Patent application title: USE OF HLA GENETIC STATUS TO ASSESS OR SELECT TREATMENT OF CELIAC DISEASE
Inventors:
IPC8 Class: AC12Q16883FI
USPC Class:
1 1
Class name:
Publication date: 2020-01-23
Patent application number: 20200024664
Abstract:
Provided herein are methods of adjusting or selecting a gluten peptide
therapy based on the human leukocyte antigen (HLA) genotype, in
particular HLA-DQ2.5 homozygosity, of a subject having or suspected of
having Celiac disease. Also provided herein are methods of identifying
(e.g., diagnosing) a subject, such as a subject having or suspected of
having Celiac disease and/or assessing the efficacy of treatment of
Celiac disease, e.g. by determining responsiveness to a therapeutic
gluten peptide composition or cytokine response, and kits relating
thereto.Claims:
1. A method, comprising: selecting or adjusting a gluten peptide
treatment for a subject that has or is suspected of having Celiac disease
based on a human leukocyte antigen (HLA) genotype of the subject.
2. The method of claim 1, further comprising: assessing the HLA genotype of the subject.
3. The method of claim 2, wherein assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene in the subject.
4. The method of claim 3, wherein determining comprises performing a nucleic-acid based assay on each copy of the HLA-DQA gene, or a portion thereof, and each copy of the HLA-DQB gene, or a portion thereof.
5. The method of claim 4, wherein the nucleic-acid based assay is a probe-based assay or a sequencing assay.
6. The method of claim 1, wherein assessing further comprises identifying the subject as having a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype.
7. The method of claim 6, wherein the non-homozygous HLA-DQ2.5 genotype is a heterozygous HLA-DQ2.5 genotype.
8. The method of claim 7, wherein the heterozygous HLA-DQ2.5 genotype is HLA-DQ.sup.2.5/2.2, HLA-DQ.sup.2.5/7, or HLA-DQ.sup.2.5/8.
9. The method of claim 1, wherein the method further comprises: decreasing a dose of the gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype.
10. The method of claim 1, wherein the gluten peptide treatment comprises a composition comprising: a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO:2); a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO:3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4); and a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5).
11. The method of claim 10, wherein: the first peptide comprises the amino acid sequence LQPFPQPELPYPQPQ (SEQ ID NO: 62); the second peptide comprises the amino acid sequence QPFPQPEQPFPWQP (SEQ ID NO: 7); and the third peptide comprises the amino acid sequence PEQPIPEQPQPYPQQ (SEQ ID NO: 8).
12. The method of claim 11, wherein: the first peptide comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated; the second peptide comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal proline is amidated; and the third peptide comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated.
13. The method of claim 9, wherein the dose is or is decreased to less than 300 micrograms if the subject has a homozygous HLA-DQ2.5 genotype.
14. The method of claim 13, wherein the dose is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype.
15. A method, comprising: measuring a level of at least one circulating cytokine or chemokine in a subject that has or is suspected of having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the likelihood the subject has Celiac disease.
16. The method of claim 16, further comprising: assessing the HLA genotype of the subject.
17. The method of claim 16, wherein assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene in the subject.
18. The method of claim 17, wherein determining comprises performing a nucleic-acid based assay on each copy of the HLA-DQA gene, or a portion thereof, and each copy of the HLA-DQB gene, or a portion thereof.
19-46. (canceled)
47. A method for assessing tolerance to a gluten peptide in a subject having Celiac disease, the method comprising: measuring a level of at least one circulating cytokine or chemokine in a subject having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the tolerance of the subject to the at least one gluten peptide based on the measuring.
48-78. (canceled)
79. A method comprising: administering to a subject that has or is suspected of having Celiac disease a first composition comprising at least one gluten peptide in an amount selected based on an HLA genotype of the subject, measuring a T cell response to a second composition comprising at least one gluten peptide in a sample from the subject, and assessing the likelihood that the subject has Celiac disease.
80-87. (canceled)
Description:
RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. .sctn. 119(e) of U.S. provisional application No. 62/057,167, filed Sep. 29, 2014, the entire contents of which is incorporated by reference herein in their entirety.
BACKGROUND OF THE INVENTION
[0002] Celiac disease, also known as coeliac disease or Celiac sprue (Coeliac sprue), affects approximately 1% of people in Europe and North America. In many of those affected, Celiac disease is unrecognised, but this clinical oversight is now being rectified with greater clinical awareness. A gluten free diet is the only currently approved treatment for Celiac disease, and because regular ingestion of as little as 50 mg of gluten (equivalent to 1/100.sup.th of a standard slice of bread) can damage the small intestine; chronic inflammation of the small bowel is commonplace in subjects on a gluten free diet. Persistent inflammation of the small intestine has been shown to increase the risk of cancer, osteoporosis and death. As gluten is so widely used, for example, in commercial soups, sauces, ice-creams, etc., maintaining a gluten-free diet is difficult.
[0003] Celiac disease occurs in genetically susceptible individuals who possess either HLA-DQ2.5 (encoded by the genes HLA-DQA1*05 and HLA-DQB1*02) accounting for about 90% of individuals, HLA-DQ2.2 (encoded by the genes HLA-DQA1*02 and HLA-DQB1*02), or HLA-DQ8 (encoded by the genes HLA-DQA1*03 and HLA-DQB1*0302). Without wishing to be bound by theory, it is believed that such individuals mount an inappropriate HLA-DQ2- and/or DQ8-restricted CD4.sup.+ T cell-mediated immune response to peptides derived from the aqueous-insoluble proteins of wheat flour, gluten, and related proteins in rye and barley.
SUMMARY OF THE INVENTION
[0004] As described herein, it has been found that subjects having Celiac disease that are homozygous for HLA-DQ2.5 have higher levels of circulating cytokines and/or adverse symptoms after administration of a gluten peptide composition. Accordingly, aspects of the disclosure relate to methods of selecting or adjusting a gluten peptide treatment based on the human leukocyte antigen (HLA) genotype of a subject being treated, such as a subject having or suspected of having Celiac disease
[0005] Accordingly, aspects of the disclosure relate to a method of selecting or adjusting a gluten peptide treatment for a subject that has or is suspected of having Celiac disease based on a human leukocyte antigen (HLA) genotype of the subject.
[0006] In some embodiments of any one of the methods provided, the method further comprises assessing the HLA genotype of the subject.
[0007] In some embodiments of any one of the methods provided, assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene in the subject. In some embodiments of any one of the methods provided, determining comprises performing a nucleic-acid based assay on each copy of the HLA-DQA gene, or a portion thereof, and each copy of the HLA-DQB gene, or a portion thereof. In some embodiments of any one of the methods provided, the nucleic-acid based assay is a probe-based assay or a sequencing assay.
[0008] In some embodiments of any one of the methods provided, assessing further comprises identifying the subject as having a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the non-homozygous HLA-DQ2.5 genotype is a heterozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the heterozygous HLA-DQ2.5 genotype is HLA-DQ.sup.25/22, HLA-DQ.sup.25/7, or HLA-DQ.sup.25/8.
[0009] In some embodiments of any one of the methods provided, the method further comprises decreasing a dose of the gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype.
[0010] In some embodiments of any one of the methods provided, any one of the gluten peptide compositions may comprise at least one peptide comprising at least one amino acid sequence selected from PFPQPELPY (SEQ ID NO: 1), PQPELPYPQ (SEQ ID NO:2), PFPQPEQPF (SEQ ID NO:3), PQPEQPFPW (SEQ ID NO:4), PIPEQPQPY (SEQ ID NO:5) and EQPIPEQPQ (SEQ ID NO:6).
[0011] In some embodiments of any one of the methods provided, any one of the gluten peptide compositions may comprise:
[0012] a) a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO:2);
[0013] b) a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO:3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4); and
[0014] c) a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5).
[0015] In some embodiments of any one of the methods provided, any one of the gluten peptide compositions may comprise a first peptide that comprises the amino acid sequence LQPFPQPELPYPQPQ; a second peptide that comprises the amino acid sequence QPFPQPEQPFPWQP (SEQ ID NO: 7); and a third peptide that comprises the amino acid sequence PEQPIPEQPQPYPQQ (SEQ ID NO: 8). In some embodiments of any one of the methods provided, any one of the gluten peptide compositions may comprise a first peptide that comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated; a second peptide that comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal proline is amidated; and a third peptide that comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated.
[0016] In some embodiments of any one of the methods provided, the dose is or is decreased to less than 300 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is selected to be up to 300 micrograms if the subject has a heterozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided herein, the amount selected based on HLA-DQ2.5 genotype is any one of the foregoing.
[0017] Other aspects of the disclosure relate to a method of measuring a level of at least one circulating cytokine or chemokine in a subject that has or is suspected of having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the likelihood the subject has Celiac disease.
[0018] In some embodiments of any one of the methods provided, the method further includes comprises assessing the HLA genotype of the subject.
[0019] In some embodiments of any one of the methods provided assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene in the subject. In some embodiments of any one of the methods provided, determining comprises performing a nucleic-acid based assay on each copy of the HLA-DQA gene, or a portion thereof, and each copy of the HLA-DQB gene, or a portion thereof. In some embodiments of any one of the methods provided, the nucleic-acid based assay is a probe-based assay or a sequencing assay.
[0020] In some embodiments of any one of the methods provided, assessing further comprises identifying the subject as having a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the non-homozygous HLA-DQ2.5 genotype is a heterozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the heterozygous HLA-DQ2.5 genotype is HLA-DQ.sup.25122, HLA-DQ.sup.2517, or HLA-DQ.sup.2518.
[0021] In some embodiments of any one of the methods provided, the method further comprises decreasing the amount of a composition, e.g., a first composition, a second composition, or both, comprising at least one gluten peptide administered to the subject if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the amount of a composition, e.g., a first composition, a second composition, or both, comprising at least one gluten peptide administered to the subject if the subject has a non-homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the methods further comprises selecting any one of the amounts or doses as described herein.
[0022] In some embodiments of any one of the methods provided, a composition, e.g., a first composition and/or a second composition, comprising at least one gluten peptide comprises: a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO:2);
[0023] a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO:3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4); and
[0024] a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5).
[0025] In some embodiments of any one of the methods provided, the first peptide comprises the amino acid sequence LQPFPQPELPYPQPQ (SEQ ID NO: 62); the second peptide comprises the amino acid sequence QPFPQPEQPFPWQP (SEQ ID NO: 7); and the third peptide comprises the amino acid sequence PEQPIPEQPQPYPQQ (SEQ ID NO: 8).
[0026] In some embodiments of any one of the methods provided, the first peptide comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated; the second peptide comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal proline is amidated; and the third peptide comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated.
[0027] In some embodiments of any one of the methods provided, the amount of the composition comprising at least one gluten peptide is or is decreased to less than 300 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided the amount of the composition comprising at least one gluten peptide is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype.
[0028] In some embodiments of any one of the methods provided, the method further comprises obtaining a sample from the subject and the measuring is performed on the sample.
[0029] In some embodiments of any one of the methods provided, the sample from the subject is obtained 1 hour to 6 hours after the subject has been administered the first composition. In some embodiments of any one of the methods provided, the sample from the subject is obtained 4 hours to 6 hours after the subject has been administered the first composition. In some embodiments of any one of the methods provided, the sample from the subject is a plasma or serum sample.
[0030] In some embodiments of any one of the methods provided, the subject has been administered the first composition by injection. In some embodiments of any one of the methods provided, the subject has been administered the first composition by oral administration.
[0031] In some embodiments of any one of the methods provided, the method further comprises administering the first composition to the subject prior to measuring the level of the at least one circulating cytokine or chemokine. In some embodiments of any one of the methods provided, the at least one circulating cytokine or chemokine is MCP-1, IP-10, IL-6, IL-8, G-CSF, IL-2, IL-IRA, GRO, EOTAXIN, GM-CSF, IL-10, TNFa, IFNa2, MIP-1b, IL-12P70, IL-la, IL-17A, EGF, MIP-la, FRACTALKINE, IFNg, VEGF, IL-9, FGF-2, IL-lb, Flt-3L, I-15, TNFb, IL-12(P40), MCP-3, IL-4, MDC, IL-13, TGF-a, IL-3, IL-5, IL-7 or sCD40L.
[0032] In some embodiments of any one of the methods provided, an elevated level of the at least one circulating cytokine or chemokine compared to a control level of the at least one circulating cytokine or chemokine indicates that the subject has Celiac disease, and the step of assessing comprises comparing the level of the at least one circulating cytokine or chemokine to a control level of the at least one circulating cytokine or chemokine. In some embodiments of any one of the methods provided, the control level is a baseline level. In some embodiments of any one of the methods provided, the baseline level is a level of the at least one circulating cytokine or chemokine prior to administration of the first composition.
[0033] In some embodiments of any one of the methods provided, the method further comprises recording whether or not the subject has celiac disease based on the assessing.
[0034] In some embodiments of any one of the methods provided, the method further comprises treating, suggesting a treatment, or giving information in regard to a treatment to the subject.
[0035] In some embodiments of any one of the methods provided, the method further comprises: decreasing a dose of the gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype
[0036] In some embodiments of any one of the methods provided, measuring the level of the at least one circulating cytokine or chemokine comprises an immuno-based assay. In some embodiments of any one of the methods provided, the immuno-based assay comprises an ELISA or a multiplex bead-based assay.
[0037] In some embodiments of any one of the methods provided, the method further comprises measuring a T cell response to the first composition comprising the at least one gluten peptide.
[0038] Other aspects of the disclosure relate to a method for assessing tolerance to a gluten peptide in a subject having Celiac disease, the method comprising: measuring a level of at least one circulating cytokine or chemokine in a subject having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the tolerance of the subject to the at least one gluten peptide based on the measuring.
[0039] In some embodiments of any one of the methods provided, the method further comprises assessing the HLA genotype of the subject. In some embodiments of any one of the methods provided, assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene in the subject. In some embodiments of any one of the methods provided, determining comprises performing a nucleic-acid based assay on each copy of the HLA-DQA gene, or a portion thereof, and each copy of the HLA-DQB gene, or a portion thereof. In some embodiments of any one of the methods provided the nucleic-acid based assay is a probe-based assay or a sequencing assay.
[0040] In some embodiments of any one of the methods provided, assessing further comprises identifying the subject as having a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the non-homozygous HLA-DQ2.5 genotype is a heterozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the heterozygous HLA-DQ2.5 genotype is HLA-DQ.sup.25122, HLA-DQ.sup.2517, or HLA-DQ.sup.2518.
[0041] In some embodiments of any one of the methods provided, the method further comprises: decreasing the amount of the first composition comprising at least one gluten peptide administered to the subject if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the amount of the first composition comprising at least one gluten peptide administered to the subject if the subject has a non-homozygous HLA-DQ2.5 genotype.
[0042] In some embodiments of any one of the methods provided, a composition, e.g., a first composition and/or a second composition, comprising at least one gluten peptide comprises:
[0043] a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO:2);
[0044] a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO:3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4); and
[0045] a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5).
[0046] In some embodiments of any one of the methods provided, the first peptide comprises the amino acid sequence LQPFPQPELPYPQPQ (SEQ ID NO: 62); the second peptide comprises the amino acid sequence QPFPQPEQPFPWQP (SEQ ID NO: 7); and the third peptide comprises the amino acid sequence PEQPIPEQPQPYPQQ (SEQ ID NO: 8).
[0047] In some embodiments of any one of the methods provided, the first peptide comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated; the second peptide comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal proline is amidated; and the third peptide comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated.
[0048] In some embodiments of any one of the methods provided, the amount of the composition comprising at least one gluten peptide is or is decreased to less than 300 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the amount of the composition comprising at least one gluten peptide is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype.
[0049] In some embodiments of any one of the methods provided, the method further comprises obtaining a sample from the subject and the measuring is performed on the sample. In some embodiments of any one of the methods provided, the sample from the subject is obtained 1 hour to 6 hours after the subject has been administered the first composition. In some embodiments of any one of the methods provided, the sample from the subject is obtained 4 hours to 6 hours after the subject has been administered the first composition. In some embodiments of any one of the methods provided, the sample from the subject is a plasma or serum sample.
[0050] In some embodiments of any one of the methods provided, the subject has been administered the first composition by injection. In some embodiments of any one of the methods provided, the subject has been administered the first composition by oral administration.
[0051] In some embodiments of any one of the methods provided, the method further comprises administering the first composition to the subject prior to measuring the level of the at least one circulating cytokine or chemokine. In some embodiments of any one of the methods provided, the at least one circulating cytokine or chemokine is MCP-1, IP-10, IL-6, IL-8, G-CSF, IL-2, IL-IRA, GRO, EOTAXIN, GM-CSF, IL-10, TNFa, IFNa2, MIP-lb, IL-12P70, IL-la, IL-17A, EGF, MIP-la, FRACTALKINE, IFNg, VEGF, IL-9, FGF-2, IL-lb, Flt-3L, I-15, TNFb, IL-12(P40), MCP-3, IL-4, MDC, IL-13, TGF-a, IL-3, IL-5, IL-7 or sCD40L.
[0052] In some embodiments of any one of the methods provided, an elevated level of the at least one circulating cytokine or chemokine compared to a control level of the at least one circulating cytokine or chemokine indicates that the subject has Celiac disease, and the step of assessing comprises comparing the level of the at least one circulating cytokine or chemokine to a control level of the at least one circulating cytokine or chemokine. In some embodiments of any one of the methods provided, the control level is a baseline level. In some embodiments of any one of the methods provided, the baseline level is a level of the at least one circulating cytokine or chemokine prior to administration of the first composition.
[0053] In some embodiments of any one of the methods provided, the method further comprises recording whether or not the subject has celiac disease based on the assessing. In some embodiments of any one of the methods provided, the method further comprises treating, suggesting a treatment, or giving information in regard to a treatment to the subject.
[0054] In some embodiments of any one of the methods provided, the method further comprises: decreasing a dose of the gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype
[0055] In some embodiments of any one of the methods provided, measuring the level of the at least one circulating cytokine or chemokine comprises an immuno-based assay. In some embodiments of any one of the methods provided, the immuno-based assay comprises an ELISA or a multiplex bead-based assay.
[0056] In some embodiments of any one of the methods provided, the method further comprises measuring a T cell response to the first composition comprising the at least one gluten peptide.
[0057] Other aspects of the disclosure relate to a kit comprising i) the first composition as defined by any one of the methods provided, and ii) a binding partner for the at least one cytokine or chemokine as defined by any one of the methods provided. In some embodiments of any one of the methods provided, the kit further comprises iii) a means for injecting the first composition.
[0058] Other aspects of the disclosure relate to a method comprising: administering to a subject that has or is suspected of having Celiac disease a first composition comprising at least one gluten peptide in an amount selected based on an HLA genotype of the subject, measuring a T cell response to a second composition comprising at least one gluten peptide in a sample from the subject, and assessing the likelihood that the subject has Celiac disease.
[0059] In some embodiments of any one of the methods provided, the first composition and the second composition comprise the same gluten peptide or peptides. In some embodiments of any of the methods provided, the sample is contacted with the second composition.
[0060] In some embodiments of any one of the methods provided, the method further comprises obtaining the sample from the subject.
[0061] In some embodiments of any one of the methods provided, the the subject is orally administered or directed to consume gluten for at least three days.
[0062] In some embodiments of any one of the methods provided, the the measuring step is performed six days after the last of the gluten is orally administered or consumed.
[0063] In some embodiments of any one of the methods provided, IFN-gamma is measured. In some embodiments of any one of the methods provided, IP-10 is measured.
[0064] The details of one or more embodiments of the disclosure are set forth in the description below. Other features or advantages of the present disclosure will be apparent from the following drawings and detailed description of several embodiments, and also from the appending claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0065] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0066] FIG. 1 is a table showing the number of subjects in each of Cohorts 1, 2, and 7 that were homozygous for HLA-DQ2.5, heterozygous HLA-DQ2.5/2.2 or 2.5/7, heterozygous HLA-DQ2.5 or HLA-DQ2.5/unknown.
[0067] FIG. 2 is a table showing the median peak fold change in circulating cytokines from pre-dose after 1.sup.st dose of the gluten peptide composition. Other means non-HLA-DQ2.5 homozygous subjects. Sx=symptoms.
[0068] FIG. 3 is a graph showing the peak fold change in concentration of IL-2 at 4-6 hours after dose of the gluten peptide composition in subjects that were homozygous for HLA-DQ2.5 (n=22) or heterozygous HLA-DQ2.5/2.2 or 2.5/7, heterozygous HLA-DQ2.5 or HLA-DQ2.5/unknown (n=60).
[0069] FIG. 4 is a graph showing peak fold change in concentration of IL-2, IL-8, IL-10, TNF-.alpha., MIP-1.beta., GM-CSF, Eotaxin, IP-10, and MCP-1 at 4-6 hours after dose of the gluten peptide composition in subjects that were homozygous for HLA-DQ2.5 (n=22) or heterozygous HLA-DQ2.5/2.2 or 2.5/7, heterozygous HLA-DQ2.5 or HLA-DQ2.5/unknown (n=60).
DETAILED DESCRIPTION OF THE INVENTION
[0070] As described herein, it has been found that subjects who are homozygous for the HLA-DQ2.5 genotype have higher levels of circulating cytokines and/or adverse events in response to administration of a gluten peptide treatment. Accordingly, aspects of the disclosure relate to selecting or adjusting a gluten peptide treatment for a subject (e.g., a subject having or suspected of having Celiac disease) based on the human leukocyte antigen (HLA) genotype of the subject.
Methods
[0071] Aspects of the disclosure relate to a method, comprising selecting or adjusting a gluten peptide treatment for a subject that has or is suspected of having Celiac disease based on a human leukocyte antigen (HLA) genotype of the subject. Gluten peptide treatments are further described herein.
[0072] Another aspect of the disclosure relates to a method of identifying (e.g., diagnosing) a subject, such as a subject having or suspected of having Celiac disease based on the HLA-DQ2.5 genotype.
[0073] Yet another aspect of the disclosure relates to a method of assessing the efficacy of treatment of Celiac disease (e.g., responsiveness to a therapeutic gluten peptide composition) based on the HLA-DQ2.5 genotype
[0074] In some embodiments, the method further comprises assessing the HLA genotype of the subject. In some embodiments of any one of the methods described herein, the assessing comprises determining the sequence of each copy of an HLA-DQA gene and each copy of an HLA-DQB gene (including determining the sequence of a portion thereof) in the subject. HLA genes and genotypes are further described herein.
[0075] In some embodiments of any one of the methods described herein, determining the sequence comprises reading sequence information, e.g., on a chart, on a print-out, or on a computer such as in a database of sequence information. In some embodiments, the sequence information may be conveyed as a symbol or other words, numbers or letters that indicate the sequence (e.g., DQA1*05 or DQB1*02).
[0076] In some embodiments, assessing the genotype includes being given or being told the genotype information for the subject. In some embodiments, assessing the genotype of subject includes obtaining genotype information for the subject from an individual, e.g., a patient provider or laboratory personnel, a tangible medium, e.g., on a chart or print out, or an intangible medium, e.g., a database.
[0077] In some embodiments, assessing the genotype includes performing an assay on a patient or patient sample.
[0078] In some embodiments of any one of the methods described herein, determining comprises performing a nucleic-acid based assay on one or both copies of the HLA-DQA gene, or a portion thereof, and on one or both copies of the HLA-DQB gene, or a portion thereof. In some embodiments, the nucleic-acid based assay is a probe-based assay or a sequencing assay. Nucleic-acid based assays are further described herein.
