Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: POLYNUCLEOTIDE AGENTS TARGETING PATATIN-LIKE PHOSPHOLIPASE DOMAIN CONTAINING 3 (PNPLA3) AND METHODS OF USE THEREOF

Inventors:  Gregory Hinkle (Cambridge, MA, US)  Gregory Hinkle (Cambridge, MA, US)
IPC8 Class: AC12N15113FI
USPC Class: 1 1
Class name:
Publication date: 2021-10-14
Patent application number: 20210317458



Abstract:

The invention relates to polynucleotide agents targeting a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, and methods of using such polynucleotide agents to inhibit expression of a PNPLA3 gene and methods of treating subjects having Nonalcoholic Fatty Liver Disease (NAFLD) and/or a PNPLA3-associated disorder.

Claims:

1. An antisense polynucleotide agent for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, wherein the agent comprises about 4 to about 50 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11.

2. The agent of claim 1, wherein the equivalent region is any one of the target regions of SEQ ID NO:1 provided in Tables 3 and 4.

3. An antisense polynucleotide agent for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, wherein the agent comprises at least 8 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences listed in Tables 3 and 4, and wherein the agent is about 8 to about 50 nucleotides in length.

4. The agent of claim 1, wherein substantially all of the nucleotides of the antisense polynucleotide agent are modified nucleotides; or wherein all of the nucleotides of the antisense polynucleotide agent are modified nucleotides.

5. The agent of claim 1, which is 10 to 40 nucleotides in length; 10 to 30 nucleotides in length; 18 to 30 nucleotides in length; 10 to 24 nucleotides in length; 18 to 24 nucleotides in length; 20 nucleotides in length; or 14 nucleotides in length.

6. The agent of claim 1, wherein the modified nucleotide comprises a modified sugar moiety selected from the group consisting of: a 2'-O-methoxyethyl modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

7. The agent of claim 1, wherein the modified nucleotide is a 5-methylcytosine.

8. The agent of claim 1, wherein the modified nucleotide comprises a modified internucleoside linkage.

9. The agent of claim 1, comprising a plurality of 2'-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.

10. The agent of claim 9, wherein the agent is a gapmer comprising a gap segment comprised of linked 2'-deoxynucleotides positioned between a 5' and a 3' wing segment.

11. An antisense polynucleotide agent for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, comprising a gap segment consisting of linked deoxynucleotides; a 5'-wing segment consisting of linked nucleotides; a 3'-wing segment consisting of linked nucleotides; wherein the gap segment is positioned between the 5'-wing segment and the 3'-wing segment and wherein each nucleotide of each wing segment comprises a modified sugar moiety.

12. The agent of claim 11, wherein the gap segment is ten 2'-deoxynucleotides in length and each of the wing segments is five nucleotides in length.

13. The agent of claim 1, wherein the agent further comprises a ligand conjugated at the 3'-terminus.

14. The agent of claim 13, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

15. A pharmaceutical composition for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, comprising the agent of claim 1.

16. A pharmaceutical composition comprising the agent of claim 1, and a lipid formulation.

17. A method of inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene in a cell, the method comprising: (a) contacting the cell with the agent of claim 1; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain antisense inhibition of a PNPLA3 gene, thereby inhibiting expression of the PNPLA3 gene in the cell.

18. The method of claim 17, wherein the cell is within a subject.

19. The method of claim 18, wherein the subject is a human.

20. A method of treating a subject having a disease or disorder that would benefit from reduction in expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene, the method comprising administering to the subject a therapeutically effective amount of the agent of claim 1, thereby treating the subject having a disorder that would benefit from reduction in expression of a PNPLA3 gene.

21-23. (canceled)

Description:

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 16/790,829, filed on Feb. 14, 2020, which is a continuation of U.S. patent application Ser. No. 15/917,990, filed on Mar. 12, 2018, now U.S. Pat. No. 10,597,661, issued on Mar. 24, 2020, which is a 35 .sctn. U.S.C. 111(a) continuation application which claims the benefit of priority to PCT/US2016/051252, filed on Sep. 12, 2016 which, in turn, claims the benefit of priority to U.S. Provisional Patent Application No. 62/218,100, filed on Sep. 14, 2015. The entire contents of each of the foregoing applications are hereby incorporated herein by reference.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 27, 2020, is named 121301_04304_SL.txt and is 202,427 bytes in size.

BACKGROUND OF THE INVENTION

[0003] The accumulation of excess triglyceride in the liver is known as hepatic steatosis (or fatty liver), and is associated with adverse metabolic consequences, including insulin resistance and dyslipidemia. Fatty liver is frequently found in people who intake excessive alcohols and who have obesity, diabetes, or hyperlipidemia. Nonalcoholic fatty liver disease (NAFLD) refers to a wide spectrum of liver disease ranging from simple fatty liver (steatosis), to nonalcoholic steatohepatitis (NASH), to cirrhosis (irreversible, advanced scarring of the liver). All of the stages of NAFLD have in common the accumulation of fat (fatty infiltration) in the liver cells (hepatocytes), and NAFLD is now the leading cause of chronic liver disease in the United States.

[0004] The NAFLD spectrum is thought to begin with and progress from its simplest stage, called simple fatty liver (steatosis). Simple fatty liver involves the accumulation of fat (triglyceride) in the liver cells with no inflammation (hepatitis) or scarring (fibrosis). The next stage and degree of severity in the NAFLD spectrum is NASH, which involves the accumulation of fat in the liver cells, as well as inflammation of the liver. The inflammatory cells can destroy liver cells (hepatocellular necrosis), and NASH can ultimately lead to scarring of the liver (fibrosis), followed by irreversible, advanced scarring (cirrhosis). Cirrhosis that is caused by NASH is the last and most severe stage in the NAFLD spectrum.

[0005] In 2008, a genomewide association study of individuals with proton magnetic resonance spectroscopy of the liver to evaluate hepatic fat content, a significant association was identified between hepatic fat content and the Patatin-like Phospholipase Domain Containing 3 (PNPLA3) gene (see, for example, Romeo et al. (2008) Nat. Genet., 40(12):1461-1465). Studies with knock-in mice have demonstrated that expression of a sequence polymorphism (rs738409, I148M) in PNPLA3 causes NAFLD, and that the accumulation of catalytically inactive PNPLA3 on the surfaces of lipid droplets is associated with the accumulation of triglycerides in the liver (Smagris et al. (2015) Hepatology, 61:108-118). Specifically, the PNPLA3 I148M variant may promote the development of fibrogenesis by activating the hedgehog (Hh) signaling pathway, leading to the activation and proflieration of hepatic stellate cells and excessive generation and deposition of extracellular matrix (Chen et al. (2015) World J. Gastroenterol., 21(3):794-802).

[0006] Currently, treatments for NAFLD are directed towards weight loss and treatment of any secondary conditions, such as insulin resistance or dyslipidemia. To date, no pharmacologic treatments for NAFLD have been approved. Therefore, there is a need for therapies for subjects suffering from NAFLD.

SUMMARY OF THE INVENTION

[0007] The present invention provides polynucleotide agents, e.g., antisense polynucleotide agents, and compositions comprising such agents which target nucleic acids encoding a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene and interfere with the normal function of the targeted nucleic acid. The PNPLA3 nucleic acid may be within a cell, e.g., a cell within a subject, such as a human. The present invention also provides methods and combination therapies for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a PNPLA3 mRNA, e.g., a PNPLA3-associated disease, such as such as Nonalcoholic Fatty Liver Disease (NAFLD), using the polynucleotide agents and compositions of the invention, e.g., antisense polynucleotide agents and compositions of the invention.

[0008] Accordingly, in one aspect, the present invention provides antisense polynucleotide agents for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene. The agents include about 4 to about 50 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1-4.

[0009] In another aspect, the present invention provides antisense polynucleotide agents for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene. The agents include at least 8 contiguous nucleotides differing by no more than 3 nucleotides from any one of the target nucleotide sequences of SEQ ID NO:1 provided in Tables 3 and 4 and are about 8 to about 50 nucleotides in length.

[0010] In some embodiments, substantially all of the nucleotides of the antisense polynucleotide agents of the invention are modified nucleotides. In other embodiments, all of the nucleotides of the antisense polynucleotide agent are modified nucleotides.

[0011] The antisense polynucleotide agent may be 10 to 40 nucleotides in length; 10 to 30 nucleotides in length; 18 to 30 nucleotides in length; 10 to 24 nucleotides in length; 18 to 24 nucleotides in length; or 20 nucleotides in length.

[0012] In one embodiment, the modified nucleotide comprises a modified sugar moiety selected from the group consisting of a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

[0013] In one embodiment, the bicyclic sugar moiety has a (--CRH--)n group forming a bridge between the 2' oxygen and the 4' carbon atoms of the sugar ring, wherein n is 1 or 2 and wherein R is H, CH.sub.3 or CH.sub.3OCH.sub.3.

[0014] In a further embodiment, n is 1 and R is CH.sub.3.

[0015] In another embodiment, the modified nucleotide is a 5-methylcytosine.

[0016] In one embodiment, the modified nucleotide comprises a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

[0017] In one embodiment, an agent of the invention comprises one 2'-deoxynucleotide. In another embodiment, an agent of the invention comprises one 2'-deoxynucleotide flanked on each side by at least one nucleotide having a modified sugar moiety.

[0018] In one embodiment, an agent of the invention comprises a plurality, e.g., more than 1, e.g., 2, 3, 4, 5, 6, or 7, 2'-deoxynucleotides. In one embodiment, an agent of the invention comprises a plurality, e.g., more than 1, e.g., 2, 3, 4, 5, 6, or 7, 2'-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.

[0019] In one embodiment, the agent is a gapmer comprising a gap segment comprised of linked 2'-deoxynucleotides positioned between a 5' and a 3' wing segment.

[0020] In one embodiment, the modified sugar moiety is selected from the group consisting of a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

[0021] In one embodiment, the 5'-wing segment is 1 to 6 nucleotides in length, e.g., 2, 3, 4, or 5 nucleotides in length.

[0022] In one embodiment, the 3'-wing segment is 1 to 6 nucleotides in length, e.g., 2, 3, 4, or 5 nucleotides in length.

[0023] In one embodiment, the gap segment is 5 to 14 nucleotides in length, e.g., 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. In one embodiment, the gap segment is 10 nucleotides in length.

[0024] In one aspect, the present invention provides antisense polynucleotide agents for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene. The agents include a gap segment consisting of linked deoxynucleotides; a 5'-wing segment consisting of linked nucleotides; a 3'-wing segment consisting of linked nucleotides; wherein the gap segment is positioned between the 5'-wing segment and the 3'-wing segment and wherein each nucleotide of each wing segment comprises a modified sugar moiety.

[0025] In one embodiment, the gap segment is ten 2'-deoxynucleotides in length and each of the wing segments is five nucleotides in length.

[0026] In another embodiment, the gap segment is ten 2'-deoxynucleotides in length and each of the wing segments is four nucleotides in length.

[0027] In yet another embodiment, the gap segment is ten 2'-deoxynucleotides in length and each of the wing segments is three nucleotides in length.

[0028] In another embodiment, the gap segment is ten 2'-deoxynucleotides in length and each of the wing segments is two nucleotides in length.

[0029] In one embodiment, the modified sugar moiety is selected from the group consisting of a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

[0030] In some embodiments, the agents of the invention further comprise a ligand.

[0031] In one embodiment, the agent is conjugated to the ligand at the 3'-terminus.

[0032] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0033] In one embodiment, the ligand is

##STR00001##

[0034] In one aspect, the present invention provides pharmaceutical compositions for inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene comprising an agent of the invention.

[0035] In one embodiment, the agent is present in an unbuffered solution, such as saline or water.

[0036] In another embodiment, the agent is is present in a buffer solution, such as a buffer comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

[0037] In one embodiment, the buffer solution is phosphate buffered saline (PBS).

[0038] In another aspect, the present invention provides pharmaceutical composition comprising an agent of the invention and a lipid formulation, such as a lipid formulation comprising an LNP or a MC3.

[0039] In one aspect, the present invention provides methods of inhibiting expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene in a cell. The methods include contacting the cell with an agent of the invention or a pharmaceutical composition of the invention; and maintaining the cell for a time sufficient to obtain antisense inhibition of a PNPLA3 gene, thereby inhibiting expression of the PNPLA3 gene in the cell.

[0040] In one embodiment, the cell is within a subject.

[0041] In one embodiment, the subject is a human. In one embodiment, the subject is a female human. In another embodiment, the subject is a male human.

[0042] In one embodiment, the PNPLA3 expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%.

[0043] In another aspect, the present invention provides methods of treating a subject having a disease or disorder that would benefit from reduction in expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene. The methods include administering to the subject a therapeutically effective amount of an agent of the invention or a pharmaceutical composition of the invention, thereby treating the subject.

[0044] In yet another aspect, the present invention provides methods of preventing at least one symptom in a subject having a disease or disorder that would benefit from reduction in expression of a Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene. The methods include administering to the subject a prophylactically effective amount of an agent of the invention or a pharmaceutical composition of the invention, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in expression of a PNPLA3 gene.

[0045] In one embodiment, the administration of the agent to the subject causes a decrease in the hedgehog signaling pathway and/or a decrease in PNPLA3 protein levels in the subject.

[0046] In one embodiment, the disorder is a PNPLA3-associated disease.

[0047] In one embodiment, the PNPLA3-associated disease is a PNPLA3-associated disease. In another embodiment, the PNPLA3-associated disease is nonalcoholic fatty liver disease (NAFLD). In another embodiment, the PNPLA3-associated disease is fatty liver (steatosis). In another embodiment, the PNPLA3-associated disease is nonalcoholic steatohepatitis (NASH). In another embodiment, the PNPLA3-associated disease is obesity. In one embodiment, the subject is human. In another embodiment, the subject is a female human. In another embodiment, the subject is a male human. In one embodiment, the subject has a PNPLA3 I148M mutation. In one embodiment, the mutation is heterozygous. In another embodiment, the mutation is homozygous.

[0048] In certain embodiments, the methods further comprise administering to the subject an additional therapeutic agent suitable for treatment of a PNPLA3-associated disease. In some embodiments, the additional therapeutic agent is an anti-PNPLA3 antibody, or antigen-binding fragment thereof.

[0049] In certain embodiments, the agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg.

[0050] In certain embodiments, the agent is administered at a dose of about 10 mg/kg to about 30 mg/kg.

[0051] In certain embodiments, the agent is administered to the subject once a week.

[0052] In alternative embodiments, the agent is administered to the subject twice a week.

[0053] In yet other embodiments, the agent is administered to the subject twice a month.

[0054] In certain embodiments, the agent is administered to the subject subcutaneously.

[0055] In another embodiment, the methods of the invention further comprise measuring hedgehog signaling pathway levels in the subject. In one embodiment, a decrease in the levels of expression or activity of the hedgehog (Hh) signaling pathway indicate that the PNPLA3-associated disease is being treated or prevented.

DETAILED DESCRIPTION OF THE INVENTION

[0056] The present invention provides polynucleotide agents, e.g., antisense polynucleotide agents, and compositions comprising such agents which target nucleic acids encoding Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) (e.g., mRNA encoding PNPLA3 as provided in, for example, any one of SEQ ID NOs:1, 3, 5, 7, 9, and/or 11). The antisense polynucleotide agents bind to nucleic acids encoding PNPLA3 via, e.g., Watson-Crick base pairing, and interfere with the normal function of the targeted nucleic acid.

[0057] The polynucleotide agents, e.g., antisense polynucleotide agents, of the invention include a nucleotide sequence which is about 4 to about 50 nucleotides or less in length and which is about 80% complementary to at least part of an mRNA transcript of a PNPLA3 gene. The use of these antisense polynucleotide agents enables the targeted inhibition of RNA expression and/or activity of a PNPLA3 gene in mammals.

[0058] The present inventors have demonstrated that antisense polynucleotide agents targeting PNPLA3 can mediate antisense inhibition in vitro resulting in significant inhibition of expression of a PNPLA3 gene. Thus, methods and compositions including these antisense polynucleotide agents are useful for treating a subject who would benefit by a reduction in the levels and/or activity of an PNPLA3 protein, such as a subject having a PNPLA3-associated disease, such as Nonalcoholic Fatty Liver Disease (NAFLD).

[0059] The present invention also provides methods and combination therapies for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of an PNPLA3 gene, e.g., an PNPLA3-associated disease, such as Nonalcoholic Fatty Liver Disease (NAFLD), using the antisense polynucleotide agents and compositions of the invention.

[0060] The present invention also provides methods for preventing at least one symptom, e.g., the presence of increased protein activity in the hedgehog (Hh) signaling pathway, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD), in a subject having a disorder that would benefit from inhibiting or reducing the expression of a PNPLA3 gene, e.g., a subject having a PNPLA3-associated disorder, e.g., nonalcoholic fatty liver disease (NAFLD). The present invention further provides compositions comprising antisense polynucleotide agents which effect antisense inhibition of a PNPLA3 gene. The PNPLA3 gene may be within a cell, e.g., a cell within a subject, such as a human.

[0061] The combination therapies of the present invention include administering to a subject having a PNPLA3-associated disease, an antisense polynucleotide agent of the invention and an additional therapeutic, such as an anti-PNPLA3 antibody, or antigen-binding fragment thereof. The combination therapies of the invention reduce PNPLA3 levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) by targeting PNPLA3 mRNA with an antisense polynucleotide agent of the invention and, accordingly, allow the therapeutically (or prophylactically) effective amount of the additional therapeutic agent(s) required to treat the subject to be reduced, thereby decreasing the costs of treatment and permitting easier and more convenient ways of administering certain agents, or decreasing side effects of certain agents.

[0062] The following detailed description discloses how to make and use antisense polynucleotide agents to inhibit the mRNA and/or protein expression of a PNPLA3 gene, as well as compositions, uses, and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of this gene.

I. DEFINITIONS

[0063] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0064] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0065] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0066] The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.

[0067] The term "about" is used herein to mean within the typical ranges of tolerances in the art.

[0068] As used herein, "Patatin-Like Phospholipase Domain Containing 3," used interchangeably with the term "PNPLA3," refers to the naturally occurring gene that encodes a triacylglycerol lipase that mediates triacyl glycerol hydrolysis in adipocytes. The amino acid and complete coding sequences of the reference sequence of the human PNPLA3 gene may be found in, for example, GenBank Accession No. GI:17196625 (RefSeq Accession No. NM_025225.2; SEQ ID NO:1; SEQ ID NO:2). Mammalian orthologs of the human PNPLA3 gene may be found in, for example, GenBank Accession Nos. GI: 544461323 (RefSeq Accession No. XM_005567051.1, cynomolgus monkey; SEQ ID NO:7 and SEQ ID NO:8); GI: 544461325 (RefSeq Accession No. XM_005567052.1, cynomolgus monkey; SEQ ID NO:11 and SEQ ID NO:12); GI:297261270 (RefSeq Accession No. XM_001109144.2, rhesus monkey, SEQ ID NO:9 and SEQ ID NO:10); GI:144226244 (RefSeq Accession No. NM_054088.3, mouse; SEQ ID NO:3 and SEQ ID NO:4); GI:537361027 (RefSeq Accession No. NM_001282324.1, rat; SEQ ID NO:5 and SEQ ID NO:6).

[0069] Additional examples of PNPLA3 mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.

The term"PNPLA3," as used herein, also refers to naturally occurring DNA sequence variations of a PNPLA3 gene, such as a single nucleotide polymorphism (SNP) in a PNPLA3 gene. Exemplary SNPs may be found in the dbSNP database available at www.ncbi.nlm.nih.gov/projects/SNP/.

[0070] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PNPLA3 gene, including mRNA that is a product of RNA processing of a primary transcription product.

[0071] As used herein, "target nucleic acid" refers to a nucleic acid molecule to which an antisense polynucleotide agent of the invention specifically hybridizes.

[0072] The terms "antisense polynucleotide agent" "antisense compound", and "agent" as used interchangeably herein, refer to an agent comprising a single-stranded oligonucleotide that contains RNA as that term is defined herein, and which targets nucleic acid molecules encoding PNPLA3 (e.g., mRNA encoding PNPLA3 as provided in, for example, any one of SEQ ID NOs:1, 3, 5, 7, 9, and/or 11). The antisense polynucleotide agents specifically bind to the target nucleic acid molecules via hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) and interfere with the normal function of the targeted nucleic acid (e.g., by an antisense mechanism of action). This interference with or modulation of the function of a target nucleic acid by the polynucleotide agents of the present invention is referred to as "antisense inhibition."

[0073] The functions of the target nucleic acid molecule to be interfered with may include functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.

[0074] In some embodiments, antisense inhibition refers to "inhibiting the expression" of target nucleic acid levels and/or target protein levels in a cell, e.g., a cell within a subject, such as a mammalian subject, in the presence of the antisense polynucleotide agent complementary to a target nucleic acid as compared to target nucleic acid levels and/or target protein levels in the absence of the antisense polynucleotide agent. For example, the antisense polynucleotide agents of the invention can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355.

[0075] As used herein, the term "specifically hybridizes" refers to an antisense polynucleotide agent having a sufficient degree of complementarity between the antisense polynucleotide agent and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays and therapeutic treatments.

[0076] A target sequence may be from about 4-50 nucleotides in length, e.g., 8-45, 10-45, 10-40, 10-35, 10-30, 10-20, 11-45, 11-40, 11-35, 11-30, 11-20, 12-45, 12-40, 12-35, 12-30, 12-25, 12-20, 13-45, 13-40, 13-35, 13-30, 13-25, 13-20, 14-45, 14-40, 14-35, 14-30, 14-25, 14-20, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 16-45, 16-40, 16-35, 16-30, 16-25, 16-20, 17-45, 17-40, 17-35, 17-30, 17-25, 17-20, 18-45, 18-40, 18-35, 18-30, 18-25, 18-20, 19-45, 19-40, 19-35, 19-30, 19-25, 19-20, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides of the nucleotide sequence of an mRNA molecule formed during the transcription of a PNPLA3 gene. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0077] The terms "complementary," "fully complementary" and "substantially complementary" are used herein with respect to the base matching between an antisense polynucleotide agent and a target sequence. The term"complementarity" refers to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0078] As used herein, an antisense polynucleotide agent that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to an antisense polynucleotide agent that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a PNPLA3 gene). For example, a polynucleotide is complementary to at least a part of a PNPLA3 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding PNPLA3.

[0079] As used herein, the term "region of complementarity" refers to the region of the antisense polynucleotide agent that is substantially complementary to a sequence, for example a target sequence, e.g., a PNPLA3 nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5'- and/or 3'-terminus of the antisense polynucleotide.

[0080] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of a polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the nucleotides.

[0081] Complementary sequences include those nucleotide sequences of an antisense polynucleotide agent of the invention that base-pair to a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., antisense inhibition of target gene expression.

[0082] "Complementary" sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0083] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0084] "G," "C," "A," "T" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the terms "deoxyribonucleotide", "ribonucleotide" and "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 2). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of the agents featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

[0085] A "nucleoside" is a base-sugar combination. The "nucleobase" (also known as "base") portion of the nucleoside is normally a heterocyclic base moiety. "Nucleotides" are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. "Polynucleotides," also referred to as "oligonucleotides," are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the polynucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide.

[0086] In general, the majority of nucleotides of the antisense polynucleotide agents are ribonucleotides, but as described in detail herein, the agents may also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide. In addition, as used in this specification, an "antisense polynucleotide agent" may include nucleotides (e.g., ribonucleotides or deoxyribonucleotides) with chemical modifications; an antisense polynucleotide agent may include substantial modifications at multiple nucleotides.

[0087] As used herein, the term "modified nucleotide" refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the antisense polynucleotide agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in nucleotides, are encompassed by "antisense polynucleotide agent" for the purposes of this specification and claims.

[0088] As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in PNPLA3 gene expression and/or replication; a human at risk for a disease, disorder or condition that would benefit from reduction in PNPLA3 gene expression; a human having a disease, disorder or condition that would benefit from reduction in PNPLA3 gene expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in PNPLA3 gene expression, as described herein. In one embodiment, the subject is a female human. In another embodiment, the subject is a male human.

[0089] As used herein, the terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with PNPLA3 gene expression and/or PNPLA3 protein production, e.g., the presence of increased protein activity in the hedgehog (Hh) signaling pathway, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD). "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0090] The term "lower" in the context of the level of PNPLA3 in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. "Lower" in the context of the level of PNPLA3 in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder.

[0091] As used herein, "prevention" or "preventing," when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an PNPLA3 gene and/or production of PNPLA3 protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of PNPLA3 gene expression, such as the presence of elevated levels of proteins in the hedgehog signaling pathway, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD). The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.

[0092] As used herein, the term "Patatin-Like Phospholipase Domain Containing 3-associated disease" or "PNPLA3-associated disease," is a disease or disorder that is caused by, or associated with PNPLA3 gene expression or PNPLA3 protein production. The term "PNPLA3-associated disease" includes a disease, disorder or condition that would benefit from a decrease in PNPLA3 gene expression, replication, or protein activity. Non-limiting examples of PNPLA3-associated diseases include, for example, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD). In another embodiment, the PNPLA3-associated disease is nonalcoholic fatty liver disease (NAFLD). In another embodiment, the PNPLA3-associated disease is nonalcoholic steatohepatitis (NASH). In another embodiment, the PNPLA3-associated disease is liver cirrhosis. In another embodiment, the PNPLA3-associated disease is insulin resistance. In another embodiment, the PNPLA3-associated disease is not insulin resistance. In one embodiment, the PNPLA3-associated disease is obesity.

[0093] In one embodiment, an PNPLA3-associated disease is nonalcoholic fatty liver disease (NAFLD). As used herein, "nonalcoholic fatty liver disease," used interchangeably with the term "NAFLD," refers to a disease defined by the presence of macrovascular steatosis in the presence of less than 20 gm of alcohol ingestion per day. NAFLD is the most common liver disease in the United States, and is commonly associated with insulin resistance/type 2 diabetes mellitus and obesity. NAFLD is manifested by steatosis, steatohepatitis, cirrhosis, and sometimes hepatocellaular carcinoma. For a review of NAFLD, see Tolman and Dalpiaz (2007) Ther. Clin. Risk. Manag., 3(6):1153-1163 the entire contents of which are incorporated herein by reference.

[0094] The term "sample," as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes), the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system or parts of the central nervous system (e.g., ventricles or choroid plexus), or the pancreas or certain cells or parts of the pancreas. In some embodiments, a "sample derived from a subject" refers tocerebrospinal fluid obtained from the subject. In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In further embodiments, a "sample derived from a subject" refers to liver tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.

II. POLYNUCLEOTIDE AGENTS OF THE INVENTION

[0095] The present invention provides polynucleotide agents, e.g., antisense polynucleotide agents, and compositions comprising such agents, which target a PNPLA3 gene and inhibit the expression of the PNPLA3 gene. In one embodiment, the antisense polynucleotide agents inhibit the expression of a PNPLA3 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a PNPLA3-associated disease, e.g., nonalcoholic fatty liver disease (NAFLD).

[0096] The antisense polynucleotide agents of the invention include a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a PNPLA3 gene. The region of complementarity may be about 50 nucleotides or less in length (e.g., about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or less in length). Upon contact with a cell expressing the PNPLA3 gene, the antisense polynucleotide agent inhibits the expression of the PNPLA3 gene (e.g., a human, a primate, a non-primate, or a bird PNPLA3 gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western Blotting or flow cytometric techniques.

[0097] The region of complementarity between an antisense polynucleotide agent and a target sequence may be substantially complementary (e.g., there is a sufficient degree of complementarity between the antisense polynucleotide agent and a target nucleic acid to so that they specifically hybridize and induce a desired effect), but is generally fully complementary to the target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a PNPLA3 gene.

[0098] Accordingly, in one aspect, an antisense polynucleotide agent of the invention specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding PNPLA3, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11, or a fragment of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11.

[0099] In some embodiments, the antisense polynucleotide agents of the invention may be substantially complementary to the target sequence. For example, an antisense polynucleotide agent that is substantially complementary to the target sequence may include a contiguous nucleotide sequence comprising no more than 5 mismatches (e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches) when hybridizing to a target sequence, such as to the corresponding region of a nucleic acid which encodes a mammalian PNPLA3 mRNA. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, such as the corresponding region of a nucleic acid which encodes a mammalian PNPLA3.

[0100] In some embodiments, the antisense polynucleotide agents of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11, or a fragment of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0101] In some embodiments, an antisense polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, and 11 (or a fragment of any one of SEQ ID NOs:1-4).

