Patent application title: HUMAN KYNURENINASE ENZYME VARIANTS HAVING IMPROVED PHARMACOLOGICAL PROPERTIES
Inventors:
IPC8 Class: AC12N914FI
USPC Class:
1 1
Class name:
Publication date: 2021-07-08
Patent application number: 20210207110
Abstract:
Methods and compositions related to the use of a protein with
kynureninase activity are described. For example, in certain aspects
there may be disclosed a modified kynureninase capable of degrading
kynurenine. Furthermore, certain aspects of the invention provide
compositions and methods for the treatment of cancer with kynurenine
depletion using the disclosed proteins or nucleic acids.Claims:
1. An isolated, modified human kynureninase enzyme, said modified enzyme
having at least one of the following substitutions relative to native
human kynureninase (see SEQ ID NO: 1), said substitutions including i)
A436T and ii) 5408N or F306L, and wherein the modified enzyme comprises a
mutation set selected from the group consisting of the following mutation
sets: (a) A99I, G112A, F306Y, I331N, 1405L, 5408N and A436T; (b) A99I,
G112A, K191E, F306Y, A381S, I405L, 5408N and A436T; (c) Q14R, A99I,
G112A, M189I, H230Y, F306Y, I331N, 1405L, 5408N and A436T; (d) T1385,
H224N, F225Y, F306W, N333T, 5408N and A436T; (e) N67D, L72N, E103Q,
F225Y, I331V, S408N and A436T; (f) N67D, A1365, T1385, F225Y, 5408N and
A436T; and (g) A99S, A136G, L137T, F306L and A436T.
2. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set A99I, G112A, F306Y, I331N, I405L, 5408N and A436T.
3. The modified enzyme of claim 2, further defined as comprising SEQ ID NO:2.
4. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set A99I, G112A, K191E, F306Y, A381S, I405L, 5408N and A436T.
5. The modified enzyme of claim 4, further defined as comprising SEQ ID NO:3.
6. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set Q14R, A99I, G112A, M189I, H230Y, F306Y, I331N, I405L, 5408N and A436T.
7. The modified enzyme of claim 6, further defined as comprising SEQ ID NO:4.
8. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set T1385, H224N, F225Y, F306W, N333T, S408N and A436T.
9. The modified enzyme of claim 8, further defined as comprising SEQ ID NO:5.
10. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set N67D, L72N, E103Q, F225Y, I331V, 5408N and A436T.
11. The modified enzyme of claim 10, further defined as comprising SEQ ID NO:6.
12. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set N67D, A1365, T1385, F225Y, S408N and A436T.
13. The modified enzyme of claim 12, further defined as comprising SEQ ID NO:7.
14. The modified enzyme of claim 1, where the modified enzyme comprises at least the mutation set A99S, A136G, L137T, F306L and A436T.
15. The modified enzyme of claim 14, further defined as comprising SEQ ID NO:8.
16. The enzyme of any one of claims 1-15, further comprising a heterologous peptide segment.
17. The enzyme of any one of claims 1-16, wherein the enzyme is coupled to polyethylene glycol (PEG).
18. The enzyme of claim 17, wherein the enzyme is coupled to PEG via one or more Lys or Cys residues.
19. A nucleic acid comprising a nucleotide sequence encoding the enzyme of any one of claims 1-16.
20. The nucleic acid of claim 19, wherein the nucleic acid is codon optimized for expression in bacteria, fungus, insects, or mammals.
21. An expression vector comprising the nucleic acid of claim 19 or 20.
22. A host cell comprising the nucleic acid of claim 21.
23. The host cell of claim 22, wherein the host cell is a bacterial cell, a fungal cell, an insect cell, or a mammalian cell.
24. A pharmaceutical formulation comprising an enzyme in accordance with any one of claims 1-18 in a pharmaceutically acceptable carrier.
25. A method of treating a subject having a tumor comprising administering to the subject an effective amount of the formulation of claim 24.
26. A composition comprising an effective amount of the formulation of claim 24, for use in the treatment a subject having a tumor.
27. The method of claim 25 or composition of claim 26, wherein the subject has been identified as having an IDO1, IDO2, or TDO expressing tumor.
28. The method of claim 25 or composition of claim 26, wherein the tumor is a solid tumor.
29. The method of claim 25 or composition of claim 26, wherein the tumor is a hematological tumor.
30. The method of claim 25 or composition of claim 26, wherein the subject is a human patient.
31. The method of claim 25 or composition of claim 26, wherein the formulation is administered intratumorally, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.
32. The method of claim 25, further comprising at least a second anticancer compound.
33. The method of claim 32, wherein the second anticancer compound comprises an anti-PD1, anti-CTLA-4, or anti-PD-L1 antibody.
34. A transgenic T cell comprising an expressed chimeric antigen T-cell receptor (CAR) and an expressed kynureninase enzyme according to claim 1.
35. The cell of claim 34, wherein the cell is a human T cell.
36. The cell of claim 34, wherein DNA encoding the CAR and the kynureninase is integrated into the genome of the cell.
37. The cell of claim 34, wherein the CAR is targeted to a cancer-cell antigen.
38. The cell of claim 37, wherein the cancer-cell antigen is HER2, CD19, CD20, or GD2.
39. A method of providing a T-cell response in a human subject having a tumor comprising administering an effective amount of transgenic cells in accordance with claim 34 to the subject.
40. A composition comprising an effective amount of transgenic cells in accordance with claim 34, for use in the treatment a subject having a tumor.
41. The composition of claim 40, wherein the transgenic cells are autologous.
42. The composition of claim 40, wherein the transgenic cells are heterologous.
43. Use of a kynureninase enzyme in accordance with any one of claims 1-18 or a nucleic acid in accordance with any one of claims 19-21, in the manufacture of a medicament for the treatment of a tumor.
Description:
[0001] This application claims the benefit of U.S. Provisional Patent
Application No. 62/302,306, filed Mar. 2, 2016, the entirety of which is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
1. Field of the Invention
[0003] The invention generally relates to compositions and methods for the treatment of cancer with enzymes that deplete L-kynurenine or L-3-hydroxykynurenine. More particularly, it concerns the engineering, pharmacological optimization and use of bacterial and human enzymes with L-kynurenine degrading activity suitable for human therapy.
2. Description of Related Art
[0004] Overexpression of indolamine-2,3-dioxygenase isoforms (IDO1 or IDO2) by cancer cells or reprogramming of cancer infiltrating leukocytes to express either of these enzymes has been shown to have a profound effect on attenuating adaptive immune responses to cancer. IDO1 and IDO2 as well as the enzyme tryptophan 2,3-dioxygenase (TDO), whose expression by stromal cells may be induced by some tumors, catalyze the rate limiting step in tryptophan (Trp) catabolism to L-kynurenine (KYN). Tumors exchange a cytosolic KYN molecule for an extracellular Trp molecule using a LAT1-like amino acid exchanger (Kaper et al., 2007), which has the dual effect on immune cells of locally elevating levels of KYN while locally depleting Trp levels. Neighboring immune cells internalize KYN, where it is an activating ligand for the aryl hydrocarbon receptor (AHR) resulting in the expression of numerous cytokines and chemokines that lead to tumor tolerance through immune cell differentiation and/or induction of apoptosis (Della Chiesa et al., 2006; Opitz et al., 2011; Song et al., 2011). Additionally, other KYN-related compounds formed from kynurenine, most notably kynurenic acid also exert an immunosuppressive effect by serving as agonists of the orphan GPCR GPCR35. Inhibition of KYN formation and, thus, inhibition of the formation of KYN metabolism byproducts, including kynurenic acid, 3-hydroxyl kynurenine and quinolinic acid, via the inhibition of IDO1 or TDO has received a significant amount of attention as a cancer target (Chen and Guillemin, 2009; Rutella et al., 2009; Prendergast, 2011). Substrate analog inhibitors, such as 1-DL-methyltryptophan, for IDO1 have been developed and have shown initial promise in overcoming cancer induced tumor tolerance thus restoring the ability of the native immune system to fight tumors (Lob et al., 2009). However, KYN is also produced by tryptophan 2,3-dioxygenase (TDO), which is also frequently expressed in tumors and this enzyme is not inhibited by 1-DL-methyltryptophan (Pilotte et al., 2012).
[0005] Controlling tumor production of KYN is the focus of much research and has the potential to treat, among others, cancers such as breast cancer, ovarian, glioblastoma, and pancreatic carcinoma. KYN is known to suppress proliferation as well as induce apoptosis in T cells and NK cells (Opitz et al., 2011; Mandi and Vacsei, 2012) enabling tumors to evade detection and destruction by a patient's immune system. KYN is a potent ligand of the aryl hydrocarbon receptor (AHR) whose activation in T cells induces differentiation into CD25.sup.+FoxP3.sup.+ T regulatory cells (Tregs) (Mezrich et al., 2010). KYN has also been shown to prevent cytokine mediated up-regulation of specific receptors (NKp46 and NKG2D) required for NK mediated cell killing tumor cell lines (Della Chiesa et al., 2006), an action that is also likely mediated by its agonistic effect on AHR (Shin et al., 2013). There is also clinical evidence linking elevated serum KYN levels and decreased survival in multiple types of cancer. In healthy patients, KYN levels in serum are in the range of 0.5 to 1 .mu.M. In patients with cancer types that produce KYN, such as diffuse large B-cell lymphoma, serum KYN levels were measured to be as much as 10 times higher (Yoshikawa et al., 2010; de Jong et al., 2011; Yao et al., 2011) and were prognostic for survival among lymphoma patients receiving the same treatment regimen; those with serum levels below 1.5 .mu.M exhibited a 3 year survival rate of 89%, compared to only 58% survival for those with KYN levels above 1.5 .mu.M. This difference in survival was attributed to the immune suppressing effects of KYN (Yoshikawa et al., 2010).
[0006] The present invention discloses the use of enzymes for the specific depletion of KYN and its metabolites in tumors and/or in the blood. KYN depleting enzymes are used to lower KYN concentrations for the treatment of tumors expressing IDO1, IDO2, or TDO, thus preventing tumor-mediated tolerogenic effects and instead mediating tumor-ablating pro-inflammatory responses. Notably, the use of enzymes for the depletion of KYN and KYN metabolic byproducts circumvents the problems associated with small molecule inhibitors of IDO isoforms and TDO discussed above and further completely circumvents off target effects that are very commonly accompany small molecule drugs and lead to unpredicted toxicities and side effects.
SUMMARY OF THE INVENTION
[0007] For therapeutic applications the use of the Homo sapiens Kynureninase enzyme may be preferable. Being a native enzyme the Homo sapiens Kynureninase is expected to be subject to tolerance in humans and thus to be unlikely to elicit immune responses, including the production of anti-Homo sapiens Kynureninase antibodies, when used as a therapeutic. However the Homo sapiens Kynureninase preferentially degrades the KYN derivative 3'OH Kynurenine (3'OH KYN). The Homo sapiens Kynureninase (h-KYNase) shows catalytic activity for the degradation of KYN that is about 1,000 fold lower than the activity of some bacterial enzymes such as the enzyme from Pseudomonas fluorescence (PCT/US2014/053437). While bacterial enzymes such as those produced by Pseudomonas fluorescence or by Mucilaginibacter paludis have high catalytic activity for the degradation of KYN that has been shown to result in potent anti-tumor effects in mouse model, these enzymes are not of human origin and thus have a possibility of stimulating adverse immune responses which are detrimental for clinical applications. There is a significant need to develop variants of the Homo sapiens Kynureninase having high catalytic activity towards KYN and also a high degree (>65%) of amino acid sequence identity with the Homo sapiens enzyme.
[0008] Aspects of the present invention overcome a major deficiency in the art by providing enzymes that comprise bacterial or human polypeptide sequences capable of degrading L-kynurenine, having a high degree of sequence identity with the human enzyme to avoid the elicitation of adverse immune responses and displaying favorable pharmacokinetics in serum as desired for cancer therapy. In PCT/US2014/053437, the inventors disclosed mutant h-KYNase enzymes having up to 24-fold higher catalytic efficiency for the degradation of KYN relative to the wild-type human enzyme. There is a need for the discovery of mutant h-KYNase enzymes having higher catalytic activity than those disclosed in PCT/US2014/053437. The present invention addresses this need and discloses mutant enzymes having higher catalytic efficiencies and also mutant enzymes having higher catalytic activity than the wild type h-KYNase and different amino acid substitutions than the variants disclosed in PCT/US2014/053437.
[0009] In other aspects, there are provided polypeptides comprising either a native or modified human or primate kynureninase capable of degrading KYN. In some embodiments, the polypeptides are capable of degrading KYN under physiological conditions. For example, the polypeptides have a catalytic efficiency for KYN (k.sub.cat/K.sub.M) of at least or about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10.sup.4, 10.sup.5, 10.sup.6 M.sup.-1s.sup.-1 or any range derivable therein.
[0010] A modified polypeptide as discussed above may be characterized as having a certain percentage of identity as compared to an unmodified polypeptide (e.g., a native polypeptide) or to any polypeptide sequence disclosed herein. For example, the unmodified polypeptide may comprise at least, or up to, about 150, 200, 250, 300, 350, 400 residues (or any range derivable therein) of a native kynureninase. The percentage identity may be about, at most or at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% (or any range derivable therein) between the modified and unmodified polypeptides, or between any two sequences in comparison. It is also contemplated that percentage of identity discussed above may relate to a particular modified region of a polypeptide as compared to an unmodified region of a polypeptide. For instance, a polypeptide may contain a modified or mutant substrate recognition site of a kynureninase that can be characterized based on the identity of the amino acid sequence of the modified or mutant substrate recognition site of the kynureninase to that of an unmodified or mutant kynureninase from the same species or across the species. A modified or mutant human polypeptide characterized, for example, as having at least 90% identity to an unmodified kynureninase means that at least 90% of the amino acids in that modified or mutant human polypeptide are identical to the amino acids in the unmodified polypeptide.
[0011] Such an unmodified polypeptide may be a native kynureninase, particularly a human isoform or other primate isoforms. For example, the native human kynureninase may have the sequence of SEQ ID NO: 1. Non-limiting examples of other native primate kynureninase include Pongo abelii kynureninase (Genbank ID: XP_009235962.1, GI: 686708656), Macaca fascicularis kynureninase (Genbank ID: EHH54849.1, GI: 355750522), and Pan troglodytes kynureninase (Genbank ID: XP_003309314.1, GI: 332814521). Exemplary native polypeptides include a sequence having about, at most or at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity (or any range derivable therein) of SEQ ID NO:1. For example, the native polypeptide may comprise at least or up to about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 415 residues (or any range derivable therein) of the sequence of SEQ ID NO:1.
[0012] In some embodiments, the native Homo sapiens kynureninase (h-KYNase) is modified by one or more other modifications, such as chemical modifications, substitutions, insertions, deletions, and/or truncations. For example, the modifications are at a substrate recognitions site of the native enzyme. In a particular embodiment, the native kynureninase is modified by substitutions. For example, the number of substitutions may be one, two, three, four or more. In further embodiments, the native kynureninase is modified in the substrate recognition site or any location that may affect substrate specificity.
[0013] Accordingly, in preferred embodiments, the present invention is directed to an isolated, modified human kynureninase enzyme, said modified enzyme having at least one of the following substitutions relative to native human kynureninase (see SEQ ID NO: 1), said substitutions including i) A436T and ii) 5408N or F306L, and wherein the modified enzyme comprises a mutation set selected from the group consisting of the following mutation sets: (a) A99I, G112A, F306Y, I331N, I405L, 5408N and A436T; (b) A99I, G112A, K191E, F306Y, A381S, I405L, 5408N and A436T; (c) Q14R, A99I, G112A, M189I, H230Y, F306Y, I331N, I405L, 5408N and A436T; (d) T1385, H224N, F225Y, F306W, N333T, 5408N and A436T; (e) N67D, L72N, E103Q, F225Y, I331V, 5408N and A436T; (f) N67D, A1365, T1385, F225Y, 5408N and A436T; and (g) A99S, A136G, L137T, F306L and A436T.
[0014] In more particular aspects, the invention is directed specifically to a modified enzyme that comprises at least the mutation set A99I, G112A, F306Y, I331N, I405L, 5408N and A436T. An even more preferred enzyme in this regard is that comprising SEQ ID NO:2.
