COMPOSITIONS FOR MODULATING EXPRESSION OF C9ORF72 ANTISENSE TRANSCRIPT

Abstract

Disclosed herein are compositions and methods for reducing expression of C9ORF72 antisense transcript in an animal with C9ORF72 antisense transcript specific inhibitors. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C9ORF72 antisense transcript specific inhibitors include antisense compounds.

Description

SEQUENCE LISTING

[0001] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0262USD1SEQ_ST25.txt created Aug. 24, 2020, which is 76 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

[0002] Provided are compositions and methods for inhibiting expression of C9ORF72 antisense transcript in an animal. Such compositions and methods are useful to treat, prevent, or ameliorate neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).

BACKGROUND

[0003] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700). ALS is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537). There is growing recognition, based on clinical, genetic, and epidemiological data, that ALS and frontotemporal dementia (FTD) represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133).

[0004] To date, a number of genes have been discovered as causative for classical familial ALS, for example, SOD1, TARDBP, FUS, OPTN, and VCP (Johnson et al., Neuron, 2010, 68, 857-864; Kwiatkowski et al., Science, 2009, 323, 1205-1208; Maruyama et al., Nature, 2010, 465, 223-226; Rosen et al., Nature, 1993, 362, 59-62; Sreedharan et al., Science, 2008, 319, 1668-1672; Vance et al., Brain, 2009, 129, 868-876). Recently, linkage analysis of kindreds involving multiple cases of ALS, FTD, and ALS-FTD had suggested that there was an important locus for the disease on the short arm of chromosome 9 (Boxer et al., J. Neurol. Neurosurg. Psychiatry, 2011, 82, 196-203; Morita et al., Neurology, 2006, 66, 839-844; Pearson et al. J. Nerol., 2011, 258, 647-655; Vance et al., Brain, 2006, 129, 868-876). This mutation has been found to be the most common genetic cause of ALS and FTD. It is postulated that the ALS-FTD causing mutation is a large hexanucleotide (GGGGCC) repeat expansion in the first intron of the C9ORF72 gene (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256). A founder haplotype, covering the C9ORF72 gene, is present in the majority of cases linked to this region (Renton et al., Neuron, 2011, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Finnish patients (Laaksovirta et al, Lancet Neurol., 2010, 9, 978-985).

[0005] There are currently no effective therapies to treat such neurodegenerative diseases. Therefore, it is an object to provide compositions and methods for the treatment of such neurodegenerative diseases.

Summary

[0006] Provided herein are compositions and methods for modulating levels of C9ORF72 antisense transcript in cells, tissues, and animals. In certain embodiments, C9ORF72 antisense transcript specific inhibitors modulate expression of C9ORF72 antisense transcript. In certain embodiments, C9ORF72 antisense transcript specific inhibitors are nucleic acids, proteins, or small molecules.

[0007] In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, C9ORF72 antisense transcript levels are reduced. In certain embodiments, C9ORF72 antisense transcript associated RAN translation products are reduced. In certain embodiments, the C9ORF72 antisense transcript associated RAN translation products are poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine). In certain embodiments, the C9ORF72 antisense transcript contains a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat is transcribed in the antisense direction from the C9ORF72 gene. In certain embodiments, the hexanucleotide repeat expansion is associated with a C9ORF72 associated disease. In certain embodiments, the hexanucleotide repeat expansion is associated with a C9ORF72 hexanucleotide repeat expansion associated disease. In certain embodiments, the hexanucleotide repeat expansion comprises at least 30 GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC repeats. In certain embodiments, the hexanucleotide repeat expansion comprises more than 30 GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC repeats. In certain embodiments, the hexanucleotide repeat expansion comprises more than 100 GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC repeats. In certain embodiments, the hexanucleotide repeat expansion comprises more than 500 GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC repeats. In certain embodiments, the hexanucleotide repeat expansion comprises more than 1000 GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC repeats. In certain embodiments, the hexanucleotide repeat expansion is associated with nuclear foci. In certain embodiments, C9ORF72 antisense transcript associated RAN translation products are associated with nuclear foci. In certain embodiments, the antisense transcript associated RAN translation products are poly-(proline-alanine) and/or poly-(proline-arginine). In certain embodiments, the compositions and methods described herein are useful for reducing C9ORF72 antisense transcript levels, C9ORF72 antisense transcript associated RAN translation products, and nuclear foci. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.

[0008] Also provided are methods useful for preventing, treating, ameliorating, and slowing progression of diseases and conditions associated with C9ORF72. In certain embodiments, such diseases and conditions associated with C9ORF72 are neurodegenerative diseases. In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).

[0009] Such diseases and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a neurodegenerative disease, and, in particular, ALS and FTD, include genetic predisposition and older age.

[0010] In certain embodiments, methods of treatment include administering a C9ORF72 antisense transcript specific inhibitor to an individual in need thereof. In certain embodiments, the C9ORF72 antisense transcript specific inhibitor is a nucleic acid. In certain embodiments, the nucleic acid is an antisense compound. In certain embodiments, the antisense compound is an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is complementary to a C9ORF72 antisense transcript. In certain embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.

DETAILED DESCRIPTION

[0011] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Additionally, as used herein, the use of "and" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0012] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this disclosure, including, but not limited to, patents, patent applications, published patent applications, articles, books, treatises, and GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0013] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis.

[0014] Unless otherwise indicated, the following terms have the following meanings:

[0015] "2'-O-methoxyethyl" (also 2'-MOE and 2'-OCH.sub.2CH.sub.2--OCH.sub.3 and MOE) refers to an 0-methoxy-ethyl modification of the 2' position of a furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0016] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety.

[0017] "2'-substituted nucleoside" means a nucleoside comprising a substituent at the 2'-position of the furanose ring other than H or OH. In certain embodiments, 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0018] "5-methylcytosine" means a cytosine modified with a methyl group attached to the 5' position. A 5-methylcytosine is a modified nucleobase.

[0019] "About" means within .+-.7% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of C9ORF72 antisense transcript", it is implied that the C9ORF72 antisense transcript levels are inhibited within a range of 63% and 77%.

[0020] "Administered concomitantly" refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

[0021] "Administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.

[0022] "Amelioration" refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

[0023] "Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0024] "Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.

[0025] "Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein product encoded by such target nucleic acid.

[0026] "Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0027] "Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.

[0028] "Antisense mechanisms" are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

[0029] "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

[0030] "Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.

[0031] "Bicyclic sugar" means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

[0032] "Bicyclic nucleoside" (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

[0033] "C9ORF72 antisense transcript" means transcripts produced from the non-coding strand (also antisense strand and template strand) of the C9ORF72 gene. The C9ORF72 antisense transcript differs from the canonically transcribed "C9ORF72 sense transcript", which is produced from the coding strand (also sense strand) of the C9ORF72 gene.

[0034] "C9ORF72 antisense transcript associated RAN translation products" means aberrant peptide or di-peptide polymers translated through RAN translation (i.e., repeat-associated, and non-ATG-dependent translation). In certain embodiments, the C9ORF72 antisense transcript associated RAN translation products are any of poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine).

[0035] "C9ORF72 antisense transcript specific inhibitor" refers to any agent capable of specifically inhibiting the expression of C9ORF72 antisense transcript and/or its expression products at the molecular level. As used herein, "specific" means reducing or inhibiting expression of C9ORF72 antisense transcript without reducing non-target transcript to an appreciable degree (e.g., a C9ORF72 antisense transcript specific inhibitor reduces expression of C9ORF72 antisense transcript, but does not reduce expression of C9ORF72 sense transcript to an appreciable degree). C9ORF72 specific antisense transcript inhibitors include nucleic acids (including antisense compounds), siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C9ORF72 antisense transcript and/or its expression products, such as C9ORF72 antisense transcript associated RAN translation products.

[0036] "C9ORF72 associated disease" means any disease associated with any C9ORF72 nucleic acid or expression product thereof, regardless of which DNA strand the C9ORF72 nucleic acid or expression product thereof is derived from. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.

[0037] "C9ORF72 foci" means nuclear foci comprising a C9ORF72 transcript. In certain embodiments, a C9ORF72 foci comprises at least one C9ORF72 sense transcript (herein "C9ORF72 sense foci"). In certain embodiments, C9ORF72 sense foci comprise C9ORF72 sense transcripts comprising any of the following hexanucleotide repeats: GGGGCC, GGGGGG, GGGGGC, and/or GGGGCG. In certain embodiments, a C9ORF72 foci comprises at least one C9ORF72 antisense transcript (herein "C9ORF72 antisense foci"). In certain embodiments, C9ORF72 antisense foci comprise C9ORF72 antisense transcripts comprising any of the following hexanucleotide repeats: GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC. In certain embodiments, C9ORF72 foci comprise both C9ORF72 sense transcripts and C9ORF72 antisense transcripts.

[0038] "C9ORF72 hexanucleotide repeat expansion associated disease" means any disease associated with a C9ORF72 nucleic acid containing a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat expansion may comprise any of the following hexanucleotide repeats: GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC. In certain embodiments, the hexanucleotide repeat is repeated at least 30 times, more than 30 times, more than 100 times, more than 500 times, or more than 1000 times. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.

[0039] "C9ORF72 nucleic acid" means any nucleic acid derived from the C9ORF72 locus, regardless of which DNA strand the C9ORF72 nucleic acid is derived from. In certain embodiments, a C9ORF72 nucleic acid includes a DNA sequence encoding C9ORF72, an RNA sequence transcribed from DNA encoding C9ORF72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding C9ORF72. "C9ORF72 mRNA" means an mRNA encoding a C9ORF72 protein. In certain embodiments, a C9ORF72 nucleic acid includes transcripts produced from the coding strand of the C9ORF72 gene. C9ORF72 sense transcripts are examples of C9ORF72 nucleic acids. In certain embodiments, a C9ORF72 nucleic acid includes transcripts produced from the non-coding strand of the C9ORF72 gene. C9ORF72 antisense transcripts are examples of C9ORF72 nucleic acids.

[0040] "C9ORF72 pathogenic associated mRNA variant" means the C9ORF72 mRNA variant processed from a C9ORF72 pre-mRNA variant containing the hexanucleotide repeat. A C9ORF72 pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon 1B, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000). In certain embodiments, the level of a C9ORF72 pathogenic associated mRNA variant is measured to determine the level of a C9ORF72 pre-mRNA containing the hexanucleotide repeat in a sample.

[0041] "C9ORF72 transcript" means an RNA transcribed from C9ORF72. In certain embodiments, a C9ORF72 transcript is a C9ORF72 sense transcript. In certain embodiments, a C9ORF72 transcript is a C9ORF72 antisense transcript.

[0042] "Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0043] "cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH.sub.3)--O-2'.

[0044] "Constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH.sub.3)--O-2' bridge.

[0045] "Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-O-methoxyethyl modifications.

[0046] "Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.

[0047] "Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

[0048] "Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0049] "Comprise," "comprises," and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0050] "Contiguous nucleobases" means nucleobases immediately adjacent to each other.

[0051] "Designing" or "designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.

[0052] "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.

[0053] "Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.

[0054] "Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

[0055] "Efficacy" means the ability to produce a desired effect.

[0056] "Expression" includes all the functions by which a gene's coded information, regardless of which DNA strand the coded information is derived from, is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation, including RAN translation.

[0057] "Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

[0058] "Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as the "wings."

[0059] "Gap-narrowed" means a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

[0060] "Gap-widened" means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

[0061] "Hexanucleotide repeat expansion" means a series of six bases (for example, GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC) repeated at least twice. In certain embodiments, the hexanucleotide repeat expansion may be located in intron 1 of a C9ORF72 nucleic acid. In certain embodiments, the hexanucleotide repeat may be transcribed in the antisense direction from the C9ORF72 gene. In certain embodiments, a pathogenic hexanucleotide repeat expansion includes more than 30, more than 100, more than 500, or more than 1000 repeats of GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC in a C9ORF72 nucleic acid and is associated with disease. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. In certain embodiments, a wild-type hexanucleotide repeat expansion includes 30 or fewer repeats of GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC in a C9ORF72 nucleic acid. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases.

[0062] "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

[0063] "Hypoxanthine" (Hyp) also 6-Oxypurine is a purine derivative. In certain embodiments, a hypoxanthine (Hyp) may be used in place of a guanine (G) nucleobase to break up a series of 4 or more guanosines in a row ("G-quartet"). Hypoxanthine is a modified nucleobase.

[0064] "Identifying an animal having a C9ORF72 associated disease" means identifying an animal having been diagnosed with a C9ORF72 associated disease or predisposed to develop a C9ORF72 associated disease. Individuals predisposed to develop a C9ORF72 associated disease include those having one or more risk factors for developing a C9ORF72 associated disease, including, having a personal or family history or genetic predisposition of one or more C9ORF72 associated diseases. In certain embodiments, the C9ORF72 associated disease is a C9ORF72 hexanucleotide repeat expansion associated disease. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.

[0065] "Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.

[0066] "Individual" means a human or non-human animal selected for treatment or therapy.

[0067] "Inhibiting expression of a C9ORF72 antisense transcript" means reducing the level or expression of a C9ORF72 antisense transcript and/or its expression products (e.g., RAN translation products). In certain embodiments, C9ORF72 antisense transcripts are inhibited in the presence of an antisense compound targeting a C9ORF72 antisense transcript, including an antisense oligonucleotide targeting a C9ORF72 antisense transcript, as compared to expression of C9ORF72 antisense transcript levels in the absence of a C9ORF72 antisense compound, such as an antisense oligonucleotide.

[0068] "Inhibiting expression of a C9ORF72 sense transcript" means reducing the level or expression of a C9ORF72 sense transcript and/or its expression products (e.g., a C9ORF72 mRNA and/or protein). In certain embodiments, C9ORF72 sense transcripts are inhibited in the presence of an antisense compound targeting a C9ORF72 sense transcript, including an antisense oligonucleotide targeting a C9ORF72 sense transcript, as compared to expression of C9ORF72 sense transcript levels in the absence of a C9ORF72 antisense compound, such as an antisense oligonucleotide.

[0069] "Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

[0070] "Inosine" (I) or 9-.beta.-D-Ribosylhypoxanthine means a nucleoside that contains a hypoxanthine nucleobase.

[0071] "Internucleoside linkage" refers to the chemical bond between nucleosides.

[0072] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.

[0073] "Locked nucleic acid" or "LNA" or "LNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') LNA, (B) .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') LNA, (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') LNA, (D) Aminooxy (4'-CH.sub.2--O--N(R)-2') LNA and (E) Oxyamino (4'-CH.sub.2--N(R)--O-2') LNA, as depicted below.

##STR00001##

[0074] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from --[C(R.sub.1)(R.sub.2)].sub.n--, --C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1).dbd.N--, --C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--, --Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x-- and --N(R.sub.1)--; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.1 and R.sub.2 is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl (S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.

[0075] Examples of 4'-2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: --[C(R.sub.1)(R.sub.2)].sub.n--, --[C(R.sub.1)(R.sub.2)].sub.n--O--, --C(R.sub.1R.sub.2)--N(R.sub.1)--O-- or --C(R.sub.1R.sub.2)--O--N(R.sub.1)--. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2', 4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R.sub.1)-2' and 4'-CH.sub.2--N(R.sub.1)--O-2'-bridges, wherein each R.sub.1 and R.sub.2 is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0076] Also included within the definition of LNA according to the invention are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH.sub.2--O-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (--CH.sub.2--) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH.sub.2--O-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4' CH.sub.2CH.sub.2--O-2') LNA is used. .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2'), an isomer of methyleneoxy (4'-CH.sub.2--O-2') LNA is also encompassed within the definition of LNA, as used herein.

[0077] "Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

[0078] "Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).

[0079] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. Hypoxanthine (Hyp) is a modified nucleobase. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G); the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0080] "Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

[0081] "Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.

[0082] "Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.

[0083] "Modified sugar" means substitution and/or any change from a natural sugar moiety.

[0084] "Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0085] "Motif" means the pattern of unmodified and modified nucleoside in an antisense compound.

[0086] "Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0087] "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0088] "Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0089] "Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

[0090] "Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0091] "Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). Hypoxanthine (Hyp) binds with adenine, thymine, or cytosine with a preference for binding with cytosine. In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

[0092] "Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.

[0093] "Nucleoside" means a nucleobase linked to a sugar.

[0094] "Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by --N(H)--C(.dbd.O)--O-- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0095] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0096] "Off-target effect" refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0097] "Oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0098] "Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

[0099] "Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

[0100] "Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.

[0101] "Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. In certain embodiments, an antisense oligonucleotide targeted to C9ORF72 sense transcript is a pharmaceutical agent. In certain embodiments, an antisense oligonucleotide targeted to C9ORF72 antisense transcript is a pharmaceutical agent.

[0102] "Pharmaceutical composition" means a mixture of substances suitable for administering to as subject. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.

[0103] "Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

[0104] "Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0105] "Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0106] "Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0107] "Prevent" or "preventing" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.

[0108] "Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

[0109] "Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

[0110] "Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

[0111] "Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

[0112] "Salts" mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0113] "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.

[0114] "Shortened" or "truncated" versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted.

[0115] "Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

[0116] "Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.

[0117] "Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.

[0118] "Slows progression" means decrease in the development of the disease.

[0119] "Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.

[0120] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

[0121] "Subject" means a human or non-human animal selected for treatment or therapy.

[0122] "Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0123] "Target nucleic acid," "target RNA," and "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds.

[0124] "Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

[0125] "Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0126] "Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

[0127] "Treat" or "treating" or "treatment" means administering a composition to effect an alteration or improvement of a disease or condition.

[0128] "Unmodified nucleobases" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U).

[0129] "Unmodified nucleotide" means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. .beta.-D-ribonucleosides) or a DNA nucleotide (i.e. .beta.-D-deoxyribonucleoside).

[0130] "Wing segment" means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Certain Embodiments

[0131] Provided herein are compounds comprising a C9ORF72 antisense transcript specific inhibitor.

[0132] In certain embodiments, the C9ORF72 antisense transcript specific inhibitor is an antisense compound.

[0133] In certain embodiments, the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide.

[0134] In certain embodiments, the antisense oligonucleotide consists of 12-30 linked nucleosides.

[0135] In certain embodiments, the antisense oligonucleotide consists of 16-25 linked nucleosides.

[0136] In certain embodiments, the antisense oligonucleotide consists of 18-22 linked nucleosides

[0137] In certain embodiments, the antisense oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript.

[0138] In certain embodiments, the antisense oligonucleotide has a nucleobase sequence that is at least 90% complementary to a C9ORF72 antisense transcript.

[0139] In certain embodiments, the antisense oligonucleotide has a nucleobase sequence that is at least 95% complementary to a C9ORF72 antisense transcript.

[0140] In certain embodiments, the antisense oligonucleotide has a nucleobase sequence that is 100% complementary to a C9ORF72 antisense transcript.

[0141] In certain embodiments, the C9ORF72 antisense transcript has the nucleobase sequence of SEQ ID NO: 13.

[0142] In certain embodiments, the antisense oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of a sequence selected from among SEQ ID NO: 30-84.

[0143] In certain embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.

[0144] In certain embodiments, the modified antisense oligonucleotide comprises at least one modified internucleoside linkage.

[0145] In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0146] In certain embodiments, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0147] In certain embodiments, the modified antisense oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0148] In certain embodiments, at least one modified nucleobase is a hypoxanthine.

[0149] In certain embodiments, at least one nucleoside of the modified antisense oligonucleotide is an inosine.

[0150] In certain embodiments, the at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase.

[0151] In certain embodiments, at least one modified nucleobase is a 5-methylcytosine.

[0152] In certain embodiments, the at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar.

[0153] In certain embodiments, the at least one modified sugar is a bicyclic sugar.

[0154] In certain embodiments, the bicyclic sugar comprises a chemical bridge between the 2' and 4' position of the sugar, wherein the chemical bridge is selected from: 4'-CH.sub.2--O-2'; 4'-CH(CH.sub.3)--O-2'; 4'-(CH.sub.2).sub.2--O-2'; and 4'-CH.sub.2--N(R)--O-2' wherein R is, independently, H, C.sub.1-C.sub.12 alkyl, or a protecting group.

[0155] In certain embodiments, the at least one modified sugar comprises a 2'-O-methoxyethyl group.

[0156] In certain embodiments, the antisense oligonucleotide is a gapmer.

[0157] In certain embodiments, the compound comprises at least one conjugate.

[0158] In certain embodiments, the C9ORF72 antisense transcript specific antisense compound consists of an antisense oligonucleotide.

[0159] Provided herein are pharmaceutical compositions comprising any compound described herein and a pharmaceutically acceptable diluent or carrier.

[0160] Provided herein are pharmaceutical compositions comprising a C9ORF72 antisense transcript specific inhibitor.

[0161] Provided herein are pharmaceutical compositions comprising a C9ORF72 antisense transcript specific inhibitor and a C9ORF sense transcript specific inhibitor.

[0162] In certain embodiments, the C9ORF72 sense transcript specific inhibitor is a C9ORF72 sense transcript specific antisense compound.

[0163] In certain embodiments, the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound.

[0164] In certain embodiments, the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide.

[0165] In certain embodiments, the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide.

[0166] In certain embodiments, the C9ORF72 antisense transcript has the nucleobase sequence of SEQ ID NO: 13.

[0167] In certain embodiments, the C9ORF72 sense transcript has the nucleobase sequence of SEQ ID NO: 1-10.

[0168] Provided herein are uses of any compound described herein for the manufacture of a medicament for treating a neurodegenerative disease.

[0169] Provided herein are methods, comprising contacting a cell with an antisense oligonucleotide having a nucleobase sequence of any of SEQ ID NOs: 30-84.

[0170] Provided herein are methods, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor.

[0171] Provided herein are methods, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor.

[0172] Provided herein are methods, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor; and thereby reducing the level or expression of C9ORF72 antisense transcript in the cell.

[0173] Provided herein are methods, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor; and thereby reducing the level or expression of both C9ORF72 antisense transcript and C9ORF72 sense transcript in the cell.

[0174] In certain embodiments, the C9ORF72 antisense specific inhibitor is an antisense compound.

[0175] In certain embodiments, the C9ORF72 antisense transcript specific inhibitor is an antisense compound.

[0176] In certain embodiments, the cell is in vitro.

[0177] In certain embodiments, the cell is in an animal.

[0178] Provided herein are methods, comprising administering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor.

[0179] In certain embodiments the amount is effective to reduce the level or expression of the C9ORF72 antisense transcript.

[0180] Provided herein are methods, comprising co-administering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor.

[0181] In certain embodiments the therapeutically effective amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript.

[0182] In certain embodiments, wherein the C9ORF72 antisense transcript inhibitor is a C9ORF72 antisense transcript specific antisense compound.

[0183] In certain embodiments, the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound.

[0184] Provided herein are methods, comprising:

[0185] identifying an animal having a C9ORF72 associated disease; and

[0186] administering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor.

[0187] In certain embodiments the amount is effective to reduce the level or expression of the C9OR72 antisense transcript.

[0188] Provided herein are methods, comprising:

[0189] identifying an animal having a C9ORF72 associated disease; and

[0190] coadministering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor.

[0191] In certain embodiments the amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript.

[0192] In certain embodiments the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound.

[0193] In certain embodiments the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound.

[0194] In certain embodiments the C9ORF72 antisense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 anti sense transcript.

[0195] In certain embodiments the C9ORF72 sense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 sense transcript.

[0196] In certain embodiments the C9ORF72 antisense transcript is SEQ ID NO: 13.

[0197] In certain embodiments the C9ORF72 sense transcript is any of SEQ ID NO: 1-10.

[0198] In certain embodiments the C9ORF72 associated disease is a C9ORF72 hexanucleotide repeat expansion associated disease.

[0199] In certain embodiments the C9ORF72 associated disease or C9ORF72 hexanucleotide repeat expansion associated disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).

[0200] In certain embodiments the amyotrophic lateral sclerosis (ALS) is familial ALS or sporadic ALS.

[0201] In certain embodiments the contacting or administering reduces C9ORF72 antisense transcript associated RAN translation products.

[0202] In certain embodiments the C9ORF72 antisense transcript associated RAN translation products are any of poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine).

[0203] In certain embodiments the administering and coadminstering is parenteral administration.

[0204] In certain embodiments the parental administration is any of injection or infusion.

[0205] In certain embodiments the parenteral administration is any of intrathecal administration or intracerebroventricular administration.

[0206] In certain embodiments at least one symptom of a C9ORF72 associated disease or a C9ORF72 hexanucleotide repeat expansion associated disease is slowed, ameliorated, or prevented.

[0207] In certain embodiments the at least one symptom is any of motor function, respiration, muscle weakness, fasciculation and cramping of muscles, difficulty in projecting the voice, shortness of breath, difficulty in breathing and swallowing, inappropriate social behavior, lack of empathy, distractibility, changes in food preferences, agitation, blunted emotions, neglect of personal hygiene, repetitive or compulsive behavior, and decreased energy and motivation.

[0208] In certain embodiments the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide.

[0209] In certain embodiments the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide.

[0210] In certain embodiments the antisense oligonucleotide is a modified antisense oligonucleotide.

[0211] In certain embodiments at least one internucleoside linkage of the antisense oligonucleotide is a modified internucleoside linkage.

[0212] In certain embodiments at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0213] In certain embodiments each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0214] In certain embodiments at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase.

[0215] In certain embodiments the modified nucleobase is a 5-methylcytosine.

[0216] In certain embodiments at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar.

[0217] In certain embodiments at least one modified sugar is a bicyclic sugar.

[0218] In certain embodiments the bicyclic sugar comprises a chemical bridge between the 2' and 4' position of the sugar, wherein the chemical bridge is selected from: 4'-CH.sub.2--O-2'; 4'-CH(CH.sub.3)--O-2'; 4'-(CH.sub.2).sub.2--O-2'; and 4'-CH.sub.2--N(R)--O-2' wherein R is, independently, H, C.sub.1-C.sub.12 alkyl, or a protecting group.

[0219] In certain embodiments at least one modified sugar comprises a 2'-O-methoxyethyl group.

[0220] In certain embodiments the antisense oligonucleotide is a gapmer.

[0221] The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. A compound comprising a modified oligonucleotide consisting of 12-30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobases sequences of SEQ ID NOs: 30-99.

[0222] Embodiment 2. The compound of embodiment 1, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript.

[0223] Embodiment 3. The compound of embodiment 2, wherein the C9ORF72 antisense transcript has the nucleobase sequence of SEQ ID NO: 13.

[0224] Embodiment 4. The compound of any of embodiments 1-3, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

[0225] Embodiment 5. The compound of any of embodiments 1-4, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0226] Embodiment 6. The compound of any of embodiment 5, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0227] Embodiment 7. The compound of embodiments 5 or 6, wherein the modified oligonucleotide comprises at least one phosphodiester linkage.

[0228] Embodiment 8. The compound of embodiment 6, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0229] Embodiment 9. The compound of any of embodiments 1-8, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

[0230] Embodiment 10. The compound of embodiment 9, wherein the modified nucleobase is a 5 methylcytosine.

[0231] Embodiment 11. The compound of any of embodiments 1-10, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

[0232] Embodiment 12. The compound of embodiment 11, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar.

[0233] Embodiment 13. The compound of embodiments 11 or 12, wherein the modified sugar is a bicyclic sugar.

[0234] Embodiment 14. The compound of embodiment 13, wherein the bicyclic sugar comprises a chemical bridge between the 4' and 2' positions of the sugar, wherein the chemical bridge is selected from: 4'-CH(R)--O-2' and 4'-(CH.sub.2).sub.2--O-2', wherein R is independently selected from H, C.sub.1-C.sub.6 alkyl, and C.sub.1-C.sub.6 alkoxy.

[0235] Embodiment 15. The compound of embodiment 14, wherein the chemical bridge is 4'-CH(R)-0-2' and wherein R is methyl.

[0236] Embodiment 16. The compound of embodiment 14, wherein the chemical bridge is 4'-CH(R)-0-2' and wherein R is H.

[0237] Embodiment 17. The compound of embodiment 14, wherein the chemical bridge is 4'-CH(R)-0-2' and wherein R is --CH.sub.2--O--CH.sub.3.

[0238] Embodiment 18. The compound of embodiments 11 or 12, wherein the modified sugar comprises a 2'-O-methoxyethyl group.

[0239] Embodiment 19. The compound of any of embodiments 1-11 and 13-18, wherein the modified oligonucleotide is a gapmer.

[0240] Embodiment 20. The compound of embodiment 19, wherein the gapmer is selected from a 5-10-5 MOE gapmer, a 5-8-5 MOE gapmer, or a 4-8-4 MOE gapmer.

[0241] Embodiment 21. A pharmaceutical composition comprising the compound of any preceding embodiment or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.

[0242] Embodiment 22. The pharmaceutical composition of embodiment 21 further comprising a C9ORF72 sense transcript specific inhibitor.

[0243] Embodiment 23. The pharmaceutical composition of embodiment 22, wherein the C9ORF72 sense transcript specific inhibitor is any of a nucleic acid, aptamer, antibody, peptide, or small molecule.

[0244] Embodiment 24. The pharmaceutical composition of embodiment 23, wherein the nucleic acid is a single-stranded nucleic acids or a double-stranded nucleic acid.

[0245] Embodiment 25. The pharmaceutical composition of embodiment 23, wherein the nucleic acid is a siRNA.

[0246] Embodiment 26. The pharmaceutical composition of embodiment 22, wherein the C9ORF72 sense transcript inhibitor is an antisense compound.

[0247] Embodiment 27. The pharmaceutical composition of embodiment 26, wherein the antisense compound is an antisense oligonucleotide.

[0248] Embodiment 28. The pharmaceutical composition of embodiment 26, wherein the antisense compound is a modified oligonucleotide.

[0249] Embodiment 29. The pharmaceutical composition of embodiment 28, wherein the modified oligonucleotide is single-stranded.

[0250] Embodiment 30. The pharmaceutical composition of embodiments 28 or 29, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 sense transcript.

[0251] Embodiment 31. The pharmaceutical composition of embodiment 30 wherein the C9ORF72 sense transcript has the nucleobase sequence of SEQ ID NO: 1-10.

[0252] Embodiment 32. Use of the compound or composition of any preceding embodiment for the manufacture of a medicament for treating a neurodegenerative disease.

[0253] Embodiment 33. A method comprising administering to an animal the compound or composition of any preceding embodiment.

[0254] Embodiment 34. The method of embodiment 33, wherein the compound prevents, treats, ameliorates, or slows progression of at least one symptom of a C9ORF72 associated disease.

[0255] Embodiment 35. The method of embodiment 34, wherein the at least one symptom is selected from among impaired motor function, difficulty with respiration, muscle weakness, fasciculation and cramping of muscles, difficulty in projecting the voice, shortness of breath, difficulty in breathing and swallowing, inappropriate social behavior, lack of empathy, distractibility, changes in food preference, agitation, blunted emotions, neglect of personal hygiene, repetitive or compulsive behavior, and decreased energy and motivation.

[0256] Embodiment 36. The method of embodiment 34, wherein the C9ORF72 associated disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD).

[0257] Embodiment 37. The method of embodiment 36, wherein the amyotrophic lateral sclerosis (ALS) is familial ALS.

[0258] Embodiment 38. The method of embodiment 36, wherein the amyotrophic lateral sclerosis (ALS) is sporadic ALS.

[0259] Embodiment 39. The method of any of embodiments 33-38, wherein the administering reduces C9ORF72 antisense transcript associated RAN translation products.

[0260] Embodiment 40. The method of embodiment 39, wherein the C9ORF72 antisense transcript associated RAN translation products are any of poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine).

[0261] Embodiment 41. The method of any of embodiments 33-40, wherein the administering reduces C9ORF72 antisense foci.

[0262] Embodiment 42. The method of any of embodiments 33-41, wherein the administering reduces C9ORF72 sense foci.

[0263] Embodiment 43. The method of any of embodiments 33-42, wherein the administering is parenteral administration.

[0264] Embodiment 44. The method of embodiment 43, wherein the parenteral administration is any of injection or infusion.

[0265] Embodiment 45. The method of embodiment 43, wherein the parenteral administration is directly into the central nervous system (CNS).

[0266] Embodiment 46. The method of any of embodiments 43-45, wherein the parenteral administration is any of intrathecal administration or intracerebroventricular administration.

[0267] Embodiment 47. The compound of embodiment 11, wherein the modified oligonucleotide comprises sugar residues in any of the following patterns: eeedeeeeedeeeeedeeee or eeeeedeeeeedeeeeee, wherein,

[0268] e=a 2'-O-methoxyethylribose modified sugar, and

[0269] d=a 2'-deoxyribose sugar.

[0270] Embodiment 48. The compound of embodiment 5, wherein the modified oligonucleotide comprises internucleoside linkages in any of the following patterns: soooossssssssssooss, sooosssssssssooss, ssososssososssososs, or ssssososssosossss, wherein,

[0271] s=a phosphorothioate linkage, and

[0272] o=a phosphodiester linkage.

Antisense Compounds

[0273] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

[0274] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

[0275] In certain embodiments, an antisense compound targeted to a C9ORF72 nucleic acid is 12 to 30 subunits in length. In other words, such anti sense compounds are from 12 to 30 linked subunits. In certain embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. In certain embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides.

[0276] In certain embodiments antisense oligonucleotides targeted to a C9ORF72 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a C9ORF72 nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.

[0277] When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.

[0278] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

[0279] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

[0280] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense Compound Motifs

[0281] In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0282] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0283] Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include .beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE, and 2'-O--CH.sub.3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'-(CH.sub.2)n-O-2' bridge, where n=1 or n=2 and 4'-CH.sub.2--O--CH.sub.2-2'). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing region, "Y" represents the length of the gap region, and "Z" represents the length of the 3' wing region. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers described herein include, but are not limited to, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.

[0284] In certain embodiments, the antisense compound has a "wingmer" motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations described herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.

[0285] In certain embodiments, an antisense compound targeted to a C9ORF72 nucleic acid has a gap-narrowed motif. In certain embodiments, a gap-narrowed antisense oligonucleotide targeted to a C9ORF72 nucleic acid has a gap segment of 9, 8, 7, or 6 2'-deoxynucleotides positioned immediately adjacent to and between wing segments of 5, 4, 3, 2, or 1 chemically modified nucleosides. In certain embodiments, the chemical modification comprises a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4' to 2' bridge selected from among: 4'-(CH.sub.2).sub.n--O-2' bridge, wherein n is 1 or 2; and 4'-CH.sub.2--O--CH.sub.2-2'. In certain embodiments, the bicyclic sugar is comprises a 4'-CH(CH.sub.3)--O-2' bridge. In certain embodiments, the chemical modification comprises a non-bicyclic 2'-modified sugar moiety. In certain embodiments, the non-bicyclic 2'-modified sugar moiety comprises a 2'-O-methylethyl group or a 2'-O-methyl group.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

[0286] Nucleotide sequences that encode C9ORF72 include, without limitation, the following: the complement of GENBANK Accession No. NM 001256054.1 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 008413.18 truncated from nucleobase 27535000 to 27565000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. BQ068108.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. NM 018325.3 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DN993522.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. NM 145005.5 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 8), Sequence Identifier 4141_014_A (incorporated herein as SEQ ID NO: 9), and Sequence Identifier 4008_73_A (incorporated herein as SEQ ID NO: 10).

[0287] Nucleotide sequences that encode the C9ORF72 antisense transcript include, without limitation, the following: SEQ ID NO: 13. The sequence of SEQ ID NO: 13 is complementary to nucleotides 1159 to 1929 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleotides 27535000 to 27565000) except that SEQ ID NO: 13 has two more hexanucleotide repeats than SEQ ID NO: 2. The sequence of the hexanucleotide repeat is GGCCCC in SEQ ID NO: 13 and GGGGCC in SEQ ID NO: 2. Thus, SEQ ID NO: 13 is 12 nucleotides longer than nucleotides 1159 to 1929 of SEQ ID NO: 2, to which it is complementary.

[0288] It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

[0289] In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for C9ORF72 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

[0290] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0291] A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.

[0292] Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon.

[0293] The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

[0294] There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within a target region. In certain embodiments, reductions in C9ORF72 mRNA levels are indicative of inhibition of C9ORF72 expression. Reductions in levels of a C9ORF72 protein are also indicative of inhibition of target mRNA expression. Reduction in the presence of expanded C9ORF72 RNA foci are indicative of inhibition of C9ORF72 expression. Further, phenotypic changes are indicative of inhibition of C9ORF72 expression. For example, improved motor function and respiration may be indicative of inhibition of C9ORF72 expression.

Hybridization

[0295] In some embodiments, hybridization occurs between an antisense compound disclosed herein and a C9ORF72 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0296] Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0297] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a C9ORF72 nucleic acid.

Complementarily

[0298] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a C9ORF72 nucleic acid).

[0299] Non-complementary nucleobases between an antisense compound and a C9ORF72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a C9ORF72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

[0300] In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a C9ORF72 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

[0301] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0302] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a C9ORF72 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

[0303] The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

[0304] In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C9ORF72 nucleic acid, or specified portion thereof.

[0305] In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C9ORF72 nucleic acid, or specified portion thereof.

[0306] The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

[0307] The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[0308] In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

[0309] In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

[0310] In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Modifications

[0311] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0312] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

[0313] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

[0314] The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0315] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

[0316] In certain embodiments, antisense compounds targeted to a C9ORF72 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a C9ORF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.

Modified Sugar Moieties

[0317] Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R, R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).

[0318] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH.sub.3, 2'-OCH.sub.2CH.sub.3, 2'-OCH.sub.2CH.sub.2F and 2'-O(CH.sub.2).sub.2OCH.sub.3 substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl, OCF.sub.3, OCH.sub.2F, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), and O--CH.sub.2--C(.dbd.O)--N(R.sub.1)--(CH.sub.2).sub.2--N(R.sub.m)(R.sub.n)- , where each R.sub.l, R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C1-C.sub.10 alkyl.

[0319] As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2'; 4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' and 4'-CH(CH.sub.2OCH.sub.3)--O-2' (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4'-C(CH.sub.3)(CH.sub.3)--O-2' (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published Jan. 8, 2009); 4'-CH.sub.2--N(OCH.sub.3)-2' (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published Dec. 11, 2008); 4'-CH.sub.2--O--N(CH.sub.3)-2' (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH.sub.2--C(.dbd.CH.sub.2)-2' (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on Dec. 8, 2008).

[0320] Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. Nos. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example .alpha.-L-ribofuranose and .beta.-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

[0321] As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

[0322] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.

[0323] In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from --[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--, --C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--, and --N(R.sub.a)--; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl (S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and

[0324] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.

[0325] In certain embodiments, the bridge of a bicyclic sugar moiety is, --[C(R.sub.a)(R.sub.b)].sub.n--, --[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O-- or --C(R.sub.aR.sub.b)--O--N(R)--. In certain embodiments, the bridge is 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2', 4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R)-2' and 4'-CH.sub.2--N(R)--O-2'- wherein each R is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0326] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-(CH.sub.2)--O-2' bridge, may be in the .alpha.-L configuration or in the .beta.-D configuration. Previously, .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0327] In certain embodiments, bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, .alpha.-L-4'-(CH.sub.2)--O-2', .beta.-D-4'-CH.sub.2--O-2', 4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R)-2', 4'-CH.sub.2--N(R)--O-2', 4'-CH(CH.sub.3)--O-2', 4'-CH.sub.2--S-2', 4'-CH.sub.2--N(R)-2', 4'-CH.sub.2--CH(CH.sub.3)-2', and 4'-(CH.sub.2).sub.3-2', wherein R is H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0328] In certain embodiment, bicyclic nucleosides have the formula:

##STR00002##

wherein:

[0329] Bx is a heterocyclic base moiety;

[0330] -Q.sub.a-Q.sub.b-Q.sub.c- is --CH.sub.2--N(R.sub.c)--CH.sub.2--, --C(.dbd.O)--N(R.sub.c)--CH.sub.2--, --CH.sub.2--O--N(R.sub.c)--, --CH.sub.2--N(R.sub.c)--O-- or N(R.sub.c)--O--CH.sub.2;

[0331] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and

[0332] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

[0333] In certain embodiments, bicyclic nucleosides have the formula:

##STR00003##

wherein:

[0334] Bx is a heterocyclic base moiety;

[0335] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0336] Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

[0337] In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ.sub.c, NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(.dbd.X)J.sub.c, and NJ.sub.eC(.dbd.X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.

[0338] In certain embodiments, bicyclic nucleosides have the formula:

##STR00004##

wherein:

[0339] Bx is a heterocyclic base moiety;

[0340] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0341] Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl (C(.dbd.O)--).

[0342] In certain embodiments, bicyclic nucleosides have the formula:

##STR00005##

wherein:

[0343] Bx is a heterocyclic base moiety;

[0344] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0345] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C2-C6 alkynyl;

[0346] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6 aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;

[0347] In certain embodiments, bicyclic nucleosides have the formula:

##STR00006##

wherein:

[0348] Bx is a heterocyclic base moiety;

[0349] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0350] q.sub.a, q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j, C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j, O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k, N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;

[0351] or q.sub.e and q.sub.f together are .dbd.C(q.sub.g)(q.sub.h);

[0352] q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0353] The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4'-CH.sub.2--O-2' bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

[0354] Analogs of various bicyclic nucleosides that have 4' to 2' bridging groups such as 4'-CH.sub.2--O-2' and 4'-CH.sub.2--S-2', have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

[0355] In certain embodiments, bicyclic nucleosides have the formula:

##STR00007##

wherein:

[0356] Bx is a heterocyclic base moiety;

[0357] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0358] each q.sub.i, q.sub.j, q.sub.k and q.sub.l is, independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl, OJT, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.jJ.sub.k, C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j, O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k, N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k; and

[0359] q.sub.i and q.sub.j or q.sub.l and q.sub.k together are .dbd.C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0360] One carbocyclic bicyclic nucleoside having a 4'-(CH.sub.2).sub.3-2' bridge and the alkenyl analog bridge 4'-CH.dbd.CH--CH.sub.2-2' have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0361] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA, (B) .beta.-D-methyleneoxy (4'-CH.sub.2--O-2') BNA, (C) ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) aminooxy (4'-CH.sub.2--O--N(R)-2') BNA, (E) oxyamino (4'-CH.sub.2--N(R)--O-2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H) methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl carbocyclic (4'-CH.sub.2--CH(CH.sub.3)-2') BNA, (J) propylene carbocyclic (4'-(CH.sub.2).sub.3-2') BNA, and (K) vinyl BNA as depicted below.

##STR00008## ##STR00009##

[0362] wherein Bx is the base moiety and R is, independently, H, a protecting group, C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy.

[0363] As used herein, the term "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate. Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.

##STR00010##

[0364] In certain embodiment, sugar surrogates are selected having the formula:

##STR00011##

wherein:

[0365] Bx is a heterocyclic base moiety;

[0366] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;

[0367] q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl; and

[0368] one of R.sub.1 and R.sub.2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0369] In certain embodiments, q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0370] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term "morpholino" means a sugar surrogate having the following formula:

##STR00012##

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0371] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0372] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.

##STR00013##

[0373] wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:

[0374] Bx is a heterocyclic base moiety;

[0375] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'- or 3'-terminal group; and

[0376] q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6, q.sub.7, q.sub.8 and q.sub.9 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or other sugar substituent group.

[0377] Many other monocyclic, bicyclic and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into oligomeric compounds as provided herein (see for example review article: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to further enhance their activity.

[0378] As used herein, "2'-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nF, O(CH.sub.2).sub.nONH.sub.2, OCH.sub.2C(.dbd.O)N(H)CH.sub.3, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: C.sub.1-C.sub.12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, F, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2' MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0379] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3, O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3, O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. 2'-modified nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

[0380] As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.

[0381] As used herein, "2'-OMe" or "2'-OCH.sub.3", "2'-O-methyl" or "2'-methoxy" each refers to a nucleoside comprising a sugar comprising an --OCH.sub.3 group at the 2' position of the sugar ring.

[0382] As used herein, "MOE" or "2'-MOE" or "2'-OCH.sub.2CH.sub.2OCH.sub.3" or "2'-O-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a --OCH.sub.2CH.sub.2OCH.sub.3 group at the 2' position of the sugar ring.

[0383] Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.

[0384] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

[0385] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0386] In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH.sub.3)--O-2') bridging group. In certain embodiments, the (4'-CH(CH.sub.3)--O-2') modified nucleosides are arranged throughout the wings of a gapmer motif.

Compositions and Methods for Formulating Pharmaceutical Compositions

[0387] Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0388] An antisense compound targeted to a C9ORF72 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C9ORF72 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

[0389] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0390] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

[0391] Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[0392] Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.

Cell Culture and Antisense Compounds Treatment

[0393] The effects of antisense compounds on the level, activity or expression of C9ORF72 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, Md.) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.

In Vitro Testing of Antisense Oligonucleotides

[0394] Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

[0395] In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.

[0396] One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0397] Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0398] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

[0399] Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

[0400] The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

[0401] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

[0402] Inhibition of levels or expression of a C9ORF72 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

[0403] Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

[0404] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.

[0405] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

[0406] Probes and primers are designed to hybridize to a C9ORF72 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, Calif.).

Strand Specific Semi-Quantitative PCR Analysis of Target RNA Levels

[0407] Analysis of specific, low abundance target RNA strand levels may be accomplished by reverse transcription, PCR, and gel densitometry analysis using the Gel Logic 200 Imaging System and Kodak MI software (Kodak Scientific Imaging Systems, Rochester, N.Y., USA) according to manufacturer's instructions.

[0408] RT-PCR reactions are carried out as taught in Ladd, P. D., et al, (Human Molecular Genetics, 2007, 16, 3174-3187) and in Sopher, B. L., et al, (Neuron, 2011, 70, 1071-1084) and such methods are well known in the art.

[0409] The PCR amplification products are loaded onto gels, stained with ethidium bromide, and subjected to densitometry analysis. Mean intensities from regions of interest (ROI) that correspond to the bands of interest in the gel are measured.

[0410] Gene (or RNA) target quantities obtained by PCR are normalized using the expression level of a housekeeping gene whose expression is constant, such as GAPDH. Expression of the housekeeping gene (or RNA) is analyzed and measured using the same methods as the target.

[0411] Probes and primers are designed to hybridize to a C9ORF72 nucleic acid. Methods for designing RT-PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

[0412] Antisense inhibition of C9ORF72 nucleic acids can be assessed by measuring C9ORF72 protein levels. Protein levels of C9ORF72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human C9ORF72 are commercially available.

In Vivo Testing of Antisense Compounds

[0413] Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of C9ORF72 and produce phenotypic changes, such as, improved motor function and respiration. In certain embodiments, motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In certain embodiments, respiration is measured by whole body plethysmograph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in C9ORF72 nucleic acid expression are measured.

Targeting C9ORF72

[0414] Antisense oligonucleotides described herein may hybridize to a C9ORF72 nucleic acid derived from either DNA strand. For example, antisense oligonucleotides described herein may hybridize to a C9ORF72 antisense transcript or a C9ORF72 sense transcript. Antisense oligonucleotides described herein may hybridize to a C9ORF72 nucleic acid in any stage of RNA processing. Described herein are antisense oligonucleotides that are complementary to a pre-mRNA or a mature mRNA. Additionally, antisense oligonucleotides described herein may hybridize to any element of a C9ORF72 nucleic acid. For example, described herein are antisense oligonucleotides that are complementary to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C9ORF72 nucleic acid.

[0415] In certain embodiments, antisense oligonucleotides described herein hybridize to all variants of C9ORF72 derived from the sense strand. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to certain variants of C9ORF72 derived from the sense strand. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to variants of C9ORF72 derived from the sense strand containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to pre-mRNA variants containing a hexanucleotide repeat. In certain embodiments, pre-mRNA variants of C9ORF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.

[0416] In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C9ORF72 derived from the sense strand. In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C9ORF72 derived from the sense strand equally. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of one or more variants of C9ORF72 derived from the sense strand. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of variants of C9ORF72 derived from the sense strand containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of pre-mRNA variants containing the hexanucleotide repeat. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of C9ORF72 pathogenic associated mRNA variants. In certain embodiments, pre-mRNA variants of C9ORF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG. In certain embodiments, the hexanucleotide repeat expansion forms C9ORF72 sense foci. In certain embodiments, antisense oligonucleotides described herein are useful for reducing C9ORF72 sense foci. C9ORF72 sense foci may be reduced in terms of percent of cells with foci as well as number of foci per cell.

C9OFF72 Features

[0417] Antisense oligonucleotides described herein may hybridize to any C9ORF72 nucleic acid at any state of processing within any element of the C9ORF72 gene. In certain embodiments, antisense oligonucleotides described herein may target the antisense transcript, e.g., SEQ ID NO: 13. In certain embodiments, antisense oligonucleotides described herein may hybridize to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1 d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10. For example, antisense oligonucleotides may target any of the exons characterized below in Tables 1-5 described below. Antisense oligonucleotides described herein may also target nucleic acids not characterized below and such nucleic acid may be characterized in GENBANK. Moreover, antisense oligonucleotides described herein may also target elements other than exons and such elements as characterized in GENBANK.

TABLE-US-00001 TABLE 1 Functional Segments for NM_001256054.1 (SEQ ID NO: 1) Start site Stop site in in reference reference mRNA mRNA to SEQ to SEQ Exon start stop ID ID Number site site NO: 2 NO: 2 exon 1C 1 158 1137 1294 exon 2 159 646 7839 8326 exon 3 647 706 9413 9472 exon 4 707 802 12527 12622 exon 5 803 867 13354 13418 exon 6 868 940 14704 14776 exon 7 941 1057 16396 16512 exon 8 1058 1293 18207 18442 exon 9 1294 1351 24296 24353 exon 10 1352 1461 26337 26446 exon 11 1462 3339 26581 28458

TABLE-US-00002 TABLE 2 Functional Segments for NM_018325.3 (SEQ ID NO: 4) Start site Stop site in in reference reference mRNA mRNA to SEQ to SEQ Exon start stop ID ID Number site site NO: 2 NO: 2 exon 1B 1 63 1510 1572 exon 2 64 551 7839 8326 exon 3 552 611 9413 9472 exon 4 612 707 12527 12622 exon 5 708 772 13354 13418 exon 6 773 845 14704 14776 exon 7 846 962 16396 16512 exon 8 963 1198 18207 18442 exon 9 1199 1256 24296 24353 exon 10 1257 1366 26337 26446 exon 11 1367 3244 26581 28458

TABLE-US-00003 TABLE 3 Functional Segments for NM_145005.5 (SEQ ID NO: 6) Start site Stop site in in reference reference mRNA mRNA to SEQ to SEQ Exon start stop ID ID Number site site NO: 2 NO: 2 exon 1A 1 80 1137 1216 exon 2 81 568 7839 8326 exon 3 569 628 9413 9472 exon 4 629 724 12527 12622 exon 5B 725 1871 13354 14500 (exon 5 into intron 5)

TABLE-US-00004 TABLE 4 Functional Segments for DB079375.1 (SEQ ID NO: 7) Start site Stop site in in reference reference mRNA mRNA to SEQ to SEQ Exon start stop ID ID Number site site NO: 2 NO: 2 exon 1E 1 35 1135 1169 exon 2 36 524 7839 8326 exon 3 (EST 525 562 9413 9450 ends before end of full exon)

TABLE-US-00005 TABLE 5 Functional Segments for BU194591.1 (SEQ ID NO: 8) Start site Stop site in in reference reference mRNA mRNA to SEQ to SEQ Exon start stop ID ID Number site site NO: 2 NO: 2 exon 1D 1 36 1241 1279 exon 2 37 524 7839 8326 exon 3 525 584 9413 9472 exon 4 585 680 12527 12622 exon 5B 681 798 13354 13465 (exon 5 into intron 5)

Certain Indications

[0418] In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk for developing a neurodegenerative disease, including, but not limited to, ALS or FTD. In certain embodiments, the individual has been identified as having a C9ORF72 associated disease. In certain embodiments, the individual has been identified as having a C9ORF72 hexanucleotide repeat expansion associated disease. In certain embodiments, provided herein are methods for prophylactically reducing C9ORF72 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a C9ORF72 nucleic acid.

[0419] In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a C9ORF72 nucleic acid is accompanied by monitoring of C9ORF72 levels in an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention.

[0420] In certain embodiments, administration of an antisense compound targeted to a C9ORF72 nucleic acid results in reduction of C9ORF72 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a C9ORF72 nucleic acid results in improved motor function and respiration in an animal. In certain embodiments, administration of a C9ORF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

[0421] In certain embodiments, administration of an antisense compound targeted to a C9ORF72 antisense transcript results in reduction of C9ORF72 antisense transcript expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a C9ORF72 antisense transcript results in improved motor function and respiration in an animal. In certain embodiments, administration of a C9ORF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of a C9ORF72 antisense compound reduces the number of cells with C9ORF72 antisense foci and/or the number of C9ORF72 antisense foci per cell.

[0422] In certain embodiments, administration of an antisense compound targeted to a C9ORF72 sense transcript results in reduction of a C9ORF72 sense transcript expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a C9ORF72 sense transcript results in improved motor function and respiration in an animal. In certain embodiments, administration of a C9ORF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of a C9ORF72 antisense compound reduces the number of cells with C9ORF72 sense foci and/or the number of C9ORF72 sense foci per cell.

[0423] In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to a C9ORF72 nucleic are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including ALS and FTD.

Certain Combination Therapies

[0424] In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to produce a synergistic effect.

[0425] In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.

[0426] In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include Riluzole (Rilutek), Lioresal (Lioresal), and Dexpramipexole.

[0427] In certain embodiments, pharmaceutical agents that may be co-administered with a C9ORF72 antisense transcript specific inhibitor described herein include, but are not limited to, an additional C9ORF72 inhibitor. In certain embodiments, the co-administered pharmaceutical agent is administered prior to administration of a pharmaceutical composition described herein. In certain embodiments, the co-administered pharmaceutical agent is administered following administration of a pharmaceutical composition described herein. In certain embodiments the co-administered pharmaceutical agent is administered at the same time as a pharmaceutical composition described herein. In certain embodiments the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.

[0428] In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In other embodiments, the co-administration results in effects that are additive of the effects of the compounds when administered alone. In certain embodiments, the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound.

Certain Human Therapeutics

[0429] The human C9ORF72 antisense transcript specific antisense compounds described herein are being evaluated as possible human therapeutics. Various parameters of potency, efficacy, and/or tolerability are being examined. Such parameters include in vitro inhibition of C9ORF72 antisense transcript; in vitro dose response (IC50); in vivo inhibition of C9ORF72 antisense transcript in a transgenic animal containing a human C9ORF72 transgene in relevant tissues (e.g., brain and/or spinal cord); and/or tolerability in mouse, rat, dog, and/or primate. Tolerability markers that may be measured include blood and serum chemistry parameters, CSF chemistry parameters, body and organ weights, general observations and/or behavioral tests, and/or biochemical markers such as GFAP and/or AIF 1. Acute or long term tolerability may be measured.

Certain Assays for Measuring C9ORF72 Antisense Transcripts

[0430] Certain assays described herein are directed to the reduction of C9ORF72 antisense transcript. Additional assays may be used to measure the reduction of C9ORF72 antisense transcript. Additional controls may be used as a baseline for measuring the reduction of C9ORF72 transcript.

Certain Hotspot Regions

1. Nucleobases 196-280 of SEQ ID NO: 13

[0431] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 196-280 of SEQ ID NO: 13. In certain embodiments, nucleobases 196-280 are a hotspot region. In certain embodiments, nucleobases 196-280 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0432] In certain embodiments, nucleobases 196-280 are targeted by the following ISIS numbers: 687280, 687281, 687282, 687283, 687284, 687285, 687286, 687287, 687288, 687289, 687290, 687291, 687292, and 687293.

[0433] In certain embodiments, nucleobases 196-280 are targeted by the following SEQ ID NOs: 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, and 82.

[0434] In certain embodiments, antisense oligonucleotides targeting nucleobases 196-280 achieve at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, or at least 73% reduction of C9ORF72 antisense transcript in vitro.

2. Nucleobases 286-315 of SEQ ID NO: 13

[0435] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 286-315 of SEQ ID NO: 13. In certain embodiments, nucleobases 286-315 are a hotspot region. In certain embodiments, nucleobases 286-315 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0436] In certain embodiments, nucleobases 286-315 are targeted by the following ISIS numbers: 687277, 687278, and 687279.

[0437] In certain embodiments, nucleobases 286-315 are targeted by the following SEQ ID NOs: 66, 67, and 68.

[0438] In certain embodiments, antisense oligonucleotides targeting nucleobases 286-315 achieve at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, or at least 64% reduction of C9ORF72 antisense transcript in vitro.

3. Nucleobases 321-415 of SEQ ID NO: 13

[0439] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 321-415 of SEQ ID NO: 13. In certain embodiments, nucleobases 321-415 are a hotspot region. In certain embodiments, nucleobases 321-415 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0440] In certain embodiments, nucleobases 321-415 are targeted by the following ISIS numbers: 687261, 687262, 687263, 687264, 687265, 687266, 687267, 687268, 687269, 687270, 687271, 687272, 687273, 687274, 687275, and 687276.

[0441] In certain embodiments, nucleobases 321-415 are targeted by the following SEQ ID NOs: 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65.

[0442] In certain embodiments, antisense oligonucleotides targeting nucleobases 321-415 achieve at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, or at least 70% reduction of C9ORF72 antisense transcript in vitro.

4. Nucleobases 451-516 of SEQ ID NO: 13

[0443] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 451-516 of SEQ ID NO: 13. In certain embodiments, nucleobases 451-516 are a hotspot region. In certain embodiments, nucleobases 451-516 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 16, 18, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers, 5-8-5 MOE gapmers, 4-8-4 MOE gapmers. In certain embodiments, each nucleoside of the antisense oligonucleotides is modified with a 2'-MOE substitution. In certain embodiments, the antisense oligonucleotides contain one or more inosine residues.

[0444] In certain embodiments, nucleobases 451-516 are targeted by the following ISIS numbers: 687255, 687256, 687257, 687258, 687259, 687260, 730389, 730390, 730391, 730392, 730393, 730394, 730395, 730396, 730397, 730398, 730399, 730400, 730401, 730402, 730403, 730404, 730405, 730406, 730407, 730408, 730409, 730410, 730411, 730412, 737821, 742033, 742034, and 742035.

[0445] In certain embodiments, nucleobases 451-516 are targeted by the following SEQ ID NOs: 44, 45, 46, 47, 48, 49, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 98, and 99.

[0446] In certain embodiments, antisense oligonucleotides targeting nucleobases 451-516 achieve at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, or at least 78% reduction of C9ORF72 antisense transcript in vitro.

5. Nucleobases 527-588 of SEQ ID NO: 13

[0447] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 527-588 of SEQ ID NO: 13. In certain embodiments, nucleobases 527-588 are a hotspot region. In certain embodiments, nucleobases 527-588 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0448] In certain embodiments, nucleobases 527-588 are targeted by the following ISIS numbers: 687247, 687248, 687249, 687250, 687251, 687252, 687253, and 687254.

[0449] In certain embodiments, nucleobases 527-588 are targeted by the following SEQ ID NOs: 36, 37, 38, 39, 40, 41, 42, and 43.

[0450] In certain embodiments, antisense oligonucleotides targeting nucleobases 527-588 achieve at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, or at least 73% reduction of C9ORF72 antisense transcript in vitro.

6. Nucleobases 608-636 of SEQ ID NO: 13

[0451] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 608-636 of SEQ ID NO: 13. In certain embodiments, nucleobases 608-636 are a hotspot region. In certain embodiments, nucleobases 608-636 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0452] In certain embodiments, nucleobases 608-636 are targeted by the following ISIS numbers: 687243, 687244, 687245, and 687246.

[0453] In certain embodiments, nucleobases 608-636 are targeted by the following SEQ ID NOs: 32, 33, 34, and 35.

[0454] In certain embodiments, antisense oligonucleotides targeting nucleobases 608-636 achieve at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, or at least 72% reduction of C9ORF72 antisense transcript in vitro.

7. Nucleobases 704-726 of SEQ ID NO: 13

[0455] In certain embodiments, antisense oligonucleotides are designed to target nucleobases 704-726 of SEQ ID NO: 13. In certain embodiments, nucleobases 704-726 are a hotspot region. In certain embodiments, nucleobases 704-726 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.

[0456] In certain embodiments, nucleobases 704-726 are targeted by the following ISIS numbers: 687241 and 687242.

[0457] In certain embodiments, nucleobases 704-726 are targeted by the following SEQ ID NOs: 30 and 31.

[0458] In certain embodiments, antisense oligonucleotides targeting nucleobases 704-726 achieve at least 19%, at least 20%, or at least 21% reduction of C9ORF72 antisense transcript in vitro.

EXAMPLES

Non-Limiting Disclosure and Incorporation by Reference

[0459] While certain compounds, compositions, and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of C9ORF72 Antisense Transcript with Oligonucleotides

[0460] Antisense oligonucleotides (ASOs) targeting the human C9ORF72 antisense transcript were made and tested for inhibition of target transcript expression in vitro. All of the ASOs in the table below except Isis Numbers 742033 and 742035 are 5-10-5 MOE gapmers with phosphorothioate internucleoside linkages throughout the gapmers. They are 20 nucleosides in length, with a central gap segment consisting of ten 2'-deoxynucleosides that is flanked by wing segments in the 5' direction and the 3' direction consisting of five nucleosides each. Each nucleoside in the 5' and 3' wing segments has a 2'-MOE modification. All cytosine residues throughout each gapmer are 5 methylcytosines. Isis No. 742033 is a 5-10-5 MOE gapmer with phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages arranged in order from 5' to 3': soooossssssssssooss. Isis No. 742035 is a 5-8-5 MOE gapmer with a central gap segment consisting of eight 2'-deoxynucleosides and internucleoside linkages arranged in order from 5' to 3': sooosssssssssooss. All cytosine residues in Isis Numbers 742033 and 742035 are 5-methylcytosines. Isis Numbers 742033 and 742035 also contain inosine residues, indicated by "I". In the table below, "Start" indicates the 5'-most nucleoside to which the gapmer is targeted in the target transcript sequence. "Stop" indicates the 3'-most nucleoside to which the gapmer is targeted in the target transcript sequence. Each gapmer listed in the table below is targeted to a putative antisense transcript sequence, designated herein as SEQ ID NO: 13. The sequence of SEQ ID NO: 13 is complementary to nucleotides 1159 to 1929 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleotides 27535000 to 27565000) except that SEQ ID NO: 13 has two more hexanucleotide repeats than SEQ ID NO: 2. The sequence of the hexanucleotide repeat is GGCCCC in SEQ ID NO: 13 and GGGGCC in SEQ ID NO: 2. Thus, SEQ ID NO: 13 is 12 nucleotides longer than nucleotides 1159 to 1929 of SEQ ID NO: 2, to which it is complementary. Isis No. 129700 is a negative control ASO that does not target the C9ORF72 antisense transcript.

[0461] bEND cells were cultured in 24 well plates at 45,000-50,000 cells/well 24 hours before the first of two transfections. The cells were first transfected with 0.2 .mu.g/well of a plasmid expressing the C9ORF72 antisense transcript (SEQ ID NO: 13) and 0.5 .mu.L Lipofectamine 2000 (Life Technologies, Carlsbad, Calif.) in OptiMEM medium. Four to six hours later, the media was replaced. 24 hours after the first transfection (18-20 hours after media replacement), the bEND cells were transfected with 25 nM of an ASO listed in the table below and 0.5 .mu.L Lipofectamine 2000 in OptiMEM medium or with no ASO. Just prior to transfection, ASOs comprising a GGGGCC repeat with or without guanosine to inosine substitutions (Isis Numbers 687258, 687259, 687260, 742033, and 742035) were heated at 90.degree. C. for five minutes, then placed on ice briefly before dilution in OptiMEM. Total RNA was isolated from the cells 24 hours after the second transfection using TRIzol (Life Technologies) according to the manufacturer's directions. Two DNase reactions were performed, one on the column during RNA purification, and one after purification using TURBO DNase (Life Technologies).

[0462] Strand specific RT-qPCR was performed on the isolated RNA to generate and amplify C9ORF72 antisense cDNA using one or two of three different primer sets, LTS01222, LTS01221, and C9ATS3'-1. The LTS01222 sequences are: RT primer: CGACTGGAGCACGAGGACACTGAAAAGATGACGCTTGGTGTGTCA (SEQ ID NO: 14), forward PCR primer: CCCACACCTGCTCTTGCTAGA (SEQ ID NO: 15), reverse PCR primer: CGACTGGAGCACGAGGACACTG (SEQ ID NO: 16), and probe: CCCAAAAGAGAAGCAACCGGGCA (SEQ ID NO: 17). The LTS01221 sequences are: RT primer: CGACTGGAGCACGAGGACACTGACGGCTGCCGGGAAGA (SEQ ID NO: 18), forward PCR primer: AGAAATGAGAGGGAAAGTAAAAATGC (SEQ ID NO: 19), reverse PCR primer: CGACTGGAGCACGAGGACACTG (SEQ ID NO: 20), and probe: AGGAGAGCCCCCGCTTCTACCCG (SEQ ID NO: 21). The C9ATS3'-1 sequences are: RT primer: CGACTGGAGCACGAGGACACTGACGCTGAGGGTGAACAAGAA (SEQ ID NO: 22), forward PCR primer: GAGTTCCAGAGCTTGCTACAG (SEQ ID NO: 23), reverse PCR primer: CGACTGGAGCACGAGGACACTG (SEQ ID NO: 24), and probe: CTGCGGTTGTTTCCCTCCTTGTTT (SEQ ID NO: 25). RT-qPCR was also performed on the isolated RNA using Express One-Step Superscript qRT-PCR Kit (Life Technologies, Carlsbad, Calif.) according to manufacturer's instructions to generate and amplify GAPDH cDNA, as a control, using forward PCR primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 26), reverse PCR primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 27), and probe: AAGGCCGAGAATGGGAAGCTTGTCATC (SEQ ID NO: 28). The resulting C9ORF72 antisense levels were normalized to GAPDH. These normalized values for C9ORF72 antisense transcript expression in cells treated with an ASO were then compared to the normalized values for C9ORF72 antisense transcript expression in control cells that were transfected with the C9ORF72 antisense plasmid but not an ASO. The results for each primer probe set are shown in the table below as percent inhibition of C9ORF72 antisense transcript expression relative to the control cells that were not transfected with an ASO. A result of 0% inhibition indicates that the C9ORF72 antisense transcript levels were equal to that of control cells that were not transfected with an ASO. A negative value for % inhibition indicates that the C9ORF72 antisense transcript levels were higher than that of control cells that were not transfected with an ASO. A result of "n/a" indicates that the corresponding primer probe set was not used to analyze the indicated sample. The results show that many ASOs inhibited human C9ORF72 antisense transcript expression. The absolute inhibition results varied across different primer probe sets, but the relative potencies of the ASOs were very similar across different primer probe sets.

TABLE-US-00006 TABLE 6 C9ORF72 Antisense RNA Inhibition by Antisense Oligonucleotides SEQ Isis LTS LTS C9AT ID No. Start Stop Sequence 01222 01221 S3'-1 No. 129700 n/a n/a TAGTGCGGACCTACCCACGA 98 92 101 29 687241 707 726 GGTGTGTCAGCCGTCCCTGC n/a 19 21 30 687242 704 723 GTGTCAGCCGTCCCTGCTGC n/a -44 -1 31 687243 617 636 TGTTTTTCCCACCCTCTCTC 70 20 n/a 32 687244 614 633 TTTTCCCACCCTCTCTCCCC 68 21 n/a 33 687245 611 630 TCCCACCCTCTCTCCCCACT 72 -5 n/a 34 687246 608 627 CACCCTCTCTCCCCACTACT 59 17 n/a 35 687247 569 588 GAGGGTGAACAAGAAAAGAC 71 51 n/a 36 687248 557 576 GAAAAGACCTGATAAAGATT 50 30 n/a 37 687249 542 561 AGATTAACCAGAAGAAAACA 54 21 n/a 38 687250 539 558 TTAACCAGAAGAAAACAAGG 63 35 n/a 39 687251 536 555 ACCAGAAGAAAACAAGGAGG 73 41 n/a 40 687252 533 552 AGAAGAAAACAAGGAGGGAA 44 33 n/a 41 687253 530 549 AGAAAACAAGGAGGGAAACA 68 47 n/a 42 687254 527 546 AAACAAGGAGGGAAACAACC 57 33 n/a 43 687255 497 516 GCAAGCTCTGGAACTCAGGA 51 n/a n/a 44 687256 494 513 AGCTCTGGAACTCAGGAGTC 57 n/a n/a 45 687257 483 502 TCAGGAGTCGCGCGCTAGGG 68 n/a n/a 46 687258 480 499 GGAGTCGCGCGCTAGGGGCC 54 n/a n/a 47 687259 477 496 GTCGCGCGCTAGGGGCCGGG 63 n/a n/a 48 687260 474 493 GCGCGCTAGGGGCCGGGGCC 44 n/a n/a 49 687261 396 415 GGGCTGCGGTTGCGGTGCCT 58 n/a 56 50 687262 391 410 GCGGTTGCGGTGCCTGCGCC 55 n/a 55 51 687263 386 405 TGCGGTGCCTGCGCCCGCGG 51 n/a 53 52 687264 381 400 TGCCTGCGCCCGCGGCGGCG 40 n/a 35 53 687265 376 395 GCGCCCGCGGCGGCGGAGGC 16 n/a 15 54 687266 371 390 CGCGGCGGCGGAGGCGCAGG 45 n/a 40 55 687267 366 385 CGGCGGAGGCGCAGGCGGTG 46 n/a 45 56 687268 361 380 GAGGCGCAGGCGGTGGCGAG 29 n/a 39 57 687269 356 375 GCAGGCGGTGGCGAGTGGGT 51 n/a 52 58 687270 351 370 CGGTGGCGAGTGGGTGAGTG 56 n/a 55 59 687271 346 365 GCGAGTGGGTGAGTGAGGAG 70 n/a 69 60 687272 341 360 TGGGTGAGTGAGGAGGCGGC 69 n/a 69 61 687273 336 355 GAGTGAGGAGGCGGCATCCT 56 n/a 51 62 687274 331 350 AGGAGGCGGCATCCTGGCGG 49 n/a 46 63 687275 326 345 GCGGCATCCTGGCGGGTGGC 54 n/a 51 64 687276 321 340 ATCCTGGCGGGTGGCTGTTT 66 n/a 64 65 687277 296 315 TCGGCTGCCGGGAAGAGGCG 62 n/a 64 66 687278 291 310 TGCCGGGAAGAGGCGCGGGT 46 n/a 41 67 687279 286 305 GGAAGAGGCGCGGGTAGAAG 6 n/a 8 68 687280 261 280 GCTCTCCTCAGAGCTCGACG 48 n/a 50 69 687281 256 275 CCTCAGAGCTCGACGCATTT 48 n/a 48 70 687282 251 270 GAGCTCGACGCATTTTTACT 57 n/a 55 71 687283 246 265 CGACGCATTTTTACTTTCCC 66 n/a 62 72 687284 241 260 CATTTTTACTTTCCCTCTCA 66 n/a 67 73 687285 236 255 TTACTTTCCCTCTCATTTCT 64 n/a 61 74 687286 231 250 TTCCCTCTCATTTCTCTGAC 60 n/a 56 75 687287 226 245 TCTCATTTCTCTGACCGAAG 64 n/a 45 76 687288 221 240 TTTCTCTGACCGAAGCTGGG 70 n/a 67 77 687289 216 235 CTGACCGAAGCTGGGTGTCG 71 n/a 66 78 687290 211 230 CGAAGCTGGGTGTCGGGCTT 64 n/a 65 79 687291 206 225 CTGGGTGTCGGGCTTTCGCC 73 n/a 68 80 687292 201 220 TGTCGGGCTTTCGCCTCTAG 66 n/a 67 81 687293 196 215 GGCTTTCGCCTCTAGCGACT 70 n/a 71 82 742033 456 475 CCGGGICCGIGGCCIGGGCC 74 36 50 83 462 481 742035 454 471 GGCCGIGGCCGGIGCCGG 37 n/a 18 84 460 477 466 483

Example 2: Dose Dependent Inhibition of C9ORF72 Antisense Transcript with an Oligonucleotide Targeting a Hexanucleotide Repeat

[0463] Isis No. 742033 (see Example 1) was tested for dose dependent inhibition of C9ORF72 antisense transcript expression in vitro. bEND cells were cultured and treated as described in Example 1. During the second transfection, cells received Isis No. 742033 at a concentration listed in the table below or they received no ASO as a control. Total RNA was isolated and analyzed as described in Example 1 using primer probe set C9ATS3'-1.

TABLE-US-00007 TABLE 7 C9ORF72 Antisense RNA Inhibition by Isis No. 742033 Concentration of Isis No. 742033 (nM) % Inhibition 3.125 39 6.25 65 12.5 68 25.0 72

Example 3: Antisense Inhibition of C9ORF72 Antisense Transcript with Oligonucleotides

[0464] Antisense oligonucleotides (ASOs) targeting the human C9ORF72 antisense transcript were made and tested for inhibition of C9ORF72 antisense transcript expression in vitro. ASOs 730401-730406 in the table below are 5-8-5 MOE gapmers with phosphorothioate internucleoside linkages throughout the gapmers. ASOs 730407-730412 in the table below are 4-8-4 MOE gapmers with phosphorothioate internucleoside linkages throughout the gapmers. ASOs 730401-730412 all have a central gap segment consisting of eight 2'-deoxynucleosides that is flanked by wing segments in the 5' direction and the 3' direction consisting of four or five nucleosides each. Each nucleoside in the 5' and 3' wing segments has a 2'-MOE modification. All cytosine residues throughout each gapmer are 5-methylcytosines. In the table below, "Start" indicates the 5'-most nucleoside to which the gapmer is targeted in the target transcript sequence. "Stop" indicates the 3'-most nucleoside to which the gapmer is targeted in the target transcript sequence. Each gapmer listed in the table below is targeted to a putative antisense transcript sequence, designated herein as SEQ ID NO: 13. The sequence of SEQ ID NO: 13 is complementary to nucleotides 1159 to 1929 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleotides 27535000 to 27565000) except that SEQ ID NO: 13 has two more hexanucleotide repeats than SEQ ID NO: 2. The sequence of the hexanucleotide repeat is GGCCCC in SEQ ID NO: 13 and GGGGCC in SEQ ID NO: 2. Thus, SEQ ID NO: 13 is 12 nucleotides longer than nucleotides 1159 to 1929 of SEQ ID NO: 2, to which it is complementary. Isis No. 129700 is a negative control ASO that does not target the C9ORF72 antisense transcript, and 742035 was included for comparison, as it was described and tested in Example 1.

[0465] bEND cells were cultured and treated as described in Example 1. Strand specific RT-qPCR was performed on the isolated RNA, as described in Example 1, using the primer sets LTS01222 and LTS01221. The resulting normalized C9ORF72 antisense levels were then compared to the normalized values for C9ORF72 antisense transcript expression in control cells that were transfected with the C9ORF72 antisense plasmid but not an ASO. The results for each primer probe set are shown in the table below as percent inhibition of C9ORF72 antisense transcript expression relative to the control cells that were not transfected with an ASO. The values in the table below are the averages of two separate experiments. A result of 0% inhibition indicates that the C9ORF72 antisense transcript levels were equal to that of control cells that were not transfected with an ASO. A negative value for % inhibition indicates that the C9ORF72 antisense transcript levels were higher than that of control cells that were not transfected with an ASO. A result of "n/a" indicates that the corresponding primer probe set was not used to analyze the indicated sample. The results show that many ASOs inhibited human C9ORF72 antisense transcript expression. The absolute inhibition results varied across different primer probe sets, but the relative potencies of the ASOs were similar across different primer probe sets.

TABLE-US-00008 TABLE 8 Inhibition of C9ORF72 Antisense Transcript by Antisense Oligonucleotides SEQ Isis LTS LTS ID No. Start Stop Sequence 01222 01221 No. 129700 n/a n/a TAGTGCGGACCTACCCACGA 11 11 29 730401 456 473 GGGGCCGGGGCCGGGGCC 71 38 85 462 479 468 485 730402 451 468 CGGGGCCGGGGCCGGGGC 67 10 86 457 474 463 480 730403 452 469 CCGGGGCCGGGGCCGGGG 64 21 87 458 475 464 481 730404 459 476 GCCGGGGCCGGGGCCGGG 65 34 88 465 482 730405 454 471 GGCCGGGGCCGGGGCCGG 49 22 89 460 477 466 483 730406 455 472 GGGCCGGGGCCGGGGCCG 41 12 90 461 478 467 484 730407 456 471 GGCCGGGGCCGGGGCC 78 44 91 462 477 468 483 730408 451 466 GGGCCGGGGCCGGGGC 68 24 92 457 472 463 478 469 484 730409 452 467 GGGGCCGGGGCCGGGG 66 38 93 458 473 464 479 470 485 730410 453 468 CGGGGCCGGGGCCGGG 67 38 94 459 474 465 480 730411 454 469 CCGGGGCCGGGGCCGG 63 16 95 460 475 466 481 730412 455 470 GCCGGGGCCGGGGCCG 73 38 96 461 476 467 482 742035 454 471 GGCCGIGGCCGGIGCCGG 68 32 84 460 477 466 483

Example 4: Antisense Inhibition of C9ORF72 Antisense Transcript with Oligonucleotides

[0466] Antisense oligonucleotides (ASOs) described in Example 1 were tested for inhibition of C9ORF72 antisense transcript expression in vitro using a cell line in which a CMV promoter was installed to drive the expression of the endogenous C9ORF72 antisense gene via CRISPR/Cas9 technology.

[0467] The targeting portion of a single guide RNA (sgRNA) of the sequence 5'-GACAAGGGTACGTAATCTGTC-3', designated herein as SEQ ID NO: 97, was designed to target a site 1,020 base pairs downstream of the C9ORF72 hexanucleotide repeat. An NGG PAM motif is present at the 3' end of the target site. The targeting portion of the sgRNA was inserted into a dual-expression plasmid to generate the full-length sgRNA of the sequence: 5'-GACAAGGGTACGTAATCTGTCTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT-3', designated herein as SEQ ID NO.: 101 and Cas9 nuclease.

[0468] The donor plasmid, containing a 922 base pair 5' homology arm, reverse CMV (CMVr), and 988 base pair 3' homology arm, was generated in pCR4 (Life Technologies) backbone plasmid by Gibson Assembly. The homology arm sequences were designed to center around the CRISPR/Cas9 cleavage site and were constructed using PCR primers: 5'-TAGTCCTGCAGGTTTAAACGAATTCGTGAGTGAGGAGGCGGCA-3', forward primer, SEQ ID NO: 102, and 5'-AGCAGAGCTCAGATTACGTACCCTTGTTGTGAACAAC-3', reverse primer, SEQ ID NO: 103, for the 5' arm; and 5'-CAATGTCAACGTCTGGCATTACTTCTACTTTTG-3', forward primer, SEQ ID NO: 104, and 5'-TAGGGCGAATTGAATTTAGCGGCCGCACTGGCAGGATCATAGC-3', reverse primer, SEQ ID NO: 105, for the 3' arm. The CMVr sequence was amplified from pCDNA3.1 using PCR primers: 5'-TACGTAATCTGAGCTCTGCTTATATAGACC-3', forward primer, SEQ ID NO: 106, and 5'-AATGCCAGACGTTGACATTGATTATTGACTAGTTATTAATAG-3', reverse primer, SEQ ID NO: 107.

[0469] Neuroblast SH-SY5Y cells (Sigma-Aldrich) were cultured in a 1:1 mixture of MEM:F-12 (Life Technologies) supplemented with 10% FBS, 25 mM HEPES and Antibiotic-Antimycotic. C9orf72 CRISPR/Cas9 activity was assessed by measuring indel frequency using SURVEYOR mutation detection assay (Integrated DNA Technologies) with forward primer: 5'-GTTAGGCTCTGGGAGAGTAGTTG-3', SEQ ID NO: 108, and reverse primer: 5'-CCTGGAGCAGGTAAATGCTGG-3', SEQ ID NO: 109. To generate SH-SY5Y cells expressing C9orf72 antisense transcript, SH-SY5Y cells were transfected with a plasmid expressing C9ORF72 CRISPR sgRNA and Cas9 and with a CMVr donor plasmid. Furthermore, the cells were co-transfected with a plasmid expressing EGFP, then single-cell sorted by FACS into 96-well plates. RT-qPCR was performed to screen for increased C9ORF72 antisense RNA. Positive clones were isolated and validated by PCR using primers inside CMVr and outside the 5' and 3' arms, respectively. Amplicons were further validated by sequencing to confirm on-target insertion of CMVr. Confirmation of single or double allele targeting was obtained by PCR with primers used in the SURVEYOR assay. Sequencing showed that the C9ORF72 antisense transcript contains 2 full hexanucleotide repeats.

[0470] The engineered SH-SY5Y cells were plated at 30,000 cells per well and electroporated at 140V with 10 .mu.M ASO. 24 hours later cells were lysed. Strand specific RT-qPCR was performed on the isolated RNA, as described in Example 1, using the primer probe sets LTS01221 or C9ATS3'-1. The resulting normalized C9ORF72 antisense levels were then compared to the normalized values for C9ORF72 antisense transcript expression in control cells that were transfected with neither the C9ORF72 antisense plasmid nor an ASO. The results for each primer probe set are shown in the table below as percent inhibition of C9ORF72 antisense transcript expression relative to the control cells. A result of 0% inhibition indicates that the C9ORF72 antisense transcript levels were equal to that of control cells that were not transfected with an ASO. A negative value for % inhibition indicates that the C9ORF72 antisense transcript levels were higher than that of control cells that were not transfected with an ASO. A result of "n/a" indicates that the corresponding primer probe set was not used to analyze the indicated sample. The results show that many ASOs inhibited human C9ORF72 antisense transcript expression.

TABLE-US-00009 TABLE 9 Inhibition of C90RF72 Antisense Transcript by Antisense Oligonucleotides Isis No. LTS 01221 C9ATS3'-1 SEQ ID No. 129700 22 -4 29 687241 68 n/a 30 687242 60 n/a 31 687243 54 n/a 32 687244 47 n/a 33 687245 53 n/a 34 687246 52 n/a 35 687247 53 n/a 36 687248 14 n/a 37 687249 6 n/a 38 687250 12 n/a 39 687251 53 n/a 40 687252 32 n/a 41 687253 21 n/a 42 687254 20 n/a 43 687255 81 n/a 44 687256 78 n/a 45 687257 63 n/a 46 687258 54 n/a 47 687259 52 n/a 48 687260 23 n/a 49 687261 9 n/a 50 687262 41 n/a 51 687263 24 n/a 52 687264 42 n/a 53 687265 25 n/a 54 687266 51 n/a 55 687267 20 n/a 56 687268 24 n/a 57 687269 20 n/a 58 687270 36 n/a 59 687271 10 n/a 60 687272 47 n/a 61 687273 50 n/a 62 687274 66 n/a 63 687275 42 n/a 64 687276 48 n/a 65 687277 n/a 40 66 687278 n/a 38 67 687279 n/a -24 68 687280 n/a 60 69 687281 n/a 69 70 687282 n/a 32 71 687283 n/a 69 72 687284 n/a 47 73 687285 n/a 28 74 687286 n/a 67 75 687287 n/a 71 76 687288 n/a 65 77 687289 n/a 63 78 687290 62 48 79 687291 75 71 80 687292 77 68 81 687293 76 72 82 742033 6 26 83

Example 5: Dose Dependent Inhibition of C9ORF72 Antisense Transcript with Oligonucleotides

[0471] Isis Numbers 687241, 687255, 687256, 687280, 687281, 687283, 687286, 687287, 687288, 687289, 687291, 687292, and 687293 (see Example 1) were tested for dose dependent inhibition of C9ORF72 antisense transcript expression in vitro. The SH-SY5Y cells described in Example 4 were cultured at 30,000 cells per well and electroporated at 140 V treated with an oligonucleotide at a concentration listed in the tables below or they received no ASO as a control. 24 hours after electroporation, cells were lysed and total RNA was isolated and analyzed by RT-qPCR using primer probe set LTS01221 (Tables 10 and 11) or C9ATS3'-1 (Table 12). The results are shown below for each antisense oligonucleotide concentration, and half maximal inhibitory concentrations were calculated using Prism software (Graphpad).

TABLE-US-00010 TABLE 10 Dose Dependent C9ORF72 Antisense Transcript Inhibition Concentration % IC.sub.50 Isis No. (.mu.M) Inhibition (.mu.M) 687241 0.625 -5 3.49 1.25 17 2.5 34 5 52 10 66 20 54 687291 0.625 20 3.17 1.25 15 2.5 31 5 47 10 67 20 71

TABLE-US-00011 TABLE 11 Dose Dependent C9ORF72 Antisense Transcript Inhibition Dose % IC.sub.50 Isis No. (nM) Inhibition (.mu.M) 687255 0.625 9 2.34 1.25 20 2.5 39 5 57 10 62 20 69 687256 0.625 15 2.78 1.25 19 2.5 37 5 46 10 56 20 68 687291 0.625 24 1.72 1.25 24 2.5 41 5 63 10 62 20 70

TABLE-US-00012 TABLE 12 Dose Dependent C9ORF72 Antisense Transcript Inhibition Dose % IC.sub.50 Isis No. (nM) Inhibition (.mu.M) 687280 0.625 19 2.87 1.25 18 2.5 39 5 61 10 69 20 66 687281 0.625 13 5.21 1.25 12 2.5 26 5 39 10 60 20 69 687283 0.625 16 4.98 1.25 31 2.5 23 5 38 10 53 20 70 687286 0.625 -5 4.31 1.25 8 2.5 29 5 51 10 65 20 71 687287 0.625 5 3.10 1.25 24 2.5 25 5 64 10 73 20 85 687288 0.625 10 3.52 1.25 12 2.5 31 5 58 10 66 20 78 687289 0.625 14 5.43 1.25 14 2.5 23 5 43 10 61 20 60 687291 0.625 23 2.09 1.25 33 2.5 35 5 67 10 75 20 77 687292 0.625 19 3.94 1.25 11 2.5 25 5 56 10 68 20 65 687293 0.625 23 2.15 1.25 25 2.5 44 5 63 10 77 20 75

Example 6: Effect of Antisense Oligonucleotides Targeting C9ORF72 Antisense Transcript on RNA Foci

[0472] Antisense oligonucleotides described above and those described in the tables below can be tested for their effects on C9ORF72 antisense foci in C9ORF72 ALS/FTD patient fibroblast lines. The antisense oligonucleotides listed in Tables 13 and 14 below target the hexanucleotide repeat of the C9ORF72 antisense transcript. Each nucleoside of the antisense oligonucleotides in Table 13 below is modified with a 2'-MOE substitution. All of the cytosines are 5-methylcytosines, and all of the internucleoside linkages are phosphorothioate linkages. The motifs and internucleoside linkages of the oligonucleotides in Table 14 are shown in the table. The substitution or lack thereof at the 2'-position of each nucleoside is denoted as "d", meaning 2'-deoxy, or "e", meaning 2'-MOE. Each internucleoside linkage is denoted as "o", meaning phosphodiester, or "s", meaning phosphorothioate. All of the cytosines in Table 14 are 5-methylcytosines. The oligonucleotides in Table 14 also contain inosine residues, indicated by "I".

TABLE-US-00013 TABLE 13 Fully modified antisense oligonucleotides targeting the antisense transcript of C9ORF72 SEQ ID Isis No. Sequence No. 730389 GGGGCCGGGGCCGGGGCC 85 730390 CGGGGCCGGGGCCGGGGC 86 730391 CCGGGGCCGGGGCCGGGG 87 730392 GCCGGGGCCGGGGCCGGG 88 730393 GGCCGGGGCCGGGGCCGG 89 730394 GGGCCGGGGCCGGGGCCG 90 730395 GGCCGGGGCCGGGGCC 91 730396 GGGCCGGGGCCGGGGC 92 730397 GGGGCCGGGGCCGGGG 93 730398 CGGGGCCGGGGCCGGG 94 730399 CCGGGGCCGGGGCCGG 95 730400 GCCGGGGCCGGGGCCG 96

TABLE-US-00014 TABLE 14 Antisense oligonucleotides targeting the antisense transcript of C9ORF72 SEQ Isis Internucleoside ID No. Sequence (5' to 3') Motif (5' to 3') linkages (5' to 3') No. 737821 CCGIGGCCGIGGCCGIGGCC eeedeeeeedeeeeedeeee ssososssososssososs 98 742034 GGCCGIGGCCGIGGCCGG eeeeedeeeeedeeeeee ssssososssosossss 99

[0473] C9ORF72 antisense foci are visualized using fluorescent in situ hybridization with a fluorescently labeled Locked Nucleic Acid (LNA) probe targeting the hexanucleotide repeat containing C9ORF72 antisense transcript (Exiqon, Inc. Woburn Mass.). The sequence of the probe is presented in the table below. The probe was labeled with fluorescent 5' TYE-563. A 5' TYE-563-labeled fluorescent probe targeting CUG repeats is used as a negative control.

TABLE-US-00015 TABLE 15 LNA probes to the C9ORF72 antisense transcript containing the hexanucleotide repeat SEQ Description ID Target of probe Sequence NO GGCCCC Repeat Fluorescent TYE563- 93 of the LNA Probe GGGGCCGGGGCCGGGG Antisense Transcript CUG Repeat Fluorescent TYE563- 100 LNA Probe CAGCAGCAGCAGCAGCAGC

[0474] All hybridization steps were performed under RNase-free conditions. Patient fibroblast cells were plated into chamber slides. 24 hours later, they were washed in PBS and transfected with 25 nM of an Isis antisense oligonucleotide in the table below or a negative control ASO that does not target any C9ORF72 RNA using 1 .mu.l/ml Cytofectin transfection reagent (Genlantis, San Diego, Cat #T610001). Cells were incubated for 4 hours at 37.degree. C. and 5% CO.sub.2, before the medium was replaced with Dulbecco's modified Eagle medium (DMEM) supplemented with 20% tetracycline-free FBS and 2% penicillin/streptomycin and 1% amphotericin B. 24 hours after transfection, the cells were fixed in 4% PFA, then immediately permeabilized in 0.2% Triton X-100 (Sigma Aldrich #T-8787) in PBS for 10 minutes, washed twice in PBS for 5 minutes, dehydrated with ethanol, and air dried. The slides were heated in 400 .mu.L hybridization buffer (50% deionized formamide, 2.times.SCC, 50 mM Sodium Phosphate, pH 7, and 10% dextran sulphate) at 66.degree. C. for 20-60 minutes under floating RNase-free coverslips in a chamber humidified with hybridization buffer. Probes were denatured at 80.degree. C. for 75 seconds and returned immediately to ice before diluting with hybridization buffer (40 nM final concentration). The incubating buffer was replaced with the probe-containing mix (400 .mu.L per slide), and slides were hybridized under floating coverslips for 12-16 hours in a sealed, light-protected chamber.

[0475] After hybridization, floating coverslips were removed and slides were washed at room temperature in 0.1% Tween-20/2X SCC for 5 minutes before being subjected to three 10-minute stringency washes in 0.1.times.SCC at 65.degree. C. The slides were then dehydrated through ethanol and air dried.

[0476] Primary visualization for quantification and imaging of foci was performed at 100.times. magnification using a Nikon Eclipse Ti confocal microscope system equipped with a Nikon CFI Apo TIRF 100X Oil objective (NA 1.49). Most foci are intra-nuclear but are also occasionally found in the cytoplasm. Treatment with RNase A, but not DNase I, eliminated the C9ORF72 antisense foci, demonstrating that they are comprised primarily of RNA. The foci in the fibroblasts were counted, and the data is presented in the table below as the number of foci per positive cell and the number of foci per cell overall. (A positive cell is a cell that has at least one focus.) The data in the table below show that treatment with the antisense oligonucleotides targeting the antisense C9ORF72 transcript, listed in the table below, decreased both the number of cells with at least one focus (foci per cell) and the number of foci within cells that still had at least one focus (foci per positive cell).

TABLE-US-00016 TABLE 16 Antisense C9ORF72 foci in patient fibroblasts Foci Foci Isis No. per positive cell per cell Negative 2.99 1.50 control ASO 737821 2.73 1.00 742033 1.68 0.46 742034 1.38 0.22 742035 1.69 0.53

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 109 <210> SEQ ID NO 1 <211> LENGTH: 3339 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 acgtaaccta cggtgtcccg ctaggaaaga gaggtgcgtc aaacagcgac aagttccgcc 60 cacgtaaaag atgacgcttg gtgtgtcagc cgtccctgct gcccggttgc ttctcttttg 120 ggggcggggt ctagcaagag caggtgtggg tttaggagat atctccggag catttggata 180 atgtgacagt tggaatgcag tgatgtcgac tctttgccca ccgccatctc cagctgttgc 240 caagacagag attgctttaa gtggcaaatc acctttatta gcagctactt ttgcttactg 300 ggacaatatt cttggtccta gagtaaggca catttgggct ccaaagacag aacaggtact 360 tctcagtgat ggagaaataa cttttcttgc caaccacact ctaaatggag aaatccttcg 420 aaatgcagag agtggtgcta tagatgtaaa gttttttgtc ttgtctgaaa agggagtgat 480 tattgtttca ttaatctttg atggaaactg gaatggggat cgcagcacat atggactatc 540 aattatactt ccacagacag aacttagttt ctacctccca cttcatagag tgtgtgttga 600 tagattaaca catataatcc ggaaaggaag aatatggatg cataaggaaa gacaagaaaa 660 tgtccagaag attatcttag aaggcacaga gagaatggaa gatcagggtc agagtattat 720 tccaatgctt actggagaag tgattcctgt aatggaactg ctttcatcta tgaaatcaca 780 cagtgttcct gaagaaatag atatagctga tacagtactc aatgatgatg atattggtga 840 cagctgtcat gaaggctttc ttctcaatgc catcagctca cacttgcaaa cctgtggctg 900 ttccgttgta gtaggtagca gtgcagagaa agtaaataag atagtcagaa cattatgcct 960 ttttctgact ccagcagaga gaaaatgctc caggttatgt gaagcagaat catcatttaa 1020 atatgagtca gggctctttg tacaaggcct gctaaaggat tcaactggaa gctttgtgct 1080 gcctttccgg caagtcatgt atgctccata tcccaccaca cacatagatg tggatgtcaa 1140 tactgtgaag cagatgccac cctgtcatga acatatttat aatcagcgta gatacatgag 1200 atccgagctg acagccttct ggagagccac ttcagaagaa gacatggctc aggatacgat 1260 catctacact gacgaaagct ttactcctga tttgaatatt tttcaagatg tcttacacag 1320 agacactcta gtgaaagcct tcctggatca ggtctttcag ctgaaacctg gcttatctct 1380 cagaagtact ttccttgcac agtttctact tgtccttcac agaaaagcct tgacactaat 1440 aaaatatata gaagacgata cgcagaaggg aaaaaagccc tttaaatctc ttcggaacct 1500 gaagatagac cttgatttaa cagcagaggg cgatcttaac ataataatgg ctctggctga 1560 gaaaattaaa ccaggcctac actcttttat ctttggaaga cctttctaca ctagtgtgca 1620 agaacgagat gttctaatga ctttttaaat gtgtaactta ataagcctat tccatcacaa 1680 tcatgatcgc tggtaaagta gctcagtggt gtggggaaac gttcccctgg atcatactcc 1740 agaattctgc tctcagcaat tgcagttaag taagttacac tacagttctc acaagagcct 1800 gtgaggggat gtcaggtgca tcattacatt gggtgtctct tttcctagat ttatgctttt 1860 gggatacaga cctatgttta caatataata aatattattg ctatctttta aagatataat 1920 aataggatgt aaacttgacc acaactactg tttttttgaa atacatgatt catggtttac 1980 atgtgtcaag gtgaaatctg agttggcttt tacagatagt tgactttcta tcttttggca 2040 ttctttggtg tgtagaatta ctgtaatact tctgcaatca actgaaaact agagccttta 2100 aatgatttca attccacaga aagaaagtga gcttgaacat aggatgagct ttagaaagaa 2160 aattgatcaa gcagatgttt aattggaatt gattattaga tcctactttg tggatttagt 2220 ccctgggatt cagtctgtag aaatgtctaa tagttctcta tagtccttgt tcctggtgaa 2280 ccacagttag ggtgttttgt ttattttatt gttcttgcta ttgttgatat tctatgtagt 2340 tgagctctgt aaaaggaaat tgtattttat gttttagtaa ttgttgccaa ctttttaaat 2400 taattttcat tatttttgag ccaaattgaa atgtgcacct cctgtgcctt ttttctcctt 2460 agaaaatcta attacttgga acaagttcag atttcactgg tcagtcattt tcatcttgtt 2520 ttcttcttgc taagtcttac catgtacctg ctttggcaat cattgcaact ctgagattat 2580 aaaatgcctt agagaatata ctaactaata agatcttttt ttcagaaaca gaaaatagtt 2640 ccttgagtac ttccttcttg catttctgcc tatgtttttg aagttgttgc tgtttgcctg 2700 caataggcta taaggaatag caggagaaat tttactgaag tgctgttttc ctaggtgcta 2760 ctttggcaga gctaagttat cttttgtttt cttaatgcgt ttggaccatt ttgctggcta 2820 taaaataact gattaatata attctaacac aatgttgaca ttgtagttac acaaacacaa 2880 ataaatattt tatttaaaat tctggaagta atataaaagg gaaaatatat ttataagaaa 2940 gggataaagg taatagagcc cttctgcccc ccacccacca aatttacaca acaaaatgac 3000 atgttcgaat gtgaaaggtc ataatagctt tcccatcatg aatcagaaag atgtggacag 3060 cttgatgttt tagacaacca ctgaactaga tgactgttgt actgtagctc agtcatttaa 3120 aaaatatata aatactacct tgtagtgtcc catactgtgt tttttacatg gtagattctt 3180 atttaagtgc taactggtta ttttctttgg ctggtttatt gtactgttat acagaatgta 3240 agttgtacag tgaaataagt tattaaagca tgtgtaaaca ttgttatata tcttttctcc 3300 taaatggaga attttgaata aaatatattt gaaattttg 3339 <210> SEQ ID NO 2 <211> LENGTH: 30001 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 caaagaaaag ggggaggttt tgttaaaaaa gagaaatgtt acatagtgct ctttgagaaa 60 attcattggc actattaagg atctgaggag ctggtgagtt tcaactggtg agtgatggtg 120 gtagataaaa ttagagctgc agcaggtcat tttagcaact attagataaa actggtctca 180 ggtcacaacg ggcagttgca gcagctggac ttggagagaa ttacactgtg ggagcagtgt 240 catttgtcct aagtgctttt ctacccccta cccccactat tttagttggg tataaaaaga 300 atgacccaat ttgtatgatc aactttcaca aagcatagaa cagtaggaaa agggtctgtt 360 tctgcagaag gtgtagacgt tgagagccat tttgtgtatt tattcctccc tttcttcctc 420 ggtgaatgat taaaacgttc tgtgtgattt ttagtgatga aaaagattaa atgctactca 480 ctgtagtaag tgccatctca cacttgcaga tcaaaaggca cacagtttaa aaaacctttg 540 tttttttaca catctgagtg gtgtaaatgc tactcatctg tagtaagtgg aatctataca 600 cctgcagacc aaaagacgca aggtttcaaa aatctttgtg ttttttacac atcaaacaga 660 atggtacgtt tttcaaaagt taaaaaaaaa caactcatcc acatattgca actagcaaaa 720 atgacattcc ccagtgtgaa aatcatgctt gagagaattc ttacatgtaa aggcaaaatt 780 gcgatgactt tgcaggggac cgtgggattc ccgcccgcag tgccggagct gtcccctacc 840 agggtttgca gtggagtttt gaatgcactt aacagtgtct tacggtaaaa acaaaatttc 900 atccaccaat tatgtgttga gcgcccactg cctaccaagc acaaacaaaa ccattcaaaa 960 ccacgaaatc gtcttcactt tctccagatc cagcagcctc ccctattaag gttcgcacac 1020 gctattgcgc caacgctcct ccagagcggg tcttaagata aaagaacagg acaagttgcc 1080 ccgccccatt tcgctagcct cgtgagaaaa cgtcatcgca catagaaaac agacagacgt 1140 aacctacggt gtcccgctag gaaagagagg tgcgtcaaac agcgacaagt tccgcccacg 1200 taaaagatga cgcttggtgt gtcagccgtc cctgctgccc ggttgcttct cttttggggg 1260 cggggtctag caagagcagg tgtgggttta ggaggtgtgt gtttttgttt ttcccaccct 1320 ctctccccac tacttgctct cacagtactc gctgagggtg aacaagaaaa gacctgataa 1380 agattaacca gaagaaaaca aggagggaaa caaccgcagc ctgtagcaag ctctggaact 1440 caggagtcgc gcgctagggg ccggggccgg ggccggggcg tggtcggggc gggcccgggg 1500 gcgggcccgg ggcggggctg cggttgcggt gcctgcgccc gcggcggcgg aggcgcaggc 1560 ggtggcgagt gggtgagtga ggaggcggca tcctggcggg tggctgtttg gggttcggct 1620 gccgggaaga ggcgcgggta gaagcggggg ctctcctcag agctcgacgc atttttactt 1680 tccctctcat ttctctgacc gaagctgggt gtcgggcttt cgcctctagc gactggtgga 1740 attgcctgca tccgggcccc gggcttcccg gcggcggcgg cggcggcggc ggcgcaggga 1800 caagggatgg ggatctggcc tcttccttgc tttcccgccc tcagtacccg agctgtctcc 1860 ttcccgggga cccgctggga gcgctgccgc tgcgggctcg agaaaaggga gcctcgggta 1920 ctgagaggcc tcgcctgggg gaaggccgga gggtgggcgg cgcgcggctt ctgcggacca 1980 agtcggggtt cgctaggaac ccgagacggt ccctgccggc gaggagatca tgcgggatga 2040 gatgggggtg tggagacgcc tgcacaattt cagcccaagc ttctagagag tggtgatgac 2100 ttgcatatga gggcagcaat gcaagtcggt gtgctcccca ttctgtggga catgacctgg 2160 ttgcttcaca gctccgagat gacacagact tgcttaaagg aagtgactat tgtgacttgg 2220 gcatcacttg actgatggta atcagttgtc taaagaagtg cacagattac atgtccgtgt 2280 gctcattggg tctatctggc cgcgttgaac accaccaggc tttgtattca gaaacaggag 2340 ggaggtcctg cactttccca ggaggggtgg ccctttcaga tgcaatcgag attgttaggc 2400 tctgggagag tagttgcctg gttgtggcag ttggtaaatt tctattcaaa cagttgccat 2460 gcaccagttg ttcacaacaa gggtacgtaa tctgtctggc attacttcta cttttgtaca 2520 aaggatcaaa aaaaaaaaag atactgttaa gatatgattt ttctcagact ttgggaaact 2580 tttaacataa tctgtgaata tcacagaaac aagactatca tataggggat attaataacc 2640 tggagtcaga atacttgaaa tacggtgtca tttgacacgg gcattgttgt caccacctct 2700 gccaaggcct gccactttag gaaaaccctg aatcagttgg aaactgctac atgctgatag 2760 tacatctgaa acaagaacga gagtaattac cacattccag attgttcact aagccagcat 2820 ttacctgctc caggaaaaaa ttacaagcac cttatgaagt tgataaaata ttttgtttgg 2880 ctatgttggc actccacaat ttgctttcag agaaacaaag taaaccaagg aggacttctg 2940 tttttcaagt ctgccctcgg gttctattct acgttaatta gatagttccc aggaggacta 3000 ggttagccta cctattgtct gagaaacttg gaactgtgag aaatggccag atagtgatat 3060 gaacttcacc ttccagtctt ccctgatgtt gaagattgag aaagtgttgt gaactttctg 3120 gtactgtaaa cagttcactg tccttgaagt ggtcctgggc agctcctgtt gtggaaagtg 3180 gacggtttag gatcctgctt ctctttgggc tgggagaaaa taaacagcat ggttacaagt 3240 attgagagcc aggttggaga aggtggctta cacctgtaat gccagagctt tgggaggcgg 3300 aggcaagagg atcacttgaa gccaggagtt caagctcaac ctgggcaacg tagaccctgt 3360 ctctacaaaa aattaaaaac ttagccgggc gtggtgatgt gcacctgtag tcctagctac 3420 ttgggaggct gaggcaggag ggtcatttga gcccaagagt ttgaagttac cgagagctat 3480 gatcctgcca gtgcattcca gcctggatga caaaacgaga ccctgtctct aaaaaacaag 3540 aagtgagggc tttatgattg tagaattttc actacaatag cagtggacca accacctttc 3600 taaataccaa tcagggaaga gatggttgat tttttaacag acgtttaaag aaaaagcaaa 3660 acctcaaact tagcactcta ctaacagttt tagcagatgt taattaatgt aatcatgtct 3720 gcatgtatgg gattatttcc agaaagtgta ttgggaaacc tctcatgaac cctgtgagca 3780 agccaccgtc tcactcaatt tgaatcttgg cttccctcaa aagactggct aatgtttggt 3840 aactctctgg agtagacagc actacatgta cgtaagatag gtacataaac aactattggt 3900 tttgagctga tttttttcag ctgcatttgc atgtatggat ttttctcacc aaagacgatg 3960 acttcaagta ttagtaaaat aattgtacag ctctcctgat tatacttctc tgtgacattt 4020 catttcccag gctatttctt ttggtaggat ttaaaactaa gcaattcagt atgatctttg 4080 tccttcattt tctttcttat tctttttgtt tgtttgtttg tttgtttttt tcttgaggca 4140 gagtctctct ctgtcgccca ggctggagtg cagtggcgcc atctcagctc attgcaacct 4200 ctgccacctc cgggttcaag agattctcct gcctcagcct cccgagtagc tgggattaca 4260 ggtgtccacc accacacccg gctaattttt tgtattttta gtagaggtgg ggtttcacca 4320 tgttggccag gctggtcttg agctcctgac ctcaggtgat ccacctgcct cggcctacca 4380 aagagctggg ataacaggtg tgacccacca tgcccggccc attttttttt tcttattctg 4440 ttaggagtga gagtgtaact agcagtataa tagttcaatt ttcacaacgt ggtaaaagtt 4500 tccctataat tcaatcagat tttgctccag ggttcagttc tgttttagga aatactttta 4560 ttttcagttt aatgatgaaa tattagagtt gtaatattgc ctttatgatt atccaccttt 4620 ttaacctaaa agaatgaaag aaaaatatgt ttgcaatata attttatggt tgtatgttaa 4680 cttaattcat tatgttggcc tccagtttgc tgttgttagt tatgacagca gtagtgtcat 4740 taccatttca attcagatta cattcctata tttgatcatt gtaaactgac tgcttacatt 4800 gtattaaaaa cagtggatat tttaaagaag ctgtacggct tatatctagt gctgtctctt 4860 aagactatta aattgataca acatatttaa aagtaaatat tacctaaatg aatttttgaa 4920 attacaaata cacgtgttaa aactgtcgtt gtgttcaacc atttctgtac atacttagag 4980 ttaactgttt tgccaggctc tgtatgccta ctcataatat gataaaagca ctcatctaat 5040 gctctgtaaa tagaagtcag tgctttccat cagactgaac tctcttgaca agatgtggat 5100 gaaattcttt aagtaaaatt gtttactttg tcatacattt acagatcaaa tgttagctcc 5160 caaagcaatc atatggcaaa gataggtata tcatagtttg cctattagct gctttgtatt 5220 gctattatta taaatagact tcacagtttt agacttgctt aggtgaaatt gcaattcttt 5280 ttactttcag tcttagataa caagtcttca attatagtac aatcacacat tgcttaggaa 5340 tgcatcatta ggcgattttg tcattatgca aacatcatag agtgtactta cacaaaccta 5400 gatagtatag cctttatgta cctaggccgt atggtatagt ctgttgctcc taggccacaa 5460 acctgtacaa ctgttactgt actgaatact atagacagtt gtaacacagt ggtaaatatt 5520 tatctaaata tatgcaaaca gagaaaaggt acagtaaaag tatggtataa aagataatgg 5580 tatacctgtg taggccactt accacgaatg gagcttgcag gactagaagt tgctctgggt 5640 gagtcagtga gtgagtggtg aattaatgtg aaggcctaga acactgtaca ccactgtaga 5700 ctataaacac agtacgctga agctacacca aatttatctt aacagttttt cttcaataaa 5760 aaattataac tttttaactt tgtaaacttt ttaatttttt aacttttaaa atacttagct 5820 tgaaacacaa atacattgta tagctataca aaaatatttt ttctttgtat ccttattcta 5880 gaagcttttt tctattttct attttaaatt ttttttttta cttgttagtc gtttttgtta 5940 aaaactaaaa cacacacact ttcacctagg catagacagg attaggatca tcagtatcac 6000 tcccttccac ctcactgcct tccacctcca catcttgtcc cactggaagg tttttagggg 6060 caataacaca catgtagctg tcacctatga taacagtgct ttctgttgaa tacctcctga 6120 aggacttgcc tgaggctgtt ttacatttaa cttaaaaaaa aaaaaagtag aaggagtgca 6180 ctctaaaata acaataaaag gcatagtata gtgaatacat aaaccagcaa tgtagtagtt 6240 tattatcaag tgttgtacac tgtaataatt gtatgtgcta tactttaaat aacttgcaaa 6300 atagtactaa gaccttatga tggttacagt gtcactaagg caatagcata ttttcaggtc 6360 cattgtaatc taatgggact accatcatat atgcagtcta ccattgactg aaacgttaca 6420 tggcacataa ctgtatttgc aagaatgatt tgttttacat taatatcaca taggatgtac 6480 ctttttagag tggtatgttt atgtggatta agatgtacaa gttgagcaag gggaccaaga 6540 gccctgggtt ctgtcttgga tgtgagcgtt tatgttcttc tcctcatgtc tgttttctca 6600 ttaaattcaa aggcttgaac gggccctatt tagcccttct gttttctacg tgttctaaat 6660 aactaaagct tttaaattct agccatttag tgtagaactc tctttgcagt gatgaaatgc 6720 tgtattggtt tcttggctag catattaaat atttttatct ttgtcttgat acttcaatgt 6780 cgttttaaac atcaggatcg ggcttcagta ttctcataac cagagagttc actgaggata 6840 caggactgtt tgcccatttt ttgttatggc tccagacttg tggtatttcc atgtcttttt 6900 tttttttttt ttttttgacc ttttagcggc tttaaagtat ttctgttgtt aggtgttgta 6960 ttacttttct aagattactt aacaaagcac cacaaactga gtggctttaa acaacagcaa 7020 tttattctct cacaattcta gaagctagaa gtccgaaatc aaagtgttga caggggcatg 7080 atcttcaaga gagaagactc tttccttgcc tcttcctggc ttctggtggt taccagcaat 7140 cctgagtgtt cctttcttgc cttgtagttt caacaatcca gtatctgcct tttgtcttca 7200 catggctgtc taccatttgt ctctgtgtct ccaaatctct ctccttataa acacagcagt 7260 tattggatta ggccccactc taatccagta tgaccccatt ttaacatgat tacacttatt 7320 tctagataag gtcacattca cgtacaccaa gggttaggaa ttgaacatat ctttttgggg 7380 gacacaattc aacccacaag tgtcagtctc tagctgagcc tttcccttcc tgtttttctc 7440 ctttttagtt gctatgggtt aggggccaaa tctccagtca tactagaatt gcacatggac 7500 tggatatttg ggaatactgc gggtctattc tatgagcttt agtatgtaac atttaatatc 7560 agtgtaaaga agcccttttt taagttattt ctttgaattt ctaaatgtat gccctgaata 7620 taagtaacaa gttaccatgt cttgtaaaat gatcatatca acaaacattt aatgtgcacc 7680 tactgtgcta gttgaatgtc tttatcctga taggagataa caggattcca catctttgac 7740 ttaagaggac aaaccaaata tgtctaaatc atttggggtt ttgatggata tctttaaatt 7800 gctgaaccta atcattggtt tcatatgtca ttgtttagat atctccggag catttggata 7860 atgtgacagt tggaatgcag tgatgtcgac tctttgccca ccgccatctc cagctgttgc 7920 caagacagag attgctttaa gtggcaaatc acctttatta gcagctactt ttgcttactg 7980 ggacaatatt cttggtccta gagtaaggca catttgggct ccaaagacag aacaggtact 8040 tctcagtgat ggagaaataa cttttcttgc caaccacact ctaaatggag aaatccttcg 8100 aaatgcagag agtggtgcta tagatgtaaa gttttttgtc ttgtctgaaa agggagtgat 8160 tattgtttca ttaatctttg atggaaactg gaatggggat cgcagcacat atggactatc 8220 aattatactt ccacagacag aacttagttt ctacctccca cttcatagag tgtgtgttga 8280 tagattaaca catataatcc ggaaaggaag aatatggatg cataaggtaa gtgatttttc 8340 agcttattaa tcatgttaac ctatctgttg aaagcttatt ttctggtaca tataaatctt 8400 atttttttaa ttatatgcag tgaacatcaa acaataaatg ttatttattt tgcatttacc 8460 ctattagata caaatacatc tggtctgata cctgtcatct tcatattaac tgtggaaggt 8520 acgaaatggt agctccacat tatagatgaa aagctaaagc ttagacaaat aaagaaactt 8580 ttagaccctg gattcttctt gggagccttt gactctaata ccttttgttt ccctttcatt 8640 gcacaattct gtcttttgct tactactatg tgtaagtata acagttcaaa gtaatagttt 8700 cataagctgt tggtcatgta gcctttggtc tctttaacct ctttgccaag ttcccaggtt 8760 cataaaatga ggaggttgaa tggaatggtt cccaagagaa ttccttttaa tcttacagaa 8820 attattgttt tcctaaatcc tgtagttgaa tatataatgc tatttacatt tcagtatagt 8880 tttgatgtat ctaaagaaca cattgaattc tccttcctgt gttccagttt gatactaacc 8940 tgaaagtcca ttaagcatta ccagttttaa aaggcttttg cccaatagta aggaaaaata 9000 atatctttta aaagaataat tttttactat gtttgcaggc ttacttcctt ttttctcaca 9060 ttatgaaact cttaaaatca ggagaatctt ttaaacaaca tcataatgtt taatttgaaa 9120 agtgcaagtc attcttttcc tttttgaaac tatgcagatg ttacattgac tgttttctgt 9180 gaagttatct ttttttcact gcagaataaa ggttgttttg attttatttt gtattgttta 9240 tgagaacatg catttgttgg gttaatttcc tacccctgcc cccatttttt ccctaaagta 9300 gaaagtattt ttcttgtgaa ctaaattact acacaagaac atgtctattg aaaaataagc 9360 aagtatcaaa atgttgtggg ttgttttttt aaataaattt tctcttgctc aggaaagaca 9420 agaaaatgtc cagaagatta tcttagaagg cacagagaga atggaagatc aggtatatgc 9480 aaattgcata ctgtcaaatg tttttctcac agcatgtatc tgtataaggt tgatggctac 9540 atttgtcaag gccttggaga catacgaata agcctttaat ggagctttta tggaggtgta 9600 cagaataaac tggaggaaga tttccatatc ttaaacccaa agagttaaat cagtaaacaa 9660 aggaaaatag taattgcatc tacaaattaa tatttgctcc cttttttttt ctgtttgccc 9720 agaataaatt ttggataact tgttcatagt aaaaataaaa aaaattgtct ctgatatgtt 9780 ctttaaggta ctacttctcg aacctttccc tagaagtagc tgtaacagaa ggagagcata 9840 tgtacccctg aggtatctgt ctggggtgta ggcccaggtc cacacaatat ttcttctaag 9900 tcttatgttg tatcgttaag actcatgcaa tttacatttt attccataac tattttagta 9960 ttaaaatttg tcagtgatat ttcttaccct ctcctctagg aaaatgtgcc atgtttatcc 10020 cttggctttg aatgcccctc aggaacagac actaagagtt tgagaagcat ggttacaagg 10080 gtgtggcttc ccctgcggaa actaagtaca gactatttca ctgtaaagca gagaagttct 10140 tttgaaggag aatctccagt gaagaaagag ttcttcactt ttacttccat ttcctcttgt 10200 gggtgaccct caatgctcct tgtaaaactc caatatttta aacatggctg ttttgccttt 10260 ctttgcttct ttttagcatg aatgagacag atgatacttt aaaaaagtaa ttaaaaaaaa 10320 aaacttgtga aaatacatgg ccataataca gaacccaata caatgatctc ctttaccaaa 10380 ttgttatgtt tgtacttttg tagatagctt tccaattcag agacagttat tctgtgtaaa 10440 ggtctgactt aacaagaaaa gatttccctt tacccaaaga atcccagtcc ttatttgctg 10500 gtcaataagc agggtcccca ggaatggggt aactttcagc accctctaac ccactagtta 10560 ttagtagact aattaagtaa acttatcgca agttgaggaa acttagaacc aactaaaatt 10620 ctgcttttac tgggattttg ttttttcaaa ccagaaacct ttacttaagt tgactactat 10680 taatgaattt tggtctctct tttaagtgct cttcttaaaa atgttatctt actgctgaga 10740 agttcaagtt tgggaagtac aaggaggaat agaaacttaa gagattttct tttagagcct 10800 cttctgtatt tagccctgta ggattttttt tttttttttt ttttttggtg ttgttgagct 10860 tcagtgaggc tattcattca cttatactga taatgtctga gatactgtga atgaaatact 10920 atgtatgctt aaacctaaga ggaaatattt tcccaaaatt attcttcccg aaaaggagga 10980 gttgcctttt gattgagttc ttgcaaatct cacaacgact ttattttgaa caatactgtt 11040 tggggatgat gcattagttt gaaacaactt cagttgtagc tgtcatctga taaaattgct 11100 tcacagggaa ggaaatttaa cacggatcta gtcattattc ttgttagatt gaatgtgtga 11160 attgtaattg taaacaggca tgataattat tactttaaaa actaaaaaca gtgaatagtt 11220 agttgtggag gttactaaag gatggttttt ttttaaataa aactttcagc attatgcaaa 11280 tgggcatatg gcttaggata aaacttccag aagtagcatc acatttaaat tctcaagcaa 11340 cttaataata tggggctctg aaaaactggt taaggttact ccaaaaatgg ccctgggtct 11400 gacaaagatt ctaacttaaa gatgcttatg aagactttga gtaaaatcat ttcataaaat 11460 aagtgaggaa aaacaactag tattaaattc atcttaaata atgtatgatt taaaaaatat 11520 gtttagctaa aaatgcatag tcatttgaca atttcattta tatctcaaaa aatttactta 11580 accaagttgg tcacaaaact gatgagactg gtggtggtag tgaataaatg agggaccatc 11640 catatttgag acactttaca tttgtgatgt gttatactga attttcagtt tgattctata 11700 gactacaaat ttcaaaatta caatttcaag atgtaataag tagtaatatc ttgaaatagc 11760 tctaaaggga atttttctgt tttattgatt cttaaaatat atgtgctgat tttgatttgc 11820 atttgggtag attatacttt tatgagtatg gaggttaggt attgattcaa gttttcctta 11880 cctatttggt aaggatttca aagtcttttt gtgcttggtt ttcctcattt ttaaatatga 11940 aatatattga tgacctttaa caaatttttt ttatctcaaa ttttaaagga gatcttttct 12000 aaaagaggca tgatgactta atcattgcat gtaacagtaa acgataaacc aatgattcca 12060 tactctctaa agaataaaag tgagctttag ggccgggcat ggtcagaaat ttgacaccaa 12120 cctggccaac atggcgaaac cccgtctcta ctaaaaatac aaaaatcagc cgggcatggt 12180 ggcggcacct atagtcccag ctacttggga ggatgagaca ggagagtcac ttgaacctgg 12240 gaggagaggt tgcagtgagc tgagatcacg ccattgcact ccagcctgag caatgaaagc 12300 aaaactccat ctcaaaaaaa aaaaaagaaa agaaagaata aaagtgagct ttggattgca 12360 tataaatcct ttagacatgt agtagacttg tttgatactg tgtttgaaca aattacgaag 12420 tattttcatc aaagaatgtt attgtttgat gttattttta ttttttattg cccagcttct 12480 ctcatattac gtgattttct tcacttcatg tcactttatt gtgcagggtc agagtattat 12540 tccaatgctt actggagaag tgattcctgt aatggaactg ctttcatcta tgaaatcaca 12600 cagtgttcct gaagaaatag atgtaagttt aaatgagagc aattatacac tttatgagtt 12660 ttttggggtt atagtattat tatgtatatt attaatattc taattttaat agtaaggact 12720 ttgtcataca tactattcac atacagtatt agccacttta gcaaataagc acacacaaaa 12780 tcctggattt tatggcaaaa cagaggcatt tttgatcagt gatgacaaaa ttaaattcat 12840 tttgtttatt tcattacttt tataattcct aaaagtggga ggatcccagc tcttatagga 12900 gcaattaata tttaatgtag tgtcttttga aacaaaactg tgtgccaaag tagtaaccat 12960 taatggaagt ttacttgtag tcacaaattt agtttcctta atcatttgtt gaggacgttt 13020 tgaatcacac actatgagtg ttaagagata cctttaggaa actattcttg ttgttttctg 13080 attttgtcat ttaggttagt ctcctgattc tgacagctca gaagaggaag ttgttcttgt 13140 aaaaattgtt taacctgctt gaccagcttt cacatttgtt cttctgaagt ttatggtagt 13200 gcacagagat tgttttttgg ggagtcttga ttctcggaaa tgaaggcagt gtgttatatt 13260 gaatccagac ttccgaaaac ttgtatatta aaagtgttat ttcaacacta tgttacagcc 13320 agactaattt ttttattttt tgatgcattt tagatagctg atacagtact caatgatgat 13380 gatattggtg acagctgtca tgaaggcttt cttctcaagt aagaattttt cttttcataa 13440 aagctggatg aagcagatac catcttatgc tcacctatga caagatttgg aagaaagaaa 13500 ataacagact gtctacttag attgttctag ggacattacg tatttgaact gttgcttaaa 13560 tttgtgttat ttttcactca ttatatttct atatatattt ggtgttattc catttgctat 13620 ttaaagaaac cgagtttcca tcccagacaa gaaatcatgg ccccttgctt gattctggtt 13680 tcttgtttta cttctcatta aagctaacag aatcctttca tattaagttg tactgtagat 13740 gaacttaagt tatttaggcg tagaacaaaa ttattcatat ttatactgat ctttttccat 13800 ccagcagtgg agtttagtac ttaagagttt gtgcccttaa accagactcc ctggattaat 13860 gctgtgtacc cgtgggcaag gtgcctgaat tctctataca cctatttcct catctgtaaa 13920 atggcaataa tagtaatagt acctaatgtg tagggttgtt ataagcattg agtaagataa 13980 ataatataaa gcacttagaa cagtgcctgg aacataaaaa cacttaataa tagctcatag 14040 ctaacatttc ctatttacat ttcttctaga aatagccagt atttgttgag tgcctacatg 14100 ttagttcctt tactagttgc tttacatgta ttatcttata ttctgtttta aagtttcttc 14160 acagttacag attttcatga aattttactt ttaataaaag agaagtaaaa gtataaagta 14220 ttcactttta tgttcacagt cttttccttt aggctcatga tggagtatca gaggcatgag 14280 tgtgtttaac ctaagagcct taatggcttg aatcagaagc actttagtcc tgtatctgtt 14340 cagtgtcagc ctttcataca tcattttaaa tcccatttga ctttaagtaa gtcacttaat 14400 ctctctacat gtcaatttct tcagctataa aatgatggta tttcaataaa taaatacatt 14460 aattaaatga tattatactg actaattggg ctgttttaag gctcaataag aaaatttctg 14520 tgaaaggtct ctagaaaatg taggttccta tacaaataaa agataacatt gtgcttatag 14580 cttcggtgtt tatcatataa agctattctg agttatttga agagctcacc tacttttttt 14640 tgtttttagt ttgttaaatt gttttatagg caatgttttt aatctgtttt ctttaactta 14700 cagtgccatc agctcacact tgcaaacctg tggctgttcc gttgtagtag gtagcagtgc 14760 agagaaagta aataaggtag tttattttat aatctagcaa atgatttgac tctttaagac 14820 tgatgatata tcatggattg tcatttaaat ggtaggttgc aattaaaatg atctagtagt 14880 ataaggaggc aatgtaatct catcaaattg ctaagacacc ttgtggcaac agtgagtttg 14940 aaataaactg agtaagaatc atttatcagt ttattttgat agctcggaaa taccagtgtc 15000 agtagtgtat aaatggtttt gagaatatat taaaatcaga tatataaaaa aaattactct 15060 tctatttccc aatgttatct ttaacaaatc tgaagatagt catgtacttt tggtagtagt 15120 tccaaagaaa tgttatttgt ttattcatct tgatttcatt gtcttcgctt tccttctaaa 15180 tctgtccctt ctagggagct attgggatta agtggtcatt gattattata ctttattcag 15240 taatgtttct gaccctttcc ttcagtgcta cttgagttaa ttaaggatta atgaacagtt 15300 acatttccaa gcattagcta ataaactaaa ggattttgca cttttcttca ctgaccatta 15360 gttagaaaga gttcagagat aagtatgtgt atctttcaat ttcagcaaac ctaatttttt 15420 aaaaaaagtt ttacatagga aatatgttgg aaatgatact ttacaaagat attcataatt 15480 tttttttgta atcagctact ttgtatattt acatgagcct taatttatat ttctcatata 15540 accatttatg agagcttagt atacctgtgt cattatattg catctacgaa ctagtgacct 15600 tattccttct gttacctcaa acaggtggct ttccatctgt gatctccaaa gccttaggtt 15660 gcacagagtg actgccgagc tgctttatga agggagaaag gctccatagt tggagtgttt 15720 tttttttttt ttttaaacat ttttcccatc ctccatcctc ttgagggaga atagcttacc 15780 ttttatcttg ttttaatttg agaaagaagt tgccaccact ctaggttgaa aaccactcct 15840 ttaacataat aactgtggat atggtttgaa tttcaagata gttacatgcc tttttatttt 15900 tcctaataga gctgtaggtc aaatattatt agaatcagat ttctaaatcc cacccaatga 15960 cctgcttatt ttaaatcaaa ttcaataatt aattctcttc tttttggagg atctggacat 16020 tctttgatat ttcttacaac gaatttcatg tgtagaccca ctaaacagaa gctataaaag 16080 ttgcatggtc aaataagtct gagaaagtct gcagatgata taattcacct gaagagtcac 16140 agtatgtagc caaatgttaa aggttttgag atgccataca gtaaatttac caagcatttt 16200 ctaaatttat ttgaccacag aatccctatt ttaagcaaca actgttacat cccatggatt 16260 ccaggtgact aaagaatact tatttcttag gatatgtttt attgataata acaattaaaa 16320 tttcagatat ctttcataag caaatcagtg gtctttttac ttcatgtttt aatgctaaaa 16380 tattttcttt tatagatagt cagaacatta tgcctttttc tgactccagc agagagaaaa 16440 tgctccaggt tatgtgaagc agaatcatca tttaaatatg agtcagggct ctttgtacaa 16500 ggcctgctaa aggtatagtt tctagttatc acaagtgaaa ccacttttct aaaatcattt 16560 ttgagactct ttatagacaa atcttaaata ttagcattta atgtatctca tattgacatg 16620 cccagagact gacttccttt acacagttct gcacatagac tatatgtctt atggatttat 16680 agttagtatc atcagtgaaa caccatagaa taccctttgt gttccaggtg ggtccctgtt 16740 cctacatgtc tagcctcagg actttttttt ttttaacaca tgcttaaatc aggttgcaca 16800 tcaaaaataa gatcatttct ttttaactaa atagatttga attttattga aaaaaaattt 16860 taaacatctt taagaagctt ataggattta agcaattcct atgtatgtgt actaaaatat 16920 atatatttct atatataata tatattagaa aaaaattgta tttttctttt atttgagtct 16980 actgtcaagg agcaaaacag agaaatgtaa attagcaatt atttataata cttaaaggga 17040 agaaagttgt tcaccttgtt gaatctatta ttgttatttc aattatagtc ccaagacgtg 17100 aagaaatagc tttcctaatg gttatgtgat tgtctcatag tgactacttt cttgaggatg 17160 tagccacggc aaaatgaaat aaaaaaattt aaaaattgtt gcaaatacaa gttatattag 17220 gcttttgtgc attttcaata atgtgctgct atgaactcag aatgatagta tttaaatata 17280 gaaactagtt aaaggaaacg tagtttctat ttgagttata catatctgta aattagaact 17340 tctcctgtta aaggcataat aaagtgctta atacttttgt ttcctcagca ccctctcatt 17400 taattatata attttagttc tgaaagggac ctataccaga tgcctagagg aaatttcaaa 17460 actatgatct aatgaaaaaa tatttaatag ttctccatgc aaatacaaat catatagttt 17520 tccagaaaat acctttgaca ttatacaaag atgattatca cagcattata atagtaaaaa 17580 aatggaaata gcctctttct tctgttctgt tcatagcaca gtgcctcata cgcagtaggt 17640 tattattaca tggtaactgg ctaccccaac tgattaggaa agaagtaaat ttgttttata 17700 aaaatacata ctcattgagg tgcatagaat aattaagaaa ttaaaagaca cttgtaattt 17760 tgaatccagt gaatacccac tgttaatatt tggtatatct ctttctagtc tttttttccc 17820 ttttgcatgt attttcttta agactcccac ccccactgga tcatctctgc atgttctaat 17880 ctgctttttt cacagcagat tctaagcctc tttgaatatc aacacaaact tcaacaactt 17940 catctataga tgccaaataa taaattcatt tttatttact taaccacttc ctttggatgc 18000 ttaggtcatt ctgatgtttt gctattgaaa ccaatgctat actgaacact tctgtcacta 18060 aaactttgca cacactcatg aatagcttct taggataaat ttttagagat ggatttgcta 18120 aatcagagac cattttttaa aattaaaaaa caattattca tatcgtttgg catgtaagac 18180 agtaaatttt ccttttattt tgacaggatt caactggaag ctttgtgctg cctttccggc 18240 aagtcatgta tgctccatat cccaccacac acatagatgt ggatgtcaat actgtgaagc 18300 agatgccacc ctgtcatgaa catatttata atcagcgtag atacatgaga tccgagctga 18360 cagccttctg gagagccact tcagaagaag acatggctca ggatacgatc atctacactg 18420 acgaaagctt tactcctgat ttgtacgtaa tgctctgcct gctggtactg tagtcaagca 18480 atatgaaatt gtgtctttta cgaataaaaa caaaacagaa gttgcattta aaaagaaaga 18540 aatattacca gcagaattat gcttgaagaa acatttaatc aagcattttt ttcttaaatg 18600 ttcttctttt tccatacaat tgtgtttacc ctaaaatagg taagattaac ccttaaagta 18660 aatatttaac tatttgttta ataaatatat attgagctcc taggcactgt tctaggtacc 18720 gggcttaata gtggccaacc agacagcccc agccccagcc cctacattgt gtatagtcta 18780 ttatgtaaca gttattgaat ggacttatta acaaaaccaa agaagtaatt ctaagtcttt 18840 tttttcttga catatgaata taaaatacag caaaactgtt aaaatatatt aatggaacat 18900 ttttttactt tgcattttat attgttattc acttcttatt tttttttaaa aaaaaaagcc 18960 tgaacagtaa attcaaaagg aaaagtaatg ataattaatt gttgagcatg gacccaactt 19020 gaaaaaaaaa atgatgatga taaatctata atcctaaaac cctaagtaaa cacttaaaag 19080 atgttctgaa atcaggaaaa gaattatagt atacttttgt gtttctcttt tatcagttga 19140 aaaaaggcac agtagctcat gcctgtaaga acagagcttt gggagtgcaa ggcaggcgga 19200 tcacttgagg ccaggagttc cagaccagcc tgggcaacat agtgaaaccc catctctaca 19260 aaaaataaaa aagaattatt ggaatgtgtt tctgtgtgcc tgtaatccta gctattccga 19320 aagctgaggc aggaggatct tttgagccca ggagtttgag gttacaggga gttatgatgt 19380 gccagtgtac tccagcctgg ggaacaccga gactctgtct tatttaaaaa aaaaaaaaaa 19440 aaaatgcttg caataatgcc tggcacatag aaggtaacag taagtgttaa ctgtaataac 19500 ccaggtctaa gtgtgtaagg caatagaaaa attggggcaa ataagcctga cctatgtatc 19560 tacagaatca gtttgagctt aggtaacaga cctgtggagc accagtaatt acacagtaag 19620 tgttaaccaa aagcatagaa taggaatatc ttgttcaagg gacccccagc cttatacatc 19680 tcaaggtgca gaaagatgac ttaatatagg acccattttt tcctagttct ccagagtttt 19740 tattggttct tgagaaagta gtaggggaat gttttagaaa atgaattggt ccaactgaaa 19800 ttacatgtca gtaagttttt atatattggt aaattttagt agacatgtag aagttttcta 19860 attaatctgt gccttgaaac attttctttt ttcctaaagt gcttagtatt ttttccgttt 19920 tttgattggt tacttgggag cttttttgag gaaatttagt gaactgcaga atgggtttgc 19980 aaccatttgg tatttttgtt ttgtttttta gaggatgtat gtgtatttta acatttctta 20040 atcattttta gccagctatg tttgttttgc tgatttgaca aactacagtt agacagctat 20100 tctcattttg ctgatcatga caaaataata tcctgaattt ttaaattttg catccagctc 20160 taaattttct aaacataaaa ttgtccaaaa aatagtattt tcagccacta gattgtgtgt 20220 taagtctatt gtcacagagt cattttactt ttaagtatat gtttttacat gttaattatg 20280 tttgttattt ttaattttaa ctttttaaaa taattccagt cactgccaat acatgaaaaa 20340 ttggtcactg gaattttttt tttgactttt attttaggtt catgtgtaca tgtgcaggtg 20400 tgttatacag gtaaattgcg tgtcatgagg gtttggtgta caggtgattt cattacccag 20460 gtaataagca tagtacccaa taggtagttt tttgatcctc acccttctcc caccctcaag 20520 taggccctgg tgttgctgtt tccttctttg tgtccatgta tactcagtgt ttagctccca 20580 cttagaagtg agaacatgcg gtagttggtt ttctgttcct ggattagttc acttaggata 20640 atgacctcta gctccatctg gtttttatgg ctgcatagta ttccatggtg tatatgtatc 20700 acattttctt tatccagtct accattgata ggcatttagg ttgattccct gtctttgtta 20760 tcatgaatag tgctgtgatg aacatacaca tgcatgtgtc tttatggtag aaaaatttgt 20820 attcctttag gtacatatag aataatgggg ttgctagggt gaatggtagt tctattttca 20880 gttatttgag aaatcttcaa actgcttttc ataatagcta aactaattta cagtcccgcc 20940 agcagtgtat aagtgttccc ttttctccac aaccttgcca acatctgtga ttttttgact 21000 ttttaataat agccattcct agagaattga tttgcaattc tctattagtg atattaagca 21060 ttttttcata tgctttttag ctgtctgtat atattcttct gaaaaatttt catgtccttt 21120 gcccagtttg tagtggggtg ggttgttttt tgcttgttaa ttagttttaa gttccttcca 21180 gattctgcat atccctttgt tggatacatg gtttgcagat atttttctcc cattgtgtag 21240 gttgtctttt actctgttga tagtttcttt tgccatgcag gagctcgtta ggtcccattt 21300 gtgtttgttt ttgttgcagt tgcttttggc gtcttcatca taaaatctgt gccagggcct 21360 atgtccagaa tggtatttcc taggttgtct tccagggttt ttacaatttt agattttacg 21420 tttatgtctt taatccatct tgagttgatt tttgtatatg gcacaaggaa ggggtccagt 21480 ttcactccaa ttcctatggc tagcaattat cccagcacca tttattgaat acggagtcct 21540 ttccccattg cttgtttttt gtcaactttg ttgaagatca gatggttgta agtgtgtggc 21600 tttatttctt ggctctctat tctccattgg tctatgtgtc tgtttttata acagtaccct 21660 gctgttcagg ttcctatagc cttttagtat aaaatcggct aatgtgatgc ctccagcttt 21720 gttctttttg cttaggattg ctttggctat ttgggctcct ttttgggtcc atattaattt 21780 taaaacagtt ttttctggtt ttgtgaagga tatcattggt agtttatagg aatagcattg 21840 aatctgtaga ttgctttggg cagtatggcc attttaacaa tattaattct tcctatctat 21900 gaatatggaa tgtttttcca tgtgtttgtg tcatctcttt atacctgatg tataaagaaa 21960 agctggtatt attcctactc aatctgttcc aaaaaattga ggaggaggaa ctcttcccta 22020 atgaggccag catcattctg ataccaaaac ctggcagaga cacaacagaa aaaagaaaac 22080 ttcaggccaa tatccttgat gaatatagat gcaaaaatcc tcaacaaaat actagcaaac 22140 caaatccagc agcacatcaa aaagctgatc tactttgatc aagtaggctt tatccctggg 22200 atgcaaggtt ggttcaacat acacaaatca ataagtgtga ttcatcacat aaacagagct 22260 aaaaacaaaa accacaagat tatctcaata ggtagagaaa aggttgtcaa taaaatttaa 22320 catcctccat gttaaaaacc ttcagtaggt caggtgtagt gactcacacc tgtaatccca 22380 gcactttggg aggccaaggc gggcatatct cttaagccca ggagttcaag acgagcctag 22440 gcagcatggt gaaaccccat ctctacaaaa aaaaaaaaaa aaaaaaatta gcttggtatg 22500 gtgacatgca cctatagtcc cagctattca ggaggttgag gtgggaggat tgtttgagcc 22560 cgggaggcag aggttggcag cgagctgaga tcatgccacc gcactccagc ctgggcaacg 22620 gagtgagacc ctgtctcaaa aaagaaaaat cacaaacaat cctaaacaaa ctaggcattg 22680 aaggaacatg cctcaaaaaa ataagaacca tctatgacag acccatagcc aatatcttac 22740 caaatgggca aaagctggaa gtattctcct tgagaaccgt aacaagacaa ggatgtccac 22800 tctcaccact ccttttcagc atagttctgg aagtcctagc cagagcaatc aggaaagaga 22860 aagaaagaaa gacattcaga taggaagaga agaagtcaaa ctatttctgt ttgcaggcag 22920 tataattctg tacctagaaa atctcatagt ctctgcccag aaactcctaa atctgttaaa 22980 aatttcagca aagttttggc attctctata ctccaacacc ttccaaagtg agagcaaaat 23040 caagaacaca gtcccattca caatagccgc aaaacgaata aaatacctag gaatccagct 23100 aaccagggag gtgaaagatc tctatgagaa ttacaaaaca ctgctgaaag aaatcagaga 23160 tgacacaaac aaatggaaat gttctttttt aacaccttgc tttatctaat tcacttatga 23220 tgaagatact cattcagtgg aacaggtata ataagtccac tcgattaaat ataagcctta 23280 ttctctttcc agagcccaag aaggggcact atcagtgccc agtcaataat gacgaaatgc 23340 taatattttt cccctttacg gtttctttct tctgtagtgt ggtacactcg tttcttaaga 23400 taaggaaact tgaactacct tcctgtttgc ttctacacat acccattctc tttttttgcc 23460 actctggtca ggtataggat gatccctacc actttcagtt aaaaactcct cctcttacta 23520 aatgttctct taccctctgg cctgagtaga acctagggaa aatggaagag aaaaagatga 23580 aagggaggtg gggcctggga agggaataag tagtcctgtt tgtttgtgtg tttgctttag 23640 cacctgctat atcctaggtg ctgtgttagg cacacattat tttaagtggc cattatatta 23700 ctactactca ctctggtcgt tgccaaggta ggtagtactt tcttggatag ttggttcatg 23760 ttacttacag atggtgggct tgttgaggca aacccagtgg ataatcatcg gagtgtgttc 23820 tctaatctca ctcaaatttt tcttcacatt ttttggtttg ttttggtttt tgatggtagt 23880 ggcttatttt tgttgctggt ttgttttttg tttttttttg agatggcaag aattggtagt 23940 tttatttatt aattgcctaa gggtctctac tttttttaaa agatgagagt agtaaaatag 24000 attgatagat acatacatac ccttactggg gactgcttat attctttaga gaaaaaatta 24060 catattagcc tgacaaacac cagtaaaatg taaatatatc cttgagtaaa taaatgaatg 24120 tatattttgt gtctccaaat atatatatct atattcttac aaatgtgttt atatgtaata 24180 tcaatttata agaacttaaa atgttggctc aagtgaggga ttgtggaagg tagcattata 24240 tggccatttc aacatttgaa cttttttctt ttcttcattt tcttcttttc ttcaggaata 24300 tttttcaaga tgtcttacac agagacactc tagtgaaagc cttcctggat caggtaaatg 24360 ttgaacttga gattgtcaga gtgaatgata tgacatgttt tcttttttaa tatatcctac 24420 aatgcctgtt ctatatattt atattcccct ggatcatgcc ccagagttct gctcagcaat 24480 tgcagttaag ttagttacac tacagttctc agaagagtct gtgagggcat gtcaagtgca 24540 tcattacatt ggttgcctct tgtcctagat ttatgcttcg ggaattcaga cctttgttta 24600 caatataata aatattattg ctatctttta aagatataat aataagatat aaagttgacc 24660 acaactactg ttttttgaaa catagaattc ctggtttaca tgtatcaaag tgaaatctga 24720 cttagctttt acagatataa tatatacata tatatatcct gcaatgcttg tactatatat 24780 gtagtacaag tatatatata tgtttgtgtg tgtatatata tatagtacga gcatatatac 24840 atattaccag cattgtagga tatatatatg tttatatatt aaaaaaaagt tataaactta 24900 aaaccctatt atgttatgta gagtatatgt tatatatgat atgtaaaata tataacatat 24960 actctatgat agagtgtaat atatttttta tatatatttt aacatttata aaatgataga 25020 attaagaatt gagtcctaat ctgttttatt aggtgctttt tgtagtgtct ggtctttcta 25080 aagtgtctaa atgatttttc cttttgactt attaatgggg aagagcctgt atattaacaa 25140 ttaagagtgc agcattccat acgtcaaaca acaaacattt taattcaagc attaacctat 25200 aacaagtaag tttttttttt ttttttgaga aagggaggtt gtttatttgc ctgaaatgac 25260 tcaaaaatat ttttgaaaca tagtgtactt atttaaataa catctttatt gtttcattct 25320 tttaaaaaat atctacttaa ttacacagtt gaaggaaatc gtagattata tggaacttat 25380 ttcttaatat attacagttt gttataataa cattctgggg atcaggccag gaaactgtgt 25440 catagataaa gctttgaaat aatgagatcc ttatgtttac tagaaatttt ggattgagat 25500 ctatgaggtc tgtgacatat tgcgaagttc aaggaaaatt cgtaggcctg gaatttcatg 25560 cttctcaagc tgacataaaa tccctcccac tctccacctc atcatatgca cacattctac 25620 tcctacccac ccactccacc ccctgcaaaa gtacaggtat atgaatgtct caaaaccata 25680 ggctcatctt ctaggagctt caatgttatt tgaagatttg ggcagaaaaa attaagtaat 25740 acgaaataac ttatgtatga gttttaaaag tgaagtaaac atggatgtat tctgaagtag 25800 aatgcaaaat ttgaatgcat ttttaaagat aaattagaaa acttctaaaa actgtcagat 25860 tgtctgggcc tggtggctta tgcctgtaat cccagcactt tgggagtccg aggtgggtgg 25920 atcacaaggt caggagatcg agaccatcct gccaacatgg tgaaaccccg tctctactaa 25980 gtatacaaaa attagctggg cgtggcagcg tgtgcctgta atcccagcta cctgggaggc 26040 tgaggcagga gaatcgcttg aacccaggag gtgtaggttg cagtgagtca agatcgcgcc 26100 actgcacttt agcctggtga cagagctaga ctccgtctca aaaaaaaaaa aaaatatcag 26160 attgttccta cacctagtgc ttctatacca cactcctgtt agggggcatc agtggaaatg 26220 gttaaggaga tgtttagtgt gtattgtctg ccaagcactg tcaacactgt catagaaact 26280 tctgtacgag tagaatgtga gcaaattatg tgttgaaatg gttcctctcc ctgcaggtct 26340 ttcagctgaa acctggctta tctctcagaa gtactttcct tgcacagttt ctacttgtcc 26400 ttcacagaaa agccttgaca ctaataaaat atatagaaga cgatacgtga gtaaaactcc 26460 tacacggaag aaaaaccttt gtacattgtt tttttgtttt gtttcctttg tacattttct 26520 atatcataat ttttgcgctt cttttttttt tttttttttt tttttttcca ttatttttag 26580 gcagaaggga aaaaagccct ttaaatctct tcggaacctg aagatagacc ttgatttaac 26640 agcagagggc gatcttaaca taataatggc tctggctgag aaaattaaac caggcctaca 26700 ctcttttatc tttggaagac ctttctacac tagtgtgcaa gaacgagatg ttctaatgac 26760 tttttaaatg tgtaacttaa taagcctatt ccatcacaat catgatcgct ggtaaagtag 26820 ctcagtggtg tggggaaacg ttcccctgga tcatactcca gaattctgct ctcagcaatt 26880 gcagttaagt aagttacact acagttctca caagagcctg tgaggggatg tcaggtgcat 26940 cattacattg ggtgtctctt ttcctagatt tatgcttttg ggatacagac ctatgtttac 27000 aatataataa atattattgc tatcttttaa agatataata ataggatgta aacttgacca 27060 caactactgt ttttttgaaa tacatgattc atggtttaca tgtgtcaagg tgaaatctga 27120 gttggctttt acagatagtt gactttctat cttttggcat tctttggtgt gtagaattac 27180 tgtaatactt ctgcaatcaa ctgaaaacta gagcctttaa atgatttcaa ttccacagaa 27240 agaaagtgag cttgaacata ggatgagctt tagaaagaaa attgatcaag cagatgttta 27300 attggaattg attattagat cctactttgt ggatttagtc cctgggattc agtctgtaga 27360 aatgtctaat agttctctat agtccttgtt cctggtgaac cacagttagg gtgttttgtt 27420 tattttattg ttcttgctat tgttgatatt ctatgtagtt gagctctgta aaaggaaatt 27480 gtattttatg ttttagtaat tgttgccaac tttttaaatt aattttcatt atttttgagc 27540 caaattgaaa tgtgcacctc ctgtgccttt tttctcctta gaaaatctaa ttacttggaa 27600 caagttcaga tttcactggt cagtcatttt catcttgttt tcttcttgct aagtcttacc 27660 atgtacctgc tttggcaatc attgcaactc tgagattata aaatgcctta gagaatatac 27720 taactaataa gatctttttt tcagaaacag aaaatagttc cttgagtact tccttcttgc 27780 atttctgcct atgtttttga agttgttgct gtttgcctgc aataggctat aaggaatagc 27840 aggagaaatt ttactgaagt gctgttttcc taggtgctac tttggcagag ctaagttatc 27900 ttttgttttc ttaatgcgtt tggaccattt tgctggctat aaaataactg attaatataa 27960 ttctaacaca atgttgacat tgtagttaca caaacacaaa taaatatttt atttaaaatt 28020 ctggaagtaa tataaaaggg aaaatatatt tataagaaag ggataaaggt aatagagccc 28080 ttctgccccc cacccaccaa atttacacaa caaaatgaca tgttcgaatg tgaaaggtca 28140 taatagcttt cccatcatga atcagaaaga tgtggacagc ttgatgtttt agacaaccac 28200 tgaactagat gactgttgta ctgtagctca gtcatttaaa aaatatataa atactacctt 28260 gtagtgtccc atactgtgtt ttttacatgg tagattctta tttaagtgct aactggttat 28320 tttctttggc tggtttattg tactgttata cagaatgtaa gttgtacagt gaaataagtt 28380 attaaagcat gtgtaaacat tgttatatat cttttctcct aaatggagaa ttttgaataa 28440 aatatatttg aaattttgcc tctttcagtt gttcattcag aaaaaaatac tatgatattt 28500 gaagactgat cagcttctgt tcagctgaca gtcatgctgg atctaaactt tttttaaaat 28560 taattttgtc ttttcaaaga aaaaatattt aaagaagctt tataatataa tcttatgtta 28620 aaaaaacttt ctgcttaact ctctggattt cattttgatt tttcaaatta tatattaata 28680 tttcaaatgt aaaatactat ttagataaat tgtttttaaa cattcttatt attataatat 28740 taatataacc taaactgaag ttattcatcc caggtatcta atacatgtat ccaaagtaaa 28800 aatccaagga atctgaacac tttcatctgc aaagctagga ataggtttga cattttcact 28860 ccaagaaaaa gttttttttt gaaaatagaa tagttgggat gagaggtttc tttaaaagaa 28920 gactaactga tcacattact atgattctca aagaagaaac caaaacttca tataatacta 28980 taaagtaaat ataaaatagt tccttctata gtatatttct ataatgctac agtttaaaca 29040 gatcactctt atataatact attttgattt tgatgtagaa ttgcacaaat tgatatttct 29100 cctatgatct gcagggtata gcttaaagta acaaaaacag tcaaccacct ccatttaaca 29160 cacagtaaca ctatgggact agttttatta cttccatttt acaaatgagg aaactaaagc 29220 ttaaagatgt gtaatacacc gcccaaggtc acacagctgg taaaggtgga tttcatccca 29280 gacagttaca gtcattgcca tgggcacagc tcctaactta gtaactccat gtaactggta 29340 ctcagtgtag ctgaattgaa aggagagtaa ggaagcaggt tttacaggtc tacttgcact 29400 attcagagcc cgagtgtgaa tccctgctgt gctgcttgga gaagttactt aacctatgca 29460 aggttcattt tgtaaatatt ggaaatggag tgataatacg tacttcacca gaggatttaa 29520 tgagacctta tacgatcctt agttcagtac ctgactagtg cttcataaat gctttttcat 29580 ccaatctgac aatctccagc ttgtaattgg ggcatttaga acatttaata tgattattgg 29640 catggtaggt taaagctgtc atcttgctgt tttctatttg ttctttttgt tttctcctta 29700 cttttggatt tttttattct actatgtctt ttctattgtc ttattaacta tactctttga 29760 tttattttag tggttgtttt agggttatac ctctttctaa tttaccagtt tataaccagt 29820 ttatatacta cttgacatat agcttaagaa acttactgtt gttgtctttt tgctgttatg 29880 gtcttaacgt ttttatttct acaaacatta taaactccac actttattgt tttttaattt 29940 tacttataca gtcaattatc ttttaaagat atttaaatat aaacattcaa aacaccccaa 30000 t 30001 <210> SEQ ID NO 3 <211> LENGTH: 1031 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 attcccggga tacgtaacct acggtgtccc gctaggaaag agaggtgcgt caaacagcga 60 caagttccgc ccacgtaaaa gatgacgctt ggtgtgtcag ccgtccctgc tgcccggttg 120 cttctctttt gggggcgggg tctagcaaga gcaggtgtgg gtttaggaga tatctccgga 180 gcatttggat aatgtgacag ttggaatgca gtgatgtcga ctctttgccc accgccatct 240 ccagctgttg ccaagacaga gattgcttta agtggcaaat cacctttatt agcagctact 300 tttgcttact gggacaatat tcttggtcct agagtaaggc acatttgggc tccaaagaca 360 gaacaggtac ttctcagtga tggagaaata acttttcttg ccaaccacac tctaaatgga 420 gaaatccttc gaaatgcaga gagtggtgct atagatgtaa agttttttgt cttgtctgaa 480 aagggagtga ttattgtttc attaatcttt gatggaaact ggaatgggga tcgcagcaca 540 tatggactat caattatact tccacagaca gaacttagtt tctacctccc acttcataga 600 gtgtgtgttg atagattaac acatataatc cggaaaggaa gaatatggat gcataaggaa 660 agacaagaaa aatgtccaga agattatctt agaaggcaca gagagaatgg aagatcaggg 720 tcagagtatt attccaatgc ttactggaga agtgattcct gtaatggaaa ctgctttcct 780 ctatgaaatt cccccgggtt cctggaggaa atagatatag gctgatacag ttacccaatg 840 atggatgaat attgggggac cgcctggtca ttgaaaggct ttcttttctc caggaaagaa 900 atttttttcc ttttccataa aaagcttggg aatggaagac aacaattccc attctttttt 960 tgcgttccac ccctatgtga caacagaaat ttttggggaa acaacaacga aaaaatttta 1020 tcccgcgcgc a 1031 <210> SEQ ID NO 4 <211> LENGTH: 3244 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 4 gggcggggct gcggttgcgg tgcctgcgcc cgcggcggcg gaggcgcagg cggtggcgag 60 tggatatctc cggagcattt ggataatgtg acagttggaa tgcagtgatg tcgactcttt 120 gcccaccgcc atctccagct gttgccaaga cagagattgc tttaagtggc aaatcacctt 180 tattagcagc tacttttgct tactgggaca atattcttgg tcctagagta aggcacattt 240 gggctccaaa gacagaacag gtacttctca gtgatggaga aataactttt cttgccaacc 300 acactctaaa tggagaaatc cttcgaaatg cagagagtgg tgctatagat gtaaagtttt 360 ttgtcttgtc tgaaaaggga gtgattattg tttcattaat ctttgatgga aactggaatg 420 gggatcgcag cacatatgga ctatcaatta tacttccaca gacagaactt agtttctacc 480 tcccacttca tagagtgtgt gttgatagat taacacatat aatccggaaa ggaagaatat 540 ggatgcataa ggaaagacaa gaaaatgtcc agaagattat cttagaaggc acagagagaa 600 tggaagatca gggtcagagt attattccaa tgcttactgg agaagtgatt cctgtaatgg 660 aactgctttc atctatgaaa tcacacagtg ttcctgaaga aatagatata gctgatacag 720 tactcaatga tgatgatatt ggtgacagct gtcatgaagg ctttcttctc aatgccatca 780 gctcacactt gcaaacctgt ggctgttccg ttgtagtagg tagcagtgca gagaaagtaa 840 ataagatagt cagaacatta tgcctttttc tgactccagc agagagaaaa tgctccaggt 900 tatgtgaagc agaatcatca tttaaatatg agtcagggct ctttgtacaa ggcctgctaa 960 aggattcaac tggaagcttt gtgctgcctt tccggcaagt catgtatgct ccatatccca 1020 ccacacacat agatgtggat gtcaatactg tgaagcagat gccaccctgt catgaacata 1080 tttataatca gcgtagatac atgagatccg agctgacagc cttctggaga gccacttcag 1140 aagaagacat ggctcaggat acgatcatct acactgacga aagctttact cctgatttga 1200 atatttttca agatgtctta cacagagaca ctctagtgaa agccttcctg gatcaggtct 1260 ttcagctgaa acctggctta tctctcagaa gtactttcct tgcacagttt ctacttgtcc 1320 ttcacagaaa agccttgaca ctaataaaat atatagaaga cgatacgcag aagggaaaaa 1380 agccctttaa atctcttcgg aacctgaaga tagaccttga tttaacagca gagggcgatc 1440 ttaacataat aatggctctg gctgagaaaa ttaaaccagg cctacactct tttatctttg 1500 gaagaccttt ctacactagt gtgcaagaac gagatgttct aatgactttt taaatgtgta 1560 acttaataag cctattccat cacaatcatg atcgctggta aagtagctca gtggtgtggg 1620 gaaacgttcc cctggatcat actccagaat tctgctctca gcaattgcag ttaagtaagt 1680 tacactacag ttctcacaag agcctgtgag gggatgtcag gtgcatcatt acattgggtg 1740 tctcttttcc tagatttatg cttttgggat acagacctat gtttacaata taataaatat 1800 tattgctatc ttttaaagat ataataatag gatgtaaact tgaccacaac tactgttttt 1860 ttgaaataca tgattcatgg tttacatgtg tcaaggtgaa atctgagttg gcttttacag 1920 atagttgact ttctatcttt tggcattctt tggtgtgtag aattactgta atacttctgc 1980 aatcaactga aaactagagc ctttaaatga tttcaattcc acagaaagaa agtgagcttg 2040 aacataggat gagctttaga aagaaaattg atcaagcaga tgtttaattg gaattgatta 2100 ttagatccta ctttgtggat ttagtccctg ggattcagtc tgtagaaatg tctaatagtt 2160 ctctatagtc cttgttcctg gtgaaccaca gttagggtgt tttgtttatt ttattgttct 2220 tgctattgtt gatattctat gtagttgagc tctgtaaaag gaaattgtat tttatgtttt 2280 agtaattgtt gccaactttt taaattaatt ttcattattt ttgagccaaa ttgaaatgtg 2340 cacctcctgt gccttttttc tccttagaaa atctaattac ttggaacaag ttcagatttc 2400 actggtcagt cattttcatc ttgttttctt cttgctaagt cttaccatgt acctgctttg 2460 gcaatcattg caactctgag attataaaat gccttagaga atatactaac taataagatc 2520 tttttttcag aaacagaaaa tagttccttg agtacttcct tcttgcattt ctgcctatgt 2580 ttttgaagtt gttgctgttt gcctgcaata ggctataagg aatagcagga gaaattttac 2640 tgaagtgctg ttttcctagg tgctactttg gcagagctaa gttatctttt gttttcttaa 2700 tgcgtttgga ccattttgct ggctataaaa taactgatta atataattct aacacaatgt 2760 tgacattgta gttacacaaa cacaaataaa tattttattt aaaattctgg aagtaatata 2820 aaagggaaaa tatatttata agaaagggat aaaggtaata gagcccttct gccccccacc 2880 caccaaattt acacaacaaa atgacatgtt cgaatgtgaa aggtcataat agctttccca 2940 tcatgaatca gaaagatgtg gacagcttga tgttttagac aaccactgaa ctagatgact 3000 gttgtactgt agctcagtca tttaaaaaat atataaatac taccttgtag tgtcccatac 3060 tgtgtttttt acatggtaga ttcttattta agtgctaact ggttattttc tttggctggt 3120 ttattgtact gttatacaga atgtaagttg tacagtgaaa taagttatta aagcatgtgt 3180 aaacattgtt atatatcttt tctcctaaat ggagaatttt gaataaaata tatttgaaat 3240 tttg 3244 <210> SEQ ID NO 5 <211> LENGTH: 761 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (693)..(693) <223> OTHER INFORMATION: n is a, c, g, or t <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (722)..(722) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 5 cacgaggctt tgatatttct tacaacgaat ttcatgtgta gacccactaa acagaagcta 60 taaaagttgc atggtcaaat aagtctgaga aagtctgcag atgatataat tcacctgaag 120 agtcacagta tgtagccaaa tgttaaaggt tttgagatgc catacagtaa atttaccaag 180 cattttctaa atttatttga ccacagaatc cctattttaa gcaacaactg ttacatccca 240 tggattccag gtgactaaag aatacttatt tcttaggata tgttttattg ataataacaa 300 ttaaaatttc agatatcttt cataagcaaa tcagtggtct ttttacttca tgttttaatg 360 ctaaaatatt ttcttttata gatagtcaga acattatgcc tttttctgac tccagcagag 420 agaaaatgct ccaggttatg tgaagcagaa tcatcattta aatatgagtc agggctcttt 480 gtacaaggcc tgctaaagga ttcaactgga agctttgtgc tgcctttccg gcaagtcatg 540 tatgctccat atcccaccac acacatagat gtggatgtca atactgtgaa gcagatgcca 600 ccctgtcatg aacatattta taatcagcgt agatacatga gatccgagct gacagccttc 660 tggagagcca cttcagaaga agacatggct cangatacga tcatctacac tgacgaaagc 720 tntactcctg atttgaatat ttttcaagat gtcttacaca g 761 <210> SEQ ID NO 6 <211> LENGTH: 1901 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 6 acgtaaccta cggtgtcccg ctaggaaaga gaggtgcgtc aaacagcgac aagttccgcc 60 cacgtaaaag atgacgcttg atatctccgg agcatttgga taatgtgaca gttggaatgc 120 agtgatgtcg actctttgcc caccgccatc tccagctgtt gccaagacag agattgcttt 180 aagtggcaaa tcacctttat tagcagctac ttttgcttac tgggacaata ttcttggtcc 240 tagagtaagg cacatttggg ctccaaagac agaacaggta cttctcagtg atggagaaat 300 aacttttctt gccaaccaca ctctaaatgg agaaatcctt cgaaatgcag agagtggtgc 360 tatagatgta aagttttttg tcttgtctga aaagggagtg attattgttt cattaatctt 420 tgatggaaac tggaatgggg atcgcagcac atatggacta tcaattatac ttccacagac 480 agaacttagt ttctacctcc cacttcatag agtgtgtgtt gatagattaa cacatataat 540 ccggaaagga agaatatgga tgcataagga aagacaagaa aatgtccaga agattatctt 600 agaaggcaca gagagaatgg aagatcaggg tcagagtatt attccaatgc ttactggaga 660 agtgattcct gtaatggaac tgctttcatc tatgaaatca cacagtgttc ctgaagaaat 720 agatatagct gatacagtac tcaatgatga tgatattggt gacagctgtc atgaaggctt 780 tcttctcaag taagaatttt tcttttcata aaagctggat gaagcagata ccatcttatg 840 ctcacctatg acaagatttg gaagaaagaa aataacagac tgtctactta gattgttcta 900 gggacattac gtatttgaac tgttgcttaa atttgtgtta tttttcactc attatatttc 960 tatatatatt tggtgttatt ccatttgcta tttaaagaaa ccgagtttcc atcccagaca 1020 agaaatcatg gccccttgct tgattctggt ttcttgtttt acttctcatt aaagctaaca 1080 gaatcctttc atattaagtt gtactgtaga tgaacttaag ttatttaggc gtagaacaaa 1140 attattcata tttatactga tctttttcca tccagcagtg gagtttagta cttaagagtt 1200 tgtgccctta aaccagactc cctggattaa tgctgtgtac ccgtgggcaa ggtgcctgaa 1260 ttctctatac acctatttcc tcatctgtaa aatggcaata atagtaatag tacctaatgt 1320 gtagggttgt tataagcatt gagtaagata aataatataa agcacttaga acagtgcctg 1380 gaacataaaa acacttaata atagctcata gctaacattt cctatttaca tttcttctag 1440 aaatagccag tatttgttga gtgcctacat gttagttcct ttactagttg ctttacatgt 1500 attatcttat attctgtttt aaagtttctt cacagttaca gattttcatg aaattttact 1560 tttaataaaa gagaagtaaa agtataaagt attcactttt atgttcacag tcttttcctt 1620 taggctcatg atggagtatc agaggcatga gtgtgtttaa cctaagagcc ttaatggctt 1680 gaatcagaag cactttagtc ctgtatctgt tcagtgtcag cctttcatac atcattttaa 1740 atcccatttg actttaagta agtcacttaa tctctctaca tgtcaatttc ttcagctata 1800 aaatgatggt atttcaataa ataaatacat taattaaatg atattatact gactaattgg 1860 gctgttttaa ggcaaaaaaa aaaaaaaaaa aaaaaaaaaa a 1901 <210> SEQ ID NO 7 <211> LENGTH: 562 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (166)..(166) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 7 agacgtaacc tacggtgtcc cgctaggaaa gagagatatc tccggagcat ttggataatg 60 tgacagttgg aatgcagtga tgtcgactct ttgcccaccg ccatctccag ctgttgccaa 120 gacagagatt gctttaagtg gcaaatcacc tttattagca gctacntttt gcttactggg 180 acaatattct tggtcctaga gtaaggcaca tttgggctcc aaagacagaa caggtacttc 240 tcagtgatgg agaaataact tttcttgcca accacactct aaatggagaa atccttcgaa 300 atgcagagag tggtgctata gatgtaaagt tttttgtctt gtctgaaaag ggagtgatta 360 ttgtttcatt aatctttgat ggaaactgga atggggatcg cagcacatat ggactatcaa 420 ttatacttcc acagacagaa cttagtttct acctcccact tcatagagtg tgtgttgata 480 gattaacaca tataatccgg aaaggaagaa tatggatgca taaggaaaga caagaaaatg 540 tccagaagat tatcttagaa gg 562 <210> SEQ ID NO 8 <211> LENGTH: 798 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 8 gggctctctt ttgggggcgg ggtctagcaa gagcagatat ctccggagca tttggataat 60 gtgacagttg gaatgcagtg atgtcgactc tttgcccacc gccatctcca gctgttgcca 120 agacagagat tgctttaagt ggcaaatcac ctttattagc agctactttt gcttactggg 180 acaatattct tggtcctaga gtaaggcaca tttgggctcc aaagacagaa caggtacttc 240 tcagtgatgg agaaataact tttcttgcca accacactct aaatggagaa atccttcgaa 300 atgcagagag tggtgctata gatgtaaagt tttttgtctt gtctgaaaag ggagtgatta 360 ttgtttcatt aatctttgat ggaaactgga atggggatcg cagcacatat ggactatcaa 420 ttatacttcc acagacagaa cttagtttct acctcccact tcatagagtg tgtgttgata 480 gattaacaca tataatccgg aaaggaagaa tatggatgca taaggaaaga caagaaaatg 540 tccagaagat tatcttagaa ggcacagaga gaatggaaga tcagggtcag agtattattc 600 caatgcttac tggagaagtg attcctgtaa tgggactgct ttcatctatg aaatcacaca 660 gtgttcctga agaaatagat atagctgata cagtactcca tgatgatgat atttggtgac 720 agctgtcatg aaaggctttc ttctcaagta ggaatttttt cttttcataa aagctgggat 780 gaagccagat tcccatct 798 <210> SEQ ID NO 9 <211> LENGTH: 169 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 9 aaacagcgac aagttccgcc cacgtaaaag atgatgcttg gtgtgtcagc cgtccctgct 60 gcccggttgc ttctcttttg ggggcggggt ctagcaagag cagatatctc cggagcattt 120 ggataatgtg acagttggaa tgcggtgatg tcgactcttt gcccaccgc 169 <210> SEQ ID NO 10 <211> LENGTH: 176 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 10 aaaacgtcat cgcacataga aaacagacag acgtaaccta cggtgtcccg ctaggaaaga 60 gaggtgcgtc aaacagcgac aagttccgcc cacgtaaaag atgacgcttg atatctccgg 120 agcatttgga taatgtgaca gttggaatgc agtgatgtcg actctttgcc caccgc 176 <210> SEQ ID NO 11 <400> SEQUENCE: 11 000 <210> SEQ ID NO 12 <400> SEQUENCE: 12 000 <210> SEQ ID NO 13 <211> LENGTH: 783 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 13 gcctctcagt acccgaggct cccttttctc gagcccgcag cggcagcgct cccagcgggt 60 ccccgggaag gagacagctc gggtactgag ggcgggaaag caaggaagag gccagatccc 120 catcccttgt ccctgcgccg ccgccgccgc cgccgccgcc gggaagcccg gggcccggat 180 gcaggcaatt ccaccagtcg ctagaggcga aagcccgaca cccagcttcg gtcagagaaa 240 tgagagggaa agtaaaaatg cgtcgagctc tgaggagagc ccccgcttct acccgcgcct 300 cttcccggca gccgaacccc aaacagccac ccgccaggat gccgcctcct cactcaccca 360 ctcgccaccg cctgcgcctc cgccgccgcg ggcgcaggca ccgcaaccgc agccccgccc 420 cgggcccgcc cccgggcccg ccccgaccac gccccggccc cggccccggc cccggccccg 480 gcccctagcg cgcgactcct gagttccaga gcttgctaca ggctgcggtt gtttccctcc 540 ttgttttctt ctggttaatc tttatcaggt cttttcttgt tcaccctcag cgagtactgt 600 gagagcaagt agtggggaga gagggtggga aaaacaaaaa cacacacctc ctaaacccac 660 acctgctctt gctagacccc gcccccaaaa gagaagcaac cgggcagcag ggacggctga 720 cacaccaagc gtcatctttt acgtgggcgg aacttgtcgc tgtttgacgc acctctcttt 780 cct 783 <210> SEQ ID NO 14 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 14 cgactggagc acgaggacac tgaaaagatg acgcttggtg tgtca 45 <210> SEQ ID NO 15 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 15 cccacacctg ctcttgctag a 21 <210> SEQ ID NO 16 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 16 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 17 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 17 cccaaaagag aagcaaccgg gca 23 <210> SEQ ID NO 18 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 18 cgactggagc acgaggacac tgacggctgc cgggaaga 38 <210> SEQ ID NO 19 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 19 agaaatgaga gggaaagtaa aaatgc 26 <210> SEQ ID NO 20 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 20 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 21 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 21 aggagagccc ccgcttctac ccg 23 <210> SEQ ID NO 22 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 22 cgactggagc acgaggacac tgacgctgag ggtgaacaag aa 42 <210> SEQ ID NO 23 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 23 gagttccaga gcttgctaca g 21 <210> SEQ ID NO 24 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 24 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 25 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 25 ctgcggttgt ttccctcctt gttt 24 <210> SEQ ID NO 26 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 26 ggcaaattca acggcacagt 20 <210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 27 gggtctcgct cctggaagat 20 <210> SEQ ID NO 28 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 28 aaggccgaga atgggaagct tgtcatc 27 <210> SEQ ID NO 29 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 29 tagtgcggac ctacccacga 20 <210> SEQ ID NO 30 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 30 ggtgtgtcag ccgtccctgc 20 <210> SEQ ID NO 31 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 31 gtgtcagccg tccctgctgc 20 <210> SEQ ID NO 32 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 32 tgtttttccc accctctctc 20 <210> SEQ ID NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 33 ttttcccacc ctctctcccc 20 <210> SEQ ID NO 34 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 34 tcccaccctc tctccccact 20 <210> SEQ ID NO 35 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 35 caccctctct ccccactact 20 <210> SEQ ID NO 36 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 36 gagggtgaac aagaaaagac 20 <210> SEQ ID NO 37 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 37 gaaaagacct gataaagatt 20 <210> SEQ ID NO 38 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 38 agattaacca gaagaaaaca 20 <210> SEQ ID NO 39 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 39 ttaaccagaa gaaaacaagg 20 <210> SEQ ID NO 40 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 40 accagaagaa aacaaggagg 20 <210> SEQ ID NO 41 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 41 agaagaaaac aaggagggaa 20 <210> SEQ ID NO 42 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 42 agaaaacaag gagggaaaca 20 <210> SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 43 aaacaaggag ggaaacaacc 20 <210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 44 gcaagctctg gaactcagga 20 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 45 agctctggaa ctcaggagtc 20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 46 tcaggagtcg cgcgctaggg 20 <210> SEQ ID NO 47 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 47 ggagtcgcgc gctaggggcc 20 <210> SEQ ID NO 48 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 48 gtcgcgcgct aggggccggg 20 <210> SEQ ID NO 49 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 49 gcgcgctagg ggccggggcc 20 <210> SEQ ID NO 50 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 50 gggctgcggt tgcggtgcct 20 <210> SEQ ID NO 51 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 51 gcggttgcgg tgcctgcgcc 20 <210> SEQ ID NO 52 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 52 tgcggtgcct gcgcccgcgg 20 <210> SEQ ID NO 53 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 53 tgcctgcgcc cgcggcggcg 20 <210> SEQ ID NO 54 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 54 gcgcccgcgg cggcggaggc 20 <210> SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 55 cgcggcggcg gaggcgcagg 20 <210> SEQ ID NO 56 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 56 cggcggaggc gcaggcggtg 20 <210> SEQ ID NO 57 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 57 gaggcgcagg cggtggcgag 20 <210> SEQ ID NO 58 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 58 gcaggcggtg gcgagtgggt 20 <210> SEQ ID NO 59 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 59 cggtggcgag tgggtgagtg 20 <210> SEQ ID NO 60 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 60 gcgagtgggt gagtgaggag 20 <210> SEQ ID NO 61 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 61 tgggtgagtg aggaggcggc 20 <210> SEQ ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 62 gagtgaggag gcggcatcct 20 <210> SEQ ID NO 63 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 63 aggaggcggc atcctggcgg 20 <210> SEQ ID NO 64 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 64 gcggcatcct ggcgggtggc 20 <210> SEQ ID NO 65 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 65 atcctggcgg gtggctgttt 20 <210> SEQ ID NO 66 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 66 tcggctgccg ggaagaggcg 20 <210> SEQ ID NO 67 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 67 tgccgggaag aggcgcgggt 20 <210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 68 ggaagaggcg cgggtagaag 20 <210> SEQ ID NO 69 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 69 gctctcctca gagctcgacg 20 <210> SEQ ID NO 70 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 70 cctcagagct cgacgcattt 20 <210> SEQ ID NO 71 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 71 gagctcgacg catttttact 20 <210> SEQ ID NO 72 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 72 cgacgcattt ttactttccc 20 <210> SEQ ID NO 73 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 73 catttttact ttccctctca 20 <210> SEQ ID NO 74 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 74 ttactttccc tctcatttct 20 <210> SEQ ID NO 75 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 75 ttccctctca tttctctgac 20 <210> SEQ ID NO 76 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 76 tctcatttct ctgaccgaag 20 <210> SEQ ID NO 77 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 77 tttctctgac cgaagctggg 20 <210> SEQ ID NO 78 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 78 ctgaccgaag ctgggtgtcg 20 <210> SEQ ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 79 cgaagctggg tgtcgggctt 20 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 80 ctgggtgtcg ggctttcgcc 20 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 81 tgtcgggctt tcgcctctag 20 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 82 ggctttcgcc tctagcgact 20 <210> SEQ ID NO 83 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (15)..(15) <223> OTHER INFORMATION: I <400> SEQUENCE: 83 ccggggccgg ggccggggcc 20 <210> SEQ ID NO 84 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: I <400> SEQUENCE: 84 ggccggggcc ggggccgg 18 <210> SEQ ID NO 85 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 85 ggggccgggg ccggggcc 18 <210> SEQ ID NO 86 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 86 cggggccggg gccggggc 18 <210> SEQ ID NO 87 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 87 ccggggccgg ggccgggg 18 <210> SEQ ID NO 88 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 88 gccggggccg gggccggg 18 <210> SEQ ID NO 89 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 89 ggccggggcc ggggccgg 18 <210> SEQ ID NO 90 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 90 gggccggggc cggggccg 18 <210> SEQ ID NO 91 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 91 ggccggggcc ggggcc 16 <210> SEQ ID NO 92 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 92 gggccggggc cggggc 16 <210> SEQ ID NO 93 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 93 ggggccgggg ccgggg 16 <210> SEQ ID NO 94 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 94 cggggccggg gccggg 16 <210> SEQ ID NO 95 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 95 ccggggccgg ggccgg 16 <210> SEQ ID NO 96 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 96 gccggggccg gggccg 16 <210> SEQ ID NO 97 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 97 gacaagggta cgtaatctgt c 21 <210> SEQ ID NO 98 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (4)..(4) <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (10)..(10) <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (16)..(16) <400> SEQUENCE: 98 ccggggccgg ggccggggcc 20 <210> SEQ ID NO 99 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: I <400> SEQUENCE: 99 ggccggggcc ggggccgg 18 <210> SEQ ID NO 100 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 100 cagcagcagc agcagcagc 19 <210> SEQ ID NO 101 <211> LENGTH: 99 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 101 gacaagggta cgtaatctgt ctagagctag aaatagcaag ttaaaataag gctagtccgt 60 tatcaacttg aaaaagtggc accgagtcgg tgctttttt 99 <210> SEQ ID NO 102 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 102 tagtcctgca ggtttaaacg aattcgtgag tgaggaggcg gca 43 <210> SEQ ID NO 103 <211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 103 agcagagctc agattacgta cccttgttgt gaacaac 37 <210> SEQ ID NO 104 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 104 caatgtcaac gtctggcatt acttctactt ttg 33 <210> SEQ ID NO 105 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 105 tagggcgaat tgaatttagc ggccgcactg gcaggatcat agc 43 <210> SEQ ID NO 106 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 106 tacgtaatct gagctctgct tatatagacc 30 <210> SEQ ID NO 107 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 107 aatgccagac gttgacattg attattgact agttattaat ag 42 <210> SEQ ID NO 108 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 108 gttaggctct gggagagtag ttg 23 <210> SEQ ID NO 109 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 109 cctggagcag gtaaatgctg g 21

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 109 <210> SEQ ID NO 1 <211> LENGTH: 3339 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 acgtaaccta cggtgtcccg ctaggaaaga gaggtgcgtc aaacagcgac aagttccgcc 60 cacgtaaaag atgacgcttg gtgtgtcagc cgtccctgct gcccggttgc ttctcttttg 120 ggggcggggt ctagcaagag caggtgtggg tttaggagat atctccggag catttggata 180 atgtgacagt tggaatgcag tgatgtcgac tctttgccca ccgccatctc cagctgttgc 240 caagacagag attgctttaa gtggcaaatc acctttatta gcagctactt ttgcttactg 300 ggacaatatt cttggtccta gagtaaggca catttgggct ccaaagacag aacaggtact 360 tctcagtgat ggagaaataa cttttcttgc caaccacact ctaaatggag aaatccttcg 420 aaatgcagag agtggtgcta tagatgtaaa gttttttgtc ttgtctgaaa agggagtgat 480 tattgtttca ttaatctttg atggaaactg gaatggggat cgcagcacat atggactatc 540 aattatactt ccacagacag aacttagttt ctacctccca cttcatagag tgtgtgttga 600 tagattaaca catataatcc ggaaaggaag aatatggatg cataaggaaa gacaagaaaa 660 tgtccagaag attatcttag aaggcacaga gagaatggaa gatcagggtc agagtattat 720 tccaatgctt actggagaag tgattcctgt aatggaactg ctttcatcta tgaaatcaca 780 cagtgttcct gaagaaatag atatagctga tacagtactc aatgatgatg atattggtga 840 cagctgtcat gaaggctttc ttctcaatgc catcagctca cacttgcaaa cctgtggctg 900 ttccgttgta gtaggtagca gtgcagagaa agtaaataag atagtcagaa cattatgcct 960 ttttctgact ccagcagaga gaaaatgctc caggttatgt gaagcagaat catcatttaa 1020 atatgagtca gggctctttg tacaaggcct gctaaaggat tcaactggaa gctttgtgct 1080 gcctttccgg caagtcatgt atgctccata tcccaccaca cacatagatg tggatgtcaa 1140 tactgtgaag cagatgccac cctgtcatga acatatttat aatcagcgta gatacatgag 1200 atccgagctg acagccttct ggagagccac ttcagaagaa gacatggctc aggatacgat 1260 catctacact gacgaaagct ttactcctga tttgaatatt tttcaagatg tcttacacag 1320 agacactcta gtgaaagcct tcctggatca ggtctttcag ctgaaacctg gcttatctct 1380 cagaagtact ttccttgcac agtttctact tgtccttcac agaaaagcct tgacactaat 1440 aaaatatata gaagacgata cgcagaaggg aaaaaagccc tttaaatctc ttcggaacct 1500 gaagatagac cttgatttaa cagcagaggg cgatcttaac ataataatgg ctctggctga 1560 gaaaattaaa ccaggcctac actcttttat ctttggaaga cctttctaca ctagtgtgca 1620 agaacgagat gttctaatga ctttttaaat gtgtaactta ataagcctat tccatcacaa 1680 tcatgatcgc tggtaaagta gctcagtggt gtggggaaac gttcccctgg atcatactcc 1740 agaattctgc tctcagcaat tgcagttaag taagttacac tacagttctc acaagagcct 1800 gtgaggggat gtcaggtgca tcattacatt gggtgtctct tttcctagat ttatgctttt 1860 gggatacaga cctatgttta caatataata aatattattg ctatctttta aagatataat 1920 aataggatgt aaacttgacc acaactactg tttttttgaa atacatgatt catggtttac 1980 atgtgtcaag gtgaaatctg agttggcttt tacagatagt tgactttcta tcttttggca 2040 ttctttggtg tgtagaatta ctgtaatact tctgcaatca actgaaaact agagccttta 2100 aatgatttca attccacaga aagaaagtga gcttgaacat aggatgagct ttagaaagaa 2160 aattgatcaa gcagatgttt aattggaatt gattattaga tcctactttg tggatttagt 2220 ccctgggatt cagtctgtag aaatgtctaa tagttctcta tagtccttgt tcctggtgaa 2280 ccacagttag ggtgttttgt ttattttatt gttcttgcta ttgttgatat tctatgtagt 2340 tgagctctgt aaaaggaaat tgtattttat gttttagtaa ttgttgccaa ctttttaaat 2400 taattttcat tatttttgag ccaaattgaa atgtgcacct cctgtgcctt ttttctcctt 2460 agaaaatcta attacttgga acaagttcag atttcactgg tcagtcattt tcatcttgtt 2520 ttcttcttgc taagtcttac catgtacctg ctttggcaat cattgcaact ctgagattat 2580 aaaatgcctt agagaatata ctaactaata agatcttttt ttcagaaaca gaaaatagtt 2640 ccttgagtac ttccttcttg catttctgcc tatgtttttg aagttgttgc tgtttgcctg 2700 caataggcta taaggaatag caggagaaat tttactgaag tgctgttttc ctaggtgcta 2760 ctttggcaga gctaagttat cttttgtttt cttaatgcgt ttggaccatt ttgctggcta 2820 taaaataact gattaatata attctaacac aatgttgaca ttgtagttac acaaacacaa 2880 ataaatattt tatttaaaat tctggaagta atataaaagg gaaaatatat ttataagaaa 2940 gggataaagg taatagagcc cttctgcccc ccacccacca aatttacaca acaaaatgac 3000 atgttcgaat gtgaaaggtc ataatagctt tcccatcatg aatcagaaag atgtggacag 3060 cttgatgttt tagacaacca ctgaactaga tgactgttgt actgtagctc agtcatttaa 3120 aaaatatata aatactacct tgtagtgtcc catactgtgt tttttacatg gtagattctt 3180 atttaagtgc taactggtta ttttctttgg ctggtttatt gtactgttat acagaatgta 3240 agttgtacag tgaaataagt tattaaagca tgtgtaaaca ttgttatata tcttttctcc 3300 taaatggaga attttgaata aaatatattt gaaattttg 3339 <210> SEQ ID NO 2 <211> LENGTH: 30001 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 caaagaaaag ggggaggttt tgttaaaaaa gagaaatgtt acatagtgct ctttgagaaa 60 attcattggc actattaagg atctgaggag ctggtgagtt tcaactggtg agtgatggtg 120 gtagataaaa ttagagctgc agcaggtcat tttagcaact attagataaa actggtctca 180 ggtcacaacg ggcagttgca gcagctggac ttggagagaa ttacactgtg ggagcagtgt 240 catttgtcct aagtgctttt ctacccccta cccccactat tttagttggg tataaaaaga 300 atgacccaat ttgtatgatc aactttcaca aagcatagaa cagtaggaaa agggtctgtt 360 tctgcagaag gtgtagacgt tgagagccat tttgtgtatt tattcctccc tttcttcctc 420 ggtgaatgat taaaacgttc tgtgtgattt ttagtgatga aaaagattaa atgctactca 480 ctgtagtaag tgccatctca cacttgcaga tcaaaaggca cacagtttaa aaaacctttg 540 tttttttaca catctgagtg gtgtaaatgc tactcatctg tagtaagtgg aatctataca 600 cctgcagacc aaaagacgca aggtttcaaa aatctttgtg ttttttacac atcaaacaga 660 atggtacgtt tttcaaaagt taaaaaaaaa caactcatcc acatattgca actagcaaaa 720 atgacattcc ccagtgtgaa aatcatgctt gagagaattc ttacatgtaa aggcaaaatt 780 gcgatgactt tgcaggggac cgtgggattc ccgcccgcag tgccggagct gtcccctacc 840 agggtttgca gtggagtttt gaatgcactt aacagtgtct tacggtaaaa acaaaatttc 900 atccaccaat tatgtgttga gcgcccactg cctaccaagc acaaacaaaa ccattcaaaa 960 ccacgaaatc gtcttcactt tctccagatc cagcagcctc ccctattaag gttcgcacac 1020 gctattgcgc caacgctcct ccagagcggg tcttaagata aaagaacagg acaagttgcc 1080 ccgccccatt tcgctagcct cgtgagaaaa cgtcatcgca catagaaaac agacagacgt 1140 aacctacggt gtcccgctag gaaagagagg tgcgtcaaac agcgacaagt tccgcccacg 1200 taaaagatga cgcttggtgt gtcagccgtc cctgctgccc ggttgcttct cttttggggg 1260 cggggtctag caagagcagg tgtgggttta ggaggtgtgt gtttttgttt ttcccaccct 1320 ctctccccac tacttgctct cacagtactc gctgagggtg aacaagaaaa gacctgataa 1380 agattaacca gaagaaaaca aggagggaaa caaccgcagc ctgtagcaag ctctggaact 1440 caggagtcgc gcgctagggg ccggggccgg ggccggggcg tggtcggggc gggcccgggg 1500 gcgggcccgg ggcggggctg cggttgcggt gcctgcgccc gcggcggcgg aggcgcaggc 1560 ggtggcgagt gggtgagtga ggaggcggca tcctggcggg tggctgtttg gggttcggct 1620 gccgggaaga ggcgcgggta gaagcggggg ctctcctcag agctcgacgc atttttactt 1680 tccctctcat ttctctgacc gaagctgggt gtcgggcttt cgcctctagc gactggtgga 1740 attgcctgca tccgggcccc gggcttcccg gcggcggcgg cggcggcggc ggcgcaggga 1800 caagggatgg ggatctggcc tcttccttgc tttcccgccc tcagtacccg agctgtctcc 1860 ttcccgggga cccgctggga gcgctgccgc tgcgggctcg agaaaaggga gcctcgggta 1920 ctgagaggcc tcgcctgggg gaaggccgga gggtgggcgg cgcgcggctt ctgcggacca 1980 agtcggggtt cgctaggaac ccgagacggt ccctgccggc gaggagatca tgcgggatga 2040 gatgggggtg tggagacgcc tgcacaattt cagcccaagc ttctagagag tggtgatgac 2100 ttgcatatga gggcagcaat gcaagtcggt gtgctcccca ttctgtggga catgacctgg 2160 ttgcttcaca gctccgagat gacacagact tgcttaaagg aagtgactat tgtgacttgg 2220 gcatcacttg actgatggta atcagttgtc taaagaagtg cacagattac atgtccgtgt 2280 gctcattggg tctatctggc cgcgttgaac accaccaggc tttgtattca gaaacaggag 2340 ggaggtcctg cactttccca ggaggggtgg ccctttcaga tgcaatcgag attgttaggc 2400 tctgggagag tagttgcctg gttgtggcag ttggtaaatt tctattcaaa cagttgccat 2460 gcaccagttg ttcacaacaa gggtacgtaa tctgtctggc attacttcta cttttgtaca 2520 aaggatcaaa aaaaaaaaag atactgttaa gatatgattt ttctcagact ttgggaaact 2580 tttaacataa tctgtgaata tcacagaaac aagactatca tataggggat attaataacc 2640 tggagtcaga atacttgaaa tacggtgtca tttgacacgg gcattgttgt caccacctct 2700 gccaaggcct gccactttag gaaaaccctg aatcagttgg aaactgctac atgctgatag 2760 tacatctgaa acaagaacga gagtaattac cacattccag attgttcact aagccagcat 2820 ttacctgctc caggaaaaaa ttacaagcac cttatgaagt tgataaaata ttttgtttgg 2880 ctatgttggc actccacaat ttgctttcag agaaacaaag taaaccaagg aggacttctg 2940 tttttcaagt ctgccctcgg gttctattct acgttaatta gatagttccc aggaggacta 3000 ggttagccta cctattgtct gagaaacttg gaactgtgag aaatggccag atagtgatat 3060 gaacttcacc ttccagtctt ccctgatgtt gaagattgag aaagtgttgt gaactttctg 3120 gtactgtaaa cagttcactg tccttgaagt ggtcctgggc agctcctgtt gtggaaagtg 3180 gacggtttag gatcctgctt ctctttgggc tgggagaaaa taaacagcat ggttacaagt 3240 attgagagcc aggttggaga aggtggctta cacctgtaat gccagagctt tgggaggcgg 3300 aggcaagagg atcacttgaa gccaggagtt caagctcaac ctgggcaacg tagaccctgt 3360 ctctacaaaa aattaaaaac ttagccgggc gtggtgatgt gcacctgtag tcctagctac 3420 ttgggaggct gaggcaggag ggtcatttga gcccaagagt ttgaagttac cgagagctat 3480 gatcctgcca gtgcattcca gcctggatga caaaacgaga ccctgtctct aaaaaacaag 3540

aagtgagggc tttatgattg tagaattttc actacaatag cagtggacca accacctttc 3600 taaataccaa tcagggaaga gatggttgat tttttaacag acgtttaaag aaaaagcaaa 3660 acctcaaact tagcactcta ctaacagttt tagcagatgt taattaatgt aatcatgtct 3720 gcatgtatgg gattatttcc agaaagtgta ttgggaaacc tctcatgaac cctgtgagca 3780 agccaccgtc tcactcaatt tgaatcttgg cttccctcaa aagactggct aatgtttggt 3840 aactctctgg agtagacagc actacatgta cgtaagatag gtacataaac aactattggt 3900 tttgagctga tttttttcag ctgcatttgc atgtatggat ttttctcacc aaagacgatg 3960 acttcaagta ttagtaaaat aattgtacag ctctcctgat tatacttctc tgtgacattt 4020 catttcccag gctatttctt ttggtaggat ttaaaactaa gcaattcagt atgatctttg 4080 tccttcattt tctttcttat tctttttgtt tgtttgtttg tttgtttttt tcttgaggca 4140 gagtctctct ctgtcgccca ggctggagtg cagtggcgcc atctcagctc attgcaacct 4200 ctgccacctc cgggttcaag agattctcct gcctcagcct cccgagtagc tgggattaca 4260 ggtgtccacc accacacccg gctaattttt tgtattttta gtagaggtgg ggtttcacca 4320 tgttggccag gctggtcttg agctcctgac ctcaggtgat ccacctgcct cggcctacca 4380 aagagctggg ataacaggtg tgacccacca tgcccggccc attttttttt tcttattctg 4440 ttaggagtga gagtgtaact agcagtataa tagttcaatt ttcacaacgt ggtaaaagtt 4500 tccctataat tcaatcagat tttgctccag ggttcagttc tgttttagga aatactttta 4560 ttttcagttt aatgatgaaa tattagagtt gtaatattgc ctttatgatt atccaccttt 4620 ttaacctaaa agaatgaaag aaaaatatgt ttgcaatata attttatggt tgtatgttaa 4680 cttaattcat tatgttggcc tccagtttgc tgttgttagt tatgacagca gtagtgtcat 4740 taccatttca attcagatta cattcctata tttgatcatt gtaaactgac tgcttacatt 4800 gtattaaaaa cagtggatat tttaaagaag ctgtacggct tatatctagt gctgtctctt 4860 aagactatta aattgataca acatatttaa aagtaaatat tacctaaatg aatttttgaa 4920 attacaaata cacgtgttaa aactgtcgtt gtgttcaacc atttctgtac atacttagag 4980 ttaactgttt tgccaggctc tgtatgccta ctcataatat gataaaagca ctcatctaat 5040 gctctgtaaa tagaagtcag tgctttccat cagactgaac tctcttgaca agatgtggat 5100 gaaattcttt aagtaaaatt gtttactttg tcatacattt acagatcaaa tgttagctcc 5160 caaagcaatc atatggcaaa gataggtata tcatagtttg cctattagct gctttgtatt 5220 gctattatta taaatagact tcacagtttt agacttgctt aggtgaaatt gcaattcttt 5280 ttactttcag tcttagataa caagtcttca attatagtac aatcacacat tgcttaggaa 5340 tgcatcatta ggcgattttg tcattatgca aacatcatag agtgtactta cacaaaccta 5400 gatagtatag cctttatgta cctaggccgt atggtatagt ctgttgctcc taggccacaa 5460 acctgtacaa ctgttactgt actgaatact atagacagtt gtaacacagt ggtaaatatt 5520 tatctaaata tatgcaaaca gagaaaaggt acagtaaaag tatggtataa aagataatgg 5580 tatacctgtg taggccactt accacgaatg gagcttgcag gactagaagt tgctctgggt 5640 gagtcagtga gtgagtggtg aattaatgtg aaggcctaga acactgtaca ccactgtaga 5700 ctataaacac agtacgctga agctacacca aatttatctt aacagttttt cttcaataaa 5760 aaattataac tttttaactt tgtaaacttt ttaatttttt aacttttaaa atacttagct 5820 tgaaacacaa atacattgta tagctataca aaaatatttt ttctttgtat ccttattcta 5880 gaagcttttt tctattttct attttaaatt ttttttttta cttgttagtc gtttttgtta 5940 aaaactaaaa cacacacact ttcacctagg catagacagg attaggatca tcagtatcac 6000 tcccttccac ctcactgcct tccacctcca catcttgtcc cactggaagg tttttagggg 6060 caataacaca catgtagctg tcacctatga taacagtgct ttctgttgaa tacctcctga 6120 aggacttgcc tgaggctgtt ttacatttaa cttaaaaaaa aaaaaagtag aaggagtgca 6180 ctctaaaata acaataaaag gcatagtata gtgaatacat aaaccagcaa tgtagtagtt 6240 tattatcaag tgttgtacac tgtaataatt gtatgtgcta tactttaaat aacttgcaaa 6300 atagtactaa gaccttatga tggttacagt gtcactaagg caatagcata ttttcaggtc 6360 cattgtaatc taatgggact accatcatat atgcagtcta ccattgactg aaacgttaca 6420 tggcacataa ctgtatttgc aagaatgatt tgttttacat taatatcaca taggatgtac 6480 ctttttagag tggtatgttt atgtggatta agatgtacaa gttgagcaag gggaccaaga 6540 gccctgggtt ctgtcttgga tgtgagcgtt tatgttcttc tcctcatgtc tgttttctca 6600 ttaaattcaa aggcttgaac gggccctatt tagcccttct gttttctacg tgttctaaat 6660 aactaaagct tttaaattct agccatttag tgtagaactc tctttgcagt gatgaaatgc 6720 tgtattggtt tcttggctag catattaaat atttttatct ttgtcttgat acttcaatgt 6780 cgttttaaac atcaggatcg ggcttcagta ttctcataac cagagagttc actgaggata 6840 caggactgtt tgcccatttt ttgttatggc tccagacttg tggtatttcc atgtcttttt 6900 tttttttttt ttttttgacc ttttagcggc tttaaagtat ttctgttgtt aggtgttgta 6960 ttacttttct aagattactt aacaaagcac cacaaactga gtggctttaa acaacagcaa 7020 tttattctct cacaattcta gaagctagaa gtccgaaatc aaagtgttga caggggcatg 7080 atcttcaaga gagaagactc tttccttgcc tcttcctggc ttctggtggt taccagcaat 7140 cctgagtgtt cctttcttgc cttgtagttt caacaatcca gtatctgcct tttgtcttca 7200 catggctgtc taccatttgt ctctgtgtct ccaaatctct ctccttataa acacagcagt 7260 tattggatta ggccccactc taatccagta tgaccccatt ttaacatgat tacacttatt 7320 tctagataag gtcacattca cgtacaccaa gggttaggaa ttgaacatat ctttttgggg 7380 gacacaattc aacccacaag tgtcagtctc tagctgagcc tttcccttcc tgtttttctc 7440 ctttttagtt gctatgggtt aggggccaaa tctccagtca tactagaatt gcacatggac 7500 tggatatttg ggaatactgc gggtctattc tatgagcttt agtatgtaac atttaatatc 7560 agtgtaaaga agcccttttt taagttattt ctttgaattt ctaaatgtat gccctgaata 7620 taagtaacaa gttaccatgt cttgtaaaat gatcatatca acaaacattt aatgtgcacc 7680 tactgtgcta gttgaatgtc tttatcctga taggagataa caggattcca catctttgac 7740 ttaagaggac aaaccaaata tgtctaaatc atttggggtt ttgatggata tctttaaatt 7800 gctgaaccta atcattggtt tcatatgtca ttgtttagat atctccggag catttggata 7860 atgtgacagt tggaatgcag tgatgtcgac tctttgccca ccgccatctc cagctgttgc 7920 caagacagag attgctttaa gtggcaaatc acctttatta gcagctactt ttgcttactg 7980 ggacaatatt cttggtccta gagtaaggca catttgggct ccaaagacag aacaggtact 8040 tctcagtgat ggagaaataa cttttcttgc caaccacact ctaaatggag aaatccttcg 8100 aaatgcagag agtggtgcta tagatgtaaa gttttttgtc ttgtctgaaa agggagtgat 8160 tattgtttca ttaatctttg atggaaactg gaatggggat cgcagcacat atggactatc 8220 aattatactt ccacagacag aacttagttt ctacctccca cttcatagag tgtgtgttga 8280 tagattaaca catataatcc ggaaaggaag aatatggatg cataaggtaa gtgatttttc 8340 agcttattaa tcatgttaac ctatctgttg aaagcttatt ttctggtaca tataaatctt 8400 atttttttaa ttatatgcag tgaacatcaa acaataaatg ttatttattt tgcatttacc 8460 ctattagata caaatacatc tggtctgata cctgtcatct tcatattaac tgtggaaggt 8520 acgaaatggt agctccacat tatagatgaa aagctaaagc ttagacaaat aaagaaactt 8580 ttagaccctg gattcttctt gggagccttt gactctaata ccttttgttt ccctttcatt 8640 gcacaattct gtcttttgct tactactatg tgtaagtata acagttcaaa gtaatagttt 8700 cataagctgt tggtcatgta gcctttggtc tctttaacct ctttgccaag ttcccaggtt 8760 cataaaatga ggaggttgaa tggaatggtt cccaagagaa ttccttttaa tcttacagaa 8820 attattgttt tcctaaatcc tgtagttgaa tatataatgc tatttacatt tcagtatagt 8880 tttgatgtat ctaaagaaca cattgaattc tccttcctgt gttccagttt gatactaacc 8940 tgaaagtcca ttaagcatta ccagttttaa aaggcttttg cccaatagta aggaaaaata 9000 atatctttta aaagaataat tttttactat gtttgcaggc ttacttcctt ttttctcaca 9060 ttatgaaact cttaaaatca ggagaatctt ttaaacaaca tcataatgtt taatttgaaa 9120 agtgcaagtc attcttttcc tttttgaaac tatgcagatg ttacattgac tgttttctgt 9180 gaagttatct ttttttcact gcagaataaa ggttgttttg attttatttt gtattgttta 9240 tgagaacatg catttgttgg gttaatttcc tacccctgcc cccatttttt ccctaaagta 9300 gaaagtattt ttcttgtgaa ctaaattact acacaagaac atgtctattg aaaaataagc 9360 aagtatcaaa atgttgtggg ttgttttttt aaataaattt tctcttgctc aggaaagaca 9420 agaaaatgtc cagaagatta tcttagaagg cacagagaga atggaagatc aggtatatgc 9480 aaattgcata ctgtcaaatg tttttctcac agcatgtatc tgtataaggt tgatggctac 9540 atttgtcaag gccttggaga catacgaata agcctttaat ggagctttta tggaggtgta 9600 cagaataaac tggaggaaga tttccatatc ttaaacccaa agagttaaat cagtaaacaa 9660 aggaaaatag taattgcatc tacaaattaa tatttgctcc cttttttttt ctgtttgccc 9720 agaataaatt ttggataact tgttcatagt aaaaataaaa aaaattgtct ctgatatgtt 9780 ctttaaggta ctacttctcg aacctttccc tagaagtagc tgtaacagaa ggagagcata 9840 tgtacccctg aggtatctgt ctggggtgta ggcccaggtc cacacaatat ttcttctaag 9900 tcttatgttg tatcgttaag actcatgcaa tttacatttt attccataac tattttagta 9960 ttaaaatttg tcagtgatat ttcttaccct ctcctctagg aaaatgtgcc atgtttatcc 10020 cttggctttg aatgcccctc aggaacagac actaagagtt tgagaagcat ggttacaagg 10080 gtgtggcttc ccctgcggaa actaagtaca gactatttca ctgtaaagca gagaagttct 10140 tttgaaggag aatctccagt gaagaaagag ttcttcactt ttacttccat ttcctcttgt 10200 gggtgaccct caatgctcct tgtaaaactc caatatttta aacatggctg ttttgccttt 10260 ctttgcttct ttttagcatg aatgagacag atgatacttt aaaaaagtaa ttaaaaaaaa 10320 aaacttgtga aaatacatgg ccataataca gaacccaata caatgatctc ctttaccaaa 10380 ttgttatgtt tgtacttttg tagatagctt tccaattcag agacagttat tctgtgtaaa 10440 ggtctgactt aacaagaaaa gatttccctt tacccaaaga atcccagtcc ttatttgctg 10500 gtcaataagc agggtcccca ggaatggggt aactttcagc accctctaac ccactagtta 10560 ttagtagact aattaagtaa acttatcgca agttgaggaa acttagaacc aactaaaatt 10620 ctgcttttac tgggattttg ttttttcaaa ccagaaacct ttacttaagt tgactactat 10680 taatgaattt tggtctctct tttaagtgct cttcttaaaa atgttatctt actgctgaga 10740 agttcaagtt tgggaagtac aaggaggaat agaaacttaa gagattttct tttagagcct 10800 cttctgtatt tagccctgta ggattttttt tttttttttt ttttttggtg ttgttgagct 10860 tcagtgaggc tattcattca cttatactga taatgtctga gatactgtga atgaaatact 10920 atgtatgctt aaacctaaga ggaaatattt tcccaaaatt attcttcccg aaaaggagga 10980 gttgcctttt gattgagttc ttgcaaatct cacaacgact ttattttgaa caatactgtt 11040

tggggatgat gcattagttt gaaacaactt cagttgtagc tgtcatctga taaaattgct 11100 tcacagggaa ggaaatttaa cacggatcta gtcattattc ttgttagatt gaatgtgtga 11160 attgtaattg taaacaggca tgataattat tactttaaaa actaaaaaca gtgaatagtt 11220 agttgtggag gttactaaag gatggttttt ttttaaataa aactttcagc attatgcaaa 11280 tgggcatatg gcttaggata aaacttccag aagtagcatc acatttaaat tctcaagcaa 11340 cttaataata tggggctctg aaaaactggt taaggttact ccaaaaatgg ccctgggtct 11400 gacaaagatt ctaacttaaa gatgcttatg aagactttga gtaaaatcat ttcataaaat 11460 aagtgaggaa aaacaactag tattaaattc atcttaaata atgtatgatt taaaaaatat 11520 gtttagctaa aaatgcatag tcatttgaca atttcattta tatctcaaaa aatttactta 11580 accaagttgg tcacaaaact gatgagactg gtggtggtag tgaataaatg agggaccatc 11640 catatttgag acactttaca tttgtgatgt gttatactga attttcagtt tgattctata 11700 gactacaaat ttcaaaatta caatttcaag atgtaataag tagtaatatc ttgaaatagc 11760 tctaaaggga atttttctgt tttattgatt cttaaaatat atgtgctgat tttgatttgc 11820 atttgggtag attatacttt tatgagtatg gaggttaggt attgattcaa gttttcctta 11880 cctatttggt aaggatttca aagtcttttt gtgcttggtt ttcctcattt ttaaatatga 11940 aatatattga tgacctttaa caaatttttt ttatctcaaa ttttaaagga gatcttttct 12000 aaaagaggca tgatgactta atcattgcat gtaacagtaa acgataaacc aatgattcca 12060 tactctctaa agaataaaag tgagctttag ggccgggcat ggtcagaaat ttgacaccaa 12120 cctggccaac atggcgaaac cccgtctcta ctaaaaatac aaaaatcagc cgggcatggt 12180 ggcggcacct atagtcccag ctacttggga ggatgagaca ggagagtcac ttgaacctgg 12240 gaggagaggt tgcagtgagc tgagatcacg ccattgcact ccagcctgag caatgaaagc 12300 aaaactccat ctcaaaaaaa aaaaaagaaa agaaagaata aaagtgagct ttggattgca 12360 tataaatcct ttagacatgt agtagacttg tttgatactg tgtttgaaca aattacgaag 12420 tattttcatc aaagaatgtt attgtttgat gttattttta ttttttattg cccagcttct 12480 ctcatattac gtgattttct tcacttcatg tcactttatt gtgcagggtc agagtattat 12540 tccaatgctt actggagaag tgattcctgt aatggaactg ctttcatcta tgaaatcaca 12600 cagtgttcct gaagaaatag atgtaagttt aaatgagagc aattatacac tttatgagtt 12660 ttttggggtt atagtattat tatgtatatt attaatattc taattttaat agtaaggact 12720 ttgtcataca tactattcac atacagtatt agccacttta gcaaataagc acacacaaaa 12780 tcctggattt tatggcaaaa cagaggcatt tttgatcagt gatgacaaaa ttaaattcat 12840 tttgtttatt tcattacttt tataattcct aaaagtggga ggatcccagc tcttatagga 12900 gcaattaata tttaatgtag tgtcttttga aacaaaactg tgtgccaaag tagtaaccat 12960 taatggaagt ttacttgtag tcacaaattt agtttcctta atcatttgtt gaggacgttt 13020 tgaatcacac actatgagtg ttaagagata cctttaggaa actattcttg ttgttttctg 13080 attttgtcat ttaggttagt ctcctgattc tgacagctca gaagaggaag ttgttcttgt 13140 aaaaattgtt taacctgctt gaccagcttt cacatttgtt cttctgaagt ttatggtagt 13200 gcacagagat tgttttttgg ggagtcttga ttctcggaaa tgaaggcagt gtgttatatt 13260 gaatccagac ttccgaaaac ttgtatatta aaagtgttat ttcaacacta tgttacagcc 13320 agactaattt ttttattttt tgatgcattt tagatagctg atacagtact caatgatgat 13380 gatattggtg acagctgtca tgaaggcttt cttctcaagt aagaattttt cttttcataa 13440 aagctggatg aagcagatac catcttatgc tcacctatga caagatttgg aagaaagaaa 13500 ataacagact gtctacttag attgttctag ggacattacg tatttgaact gttgcttaaa 13560 tttgtgttat ttttcactca ttatatttct atatatattt ggtgttattc catttgctat 13620 ttaaagaaac cgagtttcca tcccagacaa gaaatcatgg ccccttgctt gattctggtt 13680 tcttgtttta cttctcatta aagctaacag aatcctttca tattaagttg tactgtagat 13740 gaacttaagt tatttaggcg tagaacaaaa ttattcatat ttatactgat ctttttccat 13800 ccagcagtgg agtttagtac ttaagagttt gtgcccttaa accagactcc ctggattaat 13860 gctgtgtacc cgtgggcaag gtgcctgaat tctctataca cctatttcct catctgtaaa 13920 atggcaataa tagtaatagt acctaatgtg tagggttgtt ataagcattg agtaagataa 13980 ataatataaa gcacttagaa cagtgcctgg aacataaaaa cacttaataa tagctcatag 14040 ctaacatttc ctatttacat ttcttctaga aatagccagt atttgttgag tgcctacatg 14100 ttagttcctt tactagttgc tttacatgta ttatcttata ttctgtttta aagtttcttc 14160 acagttacag attttcatga aattttactt ttaataaaag agaagtaaaa gtataaagta 14220 ttcactttta tgttcacagt cttttccttt aggctcatga tggagtatca gaggcatgag 14280 tgtgtttaac ctaagagcct taatggcttg aatcagaagc actttagtcc tgtatctgtt 14340 cagtgtcagc ctttcataca tcattttaaa tcccatttga ctttaagtaa gtcacttaat 14400 ctctctacat gtcaatttct tcagctataa aatgatggta tttcaataaa taaatacatt 14460 aattaaatga tattatactg actaattggg ctgttttaag gctcaataag aaaatttctg 14520 tgaaaggtct ctagaaaatg taggttccta tacaaataaa agataacatt gtgcttatag 14580 cttcggtgtt tatcatataa agctattctg agttatttga agagctcacc tacttttttt 14640 tgtttttagt ttgttaaatt gttttatagg caatgttttt aatctgtttt ctttaactta 14700 cagtgccatc agctcacact tgcaaacctg tggctgttcc gttgtagtag gtagcagtgc 14760 agagaaagta aataaggtag tttattttat aatctagcaa atgatttgac tctttaagac 14820 tgatgatata tcatggattg tcatttaaat ggtaggttgc aattaaaatg atctagtagt 14880 ataaggaggc aatgtaatct catcaaattg ctaagacacc ttgtggcaac agtgagtttg 14940 aaataaactg agtaagaatc atttatcagt ttattttgat agctcggaaa taccagtgtc 15000 agtagtgtat aaatggtttt gagaatatat taaaatcaga tatataaaaa aaattactct 15060 tctatttccc aatgttatct ttaacaaatc tgaagatagt catgtacttt tggtagtagt 15120 tccaaagaaa tgttatttgt ttattcatct tgatttcatt gtcttcgctt tccttctaaa 15180 tctgtccctt ctagggagct attgggatta agtggtcatt gattattata ctttattcag 15240 taatgtttct gaccctttcc ttcagtgcta cttgagttaa ttaaggatta atgaacagtt 15300 acatttccaa gcattagcta ataaactaaa ggattttgca cttttcttca ctgaccatta 15360 gttagaaaga gttcagagat aagtatgtgt atctttcaat ttcagcaaac ctaatttttt 15420 aaaaaaagtt ttacatagga aatatgttgg aaatgatact ttacaaagat attcataatt 15480 tttttttgta atcagctact ttgtatattt acatgagcct taatttatat ttctcatata 15540 accatttatg agagcttagt atacctgtgt cattatattg catctacgaa ctagtgacct 15600 tattccttct gttacctcaa acaggtggct ttccatctgt gatctccaaa gccttaggtt 15660 gcacagagtg actgccgagc tgctttatga agggagaaag gctccatagt tggagtgttt 15720 tttttttttt ttttaaacat ttttcccatc ctccatcctc ttgagggaga atagcttacc 15780 ttttatcttg ttttaatttg agaaagaagt tgccaccact ctaggttgaa aaccactcct 15840 ttaacataat aactgtggat atggtttgaa tttcaagata gttacatgcc tttttatttt 15900 tcctaataga gctgtaggtc aaatattatt agaatcagat ttctaaatcc cacccaatga 15960 cctgcttatt ttaaatcaaa ttcaataatt aattctcttc tttttggagg atctggacat 16020 tctttgatat ttcttacaac gaatttcatg tgtagaccca ctaaacagaa gctataaaag 16080 ttgcatggtc aaataagtct gagaaagtct gcagatgata taattcacct gaagagtcac 16140 agtatgtagc caaatgttaa aggttttgag atgccataca gtaaatttac caagcatttt 16200 ctaaatttat ttgaccacag aatccctatt ttaagcaaca actgttacat cccatggatt 16260 ccaggtgact aaagaatact tatttcttag gatatgtttt attgataata acaattaaaa 16320 tttcagatat ctttcataag caaatcagtg gtctttttac ttcatgtttt aatgctaaaa 16380 tattttcttt tatagatagt cagaacatta tgcctttttc tgactccagc agagagaaaa 16440 tgctccaggt tatgtgaagc agaatcatca tttaaatatg agtcagggct ctttgtacaa 16500 ggcctgctaa aggtatagtt tctagttatc acaagtgaaa ccacttttct aaaatcattt 16560 ttgagactct ttatagacaa atcttaaata ttagcattta atgtatctca tattgacatg 16620 cccagagact gacttccttt acacagttct gcacatagac tatatgtctt atggatttat 16680 agttagtatc atcagtgaaa caccatagaa taccctttgt gttccaggtg ggtccctgtt 16740 cctacatgtc tagcctcagg actttttttt ttttaacaca tgcttaaatc aggttgcaca 16800 tcaaaaataa gatcatttct ttttaactaa atagatttga attttattga aaaaaaattt 16860 taaacatctt taagaagctt ataggattta agcaattcct atgtatgtgt actaaaatat 16920 atatatttct atatataata tatattagaa aaaaattgta tttttctttt atttgagtct 16980 actgtcaagg agcaaaacag agaaatgtaa attagcaatt atttataata cttaaaggga 17040 agaaagttgt tcaccttgtt gaatctatta ttgttatttc aattatagtc ccaagacgtg 17100 aagaaatagc tttcctaatg gttatgtgat tgtctcatag tgactacttt cttgaggatg 17160 tagccacggc aaaatgaaat aaaaaaattt aaaaattgtt gcaaatacaa gttatattag 17220 gcttttgtgc attttcaata atgtgctgct atgaactcag aatgatagta tttaaatata 17280 gaaactagtt aaaggaaacg tagtttctat ttgagttata catatctgta aattagaact 17340 tctcctgtta aaggcataat aaagtgctta atacttttgt ttcctcagca ccctctcatt 17400 taattatata attttagttc tgaaagggac ctataccaga tgcctagagg aaatttcaaa 17460 actatgatct aatgaaaaaa tatttaatag ttctccatgc aaatacaaat catatagttt 17520 tccagaaaat acctttgaca ttatacaaag atgattatca cagcattata atagtaaaaa 17580 aatggaaata gcctctttct tctgttctgt tcatagcaca gtgcctcata cgcagtaggt 17640 tattattaca tggtaactgg ctaccccaac tgattaggaa agaagtaaat ttgttttata 17700 aaaatacata ctcattgagg tgcatagaat aattaagaaa ttaaaagaca cttgtaattt 17760 tgaatccagt gaatacccac tgttaatatt tggtatatct ctttctagtc tttttttccc 17820 ttttgcatgt attttcttta agactcccac ccccactgga tcatctctgc atgttctaat 17880 ctgctttttt cacagcagat tctaagcctc tttgaatatc aacacaaact tcaacaactt 17940 catctataga tgccaaataa taaattcatt tttatttact taaccacttc ctttggatgc 18000 ttaggtcatt ctgatgtttt gctattgaaa ccaatgctat actgaacact tctgtcacta 18060 aaactttgca cacactcatg aatagcttct taggataaat ttttagagat ggatttgcta 18120 aatcagagac cattttttaa aattaaaaaa caattattca tatcgtttgg catgtaagac 18180 agtaaatttt ccttttattt tgacaggatt caactggaag ctttgtgctg cctttccggc 18240 aagtcatgta tgctccatat cccaccacac acatagatgt ggatgtcaat actgtgaagc 18300 agatgccacc ctgtcatgaa catatttata atcagcgtag atacatgaga tccgagctga 18360 cagccttctg gagagccact tcagaagaag acatggctca ggatacgatc atctacactg 18420 acgaaagctt tactcctgat ttgtacgtaa tgctctgcct gctggtactg tagtcaagca 18480 atatgaaatt gtgtctttta cgaataaaaa caaaacagaa gttgcattta aaaagaaaga 18540 aatattacca gcagaattat gcttgaagaa acatttaatc aagcattttt ttcttaaatg 18600

ttcttctttt tccatacaat tgtgtttacc ctaaaatagg taagattaac ccttaaagta 18660 aatatttaac tatttgttta ataaatatat attgagctcc taggcactgt tctaggtacc 18720 gggcttaata gtggccaacc agacagcccc agccccagcc cctacattgt gtatagtcta 18780 ttatgtaaca gttattgaat ggacttatta acaaaaccaa agaagtaatt ctaagtcttt 18840 tttttcttga catatgaata taaaatacag caaaactgtt aaaatatatt aatggaacat 18900 ttttttactt tgcattttat attgttattc acttcttatt tttttttaaa aaaaaaagcc 18960 tgaacagtaa attcaaaagg aaaagtaatg ataattaatt gttgagcatg gacccaactt 19020 gaaaaaaaaa atgatgatga taaatctata atcctaaaac cctaagtaaa cacttaaaag 19080 atgttctgaa atcaggaaaa gaattatagt atacttttgt gtttctcttt tatcagttga 19140 aaaaaggcac agtagctcat gcctgtaaga acagagcttt gggagtgcaa ggcaggcgga 19200 tcacttgagg ccaggagttc cagaccagcc tgggcaacat agtgaaaccc catctctaca 19260 aaaaataaaa aagaattatt ggaatgtgtt tctgtgtgcc tgtaatccta gctattccga 19320 aagctgaggc aggaggatct tttgagccca ggagtttgag gttacaggga gttatgatgt 19380 gccagtgtac tccagcctgg ggaacaccga gactctgtct tatttaaaaa aaaaaaaaaa 19440 aaaatgcttg caataatgcc tggcacatag aaggtaacag taagtgttaa ctgtaataac 19500 ccaggtctaa gtgtgtaagg caatagaaaa attggggcaa ataagcctga cctatgtatc 19560 tacagaatca gtttgagctt aggtaacaga cctgtggagc accagtaatt acacagtaag 19620 tgttaaccaa aagcatagaa taggaatatc ttgttcaagg gacccccagc cttatacatc 19680 tcaaggtgca gaaagatgac ttaatatagg acccattttt tcctagttct ccagagtttt 19740 tattggttct tgagaaagta gtaggggaat gttttagaaa atgaattggt ccaactgaaa 19800 ttacatgtca gtaagttttt atatattggt aaattttagt agacatgtag aagttttcta 19860 attaatctgt gccttgaaac attttctttt ttcctaaagt gcttagtatt ttttccgttt 19920 tttgattggt tacttgggag cttttttgag gaaatttagt gaactgcaga atgggtttgc 19980 aaccatttgg tatttttgtt ttgtttttta gaggatgtat gtgtatttta acatttctta 20040 atcattttta gccagctatg tttgttttgc tgatttgaca aactacagtt agacagctat 20100 tctcattttg ctgatcatga caaaataata tcctgaattt ttaaattttg catccagctc 20160 taaattttct aaacataaaa ttgtccaaaa aatagtattt tcagccacta gattgtgtgt 20220 taagtctatt gtcacagagt cattttactt ttaagtatat gtttttacat gttaattatg 20280 tttgttattt ttaattttaa ctttttaaaa taattccagt cactgccaat acatgaaaaa 20340 ttggtcactg gaattttttt tttgactttt attttaggtt catgtgtaca tgtgcaggtg 20400 tgttatacag gtaaattgcg tgtcatgagg gtttggtgta caggtgattt cattacccag 20460 gtaataagca tagtacccaa taggtagttt tttgatcctc acccttctcc caccctcaag 20520 taggccctgg tgttgctgtt tccttctttg tgtccatgta tactcagtgt ttagctccca 20580 cttagaagtg agaacatgcg gtagttggtt ttctgttcct ggattagttc acttaggata 20640 atgacctcta gctccatctg gtttttatgg ctgcatagta ttccatggtg tatatgtatc 20700 acattttctt tatccagtct accattgata ggcatttagg ttgattccct gtctttgtta 20760 tcatgaatag tgctgtgatg aacatacaca tgcatgtgtc tttatggtag aaaaatttgt 20820 attcctttag gtacatatag aataatgggg ttgctagggt gaatggtagt tctattttca 20880 gttatttgag aaatcttcaa actgcttttc ataatagcta aactaattta cagtcccgcc 20940 agcagtgtat aagtgttccc ttttctccac aaccttgcca acatctgtga ttttttgact 21000 ttttaataat agccattcct agagaattga tttgcaattc tctattagtg atattaagca 21060 ttttttcata tgctttttag ctgtctgtat atattcttct gaaaaatttt catgtccttt 21120 gcccagtttg tagtggggtg ggttgttttt tgcttgttaa ttagttttaa gttccttcca 21180 gattctgcat atccctttgt tggatacatg gtttgcagat atttttctcc cattgtgtag 21240 gttgtctttt actctgttga tagtttcttt tgccatgcag gagctcgtta ggtcccattt 21300 gtgtttgttt ttgttgcagt tgcttttggc gtcttcatca taaaatctgt gccagggcct 21360 atgtccagaa tggtatttcc taggttgtct tccagggttt ttacaatttt agattttacg 21420 tttatgtctt taatccatct tgagttgatt tttgtatatg gcacaaggaa ggggtccagt 21480 ttcactccaa ttcctatggc tagcaattat cccagcacca tttattgaat acggagtcct 21540 ttccccattg cttgtttttt gtcaactttg ttgaagatca gatggttgta agtgtgtggc 21600 tttatttctt ggctctctat tctccattgg tctatgtgtc tgtttttata acagtaccct 21660 gctgttcagg ttcctatagc cttttagtat aaaatcggct aatgtgatgc ctccagcttt 21720 gttctttttg cttaggattg ctttggctat ttgggctcct ttttgggtcc atattaattt 21780 taaaacagtt ttttctggtt ttgtgaagga tatcattggt agtttatagg aatagcattg 21840 aatctgtaga ttgctttggg cagtatggcc attttaacaa tattaattct tcctatctat 21900 gaatatggaa tgtttttcca tgtgtttgtg tcatctcttt atacctgatg tataaagaaa 21960 agctggtatt attcctactc aatctgttcc aaaaaattga ggaggaggaa ctcttcccta 22020 atgaggccag catcattctg ataccaaaac ctggcagaga cacaacagaa aaaagaaaac 22080 ttcaggccaa tatccttgat gaatatagat gcaaaaatcc tcaacaaaat actagcaaac 22140 caaatccagc agcacatcaa aaagctgatc tactttgatc aagtaggctt tatccctggg 22200 atgcaaggtt ggttcaacat acacaaatca ataagtgtga ttcatcacat aaacagagct 22260 aaaaacaaaa accacaagat tatctcaata ggtagagaaa aggttgtcaa taaaatttaa 22320 catcctccat gttaaaaacc ttcagtaggt caggtgtagt gactcacacc tgtaatccca 22380 gcactttggg aggccaaggc gggcatatct cttaagccca ggagttcaag acgagcctag 22440 gcagcatggt gaaaccccat ctctacaaaa aaaaaaaaaa aaaaaaatta gcttggtatg 22500 gtgacatgca cctatagtcc cagctattca ggaggttgag gtgggaggat tgtttgagcc 22560 cgggaggcag aggttggcag cgagctgaga tcatgccacc gcactccagc ctgggcaacg 22620 gagtgagacc ctgtctcaaa aaagaaaaat cacaaacaat cctaaacaaa ctaggcattg 22680 aaggaacatg cctcaaaaaa ataagaacca tctatgacag acccatagcc aatatcttac 22740 caaatgggca aaagctggaa gtattctcct tgagaaccgt aacaagacaa ggatgtccac 22800 tctcaccact ccttttcagc atagttctgg aagtcctagc cagagcaatc aggaaagaga 22860 aagaaagaaa gacattcaga taggaagaga agaagtcaaa ctatttctgt ttgcaggcag 22920 tataattctg tacctagaaa atctcatagt ctctgcccag aaactcctaa atctgttaaa 22980 aatttcagca aagttttggc attctctata ctccaacacc ttccaaagtg agagcaaaat 23040 caagaacaca gtcccattca caatagccgc aaaacgaata aaatacctag gaatccagct 23100 aaccagggag gtgaaagatc tctatgagaa ttacaaaaca ctgctgaaag aaatcagaga 23160 tgacacaaac aaatggaaat gttctttttt aacaccttgc tttatctaat tcacttatga 23220 tgaagatact cattcagtgg aacaggtata ataagtccac tcgattaaat ataagcctta 23280 ttctctttcc agagcccaag aaggggcact atcagtgccc agtcaataat gacgaaatgc 23340 taatattttt cccctttacg gtttctttct tctgtagtgt ggtacactcg tttcttaaga 23400 taaggaaact tgaactacct tcctgtttgc ttctacacat acccattctc tttttttgcc 23460 actctggtca ggtataggat gatccctacc actttcagtt aaaaactcct cctcttacta 23520 aatgttctct taccctctgg cctgagtaga acctagggaa aatggaagag aaaaagatga 23580 aagggaggtg gggcctggga agggaataag tagtcctgtt tgtttgtgtg tttgctttag 23640 cacctgctat atcctaggtg ctgtgttagg cacacattat tttaagtggc cattatatta 23700 ctactactca ctctggtcgt tgccaaggta ggtagtactt tcttggatag ttggttcatg 23760 ttacttacag atggtgggct tgttgaggca aacccagtgg ataatcatcg gagtgtgttc 23820 tctaatctca ctcaaatttt tcttcacatt ttttggtttg ttttggtttt tgatggtagt 23880 ggcttatttt tgttgctggt ttgttttttg tttttttttg agatggcaag aattggtagt 23940 tttatttatt aattgcctaa gggtctctac tttttttaaa agatgagagt agtaaaatag 24000 attgatagat acatacatac ccttactggg gactgcttat attctttaga gaaaaaatta 24060 catattagcc tgacaaacac cagtaaaatg taaatatatc cttgagtaaa taaatgaatg 24120 tatattttgt gtctccaaat atatatatct atattcttac aaatgtgttt atatgtaata 24180 tcaatttata agaacttaaa atgttggctc aagtgaggga ttgtggaagg tagcattata 24240 tggccatttc aacatttgaa cttttttctt ttcttcattt tcttcttttc ttcaggaata 24300 tttttcaaga tgtcttacac agagacactc tagtgaaagc cttcctggat caggtaaatg 24360 ttgaacttga gattgtcaga gtgaatgata tgacatgttt tcttttttaa tatatcctac 24420 aatgcctgtt ctatatattt atattcccct ggatcatgcc ccagagttct gctcagcaat 24480 tgcagttaag ttagttacac tacagttctc agaagagtct gtgagggcat gtcaagtgca 24540 tcattacatt ggttgcctct tgtcctagat ttatgcttcg ggaattcaga cctttgttta 24600 caatataata aatattattg ctatctttta aagatataat aataagatat aaagttgacc 24660 acaactactg ttttttgaaa catagaattc ctggtttaca tgtatcaaag tgaaatctga 24720 cttagctttt acagatataa tatatacata tatatatcct gcaatgcttg tactatatat 24780 gtagtacaag tatatatata tgtttgtgtg tgtatatata tatagtacga gcatatatac 24840 atattaccag cattgtagga tatatatatg tttatatatt aaaaaaaagt tataaactta 24900 aaaccctatt atgttatgta gagtatatgt tatatatgat atgtaaaata tataacatat 24960 actctatgat agagtgtaat atatttttta tatatatttt aacatttata aaatgataga 25020 attaagaatt gagtcctaat ctgttttatt aggtgctttt tgtagtgtct ggtctttcta 25080 aagtgtctaa atgatttttc cttttgactt attaatgggg aagagcctgt atattaacaa 25140 ttaagagtgc agcattccat acgtcaaaca acaaacattt taattcaagc attaacctat 25200 aacaagtaag tttttttttt ttttttgaga aagggaggtt gtttatttgc ctgaaatgac 25260 tcaaaaatat ttttgaaaca tagtgtactt atttaaataa catctttatt gtttcattct 25320 tttaaaaaat atctacttaa ttacacagtt gaaggaaatc gtagattata tggaacttat 25380 ttcttaatat attacagttt gttataataa cattctgggg atcaggccag gaaactgtgt 25440 catagataaa gctttgaaat aatgagatcc ttatgtttac tagaaatttt ggattgagat 25500 ctatgaggtc tgtgacatat tgcgaagttc aaggaaaatt cgtaggcctg gaatttcatg 25560 cttctcaagc tgacataaaa tccctcccac tctccacctc atcatatgca cacattctac 25620 tcctacccac ccactccacc ccctgcaaaa gtacaggtat atgaatgtct caaaaccata 25680 ggctcatctt ctaggagctt caatgttatt tgaagatttg ggcagaaaaa attaagtaat 25740 acgaaataac ttatgtatga gttttaaaag tgaagtaaac atggatgtat tctgaagtag 25800 aatgcaaaat ttgaatgcat ttttaaagat aaattagaaa acttctaaaa actgtcagat 25860 tgtctgggcc tggtggctta tgcctgtaat cccagcactt tgggagtccg aggtgggtgg 25920 atcacaaggt caggagatcg agaccatcct gccaacatgg tgaaaccccg tctctactaa 25980 gtatacaaaa attagctggg cgtggcagcg tgtgcctgta atcccagcta cctgggaggc 26040 tgaggcagga gaatcgcttg aacccaggag gtgtaggttg cagtgagtca agatcgcgcc 26100

actgcacttt agcctggtga cagagctaga ctccgtctca aaaaaaaaaa aaaatatcag 26160 attgttccta cacctagtgc ttctatacca cactcctgtt agggggcatc agtggaaatg 26220 gttaaggaga tgtttagtgt gtattgtctg ccaagcactg tcaacactgt catagaaact 26280 tctgtacgag tagaatgtga gcaaattatg tgttgaaatg gttcctctcc ctgcaggtct 26340 ttcagctgaa acctggctta tctctcagaa gtactttcct tgcacagttt ctacttgtcc 26400 ttcacagaaa agccttgaca ctaataaaat atatagaaga cgatacgtga gtaaaactcc 26460 tacacggaag aaaaaccttt gtacattgtt tttttgtttt gtttcctttg tacattttct 26520 atatcataat ttttgcgctt cttttttttt tttttttttt tttttttcca ttatttttag 26580 gcagaaggga aaaaagccct ttaaatctct tcggaacctg aagatagacc ttgatttaac 26640 agcagagggc gatcttaaca taataatggc tctggctgag aaaattaaac caggcctaca 26700 ctcttttatc tttggaagac ctttctacac tagtgtgcaa gaacgagatg ttctaatgac 26760 tttttaaatg tgtaacttaa taagcctatt ccatcacaat catgatcgct ggtaaagtag 26820 ctcagtggtg tggggaaacg ttcccctgga tcatactcca gaattctgct ctcagcaatt 26880 gcagttaagt aagttacact acagttctca caagagcctg tgaggggatg tcaggtgcat 26940 cattacattg ggtgtctctt ttcctagatt tatgcttttg ggatacagac ctatgtttac 27000 aatataataa atattattgc tatcttttaa agatataata ataggatgta aacttgacca 27060 caactactgt ttttttgaaa tacatgattc atggtttaca tgtgtcaagg tgaaatctga 27120 gttggctttt acagatagtt gactttctat cttttggcat tctttggtgt gtagaattac 27180 tgtaatactt ctgcaatcaa ctgaaaacta gagcctttaa atgatttcaa ttccacagaa 27240 agaaagtgag cttgaacata ggatgagctt tagaaagaaa attgatcaag cagatgttta 27300 attggaattg attattagat cctactttgt ggatttagtc cctgggattc agtctgtaga 27360 aatgtctaat agttctctat agtccttgtt cctggtgaac cacagttagg gtgttttgtt 27420 tattttattg ttcttgctat tgttgatatt ctatgtagtt gagctctgta aaaggaaatt 27480 gtattttatg ttttagtaat tgttgccaac tttttaaatt aattttcatt atttttgagc 27540 caaattgaaa tgtgcacctc ctgtgccttt tttctcctta gaaaatctaa ttacttggaa 27600 caagttcaga tttcactggt cagtcatttt catcttgttt tcttcttgct aagtcttacc 27660 atgtacctgc tttggcaatc attgcaactc tgagattata aaatgcctta gagaatatac 27720 taactaataa gatctttttt tcagaaacag aaaatagttc cttgagtact tccttcttgc 27780 atttctgcct atgtttttga agttgttgct gtttgcctgc aataggctat aaggaatagc 27840 aggagaaatt ttactgaagt gctgttttcc taggtgctac tttggcagag ctaagttatc 27900 ttttgttttc ttaatgcgtt tggaccattt tgctggctat aaaataactg attaatataa 27960 ttctaacaca atgttgacat tgtagttaca caaacacaaa taaatatttt atttaaaatt 28020 ctggaagtaa tataaaaggg aaaatatatt tataagaaag ggataaaggt aatagagccc 28080 ttctgccccc cacccaccaa atttacacaa caaaatgaca tgttcgaatg tgaaaggtca 28140 taatagcttt cccatcatga atcagaaaga tgtggacagc ttgatgtttt agacaaccac 28200 tgaactagat gactgttgta ctgtagctca gtcatttaaa aaatatataa atactacctt 28260 gtagtgtccc atactgtgtt ttttacatgg tagattctta tttaagtgct aactggttat 28320 tttctttggc tggtttattg tactgttata cagaatgtaa gttgtacagt gaaataagtt 28380 attaaagcat gtgtaaacat tgttatatat cttttctcct aaatggagaa ttttgaataa 28440 aatatatttg aaattttgcc tctttcagtt gttcattcag aaaaaaatac tatgatattt 28500 gaagactgat cagcttctgt tcagctgaca gtcatgctgg atctaaactt tttttaaaat 28560 taattttgtc ttttcaaaga aaaaatattt aaagaagctt tataatataa tcttatgtta 28620 aaaaaacttt ctgcttaact ctctggattt cattttgatt tttcaaatta tatattaata 28680 tttcaaatgt aaaatactat ttagataaat tgtttttaaa cattcttatt attataatat 28740 taatataacc taaactgaag ttattcatcc caggtatcta atacatgtat ccaaagtaaa 28800 aatccaagga atctgaacac tttcatctgc aaagctagga ataggtttga cattttcact 28860 ccaagaaaaa gttttttttt gaaaatagaa tagttgggat gagaggtttc tttaaaagaa 28920 gactaactga tcacattact atgattctca aagaagaaac caaaacttca tataatacta 28980 taaagtaaat ataaaatagt tccttctata gtatatttct ataatgctac agtttaaaca 29040 gatcactctt atataatact attttgattt tgatgtagaa ttgcacaaat tgatatttct 29100 cctatgatct gcagggtata gcttaaagta acaaaaacag tcaaccacct ccatttaaca 29160 cacagtaaca ctatgggact agttttatta cttccatttt acaaatgagg aaactaaagc 29220 ttaaagatgt gtaatacacc gcccaaggtc acacagctgg taaaggtgga tttcatccca 29280 gacagttaca gtcattgcca tgggcacagc tcctaactta gtaactccat gtaactggta 29340 ctcagtgtag ctgaattgaa aggagagtaa ggaagcaggt tttacaggtc tacttgcact 29400 attcagagcc cgagtgtgaa tccctgctgt gctgcttgga gaagttactt aacctatgca 29460 aggttcattt tgtaaatatt ggaaatggag tgataatacg tacttcacca gaggatttaa 29520 tgagacctta tacgatcctt agttcagtac ctgactagtg cttcataaat gctttttcat 29580 ccaatctgac aatctccagc ttgtaattgg ggcatttaga acatttaata tgattattgg 29640 catggtaggt taaagctgtc atcttgctgt tttctatttg ttctttttgt tttctcctta 29700 cttttggatt tttttattct actatgtctt ttctattgtc ttattaacta tactctttga 29760 tttattttag tggttgtttt agggttatac ctctttctaa tttaccagtt tataaccagt 29820 ttatatacta cttgacatat agcttaagaa acttactgtt gttgtctttt tgctgttatg 29880 gtcttaacgt ttttatttct acaaacatta taaactccac actttattgt tttttaattt 29940 tacttataca gtcaattatc ttttaaagat atttaaatat aaacattcaa aacaccccaa 30000 t 30001 <210> SEQ ID NO 3 <211> LENGTH: 1031 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 attcccggga tacgtaacct acggtgtccc gctaggaaag agaggtgcgt caaacagcga 60 caagttccgc ccacgtaaaa gatgacgctt ggtgtgtcag ccgtccctgc tgcccggttg 120 cttctctttt gggggcgggg tctagcaaga gcaggtgtgg gtttaggaga tatctccgga 180 gcatttggat aatgtgacag ttggaatgca gtgatgtcga ctctttgccc accgccatct 240 ccagctgttg ccaagacaga gattgcttta agtggcaaat cacctttatt agcagctact 300 tttgcttact gggacaatat tcttggtcct agagtaaggc acatttgggc tccaaagaca 360 gaacaggtac ttctcagtga tggagaaata acttttcttg ccaaccacac tctaaatgga 420 gaaatccttc gaaatgcaga gagtggtgct atagatgtaa agttttttgt cttgtctgaa 480 aagggagtga ttattgtttc attaatcttt gatggaaact ggaatgggga tcgcagcaca 540 tatggactat caattatact tccacagaca gaacttagtt tctacctccc acttcataga 600 gtgtgtgttg atagattaac acatataatc cggaaaggaa gaatatggat gcataaggaa 660 agacaagaaa aatgtccaga agattatctt agaaggcaca gagagaatgg aagatcaggg 720 tcagagtatt attccaatgc ttactggaga agtgattcct gtaatggaaa ctgctttcct 780 ctatgaaatt cccccgggtt cctggaggaa atagatatag gctgatacag ttacccaatg 840 atggatgaat attgggggac cgcctggtca ttgaaaggct ttcttttctc caggaaagaa 900 atttttttcc ttttccataa aaagcttggg aatggaagac aacaattccc attctttttt 960 tgcgttccac ccctatgtga caacagaaat ttttggggaa acaacaacga aaaaatttta 1020 tcccgcgcgc a 1031 <210> SEQ ID NO 4 <211> LENGTH: 3244 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 4 gggcggggct gcggttgcgg tgcctgcgcc cgcggcggcg gaggcgcagg cggtggcgag 60 tggatatctc cggagcattt ggataatgtg acagttggaa tgcagtgatg tcgactcttt 120 gcccaccgcc atctccagct gttgccaaga cagagattgc tttaagtggc aaatcacctt 180 tattagcagc tacttttgct tactgggaca atattcttgg tcctagagta aggcacattt 240 gggctccaaa gacagaacag gtacttctca gtgatggaga aataactttt cttgccaacc 300 acactctaaa tggagaaatc cttcgaaatg cagagagtgg tgctatagat gtaaagtttt 360 ttgtcttgtc tgaaaaggga gtgattattg tttcattaat ctttgatgga aactggaatg 420 gggatcgcag cacatatgga ctatcaatta tacttccaca gacagaactt agtttctacc 480 tcccacttca tagagtgtgt gttgatagat taacacatat aatccggaaa ggaagaatat 540 ggatgcataa ggaaagacaa gaaaatgtcc agaagattat cttagaaggc acagagagaa 600 tggaagatca gggtcagagt attattccaa tgcttactgg agaagtgatt cctgtaatgg 660 aactgctttc atctatgaaa tcacacagtg ttcctgaaga aatagatata gctgatacag 720 tactcaatga tgatgatatt ggtgacagct gtcatgaagg ctttcttctc aatgccatca 780 gctcacactt gcaaacctgt ggctgttccg ttgtagtagg tagcagtgca gagaaagtaa 840 ataagatagt cagaacatta tgcctttttc tgactccagc agagagaaaa tgctccaggt 900 tatgtgaagc agaatcatca tttaaatatg agtcagggct ctttgtacaa ggcctgctaa 960 aggattcaac tggaagcttt gtgctgcctt tccggcaagt catgtatgct ccatatccca 1020 ccacacacat agatgtggat gtcaatactg tgaagcagat gccaccctgt catgaacata 1080 tttataatca gcgtagatac atgagatccg agctgacagc cttctggaga gccacttcag 1140 aagaagacat ggctcaggat acgatcatct acactgacga aagctttact cctgatttga 1200 atatttttca agatgtctta cacagagaca ctctagtgaa agccttcctg gatcaggtct 1260 ttcagctgaa acctggctta tctctcagaa gtactttcct tgcacagttt ctacttgtcc 1320 ttcacagaaa agccttgaca ctaataaaat atatagaaga cgatacgcag aagggaaaaa 1380 agccctttaa atctcttcgg aacctgaaga tagaccttga tttaacagca gagggcgatc 1440 ttaacataat aatggctctg gctgagaaaa ttaaaccagg cctacactct tttatctttg 1500 gaagaccttt ctacactagt gtgcaagaac gagatgttct aatgactttt taaatgtgta 1560 acttaataag cctattccat cacaatcatg atcgctggta aagtagctca gtggtgtggg 1620 gaaacgttcc cctggatcat actccagaat tctgctctca gcaattgcag ttaagtaagt 1680 tacactacag ttctcacaag agcctgtgag gggatgtcag gtgcatcatt acattgggtg 1740 tctcttttcc tagatttatg cttttgggat acagacctat gtttacaata taataaatat 1800 tattgctatc ttttaaagat ataataatag gatgtaaact tgaccacaac tactgttttt 1860 ttgaaataca tgattcatgg tttacatgtg tcaaggtgaa atctgagttg gcttttacag 1920 atagttgact ttctatcttt tggcattctt tggtgtgtag aattactgta atacttctgc 1980 aatcaactga aaactagagc ctttaaatga tttcaattcc acagaaagaa agtgagcttg 2040

aacataggat gagctttaga aagaaaattg atcaagcaga tgtttaattg gaattgatta 2100 ttagatccta ctttgtggat ttagtccctg ggattcagtc tgtagaaatg tctaatagtt 2160 ctctatagtc cttgttcctg gtgaaccaca gttagggtgt tttgtttatt ttattgttct 2220 tgctattgtt gatattctat gtagttgagc tctgtaaaag gaaattgtat tttatgtttt 2280 agtaattgtt gccaactttt taaattaatt ttcattattt ttgagccaaa ttgaaatgtg 2340 cacctcctgt gccttttttc tccttagaaa atctaattac ttggaacaag ttcagatttc 2400 actggtcagt cattttcatc ttgttttctt cttgctaagt cttaccatgt acctgctttg 2460 gcaatcattg caactctgag attataaaat gccttagaga atatactaac taataagatc 2520 tttttttcag aaacagaaaa tagttccttg agtacttcct tcttgcattt ctgcctatgt 2580 ttttgaagtt gttgctgttt gcctgcaata ggctataagg aatagcagga gaaattttac 2640 tgaagtgctg ttttcctagg tgctactttg gcagagctaa gttatctttt gttttcttaa 2700 tgcgtttgga ccattttgct ggctataaaa taactgatta atataattct aacacaatgt 2760 tgacattgta gttacacaaa cacaaataaa tattttattt aaaattctgg aagtaatata 2820 aaagggaaaa tatatttata agaaagggat aaaggtaata gagcccttct gccccccacc 2880 caccaaattt acacaacaaa atgacatgtt cgaatgtgaa aggtcataat agctttccca 2940 tcatgaatca gaaagatgtg gacagcttga tgttttagac aaccactgaa ctagatgact 3000 gttgtactgt agctcagtca tttaaaaaat atataaatac taccttgtag tgtcccatac 3060 tgtgtttttt acatggtaga ttcttattta agtgctaact ggttattttc tttggctggt 3120 ttattgtact gttatacaga atgtaagttg tacagtgaaa taagttatta aagcatgtgt 3180 aaacattgtt atatatcttt tctcctaaat ggagaatttt gaataaaata tatttgaaat 3240 tttg 3244 <210> SEQ ID NO 5 <211> LENGTH: 761 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (693)..(693) <223> OTHER INFORMATION: n is a, c, g, or t <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (722)..(722) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 5 cacgaggctt tgatatttct tacaacgaat ttcatgtgta gacccactaa acagaagcta 60 taaaagttgc atggtcaaat aagtctgaga aagtctgcag atgatataat tcacctgaag 120 agtcacagta tgtagccaaa tgttaaaggt tttgagatgc catacagtaa atttaccaag 180 cattttctaa atttatttga ccacagaatc cctattttaa gcaacaactg ttacatccca 240 tggattccag gtgactaaag aatacttatt tcttaggata tgttttattg ataataacaa 300 ttaaaatttc agatatcttt cataagcaaa tcagtggtct ttttacttca tgttttaatg 360 ctaaaatatt ttcttttata gatagtcaga acattatgcc tttttctgac tccagcagag 420 agaaaatgct ccaggttatg tgaagcagaa tcatcattta aatatgagtc agggctcttt 480 gtacaaggcc tgctaaagga ttcaactgga agctttgtgc tgcctttccg gcaagtcatg 540 tatgctccat atcccaccac acacatagat gtggatgtca atactgtgaa gcagatgcca 600 ccctgtcatg aacatattta taatcagcgt agatacatga gatccgagct gacagccttc 660 tggagagcca cttcagaaga agacatggct cangatacga tcatctacac tgacgaaagc 720 tntactcctg atttgaatat ttttcaagat gtcttacaca g 761 <210> SEQ ID NO 6 <211> LENGTH: 1901 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 6 acgtaaccta cggtgtcccg ctaggaaaga gaggtgcgtc aaacagcgac aagttccgcc 60 cacgtaaaag atgacgcttg atatctccgg agcatttgga taatgtgaca gttggaatgc 120 agtgatgtcg actctttgcc caccgccatc tccagctgtt gccaagacag agattgcttt 180 aagtggcaaa tcacctttat tagcagctac ttttgcttac tgggacaata ttcttggtcc 240 tagagtaagg cacatttggg ctccaaagac agaacaggta cttctcagtg atggagaaat 300 aacttttctt gccaaccaca ctctaaatgg agaaatcctt cgaaatgcag agagtggtgc 360 tatagatgta aagttttttg tcttgtctga aaagggagtg attattgttt cattaatctt 420 tgatggaaac tggaatgggg atcgcagcac atatggacta tcaattatac ttccacagac 480 agaacttagt ttctacctcc cacttcatag agtgtgtgtt gatagattaa cacatataat 540 ccggaaagga agaatatgga tgcataagga aagacaagaa aatgtccaga agattatctt 600 agaaggcaca gagagaatgg aagatcaggg tcagagtatt attccaatgc ttactggaga 660 agtgattcct gtaatggaac tgctttcatc tatgaaatca cacagtgttc ctgaagaaat 720 agatatagct gatacagtac tcaatgatga tgatattggt gacagctgtc atgaaggctt 780 tcttctcaag taagaatttt tcttttcata aaagctggat gaagcagata ccatcttatg 840 ctcacctatg acaagatttg gaagaaagaa aataacagac tgtctactta gattgttcta 900 gggacattac gtatttgaac tgttgcttaa atttgtgtta tttttcactc attatatttc 960 tatatatatt tggtgttatt ccatttgcta tttaaagaaa ccgagtttcc atcccagaca 1020 agaaatcatg gccccttgct tgattctggt ttcttgtttt acttctcatt aaagctaaca 1080 gaatcctttc atattaagtt gtactgtaga tgaacttaag ttatttaggc gtagaacaaa 1140 attattcata tttatactga tctttttcca tccagcagtg gagtttagta cttaagagtt 1200 tgtgccctta aaccagactc cctggattaa tgctgtgtac ccgtgggcaa ggtgcctgaa 1260 ttctctatac acctatttcc tcatctgtaa aatggcaata atagtaatag tacctaatgt 1320 gtagggttgt tataagcatt gagtaagata aataatataa agcacttaga acagtgcctg 1380 gaacataaaa acacttaata atagctcata gctaacattt cctatttaca tttcttctag 1440 aaatagccag tatttgttga gtgcctacat gttagttcct ttactagttg ctttacatgt 1500 attatcttat attctgtttt aaagtttctt cacagttaca gattttcatg aaattttact 1560 tttaataaaa gagaagtaaa agtataaagt attcactttt atgttcacag tcttttcctt 1620 taggctcatg atggagtatc agaggcatga gtgtgtttaa cctaagagcc ttaatggctt 1680 gaatcagaag cactttagtc ctgtatctgt tcagtgtcag cctttcatac atcattttaa 1740 atcccatttg actttaagta agtcacttaa tctctctaca tgtcaatttc ttcagctata 1800 aaatgatggt atttcaataa ataaatacat taattaaatg atattatact gactaattgg 1860 gctgttttaa ggcaaaaaaa aaaaaaaaaa aaaaaaaaaa a 1901 <210> SEQ ID NO 7 <211> LENGTH: 562 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (166)..(166) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 7 agacgtaacc tacggtgtcc cgctaggaaa gagagatatc tccggagcat ttggataatg 60 tgacagttgg aatgcagtga tgtcgactct ttgcccaccg ccatctccag ctgttgccaa 120 gacagagatt gctttaagtg gcaaatcacc tttattagca gctacntttt gcttactggg 180 acaatattct tggtcctaga gtaaggcaca tttgggctcc aaagacagaa caggtacttc 240 tcagtgatgg agaaataact tttcttgcca accacactct aaatggagaa atccttcgaa 300 atgcagagag tggtgctata gatgtaaagt tttttgtctt gtctgaaaag ggagtgatta 360 ttgtttcatt aatctttgat ggaaactgga atggggatcg cagcacatat ggactatcaa 420 ttatacttcc acagacagaa cttagtttct acctcccact tcatagagtg tgtgttgata 480 gattaacaca tataatccgg aaaggaagaa tatggatgca taaggaaaga caagaaaatg 540 tccagaagat tatcttagaa gg 562 <210> SEQ ID NO 8 <211> LENGTH: 798 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 8 gggctctctt ttgggggcgg ggtctagcaa gagcagatat ctccggagca tttggataat 60 gtgacagttg gaatgcagtg atgtcgactc tttgcccacc gccatctcca gctgttgcca 120 agacagagat tgctttaagt ggcaaatcac ctttattagc agctactttt gcttactggg 180 acaatattct tggtcctaga gtaaggcaca tttgggctcc aaagacagaa caggtacttc 240 tcagtgatgg agaaataact tttcttgcca accacactct aaatggagaa atccttcgaa 300 atgcagagag tggtgctata gatgtaaagt tttttgtctt gtctgaaaag ggagtgatta 360 ttgtttcatt aatctttgat ggaaactgga atggggatcg cagcacatat ggactatcaa 420 ttatacttcc acagacagaa cttagtttct acctcccact tcatagagtg tgtgttgata 480 gattaacaca tataatccgg aaaggaagaa tatggatgca taaggaaaga caagaaaatg 540 tccagaagat tatcttagaa ggcacagaga gaatggaaga tcagggtcag agtattattc 600 caatgcttac tggagaagtg attcctgtaa tgggactgct ttcatctatg aaatcacaca 660 gtgttcctga agaaatagat atagctgata cagtactcca tgatgatgat atttggtgac 720 agctgtcatg aaaggctttc ttctcaagta ggaatttttt cttttcataa aagctgggat 780 gaagccagat tcccatct 798 <210> SEQ ID NO 9 <211> LENGTH: 169 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 9 aaacagcgac aagttccgcc cacgtaaaag atgatgcttg gtgtgtcagc cgtccctgct 60 gcccggttgc ttctcttttg ggggcggggt ctagcaagag cagatatctc cggagcattt 120 ggataatgtg acagttggaa tgcggtgatg tcgactcttt gcccaccgc 169 <210> SEQ ID NO 10 <211> LENGTH: 176 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 10 aaaacgtcat cgcacataga aaacagacag acgtaaccta cggtgtcccg ctaggaaaga 60 gaggtgcgtc aaacagcgac aagttccgcc cacgtaaaag atgacgcttg atatctccgg 120

agcatttgga taatgtgaca gttggaatgc agtgatgtcg actctttgcc caccgc 176 <210> SEQ ID NO 11 <400> SEQUENCE: 11 000 <210> SEQ ID NO 12 <400> SEQUENCE: 12 000 <210> SEQ ID NO 13 <211> LENGTH: 783 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 13 gcctctcagt acccgaggct cccttttctc gagcccgcag cggcagcgct cccagcgggt 60 ccccgggaag gagacagctc gggtactgag ggcgggaaag caaggaagag gccagatccc 120 catcccttgt ccctgcgccg ccgccgccgc cgccgccgcc gggaagcccg gggcccggat 180 gcaggcaatt ccaccagtcg ctagaggcga aagcccgaca cccagcttcg gtcagagaaa 240 tgagagggaa agtaaaaatg cgtcgagctc tgaggagagc ccccgcttct acccgcgcct 300 cttcccggca gccgaacccc aaacagccac ccgccaggat gccgcctcct cactcaccca 360 ctcgccaccg cctgcgcctc cgccgccgcg ggcgcaggca ccgcaaccgc agccccgccc 420 cgggcccgcc cccgggcccg ccccgaccac gccccggccc cggccccggc cccggccccg 480 gcccctagcg cgcgactcct gagttccaga gcttgctaca ggctgcggtt gtttccctcc 540 ttgttttctt ctggttaatc tttatcaggt cttttcttgt tcaccctcag cgagtactgt 600 gagagcaagt agtggggaga gagggtggga aaaacaaaaa cacacacctc ctaaacccac 660 acctgctctt gctagacccc gcccccaaaa gagaagcaac cgggcagcag ggacggctga 720 cacaccaagc gtcatctttt acgtgggcgg aacttgtcgc tgtttgacgc acctctcttt 780 cct 783 <210> SEQ ID NO 14 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 14 cgactggagc acgaggacac tgaaaagatg acgcttggtg tgtca 45 <210> SEQ ID NO 15 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 15 cccacacctg ctcttgctag a 21 <210> SEQ ID NO 16 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 16 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 17 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 17 cccaaaagag aagcaaccgg gca 23 <210> SEQ ID NO 18 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 18 cgactggagc acgaggacac tgacggctgc cgggaaga 38 <210> SEQ ID NO 19 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 19 agaaatgaga gggaaagtaa aaatgc 26 <210> SEQ ID NO 20 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 20 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 21 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 21 aggagagccc ccgcttctac ccg 23 <210> SEQ ID NO 22 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 22 cgactggagc acgaggacac tgacgctgag ggtgaacaag aa 42 <210> SEQ ID NO 23 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 23 gagttccaga gcttgctaca g 21 <210> SEQ ID NO 24 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 24 cgactggagc acgaggacac tg 22 <210> SEQ ID NO 25 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 25 ctgcggttgt ttccctcctt gttt 24 <210> SEQ ID NO 26 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 26 ggcaaattca acggcacagt 20 <210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 27 gggtctcgct cctggaagat 20 <210> SEQ ID NO 28 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Probe <400> SEQUENCE: 28 aaggccgaga atgggaagct tgtcatc 27 <210> SEQ ID NO 29 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 29 tagtgcggac ctacccacga 20 <210> SEQ ID NO 30 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<400> SEQUENCE: 30 ggtgtgtcag ccgtccctgc 20 <210> SEQ ID NO 31 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 31 gtgtcagccg tccctgctgc 20 <210> SEQ ID NO 32 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 32 tgtttttccc accctctctc 20 <210> SEQ ID NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 33 ttttcccacc ctctctcccc 20 <210> SEQ ID NO 34 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 34 tcccaccctc tctccccact 20 <210> SEQ ID NO 35 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 35 caccctctct ccccactact 20 <210> SEQ ID NO 36 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 36 gagggtgaac aagaaaagac 20 <210> SEQ ID NO 37 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 37 gaaaagacct gataaagatt 20 <210> SEQ ID NO 38 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 38 agattaacca gaagaaaaca 20 <210> SEQ ID NO 39 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 39 ttaaccagaa gaaaacaagg 20 <210> SEQ ID NO 40 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 40 accagaagaa aacaaggagg 20 <210> SEQ ID NO 41 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 41 agaagaaaac aaggagggaa 20 <210> SEQ ID NO 42 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 42 agaaaacaag gagggaaaca 20 <210> SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 43 aaacaaggag ggaaacaacc 20 <210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 44 gcaagctctg gaactcagga 20 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 45 agctctggaa ctcaggagtc 20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 46 tcaggagtcg cgcgctaggg 20 <210> SEQ ID NO 47 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 47 ggagtcgcgc gctaggggcc 20 <210> SEQ ID NO 48 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 48 gtcgcgcgct aggggccggg 20 <210> SEQ ID NO 49 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 49 gcgcgctagg ggccggggcc 20 <210> SEQ ID NO 50 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 50 gggctgcggt tgcggtgcct 20 <210> SEQ ID NO 51 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE:

<223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 51 gcggttgcgg tgcctgcgcc 20 <210> SEQ ID NO 52 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 52 tgcggtgcct gcgcccgcgg 20 <210> SEQ ID NO 53 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 53 tgcctgcgcc cgcggcggcg 20 <210> SEQ ID NO 54 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 54 gcgcccgcgg cggcggaggc 20 <210> SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 55 cgcggcggcg gaggcgcagg 20 <210> SEQ ID NO 56 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 56 cggcggaggc gcaggcggtg 20 <210> SEQ ID NO 57 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 57 gaggcgcagg cggtggcgag 20 <210> SEQ ID NO 58 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 58 gcaggcggtg gcgagtgggt 20 <210> SEQ ID NO 59 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 59 cggtggcgag tgggtgagtg 20 <210> SEQ ID NO 60 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 60 gcgagtgggt gagtgaggag 20 <210> SEQ ID NO 61 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 61 tgggtgagtg aggaggcggc 20 <210> SEQ ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 62 gagtgaggag gcggcatcct 20 <210> SEQ ID NO 63 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 63 aggaggcggc atcctggcgg 20 <210> SEQ ID NO 64 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 64 gcggcatcct ggcgggtggc 20 <210> SEQ ID NO 65 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 65 atcctggcgg gtggctgttt 20 <210> SEQ ID NO 66 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 66 tcggctgccg ggaagaggcg 20 <210> SEQ ID NO 67 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 67 tgccgggaag aggcgcgggt 20 <210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 68 ggaagaggcg cgggtagaag 20 <210> SEQ ID NO 69 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 69 gctctcctca gagctcgacg 20 <210> SEQ ID NO 70 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 70 cctcagagct cgacgcattt 20 <210> SEQ ID NO 71 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 71 gagctcgacg catttttact 20 <210> SEQ ID NO 72 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence

<220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 72 cgacgcattt ttactttccc 20 <210> SEQ ID NO 73 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 73 catttttact ttccctctca 20 <210> SEQ ID NO 74 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 74 ttactttccc tctcatttct 20 <210> SEQ ID NO 75 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 75 ttccctctca tttctctgac 20 <210> SEQ ID NO 76 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 76 tctcatttct ctgaccgaag 20 <210> SEQ ID NO 77 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 77 tttctctgac cgaagctggg 20 <210> SEQ ID NO 78 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 78 ctgaccgaag ctgggtgtcg 20 <210> SEQ ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 79 cgaagctggg tgtcgggctt 20 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 80 ctgggtgtcg ggctttcgcc 20 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 81 tgtcgggctt tcgcctctag 20 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 82 ggctttcgcc tctagcgact 20 <210> SEQ ID NO 83 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (15)..(15) <223> OTHER INFORMATION: I <400> SEQUENCE: 83 ccggggccgg ggccggggcc 20 <210> SEQ ID NO 84 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: I <400> SEQUENCE: 84 ggccggggcc ggggccgg 18 <210> SEQ ID NO 85 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 85 ggggccgggg ccggggcc 18 <210> SEQ ID NO 86 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 86 cggggccggg gccggggc 18 <210> SEQ ID NO 87 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 87 ccggggccgg ggccgggg 18 <210> SEQ ID NO 88 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 88 gccggggccg gggccggg 18 <210> SEQ ID NO 89 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 89 ggccggggcc ggggccgg 18 <210> SEQ ID NO 90 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 90 gggccggggc cggggccg 18 <210> SEQ ID NO 91 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<400> SEQUENCE: 91 ggccggggcc ggggcc 16 <210> SEQ ID NO 92 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 92 gggccggggc cggggc 16 <210> SEQ ID NO 93 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 93 ggggccgggg ccgggg 16 <210> SEQ ID NO 94 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 94 cggggccggg gccggg 16 <210> SEQ ID NO 95 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 95 ccggggccgg ggccgg 16 <210> SEQ ID NO 96 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 96 gccggggccg gggccg 16 <210> SEQ ID NO 97 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 97 gacaagggta cgtaatctgt c 21 <210> SEQ ID NO 98 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (4)..(4) <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (10)..(10) <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (16)..(16) <400> SEQUENCE: 98 ccggggccgg ggccggggcc 20 <210> SEQ ID NO 99 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (6)..(6) <223> OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY: modified_base <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: I <400> SEQUENCE: 99 ggccggggcc ggggccgg 18 <210> SEQ ID NO 100 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 100 cagcagcagc agcagcagc 19 <210> SEQ ID NO 101 <211> LENGTH: 99 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 101 gacaagggta cgtaatctgt ctagagctag aaatagcaag ttaaaataag gctagtccgt 60 tatcaacttg aaaaagtggc accgagtcgg tgctttttt 99 <210> SEQ ID NO 102 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 102 tagtcctgca ggtttaaacg aattcgtgag tgaggaggcg gca 43 <210> SEQ ID NO 103 <211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 103 agcagagctc agattacgta cccttgttgt gaacaac 37 <210> SEQ ID NO 104 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 104 caatgtcaac gtctggcatt acttctactt ttg 33 <210> SEQ ID NO 105 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 105 tagggcgaat tgaatttagc ggccgcactg gcaggatcat agc 43 <210> SEQ ID NO 106 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 106 tacgtaatct gagctctgct tatatagacc 30 <210> SEQ ID NO 107 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 107 aatgccagac gttgacattg attattgact agttattaat ag 42 <210> SEQ ID NO 108 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 108 gttaggctct gggagagtag ttg 23 <210> SEQ ID NO 109 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer <400> SEQUENCE: 109 cctggagcag gtaaatgctg g 21

Claims

1. A compound comprising a C9ORF72 antisense transcript specific inhibitor, wherein the C9ORF72 antisense transcript specific inhibitor is a modified oligonucleotide consisting of 12-30 linked nucleosides, wherein at least one nucleoside of the antisense oligonucleotide comprises a hypoxanthine nucleobase, wherein the modified oligonucleotide has a nucleobase sequence that is at least 90% complementary to a C9ORF72 antisense transcript, and wherein the modified oligonucleotide comprises at least one modified internucleoside linkage and/or at least one modified nucleoside comprising a modified sugar.

2. (canceled)

3. (canceled)

4. (canceled)

5. The compound of claim 1, wherein the modified oligonucleotide consists of 16-25 linked nucleosides.

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. The compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence that is 100% complementary to a C9ORF72 antisense transcript.

11. The compound of claim 1, wherein the C9ORF72 antisense transcript has the nucleobase sequence of SEQ ID NO: 13.

12. The compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 16 contiguous nucleobases of a sequence selected from SEQ ID NO: 30-96, 98, or 99.

13. (canceled)

14. The compound of claim 1, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

15. The compound of claim 14, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

16. The compound of claim 14, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

17. The compound of claim 14 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

18. (canceled)

19. (canceled)

20. (canceled)

21. The compound of claim 1, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

22. (canceled)

23. (canceled)

24. The compound of claim 21, wherein at least one modified sugar comprises a 2'-O-methoxyethyl group.

25. The compound of claim 1, wherein the modified oligonucleotide is a gapmer.

26-92. (canceled)

93. The compound of claim 1, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

94-145. (canceled)

146. A compound comprising a C9ORF72 antisense transcript specific inhibitor, wherein the C9ORF72 antisense transcript specific inhibitor is a modified oligonucleotide consisting of 12-30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases that are complementary to a hexanucleotide repeat expansion in a C9ORF72 antisense transcript, and wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

147. The compound of claim 146, wherein the modified oligonucleotide consists of 16-25 linked nucleosides.

148. The compound of claim 146, wherein the modified oligonucleotide has a nucleobase sequence that is at least 90% complementary to the C9ORF72 antisense transcript.

149. The compound of claim 146, wherein the modified oligonucleotide has a nucleobase sequence that is 100% complementary to the C9ORF72 antisense transcript.

150. The compound of claim 146, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 16 contiguous nucleobases of a sequence selected from SEQ ID NOs: 47-49, 85-96, 98, or 99.

151. The compound of claim 146, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

152. The compound of claim 151, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

153. The compound of claim 151, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

154. The compound of claim 151, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

155. The compound of claim 146, wherein at least one modified sugar comprises a 2'-O-methoxyethyl group.

156. The compound of claim 146, wherein the modified oligonucleotide is a gapmer.

157. The compound of claim 146, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.