FUSION PEPTIDES OF CD4 HELPER T CELL EPITOPES AND VACCINES THEREOF

Abstract

Disclosed are a fusion peptide of CD4 helper T cell epitopes, a nucleic acid encoding the same and an immunogenic composition comprising the same. The epitope fusion peptide comprises a cytomegalovirus epitope and an influenza virus epitope. The epitope fusion peptide can substantially improve the level of cellular immune response to a target immunogen, particularly a weak immunogen, and is an effective means for overcoming the immune tolerance of immune system to an antigen, particularly to a tumor antigen or an infection-related antigen, and is suitable for efficiently enhancing the efficacy of vaccine.

Description

TECHNICAL FIELD

[0001] The present invention belongs to the fields of molecular biology and immunology. In particular, the present invention relates to a fusion peptide of CD4 helper T cell epitopes, especially to a vaccine comprising the epitope fusion peptide, and use thereof.

BACKGROUND ART

[0002] T helper cells (Th cells) are the cells that play an important role in the immune system, particularly in the adaptive immune system. They promote the activities of other immune cells by releasing T cell cytokines. These cells help to inhibit or modulate immune responses. They are essential in the conversion of B cell antibody classes, the activation and growth of cytotoxic T cells, and the maximization of bactericidal activity of phagocytic cells, such as macrophages.

[0003] Mature Th cells expressing the protein CD4 are known as CD4.sup.+ T cells. As helper T cells, such CD4.sup.+ T cells are typically subjected to a pre-defined process within the immune system. For example, when antigen presenting cells express an antigen on MHC class II, CD4.sup.+ cells would assist these cells by a combination of cell-to-cell interactions (e.g., CD40 (protein) and CD40L) and cytokines.

[0004] The importance of helper T cells can be seen with respect to HIV, a virus that primarily infects CD4.sup.+ T cells. In the late stage of HIV infection, loss of functional CD4.sup.+ T cells leads to a stage of infectious symptoms known as acquired immune deficiency syndrome (AIDS). When HIV virus is found early in blood or other body fluids, a continuous treatment may delay its occurrence. If AIDS occurs, the treatment can also better manage the course of AIDS. Other rare diseases, such as lymphopenia, result in loss or dysfunction of CD4.sup.+ T cells. These diseases produce similar symptoms, many of which are thtal.

[0005] Antigenic epitope, "epitope" for short, also known as "antigenic determinant", refers to chemical groups on the surface of an antigen that determines the antigen specificity. An antigenic epitope can be recognized by the immune system, especially by antibodies, B cells or cells. A site of an antibody capable of recognizing an antigenic epitope is referred to as a "paratope" or an "antibody determinant". Although an antigenic epitope usually refers to a part of foreign protein or the like, an epitope that can be recognized by the autoimmune system is also classified as an antigenic epitope.

[0006] The epitopes of protein antigen are divided into conformational epitopes and linear epitopes according to their structures and interactions with a paratope. Since a conformational epitope consists of discrete portions in the amino acid sequence of an antigen, the interaction of a paratope with the antigenic epitope is based on the three-dimensional characteristics and shape of the surface or tertiary structure of the antigen. Most antigenic epitopes belong to conformational epitopes. In contrast, a linear epitope consists of a continuous amino acid sequence of an antigen, and the interaction with the antigen is based on its primary structure.

[0007] A T cell epitope consists mainly of a short peptide of 8-17 amino acids and exists on antigen-presenting cells (APC), which as an antigen epitope would bind to major histocompatibility complex (MHC) to form a complex and bind to the corresponding T cell epitope receptors, thereby activating T cells and generating a corresponding cellular immune response (Shimonikevitz et al., 1984; Babbitt et al., 1985; Buus et al., 1986; Townsend and Bodmer, 1989). There are two major classes of MHC molecules which bind to an epitope. Among them, major histocompatibility complex class I usually presents a T cell antigenic epitope consisting of a polypeptide of 8 to 11 amino acids in length, while major histocompatibility complex class 11 presents a relatively longer I cell antigenic epitope consisting of 13-1.7 amino acids.

[0008] Among T cell epitopes, helper T cell epitopes (Th epitopes) refer to a class of T cell epitopes which bind to MHC molecules and form complexes that can be recognized by CD4 helper T cell receptors. Th epitopes bind primarily to the molecules present on the surfaces of antigen-presenting cells (APC) encoded by MHC class II genes. The complexes of class II molecule and peptide epitope are then recognized by the specific T cell receptors (TCR) on the surfaces of T helper lymphocytes. In this way, the T cells presenting an antigenic epitope in the context of MHC molecules can be activated and provide the essential signal for B lymphocyte differentiation. Traditionally, the source of T-helper epitope of peptide immunogen has been a carrier protein covalently coupled to a peptide, but the coupling process may involve other issues, such as modification of antigenic determinants during the coupling process and induction of an antibody against the carrier at the expense of an antibody against the peptide (Schutze, M. P., Leclerc, C. Jolivet, M. Audibert, F. Chedid, L. Carrier-induced epitopic suppression, a major issue for future synthetic vaccines. J Immunol. 1985, 135, 2319-2322; DiJohn, D., Torrese, J. R. Murillo, J. Herrington, D. A. et al. Effect of priming with carrier on response to conjugate vaccine. The Lancet. 1989, 2, 1415-1416). In addition, the use of an irrelevant protein in the preparation may involve quality control problems. The choice of a suitable carrier protein, which is important in the design of peptide vaccine, is limited by the factors, such as toxicity and feasibility in a large-scale production. There are other limitations to this method, including the load size of peptide that can be coupled and the dose of carrier that can be safely administered (Audibert, F. a. C., L. 1984. Modern approaches to vaccines. Molecular and chemical basis of virus virulence and immunogenicity., Cold Spring Harbor Laboratory, New York.). Although carrier molecules allow to induce a strong immune response, they are also associated with the adverse effects, such as inhibition of anti-peptide antibody response (Herzenberg, L. A. and Tokuhisa, T. 1980. Carrier-priming leads to hapten-specific suppression. Nature 285: 664; Schutze, M. P., Leclerc, C., Jolivet, M. Audibert, F., and Chedid, L. 1985. Carrier-induced epitopic suppression, a major issue for future synthetic vaccines. J Immunol 135: 2319; Edinger, H. M., Felix, A. M., Gillessen, D., Heimer, E. P., Just, M., Pink, J. R., Sinigaglia, F., Sturchler, D., Takacs, B., Trzeciak, A., and et al., 1988. Assessment in humans of a synthetic peptide-based vaccine against the sporozoite stage of the human malaria parasite, Plasmodium falciparum. J Immunol 140: 626).

[0009] In general, an immunogen must contain a helper T cell epitope in addition to an epitope to be recognized by a surface Ig or the receptors present on the cytotoxic T cells. It will be appreciated that these types of epitopes may be very different. For B-cell epitopes, the conformation is important because B-cell receptors bind directly to native immunogens. In contrast, an epitope to be recognized by T cells is independent of the conformational integrity of the epitope, and consists of a short sequence of about 9 amino acids against CTL and a slightly longer sequence (having less length restriction) against helper T cells. The only requirement for these epitopes is that they can be accommodated in the binding clefts of class I or class II molecules, respectively, and the complexes can then bind to T cell receptors. The binding sites of class II molecules are open at both ends, allowing a greater variation in the length of a peptide (Brown, J. H., T. S. Jardetzky, J. C. Gorga, L. J. Stern, R. G. Urban, J. L. Strominger and D. C. Wiley. 1993. Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 364: 33) that binds to a reported epitope of as short as 8 amino acid residues (Fahrer, A. M., Geysen, H. M., White, D. O., Jackson, D. C. and Brown, L. E. Analysis of the requirements for class IT-restricted T-cell recognition of a single determinant reveals considerable diversity in the T-cell response and degeneracy of peptide binding to HEd J. Immunol. 1995. 155: 2849-2857).

[0010] A Th epitope can stimulate and activate helper `I` cells, and accordingly promote activation of CD8 T cells and B cells, ultimately increasing the immune response. In essence, a Th epitope, in addition to being able to activate an immune response against itself, is also effective in aiding the immune response to other antigens or epitopes associated therewith. Thus, a heterologous strong Th epitope can be fused to a target immunogen, thereby increasing the immunogenicity of the target immunogen. An artificial strong Th epitope called PADRE (pan HLA DR-binding Epitope) has been used in the fusion construction of multiple vaccines to increase the levels of immune responses to the relevant immunogens (del Guercio et al,, Vaccine, 1997, 15: 441.; Franke, E. D. et al., Vaccine, 1999, 17:1201; Jeff Alexander et al., J Immunol, 2000, 164 (3) 1625-1633; Jeff Alexander et al., Vaccine, 2004, 22: 2362.; La Rosa, Corinna et al., The Journal of infectious diseases, 2012, 205: 1294-304). In addition, as a strong Th epitope derived from tetanus toxin, P2 is also commonly used in coupling with a target immunogen to enhance the immunogenicity (Panina-Bordignon P et al., Eur J Immunol, 1989, 19: 2237-42; La Rosa, Corinna et al., The Journal of infectious diseases, 2012, 205: 1294-304).

[0011] In general, however, a Th epitope used to increase the immunogenicity is usually heterologous. In other words, a high level of immune response against the Th epitope itself will not be produced in a vaccine subject. Thus, when a vaccine subject is vaccinated with a strong Th epitope as described above, it is likely that the immune system of vaccine subject is initially exposed to such a Th epitope, the activations against both such a Th epitope and a target immunogen in the recipient immune system are substantially synchronized, and the generation time and numbers of T cells against such a Th epitope are similar to those against the target immunogen. In this way, the effect on assisting the target immunogen will be limited, accordingly. Especially for a weakly immunogenic tumor antigen, the helping effect of such a Th epitope is more difficult to exert. Indeed, the direct use of a strong Th epitope, although being capable of activating a tumor antigen, elicits a lower level of cellular immune response that do not meet the needs of a tumor vaccine (Ghaffari-Nazari H et al., PLoS ONE, 2015, 10 (11): e0142563).

[0012] Thus, new Th epitope strategies are needed to enhance the immunogenicities of target immunogens, particularly some weak immunogens, such as tumor antigens.

DISCLOSURE OF THE INVENTION

[0013] It is an object of the present invention to provide a fusion peptide of CD4 helper T cell epitopes, by which the immunogenicity of a target immunogen is enhanced.

[0014] Further, the present invention utilizes a strong Th epitope derived from cytomegalovirus (CMV) and influenza (Flu) virus (influvirus) to obtain an epitope fusion peptide for enhancing the immunogenicity of a target immunogen.

[0015] For the purposes of the present invention, the following terms are defined below.

[0016] "Epitope fusion peptide" refers to a peptide formed by joining together several epitopes.

[0017] "Target immunogen" refers to an immunogen used for achieving a certain immune response, including a substance having an immunological activity, such as an antigen, preferably a protein.

[0018] It is another object of the present invention to provide a fusion protein of the epitope fusion peptide and the target immunogen.

[0019] To achieve the above object, the present invention provides a fusion peptide of CD4 helper T cell epitopes, comprising a CMV epitope and/or an influenza virus epitope.

[0020] In one embodiment of the present invention, the epitope fusion peptide comprises one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23.

[0021] In one embodiment of the present invention, the epitope fusion peptide consists of one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23. Preferably, the epitope fusion peptide consists of 5 or 10 CMV epitopes, and/or 8 or 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 34 or 44. Most preferably, the epitope fusion peptide consists of 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 48.

[0022] Preferably, the epitope fusion peptide induces a humoral or cellular immune response.

[0023] The present invention also provides a fusion protein of the epitope fusion peptide and a target immunogen.

[0024] The present invention also provides a polynucleotide encoding the epitope fusion peptide and/or the fusion protein.

[0025] In one embodiment of the present invention, the target immunogen is any one or more immunogens. Preferably, the target immunogen is a peptide, an antigen, a hapten, a carbohydrate, a protein, a nucleic acid, an allergen, a virus or a part of a virus, a bacterium, a parasite or other whole microorganism. In one embodiment of the present invention, the antigen is a tumor antigen or an infection-related antigen.

[0026] In one embodiment of the present invention, the tumor antigen is one or more tumor antigens selected from lung cancer antigen, testicular cancer antigen, melanoma antigen, liver cancer antigen, breast cancer antigen or prostate cancer antigen.

[0027] In one embodiment of the present invention, the tumor antigen is one or more tumor antigens selected from LAGE antigen, MAGE antigen or NY-ESO-1 antigen. Preferably, the LAGE antigen is LAGE-1, and the MAGE antigen is MAGE-A3. Further preferably, the tumor antigen comprises LAGE-MAGE-A3 and NY-ESO-1. Preferably, the amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO: 26.

[0028] In one embodiment of the present invention, the infection-related antigen is one or more infection-related antigen selected from an HIV antigen, a Flu virus antigen or an HBV antigen.

[0029] Preferably, the fusion protein is as shown in one of SEQ ID NOs: 55-58.

[0030] Another object of the present invention is to provide an immunogenic composition comprising a therapeutically effective amount of the epitope fusion peptide, the fusion protein and/or the polynucleotide according to the present invention, and a pharmaceutically acceptable carrier. Preferably, the immunogenic composition is a vaccine.

[0031] It is another object of the present invention to provide a kit comprising the epitope fusion peptide, the fusion protein, the polynucleotide and/or the immunogenic composition according to the present invention, and instructions for use thereof.

