Patent application title: ADH PROTEIN FAMILY MUTANT AND USE THEREOF
Inventors:
IPC8 Class: AC12N904FI
USPC Class:
1 1
Class name:
Publication date: 2021-07-15
Patent application number: 20210214693
Abstract:
Provided are an ADH protein mutant and the use thereof. Compared with a
wild-type ADH protein, the mutant is capable of (i) enhancing the
expression purity, efficiency and yield of exogenous proteins in an
in-vitro cell-free synthesis system; and/or (ii) reducing the binding
ability of the mutant protein to Ni medium.Claims:
1. An alcohol dehydrogenase (ADH) mutant protein, wherein, the mutant
protein is a non-natural protein, and the mutant protein has mutations of
at least one histidine (H) among amino acids 45-149 of wild-type ADH.
2. The mutant protein according to claim 1, wherein the mutations do not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type ADH.
3. The mutant protein according to claim 1, wherein the histidines subjected to mutation can be independently mutated to a basic amino acid.
4. The mutant protein according to claim 1, wherein the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof.
5. The mutant protein according to claim 1, wherein the mutant protein is obtained by engineering based on ADH of yeast source, and the yeast is preferably Kluyveromyces, more preferably Kluyveromyces lactis; preferably, the histidines subjected to mutation can be independently mutated to a basic amino acid; or the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof.
6. The mutant protein according to claim 1, wherein the amino acid sequence of the ADH mutant protein is selected from the following group: (a) a polypeptide whose amino acid sequence is any one of SEQ ID NO.: 2-13; (b) a polypeptide which is derived from one of polypeptides with amino acid sequences shown in SEQ ID NO.: 2-13, and has ADH activity and reduced binding ability of the mutant protein to Ni medium; the polypeptide is formed by substitution, deletion or addition of one or several amino acid residues in any one of the amino acid sequences shown in SEQ ID NO.: 2-13, wherein number of amino acid residues subjected to substitution, deletion or addition is preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, most preferably 1; (c) a polypeptide having at least 70% homology with any one of the sequences shown in SEQ ID NO.: 2-13, preferably homology of at least 75%, 80%, 85%, 90%, and more preferably at least 95%%, 96%, 97%, 98%, 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium; and (d) a polypeptide having at least 80% homology with the sequence shown in SEQ ID No.: 1, 26, 27 or 28, preferably homology of at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium; preferably, the mutant protein is derived from ADH of yeast source, and the yeast is preferably Kluyveromyces, more preferably Kluyveromyces lactis; or preferably, the histidines subjected to mutation can be independently mutated to a basic amino acid; or the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof.
7. A polynucleotide, wherein the polynucleotide encodes the mutant protein according to claim 1 or is complementary to a polynucleotide encoding the mutant protein according to claim 1; preferably, the mutant protein is derived from ADH of yeast source, and the yeast is preferably Kluyveromyces, more preferably Kluyveromyces lactis; or preferably, the histidines subjected to mutation can be independently mutated to a basic amino acid; or the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof; or preferably, the mutations do not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type ADH; or preferably, the amino acid sequence of the ADH mutant protein is selected from the following group: (a) a polypeptide whose amino acid sequence is any one of SEQ ID NO.: 2-13; (b) a polypeptide which is derived from one of polypeptides with amino acid sequences shown in SEQ ID NO.: 2-13, and has ADH activity and reduced binding ability of the mutant protein to Ni medium; the polypeptide is formed by substitution, deletion or addition of one or several amino acid residues in any one of the amino acid sequences shown in SEQ ID NO.: 2-13, wherein number of amino acid residues subjected to substitution, deletion or addition is preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, most preferably 1; (c) a polypeptide having at least 70% homology with any one of the sequences shown in SEQ ID NO.: 2-13, preferably homology of at least 75%, 80%, 85%, 90%, and more preferably at least 95%%, 96%, 97%, 98%, 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium; and (d) a polypeptide having at least 80% homology with the sequence shown in SEQ ID No.: 1, 26, 27 or 28, preferably homology of at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium.
8. A vector containing the polynucleotide according to claim 7.
9-12. (canceled)
13. An engineered strain, wherein gene encoding its endogenous ADH protein is mutated to a polynucleotide encoding the mutant protein according to claim 1; wherein the endogenous ADH protein has affinity to Ni medium; wherein the mutant protein has ADH activity and reduced binding ability to Ni medium; preferably, the engineered strain is derived from yeast, more preferably from Kluyveromyces, and more preferably from Kluyveromyces lactis; or preferably, the histidines subjected to mutation can be independently mutated to a basic amino acid; or the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof; or preferably, the mutations do not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type ADH; or preferably, the amino acid sequence of the ADH mutant protein is selected from the following group: (a) a polypeptide whose amino acid sequence is any one of SEQ ID NO.: 2-13; (b) a polypeptide which is derived from one of polypeptides with amino acid sequences shown in SEQ ID NO.: 2-13, and has ADH activity and reduced binding ability of the mutant protein to Ni medium; the polypeptide is formed by substitution, deletion or addition of one or several amino acid residues in any one of the amino acid sequences shown in SEQ ID NO.: 2-13, wherein number of amino acid residues subjected to substitution, deletion or addition is preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, most preferably 1; (c) a polypeptide having at least 70% homology with any one of the sequences shown in SEQ ID NO.: 2-13, preferably homology of at least 75%, 80%, 85%, 90%, and more preferably at least 95%%, 96%, 97%, 98%, 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium; and (d) a polypeptide having at least 80% homology with the sequence shown in SEQ ID No.: 1, 26, 27 or 28, preferably homology of at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium.
14. A cell lysate of the engineered strain of claim 13.
15. An in vitro protein synthesis system comprising the cell lysate of claim 14; preferably, the in vitro protein synthesis system is a cell-free system; more preferably, the in vitro protein synthesis system is a cell-free transcription and translation system.
16. An enzyme preparation comprising the ADH mutant protein according to claim 1; preferably, the mutant protein is derived from ADH of yeast source, and the yeast is preferably Kluyveromyces, more preferably Kluyveromyces lactis; or preferably, the histidines subjected to mutation can be independently mutated to a basic amino acid; or the histidines subjected to mutation can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof; or preferably, the mutations do not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type ADH; or preferably, the amino acid sequence of the ADH mutant protein is selected from the following group: (a) a polypeptide whose amino acid sequence is any one of SEQ ID NO.: 2-13; (b) a polypeptide which is derived from one of polypeptides with amino acid sequences shown in SEQ ID NO.: 2-13, and has ADH activity and reduced binding ability of the mutant protein to Ni medium; the polypeptide is formed by substitution, deletion or addition of one or several amino acid residues in any one of the amino acid sequences shown in SEQ ID NO.: 2-13, wherein number of amino acid residues subjected to substitution, deletion or addition is preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, most preferably 1; (c) a polypeptide having at least 70% homology with any one of the sequences shown in SEQ ID NO.: 2-13, preferably homology of at least 75%, 80%, 85%, 90%, and more preferably at least 95%%, 96%, 97%, 98%, 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium; and (d) a polypeptide having at least 80% homology with the sequence shown in SEQ ID No.: 1, 26, 27 or 28, preferably homology of at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99%; the polypeptide has ADH activity and reduced binding ability of the mutant protein to Ni medium.
17. A method for producing the engineered strain according to claim 13.
18. A use of the engineered strain according to claim 13, where it is applicable for protein synthesis, and improved product purity of expressed protein is provided when using Ni medium for purification.
Description:
BACKGROUND OF THE INVENTION
1. Technical Field
[0001] The present invention relates to the field of biotechnology, and more particularly, to ADH protein family mutants and use thereof.
2. Description of the Related Art
[0002] Protein separation and purification refers to processes in which target proteins are purified from mixtures, extracts, cell lysis liquid, reaction products and the like by fusing poly-tag at one end of the target proteins or via the specific characteristics of the target proteins and by using chromatography method to separate other substances. Affinity chromatography refers to a method that one of two molecules having affinity is fixed on an insoluble matrix, and the other molecule is separated and purified based on the specificity and reversibility of the affinity between the two molecules. Common poly-tags used for affinity chromatography mainly include histidine (His), Glutathione S-transferase (GST), Maltose Binding Protein (MBP), etc. The principle of immobilized metal-chelating affinity chromatography (IMAC) is mainly based on the fact that amino acid residues on protein surface can form different affinity with metal ions, which can be divided into three types: electrostatic attraction, covalent binding and coordination bond binding. When protein surface contains histidine, cysteine or tryptophan, the corresponding imidazolyl group, thiol group or indolyl group can form coordination bond with metal ion. This method has become a commonly used protein purification tool by virtue of convenient expression, low cost, small impact on the properties of the target proteins and other advantages.
[0003] However, in practice, this purification method also has certain problems. Take Ni-NTA resin for example, some non-target proteins also have several discontinuous histidine residues on the surface of their three-dimensional structure, which results in that those non-target proteins also bind to Ni-NTA resin to a certain extent, thereby interfering with the purity of the final target protein.
[0004] Accordingly, there is an urgent need in the art to invent a method for engineering the histidine residues of non-target proteins to make them unable to bind to Ni ion affinity medium, such as Ni-NTA resin, so as to achieve the effect of improving the purity of target proteins.
SUMMARY OF THE INVENTION
[0005] One object of the present invention is to provide a method for engineering histidine residues of non-target proteins to make them unable to bind to Ni ion affinity medium, such as Ni-NTA resin, so as to increase the purity of target proteins.
[0006] According to the first aspect, the present invention provides an alcohol dehydrogenase (ADH) mutant protein. The mutant protein is a non-natural protein, and the mutant protein has mutations of at least one histidine (H) among amino acids 45-149 of wild-type alcohol dehydrogenase (ADH).
[0007] In another preferred embodiment, the mutation does not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type alcohol dehydrogenase (ADH).
[0008] In another preferred embodiment, compared with the wild-type alcohol dehydrogenase (ADH), the binding ability of the alcohol dehydrogenase (ADH) mutant protein to Ni medium is reduced by 10%, preferably, by 25%, more preferably, by 50%, more preferably, by 80%, and most preferably, by 100%.
[0009] In another preferred embodiment, the histidines can be independently mutated to a basic amino acid.
[0010] In another preferred embodiment, the types of independent mutations of the histidine can be the same or different.
[0011] In another preferred embodiment, the histidines can be independently mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof.
[0012] In another preferred embodiment, the mutant protein is derived from K. lactis.
[0013] In another preferred embodiment, the alcohol dehydrogenase (ADH) includes ADH1, ADH2, ADH3 and/or ADH4 protein.
[0014] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH1) corresponding to SEQ ID NO.: 1, wherein the one or more core amino acids are selected from the following group:
[0015] histidine (H) at position 47;
[0016] histidine (H) at position 51; and
[0017] histidine (H) at position 124.
[0018] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH2) corresponding to SEQ ID NO.: 26, wherein the one or more core amino acids are selected from the following group:
[0019] histidine (H) at position 45;
[0020] histidine (H) at position 49; and
[0021] histidine (H) at position 122.
[0022] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH3) corresponding to SEQ ID NO.: 27, wherein the one or more core amino acids are selected from the following group:
[0023] histidine (H) at position 71;
[0024] histidine (H) at position 75; and
[0025] histidine (H) at position 148.
[0026] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH4) corresponding to SEQ ID NO.: 28, wherein the one or more core amino acids are selected from the following group:
[0027] histidine (H) at position 72;
[0028] histidine (H) at position 76; and
[0029] histidine (H) at position 149.
[0030] In another preferred embodiment, the histidine (H) at position 47 is mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof, preferably, lysine (K), asparagine (N) and/or arginine (R), more preferably, lysine (K) and asparagine (N).
[0031] In another preferred embodiment, the histidine (H) at position 51 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof, preferably, lysine (K) and/or arginine (R), more preferably, arginine (R).
[0032] In another preferred embodiment, the histidine (H) at position 124 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof, preferably, lysine (K).
[0033] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 1, wherein the one or more core amino acids are selected from the following group:
[0034] histidine (H) at position 47; and
[0035] histidine (H) at position 124.
[0036] In another preferred embodiment, the histidine (H) at position 45 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0037] In another preferred embodiment, histidine (H) at position 49 is mutated to one or more amino acids selected from the group consisting of lysine (K), arginine (R) and a combination thereof.
[0038] In another preferred embodiment, histidine (H) at position 122 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0039] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 26, wherein the one or more core amino acids are selected from the following group:
[0040] histidine (H) at position 122; and
[0041] histidine (H) at position 45.
[0042] In another preferred embodiment, the histidine (H) at position 71 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0043] In another preferred embodiment, the histidine (H) at position 75 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0044] In another preferred embodiment, histidine (H) at position 148 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0045] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 27, wherein the one or more core amino acids are selected from the following group:
[0046] histidine (H) at position 148; and
[0047] histidine (H) at position 71.
[0048] In another preferred embodiment, the histidine (H) at position 72 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0049] In another preferred embodiment, the histidine (H) at position 76 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0050] In another preferred embodiment, the histidine (H) at position 149 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0051] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 28, wherein the one or more core amino acids are selected from the following group:
[0052] histidine (H) at position 149; and
[0053] histidine (H) at position 72.
[0054] In another preferred embodiment, the mutation is selected from the following group: H47K; H47N; H47Q; H47R; H51K; H51R; H124K; H124R; H47K and H124K; H47N and H124K; H47Q and H124K; H47R and H124K.
[0055] In another preferred embodiment, the mutation is selected from the following group: H47K; H47N; H51R; H124R; H47K and H124K; H47N and H124K.
[0056] In another preferred embodiment, the mutation is selected from the following group: H122K; H122R; H45K; H45R; H45N; H45Q; H49K; H49R; H122K and H45K; H122K and H45R; H122K and H45N; H122K and H45Q.
[0057] In another preferred embodiment, the mutation is selected from the following group: H148K; H148R; H71K; H71R; H71N; H71Q; H75K; H75R; H148K and H71K; H148K and H71R; H148K and H71N; H148K and H71Q.
[0058] In another preferred embodiment, the mutation is selected from the following group: H149K; H149R; H72K; H72R; H72N; H72Q; H76K; H76R; H149K and H72K; H149K and H72R; H149K and H72N; H149K and H72Q.
[0059] In another preferred embodiment, the amino acid sequence of the alcohol dehydrogenase (ADH) mutant protein is selected from the following group:
[0060] (1) a polypeptide whose amino acid sequence is any one of SEQ ID NO.: 2-13.
[0061] (2) a polypeptide derived from the polypeptides of amino acid sequences shown in SEQ ID NO.: 2-13, and having the function of the polypeptide described in (1), wherein the polypeptide is formed by substitution, deletion or addition of one or several (preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, most preferably 1) amino acid residues in the amino acid sequence shown in any one of SEQ ID NO.: 2-13.
[0062] In another preferred embodiment, the amino acid sequence of the mutant protein is any one of SEQ ID NO.: 2-13.
[0063] In another preferred embodiment, the amino acid sequence of the mutant protein has at least 70% (preferably at least 75%, 80%, 85%, 90%, and more preferably at least 95%%, 96%, 97%, 98%, 99%) identity with the sequence SEQ ID NO.: 2-13.
[0064] In another preferred embodiment, except for the mutation (e.g., positions 47, 51 and/or 124), the remaining amino acid sequence of the mutant protein is identical or substantially identical to the sequence shown in SEQ ID NO.: 1.
[0065] In another preferred embodiment, except for the mutation (e.g., positions 45, 49 and/or 122), the remaining amino acid sequence of the mutant protein is identical or substantially identical to the sequence shown in SEQ ID NO.: 26.
[0066] In another preferred embodiment, except for the mutation (e.g., positions 71, 75 and/or 148), the remaining amino acid sequence of the mutant protein is identical or substantially identical to the sequence shown in SEQ ID NO.: 27.
[0067] In another preferred embodiment, except for the mutation (e.g., positions 72, 76 and/or 149), the remaining amino acid sequence of the mutant protein is identical or substantially identical to the sequence shown in SEQ ID NO.: 28.
[0068] In another preferred embodiment, that "the remaining amino acid sequence is substantially identical" refers to up to 50 (preferably 1-20, more preferably 1-10, more preferably 1-5) amino acids are different, wherein, the difference includes substitution, deletion or addition of amino acids, and the mutant protein still can (i) improve the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reduce the binding ability of the mutant protein to Ni medium.
[0069] In another preferred embodiment, the homology with the sequence shown in SEQ ID NO.: 1, 26, 27 or 28 is at least 80%, preferably at least 85% or 90%, more preferably at least 95%, most preferably at least 98% or 99%.
[0070] According to the second aspect, the present invention provides a polynucleotide, wherein the polynucleotide encodes the mutant protein of the first aspect of the present invention.
[0071] In another preferred embodiment, the polynucleotide is selected from the following group:
[0072] (a) a polynucleotide encoding the polypeptide shown in any one of SEQ ID NO.: 2-13;
[0073] (b) a polynucleotide whose sequence is any one of SEQ ID NO.: 14-25;
[0074] (c) a polynucleotide encoding the polypeptide shown in any one of SEQ ID NO.: 2-13; the homology of the sequence of the polynucleotide to the sequence shown in the nucleotide sequence of the wild-type ADH1 protein is .gtoreq.95% (preferably .gtoreq.98%);
[0075] (d) a polynucleotide complementary to any of the polynucleotides described in (a) to (c).
[0076] In another preferred embodiment, the polynucleotide additionally contains accessory elements in the flank of the ORF of the mutant protein, wherein the accessory elements are selected from the following group: a signal peptide, a secretory peptide, a tag sequence (such as 6His) and combinations thereof.
[0077] In another preferred embodiment, the polynucleotide is selected from the following group: a DNA sequence, a RNA sequence and a combination thereof.
[0078] According to the third aspect, the present invention provides a vector; wherein, the vector contains the polynucleotide according to the second aspect of the present invention.
[0079] In another preferred embodiment, the vector includes one or more promoters; wherein, the promoters are operably linked to the nucleic acid sequence, enhancer, transcription termination signal, polyadenylation sequence, origin of replication, selectable marker, nucleic acid restriction site and/or homologous recombination site.
[0080] In another preferred embodiment, the vector includes a plasmid and a viral vector.
[0081] In another preferred embodiment, the viral vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, SV40, poxvirus and combinations thereof.
[0082] In another preferred embodiment, the vector includes an expression vector, a shuttle vector and an integration vector.
[0083] According to the fourth aspect, the present invention provides a host cell; wherein, the host cell contains the vector according to the third aspect of the present invention, or the host cell has the polynucleotide according to the second aspect of the present invention integrated in its genome.
[0084] In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell, a plant cell or a mammal cell (including human and non-human mammal cells).
[0085] In another preferred embodiment, the host cell is a prokaryotic cell, such as E. coli.
[0086] In another preferred embodiment, the yeast cell is selected from one or more yeasts from the following group: Pichia pastoris, Kluyveromyces and a combination thereof; preferably, the yeast cell includes: Kluyveromyces, more preferably Kluyveromyces marxianus and/or Kluyveromyces lactis.
[0087] In another preferred embodiment, the host cell is selected from the following group: E. coli, wheat germ cell, insect cell, SF9 cell, Hela cell, HEK293 cell, CHO cell, yeast cell and combinations thereof.
[0088] According to the fifth aspect, the present invention provides a method for producing the alcohol dehydrogenase (ADH) mutant protein of the first aspect of the present invention, including steps of:
[0089] the host cell according to the fourth aspect of the present invention is cultured under conditions suitable for expression so as to express the alcohol dehydrogenase (ADH) mutant protein; and/or
[0090] the alcohol dehydrogenase (ADH) mutant protein is isolated.
[0091] According to the sixth aspect, the present invention provides an enzyme preparation, wherein the enzyme preparation comprises the alcohol dehydrogenase (ADH) mutant protein according to the first aspect of the present invention.
[0092] In another preferred embodiment, the enzyme preparation includes an injection and/or a lyophilized preparation.
[0093] According to the seventh aspect, the present invention provides a use of the mutant protein according to the first aspect of the present invention; wherein the mutant protein is used to prepare an enzyme preparation which can (i) improve the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reduce the binding ability of the mutant protein to Ni medium.
[0094] In another preferred embodiment, the Ni is selected from the following group: nickel element, nickel ion, free nickel ion, chromatography medium with nickel being bound, Ni.sup.+, Ni-beads, Ni-NTA and combinations thereof.
[0095] It should be understood that, within the scope of the present invention, above-mentioned technical features and technical features specifically described hereinafter (e.g., embodiments or examples) can be combined with each other, whereby forming new or preferred technical solutions. For the simplicity, details will not be repeated herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0096] FIG. 1 shows a design route for engineering ADH1 in the K. lactis genome to eliminate its binding to Ni medium.
[0097] FIG. 2 shows a sequence homology comparison of the KlADH family protein ADH1-4. The black region represents the sequences have high homology.
[0098] FIG. 3 shows a sequence homology comparison between KlADH1 and ScADH1, wherein the sequence homology between the two is 84.9%.
[0099] FIG. 4 shows a homology modeling of KlADH4 with 2HCY as a template. Both 2HCY and KlADH4 are tetramers, and the six-His aggregation region of each monomer is represented by boxes, respectively.
[0100] FIG. 5 shows a structure diagram of ScADH1 tetramer. The two subunits A and B form a dimer through the NADH/NAD.sup.+ binding domain, and two AB dimers form a "back-to-back" tetramer.
[0101] FIG. 6 shows a diagram of the amino acid structure around H66 in ScADH1. H66 is involved in chelating the catalytic Zn.sup.2+ in two conformations of ADH1. Figure A shows a closed conformation with NAD being bound, and Figure B shows an open conformation with no NAD being bound.
[0102] FIG. 7 shows a diagram of the amino acid structure around H48 in ScADH1. H48 is involved in the formation of a ternary complex and affects the proton transfer process of the substrate.
[0103] FIG. 8 shows a diagram of the amino acid structure around H44 in ScADH1. ND1 on the imidazole ring of H44 may be involved in the binding of NAD.sup.+/NADH.
[0104] FIG. 9 shows a plasmid profile of pKMCas9_StR_KlADH1. The plasmid has a tRNA-Tyr promoter, a SNR52 terminator and a kana selection marker.
[0105] FIG. 10 shows a plasmid profile of pKMD1-.DELTA.KlADH1. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0106] FIG. 11 shows a plasmid profile of pKMD1-KlADH1-H47K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0107] FIG. 12 shows a plasmid profile of pKMD1-KlADH1-H47N. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0108] FIG. 13 shows a plasmid profile of pKMD1-KlADH1-H47Q. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0109] FIG. 14 shows a plasmid profile of pKMD1-KlADH1-H47R. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0110] FIG. 15 shows a plasmid profile of pKMD1-KlADH1-H51K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0111] FIG. 16 shows a plasmid profile of pKMD1-KlADH1-H51R. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0112] FIG. 17 shows a plasmid profile of pKMD1-KlADH1-H124K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0113] FIG. 18 shows a plasmid profile of pKMD1-KlADH1-H124R. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0114] FIG. 19 shows a plasmid profile of pKMD1-KlADH1-H47KH124K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0115] FIG. 20 shows a plasmid profile of pKMD1-KlADH1-H47NH124K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0116] FIG. 21 shows a plasmid profile of pKMD1-KlADH1-H47QH124K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0117] FIG. 22 shows a plasmid profile of pKMD1-KlADH1-H47RH124K. Homologous arm 1 and homologous arm 2 are the gene sequences at about 800 bp upstream and downstream of the ORF of the KlADH1 gene, respectively, and the plasmid has an Amp selection marker.
[0118] FIG. 23 shows a polyacrylamide gel analysis purified by Ni-NTA. As shown in the figure, knockout of KlADH1 gene and His mutation at different positions can significantly reduce the affinity of KlADH1 to Ni-NTA. The size of the target band is about 37KD, and the bands from left to right refer to marker, K. lactis wild-type cell strain WT, cell strain .DELTA.ADH1 with KlADH1 being knocked-out, KlADH1 single mutant cell strain H47K, H47N, H47R, H51K, H124K, H124KH47K and H124KH47N, respectively.
[0119] FIG. 24 shows an analysis of the cell-free transcription and translation activity of wild-type cell strain WT, cell strain .DELTA.ADH1 with KlADH1 being knocked-out, and cell strain H47K with single mutation of KlADH1. As shown in the figure, the bands from left to right refer to .DELTA.ADH1, KlADH1 H47K, K. lactis wild-type cell strain WT and negative control, respectively.
[0120] FIG. 25 shows a purification analysis of the target protein prepared by cell-free transcription and translation of wild-type cell strain WT and cell strain H47K (Mut) with single mutation of KlADH1. As shown in the figure, the bands from left to right refer to cell strain H47K (Mut) with single mutation of KlADH1 and K. lactis wild-type cell strain WT, respectively. Figure A shows the affinity analysis of between KlADH1 and Ni-NTA without the addition of exogenous target proteins. Figure B shows the purification analysis of eGFP when the target protein N-His8-eGFP was added to the cell-free transcription and translation system of cell strain H47K with single mutation of KlADH1. Figure C shows the purification analysis of Strep-eGFP when the target protein N-His8-Strep-eGFP was added to the cell-free transcription and translation system of cell strain H47K with single mutation of KlADH1.
[0121] FIG. 26 summarizes elimination of the binding ability of KlADH1 to Ni medium in order to improve the purity and specificity of the target protein by knockout of KlADH1 gene and site-directed mutation to KlADH1 gene, respectively.
DETAILED DESCRIPTION
[0122] After extensive and in-depth research, the inventors unexpectedly obtained an ADH family protein mutant. Compared with the wild-type ADH family protein, the ADH family protein mutant of the present invention can significantly (i) improve the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reduce the binding ability of the mutant protein to Ni medium. On this basis, the inventors completed the present invention.
Terms
[0123] In order to facilitate the understanding of this disclosure, certain terms are first defined. As used in this application, unless otherwise explicitly stated herein, each of the following terms shall have the meaning given below. Other definitions are stated throughout the application.
[0124] The term "about" may refer to a value or composition within an acceptable error range of a particular value or composition determined by those of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0125] As used herein, the terms "contain" or "include" can be understood to be open-ended, semi-closed-ended, or closed-ended. In other words, the terms also include "consist substantially of" or "consist of".
[0126] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of locations where the same residue appears. Normally, this is expressed as a percentage. The measurement of nucleotide sequence identity is a method well known to those skilled in the art.
[0127] As used herein, the terms "subject" and "subject in need" refer to any mammal or non-mammal. The mammal includes, but is not limited to, human, vertebrate (such as rodents), non-human primate, cow, horse, dog, cat, pig, sheep, goat, giraffe, deer, camel, antelope, hare and rabbit.
[0128] ADH Family Proteins
[0129] A large amount of alcohol dehydrogenase (ADH) family proteins can be found in human and animal livers, plants and microbial cells. As a key enzyme for the metabolism of short-chain alcohols in organisms, it plays an important role in many physiological processes. For example, in humans and mammals, alcohol dehydrogenase and acetaldehyde dehydrogenase (ALDH) constitute the alcohol dehydrogenase system, which participates in the metabolism of alcohol in the body.
[0130] The ADH family proteins include ADH1, ADH2, ADH3 and/or ADH4 proteins.
[0131] As shown in FIG. 2, the present invention found for the first time that ADH2 (SEQ ID NO.: 26, positions 45-122), ADH3 (SEQ ID NO.: 27, positions 71-148) and ADH4 (SEQ ID NO.: 28, positions 72-149) are highly homologous (about 98.7%) to ADH1 (SEQ ID NO.: 1, positions 47-124), and that ADH2 (H45, H49, H122), ADH3 (H71, H75, H148) and ADH4 (H72, H76, H149) correspond to H47, H51 and H124 in ADH1 respectively, that is, the corresponding relationship among the mutation sites of ADH1, ADH2, ADH3 and ADH4 are as follows.
TABLE-US-00001 ADH Family Proteins Mutation Sites ADH1 Position 47 Position 51 Position 124 ADH2 Position 45 Position 49 Position 122 ADH3 Position 71 Position 75 Position 148 ADH4 Position 72 Position 76 Position 149
[0132] Wild-Type ADH Family Protein
[0133] As used herein, "wild-type ADH family protein" refers to the naturally existing ADH family protein with no artificial engineering whose nucleotide sequence can be obtained through genetic engineering techniques (such as genome sequencing, polymerase chain reaction (PCR), etc.) and whose amino acid sequence can be deduced from the nucleotide sequence. The source of the wild-type ADH family protein is K. lactis wild-type cell strain. The wild-type ADH family proteins include ADH1, ADH2, ADH3 and/or ADH4 proteins.
[0134] In a preferred embodiment of the present invention, the amino acid sequence of the wild-type ADH family protein (e.g., ADH1, ADH2, ADH3, ADH4) is shown in SEQ ID NO.: 1, 26, 27 or 28, respectively.
[0135] ADH Family Protein Mutant and Coding Nucleic Acid Thereof
[0136] As used herein, the terms "mutant protein", "mutant protein of the present invention", "ADH mutant protein of the present invention", "mutated ADH protein of the present invention", "ADH mutant" and "mutant of ADH family protein" can be used interchangeably, all referring to mutant ADH protein which is not naturally existing, and the mutant protein has mutations of at least one histidine (H) among the amino acids at positions 45-149 of the wild-type alcohol dehydrogenase (ADH).
[0137] Moreover, in the present invention, the mutation does not include histidine (H) at positions 67, 69, 93 and/or 94 of the wild-type alcohol dehydrogenase (ADH).
[0138] In the present invention, the histidines can be independently mutated to basic amino acids, and the types of independent mutations of the histidine can be the same or different.
[0139] In a preferred embodiment, the histidines can be mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof.
[0140] In a preferred embodiment, the mutant ADH protein of the present invention is a protein obtained by artificially engineering the protein shown in SEQ ID NO: 1, 26, 27 or 28.
[0141] Wherein, the mutant protein contains core amino acids related to activity, and at least one of the core amino acids is artificially engineered; and the mutant protein of the present invention can significantly (i) improve the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reduce the binding ability of the mutant protein to Ni medium.
[0142] The term "core amino acids" refers to a sequence which is based on the sequence of SEQ ID NO.: 1, 26, 27 or 28 and has at least 80% (e.g., 84%, 85%, 90%, 92%, 95%, 98%) homology with SEQ ID NO.: 1, 26, 27 or 28, the corresponding position is the specific amino acids described herein. For example, based on the sequence shown in SEQ ID NO.: 1, the core amino acids are:
[0143] histidine (H) at position 47; and/or
[0144] histidine (H) at position 51; and/or
[0145] histidine (H) at position 124.
[0146] For example, based on the sequence shown in SEQ ID NO.: 26, the core amino acids are:
[0147] histidine (H) at position 45; and/or
[0148] histidine (H) at position 49; and/or
[0149] histidine (H) at position 122.
[0150] For example, based on the sequence shown in SEQ ID NO.: 27, the core amino acids are:
[0151] histidine (H) at position 71; and/or
[0152] histidine (H) at position 75; and/or
[0153] histidine (H) at position 148.
[0154] For example, based on the sequence shown in SEQ ID NO.: 28, the core amino acids are:
[0155] histidine (H) at position 72; and/or
[0156] histidine (H) at position 76; and/or
[0157] histidine (H) at position 149.
[0158] And the mutant proteins obtained by mutating the above-mentioned core amino acids have the activity of significantly (i) improving the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reducing the binding ability of the mutant protein to Ni medium.
[0159] In another preferred embodiment, the histidine (H) at position 47 is mutated to one or more amino acids selected from the following group: lysine (K), asparagine (N), glutamine (Q), arginine (R) and combinations thereof, preferably, lysine (K), asparagine (N) and/or arginine (R), more preferably, lysine (K) and/or asparagine (N).
[0160] In another preferred embodiment, the histidine (H) at position 51 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof, preferably, lysine (K) and/or arginine (R), more preferably, arginine (R).
[0161] In another preferred embodiment, the histidine (H) at position 124 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof, preferably, lysine (K).
[0162] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 1, wherein the one or more core amino acids selected from the following group:
[0163] histidine (H) at position 47; and
[0164] histidine (H) at position 124.
[0165] In another preferred embodiment, the histidine (H) at position 45 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0166] In another preferred embodiment, histidine (H) at position 49 is mutated to one or more amino acids selected from the group consisting of lysine (K), arginine (R) and a combination thereof.
[0167] In another preferred embodiment, histidine (H) at position 122 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0168] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 26, wherein the one or more core amino acids are selected from the following group:
[0169] histidine (H) at position 122; and
[0170] histidine (H) at position 45.
[0171] In another preferred embodiment, the histidine (H) at position 71 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0172] In another preferred embodiment, the histidine (H) at position 75 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0173] In another preferred embodiment, histidine (H) at position 148 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0174] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 27, wherein the one or more core amino acids are selected from the following group:
[0175] histidine (H) at position 148; and
[0176] histidine (H) at position 71.
[0177] In another preferred embodiment, the histidine (H) at position 72 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R), asparagine (N), glutamine (Q) and combinations thereof.
[0178] In another preferred embodiment, the histidine (H) at position 76 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0179] In another preferred embodiment, the histidine (H) at position 149 is mutated to one or more amino acids selected from the following group: lysine (K), arginine (R) and a combination thereof.
[0180] In another preferred embodiment, the mutant protein has mutations at one or more core amino acids of wild-type alcohol dehydrogenase (ADH) corresponding to SEQ ID NO.: 28, wherein the one or more core amino acids are selected from the following group:
[0181] histidine (H) at position 149; and
[0182] histidine (H) at position 72.
[0183] It should be understood that the amino acid serial numbers in the mutated ADH protein of the present invention are based on the amino acid sequence of the wild-type ADH protein (preferably, SEQ ID NO.: 1, 26, 27 or 28). When a specific mutant protein has at least 80% homology with the sequence shown in SEQ ID NO.: 1, 26, 27 or 28, the amino acid serial numbers of the mutant protein may have a dislocation relative to amino acid serial numbers of SEQ ID NO.: 1. 26, 27, or 28, such as 1-5 dislocation positions towards the N or C terminus of amino acids. Using conventional sequence alignment techniques in the art, it is generally understood by those skilled in the art that such dislocation is within a reasonable range, and mutant proteins having 80% (e.g. 90%, 95%, 98%) homology and having identical or similar activity, should not be excluded due to dislocation of amino acid serial numbers, from the scope of the mutant proteins of the present invention.
[0184] The mutant protein of the present invention is a synthesized protein or a recombinant protein, that is, it can be a chemically synthesized product, or be produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, plant) using recombinant technique. According to the host used in the recombinant production scheme, the mutant protein of the present invention can be glycosylated or non-glycosylated. The mutant protein of the present invention can also include or exclude the starting methionine residue.
[0185] The present invention also includes fragments, derivatives and analogues of the mutant protein. As used herein, the terms "fragment", "derivative" and "analogue" refer to a protein that substantially retains the same biological function or activity as the mutant protein.
[0186] The fragments, derivatives or analogues of the mutant protein of the present invention can be (i) a mutant protein in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, whereas such resultant substituted amino acid residues may or may not be encoded by genetic codes, or (ii) a mutant protein with a substitution group in one or more amino acid residues, or (iii) a mutant protein formed by the fusion of a mature mutant protein with another compound (such as a compound that prolongs the half-life of the mutant protein, such as polyethylene glycol), or (iv) a mutant protein formed by the fusion of an additional amino acid sequence to the mutant protein sequence (such as a fusion protein formed by fusion of a leading sequence, or a secretory sequence, or a sequence used to purify this mutant protein, or a proteogen sequence, or an antigen IgG fragment with the mutant protein). According to the teachings herein, these fragments, derivatives and analogues are within the scope well known to those skilled in the art. In the present invention, conservatively substituted amino acids are preferably generated by amino acid substitutions according to Table I.
TABLE-US-00002 TABLE I Initial Representative Preferred Residue Substitution Substitution Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu (L) Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Leu; Val; Ile; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala Leu
[0187] The active mutant protein of the present invention has the activity of significantly (i) improving the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reducing the binding ability of the mutant protein to Ni medium.
[0188] In the present invention, the mutant protein is as described in the first aspect of the present invention. Preferably, the mutant protein is an amino acid sequence as shown in any one of SEQ ID NO.: 2-13.
[0189] It should be understood that the mutant protein of the present invention generally has higher homology (identity) compared with the sequence shown in any one of SEQ ID NO.: 2-13. Preferably, the mutant protein has at least 80%, preferably at least 85%-90%, more preferably at least 95%, and most preferably at least 98% homology with any of the sequences shown in SEQ ID NO. 2-13
[0190] In addition, the mutant protein of the present invention can also be modified. Modification (usually not change the primary structure) forms include: in vivo or in vitro chemically derived forms of mutant protein, such as acetylation or carboxylation. Modification also includes glycosylation, such as glycosylation modification carried out in the synthesis and processing or in further processing steps of the mutant proteins. This modification can be accomplished by exposing the mutant proteins to enzymes (such as mammalian glycosylases or deglycosylases) that perform glycosylation. Modification forms further include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Modification forms further include mutant proteins that are modified and thereby obtain increased resistance to proteolysis or improved solubility.
[0191] The term "polynucleotide encoding the mutant protein" can be a polynucleotide encoding the mutant protein of the present invention, and also can be a polynucleotide that further contains additional coding and/or non-coding sequences.
[0192] The polynucleotide of the present invention can be in a form of DNA or RNA. In another preferred embodiment, the nucleotide is DNA. DNA forms include cDNA, genomic DNA and synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be a coding strand or a non-coding strand. The coding region sequence encoding a mature polypeptide can be the same as the sequence encoding the polypeptide shown in any one of SEQ ID NO.: 2-13 or can be a degenerate variant. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a polypeptide shown in any one of SEQ ID NO.: 2-13 but differs in the sequence of the corresponding coding region.
[0193] The present invention also relates to variants of the aforementioned polynucleotides. The variants encode fragments, analogues and derivatives of polypeptides or mutant proteins having the same amino acid sequence as that of the present invention. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide. The allelic variant may be a substitution, deletion or insertion of one or more nucleotides, but it does not substantially change the function of the mutant protein encoded by it.
[0194] The nucleic acid sequence can be DNA, RNA, cDNA or PNA. The nucleic acid sequence can be genomic, recombinant or synthetic. The nucleic acid sequence can be isolated or purified. The nucleic acid sequence can be single-stranded or double-stranded. Preferably, the nucleic acid sequence will encode a photosensitive protein as described herein. The nucleic acid sequence can be derived by cloning techniques, such as, by standard molecular cloning techniques including restriction enzyme digestion, ligation and gel electrophoresis, such as cloning techniques described in Sambrook et al. Molecular Cloning: A laboratory manual, Cold Spring Harbour Laboratory Press. The nucleic acid sequence can be isolated, for example be isolated by using PCR technology. Isolation means the isolation of nucleic acid sequences from any impurities and from other nucleic acid sequences and/or proteins that are naturally found associated with the nucleic acid sequence in the source. Preferably, the nucleic acid sequence also does not contain cellular materials, media or other chemicals from purification/production processes. The nucleic acid sequence can be synthetic, for example can be produced by direct chemical synthesis. The nucleic acid sequence can be provided as a naked nucleic acid, or can be provided in a form of complex with proteins or lipids.
[0195] The present invention also relates to a polynucleotide that hybridizes with the aforementioned sequence and has at least 50%, preferably at least 70%, and more preferably at least 80% identity with the aforementioned sequence. The present invention particularly relates to a polynucleotide that can hybridize with the polynucleotide of the present invention under strict conditions (or rigorous conditions). In the present invention, "strict conditions" refer to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2.times.SSC, 0.1% SDS, 60.degree. C.; or (2) hybridization in the presence of denaturant such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42.degree. C., etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%.
[0196] Mutant proteins and polynucleotides of the present invention are preferably provided in an isolated form, more preferably, being purified to homogeneity.
[0197] The full-length polynucleotide sequence of the present invention can usually be obtained by PCR amplification method, recombination method or artificial synthesis method. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and the relevant sequences can be amplified using a commercially available cDNA library or a cDNA library prepared according to the conventional methods known to those skilled in the art as a template. When the sequence is long, it is often necessary to perform PCR amplifications twice or more times, and then the amplified fragments obtained from each of the PCR amplifications are spliced together in correct order.
[0198] Once related sequences are obtained, related sequences can be obtained in large numbers by recombination method. This usually refers to cloning the related sequences into vectors, transformation into cells, and subsequent isolation from the proliferated host cells by conventional methods to obtain the related sequences.
[0199] In addition, the related sequences, especially related sequences with short fragment lengths, can also be synthesized by artificial synthesis methods. Usually, synthesize many small fragments first and then carry out ligation to obtain fragments with a long sequence.
[0200] At present, the DNA sequence encoding the protein (or fragment or derivative thereof) of the present invention has can be obtained entirely via chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (such as vectors) and cells known in the art. In addition, one can also introduce mutations into the protein sequence of the present invention via chemical synthesis.
[0201] The methods of amplifying DNA/RNA using PCR technology are preferably used to obtain the polynucleotide of the present invention. Especially when it is difficult to obtain full-length cDNA from the library, RACE method (RACE, Rapid Amplification of cDNA ends) can be preferably used. Primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and can be synthesized by conventional methods. Amplified DNA/RNA fragments can be separated and purified by conventional methods such as gel electrophoresis.
[0202] In the present invention, DNA coding sequence of the ADH protein mutant is the nucleotide sequence shown in any one of SEQ ID NO.: 14-25.
[0203] Expression Vector and Host Cell
[0204] The present invention also relates to a vector containing the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or using the coding sequence of the mutant protein of the present invention, and relates to a method for producing the polypeptide of the present invention through recombinant technology.
[0205] Through conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant mutant protein. Generally speaking, the method comprises the following steps:
[0206] (1) transforming or transducing an appropriate host cell with a polynucleotide (or a variant) encoding the mutant protein of the present invention, or with a recombinant expression vector containing the polynucleotide;
[0207] (2) culturing the host cell in an appropriate medium; and
[0208] (3) isolating and purifying proteins from the medium or cells.
[0209] In the present invention, the polynucleotide sequence encoding the mutant protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus and retrovirus, or other vectors well known in the art. Any plasmids and vectors can be used as long as they can be replicated and stable in the host. An important feature of the expression vector is that it usually contains a replication origin, a promoter, a marker gene and translation control elements.
[0210] Methods well known to those skilled in the art can be used to construct an expression vector containing the DNA sequence encoding the mutant protein of the present invention and appropriate transcription/translation control signals. These methods include in-vitro recombinant DNA technology, DNA synthesis technology, in-vivo recombination technology, etc. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters include: lac or trp promoter of E. coli; PL promoter of .lamda. phage; eukaryotic promoters including CMV immediate-early promoter, HSV thymidine kinase promoter, SV40 early and late promoters, LTRs of retroviruses and some other known promoters that can control gene expression in prokaryotic or eukaryotic cells or viruses therein. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.
[0211] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic characters for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or such as tetracycline resistance or ampicillin resistance for E. coli.
[0212] A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it express proteins.
[0213] The host cells can be prokaryotic cells (such as E. coli), or lower eukaryotic cells, or higher eukaryotic cells such as yeast cells, plant cells, or mammal cells (including human and non-human mammal cells). Representative examples include: E. coli, wheat germ cells, insect cells, SF9 cells, Hela cells, HEK293 cells, CHO cells, yeast cells, etc. In a preferred embodiment of the present invention, yeast cells (such as Pichia pastoris, Kluyveromyces or a combination thereof; preferably, the yeast cells include: Kluyveromyces, more preferably Kluyveromyces marxianus and/or Kluyveromyces lactis) are selected as host cells.
[0214] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. The enhancer is a cis-acting element of DNA, usually of about 10 to 300 base pairs, acting on promoters to enhance gene transcription. Examples include SV40 enhancer of 100 to 270 base pairs on the late side of replication origin, polyoma enhancer on the late side of replication origin, adenovirus enhancer, etc.
[0215] Those of ordinary skill in the art know how to select appropriate vectors, promoters, enhancers and host cells.
[0216] Transformation of host cells by using recombinant DNA can be performed by using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as E. coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and be treated by CaCl.sub.2) method, where the steps used are well known in the art. Another method is using MgCl.sub.2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method and conventional mechanical methods such as microinjection, electroporation, liposomal packaging, etc.
[0217] The obtained transformants can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. According to the host cell used, the medium used in the culture can be selected from various conventional media. The culture is carried out under conditions suitable for the growth of the host cell. After the host cell has grown to an appropriate cell density, the selected promoters are induced by appropriate methods (such as temperature switching or chemical induction) and the cells are cultured for another period of time.
[0218] The recombinant polypeptide mentioned in the above method can be expressed in the inside of the cell or on the cell membrane, or be secreted to the outside of the cell. If necessary, the recombinant protein can be separated and purified via various separation methods by virtue of its physical, chemical and other characteristics. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein-precipitating agent (salting-out method), centrifugation, osmotic lysis of bacteria, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.
[0219] The main advantages of the present invention include as follows:
[0220] (1) The present invention determines the type of intracellular protein that can bind to Ni medium via mass spectrometry identification of the components in cells that bind to Ni medium;
[0221] (2) For the first time, the present invention provides a series of histidine sites in ADH family proteins that may bind to Ni medium by systematically analyzing ADH family proteins in the cell genome.
[0222] (3) For the first time, the present invention obtains several strains that can significantly reduce the binding ability of ADH1 to Ni medium through gene knockout of ADH1 and site-directed mutation of a series of histidine sites in ADH1 that may bind to Ni medium.
[0223] (4) By analyzing the transcription and translation activity of cell-free system of multiple cell strains mentioned above, it is found that the site-directed mutation of ADH1 has less effect on the transcription and translation activity of cell-free system than the gene knockout, and for the first time, a cell strain, which does not affect the transcription and translation activity of cell-free system as well as significantly reduces the binding ability of ADH1 to Ni medium, is obtained.
[0224] (5) The present invention takes Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are also applicable to other cells including prokaryotic cells, eukaryotic cells, yeast cells, human source cells, Hela cells, CHO cells, HEK293 cells, Saccharomyces cerevisiae, etc.
[0225] (6) For the first time, it is found, in the present invention, that the mutation of the core amino acids of ADH family proteins can significantly (i) improve the expression purity, efficiency, and/or yield of the exogenous protein in an in-vitro cell-free synthesis system; and/or (ii) reduce the binding ability of the mutant protein to Ni medium.
[0226] The present invention will be further illustrated below in combination with specific examples (or embodiments). It should be understood that these examples (or embodiments) are provided solely for the purpose of illustration and should not be regarded as limitations to the scope of the present invention. With respect to the experimental methods without specifically described conditions in the following examples (or embodiments), one person can generally follow conventional conditions, such as conditions described in Sambrook et. al, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or follow conditions recommended by the manufacturer. Unless otherwise stated, percentage and portions refer to percentage by weight and portions by weight.
[0227] Unless otherwise stated, materials and reagents used in the examples of the present invention are all commercially available products.
[0228] The present invention takes Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis and experimental methods are also applicable to other cells including prokaryotic cells, eukaryotic cells, yeast cells, human source cells, Hela cells, CHO cells, HEK293 cells, Saccharomyces cerevisiae and other cells
[0229] General Method
[0230] The present invention provides a design and method as follows: Ni-binding proteins are identified through Ni purification and mass spectrometry analysis, and then, on this basis, ADH family proteins in the genome are subjected to point mutations to reduce their binding ability to Ni medium, thereby improving the efficiency, yield and purity of proteins purified by Ni. The following steps are included:
[0231] (1) identification and analysis of ADH family proteins by the following method:
[0232] A. polyacrylamide gel electrophoresis analysis of protein purified by Ni;
[0233] B. mass spectrometry analysis of non-specific bands (35-50 kDa); and
[0234] C. peptide comparison of mass spectrometry analysis results to identify the main non-specific band which was identified as ADH protein;
[0235] (2) analysis of potential binding sites of K. lactis ADH family proteins to Ni medium by the following method:
[0236] A. sequence alignment of ADH1 protein in K. lactis and ADH1 protein in Saccharomyces cerevisiae;
[0237] B. using ScADH as a template for homology modeling, and finding out the His-rich region sites in KlADH, such as H47, H51 and H124 in ADH1; H45, H49 and H122 in ADH2; H71, H75 and H148 and ADH3; H72, H76 and H149 in ADH4; and
[0238] C. performing an engineerability analysis on His sites in this region, such as whether the engineering affects the catalytic activity of ADH, and finally selecting alternative amino acids, such as a site-directed mutation of ADH1 selected from the following group: H124K, H124R, H47K, H47R, H47N, H47Q, H51K, H51R, H124KH47K, H124KH47R, H124KH47N, H124KH47Q and combinations thereof; a site-directed mutation of ADH2 selected from the following group: H122K, H122R, H45K, H45R, H45N, H45Q, H49K, H49R, H122KH45K, H122KH45R, H122KH45N, H122KH45Q and combinations thereof; a site-directed mutation of ADH3 selected from the following group: H148K, H148R, H71K, H71R, H71N, H71Q, H75K, H75R, H148KH71K, H148KH71R, H148KH71N, H148KH71Q and combinations thereof; a site-directed mutation of ADH4 selected from the following group: H149K, H149R, H72K, H72R, H72N, H72Q, H76K, H76R, H149KH72K, H149KH72R, H149KH72N, H149KH72Q and combinations thereof;
[0239] (3) construction of Cas9-gRNA cloning vector, and the construction method is as follows:
[0240] A. for the sequence of a specific gene, respectively designing a gRNA sequence that guides the splicing of the gene; and
[0241] B. recombining the above gRNA sequence into a vector containing Cas9 to obtain a first vector in which the gRNA and Cas9 are co-expressed;
[0242] (4) construction of a donor DNA which is used for knock-out of the specific gene by the following method:
[0243] A. downloading the nucleotide sequence of the specific gene from the gene database, and constructing a second vector by using sequences located at 800 bp upstream and downstream of the gene, respectively; and
[0244] B. amplifying the second vector with primers M13F and M13R, and the obtained PCR product is concentrated by alcohol precipitation to obtain the donor DNA;
[0245] (5) construction of a donor DNA with a specific point mutation of histidine residue by the following method:
[0246] A. downloading the nucleotide sequence of the specific gene from the gene database, and constructing a second vector by using the target gene and sequences located at 800 bp upstream and downstream of the target gene, respectively, making point mutations to parts of amino acid residues, and making synonymous mutations to gRNA; and
[0247] B. amplifying the second vector with primers M13F and M13R, and the obtained PCR product is concentrated by alcohol precipitation to obtain the donor DNA;
[0248] (6) obtaining a cell strain with knockout or point mutation of the specific gene by the following method:
[0249] A. transforming the first vector and the donor DNA simultaneously into competent cells; and
[0250] B. screening out monoclonal cells for enlargement culture, extracting the genome, designing primers to amplify the ADH genes and homologous arms, and the amplified PCR products are verified by sequencing;
[0251] (7) testing the binding ability of the strain, which has been subjected to gene knockout or point mutant, to Ni medium by the following method:
[0252] A. performing enlargement culture for the obtained strain having been subjected to gene knockout or point mutant, and performing cell lysis to obtain a cell lysate; and
[0253] B. purifying the cell lysate through Ni medium, and analyzing the purified product via polyacrylamide gel electrophoresis;
[0254] (8) Cell-free in vitro protein synthesis system A yeast cell lysate is prepared using the genetically engineered cell strain and added into an in vitro protein translation system. The reaction system is let stand at 20-30.degree. C. for 2-12 hours, the absorbance value by using a multifunctional microplate reader (Perkin Elmer) is read, and the activity of the enhanced green fluorescent protein (eGFP) is detected.
Example 1 Analysis and Specific Engineering of ADH Family Genes in K. lactis
[0255] 1.1 Analysis of ADH Family Genes in K. lactis
[0256] When a His-tag-labeled target protein, which was expressed in K. lactis, was affinity-purified with Ni medium, there was an obvious non-specific band at 35-50 kDa. Mass spectrometry results showed that the non-specific protein was mainly derived from ADH family proteins in K. lactis (Table 1). ADH is a NAD(P)-dependent oxidoreductase, exists in almost all organisms and catalyzes the reversible oxidation of primary and secondary alcohols to aldehydes and ketones, respectively. The ADH family proteins in K. lactis include four types of KlADH1, KlADH2, KlADH3 and KlADH4, and all of them are encoded by chromosomal DNA. Among them, ADH1 gene sequence (SEQ ID NO. 32) with a KEGG database code of KlLA0F21010g is located at chromosome F; ADH2 gene sequence (SEQ ID NO. 29) with a KEGG database code of KlLA0F18260g is located at chromosome F; ADH3 gene sequence (SEQ ID NO. 30) with a KEGG database code of KlLA0B09064g is located at chromosome B; ADH4 gene sequence (SEQ ID NO. 31) with a KEGG database code of KlLA0F13530g is located at chromosome F. Among them, ADH1 and ADH2 carry out their functions in the cytosol, while ADH3 and ADH4 carry out their functions in mitochondria, with relative molecular weights of 37.3 kDa, 37.1 kDa, 39.6 kDa and 40.2 kDa, respectively. The amino acid sequences of these four ADH proteins are highly homologous and their tertiary structures are also quite similar.
