were placed in an incubator for 10-15 days. The wells each containing a single clone were tested by ELISA, and then the cells with positive protein expression were propagated, and habitually cultured with serum-tree EX-CELL.RTM. CD CHO culture media (Cat#14361C-1000ML, SIGMA). After further screening, the cells with the highest expression levels were selected and frozen for use.

[0086] 5. Protein Production and Purification

[0087] The stably-expressing cell line (3.times.10.sup.5/ml) was inoculated into a 2L shake flask containing 300 ml of serum-free culture medium, and the shake flask was placed in a shaking bed for culture. After a cell density of 5.times.10.sup.6/ml was reached, the supernatant was collected. The supernatant was purified using Protein A column. The purified protein was transferred to PBS (pH 7.0) with dialysis. Protein electrophoresis was employed to provide proteins having a purity of at least 98%.

[0088] 6. Target Binding Activity

[0089] The binding activities of SIRP.alpha.-Fc, SIRP.alpha.D1-Fc, and HY03M to CD47 were tested by using flow cytometry.

[0090] Two cell lines, PC-3 (human prostate cancer) and Jurkat (T lymphocyte leukemia), were used to test the binding activity of each protein to CD47. After washed with PBS, the cells were suspended in PBS with a concentration of 1.times.10.sup.6/ml. The cell suspension was added with hlgG (1 .mu.g/ml) and then incubated in a refrigerator at 4.degree. C. for 1 hour. After washes with PBS, the cells were transferred to a 96-well U-shaped cell culture plate (Cat#163320, NUNC), 100 .mu.l per well. Then, the cells were added with purified proteins with different oncentrations and then incubated in a refrigerator at 4.degree. C. for 1 hour. The cells were washed with and then suspended in PBS. Thereafter, the cells were incubated together with FITC-labeled anti-human IgG-Fc antibody (Cat#F9512, Sigma). After 1 hour, the cells were tested in a flow cytometry (Guava easyCyte 6HT-2L, Millipore).

[0091] 7. Target Blockade Assay

[0092] In order to test whether the purified proteins can block the binding of CD47 to SIRP.alpha., FITC-labeled SIRP.alpha.-Fc (Cat#4546-SA-050, R&D Systems, 100 nM) was mixed with unlabeled SIRP.alpha.-Fc, SIRP.alpha.D1-Fc, HY03M, HY03MM or hIgG-Fc of different concentrations. Then, each mixture was put in a 96-well U-shaped plate with Jrukat cells, and incubated in a refrigerator at 4.degree. C. for 1 hour. After washes with PBS, the cells were re-suspended in 200 ml of PBS and analyzed for the ratio of fluorescent cells in a flow cytometry.

[0093] 8. Binding to Fc.gamma.Rs

[0094] The binding activities of proteins of the present invention to Fc.gamma.Rs were tested by ELISA as follows.

[0095] CD64 (Fc.gamma.RI) (Cat: 1257-FC-050, R&D Systems), CD32a (Fc.gamma.RIIa) (Cat: 1330-CD-050/CF, R&D Systems), CD32b (Fc.gamma.RIIb) (Cat: 1875-CD-050, R&D Systems),and CD16a (Fc.gamma.RIIIa) (Cat: 4325-FC-050, R&D Systems) were diluted with a coating buffering solution (CBS) (Sigma-Aldrich Co., Product code: 1001329288 C3041-100CAP) to a concentration of 1000 ng/ml, and 100 .mu.l of each solution was added into an ELISA plate (Cat#442404, Nunc.TM.), 100 ng per well. The plate was left in a refrigerator at 4.degree. C. overnight. Immediately before the test, the plate was washed by 0.05% PBS-T and then blocked by 3% skim milk for 1 hour at room temperature. The diluted solutions of HY03M and HY03MM (800, 400, and 200 nM) were added into the plate, 100 .mu.l per well. After incubated at room temperature for 1 hour, the liquids in the plate were discarded. The plate was washed by 0.05% PBS-T for 5 times, and then added with 100 .mu.l of HRP-Rabbit anti-human IgG Fc (Cat#: 309-036-008, Jackson ImmunoResearch Lab) diluted at 1:20000. The plate was incubated at room temperature for 1 hour and then washed by the washing solutions for 5 times. Thereafter, HRP substrates were added to the plate, and the plate was left for colorimetric reaction for 10 to 20 minutes in the dark. The colorimetric reaction was terminated later using 1 N H.sub.2SO.sub.4, and the OD450 value was obtained in a plate reader.

[0096] 9. Phagocytosis Assay

[0097] Mouse macrophages (Raw264.7) were added into a 96-well plate, 5.times.10.sup.5 cells per well, and incubated for 2 hours in an incubator at 37.degree. C. Jurkat cells labelled with CFSE (2.25 .mu.M) were incubated with 2.5 .mu.g/ml HY03M, HY03MM or IgG-Fc for 30 minutes at 37.degree. C. and then transferred to the plate containing Raw264.7 macrophages mentioned above. The plate was incubated at 37.degree. C. for another 3 hours. With washes by PBS for 3 times, Jurkat cells free in the solution were removed. The Raw264.7 cells were then observed in a flow cytometry through the CFSE contained in these cells.

[0098] 10. Antitumor Assay

[0099] The in vivo antitumor activity of HY03M was studied in a HL- 60 subcutaneous tumor model. Twenty Balb/c nude mice were injected subcutaneously with leukemia (HL60) cells, 4.times.10.sup.6 cells per mouse. When the tumors grew up to 100 to 150 mm.sup.3 in volume, the mice were randomly divided into 3 groups. The first group was intraperitoneally injected with PBS, while the second group was intraperitoneally injected with a VEGF inhibitor. The third group was intraperitoneally injected with HY03M. Each group was administered with said agent for 6 times at a dose of 10 mg/kg, twice a week. The volume and weight of the tumors were measured twice a week.

[0100] In order to know whether the Fc region contributed to anti-tumor effect, the anti-tumor activities of HY03M and HY03MM were tested using a lymphoma model, respectively, in comparison with Rituximab. Thirty-eight Balb/c rude mice were subcutaneously injected with Daudi cells, 1.times.10.sup.7 cells per mouse. When the tumors grew up to 100 to 150 mm.sup.3 in volume, the mice were randomly divided into 5 groups. The first group was intraperitoneally injected with PBS, while the second to fifth group were intraperitoneally injected with HY03M, HY03MM, Rituximab, and HY03MM plus Rituximab, respectively. Each group was administered with said agent for 8 times at a dose of 5 mg/kg, twice a week. The volume and weight of the tumors were measured twice a week.

EXPERIMENTAL RESULTS

[0101] 1. Construction of Expression Vectors

[0102] The structure of SIRP.alpha.D1-Fc was shown in FIG. 1B and FIG. 1D, wherein SIRP.alpha.D1 was linked to the N-terminus of IgG1-Fc. The nucleic acid sequence and amino acid sequences of each protein were shown in FIG. 2 to FIG. 5. The coding sequence of SIRP.alpha.-Fc consisted of 1752 nucleotides (FIG. 2A, SEQ ID No.:1), encoding 583 amino acids (FIG. 2B, SEQ ID No.:2). Among the 1752 nucleotides, 1047 encoded SIRP.alpha., 696 encoded Fc, and the remaining 6 formed EcoRI site. The coding sequence of SIRP.alpha.D1-Fc consisted of 1131 nucleotides (FIG. 3A, SEQ ID No.:3), encoding 376 amino acids (FIG. 3B, SEQ ID No.:4), wherein, 426 nucleotides encoded SIRP.alpha.D1, 696 encoded Fc, and the remaining 6 formed EcoRI site. HY03M and HY03MM contained 1125 nucleotides, wherein HY03M had a N89A mutation (FIG. 4A and 4B, SEQ ID No.:5 and 6), while HY03MM contained a N89A mutation and a D192A mutation (FIG. 5A and 5B, SEQ ID No.:7 and 8).

[0103] 2. Protein Expression Analysis

[0104] Theoretically, the four proteins, SIRP.alpha.-Fc, SIRP.alpha.D1-Fc, HY03M and HY03MM, had molecular weights of .about.128 kDa, .about.82.7 kD, .about.82.3 kDa and .about.82.3 kDa, respectively. With protein electrophoresis (SDS-PAGE), it was found that all the molecular weights were larger than the theoretically predicted ones under non-reducing conditions (FIG. 6), which might be due to protein glycosylation at a glycosylation site in relation to an Asn residue in SIRP.alpha.D1. The irregular glycosylation at this site may lead to the presence of two bands on SDS-PAGE gel under non-reducing conditions (FIG. 6B). If the site for glycosylation was removed, as in HY03M and HY03MM, only one band was found instead of two (FIG. 6C and 6D).

[0105] 3. Target Binding Activity Assay

[0106] By using flow cytometry, the binding activities of SIRP.alpha.-Fc and SIRP.alpha.D1-Fc to PC-3 cells were analyzed (FIG. 7A). It was found that the binding activity of SIRP.alpha.D1-Fc (EC50=6.57 nM) was significantly higher than that of SIRP.alpha.-Fc (EC50=12.63 nM). As previous studies showed that the glycosylation had no effect on binding of D1 to CD47 (Lee W Y et al., 2007), N89 in D1 region was mutated to A (the protein variant was designated as HY03M). The binding activity of HY03M to CD47 was compared with that of SIRP.alpha.D1-Fc. The result indicated that HY03M with the glycosylation site removed had an evidently higher binding activity to targets (EC50=0.5 nM) than SIRP.alpha.D1-Fc (EC50=1.0 nM), as shown in FIG. 7B. The study here suggested that the protein containing only D1 region had a better target binding activity than the protein containing whole extracellular domains, and to remove the glycosylation site in D1 further promoted the binding activity (the target binding activity: HY03M>SIRP.alpha.D1-Fc>SIRP.alpha.-Fc).

[0107] 4. Target Blockade Assay

[0108] With flow cytometry, the effect of the unlabeled proteins, SIRP.alpha.-Fc, SIRP.alpha.D1-Fc, HY03M and HY03MM, on binding of fluorescently labelled SIRP.alpha.-Fc with targets was studied. The results showed that, as in FIG. 8, these four proteins can all block binding of the fluorescently labelled protein to the target Jrukat cells in a dose dependent manner, with SIRP.alpha.D1-Fc and HY03M having the best blockade effects (see the table on lower part of FIG. 8).

[0109] 5. Effect of Binding Activity of HY03M or HY03MM with Fc.gamma.Rs on Phagocytosis by Macrophages

[0110] The 265th amino acid residue of human IgG1-Fc, aspartic acid (D), was key to antibody's function. If aspartic acid was converted to alanine (D265A), IgG would lose its binding activity to Fc.gamma.Rs (Fc.gamma.RI, Fc.gamma.RIIA, Fc.gamma.RIIB, Fc.gamma.RIIIA) (Shields R L, et al., 2001) and the corresponding ADCC, CDC and the like. To confirm whether Fc part in HY03M contributed to the anti-tumor activity, the aspartic acid in Fc region of HY03M was converted to alanine (HY03MM, D192A, FIG. 5B), and the binding activity of HY03M to Fc.gamma.Rs (Fc.gamma.RI, Fc.gamma.RIIA, Fc.gamma.RIIB, Fc.gamma.RIIIA) was analyzed in comparison with HY03MM. The results showed that, as in FIG. 9A, the binding activity of the protein variant (HY03MM) to Fc.gamma.Rs was decreased significantly, especially the binding activity to Fc.gamma.RIIA, Fc.gamma.RIIB and Fc.gamma.RIIIA.

[0111] To test the effect of the amino acid residue mutation on macrophages' activities, fluorescently (CFSE) labelled target Jurkat cells were incubated together with macrophages (Raw264.7) and HY03M or HY03MM. It turned out that HY03M evidently promoted the phagocytosis by macrophages as compared to the negative control group (IgG), and HY03MM lost such a function and showed no difference when compared to IgG, as shown in FIG. 9B.

[0112] The study suggested that the blockade of CD47-SIRP.alpha. binding by, for instance, HY03MM, was not sufficient to induce phagocytosis of target cells by macrophages. The interaction between Fc and Fc.gamma.Rs on surfaces of macrophages, when combined with the blockade of CD47-SIRP.alpha. binding, will stimulate phagocytosis.

[0113] 6. In Vivo Anti-Tumor Activities of HY03M and HY03MM

[0114] The in vivo anti-tumor activity of HY03M was studied in a HL- 60 subcutaneous tumor model. As shown in FIG. 10A, after treated by the VEGF inhibitor, tumor growth was not evidently inhibited in tumor-bearing mice. In the group with HY03M treatment, tumor growth was significantly inhibited, wherein the tumor size decreased gradually from 100 mm.sup.3 at the beginning of treatment, and almost vanished at the end of the experiment. In the negative control group, tumor size increased over time and became 1000 mm.sup.3 at the end of the experiment. The results suggested that the activity inhibition of VEGF alone had no obvious treatment effect on HL60 tumor, indicating that the growth of HL60 tumors did not depend much on VEGFs. However, if the inhibitory effect on phagocytosis by macrophages was removed, phagocytosis of tumor cells by macrophages would be promoted, eliminating tumor cells.

[0115] To test whether the Fc region was involved in HY03M's anti-tumor activity, the therapeutic effects of HY03M, HY03MM and Rituximab on lymphoma were studied using a lymphoma (Daudi) model. It can be seen (FIG. 10B) that tumor growth was significantly inhibited in the group with HY03M treatment (TGI=72.5%), which was much better than that in Rituximab group (TGI=45.6%). However, HY03MM with Fc region having a mutation had a much attenuated inhibitory effect on tumor growth (TGI=26.4%), suggesting that Fc region was involved in HY03M's anti-tumor activity.

[0116] The above data indicated that HY03M treated tumors by i) inhibiting binding of CD47 with SIRP.alpha. so that the inhibitory signals transmitted by SIRP.alpha. were blocked and macrophages were activated; and ii) binding Fc to Fc.gamma.Rs to active macrophages.

[0117] Conclusions

[0118] Our studies indicated that the recombinant protein SIRP.alpha.D1-Fc had a good target binding activity which was better than that of SIRP.alpha.-Fc. If the site for glycosylation was removed, as in HY03M, the target binding activity was further improved. In vivo studies showed that HY03M had a good anti-tumor activity, and would completely eliminate tumors in HL60 model. The protein fought tumors by i) inhibiting binding of CD47 with SIRP.alpha. so that the inhibitory signals transmitted by SIRP.alpha. were blocked and macrophages were activated; and ii) binding Fc to Fc.gamma.Rs to active macrophages. The two mechanisms produced a synergistic effect, sufficiently stimulating phagocytosis of tumor cells by macrophages. The activated macrophages may further present tumor antigens to T lymphocytes (Tseng D, et al., 2013) and kill the tumor cells finally.

[0119] As described above, for the binding activity of SIRP.alpha.-Fc or SIRP.alpha.D1-Fc to CD47, it was once reported (Lee W Y et al., 2007) that the affinities of these two proteins to CD47 were not different. Our studies here showed that the affinity of SIRP.alpha.D1-Fc to CD47 (in PC-3 cells) (EC50=6.57 nM) was much higher than that of SIRP.alpha.-Fc (EC50=12.63 nM). With amino acid analysis, it was found that SIRP.alpha.D1-Fc had 9 more amino acid residues (SCAWSGVAG (SEQ ID NO.: 14)) at the N-terminus compared to that constructed by Lee W Y et al., which might contribute to the increased target binding activity. Further studies found that the target binding activity was further improved when the glycosylation site (N89A) in D1 region was removed. In addition, with site-directed mutagenesis (D192A) in Fc region, Fc was found to help protein purification (by Protein A chromatography) and to improve protein stability, and also be involved in HY03M's anti-tumor activity, as the anti-tumor activity of the variant protein with D192A was greatly decreased.

[0120] While the invention has been described above in connection with one or more embodiments, it should be understood that the invention is not limited to those embodiments, and the description is intended to cover all alternatives, modifications, and equivalents, as may be included within the spirit and scope of the appended claims. All referenced cited herein are further incorporated by reference in their entirety.

REFERENCES

[0121] 1. Gardai S J, McPhillips K A, Frasch S C, Janssen W J, Starefeldt A, Murphy-Ullrich J E, Bratton D L,

[0122] Oldenborg P A, Michalak M, Henson P M. Cell-surface calreticulin initiates clearance of viable or apoptotic cells through trans-activation of LRP on the phagocyte. Cell. 2005; 123:321-334.

[0123] 2. Obeid M, Panaretakis T, Joza N, Tufi R, Tesniere A, van Endert P, Zitvogel L, Kroemer G. Calreticulin exposure is required for the immunogenicity of gamma-irradiation and UVC lightinduced apoptosis. Cell Death Differ. 2007; 14:1848-1850.

[0124] 3. Orr A W, Pedraza C E, Pallero M A, Elzie C A, Goicoechea S, Strickland D K, Murphy-Ullrich J E.

[0125] Low density lipoprotein receptor-related protein is a calreticulin coreceptor that signals focal adhesion disassembly. J Cell Biol. 2003; 161:1179-1189.

[0126] 4. Theocharides, A. P. A. ; Jin, L. Q. ; Cheng, P. Y. ; Prasolava, T. K. ; Malko, A. V. ; Ho, J. M. ; Poeppl, A. G. ; Rooijen, N. van ; Minden, M. D. ; Danska, J. S. ; Dick, J. ; Wang, J. C. Y. J. Exp. Med. 2012 Vol. 209 No. 10 1883-1899

[0127] 5. Lee W Y et al. Novel Structural Determinants on SIRP.alpha. that Mediate Binding to CD47. Immunol 2007; 179:7741-7750.

[0128] 6. Shields R L et al. High Resolution Mapping of the Binding Site on Human IgG1 for Fc.quadrature.RI, Fc.quadrature.RII, Fc.quadrature.RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the FcgR. JBC. 2001, 276:6591-6604.

[0129] 7. Tseng D, et al. Anti-CD47 antibody-mediated phagocytosis of cancer by macrophages primes an effective antitumor T-cell response. PNAS. 2013, 110:11103-11108.

Sequence CWU 1

1

1411752DNAHomo sapiens 1tcctgcgcct ggtcaggagt ggcgggtgag gaggagctgc aggtgattca gcctgacaag 60tccgtatcag ttgcagctgg agagtcggcc attctgcact gcactgtgac ctccctgatc 120cctgtggggc ccatccagtg gttcagagga gctggaccag cccgggaatt aatctacaat 180caaaaagaag gccacttccc ccgggtaaca actgtttcag agtccacaaa gagagaaaac 240atggactttt ccatcagcat cagtaacatc accccagcag atgccggcac ctactactgt 300gtgaagttcc ggaaagggag ccctgacacg gagtttaagt ctggagcagg cactgagctg 360tctgtgcgtg ccaaaccctc tgcccccgtg gtatcgggcc ctgcggcgag ggccacacct 420cagcacacag tgagcttcac ctgcgagtcc cacggcttct cacccagaga catcaccctg 480aaatggttca aaaatgggaa tgagctctca gacttccaga ccaacgtgga ccccgtagga 540gagagcgtgt cctacagcat ccacagcaca gccaaggtgg tgctgacccg cgaggacgtt 600cactctcaag tcatctgcga ggtggcccac gtcaccttgc agggggaccc tcttcgtggg 660actgccaact tgtctgagac catccgagtt ccacccacct tggaggttac tcaacagccc 720gtgagggcag agaaccaggt gaatgtcacc tgccaggtga ggaagttcta cccccagaga 780ctacagctga cctggttgga gaatggaaac gtgtcccgga cagaaacggc ctcaaccgtt 840acagagaaca aggatggtac ctacaactgg atgagctggc tcctggtgaa tgtatctgcc 900cacagggatg atgtgaagct cacctgccag gtggagcatg acgggcagcc agcggtcagc 960aaaagccatg acctgaaggt ctcagcccac ccgaaggagc agggctcaaa taccgccgct 1020gagaacactg gatctaatga acggaacgaa ttcgagccca aatcttgtga caaaactcac 1080acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 1140ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 1200gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 1260cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 1320gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 1380aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1440gaaccacagg tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 1500ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1560gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1620ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 1680tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct 1740ccgggtaaat ga 17522583PRTHomo sapiens 2Ser Cys Ala Trp Ser Gly Val Ala Gly Glu Glu Glu Leu Gln Val Ile1 5 10 15Gln Pro Asp Lys Ser Val Ser Val Ala Ala Gly Glu Ser Ala Ile Leu 20 25 30His Cys Thr Val Thr Ser Leu Ile Pro Val Gly Pro Ile Gln Trp Phe 35 40 45Arg Gly Ala Gly Pro Ala Arg Glu Leu Ile Tyr Asn Gln Lys Glu Gly 50 55 60His Phe Pro Arg Val Thr Thr Val Ser Glu Ser Thr Lys Arg Glu Asn65 70 75 80Met Asp Phe Ser Ile Ser Ile Ser Asn Ile Thr Pro Ala Asp Ala Gly 85 90 95Thr Tyr Tyr Cys Val Lys Phe Arg Lys Gly Ser Pro Asp Thr Glu Phe 100 105 110Lys Ser Gly Ala Gly Thr Glu Leu Ser Val Arg Ala Lys Pro Ser Ala 115 120 125Pro Val Val Ser Gly Pro Ala Ala Arg Ala Thr Pro Gln His Thr Val 130 135 140Ser Phe Thr Cys Glu Ser His Gly Phe Ser Pro Arg Asp Ile Thr Leu145 150 155 160Lys Trp Phe Lys Asn Gly Asn Glu Leu Ser Asp Phe Gln Thr Asn Val 165 170 175Asp Pro Val Gly Glu Ser Val Ser Tyr Ser Ile His Ser Thr Ala Lys 180 185 190Val Val Leu Thr Arg Glu Asp Val His Ser Gln Val Ile Cys Glu Val 195 200 205Ala His Val Thr Leu Gln Gly Asp Pro Leu Arg Gly Thr Ala Asn Leu 210 215 220Ser Glu Thr Ile Arg Val Pro Pro Thr Leu Glu Val Thr Gln Gln Pro225 230 235 240Val Arg Ala Glu Asn Gln Val Asn Val Thr Cys Gln Val Arg Lys Phe 245 250 255Tyr Pro Gln Arg Leu Gln Leu Thr Trp Leu Glu Asn Gly Asn Val Ser 260 265 270Arg Thr Glu Thr Ala Ser Thr Val Thr Glu Asn Lys Asp Gly Thr Tyr 275 280 285Asn Trp Met Ser Trp Leu Leu Val Asn Val Ser Ala His Arg Asp Asp 290 295 300Val Lys Leu Thr Cys Gln Val Glu His Asp Gly Gln Pro Ala Val Ser305 310 315 320Lys Ser His Asp Leu Lys Val Ser Ala His Pro Lys Glu Gln Gly Ser 325 330 335Asn Thr Ala Ala Glu Asn Thr Gly Ser Asn Glu Arg Asn Glu Phe Glu 340 345 350Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 355 360 365Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 370 375 380Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val385 390 395 400Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 405 410 415Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 420 425 430Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 435 440 445Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 450 455 460Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg465 470 475 480Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 485 490 495Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 500 505 510Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 515 520 525Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 530 535 540Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser545 550 555 560Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser 565 570 575Leu Ser Leu Ser Pro Gly Lys 58031131DNAHomo sapiens 3tcctgcgcct ggtcaggagt ggcgggtgag gaggagctgc aggtgattca gcctgacaag 60tccgtatcag ttgcagctgg agagtcggcc attctgcact gcactgtgac ctccctgatc 120cctgtggggc ccatccagtg gttcagagga gctggaccag cccgggaatt aatctacaat 180caaaaagaag gccacttccc ccgggtaaca actgtttcag agtccacaaa gagagaaaac 240atggactttt ccatcagcat cagtaacatc accccagcag atgccggcac ctactactgt 300gtgaagttcc ggaaagggag ccctgacacg gagtttaagt ctggagcagg cactgagctg 360tctgtgcgtg ccaaaccctc tgcccccgtg gtatcgggcc ctgcggcgag ggccacacct 420cagcacgaat tcgagcccaa atcttgtgac aaaactcaca catgcccacc gtgcccagca 480cctgaactcc tggggggacc gtcagtcttc ctcttccccc caaaacccaa ggacaccctc 540atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct 600gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg 660cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 720gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc 780atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg 840cccccatccc gggatgagct gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc 900ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac 960aagaccacgc ctcccgtgct ggactccgac ggctccttct tcctctacag caagctcacc 1020gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct 1080ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaata g 11314376PRTHomo sapiens 4Ser Cys Ala Trp Ser Gly Val Ala Gly Glu Glu Glu Leu Gln Val Ile1 5 10 15Gln Pro Asp Lys Ser Val Ser Val Ala Ala Gly Glu Ser Ala Ile Leu 20 25 30His Cys Thr Val Thr Ser Leu Ile Pro Val Gly Pro Ile Gln Trp Phe 35 40 45Arg Gly Ala Gly Pro Ala Arg Glu Leu Ile Tyr Asn Gln Lys Glu Gly 50 55 60His Phe Pro Arg Val Thr Thr Val Ser Glu Ser Thr Lys Arg Glu Asn65 70 75 80Met Asp Phe Ser Ile Ser Ile Ser Asn Ile Thr Pro Ala Asp Ala Gly 85 90 95Thr Tyr Tyr Cys Val Lys Phe Arg Lys Gly Ser Pro Asp Thr Glu Phe 100 105 110Lys Ser Gly Ala Gly Thr Glu Leu Ser Val Arg Ala Lys Pro Ser Ala 115 120 125Pro Val Val Ser Gly Pro Ala Ala Arg Ala Thr Pro Gln His Glu Phe 130 135 140Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala145 150 155 160Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 165 170 175Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 180 185 190Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 195 200 205Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 210 215 220Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln225 230 235 240Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 245 250 255Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 260 265 270Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 275 280 285Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 290 295 300Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr305 310 315 320Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 325 330 335Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 340 345 350Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 355 360 365Ser Leu Ser Leu Ser Pro Gly Lys 370 37551125DNAHomo sapiens 5tcctgcgcct ggtcaggagt ggcgggtgag gaggagctgc aggtgattca gcctgacaag 60tccgtatcag ttgcagctgg agagtcggcc attctgcact gcactgtgac ctccctgatc 120cctgtggggc ccatccagtg gttcagagga gctggaccag cccgggaatt aatctacaat 180caaaaagaag gccacttccc ccgggtaaca actgtttcag agtccacaaa gagagaaaac 240atggactttt ccatcagcat cagtgccatc accccagcag atgccggcac ctactactgt 300gtgaagttcc ggaaagggag ccctgacacg gagtttaagt ctggagcagg cactgagctg 360tctgtgcgtg ccaaaccctc tgcccccgtg gtatcgggcc ctgcggcgag ggccacacct 420cagcacgagc ccaaatcttg tgacaaaact cacacatgcc caccgtgccc agcacctgaa 480ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 540tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 600aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 660gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 720ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 780aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacac cctgccccca 840tcccgggatg agctgaccaa gaaccaggtc agcctgacct gcctggtcaa aggcttctat 900cccagcgaca tcgccgtgga gtgggagagc aatgggcagc cggagaacaa ctacaagacc 960acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1020aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1080aaccactaca cgcagaagag cctctccctg tctccgggta aatag 11256374PRTHomo sapiens 6Ser Cys Ala Trp Ser Gly Val Ala Gly Glu Glu Glu Leu Gln Val Ile1 5 10 15Gln Pro Asp Lys Ser Val Ser Val Ala Ala Gly Glu Ser Ala Ile Leu 20 25 30His Cys Thr Val Thr Ser Leu Ile Pro Val Gly Pro Ile Gln Trp Phe 35 40 45Arg Gly Ala Gly Pro Ala Arg Glu Leu Ile Tyr Asn Gln Lys Glu Gly 50 55 60His Phe Pro Arg Val Thr Thr Val Ser Glu Ser Thr Lys Arg Glu Asn65 70 75 80Met Asp Phe Ser Ile Ser Ile Ser Ala Ile Thr Pro Ala Asp Ala Gly 85 90 95Thr Tyr Tyr Cys Val Lys Phe Arg Lys Gly Ser Pro Asp Thr Glu Phe 100 105 110Lys Ser Gly Ala Gly Thr Glu Leu Ser Val Arg Ala Lys Pro Ser Ala 115 120 125Pro Val Val Ser Gly Pro Ala Ala Arg Ala Thr Pro Gln His Glu Pro 130 135 140Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu145 150 155 160Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 165 170 175Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 180 185 190Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 195 200 205Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn 210 215 220Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp225 230 235 240Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro 245 250 255Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu 260 265 270Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn 275 280 285Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 290 295 300Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr305 310 315 320Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys 325 330 335Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys 340 345 350Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 355 360 365Ser Leu Ser Pro Gly Lys 37071125DNAHomo sapiens 7tcctgcgcct ggtcaggagt ggcgggtgag gaggagctgc aggtgattca gcctgacaag 60tccgtatcag ttgcagctgg agagtcggcc attctgcact gcactgtgac ctccctgatc 120cctgtggggc ccatccagtg gttcagagga gctggaccag cccgggaatt aatctacaat 180caaaaagaag gccacttccc ccgggtaaca actgtttcag agtccacaaa gagagaaaac 240atggactttt ccatcagcat cagtgccatc accccagcag atgccggcac ctactactgt 300gtgaagttcc ggaaagggag ccctgacacg gagtttaagt ctggagcagg cactgagctg 360tctgtgcgtg ccaaaccctc tgcccccgtg gtatcgggcc ctgcggcgag ggccacacct 420cagcacgagc ccaaatcttg tgacaaaact cacacatgcc caccgtgccc agcacctgaa 480ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 540tcccggaccc ctgaggtcac atgcgtggtg gtggccgtga gccacgaaga ccctgaggtc 600aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 660gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 720ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 780aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacac cctgccccca 840tcccgggatg agctgaccaa gaaccaggtc agcctgacct gcctggtcaa aggcttctat 900cccagcgaca tcgccgtgga gtgggagagc aatgggcagc cggagaacaa ctacaagacc 960acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1020aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1080aaccactaca cgcagaagag cctctccctg tctccgggta aatag 11258374PRTHomo sapiens 8Ser Cys Ala Trp Ser Gly Val Ala Gly Glu Glu Glu Leu Gln Val Ile1 5 10 15Gln Pro Asp Lys Ser Val Ser Val Ala Ala Gly Glu Ser Ala Ile Leu 20 25 30His Cys Thr Val Thr Ser Leu Ile Pro Val Gly Pro Ile Gln Trp Phe 35 40 45Arg Gly Ala Gly Pro Ala Arg Glu Leu Ile Tyr Asn Gln Lys Glu Gly 50 55 60His Phe Pro Arg Val Thr Thr Val Ser Glu Ser Thr Lys Arg Glu Asn65 70 75 80Met Asp Phe Ser Ile Ser Ile Ser Ala Ile Thr Pro Ala Asp Ala Gly 85 90 95Thr Tyr Tyr Cys Val Lys Phe Arg Lys Gly Ser Pro Asp Thr Glu Phe 100 105 110Lys Ser Gly Ala Gly Thr Glu Leu Ser Val Arg Ala Lys Pro Ser Ala 115 120 125Pro Val Val Ser Gly Pro Ala Ala Arg Ala Thr Pro Gln His Glu Pro 130 135 140Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu145 150 155 160Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 165 170 175Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Ala 180 185 190Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 195 200 205Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn 210 215 220Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp225 230 235 240Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro 245 250 255Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

Gln Pro Arg Glu 260 265 270Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn 275 280 285Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 290 295 300Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr305 310 315 320Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys 325 330 335Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys 340 345 350Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 355 360 365Ser Leu Ser Pro Gly Lys 370940DNAArtificial sequencePrimer 9cccaagcttg gggccaccat ggagcccgcc ggcccggccc 401030DNAArtificial sequencePrimer 10cggaattcgt tccgttcatt agatccagtg 301130DNAArtificial sequencePrimer 11cggaattcgt gctgaggtgt ggccctcgcc 301243DNAArtificial sequencePrimer 12gaggtcacat gcgtggtggt ggccgtgagc cacgaagacc ctg 431340DNAArtificial sequencePrimer 13caccaccacg catgtgacct caggggtccg ggagatcatg 40149PRTHomo sapiens 14Ser Cys Ala Trp Ser Gly Val Ala Gly1 5

Claims

1. A recombinant bi-functional fusion protein, comprising an extracellular Ig-like domain of a signal-regulatory protein (SIRP) of SIRP.alpha. (SIRP.alpha.D1), linked to an Fc region of an immunoglobulin comprising both CH2 and CH3 regions of the immunoglobulin, wherein: the SIRP.alpha.D1 comprises a mutation, wherein: the mutation corresponds to N to A at position 89 in full length SIRP.alpha. set forth in SEQ ID NO.: 2; wherein the recombinant bi-functional fusion protein comprises an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO.: 6., and the recombinant bi-functional fusion protein can bind to CD47 and Fc.gamma. Receptor, thereby blocking the binding of CD47 to the SIRP on surfaces of macrophages and stimulating phagocytosis of tumor cells by the macrophages.

2. The recombinant bi-functional fusion protein of claim 1, wherein the Fc fragment is an Fc fragment of IgG1.

3. The recombinant bi-functional fusion protein of claim 2, wherein the IgG1 is a human IgG1.

4. The recombinant bi-functional fusion protein of claim 3, wherein the Fc region comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 6 from residue 143 to residue 374.

5. The recombinant bi-functional fusion protein of claim 3, wherein the Fc region comprises an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 6 from residue 143 to residue 374.

6. A homodimer of the recombinant bi-functional fusion protein of claim 1, wherein the homodimer comprises two fusion proteins linked by one or more disulfide bonds.

7. A polynucleotide encoding the recombinant bi-functional fusion protein of claim 1.

8. An expression vector comprising the polynucleotide of claim 7.

9. A host cell comprising and expressing the polynucleotide of claim 7.

10. A host cell comprising the expression vector of claim 8.

11. A pharmaceutical composition, comprising an effective amount of the recombinant bi-functional fusion protein of claim 1 for treating a disease caused by over expression of Cluster of Differentiation 47 (CD47), and at least one pharmaceutically-acceptable excipient, wherein the recombinant bi-functional fusion protein can bind to CD47 and Fc.gamma. Receptor, thereby blocking the binding of CD47 to the SIRP on the cell surface of macrophages and stimulating phagocytosis of tumor cells by macrophages.

12. A method for treating a disease caused by over-expression of CD47, comprising administering to a patient or a subject a therapeutically effective amount of the pharmaceutical composition of claim 11.

13. The method of claim 12, wherein the disease is selected from the group consisting of acute myelocytic leukemia (AML), chronic myelocytic leukemia (C1v1L), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), multiple myeloma (MM), bladder cancer, ovarian cancer, prostate cancer, lung cancer, colon cancer, breast cancer, pancreatic cancer, and renal cell carcinoma.

14. The method of claim 12, wherein the disease is selected from the group consisting of Crohn's disease, allergic asthma and rheumatoid arthritis.

15. A method of preparing a recombinant bi-functional fusion protein, comprising an extracellular Ig-like domain of a signal-regulatory protein (SIRP) of SIRP.alpha. (SIRP.alpha.D1), linked to an Fc region of an immunoglobulin comprising both CH2 and CH3 regions of the immunoglobulin, wherein: the SIRP.alpha.D1 comprises a mutation, wherein: the mutation corresponds to N to A at position 89 in full length SIRP.alpha. set forth in SEQ ID NO.: 2; wherein the recombinant bi-functional fusion protein comprises an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO.: 6, and the recombinant bi-functional fusion protein can bind to CD47 and Fc.gamma. Receptor, thereby blocking the binding of CD47 to the SIRP on surfaces of macrophages and stimulating phagocytosis of tumor cells by the macrophages; said method comprising cultivating host cells of claim 10 to express the protein and purifying the protein.

16. A host cell comprising an expression vector comprising the polynucleotide of claim 7; wherein said host cell expresses the polynucleotide.

17. A method of preparing a recombinant bi-functional fusion protein, comprising an extracellular Ig-like domain of a signal-regulatory protein (SIRP) of SIRP.alpha. (SIRP.alpha.D1), linked to an Fc region of an immunoglobulin comprising both CH2 and CH3 regions of the immunoglobulin, wherein: the SIRP.alpha.D1 comprises a mutation, wherein: the mutation corresponds to N to A at position 89 in full length SIRP.alpha. set forth in SEQ ID NO.: 2; wherein the recombinant bi-functional fusion protein comprises an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO.: 6, and the recombinant bi-functional fusion protein can bind to CD47 and Fc.gamma. Receptor, thereby blocking the binding of CD47 to the SIRP on surfaces of macrophages and stimulating phagocytosis of tumor cells by the macrophages; said method comprising cultivating host cells of claim 16 to express the protein and purifying the protein.