Methods of Inducing Metabolic Maturation of Human Pluripotent Stem Cells-Derived Hepatocytes

Abstract

Provided are methods of increasing metabolic maturation of an immature hepatocyte, by contacting an immature hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with an effective amount of a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, Perfluorooctanoic Acid, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil. Also provided are isolated hepatocytes and uses thereof.

Description

RELATED APPLICATION

[0001] This application claims the benefit of priority under 35 USC 119(e) of U.S. Provisional Patent Application No. 62/308,372 filed on Mar. 15, 2016, the contents of which are incorporated herein by reference in their entirety.

[0002] The work leading to this invention has received funding from the European Research Council under the European Union's Seventh Framework Programme (FP7/2007-2013)/ERC grant agreement no. [248417].

SEQUENCE LISTING STATEMENT

[0003] The ASCII file, entitled 69429SequenceListing.txt, created on Mar. 15, 2017, comprising 169,445 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

[0004] The present invention, in some embodiments thereof, relates to methods of increasing metabolic maturation of immature hepatocytes and isolated hepatocytes resulting thereof.

[0005] The liver is the largest internal organ in the human body, and is responsible for protein synthesis as well as glucose, lipid and nitrogen homeostasis. Transformation of lipid metabolites is primarily carried out by the cytochrome P450 (CYP450) family of monooxygenases, which is also responsible for the transformation of most xenobiotics, often as a first step for conjugation and secretion of water-soluble metabolites (Guengerich 2007). Due to these metabolic functions the organ is particularly sensitive to drug-induced liver injury (DILI), a leading cause of acute liver failure and post-market drug withdrawals (Kaplowitz 2005). Liver toxicity and drug metabolism are therefore a major focus of pharmaceutical and cosmetic industry compound development.

[0006] The low concordance between animal studies and clinical data (Olson, Betton et al. 2000, Gottmann, Kramer et al. 2001) and the low metabolic activity of hepatic cell lines necessitates the use of primary human hepatocytes for drug metabolism and toxicity studies (LeCluyse 2001). However, primary human hepatocytes are scarce, do not proliferate and rapidly lose their metabolic functions in vitro (Guillouzo 1998, Hewitt, Lechon et al. 2007). The recent development of micro-fabricated or oxygenated co-cultures was shown to support primary cell activity for several weeks in culture (Nahmias, Berthiaume et al. 2007, Khetani and Bhatia 2008, Kidambi, Yarmush et al. 2009, Shulman and Nahmias 2013), but did little to attenuate the need for functional cells. It is the scarcity in primary human hepatocytes that drives the current focus in hepatic cell differentiation. Although a few cell types can be coaxed into hepatic like cells (Schwartz, Reyes et al. 2002, Lue, Lin et al. 2010, Stock, Bruckner et al. 2010, Zhu, Rezvani et al. 2014), it is thought that only pluripotent stem cells (PSC) may provide the full gamete of mature hepatic function (Duan, Ma et al. 2010).

[0007] Indeed, several groups already reported the differentiation of hepatocyte-like cells from embryonic or induced pluripotent stem cells (Song, Cai et al. 2009, Duan, Ma et al. 2010, Si-Tayeb, Noto et al. 2010, Chen, Tseng et al. 2012, Roelandt, Vanhove et al. 2013, Shan et al. 2013, Chen et al. 2015). While these groups focused on albumin production, hepatocyte-like cells still display fetal markers such as .alpha.-fetoprotein (AFP) and lack the inducibility and function of most mature CYP450 enzymes, such as CYP3A4. In fact, recent attempts to use hPSC-derived hepatocytes in drug toxicity screening garnered a poor correlation with primary human hepatocytes, showing an R.sup.2 of 0.49 (Szkolnicka, Farnworth et al. 2014). Interestingly, fetal markers such as AFP and CYP3A7 were shown to decrease only after birth, with a gradual increase in CYP3A4 expression taking place only during the first year of life (Lacroix, Sonnier et al. 1997, Guengerich 2007). These in vivo results suggest that post-partum cues may drive the final maturation step of liver cells.

[0008] Postnatal maturation of mitochondria is another key limiting factor in the derivation of functional hepatocytes. Fetal hepatocytes rely on placenta-transferred carbohydrates and anaerobic glycolysis (Hommes, 1973; Hommes, 1975), while postnatal functional and structural maturation of over 1400 mitochondria in liver cells enables much higher metabolic rates (Pollak, 1980).

[0009] Therefore, recently, mitochondrial biogenesis and metabolism emerged as important factors in evaluating hepatic maturity and functionality in vitro (Yue Yu, 2012; Anais Waneta, 2014).

[0010] The liver microenvironment changes significantly by the transition from placental to enteral nutrition (Morelli 2008). Fatty acids from breastfeeding become the primary energy source, while gut colonization exposes the liver to bacterial-derived secondary metabolites, such as litocholic acid (LCA) and menaquinone-4 (MK4). LCA is a secondary bile acid, produced by intestinal bacteria, and shown to activate the pregnane X receptor (PXR), a nuclear receptor controlling the expression of CYP450 enzymes such as CYP2C9 and CYP3A4 (Staudinger, Goodwin et al. 2001). Vitamin K is a group of essential fat-soluble vitamins, whose active metabolite MK4 (vitamin K.sub.2) is synthesized by colon bacteria (Conly and Stein 1992).

[0011] Prenatal levels of vitamin K are low due to poor placental travel (Shearer, Rahim et al. 1982), and it is regularly administered to newborns immediately after birth to prevent vitamin K deficiency that leads to fatal bleeding (Shearer 2009). MK4 was also shown to activate PXR, primarily in bone cells (Tabb, Sun et al. 2003, Ichikawa, Horie-Inoue et al. 2006).

[0012] Intestinal microbial colonization in newborns is also influenced by the lipid rich diet (Morelli, 2008; DA, 2014). Bifidobacterium and lactobacillus thrive on breast milk glycans and lactate, respectively, thus becoming predominant during the lactation period (Conway, 1997; Haarman, 2005; Haarman, 2006; Sela, 2014). Both strains metabolize one of the main unsaturated fatty acid in the human breast milk, linoleic acid (LA) (Finley, 1985, Supplement table 1), to conjugated linoleic acid (CLA), mainly to cis-9,trans-11-octadecadienoic acid 18:2 (9CLA), which is known for its bioactive properties (Halade, 2009; Halade, 2010; Poirier, 2006; Reynolds, 2010; Choi, 2007). 9CLA enhances hepatic mitochondrial function in rats (Choi, 2007) and acts as a high affinity ligand of Peroxisome proliferator-activated receptor, isoform a (PPAR.alpha.) (Moya-Camarena, 1999). PPAR.alpha. is a lipid activated nuclear receptor whose expression and activity increase significantly during the suckling period (Beck, 1992; Panadero, 2000).

[0013] Additional background art includes U.S. Patent Application Publication US 20070213282 A1 [Peroxisome proliferator-activated receptor (PPAR) activator, and drugs, supplements, functional foods and food additives using the same]; Tashiro K., et al., 2009 (Stem Cells 27: 1802-1811); Inamura M et al. 2011 (Mol. Therapy, 19:400-407); Sullivan G J., et al. 2011 (Hepatology 51: 329-335); Si-Tayeb K., et al., 2010 (Hepatology 51: 297-305); Song Z., et al. 2009 (Cell Research 19: 1233-1242); Shan J., et al., 2013 (Nature Chemical Biology 9: 514-521); Kai-Ting Chen et al., 2014 (Journal of Hepatology, Elsevier, 2014, 61 (6), pp. 1276-1286); Parmentier J H 1997 (Biochemical Pharmacology 54: 889-898); Gruppuso P A., et al. 2000 (Biochimica et Biophysica Acta 1494:242-247); Esmaeli S., et al. 2014 (Cell Biochemistry and Function 32: 410-419); Chen J., et al., 2016 (Scientific Reports 6: 18841 DOI: 10.1038/srep18841); Stier H., et al., 1998 (Differentiation 64: 55-66).

SUMMARY OF THE INVENTION

[0014] According to an aspect of some embodiments of the present invention there is provided a method of increasing metabolic maturation of an immature hepatocyte, the method comprising contacting an immature hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with an effective amount of a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby increasing the metabolic maturation of the immature hepatocyte.

[0015] According to an aspect of some embodiments of the present invention there is provided a method of treating a subject diagnosed with a pathology characterized by immature hepatocytes, the method comprising administering to the subject an effective amount of a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby increasing the metabolic maturation of the immature hepatocytes and treating the subject.

[0016] According to an aspect of some embodiments of the present invention there is provided a method of increasing metabolic maturation of an immature hepatocyte, the method comprising contacting an immature hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with a medium being devoid of an IL6 ligand and which comprises an effective amount of a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid, thereby increasing the metabolic maturation of the immature hepatocyte, wherein said effective amount of said PXR agonist increases the expression of a PXR target gene selected from the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds.

[0017] According to an aspect of some embodiments of the present invention there is provided a method of treating a subject diagnosed with a pathology characterized by immature hepatocytes, the method comprising administering to the subject a pharmaceutical composition comprising an effective amount of a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid, wherein said pharmaceutical composition is devoid of an IL6 ligand, wherein said effective amount of said PXR agonist increases the expression of a PXR target gene selected from the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds, thereby increasing the metabolic maturation of said immature hepatocytes and treating the subject.

[0018] According to an aspect of some embodiments of the present invention there is provided an isolated hepatocyte characterized by a Cytochrome P450 3A4 (CYP3A4) activity which is capable of oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per milligram of cellular protein and an alpha feto-protein (AFP) activity of at least 60 .mu.g/day/mg cellular protein as assayed by ELISA when cultured in the presence of a culture medium which comprises Insulin-Transferrin-Selenium (ITS), Glutamax, Dexamethasone, hepatocyte growth factor (HGF), Oleic acid and 9CLA.

[0019] According to an aspect of some embodiments of the present invention there is provided an isolated hepatocyte obtainable by the method according to the method of some embodiments of the invention.

[0020] According to an aspect of some embodiments of the present invention there is provided an isolated population of cells wherein at least 50% of the cells comprise the isolated hepatocyte of some embodiments of the invention.

[0021] According to an aspect of some embodiments of the present invention there is provided a method of screening a compound for liver toxicity, comprising:

[0022] (a) incubating the isolated population of cells of some embodiments of the invention with the compound for a pre-determined time period, and;

[0023] (b) determining percentage of a parameter indicative of liver toxicity following the pre-determined time period, thereby screening the compound for the liver toxicity.

[0024] According to an aspect of some embodiments of the present invention there is provided a kit for screening a compound for liver toxicity comprising the isolated population of cells of some embodiments of the invention and at least one agent capable of detecting a toxicological end-point selected from the group consisting of: steatosis, cholestasis and apoptosis.

[0025] According to an aspect of some embodiments of the present invention there is provided a nutrition formula for an infant comprising 9CLA.

[0026] According to some embodiments of the invention, the effective amount of said PXR agonist causes differentiation of said immature hepatocyte into a mature hepatocyte.

[0027] According to some embodiments of the invention, the mature hepatocyte is characterized by an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4-/SOX2.sup.-/A1AT.sup.+/HN- F4.alpha..sup.+ expression signature.

[0028] According to some embodiments of the invention, the effective amount of said PXR agonist is provided in a concentration of at least half maximal effective concentration (EC.sub.50) of said PXR agonist.

[0029] According to some embodiments of the invention, the PXR agonist is selected from the group consisting of: a small molecule and a bile acid.

[0030] According to some embodiments of the invention, the small molecule is selected from the group consisting of: Rifampicin, T0901317, SR12813, mevastatin, rifaximin, hyperforin, meclizine, paclitaxel, atorvastatin, pregnenolone-16alpha-carbonitrile, Butamben and 24(S),25-Epoxycholesterol.

[0031] According to some embodiments of the invention, the bile acid is selected from the group consisting of lithocholic acid, cholic acid, chenodeoxycholic acid, deoxycholic acid, and ursodeoxycholic acid, or a derivative thereof.

[0032] According to some embodiments of the invention, the steroid is selected from the group consisting of progesterone, 17.alpha.-hydroxyprogesterone, 17.alpha.-hydroxypregnenolone, 5.alpha.-dihydroprogesterone, 5.beta.-dihydroprogesterone, allopregnanolone, corticosterone, cyproterone acetate, spironolactone, dexamethasone, and mifepristone.

[0033] According to some embodiments of the invention, the contacting or the administering is performed in an absence of an IL6 ligand.

[0034] According to some embodiments of the invention, the fatty acid is non-conjugated.

[0035] According to some embodiments of the invention, a concentration of the non-conjugated is at least 50 .mu.M.

[0036] According to some embodiments of the invention, the immature hepatocyte is characterized by an alpha-feto protein (AFP)+/Albumin+/CYP3A7+/SOX2-/OCT4- expression signature.

[0037] According to some embodiments of the invention, the immature hepatocyte does not differentiate into bile duct cells.

[0038] According to some embodiments of the invention, the method resulting in a mature hepatocyte characterized by an albumin+/CY3A4+/E-cadherin+/OCT4-/SOX2-/A1AT+/HNF4.alpha.+ expression signature.

[0039] According to some embodiments of the invention, the IL6 ligand is selected from the group consisting of oncostatin M (OSM), interleukin 6 (IL6), leukemia inhibitory factor (LIF), leptin (OB), Cardiotrophin-1/CT-1, CLC, CNTF, G-CSF, IL-11, IL-31, and Ncuropoictin/NP.

[0040] According to some embodiments of the invention, the immature hepatocyte is obtained by an in vitro differentiation of a pluripotent stem cell.

[0041] According to some embodiments of the invention, the immature hepatocyte is obtained by an in vitro differentiation of a hepatoblast.

[0042] According to some embodiments of the invention, the in vitro differentiation of the hepatoblast is performed by culturing the hepatoblast for a pre-determined time period in a culture medium which comprises an IL6 ligand.

[0043] According to some embodiments of the invention, prior to formation of the hepatoblast the fatty acid and/or the small molecule are absent from a culture comprising the hepatoblast.

[0044] According to some embodiments of the invention, the non-conjugated fatty acid is selected from the group consisting of oleic acid (OA), Palmitic Acid and linoleic acid (LA).

[0045] According to some embodiments of the invention, the non-conjugated fatty acid is selected from the group consisting of oleic acid (OA) and linoleic acid (LA).

[0046] According to some embodiments of the invention, the non-conjugated fatty acid is oleic acid (OA).

[0047] According to some embodiments of the invention, the non-conjugated fatty acid is linoleic acid (LA).

[0048] According to some embodiments of the invention, the non-conjugated fatty acid is Palmitic Acid.

[0049] According to some embodiments of the invention, the fatty acid is a conjugated fatty acid.

[0050] According to some embodiments of the invention, the conjugated fatty acid is provided at a concentration of at least 50 .mu.M.

[0051] According to some embodiments of the invention, the conjugated fatty acid is provided at a concentration of 50-200 .mu.M.

[0052] According to some embodiments of the invention, the conjugated fatty acid is 9-cis, 11-trans conjugated linoleic acid (9CLA).

[0053] According to some embodiments of the invention, the conjugated fatty acid is selected from the group consisting of a conjugated linoleic acid which comprises two conjugated double bonds, a conjugated linoleic acid which comprises three conjugated double bonds, 9E,11Z,15E-octadeca-9,11,15-trienoic acid (Rumclcnic acid), 9E,11Z,13Z,15E-octadeca-9,11,13,15-tetraenoic acid (.alpha.-Parinaric acid), all trans-octadeca-9,11,13,15-tretraenoic acid (.beta.-Parinaric) acid, and 5Z,8Z,10E,12E,14Z-eicosanoic acid (Bosseopentaenoic acid).

[0054] According to some embodiments of the invention, the fatty acid is an omega 3 polyunsaturated fatty acid.

[0055] According to some embodiments of the invention, the amphipathic carboxylic acid comprises a fibrate.

[0056] According to some embodiments of the invention, the fibrate is selected from the group consisting of Fenofibrate, Bezafibrate, Ciprofibrate, Clofibrate, Gemfibrozil, Fenofibrate, and Clinofibrate.

[0057] According to some embodiments of the invention, the Thiazolidinedione is selected from the group consisting of Pioglitazone, Rosiglitazone, Lobeglitazone, Troglitazone, Ciglitazone, Darglitazone, Englitazone, Netoglitazone and Rivoglitazone.

[0058] According to some embodiments of the invention, the metabolic maturation comprises an increase in a mitochondrial mass per cell as compared to the mitochondrial mass in a control immature hepatocyte.

[0059] According to some embodiments of the invention, the increase in the mitochondrial mass comprises an increase in a proliferation rate of the mitochondria as compared to a proliferation rate of the mitochondria in a control immature hepatocyte.

[0060] According to some embodiments of the invention, the metabolic maturation comprises an increase in a maturation state of the mitochondria as compared to a maturation state of a control immature hepatocyte.

[0061] According to some embodiments of the invention, the immature hepatocyte is from a newborn human individual.

[0062] According to some embodiments of the invention, the hepatoblast is obtainable by a method which comprises:

[0063] (a) culturing undifferentiated pluripotent stem cells in a medium which comprises activin A, B27, Wnt3A and hepatocyte growth factor (HGF) to thereby obtain cells characteristics of a definitive endoderm, and subsequently;

[0064] (b) culturing the cells characteristics of the definitive endoderm in a culture medium which comprises Dimethyl sulfoxide (DMSO), to thereby obtain the hepatoblast.

[0065] According to some embodiments of the invention, wherein step (b) further comprises passaging the cells at least once in the culture medium which comprises the DMSO.

[0066] According to some embodiments of the invention, the hepatocyte is characterized by a Cytochrome P450 3A4 (CYP3A4) activity which is capable of oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per milligram of cellular protein.

[0067] According to some embodiments of the invention, the hepatocyte is characterized by an alpha feto-protein (AFP) production of at least 60 microgram per day per milligram cellular protein as determined by an ELISA.

[0068] According to some embodiments of the invention, the hepatocyte is characterized by nuclear expression of PXR.

[0069] According to some embodiments of the invention, the liver toxicity comprises steatosis.

[0070] According to some embodiments of the invention, the steatosis is assayable using the LipidTox neutral lipid stain.

[0071] According to some embodiments of the invention, the liver toxicity comprises cholestasis.

[0072] According to some embodiments of the invention, the cholestasis is assayable using the CDFDA staining.

[0073] According to some embodiments of the invention, the liver toxicity comprises apoptosis.

[0074] According to some embodiments of the invention, the apoptosis is assayable using the TUNEL assay.

[0075] According to some embodiments of the invention, the nutrition formula being suitable for infant(s) born by C-section.

[0076] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0077] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0078] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0079] In the drawings:

[0080] FIGS. 1A-H demonstrate the differentiation of human embryonic stem cell (hESC) derived hepatocytes according to the method of some embodiments of the invention. FIG. 1A--Schematic of a four-stage protocol used to control hepatocyte differentiation. Note that in the last stage (stage 4, days 12-16) the medium is devoid of oncostatin-M (OSM). FIG. 1B--Phase and immunofluorescence micrographs of differentiating 13 human embryonic stem cells. Differentiating cells undergo distinct morphological changes (Phase images, top row) and progress through defined transcriptional states toward hepatocytes. FIGS. 1C-E--qRT-PCR analyses. FIG. 1C--qRT-PCR analysis of transcription factors maintaining pluripotency (OCT4 and SOX2); FIG. 1D--qRT-PCR analysis of transcription factors regulating hepatic differentiation (SOX17, GATA4, FOXA2 and HNF4A); FIG. 1E--qRT-PCR analysis of key liver proteins (AFP, albumin and A1AT).

[0081] The results show that the pluripotency factors disappear by day 8 (FIG. 1C), followed by a transient expression of endodermal genes (FIG. 1D) and the gradual appearance of hepatocyte specific proteins (FIG. 1E). FIG. 1F--Flow cytometry of cells at day 3 (endoderm) shows that 41% of the cells express definitive endoderm markers CXCR4 and SOX17. FIG. 1G--Flow cytometry profile of cells at day 7 (hepatoblasts) shows that 83% of the cells express standard hepatoblast markers, HNF4A and FOXA2. FIG. 1H--Flow cytometry of cells after 16 days of differentiation (hepatocytes) shows that 83% of the cells are positive for both albumin and HNF4A. The following abbreviations were used: Wnt3A, Wingless-Type MMTV Integration Site Family, Member 3A; HGF, hepatic growth factor; DMSO, Dimethyl sulfoxide; DEX, Dexamethasone; OSM, oncostatin-M; FGF2, fibroblast growth factor-2; OCT4, octamer-binding transcription factor 4; SOX17, SRY (sex determining region Y)-box 17; GATA4, GATA binding protein 4; FOXA2, forkhead box protein A2; HNF4A, hepatocyte nuclear factor 4-alpha; SOX2, SRY (sex determining region Y)-box 2; AFP, alpha-fetoprotein; A1AT, alpha 1-antitrypsin.

[0082] FIGS. 2A-I demonstrate that LCA and MK4 drive PXR dependent hepatic maturation. FIGS. 2A-B--Quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) analysis of nuclear receptors, drug transporters, and phase I drug metabolism enzymes in hESC-derived hepatocytes (hESC-H D16), adult primary human hepatocytes (PHH), and HepG2 cells. hESC-derived hepatocytes show similar expression of CAR and FXR, when compared to PHHs, while expressing lower levels of PXR, CYP3A4, and CYP2C9 that are still substantially higher than that of HepG2 cells (FIG. 2A). hESC-derived hepatocytes show a higher PPAR.alpha. expression than PHHs, but comparable expression of albumin and A1AT (FIG. 2B). FIG. 2C Molecular structures of Lithocholine Acid (LCA) and Vitamin K2 (MK4). FIGS. 2D-E--qRT-PCR analyses of hESC-derived hepatocytes exposed to increasing concentrations of LCA (FIG. 2D) or MK4 (FIG. 2E) during the final maturation step (days 12-16). LCA induced an exponential response, reaching 5- to 73-fold induction in PXR and its CYP2C9 and CYP3A4 target genes. MK4 supplementation had little effect on hESC-derived hepatocyte gene expression. FIG. 2F--qRT-PCR analysis of hESC-derived hepatocytes cultured with 10 .mu.M of LCA, 10 .mu.M of MK4, or 10 .mu.M of both compounds during the final maturation step. Cells show a synergistic effect, with PXR induced by 3.7-fold by the combination of LCA and MK4, compared to 1.3- and 1.9-fold for LCA and MK4, respectively. FIG. 2G--PXR-copGFP reporter activity in hESC-derived hepatocytes. Differentiated cells that were cultured in the presence of LCA and MK4 show a significant increase in PXR activity. FIG. 2H--A histogram depicting quantification of immunofluorescence analysis of PXR showing a 3-fold increase in nuclear localization of PXR in cells cultured with LCA and MK4, compared to standard differentiation. FIG. 2I--Addition of silibinin, a PXR inhibitor, to the final maturation step (days 12-16) of hESC-derived hepatocytes blocks the effect of LCA and MK4 supplementation. *P<0.05; **P<0.01. Abbreviations: MDR1/P-gp, multi-drug resistance protein; MRP3, multidrug resistance-associated protein; PXR, pregnane X receptor; FXR, farnesoid X receptor; CAR, constitutive androstane receptor; MK4, Menatetrenone-4 (Vitamin K.sub.2); MDR1, multidrug resistance protein 1; MRP3, multidrug resistance-associated protein 3; OATP2, organic anion-transporting polypeptide-2; PPARA, peroxisome proliferator-activated receptor alpha.

[0083] FIGS. 3A-F depict morphology, secretome and RNA-Seq analysis of hepatic maturation in the presence of 10 .mu.M LCA and 10 .mu.M MK4. FIG. 3A--hESC-derived hepatocytes (hESC-H) show a homogenous perinuclear albumin and CYP3A4 staining, clear HNF-4.alpha. nuclear localization, and lateral E-cadherin staining. White arrows indicate binuclear cells, a trait of PHHs (top). FIG. 3B--CDFDA staining shows functional bile canaliculi (arrows), whereas some no-polarized cells show diffused green CDF. FIG. 3C Graph depicting the dynamics of albumin, AFP, and ApoB100 secretion during hepatic differentiation. hESC-derived hepatocyte production of albumin and ApoB100 steadily increased during LCA and MK4 treatment and, by day 16, was not significantly different from PHHs. In contrast, AFP showed 22% decrease during the end of the differentiation period (P<0.05). FIG. 3D--Unsupervised hierarchical clustering using Spearman's rank correlation of 2,925 differentially expressed genes analyzed using RNA-Seq shows that hESC-H treated with LCA and MK4 (LCA/MK4) cluster closer to PHHs than to FHHs than untreated hESC-H controls (control). Representative heat map of 75 differential genes is shown as well. FIG. 3E--RNA abundance of adult liver markers ASGR1, CYP3A4, and GPT1/ALT was higher in treated than untreated hESC-H. FIG. 3F--RNA abundance of fetal liver markers CYP3A7 and RFC3 was higher in untreated than treated hESC-H.

[0084] FIGS. 4A-F demonstrate that hESC-derived hepatocytes (hESC-H) exhibit inducible CYP450 and accurate toxicological response. FIG. 4A--Log-scale CYP450 activity of hESC-H treated with LCA and MK4 (LCA/MK4), compared to untreated hESC-H (control), adult primary human hepatocytes (PHHs), and HepG2 cells. hESC-H treated with LCA and MK4 exhibit higher CYP450 activity than HepG2 and untreated cells. Fetal CYP1A activity is higher than PHHs when measuring EROD breakdown. MFC and BFC breakdown in differentiated cells is lower than primary cells, but higher than untreated hESC-H (P<0.05) FIG. 4B--Induction of CYP450 activity in hESC-H treated with LCA and MK4 in response to 72 hours of stimulation with AhR agonist omeprazole (purple bars) or PXR agonist rifampicin (orange bars). Omeprazole preferentially induced CYP1A (P=0.012; n=3), whereas rifampicin shows a clear induction of MFC metabolism (P=0.048; n=3). FIG. 4C--PXR and CYP450 gene expression analysis in hESC-derived hepatocytes after 2% DMSO treatment. Exposure of differentiated cells to DMSO increased expression of all CYP450 enzymes measured. FIG. 4D--Dose-dependent toxicity curves and TC.sub.50 values of different compounds obtained from 24-hour dose response in hESC-H treated with LCA and MK4 (red circles). Although generally considered safe, melatonin showed clear toxicity in differentiated cells, albeit at high concentrations. FIG. 4E--TC.sub.50 values of different compounds obtained from 24-hour dose response in PHH and HepG2 cells, compared with the values obtained from LCA- and MK4-treated hESC-H (LCA/MK4) and untreated cells. Normalized TC.sub.50 toxicity profile generated for hESC-H treated with LCA and MK4 was not significantly different from primary cells (P=0.13; n=3), whereas HepG2 profile was significantly different (P=0.04; n=3). FIG. 4F--Comparison of TC.sub.50 values between PHHs and hESC-H treated with LCA and MK4 (red circles) and untreated cells (green squares). hESC-H treated with LCA and MK4 showed a striking correlation of R.sup.2=0.94 to the perfect 45-degree angle (dotted line), compared to R.sup.2=0.19 for untreated cells. Abbreviation: N.A., not appreciable.

[0085] FIGS. 5A-I demonstrate that hESC-derived hepatocytes (hESC-H) show accurate prediction of toxicological endpoints. Differentiation of 13 hESC-derived hepatocytes was carried out in the presence of LCA and MK4. FIGS. 5A-F--Fluorescence quantification of toxicological endpoints in hESC-derived hepatocytes exposed to TC20 concentrations. FIGS. 5A-B--Intracellular lipid accumulation (stcatosis) in hESC-derived hepatocytes after a 24-hour exposure to steatosis-causing drugs, measured by LipidTOX. Exposure to amiodarone, acetylsalicylic acid (aspirin) or valproic acid caused similar and significant increase in lipid accumulation (P<0.001). FIGS. 5C-D--Loss of cell polarization and bile secretion (cholestasis) after a 24-hour exposure to cholestasis-causing drugs, evaluated by CDFDA. Troglitazone, chlorpromazine (thorazine), and cyclosporine A caused a significant, 14-fold loss of epithelial polarization (P<0.003). FIGS. 5E-F--Apoptosis of hESC-derived hepatocytes after a 24-hour exposure to apoptosis-causing drugs, measured by TUNEL. Diclofenac, acetaminophen, and aflatoxin B.sub.1 caused a significant increase in DNA fragmentation, compared to control (P<0.02). FIGS. 5G-I--Exposure to TC.sub.20 concentration of melatonin caused a significant (P<0.006) increase in intracellular lipid accumulation, while not affecting bile secretion or cell viability. Abbreviation: r.u., relative units.

[0086] FIGS. 6A-J demonstrate that oleic acid (OA) and linoleic acid (LA) induce hESC derived hepatocytes maturation. FIG. 6A--images (on the left) and histograms (on the right) depicting GFP based nuclear receptor activity reporters revealing a dose dependent increase in the activation of PPAR.alpha., LXR.alpha. and PXR and no change in the activation of FXR in response to rising concentrations of oleic acid (OA) and linoleic acid (LA). The images on the left show expression of PPAR.alpha., LXR.alpha., PXR and FXR in the absence ("control, 0 .mu.M) or presence of OA and LA ("OA+LA" at 125 .mu.M of OA and LA) fatty acids. The histogram, show the dose dependent increase to 62 .mu.M, 125 .mu.M and 250 .mu.M of the OA and LA fatty acids. FIG. 6B--qRT-PCR analysis of nuclear receptors and their target genes in response to different fatty acid concentrations. These results correlate to those of the activity reporter assay, i.e. a dose dependence expression of the LXR, PPAR and PXR nuclear receptor and their target genes is observed. *p<0.05, **p<0.01. FIG. 6C--Albumin and AFP immunostaining after differentiation following a four day treatment with OA and LA. Albumin (green label), AFP (red label) and Hoechst (nuclear staining, blue label). FIG. 6D--Microscopic quantification of albumin and AFP positive cells. OA and LA induced a dose-dependent increase in albumin and decrease in AFP up to 125 .mu.M. FIG. 6E--Apoptosis increased at fatty acid concentrations above 125 .mu.M, suggesting an optimal concentration of about 100 .mu.M OA and LA. FIG. 6F--qRT-PCR analysis of hESC-derived cells cultured with 100 .mu.M OA and 100 .mu.M LA or OA+LA and PPAR antagonist GW9662 during the final maturation step. Cells show a significant PPAR dependent expression of lipid metabolism genes and albumin. FIG. 6G--hESC derived hepatocytes (hESC-H) showed 2-fold increase in albumin secretion following treatment with 100 .mu.M OA and LA, an that was blocked by PPAR inhibitor GW9662. FIG. 6H Histogram (FIG. 6I) a 7% increase in nuclear localization in cells cultured with OA and LA, and a 50% increase in nuclear localization when 100 .mu.M LA was replaced with 100 .mu.M 9CLA, compared to un treated cells. GW9662 treatment leads to a significant decrease in nuclear localization reversing fatty acids effect. FIG. 6I--qRT-PCR analysis of PXR and its CYP450 target genes. Supporting PPAR-dependent PXR activation, CYP3A4 and CYP2C9 gene expression increased significantly in response to 9CLA and were down-regulated after GW9662 treatment. FIG. 6J--CYP450 activity of hESC-H treated with 100 M OA and LA, or 100 .mu.M OA and 9CLA, compared to untreated hESC-H (control), adult human hepatocytes (hepatocytes), and HepG2 cells. hESC-H treated with OA and 9CLA exhibit higher CYP450 activity than HepG2 and untreated cells. MFC and BFC breakdown in differentiated cells is lower than primary cells, but higher than control.

[0087] FIGS. 7A-J demonstrate that hESC-derived hepatocytes exhibit PPAR-dependent increase in mitochondrial mass in response to fatty acids. FIG. 7A--TEM representative pictures of hESC-derived control cells, OA+LA treated and OA+9CLA treated cells. All cells were metabolically active with large amounts of stored glycogen (dark dotes), rough and smooth ER and mitochondria. Treated cells had more lipid droplets and their mitochondria had a narrower morphology compared to control (black arrows). Bar=2000 nm. FIGS. 7B-C--TEM based measurements of average mitochondria diameter (FIG. 7B) and cellular and nuclear area (FIG. 7C). Similar to postnatal mitochondria development, treated cells were bigger and the average mitochondria diameter was reduced. FIG. 7D--HSP60/Actin/Hoechst immunofluorescence (IF) staining, and CellProfiler analysis (black and white) of mitochondrial network. FIGS. 7E-H--Quantification of minor (FIG. 7E) and major (FIG. 7F) mitochondria axis length, eccentricity (FIG. 7G) and HSP60 relative expression (FIG. 7H), according to IF analyses. Treated cells exhibit a more elongated and less fragmented morphology indicating the development of a mature mitochondrial network. Treatment with GW9662 reversed the effect. Mitochondria mass increased by 20% (p<0.001). FIG. 7I--Apoptosis remained unchanged in all treatments indicating that the morphological alteration were not a result of cell death. FIG. 7J--qRT-PCR of key genes in mitochondria biogenesis, fusion and fission supporting molecular mechanism underlie morphological changes. Selected key regulatory genes in mitochondrial function and morphology were all up-regulated in a PPAR dependent manner, with MFN2 increasing more significantly increasing the fusion/fission ratio.

[0088] FIGS. 8A-B demonstrate that fatty acids dramatically increase mitochondrial activity of hESC-derived hepatocytes. FIGS. 8A-B--Dynamic OCR measurements during mitochondrial stress test (Seahorse Biosciences) (FIG. 8A) and histogram summary of fluxes (FIG. 8B). Treatment with 100 .mu.M OA and LA increased basal respiration, ATP production and maximal respiration of hESC-H. Replacing LA with 9CLA showed further increase, reaching 60% of primary human hepatocytes. Results are presented as mean.+-.s.d *p<0.05, **p<0.01.

[0089] FIG. 9 is a histogram depicting the generalization of the hPSC-H protocol across multiple cell lines. qRT-PCR analysis of hepatocyte differentiation protocol on Day 16, using hESC lines 13 (Technion), H9 (WiCell), and HuES8 (Harvard) as well as hiPSC lines 12F2 (HUJI) and U21 (KUL). Results are normalized to the hESC 13 line reported (FIGS. 1A-H-3A-F).

[0090] FIG. 10 is a schematic model for proposed mechanism demonstrating that microbial-derived bile acid LCA and 9CLA affect hepatocyte maturation through parallel pathways controlled by nuclear receptors PXR and PPARA, respectively.

[0091] FIGS. 11A-B depict schematic illustrations of the differentiation method according to some embodiments of the invention.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0092] The present invention, in some embodiments thereof, relates to methods of increasing metabolic maturation of immature hepatocytes and isolated hepatocytes resulting thereof.

[0093] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details of construction and the arrangement of the components and/or methods set forth in the following description and/or illustrated in the drawings and/or the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0094] Due to recent developments in Pluripotent Stem Cell (PSC) hepatic differentiation and maturation, PSC-derived hepatocytes are now considered a reliable cellular alternative for drug development and clinical applications. The present inventors have previously shown that post-partum microbial-derived cues, litocholic acid and vitamin K.sub.2, can drive the metabolic maturation of hESC-derived and fetal hepatocytes by activating PXR (Avior, 2015).

[0095] The present inventors report a four-step 16 to 18 day differentiation protocol to produce a homogenous culture of hPSC-derived hepatocytes. The present inventors have uncovered that the addition of oleic acid (OA) and LA to the last stage of PSC differentiation induces a dose-dependent activation of key hepatic nuclear receptors, PPAR, PXR and LXR, essential for the metabolic functionality of the mature hepatocyte. Further supporting the fatty acid-induced maturation, albumin expression increased in a PPAR dependent manner concurrently with a decrease in alpha-fetoprotein (AFP) expression. Replacing LA with microbial derived 9CLA promoted an additional PPAR-dependent PXR activation, increasing nuclear localization by 30% and up-regulating CYP450 gene expression and activity. Functional and morphological analyses performed to evaluate the influence of fatty acids, showed a PPAR dependent increase in mitochondrial function, biogenesis and fusion, resulting in a significant increase in mitochondrial mass and the relevant metabolic fluxes, which are critical for proper hepatocyte function. This work provides fresh insights into the role of postnatal nutritional cues in hepatic maturation and mitochondrial development via the activation of lipid regulated PPAR. This work sheds light on the tight link between nutrition, gut colonization and cellular developmental processes that underlie haptic maturation.

[0096] According to an aspect of some embodiments of the invention there is provided a method of increasing metabolic maturation of an immature hepatocyte, the method comprising contacting an immature hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with an effective amount of a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby increasing the metabolic maturation of the immature hepatocyte.

[0097] It should be noted that the fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil are capable of activating the PPAR.alpha. (peroxisome proliferator-activated receptor alpha) and optionally the PPAR.gamma. (peroxisome proliferator-activated receptor gamma).

[0098] PPAR is subfamily of the nuclear receptor superfamily of transcription factors, plays important roles in lipid and glucose metabolism, and has been implicated in obesity-related metabolic diseases such as hyperlipidemia, insulin resistance, and coronary artery disease.

[0099] PPAR.alpha. (peroxisome proliferator-activated receptor alpha) is a fatty acid-activated member of the PPAR subfamily. It is expressed primarily in metabolic tissues (brown adipose tissue, liver, kidney) but elevated levels are also present in the digestive (jejunum, ileum, colon, gall bladder) and cardiopulmonary (aorta, heart) systems (Sher T, et al. 1993; "cDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptor". Biochemistry 32 5598-604).

[0100] PPAR.gamma. (peroxisome proliferator-activated receptor gamma) is a fatty acid-activated member of the PPAR subfamily. It is expressed at low levels in most physiological systems, including the central nervous system (CNS), endocrine system, gastrointestinal system, reproductive system, cardiopulmonary system and metabolic tissues, but is most highly expressed in brown and white adipose tissue (Elbrecht A, et al. 1996; "Molecular cloning, expression and characterization of human peroxisome proliferator activated receptors gamma 1 and gamma 2". Biochem. Biophys. Res. Commun. 224 431-7 V).

[0101] The phrase "immature hepatocyte" refers to a hepatocyte cell which expresses alpha-fetoprotein and produces albumin. It should be noted that an immature hepatocyte is also characterized by the expression of cytochrome 3A7 (CYP3A7).

[0102] According to some embodiments of the invention, the immature hepatocyte is characterized by an alpha-fetoprotein (AFP)*/Albumin*/CYP3A7*/SOX2-/OCT4-expression signature.

[0103] According to some embodiments of the invention, the immature hepatocyte is characterized by production of at least 1 g Albumin/ml/mg cellular protein (e.g., 1.5 g albumin per ml per mg cellular protein).

[0104] According to some embodiments of the invention, the immature hepatocyte is characterized by production of at least 25 .mu.g AFP/ml/mg cellular protein (e.g., 37 .mu.g AFP/ml/mg cellular protein).

[0105] According to some embodiments of the invention, the immature hepatocyte does not differentiate into bile duct cells.

[0106] According to some embodiments of the invention, the metabolic maturation comprises an increase in a mitochondrial mass per cell as compared to the mitochondrial mass in a control immature hepatocyte.

[0107] As used herein the phrase "mitochondria mass" refers to number of mature mitochondria per cell.

[0108] According to some embodiments of the invention, the increase in the mitochondrial mass comprises an increase in a proliferation rate of the mitochondria as compared to a proliferation rate of the mitochondria in a control immature hepatocyte.

[0109] According to some embodiments of the invention, the proliferation of the mitochondria comprises biogenesis, fission and/or fusion of the mitochondria.

[0110] According to some embodiments of the invention, the metabolic maturation comprises an increase in a maturation state of the mitochondria as compared to a maturation state of a control immature hepatocyte.

[0111] It should be that a mature mitochondria refers to elongated, cristae-rich mitochondria organelle connected in network, which express mitochondrial proteins such as HSP60.

[0112] According to some embodiments of the invention, the immature hepatocyte is from a newborn human individual.

[0113] According to some embodiments of the invention, the immature hepatocyte is obtained by an in vitro differentiation of a pluripotent stem cell.

[0114] As used herein the term "fatty acid" refers to a carboxylic acid with an aliphatic chain.

[0115] According to some embodiments of the invention, the aliphatic chain comprises an even number of carbon atoms. For example, the aliphatic chain of the fatty acid can include between 4 to 28 carbon atoms.

[0116] The aliphatic compounds can be saturated (saturated fatty acid) joined by single bonds (alkanes), or an unsaturated (unsaturated fatty acid), with double bonds (alkenes) or triple bonds (alkynes). Besides hydrogen, other elements can be bound to the carbon chain, the most common being oxygen, nitrogen, sulfur, and chlorine.

[0117] It should be noted that a fatty acid is not a steroid based molecule. Thus, fatty acid with an aliphatic chain is entirely different from a bile acid such as lithocholic acid, which includes aromatic rings in the backbone.

[0118] According to some embodiments of the invention, the derivative of the fatty acid is a prostaglandin molecule. Prostaglandins are lipids derived from fatty acids (they have one 5-carbon ring). Each prostaglandin contains 20 carbon atoms, including a 5-carbon ring.

[0119] According to some embodiments of the invention, the fatty acid is non-conjugated.

[0120] According to some embodiments of the invention, the concentration of the non-conjugated fatty acid is at least 50 .mu.M, e.g., at least 55 .mu.M, e.g., at least 60 .mu.M, e.g., at least 65 .mu.M, e.g., at least 70 .mu.M, e.g., at least 75 .mu.M, e.g., at least 80 .mu.M, e.g., at least 85 .mu.M, e.g., at least 90 .mu.M, e.g., at least 95 .mu.M, e.g., at least 100 .mu.M, e.g., at least 105 .mu.M, e.g., between 80-150 .mu.M, e.g., between 80-120 .mu.M, e.g., 90-110 .mu.M. e.g., about 100 .mu.M.

[0121] According to some embodiments of the invention, the concentration of the non-conjugated fatty acid does not exceed 240 .mu.M.

[0122] According to some embodiments of the invention, the non-conjugated fatty acid is selected from the group consisting of oleic acid (OA), Palmitic Acid and linoleic acid (LA).

[0123] According to some embodiments of the invention, the fatty acid is a conjugated fatty acid.

[0124] According to some embodiments of the invention, the conjugated fatty acid is provided at a concentration of at least 50 .mu.M, e.g., at least 55 .mu.M, e.g., at least 60 .mu.M, e.g., at least 65 .mu.M, e.g., at least 70 .mu.M, e.g., at least 75 .mu.M, e.g., at least 80 .mu.M, e.g., at least 85 .mu.M, e.g., at least 90 .mu.M, e.g., at least 95 .mu.M, e.g., at least 100 .mu.M, e.g., at least 105 .mu.M, e.g., at least 110 .mu.M, e.g., at least 115 .mu.M, e.g., at least 120 .mu.M, e.g., at least 125 .mu.M, e.g., at least 130 .mu.M, e.g., at least 135 .mu.M, e.g., at least 140 .mu.M, e.g., at least 145 .mu.M, e.g., at least 150 .mu.M, e.g., at least 155 .mu.M, e.g., at least 160 .mu.M, e.g., at least 165 .mu.M, e.g., at least 170 .mu.M, e.g., at least 175 .mu.M, e.g., at least 180 .mu.M, e.g., at least 185 .mu.M, e.g., at least 190 .mu.M, e.g., at least 200 .mu.M, e.g., between 80-150 .mu.M, e.g., between 80-120 .mu.M, e.g., 90-110 .mu.M. e.g., about 100 .mu.M.

[0125] According to some embodiments of the invention, the concentration of the conjugated fatty acid does not exceed 240 .mu.M.

[0126] According to some embodiments of the invention, the conjugated fatty acid is provided at a concentration of 50-200 .mu.M.

[0127] According to some embodiments of the invention, the conjugated fatty acid is 9-cis, 11-trans conjugated linoleic acid (9CLA).

[0128] According to some embodiments of the invention, the conjugated fatty acid is selected from the group consisting of a conjugated linoleic acid which comprises two conjugated double bonds, a conjugated linoleic acid which comprises three conjugated double bonds, 9E,11Z,15E-octadeca-9,11,15-trienoic acid (Rumelenic acid), 9E,11Z,13Z,15E-octadeca-9,11,13,15-tetraenoic acid (.alpha.-Parinaric acid), all trans-octadeca-9,11,13,15-tretraenoic acid (.beta.-Parinaric) acid, and 5Z,8Z,10E,12E,14Z-eicosanoic acid (Bosseopentaenoic acid).

[0129] According to some embodiments of the invention, the conjugated linoleic acid which comprises two conjugated double bonds is selected from the group consisting of 9Z,11E-octadeca-9,11-dienoic acid (Rumenic acid or Bovinic acid) and 10E,12Z-octadeca-10,12-dienoic acid (10CLA).

[0130] According to some embodiments of the invention, the conjugated linoleic acid which comprises three conjugated double bonds is selected from the group consisting of 8E,10E,12Z-octadecatrienoic acid (.alpha.-Calendic acid), 8E,10E,12E-octadecatrienoic acid (.beta.-Calendic acid), 8Z,10E,12Z-octadecatrienoic acid (Jacaric acid), 9Z,11E,13E-octadeca-9,11,13-trienoic acid (.alpha.-Eleostearic acid), 9E,11E,13E-octadeca-9,11,13-trienoic acid (.beta.-Eleostearic acid), 9Z,11Z,13E-octadeca-9,11,13-trienoic acid (Catalpic acid), and 9Z,11E,13Z-octadeca-9,11,13-trienoic acid (Punicic acid).

[0131] According to some embodiments of the invention, the fatty acid is an omega 3 polyunsaturated fatty acid.

[0132] According to some embodiments of the invention, the omega 3 polyunsaturated fatty acid is selected from the group consisting of all-cis 7,10,13-hexadecatrienoic acid (Hexadecatrienoic acid (HTA)), all-cis-9,12,15-octadecatrienoic acid (Alpha-linolenic acid (ALA)), all-cis-6,9,12,15,-octadccatctracnoic acid (Stearidonic acid (SDA)), all-cis-11,14,17-eicosatrienoic acid (Eicosatrienoic acid (ETE)), all-cis-8,11,14,17-eicosatetraenoic acid (Eicosatetraenoic acid (ETA)), all-cis-5,8,11,14,17-eicosapentaenoic acid (Eicosapentaenoic acid (EPA, Timnodonic acid)), all-cis-6,9,12,15,18-heneicosapentaenoic acid (Heneicosapentaenoic acid (HPA)), all-cis-7,10,13,16,19-docosapentaenoic acid (Docosapentaenoic acid (DPA, Clupanodonic acid)), all-cis-4,7,10,13,16,19-docosahexaenoic acid (Docosahexaenoic acid (DHA, Cervonic acid)), all-cis-9,12,15,18,21-tetracosapentaenoic acid (Tetracosapentaenoic acid), and all-cis-6,9,12,15,18,21-tetracosahexaenoic acid (Tetracosahexaenoic acid (Nisinic acid)).

[0133] According to some embodiments of the invention, the amphipathic carboxylic acid comprises a fibrate.

[0134] Fibrates are amphipathic carboxylic acids, which are metabolized by CYP3A4. In addition, fibrates are known for their ability to activate PPAR (peroxisome proliferator-activated receptors), a group of nuclear receptors, especially PPAR.alpha..

[0135] According to some embodiments of the invention, the fibrate is provided at a concentration in the range of 5 nM to 120 .mu.M, e.g., from 50 nM to 100 .mu.M, e.g., from 100 nM to 50 .mu.M, e.g., from 1 .mu.M to 50 .mu.M, e.g., in the range of 5-30 .mu.M, e.g., in the range of 5-25 .mu.M, e.g., about 5 .mu.M, about 10 .mu.M, about 15 .mu.M, about 20 .mu.M.

[0136] According to some embodiments of the invention, the fibrate is selected from the group consisting of Fenofibrate (e.g. TriCor), Bezafibrate (e.g. Bezalip), Ciprofibrate (e.g. Modalim), Clofibrate, Gemfibrozil (e.g. Lopid), and Clinofibrate (e.g. Lipoclin).

[0137] According to some embodiments of the invention, the concentration of fenofibrate is between 10-30 .mu.M, e.g., about 20 .mu.M.

[0138] According to some embodiments of the invention, the concentration of WY14643 is between 5-20 .mu.M, e.g., about 10 .mu.M.

[0139] According to some embodiments of the invention, the concentration of GW7647 is between 5-20 .mu.M, e.g., about 10 .mu.M.

[0140] Thiazolidinediones (also known as "Glitazones") are a class of medications that act by activating PPARs (peroxisome proliferator-activated receptors), with greatest specificity for PPAR.gamma. (PPAR-gamma, PPARG). The endogenous ligands for these receptors are free fatty acids (FFAs) and cicosanoids.

[0141] According to some embodiments of the invention, the Thiazolidinedione is provided at a concentration in the range of about 20 nM to about 120 .mu.M, e.g., from 50 nM to 100 .mu.M, e.g., from 100 nM to 50 .mu.M, e.g., from 1 .mu.M to 50 .mu.M, e.g., in the range of 0.5-30 .mu.M, e.g., in the range of 0.5-25 .mu.M, e.g., about 0.5 .mu.M, about 1 .mu.M, about 5 .mu.M, about 10 .mu.M, about 15 .mu.M.

[0142] According to some embodiments of the invention, the Thiazolidinedione is selected from the group consisting of Pioglitazone (Actos), Rosiglitazone (Avandia), Lobeglitazone (Dulie), Troglitazone (Rezulin), Ciglitazone, Darglitazone, Englitazone, Netoglitazone, and Rivoglitazone.

[0143] According to some embodiments of the invention, the concentration of rosiglitazone is between 1-10 .mu.M, e.g., about 5 .mu.M.

[0144] According to some embodiments of the invention, the concentration of troglitazone is between 0.5-10 .mu.M, e.g., about 0.5-5 .mu.M, e.g., about 1 .mu.M.

[0145] According to some embodiments of the invention, the method further comprising contacting the immature hepatocyte with insulin and/or dexamethasone.

[0146] As used herein the term "insulin" refers to the mature insulin polypeptide having A chain and B chain, which are covalently linked via two disulfide bonds. Also known as CAS Number 11061-68-0; EC Number 234-279-7; MDL number MFCD00131380. The precursor polypeptide preproinsulin is cleaved to remove the precursor signal peptide, and then the proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. There are 4 polypeptide variants, encoding the same protein: variant 1 [GenBank Accession No. NM_000207.2 (SEQ ID NO: 81), GenBank Accession No. NP_000198.1 (SEQ ID NO: 82)], variant 2 [GenBank Accession No. NM_001185097.1 (SEQ ID NO: 83), GenBank Accession No. NP_001172026.1 (SEQ ID NO: 84)]; variant 3 [GenBank Accession No. NM_001185098.1 (SEQ ID NO: 85), GenBank Accession No. NP_001172027.1 (SEQ ID NO: 86)]; and variant 4 [GenBank Accession No. NM_001291897.1 (SEQ ID NO: 87), GenBank Accession No. NP_001278826.1 (SEQ ID NO: 88)]. Insulin can be provided from various suppliers such as Sigma-Aldrich (e.g., recombinant human insulin Catalogue Number 91077C).

[0147] According to some embodiments of the invention, the insulin is provided at a concentration of 2.5.times.10-5 IU/mL to 1 IU/mL, e.g., between 0.1 IU/mL to about 0.5 IU/mL, e.g., about 0.24 IU/mL. It should be noted that IU/mL is an abbreviation of "International Units Per Millilitre (milliliter)".

[0148] Dexamethasone is a corticosteroid medication which can be obtained from various suppliers such as Ark Pharm, Inc., Sigma-Aldrich, Parchem, and AvaChem Scientific.

[0149] According to some embodiments of the invention, the dexamethasone is provided at a concentration of about 4 nM to about 100 .mu.M, e.g., between 4 nM to about 200 nM, e.g., between 50-150 nM, e.g., between 70-120 nM, e.g., about 100 nM.

[0150] According to some embodiments of the invention, the method further comprising contacting the immature hepatocyte with basic fibroblast growth factor.

[0151] Basic fibroblast growth factor (also known as bFGF, FGF2 or FGF-.beta.) is a member of the fibroblast growth factor family. BFGF [(e.g., human bFGF polypeptide GenBank Accession No. NP_001997.5 (SEQ ID NO:69); human bFGF polynucleotide GenBank Accession No. NM_002006.4 (SEQ ID NO:70)] can be obtained from various commercial sources such as Cell Sciences.RTM., Canton, Mass., USA (e.g., Catalogue numbers CRF001A and CRF001B), Invitrogen Corporation products, Grand Island N.Y., USA (e.g., Catalogue numbers: PHG0261, PHG0263, PHG0266 and PHG0264), ProSpec-Tany TechnoGene Ltd. Rehovot, Israel (e.g., Catalogue number: CYT-218), and Sigma, St Louis, Mo., USA (e.g., catalogue number: F0291).

[0152] According to some embodiments of the invention, the BFGF is provided at a concentration of 0.1-100 ng/ml, e.g., about 0.2-80 ng/ml, e.g., about 0.4-70 ng/ml. e.g., about 0.5-60 ng/ml, e.g., about 0.8-50 ng/ml, e.g., between about 1 ng/ml to about 40 ng/ml, e.g., about 1-10 ng/ml, e.g., about 2-8 ng/ml. e.g., about 3-6 ng/ml, e.g., about 4-5 ng/ml. e.g., about 4 ng/ml.

[0153] According to some embodiments of the invention, the method further comprising contacting the immature hepatocyte with hepatocyte growth factor (HGF).

[0154] Hepatocyte growth factor (HGF) is a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. HGF is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. Transcription of the HGF gene (Gene ID: 3082) results in 5 isoforms: HGF isoform 1 preproprotein [mRNA GenBank Accession No. NM_000601.5 (SEQ ID NO: 71), polypeptide GenBank Accession No. NP_000592.3 (SEQ ID NO:72); HGF isoform 2 precursor [mRNA GenBank Accession No. NM_001010931.2 (SEQ ID NO: 73), polypeptide GenBank Accession No. NP_001010931.1 (SEQ ID NO: 74)], HGF isoform 3 preproprotein [mRNA GenBank Accession No. NM_001010932.2 (SEQ ID NO: 75), polypeptide GenBank Accession No. NP_001010932.1 (SEQ ID NO:76)], HGF isoform 4 precursor [mRNA GenBank Accession No. NM_001010933.2 (SEQ ID NO: 77), polypeptide GenBank Accession No. NP_001010933.1 (SEQ ID NO: 78)], HGF isoforn 5 precursor [mRNA GenBank Accession No. NM_001010934.2 (SEQ ID NO: 79), polypeptide GenBank Accession No. NP_001010934.1 (SEQ ID NO: 80)]. Known suppliers of HGF include PeproTech.RTM. Rocky Hill, N.J. USA [e.g., recombinant human HGF (HEK293 derived), Catalogue Number 100-39H], LSBio LifSpan BioSciences, Inc. [e.g., recombinant human HGF Catalogue Number LS-G27264] and ThermoFisher SCIENTIFIC [e.g., HGF Recombinant Human Protein Catalogue Number PHG0254].

[0155] According to some embodiments of the invention, the HGF is provided at a concentration of 0.1 ng/mL to 100 ng/mL, e.g., about 0.2-80 ng/ml, e.g., about 0.4-70 ng/ml. e.g., about 0.5-60 ng/ml, e.g., about 0.8-50 ng/ml, e.g., between about 1 ng/ml to about 40 ng/ml, e.g., about 1-30 ng/ml, e.g., about 2-20 ng/ml. e.g., about 3-15 ng/ml, e.g., about 4-15 ng/ml. e.g., about 10 ng/ml.

[0156] Any of the proteinaceous factors used by the method of some embodiments of the invention (e.g., the insulin, bFGF, HGF) can be recombinantly expressed or biochemically synthesized. In addition, naturally occurring proteinaceous factors such as bFGF can be purified from biological samples (e.g., from human serum, cell cultures) using methods well known in the art. It should be noted that for the preparation of an animal contaminant-free culture medium the proteinaceous factor is preferably purified from a human source or is recombinantly expressed.

[0157] Biochemical synthesis of the proteinaceous factors of the present invention (e.g., the insulin, bFGF, HGF) can be performed using standard solid phase techniques. These methods include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation and classical solution synthesis.

[0158] Recombinant expression of the proteinaccous factors of the present invention can be generated using recombinant techniques such as described by Bitter et al., (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al. (1984) Nature 310:511-514, Takamatsu et al. (1987) EMBO J. 6:307-311, Coruzzi et al. (1984) EMBO J. 3:1671-1680, Brogli et al., (1984) Science 224:838-843, Gurley et al. (1986) Mol. Cell. Biol. 6:559-565 and Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463. Specifically, the IL6RIL6 chimera can be generated as described in PCT publication WO 99/02552 to Revel M., et al. and Chebath J, et al., 1997, which are fully incorporated herein by reference.

[0159] Methods of synthesizing the fatty acids, bile acids, steroids, amphipathic carboxylic acids, Thiazolidinediones (TZD), WY-14643 (Pirinixic Acids), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil are known in the art. According to some embodiments of the invention, the method is performed in-vitro.

[0160] According to some embodiments of the invention, contacting or administering the effective amount of the fatty acid or the small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil is performed in the absence of an IL6 ligand.

[0161] It should be noted that the phrase "absence of the IL6 ligand" does not exclude presence of trace concentrations of the IL6 ligand, i.e., below 5 ng/ml. Thus, for example, the method of increasing the metabolic maturation of an immature hepatocyte or the method of treating the subject diagnosed with the pathology characterized by immature hepatocytes can be performed by contacting or administering an effective amount of the fatty acid or the small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil in the presence of a trace concentration of an IL6 ligand.

[0162] According to some embodiments of the invention, the trace concentration of the IL6 ligand does not exceed 5 ng/ml of the IL6 ligand, e.g., does not exceed 4 ng/ml of the IL6 ligand, e.g., does not exceed 3 ng/ml of the IL6 ligand, e.g., does not exceed 2 ng/ml of the IL6 ligand, e.g., does not exceed 1 ng/ml of the IL6 ligand, e.g., does not exceed 0.1 ng/ml of the IL6 ligand, e.g., does not exceed 0.05 ng/ml of the IL6 ligand, e.g., does not exceed 0.01 ng/ml of the IL6 ligand.

[0163] According to some embodiments of the invention, the IL6 ligand is selected from the group consisting of oncostatin M (OSM) or a functional equivalent thereof, interleukin 6 (IL6) or a functional equivalent thereof, leukemia inhibitory factor (LIF) or a functional equivalent thereof, leptin (OB) or a functional equivalent thereof, Cardiotrophin-1/CT-1 or a functional equivalent thereof, CLC or a functional equivalent thereof, CNTF or a functional equivalent thereof, G-CSF or a functional equivalent thereof, IL-11 or a functional equivalent thereof, IL-31 or a functional equivalent thereof, and Neuropoietin/NP or a functional equivalent thereof.

[0164] According to some embodiments of the invention, the IL6 ligand is selected from the group consisting of oncostatin M (OSM), interleukin 6 (IL6), leukemia inhibitory factor (LIF), leptin (OB), Cardiotrophin-1/CT-1, CLC, CNTF, G-CSF, IL-11, IL-31, and Neuropoietin/NP.

[0165] According to some embodiments of the invention, the IL6 ligand is oncostatin M (OSM).

[0166] According to some embodiments of the invention, the immature hepatocyte is obtained by an in vitro differentiation of an hepatoblast.

[0167] The phrase "hepatoblast" refers to an hepatocyte-like cell which expresses alpha-fetoprotein but not albumin.

[0168] According to some embodiments of the invention, the in vitro differentiation of the hepatoblast is performed by culturing the hepatoblast for a pre-determined time period in a culture medium which comprises an IL6 ligand.

[0169] According to some embodiments of the invention, prior to formation of the hepatoblast the fatty acid and/or the small molecule are absent from a culture comprising the hepatoblast.

[0170] According to some embodiments of the invention, the culture medium which comprises the IL6 ligand further comprises dexamethasone, basic fibroblast growth factor (FGF2) and insulin.

[0171] Thus, the method of some embodiments of the invention can be used to generate mature hepatocytes, which can be used in various therapeutic applications.

[0172] According to an aspect of some embodiments of the invention there is provided a method of treating a subject diagnosed with a pathology characterized by immature hepatocytes, the method comprising administering to the subject an effective amount of a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, Perfluorooctanoic Acid, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby increasing the metabolic maturation of the immature hepatocytes and treating the subject.

[0173] The term "treating" refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

[0174] As used herein, the term "subject" includes mammals, preferably human beings at any age which suffer from the pathology. Preferably, this term encompasses individuals who are at risk to develop the pathology.

[0175] Non-limiting examples of pathologies characterized by an immature hepatocyte include, hyperbilirubinemia (newborn jaundice), as well as pre-term infants, infants born by C-section and the like.

[0176] As described in the Examples section which follows, the present inventors have uncovered that the metabolic maturation of the immature hepatocyte can be also increased using PXR agonist under conditions devoid of an IL6 ligand.

[0177] According to an aspect of some embodiments of the invention there is provided a method of increasing metabolic maturation of an immature hepatocyte, the method comprising contacting an immature hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with a medium which is devoid of an IL6 ligand and which comprises an effective amount of a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid, thereby increasing the metabolic maturation of the immature hepatocyte, wherein the effective amount of the PXR agonist increases the expression of a PXR target gene selected from the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds.

[0178] As used herein the term "PXR" refers to the pregnane X receptor (PXR) (also known as NR1/2), a nuclear receptor controlling the expression of CYP450 enzymes such as CYP2C9 and CYP3A4.

[0179] The primary function of the PXR nuclear receptor is to sense the presence of foreign toxic substances and in response up regulate the expression of proteins involved in the detoxification and clearance of these substances from the body. PXR is a transcriptional regulator of the cytochrome P450 gene CYP3A4, binding to the response element of the CYP3A4 promoter as a heterodimer with the 9-cis retinoic acid receptor RXR.

[0180] PXR is activated by a large number of endogenous and exogenous chemicals including steroids (e.g., progesterone, 17.alpha.-hydroxyprogesterone, 17.alpha.-hydroxypregnenolone, 5.alpha.-dihydroprogesterone, 5.beta.-dihydroprogesterone, allopregnanolone, corticosterone, cyproterone acetate, spironolactone, dexamethasone, mifepristone), antibiotics (e.g., rifampicin, rifaximin), antimycotics, bile acids, hyperforin (a constituent of the herbal antidepressant St. John's Wort), and many herbal and other compounds (e.g., meclizine, paclitaxel).

[0181] As used herein the phrase "bile acid" refers to a steroid acid found predominantly in the bile of mammals and other vertebrates.

[0182] A steroid is an organic compound with four rings arranged in a specific configuration. The steroid core structure is composed of seventeen carbon atoms, bonded in four "fused" rings: three six-member cyclohexane rings and one five-member cyclopentane ring. Steroids vary by the functional groups attached to this four-ring core and by the oxidation state of the rings. Sterols are forms of steroids with a hydroxyl group at position three and a skeleton derived from cholestane. They can also vary more markedly by changes to the ring structure (for example, ring scissions which produce secosteroids such as vitamin D3).

[0183] Examples of steroids include, but are not limited to the dietary lipid cholesterol, the sex hormones estradiol and testosterone and the anti-inflammatory drug dexamethasone. Steroids have two principal biological functions: certain steroids (such as cholesterol) are important components of cell membranes which alter membrane fluidity, and many steroids are signaling molecules which activate steroid hormone receptors. Hundreds of steroids are found in plants, animals and fungi. All steroids are manufactured in cells from the sterols lanosterol (animals and fungi) or cycloartenol (plants). Lanosterol and cycloartenol are derived from the cyclization of the triterpene squalene.

[0184] Non-limiting examples of bile acids which can be used according to the method of some embodiments of the invention include, lithocolic acid (LCA), Chenodeoxycholic acid (CDCA), cholic acid, deoxycholic acid, ursodeoxycholic acid, or their derivatives.

[0185] According to some embodiments of the invention, the bile acid is lithocolic acid (LCA).

[0186] According to some embodiments of the invention, the bile acid is Chenodeoxycholic acid (CDCA).

[0187] According to some embodiments of the invention, the bile acid is provided at a concentration range of 1 .mu.M to about 250 .mu.M, e.g., between about 1 .mu.M to about 200 M, e.g., in the range of 2-20 .mu.M, e.g., 5-15 .mu.M, e.g., 7-12 .mu.M, e.g., about 10 .mu.M; additionally or alternatively in the range of 50-200 .mu.M, e.g., 70-150 .mu.M, e.g., 80-120 .mu.M, e.g., about 100 .mu.M.

[0188] According to some embodiments of the invention, the concentration of lithocolic acid (LCA) is between 1-20 .mu.M, e.g., about 5-15 .mu.M, e.g., about 10 .mu.M.

[0189] According to some embodiments of the invention, the concentration of Chenodeoxycholic acid (CDCA) is between 50-200 .mu.M, e.g., 70-150 .mu.M, e.g., 80-120 .mu.M, e.g., about 100 .mu.M.

[0190] According to some embodiments of the invention, the PXR agonist small molecule is selected from the group consisting of: Rifampicin, T0901317, SR12813, mevastatin, rifaximin, hyperforin, meclizine, paclitaxel, atorvastatin, pregnenolone-16alpha-carbonitrile, Butamben and 24(S),25-Epoxycholesterol.

[0191] According to some embodiments of the invention, the concentration of the small molecule PXR agonist is from about 50 nM to about 100 .mu.M, e.g., from about 100 nM to about 80 .mu.M, e.g., from 500 nM to about 80 .mu.M, e.g., from about 700 nM to about 70 .mu.M, e.g., from about 1 .mu.M to about 50 .mu.M, e.g., about 1-5 .mu.M, e.g., about 10-60 .mu.M, e.g., about 1 .mu.M, e.g., about 50 .mu.M.

[0192] According to some embodiments of the invention, the concentration of SR12813 is about 0.5-5 .mu.M, e.g., about 0.8-4 .mu.M, e.g., about 0.8-2 .mu.M, e.g., about 1 .mu.M.

[0193] According to some embodiments of the invention, the concentration of rifampicin is about 1-60 .mu.M, e.g., about 5-50 .mu.M, e.g., about 10-30 .mu.M, e.g., about 20-30 .mu.M, e.g., about 25 .mu.M.

[0194] According to some embodiments of the invention, the PXR agonist steroid is selected from the group consisting of progesterone, 17.alpha.-hydroxyprogesterone, 17.alpha.-hydroxypregnenolone, 5.alpha.-dihydroprogesterone, 5.beta.-dihydroprogesterone, allopregnanolone, corticosterone, cyproterone acetate, spironolactone, dexamethasone, and mifepristone.

[0195] According to some embodiments of the invention, the concentration of the steroid PXR agonist is in the range of about 1 .mu.M to about 100 .mu.M, e.g., about 1-50 M, e.g., about 1-30 .mu.M, e.g., about 1-20 .mu.M, e.g., about 1-10 .mu.M, e.g., about 5 .mu.M, e.g., about 7 .mu.M.

[0196] According to some embodiments of the invention, the effective amount of the PXR agonist causes differentiation of said immature hepatocyte into a mature hepatocyte.

[0197] Methods of monitoring the differentiation state of an hepatocyte are known in the art, and include for example RNA detection methods (e.g., RT-PCR, quantitative RT-PCR, in situ hybridization, in-situ RT-PCR), proteins detection methods [e.g., Enzyme linked immunosorbent assay (ELISA); Western blot; Radio-immunoassay (RIA); Fluorescence activated cell sorting (FACS); Immunohistochemical analysis; Immuno-fluorescence analysis; in situ activity assay; in vitro activity assays] and morphological evaluations.

[0198] According to some embodiments of the invention, the mature hepatocyte is characterized by an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup- .+/HNF4.alpha..sup.+ expression signature.

[0199] According to some embodiments of the invention, the effective amount of the PXR agonist is provided in a concentration of at least half maximal effective concentration (EC.sub.50) of the PXR agonist.

[0200] According to some embodiments of the invention, the PXR agonist is selected from the group consisting of: a small molecule and a bile acid.

[0201] It should be noted that the increase in the level of expression of the PXR target genes is compared to the level of expression of the PXR target genes in a control immature hepatocyte before being treated by the method of some embodiments of the invention using identical assay conditions.

[0202] According to some embodiments of the invention the increase in the level of expression of the PXR target gene is by at least 2-folds, e.g., at least 3-folds, e.g., at least 4-folds, e.g., at least 5-folds, e.g., at least 6-folds, e.g., at least 7-folds, e.g., at least 8-folds, e.g., at least 9-folds, e.g., at least 10-folds, e.g., at least 11-folds, e.g., at least 12-folds, e.g., at least 13-folds, e.g., at least 14-folds, e.g., at least 15-folds, e.g., at least 16-folds or more as compared to the level of expression of the PXR target gene before being subjected to the conditions of the method of some embodiments of the invention using identical assay conditions.

[0203] Methods of detecting the level of expression of the PXR target gene CYP3A4 and CYP2C9 in a cell are known in the art and include for example, RNA and/or protein detection methods, using for example, an antibody specifically bindable to the CYP3A4 or CYP2C9 protein, or with a probe specifically hybridizable with the CYP3A4 or CYP2C9 RNA sequence.

[0204] For example, the level of CYP3A4 can be detected using any of the following antibodies: Anti-CYP3A4/Cytochrome P450 3A4 Antibody (clone 3H8) LS-C169171 (LSBio, LifeSpan BioSciences, Inc); Anti-CYP3A4/Cytochrome P450 3A4 Antibody (Biotin) LS-C36104 (LSBio); Anti-CYP3A4/Cytochrome P450 3A4 Antibody IHC-plus.TM. LS-B12328 (LSBio).

[0205] For example, the level of CYP2C9 can be detected using any of the following antibodies: CYP2C9 polyclonal antibody (ThermoFisher Scientific, Catalogue numbers PA5-15037; PA5-15046; or PA1-84219), or anti-CYP2C9 antibody (Cytochrome P450, Family 2, Subfamily C, Polypeptide 9) (Middle Region) (Antibodies-online(dot)com, Cat. No. ABIN360247).

[0206] According to an aspect of some embodiments of the invention, there is provided a method of treating a subject diagnosed with a pathology characterized by immature hepatocytes, the method comprising administering to the subject a pharmaceutical composition comprising an effective amount of a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid, wherein said pharmaceutical composition is devoid of an IL6 ligand, wherein said effective amount of said PXR agonist increases the expression of a PXR target gene selected from the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds, thereby increasing the metabolic maturation of said immature hepatocytes and treating the subject.

[0207] According to an aspect of some embodiments of the invention, there is provided an isolated immature hepatocyte obtainable by the in vitro method of some embodiments of the invention and being characterized by an alpha-fetoprotein (AFP).sup.+/Albumin.sup.+/CYP3A7.sup.+/SOX2.sup.-/OCT4.sup.- expression signature, production of at least 1 .mu.g Albumin/ml/mg cellular protein and production of at least 25 .mu.g AFP/ml/mg cellular protein.

[0208] Methods of determining the level of expression of AFP, albumin, CYP3A7, SOX2 or OCT4 are well known in the art and include RNA and/or protein detection methods. Suitable antibodies include, but are not limited to, Anti-alpha 1 Fetoprotein antibody [AFP-01] (ab3980; abeam); Anti-Albumin antibody [EPSISR1] (ab137885; abcam); CYP3A7 Monoclonal Antibody (F19 P2 H2) (ThermoFisher Scientific Catalogue number MA3-034); Anti-Sox2 Antibody (Chemicon, AB5603); or Anti-POU5F1/OCT4 Antibody IHC-plus.TM. LS-B4194 (LSBio LifeSpan BioScience, Inc.).

[0209] According to some embodiments of the invention, the hepatoblast is obtainable by a method which comprises:

[0210] (a) culturing undifferentiated pluripotent stem cells in a medium which comprises activin A, B27, Wnt3A and hepatocyte growth factor (HGF) to thereby obtain cells characteristics of a definitive endoderm, and subsequently;

[0211] (b) culturing the cells characteristics of the definitive endoderm in a culture medium which comprises Dimethyl sulfoxide (DMSO), to thereby obtain the hepatoblasts.

[0212] According to some embodiments of the invention, step (b) of the method of obtaining the hepatoblast further comprises passaging the cells at least once in the culture medium which comprises the DMSO.

[0213] According to an aspect of some embodiments of the invention there is provided an isolated hepatoblast obtainable by the method of some embodiments of the invention.

[0214] According to some embodiments of the invention, the method of increasing metabolic maturation of the immature hepatocyte results in a mature hepatocyte characterized by an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup- .+/HNF4.alpha..sup.+ expression signature.

[0215] Methods of determining the level of expression of albumin, CY3A4, E-cadherin, SOX2, OCT4, A1AT, or HNF4a are well known in the art and include RNA and/or protein detection methods. Suitable antibodies include, but are not limited to, Anti-Albumin antibody [EPSISR1] (ab137885; abeam); Anti-Cytochrome P450 3A4 (CYP3A4) antibody (ab135813, abeam); Anti-E Cadherin antibody (ab15148, abeam); Anti-Sox2 Antibody (Chemicon, AB5603); Anti-POU5F1/OCT4 Antibody IHC-plus.TM. LS-B4194 (LSBio LifeSpan BioScience, Inc.); Anti-alpha 1 Antitrypsin (A1AT) antibody [G11] (ab9400, abcam); Anti-HNF-4-alpha (HNF4a) antibody [K9218]-ChIP Grade (ab41898, abeam); or HNF-4a Antibody (H-171) (Santa Cruz catalogue number: sc-8987).

[0216] According to some embodiments of the invention, the mature hepatocyte is capable of producing at least 10 .mu.g albumin per milliliter per milligram of cellular protein, e.g., at least 15 .mu.g albumin/ml/mg cellular protein.

[0217] According to an aspect of some embodiments of the invention there is provided an isolated hepatocyte obtainable by the method according to the method of some embodiments of the invention.

[0218] According to an aspect of some embodiments of the invention, there is provided an isolated hepatocyte characterized by a Cytochrome P450 3A4 (CYP3A4) activity which is capable of oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per milligram of cellular protein and an alpha feto-protein (AFP) activity of at least 60 .mu.g/day/mg cellular protein as assayed by ELISA when cultured in the presence of a culture medium which comprises Insulin-Transferrin-Selenium (ITS), Glutamax, Dexamethasone, hepatocyte growth factor (HGF), Oleic acid and 9CLA.

[0219] According to some embodiments of the invention, the isolated hepatocyte of some embodiments of the invention is characterized by a Cytochrome P450 3A4 (CYP3A4) activity which is capable of oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per milligram of cellular protein.

[0220] According to some embodiments of the invention, the isolated hepatocyte of some embodiments of the invention is characterized by an alpha-fetoprotein (AFP) production of at least 60 microgram per day per milligram cellular protein as determined by an ELISA.

[0221] According to some embodiments of the invention, the isolated hepatocyte of some embodiments of the invention is characterized by nuclear expression of PXR.

[0222] It should be noted that the isolated hepatocyte of some embodiments of the invention is distinguishable from an adult hepatocyte by at least the expression of AFP.

[0223] The phrase "adult hepatocyte" refers to an hepatocyte cell which produces albumin and which does not express alpha-fetoprotein (AFP). It should be noted that an adult hepatocyte is also characterized by the expression of cytochrome 3A4 (CYP3A4).

[0224] According to an aspect of some embodiments of the invention, there is provided an isolated population of cells wherein at least about 50% of the cells comprise the isolated hepatocyte of some embodiments of the invention.

[0225] According to some embodiments of the invention, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, e.g., at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85% of the cells in the population are the isolated hepatocytes of some embodiments of the invention.

[0226] According to an aspect of some embodiments of the invention there is provided a method of screening a compound for liver toxicity, comprising:

[0227] (a) incubating the isolated population of cells of some embodiments of the invention with the compound for a pre-determined time period;

[0228] (b) determining percentage of a parameter indicative of liver toxicity following the pre-determined time period, thereby screening the compound for the liver toxicity.

[0229] According to some embodiments of the invention, the liver toxicity comprises steatosis.

[0230] According to some embodiments of the invention, the steatosis is assayable using the LipidTox neutral lipid stain.

[0231] According to some embodiments of the invention, the liver toxicity comprises cholestasis.

[0232] According to some embodiments of the invention, the cholestasis is assayable using the CDFDA (5(6)-carboxy-2',7'-dichlorofluorescein diacetate) staining.

[0233] According to some embodiments of the invention, the liver toxicity comprises apoptosis.

[0234] According to some embodiments of the invention, the apoptosis is assayable using the Terminal deoxynucleotidyl transferase dUTP nick end labeling TUNEL assay.

[0235] According to an aspect of some embodiments of the invention there is provided a kit for screening a compound for liver toxicity comprising the isolated population of cells of some embodiments of the invention and at least one agent capable of detecting a toxicological end-point selected from the group consisting of: steatosis, cholestasis and apoptosis.

[0236] According to an aspect of some embodiments of the invention there is provided a nutrition formula for an infant comprising 9CLA.

[0237] According to some embodiments of the invention the nutrition formula is an infant formula.

[0238] According to some embodiments of the invention, the concentration of the 9CLA in the nutrition formula is between about 70 mg/100 kJ to about 330 mg/100 kJ of formula.

[0239] According to some embodiments of the invention, the concentration of the 9CLA in the nutrition formula is between about 400-800 mg 9CLA per 100 ml of ready-to-use nutrition formula, e.g., between about 500-700 mg 9CLA per 100 ml of ready-to-use nutrition formula, e.g., about 500-650 mg 9CLA per 100 ml of ready-to-use nutrition formula.

[0240] According to some embodiments of the invention, the concentration of the 9CLA in the nutrition formula is between about 3-5 grams 9CLA per 100 grams of powder of the nutrition formula, e.g., between about 3.5-4.5 grams 9CLA per 100 grams of powder of the nutrition formula, e.g., between about 3.8-4.2 grams 9CLA per 100 grams of powder of the nutrition formula.

[0241] According to some embodiments of the invention, the nutrition formula is for use in a subject having a pathology characterized by immature hepatocytes, such as hyperbilirubinemia (newborn jaundice), pre-term infants, infants born by C-section and the like.

[0242] According to some embodiments of the invention, the nutrition formula of some embodiments of the invention is suitable for infants born by C-section (Caesarean section).

[0243] According to some embodiments of the invention, the nutrition formula of some embodiments of the invention is suitable for a non-breast fed infant.

[0244] According to some embodiments of the invention, the nutrition formula of some embodiments of the invention is suitable for at least the first week(s) of life, e.g., for at least one week of life, e.g., for at least two, at least three, for at least four, for at least five weeks of life.

[0245] The nutrition formula can be in a form of a powder that comprises 9CLA and can be combined with a liquid, such as water, to produce a milk-like beverage to be used by a subject in need thereof, or it can be in a liquid form (e.g., ready to use solution or suspension), e.g., for use by a subject diagnosed by or having a pathology characterized by immature hepatocytes.

[0246] According to some embodiments of the invention, the powder and resulting beverage have a balanced amino acid profile suitable for dietary management of individuals diagnosed by or having a pathology characterized by immature hepatocytes.

[0247] The nutrition formula of some embodiments of the invention may also include (a) complementary essential amino acids which are a mixture of tyrosine, arginine, tryptophan, leucine and histidine and, in combination, provide a balanced amino acid profile and (b) a carbohydrate source, which typically includes non-reducing sugars to minimize/reduce browning potential.

[0248] The nutrition formula of some embodiments of the invention may also include (a) complementary essential amino acids which are a mixture of tyrosine, arginine, tryptophan, leucine and histidine and, in combination, provide a balanced amino acid profile; (b) a carbohydrate source, which typically includes non-reducing sugars to minimize/reduce browning potential; and (c) a fat (lipid/oil) source.

[0249] The nutrition formula of some embodiments of the invention can further comprise vitamins and minerals, such as vitamins and minerals in sufficient quantities to meet the daily requirement for each.

[0250] The nutrition formula of some embodiments of the invention may also include (a) complementary essential amino acids which are a mixture of tyrosine, arginine, tryptophan, leucine and histidine and, in combination, provide a balanced amino acid profile; (b) a carbohydrate source, which typically includes non-reducing sugars to minimize/reduce browning potential; (c) a fat (lipid/oil) source [e.g., PUFA (Polyunsaturated fatty acids) such as DHA (Docosahexaenoic acid) and ARA (Arachidonic Acid)]; and typically, but optionally, (d) vitamins and minerals, such as vitamins and minerals in sufficient quantities to meet the daily requirements for each.

[0251] In addition, the nutrition formula typically, but optionally, includes flavors, which can be natural or artificial or a combination of both; coloring agents, which can be natural or artificial or a combination of both; sweetener, which can be natural or artificial or a combination of both; gelling agents, thickening agents, stabilizing agents, sequestrants, emulsifiers or a combination of two or more of gelling agents, thickening agents, stabilizing agents, sequestrants, emulsifiers, each of which can be natural or artificial or a combination of both.

[0252] Table 1, herein below, provides sequence information of the polypeptides/polynucleotides used in the methods of some embodiments of the invention.

TABLE-US-00001 TABLE 1 SEQ Representative SEQ Representative ID GenBank ID GenBank NO: Accession No. of NO: Accession of the mRNA of No. of the encoding the the Protein name protein protein protein mRNA Alpha-fetoprotein NP_001125.1 1 NM_001134.2 12 (AFP) cytochrome 3A7 NP_000756.3 2 NM_000765.4 13 (CYP3A7) cytochrome P450 family 3 subfamily A member 7 cytochrome 3A4 NP_001189784.1 3 NM_001202855.2 14 (CYP3A4) cytochrome P450 family 3 subfamily A member 4 isoform 2 cytochrome 3A4 NP_059488.2 4 NM_017460.5 15 (CYP3A4) cytochromc P450 family 3 subfamily A member 4 isoform 1 insulin NP_000198.1 65 NM_000207.2 66 basic fibroblast NP_001997.5 67 NM_002006.4 68 growth factor hepatocyte NP_000592.3 5 NM_000601.5 16 growth factor (HGF) isoform 1 hepatocyte NP_001010931.1 6 NM_001010931.2 17 growth factor (HGF) isoform 2 hepatocyte NP_001010932.1 7 NM_001010932.2 18 growth factor (HGF) isoform 3 hepatocyte NP_001010933.1 8 NM_001010933.2 19 growth factor (HGF) isoform 4 hepatocyte NP_001010934.1 9 NM_001010934.2 20 growth factor (HGF) isoform 5 HSP60 (heat NP_002147.2 10 NM_002156.4 21 shock protein family D (Hsp60) member 1) variant 1 HSP60 (heat NP_955472.1 11 NM_199440.1 22 shock protein family D (Hsp60) member 1) variant 2

[0253] Table 2 hereinbelow provides a non-limiting list of conjugated fatty acids which can be used according to some embodiments of the invention.

TABLE-US-00002 TABLE 2 Conjugated Fatty acids Common name Lipid name Chemical name Conjugated Linoleic Acids (two conjugated double bonds) Rumenic acid 18:2 (n-7) 9Z,11E-octadeca-9,11-dienoic acid 18:2 (n-6) 10E,12Z-octadeca-9,11-dienoic acid Conjugated Linolenic Acids (three conjugated double bonds) .alpha.-Calendic acid 18:3 (n-6) 8E,10E,12Z-octadecatrienoic acid .beta.-Calendic acid 18:3 (n-6) 8E,10E,12E-octadecatrienoic acid Jacaric acid 18:3 (n-6) 8Z,10E,12Z-octadecatrienoic acid .alpha.-Eleostearic 18:3 (n-5) 9Z,11E,13E-octadeca-9,11,13- acid trienoic acid .beta.-Eleostearic 18:3 (n-5) 9E,11E,13E-octadeca-9,11,13- acid trienoic acid Catalpic acid 18:3 (n-5) 9Z,11Z,13E-octadeca-9,11,13- trienoic acid Punicic acid 18:3 (n-5) 9Z,11E,13Z-octadeca-9,11,13- trienoic acid Other Rumelenic acid 18:3 (n-3) 9E,11Z,15E-octadeca-9,11,15- trienoic acid .alpha.-Parinaric acid 18:4 (n-3) 9E,11Z,13Z,15E-octadeca- 9,11,13,15-tetraenoic acid .beta.-Parinaric acid 18:4 (n-3) all trans-octadeca-9,11,13,15- tretraenoic acid Bosscopcntacnoic 20:5 (n-6) 5Z,8Z,10E,12E,14Z-cicosanoic acid acid Table 2: List of conjugated fatty acids

[0254] Table 3 hereinbelow, provides a non-limiting list of omega 3 polyunsaturated fatty acids which can be used according to some embodiments of the invention.

TABLE-US-00003 TABLE 3 List of omega 3 polyunsaturated fatty acids Common name Lipid name Chemical name Hexadecatrienoic acid 16:3 (n-3) all-cis 7,10,13-hexadecatrienoic (HTA) acid Alpha-linolenic acid 18:3 (n-3) all-cis-9,12,15-octadecatrienoic (ALA) acid Stearidonic acid 18:4 (n-3) all-cis-6,9,12,15- (SDA) octadecatetraenoic acid Eicosatrienoic acid 20:3 (n-3) all-cis-11,14,17-eicosatrienoic (ETE) acid Eicosatetraenoic 20:4 (n-3) all-cis-8,11,14,17- acid (ETA) eicosatetraenoic acid Eicosapentaenoic 20:5 (n-3) all-cis-5,8,11,14,17- acid (EPA, Timnodonic eicosapentaenoic acid acid) Heneicosapentaenoic 21:5 (n-3) all-cis-6,9,12,15,18- acid (HPA) heneicosapentaenoic acid Docosapentaenoic 22:5 (n-3) all-cis-7,10,13,16,19- acid (DPA, Clupanodonic docosapentaenoic acid acid) Docosahexaenoic 22:6 (n-3) all-cis-4,7,10,13,16,19- acid (DHA, Cervonic acid) docosahexaenoic acid Tetracosapentaenoic 24:5 (n-3) all-cis-9,12,15,18,21- acid tetracosapentaenoic acid Tetracosahexaenoic 24:6 (n-3) all-cis-6,9,12,15,18,21- acid (Nisinic acid) tetracosahexaenoic acid

[0255] Table 4 hereinbelow, provides a non-limiting list of small molecules which are ligands or agonist of PPARA.

TABLE-US-00004 TABLE 4 Small molecules which are ligands or agonist of PPARA Name Description CAS Registry ID GW409544 L-tyrosinc analog (Synonyms GW 9544) GW6471 An extended amide analog 436159-64-7 Pirinixic acid Hypolipidemic drug 50892-23-4 (Synonyms WY-14643) Leukotriene B4 biologically active lipid 71160-24-2 mediator GW 7647 Selective PPARA agonist 265129-71-3 Perfluorooctanesulfonic Fluorosurfactant 1763-23-1 Acid (Synonyms PFOS) PERFLUOROOCTANOIC Fluorosurfactant 335-67-1 ACID (Synonyms PFOA) CP-775146 Not Available PubChem ID 10410059 CP-865520 Not Available PubChem ID 10050146 UNII-999KY5ZIGB Not Available 702681-67-2 Gemfibrozil fibric acid derivative 25812-30-0 (Synonyms Decrelip; Jezil; Lipur; Lopid)

[0256] The agents described hereinabove for increasing metabolic maturation of an immature hepatocyte can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

[0257] As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0258] Herein the term "active ingredient" refers to the agents accountable for the biological effect [e.g., a fatty acid; a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil; a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid].

[0259] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0260] Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

[0261] Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0262] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

[0263] Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

[0264] The term "tissue" refers to part of an organism consisting of cells designed to perform a function or functions. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue.

[0265] Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0266] Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0267] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0268] For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0269] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0270] Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

[0271] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0272] For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0273] The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

[0274] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

[0275] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

[0276] The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

[0277] Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients [e.g., a fatty acid; a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil; a PXR agonist selected from the group consisting of: a small molecule, a bile acid, and a steroid] effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a pathology characterized by an immature hepatocyte) or prolong the survival of the subject being treated.

[0278] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0279] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0280] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1).

[0281] Dosage amount and interval may be adjusted individually to provide tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0282] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

[0283] The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

[0284] Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

[0285] Compositions of some embodiments of the invention, including the agents, the pharmaceutical compositions, and/or the nutrition formula of some embodiments of the invention may be included in an article of manufacture preferably along with appropriate instructions for use and labels indicating FDA approval, Food and Agriculture Organization of the United Nations approval, and/or the World Health Organization approval for use in treating a subject having immature hepatocytes.

[0286] As used herein the term "about" refers to .+-.10%

[0287] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

[0288] The term "consisting of" means "including and limited to".

[0289] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

[0290] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0291] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0292] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

[0293] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

[0294] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

[0295] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 12 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an alpha-fetoprotein nucleic acid sequence, or the RNA sequence of an alpha-fetoprotein RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.

[0296] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0297] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

[0298] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

[0299] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, Calif. (1990); Marshak et al., "Strategies for Protein Purification and Characterization--A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

[0300] General Materials and Experimental Methods

[0301] Cells and Cell Cultures--I3 hESCs (Amit M, et al. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000; 227:271-278) or HUES8 hESC were grown in a feeder-independent system (i.e., in suspension cultures) as previously described (Amit M, et al. Suspension culture of undifferentiated human embryonic and induced pluripotent stem cells. Stem Cell Rev 2010; 6:248-259). In brief, cells were removed from culture dishes using collagenase type IV, separated into small clumps using 200 .mu.l tips, and cultured in suspension in 58 mm Petri dishes at a cell density of 1-5.times.10.sup.6 cells/ml. The Petri dishes were kept static in an incubator at 37.degree. C. in 5% CO.sub.2. After 3 passages of adaptation to suspension, cells were transferred to spinner flasks, with a speed of 75 RPM. Culture medium was changed every other day, and the cells were diluted in a ratio of 1:4 every 5-7 days. The cells were kept in culture medium (Y10F) consisting of 85% DMEM/F12 (Biological Industries, Beit Haemek, Israel), 15% knockout serum replacement, 2 mM L-glutamine, 0.1 mM .beta.-mercaptoethanol, 1% non-essential amino acid stock, 500 U/mL penicillin and 1 mg/mL streptomycin (Sigma-Aldrich, St. Louis, Mo.), 10 ng/ml bFGF (R&D systems, Minneapolis, Minn.) and supplemented with 100 .mu.g/ml IL6-IL6 receptor chimera.

[0302] Prior to differentiation, 13 hESC or HUES8 hESC were cultured on growth factor reduced Matrigel.TM. (BD Biosciences, San Jose, Calif.) in mTeSR-1 media (Stemcell technologies, Vancouver, Canada) supplemented with 500 U/mL penicillin and 1 mg/mL streptomycin (Biological Industries, Beit Haemek, Israel). Cells were passaged using Accutase.TM. (Sigma Aldrich, St Louis, Mo.).

[0303] Cryopreserved human hepatocytes (Gibco, Lot number Hu8132) were thawed and plated on growth factor reduced Matrigel.TM. in Hepatocyte Maintenance Medium (HMM) per manufacturer instructions (Lonza, Cologne, Germany).

[0304] Human Subjects--All protocols involving human tissue were reviewed and exempted by the Hebrew University of Jerusalem and Weill Cornell Medical College Institutional Review Boards.

[0305] hESC Hepatic Differentiation--The first steps of the differentiation protocol are similar to those previously reported by Hay et al. (Hay D C, et al. Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 2008; 105:12301-12306) and Chen et al. (Chen Y F, et al. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 2012; 55:1193-1203), each of which is fully incorporated herein by reference in its entirety.

[0306] In brief, cells were seeded on Matrigel.TM.-coated plates in mTeSR-1 medium and allowed to reach 50% confluence.

[0307] Stage 1: In the first three days, cells were cultured in RPMI-1640, supplemented with B27 supplement (Gibco, Grand Island, N.Y.), 100 ng/ml activin A (R&D Systems, Minneapolis, Minn.), 50 ng/ml Wnt3A (R&D Systems) and 10 ng/ml HGF (hepatocyte growth factor) (PeproTech, London, UK).

[0308] Stage 2: In the following four days, cells were cultured in KnockOut DMEM (Gibco) supplemented with 20% KnockOut serum replacement (Gibco), 1% non-essential amino acids (Biological Industries, Beit Haemek, Israel), 1 mM L-glutamine (Biological Industries), 0.1 mM 2-mercaptoethanol (Sigma Aldrich) and 1% DMSO (Sigma Aldrich).

[0309] Stage 3: In the subsequent five days, cells were cultured in Iscove's modified Dulbecco's medium (IMDM) (Biological Industries) supplemented with 20 ng/ml oncostatin M (R&D Systems), 4 ng/ml FGF2 (PeproTech), Insulin-Transferrin-Selenium (ITS) supplement (Sigma Aldrich) and 0.5 .mu.M Dexamethasone (Sigma Aldrich).

[0310] The last stage of differentiation (stage 4) was performed according to the method published in Avior Y., et al., 2015 ("Microbial-derived lithocholic acid and vitamin K2 drive the metabolic maturation of pluripotent stem cells-derived and fetal hepatocytes". Hepatology. 2015 July; 62(1):265-78. Epub 2015 Apr. 22, which is fully incorporated herein by its entirety) as follows: In the last differentiation step, cells were cultured in RPMI-1640 supplemented with 0.5 .mu.M Dexamethasone, 10 ng/ml HGF and ITS+3 supplement (which includes 16.7 .mu.M of LA and OA) (Sigma Aldrich). Final differentiation step was also carried out with 10 .mu.M LCA (Sigma Aldrich) and 10 .mu.M Vitamin K.sub.2 (MK4) as described in the text (Sigma Aldrich).

[0311] Alternatively, the last stage of differentiation (stage 4) was performed as follows: In the last step, cells were cultured in Williams' medium E (Sigma Aldrich) supplemented with 0.5 .mu.M Dexamethasone, 10 ng/ml HGF (hepatocyte growth factor) and ITS supplement (Sigma Aldrich). Final differentiation step (days 12 to 16) was also carried out with different concentrations of Oleic acid-Albumin from bovine serum (Sigma Aldrich) and linoleic acid-Albumin from bovine serum (Sigma Aldrich). As indicated in the experimental results below, in some experiments linoleic acid was replaced with 9-cis, 11-trans Conjugated linoleic acid (9CLA, Sigma) and 50 .mu.M BSA (bovine serum albumin) was added. Additional details are provided in Tables 5 and 6 herein below.

[0312] It should be noted that the optimal concentrations of OA was 100 .mu.M; the optimal concentration of 9CLA was 100 .mu.M; and the optimal concentration of LA was 100 .mu.M.

TABLE-US-00005 TABLE 5 Materials for hPSCs differentiation Catalog Materials for hPSC differentiation Company number PBS Sigma D8537 RPMI-1640 Gibco 21875-034 Penicillin Streptomycin Biological Industries 03-031-1C (Pen Strep) B27 supplement Gibco 17504044 Activin-A R&D 338-AC Wnt-3A R&D 5036-WN-010 HGF Peprotech 100-39 K/O DMEM Gibco 10829018 K/O Serum Gibco 10828-028 L-Alanyl-L-Glutamin (Glutamax) Biological Industries 030221B Non Essential Amino Biological Industries 01-340-1B Acids (NEAA) DMSO (Dimethyl sulfoxide) Sigma D4540 .beta.-Mercaptoethanol Sigma M6250 Iscove's Modified Dulbecco's Biological Industries 01-058-1A Media (IMDM) ITS Sigma I3146 Dexamethasone Sigma D4902 Oncostatin-M (OSM) R&D 295-OM basic-FGF (FGF2) Peprotech 100-18B Williams Medium E Sigma W1878 Oleic acid-albumin Sigma O3008 Linoleic acid-albumin Sigma L9530 9-cis, 11-trans, conjugated Sigma 16413 linoleic acid (9CLA) Table 5. List of materials for hESC differentiation

TABLE-US-00006 TABLE 6 Exemplary culture media for specific differentiation stages of human pluripotent stem cells towards hepatocytes # Media Stage Days Changes Media Components S1 Endodermal 1-3 3 RPMI 1640 medium, Induction Pen/Strep (100 U), B27 (1X), Act-A (100 ng/ml), Wnt-3a (50 ng/ml), HGF (10 ng/ml) S2 Hepatic 4-7 4 K/O DMEM medium, Specification Pen/Strep (100 U), K/O Serum (20%), Glutamax (2 mM), NEAA (1%), DMSO (1%), .beta.-Mercaptoethanol (0.1 mM) S3 Hepatic 8-12 5 IMDM medium, Differentiation Pen/Strep (100 U), ITS (1X), Dexamethasone (0.5 .mu.M), Oncostatin M (20 ng/ml), bFGF (4 ng/ml) S4 Hepatic 13-16 4 Williams Medium E or Maturation RPMI 1640 medium, Pen/Strep (100 U), ITS (1X), Glutamax (2 mM), Dexamethasone (0.5 .mu.M), HGF (10 ng/ml), Oleic acid (100 .mu.M), 9CLA (100 .mu.M). Table 6. hESC differentiation protocol.

[0313] Sub-culturing of the cells between day 5 to 10--The present inventors have incorporated a sub-culture step on Day 8 of the differentiation method in order to increase proliferation growth and increase differentiation by minimizing contact inhibition. The hESC-H can only be sub-cultured between days 5 to 10 without loss of function such as AFP expression. Cells were washed with PBS and trypsinized off the surface following 2-5 minutes incubation at 37.degree. C. in 5% CO.sub.2. Cell suspension was diluted in DMEM containing 10% FBS and centrifuged at 300 g for 5 minutes. Cell pellet was resuspended in 2.sup.nd stage medium and cells were seeded at 50% confluence on Matrigel coated dished.

[0314] Hepatic Differentiation Protocol which Includes the Subculturing Step:

[0315] Table 7 hereinbelow, summarizes the reagents used in the differentiation protocol

TABLE-US-00007 TABLE 7 Catalogue Reagent Supplier number PBS Sigma D8537 RPMI-1640 Gibco 21875-034 Penicillin Streptomycin Biological Industries 03-031-1C (Pen Strep) B27 supplement Gibco 17504044 Activin-A R&D 338-AC Wnt-3A R&D 5036-WN-010 HGF Peprotech 100-39 K/O DMEM Gibco 10829018 K/O Serum Gibco 10828-028 L-Alanyl-L-Glutamin (Glutamax) Biological Industries 030221B Non Essential Amino Biological Industries 01-340-1B Acids (NEAA) DMSO Sigma D4540 .beta.-Mercaptoethanol Sigma M6250 Growth Factor Reduced Matrigel BD Biosciences 356230 DMEM Gibco 11965092 Fetal Bovine Serum (FBS) Biological Industries Iscove's Modified Biological Industries 01-058-1A Dulbecco's Media (IMDM) ITS Sigma I3146 Dexamethasone Sigma D4902 Oncostatin-M (OSM) R&D 295-OM basic-FGF (FGF2) Peprotech 100-18B Williams Medium E Sigma W1878 Oleic acid-albumin Sigma O3008 Linoleic acid-albumin Sigma L9530 9-cis, 11-trans, conjugated Sigma 16413 linoleic acid (9CLA)

[0316] The Differentiation Protocol was as Follows:

[0317] Day 0: Once pluripotent cell culture, passaged with Accutase as single cells, reach 50-60% confluence (which is about 2-3 days if the cells were seeded at a confluence of 20-30%), the cells were washed twice with PBS and then the S1 Medium was added.

[0318] Days 1-2: S1 medium was replaced daily with afresh S1 medium;

[0319] Day 3: The cells were washed twice with PBS and a freshly-made warm S2 medium was added;

[0320] Days 4-6: The S2 medium was replaced daily with a fresh S2 medium;

[0321] Day 7: Sub-culturing stage: When the cells reached over 90% confluence, the cells were passaged as follows. For a 6-well plate (about 10.sup.6 cells), the wells were washed with PBS, and then with 0.5 ml trypsin for a 2-5 minutes incubation at 37.degree. C. 5% CO.sub.2. Then, 1 ml of DMEM medium containing 10% FBS was added to dilute the trypsin, followed by a gentle pipetting of the suspension to obtain single cells. The cells were centrifuged for 5 minutes at 300 g, the medium was removed and the cells were re-suspended in S2 medium. The cells were seeded in a 1:2 or 1:3 ratio on Matrigel coated plates. It should be noted that Trypsin usually dissociates the differentiated cells into single cells, but still some clumps remain. According to this method, the clumps were gently broken using a 5 ml pipet and the cells were evenly distributed between the wells. The use of the 1 ml tip was avoided when sub-culturing.

[0322] Day 8: In case some cell death was visible, the plates were washed once with PBS before proceeding to S2 medium change.

[0323] Day 9: The cells were washed twice with PBS and a freshly made warm S3 medium was added.

[0324] Days 10-13: The S3 medium was replaced daily with a fresh S3 medium.

[0325] Day 14: The cells were washed twice with PBS and a freshly made warm S4 medium was added.

[0326] Days 15-17: The S4 medium was replaced daily with a fresh S4 medium.

[0327] Day 18: At this stage, cell density is about 10 times higher than in day 7. Meaning that in a 6 well there were 5*10.sup.6 cells at day 18.

[0328] Fluorescence-Activated Cell Sorting (FACS)--Cells were harvested using TrypLE Select (Gibco) and spun down for 5 minutes, then suspended in PBS buffer containing 5% FBS and the conjugated antibodies. Cells were then incubated for 1 hour at room temperature and were washed three times in buffer. Analysis was performed in FACSAria II cell sorter (BD Biosciences).

[0329] Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)--RNA was isolated and purified using RNeasy mini kit (Qiagen) or NucleoSpin RNA kit (Macherey-Nagel), according to manufacturer protocol. cDNA samples were synthesized using qScriptc DNA Super Mix (Quanta BioSciences), according to manufacturer protocol. 1 .mu.g of purified RNA was used for each reaction, with concentration and purity determined by a ND-1000 spectrophotometer (NanoDrop Technologies). Each reaction was diluted to reach a concentration of 10 ng/.mu.L. Gene expression analysis was carried out utilizing KAPA SYBR FAST Universal 2X PCR Master Mix (KapaBiosystems, Wilmington, Mass.) on BioRad CFX96 Real-Time System, according to manufacturer protocol. Gene transcription was evaluated using the .DELTA..DELTA.Ct method normalized to UBC1 and RPL32 as housekeeping genes (Table 8, hereinbelow).

TABLE-US-00008 TABLE 8 PCR primers Table 8. Alphabetical list of qRT-PCR primers and sequence identifiers. Gene SEQ ID SEQ ID Name Forward 5'-3' NO: Reverse 3'-5' NO: ABCG5 TCTGTTTCCCGTGCT 23 CCCAGCGTCCAGTAGCA 24 GCGAG CAC AFP CCTACAATTCTTCTT 25 AGTAACAGTTATGGCTT 26 TGGGCT GGA Albumin GGAATGCTGCCATG 27 CCTTCAGTTTACTGGAG 28 GAGATCTGC ATCG BAAT CTCCAAAGGCCAGC 29 CAGCCCACCCAAACCAC 30 CTGACT CAA CPT1.alpha. GCCTCGTATGTGAG 31 CCCATTCGTAGCCTTTG 32 GCAAA GTA CYP3A4 Purchased from Qiagen Purchased from Qiagen (QT00067396) (Q100067396) FIS1 AAAGTACGTCCGCG 33 TCCGATGAGTCCGGCCA 34 GGTTGC GT FoxA2 GGGAGCGGTGAAGA 35 TCATGTTGCTCACGGAG 36 TGGA GAGTA FXR Purchased from IDT Purchased from IDT (Hs.PT.56a.27354436) (Hs.PT.56a.27354436) LXR.alpha. GCCGAGTTTGCCTTG 37 TCCGGAGGCTCACCAGT 38 CTCA TTC MFN2 AAGGTGAAGCGCAA 39 CCCCCAGCTGCTCAAAA 40 TGTCCCT ATGC PGC1.alpha. TGCTCTGTGTCACTG 41 GGGCAAAGAGGCTGGTC 42 TGGATTGG TTCA PPAR.alpha. Purchased from Qiagen Purchased from Qiagen (QT00017451) (Q100017451) PXR CTCACCTCCAGGTTT 43 CTCCTTGATCGATCCTTT 44 GCTTC GC OCT4 TCTCCAGGTTGCCTC 45 GTGGAGGAAGCTGACA 46 TCACT ACAA OTC TCGAGCCAATACTG 47 CTTCTGGGAGGACATCC 48 CATCTG TTG SERPINA1 ACGAGACAGAAGAC 49 CCCTCTGGATCCACTGC 50 GGCATT TT SLC22A1 CCCCACATTCGTCAG 51 AGGTGCCCGAGGGTTCT 52 CGGTGT GAGG Sox17 GGCGCAGCAGAATC 53 CCACGACTTGCCCAGCA 54 CAGA T Sox2 GCTTAGCCTCGTCGA 55 AACCCCAAGATGCACAA 56 TGAAC CTC UBC1 CGGGTGTGGCACAG 57 TGCATTGTCAAGTGACG 58 CTAGTT ATCAC FIS1 AAAGTACGTCCGCG 59 TCCGATGAGTCCGGCCA 60 GGTTGC GT CYP2C9 Purchased from IDT Purchased from IDT (Hs.PT.56a.858384) (Hs.PT.56a.858384)

[0330] Immunofluorescence Staining--Cultured cells were fixed using 4% paraformaldehyde for 15 minutes at room temperature. Cells were then permeabilized in PBS blocking buffer containing 2% BSA and 0.25% Triton X-100 for one hour at room temperature, and incubated with primary antibodies for another hour (Table 9, hereinbelow). Following washes, cells were incubated with secondary antibodies for 1 hour at room temperature in blocking buffer (Table 10, hereinbelow). Hoechst staining was performed using bisBenzimide H33342 for 2 minutes. Imaging was performed on a Zeiss LSM 700 confocal microscope.

TABLE-US-00009 TABLE 9 Primary antibodies used for immunofluorescence analysis Antibody Host Company Catalog # Dilution AFP Rabbit Cell Marque 203A-16 1:100 Albumin Chicken ICL CAL80A 1:100 FoxA2 Rabbit Abeam AB40874 1:100 Gata4 Rabbit Abeam AB84593 1:100 HNF4a Goat Santa Cruz SC6556 1:100 HSP60 (k-19) Goat Santa Cruz SC-1722 1:100 OCT3/4 Rabbit Santa Cruz SC9081 1:100 PXR Rabbit Santa Cruz SC25381 1:100 Sox17 Goat R&D AF1924 1:100 Table 9. Primary antibodies source and dilutions

TABLE-US-00010 TABLE 10 Secondary antibodies used for immunofluorescence analysis Reactive Dilu- Sp. Host Fluorophore Company Catalog # tion Rabbit Donkey AlexaFluor 488 Jackson 715-546-150 1:100 Goat Donkey AlexaFluor 647 Jackson 705-606-147 1:100 Goat Donkey AlexaFluor 488 Jackson 705-546-147 1:100 Rabbit Donkey AlexaFluor 594 Jackson 711-585-152 1:100 Chicken Donkey AlexaFluor 488 Jackson 703-545-155 1:100 Table 10. Secondary antibodies source and dilutions

[0331] Nuclear Receptors Cop-GFP Activity Reporter Constructs

[0332] PXR Cop-GFP Activity Reporter: PXR-luciferase reporter construct was a kind gift of Chris Liddle (University of Sydney) (Goodwin B, et al. The Orphan Human Pregnane X Receptor Mediates the Transcriptional Activation of CYP3A4 by Rifampicin through a Distal Enhancer Module. Molecular Pharmacology 1999; 56:1329-1339). The reporter contains a CYP3A4 promoter element and a distal enhancer containing PXR response elements (TGAACTTGCTGACCC; SEQ ID NO: 61), digested out with Acc65 and HindIII. PXRE fragment was blunt end ligated to pGreenFire1 vector (System Biosciences, Mountain View, Calif.) containing copGFP reporter using EcoRI-BamHI digestion.

[0333] LXR Cop-GFP Activity Reporter: LXR Cop-GFP lentiviral reporter vector was purchased from System Biosciences (SBI). The reporter contains four LXR response elements (GGGTTACTGGCGGTCATTGTA; SEQ ID NO: 62) upstream of a minimal CMV promoter driving Cop-GFP.

[0334] PPAR.sub.a, Cop-GFP Activity Reporter: mCMV-GFP lentiviral vector was purchased from System Biosciences (SBI) and digested with EcoRI-BamHI to remove the minimal CMV promoter. The promoter fragment of the human CPT1A 5'-untranslated region (from -562 to +1890) that contains a PPAR response element (TACCTTTCCCCTACTTTTC; SEQ ID NO: 63) was amplified from genomic DNA by PCR using forward and reverse oligonucleotides. The forward primer contained EcoRI restriction site and the reverse primer contained a BamHI restriction site. The PCR product was sub-cloned into the digested lentiviral vector.

[0335] FXR Cop-GFP Activity Reporter: mCMV-GFP lentiviral vector was purchased from System Biosciences (SBI) and digested with XbaI-BamHI. The vector was cloned with a PCR amplified BSEP promoter element (GGGACATTGATCCT; SEQ ID NO: 64).

[0336] Lentivirus was prepared by transfecting 293T cells with one of the copGFP lentiviral reporter constructs together with pGAG-pol and pVSVG in a ratio of 3:2:1.

[0337] A total of 12 g DNA was diluted in Optimen.TM. (Invitrogen), vortexed, and supplemented with 25 .mu.L of polyethylenimine, and added drop-wise to the cells. Following 10 minutes incubation at room temperature the mix was added drop-wise to the cells. Two days later, media was collected and filtered through a 0.2 .mu.m syringe filter and concentrated in an Vivaspin 20 filter device (Satorium, Goettingen, Germany) or in an Amicon Ultra-15 filter device (Millipore). The device was spun at 3000.times.g for 10 to 15 minutes concentrating supernatant 10-fold. For 4 days, during the maturation stage of ESC-derived hepatocyte differentiation, medium was mixed with 1:10 of the concentrated virus and 1:1000 polybrene and added to the differentiating cells. In the last day of differentiation, nuclear receptor activity (PXR) was quantified using Zeiss LSM 700 microscope.

[0338] Albumin and AFP Production--Culture media samples were collected daily and stored at -80.degree. C. Albumin and AFP concentrations were analyzed using Human Albumin ELISA quantitation set (Bethyl laboratories, Montgomery, Tex.) and Human AFP (alpha-fetoprotein) Quantikine ELISA kit (R&D Systems, Minneapolis, Minn.), according to manufacturer directions. ApoB100 concentration was analyzed using ALerCHEK, Inc. (Portland, Me.), total human ApoB-100 ELISA kit as previously described (Goldwasser, 2011). Data was normalized to total cellular protein utilizing the Bradford assay.

[0339] Cytochrome P450 Activity and Induction--CYP1A activity was evaluated utilizing EROD (ethoxyresorufin-o-deethylase) as previously described (Behnia, 2000). To assess CYP3A4 and CYP2C9 activity, the present inventors used a method described by Donato et al. (Donato, 2004). Briefly, cultures were incubated with 100 .mu.M BFC (7-benzyloxy-4-trifluoromethylcoumarinat), or 10 .mu.M MFC (7-methoxy-4-trifluoromethylcoumarin) for 1 hour at 37.degree. C. Supernatant samples were collected every 30 minutes for 2.5 hours. The reactions were stopped by collection of the incubation medium. Metabolite conjugates formed via phase II activity were hydrolyzed by incubation of medium samples with .beta.-glucuronidase/arylsulfatase for 2 hours at 37.degree. C. Samples were diluted 1:1 in quenching solution and HFC (7-hydroxy-4-trifluoromethylcoumarin), the respective fluorescent metabolite formation, was measured at the appropriate wavelengths (410/510) and normalized to total protein determined by Bradford.

[0340] To evaluate CYP450 induction, cultures were incubated with 25 .mu.M rifampicin, a PXR agonist, or 50 .mu.M omeprazole, an AhR agonist, dissolved in culture medium for 72 hours. CYP450 activity was quantified as described above at the end of the stimulation period.

[0341] Functional Polarization Assay--hESC--derived hepatocytes were incubated for 30 minutes with 5(6)-carboxy-2',7'-dichlorofluorescein diacetate (CDFDA). Cultures were subsequently washed with ice-cold PBS containing calcium and magnesium and imaging was performed on a Zeiss LSM 700 confocal microscope.

[0342] Assessment of Cellular Toxicity--Cultured cells were exposed to different concentrations of compounds dissolved in culture medium for 24 hours at 37.degree. C. Cell viability was determined utilizing LIVE/DEAD Cytotoxicity kit (Molecular Probes, Eugene, Oreg.) according to manufacturer instructions. In brief, cultures were incubated with 2 .mu.M Calcein AM and 3 .mu.M ethidium homodimer-1 for 25 minutes. Hydrolysis by functional intracellular esterases causes live cells to fluoresce green, while the punctured membranes of dead cells permit ethidium homodimer-1 to bind DNA and fluoresce red. Cellular viability was calculated by live to dead ratio and normalized to negative control. TC.sub.50 values were quantified using GraphPad Prism software (La Jolla, Calif.).

[0343] Toxicological Endpoint Assays (Apoptosis, Cholestasis, Steatosis)--Toxicological endpoints were evaluated for nine hepatotoxic compounds at TC.sub.20 values identified above. Quantitation of apoptotic cells was performed utilizing DeadEnd.TM. fluorometric TUNEL System (Promega, Madison, Wis.) according to manufacturer instructions. In brief, hESC-derived hepatocytes were treated with 1.4 mM acetaminophen, 300 .mu.M diclofenac or 2 .mu.M aflatoxin B.sub.1 for 24 hours, and subsequently fixed in 4% paraformaldehyde. Cell were permeabilized and exposed to fluorescein-12-dUTP and terminal deoxynucleotidyl transferase (TdT), dying apoptotic nuclei green. The reaction was subsequently stopped and the cells counterstained for DAPI. A percent apoptotic nucleus was calculated by dividing the number of TUNEL to DAPI positive nuclei.

[0344] Quantification of intracellular lipids was performed using LipidTOX.TM. Green Neutral Lipid Stain (Molecular Probes). Differentiated cells were incubated with 135 M amiodarone, 2 mM acetylsalicylic acid or 60 .mu.M valproic acid for 24 hours. Cells were treated with 1 .mu.M LipidTOX.TM. and 1 .mu.g/mL Hoechst 33342 for 20 minutes, and washed with PBS. Staining intensity was normalized to negative control. Hepatic cholestasis was quantified using the CDFDA staining described above. hESC-derived hepatocytes were incubated with 45 .mu.M chlorpromazine, 575 .mu.M cyclosporine A or 80 .mu.M troglitazone for 24 hours. Cells were treated with 2 .mu.g/mL CD-FDA, and 1 g/mL Hoechst 33342 for 30 minutes. Incubation media was removed and cultures washed with ice-cold PBS containing calcium and magnesium. The number of green CDF particles was normalized to the number of Hoechst nuclei as an indicator of functional bile canaliculi. Particle and nuclei counting was performed utilizing the ImageJ particle analyzer.

[0345] Transmission Electron Microscopy (TEM)--For the TEM analysis, cell were seeded in a plastic 8 chamber slide (Lab-Tek) and fixed in 2.5% Glutaraldeyde, 2% paraformaldehyde in 0.1 M Cacodylate buffer (pH 7.4) for 2 hours at room temp and incubatedat 4.degree. C. overnight. Cells were then rinsed 4 times, 10 minutes each, in cacodylate buffer and post fixed and stained with 1% osmium tetroxide, 1.5% potassium ferricyanide in 0.1 M cacodylate buffer for 1 hour. Cells were then washed 4 times in cacodylate buffer followed by dehydration in increasing concentrations of ethanol consisting of 30%, 50%, 70%, 80%, 90%, 95%, for 10 minutes each step followed by 100% anhydrous ethanol 3 times, 20 minutes each. Following dehydration, the cells were infiltrated with increasing concentrations of Agar 100 resin in ethanol, consisting of 25, 50, 75, and 100% resin for 16 hours each step. The cells then were embedded in fresh resin and let polymerize in an oven at 60.degree. C. for 48 hours. Embedded cells in blocks were sectioned with a diamond knife on an LKB 3 microtome and ultrathin sections (80 nm) were collected onto 200 Mesh, thin bar copper grids. The sections on grids were sequentially stained with Uranyl acetate and Lead citrate for 10 minutes each and viewed with Tecnai 12 TEM 100 kV (Phillips, Eindhoven, The Netherlands) equipped with MegaView II CCD camera. Mitochondria diameter and cell/nuclei size were measured manually using Analysis.RTM. version 3.0 software (SoftImaging System GmbH, Munstar, Germany).

[0346] Oxygen consumption and mitochondria function evaluation using Sea Horse--The extracellular flux analyzer XFp (Seahorse Biosience, North Billerica, Mass.) was used to measure the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) at the end of the maturation differentiation stage (day 18). Cells were harvest using Trypsin at the last day of differentiation, centrifuge for 5 minutes at 90 g, re-suspended with control medium (no fatty acids) and seeded on a 1% Matrigel coated Seahorse XFp cell culture miniplates (Seahorse Bioscience) in a density of 10,000 cells per well and cultured for an additional 24 hours. Mitochondrial Stress Test assay was conducted per manufacturer instructions. Briefly, cells were incubated in unbuffered XF Base Medium supplemented with 2 mM Glutamine, 1 mM sodium pyruvate, and 10 mM glucose (pH 7.4) for 1 hour at 37.degree. C. in a non-C2 incubator. Oxygen consumption was measured by the XFp Extracellular Flux Analyzer (Seahorse Biosciences). Mitochondrial function was profiled by successive injections of 1 M oligomycin, 0.5 .mu.M Carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP), and a mixture of 0.5 .mu.M antimycin A and 0.5 .mu.M rotenone. Data are presented normalized to 10.sup.3 cells as determined by Hoechst DNA content assay.

Example 1

[0347] Derivation of Hepatocytes from Pluripotent Stem Cells

[0348] Experimental Results

[0349] Rapid Derivation of Human Embryonic Stem Cell (hESC) derived Hepatocytes--The present inventors developed a four-step hepatic differentiation protocol that included postpartum development (FIG. 1A). SRY (sex determining region Y)-box 17 (SOX17)-positive definitive endoderm emerged on the first 3 days of culture (FIGS. 1B-E), with pluripotent markers octamer-binding transcription factor 4 (OCT4) and SOX2 disappearing by day 7 on both gene and protein levels. Transient expression of GATA-binding protein 4 (GATA4) and forkhead box protein A2 (FOXA2) marked the emergence of hepatoblasts on gene and protein levels (FIGS. 1B-E). Fluorescence-activated cell sorting analysis revealed a relatively homogenous population, with 83% of cells positive for both HNF-4 and FOXA2 (FIG. 1G). Stimulation with OSM and basic fibroblast growth factor (FGF2) directed hepatoblasts to the parenchymal fate. The fetal-like hepatocyte population showed a significant expression of AFP and alpha 1 antitrypsin (A1AT), with minor expression of albumin (FIGS. 1B-E). Finally, this protocol mimicked the postpartum environment by removing OSM [Kamiya A, et al. FEBS Lett 2001; 492:90-94] and exposing cells to 16.7 .mu.M of oleic and linoleic acid (fatty acids) (FIG. 1A), promoting a dramatic increase in albumin expression, with an associated decrease of AFP expression (FIG. 1E). Ninety-six percent of differentiated cells were positive for albumin, and 83% were positive for both albumin and HNF-4.alpha. expression (FIG. 1H). The protocol was robust, producing similar results by qRT-PCR in HuES8 and H9 hESCs as well as hiPSC lines 12F2 and U21 on day 16 of differentiation (FIGS. 6A-J).

[0350] hESC-derived hepatocytes show low PXR-dependent CYP450 expression--The present inventors compared the expression patterns of hESC-derived hepatocytes to primary human hepatocytes (PHH) and HepG2 cells cultured under the same conditions (FIGS. 2A-B). Gene expression of blood proteins albumin and A1AT, was not significantly different from primary cells (FIG. 2B). Similarly the expression of hepatic nuclear receptors HNF4c, farnesoid X receptor (FXR), and constitutive androstane receptor (CAR) was equivalent to primary cells, with fatty acid-activated peroxisome proliferator-activated receptor alpha (PPAR.alpha.) showing an expected 2-fold increase over primary cells (FIGS. 2A-B). However, expression of PXR was 4% of PHH expression levels, and its targets, CYP2C9 and CYP3A4, were 4- and 8-fold lower than controls (FIGS. 2A-B). Notably, AhR target CYP1A2 and PPAR target CYP2D6 showed higher levels of expression (FIGS. 2A-B). These results suggest that lack of proper PXR activation is responsible for the minimal expression of CYP2C9 and CYP3A4 in the hESC-derived hepatocytes.

Example 2

LCA and MK4 Drive PXR-Dependent Hepatic Maturation

[0351] Experimental Results

[0352] LCA and MK4 drive PXR-dependent Hepatic Maturation--LCA and MK4 are secondary metabolites previously shown to activate PXR [Staudinger J L, et al. Proc. Natl. Acad. Sci. U.S.A. 2001; 98:3369-3374; Tabb M M, et al. J Biol Chem 2003; 278:43919-43927; Ichikawa T, et al. J Biol Chem 2006; 281:16927-16934]. When added to the last stage of differentiation, LCA caused a dose-dependent induction of PXR, CAR, CYP2C9, and CYP3A4 expression (P<0.05; n=3; FIG. 2D). At 50 .mu.M, LCA induced PXR, CAR, CYP2C9, and CYP3A4 by 10-, 16-, 5-, and 73-fold, respectively. At this concentration, CYP3A4 expression was 9-fold higher than primary hepatocytes and LCA showed mild toxicity. Therefore, subsequent differentiation was carried out at 10 .mu.M of LCA. In contrast, addition of MK4 to the last stage of differentiation showed no significant effect (FIG. 2E). However, addition of 10 .mu.M of both LCA and MK4 had a synergistic effect, up-regulating expression of CAR and PXR by 3- and 3.6-fold (P<0.05), while increasing expression of CYP3A4 and CYP2C9 by 3- to 4-fold (P<0.01), respectively (FIG. 2F).

[0353] To validate activation of PXR, the present inventors infected hESCs with a lentivirus reporter containing multiple repeats of the PXR response element upstream of a destabilized CopGFP (ppluGFP2). CopGFP expression was observable in fetal-like hepatocytes on day 12 of differentiation, but showed an additional 3-fold increase in activity by day 16 (P<0.004; FIG. 2G). Addition of LCA and MK4 showed an additional 1.5-fold increase in basal PXR activity (P<0.0001). Immunofluorescence staining showed that 70.+-.12% of hESC-derived hepatocytes treated with LCA and MK4 exhibited nuclear localization of PXR, compared with 20.+-.8% for untreated cells (P<0.01; FIG. 2H). Finally, addition of silibinin, a recently identified PXR inhibitor [Mooiman K D, et al. Drug Metab Dispos 2013; 41:1494-1504] to hESC-derived hepatocytes during treatment with LCA and MK4 reversed their effect, leading to a dose-dependent inhibition of PXR, CYP3A4, and CYP2C9 (P<0.01; FIG. 2I).

[0354] Taken together, these results demonstrate that LCA and MK4 up-regulate the nuclear receptor, PXR, and its target, CYP450, genes in hESC-derived hepatocytes. In addition, the present inventors further validated the synergistic activity of LCA and MK4 in fetal human hepatocytes [Avior Y et al. Hepatology 2015].

Example 3

Protein Expression and Functional Polarization

[0355] Experimental Results

[0356] Protein Expression and Functional Polarization--Epithelial polarization is a critical function of hepatocytes, which secrete bile acids and modified drug metabolites by apical bile canaliculi [Kidambi S, et al. Proc Natl Acad Sci USA 2009; 106:15714-15719; Khetani S R et al. Nat Biotechnol 2008; 26:120-126]. By day 16 of differentiation, in the presence of LCA and MK4, cells acquired homogenous cuboidal morphology and displayed granular perinuclear staining for albumin and CYP3A4, as well as a strong nuclear staining for HNF-4.alpha. (FIG. 3A). A small fraction of cells became binucleated (arrows). To evaluate bile canaliculi function, cells were treated with CDFDA, which was metabolized to fluorescent CDF and secreted to bile canaliculi by active multidrug resistance-associated protein 2 (MRP2). Approximately 85% of cells showed functional bile canaliculi (arrows), with isolated clusters showing cytoplasmic CDF staining (FIG. 3B, right).

[0357] Finally, secretion of albumin, AFP, and ApoB100 was tracked throughout differentiation. Albumin and ApoB100 production escalated from day 12 onward, reaching 13.2 .mu.g/mL of albumin (P=0.359; n=3) and 1.0 .mu.g/mL of ApoB100 (P=0.774; n=3), not significantly different from isolated primary hepatocytes (FIG. 3C, dashed line). In contrast, AFP production declined by 22% from day 14 onward (P<0.02; n=3; FIG. 3C).

[0358] RNA-Sequencing analysis shows that LCA and MK4 drive hepatic maturation--To explore the extent of characteristic fetal and mature expression, the present inventors carried out RNA sequencing (RNA-Seq) analysis on LCA- and MK4-treated hESC-derived hepatocytes (LCA/MK4), comparing them to untreated controls (control). RNA was similarly isolated from adult PHHs and fetal human hepatocytes (FHHs). Unsupervised Spearman's correlation of 2,925 genes (FIG. 3D) showed that LCA- and MK4-treated cells cluster closer to adult than to fetal hepatocytes. Expression of mature factors asialoglyco protein receptor 1 (ASGR1), CYP3A4, and glutamic-pyruvate transaminase/alanine aminotransferase (GPT1/ALT) were higher in treated than untreated cells (FIG. 3E), whereas fetal makers CYP3A7 and replication factor C3 (RFC3) were lower (FIG. 3F).

Example 4

CYP450 Activity and Induction in HESC-Derived Hepatocytes

[0359] Experimental Results

[0360] CYP450 Activity and Induction in hESC-Derived Hepatocytes--To evaluate CYP450 activity in hESC-derived hepatocytes differentiated in the presence of LCA and MK4, the present inventors monitored the metabolism of EROD, a CYP1A substrate [Behnia K, et al. Tissue Eng 2000; 6:467-479] and that of BFC and MFC, nonspecific substrates metabolized by CYP3A4, 2E1, and 2C9 [Donato M T, et al. Drug Metab Dispos 2004; 32:699-706]. As expected, fetal CYP1A activity was 2-fold higher in hESC-derived hepatocytes than primary cells (FIG. 4A). However, treatment with LCA and MK4 caused a 3- and 2-fold increase in BFC and MFC metabolism, compared to untreated cells, respectively (P<0.05).

[0361] Importantly, CYP450 activity in LCA- and MK4-treated hESC-derived hepatocytes was inducible by classical agonists. Omeprazole, an agonist of AhR, which regulates CYP1A, induced EROD and BFC metabolism by 9- and 3-fold, respectively (FIG. 4B). Rifampicin, an agonist of PXR, which regulates CYP3A4 and 2C9, induced BFC and MFC metabolism by 2- and 10-fold, respectively (FIG. 4B). Finally, the present inventors exposed cells to 2% DMSO, a nonspecific treatment that induces CYP450 expression in primary cells. Expression of PXR and most CYP450 enzymes which were checked increased from 2- to 6-fold (FIG. 4C). Together, the data show that LCA and MK4 induced functional CYP450 regulation at a substantial fraction of primary hepatocyte potential.

Example 5

Uses of HESC-Derived Hepatocytes for Prediction of Acute Toxicity

[0362] Experimental Results

[0363] hESC-derived hepatocytes demonstrate accurate prediction of acute toxicity--Application of hESC-derived hepatocytes for predictive toxicology was suggested by several groups, but thus far demonstrated poor correlation to primary cells [Szkolnicka D, et al. Stem Cells Transl Medicine 2014; 3:141-148]. To test the ability of LCA- and MK4-treated hESC-derived hepatocytes to predict hepatotoxic effects, the present inventors tested nine compounds that display different toxicological endpoints (e.g., cholestasis) and three control compounds generally regarded as safe. Differentiation was adapted to 96-well plates (General Materials and Experimental Methods above). Cells were exposed to increasing concentrations of compounds on day 16, and viability was quantified using fluorescence Live/Dead staining after 24 hours of exposure (FIG. 4D). Results are summarized as TC.sub.50, the concentration causing 50% cell death (FIG. 4D). Dose-dependence curves showed a classical sigmoidal response characteristic of toxic metabolite formation. Importantly, a normalized TC.sub.50 toxicity profile generated for LCA- and MK4-treated hESC-derived hepatocytes was not significantly different from primary cells (P=0.13; n=3), whereas HepG2 profile was significantly different (P=0.04; n=3; FIG. 4E).

[0364] Remarkably, TC.sub.50 values of LCA- and MK4-treated hESC-derived hepatocytes showed a striking correlation to primary cells, with an R.sup.2=0.94 to the 45-degree angle (dotted line), compared to R.sup.2=0.65 for HepG2 cells and an R.sup.2=0.19 for untreated cells (FIG. 4F).

[0365] Surprisingly, whereas menthol and mannitol controls showed no adverse effects, the hormone, melatonin, demonstrated a clear toxicity at a TC.sub.50 value of 0.7.+-.0.2 mM. This concentration is 2 orders of magnitude higher than the standard 5- to 10-mg dose marking melatonin as safe (FIG. 4D). Based on these data, the accuracy of these predictions ranges from 92% to 100%.

[0366] Accurate Prediction of Toxicological Endpoints--To demonstrate the ability of hESC-derived hepatocytes to predict the precise toxicological response, the present inventors evaluated toxicological endpoints of the nine hepatotoxic compounds defined above at TC.sub.20 concentrations to minimize the effect of cell death (FIGS. 5A-I).

[0367] Steatosis was evaluated using LipidTox neutral lipid stain. After 48 hours of exposure, cultures treated with amiodarone, acetylsalicylic acid (aspirin), or valproic acid showed a 25- to 26-fold increase in intracellular lipids, compared to control (P<0.001; n=4; FIGS. 5A-B).

[0368] Cholestasis was evaluated by CDFDA staining. After 24 hours of exposure, cultures treated with troglitazone, chlorpromazine (thorazine), or cyclosporine A showed a 13- to 30-fold decrease in number of CDF-positive bile canaliculi, compared to control (P<0.003; n=4; FIGS. 5C-D).

[0369] Finally, apoptosis was evaluated using the TUNEL assay. After 24 hours of exposure, cultures treated with diclofenac, acetaminophen (Tylenol), or aflatoxin B1 showed a 3- to 4-fold increase in percent of apoptotic nuclei, compared to control (P<0.02; n=4; FIGS. 5E-F).

[0370] Taken together, the data demonstrate that hESC-derived hepatocytes can be utilized to predict appropriate toxicological end-points with high sensitivity.

[0371] Finally, the present inventors sought to identify the toxicological mechanism underlying the observed toxicity of melatonin. Melatonin did not affect the number of functional bile canaliculi at TC.sub.20 concentration (P<0.4; n=4; FIGS. 5G-I). In contrast, melatonin caused a significant 30-fold increase in lipid accumulation (P<0.006; n=4), suggesting that the hormone might cause steatosis at high concentration or prolonged use.

Example 6

Generalized Protocol for Hepatocyte Derivation from Varying Human Pluripotent Stem Cell Lines

[0372] Experimental Results

[0373] Sub-culture and general derivation of human pluripotent stem cell (hPSC) derived hepatocytes--Human embryonic stem cells (hESC) and human induced pluripotent stem cells (hiPSC) from several sources were expanded in a feeder-independent culture. When cells reached 50% confluence, the present inventors induced hepatic differentiation using the protocol described in Avior, 2015, yet with significant improvements. Fast growing cell lines reached confluence and stopped differentiating at a fetal stage due to contact inhibition. Therefore, present inventors added a sub-culture step on day 8 of endoderm induction, that permits better control of cell density, by defining 30% confluence post-seeding. The protocol was extended to 18 days, by starting stage 3 on day 10 as shown in FIG. 11B.

Example 7

Fatty Acids Oleic Acid and Linoleic Acid Increase Human Embryonic Stem Cell Derived Hepatocyte Maturation

[0374] Experimental Results

[0375] OA and LA drive nuclear receptors activation--Nuclear receptors are ligand-activated transcription factors that play a critical role in the regulation of metabolic processes and mature liver function (Clavia Ruth Wooton-Kee, 2010; Panadero, 2000; Lacroix, 1997). Fatty acids were previously found to activate certain nuclear receptors in the adult liver, suggesting they might play a similar role in their fetal induction during the transition from glucose-rich placental to lipid-rich enteral nutrition (Finley et al, 1985, summarized in Table 11, hereinbelow); Fernando-Warnakulasuriya, 1981).

TABLE-US-00011 TABLE 11 Fatty acid composition of human breast milk Percentage in fat fraction (%) Common name C12:0 6 Lauric C14:0 8 C16:0 23 Palmitic C18:0 8 Stearic C18:1 .omega.9 32 Oleic C18:2 .omega.6 17 Linoleic C18:3 .omega.3 1.6 .alpha.-linoleic C20:4 .omega.6 0.1 Arachidonic (AA) C22:6 .omega.3 0.3 Docosahexaenoic (DHA) Table 11. Fatty acid composition of human breast milk (Values are obtained from Finley et al., 1985, which is fully incorporated herein by reference).

[0376] Oleic acid (OA) and linoleic acid (LA) were added to the last stage of differentiation [days 13-16 (when differentiation did not include a step of sub-culturing) or days 15-18 (when the differentiation included a step of sub-culture)]. Exposure to OA and LA induced a dose-dependent activation of PPAR.alpha. response element (PPRE), LXR.alpha. response element (LXRE) and PXR response element (PXRE), but not of FXR response element (FXRE) (p<0.01) (FIG. 6A). NR activation was validated by infecting hESC with a set of lentivirus activity reporters as described in the "GENERAL MATERIALS AND EXPERIMENTAL METHODS" herein above at the last four days of differentiation (FIG. 6A). Gene expression analysis showed similar induction of the nuclear receptor and a classical target gene reaching a maximum induction between 62 to 125 .mu.M (FIG. 6B).

[0377] OA and LA drive hepatocyte maturation--Albumin and AFP are positive and negative markers of hepatocyte maturity, respectively. Differentiation in the presence of OA and LA produced a dose-dependent correlation with albumin increasing by 45% and AFP decreasing by 30% at 125 .mu.M (FIGS. 6C-D). Concentrations of 250 .mu.M and above caused a toxic effect leading to decrease differentiation (FIGS. 6B-E).

[0378] Finally, a 24-hours treatment with GW9662, a PPAR.alpha./.gamma. antagonist, inhibited the expression of genes involved in lipid metabolism and caused a significant decrease in albumin gene expression and production (n=5, p<0.05), reducing them back to control levels (FIGS. 6F-G). Taken together, these results demonstrate that OA and LA promote the metabolic maturity of hESC-derived hepatocytes via nuclear receptors activation with PPAR having a key regulatory role in the hepatic metabolic profile and albumin expression.

[0379] OA and LA promote PPAR dependent PXR Activation--Each NR regulates the expression and activity of other transcription factors, forming a network of interactions regulating metabolic and developmental processes. The activation of lipid metabolism regulator, PPAR, by OA and LA at the last stage of differentiation also induced the expression, activity and nuclear localization of PXR in hESC-derived hepatocytes (FIGS. 6A, 6B and 6H-I). Surprisingly, when replacing LA with its microbial derived isomer, 9CLA, an additional 40% increase in PXR nuclear localization (p<0.0001) was detected (FIGS. 6H-I). Increased activity of PXR was supported by the increase in CYP3A4 and CYP2C9 gene expression and activity (FIGS. 6H and 6I). PXR nuclear localization and activation was down-regulated by the PPAR antagonist, GW9662, supported by fluorescent microscopy and gene expression (FIGS. 6H-I).

Example 8

Effect of the Fatty Acids on Mitochondria Development in Esc-Derived Hepatic Cell

[0380] Experimental Results

[0381] OA and LA promote hepatic mitochondria development via PPAR activation--Primary hepatocytes maintain a network of over 1400 mitochondria, whose maturation and activity is essential for hepatic function (Yue Yu, 2012; Valcarce C, 1988; E G white, 1939). Transmission electron microscopy (TEM) showed clear ultra-structural changes induced by differentiation of hESC-derived hepatocyte with OA and LA, or OA and 9CLA compared to control (FIG. 7A). Treatment with fatty acids caused the accumulation of lipid droplets (FIG. 7A) and increase cell size by 80% for OA and LA treatment compared to control (p<0.01; FIG. 7C). Mitochondria decreased in diameter by 20-30%, acquiring elongated morphology indicative of network formation (FIG. 7B).

[0382] Confocal imaging of mitochondrial protein HSP60 showed similar results (FIG. 7D) with a highly branched network of mitochondria appearing primarily during OA and 9CLA treatment. Indeed, image analysis showed a 20% decrease in mitochondria minor axis (i.e. diameter), a 12% increase in mitochondria major axis (i.e. length), and a 7% increase in eccentricity (FIGS. 7D-H).

[0383] PPAR.alpha. is known to regulate the expression of PGC1a and MFN2, essential for proper mitochondria biogenesis and fusion (Chen, 2003; Chen, 2005). To evaluate the molecular mechanism underlying the morphological changes, expression of key biogenesis, fusion and fission regulators was evaluated. Fatty acid treatment increase MFN2 expression by 70% with FIS1 increasing only by 20%, validating the increase in fusion to fission ratio (FIG. 7J). Elongation and narrowing of mitochondria was reversed by GW9662, supported by the decrease in PGC1, MFN2 and FIS1 gene expression and indicates on a PPAR.alpha.-dependent mechanism involved in regulating mitochondria morphology (FIGS. 7E-G and FIG. 7J).

[0384] OA and LA increase mitochondrial function--Hepatocyte mitochondrial activity defines the metabolic ability of the cells. To evaluate mitochondrial function the present inventors used the XFp extracellular flux analyzer (Seahorse Biosience, North Billerica, Mass.). The machine measures oxygen consumption rate (OCR) during the sequential addition of toxins and inhibitors to specifically quantify basal respiration, oxidative phosphorylation and mitochondrial mass. The present inventors show that oxidative phosphorylation (ATP production) increase by 2-folds following OA and LA addition, and by 2.7-fold increase in response to OA and 9CLA (p<0.05) (FIGS. 8A-B). Interestingly, induction of mitochondrial function by OA and 9CLA resulted in about half of the efficacy compared to human hepatocytes (FIGS. 8A-B).

[0385] Analysis and Discussion

[0386] Scarcity of human hepatocytes and batch-to-batch variability has increased interest in hESC and hiPSC-derived hepatocytes for both clinical and toxicological applications. In this work the present inventors present a rapid 16 to 18-day protocol for differentiation of hESC-derived hepatocytes. Like other groups, previous protocols produced a relatively homogenous induction of albumin and HNF4a (FIGS. 1A-H), but with high AFP expression levels, low CYP450 activity (Si-Tayeb 2010; Chen 2012; Roelandt 2013) and under-developed mitochondria (Yu, 2012; wanet, 2014; Avior, 2015). The limited hepatic function could be a result of failing to include postnatal developmental in current differentiation protocols. Recently the present inventors presented the hepatic-maturing influence of bacteria derived, lithocoloc acid (LCA) and vitamin K.sub.2(MK4), via PXR activation, suggesting a crucial role of postnatal cues in hepatic development (Avior et al. 2015).

[0387] Here the present inventors demonstrate the inductive role of postnatal nutritional cues, oleic acid (OA) and linoleic acid (LA) and that of the naturally occurring gut microbiota derived LA isomer, 9CLA, in promoting hepatic maturation and mitochondrial development via PPAR activation.

[0388] Hepatocytes play a central role in lipid, cholesterol and xenobiotics metabolism, as such they are highly metabolic. Relying on external cues to promote their functions, nuclear receptors act as sensors for many metabolites and nutrients consumed in the diet, and act as metabolic regulators in the liver. Post-partum, a variety of functional adaptations are essential for maintaining metabolic homeostasis. The arrest of placental circulation, consequently results in changes in hepatic NR activity and expression (RI, 2000; Roux C, 2000; Panadero, 2000; Lacroix, 1997). The present inventors found that addition of OA and LA during the last stage of hESC differentiation promoted the metabolic maturity of the cells by inducing the activation of key metabolic NRs-PPAR.alpha., LXR.alpha. and PXR (FIGS. 6A-I). Replacing LA with microbial derived 9CLA promoted an additional maturation by inducing a PPAR dependent-PXR activation (FIGS. 6H-J).

[0389] Mitochondrial development is closely linked to pluripotency, differentiation and proliferation (Wanet 2014). Pluripotent blastomeres, before implantation, and ESC possess small and underdeveloped mitochondria, which rely on anaerobic respiration. Upon cellular differentiation and commitment, functional and morphological changes that define the mature mitochondria occur. Mitochondria acquire an elongated morphology with swollen cristae and dense matrices, and cells gain a more efficient aerobic metabolism that result in an increase in ATP production and oxygen consumption (Valcarce C, 1988; Cuezva J M, 1990; J K, 1975; Jakovcic S, 1971; J. M. Facucho-Oliveira and J. C. St. John, 2009). Hepatocytes, having high metabolic activity, require high content of mitochondria to satisfy cellular energetic demand. Therefore, development and maturation of mitochondria must go hand in hand with hepatic maturation. Although the role of mitochondria in energy production and hepatic metabolic functionality is well documented, only few studies evaluated mitochondrial development in differentiated hepatocytes. Wanet and colleagues (Wanet, 2014) provide detailed characterization and kinetics of mitochondrial respiration, biogenesis and morphological changes during differentiation, elucidating the role of mitochondrial biogenesis and function in the regulation of hepatic differentiation (Wanet, 2014). In the work of Yu, the morphological and functional changes of differentiated hiPSC were compared to primary hepatocytes, highlighting the insufficient maturity of the cells. The present inventors attribute this significant difference in mitochondrial function to post-partum development.

[0390] Fatty acids are poorly transferred through the placenta and gut microbial population is considered to emerge only at birth. Research focusing on the microbiota has defined the metabolic and physiological roles bacteria play within the mutualistic relationship (Gakuhei, 2010; Redondo-lopez, 1990) and the role of nutritional composition on the developing microbiota (Redondo-lopez, 1990). The present inventors have uncovered that 9CLA, produced by neonatal bacteria populations, has a role in promoting hepatic maturation and mitochondria development via PPAR activation in hESC-derived hepatocytes (FIGS. 6A-J-8A-B). The increase in maturation markers and mitochondria function demonstrate, and further support, that there is a tight link between nutrition, gut bacteria populations and hepatic cellular development.

[0391] Mitochondrial development and metabolic maturation of differentiated pluripotent cells are a general concern not only in hepatic differentiation but also in differentiation of other cell types. Myocytes and pancreatic beta-cells, for example, are highly dependent on mitochondria function for their proper functionality and in order to meet their energy demands (Asa, 2007; Maechler, 2010). The inducible effect of OA, LA and especially that of microbial derived, 9CLA, on NR activation and mitochondrial development should be tested in other differentiation protocols and could assist in promoting maturation and full functionality.

[0392] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0393] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference to the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

REFERENCES

Additional References are Cited in Text

[0394] 1. A M Z. StemBook, 2008.

[0395] 2. V B S. Hepatic function and physiology in the newborn. Seminars in Neonatology 2003; 8:337-346.

[0396] 3. Morelli L. Postnatal Development of Intestinal Microflora as Influenced by Infant Nutrition. J. Nutr. September 2008; 138:1791S-1795S.

[0397] 4. D A. SDaM. The marriage of nutrigenomics with the microbiome: the case of infant-associated bifidobacteria and milk. American Society for Nutrition 2014; 99:679S-703S.

[0398] 5. P L C. Development of intestinal microbiota. Gastrointestinal Microbiology 1997; 2:3-38.

[0399] 6. Knol MHaJ. Quantitative Real-Time PCR Assays To Identify and Quantify Fecal Bifidobacterium Species in Infants Receiving a Prebiotic Infant Formula. APPLIED ANDENVIRONMENTALMICROBIOLOGY 2005:2318-2324.

[0400] 7. Finley D A L B, Dewey K G, Grivetti L E. Breast milk composition: fat content and fatty acid composition in vegetarians and non-vegetarians. Am J ClinNutr. 1985; 41:787-800.

[0401] 8. G. V. Halade MMR, and G. Fernandes, ". "Effect of CLA isomers and their mixture on aging C57B1/6J mice." European Journal of Nutrition 2009; 48:409-418.

[0402] 9. G. V. Halade MMR, and G. Fernandes, ". Differential effects of conjugated linoleic acid isomers in insulin-resistant female C57B1/6J mice," Journal of Nutritional Biochemistry, 2010; 21:332-337.

[0403] 10. H. Poirier JSS, R. J. Kim, and M. A. Lazar, "Nutri-tional supplementation with trans-10, cis-12-conjugated linoleic acid induces inflammation of white adipose tissue," Diabetes 2006; 55:1634-1641.

[0404] 11. C. M. Reynolds and H. M. Roche. Conjugated linoleic acid and inflammatory cell signalling," Prostaglandins Leukotrienes and Essential Fatty Acids 2010; 82:199-204.

[0405] 12. J. S. Choi IUK, M. H. Jung, and J. Song, ". Effects of three different conjugated linoleic acid preparations on insulin signalling, fat oxidation and mitochondrial function in rats fed a high-fat diet,". British Journal of Nutrition, 2007; 98:264-275.

[0406] 13. Finlay B S, I. Russell, S. Gut Microbiota in Health and Disease. Physiol Rev 2010; 90:859-904.

[0407] 14. Moya-Camarena S Y VdHJ, Belury M A. Conjugated linoleic acid activates peroxisome proliferator-activated receptor alpha and beta subtypes but does not induce hepatic peroxisome proliferation in Sprague-Dawley rats. BiochimBiophys Acta 1999; 1436:331-342.

[0408] 15. Beck Fea. The ontogeny of peroxisome-proliferator-activated receptor gene expression in the mouse and rat. Proceedings. Biological sciences/The Royal Society 1992; 247:83-87.

[0409] 16. Panadero M, Herrera, E. & Bocos, C. Peroxisome proliferator-activated receptor-alpha expression in rat liver during postnatal development. Biochimie 2000; 82:723-726.

[0410] 17. F A H. Energetic aspects of late fetal and neonatal metabolism Academic Press, 1975.

[0411] 18. HommesFA KGaBA. The regulation of ATP synthesis in fetal rat liver. Enzyme 1973:351.

[0412] 19. R. PLaS. The transport and accumulation of adenine nucleotides during mitochondrial biogenesis. Biochem J.192:75-83 (1980). 1980; 192:75-83.

[0413] 20. Yue Yu H L, Yasuhiro Ikeda, Bruce P. Amiot, Piero Rinaldo, Stephen A. Duncan, Scott L. Nyberg. Hepatocyte-like cells differentiated from human induced pluripotent stem cells: Relevance to cellular therapies Stem Cell Research 2012; 9:196-207.

[0414] 21. Anais Waneta NmR, Mehdi Najarb, Etienne Sokalc, Thierry Arnoulda, Mustapha Najimic, Patricia Renarda, Mitochondrial remodeling in hepatic differentiation and dedifferentiation. The International Journal of Biochemistry & Cell Biology 2014; 54:174-185.

[0415] 22. Avior Y L G, Zimmerman M, Kitsberg D, Schwartz R, Sadeh R, Moussaieff A, Cohen M, Itskovitz-Eldor J, Nahmias Y. Microbial-Derived Lithocholic Acid and Vitamin K2 Drive the Metabolic Maturation of Pluripotent Stem Cells-Derived and Fetal Hepatocytes. hepatology 2015; 62:265-278.

[0416] 23. G J Fernando-Warnakulasuriya JES, S C Frost and M A Wells. Studies on fat digestion, absorption, and transport in the suckling rat. I. Fatty acid composition and concentrations of major lipid components. The Journal of Lipid Research 1981; 22:668-374.

[0417] 24. Clavia Ruth Wooton-Kee DJC, Antony T Athippozhy, Tianyong Zhao, Brett R Jones, and Mary Vore. Mechanisms for increased expression of cholesterol 7.alpha.-hydroxylase (Cyp7al) in lactating rats Hepatology 2010; 51:277-285.

[0418] 25. Lacroix D, Sonnier, M., Moncion, A., Cheron, G. & Cresteil, T. Expression of CYP3A in the human liver--evidence that the shift between CYP3A7 and CYP3A4 occurs immediately after birth. European journal of biochemistry/FEBS 1997; 247:625-634.

[0419] 26. Esmacli S AA, Soleimani M, Rahbarizadeh F, Frouzandch-Moghadam M. The role of albumin and PPAR-.alpha. in differentiation-dependent change of fatty acid profile during differentiation of mesenchymal stem cells to hepatocyte-like cells. Cell Biochem Funct 2014; 32:410.

[0420] 27. Mochizuki K M H, Kawai H, et al. Possible role of fatty acids in milk as the regulator of the expression of cytosolic binding proteins for fatty acids and vitamin A through PPAR.alpha. in developing rats. J Nutr Sci Vitaminol 2007; 53:515-521.

[0421] 28. Avior Y, Bomze, D., Ramon, O. & Nahmias, Y. Flavonoids as dietary regulators of nuclear receptor activity. Food & function 2013; 4:831-844.

[0422] 29. Valcarce C N R, Encabo P, Locches E, Satrustegui J and Cuezva J M. Postnatal Development of Rat LiverMitochondrial Functions. The Journal of Biological Chemistry 1988; 263:7767-7775.

[0423] 30. E G. W. Some observations on the liver of the pig: the hepatic lobule and liver cell during post-natal growth. J Anat. 1939; 73:365-386.

[0424] 31. Chen H C A, Chan D C. Disruption of fusion results in mitochondrial heterogeneity and dysfunction. J Biol Chem. 2005; 280:26185-26192.

[0425] 32. Hsiuchen Chen SAD, Andrew J. Ewald, Erik E. Griffin, Scott E. Fraser, and David C. Chan. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol. 2003; 160:189-200.

[0426] 33. Si-Tayeb K, Lemaigre, F. P. & Duncan, S. A. Organogenesis and Development of the Liver. Developmental Cell 2010; 18 175-189

[0427] 34. Chen Y-Fea. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 2012; 55:1193-1203.

[0428] 35. Roelandt P, Vanhove, J. & Verfaillie, C. Directed differentiation of pluripotent stem cells to functional hepatocytes. Methods Mol Biol 2013; 997:141-147.

[0429] 36. R I. K. Inborn errors of cholesterol biosynthesis. Adv Pediatr 2000; 47:1-52.

[0430] 37. Roux C W C, Mulliez N, Gaoua W, Cormier V, Chevy F, D. aC. Role of cholesterol in embryonic development. Am J Clin Nutr 2000; 71 suppl:1270S-12795.

[0431] 38. Cuezva J M V C, Luis A M, Izquierdo J M, Alconada A and Chamorro M. Postnatal Mitochondrial Differentiation in the Newborn Rat.Endocrine and Biochemical Development of the Fetus and Neonate. Reproductive Biology 1990:113-135.

[0432] 39. J K P. The maturation of the inner membrane of foetal rat liver mitochondria. An example of a positive feedback mechanism. BIOCHEMICAL JOURNAL 1975; 150:477-488.

[0433] 40. Jakovcic S H J, Getz G S, Rabinowitz M and Swift H. Mitochondrial Development in Liver of Foetal and Newborn Rats. Biochem J 1971; 121:341-347.

[0434] 41. Facucho-Oliveira J M SJJ. The relationship between pluripotency and mitochondrial DNA proliferation during early embryo development and embryonic stem cell differentiation. Stem Cell Rev. 2009; 5:140-158.

[0435] 42. Gakuhei Son M K, and Ian N. Hines. Contribution of Gut Bacteria to Liver Pathbiology. Gastroenterology Research and Practice 2010.

[0436] 43. Redondo-Lopez V C R, Sobel J D. Emerging role of lacto-bacilli in the control and maintenance of the vaginal bacterial microflora. Rev Infect Dis 1990; 12:856-872.

[0437] 44. .ANG.sa B. Gustafsson RAG. Heart mitochondria: gates of life and death Cardiovascular Research 2007.

[0438] 45. Maechler P L N, Casimir M, Vetterli L, Frigerio F, Brun T. Role of mitochondria in beta-cell function and dysfunction. Adv Exp Med Biol. 2010; 654:193-216.

[0439] 46. Guengerich F P. Cytochrome P450 and Chemical Toxicology. Chemical Research in Toxicology 2007; 21:70-83.

[0440] 47. Kaplowitz N. Idiosyncratic drug hepatotoxicity. Nat Rev Drug Discov 2005; 4:489-499.

[0441] 48. Gottmann E, Kramer S, Pfahringer B, Helma C. Data quality in predictive toxicology: reproducibility of rodent carcinogenicity experiments. Environ Health Perspect 2001; 109:509-514.

[0442] 49. Olson H, Betton G, Robinson D, Thomas K, Monro A, Kolaja G, Lilly P, et al. Concordance of the toxicity of pharmaceuticals in humans and in animals. Regul Toxicol Pharmacol 2000; 32:56-67.

[0443] 50. LeCluyse E L. Human hepatocyte culture systems for the in vitro evaluation of cytochrome P450 expression and regulation. Eur J Pharm Sci 2001; 13:343-368.

[0444] 51. Guillouzo A. Liver cell models in vitro toxicology. Environ Health Perspect 1998; 106 Suppl 2:511-532.

[0445] 52. Hewitt N J, Lechon M J, Houston J B, Hallifax D, Brown H S, Maurel P, Kenna J G, et al. Primary hepatocytes: current understanding of the regulation of metabolic enzymes and transporter proteins, and pharmaceutical practice for the use of hepatocytes in metabolism, enzyme induction, transporter, clearance, and hepatotoxicity studies. Drug Metab Rev 2007; 39:159-234.

[0446] 53. Nahmias Y, Berthiaume F, Yarmush M L. Integration of technologies for hepatic tissue engineering. Adv Biochem Eng Biotechnol 2007; 103:309-329.

[0447] 54. Kidambi S, Yarmush R S, Novik E, Chao P, Yarmush M L, Nahmias Y. Oxygen-mediated enhancement of primary hepatocyte metabolism, functional polarization, gene expression, and drug clearance. Proc Natl Acad Sci USA 2009; 106:15714-15719.

[0448] 55. Khetani S R, Bhatia S N. Microscale culture of human liver cells for drug development. Nat Biotechnol 2008; 26:120-126.

[0449] 56. Shulman M, Nahmias Y. Long-term culture and coculture of primary rat and human hepatocytes. Methods Mol Biol 2013; 945:287-302.

[0450] 57. Schwartz R E, Reyes M, Koodie L, Jiang Y, Blackstad M, Lund T, Lenvik T, et al. Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J Clin Invest 2002; 109:1291-1302.

[0451] 58. Stock P, Bruckner S, Ebensing S, Hempel M, Dollinger M M, Christ B. The generation of hepatocytes from mesenchymal stem cells and engraftment into murine liver. Nat Protoc 2010; 5:617-627.

[0452] 59. Lue J, Lin G, Ning H, Xiong A, Lin C S, Glenn J S. Transdifferentiation of adipose-derived stem cells into hepatocytes: a new approach. Liver Int 2010; 30:913-922.

[0453] 60. Zhu S, Rezvani M, Harbell J, Mattis A N, Wolfe A R, Benet L Z, Willenbring H, et al. Mouse liver repopulation with hepatocytes generated from human fibroblasts. Nature 2014.

[0454] 61. Duan Y, Ma X, Zou W, Wang C, Bahbahan I S, Ahuja T P, Tolstikov V, et al. Differentiation and characterization of metabolically functioning hepatocytes from human embryonic stem cells. Stem Cells 2010; 28:674-686.

[0455] 62. Song Z, Cai J, Liu Y, Zhao D, Yong J, Duo S, Song X, et al. Efficient generation of hepatocyte-like cells from human induced pluripotent stem cells. Cell Res 2009; 19:1233-1242.

[0456] 63. Si-Tayeb K, Noto F K, Nagaoka M, Li J, Battle M A, Duris C, North P E, et al. Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology 2010; 51:297-305.

[0457] 64. Chen Y F, Tseng C Y, Wang H W, Kuo H C, Yang V W, Lee O K. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 2012; 55:1193-1203.

[0458] 65. Roelandt P, Vanhove J, Verfaillie C. Directed differentiation of pluripotent stem cells to functional hepatocytes. Methods Mol Biol 2013; 997:141-147.

[0459] 66. Szkolnicka D, Farnworth S L, Lucendo-Villarin B, Storck C, Zhou W, Ircdalc J P, Flint 0, et al. Accurate Prediction of Drug-Induced Liver Injury Using Stem Cell-Derived Populations. Stem Cells Translational Medicine 2014; 3:141-148.

[0460] 67. Lacroix D, Sonnier M, Moncion A, Cheron G, Cresteil T. Expression of CYP3A in the human liver--evidence that the shift between CYP3A7 and CYP3A4 occurs immediately after birth. Eur J Biochem 1997; 247:625-634.

[0461] 68. Morelli L. Postnatal development of intestinal microflora as influenced by infant nutrition. J Nutr 2008; 138:17915-17955.

[0462] 69. Staudinger J L, Goodwin B, Jones S A, Hawkins-Brown D, MacKenzie K I, LaTour A, Liu Y, et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci USA 2001; 98:3369-3374.

[0463] 70. Conly J M, Stein K. The production of menaquinones (vitamin K2) by intestinal bacteria and their role in maintaining coagulation homeostasis. Prog Food Nutr Sci 1992; 16:307-343.

[0464] 71. Shearer M J, Rahim S, Barkhan P, Stimmler L. Plasma vitamin K1 in mothers and their newborn babies. Lancet 1982; 2:460-463.

[0465] 72. Shearer M J. Vitamin K deficiency bleeding (VKDB) in early infancy. Blood Rev 2009; 23:49-59.

[0466] 73. Tabb M M, Sun A, Zhou C, Grun F, Errandi J, Romero K, Pham H, et al. Vitamin K2 regulation of bone homeostasis is mediated by the steroid and xenobiotic receptor SXR. J Biol Chem 2003; 278:43919-43927.

[0467] 74. Ichikawa T, Horie-Inoue K, Ikeda K, Blumberg B, Inoue S. Steroid and xenobiotic receptor SXR mediates vitamin K2-activated transcription of extracellular matrix-related genes and collagen accumulation in osteoblastic cells. J Biol Chem 2006; 281:16927-16934.

[0468] 75. Amit M, Chebath J, Margulets V, Laevsky I, Miropolsky Y, Shariki K, Peri M, et al. Suspension culture of undifferentiated human embryonic and induced pluripotent stem cells. Stem Cell Rev 2010; 6:248-259.

[0469] 76. Amit M, Carpenter M K, Inokuma M S, Chiu C P, Harris C P, Waknitz M A, Itskovitz-Eldor J, et al. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000; 227:271-278.

[0470] 77. Kamiya A, Kinoshita T, Miyajima A. Oncostatin M and hepatocyte growth factor induce hepatic maturation via distinct signaling pathways. FEBS Lett 2001; 492:90-94.

[0471] 78. Donato M T, Jimenez N, Castell J V, Gomez-Lechon M J. Fluorescence-based assays for screening nine cytochrome P450 (P450) activities in intact cells expressing individual human P450 enzymes. Drug Metab Dispos 2004; 32:699-706.

[0472] 79. Roelandt P, Obeid S, Paeshuyse J, Vanhove J, Van Lommel A, Nahmias Y, Nevens F, et al. Human pluripotent stem cell-derived hepatocytes support complete replication of hepatitis C virus. Journal of Hepatology 2012; 57:246-251.

[0473] 80. Takebe T, Sekine K, Enomura M, Koike H, Kimura M, Ogaeri T, Zhang R-R, et al. Vascularized and functional human liver from an iPSC-derived organ bud transplant. Nature 2013; advance online publication.

[0474] 81. Si-Tayeb K, Noto F, Nagaoka M, Li J, Battle M, Duris C, North P, et al. Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology 2010; 51:297-305.



[0475] 82. Chen Y-F, Tseng C-Y, Wang H-W, Kuo H-C, Yang V W, Lee O K. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 2012; 55:1193-1203.

[0476] 83. Beulens J W, Booth S L, van den Heuvel E G, Stoecklin E, Baka A, Vermeer C. The role of menaquinones (vitamin K(2)) in human health. Br J Nutr 2013; 110:1357-1368.

[0477] 84. Makishima M, Okamoto A Y, Repa J J, Tu H, Learned R M, Luk A, Hull M V, et al. Identification of a nuclear receptor for bile acids. Science 1999; 284:1362-1365.

[0478] 85. Avior Y, Bomze D, Ramon O, Nahmias Y. Flavonoids as dietary regulators of nuclear receptor activity. Food Funct 2013; 4:831-844.

[0479] 86. Gronlund M M, Lehtonen O P, Eerola E, Kero P. Fecal microflora in healthy infants born by different methods of delivery: permanent changes in intestinal flora after cesarean delivery. J Pediatr Gastroenterol Nutr 1999; 28:19-25.

[0480] 87. Hopkins M J, Macfarlane G T, Furrie E, Fite A, Macfarlane S. Characterisation of intestinal bacteria in infant stools using real-time PCR and northern hybridisation analyses. FEMS Microbiol Ecol 2005; 54:77-85.

[0481] 88. Hay D C, Fletcher J, Payne C, Terrace J D, Gallagher R C, Snoeys J, Black J R, et al. Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 2008; 105:12301-12306.

[0482] 89. Goodwin B, Hodgson E, Liddle C. The Orphan Human Pregnane X Receptor Mediates the Transcriptional Activation of CYP3A4 by Rifampicin through a Distal Enhancer Module. Molecular Pharmacology 1999; 56:1329-1339.

[0483] 90. Behnia K, Bhatia S, Jastromb N, Balis U, Sullivan S, Yarmush M, Toner M. Xenobiotic metabolism by cultured primary porcine hepatocytes. Tissue Eng 2000; 6:467-479.

Sequence CWU 1

1

881609PRThomo sapiens 1Met Lys Trp Val Glu Ser Ile Phe Leu Ile Phe Leu Leu Asn Phe Thr1 5 10 15Glu Ser Arg Thr Leu His Arg Asn Glu Tyr Gly Ile Ala Ser Ile Leu 20 25 30Asp Ser Tyr Gln Cys Thr Ala Glu Ile Ser Leu Ala Asp Leu Ala Thr 35 40 45Ile Phe Phe Ala Gln Phe Val Gln Glu Ala Thr Tyr Lys Glu Val Ser 50 55 60Lys Met Val Lys Asp Ala Leu Thr Ala Ile Glu Lys Pro Thr Gly Asp65 70 75 80Glu Gln Ser Ser Gly Cys Leu Glu Asn Gln Leu Pro Ala Phe Leu Glu 85 90 95Glu Leu Cys His Glu Lys Glu Ile Leu Glu Lys Tyr Gly His Ser Asp 100 105 110Cys Cys Ser Gln Ser Glu Glu Gly Arg His Asn Cys Phe Leu Ala His 115 120 125Lys Lys Pro Thr Pro Ala Ser Ile Pro Leu Phe Gln Val Pro Glu Pro 130 135 140Val Thr Ser Cys Glu Ala Tyr Glu Glu Asp Arg Glu Thr Phe Met Asn145 150 155 160Lys Phe Ile Tyr Glu Ile Ala Arg Arg His Pro Phe Leu Tyr Ala Pro 165 170 175Thr Ile Leu Leu Trp Ala Ala Arg Tyr Asp Lys Ile Ile Pro Ser Cys 180 185 190Cys Lys Ala Glu Asn Ala Val Glu Cys Phe Gln Thr Lys Ala Ala Thr 195 200 205Val Thr Lys Glu Leu Arg Glu Ser Ser Leu Leu Asn Gln His Ala Cys 210 215 220Ala Val Met Lys Asn Phe Gly Thr Arg Thr Phe Gln Ala Ile Thr Val225 230 235 240Thr Lys Leu Ser Gln Lys Phe Thr Lys Val Asn Phe Thr Glu Ile Gln 245 250 255Lys Leu Val Leu Asp Val Ala His Val His Glu His Cys Cys Arg Gly 260 265 270Asp Val Leu Asp Cys Leu Gln Asp Gly Glu Lys Ile Met Ser Tyr Ile 275 280 285Cys Ser Gln Gln Asp Thr Leu Ser Asn Lys Ile Thr Glu Cys Cys Lys 290 295 300Leu Thr Thr Leu Glu Arg Gly Gln Cys Ile Ile His Ala Glu Asn Asp305 310 315 320Glu Lys Pro Glu Gly Leu Ser Pro Asn Leu Asn Arg Phe Leu Gly Asp 325 330 335Arg Asp Phe Asn Gln Phe Ser Ser Gly Glu Lys Asn Ile Phe Leu Ala 340 345 350Ser Phe Val His Glu Tyr Ser Arg Arg His Pro Gln Leu Ala Val Ser 355 360 365Val Ile Leu Arg Val Ala Lys Gly Tyr Gln Glu Leu Leu Glu Lys Cys 370 375 380Phe Gln Thr Glu Asn Pro Leu Glu Cys Gln Asp Lys Gly Glu Glu Glu385 390 395 400Leu Gln Lys Tyr Ile Gln Glu Ser Gln Ala Leu Ala Lys Arg Ser Cys 405 410 415Gly Leu Phe Gln Lys Leu Gly Glu Tyr Tyr Leu Gln Asn Ala Phe Leu 420 425 430Val Ala Tyr Thr Lys Lys Ala Pro Gln Leu Thr Ser Ser Glu Leu Met 435 440 445Ala Ile Thr Arg Lys Met Ala Ala Thr Ala Ala Thr Cys Cys Gln Leu 450 455 460Ser Glu Asp Lys Leu Leu Ala Cys Gly Glu Gly Ala Ala Asp Ile Ile465 470 475 480Ile Gly His Leu Cys Ile Arg His Glu Met Thr Pro Val Asn Pro Gly 485 490 495Val Gly Gln Cys Cys Thr Ser Ser Tyr Ala Asn Arg Arg Pro Cys Phe 500 505 510Ser Ser Leu Val Val Asp Glu Thr Tyr Val Pro Pro Ala Phe Ser Asp 515 520 525Asp Lys Phe Ile Phe His Lys Asp Leu Cys Gln Ala Gln Gly Val Ala 530 535 540Leu Gln Thr Met Lys Gln Glu Phe Leu Ile Asn Leu Val Lys Gln Lys545 550 555 560Pro Gln Ile Thr Glu Glu Gln Leu Glu Ala Val Ile Ala Asp Phe Ser 565 570 575Gly Leu Leu Glu Lys Cys Cys Gln Gly Gln Glu Gln Glu Val Cys Phe 580 585 590Ala Glu Glu Gly Gln Lys Leu Ile Ser Lys Thr Arg Ala Ala Leu Gly 595 600 605Val2503PRThomo sapiens 2Met Asp Leu Ile Pro Asn Leu Ala Val Glu Thr Trp Leu Leu Leu Ala1 5 10 15Val Ser Leu Ile Leu Leu Tyr Leu Tyr Gly Thr Arg Thr His Gly Leu 20 25 30Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro Phe Leu Gly 35 40 45Asn Ala Leu Ser Phe Arg Lys Gly Tyr Trp Thr Phe Asp Met Glu Cys 50 55 60Tyr Lys Lys Tyr Arg Lys Val Trp Gly Ile Tyr Asp Cys Gln Gln Pro65 70 75 80Met Leu Ala Ile Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys 85 90 95Glu Cys Tyr Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly 100 105 110Phe Met Lys Asn Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg 115 120 125Ile Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu 130 135 140Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg Asn Leu145 150 155 160Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr Leu Lys His Val Phe 165 170 175Gly Ala Tyr Ser Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Ser 180 185 190Ile Asp Ser Leu Asn Asn Pro Gln Asp Pro Phe Val Glu Asn Thr Lys 195 200 205Lys Leu Leu Arg Phe Asn Pro Leu Asp Pro Phe Val Leu Ser Ile Lys 210 215 220Val Phe Pro Phe Leu Thr Pro Ile Leu Glu Ala Leu Asn Ile Thr Val225 230 235 240Phe Pro Arg Lys Val Ile Ser Phe Leu Thr Lys Ser Val Lys Gln Ile 245 250 255Lys Glu Gly Arg Leu Lys Glu Thr Gln Lys His Arg Val Asp Phe Leu 260 265 270Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Asp Ser Glu Thr His Lys 275 280 285Ala Leu Ser Asp Leu Glu Leu Met Ala Gln Ser Ile Ile Phe Ile Phe 290 295 300Ala Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser Phe Ile Ile Tyr Glu305 310 315 320Leu Ala Thr His Pro Asp Val Gln Gln Lys Val Gln Lys Glu Ile Asp 325 330 335Thr Val Leu Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln 340 345 350Leu Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro 355 360 365Val Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn 370 375 380Gly Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser Tyr Val385 390 395 400Leu His His Asp Pro Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro 405 410 415Glu Arg Phe Ser Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr 420 425 430Thr Pro Phe Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe Ala 435 440 445Leu Val Asn Met Lys Leu Ala Leu Val Arg Val Leu Gln Asn Phe Ser 450 455 460Phe Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Arg Phe Gly465 470 475 480Gly Leu Leu Leu Thr Glu Lys Pro Ile Val Leu Lys Ala Glu Ser Arg 485 490 495Asp Glu Thr Val Ser Gly Ala 5003502PRThomo sapiens 3Met Ala Leu Ile Pro Asp Leu Ala Met Glu Thr Trp Leu Leu Leu Ala1 5 10 15Val Ser Leu Val Leu Leu Tyr Leu Tyr Gly Thr His Ser His Gly Leu 20 25 30Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro Phe Leu Gly 35 40 45Asn Ile Leu Ser Tyr His Lys Gly Phe Cys Met Phe Asp Met Glu Cys 50 55 60His Lys Lys Tyr Gly Lys Val Trp Gly Phe Tyr Asp Gly Gln Gln Pro65 70 75 80Val Leu Ala Ile Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys 85 90 95Glu Cys Tyr Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly 100 105 110Phe Met Lys Ser Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg 115 120 125Leu Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu 130 135 140Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg Asn Leu145 150 155 160Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr Leu Lys Asp Val Phe 165 170 175Gly Ala Tyr Ser Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Asn 180 185 190Ile Asp Ser Leu Asn Asn Pro Gln Asp Pro Phe Val Glu Asn Thr Lys 195 200 205Lys Leu Leu Arg Phe Asp Phe Leu Asp Pro Phe Phe Leu Ser Ile Ile 210 215 220Phe Pro Phe Leu Ile Pro Ile Leu Glu Val Leu Asn Ile Cys Val Phe225 230 235 240Pro Arg Glu Val Thr Asn Phe Leu Arg Lys Ser Val Lys Arg Met Lys 245 250 255Glu Ser Arg Leu Glu Asp Thr Gln Lys His Arg Val Asp Phe Leu Gln 260 265 270Leu Met Ile Asp Ser Gln Asn Ser Lys Glu Thr Glu Ser His Lys Ala 275 280 285Leu Ser Asp Leu Glu Leu Val Ala Gln Ser Ile Ile Phe Ile Phe Ala 290 295 300Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser Phe Ile Met Tyr Glu Leu305 310 315 320Ala Thr His Pro Asp Val Gln Gln Lys Leu Gln Glu Glu Ile Asp Ala 325 330 335Val Leu Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln Met 340 345 350Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro Ile 355 360 365Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn Gly 370 375 380Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser Tyr Ala Leu385 390 395 400His Arg Asp Pro Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro Glu 405 410 415Arg Phe Ser Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr Thr 420 425 430Pro Phe Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe Ala Leu 435 440 445Met Asn Met Lys Leu Ala Leu Ile Arg Val Leu Gln Asn Phe Ser Phe 450 455 460Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Ser Leu Gly Gly465 470 475 480Leu Leu Gln Pro Glu Lys Pro Val Val Leu Lys Val Glu Ser Arg Asp 485 490 495Gly Thr Val Ser Gly Ala 5004503PRThomo sapiens 4Met Ala Leu Ile Pro Asp Leu Ala Met Glu Thr Trp Leu Leu Leu Ala1 5 10 15Val Ser Leu Val Leu Leu Tyr Leu Tyr Gly Thr His Ser His Gly Leu 20 25 30Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro Phe Leu Gly 35 40 45Asn Ile Leu Ser Tyr His Lys Gly Phe Cys Met Phe Asp Met Glu Cys 50 55 60His Lys Lys Tyr Gly Lys Val Trp Gly Phe Tyr Asp Gly Gln Gln Pro65 70 75 80Val Leu Ala Ile Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys 85 90 95Glu Cys Tyr Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly 100 105 110Phe Met Lys Ser Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg 115 120 125Leu Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu 130 135 140Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg Asn Leu145 150 155 160Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr Leu Lys Asp Val Phe 165 170 175Gly Ala Tyr Ser Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Asn 180 185 190Ile Asp Ser Leu Asn Asn Pro Gln Asp Pro Phe Val Glu Asn Thr Lys 195 200 205Lys Leu Leu Arg Phe Asp Phe Leu Asp Pro Phe Phe Leu Ser Ile Thr 210 215 220Val Phe Pro Phe Leu Ile Pro Ile Leu Glu Val Leu Asn Ile Cys Val225 230 235 240Phe Pro Arg Glu Val Thr Asn Phe Leu Arg Lys Ser Val Lys Arg Met 245 250 255Lys Glu Ser Arg Leu Glu Asp Thr Gln Lys His Arg Val Asp Phe Leu 260 265 270Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Glu Thr Glu Ser His Lys 275 280 285Ala Leu Ser Asp Leu Glu Leu Val Ala Gln Ser Ile Ile Phe Ile Phe 290 295 300Ala Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser Phe Ile Met Tyr Glu305 310 315 320Leu Ala Thr His Pro Asp Val Gln Gln Lys Leu Gln Glu Glu Ile Asp 325 330 335Ala Val Leu Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln 340 345 350Met Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro 355 360 365Ile Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn 370 375 380Gly Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser Tyr Ala385 390 395 400Leu His Arg Asp Pro Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro 405 410 415Glu Arg Phe Ser Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr 420 425 430Thr Pro Phe Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe Ala 435 440 445Leu Met Asn Met Lys Leu Ala Leu Ile Arg Val Leu Gln Asn Phe Ser 450 455 460Phe Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Ser Leu Gly465 470 475 480Gly Leu Leu Gln Pro Glu Lys Pro Val Val Leu Lys Val Glu Ser Arg 485 490 495Asp Gly Thr Val Ser Gly Ala 5005728PRThomo sapiens 5Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285Ala Asp Asn Thr Met Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu 290 295 300Cys Ile Gln Gly Gln Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile305 310 315 320Trp Asn Gly Ile Pro Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu 325 330 335His Asp Met Thr Pro Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn 340

345 350Tyr Cys Arg Asn Pro Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr 355 360 365Asp Pro Asn Ile Arg Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp 370 375 380Met Ser His Gly Gln Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met385 390 395 400Gly Asn Leu Ser Gln Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp 405 410 415Lys Asn Met Glu Asp Leu His Arg His Ile Phe Trp Glu Pro Asp Ala 420 425 430Ser Lys Leu Asn Glu Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His 435 440 445Gly Pro Trp Cys Tyr Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys 450 455 460Pro Ile Ser Arg Cys Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu465 470 475 480Asp His Pro Val Ile Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val 485 490 495Asn Gly Ile Pro Thr Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg 500 505 510Tyr Arg Asn Lys His Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp 515 520 525Val Leu Thr Ala Arg Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr 530 535 540Glu Ala Trp Leu Gly Ile His Asp Val His Gly Arg Gly Asp Glu Lys545 550 555 560Cys Lys Gln Val Leu Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly 565 570 575Ser Asp Leu Val Leu Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp 580 585 590Phe Val Ser Thr Ile Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu 595 600 605Lys Thr Ser Cys Ser Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn 610 615 620Tyr Asp Gly Leu Leu Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu625 630 635 640Lys Cys Ser Gln His His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu 645 650 655Ile Cys Ala Gly Ala Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp 660 665 670Tyr Gly Gly Pro Leu Val Cys Glu Gln His Lys Met Arg Met Val Leu 675 680 685Gly Val Ile Val Pro Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly 690 695 700Ile Phe Val Arg Val Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile705 710 715 720Leu Thr Tyr Lys Val Pro Gln Ser 7256290PRThomo sapiens 6Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285Glu Thr 2907723PRThomo sapiens 7Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys Ala Asp Asn Thr Met 275 280 285Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu Cys Ile Gln Gly Gln 290 295 300Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile Trp Asn Gly Ile Pro305 310 315 320Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu His Asp Met Thr Pro 325 330 335Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn Tyr Cys Arg Asn Pro 340 345 350Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr Asp Pro Asn Ile Arg 355 360 365Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp Met Ser His Gly Gln 370 375 380Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met Gly Asn Leu Ser Gln385 390 395 400Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp Lys Asn Met Glu Asp 405 410 415Leu His Arg His Ile Phe Trp Glu Pro Asp Ala Ser Lys Leu Asn Glu 420 425 430Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His Gly Pro Trp Cys Tyr 435 440 445Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys Pro Ile Ser Arg Cys 450 455 460Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu Asp His Pro Val Ile465 470 475 480Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val Asn Gly Ile Pro Thr 485 490 495Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg Tyr Arg Asn Lys His 500 505 510Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp Val Leu Thr Ala Arg 515 520 525Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr Glu Ala Trp Leu Gly 530 535 540Ile His Asp Val His Gly Arg Gly Asp Glu Lys Cys Lys Gln Val Leu545 550 555 560Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly Ser Asp Leu Val Leu 565 570 575Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp Phe Val Ser Thr Ile 580 585 590Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu Lys Thr Ser Cys Ser 595 600 605Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn Tyr Asp Gly Leu Leu 610 615 620Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu Lys Cys Ser Gln His625 630 635 640His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu Ile Cys Ala Gly Ala 645 650 655Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp Tyr Gly Gly Pro Leu 660 665 670Val Cys Glu Gln His Lys Met Arg Met Val Leu Gly Val Ile Val Pro 675 680 685Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly Ile Phe Val Arg Val 690 695 700Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile Leu Thr Tyr Lys Val705 710 715 720Pro Gln Ser8285PRThomo sapiens 8Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys Glu Thr 275 280 2859210PRThomo sapiens 9Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Gly Lys 21010573PRThomo sapiens 10Met Leu Arg Leu Pro Thr Val Phe Arg Gln Met Arg Pro Val Ser Arg1 5 10 15Val Leu Ala Pro His Leu Thr Arg Ala Tyr Ala Lys Asp Val Lys Phe 20 25 30Gly Ala Asp Ala Arg Ala Leu Met Leu Gln Gly Val Asp Leu Leu Ala 35 40 45Asp Ala Val Ala Val Thr Met Gly Pro Lys Gly Arg Thr Val Ile Ile 50 55 60Glu Gln Ser Trp Gly Ser Pro Lys Val Thr Lys Asp Gly Val Thr Val65 70 75 80Ala Lys Ser Ile Asp Leu Lys Asp Lys Tyr Lys Asn Ile Gly Ala Lys 85 90 95Leu Val Gln Asp Val Ala Asn Asn Thr Asn Glu Glu Ala Gly Asp Gly 100 105 110Thr Thr Thr Ala Thr Val Leu Ala Arg Ser Ile Ala Lys Glu Gly Phe 115 120 125Glu Lys Ile Ser Lys Gly Ala Asn Pro Val Glu Ile Arg Arg Gly Val 130 135 140Met Leu Ala Val Asp Ala Val Ile Ala Glu Leu Lys Lys Gln Ser Lys145 150 155 160Pro Val Thr Thr Pro Glu Glu Ile Ala Gln Val Ala Thr Ile Ser Ala 165 170 175Asn Gly Asp Lys Glu Ile Gly Asn Ile Ile Ser Asp Ala Met Lys Lys 180 185 190Val Gly Arg Lys Gly Val Ile Thr Val Lys Asp Gly Lys Thr Leu Asn 195 200 205Asp Glu Leu Glu Ile Ile Glu Gly Met Lys Phe Asp Arg Gly Tyr Ile 210 215 220Ser Pro Tyr Phe Ile Asn Thr Ser Lys Gly Gln Lys Cys Glu Phe Gln225 230 235 240Asp Ala Tyr Val Leu Leu Ser Glu Lys Lys Ile Ser Ser Ile Gln Ser 245 250 255Ile Val Pro Ala Leu Glu Ile Ala Asn Ala His Arg Lys Pro Leu Val 260 265 270Ile Ile Ala Glu Asp Val Asp Gly Glu Ala Leu Ser Thr Leu Val Leu 275 280 285Asn Arg Leu Lys Val Gly Leu Gln Val Val Ala Val Lys Ala Pro Gly 290 295 300Phe Gly Asp Asn Arg Lys Asn Gln Leu Lys Asp Met Ala Ile Ala Thr305 310 315 320Gly Gly Ala Val Phe Gly Glu Glu Gly Leu Thr Leu Asn Leu Glu Asp 325 330 335Val Gln Pro His Asp Leu Gly Lys Val Gly Glu Val Ile Val Thr Lys 340 345 350Asp Asp Ala Met Leu Leu Lys Gly Lys Gly Asp Lys Ala Gln Ile Glu 355 360 365Lys Arg Ile Gln Glu Ile Ile Glu Gln Leu Asp Val Thr Thr Ser Glu 370 375 380Tyr Glu Lys Glu Lys Leu Asn Glu Arg Leu Ala Lys Leu Ser Asp Gly385 390 395 400Val Ala Val Leu Lys Val Gly Gly Thr Ser Asp Val Glu Val Asn Glu 405 410 415Lys Lys Asp Arg Val Thr Asp Ala Leu Asn Ala Thr Arg Ala Ala Val 420 425 430Glu Glu Gly Ile Val Leu Gly Gly Gly Cys Ala Leu Leu Arg Cys Ile 435 440 445Pro Ala Leu Asp Ser Leu Thr Pro Ala Asn Glu Asp Gln Lys Ile Gly 450 455 460Ile Glu Ile Ile Lys Arg Thr Leu Lys Ile Pro Ala Met Thr Ile Ala465 470 475 480Lys Asn Ala Gly Val Glu Gly Ser Leu Ile Val Glu Lys Ile Met Gln 485 490 495Ser Ser Ser Glu Val Gly Tyr Asp Ala Met Ala Gly Asp Phe Val Asn 500 505 510Met Val Glu Lys Gly Ile Ile Asp Pro Thr Lys Val Val Arg Thr Ala 515 520 525Leu Leu Asp Ala Ala Gly Val Ala Ser Leu Leu Thr Thr Ala Glu Val 530 535 540Val Val Thr Glu Ile Pro Lys Glu Glu Lys Asp Pro Gly Met Gly Ala545 550 555 560Met Gly Gly Met Gly Gly Gly Met Gly Gly Gly Met Phe 565 57011573PRThomo sapiens

11Met Leu Arg Leu Pro Thr Val Phe Arg Gln Met Arg Pro Val Ser Arg1 5 10 15Val Leu Ala Pro His Leu Thr Arg Ala Tyr Ala Lys Asp Val Lys Phe 20 25 30Gly Ala Asp Ala Arg Ala Leu Met Leu Gln Gly Val Asp Leu Leu Ala 35 40 45Asp Ala Val Ala Val Thr Met Gly Pro Lys Gly Arg Thr Val Ile Ile 50 55 60Glu Gln Ser Trp Gly Ser Pro Lys Val Thr Lys Asp Gly Val Thr Val65 70 75 80Ala Lys Ser Ile Asp Leu Lys Asp Lys Tyr Lys Asn Ile Gly Ala Lys 85 90 95Leu Val Gln Asp Val Ala Asn Asn Thr Asn Glu Glu Ala Gly Asp Gly 100 105 110Thr Thr Thr Ala Thr Val Leu Ala Arg Ser Ile Ala Lys Glu Gly Phe 115 120 125Glu Lys Ile Ser Lys Gly Ala Asn Pro Val Glu Ile Arg Arg Gly Val 130 135 140Met Leu Ala Val Asp Ala Val Ile Ala Glu Leu Lys Lys Gln Ser Lys145 150 155 160Pro Val Thr Thr Pro Glu Glu Ile Ala Gln Val Ala Thr Ile Ser Ala 165 170 175Asn Gly Asp Lys Glu Ile Gly Asn Ile Ile Ser Asp Ala Met Lys Lys 180 185 190Val Gly Arg Lys Gly Val Ile Thr Val Lys Asp Gly Lys Thr Leu Asn 195 200 205Asp Glu Leu Glu Ile Ile Glu Gly Met Lys Phe Asp Arg Gly Tyr Ile 210 215 220Ser Pro Tyr Phe Ile Asn Thr Ser Lys Gly Gln Lys Cys Glu Phe Gln225 230 235 240Asp Ala Tyr Val Leu Leu Ser Glu Lys Lys Ile Ser Ser Ile Gln Ser 245 250 255Ile Val Pro Ala Leu Glu Ile Ala Asn Ala His Arg Lys Pro Leu Val 260 265 270Ile Ile Ala Glu Asp Val Asp Gly Glu Ala Leu Ser Thr Leu Val Leu 275 280 285Asn Arg Leu Lys Val Gly Leu Gln Val Val Ala Val Lys Ala Pro Gly 290 295 300Phe Gly Asp Asn Arg Lys Asn Gln Leu Lys Asp Met Ala Ile Ala Thr305 310 315 320Gly Gly Ala Val Phe Gly Glu Glu Gly Leu Thr Leu Asn Leu Glu Asp 325 330 335Val Gln Pro His Asp Leu Gly Lys Val Gly Glu Val Ile Val Thr Lys 340 345 350Asp Asp Ala Met Leu Leu Lys Gly Lys Gly Asp Lys Ala Gln Ile Glu 355 360 365Lys Arg Ile Gln Glu Ile Ile Glu Gln Leu Asp Val Thr Thr Ser Glu 370 375 380Tyr Glu Lys Glu Lys Leu Asn Glu Arg Leu Ala Lys Leu Ser Asp Gly385 390 395 400Val Ala Val Leu Lys Val Gly Gly Thr Ser Asp Val Glu Val Asn Glu 405 410 415Lys Lys Asp Arg Val Thr Asp Ala Leu Asn Ala Thr Arg Ala Ala Val 420 425 430Glu Glu Gly Ile Val Leu Gly Gly Gly Cys Ala Leu Leu Arg Cys Ile 435 440 445Pro Ala Leu Asp Ser Leu Thr Pro Ala Asn Glu Asp Gln Lys Ile Gly 450 455 460Ile Glu Ile Ile Lys Arg Thr Leu Lys Ile Pro Ala Met Thr Ile Ala465 470 475 480Lys Asn Ala Gly Val Glu Gly Ser Leu Ile Val Glu Lys Ile Met Gln 485 490 495Ser Ser Ser Glu Val Gly Tyr Asp Ala Met Ala Gly Asp Phe Val Asn 500 505 510Met Val Glu Lys Gly Ile Ile Asp Pro Thr Lys Val Val Arg Thr Ala 515 520 525Leu Leu Asp Ala Ala Gly Val Ala Ser Leu Leu Thr Thr Ala Glu Val 530 535 540Val Val Thr Glu Ile Pro Lys Glu Glu Lys Asp Pro Gly Met Gly Ala545 550 555 560Met Gly Gly Met Gly Gly Gly Met Gly Gly Gly Met Phe 565 570122057DNAhomo sapiens 12atattgtgct tccaccactg ccaataacaa aataactagc aaccatgaag tgggtggaat 60caattttttt aattttccta ctaaatttta ctgaatccag aacactgcat agaaatgaat 120atggaatagc ttccatattg gattcttacc aatgtactgc agagataagt ttagctgacc 180tggctaccat attttttgcc cagtttgttc aagaagccac ttacaaggaa gtaagcaaaa 240tggtgaaaga tgcattgact gcaattgaga aacccactgg agatgaacag tcttcagggt 300gtttagaaaa ccagctacct gcctttctgg aagaactttg ccatgagaaa gaaattttgg 360agaagtacgg acattcagac tgctgcagcc aaagtgaaga gggaagacat aactgttttc 420ttgcacacaa aaagcccact ccagcatcga tcccactttt ccaagttcca gaacctgtca 480caagctgtga agcatatgaa gaagacaggg agacattcat gaacaaattc atttatgaga 540tagcaagaag gcatcccttc ctgtatgcac ctacaattct tctttgggct gctcgctatg 600acaaaataat tccatcttgc tgcaaagctg aaaatgcagt tgaatgcttc caaacaaagg 660cagcaacagt tacaaaagaa ttaagagaaa gcagcttgtt aaatcaacat gcatgtgcag 720taatgaaaaa ttttgggacc cgaactttcc aagccataac tgttactaaa ctgagtcaga 780agtttaccaa agttaatttt actgaaatcc agaaactagt cctggatgtg gcccatgtac 840atgagcactg ttgcagagga gatgtgctgg attgtctgca ggatggggaa aaaatcatgt 900cctacatatg ttctcaacaa gacactctgt caaacaaaat aacagaatgc tgcaaactga 960ccacgctgga acgtggtcaa tgtataattc atgcagaaaa tgatgaaaaa cctgaaggtc 1020tatctccaaa tctaaacagg tttttaggag atagagattt taaccaattt tcttcagggg 1080aaaaaaatat cttcttggca agttttgttc atgaatattc aagaagacat cctcagcttg 1140ctgtctcagt aattctaaga gttgctaaag gataccagga gttattggag aagtgtttcc 1200agactgaaaa ccctcttgaa tgccaagata aaggagaaga agaattacag aaatacatcc 1260aggagagcca agcattggca aagcgaagct gcggcctctt ccagaaacta ggagaatatt 1320acttacaaaa tgcgtttctc gttgcttaca caaagaaagc cccccagctg acctcgtcgg 1380agctgatggc catcaccaga aaaatggcag ccacagcagc cacttgttgc caactcagtg 1440aggacaaact attggcctgt ggcgagggag cggctgacat tattatcgga cacttatgta 1500tcagacatga aatgactcca gtaaaccctg gtgttggcca gtgctgcact tcttcatatg 1560ccaacaggag gccatgcttc agcagcttgg tggtggatga aacatatgtc cctcctgcat 1620tctctgatga caagttcatt ttccataagg atctgtgcca agctcagggt gtagcgctgc 1680aaacgatgaa gcaagagttt ctcattaacc ttgtgaagca aaagccacaa ataacagagg 1740aacaacttga ggctgtcatt gcagatttct caggcctgtt ggagaaatgc tgccaaggcc 1800aggaacagga agtctgcttt gctgaagagg gacaaaaact gatttcaaaa actcgtgctg 1860ctttgggagt ttaaattact tcaggggaag agaagacaaa acgagtcttt cattcggtgt 1920gaacttttct ctttaatttt aactgattta acactttttg tgaattaatg aaatgataaa 1980gacttttatg tgagatttcc ttatcacaga aataaaatat ctccaaatgt ttccttttca 2040aaaaaaaaaa aaaaaaa 2057132099DNAhomo sapiens 13aatcactgct gtgcagggca ggaaagctcc acacacacag cccagcaaac agcagcacgc 60tgctgaaaaa aagactcaga ggagagagat aaggaaggaa agtagtgatg gatctcatcc 120caaacttggc cgtggaaacc tggcttctcc tggctgtcag cctgatactc ctctatctat 180atggaacccg tacacatgga ctttttaaga agcttggaat tccagggccc acacctctgc 240cttttttggg aaatgctttg tccttccgta agggctattg gacgtttgac atggaatgtt 300ataaaaagta tagaaaagtc tggggtattt atgactgtca acagcctatg ctggctatca 360cagatcccga catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc 420ggaggccttt cgggccagtg ggatttatga aaaatgccat ctctatagct gaggatgaag 480aatggaagag aatacgatca ttgctgtctc caacattcac cagcggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc ttgaaacacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc atttggagtg agcatcgact ctctcaacaa tccacaagac ccctttgtgg 720aaaacaccaa gaagctttta agatttaatc cattagatcc attcgttctc tcaataaaag 780tctttccatt ccttacccca attcttgaag cattaaatat cactgtgttt ccaagaaaag 840ttataagttt tctaacaaaa tctgtaaaac agataaaaga aggtcgcctc aaagagacac 900aaaagcaccg agtggatttc cttcagctga tgattgactc tcagaattca aaagactctg 960agacccacaa agctctgtct gatctggagc tcatggccca atcaattatc tttatttttg 1020ctggctatga aaccacgagc agtgttctct ccttcattat atatgaactg gccactcacc 1080ctgatgtcca gcagaaagtg cagaaggaaa ttgatacagt tttacccaat aaggcaccac 1140ccacctatga tactgtgcta cagttggagt atcttgacat ggtggtgaat gaaacactca 1200gattattccc agttgctatg agacttgaga gggtctgcaa aaaagatgtt gaaatcaatg 1260ggatgtttat tcccaaaggg gtggtggtga tgattccaag ctatgttctt catcatgacc 1320caaagtactg gacagagcct gagaagttcc tccctgaaag gttcagtaaa aagaacaagg 1380acaacataga tccttacata tacacaccct ttggaagtgg acccagaaac tgcattggca 1440tgaggtttgc tctcgtgaac atgaaacttg ctctagtcag agtccttcag aacttctcct 1500tcaaaccttg taaagaaaca cagatccccc tgaaattacg ctttggagga cttcttctaa 1560cagaaaaacc cattgttcta aaggctgagt caagggatga gaccgtaagt ggagcctgat 1620ttccctaagg acttctggtt tgctctttaa gaaagctgtg ccccagaaca ccagagacct 1680caaattactt tacaaataga accctgaaat gaagacgggc ttcatccaat gtgctgcata 1740aataatcagg gattctgtac gtgcattgtg ctctctcatg gtctgtatag agtgttatac 1800ttggtaatat agaggagatg accaaatcag tgctggggaa gtagatttgg cttctctgct 1860tctcatagga ctatctccac cacccccagt tagcaccatt aactcctcct gagctctgat 1920aacataatta acatttctca ataatttcaa ccacaatcat taataaaaat aggaattatt 1980ttgatggctc taacagtgac atttatatca tgtgttatat ctgtagtatt ctatagtaag 2040ctttatatta agcaaatcaa taaaaacctc tttacaaaag taaaaaaaaa aaaaaaaaa 2099142789DNAhomo sapiens 14aatcactgct gtgcagggca ggaaagctcc atgcacatag cccagcaaag agcaacacag 60agctgaaagg aagactcaga ggagagagat aagtaaggaa agtagtgatg gctctcatcc 120cagacttggc catggaaacc tggcttctcc tggctgtcag cctggtgctc ctctatctat 180atggaaccca ttcacatgga ctttttaaga agcttggaat tccagggccc acacctctgc 240cttttttggg aaatattttg tcctaccata agggcttttg tatgtttgac atggaatgtc 300ataaaaagta tggaaaagtg tggggctttt atgatggtca acagcctgtg ctggctatca 360cagatcctga catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc 420ggaggccttt tggtccagtg ggatttatga aaagtgccat ctctatagct gaggatgaag 480aatggaagag attacgatca ttgctgtctc caaccttcac cagtggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc ttgaaagacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc atttggagtg aacatcgact ctctcaacaa tccacaagac ccctttgtgg 720aaaacaccaa gaagctttta agatttgatt ttttggatcc attctttctc tcaataatct 780ttccattcct catcccaatt cttgaagtat taaatatctg tgtgtttcca agagaagtta 840caaatttttt aagaaaatct gtaaaaagga tgaaagaaag tcgcctcgaa gatacacaaa 900agcaccgagt ggatttcctt cagctgatga ttgactctca gaattcaaaa gaaactgagt 960cccacaaagc tctgtccgat ctggagctcg tggcccaatc aattatcttt atttttgctg 1020gctatgaaac cacgagcagt gttctctcct tcattatgta tgaactggcc actcaccctg 1080atgtccagca gaaactgcag gaggaaattg atgcagtttt acccaataag gcaccaccca 1140cctatgatac tgtgctacag atggagtatc ttgacatggt ggtgaatgaa acgctcagat 1200tattcccaat tgctatgaga cttgagaggg tctgcaaaaa agatgttgag atcaatggga 1260tgttcattcc caaaggggtg gtggtgatga ttccaagcta tgctcttcac cgtgacccaa 1320agtactggac agagcctgag aagttcctcc ctgaaagatt cagcaagaag aacaaggaca 1380acatagatcc ttacatatac acaccctttg gaagtggacc cagaaactgc attggcatga 1440ggtttgctct catgaacatg aaacttgctc taatcagagt ccttcagaac ttctccttca 1500aaccttgtaa agaaacacag atccccctga aattaagctt aggaggactt cttcaaccag 1560aaaaacccgt tgttctaaag gttgagtcaa gggatggcac cgtaagtgga gcctgaattt 1620tcctaaggac ttctgctttg ctcttcaaga aatctgtgcc tgagaacacc agagacctca 1680aattactttg tgaatagaac tctgaaatga agatgggctt catccaatgg actgcataaa 1740taaccgggga ttctgtacat gcattgagct ctctcattgt ctgtgtagag tgttatactt 1800gggaatataa aggaggtgac caaatcagtg tgaggaggta gatttggctc ctctgcttct 1860cacgggacta tttccaccac ccccagttag caccattaac tcctcctgag ctctgataag 1920agaatcaaca tttctcaata atttcctcca caaattatta atgaaaataa gaattatttt 1980gatggctcta acaatgacat ttatatcaca tgttttctct ggagtattct ataagtttta 2040tgttaaatca ataaagacca ctttacaaaa gtattatcag atgctttcct gcacattaag 2100gagaaatcta tagaactgaa tgagaaccaa caagtaaata tttttggtca ttgtaatcac 2160tgttggcgtg gggcctttgt cagaactaga atttgattat taacataggt gaaagttaat 2220ccactgtgac tttgcccatt gtttagaaag aatattcata gtttaattat gccttttttg 2280atcaggcaca gtggctcacg cctgtaatcc tagcagtttg ggaggctgag ccgggtggat 2340cgcctgaggt caggagttca agacaagcct ggcctacatg gttgaaaccc catctctact 2400aaaaatacac aaattagcta ggcatggtgg actcgcctgt aatctcacta cacaggaggc 2460tgaggcagga gaatcacttg aacctgggag gcggatgttg aagtgagctg agattgcacc 2520actgcactcc agtctgggtg agagtgagac tcagtcttaa aaaaatatgc ctttttgaag 2580cacgtacatt ttgtaacaaa gaactgaagc tcttattata ttattagttt tgatttaatg 2640ttttcagccc atctcctttc atatttctgg gagacagaaa acatgtttcc ctacacctct 2700tgcattccat cctcaacacc caactgtctc gatgcaatga acacttaata aaaaacagtc 2760gattggtcaa ttgattgagc aataagcct 2789152792DNAhomo sapiens 15aatcactgct gtgcagggca ggaaagctcc atgcacatag cccagcaaag agcaacacag 60agctgaaagg aagactcaga ggagagagat aagtaaggaa agtagtgatg gctctcatcc 120cagacttggc catggaaacc tggcttctcc tggctgtcag cctggtgctc ctctatctat 180atggaaccca ttcacatgga ctttttaaga agcttggaat tccagggccc acacctctgc 240cttttttggg aaatattttg tcctaccata agggcttttg tatgtttgac atggaatgtc 300ataaaaagta tggaaaagtg tggggctttt atgatggtca acagcctgtg ctggctatca 360cagatcctga catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc 420ggaggccttt tggtccagtg ggatttatga aaagtgccat ctctatagct gaggatgaag 480aatggaagag attacgatca ttgctgtctc caaccttcac cagtggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc ttgaaagacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc atttggagtg aacatcgact ctctcaacaa tccacaagac ccctttgtgg 720aaaacaccaa gaagctttta agatttgatt ttttggatcc attctttctc tcaataacag 780tctttccatt cctcatccca attcttgaag tattaaatat ctgtgtgttt ccaagagaag 840ttacaaattt tttaagaaaa tctgtaaaaa ggatgaaaga aagtcgcctc gaagatacac 900aaaagcaccg agtggatttc cttcagctga tgattgactc tcagaattca aaagaaactg 960agtcccacaa agctctgtcc gatctggagc tcgtggccca atcaattatc tttatttttg 1020ctggctatga aaccacgagc agtgttctct ccttcattat gtatgaactg gccactcacc 1080ctgatgtcca gcagaaactg caggaggaaa ttgatgcagt tttacccaat aaggcaccac 1140ccacctatga tactgtgcta cagatggagt atcttgacat ggtggtgaat gaaacgctca 1200gattattccc aattgctatg agacttgaga gggtctgcaa aaaagatgtt gagatcaatg 1260ggatgttcat tcccaaaggg gtggtggtga tgattccaag ctatgctctt caccgtgacc 1320caaagtactg gacagagcct gagaagttcc tccctgaaag attcagcaag aagaacaagg 1380acaacataga tccttacata tacacaccct ttggaagtgg acccagaaac tgcattggca 1440tgaggtttgc tctcatgaac atgaaacttg ctctaatcag agtccttcag aacttctcct 1500tcaaaccttg taaagaaaca cagatccccc tgaaattaag cttaggagga cttcttcaac 1560cagaaaaacc cgttgttcta aaggttgagt caagggatgg caccgtaagt ggagcctgaa 1620ttttcctaag gacttctgct ttgctcttca agaaatctgt gcctgagaac accagagacc 1680tcaaattact ttgtgaatag aactctgaaa tgaagatggg cttcatccaa tggactgcat 1740aaataaccgg ggattctgta catgcattga gctctctcat tgtctgtgta gagtgttata 1800cttgggaata taaaggaggt gaccaaatca gtgtgaggag gtagatttgg ctcctctgct 1860tctcacggga ctatttccac cacccccagt tagcaccatt aactcctcct gagctctgat 1920aagagaatca acatttctca ataatttcct ccacaaatta ttaatgaaaa taagaattat 1980tttgatggct ctaacaatga catttatatc acatgttttc tctggagtat tctataagtt 2040ttatgttaaa tcaataaaga ccactttaca aaagtattat cagatgcttt cctgcacatt 2100aaggagaaat ctatagaact gaatgagaac caacaagtaa atatttttgg tcattgtaat 2160cactgttggc gtggggcctt tgtcagaact agaatttgat tattaacata ggtgaaagtt 2220aatccactgt gactttgccc attgtttaga aagaatattc atagtttaat tatgcctttt 2280ttgatcaggc acagtggctc acgcctgtaa tcctagcagt ttgggaggct gagccgggtg 2340gatcgcctga ggtcaggagt tcaagacaag cctggcctac atggttgaaa ccccatctct 2400actaaaaata cacaaattag ctaggcatgg tggactcgcc tgtaatctca ctacacagga 2460ggctgaggca ggagaatcac ttgaacctgg gaggcggatg ttgaagtgag ctgagattgc 2520accactgcac tccagtctgg gtgagagtga gactcagtct taaaaaaata tgcctttttg 2580aagcacgtac attttgtaac aaagaactga agctcttatt atattattag ttttgattta 2640atgttttcag cccatctcct ttcatatttc tgggagacag aaaacatgtt tccctacacc 2700tcttgcattc catcctcaac acccaactgt ctcgatgcaa tgaacactta ataaaaaaca 2760gtcgattggt caattgattg agcaataagc ct 2792166002DNAhomo sapiens 16gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa 1080ttaaaacatg cgctgacaat actatgaatg acactgatgt tcctttggaa acaactgaat 1140gcatccaagg tcaaggagaa ggctacaggg gcactgtcaa taccatttgg aatggaattc 1200catgtcagcg ttgggattct cagtatcctc acgagcatga catgactcct gaaaatttca 1260agtgcaagga cctacgagaa aattactgcc gaaatccaga tgggtctgaa tcaccctggt 1320gttttaccac tgatccaaac atccgagttg gctactgctc ccaaattcca aactgtgata 1380tgtcacatgg acaagattgt tatcgtggga atggcaaaaa ttatatgggc aacttatccc 1440aaacaagatc tggactaaca tgttcaatgt gggacaagaa catggaagac ttacatcgtc 1500atatcttctg ggaaccagat gcaagtaagc tgaatgagaa ttactgccga aatccagatg 1560atgatgctca tggaccctgg tgctacacgg gaaatccact cattccttgg gattattgcc 1620ctatttctcg ttgtgaaggt

gataccacac ctacaatagt caatttagac catcccgtaa 1680tatcttgtgc caaaacgaaa caattgcgag ttgtaaatgg gattccaaca cgaacaaaca 1740taggatggat ggttagtttg agatacagaa ataaacatat ctgcggagga tcattgataa 1800aggagagttg ggttcttact gcacgacagt gtttcccttc tcgagacttg aaagattatg 1860aagcttggct tggaattcat gatgtccacg gaagaggaga tgagaaatgc aaacaggttc 1920tcaatgtttc ccagctggta tatggccctg aaggatcaga tctggtttta atgaagcttg 1980ccaggcctgc tgtcctggat gattttgtta gtacgattga tttacctaat tatggatgca 2040caattcctga aaagaccagt tgcagtgttt atggctgggg ctacactgga ttgatcaact 2100atgatggcct attacgagtg gcacatctct atataatggg aaatgagaaa tgcagccagc 2160atcatcgagg gaaggtgact ctgaatgagt ctgaaatatg tgctggggct gaaaagattg 2220gatcaggacc atgtgagggg gattatggtg gcccacttgt ttgtgagcaa cataaaatga 2280gaatggttct tggtgtcatt gttcctggtc gtggatgtgc cattccaaat cgtcctggta 2340tttttgtccg agtagcatat tatgcaaaat ggatacacaa aattatttta acatataagg 2400taccacagtc atagctgaag taagtgtgtc tgaagcaccc accaatacaa ctgtctttta 2460catgaagatt tcagagaatg tggaatttaa aatgtcactt acaacaatcc taagacaact 2520actggagagt catgtttgtt gaaattctca ttaatgttta tgggtgtttt ctgttgtttt 2580gtttgtcagt gttattttgt caatgttgaa gtgaattaag gtacatgcaa gtgtaataac 2640atatctcctg aagatacttg aatggattaa aaaaacacac aggtatattt gctggatgat 2700aaagatttca tgggaaaaaa aatcaattaa tctgtctaag ctgctttctg atgttggttt 2760cttaataatg agtaaaccac aaattaaatg ttattttaac ctcaccaaaa caatttatac 2820cttgtgtccc taaattgtag ccctatatta aattatatta catttcatat gctatatgtt 2880atagttcatt catttctctt caccatgtat cctgcaatac tggtacacga acacactttt 2940tacaaaacca catacccatg tacacatgcc taggtacaca tgtgcatgca ctacagttta 3000aattatggtg tacctaatgt aacccctaaa tattttagaa gtatgtacct atagttttac 3060ctcaaaaaaa ccagaaatct ctaaagacca gtagaaatat taaaaaatga tgcaagatca 3120aaatgattag ctaattctcc atacataatc tgcagatgat cttctttggt tggcatttca 3180ggtgtggcca tcacccagag ttaaataaca cctaatctag gtgtttacat gtattcatta 3240tcctagttat ttcatgtagt ttctaattct taaaggaaag agggtaatag ttctatttgt 3300gtaatttgtt tcctccaaac ttaaggccac ttatttacac aagatatttg tagatctatt 3360ttcctaaagc atttcttaag tgctcagatc agtatctaat tgaagaagtt taaaagtgtt 3420ttggtcatta aaaatgtact taaataggtt aaatctaagc cttgctgctg tgattggctt 3480ctagctcact gcctttaaat tttaaaaaat ttaagaggaa aatttccaag tctccaaagt 3540tttataaata cccttcatca agtcatgcat taaagtatat attggagaaa aaaataaaaa 3600tacttttctc aacctggaag attttagcct aataaagctt ttttgaagta aaagacaact 3660tgtaaaagga aagaaactag tttgtctcaa ctctgtattc atttattttt tttttgaagt 3720agagtggaat ctgttgaatc agatatttta tcaagatatg tttatttttt cttatttcat 3780tttacaaagt tcactcctaa tgccatatgt aacagacatt taaattttgt gttctgtata 3840acagccaaat tatcatattt atcattgtat ttgtcatgct tagctaaaga tcatgtattt 3900gttgagaaat agaataacaa aaagtaatag gataggcttt gaatttttgc agaaatcttc 3960ctgtacaaaa cacctttaaa aataattttt tgaatggtgt gaatccagta gtcccatttc 4020tctgacttag ttttcttgag tgatttttat caaggccaag tccccaaaca attccctacc 4080agctctttag agtactgttc aatctggact aaaatggttt taagtttatg gagagcttag 4140tccacagaat atagggcggc gagtccagaa atgcttatac aatttttttt tcataataag 4200atatgtgctg gcatcaagaa acttaaagtg gaagcaaaaa gacatccaac tagttgctgg 4260tctctatcat cttatctgat ggtatttcta ttttccttat ataatacacc attttagtaa 4320gaactcctag aaatttcaag agcatattgc caaaatataa agtatatttc atagtttctt 4380ctggctgaac cagtgaaatt ttattattgc atattaatga tatttgtaaa acttttataa 4440aaattgtcat aattttaaat actcacattt taaaaatact tctttaatga ctcttcctct 4500aaatttcctg gaaatacaga taaagattag ctagatacaa gatacagcta agtatttaga 4560cattttgagg ctagtatttt tcattttatt aaaggctaaa aacaatacca ccaataaatc 4620atcaaacaaa ccgtacaaag taattctctc tttgggaggc tcctttcgtg atagagggac 4680atgggtggaa ttgacaatga aacttagatg aacaaggtcc atgttatttt aggtggtaga 4740acagggtaga gtcatgtcat tatttgctgg tggaagacac tatttaccag gtgttctttg 4800ctgaataaat cattaaacat ttttaaaaat ccaacaatcc actttatttt gtgtcattga 4860caaaaggatc ttttaaatca gaaggtttca atgcaatttt tggtttggct gtttgaataa 4920tggttatgta ctgttataat tgtagacatt ttctcacgtc taccaggaat tgaagtgtaa 4980aactaaaata tttttcataa tgcctctgcc gtgcagaagg aatgataatc cttttgtata 5040cttctttaat tttattgtaa aatgtgtaat gacttttacc tatatgctgt gggcaggtcc 5100tcagtaaaat ctattgagtc aatttctagt attaacaggc ttttgcttgc tatctaagtg 5160tttcaaatta tgggaagtgt gagacactgg aaggcaagaa aattaacaat aatggcatgt 5220gatagcaaaa ttgtatttca cttattcctg tgaatatttc ttgttggtac caatggtact 5280gtacaaagtg aatgttatag ccacaacatt ctcttgaaaa gaacactgtc aagaagtggg 5340aaattgctgt caggcatttc attgttgttt ttaaactttt ttaaaagaaa tactggtttt 5400gcaatataga gatcatgtgg taaagaattt taataagatc ttatactaaa aagccttaaa 5460tcaatttatt gagattcaaa aaatactatt ataattaatt acatcccata catataggca 5520aactcattta aaaaataaaa ctaattttgg taaaagtaca tggcctttgt ttttaaaata 5580cataatttta aaataaatca cttgtcatga taaagtccaa aaagaagtta tcattcaaca 5640ttcaactaag gttggagcta agaatttact aatacaaaaa aagttaaaat tttttggacc 5700atatatatct tgacagtgta acttttaagt aggttcattt ccatttgcac agaaagtttc 5760tgtctttagg aaactgaaaa tgaaatactg tggatgctat gactgtttgt cttgtatgta 5820aataggaaat taataagctg cctattgagt ggtatagctg tatgcttacc caaaaaaggg 5880aacactgtgg ttatgacttg tattataaac tttctgtagt taataaagtt gttattttta 5940taaccatgat tatattatta ttattaataa aatattttat caaaatgaaa aaaaaaaaaa 6000aa 6002171369DNAhomo sapiens 17gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa 1080ttaaaacatg cgagacataa catgggctct caactgatgg tgaacttctt ctggtgagtg 1140acagaggctg cagtgaagaa taatgagtct aatagaagtt tatcacagat gtctctaatc 1200tttatagctg atccctacct ctctcgctgt ctttgtaccc agcctgcatt ctgtttcgat 1260ctgtctttta gcagtccata caatcatttt tctacatgct ggcccttacc tagcttttct 1320gaatttacaa taaaaactat tttttaacgt gaaaaaaaaa aaaaaaaaa 1369185987DNAhomo sapiens 18gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta 720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat 1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgctg 1080acaatactat gaatgacact gatgttcctt tggaaacaac tgaatgcatc caaggtcaag 1140gagaaggcta caggggcact gtcaatacca tttggaatgg aattccatgt cagcgttggg 1200attctcagta tcctcacgag catgacatga ctcctgaaaa tttcaagtgc aaggacctac 1260gagaaaatta ctgccgaaat ccagatgggt ctgaatcacc ctggtgtttt accactgatc 1320caaacatccg agttggctac tgctcccaaa ttccaaactg tgatatgtca catggacaag 1380attgttatcg tgggaatggc aaaaattata tgggcaactt atcccaaaca agatctggac 1440taacatgttc aatgtgggac aagaacatgg aagacttaca tcgtcatatc ttctgggaac 1500cagatgcaag taagctgaat gagaattact gccgaaatcc agatgatgat gctcatggac 1560cctggtgcta cacgggaaat ccactcattc cttgggatta ttgccctatt tctcgttgtg 1620aaggtgatac cacacctaca atagtcaatt tagaccatcc cgtaatatct tgtgccaaaa 1680cgaaacaatt gcgagttgta aatgggattc caacacgaac aaacatagga tggatggtta 1740gtttgagata cagaaataaa catatctgcg gaggatcatt gataaaggag agttgggttc 1800ttactgcacg acagtgtttc ccttctcgag acttgaaaga ttatgaagct tggcttggaa 1860ttcatgatgt ccacggaaga ggagatgaga aatgcaaaca ggttctcaat gtttcccagc 1920tggtatatgg ccctgaagga tcagatctgg ttttaatgaa gcttgccagg cctgctgtcc 1980tggatgattt tgttagtacg attgatttac ctaattatgg atgcacaatt cctgaaaaga 2040ccagttgcag tgtttatggc tggggctaca ctggattgat caactatgat ggcctattac 2100gagtggcaca tctctatata atgggaaatg agaaatgcag ccagcatcat cgagggaagg 2160tgactctgaa tgagtctgaa atatgtgctg gggctgaaaa gattggatca ggaccatgtg 2220agggggatta tggtggccca cttgtttgtg agcaacataa aatgagaatg gttcttggtg 2280tcattgttcc tggtcgtgga tgtgccattc caaatcgtcc tggtattttt gtccgagtag 2340catattatgc aaaatggata cacaaaatta ttttaacata taaggtacca cagtcatagc 2400tgaagtaagt gtgtctgaag cacccaccaa tacaactgtc ttttacatga agatttcaga 2460gaatgtggaa tttaaaatgt cacttacaac aatcctaaga caactactgg agagtcatgt 2520ttgttgaaat tctcattaat gtttatgggt gttttctgtt gttttgtttg tcagtgttat 2580tttgtcaatg ttgaagtgaa ttaaggtaca tgcaagtgta ataacatatc tcctgaagat 2640acttgaatgg attaaaaaaa cacacaggta tatttgctgg atgataaaga tttcatggga 2700aaaaaaatca attaatctgt ctaagctgct ttctgatgtt ggtttcttaa taatgagtaa 2760accacaaatt aaatgttatt ttaacctcac caaaacaatt tataccttgt gtccctaaat 2820tgtagcccta tattaaatta tattacattt catatgctat atgttatagt tcattcattt 2880ctcttcacca tgtatcctgc aatactggta cacgaacaca ctttttacaa aaccacatac 2940ccatgtacac atgcctaggt acacatgtgc atgcactaca gtttaaatta tggtgtacct 3000aatgtaaccc ctaaatattt tagaagtatg tacctatagt tttacctcaa aaaaaccaga 3060aatctctaaa gaccagtaga aatattaaaa aatgatgcaa gatcaaaatg attagctaat 3120tctccataca taatctgcag atgatcttct ttggttggca tttcaggtgt ggccatcacc 3180cagagttaaa taacacctaa tctaggtgtt tacatgtatt cattatccta gttatttcat 3240gtagtttcta attcttaaag gaaagagggt aatagttcta tttgtgtaat ttgtttcctc 3300caaacttaag gccacttatt tacacaagat atttgtagat ctattttcct aaagcatttc 3360ttaagtgctc agatcagtat ctaattgaag aagtttaaaa gtgttttggt cattaaaaat 3420gtacttaaat aggttaaatc taagccttgc tgctgtgatt ggcttctagc tcactgcctt 3480taaattttaa aaaatttaag aggaaaattt ccaagtctcc aaagttttat aaataccctt 3540catcaagtca tgcattaaag tatatattgg agaaaaaaat aaaaatactt ttctcaacct 3600ggaagatttt agcctaataa agcttttttg aagtaaaaga caacttgtaa aaggaaagaa 3660actagtttgt ctcaactctg tattcattta tttttttttt gaagtagagt ggaatctgtt 3720gaatcagata ttttatcaag atatgtttat tttttcttat ttcattttac aaagttcact 3780cctaatgcca tatgtaacag acatttaaat tttgtgttct gtataacagc caaattatca 3840tatttatcat tgtatttgtc atgcttagct aaagatcatg tatttgttga gaaatagaat 3900aacaaaaagt aataggatag gctttgaatt tttgcagaaa tcttcctgta caaaacacct 3960ttaaaaataa ttttttgaat ggtgtgaatc cagtagtccc atttctctga cttagttttc 4020ttgagtgatt tttatcaagg ccaagtcccc aaacaattcc ctaccagctc tttagagtac 4080tgttcaatct ggactaaaat ggttttaagt ttatggagag cttagtccac agaatatagg 4140gcggcgagtc cagaaatgct tatacaattt ttttttcata ataagatatg tgctggcatc 4200aagaaactta aagtggaagc aaaaagacat ccaactagtt gctggtctct atcatcttat 4260ctgatggtat ttctattttc cttatataat acaccatttt agtaagaact cctagaaatt 4320tcaagagcat attgccaaaa tataaagtat atttcatagt ttcttctggc tgaaccagtg 4380aaattttatt attgcatatt aatgatattt gtaaaacttt tataaaaatt gtcataattt 4440taaatactca cattttaaaa atacttcttt aatgactctt cctctaaatt tcctggaaat 4500acagataaag attagctaga tacaagatac agctaagtat ttagacattt tgaggctagt 4560atttttcatt ttattaaagg ctaaaaacaa taccaccaat aaatcatcaa acaaaccgta 4620caaagtaatt ctctctttgg gaggctcctt tcgtgataga gggacatggg tggaattgac 4680aatgaaactt agatgaacaa ggtccatgtt attttaggtg gtagaacagg gtagagtcat 4740gtcattattt gctggtggaa gacactattt accaggtgtt ctttgctgaa taaatcatta 4800aacattttta aaaatccaac aatccacttt attttgtgtc attgacaaaa ggatctttta 4860aatcagaagg tttcaatgca atttttggtt tggctgtttg aataatggtt atgtactgtt 4920ataattgtag acattttctc acgtctacca ggaattgaag tgtaaaacta aaatattttt 4980cataatgcct ctgccgtgca gaaggaatga taatcctttt gtatacttct ttaattttat 5040tgtaaaatgt gtaatgactt ttacctatat gctgtgggca ggtcctcagt aaaatctatt 5100gagtcaattt ctagtattaa caggcttttg cttgctatct aagtgtttca aattatggga 5160agtgtgagac actggaaggc aagaaaatta acaataatgg catgtgatag caaaattgta 5220tttcacttat tcctgtgaat atttcttgtt ggtaccaatg gtactgtaca aagtgaatgt 5280tatagccaca acattctctt gaaaagaaca ctgtcaagaa gtgggaaatt gctgtcaggc 5340atttcattgt tgtttttaaa cttttttaaa agaaatactg gttttgcaat atagagatca 5400tgtggtaaag aattttaata agatcttata ctaaaaagcc ttaaatcaat ttattgagat 5460tcaaaaaata ctattataat taattacatc ccatacatat aggcaaactc atttaaaaaa 5520taaaactaat tttggtaaaa gtacatggcc tttgttttta aaatacataa ttttaaaata 5580aatcacttgt catgataaag tccaaaaaga agttatcatt caacattcaa ctaaggttgg 5640agctaagaat ttactaatac aaaaaaagtt aaaatttttt ggaccatata tatcttgaca 5700gtgtaacttt taagtaggtt catttccatt tgcacagaaa gtttctgtct ttaggaaact 5760gaaaatgaaa tactgtggat gctatgactg tttgtcttgt atgtaaatag gaaattaata 5820agctgcctat tgagtggtat agctgtatgc ttacccaaaa aagggaacac tgtggttatg 5880acttgtatta taaactttct gtagttaata aagttgttat ttttataacc atgattatat 5940tattattatt aataaaatat tttatcaaaa tgaaaaaaaa aaaaaaa 5987191354DNAhomo sapiens 19gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta 720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat 1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgaga 1080cataacatgg gctctcaact gatggtgaac ttcttctggt gagtgacaga ggctgcagtg 1140aagaataatg agtctaatag aagtttatca cagatgtctc taatctttat agctgatccc 1200tacctctctc gctgtctttg tacccagcct gcattctgtt tcgatctgtc ttttagcagt 1260ccatacaatc atttttctac atgctggccc ttacctagct tttctgaatt tacaataaaa 1320actatttttt aacgtgaaaa aaaaaaaaaa aaaa 1354202102DNAhomo sapiens 20gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga aggtaaataa acctgaatgc catgtgggcc attctattcc ccctatgtgt 900agaactgtaa ctcacattaa aggttaacag caacgaatca atcataacaa atatgttgtt 960cgtgcaaatg caactacaaa taattattta aacattttta tacaatgttt ttaaaactgt 1020tggattatca ccagattaat gcaaaataac agagcgagtt atcagtttga atttcaacac 1080tgcctgagac atccctctgg ggaaagtgaa agagagggtt tacttaccta ctgtcttgag 1140ctcacatacc tcaaaatcta ctactgtgtg gcacctgaaa ggagttgaat gaagcttagc 1200ctttcattag caatgttaat tctattcaac cagcacctgc ttccacagaa attctgtcca 1260aactatcatg aagtggtgtg acaagggtat atggacccag aagataatac aatataagaa 1320gggatcactg gaagcttgac cccatgcaca ttttggtgaa aatgtgccta gaatcaaatg 1380tgacacgtag gctggaactg agtaccattc agaataggat ctgaagagat caaagcaatg 1440gagaccacca aactgtcttg aaggcatgtc tatggacctt aagtccatgt ctatgttttc 1500agctcttctc acagcataaa agggcattgt ccttactttt gcagtggaaa actgaatggc 1560tgacaagatg gaagagtaac catttcagca ttgtatgtgg tttcattttt cttagttatc 1620tggctactga atagccggat ttttcagttc tgtcagaaac tctaaatttc caaaaatcta 1680agtgaaacat ggatgaaact ctgttagaaa attgttagga ttttggagta tttggggagg 1740gggactactg gaatgctgtc caagttttat actaagatat cttacctgtt tgttattaac

1800caaatatttt taaaaatatt tcctccataa atattcattt aatattaggt tgatatttat 1860cacataaaaa gtaaaggcta ctgttagcta attgtcacag agaaggattt gttttctgtt 1920gttagtgaat ttgaaatcct tgactttatg tgctacagcc agttccatct ctgtttgtaa 1980attcttactt tccattccat atcatattct gttccctata acctcttcat tgttttcttt 2040tcttttaaaa ataataaact tttctatgat caaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2100aa 2102212339DNAhomo sapiens 21acgcggtgcc gcggggcggg agtagaggcg gagggagggg acacgggctc attgcggtgt 60gcgccctgca ctctgtccct cactcgccgc cgacgacctg tctcgccgag cgcacgcctt 120gccgccgccc cgcagaaatg cttcggttac ccacagtctt tcgccagatg agaccggtgt 180ccagggtact ggctcctcat ctcactcggg cttatgccaa agatgtaaaa tttggtgcag 240atgcccgagc cttaatgctt caaggtgtag accttttagc cgatgctgtg gccgttacaa 300tggggccaaa gggaagaaca gtgattattg agcagagttg gggaagtccc aaagtaacaa 360aagatggtgt gactgttgca aagtcaattg acttaaaaga taaatacaaa aacattggag 420ctaaacttgt tcaagatgtt gccaataaca caaatgaaga agctggggat ggcactacca 480ctgctactgt actggcacgc tctatagcca aggaaggctt cgagaagatt agcaaaggtg 540ctaatccagt ggaaatcagg agaggtgtga tgttagctgt tgatgctgta attgctgaac 600ttaaaaagca gtctaaacct gtgaccaccc ctgaagaaat tgcacaggtt gctacgattt 660ctgcaaacgg agacaaagaa attggcaata tcatctctga tgcaatgaaa aaagttggaa 720gaaagggtgt catcacagta aaggatggaa aaacactgaa tgatgaatta gaaattattg 780aaggcatgaa gtttgatcga ggctatattt ctccatactt tattaataca tcaaaaggtc 840agaaatgtga attccaggat gcctatgttc tgttgagtga aaagaaaatt tctagtatcc 900agtccattgt acctgctctt gaaattgcca atgctcaccg taagcctttg gtcataatcg 960ctgaagatgt tgatggagaa gctctaagta cactcgtctt gaataggcta aaggttggtc 1020ttcaggttgt ggcagtcaag gctccagggt ttggtgacaa tagaaagaac cagcttaaag 1080atatggctat tgctactggt ggtgcagtgt ttggagaaga gggattgacc ctgaatcttg 1140aagacgttca gcctcatgac ttaggaaaag ttggagaggt cattgtgacc aaagacgatg 1200ccatgctctt aaaaggaaaa ggtgacaagg ctcaaattga aaaacgtatt caagaaatca 1260ttgagcagtt agatgtcaca actagtgaat atgaaaagga aaaactgaat gaacggcttg 1320caaaactttc agatggagtg gctgtgctga aggttggtgg gacaagtgat gttgaagtga 1380atgaaaagaa agacagagtt acagatgccc ttaatgctac aagagctgct gttgaagaag 1440gcattgtttt gggagggggt tgtgccctcc ttcgatgcat tccagccttg gactcattga 1500ctccagctaa tgaagatcaa aaaattggta tagaaattat taaaagaaca ctcaaaattc 1560cagcaatgac cattgctaag aatgcaggtg ttgaaggatc tttgatagtt gagaaaatta 1620tgcaaagttc ctcagaagtt ggttatgatg ctatggctgg agattttgtg aatatggtgg 1680aaaaaggaat cattgaccca acaaaggttg tgagaactgc tttattggat gctgctggtg 1740tggcctctct gttaactaca gcagaagttg tagtcacaga aattcctaaa gaagagaagg 1800accctggaat gggtgcaatg ggtggaatgg gaggtggtat gggaggtggc atgttctaac 1860tcctagacta gtgctttacc tttattaatg aactgtgaca ggaagcccaa ggcagtgttc 1920ctcaccaata acttcagaga agtcagttgg agaaaatgaa gaaaaaggct ggctgaaaat 1980cactataacc atcagttact ggtttcagtt gacaaaatat ataatggttt actgctgtca 2040ttgtccatgc ctacagataa tttattttgt atttttgaat aaaaaacatt tgtacattcc 2100tgatactggg tacaagagcc atgtaccagt gtactgcttt caacttaaat cactgaggca 2160tttttactac tattctgtta aaatcaggat tttagtgctt gccaccacca gatgagaagt 2220taagcagcct ttctgtggag agtgagaata attgtgtaca aagtagagaa gtatccaatt 2280atgtgacaac ctttgtgtaa taaaaatttg tttaaagtta aaaaaaaaaa aaaaaaaaa 2339222319DNAhomo sapiens 22gccccgacgc gcaccgcgat tcgccccaag ggccctgcgc aggacgctga cgcgaagact 60cggaggcgga agaaaaaagg agctgtttct aggcttttct aggcgcccag ccgagaaatg 120cttcggttac ccacagtctt tcgccagatg agaccggtgt ccagggtact ggctcctcat 180ctcactcggg cttatgccaa agatgtaaaa tttggtgcag atgcccgagc cttaatgctt 240caaggtgtag accttttagc cgatgctgtg gccgttacaa tggggccaaa gggaagaaca 300gtgattattg agcagagttg gggaagtccc aaagtaacaa aagatggtgt gactgttgca 360aagtcaattg acttaaaaga taaatacaaa aacattggag ctaaacttgt tcaagatgtt 420gccaataaca caaatgaaga agctggggat ggcactacca ctgctactgt actggcacgc 480tctatagcca aggaaggctt cgagaagatt agcaaaggtg ctaatccagt ggaaatcagg 540agaggtgtga tgttagctgt tgatgctgta attgctgaac ttaaaaagca gtctaaacct 600gtgaccaccc ctgaagaaat tgcacaggtt gctacgattt ctgcaaacgg agacaaagaa 660attggcaata tcatctctga tgcaatgaaa aaagttggaa gaaagggtgt catcacagta 720aaggatggaa aaacactgaa tgatgaatta gaaattattg aaggcatgaa gtttgatcga 780ggctatattt ctccatactt tattaataca tcaaaaggtc agaaatgtga attccaggat 840gcctatgttc tgttgagtga aaagaaaatt tctagtatcc agtccattgt acctgctctt 900gaaattgcca atgctcaccg taagcctttg gtcataatcg ctgaagatgt tgatggagaa 960gctctaagta cactcgtctt gaataggcta aaggttggtc ttcaggttgt ggcagtcaag 1020gctccagggt ttggtgacaa tagaaagaac cagcttaaag atatggctat tgctactggt 1080ggtgcagtgt ttggagaaga gggattgacc ctgaatcttg aagacgttca gcctcatgac 1140ttaggaaaag ttggagaggt cattgtgacc aaagacgatg ccatgctctt aaaaggaaaa 1200ggtgacaagg ctcaaattga aaaacgtatt caagaaatca ttgagcagtt agatgtcaca 1260actagtgaat atgaaaagga aaaactgaat gaacggcttg caaaactttc agatggagtg 1320gctgtgctga aggttggtgg gacaagtgat gttgaagtga atgaaaagaa agacagagtt 1380acagatgccc ttaatgctac aagagctgct gttgaagaag gcattgtttt gggagggggt 1440tgtgccctcc ttcgatgcat tccagccttg gactcattga ctccagctaa tgaagatcaa 1500aaaattggta tagaaattat taaaagaaca ctcaaaattc cagcaatgac cattgctaag 1560aatgcaggtg ttgaaggatc tttgatagtt gagaaaatta tgcaaagttc ctcagaagtt 1620ggttatgatg ctatggctgg agattttgtg aatatggtgg aaaaaggaat cattgaccca 1680acaaaggttg tgagaactgc tttattggat gctgctggtg tggcctctct gttaactaca 1740gcagaagttg tagtcacaga aattcctaaa gaagagaagg accctggaat gggtgcaatg 1800ggtggaatgg gaggtggtat gggaggtggc atgttctaac tcctagacta gtgctttacc 1860tttattaatg aactgtgaca ggaagcccaa ggcagtgttc ctcaccaata acttcagaga 1920agtcagttgg agaaaatgaa gaaaaaggct ggctgaaaat cactataacc atcagttact 1980ggtttcagtt gacaaaatat ataatggttt actgctgtca ttgtccatgc ctacagataa 2040tttattttgt atttttgaat aaaaaacatt tgtacattcc tgatactggg tacaagagcc 2100atgtaccagt gtactgcttt caacttaaat cactgaggca tttttactac tattctgtta 2160aaatcaggat tttagtgctt gccaccacca gatgagaagt taagcagcct ttctgtggag 2220agtgagaata attgtgtaca aagtagagaa gtatccaatt atgtgacaac ctttgtgtaa 2280taaaaatttg tttaaagtta aaaaaaaaaa aaaaaaaaa 23192320DNAArtificial sequenceSingle strand DNA oligonucleotide 23tctgtttccc gtgctgcgag 202420DNAArtificial sequenceSingle strand DNA oligonucleotide 24cccagcgtcc agtagcacac 202521DNAArtificial sequenceSingle strand DNA oligonucleotide 25cctacaattc ttctttgggc t 212620DNAArtificial sequenceSingle strand DNA oligonucleotide 26agtaacagtt atggcttgga 202723DNAArtificial sequenceSingle strand DNA oligonucleotide 27ggaatgctgc catggagatc tgc 232821DNAArtificial sequenceSingle strand DNA oligonucleotide 28ccttcagttt actggagatc g 212920DNAArtificial sequenceSingle strand DNA oligonucleotide 29ctccaaaggc cagcctgact 203020DNAArtificial sequenceSingle strand DNA oligonucleotide 30cagcccaccc aaaccaccaa 203119DNAArtificial sequenceSingle strand DNA oligonucleotide 31gcctcgtatg tgaggcaaa 193220DNAArtificial sequenceSingle strand DNA oligonucleotide 32cccattcgta gcctttggta 203320DNAArtificial sequenceSingle strand DNA oligonucleotide 33aaagtacgtc cgcgggttgc 203419DNAArtificial sequenceSingle strand DNA oligonucleotide 34tccgatgagt ccggccagt 193518DNAArtificial sequenceSingle strand DNA oligonucleotide 35gggagcggtg aagatgga 183622DNAArtificial sequenceSingle strand DNA oligonucleotide 36tcatgttgct cacggaggag ta 223719DNAArtificial sequenceSingle strand DNA oligonucleotide 37gccgagtttg ccttgctca 193820DNAArtificial sequenceSingle strand DNA oligonucleotide 38tccggaggct caccagtttc 203921DNAArtificial sequenceSingle strand DNA oligonucleotide 39aaggtgaagc gcaatgtccc t 214021DNAArtificial sequenceSingle strand DNA oligonucleotide 40cccccagctg ctcaaaaatg c 214123DNAArtificial sequenceSingle strand DNA oligonucleotide 41tgctctgtgt cactgtggat tgg 234221DNAArtificial sequenceSingle strand DNA oligonucleotide 42gggcaaagag gctggtcttc a 214320DNAArtificial sequenceSingle strand DNA oligonucleotide 43ctcacctcca ggtttgcttc 204420DNAArtificial sequenceSingle strand DNA oligonucleotide 44ctccttgatc gatcctttgc 204520DNAArtificial sequenceSingle strand DNA oligonucleotide 45tctccaggtt gcctctcact 204620DNAArtificial sequenceSingle strand DNA oligonucleotide 46gtggaggaag ctgacaacaa 204720DNAArtificial sequenceSingle strand DNA oligonucleotide 47tcgagccaat actgcatctg 204820DNAArtificial sequenceSingle strand DNA oligonucleotide 48cttctgggag gacatccttg 204920DNAArtificial sequenceSingle strand DNA oligonucleotide 49acgagacaga agacggcatt 205019DNAArtificial sequenceSingle strand DNA oligonucleotide 50ccctctggat ccactgctt 195121DNAArtificial sequenceSingle strand DNA oligonucleotide 51ccccacattc gtcagcggtg t 215221DNAArtificial sequenceSingle strand DNA oligonucleotide 52aggtgcccga gggttctgag g 215318DNAArtificial sequenceSingle strand DNA oligonucleotide 53ggcgcagcag aatccaga 185418DNAArtificial sequenceSingle strand DNA oligonucleotide 54ccacgacttg cccagcat 185520DNAArtificial sequenceSingle strand DNA oligonucleotide 55gcttagcctc gtcgatgaac 205620DNAArtificial sequenceSingle strand DNA oligonucleotide 56aaccccaaga tgcacaactc 205720DNAArtificial sequenceSingle strand DNA oligonucleotide 57cgggtgtggc acagctagtt 205822DNAArtificial sequenceSingle strand DNA oligonucleotide 58tgcattgtca agtgacgatc ac 225920DNAArtificial sequenceSingle strand DNA oligonucleotide 59aaagtacgtc cgcgggttgc 206019DNAArtificial sequenceSingle strand DNA oligonucleotide 60tccgatgagt ccggccagt 196115DNAArtificial sequencePXR response element 61tgaacttgct gaccc 156221DNAArtificial sequenceLXR response elements 62gggttactgg cggtcattgt a 216319DNAArtificial sequencePPAR response element 63tacctttccc ctacttttc 196414DNAArtificial sequenceBSEP promoter element 64gggacattga tcct 1465110PRThomo sapiens 65Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 11066469DNAhomo sapiens 66agccctccag gacaggctgc atcagaagag gccatcaagc agatcactgt ccttctgcca 60tggccctgtg gatgcgcctc ctgcccctgc tggcgctgct ggccctctgg ggacctgacc 120cagccgcagc ctttgtgaac caacacctgt gcggctcaca cctggtggaa gctctctacc 180tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac ccgccgggag gcagaggacc 240tgcaggtggg gcaggtggag ctgggcgggg gccctggtgc aggcagcctg cagcccttgg 300ccctggaggg gtccctgcag aagcgtggca ttgtggaaca atgctgtacc agcatctgct 360ccctctacca gctggagaac tactgcaact agacgcagcc cgcaggcagc cccacacccg 420ccgcctcctg caccgagaga gatggaataa agcccttgaa ccagcaaaa 46967288PRThomo sapiens 67Met Val Gly Val Gly Gly Gly Asp Val Glu Asp Val Thr Pro Arg Pro1 5 10 15Gly Gly Cys Gln Ile Ser Gly Arg Gly Ala Arg Gly Cys Asn Gly Ile 20 25 30Pro Gly Ala Ala Ala Trp Glu Ala Ala Leu Pro Arg Arg Arg Pro Arg 35 40 45Arg His Pro Ser Val Asn Pro Arg Ser Arg Ala Ala Gly Ser Pro Arg 50 55 60Thr Arg Gly Arg Arg Thr Glu Glu Arg Pro Ser Gly Ser Arg Leu Gly65 70 75 80Asp Arg Gly Arg Gly Arg Ala Leu Pro Gly Gly Arg Leu Gly Gly Arg 85 90 95Gly Arg Gly Arg Ala Pro Glu Arg Val Gly Gly Arg Gly Arg Gly Arg 100 105 110Gly Thr Ala Ala Pro Arg Ala Ala Pro Ala Ala Arg Gly Ser Arg Pro 115 120 125Gly Pro Ala Gly Thr Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala 130 135 140Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys145 150 155 160Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile 165 170 175His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His 180 185 190Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys 195 200 205Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu 210 215 220Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu225 230 235 240Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp 245 250 255Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr 260 265 270Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser 275 280 285686774DNAhomo sapiens 68cggccccaga aaacccgagc gagtaggggg cggcgcgcag gagggaggag aactgggggc 60gcgggaggct ggtgggtgtg gggggtggag atgtagaaga tgtgacgccg cggcccggcg 120ggtgccagat tagcggacgc ggtgcccgcg gttgcaacgg gatcccgggc gctgcagctt 180gggaggcggc tctccccagg cggcgtccgc ggagacaccc atccgtgaac cccaggtccc 240gggccgccgg ctcgccgcgc accaggggcc ggcggacaga agagcggccg agcggctcga 300ggctggggga ccgcgggcgc ggccgcgcgc tgccgggcgg gaggctgggg ggccggggcc 360ggggccgtgc cccggagcgg gtcggaggcc ggggccgggg ccgggggacg gcggctcccc 420gcgcggctcc agcggctcgg ggatcccggc cgggccccgc agggaccatg gcagccggga 480gcatcaccac gctgcccgcc ttgcccgagg atggcggcag cggcgccttc ccgcccggcc 540acttcaagga ccccaagcgg ctgtactgca aaaacggggg cttcttcctg cgcatccacc 600ccgacggccg agttgacggg gtccgggaga agagcgaccc tcacatcaag ctacaacttc 660aagcagaaga gagaggagtt gtgtctatca aaggagtgtg tgctaaccgt tacctggcta 720tgaaggaaga tggaagatta ctggcttcta aatgtgttac ggatgagtgt ttcttttttg 780aacgattgga atctaataac tacaatactt accggtcaag gaaatacacc agttggtatg 840tggcactgaa acgaactggg cagtataaac ttggatccaa aacaggacct gggcagaaag 900ctatactttt tcttccaatg tctgctaaga gctgatttta atggccacat ctaatctcat 960ttcacatgaa agaagaagta tattttagaa atttgttaat gagagtaaaa gaaaataaat 1020gtgtatagct cagtttggat aattggtcaa acaatttttt atccagtagt aaaatatgta 1080accattgtcc cagtaaagaa aaataacaaa agttgtaaaa tgtatattct cccttttata 1140ttgcatctgc tgttacccag tgaagcttac ctagagcaat gatctttttc acgcatttgc 1200tttattcgaa aagaggcttt taaaatgtgc atgtttagaa acaaaatttc ttcatggaaa 1260tcatatacat tagaaaatca cagtcagatg tttaatcaat ccaaaatgtc cactatttct 1320tatgtcattc gttagtctac atgtttctaa acatataaat gtgaatttaa tcaattcctt 1380tcatagtttt ataattctct ggcagttcct tatgatagag tttataaaac agtcctgtgt 1440aaactgctgg aagttcttcc acagtcaggt caattttgtc aaacccttct ctgtacccat 1500acagcagcag cctagcaact ctgctggtga tgggagttgt attttcagtc ttcgccaggt 1560cattgagatc catccactca catcttaagc attcttcctg gcaaaaattt atggtgaatg 1620aatatggctt taggcggcag atgatataca tatctgactt cccaaaagct ccaggatttg 1680tgtgctgttg ccgaatactc aggacggacc tgaattctga ttttatacca gtctcttcaa 1740aaacttctcg aaccgctgtg tctcctacgt aaaaaaagag atgtacaaat caataataat 1800tacactttta gaaactgtat catcaaagat tttcagttaa agtagcatta tgtaaaggct 1860caaaacatta ccctaacaaa gtaaagtttt caatacaaat tctttgcctt gtggatatca 1920agaaatccca aaatattttc ttaccactgt aaattcaaga agcttttgaa atgctgaata 1980tttctttggc tgctacttgg aggcttatct acctgtacat

ttttggggtc agctcttttt 2040aacttcttgc tgctcttttt cccaaaaggt aaaaatatag attgaaaagt taaaacattt 2100tgcatggctg cagttccttt gtttcttgag ataagattcc aaagaactta gattcatttc 2160ttcaacaccg aaatgctgga ggtgtttgat cagttttcaa gaaacttgga atataaataa 2220ttttataatt caacaaaggt tttcacattt tataaggttg atttttcaat taaatgcaaa 2280tttgtgtggc aggattttta ttgccattaa catatttttg tggctgcttt ttctacacat 2340ccagatggtc cctctaactg ggctttctct aattttgtga tgttctgtca ttgtctccca 2400aagtatttag gagaagccct ttaaaaagct gccttcctct accactttgc tggaaagctt 2460cacaattgtc acagacaaag atttttgttc caatactcgt tttgcctcta tttttcttgt 2520ttgtcaaata gtaaatgata tttgcccttg cagtaattct actggtgaaa aacatgcaaa 2580gaagaggaag tcacagaaac atgtctcaat tcccatgtgc tgtgactgta gactgtctta 2640ccatagactg tcttacccat cccctggata tgctcttgtt ttttccctct aatagctatg 2700gaaagatgca tagaaagagt ataatgtttt aaaacataag gcattcgtct gccatttttc 2760aattacatgc tgacttccct tacaattgag atttgcccat aggttaaaca tggttagaaa 2820caactgaaag cataaaagaa aaatctaggc cgggtgcagt ggctcatgcc tatattccct 2880gcactttggg aggccaaagc aggaggatcg cttgagccca ggagttcaag accaacctgg 2940tgaaaccccg tctctacaaa aaaacacaaa aaatagccag gcatggtggc gtgtacatgt 3000ggtctcagat acttgggagg ctgaggtggg agggttgatc acttgaggct gagaggtcaa 3060ggttgcagtg agccataatc gtgccactgc agtccagcct aggcaacaga gtgagacttt 3120gtctcaaaaa aagagaaatt ttccttaata agaaaagtaa tttttactct gatgtgcaat 3180acatttgtta ttaaatttat tatttaagat ggtagcacta gtcttaaatt gtataaaata 3240tcccctaaca tgtttaaatg tccattttta ttcattatgc tttgaaaaat aattatgggg 3300aaatacatgt ttgttattaa atttattatt aaagatagta gcactagtct taaatttgat 3360ataacatctc ctaacttgtt taaatgtcca tttttattct ttatgtttga aaataaatta 3420tggggatcct atttagctct tagtaccact aatcaaaagt tcggcatgta gctcatgatc 3480tatgctgttt ctatgtcgtg gaagcaccgg atgggggtag tgagcaaatc tgccctgctc 3540agcagtcacc atagcagctg actgaaaatc agcactgcct gagtagtttt gatcagttta 3600acttgaatca ctaactgact gaaaattgaa tgggcaaata agtgcttttg tctccagagt 3660atgcgggaga cccttccacc tcaagatgga tatttcttcc ccaaggattt caagatgaat 3720tgaaattttt aatcaagata gtgtgcttta ttctgttgta ttttttatta ttttaatata 3780ctgtaagcca aactgaaata acatttgctg ttttataggt ttgaagaaca taggaaaaac 3840taagaggttt tgtttttatt tttgctgatg aagagatatg tttaaatatg ttgtattgtt 3900ttgtttagtt acaggacaat aatgaaatgg agtttatatt tgttatttct attttgttat 3960atttaataat agaattagat tgaaataaaa tataatggga aataatctgc agaatgtggg 4020ttttcctggt gtttccctct gactctagtg cactgatgat ctctgataag gctcagctgc 4080tttatagttc tctggctaat gcagcagata ctcttcctgc cagtggtaat acgatttttt 4140aagaaggcag tttgtcaatt ttaatcttgt ggataccttt atactcttag ggtattattt 4200tatacaaaag ccttgaggat tgcattctat tttctatatg accctcttga tatttaaaaa 4260acactatgga taacaattct tcatttacct agtattatga aagaatgaag gagttcaaac 4320aaatgtgttt cccagttaac tagggtttac tgtttgagcc aatataaatg tttaactgtt 4380tgtgatggca gtattcctaa agtacattgc atgttttcct aaatacagag tttaaataat 4440ttcagtaatt cttagatgat tcagcttcat cattaagaat atcttttgtt ttatgttgag 4500ttagaaatgc cttcatatag acatagtctt tcagacctct actgtcagtt ttcatttcta 4560gctgctttca gggttttatg aattttcagg caaagcttta atttatacta agcttaggaa 4620gtatggctaa tgccaacggc agtttttttc ttcttaattc cacatgactg aggcatatat 4680gatctctggg taggtgagtt gttgtgacaa ccacaagcac tttttttttt tttaaagaaa 4740aaaaggtagt gaatttttaa tcatctggac tttaagaagg attctggagt atacttaggc 4800ctgaaattat atatatttgg cttggaaatg tgtttttctt caattacatc tacaagtaag 4860tacagctgaa attcagagga cccataagag ttcacatgaa aaaaatcaat ttatttgaaa 4920aggcaagatg caggagagag gaagccttgc aaacctgcag actgcttttt gcccaatata 4980gattgggtaa ggctgcaaaa cataagctta attagctcac atgctctgct ctcacgtggc 5040accagtggat agtgtgagag aattaggctg tagaacaaat ggccttctct ttcagcattc 5100acaccactac aaaatcatct tttatatcaa cagaagaata agcataaact aagcaaaagg 5160tcaataagta cctgaaacca agattggcta gagatatatc ttaatgcaat ccattttctg 5220atggattgtt acgagttggc tatataatgt atgtatggta ttttgatttg tgtaaaagtt 5280ttaaaaatca agctttaagt acatggacat ttttaaataa aatatttaaa gacaatttag 5340aaaattgcct taatatcatt gttggctaaa tagaataggg gacatgcata ttaaggaaaa 5400ggtcatggag aaataatatt ggtatcaaac aaatacattg atttgtcatg atacacattg 5460aatttgatcc aatagtttaa ggaataggta ggaaaatttg gtttctattt ttcgatttcc 5520tgtaaatcag tgacataaat aattcttagc ttattttata tttccttgtc ttaaatactg 5580agctcagtaa gttgtgttag gggattattt ctcagttgag actttcttat atgacatttt 5640actatgtttt gacttcctga ctattaaaaa taaatagtag atacaatttt cataaagtga 5700agaattatat aatcactgct ttataactga ctttattata tttatttcaa agttcattta 5760aaggctacta ttcatcctct gtgatggaat ggtcaggaat ttgttttctc atagtttaat 5820tccaacaaca atattagtcg tatccaaaat aacctttaat gctaaacttt actgatgtat 5880atccaaagct tctcattttc agacagatta atccagaagc agtcataaac agaagaatag 5940gtggtatgtt cctaatgata ttatttctac taatggaata aactgtaata ttagaaatta 6000tgctgctaat tatatcagct ctgaggtaat ttctgaaatg ttcagactca gtcggaacaa 6060attggaaaat ttaaattttt attcttagct ataaagcaag aaagtaaaca cattaatttc 6120ctcaacattt ttaagccaat taaaaatata aaagatacac accaatatct tcttcaggct 6180ctgacaggcc tcctggaaac ttccacatat ttttcaactg cagtataaag tcagaaaata 6240aagttaacat aactttcact aacacacaca tatgtagatt tcacaaaatc cacctataat 6300tggtcaaagt ggttgagaat atatttttta gtaattgcat gcaaaatttt tctagcttcc 6360atcctttctc cctcgtttct tctttttttg ggggagctgg taactgatga aatcttttcc 6420caccttttct cttcaggaaa tataagtggt tttgtttggt taacgtgata cattctgtat 6480gaatgaaaca ttggagggaa acatctactg aatttctgta atttaaaata ttttgctgct 6540agttaactat gaacagatag aagaatctta cagatgctgc tataaataag tagaaaatat 6600aaatttcatc actaaaatat gctattttaa aatctatttc ctatattgta tttctaatca 6660gatgtattac tcttattatt tctattgtat gtgttaatga ttttatgtaa aaatgtaatt 6720gcttttcatg agtagtatga ataaaattga ttagtttgtg ttttcttgtc tccc 67746940PRThomo sapiens 69Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu1 5 10 15Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu 20 25 30Tyr Gln Leu Glu Asn Tyr Cys Asn 35 40706774DNAhomo sapiens 70cggccccaga aaacccgagc gagtaggggg cggcgcgcag gagggaggag aactgggggc 60gcgggaggct ggtgggtgtg gggggtggag atgtagaaga tgtgacgccg cggcccggcg 120ggtgccagat tagcggacgc ggtgcccgcg gttgcaacgg gatcccgggc gctgcagctt 180gggaggcggc tctccccagg cggcgtccgc ggagacaccc atccgtgaac cccaggtccc 240gggccgccgg ctcgccgcgc accaggggcc ggcggacaga agagcggccg agcggctcga 300ggctggggga ccgcgggcgc ggccgcgcgc tgccgggcgg gaggctgggg ggccggggcc 360ggggccgtgc cccggagcgg gtcggaggcc ggggccgggg ccgggggacg gcggctcccc 420gcgcggctcc agcggctcgg ggatcccggc cgggccccgc agggaccatg gcagccggga 480gcatcaccac gctgcccgcc ttgcccgagg atggcggcag cggcgccttc ccgcccggcc 540acttcaagga ccccaagcgg ctgtactgca aaaacggggg cttcttcctg cgcatccacc 600ccgacggccg agttgacggg gtccgggaga agagcgaccc tcacatcaag ctacaacttc 660aagcagaaga gagaggagtt gtgtctatca aaggagtgtg tgctaaccgt tacctggcta 720tgaaggaaga tggaagatta ctggcttcta aatgtgttac ggatgagtgt ttcttttttg 780aacgattgga atctaataac tacaatactt accggtcaag gaaatacacc agttggtatg 840tggcactgaa acgaactggg cagtataaac ttggatccaa aacaggacct gggcagaaag 900ctatactttt tcttccaatg tctgctaaga gctgatttta atggccacat ctaatctcat 960ttcacatgaa agaagaagta tattttagaa atttgttaat gagagtaaaa gaaaataaat 1020gtgtatagct cagtttggat aattggtcaa acaatttttt atccagtagt aaaatatgta 1080accattgtcc cagtaaagaa aaataacaaa agttgtaaaa tgtatattct cccttttata 1140ttgcatctgc tgttacccag tgaagcttac ctagagcaat gatctttttc acgcatttgc 1200tttattcgaa aagaggcttt taaaatgtgc atgtttagaa acaaaatttc ttcatggaaa 1260tcatatacat tagaaaatca cagtcagatg tttaatcaat ccaaaatgtc cactatttct 1320tatgtcattc gttagtctac atgtttctaa acatataaat gtgaatttaa tcaattcctt 1380tcatagtttt ataattctct ggcagttcct tatgatagag tttataaaac agtcctgtgt 1440aaactgctgg aagttcttcc acagtcaggt caattttgtc aaacccttct ctgtacccat 1500acagcagcag cctagcaact ctgctggtga tgggagttgt attttcagtc ttcgccaggt 1560cattgagatc catccactca catcttaagc attcttcctg gcaaaaattt atggtgaatg 1620aatatggctt taggcggcag atgatataca tatctgactt cccaaaagct ccaggatttg 1680tgtgctgttg ccgaatactc aggacggacc tgaattctga ttttatacca gtctcttcaa 1740aaacttctcg aaccgctgtg tctcctacgt aaaaaaagag atgtacaaat caataataat 1800tacactttta gaaactgtat catcaaagat tttcagttaa agtagcatta tgtaaaggct 1860caaaacatta ccctaacaaa gtaaagtttt caatacaaat tctttgcctt gtggatatca 1920agaaatccca aaatattttc ttaccactgt aaattcaaga agcttttgaa atgctgaata 1980tttctttggc tgctacttgg aggcttatct acctgtacat ttttggggtc agctcttttt 2040aacttcttgc tgctcttttt cccaaaaggt aaaaatatag attgaaaagt taaaacattt 2100tgcatggctg cagttccttt gtttcttgag ataagattcc aaagaactta gattcatttc 2160ttcaacaccg aaatgctgga ggtgtttgat cagttttcaa gaaacttgga atataaataa 2220ttttataatt caacaaaggt tttcacattt tataaggttg atttttcaat taaatgcaaa 2280tttgtgtggc aggattttta ttgccattaa catatttttg tggctgcttt ttctacacat 2340ccagatggtc cctctaactg ggctttctct aattttgtga tgttctgtca ttgtctccca 2400aagtatttag gagaagccct ttaaaaagct gccttcctct accactttgc tggaaagctt 2460cacaattgtc acagacaaag atttttgttc caatactcgt tttgcctcta tttttcttgt 2520ttgtcaaata gtaaatgata tttgcccttg cagtaattct actggtgaaa aacatgcaaa 2580gaagaggaag tcacagaaac atgtctcaat tcccatgtgc tgtgactgta gactgtctta 2640ccatagactg tcttacccat cccctggata tgctcttgtt ttttccctct aatagctatg 2700gaaagatgca tagaaagagt ataatgtttt aaaacataag gcattcgtct gccatttttc 2760aattacatgc tgacttccct tacaattgag atttgcccat aggttaaaca tggttagaaa 2820caactgaaag cataaaagaa aaatctaggc cgggtgcagt ggctcatgcc tatattccct 2880gcactttggg aggccaaagc aggaggatcg cttgagccca ggagttcaag accaacctgg 2940tgaaaccccg tctctacaaa aaaacacaaa aaatagccag gcatggtggc gtgtacatgt 3000ggtctcagat acttgggagg ctgaggtggg agggttgatc acttgaggct gagaggtcaa 3060ggttgcagtg agccataatc gtgccactgc agtccagcct aggcaacaga gtgagacttt 3120gtctcaaaaa aagagaaatt ttccttaata agaaaagtaa tttttactct gatgtgcaat 3180acatttgtta ttaaatttat tatttaagat ggtagcacta gtcttaaatt gtataaaata 3240tcccctaaca tgtttaaatg tccattttta ttcattatgc tttgaaaaat aattatgggg 3300aaatacatgt ttgttattaa atttattatt aaagatagta gcactagtct taaatttgat 3360ataacatctc ctaacttgtt taaatgtcca tttttattct ttatgtttga aaataaatta 3420tggggatcct atttagctct tagtaccact aatcaaaagt tcggcatgta gctcatgatc 3480tatgctgttt ctatgtcgtg gaagcaccgg atgggggtag tgagcaaatc tgccctgctc 3540agcagtcacc atagcagctg actgaaaatc agcactgcct gagtagtttt gatcagttta 3600acttgaatca ctaactgact gaaaattgaa tgggcaaata agtgcttttg tctccagagt 3660atgcgggaga cccttccacc tcaagatgga tatttcttcc ccaaggattt caagatgaat 3720tgaaattttt aatcaagata gtgtgcttta ttctgttgta ttttttatta ttttaatata 3780ctgtaagcca aactgaaata acatttgctg ttttataggt ttgaagaaca taggaaaaac 3840taagaggttt tgtttttatt tttgctgatg aagagatatg tttaaatatg ttgtattgtt 3900ttgtttagtt acaggacaat aatgaaatgg agtttatatt tgttatttct attttgttat 3960atttaataat agaattagat tgaaataaaa tataatggga aataatctgc agaatgtggg 4020ttttcctggt gtttccctct gactctagtg cactgatgat ctctgataag gctcagctgc 4080tttatagttc tctggctaat gcagcagata ctcttcctgc cagtggtaat acgatttttt 4140aagaaggcag tttgtcaatt ttaatcttgt ggataccttt atactcttag ggtattattt 4200tatacaaaag ccttgaggat tgcattctat tttctatatg accctcttga tatttaaaaa 4260acactatgga taacaattct tcatttacct agtattatga aagaatgaag gagttcaaac 4320aaatgtgttt cccagttaac tagggtttac tgtttgagcc aatataaatg tttaactgtt 4380tgtgatggca gtattcctaa agtacattgc atgttttcct aaatacagag tttaaataat 4440ttcagtaatt cttagatgat tcagcttcat cattaagaat atcttttgtt ttatgttgag 4500ttagaaatgc cttcatatag acatagtctt tcagacctct actgtcagtt ttcatttcta 4560gctgctttca gggttttatg aattttcagg caaagcttta atttatacta agcttaggaa 4620gtatggctaa tgccaacggc agtttttttc ttcttaattc cacatgactg aggcatatat 4680gatctctggg taggtgagtt gttgtgacaa ccacaagcac tttttttttt tttaaagaaa 4740aaaaggtagt gaatttttaa tcatctggac tttaagaagg attctggagt atacttaggc 4800ctgaaattat atatatttgg cttggaaatg tgtttttctt caattacatc tacaagtaag 4860tacagctgaa attcagagga cccataagag ttcacatgaa aaaaatcaat ttatttgaaa 4920aggcaagatg caggagagag gaagccttgc aaacctgcag actgcttttt gcccaatata 4980gattgggtaa ggctgcaaaa cataagctta attagctcac atgctctgct ctcacgtggc 5040accagtggat agtgtgagag aattaggctg tagaacaaat ggccttctct ttcagcattc 5100acaccactac aaaatcatct tttatatcaa cagaagaata agcataaact aagcaaaagg 5160tcaataagta cctgaaacca agattggcta gagatatatc ttaatgcaat ccattttctg 5220atggattgtt acgagttggc tatataatgt atgtatggta ttttgatttg tgtaaaagtt 5280ttaaaaatca agctttaagt acatggacat ttttaaataa aatatttaaa gacaatttag 5340aaaattgcct taatatcatt gttggctaaa tagaataggg gacatgcata ttaaggaaaa 5400ggtcatggag aaataatatt ggtatcaaac aaatacattg atttgtcatg atacacattg 5460aatttgatcc aatagtttaa ggaataggta ggaaaatttg gtttctattt ttcgatttcc 5520tgtaaatcag tgacataaat aattcttagc ttattttata tttccttgtc ttaaatactg 5580agctcagtaa gttgtgttag gggattattt ctcagttgag actttcttat atgacatttt 5640actatgtttt gacttcctga ctattaaaaa taaatagtag atacaatttt cataaagtga 5700agaattatat aatcactgct ttataactga ctttattata tttatttcaa agttcattta 5760aaggctacta ttcatcctct gtgatggaat ggtcaggaat ttgttttctc atagtttaat 5820tccaacaaca atattagtcg tatccaaaat aacctttaat gctaaacttt actgatgtat 5880atccaaagct tctcattttc agacagatta atccagaagc agtcataaac agaagaatag 5940gtggtatgtt cctaatgata ttatttctac taatggaata aactgtaata ttagaaatta 6000tgctgctaat tatatcagct ctgaggtaat ttctgaaatg ttcagactca gtcggaacaa 6060attggaaaat ttaaattttt attcttagct ataaagcaag aaagtaaaca cattaatttc 6120ctcaacattt ttaagccaat taaaaatata aaagatacac accaatatct tcttcaggct 6180ctgacaggcc tcctggaaac ttccacatat ttttcaactg cagtataaag tcagaaaata 6240aagttaacat aactttcact aacacacaca tatgtagatt tcacaaaatc cacctataat 6300tggtcaaagt ggttgagaat atatttttta gtaattgcat gcaaaatttt tctagcttcc 6360atcctttctc cctcgtttct tctttttttg ggggagctgg taactgatga aatcttttcc 6420caccttttct cttcaggaaa tataagtggt tttgtttggt taacgtgata cattctgtat 6480gaatgaaaca ttggagggaa acatctactg aatttctgta atttaaaata ttttgctgct 6540agttaactat gaacagatag aagaatctta cagatgctgc tataaataag tagaaaatat 6600aaatttcatc actaaaatat gctattttaa aatctatttc ctatattgta tttctaatca 6660gatgtattac tcttattatt tctattgtat gtgttaatga ttttatgtaa aaatgtaatt 6720gcttttcatg agtagtatga ataaaattga ttagtttgtg ttttcttgtc tccc 6774716002DNAhomo sapiens 71gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa 1080ttaaaacatg cgctgacaat actatgaatg acactgatgt tcctttggaa acaactgaat 1140gcatccaagg tcaaggagaa ggctacaggg gcactgtcaa taccatttgg aatggaattc 1200catgtcagcg ttgggattct cagtatcctc acgagcatga catgactcct gaaaatttca 1260agtgcaagga cctacgagaa aattactgcc gaaatccaga tgggtctgaa tcaccctggt 1320gttttaccac tgatccaaac atccgagttg gctactgctc ccaaattcca aactgtgata 1380tgtcacatgg acaagattgt tatcgtggga atggcaaaaa ttatatgggc aacttatccc 1440aaacaagatc tggactaaca tgttcaatgt gggacaagaa catggaagac ttacatcgtc 1500atatcttctg ggaaccagat gcaagtaagc tgaatgagaa ttactgccga aatccagatg 1560atgatgctca tggaccctgg tgctacacgg gaaatccact cattccttgg gattattgcc 1620ctatttctcg ttgtgaaggt gataccacac ctacaatagt caatttagac catcccgtaa 1680tatcttgtgc caaaacgaaa caattgcgag ttgtaaatgg gattccaaca cgaacaaaca 1740taggatggat ggttagtttg agatacagaa ataaacatat ctgcggagga tcattgataa 1800aggagagttg ggttcttact gcacgacagt gtttcccttc tcgagacttg aaagattatg 1860aagcttggct tggaattcat gatgtccacg gaagaggaga tgagaaatgc aaacaggttc 1920tcaatgtttc ccagctggta tatggccctg aaggatcaga tctggtttta atgaagcttg 1980ccaggcctgc tgtcctggat gattttgtta gtacgattga tttacctaat tatggatgca 2040caattcctga aaagaccagt tgcagtgttt atggctgggg ctacactgga ttgatcaact 2100atgatggcct attacgagtg gcacatctct atataatggg aaatgagaaa tgcagccagc 2160atcatcgagg gaaggtgact ctgaatgagt ctgaaatatg tgctggggct gaaaagattg 2220gatcaggacc atgtgagggg gattatggtg gcccacttgt ttgtgagcaa cataaaatga 2280gaatggttct tggtgtcatt gttcctggtc gtggatgtgc cattccaaat cgtcctggta 2340tttttgtccg agtagcatat tatgcaaaat ggatacacaa aattatttta acatataagg 2400taccacagtc atagctgaag taagtgtgtc tgaagcaccc accaatacaa ctgtctttta 2460catgaagatt tcagagaatg tggaatttaa aatgtcactt acaacaatcc taagacaact 2520actggagagt catgtttgtt gaaattctca ttaatgttta tgggtgtttt ctgttgtttt 2580gtttgtcagt gttattttgt caatgttgaa gtgaattaag gtacatgcaa gtgtaataac 2640atatctcctg aagatacttg aatggattaa aaaaacacac aggtatattt gctggatgat 2700aaagatttca tgggaaaaaa aatcaattaa tctgtctaag ctgctttctg atgttggttt 2760cttaataatg agtaaaccac aaattaaatg ttattttaac ctcaccaaaa caatttatac 2820cttgtgtccc taaattgtag ccctatatta aattatatta catttcatat gctatatgtt 2880atagttcatt catttctctt caccatgtat cctgcaatac tggtacacga acacactttt 2940tacaaaacca catacccatg tacacatgcc taggtacaca tgtgcatgca ctacagttta 3000aattatggtg tacctaatgt aacccctaaa tattttagaa gtatgtacct atagttttac 3060ctcaaaaaaa ccagaaatct ctaaagacca gtagaaatat taaaaaatga tgcaagatca 3120aaatgattag ctaattctcc atacataatc tgcagatgat cttctttggt tggcatttca 3180ggtgtggcca tcacccagag ttaaataaca

cctaatctag gtgtttacat gtattcatta 3240tcctagttat ttcatgtagt ttctaattct taaaggaaag agggtaatag ttctatttgt 3300gtaatttgtt tcctccaaac ttaaggccac ttatttacac aagatatttg tagatctatt 3360ttcctaaagc atttcttaag tgctcagatc agtatctaat tgaagaagtt taaaagtgtt 3420ttggtcatta aaaatgtact taaataggtt aaatctaagc cttgctgctg tgattggctt 3480ctagctcact gcctttaaat tttaaaaaat ttaagaggaa aatttccaag tctccaaagt 3540tttataaata cccttcatca agtcatgcat taaagtatat attggagaaa aaaataaaaa 3600tacttttctc aacctggaag attttagcct aataaagctt ttttgaagta aaagacaact 3660tgtaaaagga aagaaactag tttgtctcaa ctctgtattc atttattttt tttttgaagt 3720agagtggaat ctgttgaatc agatatttta tcaagatatg tttatttttt cttatttcat 3780tttacaaagt tcactcctaa tgccatatgt aacagacatt taaattttgt gttctgtata 3840acagccaaat tatcatattt atcattgtat ttgtcatgct tagctaaaga tcatgtattt 3900gttgagaaat agaataacaa aaagtaatag gataggcttt gaatttttgc agaaatcttc 3960ctgtacaaaa cacctttaaa aataattttt tgaatggtgt gaatccagta gtcccatttc 4020tctgacttag ttttcttgag tgatttttat caaggccaag tccccaaaca attccctacc 4080agctctttag agtactgttc aatctggact aaaatggttt taagtttatg gagagcttag 4140tccacagaat atagggcggc gagtccagaa atgcttatac aatttttttt tcataataag 4200atatgtgctg gcatcaagaa acttaaagtg gaagcaaaaa gacatccaac tagttgctgg 4260tctctatcat cttatctgat ggtatttcta ttttccttat ataatacacc attttagtaa 4320gaactcctag aaatttcaag agcatattgc caaaatataa agtatatttc atagtttctt 4380ctggctgaac cagtgaaatt ttattattgc atattaatga tatttgtaaa acttttataa 4440aaattgtcat aattttaaat actcacattt taaaaatact tctttaatga ctcttcctct 4500aaatttcctg gaaatacaga taaagattag ctagatacaa gatacagcta agtatttaga 4560cattttgagg ctagtatttt tcattttatt aaaggctaaa aacaatacca ccaataaatc 4620atcaaacaaa ccgtacaaag taattctctc tttgggaggc tcctttcgtg atagagggac 4680atgggtggaa ttgacaatga aacttagatg aacaaggtcc atgttatttt aggtggtaga 4740acagggtaga gtcatgtcat tatttgctgg tggaagacac tatttaccag gtgttctttg 4800ctgaataaat cattaaacat ttttaaaaat ccaacaatcc actttatttt gtgtcattga 4860caaaaggatc ttttaaatca gaaggtttca atgcaatttt tggtttggct gtttgaataa 4920tggttatgta ctgttataat tgtagacatt ttctcacgtc taccaggaat tgaagtgtaa 4980aactaaaata tttttcataa tgcctctgcc gtgcagaagg aatgataatc cttttgtata 5040cttctttaat tttattgtaa aatgtgtaat gacttttacc tatatgctgt gggcaggtcc 5100tcagtaaaat ctattgagtc aatttctagt attaacaggc ttttgcttgc tatctaagtg 5160tttcaaatta tgggaagtgt gagacactgg aaggcaagaa aattaacaat aatggcatgt 5220gatagcaaaa ttgtatttca cttattcctg tgaatatttc ttgttggtac caatggtact 5280gtacaaagtg aatgttatag ccacaacatt ctcttgaaaa gaacactgtc aagaagtggg 5340aaattgctgt caggcatttc attgttgttt ttaaactttt ttaaaagaaa tactggtttt 5400gcaatataga gatcatgtgg taaagaattt taataagatc ttatactaaa aagccttaaa 5460tcaatttatt gagattcaaa aaatactatt ataattaatt acatcccata catataggca 5520aactcattta aaaaataaaa ctaattttgg taaaagtaca tggcctttgt ttttaaaata 5580cataatttta aaataaatca cttgtcatga taaagtccaa aaagaagtta tcattcaaca 5640ttcaactaag gttggagcta agaatttact aatacaaaaa aagttaaaat tttttggacc 5700atatatatct tgacagtgta acttttaagt aggttcattt ccatttgcac agaaagtttc 5760tgtctttagg aaactgaaaa tgaaatactg tggatgctat gactgtttgt cttgtatgta 5820aataggaaat taataagctg cctattgagt ggtatagctg tatgcttacc caaaaaaggg 5880aacactgtgg ttatgacttg tattataaac tttctgtagt taataaagtt gttattttta 5940taaccatgat tatattatta ttattaataa aatattttat caaaatgaaa aaaaaaaaaa 6000aa 600272728PRThomo sapiens 72Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285Ala Asp Asn Thr Met Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu 290 295 300Cys Ile Gln Gly Gln Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile305 310 315 320Trp Asn Gly Ile Pro Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu 325 330 335His Asp Met Thr Pro Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn 340 345 350Tyr Cys Arg Asn Pro Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr 355 360 365Asp Pro Asn Ile Arg Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp 370 375 380Met Ser His Gly Gln Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met385 390 395 400Gly Asn Leu Ser Gln Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp 405 410 415Lys Asn Met Glu Asp Leu His Arg His Ile Phe Trp Glu Pro Asp Ala 420 425 430Ser Lys Leu Asn Glu Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His 435 440 445Gly Pro Trp Cys Tyr Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys 450 455 460Pro Ile Ser Arg Cys Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu465 470 475 480Asp His Pro Val Ile Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val 485 490 495Asn Gly Ile Pro Thr Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg 500 505 510Tyr Arg Asn Lys His Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp 515 520 525Val Leu Thr Ala Arg Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr 530 535 540Glu Ala Trp Leu Gly Ile His Asp Val His Gly Arg Gly Asp Glu Lys545 550 555 560Cys Lys Gln Val Leu Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly 565 570 575Ser Asp Leu Val Leu Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp 580 585 590Phe Val Ser Thr Ile Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu 595 600 605Lys Thr Ser Cys Ser Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn 610 615 620Tyr Asp Gly Leu Leu Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu625 630 635 640Lys Cys Ser Gln His His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu 645 650 655Ile Cys Ala Gly Ala Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp 660 665 670Tyr Gly Gly Pro Leu Val Cys Glu Gln His Lys Met Arg Met Val Leu 675 680 685Gly Val Ile Val Pro Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly 690 695 700Ile Phe Val Arg Val Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile705 710 715 720Leu Thr Tyr Lys Val Pro Gln Ser 725731369DNAhomo sapiens 73gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa 1080ttaaaacatg cgagacataa catgggctct caactgatgg tgaacttctt ctggtgagtg 1140acagaggctg cagtgaagaa taatgagtct aatagaagtt tatcacagat gtctctaatc 1200tttatagctg atccctacct ctctcgctgt ctttgtaccc agcctgcatt ctgtttcgat 1260ctgtctttta gcagtccata caatcatttt tctacatgct ggcccttacc tagcttttct 1320gaatttacaa taaaaactat tttttaacgt gaaaaaaaaa aaaaaaaaa 136974290PRThomo sapiens 74Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285Glu Thr 290755987DNAhomo sapiens 75gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta 720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat 1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgctg 1080acaatactat gaatgacact gatgttcctt tggaaacaac tgaatgcatc caaggtcaag 1140gagaaggcta caggggcact gtcaatacca tttggaatgg aattccatgt cagcgttggg 1200attctcagta tcctcacgag catgacatga ctcctgaaaa tttcaagtgc aaggacctac 1260gagaaaatta ctgccgaaat ccagatgggt ctgaatcacc ctggtgtttt accactgatc 1320caaacatccg agttggctac tgctcccaaa ttccaaactg tgatatgtca catggacaag 1380attgttatcg tgggaatggc aaaaattata tgggcaactt atcccaaaca agatctggac 1440taacatgttc aatgtgggac aagaacatgg aagacttaca tcgtcatatc ttctgggaac 1500cagatgcaag taagctgaat gagaattact gccgaaatcc agatgatgat gctcatggac 1560cctggtgcta cacgggaaat ccactcattc cttgggatta ttgccctatt tctcgttgtg 1620aaggtgatac cacacctaca atagtcaatt tagaccatcc cgtaatatct tgtgccaaaa 1680cgaaacaatt gcgagttgta aatgggattc caacacgaac aaacatagga tggatggtta 1740gtttgagata cagaaataaa catatctgcg gaggatcatt gataaaggag agttgggttc 1800ttactgcacg acagtgtttc ccttctcgag acttgaaaga ttatgaagct tggcttggaa 1860ttcatgatgt ccacggaaga ggagatgaga aatgcaaaca ggttctcaat gtttcccagc 1920tggtatatgg ccctgaagga tcagatctgg ttttaatgaa gcttgccagg cctgctgtcc 1980tggatgattt tgttagtacg attgatttac ctaattatgg atgcacaatt cctgaaaaga 2040ccagttgcag tgtttatggc tggggctaca ctggattgat caactatgat ggcctattac 2100gagtggcaca tctctatata atgggaaatg agaaatgcag ccagcatcat cgagggaagg 2160tgactctgaa tgagtctgaa atatgtgctg gggctgaaaa gattggatca ggaccatgtg 2220agggggatta tggtggccca cttgtttgtg agcaacataa aatgagaatg gttcttggtg 2280tcattgttcc tggtcgtgga tgtgccattc caaatcgtcc tggtattttt gtccgagtag 2340catattatgc aaaatggata cacaaaatta ttttaacata taaggtacca cagtcatagc 2400tgaagtaagt gtgtctgaag cacccaccaa tacaactgtc ttttacatga agatttcaga 2460gaatgtggaa tttaaaatgt cacttacaac aatcctaaga caactactgg agagtcatgt 2520ttgttgaaat tctcattaat gtttatgggt gttttctgtt gttttgtttg tcagtgttat 2580tttgtcaatg ttgaagtgaa ttaaggtaca tgcaagtgta ataacatatc tcctgaagat 2640acttgaatgg attaaaaaaa cacacaggta tatttgctgg atgataaaga tttcatggga 2700aaaaaaatca attaatctgt ctaagctgct ttctgatgtt ggtttcttaa taatgagtaa 2760accacaaatt aaatgttatt ttaacctcac caaaacaatt tataccttgt gtccctaaat 2820tgtagcccta tattaaatta tattacattt catatgctat atgttatagt tcattcattt 2880ctcttcacca tgtatcctgc aatactggta cacgaacaca ctttttacaa aaccacatac 2940ccatgtacac atgcctaggt acacatgtgc atgcactaca gtttaaatta tggtgtacct 3000aatgtaaccc ctaaatattt tagaagtatg tacctatagt tttacctcaa aaaaaccaga 3060aatctctaaa gaccagtaga aatattaaaa aatgatgcaa gatcaaaatg attagctaat 3120tctccataca taatctgcag atgatcttct ttggttggca tttcaggtgt ggccatcacc 3180cagagttaaa taacacctaa tctaggtgtt tacatgtatt cattatccta gttatttcat 3240gtagtttcta attcttaaag gaaagagggt aatagttcta tttgtgtaat ttgtttcctc 3300caaacttaag gccacttatt tacacaagat atttgtagat ctattttcct aaagcatttc 3360ttaagtgctc agatcagtat ctaattgaag aagtttaaaa gtgttttggt cattaaaaat 3420gtacttaaat aggttaaatc taagccttgc tgctgtgatt ggcttctagc tcactgcctt 3480taaattttaa aaaatttaag aggaaaattt ccaagtctcc aaagttttat aaataccctt 3540catcaagtca tgcattaaag tatatattgg agaaaaaaat aaaaatactt ttctcaacct 3600ggaagatttt agcctaataa agcttttttg aagtaaaaga caacttgtaa aaggaaagaa 3660actagtttgt ctcaactctg tattcattta tttttttttt gaagtagagt ggaatctgtt 3720gaatcagata ttttatcaag atatgtttat tttttcttat ttcattttac aaagttcact 3780cctaatgcca tatgtaacag acatttaaat tttgtgttct gtataacagc caaattatca 3840tatttatcat tgtatttgtc atgcttagct aaagatcatg tatttgttga gaaatagaat 3900aacaaaaagt aataggatag gctttgaatt tttgcagaaa tcttcctgta caaaacacct 3960ttaaaaataa ttttttgaat ggtgtgaatc cagtagtccc atttctctga cttagttttc 4020ttgagtgatt tttatcaagg ccaagtcccc aaacaattcc ctaccagctc tttagagtac 4080tgttcaatct ggactaaaat ggttttaagt ttatggagag cttagtccac agaatatagg 4140gcggcgagtc cagaaatgct tatacaattt ttttttcata ataagatatg tgctggcatc 4200aagaaactta aagtggaagc aaaaagacat ccaactagtt gctggtctct atcatcttat 4260ctgatggtat ttctattttc cttatataat acaccatttt agtaagaact cctagaaatt 4320tcaagagcat attgccaaaa tataaagtat atttcatagt ttcttctggc tgaaccagtg 4380aaattttatt attgcatatt aatgatattt gtaaaacttt tataaaaatt gtcataattt 4440taaatactca cattttaaaa atacttcttt aatgactctt cctctaaatt tcctggaaat 4500acagataaag attagctaga tacaagatac agctaagtat ttagacattt tgaggctagt 4560atttttcatt

ttattaaagg ctaaaaacaa taccaccaat aaatcatcaa acaaaccgta 4620caaagtaatt ctctctttgg gaggctcctt tcgtgataga gggacatggg tggaattgac 4680aatgaaactt agatgaacaa ggtccatgtt attttaggtg gtagaacagg gtagagtcat 4740gtcattattt gctggtggaa gacactattt accaggtgtt ctttgctgaa taaatcatta 4800aacattttta aaaatccaac aatccacttt attttgtgtc attgacaaaa ggatctttta 4860aatcagaagg tttcaatgca atttttggtt tggctgtttg aataatggtt atgtactgtt 4920ataattgtag acattttctc acgtctacca ggaattgaag tgtaaaacta aaatattttt 4980cataatgcct ctgccgtgca gaaggaatga taatcctttt gtatacttct ttaattttat 5040tgtaaaatgt gtaatgactt ttacctatat gctgtgggca ggtcctcagt aaaatctatt 5100gagtcaattt ctagtattaa caggcttttg cttgctatct aagtgtttca aattatggga 5160agtgtgagac actggaaggc aagaaaatta acaataatgg catgtgatag caaaattgta 5220tttcacttat tcctgtgaat atttcttgtt ggtaccaatg gtactgtaca aagtgaatgt 5280tatagccaca acattctctt gaaaagaaca ctgtcaagaa gtgggaaatt gctgtcaggc 5340atttcattgt tgtttttaaa cttttttaaa agaaatactg gttttgcaat atagagatca 5400tgtggtaaag aattttaata agatcttata ctaaaaagcc ttaaatcaat ttattgagat 5460tcaaaaaata ctattataat taattacatc ccatacatat aggcaaactc atttaaaaaa 5520taaaactaat tttggtaaaa gtacatggcc tttgttttta aaatacataa ttttaaaata 5580aatcacttgt catgataaag tccaaaaaga agttatcatt caacattcaa ctaaggttgg 5640agctaagaat ttactaatac aaaaaaagtt aaaatttttt ggaccatata tatcttgaca 5700gtgtaacttt taagtaggtt catttccatt tgcacagaaa gtttctgtct ttaggaaact 5760gaaaatgaaa tactgtggat gctatgactg tttgtcttgt atgtaaatag gaaattaata 5820agctgcctat tgagtggtat agctgtatgc ttacccaaaa aagggaacac tgtggttatg 5880acttgtatta taaactttct gtagttaata aagttgttat ttttataacc atgattatat 5940tattattatt aataaaatat tttatcaaaa tgaaaaaaaa aaaaaaa 598776723PRThomo sapiens 76Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys Ala Asp Asn Thr Met 275 280 285Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu Cys Ile Gln Gly Gln 290 295 300Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile Trp Asn Gly Ile Pro305 310 315 320Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu His Asp Met Thr Pro 325 330 335Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn Tyr Cys Arg Asn Pro 340 345 350Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr Asp Pro Asn Ile Arg 355 360 365Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp Met Ser His Gly Gln 370 375 380Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met Gly Asn Leu Ser Gln385 390 395 400Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp Lys Asn Met Glu Asp 405 410 415Leu His Arg His Ile Phe Trp Glu Pro Asp Ala Ser Lys Leu Asn Glu 420 425 430Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His Gly Pro Trp Cys Tyr 435 440 445Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys Pro Ile Ser Arg Cys 450 455 460Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu Asp His Pro Val Ile465 470 475 480Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val Asn Gly Ile Pro Thr 485 490 495Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg Tyr Arg Asn Lys His 500 505 510Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp Val Leu Thr Ala Arg 515 520 525Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr Glu Ala Trp Leu Gly 530 535 540Ile His Asp Val His Gly Arg Gly Asp Glu Lys Cys Lys Gln Val Leu545 550 555 560Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly Ser Asp Leu Val Leu 565 570 575Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp Phe Val Ser Thr Ile 580 585 590Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu Lys Thr Ser Cys Ser 595 600 605Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn Tyr Asp Gly Leu Leu 610 615 620Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu Lys Cys Ser Gln His625 630 635 640His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu Ile Cys Ala Gly Ala 645 650 655Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp Tyr Gly Gly Pro Leu 660 665 670Val Cys Glu Gln His Lys Met Arg Met Val Leu Gly Val Ile Val Pro 675 680 685Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly Ile Phe Val Arg Val 690 695 700Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile Leu Thr Tyr Lys Val705 710 715 720Pro Gln Ser771354DNAhomo sapiens 77gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta 720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat 1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgaga 1080cataacatgg gctctcaact gatggtgaac ttcttctggt gagtgacaga ggctgcagtg 1140aagaataatg agtctaatag aagtttatca cagatgtctc taatctttat agctgatccc 1200tacctctctc gctgtctttg tacccagcct gcattctgtt tcgatctgtc ttttagcagt 1260ccatacaatc atttttctac atgctggccc ttacctagct tttctgaatt tacaataaaa 1320actatttttt aacgtgaaaa aaaaaaaaaa aaaa 135478285PRThomo sapiens 78Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys Glu Thr 275 280 285792102DNAhomo sapiens 79gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc 840agtgttcaga aggtaaataa acctgaatgc catgtgggcc attctattcc ccctatgtgt 900agaactgtaa ctcacattaa aggttaacag caacgaatca atcataacaa atatgttgtt 960cgtgcaaatg caactacaaa taattattta aacattttta tacaatgttt ttaaaactgt 1020tggattatca ccagattaat gcaaaataac agagcgagtt atcagtttga atttcaacac 1080tgcctgagac atccctctgg ggaaagtgaa agagagggtt tacttaccta ctgtcttgag 1140ctcacatacc tcaaaatcta ctactgtgtg gcacctgaaa ggagttgaat gaagcttagc 1200ctttcattag caatgttaat tctattcaac cagcacctgc ttccacagaa attctgtcca 1260aactatcatg aagtggtgtg acaagggtat atggacccag aagataatac aatataagaa 1320gggatcactg gaagcttgac cccatgcaca ttttggtgaa aatgtgccta gaatcaaatg 1380tgacacgtag gctggaactg agtaccattc agaataggat ctgaagagat caaagcaatg 1440gagaccacca aactgtcttg aaggcatgtc tatggacctt aagtccatgt ctatgttttc 1500agctcttctc acagcataaa agggcattgt ccttactttt gcagtggaaa actgaatggc 1560tgacaagatg gaagagtaac catttcagca ttgtatgtgg tttcattttt cttagttatc 1620tggctactga atagccggat ttttcagttc tgtcagaaac tctaaatttc caaaaatcta 1680agtgaaacat ggatgaaact ctgttagaaa attgttagga ttttggagta tttggggagg 1740gggactactg gaatgctgtc caagttttat actaagatat cttacctgtt tgttattaac 1800caaatatttt taaaaatatt tcctccataa atattcattt aatattaggt tgatatttat 1860cacataaaaa gtaaaggcta ctgttagcta attgtcacag agaaggattt gttttctgtt 1920gttagtgaat ttgaaatcct tgactttatg tgctacagcc agttccatct ctgtttgtaa 1980attcttactt tccattccat atcatattct gttccctata acctcttcat tgttttcttt 2040tcttttaaaa ataataaact tttctatgat caaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2100aa 210280210PRThomo sapiens 80Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205Gly Lys 21081469DNAhomo sapiens 81agccctccag gacaggctgc atcagaagag gccatcaagc agatcactgt ccttctgcca 60tggccctgtg gatgcgcctc ctgcccctgc tggcgctgct ggccctctgg ggacctgacc 120cagccgcagc ctttgtgaac caacacctgt gcggctcaca cctggtggaa gctctctacc 180tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac ccgccgggag gcagaggacc 240tgcaggtggg gcaggtggag ctgggcgggg gccctggtgc aggcagcctg cagcccttgg 300ccctggaggg gtccctgcag aagcgtggca ttgtggaaca atgctgtacc agcatctgct 360ccctctacca gctggagaac tactgcaact agacgcagcc cgcaggcagc cccacacccg 420ccgcctcctg caccgagaga gatggaataa agcccttgaa ccagcaaaa 46982110PRThomo sapiens 82Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 11083495DNAhomo sapiens 83agccctccag gacaggctgc atcagaagag gccatcaagc aggtctgttc caagggcctt 60tgcgtcagat cactgtcctt ctgccatggc cctgtggatg cgcctcctgc ccctgctggc 120gctgctggcc ctctggggac ctgacccagc cgcagccttt gtgaaccaac acctgtgcgg 180ctcacacctg gtggaagctc tctacctagt gtgcggggaa cgaggcttct tctacacacc 240caagacccgc cgggaggcag aggacctgca ggtggggcag gtggagctgg gcgggggccc 300tggtgcaggc agcctgcagc ccttggccct ggaggggtcc ctgcagaagc gtggcattgt 360ggaacaatgc tgtaccagca tctgctccct ctaccagctg gagaactact gcaactagac 420gcagcccgca ggcagcccca cacccgccgc ctcctgcacc gagagagatg gaataaagcc 480cttgaaccag caaaa 49584110PRThomo sapiens 84Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 11085648DNAhomo sapiens 85agccctccag gacaggctgc atcagaagag gccatcaagc aggtctgttc caagggcctt 60tgcgtcaggt gggctcagga ttccagggtg gctggacccc

aggccccagc tctgcagcag 120ggaggacgtg gctgggctcg tgaagcatgt gggggtgagc ccaggggccc caaggcaggg 180cacctggcct tcagcctgcc tcagccctgc ctgtctccca gatcactgtc cttctgccat 240ggccctgtgg atgcgcctcc tgcccctgct ggcgctgctg gccctctggg gacctgaccc 300agccgcagcc tttgtgaacc aacacctgtg cggctcacac ctggtggaag ctctctacct 360agtgtgcggg gaacgaggct tcttctacac acccaagacc cgccgggagg cagaggacct 420gcaggtgggg caggtggagc tgggcggggg ccctggtgca ggcagcctgc agcccttggc 480cctggagggg tccctgcaga agcgtggcat tgtggaacaa tgctgtacca gcatctgctc 540cctctaccag ctggagaact actgcaacta gacgcagccc gcaggcagcc ccacacccgc 600cgcctcctgc accgagagag atggaataaa gcccttgaac cagcaaaa 64886110PRThomo sapiens 86Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 11087529DNAhomo sapiens 87agccctccag gacaggctgc atcagaagag gccatcaagc aggtctgttc caagggcctt 60tgcgtcaggt gggctcagga ttccagggtg gctggacccc agatcactgt ccttctgcca 120tggccctgtg gatgcgcctc ctgcccctgc tggcgctgct ggccctctgg ggacctgacc 180cagccgcagc ctttgtgaac caacacctgt gcggctcaca cctggtggaa gctctctacc 240tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac ccgccgggag gcagaggacc 300tgcaggtggg gcaggtggag ctgggcgggg gccctggtgc aggcagcctg cagcccttgg 360ccctggaggg gtccctgcag aagcgtggca ttgtggaaca atgctgtacc agcatctgct 420ccctctacca gctggagaac tactgcaact agacgcagcc cgcaggcagc cccacacccg 480ccgcctcctg caccgagaga gatggaataa agcccttgaa ccagcaaaa 5298870PRThomo sapiens 88Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly65 70

Claims

1-27. (canceled)

28. An isolated cell population of metabolically mature hepatocytes wherein one or more hepatocyte cells exhibit Cytochrome P450 3A4 (CYP3A4) activity which oxidizes at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per milligram of cellular protein and an alpha-fetoprotein (AFP) activity of at least 60 .mu.g/day/mg cellular protein as assayed by ELISA when cultured in the presence of a culture medium which comprises Insulin-Transferrin-Selenium (ITS), Glutamax, Dexamethasone, hepatocyte growth factor (HGF), Oleic acid and 9CLA.

29. (canceled)

30. An isolated population of cells as claimed in claim 28, wherein at least 50% of the cells exhibit said activities.

31-32. (canceled)

33. The isolated hepatocyte population of claim 28, wherein said hepatocyte population is characterized by nuclear expression of pregnane X receptor (PXR).

34-37. (canceled)

38. The isolated hepatocyte population of claim 28, obtained from an immature hepatocyte which produces at least 1 .mu.g to 25 .mu.g Albumin/ml/mg cellular protein and cannot differentiate into bile duct cells.

39. The isolated hepatocyte population of claim 28, wherein said hepatocyte is distinguishable from an adult hepatocyte by at least the expression of AFP.

40. The hepatocyte population of claim 28, wherein the hepatocyte contains an increased mitochondrial mass per cell as compared to the mitochondrial mass in a control immature hepatocyte.

41. The metabolically mature hepatocyte population of claim 38, wherein said immature hepatocytes exhibit an alpha-fetoprotein (AFP).sup.+/Albumin.sup.+/CYP347.sup.+/SOX2.sup.-/OCT4.sup.- expression signature.

42. The metabolically mature hepatocyte population of claim 28, wherein the mature hepatocytes exhibit an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup- .+/HNF4.alpha..sup.+ expression signature.

43. An isolated cell population of metabolically mature hepatocytes generated from immature hepatocytes contacted with one or more of a PXR agonist, a fatty acid or a small molecule selected from the group consisting of: an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid, Perfluorooctanoic Acid, CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, said contacting increasing the metabolic maturation of the immature hepatocyte, said agonist causing increased mitochondrial mass and mitochondrial proliferation rate per cell when compared to untreated immature hepatocytes.

44. The isolated metabolically mature hepatocytes of claim 43, where the PXR agonist is a small molecule, a bile acid and a steroid, contact with said agonist increasing expression of CYP3A4 and CYP2C9 by at least two-fold.

45. The metabolically mature hepatocyte population of claim 43, wherein the mature hepatocytes exhibit an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup- .+/HNF4.alpha..sup.+ expression signature.

46. The metabolically mature hepatocyte population of claim 44, wherein the mature hepatocytes exhibit an albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup- .+/HNF4.alpha..sup.+ expression signature.