[0102] An antisense polynucleotide agent may comprise a contiguous nucleotide sequence of about 4 to about 50 nucleotides in length, e.g., 8-49, 8-48, 8-47, 8-46, 8-45, 8-44, 8-43, 8-42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10-37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-49, 11-48, 11-47, 11-46, 11-45, 11-44, 11-43, 11-42, 11-41, 11-40, 11-39, 11-38, 11-37, 11-36, 11-35, 11-34, 11-33, 11-32, 11-31, 11-30, 11-29, 11-28, 11-27, 11-26, 11-25, 11-24, 11-23, 11-22, 11-21, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12-49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42, 12-41, 12-40, 12-39, 12-38, 12-37, 12-36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-27, 12-26, 12-25, 12-24, 12-23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-49, 13-48, 13-47, 13-46, 13-45, 13-44, 13-43, 13-42, 13-41, 13-40, 13-39, 13-38, 13-37, 13-36, 13-35, 13-34, 13-33, 13-32, 13-31, 13-30, 13-29, 13-28, 13-27, 13-26, 13-25, 13-24, 13-23, 13-22, 13-21, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-49, 14-48, 14-47, 14-46, 14-45, 14-44, 14-43, 14-42, 14-41, 14-40, 14-39, 14-38, 14-37, 14-36, 14-35, 14-34, 14-33, 14-32, 14-31, 14-30, 14-29, 14-28, 14-27, 14-26, 14-25, 14-24, 14-23, 14-22, 14-21, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15-38, 15-37, 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 15-16, 16-49, 16-48, 16-47, 16-46, 16-45, 16-44, 16-43, 16-42, 16-41, 16-40, 16-39, 16-38, 16-37, 16-36, 16-35, 16-34, 16-33, 16-32, 16-31, 16-30, 16-29, 16-28, 16-27, 16-26, 16-25, 16-24, 16-23, 16-22, 16-21, 16-20, 16-19, 16-18, 16-17, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-32, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-23, 17-22, 17-21, 17-20, 17-19, 17-18, 18-49, 18-48, 18-47, 18-46, 18-45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32, 18-31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-49, 19-48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37, 19-36, 19-35, 19-34, 19-33, 19-32, 19-31, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44, 20-43, 20-42, 20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-49, 21-48, 21-47, 21-46, 21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-33, 21-32, 21-31, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-49, 22-48, 22-47, 22-46, 22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22-35, 22-34, 22-33, 22-32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23-49, 23-48, 23-47, 23-46, 23-45, 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23-36, 23-35, 23-34, 23-33, 23-32, 23-31, 23-30, 23-29, 23-28, 23-27, 23-26, 23-25, 23-24, 24-49, 24-48, 24-47, 24-46, 24-45, 24-44, 24-43, 24-42, 24-41, 24-40, 24-39, 24-38, 24-37, 24-36, 24-35, 24-34, 24-33, 24-32, 24-31, 24-30, 24-29, 24-28, 24-27, 24-26, 24-25, 25-49, 25-48, 25-47, 25-46, 25-45, 25-44, 25-43, 25-42, 25-41, 25-40, 25-39, 25-38, 25-37, 25-36, 25-35, 25-34, 25-33, 25-32, 25-31, 25-30, 25-29, 25-28, 25-27, 25-26, 26-49, 26-48, 26-47, 26-46, 26-45, 26-44, 26-43, 26-42, 26-41, 26-40, 26-39, 26-38, 26-37, 26-36, 26-35, 26-34, 26-33, 26-32, 26-31, 26-30, 26-29, 26-28, 26-27, 27-49, 27-48, 27-47, 27-46, 27-45, 27-44, 27-43, 27-42, 27-41, 27-40, 27-39, 27-38, 27-37, 27-36, 27-35, 27-34, 27-33, 27-32, 27-31, 27-30, 27-29, 27-28, 28-49, 28-48, 28-47, 28-46, 28-45, 28-44, 28-43, 28-42, 28-41, 28-40, 28-39, 28-38, 28-37, 28-36, 28-35, 28-34, 28-33, 28-32, 28-31, 28-30, 28-29, 29-49, 29-48, 29-47, 29-46, 29-45, 29-44, 29-43, 29-42, 29-41, 29-40, 29-39, 29-38, 29-37, 29-36, 29-35, 29-34, 29-33, 29-32, 29-31, 29-30, 30-49, 30-48, 30-47, 30-46, 30-45, 30-44, 30-43, 30-42, 30-41, 30-40, 30-39, 30-38, 30-37, 30-36, 30-35, 30-34, 30-33, 30-32, or 30-31 nucleotides in length, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0103] In some embodiments, an antisense polynucleotide agent may comprise a contiguous nucleotide sequence of no more than 22 nucleotides, such as no more than 21 nucleotides, 20 nucleotides, 19 nucleotides, or no more than 18 nucleotides. In some embodiments the antisense polynucleotide agents of the invention comprises less than 20 nucleotides. In other embodiments, the antisense polynucleotide agents of the invention comprise 20 nucleotides.

[0104] In certain aspects, an antisense polynucleotide agent of the invention includes a sequence selected from the group of sequences provided in Tables 3 and 4. It will be understood that, although some of the sequences in Table 4 are described as modified and/or conjugated sequences, an antisense polynucleotide agent of the invention, may also comprise any one of the sequences set forth in Table 4 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.

[0105] By virtue of the nature of the nucleotide sequences provided in Tables 3 and 4, antisense polynucleotide agents of the invention may include one of the sequences of Tables 3 and 4 minus only a few nucleotides on one or both ends and yet remain similarly effective as compared to the antisense polynucleotide agents described above. Hence, antisense polynucleotide agents having a sequence of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences of Tables 3 and 4 and differing in their ability to inhibit the expression of a PNPLA3 gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from an antisense polynucleotide agent comprising the full sequence, are contemplated to be within the scope of the present invention.

[0106] In addition, the antisense polynucleotide agents provided in Tables 3 and 4 identify a region(s) in a PNPLA3 transcript that is susceptible to antisense inhibition (e.g., the regions in SEQ ID NO:1 which the antisense polynucleotide agents may target). As such, the present invention further features antisense polynucleotide agents that target within one of these sites.

[0107] As used herein, an antisense polynucleotide agent is said to target within a particular site of an RNA transcript if the antisense polynucleotide agent promotes antisense inhibition of the target at that site. Such an antisense polynucleotide agent will generally include at least about 15 contiguous nucleotides from one of the sequences provided in Tables 3 and 4 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a PNPLA3 gene.

[0108] While a target sequence is generally about 4-50 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing antisense inhibition of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a "window" or "mask" of a given size (as a non-limiting example, 20 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence "window" progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an antisense polynucleotide agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified, for example, in Tables 3 and 4, represent effective target sequences, it is contemplated that further optimization of antisense inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.

[0109] Further, it is contemplated that for any sequence identified, e.g., in Tables 3 and 4, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of antisense polynucleotide agents based on those target sequences in an inhibition assay as known in the art and/or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in length, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.

III. MODIFIED ANTISENSE POLYNUCLEOTIDE AGENTS OF THE INVENTION

[0110] In one embodiment, the nucleotides of an antisense polynucleotide agent of the invention are un-modified, and do not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, at least one of the nucleotides of an antisense polynucleotide agent of the invention is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleotides of an antisense polynucleotide agent of the invention are modified. In other embodiments of the invention, all of the nucleotides of an antisense polynucleotide agent of the invention are modified. Antisense polynucleotide agents of the invention in which "substantially all of the nucleotides are modified" are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0111] The nucleic acids featured in the invention can be synthesized and/or modified by standard methods known in the art as further discussed below, e.g., solution-phase or solid-phase organic synthesis or both, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems.RTM., Inc. Well-established methods for the synthesis and/or modification of the nucleic acids featured in the invention are described in, for example, "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e. g., at the 2'-position or 4'-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages.

[0112] Specific examples of modified nucleotides useful in the embodiments described herein include, but are not limited to nucleotides containing modified backbones or no natural internucleoside linkages. Nucleotides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified antisense polynucleotide agent will have a phosphorus atom in its internucleoside backbone.

[0113] Modified nucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0114] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. No. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0115] Modified nucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0116] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0117] In other embodiments, suitable nucleotide mimetics are contemplated for use in antisense polynucleotide agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the antisense polynucleotide agents of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0118] Some embodiments featured in the invention include polynucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2--[known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the antisense polynucleotide agents featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0119] Modified nucleotides can also contain one or more modified or substituted sugar moieties. The antisense polynucleotide agents featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10.

[0120] In other embodiments, antisense polynucleotide agents include one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an antisense polynucleotide, or a group for improving the pharmacodynamic properties of an antisense polynucleotide agent, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2.

[0121] Other modifications include 2'-methoxy (2'-O--CH.sub.3) also referred to as 2'-OMe, 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on a nucleotide of an antisense polynucleotide agent, particularly the 3' position of the sugar on the 3' terminal nucleotide. Antisense polynucleotide agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0122] Additional nucleotides having modified or substituted sugar moieties for use in the polynucleotide agents of the invention include nucleotides comprising a bicyclic sugar. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments an antisense polynucleotide agent may include one or more locked nucleic acids. A "locked nucleic acid" ("LNA") is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH.sub.2--O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to santisense polynucleotide agents has been shown to increase santisense polynucleotide agent stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0123] Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4'-CH2-O--N(CH.sub.3)-2' (see, e.g., U U.S. Patent Publication No. 2004/0171570); 4'-CH2-N(R)--O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(.dbd.CH2)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0124] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0125] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example .alpha.-L-ribofuranose and .beta.-D-ribofuranose (see WO 99/14226).

[0126] In one particular embodiment of the invention, an antisense polynucleotide agent can include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH.sub.3)--O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in an S conformation and is referred to as an "S-constrained ethyl nucleotide" or "S-cEt."

[0127] Modified nucleotides included in the antisense polynucleotide agents of the invention can also contain one or more sugar mimetics. For example, the antisense polynucleotide agent may include a "modified tetrahydropyran nucleotide" or "modified THP nucleotide." A "modified tetrahydropyran nucleotide" has a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleotides (a sugar surrogate). Modified THP nucleotides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see, e.g., Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), or fluoro HNA (F-HNA).

[0128] In some embodiments of the invention, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleotides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). Morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0129] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4'-CH2-0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0130] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety).

[0131] An antisense polynucleotide agent can also include nucleobase modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxy-thymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in "Modified Nucleosides in Biochemistry," Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, antisense polynucleotide agent Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the agents featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., antisense polynucleotide agent Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0132] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0133] One or more of the nucleotides of an antisense polynucleotide agent of the invention may also include a hydroxymethyl substituted nucleotide. A "hydroxymethyl substituted nucleotide" is an acyclic 2'-3'-seco-nucleotide, also referred to as an "unlocked nucleic acid" ("UNA") modification. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0134] Additional modifications which may potentially stabilize the ends of antisense polynucleotide agents can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3'-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in US Patent Publication No. 2012/0142101.

[0135] Any of the antisense polynucleotide agents of the invention may be optionally conjugated with a GalNAc derivative ligand, as described in Section IV, below.

[0136] As described in more detail below, an agent that contains conjugations of one or more carbohydrate moieties to an antisense polynucleotide agent can optimize one or more properties of the agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the antisense polynucleotide agent. For example, the ribose sugar of one or more ribonucleotide subunits of an agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0137] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one "backbone attachment point," preferably two "backbone attachment points" and (ii) at least one "tethering attachment point." A "backbone attachment point" as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A "tethering attachment point" (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

[0138] The antisense polynucleotide agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.

[0139] In certain specific embodiments, the antisense polynucleotide agent for use in the methods of the invention is an agent selected from the group of agents listed in Tables 3 and 4. These agents may further comprise a ligand, as described in Section IV, below.

[0140] A. Antisense Polynucleotide Agents Comprising Motifs

[0141] In certain embodiments of the invention, at least one of the contiguous nucleotides of the antisense polynucleotide agents of the invention may be a modified nucleotide. In one embodiment, the modified nucleotide comprises one or more modified sugars. In other embodiments, the modified nucleotide comprises one or more modified nucleobases. In yet other embodiments, the modified nucleotide comprises one or more modified internucleoside linkages. In some embodiments, the modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In one embodiment, the patterns of modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another.

[0142] Antisense polynucleotide agents having modified oligonucleotides arranged in patterns, or motifs may, for example, confer to the agents properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. For example, such agents may contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of such agents may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0143] An exemplary antisense polynucleotide agent having modified oligonucleotides arranged in patterns, or motifs is a gapmer. In a "gapmer", an internal region or "gap" having a plurality of linked nucleotides that supports RNaseH cleavage is positioned between two external flanking regions or "wings" having a plurality of linked nucleotides that are chemically distinct from the linked nucleotides of the internal region. The gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleotides.

[0144] The three regions of a gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleotides and may be described as "X-Y-Z", wherein "X" represents the length of the 5-wing, "Y" represents the length of the gap, and "Z" represents the length of the 3'-wing. In one embodiment, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different.

[0145] In certain embodiments, the regions of a gapmer are differentiated by the types of modified nucleotides in the region. The types of modified nucleotides that may be used to differentiate the regions of a gapmer, in some embodiments, include .beta.-D-ribonucleotides, .beta.-D-deoxyribonucleotides, 2'-modified nucleotides, e.g., 2'-modified nucleotides (e.g., 2'-MOE, and 2'-O--CH3), and bicyclic sugar modified nucleotides (e.g., those having a 4'-(CH2)n-O-2' bridge, where n=1 or n=2).

[0146] In one embodiment, at least some of the modified nucleotides of each of the wings may differ from at least some of the modified nucleotides of the gap. For example, at least some of the modified nucleotides of each wing that are closest to the gap (the 3'-most nucleotide of the 5'-wing and the 5'-most nucleotide of the 3-wing) differ from the modified nucleotides of the neighboring gap nucleotides, thus defining the boundary between the wings and the gap. In certain embodiments, the modified nucleotides within the gap are the same as one another. In certain embodiments, the gap includes one or more modified nucleotides that differ from the modified nucleotides of one or more other nucleotides of the gap.

[0147] The length of the 5'-wing (X) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2 to 5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.

[0148] The length of the 3'-wing (Z) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2-5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.

[0149] The length of the gap (Y) of a gapmer may be 5 to 14 nucleotides in length, e.g., 5 to 13, 5 to 12, 5 to 11, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 14, 6 to 13, 6 to 12, 6 to 11, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 14, 7 to 13, 7 to 12, 7 to 11, 7 to 10, 7 to 9, 7 to 8, 8 to 14, 8 to 13, 8 to 12, 8 to 11, 8 to 10, 8 to 9, 9 to 14, 9 to 13, 9 to 12, 9 to 11, 9 to 10, 10 to 14, 10 to 13, 10 to 12, 10 to 11, 11 to 14, 11 to 13, 11 to 12, 12 to 14, 12 to 13, or 13 to 14 nucleotides in length, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length.

[0150] In some embodiments of the invention X consists of 2, 3, 4, 5 or 6 nucleotides, Y consists of 7, 8, 9, 10, 11, or 12 nucleotides, and Z consists of 2, 3, 4, 5 or 6 nucleotides. Such gapmers include (X-Y-Z) 2-7-2, 2-7-3, 2-7-4, 2-7-5, 2-7-6, 3-7-2, 3-7-3, 3-7-4, 3-7-5, 3-7-6, 4-7-3, 4-7-4, 4-7-5, 4-7-6, 5-7-3, 5-7-4, 5-7-5, 5-7-6, 6-7-3, 6-7-4, 6-7-5, 6-7-6, 3-7-3, 3-7-4, 3-7-5, 3-7-6, 4-7-3, 4-7-4, 4-7-5, 4-7-6, 5-7-3, 5-7-4, 5-7-5, 5-7-6, 6-7-3, 6-7-4, 6-7-5, 6-7-6, 2-8-2, 2-8-3, 2-8-4, 2-8-5, 2-8-6, 3-8-2, 3-8-3, 3-8-4, 3-8-5, 3-8-6, 4-8-3, 4-8-4, 4-8-5, 4-8-6, 5-8-3, 5-8-4, 5-8-5, 5-8-6, 6-8-3, 6-8-4, 6-8-5, 6-8-6, 2-9-2, 2-9-3, 2-9-4, 2-9-5, 2-9-6, 3-9-2, 3-9-3, 3-9-4, 3-9-5, 3-9-6, 4-9-3, 4-9-4, 4-9-5, 4-9-6, 5-9-3, 5-9-4, 5-9-5, 5-9-6, 6-9-3, 6-9-4, 6-9-5, 6-9-6, 2-10-2, 2-10-3, 2-10-4, 2-10-5, 2-10-6, 3-10-2, 3-10-3, 3-10-4, 3-10-5, 3-10-6, 4-10-3, 4-10-4, 4-10-5, 4-10-6, 5-10-3, 5-10-4, 5-10-5, 5-10-6, 6-10-3, 6-10-4, 6-10-5, 6-10-6, 2-11-2, 2-11-3, 2-11-4, 2-11-5, 2-11-6, 3-11-2, 3-11-3, 3-11-4, 3-11-5, 3-11-6, 4-11-3, 4-11-4, 4-11-5, 4-11-6, 5-11-3, 5-11-4, 5-11-5, 5-11-6, 6-11-3, 6-11-4, 6-11-5, 6-11-6, 2- 12-2, 2-12-3, 2-12-4, 2-12-5, 2-12-6, 3-12-2, 3-12-3, 3-12-4, 3-12-5, 3-12-6, 4-12-3, 4-12-4, 4-12-5, 4-12-6, 5-12-3, 5-12-4, 5-12-5, 5-12-6, 6-12-3, 6-12-4, 6-12-5, or 6-12-6.

[0151] In some embodiments of the invention, antisense polynucleotide agents targeting PNPLA3 include a 5-10-5 gapmer motif. In other embodiments of the invention, antisense polynucleotide agents targeting PNPLA3 include a 4-10-4 gapmer motif. In another embodiment of the invention, antisense polynucleotide agents targeting PNPLA3 include a 3-10-3 gapmer motif. In yet other embodiments of the invention, antisense polynucleotide agents targeting PNPLA3 include a 2-10-2 gapmer motif.

[0152] The 5'-wing and/or 3'-wing of a gapmer may independently include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.

[0153] In some embodiment, the 5'-wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 5'-wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 5'-wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 5'-wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 5'-wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 5'-wing of a gapmer is a modified nucleotide.

[0154] In some embodiments, the 3'-wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 3'-wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 3'-wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 3'-wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 3'-wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a modified nucleotide.

[0155] In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties of the nucleotides. In one embodiment, the nucleotides of each distinct region comprise uniform sugar moieties. In other embodiments, the nucleotides of each distinct region comprise different sugar moieties. In certain embodiments, the sugar nucleotide modification motifs of the two wings are the same as one another. In certain embodiments, the sugar nucleotide modification motifs of the 5'-wing differs from the sugar nucleotide modification motif of the 3'-wing.

[0156] The 5'-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.

[0157] In one embodiment, at least one modified nucleotide of the 5'-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA. In another embodiment, the 5'-wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides. In some embodiments, each nucleotide of the 5'-wing of a gapmer is a bicyclic nucleotide.

[0158] In one embodiment, the 5'-wing of a gapmer includes at least 1, 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 5'-wing of a gapmer is a constrained ethyl nucleotide.

[0159] In one embodiment, the 5'-wing of a gapmer comprises at least one LNA nucleotide. In another embodiment, the 5'-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides. In other embodiments, each nucleotide of the 5'-wing of a gapmer is an LNA nucleotide. In certain embodiments, at least one modified nucleotide of the 5'-wing of a gapmer is a non-bicyclic modified nucleotide, e.g., a 2'-substituted nucleotide. A "2'-substituted nucleotide" is a nucleotide comprising a modification at the 2'-position which is other than H or OH, such as a 2'-OMe nucleotide, or a 2'-MOE nucleotide. In one embodiment, the 5'-wing of a gapmer comprises 2, 3, 4, or 5 2'-substituted nucleotides. In one embodiment, each nucleotide of the 5'-wing of a gapmer is a 2'-substituted nucleotide.

[0160] In one embodiment, the 5'-wing of a gapmer comprises at least one 2'-OMe nucleotide. In one embodiment, the 5'-wing of a gapmer comprises at least 2, 3, 4, or 5 2'-OMe nucleotides. In one embodiment, each of the nucleotides of the 5'-wing of a gapmer comprises a 2'-OMe nucleotide.

[0161] In one embodiment, the 5'-wing of a gapmer comprises at least one 2'-MOE nucleotide. In one embodiment, the 5'-wing of a gapmer comprises at least 2, 3, 4, or 5 2'-MOE nucleotides. In one embodiment, each of the nucleotides of the 5'-wing of a gapmer comprises a 2'-MOE nucleotide.

[0162] In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-deoxynucleotide. In certain embodiments, each nucleotide of the 5'-wing of a gapmer is a 2'-deoxynucleotide. In a certain embodiments, the 5'-wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 5'-wing of a gapmer is a ribonucleotide.

[0163] The 3'-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.

[0164] In one embodiment, at least one modified nucleotide of the 3'-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA. In another embodiment, the 3'-wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides. In some embodiments, each nucleotide of the 3'-wing of a gapmer is a bicyclic nucleotide.

[0165] In one embodiment, the 3'-wing of a gapmer includes at least one constrained ethyl nucleotide. In another embodiment, the 3'-wing of a gapmer includes 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 3'-wing of a gapmer is a constrained ethyl nucleotide.

[0166] In one embodiment, the 3'-wing of a gapmer comprises at least one LNA nucleotide. In another embodiment, the 3'-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides. In other embodiments, each nucleotide of the 3'-wing of a gapmer is an LNA nucleotide.

[0167] In certain embodiments, at least one modified nucleotide of the 3'-wing of a gapmer is a non-bicyclic modified nucleotide, e.g., a 2'-substituted nucleotide. In one embodiment, the 3'-wing of a gapmer comprises 2, 3, 4, or 5 2'-substituted nucleotides. In one embodiment, each nucleotide of the 3'-wing of a gapmer is a 2'-substituted nucleotide.

[0168] In one embodiment, the 3'-wing of a gapmer comprises at least one 2'-OMe nucleotide. In one embodiment, the 3'-wing of a gapmer comprises at least 2, 3, 4, or 5 2'-OMe nucleotides. In one embodiment, each of the nucleotides of the 3'-wing of a gapmer comprises a 2'-OMe nucleotide.

[0169] In one embodiment, the 3'-wing of a gapmer comprises at least one 2'-MOE nucleotide. In one embodiment, the 3'-wing of a gapmer comprises at least 2, 3, 4, or 5 2'-MOE nucleotides. In one embodiment, each of the nucleotides of the 3'-wing of a gapmer comprises a 2'-MOE nucleotide.

[0170] In certain embodiments, the 3'-wing of a gapmer comprises at least one 2'-deoxynucleotide. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a 2'-deoxynucleotide. In a certain embodiments, the 3'-wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a ribonucleotide.

[0171] The gap of a gapmer may include 5-14 modified nucleotides, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 modified nucleotides.

[0172] In one embodiment, the gap of a gapmer comprises at least one 5-methylcytosine. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 5-methylcytosines. In one embodiment, all of the nucleotides of the the gap of a gapmer are 5-methylcytosines.

[0173] In one embodiment, the gap of a gapmer comprises at least one 2'-deoxynucleotide. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 2'-deoxynucleotides. In one embodiment, all of the nucleotides of the the gap of a gapmer are 2'-deoxynucleotides.

[0174] A gapmer may include one or more modified internucleotide linkages. In some embodiments, a gapmer includes one or more phosphodiester internucleotide linkages. In other embodiments, a gapmer includes one or more phosphorothioate internucleotide linkages.

[0175] In one embodiment, each nucleotide of a 5'-wing of a gapmer are linked via a phosphorothioate internucleotide linkage. In another embodiment, each nucleotide of a 3'-wing of a gapmer are linked via a phosphorothioate internucleotide linkage. In yet another embodiment, each nucleotide of a gap segment of a gapmer is linked via a phosphorothioate internucleotide linkage. In one embodiment, all of the nucleotides in a gapmer are linked via phosphorothioate internucleotide linkages.

[0176] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising five nucleotides and a 3'-wing segment comprising 5 nucleotides.

[0177] In another embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising four nucleotides and a 3'-wing segment comprising four nucleotides.

[0178] In another embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising three nucleotides and a 3'-wing segment comprising three nucleotides.

[0179] In another embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising two nucleotides and a 3'-wing segment comprising two nucleotides.

[0180] In one embodiment, each nucleotide of a 5-wing flanking a gap segment of 10 2'-deoxyribonucleotides comprises a modified nucleotide. In another embodiment, each nucleotide of a 3-wing flanking a gap segment of 10 2'-deoxyribonucleotides comprises a modified nucleotide. In one embodiment, each of the modified 5'-wing nucleotides and each of the modified 3'-wing nucleotides comprise a 2'-sugar modification. In one embodiment, the 2'-sugar modification is a 2'-OMe modification. In another embodiment, the 2'-sugar modification is a 2'-MOE modification. In one embodiment, each of the modified 5'-wing nucleotides and each of the modified 3'-wing nucleotides comprise a bicyclic nucleotide. In one embodiment, the bicyclic nucleotide is a constrained ethyl nucleotide. In another embodiment, the bicyclic nucleotide is an LNA nucleotide. In one embodiment, each cytosine in an antisense polynucleotide agent targeting a PNPLA3 gene is a 5-methylcytosine.

[0181] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising five nucleotides comprising a 2'OMe modification and a 3'-wing segment comprising five nucleotides comprising a 2'OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine. In one embodiment, the agent further comprises a ligand.

[0182] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising five nucleotides comprising a 2'MOE modification and a 3'-wing segment comprising five nucleotides comprising a 2'MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine. In one embodiment, the agent further comprises a ligand.

[0183] In one embodiment, an antisense polynucleotide agent targeting PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising five constrained ethyl nucleotides and a 3'-wing segment comprising five constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0184] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising five LNA nucleotides and a 3'-wing segment comprising five LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0185] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising four nucleotides comprising a 2'OMe modification and a 3'-wing segment comprising four nucleotides comprising a 2'OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0186] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising four nucleotides comprising a 2'MOE modification and a 3'-wing segment comprising four nucleotides comprising a 2'MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0187] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising four constrained ethyl nucleotides and a 3'-wing segment comprising four constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0188] In one embodiment, an antisense polynucleotide agent targeting PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising four LNA nucleotides and a 3'-wing segment comprising four LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0189] In one embodiment, an antisense polynucleotide agent targeting PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising three nucleotides comprising a 2'OMe modification and a 3'-wing segment comprising three nucleotides comprising a 2'OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0190] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising three nucleotides comprising a 2'MOE modification and a 3'-wing segment comprising three nucleotides comprising a 2'MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0191] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising three constrained ethyl nucleotides and a 3'-wing segment comprising three constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0192] In one embodiment, an antisense polynucleotide agent targeting PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising three LNA nucleotides and a 3'-wing segment comprising three LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0193] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising two nucleotides comprising a 2'OMe modification and a 3'-wing segment comprising two nucleotides comprising a 2'OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0194] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising two nucleotides comprising a 2'MOE modification and a 3'-wing segment comprising two nucleotides comprising a 2'MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0195] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising two constrained ethyl nucleotides and a 3'-wing segment comprising two constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0196] In one embodiment, an antisense polynucleotide agent targeting a PNPLA3 gene comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5'-wing segment comprising two LNA nucleotides and a 3'-wing segment comprising two LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.

[0197] Further gapmer designs suitable for use in the agents, compositions, and methods of the invention are disclosed in, for example, U.S. Pat. Nos. 7,687,617 and 8,580,756; U.S. Patent Publication Nos. 20060128646, 20090209748, 20140128586, 20140128591, 20100210712, and 20080015162A1; and International Publication No. WO 2013/159108, the entire content of each of which are incorporated herein by reference.

IV. ANTISENSE POLYNUCLEOTIDE AGENTS CONJUGATED TO LIGANDS

[0198] Another modification of the polynucleotide agents of the invention involves chemically linking to the agent one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the antisense polynucleotide agent. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0199] In one embodiment, a ligand alters the distribution, targeting or lifetime of an antisense polynucleotide agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in hybridization of an antisense polynucleotide agent to the targeted mRNA.

[0200] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0201] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucoseamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0202] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0203] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-.kappa.B.

[0204] The ligand can be a substance, e.g., a drug, which can increase the uptake of the antisense polynucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0205] In some embodiments, a ligand attached to an antisense polynucleotide agent as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0206] Ligand-conjugated polynucleotides of the invention may be synthesized by the use of a polynucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive polynucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

[0207] The polynucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems.RTM. (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other polynucleotides, such as the phosphorothioates and alkylated derivatives.

[0208] In the ligand-conjugated polynucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the polynucleotides and polynucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0209] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the polynucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0210] A. Lipid Conjugates

[0211] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[0212] A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0213] In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

[0214] In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.

[0215] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).

[0216] B. Cell Permeation Agents

[0217] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

[0218] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to antisense polynucleotide agents can affect pharmacokinetic distribution of the agent, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0219] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 13). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 14) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 15) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 16) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an antisense polynucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

[0220] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0221] A "cell permeation peptide" is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an .alpha.-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0222] C. Carbohydrate Conjugates

[0223] In some embodiments of the compositions and methods of the invention, an antisense polynucleotide agent further comprises a carbohydrate. The carbohydrate conjugated agents are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein (see, e.g., Prakash, et al. (2014) Nuc Acid Res doi 10.1093/nar/gku531). As used herein, "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0224] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine (GalNAc) or a GalNAc derivative.

[0225] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

##STR00002## ##STR00003## ##STR00004## ##STR00005##

[0226] In one embodiment, the GalNAc or a GalNAc derivative is

##STR00006##

[0227] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

##STR00007##

when one of X or Y is an oligonucleotide, the other is a hydrogen.

##STR00008##

when one of X or Y is an oligonucleotide, the other is a hydrogen; or both X and Y are oligonucleotides

##STR00009##

wherein Y is O or S and n is 1-6.

##STR00010##

wherein Y.dbd.O or S. n is 1-6, R is hydrogen or nucleic acid, R' is nucleic acid.

##STR00011##

wherein Y is O or S and n is 1-6.

##STR00012##

when one of X or Y is an oligonucleotide, the other is a hydrogen; or both X and Y are oligonucleotides

##STR00013##

wherein X is O or S.

[0228] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an polynucleotide agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

[0229] In one embodiment, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the polynucleotide agent. In another embodiment, the polynucleotide agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the polynucleotide agent through a plurality of monovalent linkers.

[0230] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.

[0231] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

[0232] D. Linkers

[0233] In some embodiments, the conjugate or ligand described herein can be attached to an antisense polynucleotide agent with various linkers that can be cleavable or non-cleavable.

[0234] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

[0235] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0236] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0237] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0238] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[0239] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0240] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0241] i. Redox Cleavable Linking Groups

[0242] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (--S--S--). To determine if a candidate cleavable linking group is a suitable "reductively cleavable linking group," or for example is suitable for use with a particular antisense polynucleotide agent moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

[0243] ii. Phosphate-Based Cleavable Linking Groups

[0244] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are --O-P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O--P(S)(SRk)-O--, --S--P(O)(ORk)-O--, --O--P(O)(ORk)-S--, --S-P(O)(ORk)-S--, --O--P(S)(ORk)-S--, --S--P(S)(ORk)-O--, --O-P(O)(Rk)-O--, --O--P(S)(Rk)-O--, --S--P(O)(Rk)-O--, --S--P(S)(Rk)-O--, --S--P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Preferred embodiments are --O--P(O)(OH)--O--, --O--P(S)(OH)--O--, --O--P(S)(SH)--O--, --S--P(O)(OH)--O--, --O--P(O)(OH)--S--, --S--P(O)(OH)--S--, --O--P(S)(OH)--S--, --S--P(S)(OH)--O--, --O--P(O)(H)--O--, --O--P(S)(H)--O--, --S--P(O)(H)--O, --S--P(S)(H)--O--, --S--P(O)(H)--S--, --O--P(S)(H)--S--. A preferred embodiment is --O--P(O)(OH)--O--. These candidates can be evaluated using methods analogous to those described above.

[0245] iii. Acid Cleavable Linking Groups

[0246] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula --C.dbd.NN--, C(O)O, or --OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[0247] iv. Ester-Based Linking Groups

[0248] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula --C(O)O--, or --OC(O)--. These candidates can be evaluated using methods analogous to those described above.

[0249] v. Peptide-Based Cleaving Groups

[0250] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (--C(O)NH--). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula --NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

[0251] In one embodiment, an antisense polynucleotide agent of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of antisense polynucleotide agent carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

##STR00014## ##STR00015##

[0252] when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0253] In certain embodiments of the compositions and methods of the invention, a ligand is one or more "GalNAc" (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

[0254] In one embodiment, a antisense polynucleotide agent of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXII)-(XXXV):

##STR00016##

wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O; Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R').dbd.C(R''), CC or C(O); R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), --C(O)--CH(R.sup.a)--NH--, CO, CH.dbd.N--O

##STR00017##

or heterocyclyl;

[0255] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with antisense polynucleotide agents for inhibiting the expression of a target gene, such as those of formula (XXXVI):

##STR00018##

[0256] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative.

[0257] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

[0258] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

[0259] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an antisense polynucleotide agent. The present invention also includes antisense polynucleotide agents that are chimeric compounds.

[0260] "Chimeric" antisense polynucleotide agents or "chimeras," in the context of this invention, are antisense polynucleotide agent compounds, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an antisense polynucleotide agent. These antisense polynucleotide agents typically contain at least one region wherein the RNA is modified so as to confer upon the antisense polynucleotide agent increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the antisense polynucleotide agent can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense polynucleotide agent inhibition of gene expression. Consequently, comparable results can often be obtained with shorter antisense polynucleotide agents when chimeric antisense polynucleotide agents are used, compared to phosphorothioate deoxy antisense polynucleotide agents hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0261] In certain instances, the nucleotide of an antisense polynucleotide agent can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to antisense polynucleotide agents in order to enhance the activity, cellular distribution or cellular uptake of the antisense polynucleotide agent, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

V. DELIVERY OF AN ANTISENSE POLYNUCLEOTIDE AGENT OF THE INVENTION

[0262] The delivery of an antisense polynucleotide agent of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a PNPLA3-associated disease) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an antisense polynucleotide agent of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an antisense polynucleotide agent to a subject.

[0263] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an antisense polynucleotide agent of the invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an antisense polynucleotide agent include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an antisense polynucleotide agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the antisense polynucleotide agent to be administered. Several studies have shown successful knockdown of gene products when an antisense polynucleotide agent is administered locally. For example, intraocular delivery of a VEGF antisense polynucleotide agent by intravitreal injection in cynomolgus monkeys (Tolentino, M J., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a antisense polynucleotide agent in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J., et al (2006)Mol. Ther. 14:343-350; Li, S., et al (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an antisense polynucleotide agent systemically for the treatment of a disease, the agent can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the antisense polynucleotide agent by endo- and exo-nucleases in vivo. Modification of the agent or the pharmaceutical carrier can also permit targeting of the antisense polynucleotide agent composition to the target tissue and avoid undesirable off-target effects. Antisense polynucleotide agent can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the antisense polynucleotide agent can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an antisense polynucleotide agent molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an antisense polynucleotide agent by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an antisense polynucleotide agent, or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2):107-116) that encases an antisense polynucleotide agent. The formation of vesicles or micelles further prevents degradation of the antisense polynucleotide agent when administered systemically. Methods for making and administering cationic-antisense polynucleotide agent complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N, et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of antisense polynucleotide agents include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an antisense polynucleotide agent forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of antisense polynucleotide agents and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

VI. PHARMACEUTICAL COMPOSITIONS OF THE INVENTION

[0264] The present invention also includes pharmaceutical compositions and formulations which include the antisense polynucleotide agents of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an antisense polynucleotide agent, as described herein, and a pharmaceutically acceptable carrier.

[0265] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0266] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum components, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

[0267] The pharmaceutical compositions containing the antisense polynucleotide agents are useful for treating a disease or disorder associated with the expression or activity of a PNPLA3 gene, e.g. a PNPLA3-associated disease. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC) or intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery into the brain parenchyma, e.g., by infusion into the brain, such as by continuous pump infusion. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a PNPLA3 gene. In general, a suitable dose of an antisense polynucleotide agent of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. For example, the antisense polynucleotide agent can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.

[0268] For example, the antisense polynucleotide agent may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0269] In another embodiment, the antisense polynucleotide agent is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0270] For example, the antisense polynucleotide agent may be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0271] In another embodiment, the antisense polynucleotide agent is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kgb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, the antisense polynucleotide agent is administered at a dose of about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0272] For example, subjects can be administered, e.g., subcutaneously or intravenously, a single therapeutic amount of antisense polynucleotide agent, such as about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0273] In some embodiments, subjects are administered, e.g., subcutaneously or intravenously, multiple doses of a therapeutic amount of antisense polynucleotide agent, such as a dose about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. A multi-dose regimine may include administration of a therapeutic amount of antisense polynucleotide agent daily, such as for two days, three days, four days, five days, six days, seven days, or longer.

[0274] In other embodiments, subjects are administered, e.g., subcutaneously or intravenously, a repeat dose of a therapeutic amount of antisense polynucleotide agent, such as a dose about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. A repeat-dose regimine may include administration of a therapeutic amount of antisense polynucleotide agent on a regular basis, such as every other day, every third day, every fourth day, twice a week, once a week, every other week, or once a month.

[0275] The pharmaceutical composition can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24, or about a 25 minute period. The administration may be repeated, for example, on a regular basis, such as weekly, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months or a year or longer.

[0276] The pharmaceutical composition can be administered once daily, or the pharmaceutical composition can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the antisense polynucleotide agent contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the antisense polynucleotide agent over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0277] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bi-monthly.

[0278] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual antisense polynucleotide agents encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

[0279] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a disorder that would benefit from reduction in the expression of PNPLA3. Such models can be used for in vivo testing of an antisense polynucleotide agent, as well as for determining a therapeutically effective dose. Suitable dietary and genetic mouse models are reviewed in Kanuri and Bergheim (Int. J. Mol. Sci. (2013) 14:11963-11980). Nonalcoholic steatohepatitis (NASH) mouse models (ob/ob mice) that are fed a high fat diet can be used in the present invention. Mouse models with overexpression of mutant PNPLA3 may also be suitable to be used in the present invention.

[0280] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

[0281] The antisense polynucleotide agent can be delivered in a manner to target a particular tissue, such as the liver (e.g., the hepatocytes of the liver).

[0282] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the antisense polynucleotide agents featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Antisense polynucleotide agents featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, antisense polynucleotide agents can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof). Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

[0283] A. Antisense Polynucleotide Agent Formulations Comprising Membranous Molecular Assemblies

[0284] An antisense polynucleotide agent for use in the compositions and methods of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the antisense polynucleotide agent composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the antisense polynucleotide agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the antisense polynucleotide agent are delivered into the cell where the antisense polynucleotide agent can specifically bind to a target RNA and can mediate antisense inhibition. In some cases the liposomes are also specifically targeted, e.g., to direct the antisense polynucleotide agent to particular cell types.

[0285] A liposome containing an antisense polynucleotide agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The antisense polynucleotide agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the antisense polynucleotide agent and condense around the antisense polynucleotide agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of antisense polynucleotide agent.

[0286] If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also be adjusted to favor condensation.

[0287] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984). These methods are readily adapted to packaging antisense polynucleotide agent preparations into liposomes.

[0288] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0289] Liposomes which are pH-sensitive or negatively-charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0290] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0291] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.

[0292] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM. I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome.TM. II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6) 466).

[0293] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0294] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. USA., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside GM1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

[0295] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver antisense polynucleotide agents to macrophages.

[0296] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated antisense polynucleotide agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0297] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of Antisense polynucleotide agent (see, e.g., Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0298] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin.TM. Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

[0299] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (Transfectam.TM., Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).

[0300] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

[0301] Liposomal formulations are particularly suited for topical administration; liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer an antisense polynucleotide agent into the skin. In some implementations, liposomes are used for delivering antisense polynucleotide agents to epidermal cells and also to enhance the penetration of antisense polynucleotide agents into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

[0302] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with antisense polynucleotide agents are useful for treating a dermatological disorder.

[0303] Liposomes that include antisense polynucleotide agent can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include antisense polynucleotide agents can be delivered, for example, subcutaneously by infection in order to deliver antisense polynucleotide agents to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.

[0304] Other formulations amenable to the present invention are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present invention.

[0305] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0306] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in "Pharmaceutical Dosage Forms", Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0307] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0308] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0309] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0310] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0311] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in "Pharmaceutical Dosage Forms", Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0312] The antisense polynucleotide agent for use in the compositions and methods of the invention can also be provided as micellar formulations. "Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0313] A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the antisense polynucleotide agent composition, an alkali metal C.sub.8 to C.sub.22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.

[0314] In one method a first micellar composition is prepared which contains the antisense polynucleotide agent composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the antisense polynucleotide agent composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.

[0315] Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m-cresol may be added with the micelle forming ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.

[0316] For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.

[0317] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0318] The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.

[0319] B. Lipid Particles

[0320] Antisense polynucleotide agents of in the invention may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.

[0321] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle comprising a lipid layer encapsulating a pharmaceutically active molecule. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; 6,858,225; 8,158,601; and 8,058,069; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

[0322] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to antisense polynucleotide agent ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.

[0323] The cationic lipid can be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro- -3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0324] In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-santisense polynucleotide agent nanoparticles. Synthesis of 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. provisional patent application No. 61/107,998 filed on Oct. 23, 2008, which is herein incorporated by reference.

[0325] In one embodiment, the lipid-antisense polynucleotide agent particle includes 40% 2, 2-Dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0.+-.20 nm and a 0.027 antisense polynucleotide agent/Lipid Ratio.

[0326] The ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

[0327] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0328] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0329] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008, which is incorporated herein by reference), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-antisense polynucleotide agent nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous antisense polynucleotide agent (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-antisense polynucleotide agent nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.

##STR00019##

[0330] LNP01 formulations are described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.

[0331] Additional exemplary lipid-antisense polynucleotide agent formulations are described in Table 1.

TABLE-US-00001 TABLE 1 cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid Lipid:santisense polynucleotide agent ratio SNALP- 1,2-Dilinolenyloxy-N,N-dimethylaminopropane DLinDMA/DPPC/Cholesterol/PEG-cDMA 1 (DLinDMA) (57.1/7.1/34.4/1.4) lipid:santisense polynucleotide agent~7:1 2-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DPPC/Cholesterol/PEG-cDMA dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:santisense polynucleotide agent~7:1 LNP05 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:santisense polynucleotide agent~6:1 LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:santisense polynucleotide agent~11:1 LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:santisense polynucleotide agent~6:1 LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:santisense polynucleotide agent~11:1 LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 50/10/38.5/1.5 Lipid:santisense polynucleotide agent 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- ALN100/DSPC/Cholesterol/PEG-DMG octadeca-9,12-dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d][1,3]dioxol-5-amine (ALN100) Lipid:santisense polynucleotide agent 10:1 LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31- MC-3/DSPC/Cholesterol/PEG-DMG tetraen-19-yl 4-(dimethylamino)butanoate 50/10/38.5/1.5 (MC3) Lipid:santisense polynucleotide agent 10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)(2- 50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin-1- Lipid:santisense polynucleotide agent 10:1 yl)ethylazanediypdidodecan-2-ol (Tech G1) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:santisense polynucleotide agent: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:santisense polynucleotide agent: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:santisense polynucleotide agent: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000) SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference. XTC comprising formulations are described in PCT Publication No. WO 2010/088537, the entire contents of which are hereby incorporated herein by reference. MC3 comprising formulations are described, e.g., in U.S. Publication No. 2010/0324120, filed Jun. 10, 2010, the entire contents of which are hereby incorporated by reference. ALNY-100 comprising formulations are described in PCT Publication No. WO 2010/054406, the entire contents of which are hereby incorporated herein by reference. C12-200 comprising formulations are described in PCT Publication No. WO 2010/129709, the entire contents of which are hereby incorporated herein by reference.

[0332] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which the antisense polynucleotide agents featured in the invention are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Antisense polynucleotide agents featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Antisense polynucleotide agent complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for antisense polynucleotide agents and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

[0333] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0334] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver, e.g., when treating hepatic disorders, e.g., hepatic carcinoma.

[0335] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0336] The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

[0337] C. Additional Formulations

[0338] i. Emulsions

[0339] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

[0340] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0341] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0342] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

[0343] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0344] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0345] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0346] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0347] ii. Microemulsions

[0348] In one embodiment of the present invention, the compositions of antisense polynucleotide agents are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0349] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0350] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (P0500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

[0351] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or antisense polynucleotide agents. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of antisense polynucleotide agents from the gastrointestinal tract, as well as improve the local cellular uptake of antisense polynucleotide agents and nucleic acids.

[0352] Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the antisense polynucleotide agents of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0353] iii. Microparticles

[0354] An antisense polynucleotide agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

[0355] iv. Penetration Enhancers

[0356] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly antisense polynucleotide agents, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0357] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0358] Surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of antisense polynucleotide agents through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0359] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0360] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0361] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of antisense polynucleotide agents through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0362] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of antisense polynucleotide agents through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0363] Agents that enhance uptake of antisense polynucleotide agents at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of antisense polynucleotide agents. Examples of commercially available transfection reagents include, for example Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000.TM. (Invitrogen; Carlsbad, Calif.), 293fectin.TM. (Invitrogen; Carlsbad, Calif.), Cellfectin.TM. (Invitrogen; Carlsbad, Calif.), DMRIE-C.TM. (Invitrogen; Carlsbad, Calif.), FreeStyle.TM. MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine.TM. (Invitrogen; Carlsbad, Calif.), Optifect.TM. (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam.RTM. Reagent (Promega; Madison, Wis.), TransFast.TM. Transfection Reagent (Promega; Madison, Wis.), Tfx.TM.-20 Reagent (Promega; Madison, Wis.), Tfx.TM.-50 Reagent (Promega; Madison, Wis.), DreamFect.TM. (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassa D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec.TM./LipoGen.TM. (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER.TM. transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect.TM. (B-Bridge International, Mountain View, Calif., USA), among others.

[0364] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0365] v. Carriers

[0366] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioated antisense polynucleotide agent in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense polynucleotide agent Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense polynucleotide agent & Nucl. Acid Drug Dev., 1996, 6, 177-183.

[0367] vi. Excipients

[0368] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0369] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0370] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0371] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0372] vii. Other Components

[0373] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0374] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

[0375] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more antisense polynucleotide agents and (b) one or more agents which function by a non-antisense inhibition mechanism and which are useful in treating a hemolytic disorder. Examples of such agents include, but are not limited to an anti-inflammatory agent, anti-steatosis agent, anti-viral, and/or anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in conjunction with the antisense polynucleotide agents described herein. Other agents useful for treating liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., U.S. Application Publication No. 2004/0127488.

[0376] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit high therapeutic indices are preferred.

[0377] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0378] In addition to their administration, as discussed above, the antisense polynucleotide agents featured in the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by PNPLA3 expression. In any event, the administering physician can adjust the amount and timing of antisense polynucleotide agent administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

VII. METHODS FOR INHIBITING PNPLA3 EXPRESSION

[0379] The present invention provides methods of inhibiting expression of a PNPLA3 gene in a cell. The methods include contacting a cell with an antisense polynucleotide agent of the invention in an amount effective to inhibit expression of the PNPLA3 gene in the cell, thereby inhibiting expression of the PNPLA3 gene in the cell.

[0380] Contacting of a cell with an antisense polynucleotide agent may be done in vitro or in vivo. Contacting a cell in vivo with the antisense polynucleotide agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the antisense polynucleotide agent. Combinations of in vitro and in vivo methods of contacting are also possible. Contacting may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc.sub.3 ligand, or any other ligand that directs the antisense polynucleotide agent to a site of interest, e.g., the liver or pancreas of a subject.

[0381] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating" and other similar terms, and includes any level of inhibition.

[0382] "Inhibiting expression of a PNPLA3 gene" includes any level of inhibition of a PNPLA3 gene, e.g., at least partial suppression of the expression of a PNPLA3 gene. The expression of the PNPLA3 gene may be assessed based on the level, or the change in the level, of any variable associated with PNPLA3 gene expression, e.g., PNPLA3 mRNA level, PNPLA3 protein level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject.

[0383] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with PNPLA3 expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0384] In some embodiments of the methods of the invention, expression of a PNPLA3 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. Preferably expression is inhibited by at least about 20%.

[0385] Inhibition of the expression of a PNPLA3 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a PNPLA3 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an antisense polynucleotide agent of the invention, or by administering an antisense polynucleotide agent of the invention to a subject in which the cells are or were present) such that the expression of a PNPLA3 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

( mRNA .times. .times. in .times. .times. control .times. .times. cells ) - ( mRNA .times. .times. in .times. .times. treated .times. .times. cells ) ( mRNA .times. .times. in .times. .times. control .times. .times. cells ) 100 .times. % ##EQU00001##

[0386] Alternatively, inhibition of the expression of a PNPLA3 gene may be assessed in terms of a reduction of a parameter that is functionally linked to PNPLA3 gene expression, e.g., PNPLA3 protein expression or Hedgehog pathway protein activities. PNPLA3 gene silencing may be determined in any cell expressing PNPLA3, either constitutively or by genomic engineering, and by any assay known in the art.

[0387] Inhibition of the expression of a PNPLA3 protein may be manifested by a reduction in the level of the PNPLA3 protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

[0388] A control cell or group of cells that may be used to assess the inhibition of the expression of a PNPLA3 gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

[0389] The level of PNPLA3 mRNA that is expressed by a cell or group of cells, or the level of circulating PNPLA3 mRNA, may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of PNPLA3 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the PNPLA3 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analysis. Circulating PNPLA3 mRNA may be detected using methods the described in PCT/US2012/043584, the entire contents of which are hereby incorporated herein by reference.

[0390] In one embodiment, the level of expression of PNPLA3 is determined using a nucleic acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific PNPLA3. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0391] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to PNPLA3 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix.RTM. gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of PNPLA3 mRNA.

[0392] An alternative method for determining the level of expression of PNPLA3 in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of PNPLA3 is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan.TM. System).

[0393] The expression levels of PNPLA3 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of PNPLA3 expression level may also comprise using nucleic acid probes in solution.

[0394] In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR).

[0395] The level of PNPLA3 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.

[0396] The term "sample" as used herein refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to urine drawn from the subject. In further embodiments, a "sample derived from a subject" refers to liver tissue derived from the subject.

[0397] In some embodiments of the methods of the invention, the antisense polynucleotide agent is administered to a subject such that the antisense polynucleotide agent is delivered to a specific site within the subject. The inhibition of expression of PNPLA3 may be assessed using measurements of the level or change in the level of PNPLA3 mRNA or PNPLA3 protein in a sample derived from fluid or tissue from the specific site within the subject. In preferred embodiments, the site is the liver. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites. The site may also include cells that express a particular type of receptor.

[0398] The phrase "contacting a cell with an antisense polynucleotide agent," as used herein, includes contacting a cell by any possible means. Contacting a cell with an antisense polynucleotide agent includes contacting a cell in vitro with the antisense polynucleotide agent or contacting a cell in vivo with the antisense polynucleotide agent. The contacting may be done directly or indirectly. Thus, for example, the antisense polynucleotide agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the antisense polynucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0399] Contacting a cell in vitro may be done, for example, by incubating the cell with the antisense polynucleotide agent. Contacting a cell in vivo may be done, for example, by injecting the antisense polynucleotide agent into or near the tissue where the cell is located, or by injecting the antisense polynucleotide agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the antisense polynucleotide agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the antisense polynucleotide agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an antisense polynucleotide agent and subsequently transplanted into a subject.

[0400] In one embodiment, contacting a cell with an antisense polynucleotide agent includes "introducing" or "delivering the antisense polynucleotide agent into the cell" by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an antisense polynucleotide agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an antisense polynucleotide agent into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, antisense polynucleotide agent can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, the entire contents of which are hereby incorporated herein by reference. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.

VIII. METHODS FOR TREATING OR PREVENTING PNPLA3-ASSOCIATED DISORDERS

[0401] The present invention provides therapeutic and prophylactic methods which include administering to a subject with a PNPLA3-associated disease, disorder, and/or condition, or prone to developing, a PNPLA3-associated disease, disorder, and/or condition, an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention. Non-limiting examples of PNPLA3-associated diseases include, for example, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD). In one embodiment, the PNPLA3-associated disease is NAFLD. In another embodiment, the PNPLA3-associated disease is NASH. In another embodiment, the PNPLA3-associated disease is fatty liver (steatosis). In another embodiment, the PNPLA3-associated disease is insulin resistance. In another embodiment, the PNPLA3-associated disease is not insulin resistance.

[0402] The methods of the invention are useful for treating a subject having a PNPLA3-associated disease, e.g., a subject that would benefit from reduction in PNPLA3 gene expression and/or PNPLA3 protein production. In one aspect, the present invention provides methods of reducing the level of Patatin-Like Phospholipase Domain Containing 3 (PNPLA3) gene expression in a subject having nonalcoholic fatty liver disease (NAFLD). In another aspect, the present invention provides methods of reducing the level of PNPLA3 protein in a subject with NAFLD. The present invention also provides methods of reducing the level of activity of the hedgehog pathway in a subject with NAFLD.

[0403] In another aspect, the present invention provides methods of treating a subject having an NAFLD. In one aspect, the present invention provides methods of treating a subject having an PNPLA3-associated disease, e.g., fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, or nonalcoholic fatty liver disease (NAFLD). The treatment methods (and uses) of the invention include administering to the subject, e.g., a human, a therapeutically effective amount of an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention.

[0404] In one aspect, the invention provides methods of preventing at least one symptom in a subject having NAFLD, e.g., the presence of elevated hedgehog signaling pathways, fatigue, weakness, weight loss, loss of apetite, nausea, abdominal pain, spider-like blood vessels, yellowing of the skin and eyes (jaundice), itching, fluid build up and swelling of the legs (edema), abdomen swelling (ascites), and mental confusion. The methods include administering to the subject a therapeutically effective amount of the antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in PNPLA3 gene expression.

[0405] In another aspect, the present invention provides uses of a therapeutically effective amount of an iRNA agent of the invention for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of PNPLA3 gene expression.

[0406] In a further aspect, the present invention provides uses of an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of PNPLA3 gene expression and/or PNPLA3 protein production, such as a subject having a disorder that would benefit from reduction in PNPLA3 gene expression, e.g., a PNPLA3-associated disease.

[0407] In another aspect, the invention provides uses of an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of PNPLA3 gene expression and/or PNPLA3 protein production.

[0408] In a further aspect, the present invention provides uses of an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of PNPLA3 gene expression and/or SREBP cleavage-activating protein (SCAP) protein production, such as a PNPLA3-associated disease.

[0409] "Therapeutically effective amount," as used herein, is intended to include the amount of an agent that, when administered to a patient for treating a subject having a PNPLA3-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by PNPLA3 gene expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0410] "Prophylactically effective amount," as used herein, is intended to include the amount of an agent that, when administered to a subject who does not yet experience or display symptoms of a PNPLA3-associated disease, but who may be predisposed, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0411] A "therapeutically-effective amount" or "prophylactically effective amount" also includes an amount of an agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. Agents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

[0412] In one embodiment, an antisense polynucleotide agent targeting PNPLA3 is administered to a subject having an PNPLA3-associated disease such that PNPLA3 levels, e.g., in a cell, tissue, blood, urine or other tissue or fluid of the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more and, subsequently, an additional therapeutic (as described below) is administered to the subject.

[0413] The methods and uses of the invention include administering a composition described herein such that expression of the target PNPLA3 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or about 80 hours. In certain embodiments, expression of the target PNPLA3 gene is decreased for an extended duration, e.g., at least about two, three, four, five, six, seven days or more, e.g., about one week, two weeks, three weeks, or about four weeks or longer.

[0414] Administration of the antisense polynucleotide agent according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a PNPLA3-associated disease. By "reduction" in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

[0415] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of a PNPLA3-associated disorder may be assessed, for example, by periodic monitoring of NAFLD symptoms, liver fat levels, or expression of downstream genes in the subject being treated. Comparisons of the later measurements with the initial measurements provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring such a parameter, or any combination of parameters. In connection with the administration of an antisense polynucleotide agent targeting PNPLA3 or pharmaceutical composition thereof, "effective against" a PNPLA3-associated disease indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating a PNPLA3-associated disease and the related causes.

[0416] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given antisense polynucleotide agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.

[0417] Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using an antisense polynucleotide agent or antisense polynucleotide agent formulation as described herein.

[0418] Subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.1 mg/kg, 0.15 mg/kg, 0.2 mg/kg, 0.25 mg/kg, 0.3 mg/kg, 0.35 mg/kg, 0.4 mg/kg, 0.45 mg/kg, 0.5 mg/kg, 0.55 mg/kg, 0.6 mg/kg, 0.65 mg/kg, 0.7 mg/kg, 0.75 mg/kg, 0.8 mg/kg, 0.85 mg/kg, 0.9 mg/kg, 0.95 mg/kg, 1.0 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg, 2.0 mg/kg, 2.1 mg/kg, 2.2 mg/kg, 2.3 mg/kg, 2.4 mg/kg, 2.5 mg/kg, 2.6 mg/kg, 2.7 mg/kg, 2.8 mg/kg, 2.9 mg/kg, 3.0 mg/kg, 3.1 mg/kg, 3.2 mg/kg, 3.3 mg/kg, 3.4 mg/kg, 3.5 mg/kg, 3.6 mg/kg, 3.7 mg/kg, 3.8 mg/kg, 3.9 mg/kg, 4.0 mg/kg, 4.1 mg/kg, 4.2 mg/kg, 4.3 mg/kg, 4.4 mg/kg, 4.5 mg/kg, 4.6 mg/kg, 4.7 mg/kg, 4.8 mg/kg, 4.9 mg/kg, 5.0 mg/kg, 5.1 mg/kg, 5.2 mg/kg, 5.3 mg/kg, 5.4 mg/kg, 5.5 mg/kg, 5.6 mg/kg, 5.7 mg/kg, 5.8 mg/kg, 5.9 mg/kg, 6.0 mg/kg, 6.1 mg/kg, 6.2 mg/kg, 6.3 mg/kg, 6.4 mg/kg, 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7.0 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8.0 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9.0 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 9.0 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0419] In certain embodiments, for example, when a composition of the invention comprises an antisense polynucleotide agent as described herein and a lipid, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.01 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, about 0.3 mg/kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg, about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5 mg/kg, about 3 mg/kg to about 10 mg/kg, about 3.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10 mg/kg, about 7 mg/kg to about 10 mg/kg, about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg, or about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0420] For example, the antisense polynucleotide agent may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0421] In other embodiments, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, when a composition of the invention comprises a antisense polynucleotide agent as described herein and an N-acetylgalactosamine, subjects can be administered a therapeutic amount of about 10 to about 30 mg/kg of antisense polynucleotide agent. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0422] For example, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0423] The antisense polynucleotide agent can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about a 25 minute period. The administration may be repeated, for example, on a regular basis, such as weekly, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months or a year or longer.

[0424] Administration of the antisense polynucleotide agent can reduce PNPLA3 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.

[0425] Before administration of a full dose of the antisense polynucleotide agent, patients can be administered a smaller dose, such as a 5% infusion, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

[0426] Owing to the inhibitory effects on PNPLA3 expression, a composition according to the invention or a pharmaceutical composition prepared therefrom can enhance the quality of life.

[0427] An antisense polynucleotide agent of the invention may be administered in "naked" form, or as a "free antisense polynucleotide agent." A naked antisense polynucleotide agent is administered in the absence of a pharmaceutical composition. The naked antisense polynucleotide agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the antisense polynucleotide agent can be adjusted such that it is suitable for administering to a subject.

[0428] Alternatively, an antisense polynucleotide agent of the invention may be administered as a pharmaceutical composition, such as an antisense polynucleotide agent liposomal formulation.

[0429] Subjects that would benefit from a reduction and/or inhibition of PNPLA3 gene expression are those having nonalcoholic fatty liver disease (NAFLD) and/or an PNPLA3-associated disease or disorder as described herein.

[0430] Treatment of a subject that would benefit from a reduction and/or inhibition of PNPLA3 gene expression includes therapeutic and prophylactic treatment.

[0431] The invention further provides methods and uses of an antisense polynucleotide agent or a pharmaceutical composition thereof (including methods and uses of an antisense polynucleotide agent or a pharmaceutical composition comprising an antisense polynucleotide agent and an for treatment of the PNPLA3-associated diseases) for treating a subject that would benefit from reduction and/or inhibition of PNPLA3 expression, e.g., a subject having a PNPLA3-associated disease, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an antisense polynucleotide agent targeting PNPLA3 is administered in combination with, e.g., an agent useful in treating a PNPLA3-associated disease as described elsewhere herein.

[0432] The antisense polynucleotide agent (and/or agent(s) for treatment of the PNPLA3-associated disease) and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein.

[0433] The present invention also provides methods of using an antisense polynucleotide agent of the invention and/or a composition containing an antisense polynucleotide agent of the invention to reduce and/or inhibit PNPLA3 expression in a cell. In other aspects, the present invention provides an antisense polynucleotide agent of the invention and/or a composition comprising an antisense polynucleotide agent of the invention for use in reducing and/or inhibiting PNPLA3 expression in a cell. In yet other aspects, use of an antisense polynucleotide agent of the invention and/or a composition comprising an antisense polynucleotide agent of the invention for the manufacture of a medicament for reducing and/or inhibiting PNPLA3 expression in a cell are provided.

[0434] The methods and uses include contacting the cell with an antisense polynucleotide agent, e.g., a antisense polynucleotide agent, of the invention and maintaining the cell for a time sufficient to obtain antisense inhibition of a PNPLA3 gene, thereby inhibiting expression of the PNPLA3 gene in the cell.

[0435] Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of PNPLA3 may be determined by determining the mRNA expression level of PNPLA3 using methods routine to one of ordinary skill in the art, e.g., northern blotting, qRT-PCR, by determining the protein level of PNPLA3 using methods routine to one of ordinary skill in the art, such as western blotting, immunological techniques, flow cytometry methods, ELISA, and/or by determining a biological activity of PNPLA3.