[0032] The present invention also provides use of the epitope fusion peptide, the fusion protein, the polynucleotide and/or the immunogenic composition according to the present invention in the manufacture of a medicament or a vaccine for increasing the immunogenicity of a target immunogen.

[0033] The present invention also provides a method for increasing the immunogenicity of a target immunogen using the epitope fusion peptide according to the present invention, comprising using a CD4 helper T cell epitope having a stronger immune response in a vaccine subject or population with a target immunogen to form a fusion protein. The method specifically comprises the following steps of:

[0034] (1) selecting one or more CD4 helper T cell epitopes, wherein a complex formed by combining the epitopes with MHC molecules can be recognized by CD4 helper T cell receptors, and a T cell immune response has been generated against at least one of the epitopes in a vaccine subject before vaccination;

[0035] (2) fusing the epitopes to prepare an epitope fusion peptide, fusing the epitope fusion peptide with a target immunogen to prepare a fusion protein, expressing the fusion protein and preparing it into a vaccine, wherein the expression vector can be in the form of a DNA vaccine vector, a protein vaccine vector or a virus vaccine vector; and

[0036] (3) vaccinating the vaccine subject with the above vaccine, and a suitable adjuvant, such as incomplete Freund's adjuvant, complete Freund's adjuvant, or aluminum hydroxide adjuvant and the like that can be selected for vaccination.

[0037] Further, step (1) in the method further comprises a step of examining the MHC phenotype of the vaccine subject. Preferably, examining the MHC phenotype of the vaccine subject comprises examining the MHC class II gene subtype of the vaccine subject.

[0038] The present invention also provides a method for treating or preventing a condition in a subject in need thereof, comprising administering a therapeutically effective amount of the epitope fusion peptide, the fusion protein, the immunogenic composition and/or the polynucleotide of the present invention. Preferably, the condition is one or more conditions selected from malignant tumors, and bacterial and viral chronic infections. Preferably, the malignant tumor is breast cancer or colon cancer. Preferably, in the method, the DNA vaccine vector is used for the prime immunization, and a protein vaccine vector is used for the boost immunization. More preferably, the pVKD1.0-C1-hMNB DNA vaccine is used for the prime immunization, and the LMNB-I13 protein is used for the boost immunization. The epitope fusion peptide provided by the present invention can substantially improve the level of cellular immune response to a target immunogen, particularly a weak immunogen, and is an effective means for overcoming the immune tolerance of immune system to an antigen, particularly to a tumor antigen or an infection-related antigen, and is suitable for efficiently enhancing the efficacy of a vaccine.

DESCRIPTION OF DRAWINGS

[0039] Hereinafter, the embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0040] FIGS. 1 and 2 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-hLMN carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, respectively.

[0041] FIGS. 3 and 4 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-hLMN-CTB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin subunit B, respectively.

[0042] FIGS. 5 and 6 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-C1 carrying the encoding sequences of CMV and Flu virus-derived CD4 epitopes, respectively.

[0043] FIGS. 7 and 8 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-C1-LMNB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, cholera toxin subunit B, and CMV and Flu virus-derived CD4 epitopes, respectively.

[0044] FIGS. 9 and 10 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-LMN carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, respectively.

[0045] FIGS. 11 and 12 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-LMN-CTB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin subunit B, respectively.

[0046] FIGS. 13 and 14 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV Th carrying the encoding sequence of a CMV-derived epitope, respectively.

[0047] FIGS. 15 and 16 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV10-LMNB carrying the encoding sequences of a CMV-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0048] FIGS. 17 and 18 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV Th carrying the encoding sequences of a Flu virus-derived epitope, respectively.

[0049] FIGS. 19 and 20 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-Influ8-LMNB carrying the encoding sequences of a Flu virus-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0050] FIGS. 21 and 22 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-Influ13-LMNB carrying the encoding sequences of a Flu virus-derived epitope, LAGS-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0051] FIG. 23 shows the detection results of cellular immune responses in the animal immunization experiment.

[0052] FIGS. 24 and 25 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV5-LMNB carrying the encoding sequences of a CMV-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0053] FIG. 26 shows the detection results of cellular immune responses in the animal immunization experiment in Example 12.

[0054] FIG. 27 shows the tumor growth of mice in Example 13.

[0055] FIGS. 28 and 29 show the tumor-free survival and overall survival of mice in Example 13, respectively.

[0056] FIG. 30 shows the tumor growth of mice in each treatment group for the 4T1-hNY-ESO-1 mouse tumor model.

[0057] FIG. 31 shows the tumor growth of mice in each treatment group for the CT26-hLAGE-1 mouse tumor model.

SPECIFIC EMBODIMENTS

[0058] The present invention is described in further detail below with reference to the specific embodiments. The examples are given for the purpose of illustration of the present invention only, and are not intended to limit the scope of the present invention.

EXAMPLE 1

Construction of DNA Vaccine pVKD1.0-hLMN

[0059] The amino acid sequences of LAGE-I, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. By means of an online codon optimization software (http://www.jcatdel), the nucleotide sequences for mammalian codon usage preference as shown in SEQ ID NOs: 27-29 respectively were obtained by optimization based on the above antigen amino acid sequences. The nucleotide sequences were synthesized by Shanghai Generay Biotech Co., Ltd., and then cloned between the multiple cloning sites Sal I and BamH I on the DNA vaccine vector pVKD1.0 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) by a method well known in the art to construct the DNA vaccine vector pVKD1.0-hLMN capable of expressing the fusion protein as an antigen (the plasmid map is shown in FIG. 1), which was stored after being sequenced for identification. The vector pVKD1.0-hLMN was identified by the restriction endonucleases Sal I and BamH I (the enzyme digestion system is shown in Table 1), and its enzyme digestion map for verification is shown in FIG. 2.

TABLE-US-00001 TABLE 1 Enzyme digestion system for identification of the plasmid pVKD1.0-hLMN (enzyme digestion at 37.degree. C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-hLMN 3 .mu.L, about 1 .mu.g Sal I (Takara, Cat. No. 1080A) 1 .mu.L BamH I (Takara, Cat. No. 1010A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 2

Construction of DNA Vaccine pVKD1.0-hLMN-CTB

[0060] The mammalian codon optimized sequence (SEQ ID NO: 31) of the amino acid sequence (SEQ ID NO: 30) of cholera toxin subunit B (CTB) and its eukaryotic expression vector pVKD1.0-CTB were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The primers were designed by using pVKD1.0-CTB as a template (see Table 2). The CTB gene fragment was amplified by PCR, and the corresponding fragment was then recovered from the gel. The CTB fragment was inserted into a corresponding position on the linearized vector pVKD1.0-hLMN by a homologous recombination method, to construct the DNA vaccine vector pVKD1.0-hLMN-CTB (the plasmid map is shown in FIG. 3), which was stored after being sequenced for identification. The vector pVKD1.0-hLMN-CTB was identified by the restriction endonucleases Sal I and BamH I (the enzyme digestion system is shown in Table 3), and its enzyme digestion map for verification is shown in FIG. 4.

TABLE-US-00002 TABLE 2 Primers in Example 2 Primer Sequence 1F (SEQ ID TCCCTCAGGGCAGAGGCGCATCAAGCTGAAGTTCGG NO: 32) CGTG IR (SEQ ID GAAGGCACAGCAGATCTGGATCCTCAGTTGGCCATG NO: 33) CTGATGGC

TABLE-US-00003 TABLE 3 Enzyme digestion system for identification of plasmid pVKD1.0-hLMN-CTB (enzyme digestion at 37.degree. C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-hLMN-CTB 3 .mu.L, about 1 .mu.g Sal I (Takara, Cat. No. 1080A) 1 .mu.L BamH I (Takara, Cat. No. 1010A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 3

Construction of DNA Vaccine pVKD1.0-CI-LMNB

[0061] The strong Th epitopes derived from cytomegalovirus (CMV) and influenza (Flu) virus (see Table 4) were obtained from an immune epitope database (IEDB, http://wwwiedb.org), wherein the strong Th epitopes of CMV include pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104, and the strong Th epitopes of Flu virus include HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127 and M1-210. The selected epitopes in Table 4 cover most subtypes of MHC class II molecules in both human and mouse. The selected epitopes pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221 were then linked together in tandem to form an fusion peptide of CMV virus epitopes and Flu virus epitopes having the amino acid sequence shown in SEQ ID NO: 34. The epitope fusion peptide was subjected to mammal codon optimization to give the nucleic acid sequence shown in SEQ ID NO: 35, which was sent to Suzhou Synbio Technologies Co., Ltd for synthesis, and then inserted into the DNA vaccine vector pVKD1.0 (Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) by a molecular biology method well known in the art to form the vector pVKD1.0-CI (the plasmid map is shown in FIG. 5), and stored after being sequenced fbr identification. The vector pVKD1.0-CI was identified by the restriction endonucleases Pst I and Bgl II (the enzyme digestion system is shown in Table 5) and its enzyme digestion map for verification is shown in FIG. 6.

TABLE-US-00004 TABLE 4 Th Epitopes in Example 3 Epitope Name Source Amino acid sequence pp65-11 CMV LLQTGIHVRVSQPSL (SEQ ID NO: 1) pp65-71 CMV IIKPGKISHIMLDVA (SEQ ID NO: 2) pp65-92 CMV EHPTFTSQYRIQGKL (SEQ ID NO: 3) pp65-123 CMV AGILARNLNPMVATV (SEQ ID NO: 4 pp65-128 CMV KYQEFFWDANDIYRI (SEQ ID NO: 5) pp65-57 CMV KVYLESFCEDVPSGK (SEQ ID NO: 6) pp65-62 CMV TLGSDVEEDLTMTRN (SEQ ID NO: 7) pp65-30 CMV PLKMLNIPSINVHHY (SEQ ID NO: 8) pp65-112 CMV ACTSGVMTRGRLKAE (SEQ ID NO: 9) pp65-104 CMV TERKTPRVTGGGAMA (SEQ ID NO: 10) HA203 Influ NQRALYHTENAYVSVVS (SEQ ID NO: 11) NP438 Influ SDMRAEIIKMMESARPE (SEQ ID NO: 12) NS1-84 Influ ALASRYLTDMTIEEMSR (SEQ ID NO: 13) M1-181 Influ LASTTAKAMEQMAGSSE (SEQ ID NO: 14) HA375 Influ SGYAADQKSTQNAINGITNKVN (SEQ ID NO: 15) NP24 influ EIRASVGKMIDGIGRFYI (SEQ ID NO: 16) NP95 influ PIYRRVDGKWMRELVLY (SEQ ID NO: 17) NP221 Influ RMCNILKGKFQTAAQRAM (SEQ ID NO: 18) HA434 Influ IWTYNAELLVLLENERT (SEQ ID NO: 19) HA440 Influ ELLVLLENERTLDFHDS (SEQ ID NO: 20) NP324 Influ HKSQLVWMACNSAAFED (SEQ ID NO: 21) M1-127 Influ CMGLIYNRMGAVTTESA SEQ ID NO: 22) M1-210 Influ RQMVQAMRAIGTHPSSSTGLKND SEQ ID NO: 23)

TABLE-US-00005 TABLE 5 Enzyme digestion system for identification of plasmid pVKD1.0-CI (enzyme digestion at 37.degree. C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-CI 3 .mu.L, about 1 .mu.g Pst I (Takara, Cat. No. 1073A) 1 .mu.L Bgl II (Takara, Cat. No. 1021A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

[0062] Finally, the primers were designed by using the vector pVKD1.0-hLMN-CTB in Example 2 as a template (see table 6). The target gene fragment hLMN-CTB was amplified by PCR, and was then inserted between the restriction sites Not I and Bam HI on the pVKD1.0-CI vector by a molecular biology method well known in the art to construct the DNA vaccine vector pVKD1.0-CI-LNINB (the plasmid map is shown in FIG. 7), which was stored after being sequenced for identification. The vector pVKD1.0-CI-LMNB was identified by the restriction endonucleases Barn HI and EcoR V (the enzyme digestion system is shown in Table 7), and its enzyme digestion map for verification is shown in FIG. 8.

TABLE-US-00006 TABLE 6 Primers in Example 3 Primer Sequence 3F (SEQ ID GCGCGGCCGCTGTCACCGTCGTCGACATGCAGGCCG NO: 36) AA 3R (SEQ ID GCGATCCTCAGTTGGCCATGCTGATGGCGGCGATG NO: 3

TABLE-US-00007 TABLE 7 Enzyme digestion system for identification of plasmid pVKD1.0-CI-LMNB (enzyme digestion at 37.degree. C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-CI-LMNB 3 .mu.L, about 1 .mu.g Bam HI (Takara, Cat, No. 1010A) 1 .mu.L EcoR V (Takara, Cat. No. 1042A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 4

Construction of LMN Prokaryotic Expression Vector

[0063] The amino acid sequences of LAGE-1, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. By means of an online codon optimization software (http://www.jcat.de/), the nucleotide sequences for E. coli codon usage preference shown in SEQ ID NOs: 38-40 respectively were obtained through optimization based on the antigen amino acid sequences. The nucleotide sequences were synthesized by Suzhou Synbio Technologies Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-LMN (the plasmid map is shown in FIG. 9), which was stored after being sequenced for identification. The vector pET-30a(+)-LMN was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 8), and its enzyme digestion map for verification is shown in FIG. 10.

