FGFR3 FUSION GENE AND PHARMACEUTICAL DRUG TARGETING SAME

Abstract

The FGFR-encoding gene was studied extensively with regard to its expression, hyperamplification, mutation, translocation, or such in various cancer cells. As a result, novel fusion polypeptides in which the FGFR3 polypeptide is fused with a different polypeptide were identified and isolated from several types of bladder cancer-derived cells and lung cancer cells. The use of a fusion polypeptide of the present invention as a biomarker in FGFR inhibitor-based cancer therapy enables one to avoid side effects in cancer therapy and control the therapeutic condition to produce the best therapeutic effect, thereby enabling individualized medicine.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of application Ser. No. 14/380,399, filed on Aug. 22, 2014, which is the National Stage of International Application No. PCT/JP2013/076200, filed on Sep. 27, 2013, which claims the benefit of Japanese Application No. 2012-214739, filed on Sep. 27, 2012, and Japanese Application No. 2013-149217, filed on Jul. 18, 2013.

TECHNICAL FIELD

[0002] The present invention relates to novel fusion polypeptides expressed in abnormal cells such as cancer cells; polynucleotides encoding the polypeptides; vectors comprising the polynucleotides; cells comprising the vectors; antibodies and fragments thereof which specifically bind to the polypeptides; oligonucleotide primers that hybridize to the polynucleotides; oligonucleotides that cleave the polynucleotides; pharmaceutical compositions comprising the antibodies or oligonucleotides; methods and kits for detecting the polynucleotides or fusion polypeptides; methods for testing cancer susceptibility, whether a subject is affected with cancer, or whether cancer has progressed based on the presence or absence of the polynucleotides or fusion polypeptides; methods for selecting cancer patients to which an FGFR inhibitor is applicable; pharmaceutical compositions for treating cancer wherein compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof are used for administration to patients expressing the fusion polypeptides or carrying the polynucleotides; methods for treating or preventing cancer which comprise the step of administering an effective amount of compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof to patients expressing the fusion polypeptides or carrying the polynucleotides; use of compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof in the production of pharmaceutical compositions for cancer treatment for administration to patients expressing the fusion polypeptides or carrying the polynucleotides; compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof for use in treating or preventing patients expressing the fusion polypeptides or carrying the polynucleotides; as well as methods for identifying FGFR inhibitors, and such.

BACKGROUND ART

[0003] Cancer can develop in any organ or tissue, and is highly refractory and lethal. It goes with saying that cancer is a very troublesome disease. Recent statistical data showed that one out of every two persons is diagnosed with cancer during life, and one out of four men and one out of six women die of cancer. Thus, cancer remains an extremely severe disease.

[0004] To date, a number of anticancer agents have been developed and prescribed to many cancer patients, and certain therapeutic outcome has been achieved. However, anticancer agents are well known to cause serious side effects as well. Meanwhile, it has long been known that there are individual differences in the response to anticancer agents, i.e., therapeutic effects and side effects, although the cause remains undissolved.

[0005] Recent advances in science and technology, in particular, rapid progress of pharmacogenomics (PGx), has enabled us to understand various diseases including cancer (such as cancer, diabetes, and hypertension) at the molecular level. It has been revealed that among patients showing similar symptoms, there are cases where genetic polymorphism (including gene mutation) is involved in the various individual differences observed, for example, differences in the absorption, distribution, metabolism, and excretion of administered pharmaceutical agents, as well as differences in the response at sites of action, differences in pathological conditions, and differences in disease susceptibility.

[0006] This suggests that for patients who are already affected with cancer, therapeutic effects can be enhanced and side effects can be reduced, for example, by analyzing the patients' genomic information in advance before administration of anticancer agents, and selecting an agent to be administered and determining the mode of prescription based on the presence or absence of specific genetic polymorphisms.

[0007] Likewise, for healthy persons also, genomic information of an individual can be analyzed using pharmacogenomics to predict the person's susceptibility to a disease (likelihood of being affected with a disease) as well as the person's responsiveness to pharmaceutical agents, based on the presence or absence of specific genetic polymorphisms.

[0008] This novel type of therapeutic method, which uses specific genetic polymorphisms thus identified or mutant polypeptides resulting from such polymorphisms as a biomarker, is referred to as order-made medicine, tailor-made medicine, personalized medicine, or custom-made medicine, and has been adopted for the clinical development of pharmaceutical products and clinical practice in various countries.

[0009] Similarly, agents that target the specific genetic polymorphisms identified as described above or mutant polypeptides resulting from such polymorphisms are referred to as molecularly targeted drugs, and their development is setting off actively.

[0010] Fibroblast growth factor receptors (FGFRs) are kinases belonging to the receptor tyrosine kinase family. FGFR1, FGFR2, FGFR3, and FGFR4 constitute the FGFR family. The ligand is fibroblast growth factor (FGF), and 22 types of structurally similar proteins form the family.

[0011] Signals transmitted via FGFR are conveyed to the MAPK pathway or PI3K/AKT pathway. It has been reported that in cancer, signal transduction is involved in cell growth, angiogenesis, cell migration, invasion, metastasis, etc.; and FGFR is activated as a result of overexpression, gene hyper-amplification, mutation, or translocation (Non-patent Document 1). For example, it is known that for FGFR3, genetic translocation is observed in multiple myeloma (Non-patent Document 2); gene mutation is observed in bladder cancer (Non-patent Document 3); and overexpression is observed in ovarian cancer, non-small cell lung carcinoma, and hepatocellular carcinoma.

[0012] The findings described above suggest a connection between FGFR and cancer. Thus, attempts have been made to develop compounds with FGFR inhibitory activity as anticancer agents (Non-patent Documents 4 and 5).

[0013] While it has been reported very recently that genetic translocation that suggests the presence of a fusion polypeptide of FGFR3 and transforming acidic coiled-coil protein 3 (TACC3) or a fusion polypeptide of FGFR1 and TACC1 was found in very few cases of brain tumor glioblastoma multiforme (GBM) (three of 97 samples, 3.1%) (Non-patent Document 6), the connection between fusion polypeptides of FGFR with other proteins and other types of cancer remains unclear.

PRIOR ART DOCUMENTS

Non-Patent Documents



[0014] [Non-patent Document 1] Cytokine & Growth Factor Reviews, 2005, 16: 139-149

[0015] [Non-patent Document 2] Blood, 2003, 101: 4569-4575

[0016] [Non-patent Document 3] Nature Genetics, 1999 September, 23(1): 18-20

[0017] [Non-patent Document 4] Cancer Research, 2012, 72: 2045-2056

[0018] [Non-patent Document 5] J. Med. Chem., 2011, 54: 7066-7083

[0019] [Non-patent Document 6] Science, Vol. 337, Issue 6099, 7 Sep. 2012: 1231-1235

SUMMARY OF THE INVENTION

Problems to be Solved by the Invention

[0020] In view of the above circumstances, the present invention aims to identify and provide cancer cell-specific molecules that can be used as a biomarker to enable personalized medicine for FGFR inhibitor-based cancer therapy, and cancer cell-specific molecules that are useful in development of molecularly targeted drugs targeting FGFR, as well as to provide various materials and methods to be used in personalized medicine and development of molecularly targeted drugs that utilize such molecules as a biomarker or molecular target.

Means for Solving the Problems

[0021] As mentioned above, a connection between FGFR and cancer has been suggested; however, connections between fusion proteins of FGFR with other proteins and various types of cancer remain unrevealed.

[0022] To achieve the above-described objective, the present inventors conducted dedicated studies on expression, hyper-amplification, mutation, translocation, and such of FGFR-encoding genes in various cancer cells. As a result, the present inventors discovered in multiple bladder cancer cells and lung cancer cells, novel fusion polypeptide genes between an FGFR3 polypeptide gene and other polypeptide genes, in particular, fusion polypeptide genes between an FGFR3 polypeptide gene and a BAIAP2L1 polypeptide gene, and fusion polypeptide genes between an FGFR3 polypeptide gene and a TACC3 polypeptide gene. The present inventors have thereby completed the present invention.

[0023] Specifically, the present invention relates to:

novel fusion polypeptides expressed in abnormal cells such as cancer cells, polynucleotides encoding the polypeptides, vectors comprising the polynucleotides, cells comprising the vectors, antibodies and fragments thereof that specifically bind to the polypeptides, oligonucleotide primers that hybridize to the polynucleotides, oligonucleotides that cleave the polynucleotides, pharmaceutical compositions comprising the antibodies or oligonucleotides, methods and kits for detecting the fusion polypeptides or polynucleotides, methods for testing cancer susceptibility, whether a subject is affected with cancer, or whether cancer has progressed based on the presence or absence of the fusion polypeptides or polynucleotides, methods for selecting cancer patients to which an FGFR inhibitor is applicable, pharmaceutical compositions for cancer treatment which are characterized by their use of being administered to patients expressing the fusion polypeptides or carrying the polynucleotides, methods for identifying FGFR inhibitors, and such, as described below: [1] a fusion polypeptide comprising an FGFR3 polypeptide and a BAIAP2L1 polypeptide or TACC3 polypeptide: wherein the FGFR3 polypeptide is the whole or a part of a wild-type polypeptide consisting of the amino acid sequence of SEQ ID NO: 6 or 7, or the whole or a part of a mutant polypeptide with one or more amino acid substitutions, deletions, or insertions in the wild-type polypeptide; the BAIAP2L1 polypeptide is the whole or a part of a wild-type polypeptide consisting of the amino acid sequence of SEQ ID NO: 8, or the whole or a part of a mutant polypeptide with one or more amino acid substitutions, deletions, or insertions in the wild-type polypeptide; and the TACC3 polypeptide is the whole or a part of a wild-type polypeptide consisting of the amino acid sequence of SEQ ID NO: 9, or the whole or a part of a mutant polypeptide with one or more amino acid substitutions, deletions, or insertions in the wild type polypeptide; [2] the fusion polypeptide of [1] described above, wherein the FGFR3 polypeptide is a wild-type polypeptide consisting of the amino acid sequence of SEQ ID NO: 6 or 7; [3] the fusion polypeptide of [1] or [2] described above, wherein the fusion polypeptide comprises an FGFR3 polypeptide and a BAIAP2L1 polypeptide; [4] the fusion polypeptide of [3] described above, wherein the fusion polypeptide consists of the amino acid sequence of SEQ ID NO: 32 or 38; [5] the fusion polypeptide of [1] or [2] described above, wherein the fusion polypeptide comprises an FGFR3 polypeptide and a TACC3 polypeptide; [6] the fusion polypeptide of [5] described above, wherein the fusion polypeptide consists of the amino acid sequence of SEQ ID NO: 28, 30, 34, or 36; [7] the fusion polypeptide of any of [1] to [5] described above, wherein the fusion polypeptide is derived from bladder cancer or lung cancer; [8] a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above; [9] the polynucleotide of [8] described above, which comprises the nucleotide sequence of SEQ ID NO: 14, 15, or 16; [10] the polynucleotide of [9] described above, which comprises the nucleotide sequence of SEQ ID NO: 27, 29, 31, 33, 35, or 37; [11] a vector comprising the polynucleotide of any of [8] to [10] described above; [12] a recombinant cell comprising the vector of [11] described above; [13] an antibody or antigen-binding fragment thereof which specifically binds to the fusion polypeptide of any of [1] to [7] described above; [14] a pair of oligonucleotide primers consisting of sense and antisense primers each hybridizing to a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above for detecting or amplifying the polynucleotide; [15] an oligonucleotide that binds to an mRNA polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above and has an activity to inhibit translation of the mRNA polynucleotide into protein; [16] the oligonucleotide of [15] described above, which is an siRNA that cleaves the mRNA polypeptide; [17] a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of [13] described above; [18] a pharmaceutical composition comprising the oligonucleotide of [15] or [16] described above; [19] a method for detecting a fusion polypeptide that comprises an FGFR3 polypeptide and a BAIAP2L1 polypeptide or TACC3 polypeptide, which comprises the step of detecting the fusion polypeptide in a sample isolated from a subject by using an antibody or antigen-binding fragment thereof that binds to the fusion polypeptide of any of [1] to [7] described above; [20] a method for detecting a polynucleotide encoding a fusion polypeptide that comprises an FGFR3 polypeptide and a BAIAP2L1 polypeptide or TACC3 polypeptide, which comprises the step of detecting a polynucleotide encoding the fusion polypeptide in a sample isolated from a subject by using a pair of oligonucleotide primers consisting of sense and antisense primers each hybridizing to a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above for detecting or amplifying the polynucleotide; [21] a kit for detecting a polynucleotide encoding a fusion polypeptide that comprises an FGFR3 polypeptide and a BAIAP2L1 polypeptide or TACC3 polypeptide, which comprises a pair of oligonucleotide primers consisting of sense and antisense primers each hybridizing to a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above for detecting or amplifying the polynucleotide; [22] a kit for detecting a fusion polypeptide that comprises an FGFR3 polypeptide and a BAIAP2L1 polypeptide or TACC3 polypeptide, which comprises an antibody or antigen-binding fragment thereof that binds to the fusion polypeptide of any of [1] to [7] described above; [23] a method for testing cancer susceptibility of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject by determining the presence or absence of the fusion polypeptide of any of [1] to [7] described above in a sample isolated from the subject, wherein the method is based on the criterion that a subject is more likely to develop cancer, is affected with cancer, or has progressed cancer when the fusion polypeptide is detected; [24] a method for testing cancer susceptibility of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject by determining the presence or absence of a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above in a sample isolated from the subject, wherein the method is based on the criterion that a subject is more likely to develop cancer, is affected with cancer, or has progressed cancer when the polynucleotide encoding the fusion polypeptide is detected; [25] the method of [23] or [24] described above, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [26] a method for selecting a patient to which an anticancer agent comprising a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is applicable, which comprises the steps of:

[0024] (a) determining the presence or absence of the fusion polypeptide of any of [1] to [7] described above in a sample isolated from a subject; and

[0025] (b) selecting a patient confirmed to have the fusion polypeptide as a patient to which the anticancer agent is applicable; [27] a method for selecting a patient to which an anticancer agent comprising a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is applicable, which comprises the steps of:

[0026] (a) determining the presence or absence of a polynucleotide encoding the fusion polypeptide of any of [1] to [7] described above in a sample isolated from a subject; and

[0027] (b) selecting a patient confirmed to have a polynucleotide encoding the fusion polypeptide as a patient to which the anticancer agent is applicable; [28] the method of [26] or [27] described above, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [29] the method of any of [26] to [28] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is any one of the compounds or a pharmaceutically acceptable salt thereof represented by:

##STR00001##

[0027] wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-6 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0028] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0029] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00002##

[30] the method of [29] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or a pharmaceutically acceptable salt thereof, [31] a pharmaceutical composition for cancer treatment, which comprises a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof and is used in such a manner that the compound or a pharmaceutically acceptable salt thereof is administered to a patient who expresses the fusion polypeptide of any of [1] to [7] described above or has a polynucleotide that encodes the fusion polypeptide; [32] the pharmaceutical composition of [31] described above for cancer treatment, wherein the patient is selected by the method of any of [26] to [30] described above; [33] the pharmaceutical composition of [31] or [32] described above for cancer treatment, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [34] the pharmaceutical composition of [31] or [32] described above for cancer treatment, wherein the cancer is bladder cancer; [35] the pharmaceutical composition of [34] described above for cancer treatment, wherein the bladder cancer is classified as stage 3 or later according to TNM classification; [36] the pharmaceutical composition of any of [31] to [35] for cancer treatment, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is any one of the compounds or a pharmaceutically acceptable salt thereof represented by:

##STR00003##

wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-6 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-4 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0030] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0031] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00004##

[37] the pharmaceutical composition of [36] described above for cancer treatment, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or a pharmaceutically acceptable salt thereof; [38] a method for treating or preventing cancer, comprising the step of administering an effective amount of a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof to a cancer patient expressing the fusion polypeptide of any of [1] to [7] described above or carrying a polynucleotide encoding the fusion polypeptide; [39] the method of [38] described above, wherein the patient is selected by the method of any of [26] to [30] described above; [40] the method of [38] or [39] described above, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [41] the method of [38] or [39] described above, wherein the cancer is bladder cancer; [42] the method of [41] described above, wherein the bladder cancer is classified as stage 3 or later according to TNM classification; [43] the method of any of [38] to [42] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is any one of the compounds or a pharmaceutically acceptable salt thereof represented by:

##STR00005##

wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-4 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0032] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0033] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00006##

[44] the method of [43] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or a pharmaceutically acceptable salt thereof, [45] use of a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof in the manufacture of a pharmaceutical composition for cancer treatment to be administered to a patient expressing the fusion polypeptide of any of [1] to [7] described above or carrying a polynucleotide encoding the fusion polypeptide; [46] the use of [45] described above, wherein the patient is selected by the method of any of [26] to [30] described above; [47] the use of [45] or [46] described above, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [48] the use of [45] or [46] described above, wherein the cancer is bladder cancer; [49] the use of [48] described above, wherein the bladder cancer is classified as stage 3 or later according to TNM classification; [50] the use of any of [45] to [49] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is any one of the compounds or a pharmaceutically acceptable salt thereof represented by:

##STR00007##

wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-6 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0034] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0035] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00008##

[51] the use of [50] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or pharmaceutically acceptable salt thereof; [52] a compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof for therapeutic or prophylactic use in a cancer patient expressing the fusion polypeptide of any of [1] to [7] described above or carrying a polynucleotide encoding the fusion polypeptide; [53] the compound or a pharmaceutically acceptable salt thereof of [52] described above, wherein the patient is selected by the method of any of [26] to [30] described above; [54] the compound or a pharmaceutically acceptable salt thereof of [52] or [53] described above, wherein the cancer is bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, or liver cancer; [55] the compound or a pharmaceutically acceptable salt thereof of [52] or [53] described above, wherein the cancer is bladder cancer; [56] the compound or a pharmaceutically acceptable salt thereof of [55] described above, wherein the bladder cancer is classified as stage 3 or later according to TNM classification; [57] the compound or a pharmaceutically acceptable salt thereof of any of [52] to [56] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is any one of the compounds or a pharmaceutically acceptable salt thereof represented by:

##STR00009##

wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-6 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl;

[0036] R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0037] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0038] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00010##

[58] the compound or a pharmaceutically acceptable salt thereof of [57] described above, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or a pharmaceutically acceptable salt thereof; [58] the compound of [57] described above or a pharmaceutically acceptable salt thereof, wherein the compound having FGFR inhibitory activity or a pharmaceutically acceptable salt thereof is a compound of formula (I), wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen, or a pharmaceutically acceptable salt thereof; [59] a method for identifying a compound having FGFR inhibitory activity, which comprises the steps of:

[0039] (a) culturing a cell that expresses the fusion polypeptide of any of [1] to [7] described above in the presence or absence of a test compound and determining the level of cell proliferation;

[0040] (b) comparing the proliferation level of the cultured cell between in the presence and absence of the test compound; and

[0041] (c) judging that the test compound has FGFR inhibitory activity when the proliferation level of the cell cultured in the presence of the test compound is lower than that of the cell cultured in the absence of the test compound; [60] a method for identifying a compound having FGFR inhibitory activity, which comprises the steps of:

[0042] (a) administering a test compound to anon-human mammal transplanted with a cell that expresses the fusion polypeptide of any of [1] to [7] described above and determining the proliferation level of the cell;

[0043] (b) comparing the cell proliferation level determined in step (a) with that determined using a non-human mammal transplanted with the cell but not administered with the test compound; and

[0044] (c) judging that the test compound has FGFR inhibitory activity when the cell proliferation level determined in step (a) is lower than that determined using a non-human mammal transplanted with the cell but not administered with the test compound; [61] the method of [59] or [60] described above, wherein the cell is a cancer cell; and [62] the method of [61] described above, wherein the cancer cell is a bladder cancer cell, brain tumor cell, head and neck squamous cell carcinoma cell, lung cancer cell, lung adenocarcinoma cell, lung squamous cell carcinoma cell skin melanoma cell, esophageal cancer cell, gastric cancer cell, or liver cancer cell.

Effects of the Invention

[0045] Fusion polypeptides of the present invention comprising an FGFR3 polypeptide and another polypeptide are expressed specifically in various types of cancer cells including bladder cancer cells. The proliferation of cells expressing such fusion polypeptides is significantly inhibited by compounds having FGFR inhibitory activity. Thus, use of a fusion polypeptide of the present invention as a biomarker for FGFR inhibitor-based cancer therapy enables one to assess the applicability and mode of use of an FGFR inhibitor for individual patients, and enables one to avoid side effects and control the mode of treatment to produce the best therapeutic effect in the FGFR inhibitor-based therapy. This enables personalized medicine.

[0046] In addition, the use of fusion polypeptides of the present invention as a target in developing cancer therapeutic agents targeting FGFR, i.e., molecularly targeted drugs, makes it possible to provide FGFR inhibitors with high levels of specificity and antitumor activity against target cancer cells as well as cancer therapeutic agents comprising the inhibitors.

[0047] FGFR inhibitors obtained as described above have high specificity towards target cancer cells, and it becomes possible to provide cancer therapeutic agents with great antitumor activity and few side effects.

[0048] Furthermore, fusion polypeptides of the present invention have a close correlation to various types of cancers, and thus the likelihood of developing cancer (cancer susceptibility) of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject can be tested by determining whether samples from the subject, which is not limited to cancer patients but also includes healthy persons, contain the fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide.

[0049] In addition, fusion polypeptides of the present invention have a close correlation to various types of cancers. Thus, by identifying a test compound that suppresses proliferation of cells (such as cancer cells) which express the fusion polypeptides of the present invention, it becomes possible to provide FGFR inhibitors with high FGFR specificity, and this can be done by comparing the level of cell proliferation between in the presence and absence of the test compound.

BRIEF DESCRIPTION OF THE DRAWINGS

[0050] FIG. 1 is a photograph showing results on amplification of a polynucleotide v1 encoding the FGFR3-TACC3 fusion polypeptide, as tested by polymerase chain reaction (PCR) using cDNAs derived from bladder cancer samples collected from bladder cancer patients (20 patients) and cDNAs synthesized from RT112/84 RNA.

[0051] FIG. 2 is a photograph showing results on amplification of a polynucleotide v2 encoding the FGFR3-TACC3 fusion polypeptide, as tested by polymerase chain reaction (PCR) using cDNAs derived from bladder cancer samples collected from bladder cancer patients (20 patients) and cDNAs synthesized from RT4 RNA.

[0052] FIG. 3 is a photograph showing results on amplification of a polynucleotide encoding the FGFR3-BAIAP2L1 polypeptide, as tested by polymerase chain reaction (PCR) using cDNAs derived from bladder cancer samples collected from bladder cancer patients (20 patients) and cDNAs synthesized from SW780 RNA.

[0053] FIG. 4 is a photograph showing results on amplification of a polynucleotide encoding the FGFR3-BAIAP2L1 polypeptide, as tested by polymerase chain reaction (PCR) using cDNAs derived from lung cancer samples collected from lung cancer patients (40 patients) and cDNA synthesized from SW780 RNA.

[0054] View A shows a result of the test using a pair of oligonucleotide primers (SEQ ID NOs: 3 and 4).

[0055] The leftmost lanes on the top and bottom gels show the results for molecular-weight markers.

[0056] View B shows a result of the test using a pair of oligonucleotide primers (SEQ ID NOs: 17 and 18).

[0057] The leftmost lanes on the top and bottom gels show the results for molecular-weight markers.

[0058] FIG. 5 is a photograph showing results of detecting a polynucleotide encoding a FGFR3-BAIAP2L1 polypeptide in various types of bladder cancer cell lines tested by FISH analysis.

[0059] View A1 shows a test result of the RT112/84 cell line using a split-signal probe.

[0060] View A2 shows a test result of the SW780 cell line using a split-signal probe.

[0061] View B1 shows a test result of the RT112/84 cell line using a fusion-signal probe.

[0062] View B2 shows a test result of the SW780 cell line using a fusion-signal probe.

[0063] FIG. 6 shows results of testing the presence or absence of FGFR3 dependency in the proliferation of various bladder cancer cell lines using siRNA against FGFR3 or BAIAP2L1.

[0064] View A shows a result of the test using the BFTC-905 cell line.

[0065] View B shows a result of the test using the UM-UC-14 cell line.

[0066] View C shows a result of the test using the RT4 cell line.

[0067] View D shows a result of the test using the SW780 cell line.

[0068] FIG. 7 shows results of testing the effect of FGFR inhibitors in inducing apoptosis in various cancer cells expressing the FGFR3-BAIAP2L1 fusion polypeptide.

[0069] FIG. 8 shows results of examining the ability of the FGFR3-BAIAP2L1 fusion polypeptide to transform normal cells by testing the cells in monolayer culture.

[0070] The upper figure shows a result of wild-type FGFR3-expressing cells in monolayer culture.

[0071] The lower figure shows a result of FGFR3-BAIAP2L1 fusion polypeptide-expressing cells in monolayer culture.

[0072] FIG. 9 shows results of examining the transforming ability and tumorigenic ability of the FGFR3-BAIAP2L1 fusion polypeptide in normal cells by testing the cells in spheroid culture.

[0073] The upper row photographs show results of culturing the untreated parent cells.

[0074] The middle row photographs show results of culturing the wild-type FGFR3-expressing cells.

[0075] The lower row photographs show results of culturing the FGFR3-BAIAP2L1 fusion polypeptide-expressing cells.

[0076] FIG. 10 presents photographs showing results of examining the ability of the FGFR3-BAIAP2L1 fusion polypeptide to transform normal cells and the contribution of BAIAP2L1 to the transforming ability, by performing tests using the autophosphorylation ability of FGFR3 as an indicator.

[0077] FIG. 11 shows a result of examining the ability of the FGFR3-BAIAP2L1 fusion polypeptide to transform normal cells and the contribution of BAIAP2L1 to the transforming ability, by performing tests using scaffold-independent cell proliferation as an indicator.

[0078] FIG. 12 shows results of examining the in vivo tumorigenic ability of the FGFR3-BAIAP2L1 fusion polypeptide by performing tests using nude mice.

[0079] In order from the left, the states 15 days after inoculating subcutaneously to the inguinal region of nude mice, wild-type FGFR3-expressing cells, wild-type BAIAP2L1-expressing cells, FGFR3-BAIAP2L1 fusion polypeptide-expressing cells, and cells expressing a fusion polypeptide of FGFR3 and a BAR-domain-deficient BAIAP2L1, respectively, are shown.

[0080] FIG. 13 shows a result of examining the tumor-growth-inhibiting effect of the FGFR inhibitor on the in vivo tumor formation by a FGFR3-BAIAP2L1 fusion polypeptide by using nude mice for tests.

MODE FOR CARRYING OUT THE INVENTION

[0081] The present invention is as illustrated in [1] to [62] described above, and provides novel fusion polypeptides expressed in abnormal cells such as cancer cells; polynucleotides encoding the polypeptides; vectors comprising the polynucleotides; cells comprising the vectors; antibodies and fragments thereof which specifically bind to the polypeptides; oligonucleotide primers that hybridize to the polynucleotides; oligonucleotides that cleave the polynucleotides; pharmaceutical compositions comprising the antibodies or oligonucleotides; methods and kits for detecting the polynucleotides or fusion polypeptides; methods for testing cancer susceptibility, whether a subject is affected with cancer, or whether cancer has progressed based on the presence or absence of the polynucleotides or fusion polypeptides; methods for selecting cancer patients to which an FGFR inhibitor is applicable; pharmaceutical compositions for cancer treatment which are characterized by their use of being administered to patients expressing the fusion polypeptides or carrying the polynucleotides; methods for treating or preventing cancer which comprise the step of administering an effective amount of compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof to patients expressing the fusion polypeptides or carrying the polynucleotides; use of compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof in the production of pharmaceutical compositions for cancer treatment for administration to patients expressing the fusion polypeptides or carrying the polynucleotides; and compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof for use in treatment or prevention for patients expressing the fusion polypeptides or carrying the polynucleotides.

[0082] In the present invention, "FGFR" refers to any FGFR belonging to the FGFR family comprising FGFR1, FGFR2, FGFR3, and FGFR4, which are fibroblast growth factor receptors (FGFRs) belonging to the receptor tyrosine kinase family (Cytokine & Growth Factor Reviews, 2005, 16: 139-149). FGFRs of the present invention may be of any origin, and are preferably FGFRs derived from mammals (humans, mice, rats, guinea pigs, rabbits, sheep, monkeys, goats, donkeys, bovines, horses, pigs, etc.), more preferably human FGFRs, and still more preferably human FGFR3 comprising the amino acid sequence of SEQ ID NO: 6 or 7 (cDNA sequences, SEQ ID NOs: 10 and 11, respectively/GenBank Accession Nos. NM_001163213.1 and NM_000142.4, respectively). The human FGFR3 gene locus is 4p16.3.

[0083] In the present invention, "human FGFR3" refers to a wild-type human FGFR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 6 or 7, or a mutant polypeptide with a substitution, deletion, or insertion of one or more amino acids (preferably one to ten amino acids, and more preferably one to five amino acids) in the wild-type polypeptide.

[0084] The mutant polypeptide also includes polypeptides having 70% or higher homology, preferably 80% or higher homology, more preferably 90% or higher homology, and still more preferably 95% or higher homology to the amino acid sequence of the wild-type polypeptide.

[0085] In the present invention, "BAIAP2L1" refers to brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1 (BAIAP2L1; also referred to as "insulin receptor tyrosine kinase substrate" (IRTKS)) (Journal of Cell Science, 2007, 120: 1663-1672). BAIAP2L1 of the present invention may be of any origin, and is preferably a mammalian BAIAP2L1, more preferably a human BAIAP2L1, and still more preferably a human BAIAP2L1 comprising the amino acid sequence of SEQ ID NO: 8 (cDNA sequence, SEQ ID NO: 12/GenBank Accession No. NM_018842.4). The human BAIAP2L1 gene locus is 722.1, and it is located on a chromosome different from the one that carries the FGFR3 gene.

[0086] In the present invention, "human BAIAP2L1" refers to a wild-type human BAIAP2L1 polypeptide comprising the amino acid sequence of SEQ ID NO: 8, or a mutant polypeptide with a substitution, deletion, or insertion of one or more amino acids (preferably one to ten amino acids, and more preferably one to five amino acids) in the wild-type polypeptide.

[0087] The mutant polypeptide also includes polypeptides having 70% or higher homology, preferably 80% or higher homology, more preferably 90% or higher homology, and still more preferably 95% or higher homology to the amino acid sequence of the wild-type polypeptide.

[0088] In the present invention, "TACC3" refers to transforming acidic coiled-coil protein 3 (TACC3) (Genomics. 1999 Jun. 1; 58(2): 165-70). TACC3 of the present invention may be of any origin, and is preferably a mammalian TACC3, more preferably a human TACC3, and still more preferably a human TACC3 comprising the amino acid sequence of SEQ ID NO: 9 (cDNA sequence, SEQ ID NO: 13/GenBank Accession No. NM_006342.2). The human TACC3 gene locus is 4p16.3, and it is located upstream of the FGFR3 gene on the same chromosome.

[0089] In the present invention, "human TACC3" refers to a wild-type human TACC3 polypeptide comprising the amino acid sequence of SEQ ID NO: 9, or a mutant polypeptide with a substitution, deletion, or insertion of one or more amino acids (preferably one to ten amino acids, and more preferably one to five amino acids) in the wild-type polypeptide.

[0090] The mutant polypeptide also includes polypeptides having 70% or higher homology, preferably 80% or higher homology, more preferably 90% or higher homology, and still more preferably 95% or higher homology to the amino acid sequence of the wild-type polypeptide.

[0091] Amino acid sequence (or nucleotide sequence) identity can be determined using the BLAST algorithm by Karlin and Altschul (Proc. Natl. Acad. Sci. USA (1993) 90, 5873-7). Programs such as BLASTN and BLASTX were developed based on this algorithm (Altschul et al., J. Mol. Biol. (1990) 215, 403-10). To analyze nucleotide sequences according to BLASTN based on BLAST, the parameters are set to, for example, score=100 and wordlength=12. On the other hand, parameters used for the analysis of amino acid sequences by BLASTX based on BLAST include, for example, score=50 and wordlength=3. Default parameters for each program are used when using the BLAST and Gapped BLAST programs. Specific techniques for such analyses are known in the art (one can refer to the information on the website of the National Center for Biotechnology Information (NCBI), Basic Local Alignment Search Tool (BLAST)).

[0092] In the present invention, "fusion polypeptide" refers to a polypeptide in which the whole or a part of the wild-type or mutant FGFR3 polypeptide described above is fused to the whole or a part of the wild-type or mutant TACC3 polypeptide described above, or a polypeptide in which the whole or a part of the wild-type or mutant FGFR3 polypeptide described above is fused to the whole or a part of the wild-type or mutant BAIA2P2L1 described above.

[0093] Furthermore, the fusion polypeptides of the present invention include fusion polypeptides in which the fusion site formed between the whole or a part of each of the two types of polypeptides comprises an amino acid sequence encoded by a portion of the intron sequence in the genomic DNA (including exons and introns) encoding the wild-type FGFR3 polypeptide or a mutant FGFR3 polypeptide.

[0094] Examples of such fusion polypeptides include polypeptides comprising the amino acid sequences of SEQ ID NOs: 30 and 36. The amino acid sequence of positions 761 to 793 and the amino acid sequence of positions 759 to 791 are encoded by portions of the intron sequence of the FGFR3 gene, respectively (the nucleotide sequence of positions 2,281 to 2,379 in SEQ ID NO: 29, and the nucleotide sequence of positions 2,275 to 2,373 in SEQ ID NO: 35, respectively).

[0095] Herein, "apart of a polypeptide" refers to a polypeptide consisting of an arbitrary partial sequence from the full-length amino acid sequence of a wild-type or mutant polypeptide.

[0096] Examples of specific embodiments include a fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 28, a fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 30, a fusion polypeptide of FGFR3 and BAIAP2L1 comprising the amino acid sequence of SEQ ID NO: 32, a fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 34, a fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 36, and a fusion polypeptide of FGFR3 and BAIAP2L1 comprising the amino acid sequence of SEQ ID NO: 38.

[0097] As described above, the fusion polypeptides comprising the amino acid sequences of SEQ ID NOs: 30 and 36 comprise in their fusion site an amino acid sequence encoded by a portion of the FGFR3 gene intron sequence.

[0098] Polynucleotides of the present invention include polynucleotides encoding a fusion polypeptide of the present invention described above, which include any polynucleotides that can encode a fusion polypeptide of the present invention. The polynucleotides include genomic DNAs and cDNAs. Genomic DNAs include exons and introns. Furthermore, the cDNAs may include nucleic acid sequences derived from a portion of an intron sequence that encodes amino acid sequence.

[0099] The polynucleotides also include degenerate polynucleotides constituted with any codons as long as the codons encode the same amino acids.

[0100] The polynucleotides of the present invention also include polynucleotides encoding fusion polypeptides derived from mammals. In a preferred embodiment, the polynucleotides of the present invention include polynucleotides encoding fusion polypeptides derived from humans.

[0101] In a specific embodiment, the polynucleotides of the present invention are polynucleotides encoding a fusion polypeptide in which the whole or a part of the wild-type FGFR3 polypeptide (SEQ ID NO: 6 or 7) or mutant FGFR3 polypeptide is fused to the whole or a part of the wild-type TACC3 polypeptide (SEQ ID NO: 9) or mutant TACC3 polypeptide described above or a fusion polypeptide in which the whole or a part of the wild-type or mutant FGFR3 polypeptide is fused to the whole or a part of the wild-type BAIA2P2L1 polypeptide (SEQ ID NO: 8) or mutant BAIA2P2L1 polypeptide described above.

[0102] Examples of more specific embodiments include a polynucleotide comprising a nucleotide sequence corresponding to the junction site of two polypeptides in the fusion polypeptide of SEQ ID NOs: 14, 15, or 16.

[0103] Examples of even more specific embodiments include a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 27 which encodes the fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 28, a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 29 which encodes the fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 30, a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 31 which encodes the fusion polypeptide of FGFR3 and BAIAP2L1 comprising the amino acid sequence of SEQ ID NO: 32, a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 33 which encodes the fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 34, a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 35 which encodes the fusion polypeptide of FGFR3 and TACC3 comprising the amino acid sequence of SEQ ID NO: 36, and a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 37 which encodes the fusion polypeptide of FGFR3 and BAIAP2L1 comprising the amino acid sequence of SEQ ID NO: 38.

[0104] As described above, the nucleotide sequence at positions 2,281 to 2,379 of SEQ ID NO: 29 is a nucleic acid sequence derived from an FGFR3 gene intron, and encodes the amino acid sequence of positions 761 to 793 in the polypeptide comprising the amino acid sequence of SEQ ID NO: 30.

[0105] Similarly, the nucleotide sequence at positions 2,275 to 2,373 of SEQ ID NO: 35 is a nucleic acid sequence derived from an FGFR3 gene intron, and encodes the amino acid sequence of positions 759 to 791 in the polypeptide comprising the amino acid sequence of SEQ ID NO: 36.

[0106] The polynucleotides of the present invention may be obtained by any methods. The polynucleotides of the present invention include, for example, all complementary DNAs (cDNAs) prepared from mRNAs, DNAs prepared from genomic DNA, DNAs obtained by chemical synthesis, DNAs obtained by PCR amplification using RNA or DNA as template, and DNAs constructed by appropriately combining these methods.

[0107] Polynucleotides encoding fusion polypeptides of the present invention can be obtained using routine methods by cloning cDNA from mRNA encoding a fusion polypeptide of the present invention or isolating genomic DNA and subjecting it to splicing treatment, or by chemical synthesis.

[0108] For example, in a method that clones cDNA from mRNA encoding a fusion polypeptide of the present invention, first, mRNA encoding a fusion polypeptide of the present invention is prepared from arbitrary tissues or cells expressing and producing the fusion polypeptide of the present invention according to routine methods. This may be achieved, for example, by preparing total RNA using a method such as the guanidine-thiocyanate method, hot phenol method, or AGPC method, and treating the total RNA with affinity chromatography using oligo(dT) cellulose, poly U-Sepharose, or the like.

[0109] Then, cDNA strand synthesis is carried out using the prepared mRNA as template by a known method that uses, for example, reverse transcriptase (Mol. Cell. Biol., Vol. 2, p. 161, 1982; Mol. Cell. Biol., Vol. 3, p. 280, 1983; Gene, Vol. 25, p. 263, 1983). The cDNA is converted to double-stranded cDNA, and inserted into a plasmid vector, phage vector, cosmid vector, or such. To prepare a cDNA library, the resulting vector is transformed into E. coli, or transfected into E. coli after in vitro packaging.

[0110] The present invention also relates to vectors (recombinant vectors) carrying the above-described polynucleotide encoding a fusion polypeptide of the present invention.

[0111] The vectors of the present invention are not particularly limited as long as they can replicate and maintain or self-propagate in various prokaryotic and/or eukaryotic cells as a host.

[0112] The vectors of the present invention include plasmid vectors and phage vectors.

[0113] Cloning vectors include, for example, pUC19, Xgt10, and Xgt11. When isolating host cells capable of expressing a fusion polypeptide of the present invention, preferably the vector is one that has a promoter which enables expression of the polynucleotide of the present invention.

[0114] Recombinant vectors of the present invention can be prepared using routine methods simply by ligating a polynucleotide encoding a fusion polypeptide of the present invention to a recombinant vector available in the art (plasmid DNA and bacteriophage DNA).

[0115] Recombinant vectors for use in the present invention include, for example, E. coli-derived plasmids (pBR322, pBR325, pUC12, pUC13, pUC19, etc.), yeast-derived plasmids (pSH19, pSH15, etc.), and Bacillus subtilis-derived plasmids (pUB110, pTP5, pC194, etc.).

[0116] Examples of phages are bacteriophages such as X phage, and animal or insect viruses (pVL1393, Invitrogen) such as retrovirus, vaccinia virus, nuclear polyhedrosis virus, and lentivirus.

[0117] Expression vectors are useful for the purpose of producing a fusion polypeptide of the present invention by expressing a polynucleotide encoding the fusion polypeptide of the present invention. Expression vectors are not particular limited as long as they have the function of producing fusion polypeptides of the present invention by expressing polynucleotides encoding the polypeptides in various prokaryotic and/or eukaryotic cells as a host.

[0118] Such expression vectors include, for example, pMAL C2, pEF-BOS (Nucleic Acid Research, Vol. 18, 1990, p. 5322) and pME18S (Jikken Igaku Bessatsu (Experimental Medicine: SUPPLEMENT), "Idenshi Kougaku Handbook (Handbook of Genetic Engineering)" (1992)).

[0119] Alternatively, fusion polypeptides of the present invention may be produced as fusion proteins with other proteins. For example, when preparing as a fusion protein with glutathione S-transferase (GST), cDNA encoding a fusion polypeptide of the present invention can be subcloned into, for example, plasmid pGEX4T1 (Pharmacia). E. coli DH5a is transformed with the resulting plasmid, and the transformants are cultured to prepare the fusion protein.

[0120] Alternatively, fusion polypeptides of the present invention may be produced as fusions with influenza hemagglutinin (HA), immunoglobulin constant region, s-galactosidase, maltose-binding protein (MBP), or such. Furthermore, fusion polypeptides of the present invention may be produced as fusions with known peptides, for example, FLAG (Hopp, T. P. et al., BioTechnology (1988) 6, 1204-1210), 6.times.His consisting of 6 histidine (His) residues, 10.times.His, influenza hemagglutinin (HA), fragments of human c-myc, fragments of VSV-GP, fragments of p18HIV, T7-tag, HSV-tag, E-tag, fragments of SV40T antigen, lck tag, fragments of .alpha.-tubulin, B-tag, fragments of Protein C, Stag, StrepTag, and HaloTag.

[0121] When using bacteria, in particular E coli, as a host cell, vectors of the present invention preferably contain at least a promoter-operator region, a start codon, a polynucleotide encoding a fusion polypeptide of the present invention, a stop codon, a terminator region, and a replicon.

[0122] When yeast, animal cells, or insect cells are used as a host, expression vectors preferably contain a promoter, a start codon, a polynucleotide encoding a fusion polypeptide of the present invention, and a stop codon.

[0123] The vectors may also contain DNA encoding a signal peptide, an enhancer sequence, 5' and 3' untranslated regions of the gene encoding a protein of the present invention, splice junctions, polyadenylation sites, a selection marker region, a replicon, and such.

[0124] Furthermore, if necessary, the vectors may contain marker genes (genes for gene amplification, drug resistance genes, etc.) that enable selection of transformed hosts or hosts with gene amplification.

[0125] Marker genes include, for example, the dihydrofolate reductase (DHFR) gene, thymidine kinase gene, neomycin resistance gene, glutamate synthase gene, adenosine deaminase gene, ornithine decarboxylase gene, hygromycin-B-phosphotransferase gene, and aspartate transcarbamylase gene.

[0126] A promoter-operator region for expressing the fusion polypeptide of the present invention in bacteria comprises a promoter, an operator, and a Shine-Dalgarno (SD) sequence (for example, AAGG).

[0127] For example, when the host is the genus Escherichia, it comprises, for example, the Trp promoter, lac promoter, recA promoter, XPL promoter, lpp promoter, tac promoter, or such.

[0128] Examples of a promoter for expressing the fusion polypeptide of the present invention in yeast are the PH05 promoter, PGK promoter, GAP promoter, ADH promoter, and such.

[0129] When the host is Bacillus, examples are the SL01 promoter, SP02 promoter, penP promoter, and such.

[0130] When the host is a eukaryotic cell such as a mammalian cell, examples are an SV40-derived promoter, retrovirus promoter, heat shock promoter, and such; and SV40 and retrovirus are preferred. Nevertheless, the promoter is not limited to the above examples. In addition, use of an enhancer is effective for expression.

[0131] A preferable initiation codon is, for example, a methionine codon (ATG). A commonly used termination codon (for example, TAG, TAA, TGA) is exemplified as a termination codon. Commonly used natural or synthetic terminators are used as a terminator region.

[0132] A replicon refers to a DNA capable of replicating the whole DNA sequence in host cells, and includes a natural plasmid, an artificially modified plasmid (DNA fragment prepared from a natural plasmid), a synthetic plasmid, and such. Examples of preferable plasmids for E. coli are pBR322 or its artificial derivatives (DNA fragment obtained by treating pBR322 with appropriate restriction enzymes), for yeast are yeast 2.mu. plasmid or yeast chromosomal DNA, and pRSVneo ATCC 37198, and for mammalian cells are plasmid pSV2dhfr ATCC 37145, plasmid pdBPV-MMTneo ATCC 37224, plasmid pSV2neo ATCC 37149, and such.

[0133] An enhancer sequence, polyadenylation site, and splicing junction that are usually used in the art, such as those derived from SV40 can also be used.

[0134] The expression vector of the present invention can be prepared by continuously and circularly linking at least the above-mentioned promoter, initiation codon, polynucleotide encoding the fusion polypeptide of the present invention, termination codon, and terminator region, to an appropriate replicon. If desired, appropriate DNA fragments (for example, linkers, restriction sites, and such), can be used by a common method such as restriction enzyme digestion or ligation using T4 DNA ligase.

[0135] The present invention also relates to recombinant cells transformed with the above-mentioned vectors of the present invention, and recombinant cells of the present invention can be prepared by introducing the expression vector mentioned above into host cells.

[0136] Host cells used in the present invention are not particularly limited as long as they are compatible with an expression vector mentioned above and can be transformed. Examples thereof include various cells such as wild-type cells or artificially established recombinant cells commonly used in the technical field of the present invention (for example, bacteria (the genera Escherichia and Bacillus), yeast (the genus Saccharomyces, the genus Pichia, and such), animal cells, or insect cells).

[0137] E. coli or animal cells are preferred. Specific examples are E. coli (DH5.alpha., TB1, HB101, and such), mouse-derived cells (COP, L, C127, Sp2/0, NS-1, NIH3T3, and such), rat-derived cells (PC12, PC12h), hamster-derived cells (BHK, CHO, and such), monkey-derived cells (COS1, COS3, COS7, CV1, Velo, and such), and human-derived cells (Hela, diploid fibroblast-derived cells, myeloma cells, and HepG2, and such).

[0138] An expression vector can be introduced (transformed (transfected)) into host cells according to routine methods.

[when the host is E. coli, Bacillus subtilis, or such]: Proc. Natl. Acad. Sci. USA, Vol. 69, p. 2110 (1972); Mol. Gen. Genet., Vol. 168, p. 111 (1979); J. Mol. Biol., Vol. 56, p. 209 (1971); [when the host is Saccharomyces cerevisiae]: Proc. Natl. Acad. Sci. USA, Vol. 75, p. 1927 (1978); J. Bacteriol., Vol. 153, p. 163 (1983); [when the host is an animal cell]: Virology, Vol. 52, p. 456 (1973); [when the host is an insect cell]: Mol. Cell. Biol., Vol. 3, pp. 2156-2165 (1983).

[0139] Fusion polypeptides of the present invention can be produced by culturing transformed recombinant cells (hereinafter, the term also refers to inclusion bodies) comprising an expression vector prepared as described above in nutritive media according to routine methods.

[0140] Fusion polypeptides of the present invention can be produced by culturing the above-described recombinant cells, in particular animal cells, and allowing them to secrete into culture supernatants.

[0141] The resulting culture is filtered or centrifuged to obtain a culture filtrate (supernatant). Fusion polypeptides of the present invention are purified and isolated from the culture filtrate by routine methods commonly used to purify and isolate natural or synthetic proteins. Examples of an isolation and purification method are methods that utilize solubility such as the salting out and solvent precipitation methods; methods that utilize difference in molecular weight such as dialysis, ultrafiltration, gel filtration, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis; methods that utilize charge such as ion exchange chromatography and hydroxylapatite chromatography; method that utilize specific affinity such as affinity column chromatography; methods that utilize difference in hydrophobicity such as reverse phase high performance liquid chromatography; and methods that utilize difference in the isoelectric point such as isoelectric focusing.

[0142] Meanwhile, when a fusion polypeptide of the present invention is in the periplasm or cytoplasm of cultured recombinant cells (such as E. coli), the cells are collected by routine methods such as filtration and centrifugation of the culture, and then suspended in an appropriate buffer. After the cell wall and/or cell membrane of the cells are disrupted using methods such as sonication, lysozyme, and cryolysis, a membrane fraction containing the protein of the present invention is obtained using methods such as centrifugation and filtration. The membrane fraction is solubilized with a detergent such as Triton-X100 to obtain the crude solution. Then, the protein of the present invention can be isolated and purified from the crude solution using routine methods such as those exemplified above.

[0143] The present invention also relates to arbitrary oligonucleotides that hybridize to polynucleotides (cDNAs and genomic DNAs) encoding the above-described fusion polypeptides of the present invention.

[0144] Oligonucleotides of the present invention have nucleotide sequences that are complementary to arbitrary partial nucleotide sequences of the cDNAs and genomic DNAs, and which are useful as a pair of oligonucleotide primers consisting of sense and antisense primers in polymerase chain reaction (PCR). The whole nucleotide sequence of a polynucleotide encoding a fusion polypeptide of the present invention or an arbitrary portion of the nucleotide sequence can be amplified by PCR using the pair of oligonucleotide primers.

[0145] Oligonucleotide primers of the present invention include oligonucleotides of any length that are complementary to the nucleotide sequence of a polynucleotide of the present invention. The oligonucleotide primers of the present invention preferably include those having a sequence of at least 12 consecutive nucleotides, more preferably 12 to 50 nucleotides, and still more preferably 12 to 20 nucleotides.

[0146] Oligonucleotides of the present invention are also useful as a probe when handling DNA or RNA hybridization. When used as a probe, the DNAs include a partial nucleotide sequence of 20 or more consecutive nucleotides, preferably a partial nucleotide sequence of 50 or more consecutive nucleotides, more preferably a partial nucleotide sequence of 100 or more consecutive nucleotides, even more preferably a partial nucleotide sequence of 200 or more consecutive nucleotides, and still more preferably a partial nucleotide sequence of 300 or more consecutive nucleotides, which hybridize to a polynucleotide of the present invention.

[0147] The present invention also relates to oligonucleotides that bind to mRNA polynucleotides encoding fusion polypeptides of the present invention and have an activity of inhibiting translation of the mRNAs into proteins. It is particularly preferable that the oligonucleotides include siRNAs that cleave the mRNAs by binding to the mRNA polynucleotides encoding fusion polypeptides of the present invention.

[0148] The oligonucleotides refer to those which bind to mRNAs encoding fusion polypeptides of the present invention and thereby inhibit their expression and include, for example, antisense oligonucleotides, ribozymes, and short interfering RNAs (siRNA). They bind to the mRNAs and then inhibit their translation into proteins.

[0149] An antisense oligonucleotide refers to an oligonucleotide that specifically hybridizes to genomic DNA and/or mRNA, and inhibits their protein expression by inhibiting the transcription and/or translation.

[0150] The binding to a target polynucleotide (mRNA, etc.) may be a result of common base pair complementarity. Alternatively, when an antisense oligonucleotide binds to, for example, a DNA duplex, the binding may be a result of specific interaction at the major grooves in double helix. Target sites for an antisense oligonucleotide include the 5' end of an mRNA, for example, 5' untranslated sequences up to or including the AUG start codon, and 3' untranslated sequences of an mRNA, as well as coding region sequences.

[0151] When using as an antisense oligonucleotide of the present invention, antisense oligonucleotides include partial nucleotide sequences of 5 to 100 consecutive nucleotides, preferably partial nucleotide sequences of 5 to 70 consecutive nucleotides, more preferably partial nucleotide sequences of 5 to 50 consecutive nucleotides, and still more preferably partial nucleotide sequences of 5 to 30 consecutive nucleotides.

[0152] Furthermore, antisense oligonucleotides of the present invention can be partially modified by chemical modification to prolong their half-life in blood (to stabilize them) or increase their intracellular membrane permeability when administered to patients, or to enhance their resistance to degradation or absorption in the digestive organs in oral administration. Such chemical modification includes, for example, chemical modification of a phosphate bond, ribose, nucleobase, sugar moiety in oligonucleotides, and 3' and/or 5' ends of oligonucleotides.

[0153] The modification of phosphate bonds includes, for example, conversion of one or more of the bonds to phosphodiester bonds (D-oligo), phosphorothioate bonds, phosphorodithioate bonds (S-oligo), methyl phosphonate (MP-oligo), phosphoroamidate bonds, non-phosphate bonds and methyl phosphonothioate bonds, and combinations thereof. The modification of ribose includes, for example, conversion to 2'-fluororibose or 2'-O-methylribose. The modification of nucleotide base includes, for example, conversion to 5-propynyluracil or 2-aminoadenine.

[0154] Ribozyme refers to oligonucleotides having a catalytic activity of cleaving mRNA. In general, ribozymes have endonuclease, ligase, or polymerase activity. Ribozymes include various types of trans-acting ribozymes, for example, hammerhead ribozymes and hairpin ribozymes.

[0155] siRNA refers to double-stranded oligonucleotides capable of carrying out RNA interference (for example, Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498).

[0156] siRNA cleaves mRNA in a sequence-specific manner, and as a result inhibits translation of the mRNA into protein. siRNA includes double-stranded RNAs that are 20 to 25 base pairs long and comprise a sequence complementary to the target polynucleotide sequence. siRNAs of the present invention also include oligonucleotides comprising chemically modified nucleotides and non-nucleotides.

[0157] The present invention also relates to antibodies which bind to the above-described fusion polypeptide of the present invention, and antigen-binding fragments thereof.

[0158] Antibodies of the present invention are not limited by their origin, form, function, etc. Antibodies of the present invention may be any antibodies, monoclonal or polyclonal antibodies. However, preferred antibodies of the present invention are monoclonal antibodies. Antibodies of the present invention may be those derived from any animal, such as human antibodies, mouse antibodies, and rat antibodies. Antibodies of the present invention may also be recombinant antibodies such as chimeric antibodies and humanized antibodies. Preferred antibodies of the present invention include chimeric antibodies, human antibodies, and humanized antibodies.

[0159] The humanized antibodies of the present invention can be prepared by methods known to those skilled in the art. The variable region of an antibody is typically composed of three complementarity-determining regions (CDRs) sandwiched by four frames (FRs). The CDRs practically determine the binding specificity of an antibody. The amino acid sequences of CDRs are highly diverse. On the other hand, amino acid sequences that constitute FRs often exhibit high homology among antibodies having different binding specificities. Therefore, it is said that in general the binding specificity of an antibody can be transplanted to a different antibody by grafting the CDRs.

[0160] Humanized antibodies are also referred to as reshaped human antibodies, and they are prepared by transferring the CDRs of an antibody derived from a non-human mammal such as a mouse, to the complementarity determining regions of a human antibody. General genetic recombination techniques for their preparation are also known (see European Patent Application Publication No. 125023 and WO 96/02576).

[0161] Specifically, for example, when the CDRs are derived from a mouse antibody, a DNA sequence is designed such that the CDRs of the mouse antibody are linked with the framework regions (FRs) of a human antibody, and it is synthesized by PCR using, as primers, several oligonucleotides that have portions overlapping the ends of both CDRs and FRs (see the method described in WO 98/13388). The resulting DNA is then ligated to a DNA encoding a human antibody constant region, inserted into an expression vector, and introduced into a host to produce the antibody (see European Patent Application Publication No. EP 239400 and International Patent Application Publication No. WO 96/02576).

[0162] Human antibody framework regions to be linked with CDRs are selected so that the complementarity determining regions form a favorable antigen-binding site. If needed, amino acids of the framework region in an antibody variable region may be substituted, deleted, added, and/or inserted so that the complementarity determining regions of the reshaped human antibody form a proper antigen-binding site. For example, mutations can be introduced into the amino acid sequence of the FR by applying the PCR method used to graft mouse CDRs to human FRs. Specifically, mutations can be introduced into a portion of the nucleotide sequences of primers that anneal to the FRs. The mutations are introduced into FRs synthesized using such primers. Mutant FR sequences having desired properties can be selected by assessing and determining the antigen-binding activity of amino acid-substituted mutant antibodies by the method described above and (Sato, K. et al., Cancer Res. (1993) 53, 851-856).

[0163] In general, constant regions from human antibodies are used for those of humanized antibodies.

[0164] There are no particular limitations to the human antibody constant regions to be used in the present invention; and for example, when using a heavy-chain constant region, it may be a human IgG1 constant region, human IgG2 constant region, human IgG3 constant region, human IgG4 constant region, or human IgM, IgA, IgE, or IgD constant region. Alternatively, when using a light-chain constant region, it may be a human .kappa. chain constant region or human .lamda. chain constant region. Furthermore, constant regions derived from a human antibody may have a naturally-occurring sequence or may be a constant region having a sequence with modification (substitution, deletion, addition, and/or insertion) of one or more amino acids in the naturally-occurring sequence.

[0165] Moreover, after a humanized antibody is prepared, amino acids in the variable region (for example, CDR and FR) and constant region of the humanized antibody may be deleted, added, inserted, and/or substituted with other amino acids. The humanized antibodies of the present invention also include such humanized antibodies with amino acid substitutions and such.

[0166] The origin of the CDRs of a humanized antibody is not particularly limited, and may be any animal. For example, it is possible to use sequences of mouse antibodies, rat antibodies, rabbit antibodies, camel antibodies, and such. CDR sequences of mouse antibodies are preferred.

[0167] When administered to humans for therapeutic purposes, humanized antibodies are useful because their immunogenicity in the human body is reduced.

[0168] Chimeric antibodies comprise, for example, heavy and light chain constant regions of a human antibody, and heavy and light chain variable regions of an antibody of a non-human mammal, such as mouse. Chimeric antibodies can be prepared using known methods. For example, antibodies can be produced by cloning an antibody gene from hybridomas, inserting it into an appropriate vector, and introducing the construct into hosts (see, for example, Carl, A. K. Borrebaeck, James, W. Larrick, THERAPEUTIC MONOCLONAL ANTIBODIES, Published in the United Kingdom by MACMILLAN PUBLISHERS LTD, 1990). Specifically, cDNAs of the antibody variable regions (V regions) are synthesized from the hybridoma mRNAs using reverse transcriptase. Once DNAs encoding the V regions of an antibody of interest are obtained, they are linked with DNAs encoding the constant regions (C regions) of a desired human antibody. The resulting constructs are inserted into expression vectors. Alternatively, DNAs encoding the antibody V regions may be inserted into an expression vector comprising DNAs encoding the C regions of a human antibody. The DNAs are inserted into an expression vector so that they are expressed under the regulation of expression regulatory regions, for example, enhancers and promoters. In the next step, host cells can be transformed with the expression vector to allow expression of chimeric antibodies.

[0169] Human antibodies can be obtained using methods known to those skilled in the art. For example, desired human antibodies with antigen-binding activity can be obtained by sensitizing human lymphocytes with an antigen of interest or cells expressing an antigen of interest in vitro; and fusing the sensitized lymphocytes with human myeloma cells such as U266 (see Japanese Patent Application Kokoku Publication No. (JP-B) HO1-59878 (examined, approved Japanese patent application published for opposition)). Alternatively, the desired human antibody can also be obtained by immunizing a transgenic animal having an entire repertoire of human antibody genes with a desired antigen (see International Patent Application Publication Nos. WO 93/12227, WO 92/03918, WO 94/02602, WO 94/25585, WO 96/34096, and WO 96/33735).

[0170] Alternatively, B cells expressing antibodies that have antigen-binding activity are isolated from a pool of human lymphocytes by flow cytometry, cell array, or such. The antibody genes from selected B cells can be analyzed, and DNA sequences of the human antibodies that bind to the antigen can be determined (Jin, A. et al., Nature Medicine (2009) 15, 1088-92; Scheid, J. F. et al., Nature (2009) 458, 636-640; Wrammert, J. et al., Nature (2008) 453, 667-672; Tiller, T. et al., Journal of Immunological Methods (2008) 329, 112-124). When DNA sequences of the antigen-binding antibodies are revealed, human antibodies can be prepared by constructing appropriate expression vectors carrying the sequences. Such methods are known, and WO 92/01047, WO 92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, and WO 95/15388 can be used as references.

[0171] Furthermore, techniques for obtaining human antibodies by panning with a human antibody phage library are known. For example, the variable region of a human antibody is expressed as a single chain antibody (scFv) on the phage surface using a phage display method, and phages that bind to the antigen can be selected. By analyzing the genes of selected phages, DNA sequences encoding the variable regions of human antibodies that bind to the antigen can be determined. If the DNA sequences of scFvs that bind to the antigen are identified, appropriate expression vectors comprising these sequences can be constructed to obtain human antibodies. Such methods are well known. Reference can be made to WO 92/01047, WO 92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, WO 95/15388, and such.

[0172] The antibodies of the present invention include not only divalent antibodies as represented by IgG, but also monovalent antibodies, multivalent antibodies as represented by IgM. In addition, the antibodies of the present invention also include bispecific antibodies capable of binding to different antigens.

[0173] Antibodies of the present invention include not only whole antibody molecules but also any antigen-binding fragments such as low-molecular-weight antibodies.

[0174] Antibodies of the present invention also include modified antibodies that are linked to cytotoxic substances. Antibodies of the present invention also include those with altered sugar chains.

[0175] Low-molecular-weight antibodies (minibodies) included in antigen-binding fragments of the present invention are antibodies comprising an antibody fragment that lacks part of a whole antibody (for example, whole IgG, etc.). The minibodies are not particularly limited, as long as they have the activity to bind to a fusion polypeptide of the present invention.

[0176] Minibodies of the present invention are not particularly limited, as long as they comprise a portion of a whole antibody. It is however preferable that the minibodies comprise an antigen-binding domain. In general, the antigen-binding domain is antibody CDR, and is preferably six CDRs of an antibody. Thus, the preferred antigen-binding domains include, for example, six CDRs of an antibody and antibody variable regions (heavy chain and/or light chain variable regions).

[0177] The minibodies of the present invention preferably have a smaller molecular weight than whole antibodies. However, the minibodies may form multimers, for example, dimers, trimers, or tetramers, and thus their molecular weights can be greater than those of whole antibodies.

[0178] Other specific examples of the antigen-binding molecule fragments include, for example, Fab, Fab', F(ab').sub.2, and Fv. Meanwhile, specific examples of low-molecular-weight antibodies include, for example, Fab, Fab', F(ab')2, Fv, scFv (single chain Fv), diabodies, and sc(Fv)2 (single chain (Fv)2). Multimers (for example, dimers, trimers, tetramers, and polymers) of these antibodies are also included in the low-molecular-weight antibodies of the present invention.

[0179] Antigen-binding fragments can be obtained, for example, by treating antibodies with enzymes to produce antibody fragments. Enzymes known to generate antibody fragments include, for example, papain, pepsin, and plasmin. Alternatively, a gene encoding such an antibody fragment can be constructed, introduced into an expression vector, and expressed in appropriate host cells (see, for example, Co, M. S. et al., J. Immunol. (1994) 152, 2968-2976; Better, M. & Horwitz, A. H. Methods in Enzymology (1989) 178, 476-496; Plueckthun, A. & Skerra, A. Methods in Enzymology (1989) 178, 476-496; Lamoyi, E., Methods in Enzymology (1989) 121, 652-663; Rousseaux, J. et al., Methods in Enzymology (1989) 121, 663-669; Bird, R. E. et al., TIBTECH (1991) 9, 132-137).

[0180] Digestive enzymes cleave at a specific site in an antibody fragment, yielding antibody fragments of specific structures shown below. Genetic engineering techniques can be applied to such enzymatically-obtained antibody fragments to delete an arbitrary portion of the antibody.

[0181] Antibody fragments obtained by using the above-described digestive enzymes are as follows:

Papain digestion: F(ab)2 or Fab Pepsin digestion: F(ab')2 or Fab' Plasmin digestion: Facb

[0182] The minibodies of the present invention include antibody fragments lacking an arbitrary region, as long as they have the activity to bind to a fusion polypeptide of the present invention.

[0183] "Diabody" refers to a bivalent antibody fragment constructed by gene fusion (Holliger P et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993); EP 404,097; WO 93/11161, etc.). Diabodies are dimers composed of two polypeptide chains. In each of the polypeptide chains forming a dimer, a VL and a VH are usually linked by a linker in the same chain. In general, the linker in a diabody is short enough such that the VL and VH cannot bind to each other. Specifically, the number of amino acid residues constituting the linker is, for example, about five residues. Thus, the VL and VH encoded on the same polypeptide cannot form a single-chain variable region fragment, and will form a dimer with another single-chain variable region fragment. As a result, the diabody has two antigen binding sites.

[0184] scFv antibodies are single-chain polypeptides produced by linking a heavy chain variable region ([VH]) to a light chain variable region ([VL]) via a linker or such (Huston, J. S. et al., Proc. Natl. Acad. Sci. U.S.A. (1988) 85, 5879-5883; Plickthun "The Pharmacology of Monoclonal Antibodies" Vol. 113, eds., Resenburg and Moore, Springer Verlag, New York, pp. 269-315, (1994)). The H-chain V region and L-chain V region of scFv may be derived from any antibody described herein. The peptide linker for linking the V regions is not particularly limited. For example, an arbitrary single-chain peptide containing about three to 25 residues can be used as a linker. Specifically, it is possible to use the peptide linkers or such described below.

[0185] The V regions of both chains can be linked, for example, by PCR as described above. To link the V regions by PCR, first, a DNA from the DNAs below that encodes a complete or desired partial amino acid sequence is used as a template:

DNA sequence encoding an H chain or H-chain V region of an antibody, and DNA sequence encoding an L chain or L-chain V region of an antibody.

[0186] DNAs encoding the H-chain and L-chain V regions are amplified by PCR using a pair of primers having sequences corresponding to sequences at both ends of the DNA to be amplified. Then, a DNA encoding the peptide linker portion is prepared. The peptide linker-encoding DNA can also be synthesized by PCR. Here, nucleotide sequences that can be ligated to the amplification products of V regions synthesized separately are added to the 5' end of the primers to be used. Then, PCR is carried out using each DNA of the [H chain V region DNA]-[peptide linker DNA]-[L chain V region DNA], and assembly PCR primers.

[0187] The assembly PCR primers are composed of a combination of a primer that anneals to the 5' end of the [H chain V region DNA] and a primer that anneals to the 3' end of the [L chain V region DNA]. In other words, the assembly PCR primers are a set of primers that can be used to amplify DNA encoding the full-length sequence of an scFv to be synthesized. Meanwhile, nucleotide sequences that can be ligated to the V-region DNAs have been added to the [peptide linker DNA]. Thus, these DNAs are linked together, and then the whole scFv is ultimately generated as an amplification product by the assembly PCR primers. Once the scFv-encoding DNAs are generated, expression vectors carrying these DNAs and recombinant cells transformed with these expression vectors can be obtained by conventional methods. Furthermore, the scFv can be obtained by culturing the resulting recombinant cells to express the scFv-encoding DNAs.

[0188] The order of the heavy chain and light chain variable regions to be linked together is not particularly limited, and they may be arranged in any order. Examples of the arrangement are listed below.

[VH] linker [VL] [VL] linker [VH]

[0189] sc(Fv)2 is a single-chain low-molecular-weight antibody produced by linking two VHs and two VLs using linkers and such (Hudson et al., J Immunol. Methods 1999; 231: 177-189).

[0190] For example, sc(Fv)2 can be produced by linking scFvs via a linker.

[0191] Antibodies in which two VHs and two VLs are arranged in the order of VH, VL, VH, and VL ([VH] linker [VL] linker [VH] linker [VL]) from the N terminus of the single-chain polypeptide are preferred. However, the order of the two VHs and two VLs is not limited to the above arrangement, and they may be arranged in any order. Examples of the arrangement are listed below:

[VL] linker [VH] linker [VH] linker [VL] [VH] linker [VL] linker [VL] linker [VH] [VH] linker [VH] linker [VL] linker [VL] [VL] linker [VL] linker [VH] linker [VH] [VL] linker [VH] linker [VL] linker [VH]

[0192] The amino acid sequence of the heavy chain variable region or light chain variable region in a low-molecular-weight antibody may contain a substitution, deletion, addition, and/or insertion. Furthermore, the heavy chain variable region and light chain variable region may also lack some portions or be added with other polypeptides, as long as they have antigen binding ability when linked together. Alternatively, the variable regions may be chimerized or humanized.

[0193] In the present invention, linkers which bind the variable regions of the antibody include arbitrary peptide linkers that can be introduced using genetic engineering, or synthetic linkers such as those disclosed in Protein Engineering, 9(3), 299-305, 1996.

[0194] The preferred linkers in the present invention are peptide linkers. The length of the peptide linkers is not particularly limited, and those skilled in the art can appropriately select the length depending on the purpose. A typical length is one to 100 amino acids, preferably 3 to 50 amino acids, more preferably 5 to 30 amino acids, and particularly preferably 12 to 18 amino acids (for example, 15 amino acids).

[0195] Amino acid sequences of such peptide linkers include, for example:

TABLE-US-00001 Ser; Gly.cndot.Ser; Gly.cndot.Gly.cndot.Ser; Ser.cndot.Gly.cndot.Gly; (SEQ ID NO: 19) Gly.cndot.Gly.cndot.Gly.cndot.Ser; (SEQ ID NO: 20) Ser.cndot.Gly.cndot.Gly.cndot.Gly; (SEQ ID NO: 21) Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Ser; (SEQ ID NO: 22) Ser.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly; (SEQ ID NO: 23) Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Ser; (SEQ ID NO: 24) Ser.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly; (SEQ ID NO: 25) Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Ser; (SEQ ID NO: 26) Ser.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly; (Gly.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Ser (SEQ ID NO: 21))n; and (Ser.cndot.Gly.cndot.Gly.cndot.Gly.cndot.Gly (SEQ ID NO: 22))n,

where n is an integer of 1 or larger.

[0196] The amino acid sequence of a peptide linker can be appropriately selected by those skilled in the art according to the purpose. For example, the above-mentioned "n", which determines the length of the peptide linker, is usually 1 to 5, preferably 1 to 3, and more preferably 1 or 2.

[0197] Synthetic linkers (chemical crosslinking agents) include crosslinking agents that are routinely used to crosslink peptides, for example, N-hydroxy succinimide (NHS), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BS3), dithiobis(succinimidyl propionate) (DSP), dithiobis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfo-EGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidoxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidoxycarbonyloxy)ethyl] sulfone (sulfo-BSOCOES). These crosslinking agents are commercially available.

[0198] When four antibody variable regions are linked, three linkers are usually required. Such multiple linkers may be the same or different.

[0199] The antibodies of the present invention include antibodies in which one or more amino acid residues have been added to the amino acid sequence of an antibody of the present invention. Further, fusion proteins which result from a fusion between one of the above antibodies and a second peptide or protein is included in the present invention. The fusion proteins can be prepared by ligating a polynucleotide encoding an antibody of the present invention with a polynucleotide encoding a second peptide or polypeptide in frame, inserting this into an expression vector, and expressing the fusion construct in a host. Some techniques known to those skilled in the art are available for this purpose. The partner peptide or polypeptide to be fused with an antibody of the present invention may be a known peptide, for example, FLAG (Hopp, T. P. et al., BioTechnology 6, 1204-1210 (1988)), 6.times.His consisting of six His (histidine) residues, 10.times.His, influenza hemagglutinin (HA), human c-myc fragment, VSV-GP fragment, p18HIV fragment, T7-tag, HSV-tag, E-tag, SV40 T antigen fragment, lck tag, .alpha.-tubulin fragment, B-tag, Protein C fragment, Stag, StrepTag, HaloTag. Other partner polypeptides to be fused with the antibodies of the present invention include, for example, GST (glutathione-S-transferase), HA (influenza hemagglutinin), immunoglobulin constant region, .beta.-galactosidase, and MBP (maltose-binding protein). A polynucleotide encoding one of these commercially available peptides or polypeptides can be fused with a polynucleotide encoding an antibody of the present invention. The fusion polypeptide can be prepared by expressing the fusion construct.

[0200] Furthermore, the antibodies of the present invention may be conjugated antibodies which are linked to any of various molecules including polymeric substances such as polyethylene glycol (PEG) and hyaluronic acid, radioactive substances, fluorescent substances, luminescent substances, enzymes, and toxins. Such conjugated antibodies can be obtained by chemically modifying the obtained antibodies. Methods for modifying antibodies have been established in this field (for example, U.S. Pat. Nos. 5,057,313 and 5,156,840). The "antibodies" of the present invention also include such conjugated antibodies.

[0201] Furthermore, the antibodies used in the present invention may be bispecific antibodies. The bispecific antibody refers to an antibody that has variable regions recognizing different epitopes in the same antibody molecule. In the present invention, the bispecific antibodies may recognize different epitopes on the fusion polypeptide molecule of the present invention, or recognize the fusion polypeptide of the present invention with one antigen-binding site and a different substance with the other antigen-binding site.

[0202] Methods for producing bispecific antibodies are known. Bispecific antibodies can be prepared, for example, by linking two antibodies that recognize different antigens. Antibodies to be linked together may be half molecules each of which contains an H chain and an L chain, or quarter molecules that consist of only one H chain. Alternatively, hybridomas producing different monoclonal antibodies can be fused to produce a bispecific antibody-producing fused cell. Furthermore, bispecific antibodies can be produced by genetic engineering techniques.

[0203] The antibodies of the present invention may differ in amino acid sequence, molecular weight, isoelectric point, presence/absence of sugar chains, and conformation depending on the cell or host producing the antibody or the purification method as described below. However, a resulting antibody is included in the present invention, as long as it is functionally equivalent to an antibody of the present invention. For example, when an antibody of the present invention is expressed in prokaryotic cells, for example E. coli, a methionine residue is added to the N terminus of the original antibody amino acid sequence. Such antibodies are included in the present invention.

[0204] Antibodies of the present invention may be antibodies with altered sugar chains. Methods for modifying antibody sugar chains are known to those skilled in the art, and include, for example, methods for improving ADCC by modifying antibody glycosylation, methods for adjusting ADCC by the presence or absence of fucose in antibody sugar chains, methods for preparing antibodies having sugar chains that do not contain .alpha.-1,6 core fucose by producing antibodies in YB2/0 cells, and methods for adding sugar chains having bisecting GlcNAc (WO 99/54342; WO 00/61739; WO 02/31140; WO 02/79255, etc.).

[0205] Antibodies of the present invention can be produced by known methods using as an immunogen a fusion polypeptide of the present invention (derived from mammals such as humans and mice) or a fragment thereof. Specifically, non-human mammals are immunized by a known immunization method, using as a sensitizing antigen a desired antigen or cells expressing a desired antigen. Immune cells prepared from the immunized animals are fused with known parental cells by a general cell fusion method. The resulting monoclonal antibody-producing cells (hybridomas) are sorted by general screening methods, and monoclonal antibodies are prepared by culturing the cells.

[0206] Non-human mammals to be immunized include, for example, animals such as mice, rats, rabbits, sheep, monkeys, goats, donkeys, cows, horses, and pigs. The antigen can be prepared using a polynucleotide encoding the fusion polypeptide of the present invention according to known methods, for example, by methods using baculovirus (for example, WO 98/46777) or such.

[0207] Hybridomas can be prepared, for example, according to the method of Milstein et al. (Kohler, G. and Milstein, C., Methods Enzymol. (1981) 73: 3-46) or such. When the immunogenicity of an antigen is low, immunization may be performed after linking the antigen with a macromolecule having immunogenicity, such as albumin.

[0208] In an embodiment, antibodies that bind to the fusion polypeptides of the present invention include monoclonal antibodies that bind to the fusion polypeptides of the present invention. Immunogens for preparing monoclonal antibodies having binding activity to a fusion polypeptide of the present invention are not particularly limited, as long as antibodies having binding activity to the fusion polypeptide of the present invention can be prepared. It is possible to use as an immunogen, for example, a wild-type fusion polypeptide or a fragment peptide thereof, or a polypeptide obtained by adding an artificial mutation into a wild-type fusion polypeptide.

[0209] Meanwhile, the activity of an antibody to bind to a fusion polypeptide of the present invention can be assayed by methods known to those skilled in the art.

[0210] Meanwhile, monoclonal antibodies can also be obtained by DNA immunization. DNA immunization is a method in which a vector DNA constructed such that an antigen protein-encoding gene can be expressed in an animal to be immunized is administered to the animal, and the immunogen is expressed within the body of the animal to provide immunostimulation. As compared to common immunization methods based on the administration of protein antigens, DNA immunization is expected to be advantageous in that:

[0211] it enables immunostimulation while retaining the structure of a membrane protein; and

[0212] the immunogen does not need to be purified.

[0213] In order to obtain monoclonal antibodies by DNA immunization, first, a polynucleotide encoding a fusion polypeptide of the present invention is administered to an animal to be immunized. The polynucleotide encoding a fusion polypeptide of the present invention can be synthesized according to an above-described method by known techniques such as PCR. The resulting DNA (polynucleotide) is inserted into an appropriate expression vector and then administered to an animal to be immunized. The expression vector includes any vectors described above (for example, commercially available expression vectors such as pcDNA3.1). Vectors can be administered to a living body by commonly used methods. For example, DNA immunization can be performed, for example, by using a gene gun to inject gold particles immobilized with an expression vector into cells. A preferred method for obtaining monoclonal antibodies is to perform booster immunization with cells expressing the fusion polypeptide of the present invention after DNA immunization.

[0214] Once the mammal is immunized as described above and the serum level of a desired antibody is confirmed to be increased, immune cells are collected from the mammal and subjected to cell fusion. Preferred immune cells are spleen cells in particular.

[0215] Mammalian myeloma cells are used for fusion with the above immune cells. It is preferred that myeloma cells have appropriate selection markers for screening. The selection marker refers to a phenotype that allows (or does not allow) survival under particular culture conditions. Known selection markers include hypoxanthine-guanine-phosphoribosyltransferase deficiency (hereinafter abbreviated as "HGPRT deficiency") and thymidine kinase deficiency (hereinafter abbreviated as "TK deficiency"). HGPRT- or TK-deficient cells exhibit hypoxanthine-aminopterin-thymidine sensitivity (hereinafter abbreviated as "HAT sensitivity"). In HAT selection medium, HAT-sensitive cells cannot synthesize DNA and thus will die. However, when fused with normal cells, they can continue to synthesize DNA via the salvage pathway of the normal cells and thus can grow even in HAT selection medium. HGPRT- or TK-deficient cells can be selected using a medium containing 6-thioguanine, 8-azaguanine (hereinafter abbreviated as "8AG"), or 5'-bromodeoxyuridine. While normal cells are killed due to incorporation of these pyrimidine analogs into DNA, cells lacking these enzymes can survive in the selection medium because they cannot incorporate these pyrimidine analogs. Another selection marker called G418 resistance confers resistance to 2-deoxystreptamine antibiotics (gentamicin analogs) due to the neomycin resistance gene. Various myeloma cells suitable for cell fusion are known.

[0216] Cell fusion between immune cells and myeloma cells can be essentially carried out according to known methods, for example, the method by Kohler and Milstein et al. (Kohler. G. and Milstein, C., Methods Enzymol. (1981) 73, 3-46).

[0217] More specifically, cell fusion can be carried out, for example, in a common culture medium in the presence of a cell fusion-promoting agent. The fusion-promoting agent includes, for example, polyethylene glycol (PEG) and Sendai virus (HVJ). If required, an auxiliary agent such as dimethyl sulfoxide may also be added to improve fusion efficiency.

[0218] The immune cells and myeloma cells may be used at an arbitrarily determined ratio. For example, the ratio of immune cells to myeloma cells is preferably from 1 to 10. Culture media to be used for cell fusion include, for example, media that are suitable for the cell growth of myeloma cell line, such as RPMI1640 and MEM, and other common culture media used for this type of cell culture. In addition, the culture media may also be supplemented with serum supplement such as fetal calf serum (FCS).

[0219] Predetermined amounts of immune cells and myeloma cells are mixed well in the culture medium, and then mixed with a PEG solution pre-heated to about 37.degree. C. to produce fused cells (hybridomas). In the cell fusion method, for example, PEG with mean molecular weight of about 1,000-6,000 can be added to the cells typically at a concentration of 30% to 60% (w/v). Then, successive addition of the appropriate culture medium listed above and removal of supernatant by centrifugation are repeated to eliminate the cell fusion agent and such, which are unfavorable to the growth of hybridomas.

[0220] The resulting hybridomas can be screened using a selection medium according to the selection marker possessed by myeloma cells used in the cell fusion. For example, HGPRT- or TK-deficient cells can be screened by culturing them in a HAT medium (a medium containing hypoxanthine, aminopterin, and thymidine). Specifically, when HAT-sensitive myeloma cells are used in cell fusion, cells successfully fused with normal cells can be selectively grown in the HAT medium. The cell culture using the above HAT medium is continued for a sufficient period of time to allow all cells except the desired hybridomas (non-fused cells) to die. Specifically, in general, the desired hybridomas can be selected by culturing the cells for several days to several weeks. Then, screening and single cloning of hybridomas that produce an antibody of interest can be carried out by performing ordinary limiting dilution methods.

[0221] Screening and single cloning of an antibody of interest can be suitably carried out by known screening methods based on antigen-antibody reaction. For example, an antigen is bound to a carrier such as beads made of polystyrene or such and commercially available 96-well microtiter plates, and then reacted with the culture supernatant of hybridoma. Next, the carrier is washed and then reacted with an enzyme-labeled secondary antibody or such. When the culture supernatant contains an antibody of interest reactive to the sensitizing antigen, the secondary antibody binds to the carrier via this antibody. Finally, the secondary antibody bound to the carrier is detected to determine whether the culture supernatant contains the antibody of interest. Hybridomas producing a desired antibody capable of binding to the antigen can be cloned by the limiting dilution method or such.

[0222] In addition to the above-described method for preparing hybridomas through immunization of a nonhuman animal with an antigen, antibodies of interest can also be obtained by sensitizing human lymphocytes with an antigen. Specifically, first, human lymphocytes are sensitized with the fusion polypeptide of the present invention in vitro. Then, the sensitized lymphocytes are fused with an appropriate fusion partner. For example, human-derived myeloma cells with the ability to divide permanently can be used as the fusion partner (see JP-B (Kokoku) HO1-59878). Antibodies obtained by this method are human antibodies having an activity of binding to the fusion polypeptide of the present invention.

[0223] The nucleotide sequence encoding an antibody that binds to the fusion polypeptide of the present invention obtained by the above-described method or such, and its amino acid sequence can be obtained by methods known to those skilled in the art.

[0224] Based on the obtained sequence of the antibody that binds to the fusion polypeptide of the present invention, the antibody that binds to the fusion polypeptide of the present invention can be prepared by genetic recombination techniques known to those skilled in the art. Specifically, a polynucleotide encoding an antibody can be constructed based on the sequence of the antibody that recognizes the fusion polypeptides of the present invention, inserted into an expression vector, and then expressed in appropriate host cells (see for example, Co, M. S. et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, A. H., Methods Enzymol. (1989) 178, 476-496; Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, E., Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al., Methods Enzymol. (1986) 121, 663-669; Bird, R. E. and Walker, B. W., Trends Biotechnol. (1991) 9, 132-137).

[0225] The vectors include M13 vectors, pUC vectors, pBR322, pBluescript, and pCR-Script. Alternatively, when aiming to subclone and excise cDNA, the vectors include, for example, pGEM-T, pDIRECT, and pT7, in addition to the vectors described above. Expression vectors are particularly useful when using vectors for producing the antibodies of the present invention. For example, when aiming for expression in E. coli such as JM109, DH5.alpha., HB101, and XL1-Blue, the expression vectors not only have the above-described characteristics that allow vector amplification in E. coli, but must also carry a promoter that allows efficient expression in E. coli, for example, lacZ promoter (Ward et al., Nature (1989) 341, 544-546; FASEB J. (1992) 6, 2422-2427), araB promoter (Better et al., Science (1988) 240, 1041-1043), T7 promoter or such. Such vectors include pGEX-5X-1 (Pharmacia), "QIAexpress system" (Qiagen), pEGFP, or pET (in this case, the host is preferably BL21 that expresses T7 RNA polymerase) in addition to the vectors described above.

[0226] The vectors may contain signal sequences for antibody secretion. As a signal sequence for antibody secretion, a pelB signal sequence (Lei, S. P. et al J. Bacteriol. (1987) 169, 4379) may be used when a protein is secreted into the E. coli periplasm. The vector can be introduced into host cells by calcium chloride or electroporation methods, for example.

[0227] In addition to vectors for E. coli, the vectors for producing the antibodies of the present invention include mammalian expression vectors (for example, pcDNA3 (Invitrogen), pEF-BOS (Nucleic Acids. Res. 1990, 18(17), p5322), pEF, and pCDM8), insect cell-derived expression vectors (for example, the "Bac-to-BAC baculovirus expression system" (Gibco-BRL) and pBacPAK8), plant-derived expression vectors (for example, pMH1 and pMH2), animal virus-derived expression vectors (for example, pHSV, pMV, and pAdexLcw), retroviral expression vectors (for example, pZIPneo), yeast expression vectors (for example, "Pichia Expression Kit" (Invitrogen), pNV11, and SP-Q01), and Bacillus subtilis expression vectors (for example, pPL608 and pKTH50), for example.

[0228] When aiming for expression in animal cells such as CHO, COS, and NIH3T3 cells, the vectors must have a promoter essential for expression in cells, for example, SV40 promoter (Mulligan et al., Nature (1979) 277, 108), MMLV-LTR promoter, EFla promoter (Mizushima et al., Nucleic Acids Res. (1990) 18, 5322), and CMV promoter, and more preferably they have a gene for selecting transformed cells (for example, a drug resistance gene that allows evaluation using an agent (neomycin, G418, or such)). Vectors with such characteristics include pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV, and pOP13, for example.

[0229] In addition, the following method can be used for stable gene expression and gene amplification in cells: CHO cells deficient in a nucleic acid synthesis pathway are introduced with a vector (for example, pSV2-dhfr ("Molecular Cloning 2.sup.nd edition", Cold Spring Harbor Laboratory Press, 1989)) that carries a DHFR gene which compensates for the deficiency, and the vector is amplified using methotrexate (MTX). Alternatively, the following method can be used for transient gene expression: COS cells with a gene expressing SV40 T antigen on their chromosome are transformed with a vector (pcD and such) with an SV40 replication origin. Replication origins derived from polyoma virus, adenovirus, bovine papilloma virus (BPV), and such can also be used. To amplify gene copy number in host cells, the expression vectors may further carry selection markers such as aminoglycoside transferase (APH) gene, thymidine kinase (TK) gene, E. coli xanthine-guanine phosphoribosyltransferase (Ecogpt) gene, and dihydrofolate reductase (dhfr) gene.

[0230] The antibodies of the present invention obtained by the methods described above can be isolated from inside host cells or from outside the cells (the medium, or such), and purified to homogeneity. The antibodies can be isolated and purified by methods routinely used for isolating and purifying antibodies, and the type of method is not limited. For example, the antibodies can be isolated and purified by appropriately selecting and combining column chromatography, filtration, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectrofocusing, dialysis, recrystallization, and such.

[0231] The chromatographies include, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996). The chromatographic methods described above can be conducted using liquid chromatography, for example, HPLC and FPLC. Columns that can be used for affinity chromatography include protein A columns and protein G columns. Columns using protein A include, for example, Hyper D, POROS, and Sepharose FF (GE Amersham Biosciences). The present invention includes antibodies that are highly purified using these purification methods.

[0232] The binding activity to the fusion polypeptide of the present invention of the obtained antibodies can be determined by methods known to those skilled in the art. Methods for determining the antigen-binding activity of an antibody include, for example, ELISA (enzyme-linked immunosorbent assay), EIA (enzyme immunoassay), RIA (radioimmunoassay), and fluorescent antibody method. For example, when enzyme immunoassay is used, antibody-containing samples, such as purified antibodies and culture supernatants of antibody-producing cells, are added to antigen-coated plates. A secondary antibody labeled with an enzyme, such as alkaline phosphatase, is added and the plates are incubated. After washing, an enzyme substrate, such as p-nitrophenyl phosphate, is added, and the absorbance is measured to evaluate the antigen-binding activity.

[0233] In the present invention, "cancer" generally refers to malignant neoplasm which may be metastatic or non-metastatic. For instance, non-limiting examples of cancer that develops from epithelial tissues such as gastrointestinal tract and skin include brain tumor, skin cancer, head and neck cancer, esophageal cancer, lung cancer, gastric cancer, duodenal cancer, breast cancer, prostate cancer, cervical cancer, cancer of uterine body, pancreatic cancer, liver cancer, colorectal cancer, colon cancer, bladder cancer, and ovarian cancer. Meanwhile, non-limiting examples of sarcoma that develops from non-epithelial tissues (stroma) such as muscles include osteosarcoma, chondrosarcoma, rhabdomyosarcoma, leiomyosarcoma, liposarcoma, and angiosarcoma. Furthermore, non-limiting examples of hematological cancer derived from hematopoietic organs include malignant lymphoma including Hodgkin's lymphoma and non-Hodgkin's lymphoma, leukemia including acute myelocytic leukemia, chronic myelocytic leukemia, acute lymphatic leukemia, and chronic lymphatic leukemia, and multiple myeloma.

[0234] In the present invention, cancer includes any newly developed pathological tissue tumor (neoplasm). In the present invention, neoplasm leads to tumor formation which is characterized by partial neovascularization. Neoplasm can be benign, for example, angioma, glioma, and teratoma, or malignant, for example, cancer, sarcoma, glial tumor, astrocytoma, neuroblastoma, and retinoblastoma.

[0235] In the present invention, preferred examples of cancer include bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, and liver cancer.

[0236] In the present invention, "cancer tissue" refers to a tissue containing at least one cancer cell. For example, as cancer tissues contain cancer cells and blood vessels, cancer tissue refers to all cell types that contribute to the formation of tumor mass containing cancer cells and endothelial cells. Herein, tumor mass refers to foci of tumor tissue. The term "tumor" is generally used to refer to benign or malignant neoplasm.

[0237] The present invention relates to pharmaceutical compositions comprising an above-described antibody or antigen-binding fragment thereof, or oligonucleotides of the present invention.

[0238] In the present invention, the pharmaceutical composition generally refers to a pharmaceutical agent for treating, preventing, or examining/diagnosing diseases.

[0239] The pharmaceutical compositions of the present invention can be formulated by methods known to those skilled in the art. For example, they can be used parenterally, in an injectable form of sterile solutions or suspensions including water or other pharmaceutically acceptable liquid. For example, such compositions may be formulated by mixing in a unit dose form required by the generally approved pharmaceutical manufacturing practice, by appropriately combining with pharmacologically acceptable carriers or media, specifically sterile water, physiological saline, vegetable oil, emulsifier, suspension, surfactant, stabilizer, flavoring agent, excipient, vehicle, preservative, binder, or such. The amount of active ingredient in such formulations is adjusted so that an appropriate amount can be obtained within a specified range.

[0240] Sterile compositions for injection can be formulated according to general formulation practice using vehicles such as distilled water for injection. Aqueous solutions for injection include, for example, physiological saline, and isotonic solutions containing glucose or other adjuvants (e.g., D-sorbitol, D-mannnose, D-mannitol, and sodium chloride). These can be used in combination with appropriate solubilizers, for example, alcohol (ethanol, etc.), polyalcohol (propylene glycol, polyethylene glycol, etc.), and non-ionic detergents (Polysorbate 80.sup.M, HCO-50, etc.).

[0241] Oils include sesame oil and soybean oils. Benzyl benzoate and/or benzyl alcohol can be used in combination as solubilizers. It is also possible to combine buffers (for example, phosphate buffer and sodium acetate buffer), soothing agents (for example, procaine hydrochloride), stabilizers (for example, benzyl alcohol and phenol), and/or antioxidants. Appropriate ampules are filled with the prepared injections.

[0242] The pharmaceutical compositions of the present invention are preferably administered parenterally. For example, compositions are administered in an injectable form, or in a form for transnasal administration, transpulmonary administration, or transdermal administration. For example, they can be administered systemically or locally by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, or such.

[0243] Administration methods can be appropriately selected in consideration of the patient's age and symptoms. The dose of a pharmaceutical composition containing an antigen-binding molecule may be, for example, 0.0001 mg to 1,000 mg/kg for each administration. Alternatively, the dose may be, for example, 0.001 to 100,000 mg per patient. However, the present invention is not limited by the numeric values described above. The dosage and administration method vary according to the patient's weight, age, symptoms, and such. Those skilled in the art can set an appropriate dosage and administration method in consideration of the factors described above.

[0244] Amino acids in the amino acid sequences described herein may be modified after translation (for example, modification of N-terminal glutamine into pyroglutamic acid by pyroglutamylation is well known to those skilled in the art). As a matter of course, such posttranslationally modified amino acids are also included in the amino acid sequences of the present invention.

[0245] The present invention also relates to methods for detecting an above-described fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide in samples from subjects (including cancer patients and healthy persons).

[0246] The presence or absence of a fusion polypeptide of the present invention in a sample from a subject can be tested and determined, for example, using antigen-antibody reaction which is performed by contacting an above-described antibody or antigen-binding fragment thereof that binds to a fusion polypeptide of the present invention with a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, ascites, pleural effusion, etc.)) collected from a subject (cancer patient, person who may be affected with cancer, person with the risk of getting cancer, or healthy person; however, it is not limited to human).

[0247] The antigen (i.e., a fusion polypeptide of the present invention) in an antigen-antibody reaction can be detected, for example, by using conventional immunoassay.

[0248] In the present invention, immunoassay refers to a method for detecting a fusion polypeptide of the present invention in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, ascites, pleural effusion, etc.)) based on the reaction mechanism between an antigen (i.e., a fusion polypeptide of the present invention) and an antibody that binds to the antigen or antigen-binding fragment thereof. Any immunoassay is included in the present invention as long as it is a method that can detect the fusion polypeptides of the present invention.

[0249] For immunoassay in the present invention, for example, the principles of various methods such as those described in "Kouso Men-eki Sokutei Hou (Enzyme immunoassay)" (3rd Ed., eds., Eiji Ishikawa et al., Igakushoin, 1987) can be applied. Specifically, these various methods can be carried out using one or more antibodies that bind to an antigen of interest to capture (trap) the antigen to be detected in a sample.

[0250] Applicable principles preferably include, for example, single antibody solid phase methods, double antibody liquid phase methods, double antibody solid phase methods, sandwich methods, and one-pot methods such as described in JP-B (Kokoku) H02-39747. Meanwhile, assays based on antigen-antibody reaction also include enzyme multiplied immunoassay technique (EMIT), enzyme channeling immunoassay, enzyme modulator mediated enzyme immunoassay (EMMIA), enzyme inhibitor immunoassay, immunoenzymometric assay, enzyme enhanced immunoassay, and proximal linkage immunoassay.

[0251] In the present invention, it is possible to select and use any appropriate immunoassay principle such as those described above depending on the objective of the test.

[0252] The immunoassays of the present invention also include sandwich methods using a biotin- or enzyme-labeled antibody, and multi-well microtiter plates having a number of wells including 96-well microplate, as well as one-pot methods using beads and antibodies labeled with biotin or enzyme such as peroxidase.

[0253] As described above, antibodies that bind to a fusion polypeptide of the present invention or antigen-binding fragments thereof, which are used in immunoassays of the present invention, may be labeled with a labeling substance that can provide a detectable signal by itself or upon reaction with other substances.

[0254] Such labeling substances include, for example, enzymes, fluorescent substances, chemiluminescent substances, biotin, avidin, and radioisotopes. More specifically, the substances include enzymes such as peroxidase (e.g., horseradish peroxidase), alkaline phosphatase, .beta.-D-galactosidase, glucose oxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, malate dehydrogenase, penicillinase, catalase, apoglucoseoxidase, urease, luciferase, and acetylcholinesterase; fluorescent substances such as fluorescein isothiocyanate, phycobiliprotein, rare earth metal chelates, dansyl chloride, and tetramethylrhodamine isothiocyanate; radioisotopes such as .sup.3H, .sup.14C, .sup.125I, and .sup.131I; biotin; avidin; and chemiluminescent substances.

[0255] Such radioisotopes and fluorescent substances can provide a detectable signal by themselves.

[0256] Meanwhile, enzymes, chemiluminescent substances, biotin, and avidin cannot provide any detectable signal by themselves, but provide a detectable signal when reacting with one or more different substances.

[0257] For example, when an enzyme is used, at least a substrate is necessary. Various substrates are used according to the type of enzymatic activity assay method (colorimetric assay, fluorescent assay, bioluminescence assay, chemiluminescent assay, etc.). For example, hydrogen peroxide is used as a substrate for peroxidase. Meanwhile, biotin is generally reacted with at least avidin or enzyme-modified avidin, but substrates are not limited thereto. If needed, it is also possible to use various chromogenic substances according to the substrates.

[0258] The presence or absence of a polynucleotide encoding a fusion polypeptide of the present invention in a sample from a subject can be tested and determined, for example, according to routine methods using various oligonucleotides (a pair of oligonucleotide primers, oligonucleotide probes, etc.) of the present invention described above, and mRNA, cDNA prepared using mRNA as a template, genomic DNA, or such in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, ascites, pleural effusion, etc.)) collected from a subject (cancer patient, person who may be affected with cancer, person with the risk of getting cancer, or healthy person; however, it is not limited to human) by using various gene analysis methods. Such gene analysis methods include, for example, Northern blotting, polymerase chain reaction (PCR), Southern blotting, ligase chain reaction (LCR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN), loop-mediated isothermal amplification (LAMP), TMA method (Gen-Probe's TMA system), microarray, and next-generation sequencing method.

[0259] In these assays, oligonucleotides of the present invention are hybridized to a polynucleotide encoding a fusion polypeptide of the present invention derived from a sample. Desired stringent conditions for such hybridization include, for example, the conditions of 6 M urea, 0.4% SDS, 0.5.times.SSC, and 37.degree. C.; and hybridization conditions of equivalent stringency. Depending on the objective, it is possible to use more stringent conditions, for example, 6 M urea, 0.4% SDS, and 0.1.times.SSC, and 42.degree. C.

[0260] The present invention also relates to kits for detecting an above-described fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide in samples from subjects described above (including cancer patients and healthy persons).

[0261] Specifically, detection kits of the present invention may contain an above-described antibody or antigen-binding fragment thereof that binds to a fusion polypeptide of the present invention (including antibodies or antigen-binding fragments thereof labeled with above-described various labeling substances). Depending on the objective of each immunoassay described above, the kits may also contain various detection reagents (enzymes, substrates, etc.) and instruction manuals.

[0262] Specifically, detection kits of the present invention may contain various oligonucleotides of the present invention described above (a pair of oligonucleotide primers, oligonucleotide probes, etc.) that hybridize to mRNA derived from a polynucleotide encoding an above-described fusion polypeptide of the present invention, cDNA prepared using the mRNA as template, or genomic DNA. According to the objective of each gene analysis, the kits may also contain various reagents (enzymes, other oligonucleotides, nucleic acid, reaction buffer, etc.) and instruction manuals.

[0263] The present invention also relates to methods for testing cancer susceptibility of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject based on the presence or absence of a fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide in a sample isolated from the subject.

[0264] Specifically, the methods of the present invention include methods for testing cancer susceptibility of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject by testing/determining the presence or absence of a fusion polypeptide of the present invention in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, etc.)) collected from the subject (cancer patient, person who may be affected with cancer, person with the risk of getting cancer, or healthy person; however, it is not limited to human) using the above-described methods and kits for detecting the fusion polypeptide of the present invention, wherein the method is based on the criterion that a subject is more likely to develop cancer, is affected with cancer, or has progressed cancer when the fusion polypeptide is detected.

[0265] In addition, the methods of the present invention include methods of testing cancer susceptibility of a subject, whether a subject is affected with cancer, or whether cancer has progressed in a subject by testing/determining the presence or absence of a polynucleotide encoding a fusion polypeptide of the present invention in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, etc.)) collected from the subject (cancer patient, person who may be affected with cancer, person with the risk of getting cancer, or healthy person; however, it is not limited to human) using the above-described methods and kits for detecting the polynucleotide encoding the fusion polypeptide of the present invention, wherein the method is based on the criterion that a subject is more likely to develop cancer, is affected with cancer, or has progressed cancer when the polynucleotide encoding the fusion polypeptide is detected.

[0266] The present invention also relates to methods for selecting a patient to which an anticancer agent (as described below) comprising a compound having FGFR inhibitory activity is applicable, based on the presence or absence of a fusion polypeptide of the present invention or a polynucleotide encoding a fusion polypeptide in a sample isolated from a subject.

[0267] Specifically, the methods of the present invention include methods that test/determine the presence or absence of a fusion polypeptide of the present invention in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, etc.)) collected from the subject (cancer patient or person who may be affected with cancer; however, it is not limited to human) using the above-described methods and kits for detecting the fusion polypeptide of the present invention, and select a subject as a patient to which an anticancer agent (as described below) comprising a compound having FGFR inhibitory activity is applicable when the fusion polypeptide of the present invention is detected.

[0268] The methods of the present invention further include methods that test/determine the presence or absence of a polynucleotide encoding a fusion polypeptide of the present invention in a sample (tumor tissue, normal tissue, and various body fluid specimens containing cancer or normal cells (blood, serum, urine, saliva, etc.)) collected from a subject (cancer patient or person who may be affected with cancer; however, it is not limited to human) using the above-described methods and kits for detecting the polynucleotide encoding the fusion polypeptide of the present invention, and select a subject as a patient to which an anticancer agent (as described below) comprising a compound having FGFR inhibitory activity is applicable when a polynucleotide encoding the fusion polypeptide of the present invention is detected.

[0269] In the present invention, "FGFR inhibitor" and "compound having FGFR inhibitory activity" are used interchangeably, and refer to a compound having the activity of inhibiting the activity of the above-mentioned FGFR, specifically, one or more arbitrary FGFRs belonging to the FGFR family comprising FGFR1, FGFR2, FGFR3, and FGFR4, which are fibroblast growth factor receptors (FGFRs) belonging to the receptor tyrosine kinase family. Preferably, they refer to a compound having the activity of inhibiting human FGFR activity, and more preferably a compound having the activity of inhibiting the activity of human FGFR3 comprising the amino acid sequence of SEQ ID NO: 6 or 7 (cDNA sequences, SEQ ID NOs: 10 and 11, respectively/GenBank Accession Nos. NM_001163213.1 and NM 000142.4, respectively).

[0270] Any FGFR inhibitors are included in the FGFR inhibitors of the present invention as long as the compounds have the activity of inhibiting FGFR activity.

[0271] Specifically, the FGFR inhibitors of the present invention include any compounds, antibodies, nucleic acid pharmaceuticals (siRNA, antisense nucleic acids, ribozymes, and such) having an action mechanism of:

(1) inhibiting the FGFR kinase activity; (2) inhibiting dimerization between FGFR, TACC3, and BAIAP2L1; (3) inhibiting FGFR-mediated signaling (MAPK pathway and PI3K/AKT pathway) (for example, MEK inhibitors, RAF inhibitors, ERK inhibitors, PI3K inhibitors, mTOR inhibitors, AKT inhibitors, PDK inhibitors, S6K inhibitors, etc.); or (4) inhibiting FGFR expression (for example, siRNA, HSP90 inhibitors, etc.).

[0272] Antibodies having the activity of inhibiting FGFR activity, which are included as FGFR inhibitors of the present invention, comprise antibodies identified by the following code names: RG7444, FP-1039, AV370, and PRO-001.

[0273] Low-molecular-weight compounds having the activity of inhibiting FGFR activity, which are included as FGFR inhibitors of the present invention, include, for example:

(1) compounds disclosed in the following Patent Document and Non-patent Documents: Cancer Research, 2012, 72: 2045-2056; J. Med. Chem., 2011, 54: 7066-7083; International Publication WO 2011/016528; (2) compounds identified by the following generic names or code names: AZD-4547 (compound C in Table 2-1 described below), BGJ-398 (compound D in Table 2-2 described below), LY-2874455, cediranib (AZD2171; compound E in Table 2-2 described below), PD173074 (compound B in Table 2-1 described below), regorafenib, ponatinib, orantinib, nintedanib, masitinib, lenvatinib, dovitinib (TK1258; compound F in Table 2-2 described below), brivanib, volasertib, golvatinib, ENMD-2076, E-3810, XL-999, XL-228, ARQ087, Tivozanib, motesanib, and regorafenib; and (3) compounds exemplified below; however, FGFR inhibitors are not limited thereto:

##STR00011##

wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-4 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl;

<Group P>

[0274] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R.sub.16, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl;

<Group Q>

[0275] halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

##STR00012##

[0276] Herein, the "alkyl" refers to a monovalent group derived from an aliphatic hydrocarbon by removing an arbitrary hydrogen atom. It contains no heteroatom or unsaturated carbon-carbon bond in the backbone, and has a subset of hydrocarbyl or hydrocarbon group structures which contain hydrogen and carbon atoms. The alkyl group includes linear and branched structures. Preferred alkyl groups include alkyl groups with one to six carbon atoms (C.sub.1-6; hereinafter, "C.sub.p-q" means that the number of carbon atoms is p to q), C.sub.1-5 alkyl groups, C.sub.1-4 alkyl groups, and C.sub.1-3 alkyl groups.

[0277] Specifically, the alkyl includes, for example, methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, s-butyl group, t-butyl group, pentyl group, isopentyl group, 2,3-dimethylpropyl group, 3,3-dimethylbutyl group, and hexyl group.

[0278] Herein, "alkenyl" refers to a monovalent hydrocarbon group having at least one double bond (two adjacent SP2 carbon atoms), and includes those of linear and branched forms. Depending on the configuration of the double bond and substituents (if any), the geometry of the double bond can be of entgegen (E) or zusammen (Z), or cis or trans configuration. Preferred alkenyl groups include C.sub.2-6 alkenyl groups.

[0279] Specifically, the alkenyl includes, for example, vinyl group, allyl group, 1-propenyl group, 2-propenyl group, 1-butenyl group, 2-butenyl group (including cis and trans), 3-butenyl group, pentenyl group, and hexenyl group.

[0280] Herein, "alkynyl" refers to a monovalent hydrocarbon group having at least one triple bond (two adjacent SP carbon atoms), and includes those of linear and branched forms. Preferred alkynyl groups include C.sub.2-6 alkynyl groups.

[0281] Specifically, the alkynyl includes, for example, ethynyl group, 1-propynyl group, propargyl group, 3-butynyl group, pentynyl group, and hexynyl group.

[0282] The alkenyl and alkynyl may each have one, two or more double bonds or triple bonds.

[0283] Herein, "cycloalkyl" refers to a saturated or partially saturated cyclic monovalent aliphatic hydrocarbon group, and includes monocyclic groups, bicyclo rings, and spiro rings. Preferred cycloalkyl includes C.sub.3-7 cycloalkyl groups. Specifically, the cycloalkyl group includes, for example, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, and cycloheptyl group.

[0284] Herein, "cycloalkylalkyl" refers to a group in which an arbitrary hydrogen atom of an "alkyl" defined above is substituted with a "cycloalkyl" defined above. Preferred cycloalkylalkyl groups include C.sub.3-7 cycloalkylC.sub.1-3 alkyl, and specifically include, for example, cyclopropylmethyl group and cyclopropylethyl group.

[0285] Herein, "hetero atom" refers to a nitrogen atom (N), oxygen atom (O), or sulfur atom (S).

[0286] Herein, "halogen" refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom.

[0287] Herein, "haloalkyl" refers to a group in which preferably one to nine, more preferably one to five identical or different "halogen atoms" defined above are linked to an "alkyl" defined above.

[0288] Specifically, the haloalkyl includes, for example, chloromethyl group, dichloromethyl group, trichloromethyl group, fluoromethyl group, difluoromethyl group, perfluoroalkyl group (such as trifluoromethyl group and --CF.sub.2CF.sub.3), and 2,2,2-trifluoroethyl group.

[0289] Herein, "alkoxy" refers to an oxy group linked with an "alkyl" defined above. Preferred alkoxy includes C.sub.1-4 alkoxy groups and C.sub.1-3 alkoxy groups. Specifically, alkoxy includes, for example, methoxy group, ethoxy group, 1-propoxy group, 2-propoxy group, n-butoxy group, i-butoxy group, sec-butoxy group, and tert-butoxy group.

[0290] Herein, "haloalkoxy" refers to a group in which preferably one to nine, more preferably one to five identical or different halogen atoms defined above are linked to an "alkoxy" defined above.

[0291] Specifically, the haloalkoxy includes, for example, chloromethoxy group, trichloromethoxy group, and trifluoromethoxy group.

[0292] Herein, "aryl" refers to a monovalent aromatic hydrocarbon ring. The aryl preferably includes C.sub.6-10 aryl. Specifically, the aryl includes, for example, phenyl group and naphthyl groups (for example, 1-naphthyl group and 2-naphthyl group).

[0293] Herein, "alicyclic ring" refers to a monovalent non-aromatic hydrocarbon ring. The alicyclic ring may have unsaturated bonds within its ring, and may be a multicyclic group having two or more rings. The carbon atoms constituting the ring may be oxidized to form a carbonyl. The number of atoms constituting an alicyclic ring preferably ranges from three to ten (3- to 10-membered aliphatic ring). The alicyclic ring includes, for example, cycloalkyl rings, cycloalkenyl rings, and cycloalkynyl rings.

[0294] Herein, "heteroaryl" refers to a monovalent aromatic heterocyclic group in which the ring-constituting atoms include preferably one to five hetero atoms. The heteroaryl may be partially saturated, and may be a monocyclic or condensed ring (for example, a bicyclic heteroaryl condensed with a benzene ring or monocyclic heteroaryl ring). The number of ring-constituting atoms preferably ranges from five to ten (5- to 10-membered heteroaryl).

[0295] Specifically, the heteroaryl includes, for example, furyl group, thienyl group, pyrrolyl group, imidazolyl group, pyrazolyl group, thiazolyl group, isothiazolyl group, oxazolyl group, isooxazolyl group, oxadiazolyl group, thiadiazolyl group, triazolyl group, tetrazolyl group, pyridyl group, pyrimidyl group, pyridazinyl group, pyrazinyl group, triazinyl group, benzofuranyl group, benzothienyl group, benzothiadiazolyl group, benzothiazolyl group, benzoxazolyl group, benzoxadiazolyl group, benzoimidazolyl group, indolyl group, isoindolyl group, azaindolyl group, indazolyl group, quinolyl group, isoquinolyl group, cinnolinyl group, quinazolinyl group, quinoxalinyl group, benzodioxolyl group, indolidinyl group, and imidazopyridyl group.

[0296] Herein, "heterocyclyl" refers to a non-aromatic monovalent heterocyclic group in which the ring-constituting atoms include preferably one to five hetero atoms. The heterocyclyl may contain double or triple bonds in its ring. The carbon atoms may be oxidized to form carbonyl. The ring may be a monocyclic or condensed ring. The number of the ring-constituting atoms preferably ranges from three to ten (3- to 10-membered heterocyclyl).

[0297] Specifically, the heterocyclyl includes, for example, oxetanyl group, dihydrofuryl group, tetrahydrofuryl group, dihydropyranyl group, tetrahydropyranyl group, tetrahydropyridyl group, morpholinyl group, thiomorpholinyl group, pyrrolidinyl group, piperidinyl group, piperazinyl group, pyrazolidinyl group, imidazolinyl group, imidazolidinyl group, oxazolidinyl group, isooxazolidinyl group, thiazolidinyl group, isothiazolidinyl group, thiadiazolidinyl group, azetidinyl group, oxazolidone group, benzodioxanyl group, benzoxazolyl group, dioxolanyl group, and dioxanyl group.

[0298] Herein, "arylalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with an "aryl" defined above. The arylalkyl preferably includes C.sub.6. 10 aryl C.sub.1-4 alkyl and C.sub.6-10 aryl C.sub.1-3 alkyl. Specifically, the arylalkyl includes, for example, benzyl group, phenethyl group, and naphthylmethyl group.

[0299] Herein, "heteroarylalkyl" refers to a group in which an arbitrary hydrogen atom in an alkyl defined above is substituted with a "heteroaryl" defined above. The heteroarylalkyl preferably includes 5- to 10-membered heteroaryl C.sub.1-3 alkyl. Specifically, the heteroarylalkyl includes, for example, pyrrolylmethyl group, imidazolylmethyl group, thienylmethyl group, pyridylmethyl group, pyrimidylmethyl group, quinolylmethyl group, and pyridylethyl group.

[0300] Herein, "heterocyclylalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with a "heterocyclyl" defined above. The heterocyclylalkyl preferably includes 3- to 10-membered heterocyclyl C.sub.1-3 alkyl. Specifically, the heterocyclylalkyl includes, for example, morpholinylmethyl group, morpholinylethyl group, thiomorpholinylmethyl group, pyrrolidinylmethyl group, piperidinylmethyl group, piperazinylmethyl group, piperazinylethyl group, and oxetanylmethyl group.

[0301] Herein, "monohydroxyalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with a hydroxyl group. The monohydroxyalkyl preferably includes C.sub.1-6 monohydroxyalkyl and C.sub.2-6 monohydroxyalkyl. Specifically, the monohydroxyalkyl includes, for example, hydroxymethyl group, 1-hydroxyethyl group, and 2-hydroxyethyl group.

[0302] Herein, "dihydroxyalkyl" refers to a group in which two arbitrary hydrogen atoms in an "alkyl" defined above are substituted with two hydroxyl groups. The dihydroxyalkyl preferably includes C.sub.1-6 dihydroxyalkyl and C.sub.2-6 dihydroxyalkyl. Specifically, the dihydroxyalkyl includes, for example, 1,2-dihydroxyethyl group, 1,2-dihydroxypropyl group, and 1,3-dihydroxypropyl group.

[0303] Herein, "trihydroxyalkyl" refers to a group in which three arbitrary hydrogen atoms in an "alkyl" defined above are substituted with three hydroxyl groups. The trihydroxyalkyl preferably includes C.sub.1-6 trihydroxyalkyl and C.sub.2-6 trihydroxyalkyl.

[0304] Herein, "alkoxyalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with an "alkoxy" defined above. The alkoxyalkyl preferably includes C.sub.1-3 alkoxy C.sub.1-4 alkyl and C.sub.1-3 alkoxy C.sub.2-4 alkyl. Specifically, the alkoxyalkyl includes, for example, methoxyethyl.

[0305] Herein, "alkoxyalkoxyalkyl" refers to a group in which an arbitrary hydrogen atom in the terminal alkyl of an "alkoxyalkyl" defined above is substituted with an "alkoxy" defined above. The alkoxyalkoxyalkyl preferably includes C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl and C.sub.1-3 alkoxy C.sub.2-4 alkoxy C.sub.2-4 alkyl.

[0306] Herein, "aminoalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with an amino group. The aminoalkyl group preferably includes C.sub.1. 4 aminoalkyl and C.sub.2-4 aminoalkyl.

[0307] Herein, "alkylamino" refers to an amino group linked with an "alkyl" defined above. The alkylamino preferably includes C.sub.1-4 alkylamino.

[0308] Herein, "dialkylamino" refers to an amino group linked with two "alkyls" defined above. The two alkyl groups may be same or different. The dialkylamino preferably includes di(C.sub.4 alkyl)amino.

[0309] Herein, "alkylaminoalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with an "alkylamino" defined above. The alkylaminoalkyl preferably includes C.sub.1-4 alkylamino C.sub.1-4 alkyl and C.sub.1-4 alkylamino C.sub.2-4 alkyl.

[0310] Herein, "dialkylaminoalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with a "dialkylamino" defined above. The dialkylaminoalkyl preferably includes di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl and di(C.sub.1-4 alkyl)amino C.sub.2-4 alkyl.

[0311] Herein, "heterocyclylamino" refers to an amino group linked with a "heterocyclyl" defined above. The heterocyclylamino preferably includes 3- to 10-membered heterocyclylamino.

[0312] Herein, "cyanoalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with a cyano group. The cyanoalkyl preferably includes cyano(C.sub.1-3 alkyl).

[0313] Herein, "alkylsulfonyl" refers to a sulfonyl group linked with an "alkyl" defined above (i.e. alkyl-SO.sub.2--). The alkylsulfonyl preferably includes C.sub.1-3 alkylsulfonyl. Specifically, the alkylsulfonyl includes methylsulfonyl, ethylsulfonyl, n-propylsulfonyl, and i-propylsulfonyl.

[0314] Herein, "alkylsulfonylalkyl" refers to a group in which an arbitrary hydrogen atom in an "alkyl" defined above is substituted with an "alkylsulfonyl" defined above. The alkylsulfonylalkyl preferably includes C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl and C.sub.1-3 alkylsulfonyl C.sub.2-4 alkyl.

[0315] Preferably, the compounds represented by formula (I) shown above are as follows:

[0316] R.sub.1 shown above preferably represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3.

[0317] R.sub.1 shown above more preferably represents hydrogen, hydroxy, halogen, cyano, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q. Specifically, the above 5- to 10-membered heteroaryl is particularly preferably an imidazolyl group, thienyl group, pyridyl group, pyridazinyl group, or pyrazolyl group. The above 3- to 10-membered heterocyclyl is particularly preferably a morpholinyl group, tetrahydropyridyl group, or piperidinyl group.

[0318] R.sub.2 shown above preferably represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3.

[0319] R.sub.2 shown above more preferably represents hydrogen, halogen, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, --OR.sub.5, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl which is optionally substituted with one or more groups independently selected from group Q. Specifically, this 5- to 10-membered heteroaryl is particularly preferably a pyridyl group.

[0320] R.sub.1 and R.sub.2 shown above can preferably be taken together with the atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl. The heterocyclyl or heteroaryl may have a halogen atom as a substituent. Specifically, the 3- to 10-membered heterocyclyl formed together with the atoms to which R.sub.1 and R.sub.2 are attached, is particularly preferably a dioxolanyl group or dioxanyl group.

[0321] R.sub.3 shown above preferably represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl, more preferably hydrogen, C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, or C.sub.1-3perfluoroalkyl, and particularly preferably C.sub.1 alkyl.

[0322] R.sub.4 shown above preferably represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30--SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3.

[0323] R.sub.4 shown above more preferably represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-3 perfluoroalkyl, cyano, methanesulfonyl, hydroxyl, alkoxy, or amino, and particularly preferably hydrogen or halogen.

[0324] Ring A mentioned above is preferably a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring, more preferably benzene, indole, azaindole, benzofuran, benzothiophene, benzothiazole, quinoline, or pyrrole, and particularly preferably indole or pyrrole.

[0325] R.sub.5 shown above preferably represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1. 4 alkyl, C.sub.1-4 amino alkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, or 5- to 10-membered heteroaryl C.sub.1-3 alkyl, each of which is optionally substituted with one or more groups independently selected from group Q, C.sub.1-6 monohydroxyalkyl, C.sub.1-6 dihydroxyalkyl, or C.sub.1-6 trihydroxyalkyl.

[0326] R.sub.5 shown above more preferably represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q. Specifically, the above 3- to 10-membered heterocyclylalkyl is particularly preferably a piperazinylethyl group, oxetanylmethyl group, or morpholinylethyl group. The above 3- to 10-membered heterocyclyl is particularly preferably an oxetanyl group or tetrahydropyranyl group.

[0327] R.sub.6 and R.sub.7 shown above may be the same or different, and each preferably represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.2-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxyalkyl, C.sub.1-6 dihydroxyalkyl, C.sub.1-6 trihydroxyalkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl).

[0328] R.sub.6 and R.sub.7 shown above more preferably each independently represent hydrogen, C.sub.1-3 alkoxy C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, or C.sub.1-6 dihydroxyalkyl. Specifically, the 3- to 10-membered heterocyclylalkyl is particularly preferably a morpholinylethyl group, and the 5- to 10-membered heteroarylalkyl is particularly preferably a pyridylethyl group.

[0329] Alternatively, R.sub.6 and R.sub.7 shown above can preferably be taken together with the nitrogen atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl.

[0330] "n" shown above represents an integer from 1 to 3. Preferably, n is 1.

[0331] R.sub.8 and R.sub.9 shown above preferably may be the same or different, and each represents hydrogen, C.sub.1-4 alkyl, or halogen, and more preferably hydrogen.

[0332] Alternatively, R.sub.8 and R.sub.9 shown above can preferably be taken together with the carbon atoms to which they are attached to form an alicyclic ring.

[0333] Z.sub.1 shown above preferably represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl each of which is optionally substituted with one or more groups independently selected from group Q, more preferably NR.sub.10R.sub.11 or --OH, or 3- to 10-membered heterocyclyl which is optionally substituted with one or more groups independently selected from group Q. Specifically, the above 3- to 10-membered heterocyclyl is particularly preferably a pyrrolidinyl group, piperazinyl group, piperidinyl group, or morpholinyl group.

[0334] R.sub.10 and R.sub.11 shown above preferably may be the same or different, and each preferably represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, more preferably C.sub.1-4 alkyl, C.sub.2-6 alkynyl, or C.sub.1-3 alkoxy C.sub.2-4 alkyl.

[0335] Alternatively, R.sub.10 and R.sub.11 shown above can preferably be taken together with the nitrogen atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl.

[0336] R.sub.12 and R.sub.13 shown above preferably may be the same or different, and each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered alicyclic ring, more preferably hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl.

[0337] Alternatively, R.sub.12 and R.sub.13 shown above preferably can be taken together with the nitrogen atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl each of which is optionally substituted with one or more groups independently selected from group Q, and particularly preferably 3- to 10-membered heterocyclylalkyl. Specifically, piperazinyl group, morpholinyl group, pyrrolidinyl group, and piperidinyl group are more preferred.

[0338] R.sub.14 shown above preferably represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, and more preferably represents C.sub.1-4 alkyl or C.sub.1-4 haloalkyl.

[0339] R.sub.15 shown above preferably represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q.

[0340] R.sub.16 shown above preferably represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, and more preferably represents C.sub.1-4 alkyl.

[0341] R.sub.17 shown above preferably represents hydrogen or C.sub.1-4 alkyl, and more preferably hydrogen.

[0342] R.sub.18 shown above preferably represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted with one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, and more preferably represents C.sub.1-4 alkyl.

[0343] R.sub.19 shown above preferably represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q, and more preferably represents hydrogen, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl each of which is optionally substituted with one or more groups independently selected from group Q. Specifically, this 3- to 10-membered heterocyclyl is more preferably a piperazinyl group, morpholinyl group, pyrrolidinyl group, or piperidinyl group.

[0344] R.sub.20 shown above preferably represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0345] R.sub.21 shown above preferably represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0346] R.sub.22 shown above preferably represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl.

[0347] R.sub.23 shown above preferably represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0348] R.sub.24 shown above preferably represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl.

[0349] R.sub.25 shown above preferably represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0350] R.sub.26 and R.sub.27 shown above preferably may be the same or different, and each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered alicyclic ring.

[0351] Alternatively, R.sub.26 and R.sub.27 shown above can preferably be taken together with the nitrogen atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl.

[0352] R.sub.28 and R.sub.29 shown above preferably may be the same or different, and each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered alicyclic ring.

[0353] Alternatively, R.sub.28 and R.sub.29 shown above preferably can be taken together with the nitrogen atoms to which they are attached to form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl.

[0354] R.sub.30 shown above preferably represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0355] R.sub.31 shown above preferably represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl.

[0356] R.sub.32 shown above preferably represents C.sub.1-4 alkyl, or C.sub.6-10 aryl.

[0357] Preferred substituents included in group P defined above are halogen, C.sub.1-4 alkyl, C.sub.4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, --SO.sub.2R, --CN, --NO.sub.2, and 3- to 10-membered heterocyclyl; and more preferably halogen, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, and 3- to 10-membered heterocyclyl. Specifically, this 3- to 10-membered heterocyclyl is particularly preferably a morpholinyl group.

[0358] Preferred substituents included in group Q defined above are halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxyalkyl, C.sub.1-6 dihydroxyalkyl, C.sub.1-6 trihydroxyalkyl, 3- to 10-membered heterocyclylamino, --SO.sub.2R, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted with C.sub.1-4 alkyl; and more preferably halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxyalkyl, --SO.sub.2R.sub.16, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted with C.sub.1-4 alkyl. Specifically, this 3- to 10-membered heterocyclyl is more preferably a piperazinyl group, piperidinyl group, or morpholinyl group.

[0359] Specific examples of the compounds include:

[0360] (1) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-2-y- l)-methanone;

[0361] (2) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyrrolidin- -1-ylmethyl-1H-indol-2-yl)-methanone;

[0362] (3) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-hydroxy- -piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0363] (4) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-pyrrolo[3- ,2-c]pyridin-2-yl)-methanone;

[0364] (5) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-piperazin-- 1-ylmethyl-1H-indol-2-yl)-methanone;

[0365] (6) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-morphol- in-4-yl-ethoxy)-1H-indol-2-yl]-methanone;

[0366] (7) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(tetrahydr- o-pyran-4-yloxy)-1H-indol-2-yl]-methanone;

[0367] (8) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-chloro-1H-- indol-2-yl)-methanone;

[0368] (9) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-bromo-1H-i- ndol-2-yl)-methanone;

[0369] (10) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-iodo-1H-in- dol-2-yl)-methanone;

[0370] (11) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-5-carbonitrile;

[0371] (12) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-bromo-5-fl- uoro-1H-indol-2-yl)-methanone;

[0372] (13) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-ethynyl-1H- -indol-2-yl)-methanone;

[0373] (14) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-fluoro-- phenyl)-1H-indol-2-yl]-methanone;

[0374] (15) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-fluoro-- phenyl)-1H-indol-2-yl]-methanone;

[0375] (16) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-fluoro-- phenyl)-1H-indol-2-yl]-methanone;

[0376] (17) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-chloro-- phenyl)-1H-indol-2-yl]-methanone;

[0377] (18) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-chloro-- phenyl)-1H-indol-2-yl]-methanone;

[0378] (19) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-chloro-- phenyl)-1H-indol-2-yl]-methanone;

[0379] (20) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0380] (21) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0381] (22) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0382] (23) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-bromo-1H-i- ndol-2-yl)-methanone;

[0383] (24) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-fluoro-- pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0384] (25) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-methyl-1H-- indol-2-yl)-methanone;

[0385] (26) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4,4-diflu- oro-piperidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0386] (27) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3,3-diflu- oro-piperidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0387] (28) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-5-carboxylic acid (2,2,2-trifluoro-ethyl)-amide;

[0388] (29) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-trifluo- romethyl-pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0389] (30) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(6-trifluo- romethyl-pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0390] (31) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-chloro-- pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0391] (32) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-methyl-- pyridin-2-yl)-1H-indol-2-yl] methanone;

[0392] (33) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-chloro-- 4-fluoro-phenyl)-1H-indol-2-yl]-methanone;

[0393] (34) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-trifluo- romethyl-pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0394] (35) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-trifluo- romethyl-pyridin-2-yl)-1H-indol-2-yl] methanone;

[0395] (36) [5-amino-1-(6-fluoro-2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-- indol-2-yl)-methanone;

[0396] (37) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-6-carboxylic acid;

[0397] (38) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-hydroxymet- hyl-1H-indol-2-yl)-methanone;

[0398] (39) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-{6-[2-(4-meth- yl-piperazin-1-yl)-ethoxy]-1H-indol-2-yl}-methanone;

[0399] (40) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-methyl-- oxetan-3-ylmethoxy)-1H-indol-2-yl]-methanone;

[0400] (41) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-fluoro-- piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0401] (42) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-{[bis(2-me- thoxy-ethyl)-amino]-methyl}-1H-indol-2-yl)-methanone;

[0402] (43) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-{6-[(methyl-p- rop-2-ynyl-amino)-methyl]-1H-indol-2-yl}-methanone;

[0403] (44) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3,3-diflu- oro-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0404] (45) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2,5-dimet- hyl-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0405] (46) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3,3-diflu- oro-piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0406] (47) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-((S)-3-met- hyl-morpholin-4-ylmethyl)-1H-indol-2-yl]-methanone;

[0407] (48) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-bromo-1H-i- ndol-2-yl)-methanone;

[0408] (49) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-iodo-1H-in- dol-2-yl)-methanone;

[0409] (50) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-pyrrolo[3- ,2-b]pyridin-2-yl)-methanone;

[0410] (51) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-bromo-6-tr- ifluoromethyl-1H-indol-2-yl)-methanone;

[0411] (52) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-iodo-1H-in- dol-2-yl)-methanone;

[0412] (53) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-methyl-1H-- indol-2-yl)-methanone;

[0413] (54) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-isopropyl-- 1H-indol-2-yl)-methanone;

[0414] (55) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(2-fluoro-- phenyl)-1H-indol-2-yl]-methanone;

[0415] (56) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-benzyl-1H-- indol-2-yl)-methanone;

[0416] (57) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(2-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0417] (58) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3-fluorop- henyl)-1H-indol-2-yl]-methanone;

[0418] (59) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0419] (60) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-ethynyl-1H- -indol-2-yl)-methanone;

[0420] (61) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5H-[1,3]diox- olo[4,5-f]indol-6-yl)-methanone;

[0421] (62) [5-amino-1-(7-fluoro-2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-- indol-2-yl)-methanone;

[0422] (63) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4-trifluo- romethyl-phenyl)-1H-indol-2-yl]-methanone;

[0423] (64) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-butoxy-1H-- indol-2-yl)-methanone;

[0424] (65) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1-methyl-- piperidin-4-yl)-1H-indol-2-yl] methanone;

[0425] (66) N-{2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1- H-indol-6-yl}-methanesulfonamide;

[0426] (67) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(6-morphol- in-4-yl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0427] (68) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-butyl-1H-i- ndol-2-yl)-methanone;

[0428] (69) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(1-methyl-- 1H-pyrazol-4-yl)-1H-indol-2-yl]-methanone;

[0429] (70) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-methoxy- -pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0430] (71) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-methoxy- -pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0431] (72) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-cyclopropy- l-1H-indol-2-yl)-methanone;

[0432] (73) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-methoxy- -phenyl)-1H-indol-2-yl]-methanone;

[0433] (74) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-phenyl-1H-- indol-2-yl)-methanone;

[0434] (75) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-methane- sulfonyl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0435] (76) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-isopropyl-- 1H-indol-2-yl)-methanone;

[0436] (77) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyridin-2-- yl-1H-indol-2-yl)-methanone;

[0437] (78) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-cyclopropy- l-1H-indol-2-yl)-methanone;

[0438] (79) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyridazin-- 3-yl-1H-indol-2-yl)-methanone;

[0439] (80) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-isopropoxy- -1H-indol-2-yl)-methanone;

[0440] (81) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(2-methoxy- -ethoxy)-1H-indol-2-yl]-methanone;

[0441] (82) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-cyclopropy- lmethoxy-1H-indol-2-yl)-methanone;

[0442] (83) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(2,2-difluoro- -5H-[1,3]dioxolo[4,5-f]indol-6-yl)-methanone;

[0443] (84) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-chloro-- pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0444] (85) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-fluoro-- pyridin-2-yl)-1H-indol-2-yl]-methanone;

[0445] (86) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(6-morphol- in-4-yl-pyridazin-3-yl)-1H-indol-2-yl]-methanone;

[0446] (87) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-chloro-6-c- yclopropylmethoxy-1H-indol-2-yl)-methanone;

[0447] (88) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2,4-diflu- oro-phenyl)-1H-indol-2-yl]-methanone;

[0448] (89) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyridazin-- 4-yl-1H-indol-2-yl)-methanone;

[0449] (90) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(3-fluoro-1H-- indol-2-yl)-methanone;

[0450] (91) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1-isoprop- yl-piperidin-4-yl)-6-trifluoromethyl-1H-indol-2-yl]-methanone;

[0451] (92) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-6-carbonitrile;

[0452] (93) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1,2,3,6-t- etrahydro-pyridin-4-yl)-1H-indol-2-yl]-methanone;

[0453] (94) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-piperidin-- 4-yl-1H-indol-2-yl)-methanone;

[0454] (95) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-((R)-3-flu- oro-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0455] (96) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-fluoro-5-p- iperidin-4-yl-1H-indol-2-yl)-methanone;

[0456] (97) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-fluoro-5-(- 1-methyl-piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0457] (98) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1-isoprop- yl-piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0458] (99) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-fluoro-5-(- 1-isopropyl-piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0459] (100) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyridin-3-- yl-1H-indol-2-yl)-methanone;

[0460] (101) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(6-morphol- in-4-yl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0461] (102) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-pyridin-3-- yl-1H-indol-2-yl)-methanone;

[0462] (103) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(6-piperaz- in-1-yl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0463] (104) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(6-hydroxy- -pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0464] (105) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-fluoro-5-(- 4-methyl-piperazin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0465] (106) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-fluoro-5-p- yrrolidin-1-ylmethyl-1H-indol-2-yl)-methanone;

[0466] (107) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(1-methyl-- piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0467] (108) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-morphol- in-4-yl-phenyl)-1H-indol-2-yl]-methanone;

[0468] (109) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3,4,5,6-t- etrahydro-2H-[1,2']bipyridin-5'-yl)-1H-indol-2-yl]-methanone;

[0469] (110) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(6-piperaz- in-1-yl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0470] (111) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(6-methoxy- -pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0471] (112) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-((S)-3-met- hyl-morpholin-4-ylmethyl)-1H-indol-2-yl]-methanone;

[0472] (113) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-((R)-3-flu- oro-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0473] (114) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(2,5-dimet- hyl-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0474] (115) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3-fluoro-- piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0475] (116) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3,3-diflu- oro-piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0476] (117) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-{6-[2-(4-meth- yl-piperazin-1-yl)pyridin-4-yl]-1H-indol-2-yl}-methanone;

[0477] (118) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-pyridin-4-- yl-1H-indol-2-yl)-methanone;

[0478] (119) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4-fluorop- iperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0479] (120) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4,4-diflu- oro-piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0480] (121) [5-amino-1-(2-difluoromethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1- -methyl-piperidin-4-yl)-1H-indol-2-yl]-methanone;



[0481] (122) [5-amino-1-(2-difluoromethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-i- ndol-2-yl)-methanone;

[0482] (123) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3,3-diflu- oro-pyrrolidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0483] (124) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1-cyclope- ntyl-piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0484] (125) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(1-cyclohe- xyl-piperidin-4-yl)-1H-indol-2-yl]-methanone;

[0485] (126) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-bromo-1H-p- yrrol-2-yl)-methanone;

[0486] (127) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-pyrrol-2-- yl)-methanone;

[0487] (128) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-phenyl-1H-- pyrrol-2-yl)-methanone;

[0488] (129) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(3-chloro-- phenyl)-1H-pyrrol-2-yl]-methanone;

[0489] (130) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(4-fluoro-- phenyl)-1H-pyrrol-2-yl]-methanone;

[0490] (131) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(3-fluoro-- phenyl)-1H-pyrrol-2-yl]-methanone;

[0491] (132) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-morpholin-- 4-ylmethyl-1H-indol-2-yl)-methanone;

[0492] (133) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(2-morphol- in-4-yl-ethylamino)-1H-indol-2-yl]-methanone;

[0493] (134) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4-methyl-- piperazine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0494] (135) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-morphol- in-4-yl-ethylamino)-1H-indol-2-yl]-methanone;

[0495] (136) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(piperazin- e-1-carbonyl)-1H-indol-2-yl]-methanone;

[0496] (137) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(2-methoxy- -ethylamino)-1H-indol-2-yl]-methanone;

[0497] (138) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(2-hydroxy- -1-hydroxymethyl-ethylamino)-1H-indol-2-yl]-methanone;

[0498] (139) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(2-pyridin- -4-yl-ethylamino)-1H-indol-2-yl]-methanone;

[0499] (140) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-methoxy- -ethylamino)-1H-indol-2-yl]-methanone;

[0500] (141) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-morpholin-- 4-yl-1H-indol-2-yl)-methanone;

[0501] (142) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-morpholin-- 4-yl-1H-indol-2-yl)-methanone;

[0502] (143) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-morpholin-- 4-ylmethyl-1H-indol-2-yl)-methanone;

[0503] (144) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-morpholin-- 4-ylmethyl-1H-indol-2-yl)-methanone;

[0504] (145) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(morpholin- e-4-carbonyl)-1H-indol-2-yl]-methanone;

[0505] (146) [5-amino-1-(2-isopropyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-- 2-yl)-methanone;

[0506] (147) [5-amino-1-(2-propyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-2-y- l)-methanone;

[0507] (148) [5-amino-1-(1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-2-yl)-methan- one;

[0508] (149) [5-amino-1-(2-trifluoromethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-- indol-2-yl)-methanone;

[0509] (150) [5-amino-1-(2-ethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-2-yl- )-methanone;

[0510] (151) [5-amino-1-(2-benzyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-2-y- l)methanone;

[0511] (152) 1-(4-{2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl- ]-1H-indol-5-ylmethyl}-piperazin-1-yl)-ethanone;

[0512] (153) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4-methane- sulfonyl-piperazin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0513] (154) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-piperazin-- 1-ylmethyl-1H-indol-2-yl)-methanone;

[0514] (155) 1-(4-{2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl- ]-1H-indol-6-ylmethyl}-piperazin-1-yl)-ethanone;

[0515] (156) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-methyl-- piperazin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0516] (157) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(4-methyl-- piperazin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0517] (158) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-pyrrolidin- -1-ylmethyl-1H-indol-2-yl)-methanone;

[0518] (159) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-fluoro-1H-- indol-2-yl)-methanone;

[0519] (160) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-fluoro-1H-- indol-2-yl)-methanone;

[0520] (161) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-fluoro-1H-- indol-2-yl)-methanone;

[0521] (162) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-pyrrolo[2- ,3-b]pyridin-2-yl)-methanone;

[0522] (163) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-fluoro-6-m- orpholin-4-ylmethyl-1H-indol-2-yl)-methanone;

[0523] (164) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-5-carboxylic acid;

[0524] (165) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-methoxy-1H- -indol-2-yl)-methanone;

[0525] (166) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,6-dimethox- y-1H-indol-2-yl)-methanone;

[0526] (167) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-methoxy-1H- -indol-2-yl)-methanone;

[0527] (168) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-methoxy-1H- -indol-2-yl)-methanone;

[0528] (169) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,6-dimethyl- -1H-indol-2-yl)-methanone;

[0529] (170) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-tert-butyl- -1H-indol-2-yl)-methanone;

[0530] (171) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-isopropyl-- 1H-indol-2-yl)-methanone;

[0531] (172) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-benzyloxy-- 1H-indol-2-yl)-methanone;

[0532] (173) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-benzyloxy-- 1H-indol-2-yl)-methanone;

[0533] (174) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5,6-dimethox- y-1H-indol-2-yl)-methanone;

[0534] (175) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-tert-butyl- -1H-indol-2-yl)-methanone;

[0535] (176) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-fluoro-4-t- rifluoromethyl-1H-indol-2-yl)-methanone;

[0536] (177) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-phenoxy-1H- -indol-2-yl)-methanone;

[0537] (178) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-methylsulf- anyl-1H-indol-2-yl)-methanone;

[0538] (179) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-tert-butyl- -1H-indol-2-yl)-methanone;

[0539] (180) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-methyl-1H-- indol-2-yl)-methanone;

[0540] (181) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-ethyl-1H-i- ndol-2-yl)-methanone;

[0541] (182) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-fluoro-6-t- rifluoromethyl-1H-indol-2-yl)-methanone;

[0542] (183) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-fluoro-5-m- ethoxy-1H-indol-2-yl)-methanone;

[0543] (184) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-chloro-5-m- ethoxy-1H-indol-2-yl)-methanone;

[0544] (185) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-chloro-6-m- ethoxy-1H-indol-2-yl)-methanone;

[0545] (186) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-isopropoxy- -1H-indol-2-yl)-methanone;

[0546] (187) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-benzyloxy-- 1H-indol-2-yl)-methanone;

[0547] (188) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-isopropoxy- -1H-indol-2-yl)-methanone;

[0548] (189) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(2,3-dihydro-- 6H-[1,4]dioxino[2,3-f]indol-7-yl)-methanone;

[0549] (190) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,6-di-tert-- butyl-1H-indol-2-yl)-methanone;

[0550] (191) 2-[5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazole-4-carbonyl]-1H-i- ndole-4-carbonitrile;

[0551] (192) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-imidazol-1- -yl-1H-indol-2-yl)-methanone;

[0552] (193) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-trifluorom- ethylsulfanyl-1H-indol-2-yl)-methanone;

[0553] (194) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-methylsulf- anyl-1H-indol-2-yl)-methanone;

[0554] (195) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-methanesul- fonyl-1H-indol-2-yl)-methanone;

[0555] (196) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4,4-diflu- oro-piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0556] (197) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-fluoro-- piperidin-1-ylmethyl)-1H-indol-2-yl]-methanone;

[0557] (198) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(oxetan-3-- yloxy)-1H-indol-2-yl]-methanone;

[0558] (199) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-hydroxy-1H- -indol-2-yl)-methanone;

[0559] (200) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-methanesul- fonyl-1H-indol-2-yl)-methanone;

[0560] (201) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,5-dibromo-- 1H-pyrrol-2-yl)-methanone;

[0561] (202) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,5-diphenyl- -1H-pyrrol-2-yl)-methanone; and

[0562] (203) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,5-dipyridi- n-3-yl-1H-pyrrol-2-yl)-methanone.

[0563] (204) [5-amino-1-(2-methyl-3H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-chloro-1H-- indol-2-yl)-methanone;

[0564] (205) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-chloro-1H-- indol-2-yl)-methanone;

[0565] (206) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-3-y- l)-methanone;

[0566] (207) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(1H-indol-6-y- l)-methanone;

[0567] (208) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-bromo-6-fl- uoro-1H-indol-2-yl)-methanone;

[0568] (209) [5-amino-1-(2-ethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-bromo-6-flu- oro-1H-indol-2-yl)-methanone;

[0569] (210) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-trifluorom- ethyl-1H-indol-2-yl)-methanone;

[0570] (211) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-trifluorom- ethoxy-1H-indol-2-yl)-methanone;

[0571] (212) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,6-dichloro- -1H-indol-2-yl)-methanone;

[0572] (213) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-bromo-4-fl- uoro-1H-indol-2-yl)-methanone;

[0573] (214) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-trifluorom- ethoxy-1H-indol-2-yl)-methanone;

[0574] (215) [5-amino-1-(2-ethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-trifluorome- thoxy-1H-indol-2-yl)-methanone;

[0575] (216) [5-amino-1-(2-ethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5-trifluorome- thyl-1H-indol-2-yl)-methanone;

[0576] (217) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(5,6-dichloro- -1H-indol-2-yl)-methanone;

[0577] (218) [5-amino-1-(2-ethyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-bromo-5-flu- oro-1H-indol-2-yl)-methanone;

[0578] (219) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,5-dichloro- -1H-indol-2-yl)-methanone;

[0579] (220) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4,6-difluoro- -1H-indol-2-yl)-methanone;

[0580] (221) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-chloro-- pyridin-4-yl)-1H-indol-2-yl]-methanone;

[0581] (222) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(6-methyl-- pyridine-3-yl)-1H-indol-2-yl]-methanone;

[0582] (223) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-fluoro-- pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0583] (224) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-trifluo- romethyl-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0584] (225) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-chloro-- 2-methoxy-pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0585] (226) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(5-chloro-- pyridin-3-yl)-1H-indol-2-yl]-methanone;

[0586] (227) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-thiophen-3- -yl-1H-indol-2-yl)-methanone;

[0587] (228) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(4-chlorop- yridin-3-yl)-1H-indol-2-yl]-methanone;

[0588] (229) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(6-thiophen-2- -yl-1H-indol-2-yl)-methanone;

[0589] (230) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(3-fluoro-- pyridin-4-yl)-1H-indol-2-yl]-methanone;

[0590] (231) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[6-(2-trifluo- romethyl-pyridin-4-yl)-1H-indol-2-yl]-methanone;

[0591] (232) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3,3-diflu- oro-pyrrolidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0592] (233) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(2,6-dimet- hyl-morpholine-4-carbonyl)-1H-indol-2-yl]-methanone;

[0593] (234) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-([1,4'] bipiperidinyl-1'-carbonyl)-1H-indol-2-yl]-methanone;

[0594] (235) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-{5-[4-(2,2,2-- trifluoro-ethyl)-piperazine-1-carbonyl]-1H-indol-2-yl}-methanone;

[0595] (236) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-{5-[4-(- 2-hydroxy-ethyl)-piperazine-1-carbonyl]-1H-indol-2-yl}-methanone;

[0596] (237) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-(3,3- ,4,4-tetrafluoro-pyrrolidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0597] (238) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-((R)- -3-fluoro-pyrrolidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0598] (239) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[5-((S)-3-flu- roro-pyrrolidine-1-carbonyl)-1H-indol-2-yl]-methanone;

[0599] (240) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(4-methoxy- -phenyl)-1H-pyrrol-2-yl]-methanone;

[0600] (241) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(3-methoxy- -phenyl)-1H-pyrrol-2-yl]-methanone;

[0601] (242) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4,5-bis-(3-f- luoro-phenyl)-1H-pyrrol-2-yl]-methanone;

[0602] (243) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4,5-bis-(4-m- ethoxy-phenyl)-1H-pyrrol-2-yl]-methanone;

[0603] (244) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(2,4-diflu- oro-phenyl)-1H-pyrrol-2-yl]-methanone;

[0604] (245) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4-(4-trifluo- romethoxy-phenyl)-1H-pyrrol-2-yl]-methanone;

[0605] (246) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-[4,5-bis-(3-m- ethoxy-phenyl)-1H-pyrrol-2-yl]-methanone;



[0606] (247) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-benzofuran-2-- yl-methanone;

[0607] (248) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-benzo[b] thiophen-2-yl-methanone;

[0608] (249) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-benzothiazol-- 2-yl-methanone;

[0609] (250) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(4-fluoro-phe- nyl)-methanone;

[0610] (251) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-(3-chloro-phe- nyl)-methanone;

[0611] (252) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-quinolin-3-yl- -methanone;

[0612] (253) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-quinolin-7-yl- -methanone; and

[0613] (254) [5-amino-1-(2-methyl-1H-benzimidazol-5-yl)-1H-pyrazol-4-yl]-quinolin-6-yl- -methanone.

[0614] More specific examples include compounds in which A is indole and R.sub.3 and R.sub.4 are both hydrogen in formula (I) described above, and compounds shown in Tables 1 and 2 in the Examples described later can be included as examples.

[0615] The above-mentioned compounds can be produced according to the production method described in International Publication WO 2011/016528.

[0616] In the present invention, compounds having FGFR inhibitory activity as describe above include not only free forms but also pharmaceutically acceptable salts thereof.

[0617] Such "salts" include, for example, inorganic acid salts, organic salts, inorganic base salts, organic base salts, and acidic or basic amino acid salts.

[0618] Preferred inorganic acid salts include, for example, hydrochloride, hydrobromide, sulfate, nitrate, and phosphate. Preferred organic salts include, for example, acetate, succinate, fumarate, maleate, tartrate, citrate, lactate, malate, stearate, benzoate, methanesulfonate, and p-toluenesulfonate. A particularly preferred salt in the present invention is malate.

[0619] Preferred inorganic base salts include, for example, alkali metal salts such as sodium salts and potassium salts; alkali earth metal salts such as calcium salts and magnesium salts; aluminum salts; and ammonium salts. Preferred organic base salts include, for example, diethylamine salts, diethanolamine salts, meglumine salts, and N,N-dibenzylethylenediamine salts.

[0620] Preferred acidic amino acid salts include, for example, aspartate and glutamate. Preferred basic amino acid salts include, for example, arginine salts, lysine salts, and ornithine salts.

[0621] In the present invention, compounds having FGFR inhibitory activity also include hydrates thereof. Furthermore, in the present invention, compounds having FGFR inhibitory activity may absorb some type of solvents to form solvates. Such solvates are also included.

[0622] In addition, compounds having FGFR inhibitory activity in the present invention include all possible structural isomers (geometric isomers, optical isomers, stereoisomers, tautomers, etc.), and mixtures of isomers.

[0623] Compounds having FGFR inhibitory activity in the present invention also include any crystalline polymorphism thereof.

[0624] In the present invention, compounds having FGFR inhibitory activity also include prodrugs thereof "Prodrug" refers to derivatives of the compounds of the present invention which have a chemically or metabolically degradable group, and upon administration to the living body, revert to the original compounds and exhibit the original drug efficacy. The prodrugs include non-covalent complexes and salts.

[0625] In the present invention, compounds having FGFR inhibitory activity include those in which one or more atoms within the molecule have been replaced with isotopes. Herein, "isotope" refers to an atom which has the same atomic number (proton number) but different mass number (sum of protons and neutrons). The target atoms to be replaced with an isotope in the compounds of the present invention include, for example, hydrogen atom, carbon atom, nitrogen atom, oxygen atom, phosphorus atom, sulfur atom, fluorine atom, and chlorine atom. Their isotopes include .sup.2H, .sup.3H, .sup.13C, .sup.14C, .sup.15N, .sup.17O, .sup.18O, .sup.31P, .sup.32P, .sup.35S, .sup.18F, and .sup.36Cl. In particular, radioisotopes such as .sup.13H and .sup.14C, which emit radiation and decay, are useful in in vivo tissue distribution studies or such of pharmaceuticals or compounds. Stable isotopes do not decay, and thus their quantity rarely changes; and since there is no emission of radiation, stable isotopes can be used safely. The compounds of the present invention can be converted into isotope-substituted compounds according to routine methods by replacing reagents used in synthesis with reagents containing corresponding isotopes.

[0626] Herein, "anticancer agent" or "pharmaceutical composition for treating cancer" which comprises an FGFR inhibitor are used interchangeably, and refers to a cancer therapeutic composition that comprises an above-described compound having FGFR inhibitory activity and pharmaceutically acceptable carriers.

[0627] The compounds having FGFR inhibitory activity of the present invention can be formulated into tablets, powders, fine granules, granules, coated tablets, capsules, syrups, troches, inhalants, suppositories, injections, ointments, eye ointments, eye drops, nasal drops, ear drops, cataplasms, lotions, and such by routine methods. For the formulation, conventional excipients, binders, lubricants, colorants, flavoring agents, and if needed, stabilizers, emulsifiers, absorbefacients, surfactants, pH adjusting agents, preservatives, antioxidants, and such can be used. The compounds of the present invention are formulated using routine methods, by combining ingredients that are generally used as materials for pharmaceutical preparations.

[0628] For example, to produce oral formulations, the compounds of the present invention or pharmacologically acceptable salts thereof are combined with excipients, and if needed, binders, disintegrating agents, lubricants, coloring agents, flavoring agents, and the like; and then formulated into powders, fine granules, granules, tablets, coated tablets, capsules, and such by routine methods.

[0629] The ingredients include, for example, animal and vegetable oils such as soybean oils, beef tallow, and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane, and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicon resins; silicon oils; surfactants such as polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oils, and polyoxyethylene/polyoxypropylene block copolymers; water-soluble polymers such as hydroxyethyl cellulose, polyacrylic acids, carboxyvinyl polymers, polyethylene glycol, polyvinylpyrrolidone, and methyl cellulose; lower alcohols such as ethanol and isopropanol; polyalcohols such as glycerin, propylene glycol, dipropylene glycol, and sorbitol; saccharides such as glucose and sucrose; inorganic powders such as silicic anhydride, magnesium aluminum silicate, and aluminum silicate; and purified water.

[0630] Excipients include, for example, lactose, cornstarch, sucrose, glucose, mannitol, sorbit, crystalline cellulose, and silicon dioxide.

[0631] Binders include, for example, polyvinyl alcohol, polyvinyl ether, methyl cellulose, ethyl cellulose, Arabic gum, tragacanth, gelatin, shellac, hydroxypropyl methyl cellulose, hydroxypropyl cellulose, polyvinylpyrrolidone, polypropylene glycol/polyoxyethylene block polymer, and meglumine.

[0632] Disintegrating agents include, for example, starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextran, pectin, and calcium carboxymethyl cellulose.

[0633] Lubricants include, for example, magnesium stearate, talc, polyethylene glycol, silica, and hardened vegetable oil.

[0634] Coloring agents approved for use as additives for pharmaceuticals are used. Flavoring agents used include, for example, cacao powder, menthol, aromatic powder, peppermint oil, bomeol, and cinnamon powder.

[0635] Of course, these tablets and granules may be coated with sugar, or if needed, other appropriate coatings. Alternatively, when liquid preparations such as syrups and injections are produced, the compounds of the present invention or pharmacologically acceptable salts thereof are combined with pH adjusting agents, solubilizers, isotonizing agents, or such, and if needed, solubilizing agents, stabilizers, and such, and then formulated using routine methods.

[0636] Methods for producing external preparations are not limited, and they can be produced by conventional methods. Various conventional materials for pharmaceuticals, quasi-drugs, cosmetics, and such can be used as base materials in the production. Specifically, the base materials used include, for example, animal and vegetable oils, mineral oils, ester oils, waxes, higher alcohols, fatty acids, silicon oils, surfactants, phospholipids, alcohols, polyalcohols, water-soluble polymers, clay minerals, and purified water. Furthermore, as necessary, it is possible to add pH-adjusting agents, antioxidants, chelating agents, preservatives, colorants, flavoring agents, and such. However, the base materials for external preparations of the present invention are not limited thereto.

[0637] Furthermore, if needed, the preparations may be combined with components that have an activity of inducing differentiation, or components such as blood flow-enhancing agents, antimicrobial agents, antiphlogistic agents, cell-activating agents, vitamins, amino acids, humectants, and keratolytic agents. The amount of above-described base materials added is a quantity that provides a concentration typically selected in the production of external preparations.

[0638] The anticancer agents (granular pharmaceutical compositions for treating cancer) for administering a compound having FGFR inhibitory activity in the present invention are not particularly limited in their dosage form; and the agents may be administered orally or parenterally by commonly used methods. They can be formulated and administered as, for example, tablets, powders, granules, capsules, syrups, troches, inhalants, suppositories, injections, ointments, eye ointments, eye drops, nose drops, ear drops, cataplasms, lotions, etc.

[0639] In the present invention, the dosage of an FGFR inhibitor contained in an anticancer agent or a pharmaceutical composition for treating cancer can be appropriately selected according to the severity of symptoms, age, sex, weight, dosage form, salt type, specific type of disease, and such.

[0640] The dosage varies considerably depending on the patient's disease type, symptom severity, age, sex, sensitivity to the agent, and such. Typically, the agent is administered to an adult once or several times a day at a daily dose of about 0.03 to 1,000 mg, preferably 0.1 to 500 mg, and more preferably 0.1 to 100 mg. The agents or compositions of the present invention are administered once or several times a day. When an injection is used, the daily dose is generally about 1 g/kg to 3,000 .mu.g/kg, and preferably about 3 g/kg to 1,000 .mu.g/kg.

[0641] The present invention also relates to pharmaceutical compositions for treating cancer which comprise an above-described compound having FGFR inhibitory activity, and are characterized by their use of being administered to patients expressing a fusion polypeptide of the present invention or carrying a polynucleotide encoding the fusion polypeptide.

[0642] The present invention further relates to methods for treating or preventing cancer which comprise administering an effective amount of the above-mentioned compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof to patients expressing the fusion polypeptides or carrying the polynucleotides; use of compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof in the production of pharmaceutical compositions for cancer treatment for administration to patients expressing the fusion polypeptides or carrying the polynucleotides; compounds having FGFR inhibitory activity or pharmaceutically acceptable salts thereof for use in treatment or prevention for patients expressing the fusion polypeptides or carrying the polynucleotides; and such.

[0643] Specifically, use of the pharmaceutical compositions for treating cancer is characterized in that whether a patient expresses the fusion polypeptide or carries a polynucleotide encoding the fusion polypeptide is tested using a fusion polypeptide of the present invention as a biomarker before an above-described anticancer agent comprising an FGFR inhibitor is administered to the patient, and the anticancer agent containing an FGFR inhibitor is administered to the patient only if the patient expresses the fusion polypeptide or carries a polynucleotide encoding the fusion polypeptide. This enables one to avoid side effects in therapies using the agent and control the therapeutic condition to produce the best therapeutic effect, thus enabling personalized medicine.

[0644] In the present invention, specifically in the case of bladder cancer, the fusion genes of the present invention are found to be significantly expressed when bladder cancer progresses to stage 3 or later in stage classification.

[0645] Stage classification of bladder cancer is, specifically, classification by TNM classification. TNM classification is composed of a T factor (initial of tumor) showing the extent of tumor, an N factor (initial of lymph node) showing the presence or absence of lymph node metastasis of tumor, and an M factor (initial of metastasis) showing the presence or absence of distal metastasis other than lymph node metastasis. Among them, cancers in which the tumor has infiltrated into the subepithelial connective tissue are classified as stage 1, those in which the tumor has infiltrated into muscularis propria are classified as stage 2, those in which the tumor has infiltrated into the fatty tissue surrounding the bladder to those in which the tumor has infiltrated into any one of prostate interstitium, uterus, or vagina are classified as stage 3, and those in which the tumor has infiltrated into either the pelvic wall or the abdomen wall, or those that show lymph node metastasis or distal metastasis are classified as stage 4. Whether a patient expresses a fusion polypeptide of the present invention or carries a polynucleotide encoding the fusion polypeptide can be tested by using methods of the present invention described above.

[0646] The present invention also relates to methods for identifying compounds having FGFR inhibitory activity.

[0647] Specifically, methods for identifying compounds having FGFR inhibitory activity in the present invention include methods comprising the steps of.

(a) culturing cells that express an above-described fusion polypeptide of the present invention in the presence or absence of a test compound and determining the level of cell proliferation; (b) comparing the proliferation level of cultured cell between in the presence and absence of the test compound; and (c) judging that the test compound has FGFR inhibitory activity when the proliferation level of the cell cultured in the presence of the test compound is lower than that of the cell cultured in the absence of the test compound.

[0648] Cells used for the above method may be living cells, established cell lines, or recombinant cells, as long as they express a fusion polypeptide of the present invention. Such recombinant cells include those introduced with an above-described vector carrying a polynucleotide encoding a fusion polypeptide of the present invention.

[0649] Meanwhile, the living cells include cells collected from cancer patients. The established cell lines include cancer cell lines established from cancer cells collected from cancer patients.

[0650] In the present invention, cancer includes any cancer described above.

[0651] Methods for identifying compounds having FGFR inhibitory activity in the present invention also include those comprising the steps of:

(a) administering a test compound to a non-human mammal transplanted with cells that express an above-described fusion polypeptide of the present invention and determining the proliferation level of the cells; (b) comparing the cell proliferation level determined in step (a) with that determined using a non-human mammal transplanted with the cells but not administered with the test compound; and (c) judging that the test compound has FGFR inhibitory activity when the cell proliferation level determined in step (a) is lower than that determined using a non-human mammal transplanted with the cells but not administered with the test compound.

[0652] Cells used for the above method may be living cells, established cell lines, or recombinant cells, as long as they express a fusion polypeptide of the present invention. Such recombinant cells include those introduced with an above-described vector carrying a polynucleotide encoding a fusion polypeptide of the present invention.

[0653] Meanwhile, the living cells include cells collected from cancer patients. The established cell lines include cancer cell lines established from cancer cells collected from cancer patients.

[0654] In the present invention, cancer includes any cancer described above.

[0655] In the methods of the present invention, the cell proliferation level can be tested according to routine methods, for example, by colorimetric methods that measure the enzyme activity of reducing a dye (MTT, XTT, MTS, WST, etc.) to formazan dye (purple).

[0656] When the above-described cells are cancer cells, the cell proliferation level can also be determined by measuring the volume or weight of tumor formed as a result of cell proliferation.

[0657] In the present invention, methods for identifying compounds having FGFR inhibitory activity also comprise embodiments that use reporter gene assays.

[0658] Reporter genes include commonly-used genes encoding arbitrary fluorescent proteins, for example, the green fluorescent protein (GFP) derived from Aequorea coerulescens, luciferase derived from Renilla reniformis or such, reef coral fluorescent proteins (RCFPs) derived from hermatypic coral, fruit fluorescent proteins, and variants thereof.

[0659] In the present invention, reporter gene assay can be carried out, for example, as follows.

[0660] Recombinant cells are prepared by transforming cells that are typically used for producing recombinant proteins with an expression vector inserted with a polynucleotide encoding the fusion polypeptide of the present invention and a gene encoding a reporter protein, so that the reporter protein-encoding gene is transcribed into mRNA dependently on the signal that transcribes the fusion polypeptide-encoding polynucleotide into mRNA. A test compound is contacted with the obtained transformed cells. Whether the compound affects the expression of the fusion polypeptide is indirectly analyzed by determining the expression level of the fusion polypeptide, which depends on the compound activity, by measuring the intensity of fluorescence emitted by the reporter protein simultaneously expressed with the fusion polypeptide (for example, U.S. Pat. Nos. 5,436,128; 5,401,629).

[0661] Identification of the compounds using the above-described assay can be achieved by manual operation; however, it can also be done readily and simply by so-called "high-throughput screening" using robots automatically (Soshiki Baiyou Kougaku (The Tissue Culture Engineering), Vol. 23, No. 13, p. 521-524; U.S. Pat. No. 5,670,113).

[0662] Hereinbelow, the present invention is specifically described using the Examples, but it is not to be construed as being limited thereto.

[0663] Unless otherwise specified, each assay step can be performed according to known methods.

[0664] Meanwhile, when using commercially available reagents, kits, or such, assays can be performed according to manuals included in the commercial products.

[0665] All prior art documents cited herein are incorporated by reference in their entirety.

Example 1

Expression of Fusion Polypeptides Between FGFR3 and Other Polypeptides in Various Cancer Cells

(1) RNA Analysis

[0666] RNA was extracted with the miRNeasy Mini Kit (QIAGEN) from each of the four FGFR3-expressing human cell lines derived from bladder cancer, RT112/84 (available from European Collection of Cell Cultures (ECACC); catalog No. 85061106), RT4 (available from American Type Culture Collection (ATCC); catalog No. HTB-2), SW780 (available from ATCC; catalog No. CRL-2169), and BFTC-905 (available from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ); catalog No. ACC 361). The sequences were determined using paired-end reads (Read Length: 2.times.75 bp) of the HiSeq.TM. Sequencing system (Illumina).

[0667] The determined nucleotide sequences were mapped to Refseq transcripts by referring to an existing method (Maher et al., PNAS, Jul. 28, 2009, 106(30): 12353-12358) to search for candidate fusion genes by looking for pairs of nucleotide sequences that are mapped to different genes. Furthermore, fusion sites were identified using nucleotide sequences that are not mapped to any Refseq transcript, in which one partner of the pair is mapped to one partner in a candidate fusion gene.

[0668] As a result, polynucleotides encoding a fusion polypeptide of FGFR3 and TACC3, a fusion polypeptide of FGFR3 and TACC3, and a fusion polypeptide of FGFR3 and BAIAP2L1 were identified from the three types of bladder cancer cell lines: RT112/84, RT4, and SW780. This suggests that the fusion polypeptides were expressed in these cell lines. Meanwhile, a polynucleotide encoding a wild-type FGFR3 polypeptide was confirmed in BFTC-905 cells.

(2) cDNA Analysis

[0669] cDNAs were synthesized by reverse transcription using a reverse transcription kit, Transcriptor Universal cDNA Master (Roche), according to the instruction manual protocol attached to the kit. The RNAs used in Example 1(1), which were extracted from the three types of cells suggested to express a fusion polypeptide of FGFR3 and TACC3 or a fusion polypeptide of FGFR3 and BAIAP2L1, were each used as a template.

[0670] PCR was carried out (35 cycles of 15 seconds at 94.degree. C., 30 seconds at 55.degree. C., and one minute at 68.degree. C.) using each of the prepared cDNAs as a template with DNA polymerase KOD-Plus-Ver. 2 (Toyobo), and a pair of oligonucleotide primers (set 1) having the nucleotide sequences of SEQ ID NO: 1 (F3fu-F3: gtgcacaacctcgactactacaag) and SEQ ID NO: 2 (RT112-R3: gtaatcctccacgcacttcttc), a pair of oligonucleotide primers (set 2) having the nucleotide sequences of SEQ ID NO: 1 (F3fu-F3: gtgcacaacctcgactactacaag) and SEQ ID NO: 5 (RT4-R3: gggtgtcactcttctgtctaagga), or a pair of oligonucleotide primers (set 3) having the nucleotide sequences of SEQ ID NO: 3 (F3fu-F2) tgtttgaccgagtctacactcacc) and SEQ ID NO: 4 (SW780-R2: gacatgtcccagttcagttgac). Then, electrophoresis was performed.

[0671] The results showed that with primer set 1, a band of about 670 bp was observed only when the cDNA synthesized from RT112/84 RNA was used as a template. In the amplification with primer set 2, a band of about 610 bp was observed only when the cDNA synthesized from RT4 RNA was used as template. In the amplification with primer set 3, a band of about 450 bp was observed only when the cDNA synthesized from SW780 RNA was used as a template.

[0672] Sequencing was performed by Sanger's sequencing method with BigDye.TM. Terminator v3.1 Cycle Sequencing Kit (Life Technologies) using each PCR product as a template to determine the nucleotide sequence (SEQ ID NO: 14) of the fusion site in the fusion polynucleotide of FGFR3 and TACC3 (FGFR3-TACC3 polynucleotide v1) expressed in RT112/84, the nucleotide sequence (SEQ ID NO: 15) of the fusion site in the fusion polynucleotide of FGFR3 and TACC3 (FGFR3-TACC3 polynucleotide v2) expressed in RT4, and the nucleotide sequence (SEQ ID NO: 16) of the fusion site in the fusion polynucleotide of FGFR3 and BAIAP2L1 (FGFR3-BAIAP2L1 polynucleotide) expressed in SW780.

[0673] Based on the information obtained as described above, the nucleotide sequences of cDNAs encoding each fusion polypeptide (full-length) were determined by a common method.

[0674] The nucleotide sequence of the cDNA encoding the fusion polypeptide (full-length) of FGFR3 and TACC3 expressed in RT112/84 and its amino acid sequence are shown in SEQ ID NOs: 27 and 28, respectively.

[0675] The nucleotide sequence of the cDNA encoding the fusion polypeptide (full-length) of FGFR3 and TACC3 expressed in RT4 and its amino acid sequence are shown in SEQ ID NOs: 29 and 30, respectively.

[0676] Results of analyzing the nucleotide sequence of the cDNA showed that the nucleotide sequence at positions 2,281 to 2,379 of SEQ ID NO: 29 is an intron-derived nucleic acid sequence of a gene encoding FGFR3, and encodes the amino acid sequence at positions 761 to 793 of SEQ ID NO: 30.

[0677] The nucleotide sequence of the cDNA encoding the fusion polypeptide (full-length) of FGFR3 and BAIAP2L1 expressed in SW780 and its amino acid sequence are shown in SEQ ID NOs: 31 and 32, respectively.

[0678] As described above, while there are two types of wild-type polypeptides for human FGFR3 which comprise the amino acid sequences of SEQ ID NOs: 6 and 7, respectively, the N-terminal FGFR3-derived portions in these fusion polypeptides are those of wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 6.

[0679] Based on these test results, it is assumed that two types of fusion polypeptides of TACC3 and the other wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 7, and a fusion polypeptide of BAIAP2L1 and the other wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 7 are expressed in various types of human-derived cancer cells.

[0680] The nucleotide sequence of the cDNA encoding a fusion polypeptide (full-length) of TACC3 and wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 7, and its amino acid sequence are shown in SEQ ID NOs: 33 and 34, respectively.

[0681] The nucleotide sequence of the cDNA encoding another fusion polypeptide (full-length) of TACC3 and wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 7, and its amino acid sequence are shown in SEQ ID NOs: 35 and 36, respectively.

[0682] Here, the nucleotide sequence at positions 2,275 to 2,373 of the cDNA nucleotide sequence of SEQ ID NO: 35 is a nucleic acid sequence derived from an intron of a gene encoding FGFR3, and encodes the amino acid sequence at positions 759 to 791 of SEQ ID NO: 36.

[0683] The nucleotide sequence of the cDNA encoding another fusion polypeptide (full-length) of BAIAP2L1 and wild-type FGFR3 that has the amino acid sequence of SEQ ID NO: 7, and its amino acid sequence are shown in SEQ ID NOs: 37 and 38, respectively.

[0684] Furthermore, the presence of an FGFR3-TACC3 fusion polynucleotide was suspected in head and neck squamous cell carcinoma, lung adenocarcinoma, and lung squamous cell carcinoma, while the presence of an FGFR3-BAIAP2L1 fusion polynucleotide was suspected in head and neck squamous cell carcinoma, lung squamous cell carcinoma, and skin melanoma.

Example 2

[0685] Analysis of Various FGFR Inhibitors for their Activities of Inhibiting the Kinase Activity of FGFR1, FGFR2, and FGFR3, and Inhibiting the Cell Proliferation of Cell Lines Expressing the FGFR3-TACC3 Fusion Polypeptide 1. Analysis of Various FGFR Inhibitors for their Activity of Inhibiting the Kinase Activity of FGFR1, FGFR2, and FGFR3 (In Vitro)

(1) Inhibitory Activity Against the FGFR1 Enzyme

[0686] The FGFR1 inhibitory activities of compounds listed in Tables 1-1 to 1-5 were measured based on their activity to inhibit phosphorylation of the biotinylated peptide (EGPWLEEEEEAYGWMDF; SEQ ID NO: 39) by a human FGFR1 enzyme (Carna Biosciences, cat 08-133). Phosphorylated biotinylated peptide was detected by time-resolved fluorometry using a europium cryptate-linked anti-phosphotyrosine antibody, and streptavidin linked to an allophycocyanin derivative, XL665. The half maximal inhibitory concentration (IC.sub.50) was calculated based on the inhibitory rate against the control group which does not contain the test substance.

[0687] The test result for each compound is shown in Tables 1-1 to 1-5.

(2) Inhibitory Activity Against the FGFR2 Enzyme

[0688] The FGFR2 inhibitory activities of compounds listed in Tables 1-1 to 1-5 were measured based on their activity to inhibit phosphorylation of the biotinylated peptide (EGPWLEEEEEAYGWMDF; SEQ ID NO: 39) by human FGFR2 enzyme prepared using a baculovirus expression system. Phosphorylated biotinylated peptide was detected by time-resolved fluorometry using europium cryptate-linked anti-phosphotyrosine antibody, and streptavidin linked to an allophycocyanin derivative, XL665. The half maximal inhibitory concentration (IC.sub.50) was calculated based on the inhibitory rate against the control group which does not contain the test substance.

[0689] The test result for each compound is shown in Tables 1-1 to 1-5.

(3) Inhibitory Activity Against the FGFR3 Enzyme

[0690] The FGFR3 inhibitory activities of compounds listed in Tables 1-1 to 1-5 were measured based on their activity to inhibit phosphorylation of the biotinylated peptide (EGPWLEEEEEAYGWMDF; SEQ ID NO: 39) by human FGFR3 enzyme (Carna Biosciences, cat 08-135). Phosphorylated biotinylated peptide was detected by time-resolved fluorometry using europium cryptate-linked anti-phosphotyrosine antibody, and streptavidin linked to an allophycocyanin derivative, XL665. The half maximal inhibitory concentration (IC.sub.50) was calculated based on the inhibitory rate against the control group which does not contain the test substance.

[0691] The test result for each compound is shown in Tables 1-1 to 1-5.

(4) Inhibitory Activity of FGFR Inhibitors on the Cell Proliferation of Cell Lines (In Vitro)

[0692] Cells of a bladder cancer-derived cell line RT-4 which expresses an FGFR3-TACC3 fusion polypeptide, and cells of a colon cancer-derived cell line HCT116 which does not express an FGFR3 fusion polypeptide, were plated in 96-well plates, and cultured for four days in the presence of DMSO (used as a control) or each of the compounds listed in Tables 1-1 to 1-5 in 2-fold serial dilutions (18 steps) at a maximum concentration of 50 M. Four days later, the cell proliferation level was determined using WST-8 (DOJINDO LABORATORIES).

[0693] The inhibitory activity of each compound on the cell proliferation of each cell line was calculated according to:

(1-T/C).times.100(%)

where T represents absorbance at 450 nM in wells where cells were incubated in the presence of a compound at various concentrations, and C represents absorbance at 450 nM in wells where cells were incubated in the presence of DMSO. IC50 was calculated using the least-square method.

[0694] As shown in Tables 1-1 to 1-5, the result showed that the 50% cell proliferation inhibitory concentration (IC50) for cells expressing the fusion polypeptide was significantly lower than that for cells that do not express the fusion polypeptide.

TABLE-US-00002 TABLE 1-1 HCT116 RT-4 FGFR1 FGFR2 FGFR3 (CRC) (Bladder) IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 COMPOUND (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) 1 ##STR00013## 0.0014 0.0034 0.0035 4.1 0.02 2 ##STR00014## 0.0069 0.0084 0.018 2.7 0.016 3 ##STR00015## 0.0027 0.0043 0.0054 2.9 0.018 4 ##STR00016## 0.00067 0.0085 0.030 9.5 0.018 5 ##STR00017## 0.00032 0.012 0.012 11 0.021 6 ##STR00018## 0.00081 0.012 0.0037 12 0.024 7 ##STR00019## 0.0029 0.0094 0.13 3.2 0.024 8 ##STR00020## 0.0096 0.023 0.034 11 0.029 9 ##STR00021## 0.010 0.015 0.046 6.3 0.030 10 ##STR00022## 0.009 0.0062 0.032 >50 0.039 11 ##STR00023## 0.011 0.017 0.065 5.7 0.052 12 ##STR00024## 0.045 0.021 0.082 7.2 0.058 13 ##STR00025## 0.036 0.010 0.35 0.39 0.065 14 ##STR00026## 0.038 0.0076 0.10 3.1 0.075 15 ##STR00027## 0.035 0.016 0.36 19 0.076

TABLE-US-00003 TABLE 1-2 HCT116 RT-4 FGFR1 FGFR2 FGFR3 (CRC) (Bladder) IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 COMPOUND (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) 16 ##STR00028## 0.23 0.20 0.40 17 0.076 17 ##STR00029## 0.011 0.012 0.041 3.8 0.077 18 ##STR00030## 0.048 0.021 0.079 11 0.082 19 ##STR00031## 0.017 0.017 0.070 2.5 0.084 20 ##STR00032## 0.029 0.025 0.082 >50 0.088 21 ##STR00033## 0.021 0.020 0.090 21 0.088 22 ##STR00034## 0.016 0.0086 0.21 1.2 0.089 23 ##STR00035## 0.087 0.11 0.13 10 0.09 24 ##STR00036## 0.023 0.016 0.060 >50 0.092 25 ##STR00037## 0.018 0.012 0.045 >100 0.098 26 ##STR00038## 0.022 0.0055 0.094 11 0.13 27 ##STR00039## 0.015 0.023 0.077 25 0.15 28 ##STR00040## 0.048 0.039 0.16 21 0.2 29 ##STR00041## 0.03 0.015 0.14 8.5 0.16 30 ##STR00042## 0.033 0.020 0.077 13 0.16

TABLE-US-00004 TABLE 1-3 HCT116 RT-4 FGFR1 FGFR2 FGFR3 (CRC) (Bladder) IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 COMPOUND (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) 31 ##STR00043## 0.039 0.018 0.077 2 0.17 32 ##STR00044## 0.043 0.039 0.015 8.7 0.18 33 ##STR00045## 0.15 0.056 0.95 4.4 0.18 34 ##STR00046## 0.050 0.026 0.23 3.8 0.19 35 ##STR00047## 0.043 0.022 0.086 7.8 0.19 36 ##STR00048## 0.075 0.040 0.38 4.8 0.19 37 ##STR00049## 0.040 0.015 0.080 8.9 0.19 38 ##STR00050## 0.022 0.012 0.16 6.1 0.21 39 ##STR00051## 0.024 0.0083 0.37 11 0.21 40 ##STR00052## 0.042 0.026 0.15 19 0.22 41 ##STR00053## 0.053 0.017 0.21 >20 0.24 42 ##STR00054## 0.043 0.021 0.15 15 0.25 43 ##STR00055## 0.060 0.027 0.13 >50 0.25 44 ##STR00056## 0.030 0.0089 0.11 10 0.26 45 ##STR00057## 0.0027 0.0032 0.0054 9.4 0.29

TABLE-US-00005 TABLE 1-4 HCT116 RT-4 FGFR1 FGFR2 FGFR3 (CRC) (Bladder) IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 COMPOUND (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) 46 ##STR00058## 0.056 0.021 0.068 37 0.3 47 ##STR00059## 0.0079 0.011 0.036 14 0.320 48 ##STR00060## 0.027 0.018 0.12 37 0.32 49 ##STR00061## 0.0050 0.023 0.018 13 0.350 50 ##STR00062## 0.091 0.057 0.37 34 0.39 51 ##STR00063## 0.076 0.036 0.80 5.1 0.41 52 ##STR00064## 0.093 0.019 0.35 10 0.44 53 ##STR00065## 0.057 0.014 0.67 >20 0.44 54 ##STR00066## 0.038 0.022 0.082 >20 0.46 55 ##STR00067## 0.033 0.038 0.068 16 0.48 56 ##STR00068## 0.091 0.026 1.3 19 0.49 57 ##STR00069## 0.095 0.040 0.32 >20 0.51 58 ##STR00070## 0.0055 0.0040 0.029 12 0.56 59 ##STR00071## 0.046 0.016 0.25 3.3 0.58 60 ##STR00072## 0.030 0.0054 0.0031 17 0.6

TABLE-US-00006 TABLE 1-5 HCT116 RT-4 FGFR1 FGFR2 FGFR3 (CRC) (Bladder) IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50 COMPOUND (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) (.mu.mol/L) 61 ##STR00073## 0.14 0.078 0.37 9.1 0.62 62 ##STR00074## 0.060 0.029 0.18 1.7 0.64 63 ##STR00075## 0.077 0.022 0.32 13 0.67 64 ##STR00076## 0.042 0.031 0.36 1.2 0.68 65 ##STR00077## 0.031 0.020 0.11 23 0.68 66 ##STR00078## 0.025 0.048 0.043 >50 0.74 67 ##STR00079## 0.0030 0.0043 0.0067 7.3 0.75 68 ##STR00080## 0.092 0.037 0.33 >2 0.91 69 ##STR00081## 0.12 0.11 0.38 4.3 0.92 70 ##STR00082## 0.031 0.0085 0.50 9 0.97 71 ##STR00083## 0.051 0.034 0.18 3.8 0.99

Example 3

[0695] Analysis of FGFR Inhibitors on their Cell Proliferation Inhibitory Activity Against Various Cell Lines Expressing the FGFR3-TACC3 Fusion Polypeptide or FGFR3-BAIAP2L1 Fusion Polypeptide

(1) Cell Proliferation Inhibitory Activity of FGFR Inhibitors Against Various Cell Lines (In Vitro)

[0696] Six compounds A to F (Tables 2-1 and 2-2), which are substances that suppress the kinase activity of FGFR, were assessed for their effect on cell proliferation in a total of six types of human bladder cancer-derived cell lines: three types of cell lines expressing an FGFR3-TACC3 or FGFR3-BAIAP2L1 fusion polypeptide: RT112/84 (available from ECACC; catalog No. 85061106), RT4 (available from ATCC; catalog No. HTB-2), and SW780 (available from ATCC; catalog No. CRL-2169); cell line BFTC-905 (available from DSMZ; catalog No. ACC 361) which expresses the wild-type FGFR polypeptide but does not express the fusion polypeptides; cell line UM-UC-14 (available from ECACC; catalog No. 08090509) which expresses the mutated type FGFR polypeptide but does not express the fusion polypeptides; and cell line HT-1376 (available from ATCC; catalog No. CRL-1472) which does not express FGFR3.

[0697] The cells plated in 96-well plates (RT112/84, BFTC-905, and UM-UC-14: 3.0E+03 cells/well; SW780, RT4, and HT-1376: 5.0E+03 cells/well) were cultured for four days in the presence of DMSO (used as a control) or each compound in three-fold serial dilutions (9 steps) at a maximum concentration of 20 M. Four days later, the cell proliferation level was determined using WST-8 (DOJINDO LABORATORIES).

[0698] The cell proliferation inhibitory activity of each compound against each cell line was calculated according to:

(1-T/C).times.100(%)

where T represents absorbance at 450 nM in wells where cells were incubated in the presence of a compound at various concentrations, and C represents absorbance at 450 nM in wells where cells were incubated in the presence of DMSO. IC50 was calculated using the least-square method.

[0699] As shown in Table 3, the result showed that the 50% cell proliferation inhibitory concentration (IC50) against cells expressing the fusion polypeptides was significantly lower than that against cells that do not express the fusion polypeptides.

TABLE-US-00007 TABLE 2-1 CODE STRUCTURAL FORMULA/CHEMICAL NAME A ##STR00084## B COMPOUND REPRESENTED BY [COMPOUND 2] ##STR00085## C COMPOUND REPRESENTED BY [COMPOUND 3] ##STR00086##

TABLE-US-00008 TABLE 2-2 CODE STRUCTURAL FORMULA/CHEMICAL NAME D COMPOUND REPRESENTED BY [COMPOUND 4] ##STR00087## E COMPOUND REPRESENTED BY [COMPOUND 5] ##STR00088## F COMPOUND REPRESENTED BY [COMPOUND 6] ##STR00089##

TABLE-US-00009 TABLE 3 IC50 (.mu.mol/L) COMPOUND COMPOUND COMPOUND COMPOUND COMPOUND COMPOUND CELL NAME A B C D E F UM-UC-14 0.11 0.010 0.016 0.017 0.066 0.075 RT112/84 0.018 0.014 0.017 0.018 0.15 0.13 SW780 0.12 0.069 0.16 1.1 0.53 0.57 RT4 0.35 0.18 0.25 0.23 0.24 0.25 BFTC-905 >10 14 11 >20 2.5 2.8 HT-1376 >10 11 6.7 10 1.1 0.62

(2) Cell Proliferation Inhibitory Activity of FGFR Inhibitors Against Cells Expressing the FGFR3-TACC3 Fusion Polypeptide (In Vivo)

[0700] Antitumor effect was assessed using cancer-bearing mice prepared by transplanting cells of the human bladder cancer cell line RT112/84 (ECACC) subcutaneously in the inguinal region of BALB/c nude mice (Charles River Japan, Inc.).

[0701] Nude mice were quarantined for about one week before use, and subjected to subcutaneous transplantation of about 1.times.10.sup.7 RT112/84 cells in the inguinal region. When the tumor size reached about 200 mm.sup.3, the mice were used in experiments.

[0702] Compound A was suspended in a solution containing 10% DMSO, 0% Cremophor EL, 15% PEG400, and 15% HPCD, and orally administered to the mice at a dose of 20 mL/kg once a day.

[0703] Antitumor effect was determined by comparing the tumor growth during 11 days after the first day of administration (Day 10 when the first day of administration is set at Day 0) with that of the control group.

Tumor growth inhibitory effect (TGI)=(1-[Average tumor growth level of treated group]/[Average tumor growth level of control group]).times.100(%)

[0704] The result is shown in Table 4.

[0705] FGFR inhibitors exhibited a markedly significant tumor growth inhibitory effect in mice bearing tumor cells expressing the FGFR3-TACC3 fusion polypeptide in a concentration-dependent manner.

TABLE-US-00010 TABLE 4 ANTITUMOR EFFECT DOSE (mg/kg) TGI AFTER 11 DAYS (%) Vehicle -- COMPOUND A 25 61 50 86 100 125

Example 4

Detection of Polynucleotides Encoding the FGFR3-TACC3 or FGFR3-BAIAP2L1 Fusion Polypeptide in Clinical Specimens

[0706] (1) Detection of Polynucleotide v1 which Encodes the FGFR3-TACC3 Fusion Polypeptide

[0707] In order to detect the cDNA of polynucleotide v1 encoding the FGFR3-TACC3 fusion polypeptide in clinical samples, PCR was carried out (42 cycles of 10 seconds at 98.degree. C., 15 seconds at 60.degree. C., and one minute at 68.degree. C.) with Tks Gflex.TM. DNA Polymerase (Takara bio) using, as primers, oligonucleotides having the nucleotide sequences of SEQ ID NOs: 1 and 2, and as a substrate, cDNA (Origene) derived from bladder cancer samples collected from bladder cancer patients (20 patients) or cDNA synthesized from RT112/84 (ECACC) RNA. Each of the amplified samples was electrophoresed together with size marker DNAs (Invitrogen).

[0708] As shown in FIG. 1, the result showed that cDNA fragments of polynucleotide v1 encoding the FGFR3-TACC3 fusion polypeptide were not detected in the clinical samples.

(2) Detection of Polynucleotide v2 which Encodes the FGFR3-TACC3 Fusion Polypeptide

[0709] In order to detect the cDNA of polynucleotide v2 encoding the FGFR3-TACC3 fusion polypeptide in clinical samples, PCR was carried out (42 cycles of 10 seconds at 98.degree. C., 15 seconds at 60.degree. C., and one minute at 68.degree. C.) with Tks Gflex.TM. DNA Polymerase (Takara bio) using as primers, oligonucleotides having the nucleotide sequences of SEQ ID NOs: 1 and 5, and as a substrate, cDNA (Origene) derived from bladder cancer samples collected from bladder cancer patients (20 patients) or cDNA synthesized from RT4 (ATCC) RNA. Each of the amplified samples was electrophoresed together with size marker DNAs (Invitrogen).

[0710] As shown in FIG. 2, the result showed that a cDNA fragment of polynucleotide v2 encoding the FGFR3-TACC3 fusion polypeptide was detected in a single case.

[0711] The above finding shows that the method described above allows detection of polynucleotide v2 encoding the FGFR3-TACC3 fusion polypeptide in samples derived from clinical specimens of bladder cancer, and thus enables selection of patients who are positive for polynucleotide v2 encoding the FGFR3-TACC3 fusion polypeptide.

(3) Detection of a Polynucleotide Encoding the FGFR3-BAIAP2L1 Fusion Polypeptide

[0712] In order to detect cDNA for an FGFR3-BAIAP2L1 polynucleotide in clinical samples, PCR was carried out (42 cycles of 10 seconds at 98.degree. C., 15 seconds at 60.degree. C., and one minute at 68.degree. C.) with Tks Gflex.TM. DNA Polymerase (Takara bio) using, as primers, oligonucleotides having the nucleotide sequences of SEQ ID NOs: 3 and 4, and, as a substrate, cDNA (Origene) derived from bladder cancer samples collected from bladder cancer patients (20 patients) or cDNA synthesized from SW780 (ATCC) RNA. Each of the amplified samples was electrophoresed together with size marker DNAs (Invitrogen).

[0713] As shown in FIG. 3, the result showed that a cDNA fragment of the FGFR3-BAIAP2L1 fusion polynucleotide was detected in a total of two cases.

[0714] The above finding shows that the method described above allows detection of a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide in samples derived from clinical specimens of bladder cancer, and thus enables selection of patients who are positive for a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide.

Example 5

Detection of Polynucleotides Encoding the FGFR3-BAIAP2L1 Fusion Polypeptide and FGFR3-TACC3 Fusion Polypeptide in Clinical Specimens of Various Types of Cancers

(1) Detection of a Polynucleotide Encoding the FGFR3-BAIAP2L1 Fusion Polypeptide in Clinical Specimens of Lung Cancer (Non-Bladder Cancer) (Test 1)

[0715] In order to detect cDNA for an FGFR3-BAIAP2L1 polynucleotide from clinical specimens of non-bladder cancer, PCR was carried out (42 cycles of 98.degree. C. for 10 seconds, 60.degree. C. for 15 seconds, and 68.degree. C. for one minute) with Tks Gflex.TM. DNA Polymerase (TAKARA BIO INC.) using a pair of oligonucleotide primers having the nucleotide sequences of SEQ ID NO: 3 (F3fu-F2: tgtttgaccgagtctacactcacc) and SEQ ID NO: 4 (SW780-R.sub.2: gacatgtcccagttcagttgac), and, as a substrate, 40 samples of cDNAs derived from clinical specimens of lung cancer (OriGene) and cDNA synthesized from SW780 RNA. The amplified samples were electrophoresed together with a size marker DNA (Invitrogen).

[0716] As shown in FIG. 4A, the result showed that a cDNA fragment of a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide was detected in a total of one case.

[0717] Furthermore, in order to confirm reproducibility, PCR was carried out (42 cycles of 98.degree. C. for 10 seconds, 60.degree. C. for 15 seconds, and 68.degree. C. for one minute) with Tks Gflex.TM. DNA Polymerase (TAKARA BIO INC.) using a pair of oligonucleotide primers having the nucleotide sequences of SEQ ID NO: 17 (F3fu-F1: caactgcacacacgacctgta) and SEQ ID NO: 18 (SW780-R1: ccatcgtagtaggcttttcctg), and, as a substrate, cDNAs derived from the same clinical specimens of lung cancer and cDNA synthesized from SW780 RNA. The amplified samples were electrophoresed together with a size marker DNA (Invitrogen).

[0718] As shown FIG. 4B, the result showed that a cDNA fragment of a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide was detected in a total of one case. The above finding shows that the method described above allows detection of a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide in cDNAs derived from clinical specimens of non-bladder cancer with different types of primers, and thus enables selection of patients who are positive for a polynucleotide encoding the FGFR3-BAIAP2L1 fusion polypeptide.

(2) Detection of Polynucleotides Encoding the FGFR3-BAIAP2L1 Fusion Polypeptides in Clinical Specimens of Lung Cancer (Non-Bladder Cancer) (Test 2)

[0719] PCR was carried out (35 cycles of 98.degree. C. for 10 seconds, 60.degree. C. for 15 seconds, and 68.degree. C. for one minute) with Tks Gflex.TM. DNA Polymerase (TAKARA BIO INC.) using a pair of oligonucleotide primers (Set 3) having the nucleotide sequences of SEQ ID NO: 3 (F3fu-F2: tgtttgaccgagtctacactcacc) and SEQ ID NO: 4 (SW780-R2: gacatgtcccagttcagttgac), and, as a substrate, 83 samples of cDNAs derived from clinical specimens of lung cancer (OnGene). The presence or absence of DNA amplification was confirmed for each sample by agarose gel electrophoresis. DNA bands having the size of interest were detected in two specimens, and it was determined by DNA sequence analysis (Sanger method) that they are cDNA fragment sequences derived from FGFR3-BAIAP2L1 fusion polynucleotides. Accordingly, the FGFR3-BAIAP2L1 fusion polynucleotide was confirmed to exist in cDNAs derived from clinical cancer specimens.

(3) Detection of Polynucleotides Encoding the FGFR3-TACC3 Fusion Polypeptides in Clinical Specimens of Lung Cancer, Esophageal Cancer, Gastric Cancer, and Liver Cancer (all are Non-Bladder Cancers)

[0720] PCR was carried out (35 cycles of 98.degree. C. for 10 seconds, 60.degree. C. for 15 seconds, and 68.degree. C. for one minute) with Tks Gflex.TM. DNA Polymerase (TAKARA BIO INC.) using a pair of oligonucleotide primers (Set 1) having the nucleotide sequences of SEQ ID NO: 1 (F3fu-F3: gtgcacaacctcgactactacaag) and SEQ ID NO: 2 (RT112-R3: gtaatcctccacgcacttcttc), and, as a substrate, 83 samples of cDNAs derived from clinical specimens of lung cancer (OnGene), 18 samples of cDNAs derived from clinical specimens of esophageal cancer (OnGene), five samples of cDNAs derived from clinical specimens of gastric cancer (OnGene), and five samples of cDNAs derived from clinical specimens of liver cancer (OriGene). The presence or absence of DNA amplification was confirmed for each sample by agarose gel electrophoresis. DNA bands having the size of interest were detected in the specimens from two cases of lung cancer, two cases of esophageal cancer, one case of gastric cancer, and one case of liver cancer; and it was determined by DNA sequence analysis (Sanger method) that they are cDNA fragment sequences derived from FGFR3-TACC3 fusion polynucleotides. Accordingly, the FGFR3-TACC3 fusion polynucleotides were confirmed to exist in cDNAs derived from clinical specimens of various types of cancers.

(4) Detection of Polynucleotides Encoding the FGFR3-BAIAP2L1 Fusion Polypeptides in Bladder Cancer Cell Lines Using the FISH Method

[0721] In order to detect the FGFR3-BAIAP2L1 fusion genes in bladder cancer cell lines using the fluorescence in situ hybridization (FISH) method, an experiment was performed using the following two probe sets and formalin-fixed paraffin-embedded (FFPE) samples of bladder cancer cell lines RT112/84 and SW780.

[0722] FISH analysis was performed by using FGFR3 Split Dual Color FISH Probe (Split signal probe set, GSP Lab., Inc.) to detect translocation of a part of the FGFR3 gene on human chromosome 4 to another chromosome, and by using FGFR3 and BAIAP2L1 FISH Probe (Fusion signal probe set, GSP Lab., Inc.) to detect integration of the FGFR3 gene on human chromosome 4 and the BAIAP2L1 gene on human chromosome 7 into the same chromosome.

[0723] As shown in FIG. 5, the results confirmed that, in FFPE samples prepared from SW780, signals of two colors were detected separately by FISH analysis with a Split signal probe (A2 of FIG. 5), and merged signal of two colors was detected by FISH analysis with a Fusion signal probe set (B2 of FIG. 5). Accordingly, the above-mentioned method showed that separation of the FGFR3 gene and fusion of the FGFR3 and BAIAP2L1 genes can be detected by the FISH method.

Example 6

[0724] Evaluation of Various Cell Lines that Express an FGFR3-TACC3 Fusion Polypeptide or an FGFR3-BAIAP2L1 Fusion Polypeptide

(1) Evaluation of FGFR3-Dependency of Various Cell Lines

[0725] siRNA against FGFR3 or BAIAP2L1 was added to a total of four types of cells: bladder cancer-derived human cell lines RT4 and SW780 which express an FGFR3-TACC3 fusion polypeptide or an FGFR3-BAIAP2L1 fusion polypeptide; the UM-UC-14 cell line which expresses a mutant FGFR3 polypeptide but does not express the fusion polypeptides; and the BFTC-905 cell line which express the wild-type FGFR3 polypeptide but does not express the fusion polypeptides, and effects of each type of siRNA on cell proliferation were examined.

[0726] The ON-TARGETplus siRNA Reagents (Thermo Fisher Scientific) were used for the siRNAs.

[0727] The cells plated in 96-well plates (UM-UC-14 and BFTC-905: 1.5E+03 cells/well; and SW780 and RT4: 2.5E+03 cells/well) were cultured for seven days in the presence of each siRNA or mock siRNA (used as a control) in ten-fold serial dilutions (3 steps) at a maximum concentration of 10 nM. Cell proliferation after seven days was measured by CellTiter-Glo.TM. Luminescent Cell Viability Assay (Promega).

[0728] As shown in FIG. 6, the result showed that the proliferation activity of cells which express a wild-type FGFR3 polypeptide but does not express the fusion polypeptides were not inhibited by siRNAs against each of FGFR3 and BAIAP2L1. On the other hand, the proliferation activity of the cell line which expresses a mutant FGFR3 polypeptide but does not express the fusion polypeptides, and the proliferation activity of cells which express an FGFR3-TACC3 fusion polypeptide were inhibited only by siRNA against FGFR3. On the other hand, proliferation of cells expressing an FGFR3-BAIAP2L1 fusion polypeptide was confirmed to be inhibited by either of the siRNAs against each of FGFR3 and BAIAP2L1.

(2) Evaluation of Apoptosis Induction by an FGFR Inhibitor Against Cancer Cells that Express an FGFR3-BAIAP2L1 Fusion Polypeptide

[0729] Each of six compounds A to F (Tables 2-1 and 2-2), which are substances that suppress the kinase activity of FGFR, were added to a total of four types of cells: bladder cancer-derived human cell line SW780 which expresses an FGFR3-BAIAP2L1 fusion polypeptide; the BFTC-905 cell line which expresses the wild-type FGFR polypeptide but does not express the fusion polypeptides; the UM-UC-14 cell line which expresses the mutant FGFR3 polypeptide but does not express the fusion polypeptides; and the HT-1376 cell line which does not express FGFR3 to assess whether apoptosis was induced.

[0730] The cells plated in a PrimeSurface.TM. 96U plates (Sumitomo Bakelite Co. Ltd.) (UM-UC-14 and BFTC-905: 3.0E+03 cells/well; and SW780 and HT-1376: 5.0E+03 cells/well) were cultured for four days in the presence of DMSO (used as a control) or each compound in three-fold serial dilutions (4 steps) at a maximum concentration of 20 M. Cell proliferation and caspase activity after four days was measured by CellTiter-Glo.TM. Luminescent Cell Viability Assay (Promega) Caspase-Glo.TM. 3/7 assay (Promega), respectively. The sum of caspase activity in a single well measured by Caspase-Glo.TM. 3/7 was divided by the relative viable cell count in a single well calculated from the CellTiter-Glo.TM. value to calculate the Apoptosis value. Apoptosis induction in each cell was evaluated by dividing the Apoptosis value by the Apoptosis value for each cell calculated under the DMSO-added conditions.

[0731] As shown in FIG. 7, the results confirmed that while apoptosis was not induced by the inhibitor in cells unresponsive to an FGFR inhibitor, apoptosis was induced by the FGFR inhibitor in cells responsive to an FGFR inhibitor.

(3) In Vivo Cell Proliferation Inhibitory Activity of FGFR Inhibitors Against Cells Expressing the FGFR3-BAIAP2L1 Fusion Polypeptide

[0732] Antitumor effect was assessed using cancer-bearing mice prepared by transplanting cells of the human bladder cancer cell line SW780 (ATCC) subcutaneously in the inguinal region of BALB/c nude mice (Charles River Japan, Inc.). Nude mice were quarantined for about one week before use, and subjected to subcutaneous transplantation of 5.times.10.sup.6 SW780 cells in the inguinal region. When the tumor size reached about 200 mm.sup.3, the mice were used in experiments. Compound A was suspended in a solution containing 10% DMSO, 10% Cremophor EL, 15% PEG400, and 15% HPCD, and orally administered to the mice at 20 mL/kg once a day. Antitumor effect was determined by comparing the tumor growth during 11 days after the first day of administration (Day 10 when the first day of administration is set at Day 0) with that of the control group.

Tumor growth inhibitory effect (TGI)=(1-[Average tumor growth level of treated group]/[Average tumor growth level of control group]).times.100(%)

[0733] The result is shown in Table 5.

[0734] FGFR inhibitors exhibited a markedly significant tumor growth inhibitory effect in mice bearing tumor cells expressing the FGFR3-BAIAP2L1 fusion polypeptide in a concentration-dependent manner.

TABLE-US-00011 TABLE 5 ANTITUMOR EFFECT DOSE (mg/kg) TGI AFTER 11 DAYS(%) Vehicle -- COMPOUND A 25 47 50 79 100 111

Example 7

Examination of Transforming Ability and Tumorigenic Ability of FGFR3-BAIAP2L1 Fusion Polypeptides

(1) Evaluation of Transforming Ability of an FGFR3-BAIAP2L1 Fusion Polypeptide

[0735] A cDNA (SEQ ID NO: 10) encoding FGFR3 (SEQ ID NO: 6) and a cDNA (SEQ ID NO: 31) encoding FGFR3-BAIAP2L1 (SEQ ID NO: 32) were each subcloned into a lentiviral expression vector pReceiver-Lv156 (GeneCopoeia); and lentivirus for expression of each polypeptide was produced using the Lenti-Pac.TM. Lentiviral Packaging Systems (GeneCopoeia).

[0736] Rat fetus-derived RAT-2 cells were infected with each lentivirus, and the cells were cultured under a condition with a selection marker Puromycin to establish RAT-2 cells that stably express the FGFR3 polypeptide or the FGFR3-BAIAP2L1 fusion polypeptide. As shown in FIG. 8, morphological changes of the established cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide were observed in monolayer culture.

[0737] Untreated RAT-2 cells (parent cells), RAT-2 cells stably expressing the FGFR3 polypeptide, or RAT-2 cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide plated at 2.0.times.10.sup.3 cells/well in a PrimeSurface.TM. 96U plate (Sumitomo Bakelite Co. Ltd.) were cultured for 14 days. As shown in FIG. 9, when the cells after 14 days were observed and photographed, scaffold-independent cell proliferation was found to be enhanced only in RAT-2 cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide.

[0738] From the result, the FGFR3-BAIAP2L1 fusion polypeptide was confirmed to have transforming ability in normal cells.

(2) Evaluation of the Transforming Ability of an FGFR3-BAIAP2L1 Fusion Polypeptide Lacking a Dimerization-Promoting Region

[0739] A cDNA encoding FGFR3-BAIAP2L1 ABAR, which lacks the BAR domain which is a region promoting dimerization of the BAIAP2L1 polypeptide (amino acid sequence: SEQ ID NO: 8/nucleic acid sequence: SEQ ID NO: 12), was produced by a site-directed mutagenesis method using the PCR method. cDNAs encoding each of FGFR3 (same as the above), FGFR3-BAIAP2L1 (same as the above), and FGFR3-BAIAP2L1 ABAR were subcloned into the pCXND3 vector (KAKETSUKEN) to produce vectors for expressing each of the polypeptides.

[0740] The pCXND3 vector (vehicle) or a vector for expressing each polypeptide was introduced into human embryonic kidney 293 cells using the FuGENE.TM. HD Transfection Reagent (Promega). One day later, the cells were collected as cell lysates using Cell Lysis Buffer (Cell Signaling Technology). As shown in FIG. 10, when each cell lysate was analyzed by Western blotting using a Phospho-FGF Receptor (Tyr653/654) Antibody (Cell Signaling Technology) or an anti-FGFR3 antibody (Santa Cruz), FGFR phosphorylation which was enhanced on the FGFR3-BAIAP2L1 fusion polypeptide was confirmed to be attenuated in the FGFR3-BAIAP2L1 ABAR fusion polypeptide lacking the BAR domain which is a region promoting dimerization of the BAIAP2L1 polypeptide.

[0741] Furthermore, by a method similar to that of the aforementioned examination (1), RAT-2 cells that stably express the BAIAP2L1 polypeptide (the same as the above) or the FGFR3-BAIAP2L1 ABAR fusion polypeptide (the same as the above) were established using lentiviruses.

[0742] Untreated RAT-2 cells (parent cells), RAT-2 cells stably expressing the FGFR3 polypeptide, RAT-2 cells stably expressing the BAIAP2L1 polypeptide, RAT-2 cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide, or RAT-2 cells stably expressing the FGFR3-BAIAP2L1 ABAR fusion polypeptide were plated at 2.0.times.10.sup.3 cells/well in a PrimeSurface.TM. 96U plate (Sumitomo Bakelite Co. Ltd.), and cultured for 14 days. The cell count after 14 days was determined by the CellTiter-Glo.TM. Luminescent Cell Viability Assay (Promega). As shown in FIG. 11, it was observed that RAT-2 cells stably expressing the BAIAP2L1 polypeptide did not have scaffold-independent cell proliferation ability, and scaffold-independent cell proliferation ability observed in RAT-2 cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide was lost in RAT-2 cells stably expressing the FGFR3-BAIAP2L1 ABAR fusion polypeptide.

[0743] Accordingly, the transforming ability of an FGFR3-BAIAP2L1 fusion polypeptide on normal cells was confirmed to be caused by enhanced trans-autophosphorylation of the FGFR3 polypeptide due to the dimerization-promoting domain in the BAIAP2L1 polypeptide.

(3) Evaluation of Tumorigenic Ability of an FGFR3-BAIAP2L1 Fusion Polypeptide, and Tumor Enlargement-Suppressing Activity of an FGFR Inhibitor

[0744] RAT-2 cells that stably express the FGFR3 polypeptide, the BAIAP2L1 polypeptide, the FGFR3-BAIAP2L1 fusion polypeptide, or the FGFR3-BAIAP2L1 ABAR fusion polypeptide established in the above-mentioned experiments (1) and (2) were inoculated subcutaneously into the inguinal region of BALB/c nude mice (Charles River Laboratories Japan) at 4.8-5.4.times.10.sup.6 cells, and the mice were observed for 15 days. As shown in FIG. 12, tumor enlargement was confirmed only in mice inoculated with RAT-2 cells stably expressing the FGFR3-BAIAP2L1 fusion polypeptide.

[0745] Furthermore, RAT-2 cells that stably express FGFR3-BAIAP2L1 were inoculated into nude mice at 5.04.times.10.sup.6 cells. From seven days after planting the cells, an FGFR inhibitor compound A (same as the above) suspended in a solution containing 10% DMSO, 10% Cremophor EL, 15% PEG400, and 15% HPCD was orally administered once daily to mice at a concentration of 20 mL/kg. As shown in FIG. 13, tumor enlargement enhanced by the FGFR3-BAIAP2L1 fusion polypeptide was observed to be significantly suppressed by the FGFR inhibitor in a concentration-dependent manner.

[0746] The FGFR3-BAIAP2L1 fusion polypeptide was confirmed to have very strong tumorigenic ability, and this tumorigenic ability was suppressed by the FGFR inhibitor.

INDUSTRIAL APPLICABILITY

[0747] Fusion polypeptides comprising an FGFR3 polypeptide and another polypeptide of the present invention are expressed specifically in various types of cancer cells including bladder cancer cells. The proliferation of cells expressing such fusion polypeptides is significantly inhibited by compounds having FGFR inhibitory activity. Thus, the use of a fusion polypeptide of the present invention as a biomarker for FGFR inhibitor-based cancer therapy enables to assess each patient for the applicability or mode of use of the FGFR inhibitor, and enables to avoid side effects and control the mode of therapy to produce the best therapeutic effect in the FGFR inhibitor-based therapy. Thus, this allows personalized medicine.

[0748] In addition, the use of fusion polypeptides of the present invention as a target in developing cancer therapeutic agents that target FGFR, i.e., molecularly targeted therapeutic agents, enables to provide FGFR inhibitors with high level of specificity and antitumor activity to target cancer cells as well as cancer therapeutic agents comprising the inhibitors.

[0749] FGFR inhibitors obtained as described above have high specificity towards target cancer cells, and thus it becomes possible to provide cancer therapeutic agents with great antitumor activity but few side effects.

[0750] Furthermore, fusion polypeptides of the present invention have a close correlation to various types of cancers, and thus cancer susceptibility (sensitivity to cancer) of subjects, whether subjects are affected with cancer, or whether cancer has progressed in subjects can be tested by determining the presence or absence of the fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide in samples from subjects which include not only cancer patients but also healthy persons.

[0751] In addition, fusion polypeptides of the present invention have a close correlation to various types of cancers, and thus FGFR inhibitors with high specificity to FGFR can be provided by identifying a test compound that inhibits the proliferation of cells (such as cancer cells) expressing the fusion polypeptides of the present invention by comparing the cell proliferation level between in the presence and absence of the test compound.

Sequence CWU 1

1

39124DNAArtificial SequenceAn artificially synthesized primer sequence 1gtgcacaacc tcgactacta caag 24222DNAArtificial SequenceAn artificially synthesized primer sequence 2gtaatcctcc acgcacttct tc 22324DNAArtificial SequenceAn artificially synthesized primer sequence 3tgtttgaccg agtctacact cacc 24422DNAArtificial SequenceAn artificially synthesized primer sequence 4gacatgtccc agttcagttg ac 22524DNAArtificial SequenceAn artificially synthesized primer sequence 5gggtgtcact cttctgtcta agga 246808PRTHomo sapiens 6Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750Val Leu Thr Val Thr Ser Thr Asp Glu Tyr Leu Asp Leu Ser Ala Pro 755 760 765Phe Glu Gln Tyr Ser Pro Gly Gly Gln Asp Thr Pro Ser Ser Ser Ser 770 775 780Ser Gly Asp Asp Ser Val Phe Ala His Asp Leu Leu Pro Pro Ala Pro785 790 795 800Pro Ser Ser Gly Gly Ser Arg Thr 8057806PRTHomo sapiens 7Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750Thr Val Thr Ser Thr Asp Glu Tyr Leu Asp Leu Ser Ala Pro Phe Glu 755 760 765Gln Tyr Ser Pro Gly Gly Gln Asp Thr Pro Ser Ser Ser Ser Ser Gly 770 775 780Asp Asp Ser Val Phe Ala His Asp Leu Leu Pro Pro Ala Pro Pro Ser785 790 795 800Ser Gly Gly Ser Arg Thr 8058511PRTHomo sapiens 8Met Ser Arg Gly Pro Glu Glu Val Asn Arg Leu Thr Glu Ser Thr Tyr1 5 10 15Arg Asn Val Met Glu Gln Phe Asn Pro Gly Leu Arg Asn Leu Ile Asn 20 25 30Leu Gly Lys Asn Tyr Glu Lys Ala Val Asn Ala Met Ile Leu Ala Gly 35 40 45Lys Ala Tyr Tyr Asp Gly Val Ala Lys Ile Gly Glu Ile Ala Thr Gly 50 55 60Ser Pro Val Ser Thr Glu Leu Gly His Val Leu Ile Glu Ile Ser Ser65 70 75 80Thr His Lys Lys Leu Asn Glu Ser Leu Asp Glu Asn Phe Lys Lys Phe 85 90 95His Lys Glu Ile Ile His Glu Leu Glu Lys Lys Ile Glu Leu Asp Val 100 105 110Lys Tyr Met Asn Ala Thr Leu Lys Arg Tyr Gln Thr Glu His Lys Asn 115 120 125Lys Leu Glu Ser Leu Glu Lys Ser Gln Ala Glu Leu Lys Lys Ile Arg 130 135 140Arg Lys Ser Gln Gly Ser Arg Asn Ala Leu Lys Tyr Glu His Lys Glu145 150 155 160Ile Glu Tyr Val Glu Thr Val Thr Ser Arg Gln Ser Glu Ile Gln Lys 165 170 175Phe Ile Ala Asp Gly Cys Lys Glu Ala Leu Leu Glu Glu Lys Arg Arg 180 185 190Phe Cys Phe Leu Val Asp Lys His Cys Gly Phe Ala Asn His Ile His 195 200 205Tyr Tyr His Leu Gln Ser Ala Glu Leu Leu Asn Ser Lys Leu Pro Arg 210 215 220Trp Gln Glu Thr Cys Val Asp Ala Ile Lys Val Pro Glu Lys Ile Met225 230 235 240Asn Met Ile Glu Glu Ile Lys Thr Pro Ala Ser Thr Pro Val Ser Gly 245 250 255Thr Pro Gln Ala Ser Pro Met Ile Glu Arg Ser Asn Val Val Arg Lys 260 265 270Asp Tyr Asp Thr Leu Ser Lys Cys Ser Pro Lys Met Pro Pro Ala Pro 275 280 285Ser Gly Arg Ala Tyr Thr Ser Pro Leu Ile Asp Met Phe Asn Asn Pro 290 295 300Ala Thr Ala Ala Pro Asn Ser Gln Arg Val Asn Asn Ser Thr Gly Thr305 310 315 320Ser Glu Asp Pro Ser Leu Gln Arg Ser Val Ser Val Ala Thr Gly Leu 325 330 335Asn Met Met Lys Lys Gln Lys Val Lys Thr Ile Phe Pro His Thr Ala 340 345 350Gly Ser Asn Lys Thr Leu Leu Ser Phe Ala Gln Gly Asp Val Ile Thr 355 360 365Leu Leu Ile Pro Glu Glu Lys Asp Gly Trp Leu Tyr Gly Glu His Asp 370 375 380Val Ser Lys Ala Arg Gly Trp Phe Pro Ser Ser Tyr Thr Lys Leu Leu385 390 395 400Glu Glu Asn Glu Thr Glu Ala Val Thr Val Pro Thr Pro Ser Pro Thr 405 410 415Pro Val Arg Ser Ile Ser Thr Val Asn Leu Ser Glu Asn Ser Ser Val 420 425 430Val Ile Pro Pro Pro Asp Tyr Leu Glu Cys Leu Ser Met Gly Ala Ala 435 440 445Ala Asp Arg Arg Ala Asp Ser Ala Arg Thr Thr Ser Thr Phe Lys Ala 450 455 460Pro Ala Ser Lys Pro Glu Thr Ala Ala Pro Asn Asp Ala Asn Gly Thr465 470 475 480Ala Lys Pro Pro Phe Leu Ser Gly Glu Asn Pro Phe Ala Thr Val Lys 485 490 495Leu Arg Pro Thr Val Thr Asn Asp Arg Ser Ala Pro Ile Ile Arg 500 505 5109838PRTHomo sapiens 9Met Ser Leu Gln Val Leu Asn Asp Lys Asn Val Ser Asn Glu Lys Asn1 5 10 15Thr Glu Asn Cys Asp Phe Leu Phe Ser Pro Pro Glu Val Thr Gly Arg 20 25 30Ser Ser Val Leu Arg Val Ser Gln Lys Glu Asn Val Pro Pro Lys Asn 35 40 45Leu Ala Lys Ala Met Lys Val Thr Phe Gln Thr Pro Leu Arg Asp Pro 50 55 60Gln Thr His Arg Ile Leu Ser Pro Ser Met Ala Ser Lys Leu Glu Ala65 70 75 80Pro Phe Thr Gln Asp Asp Thr Leu Gly Leu Glu Asn Ser His Pro Val 85 90 95Trp Thr Gln Lys Glu Asn Gln Gln Leu Ile Lys Glu Val Asp Ala Lys 100 105 110Thr Thr His Gly Ile Leu Gln Lys Pro Val Glu Ala Asp Thr Asp Leu 115 120 125Leu Gly Asp Ala Ser Pro Ala Phe Gly Ser Gly Ser Ser Ser Glu Ser 130 135 140Gly Pro Gly Ala Leu Ala Asp Leu Asp Cys Ser Ser Ser Ser Gln Ser145 150 155 160Pro Gly Ser Ser Glu Asn Gln Met Val Ser Pro Gly Lys Val Ser Gly 165 170 175Ser Pro Glu Gln Ala Val Glu Glu Asn Leu Ser Ser Tyr Ser Leu Asp 180 185 190Arg Arg Val Thr Pro Ala Ser Glu Thr Leu Glu Asp Pro Cys Arg Thr 195 200 205Glu Ser Gln His Lys Ala Glu Thr Pro His Gly Ala Glu Glu Glu Cys 210 215 220Lys Ala Glu Thr Pro His Gly Ala Glu Glu Glu Cys Arg His Gly Gly225 230 235 240Val Cys

Ala Pro Ala Ala Val Ala Thr Ser Pro Pro Gly Ala Ile Pro 245 250 255Lys Glu Ala Cys Gly Gly Ala Pro Leu Gln Gly Leu Pro Gly Glu Ala 260 265 270Leu Gly Cys Pro Ala Gly Val Gly Thr Pro Val Pro Ala Asp Gly Thr 275 280 285Gln Thr Leu Thr Cys Ala His Thr Ser Ala Pro Glu Ser Thr Ala Pro 290 295 300Thr Asn His Leu Val Ala Gly Arg Ala Met Thr Leu Ser Pro Gln Glu305 310 315 320Glu Val Ala Ala Gly Gln Met Ala Ser Ser Ser Arg Ser Gly Pro Val 325 330 335Lys Leu Glu Phe Asp Val Ser Asp Gly Ala Thr Ser Lys Arg Ala Pro 340 345 350Pro Pro Arg Arg Leu Gly Glu Arg Ser Gly Leu Lys Pro Pro Leu Arg 355 360 365Lys Ala Ala Val Arg Gln Gln Lys Ala Pro Gln Glu Val Glu Glu Asp 370 375 380Asp Gly Arg Ser Gly Ala Gly Glu Asp Pro Pro Met Pro Ala Ser Arg385 390 395 400Gly Ser Tyr His Leu Asp Trp Asp Lys Met Asp Asp Pro Asn Phe Ile 405 410 415Pro Phe Gly Gly Asp Thr Lys Ser Gly Cys Ser Glu Ala Gln Pro Pro 420 425 430Glu Ser Pro Glu Thr Arg Leu Gly Gln Pro Ala Ala Glu Gln Leu His 435 440 445Ala Gly Pro Ala Thr Glu Glu Pro Gly Pro Cys Leu Ser Gln Gln Leu 450 455 460His Ser Ala Ser Ala Glu Asp Thr Pro Val Val Gln Leu Ala Ala Glu465 470 475 480Thr Pro Thr Ala Glu Ser Lys Glu Arg Ala Leu Asn Ser Ala Ser Thr 485 490 495Ser Leu Pro Thr Ser Cys Pro Gly Ser Glu Pro Val Pro Thr His Gln 500 505 510Gln Gly Gln Pro Ala Leu Glu Leu Lys Glu Glu Ser Phe Arg Asp Pro 515 520 525Ala Glu Val Leu Gly Thr Gly Ala Glu Val Asp Tyr Leu Glu Gln Phe 530 535 540Gly Thr Ser Ser Phe Lys Glu Ser Ala Leu Arg Lys Gln Ser Leu Tyr545 550 555 560Leu Lys Phe Asp Pro Leu Leu Arg Asp Ser Pro Gly Arg Pro Val Pro 565 570 575Val Ala Thr Glu Thr Ser Ser Met His Gly Ala Asn Glu Thr Pro Ser 580 585 590Gly Arg Pro Arg Glu Ala Lys Leu Val Glu Phe Asp Phe Leu Gly Ala 595 600 605Leu Asp Ile Pro Val Pro Gly Pro Pro Pro Gly Val Pro Ala Pro Gly 610 615 620Gly Pro Pro Leu Ser Thr Gly Pro Ile Val Asp Leu Leu Gln Tyr Ser625 630 635 640Gln Lys Asp Leu Asp Ala Val Val Lys Ala Thr Gln Glu Glu Asn Arg 645 650 655Glu Leu Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu 660 665 670Gly Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu 675 680 685Glu Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys Val 690 695 700Leu Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu Lys705 710 715 720Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val Ile 725 730 735Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val Glu Asp 740 745 750Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln Ala Leu Lys 755 760 765Ala His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu Glu Ile Ala Gln 770 775 780Val Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala Leu Gln Ala Ser Leu785 790 795 800Arg Lys Glu Gln Met Arg Ile Gln Ser Leu Glu Lys Thr Val Glu Gln 805 810 815Lys Thr Lys Glu Asn Glu Glu Leu Thr Arg Ile Cys Asp Asp Leu Ile 820 825 830Ser Lys Met Glu Lys Ile 835102427DNAHomo sapiens 10atgggcgccc ctgcctgcgc cctcgcgctc tgcgtggccg tggccatcgt ggccggcgcc 60tcctcggagt ccttggggac ggagcagcgc gtcgtggggc gagcggcaga agtcccgggc 120ccagagcccg gccagcagga gcagttggtc ttcggcagcg gggatgctgt ggagctgagc 180tgtcccccgc ccgggggtgg tcccatgggg cccactgtct gggtcaagga tggcacaggg 240ctggtgccct cggagcgtgt cctggtgggg ccccagcggc tgcaggtgct gaatgcctcc 300cacgaggact ccggggccta cagctgccgg cagcggctca cgcagcgcgt actgtgccac 360ttcagtgtgc gggtgacaga cgctccatcc tcgggagatg acgaagacgg ggaggacgag 420gctgaggaca caggtgtgga cacaggggcc ccttactgga cacggcccga gcggatggac 480aagaagctgc tggccgtgcc ggccgccaac accgtccgct tccgctgccc agccgctggc 540aaccccactc cctccatctc ctggctgaag aacggcaggg agttccgcgg cgagcaccgc 600attggaggca tcaagctgcg gcatcagcag tggagcctgg tcatggaaag cgtggtgccc 660tcggaccgcg gcaactacac ctgcgtcgtg gagaacaagt ttggcagcat ccggcagacg 720tacacgctgg acgtgctgga gcgctccccg caccggccca tcctgcaggc ggggctgccg 780gccaaccaga cggcggtgct gggcagcgac gtggagttcc actgcaaggt gtacagtgac 840gcacagcccc acatccagtg gctcaagcac gtggaggtga atggcagcaa ggtgggcccg 900gacggcacac cctacgttac cgtgctcaag tcctggatca gtgagagtgt ggaggccgac 960gtgcgcctcc gcctggccaa tgtgtcggag cgggacgggg gcgagtacct ctgtcgagcc 1020accaatttca taggcgtggc cgagaaggcc ttttggctga gcgttcacgg gccccgagca 1080gccgaggagg agctggtgga ggctgacgag gcgggcagtg tgtatgcagg catcctcagc 1140tacggggtgg gcttcttcct gttcatcctg gtggtggcgg ctgtgacgct ctgccgcctg 1200cgcagccccc ccaagaaagg cctgggctcc cccaccgtgc acaagatctc ccgcttcccg 1260ctcaagcgac aggtgtccct ggagtccaac gcgtccatga gctccaacac accactggtg 1320cgcatcgcaa ggctgtcctc aggggagggc cccacgctgg ccaatgtctc cgagctcgag 1380ctgcctgccg accccaaatg ggagctgtct cgggcccggc tgaccctggg caagcccctt 1440ggggagggct gcttcggcca ggtggtcatg gcggaggcca tcggcattga caaggaccgg 1500gccgccaagc ctgtcaccgt agccgtgaag atgctgaaag acgatgccac tgacaaggac 1560ctgtcggacc tggtgtctga gatggagatg atgaagatga tcgggaaaca caaaaacatc 1620atcaacctgc tgggcgcctg cacgcagggc gggcccctgt acgtgctggt ggagtacgcg 1680gccaagggta acctgcggga gtttctgcgg gcgcggcggc ccccgggcct ggactactcc 1740ttcgacacct gcaagccgcc cgaggagcag ctcaccttca aggacctggt gtcctgtgcc 1800taccaggtgg cccggggcat ggagtacttg gcctcccaga agtgcatcca cagggacctg 1860gctgcccgca atgtgctggt gaccgaggac aacgtgatga agatcgcaga cttcgggctg 1920gcccgggacg tgcacaacct cgactactac aagaagacaa ccaacggccg gctgcccgtg 1980aagtggatgg cgcctgaggc cttgtttgac cgagtctaca ctcaccagag tgacgtctgg 2040tcctttgggg tcctgctctg ggagatcttc acgctggggg gctccccgta ccccggcatc 2100cctgtggagg agctcttcaa gctgctgaag gagggccacc gcatggacaa gcccgccaac 2160tgcacacacg acctgtacat gatcatgcgg gagtgctggc atgccgcgcc ctcccagagg 2220cccaccttca agcagctggt ggaggacctg gaccgtgtcc ttaccgtgac gtccaccgac 2280gagtacctgg acctgtcggc gcctttcgag cagtactccc cgggtggcca ggacaccccc 2340agctccagct cctcagggga cgactccgtg tttgcccacg acctgctgcc cccggcccca 2400cccagcagtg ggggctcgcg gacgtga 2427112421DNAHomo sapiens 11atgggcgccc ctgcctgcgc cctcgcgctc tgcgtggccg tggccatcgt ggccggcgcc 60tcctcggagt ccttggggac ggagcagcgc gtcgtggggc gagcggcaga agtcccgggc 120ccagagcccg gccagcagga gcagttggtc ttcggcagcg gggatgctgt ggagctgagc 180tgtcccccgc ccgggggtgg tcccatgggg cccactgtct gggtcaagga tggcacaggg 240ctggtgccct cggagcgtgt cctggtgggg ccccagcggc tgcaggtgct gaatgcctcc 300cacgaggact ccggggccta cagctgccgg cagcggctca cgcagcgcgt actgtgccac 360ttcagtgtgc gggtgacaga cgctccatcc tcgggagatg acgaagacgg ggaggacgag 420gctgaggaca caggtgtgga cacaggggcc ccttactgga cacggcccga gcggatggac 480aagaagctgc tggccgtgcc ggccgccaac accgtccgct tccgctgccc agccgctggc 540aaccccactc cctccatctc ctggctgaag aacggcaggg agttccgcgg cgagcaccgc 600attggaggca tcaagctgcg gcatcagcag tggagcctgg tcatggaaag cgtggtgccc 660tcggaccgcg gcaactacac ctgcgtcgtg gagaacaagt ttggcagcat ccggcagacg 720tacacgctgg acgtgctgga gcgctccccg caccggccca tcctgcaggc ggggctgccg 780gccaaccaga cggcggtgct gggcagcgac gtggagttcc actgcaaggt gtacagtgac 840gcacagcccc acatccagtg gctcaagcac gtggaggtga atggcagcaa ggtgggcccg 900gacggcacac cctacgttac cgtgctcaag acggcgggcg ctaacaccac cgacaaggag 960ctagaggttc tctccttgca caacgtcacc tttgaggacg ccggggagta cacctgcctg 1020gcgggcaatt ctattgggtt ttctcatcac tctgcgtggc tggtggtgct gccagccgag 1080gaggagctgg tggaggctga cgaggcgggc agtgtgtatg caggcatcct cagctacggg 1140gtgggcttct tcctgttcat cctggtggtg gcggctgtga cgctctgccg cctgcgcagc 1200ccccccaaga aaggcctggg ctcccccacc gtgcacaaga tctcccgctt cccgctcaag 1260cgacaggtgt ccctggagtc caacgcgtcc atgagctcca acacaccact ggtgcgcatc 1320gcaaggctgt cctcagggga gggccccacg ctggccaatg tctccgagct cgagctgcct 1380gccgacccca aatgggagct gtctcgggcc cggctgaccc tgggcaagcc ccttggggag 1440ggctgcttcg gccaggtggt catggcggag gccatcggca ttgacaagga ccgggccgcc 1500aagcctgtca ccgtagccgt gaagatgctg aaagacgatg ccactgacaa ggacctgtcg 1560gacctggtgt ctgagatgga gatgatgaag atgatcggga aacacaaaaa catcatcaac 1620ctgctgggcg cctgcacgca gggcgggccc ctgtacgtgc tggtggagta cgcggccaag 1680ggtaacctgc gggagtttct gcgggcgcgg cggcccccgg gcctggacta ctccttcgac 1740acctgcaagc cgcccgagga gcagctcacc ttcaaggacc tggtgtcctg tgcctaccag 1800gtggcccggg gcatggagta cttggcctcc cagaagtgca tccacaggga cctggctgcc 1860cgcaatgtgc tggtgaccga ggacaacgtg atgaagatcg cagacttcgg gctggcccgg 1920gacgtgcaca acctcgacta ctacaagaag acaaccaacg gccggctgcc cgtgaagtgg 1980atggcgcctg aggccttgtt tgaccgagtc tacactcacc agagtgacgt ctggtccttt 2040ggggtcctgc tctgggagat cttcacgctg gggggctccc cgtaccccgg catccctgtg 2100gaggagctct tcaagctgct gaaggagggc caccgcatgg acaagcccgc caactgcaca 2160cacgacctgt acatgatcat gcgggagtgc tggcatgccg cgccctccca gaggcccacc 2220ttcaagcagc tggtggagga cctggaccgt gtccttaccg tgacgtccac cgacgagtac 2280ctggacctgt cggcgccttt cgagcagtac tccccgggtg gccaggacac ccccagctcc 2340agctcctcag gggacgactc cgtgtttgcc cacgacctgc tgcccccggc cccacccagc 2400agtgggggct cgcggacgtg a 2421121536DNAHomo sapiens 12atgtcccggg ggcccgagga ggtgaaccgg ctcacggaga gcacctaccg gaatgttatg 60gaacagttca atcctgggct gcgaaattta ataaacctgg ggaaaaatta tgagaaagct 120gtaaacgcta tgatcctggc aggaaaagcc tactacgatg gagtggccaa gatcggtgag 180attgccactg ggtcccccgt gtcaactgaa ctgggacatg tcctcataga gatttcaagt 240acccacaaga aactcaacga gagtcttgat gaaaatttta aaaaattcca caaagagatt 300atccatgagc tggagaagaa gatagaactt gacgtgaaat atatgaacgc aactctaaaa 360agataccaaa cagaacacaa gaataaatta gagtctttgg agaaatccca agctgagttg 420aagaagatca gaaggaaaag ccaaggaagc cgaaacgcac tcaaatatga acacaaagaa 480attgagtatg tggagaccgt tacttctcgt cagagtgaaa tccagaaatt cattgcagat 540ggttgcaaag aggctctgct tgaagagaag aggcgcttct gctttctggt tgataagcac 600tgtggctttg caaaccacat acattattat cacttacagt ctgcagaact actgaattcc 660aagctgcctc ggtggcagga gacctgtgtt gatgccatca aagtgccaga gaaaatcatg 720aatatgatcg aagaaataaa gaccccagcc tctacccccg tgtctggaac tcctcaggct 780tcacccatga tcgagagaag caatgtggtt aggaaagatt acgacaccct ttctaaatgc 840tcaccaaaga tgccccccgc tccttcaggc agagcatata ccagtccctt gatcgatatg 900tttaataacc cagccacggc tgccccgaat tcacaaaggg taaataattc aacaggtact 960tccgaagatc ccagtttaca gcgatcagtt tcggttgcaa cgggactgaa catgatgaag 1020aagcagaaag tgaagaccat cttcccgcac actgcgggct ccaacaagac cttactcagc 1080tttgcacagg gagatgtcat cacgctgctc atccccgagg agaaggatgg ctggctctat 1140ggagaacacg acgtgtccaa ggcgaggggt tggttcccgt cgtcgtacac gaagttgctg 1200gaagaaaatg agacagaagc agtgaccgtg cccacgccaa gccccacacc agtgagaagc 1260atcagcaccg tgaacttgtc tgagaatagc agtgttgtca tccccccacc cgactacttg 1320gaatgcttgt ccatgggggc agctgccgac aggagagcag attcggccag gacgacatcc 1380acctttaagg ccccagcgtc caagcccgag accgcggctc ctaacgatgc caacgggact 1440gcaaagccgc cttttctcag cggagaaaac ccctttgcca ctgtgaaact ccgcccgact 1500gtgacgaatg atcgctcggc acccatcatt cgatga 1536132517DNAHomo sapiens 13atgagtctgc aggtcttaaa cgacaaaaat gtcagcaatg aaaaaaatac agaaaattgc 60gacttcctgt tttcgccacc agaagttacc ggaagatcgt ctgttcttcg tgtgtcacag 120aaagaaaatg tgccacccaa gaacctggcc aaagctatga aggtgacttt tcagacacct 180ctgcgggatc cacagacgca caggattcta agtcctagca tggccagcaa acttgaggct 240cctttcactc aggatgacac ccttggactg gaaaactcac acccggtctg gacacagaaa 300gagaaccaac agctcatcaa ggaagtggat gccaaaacta ctcatggaat tctacagaaa 360ccagtggagg ctgacaccga cctcctgggg gatgcaagcc cagcctttgg gagtggcagc 420tccagcgagt ctggcccagg tgccctggct gacctggact gctcaagctc ttcccagagc 480ccaggaagtt ctgagaacca aatggtgtct ccaggaaaag tgtctggcag ccctgagcaa 540gccgtggagg aaaaccttag ttcctattcc ttagacagaa gagtgacacc cgcctctgag 600accctagaag acccttgcag gacagagtcc cagcacaaag cggagactcc gcacggagcc 660gaggaagaat gcaaagcgga gactccgcac ggagccgagg aggaatgccg gcacggtggg 720gtctgtgctc ccgcagcagt ggccacttcg cctcctggtg caatccctaa ggaagcctgc 780ggaggagcac ccctgcaggg tctgcctggc gaagccctgg gctgccctgc gggtgtgggc 840acccccgtgc cagcagatgg cactcagacc cttacctgtg cacacacctc tgctcctgag 900agcacagccc caaccaacca cctggtggct ggcagggcca tgaccctgag tcctcaggaa 960gaagtggctg caggccaaat ggccagctcc tcgaggagcg gacctgtaaa actagaattt 1020gatgtatctg atggcgccac cagcaaaagg gcacccccac caaggagact gggagagagg 1080tccggcctca agcctccctt gaggaaagca gcagtgaggc agcaaaaggc cccgcaggag 1140gtggaggagg acgacggtag gagcggagca ggagaggacc cccccatgcc agcttctcgg 1200ggctcttacc acctcgactg ggacaaaatg gatgacccaa acttcatccc gttcggaggt 1260gacaccaagt ctggttgcag tgaggcccag cccccagaaa gccctgagac caggctgggc 1320cagccagcgg ctgaacagtt gcatgctggg cctgccacgg aggagccagg tccctgtctg 1380agccagcagc tgcattcagc ctcagcggag gacacgcctg tggtgcagtt ggcagccgag 1440accccaacag cagagagcaa ggagagagcc ttgaactctg ccagcacctc gcttcccaca 1500agctgtccag gcagtgagcc agtgcccacc catcagcagg ggcagcctgc cttggagctg 1560aaagaggaga gcttcagaga ccccgctgag gttctaggca cgggcgcgga ggtggattac 1620ctggagcagt ttggaacttc ctcgtttaag gagtcggcct tgaggaagca gtccttatac 1680ctcaagttcg accccctcct gagggacagt cctggtagac cagtgcccgt ggccaccgag 1740accagcagca tgcacggtgc aaatgagact ccctcaggac gtccgcggga agccaagctt 1800gtggagttcg atttcttggg agcactggac attcctgtgc caggcccacc cccaggtgtt 1860cccgcgcctg ggggcccacc cctgtccacc ggacctatag tggacctgct ccagtacagc 1920cagaaggacc tggatgcagt ggtaaaggcg acacaggagg agaaccggga gctgaggagc 1980aggtgtgagg agctccacgg gaagaacctg gaactgggga agatcatgga caggttcgaa 2040gaggttgtgt accaggccat ggaggaagtt cagaagcaga aggaactttc caaagctgaa 2100atccagaaag ttctaaaaga aaaagaccaa cttaccacag atctgaactc catggagaag 2160tccttctccg acctcttcaa gcgttttgag aaacagaaag aggtgatcga gggctaccgc 2220aagaacgaag agtcactgaa gaagtgcgtg gaggattacc tggcaaggat cacccaggag 2280ggccagaggt accaagccct gaaggcccac gcggaggaga agctgcagct ggcaaacgag 2340gagatcgccc aggtccggag caaggcccag gcggaagcgt tggccctcca ggccagcctg 2400aggaaggagc agatgcgcat ccagtcgctg gagaagacag tggagcagaa gactaaagag 2460aacgaggagc tgaccaggat ctgcgacgac ctcatctcca agatggagaa gatctga 251714383DNAHomo sapiens 14aactgcacac acgacctgta catgatcatg cgggagtgct ggcatgccgc gccctcccag 60aggcccacct tcaagcagct ggtggaggac ctggaccgtg tccttaccgt gacgtccacc 120gacgtaaagg cgacacagga ggagaaccgg gagctgagga gcaggtgtga ggagctccac 180gggaagaacc tggaactggg gaagatcatg gacaggttcg aagaggttgt gtaccaggcc 240atggaggaag ttcagaagca gaaggaactt tccaaagctg aaatccagaa agttctaaaa 300gaaaaagacc aacttaccac agatctgaac tccatggaga agtccttctc cgacctcttc 360aagcgttttg agaaacagaa aga 38315448DNAHomo sapiens 15gctccccgta ccccggcatc cctgtggagg agctcttcaa gctgctgaag gagggccacc 60gcatggacaa gcccgccaac tgcacacacg acctgtacat gatcatgcgg gagtgctggc 120atgccgcgcc ctcccagagg cccaccttca agcagctggt ggaggacctg gaccgtgtcc 180ttaccgtgac gtccaccgac gtgagtgctg gctctggcct ggtgccaccc gcctatgccc 240ctccccctgc cgtccccggc catcctgccc cccagagtgc tgaggtgtgg ggcgggcctt 300ctggcccagg tgccctggct gacctggact gctcaagctc ttcccagagc ccaggaagtt 360ctgagaacca aatggtgtct ccaggaaaag tgtctggcag ccctgagcaa gccgtggagg 420aaaaccttag ttcctattcc ttagacag 44816427DNAHomo sapiens 16tctacactca ccagagtgac gtctggtcct ttggggtcct gctctgggag atcttcacgc 60tggggggctc cccgtacccc ggcatccctg tggaggagct cttcaagctg ctgaaggagg 120gccaccgcat ggacaagccc gccaactgca cacacgacct gtacatgatc atgcgggagt 180gctggcatgc cgcgccctcc cagaggccca ccttcaagca gctggtggag gacctggacc 240gtgtccttac cgtgacgtcc accgacaatg ttatggaaca gttcaatcct gggctgcgaa 300atttaataaa cctggggaaa aattatgaga aagctgtaaa cgctatgatc ctggcaggaa 360aagcctacta cgatggagtg gccaagatcg gtgagattgc cactgggtcc cccgtgtcaa 420ctgaact 4271721DNAArtificial SequenceAn artificially synthesized primer sequence 17caactgcaca cacgacctgt a 211822DNAArtificial SequenceAn artificially synthesized primer sequence 18ccatcgtagt aggcttttcc tg 22194PRTArtificial SequencePeptide linker sequence 19Gly Gly Gly Ser1204PRTArtificial SequencePeptide linker sequence 20Ser Gly Gly Gly1215PRTArtificial SequencePeptide linker sequence 21Gly Gly Gly Gly Ser1 5225PRTArtificial SequencePeptide linker sequence 22Ser Gly Gly Gly Gly1 5236PRTArtificial SequencePeptide linker sequence 23Gly Gly Gly Gly Gly Ser1 5246PRTArtificial SequencePeptide linker sequence 24Ser Gly Gly Gly Gly Gly1 5257PRTArtificial SequencePeptide linker sequence 25Gly Gly Gly Gly Gly Gly Ser1 5267PRTArtificial SequencePeptide linker sequence 26Ser Gly Gly Gly Gly Gly Gly1 5272856DNAHomo sapiensCDS(1)..(2856) 27atg ggc gcc cct gcc tgc gcc ctc

gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110ctc acg cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag tcc tgg atc agt gag agt gtg gag gcc gac 960Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320gtg cgc ctc cgc ctg gcc aat gtg tcg gag cgg gac ggg ggc gag tac 1008Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335ctc tgt cga gcc acc aat ttc ata ggc gtg gcc gag aag gcc ttt tgg 1056Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350ctg agc gtt cac ggg ccc cga gca gcc gag gag gag ctg gtg gag gct 1104Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365gac gag gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc 1152Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380ttc ttc ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg 1200Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400cgc agc ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc 1248Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415tcc cgc ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc 1296Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430atg agc tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg 1344Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445gag ggc ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac 1392Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460ccc aaa tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt 1440Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480ggg gag ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att 1488Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495gac aag gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg 1536Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510aaa gac gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg 1584Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525gag atg atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg 1632Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540ggc gcc tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg 1680Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560gcc aag ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc 1728Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575ctg gac tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc 1776Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590ttc aag gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag 1824Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605tac ttg gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat 1872Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620gtg ctg gtg acc gag gac aac gtg atg aag atc gca gac ttc ggg ctg 1920Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640gcc cgg gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc 1968Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655cgg ctg ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc 2016Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670tac act cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag 2064Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685atc ttc acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag 2112Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700ctc ttc aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac 2160Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720tgc aca cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg 2208Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735ccc tcc cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt 2256Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750gtc ctt acc gtg acg tcc acc gac gta aag gcg aca cag gag gag aac 2304Val Leu Thr Val Thr Ser Thr Asp Val Lys Ala Thr Gln Glu Glu Asn 755 760 765cgg gag ctg agg agc agg tgt gag gag ctc cac ggg aag aac ctg gaa 2352Arg Glu Leu Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu 770 775 780ctg ggg aag atc atg gac agg ttc gaa gag gtt gtg tac cag gcc atg 2400Leu Gly Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met785 790 795 800gag gaa gtt cag aag cag aag gaa ctt tcc aaa gct gaa atc cag aaa 2448Glu Glu Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys 805 810 815gtt cta aaa gaa aaa gac caa ctt acc aca gat ctg aac tcc atg gag 2496Val Leu Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu 820 825 830aag tcc ttc tcc gac ctc ttc aag cgt ttt gag aaa cag aaa gag gtg 2544Lys Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val 835 840 845atc gag ggc tac cgc aag aac gaa gag tca ctg aag aag tgc gtg gag 2592Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val Glu 850 855 860gat tac ctg gca agg atc acc cag gag ggc cag agg tac caa gcc ctg 2640Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln Ala Leu865 870 875 880aag gcc cac gcg gag gag aag ctg cag ctg gca aac gag gag atc gcc 2688Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu Glu Ile Ala 885 890 895cag gtc cgg agc aag gcc cag gcg gaa gcg ttg gcc ctc cag gcc agc 2736Gln Val Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala Leu Gln Ala Ser 900 905 910ctg agg aag gag cag atg cgc atc cag tcg ctg gag aag aca gtg gag 2784Leu Arg Lys Glu Gln Met Arg Ile Gln Ser Leu Glu Lys Thr Val Glu 915 920 925cag aag act aaa gag aac gag gag ctg acc agg atc tgc gac gac ctc 2832Gln Lys Thr Lys Glu Asn Glu Glu Leu Thr Arg Ile Cys Asp Asp Leu 930 935 940atc tcc aag atg gag aag atc tga 2856Ile Ser Lys Met Glu Lys Ile945 95028951PRTHomo sapiens 28Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750Val Leu Thr Val Thr Ser Thr Asp Val Lys Ala Thr Gln Glu Glu Asn 755 760 765Arg Glu Leu Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu 770 775 780Leu Gly Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met785 790 795 800Glu Glu Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys 805 810 815Val Leu Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu 820 825 830Lys Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val 835 840 845Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val Glu 850 855 860Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln Ala Leu865 870 875 880Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu Glu Ile Ala 885 890 895Gln Val Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala Leu Gln Ala Ser 900 905 910Leu Arg Lys Glu Gln Met Arg Ile Gln Ser Leu Glu Lys Thr Val Glu 915 920 925Gln Lys Thr Lys Glu Asn Glu Glu Leu Thr Arg Ile Cys Asp Asp Leu 930 935 940Ile Ser Lys

Met Glu Lys Ile945 950294467DNAHomo sapiensCDS(1)..(4467) 29atg ggc gcc cct gcc tgc gcc ctc gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110ctc acg cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag tcc tgg atc agt gag agt gtg gag gcc gac 960Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320gtg cgc ctc cgc ctg gcc aat gtg tcg gag cgg gac ggg ggc gag tac 1008Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335ctc tgt cga gcc acc aat ttc ata ggc gtg gcc gag aag gcc ttt tgg 1056Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350ctg agc gtt cac ggg ccc cga gca gcc gag gag gag ctg gtg gag gct 1104Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365gac gag gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc 1152Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380ttc ttc ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg 1200Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400cgc agc ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc 1248Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415tcc cgc ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc 1296Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430atg agc tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg 1344Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445gag ggc ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac 1392Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460ccc aaa tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt 1440Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480ggg gag ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att 1488Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495gac aag gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg 1536Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510aaa gac gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg 1584Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525gag atg atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg 1632Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540ggc gcc tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg 1680Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560gcc aag ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc 1728Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575ctg gac tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc 1776Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590ttc aag gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag 1824Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605tac ttg gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat 1872Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620gtg ctg gtg acc gag gac aac gtg atg aag atc gca gac ttc ggg ctg 1920Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640gcc cgg gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc 1968Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655cgg ctg ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc 2016Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670tac act cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag 2064Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685atc ttc acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag 2112Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700ctc ttc aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac 2160Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720tgc aca cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg 2208Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735ccc tcc cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt 2256Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750gtc ctt acc gtg acg tcc acc gac gtg agt gct ggc tct ggc ctg gtg 2304Val Leu Thr Val Thr Ser Thr Asp Val Ser Ala Gly Ser Gly Leu Val 755 760 765cca ccc gcc tat gcc cct ccc cct gcc gtc ccc ggc cat cct gcc ccc 2352Pro Pro Ala Tyr Ala Pro Pro Pro Ala Val Pro Gly His Pro Ala Pro 770 775 780cag agt gct gag gtg tgg ggc ggg cct tct ggc cca ggt gcc ctg gct 2400Gln Ser Ala Glu Val Trp Gly Gly Pro Ser Gly Pro Gly Ala Leu Ala785 790 795 800gac ctg gac tgc tca agc tct tcc cag agc cca gga agt tct gag aac 2448Asp Leu Asp Cys Ser Ser Ser Ser Gln Ser Pro Gly Ser Ser Glu Asn 805 810 815caa atg gtg tct cca gga aaa gtg tct ggc agc cct gag caa gcc gtg 2496Gln Met Val Ser Pro Gly Lys Val Ser Gly Ser Pro Glu Gln Ala Val 820 825 830gag gaa aac ctt agt tcc tat tcc tta gac aga aga gtg aca ccc gcc 2544Glu Glu Asn Leu Ser Ser Tyr Ser Leu Asp Arg Arg Val Thr Pro Ala 835 840 845tct gag acc cta gaa gac cct tgc agg aca gag tcc cag cac aaa gcg 2592Ser Glu Thr Leu Glu Asp Pro Cys Arg Thr Glu Ser Gln His Lys Ala 850 855 860gag act ccg cac gga gcc gag gaa gaa tgc aaa gcg gag act ccg cac 2640Glu Thr Pro His Gly Ala Glu Glu Glu Cys Lys Ala Glu Thr Pro His865 870 875 880gga gcc gag gag gaa tgc cgg cac ggt ggg gtc tgt gct ccc gca gca 2688Gly Ala Glu Glu Glu Cys Arg His Gly Gly Val Cys Ala Pro Ala Ala 885 890 895gtg gcc act tcg cct cct ggt gca atc cct aag gaa gcc tgc gga gga 2736Val Ala Thr Ser Pro Pro Gly Ala Ile Pro Lys Glu Ala Cys Gly Gly 900 905 910gca ccc ctg cag ggt ctg cct ggc gaa gcc ctg ggc tgc cct gcg ggt 2784Ala Pro Leu Gln Gly Leu Pro Gly Glu Ala Leu Gly Cys Pro Ala Gly 915 920 925gtg ggc acc ccc gtg cca gca gat ggc act cag acc ctt acc tgt gca 2832Val Gly Thr Pro Val Pro Ala Asp Gly Thr Gln Thr Leu Thr Cys Ala 930 935 940cac acc tct gct cct gag agc aca gcc cca acc aac cac ctg gtg gct 2880His Thr Ser Ala Pro Glu Ser Thr Ala Pro Thr Asn His Leu Val Ala945 950 955 960ggc agg gcc atg acc ctg agt cct cag gaa gaa gtg gct gca ggc caa 2928Gly Arg Ala Met Thr Leu Ser Pro Gln Glu Glu Val Ala Ala Gly Gln 965 970 975atg gcc agc tcc tcg agg agc gga cct gta aaa cta gaa ttt gat gta 2976Met Ala Ser Ser Ser Arg Ser Gly Pro Val Lys Leu Glu Phe Asp Val 980 985 990tct gat ggc gcc acc agc aaa agg gca ccc cca cca agg aga ctg gga 3024Ser Asp Gly Ala Thr Ser Lys Arg Ala Pro Pro Pro Arg Arg Leu Gly 995 1000 1005gag agg tcc ggc ctc aag cct ccc ttg agg aaa gca gca gtg agg 3069Glu Arg Ser Gly Leu Lys Pro Pro Leu Arg Lys Ala Ala Val Arg 1010 1015 1020cag caa aag gcc ccg cag gag gtg gag gag gac gac ggt agg agc 3114Gln Gln Lys Ala Pro Gln Glu Val Glu Glu Asp Asp Gly Arg Ser 1025 1030 1035gga gca gga gag gac ccc ccc atg cca gct tct cgg ggc tct tac 3159Gly Ala Gly Glu Asp Pro Pro Met Pro Ala Ser Arg Gly Ser Tyr 1040 1045 1050cac ctc gac tgg gac aaa atg gat gac cca aac ttc atc ccg ttc 3204His Leu Asp Trp Asp Lys Met Asp Asp Pro Asn Phe Ile Pro Phe 1055 1060 1065gga ggt gac acc aag tct ggt tgc agt gag gcc cag ccc cca gaa 3249Gly Gly Asp Thr Lys Ser Gly Cys Ser Glu Ala Gln Pro Pro Glu 1070 1075 1080agc cct gag acc agg ctg ggc cag cca gcg gct gaa cag ttg cat 3294Ser Pro Glu Thr Arg Leu Gly Gln Pro Ala Ala Glu Gln Leu His 1085 1090 1095gct ggg cct gcc acg gag gag cca ggt ccc tgt ctg agc cag cag 3339Ala Gly Pro Ala Thr Glu Glu Pro Gly Pro Cys Leu Ser Gln Gln 1100 1105 1110ctg cat tca gcc tca gcg gag gac acg cct gtg gtg cag ttg gca 3384Leu His Ser Ala Ser Ala Glu Asp Thr Pro Val Val Gln Leu Ala 1115 1120 1125gcc gag acc cca aca gca gag agc aag gag aga gcc ttg aac tct 3429Ala Glu Thr Pro Thr Ala Glu Ser Lys Glu Arg Ala Leu Asn Ser 1130 1135 1140gcc agc acc tcg ctt ccc aca agc tgt cca ggc agt gag cca gtg 3474Ala Ser Thr Ser Leu Pro Thr Ser Cys Pro Gly Ser Glu Pro Val 1145 1150 1155ccc acc cat cag cag ggg cag cct gcc ttg gag ctg aaa gag gag 3519Pro Thr His Gln Gln Gly Gln Pro Ala Leu Glu Leu Lys Glu Glu 1160 1165 1170agc ttc aga gac ccc gct gag gtt cta ggc acg ggc gcg gag gtg 3564Ser Phe Arg Asp Pro Ala Glu Val Leu Gly Thr Gly Ala Glu Val 1175 1180 1185gat tac ctg gag cag ttt gga act tcc tcg ttt aag gag tcg gcc 3609Asp Tyr Leu Glu Gln Phe Gly Thr Ser Ser Phe Lys Glu Ser Ala 1190 1195 1200ttg agg aag cag tcc tta tac ctc aag ttc gac ccc ctc ctg agg 3654Leu Arg Lys Gln Ser Leu Tyr Leu Lys Phe Asp Pro Leu Leu Arg 1205 1210 1215gac agt cct ggt aga cca gtg ccc gtg gcc acc gag acc agc agc 3699Asp Ser Pro Gly Arg Pro Val Pro Val Ala Thr Glu Thr Ser Ser 1220 1225 1230atg cac ggt gca aat gag act ccc tca gga cgt ccg cgg gaa gcc 3744Met His Gly Ala Asn Glu Thr Pro Ser Gly Arg Pro Arg Glu Ala 1235 1240 1245aag ctt gtg gag ttc gat ttc ttg gga gca ctg gac att cct gtg 3789Lys Leu Val Glu Phe Asp Phe Leu Gly Ala Leu Asp Ile Pro Val 1250 1255 1260cca ggc cca ccc cca ggt gtt ccc gcg cct ggg ggc cca ccc ctg 3834Pro Gly Pro Pro Pro Gly Val Pro Ala Pro Gly Gly Pro Pro Leu 1265 1270 1275tcc acc gga cct ata gtg gac ctg ctc cag tac agc cag aag gac 3879Ser Thr Gly Pro Ile Val Asp Leu Leu Gln Tyr Ser Gln Lys Asp 1280 1285 1290ctg gat gca gtg gta aag gcg aca cag gag gag aac cgg gag ctg 3924Leu Asp Ala Val Val Lys Ala Thr Gln Glu Glu Asn Arg Glu Leu 1295 1300 1305agg agc agg tgt gag gag ctc cac ggg aag aac ctg gaa ctg ggg 3969Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly 1310 1315 1320aag atc atg gac agg ttc gaa gag gtt gtg tac cag gcc atg gag 4014Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu 1325 1330 1335gaa gtt cag aag cag aag gaa ctt tcc aaa gct gaa atc cag aaa 4059Glu Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys 1340 1345 1350gtt cta aaa gaa aaa gac caa ctt acc aca gat ctg aac tcc atg 4104Val Leu Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met 1355 1360 1365gag aag tcc ttc tcc gac ctc ttc aag cgt ttt gag aaa cag aaa 4149Glu Lys Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys 1370 1375 1380gag gtg atc gag ggc tac cgc aag aac gaa gag tca ctg aag aag 4194Glu Val Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys 1385 1390 1395tgc gtg gag gat tac ctg gca agg atc acc cag gag ggc cag agg 4239Cys Val Glu Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg 1400 1405 1410tac caa gcc ctg aag gcc cac gcg gag gag aag ctg cag ctg gca 4284Tyr Gln Ala Leu Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala 1415 1420 1425aac gag gag atc gcc cag gtc cgg agc aag gcc cag gcg gaa gcg 4329Asn Glu Glu Ile Ala Gln Val Arg Ser Lys Ala Gln Ala Glu Ala 1430 1435 1440ttg gcc ctc cag gcc agc ctg agg aag gag cag atg cgc atc cag 4374Leu Ala Leu Gln Ala Ser Leu Arg Lys Glu Gln Met Arg Ile Gln 1445 1450 1455tcg ctg gag aag aca gtg gag cag aag act aaa gag aac gag gag 4419Ser Leu Glu Lys Thr Val Glu Gln Lys Thr Lys Glu Asn Glu Glu 1460 1465 1470ctg acc agg atc tgc gac gac ctc atc tcc aag atg gag aag atc 4464Leu Thr Arg Ile Cys Asp Asp Leu Ile Ser Lys Met Glu Lys Ile 1475 1480 1485tga 4467301488PRTHomo sapiens 30Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25

30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750Val Leu Thr Val Thr Ser Thr Asp Val Ser Ala Gly Ser Gly Leu Val 755 760 765Pro Pro Ala Tyr Ala Pro Pro Pro Ala Val Pro Gly His Pro Ala Pro 770 775 780Gln Ser Ala Glu Val Trp Gly Gly Pro Ser Gly Pro Gly Ala Leu Ala785 790 795 800Asp Leu Asp Cys Ser Ser Ser Ser Gln Ser Pro Gly Ser Ser Glu Asn 805 810 815Gln Met Val Ser Pro Gly Lys Val Ser Gly Ser Pro Glu Gln Ala Val 820 825 830Glu Glu Asn Leu Ser Ser Tyr Ser Leu Asp Arg Arg Val Thr Pro Ala 835 840 845Ser Glu Thr Leu Glu Asp Pro Cys Arg Thr Glu Ser Gln His Lys Ala 850 855 860Glu Thr Pro His Gly Ala Glu Glu Glu Cys Lys Ala Glu Thr Pro His865 870 875 880Gly Ala Glu Glu Glu Cys Arg His Gly Gly Val Cys Ala Pro Ala Ala 885 890 895Val Ala Thr Ser Pro Pro Gly Ala Ile Pro Lys Glu Ala Cys Gly Gly 900 905 910Ala Pro Leu Gln Gly Leu Pro Gly Glu Ala Leu Gly Cys Pro Ala Gly 915 920 925Val Gly Thr Pro Val Pro Ala Asp Gly Thr Gln Thr Leu Thr Cys Ala 930 935 940His Thr Ser Ala Pro Glu Ser Thr Ala Pro Thr Asn His Leu Val Ala945 950 955 960Gly Arg Ala Met Thr Leu Ser Pro Gln Glu Glu Val Ala Ala Gly Gln 965 970 975Met Ala Ser Ser Ser Arg Ser Gly Pro Val Lys Leu Glu Phe Asp Val 980 985 990Ser Asp Gly Ala Thr Ser Lys Arg Ala Pro Pro Pro Arg Arg Leu Gly 995 1000 1005Glu Arg Ser Gly Leu Lys Pro Pro Leu Arg Lys Ala Ala Val Arg 1010 1015 1020Gln Gln Lys Ala Pro Gln Glu Val Glu Glu Asp Asp Gly Arg Ser 1025 1030 1035Gly Ala Gly Glu Asp Pro Pro Met Pro Ala Ser Arg Gly Ser Tyr 1040 1045 1050His Leu Asp Trp Asp Lys Met Asp Asp Pro Asn Phe Ile Pro Phe 1055 1060 1065Gly Gly Asp Thr Lys Ser Gly Cys Ser Glu Ala Gln Pro Pro Glu 1070 1075 1080Ser Pro Glu Thr Arg Leu Gly Gln Pro Ala Ala Glu Gln Leu His 1085 1090 1095Ala Gly Pro Ala Thr Glu Glu Pro Gly Pro Cys Leu Ser Gln Gln 1100 1105 1110Leu His Ser Ala Ser Ala Glu Asp Thr Pro Val Val Gln Leu Ala 1115 1120 1125Ala Glu Thr Pro Thr Ala Glu Ser Lys Glu Arg Ala Leu Asn Ser 1130 1135 1140Ala Ser Thr Ser Leu Pro Thr Ser Cys Pro Gly Ser Glu Pro Val 1145 1150 1155Pro Thr His Gln Gln Gly Gln Pro Ala Leu Glu Leu Lys Glu Glu 1160 1165 1170Ser Phe Arg Asp Pro Ala Glu Val Leu Gly Thr Gly Ala Glu Val 1175 1180 1185Asp Tyr Leu Glu Gln Phe Gly Thr Ser Ser Phe Lys Glu Ser Ala 1190 1195 1200Leu Arg Lys Gln Ser Leu Tyr Leu Lys Phe Asp Pro Leu Leu Arg 1205 1210 1215Asp Ser Pro Gly Arg Pro Val Pro Val Ala Thr Glu Thr Ser Ser 1220 1225 1230Met His Gly Ala Asn Glu Thr Pro Ser Gly Arg Pro Arg Glu Ala 1235 1240 1245Lys Leu Val Glu Phe Asp Phe Leu Gly Ala Leu Asp Ile Pro Val 1250 1255 1260Pro Gly Pro Pro Pro Gly Val Pro Ala Pro Gly Gly Pro Pro Leu 1265 1270 1275Ser Thr Gly Pro Ile Val Asp Leu Leu Gln Tyr Ser Gln Lys Asp 1280 1285 1290Leu Asp Ala Val Val Lys Ala Thr Gln Glu Glu Asn Arg Glu Leu 1295 1300 1305Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly 1310 1315 1320Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu 1325 1330 1335Glu Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys 1340 1345 1350Val Leu Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met 1355 1360 1365Glu Lys Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys 1370 1375 1380Glu Val Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys 1385 1390 1395Cys Val Glu Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg 1400 1405 1410Tyr Gln Ala Leu Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala 1415 1420 1425Asn Glu Glu Ile Ala Gln Val Arg Ser Lys Ala Gln Ala Glu Ala 1430 1435 1440Leu Ala Leu Gln Ala Ser Leu Arg Lys Glu Gln Met Arg Ile Gln 1445 1450 1455Ser Leu Glu Lys Thr Val Glu Gln Lys Thr Lys Glu Asn Glu Glu 1460 1465 1470Leu Thr Arg Ile Cys Asp Asp Leu Ile Ser Lys Met Glu Lys Ile 1475 1480 1485313765DNAHomo sapiensCDS(1)..(3765) 31atg ggc gcc cct gcc tgc gcc ctc gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110ctc acg cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag tcc tgg atc agt gag agt gtg gag gcc gac 960Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320gtg cgc ctc cgc ctg gcc aat gtg tcg gag cgg gac ggg ggc gag tac 1008Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335ctc tgt cga gcc acc aat ttc ata ggc gtg gcc gag aag gcc ttt tgg 1056Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350ctg agc gtt cac ggg ccc cga gca gcc gag gag gag ctg gtg gag gct 1104Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365gac gag gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc 1152Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380ttc ttc ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg 1200Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400cgc agc ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc 1248Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415tcc cgc ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc 1296Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430atg agc tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg 1344Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445gag ggc ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac 1392Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460ccc aaa tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt 1440Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480ggg gag ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att 1488Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495gac aag gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg 1536Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510aaa gac gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg 1584Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525gag atg atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg 1632Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540ggc gcc tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg 1680Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560gcc aag ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc 1728Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575ctg gac tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc 1776Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590ttc aag gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag 1824Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605tac ttg gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat 1872Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620gtg ctg gtg acc gag gac aac gtg atg aag atc

gca gac ttc ggg ctg 1920Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640gcc cgg gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc 1968Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655cgg ctg ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc 2016Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670tac act cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag 2064Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685atc ttc acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag 2112Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700ctc ttc aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac 2160Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720tgc aca cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg 2208Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735ccc tcc cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt 2256Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750gtc ctt acc gtg acg tcc acc gac aat gtt atg gaa cag ttc aat cct 2304Val Leu Thr Val Thr Ser Thr Asp Asn Val Met Glu Gln Phe Asn Pro 755 760 765ggg ctg cga aat tta ata aac ctg ggg aaa aat tat gag aaa gct gta 2352Gly Leu Arg Asn Leu Ile Asn Leu Gly Lys Asn Tyr Glu Lys Ala Val 770 775 780aac gct atg atc ctg gca gga aaa gcc tac tac gat gga gtg gcc aag 2400Asn Ala Met Ile Leu Ala Gly Lys Ala Tyr Tyr Asp Gly Val Ala Lys785 790 795 800atc ggt gag att gcc act ggg tcc ccc gtg tca act gaa ctg gga cat 2448Ile Gly Glu Ile Ala Thr Gly Ser Pro Val Ser Thr Glu Leu Gly His 805 810 815gtc ctc ata gag att tca agt acc cac aag aaa ctc aac gag agt ctt 2496Val Leu Ile Glu Ile Ser Ser Thr His Lys Lys Leu Asn Glu Ser Leu 820 825 830gat gaa aat ttt aaa aaa ttc cac aaa gag att atc cat gag ctg gag 2544Asp Glu Asn Phe Lys Lys Phe His Lys Glu Ile Ile His Glu Leu Glu 835 840 845aag aag ata gaa ctt gac gtg aaa tat atg aac gca act cta aaa aga 2592Lys Lys Ile Glu Leu Asp Val Lys Tyr Met Asn Ala Thr Leu Lys Arg 850 855 860tac caa aca gaa cac aag aat aaa tta gag tct ttg gag aaa tcc caa 2640Tyr Gln Thr Glu His Lys Asn Lys Leu Glu Ser Leu Glu Lys Ser Gln865 870 875 880gct gag ttg aag aag atc aga agg aaa agc caa gga agc cga aac gca 2688Ala Glu Leu Lys Lys Ile Arg Arg Lys Ser Gln Gly Ser Arg Asn Ala 885 890 895ctc aaa tat gaa cac aaa gaa att gag tat gtg gag acc gtt act tct 2736Leu Lys Tyr Glu His Lys Glu Ile Glu Tyr Val Glu Thr Val Thr Ser 900 905 910cgt cag agt gaa atc cag aaa ttc att gca gat ggt tgc aaa gag gct 2784Arg Gln Ser Glu Ile Gln Lys Phe Ile Ala Asp Gly Cys Lys Glu Ala 915 920 925ctg ctt gaa gag aag agg cgc ttc tgc ttt ctg gtt gat aag cac tgt 2832Leu Leu Glu Glu Lys Arg Arg Phe Cys Phe Leu Val Asp Lys His Cys 930 935 940ggc ttt gca aac cac ata cat tat tat cac tta cag tct gca gaa cta 2880Gly Phe Ala Asn His Ile His Tyr Tyr His Leu Gln Ser Ala Glu Leu945 950 955 960ctg aat tcc aag ctg cct cgg tgg cag gag acc tgt gtt gat gcc atc 2928Leu Asn Ser Lys Leu Pro Arg Trp Gln Glu Thr Cys Val Asp Ala Ile 965 970 975aaa gtg cca gag aaa atc atg aat atg atc gaa gaa ata aag acc cca 2976Lys Val Pro Glu Lys Ile Met Asn Met Ile Glu Glu Ile Lys Thr Pro 980 985 990gcc tct acc ccc gtg tct gga act cct cag gct tca ccc atg atc gag 3024Ala Ser Thr Pro Val Ser Gly Thr Pro Gln Ala Ser Pro Met Ile Glu 995 1000 1005aga agc aat gtg gtt agg aaa gat tac gac acc ctt tct aaa tgc 3069Arg Ser Asn Val Val Arg Lys Asp Tyr Asp Thr Leu Ser Lys Cys 1010 1015 1020tca cca aag atg ccc ccc gct cct tca ggc aga gca tat acc agt 3114Ser Pro Lys Met Pro Pro Ala Pro Ser Gly Arg Ala Tyr Thr Ser 1025 1030 1035ccc ttg atc gat atg ttt aat aac cca gcc acg gct gcc ccg aat 3159Pro Leu Ile Asp Met Phe Asn Asn Pro Ala Thr Ala Ala Pro Asn 1040 1045 1050tca caa agg gta aat aat tca aca ggt act tcc gaa gat ccc agt 3204Ser Gln Arg Val Asn Asn Ser Thr Gly Thr Ser Glu Asp Pro Ser 1055 1060 1065tta cag cga tca gtt tcg gtt gca acg gga ctg aac atg atg aag 3249Leu Gln Arg Ser Val Ser Val Ala Thr Gly Leu Asn Met Met Lys 1070 1075 1080aag cag aaa gtg aag acc atc ttc ccg cac act gcg ggc tcc aac 3294Lys Gln Lys Val Lys Thr Ile Phe Pro His Thr Ala Gly Ser Asn 1085 1090 1095aag acc tta ctc agc ttt gca cag gga gat gtc atc acg ctg ctc 3339Lys Thr Leu Leu Ser Phe Ala Gln Gly Asp Val Ile Thr Leu Leu 1100 1105 1110atc ccc gag gag aag gat ggc tgg ctc tat gga gaa cac gac gtg 3384Ile Pro Glu Glu Lys Asp Gly Trp Leu Tyr Gly Glu His Asp Val 1115 1120 1125tcc aag gcg agg ggt tgg ttc ccg tcg tcg tac acg aag ttg ctg 3429Ser Lys Ala Arg Gly Trp Phe Pro Ser Ser Tyr Thr Lys Leu Leu 1130 1135 1140gaa gaa aat gag aca gaa gca gtg acc gtg ccc acg cca agc ccc 3474Glu Glu Asn Glu Thr Glu Ala Val Thr Val Pro Thr Pro Ser Pro 1145 1150 1155aca cca gtg aga agc atc agc acc gtg aac ttg tct gag aat agc 3519Thr Pro Val Arg Ser Ile Ser Thr Val Asn Leu Ser Glu Asn Ser 1160 1165 1170agt gtt gtc atc ccc cca ccc gac tac ttg gaa tgc ttg tcc atg 3564Ser Val Val Ile Pro Pro Pro Asp Tyr Leu Glu Cys Leu Ser Met 1175 1180 1185ggg gca gct gcc gac agg aga gca gat tcg gcc agg acg aca tcc 3609Gly Ala Ala Ala Asp Arg Arg Ala Asp Ser Ala Arg Thr Thr Ser 1190 1195 1200acc ttt aag gcc cca gcg tcc aag ccc gag acc gcg gct cct aac 3654Thr Phe Lys Ala Pro Ala Ser Lys Pro Glu Thr Ala Ala Pro Asn 1205 1210 1215gat gcc aac ggg act gca aag ccg cct ttt ctc agc gga gaa aac 3699Asp Ala Asn Gly Thr Ala Lys Pro Pro Phe Leu Ser Gly Glu Asn 1220 1225 1230ccc ttt gcc act gtg aaa ctc cgc ccg act gtg acg aat gat cgc 3744Pro Phe Ala Thr Val Lys Leu Arg Pro Thr Val Thr Asn Asp Arg 1235 1240 1245tcg gca ccc atc att cga tga 3765Ser Ala Pro Ile Ile Arg 1250321254PRTHomo sapiens 32Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Ser Trp Ile Ser Glu Ser Val Glu Ala Asp305 310 315 320Val Arg Leu Arg Leu Ala Asn Val Ser Glu Arg Asp Gly Gly Glu Tyr 325 330 335Leu Cys Arg Ala Thr Asn Phe Ile Gly Val Ala Glu Lys Ala Phe Trp 340 345 350Leu Ser Val His Gly Pro Arg Ala Ala Glu Glu Glu Leu Val Glu Ala 355 360 365Asp Glu Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly 370 375 380Phe Phe Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu385 390 395 400Arg Ser Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile 405 410 415Ser Arg Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser 420 425 430Met Ser Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly 435 440 445Glu Gly Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp 450 455 460Pro Lys Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu465 470 475 480Gly Glu Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile 485 490 495Asp Lys Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu 500 505 510Lys Asp Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met 515 520 525Glu Met Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu 530 535 540Gly Ala Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala545 550 555 560Ala Lys Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly 565 570 575Leu Asp Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr 580 585 590Phe Lys Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu 595 600 605Tyr Leu Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn 610 615 620Val Leu Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu625 630 635 640Ala Arg Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly 645 650 655Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val 660 665 670Tyr Thr His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu 675 680 685Ile Phe Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu 690 695 700Leu Phe Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn705 710 715 720Cys Thr His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala 725 730 735Pro Ser Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg 740 745 750Val Leu Thr Val Thr Ser Thr Asp Asn Val Met Glu Gln Phe Asn Pro 755 760 765Gly Leu Arg Asn Leu Ile Asn Leu Gly Lys Asn Tyr Glu Lys Ala Val 770 775 780Asn Ala Met Ile Leu Ala Gly Lys Ala Tyr Tyr Asp Gly Val Ala Lys785 790 795 800Ile Gly Glu Ile Ala Thr Gly Ser Pro Val Ser Thr Glu Leu Gly His 805 810 815Val Leu Ile Glu Ile Ser Ser Thr His Lys Lys Leu Asn Glu Ser Leu 820 825 830Asp Glu Asn Phe Lys Lys Phe His Lys Glu Ile Ile His Glu Leu Glu 835 840 845Lys Lys Ile Glu Leu Asp Val Lys Tyr Met Asn Ala Thr Leu Lys Arg 850 855 860Tyr Gln Thr Glu His Lys Asn Lys Leu Glu Ser Leu Glu Lys Ser Gln865 870 875 880Ala Glu Leu Lys Lys Ile Arg Arg Lys Ser Gln Gly Ser Arg Asn Ala 885 890 895Leu Lys Tyr Glu His Lys Glu Ile Glu Tyr Val Glu Thr Val Thr Ser 900 905 910Arg Gln Ser Glu Ile Gln Lys Phe Ile Ala Asp Gly Cys Lys Glu Ala 915 920 925Leu Leu Glu Glu Lys Arg Arg Phe Cys Phe Leu Val Asp Lys His Cys 930 935 940Gly Phe Ala Asn His Ile His Tyr Tyr His Leu Gln Ser Ala Glu Leu945 950 955 960Leu Asn Ser Lys Leu Pro Arg Trp Gln Glu Thr Cys Val Asp Ala Ile 965 970 975Lys Val Pro Glu Lys Ile Met Asn Met Ile Glu Glu Ile Lys Thr Pro 980 985 990Ala Ser Thr Pro Val Ser Gly Thr Pro Gln Ala Ser Pro Met Ile Glu 995 1000 1005Arg Ser Asn Val Val Arg Lys Asp Tyr Asp Thr Leu Ser Lys Cys 1010 1015 1020Ser Pro Lys Met Pro Pro Ala Pro Ser Gly Arg Ala Tyr Thr Ser 1025 1030 1035Pro Leu Ile Asp Met Phe Asn Asn Pro Ala Thr Ala Ala Pro Asn 1040 1045 1050Ser Gln Arg Val Asn Asn Ser Thr Gly Thr Ser Glu Asp Pro Ser 1055 1060 1065Leu Gln Arg Ser Val Ser Val Ala Thr Gly Leu Asn Met Met Lys 1070 1075 1080Lys Gln Lys Val Lys Thr Ile Phe Pro His Thr Ala Gly Ser Asn 1085 1090 1095Lys Thr Leu Leu Ser Phe Ala Gln Gly Asp Val Ile Thr Leu Leu 1100 1105 1110Ile Pro Glu Glu Lys Asp Gly Trp Leu Tyr Gly Glu His Asp Val 1115 1120 1125Ser Lys Ala Arg Gly Trp Phe Pro Ser Ser Tyr Thr Lys Leu Leu 1130 1135 1140Glu Glu Asn Glu Thr Glu Ala Val Thr Val Pro Thr Pro Ser Pro 1145 1150 1155Thr Pro Val Arg Ser Ile Ser Thr Val Asn Leu Ser Glu Asn Ser 1160 1165 1170Ser Val Val Ile Pro Pro Pro Asp Tyr Leu Glu Cys Leu Ser Met 1175 1180 1185Gly Ala Ala Ala Asp Arg Arg Ala Asp Ser Ala Arg Thr Thr Ser 1190 1195 1200Thr Phe Lys Ala Pro Ala Ser Lys Pro Glu Thr Ala Ala Pro Asn 1205 1210 1215Asp Ala Asn Gly Thr Ala Lys Pro Pro Phe Leu Ser Gly Glu Asn 1220 1225 1230Pro Phe Ala Thr Val Lys Leu Arg Pro Thr Val Thr Asn Asp Arg 1235 1240 1245Ser Ala Pro Ile Ile Arg 1250332850DNAHomo sapiensCDS(1)..(2850) 33atg ggc gcc cct gcc tgc gcc ctc gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110ctc acg

cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag acg gcg ggc gct aac acc acc gac aag gag 960Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320cta gag gtt ctc tcc ttg cac aac gtc acc ttt gag gac gcc ggg gag 1008Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335tac acc tgc ctg gcg ggc aat tct att ggg ttt tct cat cac tct gcg 1056Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350tgg ctg gtg gtg ctg cca gcc gag gag gag ctg gtg gag gct gac gag 1104Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc ttc ttc 1152Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg cgc agc 1200Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc tcc cgc 1248Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc atg agc 1296Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg gag ggc 1344Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac ccc aaa 1392Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt ggg gag 1440Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att gac aag 1488Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg aaa gac 1536Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg gag atg 1584Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg ggc gcc 1632Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg gcc aag 1680Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc ctg gac 1728Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc ttc aag 1776Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag tac ttg 1824Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat gtg ctg 1872Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620gtg acc gag gac aac gtg atg aag atc gca gac ttc ggg ctg gcc cgg 1920Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc cgg ctg 1968Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc tac act 2016Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag atc ttc 2064His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag ctc ttc 2112Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac tgc aca 2160Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg ccc tcc 2208His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt gtc ctt 2256Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750acc gtg acg tcc acc gac gta aag gcg aca cag gag gag aac cgg gag 2304Thr Val Thr Ser Thr Asp Val Lys Ala Thr Gln Glu Glu Asn Arg Glu 755 760 765ctg agg agc agg tgt gag gag ctc cac ggg aag aac ctg gaa ctg ggg 2352Leu Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly 770 775 780aag atc atg gac agg ttc gaa gag gtt gtg tac cag gcc atg gag gaa 2400Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu Glu785 790 795 800gtt cag aag cag aag gaa ctt tcc aaa gct gaa atc cag aaa gtt cta 2448Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys Val Leu 805 810 815aaa gaa aaa gac caa ctt acc aca gat ctg aac tcc atg gag aag tcc 2496Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu Lys Ser 820 825 830ttc tcc gac ctc ttc aag cgt ttt gag aaa cag aaa gag gtg atc gag 2544Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val Ile Glu 835 840 845ggc tac cgc aag aac gaa gag tca ctg aag aag tgc gtg gag gat tac 2592Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val Glu Asp Tyr 850 855 860ctg gca agg atc acc cag gag ggc cag agg tac caa gcc ctg aag gcc 2640Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln Ala Leu Lys Ala865 870 875 880cac gcg gag gag aag ctg cag ctg gca aac gag gag atc gcc cag gtc 2688His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu Glu Ile Ala Gln Val 885 890 895cgg agc aag gcc cag gcg gaa gcg ttg gcc ctc cag gcc agc ctg agg 2736Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala Leu Gln Ala Ser Leu Arg 900 905 910aag gag cag atg cgc atc cag tcg ctg gag aag aca gtg gag cag aag 2784Lys Glu Gln Met Arg Ile Gln Ser Leu Glu Lys Thr Val Glu Gln Lys 915 920 925act aaa gag aac gag gag ctg acc agg atc tgc gac gac ctc atc tcc 2832Thr Lys Glu Asn Glu Glu Leu Thr Arg Ile Cys Asp Asp Leu Ile Ser 930 935 940aag atg gag aag atc tga 2850Lys Met Glu Lys Ile94534949PRTHomo sapiens 34Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750Thr Val Thr Ser Thr Asp Val Lys Ala Thr Gln Glu Glu Asn Arg Glu 755 760 765Leu Arg Ser Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly 770 775 780Lys Ile Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu Glu785 790 795 800Val Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys Val Leu 805 810 815Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu Lys Ser 820 825 830Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val Ile Glu 835 840 845Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val Glu Asp Tyr 850 855 860Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln Ala Leu Lys Ala865 870 875 880His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu Glu Ile Ala Gln Val 885 890 895Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala Leu Gln Ala Ser Leu Arg 900 905 910Lys Glu Gln Met Arg Ile Gln Ser Leu Glu Lys Thr Val Glu Gln Lys 915 920 925Thr Lys Glu Asn Glu Glu Leu Thr Arg Ile Cys Asp Asp Leu Ile Ser 930 935 940Lys Met Glu Lys Ile945354461DNAHomo sapiensCDS(1)..(4461) 35atg ggc gcc cct gcc tgc gcc ctc gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg

100 105 110ctc acg cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag acg gcg ggc gct aac acc acc gac aag gag 960Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320cta gag gtt ctc tcc ttg cac aac gtc acc ttt gag gac gcc ggg gag 1008Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335tac acc tgc ctg gcg ggc aat tct att ggg ttt tct cat cac tct gcg 1056Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350tgg ctg gtg gtg ctg cca gcc gag gag gag ctg gtg gag gct gac gag 1104Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc ttc ttc 1152Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg cgc agc 1200Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc tcc cgc 1248Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc atg agc 1296Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg gag ggc 1344Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac ccc aaa 1392Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt ggg gag 1440Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att gac aag 1488Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg aaa gac 1536Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg gag atg 1584Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg ggc gcc 1632Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg gcc aag 1680Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc ctg gac 1728Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc ttc aag 1776Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag tac ttg 1824Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat gtg ctg 1872Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620gtg acc gag gac aac gtg atg aag atc gca gac ttc ggg ctg gcc cgg 1920Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc cgg ctg 1968Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc tac act 2016Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag atc ttc 2064His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag ctc ttc 2112Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac tgc aca 2160Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg ccc tcc 2208His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt gtc ctt 2256Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750acc gtg acg tcc acc gac gtg agt gct ggc tct ggc ctg gtg cca ccc 2304Thr Val Thr Ser Thr Asp Val Ser Ala Gly Ser Gly Leu Val Pro Pro 755 760 765gcc tat gcc cct ccc cct gcc gtc ccc ggc cat cct gcc ccc cag agt 2352Ala Tyr Ala Pro Pro Pro Ala Val Pro Gly His Pro Ala Pro Gln Ser 770 775 780gct gag gtg tgg ggc ggg cct tct ggc cca ggt gcc ctg gct gac ctg 2400Ala Glu Val Trp Gly Gly Pro Ser Gly Pro Gly Ala Leu Ala Asp Leu785 790 795 800gac tgc tca agc tct tcc cag agc cca gga agt tct gag aac caa atg 2448Asp Cys Ser Ser Ser Ser Gln Ser Pro Gly Ser Ser Glu Asn Gln Met 805 810 815gtg tct cca gga aaa gtg tct ggc agc cct gag caa gcc gtg gag gaa 2496Val Ser Pro Gly Lys Val Ser Gly Ser Pro Glu Gln Ala Val Glu Glu 820 825 830aac ctt agt tcc tat tcc tta gac aga aga gtg aca ccc gcc tct gag 2544Asn Leu Ser Ser Tyr Ser Leu Asp Arg Arg Val Thr Pro Ala Ser Glu 835 840 845acc cta gaa gac cct tgc agg aca gag tcc cag cac aaa gcg gag act 2592Thr Leu Glu Asp Pro Cys Arg Thr Glu Ser Gln His Lys Ala Glu Thr 850 855 860ccg cac gga gcc gag gaa gaa tgc aaa gcg gag act ccg cac gga gcc 2640Pro His Gly Ala Glu Glu Glu Cys Lys Ala Glu Thr Pro His Gly Ala865 870 875 880gag gag gaa tgc cgg cac ggt ggg gtc tgt gct ccc gca gca gtg gcc 2688Glu Glu Glu Cys Arg His Gly Gly Val Cys Ala Pro Ala Ala Val Ala 885 890 895act tcg cct cct ggt gca atc cct aag gaa gcc tgc gga gga gca ccc 2736Thr Ser Pro Pro Gly Ala Ile Pro Lys Glu Ala Cys Gly Gly Ala Pro 900 905 910ctg cag ggt ctg cct ggc gaa gcc ctg ggc tgc cct gcg ggt gtg ggc 2784Leu Gln Gly Leu Pro Gly Glu Ala Leu Gly Cys Pro Ala Gly Val Gly 915 920 925acc ccc gtg cca gca gat ggc act cag acc ctt acc tgt gca cac acc 2832Thr Pro Val Pro Ala Asp Gly Thr Gln Thr Leu Thr Cys Ala His Thr 930 935 940tct gct cct gag agc aca gcc cca acc aac cac ctg gtg gct ggc agg 2880Ser Ala Pro Glu Ser Thr Ala Pro Thr Asn His Leu Val Ala Gly Arg945 950 955 960gcc atg acc ctg agt cct cag gaa gaa gtg gct gca ggc caa atg gcc 2928Ala Met Thr Leu Ser Pro Gln Glu Glu Val Ala Ala Gly Gln Met Ala 965 970 975agc tcc tcg agg agc gga cct gta aaa cta gaa ttt gat gta tct gat 2976Ser Ser Ser Arg Ser Gly Pro Val Lys Leu Glu Phe Asp Val Ser Asp 980 985 990ggc gcc acc agc aaa agg gca ccc cca cca agg aga ctg gga gag agg 3024Gly Ala Thr Ser Lys Arg Ala Pro Pro Pro Arg Arg Leu Gly Glu Arg 995 1000 1005tcc ggc ctc aag cct ccc ttg agg aaa gca gca gtg agg cag caa 3069Ser Gly Leu Lys Pro Pro Leu Arg Lys Ala Ala Val Arg Gln Gln 1010 1015 1020aag gcc ccg cag gag gtg gag gag gac gac ggt agg agc gga gca 3114Lys Ala Pro Gln Glu Val Glu Glu Asp Asp Gly Arg Ser Gly Ala 1025 1030 1035gga gag gac ccc ccc atg cca gct tct cgg ggc tct tac cac ctc 3159Gly Glu Asp Pro Pro Met Pro Ala Ser Arg Gly Ser Tyr His Leu 1040 1045 1050gac tgg gac aaa atg gat gac cca aac ttc atc ccg ttc gga ggt 3204Asp Trp Asp Lys Met Asp Asp Pro Asn Phe Ile Pro Phe Gly Gly 1055 1060 1065gac acc aag tct ggt tgc agt gag gcc cag ccc cca gaa agc cct 3249Asp Thr Lys Ser Gly Cys Ser Glu Ala Gln Pro Pro Glu Ser Pro 1070 1075 1080gag acc agg ctg ggc cag cca gcg gct gaa cag ttg cat gct ggg 3294Glu Thr Arg Leu Gly Gln Pro Ala Ala Glu Gln Leu His Ala Gly 1085 1090 1095cct gcc acg gag gag cca ggt ccc tgt ctg agc cag cag ctg cat 3339Pro Ala Thr Glu Glu Pro Gly Pro Cys Leu Ser Gln Gln Leu His 1100 1105 1110tca gcc tca gcg gag gac acg cct gtg gtg cag ttg gca gcc gag 3384Ser Ala Ser Ala Glu Asp Thr Pro Val Val Gln Leu Ala Ala Glu 1115 1120 1125acc cca aca gca gag agc aag gag aga gcc ttg aac tct gcc agc 3429Thr Pro Thr Ala Glu Ser Lys Glu Arg Ala Leu Asn Ser Ala Ser 1130 1135 1140acc tcg ctt ccc aca agc tgt cca ggc agt gag cca gtg ccc acc 3474Thr Ser Leu Pro Thr Ser Cys Pro Gly Ser Glu Pro Val Pro Thr 1145 1150 1155cat cag cag ggg cag cct gcc ttg gag ctg aaa gag gag agc ttc 3519His Gln Gln Gly Gln Pro Ala Leu Glu Leu Lys Glu Glu Ser Phe 1160 1165 1170aga gac ccc gct gag gtt cta ggc acg ggc gcg gag gtg gat tac 3564Arg Asp Pro Ala Glu Val Leu Gly Thr Gly Ala Glu Val Asp Tyr 1175 1180 1185ctg gag cag ttt gga act tcc tcg ttt aag gag tcg gcc ttg agg 3609Leu Glu Gln Phe Gly Thr Ser Ser Phe Lys Glu Ser Ala Leu Arg 1190 1195 1200aag cag tcc tta tac ctc aag ttc gac ccc ctc ctg agg gac agt 3654Lys Gln Ser Leu Tyr Leu Lys Phe Asp Pro Leu Leu Arg Asp Ser 1205 1210 1215cct ggt aga cca gtg ccc gtg gcc acc gag acc agc agc atg cac 3699Pro Gly Arg Pro Val Pro Val Ala Thr Glu Thr Ser Ser Met His 1220 1225 1230ggt gca aat gag act ccc tca gga cgt ccg cgg gaa gcc aag ctt 3744Gly Ala Asn Glu Thr Pro Ser Gly Arg Pro Arg Glu Ala Lys Leu 1235 1240 1245gtg gag ttc gat ttc ttg gga gca ctg gac att cct gtg cca ggc 3789Val Glu Phe Asp Phe Leu Gly Ala Leu Asp Ile Pro Val Pro Gly 1250 1255 1260cca ccc cca ggt gtt ccc gcg cct ggg ggc cca ccc ctg tcc acc 3834Pro Pro Pro Gly Val Pro Ala Pro Gly Gly Pro Pro Leu Ser Thr 1265 1270 1275gga cct ata gtg gac ctg ctc cag tac agc cag aag gac ctg gat 3879Gly Pro Ile Val Asp Leu Leu Gln Tyr Ser Gln Lys Asp Leu Asp 1280 1285 1290gca gtg gta aag gcg aca cag gag gag aac cgg gag ctg agg agc 3924Ala Val Val Lys Ala Thr Gln Glu Glu Asn Arg Glu Leu Arg Ser 1295 1300 1305agg tgt gag gag ctc cac ggg aag aac ctg gaa ctg ggg aag atc 3969Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly Lys Ile 1310 1315 1320atg gac agg ttc gaa gag gtt gtg tac cag gcc atg gag gaa gtt 4014Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu Glu Val 1325 1330 1335cag aag cag aag gaa ctt tcc aaa gct gaa atc cag aaa gtt cta 4059Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys Val Leu 1340 1345 1350aaa gaa aaa gac caa ctt acc aca gat ctg aac tcc atg gag aag 4104Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu Lys 1355 1360 1365tcc ttc tcc gac ctc ttc aag cgt ttt gag aaa cag aaa gag gtg 4149Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val 1370 1375 1380atc gag ggc tac cgc aag aac gaa gag tca ctg aag aag tgc gtg 4194Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val 1385 1390 1395gag gat tac ctg gca agg atc acc cag gag ggc cag agg tac caa 4239Glu Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln 1400 1405 1410gcc ctg aag gcc cac gcg gag gag aag ctg cag ctg gca aac gag 4284Ala Leu Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu 1415 1420 1425gag atc gcc cag gtc cgg agc aag gcc cag gcg gaa gcg ttg gcc 4329Glu Ile Ala Gln Val Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala 1430 1435 1440ctc cag gcc agc ctg agg aag gag cag atg cgc atc cag tcg ctg 4374Leu Gln Ala Ser Leu Arg Lys Glu Gln Met Arg Ile Gln Ser Leu 1445 1450 1455gag aag aca gtg gag cag aag act aaa gag aac gag gag ctg acc 4419Glu Lys Thr Val Glu Gln Lys Thr Lys Glu Asn Glu Glu Leu Thr 1460 1465 1470agg atc tgc gac gac ctc atc tcc aag atg gag aag atc tga 4461Arg Ile Cys Asp Asp Leu Ile Ser Lys Met Glu Lys Ile 1475 1480 1485361486PRTHomo sapiens 36Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly

Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750Thr Val Thr Ser Thr Asp Val Ser Ala Gly Ser Gly Leu Val Pro Pro 755 760 765Ala Tyr Ala Pro Pro Pro Ala Val Pro Gly His Pro Ala Pro Gln Ser 770 775 780Ala Glu Val Trp Gly Gly Pro Ser Gly Pro Gly Ala Leu Ala Asp Leu785 790 795 800Asp Cys Ser Ser Ser Ser Gln Ser Pro Gly Ser Ser Glu Asn Gln Met 805 810 815Val Ser Pro Gly Lys Val Ser Gly Ser Pro Glu Gln Ala Val Glu Glu 820 825 830Asn Leu Ser Ser Tyr Ser Leu Asp Arg Arg Val Thr Pro Ala Ser Glu 835 840 845Thr Leu Glu Asp Pro Cys Arg Thr Glu Ser Gln His Lys Ala Glu Thr 850 855 860Pro His Gly Ala Glu Glu Glu Cys Lys Ala Glu Thr Pro His Gly Ala865 870 875 880Glu Glu Glu Cys Arg His Gly Gly Val Cys Ala Pro Ala Ala Val Ala 885 890 895Thr Ser Pro Pro Gly Ala Ile Pro Lys Glu Ala Cys Gly Gly Ala Pro 900 905 910Leu Gln Gly Leu Pro Gly Glu Ala Leu Gly Cys Pro Ala Gly Val Gly 915 920 925Thr Pro Val Pro Ala Asp Gly Thr Gln Thr Leu Thr Cys Ala His Thr 930 935 940Ser Ala Pro Glu Ser Thr Ala Pro Thr Asn His Leu Val Ala Gly Arg945 950 955 960Ala Met Thr Leu Ser Pro Gln Glu Glu Val Ala Ala Gly Gln Met Ala 965 970 975Ser Ser Ser Arg Ser Gly Pro Val Lys Leu Glu Phe Asp Val Ser Asp 980 985 990Gly Ala Thr Ser Lys Arg Ala Pro Pro Pro Arg Arg Leu Gly Glu Arg 995 1000 1005Ser Gly Leu Lys Pro Pro Leu Arg Lys Ala Ala Val Arg Gln Gln 1010 1015 1020Lys Ala Pro Gln Glu Val Glu Glu Asp Asp Gly Arg Ser Gly Ala 1025 1030 1035Gly Glu Asp Pro Pro Met Pro Ala Ser Arg Gly Ser Tyr His Leu 1040 1045 1050Asp Trp Asp Lys Met Asp Asp Pro Asn Phe Ile Pro Phe Gly Gly 1055 1060 1065Asp Thr Lys Ser Gly Cys Ser Glu Ala Gln Pro Pro Glu Ser Pro 1070 1075 1080Glu Thr Arg Leu Gly Gln Pro Ala Ala Glu Gln Leu His Ala Gly 1085 1090 1095Pro Ala Thr Glu Glu Pro Gly Pro Cys Leu Ser Gln Gln Leu His 1100 1105 1110Ser Ala Ser Ala Glu Asp Thr Pro Val Val Gln Leu Ala Ala Glu 1115 1120 1125Thr Pro Thr Ala Glu Ser Lys Glu Arg Ala Leu Asn Ser Ala Ser 1130 1135 1140Thr Ser Leu Pro Thr Ser Cys Pro Gly Ser Glu Pro Val Pro Thr 1145 1150 1155His Gln Gln Gly Gln Pro Ala Leu Glu Leu Lys Glu Glu Ser Phe 1160 1165 1170Arg Asp Pro Ala Glu Val Leu Gly Thr Gly Ala Glu Val Asp Tyr 1175 1180 1185Leu Glu Gln Phe Gly Thr Ser Ser Phe Lys Glu Ser Ala Leu Arg 1190 1195 1200Lys Gln Ser Leu Tyr Leu Lys Phe Asp Pro Leu Leu Arg Asp Ser 1205 1210 1215Pro Gly Arg Pro Val Pro Val Ala Thr Glu Thr Ser Ser Met His 1220 1225 1230Gly Ala Asn Glu Thr Pro Ser Gly Arg Pro Arg Glu Ala Lys Leu 1235 1240 1245Val Glu Phe Asp Phe Leu Gly Ala Leu Asp Ile Pro Val Pro Gly 1250 1255 1260Pro Pro Pro Gly Val Pro Ala Pro Gly Gly Pro Pro Leu Ser Thr 1265 1270 1275Gly Pro Ile Val Asp Leu Leu Gln Tyr Ser Gln Lys Asp Leu Asp 1280 1285 1290Ala Val Val Lys Ala Thr Gln Glu Glu Asn Arg Glu Leu Arg Ser 1295 1300 1305Arg Cys Glu Glu Leu His Gly Lys Asn Leu Glu Leu Gly Lys Ile 1310 1315 1320Met Asp Arg Phe Glu Glu Val Val Tyr Gln Ala Met Glu Glu Val 1325 1330 1335Gln Lys Gln Lys Glu Leu Ser Lys Ala Glu Ile Gln Lys Val Leu 1340 1345 1350Lys Glu Lys Asp Gln Leu Thr Thr Asp Leu Asn Ser Met Glu Lys 1355 1360 1365Ser Phe Ser Asp Leu Phe Lys Arg Phe Glu Lys Gln Lys Glu Val 1370 1375 1380Ile Glu Gly Tyr Arg Lys Asn Glu Glu Ser Leu Lys Lys Cys Val 1385 1390 1395Glu Asp Tyr Leu Ala Arg Ile Thr Gln Glu Gly Gln Arg Tyr Gln 1400 1405 1410Ala Leu Lys Ala His Ala Glu Glu Lys Leu Gln Leu Ala Asn Glu 1415 1420 1425Glu Ile Ala Gln Val Arg Ser Lys Ala Gln Ala Glu Ala Leu Ala 1430 1435 1440Leu Gln Ala Ser Leu Arg Lys Glu Gln Met Arg Ile Gln Ser Leu 1445 1450 1455Glu Lys Thr Val Glu Gln Lys Thr Lys Glu Asn Glu Glu Leu Thr 1460 1465 1470Arg Ile Cys Asp Asp Leu Ile Ser Lys Met Glu Lys Ile 1475 1480 1485373759DNAHomo sapiensCDS(1)..(3759) 37atg ggc gcc cct gcc tgc gcc ctc gcg ctc tgc gtg gcc gtg gcc atc 48Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15gtg gcc ggc gcc tcc tcg gag tcc ttg ggg acg gag cag cgc gtc gtg 96Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30ggg cga gcg gca gaa gtc ccg ggc cca gag ccc ggc cag cag gag cag 144Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45ttg gtc ttc ggc agc ggg gat gct gtg gag ctg agc tgt ccc ccg ccc 192Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60ggg ggt ggt ccc atg ggg ccc act gtc tgg gtc aag gat ggc aca ggg 240Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80ctg gtg ccc tcg gag cgt gtc ctg gtg ggg ccc cag cgg ctg cag gtg 288Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95ctg aat gcc tcc cac gag gac tcc ggg gcc tac agc tgc cgg cag cgg 336Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110ctc acg cag cgc gta ctg tgc cac ttc agt gtg cgg gtg aca gac gct 384Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125cca tcc tcg gga gat gac gaa gac ggg gag gac gag gct gag gac aca 432Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140ggt gtg gac aca ggg gcc cct tac tgg aca cgg ccc gag cgg atg gac 480Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160aag aag ctg ctg gcc gtg ccg gcc gcc aac acc gtc cgc ttc cgc tgc 528Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175cca gcc gct ggc aac ccc act ccc tcc atc tcc tgg ctg aag aac ggc 576Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190agg gag ttc cgc ggc gag cac cgc att gga ggc atc aag ctg cgg cat 624Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205cag cag tgg agc ctg gtc atg gaa agc gtg gtg ccc tcg gac cgc ggc 672Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220aac tac acc tgc gtc gtg gag aac aag ttt ggc agc atc cgg cag acg 720Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240tac acg ctg gac gtg ctg gag cgc tcc ccg cac cgg ccc atc ctg cag 768Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255gcg ggg ctg ccg gcc aac cag acg gcg gtg ctg ggc agc gac gtg gag 816Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270ttc cac tgc aag gtg tac agt gac gca cag ccc cac atc cag tgg ctc 864Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285aag cac gtg gag gtg aat ggc agc aag gtg ggc ccg gac ggc aca ccc 912Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300tac gtt acc gtg ctc aag acg gcg ggc gct aac acc acc gac aag gag 960Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320cta gag gtt ctc tcc ttg cac aac gtc acc ttt gag gac gcc ggg gag 1008Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335tac acc tgc ctg gcg ggc aat tct att ggg ttt tct cat cac tct gcg 1056Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350tgg ctg gtg gtg ctg cca gcc gag gag gag ctg gtg gag gct gac gag 1104Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365gcg ggc agt gtg tat gca ggc atc ctc agc tac ggg gtg ggc ttc ttc 1152Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380ctg ttc atc ctg gtg gtg gcg gct gtg acg ctc tgc cgc ctg cgc agc 1200Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400ccc ccc aag aaa ggc ctg ggc tcc ccc acc gtg cac aag atc tcc cgc 1248Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415ttc ccg ctc aag cga cag gtg tcc ctg gag tcc aac gcg tcc atg agc 1296Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430tcc aac aca cca ctg gtg cgc atc gca agg ctg tcc tca ggg gag ggc 1344Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445ccc acg ctg gcc aat gtc tcc gag ctc gag ctg cct gcc gac ccc aaa 1392Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460tgg gag ctg tct cgg gcc cgg ctg acc ctg ggc aag ccc ctt ggg gag 1440Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480ggc tgc ttc ggc cag gtg gtc atg gcg gag gcc atc ggc att gac aag 1488Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495gac cgg gcc gcc aag cct gtc acc gta gcc gtg aag atg ctg aaa gac 1536Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510gat gcc act gac aag gac ctg tcg gac ctg gtg tct gag atg gag atg 1584Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525atg aag atg atc ggg aaa cac aaa aac atc atc aac ctg ctg ggc gcc 1632Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540tgc acg cag ggc ggg ccc ctg tac gtg ctg gtg gag tac gcg gcc aag 1680Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560ggt aac ctg cgg gag ttt ctg cgg gcg cgg cgg ccc ccg ggc ctg gac 1728Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575tac tcc ttc gac acc tgc aag ccg ccc gag gag cag ctc acc ttc aag 1776Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590gac ctg gtg tcc tgt gcc tac cag gtg gcc cgg ggc atg gag tac ttg 1824Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605gcc tcc cag aag tgc atc cac agg gac ctg gct gcc cgc aat gtg ctg 1872Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620gtg acc gag gac aac gtg atg aag atc gca gac ttc ggg ctg gcc cgg 1920Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640gac gtg cac aac ctc gac tac tac aag aag aca acc aac ggc cgg ctg 1968Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655ccc gtg aag tgg atg gcg cct gag gcc ttg ttt gac cga gtc tac act 2016Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670cac cag agt gac gtc tgg tcc ttt ggg gtc ctg ctc tgg gag atc ttc 2064His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685acg ctg ggg ggc tcc ccg tac ccc ggc atc cct gtg gag gag ctc ttc 2112Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700aag ctg ctg aag gag ggc cac cgc atg gac aag ccc gcc aac tgc aca 2160Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720cac gac ctg tac atg atc atg cgg gag tgc tgg cat gcc gcg ccc tcc 2208His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735cag agg ccc acc ttc aag cag ctg gtg gag gac ctg gac cgt gtc ctt 2256Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740

745 750acc gtg acg tcc acc gac aat gtt atg gaa cag ttc aat cct ggg ctg 2304Thr Val Thr Ser Thr Asp Asn Val Met Glu Gln Phe Asn Pro Gly Leu 755 760 765cga aat tta ata aac ctg ggg aaa aat tat gag aaa gct gta aac gct 2352Arg Asn Leu Ile Asn Leu Gly Lys Asn Tyr Glu Lys Ala Val Asn Ala 770 775 780atg atc ctg gca gga aaa gcc tac tac gat gga gtg gcc aag atc ggt 2400Met Ile Leu Ala Gly Lys Ala Tyr Tyr Asp Gly Val Ala Lys Ile Gly785 790 795 800gag att gcc act ggg tcc ccc gtg tca act gaa ctg gga cat gtc ctc 2448Glu Ile Ala Thr Gly Ser Pro Val Ser Thr Glu Leu Gly His Val Leu 805 810 815ata gag att tca agt acc cac aag aaa ctc aac gag agt ctt gat gaa 2496Ile Glu Ile Ser Ser Thr His Lys Lys Leu Asn Glu Ser Leu Asp Glu 820 825 830aat ttt aaa aaa ttc cac aaa gag att atc cat gag ctg gag aag aag 2544Asn Phe Lys Lys Phe His Lys Glu Ile Ile His Glu Leu Glu Lys Lys 835 840 845ata gaa ctt gac gtg aaa tat atg aac gca act cta aaa aga tac caa 2592Ile Glu Leu Asp Val Lys Tyr Met Asn Ala Thr Leu Lys Arg Tyr Gln 850 855 860aca gaa cac aag aat aaa tta gag tct ttg gag aaa tcc caa gct gag 2640Thr Glu His Lys Asn Lys Leu Glu Ser Leu Glu Lys Ser Gln Ala Glu865 870 875 880ttg aag aag atc aga agg aaa agc caa gga agc cga aac gca ctc aaa 2688Leu Lys Lys Ile Arg Arg Lys Ser Gln Gly Ser Arg Asn Ala Leu Lys 885 890 895tat gaa cac aaa gaa att gag tat gtg gag acc gtt act tct cgt cag 2736Tyr Glu His Lys Glu Ile Glu Tyr Val Glu Thr Val Thr Ser Arg Gln 900 905 910agt gaa atc cag aaa ttc att gca gat ggt tgc aaa gag gct ctg ctt 2784Ser Glu Ile Gln Lys Phe Ile Ala Asp Gly Cys Lys Glu Ala Leu Leu 915 920 925gaa gag aag agg cgc ttc tgc ttt ctg gtt gat aag cac tgt ggc ttt 2832Glu Glu Lys Arg Arg Phe Cys Phe Leu Val Asp Lys His Cys Gly Phe 930 935 940gca aac cac ata cat tat tat cac tta cag tct gca gaa cta ctg aat 2880Ala Asn His Ile His Tyr Tyr His Leu Gln Ser Ala Glu Leu Leu Asn945 950 955 960tcc aag ctg cct cgg tgg cag gag acc tgt gtt gat gcc atc aaa gtg 2928Ser Lys Leu Pro Arg Trp Gln Glu Thr Cys Val Asp Ala Ile Lys Val 965 970 975cca gag aaa atc atg aat atg atc gaa gaa ata aag acc cca gcc tct 2976Pro Glu Lys Ile Met Asn Met Ile Glu Glu Ile Lys Thr Pro Ala Ser 980 985 990acc ccc gtg tct gga act cct cag gct tca ccc atg atc gag aga agc 3024Thr Pro Val Ser Gly Thr Pro Gln Ala Ser Pro Met Ile Glu Arg Ser 995 1000 1005aat gtg gtt agg aaa gat tac gac acc ctt tct aaa tgc tca cca 3069Asn Val Val Arg Lys Asp Tyr Asp Thr Leu Ser Lys Cys Ser Pro 1010 1015 1020aag atg ccc ccc gct cct tca ggc aga gca tat acc agt ccc ttg 3114Lys Met Pro Pro Ala Pro Ser Gly Arg Ala Tyr Thr Ser Pro Leu 1025 1030 1035atc gat atg ttt aat aac cca gcc acg gct gcc ccg aat tca caa 3159Ile Asp Met Phe Asn Asn Pro Ala Thr Ala Ala Pro Asn Ser Gln 1040 1045 1050agg gta aat aat tca aca ggt act tcc gaa gat ccc agt tta cag 3204Arg Val Asn Asn Ser Thr Gly Thr Ser Glu Asp Pro Ser Leu Gln 1055 1060 1065cga tca gtt tcg gtt gca acg gga ctg aac atg atg aag aag cag 3249Arg Ser Val Ser Val Ala Thr Gly Leu Asn Met Met Lys Lys Gln 1070 1075 1080aaa gtg aag acc atc ttc ccg cac act gcg ggc tcc aac aag acc 3294Lys Val Lys Thr Ile Phe Pro His Thr Ala Gly Ser Asn Lys Thr 1085 1090 1095tta ctc agc ttt gca cag gga gat gtc atc acg ctg ctc atc ccc 3339Leu Leu Ser Phe Ala Gln Gly Asp Val Ile Thr Leu Leu Ile Pro 1100 1105 1110gag gag aag gat ggc tgg ctc tat gga gaa cac gac gtg tcc aag 3384Glu Glu Lys Asp Gly Trp Leu Tyr Gly Glu His Asp Val Ser Lys 1115 1120 1125gcg agg ggt tgg ttc ccg tcg tcg tac acg aag ttg ctg gaa gaa 3429Ala Arg Gly Trp Phe Pro Ser Ser Tyr Thr Lys Leu Leu Glu Glu 1130 1135 1140aat gag aca gaa gca gtg acc gtg ccc acg cca agc ccc aca cca 3474Asn Glu Thr Glu Ala Val Thr Val Pro Thr Pro Ser Pro Thr Pro 1145 1150 1155gtg aga agc atc agc acc gtg aac ttg tct gag aat agc agt gtt 3519Val Arg Ser Ile Ser Thr Val Asn Leu Ser Glu Asn Ser Ser Val 1160 1165 1170gtc atc ccc cca ccc gac tac ttg gaa tgc ttg tcc atg ggg gca 3564Val Ile Pro Pro Pro Asp Tyr Leu Glu Cys Leu Ser Met Gly Ala 1175 1180 1185gct gcc gac agg aga gca gat tcg gcc agg acg aca tcc acc ttt 3609Ala Ala Asp Arg Arg Ala Asp Ser Ala Arg Thr Thr Ser Thr Phe 1190 1195 1200aag gcc cca gcg tcc aag ccc gag acc gcg gct cct aac gat gcc 3654Lys Ala Pro Ala Ser Lys Pro Glu Thr Ala Ala Pro Asn Asp Ala 1205 1210 1215aac ggg act gca aag ccg cct ttt ctc agc gga gaa aac ccc ttt 3699Asn Gly Thr Ala Lys Pro Pro Phe Leu Ser Gly Glu Asn Pro Phe 1220 1225 1230gcc act gtg aaa ctc cgc ccg act gtg acg aat gat cgc tcg gca 3744Ala Thr Val Lys Leu Arg Pro Thr Val Thr Asn Asp Arg Ser Ala 1235 1240 1245ccc atc att cga tga 3759Pro Ile Ile Arg 1250381252PRTHomo sapiens 38Met Gly Ala Pro Ala Cys Ala Leu Ala Leu Cys Val Ala Val Ala Ile1 5 10 15Val Ala Gly Ala Ser Ser Glu Ser Leu Gly Thr Glu Gln Arg Val Val 20 25 30Gly Arg Ala Ala Glu Val Pro Gly Pro Glu Pro Gly Gln Gln Glu Gln 35 40 45Leu Val Phe Gly Ser Gly Asp Ala Val Glu Leu Ser Cys Pro Pro Pro 50 55 60Gly Gly Gly Pro Met Gly Pro Thr Val Trp Val Lys Asp Gly Thr Gly65 70 75 80Leu Val Pro Ser Glu Arg Val Leu Val Gly Pro Gln Arg Leu Gln Val 85 90 95Leu Asn Ala Ser His Glu Asp Ser Gly Ala Tyr Ser Cys Arg Gln Arg 100 105 110Leu Thr Gln Arg Val Leu Cys His Phe Ser Val Arg Val Thr Asp Ala 115 120 125Pro Ser Ser Gly Asp Asp Glu Asp Gly Glu Asp Glu Ala Glu Asp Thr 130 135 140Gly Val Asp Thr Gly Ala Pro Tyr Trp Thr Arg Pro Glu Arg Met Asp145 150 155 160Lys Lys Leu Leu Ala Val Pro Ala Ala Asn Thr Val Arg Phe Arg Cys 165 170 175Pro Ala Ala Gly Asn Pro Thr Pro Ser Ile Ser Trp Leu Lys Asn Gly 180 185 190Arg Glu Phe Arg Gly Glu His Arg Ile Gly Gly Ile Lys Leu Arg His 195 200 205Gln Gln Trp Ser Leu Val Met Glu Ser Val Val Pro Ser Asp Arg Gly 210 215 220Asn Tyr Thr Cys Val Val Glu Asn Lys Phe Gly Ser Ile Arg Gln Thr225 230 235 240Tyr Thr Leu Asp Val Leu Glu Arg Ser Pro His Arg Pro Ile Leu Gln 245 250 255Ala Gly Leu Pro Ala Asn Gln Thr Ala Val Leu Gly Ser Asp Val Glu 260 265 270Phe His Cys Lys Val Tyr Ser Asp Ala Gln Pro His Ile Gln Trp Leu 275 280 285Lys His Val Glu Val Asn Gly Ser Lys Val Gly Pro Asp Gly Thr Pro 290 295 300Tyr Val Thr Val Leu Lys Thr Ala Gly Ala Asn Thr Thr Asp Lys Glu305 310 315 320Leu Glu Val Leu Ser Leu His Asn Val Thr Phe Glu Asp Ala Gly Glu 325 330 335Tyr Thr Cys Leu Ala Gly Asn Ser Ile Gly Phe Ser His His Ser Ala 340 345 350Trp Leu Val Val Leu Pro Ala Glu Glu Glu Leu Val Glu Ala Asp Glu 355 360 365Ala Gly Ser Val Tyr Ala Gly Ile Leu Ser Tyr Gly Val Gly Phe Phe 370 375 380Leu Phe Ile Leu Val Val Ala Ala Val Thr Leu Cys Arg Leu Arg Ser385 390 395 400Pro Pro Lys Lys Gly Leu Gly Ser Pro Thr Val His Lys Ile Ser Arg 405 410 415Phe Pro Leu Lys Arg Gln Val Ser Leu Glu Ser Asn Ala Ser Met Ser 420 425 430Ser Asn Thr Pro Leu Val Arg Ile Ala Arg Leu Ser Ser Gly Glu Gly 435 440 445Pro Thr Leu Ala Asn Val Ser Glu Leu Glu Leu Pro Ala Asp Pro Lys 450 455 460Trp Glu Leu Ser Arg Ala Arg Leu Thr Leu Gly Lys Pro Leu Gly Glu465 470 475 480Gly Cys Phe Gly Gln Val Val Met Ala Glu Ala Ile Gly Ile Asp Lys 485 490 495Asp Arg Ala Ala Lys Pro Val Thr Val Ala Val Lys Met Leu Lys Asp 500 505 510Asp Ala Thr Asp Lys Asp Leu Ser Asp Leu Val Ser Glu Met Glu Met 515 520 525Met Lys Met Ile Gly Lys His Lys Asn Ile Ile Asn Leu Leu Gly Ala 530 535 540Cys Thr Gln Gly Gly Pro Leu Tyr Val Leu Val Glu Tyr Ala Ala Lys545 550 555 560Gly Asn Leu Arg Glu Phe Leu Arg Ala Arg Arg Pro Pro Gly Leu Asp 565 570 575Tyr Ser Phe Asp Thr Cys Lys Pro Pro Glu Glu Gln Leu Thr Phe Lys 580 585 590Asp Leu Val Ser Cys Ala Tyr Gln Val Ala Arg Gly Met Glu Tyr Leu 595 600 605Ala Ser Gln Lys Cys Ile His Arg Asp Leu Ala Ala Arg Asn Val Leu 610 615 620Val Thr Glu Asp Asn Val Met Lys Ile Ala Asp Phe Gly Leu Ala Arg625 630 635 640Asp Val His Asn Leu Asp Tyr Tyr Lys Lys Thr Thr Asn Gly Arg Leu 645 650 655Pro Val Lys Trp Met Ala Pro Glu Ala Leu Phe Asp Arg Val Tyr Thr 660 665 670His Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile Phe 675 680 685Thr Leu Gly Gly Ser Pro Tyr Pro Gly Ile Pro Val Glu Glu Leu Phe 690 695 700Lys Leu Leu Lys Glu Gly His Arg Met Asp Lys Pro Ala Asn Cys Thr705 710 715 720His Asp Leu Tyr Met Ile Met Arg Glu Cys Trp His Ala Ala Pro Ser 725 730 735Gln Arg Pro Thr Phe Lys Gln Leu Val Glu Asp Leu Asp Arg Val Leu 740 745 750Thr Val Thr Ser Thr Asp Asn Val Met Glu Gln Phe Asn Pro Gly Leu 755 760 765Arg Asn Leu Ile Asn Leu Gly Lys Asn Tyr Glu Lys Ala Val Asn Ala 770 775 780Met Ile Leu Ala Gly Lys Ala Tyr Tyr Asp Gly Val Ala Lys Ile Gly785 790 795 800Glu Ile Ala Thr Gly Ser Pro Val Ser Thr Glu Leu Gly His Val Leu 805 810 815Ile Glu Ile Ser Ser Thr His Lys Lys Leu Asn Glu Ser Leu Asp Glu 820 825 830Asn Phe Lys Lys Phe His Lys Glu Ile Ile His Glu Leu Glu Lys Lys 835 840 845Ile Glu Leu Asp Val Lys Tyr Met Asn Ala Thr Leu Lys Arg Tyr Gln 850 855 860Thr Glu His Lys Asn Lys Leu Glu Ser Leu Glu Lys Ser Gln Ala Glu865 870 875 880Leu Lys Lys Ile Arg Arg Lys Ser Gln Gly Ser Arg Asn Ala Leu Lys 885 890 895Tyr Glu His Lys Glu Ile Glu Tyr Val Glu Thr Val Thr Ser Arg Gln 900 905 910Ser Glu Ile Gln Lys Phe Ile Ala Asp Gly Cys Lys Glu Ala Leu Leu 915 920 925Glu Glu Lys Arg Arg Phe Cys Phe Leu Val Asp Lys His Cys Gly Phe 930 935 940Ala Asn His Ile His Tyr Tyr His Leu Gln Ser Ala Glu Leu Leu Asn945 950 955 960Ser Lys Leu Pro Arg Trp Gln Glu Thr Cys Val Asp Ala Ile Lys Val 965 970 975Pro Glu Lys Ile Met Asn Met Ile Glu Glu Ile Lys Thr Pro Ala Ser 980 985 990Thr Pro Val Ser Gly Thr Pro Gln Ala Ser Pro Met Ile Glu Arg Ser 995 1000 1005Asn Val Val Arg Lys Asp Tyr Asp Thr Leu Ser Lys Cys Ser Pro 1010 1015 1020Lys Met Pro Pro Ala Pro Ser Gly Arg Ala Tyr Thr Ser Pro Leu 1025 1030 1035Ile Asp Met Phe Asn Asn Pro Ala Thr Ala Ala Pro Asn Ser Gln 1040 1045 1050Arg Val Asn Asn Ser Thr Gly Thr Ser Glu Asp Pro Ser Leu Gln 1055 1060 1065Arg Ser Val Ser Val Ala Thr Gly Leu Asn Met Met Lys Lys Gln 1070 1075 1080Lys Val Lys Thr Ile Phe Pro His Thr Ala Gly Ser Asn Lys Thr 1085 1090 1095Leu Leu Ser Phe Ala Gln Gly Asp Val Ile Thr Leu Leu Ile Pro 1100 1105 1110Glu Glu Lys Asp Gly Trp Leu Tyr Gly Glu His Asp Val Ser Lys 1115 1120 1125Ala Arg Gly Trp Phe Pro Ser Ser Tyr Thr Lys Leu Leu Glu Glu 1130 1135 1140Asn Glu Thr Glu Ala Val Thr Val Pro Thr Pro Ser Pro Thr Pro 1145 1150 1155Val Arg Ser Ile Ser Thr Val Asn Leu Ser Glu Asn Ser Ser Val 1160 1165 1170Val Ile Pro Pro Pro Asp Tyr Leu Glu Cys Leu Ser Met Gly Ala 1175 1180 1185Ala Ala Asp Arg Arg Ala Asp Ser Ala Arg Thr Thr Ser Thr Phe 1190 1195 1200Lys Ala Pro Ala Ser Lys Pro Glu Thr Ala Ala Pro Asn Asp Ala 1205 1210 1215Asn Gly Thr Ala Lys Pro Pro Phe Leu Ser Gly Glu Asn Pro Phe 1220 1225 1230Ala Thr Val Lys Leu Arg Pro Thr Val Thr Asn Asp Arg Ser Ala 1235 1240 1245Pro Ile Ile Arg 12503917PRTArtificial SequenceBiotinylated peptide sequence 39Glu Gly Pro Trp Leu Glu Glu Glu Glu Glu Ala Tyr Gly Trp Met Asp1 5 10 15Phe

Claims

1-62. (canceled)

63. A method of reducing the likelihood that a subject will develop a tumor, the method comprising (a) determining that a sample from a human subject comprises: (i) a fusion polypeptide comprising part or all of the amino acid sequence of an FGFR3 protein whose sequence is at least 70% identical to SEQ ID NO: 6 or 7, and part or all of the amino acid sequence of a BAIAP2L1 protein whose sequence is at least 70% identical to SEQ ID NO: 8, or (ii) a polynucleotide encoding the fusion polypeptide; (b) determining that the subject is in need of a treatment to reduce the subject's likelihood of developing a tumor that expresses the fusion polypeptide; and (c) administering to the subject an FGFR inhibitor in an amount effective to reduce the subject's likelihood of developing a tumor that expresses the fusion polypeptide.

64. The method of claim 63, wherein the FGFR inhibitor is a tyrosine kinase inhibitor that inhibits phosphorylation of FGFR.

65. The method of claim 63, wherein the FGFR inhibitor is an antibody.

66. The method of claim 63, wherein the amino acid sequence of the FGFR3 protein is SEQ ID NO: 6 or 7.

67. The method of claim 63, wherein the amino acid sequence of the BAIAP2L1 protein is SEQ ID NO: 8.

68. The method of claim 63, wherein the fusion polypeptide consists of the amino acid sequence of SEQ ID NO: 32 or 38.

69. The method of claim 63, further comprising determining the fusion polypeptide comprises additional amino acid sequence that is not a part of SEQ ID NO: 6, 7, or 8.

70. The method of claim 63, wherein the fusion polypeptide induces phosphorylation of FGFR3 and wherein cells expressing the fusion polypeptide are transformed into tumor cells.

71. The method of claim 63, wherein the BAIAP2L1 protein comprises a BAR (Bin-Amphiphysin-Rvs) dimerization domain.

72. The method of claim 63, wherein the cancer is selected from the group consisting of bladder cancer, brain tumor, head and neck squamous cell carcinoma, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, skin melanoma, esophageal cancer, gastric cancer, and liver cancer.

73. The method of claim 63, wherein the cancer is bladder cancer.

74. The method of claim 63, wherein the cancer is lung cancer.

75. The method of claim 63, wherein the FGFR inhibitor is a compound of formula I, or a pharmaceutically acceptable salt thereof: ##STR00090## wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 each independently represents the group listed below: R.sub.1 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; R.sub.2 represents hydrogen, hydroxy, halogen, cyano, nitro, C.sub.1-4 haloalkyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, C.sub.6-10 aryl C.sub.1-4 alkyl, --OR.sub.5, --NR.sub.6R.sub.7, --(CR.sub.8R.sub.9).sub.nZ.sub.1, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, --NR.sub.17SO.sub.2R.sub.18, COOH, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; or R.sub.1 and R.sub.2, together with an atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl, wherein the heterocyclyl or heteroaryl is optionally substituted by halogen; R.sub.3 represents hydrogen, C.sub.1-5 alkyl, C.sub.6-10 aryl C.sub.1-6 alkyl, or C.sub.1-4 haloalkyl; R.sub.4 represents hydrogen, halogen, C.sub.1-3 alkyl, C.sub.1-4 haloalkyl, hydroxy, cyano, nitro, C.sub.1-4 alkoxy, --(CH.sub.2).sub.nZ.sub.1, --NR.sub.6R.sub.7, --OR.sub.5, --C(O)NR.sub.12R.sub.13, --SR.sub.14, --SOR.sub.15, --SO.sub.2R.sub.16, NR.sub.17SO.sub.2R.sub.18, COOH, --COR.sub.19, --COOR.sub.20, --OC(O)R.sub.21, --NR.sub.22C(O)R.sub.23, --NR.sub.24C(S)R.sub.25, --C(S)NR.sub.26R.sub.27, --SO.sub.2NR.sub.28R.sub.29, --OSO.sub.2R.sub.30, --SO.sub.3R.sub.31, or --Si(R.sub.32).sub.3; A represents a 5- to 10-membered heteroaryl ring or C.sub.6-10 aryl ring; R.sub.5 represents C.sub.1-5 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyl C.sub.1-3 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.1-3 alkoxy C.sub.1-4 alkoxy C.sub.1-4 alkyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, C.sub.6-10 aryl, C.sub.6-10 aryl C.sub.1-3 alkyl, or 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, or C.sub.1-6 trihydroxy alkyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.6 and R.sub.7, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl C.sub.1-3 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl, C.sub.1-4 aminoalkyl, C.sub.1-4 alkylamino C.sub.1-4 alkyl, di(C.sub.1-4 alkyl)amino C.sub.1-4 alkyl, or cyano(C.sub.1-3 alkyl); or alternatively R.sub.6 and R.sub.7, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; n represents 1 to 3; R.sub.8 and R.sub.9, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, or halogen; or alternatively R.sub.8 and R.sub.9, together with a carbon atom linked thereto, form a cycloaliphatic ring; Z.sub.1 represents hydrogen, NR.sub.10R.sub.11, --OH, or 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.10 and R.sub.11, which can be the same or different, each represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, cyano(C.sub.1-3 alkyl), or C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl; or alternatively R.sub.10 and R.sub.11, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.12 and R.sub.13, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxy C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, 3- to 10-membered cycloaliphatic ring, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; or alternatively R.sub.12 and R.sub.13, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl which is optionally substituted by one or more groups independently selected from group Q; R.sub.14 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.15 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.16 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.17 represents hydrogen or C.sub.1-4 alkyl; R.sub.18 represents C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl which is optionally substituted by one or more groups independently selected from group P, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.19 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, or 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl which is optionally substituted by one or more groups independently selected from group Q; R.sub.20 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.21 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.22 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.23 represents hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.24 represents hydrogen, C.sub.1-4 alkyl, or C.sub.1-4 haloalkyl; R.sub.25 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.26 and R.sub.27, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.26 and R.sub.27, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.28 and R.sub.29, which can be the same or different, each represents hydrogen, C.sub.1-4 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 haloalkyl, C.sub.1-3 alkoxyl C.sub.1-4 alkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocyclyl, C.sub.6-10 aryl C.sub.1-4 alkyl, 3- to 10-membered heterocyclyl C.sub.1-3 alkyl, 5- to 10-membered heteroaryl C.sub.1-3 alkyl, cyano(C.sub.1-3 alkyl), C.sub.1-3 alkylsulfonyl C.sub.1-4 alkyl, or 3- to 10-membered cycloaliphatic ring; or alternatively R.sub.28 and R.sub.29, together with a nitrogen atom linked thereto, form 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl; R.sub.30 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.31 represents C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.1-4 haloalkyl, C.sub.6-10 aryl, 5- to 10-membered heteroaryl, or 3- to 10-membered heterocyclyl; R.sub.32 represents C.sub.1-4 alkyl or C.sub.6-10 aryl; <group P> halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-3 haloalkoxy, 3- to 10-membered heterocyclylamino, -SO.sub.2R.sub.6, --CN, -NO.sub.2, and 3- to 10-membered heterocyclyl; <group Q> halogen, C.sub.1-4 alkyl, C.sub.1-4 haloalkyl, --OH, C.sub.1-3 alkoxy, C.sub.1-6 monohydroxy alkyl, C.sub.1-6 dihydroxy alkyl, C.sub.1-6 trihydroxy alkyl, 3- to 10-membered heterocyclyl amine, --SO.sub.2R.sub.16, --CN, --NO.sub.2, C.sub.3-7 cycloalkyl, --COR.sub.19, and 3- to 10-membered heterocyclyl which is optionally substituted by C.sub.1-4 alkyl.

76. The method of claim 75, wherein A is indole, and R.sub.3 and R.sub.4 are both hydrogen.

77. The method of claim 63, wherein the FGFR inhibitor is a compound having the formula: ##STR00091## or a pharmaceutically acceptable salt thereof.

78. The method of claim 63, wherein the FGFR inhibitor is a compound having the formula: ##STR00092## or a pharmaceutically acceptable salt thereof.

79. The method of claim 63, wherein the FGFR inhibitor is a compound having the formula: ##STR00093## or a pharmaceutically acceptable salt thereof.

80. The method of claim 63, wherein the FGFR inhibitor is a compound having the formula: ##STR00094## or a pharmaceutically acceptable salt thereof.

81. The method of claim 63, wherein the FGFR inhibitor is a 2-hydroxypropionic acid salt of a compound having the formula: ##STR00095##