[0436] In the methods and uses of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. In embodiments of the invention in which the cell is within a subject, the methods may include further contacting the cell with an agent for treatment of the PNPLA3-associated disease.

[0437] A cell suitable for treatment using the methods of the invention may be any cell that expresses a PNPLA3 gene. A cell suitable for use in the methods and uses of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell.

[0438] PNPLA3 expression may be inhibited in the cell by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100%.

[0439] The in vivo methods and uses of the invention may include administering to a subject a composition containing an antisense polynucleotide agent, where the antisense polynucleotide agent includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the PNPLA3 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0440] In some embodiments, the administration is via a depot injection. A depot injection may release the antisense polynucleotide agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of PNPLA3, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

[0441] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the antisense polynucleotide agent to the liver.

[0442] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

[0443] In one aspect, the present invention also provides methods for inhibiting the expression of an PNPLA3 gene in a mammal, e.g., a human. The present invention also provides a composition comprising an antisense polynucleotide agent that targets a PNPLA3 gene in a cell of a mammal for use in inhibiting expression of the PNPLA3 gene in the mammal. In another aspect, the present invention provides use of an antisense polynucleotide agent that targets an PNPLA3 gene in a cell of a mammal in the manufacture of a medicament for inhibiting expression of the PNPLA3 gene in the mammal.

[0444] The methods and uses include administering to the mammal, e.g., a human, a composition comprising an antisense polynucleotide agent that targets a PNPLA3 gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain antisense inhibition of the mRNA transcript of the PNPLA3 gene, thereby inhibiting expression of the PNPLA3 gene in the mammal. In some embodiment, the methods further comprise administering an agent for treatment of the PNPLA3-associated disease to the subject.

[0445] Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g., ELISA or western blotting, described herein. In one embodiment, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in PNPLA3 gene and/or protein expression. In another embodiment, a blood sample serves as the tissue material for monitoring the reduction in PNPLA3 gene and/or protein expression. Suitable assays are further described in the Examples section below.

[0446] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the antisense polynucleotide agents and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

EXAMPLES

Example 1. Design and Synthesis of Antisense Polynucleotides

Source of Reagents

[0447] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

Transcripts

[0448] Design of Antisense Polynucleotide Agents

[0449] A set of antisense oligos (ASOs) targeting the human PNPLA3, "patatin-like phospholipase domain containing 3", (human: NCBI refseqID NM_025225; NCBI GeneID: 80339) were designed using custom R and Python scripts. The rationale and method for the set of ASO designs is as follows: the predicted efficacy for every potential 19mer ASO from position 1 through the end of the mRNA was determined with a linear model derived the direct measure of mRNA knockdown from more than 20,000 distinct siRNA designs targeting a large number of vertebrate genes. Starting from position 1 a set of ASOs was created by systematically picking an ASO design whose 5' base began every 11 bases along the entire length of the mRNA. Predicted efficacy was used to allow for the substitution of a neighboring, predicted-to-be-more-potent ASO design where the neighboring ASO was 1 base either toward the 5' or 3' end of the mRNA. Low complexity ASO designs were removed by filtering with a Shannon entropy index greater than 1.35.

[0450] The antisense polynucleotides targeting PNPLA3 were synthesized using standard synthesis methods well known in the art.

[0451] A detailed list of the unmodified antisense polynucleotide molecules targeting PNPLA3 is shown in Table 3 and a detailed list of the modified antisense polynucleotide molecules targeting PNPLA3 is shown in Table 4.

Example 2. In Vitro Screening

[0452] Human hepatoma cells (HuH7 cells) were transfected with 500 nM of each single stranded antisense oligonucleotide (ASO). To do so, Lipofectamine 2000 (Invitrogen) was incubated with each ASO according to the manufacturer's protocol and then added to 2.times.10.sup.4 cells in each well of a 96 well plate. Plates were incubated for 24 hours prior to harvesting for analysis.

[0453] For measurement of PNPLA3 mRNA, cells were harvested 24 hours after transfection and lysed at 53.degree. C. following procedures recommended by the manufacturer of the Quantigene II Kit for PNPLA3 and Quantigene I Explore Kit for (Panomics, Fremont, Calif., USA) bDNA. Afterwards, 50 .mu.l of the lysates were incubated with probesets specific to human PNPLA3 and 10 .mu.l of the lysates for human GAPDH and processed according to the manufacturer's protocol for QuantiGene. Chemoluminescence was measured in a Victor2-Light (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the human PNPLA3 probeset were normalized to the respective human GAPDH values for each well and then related to the mean of an unrelated control gene. Table 5 shows the results of single dose transfection screen in cells transfected with the indicated antisense polynucleotide.

TABLE-US-00002 TABLE 2 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphorothioate As adenosine-3'-phosphorothioate a 2'-O-methyladenosine-3'-phosphate as 2'-O-methyladenosine-3'-phosphorothioate C cytidine-3'-phosphate dA 2-deoxyadenosine-3'-phosphate dAs 2'-deoxyadenosine-3'-phosphorothioate Cf 2'-fluorocytidine-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphorothioate Cs cytidine-3'-phosphorothioate c 2'-O-methylcytidine-3'-phosphate cs 2'-O-methylcytidine-3'-phosphorothioate dC 2'-deoxycytidine-3'-phosphate dCs 2'-deoxycytidine-3'-phosphorothioate G guanosine-3'-phosphate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphorothioate Gs guanosine-3'-phosphorothioate g 2'-O-methylguanosine-3'-phosphate gs 2'-O-methylguanosine-3'-phosphorothioate dG 2'-deoxyguanosine-3'-phosphate dGs 2'-deoxyguanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tf 2'-fluoro-5-methyluridine-3'-phosphate Tfs 2'-fluoro-5-methyluridine-3'-phosphorothioate Ts 5-methyluridine-3'-phosphorothioate t 2'-O-methyl-5-methyluridine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphorothioate dT 2'-deoxythymidine-3'-phosphate dTs 2'-deoxythymidine-3'-phosphorothioate U Uridine-3'-phosphate Uf 2'-fluorouridine-3'-phosphate Ufs 2'-fluorouridine-3'-phosphorothioate Us uridine-3'-phosphorothioate u 2'-O-methyluridine-3'-phosphate us 2'-O-methyluridine-3'-phosphorothioate dU 2-deoxyuridine-3'-phosphate dUs 2'-deoxyuridine-3'-phosphorothioate s phosphorothioate linkage N any nucleotide (G, A, C, T or U) L96 N-[tris(GalNAc-alkyl)-amidodecanoyol-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3 (dt) deoxy-thymine (5MdC) 5'-methyl-deoxycytidine-3'-phosphate (5MdC)s 5'-methyl-deoxycytidine-3'-phosphorothioate

TABLE-US-00003 TABLE 3 Unmodified Antisense Polynucleotides Agents Targeting PNPLA3. Oligo Sequence SEQ Position in Name (5' to 3') ID NO NM_025225.2 A-137806.1 CGACGUCAGCCCCGCCCCCC 17 10 A-137807.1 GGCAUUCCCAGCGCGACGUC 18 23 A-137808.1 GUCUCGGCCAGGGCAUUCCC 19 34 A-137809.1 UGCCUCAGUGUCUCGGCCAG 20 43 A-137810.1 CGCUCUCUACCCUGCCUCAG 21 55 A-137811.1 GCGCCCGCAAGCGCUCUCUA 22 66 A-137812.1 CAGCUCCGCCCGGCGCCCGC 23 78 A-137813.1 UGAUCCGCAGCAGCUCCGCC 24 88 A-137814.1 GCUCGGGUCCUGAUCCGCAG 25 98 A-137815.1 AUCGGGAAUCGGCUCGGGUC 26 109 A-137816.1 UCUGGGUCGGGAUCGGGAAU 27 120 A-137817.1 CGCGGGUUAGGAUCUGGGUC 28 132 A-137818.1 GGGGCGGGGGCGCGGGUUAG 29 142 A-137819.1 GGCGGCGGCGGCGGGGCGGG 30 154 A-137820.1 UGCGUCGUACAUGGCGGCGG 31 166 A-137821.1 AGCCGCGCUCUGCGUCGUAC 32 176 A-137822.1 AGGACAAGCUCCAGCCGCGC 33 188 A-137823.1 AGCCCGCGAAGGACAAGCUC 34 197 A-137824.1 CAGGAAGCCGCAGCCCGCGA 35 208 A-137825.1 CGUGGUAGAAGCCCAGGAAG 36 221 A-137826.1 UCGCCCCGACGUGGUAGAAG 37 230 A-137827.1 CAGGCAGCGGGUCGCCCCGA 38 241 A-137828.1 GGGCGUGCUCGCUCAGGCAG 39 254 A-137829.1 AGGAGGUGCGGGGCGUGCUC 40 264 A-137830.1 CGCGCGUCGCGGAGGAGGUG 41 276 A-137831.1 AACAACAUGCGCGCGUCGCG 42 285 A-137832.1 GCCGAAGCGCCGAACAACAU 43 297 A-137833.1 UGCAACGCCCCGGCCGAAGC 44 309 A-137834.1 GCCGACGCAGUGCAACGCCC 45 319 A-137835.1 CGGAGAGGACGCCGACGCAG 46 329 A-137836.1 UCCAGCGGGAUACCGGAGAG 47 342 A-137837.1 AGAGUCUGCUCCAGCGGGAU 48 351 A-137838.1 AGAGGACCUGCAGAGUCUGC 49 362 A-137839.1 CGCACAAGAUCUGAGAGGAC 50 375 A-137840.1 CCUGGCCUUCCGCACAAGAU 51 385 A-137841.1 UGUUCCGACUCCUGGCCUUC 52 395 A-137842.1 GGAAGAUGCCAAUGUUCCGA 53 407 A-137843.1 AAGGAUGGAUGGAAGAUGCC 54 417 A-137844.1 UGCUUAAGUUGAAGGAUGGA 55 428 A-137845.1 GUCGGAGGAACUUGCUUAAG 56 440 A-137846.1 GCAGAGACCCUGUCGGAGGA 57 451 A-137847.1 CGGGAGGCAUUUGCAGAGAC 58 463 A-137848.1 GGACAUUGGCCGGGAGGCAU 59 473 A-137849.1 AGAUGAGCUGGUGGACAUUG 60 485 A-137850.1 AUUUUGCCGGAGAUGAGCUG 61 495 A-137851.1 AGAGAUGCCUAUUUUGCCGG 62 505 A-137852.1 ACACUCUGGUAAGAGAGAUG 63 518 A-137853.1 CCCCAUCAGACACUCUGGUA 64 527 A-137854.1 ACCAGAACGUUUUCCCCAUC 65 540 A-137855.1 AAGUCAGACACCAGAACGUU 66 549 A-137856.1 CUUUGGACCGAAAGUCAGAC 67 560 A-137857.1 CCACGACUUCGUCUUUGGAC 68 572 A-137858.1 ACCAAGGCAUCCACGACUUC 69 582 A-137859.1 AAGCAGGAACAUACCAAGGC 70 594 A-137860.1 AGAAGGGGAUGAAGCAGGAA 71 605 A-137861.1 AGGCCACUGUAGAAGGGGAU 72 615 A-137862.1 AAGGAGGGAUAAGGCCACUG 73 626 A-137863.1 CGCCUCUGAAGGAAGGAGGG 74 638 A-137864.1 ACAUAUCGCACGCCUCUGAA 75 648 A-137865.1 ACUCCUCCAUCCACAUAUCG 76 660 A-137866.1 ACGUUGUCACUCACUCCUCC 77 672 A-137867.1 AAUGAAGGGUACGUUGUCAC 78 682 A-137868.1 GUUUUGGCAUCAAUGAAGGG 79 693 A-137869.1 GGUGAUGGUUGUUUUGGCAU 80 703 A-137870.1 AGAAGGGGGACACGGUGAUG 81 716 A-137871.1 ACUCCCCAUAGAAGGGGGAC 82 725 A-137872.1 GCAGAUGUCGUACUCCCCAU 83 736 A-137873.1 ACUUGACUUUAGGGCAGAUG 84 749 A-137874.1 AAAGUUCGUGGACUUGACUU 85 760 A-137875.1 CCACAUGAAGAAAGUUCGUG 86 770 A-137876.1 UUGGUGAUGUCCACAUGAAG 87 780 A-137877.1 CGUAGACUGAGCUUGGUGAU 88 792 A-137878.1 CUGUGCAGAGGCGUAGACUG 89 803 A-137879.1 GUAGAGGUUCCCUGUGCAGA 90 814 A-137880.1 UCGAGAGAAGGUAGAGGUUC 91 824 A-137881.1 GGGACAAAAGCUCUCGAGAG 92 837 A-137882.1 UGAGAUCCGGGGGGACAAAA 93 848 A-137883.1 CCAGCACCUUGAGAUCCGGG 94 857 A-137884.1 AGGCAUAUCUCUCCCAGCAC 95 870 A-137885.1 UAUCCUCGAAGGCAUAUCUC 96 879 A-137886.1 GAAUGCAUCCAAAUAUCCUC 97 892 A-137887.1 UCCAAGAACCUGAAUGCAUC 98 903 A-137888.1 UGCCCUUCUCUUCCAAGAAC 99 914 A-137889.1 UGUUGCAGAUGCCCUUCUCU 100 923 A-137890.1 CUGGCUGGGGCCUGUUGCAG 101 935 A-137891.1 AUGACUUCAGGCCUGGCUGG 102 947 A-137892.1 CCCUUCUGAGGAUGACUUCA 103 958 A-137893.1 CAGGAUCCAUCCCUUCUGAG 104 968 A-137894.1 AUGGCGACCUCAGGAUCCAU 105 978 A-137895.1 UGCCCAGCUGGGCAUGGCGA 106 991 A-137896.1 ACUCAUGUUUGCCCAGCUGG 107 1000 A-137897.1 GGAAGAAUCCAGACUCAUGU 108 1012 A-137898.1 AGCCGACUCCGGGGAAGAAU 109 1024 A-137899.1 ACAGCCAAGGCAGCCGACUC 110 1035 A-137900.1 CCUCCAGCCUCACAGCCAAG 111 1046 A-137901.1 GCUCAUCUCCCUCCAGCCUC 112 1055 A-137902.1 AGGUGGUCUAGCAGCUCAUC 113 1068 A-137903.1 CUGAGACGCAGGUGGUCUAG 114 1077 A-137904.1 AGGGCAGGAUGCUGAGACGC 115 1088 A-137905.1 GCUCUCAUCCCAGGGCAGGA 116 1099 A-137906.1 GUGUCCAGGAUGCUCUCAUC 117 1110 A-137907.1 CUGGGCGAGAGGGUGUCCAG 118 1122 A-137908.1 CUGUAGCGAGCCUGGGCGAG 119 1133 A-137909.1 UCACUCAGUGCUGUAGCGAG 120 1143 A-137910.1 CUUUCAUUUCUUCACUCAGU 121 1154 A-137911.1 AUCCACCUUUGUCUUUCAUU 122 1166 A-137912.1 UUGCUCAUGUAUCCACCUUU 123 1176 A-137913.1 AGUUGCAAAUCUUGCUCAUG 124 1187 A-137914.1 AAUGGGUAGCAAGUUGCAAA 125 1198 A-137915.1 AGACAUUAUCCUAAUGGGUA 126 1210 A-137916.1 AGCAUUACAUAAGACAUUAU 127 1221 A-137917.1 AGGGUACAGGGCAGCAUUAC 128 1233 A-137918.1 AUUCCACAGGCAGGGUACAG 129 1244 A-137919.1 CGCAAUGGCAGAUUCCACAG 130 1255 A-137920.1 CUGGACAAUCGCAAUGGCAG 131 1264 A-137921.1 GUCACCAGUCUCUGGACAAU 132 1275 A-137922.1 AUCUGGAAGCCAUGUCACCA 133 1288 A-137923.1 UCGUCGGGCAUAUCUGGAAG 134 1299 A-137924.1 CACAGGACAUCGUCGGGCAU 135 1308 A-137925.1 ACCCACUGCAACCACAGGAC 136 1320 A-137926.1 ACCUGUGAGGUCACCCACUG 137 1332 A-137927.1 CUCGAGUGAACACCUGUGAG 138 1343

A-137928.1 ACAUCAGCACUCGAGUGAAC 139 1352 A-137929.1 GCGGGGAGCAGACACAUCAG 140 1365 A-137930.1 GACCUGGAGGCGGGGAGCAG 141 1374 A-137931.1 ACUGGCAUUUGGGACCUGGA 142 1386 A-137932.1 UUGGCUGCUCACUGGCAUUU 143 1396 A-137933.1 AUGGGGAGGCCUGUUGGCUG 144 1409 A-137934.1 UCAGGUGUGCAUGGGGAGGC 145 1419 A-137935.1 GGCCAGUCCUGCUCAGGUGU 146 1431 A-137936.1 GAGUCCAGCAGGGCCAGUCC 147 1442 A-137937.1 GGGAGCAGGGAGUCCAGCAG 148 1451 A-137938.1 ACAGCCCUUGGGGGAGCAGG 149 1462 A-137939.1 GUCUCUGCUGGACAGCCCUU 150 1473 A-137940.1 GCCUCUGCUUUGGUCUCUGC 151 1485 A-137941.1 CCGCGGGGUGGCCUCUGCUU 152 1495 A-137942.1 ACCUGAGGAUGGACCGCGGG 153 1508 A-137943.1 GUUCAGGCUGGACCUGAGGA 154 1519 A-137944.1 CCAAGAAGAAGUUCAGGCUG 155 1529 A-137945.1 GUACUUUAUUGCCCAAGAAG 156 1541 A-137946.1 AGCACCAGCAGGUACUUUAU 157 1552 A-137947.1 GAGAGCCCCUCAGCACCAGC 158 1563 A-137948.1 GGAAAGGUGGAGAGCCCCUC 159 1572 A-137949.1 AGUGAAAAACUGGGAAAGGU 160 1584 A-137950.1 ACUCUUCUCUAGUGAAAAAC 161 1594 A-137951.1 AAGUGACUCACAGACUCUUC 162 1607 A-137952.1 CUCGCCUCCUCAAGUGACUC 163 1618 A-137953.1 UCUGCUAGACUCGCCUCCUC 164 1627 A-137954.1 ACCUCUGAAAGAAUCUGCUA 165 1640 A-137955.1 AAACUUUAGCACCUCUGAAA 166 1650 A-137956.1 ACAAAGAUGGGAAACUUUAG 167 1661 A-137957.1 GGAGGUAGCUGCACAAAGAU 168 1673 A-137958.1 CAGCAAUGCGGAGGUAGCUG 169 1682 A-137959.1 AGGGGUCACUACACAGCAAU 170 1695 A-137960.1 ACGUCACAGGCAGGGGUCAC 171 1706 A-137961.1 UGGGAUCCUCCACGUCACAG 172 1717 A-137962.1 GCUCAGAGGCUGGGAUCCUC 173 1727 A-137963.1 AAACCAACUCAGCUCAGAGG 174 1738 A-137964.1 UAGCUUUUCAUAAAACCAAC 175 1750 A-137965.1 AGGUUGCUUCCUAGCUUUUC 176 1761 A-137966.1 ACAGGCGAAAGGUUGCUUCC 177 1770 A-137967.1 UGGACCGCUGCACAGGCGAA 178 1781 A-137968.1 AGAGUUAAGUGCUGGACCGC 179 1793 A-137969.1 GCUGAUGUAUUAGAGUUAAG 180 1804 A-137970.1 AUUAACGCAUGCUGAUGUAU 181 1814 A-137971.1 CCAACCAGCUGAAUUAACGC 182 1826 A-137972.1 GGUGUCAUUUCCCAACCAGC 183 1837 A-137973.1 UGGGCUUCCUGGUGUCAUUU 184 1847 A-137974.1 GACCCUCUGCACUGGGCUUC 185 1859 A-137975.1 AGUCAGUAAGGGACCCUCUG 186 1870 A-137976.1 GCCACGAAACAGUCAGUAAG 187 1880 A-137977.1 CCAUUAAUAGGGCCACGAAA 188 1891 A-137978.1 GGAACAGUCUGACCAUUAAU 189 1903 A-137979.1 ACCUCAUGCUGGAACAGUCU 190 1913 A-137980.1 UGUCAUUCUAAGAACCUCAU 191 1926 A-137981.1 CCAAACACCUGUCAUUCUAA 192 1935 A-137982.1 GCCCCCACCCAUCCAAACAC 193 1947 A-137983.1 CCCCAUCACAAGGCCCCCAC 194 1959 A-137984.1 CAGCCUACCCCCCAUCACAA 195 1968 A-137985.1 UCACACAUGGGCCAGCCUAC 196 1980 A-137986.1 CACCCCACAAGAUCACACAU 197 1992 A-137987.1 UCUUCCCUCCACCCCACAAG 198 2001 A-137988.1 UCAUGCUAUUCUCUUCCCUC 199 2012 A-137989.1 GGGAAGUGGGAUCAUGCUAU 200 2023 A-137990.1 UCCCACAGCAUGGGGAAGUG 201 2035 A-137991.1 ACUGCACCCCUUCCCACAGC 202 2046 A-137992.1 UCUUGGGGACGAACUGCACC 203 2058 A-137993.1 GCAGUGUCGUUCUUGGGGAC 204 2068 A-137994.1 ACCACCUGACAGGCAGUGUC 205 2080 A-137995.1 AUCUUUGCAGACCACCUGAC 206 2090 A-137996.1 CAAGGUUAUCAUCUUUGCAG 207 2100 A-137997.1 GUUUUUAGUAGUCAAGGUUA 208 2112 A-137998.1 CGCCAUGGAGACGUUUUUAG 209 2124 A-137999.1 CUUGUUACCCCCGCCAUGGA 210 2135 A-138000.1 AGAUUAUCAUCUUGUUACCC 211 2145 A-138001.1 AAAAUUAAGUAGAUUAUCAU 212 2155 A-138002.1 AAAGGUGUUCUAAAAUUAAG 213 2166 A-138003.1 AGUUAGGUGAAAAAGGUGUU 214 2177 A-138004.1 AAACAUUAUUUUAGUUAGGU 215 2189 A-138005.1 AAAACUCUUUAAACAUUAUU 216 2199 A-138006.1 ACAUUUUUAUACAAAACUCU 217 2211 A-138007.1 AACGCUUCCUUACAUUUUUA 218 2222 A-138008.1 AACAGGUAACAACGCUUCCU 219 2232 A-138009.1 AUACAAAAUUCAACAGGUAA 220 2243 A-138010.1 ACUGAUUCACAUAAUACAAA 221 2256 A-138011.1 ACUAACAUCUCACUGAUUCA 222 2267 A-138012.1 AGGCUUAUUCUACUAACAUC 223 2278 A-138013.1 UUUUUUUUUUAAGGCUUAUU 224 2289 A-138014.1 AACCGAUUUUUUUUUUUUUA 225 2298 A-138015.1 CCACUGCACCCAACCGAUUU 226 2309 A-138016.1 ACAGCCGUGUGCCACUGCAC 227 2320 A-138017.1 AAGUGCUGGGAUUACAGCCG 228 2333 A-138018.1 UUGGCCUCCCAAAGUGCUGG 229 2344 A-138019.1 AUCUGCCAACCUUGGCCUCC 230 2355 A-138020.1 ACCUCAGGUGAUCUGCCAAC 231 2365 A-138021.1 CUUGAACUCCUGACCUCAGG 232 2377 A-138022.1 CCAGACUGGUCUUGAACUCC 233 2387 A-138023.1 UGCUAUGUUGGCCAGACUGG 234 2398 A-138024.1 GACAGGGUUUUGCUAUGUUG 235 2408 A-138025.1 AUUUUUAGUAGAGACAGGGU 236 2420 A-138026.1 AUAAUUUUUGUAUUUUUAGU 237 2431 A-138027.1 ACCAUGCCCAGAUAAUUUUU 238 2442 A-138028.1 AGGCAUGCACCACCAUGCCC 239 2453 A-138029.1 AGCUGGGAUUACAGGCAUGC 240 2465 A-138030.1 CUUCCGAAUAGCUGGGAUUA 241 2474 A-138031.1 CCUGCCUCAGCCUUCCGAAU 242 2485 A-138032.1 UCAAGUGAUUCUCCUGCCUC 243 2497 A-138033.1 CCUCCUGGGUUCAAGUGAUU 244 2507 A-138034.1 CCGCAACCUCCGCCUCCUGG 245 2519 A-138035.1 AAUCUCAGCUCACCGCAACC 246 2531 A-138036.1 UGAAAUGGUGCAAUCUCAGC 247 2542 A-138037.1 AGGCUGGAAUGAAAUGGUGC 248 2551 A-138038.1 ACUCAUGUUGCCCAGGCUGG 249 2564 A-138039.1 UCAGACUUUCACUCAUGUUG 250 2574 A-138040.1 UUUUUUUUUGAGUCAGACUU 251 2586 A-138041.1 UUUUAAAUUUUUUUUUUUUG 252 2596 A-138042.1 GAUUAUUUUGUUUUUUAAAU 253 2608 A-138043.1 CUGCACACUAGAUUAUUUUG 254 2618 A-138044.1 AGGUGAAUGCCCUGCACACU 255 2629 A-138045.1 UGGGGGGCUGAGGUGAAUGC 256 2639 A-138046.1 CUUGGCUCCUGCCUGGGGGG 257 2652 A-138047.1 CCUGCUGUGCUUGGCUCCUG 258 2661 A-138048.1 AGGCGGAAGCUCCUGCUGUG 259 2672 A-138049.1 CAGUGGAGAGGAGGCGGAAG 260 2683 A-138050.1 AGUUGUGUGCUCCAGUGGAG 261 2695 A-138051.1 AGCCAGGUUCAAGUUGUGUG 262 2706 A-138052.1 GCAGAAAAUAAGCCAGGUUC 263 2716

A-138053.1 GGGGCUGGUCCCUGCAGAAA 264 2729 A-138054.1 ACUGACCAUGUGGGGCUGGU 265 2740 A-138055.1 GGAGAAACUCACUGACCAUG 266 2750 A-138056.1 CGCCACACAUGGGGAGAAAC 267 2762 A-138057.1 ACUCUCUCAUCGCCACACAU 268 2772 A-138058.1 CUUUAUUUCUACACUCUCUC 269 2784

TABLE-US-00004 TABLE 4 Modified Antisense Polynucleotides Agents Targeting PNPLA3. Oligo SEQ Name Sequence 5'-3' ID NO A-137806.1 csgsascsgsdTs(5MdC)sdAsdGs(5MdC)s(5MdC)s(5MdC)s(5MdC)sdGs(5MdC)- scscscscsc 270 A-137807.1 gsgscsasusdTs(5MdC)s(5MdC)s(5MdC)sdAsdGs(5MdC)sdGs(5MdC)sdGsasc- sgsusc 271 A-137808.1 gsuscsuscsdGsdGs(5MdC)s(5MdC)sdAsdGsdGsdGs(5MdC)sdAsususcscsc 272 A-137809.1 usgscscsus(5MdC)sdAsdGsdTsdGsdTs(5MdC)sdTs(5MdC)sdGsgscscsasg 273 A-137810.1 csgscsuscsdTs(5MdC)sdTsdAs(5MdC)s(5MdC)s(5MdC)sdTsdGs(5MdC)scsu- scsasg 274 A-137811.1 gscsgscscs(5MdC)sdGs(5MdC)sdAsdAsdGs(5MdC)sdGs(5MdC)sdTscsuscsu- sa 275 A-137812.1 csasgscsus(5MdC)s(5MdC)sdGs(5MdC)s(5MdC)s(5MdC)sdGsdGs(5MdC)sdG- scscscsgsc 276 A-137813.1 usgsasuscs(5MdC)sdGs(5MdC)sdAsdGs(5MdC)sdAsdGs(5MdC)sdTscscsgsc- sc 277 A-137814.1 gscsuscsgsdGsdGsdTs(5MdC)s(5MdC)sdTsdGsdAsdTs(5MdC)scsgscsasg 278 A-137815.1 asuscsgsgsdGsdAsdAsdTs(5MdC)sdGsdGs(5MdC)sdTs(5MdC)sgsgsgsusc 279 A-137816.1 uscsusgsgsdGsdTs(5MdC)sdGsdGsdGsdAsdTs(5MdC)sdGsgsgsasasu 280 A-137817.1 csgscsgsgsdGsdTsdTsdAsdGsdGsdAsdTs(5MdC)sdTsgsgsgsusc 281 A-137818.1 gsgsgsgscsdGsdGsdGsdGsdGs(5MdC)sdGs(5MdC)sdGsdGsgsususasg 282 A-137819.1 gsgscsgsgs(5MdC)sdGsdGs(5MdC)sdGsdGs(5MdC)sdGsdGsdGsgscsgsgsg 283 A-137820.1 usgscsgsus(5MdC)sdGsdTsdAs(5MdC)sdAsdTsdGsdGs(5MdC)sgsgscsgsg 284 A-137821.1 asgscscsgs(5MdC)sdGs(5MdC)sdTs(5MdC)sdTsdGs(5MdC)sdGsdTscsgsusa- sc 285 A-137822.1 asgsgsascsdAsdAsdGs(5MdC)sdTs(5MdC)s(5MdC)sdAsdGs(5MdC)scsgscsg- sc 286 A-137823.1 asgscscscsdGs(5MdC)sdGsdAsdAsdGsdGsdAs(5MdC)sdAsasgscsusc 287 A-137824.1 csasgsgsasdAsdGs(5MdC)s(5MdC)sdGs(5MdC)sdAsdGs(5MdC)s(5MdC)scsg- scsgsa 288 A-137825.1 csgsusgsgsdTsdAsdGsdAsdAsdGs(5MdC)s(5MdC)s(5MdC)sdAsgsgsasasg 289 A-137826.1 uscsgscscs(5MdC)s(5MdC)sdGsdAs(5MdC)sdGsdTsdGsdGsdTsasgsasasg 290 A-137827.1 csasgsgscsdAsdGs(5MdC)sdGsdGsdGsdTs(5MdC)sdGs(5MdC)scscscsgsa 291 A-137828.1 gsgsgscsgsdTsdGs(5MdC)sdTs(5MdC)sdGs(5MdC)sdTs(5MdC)sdAsgsgscsa- sg 292 A-137829.1 asgsgsasgsdGsdTsdGs(5MdC)sdGsdGsdGsdGs(5MdC)sdGsusgscsusc 293 A-137830.1 csgscsgscsdGsdTs(5MdC)sdGs(5MdC)sdGsdGsdAsdGsdGsasgsgsusg 294 A-137831.1 asascsasas(5MdC)sdAsdTsdGs(5MdC)sdGs(5MdC)sdGs(5MdC)sdGsuscsgsc- sg 295 A-137832.1 gscscsgsasdAsdGs(5MdC)sdGs(5MdC)s(5MdC)sdGsdAsdAs(5MdC)sasascsa- su 296 A-137833.1 usgscsasas(5MdC)sdGs(5MdC)s(5MdC)s(5MdC)s(5MdC)sdGsdGs(5MdC)s(5- MdC)sgsasasgsc 297 A-137834.1 gscscsgsas(5MdC)sdGs(5MdC)sdAsdGsdTsdGs(5MdC)sdAsdAscsgscscsc 298 A-137835.1 csgsgsasgsdAsdGsdGsdAs(5MdC)sdGs(5MdC)s(5MdC)sdGsdAscsgscsasg 299 A-137836.1 uscscsasgs(5MdC)sdGsdGsdGsdAsdTsdAs(5MdC)s(5MdC)sdGsgsasgsasg 300 A-137837.1 asgsasgsus(5MdC)sdTsdGs(5MdC)sdTs(5MdC)s(5MdC)sdAsdGs(5MdC)sgsg- sgsasu 301 A-137838.1 asgsasgsgsdAs(5MdC)s(5MdC)sdTsdGs(5MdC)sdAsdGsdAsdGsuscsusgsc 302 A-137839.1 csgscsascsdAsdAsdGsdAsdTs(5MdC)sdTsdGsdAsdGsasgsgsasc 303 A-137840.1 cscsusgsgs(5MdC)s(5MdC)sdTsdTs(5MdC)s(5MdC)sdGs(5MdC)sdAs(5MdC)- sasasgsasu 304 A-137841.1 usgsususcs(5MdC)sdGsdAs(5MdC)sdTs(5MdC)s(5MdC)sdTsdGsdGscscsusu- sc 305 A-137842.1 gsgsasasgsdAsdTsdGs(5MdC)s(5MdC)sdAsdAsdTsdGsdTsuscscsgsa 306 A-137843.1 asasgsgsasdTsdGsdGsdAsdTsdGsdGsdAsdAsdGsasusgscsc 307 A-137844.1 usgscsususdAsdAsdGsdTsdTsdGsdAsdAsdGsdGsasusgsgsa 308 A-137845.1 gsuscsgsgsdAsdGsdGsdAsdAs(5MdC)sdTsdTsdGs(5MdC)sususasasg 309 A-137846.1 gscsasgsasdGsdAs(5MdC)s(5MdC)s(5MdC)sdTsdGsdTs(5MdC)sdGsgsasgsg- sa 310 A-137847.1 csgsgsgsasdGsdGs(5MdC)sdAsdTsdTsdTsdGs(5MdC)sdAsgsasgsasc 311 A-137848.1 gsgsascsasdTsdTsdGsdGs(5MdC)s(5MdC)sdGsdGsdGsdAsgsgscsasu 312 A-137849.1 asgsasusgsdAsdGs(5MdC)sdTsdGsdGsdTsdGsdGsdAscsasususg 313 A-137850.1 asususususdGs(5MdC)s(5MdC)sdGsdGsdAsdGsdAsdTsdGsasgscsusg 314 A-137851.1 asgsasgsasdTsdGs(5MdC)s(5MdC)sdTsdAsdTsdTsdTsdTsgscscsgsg 315 A-137852.1 ascsascsus(5MdC)sdTsdGsdGsdTsdAsdAsdGsdAsdGsasgsasusg 316 A-137853.1 cscscscsasdTs(5MdC)sdAsdGsdAs(5MdC)sdAs(5MdC)sdTs(5MdC)susgsgsu- sa 317 A-137854.1 ascscsasgsdAsdAs(5MdC)sdGsdTsdTsdTsdTs(5MdC)s(5MdC)scscsasusc 318 A-137855.1 asasgsuscsdAsdGsdAs(5MdC)sdAs(5MdC)s(5MdC)sdAsdGsdAsascsgsusu 319 A-137856.1 csusususgsdGsdAs(5MdC)s(5MdC)sdGsdAsdAsdAsdGsdTscsasgsasc 320 A-137857.1 cscsascsgsdAs(5MdC)sdTsdTs(5MdC)sdGsdTs(5MdC)sdTsdTsusgsgsasc 321 A-137858.1 ascscsasasdGsdGs(5MdC)sdAsdTs(5MdC)s(5MdC)sdAs(5MdC)sdGsascsusu- sc 322 A-137859.1 asasgscsasdGsdGsdAsdAs(5MdC)sdAsdTsdAs(5MdC)s(5MdC)sasasgsgsc 323 A-137860.1 asgsasasgsdGsdGsdGsdAsdTsdGsdAsdAsdGs(5MdC)sasgsgsasa 324 A-137861.1 asgsgscscsdAs(5MdC)sdTsdGsdTsdAsdGsdAsdAsdGsgsgsgsasu 325 A-137862.1 asasgsgsasdGsdGsdGsdAsdTsdAsdAsdGsdGs(5MdC)scsascsusg 326 A-137863.1 csgscscsus(5MdC)sdTsdGsdAsdAsdGsdGsdAsdAsdGsgsasgsgsg 327 A-137864.1 ascsasusasdTs(5MdC)sdGs(5MdC)sdAs(5MdC)sdGs(5MdC)s(5MdC)sdTscsu- sgsasa 328 A-137865.1 ascsuscscsdTs(5MdC)s(5MdC)sdAsdTs(5MdC)s(5MdC)sdAs(5MdC)sdAsusa- suscsg 329 A-137866.1 ascsgsususdGsdTs(5MdC)sdAs(5MdC)sdTs(5MdC)sdAs(5MdC)sdTscscsusc- sc 330 A-137867.1 asasusgsasdAsdGsdGsdGsdTsdAs(5MdC)sdGsdTsdTsgsuscsasc 331 A-137868.1 gsususususdGsdGs(5MdC)sdAsdTs(5MdC)sdAsdAsdTsdGsasasgsgsg 332 A-137869.1 gsgsusgsasdTsdGsdGsdTsdTsdGsdTsdTsdTsdTsgsgscsasu 333 A-137870.1 asgsasasgsdGsdGsdGsdGsdAs(5MdC)sdAs(5MdC)sdGsdGsusgsasusg 334 A-137871.1 ascsuscscs(5MdC)s(5MdC)sdAsdTsdAsdGsdAsdAsdGsdGsgsgsgsasc 335 A-137872.1 gscsasgsasdTsdGsdTs(5MdC)sdGsdTsdAs(5MdC)sdTs(5MdC)scscscsasu 336 A-137873.1 ascsususgsdAs(5MdC)sdTsdTsdTsdAsdGsdGsdGs(5MdC)sasgsasusg 337 A-137874.1 asasasgsusdTs(5MdC)sdGsdTsdGsdGsdAs(5MdC)sdTsdTsgsascsusu 338 A-137875.1 cscsascsasdTsdGsdAsdAsdGsdAsdAsdAsdGsdTsuscsgsusg 339 A-137876.1 ususgsgsusdGsdAsdTsdGsdTs(5MdC)s(5MdC)sdAs(5MdC)sdAsusgsasasg 340 A-137877.1 csgsusasgsdAs(5MdC)sdTsdGsdAsdGs(5MdC)sdTsdTsdGsgsusgsasu 341 A-137878.1 csusgsusgs(5MdC)sdAsdGsdAsdGsdGs(5MdC)sdGsdTsdAsgsascsusg 342 A-137879.1 gsusasgsasdGsdGsdTsdTs(5MdC)s(5MdC)s(5MdC)sdTsdGsdTsgscsasgsa 343 A-137880.1 uscsgsasgsdAsdGsdAsdAsdGsdGsdTsdAsdGsdAsgsgsususc 344 A-137881.1 gsgsgsascsdAsdAsdAsdAsdGs(5MdC)sdTs(5MdC)sdTs(5MdC)sgsasgsasg 345 A-137882.1 usgsasgsasdTs(5MdC)s(5MdC)sdGsdGsdGsdGsdGsdGsdAscsasasasa 346 A-137883.1 cscsasgscsdAs(5MdC)s(5MdC)sdTsdTsdGsdAsdGsdAsdTscscsgsgsg 347 A-137884.1 asgsgscsasdTsdAsdTs(5MdC)sdTs(5MdC)sdTs(5MdC)s(5MdC)s(5MdC)sasg- scsasc 348 A-137885.1 usasuscscsdTs(5MdC)sdGsdAsdAsdGsdGs(5MdC)sdAsdTsasuscsusc 349 A-137886.1 gsasasusgs(5MdC)sdAsdTs(5MdC)s(5MdC)sdAsdAsdAsdTsdAsuscscsusc 350 A-137887.1 uscscsasasdGsdAsdAs(5MdC)s(5MdC)sdTsdGsdAsdAsdTsgscsasusc 351 A-137888.1 usgscscscsdTsdTs(5MdC)sdTs(5MdC)sdTsdTs(5MdC)s(5MdC)sdAsasgsasa- sc 352 A-137889.1 usgsususgs(5MdC)sdAsdGsdAsdTsdGs(5MdC)s(5MdC)s(5MdC)sdTsuscsusc- su 353 A-137890.1 csusgsgscsdTsdGsdGsdGsdGs(5MdC)s(5MdC)sdTsdGsdTsusgscsasg 354 A-137891.1 asusgsascsdTsdTs(5MdC)sdAsdGsdGs(5MdC)s(5MdC)sdTsdGsgscsusgsg 355 A-137892.1 cscscsusus(5MdC)sdTsdGsdAsdGsdGsdAsdTsdGsdAscsususcsa 356 A-137893.1 csasgsgsasdTs(5MdC)s(5MdC)sdAsdTs(5MdC)s(5MdC)s(5MdC)sdTsdTscsu- sgsasg 357 A-137894.1 asusgsgscsdGsdAs(5MdC)s(5MdC)sdTs(5MdC)sdAsdGsdGsdAsuscscsasu 358 A-137895.1 usgscscscsdAsdGs(5MdC)sdTsdGsdGsdGs(5MdC)sdAsdTsgsgscsgsa 359 A-137896.1 ascsuscsasdTsdGsdTsdTsdTsdGs(5MdC)s(5MdC)s(5MdC)sdAsgscsusgsg 360 A-137897.1 gsgsasasgsdAsdAsdTs(5MdC)s(5MdC)sdAsdGsdAs(5MdC)sdTscsasusgsu 361 A-137898.1 asgscscsgsdAs(5MdC)sdTs(5MdC)s(5MdC)sdGsdGsdGsdGsdAsasgsasasu 362 A-137899.1 ascsasgscs(5MdC)sdAsdAsdGsdGs(5MdC)sdAsdGs(5MdC)s(5MdC)sgsascsu- sc 363 A-137900.1 cscsuscscsdAsdGs(5MdC)s(5MdC)sdTs(5MdC)sdAs(5MdC)sdAsdGscscsasa- sg 364

A-137901.1 gscsuscsasdTs(5MdC)sdTs(5MdC)s(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)sdA- sgscscsusc 365 A-137902.1 asgsgsusgsdGsdTs(5MdC)sdTsdAsdGs(5MdC)sdAsdGs(5MdC)suscsasusc 366 A-137903.1 csusgsasgsdAs(5MdC)sdGs(5MdC)sdAsdGsdGsdTsdGsdGsuscsusasg 367 A-137904.1 asgsgsgscsdAsdGsdGsdAsdTsdGs(5MdC)sdTsdGsdAsgsascsgsc 368 A-137905.1 gscsuscsus(5MdC)sdAsdTs(5MdC)s(5MdC)s(5MdC)sdAsdGsdGsdGscsasgsg- sa 369 A-137906.1 gsusgsuscs(5MdC)sdAsdGsdGsdAsdTsdGs(5MdC)sdTs(5MdC)suscsasusc 370 A-137907.1 csusgsgsgs(5MdC)sdGsdAsdGsdAsdGsdGsdGsdTsdGsuscscsasg 371 A-137908.1 csusgsusasdGs(5MdC)sdGsdAsdGs(5MdC)s(5MdC)sdTsdGsdGsgscsgsasg 372 A-137909.1 uscsascsus(5MdC)sdAsdGsdTsdGs(5MdC)sdTsdGsdTsdAsgscsgsasg 373 A-137910.1 csusususcsdAsdTsdTsdTs(5MdC)sdTsdTs(5MdC)sdAs(5MdC)suscsasgsu 374 A-137911.1 asuscscsas(5MdC)s(5MdC)sdTsdTsdTsdGsdTs(5MdC)sdTsdTsuscsasusu 375 A-137912.1 ususgscsus(5MdC)sdAsdTsdGsdTsdAsdTs(5MdC)s(5MdC)sdAscscsususu 376 A-137913.1 asgsususgs(5MdC)sdAsdAsdAsdTs(5MdC)sdTsdTsdGs(5MdC)suscsasusg 377 A-137914.1 asasusgsgsdGsdTsdAsdGs(5MdC)sdAsdAsdGsdTsdTsgscsasasa 378 A-137915.1 asgsascsasdTsdTsdAsdTs(5MdC)s(5MdC)sdTsdAsdAsdTsgsgsgsusa 379 A-137916.1 asgscsasusdTsdAs(5MdC)sdAsdTsdAsdAsdGsdAs(5MdC)sasususasu 380 A-137917.1 asgsgsgsusdAs(5MdC)sdAsdGsdGsdGs(5MdC)sdAsdGs(5MdC)sasususasc 381 A-137918.1 asususcscsdAs(5MdC)sdAsdGsdGs(5MdC)sdAsdGsdGsdGsusascsasg 382 A-137919.1 csgscsasasdTsdGsdGs(5MdC)sdAsdGsdAsdTsdTs(5MdC)scsascsasg 383 A-137920.1 csusgsgsas(5MdC)sdAsdAsdTs(5MdC)sdGs(5MdC)sdAsdAsdTsgsgscsasg 384 A-137921.1 gsuscsascs(5MdC)sdAsdGsdTs(5MdC)sdTs(5MdC)sdTsdGsdGsascsasasu 385 A-137922.1 asuscsusgsdGsdAsdAsdGs(5MdC)s(5MdC)sdAsdTsdGsdTscsascscsa 386 A-137923.1 uscsgsuscsdGsdGsdGs(5MdC)sdAsdTsdAsdTs(5MdC)sdTsgsgsasasg 387 A-137924.1 csascsasgsdGsdAs(5MdC)sdAsdTs(5MdC)sdGsdTs(5MdC)sdGsgsgscsasu 388 A-137925.1 ascscscsas(5MdC)sdTsdGs(5MdC)sdAsdAs(5MdC)s(5MdC)sdAs(5MdC)sasg- sgsasc 389 A-137926.1 ascscsusgsdTsdGsdAsdGsdGsdTs(5MdC)sdAs(5MdC)s(5MdC)scsascsusg 390 A-137927.1 csuscsgsasdGsdTsdGsdAsdAs(5MdC)sdAs(5MdC)s(5MdC)sdTsgsusgsasg 391 A-137928.1 ascsasuscsdAsdGs(5MdC)sdAs(5MdC)sdTs(5MdC)sdGsdAsdGsusgsasasc 392 A-137929.1 gscsgsgsgsdGsdAsdGs(5MdC)sdAsdGsdAs(5MdC)sdAs(5MdC)sasuscsasg 393 A-137930.1 gsascscsusdGsdGsdAsdGsdGs(5MdC)sdGsdGsdGsdGsasgscsasg 394 A-137931.1 ascsusgsgs(5MdC)sdAsdTsdTsdTsdGsdGsdGsdAs(5MdC)scsusgsgsa 395 A-137932.1 ususgsgscsdTsdGs(5MdC)sdTs(5MdC)sdAs(5MdC)sdTsdGsdGscsasususu 396 A-137933.1 asusgsgsgsdGsdAsdGsdGs(5MdC)s(5MdC)sdTsdGsdTsdTsgsgscsusg 397 A-137934.1 uscsasgsgsdTsdGsdTsdGs(5MdC)sdAsdTsdGsdGsdGsgsasgsgsc 398 A-137935.1 gsgscscsasdGsdTs(5MdC)s(5MdC)sdTsdGs(5MdC)sdTs(5MdC)sdAsgsgsusg- su 399 A-137936.1 gsasgsuscs(5MdC)sdAsdGs(5MdC)sdAsdGsdGsdGs(5MdC)s(5MdC)sasgsusc- sc 400 A-137937.1 gsgsgsasgs(5MdC)sdAsdGsdGsdGsdAsdGsdTs(5MdC)s(5MdC)sasgscsasg 401 A-137938.1 ascsasgscs(5MdC)s(5MdC)sdTsdTsdGsdGsdGsdGsdGsdAsgscsasgsg 402 A-137939.1 gsuscsuscsdTsdGs(5MdC)sdTsdGsdGsdAs(5MdC)sdAsdGscscscsusu 403 A-137940.1 gscscsuscsdTsdGs(5MdC)sdTsdTsdTsdGsdGsdTs(5MdC)suscsusgsc 404 A-137941.1 cscsgscsgsdGsdGsdGsdTsdGsdGs(5MdC)s(5MdC)sdTs(5MdC)susgscsusu 405 A-137942.1 ascscsusgsdAsdGsdGsdAsdTsdGsdGsdAs(5MdC)s(5MdC)sgscsgsgsg 406 A-137943.1 gsususcsasdGsdGs(5MdC)sdTsdGsdGsdAs(5MdC)s(5MdC)sdTsgsasgsgsa 407 A-137944.1 cscsasasgsdAsdAsdGsdAsdAsdGsdTsdTs(5MdC)sdAsgsgscsusg 408 A-137945.1 gsusascsusdTsdTsdAsdTsdTsdGs(5MdC)s(5MdC)s(5MdC)sdAsasgsasasg 409 A-137946.1 asgscsascs(5MdC)sdAsdGs(5MdC)sdAsdGsdGsdTsdAs(5MdC)susususasu 410 A-137947.1 gsasgsasgs(5MdC)s(5MdC)s(5MdC)s(5MdC)sdTs(5MdC)sdAsdGs(5MdC)sdA- scscsasgsc 411 A-137948.1 gsgsasasasdGsdGsdTsdGsdGsdAsdGsdAsdGs(5MdC)scscscsusc 412 A-137949.1 asgsusgsasdAsdAsdAsdAs(5MdC)sdTsdGsdGsdGsdAsasasgsgsu 413 A-137950.1 ascsuscsusdTs(5MdC)sdTs(5MdC)sdTsdAsdGsdTsdGsdAsasasasasc 414 A-137951.1 asasgsusgsdAs(5MdC)sdTs(5MdC)sdAs(5MdC)sdAsdGsdAs(5MdC)suscsusu- sc 415 A-137952.1 csuscsgscs(5MdC)sdTs(5MdC)s(5MdC)sdTs(5MdC)sdAsdAsdGsdTsgsascsu- sc 416 A-137953.1 uscsusgscsdTsdAsdGsdAs(5MdC)sdTs(5MdC)sdGs(5MdC)s(5MdC)suscscsu- sc 417 A-137954.1 ascscsuscsdTsdGsdAsdAsdAsdGsdAsdAsdTs(5MdC)susgscsusa 418 A-137955.1 asasascsusdTsdTsdAsdGs(5MdC)sdAs(5MdC)s(5MdC)sdTs(5MdC)susgsasa- sa 419 A-137956.1 ascsasasasdGsdAsdTsdGsdGsdGsdAsdAsdAs(5MdC)susususasg 420 A-137957.1 gsgsasgsgsdTsdAsdGs(5MdC)sdTsdGs(5MdC)sdAs(5MdC)sdAsasasgsasu 421 A-137958.1 csasgscsasdAsdTsdGs(5MdC)sdGsdGsdAsdGsdGsdTsasgscsusg 422 A-137959.1 asgsgsgsgsdTs(5MdC)sdAs(5MdC)sdTsdAs(5MdC)sdAs(5MdC)sdAsgscsasa- su 423 A-137960.1 ascsgsuscsdAs(5MdC)sdAsdGsdGs(5MdC)sdAsdGsdGsdGsgsuscsasc 424 A-137961.1 usgsgsgsasdTs(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)sdAs(5MdC)sdGsdTscsa- scsasg 425 A-137962.1 gscsuscsasdGsdAsdGsdGs(5MdC)sdTsdGsdGsdGsdAsuscscsusc 426 A-137963.1 asasascscsdAsdAs(5MdC)sdTs(5MdC)sdAsdGs(5MdC)sdTs(5MdC)sasgsasg- sg 427 A-137964.1 usasgscsusdTsdTsdTs(5MdC)sdAsdTsdAsdAsdAsdAscscsasasc 428 A-137965.1 asgsgsususdGs(5MdC)sdTsdTs(5MdC)s(5MdC)sdTsdAsdGs(5MdC)susususu- sc 429 A-137966.1 ascsasgsgs(5MdC)sdGsdAsdAsdAsdGsdGsdTsdTsdGscsususcsc 430 A-137967.1 usgsgsascs(5MdC)sdGs(5MdC)sdTsdGs(5MdC)sdAs(5MdC)sdAsdGsgscsgsa- sa 431 A-137968.1 asgsasgsusdTsdAsdAsdGsdTsdGs(5MdC)sdTsdGsdGsascscsgsc 432 A-137969.1 gscsusgsasdTsdGsdTsdAsdTsdTsdAsdGsdAsdGsususasasg 433 A-137970.1 asususasas(5MdC)sdGs(5MdC)sdAsdTsdGs(5MdC)sdTsdGsdAsusgsusasu 434 A-137971.1 cscsasascs(5MdC)sdAsdGs(5MdC)sdTsdGsdAsdAsdTsdTsasascsgsc 435 A-137972.1 gsgsusgsus(5MdC)sdAsdTsdTsdTs(5MdC)s(5MdC)s(5MdC)sdAsdAscscsasg- sc 436 A-137973.1 usgsgsgscsdTsdTs(5MdC)s(5MdC)sdTsdGsdGsdTsdGsdTscsasususu 437 A-137974.1 gsascscscsdTs(5MdC)sdTsdGs(5MdC)sdAs(5MdC)sdTsdGsdGsgscsususc 438 A-137975.1 asgsuscsasdGsdTsdAsdAsdGsdGsdGsdAs(5MdC)s(5MdC)scsuscsusg 439 A-137976.1 gscscsascsdGsdAsdAsdAs(5MdC)sdAsdGsdTs(5MdC)sdAsgsusasasg 440 A-137977.1 cscsasususdAsdAsdTsdAsdGsdGsdGs(5MdC)s(5MdC)sdAscsgsasasa 441 A-137978.1 gsgsasascsdAsdGsdTs(5MdC)sdTsdGsdAs(5MdC)s(5MdC)sdAsususasasu 442 A-137979.1 ascscsuscsdAsdTsdGs(5MdC)sdTsdGsdGsdAsdAs(5MdC)sasgsuscsu 443 A-137980.1 usgsuscsasdTsdTs(5MdC)sdTsdAsdAsdGsdAsdAs(5MdC)scsuscsasu 444 A-137981.1 cscsasasas(5MdC)sdAs(5MdC)s(5MdC)sdTsdGsdTs(5MdC)sdAsdTsuscsusa- sa 445 A-137982.1 gscscscscs(5MdC)sdAs(5MdC)s(5MdC)s(5MdC)sdAsdTs(5MdC)s(5MdC)sdA- sasascsasc 446 A-137983.1 cscscscsasdTs(5MdC)sdAs(5MdC)sdAsdAsdGsdGs(5MdC)s(5MdC)scscscsa- sc 447 A-137984.1 csasgscscsdTsdAs(5MdC)s(5MdC)s(5MdC)s(5MdC)s(5MdC)s(5MdC)sdAsdT- scsascsasa 448 A-137985.1 uscsascsas(5MdC)sdAsdTsdGsdGsdGs(5MdC)s(5MdC)sdAsdGscscsusasc 449 A-137986.1 csascscscs(5MdC)sdAs(5MdC)sdAsdAsdGsdAsdTs(5MdC)sdAscsascsasu 450 A-137987.1 uscsususcs(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)sdAs(5MdC)s(5MdC)s(5MdC- )s(5MdC)sascsasasg 451 A-137988.1 uscsasusgs(5MdC)sdTsdAsdTsdTs(5MdC)sdTs(5MdC)sdTsdTscscscsusc 452 A-137989.1 gsgsgsasasdGsdTsdGsdGsdGsdAsdTs(5MdC)sdAsdTsgscsusasu 453 A-137990.1 uscscscsas(5MdC)sdAsdGs(5MdC)sdAsdTsdGsdGsdGsdGsasasgsusg 454 A-137991.1 ascsusgscsdAs(5MdC)s(5MdC)s(5MdC)s(5MdC)sdTsdTs(5MdC)s(5MdC)s(5- MdC)sascsasgsc 455 A-137992.1 uscsususgsdGsdGsdGsdAs(5MdC)sdGsdAsdAs(5MdC)sdTsgscsascsc 456 A-137993.1 gscsasgsusdGsdTs(5MdC)sdGsdTsdTs(5MdC)sdTsdTsdGsgsgsgsasc 457 A-137994.1 ascscsascs(5MdC)sdTsdGsdAs(5MdC)sdAsdGsdGs(5MdC)sdAsgsusgsusc 458 A-137995.1 asuscsususdTsdGs(5MdC)sdAsdGsdAs(5MdC)s(5MdC)sdAs(5MdC)scsusgsa- sc 459 A-137996.1 csasasgsgsdTsdTsdAsdTs(5MdC)sdAsdTs(5MdC)sdTsdTsusgscsasg 460 A-137997.1 gsususususdTsdAsdGsdTsdAsdGsdTs(5MdC)sdAsdAsgsgsususa 461 A-137998.1 csgscscsasdTsdGsdGsdAsdGsdAs(5MdC)sdGsdTsdTsusususasg 462 A-137999.1 csususgsusdTsdAs(5MdC)s(5MdC)s(5MdC)s(5MdC)s(5MdC)sdGs(5MdC)s(5- MdC)sasusgsgsa 463

A-138000.1 asgsasususdAsdTs(5MdC)sdAsdTs(5MdC)sdTsdTsdGsdTsusascscsc 464 A-138001.1 asasasasusdTsdAsdAsdGsdTsdAsdGsdAsdTsdTsasuscsasu 465 A-138002.1 asasasgsgsdTsdGsdTsdTs(5MdC)sdTsdAsdAsdAsdAsususasasg 466 A-138003.1 asgsususasdGsdGsdTsdGsdAsdAsdAsdAsdAsdGsgsusgsusu 467 A-138004.1 asasascsasdTsdTsdAsdTsdTsdTsdTsdAsdGsdTsusasgsgsu 468 A-138005.1 asasasascsdTs(5MdC)sdTsdTsdTsdAsdAsdAs(5MdC)sdAsususasusu 469 A-138006.1 ascsasususdTsdTsdTsdAsdTsdAs(5MdC)sdAsdAsdAsascsuscsu 470 A-138007.1 asascsgscsdTsdTs(5MdC)s(5MdC)sdTsdTsdAs(5MdC)sdAsdTsususususa 471 A-138008.1 asascsasgsdGsdTsdAsdAs(5MdC)sdAsdAs(5MdC)sdGs(5MdC)sususcscsu 472 A-138009.1 asusascsasdAsdAsdAsdTsdTs(5MdC)sdAsdAs(5MdC)sdAsgsgsusasa 473 A-138010.1 ascsusgsasdTsdTs(5MdC)sdAs(5MdC)sdAsdTsdAsdAsdTsascsasasa 474 A-138011.1 ascsusasas(5MdC)sdAsdTs(5MdC)sdTs(5MdC)sdAs(5MdC)sdTsdGsasususc- sa 475 A-138012.1 asgsgscsusdTsdAsdTsdTs(5MdC)sdTsdAs(5MdC)sdTsdAsascsasusc 476 A-138013.1 usususususdTsdTsdTsdTsdTsdAsdAsdGsdGs(5MdC)sususasusu 477 A-138014.1 asascscsgsdAsdTsdTsdTsdTsdTsdTsdTsdTsdTsususususa 478 A-138015.1 cscsascsusdGs(5MdC)sdAs(5MdC)s(5MdC)s(5MdC)sdAsdAs(5MdC)s(5MdC)- sgsasususu 479 A-138016.1 ascsasgscs(5MdC)sdGsdTsdGsdTsdGs(5MdC)s(5MdC)sdAs(5MdC)susgscsa- sc 480 A-138017.1 asasgsusgs(5MdC)sdTsdGsdGsdGsdAsdTsdTsdAs(5MdC)sasgscscsg 481 A-138018.1 ususgsgscs(5MdC)sdTs(5MdC)s(5MdC)s(5MdC)sdAsdAsdAsdGsdTsgscsusg- sg 482 A-138019.1 asuscsusgs(5MdC)s(5MdC)sdAsdAs(5MdC)s(5MdC)sdTsdTsdGsdGscscsusc- sc 483 A-138020.1 ascscsuscsdAsdGsdGsdTsdGsdAsdTs(5MdC)sdTsdGscscsasasc 484 A-138021.1 csususgsasdAs(5MdC)sdTs(5MdC)s(5MdC)sdTsdGsdAs(5MdC)s(5MdC)susc- sasgsg 485 A-138022.1 cscsasgsas(5MdC)sdTsdGsdGsdTs(5MdC)sdTsdTsdGsdAsascsuscsc 486 A-138023.1 usgscsusasdTsdGsdTsdTsdGsdGs(5MdC)s(5MdC)sdAsdGsascsusgsg 487 A-138024.1 gsascsasgsdGsdGsdTsdTsdTsdTsdGs(5MdC)sdTsdAsusgsususg 488 A-138025.1 asususususdTsdAsdGsdTsdAsdGsdAsdGsdAs(5MdC)sasgsgsgsu 489 A-138026.1 asusasasusdTsdTsdTsdTsdGsdTsdAsdTsdTsdTsususasgsu 490 A-138027.1 ascscsasusdGs(5MdC)s(5MdC)s(5MdC)sdAsdGsdAsdTsdAsdAsususususu 491 A-138028.1 asgsgscsasdTsdGs(5MdC)sdAs(5MdC)s(5MdC)sdAs(5MdC)s(5MdC)sdAsusg- scscsc 492 A-138029.1 asgscsusgsdGsdGsdAsdTsdTsdAs(5MdC)sdAsdGsdGscsasusgsc 493 A-138030.1 csususcscsdGsdAsdAsdTsdAsdGs(5MdC)sdTsdGsdGsgsasususa 494 A-138031.1 cscsusgscs(5MdC)sdTs(5MdC)sdAsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)scsg- sasasu 495 A-138032.1 uscsasasgsdTsdGsdAsdTsdTs(5MdC)sdTs(5MdC)s(5MdC)sdTsgscscsusc 496 A-138033.1 cscsuscscsdTsdGsdGsdGsdTsdTs(5MdC)sdAsdAsdGsusgsasusu 497 A-138034.1 cscsgscsasdAs(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)sdGs(5MdC)s(5MdC)sdT- scscsusgsg 498 A-138035.1 asasuscsus(5MdC)sdAsdGs(5MdC)sdTs(5MdC)sdAs(5MdC)s(5MdC)sdGscsa- sascsc 499 A-138036.1 usgsasasasdTsdGsdGsdTsdGs(5MdC)sdAsdAsdTs(5MdC)suscsasgsc 500 A-138037.1 asgsgscsusdGsdGsdAsdAsdTsdGsdAsdAsdAsdTsgsgsusgsc 501 A-138038.1 ascsuscsasdTsdGsdTsdTsdGs(5MdC)s(5MdC)s(5MdC)sdAsdGsgscsusgsg 502 A-138039.1 uscsasgsas(5MdC)sdTsdTsdTs(5MdC)sdAs(5MdC)sdTs(5MdC)sdAsusgsusu- sg 503 A-138040.1 usususususdTsdTsdTsdTsdGsdAsdGsdTs(5MdC)sdAsgsascsusu 504 A-138041.1 ususususasdAsdAsdTsdTsdTsdTsdTsdTsdTsdTsususususg 505 A-138042.1 gsasususasdTsdTsdTsdTsdGsdTsdTsdTsdTsdTsusasasasu 506 A-138043.1 csusgscsas(5MdC)sdAs(5MdC)sdTsdAsdGsdAsdTsdTsdAsususususg 507 A-138044.1 asgsgsusgsdAsdAsdTsdGs(5MdC)s(5MdC)s(5MdC)sdTsdGs(5MdC)sascsasc- su 508 A-138045.1 usgsgsgsgsdGsdGs(5MdC)sdTsdGsdAsdGsdGsdTsdGsasasusgsc 509 A-138046.1 csususgsgs(5MdC)sdTs(5MdC)s(5MdC)sdTsdGs(5MdC)s(5MdC)sdTsdGsgsg- sgsgsg 510 A-138047.1 cscsusgscsdTsdGsdTsdGs(5MdC)sdTsdTsdGsdGs(5MdC)suscscsusg 511 A-138048.1 asgsgscsgsdGsdAsdAsdGs(5MdC)sdTs(5MdC)s(5MdC)sdTsdGscsusgsusg 512 A-138049.1 csasgsusgsdGsdAsdGsdAsdGsdGsdAsdGsdGs(5MdC)sgsgsasasg 513 A-138050.1 asgsususgsdTsdGsdTsdGs(5MdC)sdTs(5MdC)s(5MdC)sdAsdGsusgsgsasg 514 A-138051.1 asgscscsasdGsdGsdTsdTs(5MdC)sdAsdAsdGsdTsdTsgsusgsusg 515 A-138052.1 gscsasgsasdAsdAsdAsdTsdAsdAsdGs(5MdC)s(5MdC)sdAsgsgsususc 516 A-138053.1 gsgsgsgscsdTsdGsdGsdTs(5MdC)s(5MdC)s(5MdC)sdTsdGs(5MdC)sasgsasa- sa 517 A-138054.1 ascsusgsas(5MdC)s(5MdC)sdAsdTsdGsdTsdGsdGsdGsdGscsusgsgsu 518 A-138055.1 gsgsasgsasdAsdAs(5MdC)sdTs(5MdC)sdAs(5MdC)sdTsdGsdAscscsasusg 519 A-138056.1 csgscscsas(5MdC)sdAs(5MdC)sdAsdTsdGsdGsdGsdGsdAsgsasasasc 520 A-138057.1 ascsuscsus(5MdC)sdTs(5MdC)sdAsdTs(5MdC)sdGs(5MdC)s(5MdC)sdAscsa- scsasu 521 A-138058.1 csusususasdTsdTsdTs(5MdC)sdTsdAs(5MdC)sdAs(5MdC)sdTscsuscsusc 522

TABLE-US-00005 TABLE 5 PNPLA3 Single Dose Screen in HuH7 Cells. Oligo Name Avg. 500 nM SD A-133284.1 51.5 11.4 A-133285.1 54.9 9.0 A-133286.1 49.7 11.0 A-133287.1 36.3 4.7 A-133288.1 31.5 5.0 A-133289.1 27.4 2.5 A-133290.1 57.2 16.1 A-133291.1 56.5 8.5 A-133292.1 32.6 2.2 A-133293.1 42.1 4.1 A-133294.1 57.1 32.5 A-133295.1 40.2 12.6 A-133296.1 58.6 28.7 A-133297.1 54.2 19.7 A-133298.1 35.2 10.8 A-133299.1 42.2 8.4 A-133300.1 24.9 4.2 A-133301.1 47.7 5.7 A-133302.1 70.2 10.7 A-133303.1 45.0 3.9 A-133304.1 33.9 8.3 A-133305.1 25.2 8.5 A-133306.1 36.1 10.9 A-133307.1 84.0 24.6 A-133308.1 49.4 8.0 A-133309.1 56.4 3.6 A-133310.1 49.1 6.6 A-133311.1 51.4 3.4 A-133312.1 31.3 3.5 A-133313.1 52.5 4.1 A-133314.1 71.1 8.8 A-133315.1 70.0 22.7 A-133316.1 78.5 35.3 A-133317.1 59.1 21.4 A-133318.1 46.2 12.9 A-133319.1 50.0 9.3 A-133320.1 45.1 9.1 A-133321.1 45.3 3.6 A-133322.1 38.0 4.1 A-133323.1 40.7 5.5 A-133324.1 31.8 8.4 A-133325.1 37.1 8.7 A-133326.1 40.9 5.6 A-133327.1 38.4 4.4 A-133328.1 21.3 3.5 A-133329.1 34.7 4.4 A-133330.1 53.5 10.4 A-133331.1 65.0 10.9 A-133332.1 62.3 6.9 A-133333.1 58.8 5.7 A-133334.1 76.6 9.2 A-133335.1 70.0 5.1 A-133336.1 63.7 4.3 A-133337.1 71.7 3.7 A-133338.1 77.7 18.3 A-133339.1 42.0 5.2 A-133340.1 48.0 11.6 A-133341.1 33.7 6.3 A-133342.1 36.8 10.4 A-133343.1 53.0 11.8 A-133344.1 71.7 9.1 A-133345.1 71.9 22.0 A-133346.1 45.5 6.4 A-133347.1 57.7 10.5 A-133348.1 37.2 6.6 A-133349.1 57.8 10.3 A-133350.1 83.7 17.1 A-133351.1 52.1 6.4 A-133352.1 34.1 4.0 A-133353.1 46.3 3.1 A-133354.1 52.0 2.2 A-133355.1 36.4 3.9 A-133356.1 41.0 7.0 A-133357.1 44.9 5.0 A-133358.1 69.8 3.8 A-133359.1 53.0 3.9 A-133360.1 35.0 2.3 A-133361.1 34.2 2.4 A-133362.1 69.5 4.5 A-133363.1 49.3 4.0 A-133364.1 20.0 3.6 A-133365.1 36.4 4.8 A-133366.1 27.3 2.2 A-133367.1 35.8 6.7 A-133368.1 26.1 3.9 A-133369.1 24.1 5.6 A-133370.1 46.7 6.2 A-133371.1 22.9 4.2 A-133372.1 20.9 4.7 A-133373.1 39.4 4.2 A-133374.1 85.2 8.4 A-133375.1 49.3 3.8 A-133376.1 83.1 9.1 A-133377.1 38.6 5.0 A-133378.1 32.4 6.1 A-133379.1 48.3 15.0 A-133380.1 44.5 14.6 A-133381.1 41.8 14.5 A-133382.1 62.5 23.6 A-133383.1 62.8 19.5 A-133384.1 36.0 6.8 A-133385.1 34.3 5.6 A-133386.1 44.9 11.8 A-133387.1 60.1 11.0 A-133388.1 71.6 14.4 A-133389.1 67.0 13.3 A-133390.1 38.7 8.9 A-133391.1 20.2 4.6 A-133392.1 18.0 3.3 A-133393.1 15.6 2.3 A-133394.1 98.3 10.1 A-133395.1 39.0 3.2 A-133396.1 23.4 7.0 A-133397.1 80.4 7.9 A-133398.1 64.8 9.7 A-133399.1 86.8 17.9 A-133400.1 63.1 6.9 A-133401.1 24.0 5.6 A-133402.1 15.8 1.0 A-133403.1 53.5 6.7 A-133404.1 50.3 7.4 A-133405.1 47.0 6.8 A-133406.1 72.1 11.9 A-133407.1 57.1 13.2 A-133408.1 60.2 11.7 A-133409.1 42.2 9.4 A-133410.1 79.8 15.8 A-133411.1 77.7 15.1 A-133412.1 28.6 5.5 A-133413.1 96.3 8.5 A-133414.1 65.0 7.8 A-133415.1 28.3 2.7 A-133416.1 62.7 12.2 A-133417.1 71.1 6.6 A-133418.1 74.8 14.2 A-133419.1 49.4 6.9 A-133420.1 82.6 19.7 A-133421.1 38.0 7.2 A-133422.1 78.3 13.6 A-133423.1 47.7 8.4 A-133424.1 41.9 9.8 A-133425.1 14.0 4.0 A-133426.1 25.3 6.3 A-133427.1 41.8 7.3 A-133428.1 42.6 6.7 A-133429.1 62.0 3.1 A-133430.1 44.3 4.0 A-133431.1 78.5 5.9 A-133432.1 62.7 9.5 A-133433.1 51.0 9.8 A-133434.1 35.3 2.8 A-133435.1 59.0 1.9 A-133436.1 88.7 11.0 A-133437.1 81.0 11.4 A-133438.1 55.3 3.7 A-133439.1 37.6 6.4

Sequence CWU 1

1

52212805DNAHomo sapiens 1atggtccgag gggggcgggg ctgacgtcgc gctgggaatg ccctggccga gacactgagg 60cagggtagag agcgcttgcg ggcgccgggc ggagctgctg cggatcagga cccgagccga 120ttcccgatcc cgacccagat cctaacccgc gcccccgccc cgccgccgcc gccatgtacg 180acgcagagcg cggctggagc ttgtccttcg cgggctgcgg cttcctgggc ttctaccacg 240tcggggcgac ccgctgcctg agcgagcacg ccccgcacct cctccgcgac gcgcgcatgt 300tgttcggcgc ttcggccggg gcgttgcact gcgtcggcgt cctctccggt atcccgctgg 360agcagactct gcaggtcctc tcagatcttg tgcggaaggc caggagtcgg aacattggca 420tcttccatcc atccttcaac ttaagcaagt tcctccgaca gggtctctgc aaatgcctcc 480cggccaatgt ccaccagctc atctccggca aaataggcat ctctcttacc agagtgtctg 540atggggaaaa cgttctggtg tctgactttc ggtccaaaga cgaagtcgtg gatgccttgg 600tatgttcctg cttcatcccc ttctacagtg gccttatccc tccttccttc agaggcgtgc 660gatatgtgga tggaggagtg agtgacaacg tacccttcat tgatgccaaa acaaccatca 720ccgtgtcccc cttctatggg gagtacgaca tctgccctaa agtcaagtcc acgaactttc 780ttcatgtgga catcaccaag ctcagtctac gcctctgcac agggaacctc taccttctct 840cgagagcttt tgtccccccg gatctcaagg tgctgggaga gatatgcctt cgaggatatt 900tggatgcatt caggttcttg gaagagaagg gcatctgcaa caggccccag ccaggcctga 960agtcatcctc agaagggatg gatcctgagg tcgccatgcc cagctgggca aacatgagtc 1020tggattcttc cccggagtcg gctgccttgg ctgtgaggct ggagggagat gagctgctag 1080accacctgcg tctcagcatc ctgccctggg atgagagcat cctggacacc ctctcgccca 1140ggctcgctac agcactgagt gaagaaatga aagacaaagg tggatacatg agcaagattt 1200gcaacttgct acccattagg ataatgtctt atgtaatgct gccctgtacc ctgcctgtgg 1260aatctgccat tgcgattgtc cagagactgg tgacatggct tccagatatg cccgacgatg 1320tcctgtggtt gcagtgggtg acctcacagg tgttcactcg agtgctgatg tgtctgctcc 1380ccgcctccag gtcccaaatg ccagtgagca gccaacaggc ctccccatgc acacctgagc 1440aggactggcc ctgctggact ccctgctccc ccaagggctg tccagcagag accaaagcag 1500aggccacccc gcggtccatc ctcaggtcca gcctgaactt cttcttgggc aataaagtac 1560ctgctggtgc tgaggggctc tccacctttc ccagtttttc actagagaag agtctgtgag 1620tcacttgagg aggcgagtct agcagattct ttcagaggtg ctaaagtttc ccatctttgt 1680gcagctacct ccgcattgct gtgtagtgac ccctgcctgt gacgtggagg atcccagcct 1740ctgagctgag ttggttttat gaaaagctag gaagcaacct ttcgcctgtg cagcggtcca 1800gcacttaact ctaatacatc agcatgcgtt aattcagctg gttgggaaat gacaccagga 1860agcccagtgc agagggtccc ttactgactg tttcgtggcc ctattaatgg tcagactgtt 1920ccagcatgag gttcttagaa tgacaggtgt ttggatgggt gggggccttg tgatgggggg 1980taggctggcc catgtgtgat cttgtggggt ggagggaaga gaatagcatg atcccacttc 2040cccatgctgt gggaaggggt gcagttcgtc cccaagaacg acactgcctg tcaggtggtc 2100tgcaaagatg ataaccttga ctactaaaaa cgtctccatg gcgggggtaa caagatgata 2160atctacttaa ttttagaaca cctttttcac ctaactaaaa taatgtttaa agagttttgt 2220ataaaaatgt aaggaagcgt tgttacctgt tgaattttgt attatgtgaa tcagtgagat 2280gttagtagaa taagccttaa aaaaaaaaaa atcggttggg tgcagtggca cacggctgta 2340atcccagcac tttgggaggc caaggttggc agatcacctg aggtcaggag ttcaagacca 2400gtctggccaa catagcaaaa ccctgtctct actaaaaata caaaaattat ctgggcatgg 2460tggtgcatgc ctgtaatccc agctattcgg aaggctgagg caggagaatc acttgaaccc 2520aggaggcgga ggttgcggtg agctgagatt gcaccatttc attccagcct gggcaacatg 2580agtgaaagtc tgactcaaaa aaaaaaaatt taaaaaacaa aataatctag tgtgcagggc 2640attcacctca gccccccagg caggagccaa gcacagcagg agcttccgcc tcctctccac 2700tggagcacac aacttgaacc tggcttattt tctgcaggga ccagccccac atggtcagtg 2760agtttctccc catgtgtggc gatgagagag tgtagaaata aagac 280522805DNAHomo sapiens 2gtctttattt ctacactctc tcatcgccac acatggggag aaactcactg accatgtggg 60gctggtccct gcagaaaata agccaggttc aagttgtgtg ctccagtgga gaggaggcgg 120aagctcctgc tgtgcttggc tcctgcctgg ggggctgagg tgaatgccct gcacactaga 180ttattttgtt ttttaaattt tttttttttg agtcagactt tcactcatgt tgcccaggct 240ggaatgaaat ggtgcaatct cagctcaccg caacctccgc ctcctgggtt caagtgattc 300tcctgcctca gccttccgaa tagctgggat tacaggcatg caccaccatg cccagataat 360ttttgtattt ttagtagaga cagggttttg ctatgttggc cagactggtc ttgaactcct 420gacctcaggt gatctgccaa ccttggcctc ccaaagtgct gggattacag ccgtgtgcca 480ctgcacccaa ccgatttttt tttttttaag gcttattcta ctaacatctc actgattcac 540ataatacaaa attcaacagg taacaacgct tccttacatt tttatacaaa actctttaaa 600cattatttta gttaggtgaa aaaggtgttc taaaattaag tagattatca tcttgttacc 660cccgccatgg agacgttttt agtagtcaag gttatcatct ttgcagacca cctgacaggc 720agtgtcgttc ttggggacga actgcacccc ttcccacagc atggggaagt gggatcatgc 780tattctcttc cctccacccc acaagatcac acatgggcca gcctaccccc catcacaagg 840cccccaccca tccaaacacc tgtcattcta agaacctcat gctggaacag tctgaccatt 900aatagggcca cgaaacagtc agtaagggac cctctgcact gggcttcctg gtgtcatttc 960ccaaccagct gaattaacgc atgctgatgt attagagtta agtgctggac cgctgcacag 1020gcgaaaggtt gcttcctagc ttttcataaa accaactcag ctcagaggct gggatcctcc 1080acgtcacagg caggggtcac tacacagcaa tgcggaggta gctgcacaaa gatgggaaac 1140tttagcacct ctgaaagaat ctgctagact cgcctcctca agtgactcac agactcttct 1200ctagtgaaaa actgggaaag gtggagagcc cctcagcacc agcaggtact ttattgccca 1260agaagaagtt caggctggac ctgaggatgg accgcggggt ggcctctgct ttggtctctg 1320ctggacagcc cttgggggag cagggagtcc agcagggcca gtcctgctca ggtgtgcatg 1380gggaggcctg ttggctgctc actggcattt gggacctgga ggcggggagc agacacatca 1440gcactcgagt gaacacctgt gaggtcaccc actgcaacca caggacatcg tcgggcatat 1500ctggaagcca tgtcaccagt ctctggacaa tcgcaatggc agattccaca ggcagggtac 1560agggcagcat tacataagac attatcctaa tgggtagcaa gttgcaaatc ttgctcatgt 1620atccaccttt gtctttcatt tcttcactca gtgctgtagc gagcctgggc gagagggtgt 1680ccaggatgct ctcatcccag ggcaggatgc tgagacgcag gtggtctagc agctcatctc 1740cctccagcct cacagccaag gcagccgact ccggggaaga atccagactc atgtttgccc 1800agctgggcat ggcgacctca ggatccatcc cttctgagga tgacttcagg cctggctggg 1860gcctgttgca gatgcccttc tcttccaaga acctgaatgc atccaaatat cctcgaaggc 1920atatctctcc cagcaccttg agatccgggg ggacaaaagc tctcgagaga aggtagaggt 1980tccctgtgca gaggcgtaga ctgagcttgg tgatgtccac atgaagaaag ttcgtggact 2040tgactttagg gcagatgtcg tactccccat agaaggggga cacggtgatg gttgttttgg 2100catcaatgaa gggtacgttg tcactcactc ctccatccac atatcgcacg cctctgaagg 2160aaggagggat aaggccactg tagaagggga tgaagcagga acataccaag gcatccacga 2220cttcgtcttt ggaccgaaag tcagacacca gaacgttttc cccatcagac actctggtaa 2280gagagatgcc tattttgccg gagatgagct ggtggacatt ggccgggagg catttgcaga 2340gaccctgtcg gaggaacttg cttaagttga aggatggatg gaagatgcca atgttccgac 2400tcctggcctt ccgcacaaga tctgagagga cctgcagagt ctgctccagc gggataccgg 2460agaggacgcc gacgcagtgc aacgccccgg ccgaagcgcc gaacaacatg cgcgcgtcgc 2520ggaggaggtg cggggcgtgc tcgctcaggc agcgggtcgc cccgacgtgg tagaagccca 2580ggaagccgca gcccgcgaag gacaagctcc agccgcgctc tgcgtcgtac atggcggcgg 2640cggcggggcg ggggcgcggg ttaggatctg ggtcgggatc gggaatcggc tcgggtcctg 2700atccgcagca gctccgcccg gcgcccgcaa gcgctctcta ccctgcctca gtgtctcggc 2760cagggcattc ccagcgcgac gtcagccccg cccccctcgg accat 280534649DNAMus musculus 3agagcagcaa caccgggagc agagctgaac tgcagcgccg cccggagctt caagcaccat 60gtatgaccca gagcgccgct ggagcctgtc gtttgcaggc tgcggcttcc tgggcttcta 120ccacgtcggg gctacgctat gtctgagcga gcgcgccccg cacctcctcc gcgatgcgcg 180cactttcttt ggctgctcgg ccggtgcact gcacgcggtc accttcgtgt gcagtctccc 240tctcggccgt ataatggaga tcctcatgga cctcgtgcgg aaagccagga gccgcaacat 300cggcaccctc cacccgttct tcaacattaa caagtgcatc agagacgggc tccaggagag 360cctcccagac aatgtccacc aggtcatttc tggcaaggtt cacatctcac tcaccagggt 420gtcggatggg gagaacgtgc tggtgtctga gttccattcc aaagacgaag tcgtggatgc 480cctggtgtgt tcctgcttca ttcccctctt ctctggccta atccctcctt ccttccgagg 540cgagcggtac gtggacggag gagtgagcga caacgtccct gtgctggatg ccaaaaccac 600catcacggtg tcacctttct acggtgagca tgacatctgc cccaaagtca agtccaccaa 660cttcttccac gtgaatatca ccaacctcag cctccgcctc tgcactggga acctccaact 720tctgaccaga gcgctcttcc cgtctgatgt gaaggtgatg ggagagctgt gctatcaagg 780gtacctggac gccttccggt tcctggagga gaatggcatc tgtaacgggc cacagcgcag 840cctgagtctg tccttggtgg cgccagaagc ctgcttggaa aatggcaaac ttgtgggaga 900caaggtgcca gtcagcctat gctttacaga tgagaacatc tgggagacac tgtcccccga 960gctcagcaca gctctgagtg aagcgattaa ggacagggag ggctacctga gcaaagtctg 1020caacctcctg cccgtcagga tcctgtccta catcatgctg ccctgcagtc tgcccgtgga 1080gtcggctatc gctgcagtcc acaggctggt gacatggctc cctgatatcc aggatgatat 1140ccagtggcta caatgggcga catcccaggt ttgtgcccga atgacgatgt gcctgctccc 1200ctctaccagg taaatacttg ggcccagggt gtgtgggcca gataggcatc cctcccggtt 1260gttcccagag ctcttagggt cagagcttgg gtggtgacag ccttaacaag ccaggctcag 1320ccgcctgtcc ccagcatgcc attaaagaaa ccggtagcag agaaagcagg tttattcgaa 1380tataaaaagg ttcaagcccc cacccggtta atctttaaga taccaacagg aggcttaagt 1440ttaaacagag ttacacataa acagtctgaa tcagggcgtg gtcctgccca ccattgtctg 1500ggcttcaagg ttccttcttt ctctccctag catgagattc ctgggacaat cccaattcct 1560tggcctccat tgtatcaaag ggctgaaaac caaagggaag gcacagctgt ctcttcagca 1620tgcctcttct gccagaacca ctgcaaggtt tggtgctcag gctgtgcaaa cattctagca 1680atgtttgact cagtgtcaag caggtgacaa ggaacatggt gctgtgtggg gggaacccat 1740ggcccaggtg agggcttatt ggtgggtgaa gctgtgggtg ttcaggtggt ggagaaggcc 1800ttaagggatg ggactgacac ctcagcactg aaggcaggag gaagctgtgg ctctgggttg 1860cacccctgcc tggctccacc ctctctggca tctgtagaag ttacagctgg ttcttcctct 1920cagccccatg ctcccagaaa taagactcag acccaaatta tagttacaaa taccttggcc 1980atatagctag gctcttctca gactagctca taacttaact cattaatttt aacctccatc 2040ctgccacatg gctggtggcc tgtgctcagg taccatgagt ccagctcttc acatctttcc 2100ggatgaatct tccataattc tttctgcctc ctggatgttc caccttctat tccacctttt 2160cctataggcc atggttttgt ttttgttttt tttttccaaa tttaatttaa ttaattaatt 2220tatttatttt tggtttttcg agacagggtt tctctgtatc gccctggctg tcctggaact 2280cactatgtaa gccaggctgg cctcaaactc agaaatccgc ctgcctctgc ctcctgagtg 2340ctgggattaa aggcgtgcgc aaccatgccc ggtgtggttt tttttttttt ttaattgaca 2400ggtggatgca tctatataat ccataacata ttctctctac aggtatctat taggttttgg 2460gtgaggtgtg gagttctagg gaactctgag agaaattcct ggggagtaag tggtttatca 2520agttgattgg aggagttttt aatgctatgg acagacagac agaaggacaa cagcatagtc 2580ggggctacca gggagttcag gccccggcat cggagataga agcaggatgg ggtctttgaa 2640gagattctga gcccacacag cagaggaggg actctctctt tagagctttt gaggatgagg 2700gaggttgact gcaagagcct acagccaggc tcgaggcagg cagggggtgg ggagcaggat 2760gtaaacccct tcgatgctga cagactcact tctggggtaa aatattatga gatgcctgtc 2820agtgtctgtg aagagacctg agcagagtct ggattctgac atcaatcatg ttcttacaat 2880actgaagacc tgagagcctg caatcttggt ttgtaaattg ctggtctccg tgcttccagt 2940gaacttggac attcttctca tggttggtcc aggagaggcc aaagctgagg gcaccctgcc 3000ttccaccccc agtccagctt gaccttttat ctggagcaac agtgtctaga tgatgggtgg 3060gtgaggggtg ctatactgtc tgtccctctg ggaagggttc tgttactttt ggaggcagct 3120aggaagtttc tctgtgcagc tgccccctgg tgctgtgtgg tgacctcatt gcctgtgacc 3180ccaggatcac aggatctggg ctaaagtggt agtccataga aaccaaagac aatgatttgg 3240tgtttagaaa gctactcttg gtctgggtga agtctggtgc ttaagggcta tcacaaagag 3300cgtgtcaaac catctctcag cctgtgagtc agtggggagc ccaagggcat cagtgtttgg 3360aaactggaat ccaaaccggg caatctcgga aggaaactgt ttaggaattg tgatgggacg 3420ggccgtggct gtctctgaaa agggcctgcc agataactta ttacttttaa ggacaccttt 3480ggctcttact aatttataaa gcattttata taaacacacc agggagtgca tggtgaacta 3540cacgtatgat cagttaagtg gggctagaat taggtaggga gagcatcgga cctctgcctc 3600ctcaacctca acttgcttgc tttctccact ggctccaaat ctttgtatag tcatcagcca 3660tgaccacctc tctccctccc catctactac cagcagcgtt aatgggaata agtacccact 3720tctctcaggt gtactataca gctgtgggtg tggtgtgtgt ttcctgtaat tcacacttta 3780gaaaggaaac aagcaaacaa aagaaaccag gtgctgccca tactcctaag tgtagacagt 3840gaaggtgtgt gtctcccatg cctgagtctc ctggaggcct agtgagctcc aggttcatgc 3900aagcacatca ggaggaatca tataatctca gcacggttga tccagatggg ataagaaagg 3960actctgggag agagaatgtg gttctagaga caaagtgtct aggctacaca gaagataaga 4020ctgtcccaag gaaagaaaag aaaccaggaa ctagggtgca gctcagttgt cagaggactt 4080ctctaggctt gaagcccaga gtccaatctc agcaccttat aaactgtgga gtgacaggca 4140gtgacatcgg cctgtaatcc caacactcaa gcagtagagg caagaggatc ataagttcaa 4200ggtcttcctt ggctatttag ggagttggag gttagctctg gctacatgag accctgtctc 4260aaaaaaaaaa aaaaaaaaaa gtagaaactt ctgccttgct ttgagctgcc cctttctgga 4320cgtttctcat cagtagagaa tattcctgcc accctatcag acaaaactcc cactggtttg 4380gagtctctcc attctcagga acacctcagg agtcagacag tgagcagcag ggagcaatgt 4440cttgacttgt aagcccctta gcaaggctgg ttcatttgtt tattaaaagc aggtgtgggt 4500gaatttatgc aaatgagtat gcaaactagt ggaacagcag aaggattgaa tggatacacc 4560aaaaataacc acaactgttt aagggaaaag ggtccataat aaatgtgggg aacaaaaaac 4620aaataaatgt gatttttttt agaaaaatg 464944649DNAMus musculus 4catttttcta aaaaaaatca catttatttg ttttttgttc cccacattta ttatggaccc 60ttttccctta aacagttgtg gttatttttg gtgtatccat tcaatccttc tgctgttcca 120ctagtttgca tactcatttg cataaattca cccacacctg cttttaataa acaaatgaac 180cagccttgct aaggggctta caagtcaaga cattgctccc tgctgctcac tgtctgactc 240ctgaggtgtt cctgagaatg gagagactcc aaaccagtgg gagttttgtc tgatagggtg 300gcaggaatat tctctactga tgagaaacgt ccagaaaggg gcagctcaaa gcaaggcaga 360agtttctact tttttttttt tttttttttg agacagggtc tcatgtagcc agagctaacc 420tccaactccc taaatagcca aggaagacct tgaacttatg atcctcttgc ctctactgct 480tgagtgttgg gattacaggc cgatgtcact gcctgtcact ccacagttta taaggtgctg 540agattggact ctgggcttca agcctagaga agtcctctga caactgagct gcaccctagt 600tcctggtttc ttttctttcc ttgggacagt cttatcttct gtgtagccta gacactttgt 660ctctagaacc acattctctc tcccagagtc ctttcttatc ccatctggat caaccgtgct 720gagattatat gattcctcct gatgtgcttg catgaacctg gagctcacta ggcctccagg 780agactcaggc atgggagaca cacaccttca ctgtctacac ttaggagtat gggcagcacc 840tggtttcttt tgtttgcttg tttcctttct aaagtgtgaa ttacaggaaa cacacaccac 900acccacagct gtatagtaca cctgagagaa gtgggtactt attcccatta acgctgctgg 960tagtagatgg ggagggagag aggtggtcat ggctgatgac tatacaaaga tttggagcca 1020gtggagaaag caagcaagtt gaggttgagg aggcagaggt ccgatgctct ccctacctaa 1080ttctagcccc acttaactga tcatacgtgt agttcaccat gcactccctg gtgtgtttat 1140ataaaatgct ttataaatta gtaagagcca aaggtgtcct taaaagtaat aagttatctg 1200gcaggccctt ttcagagaca gccacggccc gtcccatcac aattcctaaa cagtttcctt 1260ccgagattgc ccggtttgga ttccagtttc caaacactga tgcccttggg ctccccactg 1320actcacaggc tgagagatgg tttgacacgc tctttgtgat agcccttaag caccagactt 1380cacccagacc aagagtagct ttctaaacac caaatcattg tctttggttt ctatggacta 1440ccactttagc ccagatcctg tgatcctggg gtcacaggca atgaggtcac cacacagcac 1500cagggggcag ctgcacagag aaacttccta gctgcctcca aaagtaacag aacccttccc 1560agagggacag acagtatagc acccctcacc cacccatcat ctagacactg ttgctccaga 1620taaaaggtca agctggactg ggggtggaag gcagggtgcc ctcagctttg gcctctcctg 1680gaccaaccat gagaagaatg tccaagttca ctggaagcac ggagaccagc aatttacaaa 1740ccaagattgc aggctctcag gtcttcagta ttgtaagaac atgattgatg tcagaatcca 1800gactctgctc aggtctcttc acagacactg acaggcatct cataatattt taccccagaa 1860gtgagtctgt cagcatcgaa ggggtttaca tcctgctccc caccccctgc ctgcctcgag 1920cctggctgta ggctcttgca gtcaacctcc ctcatcctca aaagctctaa agagagagtc 1980cctcctctgc tgtgtgggct cagaatctct tcaaagaccc catcctgctt ctatctccga 2040tgccggggcc tgaactccct ggtagccccg actatgctgt tgtccttctg tctgtctgtc 2100catagcatta aaaactcctc caatcaactt gataaaccac ttactcccca ggaatttctc 2160tcagagttcc ctagaactcc acacctcacc caaaacctaa tagatacctg tagagagaat 2220atgttatgga ttatatagat gcatccacct gtcaattaaa aaaaaaaaaa aaccacaccg 2280ggcatggttg cgcacgcctt taatcccagc actcaggagg cagaggcagg cggatttctg 2340agtttgaggc cagcctggct tacatagtga gttccaggac agccagggcg atacagagaa 2400accctgtctc gaaaaaccaa aaataaataa attaattaat taaattaaat ttggaaaaaa 2460aaaacaaaaa caaaaccatg gcctatagga aaaggtggaa tagaaggtgg aacatccagg 2520aggcagaaag aattatggaa gattcatccg gaaagatgtg aagagctgga ctcatggtac 2580ctgagcacag gccaccagcc atgtggcagg atggaggtta aaattaatga gttaagttat 2640gagctagtct gagaagagcc tagctatatg gccaaggtat ttgtaactat aatttgggtc 2700tgagtcttat ttctgggagc atggggctga gaggaagaac cagctgtaac ttctacagat 2760gccagagagg gtggagccag gcaggggtgc aacccagagc cacagcttcc tcctgccttc 2820agtgctgagg tgtcagtccc atcccttaag gccttctcca ccacctgaac acccacagct 2880tcacccacca ataagccctc acctgggcca tgggttcccc ccacacagca ccatgttcct 2940tgtcacctgc ttgacactga gtcaaacatt gctagaatgt ttgcacagcc tgagcaccaa 3000accttgcagt ggttctggca gaagaggcat gctgaagaga cagctgtgcc ttccctttgg 3060ttttcagccc tttgatacaa tggaggccaa ggaattggga ttgtcccagg aatctcatgc 3120tagggagaga aagaaggaac cttgaagccc agacaatggt gggcaggacc acgccctgat 3180tcagactgtt tatgtgtaac tctgtttaaa cttaagcctc ctgttggtat cttaaagatt 3240aaccgggtgg gggcttgaac ctttttatat tcgaataaac ctgctttctc tgctaccggt 3300ttctttaatg gcatgctggg gacaggcggc tgagcctggc ttgttaaggc tgtcaccacc 3360caagctctga ccctaagagc tctgggaaca accgggaggg atgcctatct ggcccacaca 3420ccctgggccc aagtatttac ctggtagagg ggagcaggca catcgtcatt cgggcacaaa 3480cctgggatgt cgcccattgt agccactgga tatcatcctg gatatcaggg agccatgtca 3540ccagcctgtg gactgcagcg atagccgact ccacgggcag actgcagggc agcatgatgt 3600aggacaggat cctgacgggc aggaggttgc agactttgct caggtagccc tccctgtcct 3660taatcgcttc actcagagct gtgctgagct cgggggacag tgtctcccag atgttctcat 3720ctgtaaagca taggctgact ggcaccttgt ctcccacaag tttgccattt tccaagcagg 3780cttctggcgc caccaaggac agactcaggc tgcgctgtgg cccgttacag atgccattct 3840cctccaggaa ccggaaggcg tccaggtacc cttgatagca cagctctccc atcaccttca 3900catcagacgg gaagagcgct ctggtcagaa gttggaggtt cccagtgcag aggcggaggc 3960tgaggttggt gatattcacg tggaagaagt tggtggactt gactttgggg cagatgtcat 4020gctcaccgta gaaaggtgac accgtgatgg tggttttggc atccagcaca gggacgttgt 4080cgctcactcc tccgtccacg taccgctcgc ctcggaagga aggagggatt aggccagaga 4140agaggggaat gaagcaggaa cacaccaggg catccacgac ttcgtctttg gaatggaact 4200cagacaccag cacgttctcc ccatccgaca ccctggtgag tgagatgtga accttgccag 4260aaatgacctg gtggacattg tctgggaggc tctcctggag cccgtctctg atgcacttgt 4320taatgttgaa gaacgggtgg agggtgccga tgttgcggct cctggctttc cgcacgaggt 4380ccatgaggat ctccattata cggccgagag ggagactgca cacgaaggtg accgcgtgca 4440gtgcaccggc cgagcagcca aagaaagtgc gcgcatcgcg gaggaggtgc ggggcgcgct 4500cgctcagaca tagcgtagcc ccgacgtggt agaagcccag gaagccgcag cctgcaaacg 4560acaggctcca gcggcgctct gggtcataca tggtgcttga agctccgggc ggcgctgcag 4620ttcagctctg ctcccggtgt tgctgctct