[0079] In some embodiments of any one of the methods described herein, assessing further comprises identifying the subject as having a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype. In some embodiments, the non-homozygous HLA-DQ2.5 genotype is a heterozygous HLA-DQ2.5 genotype. HLA-DQ2.5 genotypes are further described herein.
[0080] In some embodiments of any one of the methods described herein, the method further comprises decreasing a dose of the gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype; or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype.
[0081] In some embodiments of any one of the methods described herein, the method further comprises measuring a level of at least one circulating cytokine or chemokine in a subject that has or is suspected of having celiac disease, wherein the subject has been administered a composition comprising a decreased dose of at least one gluten peptide as described herein based on the HLA-DQ2.5 genotype.
[0082] In some embodiments of any one of the methods provided, the dose is or is decreased to less than 300 micrograms of the gluten peptides if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is or is increased to up to 300 micrograms if the subject has a heterozygous HLA-DQ2.5 genotype.
[0083] In some embodiments of any one of the methods provided, the dose of the gluten peptides is selected to be up to 300 micrograms if the subject has a heterozygous HLA-DQ2.5 genotype.
[0084] In some embodiments, the selected dose for a subject having a homozygous DQ2.5 genotype is less than the dose that would be selected for a subject having a heterozygous DQ2.5 genotype. In some embodiments, the selected dose for a subject having a heterozygous DQ2.5 genotype is more than the dose that would be selected for a subject having a homozygous DQ2.5 genotype.
HLA Genotypes
[0085] Aspects of the disclosure relate to the assessment and/or assaying of an HLA genotype in a subject. In some embodiments, the assessing comprises determining the presence or absence of one or more HLA-DQA alleles and one or more HLA-DQB alleles. In some embodiments, the assessing comprises determining the sequence of one or more copies of an HLA-DQA gene and/or one or more copies of an HLA-DQB gene (including determining the sequence of a portion of each gene or determining the identity of a SNP associated with a particular allele) in a subject. In some embodiments, the HLA genotype is a homozygous HLA-DQ2.5 genotype or a non-homozygous HLA-DQ2.5 genotype. The non-homozygous HLA-DQ2.5 genotype may be, e.g., a heterozygous HLA-DQ2.5 genotype. Exemplary heterozygous HLA-DQ2.5 genotypes include, but are not limited to, HLA-DQ2.5/2.2, HLA-DQ2.5/7, or HLA-DQ2.5/8.
[0086] Exemplary HLA-DQA and HLA-DQB alleles for the HLA-DQA and HLA-DQB genes are: HLA-DQ2.5 (DQA1*05 and DQB1*02), DQ2.2 (DQA1*02 and DQB1*02), DQ7 (DQA1*05 and DQB1*0301) and DQ8 (DQA1*03 and DQB1*0302). Exemplary sequences for DQA and DQB alleles are shown below.
TABLE-US-00001 HLA-DQA1*0501 (Genbank accession number: AF515813.1) DQA1*0501 allele, 3' UTR and partial cds (SEQ ID NO: 82) GGCCTGCGTTCAGTTGGTGCTTCCAGACACCAAGGGCCCTTGTGAATCCCATCCTGGAATGGAAGGTAAG ATTGAGATTTGTTAGAGCTGAATCCGCAGTATGAGAGGAAGGAAAGTGGAGGAGGCTGTGGACATGAATG GTTGAAAGTTGTAGGGGAATTGGGAAGTGGCATGATGATGACATAGGAGCGGCCTAGGACCCATCCATCT CATGTCTGTCCTGTTGCAGGTGCATCGCCATCTACAGGAGCAGAAGAGTGGACTTGCTACATGACCTAGC ATTATTTTCTGGCCCCATTTATCATATCCCTTTTCTCCTCCAAATGTTTCTCCTCTCACCTCTTCTGTGG GACTTAAATTGCTATATCTGCTCAGAGCTCACAAATGCCTTTGAATTATTTCCCTGACTTCCTGATTTTT TTCTTCTTAAGTGTTACCTACTAAGAGTTGCCTGGAGTAAGCCACCCAGCTACCTAATTCCTCAGTAACC TCCATCTATAATCTCCATGGAAGCAACAAATTCCCTTTATGAGATATATGTCAAATTTTTCCATCTTTCA TCCAGGGCTGACTGAAACCGTGGCTAAGAATTGGGAGACTCTCTTGTTTCAAGCCAATTTAACATCATTT ACCAGATCATTTGTCATGTCCAGTAACACAGAAGCAACCAACTACAGTATAGCCTGATAACATGTTGATT TCTTAGCTGACATTAATATTTCTTTCTTCCTTGTGTTCCCACCCTTGGCATTGCCACCCACCCCTCAATT AAGGCAACAATGAAGTTAATGGATACCCTCTGCCTTTGGCTCAGAAATGTTATAGCAAAAATTTTAAAAT AAAAAAGTAAGTCTGTACTAATTTCAATATGACTTTTAAAAGTATGACAGAGAAATGGGTTGGGATAAAG GAAATTTGAATCTCAAAAATATCAATAGTGAAAAGTTATTCTCAAAACTTTAAATTTGTGAAGAATGATG ACAGTAGAAGCCTTCCTCTCCCCTCCTCACCCTGAAGGAATAAAATTTCCTTAGGCAGGAAAAGAAATGG AAGTCAGAAAAACATTAGAATAAGACAATAATGTGGGTATCTGAAAAGGAACAAATACTCATTCCTCACA TAGGGTTAGTGACAATGG HLA-DQA1*0505 (Genbank accession number: AH013295.2) HLA-DQA1*0505 allele, partial cds (SEQ ID NO: 83) CCAGTCCTGAGAGGAAAGAAAATACAATCAGTTTGTTATTAACTGAGGAAAGAATTAAGTGAAAGATGAA TCTTAGGAAGCAGAAGGAAGTAAACCTAATCTCTGACTAAGAAAGCTAAATACCATAATAACTCATTCAT TCCTTCTTTTGTTTAATTACATTATTTAATCATAAGTCCGTGATGTGCCAGGCACTCAGGAAATAGTAAA AACTGGACATGTGATATTCTGCCCTTGTGTAGCGCACATTATAGTGGGAAAGAAAGCGCAATTTTAACCG GACAACTACCAACAATAAGAGCGGAGGAAGCAGGGGTTGGAAATGTCCACAGGCTGTGCCAAAGATGAAG CCCGTAATATTTGAAAGTCAGTTTCTTTCATCATTTTGTGTATTAAGGTTCTTTCTTCCCCTGTTCTCCA CCTTCCTGCTTGTCATCTTCACTCATCAGCTGACCACGTCGCCTCTTATGGTGTAAACTTGTACCAGTCT TACGGTCCCTCTGGCCAGTACACCCATGAATTTGATGGAGATGAGCAGTTCTACGTGGACCTGGGGAGGA AGGAGACTGTCTGGTGTTTGCCTGTTCTCAGACAATTTAGATTTGACCCGCAATTTGCACTGACAAACAT CGCTGTCCTAAAACATAACTTGAACAGTCTGATTAAACGCTCCAACTCTACCGCTGCTACCAATGGTATG TGTCAACAATTCTGCCCCTCTTTACTGATTTATCCCTTCATACCAAGTTTCATTATTTTATTTCCAAGAG GTCCCCAGATCTTCTCATGGCAATTGCTGAAATTTTATCATCTCCCATCTCTAAAATCACATATTCCCAT GTAATACAAGGGTCTTTCCATTATCCATTCATTAAATCCTTCTCGGAGAGGTCTCATCAACCTCCTACTT TATTAAACATGCCCACAGAGAGAAGGGCACAGGAATAAAGCGGAGGCAATGTGTCGTTGCTCCCAAGCAG AAGGTAAATAAGACCTCTTTGACTATCAGGTGGTGAAATGCTGGTAGGAGGGCTCTTCCAGGATGTAATG CAGAAGCTCATGGCAGAGCTATTCACACTTCACATCAGTGCTGTTTCCTCACCACAGAGGTTCCTGAGGT CACAGTGTTTTCCAAGTCTCCCGTGACACTGGGTCAGCCCAACATCCTCATCTGTCTTGTGGACAACATC TTTCCTCCTGTGGTCAACATCACATGGCTGAGCAATGGGCACTCAGTCACAGAAGGTGTTTCTGAGACCA GCTTCCTCTCCAAGAGTGATCATTCCTTCTTCAAGATCAGTTACCTCACCCTCCTCCCTTCTGCTGAGGA GAGTTATGACTGCAAGGTGGAGCACTGGGGACTGGACAAGCCTCTTCTGAAACACTGGGGTAAGGATGAG TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTGAAAGAATAAAGCAACAAAAGCAAAGATTTATTG AAAATGAAAGTACACTTCACATGGTGGGAGCGGGCCTGAGCATAGGGGCTCAAGAGCCACTTCATGGGTT TCTAATGATAGACTTCACTCTCCTCCCTAAGCTGGGGACCATGAGTCTTTGCAGAGCCAACCCTCCACCC CATCCCATCCCACACACATGCACATGAGCACACTCTGCTTTCTGACCTCAACGACTTCATATCCACAGAG CCTGAGATTCCAGCCCCTATGTCAGAGCTCACAGAGACTGTGGTCTGCGCCCTGGGGTTGTCTGTGGGCC TCGTGGGCATTGTGGTGGGCACTGTCTTCATCATCCGAGGCCTGCGTTCAGTTGGTGCTTCCAGACACCA AGGGCCCTTGTGAATCCCATCCTGGAATGGAAGGTAAGATTGAGATTTGTTAGAGCTGAATCCGCAGTAT GAGAGGAAGGAAAGTGGAGGAGGCTGTGGACATGAATGGTTGAAAGTTGTAGGGGAATTGGGAAGTGGCA TGATGATGACATAGGAGCGGCCTAGGACCCATCCATCTCATGTCTGTCCTGTTGCAGGTGCATCGCCATC TACAGGAGCAGAAGAGTGGACTTGCTACATGACCTAGCATTATTTTCTGGCCCCATTTATCATATCCCTT TTCTCCTCCAAATGTTTCTCCTCTCACCTCTTCTGTGGGACTTAAATTGCTATATCTGCTCAGAGCTCAC AAATGCCTTTGAATTATTTCCCTGACTTCCTGATTTTTTTCTTTTCTCAAGTGTTACCTACTAAGGGATG CCTGGAGTAAGCCACCCAGCTACCTAATTCCTCA HLA-DQB1*0201 (Genbank accession number: AY375842.1) HLA-DQB1*0201 allele, exons 1 through 4, and partial cds (SEQ ID NO: 84) TCCCCCTTAATTTGCCCTATTGAAAGAATCCCAAGTATAAGAACAACTGGTTTTTAATCAATATTACAAA GATGTTTACTGTTGAATCGCATTTTTCTTTGGCTTCTTAAAATCCCTTAGGCATTCAATCTTCAGCTCTT CCATAATTGAGAGGAAATTTTCACCTCAAATGTTCATCCAGTGCAATTGAAAGACGTCACAGTGCCAGGC ACTGGATTCAGAACCTTCACAAAAAAAAAATCTGCCCAGAGACAGATGAGGTCCTTCAGCTCCAGTGCTG ATTGGTTCCTTTCCAAGGGACCATCCAATCCTACCACGCATGGAAACATCCACAGATTTTTATTCTTTCT GCCAGGTACATCAGATCCATCAGGTCCGAGCTGTGTTGACTACCACTTTTCCCTTCGTCTCAATTATGTC TTGGAAAAAGGCTTTGCGGATCCCCGGAGGCCTTCGGGCAGCAACTGTGACCTTGATGCTGTCGATGCTG AGCACCCCAGTGGCTGAGGGCAGAGACTCTCCCGGTAAGTGCAGGGCAGCTGCTCTCCAGAGCCGCTACT CTGGGAACAGGCTCTCCTTGGGCTGGGGTACGGGGATGGTGATCTCCATAATCTCGGACACAATCTTTTA TCAACATTTCCTCTGTTTTGGGAAAGAGAGCTATGTTGCATTTCCATTTATCTTTTAATGATGAAGTGAG GACAATCCAATCCCATCCTACAGGCTTAAGCCTGGAAGAGGAGGAGAGAGGAGAGAAAAGAGGAGACAAA GTGTTCATTTACTACCAGTGATAGGACAAAGTGAGCATGGGGTTATTTTTGAAGATATGAATTTCTCCAA AGACACAGCAGGATTTGCCATTTAGGCGTGTCCCAAGACTTGCCTGGACTAAATATTATGATTTCCTGCA TTGGGAAATGCAAGGCAGCAATGGTGTCTGTAGTCTCCGTATTTGGGGAAAAGTTGTCTGTATTCCTGAC CCAGTGGAGCGTTTGTGGAGGCAAAATCTTGGTACTGAGGGAAGCTGACTGGCTGACCACAGAAAGAGAG CCTTCAGGTTTCACTGATTTATGGGCAAATGGTGACCTGAGTGGGATTCAGATACCCGAGTTGATGATGG ACTAAATTTAGTAGAAAGGAGGATGTAAAGAAGGGAAATAACACATACTGTGAAACCACTCATTTCAGAC ACAGAACAATACTTTACATAAATTCTCTCTCACTCCTTCTAACATCCTGTGTGTAGATATCATGATTTTC TTTTACACAATTATACTTGTGATATGGATATTCTGTTACATAACCTGCCCGGGCTGGTGACTGCCACAGT TTAATGGGAATCTAGTTTATCAAATTCAAAAGCTTGTGCTCTTTCGGTGAATAAATGTTTCTTTCTAGGA CTCAGAGATCTAGGACTCCCTTCTTTCTAACACAGACGTGAGTGAACCTCACAGGGCACTTGGGAGGGTA AATCCAGGCATGGGAAGGAAGGTATTTTACCCAGGGACCAAGAGAATAGGCGTATCGGAAGAGGACAGGT TTAATTCCTGGACCTGTCTCGTCATTCCCTTGAACTGTCAGGTTTATGTGGATAACTTTATCTCTGAGGT ACCCAGGAGCTCCATGGAAAATGAGATTTCATGCGAGAACGCCCTGATCCCTCTAAGTGCAGAGGTCCAT GTAAAATCAGCCCGACTGCCTCTTCACTTGGTTCACAGGCCGAGACAGGGACAGGGCTTTCCTCCCTTTC CTGCCTGTAGGAAGGCGGATTCCCGAAGACCCCCGAGAGGGCGGGCAGGGCTGGGCAGAGCCGCCGGGAG GATCCCAGGTCTGCAGCGCGAGGCACGGGCCGGCGGGAACTTGTGGTCGCGCGGGCTGTTCCACAGCTCC GGGCCGGGTCAGGGTGGCGGCTGCGGGGGCGGACGGGCTGGGCCGCACTGACTGGCCGGTGATTCCTCGC AGAGGATTTCGTGTACCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACAGAGCGCGTGCGTCTTGTG AGCAGAAGCATCTATAACCGAGAAGAGATCGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGA CGCTGCTGGGGCTGCCTGCCGCCGAGTACTGGAACAGCCAGAAGGACATCCTGGAGAGGAAACGGGCGGC GGTGGACAGGGTGTGCAGACACAACTACCAGTTGGAGCTCCGCACGACCTTGCAGCGGCGAGGTGAGCGG CGTCGCCCCTCTGCGAGGCCCACCCTTGGCCCCAAGTCTCTGCGCCAGGAGGGGCGAAGGGTCGTGGCCT CTGGAACCTGAGCCCCGTTTGTTCCACCCCAGAGGACAGGAGGCAGCGGCGAGAGTGGTGGGGGCAGGTG CATCGGAGGTGCGGGGACCTAGGGCAGAGCAGGGGGACAGGCAGAGTTGGCCAGGCTGCCTAGTGTCGCC CCAGCCTACCCGTTCGTCGGCCTTGTCCTCTGCTCTGCATGTTCTTGCCTCGTGCCTTATGCATTTGCCT CCTTTTGCCTTACCTTTGCTAAGCAGCTCTCTCTGCTCAGAATGCCCGCCCTCTTCCCCTGCCCGCCCGC CCGCCCCACTAGCACTGCCCCACCCAGCAAGGCCCACGTGCACAGCTCTTGCAGCAGGAAGCTTCAGGCT TAGCCTGGTGGAGTTAGGGCTGTTCCACAACTGCGCGCAGGACATTCAGCAATTACAGTTGTGAAATAAG ATATTTTAACTTTTGGCTTCAAATCATTATTCATCGTAATTCTGTTTTCTTAAATGGCTCTCATTCATGG CAGAGATCTTTGAGGTGAGGGTGTTTTAATCATTGCATGCCTAGTACCTGACACATTGACTGGTATGTGG TGTGAGCTCAATGATCTTCTGTTAAATTAATGAATAAATGTACTCAGCTGCCCATCCACTTAGGCTCAAG AAAAAAAAAGAGGTAAACAGAGCCTTAAAAATGGACTTTATTAATTATTTTCTATAATTTTGCTTAATGC TTTAAAGTAAACTCTTATTGACTTGGATCTTAATAGAGTTTGTGAATACAAAATCTGAGGAAAAAAGTTT TTGCTAAAAATAAAAACAACGCTTGAAAGATATTGTAAGGCAGTTTAAATTTCTTTTCTTTTCTTTTTTT TTTTTTTTGAGACGGATTCTCACTCTGTCGCCCAGGCCGGAGTGCAGTGGCGCGATCTCGGCTCACTGCA AGCTCCGCCTCCCGGGTTCACGCCATTCTCCTGCCTCAGCCTCCTGAGTAGGTGGGATTACAGGCGCGTG CCACCACGCCCGGCTAATTTTTTTGTATTTTTAGTAGAGGCGGGGTTTCACCGTGTTAGCCAGGATGGTC TGGATCTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACA GTGCCCGGCCGGCACTTTTAATTTCTTAGAAAAGCTGAACAAATGGCACAATGCAAAGAGCAAAAGTTTT GGAATAAATAGATTGAAGCCATTAAATTATTGGATAAAAATAGTTTCGGGTTGCTTTTGGCCTAGGTTCT CCCCTCCCCCCATGACTATCCACTTCAGGAATAAACATTCTGAAAGTCAATTTTACCCATTTAGTGAGCA TTTATTTCTAGACAGTTGCCTTATCAAATACCATCTATGTTACGTCATTTAATCTCACAGTTACTTGTGC ATCAGAGATTAGCATCACCACTTTATATATTGGTACATGATAAACACTTTATTGGTCATGGATGGGGAGA TGGTCACTGTAGGCTAATATTGGTACATGATAAACACTTTAAGTAATCAGCCCATAATTGCTCACCAAGA CCTTAAGCCTCCCAAAGTACACAACATTCTTTGTGTTCTTCACTACACATCCATAGAGTCTAAGGGACGT AAAGCCTCGTTAAAGCCAGTTTTGACCAGAAGCAGCAATGAGTCTATTCCTGTGTGTTTTCCATGTTAAT GGGACAAAATGATACTTTCAAGGCATTGAAAATTCATGATTAATCAATCCCTAGTCTGACCCCAGTGTTA TCTATGCAGGTTTGCAAAACCTTTAGTTTACTTAATACTCCCTTGCCTTCTTTTGATTCACATCCTAATG CCAGCAAATACTTATGTTTTTGCTATTTCAGTTCCATTTCCATAAAATTTATTTTATCATCTTTTCTCAT AAATTTATGCCCTCTATTTTTACTCCCAATCTGTTTAAGATGAACAAATCTTATAAGGCCACATAGCTGA CTGTTATTTCTGTTGGACTCCAGGAAGGAGAACCTAAAGAAAAGTTCAAGTCCAAGCAGAAACCGTGATT TCTTCCAGATGATGGCTCATGAGTGCCATTTAATTGGGGTGCCACCTGGTGACCTCAGCAAATCCCAGCT ATATTTATGTGTTCACATTACAGGATCATTAACCCAGACCGACCACTGCACAGATCTCAGAATATTTTCT ATGGAGAACATACATAATAATGCCTGATTTCAGAAGAAGAAAGTAATTCTCAATAGCAAGGGGATGGAGT AGGGTAGACAGCTGTAATTAAACTCACTTGTGTGATAAAAAGAAATTAAGGAAAAAAGAAAATGAGAGAA CATATTACTAAATAAAGAAAGCATACATTAAATATTTACTATAGTTTCACACTAAGAGAATAAAGGAAAT GCAATAAAGTGGCCTGAAAGGTAAAGGATGAGATGTGTAAAGGGGTGTAGTATTTTTACTATGAGCAGCA ATCTGAGAAGATAAAGGAATCGAGTTACGGGCAAACATGATGTTTGATCAGTGTTATTTGTTTTCAAGGC
CTGCCTAAATTTTTTTCAAATATTACAAACTTTTGAAATAACATTCTTTTTGTTTTTTGCTGTCTGTTAC TAGGTTGCACATTTTATAAAGGCAGGGACCATGGTATGTTGTTTGTCTTTGGATTCTCAGTGATTGTTAT ATTTATATTTGTTGAAGGAACCTTAATCCAAGACTTGGACTCCAAGTATCTTTCCACTCTGGTTCCAAGG AGGGACCTTCCTCACAGCAGGCATGCTGTGTGGTCTCACATCTCACTCCTATATCTTTCCCTGTCTGTTA CTGCCCTCAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAACCTGC TGGTCTGCTCGGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGGAATGACCAGGAGGA GACAGCTGGCGTTGTGTCCACCCCCCTTATTAGGAATGGTGACTGGACCTTCCAGATCCTGGTGATGCTG GAAATGACTCCCCAGCGTGGAGACGTCTACACCTGCCACGTGGAGCACCCCAGCCTCCAGAGCCCCATCA CCGTGGAGTGGCGTAAGGGGATATTGAGTTTCTGTTACTGTGGGCCCCACAAGACAAAGGACAGAGCTCC TTCTGACCCATCCCTTCCCATCTCTTATCCCTGATGTCACTGCTGAGCTGGGAATCACAGGAGACTAGAG CACCTCTAGTTCCATGGCGAGTGCATCAGAAGAATCCTGATCTCATCACCTTTCCAGATGCTAGGGAAAT TACTCTACATACTGTTGCTCTGGATCCCAGTCCTGATTGCTCTGAGGAACTGATTATTAGGGCTGGTGAC TGGGATCTTAGGGTCTAAGTTTATGGATGAGTTCCTGAGGAGTGGAGATCTGCTTCCCCACTCTGTCACC TACTCACTGTATCCAAGGACCTATTGGCTGGCCTTTCCCTCCCTTAGGGGTGGTCTGAATGGAGAACTAG GTTCCTTTGATGCCTTCACCTCCTGCATCTCAGACTGGACTTCAGCTCCTCATCAGGGAAACTATGGGGT ATGGGGACAAACACTGACACTCAGGCTCTGCTTCTCAGGGGCTCAATCTGAATCTGCCCAGAGCAAGATG CTGAGTGGCAT HLA-DQB1*0202 (Genbank accession number: AY375844.1) HLA-DQB1*0202 allele, exons 1 through 4, and partial cds (SEQ ID NO: 85) TTGAAAGAATCCCAAGTATAAGAACAACTGGTTTTTAATCAATATTACAAAGATGTTTACTGTTGAATCG CATTTTTCTTTGGCTTCTTAAAATCCCTTAGGCATTCAATCTTCAGCTCTTCCATAATTGAGAGGAAATT TTCACCTCAAATGTTCATCCAGTGCAATTGAAAGACGTCACAGTGCCAGGCACTGGATTCAGAACCTTCA CACAAAAAAAATCTGCCCAGAGACAGATGAGGTCCTTCAGCTCCAGTGCTGATTGGTTCCTTTCCAAGGG ACCATCCAATCCTACCACGCATGGAAACATCCACAGATTTTTATTCTTTCTGCCAGGTACATCAGATCCA TCAGGTCCGAGCTGTGTTGACTACCACTTTTCCCTTCGTCTCAATTATGTCTTGGAAAAAGGCTTTGCGG ATCCCCGGAGGCCTTCGGGCAGCAACTGTGACCTTGATGCTGTCGATGCTGAGCACCCCAGTGGCTGAGG GCAGAGACTCTCCCGGTAAGTGCAGGGCAGCTGCTCTCCAGAGCCGCTACTCTGGGAACAGGCTCTCCTT GGGCTGGGGTACGGGGATGGTGATCTCCATAATCTCGGACACAATCTTTTATCAACATTTCCTCTGTTTT GGGAAAGAGAGCTATGTTGCATTTCCATTTATCTTTTAATGATGAAGTGAGGACAATCCAATCCCATCCT ACAGGCTTAAGCCTGGAAGAGGAGGAGAGAGGAGAGAAAAGAGGAGACAAAGTGTTCATTTACTACCAGT GATAGGACAAAGTGAGCATGGGGTTATTTTTGAAGATATGAATTTCTCCAAAGACACAGCAGGATTTGCC ATTTAGGCGTGTCCCAAGACTTGCCTGGACTAAATATTATGATTTCCTGCATTGGGAAATGCAAGGCAGC AATGGTGTCTGTAGTCTCCGTATTTGGGGAAAAGTTGTCTGTATTCCTGACCCAGTGGAGCGTTTGTGGA GGCAAAATCTTGGTACTGAGGGAAGCTGACTGGCTGACCACAGAAAGAGAGCCTTCAGGTTTCACTGATT TATGGGCAAATGGTGACCTGAGTGGGATTCAGATACCCGAGTTGATGATGGACTAAATTTAGTAGAAAGG AGGATGTAAAGAAGGGAAATAACACATACTGTGAAACCACTCATTTCAGACACAGAACAATACTTTACAT AAATTCTCTCTCACTCCTTCTAACATCCTGTGTGTAGATATCATGATTTTCTTTTACACAATTATACTTG TGATATGGATATTCTGTTACATAACCTGCCCGGGCTGGTGACTGCCACAGTTTAATGGGAATCTAGTTTA TCAAATTCAAAAGCTTGTGCTCTTTCGGTGAATAAATGTTTCTTTCTAGGACTCAGAGATCTAGGACTCC CTTCTTTCTAACACAGAAGTGAGTGAACCTCACAGGGCACTTGGGAGGGTAAATCCAGGCATGGGAAGGA AGGTATTTTACCCAGGGACCAAGAGAATAGGCGTATCGGAAGAGGACAGGTTTAATTCCTGGACCTGTCT CGTCATTCCCTTGAACTGTCAGGTTTATGTGGATAACTTTATCTCTGAGGTACCCAGGAGCTCCATGGAA AATGAGATTTCATGCGAGAACGCCCTGATCCCTCTAAGTGCAGAGGTCCATGTAAAATCAGCCCGACTGC CTCTTCACTTGGTTCACAGGCCGAGACAGGGACAGGGCTTTCCTCCCTTTCCTGCCTTTAGGAAGGCGGA TTCCCGAAGACCCCCGAGAGGGCGGGCAGGGCTGGGCAGAGCCGCCGGGAGGATCCCAGGTCTGCAGCGC GAGGCACGGGCCGGCGGGAACTTGTGGTCGCGCGGGCTGTTCCACAGCTCCGGGCCGGGTCAGGGTGGCG GCTGCGGGGGCGGACGGGCTGGGCCGCACTGACTGGCCGGTGATTCCTCGCAGAGGATTTCGTGTACCAG TTTAAGGGCATGTGCTACTTCACCAACGGGACAGAGCGCGTGCGTCTTGTGAGCAGAAGCATCTATAACC GAGAAGAGATCGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGCTGCTGGGGCTGCCTGC CGCCGAGTACTGGAACAGCCAGAAGGACATCCTGGAGAGGAAACGGGCGGCGGTGGACAGGGTGTGCAGA CACAACTACCAGTTGGAGCTCCGCACGACCTTGCAGCGGCGAGGTGAGCGGCGTCGCCCCTCTGCGAGGC CCACCCTTGGCCCCAAGTCTCTGCGCCAGGAGGGGCGAAGGGTCGTTGCCTCTGGAACCTGAGCCCCGTT TGTTCCACCCCAGAGGACAGGAGGCAGCGGCGAGAGTGGTGGGGGCAGGTGCATCGGAGGTGCGGGGACC TAGGGCAGAGCAGGGGGACAGGCAGAGTTGGCCAGGCTGCCTAGTGTCGCCCCAGCCTACCCGTTCGTCG GCCTTGTCCTCTGCTCTGCATGTTCTTGCCTCGTGCCTTATGCATTTGCCTCCTTTTGCCTTACCTTTGC TAAGCAGCTCTCTCTGCTCAGAATGCCCGCCCTCTTCCCCTGCCCGCCCGCCCGCCCCGCTAGCACTGCC CCACCCAGCAAGGCCCACGTGCACAGCTCTTGCAGCAGGAAGCTTCAGGCTTAGCCTGGTGGAGTTAGGG CTGTTCCACAACTGCGCGCAGGACATCCAGCAATTACAGTTGTGAAATAAGATATTTTAACTTTTGGCTT CAAATCATTATTCATCGTAATTCTGTTTTCTTAAATGGCTCTCATTCATGGCAGAGATCTTTGAGGTGAG GGTGTTTTAATCATTGCATGCCTAGTACCTGACACATTGACTGGTATGTGGTGTGAGCTCAATGATCTTC TGTTAAATTAATGAATAAATGTACTCAGCTGCCCATCCACTTAGGCTCAAGAAAAAAAAAGAGGTAAACA GAGCCTTAAAAATGGACTTTATTAATTATTTTCTATAATTTTGCTTAATGCTTTAAAGTAAACTCTTATT GACTTGGATCTTAATAGAGTTTGTGAATACAAAATCTGAGGAAAAAAGTTTTTGCTAAAAATAAAAACAA CGCTTGAAAGATATTGTAATGCAGTTTAAATTTCTTTTCTTTTTTTTTTTTTTTTTGAGACGGATTCTCA CTCTGTCGCCCAGGCCGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAAGCTCCGCCTCCCGGGTTCACG CCATTCTCCTGCCTCAGCCTCCTGAGTAGGTGGGATTACAGGCGCGTGCCACCACGCCCGGCTAATTTTT TTGTATTTTTAGTAGAGGCGGGGTTTCACCGTGTTAGCCAGGATGGTCTGGATCTCCTGACCTCATGATC CGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACAGTGCCCGGCCGGCACTTTTAAT TTCTTAGAAAAGCTGAACAAATGGCACAATGCAAAGAGCAAAAGTTTTGGAATAAATAGATTGAAGCCAT TAAATTATTGGATAAAAATAGTTTCGGGTTGCTTTTGGCCTAGGTTCTCCCCTCCCCCCATGACTATCCA CTTCAGGAATAAACATTCTGAAAGTCAATTTTACCCATTTAGTGAGCATTTATTTCTAGACAGTTGCCTT ATCAAATACCATCTATGTTACGTCATTTAATCTCACAGTTACTTGTGCATCAGAGATTAGCATCACCACT TTATATATTGGTACATGATAAACACTTTATTGGTCATGGATGGGGAGATGGTCACTGTAGGCTAATATTG GTACATGATAAACACTTTAAGTAATCAGCCCATAATTGCTCACCAAGACCTTAAGCCTCCCAAAGTACAC AACATTCTTTGTGTTCTTCACTACACATCCATAGAGTCTAAGGGACGTAAAGCCTCGTTAAAGCCAGTTT TGACCAGAAGCAGCAATGAGTCTATTCCTGTGTGTTTTCCATGTTAATGGGACAAAATGATACTTTCAAG GCATTGAAAATTCATGATTAATCAATCGCTAGTCTGACCCCAGTGTTATCTATGCAGGTTTGCAAAACCT TTAGTTTACTTAATACTCCCTTGCCTTCTTTTGATTCACATCCTAATGCCAGCAAATACTTATGTTTTTG CTATTTCAGTTCCATTTCCATAAAATTTATTTTATCATCTTTTCTCATAAATTTATGCCCTCTATTTTTA CTCCCAATCTGTTTAAGATGAACAAATCTTATAAGGCCACATAGCTGACTGTTATTTCTGTTGGACTCCA GGAAGGAGAACCTAAAGAAAAGTTCAAGTCCAAGCAGAAACCGTGATTTCTTCCAGATGATGGCTCATGA GTGCCATTTAATTGGGGTGCCACCTGGTGACCTCAGCAAATCCCAGCTATATTTATGTGTTCACATTACA GGATCATTAACCCAGACCGACCACTGCACAGATCTCAGAATATTTTCTATGGAGAACATACATAATAATG CCTGATTTCAGAAGAAGAAAGTAATTCTCAATAGCAAGGGGATGGAGTAGGGTAGACAGCTGTAATTAAA CTCACTTGTGTGATAAAAAGAAATTAAGGAAAAAAGAAAATGAGAGAACATATTACTAAATAAAGAAAGC ATACATTAAATATTTACTATAGTTTCACACTAAGAGAATAAAGGAAATGCAATAAAGTGGCCTGAAAGGT AAAGGATGAGATGTGTAAAGGGGTGTAGTATTTTTACTATGAGCAGCAATCTGAGAAGATAAAGGAATCG AGTTACGGGCAAACATGATGTTTGATCAGTGTTATTTGTTTTCAAGGCCTGCCTAAATTTTTTTCAAATA TTACAAACTTTTGAAATAACATTCTTTTTGTTTTTTGCTGTCTGTTACTAGGTTGCACATTTTATAAAGG CAGGGACCATGGTATGTTGTTTGTCTTTGGATTCTCAGTGATTGTTATATTTATATTTGTTGAAGGAACC TTAATCCAAGACTTGGACTCCAAGTATCTTTCCACTCTGGTTCCAAGGAGGGACCTTCCTCACAGCAGGC ATGCTGTGTGGTCTCACATCTCACTCCTATATCTTTCCCTGTCTGTTACTGCCCTCAGTGGAGCCCACAG TGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAACCTGCTGGTCTGCTCGGTGACAGATTT CTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGGAATGGCCAGGAGGAGACAGCTGGCGTTGTGTCCACC CCCCTTATTAGGAATGGTGACTGGACCTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAG ACGTCTACACCTGCCACGTGGAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGTAAGGGGAT ATTGAGTTTCTGTTACTGTGGGCCCCACAAGACAAAGGACAGAGCTCCTTCTGACCCATCCCTTCCCATC TCTTATCCCTGATGTCACTGCTGAGCTGGGAATCACAGGAGACTAGAGCACCTCTAGTTCCATGGCGAGT GCATCAGAAGAATCCTGATCTCATCACCTTTCCAGATGCTAGGGAAATTACTCTACATACTGTTGCTCTG GATCCCAGTCCTGATTGCTCTGAGGAACTGATTATTAGGGCTGGTGACTGGGATCTTAGGGTCTAAGTTT ATGGATGAGTTCCTGAGGAGTGGAGATCTGCTTCCCCACTCTGTCACCTACTCACTGTATCCAAGTACCT ATTGGCTGGCCTTTCCCTCCCTTAGGGGTGGTCTGAATGGAGAACTAGGTTCCTTTGATGCCTTCACCTC CTGCATCTCAGACTGGACTTCAGCTCCTCATCAGGGAAACTATGGGGTATGGGGACAAACACTGACACTC AGGCTCTGCTTCTCAGGGGCTCAATCTGAATCTGCCCAGAGCAAGATGCTGAGTGGCA
HLA Genotype Assays
[0087] Other aspects of the disclosure relate to assays for detecting the HLA genotype of a subject, e.g., a nucleic-acid based assay. The HLA genotype may be detected, e.g., using one or more single nucleotide polymorphisms associated with an HLA genotype or by sequencing all or part of an HLA-DQA and/or HLA-DQB gene. Exemplary SNPs for use in HLA genotyping include, but are not limited to: rs2187668, rs2395182, rs4713586, rs7775228, rs4639334, and rs7454108. Any one or more of such exemplary SNPs may be used for HLA genotyping.
[0088] Detection of a nucleic acid sequence, e.g., the sequence of an HLA DQA and/or DQB gene, or a portion thereof (e.g., a SNP or a fragment of the gene), may be accomplished using any nucleic-acid based assay known in the art (see, e.g., Bunce M, et al. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence-specific primers (PCR-SSP). Tissue Antigens 46, 355-367 (1995); Olerup O, Aldener A, Fogdell A. HLA-DQB1 and DQA1 typing by PCR amplification with sequence-specific primers in 2 hours. Tissue antigens 41, 119-134 (1993); Mullighan C G, Bunce M, Welsh K I. High-resolution HLA-DQB1 typing using the polymerase chain reaction and sequence-specific primers. Tissue-Antigens. 50, 688-92 (1997); Koskinen L, Romanos J, Kaukinen K, Mustalahti K, Korponay-Szabo I, et al. (2009) Cost-effective HLA typing with tagging SNPs predicts celiac disease risk haplotypes in the Finnish, Hungarian, and Italian populations. Immunogenetics 61: 247-256.; and Monsuur A J, de Bakker P I, Zhernakova A, Pinto D, Verduijn W, et al. (2008) Effective detection of human leukocyte antigen risk alleles in celiac disease using tag single nucleotide polymorphisms. PLoS ONE 3: e2270; Koskinen L, Romanos J, Kaukinen K, Mustalahti K, Korponay-Szabo I, Barisani D, Bardella M T, Ziberna F, Vatta S, Szeles G et al: Cost-effective HLA typing with tagging SNPs predicts Celiac disease risk haplotypes in the Finnish, Hungarian, and Italian populations. Immunogenetics 2009, 61(4):247-256; Monsuur A J, de Bakker P I, Zhernakova A, Pinto D, Verduijn W, Romanos J, Auricchio R, Lopez A, van Heel D A, Crusius J B et al: Effective detection of human leukocyte antigen risk alleles in Celiac disease using tag single nucleotide polymorphisms. PLoS ONE 2008, 3(5):e2270).
[0089] Exemplary nucleic acid-based assays include, but are not limited to, PCR, restriction fragment length polymorphism identification (RFLPI), random amplified polymorphic detection (RAPD), amplified fragment length polymorphism detection (AFLPD), allele specific oligonucleotide (ASO) probes, hybridization to microarrays or beads, Sanger sequencing, Single-molecule real-time sequencing (Pacific Bio), Ion semiconductor (Ion Torrent sequencing), Pyrosequencing (454), Single molecule real time (SMRT) sequencing), Sequencing by synthesis (Illumina), and Sequencing by ligation (SOLiD sequencing). The assays may include the use of one or more nucleic acid probes or primers. The one or more probes or primers may be designed, e.g., to specifically bind to nucleic sequences within one or more HLA-DQA or DQB alleles. Methods for designing probes and primers are known in the art. The probes or primers may be attached to a detectable label. Any suitable detectable label is contemplated. Detectable labels include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means, e.g., an enzyme, a radioactive label, a fluorophore, an electron dense reagent, biotin, digoxigenin, or a hapten. Such detectable labels are well-known in the art and can be detected through use of, e.g., an enzyme assay, a chromogenic assay, a luminometric assay, a fluorogenic assay, or a radioimmune assay. The reaction conditions to perform detection of the detectable label depend upon the detection method selected.
Gluten Peptide Treatment
[0090] Aspects of the disclosure relate to gluten peptide treatments and uses thereof in any one of the methods described herein. As used herein the term "gluten peptide" includes any peptide comprising a sequence derived from, or encompassed within, one or more of gluten proteins alpha (.alpha.), beta (.beta.), .gamma. (.gamma.) and omega (.omega.) gliadins, and low and high molecular weight (LMW and HMW) glutenins in wheat, B, C and D hordeins in barley, .beta., .gamma. and omega secalins in rye, and optionally avenins in oats, including deamidated variants thereof containing one or more glutamine to glutamate substitutions. In some embodiments, the gluten peptide(s) stimulate a CD4+ T cell specific response.
[0091] A gluten peptide may include one or more epitopes known to be recognized by a CD4.sup.+ T cell in a subject with Celiac disease, e.g., PELP (SEQ ID NO: 12), PELPY (SEQ ID NO: 13), QPELPYP (SEQ ID NO: 64), PQPELPY (SEQ ID NO: 65), FPQPELP (SEQ ID NO: 66), PELPYPQ (SEQ ID NO: 67), FPQPELPYP (SEQ ID NO: 68), PYPQPELPY (SEQ ID NO: 14), PFPQPELPY (SEQ ID NO: 1), PQPELPYPQ (SEQ ID NO: 2), PFPQPEQPF (SEQ ID NO: 3), PQPEQPFPW (SEQ ID NO: 4), PIPEQPQPY (SEQ ID NO: 5), PQPELPYPQ (SEQ ID NO: 2), FRPEQPYPQ (SEQ ID NO: 27), PQQSFPEQQ (SEQ ID NO: 28), IQPEQPAQL (SEQ ID NO: 29), QQPEQPYPQ (SEQ ID NO: 30), SQPEQEFPQ (SEQ ID NO: 31), PQPEQEFPQ (SEQ ID NO: 32), QQPEQPFPQ (SEQ ID NO: 33), PQPEQPFCQ (SEQ ID NO: 34), QQPFPEQPQ (SEQ ID NO: 35), PFPQPEQPF (SEQ ID NO: 3), PQPEQPFPW (SEQ ID NO:4), PFSEQEQPV (SEQ ID NO: 36), FSQQQESPF (SEQ ID NO: 37), PFPQPEQPF (SEQ ID NO:3), PQPEQPFPQ (SEQ ID NO: 38), PIPEQPQPY (SEQ ID NO:5), PFPQPEQPF (SEQ ID NO:3), PQPEQPFPQ (SEQ ID NO:38), PYPEQEEPF (SEQ ID NO: 39), PYPEQEQPF (SEQ ID NO: 40), PFSEQEQPV (SEQ ID NO:36), EGSFQPSQE (SEQ ID NO: 41), EQPQQPFPQ (SEQ ID NO: 42), EQPQQPYPE (SEQ ID NO: 43), QQGYYPTSPQ (SEQ ID NO: 44), EGSFQPSQE (SEQ ID NO:41), PQQSFPEQE (SEQ ID NO: 45), or QGYYPTSPQ (SEQ ID NO: 46) (see, e.g., Sollid L M, Qiao S W, Anderson R P, Gianfrani C, Koning F. Nomenclature and listing of celiac disease relevant gluten epitopes recognized by CD4.sup.+ T cells. Immunogenetics. 2012; 64:455-60; PCT Publication Nos.: WO/2001/025793, WO/2003/104273, WO/2005/105129, and WO/2010/060155). Preferably, in some embodiments, the gluten peptides that comprise epitopes such as those set forth in SEQ ID NO: 12, 13, etc., also comprise additional amino acids flanking either or both sides of the epitope. Exemplary gluten peptides and methods for synthesizing such peptides are known in the art (see, e.g., PCT Publication Nos.: WO/2001/025793, WO/2003/104273, WO/2005/105129, and WO/2010/060155, which are incorporated herein by reference in their entirety). In some embodiments, the gluten peptide comprises PELP (SEQ ID NO: 12), PELPY (SEQ ID NO: 13), QPELPYP (SEQ ID NO: 64), PQPELPY (SEQ ID NO: 65), FPQPELP (SEQ ID NO: 66), or PELPYPQ (SEQ ID NO: 67) and is at least 8 or 9 amino acids in length.
[0092] In some embodiments, one or more glutamate residues of a gluten peptide may be generated by tissue transglutaminase (tTG) deamidation activity upon one or more glutamine residues of the gluten peptide. This deamidation of glutamine to glutamate can cause the generation of gluten peptides that can bind to HLA-DQ2 or -DQ8 molecules with high affinity. This reaction may occur in vitro by contacting the gluten peptide composition with tTG outside of the subject (e.g., prior to or during contact of a gluten peptide composition with a sample comprising T cells from a subject) or in vivo following administration through deamidation via tTG in the body. Deamidation of a peptide may also be accomplished by synthesizing a peptide de novo with glutamate residues in place of one or more glutamine residues, and thus deamidation does not necessarily require use of tTG. For example, PFPQPQLPY (SEQ ID NO: 15) could become PFPQPELPY (SEQ ID NO: 1) after processing by tTG. Conservative substitution of E with D is also contemplated herein (e.g., PFPQPELPY (SEQ ID NO: 1) could become PFPQPDLPY (SEQ ID NO: 26). Exemplary peptides including an E to D substitution include peptides comprising or consisting of PFPQPDLPY (SEQ ID NO: 26), PQPDLPYPQ (SEQ ID NO: 69), PFPQPDQPF (SEQ ID NO: 70), PQPDQPFPW (SEQ ID NO: 71), PIPDQPQPY (SEQ ID NO: 72), LQPFPQPDLPYPQPQ (SEQ ID NO: 73), QPFPQPDQPFPWQP (SEQ ID NO: 74), or PQQPIPDQPQPYPQQ (SEQ ID NO: 75). Such substituted peptides can be the gluten peptides of any of the methods and compositions provided herein. Accordingly, gluten peptides that have not undergone deamidation are also contemplated herein (e.g., gluten peptides comprising or consisting of PQLP (SEQ ID NO: 16), PQLPY (SEQ ID NO: 17), QPQLPYP (SEQ ID NO: 76), PQPQLPY (SEQ ID NO: 77), FPQPQLP (SEQ ID NO: 78), PQLPYPQ (SEQ ID NO: 79), FPQPQLPYP (SEQ ID NO: 80), PYPQPQLPY (SEQ ID NO: 18), PFPQPQLPY (SEQ ID NO: 15), PQPQLPYPQ (SEQ ID NO: 19), PFPQPQQPF (SEQ ID NO: 20), PQPQQPFPW (SEQ ID NO: 21), PIPQQPQPY (SEQ ID NO: 22), LQPFPQPQLPYPQPQ (SEQ ID NO: 23), QPFPQPQQPFPWQP (SEQ ID NO: 24), or PEQPIPQQPQPYPQQ (SEQ ID NO: 25), PQPQLPYPQ (SEQ ID NO:19), FRPQQPYPQ (SEQ ID NO: 47), PQQSFPQQQ (SEQ ID NO: 48), IQPQQPAQL (SEQ ID NO: 49), QQPQQPYPQ (SEQ ID NO: 50), SQPQQQFPQ (SEQ ID NO: 51), PQPQQQFPQ (SEQ ID NO: 52), QQPQQPFPQ (SEQ ID NO: 53), PQPQQPFCQ (SEQ ID NO: 54), QQPFPQQPQ (SEQ ID NO: 55), PFPQPQQPF (SEQ ID NO:20), PQPQQPFPW (SEQ ID NO: 21), PFSQQQQPV (SEQ ID NO: 56), FSQQQQSPF (SEQ ID NO: 57), PFPQPQQPF (SEQ ID NO:20), PQPQQPFPQ (SEQ ID NO: 58), PIPQQPQPY (SEQ ID NO:22), PFPQPQQPF (SEQ ID NO:20), PQPQQPFPQ (SEQ ID NO:58), PYPEQQEPF (SEQ ID NO: 59), PYPEQQQPF (SEQ ID NO: 60), PFSQQQQPV (SEQ ID NO:56), QGSFQPSQQ (SEQ ID NO: 61), QQPQQPFPQ (SEQ ID NO:53), QQPQQPYPQ (SEQ ID NO:50), QQGYYPTSPQ (SEQ ID NO:53), QGSFQPSQQ (SEQ ID NO:61), PQQSFPQQQ (SEQ ID NO:48), QGYYPTSPQ (SEQ ID NO:56), LQPFPQPELPYPQPQ (SEQ ID NO: 62), QPFPQPQQPFPWQP (SEQ ID NO:24), or PQQPIPQQPQPYPQQ (SEQ ID NO: 63)). In some embodiments, the gluten peptide comprises PQLP (SEQ ID NO: 16), PQLPY (SEQ ID NO: 17), QPQLPYP (SEQ ID NO: 76), PQPQLPY (SEQ ID NO: 77), FPQPQLP (SEQ ID NO: 78), or PQLPYPQ (SEQ ID NO: 79) and is at least 8 or 9 amino acids in length.
[0093] A gluten peptide may also be an analog of any of the peptides described herein. Preferably, in some embodiments the analog is recognized by a CD4.sup.+ T cell that recognizes one or more of the epitopes listed herein. Exemplary analogs comprise a peptide that has a sequence that is, e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homologous to the epitopes specifically recited herein. In some embodiments, the analogs comprise a peptide that is, e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homologous to the peptides specifically recited herein. Analogs may also be a variant of any of the peptides provided, such variants can include conservative amino acid substitution variants, e.g., E to D substitution.
[0094] In some embodiments, analogs may include one or more amino acid substitutions as shown in Table 1 (see, e.g., Anderson et al. Antagonists and non-toxic variants of the dominant wheat gliadin T cell epitope in coeliac disease. Gut. 2006 April; 55(4): 485-491; and PCT Publication WO2003104273, the contents of which are incorporated herein by reference). The gluten peptides provided herein include analogs of SEQ ID NO:68 comprising one or more of the listed amino acid substitutions. In some embodiments, the analog is an analog of SEQ ID NO: 68 comprising one of the amino acid substitutions provided in Table 1 below. Preferably, analogs generate a T cell response as described herein.
TABLE-US-00002 TABLE 1 Exemplary substitutions in the epitope FPQPELPYP (SEQ ID NO: 68) Amino acid in epitope F P Q P E L P Y P Exemplary A, G, H, I, A, F, I, M, A, F, G, -- D M S I, S, S, T, Substitutions L, M P, S, S, T, V, H, I, L, V, W Y T, W, Y W, Y M, S, T, V
[0095] The length of the peptide may vary. In some embodiments, peptides are, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acids in length. In some embodiments, peptides are, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 or fewer amino acids in length. In some embodiments, peptides are, e.g., 4-1000, 4-500, 4-100, 4-50, 4-40, 4-30, or 4-20 amino acids in length. In some embodiments, peptides are 4-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, or 15-20 amino acids in length. In some embodiments, peptides are e.g., 5-30, 10-30, 15-30 or 20-30 amino acids in length. In some embodiments, peptides are 4-50, 5-50, 6-50, 7-50, 8-50, 9-50, 10-50, 11-50, 12-50, 13-50, 14-50, or 15-50 amino acids in length. In some embodiments, peptides are 8-50 amino acids in length.
[0096] In some embodiments, the gluten peptide treatment is a composition comprising at least one or one or more gluten peptide(s). In some embodiments, any one of the methods described herein comprises administering the composition to a subject (e.g., a subject having or suspected of having Celiac disease).
[0097] In some embodiments, the gluten peptide treatment comprises a composition comprising at least one peptide comprising at least one amino acid sequence selected from PFPQPELPY (SEQ ID NO: 1), PQPELPYPQ (SEQ ID NO: 2), PFPQPEQPF (SEQ ID NO: 3), PQPEQPFPW (SEQ ID NO: 4), PIPEQPQPY (SEQ ID NO: 5) and EQPIPEQPQ (SEQ ID NO: 6). In some embodiments, the gluten peptide treatment comprises a composition comprising at least one of: (i) a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and PQPELPYPQ (SEQ ID NO: 2), (ii) a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO: 3) and PQPEQPFPW (SEQ ID NO: 4), and (iii) a third peptide comprising the amino acid sequence PIPEQPQPY (SEQ ID NO: 5) and EQPIPEQPQ (SEQ ID NO: 6). "First", "second", and "third" are not meant to imply an order of use or importance, unless specifically stated otherwise. In some embodiments, the composition comprises the first and second peptide, the first and third peptide, or the second and third peptide. In some embodiments, the composition comprises the first and second peptide. In some embodiments, the composition comprises the first, second, and third peptide. In some embodiments, the first peptide comprises the amino acid sequence LQPFPQPELPYPQPQ (SEQ ID NO: 62); the second peptide comprises the amino acid sequence QPFPQPEQPFPWQP (SEQ ID NO: 7); and/or the third peptide comprises the amino acid sequence PEQPIPEQPQPYPQQ (SEQ ID NO: 8).
[0098] In some embodiments, it may be desirable to utilize the non-deamidated forms of such peptides, e.g., if the peptides are contained within a composition for administration to a subject where tissue transglutaminase will act in situ (see, e.g., oyvind Molberg, Stephen McAdam, Knut E. A. Lundin, Christel Kristiansen, Helene Arentz-Hansen, Kjell Kett and Ludvig M. Sollid. T cells from celiac disease lesions recognize gliadin epitopes deamidated in situ by endogenous tissue transglutaminase. Eur. J. Immunol. 2001. 31: 1317-1323). Accordingly, in some embodiments, the composition comprises at least one of: (i) a first peptide comprising the amino acid sequence PFPQPQLPY (SEQ ID NO: 15) and PQPQLPYPQ (SEQ ID NO: 19), (ii) a second peptide comprising the amino acid sequence PFPQPQQPF (SEQ ID NO: 20) and PQPQQPFPW (SEQ ID NO: 21), and (iii) a third peptide comprising the amino acid sequence PIPQQPQPY (SEQ ID NO: 22). In some embodiments, the first peptide comprises the amino acid sequence LQPFPQPQLPYPQPQ (SEQ ID NO:23); the second peptide comprises the amino acid sequence QPFPQPQQPFPWQP (SEQ ID NO:24); and/or the third peptide comprises the amino acid sequence PQQPIPQQPQPYPQQ (SEQ ID NO: 63). In some embodiments, the peptides are 8-30 amino acids in length.
[0099] Modifications to a gluten peptide are also contemplated herein. This modification may occur during or after translation or synthesis (for example, by farnesylation, prenylation, myristoylation, glycosylation, palmitoylation, acetylation, phosphorylation (such as phosphotyrosine, phosphoserine or phosphothreonine), amidation, pyrolation, derivatisation by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, and the like). Any of the numerous chemical modification methods known within the art may be utilized including, but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
[0100] The phrases "protecting group" and "blocking group" as used herein, refers to modifications to the peptide, which protect it from undesirable chemical reactions, particularly chemical reactions in vivo. Examples of such protecting groups include esters of carboxylic acids and boronic acids, ethers of alcohols and acetals, and ketals of aldehydes and ketones. Examples of suitable groups include acyl protecting groups such as, for example, furoyl, formyl, adipyl, azelayl, suberyl, dansyl, acetyl, theyl, benzoyl, trifluoroacetyl, succinyl and methoxysuccinyl; aromatic urethane protecting groups such as, for example, benzyloxycarbonyl (Cbz); aliphatic urethane protecting groups such as, for example, t-butoxycarbonyl (Boc) or 9-fluorenylmethoxy-carbonyl (FMOC); pyroglutamate and amidation. Many other modifications providing increased potency, prolonged activity, ease of purification, and/or increased half-life will be known to the person skilled in the art.
[0101] The peptides may comprise one or more modifications, which may be natural post-translation modifications or artificial modifications. The modification may provide a chemical moiety (typically by substitution of a hydrogen, for example, of a C--H bond), such as an amino, acetyl, acyl, amide, carboxy, hydroxy or halogen (for example, fluorine) group, or a carbohydrate group. Typically, the modification may be present on the N- and/or C-terminus. Furthermore, one or more of the peptides may be PEGylated, where the PEG (polyethyleneoxy group) provides for enhanced lifetime in the blood stream. One or more of the peptides may also be combined as a fusion or chimeric protein with other proteins, or with specific binding agents that allow targeting to specific moieties on a target cell.
[0102] A gluten peptide may also be chemically modified at the level of amino acid side chains, of amino acid chirality, and/or of the peptide backbone.
[0103] Particular changes can be made to a gluten peptide to improve resistance to degradation or optimize solubility properties or otherwise improve bioavailability compared to the parent gluten peptide, thereby providing gluten peptides having similar or improved therapeutic, diagnostic and/or pharmacokinetic properties. A preferred such modification, in some embodiments, includes the use of an N-terminal acetyl group or pyroglutamate and/or a C-terminal amide. Such modifications have been shown in the art to significantly increase the half-life and bioavailability of peptides compared to the peptides having a free N- and C-terminus (see, e.g., PCT Publication No.: WO/2010/060155). In some embodiments, the first, second and/or third peptides comprise an N-terminal acetyl group or pyroglutamate group and/or a C-terminal amide group. In some embodiments, the first peptide comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal E is a pyroglutamate; the second peptide comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal E is a pyroglutamate; and/or the third peptide comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal E is a pyroglutamate. In some embodiments, the first peptide comprises the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group; the second peptide comprises the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group; and/or the third peptide comprises the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group. In some embodiments, the first peptide consists of the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO: 9), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group; the second peptide consists of the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group; and/or the third peptide consists of the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal E is a pyroglutamate, and wherein the peptide contains a C-terminal amide group.
[0104] In a particular embodiment, a composition comprising a first peptide comprising the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO:9), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated (i.e., the free C-terminal COO is amidated); a second peptide comprising the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal proline is amidated (i.e., the free C-terminal COO is amidated); and a third peptide comprising the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the C-terminal glutamine is amidated (i.e., the free C-terminal COO is amidated) is contemplated. In some embodiments, the first, second and/or third peptides consist essentially of or consist of the amino acid sequence of SEQ ID NO: 9, 10, or 11, respectively. Compositions are further described herein.
[0105] In another embodiment, a composition comprising first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO:2), optionally wherein the N-terminus comprises a pyroglutamate (e.g., any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal glutamine is amidated); a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO:3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4), optionally wherein the N-terminus comprises a pyroglutamate (e.g., any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal proline is amidated); and a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5), optionally wherein the N-terminus comprises a pyroglutamate (e.g., any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal glutamine is amidated) is contemplated.
[0106] Certain peptides described herein may exist in particular geometric or stereoisomeric forms. The present disclosure contemplates all such forms, including cis-(Z) and trans-(E) isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, the racemic mixtures thereof, and other mixtures thereof, as, falling within the scope of the disclosure. Additional asymmetric carbon atoms may be present in a substituent, such as an alkyl group. All such isomers, as well as mixtures thereof, are intended to be included in this disclosure.
[0107] In another example, to prevent cleavage by peptidases, any one or more of the peptides may include a non-cleavable peptide bond in place of a particularly sensitive peptide bond to provide a more stable peptide. Such non-cleavable peptide bonds may include beta amino acids.
[0108] In certain embodiments, any one or more of the peptides may include a functional group, for example, in place of the scissile peptide bond, which facilitates inhibition of a serine-, cysteine- or aspartate-type protease, as appropriate. For example, the disclosure includes a peptidyl diketone or a peptidyl keto ester, a peptide haloalkylketone, a peptide sulfonyl fluoride, a peptidyl boronate, a peptide epoxide, a peptidyl diazomethane, a peptidyl phosphonate, isocoumarins, benzoxazin-4-ones, carbamates, isocyantes, isatoic anhydrides or the like. Such functional groups have been provided in other peptide molecules, and general routes for their synthesis are known.
[0109] The peptides may be in a salt form, preferably, a pharmaceutically acceptable salt form. "A pharmaceutically acceptable salt form" includes the conventional non-toxic salts or quaternary ammonium salts of a peptide, for example, from non-toxic organic or inorganic acids. Conventional non-toxic salts include, for example, those derived from inorganic acids such as hydrochloride, hydrobromic, sulphuric, sulfonic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.
Peptide Production
[0110] The peptides described herein (e.g., gluten peptides) can be prepared in any suitable manner. For example, the peptides can be recombinantly and/or synthetically produced.
[0111] The peptides may be synthesised by standard chemistry techniques, including synthesis by an automated procedure using a commercially available peptide synthesiser. In general, peptides may be prepared by solid-phase peptide synthesis methodologies which may involve coupling each protected amino acid residue to a resin support, preferably a 4-methylbenzhydrylamine resin, by activation with dicyclohexylcarbodiimide to yield a peptide with a C-terminal amide. Alternatively, a chloromethyl resin (Merrifield resin) may be used to yield a peptide with a free carboxylic acid at the C-terminal. After the last residue has been attached, the protected peptide-resin is treated with hydrogen fluoride to cleave the peptide from the resin, as well as deprotect the side chain functional groups. Crude product can be further purified by gel filtration, high pressure liquid chromatography (HPLC), partition chromatography, or ion-exchange chromatography.
[0112] If desired, and as outlined above, various groups may be introduced into the peptide of the composition during synthesis or during expression, which allow for linking to other molecules or to a surface. For example, cysteines can be used to make thioethers, histidines for linking to a metal ion complex, carboxyl groups for forming amides or esters, amino groups for forming amides, and the like.
[0113] The peptides may also be produced using cell-free translation systems. Standard translation systems, such as reticulocyte lysates and wheat germ extracts, use RNA as a template; whereas "coupled" and "linked" systems start with DNA templates, which are transcribed into RNA then translated.
[0114] Alternatively, the peptides may be produced by transfecting host cells with expression vectors that comprise a polynucleotide(s) that encodes one or more peptides.
[0115] For recombinant production, a recombinant construct comprising a sequence which encodes one or more of the peptides is introduced into host cells by conventional methods such as calcium phosphate transfection, DEAE-dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape lading, ballistic introduction or infection.
[0116] One or more of the peptides may be expressed in suitable host cells, such as, for example, mammalian cells (for example, COS, CHO, BHK, 293 HEK, VERO, HeLa, HepG2, MDCK, W138, or NIH 3T3 cells), yeast (for example, Saccharomyces or Pichia), bacteria (for example, E. coli, P. pastoris, or B. subtilis), insect cells (for example, baculovirus in Sf9 cells) or other cells under the control of appropriate promoters using conventional techniques. Following transformation of the suitable host strain and growth of the host strain to an appropriate cell density, the cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification of the peptide or variant thereof.
[0117] Suitable expression vectors include, for example, chromosomal, non-chromosomal and synthetic polynucleotides, for example, derivatives of SV40, bacterial plasmids, phage DNAs, yeast plasmids, vectors derived from combinations of plasmids and phage DNAs, viral DNA such as vaccinia viruses, adenovirus, adeno-associated virus, lentivirus, canary pox virus, fowl pox virus, pseudorabies, baculovirus, herpes virus and retrovirus. The polynucleotide may be introduced into the expression vector by conventional procedures known in the art.
[0118] The polynucleotide which encodes one or more peptides may be operatively linked to an expression control sequence, i.e., a promoter, which directs mRNA synthesis. Representative examples of such promoters include the LTR or SV40 promoter, the E. coli lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or in viruses. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vectors may also include an origin of replication and a selectable marker, such as the ampicillin resistance gene of E. coli to permit selection of transformed cells, i.e., cells that are expressing the heterologous polynucleotide. The nucleic acid molecule encoding one or more of the peptides may be incorporated into the vector in frame with translation initiation and termination sequences.
[0119] One or more of the peptides can be recovered and purified from recombinant cell cultures (i.e., from the cells or culture medium) by well-known methods including ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, lectin chromatography, and HPLC. Well known techniques for refolding proteins may be employed to regenerate active conformation when the peptide is denatured during isolation and or purification.
[0120] To produce a glycosylated peptide, it is preferred in some embodiments that recombinant techniques be used. To produce a glycosylated peptide, it is preferred in some embodiments that mammalian cells such as, COS-7 and Hep-G2 cells be employed in the recombinant techniques.
[0121] The peptides can also be prepared by cleavage of longer peptides, especially from food extracts.
[0122] Pharmaceutically acceptable salts of the peptides can be synthesised from the peptides which contain a basic or acid moiety by conventional chemical methods. Generally, the salts are prepared by reacting the free base or acid with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid or base in a suitable solvent. In some embodiments, the pharmaceutically acceptable salt is a trifluoroacetate (TFA) salt or an acetate salt.
Dosage and Administration
Compositions
[0123] The disclosure also provides compositions comprising gluten peptides, e.g., for treatment, for diagnostic methods, for therapeutic efficacy methods, among others. In some embodiments, the composition comprising gluten peptides is a gluten peptide treatment. In some embodiments, the composition comprising gluten peptides is a first composition. In some embodiments, the composition comprising gluten peptides is a second composition.
[0124] In some embodiments, the composition comprises a first peptide comprising the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO:9), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal glutamine is amidated; a second peptide comprising the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal proline is amidated; and a third peptide comprising the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal glutamine is amidated. In some embodiments, the composition is a vaccine composition.
[0125] The disclosure additionally provides a composition comprising a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and the amino acid sequence PQPELPYPQ (SEQ ID NO: 2), optionally wherein the N-terminus comprises a pyroglutamate (e.g., any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal glutamine is amidated); a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO: 3) and the amino acid sequence PQPEQPFPW (SEQ ID NO:4), optionally wherein the N-terminus comprises a pyroglutamate (e.g., any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal proline is amidated); and a third peptide comprising the amino acid sequence EQPIPEQPQ (SEQ ID NO:6) and the amino acid sequence PIPEQPQPY (SEQ ID NO:5), optionally wherein the N-terminus comprises a pyroglutamate (e.g, any N-terminal glutamate is a pyroglutamate) and the C-terminus is amidated (e.g., any C-terminal glutamine is amidated). In some embodiments, the composition is a vaccine composition.
[0126] As used herein, the term "vaccine" refers to a composition comprising peptide(s) that can be administered to a subject having Celiac disease to modulate the subject's response to gluten. The vaccine may reduce the immunological reactivity of a subject towards gluten. Preferably, the vaccine induces tolerance to gluten.
[0127] Without being bound by any theory, administration of the vaccine composition to a subject may induce tolerance by clonal deletion of gluten-specific effector T cell populations, for example, gluten-specific CD4.sup.+ T cells, or by inactivation (anergy) of said T cells such that they become less responsive, preferably, unresponsive to subsequent exposure to gluten (or peptides thereof). Deletion or inactivation of said T cells can be measured, for example, by contacting ex vivo a sample comprising said T cells with gluten or a peptide thereof and measuring the response of said T cells to the gluten or peptide thereof. An exemplary T cell response measurement is measurement of the level of interferon-gamma (IFN-.gamma., see, e.g., NCBI Gene ID 3458 and Protein ID NP_000610.2) in the sample after contact with the gluten or peptide thereof. A decreased level of IFN-.gamma. may indicate deletion or inactivation of said T cells. The level of IFN-.gamma. can be measured using any method known to those of skill in the art, e.g., using immuno-based detection methods such as Western blot or enzyme-linked immunosorbent assay (ELISA).
[0128] Alternatively, or in addition, administration of the vaccine composition may modify the cytokine secretion profile of the subject (for example, result in decreased IL-4, IL-2, TNF-.alpha. and/or IFN-.gamma., and/or increased IL-10). The vaccine composition may induce suppressor T cell subpopulations, for example Treg cells, to produce IL-10 and/or TGF-.beta. and thereby suppress gluten-specific effector T cells. The cytokine secretion profile of the subject can be measured using any method known to those of skill in the art, e.g., using immuno-based detection methods such as Western blot or enzyme-linked immunosorbent assay (ELISA).
[0129] The vaccine composition of the disclosure can be used for prophylactic treatment of a subject capable of developing Celiac disease and/or used in ongoing treatment of a subject who has Celiac disease. In some embodiments, the composition is for use in treating Celiac disease in a subject.
Dosage
[0130] The actual amount administered (e.g., dose or dosage) and the rate and time-course of administration of the gluten peptide composition may depend upon the HLA genotype of the subject. In some embodiments of any one of the methods described herein, the method comprises adjusting or selecting a dose of a gluten peptide composition, e.g., gluten peptide treatment for a subject based on the HLA genotype of the subject. In some embodiments of any one of the methods described herein, the method comprises decreasing a dose of the gluten peptide peptide composition, e.g., gluten peptide treatment if the subject has a homozygous HLA-DQ2.5 genotype or maintaining or increasing the dose of the gluten peptide treatment if the subject has a non-homozygous HLA-DQ2.5 genotype.
[0131] In some embodiments of any one of the methods described herein, the method comprises measuring a level of at least one circulating cytokine or chemokine in a subject that has or is suspected of having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the likelihood the subject has Celiac disease.
[0132] In some embodiments of any one of the methods described herein, the method comprises assessing tolerance to a gluten peptide in a subject having Celiac disease, the method comprising: measuring a level of at least one circulating cytokine or chemokine in a subject having Celiac disease, wherein the subject has been administered a first composition comprising at least one gluten peptide in an amount selected based on a human leukocyte antigen (HLA) genotype of the subject, and assessing the tolerance of the subject to the at least one gluten peptide based on the measuring.
[0133] HLA genotypes are further described herein. The dose may be decreased, e.g., by decreasing the amount of gluten peptide treatment administered to the subject or by decreasing the rate of administration of the gluten peptide treatment to the subject (e.g., by separating each administration by a longer period of time).
[0134] In some embodiments, the dose is adjusted or selected for a subject such that the amount is sufficient to provide the desired therapeutic or physiological effect when administered under appropriate or sufficient conditions without causing severe adverse effects. In some embodiments, when the gluten peptide treatment is a composition comprising a first peptide comprising the amino acid sequence ELQPFPQPELPYPQPQ (SEQ ID NO:9), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal glutamine is amidated; a second peptide comprising the amino acid sequence EQPFPQPEQPFPWQP (SEQ ID NO: 10), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal proline is amidated; and a third peptide comprising the amino acid sequence EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), wherein the N-terminal glutamate is a pyroglutamate and the carboxyl group of the C-terminal glutamine is amidated, the dose to be adjusted is 150 micrograms of the peptides provided herein (i.e., 50 micrograms of the first peptide and an equimolar amount of each of the second and third peptides). In some embodiments, the dose to be adjusted is 26.5 nmol of each of the first, second, and third peptides. Methods for producing equimolar peptide compositions are known in the art and provided herein (see, e.g., Example 1 and Muller et al. Successful immunotherapy with T-cell epitope peptides of bee venom phospholipase A2 induces specific T-cell anergy in patient allergic to bee venom. J. Allergy Clin. Immunol. Vol. 101, Number 6, Part 1: 747-754 (1998)). In some embodiments, the dose to be adjusted is 300 micrograms of the peptides provided herein (i.e., 100 micrograms of the first peptide and an equimolar amount of each of the second and third peptides). In some embodiments, the dose to be adjusted is administered in sterile sodium chloride 0.9% USP as a bolus intradermal injection.
[0135] In some embodiments of any one of the methods provided, the dose is or is decreased to less than 300 micrograms of the peptides if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is or is decreased to less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the dose is or is increased to up to 300 micrograms if the subject has a heterozygous HLA-DQ2.5 genotype.
[0136] In some embodiments of any one of the methods provided, the dose is selected to be up to 300 micrograms if the subject has a heterozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided herein, the amount selected based on HLA-DQ2.5 genotype is any one of the foregoing. In some embodiments, the selected dose for a subject having a homozygous DQ2.5 genotype is less than the dose that would be selected for a subject having a heterozygous DQ2.5 genotype. In some embodiments, the selected dose for a subject having a heterozygous DQ2.5 genotype is more than the dose that would be selected for a subject having a homozygous DQ2.5 genotype.
[0137] In some embodiments, the dose that is adjusted or selected for a subject is believed to modify a T cell response, e.g., by inducing immune tolerance, to wheat, barley and rye in the subject, and preferably wheat, barley, rye and oats. Thus, a subject treated according to the disclosure preferably is able to eat at least wheat, rye, barley and optionally oats without a significant T cell response which would normally lead to clinical manifestations of active Celiac disease.
[0138] In some embodiments, it is advantageous to formulate the active in a dosage unit form for ease of administration and uniformity of dosage. "Dosage unit form" as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms are dictated by and directly dependent on the unique characteristics of the active agent and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active agent for the treatment of subjects. Examples of dosage units include sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
[0139] The composition may also be included in a container, pack, or dispenser together with instructions for administration.
[0140] The actual amount administered (or dose or dosage) and the rate and time-course of administration are as provided herein.
[0141] The administration may occur at least once, e.g., once or twice a week. In some embodiments, a composition described herein is administered once or twice a week. In some embodiments, a composition described herein is administered for 3, 4 or 8 weeks. In some embodiments, a composition described herein is administered once a week for 8 weeks. In some embodiments, a composition described herein is administered once a week for 3 weeks. In some embodiments, a composition described herein is administered twice a week for 4 weeks. In some embodiments, a composition described herein is administered twice a week for 8 weeks. In some embodiments, the administration occurs 3, 8 or 16 times.
Kits
[0142] Another aspect of the disclosure relates to kits. In some embodiments, the kit comprises a composition comprising the peptides as described herein. The peptides can be contained within the same container or separate containers. In some embodiments, the kit can further comprise a placebo. In some embodiments, the peptide or ptides may be contained within the container(s) (e.g., dried onto the wall of the container(s)). In some embodiments, the peptides are contained within a solution separate from the container, such that the peptides may be added to the container at a subsequent time. In some embodiments, the peptides are in lyophilized form in a separate container, such that the peptides may be reconstituted and added to the container at a subsequent time.
[0143] In some embodiments, the kit further comprises instructions for reconstitution, mixing, administration, etc. In some embodiments, the instructions include the methods described herein. Instructions can be in any suitable form, e.g., as a printed insert or a label.
Pharmaceutically Acceptable Carriers
[0144] The composition may include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to molecular entities and compositions that do not produce an allergic, toxic or otherwise adverse reaction when administered to a subject, particularly a mammal, and more particularly a human. The pharmaceutically acceptable carrier may be solid or liquid. Useful examples of pharmaceutically acceptable carriers include, but are not limited to, diluents, excipients, solvents, surfactants, suspending agents, buffering agents, lubricating agents, adjuvants, vehicles, emulsifiers, absorbants, dispersion media, coatings, stabilizers, protective colloids, adhesives, thickeners, thixotropic agents, penetration agents, sequestering agents, isotonic and absorption delaying agents that do not affect the activity of the active agents of the disclosure. In some embodiments, the pharmaceutically acceptable carrier is a sodium chloride solution (e.g., sodium chloride 0.9% USP).
[0145] The carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active agent, and by the route of administration. Suitable carriers for this disclosure include those conventionally used, for example, water, saline, aqueous dextrose, lactose, Ringer's solution, a buffered solution, hyaluronan, glycols, starch, cellulose, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, glycerol, propylene glycol, water, ethanol, and the like. Liposomes may also be used as carriers.
[0146] Techniques for preparing pharmaceutical compositions are generally known in the art as exemplified by Remington's Pharmaceutical Sciences, 16th Ed. Mack Publishing Company, 1980.
[0147] Administration preferably is intradermal administration. Thus, the composition of the disclosure may be in a form suitable for intradermal injection. In some embodiments, the composition of the disclosure is in the form of a bolus for intradermal injection.
Injectables
[0148] The pharmaceutical composition(s) may be in the form of a sterile injectable aqueous or oleagenous suspension. In some embodiments, the composition is formulated as a sterile, injectable solution. This suspension or solution may be formulated according to known methods using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may be a suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable carriers that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In some embodiments, the composition is formulated as a sterile, injectable solution, wherein the solution is a sodium chloride solution (e.g., sodium chloride 0.9% USP). In some embodiments, the composition is formulated as a bolus for intradermal injection.
[0149] Examples of appropriate delivery mechanisms for intradermal administration include, but are not limited to, implants, depots, needles, capsules, and osmotic pumps.
Methods of Treatment
[0150] Aspects of the disclosure relate to use of the compositions described herein for treating a subject having, suspected of having or at risk of having Celiac disease.
[0151] As used herein, the terms "treat", "treating", and "treatment" include abrogating, inhibiting, slowing, or reversing the progression of a disease or condition, or ameliorating or preventing a clinical symptom of the disease (for example, Celiac disease). Treatment may include induction of immune tolerance (for example, to gluten or peptide(s) thereof), modification of the cytokine secretion profile of the subject and/or induction of suppressor T cell subpopulations to secrete cytokines. Thus, a subject treated according to the disclosure preferably is able to eat at least wheat, rye, barley and optionally oats without a significant T cell response which would normally lead to symptoms of Celiac disease.
Subjects
[0152] A subject may include any subject that has or is suspected of having Celiac disease. Preferably, the subject is a human. In some embodiments, the subject has one or more HLA-DQA and HLA-DQB susceptibility alleles encoding HLA-DQ2.5 (DQA1*05 and DQB1*02), HLA-DQ2.2 (DQA1*02 and DQB1*02) or HLA-DQ8 (DQA1*03 and DQB1*0302). In some embodiments, the subject is HLA-DQ2.5 positive (i.e., has both susceptibility alleles DQA1*05 and DQB1*02). In some embodiments, a subject may have a family member that has one or more HLA-DQA and HLA-DQB susceptibility alleles encoding HLA-DQ2.5 (DQA1*05 and DQB1*02), HLA-DQ2.2 (DQA1*02 and DQB1*02) or HLA-DQ8 (DQA1*03 and DQB1*0302). In some embodiments of any one of the methods provided herein, the subject is on a gluten-free diet.
[0153] Exemplary methods for identifying subjects having or suspected of having Celiac disease include, but are not limited to, intestinal biopsy, serology (measuring the levels of one or more antibodies present in the serum), genotyping (see, e.g., Walker-Smith J A, et al. Arch Dis Child 1990), and measurement of a T cell response. Such methods may be performed as part of any one of the methods described herein or after any one of the methods described herein (e.g., as a companion diagnostic), or before any one of the methods described herein (e.g., as a first-pass screen to eliminate certain subjects before use of the methods described herein, e.g., eliminating those that do not have one or more HLA-DQA and HLA-DQB susceptibility alleles).
[0154] Detection of serum antibodies (serology) is contemplated. The presence of such serum antibodies can be detected using methods known to those of skill in the art, e.g., by ELISA, histology, cytology, immunofluorescence or western blotting. Such antibodies include, but are not limited to: IgA anti-endomysial antibody (IgA EMA), IgA anti-tissue transglutaminase 2 antibody (IgA tTG), IgA anti-deamidated gliadin peptide antibody (IgA DGP), and IgG anti-deamidated gliadin peptide antibody (IgG DGP). Deamidated gliadin peptide-IgA (DGP-IgA) and deamidated gliadin peptide-IgG (DGP-IgG) can be evaluated with commercial kits (e.g. INV 708760, 704525, and 704520, INOVA Diagnostics, San Diego, Calif.).
[0155] IgA EMA: IgA endomysial antibodies bind to endomysium, the connective tissue around smooth muscle, producing a characteristic staining pattern that is visualized by indirect immunofluorescence. The target antigen has been identified as tissue transglutaminase (tTG or transglutaminase 2). IgA endomysial antibody testing is thought to be moderately sensitive and highly specific for untreated (active) Celiac disease.
[0156] IgA tTG: The antigen is tTG. Anti-tTG antibodies are thought to be highly sensitive and specific for the diagnosis of Celiac disease. Enzyme-linked immunosorbent assay (ELISA) tests for IgA anti-tTG antibodies are now widely available and are easier to perform, less observer-dependent, and less costly than the immunofluorescence assay used to detect IgA endomysial antibodies. The diagnostic accuracy of IgA anti-tTG immunoassays has been improved further by the use of human tTG in place of the nonhuman tTG preparations used in earlier immunoassay kits. Kits for IgA tTG are commercially available (INV 708760, 704525, and 704520, INOVA Diagnostics, San Diego, Calif.).
[0157] Deamidated gliadin peptide-IgA (DGP-IgA) and deamidated gliadin peptide-IgG (DGP-IgG) are also contemplated herein and can be evaluated with commercial kits (INV 708760, 704525, and 704520, INOVA Diagnostics, San Diego, Calif.).
[0158] T cell response tests are also contemplated as other testing. In some embodiments, a T cell response test comprises contacting a sample comprising a T cell with at least one gluten peptide and measuring a T cell response in the sample. In some embodiments, a T cell response is measured by measuring a level of IFN-.gamma., where an increased level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) may identify a subject as having Celiac disease. T cell response tests are known in the art (see, e.g., PCT Publication Nos.: WO/2001/025793, WO/2003/104273, WO/2005/105129, and WO/2010/060155).
Diagnostic Methods
[0159] One aspect of the disclosure relates to methods of identifying (e.g., diagnosing) subjects, such as subjects having or suspected of having Celiac disease.
[0160] In some embodiments, the method comprises measuring a level of at least one circulating cytokine or chemokine in a subject that has or is suspected of having celiac disease, wherein the subject has been administered a composition comprising at least one gluten peptide as described herein. In some embodiments, the method further comprises assessing the likelihood the subject has Celiac disease. In some embodiments, assessing comprises comparing the level of the at least one circulating cytokine or chemokine to a control level of the at least one circulating cytokine or chemokine. Levels as used herein can be absolute or relative amounts. In some embodiments, assessing comprises determining the ratio of the level of the at least one circulating cytokine or chemokine to the control level. In some embodiments, the control level of the at least one circulating cytokine or chemokine is a baseline level of the circulating cytokine or chemokine. In some embodiments, the baseline level is the level of the circulating cytokine or chemokine in the subject prior to the administration of the one or more gluten peptides. In some embodiments of any one of the methods provided herein, the method can further comprise the step of determining a baseline level of the circulating cytokine or chemokine in the subject.
[0161] In some embodiments, an elevated level of the at least one circulating cytokine or chemokine compared to a control level, such as a baseline level, of the at least one circulating cytokine or chemokine indicates that the subject has or is likely to have celiac disease. In some embodiments, a ratio greater than 1 (e.g., greater than 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) of the at least one circulating cytokine or chemokine to the control level, such as a baseline level, indicates that the subject has or is likely to have celiac disease. In some embodiments of any one of the methods provided herein, the method further comprises recording whether or not the subject has or is likely to have celiac disease based on the level or ratio.
[0162] In some embodiments, the level of the at least one circulating cytokine or chemokine is measured in a sample, e.g., a serum, plasma or urine sample, obtained from the subject. Samples are described elsewhere herein. In some embodiments, the sample is obtained from the subject within 1-24 hours, such as within 1-6 hours, of administration of the composition. In some embodiments, the sample is obtained from the subject within 4-6 hours of administration of the composition.
[0163] In some embodiments of any one of the methods provided herein, the method further comprises administering the composition comprising at least one gluten peptide as described herein to the subject, e.g., by injection. In some embodiments, the composition is administered via intradermal injection. In some embodiments, the composition is administered once. In some embodiments, the composition is administered once via intradermal injection.
[0164] In some embodiments of any one of the methods provided herein, the method further comprises performing other testing. Any method of other testing as described herein is contemplated. In some embodiments, the other testing comprises a serology test, genotyping, an intestinal biopsy, and/or a T cell response test. In some embodiments of any one of the methods provided herein, the method further comprises performing one or more additional tests on the subject. In some embodiments, the method further comprises contacting a sample comprising a T cell from the subject with a gluten peptide and measuring a T cell response in the sample. In some embodiments, a T cell response is measured by measuring a level of IFN-.gamma., where an increased level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) may identify a subject as having Celiac disease. In some embodiments, a level of IFN-.gamma. at or above a cut-off level (e.g., at or above 7.2 pg/ml) may identify a subject as having or likely as having Celiac disease.
[0165] In some embodiments of any one of the methods provided herein, the method further comprising treating or suggesting a treatment if the subject is identified as having or likely of having celiac disease. In some embodiments of any one of the methods provided herein, the method further comprises recommending a gluten-free diet and/or providing information in regard thereto to the subject. In some embodiments of any one of the methods provided herein, the method further comprises administering a treatment, or providing information in regard thereto, to the subject. Suitable treatments are described herein. In some embodiments, the treatment is a composition comprising a gluten peptide as described herein. In some embodiments, the treatment comprises a gluten-free diet.
[0166] In some embodiments, the method further comprises orally administering or directing the subject to consume gluten prior to the measuring step. In some embodiments, the subject is orally administered or directed to consume gluten for at least three days. In some embodiments, the measuring step is performed six days after the last of the gluten is orally administered or consumed.
[0167] Other aspects of the disclosure relate to a method comprising: administering to a subject that has or is suspected of having Celiac disease a first composition comprising at least one gluten peptide in an amount selected based on an HLA genotype of the subject, measuring a T cell response to a second composition comprising at least one gluten peptide in a sample from the subject, and assessing the likelihood that the subject has Celiac disease.
[0168] In some embodiments of any one of the methods provided, the first composition and the second composition comprise the same gluten peptide or peptides. In some embodiments of any of the methods provided, the sample is contacted with the second composition.
[0169] In some embodiments of any one of the methods provided, the method further comprises obtaining the sample from the subject.
[0170] In some embodiments of any one of the methods provided, the the subject is orally administered or directed to consume gluten for at least three days.
[0171] In some embodiments of any one of the methods provided, the the measuring step is performed six days after the last of the gluten is orally administered or consumed.
[0172] In some embodiments of any one of the methods provided, IFN-gamma is measured. In some embodiments of any one of the methods provided, IP-10 is measured.
[0173] In some embodiments of any one of the methods provided, the amount of the first composition, the second composition, or each of the first composition and second composition, is less than 150 micrograms if the subject has a homozygous HLA-DQ2.5 genotype. In some embodiments of any one of the methods provided, the amount of the first composition, the second composition, or each of the first composition and second composition, is less than 300 micrograms if the subject has a homozygous HLA-DQ2.5 genotype.
Therapeutic Efficacy Methods
[0174] One aspect of the disclosure relates to methods of assessing the efficacy of treatment of Celiac disease (e.g., responsiveness to a therapeutic gluten peptide composition). In some embodiments, the method comprises (a) measuring in a subject that has been administered a first composition comprising at least one gluten peptide
[0175] (i) a level of at least one circulating cytokine or chemokine, and/or
[0176] (ii) a level of at least one circulating T cell; and (b) assessing the efficacy based on the measuring. The method, in some embodiments, can further include (c) treating the subject, or suggesting a treatment to the subject, based on the assessing.
[0177] In some embodiments, assessing comprises comparing the level of the at least one circulating cytokine, chemokine, or T cell to a control level of the at least one circulating cytokine, chemokine, or T cell. Levels as used herein can be absolute or relative amounts. In some embodiments, assessing comprises determining the ratio of the level of the at least one circulating cytokine, chemokine, or T cell to the control level. In some embodiments, the control level of the at least one circulating cytokine, chemokine, or T cell is a baseline level of the circulating cytokine, chemokine, or T cell. In some embodiments, the baseline level is the level of the circulating cytokine, chemokine, or T cell in the subject prior to the administration of the one or more gluten peptides. In some embodiments of any one of the methods provided herein, the method can further comprise the step of determining a baseline level of the circulating cytokine, chemokine, or T cell in the subject.
[0178] In some embodiments, the assessing comprises comparing the level of the at least one circulating cytokine or chemokine, and/or the level of at least one circulating T cell to a circulating cytokine or chemokine control level, such as a baseline level, and/or a circulating T cell control level, respectively. In some embodiments, the method further comprises recording the level(s), the result(s) of the assessing and/or the treatment, or suggestion for treatment, based on the assessing.
[0179] In some embodiments, a ratio of about 1 of the at least one circulating cytokine, chemokine, or T cell compared to a control level, such as a baseline level or negative control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has been effective. In some embodiments, a ratio of greater than 1 of the at least one circulating cytokine, chemokine, or T cell compared to a control level, such as a baseline level or negative control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has not been effective or completely effective. In some embodiments, a ratio of greater than or about equal to 1 of the at least one circulating cytokine, chemokine, or T cell compared to a control level, such as a positive control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has not been effective or completely effective. In some embodiments, a ratio of less than 1 of the at least one circulating cytokine, chemokine, or T cell compared to a control level, such as a positive control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has been effective. In some embodiments, the method further comprises recording whether or not the treatment has been effective or completely effective based on the level or ratio.
[0180] In some embodiments, a level of the at least one circulating cytokine, chemokine, or T cell that is no more than two-fold above a control level, such as a baseline level or negative control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has been effective. In some embodiments, a level of the at least one circulating cytokine, chemokine, or T cell that is two-fold or more above a control level, such as a baseline level or negative control, of the at least one circulating cytokine, chemokine, or T cell indicates that a treatment has not been effective or completely effective. In some embodiments, a level of IL-2 and IL-8 that are each no more than two-fold above a control level, such as a baseline level or negative control, of IL-2 and IL-8 indicates that a treatment has been effective. In some embodiments, a level of IL-2 and IL-8 that is two-fold or more above a control level, such as a baseline level or negative control, of IL-2 and IL-8 indicates that a treatment has not been effective or completely effective.
[0181] In some embodiments, the measuring is performed on a sample obtained from the subject, e.g., a serum, plasma or urine sample. Samples are described herein. In some embodiments, the method further comprises obtaining the sample from the subject. In some embodiments, the sample is obtained from the subject within 4-6 hours of administration of the composition. In some embodiments, the sample is obtained from the subject within 1-24 hours, such as within 1-6 hours, of administration of the composition. In some embodiments, the sample is obtained from the subject within 4-6 hours of administration of the composition.
[0182] In some embodiments, the method further comprises administering the composition comprising at least one gluten peptide as described herein to the subject, e.g., by injection or oral administration. In some embodiments, the composition is administered via intradermal injection. In some embodiments, the composition is administered once. In some embodiments, the composition is administered once via intradermal injection.
[0183] In some embodiments, treating comprises continuing with the treatment, or suggesting comprises suggesting the subject continue with the treatment, based on the assessing. In some embodiments, treating comprises ceasing the treatment, or suggesting comprises suggesting the subject cease the treatment, based on the assessing. In some embodiments, treating comprises administering a different or additional treatment, or the suggesting comprises suggesting the subject be treated with an additional or different treatment, based on the assessing. Exemplary treatments are described herein. In some embodiments, the treatment is a composition comprising a gluten peptide as described herein.
[0184] In some embodiments, the method further comprises orally administering or directing the subject to consume gluten prior to the measuring step. In some embodiments, the subject is orally administered or directed to consume gluten for at least three days. In some embodiments, the measuring step is performed six days after the last of the gluten is orally administered or consumed.
[0185] In some embodiments, the method further comprises performing other testing. Any method of other testing as described herein is contemplated. In some embodiments, the other testing comprises a serology test, genotyping, an intestinal biopsy, and/or a T-cell response test. In some embodiments, the method further comprises contacting a sample comprising a T cell from the subject (e.g., a whole blood sample) with a gluten peptide and measuring a T cell response in the sample. In some embodiments, a T cell response is measured by measuring a level of IFN-.gamma.. In some embodiments, a decreased or similar level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) indicates that a treatment has been effective. In some embodiments, a level of IFN-.gamma. below a cut-off level (e.g., below 7.2 pg/ml) indicates that a treatment has been effective. In some embodiments, a T cell response is measured by measuring a level of IFN-7, where an elevated level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) indicates that a treatment has not been effective. In some embodiments, a level of IFN-.gamma. at or above a cut-off level (e.g., at or above 7.2 pg/ml) indicates that a treatment has not been effective.
[0186] Another aspect of the disclosure relates to methods of assessing tolerance to a gluten peptide in a subject having Celiac disease. In some embodiments, tolerance is a state of lessened responsiveness or non-responsiveness of the immune system to a gluten peptide.
[0187] In some embodiments, the method can be any of the methods provided herein. In one embodiment, the method comprises (a) measuring in a subject that has been administered a first composition comprising at least one gluten peptide a level of at least one circulating cytokine or chemokine; and (b) assessing the tolerance of the subject to the at least one gluten peptide based on the measuring. In some embodiments, the subject is a subject that has previously received or is receiving treatment for Celiac disease. In some embodiments, the treatment is a composition comprising a gluten peptide as described herein.
[0188] In some embodiments, assessing comprises comparing the level of the at least one circulating cytokine or chemokine to a control level of the at least one circulating cytokine or chemokine. Levels as used herein can be absolute or relative amounts. In some embodiments, assessing comprises determining the ratio of the level of the at least one circulating cytokine or chemokine to the control level. In some embodiments, the control level of the at least one circulating cytokine or chemokine is a baseline level of the circulating cytokine or chemokine. In some embodiments, the baseline level is the level of the circulating cytokine or chemokine in the subject prior to the administration of the one or more gluten peptides. In some embodiments of any one of the methods provided herein, the method can further comprise the step of determining a baseline level of the circulating cytokine or chemokine in the subject.
[0189] In some embodiments, the assessing comprises comparing the level of the at least one circulating cytokine or chemokine to a circulating cytokine or chemokine control level, such as a baseline level. In some embodiments, the method further comprises recording the level(s) or the result(s) of the assessing.
[0190] In some embodiments, a ratio of about 2 or less (e.g., less than 2, less than 1, or less than 0.5) of the at least one circulating cytokine or chemokine compared to a control level, such as a baseline level or negative control, of the at least one circulating cytokine or chemokine indicates that the subject has been tolerized to the gluten peptide. In some embodiments, a ratio of greater than about 2 (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, or at least 30) of the at least one circulating cytokine or chemokine to a control level, such as a baseline level or negative control, of the at least one circulating cytokine or chemokine indicates that the subject has not been tolerized to the gluten peptide. In some embodiments, the method further comprises recording whether or not the subject has been tolerized to a gluten peptide based on the level or ratio.
[0191] In some embodiments, the measuring is performed on a sample obtained from the subject, e.g., a serum, plasma, or urine sample. Samples are described herein. In some embodiments, the method further comprises obtaining the sample from the subject. In some embodiments, the sample is obtained from the subject within 1-24 hours, such as within 1-6 hours, of administration of the composition. In some embodiments, the sample is obtained from the subject within 4-6 hours of administration of the composition.
[0192] In some embodiments, the method further comprises administering the composition comprising at least one gluten peptide as described herein to the subject, e.g., by injection or oral administration. In some embodiments, the composition is administered via intradermal injection. In some embodiments, the composition is administered once. In some embodiments, the composition is administered once via intradermal injection.
[0193] In some embodiments, the method further comprises treating the subject or recommending a treatment to the subject based on the assessing. In some embodiments, treating comprises continuing with the treatment, or suggesting comprises suggesting the subject continue with the treatment, based on the assessing. In some embodiments, treating comprises ceasing the treatment, or suggesting comprises suggesting the subject cease the treatment, based on the assessing. In some embodiments, treating comprises administering a different or additional treatment, or the suggesting comprises suggesting the subject be treated with an additional or different treatment, based on the assessing. Exemplary treatments are described herein. In some embodiments, the treatment is a composition comprising a gluten peptide as described herein. In some embodiments, the treatment comprises a gluten-free diet.
[0194] In some embodiments, the method further comprises orally administering or directing the subject to consume gluten prior to the measuring step. In some embodiments, the subject is orally administered or directed to consume gluten for at least three days. In some embodiments, the measuring step is performed six days after the gluten is orally administered or consumed.
[0195] In some embodiments, the method further comprises performing other testing. Any method of other testing as described herein is contemplated. In some embodiments, the other testing comprises a serology test, genotyping, an intestinal biopsy, and/or a T cell response test. In some embodiments, the method further comprises contacting a sample comprising a T cell from the subject (e.g., a whole blood sample) with a gluten peptide and measuring a T cell response in the sample. In some embodiments, a T cell response is measured by measuring a level of IFN-.gamma.. In some embodiments, a decreased or similar level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) may indicate that a subject has been tolerized to the gluten peptide. In some embodiments, a level of IFN-.gamma. below a cut-off level (e.g., below 7.2 pg/ml) may indicate that a subject has been tolerized to the gluten peptide. In some embodiments, a T cell response is measured by measuring a level of IFN-.gamma., where an elevated level of IFN-.gamma. compared to a control level (e.g., a level of IFN-.gamma. in a sample that has not been contacted with a gluten peptide) may indicate that a subject has not been tolerized to the gluten peptide. In some embodiments, a level of IFN-.gamma. at or above a cut-off level (e.g., above 7.2 pg/ml) may indicate that a subject has not been tolerized to the gluten peptide.
Circulating Cytokines and Chemokines
[0196] Aspects of the disclosure relate to circulating cytokines and/or chemokines and uses thereof in a method, composition or kit described herein. As used herein, a "circulating cytokine or chemokine" is a cytokine or chemokine present in vivo in a subject, e.g., within the blood, plasma, serum, urine etc. of the subject, that may be measured in a sample obtained from the subject, e.g., in a blood (such as plasma or serum) or urine sample. The levels of such circulating cytokines or chemokines may be increased or decreased in the subject as a result of administration of a composition comprising a gluten peptide to the subject, such as for a treatment of Celiac disease. Non-limiting examples of circulating cytokines and chemokines that can be used in any one of the methods, compositions and kits described herein include, but are not limited to, those shown in Table 2. The sequences of the genes, mRNAs, and proteins for each cytokines/chemokine can be determined by one of ordinary skill in the art using the National Center for Biotechnology Information (NCBI) gene database at www.ncbi.nlm.nih.gov/gene.
TABLE-US-00003 TABLE 2 Cytokines and chemokines. Cytokine or Cytokine or NCBI Reference Chemokine Chemokine Symbol NCBI Human Sequences Symbol (/Alternative Symbol) Gene ID Human Protein ID(s) Chemokine (C-C MCP-1/CCL2 6347 NP_002973.1 motif) ligand 2 Chemokine (C-X- IP-10/CXCL10 3627 NP_001556.2 C motif) ligand 10 Interleukin 6 IL-6 3569 NP_000591.1 Interleukin 8 IL-8 3576 NP_000575.1 Granulocyte G-CSF 1440 NP_000750.1, colony- NP_001171618.1, stimulating factor NP_757373.1, NP_757374.2 Interleukin 2 IL-2 3558 NP_000577.2 Interleukin 1 IL-1RA 3557 NP_000568.1, receptor NP_776213.1, antagonist NP_776214.1, NP_776215.1 Chemokine (C-X- GRO/CXCL1 2919 NP_001502.1 C motif) ligand 1 Chemokine (C-C EOTAXIN/CCL11 6356 NP_002977.1 motif) ligand 11 Granulocyte- GM-CSF 1437 NP_000749.2 macrophage colony- stimulating factor Interleukin 10 IL-10 3586 NP_000563.1 Tumor necrosis TNFa 7124 NP_000585.2 factor alpha Interferon, alpha 2 IFNa2 3440 NP_000596.2 Chemokine (C-C MIP-1b/CCL4 6351 NP_002975.1 motif) ligand 4 Interleukin 12 IL-12P70 (heterodimer IL-12A 3592 IL-12A of IL-12A and IL-12B) IL-12B 3593 NP_000873.2 IL-12B NP_002178.2 Interleukin 1, IL-1a 3552 NP_000566.3 alpha Interleukin 17A IL-17A 3605 NP_002181.1 Epidermal growth EGF 1950 NP_001171601.1, factor NP_001171602.1, NP_001954.2 Chemokine (C-C MIP-1a/CCL3 6348 NP_002974.1 motif) ligand 3 Chemokine (C- FRACTALKINE/ 6376 NP_002987.1 X3-C motif) CX3CL1 ligand 1 Interferon gamma IFNg or IFN-.gamma. 3458 NP_000610.2 Vascular VEGF 7422 NP_001020537.2, endothelial NP_001020538.2, growth factor NP_001020539.2, NP_001020540.2, NP_001020541.2, NP_001028928.1, NP_001165093.1, NP_001165094.1, NP_001165095.1, NP_001165096.1, NP_001165097.1, NP_001165098.1, NP_001165099.1, NP_001165100.1, NP_001165101.1, NP_001191313.1, NP_001191314.1, NP_001273973.1, NP_003367.4 Interleukin 9 IL-9 3578 NP_000581.1 Fibroblast growth FGF-2 2247 NP_001997.5 factor 2 Interleukin 1, beta IL-1b 3553 NP_000567.1 Fms-related Flt-3L 2323 NP_001191431.1, tyrosine kinase 3 NP_001191432.1, ligand NP_001265566.1, NP_001265567.1 Interleukin 15 IL-15 3600 NP_000576.1, NP_751915.1 Lymphotoxin TNFb/LTA 4049 NP_000586.2, alpha NP_001153212.1 Interleukin 12B IL-12(P40)/IL12B 3593 NP_002178.2 Chemokine (C-C MCP-3/CCL7 6354 NP_006264.2 motif) ligand 7 Interleukin 4 IL-4 3565 NP_000580.1, NP_758858.1 Chemokine (C-C MDC/CCL22 6367 NP_002981.2 motif) ligand 22 Interleukin 13 IL-13 3596 NP_002179.2 soluble CD40 sCD40L 959 NP_000065.1 ligand Transforming TGF-a 7039 NP_001093161.1, growth factor, NP_003227.1 alpha Interleukin 3 IL-3 3562 NP_000579.2 Interleukin 5 IL-5 3567 NP_000870.1 Interleukin 7 IL-7 3574 NP_000871.1, NP_001186815.1, NP_001186816.1, NP_001186817.1
[0197] In some embodiments, the at least one circulating cytokine or chemokine is MCP-1, IL-6, IL-10, IL-8, or G-CSF. In some embodiments, the at least one circulating cytokine or chemokine is IL-2, IL-8, IL-10, or MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises one or more of IL-2, IL-8, IL-10, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2, IL-8, IL-10, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-8, IL-10, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2, IL-10, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2, IL-8, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2, IL-8, and IL-10. In some embodiments, the at least one circulating cytokine or chemokine is MCP-1, IL-6, IL-8, or G-CSF. In some embodiments, the at least one circulating cytokine or chemokine is IL-2, IL-8, or MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises one or more of IL-2, IL-8, and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-8 and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2 and MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2 and IL-8. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-8. In some embodiments, the at least one circulating cytokine or chemokine comprises MCP-1. In some embodiments, the at least one circulating cytokine or chemokine comprises one or more of IL-2, IP-10, and IFN-.gamma.. In some embodiments, the at least one circulating cytokine or chemokine comprises IL-2, IP-10, and IFN-.gamma..
[0198] In some embodiments, an elevated level (e.g., an elevated level of protein or nucleic acid (e.g., mRNA level)) of the at least one circulating cytokine or chemokine compared to a control level of the at least one circulating cytokine or chemokine indicates that the subject has or is likely to have celiac disease. In some embodiments, methods provided herein comprise use of the ratio of the level of the at least one circulating cytokine or chemokine to a control level, such as a baseline level.
[0199] In some embodiments, the level of more than one circulating cytokine or chemokine is measured, e.g., the level of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more circulating cytokines or chemokines.
[0200] Assays for detecting cytokine or chemokine protein levels include, but are not limited to, immunoassays (also referred to herein as immune-based or immuno-based assays, e.g., Western blot or enzyme-linked immunosorbent assay (ELISA)), Mass spectrometry, and multiplex bead-based assays. Binding partners for protein detection can be designed using methods known in the art and as described herein. In some embodiments, the protein binding partners, e.g., antibodies, bind to a part of or an entire amino acid sequence of at least one cytokine or chemokine, the sequence(s) being identifiable using the Genbank IDs described herein. Other examples of protein detection and quantitation methods include multiplexed immunoassays as described for example in U.S. Pat. Nos. 6,939,720 and 8,148,171, and published U.S. Patent Application No. 2008/0255766, and protein microarrays as described for example in published U.S. Patent Application No. 2009/0088329.
[0201] An exemplary ELISA involves at least one binding partner, e.g., an antibody or antigen-binding fragment thereof, with specificity for the at least one cytokine or chemokine. The sample with an unknown amount of the at least one cytokine or chemokine can be immobilized on a solid support (e.g., a polystyrene microtiter plate) either non-specifically (via adsorption to the surface) or specifically (via capture by another binding partner specific to the same at least one cytokine, as in a "sandwich" ELISA). After the cytokine or chemokine is immobilized, the binding partner for the at least one cytokine or chemokine can be added, forming a complex with the immobilized at least one cytokine or chemokine. The binding partner can be attached to a detectable label as described herein (e.g., a fluorophore or an enzyme), or can itself be detected by an agent that recognizes the at least one cytokine or chemokine binding partner that is attached to a detectable label as described herein (e.g., a fluorophore or an enzyme). If the detectable label is an enzyme, a substrate for the enzyme is added, and the enzyme elicits a chromogenic or fluorescent signal by acting on the substrate. The detectable label can then be detected using an appropriate machine, e.g., a fluorimeter or spectrophotometer, or by eye.
[0202] Assays may also include a multiplex bead-based assay, such as an assay commercially available from Luminex (see, e.g., the MAGPIX.RTM. system). Multiplex bead-based assays are known in the art.
[0203] Assays for detecting cytokine or chemokine nucleic acid, such as RNA, include, but are not limited to, Northern blot analysis, RT-PCR, sequencing technology, RNA in situ hybridization (using e.g., DNA or RNA probes to hybridize RNA molecules present in the sample), in situ RT-PCR (e.g., as described in Nuovo G J, et al. Am J Surg Pathol. 1993, 17: 683-90; Komminoth P, et al. Pathol Res Pract. 1994, 190: 1017-25), and oligonucleotide microarray (e.g., by hybridization of polynucleotide sequences derived from a sample to oligonucleotides attached to a solid surface (e.g., a glass wafer with addressable location, such as Affymetrix microarray (Affymetrix.RTM., Santa Clara, Calif.)). Designing nucleic acid binding partners, such as probes, is well known in the art. In some embodiments, the nucleic acid binding partners bind to a part of or an entire nucleic acid sequence of at least one cytokine or chemokine, the sequence(s) being identifiable using the Genbank IDs described herein.
Circulating T Cells
[0204] Aspects of the disclosure relate to circulating T cells and uses thereof in a method or kit described herein. As used herein, a "circulating T cell" is a T cell present in vivo in a subject, e.g., within the blood of the subject, that may be measured in a sample obtained from the subject, e.g., in a blood (such as plasma or serum) sample. The levels of such circulating T cells may be increased or decreased in the subject as a result of administration of a composition comprising a gluten peptide to the subject. Non-limiting examples of circulating T cells that can be used in the methods and kits described herein include, but are not limited to, at least one circulating T cell that recognizes at least one gluten peptide, e.g., a gluten peptide comprised in a composition described herein. In some embodiments, the T cells recognizes at least one of: (i) a first peptide comprising the amino acid sequence PFPQPELPY (SEQ ID NO: 1) and PQPELPYPQ (SEQ ID NO: 2), (ii) a second peptide comprising the amino acid sequence PFPQPEQPF (SEQ ID NO: 3) and PQPEQPFPW (SEQ ID NO: 4), and (iii) a third peptide comprising the amino acid sequence PIPEQPQPY (SEQ ID NO: 5). A T cell that recognizes a gluten peptide is a T cell that comprises a T cell receptor that binds to the gluten peptide and/or that binds to the gluten peptide attached to one or more Major Histocompatibility Complex (MHC) molecules. In some embodiments, the circulating T cell is a CD4.sup.+ T cell. In some embodiments, the level of more than one circulating T cell is measured. The circulating T cell may be measured by direct assessment of T cells, for example by staining with MHC-peptide multimer and flow cytometery or by functional cytokine release assays, such as interferon-.gamma. secretion in plasma from whole blood incubated with the cognate peptide of the T cell population of interest (e.g., a gluten peptide described herein) or another T cell response method described herein or otherwise known in the art.
[0205] Assays for detecting circulating T cells include, but are not limited to, a Major Histocompatibility Complex (MHC) tetramer assay and a T cell response assay. Such assays are known in the art (see, e.g., John D. Altman et al. (1996). "Phenotypic Analysis of Antigen-Specific T Lymphocytes." Science 274 (5284): 94-96; Hanne Quarsten et al. (2001) "Staining of Celiac Disease-Relevant T Cells by Peptide-DQ2 Multimers." Journal of Immunology 167(9):4861-4868; Melinda Riki et al. (2007) "Tetramer visualization of gut-homing gluten-specific T cells in the peripheral blood of celiac disease patients." PNAS 104(8): 2831-2836). T cell response assays are described herein and are known in the art (see, e.g., Ontiveros N, Tye-Din J A, Hardy M Y, Anderson R P. Ex vivo whole blood secretion of interferon-.gamma. (IFN-.gamma.) and IFN-.gamma.-inducible protein-10 (IP-10) measured by ELISA are as sensitive as IFN-.gamma. ELISpot for the detection of gluten-reactive T cells in HLA-DQ2.5+ associated celiac disease. Clin Exp Immunol. 2014; 175:305-315).
[0206] An exemplary MHC tetramer assay involves use of DQ2 (DQA1*0501/DQB1*0201) MHC molecules containing a biotin. The DQ2 molecules are mixed with peptides, e.g., gluten peptides, to form DQ2-peptide complexes. Tetramers may be made by conjugating the DQ2-peptide complexes with streptavidin labeled with a fluorophore. For tetramer staining, circulating T cells are contacted with the tetramers and the tetramers bound to the circulating T cells are then detected, e.g., by flow cytometry. Secondary T cell markers may also be used in connection with the tetramer assay, e.g., anti-CD4 antibodies, anti-CD3 antibodies, and anti-CD45RA antibodies.
Samples
[0207] Samples, as used herein, refer to biological samples taken or derived from a subject, e.g., a subject having or suspected of having Celiac disease. Examples of samples include tissue samples or fluid samples. In some embodiments, the sample is a buccal swab or a buffy coat (e.g., isolated from anti-coagulant treated blood such as blood treated with EDTA or citrate).
General Techniques and Definitions
[0208] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).
[0209] Unless otherwise indicated, techniques utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (2000 and 1991); D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996); F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present); Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988); and J. E. Coligan et al. (editors), Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0210] In any one aspect or embodiment provided herein "comprising" may be replaced with "consisting essentially of" or "consisting of".
[0211] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1: Results of the Phase I Randomized, Double-Blind, Placebo-Controlled, Multiple Ascending Dose Study in Patients with Celiac Disease
[0212] 3 cohorts of subjects with HLA-DQ2.5+(heterozygous or homozygous) biopsy-proven Celiac disease on a gluten-free diet for at least 1 year were included in the study. The first cohort (Cohort 1) contained 12 subjects who were dosed with 150 mcg of a gluten peptide composition (an equimolar composition in sodium chloride 0.9% USP of 3 peptides: ELQPFPQPELPYPQPQ (SEQ ID NO: 9), EQPFPQPEQPFPWQP (SEQ ID NO: 10), and EPEQPIPEQPQPYPQQ (SEQ ID NO: 11), each peptide comprising an N-terminal pyroglutamate and C-terminal amidated amino acid) or a placebo (sodium chloride 0.9% USP) intradermally, twice a week for 8 weeks total. The second cohort (Cohort 2) contained 13 subjects who were dosed with 300 mcg of the gluten peptide composition or the placebo intradermally, twice a week for 8 weeks total. The gluten peptide composition to placebo ratio for each of Cohorts 1 and 2 were 2:1. Both Cohorts 1 and 2 received an oral gluten challenge and were assessed for gamma-interferon (gIFN) release and then returned to baseline prior to starting the treatment regimen. The third cohort (Cohort 7) contained 14 subjects who were dosed with 150 mcg of the peptide composition or the placebo intradermally, twice a week for 8 weeks total. The peptide composition to placebo ratio for Cohort 7 was 1:1. The subjects in Cohort 7 did not undergo an oral gluten challenge or a gIFN release assay before starting the dosage regimen.
[0213] The progress of each subject before, during and after the trial was assessed using multiple tests including serology (tTG-IgA, DGP-IgG, DGP-IgA, and EMA-IgA), histology, and IFNg whole blood release assay, and cytokine/chemokines in plasma (measured by MAGPIX.RTM. multiplex platform). Plasma cytokines and chemokines were measured at several timepoints pre and post first and last dose.
[0214] Subject disposition is summarized in Table 3. Subject demographics are summarized in Table 4. The extent of exposure for each subject is summarized in Table 5.
TABLE-US-00004 TABLE 3 Subject disposition. Placebo Placebo All All Cohort 1 Cohort 2 Cohort 7 (from Cohorts (from Subjects Subjects Completion (150 mg) (300 mg) (150 mg) 1 and 2) Cohort 7) Dosed Screened Status (N = 8) (N = 8) (N = 7) (N = 7) (N = 7) (N = 39) (N = 67) Screened 67 (100%) Enrolled 8 (100%) 10 (100%) 7 (100%) 7 (100%) 7 (100%) 39 (100%) 39 (58%) Completed 8 (100%) 6 (60%) 7 (100%) 6 (86%) 7 (100%) 34 (87%) the study as required Completed 8 (100%) 2 (20%) 7 (100%) 5 (71%) 7 (100%) 29 (74%) study treatment per protocol (received at least 15 of 16 doses) Received all 7 (88%) 2 (20%) 5 (71%) 4 (57%) 6 (86%) 24 (62%) 16 doses of study treatment Discontinued 8 (80%) 2 (29%) 10 (26%) the study prior to completion
TABLE-US-00005 TABLE 4 Subject Demographics All Cohort 1 Cohort 2 Cohort 7 Placebo subjects (150 mg) (300 mg) (150 mg) (pooled) dosed Parameter Statistic (N = 8) (N = 10) (N = 7) (N = 14) (N = 39) Age N 8 10 7 14 39 (years) Mean 52.0 50.0 42.6 39.1 45.2 SD 11.9 10.1 5.4 15.5 13.0 Median 52.5 52.0 45.0 34.0 47.0 Min 31 28 33 18 18 Max 66 64 47 64 66 Race White n(%) 8 10 7 14 39 (100%) Sex Female n(%) 7 7 5 10 29 (74%) Male n(%) 1 3 2 4 10 (26%) Height N 8 10 7 14 39 (cm) Mean 167.7 170.1 168.4 170.6 169.5 SD 10.0 9.8 8.3 10.0 9.4 Median 168.7 167.0 173.0 170.5 169.0 Min 154 158 156 156 154 Max 186 186 179 186 186 Weight N 8 10 7 14 39 (kg) Mean 70.66 85.34 74.40 66.55 73.62 SD 11.17 13.02 11.58 12.91 14.07 Median 69.20 85.05 73.00 64.10 70.50 Min 60.2 66.0 58.5 48.5 48.5 Max 95.1 105.5 92.5 92.3 105.5 BMI N 8 10 7 14 39 (kg/m{circumflex over ( )}2) Mean 25.24 29.55 26.13 22.81 25.63 SD 4.28 4.54 2.63 3.72 4.60 Median 23.91 28.91 25.23 22.64 25.23 Min 20.7 25.2 23.3 17.2 17.2 Max 33.2 40.2 30.9 32.3 40.2
TABLE-US-00006 TABLE 5 Summary of subject exposure Number of Number of Cohort Treatment Dose level Doses Total Dose Subjects 1 peptide 150 16 2400 7 composition 1 peptide 150 15 2250 1 composition 1 Placebo 0 16 0 4 2 peptide 300 16 4800 2 composition 2 peptide 300 5 1500 1 composition 2 peptide 300 4 1200 2 composition 2 peptide 300 3 900 1 composition 2 peptide 300 2 600 1 composition 2 peptide 300 1 300 3 composition 2 Placebo 0 15 0 1 2 Placebo 0 10 0 1 2 Placebo 0 5 0 1 7 peptide 150 16 2400 5 composition 7 peptide 150 15 2250 2 composition 7 Placebo 0 16 0 6 7 Placebo 0 15 0 1
[0215] Through random distribution of the subjects, all of the subjects who were homozygous for HLA-DQ2.5 received the gluten peptide composition treatment (FIG. 1). Non-homozygous HLA-DQ2.5 subjects received either the gluten peptide composition treatment or placebo (FIG. 1). A qualitative functional HLA-DQ2.5 "dose" was estimated based on the genotype of each subject. If the subject had the DQA1*05 allele for both copies of the HLA-DQA gene and had the DQB1*02 allele for both copies of the HLA-DQB gene (i.e., was homozygous for HLA-DQ2.5), the functional HLA-DQ2.5 dose was high. If the subject had the DQA1*05 allele for one copy of the HLA-DQA gene and had the DQB1*02 allele for one copy of the HLA-DQB gene (i.e., was heterozygous for HLA-DQ2.5), the functional HLA-DQ2.5 dose was low. If the subject had the HLA-DQ2.5/2.2 genotype (i.e., the subject had two DQB1*02 alleles for the HLA-DQB gene and one copy of the DQA1*05 allele for the HLA-DQA gene), the functional HLA-DQ2.5 dose was intermediate because the subject was homozygous for DQB1*02 and heterozygous for DQA1*05. If the subject had the HLA-DQ2.5/7 genotype (i.e., the subject had one DQB1*02 allele for the HLA-DQB gene and two copies of the DQA1*05 allele for the HLA-DQA gene), the functional HLA-DQ2.5 dose was intermediate because the subject was heterozygous for DQB1*02 and homozygous for DQA1*05.
[0216] It was found that subjects that had a high functional HLA-DQ2.5 dose (i.e., were homozygous for HLA-DQ2.5) had generally increased levels of circulating cytokines in response to administration of the gluten peptide composition when received at a dose of 150 micrograms compared to subjects with other genotypes that received the same dose of the gluten peptide composition (FIG. 2, FIG. 3 and FIG. 4). It was also found that subjects that had a high functional HLA-DQ2.5 dose (i.e., were homozygous for HLA-DQ2.5) had more adverse symptoms in response to administration of the gluten peptide composition when received at a dose of 300 micrograms compared to subjects with other genotypes that received the same dose of the gluten peptide composition (FIG. 2).
[0217] It was also found that subjects that had a high functional HLA-DQ2.5 dose (i.e., were homozygous for HLA-DQ2.5) had more treatment emergent adverse events in response to administration of the gluten peptide composition when received at a dose of 300 micrograms or 150 micrograms compared to subjects with other genotypes that received the same dose of the gluten peptide composition (Table 6).
TABLE-US-00007 TABLE 6 Treatment emergent adverse events Total # # HLA-DQ2.5 moderate/ # Subjects Total # homozygous severe AEs reporting moderate/ # HLA-DQ2.5 subjects reported by moderate/ severe homozygous reporting HLA-DQ2.5 # Subjects severe AEs subjects in moderate/ homozygous in Cohort AEs reported cohort severe AEs subjects Cohort 1 8 6 11 4 4 8 Cohort 2 10 8 12 1 1 3 Cohort 7 7 3 4 2 2 3
[0218] As a result, it is expected that a subject who is homozygous for HLA-DQ2.5 may benefit from a lower dosage of a gluten peptide treatment compared to subjects who have a non-homozygous genotype (e.g., are HLA-DQ2.5 heterozygotes).
Example 2: Preparation of a 150 Microgram Dosage Composition of the First, Second, and Third Peptide
[0219] A dose of 150 tg the peptide composition was defined by there being 50 tg (26.5 nmol) of pure peptide 1 (ELQPFPQPELPYPQPQ (SEQ ID NO: 9)) comprising an N-terminal pyroglutamate and C-terminal amidated amino acid), and an equimolar amount of peptide 2 and peptide 3 (EQPFPQPEQPFPWQP (SEQ ID NO: 10)) and EPEQPIPEQPQPYPQQ (SEQ ID NO: 11)), respectively, each peptide comprising an N-terminal pyroglutamate and C-terminal amidated amino acid). The molar equivalent of 50 gg peptide 1 was given by 50 gg/1889.3 g/mol=26.5 nmol. When preparing a solution containing 150 gg of the peptide composition, for the constituent peptides, the weight of each peptide was adjusted according to peptide purity and peptide content of the lyophilized stock material. For example, if the peptide 1 stock material had peptide purity of 98% and its peptide content was 90%, the weight of stock material yielding 50 tg peptide 1 was 50 gg/(peptide purity.times.peptide content)=50 ug/(0.98.times.0.90)=56.7 ug.
[0220] The molar amount of peptide 1 in 150 gg of the peptide composition was 26.5 nmol, and the weight of lyophilized peptide 2 stock material was therefore given by 26.5 nmol.times.1833.2 g/mol/(peptide purity.times.peptide content). For example, if peptide 2 peptide purity was 99%, and peptide content of 95%, the mass of stock required was 51.7 ug.
[0221] The molar amount of peptide 3 in 150 ug of the peptide composition was 26.5 nmol, and the weight of lyophilized peptide 3 stock material was therefore given by 26.5 nmol.times.1886.2 g/mol/(peptide purity.times.peptide content). For example, if peptide 3 peptide purity was 98%, and peptide content of 92%, the mass of stock required was 55.4 ug.
Other Embodiments
[0222] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0223] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0224] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0225] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0226] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0227] The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one."
[0228] The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0229] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and/or" as defined above. For example, when separating items in a list, "or" or "and/or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e. "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0230] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0231] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0232] In the claims, as well as in the specification above, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
Sequence CWU
1
1
8519PRTArtificial SequenceSynthetic Polypeptide 1Pro Phe Pro Gln Pro Glu
Leu Pro Tyr1 529PRTArtificial SequenceSynthetic Polypeptide
2Pro Gln Pro Glu Leu Pro Tyr Pro Gln1 539PRTArtificial
SequenceSynthetic Polypeptide 3Pro Phe Pro Gln Pro Glu Gln Pro Phe1
549PRTArtificial SequenceSynthetic Polypeptide 4Pro Gln Pro Glu
Gln Pro Phe Pro Trp1 559PRTArtificial SequenceSynthetic
Polypeptide 5Pro Ile Pro Glu Gln Pro Gln Pro Tyr1
569PRTArtificial SequenceSynthetic Polypeptide 6Glu Gln Pro Ile Pro Glu
Gln Pro Gln1 5714PRTArtificial SequenceSynthetic
Polypeptide 7Gln Pro Phe Pro Gln Pro Glu Gln Pro Phe Pro Trp Gln Pro1
5 10815PRTArtificial SequenceSynthetic
Polypeptide 8Pro Glu Gln Pro Ile Pro Glu Gln Pro Gln Pro Tyr Pro Gln Gln1
5 10 15916PRTArtificial
SequenceSynthetic Polypeptide 9Glu Leu Gln Pro Phe Pro Gln Pro Glu Leu
Pro Tyr Pro Gln Pro Gln1 5 10
151015PRTArtificial SequenceSynthetic Polypeptide 10Glu Gln Pro Phe
Pro Gln Pro Glu Gln Pro Phe Pro Trp Gln Pro1 5
10 151116PRTArtificial SequenceSynthetic
Polypeptide 11Glu Pro Glu Gln Pro Ile Pro Glu Gln Pro Gln Pro Tyr Pro Gln
Gln1 5 10
15124PRTArtificial SequenceSynthetic Polypeptide 12Pro Glu Leu
Pro1135PRTArtificial SequenceSynthetic Polypeptide 13Pro Glu Leu Pro Tyr1
5149PRTArtificial SequenceSynthetic Polypeptide 14Pro Tyr
Pro Gln Pro Glu Leu Pro Tyr1 5159PRTArtificial
SequenceSynthetic Polypeptide 15Pro Phe Pro Gln Pro Gln Leu Pro Tyr1
5164PRTArtificial SequenceSynthetic Polypeptide 16Pro Gln Leu
Pro1175PRTArtificial SequenceSynthetic Polypeptide 17Pro Gln Leu Pro Tyr1
5189PRTArtificial SequenceSynthetic Polypeptide 18Pro Tyr
Pro Gln Pro Gln Leu Pro Tyr1 5199PRTArtificial
SequenceSynthetic Polypeptide 19Pro Gln Pro Gln Leu Pro Tyr Pro Gln1
5209PRTArtificial SequenceSynthetic Polypeptide 20Pro Phe Pro
Gln Pro Gln Gln Pro Phe1 5219PRTArtificial
SequenceSynthetic Polypeptide 21Pro Gln Pro Gln Gln Pro Phe Pro Trp1
5229PRTArtificial SequenceSynthetic Polypeptide 22Pro Ile Pro
Gln Gln Pro Gln Pro Tyr1 52315PRTArtificial
SequenceSynthetic Polypeptide 23Leu Gln Pro Phe Pro Gln Pro Gln Leu Pro
Tyr Pro Gln Pro Gln1 5 10
152414PRTArtificial SequenceSynthetic Polypeptide 24Gln Pro Phe Pro Gln
Pro Gln Gln Pro Phe Pro Trp Gln Pro1 5
102515PRTArtificial SequenceSynthetic Polypeptide 25Pro Glu Gln Pro Ile
Pro Gln Gln Pro Gln Pro Tyr Pro Gln Gln1 5
10 15269PRTArtificial SequenceSynthetic Polypeptide
26Pro Phe Pro Gln Pro Asp Leu Pro Tyr1 5279PRTArtificial
SequenceSynthetic Polypeptide 27Phe Arg Pro Glu Gln Pro Tyr Pro Gln1
5289PRTArtificial SequenceSynthetic Polypeptide 28Pro Gln Gln
Ser Phe Pro Glu Gln Gln1 5299PRTArtificial
SequenceSynthetic Polypeptide 29Ile Gln Pro Glu Gln Pro Ala Gln Leu1
5309PRTArtificial SequenceSynthetic Polypeptide 30Gln Gln Pro
Glu Gln Pro Tyr Pro Gln1 5319PRTArtificial
SequenceSynthetic Polypeptide 31Ser Gln Pro Glu Gln Glu Phe Pro Gln1
5329PRTArtificial SequenceSynthetic Polypeptide 32Pro Gln Pro
Glu Gln Glu Phe Pro Gln1 5339PRTArtificial
SequenceSynthetic Polypeptide 33Gln Gln Pro Glu Gln Pro Phe Pro Gln1
5349PRTArtificial SequenceSynthetic Polypeptide 34Pro Gln Pro
Glu Gln Pro Phe Cys Gln1 5359PRTArtificial
SequenceSynthetic Polypeptide 35Gln Gln Pro Phe Pro Glu Gln Pro Gln1
5369PRTArtificial SequenceSynthetic Polypeptide 36Pro Phe Ser
Glu Gln Glu Gln Pro Val1 5379PRTArtificial
SequenceSynthetic Polypeptide 37Phe Ser Gln Gln Gln Glu Ser Pro Phe1
5389PRTArtificial SequenceSynthetic Polypeptide 38Pro Gln Pro
Glu Gln Pro Phe Pro Gln1 5399PRTArtificial
SequenceSynthetic Polypeptide 39Pro Tyr Pro Glu Gln Glu Glu Pro Phe1
5409PRTArtificial SequenceSynthetic Polypeptide 40Pro Tyr Pro
Glu Gln Glu Gln Pro Phe1 5419PRTArtificial
SequenceSynthetic Polypeptide 41Glu Gly Ser Phe Gln Pro Ser Gln Glu1
5429PRTArtificial SequenceSynthetic Polypeptide 42Glu Gln Pro
Gln Gln Pro Phe Pro Gln1 5439PRTArtificial
SequenceSynthetic Polypeptide 43Glu Gln Pro Gln Gln Pro Tyr Pro Glu1
54410PRTArtificial SequenceSynthetic Polypeptide 44Gln Gln Gly
Tyr Tyr Pro Thr Ser Pro Gln1 5
10459PRTArtificial SequenceSynthetic Polypeptide 45Pro Gln Gln Ser Phe
Pro Glu Gln Glu1 5469PRTArtificial SequenceSynthetic
Polypeptide 46Gln Gly Tyr Tyr Pro Thr Ser Pro Gln1
5479PRTArtificial SequenceSynthetic Polypeptide 47Phe Arg Pro Gln Gln Pro
Tyr Pro Gln1 5489PRTArtificial SequenceSynthetic
Polypeptide 48Pro Gln Gln Ser Phe Pro Gln Gln Gln1
5499PRTArtificial SequenceSynthetic Polypeptide 49Ile Gln Pro Gln Gln Pro
Ala Gln Leu1 5509PRTArtificial SequenceSynthetic
Polypeptide 50Gln Gln Pro Gln Gln Pro Tyr Pro Gln1
5519PRTArtificial SequenceSynthetic Polypeptide 51Ser Gln Pro Gln Gln Gln
Phe Pro Gln1 5529PRTArtificial SequenceSynthetic
Polypeptide 52Pro Gln Pro Gln Gln Gln Phe Pro Gln1
5539PRTArtificial SequenceSynthetic Polypeptide 53Gln Gln Pro Gln Gln Pro
Phe Pro Gln1 5549PRTArtificial SequenceSynthetic
Polypeptide 54Pro Gln Pro Gln Gln Pro Phe Cys Gln1
5559PRTArtificial SequenceSynthetic Polypeptide 55Gln Gln Pro Phe Pro Gln
Gln Pro Gln1 5569PRTArtificial SequenceSynthetic
Polypeptide 56Pro Phe Ser Gln Gln Gln Gln Pro Val1
5579PRTArtificial SequenceSynthetic Polypeptide 57Phe Ser Gln Gln Gln Gln
Ser Pro Phe1 5589PRTArtificial SequenceSynthetic
Polypeptide 58Pro Gln Pro Gln Gln Pro Phe Pro Gln1
5599PRTArtificial SequenceSynthetic Polypeptide 59Pro Tyr Pro Glu Gln Gln
Glu Pro Phe1 5609PRTArtificial SequenceSynthetic
Polypeptide 60Pro Tyr Pro Glu Gln Gln Gln Pro Phe1
5619PRTArtificial SequenceSynthetic Polypeptide 61Gln Gly Ser Phe Gln Pro
Ser Gln Gln1 56215PRTArtificial SequenceSynthetic
Polypeptide 62Leu Gln Pro Phe Pro Gln Pro Glu Leu Pro Tyr Pro Gln Pro
Gln1 5 10
156315PRTArtificial SequenceSynthetic Polypeptide 63Pro Gln Gln Pro Ile
Pro Gln Gln Pro Gln Pro Tyr Pro Gln Gln1 5
10 15647PRTArtificial SequenceSynthetic Polypeptide
64Gln Pro Glu Leu Pro Tyr Pro1 5657PRTArtificial
SequenceSynthetic Polypeptide 65Pro Gln Pro Glu Leu Pro Tyr1
5667PRTArtificial SequenceSynthetic Polypeptide 66Phe Pro Gln Pro Glu
Leu Pro1 5677PRTArtificial SequenceSynthetic Polypeptide
67Pro Glu Leu Pro Tyr Pro Gln1 5689PRTArtificial
SequenceSynthetic Polypeptide 68Phe Pro Gln Pro Glu Leu Pro Tyr Pro1
5699PRTArtificial SequenceSynthetic Polypeptide 69Pro Gln Pro
Asp Leu Pro Tyr Pro Gln1 5709PRTArtificial
SequenceSynthetic Polypeptide 70Pro Phe Pro Gln Pro Asp Gln Pro Phe1
5719PRTArtificial SequenceSynthetic Polypeptide 71Pro Gln Pro
Asp Gln Pro Phe Pro Trp1 5729PRTArtificial
SequenceSynthetic Polypeptide 72Pro Ile Pro Asp Gln Pro Gln Pro Tyr1
57315PRTArtificial SequenceSynthetic Polypeptide 73Leu Gln Pro
Phe Pro Gln Pro Asp Leu Pro Tyr Pro Gln Pro Gln1 5
10 157414PRTArtificial SequenceSynthetic
Polypeptide 74Gln Pro Phe Pro Gln Pro Asp Gln Pro Phe Pro Trp Gln Pro1
5 107515PRTArtificial SequenceSynthetic
Polypeptide 75Pro Gln Gln Pro Ile Pro Asp Gln Pro Gln Pro Tyr Pro Gln
Gln1 5 10
15767PRTArtificial SequenceSynthetic Polypeptide 76Gln Pro Gln Leu Pro
Tyr Pro1 5777PRTArtificial SequenceSynthetic Polypeptide
77Pro Gln Pro Gln Leu Pro Tyr1 5787PRTArtificial
SequenceSynthetic Polypeptide 78Phe Pro Gln Pro Gln Leu Pro1
5797PRTArtificial SequenceSynthetic Polypeptide 79Pro Gln Leu Pro Tyr
Pro Gln1 5809PRTArtificial SequenceSynthetic Polypeptide
80Phe Pro Gln Pro Gln Leu Pro Tyr Pro1 5811138DNAHomo
sapiens 81ggcctgcgtt cagttggtgc ttccagacac caagggccct tgtgaatccc
atcctggaat 60ggaaggtaag attgagattt gttagagctg aatccgcagt atgagaggaa
ggaaagtgga 120ggaggctgtg gacatgaatg gttgaaagtt gtaggggaat tgggaagtgg
catgatgatg 180acataggagc ggcctaggac ccatccatct catgtctgtc ctgttgcagg
tgcatcgcca 240tctacaggag cagaagagtg gacttgctac atgacctagc attattttct
ggccccattt 300atcatatccc ttttctcctc caaatgtttc tcctctcacc tcttctgtgg
gacttaaatt 360gctatatctg ctcagagctc acaaatgcct ttgaattatt tccctgactt
cctgattttt 420ttcttcttaa gtgttaccta ctaagagttg cctggagtaa gccacccagc
tacctaattc 480ctcagtaacc tccatctata atctccatgg aagcaacaaa ttccctttat
gagatatatg 540tcaaattttt ccatctttca tccagggctg actgaaaccg tggctaagaa
ttgggagact 600ctcttgtttc aagccaattt aacatcattt accagatcat ttgtcatgtc
cagtaacaca 660gaagcaacca actacagtat agcctgataa catgttgatt tcttagctga
cattaatatt 720tctttcttcc ttgtgttccc acccttggca ttgccaccca cccctcaatt
aaggcaacaa 780tgaagttaat ggataccctc tgcctttggc tcagaaatgt tatagcaaaa
attttaaaat 840aaaaaagtaa gtctgtacta atttcaatat gacttttaaa agtatgacag
agaaatgggt 900tgggataaag gaaatttgaa tctcaaaaat atcaatagtg aaaagttatt
ctcaaaactt 960taaatttgtg aagaatgatg acagtagaag ccttcctctc ccctcctcac
cctgaaggaa 1020taaaatttcc ttaggcagga aaagaaatgg aagtcagaaa aacattagaa
taagacaata 1080atgtgggtat ctgaaaagga acaaatactc attcctcaca tagggttagt
gacaatgg 1138822414DNAHomo sapiensmisc_feature(1403)..(1502)n is a,
c, g, or t 82ccagtcctga gaggaaagaa aatacaatca gtttgttatt aactgaggaa
agaattaagt 60gaaagatgaa tcttaggaag cagaaggaag taaacctaat ctctgactaa
gaaagctaaa 120taccataata actcattcat tccttctttt gtttaattac attatttaat
cataagtccg 180tgatgtgcca ggcactcagg aaatagtaaa aactggacat gtgatattct
gcccttgtgt 240agcgcacatt atagtgggaa agaaagcgca attttaaccg gacaactacc
aacaataaga 300gcggaggaag caggggttgg aaatgtccac aggctgtgcc aaagatgaag
cccgtaatat 360ttgaaagtca gtttctttca tcattttgtg tattaaggtt ctttcttccc
ctgttctcca 420ccttcctgct tgtcatcttc actcatcagc tgaccacgtc gcctcttatg
gtgtaaactt 480gtaccagtct tacggtccct ctggccagta cacccatgaa tttgatggag
atgagcagtt 540ctacgtggac ctggggagga aggagactgt ctggtgtttg cctgttctca
gacaatttag 600atttgacccg caatttgcac tgacaaacat cgctgtccta aaacataact
tgaacagtct 660gattaaacgc tccaactcta ccgctgctac caatggtatg tgtcaacaat
tctgcccctc 720tttactgatt tatcccttca taccaagttt cattatttta tttccaagag
gtccccagat 780cttctcatgg caattgctga aattttatca tctcccatct ctaaaatcac
atattcccat 840gtaatacaag ggtctttcca ttatccattc attaaatcct tctcggagag
gtctcatcaa 900cctcctactt tattaaacat gcccacagag agaagggcac aggaataaag
cggaggcaat 960gtgtcgttgc tcccaagcag aaggtaaata agacctcttt gactatcagg
tggtgaaatg 1020ctggtaggag ggctcttcca ggatgtaatg cagaagctca tggcagagct
attcacactt 1080cacatcagtg ctgtttcctc accacagagg ttcctgaggt cacagtgttt
tccaagtctc 1140ccgtgacact gggtcagccc aacatcctca tctgtcttgt ggacaacatc
tttcctcctg 1200tggtcaacat cacatggctg agcaatgggc actcagtcac agaaggtgtt
tctgagacca 1260gcttcctctc caagagtgat cattccttct tcaagatcag ttacctcacc
ctcctccctt 1320ctgctgagga gagttatgac tgcaaggtgg agcactgggg actggacaag
cctcttctga 1380aacactgggg taaggatgag ttnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1440nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1500nntttctttc tttctttctt tctttctttc tttctttctt tctttctttc
tttctttctt 1560tctttctttc ttttttgaaa gaataaagca acaaaagcaa agatttattg
aaaatgaaag 1620tacacttcac atggtgggag cgggcctgag cataggggct caagagccac
ttcatgggtt 1680tctaatgata gacttcactc tcctccctaa gctggggacc atgagtcttt
gcagagccaa 1740ccctccaccc catcccatcc cacacacatg cacatgagca cactctgctt
tctgacctca 1800acgacttcat atccacagag cctgagattc cagcccctat gtcagagctc
acagagactg 1860tggtctgcgc cctggggttg tctgtgggcc tcgtgggcat tgtggtgggc
actgtcttca 1920tcatccgagg cctgcgttca gttggtgctt ccagacacca agggcccttg
tgaatcccat 1980cctggaatgg aaggtaagat tgagatttgt tagagctgaa tccgcagtat
gagaggaagg 2040aaagtggagg aggctgtgga catgaatggt tgaaagttgt aggggaattg
ggaagtggca 2100tgatgatgac ataggagcgg cctaggaccc atccatctca tgtctgtcct
gttgcaggtg 2160catcgccatc tacaggagca gaagagtgga cttgctacat gacctagcat
tattttctgg 2220ccccatttat catatccctt ttctcctcca aatgtttctc ctctcacctc
ttctgtggga 2280cttaaattgc tatatctgct cagagctcac aaatgccttt gaattatttc
cctgacttcc 2340tgattttttt cttttctcaa gtgttaccta ctaagggatg cctggagtaa
gccacccagc 2400tacctaattc ctca
2414832414DNAHomo sapiensmisc_feature(1403)..(1502)n is a, c,
g, or t 83ccagtcctga gaggaaagaa aatacaatca gtttgttatt aactgaggaa
agaattaagt 60gaaagatgaa tcttaggaag cagaaggaag taaacctaat ctctgactaa
gaaagctaaa 120taccataata actcattcat tccttctttt gtttaattac attatttaat
cataagtccg 180tgatgtgcca ggcactcagg aaatagtaaa aactggacat gtgatattct
gcccttgtgt 240agcgcacatt atagtgggaa agaaagcgca attttaaccg gacaactacc
aacaataaga 300gcggaggaag caggggttgg aaatgtccac aggctgtgcc aaagatgaag
cccgtaatat 360ttgaaagtca gtttctttca tcattttgtg tattaaggtt ctttcttccc
ctgttctcca 420ccttcctgct tgtcatcttc actcatcagc tgaccacgtc gcctcttatg
gtgtaaactt 480gtaccagtct tacggtccct ctggccagta cacccatgaa tttgatggag
atgagcagtt 540ctacgtggac ctggggagga aggagactgt ctggtgtttg cctgttctca
gacaatttag 600atttgacccg caatttgcac tgacaaacat cgctgtccta aaacataact
tgaacagtct 660gattaaacgc tccaactcta ccgctgctac caatggtatg tgtcaacaat
tctgcccctc 720tttactgatt tatcccttca taccaagttt cattatttta tttccaagag
gtccccagat 780cttctcatgg caattgctga aattttatca tctcccatct ctaaaatcac
atattcccat 840gtaatacaag ggtctttcca ttatccattc attaaatcct tctcggagag
gtctcatcaa 900cctcctactt tattaaacat gcccacagag agaagggcac aggaataaag
cggaggcaat 960gtgtcgttgc tcccaagcag aaggtaaata agacctcttt gactatcagg
tggtgaaatg 1020ctggtaggag ggctcttcca ggatgtaatg cagaagctca tggcagagct
attcacactt 1080cacatcagtg ctgtttcctc accacagagg ttcctgaggt cacagtgttt
tccaagtctc 1140ccgtgacact gggtcagccc aacatcctca tctgtcttgt ggacaacatc
tttcctcctg 1200tggtcaacat cacatggctg agcaatgggc actcagtcac agaaggtgtt
tctgagacca 1260gcttcctctc caagagtgat cattccttct tcaagatcag ttacctcacc
ctcctccctt 1320ctgctgagga gagttatgac tgcaaggtgg agcactgggg actggacaag
cctcttctga 1380aacactgggg taaggatgag ttnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1440nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1500nntttctttc tttctttctt tctttctttc tttctttctt tctttctttc
tttctttctt 1560tctttctttc ttttttgaaa gaataaagca acaaaagcaa agatttattg
aaaatgaaag 1620tacacttcac atggtgggag cgggcctgag cataggggct caagagccac
ttcatgggtt 1680tctaatgata gacttcactc tcctccctaa gctggggacc atgagtcttt
gcagagccaa 1740ccctccaccc catcccatcc cacacacatg cacatgagca cactctgctt
tctgacctca 1800acgacttcat atccacagag cctgagattc cagcccctat gtcagagctc
acagagactg 1860tggtctgcgc cctggggttg tctgtgggcc tcgtgggcat tgtggtgggc
actgtcttca 1920tcatccgagg cctgcgttca gttggtgctt ccagacacca agggcccttg
tgaatcccat 1980cctggaatgg aaggtaagat tgagatttgt tagagctgaa tccgcagtat
gagaggaagg 2040aaagtggagg aggctgtgga catgaatggt tgaaagttgt aggggaattg
ggaagtggca 2100tgatgatgac ataggagcgg cctaggaccc atccatctca tgtctgtcct
gttgcaggtg 2160catcgccatc tacaggagca gaagagtgga cttgctacat gacctagcat
tattttctgg 2220ccccatttat catatccctt ttctcctcca aatgtttctc ctctcacctc
ttctgtggga 2280cttaaattgc tatatctgct cagagctcac aaatgccttt gaattatttc
cctgacttcc 2340tgattttttt cttttctcaa gtgttaccta ctaagggatg cctggagtaa
gccacccagc 2400tacctaattc ctca
2414845961DNAHomo sapiens 84tcccccttaa tttgccctat tgaaagaatc
ccaagtataa gaacaactgg tttttaatca 60atattacaaa gatgtttact gttgaatcgc
atttttcttt ggcttcttaa aatcccttag 120gcattcaatc ttcagctctt ccataattga
gaggaaattt tcacctcaaa tgttcatcca 180gtgcaattga aagacgtcac agtgccaggc
actggattca gaaccttcac aaaaaaaaaa 240tctgcccaga gacagatgag gtccttcagc
tccagtgctg attggttcct ttccaaggga 300ccatccaatc ctaccacgca tggaaacatc
cacagatttt tattctttct gccaggtaca 360tcagatccat caggtccgag ctgtgttgac
taccactttt cccttcgtct caattatgtc 420ttggaaaaag gctttgcgga tccccggagg
ccttcgggca gcaactgtga ccttgatgct 480gtcgatgctg agcaccccag tggctgaggg
cagagactct cccggtaagt gcagggcagc 540tgctctccag agccgctact ctgggaacag
gctctccttg ggctggggta cggggatggt 600gatctccata atctcggaca caatctttta
tcaacatttc ctctgttttg ggaaagagag 660ctatgttgca tttccattta tcttttaatg
atgaagtgag gacaatccaa tcccatccta 720caggcttaag cctggaagag gaggagagag
gagagaaaag aggagacaaa gtgttcattt 780actaccagtg ataggacaaa gtgagcatgg
ggttattttt gaagatatga atttctccaa 840agacacagca ggatttgcca tttaggcgtg
tcccaagact tgcctggact aaatattatg 900atttcctgca ttgggaaatg caaggcagca
atggtgtctg tagtctccgt atttggggaa 960aagttgtctg tattcctgac ccagtggagc
gtttgtggag gcaaaatctt ggtactgagg 1020gaagctgact ggctgaccac agaaagagag
ccttcaggtt tcactgattt atgggcaaat 1080ggtgacctga gtgggattca gatacccgag
ttgatgatgg actaaattta gtagaaagga 1140ggatgtaaag aagggaaata acacatactg
tgaaaccact catttcagac acagaacaat 1200actttacata aattctctct cactccttct
aacatcctgt gtgtagatat catgattttc 1260ttttacacaa ttatacttgt gatatggata
ttctgttaca taacctgccc gggctggtga 1320ctgccacagt ttaatgggaa tctagtttat
caaattcaaa agcttgtgct ctttcggtga 1380ataaatgttt ctttctagga ctcagagatc
taggactccc ttctttctaa cacagacgtg 1440agtgaacctc acagggcact tgggagggta
aatccaggca tgggaaggaa ggtattttac 1500ccagggacca agagaatagg cgtatcggaa
gaggacaggt ttaattcctg gacctgtctc 1560gtcattccct tgaactgtca ggtttatgtg
gataacttta tctctgaggt acccaggagc 1620tccatggaaa atgagatttc atgcgagaac
gccctgatcc ctctaagtgc agaggtccat 1680gtaaaatcag cccgactgcc tcttcacttg
gttcacaggc cgagacaggg acagggcttt 1740cctccctttc ctgcctgtag gaaggcggat
tcccgaagac ccccgagagg gcgggcaggg 1800ctgggcagag ccgccgggag gatcccaggt
ctgcagcgcg aggcacgggc cggcgggaac 1860ttgtggtcgc gcgggctgtt ccacagctcc
gggccgggtc agggtggcgg ctgcgggggc 1920ggacgggctg ggccgcactg actggccggt
gattcctcgc agaggatttc gtgtaccagt 1980ttaagggcat gtgctacttc accaacggga
cagagcgcgt gcgtcttgtg agcagaagca 2040tctataaccg agaagagatc gtgcgcttcg
acagcgacgt gggggagttc cgggcggtga 2100cgctgctggg gctgcctgcc gccgagtact
ggaacagcca gaaggacatc ctggagagga 2160aacgggcggc ggtggacagg gtgtgcagac
acaactacca gttggagctc cgcacgacct 2220tgcagcggcg aggtgagcgg cgtcgcccct
ctgcgaggcc cacccttggc cccaagtctc 2280tgcgccagga ggggcgaagg gtcgtggcct
ctggaacctg agccccgttt gttccacccc 2340agaggacagg aggcagcggc gagagtggtg
ggggcaggtg catcggaggt gcggggacct 2400agggcagagc agggggacag gcagagttgg
ccaggctgcc tagtgtcgcc ccagcctacc 2460cgttcgtcgg ccttgtcctc tgctctgcat
gttcttgcct cgtgccttat gcatttgcct 2520ccttttgcct tacctttgct aagcagctct
ctctgctcag aatgcccgcc ctcttcccct 2580gcccgcccgc ccgccccact agcactgccc
cacccagcaa ggcccacgtg cacagctctt 2640gcagcaggaa gcttcaggct tagcctggtg
gagttagggc tgttccacaa ctgcgcgcag 2700gacattcagc aattacagtt gtgaaataag
atattttaac ttttggcttc aaatcattat 2760tcatcgtaat tctgttttct taaatggctc
tcattcatgg cagagatctt tgaggtgagg 2820gtgttttaat cattgcatgc ctagtacctg
acacattgac tggtatgtgg tgtgagctca 2880atgatcttct gttaaattaa tgaataaatg
tactcagctg cccatccact taggctcaag 2940aaaaaaaaag aggtaaacag agccttaaaa
atggacttta ttaattattt tctataattt 3000tgcttaatgc tttaaagtaa actcttattg
acttggatct taatagagtt tgtgaataca 3060aaatctgagg aaaaaagttt ttgctaaaaa
taaaaacaac gcttgaaaga tattgtaagg 3120cagtttaaat ttcttttctt ttcttttttt
ttttttttga gacggattct cactctgtcg 3180cccaggccgg agtgcagtgg cgcgatctcg
gctcactgca agctccgcct cccgggttca 3240cgccattctc ctgcctcagc ctcctgagta
ggtgggatta caggcgcgtg ccaccacgcc 3300cggctaattt ttttgtattt ttagtagagg
cggggtttca ccgtgttagc caggatggtc 3360tggatctcct gacctcatga tccgcccgcc
tcggcctccc aaagtgctgg gattacaggt 3420gtgagccaca gtgcccggcc ggcactttta
atttcttaga aaagctgaac aaatggcaca 3480atgcaaagag caaaagtttt ggaataaata
gattgaagcc attaaattat tggataaaaa 3540tagtttcggg ttgcttttgg cctaggttct
cccctccccc catgactatc cacttcagga 3600ataaacattc tgaaagtcaa ttttacccat
ttagtgagca tttatttcta gacagttgcc 3660ttatcaaata ccatctatgt tacgtcattt
aatctcacag ttacttgtgc atcagagatt 3720agcatcacca ctttatatat tggtacatga
taaacacttt attggtcatg gatggggaga 3780tggtcactgt aggctaatat tggtacatga
taaacacttt aagtaatcag cccataattg 3840ctcaccaaga ccttaagcct cccaaagtac
acaacattct ttgtgttctt cactacacat 3900ccatagagtc taagggacgt aaagcctcgt
taaagccagt tttgaccaga agcagcaatg 3960agtctattcc tgtgtgtttt ccatgttaat
gggacaaaat gatactttca aggcattgaa 4020aattcatgat taatcaatcc ctagtctgac
cccagtgtta tctatgcagg tttgcaaaac 4080ctttagttta cttaatactc ccttgccttc
ttttgattca catcctaatg ccagcaaata 4140cttatgtttt tgctatttca gttccatttc
cataaaattt attttatcat cttttctcat 4200aaatttatgc cctctatttt tactcccaat
ctgtttaaga tgaacaaatc ttataaggcc 4260acatagctga ctgttatttc tgttggactc
caggaaggag aacctaaaga aaagttcaag 4320tccaagcaga aaccgtgatt tcttccagat
gatggctcat gagtgccatt taattggggt 4380gccacctggt gacctcagca aatcccagct
atatttatgt gttcacatta caggatcatt 4440aacccagacc gaccactgca cagatctcag
aatattttct atggagaaca tacataataa 4500tgcctgattt cagaagaaga aagtaattct
caatagcaag gggatggagt agggtagaca 4560gctgtaatta aactcacttg tgtgataaaa
agaaattaag gaaaaaagaa aatgagagaa 4620catattacta aataaagaaa gcatacatta
aatatttact atagtttcac actaagagaa 4680taaaggaaat gcaataaagt ggcctgaaag
gtaaaggatg agatgtgtaa aggggtgtag 4740tatttttact atgagcagca atctgagaag
ataaaggaat cgagttacgg gcaaacatga 4800tgtttgatca gtgttatttg ttttcaaggc
ctgcctaaat ttttttcaaa tattacaaac 4860ttttgaaata acattctttt tgttttttgc
tgtctgttac taggttgcac attttataaa 4920ggcagggacc atggtatgtt gtttgtcttt
ggattctcag tgattgttat atttatattt 4980gttgaaggaa ccttaatcca agacttggac
tccaagtatc tttccactct ggttccaagg 5040agggaccttc ctcacagcag gcatgctgtg
tggtctcaca tctcactcct atatctttcc 5100ctgtctgtta ctgccctcag tggagcccac
agtgaccatc tccccatcca ggacagaggc 5160cctcaaccac cacaacctgc tggtctgctc
ggtgacagat ttctatccag cccagatcaa 5220agtccggtgg tttcggaatg accaggagga
gacagctggc gttgtgtcca ccccccttat 5280taggaatggt gactggacct tccagatcct
ggtgatgctg gaaatgactc cccagcgtgg 5340agacgtctac acctgccacg tggagcaccc
cagcctccag agccccatca ccgtggagtg 5400gcgtaagggg atattgagtt tctgttactg
tgggccccac aagacaaagg acagagctcc 5460ttctgaccca tcccttccca tctcttatcc
ctgatgtcac tgctgagctg ggaatcacag 5520gagactagag cacctctagt tccatggcga
gtgcatcaga agaatcctga tctcatcacc 5580tttccagatg ctagggaaat tactctacat
actgttgctc tggatcccag tcctgattgc 5640tctgaggaac tgattattag ggctggtgac
tgggatctta gggtctaagt ttatggatga 5700gttcctgagg agtggagatc tgcttcccca
ctctgtcacc tactcactgt atccaaggac 5760ctattggctg gcctttccct cccttagggg
tggtctgaat ggagaactag gttcctttga 5820tgccttcacc tcctgcatct cagactggac
ttcagctcct catcagggaa actatggggt 5880atggggacaa acactgacac tcaggctctg
cttctcaggg gctcaatctg aatctgccca 5940gagcaagatg ctgagtggca t
5961855938DNAHomo sapiens 85ttgaaagaat
cccaagtata agaacaactg gtttttaatc aatattacaa agatgtttac 60tgttgaatcg
catttttctt tggcttctta aaatccctta ggcattcaat cttcagctct 120tccataattg
agaggaaatt ttcacctcaa atgttcatcc agtgcaattg aaagacgtca 180cagtgccagg
cactggattc agaaccttca cacaaaaaaa atctgcccag agacagatga 240ggtccttcag
ctccagtgct gattggttcc tttccaaggg accatccaat cctaccacgc 300atggaaacat
ccacagattt ttattctttc tgccaggtac atcagatcca tcaggtccga 360gctgtgttga
ctaccacttt tcccttcgtc tcaattatgt cttggaaaaa ggctttgcgg 420atccccggag
gccttcgggc agcaactgtg accttgatgc tgtcgatgct gagcacccca 480gtggctgagg
gcagagactc tcccggtaag tgcagggcag ctgctctcca gagccgctac 540tctgggaaca
ggctctcctt gggctggggt acggggatgg tgatctccat aatctcggac 600acaatctttt
atcaacattt cctctgtttt gggaaagaga gctatgttgc atttccattt 660atcttttaat
gatgaagtga ggacaatcca atcccatcct acaggcttaa gcctggaaga 720ggaggagaga
ggagagaaaa gaggagacaa agtgttcatt tactaccagt gataggacaa 780agtgagcatg
gggttatttt tgaagatatg aatttctcca aagacacagc aggatttgcc 840atttaggcgt
gtcccaagac ttgcctggac taaatattat gatttcctgc attgggaaat 900gcaaggcagc
aatggtgtct gtagtctccg tatttgggga aaagttgtct gtattcctga 960cccagtggag
cgtttgtgga ggcaaaatct tggtactgag ggaagctgac tggctgacca 1020cagaaagaga
gccttcaggt ttcactgatt tatgggcaaa tggtgacctg agtgggattc 1080agatacccga
gttgatgatg gactaaattt agtagaaagg aggatgtaaa gaagggaaat 1140aacacatact
gtgaaaccac tcatttcaga cacagaacaa tactttacat aaattctctc 1200tcactccttc
taacatcctg tgtgtagata tcatgatttt cttttacaca attatacttg 1260tgatatggat
attctgttac ataacctgcc cgggctggtg actgccacag tttaatggga 1320atctagttta
tcaaattcaa aagcttgtgc tctttcggtg aataaatgtt tctttctagg 1380actcagagat
ctaggactcc cttctttcta acacagaagt gagtgaacct cacagggcac 1440ttgggagggt
aaatccaggc atgggaagga aggtatttta cccagggacc aagagaatag 1500gcgtatcgga
agaggacagg tttaattcct ggacctgtct cgtcattccc ttgaactgtc 1560aggtttatgt
ggataacttt atctctgagg tacccaggag ctccatggaa aatgagattt 1620catgcgagaa
cgccctgatc cctctaagtg cagaggtcca tgtaaaatca gcccgactgc 1680ctcttcactt
ggttcacagg ccgagacagg gacagggctt tcctcccttt cctgccttta 1740ggaaggcgga
ttcccgaaga cccccgagag ggcgggcagg gctgggcaga gccgccggga 1800ggatcccagg
tctgcagcgc gaggcacggg ccggcgggaa cttgtggtcg cgcgggctgt 1860tccacagctc
cgggccgggt cagggtggcg gctgcggggg cggacgggct gggccgcact 1920gactggccgg
tgattcctcg cagaggattt cgtgtaccag tttaagggca tgtgctactt 1980caccaacggg
acagagcgcg tgcgtcttgt gagcagaagc atctataacc gagaagagat 2040cgtgcgcttc
gacagcgacg tgggggagtt ccgggcggtg acgctgctgg ggctgcctgc 2100cgccgagtac
tggaacagcc agaaggacat cctggagagg aaacgggcgg cggtggacag 2160ggtgtgcaga
cacaactacc agttggagct ccgcacgacc ttgcagcggc gaggtgagcg 2220gcgtcgcccc
tctgcgaggc ccacccttgg ccccaagtct ctgcgccagg aggggcgaag 2280ggtcgttgcc
tctggaacct gagccccgtt tgttccaccc cagaggacag gaggcagcgg 2340cgagagtggt
gggggcaggt gcatcggagg tgcggggacc tagggcagag cagggggaca 2400ggcagagttg
gccaggctgc ctagtgtcgc cccagcctac ccgttcgtcg gccttgtcct 2460ctgctctgca
tgttcttgcc tcgtgcctta tgcatttgcc tccttttgcc ttacctttgc 2520taagcagctc
tctctgctca gaatgcccgc cctcttcccc tgcccgcccg cccgccccgc 2580tagcactgcc
ccacccagca aggcccacgt gcacagctct tgcagcagga agcttcaggc 2640ttagcctggt
ggagttaggg ctgttccaca actgcgcgca ggacatccag caattacagt 2700tgtgaaataa
gatattttaa cttttggctt caaatcatta ttcatcgtaa ttctgttttc 2760ttaaatggct
ctcattcatg gcagagatct ttgaggtgag ggtgttttaa tcattgcatg 2820cctagtacct
gacacattga ctggtatgtg gtgtgagctc aatgatcttc tgttaaatta 2880atgaataaat
gtactcagct gcccatccac ttaggctcaa gaaaaaaaaa gaggtaaaca 2940gagccttaaa
aatggacttt attaattatt ttctataatt ttgcttaatg ctttaaagta 3000aactcttatt
gacttggatc ttaatagagt ttgtgaatac aaaatctgag gaaaaaagtt 3060tttgctaaaa
ataaaaacaa cgcttgaaag atattgtaat gcagtttaaa tttcttttct 3120tttttttttt
ttttttgaga cggattctca ctctgtcgcc caggccggag tgcagtggcg 3180cgatctcggc
tcactgcaag ctccgcctcc cgggttcacg ccattctcct gcctcagcct 3240cctgagtagg
tgggattaca ggcgcgtgcc accacgcccg gctaattttt ttgtattttt 3300agtagaggcg
gggtttcacc gtgttagcca ggatggtctg gatctcctga cctcatgatc 3360cgcccgcctc
ggcctcccaa agtgctggga ttacaggtgt gagccacagt gcccggccgg 3420cacttttaat
ttcttagaaa agctgaacaa atggcacaat gcaaagagca aaagttttgg 3480aataaataga
ttgaagccat taaattattg gataaaaata gtttcgggtt gcttttggcc 3540taggttctcc
cctcccccca tgactatcca cttcaggaat aaacattctg aaagtcaatt 3600ttacccattt
agtgagcatt tatttctaga cagttgcctt atcaaatacc atctatgtta 3660cgtcatttaa
tctcacagtt acttgtgcat cagagattag catcaccact ttatatattg 3720gtacatgata
aacactttat tggtcatgga tggggagatg gtcactgtag gctaatattg 3780gtacatgata
aacactttaa gtaatcagcc cataattgct caccaagacc ttaagcctcc 3840caaagtacac
aacattcttt gtgttcttca ctacacatcc atagagtcta agggacgtaa 3900agcctcgtta
aagccagttt tgaccagaag cagcaatgag tctattcctg tgtgttttcc 3960atgttaatgg
gacaaaatga tactttcaag gcattgaaaa ttcatgatta atcaatcgct 4020agtctgaccc
cagtgttatc tatgcaggtt tgcaaaacct ttagtttact taatactccc 4080ttgccttctt
ttgattcaca tcctaatgcc agcaaatact tatgtttttg ctatttcagt 4140tccatttcca
taaaatttat tttatcatct tttctcataa atttatgccc tctattttta 4200ctcccaatct
gtttaagatg aacaaatctt ataaggccac atagctgact gttatttctg 4260ttggactcca
ggaaggagaa cctaaagaaa agttcaagtc caagcagaaa ccgtgatttc 4320ttccagatga
tggctcatga gtgccattta attggggtgc cacctggtga cctcagcaaa 4380tcccagctat
atttatgtgt tcacattaca ggatcattaa cccagaccga ccactgcaca 4440gatctcagaa
tattttctat ggagaacata cataataatg cctgatttca gaagaagaaa 4500gtaattctca
atagcaaggg gatggagtag ggtagacagc tgtaattaaa ctcacttgtg 4560tgataaaaag
aaattaagga aaaaagaaaa tgagagaaca tattactaaa taaagaaagc 4620atacattaaa
tatttactat agtttcacac taagagaata aaggaaatgc aataaagtgg 4680cctgaaaggt
aaaggatgag atgtgtaaag gggtgtagta tttttactat gagcagcaat 4740ctgagaagat
aaaggaatcg agttacgggc aaacatgatg tttgatcagt gttatttgtt 4800ttcaaggcct
gcctaaattt ttttcaaata ttacaaactt ttgaaataac attctttttg 4860ttttttgctg
tctgttacta ggttgcacat tttataaagg cagggaccat ggtatgttgt 4920ttgtctttgg
attctcagtg attgttatat ttatatttgt tgaaggaacc ttaatccaag 4980acttggactc
caagtatctt tccactctgg ttccaaggag ggaccttcct cacagcaggc 5040atgctgtgtg
gtctcacatc tcactcctat atctttccct gtctgttact gccctcagtg 5100gagcccacag
tgaccatctc cccatccagg acagaggccc tcaaccacca caacctgctg 5160gtctgctcgg
tgacagattt ctatccagcc cagatcaaag tccggtggtt tcggaatggc 5220caggaggaga
cagctggcgt tgtgtccacc ccccttatta ggaatggtga ctggaccttc 5280cagatcctgg
tgatgctgga aatgactccc cagcgtggag acgtctacac ctgccacgtg 5340gagcacccca
gcctccagag ccccatcacc gtggagtggc gtaaggggat attgagtttc 5400tgttactgtg
ggccccacaa gacaaaggac agagctcctt ctgacccatc ccttcccatc 5460tcttatccct
gatgtcactg ctgagctggg aatcacagga gactagagca cctctagttc 5520catggcgagt
gcatcagaag aatcctgatc tcatcacctt tccagatgct agggaaatta 5580ctctacatac
tgttgctctg gatcccagtc ctgattgctc tgaggaactg attattaggg 5640ctggtgactg
ggatcttagg gtctaagttt atggatgagt tcctgaggag tggagatctg 5700cttccccact
ctgtcaccta ctcactgtat ccaagtacct attggctggc ctttccctcc 5760cttaggggtg
gtctgaatgg agaactaggt tcctttgatg ccttcacctc ctgcatctca 5820gactggactt
cagctcctca tcagggaaac tatggggtat ggggacaaac actgacactc 5880aggctctgct
tctcaggggc tcaatctgaa tctgcccaga gcaagatgct gagtggca 5938
User Contributions:
Comment about this patent or add new information about this topic: