RECOMBINANT FUSION PROTEINS FOR PREVENTING OR TREATING ADHESIONS OF TISSUES OR ORGANS

Abstract

The invention relates to recombinant fusion proteins comprising a fibrinogenolytic enzyme having an amino acid sequence that is C-terminally and/or N-terminally linked to the amino acid sequence of at least one high-molecular inert stabilization domain with a molecular weight of >50 kDa, for the prevention or treatment of adhesions at tissues or organs, in particular peritoneal adhesions following surgical interventions.

Description

CROSS-REFERENCE RELATED TO APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. 120 to U.S. application Ser. No. 15/506,588, filed Feb. 24, 2017, which in turn claims benefit under 35 U.S.C. 119 to PCT/EP2015/069167 filed Aug. 20, 2015, which further claims benefit over German Application No. 102014112212.7 filed Aug. 26, 2014.

DESCRIPTION

[0002] Under normal healing conditions the mammalian organism responds to injury with specifically running wound healing processes. These result in the production of fibrin, a sticky substance, responsible for wound healing. Fibrinogen, the precursor of fibrin, circulates in the blood and occurs in the area of injury as wound fluid (exsudate). Due to the action of the locally formed thrombin, fibrinogen is converted to insoluble fibrin, so that the wound is sealed within a few minutes. Excess fibrin is removed rapidly by the simultaneously activated endogenous fibrinolytic system mediated by the action of plasmin.

TECHNICAL FIELD

[0003] Tissue agglutinations or adhesions are the result of misdirected wound healing processes, which is attributed to an imbalance of the endogenous fibrinolytic system (Hellebrekers et al, 2005; Hellebrekers & Kooistra, 2011). In accident- or surgery-related injuries in the abdominal area, the removal of fibrin is impaired by the activation of inhibitors of plasmin, in particular by PAI-1, PAI-2 and a.sub.2-anti plasmin. Excess fibrin that has not been removed results in an agglutination of adjacent tissues and organs, which are converted within a few days by the growth of fibroblasts and blood vessels into permanent adhesions (Arung et al., 2011). These adhesions can occur both between different organs and also between organs and the peritoneum. The resulting limited mobility of the organs is noticeable in many cases by chronic pain or, in female patients, by infertility and can, in severe cases, result in a life-threatening intestinal blockage caused by the impairment of peristalsis.

STATE OF THE ART

[0004] A retrospective analysis of the Scottish National Health Service Medical Record Linkage Database revealed that in more than half of all surgical procedures there are adhesions in the abdominal area (Ellis et al. 1999). In approximately one third of the patients with adhesions the clinical symptoms were so severe that they had to be re-operated in the first year after surgery. The high number of multiple operations shows that the risk of further adhesions increases significantly with the number of operations (Parker et al, 2001, 2005).

[0005] A meta-analysis of 196 studies with a total of 1,50,797 patients showed that up to 9% of abdominal surgery, an intestinal obstruction occurred as a serious complication (Broek et al., 2013a), wherein the adhesions were confirmed intra-operatively in emergency surgery in 2% of intestinal obstruction. In 6% of post-operations that were carried out to remove adhesions, serious consequential damages were caused to internal organs. Injuries to the intestine during surgical removal of adhesions represented the most important isolated risk factor (Brummer et al. 2011). The additional costs of time and material caused by the adhesions are considerable. With 138 hospitalisations for postoperative intestinal obstructions (Kassi et al. 2003) a total of 1118 inpatient days were required.

[0006] On the basis of data of "2005 Healthcare Cost and Utilization Project's Nationwide Inpatient Sample", Sikirica et al. (2011) calculated a total cost of $2.3 billion to remedy the adhesion-caused operational consequences. Of this amount, 1.4 billion USD accounted for primary adhesiolysis and 926 million USD for secondary adhesiolysis. The adhesion-caused cases of abdominal operations caused a total of 57,005 extra days in hospital. An analysis of sickness data on the basis of the US "National Hospital Discharge Database", 1994, showed that for subsequent removal of adhesions a total 846,415 additional hospital days were required, resulting in an additional cost of 1.3 billion USD annually (Ray et al., 1998).

[0007] These pharmaco-economic data support the need for and the potential benefits of an effective and safe adhesion prevention both for the individual patients and for the health care system. The only possible therapy of peritoneal adhesions is surgical separation of conjoined surfaces and organs. Due to the increased risk for the development of further adhesions by the renewed intervention, prophylactic methods that are likely to reduce the risk of the formation of adhesions, become particularly important.

[0008] As prophylactic methods for preventing agglutinations or adhesions, either the surgical technique can be optimized or mechanical methods for physical separation of the injured surfaces can be utilized. Finally, there are pharmacological approaches for influencing the underlying patho-physiological processes (summarized in Arung et al, (2011); Schnuriger et al, (2011)).

[0009] Due to the use of minimal invasive surgical techniques (laparoscopy), the risk of agglutinations and adhesions appears to be slightly lower in comparison to the conventional surgical technique with open abdomen (laparotomy) (Broek et al, 2013b; Schnuriger et al, 2011). The difference is probably due to the smaller wound surface in comparison to laparotomy, less manipulation of tissues and organs, as well as the generally lower risk of infection of this surgical technique (SCAR Group, 2013). Despite numerous improvements in surgical technique, the adhesions, as a result of surgical procedures in the abdominal area, still represent an unchanged high risk of complications, such as chronic pain, infertility or even intestinal obstruction (Wallwiener et al., 2014).

[0010] Another method currently used to reduce the risk of postoperative adhesions is the mechanical separation of the wounded tissue areas by the use of barriers of different biocompatible materials or by the instillation of a larger amount of fluid in the abdominal cavity. The most commonly used measure is the introduction of thin membranes of biodegradable materials, which are introduced between the wounded areas and fixed there. Due to the mechanical separation of organ surfaces, these can heal in an isolated way, which should lead to the prevention of adhesions. Compositions such as hyaluronic acid and carboxy-methylcellulose (Seprafilm) are placed, for example, as a membrane on the injured surface. Further, hyaluronic acid has been used to prevent adhesions in a myomectomy, resulting in a reduction of agglutinations (Fossum et al. 2011). Other known compositions are gel-forming polyethylene glycols, polyethylene oxide in combination with sodium carboxy-methylcellulose or oxygenated regenerated cellulose. Further examples of such adhesion barriers are described in the published patent application U.S. Pat. No. 8,629,314 A, and in the form of a novel multilayer adhesion barrier in US 20080254091 A

[0011] Some experimental approaches deal with the use of chemical substances with the aim of intervening in the patho-physiological process of adhesion formation at an early stage. This initial phase of adhesion, which only last a few hours is characterized by a persistent local inflammation and clot activation, followed by increased vascular permeability, resulting in an accumulation of a fibrin-rich exudate covering the surface (Hellebrekers and Kooistra 2011). Conditions such as tissue hypoxia (Saeed and Diamond 2004) and the cytokines-induced cellular immune reaction which is caused by macrophages and T cells are augmented factors for the formation of adhesions (Binnebosel et al. 2011). Already on the second day, the wound surface is covered by macrophages, fibroblasts and mesothelial cells, which come together in a short time to form a closed layer, penetrated by mast cells, fibroblasts and newly formed endothelial cells. This irreversible formation of a solid matrix is the basis for further coalescence, characterized by band-like collagen fibrils and growing-in of blood vessels and connective tissue fibres.

[0012] The central event in the formation of adhesions is thus the formation of a local fibrin from the precursor fibrinogen. Under normal conditions there is a balance between fibrin formation and fibrin reduction by plasmin, whose enzymatic activity is in turn controlled by the inhibitors PAI-1, PAI-2 and a 2-antiplasmin. Experimental data show that fibroblasts that occur in the area of adhesions, have a reduced concentration of plasminogen activator at elevated plasminogen activator-inhibitor formation, which supports the uncontrolled formation of a fibrin matrix (Diamond et al. 2004). This observation was confirmed in a prospective study of patients with endometriosis (Hellebrekers et al. 2005).

[0013] The inhibition of inflammatory reaction, the increase in fibrinolytic activity and the impact of the clotting thus seemed to be the useful therapeutic targets, in order to prevent the formation of adhesions. In numerous experiments, attempts were made to compensate for the lack of endogenous fibrinolytic activity by administering fibrinolytic active substances. EP 0318801 B1, U.S. Pat. No. 5,578,305A, EP 0297860B1 and EP 0227400B1 describe, for example, the use of rt-PA in hydroxyethyl cellulose hydrogel and other matrices to be effective in preventing adhesions. Even r-tPA modifications with increased fibrin affinity have been proposed for this application (EP 0517756B1). The inhibition of fibrin formation, as described in EP 087463461, by using thrombin inhibitors, represents another approach to prevent the adhesion at an early stage. EP 0473689B1 describes the use of plasminogen activators, such as urokinase, streptokinase and t-PA and refers to the short half-life period in blood. As a solution, the coupling of plasminogen activators to a fibrin fragment is suggested.

[0014] Due to repeated intraperitoneal administration of rt-PA, the formation of adhesions was reduced in a mouse model, wherein the effect was, however, not dose-dependent (Binda et al. 2009). In an adhesion model in rats, the plasminogen activator t-PA, urokinase or streptokinase was administered over 4 days using either a biodegradable hydrogel matrix or by 4.times.daily injections. The t-PA released from a matrix reduced the adhesion of 72.+-.15% (control) to 4.+-.3%, while intraperitoneal injections reduced adhesions only to 49.+-.8% (Hill-West et al. 1995). In summary, the results obtained with fibrinolytic substances are unsatisfactory.

[0015] Despite these negative experimental findings, rt-PA was tested in a prospective study of 26 patients with myomectomy under clinical conditions (Hellebrekers et al. 2009). A significant difference in the frequency of adhesions between the two groups could not be observed. The frequency and severity of adhesions were correlated with the PAI-1 concentrations measured before surgery and therefore refer to the importance of the fibrinolytic system for adhesion formation. However, for successful prevention, relatively high t-PA concentrations are required that have not been achieved in this study because of the short biological half-life of rt-PA. Thus, these substances are not suitable for a preventive or therapeutic use to prevent adhesions in tissue compartments after injuries of the abdominal area.

[0016] All previously used pharmacological methods for reducing the risk of adhesions generally proved to be rather ineffective in clinical trials.

[0017] In particular, the efficacy of fibrinolytic active substances was disappointing. This is presumably due to the fact that the fibrinolytic activity of exogenously administered fibrinolytic substances is inhibited by high concentrations of plasminogen-activator inhibitor (PAI-1, PAI-2) occurring during bonding. In order to achieve a sufficient efficacy of fibrinolytic substances, very high dosages are required, but due to the absorption of these substances through the peritoneal membrane they result in systemic side effects, particularly bleedings. The prevention that is free from side effects or early resolution of the resulting fibrin bridges as cause of adhesions is thus not guaranteed.

[0018] The removal of fibrinogen, the precursor of fibrin, seems thus more promising in order to inhibit its formation at an early stage. The suitability of fibrinogenolytic enzymes for the prevention of postoperative adhesions was experimentally studied on animals using isolated enzyme ancrod of the venom of the Malayan pit viper, Calloselasma rhodostoma (Ashby et al, 1969; Buckman et al, 1975; Chowdhury, & Hubbell, 1996). Ancrod specifically cuts the arginine-glycine bonding of Aa-chain of fibrinogen. Unlike thrombin, the BB-chain is not cut by ancrod. The resulting des-A-fibrin monomers polymerize after the splitting of fibrinopeptides to short chain soluble fibrin, which is not cross-linked and is rapidly eliminated by the reticuloendothelial system and plasmin. By intravenous or intraperitoneal administration of ancrod the fibrinogen concentration in the blood can be reduced in a controlled manner. In the studies as cited, this resulted in a near complete, dose-dependent inhibition of adhesion formation. Because of the low molecular weight of <40 kDa, ancrod can quickly escape from the abdominal area into the blood circulatory system, where it causes inhibition of clotting. In accordance with high blood concentration, this can result in local bleeding.

[0019] In addition, pharmaceutical compositions of a fusion protein of ancrod are known, which are used for resolving blood coagulation. For instance, EP 0395375 A1 describes a fusion protein between ancrod and a 5'-terminal polypeptide, which may include 2 to 1000 amino acids. The use of this fusion protein for the treatment of post-operative adhesions, however, is not described therein.

[0020] In a similar way acts batroxobin obtained from the venom of the South American snake Bothrops atrox, which likewise selectively splits fibrinogen, thereby reducing the concentration of fibrinogen. A fusion protein between batroxobin and a second polypeptide chain is described, for example, in WO 99/29838 A1.

[0021] For many years, ancrod was used, inter alia, to prevent thrombosis in patients with heparin-induced thrombocytopenia and for the treatment of peripheral arterial circulatory disturbances; however, it has since been replaced by newer drugs. However, these and similar enzymes are not suitable for the prophylaxis of peritoneal adhesions despite their good efficacy in animal models, because they do not remain sufficiently long in the abdominal area due to their molecular structure and because they quickly get into the bloodstream and thereby inhibit clotting. This side effect is prohibitive for the indication "Prophylaxis of postoperative adhesions", so that a native application of these substances is not considered for patients.

[0022] Further, there are other fibrinogenolytic fusion proteins which, however, have not been developed with the approach to a treatment of peritoneal adhesions. Such constructs are disclosed in U.S. Pat. No. 6,214,594 B1 or in Yang et al, Protein Expression and Purification, 66 (2009). 138-147.

[0023] In order to achieve a slow release of the active ingredients and a longer duration of action in peritoneal cavity, fibrinolytic and defibrinogenating substances were, for example, embedded in a carrier material (US 2004/224006 A1). The U.S. Pat. No. 8,629,314 B2 describes the implementation of different active substances into a polymer matrix for the prevention of adhesions. Similar experiments are also disclosed in U.S. Pat. No. 6,461,640 B1 and WO 1995/15747 A1. Here, a topically applied biodegradable polymer matrix is used as a carrier for plasminogen, urokinase and streptokinase, and ancrod. The success of these measures was low, probably mainly due to the uncontrolled release of the embedded active agents.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1 shows the enzyme activity in the fluid in the abdominal area after a single intra-peritoneal administration of native ancrod and ancrod fusion protein of the invention (AK03).

[0025] FIG. 2 shows the effect of ancrod and the ancrod-fusion protein of the invention (AK03) on fibrinogen concentration in blood plasma.

SUMMARY OF THE INVENTION

[0026] Against this background, it is the object of the present invention to reduce and prevent the local or systemic side effects associated with the known fibrinolytic or fibrinogenolytic substances, particularly in the form of bleeding or an inhibition of blood clotting, and to provide a pharmacologically active agent, which allows the prevention or reduction of post-operative adhesions. This object is solved by a recombinant fusion protein having the features of claim 1. Preferred embodiments can be found in the dependent claims.

[0027] The inventors have surprisingly found out that the undesirable properties of known fibrinogenolytic enzymes for the prophylaxis of post-operative adhesions, particularly in the peritoneal cavity, can be reduced or prevented by linkage to an inert stabilizing domain of high molecular weight. The inventive recombinant fusion proteins enable a preventive treatment of adhesions in tissues or organs, in particular peritoneal adhesions following surgery or injury. In the case of fusion protein, a fibrinogenolytic enzyme or enzyme fragment is linked to an inert stabilization domain of high molecular weight as biologically active domain, whereby a fusion protein arises, which represents a high molecular fibrinogenase with novel enzymatic and pharmacokinetic properties. By linking the fibrinogenolytic enzyme to the inert high molecular weight stabilization domain, the molecular weight is significantly increased and a non-specific bonding to mesothelium surface lining the peritoneal cavity is obtained. Surprisingly, the transport through the peritoneal membrane is reduced and also the transfer into the bloodstream. In addition, the residence time and thus action time of fibrinogenase is extended as recombinant active ingredient in the abdominal area, whereby the chance of successfully treating affected patients (e.g. human or animal) upon application is increased. Due to the longer residence time and action time, the necessary biologically active doses for fibrinogen removal can be drastically reduced, whereby the drawbacks, initially described for fibrinolytic or fibrinogenolytic active substances with reference to symptoms such as bleeding or preventing blood clotting, can be almost completely eliminated or at least significantly reduced.

[0028] Preferably, the inert stabilizing domain of high molecular weight relates to a protein a, polypeptide a or a peptide having a molecular weight of more than 50 kDa, preferably a molecular weight of more than 80 kDa. Preferred molecular weights of the stabilization domain, provided for linking to the enzyme domain, lie between 50 and 150 kDa, preferably between 50 and 100 kDa. The desired increased molecular weight of the stabilization domain can also be produced by dimerization or multimerization of the stabilization domain, for example, by dimerization of an IgG-Fc fragment of the human IgG1-Fe fragment. The coupling of the inert stabilization domain of high molecular weight to the fibrinogenolytic enzyme occurs either C-terminal and/or N-terminal. For maintaining the enzymatic activity, the structure of the enzyme domain must be considered here. Optionally, sufficiently long linker sequences must be inserted between the proteins. If a free N- or C-terminus is required for the enzymatic activity, the enzymatic activity in only one of the possible variants is maintained. This can be determined by the expert without undue burden according to known methods, for example, based on activity assays. In a preferred variant, a plurality of stabilization domains can be linked to the C-terminus or N-terminus of the enzyme domain in order to achieve this increase of molecular weight. Also a combination of different stabilization domains (for example, prepared as recombinant expression products) is possible. By linking the stabilization domain to the fibrinogenolytic enzyme, the fibrinogenolytic properties of the enzyme are preserved even in the fusion product, so that the resultant novel recombinant fusion protein is pharmacologically active while simultaneously avoiding the disadvantages mentioned.

[0029] A coupling of ancrod to the N-terminus of the stabilization domain has been found to be particularly effective. In particular, an extended residence time of the construct could be detected in the peritoneal cavity as compared to the native ancrod molecule.

[0030] The biologically active domain of the recombinant fusion protein causes the enzymatic removal of fibrinogen, thereby preventing the formation of fibrin, the precursor of adhesions. By coupling the enzyme to a stabilization domain based on proteins or peptides, a discharge of the biologically active enzyme components from the abdominal area in the blood circulatory system is reduced or prevented, whereby the effect on the local, excessive fibrin formation is limited and an undesirable prevention of blood coagulation is reduced or prevented. In doing so, bleeding can be prevented without compromising the healing of the surgical wound. Thanks to the increased residence time of the said construct, the residence time of the active substance is further increased so that the formation of adhesions is suppressed via the critical healing phase of 2 to 4 days. For these reasons, the recombinant fusion proteins of the invention are excellent candidates for therapeutic use because they cause little or no side effects compared to the substances tested to date, which is due to the low systemic availability. Further, the substances of the invention have a significantly better efficacy due to the long action duration, so that they are generally suitable for all therapeutic applications that require a long action duration of the active substances.

[0031] In a preferred embodiment, the domain encoding the fibrinogenolytic enzyme and the stabilization domain must be interlinked directly via their C-terminus or N-terminus. The coupling of the stabilization domain to the amino acid sequence of the fibrinogenolytic enzyme can be carried out, for example, by methods such as those described in US 2009/0175893A and US 2014/0017273A.

[0032] The biological activity of the recombinant fusion protein produced by linking a fibrinogenolytic enzyme to a stabilization domain can be optimized, however, by an additional linker which is arranged between the stabilization domain and enzyme domain. In a preferred embodiment, the inert stabilization domain is therefore connected via a variable linker to the fibrinogenolytic enzyme. The coupling of the linker takes place either via the C-terminus or the N-terminus of the stabilization domains or the enzymatically active domain. For attaching the linker, standard methods as known in prior art can be used.

[0033] The linker preferably relates to a peptide or polypeptide, whose amino acid sequence may have a different length or degree of branching. A preferred linker comprises, for example, repetitive sequences of glycine, alanine and serine residues. Preferably, the linker comprises a sequence (GGGGGS)x or (GGGGA)xR, where A=alanine; G=glycine; S=serine; R=arginine; x=number of repeats >1. The number of repetitions x in the linker sequence is preferably between 1 and 4. The linker increases the spherical distance between the fibrinogenolytic enzyme and the inert stabilization domain of the recombinant fusion protein according to the invention.

[0034] In addition to the peptide linkers as mentioned above, well-known chemical linkers according to the present invention can be used for linking both domains, whereby their structure and length can be modified within the usual methodology for the orientation of both domains to gain an optimized expression and enzymatic activity of the fusion protein. The constructs of the invention are verified for their biological activity in one of the known assays after their production, in which the fibrinogenolytic enzyme activity of the fusion proteins is determined. More particularly, the invention comprises fusion proteins that are sufficiently fibrinogenolytically active. In order to optimize the biological activity, it may be necessary to adjust the type and position of the coupling, the structure and length of the linker as well as the type and the structure of the stabilizing domain. In particular, a steric obstruction of the stabilization domain affects the enzyme activity adversely, but this can be easily determined by a person skilled in the art using the available means in vitro.

[0035] The recombinant fusion proteins of high molecular weight of the present invention thus represent highly effective fibrinogenases, which can be cloned using standard methods and can be expressed in suitable expression systems. Because of the relatively high molecular weight of the constructs and their complex structure, which comprise disulfide bridges, eukaryotic expression systems are preferred.

[0036] As used herein, the term "fibrinogenolytic enzyme" comprises enzymes, active enzyme fragments or enzymatically active substances, which have a fibrinogenase activity and cause or promote the degradation of fibrinogen. Preferably, the fibrinogenolytic enzyme of the fibrinogenase domain relates to a serine protease, preferably a thrombin-like serine protease. Preferred fibrinogenolytic enzymes are, for example, the enzymes ancrod or batroxobin, isolated from snake venoms. These enzymes have been proven to be very suitable for coupling with the high-molecular inert stabilization domain, since they largely retain their activity in the recombinant fusion protein of the invention. Besides, there are other suitable candidates, such as thrombin-like proteases and recombinant versions thereof isolated from snake venoms. In particular, recombinant forms or variants of the enzymes ancrod or batroxobin are suitable as fibrinogenase domain of the recombinant fusion protein.

[0037] The high molecular inert stabilization domain preferably relates to serum albumin, preferably animal or human serum albumin. In another variant, the inert stabilization domain of high molecular weight includes transferrin or variants of transferrin inactivated by genetic modifications. In another variant, the high-molecular inert stabilization domain comprises artificial amino acid sequences, such as PAS (Schlapschy et. al 2013) or XTEN (US 2013/0165389 A1). Further, antibodies or antibody fragments can be linked as a stabilization domain with the fibrinogenolytic enzyme. For prophylactic or therapeutic application in humans, monoclonal antibodies, humanized antibodies or antibody fragments thereof are preferably used as antibodies. Furthermore, variants of the aforementioned stabilization domains can also be used for the purpose according to the present invention. Other embodiments also provide for the use of synthetic domains or other inert protein domains, insofar as they are described in the prior art.

[0038] In a preferred embodiment the fusion protein comprises an amino acid sequence that comprises the enzyme ancrod and a stabilizing domain (e.g. serum albumin or IgG-Fc antibody fragment). Preferably, the fusion protein comprises an amino acid sequence or fibrinogenolytically effective fragments of this sequence, such as recited in SEQ ID NO. 2 or SEQ ID NO. 4. Fibrinogenolytically effective fragments of this sequence refer to sequence segments coding for the enzyme domain and the stabilizing domain and that are enzymatically active in the degradation of fibrinogen. In the concrete examples, e.g. a hexahistidine-tag (His-tag) was added to the fibrinogenolytic components for ease of purification and a signal peptide. Further, additional or alternative amino acids may be added to or removed from the sequences above.

[0039] The fusion proteins of the present invention are fibrinogenolytically highly effective and lead to a specific degradation of fibrinogen. As a secondary effect, a fibrinolytic effect can be detected when applied in organism, since the degradation products of the enzyme, desA-profibrin and desAA-fibrin monomers, form soluble fibrin complexes, which in turn lead to plasminogen activation through the stimulation of endogenous t-PA. This effect can be measured in vivi as an increase in plasmin concentration following application of the enzyme. This effect provides a further advantage, as high concentrations of plasminogen activator inhibitor (PAI-1) in case of injuries would lead to the failure of natural fibrin degradation and to adhesion.

[0040] By the C-terminal coupling of ancrod or another fibrinogenolytically active protein to a stabilization domain, for example to serum albumin or IgG-Fc antibody fragment, the residence time of the construct will be extended significantly in the peritoneal cavity compared to the native fibrinogenolytically active enzyme. The construct can, in this way, exhibit a much longer duration of action as it would be the case with a native ancrod molecule. By retaining the construct in the peritoneal cavity, the passage of the active substance in the bloodstream has been significantly reduced.

[0041] The present invention further relates to a pharmaceutical composition comprising a recombinant fusion protein as described above. The pharmaceutical composition comprises a pharmaceutically acceptable carrier, and can be applied as a solution directly into the affected wound area, such as the abdominal area. Thereby, the active substance prevents the formation of adhesions throughout the compartment, especially where injuries may have possibly occurred. Due to the high molecular weight, the recombinant fusion protein remains as active substance for a longer period of time in the peritoneal cavity and does not or only to a small extent enter into the blood circulation system. Thereby, systemic effects and side effects of natural substances (for example, of ancrod or batroxobin) are prevented or reduced. The active substance can be applied during or after the surgery in the peritoneal cavity once or more times. A single application is preferred so that further injections or infusions are not absolutely necessary. This advantage is due to the longer residence time of the recombinant construct into the abdominal area compared to the natural substances.

[0042] In a preferred embodiment, the recombinant fusion protein of the invention can be used in combination with other treatments or products. For example, a combination of the fusion protein with physical barrier methods of solid or liquid membranes, gels or sprays is conceivable. Preferably, these are biodegradable.

[0043] By the application of species-specific domains as a stabilizing domain (for example, human serum albumin (HSA) or a human IgG-Fc antibody fragment), the inventive recombinant fusion protein has a low immunogenicity and does not have an own pharmacodynamic effect.

[0044] Due to the high molecular weight of preferably >50 kDa, a long biological durability is also guaranteed.

[0045] In order to develop an optimum prophylactic efficacy with the pharmaceutical composition of the invention, the fibrinogenolytic activity must be present throughout the entire period of wound healing. Preferably, the recombinant fusion protein is present at the site of action in an effective concentration. The time required for complete wound healing is between 1-8 days; for the prophylactic treatment, a period of 2 to 4 days is preferred. The enzymatic activity of the pharmaceutically effective solution, administered in the abdominal area, which is required for preventive or therapeutic efficacy, lies in the range between 0.01 and 10 units/ml over the entire period of wound healing. Preferably, concentrations of the fusion protein are used that are between 0.1 to 5 units/ml (units/ml). Preferably, the recombinant fusion protein will be used in an osmotically active medium (e.g. ico-dextrin solution).

[0046] The present invention further relates to a combined use of the fusion protein with other products, for the prevention of tissue adhesions (adhesions), particularly after surgery. For this purpose, membranes are used, which are made of oxidized regenerated cellulose, polytetrafluoroethylene, hyaluronic acid carboxy methyl cellulose or polyethylene glycol. Further, liquid adhesion barriers can be used, which separate the organs and tissues by hydroflotation. Preferably, hyaluronic acid, cross-linked hyaluronic acid or ico-dextrin is used.

[0047] The recombinant fusion protein of the invention is preferably embedded in a biocompatible, biodegradable matrix, which continuously releases the fusion protein during the initial healing phase, preferably, over a period of 2 to 4 days.

Ways of Implementing the Invention

[0048] The invention is illustrated in the following examples.

EXAMPLES

Example 1

[0049] Preparation of N-Ancrod-Fc-Fusion Protein

[0050] For the production of the composition of the invention a fusion protein was prepared, consisting of ancrod and the constant region of a human IgG1 antibody. Between the biologically active ancrod domain and the stabilizing domain formed by the IgG1-Fc antibody fragment, a glycine-alanine-linker is inserted. In order to improve secretion into the cell culture medium and to facilitate purification, the signal peptide of human serum albumin was added at the N-terminus. For the production, the sequence of ancrod protein (access number: ABN13428.1) was added at its C-terminus to the constant region of a human IgG1 (Uniprot ace.no. P01857-1, amino acids 104-330) via a flexible glycine-alanine linker. Subsequently, the HSA-signal peptide (amino acids 1 to 18), required for the purification was added. For the synthesis of cDNA coding for the fusion protein, the DNA codons were optimized for expression in human cells. At the 5' end of cDNA, restriction sites for NatI and XbaI were added, and at the 3' end, restriction sites for BstXI and HindiII, which allows the cloning of DNA into the appropriate vectors fora transient expression and/or for the production of stable cell lines. The resulting cDNA construct was produced synthetically.

[0051] This cDNA was cloned, amplified, and recloned into an expression vector for transient transfection. The correct insertion of cDNA was tested via a restriction digest. With the resulting plasmid, E. coli bacteria (DH5a) were then transformed and the strain was cultured in 0.8 litre of LB medium. From this, the plasmid DNA was isolated and the endotoxin solution was filtered sterile.

[0052] For transient expression of the protein, HEK-F cells were set up in serum-free suspension culture in a volume of 500 ml in shake flasks (approximately 2.5.times.10.sup.6 cells/ml). Transfection of cells was carried out via a branched PEG-amino ester copolymer with a transfection mixture of about 10 .mu.g DNA/1.times.10.sup.7 cells-DNA/coPEG33-1/6 (w/w). After the addition of valproic acid, the cell culture was cultivated for a further 7 days. Thereafter, the cell culture supernatant was harvested by centrifugation. Chromatography was performed in 50 mM MES buffer, pH 5.5.

[0053] The purification of the fusion protein was carried out by ion exchange chromatography. HiTrap SP FF Affinity Resin (GE Healthcare Europe GmbH, Freiburg, Germany) was used as column material. The elution of fusion protein was carried out by a sodium chloride gradient. Analysis of the eluate fractions was carried out by gel electrophoresis (SDS-PAGE) and suitable protein fractions were pooled and dialyzed, aliquoted and stored until further use at -20 C..degree. against buffered saline (PBS).

[0054] The cDNA sequence of the construct is shown in SEQ ID NO 1:

[0055] Underlined are the inserted restriction sites.--The sequence encoding the fusion protein is shown in bold.

TABLE-US-00001 gcggccgccaccatgaaatgggtcacctttatctcccttctgttcctctt tagtagcgcctattctgtcatcggtggtgacgagtgcaatatcaacgagc atcgatttctggtggcagtgtatgaaggaaccaactggacctttatctgc ggcggggtccttattcacccagagtgggtcattaccgccgaacactgtgc tcggcgtcgaatgaatcttgtgttcgggatgcacaggaaatcagagaagt ttgatgacgaacaggaacggtatcccaagaagcggtacttcattcgatgc aacaaaacccggactagctgggatgaggacatcatgctgattcggctgaa caagcccgtgaataacagcgagcatattgctcctttgtcactgccttcca atccgcctattgtgggtagtgactgccgtgtgatgggctggggtagcatt aacagaaggatccacgtgcttagcgatgaacccagatgtgccaacatcaa tctccacaacttcaccatgtgtcatgggttgttccgcaagatgcctaaga agggacgcgtactctgtgctggcgatctgcgcggtagacgggactcttgc aattcagatagtggaggaccccttatctgcaacgaagagctgcatggcat tgtggccagaggccccaatccatgtgcacagcccaacaaaccagctctgt atactagcgtgtacgactacagggattgggtgaacaacgttatcgccggc aatgcaacctgtagtccaggcggcggcggagccggtggaggcggggcagg aggaggaggagctagagacaaaacacacacttgtccaccctgtcctgctc ccgaactgcttggtggacccagcgtgtttctgtttccgcctaagcccaaa gacaccctcatgatctcacggactcccgaagttacgtgtgtcgtagtaga cgtgtcacacgaagatcccgaggtcaagttcaactggtatgtggacggag ttgaggttcacaacgccaaaaccaaaccgagagaggagcagtacaactcc acatatagggtggtaagcgtgttgaccgtgctgcatcaggattggctgaa tggcaaagagtacaagtgcaaggtgtccaataaggctcttccagcaccca ttgagaaaacgatctccaaggcgaaaggccaacctcgtgaacctcaggtg tatactctccctccaagtcgcgatgagctcaccaagaaccaggtgtcttt gacatgcctcgtcaaagggttctacccatcagacatagccgtcgaatggg agtctaatggccaaccagagaataactacaagaccactcctccggttctg gatagtgatgggagcttctttctgtacagcaagctgacagtcgacaagtc ccgatggcagcagggtaatgtgttcagttgctctgtgatgcatgaagccc tgcataaccactatacccagaaaagcctgtctctgagcccaggaaagtaa tagaagctt

[0056] The resulting amino acid sequence is shown in SEQ ID NO 2:

TABLE-US-00002 MKWVTFISLL FLFSSAYSVI GGDECNINEH RFLVAVYEGT NWTFICGGVL 50 IHPEWVITAE HCARRRMNLV FGMHRKSEKF DDEQERYPKK RYFIRCNKTR 100 TSWDEDIMLI RLNKPVNNSE HIAPLSLPSN PPIVGSDCRV MGWGSINRRI 150 HVLSDEPRCA NINLHNFTMC HGLFRKMPKK GRVLCAGDLR GRRDSCNSDS 200 GGPLICNEEL HGIVARGPNP CAQPNKPALY TSVYDYRDWV NNVIAGNATC 250 SPGGGGAGGG GAGGGGARDK THTCPPCPAP ELLGGPSVFL FPPKPKDTLM 300 ISRTPEVTCV WDVSHEDPE VKFNWYVDGV EVHNAKTKPR EEQYNSTYRV 350 VSVLTVLHQD WLNGKEYKCK VSNKALPAPI EKTISKAKGQ PREPQVYTLP 400 PSRDELTKNQ VSLTCLVKGF YPSDIAVEWE SNGQPENNYK TTPPVLDSDG 450 SFFLYSKLTV DKSRWQQGNV FSCSVMHEAL HNHYTQKSLS LSPGK 495

[0057] The amino acid sequence starts with the signal peptide of human serum albumin MKVVVTFISLLFLFSSAYS shown (underlined), which is separated during secretion of the protein from the cell. The linker GGGGAGGGGAGGGGAR, arranged between the human serum albumin and the ancrod-domain, is connected to the C-terminus of ancrod (shown in bold).

Example 2

[0058] Preparation of N-Ancrod-HSA-C Fusion Protein with His-Tag.

[0059] In this example, a further variant of an ancrod-based fusion protein is shown, consisting of ancrod, human serum albumin (HSA), a signal peptide of human serum albumin and a subsequent His-Tag. Between the biologically active domain and the stabilization domain formed by the human serum albumin, a glycine-/serin-linker is inserted. For the production, the sequence of ancrod protein (accession number: ABN13428.1) is merged C-terminally with the N-terminus of human serum albumin (HSA) (accession number: P02768, amino acids 25-609). Subsequently, the HSA signal peptide (amino acids 1 to 18) was added. The cDNA was processed as described above and the protein was expressed.

[0060] The cDNA sequence of the construct is shown in SEQ ID NO 3:

TABLE-US-00003 gcggccgctctagagccaccatgaaatgggttaccttcattagcctcctg ttcctgttttcctccgcctattctgttatcggtggtgacgagtgtaacat caacgagcataggttcctggtcgcagtgtatgagggcacaaactggacct tcatttgtggcggggtgctgattcacccagagtgggtaataacagcggag cattgtgcccgcagacgcatgaatctcgtgtttggaatgcatcgcaaaag cgagaaattcgatgatgaacaagaaaggtaccctaagaagcggtacttca ttcggtgcaacaagacaagaacttcatgggacgaggacatcatgctgatc cgtcttaacaagccggtaaataacagcgagcatatcgcaccactctcatt gcccagcaaccctcccatcgtgggaagcgattgcagagtgatggggtggg gctccatcaatagaaggattcacgtgctctctgatgaaccgcggtgtgcc aacattaatctgcataattttactatgtgccatggtctgtttcgcaaaat gcccaagaaaggaagagttctgtgtgcaggcgatctgagaggaaggagag actcttgcaactccgatagtggcgggccactgatatgcaacgaagagctt cacggaatcgtggccagaggtcctaatccatgtgctcagcctaacaagcc cgctctgtacaccagcgtttatgactaccgggattgggtcaacaatgtca ttgccggaaatgccacctgttcccctggcggcggcgggtcaggaggagga gggtctggtggcggcgggtctgacgcacataaaagcgaagtggctcaccg gtttaaagatctcggcgaagagaacttcaaagctcttgtattgattgcct tcgctcagtacttgcaacagtgccctttcgaggaccacgtgaaactggtg aatgaagtcacagaattcgctaagacgtgtgtggcggatgagagtgctga gaactgtgacaagagtctgcacaccctgtttggggataaactgtgcactg tcgctactctgcgagaaacttatggcgaaatggccgactgctgcgccaag caggaacccgagagaaatgaatgctttctgcagcacaaagacgacaaccc taatctgccacgattggttcggcccgaggtggacgtaatgtgcacggctt tccacgacaatgaggaaaccttcctgaagaagtatctctacgaaatagct cgacggcatccctacttttatgcacccgagctgctgttctttgcgaagcg ctataaggccgctttcacagaatgctgtcaagctgccgacaaggctgcct gtctcctcccaaaactggacgagctccgcgatgaggggaaggcaagcagt gccaaacagcgcctgaaatgcgcatcacttcagaaattcggagagcgcgc attcaaagcatgggcagtggctcgattgtcccagcgatttcctaaggctg aatttgccgaagtgtcaaagctggtgacagaccttaccaaagtccacaca gaatgctgccatggtgacttgctggagtgcgccgatgacagagccgatct ggccaagtacatctgtgaaaatcaggattccatctcctccaaactgaaag aatgctgcgagaaacccctgctggagaagagccattgtattgctgaggtg gaaaacgatgagatgccagcggacctcccatcactggcagccgacttcgt cgagagtaaggacgtgtgtaagaactacgccgaagcgaaggatgtgtttc tcgggatgtttctgtacgaatatgcgcgtcgtcatcccgattatagcgtg gttctgctgcttaggcttgccaagacttacgaaaccaccctcgagaagtg ttgtgccgccgctgacccgcatgagtgctacgccaaagtatttgacgagt ttaagcctctggtcgaggagcctcagaacctgatcaaacagaactgcgag cttttcgagcagttgggtgaatacaaatttcagaatgccctgctcgtcag gtatactaagaaggtgccccaagtgtctacacctaccttggttgaggtca gccggaatctcggcaaggtcggcagcaaatgctgtaagcacccagaggca aagcgtatgccatgtgcagaggattatctgagtgtcgtcctcaaccagct gtgcgtacttcacgaaaagacaccagtgtccgatagggtcactaaatgtt gcaccgaatctctggtgaatcggaggccctgtttctcagctctggaagtt gatgaaacctacgttccgaaggagttcaatgcagaaacgtttacctttca cgctgacatctgcacgctctctgagaaggagaggcagataaagaagcaaa cagccctggtagagctggttaaacacaagcccaaagcaacaaaggagcag ctgaaagcggtgatggatgacttcgccgcgtttgtggagaagtgctgtaa ggccgacgataaagaaacttgcttcgccgaagagggaaagaagcttgtgg cagctagccaagcagcccttgggttgcaccaccatcaccaccactaatag ccactgtgctggttcgaa

[0061] Underlined are the inserted restriction sites (5': NatI, XbaI; 3': BstXI, HindIII)--in bold, the sequence encoding the fusion protein sequence is shown in bold.

[0062] The resulting amino acid sequence is shown in SEQ ID No 4:

TABLE-US-00004 MKWVTFISLL FLFSSAYSVI GGDECNINEH RFLVAVYEGT NWTFICGGVL IHPEWVITAE 60 HCARRRMNLV FGMHRKSEKF DDEQERYPKK RYFIRCNKTR TSWDEDIMLI RLNKPVNNSE 120 HIAPLSLPSN PPIVGSDCRV MGWGSINRRI HVLSDEPRCA NINLHNFTMC HGLFRKMPKK 180 GRVLCAGDLR GRRDSCNSDS GGPLICNEEL HGIVARGPNP CAQPNKPALY TSVYDYRDWV 240 NNVIAGNATC SPGGGGSGGG GSGGGGSDAH KSEVAHRFKD LGEENFKALV LIAFAQYLQQ 300 CPFEDHVKLV NEVTEFAKTC VADESAENCD KSLHTLFGDK LCTVATLRET YGEMADCCAK 360 QEPERNECFL QHKDDNPNLP RLVRPEVDVM CTAFHDNEET FLKKYLYEIA RRHPYFYAPE 420 LLFFAKRYKA AFTECCQAAD KAACLLPKLD ELRDEGKASS AKQRLKCASL QKFGERAFKA 480 WAVARLSQRF PKAEFAEVSK LVTDLTKVHT ECCHGDLLEC ADDRADLAKY ICENQDSISS 540 KLKECCEKPL LEKSHCIAEV ENDEMPADLP SLAADFVESK DVCKNYAEAK DVFLGMFLYE 600 YARRHPDYSV VLLLRLAKTY ETTLEKCCAA ADPHECYAKV FDEFKPLVEE PQNLIKQNCE 660 LFEQLGEYKF QNALLVRYTK KVPQVSTPTL VEVSRNLGKV GSKCCKHPEA KRMPCAEDYL 720 SWLNQLCVL HEKTPVSDRV TKCCTESLVN RRPCFSALEV DETYVPKEFN AETFTFHADI 780 CTLSEKERQI KKQTALVELV KHKPKATKEQ LKAVMDDFAA FVEKCCKADD KETCFAEEGK 840 KLVAASQAAL GLHHHHHH 858

[0063] The amino acid sequence starts with the signal peptide of human serum albumin MKVVVTFISLLFLFSSAYS, which is separated during secretion of the protein from the cell. The linker GGGGSGGGGSGGGGS, arranged between the human serum albumin and the ancrod-domain, is connected to the N-terminus of serum albumin (shown in bold).

Example 3

[0064] Activity Test of the Produced Fusion Proteins for their Fibrinogenolytic Enzyme Activity

[0065] The activity test of the fusion protein was performed using fibrinogen as substrate (1 mg/ml) dissolved in 10 mM Tris-HCl, 0.15 M NaCl, pH 7.4. Each 500 .mu.l of fibrinogen solution were pipetted into a cuvette. After 2 minutes, 100 .mu.l sample or a positive control (batroxobin) was added. Thereafter, the increase in turbidity at 340 nm was determined by photometry over a period of one hour and the maximum slope of the curve was ascertained. The maximum slope of the curve is proportional to the enzymatic activity, which is converted into units/ml using a calibration curve.

Example 4

[0066] Treatment of Peritoneal Adhesions in Mammals

[0067] For preventive or therapeutic application in a mammal (e.g., a human or a laboratory animal), the recombinant fusion protein of the invention isolated and purified following expression, or a matching placebo was applied directly into the abdominal area of the test animal post surgery that triggered adhesions. To achieve an optimum effect, an enzymatic activity of between 0.01 and 10 U/ml is desired. The pharmaceutical solution comprises the fusion protein having an activity between 0.1 and 5 U/ml.

[0068] After administering the fusion protein, a fibrinolytic enzyme activity of the fusion protein that continues over several days can be detected while simultaneously maintaining the wound healing. Compared to placebo-treated animals, the amount and severity of adhesions occurring as part of the wound healing process will be drastically reduced.

Example 5

[0069] Pharmacological and Pharmacokinetic Properties of N-Ancrod-HSA-C Fusion Proteins

[0070] For the production of the fusion protein, the sequence of ancrod protein (accession number: ABN13428.1) was merged C-terminally with the N-terminus of human serum albumin (HSA) (accession number: P02768, amino acids 25-609). The enzymatic activity of the fusion protein is 24 U/ml.

[0071] Since native ancrod is unsuitable in a therapeutic application for the treatment of peritoneal adhesions, the resulting fusion protein was tested on its activity and disposition (residence time) in the abdominal area. FIG. 1 shows the enzyme activity in the fluid in the abdominal area after a single intra-peritoneal administration of native ancrod and ancrod fusion protein of the invention (AK03). It can be clearly seen that the native ancrod is unsuitable for therapeutic use because the intraperitoneally administered ancrod quickly leaves the abdominal area and thus only low concentrations are obtained, which additionally also fall within 6 hours to values close to the detection limit. In contrast, after administering a comparable dose of ancrod-fusion protein (AK03), significantly higher activity is achieved in the abdominal area, which still lies well within the therapeutically effective range, even after 6 hours.

[0072] In FIG. 2, the effect of ancrod and the ancrod-fusion protein of the invention (AK03) on fibrinogen concentration in blood plasma is shown. The rapid passage of ancrod in the vascular system results here in a drop in the fibrinogen level in blood by more than 50%. AK03 migrates only very slowly into the bloodstream due to the changed molecular structure, and therefore results in a slight drop in fibrinogen level of 14%. Such small changes in fibrinogen concentrations fall within the physiological range and have no effect on blood clotting.

[0073] The ancrod fusion protein AK03 equipped with the stabilization domain thus shows a much more favourable pharmacokinetic behaviour than the native ancrod molecule.

[0074] These results show that the ancrod fusion protein exhibits similar enzymatic features as ancrod, but it is pharmacokinetically distinctly different. In particular, this leads to a longer residence time of the fusion protein in the peritoneal cavity and a lower passage of the substance into the bloodstream. Due to these properties, the fusion protein of the invention is particularly suitable for intraperitoneal application for the treatment/prevention of peritoneal adhesions.

[0075] Materials and Methods

[0076] Pharmacokinetics in Dogs

[0077] Three Beagle dogs were provided with venous and intraperitoneal indwelling catheters. A week after catheter implantation, animals received one single intraperitoneal injection of the test substance. 0.5 ml of samples of peritoneal fluid were taken at intervals of 0, 0.5; 1, 2, 4, 6, and 8 hours after administration of the substance; venous blood samples were taken for extracting citrated plasma at the time-points of 0, 0.5; 1, 2, 4, 6, 8, 16 and 24 hours. The fibrinogen concentration in the plasma samples was determined photometrically by the method according to Clauss. The enzyme activity in peritoneal fluid was determined by centrifugation of the samples using a kinetic turbidimetric method following addition of human fibrinogen.

[0078] Pharmacokinetics in Rats:

[0079] Sprague-Dawley rats received intraperitoneal injections of the test substance in a short inhalation anaesthesia. Simultaneously, a venous blood sample was taken. Thereafter, the animals were returned to the cage where they awoke after a short time. Six hours after administrating the substance, the animals were anesthetized again and the peritoneal fluid and a further blood sample were withdrawn for extracting citrate plasma. Both samples were immediately centrifuged after collection and snap frozen at -80.degree. C. and analyzed at a later time with the methods described above.

BIBLIOGRAPHY

[0080] Arung, W.; Meurisse, M.; Detry, O. (2011): Pathophysiology and prevention of postoperative peritoneal adhesions. In: World J Gastroenterol 17 (41), pp 4545-4553.

[0081] Ashby, E. C; James, D. C; Ellis, H. (1970): The effect of intraperitoneal Malayan pit viper venom-on adhesion formation and peritoneal healing. In: Br J Surg 57 (1 1), S. 863 ad.

[0082] Binda, M M; Hellebrekers, B W; Declerck, P J; Koninckx, P R (2009): Effect of Reteplase and PAI-1 antibodies on postoperative adhesion formation in a laparoscopic mouse model. In: Surgical Endoscopy 23 (5), pp 1018-1025.

[0083] Binnebosel, M.; Klink, C; Serna, J.; Jansen, P.; Trotha, K. of; Neumann, U.; Young, K. (2011): Chronological evaluation of inflammatory mediators during peritoneal adhesion formation using a rat model. In: Langenbeck's Archives of Surgery 396 (3), pp 371-378.

[0084] Broek, R. P. G. ten; Issa, Y.; van Santbrink, E J P; Bouvy, N. D.; Kruitwagen, R. F. P. M.; Jeekel, J. et al. (2013A): Burden of adhesions in abdominal and pelvic surgery: systematic review and met-analysis. In: BMJ 347, pf5588.

[0085] Broek, R P G ten; Kok-Krant, N.; Bakkum, E A; Bleichrodt, R P; van Goar, H. (2013B): Different surgical techniques to reduce post-operative adhesion formation: a systematic review and meta-analysis. In: Hum Reprod Update 19 (1), pp 12-25.

[0086] Brokelman, W J A; Lensvelt, M.; Borel Rinkes, I. H. M.; Klinkenbijl, J H G; Reijnen, M. M. P. J. (2011): Peritoneal changes due to laparoscopic surgery. In: Surg Endosc 25 (1), pp 1-9.

[0087] Brummer, T. H. I.; Jalkanen, J.; Fraser, J.; Heikkinen, A-M.; Kauko, M.; Makinen, J. et al. (2011): FINHYST, a prospective study of 5279 hysterectomies: complications and their risk factors. In: Hum Reprod 26 (7) pp 1741-1751. Buckman, RFJr; Bordas, D.; Bell, W. R.;

[0088] Cameron, J. L. (1975): Prevention of experimental postoperative adhesions by ancrod defibrinogenation. In: J Surg Res 18 (4), pp 377-384.

[0089] Chowdhury, S. M.; Hubbell, J. A. (1996): Adhesion prevention with ancrod released via a tissue-adherent hydrogel. In: J Surg Res 61 (1), pp 58-64.

[0090] Cohen, Z.; Senagore, A. J.; Dayton, M. T.; Koruda, M. J.; de Beck; Wolff, B. G. et al. (2005): Prevention of postoperative abdominal adhesions by a novel, glycerol/sodium hyaluronate/carboxymethylcellulose-based bioresorbable membrane: a prospective, randomized, evaluator-blinded multicenter study. In: Diseases of the colon and rectum 48 (6), pp 1130-1139.

[0091] Diamond, M. P.; Kruger, M.; Saed, G. M. (2004): Effect of Tisseel on expression of plasminogen activator and plasminogen activator tissue inhibitor-1. In: Fertility and sterility 81 (6), pp 1657-1664.

[0092] Ellis, H.; Moran, B. J.; Thompson, J. N.; Parker, M. C; Wilson, M. S.; Menzies, D. et al. (1999): Adhesion-related hospital readmissions after abdominal and pelvic surgery: a retrospective cohort study. In: Lancet 353 (9163), pp 1476-1480.

[0093] Fossum, G. T.; Silverberg, K. M.; Miller, C. E.; Diamond, M. P.; Holmdahl, L. (2011): Gynecologic use of Sepraspray Adhesion Barrier for reduction of adhesion development after laparoscopic myomectomy: a pilot study. In: Fertil Steril 96 (2), pp 487-491.

[0094] Hellebrekers, B. W. J.; Emeis, J. J.; Kooistra, T.; Trimbos, J. B.; Moore, N. R.; Zwinderman, K. H.; Trimbos-Kemper, T C (2005): A role for the fibrinolytic system in postsurgical adhesion formation. In: Fertil Steril 83 (1), pp 122-129.

[0095] Hellebrekers, B. W/; Trimbos-Kemper, T. C; Boesten, L; Jansen, F. W.; Kolkman, W.; Trimbos, J. B. et al. (2009): Preoperative predictors of postsurgical adhesion formation and the Prevention of Adhesions with Plasminogen Activator (PA-study): results of a clinical pilot study. In: Fertil Steril 91 (4), pp 1204-1214.

[0096] Hellebrekers, W. J.; Kooistra, T. (2011): Pathogenesis of postoperative adhesion formation. In: Br J Surg 98 (11), pp 1503-1516.

[0097] Hill-West, J. L.; Dunn, R. C.; Hubbell, J. A. (1995): Local release of fibrinolytic agents for adhesion prevention. In: J Surgical Research 59 (6), pp 759-763.

[0098] Klingler, P. J.; Floch, N. Ft.; Seelig, M. H.; Branton, S. A.; Wolfe, J. T.; Metzger, P. P. (1999): Seprafilm-induced peritoneal inflammation: a previously unknown complication. Report of a case. In: Diseases of the colon and rectum 42 (12), pp 1639-1643.

[0099] Kassi, J.; Salminen, P.; Rantala, A.; Laato, M. (2003): Population-based study of the surgical workload and economic impact of bowel obstruction caused by postoperative adhesions. In: Br J Surg 90(11), pp 1441-1444.

[0100] Parker, M. C; Wilson, M. S.; Menzies, D.; Sunderland, G.; Clark, D. N.; Knight, A. D.; Crowe, A. M. (2005): The SCAR-3 study: 5-year adhesion-related readmission risk Following lower abdominal surgical procedures. In: Colorectal Dis 7 (6), pp 551-558.

[0101] Parker, M. C; Ellis, H.; Moran, B. J.; Thompson, J. N.; Wilson, M. S.; Menzies, D. et al. (2001): Postoperative adhesions: ten-year follow-up of 12,584 patients undergoing lower abdominal surgery. In: Dis Colon Rectum 44 (6), pp 822-830.

[0102] Ray, N. F.; Denton, W. G.; Thamer, M.; Henderson, S. C; Perry, S. (1998): Abdominal adhesiolysis: inpatient care and expenditures in the United States in 1994. J Am Surg Coli 186 (1), pp 1-9.

[0103] Saed, G. M.; Diamond, M. P. (2004): Molecular characterization of postoperative adhesions: the adhesion phenotype. In: The Journal of the American Association of Gynecologic Laparoscopists 11 (3), pp 307-314.

[0104] SCAR Group (2013): Pathogenesis, consequences, and control of peritoneal adhesions in gynaecologic surgery: a committee opinion. Fertil Steril 99 (6), pp 1550-1555.

[0105] SchnOriger, B.; Barmparas, G.; Branco, B. C; Lustenberger, T.; Inaba, K.; Demetriades, D. (2011): Prevention of postoperative peritoneal adhesions: a review of the literature. The American Journal of Surgery 201 (1), pp 111-121.

[0106] Schlapschy M, Binder U, Borger C, et al. (2013) PASylation: a biological alternative to PEGylation for extending the plasma half-life of pharmaceutically active proteins. Protein Eng Des Sel. 26 (8): 489-501.

[0107] Sikirica, V.; Bapat, B.; Candrilli, S. D.; Davis, K. L; Wilson, M.; Johns, A. (2011): The inpatient burden of abdominal and gynaecological adhesiolysis in the US. BMC Surg 11, p. 13.

[0108] Wallwiener, M.; Koninckx, P. R.; Hackethal, A.; Brolmann, H.; Lundorff, P.; Mara, M. et al. (2014): A European survey on awareness of post-surgical adhesions among gynaecological surgeons. In: Surg Gynecol 11 (2), pp 105-112.

Sequence CWU 1

1

411509DNAArtificialFusion between Ancrod and the human Fc IgG1 antibody 1gcggccgcca ccatgaaatg ggtcaccttt atctcccttc tgttcctctt tagtagcgcc 60tattctgtca tcggtggtga cgagtgcaat atcaacgagc atcgatttct ggtggcagtg 120tatgaaggaa ccaactggac ctttatctgc ggcggggtcc ttattcaccc agagtgggtc 180attaccgccg aacactgtgc tcggcgtcga atgaatcttg tgttcgggat gcacaggaaa 240tcagagaagt ttgatgacga acaggaacgg tatcccaaga agcggtactt cattcgatgc 300aacaaaaccc ggactagctg ggatgaggac atcatgctga ttcggctgaa caagcccgtg 360aataacagcg agcatattgc tcctttgtca ctgccttcca atccgcctat tgtgggtagt 420gactgccgtg tgatgggctg gggtagcatt aacagaagga tccacgtgct tagcgatgaa 480cccagatgtg ccaacatcaa tctccacaac ttcaccatgt gtcatgggtt gttccgcaag 540atgcctaaga agggacgcgt actctgtgct ggcgatctgc gcggtagacg ggactcttgc 600aattcagata gtggaggacc ccttatctgc aacgaagagc tgcatggcat tgtggccaga 660ggccccaatc catgtgcaca gcccaacaaa ccagctctgt atactagcgt gtacgactac 720agggattggg tgaacaacgt tatcgccggc aatgcaacct gtagtccagg cggcggcgga 780gccggtggag gcggggcagg aggaggagga gctagagaca aaacacacac ttgtccaccc 840tgtcctgctc ccgaactgct tggtggaccc agcgtgtttc tgtttccgcc taagcccaaa 900gacaccctca tgatctcacg gactcccgaa gttacgtgtg tcgtagtaga cgtgtcacac 960gaagatcccg aggtcaagtt caactggtat gtggacggag ttgaggttca caacgccaaa 1020accaaaccga gagaggagca gtacaactcc acatataggg tggtaagcgt gttgaccgtg 1080ctgcatcagg attggctgaa tggcaaagag tacaagtgca aggtgtccaa taaggctctt 1140ccagcaccca ttgagaaaac gatctccaag gcgaaaggcc aacctcgtga acctcaggtg 1200tatactctcc ctccaagtcg cgatgagctc accaagaacc aggtgtcttt gacatgcctc 1260gtcaaagggt tctacccatc agacatagcc gtcgaatggg agtctaatgg ccaaccagag 1320aataactaca agaccactcc tccggttctg gatagtgatg ggagcttctt tctgtacagc 1380aagctgacag tcgacaagtc ccgatggcag cagggtaatg tgttcagttg ctctgtgatg 1440catgaagccc tgcataacca ctatacccag aaaagcctgt ctctgagccc aggaaagtaa 1500tagaagctt 15092495PRTArtificialFusion between Ancrod and the human Fc IgG1 antibody 2Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser Val Ile Gly Gly Asp Glu Cys Asn Ile Asn Glu His Arg Phe 20 25 30Leu Val Ala Val Tyr Glu Gly Thr Asn Trp Thr Phe Ile Cys Gly Gly 35 40 45Val Leu Ile His Pro Glu Trp Val Ile Thr Ala Glu His Cys Ala Arg 50 55 60Arg Arg Met Asn Leu Val Phe Gly Met His Arg Lys Ser Glu Lys Phe65 70 75 80Asp Asp Glu Gln Glu Arg Tyr Pro Lys Lys Arg Tyr Phe Ile Arg Cys 85 90 95Asn Lys Thr Arg Thr Ser Trp Asp Glu Asp Ile Met Leu Ile Arg Leu 100 105 110Asn Lys Pro Val Asn Asn Ser Glu His Ile Ala Pro Leu Ser Leu Pro 115 120 125Ser Asn Pro Pro Ile Val Gly Ser Asp Cys Arg Val Met Gly Trp Gly 130 135 140Ser Ile Asn Arg Arg Ile His Val Leu Ser Asp Glu Pro Arg Cys Ala145 150 155 160Asn Ile Asn Leu His Asn Phe Thr Met Cys His Gly Leu Phe Arg Lys 165 170 175Met Pro Lys Lys Gly Arg Val Leu Cys Ala Gly Asp Leu Arg Gly Arg 180 185 190Arg Asp Ser Cys Asn Ser Asp Ser Gly Gly Pro Leu Ile Cys Asn Glu 195 200 205Glu Leu His Gly Ile Val Ala Arg Gly Pro Asn Pro Cys Ala Gln Pro 210 215 220Asn Lys Pro Ala Leu Tyr Thr Ser Val Tyr Asp Tyr Arg Asp Trp Val225 230 235 240Asn Asn Val Ile Ala Gly Asn Ala Thr Cys Ser Pro Gly Gly Gly Gly 245 250 255Ala Gly Gly Gly Gly Ala Gly Gly Gly Gly Ala Arg Asp Lys Thr His 260 265 270Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val 275 280 285Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 290 295 300Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu305 310 315 320Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 325 330 335Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser 340 345 350Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 355 360 365Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile 370 375 380Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro385 390 395 400Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 405 410 415Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 420 425 430Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 435 440 445Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 450 455 460Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu465 470 475 480His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 485 490 49532618DNAArtificialFusion between Ancrod and human serum albumin 3gcggccgctc tagagccacc atgaaatggg ttaccttcat tagcctcctg ttcctgtttt 60cctccgccta ttctgttatc ggtggtgacg agtgtaacat caacgagcat aggttcctgg 120tcgcagtgta tgagggcaca aactggacct tcatttgtgg cggggtgctg attcacccag 180agtgggtaat aacagcggag cattgtgccc gcagacgcat gaatctcgtg tttggaatgc 240atcgcaaaag cgagaaattc gatgatgaac aagaaaggta ccctaagaag cggtacttca 300ttcggtgcaa caagacaaga acttcatggg acgaggacat catgctgatc cgtcttaaca 360agccggtaaa taacagcgag catatcgcac cactctcatt gcccagcaac cctcccatcg 420tgggaagcga ttgcagagtg atggggtggg gctccatcaa tagaaggatt cacgtgctct 480ctgatgaacc gcggtgtgcc aacattaatc tgcataattt tactatgtgc catggtctgt 540ttcgcaaaat gcccaagaaa ggaagagttc tgtgtgcagg cgatctgaga ggaaggagag 600actcttgcaa ctccgatagt ggcgggccac tgatatgcaa cgaagagctt cacggaatcg 660tggccagagg tcctaatcca tgtgctcagc ctaacaagcc cgctctgtac accagcgttt 720atgactaccg ggattgggtc aacaatgtca ttgccggaaa tgccacctgt tcccctggcg 780gcggcgggtc aggaggagga gggtctggtg gcggcgggtc tgacgcacat aaaagcgaag 840tggctcaccg gtttaaagat ctcggcgaag agaacttcaa agctcttgta ttgattgcct 900tcgctcagta cttgcaacag tgccctttcg aggaccacgt gaaactggtg aatgaagtca 960cagaattcgc taagacgtgt gtggcggatg agagtgctga gaactgtgac aagagtctgc 1020acaccctgtt tggggataaa ctgtgcactg tcgctactct gcgagaaact tatggcgaaa 1080tggccgactg ctgcgccaag caggaacccg agagaaatga atgctttctg cagcacaaag 1140acgacaaccc taatctgcca cgattggttc ggcccgaggt ggacgtaatg tgcacggctt 1200tccacgacaa tgaggaaacc ttcctgaaga agtatctcta cgaaatagct cgacggcatc 1260cctactttta tgcacccgag ctgctgttct ttgcgaagcg ctataaggcc gctttcacag 1320aatgctgtca agctgccgac aaggctgcct gtctcctccc aaaactggac gagctccgcg 1380atgaggggaa ggcaagcagt gccaaacagc gcctgaaatg cgcatcactt cagaaattcg 1440gagagcgcgc attcaaagca tgggcagtgg ctcgattgtc ccagcgattt cctaaggctg 1500aatttgccga agtgtcaaag ctggtgacag accttaccaa agtccacaca gaatgctgcc 1560atggtgactt gctggagtgc gccgatgaca gagccgatct ggccaagtac atctgtgaaa 1620atcaggattc catctcctcc aaactgaaag aatgctgcga gaaacccctg ctggagaaga 1680gccattgtat tgctgaggtg gaaaacgatg agatgccagc ggacctccca tcactggcag 1740ccgacttcgt cgagagtaag gacgtgtgta agaactacgc cgaagcgaag gatgtgtttc 1800tcgggatgtt tctgtacgaa tatgcgcgtc gtcatcccga ttatagcgtg gttctgctgc 1860ttaggcttgc caagacttac gaaaccaccc tcgagaagtg ttgtgccgcc gctgacccgc 1920atgagtgcta cgccaaagta tttgacgagt ttaagcctct ggtcgaggag cctcagaacc 1980tgatcaaaca gaactgcgag cttttcgagc agttgggtga atacaaattt cagaatgccc 2040tgctcgtcag gtatactaag aaggtgcccc aagtgtctac acctaccttg gttgaggtca 2100gccggaatct cggcaaggtc ggcagcaaat gctgtaagca cccagaggca aagcgtatgc 2160catgtgcaga ggattatctg agtgtcgtcc tcaaccagct gtgcgtactt cacgaaaaga 2220caccagtgtc cgatagggtc actaaatgtt gcaccgaatc tctggtgaat cggaggccct 2280gtttctcagc tctggaagtt gatgaaacct acgttccgaa ggagttcaat gcagaaacgt 2340ttacctttca cgctgacatc tgcacgctct ctgagaagga gaggcagata aagaagcaaa 2400cagccctggt agagctggtt aaacacaagc ccaaagcaac aaaggagcag ctgaaagcgg 2460tgatggatga cttcgccgcg tttgtggaga agtgctgtaa ggccgacgat aaagaaactt 2520gcttcgccga agagggaaag aagcttgtgg cagctagcca agcagccctt gggttgcacc 2580accatcacca ccactaatag ccactgtgct ggttcgaa 26184858PRTArtificialFusion between Ancrod and human serum albumin 4Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser Val Ile Gly Gly Asp Glu Cys Asn Ile Asn Glu His Arg Phe 20 25 30Leu Val Ala Val Tyr Glu Gly Thr Asn Trp Thr Phe Ile Cys Gly Gly 35 40 45Val Leu Ile His Pro Glu Trp Val Ile Thr Ala Glu His Cys Ala Arg 50 55 60Arg Arg Met Asn Leu Val Phe Gly Met His Arg Lys Ser Glu Lys Phe65 70 75 80Asp Asp Glu Gln Glu Arg Tyr Pro Lys Lys Arg Tyr Phe Ile Arg Cys 85 90 95Asn Lys Thr Arg Thr Ser Trp Asp Glu Asp Ile Met Leu Ile Arg Leu 100 105 110Asn Lys Pro Val Asn Asn Ser Glu His Ile Ala Pro Leu Ser Leu Pro 115 120 125Ser Asn Pro Pro Ile Val Gly Ser Asp Cys Arg Val Met Gly Trp Gly 130 135 140Ser Ile Asn Arg Arg Ile His Val Leu Ser Asp Glu Pro Arg Cys Ala145 150 155 160Asn Ile Asn Leu His Asn Phe Thr Met Cys His Gly Leu Phe Arg Lys 165 170 175Met Pro Lys Lys Gly Arg Val Leu Cys Ala Gly Asp Leu Arg Gly Arg 180 185 190Arg Asp Ser Cys Asn Ser Asp Ser Gly Gly Pro Leu Ile Cys Asn Glu 195 200 205Glu Leu His Gly Ile Val Ala Arg Gly Pro Asn Pro Cys Ala Gln Pro 210 215 220Asn Lys Pro Ala Leu Tyr Thr Ser Val Tyr Asp Tyr Arg Asp Trp Val225 230 235 240Asn Asn Val Ile Ala Gly Asn Ala Thr Cys Ser Pro Gly Gly Gly Gly 245 250 255Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ala His Lys Ser 260 265 270Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala 275 280 285Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu 290 295 300Asp His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys305 310 315 320Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu 325 330 335Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly 340 345 350Glu Met Ala Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys 355 360 365Phe Leu Gln His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg 370 375 380Pro Glu Val Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr385 390 395 400Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe 405 410 415Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe 420 425 430Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys 435 440 445Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg 450 455 460Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala465 470 475 480Trp Ala Val Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala 485 490 495Glu Val Ser Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys 500 505 510Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala 515 520 525Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu 530 535 540Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val545 550 555 560Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe 565 570 575Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val 580 585 590Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr 595 600 605Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu 610 615 620Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val625 630 635 640Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys 645 650 655Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn 660 665 670Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro 675 680 685Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys 690 695 700Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu705 710 715 720Ser Val Val Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val 725 730 735Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg 740 745 750Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu 755 760 765Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser 770 775 780Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val785 790 795 800Lys His Lys Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp 805 810 815Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu 820 825 830Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala 835 840 845Ala Leu Gly Leu His His His His His His 850 855

Claims

1-15. (canceled)

16. A recombinant fusion protein comprising a fibrinogenolytic enzyme having an amino acid sequence that is C-terminally and/or N-terminally linked to the amino acid sequence of at least one high-molecular inert stabilization domain with a molecular weight of >50 kDa, for the prevention or treatment of peritoneal adhesions following surgical interventions in the peritoneal cavity.

17. The recombinant fusion protein for use according to claim 16, characterized in that the inert stabilization domain is connected via a linker to the fibrinogenolytic enzyme.

18. The recombinant fusion protein for use according to claim 17, characterized in that the linker relates to a glycine-serine linker having the sequence (GGGGGS)x, or glycine-alanine linker with the sequence (GGGGA)xR, where A=alanine; G=glycine; R=arginine; S=serine; x=number of repetitions >1.

19. The recombinant fusion protein for use according to claim 16, characterized in that a plurality of inert stabilization domains are linked to the C-terminus of the fibrinogenolytic enzyme.

20. The recombinant fusion protein for use according to claim 16, characterized in that a plurality of inert stabilization domains are linked to the N-terminus of the fibrinogenolytic enzyme.

21. The recombinant fusion protein for use according to claim 16, characterized in that the stabilization domain has a molecular weight between 50 and 150 kDa.

22. The recombinant fusion protein for use according to claim 16, characterized in that the fibrinogenolytic enzyme relates to a thrombin-like serine protease.

23. The recombinant fusion protein for use according to claim 16, characterized in that the fibrinogenolytic enzyme relates to ancrod or batroxobin, or a recombinant variant of ancrod or batroxobin.

24. The recombinant fusion protein for use according to claim 16, characterized in that the high molecular inert stabilization domain relates to a protein or peptide domain, in particular serum albumin, transferrin, a monoclonal or humanized antibody or an antibody fragment, or an artificial domain, e.g. PAS or XTEN.

25. The recombinant fusion protein for use according to claim 16, characterized in that the amino acid sequence of human serum albumin, or a part of this sequence having a molecular weight of >50 kDa, is linked as inert stabilizing domain to the C-terminus or N-terminus of ancrod or batroxobin as fibrinogenolytic enzyme.

26. The recombinant fusion protein for use according to claim 25, characterized in that the fusion protein comprises an amino acid sequence set forth in SEQ ID NO. 2 (N-terminal fusion) or SEQ ID NO. 4 (C-terminal fusion), or fibrinogenolytically effective parts of this sequence.

27. The recombinant fusion protein for use according to claim 16, characterized in that the fusion protein is embedded in a biodegradable matrix for continuous intraperitoneal release.

28. A pharmaceutical composition comprising a recombinant fusion protein according to claim 16 for use in the prevention or treatment of peritoneal adhesions following surgical interventions in the peritoneal cavity.

29. The pharmaceutical composition for use according to claim 28, characterized in that the recombinant fusion protein is present in an osmotically active medium, preferably Ico-dextrin solution.