464952759DNARattus norvegicus 5cccggagcag aattgagctg catcgccttc cggagcctcc agcgccatgt acgacccaga 60gcgccgctgg agcctgtcgt tcgcaggctg cggcttccta ggcttctacc acatcggggc 120tacgctatgt ctgagcgagc gcgctccgca catcctccgc gaagcgcgca ctttcttcgg 180ctgctcggcc ggtgcactgc acgcggtcac cttcgtgtgc agtctccctc tcgatcacat 240catggagatc ctcatggacc tcgtgcggaa agccaggagc cgcaacatcg gcaccctcca 300cccgttcttc aacattaaca agtgcgtcag agacggcctt caggagaccc tcccagacaa 360cgtccaccag atcatttctg gcaaggttta catctcactc accagagtgt ccgatgggga 420gaacgtgctg gtgtctgagt tccattccaa agacgaagtg gtggatgccc tggtgtgctc 480ctgcttcatt cctctcttct ctggcctaat ccctccttcc ttccgaggtg agcggtacgt 540ggatggagga gtgagtgaca acgtccctgt gctggacgcc aaaaccacca tcacggtgtc 600ccctttctat ggtgagcatg acatctgtcc caaagtgaag tccaccaact tcctccaggt 660gaatatcacc aacctcagtc ttcgtctctg cactgggaac cttcatcttc tgaccagagc 720actcttccca tctgatgtga aggtgatggg agagctgtgc tttcaagggt acctggacgc 780cttccggttc ctggaagaga acggcatctg taatgggcca cagcgcagcc tgagtctgtc 840cttggagaag gaaatggcgc cagaaaccat gataccctgc ttggaaaatg gccaccttgt 900agcagggaac aaggtgccag taagctgtgt atgccttaca gctgtgccgt cggatgagag 960catctgggag atgctgtccc ccaagctcag cacagctctg actgaagcga ttaaagacag 1020ggggggctac ctgaacaaag tctgcaacct cctgcccatt aggatcctgt cctacatctt 1080gctgccctgc actctgcccg tggagtcggc catcgctgca gtccacaggc tggtgatgtg 1140gctccctgat atccatgaag atatccagtg gctacagtgg gcaacatccc aggtgtgtgc 1200ccgaatgacc atgtgcctgc tcccctctac cagatccaga gcatccaagg ataaccatca 1260aacactcaag catggatatc acccatctct ccacaaaccc caaggcagct ctgccggttt 1320gtaaattgct ggtctccgtg cttccgatga acttgggcat tctccctgtg gatggttcca 1380ggagaggcca tagctgaagg cactctgcct tccaccccaa gtccagtttg acctttatct 1440agagcaacag tgtctagatg ataggtgggt ggggggtgct gtctctctgt ttccctctgg 1500gaagggttct gttaactttt ggaggcagct aggaaatttc tctccaggag ctgagcctgt 1560gcagctgccc ccttggtgct gtgtggtaac ctcattgcct gtgaccctag gatcatagga 1620tctgggctaa ataggtagtt catagaaacc aaagacaata atttggtgtt tagaaaacta 1680cttttggtct gggtgaagtc tggtgcttga gagttagtgc agagagaacg gtcaaaccgt 1740ctctcagcct gtggatctat ggggattcca agggcttcag tgtttggaaa cggcaatcca 1800aacgggcaat cttgtgcaat cttggaagga gaactgttca ggaagtgtga tgggatgagc 1860tgtggctgtc tctgaaaagg gcctaccata taacttatta ctttcaagga tacctttggc 1920tcttactaaa atagtttata aagcatttta tagaaacaca ccagggaatg cgtggtgaac 1980tacatgtatg atcagtgaac tgtgactaga attaacctta aaatctcttg tatgtggggc 2040cagagcaaca caggtgggaa acgcagcgga cctctgcctc ctcggcctca acatgaactt 2100ggcttgcttt ctccaccgtc tccaaatctt tgtatagtca tcgaccatta ccacctctcc 2160tttcccatct actacagcag ccttaatggg gataagtacc cccttttctc aggtgtccga 2220ataagctgtg ggtgtggcct gtgtttcctg taattctgag gttagattgg aacataagca 2280agcagacaaa caagcagaca aacaaacaag gttctactca tattcctaag cagtgacagt 2340gaaggcatgt gtctcccatg cctgagtctc ctagggtcct agtgagctct gggttcatgc 2400aagcacttcc ggaggaattg caccctccat ggaacacata atctccactg ggttgatcct 2460gattggataa gaaaggatct cggggagaga atgtggttcc agaggcaaag tgtctaggct 2520acacagaaaa ggtaagactg tccccaaggg aagaaaacaa actgggagct ggggtccagc 2580tcaattgtta agagtgcttc tctagtatgc gtgaagccca gagtccaatc tcagtaccag 2640atacacggta caggcagtga catatgcctg taatcccaac cctcaagcag tagaggcaag 2700aggatcagaa gttcatggtc atccttgact acttatactt agggagttgg aggtcagcc 275962759DNARattus norvegicus 6ggctgacctc caactcccta agtataagta gtcaaggatg accatgaact tctgatcctc 60ttgcctctac tgcttgaggg ttgggattac aggcatatgt cactgcctgt accgtgtatc 120tggtactgag attggactct gggcttcacg catactagag aagcactctt aacaattgag 180ctggacccca gctcccagtt tgttttcttc ccttggggac agtcttacct tttctgtgta 240gcctagacac tttgcctctg gaaccacatt ctctccccga gatcctttct tatccaatca 300ggatcaaccc agtggagatt atgtgttcca tggagggtgc aattcctccg gaagtgcttg 360catgaaccca gagctcacta ggaccctagg agactcaggc atgggagaca catgccttca 420ctgtcactgc ttaggaatat gagtagaacc ttgtttgttt gtctgcttgt ttgtctgctt 480gcttatgttc caatctaacc tcagaattac aggaaacaca ggccacaccc acagcttatt 540cggacacctg agaaaagggg gtacttatcc ccattaaggc tgctgtagta gatgggaaag 600gagaggtggt aatggtcgat gactatacaa agatttggag acggtggaga aagcaagcca 660agttcatgtt gaggccgagg aggcagaggt ccgctgcgtt tcccacctgt gttgctctgg 720ccccacatac aagagatttt aaggttaatt ctagtcacag ttcactgatc atacatgtag 780ttcaccacgc attccctggt gtgtttctat aaaatgcttt ataaactatt ttagtaagag 840ccaaaggtat ccttgaaagt aataagttat atggtaggcc cttttcagag acagccacag 900ctcatcccat cacacttcct gaacagttct ccttccaaga ttgcacaaga ttgcccgttt 960ggattgccgt ttccaaacac tgaagccctt ggaatcccca tagatccaca ggctgagaga 1020cggtttgacc gttctctctg cactaactct caagcaccag acttcaccca gaccaaaagt 1080agttttctaa acaccaaatt attgtctttg gtttctatga actacctatt tagcccagat 1140cctatgatcc tagggtcaca ggcaatgagg ttaccacaca gcaccaaggg ggcagctgca 1200caggctcagc tcctggagag aaatttccta gctgcctcca aaagttaaca gaacccttcc 1260cagagggaaa cagagagaca gcacccccca cccacctatc atctagacac tgttgctcta 1320gataaaggtc aaactggact tggggtggaa ggcagagtgc cttcagctat ggcctctcct 1380ggaaccatcc acagggagaa tgcccaagtt catcggaagc acggagacca gcaatttaca 1440aaccggcaga gctgccttgg ggtttgtgga gagatgggtg atatccatgc ttgagtgttt 1500gatggttatc cttggatgct ctggatctgg tagaggggag caggcacatg gtcattcggg 1560cacacacctg ggatgttgcc cactgtagcc actggatatc ttcatggata tcagggagcc 1620acatcaccag cctgtggact gcagcgatgg ccgactccac gggcagagtg cagggcagca 1680agatgtagga caggatccta atgggcagga ggttgcagac tttgttcagg tagccccccc 1740tgtctttaat cgcttcagtc agagctgtgc tgagcttggg ggacagcatc tcccagatgc 1800tctcatccga cggcacagct gtaaggcata cacagcttac tggcaccttg ttccctgcta 1860caaggtggcc attttccaag cagggtatca tggtttctgg cgccatttcc ttctccaagg 1920acagactcag gctgcgctgt ggcccattac agatgccgtt ctcttccagg aaccggaagg 1980cgtccaggta cccttgaaag cacagctctc ccatcacctt cacatcagat gggaagagtg 2040ctctggtcag aagatgaagg ttcccagtgc agagacgaag actgaggttg gtgatattca 2100cctggaggaa gttggtggac ttcactttgg gacagatgtc atgctcacca tagaaagggg 2160acaccgtgat ggtggttttg gcgtccagca cagggacgtt gtcactcact cctccatcca 2220cgtaccgctc acctcggaag gaaggaggga ttaggccaga gaagagagga atgaagcagg 2280agcacaccag ggcatccacc acttcgtctt tggaatggaa ctcagacacc agcacgttct 2340ccccatcgga cactctggtg agtgagatgt aaaccttgcc agaaatgatc tggtggacgt 2400tgtctgggag ggtctcctga aggccgtctc tgacgcactt gttaatgttg aagaacgggt 2460ggagggtgcc gatgttgcgg ctcctggctt tccgcacgag gtccatgagg atctccatga 2520tgtgatcgag agggagactg cacacgaagg tgaccgcgtg cagtgcaccg gccgagcagc 2580cgaagaaagt gcgcgcttcg cggaggatgt gcggagcgcg ctcgctcaga catagcgtag 2640ccccgatgtg gtagaagcct aggaagccgc agcctgcgaa cgacaggctc cagcggcgct 2700ctgggtcgta catggcgctg gaggctccgg aaggcgatgc agctcaattc tgctccggg 275972281DNAMacaca fascicularis 7tgctgcggat caggacccga gccgatcccc gatcccgact ccgatccgga tccgcgcccc 60cgcccccgcc ccgccatgta cgacgccgag cgcggctgga gcttgtcctt cgcgggctgc 120ggcttcctgg gcttctacca cgtcggggcg acccggtgcc tgagcgagca cgccccgcac 180ctcctccgcg acgcgcgcat gttgttcggc gcctcggccg gggcgttgca ctgcgtcggc 240gtcctctccg ggatcccgct ggagcagact ctgcaggtcc tctcagatct tgtccggaag 300gccaggagtc ggaacattgg tatcttccat ccatccttca acataggcaa gttcctccga 360caggatctct acaaatacct cccggccaat gtccaccagc tcatctctgg caaaatatgc 420gtctcactca ccagagtgtc tgatggggaa aacgttctgg tgtctgactt tcagtccaaa 480gacgaagtcg tggatgcctt gatttgttcc tgcttcatcc ctttctacag tggccttatc 540cctccttcct tcagaggcgt gcgatatgtg gatggaggag cgagtgacaa cgtacccttc 600attgatgcca agacaaccat caccgtgtcg cccttctatg gggagtacga catctgccct 660aaagtcaagt ccaccaactt tcttcatgtg gacatcacca agctcagcct acgcctctgc 720acagggaacc tctaccttct ctcaagagcg tttgtccccc cggatctcaa ggtgctggga 780gagatatgcc ttcgaggata tttggacgcg ttcaggttct tggaagagaa gggcatctgc 840aacaagcccc agcggggtct gaagtcatcc tcagaaggga tggattctga ggtcactgcg 900cccggctggg aaaacacaag tctggattct tccccggagc cggctgcctt ggctatgagg 960ctggatggag atgagctgct agaccacctg cgtctcagca tcctgccctg ggatgagagc 1020atcctggaca ccctgtcgcc cgagctcgct acagcagtga gtgaagcaat gaaagacaaa 1080ggtggataca tgagcaagat ttgcaacttg ctacccatta ggataatatc ttatgtgatg 1140ctgccctgta ccctgcctgt ggagtctgcc attgcgattg tccagagact ggtgacatgg 1200cttccagata tgcccgacga tgtgcagtgg ctgcagtggg tgacctcaca ggtcttcact 1260cgagcgctga tgtgtctgct tcccgcctcc aggtcccaaa tgccagtgag cagcgaacag 1320gcctccccat gcaaaccgga gcaggactgg cactgctgga ctccctgctc ccccgaggac 1380tgtcctgcag aggccaaagc agaggctacc ccacggtcca tcctcaggtc cagcctgaac 1440ttcttctggg gcaataaagt acctgctggt gctgaggggc tctccacctt tcccagtttt 1500tcactggaga agaatttgtg agtcatttga ggaggcgagt ctaggagatt ctttcagagg 1560tgctaaagct tcccatcttt gtgcagctac ctccgcattg ccgtgtagtg acccctgcct 1620gtgacgtgga ggatcccagc ctctgagctg agttggtttt atgaaaagct aggaagcaat 1680gtttggtctg tgcagcagtc cagcacttaa gtctaatacg tcagcatgcg ttagttcagc 1740tggttgggaa atgacaccgg gaagcctagc gcagagggtc ccttactgac tatttcatgg 1800tcctattaat ggtcagactg ttccagtgtg aggttcttag aatgactagt gtttggatgg 1860gtgggggcct tgtggtgggg ggtgggctgg cctatgtgtg atcttgtggg gtggaaggaa 1920gagagtagca caatcccacc tccccatgcc gtgggaaggg gtgcacttgg ttcccaagaa 1980ggacactgcc tgtcaggtgg cctgcaaata taataacctt gacaactaaa aacctctcca 2040tgggggtggg aggtaccaag ataataaccg atttacattt tagagcacct ttttcaccta 2100actaaaataa tgtttaaaga gttttatata aaaatgtaag gaagagttgt tatctgttga 2160attttgtatt atatgaatca gtgagatgtt aatagaataa gcctttaaaa agaaaaaaag 2220ttcagccagg cgctgtggca cacgcctgta atcccagcac tttggaaggc cgaggtgggc 2280a 228182281DNAMacaca fascicularis 8tgcccacctc ggccttccaa agtgctggga ttacaggcgt gtgccacagc gcctggctga 60actttttttc tttttaaagg cttattctat taacatctca ctgattcata taatacaaaa 120ttcaacagat aacaactctt ccttacattt ttatataaaa ctctttaaac attattttag 180ttaggtgaaa aaggtgctct aaaatgtaaa tcggttatta tcttggtacc tcccaccccc 240atggagaggt ttttagttgt caaggttatt atatttgcag gccacctgac aggcagtgtc 300cttcttggga accaagtgca ccccttccca cggcatgggg aggtgggatt gtgctactct 360cttccttcca ccccacaaga tcacacatag gccagcccac cccccaccac aaggccccca 420cccatccaaa cactagtcat tctaagaacc tcacactgga acagtctgac cattaatagg 480accatgaaat agtcagtaag ggaccctctg cgctaggctt cccggtgtca tttcccaacc 540agctgaacta acgcatgctg acgtattaga cttaagtgct ggactgctgc acagaccaaa 600cattgcttcc tagcttttca taaaaccaac tcagctcaga ggctgggatc ctccacgtca 660caggcagggg tcactacacg gcaatgcgga ggtagctgca caaagatggg aagctttagc 720acctctgaaa gaatctccta gactcgcctc ctcaaatgac tcacaaattc ttctccagtg 780aaaaactggg aaaggtggag agcccctcag caccagcagg tactttattg ccccagaaga 840agttcaggct ggacctgagg atggaccgtg gggtagcctc tgctttggcc tctgcaggac 900agtcctcggg ggagcaggga gtccagcagt gccagtcctg ctccggtttg catggggagg 960cctgttcgct gctcactggc atttgggacc tggaggcggg aagcagacac atcagcgctc 1020gagtgaagac ctgtgaggtc acccactgca gccactgcac atcgtcgggc atatctggaa 1080gccatgtcac cagtctctgg acaatcgcaa tggcagactc cacaggcagg gtacagggca 1140gcatcacata agatattatc ctaatgggta gcaagttgca aatcttgctc atgtatccac 1200ctttgtcttt cattgcttca ctcactgctg tagcgagctc gggcgacagg gtgtccagga 1260tgctctcatc ccagggcagg atgctgagac gcaggtggtc tagcagctca tctccatcca 1320gcctcatagc caaggcagcc ggctccgggg aagaatccag acttgtgttt tcccagccgg 1380gcgcagtgac ctcagaatcc atcccttctg aggatgactt cagaccccgc tggggcttgt 1440tgcagatgcc cttctcttcc aagaacctga acgcgtccaa atatcctcga aggcatatct 1500ctcccagcac cttgagatcc ggggggacaa acgctcttga gagaaggtag aggttccctg 1560tgcagaggcg taggctgagc ttggtgatgt ccacatgaag aaagttggtg gacttgactt 1620tagggcagat gtcgtactcc ccatagaagg gcgacacggt gatggttgtc ttggcatcaa 1680tgaagggtac gttgtcactc gctcctccat ccacatatcg cacgcctctg aaggaaggag 1740ggataaggcc actgtagaaa gggatgaagc aggaacaaat caaggcatcc acgacttcgt 1800ctttggactg aaagtcagac accagaacgt tttccccatc agacactctg gtgagtgaga 1860cgcatatttt gccagagatg agctggtgga cattggccgg gaggtatttg tagagatcct 1920gtcggaggaa cttgcctatg ttgaaggatg gatggaagat accaatgttc cgactcctgg 1980ccttccggac aagatctgag aggacctgca gagtctgctc cagcgggatc ccggagagga 2040cgccgacgca gtgcaacgcc ccggccgagg cgccgaacaa catgcgcgcg tcgcggagga 2100ggtgcggggc gtgctcgctc aggcaccggg tcgccccgac gtggtagaag cccaggaagc 2160cgcagcccgc gaaggacaag ctccagccgc gctcggcgtc gtacatggcg gggcgggggc 2220gggggcgcgg atccggatcg gagtcgggat cggggatcgg ctcgggtcct gatccgcagc 2280a 228191544DNAMacaca mulatta 9cgcttgcggg cgcccggcgg agctgctgcg gatcaggacc cgagccgatc cccgatcccg 60actccgatcc ggatccgcgc ccccgccccc gccccgccat gtacgacgcc gagcgcggct 120ggagcttgtc cttcgcgggc tgcggcttcc tgggcttcta ccacgtcggg gcgacccgct 180gcctgagcga gcacgccccg cacctcctcc gcgacgcgcg catgttgttc ggcgcctcgg 240ccggggcgtt gcactgcgtc ggcgtcctct ccgggatccc gctggagcag actctgcagg 300tcctctcaga tcttgtccgg aaggccagga gtcggaacat tggtatcttc catccatcct 360tcaacatagg caagttcctc cgacaggatc tctacaaata cctcccggcc aatgtccacc 420agctcatctc tggcaaaata tgcgtctcac tcaccagagt gtctgatggg gaaaacgttc 480tggtgtctga ctttcagtcc aaagacgaag tcgtggatgc cttgatttgt tcctgcttca 540tccctttcta cagtggcctt atccctcctt ccttcagagg cgtgcgatat gtggatggag 600gagcgagtga caacgtaccc ttcattgatg ccaagacaac catcaccgtg tcgcccttct 660atggggagta cgacatctgc cctaaagtca agtccaccaa ctttcttcat gtggacatca 720ccaagctcag cctacgcctc tgcacaggga acctctacct tctctcaaga gcgtttgtcc 780ccccggatct caaggtgctg ggagagatat gccttcgagg atatttggac gcgttcaggt 840tcttggaaga gaagggcatc tgcaacaagc cccagcgggg tctgaagtca tcctcagaag 900ggatggattc tgaggtcact gcgcccggct gggaaaacac aagtctggat tcttccccgg 960agccggctgc cttggctatg aggctggatg gagatgagct gctagaccac ctgcgtctca 1020gcatcctgcc ctgggatgag agcatcctgg acaccctgtc gcccgagctc gctacagcag 1080tgagtgaagc aatgaaagac aaaggtggat acatgagcaa gatttgcaac ttgctaccca 1140ttaggataat gtcttatgtg atgctgccct gtaccctgcc tgtggagtct gccattgcga 1200ttgtccagag actggtgaca tggcttccgg atatgcccga cgatgtgcag tggctgcagt 1260gggtgacctc acaggtcttc actcgagcgc tgatgtgtct gcttcccgcc tccaggtccc 1320aaatgccagt gagcggcgaa caggcctccc catgcaaacc ggagcaggac tggcactgct 1380ggactccctg ctcccccgag gactgtcctg cagaggccaa agcagaggct accccacggt 1440ccatcctcag gtccagcctg aacttcttct ggggcaataa agtacctgct ggtgctgagg 1500ggctctccac ctttcccagt ttttcactgg agaagaattt gtga 1544101544DNAMacaca mulatta 10tcacaaattc ttctccagtg aaaaactggg aaaggtggag agcccctcag caccagcagg 60tactttattg ccccagaaga agttcaggct ggacctgagg atggaccgtg gggtagcctc 120tgctttggcc tctgcaggac agtcctcggg ggagcaggga gtccagcagt gccagtcctg 180ctccggtttg catggggagg cctgttcgcc gctcactggc atttgggacc tggaggcggg 240aagcagacac atcagcgctc gagtgaagac ctgtgaggtc acccactgca gccactgcac 300atcgtcgggc atatccggaa gccatgtcac cagtctctgg acaatcgcaa tggcagactc 360cacaggcagg gtacagggca gcatcacata agacattatc ctaatgggta gcaagttgca 420aatcttgctc atgtatccac ctttgtcttt cattgcttca ctcactgctg tagcgagctc 480gggcgacagg gtgtccagga tgctctcatc ccagggcagg atgctgagac gcaggtggtc 540tagcagctca tctccatcca gcctcatagc caaggcagcc ggctccgggg aagaatccag 600acttgtgttt tcccagccgg gcgcagtgac ctcagaatcc atcccttctg aggatgactt 660cagaccccgc tggggcttgt tgcagatgcc cttctcttcc aagaacctga acgcgtccaa 720atatcctcga aggcatatct ctcccagcac cttgagatcc ggggggacaa acgctcttga 780gagaaggtag aggttccctg tgcagaggcg taggctgagc ttggtgatgt ccacatgaag 840aaagttggtg gacttgactt tagggcagat gtcgtactcc ccatagaagg gcgacacggt 900gatggttgtc ttggcatcaa tgaagggtac gttgtcactc gctcctccat ccacatatcg 960cacgcctctg aaggaaggag ggataaggcc actgtagaaa gggatgaagc aggaacaaat 1020caaggcatcc acgacttcgt ctttggactg aaagtcagac accagaacgt tttccccatc 1080agacactctg gtgagtgaga cgcatatttt gccagagatg agctggtgga cattggccgg 1140gaggtatttg tagagatcct gtcggaggaa cttgcctatg ttgaaggatg gatggaagat 1200accaatgttc cgactcctgg ccttccggac aagatctgag aggacctgca gagtctgctc 1260cagcgggatc ccggagagga cgccgacgca gtgcaacgcc ccggccgagg cgccgaacaa 1320catgcgcgcg tcgcggagga ggtgcggggc gtgctcgctc aggcagcggg tcgccccgac 1380gtggtagaag cccaggaagc cgcagcccgc gaaggacaag ctccagccgc gctcggcgtc 1440gtacatggcg gggcgggggc gggggcgcgg atccggatcg gagtcgggat cggggatcgg 1500ctcgggtcct gatccgcagc agctccgccg ggcgcccgca agcg 1544111495DNAMacaca fascicularis 11gctgctgcgg atcaggaccc gagccgatcc ccgatcccga ctccgatccg gatccgcgcc 60cccgcccccg ccccgccatg tacgacgccg agcgcggctg gagcttgtcc ttcgcgggct 120gcggcttcct gggcttctac cacgtcgggg cgacccggtg cctgagcgag cacgccccgc 180acctcctccg cgacgcgcgc atgttgttcg gcgcctcggc cggggcgttg cactgcgtcg 240gcgtcctctc cgggatcccg ctggagcaga ctctgcaggt cctctcagat cttgtccgga 300aggccaggag tcggaacatt ggtatcttcc atccatcctt caacataggc aagttcctcc 360gacaggatct ctacaaatac ctcccggcca atgtccacca gctcatctct ggcaaaatat 420gcgtctcact caccagagtg tctgatgggg aaaacgttct ggtgtctgac tttcagtcca 480aagacgaagt cgtggatgcc ttgatttgtt cctgcttcat ccctttctac agtggcctta 540tccctccttc cttcagaggc gtgcgatatg tggatggagg agcgagtgac aacgtaccct 600tcattgatgc caagacaacc atcaccgtgt cgcccttcta tggggagtac gacatctgcc 660ctaaagtcaa gtccaccaac tttcttcatg tggacatcac caagctcagc ctacgcctct 720gcacagggaa cctctacctt ctctcaagag cgtttgtccc cccggatctc aaggtgctgg 780gagagatatg ccttcgagga tatttggacg cgttcaggtt cttggaagag aagggcatct 840gcaacaagcc ccagcggggt ctgaagtcat cctcagaagg gatggattct gaggtcactg 900cgcccggctg ggaaaacaca agtctggatt cttccccgga gccggctgcc ttggctatga 960ggctggatgg agatgagctg ctagaccacc tgcgtctcag catcctgccc tgggatgaga 1020gcatcctgga caccctgtcg cccgagctcg ctacagcagt gagtgaagca atgaaagaca 1080aaggtggata catgagcaag atttgcaact tgctacccat taggataata tcttatgtga 1140tgctgccctg taccctgcct gtggagtctg ccattgcgat tgtccagagt gtaagtcctt 1200tgagctttct tgaaccagaa gtggcctcat tttgctttag agatttcaga tgggctcatc 1260cttgtcctgt catcccagat ccacctgctg ggaagtcatc agattggaga tgatgttggc 1320ggcttttgta aacaaagggt ggtgttgtaa gctgttgtgt ctgcctgtgt gtgtgtttgt 1380gtacttggtc ttatctctgc agactggtga catggcttcc agatatgccc gacgatgtgc 1440agtggctgca gtgggtgacc tcacaggtct tcactcgagc gctgatgtgt ctgct

1495121495DNAMacaca fascicularis 12agcagacaca tcagcgctcg agtgaagacc tgtgaggtca cccactgcag ccactgcaca 60tcgtcgggca tatctggaag ccatgtcacc agtctgcaga gataagacca agtacacaaa 120cacacacaca ggcagacaca acagcttaca acaccaccct ttgtttacaa aagccgccaa 180catcatctcc aatctgatga cttcccagca ggtggatctg ggatgacagg acaaggatga 240gcccatctga aatctctaaa gcaaaatgag gccacttctg gttcaagaaa gctcaaagga 300cttacactct ggacaatcgc aatggcagac tccacaggca gggtacaggg cagcatcaca 360taagatatta tcctaatggg tagcaagttg caaatcttgc tcatgtatcc acctttgtct 420ttcattgctt cactcactgc tgtagcgagc tcgggcgaca gggtgtccag gatgctctca 480tcccagggca ggatgctgag acgcaggtgg tctagcagct catctccatc cagcctcata 540gccaaggcag ccggctccgg ggaagaatcc agacttgtgt tttcccagcc gggcgcagtg 600acctcagaat ccatcccttc tgaggatgac ttcagacccc gctggggctt gttgcagatg 660cccttctctt ccaagaacct gaacgcgtcc aaatatcctc gaaggcatat ctctcccagc 720accttgagat ccggggggac aaacgctctt gagagaaggt agaggttccc tgtgcagagg 780cgtaggctga gcttggtgat gtccacatga agaaagttgg tggacttgac tttagggcag 840atgtcgtact ccccatagaa gggcgacacg gtgatggttg tcttggcatc aatgaagggt 900acgttgtcac tcgctcctcc atccacatat cgcacgcctc tgaaggaagg agggataagg 960ccactgtaga aagggatgaa gcaggaacaa atcaaggcat ccacgacttc gtctttggac 1020tgaaagtcag acaccagaac gttttcccca tcagacactc tggtgagtga gacgcatatt 1080ttgccagaga tgagctggtg gacattggcc gggaggtatt tgtagagatc ctgtcggagg 1140aacttgccta tgttgaagga tggatggaag ataccaatgt tccgactcct ggccttccgg 1200acaagatctg agaggacctg cagagtctgc tccagcggga tcccggagag gacgccgacg 1260cagtgcaacg ccccggccga ggcgccgaac aacatgcgcg cgtcgcggag gaggtgcggg 1320gcgtgctcgc tcaggcaccg ggtcgccccg acgtggtaga agcccaggaa gccgcagccc 1380gcgaaggaca agctccagcc gcgctcggcg tcgtacatgg cggggcgggg gcgggggcgc 1440ggatccggat cggagtcggg atcggggatc ggctcgggtc ctgatccgca gcagc 14951316PRTUnknownsource/note="Description of Unknown hydrophobic MTS-containing sequence" 13Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro1 5 10 151411PRTUnknownsource/note="Description of Unknown RFGF analogue sequence" 14Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro1 5 101513PRTHuman immunodeficiency virus 15Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln1 5 101616PRTDrosophila sp. 16Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10 151720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 17cgacgucagc cccgcccccc 201820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 18ggcauuccca gcgcgacguc 201920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 19gucucggcca gggcauuccc 202020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 20ugccucagug ucucggccag 202120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 21cgcucucuac ccugccucag 202220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 22gcgcccgcaa gcgcucucua 202320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 23cagcuccgcc cggcgcccgc 202420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 24ugauccgcag cagcuccgcc 202520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 25gcucgggucc ugauccgcag 202620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 26aucgggaauc ggcucggguc 202720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 27ucugggucgg gaucgggaau 202820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 28cgcggguuag gaucuggguc 202920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 29ggggcggggg cgcggguuag 203020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 30ggcggcggcg gcggggcggg 203120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 31ugcgucguac auggcggcgg 203220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 32agccgcgcuc ugcgucguac 203320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 33aggacaagcu ccagccgcgc 203420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 34agcccgcgaa ggacaagcuc 203520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 35caggaagccg cagcccgcga 203620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 36cgugguagaa gcccaggaag 203720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 37ucgccccgac gugguagaag 203820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 38caggcagcgg gucgccccga 203920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 39gggcgugcuc gcucaggcag 204020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 40aggaggugcg gggcgugcuc 204120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 41cgcgcgucgc ggaggaggug 204220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 42aacaacaugc gcgcgucgcg 204320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 43gccgaagcgc cgaacaacau 204420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 44ugcaacgccc cggccgaagc 204520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 45gccgacgcag ugcaacgccc 204620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 46cggagaggac gccgacgcag 204720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 47uccagcggga uaccggagag 204820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 48agagucugcu ccagcgggau 204920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 49agaggaccug cagagucugc 205020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 50cgcacaagau cugagaggac 205120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 51ccuggccuuc cgcacaagau 205220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 52uguuccgacu ccuggccuuc 205320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 53ggaagaugcc aauguuccga 205420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 54aaggauggau ggaagaugcc 205520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 55ugcuuaaguu gaaggaugga 205620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 56gucggaggaa cuugcuuaag 205720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 57gcagagaccc ugucggagga 205820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 58cgggaggcau uugcagagac 205920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 59ggacauuggc cgggaggcau 206020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 60agaugagcug guggacauug 206120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 61auuuugccgg agaugagcug 206220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 62agagaugccu auuuugccgg 206320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 63acacucuggu aagagagaug 206420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 64ccccaucaga cacucuggua 206520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 65accagaacgu uuuccccauc 206620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 66aagucagaca ccagaacguu 206720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 67cuuuggaccg aaagucagac 206820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 68ccacgacuuc gucuuuggac 206920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 69accaaggcau ccacgacuuc 207020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 70aagcaggaac auaccaaggc 207120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 71agaaggggau gaagcaggaa 207220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 72aggccacugu agaaggggau 207320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 73aaggagggau aaggccacug 207420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 74cgccucugaa ggaaggaggg 207520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 75acauaucgca cgccucugaa 207620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 76acuccuccau ccacauaucg 207720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 77acguugucac ucacuccucc 207820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 78aaugaagggu acguugucac 207920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 79guuuuggcau caaugaaggg 208020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 80ggugaugguu guuuuggcau 208120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 81agaaggggga cacggugaug 208220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 82acuccccaua gaagggggac 208320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 83gcagaugucg uacuccccau 208420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 84acuugacuuu agggcagaug 208520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 85aaaguucgug gacuugacuu 208620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 86ccacaugaag aaaguucgug 208720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 87uuggugaugu ccacaugaag 208820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 88cguagacuga gcuuggugau 208920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 89cugugcagag gcguagacug 209020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 90guagagguuc ccugugcaga 209120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 91ucgagagaag guagagguuc 209220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 92gggacaaaag cucucgagag 209320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 93ugagauccgg ggggacaaaa 209420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 94ccagcaccuu gagauccggg 209520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 95aggcauaucu cucccagcac 209620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 96uauccucgaa ggcauaucuc 209720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 97gaaugcaucc aaauauccuc

209820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 98uccaagaacc ugaaugcauc 209920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 99ugcccuucuc uuccaagaac 2010020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 100uguugcagau gcccuucucu 2010120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 101cuggcugggg ccuguugcag 2010220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 102augacuucag gccuggcugg 2010320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 103cccuucugag gaugacuuca 2010420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 104caggauccau cccuucugag 2010520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 105auggcgaccu caggauccau 2010620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 106ugcccagcug ggcauggcga 2010720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 107acucauguuu gcccagcugg 2010820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 108ggaagaaucc agacucaugu 2010920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 109agccgacucc ggggaagaau 2011020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 110acagccaagg cagccgacuc 2011120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 111ccuccagccu cacagccaag 2011220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 112gcucaucucc cuccagccuc 2011320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 113agguggucua gcagcucauc 2011420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 114cugagacgca gguggucuag 2011520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 115agggcaggau gcugagacgc 2011620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 116gcucucaucc cagggcagga 2011720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 117guguccagga ugcucucauc 2011820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 118cugggcgaga ggguguccag 2011920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 119cuguagcgag ccugggcgag 2012020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 120ucacucagug cuguagcgag 2012120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 121cuuucauuuc uucacucagu 2012220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 122auccaccuuu gucuuucauu 2012320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 123uugcucaugu auccaccuuu 2012420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 124aguugcaaau cuugcucaug 2012520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 125aauggguagc aaguugcaaa 2012620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 126agacauuauc cuaaugggua 2012720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 127agcauuacau aagacauuau 2012820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 128aggguacagg gcagcauuac 2012920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 129auuccacagg caggguacag 2013020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 130cgcaauggca gauuccacag 2013120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 131cuggacaauc gcaauggcag 2013220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 132gucaccaguc ucuggacaau 2013320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 133aucuggaagc caugucacca 2013420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 134ucgucgggca uaucuggaag 2013520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 135cacaggacau cgucgggcau 2013620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 136acccacugca accacaggac 2013720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 137accugugagg ucacccacug 2013820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 138cucgagugaa caccugugag 2013920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 139acaucagcac ucgagugaac 2014020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 140gcggggagca gacacaucag 2014120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 141gaccuggagg cggggagcag 2014220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 142acuggcauuu gggaccugga 2014320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 143uuggcugcuc acuggcauuu 2014420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 144auggggaggc cuguuggcug 2014520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 145ucaggugugc auggggaggc 2014620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 146ggccaguccu gcucaggugu 2014720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 147gaguccagca gggccagucc 2014820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 148gggagcaggg aguccagcag 2014920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 149acagcccuug ggggagcagg 2015020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 150gucucugcug gacagcccuu 2015120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 151gccucugcuu uggucucugc 2015220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 152ccgcggggug gccucugcuu 2015320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 153accugaggau ggaccgcggg 2015420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 154guucaggcug gaccugagga 2015520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 155ccaagaagaa guucaggcug 2015620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 156guacuuuauu gcccaagaag 2015720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 157agcaccagca gguacuuuau 2015820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 158gagagccccu cagcaccagc 2015920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 159ggaaaggugg agagccccuc 2016020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 160agugaaaaac ugggaaaggu 2016120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 161acucuucucu agugaaaaac 2016220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 162aagugacuca cagacucuuc 2016320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 163cucgccuccu caagugacuc 2016420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 164ucugcuagac ucgccuccuc 2016520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 165accucugaaa gaaucugcua 2016620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 166aaacuuuagc accucugaaa 2016720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 167acaaagaugg gaaacuuuag 2016820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 168ggagguagcu gcacaaagau 2016920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 169cagcaaugcg gagguagcug 2017020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 170aggggucacu acacagcaau 2017120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 171acgucacagg caggggucac 2017220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 172ugggauccuc cacgucacag 2017320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 173gcucagaggc ugggauccuc 2017420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 174aaaccaacuc agcucagagg 2017520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 175uagcuuuuca uaaaaccaac 2017620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 176agguugcuuc cuagcuuuuc 2017720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 177acaggcgaaa gguugcuucc 2017820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 178uggaccgcug cacaggcgaa 2017920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 179agaguuaagu gcuggaccgc 2018020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 180gcugauguau uagaguuaag 2018120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 181auuaacgcau gcugauguau 2018220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 182ccaaccagcu gaauuaacgc 2018320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 183ggugucauuu cccaaccagc 2018420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 184ugggcuuccu ggugucauuu 2018520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 185gacccucugc acugggcuuc 2018620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 186agucaguaag ggacccucug 2018720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 187gccacgaaac agucaguaag 2018820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 188ccauuaauag ggccacgaaa 2018920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 189ggaacagucu gaccauuaau 2019020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 190accucaugcu ggaacagucu 2019120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 191ugucauucua agaaccucau 2019220RNAArtificial

Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 192ccaaacaccu gucauucuaa 2019320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 193gcccccaccc auccaaacac 2019420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 194ccccaucaca aggcccccac 2019520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 195cagccuaccc cccaucacaa 2019620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 196ucacacaugg gccagccuac 2019720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 197caccccacaa gaucacacau 2019820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 198ucuucccucc accccacaag 2019920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 199ucaugcuauu cucuucccuc 2020020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 200gggaaguggg aucaugcuau 2020120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 201ucccacagca uggggaagug 2020220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 202acugcacccc uucccacagc 2020320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 203ucuuggggac gaacugcacc 2020420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 204gcagugucgu ucuuggggac 2020520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 205accaccugac aggcaguguc 2020620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 206aucuuugcag accaccugac 2020720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 207caagguuauc aucuuugcag 2020820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 208guuuuuagua gucaagguua 2020920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 209cgccauggag acguuuuuag 2021020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 210cuuguuaccc ccgccaugga 2021120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 211agauuaucau cuuguuaccc 2021220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 212aaaauuaagu agauuaucau 2021320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 213aaagguguuc uaaaauuaag 2021420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 214aguuagguga aaaagguguu 2021520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 215aaacauuauu uuaguuaggu 2021620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 216aaaacucuuu aaacauuauu 2021720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 217acauuuuuau acaaaacucu 2021820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 218aacgcuuccu uacauuuuua 2021920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 219aacagguaac aacgcuuccu 2022020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 220auacaaaauu caacagguaa 2022120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 221acugauucac auaauacaaa 2022220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 222acuaacaucu cacugauuca 2022320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 223aggcuuauuc uacuaacauc 2022420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 224uuuuuuuuuu aaggcuuauu 2022520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 225aaccgauuuu uuuuuuuuua 2022620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 226ccacugcacc caaccgauuu 2022720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 227acagccgugu gccacugcac 2022820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 228aagugcuggg auuacagccg 2022920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 229uuggccuccc aaagugcugg 2023020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 230aucugccaac cuuggccucc 2023120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 231accucaggug aucugccaac 2023220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 232cuugaacucc ugaccucagg 2023320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 233ccagacuggu cuugaacucc 2023420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 234ugcuauguug gccagacugg 2023520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 235gacaggguuu ugcuauguug 2023620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 236auuuuuagua gagacagggu 2023720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 237auaauuuuug uauuuuuagu 2023820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 238accaugccca gauaauuuuu 2023920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 239aggcaugcac caccaugccc 2024020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 240agcugggauu acaggcaugc 2024120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 241cuuccgaaua gcugggauua 2024220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 242ccugccucag ccuuccgaau 2024320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 243ucaagugauu cuccugccuc 2024420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 244ccuccugggu ucaagugauu 2024520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 245ccgcaaccuc cgccuccugg 2024620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 246aaucucagcu caccgcaacc 2024720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 247ugaaauggug caaucucagc 2024820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 248aggcuggaau gaaauggugc 2024920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 249acucauguug cccaggcugg 2025020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 250ucagacuuuc acucauguug 2025120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 251uuuuuuuuug agucagacuu 2025220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 252uuuuaaauuu uuuuuuuuug 2025320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 253gauuauuuug uuuuuuaaau 2025420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 254cugcacacua gauuauuuug 2025520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 255aggugaaugc ccugcacacu 2025620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 256uggggggcug aggugaaugc 2025720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 257cuuggcuccu gccugggggg 2025820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 258ccugcugugc uuggcuccug 2025920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 259aggcggaagc uccugcugug 2026020RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 260caguggagag gaggcggaag 2026120RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 261aguugugugc uccaguggag 2026220RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 262agccagguuc aaguugugug 2026320RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 263gcagaaaaua agccagguuc 2026420RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 264ggggcugguc ccugcagaaa 2026520RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 265acugaccaug uggggcuggu 2026620RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 266ggagaaacuc acugaccaug 2026720RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 267cgccacacau ggggagaaac 2026820RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 268acucucucau cgccacacau 2026920RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 269cuuuauuucu acacucucuc 2027020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 270cgacgtcagc cccgcccccc 2027120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 271ggcautccca gcgcgacguc 2027220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 272gucucggcca gggcauuccc 2027320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 273ugccucagtg tctcggccag 2027420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 274cgcuctctac cctgccucag 2027520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 275gcgcccgcaa gcgctcucua 2027620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 276cagcuccgcc cggcgcccgc 2027720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 277ugauccgcag cagctccgcc 2027820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 278gcucgggtcc tgatccgcag 2027920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 279aucgggaatc ggctcggguc 2028020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 280ucugggtcgg gatcgggaau

2028120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 281cgcgggttag gatctggguc 2028220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 282ggggcggggg cgcggguuag 2028320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 283ggcggcggcg gcggggcggg 2028420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 284ugcgucgtac atggcggcgg 2028520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 285agccgcgctc tgcgtcguac 2028620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 286aggacaagct ccagccgcgc 2028720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 287agcccgcgaa ggacaagcuc 2028820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 288caggaagccg cagcccgcga 2028920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 289cguggtagaa gcccaggaag 2029020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 290ucgccccgac gtggtagaag 2029120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 291caggcagcgg gtcgccccga 2029220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 292gggcgtgctc gctcaggcag 2029320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 293aggaggtgcg gggcgugcuc 2029420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 294cgcgcgtcgc ggaggaggug 2029520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 295aacaacatgc gcgcgucgcg 2029620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 296gccgaagcgc cgaacaacau 2029720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 297ugcaacgccc cggccgaagc 2029820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 298gccgacgcag tgcaacgccc 2029920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 299cggagaggac gccgacgcag 2030020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 300uccagcggga taccggagag 2030120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 301agaguctgct ccagcgggau 2030220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 302agaggacctg cagagucugc 2030320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 303cgcacaagat ctgagaggac 2030420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 304ccuggccttc cgcacaagau 2030520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 305uguuccgact cctggccuuc 2030620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 306ggaagatgcc aatgtuccga 2030720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 307aaggatggat ggaagaugcc 2030820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 308ugcuuaagtt gaaggaugga 2030920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 309gucggaggaa cttgcuuaag 2031020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 310gcagagaccc tgtcggagga 2031120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 311cgggaggcat ttgcagagac 2031220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 312ggacattggc cgggaggcau 2031320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 313agaugagctg gtggacauug 2031420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 314auuuugccgg agatgagcug 2031520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 315agagatgcct attttgccgg 2031620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 316acacuctggt aagagagaug 2031720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 317ccccatcaga cactcuggua 2031820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 318accagaacgt tttccccauc 2031920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 319aagucagaca ccagaacguu 2032020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 320cuuuggaccg aaagtcagac 2032120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 321ccacgacttc gtcttuggac 2032220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 322accaaggcat ccacgacuuc 2032320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 323aagcaggaac ataccaaggc 2032420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 324agaaggggat gaagcaggaa 2032520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 325aggccactgt agaaggggau 2032620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 326aaggagggat aaggccacug 2032720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 327cgccuctgaa ggaaggaggg 2032820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 328acauatcgca cgcctcugaa 2032920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 329acucctccat ccacauaucg 2033020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 330acguugtcac tcactccucc 2033120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 331aaugaagggt acgttgucac 2033220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 332guuuuggcat caatgaaggg 2033320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 333ggugatggtt gttttggcau 2033420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 334agaaggggga cacggugaug 2033520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 335acuccccata gaagggggac 2033620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 336gcagatgtcg tactccccau 2033720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 337acuugacttt agggcagaug 2033820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 338aaagutcgtg gacttgacuu 2033920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 339ccacatgaag aaagtucgug 2034020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 340uuggugatgt ccacaugaag 2034120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 341cguagactga gcttggugau 2034220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 342cugugcagag gcgtagacug 2034320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA

Molecule Synthetic oligonucleotide" 343guagaggttc cctgtgcaga 2034420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 344ucgagagaag gtagagguuc 2034520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 345gggacaaaag ctctcgagag 2034620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 346ugagatccgg ggggacaaaa 2034720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 347ccagcacctt gagatccggg 2034820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 348aggcatatct ctcccagcac 2034920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 349uaucctcgaa ggcataucuc 2035020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 350gaaugcatcc aaatauccuc 2035120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 351uccaagaacc tgaatgcauc 2035220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 352ugcccttctc ttccaagaac 2035320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 353uguugcagat gccctucucu 2035420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 354cuggctgggg cctgtugcag 2035520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 355augacttcag gcctggcugg 2035620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 356cccuuctgag gatgacuuca 2035720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 357caggatccat cccttcugag 2035820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 358auggcgacct caggauccau 2035920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 359ugcccagctg ggcatggcga 2036020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 360acucatgttt gcccagcugg 2036120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 361ggaagaatcc agactcaugu 2036220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 362agccgactcc ggggaagaau 2036320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 363acagccaagg cagccgacuc 2036420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 364ccuccagcct cacagccaag 2036520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 365gcucatctcc ctccagccuc 2036620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 366agguggtcta gcagcucauc 2036720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 367cugagacgca ggtggucuag 2036820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 368agggcaggat gctgagacgc 2036920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 369gcucucatcc cagggcagga 2037020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 370guguccagga tgctcucauc 2037120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 371cugggcgaga gggtguccag 2037220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 372cuguagcgag cctgggcgag 2037320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 373ucacucagtg ctgtagcgag 2037420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 374cuuucatttc ttcacucagu 2037520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 375auccaccttt gtcttucauu 2037620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 376uugcucatgt atccaccuuu 2037720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 377aguugcaaat cttgcucaug 2037820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 378aaugggtagc aagttgcaaa 2037920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 379agacattatc ctaatgggua 2038020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 380agcautacat aagacauuau 2038120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 381aggguacagg gcagcauuac 2038220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 382auuccacagg caggguacag 2038320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 383cgcaatggca gattccacag 2038420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 384cuggacaatc gcaatggcag 2038520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 385gucaccagtc tctggacaau 2038620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 386aucuggaagc catgtcacca 2038720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 387ucgucgggca tatctggaag 2038820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 388cacaggacat cgtcgggcau 2038920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 389acccactgca accacaggac 2039020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 390accugtgagg tcacccacug 2039120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 391cucgagtgaa cacctgugag 2039220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 392acaucagcac tcgagugaac 2039320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 393gcggggagca gacacaucag 2039420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 394gaccuggagg cggggagcag 2039520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 395acuggcattt gggaccugga 2039620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 396uuggctgctc actggcauuu 2039720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 397auggggaggc ctgttggcug 2039820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 398ucaggtgtgc atggggaggc 2039920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 399ggccagtcct gctcaggugu 2040020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 400gaguccagca gggccagucc 2040120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 401gggagcaggg agtccagcag 2040220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 402acagcccttg ggggagcagg 2040320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 403gucuctgctg gacagcccuu 2040420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 404gccuctgctt tggtcucugc 2040520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 405ccgcggggtg gcctcugcuu 2040620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic

oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 406accugaggat ggaccgcggg 2040720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 407guucaggctg gacctgagga 2040820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 408ccaagaagaa gttcaggcug 2040920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 409guacuttatt gcccaagaag 2041020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 410agcaccagca ggtacuuuau 2041120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 411gagagcccct cagcaccagc 2041220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 412ggaaaggtgg agagccccuc 2041320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 413agugaaaaac tgggaaaggu 2041420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 414acucutctct agtgaaaaac 2041520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 415aagugactca cagacucuuc 2041620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 416cucgcctcct caagtgacuc 2041720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 417ucugctagac tcgccuccuc 2041820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 418accuctgaaa gaatcugcua 2041920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 419aaacuttagc acctcugaaa 2042020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 420acaaagatgg gaaacuuuag 2042120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 421ggaggtagct gcacaaagau 2042220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 422cagcaatgcg gaggtagcug 2042320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 423aggggtcact acacagcaau 2042420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 424acgucacagg caggggucac 2042520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 425ugggatcctc cacgtcacag 2042620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 426gcucagaggc tgggauccuc 2042720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 427aaaccaactc agctcagagg 2042820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 428uagcutttca taaaaccaac 2042920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 429agguugcttc ctagcuuuuc 2043020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 430acaggcgaaa ggttgcuucc 2043120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 431uggaccgctg cacaggcgaa 2043220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 432agagutaagt gctggaccgc 2043320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 433gcugatgtat tagaguuaag 2043420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 434auuaacgcat gctgauguau 2043520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 435ccaaccagct gaattaacgc 2043620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 436ggugucattt cccaaccagc 2043720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 437ugggcttcct ggtgtcauuu 2043820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 438gaccctctgc actgggcuuc 2043920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 439agucagtaag ggacccucug 2044020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 440gccacgaaac agtcaguaag 2044120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 441ccauuaatag ggccacgaaa 2044220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 442ggaacagtct gaccauuaau 2044320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 443accucatgct ggaacagucu 2044420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 444ugucattcta agaaccucau 2044520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 445ccaaacacct gtcatucuaa 2044620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 446gcccccaccc atccaaacac 2044720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 447ccccatcaca aggcccccac 2044820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 448cagcctaccc cccatcacaa 2044920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 449ucacacatgg gccagccuac 2045020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 450caccccacaa gatcacacau 2045120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 451ucuuccctcc accccacaag 2045220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 452ucaugctatt ctcttcccuc 2045320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 453gggaagtggg atcatgcuau 2045420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 454ucccacagca tggggaagug 2045520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 455acugcacccc ttcccacagc 2045620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 456ucuuggggac gaactgcacc 2045720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 457gcagugtcgt tcttggggac 2045820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 458accacctgac aggcaguguc 2045920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 459aucuutgcag accaccugac 2046020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 460caaggttatc atcttugcag 2046120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 461guuuutagta gtcaagguua 2046220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 462cgccatggag acgttuuuag 2046320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 463cuugutaccc ccgccaugga 2046420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 464agauuatcat cttgtuaccc 2046520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 465aaaautaagt agattaucau 2046620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 466aaaggtgttc taaaauuaag 2046720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 467aguuaggtga aaaagguguu 2046820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 468aaacattatt ttagtuaggu 2046920DNAArtificial

Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 469aaaactcttt aaacauuauu 2047020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 470acauutttat acaaaacucu 2047120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 471aacgcttcct tacatuuuua 2047220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 472aacaggtaac aacgcuuccu 2047320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 473auacaaaatt caacagguaa 2047420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 474acugattcac ataatacaaa 2047520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 475acuaacatct cactgauuca 2047620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 476aggcutattc tactaacauc 2047720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 477uuuuuttttt aaggcuuauu 2047820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 478aaccgatttt tttttuuuua 2047920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 479ccacugcacc caaccgauuu 2048020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 480acagccgtgt gccacugcac 2048120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 481aagugctggg attacagccg 2048220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 482uuggcctccc aaagtgcugg 2048320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 483aucugccaac cttggccucc 2048420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 484accucaggtg atctgccaac 2048520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 485cuugaactcc tgaccucagg 2048620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 486ccagactggt cttgaacucc 2048720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 487ugcuatgttg gccagacugg 2048820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 488gacagggttt tgctauguug 2048920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 489auuuutagta gagacagggu 2049020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 490auaauttttg tatttuuagu 2049120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 491accaugccca gataauuuuu 2049220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 492aggcatgcac caccaugccc 2049320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 493agcugggatt acaggcaugc 2049420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 494cuuccgaata gctgggauua 2049520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 495ccugcctcag ccttccgaau 2049620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 496ucaagtgatt ctcctgccuc 2049720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 497ccucctgggt tcaagugauu 2049820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 498ccgcaacctc cgcctccugg 2049920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 499aaucucagct caccgcaacc 2050020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 500ugaaatggtg caatcucagc 2050120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 501aggcuggaat gaaatggugc 2050220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 502acucatgttg cccaggcugg 2050320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 503ucagactttc actcauguug 2050420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 504uuuuuttttg agtcagacuu 2050520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 505uuuuaaattt tttttuuuug 2050620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 506gauuattttg tttttuaaau 2050720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 507cugcacacta gattauuuug 2050820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 508aggugaatgc cctgcacacu 2050920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 509uggggggctg aggtgaaugc 2051020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 510cuuggctcct gcctgggggg 2051120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 511ccugctgtgc ttggcuccug 2051220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 512aggcggaagc tcctgcugug 2051320DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 513caguggagag gaggcggaag 2051420DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 514aguugtgtgc tccaguggag 2051520DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 515agccaggttc aagttgugug 2051620DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 516gcagaaaata agccagguuc 2051720DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 517ggggctggtc cctgcagaaa 2051820DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 518acugaccatg tggggcuggu 2051920DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 519ggagaaactc actgaccaug 2052020DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 520cgccacacat ggggagaaac 2052120DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 521acucuctcat cgccacacau 2052220DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 522cuuuatttct acactcucuc 20



User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
New patent applications in this class:
DateTitle
2022-09-22Electronic device
2022-09-22Front-facing proximity detection using capacitive sensor
2022-09-22Touch-control panel and touch-control display apparatus
2022-09-22Sensing circuit with signal compensation
2022-09-22Reduced-size interfaces for managing alerts
New patent applications from these inventors:
DateTitle
2022-01-06Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
2021-12-30Polynucleotide agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
2021-10-28Ketohexokinase (khk) irna compositions and methods of use thereof
2021-10-14Serpina1 irna compositions and methods of use thereof
2021-10-07Angiotensinogen (agt) irna compositions and methods of use thereof
Website © 2025 Advameg, Inc.