[0015] Another preferred enzyme is thus a modified enzyme that comprises at least the mutation set A99I , G112A, K191E, F306Y, A381S, I405L, 5408N and A436T. And, particularly preferred are modified enzymes that comprise SEQ ID NO:3.
[0016] Another preferred enzyme comprises at least the mutation set Q14R, A99I , G112A, M189I, H230Y, F306Y, I331N, I405L, 5408N and A436T and, particularly preferred are those comprising SEQ ID NO:4.
[0017] In still further embodiments, preferred enzymes comprises at least the mutation set T1385, H224N, F225Y, F306W, N333T, 5408N and A436T, and particularly preferred are those comprising SEQ ID NO:5.
[0018] Further preferred embodiments are directed to enzymes that comprise at least the mutation set N67D, L72N, E103Q, F225Y, I331V, 5408N and A436T. And, particularly preferred in this regard are enzymes that comprise SEQ ID NO:6.
[0019] And, still further preferred enzymes are those that comprise at least the mutation set N67D, A1365, T1385, F225Y, 5408N and A436T. And, particularly preferred such enzymes comprise SEQ ID NO:7.
[0020] And, still further preferred enzymes comprise at least the mutation set A99S, A136G, L137T, F306L and A436T. And, particularly preferred enzymes in this regard comprise SEQ ID NO:8.
[0021] In some aspects, the present invention also contemplates polypeptides comprising a kynureninase linked to a heterologous amino acid sequence. For example, the kynureninase may be linked to the heterologous amino acid sequence as a fusion protein. In a particular embodiment, the kynureninase is linked to amino acid sequences, such as an IgG Fc, albumin, an albumin binding protein, or an XTEN polypeptide for increasing the in vivo half-life.
[0022] To increase serum persistence, the kynureninase may be linked to one or more polyether molecules. In a particular embodiment, the polyether is polyethylene glycol (PEG). The polypeptide may be linked (e.g., covalently) to PEG via specific amino acid residues, such as lysine or cysteine. For therapeutic administration, such a polypeptide comprising the kynureninase may be dispersed in a pharmaceutically acceptable carrier.
[0023] In some aspects, a nucleic acid encoding such a kynureninase is contemplated. In some embodiments, the nucleic acid has been codon optimized for expression in bacteria. In particular embodiments, the bacteria are E. coli. In other aspects, the nucleic acid has been codon optimized for expression in fungus (e.g., yeast), insects, or mammals. The present invention further contemplates vectors, such as expression vectors, containing such nucleic acids. In particular embodiments, the nucleic acid encoding the kynureninase is operably linked to a promoter, including but not limited to heterologous promoters. In one embodiment, a kynureninase is delivered to a target cell by a vector (e.g., a gene therapy vector). Such viruses may have been modified by recombinant DNA technology to enable the expression of the kynureninase-encoding nucleic acid in the target cell. These vectors may be derived from vectors of non-viral (e.g., plasmids) or viral (e.g., adenovirus, adeno-associated virus, retrovirus, lentivirus, herpes virus, or vaccinia virus) origin. Non-viral vectors are preferably complexed with agents to facilitate the entry of the DNA across the cellular membrane. Examples of such non-viral vector complexes include the formulation with polycationic agents which facilitate the condensation of the DNA and lipid-based delivery systems. An example of a lipid-based delivery system would include liposome based delivery of nucleic acids.
[0024] In still further aspects, the present invention further contemplates host cells comprising such vectors. The host cells may be bacteria (e.g., E. coli), fungal cells (e.g., yeast), insect cells, or mammalian cells.
[0025] In some embodiments, the vectors are introduced into host cells for expressing the kynureninase. The proteins may be expressed in any suitable manner. In one embodiment, the proteins are expressed in a host cell such that the protein is glycosylated. In another embodiment, the proteins are expressed in a host cell such that the protein is aglycosylated.
[0026] In some embodiments, the cancer is any cancer that is sensitive to kynurenine depletion. In one embodiment, the present invention contemplates a method of treating a tumor cell or a cancer patient comprising administering a formulation comprising such a polypeptide. In some embodiments, the administration occurs under conditions such that at least a portion of the cells of the cancer are killed. In another embodiment, the formulation comprises such a kynureninase with kynurenine-degrading activity at physiological conditions and further comprising an attached polyethylene glycol chain. In some embodiment, the formulation is a pharmaceutical formulation comprising any of the above discussed kynureninases and pharmaceutically acceptable excipients. Such pharmaceutically acceptable excipients are well known to those of skill in the art. All of the above kynureninases may be contemplated as useful for human therapy.
[0027] In a further embodiment, there may also be provided a method of treating a tumor cell comprising administering a formulation comprising a non-bacterial (mammalian, e.g., primate or mouse) kynureninase that has kynurenine-degrading activity or a nucleic acid encoding thereof.
[0028] In accordance with certain aspects of the present invention, such a formulation containing the kynureninase can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intrasynovially, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, intratumorally, intramuscularly, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, by inhalation, infusion, continuous infusion, localized perfusion, via a catheter, via a lavage, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art.
[0029] In a further embodiment, the method also comprises administering at least a second anticancer therapy to the subject. The second anticancer therapy may be a surgical therapy, chemotherapy, radiation therapy, cryotherapy, hormone therapy, immunotherapy or cytokine therapy. In certain aspects, the second anticancer therapy may be an antibody therapy such as anti-PD-1, anti-CTLA-4, anti-PD-L1 antibody, anti-LAG3, anti-TIM-3, anti-ICOS, anti-CD137, anti-CD40, anti-KIR, anti-CD40L, anti-GITR, or anti-OX40 therapy.
[0030] In some embodiments, a T cell comprising a chimeric antigen receptor (CAR) and a kynureninase enzyme are contemplated for use in treating a subject with cancer. In some aspects, the cell may be transfected with a DNA encoding the CAR and the kynureninase and, in some cases, a transposase.
[0031] The CAR may target any cancer-cell antigen of interest, including, for example, HER2, CD19, CD20, and GD2. The antigen binding regions or domain can comprise a fragment of the V.sub.H and V.sub.L chains of a single-chain variable fragment (scFv) derived from a particular human monoclonal antibody, such as those described in U.S. Pat. No. 7,109,304, which is incorporated herein by reference in its entirety. The fragment can also be any number of different antigen binding domains of a human antigen-specific antibody. In a more specific embodiment, the fragment is an antigen-specific scFv encoded by a sequence that is optimized for human codon usage for expression in human cells. For additional examples of CARs, see, for example, WO 2012/031744, WO 2012/079000, WO 2013/059593, and U.S. Pat. No. 8,465,743, all of which are incorporated herein by reference in their entireties.
[0032] The kynureninase may be any kynureninase disclosed herein. Methods of transfecting of cells are well known in the art, but in certain aspects, highly efficient transfections methods such as electroporation are employed. For example, nucleic acids may be introduced into cells using a nucleofection apparatus. Preferably, the transfection step does not involve infecting or transducing the cells with virus, which can cause genotoxicity and/or lead to an immune response to cells containing viral sequences in a treated subject.
[0033] A wide range of CAR constructs and expression vectors for the same are known in the art and are further detailed herein. For example, in some aspects, the CAR expression vector is a DNA expression vector such as a plasmid, linear expression vector or an episome. In some aspects, the vector comprises additional sequences, such as sequence that facilitates expression of the CAR, such a promoter, enhancer, poly-A signal, and/or one or more introns. In preferred aspects, the CAR coding sequence is flanked by transposon sequences, such that the presence of a transposase allows the coding sequence to integrate into the genome of the transfected cell.
[0034] In certain aspects, cells are further transfected with a transposase that facilitates integration of a CAR coding sequence into the genome of the transfected cells. In some aspects, the transposase is provided as DNA expression vector. However, in preferred aspects, the transposase is provided as an expressible RNA or a protein such that long-term expression of the transposase does not occur in the transgenic cells. Any transposase system may be used in accordance with the embodiments. In other aspects, cells may be infected with a lentivirus to facilitate integration of the CAR coding sequence and the kynureninase coding sequence into the genome of the cell.
[0035] In one embodiment, a composition comprising a kynureninase or a nucleic acid encoding a kynureninase is provided for use in the treatment of a tumor in a subject. In another embodiment, the use of a kynureninase or a nucleic acid encoding a kynureninase in the manufacture of a medicament for the treatment of a tumor is provided. Said kynureninase may be any kynureninase of the embodiments.
[0036] Embodiments discussed in the context of methods and/or compositions of the invention may be employed with respect to any other method or composition described herein. Thus, an embodiment pertaining to one method or composition may be applied to other methods and compositions of the invention as well.
[0037] As used herein the terms "encode" or "encoding," with reference to a nucleic acid, are used to make the invention readily understandable by the skilled artisan; however, these terms may be used interchangeably with "comprise" or "comprising," respectively.
[0038] As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising," the words "a" or "an" may mean one or more than one.
[0039] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used herein "another" may mean at least a second or more.
[0040] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0041] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0043] FIG. 1: Mice bearing CT26 tumors (n=4 each time point) were injected with 50 mg/kg PEGylated kynureninase (SEQ ID NO:2) by peri-tumoral injection at time=0 hours, and plasma KYN levels were assessed by mass spectrometry at 0, 6, and 24 hours.
[0044] FIG. 2: Mice bearing CT26 tumors (n=4 each time point) were injected with 50 mg/kg PEGylated kynureninase (SEQ ID NO:4) by peri-tumoral injection at time=0 hours, and plasma KYN levels were assessed by mass spectrometry at 0, 6, and 24 hours.
[0045] FIG. 3: Mice (n=9 mice treated group, n=8 mice control group) were inoculated with 5.times.10.sup.4 CT26 cells and allowed to develop tumors until day 14 at which point they were treated with 20 mg/kg PEGylated kynureninase (SEQ ID NO:4) by peri-tumoral injection every three days. As a control, one group was treated with the same dosing schedule using heat deactivated PEGylated kynureninase (SEQ ID NO:4).
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0046] Kynurenine (KYN) is a metabolite of the amino acid tryptophan generated via the action of either indolamine-2,3-dioxygenase (IDO) or tryptophan-2,3-dioxygenase (TDO). Kynurenine exerts multiple effects on cell physiology, one of the most important of which is modulation of T cell responses. Many tumor cells regulate the synthesis of IDO and/or TDO to elevate the local concentration of kynurenine, which is accompanied with depletion of tryptophan. High levels of kynurenine serve as a powerful way to inhibit the function of tumor infiltrating T cells that would otherwise attack the tumor.
[0047] The present invention provides methods for the use of kynurenine degrading enzymes as a means for depleting local kynurenine levels in the tumor microenvironment as well as in the serum and thus prevent tumor-mediated suppression of T-cell action. Kynurenine hydrolyzing enzymes (kynureninases) convert kynurenine to alanine and anthranilic acid, the latter of which is not known to affect T-cell function. The inventors generated a pharmaceutical preparation of kynureninase enzyme to enable the enzyme to persist for prolonged times under physiological conditions. The inventors then showed that intratumoral administration of the enzyme results in dramatic retardation of growth of an aggressive tumor in mice.
I. DEFINITIONS
[0048] As used herein the terms "protein" and "polypeptide" refer to compounds comprising amino acids joined via peptide bonds and are used interchangeably.
[0049] As used herein, the term "fusion protein" refers to a chimeric protein containing proteins or protein fragments operably linked in a non-native way.
[0050] As used herein, the term "half-life" (1/2-life) refers to the time that would be required for the concentration of a polypeptide thereof to fall by half in vitro or in vivo, for example, after injection in a mammal.
[0051] The terms "in operable combination," "in operable order," and "operably linked" refer to a linkage wherein the components so described are in a relationship permitting them to function in their intended manner, for example, a linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of desired protein molecule, or a linkage of amino acid sequences in such a manner so that a fusion protein is produced.
[0052] The term "linker" is meant to refer to a compound or moiety that acts as a molecular bridge to operably link two different molecules, wherein one portion of the linker is operably linked to a first molecule, and wherein another portion of the linker is operably linked to a second molecule.
[0053] The term "PEGylated" refers to conjugation with polyethylene glycol (PEG), which has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. PEG can be coupled (e.g., covalently linked) to active agents through the hydroxy groups at the end of the PEG chain via chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids have been explored as novel biomaterial that would retain the biocompatibility of PEG, but that would have the added advantage of numerous attachment points per molecule (thus providing greater drug loading), and that can be synthetically designed to suit a variety of applications.
[0054] The term "gene" refers to a DNA sequence that comprises control and coding sequences necessary for the production of a polypeptide or precursor thereof. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so as the desired enzymatic activity is retained.
[0055] The term "native" refers to the typical form of a gene, a gene product, or a characteristic of that gene or gene product when isolated from a naturally occurring source. A native form is that which is most frequently observed in a natural population and is thus arbitrarily designated the normal or wild-type form. In contrast, the term "modified," "variant," or "mutant" refers to a gene or gene product that displays modification in sequence and functional properties (i.e., altered characteristics) when compared to the native gene or gene product.
[0056] The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques
[0057] The term "expression vector" refers to any type of genetic construct comprising a nucleic acid coding for an RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
[0058] The term "therapeutically effective amount" as used herein refers to an amount of cells and/or therapeutic composition (such as a therapeutic polynucleotide and/or therapeutic polypeptide) that is employed in methods to achieve a therapeutic effect. The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.
[0059] The term "K.sub.M" as used herein refers to the Michaelis-Menten constant for an enzyme and is defined as the concentration of the specific substrate at which a given enzyme yields one-half its maximum velocity in an enzyme catalyzed reaction. The term "k.sub.cat" as used herein refers to the turnover number or the number of substrate molecules each enzyme site converts to product per unit time, and in which the enzyme is working at maximum efficiency. The term "k.sub.cat/K.sub.M" as used herein is the specificity constant, which is a measure of how efficiently an enzyme converts a substrate into product.
[0060] The term "chimeric antigen receptors (CARs)," as used herein, may refer to artificial T-cell receptors, chimeric T-cell receptors, or chimeric immunoreceptors, for example, and encompass engineered receptors that graft an artificial specificity onto a particular immune effector cell. CARs may be employed to impart the specificity of a monoclonal antibody onto a T cell, thereby allowing a large number of specific T cells to be generated, for example, for use in adoptive cell therapy. In specific embodiments, CARs direct specificity of the cell to a tumor associated antigen, for example. In some embodiments, CARs comprise an intracellular activation domain, a transmembrane domain, and an extracellular domain comprising a tumor associated antigen binding region. In particular aspects, CARs comprise fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies (such as those described in U.S. Pat. No. 7,109,304, which is incorporated herein by reference in its entirety), fused to CD3-zeta transmembrane and endodomains. The specificity of other CAR designs may be derived from ligands of receptors (e.g., peptides) or from pattern-recognition receptors, such as Dectins. In particular embodiments, one can target malignant B cells by redirecting the specificity of T cells by using a CAR specific for the B-lineage molecule, CD19. In certain cases, the spacing of the antigen-recognition domain can be modified to reduce activation-induced cell death. In certain cases, CARs comprise domains for additional co-stimulatory signaling, such as CD3-zeta, FcR, CD27, CD28, CD137, DAP10, and/or OX40. In some cases, molecules can be co-expressed with the CAR, including co-stimulatory molecules, reporter genes for imaging (e.g., for positron emission tomography), gene products that conditionally ablate the T cells upon addition of a pro-drug, homing receptors, chemokines, chemokine receptors, cytokines, and cytokine receptors.
[0061] "Treatment" and "treating" refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of a kynureninase.
[0062] "Subject" and "patient" refer to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human.
II. KYNURENINASE POLYPEPTIDES
[0063] Some embodiments concern modified proteins and polypeptides. Particular embodiments concern a modified protein or polypeptide that exhibits at least one functional activity that is comparable to the unmodified version, preferably, the kynurenine degrading activity. In further aspects, the protein or polypeptide may be further modified to increase serum stability. Thus, when the present application refers to the function or activity of "modified protein" or a "modified polypeptide," one of ordinary skill in the art would understand that this includes, for example, a protein or polypeptide that possesses an additional advantage over the unmodified protein or polypeptide, such as kynurenine degrading activity or thermodynamic stability.
[0064] Determination of activity may be achieved using assays familiar to those of skill in the art, particularly with respect to the protein's activity, and may include for comparison purposes, the use of native and/or recombinant versions of either the modified or unmodified protein or polypeptide.
[0065] In certain embodiments, a modified polypeptide, such as a modified kynureninase, may be identified based on its increase in kynurenine. For example, substrate recognition sites of the unmodified polypeptide may be identified. This identification may be based on structural analysis or homology analysis. A population of mutants involving modifications of such substrate recognition sites may be generated. In a further embodiment, mutants with increased kynurenine degrading activity may be selected from the mutant population. Selection of desired mutants may include methods, such as detection of byproducts or products from kynurenine degradation.
[0066] Modified proteins may possess deletions and/or substitutions of amino acids; thus, a protein with a deletion, a protein with a substitution, and a protein with a deletion and a substitution are modified proteins. In some embodiments, these modified proteins may further include insertions or added amino acids, such as with fusion proteins or proteins with linkers, for example. A "modified deleted protein" lacks one or more residues of the native protein, but may possess the specificity and/or activity of the native protein. A "modified deleted protein" may also have reduced immunogenicity or antigenicity. An example of a modified deleted protein is one that has an amino acid residue deleted from at least one antigenic region that is, a region of the protein determined to be antigenic in a particular organism, such as the type of organism that may be administered the modified protein.
[0067] Substitution or replacement variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide, particularly its effector functions and/or bioavailability. Substitutions may or may not be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
[0068] In addition to a deletion or substitution, a modified protein may possess an insertion of residues, which typically involves the addition of at least one residue in the polypeptide. This may include the insertion of a targeting peptide or polypeptide or simply a single residue. Terminal additions, called fusion proteins, are discussed below.
[0069] The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%, or between about 81% and about 90%, or even between about 91% and about 99% of amino acids that are identical or functionally equivalent to the amino acids of a control polypeptide are included, provided the biological activity of the protein is maintained. A modified protein may be biologically functionally equivalent to its native counterpart in certain aspects.
[0070] It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
III. ENZYMATIC KYNURENINE DEGRADATION FOR THERAPY
[0071] In certain aspects, the polypeptides may be used for the treatment of diseases, including cancers that are sensitive to kynurenine depletion, with enzymes that deplete kynurenine, to prevent tumor-mediated tolerogenic effects and instead mediate tumor-ablating pro-inflammatory responses. In certain aspects, kynureninases are contemplated for use in treating tumors expressing IDO1, IDO2, and/or TDO.
[0072] Certain aspects of the present invention provide a modified kynureninase for treating diseases, such as tumors. Particularly, the modified polypeptide may have human polypeptide sequences and thus may prevent allergic reactions in human patients, allow repeated dosing, and increase the therapeutic efficacy.
[0073] Tumors for which the present treatment methods are useful include any malignant cell type, such as those found in a solid tumor or a hematological tumor. Exemplary solid tumors can include, but are not limited to, a tumor of an organ selected from the group consisting of pancreas, colon, cecum, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate, and breast. Exemplary hematological tumors include tumors of the bone marrow, T or B cell malignancies, leukemias, lymphomas, blastomas, myelomas, and the like. Further examples of cancers that may be treated using the methods provided herein include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, squamous cell cancer, lung cancer (including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung), cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, various types of head and neck cancer, melanoma, superficial spreading melanoma, lentigo malignant melanoma, acral lentiginous melanomas, nodular melanomas, as well as B-cell lymphoma (including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's macroglobulinemia), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), Hairy cell leukemia, multiple myeloma, acute myeloid leukemia (AML) and chronic myeloblastic leukemia.
[0074] The cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; hodgkin's disease; hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
[0075] The kynureninase may be used herein as an antitumor agent in a variety of modalities for depleting kynurenine and/or kynurenine-derived metabolites from tumor tissue, or the circulation of a mammal with cancer, or for depletion of kynurenine where its depletion is considered desirable.
[0076] Depletion can be conducted in vivo in the circulation of a mammal, in vitro in cases where kynurenine and/or kynurenine-derived metabolites depletion in tissue culture or other biological mediums is desired, and in ex vivo procedures where biological fluids, cells, or tissues are manipulated outside the body and subsequently returned to the body of the patient mammal. Depletion of kynurenine from circulation, culture media, biological fluids, or cells is conducted to reduce the amount of kynurenine accessible to the material being treated, and therefore comprises contacting the material to be depleted with a kynurenine-depleting amount of the kynureninase under kynurenine-depleting conditions as to degrade the ambient kynurenine in the material being contacted.
[0077] The depletion may be directed to the nutrient source for the cells, and not necessarily the cells themselves. Therefore, in an in vivo application, treating a tumor cell includes contacting the nutrient medium for a population of tumor cells with the kynureninase. In this embodiment, the medium may be blood, lymphatic fluid, spinal fluid and the like bodily fluid where kynurenine depletion is desired.
[0078] Kynurenine- and/or kynurenine-derived metabolites depletion efficiency can vary widely depending upon the application, and typically depends upon the amount of kynurenine present in the material, the desired rate of depletion, and the tolerance of the material for exposure to kynureninase. Kynurenine and kynurenine metabolite levels in a material, and therefore rates of kynurenine and kynurenine metabolite depletion from the material, can readily be monitored by a variety of chemical and biochemical methods well known in the art. Exemplary kynurenine-depleting amounts are described further herein, and can range from 0.001 to 100 units (U) of kynureninase, preferably about 0.01 to 10 U, and more preferably about 0.1 to 5 U kyureninase per milliliter (mL) of material to be treated. Typical dosages can be administered based on body weight, and are in the range of about 5-1000 U/kilogram (kg)/day, preferably about 5-100 U/kg/day, more preferably about 10-50 U/kg/day, and more preferably about 20-40 U/kg/day.
[0079] Kynurenine-depleting conditions are buffer and temperature conditions compatible with the biological activity of a kynureninase, and include moderate temperature, salt, and pH conditions compatible with the enzyme, for example, physiological conditions. Exemplary conditions include about 4-40.degree. C., ionic strength equivalent to about 0.05 to 0.2 M NaCl, and a pH of about 5 to 9, while physiological conditions are included.
[0080] In a particular embodiment, the invention contemplates methods of using a kynureninase as an antitumor agent, and therefore comprises contacting a population of tumor cells with a therapeutically effective amount of kynureninase for a time period sufficient to inhibit tumor cell growth.
[0081] A therapeutically effective amount of a kynureninase is a predetermined amount calculated to achieve the desired effect, i.e., to deplete kynurenine in the tumor tissue or in a patient's circulation, and thereby mediate a tumor-ablating pro-inflammatory response. Thus, the dosage ranges for the administration of kynureninase of the invention are those large enough to produce the desired effect in which the symptoms of tumor cell division and cell cycling are reduced. The dosage should not be so large as to cause adverse side effects, such as hyperviscosity syndromes, pulmonary edema, congestive heart failure, neurological effects, and the like. Generally, the dosage will vary with age of, condition of, sex of, and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication.
[0082] The kynureninase can be administered parenterally by injection or by gradual infusion over time. The kynureninase can be administered intravenously, intraperitoneally, orally, intramuscularly, subcutaneously, intracavity, transdermally, dermally, can be delivered by peristaltic means, can be injected directly into the tissue containing the tumor cells, or can be administered by a pump connected to a catheter that may contain a potential biosensor for kynurenine.
[0083] The therapeutic compositions containing kynureninase are conventionally administered intravenously, as by injection of a unit dose, for example. The term "unit dose" when used in reference to a therapeutic composition refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent, i.e., carrier, or vehicle.
[0084] The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, capacity of the subject's system to utilize the active ingredient, and degree of therapeutic effect desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosage ranges for systemic application are disclosed herein and depend on the route of administration. Suitable regimes for initial administration and booster shots are also contemplated and are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Exemplary multiple administrations are described herein and are particularly preferred to maintain continuously high serum and tissue levels of kynureninase and conversely low serum and tissue levels of kynurenine. Alternatively, continuous intravenous infusion sufficient to maintain concentrations in the blood in the ranges specified for in vivo therapies are contemplated.
IV. CONJUGATES
[0085] Compositions and methods of the present invention involve modified kynureninases, such as by forming conjugates with heterologous peptide segments or polymers, such as polyethylene glycol. In further aspects, the kynureninases may be linked to PEG to increase the hydrodynamic radius of the enzyme and hence increase the serum persistence. In certain aspects, the disclosed polypeptide may be conjugated to any targeting agent, such as a ligand having the ability to specifically and stably bind to an external receptor or binding site on a tumor cell (U.S. Patent Publ. 2009/0304666).
[0086] A. Fusion Proteins
[0087] Certain embodiments of the present invention concern fusion proteins. These molecules may have a native or modified kynureninase linked at the N- or C-terminus to a heterologous domain. For example, fusions may also employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host. Another useful fusion includes the addition of a protein affinity tag, such as a serum albumin affinity tag or six histidine residues, or an immunologically active domain, such as an antibody epitope, preferably cleavable, to facilitate purification of the fusion protein. Non-limiting affinity tags include polyhistidine, chitin binding protein (CBP), maltose binding protein (MBP), and glutathione-S-transferase (GST).
[0088] In a particular embodiment, the kynureninase may be linked to a peptide that increases the in vivo half-life, such as an XTEN polypeptide (Schellenberger et al., 2009), IgG Fc domain, albumin, or albumin binding peptide.
[0089] Methods of generating fusion proteins are well known to those of skill in the art. Such proteins can be produced, for example, by de novo synthesis of the complete fusion protein, or by attachment of the DNA sequence encoding the heterologous domain, followed by expression of the intact fusion protein.
[0090] Production of fusion proteins that recover the functional activities of the parent proteins may be facilitated by connecting genes with a bridging DNA segment encoding a peptide linker that is spliced between the polypeptides connected in tandem. The linker would be of sufficient length to allow proper folding of the resulting fusion protein.
[0091] B. PEGylation
[0092] In certain aspects of the invention, methods and compositions related to PEGylation of kynureninase are disclosed. For example, the kynureninase may be PEGylated in accordance with the methods disclosed herein.
[0093] PEGylation is the process of covalent attachment of poly(ethylene glycol) polymer chains to another molecule, normally a drug or therapeutic protein. PEGylation is routinely achieved by incubation of a reactive derivative of PEG with the target macromolecule. The covalent attachment of PEG to a drug or therapeutic protein can "mask" the agent from the host's immune system (reduced immunogenicity and antigenicity) or increase the hydrodynamic size (size in solution) of the agent, which prolongs its circulatory time by reducing renal clearance. PEGylation can also provide water solubility to hydrophobic drugs and proteins.
[0094] The first step of the PEGylation is the suitable functionalization of the PEG polymer at one or both terminals. PEGs that are activated at each terminus with the same reactive moiety are known as "homobifunctional," whereas if the functional groups present are different, then the PEG derivative is referred as "heterobifunctional" or "heterofunctional." The chemically active or activated derivatives of the PEG polymer are prepared to attach the PEG to the desired molecule.
[0095] The choice of the suitable functional group for the PEG derivative is based on the type of available reactive group on the molecule that will be coupled to the PEG. For proteins, typical reactive amino acids include lysine, cysteine, histidine, arginine, aspartic acid, glutamic acid, serine, threonine, and tyrosine. The N-terminal amino group and the C-terminal carboxylic acid can also be used.
[0096] The techniques used to form first generation PEG derivatives are generally reacting the PEG polymer with a group that is reactive with hydroxyl groups, typically anhydrides, acid chlorides, chloroformates, and carbonates. In the second generation PEGylation chemistry more efficient functional groups, such as aldehyde, esters, amides, etc., are made available for conjugation.
[0097] As applications of PEGylation have become more and more advanced and sophisticated, there has been an increase in need for heterobifunctional PEGs for conjugation. These heterobifunctional PEGs are very useful in linking two entities, where a hydrophilic, flexible, and biocompatible spacer is needed. Preferred end groups for heterobifunctional PEGs are maleimide, vinyl sulfones, pyridyl disulfide, amine, carboxylic acids, and NHS esters.
[0098] The most common modification agents, or linkers, are based on methoxy PEG (mPEG) molecules. Their activity depends on adding a protein-modifying group to the alcohol end. In some instances polyethylene glycol (PEG diol) is used as the precursor molecule. The diol is subsequently modified at both ends in order to make a hetero- or homo-dimeric PEG-linked molecule.
[0099] Proteins are generally PEGylated at nucleophilic sites, such as unprotonated thiols (cysteinyl residues) or amino groups. Examples of cysteinyl-specific modification reagents include PEG maleimide, PEG iodoacetate, PEG thiols, and PEG vinylsulfone. All four are strongly cysteinyl-specific under mild conditions and neutral to slightly alkaline pH but each has some drawbacks. The thioether formed with the maleimides can be somewhat unstable under alkaline conditions so there may be some limitation to formulation options with this linker. The carbamothioate linkage formed with iodo PEGs is more stable, but free iodine can modify tyrosine residues under some conditions. PEG thiols form disulfide bonds with protein thiols, but this linkage can also be unstable under alkaline conditions. PEG-vinylsulfone reactivity is relatively slow compared to maleimide and iodo PEG; however, the thioether linkage formed is quite stable. Its slower reaction rate also can make the PEG-vinylsulfone reaction easier to control.
[0100] Site-specific PEGylation at native cysteinyl residues is seldom carried out, since these residues are usually in the form of disulfide bonds or are required for biological activity. On the other hand, site-directed mutagenesis can be used to incorporate cysteinyl PEGylation sites for thiol-specific linkers. The cysteine mutation must be designed such that it is accessible to the PEGylation reagent and is still biologically active after PEGylation.
[0101] Amine-specific modification agents include PEG NHS ester, PEG tresylate, PEG aldehyde, PEG isothiocyanate, and several others. All react under mild conditions and are very specific for amino groups. The PEG NHS ester is probably one of the more reactive agents; however, its high reactivity can make the PEGylation reaction difficult to control on a large scale. PEG aldehyde forms an imine with the amino group, which is then reduced to a secondary amine with sodium cyanoborohydride. Unlike sodium borohydride, sodium cyanoborohydride will not reduce disulfide bonds. However, this chemical is highly toxic and must be handled cautiously, particularly at lower pH where it becomes volatile.
[0102] Due to the multiple lysine residues on most proteins, site-specific PEGylation can be a challenge. Fortunately, because these reagents react with unprotonated amino groups, it is possible to direct the PEGylation to lower-pK amino groups by performing the reaction at a lower pH. Generally the pK of the alpha-amino group is 1-2 pH units lower than the epsilon-amino group of lysine residues. By PEGylating the molecule at pH 7 or below, high selectivity for the N-terminus frequently can be attained. However, this is only feasible if the N-terminal portion of the protein is not required for biological activity. Still, the pharmacokinetic benefits from PEGylation frequently outweigh a significant loss of in vitro bioactivity, resulting in a product with much greater in vivo bioactivity regardless of PEGylation chemistry.
[0103] There are several parameters to consider when developing a PEGylation procedure. Fortunately, there are usually no more than four or five key parameters. The "design of experiments" approach to optimization of PEGylation conditions can be very useful. For thiol-specific PEGylation reactions, parameters to consider include: protein concentration, PEG-to-protein ratio (on a molar basis), temperature, pH, reaction time, and in some instances, the exclusion of oxygen. (Oxygen can contribute to intermolecular disulfide formation by the protein, which will reduce the yield of the PEGylated product.) The same factors should be considered (with the exception of oxygen) for amine-specific modification except that pH may be even more critical, particularly when targeting the N-terminal amino group.
[0104] For both amine- and thiol-specific modifications, the reaction conditions may affect the stability of the protein. This may limit the temperature, protein concentration, and pH. In addition, the reactivity of the PEG linker should be known before starting the PEGylation reaction. For example, if the PEGylation agent is only 70 percent active, the amount of PEG used should ensure that only active PEG molecules are counted in the protein-to-PEG reaction stoichiometry.
V. PROTEINS AND PEPTIDES
[0105] In certain embodiments, the present invention concerns novel compositions comprising at least one protein or peptide, such as a kynureninase. These peptides may be comprised in a fusion protein or conjugated to an agent as described supra.
[0106] As used herein, a protein or peptide generally refers, but is not limited to, a protein of greater than about 200 amino acids, up to a full length sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. For convenience, the terms "protein," "polypeptide," and "peptide" are used interchangeably herein.
[0107] As used herein, an "amino acid residue" refers to any naturally occurring amino acid, any amino acid derivative, or any amino acid mimic known in the art. In certain embodiments, the residues of the protein or peptide are sequential, without any non-amino acids interrupting the sequence of amino acid residues. In other embodiments, the sequence may comprise one or more non-amino acid moieties. In particular embodiments, the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties.
[0108] Accordingly, the term "protein or peptide" encompasses amino acid sequences comprising at least one of the 20 common amino acids found in naturally occurring proteins, or at least one modified or unusual amino acid.
[0109] Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides, or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides. The nucleotide and protein, polypeptide, and peptide sequences corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases (available on the world wide web at ncbi.nlm.nih.gov/). The coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art. Alternatively, various commercial preparations of proteins, polypeptides, and peptides are known to those of skill in the art.
VI. NUCLEIC ACIDS AND VECTORS
[0110] In certain aspects of the invention, nucleic acid sequences encoding a kynureninase or a fusion protein containing a kynureninase may be disclosed. Depending on which expression system is used, nucleic acid sequences can be selected based on conventional methods. For example, if the kynureninase is derived from human kynureninase and contains multiple codons that are rarely utilized in E. coli, then that may interfere with expression. Therefore, the respective genes or variants thereof may be codon optimized for E. coli expression. Various vectors may be also used to express the protein of interest. Exemplary vectors include, but are not limited, plasmid vectors, viral vectors, transposon, or liposome-based vectors.
VII. HOST CELLS
[0111] Host cells may be any that may be transformed to allow the expression and secretion of kynureninase and conjugates thereof. The host cells may be bacteria, mammalian cells, yeast, or filamentous fungi. Various bacteria include Escherichia and Bacillus. Yeasts belonging to the genera Saccharomyces, or Pichia would find use as an appropriate
VIII. PHARMACEUTICAL COMPOSITIONS
[0112] It is contemplated that the novel kynureninase can be administered systemically or locally to inhibit tumor cell growth and, most preferably, to kill cancer cells in cancer patients with locally advanced or metastatic cancers. They can be administered intravenously, intrathecally, and/or intraperitoneally. They can be administered alone or in combination with anti-proliferative drugs. In one embodiment, they are administered to reduce the cancer load in the patient prior to surgery or other procedures. Alternatively, they can be administered after surgery to ensure that any remaining cancer (e.g., cancer that the surgery failed to eliminate) does not survive.
[0113] It is not intended that the present invention be limited by the particular nature of the therapeutic preparation. For example, such compositions can be provided in formulations together with physiologically tolerable liquid, gel, or solid carriers, diluents, and excipients. These therapeutic preparations can be administered to mammals for veterinary use, such as with domestic animals, and clinical use in humans in a manner similar to other therapeutic agents. In general, the dosage required for therapeutic efficacy will vary according to the type of use and mode of administration, as well as the particularized requirements of individual subjects.
[0114] Such compositions are typically prepared as liquid solutions or suspensions, as injectables. Suitable diluents and excipients are, for example, water, saline, dextrose, glycerol, or the like, and combinations thereof. In addition, if desired, the compositions may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, stabilizing agents, or pH buffering agents.
[0115] Where clinical applications are contemplated, it may be necessary to prepare pharmaceutical compositions comprising proteins, antibodies, and drugs in a form appropriate for the intended application. Generally, pharmaceutical compositions may comprise an effective amount of one or more kynureninase or additional agents dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one kyureninase isolated by the method disclosed herein, or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Office of Biological Standards.
[0116] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
[0117] Certain embodiments of the present invention may comprise different types of carriers depending on whether it is to be administered in solid, liquid, or aerosol form, and whether it needs to be sterile for the route of administration, such as injection. The compositions can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, intramuscularly, subcutaneously, mucosally, orally, topically, locally, by inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in lipid compositions (e.g., liposomes), or by other methods or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference).
[0118] The modified polypeptides may be formulated into a composition in a free base, neutral, or salt form. Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine, or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as formulated for parenteral administrations, such as injectable solutions, or aerosols for delivery to the lungs, or formulated for alimentary administrations, such as drug release capsules and the like.
[0119] Further in accordance with certain aspects of the present invention, the composition suitable for administration may be provided in a pharmaceutically acceptable carrier with or without an inert diluent. The carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent, or carrier is detrimental to the recipient or to the therapeutic effectiveness of the composition contained therein, its use in administrable composition for use in practicing the methods is appropriate. Examples of carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers, and the like, or combinations thereof. The composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives, such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
[0120] In accordance with certain aspects of the present invention, the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsification, admixture, encapsulation, absorption, and the like. Such procedures are routine for those skilled in the art.
[0121] In a specific embodiment of the present invention, the composition is combined or mixed thoroughly with a semi-solid or solid carrier. The mixing can be carried out in any convenient manner, such as grinding. Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach. Examples of stabilizers for use in a composition include buffers, amino acids, such as glycine and lysine, carbohydrates, such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
[0122] In further embodiments, the present invention may concern the use of a pharmaceutical lipid vehicle composition that includes kynureninases, one or more lipids, and an aqueous solvent. As used herein, the term "lipid" will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds is well known to those of skill in the art, and as the term "lipid" is used herein, it is not limited to any particular structure. Examples include compounds that contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally occurring or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether- and ester-linked fatty acids, polymerizable lipids, and combinations thereof. Of course, compounds other than those specifically described herein that are understood by one of skill in the art as lipids are also encompassed by the compositions and methods.
[0123] One of ordinary skill in the art would be familiar with the range of techniques that can be employed for dispersing a composition in a lipid vehicle. For example, the kynureninase or a fusion protein thereof may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art. The dispersion may or may not result in the formation of liposomes.
[0124] The actual dosage amount of a composition administered to an animal patient can be determined by physical and physiological factors, such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0125] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of active compound(s) in each therapeutically useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors, such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations, will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0126] In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 milligram/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 milligram/kg/body weight to about 100 milligram/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
IX. COMBINATION TREATMENTS
[0127] In certain embodiments, the compositions and methods of the present embodiments involve administration of a kynureninase in combination with a second or additional therapy. Such therapy can be applied in the treatment of any disease that is associated with kynurenine dependency. For example, the disease may be cancer.
[0128] The methods and compositions, including combination therapies, enhance the therapeutic or protective effect, and/or increase the therapeutic effect of another anti-cancer or anti-hyperproliferative therapy. Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve administering a kynureninase and a second therapy. The second therapy may or may not have a direct cytotoxic effect. For example, the second therapy may be an agent that upregulates the immune system without having a direct cytotoxic effect. A tissue, tumor, or cell can be exposed to one or more compositions or pharmacological formulation(s) comprising one or more of the agents (e.g., a kynureninase or an anti-cancer agent), or by exposing the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) a kynureninase, 2) an anti-cancer agent, or 3) both a kynureninase and an anti-cancer agent. Also, it is contemplated that such a combination therapy can be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy.
[0129] The terms "contacted" and "exposed," when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing, for example, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
[0130] A kynureninase may be administered before, during, after, or in various combinations relative to an anti-cancer treatment. The administrations may be in intervals ranging from concurrently to minutes to days to weeks. In embodiments where the kynureninase is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient. In such instances, it is contemplated that one may provide a patient with the kynureninase and the anti-cancer therapy within about 12 to 24 or 72 h of each other and, more particularly, within about 6-12 h of each other. In some situations it may be desirable to extend the time period for treatment significantly where several days (2, 3, 4, 5, 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8) lapse between respective administrations.
[0131] In certain embodiments, a course of treatment will last 1-90 days or more (this such range includes intervening days). It is contemplated that one agent may be given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof, and another agent is given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered. This time period may last 1-7 days, and/or 1-5 weeks, and/or 1-12 months or more (this such range includes intervening days), depending on the condition of the patient, such as their prognosis, strength, health, etc. It is expected that the treatment cycles would be repeated as necessary.
[0132] Various combinations may be employed. For the example below a kynureninase is "A" and an anti-cancer therapy is "B":
TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[0133] Administration of any compound or therapy of the present embodiments to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy.
X. EXAMPLES
[0134] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1--Gene Construction, Expression, and Purification of Kynureninase from Homo sapiens
[0135] A gene for expression of the kynureninase enzyme from Homo sapiens (h-KYNU) was obtained by overlap extension polymerase chain reaction (PCR) of four codon optimized gene blocks designed using DNA-Works software (Hoover and Lubkowski, 2002). The full-length gene includes an N-terminal XbaI restriction enzyme site (nucleotides 1-6), an optimized ribosomal binding site (nucleotides 28-60), a start codon (nucleotides 61-63), an N-terminal His6 tag (nucleotides 64-96), an E. coli codon optimized h-KYNU gene (nucleotides 97-1488), a stop codon (nucleotides 1489-1491), and a C-terminal BamHI restriction enzyme site (nucleotides 1492-1497) (SEQ ID NO: 34). The aforementioned restriction enzyme sites were used to clone the assembled gene into a pET-28a+ vector (Novagen). This construct was then used to transform BL21 (DE3) E. coli for expression. Cells were grown at 37.degree. C. with shaking at 210 rpm in Terrific Broth (TB) media with 50 mg/L of kanamycin. Expression was induced when an OD.sub.600 .about.1.0 was reached by adding IPTG (0.5 mM final concentration) with continued shaking overnight at 25.degree. C. Cells were then harvested by centrifugation and re-suspended in lysis buffer consisting of 100 mM sodium phosphate, pH 8.0, 300 mM NaCl, 25 mM imidazole, 1 mM pyridoxyl phosphate (PLP), 1 mM phenylmethylsulfonylfluoride, 0.1% Tween 20, and 25 U/mL Pierce.TM. Universal Nuclease for Cell Lysis (ThermoFisher Scientific). Lysis was achieved by French press and the lysate was cleared of particulates by centrifuging at 20,000.times.g for 1 h at 25.degree. C. The supernatant was then filtered through a 0.45 .mu.m syringe filter and applied to a Ni-NTA/agarose column (Qiagen) pre-equilibrated in 100 mM sodium phosphate, pH 8.0, 300 mM NaCl, 25 mM imidazole, and 0.1% Tween 20.
[0136] After loading the lysate onto the column, the resin was washed with 20 column volumes (CV) of 100 mM sodium phosphate, pH 8.0, 300 mM NaCl, 25 mM imidazole, and 0.1% Tween 20. The enzyme was then eluted in 5 CV of 300 mM NaCl, 100 mM sodium phosphate pH 8.0, 10 mM PLP and 300 mM imidazole, and then incubated at 37.degree. C. for two hours in the elution buffer to ensure proper PLP loading. At this point, enzyme was dialyzed against 4L of 50 mM Tris-HCl pH 8.5 overnight at 4.degree. C. to remove excess PLP and imidazole, and 10% glycerol was added to the enzyme and aliquots were flash frozen in liquid nitrogen for storage at -80.degree. C. Alternatively, enzyme could be buffer exchanged into freshly made, sterile 100 mM sodium phosphate, pH 8.4, to both remove imidazole and PLP and prepare it for PEGylation (see Example 4 of PCT/US2014/053437). Enzyme purities were typically >95% as assessed by SDS-PAGE analysis and typical yields averaged around 5 mg/L of liquid culture. Protein quantities were assessed by measuring Abs.sub.280 nm.
Example 2--Assay for Measuring Kinetic Parameters of Kynureninase
[0137] The kinetic parameters of h-KYNU, and of h-KYNU variants as described in Examples 5, 6, and 7 below, were quantified by a spectrophotometric assay, in which the decay in the maximum absorbance of the enzyme substrate, L-kynurenine, was monitored as a function of time. L-kynurenine solutions were prepared in a PBS buffer, pH 7.4, to result in final concentrations ranging from 31 .mu.M to 2000 .mu.M. L-Kynurenine has an extinction coefficient of 4,500 M.sup.-1cm.sup.-1 with a .lamda..sub.max at 365 nm while the products of the kynureninase reaction, L-anthranilic acid and L-alanine, do not appreciably absorb at 365 nm. Reactions were initiated by adding and rapidly mixing enzyme solutions (.about.20 nM final) with the substrate solutions and monitoring the loss of substrate KYN at 37.degree. C. by measuring Abs.sub.365 nm over time. The resulting data was processed and fitted to the Michaelis-Menten equation for determining kinetic constants. For the authentic (wild-type) h-KYNU enzyme, k.sub.cat/K.sub.M=1.0.times.10.sup.2 M.sup.-1s.sup.-1.
Example 3--Genetic Selection for Kynureninase Activity
[0138] The amino acid L-tryptophan (L-Trp) is synthesized from the pentose derived precursor, chorismate, by expression of the trp biosynthetic genes. In bacteria such as E. coli the trp biosynthetic genes are organized in an operon composed of five genes; trpE, trpD, trpC, trpB, and trpA. The TrpE and TrpD proteins are components of the anthranilate synthase complex that catalyzes the first step in the conversion of chorismate and L-glutamine to anthranilic acid and L-glutamate. Anthranilic acid is then subsequently converted to L-Trp by the action of TrpD, TrpC, TrpA, and TrpB. Cells lacking a functional anthranilate synthase gene are auxotrophic for L-Trp and cannot grow in minimal media without tryptophan. The inventors postulated that since kynurenine can be transported into the cytosol of many organisms, cells expressing recombinant L-kynureninase (h-KYNase) enzymes displaying a sufficiently high catalytic activity should be able to convert cytosolic L-kynurenine to anthranilic acid and the latter then enables the synthesis of L-Trp. By contrast, cells that do not express the enzyme or express variants with low catalytic activity should display either no growth or very slow growth, respectively, on minimal media with L-kynurenine.
[0139] To select h-KYNase bacteria transformed with library DNA expressing h-KYNase enzyme variants were grown in culture media, dubbed M9-KYN media, contained M9 minimal salts, 2 mM magnesium sulfate, 0.1 mM calcium chloride, 2% glucose, 10 .mu.M IPTG, ampicillin, 100 .mu.M Kynurenine, and water. As described above, an E. coli .DELTA.trpE deletion mutant was utilized for genetic selection experiments. The E. coli .DELTA.trpE strain was obtained from Genetic Resources at Yale CGSC and had the genotype (F-, .DELTA.(araD-araB)567, AlacZ4787(::rmB-3), .lamda..sup.-, .DELTA.trpE772::kan, rph-1, .DELTA.(rhaD-rhaB)568, hsdR514). Clones expressing enzymes having better catalytic activity for KYN degradation and/or expression are able to grow better in the M9-KYN media and thus become enriched.
Example 4--Construction of an E. coli Tac Promoter Expression Vector with Chloramphenicol Resistance for Use in Genetic Selections (See Example 3 Above)
[0140] In total, six nucleotide fragments were PCR amplified for downstream Gibson-mediated assembly (see Gibson et al, "Enzymatic Assembly of DNA molecules up to several hundred kilobases," Nature Methods 6:343-345 (2009), incorporated by reference). Four nucleotide fragments were PCR amplified using the E. coli expression vector pMAL-c2x as template and oligonucleotide primer pairs as follows: Pair 1=5' TAAACAACTGGCGGTATGGCCGACACCATCGAATGGTGC 3' (SEQ ID NO: 10) and 5' GTTTTATCAATGCATTAGGTACCACTTGTTGGTGAAGTGCTCGTGAAAAC 3' (SEQ ID NO: 11), Pair 2=5' GTGTATACTGGCTTAACTGGCCAGGAACCGTAAAAAGGCC 3' (SEQ ID NO: 12) and 5' ATAGGCCGAAATCGGCAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTC 3' (SEQ ID NO: 13), Pair 3=5' CTTTTTACGGTTCCTGGCCAGTTAAGCCAGTATACACTCCGCTATCGC 3' (SEQ ID NO: 14) and 5' ACCATTCGATGGTGTCGGCCATACCGCCAGTTGTTTACCCTC 3' (SEQ ID NO: 15), Pair 4=5' TGCCGCGGATTACCCGGGCTGCAGGCAAGCTTGGCACT 3' (SEQ ID NO: 16) and 5' CACCTGAAATTGTAAACGTTAAAAAGGCCATCCGTCAGGATG 3' (SEQ ID NO: 17). The fifth nucleotide fragment containing the chloramphenicol resistance gene was PCR amplified using the E. coli phage display vector pAK200 as template and the following oligonucleotide primer pair: 5' CTGACGGATGGCCTTTTTAACGTTTACAATTTCAGGTGGCACTTTTC 3' (SEQ ID NO: 18) and 5' GATCTTCACCTAGATCCTTTTAATTATTACCTCCACGGGGAGAGCC 3' (SEQ ID NO: 19). The sixth and final nucleotide fragment containing a partial sequence of the wildtype h-KYNU gene was amplified using the following oligonucleotide primer pair: 5' GTGGTACCTAATGCATTGATAAAACCGCGCGAAGGTG 3' (SEQ ID NO: 20) and 5' AGCCCGGGTAATCCGCGGCAGCACGCAAAATCAACGCC 3' (SEQ ID NO: 21). These six fragments were assembled using Gibson-mediated assembly, resulting in an E. coli expression vector with chloramphenicol resistance that utilized the Tac promoter for expression of wildtype h-KYNU gene contained between XmaI and KpnI restriction enzyme sites (SEQ ID NO: 9).
Example 5--Isolation of h-KYNase Variants with Highly Enhanced Kynureninase Activity from Libraries of Random Mutants
[0141] To engineer improved L-Kynurenine degrading activity into an h-KYNase variant with the mutations A99I/G112A/F306Y/I405L/S408N/A436T (see SEQ ID NO: 93 of PCT/US2015/047475, incorporated herein as SEQ ID NO: 22), random mutations were introduced in SEQ ID NO: 22 by error-prone PCR of the entire gene for 25 cycles using Taq Polymerase and 0.22 mM dATP, 0.20 mM dCTP, 0.27 mM dGTP, 1.88 mM dTTP, 2.75 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 0.005 mg/ml BSA, and 0.5 mM of each primer of the following two primers: 5' CACTGTGTGGTACCGAGGTAATACATGGGCGGTCATCATCACCACCATCATGG 3' (SEQ ID NO: 23) and 5' CGAGTCAGCCCGGGTAATCCGCGGCTAGTTTTTGGTTTCCGCACTGTCCA 3' (SEQ ID NO: 24). Error rate was determined by subcloning 1 .mu.L of the purified PCR product into the pCR.TM.4-TOPO.RTM. plasmid and transforming the ligation product into One Shot TOP10 Chemically Competent cells, plating on LB+50 .mu.g/mL Ampicillin plates and growing overnight at 37.degree. C., followed by picking 10 single colonies, growing overnight at 37.degree. C. in LB+50 .mu.g/mL Ampicillin, and then extracting and sequencing the plasmid DNA with the m13-FORWARD (-20) and m13-REVERSE primers. Error rate was determined to be 0.55% by sequencing the DNA fragment from 10 bacterial colonies picked at random. The purified PCR produced was then digested overnight with KpnI-HF and XmaI, repurified, and ligated into an equimolar amount of similarly digested and purified chloramphenicol resistant E. coli expression vector (SEQ ID NO: 9), resulting in 750,000 transformants.
[0142] After construction of the library, it was subjected to multiple rounds of genetic selection in the E. coli -.DELTA.trpE selection cell line in M9-KYN media with decreasing inoculum amounts as described in Example 24 of PCT/US2014/053437, using M9-KYN media that contained M9 minimal salts, 2 mM magnesium sulfate, 0.1 mM calcium chloride, 2% glucose, 10 .mu.M IPTG, 35 .mu.g/mL chloramphenicol, 100 .mu.M Kynurenine, and water, and inoculating with 2*10.sup.7 cells for Round 1, 2*10.sup.7 cells for Round 2, 1*10.sup.7 cells for Round 3, 2*10.sup.6 cells for Round 4, 1*10.sup.6 cells for Round 5, 3.3*10.sup.5 cells for Round 6, 1*10.sup.5 cells for Round 7, 1*10.sup.5 cells for Round 8. After plating the final round of E. coli -.DELTA.trpE selection cells on an LB+35 .mu.g/mL chloramphenicol plate, individual colonies were selected and evaluated for catalytic activity using a microtiter plate kynureninase assay as described in PCT/US2014/053437. Clones displaying greater activity than cells expressing the wild type h-KYNase were sequenced to determine mutations, and subsequently purified to near homogeneity as described in Example 1 and assessed in detail for their steady-state kinetic parameters at 37.degree. C. as described in Example 2. The results of these efforts led to the isolation of two new variants with enhanced kynurenine degrading activity (amino acid SEQ ID NOS: 2 and 3, nucleotide SEQ ID NOS: 27 and 28).
[0143] To engineer improved L-Kynurenine degrading activity into an h-KYNase variant with the mutations A99I/G112A/F306Y/I331N/I405L/S408N/A436T (SEQ ID NO: 2), random mutations were introduced in SEQ ID NO: 2 by error-prone PCR of the entire gene. An error-prone PCR library using SEQ ID NO: 27 as template DNA was constructed as described above in Example 5, resulting 165,000,000 transformants with an error rate of 0.45%. After construction of the library, it was subjected to 14 rounds of genetic selection in the E. coli -.DELTA.trpE selection cell line as described above in Example 5, using the following inoculumn cell counts for Rounds 1-14: 1*10.sup.9, 5.3*10.sup.8, 2.7*10.sup.8, 9*10.sup.7, 3*10.sup.7, 1*10.sup.7, 5*10.sup.6, 2.5*10.sup.6, 1*10.sup.6, 1*10.sup.6, 1*10.sup.6, 1*10.sup.6, 1*10.sup.6, and 1*10.sup.6 cells respectively. After plating the final round of E. coli -.DELTA.trpE selection cells on an LB+35 .mu.g/mL chloramphenicol plate, individual colonies were selected and evaluated for catalytic activity using a microtiter plate kynureninase assay as described in PCT/US2014/053437. Clones displaying greater activity than cells expressing the wild type h-KYNase (SEQ ID NO: 1) were sequenced to determine mutations, and subsequently purified to near homogeneity as described in Example 1 and assessed in detail for their steady-state kinetic parameters at 37.degree. C. as described in Example 2. The results of these efforts led to the isolation of one new variant with enhanced kynurenine degrading activity (amino acid SEQ ID NO: 4; nucleotide SEQ ID NO: 29).
Example 6--Isolation of h-KYNase Variants with Highly Enhanced Kynureninase Activity from Oligonucleotide-Directed Partial Mutagenesis Libraries Focused Around the Active Site Residues Coordinating Substrate Binding
[0144] A structural and phylogenetic analysis of residues from KYN preferring and OH-KYN preferring enzyme active sites revealed several differences in the identities of 1.sup.st and 2.sup.nd shell residues that coordinate substrate binding as defined by those residues within 6 .ANG. of the pyridoxal phosphate cofactor or substrate binding pocket. Differential residues meeting these criteria include for h-KYNU: L72, A99, H102, I110, A136, L137, T138, S221, F225, S332, N333, and Q402. In contrast the most prevalent residues observed in these respective positions for KYN preferring enzymes include (corresponding to h-KYNase numbering): D72, I99, W102, F110, 5136, T137, T/S138, P221, Y225, G332, T333, and H402. These distinct active-site amino acid differences suggest that they play a role in substrate discrimination between KYN and OH-KYN. These residues were sometimes near previously determined catalytically important mutations, including N67D, F70L, L72N, and F306/L/W (PCT/US2014/053437). Additional possible mutations of nearby residues of interest included E103Q and H224N to reduce impact of charge imbalances from potential mutations. Thus a degenerate codon library ecompassing N67, F70, L72, A99, H102, E103, P108, 1110, A136, L137, T138, 5221, H224, F225, F306, 1331, S332 and N333, P334, and Q402 was constructed by oligonucleotide-directed mutagenesis of codons corresponding to the above amino acids such that the resulting library of genes could contain either the WT h-KYNU codon or a codon for the mutation of interest, i.e., the amino acid most commonly found in KYN preferring enzymes. After construction and sequence confirmation of a library with 21,000,000 members through ligation into the chloramphenicol resistant E. coli expression vector (SEQ ID NO: 9), as described in Example 5, the library was subjected to 8 rounds of genetic selection in the E. coli -.DELTA.trpE selection cell line in M9-KYN media with decreasing inoculum amounts as described in Example 5 using the following inoculumn cell counts for Rounds 1-8: 4*10.sup.8, 2*10.sup.8, 4*10.sup.7, 2*10.sup.7, 1*10.sup.7, 3*10.sup.6, 1*10.sup.6, and 5*10.sup.5 cells respectively. After plating the final round of E. coli -.DELTA.trpE selection cells on an LB+35 .mu.g/mL chloramphenicol plate, individual colonies were selected and evaluated for catalytic activity as in Example 5. Clones displaying greater apparent activity than controls were sequenced to determine mutations, and subsequently purified to near homogeneity as described in Example 1 and assessed in detail for their steady-state kinetic parameters at 37.degree. C. as described in Example 2. The results of these efforts led to the isolation of three new variants with enhanced kynurenine degrading activity (amino acid SEQ ID NOS: 5, 6, and 7; nucleotide SEQ ID NOS: 30, 31, and 32).
Example 7--Isolation of an h-KYNase Variant with Highly Enhanced Kynureninase Activity from an Oligonucleotide-Directed Saturated Mutagenesis Library Targeting the Residues Coordinating the Pyridoxal Phosphate Cofactor
[0145] The phosphate of the essential cofactor PLP has been demonstrated to act as an acid/base catalyst in the mechanism of KYN hydrolysis (Philips et al., FEBS J. 2014 February;281(4):1100-9). A structural and phylogenetic analysis of residues from KYN preferring and OH-KYN preferring enzymes revealed differential coordination of the phosphate of PLP. Specifically h-KYNU residues A136/L137 are near the PLP phosphate while KYN preferring enzymes (such as Pf-KYNU (see SEQ ID NO: 1 of PCT/US2015/047475, incorporated herein as SEQ ID NO: 25) have Ser/Thr residues at these residues which donate additional hydrogen bonds to the cofactor. These differences in the active sites suggested that the additional hydrogen bonds to the PLP phosphate in KYN preferring enzymes may mechanistically facilitate the contribution of PLP phosphate to the reaction. Thus an h-KYNU variant with the mutations A99S/F306L/A436T (see SEQ ID NO: 64 of PCT/US2015/047475, incorporated herein as SEQ ID NO: 26), was used as a scaffold to construct an oligonucleotide-directed saturated mutagenesis library of codons corresponding to amino acids 136 and 137. After construction and sequence confirmation of a library with 8,000,000 members through ligation into the chloramphenicol resistant E. coli expression vector (SEQ ID NO: 9) as described in Examples 5 and 6, the library was subjected to 5 rounds of genetic selection in the E. coli -.DELTA.trpE selection cell line in M9-KYN media with decreasing inoculum amounts as described in Examples 5 and 6 using the following inoculumn cell counts for Rounds 1-5: 7*10.sup.7, 1*10.sup.7, 1*10.sup.6, 2*10.sup.5, and 1*10.sup.5 cells, respectively. After plating the final round of E. coli -.DELTA.trpE selection cells on an LB+35 .mu.g/mL chloramphenicol plate, individual colonies were selected and evaluated for catalytic activity as in Examples 5 and 6. Clones displaying greater apparent activity than controls were sequenced to determine mutations, and subsequently purified to near homogeneity as described in Example 1 and assessed in detail for their steady-state kinetic parameters at 37.degree. C. as described in Example 2. The results of these efforts led to the isolation of one new variant with enhanced kynurenine degrading activity (amino acid SEQ ID NO: 8; nucleotide SEQ ID NO: 33).
Example 8--Comparison of the Kynurieninase Activity of the h-KYNU Variants Described Above to Wild Type h-KYNU
[0146] The following table is a compilation of data comparing the kynurieninase activity of the h-KYNU variants described above to wild type h-KYNU, the results of which demonstrate that the surprising improvements in activity achieved as compared to the human enzyme. These assays were carried out as described above, and are compiled in the following table, Table 1:
TABLE-US-00002 TABLE 1 h-KYNU Variants with Improved Activity Fold change SEQ ID k.sub.cat/K.sub.M from NO. Variant (s.sup.-1mM.sup.-1) WT 2 A99I/G112A/F306Y/I331N/I405L/ 5.5 55 S408N/A436T 3 A99I/G112A/K191E/F306Y/A381S/ 5.9 59 I405L/S408N/A436T 4 Q14R/A99I/G112A/M189I/H230Y/ 7.0 70 F306Y/I331N/I405L/S408N/A436T 5 T138S/H224N/F225Y/F306W/N333T/ 0.6 6 S408N/A436T 6 N67D/L72N/E103Q/F225Y/I331V/ 3.2 32 S408N/A436T 7 N67D/A136S/T138S/F225Y/S408N/ 1.2 12 A436T 8 A99S/A136G/L137T/F306L/A436T 2.6 26
Example 9--Systemic Kynurenine Depletion by PEG-Hs-KYNU (SEQ ID NO:2) Therapy in the Syngeneic CT26 Mouse Colon Carcinoma Model
[0147] The ability of the PEGylated human kynureninase variant (PEG-hs-KYNU, SEQ ID NO:2) to deplete serum kynurenine levels was evaluated in the IDO1-expressing CT26 colon carcinoma mouse model. Tumors were initiated by implanting 50,000 CT26 cells in the flanks of Balb/c mice (Day 0, n=12 mice total, n=4 mice for each time point). Once the tumors reached a mean volume of 60 mm.sup.3 (Day 14), the animals were treated with 1.25 mg of PEG-hs-KYNU (SEQ ID NO:2) by peri-tumoral injection. Plasma kynurenine levels were assessed by mass spectrometry after 6 hours, and 24 hours (n=4 mice per time point) (FIG. 1). Baseline Kyn levels were determined by administering 1.25 mg of heat inactivated PEG-hs-KYNU by peri-tumoral injection and assessed by mass spectometry 24 hrs post dosing (n=4 mice). Administration of PEG-hs-KYNU (SEQ ID NO:2) resulted in systemic kynurenine depletion 6 hours and 24 hours after treatment.
Example 10--Systemic Kynurenine Depletion by PEG-Hs-KYNU (SEQ ID NO:4) Therapy in the Syngeneic CT26 Mouse Colon Carcinoma Model
[0148] The ability of the PEGylated human kynureninase variant (PEG-hs-KYNU, SEQ ID NO:4) to depleted serum kynurenine levels was also evaluated in the CT26 colon carcinoma mouse model. Tumors were initiated by implanting 50,000 CT26 cells in the flanks of Balb/c mice (Day 0, n=12 mice total, n=4 mice for each time point). Once the tumors reached a mean volume of 60 mm.sup.3 (Day 14), the animals were treated with 1.25 mg of PEG-hs-KYNU (SEQ ID NO 4) by peri-tumoral injection. Plasma kynurenine levels were assessed by mass spectrometry after 6 hours, and 24 hours (n=4 mice per time point) (FIG. 2). Baseline Kyn levels were determined by administering 1.25 mg of heat inactivated PEG-hs-KYNU by peri-tumoral injection and assessed by mass spec 24 hrs post dosing (n=4 mice). Administration of PEG-hs-KYNU (SEQ ID NO:4) resulted in systemic kynurenine depletion 6 hours and 24 hours after treatment.
Example 11--Determination of Plasma KYN Levels by LC-MS
[0149] Following collection from mice of Examples 9 and 10, blood samples were kept on ice at all times until addition to pre-chilled EDTA-K2 anticoagulant tubes. Plasma was then collected by centrifugation at 4.degree. C. for 5 min to remove cellular debris. A 50 .mu.L aliquot of plasma was then added into pre-chilled tubes containing 200 .mu.L internal standard (200 ng/mL 13C4, 15N-Kynurenine in ACN/MeOH(v:v, 25:75) with 0.3% formic acdi and 0.1 mol/L citric acid) and centrifuged at 13000 rpm in a microcentrifuge for 10 min, 4.degree. C. Kyn levels were then assessed by UPLC-MS using a 4000 Q TRAP system by applying samples to an ACE 3 AQ 2.1*100 mm, 3 .mu.m column (Phenomenex) under a Mobile Phase consisting of 99% 0.1% formic acid in water (mobile phase A) and 1% 0.5% formic acid in acetonitrile (mobile phase B) at a flow rate of 0.7 ml/min. Kyn and internal standard is subsequently eluted by a stepwise gradient of 95% Mobile phase B and detected by ESI in positive mode. Plasma Kyn levels were then quantitated ratiometrically using the 13C4, 15N-Kynurenine internal standard.
Example 12--Efficacy of PEG-Hs-KYNU Therapies in the Syngeneic CT26 Mouse Colon Carcinoma Model
[0150] The PEGylated human kynureninase variant (PEG-hs-KYNU, SEQ ID NO:4) was evaluated in the CT26 colon carcinoma mouse model. Tumors were initiated by implanting 50,000 CT26 cells in the flanks of Balb/c mice (Day 0, n=9 mice treated group, n=8 mice control group). Once the tumors reached a mean volume of 60 mm.sup.3 (Day 14), the animals were treated with 500 .mu.g of PEG-hs-KYNU (SEQ ID NO:4) by subcutaneous injection near the tumor site every three days for a total of 6 doses. An identical treatment regimen with heat-inactivated PEG-hs-KYNU (SEQ ID NO:4) was used as a control. Administration of PEG-hs-KYNU (SEQ ID NO:4) resulted in drastic tumor growth retardation (FIG. 3) with 33% of the treated mice displaying complete tumor regression.
[0151] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
[0152] Ahmed et al., HER2-specific T cells target primary glioblastoma stem cells and induce regression of autologous experimental tumors. Clinical Cancer Research, 16(2):474-485, 2010.
[0153] Austin-Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998.
[0154] Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y., 1994.
[0155] Bukowski et al., Clinical Cancer Res., 4(10):2337-2347, 1998.
[0156] Chen and Guillemin, Kynurenine pathway metabolites in humans: disease and healthy States. Int J Tryptophan Res, 2:1-19, 2009.
[0157] Christodoulides et al., Microbiology, 144(Pt 11):3027-3037, 1998.
[0158] Cole and Gaucher, Exploiting models of molecular evoluation to efficiently direct protein engineering. J. Mol. Evol., 72:193, 2011.
[0159] Curran et al., PD-1 and CTLA-4 combination blockade expands infiltrating T cells and reduces regulatory T and myeloid cells within B16 melanoma tumors. Proceedings of the National Academy of Sciences, 107:4275-4280, 2010.
[0160] Davidson et al., J. Immunother 21(5):389-398, 1998.
[0161] de Jong et al., Serum tryptophan and kynurenine concentrations as parameters for indoleamine 2,3-dioxygenase activity in patients with endometrial, ovarian, and vulvar cancer. Int J Gynecol Cancer, 21(7):1320-1327, 2011.
[0162] Della Chiesa et al., The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46-and NKG2D-activating receptors and regulates NK-cell function. Blood, 108(13):4118-4125, 2006.
[0163] Godin-Ethier et al., Indoleamine 2, 3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Clinical Cancer Research, 17(22):6985-6991, 2011.
[0164] Hanibuchi et al., Int. J. Cancer, 78(4):480-485, 1998.
[0165] Harkki et al., BioTechnology, 7:596-603, 1989.
[0166] Hellstrand et al., Acta Oncologica, 37(4):347-353, 1998.
[0167] Hollander, Front. Immun., 3:3, 2012.
[0168] Holmgaard et al., Indoleamine 2, 3-dioxygenase is a critical resistance mechanism in antitumor T cell immunotherapy targeting CTLA-4. The Journal of Experimental Medicine, 210:1389-1402, 2013.
[0169] Hoover and Lubkowski, DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Research, 30(10):e43-e43, 2002.
[0170] Hopwood et al., In: Genetic Manipulation of Streptomyces, A Laboratory Manual, The John Innes Foundation, Norwich, Conn., 1985.
[0171] Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.
[0172] Ito et al., J. Biochem., 79:1263, 1976.
[0173] Kaper et al., Nanosensor detection of an immunoregulatory tryptophan influx/kynurenine efflux cycle. PLoS Biology, 5(10):e257, 2007.
[0174] Lipowska-Bhalla et al., Targeted immunotherapy of cancer with CAR T cells: achievements and challenges. Cancer Immunology Immunotherapy, 61(7):953-962, 2012.
[0175] Lob et al., Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? Nat Rev Cancer, 9(6):445-452, 2009.
[0176] Lordanescu, J Bacteriol, 12:597 601, 1975.
[0177] Mandi and Vecsei, The kynurenine system and immunoregulation. J Neural Transm, 119(2):197-209, 2012.
[0178] Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988.
[0179] Mellor et al., Gene, 24:1-14, 1983.
[0180] Mezrich et al., An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. The Journal of Immunology, 185 (6): 3190-3198, 2010.
[0181] Opitz et al., The Indoleamine-2, 3-Dioxygenase (IDO) Inhibitor 1-Methyl-D-tryptophan Upregulates IDO1 in Human Cancer Cells. PLoS One, 6(5):e19823, 2011.
[0182] Opitz et al., An endogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Nature, 478(7368):197-203, 2011.
[0183] Penttila et al., Gene, 61:155-164, 1987.
[0184] Pilotte et al., Reversal of tumoral immune resistance by inhibition of tryptophan 2,3-dioxygenase. Proc Natl Acad Sci USA, 109(7):2497-2502, 2012.
[0185] Prendergast, Cancer: Why tumours eat tryptophan. Nature, 478(7368):192-194, 2011.
[0186] Qin et al., Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998.
[0187] Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1289-1329, 1990.
[0188] Rutella et al., Targeting indoleamine 2,3-dioxygenase (IDO) to counteract tumour-induced immune dysfunction: from biochemistry to clinical development. Endocr Metab Immune Disord Drug Targets, 9(2):151-177, 2009.
[0189] Schellenberger et al., Nature Biotech., 27:1186-1190, 2009.
[0190] Shin et al., Modulation of natural killer cell antitumor activity by the aryl hydrocarbon receptor. Proc Natl Acad Sci USA, 110(30):12391-12396, 2013.
[0191] Sibakov et al., Eur. J. Biochem., 145:567 572, 1984.
[0192] Song et al., L-Kynurenine-induced apoptosis in human NK cells is mediated by reactive oxygen species. International Immunopharmacology, 11(8):932-938, 2011.
[0193] Stone et al., Replacing Mn.sup.2+ with Co.sup.2+ in human arginase I enhances cytotoxicity toward L-arginine auxotrophic cancer cell lines. ACS Chemical Biology, 5:333-342, 2010.
[0194] Voigt et al., Protein building blocks preserved by recombination. Nature Structural & Molecular Biology, 9:553, 2002.
[0195] Ward, Proc, Embo-Alko Workshop on Molecular Biology of Filamentous Fungi, Helsinki, 119-128, 1989.
[0196] Wawrzynczak and Thorpe, In: Immunoconjugates, Antibody Conuugates In Radioimaging And Therapy Of Cancer, Vogel (Ed.), NY, Oxford University Press, 28, 1987.
[0197] Yao et al., Serum metabolic profiling and features of papillary thyroid carcinoma and nodular goiter. Mol Biosyst, 7(9):2608-2614, 2011.
[0198] Yoshikawa et al., Serum concentration of L-kynurenine predicts the clinical outcome of patients with diffuse large B-cell lymphoma treated with R-CHOP. Eur J Haematol, 84(4):304-309, 2010.
Sequence CWU
1
1
341465PRTHomo sapiens 1Met Glu Pro Ser Ser Leu Glu Leu Pro Ala Asp Thr Val
Gln Arg Ile1 5 10 15Ala
Ala Glu Leu Lys Cys His Pro Thr Asp Glu Arg Val Ala Leu His 20
25 30Leu Asp Glu Glu Asp Lys Leu Arg
His Phe Arg Glu Cys Phe Tyr Ile 35 40
45Pro Lys Ile Gln Asp Leu Pro Pro Val Asp Leu Ser Leu Val Asn Lys
50 55 60Asp Glu Asn Ala Ile Tyr Phe Leu
Gly Asn Ser Leu Gly Leu Gln Pro65 70 75
80Lys Met Val Lys Thr Tyr Leu Glu Glu Glu Leu Asp Lys
Trp Ala Lys 85 90 95Ile
Ala Ala Tyr Gly His Glu Val Gly Lys Arg Pro Trp Ile Thr Gly
100 105 110Asp Glu Ser Ile Val Gly Leu
Met Lys Asp Ile Val Gly Ala Asn Glu 115 120
125Lys Glu Ile Ala Leu Met Asn Ala Leu Thr Val Asn Leu His Leu
Leu 130 135 140Met Leu Ser Phe Phe Lys
Pro Thr Pro Lys Arg Tyr Lys Ile Leu Leu145 150
155 160Glu Ala Lys Ala Phe Pro Ser Asp His Tyr Ala
Ile Glu Ser Gln Leu 165 170
175Gln Leu His Gly Leu Asn Ile Glu Glu Ser Met Arg Met Ile Lys Pro
180 185 190Arg Glu Gly Glu Glu Thr
Leu Arg Ile Glu Asp Ile Leu Glu Val Ile 195 200
205Glu Lys Glu Gly Asp Ser Ile Ala Val Ile Leu Phe Ser Gly
Val His 210 215 220Phe Tyr Thr Gly Gln
His Phe Asn Ile Pro Ala Ile Thr Lys Ala Gly225 230
235 240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp
Leu Ala His Ala Val Gly 245 250
255Asn Val Glu Leu Tyr Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp
260 265 270Cys Ser Tyr Lys Tyr
Leu Asn Ala Gly Ala Gly Gly Ile Ala Gly Ala 275
280 285Phe Ile His Glu Lys His Ala His Thr Ile Lys Pro
Ala Leu Val Gly 290 295 300Trp Phe Gly
His Glu Leu Ser Thr Arg Phe Lys Met Asp Asn Lys Leu305
310 315 320Gln Leu Ile Pro Gly Val Cys
Gly Phe Arg Ile Ser Asn Pro Pro Ile 325
330 335Leu Leu Val Cys Ser Leu His Ala Ser Leu Glu Ile
Phe Lys Gln Ala 340 345 350Thr
Met Lys Ala Leu Arg Lys Lys Ser Val Leu Leu Thr Gly Tyr Leu 355
360 365Glu Tyr Leu Ile Lys His Asn Tyr Gly
Lys Asp Lys Ala Ala Thr Lys 370 375
380Lys Pro Val Val Asn Ile Ile Thr Pro Ser His Val Glu Glu Arg Gly385
390 395 400Cys Gln Leu Thr
Ile Thr Phe Ser Val Pro Asn Lys Asp Val Phe Gln 405
410 415Glu Leu Glu Lys Arg Gly Val Val Cys Asp
Lys Arg Asn Pro Asn Gly 420 425
430Ile Arg Val Ala Pro Val Pro Leu Tyr Asn Ser Phe His Asp Val Tyr
435 440 445Lys Phe Thr Asn Leu Leu Thr
Ser Ile Leu Asp Ser Ala Glu Thr Lys 450 455
460Asn4652465PRTArtificial sequenceSynthetic polypeptide 2Met Glu
Pro Ser Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro
Thr Asp Glu Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr
Ile 35 40 45Pro Lys Ile Gln Asp
Leu Pro Pro Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asn Ala Ile Tyr Phe Leu Gly Asn Ser Leu Gly Leu
Gln Pro65 70 75 80Lys
Met Val Lys Thr Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys
85 90 95Ile Ala Ile Tyr Gly His Glu
Val Gly Lys Arg Pro Trp Ile Thr Ala 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala
Asn Glu 115 120 125Lys Glu Ile Ala
Leu Met Asn Ala Leu Thr Val Asn Leu His Leu Leu 130
135 140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr
Lys Ile Leu Leu145 150 155
160Glu Ala Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu
Asn Ile Glu Glu Ser Met Arg Met Ile Lys Pro 180
185 190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile
Leu Glu Val Ile 195 200 205Glu Lys
Glu Gly Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Phe Tyr Thr Gly Gln His Phe Asn Ile Pro Ala
Ile Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu
Tyr Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly
Gly Ile Ala Gly Ala 275 280 285Phe
Ile His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Tyr Gly His Glu Leu Ser Thr Arg Phe
Lys Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Asn Ser Asn Pro Pro
Ile 325 330 335Leu Leu Val
Cys Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val
Leu Leu Thr Gly Tyr Leu 355 360
365Glu Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr
Pro Ser His Val Glu Glu Arg Gly385 390
395 400Cys Gln Leu Thr Leu Thr Phe Asn Val Pro Asn Lys
Asp Val Phe Gln 405 410
415Glu Leu Glu Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly
420 425 430Ile Arg Val Thr Pro Val
Pro Leu Tyr Asn Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu
Thr Lys 450 455
460Asn4653465PRTArtificial sequenceSynthetic polypeptide 3Met Glu Pro Ser
Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro Thr Asp
Glu Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr Ile
35 40 45Pro Lys Ile Gln Asp Leu Pro Pro
Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asn Ala Ile Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65
70 75 80Lys Met Val Lys Thr
Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys 85
90 95Ile Ala Ile Tyr Gly His Glu Val Gly Lys Arg
Pro Trp Ile Thr Ala 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu
115 120 125Lys Glu Ile Ala Leu Met Asn
Ala Leu Thr Val Asn Leu His Leu Leu 130 135
140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu
Leu145 150 155 160Glu Ala
Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu Asn Ile
Glu Glu Ser Met Arg Met Ile Glu Pro 180 185
190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu
Val Ile 195 200 205Glu Lys Glu Gly
Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Phe Tyr Thr Gly Gln His Phe Asn Ile Pro Ala Ile
Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu Tyr
Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly
Ile Ala Gly Ala 275 280 285Phe Ile
His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Tyr Gly His Glu Leu Ser Thr Arg Phe Lys
Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Ile Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys
Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu
Leu Thr Gly Tyr Leu 355 360 365Glu
Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ser Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser
His Val Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Leu Thr Phe Asn Val Pro Asn Lys Asp Val Phe
Gln 405 410 415Glu Leu Glu
Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn
Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn4654465PRTArtificial
sequenceSynthetic polypeptide 4Met Glu Pro Ser Ser Leu Glu Leu Pro Ala
Asp Thr Val Arg Arg Ile1 5 10
15Ala Ala Glu Leu Lys Cys His Pro Thr Asp Glu Arg Val Ala Leu His
20 25 30Leu Asp Glu Glu Asp Lys
Leu Arg His Phe Arg Glu Cys Phe Tyr Ile 35 40
45Pro Lys Ile Gln Asp Leu Pro Pro Val Asp Leu Ser Leu Val
Asn Lys 50 55 60Asp Glu Asn Ala Ile
Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65 70
75 80Lys Met Val Lys Thr Tyr Leu Glu Glu Glu
Leu Asp Lys Trp Ala Lys 85 90
95Ile Ala Ile Tyr Gly His Glu Val Gly Lys Arg Pro Trp Ile Thr Ala
100 105 110Asp Glu Ser Ile Val
Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu 115
120 125Lys Glu Ile Ala Leu Met Asn Ala Leu Thr Val Asn
Leu His Leu Leu 130 135 140Met Leu Ser
Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu Leu145
150 155 160Glu Ala Lys Ala Phe Pro Ser
Asp His Tyr Ala Ile Glu Ser Gln Leu 165
170 175Gln Leu His Gly Leu Asn Ile Glu Glu Ser Met Arg
Ile Ile Lys Pro 180 185 190Arg
Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu Val Ile 195
200 205Glu Lys Glu Gly Asp Ser Ile Ala Val
Ile Leu Phe Ser Gly Val His 210 215
220Phe Tyr Thr Gly Gln Tyr Phe Asn Ile Pro Ala Ile Thr Lys Ala Gly225
230 235 240Gln Ala Lys Gly
Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly 245
250 255Asn Val Glu Leu Tyr Leu His Asp Trp Gly
Val Asp Phe Ala Cys Trp 260 265
270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly Ile Ala Gly Ala
275 280 285Phe Ile His Glu Lys His Ala
His Thr Ile Lys Pro Ala Leu Val Gly 290 295
300Trp Tyr Gly His Glu Leu Ser Thr Arg Phe Lys Met Asp Asn Lys
Leu305 310 315 320Gln Leu
Ile Pro Gly Val Cys Gly Phe Arg Asn Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys Ser Leu His
Ala Ser Leu Glu Ile Phe Lys Gln Ala 340 345
350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu Leu Thr Gly
Tyr Leu 355 360 365Glu Tyr Leu Ile
Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser His Val
Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Leu Thr Phe Asn Val Pro Asn Lys Asp Val Phe Gln
405 410 415Glu Leu Glu Lys Arg
Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn Ser Phe
His Asp Val Tyr 435 440 445Lys Phe
Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn4655465PRTArtificial sequenceSynthetic
polypeptide 5Met Glu Pro Ser Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg
Ile1 5 10 15Ala Ala Glu
Leu Lys Cys His Pro Thr Asp Glu Arg Val Ala Leu His 20
25 30Leu Asp Glu Glu Asp Lys Leu Arg His Phe
Arg Glu Cys Phe Tyr Ile 35 40
45Pro Lys Ile Gln Asp Leu Pro Pro Val Asp Leu Ser Leu Val Asn Lys 50
55 60Asp Glu Asn Ala Ile Tyr Phe Leu Gly
Asn Ser Leu Gly Leu Gln Pro65 70 75
80Lys Met Val Lys Thr Tyr Leu Glu Glu Glu Leu Asp Lys Trp
Ala Lys 85 90 95Ile Ala
Ala Tyr Gly His Glu Val Gly Lys Arg Pro Trp Ile Thr Gly 100
105 110Asp Glu Ser Ile Val Gly Leu Met Lys
Asp Ile Val Gly Ala Asn Glu 115 120
125Lys Glu Ile Ala Leu Met Asn Ala Leu Ser Val Asn Leu His Leu Leu
130 135 140Met Leu Ser Phe Phe Lys Pro
Thr Pro Lys Arg Tyr Lys Ile Leu Leu145 150
155 160Glu Ala Lys Ala Phe Pro Ser Asp His Tyr Ala Ile
Glu Ser Gln Leu 165 170
175Gln Leu His Gly Leu Asn Ile Glu Glu Ser Met Arg Met Ile Lys Pro
180 185 190Arg Glu Gly Glu Glu Thr
Leu Arg Ile Glu Asp Ile Leu Glu Val Ile 195 200
205Glu Lys Glu Gly Asp Ser Ile Ala Val Ile Leu Phe Ser Gly
Val Asn 210 215 220Tyr Tyr Thr Gly Gln
His Phe Asn Ile Pro Ala Ile Thr Lys Ala Gly225 230
235 240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp
Leu Ala His Ala Val Gly 245 250
255Asn Val Glu Leu Tyr Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp
260 265 270Cys Ser Tyr Lys Tyr
Leu Asn Ala Gly Ala Gly Gly Ile Ala Gly Ala 275
280 285Phe Ile His Glu Lys His Ala His Thr Ile Lys Pro
Ala Leu Val Gly 290 295 300Trp Trp Gly
His Glu Leu Ser Thr Arg Phe Lys Met Asp Asn Lys Leu305
310 315 320Gln Leu Ile Pro Gly Val Cys
Gly Phe Arg Ile Ser Thr Pro Pro Ile 325
330 335Leu Leu Val Cys Ser Leu His Ala Ser Leu Glu Ile
Phe Lys Gln Ala 340 345 350Thr
Met Lys Ala Leu Arg Lys Lys Ser Val Leu Leu Thr Gly Tyr Leu 355
360 365Glu Tyr Leu Ile Lys His Asn Tyr Gly
Lys Asp Lys Ala Ala Thr Lys 370 375
380Lys Pro Val Val Asn Ile Ile Thr Pro Ser His Val Glu Glu Arg Gly385
390 395 400Cys Gln Leu Thr
Ile Thr Phe Asn Val Pro Asn Lys Asp Val Phe Gln 405
410 415Glu Leu Glu Lys Arg Gly Val Val Cys Asp
Lys Arg Asn Pro Asn Gly 420 425
430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn Ser Phe His Asp Val Tyr
435 440 445Lys Phe Thr Asn Leu Leu Thr
Ser Ile Leu Asp Ser Ala Glu Thr Lys 450 455
460Asn4656465PRTArtificial sequenceSynthetic polypeptide 6Met Glu
Pro Ser Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro
Thr Asp Glu Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr
Ile 35 40 45Pro Lys Ile Gln Asp
Leu Pro Pro Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asp Ala Ile Tyr Phe Asn Gly Asn Ser Leu Gly Leu
Gln Pro65 70 75 80Lys
Met Val Lys Thr Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys
85 90 95Ile Ala Ala Tyr Gly His Gln
Val Gly Lys Arg Pro Trp Ile Thr Gly 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala
Asn Glu 115 120 125Lys Glu Ile Ala
Leu Met Asn Ala Leu Thr Val Asn Leu His Leu Leu 130
135 140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr
Lys Ile Leu Leu145 150 155
160Glu Ala Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu
Asn Ile Glu Glu Ser Met Arg Met Ile Lys Pro 180
185 190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile
Leu Glu Val Ile 195 200 205Glu Lys
Glu Gly Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Tyr Tyr Thr Gly Gln His Phe Asn Ile Pro Ala
Ile Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu
Tyr Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly
Gly Ile Ala Gly Ala 275 280 285Phe
Ile His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Phe Gly His Glu Leu Ser Thr Arg Phe
Lys Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Val Ser Asn Pro Pro
Ile 325 330 335Leu Leu Val
Cys Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val
Leu Leu Thr Gly Tyr Leu 355 360
365Glu Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr
Pro Ser His Val Glu Glu Arg Gly385 390
395 400Cys Gln Leu Thr Ile Thr Phe Asn Val Pro Asn Lys
Asp Val Phe Gln 405 410
415Glu Leu Glu Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly
420 425 430Ile Arg Val Thr Pro Val
Pro Leu Tyr Asn Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu
Thr Lys 450 455
460Asn4657465PRTArtificial sequenceSynthetic polypeptide 7Met Glu Pro Ser
Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro Thr Asp
Glu Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr Ile
35 40 45Pro Lys Ile Gln Asp Leu Pro Pro
Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asp Ala Ile Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65
70 75 80Lys Met Val Lys Thr
Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys 85
90 95Ile Ala Ala Tyr Gly His Glu Val Gly Lys Arg
Pro Trp Ile Thr Gly 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu
115 120 125Lys Glu Ile Ala Leu Met Asn
Ser Leu Ser Val Asn Leu His Leu Leu 130 135
140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu
Leu145 150 155 160Glu Ala
Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu Asn Ile
Glu Glu Ser Met Arg Met Ile Lys Pro 180 185
190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu
Val Ile 195 200 205Glu Lys Glu Gly
Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Tyr Tyr Thr Gly Gln His Phe Asn Ile Pro Ala Ile
Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu Tyr
Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly
Ile Ala Gly Ala 275 280 285Phe Ile
His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Phe Gly His Glu Leu Ser Thr Arg Phe Lys
Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Ile Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys
Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu
Leu Thr Gly Tyr Leu 355 360 365Glu
Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser
His Val Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Ile Thr Phe Asn Val Pro Asn Lys Asp Val Phe
Gln 405 410 415Glu Leu Glu
Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn
Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn4658465PRTArtificial
sequenceSynthetic polypeptide 8Met Glu Pro Ser Ser Leu Glu Leu Pro Ala
Asp Thr Val Gln Arg Ile1 5 10
15Ala Ala Glu Leu Lys Cys His Pro Thr Asp Glu Arg Val Ala Leu His
20 25 30Leu Asp Glu Glu Asp Lys
Leu Arg His Phe Arg Glu Cys Phe Tyr Ile 35 40
45Pro Lys Ile Gln Asp Leu Pro Pro Val Asp Leu Ser Leu Val
Asn Lys 50 55 60Asp Glu Asn Ala Ile
Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65 70
75 80Lys Met Val Lys Thr Tyr Leu Glu Glu Glu
Leu Asp Lys Trp Ala Lys 85 90
95Ile Ala Ser Tyr Gly His Glu Val Gly Lys Arg Pro Trp Ile Thr Gly
100 105 110Asp Glu Ser Ile Val
Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu 115
120 125Lys Glu Ile Ala Leu Met Asn Gly Thr Thr Val Asn
Leu His Leu Leu 130 135 140Met Leu Ser
Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu Leu145
150 155 160Glu Ala Lys Ala Phe Pro Ser
Asp His Tyr Ala Ile Glu Ser Gln Leu 165
170 175Gln Leu His Gly Leu Asn Ile Glu Glu Ser Met Arg
Met Ile Lys Pro 180 185 190Arg
Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu Val Ile 195
200 205Glu Lys Glu Gly Asp Ser Ile Ala Val
Ile Leu Phe Ser Gly Val His 210 215
220Phe Tyr Thr Gly Gln His Phe Asn Ile Pro Ala Ile Thr Lys Ala Gly225
230 235 240Gln Ala Lys Gly
Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly 245
250 255Asn Val Glu Leu Tyr Leu His Asp Trp Gly
Val Asp Phe Ala Cys Trp 260 265
270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly Ile Ala Gly Ala
275 280 285Phe Ile His Glu Lys His Ala
His Thr Ile Lys Pro Ala Leu Val Gly 290 295
300Trp Leu Gly His Glu Leu Ser Thr Arg Phe Lys Met Asp Asn Lys
Leu305 310 315 320Gln Leu
Ile Pro Gly Val Cys Gly Phe Arg Ile Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys Ser Leu His
Ala Ser Leu Glu Ile Phe Lys Gln Ala 340 345
350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu Leu Thr Gly
Tyr Leu 355 360 365Glu Tyr Leu Ile
Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser His Val
Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Ile Thr Phe Ser Val Pro Asn Lys Asp Val Phe Gln
405 410 415Glu Leu Glu Lys Arg
Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn Ser Phe
His Asp Val Tyr 435 440 445Lys Phe
Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn46594719DNAEscherichia coli 9ccgacaccat
cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag
ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta
tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa
agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc
gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc
gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc
gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca
acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga
agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa
cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt
gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg
tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720cggaacggga
aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat
cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat
taccgagtcc gggctgcgcg ttggtgcgga tatctcagta gtgggatacg 900acgataccga
agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg
gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca
gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc
ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga
aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct
catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc
atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa
ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata
ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg
gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc
aacaagtggt acctaatgca ttgataaaac cgcgcgaagg tgaggagacc 1560ctgcggattg
aggacatcct ggaggtgatc gagaaggagg gcgacagtat cgcggtgata 1620cttttcagcg
gcgtgcattt ctacacgggc caacacttca atatcccggc cattaccaaa 1680gccggccagg
cgaaagggtg ctatgtaggc tttgatctgg cgcatgcagt gggcaacgtc 1740gaactgtatc
ttcatgattg gggcgttgat tttgcgtgct gccgcggatt acccgggctg 1800caggcaagct
tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt 1860acccaactta
atcgccttgc agcacatccc catttcgcca gctggcgtaa tagcgaagag 1920gcccgcaccg
atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcagcttggc 1980tgttttggcg
gatgagataa gattttcagc ctgatacaga ttaaatcaga acgcagaagc 2040ggtctgataa
aacagaattt gcctggcggc agtagcgcgg tggtcccacc tgaccccatg 2100ccgaactcag
aagtgaaacg ccgtagcgcc gatggtagtg tggggtctcc ccatgcgaga 2160gtagggaact
gccaggcatc aaataaaacg aaaggctcag tcgaaagact gggcctttcg 2220ttttatctgt
tgtttgtcgg tgaacgctct cctgagtagg acaaatccgc cgggagcgga 2280tttgaacgtt
gcgaagcaac ggcccggagg gtggcgggca ggacgcccgc cataaactgc 2340caggcatcaa
attaagcaga aggccatcct gacggatggc ctttttaacg tttacaattt 2400caggtggcac
ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac 2460attcaaatat
gtatccgctc atgtcgagac gttgggtgag gttccaactt tcaccataat 2520gaaataagat
cactaccggg cgtatttttt gagttatcga gattttcagg agctaaggaa 2580gctaaaatgg
agaaaaaaat cactggatat accaccgttg atatatccca atggcatcgt 2640aaagaacatt
ttgaggcatt tcagtcagtt gctcaatgta cctataacca gaccgttcag 2700ctggatatta
cggccttttt aaagaccgta aagaaaaata agcacaagtt ttatccggcc 2760tttattcaca
ttcttgcccg cctgatgaat gctcatccgg agttccgtat ggcaatgaaa 2820gacggtgagc
tggtgatatg ggatagtgtt cacccttgtt acaccgtttt ccatgagcaa 2880actgaaacgt
tttcatcgct ctggagtgaa taccacgacg atttccggca gtttctacac 2940atatattcgc
aagatgtggc gtgttacggt gaaaacctgg cctatttccc taaagggttt 3000attgagaata
tgtttttcgt ctcagccaat ccctgggtga gtttcaccag ttttgattta 3060aacgtggcca
atatggacaa cttcttcgcc cccgttttca ccatgggcaa atattatacg 3120caaggcgaca
aggtgctgat gccgctggcg attcaggttc atcatgccgt ttgtgatggc 3180ttccatgtcg
gcagaatgct taatgaatta caacagtact gcgatgagtg gcagggcggg 3240gcgtaatttt
tttaaggcag ttattggtgc ccttaaacgc ctggttgcta cgcctgaata 3300agtgataata
agcggatgaa tggcagaaat tcgaaagcaa attcgacccg gtcgtcggtt 3360cagggcaggg
tcgttaaata gccgcttatg tctattgctg gtttaccggt ttattgacta 3420ccggaagcag
tgtgaccgtg tgcttctcaa atgcctgagg ccagtttgct caggctctcc 3480ccgtggaggt
aataattaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 3540aaatccctta
acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 3600gatcttcttg
agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 3660cgctaccagc
ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 3720ctggcttcag
cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc 3780accacttcaa
gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 3840tggctgctgc
cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 3900cggataaggc
gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 3960gaacgaccta
caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 4020ccgaagggag
aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 4080cgagggagct
tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 4140tctgacttga
gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 4200ccagcaacgc
ggccttttta cggttcctgg ccagttaagc cagtatacac tccgctatcg 4260ctacgtgact
gggtcatggc tgcgccccga cacccgccaa cacccgctga cgcgccctga 4320cgggcttgtc
tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 4380atgtgtcaga
ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg gtaaagctca 4440tcagcgtggt
cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc cagctcgttg 4500agtttctcca
gaagcgttaa tgtctggctt ctgataaagc gggccatgtt aagggcggtt 4560ttttcctgtt
tggtcactga tgcctccgtg taagggggat ttctgttcat gggggtaatg 4620ataccgatga
aacgagagag gatgctcacg atacgggtta ctgatgatga acatgcccgg 4680ttactggaac
gttgtgaggg taaacaactg gcggtatgg
47191039DNAArtificial sequenceSynthetic primer 10taaacaactg gcggtatggc
cgacaccatc gaatggtgc 391150DNAArtificial
sequenceSynthetic primer 11gttttatcaa tgcattaggt accacttgtt ggtgaagtgc
tcgtgaaaac 501240DNAArtificial sequenceSynthetic primer
12gtgtatactg gcttaactgg ccaggaaccg taaaaaggcc
401352DNAArtificial sequenceSynthetic primer 13ataggccgaa atcggcaaaa
ggatctaggt gaagatcctt tttgataatc tc 521448DNAArtificial
sequenceSynthetic primer 14ctttttacgg ttcctggcca gttaagccag tatacactcc
gctatcgc 481542DNAArtificial sequenceSynthetic primer
15accattcgat ggtgtcggcc ataccgccag ttgtttaccc tc
421638DNAArtificial sequenceSynthetic primer 16tgccgcggat tacccgggct
gcaggcaagc ttggcact 381742DNAArtificial
sequenceSynthetic primer 17cacctgaaat tgtaaacgtt aaaaaggcca tccgtcagga tg
421847DNAArtificial sequenceSynthetic primer
18ctgacggatg gcctttttaa cgtttacaat ttcaggtggc acttttc
471946DNAArtificial sequenceSynthetic primer 19gatcttcacc tagatccttt
taattattac ctccacgggg agagcc 462037DNAArtificial
sequenceSynthetic primer 20gtggtaccta atgcattgat aaaaccgcgc gaaggtg
372138DNAArtificial sequenceSynthetic primer
21agcccgggta atccgcggca gcacgcaaaa tcaacgcc
3822465PRTArtificial sequenceSynthetic polypeptide 22Met Glu Pro Ser Ser
Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro Thr Asp Glu
Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr Ile
35 40 45Pro Lys Ile Gln Asp Leu Pro Pro
Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asn Ala Ile Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65
70 75 80Lys Met Val Lys Thr
Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys 85
90 95Ile Ala Ile Tyr Gly His Glu Val Gly Lys Arg
Pro Trp Ile Thr Ala 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu
115 120 125Lys Glu Ile Ala Leu Met Asn
Ala Leu Thr Val Asn Leu His Leu Leu 130 135
140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu
Leu145 150 155 160Glu Ala
Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu Asn Ile
Glu Glu Ser Met Arg Met Ile Lys Pro 180 185
190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu
Val Ile 195 200 205Glu Lys Glu Gly
Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Phe Tyr Thr Gly Gln His Phe Asn Ile Pro Ala Ile
Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu Tyr
Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly
Ile Ala Gly Ala 275 280 285Phe Ile
His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Tyr Gly His Glu Leu Ser Thr Arg Phe Lys
Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Ile Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys
Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu
Leu Thr Gly Tyr Leu 355 360 365Glu
Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser
His Val Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Leu Thr Phe Asn Val Pro Asn Lys Asp Val Phe
Gln 405 410 415Glu Leu Glu
Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn
Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn4652353DNAArtificial
sequenceSynthetic primer 23cactgtgtgg taccgaggta atacatgggc ggtcatcatc
accaccatca tgg 532450DNAArtificial sequenceSynthetic primer
24cgagtcagcc cgggtaatcc gcggctagtt tttggtttcc gcactgtcca
50251347DNAArtificial sequenceSynthetic oligonucleotide 25tctagaaata
attttgttta actttaagga aaacattaaa ataaggaggt agcaaatggg 60cggtcatcat
caccaccatc atgggagcgg caccacccgc aacgattgcc tggcgctgga 120tgcgcaggat
agcctggcac cgctgcgtca gcagtttgcg ctgccggaag gtgttattta 180tctggatggc
aacagcctgg gtgcgcgtcc ggttgcggcg ctggcgcgtg cgcaggcggt 240gattgcggaa
gaatggggca acggcctgat tcgcagctgg aacagcgcgg gctggcgcga 300tctgagcgaa
cgcctgggca accgcctggc gaccctgatt ggcgcgcgcg atggcgaagt 360ggtggtgacc
gataccacca gcattaacct gtttaaagtg ctgagcgcgg cgctgcgcgt 420gcaggcgacc
cgcagcccgg aacgccgcgt gattgtgacc gaaaccagca actttccgac 480cgatctgtat
attgcggaag gcctggcgga tatgctgcag cagggctata ccctgcgcct 540ggtggatagc
ccggaagaac tgccgcaggc gattgatcag gataccgcgg tggtgatgct 600gacccatgtg
aactataaaa ccggctatat gcatgatatg caggcgctga ccgcgctgag 660ccatgaatgc
ggcgcgctgg cgatttggga tctggcgcat agcgcgggcg cggtgccggt 720ggatctgcat
caggcgggcg cggattatgc gattggctgc acctataaat atctgaacgg 780cggcccgggc
agccaggcgt ttgtgtgggt gagcccgcag ctgtgcgatc tggtgccgca 840gccgctgtct
ggttggtttg gccatagccg ccagtttgcg atggaaccgc gctatgaacc 900gagcaacggc
attgcgcgct atctgtgcgg cacccagccg attaccagcc tggcgatggt 960ggaatgcggc
ctggatgtgt ttgcgcagac cgatatggcg agcctgcgcc gcaaaagcct 1020ggcgctgacc
gatctgttta ttgaactggt ggaacagcgc tgcgcggcgc atgaactgac 1080cctggtgacc
ccgcgcgaac atgcgaaacg cggcagccat gtgagctttg aacatccgga 1140aggctatgcg
gtgattcagg cgctgattga tcgcggcgtg attggcgatt atcgcgaacc 1200gcgcattatg
cgctttggct ttaccccgct gtataccacc tttaccgaag tgtgggatgc 1260ggtgcagatt
ctgggcgaaa ttctggatcg caaaacctgg gcgcaggcgc agtttcaggt 1320gcgccatagc
gtgacctagt aggatcc
134726465PRTArtificial sequenceSynthetic polypeptide 26Met Glu Pro Ser
Ser Leu Glu Leu Pro Ala Asp Thr Val Gln Arg Ile1 5
10 15Ala Ala Glu Leu Lys Cys His Pro Thr Asp
Glu Arg Val Ala Leu His 20 25
30Leu Asp Glu Glu Asp Lys Leu Arg His Phe Arg Glu Cys Phe Tyr Ile
35 40 45Pro Lys Ile Gln Asp Leu Pro Pro
Val Asp Leu Ser Leu Val Asn Lys 50 55
60Asp Glu Asn Ala Ile Tyr Phe Leu Gly Asn Ser Leu Gly Leu Gln Pro65
70 75 80Lys Met Val Lys Thr
Tyr Leu Glu Glu Glu Leu Asp Lys Trp Ala Lys 85
90 95Ile Ala Ser Tyr Gly His Glu Val Gly Lys Arg
Pro Trp Ile Thr Gly 100 105
110Asp Glu Ser Ile Val Gly Leu Met Lys Asp Ile Val Gly Ala Asn Glu
115 120 125Lys Glu Ile Ala Leu Met Asn
Ala Leu Thr Val Asn Leu His Leu Leu 130 135
140Met Leu Ser Phe Phe Lys Pro Thr Pro Lys Arg Tyr Lys Ile Leu
Leu145 150 155 160Glu Ala
Lys Ala Phe Pro Ser Asp His Tyr Ala Ile Glu Ser Gln Leu
165 170 175Gln Leu His Gly Leu Asn Ile
Glu Glu Ser Met Arg Met Ile Lys Pro 180 185
190Arg Glu Gly Glu Glu Thr Leu Arg Ile Glu Asp Ile Leu Glu
Val Ile 195 200 205Glu Lys Glu Gly
Asp Ser Ile Ala Val Ile Leu Phe Ser Gly Val His 210
215 220Phe Tyr Thr Gly Gln His Phe Asn Ile Pro Ala Ile
Thr Lys Ala Gly225 230 235
240Gln Ala Lys Gly Cys Tyr Val Gly Phe Asp Leu Ala His Ala Val Gly
245 250 255Asn Val Glu Leu Tyr
Leu His Asp Trp Gly Val Asp Phe Ala Cys Trp 260
265 270Cys Ser Tyr Lys Tyr Leu Asn Ala Gly Ala Gly Gly
Ile Ala Gly Ala 275 280 285Phe Ile
His Glu Lys His Ala His Thr Ile Lys Pro Ala Leu Val Gly 290
295 300Trp Leu Gly His Glu Leu Ser Thr Arg Phe Lys
Met Asp Asn Lys Leu305 310 315
320Gln Leu Ile Pro Gly Val Cys Gly Phe Arg Ile Ser Asn Pro Pro Ile
325 330 335Leu Leu Val Cys
Ser Leu His Ala Ser Leu Glu Ile Phe Lys Gln Ala 340
345 350Thr Met Lys Ala Leu Arg Lys Lys Ser Val Leu
Leu Thr Gly Tyr Leu 355 360 365Glu
Tyr Leu Ile Lys His Asn Tyr Gly Lys Asp Lys Ala Ala Thr Lys 370
375 380Lys Pro Val Val Asn Ile Ile Thr Pro Ser
His Val Glu Glu Arg Gly385 390 395
400Cys Gln Leu Thr Ile Thr Phe Ser Val Pro Asn Lys Asp Val Phe
Gln 405 410 415Glu Leu Glu
Lys Arg Gly Val Val Cys Asp Lys Arg Asn Pro Asn Gly 420
425 430Ile Arg Val Thr Pro Val Pro Leu Tyr Asn
Ser Phe His Asp Val Tyr 435 440
445Lys Phe Thr Asn Leu Leu Thr Ser Ile Leu Asp Ser Ala Glu Thr Lys 450
455 460Asn465271398DNAArtificial
sequenceSynthetic oligonucleotide 27atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagaa cgccatctac
ttcctgggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcgatctac 300ggccatgaag tcggcaagcg tccctggatt
accgctgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacgcgct gaccgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660agcggcgtgc atttctacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggtatgg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
aatagcaacc ccccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccaactga cgcttacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398281398DNAArtificial
sequenceSynthetic oligonucleotide 28atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagaa cgccatctac
ttcctgggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcgatctac 300ggccatgaag tcggcaagcg tccctggatt
accgctgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacgcgct gaccgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
gaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660agcggcgtgc atttctacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggtatgg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
attagcaacc ccccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140tcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccaactga cgcttacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398291398DNAArtificial
sequenceSynthetic oligonucleotide 29atggaaccga gctcccttga acttccggcc
gataccgtgc gacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg acgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagaa cgccatctac
ttcctgggta atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcgatctac 300ggccatgaag tcggcaagcg tccctggatt
accgctgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacgcgct gaccgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtataata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660agcggcgtgc atttctacac gggccaatac
ttcaatatcc cggccattac caaagctggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac atgcgcatac cattaaaccg 900gcgctggttg gctggtatgg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
aatagcaacc ccccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacta tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta tctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccaactga cgcttacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398301398DNAArtificial
sequenceSynthetic oligonucleotide 30atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagaa tgccatctat
ttcctgggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcggcctac 300ggccatgagg tcggcaagcg tccctggatt
accggcgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacgcctt atctgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660tctggcgtga attattacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggtgggg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
attagcaccc cgccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccagctga cgataacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398311398DNAArtificial
sequenceSynthetic oligonucleotide 31atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagga tgccatctat
ttcaatggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcggcctac 300ggccatcagg tcggcaagcg tccctggatt
accggcgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacgcctt aactgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660tctggcgtgc attattacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggtttgg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
gttagcaacc cgccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccagctga cgataacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398321398DNAArtificial
sequenceSynthetic oligonucleotide 32atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagga tgccatctat
ttcctgggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcggcctac 300ggccatgagg tcggcaagcg tccctggatt
accggcgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaactcctt atctgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660tctggcgtgc attattacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggtttgg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
attagcaacc cgccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccagctga cgataacgtt caacgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398331398DNAArtificial
sequenceSynthetic oligonucleotide 33atggaaccga gctcccttga acttccggcc
gataccgtgc aacggatagc ggcggaattg 60aaatgtcacc cgaccgacga acgcgtcgcg
ttacatctgg atgaggaaga caagctgcgt 120cacttccgcg agtgctttta cattccgaaa
attcaggatc tgccgccagt ggacttgagc 180ctggtcaaca aagacgagaa cgccatctac
ttcctgggca atagcctggg cctgcaacca 240aagatggtga aaacctatct tgaggaggag
cttgacaaat gggcgaagat cgcgagctac 300ggccatgaag tcggcaagcg tccctggatt
accggcgatg agtcaatcgt tggcttgatg 360aaggatatcg tcggcgcgaa cgagaaagaa
attgcgctga tgaacggcac gaccgtgaat 420ctgcatctgc tgatgctgtc attctttaag
cccaccccga agcgctacaa aatcctgctg 480gaagcgaaag cgtttcccag cgatcattat
gcgatagaaa gccagctgca actgcacggc 540ctgaatatcg aggagagcat gcgtatgata
aaaccgcgcg aaggtgagga gaccctgcgg 600attgaggaca tcctggaggt gatcgagaag
gagggcgaca gtatcgcggt gatacttttc 660agcggcgtgc atttctacac gggccaacac
ttcaatatcc cggccattac caaagccggc 720caggcgaaag ggtgctatgt aggctttgat
ctggcgcatg cagtgggcaa cgtcgaactg 780tatcttcatg attggggcgt tgattttgcg
tgctggtgca gctataagta tctgaatgcc 840ggggccggtg ggattgcggg agcctttatt
catgagaaac acgcgcatac cattaaaccg 900gcgctggttg gctggctggg gcacgaactg
agcacccgct tcaagatgga taacaaactg 960caattgattc cgggcgtgtg cggctttcgt
attagcaacc ccccgattct gctggtctgc 1020agcctgcacg cgtctctgga gattttcaag
caggcgacca tgaaagcgct gcgtaagaaa 1080agtgtgcttc tgacgggcta cctggagtac
ctgataaagc acaactacgg caaggataag 1140gcggccacga agaagccggt tgtgaacatt
atcaccccgt ctcatgtgga agaacgtggc 1200tgccaactga cgataacgtt cagcgtgcca
aacaaggacg tgttccaaga gctggagaag 1260cgtggcgtgg tgtgtgataa acgtaatccg
aatggcattc gtgtgacgcc tgtgccgctg 1320tacaacagct tccacgacgt gtataagttc
accaacctgc tgacgagcat tctggacagt 1380gcggaaacca aaaactag
1398341497DNAArtificial
sequenceSynthetic oligonucleotide 34tctagaaata attttgttta actttaagga
caaatcagga cacagttaag gaggtaaaat 60atgggcggtc atcatcacca ccatcatggg
agcggcgaac cgagctccct tgaacttccg 120gccgataccg tgcaacggat agcggcggaa
ttgaaatgtc acccgaccga cgaacgcgtc 180gcgttacatc tggatgagga agacaagctg
cgtcacttcc gcgagtgctt ttacattccg 240aaaattcagg atctgccgcc agtggacttg
agcctggtca acaaagacga gaacgccatc 300tacttcctgg gcaatagcct gggcctgcaa
ccaaagatgg tgaaaaccta tcttgaggag 360gagcttgaca aatgggcgaa gatcgcggcc
tacggccatg aagtcggcaa gcgtccctgg 420attaccggcg atgagtcaat cgttggcttg
atgaaggata tcgtcggcgc gaacgagaaa 480gaaattgcgc tgatgaacgc gctgaccgtg
aatctgcatc tgctgatgct gtcattcttt 540aagcccaccc cgaagcgcta caaaatcctg
ctggaagcga aagcgtttcc cagcgatcat 600tatgcgatag aaagccagct gcaactgcac
ggcctgaata tcgaggagag catgcgtatg 660ataaaaccgc gcgaaggtga ggagaccctg
cggattgagg acatcctgga ggtgatcgag 720aaggagggcg acagtatcgc ggtgatactt
ttcagcggcg tgcatttcta cacgggccaa 780cacttcaata tcccggccat taccaaagcc
ggccaggcga aagggtgcta tgtaggcttt 840gatctggcgc atgcagtggg caacgtcgaa
ctgtatcttc atgattgggg cgttgatttt 900gcgtgctggt gcagctataa gtatctgaat
gccggggccg gtgggattgc gggagccttt 960attcatgaga aacacgcgca taccattaaa
ccggcgctgg ttggctggtt tgggcacgaa 1020ctgagcaccc gcttcaagat ggataacaaa
ctgcaattga ttccgggcgt gtgcggcttt 1080cgtattagca accccccgat tctgctggtc
tgcagcctgc acgcgtctct ggagattttc 1140aagcaggcga ccatgaaagc gctgcgtaag
aaaagtgtgc ttctgacggg ctacctggag 1200tacctgataa agcacaacta cggcaaggat
aaggcggcca cgaagaagcc ggttgtgaac 1260attatcaccc cgtctcatgt ggaagaacgt
ggctgccaac tgacgataac gttcagcgtg 1320ccaaacaagg acgtgttcca agagctggag
aagcgtggcg tggtgtgtga taaacgtaat 1380ccgaatggca ttcgtgtggc gcctgtgccg
ctgtacaaca gcttccacga cgtgtataag 1440ttcaccaacc tgctgacgag cattctggac
agtgcggaaa ccaaaaacta gggatcc 1497
User Contributions:
Comment about this patent or add new information about this topic: