Patent application title: ANTISENSE NUCLEIC ACID FOR TREATING AMYOTROPHY
Inventors:
IPC8 Class: AC12N15113FI
USPC Class:
1 1
Class name:
Publication date: 2020-04-23
Patent application number: 20200123546
Abstract:
There has been a demand for a novel antisense nucleic acid or the like
capable of inhibiting myostatin at the mRNA level. The present invention
provides a specific antisense oligomer which allows exon 2 skipping in
the myostatin gene or induces degradation of mRNA of the myostatin gene.Claims:
1.-22. (canceled)
23. Any one antisense oligomer selected from the group consisting of (A) to (H) shown below or a pharmaceutically acceptable salt or hydrate thereof: (A) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene; (B) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene; (C) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene; (D) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene; (E) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene; (F) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene; (G) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and (H) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
24. Any one antisense oligomer selected from the group consisting of (I) to (L) shown below or a pharmaceutically acceptable salt or hydrate thereof: (I) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene; (J) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene, wherein the 3'-terminal base of the nucleotide sequence of 14 to 30 bases in length is a base located at position 140 from the 5'-terminal end of said exon 2; (K) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene; and (L) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene.
25. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (A) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 13 (NMS-17), SEQ ID NO: 76 (NMS-138), SEQ ID NO: 68 (NMS-120), SEQ ID NO: 75 (NMS-137), SEQ ID NO: 51 (NMS-76), SEQ ID NO: 52 (NMS-79), SEQ ID NO: 54 (NMS-81), SEQ ID NO: 55 (NMS-82), SEQ ID NO: 56 (NMS-83), SEQ ID NO: 53 (NMS-80), SEQ ID NO: 33 (NMS-49), SEQ ID NO: 63 (NMS-114), SEQ ID NO: 69 (NMS-124), SEQ ID NO: 70 (NMS-125), SEQ ID NO: 61 (NMS-110), SEQ ID NO: 31 (NMS-46), SEQ ID NO: 34 (NMS-50), SEQ ID NO: 50 (NMS-75), SEQ ID NO: 45 (NMS-67) and SEQ ID NO: 64 (NMS-115).
26. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (B) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 3 (NMS-6), SEQ ID NO: 66 (NMS-118), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 28 (NMS-33), SEQ ID NO: 72 (NMS-127), SEQ ID NO: 16 (NMS-20), SEQ ID NO: 82 (NMS-187) and SEQ ID NO: 25 (NMS-30).
27. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (C) consists of a nucleotide sequence shown in SEQ ID NO: 12 (NMS-16).
28. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (D) consists of a nucleotide sequence shown in SEQ ID NO: 4 (NMS-7).
29. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (E) consists of a nucleotide sequence shown in SEQ ID NO: 90 (NMS-51).
30. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (F) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 91 (NMS-52), SEQ ID NO: 28 (NMS-33) and SEQ ID NO: 25 (NMS-30), SEQ ID NO: 41 (NMS-61), SEQ ID NO: 24 (NMS-29), SEQ ID NO: 42 (NMS-62), SEQ ID NO: 43 (NMS-63), SEQ ID NO: 11 (NMS-15), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 80 (NMS-161) and SEQ ID NO: 82 (NMS-187).
31. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (G) consists of a nucleotide sequence shown in SEQ ID NO: 7 (NMS-10).
32. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer (H) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 4 (NMS-7), SEQ ID NO: 9 (NMS-12), SEQ ID NO: 10 (NMS-14) and SEQ ID NO: 14 (NMS-18).
33. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof claim 23, wherein the antisense oligomer is an oligonucleotide.
34. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 33, wherein at least one sugar moiety and/or at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is modified.
35. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 34, wherein the at least one sugar moiety in nucleotides constituting the oligonucleotide is a ribose in which the --OH group at the 2'-position is substituted with any group selected from the group consisting of OR, R, R'OR, SH, SR, NH.sub.2, NHR, NR.sub.2, N.sub.3, CN, F, Cl, Br and I (wherein R represents alkyl or aryl, and R' represents alkylene).
36. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 34, wherein the at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoroamidate bond and a boranophosphate bond.
37. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23, wherein the antisense oligomer is a morpholino oligomer.
38. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 37, wherein the morpholino oligomer is a phosphorodiamidate morpholino oligomer.
39. The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 37, whose 5'-terminal end is any one of the groups represented by chemical formulae (1) to (3) shown below: ##STR00022##
40. A pharmaceutical composition comprising the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23.
41. The pharmaceutical composition according to claim 40, which further comprises a pharmaceutically acceptable carrier.
42. The pharmaceutical composition according to claim 40 or 41 for use in the treatment of an amyotrophic disease or a muscle wasting disease.
43. The pharmaceutical composition according to claim 42 for use in the treatment of muscular dystrophy.
44. A method for prevention or treatment of an amyotrophic disease or a muscle wasting disease, which comprises administering a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease with a therapeutically effective amount of the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 23.
45. The method according to claim 44, wherein the amyotrophic disease or muscle wasting disease is muscular dystrophy.
46. The method according to claim 44, wherein the subject is a human subject.
47-48. (canceled)
Description:
TECHNICAL FIELD
[0001] The present invention relates to an antisense oligomer which allows exon 2 skipping in the myostatin gene, and a pharmaceutical composition comprising such an oligomer.
BACKGROUND ART
[0002] Myostatin (also known as GDF-8) was discovered in 1997 as a novel cytokine belonging to the TGF-.beta. superfamily. Its expression is specific to skeletal muscle which is a primary tissue responsible for movement and metabolism. Myostatin-deficient mutant animals show significant muscle hypertrophy where skeletal muscle mass is increased twice as much as in wild-type animals, so that myostatin is considered to be a negative control factor for skeletal muscle mass.
[0003] Based on the above findings, a therapeutic strategy can be designed to treat amyotrophic diseases or muscle wasting diseases through inhibition of myostatin. Skeletal muscle atrophy will induce not only limitation of daily living activities due to muscle weakness, but also serious systemic complications such as undernutrition and respiratory failure. Target diseases of this therapeutic strategy may include myogenic amyotrophy (e.g., muscular dystrophy, congenital myopathy, inclusion body myositis), neurogenic amyotrophy (e.g., amyotrophic lateral sclerosis, spinal muscular atrophy, spinal and bulbar muscular atrophy), disuse amyotrophy (e.g., apoplexy-induced disuse syndrome), muscle wasting diseases (e.g., cancer cachexia, sepsis-related amyotrophy), various types of sarcopenia including age-related skeletal muscle loss (age-related sarcopenia), etc.
[0004] The human myostatin gene is located on the long arm of chromosome 2. From three exons constituting this gene, mature mRNA having a chain length of approximately 2.8 kilobases is transcribed and further translated into a precursor polypeptide consisting of 375 amino acid residues. Myostatin precursor polypeptide molecules form a dimer through disulfide bonding between their C-terminal domains, and then cleaved between amino acid residues at positions 266 and 267 (R-D) in endoplasmic reticulum by the actin of a protease of the Furin family, so that the precursor dimer is divided into an N-terminal propeptide and a C-terminal domain dimer which will function later as active myostatin. These peptides are associated through non-covalent bonding and secreted as an inactive complex into the extracellular environment. This complex is further dissociated when the N-terminal propeptide is cleaved off between amino acid residues at positions 98 and 99 (R-D) by the action of a matrix metalloprotease of the BMP1/Tolloid family, whereby an active myostatin dimer appears.
[0005] In recent years, attention has been focused on antisense nucleic acid drugs, which are designed and chemically synthesized as short antisense artificial nucleic acids binding complementarily to a part of precursor mRNA in an attempt to inhibit mRNA function. In the normal mechanism of gene transcription, introns in precursor mRNA are cleaved and removed by the action of an enzyme complex called spliceosome to thereby generate mature mRNA. An antisense nucleic acid for exon skipping is designed to modify this spliceosome-mediated splicing regulatory mechanism and induce the generation of mRNA different from normal mature mRNA, thereby inhibiting the function of the gene. Moreover, mRNA is associated not only with the spliceosome, but also with an mRNA-stabilizing protein or an expression/translation regulatory factor (including miRNA) for regulation of mRNA degradation, expression and translation. An antisense nucleic acid is also considered to inhibit the association of such an mRNA-binding protein to its target mRNA, thereby inhibiting the function of the gene.
[0006] Currently, some antisense nucleic acids have been known to cause exon skipping in myostatin (Patent Documents 1 to 3 and Non-patent Documents 1 to 4).
PRIOR ART DOCUMENTS
Patent Documents
[0007] Patent Document 1: US2013/0085139A1
[0008] Patent Document 2: WO2006/086667A2
[0009] Patent Document 3: JP2007-104971A
Non-patent Documents
[0010] Non-patent Document 1: Kang J K et al., Mol. Ther. (2011) 19(1):159-164
[0011] Non-patent Document 2: Kemaladewi et al., BMC Med Genomics. (2011) 4:36
[0012] Non-patent Document 3: Alberto Malerba et al., Mol. Ther. Nucleic Acids. (2012) 1:e62
[0013] Non-patent Document 4: Bestas B et al., Nucleic Acid Ther. (2014) 24(1):13-24
SUMMARY OF THE INVENTION
Problem to be Solved by the Invention
[0014] Under such circumstances as described above, there has been a demand for a novel antisense nucleic acid capable of inhibiting myostatin at the mRNA level.
Means to Solve the Problem
[0015] As a result of repeating extensive and intensive efforts to solve the problem stated above, the inventors of the present invention have found that myostatin can be efficiently inhibited at the mRNA level when a particular function inhibitory antisense nucleic acid is applied to the myostatin gene. This finding led to the completion of the present invention.
[0016] Namely, the present invention is as follows.
[0017] [1]
[0018] An antisense oligomer of 14 to 30 bases in length comprising the following unit oligomers connected together:
[0019] (a) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence consisting of contiguous 7 to 15 bases in exon 2 of the human or mouse myostatin gene; and
[0020] (b) a second unit oligomer comprising a nucleotide sequence complementary to a second nucleotide sequence consisting of contiguous 7 to 15 bases in said exon 2,
[0021] wherein the first nucleotide sequence and the second nucleotide sequence are not contiguous to each other or do not overlap with each other, or a pharmaceutically acceptable salt or hydrate thereof.
[0022] [2]
[0023] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [1] above, wherein the antisense oligomer is (c) or (d) shown below:
[0024] (c) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (c-1) to (c-6) shown below:
[0025] (c-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0026] (c-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0027] (c-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0028] (c-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 166 to 210 from the 5' -terminal end of exon 2 in the human myostatin gene;
[0029] (c-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene; and
[0030] (c-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene; or
[0031] (d) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (d-1) to (d-7) shown below:
[0032] (d-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0033] (d-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0034] (d-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0035] (d-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0036] (d-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0037] (d-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0038] (d-7) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
[0039] [3]
[0040] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [1] above, wherein the antisense oligomer is (e) or (f) shown below:
[0041] (e) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (e-1) to (e-6) shown below:
[0042] (e-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0043] (e-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0044] (e-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0045] (e-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0046] (e-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene; and
[0047] (e-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene; or
[0048] (f) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (f-1) to (f-7) shown below:
[0049] (f-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0050] (f-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0051] (f-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0052] (f-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0053] (f-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 211 to 225 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0054] (f-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0055] (f-7) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
[0056] [4]
[0057] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [2] above, wherein the antisense oligomer (c) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 103 (NMS-48), SEQ ID NO: 116 (NMS-89), SEQ ID NO: 117 (NMS-90), SEQ ID NO: 120 (NMS-93), SEQ ID NO: 128 (NMS-101), SEQ ID NO: 131 (NMS-104), SEQ ID NO: 136 (NMS-113), SEQ ID NO: 137 (NMS-117), SEQ ID NO: 140 (NMS-123), SEQ ID NO: 145 (NMS-136), SEQ ID NO: 146 (NMS-139), SEQ ID NO: 147 (NMS-140), SEQ ID NO: 148 (NMS-141), SEQ ID NO: 149 (NMS-142), SEQ ID NO: 152 (NMS-145), SEQ ID NO: 155 (NMS-148), SEQ ID NO: 156 (NMS-149), SEQ ID NO: 157 (NMS-150), SEQ ID NO: 159 (NMS-152), SEQ ID NO: 162 (NMS-156), SEQ ID NO: 163 (NMS-157), SEQ ID NO: 165 (NMS-162), SEQ ID NO: 166 (NMS-163), SEQ ID NO: 167 (NMS-164), SEQ ID NO: 168 (NMS-166), SEQ ID NO: 169 (NMS-167), SEQ ID NO: 170 (NMS-168), SEQ ID NO: 171 (NMS-169), SEQ ID NO: 176 (NMS-174), SEQ ID NO: 177 (NMS-175), SEQ ID NO: 178 (NMS-176), SEQ ID NO: 179 (NMS-177), SEQ ID NO: 180 (NMS-178), SEQ ID NO: 183 (NMS-181), SEQ ID NO: 187 (NMS-185), SEQ ID NO: 189 (NMS-188), SEQ ID NO: 190 (NMS-189), SEQ ID NO: 191 (NMS-190), SEQ ID NO: 192 (NMS-191), SEQ ID NO: 193 (NMS-192), SEQ ID NO: 196 (NMS-195), SEQ ID NO: 199 (NMS-198), SEQ ID NO: 200 (NMS-199), SEQ ID NO: 201 (NMS-200), SEQ ID NO: 203 (NMS-202), SEQ ID NO: 204 (NMS-203), SEQ ID NO: 206 (NMS-206), SEQ ID NO: 208 (NMS-208), SEQ ID NO: 212 (NMS-212), SEQ ID NO: 213 (NMS-213), SEQ ID NO: 214 (NMS-214), SEQ ID NO: 215 (NMS-215), SEQ ID NO: 217 (NMS-217), SEQ ID NO: 225 (NMS-225), SEQ ID NO: 226 (NMS-228), SEQ ID NO: 228 (NMS-230), SEQ ID NO: 229 (NMS-231), SEQ ID NO: 231 (NMS-233), SEQ ID NO: 232 (NMS-234), SEQ ID NO: 233 (NMS-235), SEQ ID NO: 236 (NMS-240), SEQ ID NO: 237 (NMS-241), SEQ ID NO: 240 (NMS-244), SEQ ID NO: 243 (NMS-247), SEQ ID NO: 244 (NMS-248), SEQ ID NO: 245 (NMS-249), SEQ ID NO: 246 (NMS-250), SEQ ID NO: 247 (NMS-251), SEQ ID NO: 248 (NMS-252), SEQ ID NO: 252 (NMS-256), SEQ ID NO: 261 (NMS-272), SEQ ID NO: 273 (NMS-284), SEQ ID NO: 274 (NMS-285), SEQ ID NO: 275 (NMS-286) and SEQ ID NO: 277 (NMS-297).
[0058] [5]
[0059] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [2] above, wherein the antisense oligomer (d) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 95 (NMS-38), SEQ ID NO: 96 (NMS-39), SEQ ID NO: 107 (NMS-66), SEQ ID NO: 223 (NMS-223), SEQ ID NO: 234 (NMS-238), SEQ ID NO: 235 (NMS-239), SEQ ID NO: 242 (NMS-246), SEQ ID NO: 249 (NMS-253), SEQ ID NO: 250 (NMS-254), SEQ ID NO: 251 (NMS-255), SEQ ID NO: 257 (NMS-268), SEQ ID NO: (NMS-280), SEQ ID NO: (NMS-281), SEQ ID NO: (NMS-282), SEQ ID NO: (NMS-288), SEQ ID NO: (NMS-289), SEQ ID NO: (NMS-290), SEQ ID NO: (NMS-292), SEQ ID NO: (NMS-293), SEQ ID NO: (NMS-294), SEQ ID NO: (NMS-295), SEQ ID NO: (NMS-298), SEQ ID NO: (NMS-299), SEQ ID NO: (NMS-300), SEQ ID NO: (NMS-302) and SEQ ID NO: (NMS-303).
[0060] [6]
[0061] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [5] above, wherein the antisense oligomer is an oligonucleotide.
[0062] [7]
[0063] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [6] above, wherein at least one sugar moiety and/or at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is modified.
[0064] [8]
[0065] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [7] above, wherein the at least one sugar moiety in nucleotides constituting the oligonucleotide is a ribose in which the -OH group at the 2'-position is substituted with any group selected from the group consisting of OR, R, R'OR, SH, SR, NH.sub.2, NHR, NR.sub.2, N.sub.3, CN, F, Cl, Br and I (wherein R represents alkyl or aryl, and R' represents alkylene).
[0066] [9]
[0067] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [7] or [8] above, wherein the at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoroamidate bond and a boranophosphate bond.
[0068] [10]
[0069] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [5] above, wherein the antisense oligomer is a morpholino oligomer.
[0070] [11]
[0071] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [10] above, wherein the morpholino oligomer is a phosphorodiamidate morpholino oligomer.
[0072] [12]
[0073] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [10] or [11] above, whose 5'-terminal end is any one of the groups represented by chemical formulae (1) to (3) shown below.
##STR00001##
[0074] [13]
[0075] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [4] and [6] to [12] above, wherein the antisense oligomer consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 171 (NMS-169), SEQ ID NO: 192 (NMS-191), SEQ ID NO: 245 (NMS-249) and SEQ ID NO: 231 (NMS-233).
[0076] [14]
[0077] A pharmaceutical composition comprising the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [3] to [13] above.
[0078] [15]
[0079] The pharmaceutical composition according to [14] above, which further comprises a pharmaceutically acceptable carrier.
[0080] [16]
[0081] The pharmaceutical composition according to [14] or [15] above for use in the treatment of an amyotrophic disease or a muscle wasting disease.
[0082] [17]
[0083] The pharmaceutical composition according to [16] above for use in the treatment of muscular dystrophy.
[0084] [18]
[0085] A method for prevention or treatment of an amyotrophic disease or a muscle wasting disease, which comprises administering a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease with a therapeutically effective amount of the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [13] above.
[0086] [19]
[0087] The method according to [18] above, wherein the amyotrophic disease or muscle wasting disease is muscular dystrophy.
[0088] [20]
[0089] The method according to [18] or [19] above, wherein the subject is a human subject.
[0090] [21]
[0091] Use of the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [13] above in the manufacture of a pharmaceutical composition for treatment of an amyotrophic disease or a muscle wasting disease.
[0092] [22]
[0093] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [13] above for use in the treatment of an amyotrophic disease or a muscle wasting disease.
[0094] [23]
[0095] Any one antisense oligomer selected from the group consisting of (A) to (H) shown below or a pharmaceutically acceptable salt or hydrate thereof:
[0096] (A) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0097] (B) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0098] (C) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0099] (D) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0100] (E) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0101] (F) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0102] (G) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0103] (H) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5 `-terminal end of exon 2 in the mouse myostatin gene.
[0104] [24]
[0105] Any one antisense oligomer selected from the group consisting of (I) to (L) shown below or a pharmaceutically acceptable salt or hydrate thereof:
[0106] (I) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5`-terminal end of exon 2 in the human myostatin gene;
[0107] (J) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene, wherein the 3'-terminal base of the nucleotide sequence of 14 to 30 bases in length is a base located at position 140 from the 5'-terminal end of said exon 2;
[0108] (K) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene; and
[0109] (L) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene.
[0110] [25]
[0111] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (A) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 13 (NMS-17), SEQ ID NO: 76 (NMS-138), SEQ ID NO: 68 (NMS-120), SEQ ID NO: 75 (NMS-137), SEQ ID NO: 51 (NMS-76), SEQ ID NO: 52 (NMS-79), SEQ ID NO: 54 (NMS-81), SEQ ID NO: 55 (NMS-82), SEQ ID NO: 56 (NMS-83), SEQ ID NO: 53 (NMS-80), SEQ ID NO: 33 (NMS-49), SEQ ID NO: 63 (NMS-114), SEQ ID NO: 69 (NMS-124), SEQ ID NO: 70 (NMS-125), SEQ ID NO: 61 (NMS-110), SEQ ID NO: 31 (NMS-46), SEQ ID NO: 34 (NMS-50), SEQ ID NO: 50 (NMS-75), SEQ ID NO: 45 (NMS-67) and SEQ ID NO: 64 (NMS-115).
[0112] [26]
[0113] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (B) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 3 (NMS-6), SEQ ID NO: 66 (NMS-118), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 28 (NMS-33), SEQ ID NO: 72 (NMS-127), SEQ ID NO: 16 (NMS-20), SEQ ID NO: 82 (NMS-187) and SEQ ID NO: 25 (NMS-30).
[0114] [27]
[0115] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (C) consists of a nucleotide sequence shown in SEQ ID NO: 12 (NMS-16).
[0116] [28]
[0117] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (D) consists of a nucleotide sequence shown in SEQ ID NO: 4 (NMS-7).
[0118] [29]
[0119] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (E) consists of a nucleotide sequence shown in SEQ ID NO: 90 (NMS-51).
[0120] [30]
[0121] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (F) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 91 (NMS-52), SEQ ID NO: 28 (NMS-33) and SEQ ID NO: 25 (NMS-30), SEQ ID NO: 41 (NMS-61), SEQ ID NO: 24 (NMS-29), SEQ ID NO: 42 (NMS-62), SEQ ID NO: 43 (NMS-63), SEQ ID NO: 11 (NMS-15), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 80 (NMS-161) and SEQ ID NO: 82 (NMS-187).
[0122] [31]
[0123] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (G) consists of a nucleotide sequence shown in SEQ ID NO: 7 (NMS-10).
[0124] [32]
[0125] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [23] above, wherein the antisense oligomer (H) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 4 (NMS-7), SEQ ID NO: 9 (NMS-12), SEQ ID NO: 10 (NMS-14) and SEQ ID NO: 14 (NMS-18).
[0126] [33]
[0127] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [32] above, wherein the antisense oligomer is an oligonucleotide.
[0128] [34]
[0129] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [33] above, wherein at least one sugar moiety and/or at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is modified.
[0130] [35]
[0131] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [34] above, wherein the at least one sugar moiety in nucleotides constituting the oligonucleotide is a ribose in which the -OH group at the 2'-position is substituted with any group selected from the group consisting of OR, R, R'OR, SH, SR, NH.sub.2, NHR, NR.sub.2, N.sub.3, CN, F, Cl, Br and I (wherein R represents alkyl or aryl, and R' represents alkylene).
[0132] [36]
[0133] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [34] or [35] above, wherein the at least one phosphate bond moiety in nucleotides constituting the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoroamidate bond and a boranophosphate bond.
[0134] [37]
[0135] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [32] above, wherein the antisense oligomer is a morpholino oligomer.
[0136] [38]
[0137] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [37] above, wherein the morpholino oligomer is a phosphorodiamidate morpholino oligomer.
[0138] [39]
[0139] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to [37] or [38] above, whose 5'-terminal end is any one of the groups represented by chemical formulae (1) to (3) shown below.
##STR00002##
[0140] [40]
[0141] A pharmaceutical composition comprising the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [39] above.
[0142] [41]
[0143] The pharmaceutical composition according to [40] above, which further comprises a pharmaceutically acceptable carrier.
[0144] [42]
[0145] The pharmaceutical composition according to [40] or [41] above for use in the treatment of an amyotrophic disease or a muscle wasting disease.
[0146] [43]
[0147] The pharmaceutical composition according to [42] above for use in the treatment of muscular dystrophy.
[0148] [44]
[0149] A method for prevention or treatment of an amyotrophic disease or a muscle wasting disease, which comprises administering a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease with a therapeutically effective amount of the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [39] above.
[0150] [45]
[0151] The method according to [44] above, wherein the amyotrophic disease or muscle wasting disease is muscular dystrophy.
[0152] [46]
[0153] The method according to [44] or [45] above, wherein the subject is a human subject.
[0154] [47]
[0155] Use of the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [39] above in the manufacture of a pharmaceutical composition for treatment of an amyotrophic disease or a muscle wasting disease.
[0156] [48]
[0157] The antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to any one of [23] to [39] above for use in the treatment of an amyotrophic disease or a muscle wasting disease.
Effects of the Invention
[0158] Antisense oligomers according to some embodiments of the present invention allow induction of exon skipping in the myostatin gene. In addition, an amyotrophic disease or a muscle wasting disease can be prevented or treated when an antisense oligomer according to a preferred embodiment of the present invention or a pharmaceutically acceptable salt or hydrate thereof is administered to a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0159] FIG. 1 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0160] FIG. 2 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0161] FIG. 3 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0162] FIG. 4 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0163] FIG. 5 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0164] FIG. 6 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0165] FIG. 7 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0166] FIG. 8 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0167] FIG. 9 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0168] FIG. 10 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0169] FIG. 11 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0170] FIG. 12 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0171] FIG. 13 is a graph showing the efficiency of exon 2 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0172] FIG. 14 is a graph showing the efficiency of exon 3 skipping in the human myostatin gene in a human rhabdomyosarcoma cell line (RD cells).
[0173] FIG. 15 shows the results of Test Example 2.
DESCRIPTION OF EMBODIMENTS
[0174] The present invention will be described in more detail below. The following embodiments are illustrated to describe the present invention, and it is not intended to limit the present invention only to these embodiments. The present invention can be implemented in various modes without departing from the spirit of the present invention.
[0175] It should be noted that all publications cited herein, including prior art documents, patent gazettes and other patent documents, are incorporated herein by reference. Moreover, this specification incorporates the contents disclosed in the specification and drawings of Japanese Patent Application No. 2015-18214 (filed on September 16, 2015), based on which the present application claims priority.
[0176] 1. Antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof
[0177] The present invention provides an antisense oligomer which allows exon 2 skipping in the myostatin gene, or a pharmaceutically acceptable salt or hydrate thereof (hereinafter collectively referred to as "the antisense oligomer of the present invention").
[0178] The following "antisense oligomer A of the present invention" and "antisense oligomer B of the present invention" may also be collectively referred to as "the antisense oligomer of the present invention."
[0179] 1.1. Antisense oligomer A of the Present Invention
[0180] The antisense oligomer A of the present invention is an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of (a) and (b) shown below, or a pharmaceutically acceptable salt or hydrate thereof:
[0181] (a) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence consisting of contiguous 7 to 15 bases in exon 2 of the human or mouse myostatin gene; and
[0182] (b) a second unit oligomer comprising a nucleotide sequence complementary to a second nucleotide sequence consisting of contiguous 7 to 15 bases in said exon 2,
[0183] wherein the first nucleotide sequence and the second nucleotide sequence are not contiguous to each other or do not overlap with each other.
[0184] The antisense oligomer A of the present invention is more specifically an antisense oligomer shown in (c) or (d) below, or a pharmaceutically acceptable salt or hydrate thereof:
[0185] (c) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (c-1) to (c-6) shown below:
[0186] (c-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0187] (c-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0188] (c-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0189] (c-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0190] (c-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene; and (c-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene; or
[0191] (d) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (d-1) to (d-7) shown below:
[0192] (d-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -1 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0193] (d-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0194] (d-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0195] (d-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0196] (d-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0197] (d-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0198] (d-7) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
[0199] Further, the antisense oligomer A of the present invention is more specifically an antisense oligomer shown in (e) or (f) below, or a pharmaceutically acceptable salt or hydrate thereof:
[0200] (e) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (e-1) to (e-6) shown below:
[0201] (e-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0202] (e-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0203] (e-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0204] (e-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0205] (e-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene; and
[0206] (e-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene; or
[0207] (f) an antisense oligomer of 14 to 30 bases in length comprising connected two unit oligomers selected from the group consisting of unit oligomers (f-1) to (f-7) shown below:
[0208] (f-1) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0209] (f-2) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0210] (f-3) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0211] (f-4) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0212] (f-5) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 211 to 225 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0213] (f-6) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0214] (f-7) a unit oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence consisting of contiguous 7 to 15 bases selected from a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
[0215] In the antisense oligomer A of the present invention, the term "gene" is intended to include not only a genomic gene, but also cDNA, precursor mRNA, and mRNA. The gene is preferably precursor mRNA, i.e., pre-mRNA.
[0216] Pre-mRNA transcribed from the myostatin gene contains three exons and two introns in the order of (5'-terminal end) exon 1, intron 1, exon 2, intron 2 and exon 3 (3'-terminal end). Pre-mRNA is spliced to generate mature mRNA. The nucleotide sequences of the human and mouse wild-type myostatin genes are known (RefSeq Accession No. NM_005259 (human) and RefSeq Accession No. NM 010834 (mouse), respectively). The nucleotide sequence of exon 2 in the wild-type myostatin gene is as shown below:
[0217] exon 2 (human): SEQ ID NO: 323; and
[0218] exon 2 (mouse): SEQ ID NO: 324.
[0219] In the above unit oligomer (c-1), the "nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 337.
[0220] In the above unit oligomer (c-2), the "nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 338.
[0221] In the above unit oligomer (c-3), the "nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 339.
[0222] In the above unit oligomer (c-4), the "nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 340.
[0223] In the above unit oligomer (c-5), the "nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 341.
[0224] In the above unit oligomer (c-6), the "nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 342.
[0225] In the above unit oligomer (d-1), the "nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 343.
[0226] In the above unit oligomer (d-2), the "nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 344.
[0227] In the above unit oligomer (d-3), the "nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 345.
[0228] In the above unit oligomer (d-4), the "nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 346.
[0229] In the above unit oligomer (d-5), the "nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 347.
[0230] In the above unit oligomer (d-6), the "nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 364.
[0231] In the above unit oligomer (d-7), the "nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 348.
[0232] In the above unit oligomer (e-1), the "nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 349.
[0233] In the above unit oligomer (e-2), the "nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 350.
[0234] In the above unit oligomer (e-3), the "nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 351.
[0235] In the above unit oligomer (e-4), the "nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 352.
[0236] In the above unit oligomer (e-5), the "nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 353.
[0237] In the above unit oligomer (e-6), the "nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 354.
[0238] In the above unit oligomer (f-1), the "nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 355.
[0239] In the above unit oligomer (f-2), the "nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 356.
[0240] In the above unit oligomer (f-3), the "nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 357.
[0241] In the above unit oligomer (f-4), the "nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 358.
[0242] In the above unit oligomer (f-5), the "nucleotide sequence located at positions 211 to 225 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 359.
[0243] In the above unit oligomer (f-6), the "nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 365.
[0244] In the above unit oligomer (f-7), the "nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 366.
[0245] The antisense oligomer A of the present invention has now been prepared to cause exon 2 skipping in the myostatin gene with the aim of modifying a protein encoded by the myostatin gene into a mutant protein lacking the function of myostatin. The "function of myostatin" refers to, for example, the function or activity to negatively control skeletal muscle mass. Thus, exon 2 in the myostatin gene to be skipped by the antisense oligomer A of the present invention includes not only wild-type, but also mutated forms.
[0246] More specifically, mutated exon 2 in the myostatin gene or a portion thereof is a polynucleotide shown in (a) or (b) below:
[0247] (a) a polynucleotide hybridizable under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 337 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 338 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 339 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 340 (a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 341 (a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 342 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 349 (a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 350 (a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 351 (a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 352 (a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 353 (a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 354 (a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 343 (a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 344 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 345 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 346 (a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 347 (a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 364 (a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 348 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 355 (a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 356 (a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 357 (a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 358 (a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 359 (a nucleotide sequence located at positions 211 to 255 from the 5% terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 365 (a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 366 (a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene); or
[0248] (b) a polynucleotide consisting of a nucleotide sequence sharing an identity of 90% or more with any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 337 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 338 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 339 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 340 (a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 341 (a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 342 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 349 (a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 350 (a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 351 (a nucleotide sequence located at positions 128 to 142 from the 5% terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 352 (a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 353 (a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 354 (a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 343 (a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 344 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 345 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 346 (a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 347 (a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 364 (a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 348 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 355 (a nucleotide sequence located at positions Ito 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 356 (a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 357 (a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 358 (a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 359 (a nucleotide sequence located at positions 211 to 255 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 365 (a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 366 (a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene).
[0249] As used herein, the term "polynucleotide" is intended to mean DNA or RNA.
[0250] As used herein, the expression "nucleotide sequence complementary" is not limited only to a nucleotide sequence forming Watson-Crick pairs with a target nucleotide sequence and also includes nucleotide sequences forming wobble base pairs with a target nucleotide sequence. In this regard, a Watson-Crick pair is intended to mean a base pair which forms hydrogen bonding between adenine and thymine, between adenine and uracil or between guanine and cytosine, whereas a wobble base pair is intended to mean a base pair which forms hydrogen bonding between guanine and uracil, between inosine and uracil, between inosine and adenine or between inosine and cytosine. Moreover, such a "nucleotide sequence complementary" does not necessarily have 100% complementarity to a target nucleotide sequence and may contain non-complementary bases (e.g., 1 to 3 bases, 1 or 2 bases, or a single base) to the target nucleotide sequence.
[0251] As used herein, the expression "polynucleotide hybridizable under stringent conditions" is intended to mean, for example, an antisense oligomer that can be obtained by means of colony hybridization, plaque hybridization, Southern hybridization or other hybridization techniques using, as a probe, the whole or a part of a polynucleotide consisting of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 337 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 338 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 339 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 340 (a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 341 (a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 342 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 349 (a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 350 (a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 351 (a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 352 (a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 353 (a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 354 (a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 343 (a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 344 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 345 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 346 (a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 347 (a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 364 (a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 348 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 355 (a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 356 (a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 357 (a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 358 (a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 359 (a nucleotide sequence located at positions 211 to 255 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 365 (a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 366 (a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene). For hybridization, it is possible to use techniques as described in, e.g., "Sambrook & Russell, Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor, Laboratory Press 2012" and "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997."
[0252] As used herein, the term "stringent conditions" may be any of low stringent conditions, moderately stringent conditions and high stringent conditions. "Low stringent conditions" refer to, for example, conditions of 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 32.degree. C. Likewise, "moderately stringent conditions" refer to, for example, conditions of 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 42.degree. C. or conditions of 5.times.SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide and 42.degree. C. "High stringent conditions" refer to, for example, conditions of (1) 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 50.degree. C., (2) 0.2.times.SSC, 0.1% SDS and 60.degree. C., (3) 0.2.times.SSC, 0.1% SDS and 62.degree. C., (4) 0.2.times.SSC, 0.1% SDS and 65.degree. C., or (5) 0.1.times.SSC, 0.1% SDS and 65.degree. C., but are not limited thereto. Under these conditions, it can be expected that an antisense oligomer having a higher sequence identity is more efficiently obtained at a higher temperature. However, the stringency of hybridization would be affected by a plurality of factors, including temperature, probe concentration, probe length, ionic strength, reaction time, salt concentration and so on. Those skilled in the art would be able to achieve the same stringency by selecting these factors as appropriate.
[0253] It should be noted that if a commercially available kit is used for hybridization, an Alkphos Direct Labelling and Detection System (GE Healthcare) may be used for this purpose, by way of example. In this case, hybridization may be accomplished in accordance with the protocol attached to the kit, i.e., a membrane may be incubated overnight with a labeled probe and then washed with a primary washing buffer containing 0.1% (w/v) SDS under conditions of 55.degree. C. to detect the hybridized antisense oligomer. Alternatively, if a commercially available reagent (e.g., PCR labeling mix (Roche Diagnostics)) is used for digoxigenin (DIG) labeling of a probe during probe preparation based on the whole or a part of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 337 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 338 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 339 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 340 (a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 341 (a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 342 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 349 (a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 350 (a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 351 (a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 352 (a nucleotide sequence located at positions 169 to 206 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 353 (a nucleotide sequence located at positions 209 to 228 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 354 (a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon .2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 343 (a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 344 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 345 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 346 (a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 347 (a nucleotide sequence located at positions 196 to 233 from the 5% terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 364 (a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 348 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 355 (a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 356 (a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 357 (a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 358 (a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 359 (a nucleotide sequence located at positions 211 to 255 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 365 (a nucleotide sequence located at positions 271 to 282 from the 5' -terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 366 (a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene), a DIG nucleic acid detection kit (Roche Diagnostics) may be used for detection of hybridization.
[0254] In addition to those listed above, other hybridizable antisense oligomers include polynucleotides sharing an identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 337 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 338 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 339 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 340 (a nucleotide sequence located at positions 166 to 210 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 341 (a nucleotide sequence located at positions 204 to 233 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 342 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 349 (a nucleotide sequence located at positions -4 to 25 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 350 (a nucleotide sequence located at positions 112 to 131 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 351 (a nucleotide sequence located at positions 128 to 142 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 352 (a nucleotide sequence located at positions 169 to 206 from the 5 `-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 353 (a nucleotide sequence located at positions 209 to 228 from the 5`-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 354 (a nucleotide sequence located at positions 331 to 365 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 343 (a nucleotide sequence located at positions -10 to 65 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 344 (a nucleotide sequence located at positions 91 to 135 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 345 (a nucleotide sequence located at positions 121 to 155 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 346 (a nucleotide sequence located at positions 151 to 210 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 347 (a nucleotide sequence located at positions 196 to 233 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 364 (a nucleotide sequence located at positions 266 to 295 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 348 (a nucleotide sequence located at positions 326 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 355 (a nucleotide sequence located at positions 1 to 18 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 356 (a nucleotide sequence located at positions 116 to 131 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 357 (a nucleotide sequence located at positions 130 to 140 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 358 (a nucleotide sequence located at positions 160 to 206 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 359 (a nucleotide sequence located at positions 211 to 255 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 365 (a nucleotide sequence located at positions 271 to 282 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 366 (a nucleotide sequence located at positions 341 to 365 from the 5'-terminal end of exon 2 in the mouse myostatin gene), as calculated by the homology search software BLAST using default parameters.
[0255] It should be noted that the identity of nucleotide sequences can be determined by BLAST (Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc. Natl. Acad. Sci. USA 90: 5873, 1993). If BLAST is used, default parameters in each program may be used.
[0256] The unit oligomers (hereinafter also simply referred to as "units") shown in (c) to (f) above each have a size of 7 to 15 bases in length, preferably 8 to 15 bases in length, 9 to 15 bases in length, 10 to 15 bases in length, 10 to 14 bases in length, 10 to 13 bases in length or 11 to 13 bases in length. The respective units shown in (c) to (1) above may be of the same or different size.
[0257] In the above antisense oligomer (c), either of two units selected from the group consisting of the above units (c-1) to (c-6) may be located at the 5'-terminal side.
[0258] In the above antisense oligomer (d), either of two units selected from the group consisting of the above units (d-1) to (d-7) may be located at the 5'-terminal side.
[0259] In the above antisense oligomer (e), either of two units selected from the group consisting of the above units (e-1) to (e-6) may be located at the 5'-terminal side.
[0260] In the above antisense oligomer (e), either of two units selected from the group consisting of the above units (f-1) to (f-7) may be located at the 5'-terminal side.
[0261] As used here, the term "connected" is intended to mean that two units are directly connected to each other. Namely, when two units are connected, it means that the 3'-terminal end of the unit located at the 5'-terminal side and the 5'-terminal end of the unit located at the 3'-terminal side form a phosphate bond or any of the following groups:
##STR00003##
(wherein X represents --OH, --CH.sub.2R.sup.1, --O--CH.sub.2R.sup.1, --S--CH.sub.2R.sup.1, --NR.sup.2R.sup.3 or F;
[0262] R.sup.1 represents H or alkyl;
[0263] R.sup.2 and R.sup.3, which may be the same or different, each represent H, alkyl, cycloalkyl or aryl;
[0264] Y.sub.1 represents O, S, CH.sub.2 or NR.sup.1;
[0265] Y.sub.2 represents O, S or NR.sup.1; and
[0266] Z represents O or S).
[0267] In a preferred embodiment of the antisense oligomer A of the present invention, the above antisense oligomer (c) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 103 (NMS-48), SEQ ID NO: 116 (NMS-89), SEQ ID NO: 117 (NMS-90), SEQ ID NO: 120 (NMS-93), SEQ ID NO: 128 (NMS-101), SEQ ID NO: 131 (NMS-104), SEQ ID NO: 136 (NMS-113), SEQ ID NO: 137 (NMS-117), SEQ ID NO: 140 (NMS-123), SEQ ID NO: 145 (NMS-136), SEQ ID NO: 146 (NMS-139), SEQ ID NO: 147 (NMS-140), SEQ ID NO: 148 (NMS-141), SEQ ID NO: 149 (NMS-142), SEQ ID NO: 152 (NMS-145), SEQ ID NO: 155 (NMS-148), SEQ ID NO: 156 (NMS-149), SEQ ID NO: 157 (NMS-150), SEQ ID NO: 159 (NMS-152), SEQ ID NO: 162 (NMS-156), SEQ ID NO: 163 (NMS-157), SEQ ID NO: 165 (NMS-162), SEQ ID NO: 166 (NMS-163), SEQ ID NO: 167 (NMS-164), SEQ ID NO: 168 (NMS-166), SEQ ID NO: 169 (NMS-167), SEQ ID NO: 170 (NMS-168), SEQ ID NO: 171 (NMS-169), SEQ ID NO: 176 (NMS-174), SEQ ID NO: 177 (NMS-175), SEQ ID NO: 178 (NMS-176), SEQ ID NO: 179 (NMS-177), SEQ ID NO: 180 (NMS-178), SEQ ID NO: 183 (NMS-181), SEQ ID NO: 187 (NMS-185), SEQ ID NO: 189 (NMS-188), SEQ ID NO: 190 (NMS-189), SEQ ID NO: 191 (NMS-190), SEQ ID NO: 192 (NMS-191), SEQ ID NO: 193 (NMS-192), SEQ ID NO: 196 (NMS-195), SEQ ID NO: 199 (NMS-198), SEQ ID NO: 200 (NMS-199), SEQ ID NO: 201 (NMS-200), SEQ ID NO: 203 (NMS-202), SEQ ID NO: 204 (NMS-203), SEQ ID NO: 206 (NMS-206), SEQ ID NO: 208 (NMS-208), SEQ ID NO: 212 (NMS-212), SEQ ID NO: 213 (NMS-213), SEQ ID NO: 214 (NMS-214), SEQ ID NO: 215 (NMS-215), SEQ ID NO: 217 (NMS-217), SEQ ID NO: 225 (NMS-225), SEQ ID NO: 226 (NMS-228), SEQ ID NO: 228 (NMS-230), SEQ ID NO: 229 (NMS-231), SEQ ID NO: 231 (NMS-233), SEQ ID NO: 232 (NMS-234), SEQ ID NO: 233 (NMS-235), SEQ ID NO: 236 (NMS-240), SEQ ID NO: 237 (NMS-241), SEQ ID NO: 240 (NMS-244), SEQ ID NO: 243 (NMS-247), SEQ ID NO: 244 (NMS-248), SEQ ID NO: 245 (NMS-249), SEQ ID NO: 246 (NMS-250), SEQ ID NO: 247 (NMS-251), SEQ ID NO: 248 (NMS-252), SEQ ID NO: 252 (NMS-256), SEQ ID NO: 261 (NMS-272), SEQ ID NO: 273 (NMS-284), SEQ ID NO: 274 (NMS-285), SEQ ID NO: 275 (NMS-286) and SEQ ID NO: 277 (NMS-297).
[0268] In another preferred embodiment of the antisense oligomer A of the present invention, the above antisense oligomer (d) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 95 (NMS-38), SEQ ID NO: 96 (NMS-39), SEQ ID NO: 107 (NMS-66), SEQ ID NO: 223 (NMS-223), SEQ ID NO: 234 (NMS-238), SEQ ID NO: 235 (NMS-239), SEQ ID NO: 242 (NMS-246), SEQ ID NO: 249 (NMS-253), SEQ ID NO: 250 (NMS-254), SEQ ID NO: 251 (NMS-255), SEQ ID NO: 257 (NMS-268), SEQ ID NO: (NMS-280), SEQ ID NO: (NMS-281), SEQ ID NO: (NMS-282), SEQ ID NO: (NMS-288), SEQ ID NO: (NMS-289), SEQ ID NO: (NMS-290), SEQ ID NO: (NMS-292), SEQ ID NO: (NMS-293), SEQ ID NO: (NMS-294), SEQ ID NO: (NMS-295), SEQ ID NO: (NMS-298), SEQ ID NO: (NMS-299), SEQ ID NO: (NMS-300), SEQ ID NO: (NMS-302) and SEQ ID NO: (NMS-303).
[0269] In a particularly preferred embodiment of the antisense oligomer A of the present invention, the above antisense oligomer (c) or (e) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 171 (NMS-169), SEQ ID NO: 192 (NMS-191), SEQ ID NO: 245 (NMS-249) and SEQ ID NO: 231 (NMS-233).
[0270] The expression "allowing exon 2 skipping in the myostatin gene" is intended to mean that upon binding the antisense oligomer A of the present invention to a transcript (e.g., pre-mRNA) of the human myostatin gene, the transcript is spliced to delete the whole or a part of exon 2 to thereby form mature mRNA which encodes mutant myostatin lacking the function of myostatin.
[0271] The antisense oligomer A of the present invention does not necessarily have a nucleotide sequence which is 100% complementary to a target sequence, as long as it allows exon 2 skipping in the myostatin gene. For example, the oligomer B of the present invention may contain non-complementary bases (e.g., 1 to 3 bases, 1 or 2 bases, or a single base) to the target sequence.
[0272] The term "binding" is used here to mean that once the antisense oligomer A of the present invention has been mixed with a transcript of the myostatin gene, both will be hybridized with each other under physiological conditions to form a duplex. The expression "under physiological conditions" is used here to mean conditions adjusted to mimic in vivo pH, salt composition and temperature, as exemplified by conditions of 25.degree. C. to 40.degree. C., preferably 37.degree. C., pH 5 to 8, preferably pH 7.4, and a sodium chloride concentration of 150 mM.
[0273] The efficiency of skipping is as described later.
[0274] The antisense oligomer A of the present invention may be an oligonucleotide, a morpholino oligomer or a peptide nucleic acid oligomer. Such an oligonucleotide, a morpholino oligomer or a peptide nucleic acid oligomer is as described later.
[0275] 1.2. Antisense Oligomer B of the Present Invention
[0276] The antisense oligomer B of the present invention is any one antisense oligomer selected from the group consisting of (A) to (H) shown below, or a pharmaceutically acceptable salt or hydrate thereof:
[0277] (A) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0278] (B) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0279] (C) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0280] (D) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0281] (E) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0282] (F) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene;
[0283] (G) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene; and
[0284] (H) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene.
[0285] In a more preferred embodiment, the antisense oligomer B of the present invention is any one antisense oligomer selected from the group consisting of (I) to (L) shown below, or a pharmaceutically acceptable salt or hydrate thereof:
[0286] (I) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene;
[0287] (J) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene, wherein the 3 `-terminal base of the nucleotide sequence of 14 to 30 bases in length is a base located at position 140 from the 5`-terminal end of said exon 2;
[0288] (K) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene; and
[0289] (L) an antisense oligomer consisting of a nucleotide sequence complementary to a nucleotide sequence of contiguous 14 to 30 bases in length selected from a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene.
[0290] In the antisense oligomer B of the present invention, the term "gene" is intended to include not only a genomic gene, but also cDNA, precursor mRNA, and mRNA. The gene is preferably precursor mRNA, i.e., pre-mRNA.
[0291] Pre-mRNA transcribed from the myostatin gene contains three exons and two introns in the order of (5'-terminal end) exon 1, intron 1, exon 2, intron 2 and exon 3 (3'-terminal end). Pre-mRNA is spliced to generate mature mRNA. The nucleotide sequences of the human and mouse wild-type myostatin genes are known (RefSeq Accession No. NM_005259 (human) and RefSeq Accession No. NM_010834 (mouse)). The nucleotide sequence of exon 2 in the wild-type myostatin gene is as shown below:
[0292] exon 2 (human): SEQ ID NO: 323; and
[0293] exon 2 (mouse): SEQ ID NO: 324.
[0294] A nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 (human) is shown in SEQ ID NO: 325.
[0295] A nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 (mouse) is shown in SEQ ID NO: 326.
[0296] In the above antisense oligomer (A), the "nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 327.
[0297] In the above antisense oligomer (B), the "nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 328.
[0298] In the above antisense oligomer (C), the "nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 329.
[0299] In the above antisense oligomer (D), the "nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 330.
[0300] In the above antisense oligomer (E), the "nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 331.
[0301] In the above antisense oligomer (F), the "nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 332.
[0302] In the above antisense oligomer (G), the "nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 333.
[0303] In the above antisense oligomer (H), the "nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene" is shown in SEQ ID NO: 334.
[0304] In the above antisense oligomer (I), the "nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 335.
[0305] In the above antisense oligomer (J), the "nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 336.
[0306] In the above antisense oligomer (K), the "nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 362.
[0307] In the above antisense oligomer (L), the "nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene" is shown in SEQ ID NO: 363.
[0308] The antisense oligomer B of the present invention has now been prepared to cause exon 2 skipping in the myostatin gene with the aim of modifying a protein encoded by the myostatin gene into a mutant protein lacking the function of myostatin. The "function of myostatin" refers to, for example, the function or activity to negatively control skeletal muscle mass. Thus, exon 2 in the myostatin gene to be skipped by the antisense oligomer B of the present invention includes not only wild-type, but also mutated forms.
[0309] More specifically, mutated exon 2 in the myostatin gene or a portion thereof is a polynucleotide shown in (a) or (b) below:
[0310] (a) a polynucleotide hybridizable under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 325 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 327 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 328 (a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 329 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 330 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 335 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 336 (a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 362 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 363 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 326 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 331 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 332 (a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 333 (a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 334 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene); or
[0311] (b) a polynucleotide consisting of a nucleotide sequence sharing an identity of 90% or more with any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 325 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 327 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 328 (a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 329 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 330 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 335 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 336 (a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 362 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 363 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 326 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 331 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 332 (a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 333 (a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 334 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene).
[0312] As used herein, the term "polynucleotide" is intended to mean DNA or RNA.
[0313] As used herein, the expression "nucleotide sequence complementary" is not limited only to a nucleotide sequence forming Watson-Crick pairs with a target nucleotide sequence and also includes nucleotide sequences forming wobble base pairs with a target nucleotide sequence. In this regard, a Watson-Crick pair is intended to mean a base pair which forms hydrogen bonding between adenine and thymine, between adenine and uracil or between guanine and cytosine, whereas a wobble base pair is intended to mean a base pair which forms hydrogen bonding between guanine and uracil, between inosine and uracil, between inosine and adenine or between inosine and cytosine. Moreover, such a "nucleotide sequence complementary" does not necessarily have 100% complementarity to a target nucleotide sequence and may contain non-complementary bases (e.g., 1 to 3 bases, 1 or 2 bases, or a single base) to the target nucleotide sequence.
[0314] As used herein, the expression "polynucleotide hybridizable under stringent conditions" is intended to mean, for example, an antisense oligomer that can be obtained by means of colony hybridization, plaque hybridization, Southern hybridization or other hybridization techniques using, as a probe, the whole or a part of a polynucleotide consisting of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 325 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 327 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 328 (a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 329 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 330 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 335 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 336 (a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 362 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 363 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 326 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 331 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 332 (a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 333 (a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 334 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene). For hybridization, it is possible to use techniques as described in, e.g., "Sambrook & Russell, Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor, Laboratory Press 2012" and "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997."
[0315] As used herein, the term "stringent conditions" may be any of low stringent conditions, moderately stringent conditions and high stringent conditions. "Low stringent conditions" refer to, for example, conditions of 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 32.degree. C. Likewise, "moderately stringent conditions" refer to, for example, conditions of 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 42.degree. C. or conditions of 5.times.SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide and 42.degree. C. "High stringent conditions" refer to, for example, conditions of (1) 5.times.SSC, 5.times.Denhardt's solution, 0.5% SDS, 50% formamide and 50.degree. C., (2) 0.2.times.SSC, 0.1% SDS and 60.degree. C., (3) 0.2.times.SSC, 0.1% SDS and 62.degree. C., (4) 0.2.times.SSC, 0.1% SDS and 65.degree. C., or (5) 0.1.times.SSC, 0.1% SDS and 65.degree. C., but are not limited thereto. Under these conditions, it can be expected that an antisense oligomer having a higher sequence identity is more efficiently obtained at a higher temperature. However, the stringency of hybridization would be affected by a plurality of factors, including temperature, probe concentration, probe length, ionic strength, reaction time, salt concentration and so on. Those skilled in the art would be able to achieve the same stringency by selecting these factors as appropriate.
[0316] It should be noted that if a commercially available kit is used for hybridization, an Alkphos Direct Labelling and Detection System (GE Healthcare) may be used for this purpose, by way of example. In this case, hybridization may be accomplished in accordance with the protocol attached to the kit, i.e., a membrane may be incubated overnight with a labeled probe and then washed with a primary washing buffer containing 0.1% (w/v) SDS under conditions of 55.degree. C. to detect the hybridized antisense oligomer. Alternatively, if a commercially available reagent (e.g., PCR labeling mix (Roche Diagnostics)) is used for digoxigenin (DIG) labeling of a probe during probe preparation based on the whole or a part of a nucleotide sequence complementary to any nucleotide sequence selected from the group consisting of SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 325 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 327 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 328 (a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 329 (a nucleotide sequence located at positions 146 to 180 from the 5' -terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 330 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 335 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 336 (a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 362 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 363 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 326 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 331 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 332 (a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 333 (a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 334 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), a DIG nucleic acid detection kit (Roche Diagnostics) may be used for detection of hybridization.
[0317] In addition to those listed above, other hybridizable antisense oligomers include polynucleotides sharing an identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with SEQ ID NO: 323 (exon 2 in the human myostatin gene), SEQ ID NO: 325 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 327 (a nucleotide sequence located at positions -10 to 45 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 328 (a nucleotide sequence located at positions 91 to 145 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 329 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 330 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 335 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 336 (a nucleotide sequence located at positions 111 to 140 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 362 (a nucleotide sequence located at positions 146 to 180 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 363 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the human myostatin gene), SEQ ID NO: 324 (exon 2 in the mouse myostatin gene), SEQ ID NO: 326 (a nucleotide sequence located at position -10 from the 5'-terminal end up to the 3'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 331 (a nucleotide sequence located at positions -10 to 31 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 332 (a nucleotide sequence located at positions 111 to 162 from the 5'-terminal end of exon 2 in the mouse myostatin gene), SEQ ID NO: 333 (a nucleotide sequence located at positions 166 to 195 from the 5'-terminal end of exon 2 in the mouse myostatin gene) and SEQ ID NO: 334 (a nucleotide sequence located at positions 331 to 374 from the 5'-terminal end of exon 2 in the mouse myostatin gene), as calculated by the homology search software BLAST using default parameters.
[0318] It should be noted that the identity of nucleotide sequences can be determined by BLAST (Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc. Natl. Acad. Sci. USA 90: 5873, 1993). If BLAST is used, default parameters in each program may be used.
[0319] The expression "allowing exon 2 skipping in the myostatin gene" is intended to mean that upon binding the antisense oligomer B of the present invention to a transcript (e.g., pre-mRNA) of the human myostatin gene, the transcript is spliced to delete the whole or a part of exon 2 to thereby form mature mRNA which encodes mutant myostatin lacking the function of myostatin.
[0320] The antisense oligomer B of the present invention does not necessarily have a nucleotide sequence which is 100% complementary to a target sequence, as long as it allows exon 2 skipping in the myostatin gene. For example, the antisense oligomer B of the present invention may contain non-complementary bases (e.g., 1 to 3 bases, 1 or 2 bases, or a single base) to the target sequence.
[0321] The term "binding" is used here to mean that once the antisense oligomer B of the present invention has been mixed with a transcript of the myostatin gene, both will be hybridized with each other under physiological conditions to form a duplex. The expression "under physiological conditions" is used here to mean conditions adjusted to mimic in vivo pH, salt composition and temperature, as exemplified by conditions of 25.degree. C. to 40.degree. C., preferably 37.degree. C., pH 5 to 8, preferably pH 7.4, and a sodium chloride concentration of 150 mM.
[0322] In another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (A) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 13 (NMS-17), SEQ ID NO: 76 (NMS-138), SEQ ID NO: 68 (NMS-120), SEQ ID NO: 75 (NMS-137), SEQ ID NO: 51 (NMS-76), SEQ ID NO: 52 (NMS-79), SEQ ID NO: 54 (NMS-81), SEQ ID NO: 55 (NMS-82), SEQ ID NO: 56 (NMS-83), SEQ ID NO: 53 (NMS-80), SEQ ID NO: 33 (NMS-49), SEQ ID NO: 63 (NMS-114), SEQ ID NO: 69 (NMS-124), SEQ ID NO: 70 (NMS-125), SEQ ID NO: 61 (NMS-110), SEQ ID NO: 31 (NMS-46), SEQ ID NO: 34 (NMS-50), SEQ ID NO: 50 (NMS-75), SEQ ID NO: 45 (NMS-67) and SEQ ID NO: 64 (NMS-115).
[0323] In a preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (B) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 3 (NMS-6), SEQ ID NO: 66 (NMS-118), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 28 (NMS-33), SEQ ID NO: 72 (NMS-127), SEQ ID NO: 16 (NMS-20), SEQ ID NO: 82 (NMS-187) and SEQ ID NO: 25 (NMS-30).
[0324] In another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (C) consists of a nucleotide sequence shown in SEQ ID NO: 12 (NMS-16).
[0325] In another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (D) consists of a nucleotide sequence shown in SEQ ID NO: 4 (NMS-7).
[0326] In yet another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (E) consists of a nucleotide sequence shown in SEQ ID NO: 90 (NMS-51).
[0327] In yet another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (F) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 91 (NMS-52), SEQ ID NO: 28 (NMS-33) and SEQ ID NO: 25 (NMS-30), SEQ ID NO: 41 (NMS-61), SEQ ID NO: 24 (NMS-29), SEQ ID NO: 42 (NMS-62), SEQ ID NO: 43 (NMS-63), SEQ ID NO: 11 (NMS-15), SEQ ID NO: 67 (NMS-119), SEQ ID NO: 80 (NMS-161) and SEQ ID NO: 82 (NMS-187).
[0328] In yet another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (G) consists of a nucleotide sequence shown in SEQ ID NO: 7 (NMS-10).
[0329] In yet another preferred embodiment of the antisense oligomer B of the present invention, the above antisense oligomer (H) consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 4 (NMS-7), SEQ ID NO: 9 (NMS-12), SEQ ID NO: 10 (NMS-14) and SEQ ID NO: 14 (NMS-18).
[0330] The efficiency of skipping is as described later.
[0331] The antisense oligomer B of the present invention may be an oligonucleotide, a morpholino oligomer or a peptide nucleic acid oligomer. Such an oligonucleotide, a morpholino oligomer or a peptide nucleic acid oligomer is as described later.
[0332] 1.3. Skipping Efficiency
[0333] To confiiui whether or not exon skipping was caused in the myostatin gene, the antisense oligomer of the present invention may be transfected into myostatin-expressing cells (e.g., human rhabdomyosarcoma cells) and a region around the exon in mRNA of the myostatin gene may be amplified by RT-PCR from the total RNA of the above myostatin-expressing cells, followed by nested PCR or sequencing analysis on the PCR amplification product.
[0334] The efficiency of skipping may be determined as follows: mRNA of the myostatin gene is collected from test cells and the mRNA is measured for the polynucleotide level "A" in the band with exon skipping and the polynucleotide level "B" in the band without exon skipping, followed by calculation based on these measured values of "A" and "B" according to the following equation.
Skipping efficiency (%)={A/(A+B)}.times.100
[0335] In a preferred embodiment, the antisense oligomer of the present invention causes exon skipping with an efficiency of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.
[0336] As to the calculation of skipping efficiency, reference may be made to WO2012/029986.
[0337] 1.4. Oligonucleotide, Morpholino Oligomer or Peptide Nucleic Acid Oligomer
[0338] The antisense oligomer of the present invention may be exemplified by an oligonucleotide, a morpholino oligomer or a peptide nucleic acid (PNA) oligomer, each being 14 to 30 bases in length. The antisense oligomer of the present invention is preferably 15 to 29 bases, 16 to 28 bases, 17 to 27 bases or 18 to 26 bases in length, and is preferably a morpholino oligomer.
[0339] The above oligonucleotide (hereinafter referred to as "the oligonucleotide of the present invention") is an antisense oligomer according to the present invention, whose constituent unit is a nucleotide, and such a nucleotide may be any of a ribonucleotide, a deoxyribonucleotide or a modified nucleotide.
[0340] A modified nucleotide refers to a ribonucleotide or deoxyribonucleotide whose nucleobase, sugar moiety and phosphate bond moiety are all or partly modified.
[0341] In the present invention, examples of a nucleobase include adenine, guanine, hypoxanthine, cytosine, thymine, uracil, or modified bases thereof. Such modified bases may be exemplified by pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosines (e.g., 5-methylcytosine), 5-alkyluracils (e.g., 5-ethyluracil), 5-halouracils (e.g., 5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidines (e.g., 6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2,6-diaminopurine, 2-aminopurine, isoguanine, indole, imidazole, xanthine and so on, but are not limited thereto.
[0342] Modifications to the sugar moiety may be exemplified by modifications at the 2'-position of ribose and modifications at the other positions of sugar. Examples of modifications at the 2'-position of ribose include modifications intended to replace the --OH group at the 2'-position of ribose with OR, R, R'OR, SH, SR, NH.sub.2, NHR, NR.sub.2, N.sub.3, CN, F, Cl, Br or I, wherein R represents alkyl or aryl, and R' represents alkylene.
[0343] Examples of modifications at the other positions of sugar include replacement of O with S at the 4'-position of ribose or deoxyribose, and bridging between 2'- and 4'-positions of sugar, as exemplified by LNAs (locked nucleic acids) or ENAs (2'-O,4'-C-ethylene-bridged nucleic acids), but are not limited thereto.
[0344] Modifications to the phosphate bond moiety may be exemplified by modifications intended to replace the phosphodiester bond with a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoroamidate bond or a boranophosphate bond (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, e.g., JP WO2006/129594 and JP WO2006/038608).
[0345] In the present invention, alkyl is preferably a linear or branched alkyl containing 1 to 6 carbon atoms. More specifically, examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl and isohexyl. Such an alkyl may be substituted with 1 to 3 substituents including halogen, alkoxy, cyano, nitro, etc.
[0346] In the present invention, cycloalkyl is preferably a cycloalkyl containing 5 to 12 carbon atoms. More specifically, examples include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl and cyclododecyl.
[0347] In the present invention, halogens include fluorine, chlorine, bromine and iodine. Alkoxy may be a linear or branched alkoxy containing 1 to 6 carbon atoms, as exemplified by methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentyloxy, n-hexyloxy, isohexyloxy and so on. Particularly preferred is an alkoxy containing 1 to 3 carbon atoms.
[0348] In the present invention, aryl is preferably an aryl containing 6 to 10 carbon atoms. More specifically, examples include phenyl, .alpha.-naphthyl and .beta.-naphthyl. Particularly preferred is phenyl. Such an aryl may be substituted with 1 to 3 substituents including alkyl, halogen, alkoxy, cyano, nitro, etc.
[0349] In the present invention, alkylene is preferably a linear or branched alkylene containing 1 to 6 carbon atoms. More specifically, examples include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene and 1-(methyl)tetramethylene.
[0350] In the present invention, acyl may be a linear or branched alkanoyl or an aroyl. Examples of such an alkanoyl include formyl, acetyl, 2-methylacetyl, 2,2-dimethylacetyl, propionyl, butyryl, isobutyryl, pentanoyl, 2,2-dimethylpropionyl, hexanoyl and so on. Examples of an aroyl include benzoyl, toluoyl and naphthoyl. Such an aroyl may be substituted at any substitutable position and may be substituted with alkyl(s).
[0351] The oligonucleotide of the present invention is preferably an antisense oligomer according to the present invention, whose constituent unit is a group represented by the following general formula, in which the --OH group at the 2'-position of ribose is substituted with methoxy and the phosphate bond moiety is a phosphorothioate bond:
##STR00004##
(wherein Base represents a nucleobase).
[0352] The oligonucleotide of the present invention may be readily synthesized with various automatic synthesizers (e.g., FOCUS (Aapptec), AKTA oligopilot plus 10/100 (GE Healthcare)), or alternatively, its synthesis may be entrusted to a third party (e.g., Promega, Takara, or Japan Bio Services), etc.
[0353] The morpholino oligomer of the present invention is an antisense oligomer according to the present invention, whose constituent unit is a group represented by the following general formula:
##STR00005##
(wherein Base is the same as defined above; and
[0354] W represents a group represented by any of the following formulae:
##STR00006##
(wherein X represents --CH.sub.2R.sup.1, --O--CH.sub.2R.sup.1, --S--CH.sub.2R.sup.1, --NR.sup.2R.sup.3 or F;
[0355] R.sup.1 represents H or alkyl;
[0356] R.sup.2 and R.sup.3, which may be the same or different, each represent H, alkyl, cycloalkyl or aryl;
[0357] Y.sub.1 represents O, S, CH.sub.2 or NR.sup.1;
[0358] Y.sub.2 represents O, S or NR.sup.1; and
[0359] Z represents O or S)).
[0360] The morpholino oligomer is preferably an oligomer whose constituent unit is a group represented by the following formula (i.e., a phosphorodiamidate morpholino oligomer (hereinafter referred to as "PMO")):
##STR00007##
(wherein Base, R.sup.2 and R.sup.3 are the same as defined above).
[0361] For example, the morpholino oligomer may be prepared in accordance with WO1991/009033 or WO2009/064471. In particular, PMO may be prepared in accordance with the procedures described in WO2009/064471 or may be prepared in accordance with the procedures shown below.
[0362] [Process for PMO Preparation]
[0363] As one embodiment of PMO, a compound represented by the following general formula (I) (hereinafter referred to as PMO (I)) may be given by way of example:
##STR00008##
[wherein each Base, R.sup.2 and R.sup.3 are the same as defined above; and
[0364] n is any integer in the range of 1 to 99, preferably any integer in the range of 13 to 29, 14 to 28 or 15 to 27, 16 to 26, 17 to 25].
[0365] PMO (I) may be prepared in accordance with known procedures, for example, by conducting the operations shown in the following steps.
[0366] Compounds and reagents used in the following steps are not limited in any way as long as they are commonly used for PMO preparation.
[0367] Moreover, all the following steps may be accomplished by the liquid phase method or the solid phase method (in accordance with instruction manuals or using a commercially available solid phase automatic synthesizer). When PMO is prepared by the solid phase method, it is desirable to use an automatic synthesizer in terms of simple operation and accurate synthesis.
[0368] (1) Step A:
[0369] This is a step where a compound represented by the following general formula (II) (hereinafter referred to as compound (II)) is treated with an acid to prepare a compound represented by the following general formula (III) (hereinafter referred to as compound (III)):
##STR00009##
[wherein n, R.sup.2 and R.sup.3 are the same as defined above;
[0370] each B.sup.P independently represents a nucleobase which may be protected;
[0371] T represents a trityl group, a monomethoxytrityl group or a dimethoxytrityl group; and
[0372] L represents hydrogen, acyl or a group represented by the following general formula (IV) (hereinafter referred to as group (IV))]:
##STR00010##
[0373] "Nucleobases" possible for BP may be exemplified by the same "nucleobases" as listed for Base, provided that amino groups or hydroxyl groups in these nucleobases for BP may be protected.
[0374] Protecting groups for these amino groups are not limited in any way as long as they are used as protecting groups for nucleic acids. More specifically, examples include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene. Protecting groups for hydroxyl groups include, for example, 2-cyanoethyl, 4-nitrophenethyl, phenylsulfonylethyl, methylsulfonylethyl, trimethylsilylethyl, phenyl which may be substituted with 1 to 5 electron withdrawing groups at any substitutable position(s), diphenylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, methylphenylcarbamoyl, 1-pyrrolidinylcarbamoyl, morpholinocarbamoyl, 4-(tert-butylcarboxy)benzyl, 4-[(dimethylamino)carboxy]benzyl, and 4-(phenylcarboxy)benzyl (see, e.g., WO2009/064471).
[0375] The "solid carrier" is not limited in any way as long as it is a carrier available for use in the solid phase reaction of nucleic acids, but it is desirable to use, for example, a carrier which (i) is sparingly soluble in reagents available for use in the synthesis of morpholino nucleic acid derivatives (e.g., dichloromethane, acetonitrile, tetrazole, N-methylimidazole, pyridine, acetic anhydride, lutidine, trifluoroacetic acid), (ii) is chemically stable against the reagents available for use in the synthesis of morpholino nucleic acid derivatives, (iii) can be chemically modified, (iv) can be loaded with desired morpholino nucleic acid derivatives, (v) has strength sufficient to withstand high pressure during processing, and (vi) has a certain range of particle size and distribution. More specifically, examples include swelling polystyrenes (e.g., aminomethyl polystyrene resin crosslinked with 1% divinylbenzene (200 to 400 mesh) (2.4 to 3.0 mmol/g) (Tokyo Chemical Industry Co., Ltd., Japan), Aminomethylated Polystyrene Resin HCl [divinylbenzene 1%, 100 to 200 mesh] (Peptide Institute, Inc., Japan)), non-swelling polystyrenes (e.g., Primer Support (GE Healthcare)), PEG chain-liked polystyrenes (e.g., NH2-PEG resin (Watanabe Chemical Industries, Ltd., Japan), TentaGel resin), controlled pore glass (CPG) (e.g., a product of CPG Inc.), oxalylated controlled pore glass (see, e.g., Alul et al., Nucleic Acids Research, Vol. 19, 1527 (1991)), TentaGel support-aminopolyethylene glycol-derivatized support (see, e.g., Wright et al., Tetrahedron Letters, Vol. 34, 3373 (1993)), and a Poros-polystyrene/divinylbenzene copolymer.
[0376] As a "linker," it is possible to use a known linker which is commonly used to link a nucleic acid or a morpholino nucleic acid derivative, and examples include 3-aminopropyl, succinyl, 2,2'-diethanol sulfonyl, and a long-chain alkylamino (LCAA).
[0377] This step may be accomplished by treating compound (II) with an acid.
[0378] Examples of an "acid" available for use in this step include trifluoroacetic acid, dichloroacetic acid or trichloroacetic acid. The amount of an acid to be used is, for example, reasonably in the range of 0.1 molar equivalents to 1000 molar equivalents, preferably in the range of 1 molar equivalent to 100 molar equivalents, relative to 1 mole of compound (II).
[0379] Moreover, it is possible to use an organic amine together with the above acid. Any organic amine may be used for this purpose, and examples include triethylamine. The amount of an organic amine to be used is, for example, reasonably in the range of 0.01 molar equivalents to 10 molar equivalents, preferably in the range of 0.1 molar equivalents to 2 molar equivalents, relative to 1 mole of the acid.
[0380] In a case where an acid and an organic amine are used as a salt or mixture in this step, examples include a salt or mixture of trifluoroacetic acid and triethylamine, more specifically a mixture containing 2 equivalents of trifluoroacetic acid and 1 equivalent of triethylamine.
[0381] An acid available for use in this step may be used by being diluted with an appropriate solvent to give a concentration in the range of 0.1% to 30%. Any solvent may be used for this purpose as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, alcohols (e.g., ethanol, isopropanol, trifluoroethanol), water, or mixtures thereof.
[0382] The reaction temperature in the above reaction is, for example, preferably in the range of 10.degree. C. to 50.degree. C., more preferably in the range of 20.degree. C. to 40.degree. C., and even more preferably in the range of 25.degree. C. to 35.degree. C.
[0383] The reaction time will vary depending on the type of acid to be used and/or the reaction temperature, but it is generally reasonably in the range of 0.1 minutes to 24 hours, and preferably in the range of 1 minute to 5 hours.
[0384] Moreover, after completion of this step, a base may optionally be added to neutralize the acid remaining in the system. Any "base" may be used for this purpose and examples include diisopropylethylamine. Such a base may be used by being diluted with an appropriate solvent to give a concentration in the range of 0.1% (v/v) to 30% (v/v).
[0385] Any solvent may be used in this step as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, alcohols (e.g., ethanol, isopropanol, trifluoroethanol), water, or mixtures thereof. The reaction temperature is, for example, preferably in the range of 10.degree. C. to 50.degree. C., more preferably in the range of 20.degree. C. to 40.degree. C., and even more preferably in the range of 25.degree. C. to 35.degree. C.
[0386] The reaction time will vary depending on the type of base to be used and/or the reaction temperature, but it is generally reasonably in the range of 0.1 minutes to 24 hours, and preferably in the range of 1 minute to 5 hours.
[0387] It should be noted that compound (II) in which n =1 and L is group (IV), i.e., a compound represented by the following general formula (IIa) (hereinafter referred to as compound (IIa)) may be prepared in accordance with the following procedures:
##STR00011##
[wherein B.sup.P, T, Linker and Solid carrier are the same as defined above].
[0388] Step 1:
[0389] This is a step where a compound represented by the following general formula (V) is treated with an acylating agent to prepare a compound represented by the following general formula (VI) (hereinafter referred to as compound (VI)):
##STR00012##
[wherein B.sup.P, T and Linker are the same as defined above; and
[0390] R.sup.4 represents a hydroxyl group, halogen, a carboxyl group or amino].
[0391] This step may be accomplished starting from compound (V) by any known reaction for linker introduction.
[0392] In particular, a compound represented by the following general formula (VIa) may be prepared by any process known as esterification reaction with the use of compound (V) and succinic anhydride:
##STR00013##
[wherein B.sup.P and T are the same as defined above].
[0393] Step 2:
[0394] This is a step where compound (VI) is reacted with a solid carrier by being treated with a condensing agent or the like to prepare compound (IIa):
##STR00014##
[wherein B.sup.P, R.sup.4, T, Linker and Solid carrier are the same as defined above].
[0395] This step may be accomplished by any process known as condensation reaction with the use of compound (VI) and a solid carrier.
[0396] Compound (II) in which n=2 to 99 (preferably any an integer in the range of 13 to 29, 14 to 28, 15 to 27, 16 to 26, or 17 to 25) and L is group (IV), i.e., a compound represented by the following general formula (IIa2) may be prepared starting from compound (IIa) by repeating desired times Steps A and B of the process for PMO preparation disclosed herein:
##STR00015##
[wherein B.sup.P, R.sup.2, R.sup.3, T, Linker and Solid carrier are the same as defined above; and
[0397] n' represents 1 to 98 (in particular embodiments, n' represents 1 to 28, 1 to 27, 1 to 26, 1 to 25, or 1 to 24)].
[0398] (2) Step B:
[0399] This is a step where compound (III) is treated with a morpholino monomer compound in the presence of a base to prepare a compound represented by the following general formula (VII) (hereinafter referred to as compound (VII)):
##STR00016##
[wherein each B.sup.P, L, n, R.sup.2, R.sup.3 and T are the same as defined above].
[0400] This step may be accomplished by treating compound (III) with a morpholino monomer compound in the presence of a base.
[0401] Such a morpholino monomer compound may be exemplified by a compound represented by the following general formula (VIII):
##STR00017##
[wherein B.sup.P, R.sup.2, R.sup.3 and T are the same as defined above].
[0402] Examples of a "base" available for use in this step include diisopropylethylamine, triethylamine or N-ethylmorpholine. The amount of a base to be used is, for example, reasonably in the range of 1 molar equivalent to 1000 molar equivalents, preferably in the range of 10 molar equivalents to 100 molar equivalents, relative to 1 mole of compound (III).
[0403] Such a morpholino monomer compound and a base available for use in this step may be used by being diluted with an appropriate solvent to give a concentration of 0.1% to 30%. Any solvent may be used for this purpose as long as it is inert to the reaction, and examples include N,N-dimethylimidazolidone, N-methylpiperidone, DMF, dichloromethane, acetonitrile, tetrahydrofuran, or mixtures thereof.
[0404] The reaction temperature is, for example, preferably in the range of 0.degree. C. to 100.degree. C., and more preferably in the range of 10.degree. C. to 50.degree. C.
[0405] The reaction time will vary depending on the type of base to be used and/or the reaction temperature, but it is generally reasonably in the range of 1 minute to 48 hours, and preferably in the range of 30 minutes to 24 hours.
[0406] Moreover, after completion of this step, an acylating agent may optionally be added. Examples of an "acylating agent" include acetic anhydride, acetic acid chloride and phenoxyacetic anhydride. Such an acylating agent may be used by being diluted with an appropriate solvent to give a concentration in the range of 0.1% to 30%, by way of example. Any solvent may be used for this purpose as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, tetrahydrofuran, alcohols (e.g., ethanol, isopropanol, trifluoroethanol), water, or mixtures thereof.
[0407] If necessary, it is possible to use a base (e.g., pyridine, lutidine, collidine, triethylamine, diisopropylethylamine, N-ethylmorpholine) together with an acylating agent. The amount of an acylating agent to be used is preferably in the range of 0.1 molar equivalents to 10000 molar equivalents, and more preferably in the range of 1 molar equivalent to 1000 molar equivalents. The amount of a base to be used is, for example, reasonably in the range of 0.1 molar equivalents to 100 molar equivalents, preferably in the range of 1 molar equivalent to 10 molar equivalents, relative to 1 mole of an acylating agent.
[0408] The reaction temperature in this reaction is preferably in the range of 10.degree. C. to 50.degree. C., more preferably in the range of 10.degree. C. to 50.degree. C., even more preferably in the range of 20.degree. C. to 40.degree. C., and still even more preferably in the range of 25.degree. C. to 35.degree. C. The reaction time will vary, e.g., depending on the type of acylating agent to be used and/or the reaction temperature, but it is generally reasonably in the range of 0.1 minutes to 24 hours, and preferably in the range of 1 minute to 5 hours.
[0409] (3) Step C:
[0410] This is a step where a deprotecting agent is used to remove the protecting groups from compound (VII) prepared in Step B, thereby preparing a compound represented by general formula (IX):
##STR00018##
[wherein Base, B.sup.P, L, n, R.sup.2, R.sup.3 and T are the same as defined above].
[0411] This step may be accomplished by treating compound (VII) with a deprotecting agent.
[0412] Examples of a "deprotecting agent" include concentrated aqueous ammonia and methylamine. Such a "deprotecting agent" available for use in this step may be used by being diluted with water, methanol, ethanol, isopropyl alcohol, acetonitrile, tetrahydrofuran, DMF, N,N-dimethylimidazolidinone, N-methylpiperidone, or a mixed solvent thereof. Among them, preferred is ethanol. The amount of a deprotecting agent to be used is, for example, reasonably in the range of 1 molar equivalent to 100000 molar equivalents, preferably in the range of 10 molar equivalents to 1000 molar equivalents, relative to 1 mole of compound (VII), by way of example.
[0413] The reaction temperature is, for example, reasonably in the range of 15.degree. C. to 75.degree. C., preferably in the range of 40.degree. C. to 70.degree. C., and more preferably in the range of 50.degree. C. to 60.degree. C. The reaction time for deprotection will vary depending on the type of compound (VII) and/or the reaction temperature, etc., but it is reasonably in the range of 10 minutes to 30 hours, preferably in the range of 30 minutes to 24 hours, and more preferably in the range of 5 hours to 20 hours.
[0414] (4) Step D:
[0415] This is a step where compound (LX) prepared in Step C is treated with an acid to prepare PMO (I):
##STR00019##
[wherein Base, n, R.sup.2, R.sup.3 and T are the same as defined above].
[0416] This step may be accomplished by adding an acid to compound (IX).
[0417] Examples of an "acid" available for use in this step include trichloroacetic acid, dichloroacetic acid, acetic acid, phosphoric acid and hydrochloric acid, etc. As to the amount of an acid to be used, it is reasonable to use the acid in an amount to give a solution pH, for example, in the range of 0.1 to 4.0, more preferably in the range of 1.0 to 3.0. Any solvent may be used in this step as long as it is inert to the reaction, and examples include acetonitrile, water, or mixed solvents thereof.
[0418] The reaction temperature is preferably in the range of 10.degree. C. to 50.degree. C., more preferably in the range of 20.degree. C. to 40.degree. C., and even more preferably in the range of 25.degree. C. to 35.degree. C. The reaction time for deprotection will vary depending on the type of compound (IX) and/or the reaction temperature, etc., but it is reasonably in the range of 0.1 minutes to 5 hours, preferably in the range of 1 minute to 1 hour, and more preferably in the range of 1 minute to 30 minutes.
[0419] PMO (I) may be obtained from the reaction mixture obtained in this step by commonly used separation and purification means including extraction, concentration, neutralization, filtration, centrifugation, recrystallization, C.sub.8 to C.sub.18 reversed-phase column chromatography, cation exchange column chromatography, anion exchange column chromatography, gel filtration column chromatography, high performance liquid chromatography, dialysis, ultrafiltration and other means, which may be used either alone or in combination, whereby desired PMO (I) can be isolated and purified (see, e.g., WO1991/09033).
[0420] In the case of using reversed-phase chromatography for purification of PMO (I), a mixed solution of 20 mM triethylamine/acetate buffer and acetonitrile may be used as an elution solvent, by way of example.
[0421] Likewise, in the case of using ion exchange chromatography for purification of PMO (I), a mixed solution of 1 M aqueous sodium chloride and 10 mM aqueous sodium hydroxide may be used, by way of example.
[0422] The peptide nucleic acid oligomer is an antisense oligomer according to the present invention, whose constituent unit is a group represented by the following general formula:
##STR00020##
(wherein Base is the same as defined above).
[0423] Peptide nucleic acids may be prepared, for example, in accordance with the documents listed below.
[0424] 1) P. E. Nielsen, M. Egholm, R. H. Berg, O. Buchardt, Science, 254, 1497 (1991)
[0425] 2) M. Egholm, O. Buchardt, P. E. Nielsen, R. H. Berg, Jacs., 114, 1895 (1992)
[0426] 3) K. L. Dueholm, M. Egholm, C. Behrens, L. Christensen, H. F. Hansen, T. Vulpius, K. H. Petersen, R. H. Berg, P. E. Nielsen, O. Buchardt, J. Org. Chem., 59, 5767 (1994)
[0427] 4) L. Christensen, R. Fitzpatrick, B. Gildea, K. H. Petersen, H. F. Hansen, T. Koch, M. Egholm, O. Buchardt, P. E. Nielsen, J. Coull, R. H. Berg, J. Pept. Sci., 1, 175 (1995)
[0428] 5) T. Koch, H. F. Hansen, P. Andersen, T. Larsen, H. G. Batz, K. Otteson, H. Orum, J. Pept. Res., 49, 80 (1997)
[0429] Moreover, the antisense oligomer of the present invention may be configured such that its 5'-terminal end is any one of the groups represented by chemical formulae (1) to (3) shown below, with (3) --OH being preferred.
##STR00021##
[0430] 2. Pharmaceutical Composition
[0431] In a preferred embodiment, the antisense oligomer of the present invention allows inhibition of myostatin at the mRNA level through induction of exon skipping or mRNA degradation. Thus, an amyotrophic disease or a muscle wasting disease can be prevented or treated when the antisense oligomer of the present invention according to this preferred embodiment, a pharmaceutically acceptable salt or hydrate thereof is administered to a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease.
[0432] In some embodiments of the present invention, there is provided a pharmaceutical composition comprising the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof as an active ingredient (hereinafter referred to as "the pharmaceutical composition of the present invention"). The pharmaceutical composition of the present invention is preferably provided for use in the treatment of a metabolic disorder (e.g., obesity, metabolic syndrome, diabetes), an amyotrophic disease or a muscle wasting disease. Examples of an amyotrophic disease or a muscle wasting disease include myogenic amyotrophy (e.g., muscular dystrophy (e.g., Duchenne muscular dystrophy, Fukuyama muscular dystrophy, myotonic dystrophy), congenital myopathy, inclusion body myositis), neurogenic amyotrophy (e.g., amyotrophic lateral sclerosis, spinal muscular atrophy, spinal and bulbar muscular atrophy), disuse amyotrophy (e.g., apoplexy-induced disuse syndrome), muscle wasting diseases (e.g., cancer cachexia, sepsis-related amyotrophy), various types of sarcopenia including age-related skeletal muscle loss (age-related sarcopenia), etc., with muscular dystrophy being preferred.
[0433] In some other embodiments of the present invention, there is provided a method for prevention or treatment of an amyotrophic disease or a muscle wasting disease, which comprises administering a subject in need of prevention or treatment of an amyotrophic disease or a muscle wasting disease with a therapeutically effective amount of the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof. In this method, the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof may be administered to the subject in the form of the pharmaceutical composition of the present invention.
[0434] In the context of the present invention, the term "subject" is intended to mean a human subject or a non-human warm-blooded animal, as exemplified by birds and non-human mammals (e.g., cow, monkey, cat, mouse, rat, guinea pig, hamster, pig, dog, rabbit, sheep, horse). The "subject" is preferably a human subject.
[0435] In some yet other embodiments of the present invention, there is provided use of the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof in the manufacture of a pharmaceutical composition for treatment of an amyotrophic disease or a muscle wasting disease.
[0436] In some yet other embodiments of the present invention, there is provided the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof for use in the treatment of an amyotrophic disease or a muscle wasting disease.
[0437] Examples of a pharmaceutically acceptable salt of the antisense oligomer of the present invention contained in the pharmaceutical composition of the present invention include alkali metal salts (e.g., sodium salt, potassium salt, lithium salt); alkaline earth metal salts (e.g., calcium salt, magnesium salt); metal salts (e.g., aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt); ammonium salt; organic amine salts (e.g., t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetramethylammonium salt, tris(hydroxymethyl)aminomethane salt); hydrohalic acid salts (e.g., hydrofluoride salt, hydrochloride salt, hydrobromide salt, hydroiodide salt); inorganic acid salts (i.e., nitrate salt, perchlorate salt, sulfate salt, phosphate salt); lower alkanesulfonic acid salts (e.g., methanesulfonate salt, trifluoromethanesulfonate salt, ethanesulfonate salt); arylsulfonic acid salts (e.g., benzenesulfonate salt, p-toluenesulfonate salt); organic acid salts (e.g., acetate salt, malate salt, fumarate salt, succinate salt, citrate salt, tartrate salt, oxalate salt, maleate salt); amino acid salts (e.g., glycine salt, lysine salt, arginine salt, ornithine salt, glutamate salt, aspartate salt), etc. These salts may be prepared in any known manner.
[0438] The antisense oligomer of the present invention contained in the pharmaceutical composition of the present invention may be in the form of a hydrate thereof. Such a hydrate may be prepared in any known manner.
[0439] The pharmaceutical composition of the present invention may be administered in any pharmaceutically acceptable mode, which may be selected as appropriate for the intended therapeutic method. However, in terms of easy delivery to muscle tissue, preferred are intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, oral administration, interstitial administration, percutaneous administration and so on. Moreover, the composition of the present invention may be in any dosage form, and examples include various types of injections, oral formulations, drops, inhalants, ointments, lotions, etc.
[0440] The pharmaceutical composition of the present invention comprises a carrier which promotes the delivery of the oligomer to muscle tissue. Such a carrier is not limited in any way as long as it is pharmaceutically acceptable, and examples include cationic carriers (e.g., cationic liposomes, cationic polymers) or viral envelope-based carriers. Examples of cationic liposomes include liposomes formed from 2-O-(2-diethylaminoethyl)carbamoyl-1,3-O-dioleoyl glycerol and a phospholipid as essential constituent members (hereinafter referred to as "liposome A"), Oligofectamine.RTM. (Invitrogen), Lipofectin.RTM. (Invitrogen), Lipofeetamine.RTM. (Invitrogen), Lipofectamine 2000.RTM. (Invitrogen), DMRIE-C.RTM. (Invitrogen), GeneSilencer.RTM. (Gene Therapy Systems), TransMessenger.RTM. (QIAGEN), TransIT TKO.RTM. (Mirus) and Nucleofector II (Lonza). Among them, preferred is liposome A. Examples of cationic polymers include JetSI.RTM. (Qbiogene) and Jet-PEI.RTM. (polyethyleneimine, Qbiogene). Examples of viral envelope-based carriers include GenomeOne.RTM. (HVJ-E liposomes, Ishihara Sangyo Kaisha, Ltd., Japan). Alternatively, it is also possible to use the pharmaceutical device shown in Japanese Patent No. 2924179 or the cationic carriers shown in JP WO2006/129594 and JP WO2008/096690.
[0441] For more details, reference may be made to U.S. Pat. Nos. 4,235,871 and 4,737,323, WO96/14057, "New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990) pages 33-104," etc.
[0442] The concentration of the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof contained in the pharmaceutical composition of the present invention will vary, e.g., depending on the type of carrier, but it is reasonably in the range of 0.1 nM to 100 .mu.M, and preferably in the range of 100 nM to 10 .mu.M. Likewise, the weight ratio of the carrier to the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof contained in the pharmaceutical composition of the present invention (i.e., the carrier/antisense oligomer or pharmaceutically acceptable salt or hydrate thereof ratio) will vary, e.g., depending on the properties of the oligomer and the type of the carrier, but it is reasonably in the range of 0.1 to 100, and preferably in the range of 0.1 to 10.
[0443] The pharmaceutical composition of the present invention may optionally comprise a pharmaceutically acceptable additive, in addition to the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof and a carrier as described above. Examples of such an additive include an emulsifier aid (e.g., a fatty acid containing 6 to 22 carbon atoms or a pharmaceutically acceptable salt thereof, albumin, dextran), a stabilizing agent (e.g., cholesterol, phosphatidic acid), an isotonizing agent (e.g., sodium chloride, glucose, maltose, lactose, sucrose, trehalose), and a pH adjuster (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, triethanolamine). These additives may be used either alone or in combination. The content of the additive(s) in the pharmaceutical composition of the present invention is reasonably 90% by weight or less, preferably 70% by weight or less, and more preferably 50% by weight or less.
[0444] The pharmaceutical composition of the present invention may be prepared by adding the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof to a dispersion of a carrier, followed by adequate stirring. An additive(s) may be added at any appropriate stage, either before or after adding the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof. Any aqueous solvent may be used for adding the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof as long as it is pharmaceutically acceptable, and examples include injectable water, injectable distilled water, electrolytic solutions (e.g., physiological saline), and sugar solutions (e.g., glucose solution, maltose solution). Moreover, in this case, conditions including pH and temperature may be selected as appropriate by those skilled in the art.
[0445] The pharmaceutical composition of the present invention may be formulated into a solution or a lyophilized formulation thereof, by way of example. Such a lyophilized formulation may be prepared in a standard manner by freeze-drying the pharmaceutical composition of the present invention in a solution form. For example, the pharmaceutical composition of the present invention in a solution form may be sterilized as appropriate and then dispensed in given amounts into vial bottles, followed by preliminary freezing under conditions of about -40.degree. C. to -20.degree. C. for about 2 hours, primary drying at about 0.degree. C. to 10.degree. C. under reduced pressure and then secondary drying at about 15.degree. C. to 25.degree. C. under reduced pressure. Moreover, in most cases, the vials may be purged with a nitrogen gas and then capped, thereby giving a lyophilized formulation of the pharmaceutical composition of the present invention.
[0446] Such a lyophilized formulation of the pharmaceutical composition of the present invention may generally be used after being reconstituted by addition of any appropriate solution (i.e., a reconstituting solution). Examples of such a reconstituting solution include injectable water, physiological saline, and other commonly used infusion solutions. The volume of such a reconstituting solution will vary, e.g., depending on the intended use and is not limited in any way, but it is reasonably 0.5- to 2-fold greater than the solution volume before freeze-drying, or 500 mL or less.
[0447] The dose for administration of the pharmaceutical composition of the present invention is desirably adjusted in consideration of the type of the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof contained therein, the intended dosage form, the condition of a subject such as age and body weight, the route of administration, and the nature and severity of a disease. If the subject is a human subject, the daily dose for adults is generally in the range of 0.1 mg to 10 g/human, preferably in the range of 1 mg to 1 g/human, calculated as the amount of the antisense oligomer of the present invention or a pharmaceutically acceptable salt or hydrate thereof. This numerical range may vary depending on the type of disease to be targeted, the mode of administration, and/or the type of target molecule. Thus, a dose lower than this range may be sufficient in some cases, or conversely, a dose higher than this range should be required in some cases. Moreover, the pharmaceutical composition of the present invention may be administered once to several times a day or at intervals of one to several days.
[0448] In another embodiment, the pharmaceutical composition of the present invention may be a pharmaceutical composition comprising a vector capable of expressing the antisense oligonucleotide of the present invention and a carrier as described above. Such an expression vector may be capable of expressing a plurality of antisense oligonucleotides according to the present invention. Such a pharmaceutical composition may optionally comprise a pharmaceutically acceptable additive, as described above. The concentration of the expression vector contained in this pharmaceutical composition will vary, e.g., depending on the type of carrier, but it is reasonably in the range of 0.1 nM to 100 .mu.M, and preferably in the range of 100 nM to 10 .mu.M. The weight ratio of the carrier to the expression vector contained in this pharmaceutical composition (i.e., the carrier/expression vector ratio) will vary, e.g., depending on the properties of the expression vector and the type of the carrier, but it is reasonably in the range of 0.1 to 100, and preferably in the range of 0.1 to 10. Moreover, the content of the carrier contained in this pharmaceutical composition is the same as described above, and procedures for preparation are also the same as described above.
[0449] It should be noted that all publications cited herein, including prior art documents, patent gazettes and other patent documents, are incorporated herein by reference.
[0450] The present invention will be further described in more detail below by way of the following illustrative examples, although the present invention is not limited thereto.
EXAMPLES
[0451] The present invention will be further described in more detail below by way of the following illustrative examples and test examples, although the present invention is not limited thereto.
Reference Example 1
4-{[(2S,6R)-6-(5-Methyl-2,4-dioxopyrimidin-1-yl)-4-tritylmorpholin-2-yl]me- thoxy}-4-oxobutanoic acid loaded on aminopolystyrene resin
Step 1: Preparation of 4-{[(2S,6R)-6-(5-methyl-2,4-dioxopyrimidin-1-yl)-4-tritylmorpholin-2-yl]m- ethoxy}-4-oxobutanoic acid
[0452] Under an argon atmosphere, 1-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]-5-methylpyrimidine-2- ,4-dione (41.11 g) and 4-dimethylaminopyridine (4-DMAP) (15.58 g) were suspended in dichloromethane (850 mL), and succinic anhydride (12.76 g) was then added thereto, followed by stirring at room temperature for 3.5 hours. The reaction solution was extracted with dichloromethane and 1 M aqueous sodium dihydrogen phosphate. The resulting organic layer was washed sequentially with 1 M aqueous sodium dihydrogen phosphate and saturated aqueous sodium chloride. The resulting organic layer was dried over sodium sulfate and concentrated under reduced pressure. To the resulting solid, dichloromethane (600 mL) was added to effect crystallization, followed by filtration. After additional dichloromethane (300 mL) was added, the crystals were stirred for 5 minutes, and then filtered and dried overnight under reduced pressure to obtain the desired product (50.2 g).
Step 2: Preparation of 4-{[(25,6R)-6-(5-methyl-2,4-dioxopyrimidin-1-yl)-4-tritylmorpholin-2-yl]m- ethoxy) -4-oxobutanoic acid loaded on aminopolystyrene resin
[0453] 4-[(2S,6R)-6-(5-Methyl-2,4-dioxopyrimidin-1-yl)-4-tritylmorpholin-2- -yl]methoxy}-4-oxobutanoic acid (50.2 g) was dissolved in pyridine (dehydrated) (600 mL), followed by addition of 4-DMAP (12.4 g) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (77.6 g). The aminopolystyrene resin Aminomethyl resin (a product of Watanabe Chemical Industries, Ltd., Japan, A00673, 200 to 400 mesh, 1 mmol/g, 1% DVB) (40.5 g) and triethylamine (69.6 mL) were then added to this mixture, followed by shaking at room temperature for 4 days. After the reaction, the resin was collected by filtration. The resulting resin was washed sequentially with pyridine, methanol and dichloromethane, and then dried under reduced pressure. To the resulting resin, tetrahydrofuran (dehydrated) (500 mL), acetic anhydride (104 mL) and 2,6-lutidine (128 mL) were added, followed by shaking at room temperature for 4 hours. The resin was collected by filtration, washed sequentially with pyridine, methanol and dichloromethane, and then dried under reduced pressure to obtain 59.0 g of the desired product.
[0454] To determine the loading amount of the desired product, the molar amount of trityl per gram of the resin was measured in a known mariner as UV absorbance at 409 nm. The loading amount on the resin was found to be 467.83 .mu.mol/g.
[0455] Conditions for UV measurement
[0456] Instrument: U-2910 (Hitachi, Ltd., Japan)
[0457] Solvent: methanesulfonic acid
[0458] Wavelength: 409 nm
[0459] .epsilon. value: 45000
Reference Example 2
4-{[(2S,6R)-6-(4-Benzamido-2-oxopyrimidin-1-yl)-4-tritylmorpholin-2-yl]met- hoxy}-4-oxobutanoic Acid Loaded on Aminopolystyrene Resin
[0460] The same procedures as shown in Reference Example 1 were repeated to prepare the titled compound, except that 1-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]-5-methylpyrimidine-2- ,4-dione used in Step 1 of Reference Example 1 was replaced in this step with N-{1-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]-2-oxo-1,2-di- hydropyrimidin-4-yl}benzamide.
[0461] To determine the loading amount of the desired product, the molar amount of trityl per gram of the resin was measured in a known manner as UV absorbance at 409 nm. The loading amount on the resin was found to be 460.28 .mu.mol/g.
Reference Example 3
4-{[(2S,6R)-6-(6-Benzamidopurin-9-yl)-4-tritylmorpholin-2-yl]methoxy}-4-ox- obutanoic acid loaded on aminopolystyrene resin
[0462] The same procedures as shown in Reference Example 1 were repeated to prepare the titled compound, except that 1-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]-5-methylpyrimidine-2- ,4-dione used in Step 1 of Reference Example 1 was replaced in this step with N-{9-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]purin-6-yl}be- nzamide.
[0463] To determine the loading amount of the desired product, the molar amount of trityl per gram of the resin was measured in a known manner as UV absorbance at 409 nm. The loading amount on the resin was found to be 425.13 .mu.mol/g.
Reference Example 4
4-{{(2S,6R)-6-{6-(2-Cyanoethoxy)-2-[(2-phenoxyacetyl)amino]purin-9-yl}-4-t- ritylmorpholin-2-yl}methoxy}-4-oxobutanoic Acid Loaded on Aminopolystyrene Resin
[0464] The same procedures as shown in Reference Example 1 were repeated to prepare the titled compound, except that 1-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl]-5-methylpyrimidine-2- ,4-dione used in Step 1 of Reference Example 1 was replaced in this step with N-{6-(2-cyanoethoxy)-9-[(2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-- 2-yl]purin-2-yl}-2-phenoxyacetamide.
[0465] To determine the loading amount of the desired product, the molar amount of trityl per gram of the resin was measured in a known manner as UV absorbance at 409 nm. The loading amount on the resin was found to be 341.09 .mu.mol/g.
[0466] In accordance with the descriptions in Example 1 shown below or in accordance with the procedures described in PCT/JP2015/57180 using a nucleic acid synthesizer (AKTA Oligopilot 10 plus), PMO Nos. 1 to 191, 198, 199, 201 to 316, 321 to 323, 325 to 327 and 333 indicated in Tables 1 to 3 were synthesized (the 5'-terminal end is group (3)).
TABLE-US-00001 TABLE 1 Molecular Molecular PMO weight weight SEQ No. Sequence name Nucleotide sequence (5'>3') (calculated) (measured) ID NO: 1 MSTN_H2_128-140_157-169 TTCATAGGTTTGACACAAACACTGTT 8590.98 8591.04 93 2 MSTN_H2_169-181_213-225 TGCCTGGGTTCATCTTGTACCGTCTT 8556.93 8556.73 94 3 MSTN_HM2_169-181_341-353 TGGGAAGGTTACACTTGTACCGTCTT 8638.98 8638.93 95 4 MSTN_HM2_169-181_353-365 TTCTCCTGGTCCTCTTGTACCGTCTT 8467.90 8467.22 96 5 MSTN_H2_12-24_128-140 CACAAACACTGTTCATCCACTTGCAT 8480.95 8480.44 97 6 MSTN_H2_42-54_128-140 CACAAACACTGTTTAAATTTAAAGAA 8601.01 8600.99 98 7 MSTN_HM2_52-64_128-140 CACAAACACTGTTATTTTAGAGCTAA 8583.99 8583.56 99 8 MSTN_HM2_169-181_201-213 TGTCAAGTTTCAGCTTGTACCGTCTT 8564.94 8564.73 100 9 MSTN_H2_22-34_128-140 CACAAACACTGTTTTGGGTTTTCCAT 8557.95 8557.82 101 10 MSTN_HM2_128-140_347-359 TGGTCCTGGGAAGCACAAACACTGTT 8641.99 8641.67 102 11 MSTN_H2_2-14_116-128 TGTAGGAGTCTCGCATTAGAAAATCA 8665.01 8665.04 103 12 MSTN_H2_32-44_128-140 CACAAACACTGTTGAAGCAACATTTG 8593.99 8593.64 104 13 MSTN_H2_12-24_116-128 TGTAGGAGTCTCGCATCCACTTGCAT 8583.96 8583.74 105 14 MSTN_HM2_177-189_331-343 ACAGCAAGATCATCAGTATACCTTGT 8584.98 8584.99 106 15 MSTN_HM2_177-189_351-363 CTCCTGGTCCTGGCAGTATACCTTGT 8550.94 8550.82 107 16 MSTN_H2_2-14_128-140 CACAAACACTGTTCATTAGAAAATCA 8561.99 8561.39 108 17 MSTN_H2_72-84_128-140 CACAAACACTGTTTTACTACTTTATT 8500.94 8500.36 109 18 MSTN_HM2_177-189_341-353 TGGGAAGGTTACACAGTATACCTTGT 8672.00 8672.41 110 19 MSTN_H2_62-74_128-140 CACAAACACTGTTATTGTATTGTATT 8580.97 8580.58 111 20 MSTN_H2_82-94_128-140 CACAAACACTGTTAGTTGGGCCTTTA 8591.97 8591.99 112 21 MSTN_H2_2-14_119-131 TGTTGTAGGAGTCCATTAGAAAATCA 8680.01 8681.03 113 22 MSTN_H2_2-14_122-134 CACTGTTGTAGGACATTAGAAAATCA 8649.01 8649.13 114 23 MSTN_H2_92-104_128-140 CACAAACACTGTTATATATCCATAGT 8543.97 8544.20 115 24 MSTN_H2_102-114_128-140 CACAAACACTGTTCGGGTCTCAAATA 8569.98 8570.28 116 25 MSTN_H2_7-19_116-128 TGTAGGAGTCTCGACTTGCATTAGAA 8672.00 8671.90 117 26 MSTN_H2_2-14_113-125 AGGAGTCTCGACGCATTAGAAAATCA 8659.02 8659.54 118 27 MSTN_H2_2-14_125-137 AAACACTGTTGTACATTAGAAAATCA 8617.01 8617.59 119 28 MSTN_H2_112-124_128-140 CACAAACACTGTTGGAGTCTCGACGG 8626.99 8627.55 120 29 MSTN_H2_32-44_178-190 CCAGTATACCTTGGAAGCAACATTTG 8600.98 8599.85 121 30 MSTN_H2_32-44_193-205 TTCAGAGATCGGAGAAGCAACATTTG 8690.02 8689.34 122 31 MSTN_H2_32-44_347-359 TGGTCCTGGGAAGGAAGCAACATTTG 8722.02 8722.45 123 32 MSTN_HM2_193-205_347-359 TGGTCCTGGGAAGTTCAGAGATCGGA 8738.02 8737.65 124 33 MSTN_H2_2-14_347-359 TGGTCCTGGGAAGCATTAGAAAATCA 8690.02 8689.78 125 34 MSTN_H2_32-44_116-128 TGTAGGAGTCTCGGAAGCAACATTTG 8697.01 8696.54 126 35 MSTN_H2_116-128_178-190 CCAGTATACCTTGTGTAGGAGTCTCG 8623.97 8623.93 127 36 MSTN_H2_4-16_116-128 TGTAGGAGTCTCGTGCATTAGAAAAT 8696.01 8695.71 128 37 MSTN_H2_9-21_116-128 TGTAGGAGTCTCGCCACTTGCATTAG 8623.97 8623.22 129 38 MSTN_H2_-4-9_116-128 TGTAGGAGTCTCGGAAAATCAGCTAT 8681.01 8681.53 130 39 MSTN_H2_-2-11_116-128 TGTAGGAGTCTCGTAGAAAATCAGCT 8681.01 8681.66 131 40 MSTN_H2_2-14_32-44 GAAGCAACATTTGCATTAGAAAATCA 8642.02 8642.96 132 41 MSTN_H2_2-14_178-190 CCAGTATACCTTGCATTAGAAAATCA 8568.98 8569.60 133 42 MSTN_H2_3-14_117-128 TGTAGGAGTCTCCATTAGAAAATC 7970.77 7971.87 134 43 MSTN_H2_2-14_193-205 TTCAGAGATCGGACATTAGAAAATCA 8658.02 8657.79 135 44 MSTN_H2_116-128_347-359 TGGTCCTGGGAAGTGTAGGAGTCTCG 8745.01 8744.89 136 45 MSTN_H2_116-128_193-205 TTCAGAGATCGGATGTAGGAGTCTCG 8713.01 8713.65 137 46 MSTN_H2_2-13_116-127 GTAGGAGTCTCGATTAGAAAATCA 8019.79 8019.95 138 47 MSTN_H2_2-13_117-128 TGTAGGAGTCTCATTAGAAAATCA 7994.78 7994.91 139 48 MSTN_H2_3-14_116-127 GTAGGAGTCTCGCATTAGAAAATC 7995.78 7995.99 140 49 MSTN_H2_2-14_102-114 CGGGTCTCAAATACATTAGAAAATCA 8618.01 8618.54 141 50 MSTN_H2_2-14_106-118 TCGACGGGTCTCACATTAGAAAATCA 8609.99 8610.74 142 51 MSTN_H2_2-14_110-122 AGTCTCGACGGGTCATTAGAAAATCA 8650.01 8650.84 143 52 MSTN_H2_106-118_128-140 CACAAACACTGTTTCGACGGGTCTCA 8561.97 8562.71 144 53 MSTN_H2_109-121_128-140 CACAAACACTGTTGTCTCGACGGGTC 8577.97 8578.09 145 54 MSTN_H2_-1-12_116-128 TGTAGGAGTCTCGTTAGAAAATCAGC 8681.01 8681.08 146 55 MSTN_H2_1-13_116-128 TGTAGGAGTCTCGATTAGAAAATCAG 8705.02 8704.93 147 56 MSTN_H2_1-14_116-127 GTAGGAGTCTCGCATTAGAAAATCAG 8690.02 8690.13 148 57 MSTN_H2_-1-14_116-126 TAGGAGTCTCGCATTAGAAAATCAGC 8650.01 8649.42 149 58 MSTN_H2_2-14_117-129 TTGTAGGAGTCTCCATTAGAAAATCA 8640.00 8639.61 150 59 MSTN_H2_2-14_118-130 GTTGTAGGAGTCTCATTAGAAAATCA 8680.01 8679.96 151 60 MSTN_H2_3-15_116-128 TGTAGGAGTCTCGGCATTAGAAAATC 8681.01 8680.78 152 61 MSTN_H2_2-14_114-126 TAGGAGTCTCGACCATTAGAAAATCA 8634.01 8633.96 153 62 MSTN_H2_2-14_115-127 GTAGGAGTCTCGACATTAGAAAATCA 8674.02 8673.75 154 63 MSTN_H2_3-15_115-127 GTAGGAGTCTCGAGCATTAGAAAATC 8690.02 8689.33 155 64 MSTN_H2_3-15_117-129 TTGTAGGAGTCTCGCATTAGAAAATC 8656.00 8655.37 156 65 MSTN_H2_116-128_213-225 TGCCTGGGTTCATTGTAGGAGTCTCG 8670.98 8670.44 157 66 MSTN_H2_116-128_268-280 TGTTTGAGCCAATTGTAGGAGTCTCG 8678.99 8679.10 158 67 MSTN_H2_1-13_115-127 GTAGGAGTCTCGAATTAGAAAATCAG 8714.03 8714.18 159 68 MSTN_H2_1-13_117-129 TTGTAGGAGTCTCATTAGAAAATCAG 8680.01 8679.50 160 69 MSTN_H2_2-13_116-128 TGTAGGAGTCTCGATTAGAAAATCA 8349.90 8349.01 161 70 MSTN_H2_3-14_116-128 TGTAGGAGTCTCGCATTAGAAAATC 8325.89 8324.88 162 71 MSTN_H2_2-14_116-127 GTAGGAGTCTCGCATTAGAAAATCA 8334.90 8333.29 163 72 MSTN_H2_2-14_117-128 TGTAGGAGTCTCCATTAGAAAATCA 8309.89 8310.03 164 73 MSTN_H2_117-128_192-203 CAGAGATCGGATTGTAGGAGTCTC 8027.78 8027.24 165 74 MSTN_H2_117-128_193-204 TCAGAGATCGGATGTAGGAGTCTC 8027.78 8027.42 166 75 MSTN_H2_117-128_194-205 TTCAGAGATCGGTGTAGGAGTCTC 8018.77 8018.26 167 76 MSTN_H2_114-126_194-205 TTCAGAGATCGGTAGGAGTCTCGAC 8342.89 8342.62 168 77 MSTN_H2_115-128_192-203 CAGAGATCGGATTGTAGGAGTCTCGA 8722.02 8722.80 169 78 MSTN_H2_114-126_193-204 TCAGAGATCGGATAGGAGTCTCGAC 8351.90 8352.40 170 79 MSTN_H2_117-128_192-205 TTCAGAGATCGGATTGTAGGAGTCTC 8688.00 8687.62 171 80 MSTN_H2_3-14_116-125 AGGAGTCTCGCATTAGAAAATC 7310.55 7310.13 172 81 MSTN_H2_3-15_115-125 AGGAGTCTCGAGCATTAGAAAATC 8004.79 8004.56 173 82 MSTN_H2_-1-11_116-127 GTAGGAGTCTCGTAGAAAATCAGC 8020.79 8020.35 174 83 MSTN_H2_-1-12_115-125 AGGAGTCTCGATTAGAAAATCAGC 8004.79 8005.06 175 84 MSTN_H2_3-15_116-127 GTAGGAGTCTCGGCATTAGAAAATC 8350.90 8351.16 176 85 MSTN_H2_-1-12_116-127 GTAGGAGTCTCGTTAGAAAATCAGC 8350.90 8350.46 177 86 MSTN_H2_117-125_211-225 TGCCTGGGTTCATGTAGGAGTCTC 7985.75 7986.39 178 87 MSTN_H2_117-127_216-228 CAGTGCCTGGGTTGTAGGAGTCTC 8010.76 8011.08 179 88 MSTN_H2_2-14_116-126 TAGGAGTCTCGCATTAGAAAATCA 7979.78 7979.75 180 89 MSTN_H2_-1-12_116-126 TAGGAGTCTCGTTAGAAAATCAGC 7995.78 7996.47 181 90 MSTN_H2_-1-14_116-126(-5A) TAGGAGTCTCGCATTAGAAATCAGC 8310.89 8311.25 182 91 MSTN_H2_117-127_344-358 GGTCCTGGGAAGGTTGTAGGAGTCTC 8745.01 8745.96 183 92 MSTN_H2_4-14_116-126 TAGGAGTCTCGCATTAGAAAAT 7325.55 7325.56 184 93 MSTN_H2_3-14_116-126 TAGGAGTCTCGCATTAGAAAATC 7640.66 7640.90 185 94 MSTN_H2_3-15_116-126 TAGGAGTCTCGGCATTAGAAAATC 7995.78 7996.39 186 95 MSTN_H2_117-127_344-356 TCCTGGGAAGGTTGTAGGAGTCTC 8034.77 8035.29 187 96 MSTN_H2_114-125_194-205 TTCAGAGATCGGAGGAGTCTCGAC 8012.78 8012.48 188 97 MSTN_H2_114-125_129-140 CACAAACACTGTAGGAGTCTCGAC 7925.76 7925.65 189 98 MSTN_H2_115-126_129-140 CACAAACACTGTTAGGAGTCTCGA 7940.76 7940.82 190 99 MSTN_H2_117-126_129-140 CACAAACACTGTTAGGAGTCTC 7246.52 7246.96 191 100 MSTN_H2_117-127_130-140 CACAAACACTGGTAGGAGTCTC 7271.53 7272.21 192 101 MSTN_H2_117-127_129-140 CACAAACACTGTGTAGGAGTCTC 7601.64 7602.24 193 102 MSTN_H2_117-127_192-202 AGAGATCGGATGTAGGAGTCTC 7382.56 7382.52 194 103 MSTN_H2_117-127_195-205 TTCAGAGATCGGTAGGAGTCTC 7333.54 7333.88 195 104 MSTN_H2_117-128_213-225 TGCCTGGGTTCATTGTAGGAGTCTC 8315.86 8316.77 196 105 MSTN_H2_114-125_213-225 TGCCTGGGTTCATAGGAGTCTCGAC 8309.86 8310.88 197 106 MSTN_H2_114-125_345-356 TCCTGGGAAGGTAGGAGTCTCGAC 8028.78 8028.48 198 107 MSTN_H2_117-128_348-359 TGGTCCTGGGAATGTAGGAGTCTC 8034.77 8034.02 199 108 MSTN_H2_114-125_211-222 CTGGGTTCATGTAGGAGTCTCGAC 7994.76 7995.78 200 109 MSTN_H2_117-128_211-222 CTGGGTTCATGTTGTAGGAGTCTC 8000.75 7999.95 201 110 MSTN_H2_115-125_129-140 CACAAACACTGTAGGAGTCTCGA 7610.65 7609.85 202
111 MSTN_H2_117-125_129-140 CACAAACACTGTAGGAGTCTC 6916.41 6916.94 203 112 MSTN_H2_117-128_193-205 TTCAGAGATCGGATGTAGGAGTCTC 8357.89 8357.86 204 113 MSTN_H2-1-10_15-26 TCCATCCACTTGAGAAAATCAGC 7545.63 7545.89 205 114 MSTN_H2_117-128_213-223 CCTGGGTTCATTGTAGGAGTCTC 7630.63 7631.02 206 115 MSTN_H2_119-125_211-225 TGCCTGGGTTCATGTAGGAGTC 7340.53 7341.36 207 116 MSTN_H2_117-125_211-223 CCTGGGTTCATGTAGGAGTCTC 7300.52 7301.46 208 117 MSTN_H2_-1-10_115-125 AGGAGTCTCGAAGAAAATCAGC 7344.57 7346.16 209 118 MSTN_H2_-1-10_116-126 TAGGAGTCTCGAGAAAATCAGC 7335.56 7336.62 210 119 MSTN_H2_3-13_116-126 TAGGAGTCTCGATTAGAAAATC 7325.55 7326.53 211 120 MSTN_H2_117-128_210-221 TGGGTTCATGTCTGTAGGAGTCTC 8000.75 8000.51 212 121 MSTN_H2_117-128_212-223 CCTGGGTTCATGTGTAGGAGTCTC 7985.75 7985.16 213 122 MSTN_H2_117-128_211-221 TGGGTTCATGTTGTAGGAGTCTC 7685.64 7685.86 214 123 MSTN_H2_118-128_211-222 CTGGGTTCATGTTGTAGGAGTCT 7685.64 7686.62 215 124 MSTN_H2_117-128_212-222 CTGGGTTCATGTGTAGGAGTCTC 7670.64 7670.94 216 125 MSTN_H2_117-128_192-204 TCAGAGATCGGATTGTAGGAGTCTC 8357.89 8358.93 217 126 MSTN_H2_117-128_213-222 CTGGGTTCATTGTAGGAGTCTC 7315.52 7316.24 218 127 MSTN_H2_117-129_213-222 CTGGGTTCATTTGTAGGAGTCTC 7645.63 7646.63 219 128 MSTN_H2_117-126_211-222 CTGGGTTCATGTTAGGAGTCTC 7315.52 7316.36 220 129 MSTN_H2_114-125_210-221 TGGGTTCATGTCAGGAGTCTCGAC 7994.76 7994.90 221 130 MSTN_H2_117-128_191-202 AGAGATCGGATTTGTAGGAGTCTC 8042.78 8043.31 222 131 MSTN_HM2_118-127_130-140 CACAAACACTGGTAGGAGTCT 6956.43 6956.19 223 132 MSTN_H2_117-127_130-139 ACAAACACTGGTAGGAGTCTC 6956.43 6956.76 224 133 MSTN_H2_114-125_212-223 CCTGGGTTCATGAGGAGTCTCGAC 7979.75 7979.45 225 134 MSTN_H2_118-128_213-223 CCTGGGTTCATTGTAGGAGTCT 7315.52 7315.38 226 135 MSTN_H2_118-128_213-222 CTGGGTTCATTGTAGGAGTCT 7000.41 7000.35 227 136 MSTN_H2_119-128_213-223 CCTGGGTTCATTGTAGGAGTC 6985.41 6984.76 228 137 MSTN_H2_117-126_213-223 CCTGGGTTCATTAGGAGTCTC 6945.40 6945.37 229 138 MSTN_H2_117-125_211-222 CTGGGTTCATGTAGGAGTCTC 6985.41 6985.57 230 139 MSTN_H2_117-127_214-223 CCTGGGTTCAGTAGGAGTCTC 6970.41 6969.84 231 140 MSTN_H2_117-128_131-140 CACAAACACTTGTAGGAGTCTC 7246.52 7246.02 232 141 MSTN_H2_115-125_130-140 CACAAACACTGAGGAGTCTCGA 7280.54 7280.06 233 142 MSTN_HM2_119-129_194-206 TTTCAGAGATCGGTTGTAGGAGTC 8033.77 8033.86 234 143 MSTN_HM2_118-129_193-204 TCAGAGATCGGATTGTAGGAGTCT 8042.78 8043.06 235 144 MSTN_H2_114-124_130-140 CACAAACACTGGGAGTCTCGAC 7256.53 7256.65 236 145 MSTN_H2_114-125_211-221 TGGGTTCATGTAGGAGTCTCGAC 7679.65 7679.17 237 146 MSTN_H2_114-126_213-222 CTGGGTTCATTAGGAGTCTCGAC 7639.64 7640.01 238 147 MSTN_H2_117-128_195-206 TTTCAGAGATCGTGTAGGAGTCTC 7993.76 7994.63 239 148 MSTN_H2_117-128_211-223 CCTGGGTTCATGTTGTAGGAGTCTC 8315.86 8316.07 240 149 MSTN_H2_117-126_213-222 CTGGGTTCATTAGGAGTCTC 6630.29 6631.27 241 150 MSTN_HM2_119-129_193-205 TTCAGAGATCGGATTGTAGGAGTC 8042.78 8043.75 242 151 MSTN_H2_118-127_214-223 CCTGGGTTCAGTAGGAGTCT 6655.30 6654.87 243 152 MSTN_H2_117-126_214-223 CCTGGGTTCATAGGAGTCTC 6615.29 6615.00 244 153 MSTN_H2_117-127_215-223 CCTGGGTTCGTAGGAGTCTC 6631.29 6631.07 245 154 MSTN_H2_114-124_214-223 CCTGGGTTCAGGAGTCTCGAC 6955.40 6955.05 246 155 MSTN_H2_115-125_214-223 CCTGGGTTCAAGGAGTCTCGA 6979.42 6979.46 247 156 MSTN_H2_118-128_214-223 CCTGGGTTCATGTAGGAGTCT 6985.41 6985.70 248 157 MSTN_HM2_118-129_192-203 CAGAGATCGGATTTGTAGGAGTCT 8042.78 8042.98 249 158 MSTN_HM2_118-129_194-205 TTCAGAGATCGGTTGTAGGAGTCT 8033.77 8033.36 250 159 MSTN_HM2_119-129_192-204 TCAGAGATCGGATTTGTAGGAGTC 8042.78 8043.12 251 160 MSTN_H2_117-129_213-223 CCTGGGTTCATTTGTAGGAGTCTC 7960.74 7960.09 252 161 MSTN_H2_117-127_188-198 ATCGGATTCCAGTAGGAGTCTC 7293.53 7294.09 253 162 MSTN_H2_117-127_198-208 AGTTTCAGAGAGTAGGAGTCTC 7357.55 7357.72 254 163 MSTN_H2_114-123_213-223 CCTGGGTTCATGAGTCTCGAC 6930.39 6930.41 255 164 MSTN_H2_119-129_213-222 CTGGGTTCATTTGTAGGAGTC 7000.41 7000.29 256 165 MSTN_HM2_119-129_191-203 CAGAGATCGGATTTTGTAGGAGTC 8042.78 8042.56 257 166 MSTN_H2_117-127_131-141 GCACAAACACTGTAGGAGTCTC 7271.53 7271.82 258 167 MSTN_H2_117-127_132-142 TGCACAAACACGTAGGAGTCTC 7271.53 7271.85 259 168 MSTN_H2_129-140_214-223 CCTGGGTTCACACAAACACTGT 7222.51 7222.91 260 169 MSTN_H2_129-140_212-223 CCTGGGTTCATGCACAAACACTGT 7907.74 7907.65 261 170 MSTN_HM2_129-140_192-203 CAGAGATCGGATCACAAACACTGT 7949.77 7949.90 262 171 MSTN_HM2_129-140_193-204 TCAGAGATCGGACACAAACACTGT 7949.77 7950.17 263 172 MSTN_H2_114-124_195-205 TTCAGAGATCGGGAGTCTCGAC 7318.54 7317.96 264 173 MSTN_H2_114-123_214-223 CCTGGGTTCAGAGTCTCGAC 6600.28 6600.76 265 174 MSTN_H2_117-127_180-190 CCAGTATACCTGTAGGAGTCTC 7253.51 7253.54 266 175 MSTN_H2_117-127_182-192 TTCCAGTATACGTAGGAGTCTC 7268.52 7268.89 267 176 MSTN_H2_193-204_212-223 CCTGGGTTCATGTCAGAGATCGGA 8003.77 8003.32 268 177 MSTN_H2_191-202_212-223 CCTGGGTTCATGAGAGATCGGATT 8018.77 8018.85 269 178 MSTN_H2_117-127_196-206 TTTCAGAGATCGTAGGAGTCTC 7308.53 7308.94 270 179 MSTN_H2_114-124_128-138 CAAACACTGTTGGAGTCTCGAC 7262.52 7262.78 271 180 MSTN_H2_114-124_129-139 ACAAACACTGTGGAGTCTCGAC 7271.53 7271.50 272 181 MSTN_H2_117-126_215-223 CCTGGGTTCTAGGAGTCTC 6276.17 6276.10 273 182 MSTN_H2_118-127_215-223 CCTGGGTTCGTAGGAGTCT 6316.18 6316.00 274 183 MSTN_H2_117-125_215-223 CCTGGGTTCAGGAGTCTC 5946.06 5946.39 275 184 MSTN_H2_118-126_215-223 CCTGGGTTCTAGGAGTCT 5961.06 5960.99 276 185 MSTN_H2_117-128_281-292 TTGGATTCAGGTTGTAGGAGTCTC 8024.76 8024.64 277 186 MSTN_H2_117-128_284-295 AAGTTGGATTCATGTAGGAGTCTC 8017.77 8017.74 278 187 MSTN_H2_117-128_139-150 TCAGGATTTGCATGTAGGAGTCTC 7993.76 7994.08 279 188 MSTN_H2_117-128_141-152 TCTCAGGATTTGTGTAGGAGTCTC 7984.75 7984.49 280 189 MSTN_H2_117-127_190-200 AGATCGGATTCGTAGGAGTCTC 7333.54 7333.23 281 190 MSTN_H2_117-127_193-203 CAGAGATCGGAGTAGGAGTCTC 7367.56 7368.05 282 191 MSTN_H2_117-127_194-204 TCAGAGATCGGGTAGGAGTCTC 7358.55 7358.58 283 192 MSTN_H2_179-190_212-223 CCTGGGTTCATGCCAGTATACCTT 7889.72 7889.74 284 193 MSTN_H2_181-192_212-223 CCTGGGTTCATGTTCCAGTATACC 7889.72 7890.21 285 194 MSTN_H2_212-223_267-278 TTTGAGCCAATTCCTGGGTTCATG 7944.74 7945.28 286 195 MSTN_H2_212-223_269-280 TGTTTGAGCCAACCTGGGTTCATG 7969.75 7969.96 287 196 MSTN_H2_212-223_345-356 TCCTGGGAAGGTCCTGGGTTCATG 8010.76 8010.35 288 197 MSTN_H2_212-223_348-359 TGGTCCTGGGAACCTGGGTTCATG 8010.76 289 198 MSTN_H2_117-126_196-205 TTCAGAGATCTAGGAGTCTC 6623.30 6622.99 371 199 MSTN_H2_117-126_195-204 TCAGAGATCGTAGGAGTCTC 6648.31 6648.32 372 200 MSTN_H2_117-126_194-203 CAGAGATCGGTAGGAGTCTC 6673.32 6673.28 373 201 MSTN_HM2_118-128_196-206 TTTCAGAGATCTGTAGGAGTCT 7323.53 7323.56 374 202 MSTN_HM2_118-128_195-205 TTCAGAGATCGTGTAGGAGTCT 7348.54 7348.26 375 203 MSTN_H2_114-124_196-206 TTTCAGAGATCGGAGTCTCGAC 7293.53 7293.71 376 204 MSTN_H2_117-128_195-204 TCAGAGATCGTGTAGGAGTCTC 7333.54 7333.02 377
TABLE-US-00002 TABLE 2 Molecular Molecular PMO weight weight SEQ No. Sequence name Nucleotide sequence (5'>3') (calculated) (measured) ID NO: 205 MSTN_H2_21-45 AGAAGCAACATTTGGGTTTTCCATC 8276.87 8276.83 1 206 MSTN_H2_96-120 TCTCGACGGGTCTCAAATATATCCA 8221.85 8221.83 2 207 MSTN_H2_116-140 CACAAACACTGTTGTAGGAGTCTCG 8286.87 8286.48 3 208 MSTN_HM2_331-355 CCTGGGAAGGTTACAGCAAGATCAT 8335.90 8336.04 4 209 MSTN_H2_96-115 ACGGGTCTCAAATATATCCA 6576.30 6575.60 5 210 MSTN_H2_101-120 TCTCGACGGGTCTCAAATAT 6583.29 6583.07 6 211 MSTN_HM2_171-195 GGATTCCAGTATACCTTGTACCGTC 8228.84 8228.81 7 212 MSTN_HM2_166-190 CCAGTATACCTTGTACCGTCTTTCA 8163.82 8164.84 8 213 MSTN_HM2_336-360 CTGGTCCTGGGAAGGTTACAGCAAG 8367.90 8367.65 9 214 MSTN_HM2_341-365 TTCTCCTGGTCCTGGGAAGGTTACA 8284.85 8284.11 10 215 MSTN_HM2_136-160 TTGATGAGTCTCAGGATTTGCACAA 8316.88 8316.35 11 216 MSTN_H2_151-175 CCGTCTTTCATAGGTTTGATGAGTC 8274.85 8274.80 12 217 MSTN_H2_1-25 CCATCCACTTGCATTAGAAAATCAG 8214.86 8215.09 13 218 MSTN_HM2_346-370 CCATCTTCTCCTGGTCCTGGGAAGG 8245.84 8245.09 14 219 MSTN_H2_141-165 TAGGTTTGATGAGTCTCAGGATTTG 8378.88 8378.39 15 220 MSTN_H2_106-130 GTTGTAGGAGTCTCGACGGGTCTCA 8349.88 8349.83 16 221 MSTN_H2_106-125 AGGAGTCTCGACGGGTCTCA 6649.31 6649.01 17 222 MSTN_H2_116-135 ACACTGTTGTAGGAGTCTCG 6639.30 6639.41 18 223 MSTN_H2_98-117 CGACGGGTCTCAAATATATC 6592.30 6592.25 19 224 MSTN_H2_103-122 AGTCTCGACGGGTCTCAAAT 6608.30 6607.83 20 225 MSTN_H2_113-132 CTGTTGTAGGAGTCTCGACG 6655.30 6655.45 21 226 MSTN_H2_23-42 AGCAACATTTGGGTTTTCCA 6598.29 6598.57 22 227 MSTN_H2_116-137 AAACACTGTTGTAGGAGTCTCG 7317.54 7317.18 23 228 MSTN_HM2_121-145 ATTTGCACAAACACTGTTGTAGGAG 8325.89 8324.98 24 229 MSTN_HM2_121-140 CACAAACACTGTTGTAGGAG 6641.32 6641.73 25 230 MSTN_H2_111-135 ACACTGTTGTAGGAGTCTCGACGGG 8358.89 8358.77 26 231 MSTN_H2_111-130 GTTGTAGGAGTCTCGACGGG 6720.32 6720.08 27 232 MSTN_HM2_119-140 CACAAACACTGTTGTAGGAGTC 7286.54 7286.24 28 233 MSTN_H2_21-40 CAACATTTGGGTTTTCCATC 6549.27 6548.67 29 234 MSTN_H2_26-45 AGAAGCAACATTTGGGTTTT 6662.31 6662.77 30 235 MSTN_H2_-10-15 GCATTAGAAAATCAGCTATAAATGA 8326.91 8326.50 31 236 MSTN_H2_11-35 TTTGGGTTTTCCATCCACTTGCATT 8200.81 8200.79 32 237 MSTN_H2_6-30 GTTTTCCATCCACTTGCATTAGAAA 8211.84 8211.40 33 238 MSTN_H2_-5-20 CACTTGCATTAGAAAATCAGCTATA 8253.88 8253.71 34 239 MSTN_H2_101-125 AGGAGTCTCGACGGGTCTCAAATAT 8326.89 8326.20 35 240 MSTN_H2_112-136 AACACTGTTGTAGGAGTCTCGACGG 8342.89 8343.14 36 241 MSTN_H2_113-137 AAACACTGTTGTAGGAGTCTCGACG 8326.89 8327.41 37 242 MSTN_H2_115-139 ACAAACACTGTTGTAGGAGTCTCGA 8310.89 8310.85 38 243 MSTN_H2_114-138 CAAACACTGTTGTAGGAGTCTCGAC 8286.87 8286.68 39 244 MSTN_H2_117-141 GCACAAACACTGTTGTAGGAGTCTC 8286.87 8287.41 40 245 MSTN_HM2_118-142 TGCACAAACACTGTTGTAGGAGTCT 8301.88 8301.26 41 246 MSTN_HM2_119-143 TTGCACAAACACTGTTGTAGGAGTC 8301.88 8301.89 42 247 MSTN_HM2_120-144 TTTGCACAAACACTGTTGTAGGAGT 8316.88 8316.69 43 248 MSTN_H2_91-115 ACGGGTCTCAAATATATCCATAGTT 8260.87 8260,78 44 249 MSTN_H2_-3-22 TCCACTTGCATTAGAAAATCAGCTA 8229.86 8229.36 45 250 MSTN_HM2_191-215 CATGTCAAGTTTCAGAGATCGGATT 8316.88 8317.25 46 251 MSTN_H2_201-225 TGCCTGGGTTCATGTCAAGTTTCAG 8299.86 8299.68 47 252 MSTN_H2_211-235 CAAATACCAGTGCCTGGGTTCATGT 8277.86 8277.30 48 253 MSTN_H2_54-78 CTTTATTGTATTGTATTTTAGAGCT 8278.84 8278.45 49 254 MSTN_H2_-4-21 CCACTTGCATTAGAAAATCAGCTAT 8229.86 8229.68 50 255 MSTN_H2_-2-23 ATCCACTTGCATTAGAAAATCAGCT 8229.86 8229.37 51 256 MSTN_H2_-1-24 CATCCACTTGCATTAGAAAATCAGC 8214.86 8214.95 52 257 MSTN_H2_5-29 TTTTCCATCCACTTGCATTAGAAAA 8195.84 8194.80 53 258 MSTN_H2_2-26 TCCATCCACTTGCATTAGAAAATCA 8189.85 8189.90 54 259 MSTN_H2_3-27 TTCCATCCACTTGCATTAGAAAATC 8180.84 8181.54 55 260 MSTN_H2_4-28 TTTCCATCCACTTGCATTAGAAAAT 8195.84 8196.94 56 261 MSTN_H2_-7-18 CTTGCATTAGAAAATCAGCTATAAA 8277.89 8278.60 57 262 MSTN_H2_8-32 GGGYTTTCCATCCACTTGCATTAGA 8243.84 8244.65 58 263 MSTN_H2_117-138 CAAACACTGTTGTAGGAGTCTC 7277.53 7277.87 59 264 MSTN_HM2_118-139 ACAAACACTGTTGTAGGAGTCT 7301.54 7302.04 60 265 MSTN_H2_1-21 CCACTTGCATTAGAAAATCAG 6915.42 6915.68 61 266 MSTN_H2_9-29 TTTTCCATCCACTTGCATTAG 6839.36 6840.60 62 267 MSTN_H2_7-31 GGTTTTCCATCCACTTGCATTAGAA 8227.84 8226.95 63 268 MSTN_H2_5-25 CCATCCACTTGCATTAGAAAA 6875.40 6875.44 64 269 MSTN_H2_7-29 TTTTCCATCCACTTGCATTAGAA 7517.60 7517.22 65 270 MSTN_H2_117-140 CACAAACACTGTTGTAGGAGTCTC 7931.75 7931.52 66 271 MSTN_HM2_118-140 CACAAACACTGTTGTAGGAGTCT 7616.65 7616.24 67 272 MSTN_H2_1-23 ATCCACTTGCATTAGAAAATCAG 7584.65 7584.03 68 273 MSTN_H2_3-25 CCATCCACTTGCATTAGAAAATC 7520.62 7520.93 69 274 MSTN_H2_5-27 TTCCATCCACTTGCATTAGAAAA 7535.62 7536.03 70 275 MSTN_H2_93-117 CGACGGGTCTCAAATATATCCATAG 8270.87 8270.98 71 276 MSTN_H2_98-122 AGTCTCGACGGGTCTCAAATATATC 8261.86 8262.37 72 277 MSTN_H2_103-127 GTAGGAGTCTCGACGGGTCTCAAAT 8342.89 8343.04 73 278 MSTN_H2_108-132 CTGTTGTAGGAGTCTCGACGGGTCT 8340.87 8340.17 74 279 MSTN_H2_-1-25 CCATCCACTTGCATTAGAAAATCAGC 8529.97 8530.68 75 280 MSTN_H2_1-26 TCCATCCACTTGCATTAGAAAATCAG 8544.97 8545.57 76 281 MSTN_H2_116-139 ACAAACACTGTTGTAGGAGTCTCG 7971.77 7971.34 77 282 MSTN_HM2_120-141 GCACAAACACTGTTGTAGGAGT 7326.55 7326.14 78 283 MSTN_HM2_119-141 GCACAAACACTGTTGTAGGAGTC 7641.66 7641.12 79 284 MSTN_HM2_118-141 GCACAAACACTGTTGTAGGAGTCT 7971.77 7971.23 80 285 MSTN_H2_117-139 ACAAACACTGTTGTAGGAGTCTC 7616.65 7616.99 81 286 MSTN_HM2_120-140 CACAAACACTGTTGTAGGAGT 6971.43 6971.71 82 287 MSTN_H2_117-129 TTGTAGGAGTCTC 4290.49 4290.46 83 288 MSTN_H2_214-223 CCTGGGTTCA 3251.14 3251.29 84 289 MSTN_HM2_130-140 CACAAACACTG 3552.27 3552.07 85 290 MSTN_H2_117-127 GTAGGAGTCTC 3630.27 3630.01 86 291 MSTN_H2 117-128 TGTAGGAGTCTC 3960.38 3960.15 87 292 MSTN_H2_213-223 CCTGGGTTCAT 3581.25 3581.03 88 293 MSTN_HM2_193-205 TTCAGAGATCGGA 4308.51 4308.49 89
TABLE-US-00003 TABLE 3 Molecular Molecular PMO weight weight SEQ No. Sequence name Nucleotide sequence (5'>3') (calculated) (measured) ID NO: 294 MSTN_M2_1-25 CCATCCGCTTGCATTAGAAAGTCAG 8246.86 8246.02 90 295 MSTN_M2_116-140 CACAAACACTGTTGTAGGAGTCTTG 8301.88 8302.03 91 296 MSTN_M2_21-45 AAAAGCAACATTTGGGCTTGCCATC 8270.87 8270.72 92 297 MSTN_M2_117-127_214-223 CCTGGGCTCAGTAGGAGTCTT 6970.41 6969.99 290 298 MSTN_M2_117-128_211-223 CCTGGGCTCATGTTGTAGGAGTCTT 8315.86 8315.79 291 299 MSTN_M2_1-14_116-127 GTAGGAGTCTTGCATTAGAAAGTCAG 8721.02 8721.53 292 300 MSTN_M2_117-129_213-223 CCTGGGCTCATTTGTAGGAGTCTT 7960.74 7960.75 293 301 MSTN_M2_114-125_212-223 CCTGGGCTCATGAGGAGTCTTGAC 7979.75 7979.86 294 302 MSTN_M2_117-127_130-140 CACAAACACTGGTAGGAGTCTT 7286.54 7286.69 295 303 MSTN_HM2_169-181_348-360 CTGGTCCTGGGAACTTGTACCGTCTT 8590.95 8591.36 296 304 MSTN_M2_117-128_213-223 CCTGGGCTCATTGTAGGAGTCTT 7630.63 7630.35 297 305 MSTN_M2_117-125_211-223 CCTGGGCTCATGTAGGAGTCTT 7300.52 7300.50 298 306 MSTN_M2_117-127_215-223 CCTGGGCTCGTAGGAGTCTT 6631.29 6631.39 299 307 MSTN_M2_118-128_213-223 CCTGGGCTCATTGTAGGAGTCT 7300.52 7300.55 300 308 MSTN_M2_117-128_214-225 TGCCTGGGCTCATGTAGGAGTCTT 7985.75 7985.85 301 309 MSTN_M2_117-128_271-282 GCTGTTTGAGCCTGTAGGAGTCTT 8000.75 8000.54 302 310 MSTN_M2_117-128_212-223 CCTGGGCTCATGTGTAGGAGTCTT 7985.75 7986.02 303 311 MSTN_M2_117-128_160-171 CTTTCATGGGTTTGTAGGAGTCTT 7990.74 7990.86 304 312 MSTN_M2_118-129_211-223 CCTGGGCTCATGTTTGTAGGAGTCT 8315.86 8316.08 305 313 MSTN_M2_117-128_212-224 GCCTGGGCTCATGTGTAGGAGTCTT 8340.87 8341.12 306 314 MSTN_M2_117-128_210-222 CTGGGCTCATGTCTGTAGGAGTCTT 8315.86 8316.11 307 315 MSTN_M2_116-127_211-223 CCTGGGCTCATGTGTAGGAGTCTTG 8340.87 8341.16 308 316 MSTN_HM2_118-128_180-191 TCCAGTATACCTTGTAGGAGTCT 7598.63 7598.40 309 317 MSTN_M2_117-128_156-167 CATGGGTTTGATTGTAGGAGTCTT 8039.76 310 318 MSTN_M2_117-128_278-289 GATTCAGGCTGTTGTAGGAGTCTT 8024.76 8026.40 311 319 MSTN_HM2_164-176_353-365 TTCTCCTGGTCCTACCGTCTTTCATG 8476.91 8477.91 312 320 MSTN_HM2_173-185_353-365 TTCTCCTGGTCCTATACCTTGTACCG 8485.92 313 321 MSTN_M2_90-102_117-128 TGTAGGAGTCTTATATCCACAGTTG 8307.87 8308.09 314 322 MSTN_HM2_119-130_192-203 CAGAGATCGGATGTTGTAGGAGTC 8067.79 8067.22 315 323 MSTN_HM2_118-129_191-202 AGAGATCGGATTTTGTAGGAGTCT 8057.78 8058.06 316 324 MSTN_M2_117-127_194-206 TTTCAGAGATCGGGTAGGAGTCTT 8033.77 8033.56 317 325 MSTN_HM2_118-128_194-206 TTTCAGAGATCGGTGTAGGAGTCT 8033.77 8033.04 318 326 MSTN_HM2_120-130_194-206 TTTCAGAGATCGGGTTGTAGGAGT 8073.78 8074.04 319 327 MSTN_HM2_119-129_190-202 AGAGATCGGATTCTTGTAGGAGTC 8042.78 8042.38 320 328 MSTN_M2_117-128_182-193 ATTCCAGTATACTGTAGGAGTCTT 7952.75 7952.88 321 329 MSTN_M2_117-128_180-191 TCCAGTATACCTTGTAGGAGTCTT 7928.74 7929.27 322 330 MSTN_M2_117-128_192-205 TTCAGAGATCGGATTGTAGGAGTCTT 8703.00 8703.29 367 331 MSTN_HM2_169-181_358-370 CCATCTTCTCCTGCTTGTACCGTCTT 8436.90 8437.03 368 332 MSTN_M2_93-105_117-128 TGTAGGAGTCTTGATATATCCACAG 8316.88 8316.77 369 333 MSTN_M2_117-128_192-203 CAGAGATCGGATTGTAGGAGTCTT 8042.78 8043.05 370
Example 1
[0467] 4-{[(2S,6R)-6-(5-Methyl-2,4-dioxopyrimidin-1-yl)-4-tritylmorpholin-- 2-yl]methoxy}-4-oxobutanoic acid loaded on aminopolystyrene resin (Reference Example 1) or 4-{[(2S,6R)-6-(4-benzamido-2-oxopyrimidin-1-yl)-4-tritylmorpholin-2-yl]me- thoxy}-4-oxobutanoic acid loaded on aminopolystyrene resin (Reference Example 2) or 4-{[(2S,6R)-6-(6-benzamidopurin-9-yl)-4-tritylmorpholin-2-yl]methoxy}-4-o- xobutanoic acid loaded on aminopolystyrene resin (Reference Example 3) or 4-{{(2S,6R)-6-6-(2-cyanoethoxy)-2-[(2-phenoxyacetyl)amino]purin-9-yl}-4-t- ritylmorpholin-2-yl)methoxy}-4-oxobutanoic acid loaded on aminopolystyrene resin (Reference Example 4), each corresponding to the 5'-terminal base, was filled in an amount of 0.1 g into a reaction vessel equipped with a filter to initiate the following synthesis cycles using a peptide synthesizer (FOCUS). To give the nucleotide sequence of each compound indicated in Tables 1 to 4, a desired morpholino monomer compound was added in each coupling cycle (see Table 4 below).
TABLE-US-00004 TABLE 4 Volume Time Number Step Reagent (mL/run) (min/run) of runs 1 Deblocking solution 1.8 to 3 0.1 to 2.sup. 3 to 8 2 Neutralizing solution 2 to 10 1 3 3 Dichloromethane 2 to 10 -- 5 4 Activator solution 1.8 to 3 -- 1 5 Monomer solution 1 to 1.5 -- 1 6 Activator solution 0.9 to 1.4 -- 1 7 Coupling reaction with 120 to 180 the reagents charged in Steps 5 and 6 8 Dichloromethane 2 to 10 -- 5 9 Capping solution 2 to 3 2 2 10 Dichloromethane 2 to 10 -- 5
[0468] It should be noted that the deblocking solution used was prepared by dissolving a mixture of trifluoroacetic acid (2 equivalents) and triethylamine (1 equivalent) at a concentration of 3% (w/v) in a dichloromethane solution containing 1% (v/v) ethanol and 10% (v/v) 2,2,2-trifluoroethanol. The neutralizing solution used was prepared by dissolving N,N-diisopropylethylamine at a concentration of 5% (v/v) in a dichloromethane solution containing 25% (v/v) 2-propanol. The activator solution used was a 1,3-dimethyl-2-imidazolidinone solution containing 20% (v/v) N,N-diisopropylethylamine. The monomer solution used was prepared by dissolving a morpholino monomer compound at a concentration of 0.20 M in tetrahydrofuran. The capping solution used was prepared by dissolving acetic anhydride at 10% (v/v) and 2,6-lutidine at 15% (v/v) in dichloromethane.
[0469] The aminopolystyrene resin loaded with PMO synthesized as above was collected from the reaction vessel and dried at 30.degree. C. for 2 hours or longer under reduced pressure. The dried PMO loaded on the aminopolystyrene resin was charged into a reaction vessel and 5 mL of 28% aqueous ammonia-ethanol (1/3) was added thereto, followed by standing at 55.degree. C. for 16 hours. The aminopolystyrene resin was separated by filtration and washed with 3 mL of water-acetonitrile (1/1). After the resulting filtrate was mixed with ethanol (3 mL) and diethyl ether (35 mL), the mixture was centrifuged and then decanted to remove the supernatant, and the residue was dried under reduced pressure. The resulting residue was dissolved in 10 mL of a mixed solvent containing 20 mM aqueous ammonium acetate and acetonitrile (4/1), and then purified by reversed-phase HPLC. The conditions used are as indicated in Table 5 below.
TABLE-US-00005 TABLE 5 Column XBridge 5 .mu.m C18 (Waters, .PHI. 19 .times. 50 mm, 1 CV = 14 mL) Flow rate 10 mL/minute Column room temperature temperature Solution A 20 mM aqueous ammonium acetate Solution B CH.sub.3CN Gradient (B) conc. 20% .fwdarw. 50%/10 CV CV: column volume
[0470] The fractions were each analyzed to collect the desired product. The resulting solution was mixed with 0.1 M aqueous hydrochloric acid (4 mL) and allowed to stand for 2 hours. After the reaction, 1 M aqueous sodium hydroxide (0.4 mL) was added to neutralize the mixture, which was then filtered through a membrane filter (0.22 .mu.m).
[0471] The resulting aqueous solution containing the desired product was made alkaline with 1 M aqueous sodium hydroxide (0.4 mL) and purified through an anion exchange resin column. The conditions used are as indicated in Table 6 below.
TABLE-US-00006 TABLE 6 Column Source 15Q (GE Healthcare, .PHI.16 .times. 97 mm, 1 CV = 19.5 mL) Flow rate 10 mL/minute Column room temperature temperature Solution A 10 mM aqueous sodium hydroxide Solution B 10 mM aqueous sodium hydroxide, 1M aqueous sodium chloride Gradient (B) conc. 5% .fwdarw. 50%/20 CV
[0472] The fractions were each analyzed (by HPLC) to obtain the desired product as an aqueous solution. The resulting aqueous solution was neutralized with 0.1 M phosphate buffer (pH 6.0) and then desalted by reversed-phase HPLC under the conditions shown in Table 7 below.
TABLE-US-00007 TABLE 7 Column YMC GEL C4 HG 10 .mu.m (YMC, .PHI.10 .times. 35 mm, 1 CV = 2.7 mL) Flow rate 10 mL/minute Column room temperature temperature Solution A water Solution B CH.sub.3CN Gradient (B) conc. 0% .fwdarw. 50%/10 CV
[0473] The desired product was collected and concentrated under reduced pressure. The resulting residue was dissolved in water and freeze-dried to obtain the desired compound as a white flocculent solid. The calculated and measured values of ESI-TOF-MS are shown in Tables 1 to 3.
Test Example 1
In Vitro Assay
[0474] Into 3.times.10.sup.5 RD cells (human rhabdomyosarcoma cell line), the antisense oligomers shown in Table 1 or 3 were each transfected at 1, 3 or 10 .mu.M through Nucleofector II (Lonza) using an Amaxa Cell Line Nucleofector Kit L. The program used was T-030.
[0475] After transfection, the cells were cultured for three nights at 37.degree. C. under 5% CO.sub.2 conditions in 2 mL of Dulbecco's Modified Eagle's Medium (DMEM) (SIGMA; the same applies hereinafter) containing 10% fetal calf serum (FCS) (Invitrogen).
[0476] After the cells were washed once with PBS (Nissui Pharmaceutical Co., Ltd., Japan; the same applies hereinafter), 350 .mu.L of Buffer RLT (QIAGEN) containing 1% 2-mercaptoethanol (Nacalai Tesque, Inc., Japan) was added to the cells, and the cells were lysed by being allowed to stand at room temperature for a few minutes. The cell lysate was collected into a QIAshredder homogenizer (QIAGEN) and centrifuged at 20,400.times.g for 2 minutes to prepare a homogenate. The total RNA was extracted in accordance with the protocol attached to an RNeasy Mini Kit (QIAGEN). The concentration of the extracted total RNA was measured with a NanoDrop ND-1000 spectrophotometer (LMS Co., Ltd., Japan).
[0477] The extracted total RNA (10 ng) was used as a template to perform One-Step RT-PCR with a QIAGEN OneStep RT-PCR Kit (QIAGEN). A reaction solution was prepared in accordance with the protocol attached to the kit. The thermal cycler used was TaKaRa PCR Thermal Cycler Dice Touch (Takara Bio Inc., Japan). The RT-PCR program used is as shown below.
[0478] 50.degree. C. for 30 minutes: reverse transcription reaction
[0479] 95.degree. C. for 15 minutes: polymerase activation, reverse transcriptase inactivation
[0480] [94.degree. C. for 30 seconds; 61.degree. C. for 30 seconds; 72.degree. C. for 1 minute].times.27 cycles: PCR
[0481] 72.degree. C. for 7 minutes: final elongation reaction
[0482] The nucleotide sequences of the forward and reverse primers used for RT-PCR are as shown below.
TABLE-US-00008 Forward primer: (SEQ ID NO: 360) 5'-TTCGTCTGGAAACAGCTCCT-3' Reverse primer: (SEQ ID NO: 361) 5'-AGAGGGTAACGACAGCATCG-3'
[0483] The above PCR reaction product (1 .mu.L) was analyzed using a Bioanalyzer (Agilent).
[0484] The polynucleotide level "A" in the PCR amplicon with exon 2 skipping and the polynucleotide level "B" in the wild-type PCR amplicon were measured. Based on these measured values of "A" and "B," the skipping efficiency was determined according to the following equation.
Skipping efficiency (%)=A/(A+B).times.100
[0485] Experimental Results
[0486] The results obtained are shown in FIGS. 1 to 14.
[0487] FIGS. 1 to 14 indicated that the antisense oligomer of the present invention effectively caused exon 2 skipping.
Test Example 2
In Vitro Assay
[0488] The same procedures as shown in Test Example 1 were repeated to conduct this experiment, except that 3 x 10.sup.5 RD cells (human rhabdomyosarcoma cell line) were transfected with the oligomer of the present invention alone (PMO No. 100 (NMS-191), PMO No. 139 (NMS-233), PMO No. 79 (NMS-169) or PMO No. 114 (NMS-206)) or with either of the two unit oligomers constituting each oligomer or with a cocktail of the two unit oligomers constituting each oligomer through Nucleofector II (Lonza) using an Amaxa Cell Line Nucleofector Kit L. The pulse program used was T-030. Combinations of the sequences transfected are as shown below.
TABLE-US-00009 TABLE 8 Sequence Transfection concentration 1 PMO No. 100 (NMS-191) alone 3 .mu.m PMO No. 290 (NMS-258) alone, 3 .mu.m which is a unit oligomer constituting PMO No. 100 (NMS-191) PMO No. 289 (NMS-257) alone, 3 .mu.m which is a unit oligomer constituting PMO No. 100 (NMS-191) Cocktail of two unit oligomers 3 .mu.m each constituting PMO No. 100 (NMS-191) (i.e., PMO No. 290 (NMS-258) and PMO No. 289 (NMS-257)) 2 PMO No. 139 (NMS-233) alone 1 .mu.m PMO No. 290 (NMS-258) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 139 (NMS-233) PMO No. 288 (NMS-237) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 139 (NMS-233) Cocktail of two unit oligomers 1 .mu.m each constituting PMO No. 139 (NMS-233) (i.e., PMO No. 290 (NMS-258) and PMO No. 288 (NMS-237)) 3 PMO No. 79 (NMS-169) alone 1 .mu.m PMO No. 287 (NMS-236) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 79 (NMS-169) PMO No. 293 (NMS-265) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 79 (NMS-169) Cocktail of two unit oligomers 1 .mu.m each constituting PMO No. 79 (NMS-169) (i.e., PMO No. 287 (NMS-236) and PMO No. 293 (NMS-265)) 4 PMO No. 114 (NMS-206) alone 1 .mu.m PMO No. 287 (NMS-236) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 114 (NMS-206) PMO No. 288 (NMS-237) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 114 (NMS-206) Cocktail of two unit oligomers 1 .mu.m each constituting PMO No. 114 (NMS-206) (i.e., PMO No. 287 (NMS-236) and PMO No. 288 (NMS-237)) 5 PMO No. 114 (NMS-206) alone 1 .mu.m PMO No. 291 (NMS-263) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 114 (NMS-206) PMO No. 292 (NMS-264) alone, 1 .mu.m which is a unit oligomer constituting PMO No. 114 (NMS-206) Cocktail of two unit oligomers 1 .mu.m each constituting PMO No. 114 (NMS-206) (i.e., PMO No. 291 (NMS-263) and PMO No. 292 (NMS-264))
[0489] Experimental Results
[0490] The results obtained are shown in FIG. 15. This experiment indicated that when compared to a cocktail of two antisense nucleic acids targeting different sites in exon 2 (i.e., PMO No. 290 (NMS-258) and PMO No. 289 (NMS-257), PMO No. 290 (NMS-258) and PMO No. 288 (NMS-237), PMO No. 287 (NMS-236) and PMO No. 293 (NMS-265), PMO No. 287 (NMS-236) and PMO No. 288 (NMS-237), or PMO No. 291 (NMS-263) and PMO No. 292 (NMS-264)), the oligomers of the present invention, i.e., PMO No. 100 (NMS-191), PMO No. 139 (NMS-233), PMO No. 79 (NMS-169) and PMO No. 114 (NMS-206), in which the respective two antisense nucleic acids are connected together, caused exon 2 skipping with higher efficiency.
Sequence CWU
1
1
379125DNAArtificialSynthetic nucleic acid 1agaagcaaca tttgggtttt ccatc
25225DNAArtificialSynthetic nucleic
acid 2tctcgacggg tctcaaatat atcca
25325DNAArtificialSynthetic nucleic acid 3cacaaacact gttgtaggag tctcg
25425DNAArtificialSynthetic
nucleic acid 4cctgggaagg ttacagcaag atcat
25520DNAArtificialSynthetic nucleic acid 5acgggtctca aatatatcca
20620DNAArtificialSynthetic nucleic acid 6tctcgacggg tctcaaatat
20725DNAArtificialSynthetic nucleic
acid 7ggattccagt ataccttgta ccgtc
25825DNAArtificialSynthetic nucleic acid 8ccagtatacc ttgtaccgtc tttca
25925DNAArtificialSynthetic
nucleic acid 9ctggtcctgg gaaggttaca gcaag
251025DNAArtificialSynthetic nucleic acid 10ttctcctggt
cctgggaagg ttaca
251125DNAArtificialSynthetic nucleic acid 11ttgatgagtc tcaggatttg cacaa
251225DNAArtificialSynthetic
nucleic acid 12ccgtctttca taggtttgat gagtc
251325DNAArtificialSynthetic nucleic acid 13ccatccactt
gcattagaaa atcag
251425DNAArtificialSynthetic nucleic acid 14ccatcttctc ctggtcctgg gaagg
251525DNAArtificialSynthetic
nucleic acid 15taggtttgat gagtctcagg atttg
251625DNAArtificialSynthetic nucleic acid 16gttgtaggag
tctcgacggg tctca
251720DNAArtificialSynthetic nucleic acid 17aggagtctcg acgggtctca
201820DNAArtificialSynthetic
nucleic acid 18acactgttgt aggagtctcg
201920DNAArtificialSynthetic nucleic acid 19cgacgggtct
caaatatatc
202020DNAArtificialSynthetic nucleic acid 20agtctcgacg ggtctcaaat
202120DNAArtificialSynthetic
nucleic acid 21ctgttgtagg agtctcgacg
202220DNAArtificialSynthetic nucleic acid 22agcaacattt
gggttttcca
202322DNAArtificialSynthetic nucleic acid 23aaacactgtt gtaggagtct cg
222425DNAArtificialSynthetic
nucleic acid 24atttgcacaa acactgttgt aggag
252520DNAArtificialSynthetic nucleic acid 25cacaaacact
gttgtaggag
202625DNAArtificialSynthetic nucleic acid 26acactgttgt aggagtctcg acggg
252720DNAArtificialSynthetic
nucleic acid 27gttgtaggag tctcgacggg
202822DNAArtificialSynthetic nucleic acid 28cacaaacact
gttgtaggag tc
222920DNAArtificialSynthetic nucleic acid 29caacatttgg gttttccatc
203020DNAArtificialSynthetic
nucleic acid 30agaagcaaca tttgggtttt
203125DNAArtificialSynthetic nucleic acid 31gcattagaaa
atcagctata aatga
253225DNAArtificialSynthetic nucleic acid 32tttgggtttt ccatccactt gcatt
253325DNAArtificialSynthetic
nucleic acid 33gttttccatc cacttgcatt agaaa
253425DNAArtificialSynthetic nucleic acid 34cacttgcatt
agaaaatcag ctata
253525DNAArtificialSynthetic nucleic acid 35aggagtctcg acgggtctca aatat
253625DNAArtificialSynthetic
nucleic acid 36aacactgttg taggagtctc gacgg
253725DNAArtificialSynthetic nucleic acid 37aaacactgtt
gtaggagtct cgacg
253825DNAArtificialSynthetic nucleic acid 38acaaacactg ttgtaggagt ctcga
253925DNAArtificialSynthetic
nucleic acid 39caaacactgt tgtaggagtc tcgac
254025DNAArtificialSynthetic nucleic acid 40gcacaaacac
tgttgtagga gtctc
254125DNAArtificialSynthetic nucleic acid 41tgcacaaaca ctgttgtagg agtct
254225DNAArtificialSynthetic
nucleic acid 42ttgcacaaac actgttgtag gagtc
254325DNAArtificialSynthetic nucleic acid 43tttgcacaaa
cactgttgta ggagt
254425DNAArtificialSynthetic nucleic acid 44acgggtctca aatatatcca tagtt
254525DNAArtificialSynthetic
nucleic acid 45tccacttgca ttagaaaatc agcta
254625DNAArtificialSynthetic nucleic acid 46catgtcaagt
ttcagagatc ggatt
254725DNAArtificialSynthetic nucleic acid 47tgcctgggtt catgtcaagt ttcag
254825DNAArtificialSynthetic
nucleic acid 48caaataccag tgcctgggtt catgt
254925DNAArtificialSynthetic nucleic acid 49ctttattgta
ttgtatttta gagct
255025DNAArtificialSynthetic nucleic acid 50ccacttgcat tagaaaatca gctat
255125DNAArtificialSynthetic
nucleic acid 51atccacttgc attagaaaat cagct
255225DNAArtificialSynthetic nucleic acid 52catccacttg
cattagaaaa tcagc
255325DNAArtificialSynthetic nucleic acid 53ttttccatcc acttgcatta gaaaa
255425DNAArtificialSynthetic
nucleic acid 54tccatccact tgcattagaa aatca
255525DNAArtificialSynthetic nucleic acid 55ttccatccac
ttgcattaga aaatc
255625DNAArtificialSynthetic nucleic acid 56tttccatcca cttgcattag aaaat
255725DNAArtificialSynthetic
nucleic acid 57cttgcattag aaaatcagct ataaa
255825DNAArtificialSynthetic nucleic acid 58gggttttcca
tccacttgca ttaga
255922DNAArtificialSynthetic nucleic acid 59caaacactgt tgtaggagtc tc
226022DNAArtificialSynthetic
nucleic acid 60acaaacactg ttgtaggagt ct
226121DNAArtificialSynthetic nucleic acid 61ccacttgcat
tagaaaatca g
216221DNAArtificialSynthetic nucleic acid 62ttttccatcc acttgcatta g
216325DNAArtificialSynthetic
nucleic acid 63ggttttccat ccacttgcat tagaa
256421DNAArtificialSynthetic nucleic acid 64ccatccactt
gcattagaaa a
216523DNAArtificialSynthetic nucleic acid 65ttttccatcc acttgcatta gaa
236624DNAArtificialSynthetic
nucleic acid 66cacaaacact gttgtaggag tctc
246723DNAArtificialSynthetic nucleic acid 67cacaaacact
gttgtaggag tct
236823DNAArtificialSynthetic nucleic acid 68atccacttgc attagaaaat cag
236923DNAArtificialSynthetic
nucleic acid 69ccatccactt gcattagaaa atc
237023DNAArtificialSynthetic nucleic acid 70ttccatccac
ttgcattaga aaa
237125DNAArtificialSynthetic nucleic acid 71cgacgggtct caaatatatc catag
257225DNAArtificialSynthetic
nucleic acid 72agtctcgacg ggtctcaaat atatc
257325DNAArtificialSynthetic nucleic acid 73gtaggagtct
cgacgggtct caaat
257425DNAArtificialSynthetic nucleic acid 74ctgttgtagg agtctcgacg ggtct
257526DNAArtificialSynthetic
nucleic acid 75ccatccactt gcattagaaa atcagc
267626DNAArtificialSynthetic nucleic acid 76tccatccact
tgcattagaa aatcag
267724DNAArtificialSynthetic nucleic acid 77acaaacactg ttgtaggagt ctcg
247822DNAArtificialSynthetic
nucleic acid 78gcacaaacac tgttgtagga gt
227923DNAArtificialSynthetic nucleic acid 79gcacaaacac
tgttgtagga gtc
238024DNAArtificialSynthetic nucleic acid 80gcacaaacac tgttgtagga gtct
248123DNAArtificialSynthetic
nucleic acid 81acaaacactg ttgtaggagt ctc
238221DNAArtificialSynthetic nucleic acid 82cacaaacact
gttgtaggag t
218313DNAArtificialSynthetic nucleic acid 83ttgtaggagt ctc
138410DNAArtificialSynthetic
nucleic acid 84cctgggttca
108511DNAArtificialSynthetic nucleic acid 85cacaaacact g
118611DNAArtificialSynthetic nucleic acid 86gtaggagtct c
118712DNAArtificialSynthetic
nucleic acid 87tgtaggagtc tc
128811DNAArtificialSynthetic nucleic acid 88cctgggttca t
118913DNAArtificialSynthetic nucleic acid 89ttcagagatc gga
139025DNAArtificialSynthetic
nucleic acid 90ccatccgctt gcattagaaa gtcag
259125DNAArtificialSynthetic nucleic acid 91cacaaacact
gttgtaggag tcttg
259225DNAArtificialSynthetic nucleic acid 92aaaagcaaca tttgggcttg ccatc
259326DNAArtificialSynthetic
nucleic acid 93ttcataggtt tgacacaaac actgtt
269426DNAArtificialSynthetic nucleic acid 94tgcctgggtt
catcttgtac cgtctt
269526DNAArtificialSynthetic nucleic acid 95tgggaaggtt acacttgtac cgtctt
269626DNAArtificialSynthetic
nucleic acid 96ttctcctggt cctcttgtac cgtctt
269726DNAArtificialSynthetic nucleic acid 97cacaaacact
gttcatccac ttgcat
269826DNAArtificialSynthetic nucleic acid 98cacaaacact gtttaaattt aaagaa
269926DNAArtificialSynthetic
nucleic acid 99cacaaacact gttattttag agctaa
2610026DNAArtificialSynthetic nucleic acid 100tgtcaagttt
cagcttgtac cgtctt
2610126DNAArtificialSynthetic nucleic acid 101cacaaacact gttttgggtt
ttccat
2610226DNAArtificialSynthetic nucleic acid 102tggtcctggg aagcacaaac
actgtt
2610326DNAArtificialSynthetic nucleic acid 103tgtaggagtc tcgcattaga
aaatca
2610426DNAArtificialSynthetic nucleic acid 104cacaaacact gttgaagcaa
catttg
2610526DNAArtificialSynthetic nucleic acid 105tgtaggagtc tcgcatccac
ttgcat
2610626DNAArtificialSynthetic nucleic acid 106acagcaagat catcagtata
ccttgt
2610726DNAArtificialSynthetic nucleic acid 107ctcctggtcc tggcagtata
ccttgt
2610826DNAArtificialSynthetic nucleic acid 108cacaaacact gttcattaga
aaatca
2610926DNAArtificialSynthetic nucleic acid 109cacaaacact gttttactac
tttatt
2611026DNAArtificialSynthetic nucleic acid 110tgggaaggtt acacagtata
ccttgt
2611126DNAArtificialSynthetic nucleic acid 111cacaaacact gttattgtat
tgtatt
2611226DNAArtificialSynthetic nucleic acid 112cacaaacact gttagttggg
ccttta
2611326DNAArtificialSynthetic nucleic acid 113tgttgtagga gtccattaga
aaatca
2611426DNAArtificialSynthetic nucleic acid 114cactgttgta ggacattaga
aaatca
2611526DNAArtificialSynthetic nucleic acid 115cacaaacact gttatatatc
catagt
2611626DNAArtificialSynthetic nucleic acid 116cacaaacact gttcgggtct
caaata
2611726DNAArtificialSynthetic nucleic acid 117tgtaggagtc tcgacttgca
ttagaa
2611826DNAArtificialSynthetic nucleic acid 118aggagtctcg acgcattaga
aaatca
2611926DNAArtificialSynthetic nucleic acid 119aaacactgtt gtacattaga
aaatca
2612026DNAArtificialSynthetic nucleic acid 120cacaaacact gttggagtct
cgacgg
2612126DNAArtificialSynthetic nucleic acid 121ccagtatacc ttggaagcaa
catttg
2612226DNAArtificialSynthetic nucleic acid 122ttcagagatc ggagaagcaa
catttg
2612326DNAArtificialSynthetic nucleic acid 123tggtcctggg aaggaagcaa
catttg
2612426DNAArtificialSynthetic nucleic acid 124tggtcctggg aagttcagag
atcgga
2612526DNAArtificialSynthetic nucleic acid 125tggtcctggg aagcattaga
aaatca
2612626DNAArtificialSynthetic nucleic acid 126tgtaggagtc tcggaagcaa
catttg
2612726DNAArtificialSynthetic nucleic acid 127ccagtatacc ttgtgtagga
gtctcg
2612826DNAArtificialSynthetic nucleic acid 128tgtaggagtc tcgtgcatta
gaaaat
2612926DNAArtificialSynthetic nucleic acid 129tgtaggagtc tcgccacttg
cattag
2613026DNAArtificialSynthetic nucleic acid 130tgtaggagtc tcggaaaatc
agctat
2613126DNAArtificialSynthetic nucleic acid 131tgtaggagtc tcgtagaaaa
tcagct
2613226DNAArtificialSynthetic nucleic acid 132gaagcaacat ttgcattaga
aaatca
2613326DNAArtificialSynthetic nucleic acid 133ccagtatacc ttgcattaga
aaatca
2613424DNAArtificialSynthetic nucleic acid 134tgtaggagtc tccattagaa aatc
2413526DNAArtificialSynthetic
nucleic acid 135ttcagagatc ggacattaga aaatca
2613626DNAArtificialSynthetic nucleic acid 136tggtcctggg
aagtgtagga gtctcg
2613726DNAArtificialSynthetic nucleic acid 137ttcagagatc ggatgtagga
gtctcg
2613824DNAArtificialSynthetic nucleic acid 138gtaggagtct cgattagaaa atca
2413924DNAArtificialSynthetic
nucleic acid 139tgtaggagtc tcattagaaa atca
2414024DNAArtificialSynthetic nucleic acid 140gtaggagtct
cgcattagaa aatc
2414126DNAArtificialSynthetic nucleic acid 141cgggtctcaa atacattaga
aaatca
2614226DNAArtificialSynthetic nucleic acid 142tcgacgggtc tcacattaga
aaatca
2614326DNAArtificialSynthetic nucleic acid 143agtctcgacg ggtcattaga
aaatca
2614426DNAArtificialSynthetic nucleic acid 144cacaaacact gtttcgacgg
gtctca
2614526DNAArtificialSynthetic nucleic acid 145cacaaacact gttgtctcga
cgggtc
2614626DNAArtificialSynthetic nucleic acid 146tgtaggagtc tcgttagaaa
atcagc
2614726DNAArtificialSynthetic nucleic acid 147tgtaggagtc tcgattagaa
aatcag
2614826DNAArtificialSynthetic nucleic acid 148gtaggagtct cgcattagaa
aatcag
2614926DNAArtificialSynthetic nucleic acid 149taggagtctc gcattagaaa
atcagc
2615026DNAArtificialSynthetic nucleic acid 150ttgtaggagt ctccattaga
aaatca
2615126DNAArtificialSynthetic nucleic acid 151gttgtaggag tctcattaga
aaatca
2615226DNAArtificialSynthetic nucleic acid 152tgtaggagtc tcggcattag
aaaatc
2615326DNAArtificialSynthetic nucleic acid 153taggagtctc gaccattaga
aaatca
2615426DNAArtificialSynthetic nucleic acid 154gtaggagtct cgacattaga
aaatca
2615526DNAArtificialSynthetic nucleic acid 155gtaggagtct cgagcattag
aaaatc
2615626DNAArtificialSynthetic nucleic acid 156ttgtaggagt ctcgcattag
aaaatc
2615726DNAArtificialSynthetic nucleic acid 157tgcctgggtt cattgtagga
gtctcg
2615826DNAArtificialSynthetic nucleic acid 158tgtttgagcc aattgtagga
gtctcg
2615926DNAArtificialSynthetic nucleic acid 159gtaggagtct cgaattagaa
aatcag
2616026DNAArtificialSynthetic nucleic acid 160ttgtaggagt ctcattagaa
aatcag
2616125DNAArtificialSynthetic nucleic acid 161tgtaggagtc tcgattagaa aatca
2516225DNAArtificialSynthetic
nucleic acid 162tgtaggagtc tcgcattaga aaatc
2516325DNAArtificialSynthetic nucleic acid 163gtaggagtct
cgcattagaa aatca
2516425DNAArtificialSynthetic nucleic acid 164tgtaggagtc tccattagaa aatca
2516524DNAArtificialSynthetic
nucleic acid 165cagagatcgg attgtaggag tctc
2416624DNAArtificialSynthetic nucleic acid 166tcagagatcg
gatgtaggag tctc
2416724DNAArtificialSynthetic nucleic acid 167ttcagagatc ggtgtaggag tctc
2416825DNAArtificialSynthetic
nucleic acid 168ttcagagatc ggtaggagtc tcgac
2516926DNAArtificialSynthetic nucleic acid 169cagagatcgg
attgtaggag tctcga
2617025DNAArtificialSynthetic nucleic acid 170tcagagatcg gataggagtc tcgac
2517126DNAArtificialSynthetic
nucleic acid 171ttcagagatc ggattgtagg agtctc
2617222DNAArtificialSynthetic nucleic acid 172aggagtctcg
cattagaaaa tc
2217324DNAArtificialSynthetic nucleic acid 173aggagtctcg agcattagaa aatc
2417424DNAArtificialSynthetic
nucleic acid 174gtaggagtct cgtagaaaat cagc
2417524DNAArtificialSynthetic nucleic acid 175aggagtctcg
attagaaaat cagc
2417625DNAArtificialSynthetic nucleic acid 176gtaggagtct cggcattaga aaatc
2517725DNAArtificialSynthetic
nucleic acid 177gtaggagtct cgttagaaaa tcagc
2517824DNAArtificialSynthetic nucleic acid 178tgcctgggtt
catgtaggag tctc
2417924DNAArtificialSynthetic nucleic acid 179cagtgcctgg gttgtaggag tctc
2418024DNAArtificialSynthetic
nucleic acid 180taggagtctc gcattagaaa atca
2418124DNAArtificialSynthetic nucleic acid 181taggagtctc
gttagaaaat cagc
2418225DNAArtificialSynthetic nucleic acid 182taggagtctc gcattagaaa tcagc
2518326DNAArtificialSynthetic
nucleic acid 183ggtcctggga aggttgtagg agtctc
2618422DNAArtificialSynthetic nucleic acid 184taggagtctc
gcattagaaa at
2218523DNAArtificialSynthetic nucleic acid 185taggagtctc gcattagaaa atc
2318624DNAArtificialSynthetic
nucleic acid 186taggagtctc ggcattagaa aatc
2418724DNAArtificialSynthetic nucleic acid 187tcctgggaag
gttgtaggag tctc
2418824DNAArtificialSynthetic nucleic acid 188ttcagagatc ggaggagtct cgac
2418924DNAArtificialSynthetic
nucleic acid 189cacaaacact gtaggagtct cgac
2419024DNAArtificialSynthetic nucleic acid 190cacaaacact
gttaggagtc tcga
2419122DNAArtificialSynthetic nucleic acid 191cacaaacact gttaggagtc tc
2219222DNAArtificialSynthetic
nucleic acid 192cacaaacact ggtaggagtc tc
2219323DNAArtificialSynthetic nucleic acid 193cacaaacact
gtgtaggagt ctc
2319422DNAArtificialSynthetic nucleic acid 194agagatcgga tgtaggagtc tc
2219522DNAArtificialSynthetic
nucleic acid 195ttcagagatc ggtaggagtc tc
2219625DNAArtificialSynthetic nucleic acid 196tgcctgggtt
cattgtagga gtctc
2519725DNAArtificialSynthetic nucleic acid 197tgcctgggtt cataggagtc tcgac
2519824DNAArtificialSynthetic
nucleic acid 198tcctgggaag gtaggagtct cgac
2419924DNAArtificialSynthetic nucleic acid 199tggtcctggg
aatgtaggag tctc
2420024DNAArtificialSynthetic nucleic acid 200ctgggttcat gtaggagtct cgac
2420124DNAArtificialSynthetic
nucleic acid 201ctgggttcat gttgtaggag tctc
2420223DNAArtificialSynthetic nucleic acid 202cacaaacact
gtaggagtct cga
2320321DNAArtificialSynthetic nucleic acid 203cacaaacact gtaggagtct c
2120425DNAArtificialSynthetic
nucleic acid 204ttcagagatc ggatgtagga gtctc
2520523DNAArtificialSynthetic nucleic acid 205tccatccact
tgagaaaatc agc
2320623DNAArtificialSynthetic nucleic acid 206cctgggttca ttgtaggagt ctc
2320722DNAArtificialSynthetic
nucleic acid 207tgcctgggtt catgtaggag tc
2220822DNAArtificialSynthetic nucleic acid 208cctgggttca
tgtaggagtc tc
2220922DNAArtificialSynthetic nucleic acid 209aggagtctcg aagaaaatca gc
2221022DNAArtificialSynthetic
nucleic acid 210taggagtctc gagaaaatca gc
2221122DNAArtificialSynthetic nucleic acid 211taggagtctc
gattagaaaa tc
2221224DNAArtificialSynthetic nucleic acid 212tgggttcatg tctgtaggag tctc
2421324DNAArtificialSynthetic
nucleic acid 213cctgggttca tgtgtaggag tctc
2421423DNAArtificialSynthetic nucleic acid 214tgggttcatg
ttgtaggagt ctc
2321523DNAArtificialSynthetic nucleic acid 215ctgggttcat gttgtaggag tct
2321623DNAArtificialSynthetic
nucleic acid 216ctgggttcat gtgtaggagt ctc
2321725DNAArtificialSynthetic nucleic acid 217tcagagatcg
gattgtagga gtctc
2521822DNAArtificialSynthetic nucleic acid 218ctgggttcat tgtaggagtc tc
2221923DNAArtificialSynthetic
nucleic acid 219ctgggttcat ttgtaggagt ctc
2322022DNAArtificialSynthetic nucleic acid 220ctgggttcat
gttaggagtc tc
2222124DNAArtificialSynthetic nucleic acid 221tgggttcatg tcaggagtct cgac
2422224DNAArtificialSynthetic
nucleic acid 222agagatcgga tttgtaggag tctc
2422321DNAArtificialSynthetic nucleic acid 223cacaaacact
ggtaggagtc t
2122421DNAArtificialSynthetic nucleic acid 224acaaacactg gtaggagtct c
2122524DNAArtificialSynthetic
nucleic acid 225cctgggttca tgaggagtct cgac
2422622DNAArtificialSynthetic nucleic acid 226cctgggttca
ttgtaggagt ct
2222721DNAArtificialSynthetic nucleic acid 227ctgggttcat tgtaggagtc t
2122821DNAArtificialSynthetic
nucleic acid 228cctgggttca ttgtaggagt c
2122921DNAArtificialSynthetic nucleic acid 229cctgggttca
ttaggagtct c
2123021DNAArtificialSynthetic nucleic acid 230ctgggttcat gtaggagtct c
2123121DNAArtificialSynthetic
nucleic acid 231cctgggttca gtaggagtct c
2123222DNAArtificialSynthetic nucleic acid 232cacaaacact
tgtaggagtc tc
2223322DNAArtificialSynthetic nucleic acid 233cacaaacact gaggagtctc ga
2223424DNAArtificialSynthetic
nucleic acid 234tttcagagat cggttgtagg agtc
2423524DNAArtificialSynthetic nucleic acid 235tcagagatcg
gattgtagga gtct
2423622DNAArtificialSynthetic nucleic acid 236cacaaacact gggagtctcg ac
2223723DNAArtificialSynthetic
nucleic acid 237tgggttcatg taggagtctc gac
2323823DNAArtificialSynthetic nucleic acid 238ctgggttcat
taggagtctc gac
2323924DNAArtificialSynthetic nucleic acid 239tttcagagat cgtgtaggag tctc
2424025DNAArtificialSynthetic
nucleic acid 240cctgggttca tgttgtagga gtctc
2524120DNAArtificialSynthetic nucleic acid 241ctgggttcat
taggagtctc
2024224DNAArtificialSynthetic nucleic acid 242ttcagagatc ggattgtagg agtc
2424320DNAArtificialSynthetic
nucleic acid 243cctgggttca gtaggagtct
2024420DNAArtificialSynthetic nucleic acid 244cctgggttca
taggagtctc
2024520DNAArtificialSynthetic nucleic acid 245cctgggttcg taggagtctc
2024621DNAArtificialSynthetic
nucleic acid 246cctgggttca ggagtctcga c
2124721DNAArtificialSynthetic nucleic acid 247cctgggttca
aggagtctcg a
2124821DNAArtificialSynthetic nucleic acid 248cctgggttca tgtaggagtc t
2124924DNAArtificialSynthetic
nucleic acid 249cagagatcgg atttgtagga gtct
2425024DNAArtificialSynthetic nucleic acid 250ttcagagatc
ggttgtagga gtct
2425124DNAArtificialSynthetic nucleic acid 251tcagagatcg gatttgtagg agtc
2425224DNAArtificialSynthetic
nucleic acid 252cctgggttca tttgtaggag tctc
2425322DNAArtificialSynthetic nucleic acid 253atcggattcc
agtaggagtc tc
2225422DNAArtificialSynthetic nucleic acid 254agtttcagag agtaggagtc tc
2225521DNAArtificialSynthetic
nucleic acid 255cctgggttca tgagtctcga c
2125621DNAArtificialSynthetic nucleic acid 256ctgggttcat
ttgtaggagt c
2125724DNAArtificialSynthetic nucleic acid 257cagagatcgg attttgtagg agtc
2425822DNAArtificialSynthetic
nucleic acid 258gcacaaacac tgtaggagtc tc
2225922DNAArtificialSynthetic nucleic acid 259tgcacaaaca
cgtaggagtc tc
2226022DNAArtificialSynthetic nucleic acid 260cctgggttca cacaaacact gt
2226124DNAArtificialSynthetic
nucleic acid 261cctgggttca tgcacaaaca ctgt
2426224DNAArtificialSynthetic nucleic acid 262cagagatcgg
atcacaaaca ctgt
2426324DNAArtificialSynthetic nucleic acid 263tcagagatcg gacacaaaca ctgt
2426422DNAArtificialSynthetic
nucleic acid 264ttcagagatc gggagtctcg ac
2226520DNAArtificialSynthetic nucleic acid 265cctgggttca
gagtctcgac
2026622DNAArtificialSynthetic nucleic acid 266ccagtatacc tgtaggagtc tc
2226722DNAArtificialSynthetic
nucleic acid 267ttccagtata cgtaggagtc tc
2226824DNAArtificialSynthetic nucleic acid 268cctgggttca
tgtcagagat cgga
2426924DNAArtificialSynthetic nucleic acid 269cctgggttca tgagagatcg gatt
2427022DNAArtificialSynthetic
nucleic acid 270tttcagagat cgtaggagtc tc
2227122DNAArtificialSynthetic nucleic acid 271caaacactgt
tggagtctcg ac
2227222DNAArtificialSynthetic nucleic acid 272acaaacactg tggagtctcg ac
2227319DNAArtificialSynthetic
nucleic acid 273cctgggttct aggagtctc
1927419DNAArtificialSynthetic nucleic acid 274cctgggttcg
taggagtct
1927518DNAArtificialSynthetic nucleic acid 275cctgggttca ggagtctc
1827618DNAArtificialSynthetic
nucleic acid 276cctgggttct aggagtct
1827724DNAArtificialSynthetic nucleic acid 277ttggattcag
gttgtaggag tctc
2427824DNAArtificialSynthetic nucleic acid 278aagttggatt catgtaggag tctc
2427924DNAArtificialSynthetic
nucleic acid 279tcaggatttg catgtaggag tctc
2428024DNAArtificialSynthetic nucleic acid 280tctcaggatt
tgtgtaggag tctc
2428122DNAArtificialSynthetic nucleic acid 281agatcggatt cgtaggagtc tc
2228222DNAArtificialSynthetic
nucleic acid 282cagagatcgg agtaggagtc tc
2228322DNAArtificialSynthetic nucleic acid 283tcagagatcg
ggtaggagtc tc
2228424DNAArtificialSynthetic nucleic acid 284cctgggttca tgccagtata cctt
2428524DNAArtificialSynthetic
nucleic acid 285cctgggttca tgttccagta tacc
2428624DNAArtificialSynthetic nucleic acid 286tttgagccaa
ttcctgggtt catg
2428724DNAArtificialSynthetic nucleic acid 287tgtttgagcc aacctgggtt catg
2428824DNAArtificialSynthetic
nucleic acid 288tcctgggaag gtcctgggtt catg
2428924DNAArtificialSynthetic nucleic acid 289tggtcctggg
aacctgggtt catg
2429021DNAArtificialSynthetic nucleic acid 290cctgggctca gtaggagtct t
2129125DNAArtificialSynthetic
nucleic acid 291cctgggctca tgttgtagga gtctt
2529226DNAArtificialSynthetic nucleic acid 292gtaggagtct
tgcattagaa agtcag
2629324DNAArtificialSynthetic nucleic acid 293cctgggctca tttgtaggag tctt
2429424DNAArtificialSynthetic
nucleic acid 294cctgggctca tgaggagtct tgac
2429522DNAArtificialSynthetic nucleic acid 295cacaaacact
ggtaggagtc tt
2229626DNAArtificialSynthetic nucleic acid 296ctggtcctgg gaacttgtac
cgtctt
2629723DNAArtificialSynthetic nucleic acid 297cctgggctca ttgtaggagt ctt
2329822DNAArtificialSynthetic
nucleic acid 298cctgggctca tgtaggagtc tt
2229920DNAArtificialSynthetic nucleic acid 299cctgggctcg
taggagtctt
2030022DNAArtificialSynthetic nucleic acid 300cctgggctca ttgtaggagt ct
2230124DNAArtificialSynthetic
nucleic acid 301tgcctgggct catgtaggag tctt
2430224DNAArtificialSynthetic nucleic acid 302gctgtttgag
cctgtaggag tctt
2430324DNAArtificialSynthetic nucleic acid 303cctgggctca tgtgtaggag tctt
2430424DNAArtificialSynthetic
nucleic acid 304ctttcatggg tttgtaggag tctt
2430525DNAArtificialSynthetic nucleic acid 305cctgggctca
tgtttgtagg agtct
2530625DNAArtificialSynthetic nucleic acid 306gcctgggctc atgtgtagga gtctt
2530725DNAArtificialSynthetic
nucleic acid 307ctgggctcat gtctgtagga gtctt
2530825DNAArtificialSynthetic nucleic acid 308cctgggctca
tgtgtaggag tcttg
2530923DNAArtificialSynthetic nucleic acid 309tccagtatac cttgtaggag tct
2331024DNAArtificialSynthetic
nucleic acid 310catgggtttg attgtaggag tctt
2431124DNAArtificialSynthetic nucleic acid 311gattcaggct
gttgtaggag tctt
2431226DNAArtificialSynthetic nucleic acid 312ttctcctggt cctaccgtct
ttcatg
2631326DNAArtificialSynthetic nucleic acid 313ttctcctggt cctatacctt
gtaccg
2631425DNAArtificialSynthetic nucleic acid 314tgtaggagtc ttatatccac agttg
2531524DNAArtificialSynthetic
nucleic acid 315cagagatcgg atgttgtagg agtc
2431624DNAArtificialSynthetic nucleic acid 316agagatcgga
ttttgtagga gtct
2431724DNAArtificialSynthetic nucleic acid 317tttcagagat cgggtaggag tctt
2431824DNAArtificialSynthetic
nucleic acid 318tttcagagat cggtgtagga gtct
2431924DNAArtificialSynthetic nucleic acid 319tttcagagat
cgggttgtag gagt
2432024DNAArtificialSynthetic nucleic acid 320agagatcgga ttcttgtagg agtc
2432124DNAArtificialSynthetic
nucleic acid 321attccagtat actgtaggag tctt
2432224DNAArtificialSynthetic nucleic acid 322tccagtatac
cttgtaggag tctt
24323374DNAHomo sapiens 323ctgattttct aatgcaagtg gatggaaaac ccaaatgttg
cttctttaaa tttagctcta 60aaatacaata caataaagta gtaaaggccc aactatggat
atatttgaga cccgtcgaga 120ctcctacaac agtgtttgtg caaatcctga gactcatcaa
acctatgaaa gacggtacaa 180ggtatactgg aatccgatct ctgaaacttg acatgaaccc
aggcactggt atttggcaga 240gcattgatgt gaagacagtg ttgcaaaatt ggctcaaaca
acctgaatcc aacttaggca 300ttgaaataaa agctttagat gagaatggtc atgatcttgc
tgtaaccttc ccaggaccag 360gagaagatgg gctg
374324374DNAMus musculus 324ctgactttct aatgcaagcg
gatggcaagc ccaaatgttg cttttttaaa tttagctcta 60aaatacagta caacaaagta
gtaaaagccc aactgtggat atatctcaga cccgtcaaga 120ctcctacaac agtgtttgtg
caaatcctga gactcatcaa acccatgaaa gacggtacaa 180ggtatactgg aatccgatct
ctgaaacttg acatgagccc aggcactggt atttggcaga 240gtattgatgt gaagacagtg
ttgcaaaatt ggctcaaaca gcctgaatcc aacttaggca 300ttgaaatcaa agctttggat
gagaatggcc atgatcttgc tgtaaccttc ccaggaccag 360gagaagatgg gctg
374325384DNAHomo sapiens
325tcatttatag ctgattttct aatgcaagtg gatggaaaac ccaaatgttg cttctttaaa
60tttagctcta aaatacaata caataaagta gtaaaggccc aactatggat atatttgaga
120cccgtcgaga ctcctacaac agtgtttgtg caaatcctga gactcatcaa acctatgaaa
180gacggtacaa ggtatactgg aatccgatct ctgaaacttg acatgaaccc aggcactggt
240atttggcaga gcattgatgt gaagacagtg ttgcaaaatt ggctcaaaca acctgaatcc
300aacttaggca ttgaaataaa agctttagat gagaatggtc atgatcttgc tgtaaccttc
360ccaggaccag gagaagatgg gctg
384326384DNAMus musculus 326tcctttgtag ctgactttct aatgcaagcg gatggcaagc
ccaaatgttg cttttttaaa 60tttagctcta aaatacagta caacaaagta gtaaaagccc
aactgtggat atatctcaga 120cccgtcaaga ctcctacaac agtgtttgtg caaatcctga
gactcatcaa acccatgaaa 180gacggtacaa ggtatactgg aatccgatct ctgaaacttg
acatgagccc aggcactggt 240atttggcaga gtattgatgt gaagacagtg ttgcaaaatt
ggctcaaaca gcctgaatcc 300aacttaggca ttgaaatcaa agctttggat gagaatggcc
atgatcttgc tgtaaccttc 360ccaggaccag gagaagatgg gctg
38432755DNAHomo sapiens 327tcatttatag ctgattttct
aatgcaagtg gatggaaaac ccaaatgttg cttct 5532855DNAHomo sapiens
328aactatggat atatttgaga cccgtcgaga ctcctacaac agtgtttgtg caaat
5532935DNAHomo sapiens 329cctgagactc atcaaaccta tgaaagacgg tacaa
3533044DNAHomo sapiens 330atgatcttgc tgtaaccttc
ccaggaccag gagaagatgg gctg 4433141DNAMus musculus
331tcctttgtag ctgactttct aatgcaagcg gatggcaagc c
4133252DNAMus musculus 332cccgtcaaga ctcctacaac agtgtttgtg caaatcctga
gactcatcaa ac 5233330DNAMus musculus 333tgaaagacgg tacaaggtat
actggaatcc 3033444DNAMus musculus
334atgatcttgc tgtaaccttc ccaggaccag gagaagatgg gctg
4433541DNAHomo sapiens 335tcatttatag ctgattttct aatgcaagtg gatggaaaac c
4133630DNAHomo sapiens 336cccgtcgaga ctcctacaac
agtgtttgtg 3033755DNAHomo sapiens
337tcatttatag ctgattttct aatgcaagtg gatggaaaac ccaaatgttg cttct
5533845DNAHomo sapiens 338aactatggat atatttgaga cccgtcgaga ctcctacaac
agtgt 4533935DNAHomo sapiens 339ctcctacaac agtgtttgtg
caaatcctga gactc 3534045DNAHomo sapiens
340tgaaagacgg tacaaggtat actggaatcc gatctctgaa acttg
4534130DNAHomo sapiens 341aaacttgaca tgaacccagg cactggtatt
3034249DNAHomo sapiens 342tggtcatgat cttgctgtaa
ccttcccagg accaggagaa gatgggctg 4934375DNAMus musculus
343tcctttgtag ctgactttct aatgcaagcg gatggcaagc ccaaatgttg cttttttaaa
60tttagctcta aaata
7534445DNAMus musculus 344aactgtggat atatctcaga cccgtcaaga ctcctacaac
agtgt 4534535DNAMus musculus 345ctcctacaac agtgtttgtg
caaatcctga gactc 3534660DNAMus musculus
346gactcatcaa acccatgaaa gacggtacaa ggtatactgg aatccgatct ctgaaacttg
6034738DNAMus musculus 347gatctctgaa acttgacatg agcccaggca ctggtatt
3834849DNAMus musculus 348tggccatgat cttgctgtaa
ccttcccagg accaggagaa gatgggctg 4934929DNAHomo sapiens
349atagctgatt ttctaatgca agtggatgg
2935020DNAHomo sapiens 350ccgtcgagac tcctacaaca
2035115DNAHomo sapiens 351aacagtgttt gtgca
1535238DNAHomo sapiens
352aagacggtac aaggtatact ggaatccgat ctctgaaa
3835320DNAHomo sapiens 353tgacatgaac ccaggcactg
2035435DNAHomo sapiens 354atgatcttgc tgtaaccttc
ccaggaccag gagaa 3535518DNAMus musculus
355ctgactttct aatgcaag
1835618DNAMus musculus 356gtcaagactc ctacaaca
1835711DNAMus musculus 357cagtgtttgt g
1135847DNAMus musculus
358aacccatgaa agacggtaca aggtatactg gaatccgatc tctgaaa
4735915DNAMus musculus 359acatgagccc aggca
1536020DNAArtificialSynthetic nucleic acid
360ttcgtctgga aacagctcct
2036120DNAArtificialSynthetic nucleic acid 361agagggtaac gacagcatcg
2036235DNAHomo sapiens
362cctgagactc atcaaaccta tgaaagacgg tacaa
3536344DNAHomo sapiens 363atgatcttgc tgtaaccttc ccaggaccag gagaagatgg
gctg 4436430DNAMus musculus 364aaattggctc aaacagcctg
aatccaactt 3036512DNAMus musculus
365ggctcaaaca gc
1236625DNAMus musculus 366tgtaaccttc ccaggaccag gagaa
2536726DNAArtificialSynthetic nucleic acid
367ttcagagatc ggattgtagg agtctt
2636826DNAArtificialSynthetic nucleic acid 368ccatcttctc ctgcttgtac
cgtctt
2636925DNAArtificialSynthetic nucleic acid 369tgtaggagtc ttgatatatc cacag
2537024DNAArtificialSynthetic
nucleic acid 370cagagatcgg attgtaggag tctt
2437120DNAArtificialSynthetic nucleic acid 371ttcagagatc
taggagtctc
2037220DNAArtificialSynthetic nucleic acid 372tcagagatcg taggagtctc
2037320DNAArtificialSynthetic
nucleic acid 373cagagatcgg taggagtctc
2037422DNAArtificialSynthetic nucleic acid 374tttcagagat
ctgtaggagt ct
2237522DNAArtificialSynthetic nucleic acid 375ttcagagatc gtgtaggagt ct
2237622DNAArtificialSynthetic
nucleic acid 376tttcagagat cggagtctcg ac
2237722DNAArtificialSynthetic nucleic acid 377tcagagatcg
tgtaggagtc tc
2237820DNAArtificialSynthetic nucleic acid 378tgacagcagt gatggctctt
2037920DNAArtificialSynthetic
nucleic acid 379ccaaaggctt caaaatcgac
20
User Contributions:
Comment about this patent or add new information about this topic: