Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: MECP2E1 GENE

Inventors:
IPC8 Class: AC12Q16883FI
USPC Class: 1 1
Class name:
Publication date: 2020-08-27
Patent application number: 20200270693



Abstract:

The invention is a novel MECP2E1 splice variant and its corresponding polypeptide. The invention also includes methods of using these nucleic acid sequences and proteins in medical diagnosis and treatment of neuropsychiatric disorders or development disorders.

Claims:

1-14. (canceled)

15. A method of preparing an MECP2 amplified fraction from a subject useful for analyzing an MECP2E1 gene involved in neuropsychiatric or developmental disorder, comprising: (a) extracting nucleic acids comprising an MECP2E1 gene from a sample from the subject; (b) producing an MECP2E1 amplified fraction of the nucleic acids extracted in (a) by contacting the nucleic acids extracted in (a) with primers to amplify the MECP2E1 gene, wherein the MECP2E1 amplified fraction comprises MECP2E1 amplified products; and (c) analyzing the MECP2E1 amplified fraction produced in (b).

16. The method of claim 15, wherein step (c) comprises detecting a mutation within exon 1, or in the intron-exon boundary immediately adjacent to exon 1, of a nucleic acid sequence encoding an MeCP2E1 protein having the amino acid sequence of SEQ ID NO: 4.

17. The method of claim 16, wherein mutation is selected from the group consisting of: (1) a deletion of 11 consecutive base pairs in nucleotides 38 to 54 of SEQ ID NO: 1, the deletion causing a truncation of the MeCP2E1 protein of SEQ ID NO: 4 after amino acid 36; (2) a deletion consisting of nucleotides 1-69 of exon 1 of SEQ ID NO: 1; (3) an adenine to thymine change at nucleotide position 8 of SEQ ID NO: 1; (4) a deletion of a T, G or TG between nucleotide positions 69-71 of SEQ ID NO: 1; (5) a deletion of a T, G or TG between nucleotide positions 70-71 of SEQ ID NO: 1; (6) a deletion of the nucleotide sequence GC at nucleotides -38 and -39 upstream of the position corresponding to nucleotide 1 of SEQ ID NO: 1; (7) a deletion of the nucleotide sequence AG at nucleotides -19 and -20 upstream of the position corresponding to nucleotide 1 of SEQ ID NO: 1; (8) a deletion of 11 consecutive base pairs in nucleotides 38 to 54 of SEQ ID NO: 1, the deletion causing a truncation of the MeCP2E1 protein of SEQ ID NO: 4 after amino acid 36; and (9) an adenine to thymine mutation at the nucleotide position corresponding to position 8 of SEQ ID NO: 1.

18. The method of claim 15, wherein the sample from the subject is a selected from blood, urine, serum, tears, saliva, and feces.

19. The method of claim 15, wherein step (c) comprises sequencing the MECP2 amplified products.

20. The method of claim 15, wherein step (b) comprises PCR, rtPCR, multiplex ligation-dependent probe amplification (MLPA), ligase chain reaction, or NASBA.

21. The method of claim 15, wherein the neuropsychiatric or developmental disorder is selected from autism, autism spectrum disorder, epilepsy, Angelman syndrome, Prader-Willi syndrome, encephalopathy, schizophrenia, bipolar affective disorder, depression, obsessive compulsive disorder, panic disorder, attention deficit hyperactivity disorder, ataxia, and mental retardation.

22. A method of detecting a mutation in the human MECP2 gene, comprising: (a) contacting an MECP2 nucleic acid in a human sample with a labeled oligonucleotide that hybridizes under stringent conditions to the sequence portion within the MECP2 nucleic acid comprising the mutation; and (b) detecting the hybridization of the labeled oligonucleotide with the MECP2 nucleic acid under stringent hybridization conditions, wherein detection of hybridization indicates that the mutation is present in the MECP2 nucleic acid; wherein the mutation is selected from the group consisting of: (i) a deletion of the nucleotide sequence GC at nucleotides -38 and -39 upstream of a position corresponding to nucleotide 1 of SEQ ID NO. 1; and (ii) a deletion of the nucleotide sequence AG at nucleotides -19 and -20 upstream of a position corresponding to nucleotide 1 of SEQ ID NO. 1.

23. A method of detecting the presence of a mutation or deletion in a nucleic acid molecule encoding the MeCP2E1 protein comprising: a) analyzing a test sample containing a nucleic acid sequence encoding the MeCP2E1 protein consisting of SEQ ID NO.: 4 for a mutation or deletion within exon 1, or in the intron-exon boundary immediately adjacent to exon 1, of the nucleic acid sequence; and b) comparing the results of the analysis of the test sample with the results of analysis of a control sample, wherein the control sample comprises the nucleic acid encoding the MeCP2E1 protein consisting of SEQ ID NO.: 4 without a mutation or deletion within exon 1, or in the intron-exon boundary immediately adjacent to exon 1.

Description:

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 15/421,156, filed Jan. 31, 2017, which is a continuation of U.S. patent application Ser. No. 12/313,251, filed Nov. 18, 2008, which is a divisional of U.S. patent application Ser. No. 11/352,153, filed Feb. 9, 2006, now U.S. Pat. No. 7,670,773, which is a continuation of International Patent Application No. PCT/CA2005/000198, filed Feb. 17, 2005, which claims the benefit of U.S. Provisional Patent Application No. 60/544,311, filed Feb. 17, 2004. The entire contents of the above applications are incorporated herein by reference in their entirety.

BACKGROUND OF THE INVENTION

[0002] Neuropsychiatric disorders account for six of the ten highest impact diseases worldwide, according to the World Health Organization. Cost to the US economy is $100 billion--one of every four persons entering physician offices has a diagnosable mental disorder.

[0003] Rett syndrome (RTT) (OMIM #312750) is characterized by onset, in girls, of a gradual slowing of neurodevelopment in the second half of the first year of life towards stagnation by age four, followed by regression and loss of acquired fine motor and communication skills. A pseudostationary period follows during which a picture of preserved ambulation, aberrant communication and stereotypic hand wringing approximates early autism. Regression, however, remains insidiously ongoing and ultimately results in profound mental retardation.

[0004] Up to 80% of patients with RTT have mutations in exons 3 and 4 of the 4-exon MECP2 gene (FIG. 1A) encoding the MeCP2 transcriptional repressor. Mutations in the remaining 20% of patients has remained elusive. In the known transcript of the gene all four exons are utilized, the translation start site is in exon 2, and exon 1 and most of exon 2 form the 5'untranslated region (UTR). For clarity, this transcript is named MECP2E2 (previously MECP2A), and its encoded protein MeCP2E2 (previously MeCP2A).

[0005] No mutation specific to the MeCP2E2-defining exon 2 has been found to date despite several hundred patients analyzed for mutations in this exon. These studies did not include exon 1 as it was considered non-coding.

[0006] Non-inactivating MECP2 mutations have also been associated with phenotypes that overlap RTT such as mental retardation and autism. There is a need for the identification of further mutations to account for the remaining 20% of RTT patients so that methods of diagnosing and treating RTT can be identified.

[0007] Mutations in the Rett syndrome gene, MECP2, have also been found among autism patients as well as in patients with childhood onset psychosis, Angelman syndrome, non-syndromic mental retardation and neo-natal encepalopathy, demonstrating that there may be diverse phenotypic consequences of mutations in MECP2.

SUMMARY OF THE INVENTION

[0008] The present inventors have identified a novel open reading frame of the MECP2 gene, that is called MECP2E1. Inspection of the 5'UTR revealed that, whereas exon 2 has a number of in-frame stops upstream of the ATG, exon 1 contains an open reading frame across its entire length including an ATG. This open reading frame encodes a transcript composed of exons 1, 3 and 4 of the MECP2 gene. MECP2E1 is similar to MECP2E2 (GenBank accession # NM_004992, (SEQ ID NO. 1) except with nucleotides 71-193 absent, corresponding to the splicing out of exon 2.

[0009] Accordingly, the present invention provides an isolated nucleic acid molecule comprising a sequence encoding the MeCP2E1 protein. The invention also includes the corresponding polypeptide, MeCP2E1.

[0010] Accordingly, the present invention provides an isolated nucleic acid molecule comprising a sequence encoding the MECP2E1 protein. The invention also includes the corresponding polypeptide, MeCP2E1.

[0011] In one embodiment, the purified and isolated nucleic acid molecule comprises

[0012] (a) a nucleic acid sequence encoding a protein as shown in SEQ ID No. 4;

[0013] (b) a nucleic acid sequence complementary to (a);

[0014] (c) a nucleic acid sequence that has substantial homology to (a) or (b);

[0015] (d) a nucleic acid sequence that is an analog to a nucleic acid sequence of (a), (b), or (c);

[0016] (e) a fragment of (a) to (d) that is at least 15 bases, preferably 20 to 30 bases, and which will hybridize to a nucleic acid sequence of (a), (b), (c) or (d) under stringent hybridization conditions; or

[0017] (f) a nucleic acid molecule differing from any of the nucleic acids of (a) to (c) in codon sequences due to the degeneracy of the genetic code.

[0018] In a specific embodiment of the invention, an isolated nucleic acid molecule is provided having a sequence as shown in SEQ ID No. 3 or a fragment or variant thereof.

[0019] The inventors have found that patients with a neuropsychiatric disorder or developmental disorder such as Rett's syndrome and mental retardation, had mutations in exon 1 of the MECP2E1 gene. Accordingly, the present invention provides a method of detecting a neuropsychiatric disorder or developmental disorder comprising detecting a mutation or deletion in exon 1 of the MECP2E1 sequence SEQ ID No. 3. A mutation can be detected by sequencing PCR products from genomic DNA using primers X1F/X1R: mutation screening primers (FIGS. 1A-1F). Detection of instertion or deletion mutations may require the cloning of the PCR product into a suitable plasmid vector, followed by transfection into E. coli, and sequencing of clones from isolated colonies. Alternatively, a mutation can be detected by multiple ligation-dependent probe amplification (MLPA) using 20 probe pairs that target the four MECP2 exons, six X-linked control regions and ten autosomal control regions. A mutation or deletion can also be detected by assaying for the protein product encoded by MECP2E1.

[0020] Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0022] The invention will now be described in relation to the drawings in which:

[0023] FIGS. 1A-1F shows MECP2 5' splice variants. a) Structure of the MECP2 gene. Numbered boxes indicate exons; asterisks indicate in-frame stop codons. In the traditional MECP2E2 splice variant, the start codon is in exon 2. In MECP2E1, exon 2 is not present and the start codon is in exon 1. HF/HR1 and MF/MR: human and mouse primer pairs used in the rtPCR experiments shown in panel c. HR2: a second human reverse primer, which confirms the results obtained with HR1 (data not shown). X1F/X1R: mutation screening primers (see FIGS. 2A-2C). Primer sequences (5'-3'): HF-ctcggagagagggctgtg (SEQ ID No. 5), HR1-cttgaggggtttgtccttga (SEQ ID No. 6), HR2-cgtttgatcaccatgacctg (SEQ ID No. 7), MF-aggaggcgaggaggagagac (SEQ ID No. 8), MR-ctggctctgcagaatggtg (SEQ ID No. 9), X1F-ccatcacagccaatgacg (SEQ ID No. 19), X1R-agggggagggtagagaggag (SEQ ID No. 20). b) Examples of MECP2 ESTs. c) PCR results using primers in (a) (HF/HR1 and MF/MR) on cDNA from indicated adult tissues (except where indicated otherwise) and cell cultures; d.p.c.: days postcoitum. d) Transcript-specific real-time quantitative PCR (SYBR Green detection method) on cDNA from indicated tissues or cell cultures. e) 3'myc-tagged MeCP2E1 (and MeCP2E2) localize principally in the nucleus, and in indeterminate puncti in the cytoplasm. f) N-termini of indicated proteins; dashes represent no amino acids.

[0024] FIGS. 2A-2C shows a deletion mutation in patient V1. a1) Sequence of PCR product from genomic DNA using primers X1F/X1R (FIG. 1A). Note mixed sequence. a2) and a3) Sequences of clones of the patient's wild-type and mutant alleles respectively; red box indicating the 11 nucleotides deleted in the mutated allele. b) Electropherograms of the same cloned wild-type and deleted alleles. c) PCR on indicated cDNAs using primers HF/HR1 (FIGS. 1A,C). Lanes 1 and 2 (on 2.5% high resolution agarose) are from control and patient whole blood respectively. Lanes 3 to 8 (on 6% denaturing polyacrylamide) are from control blood (3), patient blood (4), control fetal brain (5), control adult brain (6), control testis (7) and control genomic DNA (8). Note that expression of the patient's MECP2E2 transcript with the 11 bp exon 1 deletion (band at 266 bp) is not diminished compared to the non-deleted allele (277 bp). The 141 and 152 bp bands are the deleted and non-deleted MECP2E1 transcripts respectively.

[0025] FIGS. 3A-3B shows a deletion mutation in patient V2. MECP2 Multiplex ligation-dependent probe amplification (MLPA) peak profiles are shown. Control loci are listed along the top. Boxed regions (E1-E4) indicate MECP2 exons 1-4. a) MLPA profile of normal control. b) MLPA profile of patient V2 shows a hemizygous exon 1 deletion (asterisk). The result was consistently reproducible and sequencing ruled out the possibility of a SNP interfering with the ligation efficiency of the MLPA reaction.

[0026] FIGS. 4A-4B shows the characterization of the primary brain cell cultures by rtPCRR (A) and IF (B). (A) Map2, Gfap and Nestin expressions indicate that the cultures in B-27 medium were composed primarily of neurons and those in G-5 medium were glial cells. Fibroblasts from the same embryos were also cultured and used as negative controls. Whole brain tissue (15.5 dpc) was used as a positive control for Map2 and Nestin. (B) Double staining for neurons was performed with mouse anti-MAP2 and rabbit anti-GFAP antibodies. They were also counterstained with DAPI (blue). Most of the cells are neurons, which stained positively for MAP2 (green), and an insignificant percentage of contamination with glial cells stained positively for GFAP (red) was detected.

[0027] FIG. 5 shows the nucleotide sequence of the five MECP2 exon 1 variants identified in female MR patients. All sequences were obtained from single colonies, after cloning the heterozygous PCR product into the pDRIVE vector (Qiagen). The ATG start codon is indicated by a red box, where possible. The resulting amino acid sequence is also indicated, with wild type sequence shown in red, and changes indicated in green type.

[0028] FIG. 6 shows a high resolution agarose gel (2.2%) of PCR product for MECP2 exon 1 for negative controls (Lanes 1 and 2), 3 bp insertion (Lanes 3 and 4), 9 bp insertion (Lane 5) and 2 bp deletion (Lane 6). Size ladder (M) 100 bp ladder (MBI Fermentas), flanks the PCR lanes.

DETAILED DESCRIPTION OF THE INVENTION

[0029] The present inventors have identified a MECP2 splice variant that contributes to new coding sequence that may contain mutations in patients with neuropsychiatric disorders such as Rett's syndrome and mental retardation.

I. Nucleic Acid Molecules of the Invention

[0030] As hereinbefore mentioned, the present invention relates to isolated MECP2E1 nucleic acid molecules. The term "isolated" refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.

[0031] The term "nucleic acid" is intended to include DNA and RNA and can be either double stranded or single stranded. The term is also intended to include a strand that is a mixture of nucleic acid molecules and nucleic acid analogs and/or nucleotide analogs, or that is made entirely of nucleic acid analogs and/or nucleotide analogs.

[0032] Broadly stated, the present invention provides an isolated nucleic acid molecule containing a sequence encoding the MECP2E1 transcript of the MECP2 gene. Accordingly, the present invention provides an isolated nucleic acid molecule containing a sequence encoding MECP2E1 shown in SEQ ID No. 4 or a fragment, variant, or analog thereof.

[0033] In one embodiment, the purified and isolated nucleic acid molecule comprises

[0034] (a) a nucleic acid sequence encoding a MECP2E1 protein as shown in SEQ ID No. 4;

[0035] (b) a nucleic acid sequence complementary to (a);

[0036] (c) a nucleic acid sequence that has substantial homology to (a) or (b);

[0037] (d) a nucleic acid sequence that is an analog to a nucleic acid sequence of (a), (b), or (c);

[0038] (e) a fragment of (a) to (d) that is at least 15 bases, preferably 20 to 30 bases, and which will hybridize to a nucleic acid sequence of (a), (b), (c) or (d) under stringent hybridization conditions; or

[0039] (f) a nucleic acid molecule differing from any of the nucleic acids of (a) to (c) in codon sequences due to the degeneracy of the genetic code.

[0040] In a specific embodiment of the invention, the isolated nucleic acid molecule has a sequence as shown in SEQ ID No. 3 or a fragment or variant thereof.

[0041] The term "MECP2E1" means an isoform of the MECP2 gene that contains exons 1, 3 and 4 but lacks exon 2. This gene was previously referred to as MECP2B but is now called MECP2E1 indicating the translation start site in exon one. The term "MECP2E1" includes the nucleic acid sequence as shown in SEQ ID No. 3 as well as mutations, variants and fragments thereof that are associated with neuropsychiatric disorders and developmental disorders.

[0042] It will be appreciated that the invention includes nucleic acid molecules encoding truncations of the MeCP2E1 proteins of the invention, and analogs and homologs of the MeCP2E1 proteins of the invention and truncations thereof, as described below.

[0043] Further, it will be appreciated that the invention includes nucleic acid molecules comprising nucleic acid sequences having substantial sequence homology with the nucleic acid sequences of the invention and fragments thereof. The term "sequences having substantial sequence homology" means those nucleic acid sequences which have slight or inconsequential sequence variations from these sequences, i.e. the sequences function in substantially the same manner to produce functionally equivalent proteins. The variations may be attributable to local mutations or structural modifications.

[0044] Generally, nucleic acid sequences having substantial homology include nucleic acid sequences having at least 70%, preferably 80-90% identity with the nucleic acid sequences of the invention.

Sequence identity is most preferably assessed by the algorithm of the BLAST version 2.1 program advanced search (BLAST is a series of programs that are available online at the National Center for Biotechnology Information website. The advanced blast search is set to default parameters. (ie Matrix BLOSUM62; Gap existence cost 11; Per residue gap cost 1; Lambda ratio 0.85 default).). For example, if a nucleotide sequence (called "Sequence A") has 90% identity to a portion of the nucleotide sequence in SEQ ID No. 3, then Sequence A will be identical to the referenced portion of the nucleotide sequence in SEQ ID No. 3, except that Sequence A may include up to 10 point mutations, such as substitutions with other nucleotides, per each 100 nucleotides of the referenced portion of the nucleotide sequence in SEQ ID No. 3. Nucleotide sequences functionally equivalent to the MECP2E1 transcript can occur in a variety of forms as described below.

[0045] The term "a nucleic acid sequence which is an analog" means a nucleic acid sequence which has been modified as compared to the sequence of (a), (b) or (c) wherein the modification does not alter the utility of the sequence as described herein. The modified sequence or analog may have improved properties over the sequence shown in (a), (b) or (c). One example of a modification to prepare an analog is to replace one of the naturally occurring bases (i.e. adenine, guanine, cytosine or thymidine) of the sequence shown in SEQ ID No. 3, with a modified base such as such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8 amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine.

[0046] Another example of a modification is to include modified phosphorous or oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages in the nucleic acid molecule shown in SEQ ID No. 3. For example, the nucleic acid sequences may contain phosphorothioates, phosphotriesters, methyl phosphonates, and phosphorodithioates.

[0047] A further example of an analog of a nucleic acid molecule of the invention is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in the DNA (or RNA), is replaced with a polyamide backbone which is similar to that found in peptides (P. E. Nielsen, et al Science 1991, 254, 1497). PNA analogs have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind stronger to a complimentary DNA sequence due to the lack of charge repulsion between the PNA strand and the DNA strand. Other nucleic acid analogs may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may have morpholino backbone structures (U.S. Pat. No. 5,034,506). The analogs may also contain groups such as reporter groups, a group for improving the pharmacokinetic or pharmacodynamic properties of nucleic acid sequence.

[0048] Another aspect of the invention provides a nucleic acid molecule, and fragments thereof having at least 15 bases, which hybridizes to the nucleic acid molecules of the invention under hybridization conditions. Such nucleic acid molecules preferably hybridize to all or a portion of MECP2E1 or its complement under stringent conditions as defined herein (see Sambrook et al. (most recent edition) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, NY)). The portion of the hybridizing nucleic acids is typically at least 15 (e.g. 20, 25, 30 or 50) nucleotides in length. The hybridizing portion of the hybridizing nucleic acid is at least 80% e.g. at least 95% or at least 98% identical to the sequence or a portion or all of a nucleic acid encoding a MeCP2E1 polypeptide, or its complement. Hybridizing nucleic acids of the type described herein can be used, for example, as a cloning probe, a primer (e.g. a PCR primer) or a diagnostic probe. Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under stringent conditions. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical to the probe, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g. SSC or SSPE). Then, assuming that 1% mismatching results in a 1 degree Celsius decrease in the Tm, the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having greater than 95% identity with the probe are sought, the final wash temperature is decreased by 5 degrees Celsius). In practice, the change in Tm can be between 0.5 degrees Celsius and 1.5 degrees Celsius per 1% mismatch. Low stringency conditions involve hybridizing at about: 1.times.SSC, 0.1% SDS at 50.degree. C. High stringency conditions are: 0.1.times.SSC, 0.1% SDS at 65.degree. C. Moderate stringency is about 1.times.SSC 0.1% SDS at 60 degrees Celsius. The parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.

[0049] Isolated and purified nucleic acid molecules having sequences which differ from the nucleic acid sequence shown in SEQ ID No. 3 due to degeneracy in the genetic code are also within the scope of the invention. The genetic code is degenerate so other nucleic acid molecules, which encode a polypeptide identical to the MeCP2E1 amino acid sequence SEQ ID No. 4 may also be used.

[0050] The present invention also includes mutated forms of MEC2P2E1 associated with a neuropsychiatric disorder or developmental disorder including the specific mutations listed in Table 1. Specifically, the following mutations are associated with Rett's syndrome: (1) an 11 bp deletion in nucleotides 38 to 54 shown in SEQ ID No. 1; (2) a deletion of exon 1 containing nucleotides 1-69 shown in SEQ ID No. 1; (3) a adenosine to threonine change at nucleotide position 8 shown in SEQ ID No. 1; and (4) a deletion in the sequence TG at nucleotide positions 70-71 in SEQ ID No. 1.

[0051] The following mutations are associated with developmental delay: (1) an insertion of one or more copies of the trinucleotide sequence GCC between nucleotides 11 and 29 shown in SEQ ID No. 1; (2) a deletion of one or more copies of the trinucleotide sequence GCC between nucleotides 11 and 29 shown in SEQ ID No. 1; (3) an insertion of the nucleotide sequence GGA between nucleotides 38 and 54 shown in SEQ ID No. 1; (4) a deletion of the nucleotide sequence GC at nucleotides -38 and -39 upstream of nucleotide 1 shown in SEQ ID No. 1; and (5) a deletion of the nucleotide sequence AG at nucleotides -19 and -20 upstream of nucleotide 1 shown in SEQ ID No. 1.

[0052] With respect to mutations (4) and (5) in the developmental delay group, these are upstream of nucleotide 1 shown in SEQ ID No. 1 GenBank Accession number BX538060 has the upstream sequences. Therefore, for greater clarity mutation (4), that consists of a deletion of the nucleotide sequence GC at nucleotides -38 and -39, corresponds to nucleotides 11-12 of sequence BX538060; and mutation (5), that consists of a deletion of the nucleotide sequence AG at nucleotides -19 and -20, corresponds to nucleotides 30-31 of BX538060.

[0053] Nucleic acid molecules from MECP2E1 can be isolated by preparing a labeled nucleic acid probe based on all or part of the nucleic acid sequences as shown in SEQ ID No. 3, and using this labelled nucleic acid probe to screen an appropriate DNA library (e.g. a cDNA or genomic DNA library). Nucleic acids isolated by screening of a cDNA or genomic DNA library can be sequenced by standard techniques. Another method involves comparing the MECP2E1 sequence to other sequences, for example using bioinformatics techniques such as database searches or alignment strategies, and detecting the presence of a MECP2E1 nucleic acid sequence.

[0054] Nucleic acid molecules of the invention can also be isolated by selectively amplifying a nucleic acid using the polymerase chain reaction (PCR) methods and cDNA or genomic DNA. It is possible to design synthetic oligonucleotide primers from the nucleic acid molecules as shown in SEQ ID No. 3 for use in PCR. A nucleic acid can be amplified from cDNA or genomic DNA using these oligonucleotide primers and standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. It will be appreciated that cDNA may be prepared from mRNA, by isolating total cellular mRNA by a variety of techniques, for example, by using the guanidinium-thiocyanate extraction procedure of Chirgwin et al., Biochemistry, 18, 5294-5299 (1979). cDNA is then synthesized from the mRNA using reverse transcriptase (for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, Md., or AMV reverse transcriptase available from Seikagaku America, Inc., St. Petersburg, Fla.).

[0055] An isolated nucleic acid molecule of the invention which is RNA can be isolated by cloning a cDNA encoding a novel protein of the invention into an appropriate vector which allows for transcription of the cDNA to produce an RNA molecule which encodes the MeCP2E1 protein. For example, a cDNA can be cloned downstream of a bacteriophage promoter, (e.g. a T7 promoter) in a vector, cDNA can be transcribed in vitro with T7 polymerase, and the resultant RNA can be isolated by standard techniques.

[0056] A nucleic acid molecule of the invention may also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Pat. No. 4,598,049; Caruthers et al. U.S. Pat. No. 4,458,066; and Itakura U.S. Pat. Nos. 4,401,796 and 4,373,071).

[0057] The initiation codon and untranslated sequences of the nucleic acid molecules of the invention may be determined using currently available computer software designed for the purpose, such as PC/Gene (IntelliGenetics Inc., Calif.). Regulatory elements can be identified using conventional techniques. The function of the elements can be confirmed by using these elements to express a reporter gene which is operatively linked to the elements. These constructs may be introduced into cultured cells using standard procedures. In addition to identifying regulatory elements in DNA, such constructs may also be used to identify proteins interacting with the elements, using techniques known in the art.

[0058] The sequence of a nucleic acid molecule of the invention may be inverted relative to its normal presentation for transcription to produce an antisense nucleic acid molecule. Preferably, an antisense sequence is constructed by inverting a region preceding the initiation codon or an unconserved region. In particular, the nucleic acid sequences contained in the nucleic acid molecules of the invention or a fragment thereof, preferably a nucleic acid sequence shown in SEQ ID No. 3 may be inverted relative to its normal presentation for transcription to produce antisense nucleic acid molecules.

[0059] The antisense nucleic acid molecules of the invention or a fragment thereof, may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g. phosphorothioate derivatives and acridine substituted nucleotides. The antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced.

[0060] The invention also provides nucleic acids encoding fusion proteins comprising a novel protein of the invention and a selected protein, or a selectable marker protein (see below).

II. Novel Proteins of the Invention

[0061] The invention further includes an isolated MeCP2E1 protein encoded by the nucleic acid molecules of the invention. Within the context of the present invention, a protein of the invention may include various structural forms of the primary protein which retain biological activity.

[0062] Broadly stated, the present invention provides an isolated protein encoded by exon 1, 3 and 4 of the MECP2 gene.

[0063] In a preferred embodiment of the invention, the MeCP2E1 protein has the amino acid sequence as shown in SEQ ID No. 4 or a fragment or variant thereof.

[0064] The invention also includes mutated forms of the MeCP2E1 protein that are associated with a neuropsychiatric disorder or developmental disorder. Specifically, the invention includes the mutations in MECP2E1 described in Table 1.

[0065] In addition to full length amino acid sequences, the proteins of the present invention also include truncations of the protein, and analogs, and homologs of the protein and truncations thereof as described herein. Truncated proteins may comprise peptides of at least fifteen amino acid residues.

[0066] Analogs or variants of the protein having the amino acid sequence shown in SEQ ID No. 4 and/or truncations thereof as described herein, may include, but are not limited to an amino acid sequence containing one or more amino acid substitutions, insertions, and/or deletions. Amino acid substitutions may be of a conserved or non-conserved nature. Conserved amino acid substitutions involve replacing one or more amino acids of the proteins of the invention with amino acids of similar charge, size, and/or hydrophobicity characteristics. When only conserved substitutions are made the resulting analog should be functionally equivalent. Non-conserved substitutions involve replacing one or more amino acids of the amino acid sequence with one or more amino acids which possess dissimilar charge, size, and/or hydrophobicity characteristics.

[0067] One or more amino acid insertions may be introduced into the amino acid sequence shown in SEQ ID No. 4. Amino acid insertions may consist of single amino acid residues or sequential amino acids ranging from 2 to 15 amino acids in length. For example, amino acid insertions may be used to destroy target sequences so that the protein is no longer active. This procedure may be used in vivo to inhibit the activity of a protein of the invention.

[0068] Deletions may consist of the removal of one or more amino acids, or discrete portions from the amino acid sequence shown in SEQ ID No. 4. The deleted amino acids may or may not be contiguous. The lower limit length of the resulting analog with a deletion mutation is about 10 amino acids, preferably 100 amino acids.

[0069] Analogs of a protein of the invention may be prepared by introducing mutations in the nucleotide sequence encoding the protein. Mutations in nucleotide sequences constructed for expression of analogs of a protein of the invention must preserve the reading frame of the coding sequences. Furthermore, the mutations will preferably not create complementary regions that could hybridize to produce secondary mRNA structures, such as loops or hairpins, which could adversely affect translation of the receptor mRNA.

[0070] Mutations may be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.

[0071] Alternatively, oligonucleotide-directed site specific mutagenesis procedures may be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Deletion or truncation of a protein of the invention may also be constructed by utilizing convenient restriction endonuclease sites adjacent to the desired deletion. Subsequent to restriction, overhangs may be filled in, and the DNA religated. Exemplary methods of making the alterations set forth above are disclosed by Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989).

[0072] The proteins of the invention also include homologs of the amino acid sequence having the exon 1 region shown in SEQ ID No. 4 and/or truncations thereof as described herein.

[0073] A homologous protein includes a protein with an amino acid sequence having at least 70%, preferably 80-90% identity with the amino acid sequence as shown in SEQ ID No. 4 and includes the exon 1 region characteristic of the MeCP2E1 protein. As with the nucleic acid molecules of the invention, identity is calculated according to methods known in the art. Sequence identity is most preferably assessed by the algorithm of BLAST version 2.1 advanced search. BLAST is a series of programs that are available online at the National Center for Biotechnology Information website. The advanced blast search is set to default parameters (i.e. Matrix BLOSUM62, Gap existence cost 11; Per residue gap cost 1; Lambda ration 0.85 default).

[0074] The invention also contemplates isoforms of the proteins of the invention. An isoform contains the same number and kinds of amino acids as a protein of the invention, but the isoform has a different molecular structure. The isoforms contemplated by the present invention are those having the same properties as a protein of the invention as described herein.

[0075] The present invention also includes a protein of the invention conjugated with a selected protein, or a selectable marker protein (see below) to produce fusion proteins. Additionally, immunogenic portions of a protein of the invention are within the scope of the invention.

[0076] The proteins of the invention (including truncations, analogs, etc.) may be prepared using recombinant DNA methods. Accordingly, the nucleic acid molecules of the present invention having a sequence which encodes a protein of the invention may be incorporated in a known manner into an appropriate expression vector which ensures good expression of the protein. Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno-associated viruses), so long as the vector is compatible with the host cell used. The expression vectors are "suitable for transformation of a host cell", means that the expression vectors contain a nucleic acid molecule of the invention and regulatory sequences selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid molecule. Operatively linked is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.

[0077] The invention therefore contemplates a recombinant expression vector of the invention containing a nucleic acid molecule of the invention, or a fragment thereof, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence. Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, or viral genes (For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Selection of appropriate regulatory sequences is dependent on the host cell chosen, and may be readily accomplished by one of ordinary skill in the art. Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other sequences, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector. It will also be appreciated that the necessary regulatory sequences may be supplied by the native protein and/or its flanking regions.

[0078] The invention further provides a recombinant expression vector comprising a DNA nucleic acid molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression, by transcription of the DNA molecule, of an RNA molecule which is antisense to a nucleotide sequence comprising the nucleotides as shown SEQ ID No. 3. Regulatory sequences operatively linked to the antisense nucleic acid can be chosen which direct the continuous expression of the antisense RNA molecule.

[0079] The recombinant expression vectors of the invention may also contain a selectable marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule of the invention. Examples of selectable marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, -galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. Transcription of the selectable marker gene is monitored by changes in the concentration of the selectable marker protein such as -galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. If the selectable marker gene encodes a protein conferring antibiotic resistance such as neomycin resistance transformant cells can be selected with G418. Cells that have incorporated the selectable marker gene will survive, while the other cells die. This makes it possible to visualize and assay for expression of recombinant expression vectors of the invention and in particular to determine the effect of a mutation on expression and phenotype. It will be appreciated that selectable markers can be introduced on a separate vector from the nucleic acid of interest.

[0080] The recombinant expression vectors may also contain genes which encode a fusion moiety which provides increased expression of the recombinant protein; increased solubility of the recombinant protein; and aid in the purification of a target recombinant protein by acting as a ligand in affinity purification. For example, a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.

[0081] Recombinant expression vectors can be introduced into host cells to produce a transformed host cell. The term "transformant host cell" is intended to include prokaryotic and eukaryotic cells which have been transformed or transfected with a recombinant expression vector of the invention. The terms "transformed with", "transfected with", "transformation" and "transfection" are intended to encompass introduction of nucleic acid (e.g. a vector) into a cell by one of many possible techniques known in the art. Prokaryotic cells can be transformed with nucleic acid by, for example, electroporation or calcium-chloride mediated transformation. Nucleic acid can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks.

[0082] Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the proteins of the invention may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells or mammalian cells. Other suitable host cells can be found in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1991).

[0083] The proteins of the invention may also be prepared by chemical synthesis using techniques well known in the chemistry of proteins such as solid phase synthesis (Merrifield, 1964, J. Am. Chem. Assoc. 85:2149-2154) or synthesis in homogenous solution (Houbenweyl, 1987, Methods of Organic Chemistry, ed. E. Wansch, Vol. 15 I and II, Thieme, Stuttgart).

III. Applications

A. Diagnostic Applications

[0084] As previously mentioned, the present inventors have isolated a novel splice variant of the MECP2 gene, MECP2E1, and have shown that exon 1 is deleted or mutated in people with neuropsychiatric disorders or developmental disorders such as Rett's syndrome or mental retardation. As a result, the present invention also includes a method of detecting a neuropsychiatric or developmental disorder by detecting a mutation or deletion in the MECP2E1 nucleic acid or MeCP2E1 protein.

[0085] As previously mentioned, the present inventors have isolated a novel splice variant of the MECP2 gene, MeCP2E1, and have shown that exon 1 is deleted or mutated in people with neuropsychiatric disorders or developmental disorders such as Rett's syndrome or mental retardation. As a result, the present invention also includes a method of detecting a neuropsychiatric or developmental disorder by detecting a mutation or deletion in the MECP2E1 nucleic acid or protein.

[0086] The term "neuropsychiatric disorder" as used herein includes, but is not limited to, autism/autism spectrum disorder, epilepsy, Angelman syndrome, Prader-Willi syndrome, encephalopathy, schizophrenia, bipolar affective disorder, depression, obsessive compulsive disorder, panic disorder, attention deficit hyperactivity disorder, and ataxia.

[0087] The term "developmental disorder" includes but is not limited to, mental retardation.

i) Detecting Mutations in the Nucleic Acid Sequence

[0088] In one embodiment, the present invention provides a method for detecting a neuropsychiatric or developmental disorder comprising detecting a deletion or mutation in exon 1 of the MECP2 gene in a sample obtained from an animal, preferably a mammal, more preferably a human.

[0089] The Examples and Table 1 summarize some of the mutations found in MECP2E1 in patient's with Rett's syndrome or developmental delay. (They are also described in Section I). Screening assays can be developed for each of the mutations. Examples of methods that can be used to detect mutations include sequencing, polymerase chain reaction, reverse transcription-polymerase chain reaction, denaturing HPLC, electrophoretic mobility, nucleic acid hybridization, fluorescent in situ hybridization and multiplex ligation-dependent probe amplification. Details of screening assays that may be employed are provided in Examples 3, 4 or 5.

[0090] Rett's syndrome has been shown to be caused by deletions in exon 1 of MECP2. Patients homozygous for these deletions can be detected by PCR-amplifying and sequencing exon 1 and flanking sequences using X1F/X1R primers. Consequently, the present invention includes a method for determining a deletion in exon 1 of the MECP2 gene by a method comprising:

[0091] (a) amplifying the nucleic acid sequences in the sample with primers X1F (5'-CCATCACAGCCAATGACG-3') (SEQ ID No. 19) and X1R (5'-AGGGGGAGGGTAGAGAGGAG-3') (SEQ ID No. 20) in a polymerase chain reaction;

[0092] (b) amplifying the nucleic acid sequences from a control with same primers;

[0093] (c) sequencing the amplified sequences; and

[0094] (d) comparing the sample sequences to the control sequences

[0095] wherein deletion of nucleotides in the sample sequence compared to the control sequence indicates that the sample is from an animal with Rett's syndrome.

[0096] Additional exon 1 mutations not detectable by the PCR reaction, can be identified using multiplex ligation-dependent probe amplification (MLPA) in all four exons. MLPA analysis is described in reference 5 and in Schouten, U.S. application Ser. No. 10/218,567, (publication number 2003/0108913) which are incorporated herein in by reference. Accordingly, the present invention includes a method for determining a deletion in exon 1 of the MECP2 gene by performing MLPA analysis with 20 probe pairs that target the four MECP2 exons, six X-linked control regions and ten autosomal control regions.

[0097] One skilled in the art will appreciate that other methods, in addition to the ones discussed above and in the examples, can be used to detect mutations in exon 1 of the MECP2 gene. For example, in order to isolate nucleic acids from a sample, one can prepare nucleotide probes from the nucleic acid sequences of the invention. In addition, the nucleic acid probes described herein (for example, see FIGS. 1A-1F) can also be used. A nucleotide probe may be labelled with a detectable marker such as a radioactive label which provides for an adequate signal and has sufficient half life such as 32p, .sup.3H, 14C or the like. Other detectable markers which may be used include antigens that are recognized by a specific labelled antibody, fluorescent compounds, enzymes, antibodies specific for a labelled antigen, and chemiluminescent compounds. An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleotide to be detected and the amount of nucleotide available for hybridization.

[0098] Accordingly, the present invention also relates to a method of detecting the presence of a nucleic acid molecule containing exon 1 of the MECP2 gene in a sample comprising contacting the sample under hybridization conditions with one or more of nucleotide probes which hybridize to the nucleic acid molecules and are labelled with a detectable marker, and determining the degree of hybridization between the nucleic acid molecule in the sample and the nucleotide probes.

[0099] Hybridization conditions which may be used in the methods of the invention are known in the art and are described for example in Sambrook J, Fritch E F, Maniatis T. In: Molecular Cloning, A Laboratory Manual, 1989. (Nolan C, Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. The hybridization product may be assayed using techniques known in the art. The nucleotide probe may be labelled with a detectable marker as described herein and the hybridization product may be assayed by detecting the detectable marker or the detectable change produced by the detectable marker.

[0100] Prior to hybridizing a sample with DNA probes, the sample can be treated with primers that flank the MECP2 gene in order to amplify the nucleic acid sequences in the sample. The primers used may be the ones described in the present application. For example, primers specific for human MECP2 include HF(ctcggagagagggctgtg) (SEQ ID No. 5), HR1(cttgaggggtttgtccttga) (SEQ ID No. 6), HR2(cgtttgatcaccatgacctg) (SEQ ID No. 7). Primers for mouse MECP2 include MF(aggaggcgaggaggagagac) (SEQ ID NO. 8) and MR(ctggctctgcagaatggtg) (SEQ ID No. 9). In addition, the sequence of the MECP2 gene provided herein also permits the identification and isolation, or synthesis of new nucleotide sequences which may be used as primers to amplify a nucleic acid molecule of the invention. The primers may be used to amplify the genomic DNA of other species. The PCR amplified sequences can be examined to determine the relationship between the genes of various species.

[0101] The length and bases of the primers for use in the PCR are selected so that they will hybridize to different strands of the desired sequence and at relative positions along the sequence such that an extension product synthesized from one primer when it is separated from its template can serve as a template for extension of the other primer into a nucleic acid of defined length. Primers which may be used in the invention are oligonucleotides i.e. molecules containing two or more deoxyribonucleotides of the nucleic acid molecule of the invention which occur naturally as in a purified restriction endonuclease digest or are produced synthetically using techniques known in the art such as for example phosphotriester and phosphodiester methods (See Good et al Nucl. Acid Res 4:2157, 1977) or automated techniques (See for example, Conolly, B. A. Nucleic Acids Res. 15(7): 3131, 1987). The primers are capable of acting as a point of initiation of synthesis when placed under conditions which permit the synthesis of a primer extension product which is complementary to the DNA sequence of the invention i.e. in the presence of nucleotide substrates, an agent for polymerization such as DNA polymerase and at suitable temperature and pH. Preferably, the primers are sequences that do not form secondary structures by base pairing with other copies of the primer or sequences that form a hair pin configuration. The primer preferably contains between about 7 and 25 nucleotides.

[0102] The primers may be labelled with detectable markers which allow for detection of the amplified products. Suitable detectable markers are radioactive markers such as P-32, S-35, 1-125, and H-3, luminescent markers such as chemiluminescent markers, preferably luminol, and fluorescent markers, preferably dansyl chloride, fluorescein-5-isothiocyanate, and 4-fluor-7-nitrobenz-2-axa-1,3 diazole, enzyme markers such as horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase, acetylcholinesterase, or biotin.

[0103] It will be appreciated that the primers may contain non-complementary sequences provided that a sufficient amount of the primer contains a sequence which is complementary to a nucleic acid molecule of the invention or oligonucleotide fragment thereof, which is to be amplified. Restriction site linkers may also be incorporated into the primers allowing for digestion of the amplified products with the appropriate restriction enzymes facilitating cloning and sequencing of the amplified product.

[0104] In an embodiment of the invention a method of determining the presence of a nucleic acid molecule of the invention is provided comprising treating the sample with primers which are capable of amplifying the nucleic acid molecule or a predetermined oligonucleotide fragment thereof in a polymerase chain reaction to form amplified sequences, under conditions which permit the formation of amplified sequences and, assaying for amplified sequences.

[0105] The polymerase chain reaction refers to a process for amplifying a target nucleic acid sequence as generally described in Innis et al, Academic Press, 1990 in Mullis et al., U.S. Pat. No. 4,863,195 and Mullis, U.S. Pat. No. 4,683,202 which are incorporated herein by reference. Conditions for amplifying a nucleic acid template are described in M. A. Innis and D. H. Gelfand, PCR Protocols, A Guide to Methods and Applications M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White eds, pp 3-12, Academic Press 1989, which is also incorporated herein by reference.

[0106] The amplified products can be isolated and distinguished based on their respective sizes using techniques known in the art. For example, after amplification, the DNA sample can be separated on an agarose gel and visualized, after staining with ethidium bromide, under ultra violet (UV) light. DNA may be amplified to a desired level and a further extension reaction may be performed to incorporate nucleotide derivatives having detectable markers such as radioactive labelled or biotin labelled nucleoside triphosphates. The primers may also be labelled with detectable markers as discussed above. The detectable markers may be analyzed by restriction and electrophoretic separation or other techniques known in the art.

[0107] The conditions which may be employed in the methods of the invention using PCR are those which permit hybridization and amplification reactions to proceed in the presence of DNA in a sample and appropriate complementary hybridization primers. Conditions suitable for the polymerase chain reaction are generally known in the art. For example, see M. A. Innis and D. H. Gelfand, PCR Protocols, A guide to Methods and Applications M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White eds, pp 3-12, Academic Press 1989, which is incorporated herein by reference. Preferably, the PCR utilizes polymerase obtained from the thermophilic bacterium Thermus aquatics (Taq polymerase, GeneAmp Kit, Perkin Elmer Cetus) or other thermostable polymerase may be used to amplify DNA template strands.

[0108] It will be appreciated that other techniques such as the Ligase Chain Reaction (LCR) and NASBA may be used to amplify a nucleic acid molecule of the invention (Barney in "PCR Methods and Applications", August 1991, Vol. 1(1), page 5, and European Published Application No. 0320308, published Jun. 14, 1989, and U.S. Pat. No. 5,130,238 to Malek).

(ii) Detecting the MeCP2E1 Protein

[0109] In another embodiment, the present invention provides a method for detecting a neuropsychiatric or developmental disorder comprising detecting a deletion or mutation in the MeCP2E1 protein in a sample from an animal.

[0110] The MeCP2E1 protein of the present invention may be detected in a biological sample using antibodies that are specific for MeCP2E1 using various immunoassays that are discussed below.

[0111] Conventional methods can be used to prepare the antibodies. For example, by using a peptide from the MeCP2E1 protein of the invention, polyclonal antisera or monoclonal antibodies can be made using standard methods. A mammal, (e.g., a mouse, hamster, or rabbit) can be immunized with an immunogenic form of the peptide which elicits an antibody response in the mammal. Techniques for conferring immunogenicity on a peptide include conjugation to carriers or other techniques well known in the art. For example, the peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassay procedures can be used with the immunogen as antigen to assess the levels of antibodies. Following immunization, antisera can be obtained and, if desired, polyclonal antibodies isolated from the sera.

[0112] To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Such techniques are well known in the art, (e.g., the hybridoma technique originally developed by Kohler and Milstein (Nature 256, 495-497 (1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4, 72 (1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and screening of combinatorial antibody libraries (Huse et al., Science 246, 1275 (1989)). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the peptide and the monoclonal antibodies can be isolated. Therefore, the invention also contemplates hybridoma cells secreting monoclonal antibodies with specificity for a protein of the invention.

[0113] The term "antibody" as used herein is intended to include fragments thereof which also specifically react with a protein of the invention, or peptide thereof. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above. For example, F(ab')2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments.

[0114] Chimeric antibody derivatives, i.e., antibody molecules that combine a non-human animal variable region and a human constant region are also contemplated within the scope of the invention. Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, or other species, with human constant regions. Conventional methods may be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes a CipA protein (See, for example, Morrison et al., Proc. Natl. Acad. Sci. U.S.A. 81, 6851 (1985); Takeda et al., Nature 314, 452 (1985), Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom patent GB 2177096B).

[0115] Monoclonal or chimeric antibodies specifically reactive with a protein of the invention as described herein can be further humanized by producing human constant region chimeras, in which parts of the variable regions, particularly the conserved framework regions of the antigen-binding domain, are of human origin and only the hypervariable regions are of non-human origin. Such immunoglobulin molecules may be made by techniques known in the art, (e.g., Teng et al., Proc. Natl. Acad. Sci. U.S.A., 80, 7308-7312 (1983); Kozbor et al., Immunology Today, 4, 7279 (1983); Olsson et al., Meth. Enzymol., 92, 3-16 (1982)), and PCT Publication WO92/06193 or EP 0239400). Humanized antibodies can also be commercially produced (Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great Britain.)

[0116] Specific antibodies, or antibody fragments, reactive against a protein of the invention may also be generated by screening expression libraries encoding immunoglobulin genes, or portions thereof, expressed in bacteria with peptides produced from the nucleic acid molecules of the present invention. For example, complete Fab fragments, VH regions and FV regions can be expressed in bacteria using phage expression libraries (See for example Ward et al., Nature 341, 544-546: (1989); Huse et al., Science 246, 1275-1281 (1989); and McCafferty et al. Nature 348, 552-554 (1990)).

[0117] Antibodies may also be prepared using DNA immunization. For example, an expression vector containing a nucleic acid of the invention (as described above) may be injected into a suitable animal such as mouse. The protein of the invention will therefore be expressed in vivo and antibodies will be induced. The antibodies can be isolated and prepared as described above for protein immunization.

[0118] The antibodies may be labelled with a detectable marker including various enzymes, fluorescent materials, luminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, biotin, alkaline phosphatase, -galactosidase, or acetylcholinesterase; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include S-35, Cu-64, Ga-67, Zr-89, Ru-97, Tc-99m, Rh-105, Pd-109, In-111, I-123, I-125, I131, Re-186, Au-198, Au-199, Pb-203, At-211, Pb-212 and Bi-212. The antibodies may also be labelled or conjugated to one partner of a ligand binding pair. Representative examples include avidin-biotin and riboflavin-riboflavin binding protein. Methods for conjugating or labelling the antibodies discussed above with the representative labels set forth above may be readily accomplished using conventional techniques.

[0119] The antibodies reactive against proteins of the invention (e.g. enzyme conjugates or labelled derivatives) may be used to detect a protein of the invention in various samples, for example they may be used in any known immunoassays which rely on the binding interaction between an antigenic determinant of a protein of the invention and the antibodies. Examples of such assays are radioimmunoassays, enzyme immunoassays (e.g. ELISA), immunofluorescence, immuno-precipitation, latex agglutination, hemagglutination, and histochemical tests. Thus, the antibodies may be used to identify or quantify the amount of a protein of the invention in a sample in order to diagnose the presence of Rett's syndrome.

[0120] In a method of the invention a predetermined amount of a sample or concentrated sample is mixed with antibody or labelled antibody. The amount of antibody used in the process is dependent upon the labelling agent chosen. The resulting protein bound to antibody or labelled antibody may be isolated by conventional isolation techniques, for example, salting out, chromatography, electrophoresis, gel filtration, fractionation, absorption, polyacrylamide gel electrophoresis, agglutination, or combinations thereof.

[0121] The sample or antibody may be insolubilized, for example, the sample or antibody can be reacted using known methods with a suitable carrier. Examples of suitable carriers are Sepharose or agarose beads. When an insolubilized sample or antibody is used protein bound to antibody or unreacted antibody is isolated by washing. For example, when the sample is blotted onto a nitrocellulose membrane, the antibody bound to a protein of the invention is separated from the unreacted antibody by washing with a buffer, for example, phosphate buffered saline (PBS) with bovine serum albumin (BSA).

[0122] When labelled antibody is used, the presence of MeCP2E1 can be determined by measuring the amount of labelled antibody bound to a protein of the invention in the sample or of the unreacted labelled antibody. The appropriate method of measuring the labelled material is dependent upon the labelling agent.

[0123] When unlabelled antibody is used in the method of the invention, the presence of MeCP2E1 can be determined by measuring the amount of antibody bound to the protein using substances that interact specifically with the antibody to cause agglutination or precipitation. In particular, labelled antibody against an antibody specific for a protein of the invention, can be added to the reaction mixture. The presence of a protein of the invention can be determined by a suitable method from among the already described techniques depending on the type of labelling agent. The antibody against an antibody specific for a protein of the invention can be prepared and labelled by conventional procedures known in the art which have been described herein.

[0124] The antibody against an antibody specific for a protein of the invention may be a species specific anti-immunoglobulin antibody or monoclonal antibody, for example, goat anti-rabbit antibody may be used to detect rabbit antibody specific for a protein of the invention.

(iii) Kits

[0125] The reagents suitable for carrying out the methods of the invention may be packaged into convenient kits providing the necessary materials, packaged into suitable containers. Such kits may include all the reagents required to detect a nucleic acid molecule or protein of the invention in a sample by means of the methods described herein, and optionally suitable supports useful in performing the methods of the invention.

[0126] In one embodiment of the invention, the kit includes primers which are capable of amplifying a nucleic acid molecule of the invention or a predetermined oligonucleotide fragment thereof, all the reagents required to produce the amplified nucleic acid molecule or predetermined fragment thereof in the polymerase chain reaction, and means for assaying the amplified sequences. The kit may also include restriction enzymes to digest the PCR products. In another embodiment of the invention the kit contains a nucleotide probe which hybridizes with a nucleic acid molecule of the invention, reagents required for hybridization of the nucleotide probe with the nucleic acid molecule, and directions for its use. In a further embodiment of the invention the kit includes antibodies of the invention and reagents required for binding of the antibody to a protein of the invention in a sample.

[0127] The kits may include nucleic acid molecules, proteins or antibodies of the invention (described above) to detect or treat neuropsychiatric disorders and developmental disorders together with instructions for the use thereof.

[0128] The methods and kits of the present invention may be used to detect neuropsychiatric and developmental disorders such as Rett's syndrome and mental retardation. Samples which may be tested include bodily materials such as blood, urine, serum, tears, saliva, feces, tissues, organs, cells and the like. In addition to human samples, samples may be taken from mammals such as non-human primates, etc.

[0129] Before testing a sample in accordance with the methods described herein, the sample may be concentrated using techniques known in the art, such as centrifugation and filtration. For the hybridization and/or PCR-based methods described herein, nucleic acids may be extracted from cell extracts of the test sample using techniques known in the art.

B. Therapeutic Applications

[0130] As mentioned previously, the nucleic acid molecules of the present invention are deleted or mutated in people with neuropsychiatric disorders and developmental disorders. Accordingly, the present invention provides a method of treating or preventing neuropsychiatric disorders and developmental disorders by administering a nucleic acid sequence containing a sufficient portion of the MECP2E1 splice variant to treat or prevent neuropsychiatric disorders and developmental disorders. The present invention includes a use of a nucleic acid molecule or protein of the invention to treat or detect neuropsychiatric disorders and developmental disorders.

[0131] Recombinant molecules comprising a nucleic acid sequence or fragment thereof, may be directly introduced into cells or tissues in vivo using delivery vehicles such as retroviral vectors, adenoviral vectors and DNA virus vectors. They may also be introduced into cells in vivo using physical techniques such as microinjection and electroporation or chemical methods such as coprecipitation and incorporation of DNA into liposomes. Recombinant molecules may also be delivered in the form of an aerosol or by lavage.

[0132] The nucleic acid sequences may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for administration in vivo. By "biologically compatible form suitable for administration in vivo" is meant a form of the substance to be administered in which any toxic effects are outweighed by the therapeutic effects. The substances may be administered to living organisms including humans, and animals. Administration of a therapeutically active amount of the pharmaceutical compositions of the present invention is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, a therapeutically active amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of antibody to elicit a desired response in the individual. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0133] The active substance may be administered in a convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration. Depending on the route of administration, the active substance may be coated in a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound.

[0134] The compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985). On this basis, the compositions include, albeit not exclusively, solutions of the substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.

C. Experimental Models

[0135] The present invention also includes methods and experimental models for studying the function of the MECP2 gene and MeCP2E1 protein. Cells, tissues and non-human animals that lack the MECP2E1 splice variant or partially lack in MeCP2E1 expression may be developed using recombinant expression vectors having a specific deletion or mutation in the MECP2E1 gene. A recombinant expression vector may be used to inactivate or alter the MECP2 gene by homologous recombination and thereby create a MECP2E1 deficient cell, tissue or animal. In particular, a targeted mutation could be designed to result in deficient MECP2E1 while MECP2E2 remains unaltered. This can be accomplished by targeting exon 1 of the MECP2 gene.

[0136] Null alleles may be generated in cells, such as embryonic stem cells by deletion mutation. A recombinant MECP2 gene may also be engineered to contain an insertion mutation which inactivates MECP2E1. Such a construct may then be introduced into a cell, such as an embryonic stem cell, by a technique such as transfection, electroporation, injection etc. Cells lacking an intact MECP2 gene may then be identified, for example by Southern blotting, Northern Blotting or by assaying for MECP2E1 using the methods described herein. Such cells may then be fused to embryonic stem cells to generate transgenic non-human animals deficient in MECP2E1. Germline transmission of the mutation may be achieved, for example, by aggregating the embryonic stem cells with early stage embryos, such as 8 cell embryos, in vitro; transferring the resulting blastocysts into recipient females and; generating germline transmission of the resulting aggregation chimeras. Such a mutant animal may be used to define specific cell populations, developmental patterns and in vivo processes, normally dependent on MECP2E1 expression. The present invention also includes the preparation of tissue specific knock-outs of the MECP2E1 variant.

[0137] The following non-limiting examples are illustrative of the present invention:

EXAMPLES

Example 1

Identification of MEC2E1 Splice Variant

[0138] Inspection of the 5'UTR revealed that, whereas exon 2 has a number of in-frame stops upstream of the ATG, exon 1 contains an open reading frame across its entire length including an ATG. Submitting a theoretical construct composed of exons 1, 3 and 4 to the ATGpr program at the Helix Research Institute website, which predicts the likelihood of an ATG to be an initiation codon based on significance of its surrounding Kozak nucleotide context, returned a reliability score of 97% compared to 64% for MECP2E2. A search in EST databases identified eight examples of our theorized transcript (named MECP2E1) (FIG. 1B) (vs. 14 examples of MECP2E2). MECP2E1 would be predicted to encode a new variant, MeCP2E1, with an alternative longer N-terminus determined by exon 1.

Example 2

Expression of MECP2E1

[0139] To confirm that MECP2E1 is in fact expressed and not an artifact of cDNA library preparations, cDNA from a variety of tissues was PCR-amplified using a 5'-primer in exon 1 and a 3'-primer in exon 3 (FIG. 1A). Two PCR products corresponding to MECP2E2 and MECP2E1 by size and sequence were obtained in all tissues, including fetal and adult brain, and in brain subregions (FIG. 1C). Results in mouse were similar (FIG. 1C). The expression levels of the two transcripts in adult human brain were quantified. MECP2E1 expression is 10 times higher than MECP2E2 (FIG. 1D). The subcellular localization of MeCP2E1 following transfection of 3' myc-tagged MECP2E1 into COS-7 cells was found to be principally in the nucleus (FIG. 1E).

[0140] MECP2E1 was not detected in previous expression studies. Northern analyses reveal three transcripts, 1.9, 5 and 10.1 kb, with the differences in size due to alternative polyadenylation signal usage (4, 6, 8) (FIG. 1A). MECP2E1 differs from MECP2E2 in lacking the 124-nucleotide exon 2. At the 5 and 10.1 kb positions on the gel, the two transcripts would not be separable. In the 1.9 kb range, published northern blots do show a thick or double band likely corresponding to the two transcripts. Likewise, conventional western blot analysis would not allow resolution of the two MeCP2 isoforms (molecular weight difference<0.9kD; FIG. 1F).

Example 3

Mutations in MECP2E1 in Rett's Syndrome

[0141] To determine whether the new coding region is mutated in Rett's syndrome, Exon 1 and flanking sequences were PCR-amplified and sequenced in 19 girls with typical RTT in whom no mutations had been found in the other exons. One patient (V1) was found to carry an 11 bp deletion mutation in exon 1 (FIGS. 2A-2C). The deletion occurs within the predicted exon 1 open reading frame of MECP2E1 and leads to a frame shift that results in a missense amino acid sequence followed by a premature stop codon after amino acid 36. It does not affect the coding sequence of MECP2E2. This sequence change was not found in 200 control individuals including the patient's parents and brother.

[0142] To search, in the remaining patients, for additional exon 1 deletions not detectable by our PCR reaction, multiplex ligation-dependent probe amplification (MLPA) (5) was performed in all four exons and detected a hemizygous deletion of exon 1 in one patient (Patient V2; FIGS. 3A-3B). Finally, an additional patient with an MLPA-detected deletion restricted to exon 1 was recently documented in abstract form, though the effect on MECP2E1 was not realized (S. Boulanger et al. Am J Hum Genet 73, 572 (2003)).

[0143] In contrast, no mutation specific to the MeCP2E2-defining exon 2 has been found to date despite several hundred patients analyzed for mutations in this exon. These studies did not include exon 1 as it was considered non-coding.

[0144] Exon 1 deletions result in absent or truncated MeCP2E1 proteins. However, they also result in shortening of MECP2E2's 5'UTR and may possibly affect its expression. This possibility was tested in patient V1 by RT-PCR on whole blood. No diminution of MECP2E2 expression was present (FIG. 2C). In conclusion, mutation data indicate that inactivation of MeCP2E1 is sufficient in RTT, but the same cannot be said, to date, of MeCP2E2.

Materials and Methods

[0145] PCR, manual sequencing, cloning, rtPCR, gel blotting. PCR amplification was performed using [NH.sub.4].sub.2SO.sub.4-containing PCR buffer (MBI Fermentas) with 1M betaine, 200 .mu.M dNTPs including 50% deaza dGTP, with a 95.degree. C. denaturing step for 3 minutes, followed by cycling at 95.degree. C. for 30 secs, 55.degree. C. for 30 secs, 72.degree. C. for 45 secs for 30 cycles, followed by a 7 minute soak step at 72.degree. C. Manual sequencing was performed, following extraction from a 1% agarose gel, using the Thermosequenase.TM. kit (USB/Amersham) and run on a 6% denaturing polyacrylamide gel for 3 hours. PCR products were cloned using the pDRIVE vector (Qiagen PCR cloning kit). Whole blood RNA was extracted using the PAXgene Blood RNA Kit (Qiagen). Reverse transcription was performed with random hexamers and a standard Superscript III protocol (Invitrogen). Human brain subregion cDNA was obtained from OriGene. The polyacrylamide gel in (FIG. 2C) was blotted onto Hybond N+(Amersham) and hybridized with primer HF labeled at the 3'end with [.alpha..sup.32P]-dCTP using deoxynucleotidyl transferase (MBI Fermentas).

[0146] Preparation of neuronal and glial cultures. Cerebral cortices were prepared from 15.5 days postcoitum (15.5 dpc) embryos of CD-1 mice. The procedure of Yamasaki et al. (Yamasaki et al. Hum Mol Genet 12: 837-847, 2003) was used. Briefly, fetal cerebral cortices without meninges were dissociated by mechanical trituration and digested with 0.25% trypsin with EDTA. After adding fetal bovine serum (FBS; GIBCO BRL), filtered cells were collected by centrifugation. The cell pellet was resuspended in Neurobasal (GIBCO BRL) medium supplemented with B-27 (GIBCO BRL) for growth of neurons or with G-5 (GIBCO BRL) for growth of glial cells. Cells were plated on polyethyleneimine-coated plastic dishes at a density of 2.times.10.sup.6 cells/ml. Cultures of neurons and glial cells were maintained in 5% CO.sub.2 at 37.degree. C. for 6 days and 12 days, respectively. Isolated brain cells were characterized by RT-PCR and immunofluorescence (IF) using the markers MAP2 (microtubule-associated protein 2) for neurons, GFAP (glial fibrillary acidic protein) for glial cells and NESTIN for progenitor cells. For IF, the following specific antibodies were used: mouse monoclonal anti-MAP2 (CHEMICON), and rabbit polyclonal anti-GFAP (DAKO). The primers used for rtPCR were same as Yamasaki et al. To obtain a semi-quantitative PCR, optimal cDNA concentration and number of cycles were determined according to Gapdh amplification as an internal control. FIGS. 4A-4B shows the characterization of the primary brain cell cultures by rtPCR (A) and IF (B).

[0147] Quantitative rtPCR. To determine the quantity of the MECP2 transcripts in different tissues, we developed transcript-specific real-time quantitative PCR assays using SYBR Green detection method (PE Applied Biosystems, ABI PRISM 7900 Sequence Detection System). The following MECP2E2-specific forward primer (25 nM) (in exon 2) was designed: 5'-ctcaccagttcctgctttgatgt-3' (SEQ ID No. 12). The MECP2E1-specific primer (25 nM) was placed at the junction of exons 1 and 3: 5'-aggagagactggaagaaaagtc-3' (SEQ ID No. 10). Both assays used the same reverse primer (25 nM) in exon 3: 5'-cttgaggggtttgtccttga-3' (SEQ ID No. 11), producing fragments of 161-(MECP2E2) and 65-bp (MECP2E1). The corresponding transcript-specific primers (25 nM) for the mouse mecp2 transcripts (mecp2e2 167 bp and mecp2e1 71 bp) were 5'-ctcaccagttcctgctttgatgt-3' (SEQ ID No. 12) (MECP2E2); 5'-aggagagactggaggaaaagtc-3' (SEQ ID No. 13) (MECP2E1) and the common reverse primer 5'-cttaaacttcagtggcttgtctctg-3' (SEQ ID No. 14). PCR conditions were: 2 min 50 C, 10 min 95 C and 40 cycles of 15 sec 95 C, 85 s 60 C. The PCR reactions were performed in separate tubes; and absolute quantitation of the MECP2E2 and E1 transcripts was performed from cDNA from human adult brain, cerebellum, fibroblast and lymphoblast (Clontech, Palo Alto, USA), as well as from murine neuronal and glial cell cultures (see above). Results were analyzed using the standard curve method according to the manufacturer's instructions (PE Applied Biosystems, ABI PRISM 7900 Sequence Detection System). The standard curve was developed using dilutions of the transcript-specific purified PCR products.

[0148] Immunofluorescence light microscopy. 3'-myc-tagged MECP2E2 and MECP2E1 constructs (pCDNA3.1A-MECP2E2-myc and pcDNA3.1A-MECP2E1-myc) were generated by PCR amplification of full-length cDNA of each transcript with BamHI (5') and XbaI (3') restriction sites attached and subsequent cloning in-frame with myc into pcDNA3.1 version A (Invitrogen). The forward primer for MECP2E2 contained the start codon in exon 2 (5'-tatggatccATGgtagctgggat-3') (SEQ ID No. 15), while the forward primer for MECP2E1 included the start codon in exon1 (5'-tatggatccggaaaATGgccg-3') (SEQ ID No. 16) (BamHI restriction site underlined, start codon uppercase). The reverse primer was the same for both amplifications (5'-gcgtctagagctaactctct-3') (SEQ ID No. 17) (XbaI restriction site underlined). The template used for PCR was small intestine cDNA for MECP2E2 and skeletal muscle cDNA for MECP2E1. pcDNA3.1A-MECP2E2-myc and pcDNA3.1A-MECP2E1-myc (2 ug) were transfected into COS-7 cells using lipofectamine (Invitrogen) and the lipid-DNA complex was exposed in DMEM (GIBCO) for 5 hours. Forty-eight hours post-transfection the cultures were rinsed in PBS and fixed for 15 min at -20.degree. C. in an acetone:methanol (1:1) mix, blocked for 1 hour (10% BSA in PBS) and incubated with anti-myc (Santa Cruz Biotechnology, 1:50 in blocking buffer) for 45 min at room temperature. After washing with PBS, slides were incubated with secondary antibody (FITC-labeled goat anti-mouse (Jackson Immunoresearch labs), 1:400, detectable through the green filter) in blocking solution, mounted with Dako Anti-Fade and analyzed by immunofluorescence light microscopy.

[0149] MLPA analysis. MLPA was performed as described by Schouten et al., supra and as described by Schouten, supra. MECP2 test kits from MRC-Holland, Amsterdam, Netherlands were utilized and consisted of 20 probe pairs that target the four MECP2 exons, six X-linked control regions and ten autosomal control regions. Briefly, 100-200 ng of genomic DNA was denatured and hybridized with the probe mix overnight at 60.degree. C. The following morning the paired probes were ligated using heat stable Ligase-65 at 54.degree. C. for 15 minutes. The ligation was followed with PCR with a common primer pair that hybridizes to the terminal end of each ligation product. One PCR primer was FAM-labeled and conditions for the PCR were as follows: 95.degree. C. 30 s, 60.degree. C. 30 s and 72.degree. 1 min. The resulting amplicons were analyzed on an ABI 3100 capillary electrophoresis instrument and ABI Genescan software. All data management and comparisons to normal controls were done with Excel software.

Discussion

[0150] Recently, studies in frog (Xenopus laevis) afforded important insight into the role of MeCP2 in neurodevelopmental transcription regulation. MeCP2 was shown to be a component of the SMRT complex involved in the regulation of genes involved in neuronal differentiation following developmental stage-specific mediation by Notch-Delta.sup.9. The frog Mecp2 transcript targeted for silencing in these experiments is an orthologue of MECP2E1 (FIG. 1F). In fact, MeCP2E1 appears to be the only form of MeCP2 in non-mammalian vertebrates (FIG. 1F).

[0151] The new MeCP2 N-terminus is a distinctive 21 amino acid peptide including polyalanine and polyglycine tracts (MAAAAAAAPSGGGGGGEEERL) (SEQ ID No. 18) (FIG. 1F). A similar N-terminus occurs in the ERK1 (MAPK3) extracellular signal-regulated kinase (FIG. 1F), a key common component of multiple signal transduction pathways. Intriguingly, in neurons, both ERK1 and MeCP2 have been shown to be present in the post-synaptic compartment, in addition to the nucleus, and the former shown to translocate between the two compartments to link synaptic activity to transcriptional regulation. It is possible that MeCP2E1 similarly links synaptic function, in this case neurodevelopmental synaptic contact guidance, with transcriptional regulation. The only other proteins in which consecutive polyalanine and polyglycine tracts are found are in some members of the homeobox (HOX) family. These, like MeCP2, are developmental transcription regulators.

[0152] Finally, non-inactivating MECP2 mutations have been associated with phenotypes that overlap RTT such as mental retardation and autism. The MeCP2 variant discovered in this study is a candidate for involvement in these disorders.

Example 4

Mutations in MECP2E1 in Mental Retardation

[0153] The inventors screened the MECP2E1 gene in N=401 autism probands, and in N=493 patients with non-specific mental retardation. Autism probands recruited through the Hospital for Sick Children in Toronto (N=146; 114 male, 32 female) and from London, UK (N=13; 10 male, 3 female) were also screened, as well as probands from multiplex families from the Autism Genetic Resource Exchange (AGRE; N=242; 100 female, 142 male). Local institutional ethics board approval was obtained, and written consent given by participants. Anonymized DNA samples were also obtained for 293 female and 200 male patients with non-specific developmental delay/mental retardation who had been referred for fragile-X testing (but tested negative) to the Department of Pediatric Laboratory Medicine at the Hospital for Sick Children. Polymerase chain reaction followed by denaturing high performance liquid chromatography (DHPLC) was used for mutation detection, with PCR primers and conditions as described previously in Example 3. PCR product from female individuals suspected of carrying a sequence variant was cloned into the pDRIVE vector (Qiagen), and at least four clones sequenced using automated BIGDYE.TM. sequencing (ABI 3100) in forward and reverse directions. PCR products from males were excised from agarose gel, column purified, then sequenced, also using automated BIGDYE.TM. sequencing (ABI 3100) in both forward and reverse directions. No mutations were identified among the autism screening set, however sequence variants were identified among eight of the female MR cases (see FIG. 5), three of which result in insertion or deletion of amino acids within the polyalanine repeat stretch, and two of which result in insertion of a glycine residue within the polyglycine repeat at the N-terminal portion of MECP2E1. The first individual identified was heterozygous for a deletion of a GpC dinucleotide positioned 45-46 bp upstream of the putative MECP2E1 start codon. This deletion could disrupt a potential SP1 transcription factor binding site (as predicted using AliBaba2.1 on the BIOBASE website), and may also eliminate potentially methylatable cytosine residues. Another individual is heterozygous for an ApG dinucleotide deletion 26 bp upstream of the MECP2E1 start codon. Two individuals are heterozygous for a GGA trinucleotide insertion within a poly[GGA] stretch, which would result in an additional glycine residue within the predicted polyglycine stretch. A fifth individual is heterozygous for a GCC trinucleotide deletion within a triplet repeat stretch encoding polyalanine. Two individuals are heterozygous for a 9 bp insertion, also within the GCC trinucleotide repeat/polyalanine region, and would result in the polyalanine stretch being extended from seven to ten residues.

[0154] The amino acid sequence variation in .about.2% of female non-specific MR cases in a new isoform of a protein that has previously been associated with a mental retardation syndrome, is extremely intriguing. Moreover, the fact that the variation occurs within a part of the protein that is conserved across many vertebrate species also adds to the interest (100% identity to chimpanzee, orangutan, macaque, cat and dog MeCP2E1 amino acid sequence). It would be particularly useful to know whether there are any specific phenotypic features among the individuals with the variants, how severe the symptoms are an whether there are overlaps with or distinctions from the Rett syndrome phenotypes. However, since the DNAs were anonymized, it is not possible, in this instance, to correlate the mutations discovered with phenotypic features or severity. In an attempt to address this issue, a second sample set of MR cases (188 female and 96 male) from the Greenwood Genetic Center, South Carolina, were screened, followed by sequencing. No variants were found in the males, and two of the females carried the GGA insertion encoding an extra glycine residue.

[0155] In the present study, three female MR patients were identified with a 3 bp insertion leading to an extra glycine residue within the polyglycine stretch at the N-terminal end of MeCP2E1. No disease association has previously been reported with expansion within a glycine repeat. The function of polyglycine stretches, either within the context of the MeCP2E1 protein or more generally, is not known, although a study of the Toc75 protein in plants suggests that a polyglycine stretch in the protein is essential for correct targeting of the protein to the chloroplast outer envelope. A similar function of protein trafficking may also be the case for mammalian proteins with polyglycine stretches, and for MeCP2E1.

[0156] The variants within the polyalanine tracts are of particular interest, as they are rarely polymorphic, and because a number of small expansions (or duplications) within such tracts have been reported to cause diseases, ranging from cleidocranial dysplasia (RUNX2), oculopharyngeal muscular dystrophy (PABPN1) and mental retardation (ARXY this gene is also X-chromosomal and has a very broad array of phenotypes--see above). The majority of polyalanine disease genes encode transcription factors, although PABPN1 gene encodes a polyadenylate binding protein. On the one hand, amongst these diseases, the smallest pathogenic repeats within the transcription factor genes are generally greater than 20 alanines in length, thus it could be considered improbable that a stretch of alanines as short as that encoded by MECP2E1 could be pathogenic, and a change of 1 or 3 alanine residues could be considered likely to be rare polymorphisms. There is currently some uncertainty as to whether small expansion of 1 or 3 alanine residues within the ARX gene may be pathogenic or innocent variants. On the other hand, oculopharyngeal muscular dystrophy is caused by mutations within a GCG tract in the PABPN1 gene, that expand a polyalanine tract from just 10 alanine residues to between 12 and 17 alanine residues. Moreover, as with the polyalanine tract in MeCP2E1, the polyalanine tract in PABPN1 is right at the N-terminal end of the gene, and thus it is possible that smaller mutations within repeat stretches within the N-terminal portion of a protein may be more detrimental than larger mutations located in the central portions of proteins.

[0157] A recently published study screened for mutations in MECP2 exon 1 among 97 Rett patients with no mutation in exons 2, 3 or 4, and among 146 controls. One of the Rett patients was found to have a 6 bp insertion within the polyalanine-encoding [GCC]stretch, but no such variations were observed among the controls. The variant was inherited from an unaffected mother, and it was concluded that the variant is thus unlikely to be etiologically relevant. However, it has also been demonstrated recently that even subtle changes in expression of Mecp2 in mice can have profound neurological and behavioural consequences. It is apparent that patients with the same MECP2 mutation may have very different phenotypic features and severity, and it is likely that variation in X-inactivation pattern plays a role in this discordancy. Thus it is quite feasible that variation in exon 1, either within the repeat stretches resulting in change in length of polyalanine or polyglycine stretch, or in the region just upstream of the start codon, may affect function or expression levels resulting in a neuropathological phenotype.

Example 5

Additional Mutations in MECP2E1 in Rett's Syndrome

[0158] The entire coding regions of exons 1, 2, 3 and 4 and their intronic flanking sequences were analyzed. Exons 2 to 4 were amplified by PCR with primer pairs designed with the use of genomic sequence information from the Human Genome Project working draft site (UCSC, Genome Bioinformatics website) and the Lasergene Primer select program. The PCR products were loaded on 2% agarose gel to confirm amplification before analysis for base changes by dHPLC (WAVE Nucleic Acid Fragment Analysis System from Transgenomic, San Jose, Calif.). Solvent A consisted of 0.1 mol/L triethylammonim acetate (TEAA) and 25% acetonitrile and solvent B contained 1M TEAA, 25% acetonitril. PCR products showing a chromatographic variation on dHPLC were sequenced directly on an automatic sequencer (Gene Reader 4200). The sequencing data was analyzed using DNA Star software SeqMan (Lasergene). Exon 1 was PCR amplified and sequenced in all patients as recently described.

TABLE-US-00001 TABLE 1 MECP2E1 mutations or variants identified to date. "del" indicates a deletion; "ins" indicates an insertion Position relative to Number of Nucleotide NM_004992 Associated Patients with change (SEQ ID No. 1) Amino acid change Effect of change phenotype mutation 11 bp deletion Between 38 to 54 Frameshift leads to MECP2E1 Rett 1 nonsense mutation, disrupted, premature truncation of MECP2E2 not protein after amino acid 36 disrupted Exon 1 deletion 1-69 No MECP2E1 translation MECP2E1 and Rett 1 MECP2E2 disrupted 1A->T 8 1Met->Leu MECP2E1 Rett 1 disrupted, MECP2E2 possibly diminished del[TG] 69 to 70 Destroys exon1/intron 1 MECP2E1 Rett 1 splice site, resulting in read disrupted, through and nonsense MECP2E2 translation, with truncation probably not after amino acid 97 disrupted ins[GCCGCCGCC] Between nt 11 ins[Ala]3 within N terminal May affect Developmental 2 and 29 polyalanine stretch of function and or Delay MECP2E1 translation of MECP2E1, but not MECP2E2 del[GCC] Between nt 11 del Ala within N terminal May affect Developmental 1 and 29 polyalanine stretch of function and or Delay MECP2E1 translation of MECP2E1, but not MECP2E2 ins[GGA] Between 38 ins Gly May affect Developmental 5 to 54 function and or Delay translation of MECP2E1, but not MECP2E2 -45 del [GC] -38 to -39 In 5'UTR, 45 nt upstream of May affect Developmental 1 relative to START codon- potential SP1 transcription or Delay BX538060 transcription factor binding translation of site MECP2E1 -26 del [AG] -19 to -20 In 5'UTR, 26 nt upstream of May affect Developmental 1 relative to START codon transcription or Delay BX538060 translation of MECP2E1

Sequence CWU 1

1

29110182DNAHomo sapiens 1ccggaaaatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 60ggagagactg ctccataaaa atacagactc accagttcct gctttgatgt gacatgtgac 120tccccagaat acaccttgct tctgtagacc agctccaaca ggattccatg gtagctggga 180tgttagggct cagggaagaa aagtcagaag accaggacct ccagggcctc aaggacaaac 240ccctcaagtt taaaaaggtg aagaaagata agaaagaaga gaaagagggc aagcatgagc 300ccgtgcagcc atcagcccac cactctgctg agcccgcaga ggcaggcaaa gcagagacat 360cagaagggtc aggctccgcc ccggctgtgc cggaagcttc tgcctccccc aaacagcggc 420gctccatcat ccgtgaccgg ggacccatgt atgatgaccc caccctgcct gaaggctgga 480cacggaagct taagcaaagg aaatctggcc gctctgctgg gaagtatgat gtgtatttga 540tcaatcccca gggaaaagcc tttcgctcta aagtggagtt gattgcgtac ttcgaaaagg 600taggcgacac atccctggac cctaatgatt ttgacttcac ggtaactggg agagggagcc 660cctcccggcg agagcagaaa ccacctaaga agcccaaatc tcccaaagct ccaggaactg 720gcagaggccg gggacgcccc aaagggagcg gcaccacgag acccaaggcg gccacgtcag 780agggtgtgca ggtgaaaagg gtcctggaga aaagtcctgg gaagctcctt gtcaagatgc 840cttttcaaac ttcgccaggg ggcaaggctg aggggggtgg ggccaccaca tccacccagg 900tcatggtgat caaacgcccc ggcaggaagc gaaaagctga ggccgaccct caggccattc 960ccaagaaacg gggccgaaag ccggggagtg tggtggcagc cgctgccgcc gaggccaaaa 1020agaaagccgt gaaggagtct tctatccgat ctgtgcagga gaccgtactc cccatcaaga 1080agcgcaagac ccgggagacg gtcagcatcg aggtcaagga agtggtgaag cccctgctgg 1140tgtccaccct cggtgagaag agcgggaaag gactgaagac ctgtaagagc cctgggcgga 1200aaagcaagga gagcagcccc aaggggcgca gcagcagcgc ctcctcaccc cccaagaagg 1260agcaccacca ccatcaccac cactcagagt ccccaaaggc ccccgtgcca ctgctcccac 1320ccctgccccc acctccacct gagcccgaga gctccgagga ccccaccagc ccccctgagc 1380cccaggactt gagcagcagc gtctgcaaag aggagaagat gcccagagga ggctcactgg 1440agagcgacgg ctgccccaag gagccagcta agactcagcc cgcggttgcc accgccgcca 1500cggccgcaga aaagtacaaa caccgagggg agggagagcg caaagacatt gtttcatcct 1560ccatgccaag gccaaacaga gaggagcctg tggacagccg gacgcccgtg accgagagag 1620ttagctgact ttacacggag cggattgcaa agcaaaccaa caagaataaa ggcagctgtt 1680gtctcttctc cttatgggta gggctctgac aaagcttccc gattaactga aataaaaaat 1740attttttttt ctttcagtaa acttagagtt tcgtggcttc agggtgggag tagttggagc 1800attggggatg tttttcttac cgacaagcac agtcaggttg aagacctaac cagggccaga 1860agtagctttg cacttttcta aactaggctc cttcaacaag gcttgctgca gatactactg 1920accagacaag ctgttgacca ggcacctccc ctcccgccca aacctttccc ccatgtggtc 1980gttagagaca gagcgacaga gcagttgaga ggacactccc gttttcggtg ccatcagtgc 2040cccgtctaca gctcccccag ctccccccac ctcccccact cccaaccacg ttgggacagg 2100gaggtgtgag gcaggagaga cagttggatt ctttagagaa gatggatatg accagtggct 2160atggcctgtg cgatcccacc cgtggtggct caagtctggc cccacaccag ccccaatcca 2220aaactggcaa ggacgcttca caggacagga aagtggcacc tgtctgctcc agctctggca 2280tggctaggag gggggagtcc cttgaactac tgggtgtaga ctggcctgaa ccacaggaga 2340ggatggccca gggtgaggtg gcatggtcca ttctcaaggg acgtcctcca acgggtggcg 2400ctagaggcca tggaggcagt aggacaaggt gcaggcaggc tggcctgggg tcaggccggg 2460cagagcacag cggggtgaga gggattccta atcactcaga gcagtctgtg acttagtgga 2520caggggaggg ggcaaagggg gaggagaaga aaatgttctt ccagttactt tccaattctc 2580ctttagggac agcttagaat tatttgcact attgagtctt catgttccca cttcaaaaca 2640aacagatgct ctgagagcaa actggcttga attggtgaca tttagtccct caagccacca 2700gatgtgacag tgttgagaac tacctggatt tgtatatata cctgcgcttg ttttaaagtg 2760ggctcagcac atagggttcc cacgaagctc cgaaactcta agtgtttgct gcaattttat 2820aaggacttcc tgattggttt ctcttctccc cttccatttc tgccttttgt tcatttcatc 2880ctttcacttc tttcccttcc tccgtcctcc tccttcctag ttcatccctt ctcttccagg 2940cagccgcggt gcccaaccac acttgtcggc tccagtcccc agaactctgc ctgccctttg 3000tcctcctgct gccagtacca gccccaccct gttttgagcc ctgaggaggc cttgggctct 3060gctgagtccg acctggcctg tctgtgaaga gcaagagagc agcaaggtct tgctctccta 3120ggtagccccc tcttccctgg taagaaaaag caaaaggcat ttcccaccct gaacaacgag 3180ccttttcacc cttctactct agagaagtgg actggaggag ctgggcccga tttggtagtt 3240gaggaaagca cagaggcctc ctgtggcctg ccagtcatcg agtggcccaa caggggctcc 3300atgccagccg accttgacct cactcagaag tccagagtct agcgtagtgc agcagggcag 3360tagcggtacc aatgcagaac tcccaagacc cgagctggga ccagtacctg ggtccccagc 3420ccttcctctg ctcccccttt tccctcggag ttcttcttga atggcaatgt tttgcttttg 3480ctcgatgcag acagggggcc agaacaccac acatttcact gtctgtctgg tccatagctg 3540tggtgtaggg gcttagaggc atgggcttgc tgtgggtttt taattgatca gttttcatgt 3600gggatcccat ctttttaacc tctgttcagg aagtccttat ctagctgcat atcttcatca 3660tattggtata tccttttctg tgtttacaga gatgtctctt atatctaaat ctgtccaact 3720gagaagtacc ttatcaaagt agcaaatgag acagcagtct tatgcttcca gaaacaccca 3780caggcatgtc ccatgtgagc tgctgccatg aactgtcaag tgtgtgttgt cttgtgtatt 3840tcagttattg tccctggctt ccttactatg gtgtaatcat gaaggagtga aacatcatag 3900aaactgtcta gcacttcctt gccagtcttt agtgatcagg aaccatagtt gacagttcca 3960atcagtagct taagaaaaaa ccgtgtttgt ctcttctgga atggttagaa gtgagggagt 4020ttgccccgtt ctgtttgtag agtctcatag ttggactttc tagcatatat gtgtccattt 4080ccttatgctg taaaagcaag tcctgcaacc aaactcccat cagcccaatc cctgatccct 4140gatcccttcc acctgctctg ctgatgaccc ccccagcttc acttctgact cttccccagg 4200aagggaaggg gggtcagaag agagggtgag tcctccagaa ctcttcctcc aaggacagaa 4260ggctcctgcc cccatagtgg cctcgaactc ctggcactac caaaggacac ttatccacga 4320gagcgcagca tccgaccagg ttgtcactga gaagatgttt attttggtca gttgggtttt 4380tatgtattat acttagtcaa atgtaatgtg gcttctggaa tcattgtcca gagctgcttc 4440cccgtcacct gggcgtcatc tggtcctggt aagaggagtg cgtggcccac caggcccccc 4500tgtcacccat gacagttcat tcagggccga tggggcagtc gtggttggga acacagcatt 4560tcaagcgtca ctttatttca ttcgggcccc acctgcagct ccctcaaaga ggcagttgcc 4620cagcctcttt cccttccagt ttattccaga gctgccagtg gggcctgagg ctccttaggg 4680ttttctctct atttccccct ttcttcctca ttccctcgtc tttcccaaag gcatcacgag 4740tcagtcgcct ttcagcaggc agccttggcg gtttatcgcc ctggcaggca ggggccctgc 4800agctctcatg ctgcccctgc cttggggtca ggttgacagg aggttggagg gaaagcctta 4860agctgcagga ttctcaccag ctgtgtccgg cccagttttg gggtgtgacc tcaatttcaa 4920ttttgtctgt acttgaacat tatgaagatg ggggcctctt tcagtgaatt tgtgaacagc 4980agaattgacc gacagctttc cagtacccat ggggctaggt cattaaggcc acatccacag 5040tctcccccac ccttgttcca gttgttagtt actacctcct ctcctgacaa tactgtatgt 5100cgtcgagctc cccccaggtc tacccctccc ggccctgcct gctggtgggc ttgtcatagc 5160cagtgggatt gccggtcttg acagctcagt gagctggaga tacttggtca cagccaggcg 5220ctagcacagc tcccttctgt tgatgctgta ttcccatatc aaaagacaca ggggacaccc 5280agaaacgcca catcccccaa tccatcagtg ccaaactagc caacggcccc agcttctcag 5340ctcgctggat ggcggaagct gctactcgtg agcgccagtg cgggtgcaga caatcttctg 5400ttgggtggca tcattccagg cccgaagcat gaacagtgca cctgggacag ggagcagccc 5460caaattgtca cctgcttctc tgcccagctt ttcattgctg tgacagtgat ggcgaaagag 5520ggtaataacc agacacaaac tgccaagttg ggtggagaaa ggagtttctt tagctgacag 5580aatctctgaa ttttaaatca cttagtaagc ggctcaagcc caggagggag cagagggata 5640cgagcggagt cccctgcgcg ggaccatctg gaattggttt agcccaagtg gagcctgaca 5700gccagaactc tgtgtccccc gtctaaccac agctcctttt ccagagcatt ccagtcaggc 5760tctctgggct gactgggcca ggggaggtta caggtaccag ttctttaaga agatctttgg 5820gcatatacat ttttagcctg tgtcattgcc ccaaatggat tcctgtttca agttcacacc 5880tgcagattct aggacctgtg tcctagactt cagggagtca gctgtttcta gagttcctac 5940catggagtgg gtctggagga cctgcccggt gggggggcag agccctgctc cctccgggtc 6000ttcctactct tctctctgct ctgacgggat ttgttgattc tctccatttt ggtgtctttc 6060tcttttagat attgtatcaa tctttagaaa aggcatagtc tacttgttat aaatcgttag 6120gatactgcct cccccagggt ctaaaattac atattagagg ggaaaagctg aacactgaag 6180tcagttctca acaatttaga aggaaaacct agaaaacatt tggcagaaaa ttacatttcg 6240atgtttttga atgaatacga gcaagctttt acaacagtgc tgatctaaaa atacttagca 6300cttggcctga gatgcctggt gagcattaca ggcaagggga atctggaggt agccgacctg 6360aggacatggc ttctgaacct gtcttttggg agtggtatgg aaggtggagc gttcaccagt 6420gacctggaag gcccagcacc accctccttc ccactcttct catcttgaca gagcctgccc 6480cagcgctgac gtgtcaggaa aacacccagg gaactaggaa ggcacttctg cctgaggggc 6540agcctgcctt gcccactcct gctctgctcg cctcggatca gctgagcctt ctgagctggc 6600ctctcactgc ctccccaagg ccccctgcct gccctgtcag gaggcagaag gaagcaggtg 6660tgagggcagt gcaaggaggg agcacaaccc ccagctcccg ctccgggctc cgacttgtgc 6720acaggcagag cccagaccct ggaggaaatc ctacctttga attcaagaac atttggggaa 6780tttggaaatc tctttgcccc caaaccccca ttctgtccta cctttaatca ggtcctgctc 6840agcagtgaga gcagatgagg tgaaaaggcc aagaggtttg gctcctgccc actgatagcc 6900cctctccccg cagtgtttgt gtgtcaagtg gcaaagctgt tcttcctggt gaccctgatt 6960atatccagta acacatagac tgtgcgcata ggcctgcttt gtctcctcta tcctgggctt 7020ttgttttgct ttttagtttt gcttttagtt tttctgtccc ttttatttaa cgcaccgact 7080agacacacaa agcagttgaa tttttatata tatatctgta tattgcacaa ttataaactc 7140attttgcttg tggctccaca cacacaaaaa aagacctgtt aaaattatac ctgttgctta 7200attacaatat ttctgataac catagcatag gacaagggaa aataaaaaaa gaaaaaaaag 7260aaaaaaaaac gacaaatctg tctgctggtc acttcttctg tccaagcaga ttcgtggtct 7320tttcctcgct tctttcaagg gctttcctgt gccaggtgaa ggaggctcca ggcagcaccc 7380aggttttgca ctcttgtttc tcccgtgctt gtgaaagagg tcccaaggtt ctgggtgcag 7440gagcgctccc ttgacctgct gaagtccgga acgtagtcgg cacagcctgg tcgccttcca 7500cctctgggag ctggagtcca ctggggtggc ctgactcccc cagtcccctt cccgtgacct 7560ggtcagggtg agcccatgtg gagtcagcct cgcaggcctc cctgccagta gggtccgagt 7620gtgtttcatc cttcccactc tgtcgagcct gggggctgga gcggagacgg gaggcctggc 7680ctgtctcgga acctgtgagc tgcaccaggt agaacgccag ggaccccaga atcatgtgcg 7740tcagtccaag gggtcccctc caggagtagt gaagactcca gaaatgtccc tttcttctcc 7800cccatcctac gagtaattgc atttgctttt gtaattctta atgagcaata tctgctagag 7860agtttagctg taacagttct ttttgatcat ctttttttaa taattagaaa caccaaaaaa 7920atccagaaac ttgttcttcc aaagcagaga gcattataat caccagggcc aaaagcttcc 7980ctccctgctg tcattgcttc ttctgaggcc tgaatccaaa agaaaaacag ccataggccc 8040tttcagtggc cgggctaccc gtgagccctt cggaggacca gggctggggc agcctctggg 8100cccacatccg gggccagctc cggcgtgtgt tcagtgttag cagtgggtca tgatgctctt 8160tcccacccag cctgggatag gggcagagga ggcgaggagg ccgttgccgc tgatgtttgg 8220ccgtgaacag gtgggtgtct gcgtgcgtcc acgtgcgtgt tttctgactg acatgaaatc 8280gacgcccgag ttagcctcac ccggtgacct ctagccctgc ccggatggag cggggcccac 8340ccggttcagt gtttctgggg agctggacag tggagtgcaa aaggcttgca gaacttgaag 8400cctgctcctt cccttgctac cacggcctcc tttccgtttg atttgtcact gcttcaatca 8460ataacagccg ctccagagtc agtagtcaat gaatatatga ccaaatatca ccaggactgt 8520tactcaatgt gtgccgagcc cttgcccatg ctgggctccc gtgtatctgg acactgtaac 8580gtgtgctgtg tttgctcccc ttccccttcc ttctttgccc tttacttgtc tttctggggt 8640ttttctgttt gggtttggtt tggtttttat ttctcctttt gtgttccaaa catgaggttc 8700tctctactgg tcctcttaac tgtggtgttg aggcttatat ttgtgtaatt tttggtgggt 8760gaaaggaatt ttgctaagta aatctcttct gtgtttgaac tgaagtctgt attgtaacta 8820tgtttaaagt aattgttcca gagacaaata tttctagaca ctttttcttt acaaacaaaa 8880gcattcggag ggagggggat ggtgactgag atgagagggg agagctgaac agatgacccc 8940tgcccagatc agccagaagc cacccaaagc agtggagccc aggagtccca ctccaagcca 9000gcaagccgaa tagctgatgt gttgccactt tccaagtcac tgcaaaacca ggttttgttc 9060cgcccagtgg attcttgttt tgcttcccct ccccccgaga ttattaccac catcccgtgc 9120ttttaaggaa aggcaagatt gatgtttcct tgaggggagc caggagggga tgtgtgtgtg 9180cagagctgaa gagctgggga gaatggggct gggcccaccc aagcaggagg ctgggacgct 9240ctgctgtggg cacaggtcag gctaatgttg gcagatgcag ctcttcctgg acaggccagg 9300tggtgggcat tctctctcca aggtgtgccc cgtgggcatt actgtttaag acacttccgt 9360cacatcccac cccatcctcc agggctcaac actgtgacat ctctattccc caccctcccc 9420ttcccagggc aataaaatga ccatggaggg ggcttgcact ctcttggctg tcacccgatc 9480gccagcaaaa cttagatgtg agaaaacccc ttcccattcc atggcgaaaa catctcctta 9540gaaaagccat taccctcatt aggcatggtt ttgggctccc aaaacacctg acagcccctc 9600cctcctctga gaggcggaga gtgctgactg tagtgaccat tgcatgccgg gtgcagcatc 9660tggaagagct aggcagggtg tctgccccct cctgagttga agtcatgctc ccctgtgcca 9720gcccagaggc cgagagctat ggacagcatt gccagtaaca caggccaccc tgtgcagaag 9780ggagctggct ccagcctgga aacctgtctg aggttgggag aggtgcactt ggggcacagg 9840gagaggccgg gacacactta gctggagatg tctctaaaag ccctgtatcg tattcacctt 9900cagtttttgt gttttgggac aattacttta gaaaataagt aggtcgtttt aaaaacaaaa 9960attattgatt gcttttttgt agtgttcaga aaaaaggttc tttgtgtata gccaaatgac 10020tgaaagcact gatatattta aaaacaaaag gcaatttatt aaggaaattt gtaccatttc 10080agtaaacctg tctgaatgta cctgtatacg tttcaaaaac accccccccc cactgaatcc 10140ctgtaaccta tttattatat aaagagtttg ccttataaat tt 101822486PRTHomo sapiens 2Met Val Ala Gly Met Leu Gly Leu Arg Glu Glu Lys Ser Glu Asp Gln1 5 10 15Asp Leu Gln Gly Leu Lys Asp Lys Pro Leu Lys Phe Lys Lys Val Lys 20 25 30Lys Asp Lys Lys Glu Glu Lys Glu Gly Lys His Glu Pro Val Gln Pro 35 40 45Ser Ala His His Ser Ala Glu Pro Ala Glu Ala Gly Lys Ala Glu Thr 50 55 60Ser Glu Gly Ser Gly Ser Ala Pro Ala Val Pro Glu Ala Ser Ala Ser65 70 75 80Pro Lys Gln Arg Arg Ser Ile Ile Arg Asp Arg Gly Pro Met Tyr Asp 85 90 95Asp Pro Thr Leu Pro Glu Gly Trp Thr Arg Lys Leu Lys Gln Arg Lys 100 105 110Ser Gly Arg Ser Ala Gly Lys Tyr Asp Val Tyr Leu Ile Asn Pro Gln 115 120 125Gly Lys Ala Phe Arg Ser Lys Val Glu Leu Ile Ala Tyr Phe Glu Lys 130 135 140Val Gly Asp Thr Ser Leu Asp Pro Asn Asp Phe Asp Phe Thr Val Thr145 150 155 160Gly Arg Gly Ser Pro Ser Arg Arg Glu Gln Lys Pro Pro Lys Lys Pro 165 170 175Lys Ser Pro Lys Ala Pro Gly Thr Gly Arg Gly Arg Gly Arg Pro Lys 180 185 190Gly Ser Gly Thr Thr Arg Pro Lys Ala Ala Thr Ser Glu Gly Val Gln 195 200 205Val Lys Arg Val Leu Glu Lys Ser Pro Gly Lys Leu Leu Val Lys Met 210 215 220Pro Phe Gln Thr Ser Pro Gly Gly Lys Ala Glu Gly Gly Gly Ala Thr225 230 235 240Thr Ser Thr Gln Val Met Val Ile Lys Arg Pro Gly Arg Lys Arg Lys 245 250 255Ala Glu Ala Asp Pro Gln Ala Ile Pro Lys Lys Arg Gly Arg Lys Pro 260 265 270Gly Ser Val Val Ala Ala Ala Ala Ala Glu Ala Lys Lys Lys Ala Val 275 280 285Lys Glu Ser Ser Ile Arg Ser Val Gln Glu Thr Val Leu Pro Ile Lys 290 295 300Lys Arg Lys Thr Arg Glu Thr Val Ser Ile Glu Val Lys Glu Val Val305 310 315 320Lys Pro Leu Leu Val Ser Thr Leu Gly Glu Lys Ser Gly Lys Gly Leu 325 330 335Lys Thr Cys Lys Ser Pro Gly Arg Lys Ser Lys Glu Ser Ser Pro Lys 340 345 350Gly Arg Ser Ser Ser Ala Ser Ser Pro Pro Lys Lys Glu His His His 355 360 365His His His His Ser Glu Ser Pro Lys Ala Pro Val Pro Leu Leu Pro 370 375 380Pro Leu Pro Pro Pro Pro Pro Glu Pro Glu Ser Ser Glu Asp Pro Thr385 390 395 400Ser Pro Pro Glu Pro Gln Asp Leu Ser Ser Ser Val Cys Lys Glu Glu 405 410 415Lys Met Pro Arg Gly Gly Ser Leu Glu Ser Asp Gly Cys Pro Lys Glu 420 425 430Pro Ala Lys Thr Gln Pro Ala Val Ala Thr Ala Ala Thr Ala Ala Glu 435 440 445Lys Tyr Lys His Arg Gly Glu Gly Glu Arg Lys Asp Ile Val Ser Ser 450 455 460Ser Met Pro Arg Pro Asn Arg Glu Glu Pro Val Asp Ser Arg Thr Pro465 470 475 480Val Thr Glu Arg Val Ser 48531504DNAHomo sapiens 3ccggaaaatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 60ggagagactg gaagaaaagt cagaagacca ggacctccag ggcctcaagg acaaacccct 120caagtttaaa aaggtgaaga aagataagaa agaagagaaa gagggcaagc atgagcccgt 180gcagccatca gcccaccact ctgctgagcc cgcagaggca ggcaaagcag agacatcaga 240agggtcaggc tccgccccgg ctgtgccgga agcttctgcc tcccccaaac agcggcgctc 300catcatccgt gaccggggac ccatgtatga tgaccccacc ctgcctgaag gctggacacg 360gaagcttaag caaaggaaat ctggccgctc tgctgggaag tatgatgtgt atttgatcaa 420tccccaggga aaagcctttc gctctaaagt ggagttgatt gcgtacttcg aaaaggtagg 480cgacacatcc ctggacccta atgattttga cttcacggta actgggagag ggagcccctc 540ccggcgagag cagaaaccac ctaagaagcc caaatctccc aaagctccag gaactggcag 600aggccgggga cgccccaaag ggagcggcac cacgagaccc aaggcggcca cgtcagaggg 660tgtgcaggtg aaaagggtcc tggagaaaag tcctgggaag ctccttgtca agatgccttt 720tcaaacttcg ccagggggca aggctgaggg gggtggggcc accacatcca cccaggtcat 780ggtgatcaaa cgccccggca ggaagcgaaa agctgaggcc gaccctcagg ccattcccaa 840gaaacggggc cgaaagccgg ggagtgtggt ggcagccgct gccgccgagg ccaaaaagaa 900agccgtgaag gagtcttcta tccgatctgt gcaggagacc gtactcccca tcaagaagcg 960caagacccgg gagacggtca gcatcgaggt caaggaagtg gtgaagcccc tgctggtgtc 1020caccctcggt gagaagagcg ggaaaggact gaagacctgt aagagccctg ggcggaaaag 1080caaggagagc agccccaagg ggcgcagcag cagcgcctcc tcacccccca agaaggagca 1140ccaccaccat caccaccact cagagtcccc aaaggccccc gtgccactgc tcccacccct 1200gcccccacct ccacctgagc ccgagagctc cgaggacccc accagccccc ctgagcccca 1260ggacttgagc agcagcgtct gcaaagagga gaagatgccc agaggaggct cactggagag 1320cgacggctgc cccaaggagc cagctaagac tcagcccgcg gttgccaccg ccgccacggc 1380cgcagaaaag tacaaacacc gaggggaggg agagcgcaaa gacattgttt catcctccat 1440gccaaggcca aacagagagg agcctgtgga cagccggacg cccgtgaccg agagagttag 1500ctga 15044498PRTHomo sapiens 4Met Ala Ala Ala Ala Ala Ala Ala Pro Ser Gly Gly Gly Gly Gly Gly1 5 10 15Glu Glu Glu Arg Leu Glu Glu Lys Ser Glu Asp Gln Asp Leu Gln Gly 20 25 30Leu Lys Asp Lys Pro Leu Lys Phe Lys Lys Val Lys Lys Asp Lys Lys 35

40 45Glu Glu Lys Glu Gly Lys His Glu Pro Val Gln Pro Ser Ala His His 50 55 60Ser Ala Glu Pro Ala Glu Ala Gly Lys Ala Glu Thr Ser Glu Gly Ser65 70 75 80Gly Ser Ala Pro Ala Val Pro Glu Ala Ser Ala Ser Pro Lys Gln Arg 85 90 95Arg Ser Ile Ile Arg Asp Arg Gly Pro Met Tyr Asp Asp Pro Thr Leu 100 105 110Pro Glu Gly Trp Thr Arg Lys Leu Lys Gln Arg Lys Ser Gly Arg Ser 115 120 125Ala Gly Lys Tyr Asp Val Tyr Leu Ile Asn Pro Gln Gly Lys Ala Phe 130 135 140Arg Ser Lys Val Glu Leu Ile Ala Tyr Phe Glu Lys Val Gly Asp Thr145 150 155 160Ser Leu Asp Pro Asn Asp Phe Asp Phe Thr Val Thr Gly Arg Gly Ser 165 170 175Pro Ser Arg Arg Glu Gln Lys Pro Pro Lys Lys Pro Lys Ser Pro Lys 180 185 190Ala Pro Gly Thr Gly Arg Gly Arg Gly Arg Pro Lys Gly Ser Gly Thr 195 200 205Thr Arg Pro Lys Ala Ala Thr Ser Glu Gly Val Gln Val Lys Arg Val 210 215 220Leu Glu Lys Ser Pro Gly Lys Leu Leu Val Lys Met Pro Phe Gln Thr225 230 235 240Ser Pro Gly Gly Lys Ala Glu Gly Gly Gly Ala Thr Thr Ser Thr Gln 245 250 255Val Met Val Ile Lys Arg Pro Gly Arg Lys Arg Lys Ala Glu Ala Asp 260 265 270Pro Gln Ala Ile Pro Lys Lys Arg Gly Arg Lys Pro Gly Ser Val Val 275 280 285Ala Ala Ala Ala Ala Glu Ala Lys Lys Lys Ala Val Lys Glu Ser Ser 290 295 300Ile Arg Ser Val Gln Glu Thr Val Leu Pro Ile Lys Lys Arg Lys Thr305 310 315 320Arg Glu Thr Val Ser Ile Glu Val Lys Glu Val Val Lys Pro Leu Leu 325 330 335Val Ser Thr Leu Gly Glu Lys Ser Gly Lys Gly Leu Lys Thr Cys Lys 340 345 350Ser Pro Gly Arg Lys Ser Lys Glu Ser Ser Pro Lys Gly Arg Ser Ser 355 360 365Ser Ala Ser Ser Pro Pro Lys Lys Glu His His His His His His His 370 375 380Ser Glu Ser Pro Lys Ala Pro Val Pro Leu Leu Pro Pro Leu Pro Pro385 390 395 400Pro Pro Pro Glu Pro Glu Ser Ser Glu Asp Pro Thr Ser Pro Pro Glu 405 410 415Pro Gln Asp Leu Ser Ser Ser Val Cys Lys Glu Glu Lys Met Pro Arg 420 425 430Gly Gly Ser Leu Glu Ser Asp Gly Cys Pro Lys Glu Pro Ala Lys Thr 435 440 445Gln Pro Ala Val Ala Thr Ala Ala Thr Ala Ala Glu Lys Tyr Lys His 450 455 460Arg Gly Glu Gly Glu Arg Lys Asp Ile Val Ser Ser Ser Met Pro Arg465 470 475 480Pro Asn Arg Glu Glu Pro Val Asp Ser Arg Thr Pro Val Thr Glu Arg 485 490 495Val Ser518DNAArtificial SequenceHF primer 5ctcggagaga gggctgtg 18620DNAArtificial SequenceHR1 primer 6cttgaggggt ttgtccttga 20720DNAArtificial SequenceHR2 primer 7cgtttgatca ccatgacctg 20820DNAArtificial SequenceMF primer 8aggaggcgag gaggagagac 20919DNAArtificial SequenceMR primer 9ctggctctgc agaatggtg 191022DNAArtificial SequenceMECP2B-specific primer 10aggagagact ggaagaaaag tc 221120DNAArtificial Sequencereverse primer 11cttgaggggt ttgtccttga 201223DNAArtificial SequenceMECP2A transcript-specific primer 12ctcaccagtt cctgctttga tgt 231322DNAArtificial SequenceMECP2B transcript-specific primer 13aggagagact ggaggaaaag tc 221425DNAArtificial Sequencereverse primer 14cttaaacttc agtggcttgt ctctg 251523DNAArtificial SequenceMECP2A forward primer 15tatggatcca tggtagctgg gat 231621DNAArtificial SequenceMECP2B forward primer 16tatggatccg gaaaatggcc g 211720DNAArtificial Sequencereverse primer 17gcgtctagag ctaactctct 201821PRTArtificial SequenceMeCP2 N-terminus 18Met Ala Ala Ala Ala Ala Ala Ala Pro Ser Gly Gly Gly Gly Gly Gly1 5 10 15Glu Glu Glu Arg Leu 201918DNAArtificial SequenceX1F primer 19ccatcacagc caatgacg 182020DNAArtificial SequenceX1R primer 20agggggaggg tagagaggag 202110171DNAHomo sapiens 21ccggaaaatg gccgccgccg ccgccgccgc gccgagcagg aggcgaggag gagagactgc 60tccataaaaa tacagactca ccagttcctg ctttgatgtg acatgtgact ccccagaata 120caccttgctt ctgtagacca gctccaacag gattccatgg tagctgggat gttagggctc 180agggaagaaa agtcagaaga ccaggacctc cagggcctca aggacaaacc cctcaagttt 240aaaaaggtga agaaagataa gaaagaagag aaagagggca agcatgagcc cgtgcagcca 300tcagcccacc actctgctga gcccgcagag gcaggcaaag cagagacatc agaagggtca 360ggctccgccc cggctgtgcc ggaagcttct gcctccccca aacagcggcg ctccatcatc 420cgtgaccggg gacccatgta tgatgacccc accctgcctg aaggctggac acggaagctt 480aagcaaagga aatctggccg ctctgctggg aagtatgatg tgtatttgat caatccccag 540ggaaaagcct ttcgctctaa agtggagttg attgcgtact tcgaaaaggt aggcgacaca 600tccctggacc ctaatgattt tgacttcacg gtaactggga gagggagccc ctcccggcga 660gagcagaaac cacctaagaa gcccaaatct cccaaagctc caggaactgg cagaggccgg 720ggacgcccca aagggagcgg caccacgaga cccaaggcgg ccacgtcaga gggtgtgcag 780gtgaaaaggg tcctggagaa aagtcctggg aagctccttg tcaagatgcc ttttcaaact 840tcgccagggg gcaaggctga ggggggtggg gccaccacat ccacccaggt catggtgatc 900aaacgccccg gcaggaagcg aaaagctgag gccgaccctc aggccattcc caagaaacgg 960ggccgaaagc cggggagtgt ggtggcagcc gctgccgccg aggccaaaaa gaaagccgtg 1020aaggagtctt ctatccgatc tgtgcaggag accgtactcc ccatcaagaa gcgcaagacc 1080cgggagacgg tcagcatcga ggtcaaggaa gtggtgaagc ccctgctggt gtccaccctc 1140ggtgagaaga gcgggaaagg actgaagacc tgtaagagcc ctgggcggaa aagcaaggag 1200agcagcccca aggggcgcag cagcagcgcc tcctcacccc ccaagaagga gcaccaccac 1260catcaccacc actcagagtc cccaaaggcc cccgtgccac tgctcccacc cctgccccca 1320cctccacctg agcccgagag ctccgaggac cccaccagcc cccctgagcc ccaggacttg 1380agcagcagcg tctgcaaaga ggagaagatg cccagaggag gctcactgga gagcgacggc 1440tgccccaagg agccagctaa gactcagccc gcggttgcca ccgccgccac ggccgcagaa 1500aagtacaaac accgagggga gggagagcgc aaagacattg tttcatcctc catgccaagg 1560ccaaacagag aggagcctgt ggacagccgg acgcccgtga ccgagagagt tagctgactt 1620tacacggagc ggattgcaaa gcaaaccaac aagaataaag gcagctgttg tctcttctcc 1680ttatgggtag ggctctgaca aagcttcccg attaactgaa ataaaaaata tttttttttc 1740tttcagtaaa cttagagttt cgtggcttca gggtgggagt agttggagca ttggggatgt 1800ttttcttacc gacaagcaca gtcaggttga agacctaacc agggccagaa gtagctttgc 1860acttttctaa actaggctcc ttcaacaagg cttgctgcag atactactga ccagacaagc 1920tgttgaccag gcacctcccc tcccgcccaa acctttcccc catgtggtcg ttagagacag 1980agcgacagag cagttgagag gacactcccg ttttcggtgc catcagtgcc ccgtctacag 2040ctcccccagc tccccccacc tcccccactc ccaaccacgt tgggacaggg aggtgtgagg 2100caggagagac agttggattc tttagagaag atggatatga ccagtggcta tggcctgtgc 2160gatcccaccc gtggtggctc aagtctggcc ccacaccagc cccaatccaa aactggcaag 2220gacgcttcac aggacaggaa agtggcacct gtctgctcca gctctggcat ggctaggagg 2280ggggagtccc ttgaactact gggtgtagac tggcctgaac cacaggagag gatggcccag 2340ggtgaggtgg catggtccat tctcaaggga cgtcctccaa cgggtggcgc tagaggccat 2400ggaggcagta ggacaaggtg caggcaggct ggcctggggt caggccgggc agagcacagc 2460ggggtgagag ggattcctaa tcactcagag cagtctgtga cttagtggac aggggagggg 2520gcaaaggggg aggagaagaa aatgttcttc cagttacttt ccaattctcc tttagggaca 2580gcttagaatt atttgcacta ttgagtcttc atgttcccac ttcaaaacaa acagatgctc 2640tgagagcaaa ctggcttgaa ttggtgacat ttagtccctc aagccaccag atgtgacagt 2700gttgagaact acctggattt gtatatatac ctgcgcttgt tttaaagtgg gctcagcaca 2760tagggttccc acgaagctcc gaaactctaa gtgtttgctg caattttata aggacttcct 2820gattggtttc tcttctcccc ttccatttct gccttttgtt catttcatcc tttcacttct 2880ttcccttcct ccgtcctcct ccttcctagt tcatcccttc tcttccaggc agccgcggtg 2940cccaaccaca cttgtcggct ccagtcccca gaactctgcc tgccctttgt cctcctgctg 3000ccagtaccag ccccaccctg ttttgagccc tgaggaggcc ttgggctctg ctgagtccga 3060cctggcctgt ctgtgaagag caagagagca gcaaggtctt gctctcctag gtagccccct 3120cttccctggt aagaaaaagc aaaaggcatt tcccaccctg aacaacgagc cttttcaccc 3180ttctactcta gagaagtgga ctggaggagc tgggcccgat ttggtagttg aggaaagcac 3240agaggcctcc tgtggcctgc cagtcatcga gtggcccaac aggggctcca tgccagccga 3300ccttgacctc actcagaagt ccagagtcta gcgtagtgca gcagggcagt agcggtacca 3360atgcagaact cccaagaccc gagctgggac cagtacctgg gtccccagcc cttcctctgc 3420tccccctttt ccctcggagt tcttcttgaa tggcaatgtt ttgcttttgc tcgatgcaga 3480cagggggcca gaacaccaca catttcactg tctgtctggt ccatagctgt ggtgtagggg 3540cttagaggca tgggcttgct gtgggttttt aattgatcag ttttcatgtg ggatcccatc 3600tttttaacct ctgttcagga agtccttatc tagctgcata tcttcatcat attggtatat 3660ccttttctgt gtttacagag atgtctctta tatctaaatc tgtccaactg agaagtacct 3720tatcaaagta gcaaatgaga cagcagtctt atgcttccag aaacacccac aggcatgtcc 3780catgtgagct gctgccatga actgtcaagt gtgtgttgtc ttgtgtattt cagttattgt 3840ccctggcttc cttactatgg tgtaatcatg aaggagtgaa acatcataga aactgtctag 3900cacttccttg ccagtcttta gtgatcagga accatagttg acagttccaa tcagtagctt 3960aagaaaaaac cgtgtttgtc tcttctggaa tggttagaag tgagggagtt tgccccgttc 4020tgtttgtaga gtctcatagt tggactttct agcatatatg tgtccatttc cttatgctgt 4080aaaagcaagt cctgcaacca aactcccatc agcccaatcc ctgatccctg atcccttcca 4140cctgctctgc tgatgacccc cccagcttca cttctgactc ttccccagga agggaagggg 4200ggtcagaaga gagggtgagt cctccagaac tcttcctcca aggacagaag gctcctgccc 4260ccatagtggc ctcgaactcc tggcactacc aaaggacact tatccacgag agcgcagcat 4320ccgaccaggt tgtcactgag aagatgttta ttttggtcag ttgggttttt atgtattata 4380cttagtcaaa tgtaatgtgg cttctggaat cattgtccag agctgcttcc ccgtcacctg 4440ggcgtcatct ggtcctggta agaggagtgc gtggcccacc aggcccccct gtcacccatg 4500acagttcatt cagggccgat ggggcagtcg tggttgggaa cacagcattt caagcgtcac 4560tttatttcat tcgggcccca cctgcagctc cctcaaagag gcagttgccc agcctctttc 4620ccttccagtt tattccagag ctgccagtgg ggcctgaggc tccttagggt tttctctcta 4680tttccccctt tcttcctcat tccctcgtct ttcccaaagg catcacgagt cagtcgcctt 4740tcagcaggca gccttggcgg tttatcgccc tggcaggcag gggccctgca gctctcatgc 4800tgcccctgcc ttggggtcag gttgacagga ggttggaggg aaagccttaa gctgcaggat 4860tctcaccagc tgtgtccggc ccagttttgg ggtgtgacct caatttcaat tttgtctgta 4920cttgaacatt atgaagatgg gggcctcttt cagtgaattt gtgaacagca gaattgaccg 4980acagctttcc agtacccatg gggctaggtc attaaggcca catccacagt ctcccccacc 5040cttgttccag ttgttagtta ctacctcctc tcctgacaat actgtatgtc gtcgagctcc 5100ccccaggtct acccctcccg gccctgcctg ctggtgggct tgtcatagcc agtgggattg 5160ccggtcttga cagctcagtg agctggagat acttggtcac agccaggcgc tagcacagct 5220cccttctgtt gatgctgtat tcccatatca aaagacacag gggacaccca gaaacgccac 5280atcccccaat ccatcagtgc caaactagcc aacggcccca gcttctcagc tcgctggatg 5340gcggaagctg ctactcgtga gcgccagtgc gggtgcagac aatcttctgt tgggtggcat 5400cattccaggc ccgaagcatg aacagtgcac ctgggacagg gagcagcccc aaattgtcac 5460ctgcttctct gcccagcttt tcattgctgt gacagtgatg gcgaaagagg gtaataacca 5520gacacaaact gccaagttgg gtggagaaag gagtttcttt agctgacaga atctctgaat 5580tttaaatcac ttagtaagcg gctcaagccc aggagggagc agagggatac gagcggagtc 5640ccctgcgcgg gaccatctgg aattggttta gcccaagtgg agcctgacag ccagaactct 5700gtgtcccccg tctaaccaca gctccttttc cagagcattc cagtcaggct ctctgggctg 5760actgggccag gggaggttac aggtaccagt tctttaagaa gatctttggg catatacatt 5820tttagcctgt gtcattgccc caaatggatt cctgtttcaa gttcacacct gcagattcta 5880ggacctgtgt cctagacttc agggagtcag ctgtttctag agttcctacc atggagtggg 5940tctggaggac ctgcccggtg ggggggcaga gccctgctcc ctccgggtct tcctactctt 6000ctctctgctc tgacgggatt tgttgattct ctccattttg gtgtctttct cttttagata 6060ttgtatcaat ctttagaaaa ggcatagtct acttgttata aatcgttagg atactgcctc 6120ccccagggtc taaaattaca tattagaggg gaaaagctga acactgaagt cagttctcaa 6180caatttagaa ggaaaaccta gaaaacattt ggcagaaaat tacatttcga tgtttttgaa 6240tgaatacgag caagctttta caacagtgct gatctaaaaa tacttagcac ttggcctgag 6300atgcctggtg agcattacag gcaaggggaa tctggaggta gccgacctga ggacatggct 6360tctgaacctg tcttttggga gtggtatgga aggtggagcg ttcaccagtg acctggaagg 6420cccagcacca ccctccttcc cactcttctc atcttgacag agcctgcccc agcgctgacg 6480tgtcaggaaa acacccaggg aactaggaag gcacttctgc ctgaggggca gcctgccttg 6540cccactcctg ctctgctcgc ctcggatcag ctgagccttc tgagctggcc tctcactgcc 6600tccccaaggc cccctgcctg ccctgtcagg aggcagaagg aagcaggtgt gagggcagtg 6660caaggaggga gcacaacccc cagctcccgc tccgggctcc gacttgtgca caggcagagc 6720ccagaccctg gaggaaatcc tacctttgaa ttcaagaaca tttggggaat ttggaaatct 6780ctttgccccc aaacccccat tctgtcctac ctttaatcag gtcctgctca gcagtgagag 6840cagatgaggt gaaaaggcca agaggtttgg ctcctgccca ctgatagccc ctctccccgc 6900agtgtttgtg tgtcaagtgg caaagctgtt cttcctggtg accctgatta tatccagtaa 6960cacatagact gtgcgcatag gcctgctttg tctcctctat cctgggcttt tgttttgctt 7020tttagttttg cttttagttt ttctgtccct tttatttaac gcaccgacta gacacacaaa 7080gcagttgaat ttttatatat atatctgtat attgcacaat tataaactca ttttgcttgt 7140ggctccacac acacaaaaaa agacctgtta aaattatacc tgttgcttaa ttacaatatt 7200tctgataacc atagcatagg acaagggaaa ataaaaaaag aaaaaaaaga aaaaaaaacg 7260acaaatctgt ctgctggtca cttcttctgt ccaagcagat tcgtggtctt ttcctcgctt 7320ctttcaaggg ctttcctgtg ccaggtgaag gaggctccag gcagcaccca ggttttgcac 7380tcttgtttct cccgtgcttg tgaaagaggt cccaaggttc tgggtgcagg agcgctccct 7440tgacctgctg aagtccggaa cgtagtcggc acagcctggt cgccttccac ctctgggagc 7500tggagtccac tggggtggcc tgactccccc agtccccttc ccgtgacctg gtcagggtga 7560gcccatgtgg agtcagcctc gcaggcctcc ctgccagtag ggtccgagtg tgtttcatcc 7620ttcccactct gtcgagcctg ggggctggag cggagacggg aggcctggcc tgtctcggaa 7680cctgtgagct gcaccaggta gaacgccagg gaccccagaa tcatgtgcgt cagtccaagg 7740ggtcccctcc aggagtagtg aagactccag aaatgtccct ttcttctccc ccatcctacg 7800agtaattgca tttgcttttg taattcttaa tgagcaatat ctgctagaga gtttagctgt 7860aacagttctt tttgatcatc tttttttaat aattagaaac accaaaaaaa tccagaaact 7920tgttcttcca aagcagagag cattataatc accagggcca aaagcttccc tccctgctgt 7980cattgcttct tctgaggcct gaatccaaaa gaaaaacagc cataggccct ttcagtggcc 8040gggctacccg tgagcccttc ggaggaccag ggctggggca gcctctgggc ccacatccgg 8100ggccagctcc ggcgtgtgtt cagtgttagc agtgggtcat gatgctcttt cccacccagc 8160ctgggatagg ggcagaggag gcgaggaggc cgttgccgct gatgtttggc cgtgaacagg 8220tgggtgtctg cgtgcgtcca cgtgcgtgtt ttctgactga catgaaatcg acgcccgagt 8280tagcctcacc cggtgacctc tagccctgcc cggatggagc ggggcccacc cggttcagtg 8340tttctgggga gctggacagt ggagtgcaaa aggcttgcag aacttgaagc ctgctccttc 8400ccttgctacc acggcctcct ttccgtttga tttgtcactg cttcaatcaa taacagccgc 8460tccagagtca gtagtcaatg aatatatgac caaatatcac caggactgtt actcaatgtg 8520tgccgagccc ttgcccatgc tgggctcccg tgtatctgga cactgtaacg tgtgctgtgt 8580ttgctcccct tccccttcct tctttgccct ttacttgtct ttctggggtt tttctgtttg 8640ggtttggttt ggtttttatt tctccttttg tgttccaaac atgaggttct ctctactggt 8700cctcttaact gtggtgttga ggcttatatt tgtgtaattt ttggtgggtg aaaggaattt 8760tgctaagtaa atctcttctg tgtttgaact gaagtctgta ttgtaactat gtttaaagta 8820attgttccag agacaaatat ttctagacac tttttcttta caaacaaaag cattcggagg 8880gagggggatg gtgactgaga tgagagggga gagctgaaca gatgacccct gcccagatca 8940gccagaagcc acccaaagca gtggagccca ggagtcccac tccaagccag caagccgaat 9000agctgatgtg ttgccacttt ccaagtcact gcaaaaccag gttttgttcc gcccagtgga 9060ttcttgtttt gcttcccctc cccccgagat tattaccacc atcccgtgct tttaaggaaa 9120ggcaagattg atgtttcctt gaggggagcc aggaggggat gtgtgtgtgc agagctgaag 9180agctggggag aatggggctg ggcccaccca agcaggaggc tgggacgctc tgctgtgggc 9240acaggtcagg ctaatgttgg cagatgcagc tcttcctgga caggccaggt ggtgggcatt 9300ctctctccaa ggtgtgcccc gtgggcatta ctgtttaaga cacttccgtc acatcccacc 9360ccatcctcca gggctcaaca ctgtgacatc tctattcccc accctcccct tcccagggca 9420ataaaatgac catggagggg gcttgcactc tcttggctgt cacccgatcg ccagcaaaac 9480ttagatgtga gaaaacccct tcccattcca tggcgaaaac atctccttag aaaagccatt 9540accctcatta ggcatggttt tgggctccca aaacacctga cagcccctcc ctcctctgag 9600aggcggagag tgctgactgt agtgaccatt gcatgccggg tgcagcatct ggaagagcta 9660ggcagggtgt ctgccccctc ctgagttgaa gtcatgctcc cctgtgccag cccagaggcc 9720gagagctatg gacagcattg ccagtaacac aggccaccct gtgcagaagg gagctggctc 9780cagcctggaa acctgtctga ggttgggaga ggtgcacttg gggcacaggg agaggccggg 9840acacacttag ctggagatgt ctctaaaagc cctgtatcgt attcaccttc agtttttgtg 9900ttttgggaca attactttag aaaataagta ggtcgtttta aaaacaaaaa ttattgattg 9960cttttttgta gtgttcagaa aaaaggttct ttgtgtatag ccaaatgact gaaagcactg 10020atatatttaa aaacaaaagg caatttatta aggaaatttg taccatttca gtaaacctgt 10080ctgaatgtac ctgtatacgt ttcaaaaaca cccccccccc actgaatccc tgtaacctat 10140ttattatata aagagtttgc cttataaatt t 101712210113DNAHomo sapiens 22gctccataaa aatacagact caccagttcc tgctttgatg tgacatgtga ctccccagaa 60tacaccttgc ttctgtagac cagctccaac aggattccat ggtagctggg atgttagggc 120tcagggaaga aaagtcagaa gaccaggacc tccagggcct caaggacaaa cccctcaagt 180ttaaaaaggt gaagaaagat aagaaagaag agaaagaggg caagcatgag cccgtgcagc 240catcagccca ccactctgct gagcccgcag aggcaggcaa agcagagaca tcagaagggt 300caggctccgc cccggctgtg ccggaagctt ctgcctcccc caaacagcgg cgctccatca 360tccgtgaccg gggacccatg tatgatgacc ccaccctgcc

tgaaggctgg acacggaagc 420ttaagcaaag gaaatctggc cgctctgctg ggaagtatga tgtgtatttg atcaatcccc 480agggaaaagc ctttcgctct aaagtggagt tgattgcgta cttcgaaaag gtaggcgaca 540catccctgga ccctaatgat tttgacttca cggtaactgg gagagggagc ccctcccggc 600gagagcagaa accacctaag aagcccaaat ctcccaaagc tccaggaact ggcagaggcc 660ggggacgccc caaagggagc ggcaccacga gacccaaggc ggccacgtca gagggtgtgc 720aggtgaaaag ggtcctggag aaaagtcctg ggaagctcct tgtcaagatg ccttttcaaa 780cttcgccagg gggcaaggct gaggggggtg gggccaccac atccacccag gtcatggtga 840tcaaacgccc cggcaggaag cgaaaagctg aggccgaccc tcaggccatt cccaagaaac 900ggggccgaaa gccggggagt gtggtggcag ccgctgccgc cgaggccaaa aagaaagccg 960tgaaggagtc ttctatccga tctgtgcagg agaccgtact ccccatcaag aagcgcaaga 1020cccgggagac ggtcagcatc gaggtcaagg aagtggtgaa gcccctgctg gtgtccaccc 1080tcggtgagaa gagcgggaaa ggactgaaga cctgtaagag ccctgggcgg aaaagcaagg 1140agagcagccc caaggggcgc agcagcagcg cctcctcacc ccccaagaag gagcaccacc 1200accatcacca ccactcagag tccccaaagg cccccgtgcc actgctccca cccctgcccc 1260cacctccacc tgagcccgag agctccgagg accccaccag cccccctgag ccccaggact 1320tgagcagcag cgtctgcaaa gaggagaaga tgcccagagg aggctcactg gagagcgacg 1380gctgccccaa ggagccagct aagactcagc ccgcggttgc caccgccgcc acggccgcag 1440aaaagtacaa acaccgaggg gagggagagc gcaaagacat tgtttcatcc tccatgccaa 1500ggccaaacag agaggagcct gtggacagcc ggacgcccgt gaccgagaga gttagctgac 1560tttacacgga gcggattgca aagcaaacca acaagaataa aggcagctgt tgtctcttct 1620ccttatgggt agggctctga caaagcttcc cgattaactg aaataaaaaa tatttttttt 1680tctttcagta aacttagagt ttcgtggctt cagggtggga gtagttggag cattggggat 1740gtttttctta ccgacaagca cagtcaggtt gaagacctaa ccagggccag aagtagcttt 1800gcacttttct aaactaggct ccttcaacaa ggcttgctgc agatactact gaccagacaa 1860gctgttgacc aggcacctcc cctcccgccc aaacctttcc cccatgtggt cgttagagac 1920agagcgacag agcagttgag aggacactcc cgttttcggt gccatcagtg ccccgtctac 1980agctccccca gctcccccca cctcccccac tcccaaccac gttgggacag ggaggtgtga 2040ggcaggagag acagttggat tctttagaga agatggatat gaccagtggc tatggcctgt 2100gcgatcccac ccgtggtggc tcaagtctgg ccccacacca gccccaatcc aaaactggca 2160aggacgcttc acaggacagg aaagtggcac ctgtctgctc cagctctggc atggctagga 2220ggggggagtc ccttgaacta ctgggtgtag actggcctga accacaggag aggatggccc 2280agggtgaggt ggcatggtcc attctcaagg gacgtcctcc aacgggtggc gctagaggcc 2340atggaggcag taggacaagg tgcaggcagg ctggcctggg gtcaggccgg gcagagcaca 2400gcggggtgag agggattcct aatcactcag agcagtctgt gacttagtgg acaggggagg 2460gggcaaaggg ggaggagaag aaaatgttct tccagttact ttccaattct cctttaggga 2520cagcttagaa ttatttgcac tattgagtct tcatgttccc acttcaaaac aaacagatgc 2580tctgagagca aactggcttg aattggtgac atttagtccc tcaagccacc agatgtgaca 2640gtgttgagaa ctacctggat ttgtatatat acctgcgctt gttttaaagt gggctcagca 2700catagggttc ccacgaagct ccgaaactct aagtgtttgc tgcaatttta taaggacttc 2760ctgattggtt tctcttctcc ccttccattt ctgccttttg ttcatttcat cctttcactt 2820ctttcccttc ctccgtcctc ctccttccta gttcatccct tctcttccag gcagccgcgg 2880tgcccaacca cacttgtcgg ctccagtccc cagaactctg cctgcccttt gtcctcctgc 2940tgccagtacc agccccaccc tgttttgagc cctgaggagg ccttgggctc tgctgagtcc 3000gacctggcct gtctgtgaag agcaagagag cagcaaggtc ttgctctcct aggtagcccc 3060ctcttccctg gtaagaaaaa gcaaaaggca tttcccaccc tgaacaacga gccttttcac 3120ccttctactc tagagaagtg gactggagga gctgggcccg atttggtagt tgaggaaagc 3180acagaggcct cctgtggcct gccagtcatc gagtggccca acaggggctc catgccagcc 3240gaccttgacc tcactcagaa gtccagagtc tagcgtagtg cagcagggca gtagcggtac 3300caatgcagaa ctcccaagac ccgagctggg accagtacct gggtccccag cccttcctct 3360gctccccctt ttccctcgga gttcttcttg aatggcaatg ttttgctttt gctcgatgca 3420gacagggggc cagaacacca cacatttcac tgtctgtctg gtccatagct gtggtgtagg 3480ggcttagagg catgggcttg ctgtgggttt ttaattgatc agttttcatg tgggatccca 3540tctttttaac ctctgttcag gaagtcctta tctagctgca tatcttcatc atattggtat 3600atccttttct gtgtttacag agatgtctct tatatctaaa tctgtccaac tgagaagtac 3660cttatcaaag tagcaaatga gacagcagtc ttatgcttcc agaaacaccc acaggcatgt 3720cccatgtgag ctgctgccat gaactgtcaa gtgtgtgttg tcttgtgtat ttcagttatt 3780gtccctggct tccttactat ggtgtaatca tgaaggagtg aaacatcata gaaactgtct 3840agcacttcct tgccagtctt tagtgatcag gaaccatagt tgacagttcc aatcagtagc 3900ttaagaaaaa accgtgtttg tctcttctgg aatggttaga agtgagggag tttgccccgt 3960tctgtttgta gagtctcata gttggacttt ctagcatata tgtgtccatt tccttatgct 4020gtaaaagcaa gtcctgcaac caaactccca tcagcccaat ccctgatccc tgatcccttc 4080cacctgctct gctgatgacc cccccagctt cacttctgac tcttccccag gaagggaagg 4140ggggtcagaa gagagggtga gtcctccaga actcttcctc caaggacaga aggctcctgc 4200ccccatagtg gcctcgaact cctggcacta ccaaaggaca cttatccacg agagcgcagc 4260atccgaccag gttgtcactg agaagatgtt tattttggtc agttgggttt ttatgtatta 4320tacttagtca aatgtaatgt ggcttctgga atcattgtcc agagctgctt ccccgtcacc 4380tgggcgtcat ctggtcctgg taagaggagt gcgtggccca ccaggccccc ctgtcaccca 4440tgacagttca ttcagggccg atggggcagt cgtggttggg aacacagcat ttcaagcgtc 4500actttatttc attcgggccc cacctgcagc tccctcaaag aggcagttgc ccagcctctt 4560tcccttccag tttattccag agctgccagt ggggcctgag gctccttagg gttttctctc 4620tatttccccc tttcttcctc attccctcgt ctttcccaaa ggcatcacga gtcagtcgcc 4680tttcagcagg cagccttggc ggtttatcgc cctggcaggc aggggccctg cagctctcat 4740gctgcccctg ccttggggtc aggttgacag gaggttggag ggaaagcctt aagctgcagg 4800attctcacca gctgtgtccg gcccagtttt ggggtgtgac ctcaatttca attttgtctg 4860tacttgaaca ttatgaagat gggggcctct ttcagtgaat ttgtgaacag cagaattgac 4920cgacagcttt ccagtaccca tggggctagg tcattaaggc cacatccaca gtctccccca 4980cccttgttcc agttgttagt tactacctcc tctcctgaca atactgtatg tcgtcgagct 5040ccccccaggt ctacccctcc cggccctgcc tgctggtggg cttgtcatag ccagtgggat 5100tgccggtctt gacagctcag tgagctggag atacttggtc acagccaggc gctagcacag 5160ctcccttctg ttgatgctgt attcccatat caaaagacac aggggacacc cagaaacgcc 5220acatccccca atccatcagt gccaaactag ccaacggccc cagcttctca gctcgctgga 5280tggcggaagc tgctactcgt gagcgccagt gcgggtgcag acaatcttct gttgggtggc 5340atcattccag gcccgaagca tgaacagtgc acctgggaca gggagcagcc ccaaattgtc 5400acctgcttct ctgcccagct tttcattgct gtgacagtga tggcgaaaga gggtaataac 5460cagacacaaa ctgccaagtt gggtggagaa aggagtttct ttagctgaca gaatctctga 5520attttaaatc acttagtaag cggctcaagc ccaggaggga gcagagggat acgagcggag 5580tcccctgcgc gggaccatct ggaattggtt tagcccaagt ggagcctgac agccagaact 5640ctgtgtcccc cgtctaacca cagctccttt tccagagcat tccagtcagg ctctctgggc 5700tgactgggcc aggggaggtt acaggtacca gttctttaag aagatctttg ggcatataca 5760tttttagcct gtgtcattgc cccaaatgga ttcctgtttc aagttcacac ctgcagattc 5820taggacctgt gtcctagact tcagggagtc agctgtttct agagttccta ccatggagtg 5880ggtctggagg acctgcccgg tgggggggca gagccctgct ccctccgggt cttcctactc 5940ttctctctgc tctgacggga tttgttgatt ctctccattt tggtgtcttt ctcttttaga 6000tattgtatca atctttagaa aaggcatagt ctacttgtta taaatcgtta ggatactgcc 6060tcccccaggg tctaaaatta catattagag gggaaaagct gaacactgaa gtcagttctc 6120aacaatttag aaggaaaacc tagaaaacat ttggcagaaa attacatttc gatgtttttg 6180aatgaatacg agcaagcttt tacaacagtg ctgatctaaa aatacttagc acttggcctg 6240agatgcctgg tgagcattac aggcaagggg aatctggagg tagccgacct gaggacatgg 6300cttctgaacc tgtcttttgg gagtggtatg gaaggtggag cgttcaccag tgacctggaa 6360ggcccagcac caccctcctt cccactcttc tcatcttgac agagcctgcc ccagcgctga 6420cgtgtcagga aaacacccag ggaactagga aggcacttct gcctgagggg cagcctgcct 6480tgcccactcc tgctctgctc gcctcggatc agctgagcct tctgagctgg cctctcactg 6540cctccccaag gccccctgcc tgccctgtca ggaggcagaa ggaagcaggt gtgagggcag 6600tgcaaggagg gagcacaacc cccagctccc gctccgggct ccgacttgtg cacaggcaga 6660gcccagaccc tggaggaaat cctacctttg aattcaagaa catttgggga atttggaaat 6720ctctttgccc ccaaaccccc attctgtcct acctttaatc aggtcctgct cagcagtgag 6780agcagatgag gtgaaaaggc caagaggttt ggctcctgcc cactgatagc ccctctcccc 6840gcagtgtttg tgtgtcaagt ggcaaagctg ttcttcctgg tgaccctgat tatatccagt 6900aacacataga ctgtgcgcat aggcctgctt tgtctcctct atcctgggct tttgttttgc 6960tttttagttt tgcttttagt ttttctgtcc cttttattta acgcaccgac tagacacaca 7020aagcagttga atttttatat atatatctgt atattgcaca attataaact cattttgctt 7080gtggctccac acacacaaaa aaagacctgt taaaattata cctgttgctt aattacaata 7140tttctgataa ccatagcata ggacaaggga aaataaaaaa agaaaaaaaa gaaaaaaaaa 7200cgacaaatct gtctgctggt cacttcttct gtccaagcag attcgtggtc ttttcctcgc 7260ttctttcaag ggctttcctg tgccaggtga aggaggctcc aggcagcacc caggttttgc 7320actcttgttt ctcccgtgct tgtgaaagag gtcccaaggt tctgggtgca ggagcgctcc 7380cttgacctgc tgaagtccgg aacgtagtcg gcacagcctg gtcgccttcc acctctggga 7440gctggagtcc actggggtgg cctgactccc ccagtcccct tcccgtgacc tggtcagggt 7500gagcccatgt ggagtcagcc tcgcaggcct ccctgccagt agggtccgag tgtgtttcat 7560ccttcccact ctgtcgagcc tgggggctgg agcggagacg ggaggcctgg cctgtctcgg 7620aacctgtgag ctgcaccagg tagaacgcca gggaccccag aatcatgtgc gtcagtccaa 7680ggggtcccct ccaggagtag tgaagactcc agaaatgtcc ctttcttctc ccccatccta 7740cgagtaattg catttgcttt tgtaattctt aatgagcaat atctgctaga gagtttagct 7800gtaacagttc tttttgatca tcttttttta ataattagaa acaccaaaaa aatccagaaa 7860cttgttcttc caaagcagag agcattataa tcaccagggc caaaagcttc cctccctgct 7920gtcattgctt cttctgaggc ctgaatccaa aagaaaaaca gccataggcc ctttcagtgg 7980ccgggctacc cgtgagccct tcggaggacc agggctgggg cagcctctgg gcccacatcc 8040ggggccagct ccggcgtgtg ttcagtgtta gcagtgggtc atgatgctct ttcccaccca 8100gcctgggata ggggcagagg aggcgaggag gccgttgccg ctgatgtttg gccgtgaaca 8160ggtgggtgtc tgcgtgcgtc cacgtgcgtg ttttctgact gacatgaaat cgacgcccga 8220gttagcctca cccggtgacc tctagccctg cccggatgga gcggggccca cccggttcag 8280tgtttctggg gagctggaca gtggagtgca aaaggcttgc agaacttgaa gcctgctcct 8340tcccttgcta ccacggcctc ctttccgttt gatttgtcac tgcttcaatc aataacagcc 8400gctccagagt cagtagtcaa tgaatatatg accaaatatc accaggactg ttactcaatg 8460tgtgccgagc ccttgcccat gctgggctcc cgtgtatctg gacactgtaa cgtgtgctgt 8520gtttgctccc cttccccttc cttctttgcc ctttacttgt ctttctgggg tttttctgtt 8580tgggtttggt ttggttttta tttctccttt tgtgttccaa acatgaggtt ctctctactg 8640gtcctcttaa ctgtggtgtt gaggcttata tttgtgtaat ttttggtggg tgaaaggaat 8700tttgctaagt aaatctcttc tgtgtttgaa ctgaagtctg tattgtaact atgtttaaag 8760taattgttcc agagacaaat atttctagac actttttctt tacaaacaaa agcattcgga 8820gggaggggga tggtgactga gatgagaggg gagagctgaa cagatgaccc ctgcccagat 8880cagccagaag ccacccaaag cagtggagcc caggagtccc actccaagcc agcaagccga 8940atagctgatg tgttgccact ttccaagtca ctgcaaaacc aggttttgtt ccgcccagtg 9000gattcttgtt ttgcttcccc tccccccgag attattacca ccatcccgtg cttttaagga 9060aaggcaagat tgatgtttcc ttgaggggag ccaggagggg atgtgtgtgt gcagagctga 9120agagctgggg agaatggggc tgggcccacc caagcaggag gctgggacgc tctgctgtgg 9180gcacaggtca ggctaatgtt ggcagatgca gctcttcctg gacaggccag gtggtgggca 9240ttctctctcc aaggtgtgcc ccgtgggcat tactgtttaa gacacttccg tcacatccca 9300ccccatcctc cagggctcaa cactgtgaca tctctattcc ccaccctccc cttcccaggg 9360caataaaatg accatggagg gggcttgcac tctcttggct gtcacccgat cgccagcaaa 9420acttagatgt gagaaaaccc cttcccattc catggcgaaa acatctcctt agaaaagcca 9480ttaccctcat taggcatggt tttgggctcc caaaacacct gacagcccct ccctcctctg 9540agaggcggag agtgctgact gtagtgacca ttgcatgccg ggtgcagcat ctggaagagc 9600taggcagggt gtctgccccc tcctgagttg aagtcatgct cccctgtgcc agcccagagg 9660ccgagagcta tggacagcat tgccagtaac acaggccacc ctgtgcagaa gggagctggc 9720tccagcctgg aaacctgtct gaggttggga gaggtgcact tggggcacag ggagaggccg 9780ggacacactt agctggagat gtctctaaaa gccctgtatc gtattcacct tcagtttttg 9840tgttttggga caattacttt agaaaataag taggtcgttt taaaaacaaa aattattgat 9900tgcttttttg tagtgttcag aaaaaaggtt ctttgtgtat agccaaatga ctgaaagcac 9960tgatatattt aaaaacaaaa ggcaatttat taaggaaatt tgtaccattt cagtaaacct 10020gtctgaatgt acctgtatac gtttcaaaaa cacccccccc ccactgaatc cctgtaacct 10080atttattata taaagagttt gccttataaa ttt 101132310182DNAHomo sapiens 23ccggaaattg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 60ggagagactg ctccataaaa atacagactc accagttcct gctttgatgt gacatgtgac 120tccccagaat acaccttgct tctgtagacc agctccaaca ggattccatg gtagctggga 180tgttagggct cagggaagaa aagtcagaag accaggacct ccagggcctc aaggacaaac 240ccctcaagtt taaaaaggtg aagaaagata agaaagaaga gaaagagggc aagcatgagc 300ccgtgcagcc atcagcccac cactctgctg agcccgcaga ggcaggcaaa gcagagacat 360cagaagggtc aggctccgcc ccggctgtgc cggaagcttc tgcctccccc aaacagcggc 420gctccatcat ccgtgaccgg ggacccatgt atgatgaccc caccctgcct gaaggctgga 480cacggaagct taagcaaagg aaatctggcc gctctgctgg gaagtatgat gtgtatttga 540tcaatcccca gggaaaagcc tttcgctcta aagtggagtt gattgcgtac ttcgaaaagg 600taggcgacac atccctggac cctaatgatt ttgacttcac ggtaactggg agagggagcc 660cctcccggcg agagcagaaa ccacctaaga agcccaaatc tcccaaagct ccaggaactg 720gcagaggccg gggacgcccc aaagggagcg gcaccacgag acccaaggcg gccacgtcag 780agggtgtgca ggtgaaaagg gtcctggaga aaagtcctgg gaagctcctt gtcaagatgc 840cttttcaaac ttcgccaggg ggcaaggctg aggggggtgg ggccaccaca tccacccagg 900tcatggtgat caaacgcccc ggcaggaagc gaaaagctga ggccgaccct caggccattc 960ccaagaaacg gggccgaaag ccggggagtg tggtggcagc cgctgccgcc gaggccaaaa 1020agaaagccgt gaaggagtct tctatccgat ctgtgcagga gaccgtactc cccatcaaga 1080agcgcaagac ccgggagacg gtcagcatcg aggtcaagga agtggtgaag cccctgctgg 1140tgtccaccct cggtgagaag agcgggaaag gactgaagac ctgtaagagc cctgggcgga 1200aaagcaagga gagcagcccc aaggggcgca gcagcagcgc ctcctcaccc cccaagaagg 1260agcaccacca ccatcaccac cactcagagt ccccaaaggc ccccgtgcca ctgctcccac 1320ccctgccccc acctccacct gagcccgaga gctccgagga ccccaccagc ccccctgagc 1380cccaggactt gagcagcagc gtctgcaaag aggagaagat gcccagagga ggctcactgg 1440agagcgacgg ctgccccaag gagccagcta agactcagcc cgcggttgcc accgccgcca 1500cggccgcaga aaagtacaaa caccgagggg agggagagcg caaagacatt gtttcatcct 1560ccatgccaag gccaaacaga gaggagcctg tggacagccg gacgcccgtg accgagagag 1620ttagctgact ttacacggag cggattgcaa agcaaaccaa caagaataaa ggcagctgtt 1680gtctcttctc cttatgggta gggctctgac aaagcttccc gattaactga aataaaaaat 1740attttttttt ctttcagtaa acttagagtt tcgtggcttc agggtgggag tagttggagc 1800attggggatg tttttcttac cgacaagcac agtcaggttg aagacctaac cagggccaga 1860agtagctttg cacttttcta aactaggctc cttcaacaag gcttgctgca gatactactg 1920accagacaag ctgttgacca ggcacctccc ctcccgccca aacctttccc ccatgtggtc 1980gttagagaca gagcgacaga gcagttgaga ggacactccc gttttcggtg ccatcagtgc 2040cccgtctaca gctcccccag ctccccccac ctcccccact cccaaccacg ttgggacagg 2100gaggtgtgag gcaggagaga cagttggatt ctttagagaa gatggatatg accagtggct 2160atggcctgtg cgatcccacc cgtggtggct caagtctggc cccacaccag ccccaatcca 2220aaactggcaa ggacgcttca caggacagga aagtggcacc tgtctgctcc agctctggca 2280tggctaggag gggggagtcc cttgaactac tgggtgtaga ctggcctgaa ccacaggaga 2340ggatggccca gggtgaggtg gcatggtcca ttctcaaggg acgtcctcca acgggtggcg 2400ctagaggcca tggaggcagt aggacaaggt gcaggcaggc tggcctgggg tcaggccggg 2460cagagcacag cggggtgaga gggattccta atcactcaga gcagtctgtg acttagtgga 2520caggggaggg ggcaaagggg gaggagaaga aaatgttctt ccagttactt tccaattctc 2580ctttagggac agcttagaat tatttgcact attgagtctt catgttccca cttcaaaaca 2640aacagatgct ctgagagcaa actggcttga attggtgaca tttagtccct caagccacca 2700gatgtgacag tgttgagaac tacctggatt tgtatatata cctgcgcttg ttttaaagtg 2760ggctcagcac atagggttcc cacgaagctc cgaaactcta agtgtttgct gcaattttat 2820aaggacttcc tgattggttt ctcttctccc cttccatttc tgccttttgt tcatttcatc 2880ctttcacttc tttcccttcc tccgtcctcc tccttcctag ttcatccctt ctcttccagg 2940cagccgcggt gcccaaccac acttgtcggc tccagtcccc agaactctgc ctgccctttg 3000tcctcctgct gccagtacca gccccaccct gttttgagcc ctgaggaggc cttgggctct 3060gctgagtccg acctggcctg tctgtgaaga gcaagagagc agcaaggtct tgctctccta 3120ggtagccccc tcttccctgg taagaaaaag caaaaggcat ttcccaccct gaacaacgag 3180ccttttcacc cttctactct agagaagtgg actggaggag ctgggcccga tttggtagtt 3240gaggaaagca cagaggcctc ctgtggcctg ccagtcatcg agtggcccaa caggggctcc 3300atgccagccg accttgacct cactcagaag tccagagtct agcgtagtgc agcagggcag 3360tagcggtacc aatgcagaac tcccaagacc cgagctggga ccagtacctg ggtccccagc 3420ccttcctctg ctcccccttt tccctcggag ttcttcttga atggcaatgt tttgcttttg 3480ctcgatgcag acagggggcc agaacaccac acatttcact gtctgtctgg tccatagctg 3540tggtgtaggg gcttagaggc atgggcttgc tgtgggtttt taattgatca gttttcatgt 3600gggatcccat ctttttaacc tctgttcagg aagtccttat ctagctgcat atcttcatca 3660tattggtata tccttttctg tgtttacaga gatgtctctt atatctaaat ctgtccaact 3720gagaagtacc ttatcaaagt agcaaatgag acagcagtct tatgcttcca gaaacaccca 3780caggcatgtc ccatgtgagc tgctgccatg aactgtcaag tgtgtgttgt cttgtgtatt 3840tcagttattg tccctggctt ccttactatg gtgtaatcat gaaggagtga aacatcatag 3900aaactgtcta gcacttcctt gccagtcttt agtgatcagg aaccatagtt gacagttcca 3960atcagtagct taagaaaaaa ccgtgtttgt ctcttctgga atggttagaa gtgagggagt 4020ttgccccgtt ctgtttgtag agtctcatag ttggactttc tagcatatat gtgtccattt 4080ccttatgctg taaaagcaag tcctgcaacc aaactcccat cagcccaatc cctgatccct 4140gatcccttcc acctgctctg ctgatgaccc ccccagcttc acttctgact cttccccagg 4200aagggaaggg gggtcagaag agagggtgag tcctccagaa ctcttcctcc aaggacagaa 4260ggctcctgcc cccatagtgg cctcgaactc ctggcactac caaaggacac ttatccacga 4320gagcgcagca tccgaccagg ttgtcactga gaagatgttt attttggtca gttgggtttt 4380tatgtattat acttagtcaa atgtaatgtg gcttctggaa tcattgtcca gagctgcttc 4440cccgtcacct gggcgtcatc tggtcctggt aagaggagtg cgtggcccac caggcccccc 4500tgtcacccat gacagttcat tcagggccga tggggcagtc gtggttggga acacagcatt 4560tcaagcgtca ctttatttca ttcgggcccc acctgcagct ccctcaaaga ggcagttgcc 4620cagcctcttt cccttccagt ttattccaga gctgccagtg gggcctgagg ctccttaggg 4680ttttctctct atttccccct ttcttcctca ttccctcgtc tttcccaaag gcatcacgag 4740tcagtcgcct ttcagcaggc agccttggcg gtttatcgcc ctggcaggca ggggccctgc 4800agctctcatg ctgcccctgc cttggggtca ggttgacagg aggttggagg gaaagcctta 4860agctgcagga ttctcaccag ctgtgtccgg cccagttttg gggtgtgacc tcaatttcaa 4920ttttgtctgt acttgaacat tatgaagatg ggggcctctt tcagtgaatt tgtgaacagc 4980agaattgacc gacagctttc cagtacccat ggggctaggt cattaaggcc acatccacag 5040tctcccccac ccttgttcca gttgttagtt actacctcct ctcctgacaa tactgtatgt 5100cgtcgagctc cccccaggtc tacccctccc ggccctgcct gctggtgggc ttgtcatagc 5160cagtgggatt gccggtcttg acagctcagt gagctggaga tacttggtca cagccaggcg 5220ctagcacagc tcccttctgt tgatgctgta ttcccatatc aaaagacaca ggggacaccc 5280agaaacgcca catcccccaa

tccatcagtg ccaaactagc caacggcccc agcttctcag 5340ctcgctggat ggcggaagct gctactcgtg agcgccagtg cgggtgcaga caatcttctg 5400ttgggtggca tcattccagg cccgaagcat gaacagtgca cctgggacag ggagcagccc 5460caaattgtca cctgcttctc tgcccagctt ttcattgctg tgacagtgat ggcgaaagag 5520ggtaataacc agacacaaac tgccaagttg ggtggagaaa ggagtttctt tagctgacag 5580aatctctgaa ttttaaatca cttagtaagc ggctcaagcc caggagggag cagagggata 5640cgagcggagt cccctgcgcg ggaccatctg gaattggttt agcccaagtg gagcctgaca 5700gccagaactc tgtgtccccc gtctaaccac agctcctttt ccagagcatt ccagtcaggc 5760tctctgggct gactgggcca ggggaggtta caggtaccag ttctttaaga agatctttgg 5820gcatatacat ttttagcctg tgtcattgcc ccaaatggat tcctgtttca agttcacacc 5880tgcagattct aggacctgtg tcctagactt cagggagtca gctgtttcta gagttcctac 5940catggagtgg gtctggagga cctgcccggt gggggggcag agccctgctc cctccgggtc 6000ttcctactct tctctctgct ctgacgggat ttgttgattc tctccatttt ggtgtctttc 6060tcttttagat attgtatcaa tctttagaaa aggcatagtc tacttgttat aaatcgttag 6120gatactgcct cccccagggt ctaaaattac atattagagg ggaaaagctg aacactgaag 6180tcagttctca acaatttaga aggaaaacct agaaaacatt tggcagaaaa ttacatttcg 6240atgtttttga atgaatacga gcaagctttt acaacagtgc tgatctaaaa atacttagca 6300cttggcctga gatgcctggt gagcattaca ggcaagggga atctggaggt agccgacctg 6360aggacatggc ttctgaacct gtcttttggg agtggtatgg aaggtggagc gttcaccagt 6420gacctggaag gcccagcacc accctccttc ccactcttct catcttgaca gagcctgccc 6480cagcgctgac gtgtcaggaa aacacccagg gaactaggaa ggcacttctg cctgaggggc 6540agcctgcctt gcccactcct gctctgctcg cctcggatca gctgagcctt ctgagctggc 6600ctctcactgc ctccccaagg ccccctgcct gccctgtcag gaggcagaag gaagcaggtg 6660tgagggcagt gcaaggaggg agcacaaccc ccagctcccg ctccgggctc cgacttgtgc 6720acaggcagag cccagaccct ggaggaaatc ctacctttga attcaagaac atttggggaa 6780tttggaaatc tctttgcccc caaaccccca ttctgtccta cctttaatca ggtcctgctc 6840agcagtgaga gcagatgagg tgaaaaggcc aagaggtttg gctcctgccc actgatagcc 6900cctctccccg cagtgtttgt gtgtcaagtg gcaaagctgt tcttcctggt gaccctgatt 6960atatccagta acacatagac tgtgcgcata ggcctgcttt gtctcctcta tcctgggctt 7020ttgttttgct ttttagtttt gcttttagtt tttctgtccc ttttatttaa cgcaccgact 7080agacacacaa agcagttgaa tttttatata tatatctgta tattgcacaa ttataaactc 7140attttgcttg tggctccaca cacacaaaaa aagacctgtt aaaattatac ctgttgctta 7200attacaatat ttctgataac catagcatag gacaagggaa aataaaaaaa gaaaaaaaag 7260aaaaaaaaac gacaaatctg tctgctggtc acttcttctg tccaagcaga ttcgtggtct 7320tttcctcgct tctttcaagg gctttcctgt gccaggtgaa ggaggctcca ggcagcaccc 7380aggttttgca ctcttgtttc tcccgtgctt gtgaaagagg tcccaaggtt ctgggtgcag 7440gagcgctccc ttgacctgct gaagtccgga acgtagtcgg cacagcctgg tcgccttcca 7500cctctgggag ctggagtcca ctggggtggc ctgactcccc cagtcccctt cccgtgacct 7560ggtcagggtg agcccatgtg gagtcagcct cgcaggcctc cctgccagta gggtccgagt 7620gtgtttcatc cttcccactc tgtcgagcct gggggctgga gcggagacgg gaggcctggc 7680ctgtctcgga acctgtgagc tgcaccaggt agaacgccag ggaccccaga atcatgtgcg 7740tcagtccaag gggtcccctc caggagtagt gaagactcca gaaatgtccc tttcttctcc 7800cccatcctac gagtaattgc atttgctttt gtaattctta atgagcaata tctgctagag 7860agtttagctg taacagttct ttttgatcat ctttttttaa taattagaaa caccaaaaaa 7920atccagaaac ttgttcttcc aaagcagaga gcattataat caccagggcc aaaagcttcc 7980ctccctgctg tcattgcttc ttctgaggcc tgaatccaaa agaaaaacag ccataggccc 8040tttcagtggc cgggctaccc gtgagccctt cggaggacca gggctggggc agcctctggg 8100cccacatccg gggccagctc cggcgtgtgt tcagtgttag cagtgggtca tgatgctctt 8160tcccacccag cctgggatag gggcagagga ggcgaggagg ccgttgccgc tgatgtttgg 8220ccgtgaacag gtgggtgtct gcgtgcgtcc acgtgcgtgt tttctgactg acatgaaatc 8280gacgcccgag ttagcctcac ccggtgacct ctagccctgc ccggatggag cggggcccac 8340ccggttcagt gtttctgggg agctggacag tggagtgcaa aaggcttgca gaacttgaag 8400cctgctcctt cccttgctac cacggcctcc tttccgtttg atttgtcact gcttcaatca 8460ataacagccg ctccagagtc agtagtcaat gaatatatga ccaaatatca ccaggactgt 8520tactcaatgt gtgccgagcc cttgcccatg ctgggctccc gtgtatctgg acactgtaac 8580gtgtgctgtg tttgctcccc ttccccttcc ttctttgccc tttacttgtc tttctggggt 8640ttttctgttt gggtttggtt tggtttttat ttctcctttt gtgttccaaa catgaggttc 8700tctctactgg tcctcttaac tgtggtgttg aggcttatat ttgtgtaatt tttggtgggt 8760gaaaggaatt ttgctaagta aatctcttct gtgtttgaac tgaagtctgt attgtaacta 8820tgtttaaagt aattgttcca gagacaaata tttctagaca ctttttcttt acaaacaaaa 8880gcattcggag ggagggggat ggtgactgag atgagagggg agagctgaac agatgacccc 8940tgcccagatc agccagaagc cacccaaagc agtggagccc aggagtccca ctccaagcca 9000gcaagccgaa tagctgatgt gttgccactt tccaagtcac tgcaaaacca ggttttgttc 9060cgcccagtgg attcttgttt tgcttcccct ccccccgaga ttattaccac catcccgtgc 9120ttttaaggaa aggcaagatt gatgtttcct tgaggggagc caggagggga tgtgtgtgtg 9180cagagctgaa gagctgggga gaatggggct gggcccaccc aagcaggagg ctgggacgct 9240ctgctgtggg cacaggtcag gctaatgttg gcagatgcag ctcttcctgg acaggccagg 9300tggtgggcat tctctctcca aggtgtgccc cgtgggcatt actgtttaag acacttccgt 9360cacatcccac cccatcctcc agggctcaac actgtgacat ctctattccc caccctcccc 9420ttcccagggc aataaaatga ccatggaggg ggcttgcact ctcttggctg tcacccgatc 9480gccagcaaaa cttagatgtg agaaaacccc ttcccattcc atggcgaaaa catctcctta 9540gaaaagccat taccctcatt aggcatggtt ttgggctccc aaaacacctg acagcccctc 9600cctcctctga gaggcggaga gtgctgactg tagtgaccat tgcatgccgg gtgcagcatc 9660tggaagagct aggcagggtg tctgccccct cctgagttga agtcatgctc ccctgtgcca 9720gcccagaggc cgagagctat ggacagcatt gccagtaaca caggccaccc tgtgcagaag 9780ggagctggct ccagcctgga aacctgtctg aggttgggag aggtgcactt ggggcacagg 9840gagaggccgg gacacactta gctggagatg tctctaaaag ccctgtatcg tattcacctt 9900cagtttttgt gttttgggac aattacttta gaaaataagt aggtcgtttt aaaaacaaaa 9960attattgatt gcttttttgt agtgttcaga aaaaaggttc tttgtgtata gccaaatgac 10020tgaaagcact gatatattta aaaacaaaag gcaatttatt aaggaaattt gtaccatttc 10080agtaaacctg tctgaatgta cctgtatacg tttcaaaaac accccccccc cactgaatcc 10140ctgtaaccta tttattatat aaagagtttg ccttataaat tt 101822410180DNAHomo sapiens 24ccggaaaatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 60ggagagacct ccataaaaat acagactcac cagttcctgc tttgatgtga catgtgactc 120cccagaatac accttgcttc tgtagaccag ctccaacagg attccatggt agctgggatg 180ttagggctca gggaagaaaa gtcagaagac caggacctcc agggcctcaa ggacaaaccc 240ctcaagttta aaaaggtgaa gaaagataag aaagaagaga aagagggcaa gcatgagccc 300gtgcagccat cagcccacca ctctgctgag cccgcagagg caggcaaagc agagacatca 360gaagggtcag gctccgcccc ggctgtgccg gaagcttctg cctcccccaa acagcggcgc 420tccatcatcc gtgaccgggg acccatgtat gatgacccca ccctgcctga aggctggaca 480cggaagctta agcaaaggaa atctggccgc tctgctggga agtatgatgt gtatttgatc 540aatccccagg gaaaagcctt tcgctctaaa gtggagttga ttgcgtactt cgaaaaggta 600ggcgacacat ccctggaccc taatgatttt gacttcacgg taactgggag agggagcccc 660tcccggcgag agcagaaacc acctaagaag cccaaatctc ccaaagctcc aggaactggc 720agaggccggg gacgccccaa agggagcggc accacgagac ccaaggcggc cacgtcagag 780ggtgtgcagg tgaaaagggt cctggagaaa agtcctggga agctccttgt caagatgcct 840tttcaaactt cgccaggggg caaggctgag gggggtgggg ccaccacatc cacccaggtc 900atggtgatca aacgccccgg caggaagcga aaagctgagg ccgaccctca ggccattccc 960aagaaacggg gccgaaagcc ggggagtgtg gtggcagccg ctgccgccga ggccaaaaag 1020aaagccgtga aggagtcttc tatccgatct gtgcaggaga ccgtactccc catcaagaag 1080cgcaagaccc gggagacggt cagcatcgag gtcaaggaag tggtgaagcc cctgctggtg 1140tccaccctcg gtgagaagag cgggaaagga ctgaagacct gtaagagccc tgggcggaaa 1200agcaaggaga gcagccccaa ggggcgcagc agcagcgcct cctcaccccc caagaaggag 1260caccaccacc atcaccacca ctcagagtcc ccaaaggccc ccgtgccact gctcccaccc 1320ctgcccccac ctccacctga gcccgagagc tccgaggacc ccaccagccc ccctgagccc 1380caggacttga gcagcagcgt ctgcaaagag gagaagatgc ccagaggagg ctcactggag 1440agcgacggct gccccaagga gccagctaag actcagcccg cggttgccac cgccgccacg 1500gccgcagaaa agtacaaaca ccgaggggag ggagagcgca aagacattgt ttcatcctcc 1560atgccaaggc caaacagaga ggagcctgtg gacagccgga cgcccgtgac cgagagagtt 1620agctgacttt acacggagcg gattgcaaag caaaccaaca agaataaagg cagctgttgt 1680ctcttctcct tatgggtagg gctctgacaa agcttcccga ttaactgaaa taaaaaatat 1740ttttttttct ttcagtaaac ttagagtttc gtggcttcag ggtgggagta gttggagcat 1800tggggatgtt tttcttaccg acaagcacag tcaggttgaa gacctaacca gggccagaag 1860tagctttgca cttttctaaa ctaggctcct tcaacaaggc ttgctgcaga tactactgac 1920cagacaagct gttgaccagg cacctcccct cccgcccaaa cctttccccc atgtggtcgt 1980tagagacaga gcgacagagc agttgagagg acactcccgt tttcggtgcc atcagtgccc 2040cgtctacagc tcccccagct ccccccacct cccccactcc caaccacgtt gggacaggga 2100ggtgtgaggc aggagagaca gttggattct ttagagaaga tggatatgac cagtggctat 2160ggcctgtgcg atcccacccg tggtggctca agtctggccc cacaccagcc ccaatccaaa 2220actggcaagg acgcttcaca ggacaggaaa gtggcacctg tctgctccag ctctggcatg 2280gctaggaggg gggagtccct tgaactactg ggtgtagact ggcctgaacc acaggagagg 2340atggcccagg gtgaggtggc atggtccatt ctcaagggac gtcctccaac gggtggcgct 2400agaggccatg gaggcagtag gacaaggtgc aggcaggctg gcctggggtc aggccgggca 2460gagcacagcg gggtgagagg gattcctaat cactcagagc agtctgtgac ttagtggaca 2520ggggaggggg caaaggggga ggagaagaaa atgttcttcc agttactttc caattctcct 2580ttagggacag cttagaatta tttgcactat tgagtcttca tgttcccact tcaaaacaaa 2640cagatgctct gagagcaaac tggcttgaat tggtgacatt tagtccctca agccaccaga 2700tgtgacagtg ttgagaacta cctggatttg tatatatacc tgcgcttgtt ttaaagtggg 2760ctcagcacat agggttccca cgaagctccg aaactctaag tgtttgctgc aattttataa 2820ggacttcctg attggtttct cttctcccct tccatttctg ccttttgttc atttcatcct 2880ttcacttctt tcccttcctc cgtcctcctc cttcctagtt catcccttct cttccaggca 2940gccgcggtgc ccaaccacac ttgtcggctc cagtccccag aactctgcct gccctttgtc 3000ctcctgctgc cagtaccagc cccaccctgt tttgagccct gaggaggcct tgggctctgc 3060tgagtccgac ctggcctgtc tgtgaagagc aagagagcag caaggtcttg ctctcctagg 3120tagccccctc ttccctggta agaaaaagca aaaggcattt cccaccctga acaacgagcc 3180ttttcaccct tctactctag agaagtggac tggaggagct gggcccgatt tggtagttga 3240ggaaagcaca gaggcctcct gtggcctgcc agtcatcgag tggcccaaca ggggctccat 3300gccagccgac cttgacctca ctcagaagtc cagagtctag cgtagtgcag cagggcagta 3360gcggtaccaa tgcagaactc ccaagacccg agctgggacc agtacctggg tccccagccc 3420ttcctctgct cccccttttc cctcggagtt cttcttgaat ggcaatgttt tgcttttgct 3480cgatgcagac agggggccag aacaccacac atttcactgt ctgtctggtc catagctgtg 3540gtgtaggggc ttagaggcat gggcttgctg tgggttttta attgatcagt tttcatgtgg 3600gatcccatct ttttaacctc tgttcaggaa gtccttatct agctgcatat cttcatcata 3660ttggtatatc cttttctgtg tttacagaga tgtctcttat atctaaatct gtccaactga 3720gaagtacctt atcaaagtag caaatgagac agcagtctta tgcttccaga aacacccaca 3780ggcatgtccc atgtgagctg ctgccatgaa ctgtcaagtg tgtgttgtct tgtgtatttc 3840agttattgtc cctggcttcc ttactatggt gtaatcatga aggagtgaaa catcatagaa 3900actgtctagc acttccttgc cagtctttag tgatcaggaa ccatagttga cagttccaat 3960cagtagctta agaaaaaacc gtgtttgtct cttctggaat ggttagaagt gagggagttt 4020gccccgttct gtttgtagag tctcatagtt ggactttcta gcatatatgt gtccatttcc 4080ttatgctgta aaagcaagtc ctgcaaccaa actcccatca gcccaatccc tgatccctga 4140tcccttccac ctgctctgct gatgaccccc ccagcttcac ttctgactct tccccaggaa 4200gggaaggggg gtcagaagag agggtgagtc ctccagaact cttcctccaa ggacagaagg 4260ctcctgcccc catagtggcc tcgaactcct ggcactacca aaggacactt atccacgaga 4320gcgcagcatc cgaccaggtt gtcactgaga agatgtttat tttggtcagt tgggttttta 4380tgtattatac ttagtcaaat gtaatgtggc ttctggaatc attgtccaga gctgcttccc 4440cgtcacctgg gcgtcatctg gtcctggtaa gaggagtgcg tggcccacca ggcccccctg 4500tcacccatga cagttcattc agggccgatg gggcagtcgt ggttgggaac acagcatttc 4560aagcgtcact ttatttcatt cgggccccac ctgcagctcc ctcaaagagg cagttgccca 4620gcctctttcc cttccagttt attccagagc tgccagtggg gcctgaggct ccttagggtt 4680ttctctctat ttcccccttt cttcctcatt ccctcgtctt tcccaaaggc atcacgagtc 4740agtcgccttt cagcaggcag ccttggcggt ttatcgccct ggcaggcagg ggccctgcag 4800ctctcatgct gcccctgcct tggggtcagg ttgacaggag gttggaggga aagccttaag 4860ctgcaggatt ctcaccagct gtgtccggcc cagttttggg gtgtgacctc aatttcaatt 4920ttgtctgtac ttgaacatta tgaagatggg ggcctctttc agtgaatttg tgaacagcag 4980aattgaccga cagctttcca gtacccatgg ggctaggtca ttaaggccac atccacagtc 5040tcccccaccc ttgttccagt tgttagttac tacctcctct cctgacaata ctgtatgtcg 5100tcgagctccc cccaggtcta cccctcccgg ccctgcctgc tggtgggctt gtcatagcca 5160gtgggattgc cggtcttgac agctcagtga gctggagata cttggtcaca gccaggcgct 5220agcacagctc ccttctgttg atgctgtatt cccatatcaa aagacacagg ggacacccag 5280aaacgccaca tcccccaatc catcagtgcc aaactagcca acggccccag cttctcagct 5340cgctggatgg cggaagctgc tactcgtgag cgccagtgcg ggtgcagaca atcttctgtt 5400gggtggcatc attccaggcc cgaagcatga acagtgcacc tgggacaggg agcagcccca 5460aattgtcacc tgcttctctg cccagctttt cattgctgtg acagtgatgg cgaaagaggg 5520taataaccag acacaaactg ccaagttggg tggagaaagg agtttcttta gctgacagaa 5580tctctgaatt ttaaatcact tagtaagcgg ctcaagccca ggagggagca gagggatacg 5640agcggagtcc cctgcgcggg accatctgga attggtttag cccaagtgga gcctgacagc 5700cagaactctg tgtcccccgt ctaaccacag ctccttttcc agagcattcc agtcaggctc 5760tctgggctga ctgggccagg ggaggttaca ggtaccagtt ctttaagaag atctttgggc 5820atatacattt ttagcctgtg tcattgcccc aaatggattc ctgtttcaag ttcacacctg 5880cagattctag gacctgtgtc ctagacttca gggagtcagc tgtttctaga gttcctacca 5940tggagtgggt ctggaggacc tgcccggtgg gggggcagag ccctgctccc tccgggtctt 6000cctactcttc tctctgctct gacgggattt gttgattctc tccattttgg tgtctttctc 6060ttttagatat tgtatcaatc tttagaaaag gcatagtcta cttgttataa atcgttagga 6120tactgcctcc cccagggtct aaaattacat attagagggg aaaagctgaa cactgaagtc 6180agttctcaac aatttagaag gaaaacctag aaaacatttg gcagaaaatt acatttcgat 6240gtttttgaat gaatacgagc aagcttttac aacagtgctg atctaaaaat acttagcact 6300tggcctgaga tgcctggtga gcattacagg caaggggaat ctggaggtag ccgacctgag 6360gacatggctt ctgaacctgt cttttgggag tggtatggaa ggtggagcgt tcaccagtga 6420cctggaaggc ccagcaccac cctccttccc actcttctca tcttgacaga gcctgcccca 6480gcgctgacgt gtcaggaaaa cacccaggga actaggaagg cacttctgcc tgaggggcag 6540cctgccttgc ccactcctgc tctgctcgcc tcggatcagc tgagccttct gagctggcct 6600ctcactgcct ccccaaggcc ccctgcctgc cctgtcagga ggcagaagga agcaggtgtg 6660agggcagtgc aaggagggag cacaaccccc agctcccgct ccgggctccg acttgtgcac 6720aggcagagcc cagaccctgg aggaaatcct acctttgaat tcaagaacat ttggggaatt 6780tggaaatctc tttgccccca aacccccatt ctgtcctacc tttaatcagg tcctgctcag 6840cagtgagagc agatgaggtg aaaaggccaa gaggtttggc tcctgcccac tgatagcccc 6900tctccccgca gtgtttgtgt gtcaagtggc aaagctgttc ttcctggtga ccctgattat 6960atccagtaac acatagactg tgcgcatagg cctgctttgt ctcctctatc ctgggctttt 7020gttttgcttt ttagttttgc ttttagtttt tctgtccctt ttatttaacg caccgactag 7080acacacaaag cagttgaatt tttatatata tatctgtata ttgcacaatt ataaactcat 7140tttgcttgtg gctccacaca cacaaaaaaa gacctgttaa aattatacct gttgcttaat 7200tacaatattt ctgataacca tagcatagga caagggaaaa taaaaaaaga aaaaaaagaa 7260aaaaaaacga caaatctgtc tgctggtcac ttcttctgtc caagcagatt cgtggtcttt 7320tcctcgcttc tttcaagggc tttcctgtgc caggtgaagg aggctccagg cagcacccag 7380gttttgcact cttgtttctc ccgtgcttgt gaaagaggtc ccaaggttct gggtgcagga 7440gcgctccctt gacctgctga agtccggaac gtagtcggca cagcctggtc gccttccacc 7500tctgggagct ggagtccact ggggtggcct gactccccca gtccccttcc cgtgacctgg 7560tcagggtgag cccatgtgga gtcagcctcg caggcctccc tgccagtagg gtccgagtgt 7620gtttcatcct tcccactctg tcgagcctgg gggctggagc ggagacggga ggcctggcct 7680gtctcggaac ctgtgagctg caccaggtag aacgccaggg accccagaat catgtgcgtc 7740agtccaaggg gtcccctcca ggagtagtga agactccaga aatgtccctt tcttctcccc 7800catcctacga gtaattgcat ttgcttttgt aattcttaat gagcaatatc tgctagagag 7860tttagctgta acagttcttt ttgatcatct ttttttaata attagaaaca ccaaaaaaat 7920ccagaaactt gttcttccaa agcagagagc attataatca ccagggccaa aagcttccct 7980ccctgctgtc attgcttctt ctgaggcctg aatccaaaag aaaaacagcc ataggccctt 8040tcagtggccg ggctacccgt gagcccttcg gaggaccagg gctggggcag cctctgggcc 8100cacatccggg gccagctccg gcgtgtgttc agtgttagca gtgggtcatg atgctctttc 8160ccacccagcc tgggataggg gcagaggagg cgaggaggcc gttgccgctg atgtttggcc 8220gtgaacaggt gggtgtctgc gtgcgtccac gtgcgtgttt tctgactgac atgaaatcga 8280cgcccgagtt agcctcaccc ggtgacctct agccctgccc ggatggagcg gggcccaccc 8340ggttcagtgt ttctggggag ctggacagtg gagtgcaaaa ggcttgcaga acttgaagcc 8400tgctccttcc cttgctacca cggcctcctt tccgtttgat ttgtcactgc ttcaatcaat 8460aacagccgct ccagagtcag tagtcaatga atatatgacc aaatatcacc aggactgtta 8520ctcaatgtgt gccgagccct tgcccatgct gggctcccgt gtatctggac actgtaacgt 8580gtgctgtgtt tgctcccctt ccccttcctt ctttgccctt tacttgtctt tctggggttt 8640ttctgtttgg gtttggtttg gtttttattt ctccttttgt gttccaaaca tgaggttctc 8700tctactggtc ctcttaactg tggtgttgag gcttatattt gtgtaatttt tggtgggtga 8760aaggaatttt gctaagtaaa tctcttctgt gtttgaactg aagtctgtat tgtaactatg 8820tttaaagtaa ttgttccaga gacaaatatt tctagacact ttttctttac aaacaaaagc 8880attcggaggg agggggatgg tgactgagat gagaggggag agctgaacag atgacccctg 8940cccagatcag ccagaagcca cccaaagcag tggagcccag gagtcccact ccaagccagc 9000aagccgaata gctgatgtgt tgccactttc caagtcactg caaaaccagg ttttgttccg 9060cccagtggat tcttgttttg cttcccctcc ccccgagatt attaccacca tcccgtgctt 9120ttaaggaaag gcaagattga tgtttccttg aggggagcca ggaggggatg tgtgtgtgca 9180gagctgaaga gctggggaga atggggctgg gcccacccaa gcaggaggct gggacgctct 9240gctgtgggca caggtcaggc taatgttggc agatgcagct cttcctggac aggccaggtg 9300gtgggcattc tctctccaag gtgtgccccg tgggcattac tgtttaagac acttccgtca 9360catcccaccc catcctccag ggctcaacac tgtgacatct ctattcccca ccctcccctt 9420cccagggcaa taaaatgacc atggaggggg cttgcactct cttggctgtc acccgatcgc 9480cagcaaaact tagatgtgag aaaacccctt cccattccat ggcgaaaaca tctccttaga 9540aaagccatta ccctcattag gcatggtttt gggctcccaa aacacctgac agcccctccc 9600tcctctgaga ggcggagagt gctgactgta gtgaccattg catgccgggt gcagcatctg 9660gaagagctag gcagggtgtc tgccccctcc tgagttgaag tcatgctccc ctgtgccagc 9720ccagaggccg agagctatgg acagcattgc cagtaacaca ggccaccctg tgcagaaggg 9780agctggctcc agcctggaaa cctgtctgag gttgggagag gtgcacttgg ggcacaggga 9840gaggccggga cacacttagc tggagatgtc tctaaaagcc ctgtatcgta ttcaccttca 9900gtttttgtgt tttgggacaa ttactttaga aaataagtag gtcgttttaa aaacaaaaat 9960tattgattgc ttttttgtag tgttcagaaa aaaggttctt tgtgtatagc caaatgactg 10020aaagcactga tatatttaaa aacaaaaggc aatttattaa ggaaatttgt accatttcag 10080taaacctgtc tgaatgtacc tgtatacgtt tcaaaaacac ccccccccca ctgaatccct

10140gtaacctatt tattatataa agagtttgcc ttataaattt 101802510191DNAHomo sapiens 25ccggaaaatg gccgccgccg ccgccgccgc cgccgccgcg ccgagcggag gaggaggagg 60aggcgaggag gagagactgc tccataaaaa tacagactca ccagttcctg ctttgatgtg 120acatgtgact ccccagaata caccttgctt ctgtagacca gctccaacag gattccatgg 180tagctgggat gttagggctc agggaagaaa agtcagaaga ccaggacctc cagggcctca 240aggacaaacc cctcaagttt aaaaaggtga agaaagataa gaaagaagag aaagagggca 300agcatgagcc cgtgcagcca tcagcccacc actctgctga gcccgcagag gcaggcaaag 360cagagacatc agaagggtca ggctccgccc cggctgtgcc ggaagcttct gcctccccca 420aacagcggcg ctccatcatc cgtgaccggg gacccatgta tgatgacccc accctgcctg 480aaggctggac acggaagctt aagcaaagga aatctggccg ctctgctggg aagtatgatg 540tgtatttgat caatccccag ggaaaagcct ttcgctctaa agtggagttg attgcgtact 600tcgaaaaggt aggcgacaca tccctggacc ctaatgattt tgacttcacg gtaactggga 660gagggagccc ctcccggcga gagcagaaac cacctaagaa gcccaaatct cccaaagctc 720caggaactgg cagaggccgg ggacgcccca aagggagcgg caccacgaga cccaaggcgg 780ccacgtcaga gggtgtgcag gtgaaaaggg tcctggagaa aagtcctggg aagctccttg 840tcaagatgcc ttttcaaact tcgccagggg gcaaggctga ggggggtggg gccaccacat 900ccacccaggt catggtgatc aaacgccccg gcaggaagcg aaaagctgag gccgaccctc 960aggccattcc caagaaacgg ggccgaaagc cggggagtgt ggtggcagcc gctgccgccg 1020aggccaaaaa gaaagccgtg aaggagtctt ctatccgatc tgtgcaggag accgtactcc 1080ccatcaagaa gcgcaagacc cgggagacgg tcagcatcga ggtcaaggaa gtggtgaagc 1140ccctgctggt gtccaccctc ggtgagaaga gcgggaaagg actgaagacc tgtaagagcc 1200ctgggcggaa aagcaaggag agcagcccca aggggcgcag cagcagcgcc tcctcacccc 1260ccaagaagga gcaccaccac catcaccacc actcagagtc cccaaaggcc cccgtgccac 1320tgctcccacc cctgccccca cctccacctg agcccgagag ctccgaggac cccaccagcc 1380cccctgagcc ccaggacttg agcagcagcg tctgcaaaga ggagaagatg cccagaggag 1440gctcactgga gagcgacggc tgccccaagg agccagctaa gactcagccc gcggttgcca 1500ccgccgccac ggccgcagaa aagtacaaac accgagggga gggagagcgc aaagacattg 1560tttcatcctc catgccaagg ccaaacagag aggagcctgt ggacagccgg acgcccgtga 1620ccgagagagt tagctgactt tacacggagc ggattgcaaa gcaaaccaac aagaataaag 1680gcagctgttg tctcttctcc ttatgggtag ggctctgaca aagcttcccg attaactgaa 1740ataaaaaata tttttttttc tttcagtaaa cttagagttt cgtggcttca gggtgggagt 1800agttggagca ttggggatgt ttttcttacc gacaagcaca gtcaggttga agacctaacc 1860agggccagaa gtagctttgc acttttctaa actaggctcc ttcaacaagg cttgctgcag 1920atactactga ccagacaagc tgttgaccag gcacctcccc tcccgcccaa acctttcccc 1980catgtggtcg ttagagacag agcgacagag cagttgagag gacactcccg ttttcggtgc 2040catcagtgcc ccgtctacag ctcccccagc tccccccacc tcccccactc ccaaccacgt 2100tgggacaggg aggtgtgagg caggagagac agttggattc tttagagaag atggatatga 2160ccagtggcta tggcctgtgc gatcccaccc gtggtggctc aagtctggcc ccacaccagc 2220cccaatccaa aactggcaag gacgcttcac aggacaggaa agtggcacct gtctgctcca 2280gctctggcat ggctaggagg ggggagtccc ttgaactact gggtgtagac tggcctgaac 2340cacaggagag gatggcccag ggtgaggtgg catggtccat tctcaaggga cgtcctccaa 2400cgggtggcgc tagaggccat ggaggcagta ggacaaggtg caggcaggct ggcctggggt 2460caggccgggc agagcacagc ggggtgagag ggattcctaa tcactcagag cagtctgtga 2520cttagtggac aggggagggg gcaaaggggg aggagaagaa aatgttcttc cagttacttt 2580ccaattctcc tttagggaca gcttagaatt atttgcacta ttgagtcttc atgttcccac 2640ttcaaaacaa acagatgctc tgagagcaaa ctggcttgaa ttggtgacat ttagtccctc 2700aagccaccag atgtgacagt gttgagaact acctggattt gtatatatac ctgcgcttgt 2760tttaaagtgg gctcagcaca tagggttccc acgaagctcc gaaactctaa gtgtttgctg 2820caattttata aggacttcct gattggtttc tcttctcccc ttccatttct gccttttgtt 2880catttcatcc tttcacttct ttcccttcct ccgtcctcct ccttcctagt tcatcccttc 2940tcttccaggc agccgcggtg cccaaccaca cttgtcggct ccagtcccca gaactctgcc 3000tgccctttgt cctcctgctg ccagtaccag ccccaccctg ttttgagccc tgaggaggcc 3060ttgggctctg ctgagtccga cctggcctgt ctgtgaagag caagagagca gcaaggtctt 3120gctctcctag gtagccccct cttccctggt aagaaaaagc aaaaggcatt tcccaccctg 3180aacaacgagc cttttcaccc ttctactcta gagaagtgga ctggaggagc tgggcccgat 3240ttggtagttg aggaaagcac agaggcctcc tgtggcctgc cagtcatcga gtggcccaac 3300aggggctcca tgccagccga ccttgacctc actcagaagt ccagagtcta gcgtagtgca 3360gcagggcagt agcggtacca atgcagaact cccaagaccc gagctgggac cagtacctgg 3420gtccccagcc cttcctctgc tccccctttt ccctcggagt tcttcttgaa tggcaatgtt 3480ttgcttttgc tcgatgcaga cagggggcca gaacaccaca catttcactg tctgtctggt 3540ccatagctgt ggtgtagggg cttagaggca tgggcttgct gtgggttttt aattgatcag 3600ttttcatgtg ggatcccatc tttttaacct ctgttcagga agtccttatc tagctgcata 3660tcttcatcat attggtatat ccttttctgt gtttacagag atgtctctta tatctaaatc 3720tgtccaactg agaagtacct tatcaaagta gcaaatgaga cagcagtctt atgcttccag 3780aaacacccac aggcatgtcc catgtgagct gctgccatga actgtcaagt gtgtgttgtc 3840ttgtgtattt cagttattgt ccctggcttc cttactatgg tgtaatcatg aaggagtgaa 3900acatcataga aactgtctag cacttccttg ccagtcttta gtgatcagga accatagttg 3960acagttccaa tcagtagctt aagaaaaaac cgtgtttgtc tcttctggaa tggttagaag 4020tgagggagtt tgccccgttc tgtttgtaga gtctcatagt tggactttct agcatatatg 4080tgtccatttc cttatgctgt aaaagcaagt cctgcaacca aactcccatc agcccaatcc 4140ctgatccctg atcccttcca cctgctctgc tgatgacccc cccagcttca cttctgactc 4200ttccccagga agggaagggg ggtcagaaga gagggtgagt cctccagaac tcttcctcca 4260aggacagaag gctcctgccc ccatagtggc ctcgaactcc tggcactacc aaaggacact 4320tatccacgag agcgcagcat ccgaccaggt tgtcactgag aagatgttta ttttggtcag 4380ttgggttttt atgtattata cttagtcaaa tgtaatgtgg cttctggaat cattgtccag 4440agctgcttcc ccgtcacctg ggcgtcatct ggtcctggta agaggagtgc gtggcccacc 4500aggcccccct gtcacccatg acagttcatt cagggccgat ggggcagtcg tggttgggaa 4560cacagcattt caagcgtcac tttatttcat tcgggcccca cctgcagctc cctcaaagag 4620gcagttgccc agcctctttc ccttccagtt tattccagag ctgccagtgg ggcctgaggc 4680tccttagggt tttctctcta tttccccctt tcttcctcat tccctcgtct ttcccaaagg 4740catcacgagt cagtcgcctt tcagcaggca gccttggcgg tttatcgccc tggcaggcag 4800gggccctgca gctctcatgc tgcccctgcc ttggggtcag gttgacagga ggttggaggg 4860aaagccttaa gctgcaggat tctcaccagc tgtgtccggc ccagttttgg ggtgtgacct 4920caatttcaat tttgtctgta cttgaacatt atgaagatgg gggcctcttt cagtgaattt 4980gtgaacagca gaattgaccg acagctttcc agtacccatg gggctaggtc attaaggcca 5040catccacagt ctcccccacc cttgttccag ttgttagtta ctacctcctc tcctgacaat 5100actgtatgtc gtcgagctcc ccccaggtct acccctcccg gccctgcctg ctggtgggct 5160tgtcatagcc agtgggattg ccggtcttga cagctcagtg agctggagat acttggtcac 5220agccaggcgc tagcacagct cccttctgtt gatgctgtat tcccatatca aaagacacag 5280gggacaccca gaaacgccac atcccccaat ccatcagtgc caaactagcc aacggcccca 5340gcttctcagc tcgctggatg gcggaagctg ctactcgtga gcgccagtgc gggtgcagac 5400aatcttctgt tgggtggcat cattccaggc ccgaagcatg aacagtgcac ctgggacagg 5460gagcagcccc aaattgtcac ctgcttctct gcccagcttt tcattgctgt gacagtgatg 5520gcgaaagagg gtaataacca gacacaaact gccaagttgg gtggagaaag gagtttcttt 5580agctgacaga atctctgaat tttaaatcac ttagtaagcg gctcaagccc aggagggagc 5640agagggatac gagcggagtc ccctgcgcgg gaccatctgg aattggttta gcccaagtgg 5700agcctgacag ccagaactct gtgtcccccg tctaaccaca gctccttttc cagagcattc 5760cagtcaggct ctctgggctg actgggccag gggaggttac aggtaccagt tctttaagaa 5820gatctttggg catatacatt tttagcctgt gtcattgccc caaatggatt cctgtttcaa 5880gttcacacct gcagattcta ggacctgtgt cctagacttc agggagtcag ctgtttctag 5940agttcctacc atggagtggg tctggaggac ctgcccggtg ggggggcaga gccctgctcc 6000ctccgggtct tcctactctt ctctctgctc tgacgggatt tgttgattct ctccattttg 6060gtgtctttct cttttagata ttgtatcaat ctttagaaaa ggcatagtct acttgttata 6120aatcgttagg atactgcctc ccccagggtc taaaattaca tattagaggg gaaaagctga 6180acactgaagt cagttctcaa caatttagaa ggaaaaccta gaaaacattt ggcagaaaat 6240tacatttcga tgtttttgaa tgaatacgag caagctttta caacagtgct gatctaaaaa 6300tacttagcac ttggcctgag atgcctggtg agcattacag gcaaggggaa tctggaggta 6360gccgacctga ggacatggct tctgaacctg tcttttggga gtggtatgga aggtggagcg 6420ttcaccagtg acctggaagg cccagcacca ccctccttcc cactcttctc atcttgacag 6480agcctgcccc agcgctgacg tgtcaggaaa acacccaggg aactaggaag gcacttctgc 6540ctgaggggca gcctgccttg cccactcctg ctctgctcgc ctcggatcag ctgagccttc 6600tgagctggcc tctcactgcc tccccaaggc cccctgcctg ccctgtcagg aggcagaagg 6660aagcaggtgt gagggcagtg caaggaggga gcacaacccc cagctcccgc tccgggctcc 6720gacttgtgca caggcagagc ccagaccctg gaggaaatcc tacctttgaa ttcaagaaca 6780tttggggaat ttggaaatct ctttgccccc aaacccccat tctgtcctac ctttaatcag 6840gtcctgctca gcagtgagag cagatgaggt gaaaaggcca agaggtttgg ctcctgccca 6900ctgatagccc ctctccccgc agtgtttgtg tgtcaagtgg caaagctgtt cttcctggtg 6960accctgatta tatccagtaa cacatagact gtgcgcatag gcctgctttg tctcctctat 7020cctgggcttt tgttttgctt tttagttttg cttttagttt ttctgtccct tttatttaac 7080gcaccgacta gacacacaaa gcagttgaat ttttatatat atatctgtat attgcacaat 7140tataaactca ttttgcttgt ggctccacac acacaaaaaa agacctgtta aaattatacc 7200tgttgcttaa ttacaatatt tctgataacc atagcatagg acaagggaaa ataaaaaaag 7260aaaaaaaaga aaaaaaaacg acaaatctgt ctgctggtca cttcttctgt ccaagcagat 7320tcgtggtctt ttcctcgctt ctttcaaggg ctttcctgtg ccaggtgaag gaggctccag 7380gcagcaccca ggttttgcac tcttgtttct cccgtgcttg tgaaagaggt cccaaggttc 7440tgggtgcagg agcgctccct tgacctgctg aagtccggaa cgtagtcggc acagcctggt 7500cgccttccac ctctgggagc tggagtccac tggggtggcc tgactccccc agtccccttc 7560ccgtgacctg gtcagggtga gcccatgtgg agtcagcctc gcaggcctcc ctgccagtag 7620ggtccgagtg tgtttcatcc ttcccactct gtcgagcctg ggggctggag cggagacggg 7680aggcctggcc tgtctcggaa cctgtgagct gcaccaggta gaacgccagg gaccccagaa 7740tcatgtgcgt cagtccaagg ggtcccctcc aggagtagtg aagactccag aaatgtccct 7800ttcttctccc ccatcctacg agtaattgca tttgcttttg taattcttaa tgagcaatat 7860ctgctagaga gtttagctgt aacagttctt tttgatcatc tttttttaat aattagaaac 7920accaaaaaaa tccagaaact tgttcttcca aagcagagag cattataatc accagggcca 7980aaagcttccc tccctgctgt cattgcttct tctgaggcct gaatccaaaa gaaaaacagc 8040cataggccct ttcagtggcc gggctacccg tgagcccttc ggaggaccag ggctggggca 8100gcctctgggc ccacatccgg ggccagctcc ggcgtgtgtt cagtgttagc agtgggtcat 8160gatgctcttt cccacccagc ctgggatagg ggcagaggag gcgaggaggc cgttgccgct 8220gatgtttggc cgtgaacagg tgggtgtctg cgtgcgtcca cgtgcgtgtt ttctgactga 8280catgaaatcg acgcccgagt tagcctcacc cggtgacctc tagccctgcc cggatggagc 8340ggggcccacc cggttcagtg tttctgggga gctggacagt ggagtgcaaa aggcttgcag 8400aacttgaagc ctgctccttc ccttgctacc acggcctcct ttccgtttga tttgtcactg 8460cttcaatcaa taacagccgc tccagagtca gtagtcaatg aatatatgac caaatatcac 8520caggactgtt actcaatgtg tgccgagccc ttgcccatgc tgggctcccg tgtatctgga 8580cactgtaacg tgtgctgtgt ttgctcccct tccccttcct tctttgccct ttacttgtct 8640ttctggggtt tttctgtttg ggtttggttt ggtttttatt tctccttttg tgttccaaac 8700atgaggttct ctctactggt cctcttaact gtggtgttga ggcttatatt tgtgtaattt 8760ttggtgggtg aaaggaattt tgctaagtaa atctcttctg tgtttgaact gaagtctgta 8820ttgtaactat gtttaaagta attgttccag agacaaatat ttctagacac tttttcttta 8880caaacaaaag cattcggagg gagggggatg gtgactgaga tgagagggga gagctgaaca 8940gatgacccct gcccagatca gccagaagcc acccaaagca gtggagccca ggagtcccac 9000tccaagccag caagccgaat agctgatgtg ttgccacttt ccaagtcact gcaaaaccag 9060gttttgttcc gcccagtgga ttcttgtttt gcttcccctc cccccgagat tattaccacc 9120atcccgtgct tttaaggaaa ggcaagattg atgtttcctt gaggggagcc aggaggggat 9180gtgtgtgtgc agagctgaag agctggggag aatggggctg ggcccaccca agcaggaggc 9240tgggacgctc tgctgtgggc acaggtcagg ctaatgttgg cagatgcagc tcttcctgga 9300caggccaggt ggtgggcatt ctctctccaa ggtgtgcccc gtgggcatta ctgtttaaga 9360cacttccgtc acatcccacc ccatcctcca gggctcaaca ctgtgacatc tctattcccc 9420accctcccct tcccagggca ataaaatgac catggagggg gcttgcactc tcttggctgt 9480cacccgatcg ccagcaaaac ttagatgtga gaaaacccct tcccattcca tggcgaaaac 9540atctccttag aaaagccatt accctcatta ggcatggttt tgggctccca aaacacctga 9600cagcccctcc ctcctctgag aggcggagag tgctgactgt agtgaccatt gcatgccggg 9660tgcagcatct ggaagagcta ggcagggtgt ctgccccctc ctgagttgaa gtcatgctcc 9720cctgtgccag cccagaggcc gagagctatg gacagcattg ccagtaacac aggccaccct 9780gtgcagaagg gagctggctc cagcctggaa acctgtctga ggttgggaga ggtgcacttg 9840gggcacaggg agaggccggg acacacttag ctggagatgt ctctaaaagc cctgtatcgt 9900attcaccttc agtttttgtg ttttgggaca attactttag aaaataagta ggtcgtttta 9960aaaacaaaaa ttattgattg cttttttgta gtgttcagaa aaaaggttct ttgtgtatag 10020ccaaatgact gaaagcactg atatatttaa aaacaaaagg caatttatta aggaaatttg 10080taccatttca gtaaacctgt ctgaatgtac ctgtatacgt ttcaaaaaca cccccccccc 10140actgaatccc tgtaacctat ttattatata aagagtttgc cttataaatt t 101912610179DNAHomo sapiens 26ccggaaaatg gccgccgccg ccgccgcgcc gagcggagga ggaggaggag gcgaggagga 60gagactgctc cataaaaata cagactcacc agttcctgct ttgatgtgac atgtgactcc 120ccagaataca ccttgcttct gtagaccagc tccaacagga ttccatggta gctgggatgt 180tagggctcag ggaagaaaag tcagaagacc aggacctcca gggcctcaag gacaaacccc 240tcaagtttaa aaaggtgaag aaagataaga aagaagagaa agagggcaag catgagcccg 300tgcagccatc agcccaccac tctgctgagc ccgcagaggc aggcaaagca gagacatcag 360aagggtcagg ctccgccccg gctgtgccgg aagcttctgc ctcccccaaa cagcggcgct 420ccatcatccg tgaccgggga cccatgtatg atgaccccac cctgcctgaa ggctggacac 480ggaagcttaa gcaaaggaaa tctggccgct ctgctgggaa gtatgatgtg tatttgatca 540atccccaggg aaaagccttt cgctctaaag tggagttgat tgcgtacttc gaaaaggtag 600gcgacacatc cctggaccct aatgattttg acttcacggt aactgggaga gggagcccct 660cccggcgaga gcagaaacca cctaagaagc ccaaatctcc caaagctcca ggaactggca 720gaggccgggg acgccccaaa gggagcggca ccacgagacc caaggcggcc acgtcagagg 780gtgtgcaggt gaaaagggtc ctggagaaaa gtcctgggaa gctccttgtc aagatgcctt 840ttcaaacttc gccagggggc aaggctgagg ggggtggggc caccacatcc acccaggtca 900tggtgatcaa acgccccggc aggaagcgaa aagctgaggc cgaccctcag gccattccca 960agaaacgggg ccgaaagccg gggagtgtgg tggcagccgc tgccgccgag gccaaaaaga 1020aagccgtgaa ggagtcttct atccgatctg tgcaggagac cgtactcccc atcaagaagc 1080gcaagacccg ggagacggtc agcatcgagg tcaaggaagt ggtgaagccc ctgctggtgt 1140ccaccctcgg tgagaagagc gggaaaggac tgaagacctg taagagccct gggcggaaaa 1200gcaaggagag cagccccaag gggcgcagca gcagcgcctc ctcacccccc aagaaggagc 1260accaccacca tcaccaccac tcagagtccc caaaggcccc cgtgccactg ctcccacccc 1320tgcccccacc tccacctgag cccgagagct ccgaggaccc caccagcccc cctgagcccc 1380aggacttgag cagcagcgtc tgcaaagagg agaagatgcc cagaggaggc tcactggaga 1440gcgacggctg ccccaaggag ccagctaaga ctcagcccgc ggttgccacc gccgccacgg 1500ccgcagaaaa gtacaaacac cgaggggagg gagagcgcaa agacattgtt tcatcctcca 1560tgccaaggcc aaacagagag gagcctgtgg acagccggac gcccgtgacc gagagagtta 1620gctgacttta cacggagcgg attgcaaagc aaaccaacaa gaataaaggc agctgttgtc 1680tcttctcctt atgggtaggg ctctgacaaa gcttcccgat taactgaaat aaaaaatatt 1740tttttttctt tcagtaaact tagagtttcg tggcttcagg gtgggagtag ttggagcatt 1800ggggatgttt ttcttaccga caagcacagt caggttgaag acctaaccag ggccagaagt 1860agctttgcac ttttctaaac taggctcctt caacaaggct tgctgcagat actactgacc 1920agacaagctg ttgaccaggc acctcccctc ccgcccaaac ctttccccca tgtggtcgtt 1980agagacagag cgacagagca gttgagagga cactcccgtt ttcggtgcca tcagtgcccc 2040gtctacagct cccccagctc cccccacctc ccccactccc aaccacgttg ggacagggag 2100gtgtgaggca ggagagacag ttggattctt tagagaagat ggatatgacc agtggctatg 2160gcctgtgcga tcccacccgt ggtggctcaa gtctggcccc acaccagccc caatccaaaa 2220ctggcaagga cgcttcacag gacaggaaag tggcacctgt ctgctccagc tctggcatgg 2280ctaggagggg ggagtccctt gaactactgg gtgtagactg gcctgaacca caggagagga 2340tggcccaggg tgaggtggca tggtccattc tcaagggacg tcctccaacg ggtggcgcta 2400gaggccatgg aggcagtagg acaaggtgca ggcaggctgg cctggggtca ggccgggcag 2460agcacagcgg ggtgagaggg attcctaatc actcagagca gtctgtgact tagtggacag 2520gggagggggc aaagggggag gagaagaaaa tgttcttcca gttactttcc aattctcctt 2580tagggacagc ttagaattat ttgcactatt gagtcttcat gttcccactt caaaacaaac 2640agatgctctg agagcaaact ggcttgaatt ggtgacattt agtccctcaa gccaccagat 2700gtgacagtgt tgagaactac ctggatttgt atatatacct gcgcttgttt taaagtgggc 2760tcagcacata gggttcccac gaagctccga aactctaagt gtttgctgca attttataag 2820gacttcctga ttggtttctc ttctcccctt ccatttctgc cttttgttca tttcatcctt 2880tcacttcttt cccttcctcc gtcctcctcc ttcctagttc atcccttctc ttccaggcag 2940ccgcggtgcc caaccacact tgtcggctcc agtccccaga actctgcctg ccctttgtcc 3000tcctgctgcc agtaccagcc ccaccctgtt ttgagccctg aggaggcctt gggctctgct 3060gagtccgacc tggcctgtct gtgaagagca agagagcagc aaggtcttgc tctcctaggt 3120agccccctct tccctggtaa gaaaaagcaa aaggcatttc ccaccctgaa caacgagcct 3180tttcaccctt ctactctaga gaagtggact ggaggagctg ggcccgattt ggtagttgag 3240gaaagcacag aggcctcctg tggcctgcca gtcatcgagt ggcccaacag gggctccatg 3300ccagccgacc ttgacctcac tcagaagtcc agagtctagc gtagtgcagc agggcagtag 3360cggtaccaat gcagaactcc caagacccga gctgggacca gtacctgggt ccccagccct 3420tcctctgctc ccccttttcc ctcggagttc ttcttgaatg gcaatgtttt gcttttgctc 3480gatgcagaca gggggccaga acaccacaca tttcactgtc tgtctggtcc atagctgtgg 3540tgtaggggct tagaggcatg ggcttgctgt gggtttttaa ttgatcagtt ttcatgtggg 3600atcccatctt tttaacctct gttcaggaag tccttatcta gctgcatatc ttcatcatat 3660tggtatatcc ttttctgtgt ttacagagat gtctcttata tctaaatctg tccaactgag 3720aagtacctta tcaaagtagc aaatgagaca gcagtcttat gcttccagaa acacccacag 3780gcatgtccca tgtgagctgc tgccatgaac tgtcaagtgt gtgttgtctt gtgtatttca 3840gttattgtcc ctggcttcct tactatggtg taatcatgaa ggagtgaaac atcatagaaa 3900ctgtctagca cttccttgcc agtctttagt gatcaggaac catagttgac agttccaatc 3960agtagcttaa gaaaaaaccg tgtttgtctc ttctggaatg gttagaagtg agggagtttg 4020ccccgttctg tttgtagagt ctcatagttg gactttctag catatatgtg tccatttcct 4080tatgctgtaa aagcaagtcc tgcaaccaaa ctcccatcag cccaatccct gatccctgat 4140cccttccacc tgctctgctg atgacccccc cagcttcact tctgactctt ccccaggaag 4200ggaagggggg tcagaagaga gggtgagtcc tccagaactc ttcctccaag gacagaaggc 4260tcctgccccc atagtggcct cgaactcctg gcactaccaa aggacactta tccacgagag 4320cgcagcatcc gaccaggttg tcactgagaa gatgtttatt ttggtcagtt gggtttttat 4380gtattatact tagtcaaatg taatgtggct tctggaatca ttgtccagag ctgcttcccc 4440gtcacctggg cgtcatctgg tcctggtaag aggagtgcgt ggcccaccag gcccccctgt 4500cacccatgac agttcattca gggccgatgg ggcagtcgtg gttgggaaca cagcatttca 4560agcgtcactt tatttcattc gggccccacc tgcagctccc tcaaagaggc agttgcccag 4620cctctttccc ttccagttta ttccagagct gccagtgggg cctgaggctc cttagggttt 4680tctctctatt tccccctttc ttcctcattc cctcgtcttt cccaaaggca tcacgagtca 4740gtcgcctttc

agcaggcagc cttggcggtt tatcgccctg gcaggcaggg gccctgcagc 4800tctcatgctg cccctgcctt ggggtcaggt tgacaggagg ttggagggaa agccttaagc 4860tgcaggattc tcaccagctg tgtccggccc agttttgggg tgtgacctca atttcaattt 4920tgtctgtact tgaacattat gaagatgggg gcctctttca gtgaatttgt gaacagcaga 4980attgaccgac agctttccag tacccatggg gctaggtcat taaggccaca tccacagtct 5040cccccaccct tgttccagtt gttagttact acctcctctc ctgacaatac tgtatgtcgt 5100cgagctcccc ccaggtctac ccctcccggc cctgcctgct ggtgggcttg tcatagccag 5160tgggattgcc ggtcttgaca gctcagtgag ctggagatac ttggtcacag ccaggcgcta 5220gcacagctcc cttctgttga tgctgtattc ccatatcaaa agacacaggg gacacccaga 5280aacgccacat cccccaatcc atcagtgcca aactagccaa cggccccagc ttctcagctc 5340gctggatggc ggaagctgct actcgtgagc gccagtgcgg gtgcagacaa tcttctgttg 5400ggtggcatca ttccaggccc gaagcatgaa cagtgcacct gggacaggga gcagccccaa 5460attgtcacct gcttctctgc ccagcttttc attgctgtga cagtgatggc gaaagagggt 5520aataaccaga cacaaactgc caagttgggt ggagaaagga gtttctttag ctgacagaat 5580ctctgaattt taaatcactt agtaagcggc tcaagcccag gagggagcag agggatacga 5640gcggagtccc ctgcgcggga ccatctggaa ttggtttagc ccaagtggag cctgacagcc 5700agaactctgt gtcccccgtc taaccacagc tccttttcca gagcattcca gtcaggctct 5760ctgggctgac tgggccaggg gaggttacag gtaccagttc tttaagaaga tctttgggca 5820tatacatttt tagcctgtgt cattgcccca aatggattcc tgtttcaagt tcacacctgc 5880agattctagg acctgtgtcc tagacttcag ggagtcagct gtttctagag ttcctaccat 5940ggagtgggtc tggaggacct gcccggtggg ggggcagagc cctgctccct ccgggtcttc 6000ctactcttct ctctgctctg acgggatttg ttgattctct ccattttggt gtctttctct 6060tttagatatt gtatcaatct ttagaaaagg catagtctac ttgttataaa tcgttaggat 6120actgcctccc ccagggtcta aaattacata ttagagggga aaagctgaac actgaagtca 6180gttctcaaca atttagaagg aaaacctaga aaacatttgg cagaaaatta catttcgatg 6240tttttgaatg aatacgagca agcttttaca acagtgctga tctaaaaata cttagcactt 6300ggcctgagat gcctggtgag cattacaggc aaggggaatc tggaggtagc cgacctgagg 6360acatggcttc tgaacctgtc ttttgggagt ggtatggaag gtggagcgtt caccagtgac 6420ctggaaggcc cagcaccacc ctccttccca ctcttctcat cttgacagag cctgccccag 6480cgctgacgtg tcaggaaaac acccagggaa ctaggaaggc acttctgcct gaggggcagc 6540ctgccttgcc cactcctgct ctgctcgcct cggatcagct gagccttctg agctggcctc 6600tcactgcctc cccaaggccc cctgcctgcc ctgtcaggag gcagaaggaa gcaggtgtga 6660gggcagtgca aggagggagc acaaccccca gctcccgctc cgggctccga cttgtgcaca 6720ggcagagccc agaccctgga ggaaatccta cctttgaatt caagaacatt tggggaattt 6780ggaaatctct ttgcccccaa acccccattc tgtcctacct ttaatcaggt cctgctcagc 6840agtgagagca gatgaggtga aaaggccaag aggtttggct cctgcccact gatagcccct 6900ctccccgcag tgtttgtgtg tcaagtggca aagctgttct tcctggtgac cctgattata 6960tccagtaaca catagactgt gcgcataggc ctgctttgtc tcctctatcc tgggcttttg 7020ttttgctttt tagttttgct tttagttttt ctgtcccttt tatttaacgc accgactaga 7080cacacaaagc agttgaattt ttatatatat atctgtatat tgcacaatta taaactcatt 7140ttgcttgtgg ctccacacac acaaaaaaag acctgttaaa attatacctg ttgcttaatt 7200acaatatttc tgataaccat agcataggac aagggaaaat aaaaaaagaa aaaaaagaaa 7260aaaaaacgac aaatctgtct gctggtcact tcttctgtcc aagcagattc gtggtctttt 7320cctcgcttct ttcaagggct ttcctgtgcc aggtgaagga ggctccaggc agcacccagg 7380ttttgcactc ttgtttctcc cgtgcttgtg aaagaggtcc caaggttctg ggtgcaggag 7440cgctcccttg acctgctgaa gtccggaacg tagtcggcac agcctggtcg ccttccacct 7500ctgggagctg gagtccactg gggtggcctg actcccccag tccccttccc gtgacctggt 7560cagggtgagc ccatgtggag tcagcctcgc aggcctccct gccagtaggg tccgagtgtg 7620tttcatcctt cccactctgt cgagcctggg ggctggagcg gagacgggag gcctggcctg 7680tctcggaacc tgtgagctgc accaggtaga acgccaggga ccccagaatc atgtgcgtca 7740gtccaagggg tcccctccag gagtagtgaa gactccagaa atgtcccttt cttctccccc 7800atcctacgag taattgcatt tgcttttgta attcttaatg agcaatatct gctagagagt 7860ttagctgtaa cagttctttt tgatcatctt tttttaataa ttagaaacac caaaaaaatc 7920cagaaacttg ttcttccaaa gcagagagca ttataatcac cagggccaaa agcttccctc 7980cctgctgtca ttgcttcttc tgaggcctga atccaaaaga aaaacagcca taggcccttt 8040cagtggccgg gctacccgtg agcccttcgg aggaccaggg ctggggcagc ctctgggccc 8100acatccgggg ccagctccgg cgtgtgttca gtgttagcag tgggtcatga tgctctttcc 8160cacccagcct gggatagggg cagaggaggc gaggaggccg ttgccgctga tgtttggccg 8220tgaacaggtg ggtgtctgcg tgcgtccacg tgcgtgtttt ctgactgaca tgaaatcgac 8280gcccgagtta gcctcacccg gtgacctcta gccctgcccg gatggagcgg ggcccacccg 8340gttcagtgtt tctggggagc tggacagtgg agtgcaaaag gcttgcagaa cttgaagcct 8400gctccttccc ttgctaccac ggcctccttt ccgtttgatt tgtcactgct tcaatcaata 8460acagccgctc cagagtcagt agtcaatgaa tatatgacca aatatcacca ggactgttac 8520tcaatgtgtg ccgagccctt gcccatgctg ggctcccgtg tatctggaca ctgtaacgtg 8580tgctgtgttt gctccccttc cccttccttc tttgcccttt acttgtcttt ctggggtttt 8640tctgtttggg tttggtttgg tttttatttc tccttttgtg ttccaaacat gaggttctct 8700ctactggtcc tcttaactgt ggtgttgagg cttatatttg tgtaattttt ggtgggtgaa 8760aggaattttg ctaagtaaat ctcttctgtg tttgaactga agtctgtatt gtaactatgt 8820ttaaagtaat tgttccagag acaaatattt ctagacactt tttctttaca aacaaaagca 8880ttcggaggga gggggatggt gactgagatg agaggggaga gctgaacaga tgacccctgc 8940ccagatcagc cagaagccac ccaaagcagt ggagcccagg agtcccactc caagccagca 9000agccgaatag ctgatgtgtt gccactttcc aagtcactgc aaaaccaggt tttgttccgc 9060ccagtggatt cttgttttgc ttcccctccc cccgagatta ttaccaccat cccgtgcttt 9120taaggaaagg caagattgat gtttccttga ggggagccag gaggggatgt gtgtgtgcag 9180agctgaagag ctggggagaa tggggctggg cccacccaag caggaggctg ggacgctctg 9240ctgtgggcac aggtcaggct aatgttggca gatgcagctc ttcctggaca ggccaggtgg 9300tgggcattct ctctccaagg tgtgccccgt gggcattact gtttaagaca cttccgtcac 9360atcccacccc atcctccagg gctcaacact gtgacatctc tattccccac cctccccttc 9420ccagggcaat aaaatgacca tggagggggc ttgcactctc ttggctgtca cccgatcgcc 9480agcaaaactt agatgtgaga aaaccccttc ccattccatg gcgaaaacat ctccttagaa 9540aagccattac cctcattagg catggttttg ggctcccaaa acacctgaca gcccctccct 9600cctctgagag gcggagagtg ctgactgtag tgaccattgc atgccgggtg cagcatctgg 9660aagagctagg cagggtgtct gccccctcct gagttgaagt catgctcccc tgtgccagcc 9720cagaggccga gagctatgga cagcattgcc agtaacacag gccaccctgt gcagaaggga 9780gctggctcca gcctggaaac ctgtctgagg ttgggagagg tgcacttggg gcacagggag 9840aggccgggac acacttagct ggagatgtct ctaaaagccc tgtatcgtat tcaccttcag 9900tttttgtgtt ttgggacaat tactttagaa aataagtagg tcgttttaaa aacaaaaatt 9960attgattgct tttttgtagt gttcagaaaa aaggttcttt gtgtatagcc aaatgactga 10020aagcactgat atatttaaaa acaaaaggca atttattaag gaaatttgta ccatttcagt 10080aaacctgtct gaatgtacct gtatacgttt caaaaacacc ccccccccac tgaatccctg 10140taacctattt attatataaa gagtttgcct tataaattt 101792710185DNAHomo sapiens 27ccggaaaatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggaggcga 60ggaggagaga ctgctccata aaaatacaga ctcaccagtt cctgctttga tgtgacatgt 120gactccccag aatacacctt gcttctgtag accagctcca acaggattcc atggtagctg 180ggatgttagg gctcagggaa gaaaagtcag aagaccagga cctccagggc ctcaaggaca 240aacccctcaa gtttaaaaag gtgaagaaag ataagaaaga agagaaagag ggcaagcatg 300agcccgtgca gccatcagcc caccactctg ctgagcccgc agaggcaggc aaagcagaga 360catcagaagg gtcaggctcc gccccggctg tgccggaagc ttctgcctcc cccaaacagc 420ggcgctccat catccgtgac cggggaccca tgtatgatga ccccaccctg cctgaaggct 480ggacacggaa gcttaagcaa aggaaatctg gccgctctgc tgggaagtat gatgtgtatt 540tgatcaatcc ccagggaaaa gcctttcgct ctaaagtgga gttgattgcg tacttcgaaa 600aggtaggcga cacatccctg gaccctaatg attttgactt cacggtaact gggagaggga 660gcccctcccg gcgagagcag aaaccaccta agaagcccaa atctcccaaa gctccaggaa 720ctggcagagg ccggggacgc cccaaaggga gcggcaccac gagacccaag gcggccacgt 780cagagggtgt gcaggtgaaa agggtcctgg agaaaagtcc tgggaagctc cttgtcaaga 840tgccttttca aacttcgcca gggggcaagg ctgagggggg tggggccacc acatccaccc 900aggtcatggt gatcaaacgc cccggcagga agcgaaaagc tgaggccgac cctcaggcca 960ttcccaagaa acggggccga aagccgggga gtgtggtggc agccgctgcc gccgaggcca 1020aaaagaaagc cgtgaaggag tcttctatcc gatctgtgca ggagaccgta ctccccatca 1080agaagcgcaa gacccgggag acggtcagca tcgaggtcaa ggaagtggtg aagcccctgc 1140tggtgtccac cctcggtgag aagagcggga aaggactgaa gacctgtaag agccctgggc 1200ggaaaagcaa ggagagcagc cccaaggggc gcagcagcag cgcctcctca ccccccaaga 1260aggagcacca ccaccatcac caccactcag agtccccaaa ggcccccgtg ccactgctcc 1320cacccctgcc cccacctcca cctgagcccg agagctccga ggaccccacc agcccccctg 1380agccccagga cttgagcagc agcgtctgca aagaggagaa gatgcccaga ggaggctcac 1440tggagagcga cggctgcccc aaggagccag ctaagactca gcccgcggtt gccaccgccg 1500ccacggccgc agaaaagtac aaacaccgag gggagggaga gcgcaaagac attgtttcat 1560cctccatgcc aaggccaaac agagaggagc ctgtggacag ccggacgccc gtgaccgaga 1620gagttagctg actttacacg gagcggattg caaagcaaac caacaagaat aaaggcagct 1680gttgtctctt ctccttatgg gtagggctct gacaaagctt cccgattaac tgaaataaaa 1740aatatttttt tttctttcag taaacttaga gtttcgtggc ttcagggtgg gagtagttgg 1800agcattgggg atgtttttct taccgacaag cacagtcagg ttgaagacct aaccagggcc 1860agaagtagct ttgcactttt ctaaactagg ctccttcaac aaggcttgct gcagatacta 1920ctgaccagac aagctgttga ccaggcacct cccctcccgc ccaaaccttt cccccatgtg 1980gtcgttagag acagagcgac agagcagttg agaggacact cccgttttcg gtgccatcag 2040tgccccgtct acagctcccc cagctccccc cacctccccc actcccaacc acgttgggac 2100agggaggtgt gaggcaggag agacagttgg attctttaga gaagatggat atgaccagtg 2160gctatggcct gtgcgatccc acccgtggtg gctcaagtct ggccccacac cagccccaat 2220ccaaaactgg caaggacgct tcacaggaca ggaaagtggc acctgtctgc tccagctctg 2280gcatggctag gaggggggag tcccttgaac tactgggtgt agactggcct gaaccacagg 2340agaggatggc ccagggtgag gtggcatggt ccattctcaa gggacgtcct ccaacgggtg 2400gcgctagagg ccatggaggc agtaggacaa ggtgcaggca ggctggcctg gggtcaggcc 2460gggcagagca cagcggggtg agagggattc ctaatcactc agagcagtct gtgacttagt 2520ggacagggga gggggcaaag ggggaggaga agaaaatgtt cttccagtta ctttccaatt 2580ctcctttagg gacagcttag aattatttgc actattgagt cttcatgttc ccacttcaaa 2640acaaacagat gctctgagag caaactggct tgaattggtg acatttagtc cctcaagcca 2700ccagatgtga cagtgttgag aactacctgg atttgtatat atacctgcgc ttgttttaaa 2760gtgggctcag cacatagggt tcccacgaag ctccgaaact ctaagtgttt gctgcaattt 2820tataaggact tcctgattgg tttctcttct ccccttccat ttctgccttt tgttcatttc 2880atcctttcac ttctttccct tcctccgtcc tcctccttcc tagttcatcc cttctcttcc 2940aggcagccgc ggtgcccaac cacacttgtc ggctccagtc cccagaactc tgcctgccct 3000ttgtcctcct gctgccagta ccagccccac cctgttttga gccctgagga ggccttgggc 3060tctgctgagt ccgacctggc ctgtctgtga agagcaagag agcagcaagg tcttgctctc 3120ctaggtagcc ccctcttccc tggtaagaaa aagcaaaagg catttcccac cctgaacaac 3180gagccttttc acccttctac tctagagaag tggactggag gagctgggcc cgatttggta 3240gttgaggaaa gcacagaggc ctcctgtggc ctgccagtca tcgagtggcc caacaggggc 3300tccatgccag ccgaccttga cctcactcag aagtccagag tctagcgtag tgcagcaggg 3360cagtagcggt accaatgcag aactcccaag acccgagctg ggaccagtac ctgggtcccc 3420agcccttcct ctgctccccc ttttccctcg gagttcttct tgaatggcaa tgttttgctt 3480ttgctcgatg cagacagggg gccagaacac cacacatttc actgtctgtc tggtccatag 3540ctgtggtgta ggggcttaga ggcatgggct tgctgtgggt ttttaattga tcagttttca 3600tgtgggatcc catcttttta acctctgttc aggaagtcct tatctagctg catatcttca 3660tcatattggt atatcctttt ctgtgtttac agagatgtct cttatatcta aatctgtcca 3720actgagaagt accttatcaa agtagcaaat gagacagcag tcttatgctt ccagaaacac 3780ccacaggcat gtcccatgtg agctgctgcc atgaactgtc aagtgtgtgt tgtcttgtgt 3840atttcagtta ttgtccctgg cttccttact atggtgtaat catgaaggag tgaaacatca 3900tagaaactgt ctagcacttc cttgccagtc tttagtgatc aggaaccata gttgacagtt 3960ccaatcagta gcttaagaaa aaaccgtgtt tgtctcttct ggaatggtta gaagtgaggg 4020agtttgcccc gttctgtttg tagagtctca tagttggact ttctagcata tatgtgtcca 4080tttccttatg ctgtaaaagc aagtcctgca accaaactcc catcagccca atccctgatc 4140cctgatccct tccacctgct ctgctgatga cccccccagc ttcacttctg actcttcccc 4200aggaagggaa ggggggtcag aagagagggt gagtcctcca gaactcttcc tccaaggaca 4260gaaggctcct gcccccatag tggcctcgaa ctcctggcac taccaaagga cacttatcca 4320cgagagcgca gcatccgacc aggttgtcac tgagaagatg tttattttgg tcagttgggt 4380ttttatgtat tatacttagt caaatgtaat gtggcttctg gaatcattgt ccagagctgc 4440ttccccgtca cctgggcgtc atctggtcct ggtaagagga gtgcgtggcc caccaggccc 4500ccctgtcacc catgacagtt cattcagggc cgatggggca gtcgtggttg ggaacacagc 4560atttcaagcg tcactttatt tcattcgggc cccacctgca gctccctcaa agaggcagtt 4620gcccagcctc tttcccttcc agtttattcc agagctgcca gtggggcctg aggctcctta 4680gggttttctc tctatttccc cctttcttcc tcattccctc gtctttccca aaggcatcac 4740gagtcagtcg cctttcagca ggcagccttg gcggtttatc gccctggcag gcaggggccc 4800tgcagctctc atgctgcccc tgccttgggg tcaggttgac aggaggttgg agggaaagcc 4860ttaagctgca ggattctcac cagctgtgtc cggcccagtt ttggggtgtg acctcaattt 4920caattttgtc tgtacttgaa cattatgaag atgggggcct ctttcagtga atttgtgaac 4980agcagaattg accgacagct ttccagtacc catggggcta ggtcattaag gccacatcca 5040cagtctcccc cacccttgtt ccagttgtta gttactacct cctctcctga caatactgta 5100tgtcgtcgag ctccccccag gtctacccct cccggccctg cctgctggtg ggcttgtcat 5160agccagtggg attgccggtc ttgacagctc agtgagctgg agatacttgg tcacagccag 5220gcgctagcac agctcccttc tgttgatgct gtattcccat atcaaaagac acaggggaca 5280cccagaaacg ccacatcccc caatccatca gtgccaaact agccaacggc cccagcttct 5340cagctcgctg gatggcggaa gctgctactc gtgagcgcca gtgcgggtgc agacaatctt 5400ctgttgggtg gcatcattcc aggcccgaag catgaacagt gcacctggga cagggagcag 5460ccccaaattg tcacctgctt ctctgcccag cttttcattg ctgtgacagt gatggcgaaa 5520gagggtaata accagacaca aactgccaag ttgggtggag aaaggagttt ctttagctga 5580cagaatctct gaattttaaa tcacttagta agcggctcaa gcccaggagg gagcagaggg 5640atacgagcgg agtcccctgc gcgggaccat ctggaattgg tttagcccaa gtggagcctg 5700acagccagaa ctctgtgtcc cccgtctaac cacagctcct tttccagagc attccagtca 5760ggctctctgg gctgactggg ccaggggagg ttacaggtac cagttcttta agaagatctt 5820tgggcatata catttttagc ctgtgtcatt gccccaaatg gattcctgtt tcaagttcac 5880acctgcagat tctaggacct gtgtcctaga cttcagggag tcagctgttt ctagagttcc 5940taccatggag tgggtctgga ggacctgccc ggtggggggg cagagccctg ctccctccgg 6000gtcttcctac tcttctctct gctctgacgg gatttgttga ttctctccat tttggtgtct 6060ttctctttta gatattgtat caatctttag aaaaggcata gtctacttgt tataaatcgt 6120taggatactg cctcccccag ggtctaaaat tacatattag aggggaaaag ctgaacactg 6180aagtcagttc tcaacaattt agaaggaaaa cctagaaaac atttggcaga aaattacatt 6240tcgatgtttt tgaatgaata cgagcaagct tttacaacag tgctgatcta aaaatactta 6300gcacttggcc tgagatgcct ggtgagcatt acaggcaagg ggaatctgga ggtagccgac 6360ctgaggacat ggcttctgaa cctgtctttt gggagtggta tggaaggtgg agcgttcacc 6420agtgacctgg aaggcccagc accaccctcc ttcccactct tctcatcttg acagagcctg 6480ccccagcgct gacgtgtcag gaaaacaccc agggaactag gaaggcactt ctgcctgagg 6540ggcagcctgc cttgcccact cctgctctgc tcgcctcgga tcagctgagc cttctgagct 6600ggcctctcac tgcctcccca aggccccctg cctgccctgt caggaggcag aaggaagcag 6660gtgtgagggc agtgcaagga gggagcacaa cccccagctc ccgctccggg ctccgacttg 6720tgcacaggca gagcccagac cctggaggaa atcctacctt tgaattcaag aacatttggg 6780gaatttggaa atctctttgc ccccaaaccc ccattctgtc ctacctttaa tcaggtcctg 6840ctcagcagtg agagcagatg aggtgaaaag gccaagaggt ttggctcctg cccactgata 6900gcccctctcc ccgcagtgtt tgtgtgtcaa gtggcaaagc tgttcttcct ggtgaccctg 6960attatatcca gtaacacata gactgtgcgc ataggcctgc tttgtctcct ctatcctggg 7020cttttgtttt gctttttagt tttgctttta gtttttctgt cccttttatt taacgcaccg 7080actagacaca caaagcagtt gaatttttat atatatatct gtatattgca caattataaa 7140ctcattttgc ttgtggctcc acacacacaa aaaaagacct gttaaaatta tacctgttgc 7200ttaattacaa tatttctgat aaccatagca taggacaagg gaaaataaaa aaagaaaaaa 7260aagaaaaaaa aacgacaaat ctgtctgctg gtcacttctt ctgtccaagc agattcgtgg 7320tcttttcctc gcttctttca agggctttcc tgtgccaggt gaaggaggct ccaggcagca 7380cccaggtttt gcactcttgt ttctcccgtg cttgtgaaag aggtcccaag gttctgggtg 7440caggagcgct cccttgacct gctgaagtcc ggaacgtagt cggcacagcc tggtcgcctt 7500ccacctctgg gagctggagt ccactggggt ggcctgactc ccccagtccc cttcccgtga 7560cctggtcagg gtgagcccat gtggagtcag cctcgcaggc ctccctgcca gtagggtccg 7620agtgtgtttc atccttccca ctctgtcgag cctgggggct ggagcggaga cgggaggcct 7680ggcctgtctc ggaacctgtg agctgcacca ggtagaacgc cagggacccc agaatcatgt 7740gcgtcagtcc aaggggtccc ctccaggagt agtgaagact ccagaaatgt ccctttcttc 7800tcccccatcc tacgagtaat tgcatttgct tttgtaattc ttaatgagca atatctgcta 7860gagagtttag ctgtaacagt tctttttgat catctttttt taataattag aaacaccaaa 7920aaaatccaga aacttgttct tccaaagcag agagcattat aatcaccagg gccaaaagct 7980tccctccctg ctgtcattgc ttcttctgag gcctgaatcc aaaagaaaaa cagccatagg 8040ccctttcagt ggccgggcta cccgtgagcc cttcggagga ccagggctgg ggcagcctct 8100gggcccacat ccggggccag ctccggcgtg tgttcagtgt tagcagtggg tcatgatgct 8160ctttcccacc cagcctggga taggggcaga ggaggcgagg aggccgttgc cgctgatgtt 8220tggccgtgaa caggtgggtg tctgcgtgcg tccacgtgcg tgttttctga ctgacatgaa 8280atcgacgccc gagttagcct cacccggtga cctctagccc tgcccggatg gagcggggcc 8340cacccggttc agtgtttctg gggagctgga cagtggagtg caaaaggctt gcagaacttg 8400aagcctgctc cttcccttgc taccacggcc tcctttccgt ttgatttgtc actgcttcaa 8460tcaataacag ccgctccaga gtcagtagtc aatgaatata tgaccaaata tcaccaggac 8520tgttactcaa tgtgtgccga gcccttgccc atgctgggct cccgtgtatc tggacactgt 8580aacgtgtgct gtgtttgctc cccttcccct tccttctttg ccctttactt gtctttctgg 8640ggtttttctg tttgggtttg gtttggtttt tatttctcct tttgtgttcc aaacatgagg 8700ttctctctac tggtcctctt aactgtggtg ttgaggctta tatttgtgta atttttggtg 8760ggtgaaagga attttgctaa gtaaatctct tctgtgtttg aactgaagtc tgtattgtaa 8820ctatgtttaa agtaattgtt ccagagacaa atatttctag acactttttc tttacaaaca 8880aaagcattcg gagggagggg gatggtgact gagatgagag gggagagctg aacagatgac 8940ccctgcccag atcagccaga agccacccaa agcagtggag cccaggagtc ccactccaag 9000ccagcaagcc gaatagctga tgtgttgcca ctttccaagt cactgcaaaa ccaggttttg 9060ttccgcccag tggattcttg ttttgcttcc cctccccccg agattattac caccatcccg 9120tgcttttaag gaaaggcaag attgatgttt ccttgagggg agccaggagg ggatgtgtgt 9180gtgcagagct gaagagctgg ggagaatggg gctgggccca cccaagcagg aggctgggac 9240gctctgctgt gggcacaggt caggctaatg ttggcagatg cagctcttcc tggacaggcc 9300aggtggtggg cattctctct ccaaggtgtg ccccgtgggc attactgttt aagacacttc 9360cgtcacatcc caccccatcc tccagggctc aacactgtga catctctatt ccccaccctc 9420cccttcccag ggcaataaaa tgaccatgga gggggcttgc actctcttgg ctgtcacccg 9480atcgccagca aaacttagat gtgagaaaac cccttcccat tccatggcga aaacatctcc 9540ttagaaaagc cattaccctc attaggcatg gttttgggct

cccaaaacac ctgacagccc 9600ctccctcctc tgagaggcgg agagtgctga ctgtagtgac cattgcatgc cgggtgcagc 9660atctggaaga gctaggcagg gtgtctgccc cctcctgagt tgaagtcatg ctcccctgtg 9720ccagcccaga ggccgagagc tatggacagc attgccagta acacaggcca ccctgtgcag 9780aagggagctg gctccagcct ggaaacctgt ctgaggttgg gagaggtgca cttggggcac 9840agggagaggc cgggacacac ttagctggag atgtctctaa aagccctgta tcgtattcac 9900cttcagtttt tgtgttttgg gacaattact ttagaaaata agtaggtcgt tttaaaaaca 9960aaaattattg attgcttttt tgtagtgttc agaaaaaagg ttctttgtgt atagccaaat 10020gactgaaagc actgatatat ttaaaaacaa aaggcaattt attaaggaaa tttgtaccat 10080ttcagtaaac ctgtctgaat gtacctgtat acgtttcaaa aacacccccc ccccactgaa 10140tccctgtaac ctatttatta tataaagagt ttgccttata aattt 101852810227DNAHomo sapiens 28gggcgcgcgc tccctcctct cggagagagg gctgtggtaa aagccgtccg gaaaatgcgc 60cgccgccgcc gccgcgccga gcggaggagg aggaggaggc gaggaggaga gactgctcca 120taaaaataca gactcaccag ttcctgcttt gatgtgacat gtgactcccc agaatacacc 180ttgcttctgt agaccagctc caacaggatt ccatggtagc tgggatgtta gggctcaggg 240aagaaaagtc agaagaccag gacctccagg gcctcaagga caaacccctc aagtttaaaa 300aggtgaagaa agataagaaa gaagagaaag agggcaagca tgagcccgtg cagccatcag 360cccaccactc tgctgagccc gcagaggcag gcaaagcaga gacatcagaa gggtcaggct 420ccgccccggc tgtgccggaa gcttctgcct cccccaaaca gcggcgctcc atcatccgtg 480accggggacc catgtatgat gaccccaccc tgcctgaagg ctggacacgg aagcttaagc 540aaaggaaatc tggccgctct gctgggaagt atgatgtgta tttgatcaat ccccagggaa 600aagcctttcg ctctaaagtg gagttgattg cgtacttcga aaaggtaggc gacacatccc 660tggaccctaa tgattttgac ttcacggtaa ctgggagagg gagcccctcc cggcgagagc 720agaaaccacc taagaagccc aaatctccca aagctccagg aactggcaga ggccggggac 780gccccaaagg gagcggcacc acgagaccca aggcggccac gtcagagggt gtgcaggtga 840aaagggtcct ggagaaaagt cctgggaagc tccttgtcaa gatgcctttt caaacttcgc 900cagggggcaa ggctgagggg ggtggggcca ccacatccac ccaggtcatg gtgatcaaac 960gccccggcag gaagcgaaaa gctgaggccg accctcaggc cattcccaag aaacggggcc 1020gaaagccggg gagtgtggtg gcagccgctg ccgccgaggc caaaaagaaa gccgtgaagg 1080agtcttctat ccgatctgtg caggagaccg tactccccat caagaagcgc aagacccggg 1140agacggtcag catcgaggtc aaggaagtgg tgaagcccct gctggtgtcc accctcggtg 1200agaagagcgg gaaaggactg aagacctgta agagccctgg gcggaaaagc aaggagagca 1260gccccaaggg gcgcagcagc agcgcctcct caccccccaa gaaggagcac caccaccatc 1320accaccactc agagtcccca aaggcccccg tgccactgct cccacccctg cccccacctc 1380cacctgagcc cgagagctcc gaggacccca ccagcccccc tgagccccag gacttgagca 1440gcagcgtctg caaagaggag aagatgccca gaggaggctc actggagagc gacggctgcc 1500ccaaggagcc agctaagact cagcccgcgg ttgccaccgc cgccacggcc gcagaaaagt 1560acaaacaccg aggggaggga gagcgcaaag acattgtttc atcctccatg ccaaggccaa 1620acagagagga gcctgtggac agccggacgc ccgtgaccga gagagttagc tgactttaca 1680cggagcggat tgcaaagcaa accaacaaga ataaaggcag ctgttgtctc ttctccttat 1740gggtagggct ctgacaaagc ttcccgatta actgaaataa aaaatatttt tttttctttc 1800agtaaactta gagtttcgtg gcttcagggt gggagtagtt ggagcattgg ggatgttttt 1860cttaccgaca agcacagtca ggttgaagac ctaaccaggg ccagaagtag ctttgcactt 1920ttctaaacta ggctccttca acaaggcttg ctgcagatac tactgaccag acaagctgtt 1980gaccaggcac ctcccctccc gcccaaacct ttcccccatg tggtcgttag agacagagcg 2040acagagcagt tgagaggaca ctcccgtttt cggtgccatc agtgccccgt ctacagctcc 2100cccagctccc cccacctccc ccactcccaa ccacgttggg acagggaggt gtgaggcagg 2160agagacagtt ggattcttta gagaagatgg atatgaccag tggctatggc ctgtgcgatc 2220ccacccgtgg tggctcaagt ctggccccac accagcccca atccaaaact ggcaaggacg 2280cttcacagga caggaaagtg gcacctgtct gctccagctc tggcatggct aggagggggg 2340agtcccttga actactgggt gtagactggc ctgaaccaca ggagaggatg gcccagggtg 2400aggtggcatg gtccattctc aagggacgtc ctccaacggg tggcgctaga ggccatggag 2460gcagtaggac aaggtgcagg caggctggcc tggggtcagg ccgggcagag cacagcgggg 2520tgagagggat tcctaatcac tcagagcagt ctgtgactta gtggacaggg gagggggcaa 2580agggggagga gaagaaaatg ttcttccagt tactttccaa ttctccttta gggacagctt 2640agaattattt gcactattga gtcttcatgt tcccacttca aaacaaacag atgctctgag 2700agcaaactgg cttgaattgg tgacatttag tccctcaagc caccagatgt gacagtgttg 2760agaactacct ggatttgtat atatacctgc gcttgtttta aagtgggctc agcacatagg 2820gttcccacga agctccgaaa ctctaagtgt ttgctgcaat tttataagga cttcctgatt 2880ggtttctctt ctccccttcc atttctgcct tttgttcatt tcatcctttc acttctttcc 2940cttcctccgt cctcctcctt cctagttcat cccttctctt ccaggcagcc gcggtgccca 3000accacacttg tcggctccag tccccagaac tctgcctgcc ctttgtcctc ctgctgccag 3060taccagcccc accctgtttt gagccctgag gaggccttgg gctctgctga gtccgacctg 3120gcctgtctgt gaagagcaag agagcagcaa ggtcttgctc tcctaggtag ccccctcttc 3180cctggtaaga aaaagcaaaa ggcatttccc accctgaaca acgagccttt tcacccttct 3240actctagaga agtggactgg aggagctggg cccgatttgg tagttgagga aagcacagag 3300gcctcctgtg gcctgccagt catcgagtgg cccaacaggg gctccatgcc agccgacctt 3360gacctcactc agaagtccag agtctagcgt agtgcagcag ggcagtagcg gtaccaatgc 3420agaactccca agacccgagc tgggaccagt acctgggtcc ccagcccttc ctctgctccc 3480ccttttccct cggagttctt cttgaatggc aatgttttgc ttttgctcga tgcagacagg 3540gggccagaac accacacatt tcactgtctg tctggtccat agctgtggtg taggggctta 3600gaggcatggg cttgctgtgg gtttttaatt gatcagtttt catgtgggat cccatctttt 3660taacctctgt tcaggaagtc cttatctagc tgcatatctt catcatattg gtatatcctt 3720ttctgtgttt acagagatgt ctcttatatc taaatctgtc caactgagaa gtaccttatc 3780aaagtagcaa atgagacagc agtcttatgc ttccagaaac acccacaggc atgtcccatg 3840tgagctgctg ccatgaactg tcaagtgtgt gttgtcttgt gtatttcagt tattgtccct 3900ggcttcctta ctatggtgta atcatgaagg agtgaaacat catagaaact gtctagcact 3960tccttgccag tctttagtga tcaggaacca tagttgacag ttccaatcag tagcttaaga 4020aaaaaccgtg tttgtctctt ctggaatggt tagaagtgag ggagtttgcc ccgttctgtt 4080tgtagagtct catagttgga ctttctagca tatatgtgtc catttcctta tgctgtaaaa 4140gcaagtcctg caaccaaact cccatcagcc caatccctga tccctgatcc cttccacctg 4200ctctgctgat gaccccccca gcttcacttc tgactcttcc ccaggaaggg aaggggggtc 4260agaagagagg gtgagtcctc cagaactctt cctccaagga cagaaggctc ctgcccccat 4320agtggcctcg aactcctggc actaccaaag gacacttatc cacgagagcg cagcatccga 4380ccaggttgtc actgagaaga tgtttatttt ggtcagttgg gtttttatgt attatactta 4440gtcaaatgta atgtggcttc tggaatcatt gtccagagct gcttccccgt cacctgggcg 4500tcatctggtc ctggtaagag gagtgcgtgg cccaccaggc ccccctgtca cccatgacag 4560ttcattcagg gccgatgggg cagtcgtggt tgggaacaca gcatttcaag cgtcacttta 4620tttcattcgg gccccacctg cagctccctc aaagaggcag ttgcccagcc tctttccctt 4680ccagtttatt ccagagctgc cagtggggcc tgaggctcct tagggttttc tctctatttc 4740cccctttctt cctcattccc tcgtctttcc caaaggcatc acgagtcagt cgcctttcag 4800caggcagcct tggcggttta tcgccctggc aggcaggggc cctgcagctc tcatgctgcc 4860cctgccttgg ggtcaggttg acaggaggtt ggagggaaag ccttaagctg caggattctc 4920accagctgtg tccggcccag ttttggggtg tgacctcaat ttcaattttg tctgtacttg 4980aacattatga agatgggggc ctctttcagt gaatttgtga acagcagaat tgaccgacag 5040ctttccagta cccatggggc taggtcatta aggccacatc cacagtctcc cccacccttg 5100ttccagttgt tagttactac ctcctctcct gacaatactg tatgtcgtcg agctcccccc 5160aggtctaccc ctcccggccc tgcctgctgg tgggcttgtc atagccagtg ggattgccgg 5220tcttgacagc tcagtgagct ggagatactt ggtcacagcc aggcgctagc acagctccct 5280tctgttgatg ctgtattccc atatcaaaag acacagggga cacccagaaa cgccacatcc 5340cccaatccat cagtgccaaa ctagccaacg gccccagctt ctcagctcgc tggatggcgg 5400aagctgctac tcgtgagcgc cagtgcgggt gcagacaatc ttctgttggg tggcatcatt 5460ccaggcccga agcatgaaca gtgcacctgg gacagggagc agccccaaat tgtcacctgc 5520ttctctgccc agcttttcat tgctgtgaca gtgatggcga aagagggtaa taaccagaca 5580caaactgcca agttgggtgg agaaaggagt ttctttagct gacagaatct ctgaatttta 5640aatcacttag taagcggctc aagcccagga gggagcagag ggatacgagc ggagtcccct 5700gcgcgggacc atctggaatt ggtttagccc aagtggagcc tgacagccag aactctgtgt 5760cccccgtcta accacagctc cttttccaga gcattccagt caggctctct gggctgactg 5820ggccagggga ggttacaggt accagttctt taagaagatc tttgggcata tacattttta 5880gcctgtgtca ttgccccaaa tggattcctg tttcaagttc acacctgcag attctaggac 5940ctgtgtccta gacttcaggg agtcagctgt ttctagagtt cctaccatgg agtgggtctg 6000gaggacctgc ccggtggggg ggcagagccc tgctccctcc gggtcttcct actcttctct 6060ctgctctgac gggatttgtt gattctctcc attttggtgt ctttctcttt tagatattgt 6120atcaatcttt agaaaaggca tagtctactt gttataaatc gttaggatac tgcctccccc 6180agggtctaaa attacatatt agaggggaaa agctgaacac tgaagtcagt tctcaacaat 6240ttagaaggaa aacctagaaa acatttggca gaaaattaca tttcgatgtt tttgaatgaa 6300tacgagcaag cttttacaac agtgctgatc taaaaatact tagcacttgg cctgagatgc 6360ctggtgagca ttacaggcaa ggggaatctg gaggtagccg acctgaggac atggcttctg 6420aacctgtctt ttgggagtgg tatggaaggt ggagcgttca ccagtgacct ggaaggccca 6480gcaccaccct ccttcccact cttctcatct tgacagagcc tgccccagcg ctgacgtgtc 6540aggaaaacac ccagggaact aggaaggcac ttctgcctga ggggcagcct gccttgccca 6600ctcctgctct gctcgcctcg gatcagctga gccttctgag ctggcctctc actgcctccc 6660caaggccccc tgcctgccct gtcaggaggc agaaggaagc aggtgtgagg gcagtgcaag 6720gagggagcac aacccccagc tcccgctccg ggctccgact tgtgcacagg cagagcccag 6780accctggagg aaatcctacc tttgaattca agaacatttg gggaatttgg aaatctcttt 6840gcccccaaac ccccattctg tcctaccttt aatcaggtcc tgctcagcag tgagagcaga 6900tgaggtgaaa aggccaagag gtttggctcc tgcccactga tagcccctct ccccgcagtg 6960tttgtgtgtc aagtggcaaa gctgttcttc ctggtgaccc tgattatatc cagtaacaca 7020tagactgtgc gcataggcct gctttgtctc ctctatcctg ggcttttgtt ttgcttttta 7080gttttgcttt tagtttttct gtccctttta tttaacgcac cgactagaca cacaaagcag 7140ttgaattttt atatatatat ctgtatattg cacaattata aactcatttt gcttgtggct 7200ccacacacac aaaaaaagac ctgttaaaat tatacctgtt gcttaattac aatatttctg 7260ataaccatag cataggacaa gggaaaataa aaaaagaaaa aaaagaaaaa aaaacgacaa 7320atctgtctgc tggtcacttc ttctgtccaa gcagattcgt ggtcttttcc tcgcttcttt 7380caagggcttt cctgtgccag gtgaaggagg ctccaggcag cacccaggtt ttgcactctt 7440gtttctcccg tgcttgtgaa agaggtccca aggttctggg tgcaggagcg ctcccttgac 7500ctgctgaagt ccggaacgta gtcggcacag cctggtcgcc ttccacctct gggagctgga 7560gtccactggg gtggcctgac tcccccagtc cccttcccgt gacctggtca gggtgagccc 7620atgtggagtc agcctcgcag gcctccctgc cagtagggtc cgagtgtgtt tcatccttcc 7680cactctgtcg agcctggggg ctggagcgga gacgggaggc ctggcctgtc tcggaacctg 7740tgagctgcac caggtagaac gccagggacc ccagaatcat gtgcgtcagt ccaaggggtc 7800ccctccagga gtagtgaaga ctccagaaat gtccctttct tctcccccat cctacgagta 7860attgcatttg cttttgtaat tcttaatgag caatatctgc tagagagttt agctgtaaca 7920gttctttttg atcatctttt tttaataatt agaaacacca aaaaaatcca gaaacttgtt 7980cttccaaagc agagagcatt ataatcacca gggccaaaag cttccctccc tgctgtcatt 8040gcttcttctg aggcctgaat ccaaaagaaa aacagccata ggccctttca gtggccgggc 8100tacccgtgag cccttcggag gaccagggct ggggcagcct ctgggcccac atccggggcc 8160agctccggcg tgtgttcagt gttagcagtg ggtcatgatg ctctttccca cccagcctgg 8220gataggggca gaggaggcga ggaggccgtt gccgctgatg tttggccgtg aacaggtggg 8280tgtctgcgtg cgtccacgtg cgtgttttct gactgacatg aaatcgacgc ccgagttagc 8340ctcacccggt gacctctagc cctgcccgga tggagcgggg cccacccggt tcagtgtttc 8400tggggagctg gacagtggag tgcaaaaggc ttgcagaact tgaagcctgc tccttccctt 8460gctaccacgg cctcctttcc gtttgatttg tcactgcttc aatcaataac agccgctcca 8520gagtcagtag tcaatgaata tatgaccaaa tatcaccagg actgttactc aatgtgtgcc 8580gagcccttgc ccatgctggg ctcccgtgta tctggacact gtaacgtgtg ctgtgtttgc 8640tccccttccc cttccttctt tgccctttac ttgtctttct ggggtttttc tgtttgggtt 8700tggtttggtt tttatttctc cttttgtgtt ccaaacatga ggttctctct actggtcctc 8760ttaactgtgg tgttgaggct tatatttgtg taatttttgg tgggtgaaag gaattttgct 8820aagtaaatct cttctgtgtt tgaactgaag tctgtattgt aactatgttt aaagtaattg 8880ttccagagac aaatatttct agacactttt tctttacaaa caaaagcatt cggagggagg 8940gggatggtga ctgagatgag aggggagagc tgaacagatg acccctgccc agatcagcca 9000gaagccaccc aaagcagtgg agcccaggag tcccactcca agccagcaag ccgaatagct 9060gatgtgttgc cactttccaa gtcactgcaa aaccaggttt tgttccgccc agtggattct 9120tgttttgctt cccctccccc cgagattatt accaccatcc cgtgctttta aggaaaggca 9180agattgatgt ttccttgagg ggagccagga ggggatgtgt gtgtgcagag ctgaagagct 9240ggggagaatg gggctgggcc cacccaagca ggaggctggg acgctctgct gtgggcacag 9300gtcaggctaa tgttggcaga tgcagctctt cctggacagg ccaggtggtg ggcattctct 9360ctccaaggtg tgccccgtgg gcattactgt ttaagacact tccgtcacat cccaccccat 9420cctccagggc tcaacactgt gacatctcta ttccccaccc tccccttccc agggcaataa 9480aatgaccatg gagggggctt gcactctctt ggctgtcacc cgatcgccag caaaacttag 9540atgtgagaaa accccttccc attccatggc gaaaacatct ccttagaaaa gccattaccc 9600tcattaggca tggttttggg ctcccaaaac acctgacagc ccctccctcc tctgagaggc 9660ggagagtgct gactgtagtg accattgcat gccgggtgca gcatctggaa gagctaggca 9720gggtgtctgc cccctcctga gttgaagtca tgctcccctg tgccagccca gaggccgaga 9780gctatggaca gcattgccag taacacaggc caccctgtgc agaagggagc tggctccagc 9840ctggaaacct gtctgaggtt gggagaggtg cacttggggc acagggagag gccgggacac 9900acttagctgg agatgtctct aaaagccctg tatcgtattc accttcagtt tttgtgtttt 9960gggacaatta ctttagaaaa taagtaggtc gttttaaaaa caaaaattat tgattgcttt 10020tttgtagtgt tcagaaaaaa ggttctttgt gtatagccaa atgactgaaa gcactgatat 10080atttaaaaac aaaaggcaat ttattaagga aatttgtacc atttcagtaa acctgtctga 10140atgtacctgt atacgtttca aaaacacccc ccccccactg aatccctgta acctatttat 10200tatataaaga gtttgcctta taaattt 102272910227DNAHomo sapiens 29gggcgcgcgc gctccctcct ctcggagagg gctgtggtaa aagccgtccg gaaaatggcc 60gccgccgccg ccgccgccga gcggaggagg aggaggaggc gaggaggaga gactgctcca 120taaaaataca gactcaccag ttcctgcttt gatgtgacat gtgactcccc agaatacacc 180ttgcttctgt agaccagctc caacaggatt ccatggtagc tgggatgtta gggctcaggg 240aagaaaagtc agaagaccag gacctccagg gcctcaagga caaacccctc aagtttaaaa 300aggtgaagaa agataagaaa gaagagaaag agggcaagca tgagcccgtg cagccatcag 360cccaccactc tgctgagccc gcagaggcag gcaaagcaga gacatcagaa gggtcaggct 420ccgccccggc tgtgccggaa gcttctgcct cccccaaaca gcggcgctcc atcatccgtg 480accggggacc catgtatgat gaccccaccc tgcctgaagg ctggacacgg aagcttaagc 540aaaggaaatc tggccgctct gctgggaagt atgatgtgta tttgatcaat ccccagggaa 600aagcctttcg ctctaaagtg gagttgattg cgtacttcga aaaggtaggc gacacatccc 660tggaccctaa tgattttgac ttcacggtaa ctgggagagg gagcccctcc cggcgagagc 720agaaaccacc taagaagccc aaatctccca aagctccagg aactggcaga ggccggggac 780gccccaaagg gagcggcacc acgagaccca aggcggccac gtcagagggt gtgcaggtga 840aaagggtcct ggagaaaagt cctgggaagc tccttgtcaa gatgcctttt caaacttcgc 900cagggggcaa ggctgagggg ggtggggcca ccacatccac ccaggtcatg gtgatcaaac 960gccccggcag gaagcgaaaa gctgaggccg accctcaggc cattcccaag aaacggggcc 1020gaaagccggg gagtgtggtg gcagccgctg ccgccgaggc caaaaagaaa gccgtgaagg 1080agtcttctat ccgatctgtg caggagaccg tactccccat caagaagcgc aagacccggg 1140agacggtcag catcgaggtc aaggaagtgg tgaagcccct gctggtgtcc accctcggtg 1200agaagagcgg gaaaggactg aagacctgta agagccctgg gcggaaaagc aaggagagca 1260gccccaaggg gcgcagcagc agcgcctcct caccccccaa gaaggagcac caccaccatc 1320accaccactc agagtcccca aaggcccccg tgccactgct cccacccctg cccccacctc 1380cacctgagcc cgagagctcc gaggacccca ccagcccccc tgagccccag gacttgagca 1440gcagcgtctg caaagaggag aagatgccca gaggaggctc actggagagc gacggctgcc 1500ccaaggagcc agctaagact cagcccgcgg ttgccaccgc cgccacggcc gcagaaaagt 1560acaaacaccg aggggaggga gagcgcaaag acattgtttc atcctccatg ccaaggccaa 1620acagagagga gcctgtggac agccggacgc ccgtgaccga gagagttagc tgactttaca 1680cggagcggat tgcaaagcaa accaacaaga ataaaggcag ctgttgtctc ttctccttat 1740gggtagggct ctgacaaagc ttcccgatta actgaaataa aaaatatttt tttttctttc 1800agtaaactta gagtttcgtg gcttcagggt gggagtagtt ggagcattgg ggatgttttt 1860cttaccgaca agcacagtca ggttgaagac ctaaccaggg ccagaagtag ctttgcactt 1920ttctaaacta ggctccttca acaaggcttg ctgcagatac tactgaccag acaagctgtt 1980gaccaggcac ctcccctccc gcccaaacct ttcccccatg tggtcgttag agacagagcg 2040acagagcagt tgagaggaca ctcccgtttt cggtgccatc agtgccccgt ctacagctcc 2100cccagctccc cccacctccc ccactcccaa ccacgttggg acagggaggt gtgaggcagg 2160agagacagtt ggattcttta gagaagatgg atatgaccag tggctatggc ctgtgcgatc 2220ccacccgtgg tggctcaagt ctggccccac accagcccca atccaaaact ggcaaggacg 2280cttcacagga caggaaagtg gcacctgtct gctccagctc tggcatggct aggagggggg 2340agtcccttga actactgggt gtagactggc ctgaaccaca ggagaggatg gcccagggtg 2400aggtggcatg gtccattctc aagggacgtc ctccaacggg tggcgctaga ggccatggag 2460gcagtaggac aaggtgcagg caggctggcc tggggtcagg ccgggcagag cacagcgggg 2520tgagagggat tcctaatcac tcagagcagt ctgtgactta gtggacaggg gagggggcaa 2580agggggagga gaagaaaatg ttcttccagt tactttccaa ttctccttta gggacagctt 2640agaattattt gcactattga gtcttcatgt tcccacttca aaacaaacag atgctctgag 2700agcaaactgg cttgaattgg tgacatttag tccctcaagc caccagatgt gacagtgttg 2760agaactacct ggatttgtat atatacctgc gcttgtttta aagtgggctc agcacatagg 2820gttcccacga agctccgaaa ctctaagtgt ttgctgcaat tttataagga cttcctgatt 2880ggtttctctt ctccccttcc atttctgcct tttgttcatt tcatcctttc acttctttcc 2940cttcctccgt cctcctcctt cctagttcat cccttctctt ccaggcagcc gcggtgccca 3000accacacttg tcggctccag tccccagaac tctgcctgcc ctttgtcctc ctgctgccag 3060taccagcccc accctgtttt gagccctgag gaggccttgg gctctgctga gtccgacctg 3120gcctgtctgt gaagagcaag agagcagcaa ggtcttgctc tcctaggtag ccccctcttc 3180cctggtaaga aaaagcaaaa ggcatttccc accctgaaca acgagccttt tcacccttct 3240actctagaga agtggactgg aggagctggg cccgatttgg tagttgagga aagcacagag 3300gcctcctgtg gcctgccagt catcgagtgg cccaacaggg gctccatgcc agccgacctt 3360gacctcactc agaagtccag agtctagcgt agtgcagcag ggcagtagcg gtaccaatgc 3420agaactccca agacccgagc tgggaccagt acctgggtcc ccagcccttc ctctgctccc 3480ccttttccct cggagttctt cttgaatggc aatgttttgc ttttgctcga tgcagacagg 3540gggccagaac accacacatt tcactgtctg tctggtccat agctgtggtg taggggctta 3600gaggcatggg cttgctgtgg gtttttaatt gatcagtttt catgtgggat cccatctttt 3660taacctctgt tcaggaagtc cttatctagc tgcatatctt catcatattg gtatatcctt 3720ttctgtgttt acagagatgt ctcttatatc taaatctgtc caactgagaa gtaccttatc 3780aaagtagcaa atgagacagc agtcttatgc ttccagaaac acccacaggc atgtcccatg 3840tgagctgctg ccatgaactg tcaagtgtgt gttgtcttgt gtatttcagt tattgtccct 3900ggcttcctta ctatggtgta atcatgaagg agtgaaacat catagaaact gtctagcact 3960tccttgccag tctttagtga tcaggaacca tagttgacag ttccaatcag tagcttaaga 4020aaaaaccgtg tttgtctctt ctggaatggt tagaagtgag ggagtttgcc ccgttctgtt 4080tgtagagtct catagttgga ctttctagca tatatgtgtc

catttcctta tgctgtaaaa 4140gcaagtcctg caaccaaact cccatcagcc caatccctga tccctgatcc cttccacctg 4200ctctgctgat gaccccccca gcttcacttc tgactcttcc ccaggaaggg aaggggggtc 4260agaagagagg gtgagtcctc cagaactctt cctccaagga cagaaggctc ctgcccccat 4320agtggcctcg aactcctggc actaccaaag gacacttatc cacgagagcg cagcatccga 4380ccaggttgtc actgagaaga tgtttatttt ggtcagttgg gtttttatgt attatactta 4440gtcaaatgta atgtggcttc tggaatcatt gtccagagct gcttccccgt cacctgggcg 4500tcatctggtc ctggtaagag gagtgcgtgg cccaccaggc ccccctgtca cccatgacag 4560ttcattcagg gccgatgggg cagtcgtggt tgggaacaca gcatttcaag cgtcacttta 4620tttcattcgg gccccacctg cagctccctc aaagaggcag ttgcccagcc tctttccctt 4680ccagtttatt ccagagctgc cagtggggcc tgaggctcct tagggttttc tctctatttc 4740cccctttctt cctcattccc tcgtctttcc caaaggcatc acgagtcagt cgcctttcag 4800caggcagcct tggcggttta tcgccctggc aggcaggggc cctgcagctc tcatgctgcc 4860cctgccttgg ggtcaggttg acaggaggtt ggagggaaag ccttaagctg caggattctc 4920accagctgtg tccggcccag ttttggggtg tgacctcaat ttcaattttg tctgtacttg 4980aacattatga agatgggggc ctctttcagt gaatttgtga acagcagaat tgaccgacag 5040ctttccagta cccatggggc taggtcatta aggccacatc cacagtctcc cccacccttg 5100ttccagttgt tagttactac ctcctctcct gacaatactg tatgtcgtcg agctcccccc 5160aggtctaccc ctcccggccc tgcctgctgg tgggcttgtc atagccagtg ggattgccgg 5220tcttgacagc tcagtgagct ggagatactt ggtcacagcc aggcgctagc acagctccct 5280tctgttgatg ctgtattccc atatcaaaag acacagggga cacccagaaa cgccacatcc 5340cccaatccat cagtgccaaa ctagccaacg gccccagctt ctcagctcgc tggatggcgg 5400aagctgctac tcgtgagcgc cagtgcgggt gcagacaatc ttctgttggg tggcatcatt 5460ccaggcccga agcatgaaca gtgcacctgg gacagggagc agccccaaat tgtcacctgc 5520ttctctgccc agcttttcat tgctgtgaca gtgatggcga aagagggtaa taaccagaca 5580caaactgcca agttgggtgg agaaaggagt ttctttagct gacagaatct ctgaatttta 5640aatcacttag taagcggctc aagcccagga gggagcagag ggatacgagc ggagtcccct 5700gcgcgggacc atctggaatt ggtttagccc aagtggagcc tgacagccag aactctgtgt 5760cccccgtcta accacagctc cttttccaga gcattccagt caggctctct gggctgactg 5820ggccagggga ggttacaggt accagttctt taagaagatc tttgggcata tacattttta 5880gcctgtgtca ttgccccaaa tggattcctg tttcaagttc acacctgcag attctaggac 5940ctgtgtccta gacttcaggg agtcagctgt ttctagagtt cctaccatgg agtgggtctg 6000gaggacctgc ccggtggggg ggcagagccc tgctccctcc gggtcttcct actcttctct 6060ctgctctgac gggatttgtt gattctctcc attttggtgt ctttctcttt tagatattgt 6120atcaatcttt agaaaaggca tagtctactt gttataaatc gttaggatac tgcctccccc 6180agggtctaaa attacatatt agaggggaaa agctgaacac tgaagtcagt tctcaacaat 6240ttagaaggaa aacctagaaa acatttggca gaaaattaca tttcgatgtt tttgaatgaa 6300tacgagcaag cttttacaac agtgctgatc taaaaatact tagcacttgg cctgagatgc 6360ctggtgagca ttacaggcaa ggggaatctg gaggtagccg acctgaggac atggcttctg 6420aacctgtctt ttgggagtgg tatggaaggt ggagcgttca ccagtgacct ggaaggccca 6480gcaccaccct ccttcccact cttctcatct tgacagagcc tgccccagcg ctgacgtgtc 6540aggaaaacac ccagggaact aggaaggcac ttctgcctga ggggcagcct gccttgccca 6600ctcctgctct gctcgcctcg gatcagctga gccttctgag ctggcctctc actgcctccc 6660caaggccccc tgcctgccct gtcaggaggc agaaggaagc aggtgtgagg gcagtgcaag 6720gagggagcac aacccccagc tcccgctccg ggctccgact tgtgcacagg cagagcccag 6780accctggagg aaatcctacc tttgaattca agaacatttg gggaatttgg aaatctcttt 6840gcccccaaac ccccattctg tcctaccttt aatcaggtcc tgctcagcag tgagagcaga 6900tgaggtgaaa aggccaagag gtttggctcc tgcccactga tagcccctct ccccgcagtg 6960tttgtgtgtc aagtggcaaa gctgttcttc ctggtgaccc tgattatatc cagtaacaca 7020tagactgtgc gcataggcct gctttgtctc ctctatcctg ggcttttgtt ttgcttttta 7080gttttgcttt tagtttttct gtccctttta tttaacgcac cgactagaca cacaaagcag 7140ttgaattttt atatatatat ctgtatattg cacaattata aactcatttt gcttgtggct 7200ccacacacac aaaaaaagac ctgttaaaat tatacctgtt gcttaattac aatatttctg 7260ataaccatag cataggacaa gggaaaataa aaaaagaaaa aaaagaaaaa aaaacgacaa 7320atctgtctgc tggtcacttc ttctgtccaa gcagattcgt ggtcttttcc tcgcttcttt 7380caagggcttt cctgtgccag gtgaaggagg ctccaggcag cacccaggtt ttgcactctt 7440gtttctcccg tgcttgtgaa agaggtccca aggttctggg tgcaggagcg ctcccttgac 7500ctgctgaagt ccggaacgta gtcggcacag cctggtcgcc ttccacctct gggagctgga 7560gtccactggg gtggcctgac tcccccagtc cccttcccgt gacctggtca gggtgagccc 7620atgtggagtc agcctcgcag gcctccctgc cagtagggtc cgagtgtgtt tcatccttcc 7680cactctgtcg agcctggggg ctggagcgga gacgggaggc ctggcctgtc tcggaacctg 7740tgagctgcac caggtagaac gccagggacc ccagaatcat gtgcgtcagt ccaaggggtc 7800ccctccagga gtagtgaaga ctccagaaat gtccctttct tctcccccat cctacgagta 7860attgcatttg cttttgtaat tcttaatgag caatatctgc tagagagttt agctgtaaca 7920gttctttttg atcatctttt tttaataatt agaaacacca aaaaaatcca gaaacttgtt 7980cttccaaagc agagagcatt ataatcacca gggccaaaag cttccctccc tgctgtcatt 8040gcttcttctg aggcctgaat ccaaaagaaa aacagccata ggccctttca gtggccgggc 8100tacccgtgag cccttcggag gaccagggct ggggcagcct ctgggcccac atccggggcc 8160agctccggcg tgtgttcagt gttagcagtg ggtcatgatg ctctttccca cccagcctgg 8220gataggggca gaggaggcga ggaggccgtt gccgctgatg tttggccgtg aacaggtggg 8280tgtctgcgtg cgtccacgtg cgtgttttct gactgacatg aaatcgacgc ccgagttagc 8340ctcacccggt gacctctagc cctgcccgga tggagcgggg cccacccggt tcagtgtttc 8400tggggagctg gacagtggag tgcaaaaggc ttgcagaact tgaagcctgc tccttccctt 8460gctaccacgg cctcctttcc gtttgatttg tcactgcttc aatcaataac agccgctcca 8520gagtcagtag tcaatgaata tatgaccaaa tatcaccagg actgttactc aatgtgtgcc 8580gagcccttgc ccatgctggg ctcccgtgta tctggacact gtaacgtgtg ctgtgtttgc 8640tccccttccc cttccttctt tgccctttac ttgtctttct ggggtttttc tgtttgggtt 8700tggtttggtt tttatttctc cttttgtgtt ccaaacatga ggttctctct actggtcctc 8760ttaactgtgg tgttgaggct tatatttgtg taatttttgg tgggtgaaag gaattttgct 8820aagtaaatct cttctgtgtt tgaactgaag tctgtattgt aactatgttt aaagtaattg 8880ttccagagac aaatatttct agacactttt tctttacaaa caaaagcatt cggagggagg 8940gggatggtga ctgagatgag aggggagagc tgaacagatg acccctgccc agatcagcca 9000gaagccaccc aaagcagtgg agcccaggag tcccactcca agccagcaag ccgaatagct 9060gatgtgttgc cactttccaa gtcactgcaa aaccaggttt tgttccgccc agtggattct 9120tgttttgctt cccctccccc cgagattatt accaccatcc cgtgctttta aggaaaggca 9180agattgatgt ttccttgagg ggagccagga ggggatgtgt gtgtgcagag ctgaagagct 9240ggggagaatg gggctgggcc cacccaagca ggaggctggg acgctctgct gtgggcacag 9300gtcaggctaa tgttggcaga tgcagctctt cctggacagg ccaggtggtg ggcattctct 9360ctccaaggtg tgccccgtgg gcattactgt ttaagacact tccgtcacat cccaccccat 9420cctccagggc tcaacactgt gacatctcta ttccccaccc tccccttccc agggcaataa 9480aatgaccatg gagggggctt gcactctctt ggctgtcacc cgatcgccag caaaacttag 9540atgtgagaaa accccttccc attccatggc gaaaacatct ccttagaaaa gccattaccc 9600tcattaggca tggttttggg ctcccaaaac acctgacagc ccctccctcc tctgagaggc 9660ggagagtgct gactgtagtg accattgcat gccgggtgca gcatctggaa gagctaggca 9720gggtgtctgc cccctcctga gttgaagtca tgctcccctg tgccagccca gaggccgaga 9780gctatggaca gcattgccag taacacaggc caccctgtgc agaagggagc tggctccagc 9840ctggaaacct gtctgaggtt gggagaggtg cacttggggc acagggagag gccgggacac 9900acttagctgg agatgtctct aaaagccctg tatcgtattc accttcagtt tttgtgtttt 9960gggacaatta ctttagaaaa taagtaggtc gttttaaaaa caaaaattat tgattgcttt 10020tttgtagtgt tcagaaaaaa ggttctttgt gtatagccaa atgactgaaa gcactgatat 10080atttaaaaac aaaaggcaat ttattaagga aatttgtacc atttcagtaa acctgtctga 10140atgtacctgt atacgtttca aaaacacccc ccccccactg aatccctgta acctatttat 10200tatataaaga gtttgcctta taaattt 10227



User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
New patent applications in this class:
DateTitle
2022-09-22Electronic device
2022-09-22Front-facing proximity detection using capacitive sensor
2022-09-22Touch-control panel and touch-control display apparatus
2022-09-22Sensing circuit with signal compensation
2022-09-22Reduced-size interfaces for managing alerts
Website © 2025 Advameg, Inc.