TABLE-US-00008 TABLE 8 Enzyme digestion system for identification of plasmid pET-30a(+)-LMN (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-LMN 3 .mu.L, about 1 .mu.g Nco I (Takara, Cat. No. 1160A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 5

Construction of LMN-CTB Prokaryotic Expression Vector

[0064] The amino acid sequence of cholera toxin subunit B (CTB) (SEQ ID NO: 30) and its prokaryotic codon optimized nucleic acid sequence (SEQ ID NO: 41) were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The primers were designed (see table 9), and a nucleic acid fragment containing the CTB encoding sequence was amplified by a PCR method using the pET-30a(+)-CTB (Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted into the pET-30a(+)-LMN vector by means of homologous recombination to construct the pET-30a(+)-LMN-CTB vector (the plasmid map is shown in FIG. 11), which was stored after being sequenced for identification. The vector pET-30a(+)-LMN-CTB was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 10), and its enzyme digestion map for verification is shown in FIG. 12.

TABLE-US-00009 TABLE 9 Primers in Example 5 Primer Sequence 5F (SEQ ID GGTGGTGGTGGTGCTCGAGTTAGTTAGCCATAGAGA NO: 42) 5R (SEQ ID TCTGCGTGAAGGTGAAGAAGCTCAGGCTGAAGGTCG NO: 43) TGG

TABLE-US-00010 TABLE 10 Enzyme digestion system for identification Example 5 (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-LMN-CTB 3 .mu.L, about 1 .mu.g Nco I (Takara, Cat. No. 1160A) 1 .mu.L Xho 1 (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 6

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTB and CMV Th Epitopes

[0065] Ten (10) CMV-derived Th epitopes pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104 were selected from Table 4, and linked together in tandem to form the amino acid sequence shown in SEQ ID NO: 44, wherein the sequence segment "EFELRRQ" in SEQ ID NO: 44 is formed due to the introduction of enzyme restriction site, which belongs to a common technique for fusion and construction. By means of an online codon optimization software (http://www.jcat.del), the nucleotide sequence for E. coli codon usage preference (SEQ ID NO: 45) was obtained through optimization based on the amino acid sequence of Th epitopes. The nucleotide sequence was synthesized by Shanghai Generay Biotech Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-CMV Th (the plasmid map is shown in FIG. 13) capable of expressing the fusion protein as an antigen, which was stored after being sequenced for identification. The vector pET-30a (+)-CMV Th was identified by the restriction endonucleases Mlu I and Xho I (the enzyme digestion system is shown in Table 11), and its enzyme digestion map for verification is shown in FIG. 14.

[0066] As shown in FIG. 13, CMV Th1 contains 5 CMV Th epitopes consisting of pp65-1L pp65-71, pp65-92, pp65-123 and pp65-128 in tandem, and CMV Th2 contains 5 CMV Th epitopes consisting of pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104. Three restriction enzyme sites such as EcoR I, Sac I and Sal I were introduced between CMV Th1 and CMV Th2.

TABLE-US-00011 TABLE 11 Enzyme digestion system for identification of plasmid pET-30a(+)-CMV Th (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV Th 3 .mu.L, about 1 .mu.g Mlu I (Takara, Cat. No. 1071A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

[0067] The Primers were designed (see Table 12), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Xho I on the pET-30a(+)-CMV Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-CMV10-LMNB vector (the plasmid map is shown in FIG. 15), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV10-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 13) and its enzyme digestion map for verification is shown in FIG. 16. As shown in FIG. 15, pET-30a(+)-CMV10-LMNB contains CMV Th1 and CMV Th2 fragments, i.e. all 10 CMV Th epitopes in Table 4. These epitopes are pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104.

TABLE-US-00012 TABLE 12 Primer design in Example 6 Primer Sequence 6F (SEQ ID NO: 46 GCGCGGCCGCGACGACAAGGCCATGGCT 6R (SEQ ID NO: 47) GCCTCGAGGTTAGCCATAGAGATAGC

TABLE-US-00013 TABLE 13 Enzyme digestion system for identification of pET-30a(+)-CMV10-LMNB (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 .mu.L, about 1 .mu.g BamH I (Takara, Cat. No. 1010A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 7

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTR and Influ Th Epitopes

[0068] Thirteen (13) Th Epitopes derived from Flu virus, HA203, NP438, NSI-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127 and M1-210 were selected from Table 4, and linked together in tandem to form the amino acid sequence shown in SEQ ID NO: 48. By means of an online codon optimization software (http://www.jcat.de/), the nucleotide sequence for E. coli codon usage preference (SEQ ID NO: 49) was obtained through optimization based on the amino acid sequence containing Flu virus Th epitopes. The nucleotide sequence was synthesized by Shanghai Generay Biotech Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-Influ Th (the plasmid map is shown in FIG. 17) capable of expressing the fusion protein as an antigen, which was stored after being sequenced for identification. The vector pET-30a(+)-Influ Th was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 14), and its enzyme digestion map for verification is shown in FIG. 18.

[0069] As shown in FIG. 17, Influ Th1 contains 8 Flu virus Th epitopes consisting of HA203, NP438, HA375, NP24, NP95 and NP221 in tandem, and Influ Th2 contains 5 Flu virus Th epitopes consisting of RA434, HA440, NP324, M1-127 and M1-210. Three restriction sites such as EcoR 1, Sac I and Sal I were introduced between Influ Th1 and Influ Th2.

TABLE-US-00014 TABLE 14 Enzyme digestion system for identification in Example 7 (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ Th 3 .mu.L, about 1 .mu.g Nco I (Takara, Cat. No. 1160A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

[0070] The primers were designed (see Table 15), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Sal I on the pET-30a(+)-Influ Th vector in Example 7 by a molecular biology method well known in the art to construct the pET-30a(+)-Influ8-LMNB vector (containing 8 Flu virus Th epitopes; the plasmid map is shown in FIG. 19), which was stored after being sequenced for identification. The vector pET-30a(+)-Influ8-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 16) and its enzyme digestion map for verification is shown in FIG. 20. As shown in FIG. 19, the pET-30a(+)-Influ8-LMNB vector contains the Influ Th1 segment, i.e., 8 Flu virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, and NP221 in Table 4.

TABLE-US-00015 TABLE 15 Primers in Example 7 Primer Sequence 7F1 (SEQ ID NO; 50) GGCGGCCGCGTTAGCCATAGAGATAGC 7R1 (SEQ ID NO: 51) GCGTCGACAAGACGACAAGGCCATGGC TATGC

TABLE-US-00016 TABLE 16 Enzyme digestion system for identification of plasmid pET-30a(+)-Influ8-LMNB (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ8-LMNB 3 .mu.L, about 1 .mu.g BamH I (Takara, Cat. No. 1010A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

[0071] The primers were designed (see Table 17), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) was referred to for the specific method. This nucleic acid fragment was then inserted between Not I and Xho I on the pET-30a(+)-Influ Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-Influ13-LMNB vector (containing 13 Flu virus Th epitopes; the plasmid map is shown in FIG. 21), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV10-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 18) and its enzyme digestion map for verification is shown in FIG. 22.

[0072] As shown in FIG. 21, the pET-30a(+)-Influ13-LMNB vector contains both the Influ Th1 and Influ Th2 segments, i.e., 8 Flu virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, and NP221 in Table 4, and 5 Flu virus Th epitopes including HA434, HA440, NP324, M1-127 and M1-210 in Table 4, The vector includes all 13 Flu virus Th epitopes in total in Table 4

TABLE-US-00017 TABLE 17 Primer design in Example 7 Primer Sequence 7F2 (SEQ ID NO: 52) GCCTCGAGGTTAGCCATAGAGATAGCA 7R2 (SEQ ID NO: 53) GCGCGGCCGCGACGACAAGGCCATGGC TATG

TABLE-US-00018 TABLE 18 Enzyme digestion system for identification in Example 7 (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ13-LMNB 3 .mu.L, about 1 .mu.g BamH I (Takara, Cat. No. 1010A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 8

Expression and Purification of Fusion Protein

[0073] The prokaryotic expression vector pET-30a(+)-LMN constructed in Example 4, the prokaryotic expression vector pET-30a(+)-LMN-CTB constructed in Example 5, the prokaryotic expression vectors pET-30a(+)-CMV5-LMNB and pET-30a(+)-CMV10-LMNB constructed in Example 6, the prokaryotic expression vectors pET-30a(+)-Influ8-LMNB and pET-30a(+)-Influ13-LMNB constructed in Example 7 were respectively transformed into BL21 (DE3) competent cells (Tiangen Biotech (Beijing) Co., Ltd., Cat. No. CB105; the instructions of competent cells were referred to for the transformation method) to prepare the recombinant proteins LMN (its amino acid sequence is shown in SEQ ID NO: 59), LMNB (its amino acid sequence is shown in SEQ ID NO: 54), LMNB-C10 (its amino acid sequence is shown in SEQ ID NO: 58), LMNB-18 (its amino acid sequence is shown in SEQ ID NO: 55), and LMNB-13 (its amino acid sequence is shown in SEQ ID NO: 56) according to the pET System Manual (TB055 8th Edition February 1999, Novagen respectively, which were stored at -80.degree. C. after subpackage.

[0074] The concentrations of the recombinant proteins prepared are 1 mg/mL, as detected by a BCA method (Beyotime Institute of Biotechnology, Cat. No. P0009), and the instructions of detection kit were referred to for the detection method. The contents of endotoxin in the prepared recombinant proteins were less than IEU/mg, as measured by a gel method (Chinese Horseshoe Crab Reagent Manufactory Co., Ltd., Xiamen, Cat. No. G011000), which meet the requirements of an animal experiment, and the instructions of horseshoe crab agent were referred to for the detection method.

EXAMPLE 9

Animal Immunization Experiment

[0075] The information of the vaccines prepared in Examples 2, 3 and 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the Flu antigen NP (NCBI reference sequence: YP_009118476.1) of the DNA vaccine pVKD1.0-NP (the expression is derived from the virus strain A/Shanghai/02/2013 (H7N9)) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the protein vaccine VP1 (VP1 protein of enterovirus 71, see the Chinese Patent Application No. 201310088364.5) was provided by the Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0076] Sixteen (16) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 20. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 .mu.g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 .mu.g/animal. Two weeks after the last immunization, the mice were sacrificed, and their serum and splenocytes were collected for an enzyme-linked immunospot (ELISPOT) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. The mouse IFN-.gamma. ELISPOT kit was purchased from BD, USA (Cat. No. 551083), and the instructions of IFN-.gamma. ELISPOT kit from BD were referred to for the method. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP) synthesized by Shanghai Science Peptide Biological Technology Co., Ltd., with the final concentration of 10 .mu.g/mL. The positive stimuli phorbol-12-myristate-13-acetate (PMA) and ionomycin were purchased from Sigma, USA.

[0077] An ELISA method is well known for a person skilled in the art, and is briefly described below. The 96-Well ELISA plates were purchased from Jianghai Glass Instrument General Factory. Both the recombinant LMN and NY-ESO-1 were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The plates were coated with the proteins in NaHCO.sub.3 buffer (pH 9.6) at 4.degree. C. overnight at a coating concentration of 10 .mu.g/mL, followed by blocking with 0.1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) at 37.degree. C. for 30 minutes and then washing 5 times with 0.5% Tween 20 in phosphate buffered saline (PBST). An incubation with the mouse serum at room temperature was carried out for 1 hour at an initial dilution of 1:100 and washed 5 times with PBST, and another incubation with goat anti-mouse HRP secondary antibody (Santacruz, USA) was carried out at 1:5000 at 37.degree. C. for 30 min. After being washing 5 times with PBST, the substrate was developed with 3,3,5,5-tetramethylbenzidine (TMB) at 37.degree. C. for 15 min and stopped with 2M dilute sulfuric acid, and then the absorbance (A) values were read at 450 nm using a microplate reader (Thermo, USA). A value which is 2.1 times greater than the negative control A value was judged to be positive, and the reciprocal of the highest dilution with respect to the positive values was defined as the serum antibody titer. A titer was defined as 50 when it was less than the initial dilution of 1:100.

TABLE-US-00019 TABLE 19 Vaccine information Vaccine Attribute Antigen CD4 Th epitope pVKD1.0-LMN-CTB DNA LAGE-1, Epitope-free MAGE-A3, NY-ESO-1, pVKD1.0-CI-LMNB DNA LAGE-1, 5 CMV epitopes, MAGE-A3, 8 influenza virus NY-ESO-1 epitopes pVKD1.0-CI DNA None 5 CMV epitopes, 8 influenza virus epitopes pVKD1.0-NP DNA NP 5 influenza virus epitopes LMNB Recombinant LACE-1, Epitope-free protein MAGE-A3, NY-ESO-1 LMNB-18 Recombinant LAGE-1, First 8 influenza protein MAGE-A3, virus epitopes NY-ESO-1 LMNB-I13 Recombinant LAGE-1, 13 influenza virus protein MAGE-A3, epitopes NY-ESO-1 LMNB-C5 Recombinant LAGE-1, First 5 CMV protein MAGE-A3, epitopes NY-ESO-1 LMNB-C10 Recombinant LAGE-1, 10 CMV epitopes protein MAGE-A3, NY-ESO-1 VP1 Recombinant VP1 Epitope-free protein

TABLE-US-00020 TABLE 20 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A(n = 4) pVKD1.0-NP 100 .mu.g pVKD1.0 100 .mu.g VP1/CFA 100 .mu.g VPI/IFA 100 .mu.g B(n = 4) pVKD1.0-NP 100 .mu.g pVKD 1.0- 100 .mu.g LMNB/CFA 100 .mu.g LMNB/IFA 100 .mu.g LMNB C(n = 4) pVKD1.0-NP 100 .mu.g pVKD 1.0- 100 .mu.g LMNB- 100 .mu.g LMNB- 100 .mu.g CI-LMNB I8/CFA I8/IFA D(n = 4) pVKD1.0-NP 100 .mu.g pVKD 1.0- 100 .mu.g LMNB- 100 .mu.g LMNB- 100 .mu.g CI-LMNB I13/CFA I13/IFA

[0078] The results of cellular immune response assay are shown in FIG. 23. Among them, the group primed with pVKD1.0-CI-LMNB DNA vaccine and boosted with LMNB-I13 protein (i.e., group D in Example 8) had the best immune effect, which was significantly higher than those of the parallel control group (group B) and the group boosted with LMNB-18 (group C). Moreover, the level of cellular immune response in the group boosted with LMNB-I13 protein was nearly 3-fold higher than that in the parallel control group (group B). The results showed that a load of 13 Flu virus Th epitopes (group D) could significantly increase the cellular immune response level of weak immunogens.

EXAMPLE 10

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTB and CMV Th Epitope

[0079] The primers were designed (see Table 21), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Sal I on the pET-30a(+)-CMV Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-CMV5-LMNB vector (the plasmid map is shown in FIG. 24), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV5-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 22) and its enzyme digestion map for verification is shown in FIG. 25. As shown in FIG. 24, pET-30a(+)-CMV5-LMNB contains a CMV Th1 fragment, i.e. the first 5 CMV Th epitopes in Table 4. These epitopes are pp65-11, pp65-71, pp65-92, pp65-123 and pp65-128.

TABLE-US-00021 TABLE 21 Primer design in Example 10 Primer Sequence 7F1 (SEQ ID NO: 50) GCGCGGCCGCGTTAGCCATAGAGATAGC 7R1 (SEQ ID NO: 51) GCGTCGACAAGACGACAAGGCCATGGCT ATGC

TABLE-US-00022 TABLE 22 Enzyme digestion system for identification of pET-30a(+)-CMV10-LMNB (enzyme digestion at 37.degree. C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 .mu.L, about 1 .mu.g BamH I (Takara, Cat. No. 1010A) 1 .mu.L Xho I (Takara, Cat. No. 1094A) 1 .mu.L Enzyme digestion buffer 1 .mu.L ddH.sub.2O q.s. to 10 .mu.L

EXAMPLE 11

Expression and Purification of Fusion Protein

[0080] As described in Example 8, the prokaryotic expression vector pET-30a(+)-CMV5-LMNB constructed in Example 10 was transformed into BL21 (DE3) competent cells ('Tangen Biotech (Beijing) Co., Ltd., Cat. No. CB105; the instructions of competent cells were referred to for the transformation method) to prepare the recombinant protein LMNB-05 (its amino acid sequence is shown in SEQ ID NO: 57) according to the pET System Manual (TB055 8th Edition February 1999, Novagen), which was stored at -80.degree. C. after subpackage.

[0081] The concentration of the recombinant protein prepared was 1 mg/mL, as detected by a BCA method (Beyotime Institute of Biotechnology, Cat. No. P0009), and the instructions of detection kit were referred to for the detection method. The content of endotoxin in the prepared recombinant protein was less than IEU/mg, as measured by a gel method (Chinese Horseshoe Crab Reagent Manufactory Co., Ltd., Xiamen, Cat. No. G011000), which met the requirements of an animal experiment, and the instructions of Horseshoe Crab agent were referred to for the detection method.

EXAMPLE 12

Animal Immunization Experiment

[0082] The vaccine information is shown in Table 19. The DNA vaccine pVKD1.0-CI (Example 3) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0083] Twenty (20) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 23. All DNA vaccines were injected into the tibial anterior muscle of the calf at 1.00 .mu.g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), and injected subcutaneously into the back at 10 .mu.g/animal. Two weeks after the last immunization, the mice were sacrificed, and serum and splenocytes were collected for an enzyme-linked immunospot (ELISPOT) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. The mouse IFN-.gamma. ELISPOT kit was purchased from BD, USA (Cat. No. 551083), and the instructions of IFN-.gamma. ELISPOT kit from BD were referred to for the method. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP) synthesized by Shanghai Science Peptide Biological Technology Co., Ltd., with a final stimulating concentration of 10 .mu.g/mL. The positive stimuli phorbol-12-myristate-13-acetate (PMA) and ionomycin were purchased from Sigma, USA.

[0084] An ELISA method is well known in the art and briefly described below. 96-Well ELISA plates were purchased from Jianghai Glass Instrument General Factory. Both recombinant LMN and NY-ESO-1 were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The plates were coated with the proteins in NaHCO.sub.3 buffer (pH 9.6) at 4.degree. C. overnight at a coating concentration of 10 .mu.g/mL, followed by blocking with 0.1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) at 37.degree. C. for 30 minutes and then washing 5 times with 0.5% Tween 20 in phosphate buffered saline (PBST). An incubation with mouse serum was carried out at room temperature for 1 hour at an initial dilution of 1:100 and washed 5 times with PBST. Another incubation with goat anti-mouse HRP secondary antibody (Santacruz, USA) was carried out at 1:5000 at 37.degree. C. for 30 min, and washed 5 times with PBST. The substrate was then developed with 3,3,5,5-tetramethylbenzidine (TMB) at 37.degree. C. for 15 min and stopped with 2M dilute sulfuric acid, and the absorbance (A) values were read at 450 nm using a microplate reader (Thermo, USA). A value which is 2 times greater than the negative control A value was judged to be positive, and the reciprocal of the highest dilution with respect to the positive values was defined as the serum antibody titer. A titer was defined as 50 when it was less than the initial dilution of 1:100.

TABLE-US-00023 TABLE 23 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A (n = 5) pVKD1.0-CI 100 .mu.g pVKD1.0 100 .mu.g VP1/CFA 100 .mu.g VPI/IFA 100 .mu.g B (n = 5) pVKD1.0-CI 100 .mu.g pVKD1.0-LMNB 100 .mu.g LMNB/CFA 100 .mu.g LMNB/IFA 100 .mu.g C (n = 5) pVKD1.0-CI 100 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-C5/CFA 100 .mu.g LMNB-C5/CFA 100 .mu.g D (n = 5) PVKD1.0-CI 100 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-C10/CFA 100 .mu.g LMNB-C10/CFA 100 .mu.g

[0085] The results of cellular immune response assay are shown in FIG. 26. Among them, the group primed with the pVKD1.0-CI-LMNB DNA vaccine, boosted with the LMNB-C5 protein (i.e. group C in Example 11) and boosted with the LMNB-C10 protein (i.e. group D in Example 11) had the best immune effect, which was significantly higher than that in the parallel control (group B). The results showed that a load of 5 CMV virus Th epitopes (group C) and 10 CMV virus Th epitopes (group D) could significantly improve the cellular immune response of weak immunogens.

EXAMPLE 13

Animal Experiment for Tumor Prevention

[0086] The information of vaccines prepared in Examples 2, 3 and 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the Flu antigen NP (NCBI reference sequence: YP_009118476.1) of the DNA vaccine pVKD1.0-NP (the expression is derived from the virus strain A/Shanghai/02/2013 (H7N9)) was provided by Vacdiagn. Biotechnology Co., Ltd., Suzhou Industrial Park, and the protein vaccine VPI (VPI protein of enterovirus 71, see the Chinese Patent Application No. 201310088364.5) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0087] Sixty (60) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 24. All DNA vaccines were injected into the tibials anterior muscle of the calf at 100 .mu.g/animal protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 .mu.g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by 4T1-hNY-ESO-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at an inoculation dose of 1.times.10.sup.5 cells/mouse, and the tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=length.times.width.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00024 TABLE 24 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0 100 .mu.g VP1/CFA 10 .mu.g VP1/IFA 10 .mu.g pVKD1.0-CI 50 .mu.g B (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0-LMNB 100 .mu.g LMNB/CFA 10 .mu.g LMNB/IFA 10 .mu.g pVKD1.0-CI 50 .mu.g C (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-I8/CFA 10 .mu.g LMNB-I8/IFA 10 .mu.g pVKD1.0-CI 50 .mu.g D (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-I13/CFA 10 .mu.g LMNB-I13/IFA 10 .mu.g pVKD1.0-CI 50 .mu.g E (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-I13/CFA 10 .mu.g LMNB-C10/IFA 10 .mu.g pVKD1.0-CI 50 .mu.g F (n = 10) pVKD1.0-NP 50 .mu.g pVKD1.0-CI-LMNB 100 .mu.g LMNB-C10/CFA 5 .mu.g LMNB-C10/IFA 5 .mu.g pVKD1.0-CI 50 .mu.g LMNB-I13/CFA 5 .mu.g LMNB-I13/IFA 5 .mu.g

[0088] The tumor growth of immunized mice in each group is shown in FIG. 27. Among them, all the mice in the control group (group A) developed tumors on the 14th day after the tumor challenge (i.e. after the tumor innoculation), and the tumors grew rapidly. The tumor growth of mice in each immunization group lagged behind that in the control group, wherein the mice in the group boosted with LMNB-I13 (group D) and the nice in the group boosted with a mixture of LMNB-I13 and LMNB-C10 (group E) had the slowest tumor growth, so these two groups of vaccines had the best effects.

[0089] In addition, an analysis of tumor-free survival was performed for the mice, and the results are shown in FIG. 28. The median tumor-free survival (TFS) of the mice in the control group A was 14 days. The tumor-free survival of the mice in each vaccine immunized group was significantly higher than that in the control group, indicating that all vaccines could increase the tumor-free survival of immunized mice. Among them, group D with the I13 epitope fusion peptide, and group E and F with the I13 and C10 epitope fusion peptide had the best effects, and the tumor-free survival of mice was doubled at the most. In the vaccine group with the I13 epitope fusion peptide (group D), the tumor-free survival was significantly increased by about 40% compared to the conventional vaccine group (group B), showing that a load of 13 Th epitopes of Flu virus or 10 Th epitopes of CMV could significantly improve the protection effect of tumor vaccine against tumor.

[0090] Finally, an analysis of mouse overall survival was also performed and the results are shown in FIG. 29. Among them, the median overall survival (OS) of mice in control group A was 35 days. The overall survival of mice in each vaccine immunized group was significantly higher than that in the control group, indicating that all vaccines could increase the survival of mice after immunization. Among them, group D with I13 epitope fusion peptide and groups E and F with I13 and C10 epitope fusion peptides had the best effects, and the overall survival rate was increased by 83%. Compared with the conventional vaccine group (group B), the vaccine group with the I13 epitope fusion peptide (groups D and group F) significantly increased the tumor-free survival by 28% at the most, indicating that a load of thirteen (13) Flu virus Th epitopes or ten (10) CMV Th epitopes could greatly improve the tumor protection effect of tumor vaccine.

EXAMPLE 14

Tumor Treatment Experiment

[0091] The vaccines involved are shown in Example 9. Thirty (30) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 25. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 .mu.g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 .mu.g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by the tumor cells 4T1-hNY-ESO-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at a dose of 1.times.10.sup.5 cells/mouse, and the corresponding mice were inoculated subcutaneously with the protein vaccine on day 1, 8 and 15 after the tumor cell inoculation, respectively. The tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=length.times.width.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00025 TABLE 25 Grouping and immunization schemes Week 0, 4, 8 Week 10 Week 11, 12 Grouping Vaccine Dose Vaccine Dose Vaccines Dose A (n = 10) pVKD1.0-NP 100 .mu.g pVKD1.0 100 .mu.g VP1/CFA 10 .mu.g B (n = 10) pVKD1.0-NP 100 .mu.g LMNB/CFA 10 .mu.g LMNB/IFA 10 .mu.g C (n = 10) pVKD1.0-NP 100 .mu.g LMNB-I13/CFA 10 .mu.g LMNB-I13/IFA 10 .mu.g

[0092] The tumor growth of immunized mice in each group is shown in FIG. 30. Among them, all the mice in the control group (group A) developed tumors on the 14th day after the tumor challenge (i.e. after the tumor innoculation), and the tumors grew rapidly. The mice in the LMNB-I13 protein vaccine treated group (group C) had the slowest tumor growth compared to the untreated control group (group A). Furthermore, the tumor size of mice in the LMNB-I13 protein vaccine treated group was significantly smaller than that in the control group (group A) on day 22 after the tumor challenge, and there was still a significant difference in tumor size between the two groups until day 30. By day 35, the tumor growth of mice began to accelerate in group C, which is possibly associated with the cease of vaccination with the LMNB-I13 protein vaccine. The results indicated that the LMNB-I13 protein vaccine could inhibit tumor growth in mice.

EXAMPLE 15

Tumor Treatment Experiment

[0093] The vaccines involved are shown in Example 9. Thirty (30) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 26. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 .mu.g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 .mu.g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by the tumor cells CT26-hLAGE-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at an inoculation dose of 1.times.10.sup.5 cells/mouse, and the corresponding mice were inoculated subcutaneously with the protein vaccine on day 1, 8 and 15 after the tumor cell inoculation, respectively. The tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=length.times.width.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00026 TABLE 26 Grouping and immunization schemes Week 0, 4, 8 Week 10 Week 11, 12 Grouping Vaccine Dose Vaccine Dose Vaccine Dose A (n = 10) pVKD1.0-NP 100 .mu.g pVKD1.0 100 .mu.g VP1/CFA 10 .mu.g B (n = 10) pVKD1.0-NP 100 .mu.g LMNB/CFA 10 .mu.g LMNB/IFA 10 .mu.g C (n = 10) pVKD1.0-NP 100 .mu.g LMNB-I13/CFA 10 .mu.g LMNB-I13/IFA 10 .mu.g

[0094] The tumor growth of immunized mice in each group is shown in FIG. 31. Due to the failure of tumor innoculation of some mice in the untreated control group (group A) after the tumor challenge (i.e. after the tumor innoculation), such mice were not included for the analysis, and the parallel controlled vaccine group (group B) and the LMNB-I13 treated group (group C) were compared. Compared with group B, the tumor growth of mice in group C was slower, and the tumor size of mice in the LMNB-I13 protein vaccine treatment group was significantly smaller than that in parallel controlled vaccine group (group B) on day 22 after the tumor challenge. There was still a significant difference in tumor size between the two groups until day 30. Similarly, the increased tumor growth of mice in group C was also observed at a later stage in the CT26 mouse model, which is possibly associated with the cease of vaccination with the LMNB-I13 protein vaccine, These results indicated that the LMNB-I13 protein vaccine could inhibit tumor growth in mice.

Sequence CWU 1

1

59115PRTArtificial SequenceSynthetic 1Leu Leu Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser Leu1 5 10 15215PRTArtificial SequenceSynthetic 2Ile Ile Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala1 5 10 15315PRTArtificial SequenceSynthetic 3Glu His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu1 5 10 15415PRTArtificial SequenceSynthetic 4Ala Gly Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val1 5 10 15515PRTArtificial SequenceSynthetic 5Lys Tyr Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile1 5 10 15615PRTArtificial SequenceSynthetic 6Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro Ser Gly Lys1 5 10 15715PRTArtificial SequenceSynthetic 7Thr Leu Gly Ser Asp Val Glu Glu Asp Leu Thr Met Thr Arg Asn1 5 10 15815PRTArtificial SequenceSynthetic 8Pro Leu Lys Met Leu Asn Ile Pro Ser Ile Asn Val His His Tyr1 5 10 15915PRTArtificial SequenceSynthetic 9Ala Cys Thr Ser Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu1 5 10 151015PRTArtificial SequenceSynthetic 10Thr Glu Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala1 5 10 151117PRTArtificial SequenceSynthetic 11Asn Gln Arg Ala Leu Tyr His Thr Glu Asn Ala Tyr Val Ser Val Val1 5 10 15Ser1217PRTArtificial SequenceSynthetic 12Ser Asp Met Arg Ala Glu Ile Ile Lys Met Met Glu Ser Ala Arg Pro1 5 10 15Glu1317PRTArtificial SequenceSynthetic 13Ala Leu Ala Ser Arg Tyr Leu Thr Asp Met Thr Ile Glu Glu Met Ser1 5 10 15Arg1417PRTArtificial SequenceSynthetic 14Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln Met Ala Gly Ser Ser1 5 10 15Glu1522PRTArtificial SequenceSynthetic 15Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln Asn Ala Ile Asn Gly1 5 10 15Ile Thr Asn Lys Val Asn 201618PRTArtificial SequenceSynthetic 16Glu Ile Arg Ala Ser Val Gly Lys Met Ile Asp Gly Ile Gly Arg Phe1 5 10 15Tyr Ile1717PRTArtificial SequenceSynthetic 17Pro Ile Tyr Arg Arg Val Asp Gly Lys Trp Met Arg Glu Leu Val Leu1 5 10 15Tyr1818PRTArtificial SequenceSynthetic 18Arg Met Cys Asn Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg1 5 10 15Ala Met1917PRTArtificial SequenceSynthetic 19Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg1 5 10 15Thr2017PRTArtificial SequenceSynthetic 20Glu Leu Leu Val Leu Leu Glu Asn Glu Arg Thr Leu Asp Phe His Asp1 5 10 15Ser2117PRTArtificial SequenceSynthetic 21His Lys Ser Gln Leu Val Trp Met Ala Cys Asn Ser Ala Ala Phe Glu1 5 10 15Asp2217PRTArtificial SequenceSynthetic 22Cys Met Gly Leu Ile Tyr Asn Arg Met Gly Ala Val Thr Thr Glu Ser1 5 10 15Ala2323PRTArtificial SequenceSynthetic 23Arg Gln Met Val Gln Ala Met Arg Ala Ile Gly Thr His Pro Ser Ser1 5 10 15Ser Thr Gly Leu Lys Asn Asp 2024210PRTArtificial SequenceSynthetic 24Met Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp1 5 10 15Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly 20 25 30Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala 35 40 45Gly Ala Ala Arg Ala Ser Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro 50 55 60His Gly Gly Ala Ala Ser Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala65 70 75 80Arg Arg Pro Asp Ser Arg Leu Leu Glu Leu His Ile Thr Met Pro Phe 85 90 95Ser Ser Pro Met Glu Ala Glu Leu Val Arg Arg Ile Leu Ser Arg Asp 100 105 110Ala Ala Pro Leu Pro Arg Pro Gly Ala Val Leu Lys Asp Phe Thr Val 115 120 125Ser Gly Asn Leu Leu Phe Met Ser Val Arg Asp Gln Asp Arg Glu Gly 130 135 140Ala Gly Arg Met Arg Val Val Gly Trp Gly Leu Gly Ser Ala Ser Pro145 150 155 160Glu Gly Gln Lys Ala Arg Asp Leu Arg Thr Pro Lys His Lys Val Ser 165 170 175Glu Gln Arg Pro Gly Thr Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln 180 185 190Gly Asp Gly Cys Arg Gly Val Ala Phe Asn Val Met Phe Ser Ala Pro 195 200 205His Ile 21025313PRTArtificial SequenceSynthetic 25Pro Leu Glu Gln Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu1 5 10 15Ala Arg Gly Glu Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr 20 25 30Glu Glu Gln Glu Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr 35 40 45Leu Gly Glu Val Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro 50 55 60Gln Gly Ala Ser Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser65 70 75 80Gln Ser Tyr Glu Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr 85 90 95Phe Pro Asp Leu Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val 100 105 110Ala Glu Leu Val His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro 115 120 125Val Thr Lys Ala Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr 130 135 140Phe Phe Pro Val Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val145 150 155 160Phe Gly Ile Glu Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile 165 170 175Phe Ala Thr Cys Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn 180 185 190Gln Ile Met Pro Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile 195 200 205Ala Arg Glu Gly Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu 210 215 220Ser Val Leu Glu Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp225 230 235 240Pro Lys Lys Leu Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu 245 250 255Tyr Arg Gln Val Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp 260 265 270Gly Pro Arg Ala Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His 275 280 285Met Val Lys Ile Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His 290 295 300Glu Trp Val Leu Arg Glu Gly Glu Glu305 31026179PRTArtificial SequenceSynthetic 26Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly1 5 10 15Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly 20 25 30Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly 35 40 45Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly Ala Pro Arg Gly Pro His 50 55 60Gly Gly Ala Ala Ser Gly Leu Asn Gly Cys Cys Arg Cys Gly Ala Arg65 70 75 80Gly Pro Glu Ser Arg Leu Leu Glu Phe Tyr Leu Ala Met Pro Phe Ala 85 90 95Thr Pro Met Glu Ala Glu Leu Ala Arg Arg Ser Leu Ala Gln Asp Ala 100 105 110Pro Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val Ser 115 120 125Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala Ala Asp His Arg Gln Leu 130 135 140Gln Leu Ser Ile Ser Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp145 150 155 160Ile Thr Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro Pro Ser Gly 165 170 175Gln Arg Arg27630DNAArtificial SequenceSynthetic 27atgcaggccg aaggccgggg cacagggggt tcgacgggcg atgctgatgg cccaggaggc 60cctggcattc ctgatggccc agggggcaat gctggcggcc caggagaggc gggtgccacg 120ggcggcagag gtccccgggg cgcaggggca gcaagggcct cggggccgag aggaggcgcc 180ccgcggggtc cgcatggcgg tgccgcttct gcgcaggatg gaaggtgccc ctgcggggcc 240aggaggccgg acagccgcct gcttgagttg cacatcacga tgcctttctc gtcgccaatg 300gaagcggagc tggtccgcag aatcctgtcc cgggatgccg caccgctccc ccgaccaggg 360gcggttctga aggacttcac cgtgtccggc aacctactgt ttatgtcagt tcgggaccag 420gacagggaag gcgctgggcg gatgagggtg gtgggttggg ggctgggatc agcctccccg 480gaggggcaga aagctagaga tctcagaaca cccaaacaca aggtctcaga acagagacct 540ggtacaccag gcccgccgcc acccgaggga gcccagggag atgggtgcag aggtgtcgcc 600tttaatgtga tgttctctgc ccctcacatt 63028939DNAArtificial SequenceSynthetic 28cccctggagc agcgcagcca gcactgcaag cccgaggagg gcctggaggc ccgcggcgag 60gccctgggcc tggtgggcgc ccaggccccc gccaccgagg agcaggaggc cgccagcagc 120agcagcaccc tggtggaggt gaccctgggc gaggtgcccg ccgccgagag ccccgacccc 180ccccagagcc cccagggcgc cagcagcctg cccaccacca tgaactaccc cctgtggagc 240cagagctacg aggacagcag caaccaggag gaggagggcc ccagcacctt ccccgacctg 300gagagcgagt tccaggccgc cctgagccgc aaggtggccg agctggtgca cttcctgctg 360ctgaagtacc gcgcccgcga gcccgtgacc aaggccgaga tgctgggcag cgtggtgggc 420aactggcagt acttcttccc cgtgatcttc agcaaggcca gcagcagcct gcagctggtg 480ttcggcatcg agctgatgga ggtggacccc atcggccacc tgtacatctt cgccacctgc 540ctgggcctga gctacgacgg cctgctgggc gacaaccaga tcatgcccaa ggccggcctg 600ctgatcatcg tgctggccat catcgcccgc gagggcgact gcgcccccga ggagaagatc 660tgggaggagc tgagcgtgct ggaggtgttc gagggccgcg aggacagcat cctgggcgac 720cccaagaagc tgctgaccca gcacttcgtg caggagaact acctggagta ccgccaggtg 780cccggcagcg accccgcctg ctacgagttc ctgtggggcc cccgcgccct ggtggagacc 840agctacgtga aggtgctgca ccacatggtg aagatcagcg gcggccccca catcagctac 900ccccccctgc acgagtgggt gctgcgcgag ggcgaggag 93929537DNAArtificial SequenceSynthetic 29caggccgaag gccggggcac agggggttcg acgggcgatg ctgatggccc aggaggccct 60ggcattcctg atggcccagg gggcaatgct ggcggcccag gagaggcggg tgccacgggc 120ggcagaggtc cccggggcgc aggggcagca agggcctcgg ggccgggagg aggcgccccg 180cggggtccgc atggcggcgc ggcttcaggg ctgaatggat gctgcagatg cggggccagg 240gggccggaga gccgcctgct tgagttctac ctcgccatgc ctttcgcgac acccatggaa 300gcagagctgg cccgcaggag cctggcccag gatgccccac cgcttcccgt gccaggggtg 360cttctgaagg agttcactgt gtccggcaac atactgacta tccgactgac tgctgcagac 420caccgccaac tgcagctctc catcagctcc tgtctccagc agctttccct gttgatgtgg 480atcacgcagt gctttctgcc cgtgtttttg gctcagcctc cctcagggca gaggcgc 53730123PRTArtificial SequenceSynthetic 30Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser Ala1 5 10 15Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr 20 25 30His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile Phe Ser Tyr Thr 35 40 45Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys Asn 50 55 60Gly Ala Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser65 70 75 80Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr 85 90 95Leu Thr Glu Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys Thr 100 105 110Pro His Ala Ile Ala Ala Ile Ser Met Ala Asn 115 12031369DNAArtificial SequenceSynthetic 31atcaagctga agttcggcgt gttcttcacc gtgctgctga gcagcgccta cgcccacggc 60accccccaga acatcaccga cctgtgcgcc gagtaccaca acacccagat ccacaccctg 120aacgacaaga tcttcagcta caccgagagc ctggccggca agcgcgagat ggccatcatc 180accttcaaga acggcgccac cttccaggtg gaggtgcccg gcagccagca catcgacagc 240cagaagaagg ccatcgagcg catgaaggac accctgcgca tcgcctacct gaccgaggcc 300aaggtggaga agctgtgcgt gtggaacaac aagacccccc acgccatcgc cgccatcagc 360atggccaac 3693240DNAArtificial SequenceSynthetic 32tccctcaggg cagaggcgca tcaagctgaa gttcggcgtg 403344DNAArtificial SequenceSynthetic 33gaaggcacag cagatctgga tcctcagttg gccatgctga tggc 4434219PRTArtificial SequenceSynthetic 34Met Leu Leu Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser Leu1 5 10 15Ile Ile Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala Glu 20 25 30His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Ala Gly 35 40 45Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Lys Tyr Gln 50 55 60Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Asn Gln Arg Ala65 70 75 80Leu Tyr His Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser Asp Met 85 90 95Arg Ala Glu Ile Ile Lys Met Met Glu Ser Ala Arg Pro Glu Ala Leu 100 105 110Ala Ser Arg Tyr Leu Thr Asp Met Thr Ile Glu Glu Met Ser Arg Leu 115 120 125Ala Ser Thr Thr Ala Lys Ala Met Glu Gln Met Ala Gly Ser Ser Glu 130 135 140Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln Asn Ala Ile Asn Gly145 150 155 160Ile Thr Asn Lys Val Asn Glu Ile Arg Ala Ser Val Gly Lys Met Ile 165 170 175Asp Gly Ile Gly Arg Phe Tyr Ile Pro Ile Tyr Arg Arg Val Asp Gly 180 185 190Lys Trp Met Arg Glu Leu Val Leu Tyr Arg Met Cys Asn Ile Leu Lys 195 200 205Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala Met 210 21535657DNAArtificial SequenceSynthetic 35atgctgctgc aaaccggcat ccacgtgcgc gtgagccagc ccagcctgat catcaagccc 60ggcaagatca gccacatcat gctggacgtg gccgagcacc ccaccttcac cagccagtac 120cgcatccagg gcaagctggc cggcatcctg gcccgcaacc tggtgcccat ggtggccacc 180gtgaagtacc aggagttctt ctgggacgcc aacgacatct accgcatcaa ccagcgcgcc 240ctgtaccaca ccgagaacgc ctacgtgagc gtggtgagca gcgacatgcg cgccgagatc 300atcaagatga tggagagcgc ccgccccgag gccctggcca gccgctacct gaccgacatg 360accatcgagg agatgagccg cctggccagc accaccgcca aggccatgga gcagatggcc 420ggcagcagcg agagcggcta cgccgccgac cagaagagca cccagaacgc catcaacggc 480atcaccaaca aggtgaacga gatccgcgcc agcgtgggca agatgatcga cggcatcggc 540cgcttctaca tccccatcta ccgccgcgtg gacggcaagt ggatgcgcga gctggtgctg 600taccgcatgt gcaacatcct gaagggcaag ttccagaccg ccgcccagcg cgccatg 6573638DNAArtificial SequenceSynthetic 36gcgcggccgc tgtcaccgtc gtcgacatgc aggccgaa 383735DNAArtificial SequenceSynthetic 37gcgatcctca gttggccatg ctgatggcgg cgatg 3538630DNAArtificial SequenceSynthetic 38atgcaggctg aaggtcgtgg taccggtggt tctaccggtg acgctgacgg tccgggtggt 60ccgggtatcc cggacggtcc gggtggtaac gctggtggtc cgggtgaagc tggtgctacc 120ggtggtcgtg gtccgcgtgg tgctggtgct gctcgtgctt ctggtccgcg tggtggtgct 180ccgcgtggtc cgcacggtgg tgctgcttct gctcaggacg gtcgttgccc gtgcggtgct 240cgtcgtccgg actctcgtct gctggaactg cacatcacca tgccgttctc ttctccgatg 300gaagctgaac tggttcgtcg tatcctgtct cgtgacgctg ctccgctgcc gcgtccgggt 360gctgttctga aagacttcac cgtttctggt aacctgctgt tcatgtctgt tcgtgaccag 420gaccgtgaag gtgctggtcg tatgcgtgtt gttggttggg gtctgggttc tgcttctccg 480gaaggtcaga aagctcgtga cctgcgtacc ccgaaacaca aagtttctga acagcgtccg 540ggtaccccgg gtccgccgcc gccggaaggt gctcagggtg acggttgccg tggtgttgct 600ttcaacgtta tgttctctgc tccgcacatc 63039939DNAArtificial SequenceSynthetic 39ccgctggaac agcgttctca gcactgcaaa ccggaagaag gtctggaagc tcgtggtgaa 60gctctgggtc tggttggtgc tcaggctccg gctaccgaag aacaggaagc tgcttcttct 120tcttctaccc tggttgaagt taccctgggt gaagttccgg ctgctgaatc tccggacccg 180ccgcagtctc cgcagggtgc ttcttctctg ccgaccacca tgaactaccc gctgtggtct 240cagtcttacg aagactcttc taaccaggaa gaagaaggtc cgtctacctt cccggacctg 300gaatctgaat tccaggctgc tctgtctcgt aaagttgctg aactggttca cttcctgctg 360ctgaaatacc gtgctcgtga accggttacc aaagctgaaa tgctgggttc tgttgttggt 420aactggcagt acttcttccc ggttatcttc tctaaagctt cttcttctct gcagctggtt 480ttcggtatcg aactgatgga agttgacccg atcggtcacc tgtacatctt cgctacctgc 540ctgggtctgt cttacgacgg tctgctgggt gacaaccaga tcatgccgaa agctggtctg 600ctgatcatcg ttctggctat catcgctcgt gaaggtgact gcgctccgga agaaaaaatc 660tgggaagaac tgtctgttct ggaagttttc gaaggtcgtg aagactctat cctgggtgac 720ccgaaaaaac tgctgaccca gcacttcgtt caggaaaact acctggaata ccgtcaggtt 780ccgggttctg acccggcttg ctacgaattc ctgtggggtc cgcgtgctct ggttgaaacc 840tcttacgtta aagttctgca ccacatggtt aaaatctctg gtggtccgca catctcttac 900ccgccgctgc acgaatgggt tctgcgtgaa ggtgaagaa

93940540DNAArtificial SequenceSynthetic 40gctcaggctg aaggtcgtgg taccggtggt tctaccggtg acgctgacgg tccgggtggt 60ccgggtatcc cggacggtcc gggtggtaac gctggtggtc cgggtgaagc tggtgctacc 120ggtggtcgtg gtccgcgtgg tgctggtgct gctcgtgctt ctggtccggg tggtggtgct 180ccgcgtggtc cgcacggtgg tgctgcttct ggtctgaacg gttgctgccg ttgcggtgct 240cgtggtccgg aatctcgtct gctggaattc tacctggcta tgccgttcgc taccccgatg 300gaagctgaac tggctcgtcg ttctctggct caggacgctc cgccgctgcc ggttccgggt 360gttctgctga aagaattcac cgtttctggt aacatcctga ccatccgtct gaccgctgct 420gaccaccgtc agctgcagct gtctatctct tcttgcctgc agcagctgtc tctgctgatg 480tggatcaccc agtgcttcct gccggttttc ctggctcagc cgccgtctgg tcagcgtcgt 54041369DNAArtificial SequenceSynthetic 41atcaaactga aatttggcgt cttcttcacc gtcctgctgt cttctgctta cgctcacggt 60accccgcaga acatcaccga cctgtgcgct gaataccaca acacccagat ccacaccctg 120aacgacaaaa tcttctctta caccgaatct ctggctggta aacgtgaaat ggctatcatc 180accttcaaaa acggtgctac cttccaggtt gaagttccgg gttctcagca catcgactct 240cagaaaaaag ctatcgaacg tatgaaagac accctgcgta tcgcttacct gaccgaagct 300aaagttgaaa aactgtgcgt ttggaacaac aaaaccccgc acgctatcgc tgctatctct 360atggctaac 3694236DNAArtificial SequenceSynthetic 42ggtggtggtg gtgctcgagt tagttagcca tagaga 364339DNAArtificial SequenceSynthetic 43tctgcgtgaa ggtgaagaag ctcaggctga aggtcgtgg 3944157PRTArtificial SequenceSynthetic 44Leu Leu Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser Leu Ile1 5 10 15Ile Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala Glu His 20 25 30Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Ala Gly Ile 35 40 45Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Lys Tyr Gln Glu 50 55 60Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Glu Phe Glu Leu Arg65 70 75 80Arg Gln Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro Ser Gly 85 90 95Lys Thr Leu Gly Ser Asp Val Glu Glu Asp Leu Thr Met Thr Arg Asn 100 105 110Pro Leu Lys Met Leu Asn Ile Pro Ser Ile Asn Val His His Tyr Ala 115 120 125Cys Thr Ser Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu Thr Glu 130 135 140Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala145 150 15545471DNAArtificial SequenceSynthetic 45ctgctgcaga ccggtatcca cgttcgtgtt tctcagccgt ctctgatcat caaaccgggt 60aaaatctctc acatcatgct ggacgttgct gaacacccga ccttcacctc tcagtaccgt 120atccagggta aactggctgg tatcctggct cgtaacctgg ttccgatggt tgctaccgtt 180aaataccagg aattcttctg ggacgctaac gacatctacc gtatcgaatt cgagctccgt 240cgacaaaaag tttacctgga atctttctgc gaagacgttc cgtctggtaa aaccctgggt 300tctgacgttg aagaagacct gaccatgacc cgtaacccgc tgaaaatgct gaacatcccg 360tctatcaacg ttcaccacta cgcttgcacc tctggtgtta tgacccgtgg tcgtctgaaa 420gctgaaaccg aacgtaaaac cccgcgtgtt accggtggtg gtgctatggc t 4714628DNAArtificial SequenceSynthetic 46gcgcggccgc gacgacaagg ccatggct 284726DNAArtificial SequenceSynthetic 47gcctcgaggt tagccataga gatagc 2648230PRTArtificial SequenceSynthetic 48Asn Gln Arg Ala Leu Tyr His Thr Glu Asn Ala Tyr Val Ser Val Val1 5 10 15Ser Ser Asp Met Arg Ala Glu Ile Ile Lys Met Met Glu Ser Ala Arg 20 25 30Pro Glu Ala Leu Ala Ser Arg Tyr Leu Thr Asp Met Thr Ile Glu Glu 35 40 45Met Ser Arg Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln Met Ala 50 55 60Gly Ser Ser Glu Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln Asn65 70 75 80Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Glu Ile Arg Ala Ser Val 85 90 95Gly Lys Met Ile Asp Gly Ile Gly Arg Phe Tyr Ile Pro Ile Tyr Arg 100 105 110Arg Val Asp Gly Lys Trp Met Arg Glu Leu Val Leu Tyr Arg Met Cys 115 120 125Asn Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala Met Glu 130 135 140Phe Glu Leu Arg Arg Gln Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val145 150 155 160Leu Leu Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser His Lys Ser 165 170 175Gln Leu Val Trp Met Ala Cys Asn Ser Ala Ala Phe Glu Asp Cys Met 180 185 190Gly Leu Ile Tyr Asn Arg Met Gly Ala Val Thr Thr Glu Ser Ala Arg 195 200 205Gln Met Val Gln Ala Met Arg Ala Ile Gly Thr His Pro Ser Ser Ser 210 215 220Thr Gly Leu Lys Asn Asp225 23049690DNAArtificial SequenceSynthetic 49aaccagcgtg ctctgtacca caccgaaaac gcttacgttt cggttgtaag ctctgacatg 60cgtgctgaaa tcatcaaaat gatggaatct gctcgtccgg aagctctggc ttctcgttac 120ctgaccgaca tgaccatcga agaaatgtct cgtctggctt ctaccaccgc taaagctatg 180gaacagatgg ctggttcttc tgaatctggt tacgctgctg accagaaatc tacccagaac 240gctatcaacg gtatcaccaa caaagttaac gaaatccgtg cttctgttgg taaaatgatc 300gacggtatag gcaggttcta catcccgata taccgtcgtg ttgacggtaa atggatgcgt 360gaactggttc tgtaccgtat gtgcaacatc ctgaaaggta aattccagac cgctgctcag 420cgtgctatgg aattcgagct ccgtcgacaa atctggacct acaacgctga actgctggtt 480ctgctggaaa acgaacgtac cctggacttc cacgactctc acaaatctca gctggtttgg 540atggcttgca actcggcggc gttcgaagac tgcatgggtc tgatctacaa ccgtatgggt 600gctgttacca ccgaatctgc tcgtcagatg gttcaggcta tgcgtgctat cggtacccac 660ccgtcttctt ctaccggtct gaaaaacgac 6905028DNAArtificial SequenceSynthetic 50gcgcggccgc gttagccata gagatagc 285132DNAArtificial SequenceSynthetic 51gcgtcgacaa gacgacaagg ccatggctat gc 325227DNAArtificial SequenceSynthetic 52gcctcgaggt tagccataga gatagca 275331DNAArtificial SequenceSynthetic 53gcgcggccgc gacgacaagg ccatggctat g 3154872PRTArtificial SequenceSynthetic 54Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Met Gln 35 40 45Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro 50 55 60Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro65 70 75 80Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala 85 90 95Ala Arg Ala Ser Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro His Gly 100 105 110Gly Ala Ala Ser Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala Arg Arg 115 120 125Pro Asp Ser Arg Leu Leu Glu Leu His Ile Thr Met Pro Phe Ser Ser 130 135 140Pro Met Glu Ala Glu Leu Val Arg Arg Ile Leu Ser Arg Asp Ala Ala145 150 155 160Pro Leu Pro Arg Pro Gly Ala Val Leu Lys Asp Phe Thr Val Ser Gly 165 170 175Asn Leu Leu Phe Met Ser Val Arg Asp Gln Asp Arg Glu Gly Ala Gly 180 185 190Arg Met Arg Val Val Gly Trp Gly Leu Gly Ser Ala Ser Pro Glu Gly 195 200 205Gln Lys Ala Arg Asp Leu Arg Thr Pro Lys His Lys Val Ser Glu Gln 210 215 220Arg Pro Gly Thr Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln Gly Asp225 230 235 240Gly Cys Arg Gly Val Ala Phe Asn Val Met Phe Ser Ala Pro His Ile 245 250 255Pro Leu Glu Gln Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu 260 265 270Ala Arg Gly Glu Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr 275 280 285Glu Glu Gln Glu Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr 290 295 300Leu Gly Glu Val Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro305 310 315 320Gln Gly Ala Ser Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser 325 330 335Gln Ser Tyr Glu Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr 340 345 350Phe Pro Asp Leu Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val 355 360 365Ala Glu Leu Val His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro 370 375 380Val Thr Lys Ala Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr385 390 395 400Phe Phe Pro Val Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val 405 410 415Phe Gly Ile Glu Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile 420 425 430Phe Ala Thr Cys Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn 435 440 445Gln Ile Met Pro Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile 450 455 460Ala Arg Glu Gly Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu465 470 475 480Ser Val Leu Glu Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp 485 490 495Pro Lys Lys Leu Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu 500 505 510Tyr Arg Gln Val Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp 515 520 525Gly Pro Arg Ala Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His 530 535 540Met Val Lys Ile Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His545 550 555 560Glu Trp Val Leu Arg Glu Gly Glu Glu Ala Gln Ala Glu Gly Arg Gly 565 570 575Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile 580 585 590Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala 595 600 605Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly 610 615 620Pro Gly Gly Gly Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly625 630 635 640Leu Asn Gly Cys Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu 645 650 655Leu Glu Phe Tyr Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu 660 665 670Leu Ala Arg Arg Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro 675 680 685Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile 690 695 700Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser705 710 715 720Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu 725 730 735Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln Arg Arg Ile Lys Leu 740 745 750Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser Ala Tyr Ala His 755 760 765Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr 770 775 780Gln Ile His Thr Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu785 790 795 800Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr 805 810 815Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys 820 825 830Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu 835 840 845Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala 850 855 860Ile Ala Ala Ile Ser Met Ala Asn865 870551043PRTArtificial SequenceSynthetic 55Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile 35 40 45Gly Ser Asn Gln Arg Ala Leu Tyr His Thr Glu Asn Ala Tyr Val Ser 50 55 60Val Val Ser Ser Asp Met Arg Ala Glu Ile Ile Lys Met Met Glu Ser65 70 75 80Ala Arg Pro Glu Ala Leu Ala Ser Arg Tyr Leu Thr Asp Met Thr Ile 85 90 95Glu Glu Met Ser Arg Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln 100 105 110Met Ala Gly Ser Ser Glu Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr 115 120 125Gln Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Glu Ile Arg Ala 130 135 140Ser Val Gly Lys Met Ile Asp Gly Ile Gly Arg Phe Tyr Ile Pro Ile145 150 155 160Tyr Arg Arg Val Asp Gly Lys Trp Met Arg Glu Leu Val Leu Tyr Arg 165 170 175Met Cys Asn Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala 180 185 190Met Glu Phe Glu Leu Arg Arg Gln Asp Asp Lys Ala Met Ala Met Gln 195 200 205Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro 210 215 220Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro225 230 235 240Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala 245 250 255Ala Arg Ala Ser Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro His Gly 260 265 270Gly Ala Ala Ser Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala Arg Arg 275 280 285Pro Asp Ser Arg Leu Leu Glu Leu His Ile Thr Met Pro Phe Ser Ser 290 295 300Pro Met Glu Ala Glu Leu Val Arg Arg Ile Leu Ser Arg Asp Ala Ala305 310 315 320Pro Leu Pro Arg Pro Gly Ala Val Leu Lys Asp Phe Thr Val Ser Gly 325 330 335Asn Leu Leu Phe Met Ser Val Arg Asp Gln Asp Arg Glu Gly Ala Gly 340 345 350Arg Met Arg Val Val Gly Trp Gly Leu Gly Ser Ala Ser Pro Glu Gly 355 360 365Gln Lys Ala Arg Asp Leu Arg Thr Pro Lys His Lys Val Ser Glu Gln 370 375 380Arg Pro Gly Thr Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln Gly Asp385 390 395 400Gly Cys Arg Gly Val Ala Phe Asn Val Met Phe Ser Ala Pro His Ile 405 410 415Pro Leu Glu Gln Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu 420 425 430Ala Arg Gly Glu Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr 435 440 445Glu Glu Gln Glu Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr 450 455 460Leu Gly Glu Val Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro465 470 475 480Gln Gly Ala Ser Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser 485 490 495Gln Ser Tyr Glu Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr 500 505 510Phe Pro Asp Leu Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val 515 520 525Ala Glu Leu Val His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro 530 535 540Val Thr Lys Ala Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr545 550 555 560Phe Phe Pro Val Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val 565 570 575Phe Gly Ile Glu Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile 580 585 590Phe Ala Thr Cys Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn 595 600 605Gln Ile Met Pro Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile 610 615 620Ala Arg Glu Gly Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu625 630 635 640Ser Val Leu Glu Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp 645 650 655Pro Lys Lys Leu Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu 660 665 670Tyr Arg Gln Val Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp 675

680 685Gly Pro Arg Ala Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His 690 695 700Met Val Lys Ile Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His705 710 715 720Glu Trp Val Leu Arg Glu Gly Glu Glu Ala Gln Ala Glu Gly Arg Gly 725 730 735Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile 740 745 750Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala 755 760 765Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly 770 775 780Pro Gly Gly Gly Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly785 790 795 800Leu Asn Gly Cys Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu 805 810 815Leu Glu Phe Tyr Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu 820 825 830Leu Ala Arg Arg Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro 835 840 845Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile 850 855 860Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser865 870 875 880Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu 885 890 895Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln Arg Arg Ile Lys Leu 900 905 910Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser Ala Tyr Ala His 915 920 925Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr 930 935 940Gln Ile His Thr Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu945 950 955 960Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr 965 970 975Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys 980 985 990Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu 995 1000 1005Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys Thr Pro His 1010 1015 1020Ala Ile Ala Ala Ile Ser Met Ala Asn Ala Ala Ala Leu Glu His 1025 1030 1035His His His His His 1040561125PRTArtificial SequenceSynthetic 56Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile 35 40 45Gly Ser Asn Gln Arg Ala Leu Tyr His Thr Glu Asn Ala Tyr Val Ser 50 55 60Val Val Ser Ser Asp Met Arg Ala Glu Ile Ile Lys Met Met Glu Ser65 70 75 80Ala Arg Pro Glu Ala Leu Ala Ser Arg Tyr Leu Thr Asp Met Thr Ile 85 90 95Glu Glu Met Ser Arg Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln 100 105 110Met Ala Gly Ser Ser Glu Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr 115 120 125Gln Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Glu Ile Arg Ala 130 135 140Ser Val Gly Lys Met Ile Asp Gly Ile Gly Arg Phe Tyr Ile Pro Ile145 150 155 160Tyr Arg Arg Val Asp Gly Lys Trp Met Arg Glu Leu Val Leu Tyr Arg 165 170 175Met Cys Asn Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala 180 185 190Met Glu Phe Glu Leu Arg Arg Gln Ile Trp Thr Tyr Asn Ala Glu Leu 195 200 205Leu Val Leu Leu Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser His 210 215 220Lys Ser Gln Leu Val Trp Met Ala Cys Asn Ser Ala Ala Phe Glu Asp225 230 235 240Cys Met Gly Leu Ile Tyr Asn Arg Met Gly Ala Val Thr Thr Glu Ser 245 250 255Ala Arg Gln Met Val Gln Ala Met Arg Ala Ile Gly Thr His Pro Ser 260 265 270Ser Ser Thr Gly Leu Lys Asn Asp Gln Ala Cys Gly Arg Asp Asp Lys 275 280 285Ala Met Ala Met Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly 290 295 300Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly305 310 315 320Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro 325 330 335Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly Pro Arg Gly Gly Ala Pro 340 345 350Arg Gly Pro His Gly Gly Ala Ala Ser Ala Gln Asp Gly Arg Cys Pro 355 360 365Cys Gly Ala Arg Arg Pro Asp Ser Arg Leu Leu Glu Leu His Ile Thr 370 375 380Met Pro Phe Ser Ser Pro Met Glu Ala Glu Leu Val Arg Arg Ile Leu385 390 395 400Ser Arg Asp Ala Ala Pro Leu Pro Arg Pro Gly Ala Val Leu Lys Asp 405 410 415Phe Thr Val Ser Gly Asn Leu Leu Phe Met Ser Val Arg Asp Gln Asp 420 425 430Arg Glu Gly Ala Gly Arg Met Arg Val Val Gly Trp Gly Leu Gly Ser 435 440 445Ala Ser Pro Glu Gly Gln Lys Ala Arg Asp Leu Arg Thr Pro Lys His 450 455 460Lys Val Ser Glu Gln Arg Pro Gly Thr Pro Gly Pro Pro Pro Pro Glu465 470 475 480Gly Ala Gln Gly Asp Gly Cys Arg Gly Val Ala Phe Asn Val Met Phe 485 490 495Ser Ala Pro His Ile Pro Leu Glu Gln Arg Ser Gln His Cys Lys Pro 500 505 510Glu Glu Gly Leu Glu Ala Arg Gly Glu Ala Leu Gly Leu Val Gly Ala 515 520 525Gln Ala Pro Ala Thr Glu Glu Gln Glu Ala Ala Ser Ser Ser Ser Thr 530 535 540Leu Val Glu Val Thr Leu Gly Glu Val Pro Ala Ala Glu Ser Pro Asp545 550 555 560Pro Pro Gln Ser Pro Gln Gly Ala Ser Ser Leu Pro Thr Thr Met Asn 565 570 575Tyr Pro Leu Trp Ser Gln Ser Tyr Glu Asp Ser Ser Asn Gln Glu Glu 580 585 590Glu Gly Pro Ser Thr Phe Pro Asp Leu Glu Ser Glu Phe Gln Ala Ala 595 600 605Leu Ser Arg Lys Val Ala Glu Leu Val His Phe Leu Leu Leu Lys Tyr 610 615 620Arg Ala Arg Glu Pro Val Thr Lys Ala Glu Met Leu Gly Ser Val Val625 630 635 640Gly Asn Trp Gln Tyr Phe Phe Pro Val Ile Phe Ser Lys Ala Ser Ser 645 650 655Ser Leu Gln Leu Val Phe Gly Ile Glu Leu Met Glu Val Asp Pro Ile 660 665 670Gly His Leu Tyr Ile Phe Ala Thr Cys Leu Gly Leu Ser Tyr Asp Gly 675 680 685Leu Leu Gly Asp Asn Gln Ile Met Pro Lys Ala Gly Leu Leu Ile Ile 690 695 700Val Leu Ala Ile Ile Ala Arg Glu Gly Asp Cys Ala Pro Glu Glu Lys705 710 715 720Ile Trp Glu Glu Leu Ser Val Leu Glu Val Phe Glu Gly Arg Glu Asp 725 730 735Ser Ile Leu Gly Asp Pro Lys Lys Leu Leu Thr Gln His Phe Val Gln 740 745 750Glu Asn Tyr Leu Glu Tyr Arg Gln Val Pro Gly Ser Asp Pro Ala Cys 755 760 765Tyr Glu Phe Leu Trp Gly Pro Arg Ala Leu Val Glu Thr Ser Tyr Val 770 775 780Lys Val Leu His His Met Val Lys Ile Ser Gly Gly Pro His Ile Ser785 790 795 800Tyr Pro Pro Leu His Glu Trp Val Leu Arg Glu Gly Glu Glu Ala Gln 805 810 815Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro 820 825 830Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro 835 840 845Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala 850 855 860Ala Arg Ala Ser Gly Pro Gly Gly Gly Ala Pro Arg Gly Pro His Gly865 870 875 880Gly Ala Ala Ser Gly Leu Asn Gly Cys Cys Arg Cys Gly Ala Arg Gly 885 890 895Pro Glu Ser Arg Leu Leu Glu Phe Tyr Leu Ala Met Pro Phe Ala Thr 900 905 910Pro Met Glu Ala Glu Leu Ala Arg Arg Ser Leu Ala Gln Asp Ala Pro 915 920 925Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly 930 935 940Asn Ile Leu Thr Ile Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln945 950 955 960Leu Ser Ile Ser Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile 965 970 975Thr Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln 980 985 990Arg Arg Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser 995 1000 1005Ser Ala Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys 1010 1015 1020Ala Glu Tyr His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile 1025 1030 1035Phe Ser Tyr Thr Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile 1040 1045 1050Ile Thr Phe Lys Asn Gly Ala Thr Phe Gln Val Glu Val Pro Gly 1055 1060 1065Ser Gln His Ile Asp Ser Gln Lys Lys Ala Ile Glu Arg Met Lys 1070 1075 1080Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala Lys Val Glu Lys 1085 1090 1095Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile Ala Ala Ile 1100 1105 1110Ser Met Ala Asn Leu Glu His His His His His His 1115 1120 112557975PRTArtificial SequenceSynthetic 57Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile 35 40 45Gly Ser Leu Leu Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser 50 55 60Leu Ile Ile Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala65 70 75 80Glu His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Ala 85 90 95Gly Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Lys Tyr 100 105 110Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Glu Phe Glu 115 120 125Leu Arg Arg Gln Asp Asp Lys Ala Met Ala Met Gln Ala Glu Gly Arg 130 135 140Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly145 150 155 160Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly 165 170 175Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser 180 185 190Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser 195 200 205Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala Arg Arg Pro Asp Ser Arg 210 215 220Leu Leu Glu Leu His Ile Thr Met Pro Phe Ser Ser Pro Met Glu Ala225 230 235 240Glu Leu Val Arg Arg Ile Leu Ser Arg Asp Ala Ala Pro Leu Pro Arg 245 250 255Pro Gly Ala Val Leu Lys Asp Phe Thr Val Ser Gly Asn Leu Leu Phe 260 265 270Met Ser Val Arg Asp Gln Asp Arg Glu Gly Ala Gly Arg Met Arg Val 275 280 285Val Gly Trp Gly Leu Gly Ser Ala Ser Pro Glu Gly Gln Lys Ala Arg 290 295 300Asp Leu Arg Thr Pro Lys His Lys Val Ser Glu Gln Arg Pro Gly Thr305 310 315 320Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln Gly Asp Gly Cys Arg Gly 325 330 335Val Ala Phe Asn Val Met Phe Ser Ala Pro His Ile Pro Leu Glu Gln 340 345 350Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu Ala Arg Gly Glu 355 360 365Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr Glu Glu Gln Glu 370 375 380Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr Leu Gly Glu Val385 390 395 400Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro Gln Gly Ala Ser 405 410 415Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser Gln Ser Tyr Glu 420 425 430Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr Phe Pro Asp Leu 435 440 445Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val Ala Glu Leu Val 450 455 460His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro Val Thr Lys Ala465 470 475 480Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr Phe Phe Pro Val 485 490 495Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val Phe Gly Ile Glu 500 505 510Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile Phe Ala Thr Cys 515 520 525Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn Gln Ile Met Pro 530 535 540Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile Ala Arg Glu Gly545 550 555 560Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu Ser Val Leu Glu 565 570 575Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp Pro Lys Lys Leu 580 585 590Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu Tyr Arg Gln Val 595 600 605Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp Gly Pro Arg Ala 610 615 620Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His Met Val Lys Ile625 630 635 640Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His Glu Trp Val Leu 645 650 655Arg Glu Gly Glu Glu Ala Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser 660 665 670Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro 675 680 685Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg 690 695 700Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly705 710 715 720Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly Leu Asn Gly Cys 725 730 735Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu Leu Glu Phe Tyr 740 745 750Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu Leu Ala Arg Arg 755 760 765Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu 770 775 780Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala785 790 795 800Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser Cys Leu Gln Gln 805 810 815Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu 820 825 830Ala Gln Pro Pro Ser Gly Gln Arg Arg Ile Lys Leu Lys Phe Gly Val 835 840 845Phe Phe Thr Val Leu Leu Ser Ser Ala Tyr Ala His Gly Thr Pro Gln 850 855 860Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln Ile His Thr865 870 875 880Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu Ala Gly Lys Arg 885 890 895Glu Met Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr Phe Gln Val Glu 900 905 910Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala Ile Glu Arg 915 920 925Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala Lys Val Glu 930 935 940Lys Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile Ala Ala Ile945 950 955 960Ser Met Ala Asn Ala Ala Ala Leu Glu His His His His His His 965 970

975581052PRTArtificial SequenceSynthetic 58Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile 35 40 45Gly Ser Leu Leu Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser 50 55 60Leu Ile Ile Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala65 70 75 80Glu His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Ala 85 90 95Gly Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Lys Tyr 100 105 110Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Glu Phe Glu 115 120 125Leu Arg Arg Gln Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro 130 135 140Ser Gly Lys Thr Leu Gly Ser Asp Val Glu Glu Asp Leu Thr Met Thr145 150 155 160Arg Asn Pro Leu Lys Met Leu Asn Ile Pro Ser Ile Asn Val His His 165 170 175Tyr Ala Cys Thr Ser Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu 180 185 190Thr Glu Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala Gln 195 200 205Ala Cys Gly Arg Asp Asp Lys Ala Met Ala Met Gln Ala Glu Gly Arg 210 215 220Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly225 230 235 240Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly 245 250 255Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser 260 265 270Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser 275 280 285Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala Arg Arg Pro Asp Ser Arg 290 295 300Leu Leu Glu Leu His Ile Thr Met Pro Phe Ser Ser Pro Met Glu Ala305 310 315 320Glu Leu Val Arg Arg Ile Leu Ser Arg Asp Ala Ala Pro Leu Pro Arg 325 330 335Pro Gly Ala Val Leu Lys Asp Phe Thr Val Ser Gly Asn Leu Leu Phe 340 345 350Met Ser Val Arg Asp Gln Asp Arg Glu Gly Ala Gly Arg Met Arg Val 355 360 365Val Gly Trp Gly Leu Gly Ser Ala Ser Pro Glu Gly Gln Lys Ala Arg 370 375 380Asp Leu Arg Thr Pro Lys His Lys Val Ser Glu Gln Arg Pro Gly Thr385 390 395 400Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln Gly Asp Gly Cys Arg Gly 405 410 415Val Ala Phe Asn Val Met Phe Ser Ala Pro His Ile Pro Leu Glu Gln 420 425 430Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu Ala Arg Gly Glu 435 440 445Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr Glu Glu Gln Glu 450 455 460Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr Leu Gly Glu Val465 470 475 480Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro Gln Gly Ala Ser 485 490 495Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser Gln Ser Tyr Glu 500 505 510Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr Phe Pro Asp Leu 515 520 525Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val Ala Glu Leu Val 530 535 540His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro Val Thr Lys Ala545 550 555 560Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr Phe Phe Pro Val 565 570 575Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val Phe Gly Ile Glu 580 585 590Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile Phe Ala Thr Cys 595 600 605Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn Gln Ile Met Pro 610 615 620Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile Ala Arg Glu Gly625 630 635 640Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu Ser Val Leu Glu 645 650 655Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp Pro Lys Lys Leu 660 665 670Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu Tyr Arg Gln Val 675 680 685Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp Gly Pro Arg Ala 690 695 700Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His Met Val Lys Ile705 710 715 720Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His Glu Trp Val Leu 725 730 735Arg Glu Gly Glu Glu Ala Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser 740 745 750Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro 755 760 765Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg 770 775 780Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly785 790 795 800Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly Leu Asn Gly Cys 805 810 815Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu Leu Glu Phe Tyr 820 825 830Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu Leu Ala Arg Arg 835 840 845Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu 850 855 860Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala865 870 875 880Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser Cys Leu Gln Gln 885 890 895Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu 900 905 910Ala Gln Pro Pro Ser Gly Gln Arg Arg Ile Lys Leu Lys Phe Gly Val 915 920 925Phe Phe Thr Val Leu Leu Ser Ser Ala Tyr Ala His Gly Thr Pro Gln 930 935 940Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln Ile His Thr945 950 955 960Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu Ala Gly Lys Arg 965 970 975Glu Met Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr Phe Gln Val Glu 980 985 990Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala Ile Glu Arg 995 1000 1005Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala Lys Val 1010 1015 1020Glu Lys Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile Ala 1025 1030 1035Ala Ile Ser Met Ala Asn Leu Glu His His His His His His 1040 1045 105059757PRTArtificial SequenceSynthetic 59Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser1 5 10 15Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp 20 25 30Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Met Gln 35 40 45Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro 50 55 60Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro65 70 75 80Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala 85 90 95Ala Arg Ala Ser Gly Pro Arg Gly Gly Ala Pro Arg Gly Pro His Gly 100 105 110Gly Ala Ala Ser Ala Gln Asp Gly Arg Cys Pro Cys Gly Ala Arg Arg 115 120 125Pro Asp Ser Arg Leu Leu Glu Leu His Ile Thr Met Pro Phe Ser Ser 130 135 140Pro Met Glu Ala Glu Leu Val Arg Arg Ile Leu Ser Arg Asp Ala Ala145 150 155 160Pro Leu Pro Arg Pro Gly Ala Val Leu Lys Asp Phe Thr Val Ser Gly 165 170 175Asn Leu Leu Phe Met Ser Val Arg Asp Gln Asp Arg Glu Gly Ala Gly 180 185 190Arg Met Arg Val Val Gly Trp Gly Leu Gly Ser Ala Ser Pro Glu Gly 195 200 205Gln Lys Ala Arg Asp Leu Arg Thr Pro Lys His Lys Val Ser Glu Gln 210 215 220Arg Pro Gly Thr Pro Gly Pro Pro Pro Pro Glu Gly Ala Gln Gly Asp225 230 235 240Gly Cys Arg Gly Val Ala Phe Asn Val Met Phe Ser Ala Pro His Ile 245 250 255Pro Leu Glu Gln Arg Ser Gln His Cys Lys Pro Glu Glu Gly Leu Glu 260 265 270Ala Arg Gly Glu Ala Leu Gly Leu Val Gly Ala Gln Ala Pro Ala Thr 275 280 285Glu Glu Gln Glu Ala Ala Ser Ser Ser Ser Thr Leu Val Glu Val Thr 290 295 300Leu Gly Glu Val Pro Ala Ala Glu Ser Pro Asp Pro Pro Gln Ser Pro305 310 315 320Gln Gly Ala Ser Ser Leu Pro Thr Thr Met Asn Tyr Pro Leu Trp Ser 325 330 335Gln Ser Tyr Glu Asp Ser Ser Asn Gln Glu Glu Glu Gly Pro Ser Thr 340 345 350Phe Pro Asp Leu Glu Ser Glu Phe Gln Ala Ala Leu Ser Arg Lys Val 355 360 365Ala Glu Leu Val His Phe Leu Leu Leu Lys Tyr Arg Ala Arg Glu Pro 370 375 380Val Thr Lys Ala Glu Met Leu Gly Ser Val Val Gly Asn Trp Gln Tyr385 390 395 400Phe Phe Pro Val Ile Phe Ser Lys Ala Ser Ser Ser Leu Gln Leu Val 405 410 415Phe Gly Ile Glu Leu Met Glu Val Asp Pro Ile Gly His Leu Tyr Ile 420 425 430Phe Ala Thr Cys Leu Gly Leu Ser Tyr Asp Gly Leu Leu Gly Asp Asn 435 440 445Gln Ile Met Pro Lys Ala Gly Leu Leu Ile Ile Val Leu Ala Ile Ile 450 455 460Ala Arg Glu Gly Asp Cys Ala Pro Glu Glu Lys Ile Trp Glu Glu Leu465 470 475 480Ser Val Leu Glu Val Phe Glu Gly Arg Glu Asp Ser Ile Leu Gly Asp 485 490 495Pro Lys Lys Leu Leu Thr Gln His Phe Val Gln Glu Asn Tyr Leu Glu 500 505 510Tyr Arg Gln Val Pro Gly Ser Asp Pro Ala Cys Tyr Glu Phe Leu Trp 515 520 525Gly Pro Arg Ala Leu Val Glu Thr Ser Tyr Val Lys Val Leu His His 530 535 540Met Val Lys Ile Ser Gly Gly Pro His Ile Ser Tyr Pro Pro Leu His545 550 555 560Glu Trp Val Leu Arg Glu Gly Glu Glu Ala Gln Ala Glu Gly Arg Gly 565 570 575Thr Gly Gly Ser Thr Gly Asp Ala Asp Gly Pro Gly Gly Pro Gly Ile 580 585 590Pro Asp Gly Pro Gly Gly Asn Ala Gly Gly Pro Gly Glu Ala Gly Ala 595 600 605Thr Gly Gly Arg Gly Pro Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly 610 615 620Pro Gly Gly Gly Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly625 630 635 640Leu Asn Gly Cys Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu 645 650 655Leu Glu Phe Tyr Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu 660 665 670Leu Ala Arg Arg Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro 675 680 685Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile 690 695 700Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser705 710 715 720Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu 725 730 735Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln Arg Arg Leu Glu His 740 745 750His His His His His 755

Claims

1. A fusion peptide of CD4 helper T cell epitopes comprising a cytomegalovirus (CMV) epitope and/or an influenza virus epitope.

2. The epitope fusion peptide of claim 1, comprising one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23.

3. The epitope fusion peptide of claim 1 or 2, consisting of one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23; preferably, the epitope fusion peptide consists of or 10 CMV epitopes, and/or 8 or 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 34 or 44; preferably, the epitope fusion peptide consists of 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 48.

4. The epitope fusion peptide of any one of claims 1-3 that induces a humoral or cellular immune response.

5. A fusion protein comprising an epitope fusion peptide of any one of claims 1 to 4, and a target immunogen.

6. The fusion protein of claim 5, wherein the target immunogen is selected from a peptide, an antigen, a hapten, a carbohydrate, a protein, a nucleic acid, an allergen, a virus or a part of a virus, a bacterium, a parasite or other whole microorganism; preferably, the antigen is a tumor antigen or an infection-related antigen; further preferably, the tumor antigen is one or more tumor antigens selected from lung cancer antigen, testicular cancer antigen, melanoma antigen, liver cancer antigen, breast cancer antigen or prostate cancer antigen; preferably, the tumor antigen is one or more tumor antigens selected from LACE antigen, MAGE antigen or NY-ESO-1 antigen; further preferably, the LACE antigen is LAGE-1, and the MAGE antigen is MAGE-A3; preferably, the amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO: 26; still further preferably, the tumor antigen comprises LAGE-1, MAGE-A3 and NY-ESO-1; preferably, the infection-related antigen is one or more infection-related antigens selected from an HIV antigen, an influenza virus antigen or an HBV antigen; preferably, the fusion protein is shown in one of SEQ ID NOs: 55-58.

7. A polynucleotide encoding the epitope fusion peptide of any one of claims 1-4 or the fusion protein of claim 5 or 6.

8. An immunogenic composition comprising a prophylactically or therapeutically effective amount of the epitope fusion peptide of any one of claims 1-4, the thsion protein of claim 5 or 6, and/or the polynucleotide of claim 7, and a pharmaceutically acceptable carrier.

9. The immunogenic composition of claim 8 in the form of a vaccine. 10, A kit comprising the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9, and instructions for use thereof.

11. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, a polynucleotide of claim 7 and/or an immunogenic composition of claim 8 or 9 in the preparation of a medicament for increasing the immunogenicity of a target immunogen.

12. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9 in the preparation of a vaccine for increasing the immunogenicity of a target immunogen.

13. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9 in the preparation of a medicament for treating or preventing a condition in a subject in need thereof.

14. The use of claim 13, wherein the condition is one or more conditions selected from malignant tumors, and bacterial and viral chronic infections.

15. The use of claim 14, wherein the malignant tumor is breast cancer or colon cancer.