VSV/NDV HYBRID VIRUSES FOR ONCOLYTIC THERAPY OF CANCER

Abstract

The present invention relates to recombinant oncolytic viruses comprising a vesicular stomatitis virus (VSV), wherein the glycoprotein (G protein) of VSV is deleted; and which comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV); and the hemagglutinin neuraminidase (HN) protein of NDV. The present invention further relates to nucleic acids encoding for the recombinant oncolytic virus and vectors comprising the nucleic acids. The present invention further relates to pharmaceutical compositions comprising the rVSV of the invention, the nucleic acid or the vector, further to uses as gene delivery tool and/or for tumor detection. The present invention further relates to the recombinant oncolytic vesicular stomatitis virus (VSV) for use in medicine, in particular for the diagnosis, prevention and/or treatment of cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation application of co-pending application Ser. No. 16/097,748, filed Oct. 30, 2018, now U.S. Pat. No. 10,906,942; which is a National Stage Application of International Application Number PCT/EP2017/062007, filed May 18, 2017; which claims priority to European Patent Application No. 16170445.7, filed May 19, 2016.

[0002] The Sequence Listing for this application is labeled "SeqList-30Oct18-ST25.txt", which was created on Oct. 30, 2018 and is 112 KB. The entire content is incorporated herein by reference in its entirety.

[0003] The present invention relates to recombinant oncolytic viruses comprising a vesicular stomatitis virus (VSV), wherein the glycoprotein (G protein) of VSV is deleted; and which comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV); and the hemagglutinin neuraminidase (HN) protein of NDV. The present invention further relates to nucleic acids encoding for the recombinant oncolytic virus and vectors comprising the nucleic acids. The present invention further relates to pharmaceutical compositions comprising the rVSV of the invention, the nucleic acid or the vector, further to uses as gene delivery tool and/or for tumor detection. The present invention further relates to the recombinant oncolytic vesicular stomatitis virus (VSV) for use in medicine, in particular for the diagnosis, prevention and/or treatment of cancer.

BACKGROUND OF THE INVENTION

[0004] Oncolytic viruses (OVs) represent a novel class of therapeutic agents for cancer treatment, due to their intrinsic ability to selectively replicate and kill tumor cells, while sparing the surrounding normal tissue (Lorence et al., 1994; Coffey et al., 1998; Kirn et al., 2001; Peng et al., 2001). OV therapies involve the use of replication-competent viruses that are either inherently tumor selective or have been engineered to preferentially grow in tumor cells. During the process of malignant transformation, genetic abnormalities accumulate to provide cancer cells with growth and survival advantages. Many OVs exploit such defects in cellular signaling pathways to support their own replication in these cells. In particular, many cancer cells are impaired in their ability to secrete or respond to interferon (IFN), which is a key mechanism in the innate immune response against invading viruses in normal cells. These defects prevent tumor cells from mounting a productive antiviral defense, and, thus, replication of the OV is supported specifically in these cells.

[0005] Oncolytic viruses exert their effects both by direct killing of infected tumor cells, as well as indirect effects, such as destruction of tumor vasculature and induction of adaptive immune responses, which can be directed against the tumor and lead to destruction of neighboring uninfected tumor cells. Furthermore, genetics systems are available, which allow us to engineer and rescue recombinant viral vectors from plasmid DNA. In this way, viruses can be modified to increase tumor specificity or to express therapeutic genes and/or reporter genes.

[0006] Over the last decade, significant progress has been made in the development of enhanced OV therapies, and a variety of vectors have entered clinical trials (Kim et al., 2001; Everts and van der Poel, 2005; Patel and Kratzke, 2013). Recently, a recombinant herpes simplex virus I vector was the first oncolytic virus to be approved by the FDA for use as a clinical agent (press release Oct. 27, 2015, Amgen), and approval in Europe is expected to follow. However, in general, clinical trial results are often disappointing due to a lack of reliable and predictive preclinical models and due to inadequate tumor responses to most OV therapies in immune competent hosts.

[0007] Therapeutic efficacy of oncolytic viral therapy often comes as a trade-off with safety, such that potent vectors are often associated with toxicity, while safer viruses provide attenuated therapeutic effects. Despite promising preclinical data, the development of vesicular stomatitis virus (VSV) as a clinical agent has been substantially hampered by the fact that severe neurotoxicity has been observed in rodents and nonhuman primates in response to treatment with wild-type VSV (van den Pool et al., 2002; Johnson et al., 2007). In addition to the safety aspect, the rapid accumulation of high intratumoral titers of VSV, as a consequence of its short life cycle, results in an early and potent innate immune response, which severely limits the ability of the virus to efficiently spread and destroy the entire tumor mass before being cleared from the host (Altomonte et al., 2008).

[0008] Newcastle disease virus (NDV) has been shown to be a potent oncolytic agent with an attractive safety profile in humans; however, the use of NDV poses an environmental risk to birds and the poultry industry, as avian species are the natural hosts of the virus. Although mesogenic and velogenic strains of NDV have been shown to be the most effective as oncolytic viruses, they have been classified by the USDA as select agents since 2008, prohibiting their use and thereby severely impeding the development of NDV into a clinical agent (www.selectagents.gov).

[0009] To improve the safety of oncolytic VSV vectors, researchers have investigated a variety of approaches. First, recombinant VSVs harboring nucleotide substitutions or deletions to alter the amino acid composition of the matrix (M) protein at position 51 interfere with the ability of the endogenous M protein to inhibit cellular transcription and nucleocytoplasmic RNA transfer, allowing for antiviral cellular responses to be launched. Although these vectors have been shown to be safer than wildtype, intratumoral replication is also attenuated (Stojdl et al., 2003; Ebert et al., 2005), limiting the therapeutic value of this approach. Another strategy to improve the safety of VSV involves the incorporation of miRNA target sequences into the virus genome in order to modify the tropism of the virus, however these vectors are also less effective (Edge et al., 2008; Kelly et al., 2010).

[0010] Various attempts are being explored to engineer the NDV genome to limit the pathogenicity in avian species, see e.g. patent application WO 2015/032755 A1. Whether or not these modifications will truly improve safety and the effect of these modifications on the oncolytic capacity of the vectors remain to be seen.

[0011] Thus, there is a need in the art for improved means and methods for oncolytic virotherapy as well as for improved oncolytic viruses.

SUMMARY OF THE INVENTION

[0012] According to the present invention this object is solved by a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV),

[0013] wherein the glycoprotein (G protein) of VSV is deleted, and which comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV); and the hemagglutinin neuraminidase (HN) protein of NDV.

[0014] According to the present invention this object is solved by a nucleic acid encoding the recombinant oncolytic virus of the invention.

[0015] According to the present invention this object is solved by a vector comprising the nucleic acid of the invention.

[0016] According to the present invention this object is solved by a pharmaceutical composition, comprising:

[0017] (i) the recombinant oncolytic virus, the nucleic acid or the vector of the present invention; and

[0018] (ii) optionally, pharmaceutically acceptable carrier(s) and/or excipient(s).

[0019] According to the present invention this object is solved by the use of the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention, as gene delivery tool, and/or (noninvasive) imaging of virus biodistribution, and/or for tumor detection.

[0020] According to the present invention this object is solved by providing the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention for use in medicine.

[0021] According to the present invention this object is solved by providing the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention for use in the diagnosis, prevention and/or treatment of cancer.

[0022] According to the present invention this object is solved by a method of diagnosis, prevention and/or treatment of cancer comprising the step of

[0023] administering to a subject in need thereof a therapeutically effective amount of the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention.

DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION

[0024] Before the present invention is described in more detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. For the purpose of the present invention, all references cited herein are incorporated by reference in their entireties.

[0025] Concentrations, amounts, and other numerical data may be expressed or presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and thus should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of "20 to 100 nucleotides" should be interpreted to include not only the explicitly recited values of 20 to 100, but also include individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, . . . 97, 98, 100 and sub-ranges such as from 25 to 35, from 20 to 40, from 25 to 50, etc. This same principle applies to ranges reciting only one numerical value, such as "at least 25 nucleotides". Furthermore, such an interpretation should apply regardless of the breadth of the range or the characteristics being described.

Oncolytic Viruses and VSV Vectors

[0026] As discussed above, the present invention provides recombinant oncolytic viruses.

[0027] In particular, the present invention provides recombinant oncolytic VSV viruses wherein the glycoprotein protein of VSV is pseudotyped.

[0028] Among the most promising OV vector platforms under development are vesicular stomatitis virus (VSV) and Newcastle disease virus (NDV).

Vesicular stomatitis virus (VSV) is a negative-strand RNA virus of the Rhabdovirus family.

[0029] VSV vectors are very attractive oncolytic agents due to their inherent tumor specificity and rapid replication cycle, which results in high intratumoral titers and subsequent tumor cell lysis.

[0030] The genome of VSV is a single molecule of negative-sense RNA that encodes five major proteins: glycoprotein (G), large polymerase protein (L), phosphoprotein (P), matrix protein (M) and nucleoprotein (N). The total genome is about 11,000 nucleotides. The VSV G protein enables viral entry. It mediates viral attachment to an LDL receptor (LDLR) or an LDLR family member present on the host cell. Following binding the VSV-LDLR complex is rapidly endocytosed. It then mediates fusion of the viral envelope with the endosomal membrane. VSV enters the cell through partially clathrin-coated vesicles; virus-containing vesicles contain more clathrin and clathrin adaptor than conventional vesicles. Virus-containing vesicles recruit components of the actin machinery for their interaction, thus inducing its own uptake. Replication occurs in the cytoplasm.

[0031] The VSV L protein is encoded by half the genome, and combines with the phosphoprotein to catalyze replication of the mRNA.

[0032] The VSV M protein is encoded by an mRNA that is 831 nucleotides long and translates to a 229 amino acid-protein. The predicted M protein sequence does not contain any long hydrophobic or nonpolar domains that might promote membrane association. The protein is rich in basic amino acids and contains a highly basic amino terminal domain.

VSV Indiana Complete Genome SEQ ID NO: 1

[0033] NCBI GenBank accession No. J02428.1

VSV Indiana G Protein SEQ ID NOs: 2 and 3

[0034] See GenBank accession No. X03633.1 for nucleotide and amino acid sequence.

[0035] Newcastle disease virus (NDV) is an avian virus of the Paramyxovirus family. Members of this family have a single stranded linear RNA. The total genome is about 16,000 nucleotides. Replication of the virus takes place in the cytoplasm of the host cell.

[0036] It is similar to VSV in that it is a negative-stand RNA virus and has been developed as an oncolytic virus, due to its innate ability to replicate and cause lysis in tumor cells, while leaving healthy cells unharmed (Altomonte et al., 2010; Vigil et al., 2007). Phase I-II clinical trials have shown promise for NDV and suggest that there is minimal toxicity related to the therapy. A major benefit of NDV as an oncolytic agent is that the viral envelope, which is comprised of a hemagglutinin-neuraminidase (HN) and fusion (F) protein, mediates not only virus attachment and fusion to the target cell, but it causes fusion of infected cells to their neighboring uninfected cells, providing a potent mechanism for viral spread and tumor cell killing. Furthermore, new evidence indicates that the syncytia formation caused by cell-cell fusion results in a multimodal cell death response, which can synergize with the direct oncolytic effect of the virus for a potent mechanism of tumor destruction (Cuadrado-Castano et al., 2015).

[0037] Two proteins of Newcastle disease virus are inserted in the envelope. They are the haemagglutinin/neuraminidase protein (HN) and the fusion protein (F). These two proteins are important in determining the virulence of the virus and how the virus infects host cells.

[0038] The haemagglutinin/neuraminidase protein has two sections that are of interest: (1) The haemagglutinin section, which is an attachment protein and binds to receptors on the outside of the membrane of host cells including red blood cells. (2) The neuraminidase section is the active site of an enzyme that aids in the release of the virus from the membrane of host cells. The activity of this enzyme affects the time taken for the virus to elute from red blood cells.

[0039] The fusion protein F fuses the virus envelope to the membrane of the host cell. This allows penetration of the host cell by the viral genome. In order for fusion to occur, the shape of the native fusion protein must be changed. This change happens when a host cell protease cleaves the protein at a specific cleavage site. After this has happened, the fusion protein is activated and can now fuse to the membrane of the cell. The sequence of the amino acids around the cleavage site determines the range of proteases that can activate cleavage of the protein. This sequence therefore determines the virulence.

[0040] NDV F protein is responsible for viral fusion with the cell membrane and for viral spread from cell to cell via formation of syncytia. The presence of a multibasic cleavage site within the F protein allows for protein cleavage and activation by a broad range of proteases and is a determinant of virulence in velogenic viral strains.

[0041] To increase oncolytic potency of a highly attenuated lentogenic Hitchner B1 NDV strain, a polybasic cleavage site was introduced into the F protein to generate rNDV/F3aa (Vigil et al., 2007). While the resultant virus exhibited only an intermediate virulence phenotype based on a mean death time in embryonated eggs, the virus formed large syncytia and was enhanced in its replication in cancer cells, leading to enhanced oncolytic effects in various animal tumor models. Similar findings were shown when the F protein of the lentogenic NDV La Sota strain was modified in an analogous fashion (Peeters et al., 1999). The inventors have further demonstrated that a single amino acid substitution from leucine to alanine at amino acid 289 (L289A) in the F3aa-modified fusion protein results in substantially greater syncytial formation and tumor necrosis than the virus bearing only the F3aa mutation, without any additional toxicity (Altomonte et al., 2010).

[0042] The fusogenic and oncolytic activity of the rNDV/F3aa strain can be further enhanced by a point mutation in the F protein at residue 289 from leucine to alanine, generating rNDV/F3aa (L289A). In an orthotopic immunocompetent liver tumor rat model, administration of the mutant virus via hepatic arterial infusion resulted in significant syncytia formation and necrosis, which translated to a significant 20% prolongation of survival over treatment with the original rNDV/F3aa virus (Altomonte et al., 2010).

TABLE-US-00001 NDV Hitchner B1 complete genome SEQ ID NO: 4 GenBank accession No. AF375823 NDV HN protein SEQ ID NOs: 5 and 6 See GenBank accession No. AF375823 and NCBI Gene ID 912270 for nucleic acid and amino acid sequence. NDVF protein SEQ ID NOs: 7 and 8 See GenBank accession No. AF375823 and NCBI Gene ID 912271 for nucleic acid and amino acid sequence. SEQ ID NO: 8 MGSRPFTKNP APMMLTIRVA LVLSCICPAN SIDGRPFAAA GIVVTGDKAV NIYTSSQTGS 60 IIVKLLPNLP KDKEACAKAP LDAYNRTLTT LLTPLGDSIR RIQESVTTSG GGRQGRLIGA 120 IIGGVALGVA TAAQITAAAA LIQAKQNAAN ILRLKESIAA TNEAVHEVTD GLSQLAVAVG 180 KMQQFVNDQF NKTAQELDCI KIAQQVGVEL NLYLTELTTV FGPQITSPAL NKLTIQALYN 240 LACGNMDYLL TKLGIGNNQL SSLIGSGLIT GNPILYDSQT QLLGIQVTLP SVGNLNNMRA 300 TYLETLSVST TRGFASALVP KVVTQVGSVI EELDTSYCIE TDLDLYCTRI VTFPMSPGIY 360 SCLSGNTSAC MYSKTEGALT TPYMTIKGSV IANCKMTTCR CVNPPGIISQ NYGEAVSLID 420 KQSCNVLSLG GITLRLSGEF DVTYQKNISI QDSQVIITGN LDISTELGNV NNSISNALNK 480 LEESNRKLDK VNVKLTSTSA LITYIVLTII SLVFGILSLI LACYLMYKQK AQQKTLLWLG 540 NNTLDQMRAT TKM 553 NDV F3aa-modified fusion protein SEQ ID NOs: 9 and 10 SEQ ID NO: 9 (Park et al., 2006 and Altomonte et al., 2010) ATGGGCTCCAGACCTTCTACCAAGAACCCAGCACCTATGATGCTGACTATCCGGGTCGCGCTGGTACTGAGTTG- C ATCTGCCCGGCAAACTCCATTGATGGCAGGCCTCTTGCAGCTGCAGGAATTGTGGTTACAGGAGACAAAGCAGI- C AACATATACACCTCATCCCAGACAGGATCAATCATAGTTAAGCTCCTCCCGAATCTGCCCAAGGATAAGGAGGC- A TGTGCGAAAGCCCCCTTGGATGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGACTCTATCCG- T AGGATACAAGAGTCTGTGACTACATCTGGAGGGCGGAGACAGAGGCGCTTTATAGGCGCCATTATTGGCGGTGT- G GCTCTTGGGGTTGCAACTGCCGCACAAATAACAGCGGCCGCAGCTCTGATACAAGCCAAACAAAATGCTGCCAA- C ATCCTCCGACTTAAAGAGAGCATTGCCGCAACCAATGAGGCTGTGCATGAGGTCACTGACGGATTATCGCAACT- A GCAGTGGCAGTTGGGAAGATGCAGCAGTTTGTTAATGACCAATTTAATAAAACAGCTCAGGAATTAGACTGCAT- C AAAATTGCACAGCAAGTTGGTGTAGAGCTCAACCTGTACCTAACCGAATTGACTACAGTATTCGGACCACAAAT- C ACTTCACCTGCCTTAAACAAGCTGACTATTCAGGCACTTTACAATCTAGCTGGTGGGAATATGGATTACTTATT- G ACTAAGTTAGGTATAGGGAACAATCAACTCAGCTCATTAATCGGTAGCGGCTTAATCACCGGTAACCCTATTCT- A TACGACTCACAGACTCAACTCTTGGGTATACAGGTAACTCTACCTTCAGICGGGAACCTAAATAATATGCGTGC- C ACCTACTTGGAAACCTTATCCGTAAGCACAACCAGGGGATTTGCCTCGGCACTTGTCCCAAAAGTGGTGACACA- G GTCGGTTCTGTGATAGAAGAACTTGACACCTCATACTGTATAGAAACTGACTTAGATTTATATTGTACAAGAAT- A GTAACGTTCCCTATGTCCCCTGGTATTTACTCCTGCTTGAGCGGCAATACATCGGCCTGTATGTACTCAAAGAC- C GAAGGCGCACTTACTACACCATATATGACTATCAAAGGCTCAGTCATCGCTAACTOCAAGATGACAACATGTAG- A TGTGTAAACCCCCCGGGTATCATATCGCAAAACTATGGAGAAGCCGTGTCTCTAATAGATAAACAATCATGCAA- T GTTTTATCCTTAGGCGGGATAACTTTAAGGCTCAGTGGGGAATTCGATGTAACTTATCAGAAGAATATCTCAAT- A CAAGATTCTCAAGTAATAATAACAGGCAATCTTGATATCTCAACTGAGCTTGGGAATGTCAACAACTCGATCAG- T AATGCTTTGAATAAGTTAGAGGAAAGCAACAGAAAACTAGACAAAGTCAATGTCAAACTGACCAGCACATCTGC- T CTCATTACCTATATCGTTTTGACTATCATATCTCTTGTTTTTGGTATACTTAGCCTGATTCTAGCATGCTACCT- A ATGTACAAGCAAAAGGCGCAACAAAAGACCTTATTATGGCTTGGGAATAATACCCTAGATCAGATGAGAGCCAC- T ACAAAAATGTGA SEQ ID NO: 10 (Park et al., 2006 and Altomonte et al., 2010) MGSRPFTKNP APMMLTTRVA LVLSCICPAN SIDGRPFAAA GIVVTGDKAV NIYTSSQTGS 60 IIVKLLPNLP KDKEACAKAP LDAYNRTLTT LLTPLGDSIR RIQESVTTSG GRRQRRFIGA 120 IIGGVALGVA TAAQITAAAA LIQAKQNAAN ILRLKESIAA TNEAVHEVTD GLSQLAVAVG 180 KMQQFVNDQF NKTAQELDCI KIAQQVGVEL NLYLTELTTV FGPQITSPAL NKLTIQALYN 240 LAGGNMDYLL TKLGIGNNQL SSLIGSGLIT GNPILYDSQT QLLGIQVTLP SVGNLNNMRA 300 TYLETLSVST TRGFASALVP KVVTQVGSVI EELDTSYCIE TDLDLYCTRI VTFPMSPGIY 360 SCLSGNTSAC MYSKTEGALT TPYMTIKGSV IANCKMTTCR CVNPPGIISQ NYGEAVSLID 420 KQSCNVLSLG GITLRLSGEF DVTYQKNISI QDSQVIITGN LDISTELGNV NNSISNALNK 480 LEESNRKLDK VNVKLTSTSA LITYTVLTII SLVFGILSLI LACYLMYKQK AQQKTLLWLG 540 NNTLDQMRAT TKM NDV F3aa-modified fusion protein with L289A SEQ ID NOs: 11 and 12 SEQ ID NO: 11 (See also Altomonte et al., 2010) ATGGGCTCCAGACCTTCTACCAAGAACCCAGCACCTATGATGCTGACTATCCGGGTCGCGCTGGTACTGAGTTG- C ATCTGCCCGGCAAACTCCATTGATGGCAGGCCTCTTGCAGCTGCAGGAATTGTGGTTACAGGAGACAAAGCAGT- C AACATATACACCTCATCCCAGACAGGATCAATCATAGTTAAGCTCCTCCCGAATCTGCCCAAGGATAAGGAGGC- A TGTGCGAAAGCCCCCTTGGATGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGACTCTATCCG- T AGGATACAAGAGTCTGTGACTACATCTGGAGGGCGGAGACAGAGGCGCTTTATAGGCGCCATTATTGGCGGTGT- G GCTCTTGGGGTTGCAACTGCCGCACAAATAACAGCGGCCGCAGCTCTGATACAAGCCAAACAAAATGCTGCCAA- C ATCCTCCGACTTAAAGAGAGCATTGCCGCAACCAATGAGGCTGTGCATGAGGTCACTGACGGATTATCGCAACT- A GCAGTGGCAGTTGGGAAGATGCAGCAGTTTGTTAATGACCAATTTAATAAAACAGCTCAGGAATTAGACTGCAT- C AAAATTGCACAGCAAGTTGGTGTAGAGCTCAACCTGTACCTAACCGAATTGACTACAGTATTCGGACCACAAAT- C ACTTCACCTGCCTTAAACAAGCTGACTATTCAGGCACTTTACAATCTAGCTGGTGGGAATATGGATTACTTATT- G ACTAAGTTAGGTATAGGGAACAATCAACTCAGCTCATTAATCGGTAGCGGCTTAATCACCGGTAACCCTATTCT- A TACGACTCACAGACTCAACTCTTGGGTATACAGGTAACTGCACCTTCAGTCGGGAACCTAAATAATATGCGTGC- C ACCTACTTGGAAACCTTATCCGTAAGCACAACCAGGGGATTTGCCTCGGCACTTGTCCCAAAAGTGGTGACACA- G GTCGGTTCTGTGATAGAAGAACTTGACACCTCATACTGTATAGAAACTGACTTAGATTTATATTGTACAAGAAT- A GTAACGTTCCCTATGTCCCCTGGTATTTACTCCTGCTTGAGCGGCAATACATCGGCCTGTATGTACTCAAAGAC- C GAAGGCGCACTTACTACACCATATATGACTATCAAAGGCTCAGTCATCGCTAACTGCAAGATGACAACATGTAG- A TGTGTAAACCCCCCGGGTATCATATCGCAAAACTATGGAGAAGCCGTGTCTCTAATAGATAAACAATCATGCAA- T GTTTTATCCTTAGGCGGGATAACTTTAAGGCTCAGTGGGGAATTCGATGTAACTTATCAGAAGAATATCTCAAT- A CAAGATTCTCAAGTAATAATAACAGGCAATCTTGATATCTCAACTGAGCTTGGGAATGTCAACAACTCGATCAG- T AATGCTTTGAATAAGTTAGAGGAAAGCAACAGAAAACTAGACAAAGTCAATGTCAAACTGACCAGCACATCTGC- T CTCATTACCTATATCGTTTTGACTATCATATCTCTTGTTTTTGGTATACTTAGCCTGATTCTAGCATGCTACCT- A ATGTACAAGCAAAAGGCGCAACAAAAGACCTTATTATGGCTTGGGAATAATACCCTAGATCAGATGAGAGCCAC- T ACAAAAATGTGA SEQ ID NO: 12 (See also Altomonte et al., 2010) MGSRPFTKNP APMMLTIRVA LVLSCICPAN SIDGRPFAAA GIVVTGDKAV NIYTSSQTGS 60 IIVKLLPNLP KDKEACAKAP LDAYNRTLTT LLTPLGDSIR RIQESVTTSG GRRQRRFIGA 120 IIGGVALGVA TAAQITAAAA LIQAKQNAAN ILRLKESTAA TNEAVHEVTD GLSQLAVAVG 180 KMQQFVNDQF NKTAQELDCI KIAQQVGVEL NLYLTELTTV FGPQITSPAL NKLTIQALYN 240 LAGGNMDYLL TKLGIGNNQL SSLIGSGLIT GNPILYDSQT QLLGTQVTAP SVGNLNNMRA 300 TYLETLSVST TRGFASALVP KVVTQVGSVI EELDTSYCIE TDLDLYCTRI VTFPMSPGIY 360 SCLSGNTSAC MYSKTEGALT TPYMTIKGSV IANCKMTTCR CVNPPGIISQ NYGEAVSLTD 420 KQSCNVLSLG GITLRLSGEE DVTYQKNISI QDSQVIITGN LDISTELGNV NNSISNALNK 480 LEESNRKLDK VNVKLTSTSA LITYIVLTII SLVFGILSLI LACYLMYKQK AQQKTLLWLG 540 NNTLDQMRAT TKM 553

[0043] As discussed above, the present invention provides recombinant oncolytic VSV viruses, wherein the glycoprotein protein of VSV is pseudotyped.

[0044] Recently, the concept of exchanging the glycoprotein ("pseudotyping") of a virus with that of a heterologous virus has been demonstrated as an effective means of altering virus tropism. Using this approach, the viral backbone is kept intact, and therefore, it is hypothesized that virus replication in susceptible cells should be minimally effected. One group has described a VSV vector that has been pseudotyped with the envelope protein of the lymphocytic choriomemingitis virus (LCMV-GP), which has been shown to be significantly less neurotropic than the wildtype vector (Muik et al., 2011). Similarly, the VSV glycoprotein has been exchanged with that of measles virus and modified with single-chain variable antibody fragments to retarget VSV to cancer cells expressing discrete surface receptors (Ayala-Breton et al., 2012).

[0045] In the present invention a recombinant oncolytic virus is provided,

[0046] comprising a vesicular stomatitis virus (VSV),

[0047] wherein the glycoprotein (G protein) of VSV is deleted, and which comprises

[0048] a modified fusion protein (F protein) of Newcastle disease virus (NDV); and

[0049] the hemagglutinin neuraminidase (HN) protein of NDV.

[0050] In a preferred embodiment, the modified fusion protein (F protein) of NDV is the F3aa-modified F protein, and/or comprises at least one amino acid substitution in the protease cleavage site, preferably in position L289, e.g. L289A.

[0051] In a preferred embodiment, the G protein of VSV is replaced by the modified fusion protein and HN protein of NDV.

[0052] The recombinant oncolytic virus furthermore comprises the remaining proteins of VSV, namely the large polymerase protein (L), phosphoprotein (P), matrix protein (M) and nucleoprotein (N).

[0053] For example, the endogenous glycoprotein of VSV can be deleted from a plasmid encoding the full-length VSV genome. The NDV glycoprotein, comprising a modified fusion protein (NDV/F(L289A)) and hemagglutinin-neuraminidase (NDV/HN), can be inserted as discrete transcription units between the VSV matrix (M) and large polymerase (L) genes. See e.g. FIG. 1.

[0054] In an embodiment of the rVSV (vector) of the present invention, the modified fusion protein (F protein) of NDV comprises or consists of the amino acid sequence of SEQ ID NO: 10 [=aa sequence of F3aa protein] or SEQ ID NO: 12 [=aa sequence of F3aa protein/L289A], or

[0055] an amino acid sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the amino acid sequence of SEQ ID NOs: 10 or 12, and/or

[0056] wherein the modified fusion protein (F protein) of NDV is encoded by a nucleotide sequence of SEQ ID NO. 9 [=nucleotide sequence of F3aa protein] or SEQ ID NO: 11[=nucleotide sequence of F3aa protein/L289A], or

[0057] a nucleotide sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the nucleotide sequence of SEQ ID NOs: 9 or 11.

[0058] In an embodiment of the rVSV (vector) of the present invention, wherein the HN protein of NDV comprises or consists of the amino acid sequence of SEQ ID NO: 6, or

[0059] an amino acid sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the amino acid sequence of SEQ ID NO: 6, and/or

[0060] wherein the HN protein of NDV is encoded by a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the nucleotide sequence of SEQ ID NO: 5.

[0061] As discussed above, the present invention comprises nucleic acids encoding the oncolytic viruses of the present invention.

[0062] As discussed above, the present invention comprises vectors comprising the nucleic acids of the present invention.

[0063] In preferred embodiments, the vector of the present invention further comprises:

[0064] reporter gene(s),

[0065] such as HSV1-sr39TK, the sodium iodide symporter (NIS), somatostatin receptor 2 (SSTR2), luciferase (Firefly or Renilla), green fluorescence protein (GFP), lacZ; tyrosinase

[0066] gene(s) to be delivered to target cell(s) or tissue,

[0067] such as gene(s) to be delivered to tumor cell(s) or tumor(s),

[0068] e.g.

[0069] immune stimulating genes, such as IFN-.alpha., IFN-.beta., or granulocyte macrophage colony-stimulating factor (GM-CSF);

[0070] immune checkpoint inhibitory antibodies, such as PD-1, PD1-L, CTLA-4, LAG-3, or B7-H3; and/or

[0071] tumor associated antigens (TAA) for vaccination (specific for the tumor being targeted);

[0072] or combinations thereof.

[0073] In an embodiment, the nucleic acid or the vector of the present invention comprises or consists of the nucleotide sequence of SEQ ID NO: 13 [=nucleotide sequence of complete virus/vector construct], or

[0074] a nucleotide sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the nucleotide sequence of SEQ ID NO: 13, and/or

[0075] comprises or consists of the nucleotide sequence coding for an amino acid sequence with SEQ ID NOs: 6, 12, 14 to 17 [=aa sequence of the proteins encoded by the virus/vector construct], or

[0076] a nucleotide sequence having at least 60%, or preferably at least 70% or 80% or 90% or 95% sequence identity to the nucleotide sequence coding for an amino acid sequence with

[0077] SEQ ID NOs: 6, 12, 14 to 17.

[0078] SEQ ID NO: 13 shows the nucleotide sequence of complete virus/vector construct.

[0079] SEQ ID NOs: 14-17 and 12 and 6 show the amino acid sequences of the proteins encoded by SEQ ID NO: 13, namely:

[0080] SEQ ID NO: 14 amino acid sequence of the protein VSV-N;

[0081] SEQ ID NO: 15 amino acid sequence of the protein VSV-P;

[0082] SEQ ID NO: 16 amino acid sequence of the protein VSV-M;

[0083] SEQ ID NO: 12 amino acid sequence of the protein NDV-F3aa(L289A);

[0084] SEQ ID NO: 6 amino acid sequence of the protein NDV-HN;

[0085] SEQ ID NO: 17 amino acid sequence of the protein VSV-L.

Pharmaceutical Compositions

[0086] As discussed above, the present invention provides a pharmaceutical composition, comprising:

[0087] (i) the recombinant oncolytic virus of the present invention or a nucleic acid of the present invention or a vector of the present invention; and

[0088] (ii) optionally, pharmaceutically acceptable carrier(s) and/or excipient(s).

[0089] In one embodiment, the pharmaceutical composition comprises further drug(s),

[0090] such as

[0091] chemotherapeutic agent(s),

[0092] radiotherapeutic agent(s),

[0093] tumor vaccine(s),

[0094] immune checkpoint inhibitor(s),

[0095] cell carrier system(s),

[0096] small molecule inhibitor(s),

[0097] embolization agent(s),

[0098] shielding polymer(s).

[0099] In one embodiment, the pharmaceutical composition is formulated for systemic delivery, tumor injection, intravenous administration, intra-arterial administration, and/or for intradermal, subcutaneous, intramuscular, intravenous, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intracerebral, intracerebroventricular and intravitreal injection(s).

Uses as Gene Delivery Tool and/or for Tumor Detection

[0100] As discussed above, the present invention provides the use of the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention:

[0101] as gene delivery tool

and/or

[0102] (noninvasive) imaging of virus biodistribution

and/or

[0103] for tumor detection.

[0104] In an embodiment, the vectors of the present invention comprise gene(s) to be delivered to target cell(s) or tissue,

[0105] such as gene(s) to be delivered to tumor cell(s) or tumor(s),

[0106] e.g.

[0107] immune stimulating genes, such as IFN-.alpha., IFN-.beta., or granulocyte macrophage colony-stimulating factor (GM-CSF);

[0108] immune checkpoint inhibitory antibodies, such as PD-1, PD1-L, CTLA-4, LAG-3, or B7-H3; and/or

[0109] tumor associated antigens (TAA) for vaccination (specific for the tumor being targeted).

[0110] In an embodiment, the vectors of the present invention comprise reporter gene(s), such as HSV1-sr39TK, the sodium iodide symporter (NIS), somatostatin receptor 2 (SSTR2), luciferase (Firefly or Renilla), green fluorescence protein (GFP), lacZ, tyrosinase and are then suitable for e.g. noninvasive imaging of virus biodistribution or tumor detection.

Medical Uses

[0111] As discussed above, the present invention provides the recombinant oncolytic viruses, the nucleic acids or the vectors of the present invention or the pharmaceutical composition of the present invention for use in medicine.

[0112] As discussed above, the present invention provides the recombinant oncolytic viruses, the nucleic acids or the vectors of the present invention or the pharmaceutical composition of the present invention for use in the diagnosis, prevention and/or treatment of cancer.

[0113] In one embodiment, the present invention provides the recombinant oncolytic viruses, the nucleic acids or the vectors of the present invention or the pharmaceutical composition of the present invention for use in oncolytic therapy.

[0114] The term "oncolytic virotherapy" as used herein refers to therapy of cancer by administration of oncolytic viruses, nucleic acids encoding them or respective vectors to induce tumor regression.

[0115] In one embodiment, the recombinant oncolytic viruses, the nucleic acids or the vectors of the present invention or the pharmaceutical composition of the present invention are provided for use in combination with other therapies.

Said other therapies can be:

[0116] cell carrier systems,

[0117] e.g. T cells, dendritic cells, NK cells, mesenchymal stem cells, immunotherapies,

[0118] e.g. tumor vaccines or immune checkpoint inhibitors,

[0119] and/or

[0120] standard tumor therapies,

[0121] e.g. radiofrequency ablation, chemotherapy, embolization, small molecule inhibitors.

[0122] In one embodiment, the administration is systemic, intravenous, intra-arterial, via injection into tumor, and/or via intradermal, subcutaneous, intramuscular, intravenous, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intracerebral, intracerebroventricular and intravitreal injection(s).

Methods of Diagnosis, Prevention and/or Treatment of Cancer

[0123] As discussed above, the present invention provides a method of diagnosis, prevention and/or treatment of cancer comprising the step of

[0124] administering to a subject in need thereof a therapeutically effective amount of the recombinant oncolytic virus, the nucleic acid or the vector of the present invention or the pharmaceutical composition of the present invention.

[0125] A therapeutically effective amount of a recombinant oncolytic virus, nucleic acid or vector of the present invention is the amount which results in the desired therapeutic result, in particular tumor regression.

[0126] The recombinant viruses, nucleic acids, vectors or their pharmaceutical composition(s) are preferably administered in multiple cycles over a period of time, such as for several days up to several weeks.

[0127] In one embodiment, the administration is systemic, intravenous, intra-arterial, via injection into tumor, and/or via intradermal, subcutaneous, intramuscular, intravenous, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intracerebral, intracerebroventricular and intravitreal injection(s).

[0128] In one embodiment, the recombinant oncolytic virus, nucleic acid or vector of the present invention or the pharmaceutical composition of the present invention are provided are administered to a subject in need thereof in combination with other therapies.

Said other therapies can be:

[0129] cell carrier systems,

[0130] e.g. T cells, dendritic cells, NK cells, mesenchymal stem cells, immunotherapies,

[0131] e.g. tumor vaccines or immune checkpoint inhibitors,

[0132] and/or

[0133] standard tumor therapies,

[0134] e.g. radiofrequency ablation, chemotherapy, embolization, small molecule inhibitors,

Further Description of Preferred Embodiments

[0135] The invention discloses a pseudotyped VSV vector, in which the endogenous glycoprotein has been deleted and exchanged with modified envelope proteins of Newcastle disease virus (NDV).

[0136] It has previously been demonstrated that a modification of the fusion protein of the Hitchner B1 strain of NDV by introduction of a polybasic protease cleavage site (rNDV/F3aa), allows for efficient syncytia formation in a wide range of cells in the absence of exogenous proteases (Vigil et al., 2007). We have further demonstrated that a single amino acid substitution from leucine to alanine at amino acid 289 (L289A) in the F3aa-modified fusion protein results in substantially greater syncytial formation and tumor necrosis than the virus bearing only the F3aa mutation, without any additional toxicity (Altomonte et al., 2010).

[0137] According to the present invention, said modified hyperfusogenic F protein has been inserted, together with the NDV HN attachment protein, into the VSV G-deleted vector.

[0138] By creating a hybrid of these two potent oncolytic vectors, we merge the positive features of each virus, while simultaneously eliminating the safety concerns of each.

[0139] The resulting vector has the VSV backbone and, therefore, maintains the rapid replication cycle of wildtype VSV. Furthermore, due to the incorporation of the HN and hyperfusogenic F proteins of NDV, the recombinant virus induces enhanced syncytia formation, allowing for efficient intratumoral spread of the virus and a potent mechanism of tumor cell death and induction of antitumor immune responses. Using this strategy, the benefit of a fusogenic virus can be achieved without the environmental threat associated with NDV.

[0140] Additionally, since the endogenous VSV glycoprotein has been deleted, there should be no neurotoxicity associated with the vector. Finally, since NDV attaches to target cells via sialic acid residues, which are upregulated on tumor cells (Bull et al., 2014), we can achieve additional transductional tumor targeting with the pseudotyped vector.

[0141] Although numerous pseudotyped VSV vectors have already been reported as safer vectors than wildtype VSV, our specific virus modification differs in that the substitution of the VSV envelope protein with that of NDV results in a more potent virus, in addition to being safer.

[0142] Furthermore, we introduce a mutated version of the NDV F protein for further improving the efficacy of the resulting recombinant virus, without negatively impacting safety.

[0143] The benefit of this glycoprotein exchange is three-fold:

[0144] 1. The neurotropism associated with the endogenous VSV glycoprotein can be averted by the deletion of the VSV envelope and the introduction of the non-neurotropic NDV envelope proteins;

[0145] 2. Tumor cells can be targeted via upregulation of sialic acid residues, which are the natural receptor for NDV; and

[0146] 3. Viral spread and tumor cell killing can be significantly enhanced via introduction of the highly fusogenic mutant version of the NDV F protein.

[0147] Our construct simultaneously provides both improved safety and efficacy.

[0148] The pseudotyped virus of the present invention offers improved safety and enhanced efficacy as obvious advantages over wildtype vectors.

[0149] Furthermore, there are also advantages of this particular vector over the previously reported pseudotyped VSV vectors. Although the VSV-GP vector (pseudotyped with LCMV-GP) demonstrates an enhanced safety profile, there is no additional therapeutic mechanism afforded by the LCMV glycoprotein in comparison with that of NDV (Muik et al., 2011). Although measles virus (MV) is similar to NDV in that it is a member of the paramyxovirus family, and its envelope also consists of a hemagglutinin and fusion protein, the rVSV-MV vector (Ayala-Breton et al., 2012) does not contain any modification to increase fusigenicity, and it likely is less efficient than our hyperfusogenic VSV-NDV in syncytial formation. Furthermore, MV attaches to target cells via three discrete receptors: CD46, signal lymphocyte activation molecule (SLAM), and nectin4. However, infection of SLAM-positive immune cells leads to immunosuppression, and infection of nectin4-positive airway epithelial cells results in respiratory shedding and virus transmission, both of which would be undesirable side effects of oncolytic virus therapy. Therefore, modifications to ablate the interaction of MV H with SLAM and nectin4 (Liu et al., 2014) or to retarget the attachment protein to tumor specific receptors (Ayala-Breton et al., 2012) has been performed in the context of the rVSV-MV vectors as strategies to retarget the pseudotyped virus to the tumor. However, these restrictions to the natural attachment mechanism of the MV envelope will surely result in an attenuation of the recombinant virus. Indeed, nectin4 and CD46 have substantially overlapping receptor binding surfaces on MV H, and it was shown that disruption of nectin4 binding compromised attachment to CD46, resulting in a greatly diminished oncolytic effect (Liu et al., 2014). Finally, since the majority of the human population is vaccinated against measles virus, the high levels of circulating antibodies directed at the viral envelope will likely play a role in neutralizing the rVSV-MV vectors.

[0150] Therefore, our rVSV-NDV vector is superior to the previously reported pseudotyped vectors, due to its hyperfusogenic feature, lack of pre-existing immunity in the general population, and no expected attenuation compared to VSV or NDV.

[0151] The following examples and drawings illustrate the present invention without, however, limiting the same thereto.

BRIEF DESCRIPTION OF THE DRAWINGS

[0152] FIG. 1. Recombinant pseudotyped VSV construct expressing the glycoprotein of NDV. The endogenous glycoprotein of VSV was deleted from a plasmid encoding the full-length VSV genome. The NDV glycoprotein, comprising a modified fusion protein (NDV/F(L289A)) and hemagglutinin-neuraminidase (NDV/HN), was inserted as discrete transcription units between the VSV matrix (M) and large polymerase (L) genes. The respective pseudotyped VSV vector was rescued using an established reverse-genetics system.

[0153] FIGS. 2A-2D. rVSV-NDV can replicate in HCC cell lines and cause complete cytotoxicity. Human HCC cell lines Huh7 (2A, 2B) and HepG2 (2C, 2D) were infected with a multiplicity of infection (MOI) of 0.01 of rVSV, rNDV, or rVSV-NDV. After a 1 hour infection, the cells were washed and fresh medium was added to the cells. At various time-points post-infection aliquots of the supernatant were collected for cytotoxicity measurements by LDH assay (2B, 2D) and cell monolayers were lysed for measurements of intracellular titers by TCID50 assay (2A, 2C). Experiments were performed in triplicate, and data are presented as mean+/-standard deviation.

[0154] FIG. 3. rVSV-NDV infection leads to rapid syncytia formation in HCC cells. In order to assess the ability of the pseudotyped rVSV-NDV vector to induce syncytia formation in tumor cells, various HCC cell lines were infected with rVSV-NDV, rNDV, or rVSV at an MOI of 0.01, and observed microscopically at various time-points post-infection. Additional cells were treated with PBS as a control. Huh7 cells are shown as a representative human HCC cell line, and representative images were captured under 200.times. magnification.

[0155] FIG. 4. Pseudotyping VSV with NDV envelope proteins does not alter the sensitivity of the vector to the antiviral actions of IFN. To assess the sensitivity of rVSV-NDV to type I IFN, an IFN-sensitive cell line (A549) was infected with rVSV-NDV, rVSV, and rNDV at an MOI of 0.01. Cells were lysed at 48 hours post-infection, and intracellular viral titers were measured by TCID50 assay. Experiments were performed in triplicate, and mean values+/-standard deviation are shown.

[0156] FIGS. 5A-5B. Replication and cytotoxicity of rVSV-NDV is substantially diminished in primary human hepatocytes. Primary human hepatocytes were infected at an MOI of 0.01 with rVSV, rNDV, or rVSV-NDV. Cell lysates were subjected to TCID50 analysis of intracellular virus titers at various timepoints. Additionally, aliquots of supernatant were collected at various timepoints for cytotoxicity measurements by LDH assay. Experiments were performed in duplicate, and means+/-standard deviation are shown.

[0157] FIGS. 6A-6B. Replication and cytotoxicity of rVSV-NDV is substantially diminished in primary mouse neurons. Primary mouse neurons were infected at an MOI of 0.01 with rVSV, rNDV, or rVSV-NDV. Cell lysates were subjected to TCID50 analysis of intracellular virus titers at various timepoints. Additional wells were assayed for cell viability using a standard MTS assay. Experiments were performed in duplicate, and means+/-standard deviation are shown.

[0158] FIG. 7. The pseudotyped rVSV-NDV vector causes immunogenic cell death. Huh7 cells were infected with rVSV, rNDV, or rVSV-NDV at an MOI of 0.01 or mock-infected for 48 hours. The conditioned media were concentrated, and 10 .mu.g of protein were subjected to Western blot analysis for detection of released HMGB1, Hsp70, and Hsp90.

[0159] FIG. 8. Pseudotyped rVSV-NDV vector demonstrates enhanced safety compared to rVSV in immune-deficient mice. Immune-deficient male NOD-SCID mice were treated by tail vein injection with rVSV-NDV or rVSV-GFP (referred to as rVSV in the figure for simplicity) at a dose of 10.sup.6 TCID50. Mice were monitored daily and euthanized at humane endpoints. Body weight changes were plotted over time with respect to the injection (left); Viral titers in blood were measured on day 1 and 7 by TCID50 analysis (center); The survival proportions were plotted by Kaplan-Maier survival curve (left).

[0160] FIG. 9. Mice treated with 10.sup.6 TCID50 rVSV revealed pathological changes in the liver and brain. H/E staining of liver revealed small group necrosis of hepatocytes after rVSV treatment, marked by hepatocellular degeneration with karyolysis (top left panel). Acute necrosis in the brain stem after rVSV application was observed with degenerating glial cells exhibiting pyknosis and karyorrhexis (top right panel). Degeneration of glial cells could be further confirmed by immunohistochemical staining for caspase-3 (bottom right). Representative images are shown; scale bars equal 50 .mu.m. Viral titers were quantified from brain and liver tissue lysate from mice receiving rVSV after demonstrating signs of toxicity. Means+SEM are shown.

EXAMPLES

1. Material and Methods

1.1 Viruses

[0161] Recombinant VSV expressing the GFP reporter (referred to herein as "rVSV") was engineered and rescued as previously described (Huang et al., 2003). Recombinant NDV harboring the F3aa(L289A) mutations and expressing the GFP reporter gene (referred to herein as "rNDV") was engineered and rescued as previously described (Altomonte et al., 2010).

[0162] Recombinant rVSV-NDV was produced by first modifying a plasmid encoding for the full-length VSV genome (pVSV-XN2) and expressing the F3aa(L289A)-modified fusion protein of NDV (Ebert et al., 2004) as an additional transcription unit between the G and L genes. The endogenous VSV glycoprotein (G) was deleted by digestion with MluI and XhoI restriction enzymes, which recognize the unique restriction sites in the 5' and 3' noncoding regions of the G, respectively. Following self-ligation of the G-deleted plasmid, a short oligonucleotide linker was inserted at the unique NheI restriction site following the NDV F gene, to create a multiple cloning site for insertion of the HN gene. The HN gene was amplified by PCR from a plasmid encoding the full-length NDV genome, utilizing primers to introduce PacI and PmeI restriction sites at the 5' and 3' ends of the PCR product, respectively, for insertion into the newly incorporated restriction sites in the G-deleted VSV-NDV/F3aa(L289A) plasmid. The resulting plasmid was subjected to sequence analysis to confirm the fidelity of the PCR insert, as well as the intergenic transcription start and stop sequences and the gene order. Finally, the infectious virus, referred to here as "rVSV-NDV", was rescued using the established reverse genetics system for rescuing negative-strand RNA viruses (Lawson et al., 1995).

[0163] See also FIG. 1.

1.2 Cell Lines

[0164] Two human HCC cell lines (HepG2 and Huh-7) were obtained from Dr. Ulrich Lauer (University Hospital Tubingen, Germany) and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine (200 mM), 1% Penicillin/streptomycin, 1% non-essential amino acids and 1% sodium pyruvate. A549 cells were obtained from the ATCC (Rockville, Md.) and cultured in the same medium as the HCC cell lines. Primary human hepatocytes were derived from patients (negative for hepatitis B and C virus and human immunodeficiency virus) who had undergone surgical resection of liver tumors, in accordance with the guidelines of the charitable state-controlled Human Tissue and Cell Research (HTCR) foundation (Regensburg, Germany). The hepatocytes were maintained in HepatoZYME-SFM medium (Gibco-Invitrogen, Karlsruhe, Germany). Primary embryonic primary cortical neurons were dissociated from E16.5 mouse cortex and provided by the laboratory of Stefan Lichtenthaler (DZNE, Munich, Germany). Neuronal cultures were maintained in Neurobasal medium (Gibco) supplemented with B27 (2%), 0.5 mM glutamine, and 1% penicillin/streptomycin. All cell lines and primary cells were maintained in the 37.degree. C. humidified incubator with 5% CO.sub.2

1.3 Microscopic Analysis

[0165] The human HCC cell lines, Huh7 and HepG2, were plated at approximately 90% confluency in 6-well dishes and infected with either rVSV, rNDV, or rVSV-NDV at an MOI of 0.01 or mock-infected. Cells were visualized at 200.times. magnification on an Axiovert 40CFL microscope (Zeiss) at 16-, 24- and 48-hours post-infection, and representative images were captured with a Canon Powershot A620 camera attached to the microscope.

1.4 IFN Dose Response Assay

[0166] Interferon-sensitive A549 cells were plated in 24-well dishes at a density of 10.sup.5 cells per well and cultured overnight. The following evening they were pre-treated with different concentrations (0, 100, 500, and 1000 IU/ml) of Universal type I Interferon added directly to the culture medium. After overnight incubation, the cells were infected with either rVSV, rNDV or rVSV-NDV at a multiplicity of infection (MOI) of 0.01. 48 hours post-infection, cells were collected in 100 .mu.l of PBS and lysed by three freeze-thaw cycles. The intratumoral virus titer was determined by TCID.sub.50 analysis of the cell lysates.

1.5 Growth Curves (TCID50 Assay)

[0167] Viral growth curves were performed in HCC cell lines (Huh7 and HepG2), as well as in primary human hepatocytes and primary mouse neurons.

HCC cell lines were plated in 6-well dishes at a density of 3.5.times.10.sup.5 cells per well, while PHH and neurons were seeded in collagen-coated 24-well dishes at a density of 10.sup.5 cells per well. Each cell line was infected with rVSV, rNDV and rVSV-NDV at a multiplicity of infection (MOI) of 0.01. The infections were performed in 1 ml of PBS (6-well dishes) or 250 .mu.l of PBS (24-well dishes) at 37.degree. C. for 1 hour. After incubation, cells were washed three times with PBS and fresh medium was added. Cell lysate was collected at 0, 16, 24, 48 and 72 hours post-infection for TCID.sub.50 analysis of intracellular virus titers.

1.6 Cytotoxicity Assays (LDH or MTS Assay)

[0168] Cell viability of infected HCC cell lines (Huh7 and HepG2) and primary human hepatocytes was analyzed by measuring released Lactate Dehyrogenase (LDH) from cell culture supernatant. The cells were plated, infected and washed as in the growth curve experiments. At 24, 48 and 72 hours post-infection, aliquots of supernatant were collected, and LDH-release was quantified using the CytoTox 96 Non-Radioactive Cytotoxicity Assay protocol (Promega). For each time point, LDH-release following virus infection was calculated as a percentage of the maximum LDH-release control. Baseline LDH levels detected in the supernatant of mock-treated cells were subtracted from the values obtained from the experimental wells.

[0169] Cell viability of neurons was analyzed by MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carbooxymethoxyphenyl)-2-(4-sulfopheny- l)-2H-tetrazolium) assay using the CellTiter96 AQueous One Solution Cell Proliferation Assay (Promega, Madison, Wis.). Neurons were seeded in collagen coated 96-well dishes at a density of 5.times.10.sup.4 cells/well and mock-treated or infected with rVSV, rNDV or rVSV-NDV at an MOI of 0.01. At 24, 48 and 72 hours post-infection, cell viability was measured according to the manufacturer's protocol. Cytotoxicity was calculated as difference in cell viability of the experimental samples compared to the uninfected controls.

1.7 Western Blots

[0170] Huh7 cells were plated in 6-well plates at approximately 90% confluence and infected with rVSV, rNDV, or rVSV-NDV at an MOI of 0.01 or mock-infected for 48 hours. The conditioned media were collected and concentrated to about 200 .mu.l using Amicon Ultra Centrifugal filters with a 10 kD cutoff (Merck Millipore, Billerica, Mass.). Protein concentrations were quantified using the Pierce BCA Protein Assay (Thermo Fisher Scientific, Waltham, Mass.), and 10 .mu.g of each sample was loaded onto a 7.5% denaturing SDS-PAGE gel, followed by transfer onto a nitrocellulose membrane. Protein bands were detected using specific antibodies against HMGB1 and Hsp90 (Cell Signaling Technology, Danvers, Mass.) and Hsp70 (Santa Cruz Biotechnology, Dallas, Tex.) and the appropriate secondary antibody conjugated with horseradish peroxidase. Bands were visualized using Amersham ECL Prime Western Blot Detection Reagent (GE Healthcare Life Sciences, Pittsburgh, Pa.).

2. Results

[0171] The recombinant VSV-NDV vector (FIG. 1) has been characterized in vitro for replication and cytotoxicity in tumor cells, as well as in healthy hepatocytes and neurons. We used two human hepatocellular carcinoma (HCC) cell lines as representative tumor cells, and compared the rVSV-NDV with rVSV and rNDV in terms of its relative ability to replicate and kill the cells. Although rVSV-NDV replication was a bit delayed compared to the wildtype vectors, it was able to reach similar titers at about 72 hours post-infection, which resulted in complete cell killing in vitro (FIG. 2).

[0172] In order to observe virus-induced syncytial formation, additional cells were infected with rVSV-NDV, as well as the parental rVSV and rNDV, for photomicroscopy. Microscopic analysis of the tumor cells revealed multiple foci of syncytia in the wells infected with rVSV-NDV by 16 hours post-infection, while it was significantly delayed in those infected with rNDV. As expected, cells that were treated with rVSV did not form syncytia; however, they were highly susceptible to the cytopathic effect (CPE), which is classic of VSV infection and occurred earlier than 16 hours post-infection (FIG. 3).

[0173] In order to rule out that the glycoprotein exchange inadvertently resulted in a loss of sensitivity of the vector to the antiviral actions of type I interferon (IFN), an IFN dose response was performed. The exquisite sensitivity of VSV to type I IFN is a key mechanism of tumor specificity, as tumor cells are often defective in their IFN signaling pathways, while healthy cells can efficiently clear the virus via IFN responsive genes. Although this assay revealed a relative insensitivity of rNDV to type I IFN, the rVSV-NDV vector was rapidly attenuated by the addition of IFN and reduced to levels similar to those observed for rVSV (FIG. 4).

[0174] We next performed growth curves and cytotoxicity assays in normal primary human hepatocytes and mouse neurons in order to assess the safety of rVSV-NDV. Very little replication of the pseudotyped vector could be observed over time, and titers were approximately 5 logs lower than the control VSV vector at 48 hours post-infection and 3 logs lower than rNDV at the same time-point in primary hepatocytes (FIG. 5). Although nearly all hepatocytes were dead by 72 hours post-infection with rVSV, no cytotoxicity could be observed by LDH assay in cells infected with rVSV-NDV (FIG. 5). Similarly, titers of rVSV-NDV were significantly lower than the control VSV vector in primary mouse neurons at all time-points investigated, which corresponded to similar levels of cell viability as those observed in PBS-treat neurons (FIG. 6). Taken together, rVSV-NDV showed little evidence of replication in primary healthy cells and resulted in little to no cytotoxicity in vitro, indicating that it is a substantially safer virus than both rVSV and rNDV.

[0175] To determine whether the pseudotyped rVSV vector would induce an immunogenic cell death, as has been shown for rNDV through syncytia formation, we investigated the release of high mobility group box 1 (HMGB1) and heat-shock proteins 70 and 90 from infected Huh7 cells. After a 48 hour infection, we observed relatively low levels of HMGB1, Hsp70, and Hsp90 released into the supernatant of rVSV-infected cells. However, infection with both rNDV and rVSV-NDV resulted in high levels of all three secreted markers for immunogenic cell death (FIG. 7). These results indicate that, in addition to the potent direct cytotoxicity caused by infection with the pseudotyped rVSV-NDV vector, in vivo treatment with this virus could result in substantial immune responses directed against the tumor.

[0176] In order to assess the safety of the pseudotyped rVSV-NDV vector in vivo, immune-deficient male NOD-SCID mice approximately 8 weeks of age were treated by tail vein injection with either rVSV-NDV or the control rVSV-GFP virus (N=6) at a dose of 10.sup.6 TCID50 per mouse. Mice were monitored daily for body weight and overall physical appearance, and they were euthanized at humane endpoints. Blood was sampled on day 1, 3, 7, 14, and at the time of euthanization for analysis serum chemistry and circulating virus titers. Two mice receiving rVSV-GFP rapidly began losing weight during the first week after treatment, and all six died acutely or were euthanized due to extreme body weight loss, dehydration, signs of distress (changes in posture, impaired movement, isolation, etc.), and/or signs of neurotoxicity (limb paralysis and circling) between 11 and 17 days post-treatment (FIG. 8). Additionally, infectious virus titers could be recovered from the blood on day 1 and 7 post-treatment (FIG. 8, center). In contrast, the mice who received rVSV-NDV lost only negligible amounts of weight, appeared healthy and exhibited normal behavior throughout the study. Three of these mice were euthanized at 21 days post-treatment for histological analysis of major organs. while the remaining animals were monitored for 60 days post-treatment, at which time they were euthanized for pathological analysis. No infectious virus titers could be detected in the blood of mice treated with rVSV-NDV at any time-point analyzed. Plasma measurements of liver function (GPT) and kidney function (BUN and Creatinine) revealed no abnormal values for either treatment group (data not shown).

[0177] Tissue sections were examined by a pathologist who was blinded to the treatment groups of the specimens. Histological analysis revealed no major pathological findings in tissue excised from mice treated with rVSV-NDV, either euthanized on day 21 or day 60. Furthermore, no detectable titers within the brain or liver tissue could be observed in mice treated with rVSV-NDV (data not shown). In stark contrast, mice that received rVSV-GFP at the same dose exhibited heavy intrasinusoidal edema, moderate acute hepatitis with single cell and small group necrosis, and apoptosis of hepatic tissue (FIG. 9). Furthermore, acute necrosis in the brain stem, with degenerating glial cells exhibiting pyknosis and karyorhexis could be observed. Degeneration of glial cells was further confirmed by immunohistochemical staining for caspase-3. TCID50 analysis of tissue lysates revealed quantifiable levels of infectious VSV in the liver and brain at the time of necropsy.

[0178] The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

REFERENCES

[0179] Altomonte, J., L. Wu, et al. (2008). "Exponential enhancement of oncolytic vesicular stomatitis virus potency by vector-mediated suppression of inflammatory responses in vivo." Mol Ther 16(1): 146-153.

[0180] Altomonte, J., S. Marozin, et al. (2010). "Engineered newcastle disease virus as an improved oncolytic agent against hepatocellular carcinoma." Mol Ther 18(2): 275-284.

[0181] Ayala-Breton, C., G. N. Barber, et al. (2012). "Retargeting vesicular stomatitis virus using measles virus envelope glycoproteins." Hum Gene Ther 23(5): 484-491.

[0182] Bull, C., M. A. Stoel, et al. (2014). "Sialic acids sweeten a tumor's life." Cancer Res 74(12): 3199-3204.

[0183] Coffey, M. C., Strong, J. E., Forsyth, P. A., Lee, P. W. (1998). "Reovirus therapy of tumors with activated Ras pathway." Science 282: 1332-1334.

[0184] Cuadrado-Castano, S., M. T. Sanchez-Aparicio, et al. (2015). "The therapeutic effect of death: Newcastle disease virus and its antitumor potential." Virus Res 209: 56-66.

[0185] Ebert, O., K. Shinozaki, et al. (2004). "Syncytia induction enhances the oncolytic potential of vesicular stomatitis virus in virotherapy for cancer." Cancer Res 64(9): 3265-70.

[0186] Ebert, O., S. Harbaran, et al. (2005). "Systemic therapy of experimental breast cancer metastases by mutant vesicular stomatitis virus in immune-competent mice." Cancer Gene Ther 12(4): 350-358.

[0187] Edge, R. E., T. J. Falls, et al. (2008). "A let-7 MicroRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replication." Mol Ther 16(8): 1437-1443.

[0188] Everts, B. and H. G. van der Poel (2005). "Replication-selective oncolytic viruses in the treatment of cancer." Cancer Gene Ther 12(2): 141-161.

[0189] Huang H. G., O. Ebert, et al. (2003). "Oncolysis of hepatic metastasis of colorectal cancer by recombinant vesicular stomatitis virus in immune competent mice." Mol Ther 8(3): 434-40.

[0190] Johnson, J. E., F. Nasar, et al. (2007). "Neurovirulence properties of recombinant vesicular stomatitis virus vectors in non-human primates." Virology 360(1): 36-49.

[0191] Kelly, E. J., R. Nace, et al. (2010). "Attenuation of vesicular stomatitis virus encephalitis through microRNA targeting." J Virol 84(3): 1550-1562.

[0192] Kim, D., Martuza, R. L., and Zwiebel, J. (2001). "Replication-selective virotherapy for cancer: biological principles, risk management, and future directions." Nat Med 7: 781-787.

[0193] Lawson, N. D., E. A. Stillman, et al. (1995). "Recombinant vesicular stomatitis viruses from DNA." Proc Natl Acad Sci 92: 4477-81.

[0194] Liu, Y. P., S. P. Russell, et al. (2014). "Ablation of nectin4 binding compromises CD46 usage by a hybrid vesicular stomatitis virus/measles virus." J Virol 88(4): 2195-2204.

[0195] Lorence, R. M., Katubig, B. B., Reichard, K. W., et al (1994). "Complete regression of human fibrosarcoma xenografts after local Newcastle disease virus therapy." Cancer Research 54: 6017-6021.

[0196] Muik, A., I. Kneiske, et al. (2011). "Pseudotyping vesicular stomatitis virus with lymphocytic choriomeningitis virus glycoproteins enhances infectivity for glioma cells and minimizes neurotropism." J Virol 85(11): 5679-5684.

[0197] Patel, M. R. and R. A. Kratzke (2013). "Oncolytic virus therapy for cancer: the first wave of translational clinical trials." Transl Res 161(4): 355-364.

[0198] Park, M. S., Steel, J., Garcia-Sastre, A., et al (2006). "Engineered viral vaccine constructs with dual specificity: Avian influenza and Newcastle disease." PNAS 103(21): 8203-8.

[0199] Peeters, B. P., O. S. de Leeuw, et al. (1999). "Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinent of virulence." J Virol 73(6):5001-9.

[0200] Peng, K. W., Ahmann, G. J., Pham, L, et al (2001). "Systemic therapy of myeloma xenografts by an attenuated measles virus." Blood 98: 2002-2007.

[0201] Quiroz, E., N. Moreno, et al. (1988). "A human case of encephalitis associated with vesicular stomatitis virus (Indiana serotype) infection." Am J Trop Med Hyg 39(3): 312-314.

[0202] Stojdl, D. F., Lichty, B. D., tenOever, B. R., et al (2003). "VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents." Cancer Cell 4(4): 263-275.

[0203] van den Pol, A., Dalton, K., and Rose, J. (2002). "Relative neurotropism of a recombinant rhabdovirus expressing a green fluorescent envelope glycoprotein." Journal of Virology 76(3): 1309-1327.

[0204] Vigil, A., M. S. Park, et al. (2007). "Use of reverse genetics to enhance the oncolytic properties of Newcastle disease virus." Cancer Res 67(17): 8285-8292.

Sequence CWU 1

1

17111161DNAVesicular stomatitis virus 1acgaagacaa acaaaccatt attatcatta aaaggctcag gagaaacttt aacagtaatc 60aaaatgtctg ttacagtcaa gagaatcatt gacaacacag tcatagttcc aaaacttcct 120gcaaatgagg atccagtgga atacccggca gattacttca gaaaatcaaa ggagattcct 180ctttacatca atactacaaa aagtttgtca gatctaagag gatatgtcta ccaaggcctc 240aaatccggaa atgtatcaat catacatgtc aacagctact tgtatggagc attaaaggac 300atccggggta agttggataa agattggtca agtttcggaa taaacatcgg gaaagcaggg 360gatacaatcg gaatatttga ccttgtatcc ttgaaagccc tggacggcgt acttccagat 420ggagtatcgg atgcttccag aaccagcgca gatgacaaat ggttgccttt gtatctactt 480ggcttataca gagtgggcag aacacaaatg cctgaataca gaaaaaagct catggatggg 540ctgacaaatc aatgcaaaat gatcaatgaa cagtttgaac ctcttgtgcc agaaggtcgt 600gacatttttg atgtgtgggg aaatgacagt aattacacaa aaattgtcgc tgcagtggac 660atgttcttcc acatgttcaa aaaacatgaa tgtgcctcgt tcagatacgg aactattgtt 720tccagattca aagattgtgc tgcattggca acatttggac acctctgcaa aataaccgga 780atgtctacag aagatgtaac gacctggatc ttgaaccgag aagttgcaga tgaaatggtc 840caaatgatgc ttccaggcca agaaattgac aaggccgatt catacatgcc ttatttgatc 900gactttggat tgtcttctaa gtctccatat tcttccgtca aaaaccctgc cttccacttc 960tgggggcaat tgacagctct tctgctcaga tccaccagag caaggaatgc ccgacagcct 1020gatgacattg agtatacatc tcttactaca gcaggtttgt tgtacgctta tgcagtagga 1080tcctctgccg acttggcaca acagttttgt gttggagata acaaatacac tccagatgat 1140agtaccggag gattgacgac taatgcaccg ccacaaggca gagatgtggt cgaatggctc 1200ggatggtttg aagatcaaaa cagaaaaccg actcctgata tgatgcagta tgcgaaaaga 1260gcagtcatgt cactgcaagg cctaagagag aagacaattg gcaagtatgc taagtcagaa 1320tttgacaaat gaccctataa ttctcagatc acctattata tattatgcta catatgaaaa 1380aaactaacag atatcatgga taatctcaca aaagttcgtg agtatctcaa gtcctattct 1440cgtctggatc aggcggtagg agagatagat gagatcgaag cacaacgagc tgaaaagtcc 1500aattatgagt tgttccaaga ggatggagtg gaagagcata ctaagccctc ttattttcag 1560gcagcagatg attctgacac agaatctgaa ccagaaattg aagacaatca aggtttgtat 1620gcacaggatc cagaagctga gcaagttgaa ggctttatac aggggccttt agatgactat 1680gcagatgagg aagtggatgt tgtatttact tcggactgga aaccacctga gcttgaatct 1740gacgagcatg gaaagacctt acggttgaca tcgccagagg gtttaagtgg agagcagaaa 1800tcccagtggc tttcgacgat taaagcagtc gtgcaaagtg ccaaatactg gaatctggca 1860gagtgcacat ttgaagcatc gggagaaggg gtcattatga aggagcgcca gataactccg 1920gatgtatata aggtcactcc agtgatgaac acacatccgt cccaatcaga agcagtatca 1980gatgtttggt ctctctcaaa gacatccatg actttccaac ccaagaaagc aagtcttcag 2040cctctcacca tatccttgga tgaattgttc tcatctagag gagagttcat ctctgtcgga 2100ggtgacggac gaatgtctca taaagaggcc atcctgctcg gcctgagata caaaaagttg 2160tacaatcagg cgagagtcaa atattctctg tagactatga aaaaaagtaa cagatatcac 2220gatctaagtg ttatcccaat ccattcatca tgagttcctt aaagaagatt ctcggtctga 2280aggggaaagg taagaaatct aagaaattag ggatcgcacc acccccttat gaagaggaca 2340ctagcatgga gtatgctccg agcgctccaa ttgacaaatc ctattttgga gttgacgaga 2400tggacaccta tgatccgaat caattaagat atgagaaatt cttctttaca gtgaaaatga 2460cggttagatc taatcgtccg ttcagaacat actcagatgt ggcagccgct gtatcccatt 2520gggatcacat gtacatcgga atggcaggga aacgtccctt ctacaaaatc ttggcttttt 2580tgggttcttc taatctaaag gccactccag cggtattggc agatcaaggt caaccagagt 2640atcacactca ctgcgaaggc agggcttatt tgccacatag gatggggaag acccctccca 2700tgctcaatgt accagagcac ttcagaagac cattcaatat aggtctttac aagggaacga 2760ttgagctcac aatgaccatc tacgatgatg agtcactgga agcagctcct atgatctggg 2820atcatttcaa ttcttccaaa ttttctgatt tcagagagaa ggccttaatg tttggcctga 2880ttgtcgagaa aaaggcatct ggagcgtggg tcctggattc tatcagccac ttcaaatgag 2940ctagtctaac ttctagcttc tgaacaatcc ccggtttact cagtctctcc taattccagc 3000ctctcgaaca actaatatcc tgtcttttct atccctatga aaaaaactaa cagagatcga 3060tctgtttcct tgacactatg aagtgccttt tgtacttagc ctttttattc attggggtga 3120attgcaagtt caccatagtt tttccacaca accaaaaagg aaactggaaa aatgttcctt 3180ctaattacca ttattgcccg tcaagctcag atttaaattg gcataatgac ttaataggca 3240cagccataca agtcaaaatg cccaagagtc acaaggctat tcaagcagac ggttggatgt 3300gtcatgcttc caaatgggtc actacttgtg atttccgctg gtatggaccg aagtatataa 3360cacagtccat ccgatccttc actccatctg tagaacaatg caaggaaagc attgaacaaa 3420cgaaacaagg aacttggctg aatccaggct tccctcctca aagttgtgga tatgcaactg 3480tgacggatgc cgaagcagtg attgtccagg tgactcctca ccatgtgctg gttgatgaat 3540acacaggaga atgggttgat tcacagttca tcaacggaaa atgcagcaat tacatatgcc 3600ccactgtcca taactctaca acctggcatt ctgactataa ggtcaaaggg ctatgtgatt 3660ctaacctcat ttccatggac atcaccttct tctcagagga cggagagcta tcatccctgg 3720gaaaggaggg cacagggttc agaagtaact actttgctta tgaaactgga ggcaaggcct 3780gcaaaatgca atactgcaag cattggggag tcagactccc atcaggtgtc tggttcgaga 3840tggctgataa ggatctcttt gctgcagcca gattccctga atgcccagaa gggtcaagta 3900tctctgctcc atctcagacc tcagtggatg taagtctaat tcaggacgtt gagaggatct 3960tggattattc cctctgccaa gaaacctgga gcaaaatcag agcgggtctt ccaatctctc 4020cagtggatct cagctatctt gctcctaaaa acccaggaac cggtcctgct ttcaccataa 4080tcaatggtac cctaaaatac tttgagacca gatacatcag agtcgatatt gctgctccaa 4140tcctctcaag aatggtcgga atgatcagtg gaactaccac agaaagggaa ctgtgggatg 4200actgggcacc atatgaagac gtggaaattg gacccaatgg agttctgagg accagttcag 4260gatataagtt tcctttatac atgattggac atggtatgtt ggactccgat cttcatctta 4320gctcaaaggc tcaggtgttc gaacatcctc acattcaaga cgctgcttcg caacttcctg 4380atgatgagag tttatttttt ggtgatactg ggctatccaa aaatccaatc gagcttgtag 4440aaggttggtt cagtagttgg aaaagctcta ttgcctcttt tttctttatc atagggttaa 4500tcattggact attcttggtt ctccgagttg gtatccatct ttgcattaaa ttaaagcaca 4560ccaagaaaag acagatttat acagacatag agatgaaccg acttggaaag taactcaaat 4620cctgcacaac agattcttca tgtttggacc aaatcaactt gtgataccat gctcaaagag 4680gcctcaatta tatttgagtt tttaattttt atgaaaaaaa ctaacagcaa tcatggaagt 4740ccacgatttt gagaccgacg agttcaatga tttcaatgaa gatgactatg ccacaagaga 4800attcctgaat cccgatgagc gcatgacgta cttgaatcat gctgattaca atttgaattc 4860tcctctaatt agtgatgata ttgacaattt gatcaggaaa ttcaattctc ttccgattcc 4920ctcgatgtgg gatagtaaga actgggatgg agttcttgag atgttaacat catgtcaagc 4980caatcccatc tcaacatctc agatgcataa atggatggga agttggttaa tgtctgataa 5040tcatgatgcc agtcaagggt atagtttttt acatgaagtg gacaaagagg cagaaataac 5100atttgacgtg gtggagacct tcatccgcgg ctggggcaac aaaccaattg aatacatcaa 5160aaaggaaaga tggactgact cattcaaaat tctcgcttat ttgtgtcaaa agtttttgga 5220cttacacaag ttgacattaa tcttaaatgc tgtctctgag gtggaattgc tcaacttggc 5280gaggactttc aaaggcaaag tcagaagaag ttctcatgga acgaacatat gcaggattag 5340ggttcccagc ttgggtccta cttttatttc agaaggatgg gcttacttca agaaacttga 5400tattctaatg gaccgaaact ttctgttaat ggtcaaagat gtgattatag ggaggatgca 5460aacggtgcta tccatggtat gtagaataga caacctgttc tcagagcaag acatcttctc 5520ccttctaaat atctacagaa ttggagataa aattgtggag aggcagggaa atttttctta 5580tgacttgatt aaaatggtgg aaccgatatg caacttgaag ctgatgaaat tagcaagaga 5640atcaaggcct ttagtcccac aattccctca ttttgaaaat catatcaaga cttctgttga 5700tgaaggggca aaaattgacc gaggtataag attcctccat gatcagataa tgagtgtgaa 5760aacagtggat ctcacactgg tgatttatgg atcgttcaga cattggggtc atccttttat 5820agattattac actggactag aaaaattaca ttcccaagta accatgaaga aagatattga 5880tgtgtcatat gcaaaagcac ttgcaagtga tttagctcgg attgttctat ttcaacagtt 5940caatgatcat aaaaagtggt tcgtgaatgg agacttgctc cctcatgatc atccctttaa 6000aagtcatgtt aaagaaaata catggcccac agctgctcaa gttcaagatt ttggagataa 6060atggcatgaa cttccgctga ttaaatgttt tgaaataccc gacttactag acccatcgat 6120aatatactct gacaaaagtc attcaatgaa taggtcagag gtgttgaaac atgtccgaat 6180gaatccgaac actcctatcc ctagtaaaaa ggtgttgcag actatgttgg acacaaaggc 6240taccaattgg aaagaatttc ttaaagagat tgatgagaag ggcttagatg atgatgatct 6300aattattggt cttaaaggaa aggagaggga actgaagttg gcaggtagat ttttctccct 6360aatgtcttgg aaattgcgag aatactttgt aattaccgaa tatttgataa agactcattt 6420cgtccctatg tttaaaggcc tgacaatggc ggacgatcta actgcagtca ttaaaaagat 6480gttagattcc tcatccggcc aaggattgaa gtcatatgag gcaatttgca tagccaatca 6540cattgattac gaaaaatgga ataaccacca aaggaagtta tcaaacggcc cagtgttccg 6600agttatgggc cagttcttag gttatccatc cttaatcgag agaactcatg aattttttga 6660gaaaagtctt atatactaca atggaagacc agacttgatg cgtgttcaca acaacacact 6720gatcaattca acctcccaac gagtttgttg gcaaggacaa gagggtggac tggaaggtct 6780acggcaaaaa ggatggacta tcctcaatct actggttatt caaagagagg ctaaaatcag 6840aaacactgct gtcaaagtct tggcacaagg tgataatcaa gttatttgca cacagtataa 6900aacgaagaaa tcgagaaacg ttgtagaatt acagggtgct ctcaatcaaa tggtttctaa 6960taatgagaaa attatgactg caatcaaaat agggacaggg aagttaggac ttttgataaa 7020tgacgatgag actatgcaat ctgcagatta cttgaattat ggaaaaatac cgattttccg 7080tggagtgatt agagggttag agaccaagag atggtcacga gtgacttgtg tcaccaatga 7140ccaaataccc acttgtgcta atataatgag ctcagtttcc acaaatgctc tcaccgtagc 7200tcattttgct gagaacccaa tcaatgccat gatacagtac aattattttg ggacatttgc 7260tagactcttg ttgatgatgc atgatcctgc tcttcgtcaa tcattgtatg aagttcaaga 7320taagataccg ggcttgcaca gttctacttt caaatacgcc atgttgtatt tggacccttc 7380cattggagga gtgtcgggca tgtctttgtc caggtttttg attagagcct tcccagatcc 7440cgtaacagaa agtctctcat tctggagatt catccatgta catgctcgaa gtgagcatct 7500gaaggagatg agtgcagtat ttggaaaccc cgagatagcc aagtttcgaa taactcacat 7560agacaagcta gtagaagatc caacctctct gaacatcgct atgggaatga gtccagcgaa 7620cttgttaaag actgaggtta aaaaatgctt aatcgaatca agacaaacca tcaggaacca 7680ggtgattaag gatgcaacca tatatttgta tcatgaagag gatcggctca gaagtttctt 7740atggtcaata aatcctctgt tccctagatt tttaagtgaa ttcaaatcag gcactttttt 7800gggagtcgca gacgggctca tcagtctatt tcaaaattct cgtactattc ggaactcctt 7860taagaaaaag tatcataggg aattggatga tttgattgtg aggagtgagg tatcctcttt 7920gacacattta gggaaacttc atttgagaag gggatcatgt aaaatgtgga catgttcagc 7980tactcatgct gacacattaa gatacaaatc ctggggccgt acagttattg ggacaactgt 8040accccatcca ttagaaatgt tgggtccaca acatcgaaaa gagactcctt gtgcaccatg 8100taacacatca gggttcaatt atgtttctgt gcattgtcca gacgggatcc atgacgtctt 8160tagttcacgg ggaccattgc ctgcttatct agggtctaaa acatctgaat ctacatctat 8220tttgcagcct tgggaaaggg aaagcaaagt cccactgatt aaaagagcta cacgtcttag 8280agatgctatc tcttggtttg ttgaacccga ctctaaacta gcaatgacta tactttctaa 8340catccactct ttaacaggcg aagaatggac caaaaggcag catgggttca aaagaacagg 8400gtctgccctt cataggtttt cgacatctcg gatgagccat ggtgggttcg catctcagag 8460cactgcagca ttgaccaggt tgatggcaac tacagacacc atgagggatc tgggagatca 8520gaatttcgac tttttattcc aagcaacgtt gctctatgct caaattacca ccactgttgc 8580aagagacgga tggatcacca gttgtacaga tcattatcat attgcctgta agtcctgttt 8640gagacccata gaagagatca ccctggactc aagtatggac tacacgcccc cagatgtatc 8700ccatgtgctg aagacatgga ggaatgggga aggttcgtgg ggacaagaga taaaacagat 8760ctatccttta gaagggaatt ggaagaattt agcacctgct gagcaatcct atcaagtcgg 8820cagatgtata ggttttctat atggagactt ggcgtataga aaatctactc atgccgagga 8880cagttctcta tttcctctat ctatacaagg tcgtattaga ggtcgaggtt tcttaaaagg 8940gttgctagac ggattaatga gagcaagttg ctgccaagta atacaccgga gaagtctggc 9000tcatttgaag aggccggcca acgcagtgta cggaggtttg atttacttga ttgataaatt 9060gagtgtatca cctccattcc tttctcttac tagatcagga cctattagag acgaattaga 9120aacgattccc cacaagatcc caacctccta tccgacaagc aaccgtgata tgggggtgat 9180tgtcagaaat tacttcaaat accaatgccg tctaattgaa aagggaaaat acagatcaca 9240ttattcacaa ttatggttat tctcagatgt cttatccata gacttcattg gaccattctc 9300tatttccacc accctcttgc aaatcctata caagccattt ttatctggga aagataagaa 9360tgagttgaga gagctggcaa atctttcttc attgctaaga tcaggagagg ggtgggaaga 9420catacatgtg aaattcttca ccaaggacat attattgtgt ccagaggaaa tcagacatgc 9480ttgcaagttc gggattgcta aggataataa taaagacatg agctatcccc cttggggaag 9540ggaatccaga gggacaatta caacaatccc tgtttattat acgaccaccc cttacccaaa 9600gatgctagag atgcctccaa gaatccaaaa tcccctgctg tccggaatca ggttgggcca 9660attaccaact ggcgctcatt ataaaattcg gagtatatta catggaatgg gaatccatta 9720cagggacttc ttgagttgtg gagacggctc cggagggatg actgctgcat tactacgaga 9780aaatgtgcat agcagaggaa tattcaatag tctgttagaa ttatcagggt cagtcatgcg 9840aggcgcctct cctgagcccc ccagtgccct agaaacttta ggaggagata aatcgagatg 9900tgtaaatggt gaaacatgtt gggaatatcc atctgactta tgtgacccaa ggacttggga 9960ctatttcctc cgactcaaag caggcttggg gcttcaaatt gatttaattg taatggatat 10020ggaagttcgg gattcttcta ctagcctgaa aattgagacg aatgttagaa attatgtgca 10080ccggattttg gatgagcaag gagttttaat ctacaagact tatggaacat atatttgtga 10140gagcgaaaag aatgcagtaa caatccttgg tcccatgttc aagacggtcg acttagttca 10200aacagaattt agtagttctc aaacgtctga agtatatatg gtatgtaaag gtttgaagaa 10260attaatcgat gaacccaatc ccgattggtc ttccatcaat gaatcctgga aaaacctgta 10320cgcattccag tcatcagaac aggaatttgc cagagcaaag aaggttagta catactttac 10380cttgacaggt attccctccc aattcattcc tgatcctttt gtaaacattg agactatgct 10440acaaatattc ggagtaccca cgggtgtgtc tcatgcggct gccttaaaat catctgatag 10500acctgcagat ttattgacca ttagcctttt ttatatggcg attatatcgt attataacat 10560caatcatatc agagtaggac cgatacctcc gaacccccca tcagatggaa ttgcacaaaa 10620tgtggggatc gctataactg gtataagctt ttggctgagt ttgatggaga aagacattcc 10680actatatcaa cagtgtttag cagttatcca gcaatcattc ccgattaggt gggaggctgt 10740ttcagtaaaa ggaggataca agcagaagtg gagtactaga ggtgatgggc tcccaaaaga 10800tacccgaact tcagactcct tggccccaat cgggaactgg atcagatctc tggaattggt 10860ccgaaaccaa gttcgtctaa atccattcaa tgagatcttg ttcaatcagc tatgtcgtac 10920agtggataat catttgaaat ggtcaaattt gcgaagaaac acaggaatga ttgaatggat 10980caatagacga atttcaaaag aagaccggtc tatactgatg ttgaagagtg acctacacga 11040ggaaaactct tggagagatt aaaaaatcat gaggagactc caaactttaa gtatgaaaaa 11100aactttgatc cttaagaccc tcttgtggtt tttatttttt atctggtttt gtggtcttcg 11160t 1116121665DNAVesicular stomatitis virus 2aacagagatc gatctgtttc cttgacacca tgaagtgctt tttgtactta gcttttttat 60tcatcggggt gaattgcaag ttcaccatag tttttccaca caaccaaaaa ggaaactgga 120aaaatgttcc ttccaattac cattattgcc cgtcaagctc agatttaaat tggcataatg 180acttaatagg cacaggctta caagtcaaaa tgcccaagag tcacaaggct attcaagcag 240acggttggat gtgtcatgct tccaaatggg tcactacttg tgatttccgc tggtacggac 300cgaagtatat aacacattcc atccgatcct tcactccatc tgtagaacaa tgcaaggaaa 360gcattgaaca aacgaaacaa ggaacttggc tgaatccagg cttccctcct caaagttgtg 420gatatgcaac tgtgacggat gccgaagcag tgattgtcca ggtgactcct caccatgtgc 480ttgttgatga atacacagga gaatgggttg attcacagtt catcaacgga aaatgcagca 540atgacatatg ccccactgtc cataactcca caacctggca ttccgactat aaggtcaaag 600ggctatgtga ttctaacctc atttccacgg acatcacctt cttctcagag gacagagagc 660tatcatccct aggaaaggag ggcacagggt tcagaagtaa ctactttgct tatgaaactg 720gagacaaggc ctgcaaaatg cagtactgca agcattgggg agtcagactc ccatcaggtg 780tctggttcga gatggctgat aaggatctct ttgctgcagc cagattccct gaatgcccag 840aagggtcaag tatctctgct ccatctcaga cctcagtgga tgtaagtctc attcaggacg 900ttgagaggat cttggattat tccctctgcc aagaaacctg gagcaaaatc agagcgggtc 960ttcccatctc tccagtggat ctcagctatc ttgctcctaa aaacccagga accggtcctg 1020cctttaccat aatcaatggt accctaaaat actttgagac cagatacatc agagtcgata 1080ttgctgctcc aatcctctca agaatggtcg gaatgatcag tggaactacc acagaaaggg 1140aactgtggga tgactgggct ccatatgaag acgtggaaat tggacccaat ggagttctga 1200ggaccagttc aggatataag tttcctttat atatgattgg acatggtatg ttggactccg 1260gtcttcatct tagctcaaag gctcaggtgt ttgaacatcc tcacattcaa gacgctgctt 1320cgcagcttcc tgatgatgag attttatttt ttggtgatac tgggctatcc aaaaatccaa 1380tcgactttgt cgaaggttgg ttcagtagtt ggaagagctc cattgcctct tttttcttta 1440tcatagggtt aatcattgga ctattcttgg ttctccgagt tggtatttat ctttacatta 1500aattaaagca caccaagaaa agacagattt atacagacat agagatgaac cgacttggaa 1560ggtaactcaa atcctgcaca acagattctt catgtttgga ccaaatcaac ttgtgatacc 1620atgctcaaag aggcctcaat tatatttgag tttttaattt ttatg 16653511PRTVesicular stomatitis virus 3Met Lys Cys Phe Leu Tyr Leu Ala Phe Leu Phe Ile Gly Val Asn Cys1 5 10 15Lys Phe Thr Ile Val Phe Pro His Asn Gln Lys Gly Asn Trp Lys Asn 20 25 30Val Pro Ser Asn Tyr His Tyr Cys Pro Ser Ser Ser Asp Leu Asn Trp 35 40 45His Asn Asp Leu Ile Gly Thr Gly Leu Gln Val Lys Met Pro Lys Ser 50 55 60His Lys Ala Ile Gln Ala Asp Gly Trp Met Cys His Ala Ser Lys Trp65 70 75 80Val Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro Lys Tyr Ile Thr His 85 90 95Ser Ile Arg Ser Phe Thr Pro Ser Val Glu Gln Cys Lys Glu Ser Ile 100 105 110Glu Gln Thr Lys Gln Gly Thr Trp Leu Asn Pro Gly Phe Pro Pro Gln 115 120 125Ser Cys Gly Tyr Ala Thr Val Thr Asp Ala Glu Ala Val Ile Val Gln 130 135 140Val Thr Pro His His Val Leu Val Asp Glu Tyr Thr Gly Glu Trp Val145 150 155 160Asp Ser Gln Phe Ile Asn Gly Lys Cys Ser Asn Asp Ile Cys Pro Thr 165 170 175Val His Asn Ser Thr Thr Trp His Ser Asp Tyr Lys Val Lys Gly Leu 180 185 190Cys Asp Ser Asn Leu Ile Ser Thr Asp Ile Thr Phe Phe Ser Glu Asp 195 200 205Arg Glu Leu Ser Ser Leu Gly Lys Glu Gly Thr Gly Phe Arg Ser Asn 210 215 220Tyr Phe Ala Tyr Glu Thr Gly Asp Lys Ala Cys Lys Met Gln Tyr Cys225 230 235 240Lys His Trp Gly Val Arg Leu Pro Ser Gly Val Trp Phe Glu Met Ala 245 250 255Asp Lys Asp Leu Phe Ala Ala Ala Arg Phe Pro Glu Cys Pro Glu Gly 260 265 270Ser Ser Ile Ser Ala Pro Ser Gln Thr Ser Val Asp Val Ser Leu Ile 275 280 285Gln Asp Val Glu Arg Ile Leu Asp Tyr Ser Leu Cys Gln Glu Thr Trp 290 295 300Ser Lys Ile Arg Ala Gly Leu Pro Ile Ser Pro Val Asp Leu Ser Tyr305 310 315 320Leu Ala Pro Lys Asn Pro Gly Thr Gly Pro Ala Phe Thr Ile Ile Asn 325 330 335Gly Thr Leu Lys Tyr Phe Glu

Thr Arg Tyr Ile Arg Val Asp Ile Ala 340 345 350Ala Pro Ile Leu Ser Arg Met Val Gly Met Ile Ser Gly Thr Thr Thr 355 360 365Glu Arg Glu Leu Trp Asp Asp Trp Ala Pro Tyr Glu Asp Val Glu Ile 370 375 380Gly Pro Asn Gly Val Leu Arg Thr Ser Ser Gly Tyr Lys Phe Pro Leu385 390 395 400Tyr Met Ile Gly His Gly Met Leu Asp Ser Gly Leu His Leu Ser Ser 405 410 415Lys Ala Gln Val Phe Glu His Pro His Ile Gln Asp Ala Ala Ser Gln 420 425 430Leu Pro Asp Asp Glu Ile Leu Phe Phe Gly Asp Thr Gly Leu Ser Lys 435 440 445Asn Pro Ile Asp Phe Val Glu Gly Trp Phe Ser Ser Trp Lys Ser Ser 450 455 460Ile Ala Ser Phe Phe Phe Ile Ile Gly Leu Ile Ile Gly Leu Phe Leu465 470 475 480Val Leu Arg Val Gly Ile Tyr Leu Tyr Ile Lys Leu Lys His Thr Lys 485 490 495Lys Arg Gln Ile Tyr Thr Asp Ile Glu Met Asn Arg Leu Gly Arg 500 505 510415186DNANewcastle disease virus 4accaaacaga gaatccgtaa gttacgataa aaggcgaagg agcaattgaa gtcgcacggg 60tagaaggtgt gaatctcgag tgcgagcccg aagcacaaac tcgaggaagc cttctgccaa 120catgtcttcc gtattcgacg agtacgaaca gctcctcgcg gctcagactc gccccaatgg 180agctcatgga gggggggaga aagggagtac cttaaaagta gacgtcccgg tattcactct 240taacagtgat gacccagaag ataggtggag ctttgtggta ttctgcctcc ggattgctgt 300tagcgaagat gccaacaaac cactcaggca aggtgctctc atatctcttt tatgctccca 360ctcacaggta atgaggaacc atgttgccct tgcagggaaa cagaatgaag ccacattggc 420cgtgcttgag attgatggct ttgccaacgg cacgccccag ttcaacaata ggagtggagt 480gtctgaagag agagcacaga gatttgcgat gatagcagga tctctccctc gggcatgcag 540caacggcacc ccgttcgtca cagccggggc tgaagatgat gcaccagaag acatcaccga 600taccctggag aggatcctct ctatccaggc tcaagtatgg gtcacagtag caaaagccat 660gactgcgtat gagactgcag atgagtcgga aacaaggcga atcaataagt atatgcagca 720aggcagggtc caaaagaaat acatcctcta ccccgtatgc aggagcacaa tccaactcac 780gatcagacag tctcttgcag tccgcatctt tttggttagc gagctcaaga gaggccgcaa 840cacggcaggt ggtacctcta cttattataa cctagtaggg gacgtagact catatatcag 900gaataccggg cttactgcat tcttcttgac actcaagtac ggaatcaaca ccaagacatc 960agcccttgca cttagtagcc tctcaggcga catccagaag atgaagcagc tcatgcgttt 1020gtatcggatg aaaggagata atgcgccgta catgacatta cttggtgata gtgaccagat 1080gagctttgcg cctgccgagt atgcacaact ttactccttt gccatgggta tggcatcagt 1140cctagataaa ggtactggga aataccaatt tgccagggac tttatgagca catcattctg 1200gagacttgga gtagagtacg ctcaggctca gggaagtagc attaacgagg atatggctgc 1260cgagctaaag ctaaccccgg cagcaaggag gggcctggca gctgctgccc aacgagtctc 1320cgaggtgacc agcagcatag acatgcctac tcaacaagtc ggagtcctca ctgggcttag 1380cgagggggga tcccaagccc tacaaggcgg atcgaataga tcgcaagggc aaccagaagc 1440cggggatggg gagacccaat tcctggatct gatgagagcg gtagcaaata gcatgaggga 1500ggcgccaaac tctgcacagg gcactcccca atcggggcct cccccaactc ctgggccatc 1560ccaagataac gacaccgact gggggtattg attgacaaaa cccagcctgc ttctacaaga 1620acatcccaat gctctcaccc gtagtcgacc cctcgatttg cggctctata tgaccacacc 1680ctcaaacaaa catccccctc tttcctccct ccccctgctg tacaactccg cacgccctag 1740ataccacagg cacaccgcgg ctcactaaca atcaaaacag agccgaggga attagaaaaa 1800agtacgggta gaagagggat attcagagat cagggcaagt ctcccgagtc tctgctctct 1860cctctacctg atagaccagg acaaacatgg ccacctttac agatgcagag atcgacgagc 1920tatttgagac aagtggaact gtcattgaca acataattac agcccagggt aaaccagcag 1980agactgttgg aaggagtgca atcccacagg gcaagaccaa ggtgctgagc gcagcatggg 2040agaagcatgg gagcatccag ccaccggcca gtcaagacaa cctcgatcga caggacagat 2100ctgacaaaca accatccaca cccgagcaaa cgaccccgca cgacagcccg ccggccacat 2160ccgctgacca gccccccacc caggccacag acgaagccgt cgacacacag ctcaggaccg 2220gagcaagcaa ctctctgctg ttgatgcttg acaagctcag caataaatcg tccaatgcta 2280aaaagggccc atggtcgagc ccccaagagg ggaatcacca acgtccgact caacagcagg 2340ggagtcaacc cagtcgcgga aacagccagg aaagactgca gaaccaagtc aaggccgccc 2400ctggaaacca gggcacagac gtgaacacag catatcatgg acaatgggag gagtcacaac 2460tatcagctgg tgcaacccct catgctctcc gatcaaggca gagccaagac aatacccttg 2520tatctgcgga tcatgtccag ccacctgtag actttgtgca agcgatgatg tctatgatgg 2580gggcgatatc acagagagta agtaaggttg actatcagct agatcttgtc ttgaaacaga 2640catcctccat ccctatgatg cggtccgaaa tccaacagct gaaaacatct gttgcagtca 2700tggaagccaa cttgggaatg atgaagattc tggatcccgg ttgtgccaac atttcatctc 2760tgagtgatct acgggcagtt gcccgatctc acccggtttt agtttcaggc cctggagacc 2820catctcccta tgtgatacaa ggaggcgaaa tggcacttaa taaactttcg caaccagtgc 2880cacatccatc tgaattgatt aaacccgcca ctgcatgcgg gcctgatata ggagtggaga 2940gggacactgt ccgtgcattg atcatgtcac gcccaatgca cccgagttct tcagccaagc 3000tcctaagcaa gttagatgca gccgggtcga tcgaggaaat caggaaaatc aagcgccttg 3060ctctaaatgg ctaattacta ctgccacacg tagcgggtcc ctgtccactc ggcatcacac 3120ggaatctgca ccgagttccc ccccgcagac ccaaggtcca actctagaag cggcaatcct 3180ctctcgcttc ctcagcccca ctgaatgatc gcgtaaccgt aattaatcta gctacattaa 3240ggattaagaa aaaatacggg tagaattgga gtgccccaat tgtgccaaga tggactcatc 3300taggacaatt gggctgtact ttgattctgc ccattcttct agcaacctgt tagcatttcc 3360gatcgtccta caagacacag gagatgggaa gaagcaaatc gccccgcaat ataggatcca 3420gcgccttgac tcgtggactg atagtaagga agactcagta ttcatcacca cctatggatt 3480catctttcaa gttgggaatg aggaagccac tgtcggcatg atcgatgata aacccaagcg 3540cgagttactt tccgctgcga tgctctgcct aggaagcgtc ccaaataccg gagaccttgt 3600tgagctggca agggcctgtc tcactatgat ggtcacatgc aagaagagtg caactaatac 3660tgagagaatg gttttctcag tagtgcaggc accccaagtg ctgcaaagct gtagggttgt 3720ggcaaataaa tactcatcag tgaatgcagt caagcacgtg aaagcgccag agaagatccc 3780cgggagtgga accctagaat acaaggtgaa ctttgtctcc ttgactgtgg taccgaagaa 3840ggatgtctac aagatcccag ctgcagtatt gaagatttct ggctcgagtc tgtacaatct 3900tgcgctcaat gtcactatta atgtggaggt agacccgagg agtcctttgg ttaaatctct 3960gtctaagtct gacagcggat actatgctaa cctcttcttg catattggac ttatgaccac 4020cgtagatagg aaggggaaga aagtgacatt tgacaagctg gaaaagaaaa taaggagcct 4080tgatctatct gtcgggctca gtgatgtgct cgggccttcc gtgttggtaa aagcaagagg 4140tgcacggact aagcttttgg cacctttctt ctctagcagt gggacagcct gctatcccat 4200agcaaatgct tctcctcagg tggccaagat actctggagt caaaccgcgt gcctgcggag 4260cgttaaaatc attatccaag caggtaccca acgcgctgtc gcagtgaccg ctgaccacga 4320ggttacctct actaagctgg agaaggggca cacccttgcc aaatacaatc cttttaagaa 4380ataagctgcg tctctgagat tgcgctccgc ccactcaccc agatcatcat gacacaaaaa 4440actaatctgt cttgattatt tacagttagt ttacctgtcc atcaagttag aaaaaacacg 4500ggtagaagat tctggatccc ggttggcgcc ctccaggtgc aggatgggct ccagaccttc 4560taccaagaac ccagcaccta tgatgctgac tatccgggtc gcgctggtac tgagttgcat 4620ctgcccggca aactccattg atggcaggcc tcttgcagct gcaggaattg tggttacagg 4680agacaaagca gtcaacatat acacctcatc ccagacagga tcaatcatag ttaagctcct 4740cccgaatctg cccaaggata aggaggcatg tgcgaaagcc cccttggatg catacaacag 4800gacattgacc actttgctca ccccccttgg tgactctatc cgtaggatac aagagtctgt 4860gactacatct ggagggggga gacaggggcg ccttataggc gccattattg gcggtgtggc 4920tcttggggtt gcaactgccg cacaaataac agcggccgca gctctgatac aagccaaaca 4980aaatgctgcc aacatcctcc gacttaaaga gagcattgcc gcaaccaatg aggctgtgca 5040tgaggtcact gacggattat cgcaactagc agtggcagtt gggaagatgc agcagtttgt 5100taatgaccaa tttaataaaa cagctcagga attagactgc atcaaaattg cacagcaagt 5160tggtgtagag ctcaacctgt acctaaccga attgactaca gtattcggac cacaaatcac 5220ttcacctgcc ttaaacaagc tgactattca ggcactttac aatctagctg gtgggaatat 5280ggattactta ttgactaagt taggtatagg gaacaatcaa ctcagctcat taatcggtag 5340cggcttaatc accggtaacc ctattctata cgactcacag actcaactct tgggtataca 5400ggtaactcta ccttcagtcg ggaacctaaa taatatgcgt gccacctact tggaaacctt 5460atccgtaagc acaaccaggg gatttgcctc ggcacttgtc ccaaaagtgg tgacacaggt 5520cggttctgtg atagaagaac ttgacacctc atactgtata gaaactgact tagatttata 5580ttgtacaaga atagtaacgt tccctatgtc ccctggtatt tactcctgct tgagcggcaa 5640tacatcggcc tgtatgtact caaagaccga aggcgcactt actacaccat atatgactat 5700caaaggctca gtcatcgcta actgcaagat gacaacatgt agatgtgtaa accccccggg 5760tatcatatcg caaaactatg gagaagccgt gtctctaata gataaacaat catgcaatgt 5820tttatcctta ggcgggataa ctttaaggct cagtggggaa ttcgatgtaa cttatcagaa 5880gaatatctca atacaagatt ctcaagtaat aataacaggc aatcttgata tctcaactga 5940gcttgggaat gtcaacaact cgatcagtaa tgctttgaat aagttagagg aaagcaacag 6000aaaactagac aaagtcaatg tcaaactgac cagcacatct gctctcatta cctatatcgt 6060tttgactatc atatctcttg tttttggtat acttagcctg attctagcat gctacctaat 6120gtacaagcaa aaggcgcaac aaaagacctt attatggctt gggaataata ccctagatca 6180gatgagagcc actacaaaaa tgtgaacaca gatgaggaac gaaggtttcc ctaatagtaa 6240tttgtgtgaa agttctggta gtctgtcagt tcggagagtt aagaaaaaac taccggttgt 6300agatgaccaa aggacgatat acgggtagaa cggtaagaga ggccgcccct caattgcgag 6360ccagacttca caacctccgt tctaccgctt caccgacaac agtcctcaat catggaccgc 6420gccgttagcc aagttgcgtt agagaatgat gaaagagagg caaaaaatac atggcgcttg 6480atattccgga ttgcaatctt attcttaaca gtagtgacct tggctatatc tgtagcctcc 6540cttttatata gcatgggggc tagcacacct agcgatcttg taggcatacc gactaggatt 6600tccagggcag aagaaaagat tacatctaca cttggttcca atcaagatgt agtagatagg 6660atatataagc aagtggccct tgagtctcca ttggcattgt taaatactga gaccacaatt 6720atgaacgcaa taacatctct ctcttatcag attaatggag ctgcaaacaa cagcgggtgg 6780ggggcaccta ttcatgaccc agattatata ggggggatag gcaaagaact cattgtagat 6840gatgctagtg atgtcacatc attctatccc tctgcatttc aagaacatct gaattttatc 6900ccggcgccta ctacaggatc aggttgcact cgaataccct catttgacat gagtgctacc 6960cattactgct acacccataa tgtaatattg tctggatgca gagatcactc acactcacat 7020cagtatttag cacttggtgt gctccggaca tctgcaacag ggagggtatt cttttctact 7080ctgcgttcca tcaacctgga cgacacccaa aatcggaagt cttgcagtgt gagtgcaact 7140cccctgggtt gtgatatgct gtgctcgaaa gccacggaga cagaggaaga agattataac 7200tcagctgtcc ctacgcggat ggtacatggg aggttagggt tcgacggcca atatcacgaa 7260aaggacctag atgtcacaac attattcggg gactgggtgg ccaactaccc aggagtaggg 7320ggtggatctt ttattgacag ccgcgtatgg ttctcagtct acggagggtt aaaacccaat 7380acacccagtg acactgtaca ggaagggaaa tatgtgatat acaagcgata caatgacaca 7440tgcccagatg agcaagacta ccagattcga atggccaagt cttcgtataa gcctggacgg 7500tttggtggga aacgcataca gcaggctatc ttatctatca aagtgtcaac atccttaggc 7560gaagacccgg tactgactgt accgcccaac acagtcacac tcatgggggc cgaaggcaga 7620attctcacag tagggacatc ccatttcttg tatcagcgag ggtcatcata cttctctccc 7680gcgttattat atcctatgac agtcagcgac aaaacagcca ctcttcatag tccttataca 7740ttcaatgcct tcactcggcc aggtagtatc ccttgccagg cttcagcaag atgccccaac 7800tcgtgtgtta ctggagtcta tacagatcca tatcccctaa tcttctatag aaaccacacc 7860ttgcgagggg tattcgggac aatgcttgat ggtgaacaag caagacttaa ccctgcgtct 7920gcagtattcg atagcacatc ccgcagtcgc ataactcgag tgagttcaag cagcatcaaa 7980gcagcataca caacatcaac ttgttttaaa gtggtcaaga ccaataagac ctattgtctc 8040agcattgctg aaatatctaa tactctcttc ggagaattca gaatcgtccc gttactagtt 8100gagatcctca aagatgacgg ggttagagaa gccaggtctg gctagttgag tcaactatga 8160aagagttgga aagatggcat tgtatcacct atcttctgcg acatcaagaa tcaaaccgaa 8220tgccggcgcg tgctcgaatt ccatgtcgcc agttgaccac aatcagccag tgctcatgcg 8280atcagattaa gccttgtcaa tagtctcttg attaagaaaa aatgtaagtg gcaatgagat 8340acaaggcaaa acagctcacg gtaaataata cgggtaggac atggcgagct ccggtcctga 8400aagggcagag catcagatta tcctaccaga gtcacacctg tcttcaccat tggtcaagca 8460caaactactc tattattgga aattaactgg gctaccgctt cctgatgaat gtgacttcga 8520ccacctcatt ctcagccgac aatggaaaaa aatacttgaa tcggcctctc ctgatactga 8580gagaatgata aaactcggaa gggcagtaca ccaaactctt aaccacaatt ccagaataac 8640cggagtactc caccccaggt gtttagaaga actggctaat attgaggtcc ctgattcaac 8700caacaaattt cggaagattg agaagaagat ccaaattcac aacacgagat atggagaact 8760gttcacaagg ctgtgtacgc atatagagaa gaaactgctg gggtcatctt ggtctaacaa 8820tgtcccccgg tcagaggagt tcagcagcat tcgtacggat ccggcattct ggtttcactc 8880aaaatggtcc acagccaagt ttgcatggct ccatataaaa cagatccaga ggcatctgat 8940tgtggcagct aggacaaggt ctgcggccaa caaattggtg atgctaaccc ataaggtagg 9000ccaagtcttt gtcactcctg aacttgttgt tgtgacgcat acgaatgaga acaagttcac 9060atgtcttacc caggaacttg tattgatgta tgcagatatg atggagggca gagatatggt 9120caacataata tcaaccacgg cggtgcatct cagaagctta tcagagaaaa ttgatgacat 9180tttgcggtta atagacgctc tggcaaaaga cttgggtaat caagtctacg atgttgtatc 9240actaatggag ggatttgcat acggagctgt ccagctactc gagccgtcag gtacatttgc 9300gggagatttc ttcgcattca acctgcagga gcttaaagac attctaattg gcctcctccc 9360caatgatata gcagaatccg tgactcatgc aatcgctact gtattctctg gtttagaaca 9420gaatcaagca gctgagatgt tgtgcctgtt gcgtctgtgg ggtcacccac tgcttgagtc 9480ccgtattgca gcaaaggcag tcaggagcca aatgtgcgca ccgaaaatgg tagactttga 9540tatgatcctt caggtactgt ctttcttcaa gggaacaatc atcaacggat acagaaagaa 9600gaatgcaggt gtgtggccgc gagtcaaagt ggatacaata tatgggaagg tcattgggca 9660actacatgca gattcagcag agatttcaca cgatatcatg ttgagagagt ataagagttt 9720atctgcactt gaatttgagc catgtataga atacgaccct gtcactaacc tgagcatgtt 9780cctaaaagac aaggcaatcg cacaccccaa cgataattgg cttgcctcgt ttaggcggaa 9840ccttctctcc gaagaccaga agaaacatgt aaaggaagcg acttcgacta accgcctctt 9900gatagagttt ttagagtcaa atgattttga tccatataaa gagatggaat atctgacgac 9960ccttgagtac cttagagatg acaatgtggc agtatcatac tcgctcaaag agaaggaagt 10020gaaagttaat ggacggatct tcgctaagct gacaaagaag ttaaggaact gtcaggtgat 10080ggcggaaggg atcctagccg atcagattgc acctttcttt cagggaaatg gagtcattca 10140ggatagcata tccttgacca agagtatgct agcgatgagt caactgtctt ttaacagcaa 10200taagaaacgt atcactgact gtaaagaaag agtatgttca aaccgcaatc atgatccgaa 10260aagcaagaac cgtcggagag ttgcaacctt cataacaact gacctgcaaa agtactgtct 10320taattggaga tatcagacga tcaaattgtt cgctcatgcc atcaatcagt tgatgggcct 10380acctcatttc ttcgagtgga ttcacctaag actgatggac actacgatgt tcgtaggaga 10440ccctttcaat cctccaagtg accctactga ctgtgacctc tcaagagtcc ctaatgatga 10500catatatatt gtcagtgcca gagggggtat cgaaggatta tgccagaagc tatggacaat 10560gatctcaatt gctgcaatcc aacttgctgc agctagatcg cattgtcgtg ttgcctgtat 10620ggtacagggt gataatcaag taatagcagt aacgagagag gtaagatcag atgactctcc 10680ggagatggtg ttgacacagt tgcatcaagc cagtgataat ttcttcaagg aattaatcca 10740tgtcaatcat ttgattggcc ataatttgaa ggatcgtgaa accatcaggt cagacacatt 10800cttcatatac agcaaacgaa tcttcaaaga tggagcaatc ctcagtcaag tcctcaaaaa 10860ttcatctaaa ttagtgctag tgtcaggtga tctcagtgaa aacaccgtaa tgtcctgtgc 10920caacattgcc tctactgtag cacggctatg cgagaacggg cttcccaaag acttctgtta 10980ctatttaaac tatataatga gttgtgtgca gacatacttt gactctgagt tctccatcac 11040caacaattcg caccccgatc ttaatcagtc gtggattgag gacatctctt ttgtgcactc 11100atatgttctg actcctgccc aattaggggg actgagtaac cttcaatact caaggctcta 11160cactagaaat atcggtgacc cggggactac tgcttttgca gagatcaagc gactagaagc 11220agtgggacta ctgagtccta acattaggac taatatctta actaggccgc ctgggaatgg 11280agattgggcc agtctgtgca acgacccata ctctttcaat tttgagactg ttgcaagccc 11340aaacattgtt cttaagaaac atacgcaaag agtcctattt gaaacttgtt caaatccctt 11400attgtctgga gtgcacacag aggataatga ggcagaagag aaggcattgg ctgaattctt 11460gcttaatcaa gaggtgattc atccccgcgt tgcgcatgcc atcatggagg caagctctgt 11520aggtaggaga aagcaaattc aagggcttgt tgacacaaca aacactgtaa ttaagattgc 11580gcttactagg aggccattag gcatcaagag gctgatgcgg atagtcaatt attctagcat 11640gcatgcaatg ctgtttagag acgatgtttt ttcctctagt agatccaacc accccttagt 11700ctcttctaat atgtgttctc tgacactggc agactatgca cggaatagaa gctggtcacc 11760tttgacggga ggcaggaaaa tactgggtgt atctaatcct gatacgatag aactcgtaga 11820gggtgagatt cttagtgtaa gcggagggtg tacaagatgt gacagcggag atgaacaatt 11880tacttggttc catcttccaa gcaatataga attgaccgat gacaccagca agaatcctcc 11940gatgagggta ccatatctcg ggtcaaagac acaggagagg agagctgcct cacttgcgaa 12000aatagctcat atgtcgccac atgtgaaggc tgccctaagg gcatcatccg tgttgatctg 12060ggcttatggg gataatgaag taaattggac tgctgctctt acgattgcaa aatctcggtg 12120taatgtaaac ttagagtatc ttcggttact gtccccttta cccacggctg ggaatcttca 12180acatagacta gatgatggta taactcagat gacattcacc cctgcatctc tctacagggt 12240gtcaccttac attcacatat ccaatgattc tcaaaggctg ttcactgaag aaggagtcaa 12300agaggggaat gtggtttacc aacagatcat gctcttgggt ttatctctaa tcgaatcgat 12360ctttccaatg acaacaacca gaacatatga tgagatcaca ctgcacctac atagtaaatt 12420tagttgctgt atcagggaag cacctgttgc ggttcctttc gagctacttg gggtggcacc 12480ggaactgagg acagtgacct caaataagtt tatgtatgat cctagccctg tatcggaggg 12540agactttgcg agacttgact tagctatctt caagagttat gagcttaatc tggagtcata 12600tcccacgata gagctaatga acattctttc aatatccagc gggaagttga ttggccagtc 12660tgtggtttct tatgatgaag atacctccat aaagaatgat gccataatag tgtatgacaa 12720tacccgaaat tggatcagtg aagctcagaa ttcagatgtg gtccgcctat ttgaatatgc 12780agcacttgaa gtgctcctcg actgttctta ccaactctat tacctgagag taagagacct 12840agacaatatt gtcttatata tgggtgattt atacaagaat atgccaggaa ttctactttc 12900caacattgca gctacaatat ctcatcctgt cattcattca aggttacatg cagtgggcct 12960ggtcaaccat gacggatcac accaacttgc agatacggat tttatcgaaa tgtctgcaaa 13020actgttagta tcttgcaccc gacgtgtgat ctccggctta tattcaggaa ataagtatga 13080tctgctgttc ccatctgtct tagatgataa cctgaatgag aagatgcttc agctgatatc 13140ccggttatgc tgtctgtaca cggtactctt tgctacaaca agagaaatcc cgaaaataag 13200aggcttaact gcagaagaga aatgttcaat actcactgag tatttactgt cggatgctgt 13260gaaaccatta cttagccccg atcaagtgag ctctatcatg tctcctaaca taattacatt 13320cccagctaat ctgtactaca tgtctcggaa gagcctcaat ttgatcaggg aaagggagga 13380cagggatact atcctggcgt tgttgttccc ccaagagcca ttattagagt tcccttctgt 13440gcaagatatt ggtgctcgag tgaaagatcc attcacccga caacctgcgg catttttgca 13500agagttagat ttgagtgctc cagcaaggta tgacgcattc acacttagtc agattcatcc 13560tgaactcaca tctccaaatc cggaggaaga ctacttagta cgatacttgt tcagagggat 13620agggactgca tcttcctctt ggtataaggc atcccatctc ctttctgtac ccgaggtaag 13680atgtgcaaga cacgggaact ccttatactt ggctgaagga agcggagcca tcatgagtct 13740tcttgaactg catgtaccac atgaaactat ctattacaat acgctctttt caaatgagat 13800gaaccccccg caacgacatt tcgggccgac cccaactcag tttttgaatt cggttgttta 13860taggaatcta caggcggagg taacatgcaa ggatggattt gtccaagagt tccgtccatt 13920atggagagaa aatacagagg aaagtgacct gacctcagat aaagcagtgg ggtatattac 13980atctgcagta

ccctacagat ctgtatcatt gctgcattgt gacattgaaa ttcctccagg 14040gtccaatcaa agcttactag atcaactagc tatcaattta tctctgattg ccatgcattc 14100tgtaagggag ggcggggtag taatcatcaa agtgttgtat gcaatgggat actactttca 14160tctactcatg aacttgtttg ctccgtgttc cacaaaagga tatattctct ctaatggtta 14220tgcatgtcga ggggatatgg agtgttacct ggtatttgtc atgggttacc tgggcgggcc 14280tacatttgta catgaggtgg tgaggatggc aaaaactctg gtgcagcggc acggtacgct 14340tttgtctaaa tcagatgaga tcacactgac caggttattc acctcacagc ggcagcgtgt 14400gacagacatc ctatccagtc ctttaccaag attaataaag tacttgagga agaatattga 14460cactgcgctg attgaagccg ggggacagcc cgtccgtcca ttctgtgcgg agagtctggt 14520gagcacgcta gcgaacataa ctcagataac ccagatcatc gctagtcaca ttgacacagt 14580catccggtct gtgatatata tggaagctga gggtgatctc gctgacacag tatttctatt 14640taccccttac aatctctcta ctgacgggaa aaagaggaca tcacttaaac agtgcacgag 14700acagatccta gaggttacaa tactaggtct tagagtcgaa aatctcaata aaataggcga 14760tataatcagc ctagtgctta aaggcatgat ctccatggag gaccttatcc cactaaggac 14820atacttgaag catagtacct gccctaaata tttgaaggct gtcctaggta ttaccaaact 14880caaagaaatg tttacagaca cttctgtact gtacttgact cgtgctcaac aaaaattcta 14940catgaaaact ataggcaatg cagtcaaagg atattacagt aactgtgact cctaacgaaa 15000atcacatatt aataggctcc ttttttggcc aattgtattc ttgttgattt aattatatta 15060tgttagaaaa aagttgaact ctgactcctt aggactcgaa ttcgaactca aataaatgtc 15120tttaaaaaag gttgcgcaca attattcttg agtgtagtct cgtcattcac caaatctttg 15180tttggt 1518651992DNANewcastle disease virus 5acgggtagaa cggtaagaga ggccgcccct caattgcgag ccagacttca caacctccgt 60tctaccgctt caccgacaac agtcctcaat catggaccgc gccgttagcc aagttgcgtt 120agagaatgat gaaagagagg caaaaaatac atggcgcttg atattccgga ttgcaatctt 180attcttaaca gtagtgacct tggctatatc tgtagcctcc cttttatata gcatgggggc 240tagcacacct agcgatcttg taggcatacc gactaggatt tccagggcag aagaaaagat 300tacatctaca cttggttcca atcaagatgt agtagatagg atatataagc aagtggccct 360tgagtctcca ttggcattgt taaatactga gaccacaatt atgaacgcaa taacatctct 420ctcttatcag attaatggag ctgcaaacaa cagcgggtgg ggggcaccta ttcatgaccc 480agattatata ggggggatag gcaaagaact cattgtagat gatgctagtg atgtcacatc 540attctatccc tctgcatttc aagaacatct gaattttatc ccggcgccta ctacaggatc 600aggttgcact cgaataccct catttgacat gagtgctacc cattactgct acacccataa 660tgtaatattg tctggatgca gagatcactc acactcatat cagtatttag cacttggtgt 720gctccggaca tctgcaacag ggagggtatt cttttctact ctgcgttcca tcaacctgga 780cgacacccaa aatcggaagt cttgcagtgt gagtgcaact cccctgggtt gtgatatgct 840gtgctcgaaa gccacggaga cagaggaaga agattataac tcagctgtcc ctacgcggat 900ggtacatggg aggttagggt tcgacggcca atatcacgaa aaggacctag atgtcacaac 960attattcggg gactgggtgg ccaactaccc aggagtaggg ggtggatctt ttattgacag 1020ccgcgtatgg ttctcagtct acggagggtt aaaacccaat tcacccagtg acactgtaca 1080ggaagggaaa tatgtgatat acaagcgata caatgacaca tgcccagatg agcaagacta 1140ccagattcga atggccaagt cttcgtataa gcctggacgg tttggtggga aacgcataca 1200gcaggctatc ttatctatca aagtgtcaac atccttaggc gaagacccgg tactgactgt 1260accgcccaac acagtcacac tcatgggggc cgaaggcaga attctcacag tagggacatc 1320ccatttcttg tatcagcgag ggtcatcata cttctctccc gcgttattat atcctatgac 1380agtcagcaac aaaacagcca ctcttcatag tccttataca ttcaatgcct tcactcggcc 1440aggtagtatc ccttgccagg cttcagcaag atgccccaac tcgtgtgtta ctggagtcta 1500tacagatcca tatcccctaa tcttctatag aaaccacacc ttgcgagggg tattcgggac 1560aatgcttgat ggtgaacaag caagacttaa ccctgcgtct gcagtattcg atagcacatc 1620ccgcagtcgc ataactcgag tgagttcaag cagcatcaaa gcagcataca caacatcaac 1680ttgttttaaa gtggtcaaga ccaataagac ctattgtctc agcattgctg aaatatctaa 1740tactctcttc ggagaattca gaatcgtccc gttactagtt gagatcctca aagatgacgg 1800ggttagagaa gccaggtctg gctagttgag tcaactatga aagagttgga aagatggcat 1860tgtatcacct atcttctgcg acatcaagaa tcaaaccgaa tgccggcgcg tgctcgaatt 1920ccatgtcgcc agttgaccac aatcagccag tgctcatgcg atcagattaa gccttgtcaa 1980tagtctcttg at 19926577PRTNewcastle disease virus 6Met Asp Arg Ala Val Ser Gln Val Ala Leu Glu Asn Asp Glu Arg Glu1 5 10 15Ala Lys Asn Thr Trp Arg Leu Ile Phe Arg Ile Ala Ile Leu Phe Leu 20 25 30Thr Val Val Thr Leu Ala Ile Ser Val Ala Ser Leu Leu Tyr Ser Met 35 40 45Gly Ala Ser Thr Pro Ser Asp Leu Val Gly Ile Pro Thr Arg Ile Ser 50 55 60Arg Ala Glu Glu Lys Ile Thr Ser Thr Leu Gly Ser Asn Gln Asp Val65 70 75 80Val Asp Arg Ile Tyr Lys Gln Val Ala Leu Glu Ser Pro Leu Ala Leu 85 90 95Leu Asn Thr Glu Thr Thr Ile Met Asn Ala Ile Thr Ser Leu Ser Tyr 100 105 110Gln Ile Asn Gly Ala Ala Asn Asn Ser Gly Trp Gly Ala Pro Ile His 115 120 125Asp Pro Asp Tyr Ile Gly Gly Ile Gly Lys Glu Leu Ile Val Asp Asp 130 135 140Ala Ser Asp Val Thr Ser Phe Tyr Pro Ser Ala Phe Gln Glu His Leu145 150 155 160Asn Phe Ile Pro Ala Pro Thr Thr Gly Ser Gly Cys Thr Arg Ile Pro 165 170 175Ser Phe Asp Met Ser Ala Thr His Tyr Cys Tyr Thr His Asn Val Ile 180 185 190Leu Ser Gly Cys Arg Asp His Ser His Ser His Gln Tyr Leu Ala Leu 195 200 205Gly Val Leu Arg Thr Ser Ala Thr Gly Arg Val Phe Phe Ser Thr Leu 210 215 220Arg Ser Ile Asn Leu Asp Asp Thr Gln Asn Arg Lys Ser Cys Ser Val225 230 235 240Ser Ala Thr Pro Leu Gly Cys Asp Met Leu Cys Ser Lys Ala Thr Glu 245 250 255Thr Glu Glu Glu Asp Tyr Asn Ser Ala Val Pro Thr Arg Met Val His 260 265 270Gly Arg Leu Gly Phe Asp Gly Gln Tyr His Glu Lys Asp Leu Asp Val 275 280 285Thr Thr Leu Phe Gly Asp Trp Val Ala Asn Tyr Pro Gly Val Gly Gly 290 295 300Gly Ser Phe Ile Asp Ser Arg Val Trp Phe Ser Val Tyr Gly Gly Leu305 310 315 320Lys Pro Asn Thr Pro Ser Asp Thr Val Gln Glu Gly Lys Tyr Val Ile 325 330 335Tyr Lys Arg Tyr Asn Asp Thr Cys Pro Asp Glu Gln Asp Tyr Gln Ile 340 345 350Arg Met Ala Lys Ser Ser Tyr Lys Pro Gly Arg Phe Gly Gly Lys Arg 355 360 365Ile Gln Gln Ala Ile Leu Ser Ile Lys Val Ser Thr Ser Leu Gly Glu 370 375 380Asp Pro Val Leu Thr Val Pro Pro Asn Thr Val Thr Leu Met Gly Ala385 390 395 400Glu Gly Arg Ile Leu Thr Val Gly Thr Ser His Phe Leu Tyr Gln Arg 405 410 415Gly Ser Ser Tyr Phe Ser Pro Ala Leu Leu Tyr Pro Met Thr Val Ser 420 425 430Asp Lys Thr Ala Thr Leu His Ser Pro Tyr Thr Phe Asn Ala Phe Thr 435 440 445Arg Pro Gly Ser Ile Pro Cys Gln Ala Ser Ala Arg Cys Pro Asn Ser 450 455 460Cys Val Thr Gly Val Tyr Thr Asp Pro Tyr Pro Leu Ile Phe Tyr Arg465 470 475 480Asn His Thr Leu Arg Gly Val Phe Gly Thr Met Leu Asp Gly Glu Gln 485 490 495Ala Arg Leu Asn Pro Ala Ser Ala Val Phe Asp Ser Thr Ser Arg Ser 500 505 510Arg Ile Thr Arg Val Ser Ser Ser Ser Ile Lys Ala Ala Tyr Thr Thr 515 520 525Ser Thr Cys Phe Lys Val Val Lys Thr Asn Lys Thr Tyr Cys Leu Ser 530 535 540Ile Ala Glu Ile Ser Asn Thr Leu Phe Gly Glu Phe Arg Ile Val Pro545 550 555 560Leu Leu Val Glu Ile Leu Lys Asp Asp Gly Val Arg Glu Ala Arg Ser 565 570 575Gly71782DNANewcastle disease virus 7acgggtagaa gactctggat cccggttggc gccctccagg tgcaggatgg gctccagacc 60ttttaccaag aacccagcac ctatgatgct gactatccgg gtcgcgctgg tattgagttg 120catctgtccg gcaaactcca ttgatggcag gccttttgca gctgcaggaa ttgtggttac 180aggagacaaa gcagtcaaca tatacacctc atcccagaca ggatcaatca tagttaagct 240cctcccgaat ctgcccaagg ataaggaggc atgtgcgaaa gcccccttgg atgcatacaa 300caggacattg accactttgc tcacccccct tggtgactct atccgtagga tacaagagtc 360tgtgactaca tctggagggg ggagacaggg gcgccttata ggcgccatta ttggcggtgt 420ggctcttggg gttgcaactg ccgcacaaat aacagcggcc gcagctctga tacaagccaa 480acaaaatgct gccaacatcc tccgacttaa agagagcatt gccgcaacca atgaggctgt 540gcatgaggtc actgacggat tatcccaact agcagtggca gttgggaaga tgcagcagtt 600tgttaatgac caatttaata aaacagctca ggaattagac tgcataaaaa ttgcacagca 660agttggtgta gagctcaacc tgtacctaac cgaattgact acagtattcg gaccacaaat 720cacttcacct gccttaaaca agctgactat tcaggcactt tacaatctag ctggtgggaa 780tatggattac ttattgacta agttaggtat agggaacaat caactcagct cattaatcgg 840tagcggctta atcaccggta accctattct atacgactca cagactcaac tcttgggtat 900acaggtaact ctaccttcag tcgggaacct aaataatatg cgtgccacct acttggaaac 960cttatccgta agcacaacca ggggatttgc ctcggcactt gtcccaaaag tggtgacaca 1020ggtcggttct gtgatagaag aacttgacac ctcatactgt atagaaactg acttagattt 1080atattgtaca agaatagtaa cgttccctat gtcccctggt atttactcct gcttgagcgg 1140caatacatcg gcctgtatgt actcaaagac cgaaggcgca cttactacac catatatgac 1200tatcaaaggc tcagtcatcg ctaactgcaa gatgacaaca tgtagatgtg taaacccccc 1260gggtatcata tcgcaaaact atggagaagc cgtgtctcta atagataaac aatcatgcaa 1320tgttttatcc ttaggcggga taactttaag gctcagtggg gaattcgatg taacttatca 1380gaagaatatc tcaatacaag attctcaagt aataataaca ggcaatcttg atatctcaac 1440tgagcttggg aatgtcaaca actcgatcag taatgctttg aataagttag aggaaagcaa 1500cagaaaacta gacaaagtca atgtcaaact gaccagcaca tctgctctca ttacctatat 1560cgttttgact atcatatctc ttgtttttgg tatacttagc ctgattctag catgctacct 1620aatgtacaag caaaaggcgc aacaaaagac cttattatgg cttgggaata ataccctaga 1680tcagatgaga gccactacaa aaatgtgaac acagatgagg aacgaaggtt tccctaatag 1740taatttgtgt gaaagttctg gtagtctgtc agttcggaga gt 17828553PRTNewcastle disease virus 8Met Gly Ser Arg Pro Phe Thr Lys Asn Pro Ala Pro Met Met Leu Thr1 5 10 15Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cys Pro Ala Asn Ser Ile 20 25 30Asp Gly Arg Pro Phe Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys 35 40 45Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gly Ser Ile Ile Val Lys 50 55 60Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala Pro65 70 75 80Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr Pro Leu Gly 85 90 95Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Thr Thr Ser Gly Gly Gly 100 105 110Arg Gln Gly Arg Leu Ile Gly Ala Ile Ile Gly Gly Val Ala Leu Gly 115 120 125Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Ala Ala Leu Ile Gln Ala 130 135 140Lys Gln Asn Ala Ala Asn Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala145 150 155 160Thr Asn Glu Ala Val His Glu Val Thr Asp Gly Leu Ser Gln Leu Ala 165 170 175Val Ala Val Gly Lys Met Gln Gln Phe Val Asn Asp Gln Phe Asn Lys 180 185 190Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Ala Gln Gln Val Gly Val 195 200 205Glu Leu Asn Leu Tyr Leu Thr Glu Leu Thr Thr Val Phe Gly Pro Gln 210 215 220Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile Gln Ala Leu Tyr Asn225 230 235 240Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr Lys Leu Gly Ile Gly 245 250 255Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gly Leu Ile Thr Gly Asn 260 265 270Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Leu Gly Ile Gln Val Thr 275 280 285Leu Pro Ser Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu 290 295 300Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Ala Ser Ala Leu Val Pro305 310 315 320Lys Val Val Thr Gln Val Gly Ser Val Ile Glu Glu Leu Asp Thr Ser 325 330 335Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cys Thr Arg Ile Val Thr 340 345 350Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu Ser Gly Asn Thr Ser 355 360 365Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Leu Thr Thr Pro Tyr Met 370 375 380Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Lys Met Thr Thr Cys Arg385 390 395 400Cys Val Asn Pro Pro Gly Ile Ile Ser Gln Asn Tyr Gly Glu Ala Val 405 410 415Ser Leu Ile Asp Lys Gln Ser Cys Asn Val Leu Ser Leu Gly Gly Ile 420 425 430Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Thr Tyr Gln Lys Asn Ile 435 440 445Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gly Asn Leu Asp Ile Ser 450 455 460Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Ser Asn Ala Leu Asn Lys465 470 475 480Leu Glu Glu Ser Asn Arg Lys Leu Asp Lys Val Asn Val Lys Leu Thr 485 490 495Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Leu Thr Ile Ile Ser Leu 500 505 510Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cys Tyr Leu Met Tyr Lys 515 520 525Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Leu Gly Asn Asn Thr Leu 530 535 540Asp Gln Met Arg Ala Thr Thr Lys Met545 55091662DNAArtificial SequenceNDV F3aa-modified fusion protein 9atgggctcca gaccttctac caagaaccca gcacctatga tgctgactat ccgggtcgcg 60ctggtactga gttgcatctg cccggcaaac tccattgatg gcaggcctct tgcagctgca 120ggaattgtgg ttacaggaga caaagcagtc aacatataca cctcatccca gacaggatca 180atcatagtta agctcctccc gaatctgccc aaggataagg aggcatgtgc gaaagccccc 240ttggatgcat acaacaggac attgaccact ttgctcaccc cccttggtga ctctatccgt 300aggatacaag agtctgtgac tacatctgga gggcggagac agaggcgctt tataggcgcc 360attattggcg gtgtggctct tggggttgca actgccgcac aaataacagc ggccgcagct 420ctgatacaag ccaaacaaaa tgctgccaac atcctccgac ttaaagagag cattgccgca 480accaatgagg ctgtgcatga ggtcactgac ggattatcgc aactagcagt ggcagttggg 540aagatgcagc agtttgttaa tgaccaattt aataaaacag ctcaggaatt agactgcatc 600aaaattgcac agcaagttgg tgtagagctc aacctgtacc taaccgaatt gactacagta 660ttcggaccac aaatcacttc acctgcctta aacaagctga ctattcaggc actttacaat 720ctagctggtg ggaatatgga ttacttattg actaagttag gtatagggaa caatcaactc 780agctcattaa tcggtagcgg cttaatcacc ggtaacccta ttctatacga ctcacagact 840caactcttgg gtatacaggt aactctacct tcagtcggga acctaaataa tatgcgtgcc 900acctacttgg aaaccttatc cgtaagcaca accaggggat ttgcctcggc acttgtccca 960aaagtggtga cacaggtcgg ttctgtgata gaagaacttg acacctcata ctgtatagaa 1020actgacttag atttatattg tacaagaata gtaacgttcc ctatgtcccc tggtatttac 1080tcctgcttga gcggcaatac atcggcctgt atgtactcaa agaccgaagg cgcacttact 1140acaccatata tgactatcaa aggctcagtc atcgctaact gcaagatgac aacatgtaga 1200tgtgtaaacc ccccgggtat catatcgcaa aactatggag aagccgtgtc tctaatagat 1260aaacaatcat gcaatgtttt atccttaggc gggataactt taaggctcag tggggaattc 1320gatgtaactt atcagaagaa tatctcaata caagattctc aagtaataat aacaggcaat 1380cttgatatct caactgagct tgggaatgtc aacaactcga tcagtaatgc tttgaataag 1440ttagaggaaa gcaacagaaa actagacaaa gtcaatgtca aactgaccag cacatctgct 1500ctcattacct atatcgtttt gactatcata tctcttgttt ttggtatact tagcctgatt 1560ctagcatgct acctaatgta caagcaaaag gcgcaacaaa agaccttatt atggcttggg 1620aataataccc tagatcagat gagagccact acaaaaatgt ga 166210553PRTArtificial SequenceNDV F3aa-modified fusion protein 10Met Gly Ser Arg Pro Phe Thr Lys Asn Pro Ala Pro Met Met Leu Thr1 5 10 15Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cys Pro Ala Asn Ser Ile 20 25 30Asp Gly Arg Pro Phe Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys 35 40 45Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gly Ser Ile Ile Val Lys 50 55 60Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala Pro65 70 75 80Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr Pro Leu Gly 85 90 95Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Thr Thr Ser Gly Gly Arg 100 105 110Arg Gln Arg Arg Phe Ile Gly Ala Ile Ile Gly Gly Val Ala Leu Gly 115 120 125Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Ala Ala Leu Ile Gln Ala 130 135 140Lys Gln Asn Ala Ala Asn Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala145 150 155 160Thr Asn Glu Ala Val His Glu Val Thr Asp Gly Leu Ser Gln Leu Ala 165 170 175Val Ala Val Gly Lys Met Gln Gln Phe Val Asn Asp Gln Phe Asn Lys 180 185 190Thr Ala Gln Glu Leu Asp

Cys Ile Lys Ile Ala Gln Gln Val Gly Val 195 200 205Glu Leu Asn Leu Tyr Leu Thr Glu Leu Thr Thr Val Phe Gly Pro Gln 210 215 220Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile Gln Ala Leu Tyr Asn225 230 235 240Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr Lys Leu Gly Ile Gly 245 250 255Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gly Leu Ile Thr Gly Asn 260 265 270Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Leu Gly Ile Gln Val Thr 275 280 285Leu Pro Ser Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu 290 295 300Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Ala Ser Ala Leu Val Pro305 310 315 320Lys Val Val Thr Gln Val Gly Ser Val Ile Glu Glu Leu Asp Thr Ser 325 330 335Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cys Thr Arg Ile Val Thr 340 345 350Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu Ser Gly Asn Thr Ser 355 360 365Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Leu Thr Thr Pro Tyr Met 370 375 380Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Lys Met Thr Thr Cys Arg385 390 395 400Cys Val Asn Pro Pro Gly Ile Ile Ser Gln Asn Tyr Gly Glu Ala Val 405 410 415Ser Leu Ile Asp Lys Gln Ser Cys Asn Val Leu Ser Leu Gly Gly Ile 420 425 430Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Thr Tyr Gln Lys Asn Ile 435 440 445Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gly Asn Leu Asp Ile Ser 450 455 460Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Ser Asn Ala Leu Asn Lys465 470 475 480Leu Glu Glu Ser Asn Arg Lys Leu Asp Lys Val Asn Val Lys Leu Thr 485 490 495Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Leu Thr Ile Ile Ser Leu 500 505 510Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cys Tyr Leu Met Tyr Lys 515 520 525Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Leu Gly Asn Asn Thr Leu 530 535 540Asp Gln Met Arg Ala Thr Thr Lys Met545 550111662DNAArtificial SequenceNDV F3aa-modified fusion protein with L289A 11atgggctcca gaccttctac caagaaccca gcacctatga tgctgactat ccgggtcgcg 60ctggtactga gttgcatctg cccggcaaac tccattgatg gcaggcctct tgcagctgca 120ggaattgtgg ttacaggaga caaagcagtc aacatataca cctcatccca gacaggatca 180atcatagtta agctcctccc gaatctgccc aaggataagg aggcatgtgc gaaagccccc 240ttggatgcat acaacaggac attgaccact ttgctcaccc cccttggtga ctctatccgt 300aggatacaag agtctgtgac tacatctgga gggcggagac agaggcgctt tataggcgcc 360attattggcg gtgtggctct tggggttgca actgccgcac aaataacagc ggccgcagct 420ctgatacaag ccaaacaaaa tgctgccaac atcctccgac ttaaagagag cattgccgca 480accaatgagg ctgtgcatga ggtcactgac ggattatcgc aactagcagt ggcagttggg 540aagatgcagc agtttgttaa tgaccaattt aataaaacag ctcaggaatt agactgcatc 600aaaattgcac agcaagttgg tgtagagctc aacctgtacc taaccgaatt gactacagta 660ttcggaccac aaatcacttc acctgcctta aacaagctga ctattcaggc actttacaat 720ctagctggtg ggaatatgga ttacttattg actaagttag gtatagggaa caatcaactc 780agctcattaa tcggtagcgg cttaatcacc ggtaacccta ttctatacga ctcacagact 840caactcttgg gtatacaggt aactgcacct tcagtcggga acctaaataa tatgcgtgcc 900acctacttgg aaaccttatc cgtaagcaca accaggggat ttgcctcggc acttgtccca 960aaagtggtga cacaggtcgg ttctgtgata gaagaacttg acacctcata ctgtatagaa 1020actgacttag atttatattg tacaagaata gtaacgttcc ctatgtcccc tggtatttac 1080tcctgcttga gcggcaatac atcggcctgt atgtactcaa agaccgaagg cgcacttact 1140acaccatata tgactatcaa aggctcagtc atcgctaact gcaagatgac aacatgtaga 1200tgtgtaaacc ccccgggtat catatcgcaa aactatggag aagccgtgtc tctaatagat 1260aaacaatcat gcaatgtttt atccttaggc gggataactt taaggctcag tggggaattc 1320gatgtaactt atcagaagaa tatctcaata caagattctc aagtaataat aacaggcaat 1380cttgatatct caactgagct tgggaatgtc aacaactcga tcagtaatgc tttgaataag 1440ttagaggaaa gcaacagaaa actagacaaa gtcaatgtca aactgaccag cacatctgct 1500ctcattacct atatcgtttt gactatcata tctcttgttt ttggtatact tagcctgatt 1560ctagcatgct acctaatgta caagcaaaag gcgcaacaaa agaccttatt atggcttggg 1620aataataccc tagatcagat gagagccact acaaaaatgt ga 166212553PRTArtificial SequenceNDV F3aa-modified fusion protein with L289A 12Met Gly Ser Arg Pro Phe Thr Lys Asn Pro Ala Pro Met Met Leu Thr1 5 10 15Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cys Pro Ala Asn Ser Ile 20 25 30Asp Gly Arg Pro Phe Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys 35 40 45Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gly Ser Ile Ile Val Lys 50 55 60Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala Pro65 70 75 80Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr Pro Leu Gly 85 90 95Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Thr Thr Ser Gly Gly Arg 100 105 110Arg Gln Arg Arg Phe Ile Gly Ala Ile Ile Gly Gly Val Ala Leu Gly 115 120 125Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Ala Ala Leu Ile Gln Ala 130 135 140Lys Gln Asn Ala Ala Asn Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala145 150 155 160Thr Asn Glu Ala Val His Glu Val Thr Asp Gly Leu Ser Gln Leu Ala 165 170 175Val Ala Val Gly Lys Met Gln Gln Phe Val Asn Asp Gln Phe Asn Lys 180 185 190Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Ala Gln Gln Val Gly Val 195 200 205Glu Leu Asn Leu Tyr Leu Thr Glu Leu Thr Thr Val Phe Gly Pro Gln 210 215 220Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile Gln Ala Leu Tyr Asn225 230 235 240Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr Lys Leu Gly Ile Gly 245 250 255Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gly Leu Ile Thr Gly Asn 260 265 270Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Leu Gly Ile Gln Val Thr 275 280 285Ala Pro Ser Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu 290 295 300Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Ala Ser Ala Leu Val Pro305 310 315 320Lys Val Val Thr Gln Val Gly Ser Val Ile Glu Glu Leu Asp Thr Ser 325 330 335Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cys Thr Arg Ile Val Thr 340 345 350Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu Ser Gly Asn Thr Ser 355 360 365Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Leu Thr Thr Pro Tyr Met 370 375 380Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Lys Met Thr Thr Cys Arg385 390 395 400Cys Val Asn Pro Pro Gly Ile Ile Ser Gln Asn Tyr Gly Glu Ala Val 405 410 415Ser Leu Ile Asp Lys Gln Ser Cys Asn Val Leu Ser Leu Gly Gly Ile 420 425 430Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Thr Tyr Gln Lys Asn Ile 435 440 445Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gly Asn Leu Asp Ile Ser 450 455 460Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Ser Asn Ala Leu Asn Lys465 470 475 480Leu Glu Glu Ser Asn Arg Lys Leu Asp Lys Val Asn Val Lys Leu Thr 485 490 495Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Leu Thr Ile Ile Ser Leu 500 505 510Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cys Tyr Leu Met Tyr Lys 515 520 525Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Leu Gly Asn Asn Thr Leu 530 535 540Asp Gln Met Arg Ala Thr Thr Lys Met545 5501313006DNAArtificial SequenceVirus/vector construct 13acgaagacaa acaaaccatt attatcatta aaaggctcag gagaaacttt aacagtaatc 60aaaatgtctg ttacagtcaa gagaatcatt gacaacacag tcgtagttcc aaaacttcct 120gcaaatgagg atccagtgga atacccggca gattacttca gaaaatcaaa ggagattcct 180ctttacatca atactacaaa aagtttgtca gatctaagag gatatgtcta ccaaggcctc 240aaatccggaa atgtatcaat catacatgtc aacagctact tgtatggagc attaaaggac 300atccggggta agttggataa agattggtca agtttcggaa taaacatcgg gaaagcaggg 360gatacaatcg gaatatttga ccttgtatcc ttgaaagccc tggacggcgt acttccagat 420ggagtatcgg atgcttccag aaccagcgca gatgacaaat ggttgccttt gtatctactt 480ggcttataca gagtgggcag aacacaaatg cctgaataca gaaaaaagct catggatggg 540ctgacaaatc aatgcaaaat gatcaatgaa cagtttgaac ctcttgtgcc agaaggtcgt 600gacatttttg atgtgtgggg aaatgacagt aattacacaa aaattgtcgc tgcagtggac 660atgttcttcc acatgttcaa aaaacatgaa tgtgcctcgt tcagatacgg aactattgtt 720tccagattca aagattgtgc tgcattggca acatttggac acctctgcaa aataaccgga 780atgtctacag aagatgtaac gacctggatc ttgaaccgag aagttgcaga tgaaatggtc 840caaatgatgc ttccaggcca agaaattgac aaggccgatt catacatgcc ttatttgatc 900gactttggat tgtcttctaa gtctccatat tcttccgtca aaaaccctgc cttccacttc 960tgggggcaat tgacagctct tctgctcaga tccaccagag caaggaatgc ccgacagcct 1020gatgacattg agtatacatc tcttactaca gcaggtttgt tgtacgctta tgcagtagga 1080tcctctgccg acttggcaca acagttttgt gttggagata acaaatacac tccagatgat 1140agtaccggag gattgacgac taatgcaccg ccacaaggca gagatgtggt cgaatggctc 1200ggatggtttg aagatcaaaa cagaaaaccg actcctgata tgatgcagta tgcgaaaaga 1260gcagtcatgt cactgcaagg cctaagagag aagacaattg gcaagtatgc taagtcagaa 1320tttgacaaat gaccctataa ttctcagatc acctattata tattatgcta catatgaaaa 1380aaactaacag atatcatgga taatctcaca aaagttcgtg agtatctcaa gtcctattct 1440cgtctggatc aggcggtagg agagatagat gagatcgaag cacaacgagc tgaaaagtcc 1500aattatgagt tgttccaaga ggatggagtg gaagagcata ctaagccctc ttattttcag 1560gcagcagatg attctgacac agaatctgaa ccagaaattg aagacaatca aggcttgtat 1620gcaccagatc cagaagctga gcaagttgaa ggctttatac aggggccttt agatgactat 1680gcagatgagg aagtggatgt tgtatttact tcggactgga aacagcctga gcttgaatct 1740gacgagcatg gaaagacctt acggttgaca tcgccagagg gtttaagtgg agagcagaaa 1800tcccagtggc tttcgacgat taaagcagtc gtgcaaagtg ccaaatactg gaatctggca 1860gagtgcacat ttgaagcatc gggagaaggg gtcattatga aggagcgcca gataactccg 1920gatgtatata aggtcactcc agtgatgaac acacatccgt cccaatcaga agcagtatca 1980gatgtttggt ctctctcaaa gacatccatg actttccaac ccaagaaagc aagtcttcag 2040cctctcacca tatccttgga tgaattgttc tcatctagag gagagttcat ctctgtcgga 2100ggtgacggac gaatgtctca taaagaggcc atcctgctcg gcctgagata caaaaagttg 2160tacaatcagg cgagagtcaa atattctctg tagactatga aaaaaagtaa cagatatcac 2220gatctaagtg ttatcccaat ccattcatca tgagttcctt aaagaagatt ctcggtctga 2280aggggaaagg taagaaatct aagaaattag ggatcgcacc acccccttat gaagaggaca 2340ctagcatgga gtatgctccg agcgctccaa ttgacaaatc ctattttgga gttgacgaga 2400tggacaccta tgatccgaat caattaagat atgagaaatt cttctttaca gtgaaaatga 2460cggttagatc taatcgtccg ttcagaacat actcagatgt ggcagccgct gtatcccatt 2520gggatcacat gtacatcgga atggcaggga aacgtccctt ctacaaaatc ttggcttttt 2580tgggttcttc taatctaaag gccactccag cggtattggc agatcaaggt caaccagagt 2640atcacgctca ctgcgaaggc agggcttatt tgccacatag gatggggaag acccctccca 2700tgctcaatgt accagagcac ttcagaagac cattcaatat aggtctttac aagggaacga 2760ttgagctcac aatgaccatc tacgatgatg agtcactgga agcagctcct atgatctggg 2820atcatttcaa ttcttccaaa ttttctgatt tcagagagaa ggccttaatg tttggcctga 2880ttgtcgagaa aaaggcatct ggagcgtggg tcctggactc tatcggccac ttcaaatgag 2940ctagtctaac ttctagcttc tgaacaatcc ccggtttact cagtctcccc taattccagc 3000ctctcgaaca actaatatcc tgtcttttct atccctatga aaaaaactaa cagagatcga 3060tctgtttacg cgtcgagatg ggctccagac cttctaccaa gaacccagca cctatgatgc 3120tgactatccg ggtcgcgctg gtactgagtt gcatctgccc ggcaaactcc attgatggca 3180ggcctcttgc agctgcagga attgtggtta caggagacaa agcagtcaac atatacacct 3240catcccagac aggatcaatc atagttaagc tcctcccgaa tctgcccaag gataaggagg 3300catgtgcgaa agcccccttg gatgcataca acaggacatt gaccactttg ctcacccccc 3360ttggtgactc tatccgtagg atacaagagt ctgtgactac atctggaggg cggagacaga 3420ggcgctttat aggcgccatt attggcggtg tggctcttgg ggttgcaact gccgcacaaa 3480taacagcggc cgcagctctg atacaagcca aacaaaatgc tgccaacatc ctccgactta 3540aagagagcat tgccgcaacc aatgaggctg tgcatgaggt cactgacgga ttatcgcaac 3600tagcagtggc agttgggaag atgcagcagt ttgttaatga ccaatttaat aaaacagctc 3660aggaattaga ctgcatcaaa attgcacagc aagttggtgt agagctcaac ctgtacctaa 3720ccgaattgac tacagtattc ggaccacaaa tcacttcacc tgccttaaac aagctgacta 3780ttcaggcact ttacaatcta gctggtggga atatggatta cttattgact aagttaggta 3840tagggaacaa tcaactcagc tcattaatcg gtagcggctt aatcaccggt aaccctattc 3900tatacgactc acagactcaa ctcttgggta tacaggtaac tgcaccttca gtcgggaacc 3960taaataatat gcgtgccacc tacttggaaa ccttatccgt aagcacaacc aggggatttg 4020cctcggcact tgtcccaaaa gtggtgacac aggtcggttc tgtgatagaa gaacttgaca 4080cctcatactg tatagaaact gacttagatt tatattgtac aagaatagta acgttcccta 4140tgtcccctgg tatttactcc tgcttgagcg gcaatacatc ggcctgtatg tactcaaaga 4200ccgaaggcgc acttactaca ccatatatga ctatcaaagg ctcagtcatc gctaactgca 4260agatgacaac atgtagatgt gtaaaccccc cgggtatcat atcgcaaaac tatggagaag 4320ccgtgtctct aatagataaa caatcatgca atgttttatc cttaggcggg ataactttaa 4380ggctcagtgg ggaattcgat gtaacttatc agaagaatat ctcaatacaa gattctcaag 4440taataataac aggcaatctt gatatctcaa ctgagcttgg gaatgtcaac aactcgatca 4500gtaatgcttt gaataagtta gaggaaagca acagaaaact agacaaagtc aatgtcaaac 4560tgaccagcac atctgctctc attacctata tcgttttgac tatcatatct cttgtttttg 4620gtatacttag cctgattcta gcatgctacc taatgtacaa gcaaaaggcg caacaaaaga 4680ccttattatg gcttgggaat aataccctag atcagatgag agccactaca aaaatgtgag 4740ctagcttaat taatatgaaa aaaactaaca gatatcatgg accgcgccgt tagccaagtt 4800gcgttagaga atgatgaaag agaggcaaaa aatacatggc gcttgatatt ccggattgca 4860atcttattct taacagtagt gaccttggct atatctgtag cctccctttt atatagcatg 4920ggggctagca cacctagcga tcttgtaggc ataccgacta ggatttccag ggcagaagaa 4980aagattacat ctacacttgg ttccaatcaa gatgtagtag ataggatata taagcaagtg 5040gcccttgagt ctccattggc attgttaaat actgagacca caattatgaa cgcaataaca 5100tctctctctt atcagattaa tggagctgca aacaacagcg ggtggggggc acctattcat 5160gacccagatt atataggggg gataggcaaa gaactcattg tagatgatgc tagtgatgtc 5220acatcattct atccctctgc atttcaagaa catctgaatt ttatcccggc gcctactaca 5280ggatcaggtt gcactcgaat accctcattt gacatgagtg ctacccatta ctgctacacc 5340cataatgtaa tattgtctgg atgcagagat cactcacact cacatcagta tttagcactt 5400ggtgtgctcc ggacatctgc aacagggagg gtattctttt ctactctgcg ttccatcaac 5460ctggacgaca cccaaaatcg gaagtcttgc agtgtgagtg caactcccct gggttgtgat 5520atgctgtgct cgaaagccac ggagacagag gaagaagatt ataactcagc tgtccctacg 5580cggatggtac atgggaggtt agggttcgac ggccaatatc acgaaaagga cctagatgtc 5640acaacattat tcggggactg ggtggccaac tacccaggag tagggggtgg atcttttatt 5700gacagccgcg tatggttctc agtctacgga gggttaaaac ccaatacacc cagtgacact 5760gtacaggaag ggaaatatgt gatatacaag cgatacaatg acacatgccc agatgagcaa 5820gactaccaga ttcgaatggc caagtcttcg tataagcctg gacggtttgg tgggaaacgc 5880atacagcagg ctatcttatc tatcaaagtg tcaacatcct taggcgaaga cccggtactg 5940actgtaccgc ccaacacagt cacactcatg ggggccgaag gcagaattct cacagtaggg 6000acatcccatt tcttgtatca gcgagggtca tcatacttct ctcccgcgtt attatatcct 6060atgacagtca gcgacaaaac agccactctt catagtcctt atacattcaa tgccttcact 6120cggccaggta gtatcccttg ccaggcttca gcaagatgcc ccaactcgtg tgttactgga 6180gtctatacag atccatatcc cctaatcttc tatagaaacc acaccttgcg aggggtattc 6240gggacaatgc ttgatggtga acaagcaaga cttaaccctg cgtctgcagt attcgatagc 6300acatcccgca gtcgcataac tcgagtgagt tcaagcagca tcaaagcagc atacacaaca 6360tcaacttgtt ttaaagtggt caagaccaat aagacctatt gtctcagcat tgctgaaata 6420tctaatactc tcttcggaga attcagaatc gtcccgttac tagttgagat cctcaaagat 6480gacggggtta gagaagccag gtctggctag gtttaaacgc tagcggcctc aattatattt 6540gagtttttaa tttttatgaa aaaaactaac agcaatcatg gaagtccacg attttgagac 6600cgacgagttc aatgatttca atgaagatga ctatgccaca agagaattcc tgaatcccga 6660tgagcgcatg acgtacttga atcatgctga ttacaacctg aattctcctc taattagtga 6720tgatattgac aatttaatca ggaaattcaa ttctcttcca attccctcga tgtgggatag 6780taagaactgg gatggagttc ttgagatgtt aacgtcatgt caagccaatc ccatcccaac 6840atctcagatg cataaatgga tgggaagttg gttaatgtct gataatcatg atgccagtca 6900agggtatagt tttttacatg aagtggacaa agaggcagaa ataacatttg acgtggtgga 6960gaccttcatc cgcggctggg gcaacaaacc aattgaatac atcaaaaagg aaagatggac 7020tgactcattc aaaattctcg cttatttgtg tcaaaagttt ttggacttac acaagttgac 7080attaatctta aatgctgtct ctgaggtgga attgctcaac ttggcgagga ctttcaaagg 7140caaagtcaga agaagttctc atggaacgaa catatgcagg attagggttc ccagcttggg 7200tcctactttt atttcagaag gatgggctta cttcaagaaa cttgatattc taatggaccg 7260aaactttctg ttaatggtca aagatgtgat tatagggagg atgcaaacgg tgctatccat 7320ggtatgtaga atagacaacc tgttctcaga gcaagacatc ttctcccttc taaatatcta 7380cagaattgga gataaaattg tggagaggca gggaaatttt tcttatgact tgattaaaat 7440ggtggaaccg atatgcaact tgaagctgat gaaattagca agagaatcaa ggcctttagt 7500cccacaattc cctcattttg aaaatcatat caagacttct gttgatgaag gggcaaaaat 7560tgaccgaggt ataagattcc tccatgatca gataatgagt gtgaaaacag tggatctcac 7620actggtgatt tatggatcgt tcagacattg gggtcatcct tttatagatt attacactgg 7680actagaaaaa

ttacattccc aagtaaccat gaagaaagat attgatgtgt catatgcaaa 7740agcacttgca agtgatttag ctcggattgt tctatttcaa cagttcaatg atcataaaaa 7800gtggttcgtg aatggagact tgctccctca tgatcatccc tttaaaagtc atgttaaaga 7860aaatacatgg cccacagctg ctcaagttca agattttgga gataaatggc atgaacttcc 7920gctgattaaa tgttttgaaa tacccgactt actagaccca tcgataatat actctgacaa 7980aagtcattca atgaataggt cagaggtgtt gaaacatgtc cgaatgaatc cgaacactcc 8040tatccctagt aaaaaggtgt tgcagactat gttggacaca aaggctacca attggaaaga 8100atttcttaaa gagattgatg agaagggctt agatgatgat gatctaatta ttggtcttaa 8160aggaaaggag agggaactga agttggcagg tagatttttc tccctaatgt cttggaaatt 8220gcgagaatac tttgtaatta ccgaatattt gataaagact catttcgtcc ctatgtttaa 8280aggcctgaca atggcggacg atctaactgc agtcattaaa aagatgttag attcctcatc 8340cggccaagga ttgaagtcat atgaggcaat ttgcatagcc aatcacattg attacgaaaa 8400atggaataac caccaaagga agttatcaaa cggcccagtg ttccgagtta tgggccagtt 8460cttaggttat ccatccttaa tcgagagaac tcatgaattt tttgagaaaa gtcttatata 8520ctacaatgga agaccagact tgatgcgtgt tcacaacaac acactgatca attcaacctc 8580ccaacgagtt tgttggcaag gacaagaggg tggactggaa ggtctacggc aaaaaggatg 8640gagtatcctc aatctactgg ttattcaaag agaggctaaa atcagaaaca ctgctgtcaa 8700agtcttggca caaggtgata atcaagttat ttgcacacag tataaaacga agaaatcgag 8760aaacgttgta gaattacagg gtgctctcaa tcaaatggtt tctaataatg agaaaattat 8820gactgcaatc aaaataggga cagggaagtt aggacttttg ataaatgacg atgagactat 8880gcaatctgca gattacttga attatggaaa aataccgatt ttccgtggag tgattagagg 8940gttagagacc aagagatggt cacgagtgac ttgtgtcacc aatgaccaaa tacccacttg 9000tgctaatata atgagctcag tttccacaaa tgctctcacc gtagctcatt ttgctgagaa 9060cccaatcaat gccatgatac agtacaatta ttttgggaca tttgctagac tcttgttgat 9120gatgcatgat cctgctcttc gtcaatcatt gtatgaagtt caagataaga taccgggctt 9180gcacagttct actttcaaat acgccatgtt gtatttggac ccttccattg gaggagtgtc 9240gggcatgtct ttgtccaggt ttttgattag agccttccca gatcccgtaa cagaaagtct 9300ctcattctgg agattcatcc atgtacatgc tcgaagtgag catctgaagg agatgagtgc 9360agtatttgga aaccccgaga tagccaagtt tcgaataact cacatagaca agctagtaga 9420agatccaacc tctctgaaca tcgctatggg aatgagtcca gcgaacttgt taaagactga 9480ggttaaaaaa tgcttaatcg aatcaagaca aaccatcagg aaccaggtga ttaaggatgc 9540aaccatatat ttgtatcatg aagaggatcg gctcagaagt ttcttatggt caataaatcc 9600tctgttccct agatttttaa gtgaattcaa atcaggcact tttttgggag tcgcagacgg 9660gctcatcagt ctatttcaaa attctcgtac tattcggaac tcctttaaga aaaagtatca 9720tagggaattg gatgatttga ttgtgaggag tgaggtatcc tctttgacac atttagggaa 9780acttcatttg agaaggggat catgtaaaat gtggacatgt tcagctactc atgctgacac 9840attaagatac aaatcctggg gccgtacagt tattgggaca actgtacccc atccattaga 9900aatgttgggt ccacaacatc gaaaagagac tccttgtgca ccatgtaaca catcagggtt 9960caattatgtt tctgtgcatt gtccagacgg gatccatgac gtctttagtt cacggggacc 10020attgcctgct tatctagggt ctaaaacatc tgaatctaca tctattttgc agccttggga 10080aagggaaagc aaagtcccac tgattaaaag agctacacgt cttagagatg ctatctcttg 10140gtttgttgaa cccgactcta aactagcaat gactatactt tctaacatcc actctttaac 10200aggcgaagaa tggaccaaaa ggcagcatgg gttcaaaaga acagggtctg cccttcatag 10260gttttcgaca tctcggatga gccatggtgg gttcgcatct cagagcactg cagcattgac 10320caggttgatg gcaactacag acaccatgag ggatctggga gatcagaatt tcgacttttt 10380attccaagca acgttgctct atgctcaaat taccaccact gttgcaagag acggatggat 10440caccagttgt acagatcatt atcatattgc ctgtaagtcc tgtttgagac ccatagaaga 10500gatcaccctg gactcaagta tggactacac gcccccagat gtatcccatg tgctgaagac 10560atggaggaat ggggaaggtt cgtggggaca agagataaaa cagatctatc ctttagaagg 10620gaattggaag aatttagcac ctgctgagca atcctatcaa gtcggcagat gtataggttt 10680tctatatgga gacttggcgt atagaaaatc tactcatgcc gaggacagtt ctctatttcc 10740tctatctata caaggtcgta ttagaggtcg aggtttctta aaagggttgc tagacggatt 10800aatgagagca agttgctgcc aagtaataca ccggagaagt ctggctcatt tgaagaggcc 10860ggccaacgca gtgtacggag gtttgattta cttgattgat aaattgagtg tatcacctcc 10920attcctttct cttactagat caggacctat tagagacgaa ttagaaacga ttccccacaa 10980gatcccaacc tcctatccga caagcaaccg tgatatgggg gtgattgtca gaaattactt 11040caaataccaa tgccgtctaa ttgaaaaggg aaaatacaga tcacattatt cacaattatg 11100gttattctca gatgtcttat ccatagactt cattggacca ttctctattt ccaccaccct 11160cttgcaaatc ctatacaagc catttttatc tgggaaagat aagaatgagt tgagagagct 11220ggcaaatctt tcttcattgc taagatcagg agaggggtgg gaagacatac atgtgaaatt 11280cttcaccaag gacatattat tgtgtccaga ggaaatcaga catgcttgca agttcgggat 11340tgctaaggat aataataaag acatgagcta tcccccttgg ggaagggaat ccagagggac 11400aattacaaca atccctgttt attatacgac caccccttac ccaaagatgc tagagatgcc 11460tccaagaatc caaaatcccc tgctgtccgg aatcaggttg ggccaattac caactggcgc 11520tcattataaa attcggagta tattacatgg aatgggaatc cattacaggg acttcttgag 11580ttgtggagac ggctccggag ggatgactgc tgcattacta cgagaaaatg tgcatagcag 11640aggaatattc aatagtctgt tagaattatc agggtcagtc atgcgaggcg cctctcctga 11700gccccccagt gccctagaaa ctttaggagg agataaatcg agatgtgtaa atggtgaaac 11760atgttgggaa tatccatctg acttatgtga cccaaggact tgggactatt tcctccgact 11820caaagcaggc ttggggcttc aaattgattt aattgtaatg gatatggaag ttcgggattc 11880ttctactagc ctgaaaattg agacgaatgt tagaaattat gtgcaccgga ttttggatga 11940gcaaggagtt ttaatctaca agacttatgg aacatatatt tgtgagagcg aaaagaatgc 12000agtaacaatc cttggtccca tgttcaagac ggtcgactta gttcaaacag aatttagtag 12060ttctcaaacg tctgaagtat atatggtatg taaaggtttg aagaaattaa tcgatgaacc 12120caatcccgat tggtcttcca tcaatgaatc ctggaaaaac ctgtacgcat tccagtcatc 12180agaacaggaa tttgccagag caaagaaggt tagtacatac tttaccttga caggtattcc 12240ctcccaattc attcctgatc cttttgtaaa cattgagact atgctacaaa tattcggagt 12300acccacgggt gtgtctcatg cggctgcctt aaaatcatct gatagacctg cagatttatt 12360gaccattagc cttttttata tggcgattat atcgtattat aacatcaatc atatcagagt 12420aggaccgata cctccgaacc ccccatcaga tggaattgca caaaatgtgg ggatcgctat 12480aactggtata agcttttggc tgagtttgat ggagaaagac attccactat atcaacagtg 12540tttagcagtt atccagcaat cattcccgat taggtgggag gctgtttcag taaaaggagg 12600atacaagcag aagtggagta ctagaggtga tgggctccca aaagataccc gaatttcaga 12660ctccttggcc ccaatcggga actggatcag atctctggaa ttggtccgaa accaagttcg 12720tctaaatcca ttcaatgaga tcttgttcaa tcagctatgt cgtacagtgg ataatcattt 12780gaaatggtca aatttgcgaa gaaacacagg aatgattgaa tggatcaata gacgaatttc 12840aaaagaagac cggtctatac tgatgttgaa gagtgaccta cacgaggaaa actcttggag 12900agattaaaaa atcatgagga gactccaaac tttaagtatg aaaaaaactt tgatccttaa 12960gaccctcttg tggtttttat tttttatctg gttttgtggt cttcgt 1300614422PRTVesicular stomatitis virus 14Met Ser Val Thr Val Lys Arg Ile Ile Asp Asn Thr Val Ile Val Pro1 5 10 15Lys Leu Pro Ala Asn Glu Asp Pro Val Glu Tyr Pro Ala Asp Tyr Phe 20 25 30Arg Lys Ser Lys Glu Ile Pro Leu Tyr Ile Asn Thr Thr Lys Ser Leu 35 40 45Ser Asp Leu Arg Gly Tyr Val Tyr Gln Gly Leu Lys Ser Gly Asn Val 50 55 60Ser Ile Ile His Val Asn Ser Tyr Leu Tyr Gly Ala Leu Lys Asp Ile65 70 75 80Arg Gly Lys Leu Asp Lys Asp Trp Ser Ser Phe Gly Ile Asn Ile Gly 85 90 95Lys Ala Gly Asp Thr Ile Gly Ile Phe Asp Leu Val Ser Leu Lys Ala 100 105 110Leu Asp Gly Val Leu Pro Asp Gly Val Ser Asp Ala Ser Arg Thr Ser 115 120 125Ala Asp Asp Lys Trp Leu Pro Leu Tyr Leu Leu Gly Leu Tyr Arg Val 130 135 140Gly Arg Thr Gln Met Pro Glu Tyr Arg Lys Lys Leu Met Asp Gly Leu145 150 155 160Thr Asn Gln Cys Lys Met Ile Asn Glu Gln Phe Glu Pro Leu Val Pro 165 170 175Glu Gly Arg Asp Ile Phe Asp Val Trp Gly Asn Asp Ser Asn Tyr Thr 180 185 190Lys Ile Val Ala Ala Val Asp Met Phe Phe His Met Phe Lys Lys His 195 200 205Glu Cys Ala Ser Phe Arg Tyr Gly Thr Ile Val Ser Arg Phe Lys Asp 210 215 220Cys Ala Ala Leu Ala Thr Phe Gly His Leu Cys Lys Ile Thr Gly Met225 230 235 240Ser Thr Glu Asp Val Thr Thr Trp Ile Leu Asn Arg Glu Val Ala Asp 245 250 255Glu Met Val Gln Met Met Leu Pro Gly Gln Glu Ile Asp Lys Ala Asp 260 265 270Ser Tyr Met Pro Tyr Leu Ile Asp Phe Gly Leu Ser Ser Lys Ser Pro 275 280 285Tyr Ser Ser Val Lys Asn Pro Ala Phe His Phe Trp Gly Gln Leu Thr 290 295 300Ala Leu Leu Leu Arg Ser Thr Arg Ala Arg Asn Ala Arg Gln Pro Asp305 310 315 320Asp Ile Glu Tyr Thr Ser Leu Thr Thr Ala Gly Leu Leu Tyr Ala Tyr 325 330 335Ala Val Gly Ser Ser Ala Asp Leu Ala Gln Gln Phe Cys Val Gly Asp 340 345 350Asn Lys Tyr Thr Pro Asp Asp Ser Thr Gly Gly Leu Thr Thr Asn Ala 355 360 365Pro Pro Gln Gly Arg Asp Val Val Glu Trp Leu Gly Trp Phe Glu Asp 370 375 380Gln Asn Arg Lys Pro Thr Pro Asp Met Met Gln Tyr Ala Lys Arg Ala385 390 395 400Val Met Ser Leu Gln Gly Leu Arg Glu Lys Thr Ile Gly Lys Tyr Ala 405 410 415Lys Ser Glu Phe Asp Lys 42015265PRTVesicular stomatitis virus 15Met Asp Asn Leu Thr Lys Val Arg Glu Tyr Leu Lys Ser Tyr Ser Arg1 5 10 15Leu Asp Gln Ala Val Gly Glu Ile Asp Glu Ile Glu Ala Gln Arg Ala 20 25 30Glu Lys Ser Asn Tyr Glu Leu Phe Gln Glu Asp Gly Val Glu Glu His 35 40 45Thr Lys Pro Ser Tyr Phe Gln Ala Ala Asp Asp Ser Asp Thr Glu Ser 50 55 60Glu Pro Glu Ile Glu Asp Asn Gln Gly Leu Tyr Ala Gln Asp Pro Glu65 70 75 80Ala Glu Gln Val Glu Gly Phe Ile Gln Gly Pro Leu Asp Asp Tyr Ala 85 90 95Asp Glu Glu Val Asp Val Val Phe Thr Ser Asp Trp Lys Pro Pro Glu 100 105 110Leu Glu Ser Asp Glu His Gly Lys Thr Leu Arg Leu Thr Ser Pro Glu 115 120 125Gly Leu Ser Gly Glu Gln Lys Ser Gln Trp Leu Ser Thr Ile Lys Ala 130 135 140Val Val Gln Ser Ala Lys Tyr Trp Asn Leu Ala Glu Cys Thr Phe Glu145 150 155 160Ala Ser Gly Glu Gly Val Ile Met Lys Glu Arg Gln Ile Thr Pro Asp 165 170 175Val Tyr Lys Val Thr Pro Val Met Asn Thr His Pro Ser Gln Ser Glu 180 185 190Ala Val Ser Asp Val Trp Ser Leu Ser Lys Thr Ser Met Thr Phe Gln 195 200 205Pro Lys Lys Ala Ser Leu Gln Pro Leu Thr Ile Ser Leu Asp Glu Leu 210 215 220Phe Ser Ser Arg Gly Glu Phe Ile Ser Val Gly Gly Asp Gly Arg Met225 230 235 240Ser His Lys Glu Ala Ile Leu Leu Gly Leu Arg Tyr Lys Lys Leu Tyr 245 250 255Asn Gln Ala Arg Val Lys Tyr Ser Leu 260 26516229PRTVesicular stomatitis virus 16Met Ser Ser Leu Lys Lys Ile Leu Gly Leu Lys Gly Lys Gly Lys Lys1 5 10 15Ser Lys Lys Leu Gly Ile Ala Pro Pro Pro Tyr Glu Glu Asp Thr Ser 20 25 30Met Glu Tyr Ala Pro Ser Ala Pro Ile Asp Lys Ser Tyr Phe Gly Val 35 40 45Asp Glu Met Asp Thr Tyr Asp Pro Asn Gln Leu Arg Tyr Glu Lys Phe 50 55 60Phe Phe Thr Val Lys Met Thr Val Arg Ser Asn Arg Pro Phe Arg Thr65 70 75 80Tyr Ser Asp Val Ala Ala Ala Val Ser His Trp Asp His Met Tyr Ile 85 90 95Gly Met Ala Gly Lys Arg Pro Phe Tyr Lys Ile Leu Ala Phe Leu Gly 100 105 110Ser Ser Asn Leu Lys Ala Thr Pro Ala Val Leu Ala Asp Gln Gly Gln 115 120 125Pro Glu Tyr His Thr His Cys Glu Gly Arg Ala Tyr Leu Pro His Arg 130 135 140Met Gly Lys Thr Pro Pro Met Leu Asn Val Pro Glu His Phe Arg Arg145 150 155 160Pro Phe Asn Ile Gly Leu Tyr Lys Gly Thr Ile Glu Leu Thr Met Thr 165 170 175Ile Tyr Asp Asp Glu Ser Leu Glu Ala Ala Pro Met Ile Trp Asp His 180 185 190Phe Asn Ser Ser Lys Phe Ser Asp Phe Arg Glu Lys Ala Leu Met Phe 195 200 205Gly Leu Ile Val Glu Lys Lys Ala Ser Gly Ala Trp Val Leu Asp Ser 210 215 220Ile Ser His Phe Lys225172109PRTVesicular stomatitis virus 17Met Glu Val His Asp Phe Glu Thr Asp Glu Phe Asn Asp Phe Asn Glu1 5 10 15Asp Asp Tyr Ala Thr Arg Glu Phe Leu Asn Pro Asp Glu Arg Met Thr 20 25 30Tyr Leu Asn His Ala Asp Tyr Asn Leu Asn Ser Pro Leu Ile Ser Asp 35 40 45Asp Ile Asp Asn Leu Ile Arg Lys Phe Asn Ser Leu Pro Ile Pro Ser 50 55 60Met Trp Asp Ser Lys Asn Trp Asp Gly Val Leu Glu Met Leu Thr Ser65 70 75 80Cys Gln Ala Asn Pro Ile Ser Thr Ser Gln Met His Lys Trp Met Gly 85 90 95Ser Trp Leu Met Ser Asp Asn His Asp Ala Ser Gln Gly Tyr Ser Phe 100 105 110Leu His Glu Val Asp Lys Glu Ala Glu Ile Thr Phe Asp Val Val Glu 115 120 125Thr Phe Ile Arg Gly Trp Gly Asn Lys Pro Ile Glu Tyr Ile Lys Lys 130 135 140Glu Arg Trp Thr Asp Ser Phe Lys Ile Leu Ala Tyr Leu Cys Gln Lys145 150 155 160Phe Leu Asp Leu His Lys Leu Thr Leu Ile Leu Asn Ala Val Ser Glu 165 170 175Val Glu Leu Leu Asn Leu Ala Arg Thr Phe Lys Gly Lys Val Arg Arg 180 185 190Ser Ser His Gly Thr Asn Ile Cys Arg Ile Arg Val Pro Ser Leu Gly 195 200 205Pro Thr Phe Ile Ser Glu Gly Trp Ala Tyr Phe Lys Lys Leu Asp Ile 210 215 220Leu Met Asp Arg Asn Phe Leu Leu Met Val Lys Asp Val Ile Ile Gly225 230 235 240Arg Met Gln Thr Val Leu Ser Met Val Cys Arg Ile Asp Asn Leu Phe 245 250 255Ser Glu Gln Asp Ile Phe Ser Leu Leu Asn Ile Tyr Arg Ile Gly Asp 260 265 270Lys Ile Val Glu Arg Gln Gly Asn Phe Ser Tyr Asp Leu Ile Lys Met 275 280 285Val Glu Pro Ile Cys Asn Leu Lys Leu Met Lys Leu Ala Arg Glu Ser 290 295 300Arg Pro Leu Val Pro Gln Phe Pro His Phe Glu Asn His Ile Lys Thr305 310 315 320Ser Val Asp Glu Gly Ala Lys Ile Asp Arg Gly Ile Arg Phe Leu His 325 330 335Asp Gln Ile Met Ser Val Lys Thr Val Asp Leu Thr Leu Val Ile Tyr 340 345 350Gly Ser Phe Arg His Trp Gly His Pro Phe Ile Asp Tyr Tyr Thr Gly 355 360 365Leu Glu Lys Leu His Ser Gln Val Thr Met Lys Lys Asp Ile Asp Val 370 375 380Ser Tyr Ala Lys Ala Leu Ala Ser Asp Leu Ala Arg Ile Val Leu Phe385 390 395 400Gln Gln Phe Asn Asp His Lys Lys Trp Phe Val Asn Gly Asp Leu Leu 405 410 415Pro His Asp His Pro Phe Lys Ser His Val Lys Glu Asn Thr Trp Pro 420 425 430Thr Ala Ala Gln Val Gln Asp Phe Gly Asp Lys Trp His Glu Leu Pro 435 440 445Leu Ile Lys Cys Phe Glu Ile Pro Asp Leu Leu Asp Pro Ser Ile Ile 450 455 460Tyr Ser Asp Lys Ser His Ser Met Asn Arg Ser Glu Val Leu Lys His465 470 475 480Val Arg Met Asn Pro Asn Thr Pro Ile Pro Ser Lys Lys Val Leu Gln 485 490 495Thr Met Leu Asp Thr Lys Ala Thr Asn Trp Lys Glu Phe Leu Lys Glu 500 505 510Ile Asp Glu Lys Gly Leu Asp Asp Asp Asp Leu Ile Ile Gly Leu Lys 515 520 525Gly Lys Glu Arg Glu Leu Lys Leu Ala Gly Arg Phe Phe Ser Leu Met 530 535 540Ser Trp Lys Leu Arg Glu Tyr Phe Val Ile Thr Glu Tyr Leu Ile Lys545 550 555 560Thr His Phe Val Pro Met Phe Lys Gly Leu Thr Met Ala Asp Asp Leu 565 570 575Thr Ala Val Ile Lys Lys Met Leu Asp Ser Ser Ser Gly Gln Gly Leu 580 585 590Lys Ser Tyr Glu Ala Ile Cys Ile Ala Asn His Ile Asp Tyr Glu Lys 595 600 605Trp Asn Asn His Gln Arg Lys Leu Ser Asn Gly Pro Val Phe Arg Val 610 615 620Met Gly Gln Phe Leu Gly Tyr Pro Ser Leu Ile Glu Arg Thr His Glu625 630 635 640Phe Phe Glu Lys Ser Leu Ile Tyr Tyr Asn Gly Arg Pro Asp Leu Met 645 650 655Arg Val His Asn Asn Thr Leu Ile Asn Ser Thr Ser Gln Arg Val Cys

660 665 670Trp Gln Gly Gln Glu Gly Gly Leu Glu Gly Leu Arg Gln Lys Gly Trp 675 680 685Thr Ile Leu Asn Leu Leu Val Ile Gln Arg Glu Ala Lys Ile Arg Asn 690 695 700Thr Ala Val Lys Val Leu Ala Gln Gly Asp Asn Gln Val Ile Cys Thr705 710 715 720Gln Tyr Lys Thr Lys Lys Ser Arg Asn Val Val Glu Leu Gln Gly Ala 725 730 735Leu Asn Gln Met Val Ser Asn Asn Glu Lys Ile Met Thr Ala Ile Lys 740 745 750Ile Gly Thr Gly Lys Leu Gly Leu Leu Ile Asn Asp Asp Glu Thr Met 755 760 765Gln Ser Ala Asp Tyr Leu Asn Tyr Gly Lys Ile Pro Ile Phe Arg Gly 770 775 780Val Ile Arg Gly Leu Glu Thr Lys Arg Trp Ser Arg Val Thr Cys Val785 790 795 800Thr Asn Asp Gln Ile Pro Thr Cys Ala Asn Ile Met Ser Ser Val Ser 805 810 815Thr Asn Ala Leu Thr Val Ala His Phe Ala Glu Asn Pro Ile Asn Ala 820 825 830Met Ile Gln Tyr Asn Tyr Phe Gly Thr Phe Ala Arg Leu Leu Leu Met 835 840 845Met His Asp Pro Ala Leu Arg Gln Ser Leu Tyr Glu Val Gln Asp Lys 850 855 860Ile Pro Gly Leu His Ser Ser Thr Phe Lys Tyr Ala Met Leu Tyr Leu865 870 875 880Asp Pro Ser Ile Gly Gly Val Ser Gly Met Ser Leu Ser Arg Phe Leu 885 890 895Ile Arg Ala Phe Pro Asp Pro Val Thr Glu Ser Leu Ser Phe Trp Arg 900 905 910Phe Ile His Val His Ala Arg Ser Glu His Leu Lys Glu Met Ser Ala 915 920 925Val Phe Gly Asn Pro Glu Ile Ala Lys Phe Arg Ile Thr His Ile Asp 930 935 940Lys Leu Val Glu Asp Pro Thr Ser Leu Asn Ile Ala Met Gly Met Ser945 950 955 960Pro Ala Asn Leu Leu Lys Thr Glu Val Lys Lys Cys Leu Ile Glu Ser 965 970 975Arg Gln Thr Ile Arg Asn Gln Val Ile Lys Asp Ala Thr Ile Tyr Leu 980 985 990Tyr His Glu Glu Asp Arg Leu Arg Ser Phe Leu Trp Ser Ile Asn Pro 995 1000 1005Leu Phe Pro Arg Phe Leu Ser Glu Phe Lys Ser Gly Thr Phe Leu 1010 1015 1020Gly Val Ala Asp Gly Leu Ile Ser Leu Phe Gln Asn Ser Arg Thr 1025 1030 1035Ile Arg Asn Ser Phe Lys Lys Lys Tyr His Arg Glu Leu Asp Asp 1040 1045 1050Leu Ile Val Arg Ser Glu Val Ser Ser Leu Thr His Leu Gly Lys 1055 1060 1065Leu His Leu Arg Arg Gly Ser Cys Lys Met Trp Thr Cys Ser Ala 1070 1075 1080Thr His Ala Asp Thr Leu Arg Tyr Lys Ser Trp Gly Arg Thr Val 1085 1090 1095Ile Gly Thr Thr Val Pro His Pro Leu Glu Met Leu Gly Pro Gln 1100 1105 1110His Arg Lys Glu Thr Pro Cys Ala Pro Cys Asn Thr Ser Gly Phe 1115 1120 1125Asn Tyr Val Ser Val His Cys Pro Asp Gly Ile His Asp Val Phe 1130 1135 1140Ser Ser Arg Gly Pro Leu Pro Ala Tyr Leu Gly Ser Lys Thr Ser 1145 1150 1155Glu Ser Thr Ser Ile Leu Gln Pro Trp Glu Arg Glu Ser Lys Val 1160 1165 1170Pro Leu Ile Lys Arg Ala Thr Arg Leu Arg Asp Ala Ile Ser Trp 1175 1180 1185Phe Val Glu Pro Asp Ser Lys Leu Ala Met Thr Ile Leu Ser Asn 1190 1195 1200Ile His Ser Leu Thr Gly Glu Glu Trp Thr Lys Arg Gln His Gly 1205 1210 1215Phe Lys Arg Thr Gly Ser Ala Leu His Arg Phe Ser Thr Ser Arg 1220 1225 1230Met Ser His Gly Gly Phe Ala Ser Gln Ser Thr Ala Ala Leu Thr 1235 1240 1245Arg Leu Met Ala Thr Thr Asp Thr Met Arg Asp Leu Gly Asp Gln 1250 1255 1260Asn Phe Asp Phe Leu Phe Gln Ala Thr Leu Leu Tyr Ala Gln Ile 1265 1270 1275Thr Thr Thr Val Ala Arg Asp Gly Trp Ile Thr Ser Cys Thr Asp 1280 1285 1290His Tyr His Ile Ala Cys Lys Ser Cys Leu Arg Pro Ile Glu Glu 1295 1300 1305Ile Thr Leu Asp Ser Ser Met Asp Tyr Thr Pro Pro Asp Val Ser 1310 1315 1320His Val Leu Lys Thr Trp Arg Asn Gly Glu Gly Ser Trp Gly Gln 1325 1330 1335Glu Ile Lys Gln Ile Tyr Pro Leu Glu Gly Asn Trp Lys Asn Leu 1340 1345 1350Ala Pro Ala Glu Gln Ser Tyr Gln Val Gly Arg Cys Ile Gly Phe 1355 1360 1365Leu Tyr Gly Asp Leu Ala Tyr Arg Lys Ser Thr His Ala Glu Asp 1370 1375 1380Ser Ser Leu Phe Pro Leu Ser Ile Gln Gly Arg Ile Arg Gly Arg 1385 1390 1395Gly Phe Leu Lys Gly Leu Leu Asp Gly Leu Met Arg Ala Ser Cys 1400 1405 1410Cys Gln Val Ile His Arg Arg Ser Leu Ala His Leu Lys Arg Pro 1415 1420 1425Ala Asn Ala Val Tyr Gly Gly Leu Ile Tyr Leu Ile Asp Lys Leu 1430 1435 1440Ser Val Ser Pro Pro Phe Leu Ser Leu Thr Arg Ser Gly Pro Ile 1445 1450 1455Arg Asp Glu Leu Glu Thr Ile Pro His Lys Ile Pro Thr Ser Tyr 1460 1465 1470Pro Thr Ser Asn Arg Asp Met Gly Val Ile Val Arg Asn Tyr Phe 1475 1480 1485Lys Tyr Gln Cys Arg Leu Ile Glu Lys Gly Lys Tyr Arg Ser His 1490 1495 1500Tyr Ser Gln Leu Trp Leu Phe Ser Asp Val Leu Ser Ile Asp Phe 1505 1510 1515Ile Gly Pro Phe Ser Ile Ser Thr Thr Leu Leu Gln Ile Leu Tyr 1520 1525 1530Lys Pro Phe Leu Ser Gly Lys Asp Lys Asn Glu Leu Arg Glu Leu 1535 1540 1545Ala Asn Leu Ser Ser Leu Leu Arg Ser Gly Glu Gly Trp Glu Asp 1550 1555 1560Ile His Val Lys Phe Phe Thr Lys Asp Ile Leu Leu Cys Pro Glu 1565 1570 1575Glu Ile Arg His Ala Cys Lys Phe Gly Ile Ala Lys Asp Asn Asn 1580 1585 1590Lys Asp Met Ser Tyr Pro Pro Trp Gly Arg Glu Ser Arg Gly Thr 1595 1600 1605Ile Thr Thr Ile Pro Val Tyr Tyr Thr Thr Thr Pro Tyr Pro Lys 1610 1615 1620Met Leu Glu Met Pro Pro Arg Ile Gln Asn Pro Leu Leu Ser Gly 1625 1630 1635Ile Arg Leu Gly Gln Leu Pro Thr Gly Ala His Tyr Lys Ile Arg 1640 1645 1650Ser Ile Leu His Gly Met Gly Ile His Tyr Arg Asp Phe Leu Ser 1655 1660 1665Cys Gly Asp Gly Ser Gly Gly Met Thr Ala Ala Leu Leu Arg Glu 1670 1675 1680Asn Val His Ser Arg Gly Ile Phe Asn Ser Leu Leu Glu Leu Ser 1685 1690 1695Gly Ser Val Met Arg Gly Ala Ser Pro Glu Pro Pro Ser Ala Leu 1700 1705 1710Glu Thr Leu Gly Gly Asp Lys Ser Arg Cys Val Asn Gly Glu Thr 1715 1720 1725Cys Trp Glu Tyr Pro Ser Asp Leu Cys Asp Pro Arg Thr Trp Asp 1730 1735 1740Tyr Phe Leu Arg Leu Lys Ala Gly Leu Gly Leu Gln Ile Asp Leu 1745 1750 1755Ile Val Met Asp Met Glu Val Arg Asp Ser Ser Thr Ser Leu Lys 1760 1765 1770Ile Glu Thr Asn Val Arg Asn Tyr Val His Arg Ile Leu Asp Glu 1775 1780 1785Gln Gly Val Leu Ile Tyr Lys Thr Tyr Gly Thr Tyr Ile Cys Glu 1790 1795 1800Ser Glu Lys Asn Ala Val Thr Ile Leu Gly Pro Met Phe Lys Thr 1805 1810 1815Val Asp Leu Val Gln Thr Glu Phe Ser Ser Ser Gln Thr Ser Glu 1820 1825 1830Val Tyr Met Val Cys Lys Gly Leu Lys Lys Leu Ile Asp Glu Pro 1835 1840 1845Asn Pro Asp Trp Ser Ser Ile Asn Glu Ser Trp Lys Asn Leu Tyr 1850 1855 1860Ala Phe Gln Ser Ser Glu Gln Glu Phe Ala Arg Ala Lys Lys Val 1865 1870 1875Ser Thr Tyr Phe Thr Leu Thr Gly Ile Pro Ser Gln Phe Ile Pro 1880 1885 1890Asp Pro Phe Val Asn Ile Glu Thr Met Leu Gln Ile Phe Gly Val 1895 1900 1905Pro Thr Gly Val Ser His Ala Ala Ala Leu Lys Ser Ser Asp Arg 1910 1915 1920Pro Ala Asp Leu Leu Thr Ile Ser Leu Phe Tyr Met Ala Ile Ile 1925 1930 1935Ser Tyr Tyr Asn Ile Asn His Ile Arg Val Gly Pro Ile Pro Pro 1940 1945 1950Asn Pro Pro Ser Asp Gly Ile Ala Gln Asn Val Gly Ile Ala Ile 1955 1960 1965Thr Gly Ile Ser Phe Trp Leu Ser Leu Met Glu Lys Asp Ile Pro 1970 1975 1980Leu Tyr Gln Gln Cys Leu Ala Val Ile Gln Gln Ser Phe Pro Ile 1985 1990 1995Arg Trp Glu Ala Val Ser Val Lys Gly Gly Tyr Lys Gln Lys Trp 2000 2005 2010Ser Thr Arg Gly Asp Gly Leu Pro Lys Asp Thr Arg Thr Ser Asp 2015 2020 2025Ser Leu Ala Pro Ile Gly Asn Trp Ile Arg Ser Leu Glu Leu Val 2030 2035 2040Arg Asn Gln Val Arg Leu Asn Pro Phe Asn Glu Ile Leu Phe Asn 2045 2050 2055Gln Leu Cys Arg Thr Val Asp Asn His Leu Lys Trp Ser Asn Leu 2060 2065 2070Arg Arg Asn Thr Gly Met Ile Glu Trp Ile Asn Arg Arg Ile Ser 2075 2080 2085Lys Glu Asp Arg Ser Ile Leu Met Leu Lys Ser Asp Leu His Glu 2090 2095 2100Glu Asn Ser Trp Arg Asp 2105

Claims

1. A method for producing a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the method comprises the steps of deleting glycoprotein (G protein) of VSV, and wherein the VSV comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV), and the hemagglutinin neuraminidase (HN) protein of NDV.

2. The method of claim 1, wherein the modified fusion protein (F protein) of NDV is a F3aa-modified F protein, and/or wherein the modified fusion protein comprises at least one amino acid substitution in the protease cleavage site, and/or wherein the G protein of VSV is replaced by the modified fusion protein and the HN protein of NDV.

3. The method of claim 1, wherein the modified fusion protein (F protein) of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NOs: 10 or 12, and/or wherein the HN protein of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 6.

4. A recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the glycoprotein (G protein) of VSV is deleted, and which comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV); and the hemagglutinin neuraminidase (HN) protein of NDV, wherein the modified fusion protein (F protein) of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NOs: 10 or 12, and/or wherein the HN protein of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 6.

5. A nucleic acid encoding a recombinant oncolytic virus according to claim 4.

6. A vector comprising a nucleic acid of claim 5.

7. A pharmaceutical composition, comprising: (a) (i) a recombinant oncolytic virus produced by a method for producing a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the method comprises the steps of deleting glycoprotein (G protein) of VSV, and wherein the VSV comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV), and the hemagglutinin neuraminidase (HN) protein of NDV; or (ii) a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the glycoprotein (G protein) of VSV is deleted, and which comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV); and the hemagglutinin neuraminidase (HN) protein of NDV, wherein the modified fusion protein (F protein) of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NOs: 10 or 12, and/or wherein the HN protein of NDV comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 6; or (iii) a nucleic acid encoding a recombinant oncolytic virus according to claim 5; and (b) pharmaceutically acceptable carrier(s) and/or excipient(s).

8. The pharmaceutical composition of claim 7, further comprising one or more compounds selected from chemotherapeutic agents, radiotherapeutic agents, tumor vaccines, immune checkpoint inhibitors, cell carrier systems, small molecule inhibitors, embolization agents, and shielding polymers.

9. The pharmaceutical composition of claim 7, formulated for delivery via a route selected from intravenous administration or intra-arterial administration, intradermal, subcutaneous, intramuscular, intravenous, intratumoral, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intracerebral, intracerebroventricular and intravitreal injection.

10. A method for oncolytic therapy wherein said method comprises the step of administering to a patient a therapeutically effective amount of: a recombinant oncolytic virus produced by a method for producing a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the method comprises the steps of deleting glycoprotein (G protein) of VSV, and wherein the VSV comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV), and the hemagglutinin neuraminidase (HN) protein of NDV; or a nucleic acid encoding the recombinant oncolytic virus according to claim 5.

11. The method according to claim 10, further comprising the step of administering one or more additional agents selected from cell carrier systems, immunotherapies, and standard tumor therapies, to said patient.

12. A method of treatment of cancer comprising the step of administering to a subject in need thereof a therapeutically effective amount of: a recombinant oncolytic virus produced by a method for producing a recombinant oncolytic virus, comprising a vesicular stomatitis virus (VSV), wherein the method comprises the steps of deleting glycoprotein (G protein) of VSV, and wherein the VSV comprises a modified fusion protein (F protein) of Newcastle disease virus (NDV), and the hemagglutinin neuraminidase (HN) protein of NDV; or a nucleic acid encoding the recombinant oncolytic virus according to claim 5.

13. The method according to claim 12, wherein the cell carrier system is selected from T cells, dendritic cells, NK cells, and mesenchymal stem cells; the immunotherapy is selected from tumor vaccines and immune checkpoint inhibitors; and the standard tumor therapy is selected from radiofrequency ablation, chemotherapy, embolization, and small molecule inhibitors.

14. The vector according to claim 6, further comprising one or more reporter genes and/or genes to be delivered to a target cell or tissue.

15. The vector according to claim 14, wherein the reporter gene is selected from HSV1-sr39TK, the sodium iodide symporter (NIS), somatostatin receptor 2 (SSTR2), luciferase, green fluorescence protein (GFP), lacZ, and tyrosinase; and the gene to be delivered to a target cell or tissue is selected from immune stimulating genes, immune checkpoint inhibitory antibodies, and tumor associated antigens (TAA).

16. A method of delivering genes, of imaging of virus biodistribution and/or for tumor detection, wherein the vector of claim 14 is administered to a patient.