TABLE-US-00003 TABLE 1 Peptide fragments obtained by identifying non-specific proteins purified by Ni medium by mass spectrometry and K. lactis endogenous proteins indicated by the peptide fragments EAIDFFSR ADH1 SNGTVVLVGLPR ADH1&ADH2 SISIVGSYVGNR ADH1 DLGGEYFIDFTK ADH1 GVIFYENGGELQYK ADH1&ADH2 LPLVGGHEGAGVVVA ADH1&ADH2&ADH3 MGENVK (mitochondria) APIHVVGLSELPSIYEK ADH1 GGAHGVINVSVSEFAI ADH1&ADH2 EQSTNYVR AGDWVAISGAAGGLG ADH1&ADH3 SLAVQYAK (mitochondria) GVIFYENGGKIEYK ADH3&ADH4 (mitochondria) SDVFNQVVK ADH1 NIPEEVIEATK ADH1 ANEILINVK ADH4
[0257] Because the crystal structure of ADH family proteins in K. lactis are still unknown, we used homology modeling to predict their spatial tertiary structures. The primary sequence alignment between KlADH1 in K. lactis and ScADH1 in Saccharomyces cerevisiae (PDB No. 4W6Z) shows that the two are tetramers with 84.9% sequence homology. Homology modeling using ScADH1 as template showed that each monomer of KlADH1 in K. lactis contains a total of six His, located at positions 47, 51, 69, 124, 243 and 321, respectively. The whole tetramer contains a total of four His-rich regions. Except that the 5th His of each monomer is relatively independent, the other five His of each monomer are close in space, wherein, the closest in space (and also in sequence) among the other five His are the three to four His in front of each monomer.
[0258] Since the four ADHs in K. lactis are highly homologous and five His are highly conserved, the spatial structures of KlADH2, KlADH3 and KlADH4 are also similar to the spatial structure of KlADH1, that is, the first four His of each ADH protein may cluster in space, thereby generating affinity to Ni medium.
[0259] 1.2 Specific Engineering of ADH Family Genes in K. lactis
[0260] In view of the need to minimize as far as possible the effect on ADH activity when eliminating the affinity of ADH to Ni medium, the analysis of function of His in KlADH becomes the key. Through a large number of comparisons and screening, it was found that among the six His in KlADH1 protein homologous to those in ScADH1 protein, H44, H48, H66 and H121, because of their homology with the four His clustered in KlADH1, become the key point of the analysis of the present invention. Because H66 is involved in chelating catalytic Zn' in both two conformations of ScADH1, as shown in FIG. 6, it may play a significant impact on the catalytic activity of ADH, so as that it is not taken as an engineering target of the present invention. Although H48 does not bind to coenzymes, it participates in the formation of the ternary complex and affects the proton transfer process of the substrate, as shown in FIG. 7. The research of the present invention found that ND1 on the H44 imidazole ring may form a hydrogen bond with O2A of NAD.sup.+, thereby participating in the binding of NAD.sup.+/NADH. H44R can reduce the dissociation constant of NAD.sup.+ and NADH by 2-4 times, and decrease the conversion number by 4-6 times. In addition, the side chain of H121 can form a hydrogen bond with T130.
[0261] Based on the above research, in the present invention, three His sites (H44, H48 and H121, respectively) that have little effect on the function of ADH1 in ScADH1 were mutated to amino acids with similar function, and finally the point mutation scheme designed for KlADH1 was H124K, H124R, H47K, H47R, H47N, H47Q, H51K, H51R, H124KH47K, H124KH47R, H124KH47N and H124KH47Q.
[0262] Because ADH2, ADH3 and ADH4 in K. lactis are highly homologous with ADH1 (FIG. 2), that is, H45, H49 and H122 in ADH2, H71, H75 and H148 in ADH3, and H72, H76 and H149 in ADH4 correspond to H47, H51 and H124 in ADH1, respectively.
[0263] Therefore, in the present invention, ADH1 is taken as an example to reduce the binding of ADH1 to Ni medium, specifically as indicated in the knockout of ADHD gene and the site-directed mutation of H47, H51 and H124. ADH2, ADH3 and ADH4 can also be engineered at corresponding sites by using methods similar to those for ADH1.
Example 2 Targeted Knockout of ADH1 Gene Via CRISPR/Cas9
[0264] 2.1 Determination of KlADH1 CRISPR gRNA Sequence
[0265] According to the point mutation designed in KlADH1, PAM sequence (NGG) was selected and corresponding gRNA sequence was determined. The principle for selecting gRNA in this example is as follows: the GC content should be moderate (40%-60%), and the existence of a poly T structure should be avoided. In this embodiment, the KlADH1 gRNA1 sequence is TGGGTGAAAACGTCAAGGGC.
[0266] Methods for plasmid construction and transformation are as follows: using primers pKMCas9-KlADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC and pCas9-KlADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG, and using pCAS plasmid as template, PCR amplification was performed. 17 .mu.L of amplified product was taken and added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours. 10 .mu.L of DpnI-treated mixture was added into 50 .mu.L of DH5.alpha. competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 45 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto a Kan-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Two monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMCas9_StR_KlADH1.
[0267] 2.2 Construction and Amplification of Donor DNA Plasmid
[0268] In this example, to facilitate the storage and amplification of linear donor DNA, the donor DNA was firstly inserted into a pKMD1 plasmid, and then amplified by PCR to obtain linear donor DNA sequences.
[0269] A PCR amplification process was carried out by using primers of pKMD1-PF: ATCGTCGACCTGCAGGCATG and pKMD1-PR: ATCTCTAGAGGATCCCCGGG with a pKMD1 plasmid as template. 17 .mu.L amplified product was taken and then added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours; and a linear fragment pKMD1-T of plasmid skeleton was obtained.
[0270] 2.2.1 Construction of Donor Plasmid pKMD1-.DELTA.KlADH1
[0271] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCT AGAGATCATGGACAATACGTTACCGAGATGAGG and KlADH1-H R1-PR: GAAGAGATTTCATTTATCTTTTTTTAGTATAGAGTTTGTG TGTTTAAAGCTTG with a Kluyveromyces lactis genomic DNA as template, and the product was named .DELTA.KlADH1-F1; another PCR amplification process was carried out by using primers of KlADH1-HR2-PF: CAAACTCTATACTAAAAAAAGATAAATGAAATCTC TTCCGCATTCAAGTCATGAC and KlADH1-HR2-PR: TGCCAAG CTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTAGATTTCA AACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named .DELTA.KlADH1-F2.
[0272] 1 .mu.L of each of the amplified products .DELTA.KlADH1-F1, .DELTA.KlADH1-F2 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix (a kit named Transgene pEASY-Uni Seamless Cloning and Assembly Kit, from TransGen Biotech Company, the same below) and 2 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells (from TransGen Biotech Company, the same below). The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-.DELTA.KlADH1.
[0273] 2.3 Electrotransformation of K. lactis
[0274] The competent cells were taken out from a -80.degree. C. refrigerator, melted on ice and added with 400 ng gRNA&Cas9 plasmids (or gRNA/cas9 fragments) and 1000 ng Donor DNA fragments. After mixing, the mixture was transferred into an electroporation cuvette and was bathed in ice for 2 minutes. The electroporation cuvette was put into electroporator for electric shock (with parameters of 1.5 kV, 200.OMEGA. and 25 .mu.F). After completion of the electric shock, the mixture was immediately added with 700 .mu.L of YPD, and then incubated on a shaker at a speed of 200 rpm at 30.degree. C. for 1-3 hours. 2-200 .mu.L of the mixture was taken and inoculated on YPD (with G418 resistance) plate and cultured at 30.degree. C. for 2-3 days until monoclonal colonies appeared.
[0275] 2.4 Positive Identification
[0276] 12 to 24 monoclonal colonies were picked out from the plate with transformed cells. Samples were detected by PCR using identification primers of ADH1-CF: GTGATGGAACACGGGAATAG and ADH1-CR: CACATATACCTTGGCAGTAG with the cells as template. Strains that were tested positive by PCR and identified by sequencing were determined as positive strains and named .DELTA.ADH1.
Example 3 Site-Directed Mutation of ADH1 H47 Site by CRISPR/Cas9
[0277] 3.1 Determination of KlADH1 CRISPR gRNA Sequence
[0278] According to the point mutation designed in KlADH1, PAM sequence (NGG) was selected and corresponding gRNA sequence was determined. The principle for selecting gRNA in this example is as follows: the gRNA should be close to the designed mutation site; the GC content should be moderate (40%-60%), and the existence of a poly T structure should be avoided. In this embodiment, the KlADH1 gRNA1 sequence is TGGGTGAAAACGTCAAGGGC.
[0279] Methods for plasmid construction and transformation are as follows: using primers pCas9-KlADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC and pCas9-KlADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG, and using pCAS plasmid as template, PCR amplification was performed. 17 .mu.L of amplified product was taken and added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer. After mixing, the mixture was incubated at 37.degree. C. for 3 hours. 10 .mu.L of DpnI-treated mixture was added into 50 .mu.L of DH5.alpha. competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 45 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto a Kan-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Two monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMCas9_StR_KlADH1.
[0280] 3.2 Construction and Amplification of Donor DNA Plasmid
[0281] In this example, to facilitate the storage and amplification of linear donor DNA, the donor DNA was firstly inserted into a pKMD1 plasmid, and then amplified by PCR to obtain linear donor DNA sequences.
[0282] A PCR amplification process was carried out by using primers of pKMD1-PF: ATCGTCGACCTGCAGGCATG and pKMD1-PR: ATCTCTAGAGGATCCCCGGG with a pKMD1 plasmid as template. 17 .mu.L amplified product was taken and then added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours; and a linear fragment pKMD1-T of plasmid skeleton was obtained.
[0283] 3.2.1 Construction of Donor Plasmid pKMD1-KlADH1-H47K
[0284] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47K-PR: AGCATGAAGGTCAGTTTTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47K-F1; another PCR amplification process was carried out by using primers of KlADH1-H47K-PF: GTAAAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47N-F3.
[0285] 1 .mu.L of each of the amplified products KlADH1-H47K-F1, KlADH1-H47K-F2, KlADH1-H47K-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47K.
[0286] 3.2.2 Construction of Donor Plasmid pKMD1-KlADH1-H47N
[0287] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47N-PR: AGCATGAAGGTCAGTATTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47N-F1; another PCR amplification process was carried out by using primers of KlADH1-H47N-PF: GTAATACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47N-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47N-F3.
[0288] 1 .mu.L of each of the amplified products KlADH1-H47N-F1, KlADH1-H47N-F2, KlADH1-H47N-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47N.
[0289] 3.2.3 Construction of donor plasmid pKMD1-KlADH1-H47Q One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47Q-PR: AGCATGAAGGTCAGTTTGACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47Q-F1; another PCR amplification process was carried out by using primers of KlADH1-H47Q-PF: GTCAAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47Q-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47Q-F3.
[0290] 1 .mu.L of each of the amplified products KlADH1-H47Q-F1, KlADH1-H47Q-F2, KlADH1-H47Q-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47Q.
[0291] 3.2.4 Construction of Donor Plasmid pKMD1-KlADH1-H47R
[0292] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47R-PR: AGCATGAAGGTCAGTTCTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47R-F1; another PCR amplification process was carried out by using primers of KlADH1-H47R-PF: GTAGAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47R-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47R-F3.
[0293] 1 .mu.L of each of the amplified products KlADH1-H47R-F1, KlADH1-H47R-F2, KlADH1-H47R-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47R.
[0294] 3.3 Electrotransformation of K. lactis (the Same as Example 2.3)
[0295] 3.4 Positive Identification
[0296] 12 to 24 monoclonal colonies were picked out from a plate with transformed cells. Samples were detected by PCR using identification primers of ADH1-m-CF: TGGGAGAGAATGTTAAAGGT and ADH1-m-CR: TGACGGTCGTTAACTAAGAT and by using the cells as template. Strains that were tested positive by PCR and identified by sequencing were determined as positive strains and named ADH1 H47K, ADH1 H47N, ADH1 H47Q and ADH1 H47R, respectively.
Example 4 Site-Directed Mutation of ADH1 H51 Site by CRISPR/Cas9
[0297] 4.1 Determination of KlADH1 CRISPR gRNA Sequence
[0298] According to the point mutation designed in KlADH1, PAM sequence (NGG) was selected and corresponding gRNA sequence was determined. The principle for selecting gRNA in this example is as follows: the gRNA should be close to the designed mutation site; the GC content should be moderate (40%-60%), and the existence of a poly T structure should be avoided. In this embodiment, the KlADH1 gRNA1 sequence is TGGGTGAAAACGTCAAGGGC.
[0299] Methods for plasmid construction and transformations are as follows: using primers pCas9-KlADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC and pCas9-KlADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG, and using pCAS plasmid as template, PCR amplification was performed. 17 .mu.L of amplified product was taken and added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer. After mixing the mixture was incubated at 37.degree. C. for 3 hours. 10 .mu.L of DpnI-treated mixture was added into 50 .mu.L of DH5.alpha. competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 45 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto a Kan-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Two monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMCas9_StR_KlADH1.
[0300] 4.2 Construction and Amplification of Donor DNA Plasmid
[0301] In this example, to facilitate the storage and amplification of linear donor DNA, the donor DNA was firstly inserted into a pKMD1 plasmid, and then amplified by PCR to obtain linear donor DNA sequences.
[0302] One PCR amplification process was carried out by using primers of pKMD1-PF: ATCGTCGACCTGCAGGCATG and pKMD1-PR: ATCTCTAGAGGATCCCCGGG with a pKMD1 plasmid as template. 17 .mu.L amplified product was taken and then added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours; and a linear fragment pKMD1-T of plasmid skeleton was obtained.
[0303] 4.2.1 Construction of Donor Plasmid pKMD1-KlADH1-H51K
[0304] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H51K-PR: CCAAGCTTTAAGGTCAGTATGACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51K-F1; another PCR amplification process was carried out by using primers of KlADH1-H51K-PF: GTCATACTGACCTTAAAGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51K-F3.
[0305] 1 .mu.L of each of the amplified products KlADH1-H51K-F1, KlADH1-H51K-F2, KlADH1-H51K-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H51K.
[0306] 4.2.2 Construction of Donor Plasmid pKMD1-KlADH1-H51R
[0307] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H51R-PR: CCAAGCTCTAAGGTCAGTATGACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51R-F1; another PCR amplification process was carried out by using primers of KlADH1-H51R-PF: GTCATACTGACCTTAGAGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51R-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H51R-F3.
[0308] 1 .mu.L of each of the amplified products KlADH1-H51R-F1, KlADH1-H51R-F2, KlADH1-H51R-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H51R.
[0309] 4.3 Electrotransformation of K. lactis (the Same as Example 2.3)
[0310] 4.4 Positive Identification
[0311] 12 to 24 monoclonal colonies were picked out from a plate with transformed cells. Samples were detected by PCR using identification primers of ADH1-m-CF: TGGGAGAGAATGTTAAAGGT and ADH1-m-CR: TGACGGTCGTTAACTAAGAT with the cells as template. Strains that were tested positive by PCR and identified by sequencing were determined as positive strains and named ADH1 H51K and ADH1 H51R, respectively.
Example 5 Site-Directed Mutation of ADH1 H124 Site by CRISPR/Cas9
[0312] 5.1 Determination of KlADH1 CRISPR gRNA Sequence
[0313] According to the point mutation designed in KlADH1, PAM sequence (NGG) was selected and corresponding gRNA sequence was determined. The principle for selecting gRNA in this example is as follows: the gRNA should be close to the designed mutation site; the GC content should be moderate (40%-60%), and the existence of a poly T structure should be avoided. In this embodiment, the KlADH1 gRNA1 sequence is TGGGTGAAAACGTCAAGGGC.
[0314] Methods for plasmid construction and transformation of are as follows: using primers pCas9-KlADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC and pCas9-KlADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG, and using pCAS plasmid as template, PCR amplification was performed. 17 .mu.L of amplified product was taken and added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours. 10 .mu.L of DpnI-treated mixture was added into 50 .mu.L of DH5.alpha. competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 45 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto a Kan-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Two monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMCas9_StR_KlADH1.
[0315] 5.2 Construction and Amplification of Donor DNA Plasmid
[0316] In this example, to facilitate the storage and amplification of linear donor DNA, the donor DNA was firstly inserted into a pKMD1 plasmid, and then amplified by PCR to obtain linear donor DNA sequences.
[0317] A PCR amplification process was carried out by using primers of pKMD1-PF: ATCGTCGACCTGCAGGCATG and pKMD1-PR: ATCTCTAGAGGATCCCCGGG with a pKMD1 plasmid as template. 17 .mu.L amplified product was taken and then added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours; and a linear fragment pKMD1-T of plasmid skeleton was obtained.
[0318] 5.2.1 Construction of donor plasmid pKMD1-KlADH1-H124K One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124K-F1; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTG G and KlADH1-H124K-PR: CCATCTTTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTG G with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124K-F2; another PCR amplification process was carried out by using primers of KlADH1-H124K-PF: CTTGAGTGGATATACAAAAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124K-F3.
[0319] 1 .mu.L of each of the amplified products KlADH1-H124K-F1, KlADH1-H124K-F2, KlADH1-H124K-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H124K.
[0320] 5.2.2 Construction of Donor Plasmid pKMD1-KlADH1-H124R
[0321] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124K-F1; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTG G and KlADH1-H124R-PR: CCATCTCTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTG G with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124R-F2; another PCR amplification process was carried out by using primers of KlADH1-H124R-PF: CTTGAGTGGATATACAAGAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H124R-F3.
[0322] 1 .mu.L of each of the amplified products KlADH1-H124R-F1, KlADH1-H124R-F2, KlADH1-H124R-F3 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix and 1 .mu.L of water. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H124R.
[0323] 5.3 Electrotransformation of K. lactis (the Same as Example 2.3)
[0324] 5.4 Positive Identification
[0325] 12 to 24 monoclonal colonies were picked out from a plate with transformed cells. Samples were detected by PCR using identification primers of ADH1-m-CF: TGGGAGAGAATGTTAAAGGT and ADH1-m-CR: TGACGGTCGTTAACTAAGAT with the cells as template. Strains that were tested positive by PCR and identified by sequencing were determined as positive strains and named ADH1 H124K and ADH1 H124R, respectively.
Example 6 Simultaneous Site-Directed Mutation of ADH1 H47 and H124 Sites by CRISPR/Cas9
[0326] 6.1 Determination of KlADH1 CRISPR gRNA Sequence
[0327] According to the point mutation designed in KlADH1, PAM sequence (NGG) was selected and corresponding gRNA sequence was determined. The principle for selecting gRNA in this example is as follows: the gRNA should be close to the designed mutation site; the GC content should be moderate (40%-60%), and the existence of a poly T structure should be avoided. In this embodiment, the KlADH1 gRNA1 sequence is TGGGTGAAAACGTCAAGGGC.
[0328] Methods for plasmid construction and transformation of are as follows: using primers pCas9-KlADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC and pCas9-KlADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG, and using pCAS plasmid as template, PCR amplification was performed. 17 .mu.L of amplified product was taken and added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours. 10 .mu.L of DpnI-treated mixture was added into 50 .mu.L of DH5.alpha. competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 45 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto a Kan-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Two monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMCas9_StR_KlADH1.
[0329] 6.2 Construction and Amplification of Donor DNA Plasmid
[0330] In this example, to facilitate the storage and amplification of linear donor DNA, the donor DNA was firstly inserted into a pKMD1 plasmid, and then amplified by PCR to obtain linear donor DNA sequences.
[0331] A PCR amplification process was carried out by using primers of pKMD1-PF: ATCGTCGACCTGCAGGCATG and pKMD1-PR: ATCTCTAGAGGATCCCCGGG with a pKMD1 plasmid as template. 17 .mu.L amplified product was taken and then added with 1 .mu.L of Dpn I and 2 .mu.L of 10.times. digestion buffer; after mixing, the mixture was incubated at 37.degree. C. for 3 hours; and a linear fragment pKMD1-T of plasmid skeleton was obtained.
[0332] 6.2.1 Construction of Donor Plasmid pKMD1-KlADH1-H47KH124K
[0333] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47K-PR: AGCATGAAGGTCAGTTTTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47KH124K-F1; another PCR amplification process was carried out by using primers of KlADH1-H47K-PF: GTAAAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47KH124K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-H124K-PR: CCATCTTTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTGG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47KH124K-F3; another PCR amplification process was carried out by using primers of KlADH1-H124K-PF: CTTGAGTGGATATACAAAAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47KH124K-F4.
[0334] 1 .mu.L of each of the amplified products KlADH1-H47KH124K-F1, KlADH1-H47KH124K-F2, KlADH1-H47KH124K-F3, KlADH1-H47KH124K-F4 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADHJ-H47KH124K.
[0335] 6.2.2 Construction of Donor Plasmid pKMD1-KlADH1-H47NH124K
[0336] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47N-PR: AGCATGAAGGTCAGTATTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47NH124K-F1; another PCR amplification process was carried out by using primers of KlADH1-H47N-PF: GTAATACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47NH124K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-H124K-PR: CCATCTTTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTGG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47NH124K-F3; another PCR amplification process was carried out by using primers of KlADH1-H124K-PF: CTTGAGTGGATATACAAAAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47NH124K-F4.
[0337] 1 .mu.L of each of the amplified products KlADH1-H47NH124K-F1, KlADH1-H47NH124K-F2, KlADH1-H47NH124K-F3, KlADH1-H47NH124K-F4 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADHJ-H47NH124K.
[0338] 6.2.3 Construction of Donor Plasmid pKMD1-KlADH1-H47QH124K
[0339] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47Q-PR: AGCATGAAGGTCAGTTTGACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47QH124K-F1; another PCR amplification process was carried out by using primers of KlADH1-H47Q-PF: GTCAAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR: CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47QH124K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-H124K-PR: CCATCTTTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTGG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47QH124K-F3; another PCR amplification process was carried out by using primers of KlADH1-H124K-PF: CTTGAGTGGATATACAAAAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47QH124K-F4.
[0340] 1 .mu.L of each of the amplified products KlADH1-H47QH124K-F1, KlADH1-H47QH124K-F2, KlADH1-H47QH124K-F3, KlADH1-H47QH124K-F4 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47QH124K.
[0341] 6.2.4 Construction of Donor Plasmid pKMD1-KlADH1-H47RH124K
[0342] One PCR amplification process was carried out by using primers of KlADH1-HR1-PF: TCGAGCTCGGTACCCGGGGATCCTCTAGAGATCATGGACAATAC GTTACCGAGATGAGG and KlADH1-H47R-PR: AGCATGAAGGTCAGTTCTACAGACACCGGAGTACTTGACG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47RH124K-F1; another PCR amplification process was carried out by using primers of KlADH1-H47R-PF: GTAGAACTGACCTTCATGCTTGGAAGGGTGACTGGCCTTTG and KlADH1-gRNA1-m-PR CCAACCTTTAACATTCTCTCCCATAGCAACAACGACACCAG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47RH124K-F2; another PCR amplification process was carried out by using primers of KlADH1-gRNA1-m-PF: GGGAGAGAATGTTAAAGGTTGGAAGATTGGTGACTTCGCTGG and KlADH1-H124K-PR: CCATCTTTTGTATATCCACTCAAGTCAGCTTCTGGACAGTTGG with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47RH124K-F3; another PCR amplification process was carried out by using primers of KlADH1-H124K-PF: CTTGAGTGGATATACAAAAGATGGTTCTTTCCAACAATACGCTA CTGC and KlADH1-HR2-PR: TGCCAAGCTTGCATGCCTGCAGGTCGACGATCTTATACTGGGTA GATTTCAAACGGGAC with a Kluyveromyces lactis genomic DNA as template, and the product was named KlADH1-H47RH124K-F4.
[0343] 1 .mu.L of each of the amplified products KlADH1-H47RH124K-F1, KlADH1-H47RH124K-F2, KlADH1-H47RH124K-F3, KlADH1-H47RH124K-F4 and pKMD1-T were mixed, and added with 5 .mu.L of Cloning Mix. After mixing, the mixture was bathed in 50.degree. C. water for 1 hour. After the water bath, the mixture was placed on ice for 2 minutes. 10 .mu.L of the reaction mixture was all added into 50 .mu.L of Trans-T1 competent cells. The mixture was placed on ice for 30 minutes, heat-shocked at 42.degree. C. for 30 seconds, followed by the addition of 1 mL of LB liquid medium, and then cultured with shaking at 37.degree. C. for 1 hour. Thereafter, the mixture was coated onto an Amp-resistant LB solid medium, and then an inverted culture was carried out at 37.degree. C. until monoclonal colonies grew out. Six monoclonal colonies were picked out and then cultured with shaking in an LB liquid medium. After being detected PCR-positive and confirmed by sequencing, the plasmid was extracted and stored, and named pKMD1-KlADH1-H47RH124K.
[0344] 6.3 Electrotransformation of K. lactis (the Same as Example 2.3)
[0345] 6.4 Positive Identification
[0346] 12 to 24 monoclonal colonies were picked out from a plate with transformed cells. Samples were detected by PCR using identification primers of ADH1-m-CF: TGGGAGAGAATGTTAAAGGT and ADH1-m-CR: TGACGGTCGTTAACTAAGAT with the cells as template. Strains that were tested positive by PCR and identified by sequencing were determined as positive strains and named ADH1 H47KH124K, ADH1 H47NH124K, ADH1 H47QH124K and ADH1 H47RH124K, respectively.
Example 7 Analysis of Binding Ability of Endogenous Protein of KlADH1-Engineered Cell Strains to Ni Medium
[0347] 7.1 Reagent Preparation for Protein Purification System
[0348] Binding buffer: 0.5 M NaCl, 20 mM Tris-HCl, 5 mM imidazole, pH 7.9.
[0349] Wash buffer: 0.5 M NaCl, 20 mM Tris-HCl, 60 mM imidazole, pH 7.9.
[0350] 7.2 Purification of Endogenous Protein in KlADH1-Engineered Cell Strains and Analysis of their Binding Ability to Ni Medium
[0351] Ni-NTA beads were balanced by binding buffer; an appropriate amount of cell lysate of KlADH1-engineered cell strains was added and incubated at 4.degree. C. for 60 minutes; the beads were washed with wash buffer; after removal of the wash buffer, a little amount of loading buffer was added and a treatment at 96.degree. C. for 5 minutes was carried out. The above samples were analyzed by polyacrylamide gel electrophoresis.
Example 8 In Vitro Protein Synthesis System
[0352] 8.1 Preparation of Storage Solution for the In-Vitro Protein Synthesis System
[0353] Final concentration: 22 mM 4-hydroxyethyl piperazine ethanesulfonic acid (pH of 7.4), 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM of a mixture of nucleoside triphosphates (adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP) and uridine triphosphate (UTP)), 0.08-0.24 mM of a mixture of amino acids (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine), 25 mM phosphocreatine, 1.7 mM dithiothreitol, 0.27 mg/ml creatine phosphokinase, 0.027-0.054 mg/mL T7 RNA polymerase, 1%-4% PEG, 0.5%-2% sucrose, and finally added 50% by volume of the cell extract.
[0354] 8.2 In Vitro Protein Synthesis Reaction
[0355] The above-mentioned reaction system was placed in an environment of 20-30.degree. C., and let the mixture stand for a reaction for 2 to 12 hours.
[0356] Assay of the activity of enhanced green fluorescent protein (eGFP): after several hours of reaction, 10 .mu.L of the reaction solution was added into a 96-well white plate or a 384-well white plate; thereafter the mixture was immediately placed in an Envision 2120 multifunctional microplate reader (Perkin Elmer), and the absorbance was read to detect the activity of enhanced green fluorescent protein, where the unit of activity is relative fluorescence unit (RFU) value, as shown in FIG. 24.
Example 9 In Vitro Protein Synthesis and Purification
[0357] 9.1 In Vitro Protein Synthesis
[0358] In view of the results that, compared with the wild-type cell strain, the .DELTA.ADH1 cell strain has significantly reduced transcription and translation activity of cell-free system, while the ADH1 H47K cell strain had no obvious change, accordingly, ADH1 H47K became the material for our in vitro protein synthesis study. The cell-free transcription and translation system of the ADH1 H47K cell strain was added with templates of N-His8-eGFP and N-His8-Strep-GFP. The above-mentioned reaction system was placed in an environment of 20-30.degree. C., and let the mixture stand for a reaction of 2 to 12 hours.
[0359] 9.2 In Vitro Protein Purification
[0360] Ni-NTA beads were balanced by binding buffer; an appropriate amount of the above-mentioned reaction system was added and incubated at 4.degree. C. for 60 minutes; the beads were washed with wash buffer; after removal of the wash buffer, a little amount of loading buffer was added and a treatment at 96.degree. C. for 5 minutes was carried out. The above samples were analyzed by polyacrylamide gel electrophoresis. The results are shown in FIG. 25.
[0361] The results of the examples of the present invention indicate that:
[0362] The results of Example 7 of the present invention showed that, compared with the wild-type cell strain, the affinity to Ni medium generated by the engineered cell strains of the present invention were all significantly reduced.
[0363] Among them, cell strains such as .DELTA.ADH1, ADH1 H47K, ADH1 H47N, ADH1 H51R, ADH1 H124K, ADH1 H47KH124K and ADH1 H47NH124K had the lowest affinity with Ni medium.
[0364] .DELTA.ADH1, ADH1 H47K, ADH1 H47N, ADH1 H51R, ADH1 H124K, ADH1 H47KH124K and ADH1 H47NH124K had similar affinity to Ni medium, and the present invention selected .DELTA.ADH1 and ADH1 H47K to analyze the transcription and translation activity of cell-free system.
[0365] The results were shown in FIG. 24. The relative fluorescence unit (RFU) value of transcription and translation activity of the wild-type cell-free system was 442, and the RFU value of .DELTA.ADH1 cell-free system was 12, which was significantly reduced than that of the wild-type cell-free system, indicating that the knockout of ADH1 gene had a great negative impact on transcription and translation activity of cell-free system. The relative fluorescence unit (RFU) value of cell-free system of ADH1 H47K was 419, which had no significant change compared with that of the wild-type cell strain.
[0366] The same method was used to analyze the cell-free system transcription and translation activity of other mutant cell strains. The results showed that the relative fluorescence unit (RFU) value of cell-free system transcription and translation activity of other mutant cell strains were 300-400 which were substantially equivalent to that of the wild-type cell strain.
[0367] In addition, the expression purity of the exogenous proteins N-His8-eGFP and N-His8-Strep-eGFP in the KlADH1 H47K cell-free transcription and translation system of the present invention was analyzed. The results was shown in FIG. 25. Compared with the wild-type cell strains (WT), the KlADH1 H47K cell strain showed a significantly weakened ADH1 protein band at 37 kD, indicating that the purity of the exogenous proteins N-His8-eGFP and N-His8-Strep-eGFP was significantly improved in the cell-free transcription and translation system of KlADH1 H47K.
[0368] The purity of other mutant cell strains was analyzed by using the same method. The results showed that the purity of the exogenous proteins N-His8-eGFP and N-His8-Strep-eGFP was also significantly improved in the cell-free transcription and translation system of other mutant cell strains compared with that of the wild-type cell strain (WT).
[0369] All the above results indicate that the site-directed mutation of ADH family proteins in the present invention can not only reduce the binding ability of ADH family proteins to Ni medium, but also do not affect the cell-free system transcription and translation activity of the strain, and can further effectively improve the expression purity of the exogenous protein in the cell-free system transcription and translation activity of the cell strain.
[0370] All documents mentioned in the present invention are cited as references in this application, just as each document is individually cited as a reference. Additionally, it should be understood that those skilled in the art can make various changes or modifications to the present invention in light of the above teachings, and the equivalents also fall into the scope as defined by the appended claims of this application.
Sequence CWU
1
1
631350PRTKluyveromyces lactis 1Met Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly
Val Ile Phe Tyr Glu1 5 10
15Asn Gly Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys
20 25 30Ala Asn Glu Leu Leu Ile Asn
Val Lys Tyr Ser Gly Val Cys His Thr 35 40
45Asp Leu His Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu
Pro 50 55 60Leu Val Gly Gly His Glu
Gly Ala Gly Val Val Val Ala Met Gly Glu65 70
75 80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala
Gly Ile Lys Trp Leu 85 90
95Asn Gly Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser
100 105 110Asn Cys Pro Glu Ala Asp
Leu Ser Gly Tyr Thr His Asp Gly Ser Phe 115 120
125Gln Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile
Pro Val 130 135 140Gly Thr Asp Leu Ala
Glu Val Ala Pro Val Leu Cys Ala Gly Val Thr145 150
155 160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu
Lys Ala Gly Asp Trp Val 165 170
175Ala Ile Ser Gly Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr
180 185 190Ala Lys Ala Met Gly
Tyr Arg Val Leu Gly Ile Asp Ala Gly Glu Glu 195
200 205Lys Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr
Phe Ile Asp Phe 210 215 220Thr Lys Ser
Lys Asn Ile Pro Glu Glu Val Ile Glu Ala Thr Lys Gly225
230 235 240Gly Ala His Gly Val Ile Asn
Val Ser Val Ser Glu Phe Ala Ile Glu 245
250 255Gln Ser Thr Asn Tyr Val Arg Ser Asn Gly Thr Val
Val Leu Val Gly 260 265 270Leu
Pro Arg Asp Ala Lys Cys Lys Ser Asp Val Phe Asn Gln Val Val 275
280 285Lys Ser Ile Ser Ile Val Gly Ser Tyr
Val Gly Asn Arg Ala Asp Thr 290 295
300Arg Glu Ala Ile Asp Phe Phe Ser Arg Gly Leu Val Lys Ala Pro Ile305
310 315 320His Val Val Gly
Leu Ser Glu Leu Pro Ser Ile Tyr Glu Lys Met Glu 325
330 335Lys Gly Ala Ile Val Gly Arg Tyr Val Val
Asp Thr Ser Lys 340 345
3502350PRTArtificial sequenceSynthetic protein {ADH mutant protein 2Met
Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1
5 10 15Asn Gly Gly Glu Leu Gln Tyr
Lys Asp Ile Pro Val Pro Lys Pro Lys 20 25
30Ala Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys
Lys Thr 35 40 45Asp Leu His Ala
Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala
Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu
85 90 95Asn Gly Ser Cys Met Ser
Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His
Asp Gly Ser Phe 115 120 125Gln Gln
Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val 130
135 140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu
Cys Ala Gly Val Thr145 150 155
160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly
Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr 180
185 190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile
Asp Ala Gly Glu Glu 195 200 205Lys
Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val
Ile Glu Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile
Glu 245 250 255Gln Ser Thr
Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp
Val Phe Asn Gln Val Val 275 280
285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser
Arg Gly Leu Val Lys Ala Pro Ile305 310
315 320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr
Glu Lys Met Glu 325 330
335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 3503350PRTArtificial
sequenceSynthetic protein {ADH mutant protein 3Met Ala Ala Ser Ile Pro
Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1 5
10 15Asn Gly Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val
Pro Lys Pro Lys 20 25 30Ala
Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys Asn Thr 35
40 45Asp Leu His Ala Trp Lys Gly Asp Trp
Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Met Gly Glu65
70 75 80Asn Val Lys Gly Trp
Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu 85
90 95Asn Gly Ser Cys Met Ser Cys Glu Tyr Cys Glu
Leu Ser Asn Glu Ser 100 105
110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His Asp Gly Ser Phe
115 120 125Gln Gln Tyr Ala Thr Ala Asp
Ala Val Gln Ala Ala Lys Ile Pro Val 130 135
140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu Cys Ala Gly Val
Thr145 150 155 160Val Tyr
Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly Ala Ala Gly
Gly Leu Gly Ser Leu Ala Val Gln Tyr 180 185
190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile Asp Ala Gly
Glu Glu 195 200 205Lys Ala Lys Leu
Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val Ile Glu
Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile Glu
245 250 255Gln Ser Thr Asn Tyr
Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp Val Phe
Asn Gln Val Val 275 280 285Lys Ser
Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser Arg Gly Leu
Val Lys Ala Pro Ile305 310 315
320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr Glu Lys Met Glu
325 330 335Lys Gly Ala Ile
Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 3504350PRTArtificial sequenceSynthetic protein {ADH
mutant protein 4Met Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe
Tyr Glu1 5 10 15Asn Gly
Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys 20
25 30Ala Asn Glu Leu Leu Ile Asn Val Lys
Tyr Ser Gly Val Cys Gln Thr 35 40
45Asp Leu His Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50
55 60Leu Val Gly Gly His Glu Gly Ala Gly
Val Val Val Ala Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys
Trp Leu 85 90 95Asn Gly
Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly
Tyr Thr His Asp Gly Ser Phe 115 120
125Gln Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val
130 135 140Gly Thr Asp Leu Ala Glu Val
Ala Pro Val Leu Cys Ala Gly Val Thr145 150
155 160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala
Gly Asp Trp Val 165 170
175Ala Ile Ser Gly Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr
180 185 190Ala Lys Ala Met Gly Tyr
Arg Val Leu Gly Ile Asp Ala Gly Glu Glu 195 200
205Lys Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile
Asp Phe 210 215 220Thr Lys Ser Lys Asn
Ile Pro Glu Glu Val Ile Glu Ala Thr Lys Gly225 230
235 240Gly Ala His Gly Val Ile Asn Val Ser Val
Ser Glu Phe Ala Ile Glu 245 250
255Gln Ser Thr Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly
260 265 270Leu Pro Arg Asp Ala
Lys Cys Lys Ser Asp Val Phe Asn Gln Val Val 275
280 285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn
Arg Ala Asp Thr 290 295 300Arg Glu Ala
Ile Asp Phe Phe Ser Arg Gly Leu Val Lys Ala Pro Ile305
310 315 320His Val Val Gly Leu Ser Glu
Leu Pro Ser Ile Tyr Glu Lys Met Glu 325
330 335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr
Ser Lys 340 345
3505350PRTArtificial sequenceSynthetic protein {ADH mutant protein 5Met
Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1
5 10 15Asn Gly Gly Glu Leu Gln Tyr
Lys Asp Ile Pro Val Pro Lys Pro Lys 20 25
30Ala Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys
Arg Thr 35 40 45Asp Leu His Ala
Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala
Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu
85 90 95Asn Gly Ser Cys Met Ser
Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His
Asp Gly Ser Phe 115 120 125Gln Gln
Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val 130
135 140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu
Cys Ala Gly Val Thr145 150 155
160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly
Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr 180
185 190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile
Asp Ala Gly Glu Glu 195 200 205Lys
Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val
Ile Glu Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile
Glu 245 250 255Gln Ser Thr
Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp
Val Phe Asn Gln Val Val 275 280
285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser
Arg Gly Leu Val Lys Ala Pro Ile305 310
315 320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr
Glu Lys Met Glu 325 330
335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 3506350PRTArtificial
sequenceSynthetic protein {ADH mutant protein 6Met Ala Ala Ser Ile Pro
Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1 5
10 15Asn Gly Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val
Pro Lys Pro Lys 20 25 30Ala
Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys His Thr 35
40 45Asp Leu Lys Ala Trp Lys Gly Asp Trp
Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Met Gly Glu65
70 75 80Asn Val Lys Gly Trp
Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu 85
90 95Asn Gly Ser Cys Met Ser Cys Glu Tyr Cys Glu
Leu Ser Asn Glu Ser 100 105
110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His Asp Gly Ser Phe
115 120 125Gln Gln Tyr Ala Thr Ala Asp
Ala Val Gln Ala Ala Lys Ile Pro Val 130 135
140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu Cys Ala Gly Val
Thr145 150 155 160Val Tyr
Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly Ala Ala Gly
Gly Leu Gly Ser Leu Ala Val Gln Tyr 180 185
190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile Asp Ala Gly
Glu Glu 195 200 205Lys Ala Lys Leu
Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val Ile Glu
Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile Glu
245 250 255Gln Ser Thr Asn Tyr
Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp Val Phe
Asn Gln Val Val 275 280 285Lys Ser
Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser Arg Gly Leu
Val Lys Ala Pro Ile305 310 315
320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr Glu Lys Met Glu
325 330 335Lys Gly Ala Ile
Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 3507350PRTArtificial sequenceSynthetic protein {ADH
mutant protein 7Met Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe
Tyr Glu1 5 10 15Asn Gly
Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys 20
25 30Ala Asn Glu Leu Leu Ile Asn Val Lys
Tyr Ser Gly Val Cys His Thr 35 40
45Asp Leu Arg Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50
55 60Leu Val Gly Gly His Glu Gly Ala Gly
Val Val Val Ala Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys
Trp Leu 85 90 95Asn Gly
Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly
Tyr Thr His Asp Gly Ser Phe 115 120
125Gln Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val
130 135 140Gly Thr Asp Leu Ala Glu Val
Ala Pro Val Leu Cys Ala Gly Val Thr145 150
155 160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala
Gly Asp Trp Val 165 170
175Ala Ile Ser Gly Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr
180 185 190Ala Lys Ala Met Gly Tyr
Arg Val Leu Gly Ile Asp Ala Gly Glu Glu 195 200
205Lys Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile
Asp Phe 210 215 220Thr Lys Ser Lys Asn
Ile Pro Glu Glu Val Ile Glu Ala Thr Lys Gly225 230
235 240Gly Ala His Gly Val Ile Asn Val Ser Val
Ser Glu Phe Ala Ile Glu 245 250
255Gln Ser Thr Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly
260 265 270Leu Pro Arg Asp Ala
Lys Cys Lys Ser Asp Val Phe Asn Gln Val Val 275
280 285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn
Arg Ala Asp Thr 290 295 300Arg Glu Ala
Ile Asp Phe Phe Ser Arg Gly Leu Val Lys Ala Pro Ile305
310 315 320His Val Val Gly Leu Ser Glu
Leu Pro Ser Ile Tyr Glu Lys Met Glu 325
330 335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr
Ser Lys 340 345
3508350PRTArtificial sequenceSynthetic protein {ADH mutant protein 8Met
Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1
5 10 15Asn Gly Gly Glu Leu Gln Tyr
Lys Asp Ile Pro Val Pro Lys Pro Lys 20 25
30Ala Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys
His Thr 35 40 45Asp Leu His Ala
Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala
Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu
85 90 95Asn Gly Ser Cys Met Ser
Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr Lys
Asp Gly Ser Phe 115 120 125Gln Gln
Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val 130
135 140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu
Cys Ala Gly Val Thr145 150 155
160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly
Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr 180
185 190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile
Asp Ala Gly Glu Glu 195 200 205Lys
Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val
Ile Glu Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile
Glu 245 250 255Gln Ser Thr
Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp
Val Phe Asn Gln Val Val 275 280
285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser
Arg Gly Leu Val Lys Ala Pro Ile305 310
315 320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr
Glu Lys Met Glu 325 330
335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 3509350PRTArtificial
sequenceSynthetic protein {ADH mutant protein 9Met Ala Ala Ser Ile Pro
Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1 5
10 15Asn Gly Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val
Pro Lys Pro Lys 20 25 30Ala
Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys His Thr 35
40 45Asp Leu His Ala Trp Lys Gly Asp Trp
Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Met Gly Glu65
70 75 80Asn Val Lys Gly Trp
Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu 85
90 95Asn Gly Ser Cys Met Ser Cys Glu Tyr Cys Glu
Leu Ser Asn Glu Ser 100 105
110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr Arg Asp Gly Ser Phe
115 120 125Gln Gln Tyr Ala Thr Ala Asp
Ala Val Gln Ala Ala Lys Ile Pro Val 130 135
140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu Cys Ala Gly Val
Thr145 150 155 160Val Tyr
Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly Ala Ala Gly
Gly Leu Gly Ser Leu Ala Val Gln Tyr 180 185
190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile Asp Ala Gly
Glu Glu 195 200 205Lys Ala Lys Leu
Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val Ile Glu
Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile Glu
245 250 255Gln Ser Thr Asn Tyr
Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp Val Phe
Asn Gln Val Val 275 280 285Lys Ser
Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser Arg Gly Leu
Val Lys Ala Pro Ile305 310 315
320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr Glu Lys Met Glu
325 330 335Lys Gly Ala Ile
Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 35010350PRTArtificial sequenceSynthetic protein {ADH
mutant protein 10Met Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe
Tyr Glu1 5 10 15Asn Gly
Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys 20
25 30Ala Asn Glu Leu Leu Ile Asn Val Lys
Tyr Ser Gly Val Cys Lys Thr 35 40
45Asp Leu His Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50
55 60Leu Val Gly Gly His Glu Gly Ala Gly
Val Val Val Ala Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys
Trp Leu 85 90 95Asn Gly
Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly
Tyr Thr Lys Asp Gly Ser Phe 115 120
125Gln Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val
130 135 140Gly Thr Asp Leu Ala Glu Val
Ala Pro Val Leu Cys Ala Gly Val Thr145 150
155 160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala
Gly Asp Trp Val 165 170
175Ala Ile Ser Gly Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr
180 185 190Ala Lys Ala Met Gly Tyr
Arg Val Leu Gly Ile Asp Ala Gly Glu Glu 195 200
205Lys Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile
Asp Phe 210 215 220Thr Lys Ser Lys Asn
Ile Pro Glu Glu Val Ile Glu Ala Thr Lys Gly225 230
235 240Gly Ala His Gly Val Ile Asn Val Ser Val
Ser Glu Phe Ala Ile Glu 245 250
255Gln Ser Thr Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly
260 265 270Leu Pro Arg Asp Ala
Lys Cys Lys Ser Asp Val Phe Asn Gln Val Val 275
280 285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn
Arg Ala Asp Thr 290 295 300Arg Glu Ala
Ile Asp Phe Phe Ser Arg Gly Leu Val Lys Ala Pro Ile305
310 315 320His Val Val Gly Leu Ser Glu
Leu Pro Ser Ile Tyr Glu Lys Met Glu 325
330 335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr
Ser Lys 340 345
35011350PRTArtificial sequenceSynthetic protein {ADH mutant protein 11Met
Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1
5 10 15Asn Gly Gly Glu Leu Gln Tyr
Lys Asp Ile Pro Val Pro Lys Pro Lys 20 25
30Ala Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys
Asn Thr 35 40 45Asp Leu His Ala
Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala
Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu
85 90 95Asn Gly Ser Cys Met Ser
Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr Lys
Asp Gly Ser Phe 115 120 125Gln Gln
Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val 130
135 140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu
Cys Ala Gly Val Thr145 150 155
160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly
Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr 180
185 190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile
Asp Ala Gly Glu Glu 195 200 205Lys
Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val
Ile Glu Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile
Glu 245 250 255Gln Ser Thr
Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp
Val Phe Asn Gln Val Val 275 280
285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser
Arg Gly Leu Val Lys Ala Pro Ile305 310
315 320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr
Glu Lys Met Glu 325 330
335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 35012350PRTArtificial
sequenceSynthetic protein {ADH mutant protein 12Met Ala Ala Ser Ile Pro
Glu Thr Gln Lys Gly Val Ile Phe Tyr Glu1 5
10 15Asn Gly Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val
Pro Lys Pro Lys 20 25 30Ala
Asn Glu Leu Leu Ile Asn Val Lys Tyr Ser Gly Val Cys Gln Thr 35
40 45Asp Leu His Ala Trp Lys Gly Asp Trp
Pro Leu Pro Thr Lys Leu Pro 50 55
60Leu Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Met Gly Glu65
70 75 80Asn Val Lys Gly Trp
Lys Ile Gly Asp Phe Ala Gly Ile Lys Trp Leu 85
90 95Asn Gly Ser Cys Met Ser Cys Glu Tyr Cys Glu
Leu Ser Asn Glu Ser 100 105
110Asn Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr Lys Asp Gly Ser Phe
115 120 125Gln Gln Tyr Ala Thr Ala Asp
Ala Val Gln Ala Ala Lys Ile Pro Val 130 135
140Gly Thr Asp Leu Ala Glu Val Ala Pro Val Leu Cys Ala Gly Val
Thr145 150 155 160Val Tyr
Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala Gly Asp Trp Val
165 170 175Ala Ile Ser Gly Ala Ala Gly
Gly Leu Gly Ser Leu Ala Val Gln Tyr 180 185
190Ala Lys Ala Met Gly Tyr Arg Val Leu Gly Ile Asp Ala Gly
Glu Glu 195 200 205Lys Ala Lys Leu
Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile Asp Phe 210
215 220Thr Lys Ser Lys Asn Ile Pro Glu Glu Val Ile Glu
Ala Thr Lys Gly225 230 235
240Gly Ala His Gly Val Ile Asn Val Ser Val Ser Glu Phe Ala Ile Glu
245 250 255Gln Ser Thr Asn Tyr
Val Arg Ser Asn Gly Thr Val Val Leu Val Gly 260
265 270Leu Pro Arg Asp Ala Lys Cys Lys Ser Asp Val Phe
Asn Gln Val Val 275 280 285Lys Ser
Ile Ser Ile Val Gly Ser Tyr Val Gly Asn Arg Ala Asp Thr 290
295 300Arg Glu Ala Ile Asp Phe Phe Ser Arg Gly Leu
Val Lys Ala Pro Ile305 310 315
320His Val Val Gly Leu Ser Glu Leu Pro Ser Ile Tyr Glu Lys Met Glu
325 330 335Lys Gly Ala Ile
Val Gly Arg Tyr Val Val Asp Thr Ser Lys 340
345 35013350PRTArtificial sequenceSynthetic protein {ADH
mutant protein 13Met Ala Ala Ser Ile Pro Glu Thr Gln Lys Gly Val Ile Phe
Tyr Glu1 5 10 15Asn Gly
Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys 20
25 30Ala Asn Glu Leu Leu Ile Asn Val Lys
Tyr Ser Gly Val Cys Arg Thr 35 40
45Asp Leu His Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys Leu Pro 50
55 60Leu Val Gly Gly His Glu Gly Ala Gly
Val Val Val Ala Met Gly Glu65 70 75
80Asn Val Lys Gly Trp Lys Ile Gly Asp Phe Ala Gly Ile Lys
Trp Leu 85 90 95Asn Gly
Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser 100
105 110Asn Cys Pro Glu Ala Asp Leu Ser Gly
Tyr Thr Lys Asp Gly Ser Phe 115 120
125Gln Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Val
130 135 140Gly Thr Asp Leu Ala Glu Val
Ala Pro Val Leu Cys Ala Gly Val Thr145 150
155 160Val Tyr Lys Ala Leu Lys Ser Ala Asn Leu Lys Ala
Gly Asp Trp Val 165 170
175Ala Ile Ser Gly Ala Ala Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr
180 185 190Ala Lys Ala Met Gly Tyr
Arg Val Leu Gly Ile Asp Ala Gly Glu Glu 195 200
205Lys Ala Lys Leu Phe Lys Asp Leu Gly Gly Glu Tyr Phe Ile
Asp Phe 210 215 220Thr Lys Ser Lys Asn
Ile Pro Glu Glu Val Ile Glu Ala Thr Lys Gly225 230
235 240Gly Ala His Gly Val Ile Asn Val Ser Val
Ser Glu Phe Ala Ile Glu 245 250
255Gln Ser Thr Asn Tyr Val Arg Ser Asn Gly Thr Val Val Leu Val Gly
260 265 270Leu Pro Arg Asp Ala
Lys Cys Lys Ser Asp Val Phe Asn Gln Val Val 275
280 285Lys Ser Ile Ser Ile Val Gly Ser Tyr Val Gly Asn
Arg Ala Asp Thr 290 295 300Arg Glu Ala
Ile Asp Phe Phe Ser Arg Gly Leu Val Lys Ala Pro Ile305
310 315 320His Val Val Gly Leu Ser Glu
Leu Pro Ser Ile Tyr Glu Lys Met Glu 325
330 335Lys Gly Ala Ile Val Gly Arg Tyr Val Val Asp Thr
Ser Lys 340 345
350141053DNAArtificial sequenceSynthetic DNA {nucleotide sequence of ADH
mutant protein 14atggccgcat ctatcccaga aactcaaaag ggtgttatct
tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc agttccaaag ccaaaggcta
acgaactttt gatcaacgtc 120aagtactccg gtgtctgtaa aactgacctt catgcttgga
agggtgactg gcctttgcca 180accaaattgc cattagttgg tggtcacgaa ggtgctggtg
tcgttgttgc tatgggagag 240aatgttaaag gttggaagat tggtgacttc gctggtatca
aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga attgtccaac gaatccaact
gtccagaagc tgacttgtcc 360ggttacactc acgacggttc tttccaacaa tacgctactg
ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga cttggctgaa gttgctccag
tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg
actgggtcgc catctctggt 540gctgctggtg gtctaggttc tctagctgtc caatacgcca
aggccatggg ttacagagtg 600ttgggtatcg atgctggtga agaaaaggct aagttgttca
aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc caagaacatc ccagaagaag
tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg
ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac
caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg
tcggttctta cgtcggtaac 900agagctgaca ccagagaagc cattgacttc ttctccagag
gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga actaccatcc atctacgaaa
agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053151053DNAArtificial sequenceSynthetic DNA
{nucleotide sequence of ADH mutant protein 15atggccgcat ctatcccaga
aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc
agttccaaag ccaaaggcta acgaactttt gatcaacgtc 120aagtactccg gtgtctgtaa
tactgacctt catgcttgga agggtgactg gcctttgcca 180accaaattgc cattagttgg
tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag 240aatgttaaag gttggaagat
tggtgacttc gctggtatca aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga
attgtccaac gaatccaact gtccagaagc tgacttgtcc 360ggttacactc acgacggttc
tttccaacaa tacgctactg ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga
cttggctgaa gttgctccag tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc
cgccaacttg aaggccggtg actgggtcgc catctctggt 540gctgctggtg gtctaggttc
tctagctgtc caatacgcca aggccatggg ttacagagtg 600ttgggtatcg atgctggtga
agaaaaggct aagttgttca aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc
caagaacatc ccagaagaag tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa
cgtctctgtc tccgaattcg ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac
cgtcgtattg gtcggtctac caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt
tgtgaagtcc atctccattg tcggttctta cgtcggtaac 900agagctgaca ccagagaagc
cattgacttc ttctccagag gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga
actaccatcc atctacgaaa agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga
cacttcaaaa taa 1053161053DNAArtificial
sequenceSynthetic DNA {nucleotide sequence of ADH mutant protein
16atggccgcat ctatcccaga aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa
60ttgcaataca aggacatccc agttccaaag ccaaaggcta acgaactttt gatcaacgtc
120aagtactccg gtgtctgtca aactgacctt catgcttgga agggtgactg gcctttgcca
180accaaattgc cattagttgg tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag
240aatgttaaag gttggaagat tggtgacttc gctggtatca aatggttgaa cggttcttgt
300atgtcctgtg aatactgtga attgtccaac gaatccaact gtccagaagc tgacttgtcc
360ggttacactc acgacggttc tttccaacaa tacgctactg ctgatgccgt tcaagctgcc
420aagatcccag tcggtactga cttggctgaa gttgctccag tgctatgtgc tggtgtcacc
480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg actgggtcgc catctctggt
540gctgctggtg gtctaggttc tctagctgtc caatacgcca aggccatggg ttacagagtg
600ttgggtatcg atgctggtga agaaaaggct aagttgttca aggacttggg tggtgaatac
660ttcattgatt tcaccaagtc caagaacatc ccagaagaag tcatcgaagc taccaagggt
720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg ctatcgaaca atctaccaac
780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac caagagacgc caagtgtaag
840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg tcggttctta cgtcggtaac
900agagctgaca ccagagaagc cattgacttc ttctccagag gtctagtcaa ggctccaatc
960cacgtcgttg gtttgtccga actaccatcc atctacgaaa agatggaaaa gggtgctatc
1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053171053DNAArtificial sequenceSynthetic DNA {nucleotide sequence of ADH
mutant protein 17atggccgcat ctatcccaga aactcaaaag ggtgttatct
tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc agttccaaag ccaaaggcta
acgaactttt gatcaacgtc 120aagtactccg gtgtctgtag aactgacctt catgcttgga
agggtgactg gcctttgcca 180accaaattgc cattagttgg tggtcacgaa ggtgctggtg
tcgttgttgc tatgggagag 240aatgttaaag gttggaagat tggtgacttc gctggtatca
aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga attgtccaac gaatccaact
gtccagaagc tgacttgtcc 360ggttacactc acgacggttc tttccaacaa tacgctactg
ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga cttggctgaa gttgctccag
tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg
actgggtcgc catctctggt 540gctgctggtg gtctaggttc tctagctgtc caatacgcca
aggccatggg ttacagagtg 600ttgggtatcg atgctggtga agaaaaggct aagttgttca
aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc caagaacatc ccagaagaag
tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg
ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac
caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg
tcggttctta cgtcggtaac 900agagctgaca ccagagaagc cattgacttc ttctccagag
gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga actaccatcc atctacgaaa
agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053181053DNAArtificial sequenceSynthetic DNA
{nucleotide sequence of ADH mutant protein 18atggccgcat ctatcccaga
aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc
agttccaaag ccaaaggcta acgaactttt gatcaacgtc 120aagtactccg gtgtctgtca
tactgacctt aaagcttgga agggtgactg gcctttgcca 180accaaattgc cattagttgg
tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag 240aatgttaaag gttggaagat
tggtgacttc gctggtatca aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga
attgtccaac gaatccaact gtccagaagc tgacttgtcc 360ggttacactc acgacggttc
tttccaacaa tacgctactg ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga
cttggctgaa gttgctccag tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc
cgccaacttg aaggccggtg actgggtcgc catctctggt 540gctgctggtg gtctaggttc
tctagctgtc caatacgcca aggccatggg ttacagagtg 600ttgggtatcg atgctggtga
agaaaaggct aagttgttca aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc
caagaacatc ccagaagaag tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa
cgtctctgtc tccgaattcg ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac
cgtcgtattg gtcggtctac caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt
tgtgaagtcc atctccattg tcggttctta cgtcggtaac 900agagctgaca ccagagaagc
cattgacttc ttctccagag gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga
actaccatcc atctacgaaa agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga
cacttcaaaa taa 1053191053DNAArtificial
sequenceSynthetic DNA {nucleotide sequence of ADH mutant protein
19atggccgcat ctatcccaga aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa
60ttgcaataca aggacatccc agttccaaag ccaaaggcta acgaactttt gatcaacgtc
120aagtactccg gtgtctgtca tactgacctt agagcttgga agggtgactg gcctttgcca
180accaaattgc cattagttgg tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag
240aatgttaaag gttggaagat tggtgacttc gctggtatca aatggttgaa cggttcttgt
300atgtcctgtg aatactgtga attgtccaac gaatccaact gtccagaagc tgacttgtcc
360ggttacactc acgacggttc tttccaacaa tacgctactg ctgatgccgt tcaagctgcc
420aagatcccag tcggtactga cttggctgaa gttgctccag tgctatgtgc tggtgtcacc
480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg actgggtcgc catctctggt
540gctgctggtg gtctaggttc tctagctgtc caatacgcca aggccatggg ttacagagtg
600ttgggtatcg atgctggtga agaaaaggct aagttgttca aggacttggg tggtgaatac
660ttcattgatt tcaccaagtc caagaacatc ccagaagaag tcatcgaagc taccaagggt
720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg ctatcgaaca atctaccaac
780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac caagagacgc caagtgtaag
840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg tcggttctta cgtcggtaac
900agagctgaca ccagagaagc cattgacttc ttctccagag gtctagtcaa ggctccaatc
960cacgtcgttg gtttgtccga actaccatcc atctacgaaa agatggaaaa gggtgctatc
1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053201053DNAArtificial sequenceSynthetic DNA {nucleotide sequence of ADH
mutant protein 20atggccgcat ctatcccaga aactcaaaag ggtgttatct
tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc agttccaaag ccaaaggcta
acgaactttt gatcaacgtc 120aagtactccg gtgtctgtca caccgatttg cacgcatgga
agggtgactg gcctttgcca 180accaaattgc cattagttgg tggtcacgaa ggtgctggtg
tcgttgttgc tatgggagag 240aatgttaaag gttggaagat tggtgacttc gctggtatca
aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga attgtccaac gaatccaact
gtccagaagc tgacttgagt 360ggatatacaa aagatggttc tttccaacaa tacgctactg
ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga cttggctgaa gttgctccag
tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg
actgggtcgc catctctggt 540gctgctggtg gtctaggttc tctagctgtc caatacgcca
aggccatggg ttacagagtg 600ttgggtatcg atgctggtga agaaaaggct aagttgttca
aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc caagaacatc ccagaagaag
tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg
ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac
caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg
tcggttctta cgtcggtaac 900agagctgaca ccagagaagc cattgacttc ttctccagag
gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga actaccatcc atctacgaaa
agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053211053DNAArtificial sequenceSynthetic DNA
{nucleotide sequence of ADH mutant protein 21atggccgcat ctatcccaga
aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc
agttccaaag ccaaaggcta acgaactttt gatcaacgtc 120aagtactccg gtgtctgtca
caccgatttg cacgcatgga agggtgactg gcctttgcca 180accaaattgc cattagttgg
tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag 240aatgttaaag gttggaagat
tggtgacttc gctggtatca aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga
attgtccaac gaatccaact gtccagaagc tgacttgagt 360ggatatacaa gagatggttc
tttccaacaa tacgctactg ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga
cttggctgaa gttgctccag tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc
cgccaacttg aaggccggtg actgggtcgc catctctggt 540gctgctggtg gtctaggttc
tctagctgtc caatacgcca aggccatggg ttacagagtg 600ttgggtatcg atgctggtga
agaaaaggct aagttgttca aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc
caagaacatc ccagaagaag tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa
cgtctctgtc tccgaattcg ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac
cgtcgtattg gtcggtctac caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt
tgtgaagtcc atctccattg tcggttctta cgtcggtaac 900agagctgaca ccagagaagc
cattgacttc ttctccagag gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga
actaccatcc atctacgaaa agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga
cacttcaaaa taa 1053221053DNAArtificial
sequenceSynthetic DNA {nucleotide sequence of ADH mutant protein
22atggccgcat ctatcccaga aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa
60ttgcaataca aggacatccc agttccaaag ccaaaggcta acgaactttt gatcaacgtc
120aagtactccg gtgtctgtaa aactgacctt catgcttgga agggtgactg gcctttgcca
180accaaattgc cattagttgg tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag
240aatgttaaag gttggaagat tggtgacttc gctggtatca aatggttgaa cggttcttgt
300atgtcctgtg aatactgtga attgtccaac gaatccaact gtccagaagc tgacttgagt
360ggatatacaa aagatggttc tttccaacaa tacgctactg ctgatgccgt tcaagctgcc
420aagatcccag tcggtactga cttggctgaa gttgctccag tgctatgtgc tggtgtcacc
480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg actgggtcgc catctctggt
540gctgctggtg gtctaggttc tctagctgtc caatacgcca aggccatggg ttacagagtg
600ttgggtatcg atgctggtga agaaaaggct aagttgttca aggacttggg tggtgaatac
660ttcattgatt tcaccaagtc caagaacatc ccagaagaag tcatcgaagc taccaagggt
720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg ctatcgaaca atctaccaac
780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac caagagacgc caagtgtaag
840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg tcggttctta cgtcggtaac
900agagctgaca ccagagaagc cattgacttc ttctccagag gtctagtcaa ggctccaatc
960cacgtcgttg gtttgtccga actaccatcc atctacgaaa agatggaaaa gggtgctatc
1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053231053DNAArtificial sequenceSynthetic DNA {nucleotide sequence of ADH
mutant protein 23atggccgcat ctatcccaga aactcaaaag ggtgttatct
tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc agttccaaag ccaaaggcta
acgaactttt gatcaacgtc 120aagtactccg gtgtctgtaa tactgacctt catgcttgga
agggtgactg gcctttgcca 180accaaattgc cattagttgg tggtcacgaa ggtgctggtg
tcgttgttgc tatgggagag 240aatgttaaag gttggaagat tggtgacttc gctggtatca
aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga attgtccaac gaatccaact
gtccagaagc tgacttgagt 360ggatatacaa aagatggttc tttccaacaa tacgctactg
ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga cttggctgaa gttgctccag
tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg
actgggtcgc catctctggt 540gctgctggtg gtctaggttc tctagctgtc caatacgcca
aggccatggg ttacagagtg 600ttgggtatcg atgctggtga agaaaaggct aagttgttca
aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc caagaacatc ccagaagaag
tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg
ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac
caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg
tcggttctta cgtcggtaac 900agagctgaca ccagagaagc cattgacttc ttctccagag
gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga actaccatcc atctacgaaa
agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga cacttcaaaa taa
1053241053DNAArtificial sequenceSynthetic DNA
{nucleotide sequence of ADH mutant protein 24atggccgcat ctatcccaga
aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc
agttccaaag ccaaaggcta acgaactttt gatcaacgtc 120aagtactccg gtgtctgtca
aactgacctt catgcttgga agggtgactg gcctttgcca 180accaaattgc cattagttgg
tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag 240aatgttaaag gttggaagat
tggtgacttc gctggtatca aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga
attgtccaac gaatccaact gtccagaagc tgacttgagt 360ggatatacaa aagatggttc
tttccaacaa tacgctactg ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga
cttggctgaa gttgctccag tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc
cgccaacttg aaggccggtg actgggtcgc catctctggt 540gctgctggtg gtctaggttc
tctagctgtc caatacgcca aggccatggg ttacagagtg 600ttgggtatcg atgctggtga
agaaaaggct aagttgttca aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc
caagaacatc ccagaagaag tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa
cgtctctgtc tccgaattcg ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac
cgtcgtattg gtcggtctac caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt
tgtgaagtcc atctccattg tcggttctta cgtcggtaac 900agagctgaca ccagagaagc
cattgacttc ttctccagag gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga
actaccatcc atctacgaaa agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga
cacttcaaaa taa 1053251053DNAArtificial
sequenceSynthetic DNA {nucleotide sequence of ADH mutant protein
25atggccgcat ctatcccaga aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa
60ttgcaataca aggacatccc agttccaaag ccaaaggcta acgaactttt gatcaacgtc
120aagtactccg gtgtctgtag aactgacctt catgcttgga agggtgactg gcctttgcca
180accaaattgc cattagttgg tggtcacgaa ggtgctggtg tcgttgttgc tatgggagag
240aatgttaaag gttggaagat tggtgacttc gctggtatca aatggttgaa cggttcttgt
300atgtcctgtg aatactgtga attgtccaac gaatccaact gtccagaagc tgacttgagt
360ggatatacaa aagatggttc tttccaacaa tacgctactg ctgatgccgt tcaagctgcc
420aagatcccag tcggtactga cttggctgaa gttgctccag tgctatgtgc tggtgtcacc
480gtttacaagg ccctaaaatc cgccaacttg aaggccggtg actgggtcgc catctctggt
540gctgctggtg gtctaggttc tctagctgtc caatacgcca aggccatggg ttacagagtg
600ttgggtatcg atgctggtga agaaaaggct aagttgttca aggacttggg tggtgaatac
660ttcattgatt tcaccaagtc caagaacatc ccagaagaag tcatcgaagc taccaagggt
720ggtgctcacg gtgtcatcaa cgtctctgtc tccgaattcg ctatcgaaca atctaccaac
780tacgtcagat ctaacggtac cgtcgtattg gtcggtctac caagagacgc caagtgtaag
840tccgatgtct ttaaccaagt tgtgaagtcc atctccattg tcggttctta cgtcggtaac
900agagctgaca ccagagaagc cattgacttc ttctccagag gtctagtcaa ggctccaatc
960cacgtcgttg gtttgtccga actaccatcc atctacgaaa agatggaaaa gggtgctatc
1020gtcggtagat acgtcgtcga cacttcaaaa taa
105326348PRTKluyveromyces lactis 26Met Ser Ile Pro Glu Thr Gln Lys Gly
Val Ile Phe Tyr Glu Asn Gly1 5 10
15Gly Glu Leu Gln Tyr Lys Asp Ile Pro Val Pro Lys Pro Lys Ala
Asn 20 25 30Glu Leu Leu Ile
Asn Val Lys Tyr Ser Gly Val Cys His Thr Asp Leu 35
40 45His Ala Trp Lys Gly Asp Trp Pro Leu Pro Thr Lys
Leu Pro Leu Val 50 55 60Gly Gly His
Glu Gly Ala Gly Val Val Val Ala Met Gly Glu Asn Val65 70
75 80Lys Gly Trp Asn Ile Gly Asp Phe
Ala Gly Ile Lys Trp Leu Asn Gly 85 90
95Ser Cys Met Ser Cys Glu Tyr Cys Glu Leu Ser Asn Glu Ser
Asn Cys 100 105 110Pro Asp Ala
Asp Leu Ser Gly Tyr Thr His Asp Gly Ser Phe Gln Gln 115
120 125Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Arg
Ile Pro Lys Gly Thr 130 135 140Asp Leu
Ala Glu Val Ala Pro Ile Leu Cys Ala Gly Val Thr Val Tyr145
150 155 160Lys Ala Leu Lys Ser Ala Asp
Leu Lys Ala Gly Asp Trp Val Ala Ile 165
170 175Ser Gly Ala Cys Gly Gly Leu Gly Ser Leu Ala Ile
Gln Tyr Ala Lys 180 185 190Ala
Met Gly Tyr Arg Val Leu Gly Ile Asp Thr Gly Ala Glu Lys Ala 195
200 205Lys Leu Phe Lys Glu Leu Gly Gly Glu
Tyr Phe Val Asp Tyr Ala Val 210 215
220Ser Lys Asp Leu Ile Lys Glu Ile Val Asp Ala Thr Asn Gly Gly Ala225
230 235 240His Gly Val Ile
Asn Val Ser Val Ser Glu Phe Ala Ile Glu Gln Ser 245
250 255Thr Asn Tyr Val Arg Ser Asn Gly Thr Val
Val Leu Val Gly Leu Pro 260 265
270Arg Asp Ala Lys Cys Lys Ser Asp Val Phe Thr Gln Val Val Lys Ser
275 280 285Val Ser Ile Val Gly Ser Tyr
Val Gly Asn Arg Ala Asp Thr Arg Glu 290 295
300Ala Leu Asp Phe Phe Ala Arg Gly Leu Val His Ala Pro Ile Lys
Ile305 310 315 320Val Gly
Leu Ser Glu Leu Ala Asp Val Tyr Asp Lys Met Val Lys Gly
325 330 335Glu Ile Val Gly Arg Tyr Val
Val Asp Thr Ser Lys 340
34527374PRTKluyveromyces lactis 27Met Leu Arg Leu Thr Ser Ala Arg Ser Ile
Val Ser Pro Leu Arg Lys1 5 10
15Gly Ala Phe Gly Ser Ile Arg Thr Leu Ala Thr Ser Val Pro Glu Thr
20 25 30Gln Lys Gly Val Ile Phe
Tyr Glu Asn Gly Gly Lys Leu Glu Tyr Lys 35 40
45Asp Ile Pro Val Pro Lys Pro Lys Pro Asn Glu Ile Leu Ile
Asn Val 50 55 60Lys Tyr Ser Gly Val
Cys His Thr Asp Leu His Ala Trp Lys Gly Asp65 70
75 80Trp Pro Leu Pro Thr Lys Leu Pro Leu Val
Gly Gly His Glu Gly Ala 85 90
95Gly Val Val Val Ala Met Gly Glu Asn Val Lys Gly Trp Asn Ile Gly
100 105 110Asp Phe Ala Gly Ile
Lys Trp Leu Asn Gly Ser Cys Met Ser Cys Glu 115
120 125Tyr Cys Glu Leu Ser Asn Glu Ser Asn Cys Pro Asp
Ala Asp Leu Ser 130 135 140Gly Tyr Thr
His Asp Gly Ser Phe Gln Gln Tyr Ala Thr Ala Asp Ala145
150 155 160Val Gln Ala Ala Arg Ile Pro
Lys Gly Thr Asp Leu Ala Glu Val Ala 165
170 175Pro Ile Leu Cys Ala Gly Val Thr Val Tyr Lys Ala
Leu Lys Ser Ala 180 185 190Asn
Leu Lys Ala Gly Asp Trp Val Ala Ile Ser Gly Ala Ala Gly Gly 195
200 205Leu Gly Ser Leu Ala Val Gln Tyr Ala
Lys Ala Met Gly Tyr Arg Val 210 215
220Val Gly Ile Asp Gly Gly Glu Glu Lys Gly Lys Leu Val Lys Gln Leu225
230 235 240Gly Gly Glu Ala
Phe Val Asp Phe Thr Lys Thr Lys Asp Met Val Ala 245
250 255Glu Ile Gln Glu Ile Thr Asn Gly Gly Pro
His Gly Val Ile Asn Val 260 265
270Ser Val Ser Glu Ala Ala Met Asn Ala Ser Thr Gln Phe Val Arg Pro
275 280 285Thr Gly Thr Val Val Leu Val
Gly Leu Pro Ala Gly Ala Val Ile Lys 290 295
300Ser Glu Val Phe Ser His Val Val Lys Ser Ile Asn Ile Lys Gly
Ser305 310 315 320Tyr Val
Gly Asn Arg Ala Asp Thr Arg Glu Ala Ile Asn Phe Phe Ala
325 330 335Asn Gly His Val His Ser Pro
Ile Lys Val Val Gly Leu Ser Glu Leu 340 345
350Pro Lys Val Tyr Glu Leu Met Glu Gln Gly Lys Ile Leu Gly
Arg Tyr 355 360 365Val Val Asp Thr
Ser Asn 37028375PRTKluyveromyces lactis 28Met Phe Arg Leu Ala Arg Ala
Gln Thr Ala Leu Ala Asn Lys Ala Ser1 5 10
15Val Ser Arg Ser Phe Leu Arg Leu Asn Ser Ser Phe Ala
Ile Pro Glu 20 25 30Thr Gln
Lys Gly Val Ile Phe Tyr Glu Asn Gly Gly Lys Leu Glu Tyr 35
40 45Lys Asp Leu Pro Val Pro Lys Pro Lys Ala
Asn Glu Ile Leu Ile Asn 50 55 60Val
Lys Tyr Ser Gly Val Cys His Thr Asp Leu His Ala Trp Lys Gly65
70 75 80Asp Trp Pro Leu Pro Val
Lys Leu Pro Leu Val Gly Gly His Glu Gly 85
90 95Ala Gly Ile Val Val Ala Lys Gly Glu Asn Val Lys
Asn Phe Glu Ile 100 105 110Gly
Asp Tyr Ala Gly Ile Lys Trp Leu Asn Gly Ser Cys Met Ser Cys 115
120 125Glu Leu Cys Glu Gln Gly Tyr Glu Ser
Asn Cys Leu Gln Ala Asp Leu 130 135
140Ser Gly Tyr Thr His Asp Gly Ser Phe Gln Gln Tyr Ala Thr Ala Asp145
150 155 160Ala Val Gln Ala
Ala Gln Ile Pro Lys Gly Thr Asp Leu Ala Glu Ile 165
170 175Ala Pro Ile Leu Cys Ala Gly Val Thr Val
Tyr Lys Ala Leu Lys Thr 180 185
190Ala Asp Leu Lys Pro Gly Gln Trp Val Ala Ile Ser Gly Ala Ala Gly
195 200 205Gly Leu Gly Ser Leu Ala Val
Gln Tyr Ala Lys Ala Met Gly Leu Arg 210 215
220Val Leu Gly Ile Asp Gly Gly Asp Gly Lys Glu Glu Leu Phe Lys
Gln225 230 235 240Cys Gly
Gly Glu Val Phe Ile Asp Phe Arg Lys Ser Lys Asp Met Val
245 250 255Ala Asp Ile Gln Glu Ala Thr
Asn Gly Gly Pro His Gly Val Ile Asn 260 265
270Val Ser Val Ser Glu Ala Ala Ile Ser Met Ser Thr Glu Tyr
Val Arg 275 280 285Pro Thr Gly Val
Val Val Leu Val Gly Leu Pro Ala Asp Ala Tyr Val 290
295 300Lys Ser Glu Val Phe Ser His Val Val Lys Ser Ile
Ser Ile Lys Gly305 310 315
320Ser Tyr Val Gly Asn Arg Ala Asp Thr Arg Glu Ala Thr Asp Phe Phe
325 330 335Thr Arg Gly Leu Val
Lys Ser Pro Ile Lys Ile Ile Gly Leu Ser Glu 340
345 350Leu Pro Glu Ala Tyr Glu Leu Met Glu Gln Gly Lys
Ile Leu Gly Arg 355 360 365Phe Val
Val Asp Thr Tyr Lys 370 375291047DNAKluyveromyces
lactis 29atgtccattc ctgaaactca aaagggtgtt atcttttacg aaaacggtgg
tgaattgcaa 60tacaaggaca ttccagttcc aaagccaaag gccaacgaac ttttgatcaa
cgtcaagtac 120tccggtgtct gtcacaccga tttgcacgca tggaagggtg actggccttt
gccaaccaaa 180ttgccattag ttggtggtca cgaaggtgct ggtgtcgttg ttgctatggg
tgaaaatgtc 240aagggctgga acattggtga ctttgctggt atcaaatggt tgaacggttc
ttgtatgtcc 300tgtgaatact gtgaattgtc caatgaatcc aactgtcccg atgctgactt
gtctggttac 360acccacgatg gttctttcca acaatatgct accgctgatg ccgttcaagc
tgctagaatt 420ccaaagggta ccgatttggc tgaagttgct ccaattctat gtgccggtgt
taccgtttac 480aaggctctaa aatctgctga cttgaaggcc ggtgactggg ttgccatttc
cggtgcctgt 540ggtggtctag gttctttggc tatccaatac gccaaggcta tgggttacag
agtcttgggt 600attgataccg gtgctgaaaa ggctaagttg ttcaaggagc taggtggtga
atacttcgtc 660gattatgccg tctctaagga tttgattaaa gaaattgttg acgctactaa
cggtggtgcc 720cacggtgtca ttaacgtctc tgtctccgaa tttgctatag aacaatccac
caattacgtt 780agatcaaacg gtaccgttgt attggtcggt ctaccaaggg acgccaaatg
taagtctgat 840gtctttacac aagttgtcaa atcggtctcc attgttggtt cttacgtcgg
taacagagct 900gacaccagag aagctctaga tttcttcgca agaggtttag tgcatgctcc
aattaagata 960gtcggattat ctgaattggc agatgtttat gacaagatgg tcaagggtga
aatcgttggt 1020agatacgttg tcgacacctc aaaataa
1047301125DNAKluyveromyces lactis 30atgttgagat tgacttccgc
cagatccatt gtttccccat tgcgtaaggg tgcttttggt 60tccatcagaa ccttagctac
ctctgtgcca gaaacccaaa agggtgttat tttctatgag 120aatggtggta aattggaata
caaggacatt ccagttccaa agccaaagcc aaatgaaatc 180ttgatcaacg tcaagtactc
cggtgtgtgt cataccgatt tgcacgcatg gaagggtgac 240tggccattgc caaccaagtt
gccattggtc ggtggtcacg aaggtgctgg tgtcgttgtt 300gctatgggtg aaaacgtcaa
gggctggaac attggtgact ttgcgggtat caaatggttg 360aacggttctt gtatgtcctg
tgaatactgt gaattgtcca atgaatccaa ctgtccagat 420gctgacttgt ctggttacac
ccacgatggt tctttccaac aatacgctac cgcagatgct 480gttcaagctg ccagaattcc
aaagggtacc gatttggctg aagttgctcc aattctatgt 540gccggtgtta ctgtttacaa
ggctttgaaa agtgctaact tgaaggctgg tgactgggtt 600gccatctctg gtgctgctgg
tggtctaggt tctctagctg tccaatacgc caaggccatg 660ggttacagag tcgttggtat
cgacggtggt gaagaaaagg gtaagttggt caagcaattg 720ggtggtgaag cctttgttga
tttcaccaaa accaaggaca tggttgctga aatccaagaa 780atcaccaacg gtggtccaca
cggtgtcatt aacgtctctg tttctgaagc tgccatgaac 840gcttccactc aattcgtcag
accaactggt actgtcgtat tggtcggttt gccagctggt 900gccgtcatca agtccgaagt
cttctcccac gtcgttaagt ctattaacat caagggttct 960tacgtcggta acagagctga
caccagagaa gctatcaact tcttcgctaa cggtcacgtc 1020cactctccaa tcaaggttgt
tggtttgtcc gaactaccaa aggtttacga attgatggaa 1080caaggtaaga ttttgggtag
atacgttgtt gacacctcca actag 1125311128DNAKluyveromyces
lactis 31atgttcagat tagcccgtgc ccaaactgct ctagcgaaca aagcttctgt
ttccagaagc 60tttttgagat taaactcttc tttcgctatc ccagaaactc aaaagggtgt
tatcttctac 120gaaaatggtg gtaagttgga atacaaggat ttgccagttc caaagccaaa
ggctaacgaa 180attttgatta acgttaagta ctccggtgtt tgtcacaccg atttgcacgc
ctggaagggt 240gactggccat tgccagttaa attgccatta gtcggtggtc acgaaggtgc
tggtatcgtt 300gttgccaagg gtgaaaacgt taagaacttc gaaattggtg attacgctgg
tatcaagtgg 360ttgaacggtt cttgtatgtc ttgtgaattg tgtgaacaag gttacgaatc
taactgtttg 420caagctgact tgtctggtta cacccatgac ggttctttcc aacaatacgc
taccgctgat 480gccgttcaag ctgctcaaat tccaaagggt accgatttgg ctgaaatcgc
cccaatcttg 540tgtgccggtg ttaccgttta caaggctttg aagaccgctg acttgaaacc
aggccaatgg 600gttgctatct ccggtgctgc cggtggttta ggttcccttg ctgtgcaata
cgccaaggcc 660atgggtttga gagtcctagg tattgacggt ggtgatggta aggaagaatt
gttcaagcaa 720tgtggtggtg aagtcttcat cgacttcaga aagtctaagg acatggtcgc
cgatatccaa 780gaagctacca acggtggtcc tcacggtgtc attaacgtct ccgtctccga
ggctgctatc 840tccatgtcta ccgaatacgt tagaccaacc ggtgttgttg tcttggtcgg
tttgccagct 900gacgcttacg tcaagtccga agtcttctcc cacgtcgtta agtccatctc
catcaagggt 960tcttacgtcg gtaacagagc tgacaccaga gaagccaccg acttcttcac
cagaggtttg 1020gtcaagtctc caatcaagat catcggtcta tctgaattgc cagaagctta
tgaactaatg 1080gaacaaggta agatcttggg tagattcgtc gttgacactt acaaataa
1128321053DNAKluyveromyces lactis 32atggccgcat ctatcccaga
aactcaaaag ggtgttatct tctacgaaaa cggtggtgaa 60ttgcaataca aggacatccc
agttccaaag ccaaaggcta acgaactttt gatcaacgtc 120aagtactccg gtgtctgtca
caccgatttg cacgcatgga agggtgactg gcctttgcca 180accaaattgc cattagttgg
tggtcacgaa ggtgctggtg tcgttgttgc tatgggtgaa 240aacgtcaagg gctggaagat
tggtgacttc gctggtatca aatggttgaa cggttcttgt 300atgtcctgtg aatactgtga
attgtccaac gaatccaact gtccagaagc tgacttgtcc 360ggttacactc acgacggttc
tttccaacaa tacgctactg ctgatgccgt tcaagctgcc 420aagatcccag tcggtactga
cttggctgaa gttgctccag tgctatgtgc tggtgtcacc 480gtttacaagg ccctaaaatc
cgccaacttg aaggccggtg actgggtcgc catctctggt 540gctgctggtg gtctaggttc
tctagctgtc caatacgcca aggccatggg ttacagagtg 600ttgggtatcg atgctggtga
agaaaaggct aagttgttca aggacttggg tggtgaatac 660ttcattgatt tcaccaagtc
caagaacatc ccagaagaag tcatcgaagc taccaagggt 720ggtgctcacg gtgtcatcaa
cgtctctgtc tccgaattcg ctatcgaaca atctaccaac 780tacgtcagat ctaacggtac
cgtcgtattg gtcggtctac caagagacgc caagtgtaag 840tccgatgtct ttaaccaagt
tgtgaagtcc atctccattg tcggttctta cgtcggtaac 900agagctgaca ccagagaagc
cattgacttc ttctccagag gtctagtcaa ggctccaatc 960cacgtcgttg gtttgtccga
actaccatcc atctacgaaa agatggaaaa gggtgctatc 1020gtcggtagat acgtcgtcga
cacttcaaaa taa 10533320DNAArtificial
sequenceSynthetic DNA {KlADH1 gRNA1 sequence 33tgggtgaaaa cgtcaagggc
203440DNAArtificial
sequenceSynthetic DNA {pKMCas9-KlADH1-gRNA1-PF forward primer
34tgggtgaaaa cgtcaagggc gttttagagc tagaaatagc
403540DNAArtificial sequenceSynthetic DNA {pCas9-KlADH1-gRNA1-PR reverse
primer 35gcccttgacg ttttcaccca aaagtcccat tcgccacccg
403620DNAArtificial sequenceSynthetic DNA {pKMD1-PF forward
primer 36atcgtcgacc tgcaggcatg
203720DNAArtificial sequenceSynthetic DNA {pKMD1-PR reverse primer
37atctctagag gatccccggg
203859DNAArtificial sequenceSynthetic DNA {KlADH1-HR1-PF forward primer
38tcgagctcgg tacccgggga tcctctagag atcatggaca atacgttacc gagatgagg
593953DNAArtificial sequenceSynthetic DNA {KlADH1-HR1-PR reverse primer
39gaagagattt catttatctt tttttagtat agagtttgtg tgtttaaagc ttg
534055DNAArtificial sequenceSynthetic DNA {KlADH1-HR2-PF forward primer
40caaactctat actaaaaaaa gataaatgaa atctcttccg cattcaagtc atgac
554159DNAArtificial sequenceSynthetic DNA {KlADH1-HR2-PR reverse primer
41tgccaagctt gcatgcctgc aggtcgacga tcttatactg ggtagatttc aaacgggac
594220DNAArtificial sequenceSynthetic DNA {ADH1-CF forward primer
42gtgatggaac acgggaatag
204320DNAArtificial sequenceSynthetic DNA {ADH1-CR reverse primer
43cacatatacc ttggcagtag
204440DNAArtificial sequenceSynthetic DNA {KlADH1-H47K-PR reverse primer
44agcatgaagg tcagttttac agacaccgga gtacttgacg
404541DNAArtificial sequenceSynthetic DNA {KlADH1-H47K-PF forward primer
45gtaaaactga ccttcatgct tggaagggtg actggccttt g
414641DNAArtificial sequenceSynthetic DNA {KlADH1-gRNA1-m-PR reverse
primer 46ccaaccttta acattctctc ccatagcaac aacgacacca g
414742DNAArtificial sequenceSynthetic DNA {KlADH1-gRNA1-m-PF forward
primer 47gggagagaat gttaaaggtt ggaagattgg tgacttcgct gg
424840DNAArtificial sequenceSynthetic DNA {KlADH1-H47N-PR
reverse primer 48agcatgaagg tcagtattac agacaccgga gtacttgacg
404941DNAArtificial sequenceSynthetic DNA {KlADH1-H47N-PF
forward primer 49gtaatactga ccttcatgct tggaagggtg actggccttt g
415040DNAArtificial sequenceSynthetic DNA {KlADH1-H47Q-PR
reverse primer 50agcatgaagg tcagtttgac agacaccgga gtacttgacg
405141DNAArtificial sequenceSynthetic DNA {KlADH1-H47Q-PF
forward primer 51gtcaaactga ccttcatgct tggaagggtg actggccttt g
415240DNAArtificial sequenceSynthetic DNA {KlADH1-H47R-PR
reverse primer 52agcatgaagg tcagttctac agacaccgga gtacttgacg
405341DNAArtificial sequenceSynthetic DNA {KlADH1-H47R-PF
forward primer 53gtagaactga ccttcatgct tggaagggtg actggccttt g
415420DNAArtificial sequenceSynthetic DNA {ADH1-m-CF forward
primer 54tgggagagaa tgttaaaggt
205520DNAArtificial sequenceSynthetic DNA {ADH1-m-CR reverse primer
55tgacggtcgt taactaagat
205643DNAArtificial sequenceSynthetic DNA {KlADH1-H51K-PR reverse primer
56ccaagcttta aggtcagtat gacagacacc ggagtacttg acg
435741DNAArtificial sequenceSynthetic DNA {KlADH1-H51K-PF forward primer
57gtcatactga ccttaaagct tggaagggtg actggccttt g
415843DNAArtificial sequenceSynthetic DNA {KlADH1-H51R-PR reverse primer
58ccaagctcta aggtcagtat gacagacacc ggagtacttg acg
435941DNAArtificial sequenceSynthetic DNA {KlADH1-H51R-PF forward primer
59gtcatactga ccttagagct tggaagggtg actggccttt g
416043DNAArtificial sequenceSynthetic DNA {KlADH1-H124K-PR reverse primer
60ccatcttttg tatatccact caagtcagct tctggacagt tgg
436148DNAArtificial sequenceSynthetic DNA {KlADH1-H124K-PF forward primer
61cttgagtgga tatacaaaag atggttcttt ccaacaatac gctactgc
486243DNAArtificial sequenceSynthetic DNA {KlADH1-H124R-PR reverse primer
62ccatctcttg tatatccact caagtcagct tctggacagt tgg
436348DNAArtificial sequenceSynthetic DNA {KlADH1-H124R-PF forward primer
63cttgagtgga tatacaagag atggttcttt ccaacaatac gctactgc
48
User Contributions:
Comment about this patent or add new information about this topic: