ADENO-ASSOCIATED VIRUS COMPOSITIONS FOR RESTORING PAH GENE FUNCTION AND METHODS OF USE THEREOF

Abstract

Provided herein are adeno-associated virus (AAV) compositions that can restore phenylalanine hydroxylase (PAH) gene function in cell. Also provided are methods of use of the AAV compositions, and packaging systems for making the AAV compositions.

Description

RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application Ser. Nos. 62/625,149, filed Feb. 1, 2018, and 62/672,377, filed May 16, 2018, the entire disclosures of which are hereby incorporated herein by reference.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] The content of the electronically submitted sequence listing in ASCII text file (Name: 610009_HMT-024_Sequence_Listing.txt; Size: 367,285 bytes; and Date of Creation: Feb. 1, 2019) is incorporated herein by reference in its entirety.

BACKGROUND

[0003] Phenylketonuria (PKU) is an autosomal recessive genetic disorder where the majority of cases are caused by mutations in the phenylalanine hydroxylase (PAH) gene. The PAH gene encodes a hepatic enzyme that catalyzes the hydroxylation of L-phenylalanine (Phe) to L-tyrosine (Tyr) upon multimerization. Reduction or loss of PAH activity leads to phenylalanine accumulation and its conversion into phenylpyruvate (also known as phenylketone). This abnormality in phenylalanine metabolism impairs neuronal maturation and the synthesis of myelin, resulting in mental retardation, seizures and other serious medical problems.

[0004] Currently, there is no cure for PKU. The standard of care is diet management by minimizing foods that contain high amounts of phenylalanine. Dietary management from birth with a low phenylalanine formula largely prevents the development of the neurological consequences of the disorder. However, even on a low-protein diet, children still suffer from growth retardation, and adults often have osteoporosis and vitamin deficiencies. Moreover, adherence to life-long dietary treatment is difficult, particularly beyond school age.

[0005] New treatment strategies have recently emerged, including large neutral amino acid (LNAA) supplementation, cofactor tetrahydrobiopterin therapy, enzyme replacement therapy, and genetically modified probiotic therapy. However, these strategies suffer from shortcomings. The LNAA supplementation is suitable only for adults not adhering to a low Phe diet. The cofactor tetrahydrobiopterin can only be used in some mild forms of PKU. Enzyme replacement by administration of a substitute for PAH, e.g., phenylalanine ammonia-lyase (PAL), can lead to immune responses that reduce the efficacy and/or cause side effects. As to genetically modified probiotic therapy, the pathogenicity of PAL-expressing E. coli has been a concern.

[0006] Gene therapy provides a unique opportunity to cure PKU. Retroviral vectors, including lentiviral vectors, are capable of integrating nucleic acids into host cell genomes. However, these vectors may raise safety concerns due to their non-targeted insertion into the genome. For example, there is a risk of the vector disrupting a tumor suppressor gene or activating an oncogene, thereby causing a malignancy. Indeed, in a clinical trial for treating X-linked severe combined immunodeficiency (SCID) by transducing CD34.sup.+ bone marrow precursors with a gammaretroviral vector, four out of ten patients developed leukemia (Hacein-Bey-Abina et al., J Clin Invest. (2008) 118(9):3132-42).

[0007] It has also been speculated that nuclease-based gene editing technologies, such as meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered, regularly interspaced, short palindromic repeat (CRISPR) technology, may be used to correct defects in the PAH gene in PKU patients. However, each of these technologies raises safety concerns due to the potential for off-target mutation of sites in the human genome similar in sequence to the intended target site.

[0008] Accordingly, there is a need in the art for improved gene therapy compositions and methods that can efficiently and safely restore PAH gene function in PKU patients.

SUMMARY

[0009] Provided herein are adeno-associated virus (AAV) compositions that can restore PAH gene function in cells, and methods for using the same to treat diseases associated with reduction of PAH gene function (e.g., PKU). Also provided are packaging systems for making the adeno-associated virus compositions.

[0010] Accordingly, in one aspect, the instant disclosure provides a method for correcting a mutation in a phenylalanine hydroxylase (PAH) gene in a cell, the method comprising transducing the cell with a replication-defective adeno-associated virus (AAV) comprising:

(a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus, wherein the cell is transduced without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.

[0011] In certain embodiments, the cell is a hepatocyte, a renal cell, or a cell in the brain, pituitary gland, adrenal gland, pancreas, urinary bladder, gallbladder, colon, small intestine, or breast. In certain embodiments, the cell is in a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject.

In another aspect, the instant disclosure provides a method for treating a subject having a disease or disorder associated with a PAH gene mutation, the method comprising administering to the subject an effective amount of a replication-defective AAV comprising: (a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus, wherein an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease is not co-administered to the subject.

[0012] In certain embodiments, the disease or disorder is phenylketonuria. In certain embodiments, the subject is a human subject.

[0013] In another aspect, the instant disclosure provides a replication-defective adeno-associated virus (AAV) comprising:

(a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus.

[0014] The following embodiments apply to each of the foregoing aspects.

[0015] In certain embodiments, the editing element comprises at least a portion of a PAH coding sequence. In certain embodiments, the editing element comprises a PAH coding sequence. In certain embodiments, the PAH coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24. In certain embodiments, the PAH coding sequence is silently altered. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143.

[0016] In certain embodiments, the editing element comprises a PAH intron-inserted coding sequence, optionally wherein the PAH intron-inserted coding sequence comprises a nonnative intron inserted in a PAH coding sequence. In certain embodiments, the nonnative intron is selected from the group consisting of a first intron of a hemoglobin beta gene and a minute virus in mice (MVM) intron. In certain embodiments, the nonnative intron consists of a nucleotide sequence at least 90% identical to any one of SEQ ID NOs: 28-30, and 120-130. In certain embodiments, the nonnative intron consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 28-30, and 120-130.

[0017] In certain embodiments, the PAH intron-inserted coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH intron-inserted coding sequence comprises from 5' to 3': a first portion of a PAH coding sequence, the intron, and a second portion of a PAH coding sequence, wherein the first portion and the second portion, when spliced together, form a complete PAH coding sequence. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24. In certain embodiments, the PAH coding sequence is silently altered. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25 or 116. In certain embodiments, the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and/or the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67. In certain embodiments, the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 64 or 65, and the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 66 or 67.

[0018] In certain embodiments, the editing element comprises from 5' to 3': a ribosomal skipping element, and the PAH coding sequence or the PAH intron-inserted coding sequence. In certain embodiments, the editing element further comprises a polyadenylation sequence 3' to the PAH coding sequence or the PAH intron-inserted coding sequence. In certain embodiments, the polyadenylation sequence is an exogenous polyadenylation sequence, optionally wherein the exogenous polyadenylation sequence is an SV40 polyadenylation sequence. In certain embodiments, the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34, and a sequence complementary thereto.

[0019] In certain embodiments, the nucleotide 5' to the target locus is in an exon of the PAH gene. In certain embodiments, the nucleotide 5' to the target locus is in exon 1 of the PAH gene.

[0020] In certain embodiments, the editing element further comprises a splice acceptor 5' to the ribosomal skipping element. In certain embodiments, the nucleotide 5' to the target locus is in an intron of the PAH gene. In certain embodiments, the nucleotide 5' to the target locus is in intron 1 of the PAH gene. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35.

[0021] In certain embodiments, the 5' homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region. In certain embodiments, the 3' homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region.

[0022] In certain embodiments, the first genomic region is located in a first editing window, and the second genomic region is located in a second editing window. In certain embodiments, the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36, and the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45.

[0023] In certain embodiments, the first genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 36. In certain embodiments, the second genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 45.

[0024] In certain embodiments, each of the 5' and 3' homology arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides.

[0025] In certain embodiments, the 5' homology arm comprises: C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -181 of the PAH gene, G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, C corresponding to nucleotide -433 of the PAH gene, C corresponding to nucleotide -432 of the PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene, A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and/or A corresponding to nucleotide -203 of the PAH gene. In certain embodiments, the 5' homology arm comprises:

(a) C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and G corresponding to nucleotide 9 of the PAH gene; (b) A corresponding to nucleotide -467 of the PAH gene, and A corresponding to nucleotide -465 of the PAH gene; (c) A corresponding to nucleotide -181 of the PAH gene; (d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene; (e) G corresponding to nucleotide 194 of the PAH gene; (f) C corresponding to nucleotide -433 of the PAH gene, and C corresponding to nucleotide -432 of the PAH gene; (g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and/or (h) A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and A corresponding to nucleotide -203 of the PAH gene. In certain embodiments, the 5' homology arm comprises the modifications of (c) and (d), (f) and (g), and/or (b) and (h).

[0026] In certain embodiments, the 5' homology arm consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 36-44, 111, 115, and 142. In certain embodiments, the 3' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 45, 112, 117, 144.

[0027] In certain embodiments, the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145.

[0028] In certain embodiments, the correction genome further comprises a 5' inverted terminal repeat (5' ITR) nucleotide sequence 5' of the 5' homology arm nucleotide sequence, and a 3' inverted terminal repeat (3' ITR) nucleotide sequence 3' of the 3' homology arm nucleotide sequence. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27.

[0029] In certain embodiments, the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146. In certain embodiments, the correction genome consists of the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146.

[0030] In certain embodiments, the AAV capsid comprises an AAV Clade F capsid protein.

[0031] In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments,

(a) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (b) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (c) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (d) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (e) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. In certain embodiments, the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.

[0032] In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments,

(a) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (b) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (c) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (d) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (e) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. In certain embodiments, the capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17.

[0033] In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L; the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments,

(a) the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; (b) the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y; (c) the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; (d) the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; (e) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (f) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (g) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (h) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (i) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C.

[0034] In certain embodiments, the capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.

[0035] In certain embodiments, the integration efficiency of the editing element into the target locus is at least 1% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions. In certain embodiments, the allelic frequency of integration of the editing element into the target locus is at least 0.5% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.

[0036] In another aspect, the instant disclosure provides a pharmaceutical composition comprising an AAV disclosed herein.

[0037] In another aspect, the instant disclosure provides a packaging system for recombinant preparation of an AAV, wherein the packaging system comprises:

(a) a Rep nucleotide sequence encoding one or more AAV Rep proteins; (b) Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins as disclosed herein; and (c) a correction genome or transfer genome as disclosed herein, wherein the packaging system is operative in a cell for enclosing the correction genome or transfer genome in the capsid to form the AAV.

[0038] In certain embodiments, the packaging system comprises a first vector comprising the Rep nucleotide sequence and the Cap nucleotide sequence, and a second vector comprising the correction genome. In certain embodiments, the Rep nucleotide sequence encodes an AAV2 Rep protein. In certain embodiments, the AAV2 Rep protein is 78/68 or Rep 68/52. In certain embodiments, the AAV2 Rep protein comprises an amino acid sequence having a minimum percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, wherein the minimum percent sequence identity is at least 70% across the length of the amino acid sequence encoding the AAV2 Rep protein.

[0039] In certain embodiments, the packaging system further comprises a third vector, wherein the third vector is a helper virus vector. In certain embodiments, the helper virus vector is an independent third vector. In certain embodiments, the helper virus vector is integral with the first vector. In certain embodiments, the helper virus vector is integral with the second vector. In certain embodiments, the third vector comprises genes encoding helper virus proteins. In certain embodiments, the helper virus is selected from the group consisting of adenovirus, herpes virus, vaccinia virus, and cytomegalovirus (CMV). In certain embodiments, the helper virus is adenovirus. In certain embodiments, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA. In certain embodiments, the helper virus is herpes simplex virus (HSV). In certain embodiments, the HSV genome comprises one or more of HSV genes selected from the group consisting of UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL42.

[0040] In certain embodiments, the first vector and the third vector are contained within a first transfecting plasmid. In certain embodiments, the nucleotides of the second vector and the third vector are contained within a second transfecting plasmid. In certain embodiments, the nucleotides of the first vector and the third vector are cloned into a recombinant helper virus. In certain embodiments, the nucleotides of the second vector and the third vector are cloned into a recombinant helper virus.

[0041] In another aspect, the instant disclosure provides a method for recombinant preparation of an AAV, the method comprising introducing a packaging system as described herein into a cell under conditions operative for enclosing the correction genome or the transfer genome in the capsid to form the AAV.

BRIEF DESCRIPTION OF THE DRAWINGS

[0042] FIG. 1A is a map of the pHMI-hPAH-hAC-008 vector.

[0043] FIG. 1B is a map of the pHMI-hPAH-hlC-007 vector.

[0044] FIG. 1C is a map of the pHMIA-hPAH-hIlC-032.1 vector.

[0045] FIG. 2 is an image of Western blot showing the expression of human PAH from the pCOH-WT-PAH ("WT PAH"), pCOH-CO-PAH ("CO PAH pCOH"), and pHMI-CO-PAH ("CO PAH pHMI") vectors. 5.times.10.sup.5 HEK 293 cells were transfected with 1 .mu.g of vector. Lysate of the cells was collected 48 hours after transfection. The expression of human PAH was detected by Western blotting with an anti-PAH antibody (Sigma HPA031642). The amount of GAPDH protein as detected by an anti-GAPDH antibody (Millipore MAB 374) was shown as a loading control.

[0046] FIG. 3A is a graph showing quantitation of the PAH cDNA cassette following linear amplification ("LAM-Enriched") or PCR amplification ("Amplicon") of the editing target site.

[0047] FIG. 3B is a graph showing quantitative analysis of integration of the pHMI-hPAH-hA-002 vector by droplet digital PCR (ddPCR).

[0048] FIG. 4A shows the design of the pHMI-hPAH-mAC-006 vector and its expected integration into a mouse genome.

[0049] FIG. 4B is a diagram illustrating a method for detecting by PCR an allele edited by the pHMI-hPAH-mAC-006 vector. Two pairs of primers were designed: the first pair could amplify a 867 bp DNA from an unedited allele ("Control PCR"); the second pair could specifically amplify a 2459 bp DNA from an edited allele ("Edited Allele PCR").

[0050] FIG. 4C is an image of DNA electrophoresis showing the PCR product from the Control PCR ("Control PCR") and Edited Allele PCR ("Edit PCR") as illustrated in FIG. 4A. The pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid was injected to two wild-type neonatal mice intravenously via the tail vein at a dose of 2.times.10.sup.13 vector genomes per kg of body weight. Liver samples were collected after 2 weeks. A liver sample from a saline treated mouse and a cell sample of 3T3 mouse fibroblasts were used as negative control for the Edited Allele PCR.

[0051] FIG. 5A is a diagram illustrating a method for quantifying an edited allele by ddPCR. A first pair of primers was designed to amplify a first sequence in the pHMI-hPAH-mAC-006 vector, and a first probe ("vector probe") was designed to hybridize to the first sequence. A second pair of primers was designed to amplify a second sequence on the mouse genome near the vector, and a second probe ("locus probe") was designed to hybridize to the second sequence. DNA samples were partitioned into oil droplets. The concentration of DNA was optimized to 600 pg per 20 .mu.L in order to significantly reduce the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle (p<0.001). Upon integration of the vector into the genome, the rate of double positivity of the vector probe and the locus probe in the same droplet increases.

[0052] FIG. 5B is a diagram illustrating an expected result using the method described in FIG. 5A. In this diagram, each dot represents a single oil droplet. The dots with negative vector probe signal but positive locus probe signal represent the unedited alleles, whereas the dots with positive vector probe signal but positive locus probe signal represent the edited alleles.

[0053] FIG. 5C is a graph showing the data generated from mouse liver using the method described in FIG. 5A. The pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid was injected to two wild-type neonatal mice intravenously via the tail vein at a dose of 2.times.10.sup.13 vector genomes per kg of body weight. Liver samples were collected after 2 weeks. One sample was analyzed using the method described in FIG. 5A. Vector probe and locus probe double positive droplets were detected.

[0054] FIG. 5D is a graph showing the data generated from a sample containing liver from a saline treated mouse and the pHMI-hPAH-mAC-006 plasmid. Few probe and locus probe double positive droplets were detected, suggesting that the sample has been sufficiently diluted so that the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle is very low.

[0055] FIG. 5E is a graph showing the quantification of the graph in FIG. 5D and the graphs generated from other samples. The two control mice had 0% and 0.0395% edited alleles in the liver, respectively, and the two mice treated with the pHMI-hPAH-mAC-006 vector had 2.504% and 2.783% edited alleles in the liver, respectively.

[0056] FIG. 6 is a graph showing the mRNA expression of human PAH in the liver after administration of the pHMI-hPAH-mAC-006 vector. RNA was extracted and reverse transcribed. A pair of primers and a probe were designed to specifically detect PAH expression from the edited allele. Each PAH expression level is normalized to the expression level of endogenous Hprt.

[0057] FIG. 7A is a graph showing the transduction efficiency of the pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsids in mouse blood samples, measured by ddPCR using primer and probe sets to measure the vector and the mouse PAH genomic loci copy numbers. The numbers of vector genomes per cell ("VG per Cell") is calculated from the measured ratio of number of vectors versus the copy numbers of the genomic locus of mouse PAH.

[0058] FIG. 7B is a graph showing the percentage editing efficiency in mouse blood samples measured by multiplexed ddPCR using primer probe sets to measure the frequency of the integrated DNA from the AAV vector ("payload") integrating into the mouse PAH locus and the human PAH locus. Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.

[0059] FIG. 7C is a graph showing the percentage levels of serum phenylalanine relative to the baseline in the mice after administration of the pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid. The average levels in the treated animals and control animals (mice that did not receive AAV administration) are plotted.

[0060] FIG. 7D is a graph showing the percentage levels of serum phenylalanine relative to the baseline in each individual mouse injected with the pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid or in each control mice that did not receive AAV administration. The p values were calculated by ANOVA against the control distribution.

[0061] FIG. 7E is a graph showing the correlation between the percentage levels of serum phenylalanine relative to the baseline and the percentage editing efficiency.

[0062] FIG. 7F is a set of images showing in situ hybridization (ISH) of Pah mRNA and possibly virus DNA comprising PAH sequence in liver samples of mice injected with the hPAH-mAC-006 vector (middle panel), a non-integrating Pah transgene vector (right panel), or saline control (left panel).

[0063] FIG. 8A is a graph showing the transduction efficiency of the hPAH-hAC-008 vector and hPAH-hAC-008-HBB vector in human and mouse hepatocytes in mice administered with the vector packaged in AAVHSC15 capsids, as measured by ddPCR using primers and probe sets specific for the vector. The y-axis represents the number of vectors measured relative to genomes of the mouse or human cells.

[0064] FIG. 8B is a series of photos showing in situ hybridization of human Pah mRNA and possibly virus DNA comprising PAH sequence with silent codon alteration in liver samples from mice administered an unmodified or a modified hPAH-hAC-008 vector. The probe detected only the mRNA transcribed from a gene locus edited by the unmodified or modified hPAH-hAC-008 vector.

[0065] FIG. 8C is a graph showing the percentage editing efficiency of the hPAH-hAC-008 vector in mouse and human hepatocytes from mice transplanted with human hepatocytes, as measured by multiplexed ddPCR. The left half of the figure refers to the editing efficiency of an animal treated with the hPAH-hAC-008-HBB vector, and the right half refers to that of an animal treated with the hPAH-hAC-008 vector. The p values were calculated by ANOVA.

[0066] FIG. 9A depicts a schematic of the assay used to determine editing efficiency of the PAH gene in mice.

[0067] FIG. 9B is a graph showing the PAH gene editing efficiency in cells from mice that have been administered either the pHMI-hPAH-mAC-006 vector or vehicle control.

[0068] FIG. 10A is a graph showing the average percentage levels of serum phenylalanine relative to the baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.

[0069] FIG. 10B is a graph showing the average percentage levels of serum tyrosine relative to the baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.

[0070] FIG. 10C is a graph showing the ratio between serum phenylalanine and serum tyrosine levels in mice that received either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.

[0071] FIG. 11A is a graph showing the average PAH gene editing efficiency and transduction efficiency in cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector or a vehicle control.

[0072] FIG. 11B depicts a graph showing the relative quantity of PAH mRNA expressed, normalized to the expression level of mouse GAPDH, in cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) and or a vehicle control.

[0073] FIG. 12A is a schematic showing the HuLiv humanized liver mouse model.

[0074] FIG. 12B depicts the average PAH gene editing efficiency in cells obtained from mice 1 week and 6 weeks after administration of the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.

[0075] FIG. 13 is a graph showing the average PAH gene editing efficiency, as determined by ddPCR and next generation sequencing (NGS), in cells obtained from HuLiv mice administered the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.

[0076] FIG. 14 is a graph showing the average serum phenylalanine levels of PAH knock-out mouse model (PAH.sup.ENU2) mice administered intravenously with either the pHMIK-hPAH-hI1C-032 vector (hPAH-032) or the pHMI-hPAH-mAC-006 vector (mPAH-006), packaged in AAVHSC15 capsids, compared to control mice.

[0077] FIG. 15A is a graph showing the relationship between human PAH expression and serum Phe levels.

[0078] FIG. 15B is a plot showing the expression of human PAH relative to human GAPDH in two different HuLiv mice treated with pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.

[0079] FIG. 16 is a plot showing human PAH gene expression in HuLiv mice treated with (left) and mouse PAH gene expression in PAH.sup.ENU2 mice treated with pHMI-hPAH-mAC-006 vector (right) packaged in AAVHSC15 capsids.

[0080] FIG. 17A, 17B, 17C, 17D, 17E depict vector maps of pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, pKITR-hPAH-mAC-006-SD.3, pHMIA2-hPAH-hI1C-032-SD.3, and pHMIA2-hPAH-mAC-006-HBB1, respectively.

DETAILED DESCRIPTION

[0081] The instant disclosure provided adeno-associated virus (AAV) compositions that can restore PAH gene function in a cell. Also provide are packaging systems for making the adeno-associated virus compositions.

I. Definitions

[0082] As used herein, the term "replication-defective adeno-associated virus" refers to an AAV comprising a genome lacking Rep and Cap genes.

[0083] As used herein, the term "PAH gene" refers to the phenylalanine hydroxylase (PAH) gene, including but not limited to the coding regions, exons, introns, 5' UTR, 3' UTR, and transcriptional regulatory regions of the PAH gene. The human PAH gene is identified by Entrez Gene ID 5053. An exemplary nucleotide sequence of a PAH mRNA is provided as SEQ ID NO: 24. An exemplary amino acid sequence of a PAH polypeptide is provided as SEQ ID NO: 23.

[0084] As used herein, the term "correcting a mutation in a PAH gene" refers to the insertion, deletion, or substitution of one or more nucleotides at a target locus in a mutant PAH gene to create a PAH gene that is capable of expressing a wild-type PAH polypeptide. In certain embodiments, "correcting a mutation in a PAH gene" involves inserting a nucleotide sequence encoding at least a portion of a wild-type PAH polypeptide or a functional equivalent thereof into the mutant PAH gene, such that a wild-type PAH polypeptide or a functional equivalent thereof is expressed from the mutant PAH gene locus (e.g., under the control of an endogenous PAH gene promoter).

[0085] As used herein, the term "correction genome" refers to a recombinant AAV genome that is capable of integrating an editing element (e.g., one or more nucleotides or an internucleotide bond) via homologous recombination into a target locus to correct a genetic defect in a PAH gene. In certain embodiments, the target locus is in the human PAH gene. The skilled artisan will appreciate that the portion of a correction genome comprising the 5' homology arm, editing element, and 3' homology arm can be in the sense or antisense orientation relative to the target locus (e.g., the human PAH gene).

[0086] As used herein, the term "editing element" refers to the portion of a correction genome that when integrated at a target locus modifies the target locus. An editing element can mediate insertion, deletion, or substitution of one or more nucleotides at the target locus. As used herein, the term "target locus" refers to a region of a chromosome or an internucleotide bond (e.g., a region or an internucleotide bond of the human PAH gene) that is modified by an editing element.

[0087] As used herein, the term "homology arm" refers to a portion of a correction genome positioned 5' or 3' of an editing element that is substantially identical to the genome flanking a target locus. In certain embodiments, the target locus is in a human PAH gene, and the homology arm comprises a sequence substantially identical to the genome flanking the target locus.

[0088] As used herein, the term "Clade F capsid protein" refers to an AAV VP1, VP2, or VP3 capsid protein that comprises an amino acid sequence having at least 90% identity with the VP1, VP2, or VP3 amino acid sequences set forth, respectively, in amino acids 1-736, 138-736, and 203-736 of SEQ ID NO:1 herein.

[0089] As used herein, the identity between two nucleotide sequences or between two amino acid sequences is determined by the number of identical nucleotides or amino acids in alignment divided by the full length of the longer nucleotide or amino acid sequence.

[0090] As used herein, the term "a disease or disorder associated with a PAH gene mutation" refers to any disease or disorder caused by, exacerbated by, or genetically linked with variation of a PAH gene. In certain embodiments, the disease or disorder associated with a PAH gene mutation is phenylketonuria (PKU).

[0091] As used herein, the term "silently altered" refers to alteration of a coding sequence or a stuffer-inserted coding sequence of a gene (e.g., by nucleotide substitution) without changing the amino acid sequence of the polypeptide encoded by the coding sequence or stuffer-inserted coding sequence. Codon alteration can be conducted by any method known in the art (e.g., as described in Mauro & Chappell (2014) Trends Mol Med. 20(11):604-13, which is incorporated by reference herein in its entirety). Such silent alteration is advantageous in that it reduces the likelihood of integration of the correction genome into loci of other genes or pseudogenes paralogous to the target gene. Such silent alteration also reduces the homology between the editing element and the target gene, thereby reducing undesired integration mediated by the editing element rather than by a homology arm.

[0092] As used herein, the term "coding sequence" refers to the portion of a complementary DNA (cDNA) that encodes a polypeptide, starting at the start codon and ending at the stop codon. A gene may have one or more coding sequences due to alternative splicing and/or alternative translation initiation. A coding sequence may either be wild-type or silently altered. An exemplary wild-type PAH coding sequence is set forth in SEQ ID NO: 24.

[0093] As used herein, the term "intron-inserted coding sequence" of a gene refers to a nucleotide sequence comprising one or more introns inserted in a coding sequence of the gene. In certain embodiments, at least one of the introns is a nonnative intron, i.e., having a sequence different from a native intron of the gene. In certain embodiments, all of the introns in the intron-inserted coding sequence are nonnative introns. A nonnative intron can have the sequence of an intron from a different species or the sequence of an intron in a different gene from the same species. Alternatively or additionally, at least a portion of a nonnative intron sequence can be synthetic. A skilled worker will appreciate that nonnative intron sequences can be designed to mediate RNA splicing by introducing any consensus splicing motifs known in the art. Exemplary consensus splicing motifs are provided in Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21, which is incorporated by reference herein in its entirety. Insertion of a nonnative intron may promote the efficiency and robustness of vector packaging, as stuffer sequences allow adjustments of the vector to reach an optimal size (e.g., 4.5-4.8 kb). In certain embodiments, at least one of the introns is a native intron of the gene. In certain embodiments, all of the introns in the intron-inserted coding sequence are native introns of the gene. The nonnative or native introns can be inserted at any internucleotide bonds in the coding sequence. In certain embodiments, one or more nonnative or native introns are inserted at internucleotide bonds predicted to promote efficient splicing (see e.g., Zhang (1998) Human Molecular Genetics, 7(5):919-32, which is incorporated by reference herein in its entirety). In certain embodiments, one or more nonnative or native introns are inserted at internucleotide bonds that link two endogenous exons.

[0094] As used herein, the term "ribosomal skipping element" refers to a nucleotide sequence encoding a short peptide sequence capable of causing generation of two peptide chains from translation of one mRNA molecule. In certain embodiments, the ribosomal skipping element encodes a peptide comprising a consensus motif of X.sub.1X.sub.2EX.sub.3NPGP, wherein X.sub.1 is D or G, X.sub.2 is V or I, and X.sub.3 is any amino acid (SEQ ID NO: 75). In certain embodiments, the ribosomal skipping element encodes thosea-asigna virus 2A peptide (T2A), porcine teschovirus-1 2A peptide (P2A), foot-and-mouth disease virus 2A peptide (F2A), equine rhinitis A virus 2A peptide (E2A), cytoplasmic polyhedrosis virus 2A peptide (BmCPV 2A), or flacherie virus of B. mori 2A peptide (BmIFV 2A). Exemplary amino acid sequences of T2A peptide and P2A peptide are set forth in SEQ ID NOs: 76 and 77, respectively. Exemplary nucleotide sequences of T2A element and P2A element are set forth in SEQ ID NOs: 78 and 79, respectively. In certain embodiments, the ribosomal skipping element encodes a peptide that further comprises a sequence of Gly-Ser-Gly at the N terminus, optionally wherein the sequence of Gly-Ser-Gly is encoded by the nucleotide sequence of GGCAGCGGA. While not wishing to be bound by theory, it is hypothesized that ribosomal skipping elements function by: terminating translation of the first peptide chain and re-initiating translation of the second peptide chain; or by cleavage of a peptide bond in the peptide sequence encoded by the ribosomal skipping element by an intrinsic protease activity of the encoded peptide, or by another protease in the environment (e.g., cytosol).

[0095] As used herein, the term "ribosomal skipping peptide" refers to a peptide encoded by a ribosomal skipping element.

[0096] As used herein, the term "polyadenylation sequence" refers to a DNA sequence that when transcribed into RNA constitutes a polyadenylation signal sequence. The polyadenylation sequence can be native (e.g., from the PAH gene) or exogenous. The exogenous polyadenylation sequence can be a mammalian or a viral polyadenylation sequence (e.g., an SV40 polyadenylation sequence).

[0097] In the instant disclosure, nucleotide positions in a PAH gene are specified relative to the first nucleotide of the start codon. The first nucleotide of a start codon is position 1; the nucleotides 5' to the first nucleotide of the start codon have negative numbers; the nucleotides 3' to the first nucleotide of the start codon have positive numbers. As used herein, nucleotide 1 of the human PAH gene is nucleotide 5,473 of the NCBI Reference Sequence: NG_008690.1, and nucleotide -1 of the human PAH gene is nucleotide 5,472 of the NCBI Reference Sequence: NG_008690.1.

[0098] In the instant disclosure, exons and introns in a PAH gene are specified relative to the exon encompassing the first nucleotide of the start codon, which is nucleotide 5473 of the NCBI Reference Sequence: NG_008690.1. The exon encompassing the first nucleotide of the start codon is exon 1. Exons 3' to exon 1 are from 5' to 3': exon 2, exon 3, etc. Introns 3' to exon 1 are from 5' to 3': intron 1, intron 2, etc. Accordingly, the PAH gene comprises from 5' to 3': exon 1, intron 1, exon 2, intron 2, exon 3, etc. As used herein, exon 1 of the human PAH gene is nucleotides 5001-5532 of the NCBI Reference Sequence: NG_008690.1, and intron 1 of the human PAH gene is nucleotides 5533-9704 of the NCBI Reference Sequence: NG_008690.1. As used herein, the term "integration" refers to introduction of an editing element into a target locus (e.g., of a PAH gene) by homologous recombination between a correction genome and the target locus. Integration of an editing element can result in substitution, insertion and/or deletion of one or more nucleotides in a target locus (e.g., of a PAH gene).

[0099] As used herein, the term "integration efficiency of the editing element into the target locus" refers to the percentage of cells in a transduced population in which integration of the editing element into the target locus has occurred.

[0100] As used herein, the term "allelic frequency of integration of the editing element into the target locus" refers to the percentage of alleles in a population of transduced cells in which integration of the editing element into the target locus has occurred.

[0101] As used herein, the term "standard AAV administration conditions" refers to transduction of human hepatocytes implanted into a mouse following hepatocyte ablation, wherein the AAV is administered intravenously at a dose of 1.times.10.sup.13 vector genomes per kilogram of body weight, as provided by the method of Example 5, section b.

[0102] As used herein, the term "effective amount" in the context of the administration of an AAV to a subject refers to the amount of the AAV that achieves a desired prophylactic or therapeutic effect.

II. Adeno-Associated Virus Compositions

[0103] In one aspect, provided herein are novel replication-defective AAV compositions useful for restoring PAH expression in cells with reduced or otherwise defective PAH gene function. Such AAV compositions are highly efficient at correcting mutations in the PAH gene or restoring PAH expression, and do not require cleavage of the genome at the target locus by the action of an exogenous nuclease (e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9) to facilitate such correction. Accordingly, in certain embodiments, the AAV composition disclosed herein does not comprise an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.

[0104] In certain embodiments, the AAV disclosed herein comprise: an AAV capsid; and a correction genome for editing a target locus in a PAH gene. The AAV capsid proteins that can be used in the AAV compositions disclosed herein include without limitation AAV capsid proteins and derivatives thereof of Clade A AAVs, Clade B AAVs, Clade C AAVs, Clade D AAVs, Clade E AAVs, and Clade F AAVs. In certain embodiments, the AAV capsid protein is an AAV capsid protein or a derivative thereof of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrh10. In certain embodiments, the AAV capsid comprises an AAV Clade F capsid protein.

[0105] Any AAV Clade F capsid protein or derivative thereof can be used in the AAV compositions disclosed herein. For example, in certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. In certain embodiments, the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.

[0106] For example, in certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. In certain embodiments, the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17.

[0107] For example, in certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L; the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. In certain embodiments, the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.

[0108] In certain embodiments, the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. In certain embodiments, the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.

[0109] In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 1-736 of SEQ ID NO: 8. In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 8. In certain embodiments, the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 8. In certain embodiments, the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 8.

[0110] In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 1-736 of SEQ ID NO: 11. In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 11. In certain embodiments, the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 11. In certain embodiments, the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 11.

[0111] In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 1-736 of SEQ ID NO: 13. In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 13. In certain embodiments, the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 13. In certain embodiments, the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 13.

[0112] In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 1-736 of SEQ ID NO: 16. In certain embodiments, the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 16. In certain embodiments, the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 16. In certain embodiments, the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 16.

[0113] Correction genomes useful in the AAV compositions disclosed herein generally comprise: (i) an editing element for editing a target locus in an PAH gene, (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus, and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus, wherein the portion of the correction genome comprising the 5' homology arm, editing element, and 3' homology arm can be in the sense or antisense orientation relative to the PAH gene locus. In certain embodiments, the correction genome comprises a 5' inverted terminal repeat (5' ITR) nucleotide sequence 5' of the 5' homology arm nucleotide sequence, and a 3' inverted terminal repeat (3' ITR) nucleotide sequence 3' of the 3' homology arm nucleotide sequence.

[0114] Editing elements used in the correction genomes disclosed herein can mediate insertion, deletion or substitution of one or more nucleotides at the target locus.

[0115] In certain embodiments, when correctly integrated by homologous recombination at the target locus, the editing element inserts a nucleotide sequence comprising at least a portion of a PAH coding sequence into a mutant PAH gene, such that a wild-type PAH polypeptide or a functional equivalent thereof is expressed from the mutant PAH gene locus. In certain embodiments, the editing element comprises a complete PAH coding sequence (e.g., a wild-type PAH coding sequence or a silently altered PAH coding sequence). In certain embodiments, the editing element comprises nucleotides 4 to 1359 of a PAH coding sequence. In certain embodiments, the editing element comprises a PAH intron-inserted coding sequence (e.g., comprising an intron inserted in a wild-type or silently altered PAH coding sequence).

[0116] In certain embodiments, the PAH coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23). In certain embodiments, the PAH coding sequence is wild-type (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 24). In certain embodiments, the PAH coding sequence is silently altered to be less than 100% (e.g., less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, or 50%) identical to the corresponding exons of the wild-type PAH gene. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25). In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 116).

[0117] In certain embodiments, the PAH intron-inserted coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23). In certain embodiments, the PAH intron-inserted coding sequence comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) intron inserted in a PAH coding sequence. The intron can comprise a native intron sequence of the PAH gene, an intron sequence from a different species or a different gene from the same species, and/or a synthetic intron sequence. In certain embodiments, the nonnative intron is no more than 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1,500, or 2,000 nucleotides in length. While not wishing to be bound by theory, it is hypothesized that introns can increase transgene expression, for example, by reducing transcriptional silencing and enhancing mRNA export from the nucleus to the cytoplasm. A skilled worker will appreciate that synthetic intron sequences can be designed to mediate RNA splicing by introducing any consensus splicing motifs known in the art (e.g., in Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21, which is incorporated by reference herein in its entirety). Exemplary intron sequences are provided in Lu et al. (2013) Molecular Therapy 21(5): 954-63, and Lu et al. (2017) Hum. Gene Ther. 28(1): 125-34, which are incorporated by reference herein in their entirety. In certain embodiments, the editing element comprises a first intron of a hemoglobin beta gene in any species (e.g., human, mouse, or rabbit). In certain embodiments, the editing element comprises a first intron of a human HBB gene (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 28). In certain embodiments, the editing element comprises a first intron of a mouse HBB gene (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 29). In certain embodiments, the editing element comprises a minute virus of mouse (MVM) intron (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 30).

[0118] In certain embodiments, the editing element comprises a chimeric MVM intron (also referred to herein as ChiMVM), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 120. In certain embodiments, the editing element comprises an SV40 intron, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 121. In certain embodiments, the editing element comprises an adenovirus tripartite leader intron (also referred to herein as AdTPL), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 122. In certain embodiments, the editing element comprises a mini .beta.-globin intron (also referred to herein as MiniBGlobin), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 123. In certain embodiments, the editing element comprises an AdV/Ig chimeric intron (also referred to herein as AdVIgG), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 124. In certain embodiments, the editing element comprises a .beta.-globin Ig heavy chain intron (also referred to herein as BglobinIg), which is a chimeric intron comprising a .beta.-globin splice donor region and a IgG heavy chain splice acceptor region, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 125. In certain embodiments, the editing element comprises a Wu MVM intron (also referred to herein as Wu MVM), which is a variant of the wild type MVM intron, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 126. In certain embodiments, the editing element comprises an HCR1 element (also referred to herein as OptHCR), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 127. In certain embodiments, the editing element comprises a .beta.-globin intron (also referred to herein as Bglobin), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 128. In certain embodiments, the editing element comprises a Factor IX intron (also referred to herein as tFIX or FIX intron), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 129. In certain embodiments, the editing element comprises a ch2BLood intron (also referred to herein as BloodEnh), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 130. In certain embodiments, the PAH intron-inserted coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23). In certain embodiments, the PAH intron-inserted coding sequence comprises portions of a PAH coding sequence that when spliced together, form a complete PAH coding sequence. In certain embodiments, the PAH coding sequence is wild-type (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 24). In certain embodiments, the PAH coding sequence is silently altered to be less than 100% (e.g., less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, or 50%) identical to the corresponding exons of the wild-type PAH gene. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25). In certain embodiments, the PAH coding sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 116. In certain embodiments, an intron-inserted PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 116. In certain embodiments, the PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 116. In certain embodiments, an intron-inserted PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143. In certain embodiments, an intron-inserted PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 80, 81, 82, 131, 132, or 143. In certain embodiments, an intron-inserted PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143.

[0119] The intron can be inserted at any position in the PAH coding sequence. In certain embodiments, the intron is inserted at a position corresponding to an internucleotide bond that links two native exons. In certain embodiments, the intron is inserted at a position corresponding to an internucleotide bond that links native exon 8 and exon 9. In certain embodiments, the PAH intron-inserted coding sequence comprises from 5' to 3': a first portion of a PAH coding sequence, the intron, and a second portion of a PAH coding sequence, wherein the first portion and the second portion, when spliced together, form a complete PAH coding sequence (e.g., wild-type PAH coding sequence, or silently altered PAH coding sequence). In certain embodiments, the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and/or the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67. In certain embodiments, the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 64 or 65, and the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 66 or 67. In certain embodiments, the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 65, and the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 67. In certain embodiments, the editing element comprises from 3' to 5': a first portion of a PAH coding sequence consist of the nucleotide sequence set forth in SEQ ID NO: 64, or a silently altered variant thereof (e.g., consisting of the nucleotide sequence set forth in SEQ ID NO: 65); an intron (e.g., consisting the nucleotide sequence set forth in SEQ ID NO: 28, 29, or 30); and a second portion of a PAH coding sequence consist of the nucleotide sequence set forth in SEQ ID NO: 66, or a silently altered variant thereof (e.g., consisting of the nucleotide sequence set forth in SEQ ID NO: 66).

[0120] In certain embodiments, the PAH coding sequence comprises a modified splice donor site. In certain embodiments, a splice donor site-modified PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 138 or 139. In certain embodiments, a splice donor site-modified PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 138 or 139. In certain embodiments, a splice donor site-modified PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 138 or 139.

[0121] In certain embodiments, the editing element further comprises a transcription terminator 3' to the PAH coding sequence or the PAH intron-inserted coding sequence. In certain embodiments, the transcription terminator comprises a polyadenylation sequence (e.g., an exogenous polyadenylation sequence). In certain embodiments, the exogenous polyadenylation sequence comprises an SV40 polyadenylation sequence (e.g., comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34, or a sequence complementary thereto). In certain embodiments, the SV40 polyadenylation sequence comprises the nucleotide sequence set forth in SEQ ID NO: 31. In certain embodiments, the editing element comprises from 5' to 3': a PAH coding sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 25) or a PAH intron-inserted coding sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 80), and an SV40 polyadenylation sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 31).

[0122] In certain embodiments, the editing element may further comprise an ID cassette 5' to an SV40 polyadenylation sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 31). The ID cassette provides a sequence that can be used for identification purposes when performing next generation sequencing experiments. In certain embodiments, the ID cassette comprises the nucleotide sequence set forth in SEQ ID NO: 33. In certain embodiments, the ID cassette comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 33. In certain embodiments, the ID cassette consists of the nucleotide sequence set forth in SEQ ID NO: 33. In certain embodiments, the editing element comprises from 5' to 3': a PAH coding sequence or PAH intron-inserted coding sequence, an ID cassette, and an SV40 polyadenylation sequence.

[0123] In certain embodiments, the editing element further comprises a ribosomal skipping element 5' to the PAH coding sequence or the PAH intron-inserted coding sequence. In certain embodiments, the editing element comprises from 5' to 3': a ribosomal skipping element; a PAH coding sequence or a PAH intron-inserted coding sequence; and optionally a transcription terminator (e.g., polyadenylation sequence). In certain embodiments, the aforementioned editing elements can be integrated into an exon of the PAH gene (e.g., the nucleotide 5' to the target locus is in an exon of the PAH gene) by homologous recombination to produce a recombinant sequence comprising from 5' to 3': a portion of the PAH gene 5' to the target locus; the ribosomal skipping element; the PAH coding sequence or PAH intron-inserted coding sequence; and the transcription terminator (e.g., polyadenylation sequence), wherein the ribosomal skipping element is positioned such that it is in frame with the portion of the PAH gene 5' to the target locus and the complete PAH coding sequence. Transcription and translation of this recombinant sequence produces a first polypeptide comprising the amino acid sequence encoded by the portion of the PAH gene 5' to the target locus fused to a 5' portion of the encoded ribosomal skipping peptide, and a second polypeptide comprising a 3' portion of the encoded ribosomal skipping peptide fused to the complete amino acid sequence of the PAH polypeptide.

[0124] In certain embodiments, the nucleotide 5' to the target locus is in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene. In certain embodiments, the target locus is an internucleotide bond in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene. In certain embodiments, the target locus is a sequence in the PAH gene, wherein the 5' end of this sequence is in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene or in the intergenic region between Achaete-scute homolog 1 (ASCL1) and PAH, and wherein the 3' end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and insulin-like growth factor 1 (IGF1). In certain embodiments, the nucleotide 5' to the target locus is in exon 1, exon 2, or exon 3 of the PAH gene. In certain embodiments, the target locus is an internucleotide bond in exon 1, exon 2, or exon 3 of the PAH gene. In certain embodiments, the target locus is a sequence in the PAH gene wherein the 5' end of this sequence is in exon 1, exon 2, or exon 3 of the PAH gene, wherein the 3' end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.

[0125] In certain embodiments, the editing element comprises a splice acceptor 5' to the ribosomal skipping element. In certain embodiments, the editing element comprises from 5' to 3': a splice acceptor; a ribosomal skipping element; a PAH coding sequence or a PAH intron-inserted coding sequence; and optionally a transcription terminator (e.g., polyadenylation sequence). In certain embodiments, the aforementioned editing element can be integrated into an intron of the PAH gene (e.g., the nucleotide 5' to the target locus is in an intron of the PAH gene) by homologous recombination to produce a recombinant sequence comprising 5' to 3': a portion of the PAH gene 5' to the target locus including the endogenous splice donor site but not the endogenous splice acceptor of the intron; the splice acceptor; the ribosomal skipping element, the PAH coding sequence or PAH intron-inserted coding sequence; and the transcription terminator (e.g., polyadenylation sequence), wherein the ribosomal skipping element is positioned such that it is in frame with the PAH coding sequence or PAH intron-inserted coding sequence, and such that splicing of the splice acceptor to the endogenous splice donor of the intron of PAH places it in frame with the portion of the PAH gene 5' to the target locus. Expression of this recombinant sequence produces a first polypeptide comprising the amino acid sequence encoded by the portion of the PAH gene 5' to the target locus fused to a 5' portion of the encoded ribosomal skipping peptide, and a second polypeptide comprising the complete amino acid sequence of the PAH polypeptide fused to a 3' portion of the encoded ribosomal skipping peptide.

[0126] In certain embodiments, the nucleotide 5' to the target locus is in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene. In certain embodiments, the target locus is an internucleotide bond in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene. In certain embodiments, the target locus is a sequence in the PAH gene wherein the 5' end of this sequence is in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene, wherein the 3' end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1. In certain embodiments, the nucleotide 5' to the target locus is in intron 1, intron 2, or intron 3 of the PAH gene. In certain embodiments, the target locus is an internucleotide bond in intron 1, intron 2, or intron 3 of the PAH gene. In certain embodiments, the target locus is a sequence in the PAH gene wherein the 5' end of this sequence is in intron 1, intron 2, or intron 3 of the PAH gene, wherein the 3' end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1. In certain embodiments, the nucleotide 5' to the target locus is in intron 1 of the PAH gene. In certain embodiments, the target locus is a sequence in the PAH gene wherein the 5' end of this sequence is in intron 1 of the PAH gene, wherein the 3' end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.

[0127] Any and all of the editing elements disclosed herein can further comprise a restriction endonuclease site not present in the wild-type PAH gene. Such restriction endonuclease sites allow for identification of cells that have integration of the editing element at the target locus based upon restriction fragment length polymorphism analysis or by nucleic sequencing analysis of the target locus and its flanking regions, or a nucleic acid amplified therefrom.

[0128] Any and all of the editing elements disclosed herein can comprise one or more nucleotide alterations that cause one or more amino acid mutations in PAH polypeptide when integrated into the target locus. In certain embodiments, the mutant PAH polypeptide is a functional equivalent of the wild-type PAH polypeptide, i.e., can function as a wild-type PAH polypeptide. In certain embodiments, the functionally equivalent PAH polypeptide further comprises at least one characteristic not found in the wild-type PAH polypeptide, e.g., the ability to stabilize PAH protein (e.g., dimer or tetramer), or the ability to resist protein degradation.

[0129] In certain embodiments, an editing element as described herein comprises at least 0, 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides. In certain embodiments, the editing element comprises or consists of 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200, 1 to 100, 1 to 50, or 1 to 10 nucleotides.

[0130] In certain embodiments, an editing element as described herein comprises or consists of a PAH coding sequence or a portion thereof (e.g., the complete human PAH coding sequence, or nucleotides 4 to 1359 of the human PAH coding sequence), a 5' untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence encoding a non-coding RNA, an insulator, a gene, or a combination thereof.

[0131] In certain embodiments, the editing element comprises a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the sequence set forth in SEQ ID NO: 35, 83, or 84. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35, 83, or 84. In certain embodiments, the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 35, 83, or 84. In certain embodiments, the editing element comprises a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153. In certain embodiments, the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153.

[0132] Homology arms used in the correction genomes disclosed herein can be directed to any region of the PAH gene or a gene nearby on the genome. The precise identity and positioning of the homology arms are determined by the identity of the editing element and/or the target locus.

[0133] Homology arms employed in the correction genomes disclosed herein are substantially identical to the genome flanking a target locus (e.g., a target locus in a PAH gene). In certain embodiments, the 5' homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to a first genomic region 5' to the target locus. In certain embodiments, the 5' homology arm has 100% nucleotide sequence identity to the first genomic region. In certain embodiments, the 3' homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to a second genomic region 3' to the target locus. In certain embodiments, the 3' homology arm has 100% nucleotide sequence identity to the second genomic region. In certain embodiments, the 5' and 3' homology arms are each at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to the first and second genomic regions flanking the target locus (e.g., a target locus in the PAH gene), respectively. In certain embodiments, the 5' and 3' homology arms are each 100% identical to the first and second genomic regions flanking the target locus (e.g., a target locus in the PAH gene), respectively. In certain embodiments, differences in nucleotide sequences of the 5' homology arm and/or the 3' homology arm and the corresponding regions the genome flanking a target locus comprise, consist essentially of or consist of non-coding differences in nucleotide sequences.

[0134] The skilled worker will appreciate that homology arms do not need to be 100% identical to the genomic sequence flanking the target locus to be able to mediate integration of an editing element into that target locus by homologous recombination. For example, the homology arms can comprise one or more genetic variations in the human population, and/or one or more modifications (e.g., nucleotide substitutions, insertions, or deletions) designed to improve expression level or specificity. Human genetic variations include both inherited variations and de novo variations that are private to the target genome, and encompass simple nucleotide polymorphisms, insertions, deletions, rearrangements, inversions, duplications, micro-repeats, and combinations thereof. Such variations are known in the art, and can be found, for example, in the databases of dnSNP (see Sherry et al. Nucleic Acids Res. 2001; 29(1):308-11), the Database of Genomic Variants (see Nucleic Acids Res. 2014; 42(Database issue):D986-92), ClinVar (see Nucleic Acids Res. 2014; 42(Database issue): D980-D985), Genbank (see Nucleic Acids Res. 2016; 44(Database issue): D67-D72), ENCODE (genome.ucsc.edu/encode/terms.html), JASPAR (see Nucleic Acids Res. 2018; 46(D1): D260-D266), and PROMO (see Messeguer et al. Bioinformatics 2002; 18(2):333-334; Farre et al. Nucleic Acids Res. 2003; 31(13):3651-3653), each of which is incorporated herein by reference. The skilled worker will further appreciate that in situations where a homology arm is not 100% identical to the genomic sequence flanking the target locus, homologous recombination between the homology arm and the genome may alter the genomic sequence flanking the target locus such that it becomes identical to the sequence of the homology arm used.

[0135] In certain embodiments, the first genomic region 5' to the target locus is located in a first editing window, wherein the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36. In certain embodiments, the second genomic region 3' to the target locus is located in a second editing window, wherein the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45. In certain embodiments, the first genomic region 5' to the target locus is located in a first editing window, wherein the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36; and the second genomic region 3' to the target locus is located in a second PAH targeting locus, wherein the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45.

[0136] In certain embodiments, the first and second editing windows are different. In certain embodiments, the first editing window is located 5' to the second editing window. In certain embodiments, the first genomic region consists of a sequence shorter than the sequence of the first editing window in which the first genomic region is located. In certain embodiments, the first genomic region consists of the sequence of the first editing window in which the first genomic region is located. In certain embodiments, the second genomic region consists of a sequence shorter than the sequence of the second editing window in which the second genomic region is located. In certain embodiments, the second genomic region consists of the sequence of the second editing window in which the second genomic region is located. In certain embodiments, the first genomic region 5' to the target locus has the sequence set forth in SEQ ID NO: 36. In certain embodiments, the second genomic region 3' to the target locus has the sequence set forth in SEQ ID NO: 45. In certain embodiments, the first genomic region 5' to the target locus and the second genomic region 3' to the target locus have the sequences set forth in SEQ ID NOs: 36 and 45, respectively.

[0137] In certain embodiments, the first and second editing windows are the same. In certain embodiments, the target locus is an internucleotide bond or a nucleotide sequence in the editing window, wherein the first genomic region consists of a first portion of the editing window 5' to the target locus, and the second genomic region consists of a second portion of the editing window 3' to the target locus. In certain embodiments, the first portion of the editing window consists of the sequence from the 5' end of the editing window to the nucleotide adjacently 5' to the target locus. In certain embodiments, the second portion of the editing window consists of the sequence from the nucleotide adjacently 3' to the target locus to the 3' end of the editing window. In certain embodiments, the first portion of the editing window consists of the sequence from the 5' end of the editing window to the nucleotide adjacently 5' to the target locus, and the second portion of the editing window consists of the sequence from the nucleotide adjacently 3' to the target locus to the 3' end of the editing window. In certain embodiments, the editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the first and second portions of the editing windows have substantially equal lengths (e.g., the ratio of the length of the shorter portion to the length of the longer portion is greater than 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, or 0.99).

[0138] In certain embodiments, the 5' homology arm has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 5' homology arm has a length of about 800 nucleotides. In certain embodiments, the 5' homology arm has a length of about 100 nucleotides. In certain embodiments, the 3' homology arm has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 3' homology arm has a length of about 800 nucleotides. In certain embodiments, the 3' homology arm has a length of about 100 nucleotides. In certain embodiments, each of the 5' and 3' homology arms independently has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 5' and 3' homology arm has a length of about 800 nucleotides.

[0139] In certain embodiments, the 5' and 3' homology arms have substantially equal nucleotide lengths. In certain embodiments, the 5' and 3' homology arms have asymmetrical nucleotide lengths. In certain embodiments, the asymmetry in nucleotide length is defined by a difference between the 5' and 3' homology arms of up to 90% in the length, such as up to an 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% difference in the length.

[0140] In certain embodiments, the 5' homology arm comprises: C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -181 of the PAH gene, G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, C corresponding to nucleotide -433 of the PAH gene, C corresponding to nucleotide -432 of the PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene, A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and/or A corresponding to nucleotide -203 of the PAH gene.

[0141] In certain embodiments, the 5' homology arm comprises:

(a) C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and G corresponding to nucleotide 9 of the PAH gene; (b) A corresponding to nucleotide -467 of the PAH gene, and A corresponding to nucleotide -465 of the PAH gene; (c) A corresponding to nucleotide -181 of the PAH gene; (d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene; (e) G corresponding to nucleotide 194 of the PAH gene; (f) C corresponding to nucleotide -433 of the PAH gene, and C corresponding to nucleotide -432 of the PAH gene; (g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and/or (h) A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and A corresponding to nucleotide -203 of the PAH gene.

[0142] In certain embodiments, the 5' homology arm comprises:

(a) C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and G corresponding to nucleotide 9 of the PAH gene; (b) A corresponding to nucleotide -467 of the PAH gene, and A corresponding to nucleotide -465 of the PAH gene; (c) A corresponding to nucleotide -181 of the PAH gene; (d) A corresponding to nucleotide -181 of the PAH gene, G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene; (e) G corresponding to nucleotide 194 of the PAH gene; (f) C corresponding to nucleotide -433 of the PAH gene, and C corresponding to nucleotide -432 of the PAH gene; (g) C corresponding to nucleotide -433 of the PAH gene, C corresponding to nucleotide -432 of the PAH gene, and ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and/or (h) A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and A corresponding to nucleotide -203 of the PAH gene.

[0143] In certain embodiments, the 5' homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 36, optionally comprising one or more of the nucleotides at the positions set forth above. In certain embodiments, the 5' homology arm further comprises one or more genetic variations in the human population. In certain embodiments, the 5' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44. In certain embodiments, the 5' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44.

[0144] In certain embodiments, the 3' homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 45. In certain embodiments, the 3' homology arm further comprises one or more genetic variations in the human population. In certain embodiments, the 3' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 45. In certain embodiments, the 3' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 45.

[0145] In certain embodiments, the 5' homology arm and the 3' homology arm each have at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, respectively, optionally wherein the 5' homology arm comprises one or more of the nucleotides at the positions set forth above. In certain embodiments, the 5' homology arm and the 3' homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and 45, or, 44 and 45, respectively. In certain embodiments, the 5' homology arm and the 3' homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and 45, or, 44 and 45, respectively.

[0146] In certain embodiments, the 5' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 5' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 3' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 3' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 5' homology arm and the 3' homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively. In certain embodiments, the 5' homology arm and the 3' homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively.

[0147] In certain embodiments, the 5' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 111, 115, or 142. In certain embodiments, the 5' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 111, 115, or 142. In certain embodiments, the 3' homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 112, 117, or 144. In certain embodiments, the 3' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 112, 117, or 144. In certain embodiments, the 5' homology arm and the 3' homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively. In certain embodiments, the 5' homology arm and the 3' homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively.

[0148] In certain embodiments, the correction genome comprises a nucleotide sequence at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145. In certain embodiments, the correction genome comprises the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145. In certain embodiments, the correction genome consists of the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145

[0149] In certain embodiments, the correction genomes disclosed herein further comprise a 5' inverted terminal repeat (5' ITR) nucleotide sequence 5' of the 5' homology arm nucleotide sequence, and a 3' inverted terminal repeat (3' ITR) nucleotide sequence 3' of the 3' homology arm nucleotide sequence. ITR sequences from any AAV serotype or variant thereof can be used in the correction genomes disclosed herein. The 5' and 3' ITR can be from an AAV of the same serotype or from AAVs of different serotypes. Exemplary ITRs for use in the correction genomes disclosed herein are set forth in SEQ ID NO: 18-21 herein. In certain embodiments, the 5' ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially complementary to each other (e.g., are complementary to each other except for mismatch at 1, 2, 3, 4 or 5 nucleotide positions in the 5' or 3' ITR).

[0150] In certain embodiments, the 5' ITR or 3' ITR is from AAV2. In certain embodiments, both the 5' ITR and the 3' ITR are from AAV2. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:18, or the 3' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:19. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:18, and the 3' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:19. In certain embodiments, the correction genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:18, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:19. In certain embodiments, the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:18, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:19. In certain embodiments, the correction genome consists of 5' to 3' a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:18, the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:19.

[0151] In certain embodiments, the 5' ITR or 3' ITR are from AAV5. In certain embodiments, both the 5' ITR and 3' ITR are from AAV5. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:20, or the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO:21. In certain embodiments, the 5' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:20, and the 3' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:21. In certain embodiments, the correction genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:20, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:21. In certain embodiments, the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:20, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:21. In certain embodiments, the correction genome consists of 5' to 3' a 5' ITR nucleotide sequence having the sequence of SEQ ID NO:20, the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, and a 3' ITR nucleotide sequence having the sequence of SEQ ID NO:21.

[0152] In certain embodiments, the 5' ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially complementary to each other (e.g., are complementary to each other except for mismatch at 1, 2, 3, 4 or 5 nucleotide positions in the 5' or 3' ITR).

[0153] In certain embodiments, the 5' ITR or the 3' ITR is modified to reduce or abolish resolution by Rep protein ("non-resolvable ITR"). In certain embodiments, the non-resolvable ITR comprises an insertion, deletion, or substitution in the nucleotide sequence of the terminal resolution site. Such modification allows formation of a self-complementary, double-stranded DNA genome of the AAV after the transfer genome is replicated in an infected cell. Exemplary non-resolvable ITR sequences are known in the art (see e.g., those provided in U.S. Pat. Nos. 7,790,154 and 9,783,824, which are incorporated by reference herein in their entirety). In certain embodiments, the 5' ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5' ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26. In certain embodiments, the 3' ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 27. In certain embodiments, the 5' ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, 3or 99% identical to SEQ ID NO: 27. In certain embodiments, the 3' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27. In certain embodiments, the 5' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26, and the 3' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27. In certain embodiments, the 5' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26, and the 3' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 19.

[0154] In certain embodiments, the 3' ITR is flanked by an additional nucleotide sequence derived from a wild-type AAV2 genomic sequence. In certain embodiments, the 3' ITR is flanked by an additional 37 bp sequence derived from a wild-type AAV2 sequence that is adjacent to a wild-type AAV2 ITR. See, e.g., Savy et al., Human Gene Therapy Methods (2017) 28(5): 277-289 (which is hereby incorporated by reference herein in its entirety). In certain embodiments, the additional 37 bp sequence is internal to the 3' ITR. In certain embodiments, the 37 bp sequence consists of the sequence set forth in SEQ ID NO: 140. In certain embodiments, the 3' ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the 3' ITR comprises the nucleotide sequence set forth in SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of the 3' ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of the 3' ITR consists of the nucleotide sequence set forth in SEQ ID NO: 141.

[0155] In certain embodiments, the correction genome disclosed herein has a length of about 0.5 to about 8 kb (e.g., about 1 to about 5, about 2 to about 5, about 3 to about 5, about 4 to about 5, about 4.5 to about 4.8, or about 4.7 kb).

[0156] In certain embodiments, the correction genome comprises a nucleotide sequence at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146. In certain embodiments, the correction genome comprises the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146. In certain embodiments, the correction genome consists of the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146.

[0157] In certain embodiments, the replication-defective AAV comprises: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19); (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19); and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19).

[0158] In certain embodiments, the replication-defective AAV comprises: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146.

[0159] The AAV compositions disclosed herein are particularly advantageous in that they are capable of correcting a PAH gene in a cell with high efficiency both in vivo and in vitro. In certain embodiments, the integration efficiency of the editing element into the target locus is at least 1% (e.g. at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions. In certain embodiments, the allelic frequency of integration of the editing element into the target locus is at least 0.5% (e.g. at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.

[0160] Any methods of determining the efficiency of editing of the PAH gene can be employed. In certain embodiments, individual cells are separated from the population of transduced cells and subject to single-cell PCR using PCR primers that can identify the presence of an editing element correctly integrated into the target locus of the PAH gene. Such method can further comprise single-cell PCR of the same cells using PCR primers that selectively amplify an unmodified target locus. In this way, the genotype of the cells can be determined. For example, if the single cell PCR showed that a cell has both an edited target locus and an unmodified target locus, then the cell would be considered heterozygous for the edited PAH gene.

[0161] Additionally or alternatively, in certain embodiments, linear amplification mediated PCR (LAM-PCR), quantitative PCR (qPCR) or digital droplet PCR (ddPCR) can be performed on DNA extracted from the population of transduced cells using primers and probes that only detect edited PAH alleles. Such methods can further comprise an additional qPCR or ddPCR (either in the same reaction or a separate reaction) to determine the number of total genomes in the sample and the number of unedited PAH alleles. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.

[0162] Additionally or alternatively, in certain embodiments, the PAH locus can be amplified from DNA extracted from the population of transduced cells either by PCR using primers that bind to regions of the PAH gene flanking the target locus, or by LAM-PCR using a primer that binds a region within the correction genome (e.g., a region comprising an exogenous sequence non-native to the locus). The resultant PCR amplicons can be individually sequenced using single molecule next generation sequencing (NGS) techniques to determine the relative number of edited and unedited PAH alleles present in the population of transduced cells. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.

[0163] In another aspect, the instant disclosure provides pharmaceutical compositions comprising an AAV as disclosed herein together with a pharmaceutically acceptable excipient, adjuvant, diluent, vehicle or carrier, or a combination thereof. A "pharmaceutically acceptable carrier" includes any material which, when combined with an active ingredient of a composition, allows the ingredient to retain biological activity and without causing disruptive physiological reactions, such as an unintended immune reaction. Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions such as oil/water emulsion, and wetting agents. Compositions comprising such carriers are formulated by well-known conventional methods such as those set forth in Remington's Pharmaceutical Sciences, current Ed., Mack Publishing Co., Easton Pa. 18042, USA; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. C. Ansel et al, 7th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A. H. Kibbe et al, 3rd ed. Amer. Pharmaceutical Assoc.

III. Method of Use

[0164] In another aspect, the instant disclosure provides methods for correcting a mutation in the PAH gene or expressing a PAH polypeptide in a cell. The methods generally comprise transducing the cell with a replication-defective AAV as disclosed herein. Such methods are highly efficient at correcting mutations in the PAH gene or restoring PAH expression, and do not require cleavage of the genome at the target locus by the action of an exogenous nuclease (e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9) to facilitate such correction. Accordingly, in certain embodiments, the methods disclosed herein involve transducing the cell with a replication-defective AAV as disclosed herein without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.

[0165] The methods disclosed herein can be applied to any cell harboring a mutation in the PAH gene. The skilled worker will appreciate that cells that actively express PAH are of particular interest. Accordingly, in certain embodiments, the method is applied to cells in the liver, kidney, brain, pituitary gland, adrenal gland, pancreas, urinary bladder, gallbladder, colon, small intestine, or breast. In certain embodiments, the method is applied to hepatocytes and/or renal cells.

[0166] The methods disclosed herein can be performed in vitro for research purposes or can be performed ex vivo or in vivo for therapeutic purposes.

[0167] In certain embodiments, the cell to be transduced is in a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject. Accordingly, in certain embodiments, the instant disclosure provides a method for treating a subject having a disease or disorder associated with a PAH gene mutation, the method generally comprising administering to the subject an effective amount of a replication-defective AAV as disclosed herein. The subject can be a human subject or a rodent subject (e.g., a mouse) containing human liver cells. Suitable mouse subjects include without limitation, mice into which human liver cells (e.g., human hepatocytes) have been engrafted. Any disease or disorder associated with a PAH gene mutation can be treated using the methods disclosed herein. Suitable diseases or disorders include, without limitation, phenylketonuria. In certain embodiments, the cell is transduced without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.

[0168] The methods disclosed herein are particularly advantageous in that they are capable of correcting a PAH gene in a cell with high efficiency both in vivo and in vitro. In certain embodiments, the integration efficiency of the editing element into the target locus is at least 1% (e.g. at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions. In certain embodiments, the allelic frequency of integration of the editing element into the target locus is at least 0.5% (e.g. at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.

[0169] In certain embodiments, transduction of a cell with an AAV composition disclosed herein can be performed as provided herein or by any method of transduction known to one of ordinary skill in the art. In certain embodiments, the cell may be contacted with the AAV at a multiplicity of infection (MOI) of 50,000; 100,000; 150,000; 200,000; 250,000; 300,000; 350,000; 400,000; 450,000; or 500,000, or at any MOI that provides for optimal transduction of the cell.

[0170] In certain embodiments, the foregoing methods employ a replication-defective AAV comprising: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19); (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19); and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a transfer genome comprising 5' to 3' the following genetic elements: a 5' ITR element (e.g., the 5' ITR of SEQ ID NOs: 18), a 5' homology arm (e.g., the 5' homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3' homology arm (e.g., the 3' homology arm of SEQ ID NOs: 117, and a 3' ITR element (e.g., the 3' ITR of SEQ ID NOs: 19).

[0171] In certain embodiments, the foregoing methods employ a replication-defective AAV comprising: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146.

[0172] An AAV composition disclosed herein can be administered to a subject by any appropriate route including, without limitation, intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal, topical or intradermal routes. In certain embodiments, the composition is formulated for administration via intravenous injection or subcutaneous injection.

IV. AAV Packaging Systems

[0173] In another aspect, the instant disclosure provides packaging systems for recombinant preparation of a replication-defective AAV disclosed herein. Such packaging systems generally comprise: a Rep nucleotide sequence encoding one or more AAV Rep proteins; a Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins as disclosed herein; and a correction genome for correction of the PAH gene or a transfer genome for expression of the PAH gene as disclosed herein, wherein the packaging system is operative in a cell for enclosing the correction genome in the capsid to form the AAV.

[0174] In certain embodiments, the packaging system comprises a first vector comprising the Rep nucleotide sequence and the Cap nucleotide sequence, and a second vector comprising the correction genome or transfer genome. As used in the context of a packaging system as described herein, a "vector" refers to a nucleic acid molecule that is a vehicle for introducing nucleic acids into a cell (e.g., a plasmid, a virus, a cosmid, an artificial chromosome, etc.).

[0175] Any AAV Rep protein can be employed in the packaging systems disclosed herein. In certain embodiments of the packaging system, the Rep nucleotide sequence encodes an AAV2 Rep protein. Suitable AAV2 Rep proteins include, without limitation, Rep 78/68 or Rep 68/52. In certain embodiments of the packaging system, the nucleotide sequence encoding the AAV2 Rep protein comprises a nucleotide sequence that encodes a protein having a minimum percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, wherein the minimum percent sequence identity is at least 70% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%) across the length of the amino acid sequence of the AAV2 Rep protein. In certain embodiments of the packaging system, the AAV2 Rep protein has the amino acid sequence set forth in SEQ ID NO: 22.

[0176] In certain embodiments of the packaging system, the packaging system further comprises a third vector, e.g., a helper virus vector. The third vector may be an independent third vector, integral with the first vector, or integral with the second vector. In certain embodiments, the third vector comprises genes encoding helper virus proteins.

[0177] In certain embodiments of the packaging system, the helper virus is selected from the group consisting of adenovirus, herpes virus (including herpes simplex virus (HSV)), poxvirus (such as vaccinia virus), cytomegalovirus (CMV), and baculovirus. In certain embodiments of the packaging system, where the helper virus is adenovirus, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA. In certain embodiments of the packaging system, where the helper virus is HSV, the HSV genome comprises one or more of HSV genes selected from the group consisting of UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL42.

[0178] In certain embodiments of the packaging system, the first, second, and/or third vector are contained within one or more transfecting plasmids. In certain embodiments, the first vector and the third vector are contained within a first transfecting plasmid. In certain embodiments the second vector and the third vector are contained within a second transfecting plasmid.

[0179] In certain embodiments of the packaging system, the first, second, and/or third vector are contained within one or more recombinant helper viruses. In certain embodiments, the first vector and the third vector are contained within a recombinant helper virus. In certain embodiments, the second vector and the third vector are contained within a recombinant helper virus.

[0180] In a further aspect, the disclosure provides a method for recombinant preparation of an AAV as described herein, wherein the method comprises transfecting or transducing a cell with a packaging system as described under conditions operative for enclosing the correction genome in the capsid to form the AAV as described herein. Exemplary methods for recombinant preparation of an AAV include transient transfection (e.g., with one or more transfection plasmids containing a first, and a second, and optionally a third vector as described herein), viral infection (e.g. with one or more recombinant helper viruses, such as a adenovirus, poxvirus (such as vaccinia virus), herpes virus (including HSV, cytomegalovirus, or baculovirus, containing a first, and a second, and optionally a third vector as described herein), and stable producer cell line transfection or infection (e.g., with a stable producer cell, such as a mammalian or insect cell, containing a Rep nucleotide sequence encoding one or more AAV Rep proteins and/or a Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins as described herein, and with a correction genome as described herein being delivered in the form of a transfecting plasmid or a recombinant helper virus).

V. Examples

[0181] The recombinant AAV vectors disclosed herein mediate highly efficient gene editing in vitro and in vivo. The following examples provide correction vectors that can be packaged with an AAV clade F capsid (e.g., AAVHSC7, AAVHSC15 or AAVHSC17, as disclosed in U.S. Pat. No. 9,623,120, which is incorporated by reference herein in its entirety), and demonstrate the efficient restoration of the expression of the PAH gene which is mutated in certain human diseases, such as phenylketonuria. These examples are offered by way of illustration, and not by way of limitation.

Example 1: PAH Correction Vector pHMI-hPAH-hAC-008

[0182] a) PAH Correction Vector pHMI-hPAH-hAC-008

[0183] PAH correction vector pHMI-hPAH-hAC-008, as shown in FIG. 1A, comprises 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 1. The 5' homology arm comprises a wild-type genomic sequence 800 nucleotides upstream from the human PAH start codon, and thus has the ability to correct mutations in the start codon and/or 5' untranslated region (UTR) that affect PAH expression as observed in some PKU patients. The 3' homology arm comprises the wild-type genomic sequence 800 nucleotides downstream from the start codon. Integration of the PAH correction vector pHMI-hPAH-hAC-008 into the human genome inserts the silently altered human PAH coding sequence, the SV40 polyadenylation sequence, and the targeted integration restriction cassette at the PAH start codon target locus (i.e., replacing nucleotides 1-3 of the PAH gene), thereby restoring the expression of a wild-type PAH protein that has been impaired by mutations in 5' UTR, coding sequence, or 3' UTR of the PAH gene.

TABLE-US-00001 TABLE 1 Genetic elements in PAH correction vector pHMI-hPAH-hAC-008 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 69 silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 targeted integration restriction cassette 71 3' homology arm 70 3' ITR element 19 Editing element 83 Correction genome from 5' homology 85 arm to 3' homology arm Correction genome from 5' ITR to 3' ITR 87

b) PAH correction vector pHMI-hPAH-h1C-007

[0184] PAH correction vector pHMI-hPAH-h1C-007, as shown in FIG. 1B, comprises 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a splice acceptor, a 2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 2. The 5' homology arm comprises the wild-type genomic sequence of 800 nucleotides upstream from nucleotide 2128 of human PAH, which is located in intron 1. The 3' homology arm comprises the wild-type genomic sequence of 800 nucleotides downstream from nucleotide 2127 of human PAH. Integration of the PAH correction vector pHMI-hPAH-h1C-007 into the human genome allows transcription of the PAH locus into a pre-mRNA comprising 5' to 3' the following elements: exon 1 of endogenous PAH, part of intron 1 from its 5' splice donor to nucleotide 2127, the splice acceptor in the vector pHMI-hPAH-h1C-007, the 2A element, the silently altered human PAH coding sequence, and the SV40 polyadenylation sequence. Splicing of this pre-mRNA generates an mRNA comprising 5' to 3' the following elements: exon 1 of endogenous PAH, the 2A element (in frame with the PAH exon 1), the silently altered human PAH coding sequence (in frame with the 2A element), and the SV40 polyadenylation sequence. The 2A element leads to generation of two polypeptides: a truncated PAH peptide terminated at the end of exon 1 fused with an N-terminal part of the 2A peptide, and a proline from the 2A peptide fused with a full-length PAH polypeptide. Therefore, integration of the vector pHMI-hPAH-h1C-007 can restore the expression of wild-type PAH protein that has been impaired by mutations in the coding sequence or 3' UTR of the PAH gene.

TABLE-US-00002 TABLE 2 Genetic elements in PAH correction vector pHMI-hPAH-h1C-007 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 72 Splice acceptor 14 2A element 74 silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 targeted integration restriction cassette 71 3' homology arm 73 3' ITR element 19 Editing element 84 Correction genome from 5' homology arm 86 to 3' homology arm Correction genome from 5' ITR to 3' ITR 88

[0185] The silent alteration adopted in the two vectors above significantly improved the expression of the PAH protein, as demonstrated by comparison of expression vectors pCOH-WT-PAH, pCOH-CO-PAH, and pHMI-CO-PAH. The pCOH-WT-PAH vector comprises a CBA promoter operably linked to a wild-type PAH coding sequence set forth in SEQ ID NO: 24. The pCOH-CO-PAH and pHMI-CO-PAH vectors each comprise a CBA promoter operably linked to a silently altered human PAH coding sequence as set forth in SEQ ID NO: 25. The pCOH-CO-PAH and pHMI-CO-PAH vectors were highly similar. Each vector was transfected in HEK 293 cells which is naturally deficient in PAH. As shown in FIG. 2, VG-GT-CO-PAH ("CO-hPAH") gave rise to an expression level of human PAH notably higher than VG-GT-PAH ("WT-hPAH").

Example 2: PAH Correction Vector pHMIA-hPAH-hI1C-032.1 and its Variants

[0186] In order to identify homology arm sequences that facilitate efficient gene editing, 130 correction vectors were designed, and 70 of them were tested in human hepatocellular carcinoma cells. The pHMIA-hPAH-hI1C-032.1 vector showed the highest editing efficiency in vitro. This example provides the structure of this vector and its variants.

a) PAH Correction Vector pHMIA-hPAH-hI1C-032.1

[0187] PAH correction vector pHMIA-hPAH-hI1C-032.1, as shown in FIG. 1C, comprises 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a splice acceptor, a P2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 3. The 5' homology arm comprises the wild-type genomic sequence of nucleotides -686 to 274 of human PAH, the 3' end of which is located in intron 1. The 3' homology arm comprises the wild-type genomic sequence of nucleotides 415 to 1325 of human PAH. Integration of the PAH correction vector pHMIA-hPAH-hI1C-032.1 into the human genome allows transcription of the PAH locus into a pre-mRNA comprising 5' to 3' the following elements: exon 1 of endogenous PAH, part of intron 1 from its 5' splice donor to nucleotide 274, the splice acceptor in the vector pHMIA-hPAH-hI1C-032.1, the P2A element, the silently altered human PAH coding sequence, and the SV40 polyadenylation sequence. Splicing of this pre-mRNA generates an mRNA comprising 5' to 3' the following elements: exon 1 of endogenous PAH, the P2A element (in frame with the PAH exon 1), the silently altered human PAH coding sequence (in frame with the P2A element), and the SV40 polyadenylation sequence. The P2A element leads to generation of two polypeptides: a truncated PAH peptide terminated at the end of exon 1 fused with an N-terminal part of the P2A peptide, and a proline from the P2A peptide fused with a full-length PAH polypeptide. Therefore, integration of the vector pHMIA-hPAH-hI1C-032.1 can restore the expression of wild-type PAH protein that has been impaired by mutations in the coding sequence or 3' UTR of the PAH gene.

TABLE-US-00003 TABLE 3 Genetic elements in PAH correction vector pHMIA-hPAH-hI1C-032.1 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 36 Splice acceptor 14 P2A element 79 silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 3' homology arm 45 3' ITR element 19 Editing element 35 Correction genome from 5' homology arm 46 to 3' homology arm Correction genome from 5' ITR to 3' ITR 55

b) Variants of PAH Correction Vector pHMIA-hPAH-hI1C-032.1

[0188] Eight variants of the pHMIA-hPAH-hI1C-032.1 vector have been designed to improve the expression of the PAH gene locus. These variants, named pHMIA-hPAH-hI1C-032.2 to pHMIA-hPAH-hI1C-032.9, differ from pHMIA-hPAH-hI1C-032.1 only in the 5' homology arm. The sequences of the different elements are set forth in Table 4.

TABLE-US-00004 TABLE 4 Variants of the pHMIA-hPAH-hI1C-032.1 vector SEQ ID NO Correction 5' homology genome Correction arm from 5' genome from 5' Vector name (HA) HA to 3' HA ITR to 3' ITR pHMIA-hPAH-hI1C-032.2 37 47 56 pHMIA-hPAH-hI1C-032.3 38 48 57 pHMIA-hPAH-hI1C-032.4 39 49 58 pHMIA-hPAH-hI1C-032.5 40 50 59 pHMIA-hPAH-hI1C-032.6 41 51 60 pHMIA-hPAH-hI1C-032.7 42 52 61 pHMIA-hPAH-hI1C-032.8 43 53 62 pHMIA-hPAH-hI1C-032.9 44 54 63

[0189] The pHMIA-hPAH-hI1C-032.2 vector was designed to optimize the Kozak sequence for improved ribosome recruitment to the transcript. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C, G, G, G, and G at positions -2, 4, 6, 7, and 9, respectively, of the PAH gene.

[0190] The pHMIA-hPAH-hI1C-032.3 vector was designed to remove a single quadruplex in 5' UTR of the PAH gene that might suppress expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides A and A at positions -467 and -465, respectively, of the PAH gene.

[0191] The pHMIA-hPAH-hI1C-032.4 vector was designed to optimize a cyclic AMP response element to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide A at position -181 of the PAH gene.

[0192] The pHMIA-hPAH-hI1C-032.5 vector was designed to optimize two cyclic AMP response elements to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides G, C, A, and A at positions -214, -212, -211, and -181, respectively, of the PAH gene.

[0193] The pHMIA-hPAH-hI1C-032.6 vector was designed to incorporate the minor allele of SNP rs1522295, which correlates with altered PAH expression in humans. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide G at position 194 of the PAH gene.

[0194] The pHMIA-hPAH-hI1C-032.7 vector was designed to optimize a glucocorticoid binding site in the 5' UTR to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C and C at positions -433 and -432, respectively, of the PAH gene.

[0195] The pHMIA-hPAH-hI1C-032.8 vector was designed to modify two glucocorticoid binding sites and a single AP2 binding site for improved expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C and C at positions -433 and -432, respectively, of the PAH gene, and having the nucleotide sequence ACGCTGTTCTTCGCC (SEQ ID NO: 68) at positions -394 to -388 of the PAH gene.

[0196] The pHMIA-hPAH-hI1C-032.9 vector was designed to disrupt three G-quadruplexes in the 5' UTR that might suppress expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide A at each of the nucleotide positions -467, -465, -341, -339, --225, -211, and -203 of the PAH gene.

Example 3: In Vitro Human PAH Gene Editing

[0197] This example provides an in vitro method for examining PAH correction vectors, such as those described in the previous examples.

[0198] PAH correction vector pHMI-hPAH-hA-002, a variant of pHMI-hPAH-hAC-008 wherein the PAH coding sequence is wild-type (i.e., not silently altered), and PAH correction vector pHMI-hPAH-h1-001, a variant of pHMI-hPAH-h1C-007 wherein the PAH coding sequence is wild-type (i.e., not silently altered), were examined for assessment of targeted integration. K562 cells were transduced with the pHMI-hPAH-hA-002 vector packaged in AAVHSC17 at an MOI of 150,000. The genomic DNA of the cells was collected after 48 hours. Single biotinylated primers with the sequences ccaaatcccaccagctcact (SEQ ID NO: 89) and tcccatgaaactgaggtgtga (SEQ ID NO: 90), each located outside the homology arms, were separately used to amplify the DNA samples by linear amplification. Both the edited and unedited alleles were amplified without bias. The amplified DNA samples were pooled and enriched by streptavidin pulldown. The number of alleles with pHMI-hPAH-hA-002 integration was measured by ddPCR using the PAH_Genomic Set 1 primer/probe set.

[0199] As shown in FIG. 3A, left panel ("LAM-Enriched"), the desired integration was detected in a sample from cells transduced with the pHMI-hPAH-hA-002 vector ("R1 ATG"), but not detected in samples from cells transduced with the pHMI-hPAH-h1-001 vector ("R1 Intron") or untransduced cells ("R1 WT"). In the right panel of FIG. 3A ("Amplicon"), the amount of vector integration was measured by ddPCR using the SV40_FAM Set 1 primer/probe set. Positive signals were detected in samples from both the cells transduced with the pHMI-hPAH-hA-002 vector ("T001 Frag") and the cells transduced with the pHMI-hPAH-h1-001 vector ("T002 Frag"), indicating that both cells underwent vector integration.

[0200] To quantify the targeted integration, three sets of primers and probes, as shown in Table 6, were designed for detection the integration by ddPCR. PAH_Genomic Set 1 detected the unedited genome and the edited genome after the targeted integration of pHMI-hPAH-hA-002. SV40_FAM Set 1 detected a sequence in the SV40 polyadenylation sequence, which was present in the edited genome and the unintegrated vectors. PAH_HA Set 1 detected a region in the homology arm, which was present in both edited and unedited genomes, as well as in the unintegrated vectors.

[0201] DNA samples were partitioned into oil droplets. The concentration of DNA was optimized to a concentration of 600 pg per 20 .mu.L in order to significantly reduce the probability that one oil droplet randomly contains two DNA molecules (e.g., a vector particle and a genomic DNA particle) (p<0.001). The quantity of DNA identified by PAH_Genomic Set 1 (Quantity_genome) represented the total amount of unedited and edited genomes. The quantity of DNA identified by SV40_FAM Set 1 (Quantity_payload) represented the total amount of edited genomes and unintegrated vectors. The quantity of DNA identified by PAH_HA Set 1 (Quantity_HA) represented the total amount of unedited genomes, edited genomes, and unintegrated vectors. Thus, the quantity of edited genome can be calculated by the follow formula: Quantity_genome+Quantity_payload-Quantity_HA. The fraction of genome having the correct integration can be calculated as the quantity of edited genome divided by Quantity_genome.

TABLE-US-00005 TABLE 5 Primers and probes for quantifying integration of human PAH into the human genome Primer or Probe Sequence SEQ ID NO PAH_Genomic Set 1, primer F GCTCCATCCTGCACATAGTT 91 PAH_Genomic Set 1, primer R CCTATGCTTTCCTGATGAGATCC 92 PAH_Genomic Set 1, probe TTGGTGCTGCTGGCAATACGGTC 93 SV40_FAM Set 1, primer F GCAATAGCATCACAAATTTCAC 94 SV40_FAM Set 1, primer R GATCCAGACATGATAAGATACATTG 95 SV40_FAM Set 1, probe TCACTGCATTCTAGTTGTGGTTTGTCCA 96 PAH_HA Set 1, primer F TCCAGTCACCAGACAGTTAGT 97 PAH_HA Set 1, primer R GGAGAGAAATGGAGCAAGTGAA 98 PAH_HA Set 1, probe ACAGCCTATATTTCACCATGCTGATCCC 99

[0202] As shown in FIG. 3B, the percentage of genome having the correct integration of the pHMI-hPAH-hA-002 vector, as measured by the above primer/probe sets, was 17.86%. No integration was detected in the control cells which were not transduced with the pHMI-hPAH-hA-002 vector.

Example 4: In Vivo PAH Gene Editing in Mouse Liver

[0203] This example provides animal models for examining PAH correction vectors that are capable of editing mouse PAH gene, and determining their editing efficiency in mouse liver.

a) Editing of the Mouse PAH Gene in Wild-Type Mice

[0204] In a specific example, provided herein is in vivo editing of the mouse genome using the pHMI-hPAH-mAC-006 vector. The pHMI-hPAH-mAC-006 vector was similar to the pHMI-hPAH-hAC-008 vector, but was capable of editing the mouse PAH gene rather than the human PAH gene (FIG. 4A). Specifically, pHMI-hPAH-mAC-006 comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 6. The 5' homology arm comprised the wild-type genomic sequence upstream from and including the mouse PAH start codon, and thus had the ability to correct mutations in the start codon and/or 5' untranslated region (UTR) of the mouse PAH gene. The 3' homology arm comprised the wild-type genomic sequence downstream from the start codon of mouse PAH. Integration of the PAH correction vector pHMI-hPAH-mAC-006 into the mouse genome could insert the silently altered human PAH coding sequence, the SV40 polyadenylation sequence, and the targeted integration restriction cassette at the start codon of the mouse PAH gene (i.e., replacing nucleotides 1-3 of the mouse PAH gene), thereby expressing a wild-type human PAH protein in a mouse cell. The vector alone did not include a promoter sequence, and could not drive independent PAH expression without genomic integration.

TABLE-US-00006 TABLE 6 Genetic elements in PAH correction vector pHMI-hPAH-mAC-006 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 100 Silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 targeted integration restriction cassette 71 3' homology arm 101 3' ITR element 19

[0205] The pHMI-hPAH-mAC-006 vector was packaged in AAVHSC17 capsid and injected to two wild-type neonatal mice intravenously via the tail vein at a dose of 2.times.10.sup.13 vector genomes per kg of body weight. Two control mice received saline injection via the tail vein. Liver samples were collected after 2 weeks.

[0206] A PCR method was developed to detect the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome. As shown in FIG. 4B, a first pair of primers (SEQ ID NOs: 62 and 63) were designed to amplify an 867 bp DNA from an unedited allele ("Control PCR"); a second pair of primers (SEQ ID NOs: 64 and 65) were designed to specifically amplify a 2459 bp DNA from an edited allele ("Edited Allele PCR"). As shown in FIG. 4C, a liver sample from a saline treated mouse and a cell sample of 3T3 mouse fibroblasts did not generate the PCR product corresponding to the edited allele, whereas the liver samples from the two mice injected with the pHMI-hPAH-mAC-006 vector generated the PCR product corresponding to the edited allele. All four samples generated similar levels of the PCR product corresponding to the unedited allele, suggesting that the samples were comparable in quality.

[0207] A ddPCR method was developed to quantify the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome. Two sets of primers and probes, as shown in Table 7, were designed for detection the integration by ddPCR. mPAH_ATG_gDNA_FAM Set 1 detected the unedited genome and the edited genome after the targeted integration of pHMI-hPAH-mAC-006. SV40_FAM Set 1 detected a sequence in the SV40 polyadenylation sequence, which was present in the edited genome and the unintegrated vectors (FIG. 5A).

[0208] DNA samples were partitioned into oil droplets. The concentration of DNA was optimized to 600 pg per 20 .mu.L in order to significantly reduce the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle (p<0.001) (FIGS. 5C and 5D). Upon integration of the vector into the genome, the rate of double positivity of the vector probe and the locus probe in the same droplet increases (FIG. 5B). As shown in FIG. 5E, the two control mice had 0% and 0.0395% edited alleles in the liver, respectively, and the two mice treated with the pHMI-hPAH-mAC-006 vector had 2.504% and 2.783% edited alleles in the liver, respectively. Thus, the overall integration efficiency of the pHMI-hPAH-mAC-006 vector in the liver under the given conditions was about 2.6%. The integration efficiency for each individual cell is expected to be higher, because not all cells were transduced with the vector.

TABLE-US-00007 TABLE 7 Primers and probes for quantifying integration of human PAH into the mouse genome SEQ ID Primer or Probe Sequence NO mPAH_ATG_gDNA_FAM CAGCATCAGAAGCAGAACATTT 102 Set 1, primer F mPAH_ATG_gDNA_FAM AAAGCACATCAGCAGTTTCAA 103 Set 1, primer R mPAH_ATG_gDNA_FAM AGATGAAAGCAACTGAACATCGACTACGA 104 Set 1, probe SV40_FAM Set 1, primer F GCAATAGCATCACAAATTTCAC 105 SV40_FAM Set 1, primer R GATCCAGACATGATAAGATACATTG 106 SV40_FAM Set 1, probe TCACTGCATTCTAGTTGTGGTTTGTCCA 107 mPah_1C_LHA_FAM Set 3, gcaagctccagatcaccaata 108 primer F mPah_1C_LHA_FAM Set 3, ctgagcaatgcattcagcaataa 109 primer R mPah_1C_LHA_FAM Set 3, CCCTGAACATCCCTTGACAGAGCA 110 probe

[0209] The relative quantity of the mRNA expressed from the edited allele was determined by ddPCR. SV40_FAM Set 1 was used to specifically detect human PAH expression from the edited allele. Each PAH expression level was normalized to the expression level of endogenous Hprt. As shown in FIG. 6, control mice showed no expression of human PAH, suggesting that the primers and probe did not cross react with the endogenous mouse PAH. The percent PAH expression relative to wild-type levels was calculated based on the human PAH signal relative to Hprt normalized against the endogenous mouse PAH signal relative to Hprt. The two mice treated with the pHMI-hPAH-mAC-006 vector had 5.378% and 4.846% mRNA levels relative to the endogenous mouse PAH levels, respectively. Thus, the overall mRNA level of the pHMI-hPAH-mAC-006 vector in the liver under the given conditions was about 5%. The mRNA level for each individual cell is expected to be higher, because not all cells were transduced with the vector.

b) Editing of the Mouse pah Gene in Pah Knockout Mice

[0210] In one experiment, the efficacy of the pHMI-hPAH-mAC-006 vector in phenotypic correction was determined using a PAH knock-out mouse model (PAH.sup.ENU2). Briefly, the hPAH-mAC-006 vector packaged in AAVHSC15 capsids was administered intravenously, in 5 consecutive days, to these mice at a dose of 1.16.times.10.sup.14 vector genomes per kilogram of body weight. Serum phenylalanine (Phe) was measured weekly for 5 months by mass spectrometry. After 5 months, DNA was extracted from liver samples, and the numbers of vector genomes per cell were analyzed by ddPCR using primer and probe sets to measure the vector and the human PAH genomic locus copy numbers.

[0211] Transduction efficiency (measured in number of vector genomes per cell ("VG per Cell")) was the determined by ddPCR using primer and probe sets to measure the vector, and the mouse and human PAH genomic loci copy numbers. Editing frequency was measured by multiplexed ddPCR using primer probe sets to measure the frequency of the editing element DNA from the AAV vector ("payload") integrated into the mouse PAH locus and the human PAH locus. Briefly, single DNA strands were partitioned into oil droplets. Each droplet was tested for the presence of either human or mouse PAH DNA along with the presence or absence of the payload. Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.

[0212] The PAH knock-out mice had a phenotype of increased phenylalanine (Phe) levels in the blood. To examine phenotypic changes, the serum levels of Phe after administration of the AAV vectors were measured, the percentage levels were calculated relative to the baseline at time zero, and the percentage levels were compared to the control mice that did not receive the AAV vectors.

[0213] The mice administered the hPAH-mAC-006 vector packaged in AAVHSC15 capsids showed a transduction efficiency of about 8 to 18 vector genomes per cell (FIG. 7A), and an average editing efficiency of about 4.4% relative to the number of alleles (FIG. 7B). This editing efficiency supported an expression level of PAH sufficient to reduce Phe levels in the serum of the mice by about 50% for at least 5 months (FIGS. 7C and 7D), and the phenotypic changes correlated with the editing efficiency (FIG. 7E). The correct homologous recombination of the vector at the Pah locus was verified by the length of the PCR product amplified from the edited genomic locus using a first primer that hybridized to the payload, and a second primer that hybridized to a genomic sequence downstream from the right homology arm (data not shown).

[0214] To determine whether the homologous recombination introduced any genomic alterations into the edited alleles, the DNA sequences in the genomic regions corresponding to the homology arms were further analyzed by deep sequencing (Illumina). The samples all had high quality sequence reads, and all the positions were sequenced with a depth of over 20,000 reads. Insertions and deletions (hereinafter "indels") were identified by Somatic Variant Callers with an indel quality filter and a strand bias filter. Specifically, a region in the right homology arm comprising 10 continuous G showed an elevated indel rate of about 0.02-0.05% in both control and treated animals. Indels at this locus, as well as several other loci, did not pass filters for bona fide changes, and were removed from further analysis. As shown in Table 8, the untreated control animals showed an indel rate of 0.002-0.006%. Treated animal 1 had an indel rate of 0.031%; treated animal 2 had no indels that passed the filters; treated animal 3 had an indel rate similar to those of the control animals. All the indels identified were located in untranslated regions.

TABLE-US-00008 TABLE 8 Deep sequencing data for individual animals Accumulative Average Number of mutations Total depth mutations passing Animal reads per base passing filter filter in % Control animal 1 4,218,356 341,291 1 0.002% Control animal 2 5,599,928 453,069 2 0.006% Treated animal 1 4,785,826 387,203 9 0.031% Treated animal 2 3,353,288 271,302 0 0.000% Treated animal 3 9,514,938 769,817 9 0.006%

[0215] The results above demonstrated the feasibility of reversing the phenotypes of PAH deficiency using correction vectors that insert a PAH coding sequence in a genome.

[0216] To detect expression of human PAH in individual mouse hepatocytes after the in vivo transduction, RNA in situ hybridization (ISH) was performed on liver tissue sections using a probe specific to >1 kb of the human PAH RNA having the silent codon alteration as described above (Advanced Cell Diagnostics, Inc., Hayward, Calif.). As shown in FIG. 7F, this probe detected human PAH RNA and possibly virus DNA comprising PAH sequence in mouse hepatocytes transduced with the hPAH-mAC-006 vector, but did not cross-hybridize to endogenous mouse Pah RNA. A liver sample of a mouse transduced with a transgene construct comprising a CMV promoter driving the expression of a human Pah RNA having the same silent codon alteration was used as a positive control.

c) PAH Correction Vector pHMI-hPAH-mAC-006

[0217] The pHMI-hPAH-mAC-006 vector comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 9.

TABLE-US-00009 TABLE 9 Genetic elements in PAH correction vector pHMI-hPAH-mAC-006 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 111 Silently altered human PAH 25 coding sequence SV40 polyadenylation sequence 31 Targeted integration restriction 71 cassette 3' homology arm 112 3' ITR element 19 correction genome (5' HA to 3' 113 HA) correction genome (5' ITR to 3' 114 ITR)

d) PAH Gene Editing Efficiency in Mice Administered pHMI-hPAH-mAC-006

[0218] FIG. 9A depicts a schematic of the assay used to determine editing efficiency of the PAH gene in mice that received the pHMI-hPAH-mAC-006 vector. ddPCR and LAM-NGS (LAM-PCR followed by next generation sequencing (NGS)) was performed as described herein and as indicated in FIG. 9A. FIG. 9B shows a graph of PAH gene editing efficiency as determined in cells of mice administered either the pHMI-hPAH-mAC-006 vector or vehicle control. As shown in FIG. 9B, PAH gene editing efficiency in mice administered the HMI-hPAH-mAC-006 vector was determined to be about 8% relative to the number of alleles. No errors were detected in the edited regions.

e) Durable Phenotypic Correction of Hyperphenylalaninemia in Mouse Models

[0219] In one experiment, the efficacy of the pHMI-hPAH-mAC-006 vector in phenotypic correction was determined using a PAH knock-out mouse model (PAH.sup.ENU2). The pHMI-hPAH-mAC-006 vector was packaged in AAVHSC15 capsids and administered intravenously to mice at a dose of 1.times.10.sup.14 vector genomes per kilogram of body weight. To examine phenotypic changes, the serum levels of phenylalanine (Phe) and tyrosine (Tyr) after administration of the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids was measured weekly beyond 7 weeks, the percentage levels were calculated relative to the baseline at time zero, and the percentage levels were compared to the control mice that received a vehicle control. A total of 4 mice were administered the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids, and 2 mice were administered vehicle control. As shown in FIG. 10, a significant reduction in serum levels of Phe (FIG. 10A; * indicates p<0.0001 by repeated measures 2-way ANOVA vs vehicle; p<0.0001 by repeated measures 2-way ANOVA vs time) and a significant increase in serum levels of Tyr (FIG. 10B; * indicates p<0.05 by repeated measures 2-way ANOVA vs vehicle; p<0.0003 by repeated measures 2-way ANOVA vs time) were observed in mice that received the vector. FIG. 10C shows the ratio between serum Phe and serum Tyr in mice that received the vector or a vehicle control (* indicates p<0.002 by repeated measures 2-way ANOVA vs vehicle; p<0.0004 by repeated measures 2-way ANOVA vs time).

[0220] FIG. 11A depicts a graph showing the PAH gene editing efficiency and transduction efficiency of cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector or a vehicle control. The left y-axis of FIG. 11A indicates the percentage of editing efficiency and shows that mice administered the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had about 5% editing efficiency relative to the number of alleles. The right y-axis of FIG. 11A indicates the number of vector genomes per cell and shows that mice administered the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had a transduction efficiency of about 140 vector genomes per cell.

[0221] FIG. 11B depicts a graph showing the relative quantity of PAH mRNA expressed, normalized to the expression level of mouse GAPDH, of cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) or a vehicle control. As shown, cells obtained from mice administered the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had significant levels of human PAH mRNA, as compared mice administered a vehicle control (* indicates p<0.005 by two-tailed Mann Whitney test vs vehicle).

Example 5: In Vivo Editing of the Human PAH Gene in a Mouse Model

[0222] This example provides animal models for examining PAH correction vectors, such as those described in the previous examples, in the editing of the human PAH gene in a mouse model.

a) Editing of Human PAH in Human Blood Cells in a Mouse Model

[0223] Briefly, NOD.Cg-Prkdc.sup.scidI12rg.sup.tan tWj1/SzJ (NSG) mice were myeloblated through sublethal irradiation, and transplanted with human CD34.sup.+ hematopoietic stem cells. Engraftment levels were determined after 12 weeks by identifying the amounts of human and murine CD45.sup.+ cells in the peripheral blood by flow cytometry, and the mice having more than 50% of circulating human CD45.sup.+ cells were selected. The hPAH-hAC-008 vector packaged with the AAVHSC17 capsid was administered intravenously to 12 such mice divided equally into four groups. The first and second groups of mice received a dose of 1.54.times.10.sup.13 vector genomes per kilogram of body weight, and the third and fourth groups received a dose of 2.1.times.10.sup.12 vector genomes per kilogram of body weight. The mice were euthanized 6 weeks after the injections. Samples of blood, bone marrow and spleen tissues were collected, and genomic DNA was extracted.

[0224] Editing frequency in mouse and human cells were measured by multiplexed droplet digital PCR (ddPCR) using primer probe sets to measure the frequency of the integrated DNA from the AAV vector ("payload") integrating into the mouse PAH locus and the human PAH locus. In short, single DNA strands were partitioned into oil droplets. Each droplet was tested for the presence of either human or mouse PAH DNA along with the presence or absence of the payload. Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.

[0225] As shown in Table 10, editing of human cells was detected in bone marrow samples in a dose-dependent manner. Notably, editing was specific to human genome, as no editing was detected in mouse cells.

TABLE-US-00010 TABLE 10 Editing efficiencies of hPAH-hAC-008 in mouse tissues % Editing in % Editing % Editing Group bone marrow in spleen in blood 1 0.16 0.0 0.0 2 0.25 0.01 0.0 3 0.09 0.09 0.0 4 0.02 0.013 0.001

[0226] FIG. 8A shows the transduction efficiency of the hPAH-hAC-008 vector and hPAH-hAC-008-HBB vector in human and mouse hepatocytes in mice administered with the vector packaged in AAVHSC15 capsids.

b) Editing of Human PAH in Human Hepatocytes in a Mouse Model Using a Vector Comprising an HBB Intron

[0227] The hPAH-hAC-008 vector comprises a complete human PAH coding sequence without any intron. A modified vector hPAH-hAC-008-HBB, wherein the first intron of the human HBB gene (having the nucleotide sequence of SEQ ID NO: 28) is added between nucleotides 912 and 913 of the human PAH coding sequence, was generated for improving the nuclear export and stability of RNA molecules transcribed from the vector. The internucleotide bond between nucleotides 912 and 913 corresponds to the splicing site between exon 8 and exon 9 of the native PAH gene, which was not disrupted by the silent alteration of the codons.

[0228] The vectors were packages with AAVHSC15 capsids, and were administered into mice intravenously at a dose of 1.times.10.sup.13 vector genomes per kilogram of body weight. Six weeks after the administration, liver samples were collected, and the localization of the silently altered human PAH mRNA and possibly virus DNA comprising PAH sequence was examined by in situ hybridization. As shown in FIG. 8B, the addition of the HBB intron substantially improved the nuclear export of the mRNA. This result demonstrated that addition of an intron in the PAH coding sequence could potentially increase the expression level of the PAH gene, and this feature can be included in the design of PAH correction vectors.

c) Editing of Human PAH in Human Hepatocytes in a Mouse Model

[0229] Briefly, Fah.sup.-/- Rag2.sup.-/- I12rg.sup.-/- mice on the C57B1/6 background, commonly referred to as the FRG.RTM. Knockout mice, were used as a model for liver humanization. The mice were immunodeficient and lacked the tyrosine catabolic enzyme fumarylacetoacetate hydrolase (Fah). Ablation of mouse hepatocytes was induced by the withdrawal of the protective drug 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC). The mice were then engrafted with human hepatocytes, and a urokinase-expressing adenovirus was administered to enhance repopulation of the human hepatocytes. Engraftment was sustained over the life of the animal with an appropriate regimen of CuRx.TM. Nitisinone (20-0026) and prophylactic treatment of SMX/TMP antibiotics (20-0037). The animals weighed 22 grams on average and had a typical lifespan of 18-24 months.

[0230] The hPAH-hAC-008 or hPAH-hAC-008-HBB vector was packaged with AAVHSC15 capsids, and was administered into mice intravenously at a dose of 1.times.10.sup.13 vector genomes per kilogram of body weight. Six weeks after the administration, liver samples were collected, the human and mouse hepatocytes were separated and purified using Miltenyi autoMACS columns following liver perfusion. DNA was extracted, and the efficiency of gene editing was measured using the same ddPCR method as described above.

[0231] As shown in FIG. 8C, the percentage editing efficiency in human hepatocytes, measured as the percentage of edited alleles out of all alleles, was 2.2% in an animal treated with the hPAH-hAC-008 vector, and 4.3% in an animal treated with the hPAH-hAC-008-HBB vector. Editing was not detected in mouse hepatocytes from either animal. The lack of detection of editing in mouse hepatocytes from either animal is unlikely to be due to lack of transduction efficiency as mouse hepatocytes were transduced well (FIG. 8A). In a separate experiment, editing of the human genome by the hPAH-hAC-008 vector was detected at a rate of 2.131% relative to the number of alleles of human genome, whereas editing of the mouse genome in the liver sample was detected at a rate of 0.05% relative to the number of alleles of mouse genome. These results showed human-specific editing of the PAH gene by the hPAH-hAC-008 vector or a modified version thereof, and provided an in vivo model for examining the editing efficiency in hepatocytes.

d) Editing of Human PAH in Human Hepatocytes in a Mouse Model

[0232] In one experiment, Fah.sup.-/- Rag2.sup.-/- I12rg.sup.-/- mice on the C57B1/6 background, commonly referred to as the FRG.RTM. Knockout mice (also referred to herein as HuLiv mice), were used as a model for liver humanization, as described above (see FIG. 12A).

[0233] The pHMIK-hPAH-hI1C-032 vector comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a splicing acceptor, a 2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 11.

TABLE-US-00011 TABLE 11 Genetic elements in PAH correction vector pHMIK-hPAH-hI1C-032 Genetic Element SEQ ID NO 5' ITR element 18 5' homology arm 115 Splice acceptor 14 2A element 74 Silently altered human PAH coding sequence 116 SV40 polyadenylation sequence 31 3' homology arm 117 3' ITR element 19 Correction genome (5' HA to 3' HA) 118 Correction genome (5' ITR to 3' ITR) 119

[0234] The pHMIK-hPAH-hI1C-032 vector was packaged with AAVHSC15 capsids, and was administered into mice intravenously at a dose of 1.times.10.sup.14 vector genomes per kilogram of body weight. Liver samples from 3 mice that received the pHMIK-hPAH-hI1C-032 vector packaged with AAVHSC15 capsids were collected, the human and mouse hepatocytes were separated and purified, and DNA was extracted. The efficiency of gene editing was measured using the same ddPCR method as described above.

[0235] The durability of PAH gene editing in human hepatocytes was measured by determining the percentage of edited alleles out of all alleles in cells obtained from treated mice 1 week and 6 weeks post-administration of vector. As shown in FIG. 12B, about 4% PAH gene editing was measured in cells obtained from mice 1 week after administration of the vector, and about 7% editing was measured in cells obtained from mice 6 weeks after administration of the vector.

[0236] Genome editing mediated by the pHMIK-hPAH-hI1C-032 vector was found to be specific for human hepatocytes in the HuLiv mice. As shown in FIG. 13, at 1 week after administration of the vector, PAH gene editing (as determined by ddPCR and NGS) was detected at a rate of about 3% to 3.5% relative to the number of alleles of human genome, whereas editing of the mouse genome in the liver sample was close to 0% relative to the number of alleles of mouse genome. At 6 weeks after administration of the vector, editing was detected at a rate of about 5% to 6.5% relative to the number of alleles of human genome. * indicates p<0.0025 compared to mouse values.

[0237] Further, the pHMIK-hPAH-hI1C-032 vector was found to be ineffective in non-human cells. As shown in FIG. 14, when PAH knock-out mouse (PAH.sup.ENu2) mice were administered intravenously the pHMIK-hPAH-hI1C-032 vector (hPAH-032) packaged with AAVHSC15 capsids at a dose of 1.times.10'' vector genomes per kilogram of body weight, the level of serum phenylalanine was similar to that of mice administered a control up to 3 weeks post-injection. In contrast, mice administered the pHMI-hPAH-mAC-006 vector (mPAH-006) showed reduction in serum Phe levels as soon as 1 week post-injection.

[0238] FIG. 15A shows the relationship between human PAH expression and serum Phe levels. As shown, in data gleaned from experiments using the pHMI-hPAH-mAC-006 vector in PAH.sup.ENU2 mice, 10% of human PAH expression corrects the phenotype in PAH.sup.ENU2 mice. Thus, 10% of human PAH expression relative to endogenous levels was determined to be the level required to correct phenylalaninemia (e.g., a therapeutic level).

[0239] Therapeutic levels of expression were detected with the pHMIK-hPAH-hI1C-032 vector. Human PAH expression in human hepatocytes was measured relative to human GAPDH in HuLiv mice administered the pHMIK-hPAH-hI1C-032 vector (hPAH-032) at a dose of 1.times.10.sup.14 vector genomes per kilogram of body weight. As shown in FIG. 15B, using two different expression probes to measure expression of human PAH in two different HuLiv mice treated with the vector, human PAH expression was determined to be greater than 10% in human hepatocytes. The PAH gene editing range in human hepatocytes of HuLiv mice administered the vector was measured to be about 5% to about 11% in 13 different mice across 3 different experiments.

[0240] The pHMIK-hPAH-hI1C-032 vector was found to target human PAH gene and resulted in corrected levels of edited mRNA in HuLiv mice. The PAH mRNA level required for phenotypic correction was first established in a murine model (using the PAH knock-out mouse model (PAH.sup.ENU2)). This was determined to be about 10% of PAH expression relative to endogenous levels (see FIG. 15A). As shown in FIG. 16, human PAH gene expression relative to GAPDH expression was determined to be about 44.9% (left), and mouse PAH gene expression relative to GAPDH expression was determined to be about 39.7% (right).

Example 6: Human PAH Correction Vectors

[0241] This example provides the human PAH correction vectors pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, pKITR-hPAH-mAC-006-SD.3, pHMIA2-hPAH-hI1C-032-SD.3, and pHMIA2-hPAH-mAC-006-HBB1. Schematics of the vectors are depicted in FIGS. 17A, 17B, 17C, 17D, and 17E, respectively.

a) pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, and pHMIA2-hPAH-mAC-006-HBB1

[0242] Vectors pKITR-hPAH-mAC-006-HCR and pKITR-hPAH-hI1C-032-HCR were generated by inserting an HCR intron into the PAH coding sequence. Vector pHMIA2-hPAH-mAC-006-HBB1 was generated by inserting an HBB1 intron into the PAH coding sequence. The HCR and HBB1 introns were selected based on their performance in intron screening experiments using a luciferase reporter to determine introns that exhibit high expression in liver and blood cell lines. The introns used in the screen are set forth in Table 12.

TABLE-US-00012 TABLE 12 Intron sequences used in luciferase reporter screen Intron SEQ ID NO Chimeric MVM Intron (ChiMVM) 120 SV40 Intron 121 Adenovirus Tripartite Leader 122 Intron (AdTPL) Mini B-Globin Intron 123 AdV/Ig Chimeric Intron (AdVIgG) 124 B-Globin Ig Heavy Chain Intron (BGlobinIg) 125 Wu MVM Intron (Wu MVM) 126 HCR1 Intron (OptHCR) 127 B-Globin Intron 128 tFIX Intron (FIX) 129 ch2BLood Intron (BloodEnh) 130

[0243] pKITR-hPAH-mAC-006-HCR comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence with HCR intron inserted therein, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. pKITR-hPAH-hI1C-032-HCR comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a splice acceptor, a 2A element, a silently altered human PAH coding sequence with HCR intron inserted therein, an SV40 polyadenylation sequence, a 3' homology arm, and a 3' ITR element. pHMIA2-hPAH-mAC-006-HBB1 comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence with HBB intron inserted therein, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 13.

TABLE-US-00013 TABLE 13 Genetic elements in PAH correction vectors pKITR-hPAH- mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, and pHMI42- hPAH-mAC-006-HBB1 SEQ ID NO Genetic Element -006-HCR -032-HCR -006-HBB1 5' ITR element 18 18 18 5' homology arm 111 115 142 Splice acceptor N/A 14 N/A 2A element N/A 74 N/A Human PAH coding sequence 131 132 143 SV40 polyadenylation sequence 31 31 31 Targeted integration restriction 71 N/A 71 cassette 3' homology arm 112 117 144 3' ITR element 19 19 19 Correction genome (5' HA to 3' 134 136 145 HA) Correction genome (5' ITR to 3' 135 137 146 ITR)

b) pKITR-hPAH-mAC-006-SD.3 and pHMIA2-hPAH-hI1C-032-SD.3

[0244] Vectors pKITR-hPAH-mAC-006-SD.3 and pHMIA2-hPAH-hI1C-032-SD.3 were generated by modifying a splice donor site. The splice donor was modified as indicated in FIGS. 17C and 17D, respectively. pKITR-hPAH-mAC-006-SD.3 comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a silently altered human PAH coding sequence with splice donor modification, an SV40 polyadenylation sequence, a targeted integration restriction cassette ("TI RE"), a 3' homology arm, and a 3' ITR element. pHMIA2-hPAH-hI1C-032-SD.3 comprised 5' to 3' the following genetic elements: a 5' ITR element, a 5' homology arm, a splicing acceptor, a 2A element, a silently altered human PAH coding sequence with splice donor modification, an SV40 polyadenylation sequence, a 3' homology arm, and a 3' ITR element. The sequences of these elements are set forth in Table 14.

TABLE-US-00014 TABLE 14 Genetic elements in PAH correction vectors pKITR-hPAH- mAC-006-SD.3 and pHMI42-hPAH-hI1C-032-SD.3 SEQ ID NO Genetic Element -006-SD.3 -032-SD.3 5' ITR element 18 18 5' homology arm 111 115 Splice acceptor N/A 14 2A element N/A 74 Human PAH coding sequence 138 139 SV40 polyadenylation sequence 31 31 Targeted integration restriction 71 N/A cassette 3' homology arm 112 117 3' ITR element 19 19

[0245] The invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[0246] All references (e.g., publications or patents or patent applications) cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual reference (e.g., publication or patent or patent application) was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Other embodiments are within the following claims.

Sequence CWU 1

1

1531736PRTArtificial Sequenceadeno-associated AAV9 1Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7352736PRTArtificial Sequencenovel AAV isolate 2Met Thr Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Gln Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7353736PRTArtificial Sequencenovel AAV isolate 3Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Gly Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Gly Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7354736PRTArtificial Sequencenovel AAV isolate 4Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Ile Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230

235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Tyr Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7355736PRTArtificial Sequencenovel AAV isolate 5Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Asp145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7356736PRTArtificial Sequencenovel AAV isolate 6Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Leu Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Ser Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7357736PRTArtificial Sequencenovel AAV isolate 7Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470

475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Arg Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7358736PRTArtificial Sequencenovel AAV isolate 8Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Val Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7359736PRTArtificial Sequencenovel AAV isolate 9Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Arg Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73510736PRTArtificial Sequencenovel AAV isolate 10Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Cys Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715

720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73511736PRTArtificial Sequencenovel AAV isolate 11Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Arg Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Lys Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73512736PRTArtificial Sequencenovel AAV isolate 12Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro His Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Asn 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Arg Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Met Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73513736PRTArtificial Sequencenovel AAV isolate 13Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Arg Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 7351426DNAArtificial Sequencesplice acceptor 14ctgacctctt ctcttcctcc cacagg 2615736PRTArtificial Sequencenovel AAV isolate 15Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly

Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Arg Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Arg Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73516736PRTArtificial Sequencenovel AAV isolate 16Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Ala Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Arg Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73517736PRTArtificial Sequencenovel AAV isolate 17Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495Asn Asn Ser Glu Ile Ala Trp Pro Arg Ala Ser Ser Trp Ala Leu Asn 500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635 640Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700Tyr Cys Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715 720Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 73518145DNAArtificial SequenceAAV2 5' ITR 18ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcct 14519145DNAArtificial SequenceAAV2 3' ITR 19aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120gagcgcgcag agagggagtg gccaa 14520167DNAArtificial SequenceAAV5 5' ITR 20ctctcccccc tgtcgcgttc gctcgctcgc tggctcgttt gggggggtgg cagctcaaag 60agctgccaga cgacggccct ctggccgtcg cccccccaaa cgagccagcg agcgagcgaa 120cgcgacaggg gggagagtgc cacactctca agcaaggggg ttttgta 16721167DNAArtificial SequenceAAV5 3' ITR 21tacaaaacct ccttgcttga gagtgtggca ctctcccccc tgtcgcgttc gctcgctcgc 60tggctcgttt gggggggtgg cagctcaaag agctgccaga cgacggccct ctggccgtcg 120cccccccaaa cgagccagcg agcgagcgaa cgcgacaggg gggagag 16722621PRTArtificial SequenceAAV2 Rep 22Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp1 5 10 15Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu 20 25 30Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile 35 40 45Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu 50 55 60Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val65 70 75 80Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu 85 90 95Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile 100 105 110Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu 115 120 125Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly 130 135 140Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys145 150 155 160Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu 165 170 175Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His 180 185 190Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn 195 200 205Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr 210 215 220Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys225 230 235 240Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala 245 250 255Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys 260 265 270Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln 275 280 285Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu 290 295

300Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala305 310 315 320Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala 325 330 335Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro 340 345 350Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp 355 360 365Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala 370 375 380Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg385 390 395 400Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val 405 410 415Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser 420 425 430Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe 435 440 445Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln 450 455 460Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val465 470 475 480Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala 485 490 495Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val 500 505 510Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp 515 520 525Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu 530 535 540Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Ser Asn Ile Cys545 550 555 560Phe Thr His Gly Gln Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu 565 570 575Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr 580 585 590Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp 595 600 605Leu Val Asn Val Asp Leu Asp Asp Cys Ile Phe Glu Gln 610 615 62023452PRTHomo sapiens 23Met Ser Thr Ala Val Leu Glu Asn Pro Gly Leu Gly Arg Lys Leu Ser1 5 10 15Asp Phe Gly Gln Glu Thr Ser Tyr Ile Glu Asp Asn Cys Asn Gln Asn 20 25 30Gly Ala Ile Ser Leu Ile Phe Ser Leu Lys Glu Glu Val Gly Ala Leu 35 40 45Ala Lys Val Leu Arg Leu Phe Glu Glu Asn Asp Val Asn Leu Thr His 50 55 60Ile Glu Ser Arg Pro Ser Arg Leu Lys Lys Asp Glu Tyr Glu Phe Phe65 70 75 80Thr His Leu Asp Lys Arg Ser Leu Pro Ala Leu Thr Asn Ile Ile Lys 85 90 95Ile Leu Arg His Asp Ile Gly Ala Thr Val His Glu Leu Ser Arg Asp 100 105 110Lys Lys Lys Asp Thr Val Pro Trp Phe Pro Arg Thr Ile Gln Glu Leu 115 120 125Asp Arg Phe Ala Asn Gln Ile Leu Ser Tyr Gly Ala Glu Leu Asp Ala 130 135 140Asp His Pro Gly Phe Lys Asp Pro Val Tyr Arg Ala Arg Arg Lys Gln145 150 155 160Phe Ala Asp Ile Ala Tyr Asn Tyr Arg His Gly Gln Pro Ile Pro Arg 165 170 175Val Glu Tyr Met Glu Glu Glu Lys Lys Thr Trp Gly Thr Val Phe Lys 180 185 190Thr Leu Lys Ser Leu Tyr Lys Thr His Ala Cys Tyr Glu Tyr Asn His 195 200 205Ile Phe Pro Leu Leu Glu Lys Tyr Cys Gly Phe His Glu Asp Asn Ile 210 215 220Pro Gln Leu Glu Asp Val Ser Gln Phe Leu Gln Thr Cys Thr Gly Phe225 230 235 240Arg Leu Arg Pro Val Ala Gly Leu Leu Ser Ser Arg Asp Phe Leu Gly 245 250 255Gly Leu Ala Phe Arg Val Phe His Cys Thr Gln Tyr Ile Arg His Gly 260 265 270Ser Lys Pro Met Tyr Thr Pro Glu Pro Asp Ile Cys His Glu Leu Leu 275 280 285Gly His Val Pro Leu Phe Ser Asp Arg Ser Phe Ala Gln Phe Ser Gln 290 295 300Glu Ile Gly Leu Ala Ser Leu Gly Ala Pro Asp Glu Tyr Ile Glu Lys305 310 315 320Leu Ala Thr Ile Tyr Trp Phe Thr Val Glu Phe Gly Leu Cys Lys Gln 325 330 335Gly Asp Ser Ile Lys Ala Tyr Gly Ala Gly Leu Leu Ser Ser Phe Gly 340 345 350Glu Leu Gln Tyr Cys Leu Ser Glu Lys Pro Lys Leu Leu Pro Leu Glu 355 360 365Leu Glu Lys Thr Ala Ile Gln Asn Tyr Thr Val Thr Glu Phe Gln Pro 370 375 380Leu Tyr Tyr Val Ala Glu Ser Phe Asn Asp Ala Lys Glu Lys Val Arg385 390 395 400Asn Phe Ala Ala Thr Ile Pro Arg Pro Phe Ser Val Arg Tyr Asp Pro 405 410 415Tyr Thr Gln Arg Ile Glu Val Leu Asp Asn Thr Gln Gln Leu Lys Ile 420 425 430Leu Ala Asp Ser Ile Asn Ser Glu Ile Gly Ile Leu Cys Ser Ala Leu 435 440 445Gln Lys Ile Lys 450241359DNAHomo sapiens 24atgtccactg cggtcctgga aaacccaggc ttgggcagga aactctctga ctttggacag 60gaaacaagct atattgaaga caactgcaat caaaatggtg ccatatcact gatcttctca 120ctcaaagaag aagttggtgc attggccaaa gtattgcgct tatttgagga gaatgatgta 180aacctgaccc acattgaatc tagaccttct cgtttaaaga aagatgagta tgaatttttc 240acccatttgg ataaacgtag cctgcctgct ctgacaaaca tcatcaagat cttgaggcat 300gacattggtg ccactgtcca tgagctttca cgagataaga agaaagacac agtgccctgg 360ttcccaagaa ccattcaaga gctggacaga tttgccaatc agattctcag ctatggagcg 420gaactggatg ctgaccaccc tggttttaaa gatcctgtgt accgtgcaag acggaagcag 480tttgctgaca ttgcctacaa ctaccgccat gggcagccca tccctcgagt ggaatacatg 540gaggaagaaa agaaaacatg gggcacagtg ttcaagactc tgaagtcctt gtataaaacc 600catgcttgct atgagtacaa tcacattttt ccacttcttg aaaagtactg tggcttccat 660gaagataaca ttccccagct ggaagacgtt tctcaattcc tgcagacttg cactggtttc 720cgcctccgac ctgtggctgg cctgctttcc tctcgggatt tcttgggtgg cctggccttc 780cgagtcttcc actgcacaca gtacatcaga catggatcca agcccatgta tacccccgaa 840cctgacatct gccatgagct gttgggacat gtgcccttgt tttcagatcg cagctttgcc 900cagttttccc aggaaattgg ccttgcctct ctgggtgcac ctgatgaata cattgaaaag 960ctcgccacaa tttactggtt tactgtggag tttgggctct gcaaacaagg agactccata 1020aaggcatatg gtgctgggct cctgtcatcc tttggtgaat tacagtactg cttatcagag 1080aagccaaagc ttctccccct ggagctggag aagacagcca tccaaaatta cactgtcacg 1140gagttccagc ccctgtatta cgtggcagag agttttaatg atgccaagga gaaagtaagg 1200aactttgctg ccacaatacc tcggcccttc tcagttcgct acgacccata cacccaaagg 1260attgaggtct tggacaatac ccagcagctt aagattttgg ctgattccat taacagtgaa 1320attggaatcc tttgcagtgc cctccagaaa ataaagtaa 1359251359DNAArtificial SequenceSilently altered PAH coding sequence 25atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggagatcgg actggcatct ctgggagcac ctgacgagta catcgagaag 960ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg cgatagcatc 1020aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg tctgtccgag 1080aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta caccgtgaca 1140gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga gaaggtgaga 1200aatttcgccg ccacaatccc taggcccttc agcgtgcggt acgaccctta tacccagagg 1260atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat caatagcgaa 1320atcggaatcc tgtgctccgc cctgcagaaa atcaaatga 135926106DNAArtificial Sequencetruncated AAV2 5'ITR 26ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtgg 10627143DNAArtificial Sequencemodified AAV2 3'ITR 27aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120gagcgcgcag agagggagtg gcc 14328130DNAHomo sapiens 28gttggtatca aggttacaag acaggtttaa ggagaccaat agaaactggg catgtggaga 60cagagaagac tcttgggttt ctgataggca ctgactctct ctgcctattg gtctattttc 120ccacccttag 13029116DNAMus musculus 29gttggtatcc aggttacaag gcagctcaca agaagaagtt gggtgcttgg agacagaggt 60ctgctttcca gcagacacta actttcagtg tcccctgtct atgtttccct ttttag 1163092DNAArtificial SequenceMinute virus in mice 30aagaggtaag ggtttaaggg atggttggtt ggtggggtat taatgtttaa ttacctggag 60cacctgcctg aaatcacttt ttttcaggtt gg 9231198DNASimian virus 40 31gatccagaca tgataagata cattgatgag tttggacaaa ccacaactag aatgcagtga 60aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac cattataagc 120tgcaataaac aagttaacaa caacaattgc attcatttta tgtttcaggt tcagggggag 180gtgtgggagg ttttttaa 19832122DNASimian virus 40 32aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120ta 12233133DNASimian virus 40 33tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat 60aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg 120gaggtttttt aaa 13334135DNASimian virus 40 34gatccagaca tgataagata cattgatgag tttggacaaa ccacaactag aatgcagtga 60aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac cattataagc 120tgcaataaac aagtt 135351654DNAArtificial SequencepHMIA-hPAH-hI1C-032.1 editing element 35ctgacctctt ctcttcctcc cacagggcag cggagctact aacttcagcc tgctgaagca 60ggctggagac gtggaggaga accctggacc tatgtccacc gctgtgctgg agaaccctgg 120gctggggagg aaactgtcag acttcgggca ggagacttca tacattgagg ataactgtaa 180ccagaatggc gccatctctc tgatcttcag cctgaaggag gaagtgggcg ccctggcaaa 240ggtgctgcgc ctgtttgagg agaacgacgt gaatctgacc cacatcgagt cccggccttc 300tagactgaag aaggacgagt acgagttctt tacccacctg gataagcggt ccctgccagc 360cctgacaaac atcatcaaga tcctgaggca cgacatcgga gcaaccgtgc acgagctgtc 420tcgggacaag aagaaggata ccgtgccctg gttccctcgg acaatccagg agctggatag 480atttgccaac cagatcctgt cttacggagc agagctggac gcagatcacc ctggcttcaa 540ggacccagtg tatcgggccc ggagaaagca gtttgccgat atcgcctaca attataggca 600cggacagcca atccctcgcg tggagtatat ggaggaggag aagaagacct ggggcacagt 660gttcaagacc ctgaagagcc tgtacaagac acacgcctgc tacgagtata accacatctt 720ccccctgctg gagaagtatt gtggctttca cgaggacaat atccctcagc tggaggacgt 780gagccagttc ctgcagacct gcacaggctt taggctgagg ccagtggcag gactgctgag 840ctcccgggac ttcctgggag gactggcctt cagagtgttt cactgcaccc agtacatcag 900gcacggctcc aagccaatgt atacaccaga gcccgacatc tgtcacgagc tgctgggcca 960cgtgcccctg tttagcgata gatccttcgc ccagttttcc caggagatcg gactggcatc 1020tctgggagca cctgacgagt acatcgagaa gctggccacc atctattggt tcacagtgga 1080gtttggcctg tgcaagcagg gcgatagcat caaggcctac ggagcaggac tgctgtctag 1140cttcggcgag ctgcagtatt gtctgtccga gaagccaaag ctgctgcccc tggagctgga 1200gaagaccgcc atccagaact acaccgtgac agagttccag cccctgtact atgtggccga 1260gtcttttaac gatgccaagg agaaggtgag aaatttcgcc gccacaatcc ctaggccctt 1320cagcgtgcgg tacgaccctt atacccagag gatcgaggtg ctggataata cacagcagct 1380gaagatcctg gctgactcaa tcaatagcga aatcggaatc ctgtgctccg ccctgcagaa 1440aatcaaatga ggtaccgatc cagacatgat aagatacatt gatgagtttg gacaaaccac 1500aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt 1560tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt 1620tcaggttcag ggggaggtgt gggaggtttt ttaa 165436960DNAHomo sapiens 36gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96037960DNAArtificial Sequence32.2 vector 5' homology arm 37gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccaccatgg cggcggcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96038960DNAArtificial Sequence32.3 vector 5' homology arm 38gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctga gagtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96039960DNAArtificial Sequence32.4 vector 5' homology arm 39gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgagtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa

96040960DNAArtificial Sequence32.5 vector 5' homology arm 40gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acgtcaagca 480tccggcaggc tgccctggcc tcctgagtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96041960DNAArtificial Sequence32.6 vector 5' homology arm 41gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaatg tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96042960DNAArtificial Sequence32.7 vector 5' homology arm 42gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttccaccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96043968DNAArtificial Sequence32.8 vector 5' homology arm 43gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttccaccag acggtcgcag gcttagtcca attgcagaga acacgctgtt 300cttcgcccca ggcttctgag agtcccggaa gtgcctaaac ctgtctaatc gacggggctt 360gggtggcccg tcgctccctg gcttcttccc tttacccagg gcgggcagcg aagtggtgcc 420tcctgcgtcc cccacaccct ccctcagccc ctcccctccg gcccgtcctg ggcaggtgac 480ctggagcatc cggcaggctg ccctggcctc ctgcgtcagg acaacgccca cgaggggcgt 540tactgtgcgg agatgcacca cgcaagagac accctttgta actctcttct cctccctagt 600gcgaggttaa aaccttcagc cccacgtgct gtttgcaaac ctgcctgtac ctgaggccct 660aaaaagccag agacctcact cccggggagc cagcatgtcc actgcggtcc tggaaaaccc 720aggcttgggc aggaaactct ctgactttgg acaggtgagc cacggcagcc tgagctgctc 780agttagggga atttgggcct ccagagaaag agatccgaag actgctggtg cttcctggtt 840tcataagctc agtaagaagt ctgaattcgt tggaagctga tgagaatatc caggaagtca 900acagacaaat gtcctcaaca attgtttcta agtaggagaa catctgtcct cggtggcttt 960cacaggaa 96844960DNAArtificial Sequence32.9 vector 5' homology arm 44gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctga gagtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacagagc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc taggcaggtg acctgaagca 480tccagcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 96045911DNAHomo sapiens 45ctgggatggg atgtggaatc cttctagatt tcttttgtaa tatttataaa gtgctctcag 60caaggtatca aaatggcaaa attgtgagta actatcctcc tttcattttg ggaagaagat 120gaggcatgaa gagaattcag acagaaactt actcagacca ggggaggcag aaactaagca 180gagaggaaaa tgaccaagag ttagccctgg gcatggaatg tgaaagaacc ctaaacgtga 240cttggaaata atgcccaagg tatattccat tctccgggat ttgttggcat tttcttgagg 300tgaagaattg cagaatacat tctttaatgt gacctacata tttacccatg ggaggaagtc 360tgctcctgga ctcttgagat tcagtcataa agcccaggcc agggaaataa tgtaagtctg 420caggcccctg tcatcagtag gattagggag aagagttctc agtagaaaac agggaggctg 480gagagaaaag aatggttaat gttaacgtta atataactag aaagactgca gaacttagga 540ctgattttta tttgaatcct taaaaaaaaa aatttcttat gaaaatagta catggctctt 600aggagacaga acttattgta cagaggaaca gcgtgagagt cagagtgatc ccagaacagg 660tcctggctcc atcctgcaca tagttttggt gctgctggca atacggtccc cacaactgtg 720ggaaggggtt aggggcaggg atctcatcag gaaagcatag gggtttaaag ttctttatag 780agcacttaga agattgagaa tccacaaatt atattaataa caaacaaagt agtgtcgtgt 840tatatagtaa atgtgaattt gcagacacat ttagggaaaa gttataatta aaaaaatagg 900ctgtatatat a 911463537DNAArtificial Sequence32.1 vector correction genome 46gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537473537DNAArtificial Sequence32.2 vector correction genome 47gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccaccatgg cggcggcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537483537DNAArtificial Sequence32.3 vector correction genome 48gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctga gagtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca

1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537493537DNAArtificial Sequence32.4 vector correction genome 49gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgagtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537503537DNAArtificial Sequence32.5 vector correction genome 50gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acgtcaagca 480tccggcaggc tgccctggcc tcctgagtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537513537DNAArtificial Sequence32.6 vector correction genome 51gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaatg tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537523537DNAArtificial Sequence32.7 vector correction genome 52gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttccaccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca

2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537533545DNAArtificial Sequence32.8 vector correction genome 53gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttccaccag acggtcgcag gcttagtcca attgcagaga acacgctgtt 300cttcgcccca ggcttctgag agtcccggaa gtgcctaaac ctgtctaatc gacggggctt 360gggtggcccg tcgctccctg gcttcttccc tttacccagg gcgggcagcg aagtggtgcc 420tcctgcgtcc cccacaccct ccctcagccc ctcccctccg gcccgtcctg ggcaggtgac 480ctggagcatc cggcaggctg ccctggcctc ctgcgtcagg acaacgccca cgaggggcgt 540tactgtgcgg agatgcacca cgcaagagac accctttgta actctcttct cctccctagt 600gcgaggttaa aaccttcagc cccacgtgct gtttgcaaac ctgcctgtac ctgaggccct 660aaaaagccag agacctcact cccggggagc cagcatgtcc actgcggtcc tggaaaaccc 720aggcttgggc aggaaactct ctgactttgg acaggtgagc cacggcagcc tgagctgctc 780agttagggga atttgggcct ccagagaaag agatccgaag actgctggtg cttcctggtt 840tcataagctc agtaagaagt ctgaattcgt tggaagctga tgagaatatc caggaagtca 900acagacaaat gtcctcaaca attgtttcta agtaggagaa catctgtcct cggtggcttt 960cacaggaaaa gcttctgacc tcttctcttc ctcccacagg gcagcggagc tactaacttc 1020agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatgtc caccgctgtg 1080ctggagaacc ctgggctggg gaggaaactg tcagacttcg ggcaggagac ttcatacatt 1140gaggataact gtaaccagaa tggcgccatc tctctgatct tcagcctgaa ggaggaagtg 1200ggcgccctgg caaaggtgct gcgcctgttt gaggagaacg acgtgaatct gacccacatc 1260gagtcccggc cttctagact gaagaaggac gagtacgagt tctttaccca cctggataag 1320cggtccctgc cagccctgac aaacatcatc aagatcctga ggcacgacat cggagcaacc 1380gtgcacgagc tgtctcggga caagaagaag gataccgtgc cctggttccc tcggacaatc 1440caggagctgg atagatttgc caaccagatc ctgtcttacg gagcagagct ggacgcagat 1500caccctggct tcaaggaccc agtgtatcgg gcccggagaa agcagtttgc cgatatcgcc 1560tacaattata ggcacggaca gccaatccct cgcgtggagt atatggagga ggagaagaag 1620acctggggca cagtgttcaa gaccctgaag agcctgtaca agacacacgc ctgctacgag 1680tataaccaca tcttccccct gctggagaag tattgtggct ttcacgagga caatatccct 1740cagctggagg acgtgagcca gttcctgcag acctgcacag gctttaggct gaggccagtg 1800gcaggactgc tgagctcccg ggacttcctg ggaggactgg ccttcagagt gtttcactgc 1860acccagtaca tcaggcacgg ctccaagcca atgtatacac cagagcccga catctgtcac 1920gagctgctgg gccacgtgcc cctgtttagc gatagatcct tcgcccagtt ttcccaggag 1980atcggactgg catctctggg agcacctgac gagtacatcg agaagctggc caccatctat 2040tggttcacag tggagtttgg cctgtgcaag cagggcgata gcatcaaggc ctacggagca 2100ggactgctgt ctagcttcgg cgagctgcag tattgtctgt ccgagaagcc aaagctgctg 2160cccctggagc tggagaagac cgccatccag aactacaccg tgacagagtt ccagcccctg 2220tactatgtgg ccgagtcttt taacgatgcc aaggagaagg tgagaaattt cgccgccaca 2280atccctaggc ccttcagcgt gcggtacgac ccttataccc agaggatcga ggtgctggat 2340aatacacagc agctgaagat cctggctgac tcaatcaata gcgaaatcgg aatcctgtgc 2400tccgccctgc agaaaatcaa atgaggtacc gatccagaca tgataagata cattgatgag 2460tttggacaaa ccacaactag aatgcagtga aaaaaatgct ttatttgtga aatttgtgat 2520gctattgctt tatttgtaac cattataagc tgcaataaac aagttaacaa caacaattgc 2580attcatttta tgtttcaggt tcagggggag gtgtgggagg ttttttaagg atccctggga 2640tgggatgtgg aatccttcta gatttctttt gtaatattta taaagtgctc tcagcaaggt 2700atcaaaatgg caaaattgtg agtaactatc ctcctttcat tttgggaaga agatgaggca 2760tgaagagaat tcagacagaa acttactcag accaggggag gcagaaacta agcagagagg 2820aaaatgacca agagttagcc ctgggcatgg aatgtgaaag aaccctaaac gtgacttgga 2880aataatgccc aaggtatatt ccattctccg ggatttgttg gcattttctt gaggtgaaga 2940attgcagaat acattcttta atgtgaccta catatttacc catgggagga agtctgctcc 3000tggactcttg agattcagtc ataaagccca ggccagggaa ataatgtaag tctgcaggcc 3060cctgtcatca gtaggattag ggagaagagt tctcagtaga aaacagggag gctggagaga 3120aaagaatggt taatgttaac gttaatataa ctagaaagac tgcagaactt aggactgatt 3180tttatttgaa tccttaaaaa aaaaaatttc ttatgaaaat agtacatggc tcttaggaga 3240cagaacttat tgtacagagg aacagcgtga gagtcagagt gatcccagaa caggtcctgg 3300ctccatcctg cacatagttt tggtgctgct ggcaatacgg tccccacaac tgtgggaagg 3360ggttaggggc agggatctca tcaggaaagc ataggggttt aaagttcttt atagagcact 3420tagaagattg agaatccaca aattatatta ataacaaaca aagtagtgtc gtgttatata 3480gtaaatgtga atttgcagac acatttaggg aaaagttata attaaaaaaa taggctgtat 3540atata 3545543537DNAArtificial Sequence32.9 vector correction genome 54gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctga gagtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacagagc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc taggcaggtg acctgaagca 480tccagcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatccga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcagcgga gctactaact tcagcctgct 1020gaagcaggct ggagacgtgg aggagaaccc tggacctatg tccaccgctg tgctggagaa 1080ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca ttgaggataa 1140ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag tgggcgccct 1200ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca tcgagtcccg 1260gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata agcggtccct 1320gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa ccgtgcacga 1380gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa tccaggagct 1440ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag atcaccctgg 1500cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg cctacaatta 1560taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga agacctgggg 1620cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg agtataacca 1680catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc ctcagctgga 1740ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag tggcaggact 1800gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact gcacccagta 1860catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc acgagctgct 1920gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg agatcggact 1980ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct attggttcac 2040agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag caggactgct 2100gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc tgcccctgga 2160gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc tgtactatgt 2220ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca caatccctag 2280gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg ataatacaca 2340gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt gctccgccct 2400gcagaaaatc aaatgaggta ccgatccaga catgataaga tacattgatg agtttggaca 2460aaccacaact agaatgcagt gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc 2520tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt gcattcattt 2580tatgtttcag gttcaggggg aggtgtggga ggttttttaa ggatccctgg gatgggatgt 2640ggaatccttc tagatttctt ttgtaatatt tataaagtgc tctcagcaag gtatcaaaat 2700ggcaaaattg tgagtaacta tcctcctttc attttgggaa gaagatgagg catgaagaga 2760attcagacag aaacttactc agaccagggg aggcagaaac taagcagaga ggaaaatgac 2820caagagttag ccctgggcat ggaatgtgaa agaaccctaa acgtgacttg gaaataatgc 2880ccaaggtata ttccattctc cgggatttgt tggcattttc ttgaggtgaa gaattgcaga 2940atacattctt taatgtgacc tacatattta cccatgggag gaagtctgct cctggactct 3000tgagattcag tcataaagcc caggccaggg aaataatgta agtctgcagg cccctgtcat 3060cagtaggatt agggagaaga gttctcagta gaaaacaggg aggctggaga gaaaagaatg 3120gttaatgtta acgttaatat aactagaaag actgcagaac ttaggactga tttttatttg 3180aatccttaaa aaaaaaaatt tcttatgaaa atagtacatg gctcttagga gacagaactt 3240attgtacaga ggaacagcgt gagagtcaga gtgatcccag aacaggtcct ggctccatcc 3300tgcacatagt tttggtgctg ctggcaatac ggtccccaca actgtgggaa ggggttaggg 3360gcagggatct catcaggaaa gcataggggt ttaaagttct ttatagagca cttagaagat 3420tgagaatcca caaattatat taataacaaa caaagtagtg tcgtgttata tagtaaatgt 3480gaatttgcag acacatttag ggaaaagtta taattaaaaa aataggctgt atatata 3537553943DNAArtificial Sequence32.1 vector correction genome (+ ITRs) 55ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943563943DNAArtificial Sequence32.2 vector correction genome (+ ITRs) 56ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc accatggcgg 900cggcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca

2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943573943DNAArtificial Sequence32.3 vector correction genome (+ ITRs) 57ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctgagag taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943583943DNAArtificial Sequence32.4 vector correction genome (+ ITRs) 58ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgagtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943593943DNAArtificial Sequence32.5 vector correction genome (+ ITRs) 59ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacg tcaagcatcc ggcaggctgc cctggcctcc tgagtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943603943DNAArtificial Sequence32.6 vector correction genome (+ ITRs) 60ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatgtcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt

1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943613943DNAArtificial Sequence32.7 vector correction genome (+ ITRs) 61ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ccaccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 3943623951DNAArtificial Sequence32.8 vector correction genome (+ ITRs) 62ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ccaccagacg gtcgcaggct 480tagtccaatt gcagagaaca cgctgttctt cgccccaggc ttctgagagt cccggaagtg 540cctaaacctg tctaatcgac ggggcttggg tggcccgtcg ctccctggct tcttcccttt 600acccagggcg ggcagcgaag tggtgcctcc tgcgtccccc acaccctccc tcagcccctc 660ccctccggcc cgtcctgggc aggtgacctg gagcatccgg caggctgccc tggcctcctg 720cgtcaggaca acgcccacga ggggcgttac tgtgcggaga tgcaccacgc aagagacacc 780ctttgtaact ctcttctcct ccctagtgcg aggttaaaac cttcagcccc acgtgctgtt 840tgcaaacctg cctgtacctg aggccctaaa aagccagaga cctcactccc ggggagccag 900catgtccact gcggtcctgg aaaacccagg cttgggcagg aaactctctg actttggaca 960ggtgagccac ggcagcctga gctgctcagt taggggaatt tgggcctcca gagaaagaga 1020tccgaagact gctggtgctt cctggtttca taagctcagt aagaagtctg aattcgttgg 1080aagctgatga gaatatccag gaagtcaaca gacaaatgtc ctcaacaatt gtttctaagt 1140aggagaacat ctgtcctcgg tggctttcac aggaaaagct tctgacctct tctcttcctc 1200ccacagggca gcggagctac taacttcagc ctgctgaagc aggctggaga cgtggaggag 1260aaccctggac ctatgtccac cgctgtgctg gagaaccctg ggctggggag gaaactgtca 1320gacttcgggc aggagacttc atacattgag gataactgta accagaatgg cgccatctct 1380ctgatcttca gcctgaagga ggaagtgggc gccctggcaa aggtgctgcg cctgtttgag 1440gagaacgacg tgaatctgac ccacatcgag tcccggcctt ctagactgaa gaaggacgag 1500tacgagttct ttacccacct ggataagcgg tccctgccag ccctgacaaa catcatcaag 1560atcctgaggc acgacatcgg agcaaccgtg cacgagctgt ctcgggacaa gaagaaggat 1620accgtgccct ggttccctcg gacaatccag gagctggata gatttgccaa ccagatcctg 1680tcttacggag cagagctgga cgcagatcac cctggcttca aggacccagt gtatcgggcc 1740cggagaaagc agtttgccga tatcgcctac aattataggc acggacagcc aatccctcgc 1800gtggagtata tggaggagga gaagaagacc tggggcacag tgttcaagac cctgaagagc 1860ctgtacaaga cacacgcctg ctacgagtat aaccacatct tccccctgct ggagaagtat 1920tgtggctttc acgaggacaa tatccctcag ctggaggacg tgagccagtt cctgcagacc 1980tgcacaggct ttaggctgag gccagtggca ggactgctga gctcccggga cttcctggga 2040ggactggcct tcagagtgtt tcactgcacc cagtacatca ggcacggctc caagccaatg 2100tatacaccag agcccgacat ctgtcacgag ctgctgggcc acgtgcccct gtttagcgat 2160agatccttcg cccagttttc ccaggagatc ggactggcat ctctgggagc acctgacgag 2220tacatcgaga agctggccac catctattgg ttcacagtgg agtttggcct gtgcaagcag 2280ggcgatagca tcaaggccta cggagcagga ctgctgtcta gcttcggcga gctgcagtat 2340tgtctgtccg agaagccaaa gctgctgccc ctggagctgg agaagaccgc catccagaac 2400tacaccgtga cagagttcca gcccctgtac tatgtggccg agtcttttaa cgatgccaag 2460gagaaggtga gaaatttcgc cgccacaatc cctaggccct tcagcgtgcg gtacgaccct 2520tatacccaga ggatcgaggt gctggataat acacagcagc tgaagatcct ggctgactca 2580atcaatagcg aaatcggaat cctgtgctcc gccctgcaga aaatcaaatg aggtaccgat 2640ccagacatga taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa 2700aaatgcttta tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc 2760aataaacaag ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg 2820tgggaggttt tttaaggatc cctgggatgg gatgtggaat ccttctagat ttcttttgta 2880atatttataa agtgctctca gcaaggtatc aaaatggcaa aattgtgagt aactatcctc 2940ctttcatttt gggaagaaga tgaggcatga agagaattca gacagaaact tactcagacc 3000aggggaggca gaaactaagc agagaggaaa atgaccaaga gttagccctg ggcatggaat 3060gtgaaagaac cctaaacgtg acttggaaat aatgcccaag gtatattcca ttctccggga 3120tttgttggca ttttcttgag gtgaagaatt gcagaataca ttctttaatg tgacctacat 3180atttacccat gggaggaagt ctgctcctgg actcttgaga ttcagtcata aagcccaggc 3240cagggaaata atgtaagtct gcaggcccct gtcatcagta ggattaggga gaagagttct 3300cagtagaaaa cagggaggct ggagagaaaa gaatggttaa tgttaacgtt aatataacta 3360gaaagactgc agaacttagg actgattttt atttgaatcc ttaaaaaaaa aaatttctta 3420tgaaaatagt acatggctct taggagacag aacttattgt acagaggaac agcgtgagag 3480tcagagtgat cccagaacag gtcctggctc catcctgcac atagttttgg tgctgctggc 3540aatacggtcc ccacaactgt gggaaggggt taggggcagg gatctcatca ggaaagcata 3600ggggtttaaa gttctttata gagcacttag aagattgaga atccacaaat tatattaata 3660acaaacaaag tagtgtcgtg ttatatagta aatgtgaatt tgcagacaca tttagggaaa 3720agttataatt aaaaaaatag gctgtatata tacctgcagg tctagatacg tagataagta 3780gcatggcggg ttaatcatta actacaagga acccctagtg atggagttgg ccactccctc 3840tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt 3900tgcccgggcg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca a 3951633943DNAArtificial Sequence32.9 vector correction genome (+ ITRs) 63ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctgagag taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acagagcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctag gcaggtgacc tgaagcatcc agcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 1260acctatgtcc accgctgtgc tggagaaccc tgggctgggg aggaaactgt cagacttcgg 1320gcaggagact tcatacattg aggataactg taaccagaat ggcgccatct ctctgatctt 1380cagcctgaag gaggaagtgg gcgccctggc aaaggtgctg cgcctgtttg aggagaacga 1440cgtgaatctg acccacatcg agtcccggcc ttctagactg aagaaggacg agtacgagtt 1500ctttacccac ctggataagc ggtccctgcc agccctgaca aacatcatca agatcctgag 1560gcacgacatc ggagcaaccg tgcacgagct gtctcgggac aagaagaagg ataccgtgcc 1620ctggttccct cggacaatcc aggagctgga tagatttgcc aaccagatcc tgtcttacgg 1680agcagagctg gacgcagatc accctggctt caaggaccca gtgtatcggg cccggagaaa 1740gcagtttgcc gatatcgcct acaattatag gcacggacag ccaatccctc gcgtggagta 1800tatggaggag gagaagaaga cctggggcac agtgttcaag accctgaaga gcctgtacaa 1860gacacacgcc tgctacgagt ataaccacat cttccccctg ctggagaagt attgtggctt 1920tcacgaggac aatatccctc agctggagga cgtgagccag ttcctgcaga cctgcacagg 1980ctttaggctg aggccagtgg caggactgct gagctcccgg gacttcctgg gaggactggc 2040cttcagagtg tttcactgca cccagtacat caggcacggc tccaagccaa tgtatacacc 2100agagcccgac atctgtcacg agctgctggg ccacgtgccc ctgtttagcg atagatcctt 2160cgcccagttt tcccaggaga tcggactggc atctctggga gcacctgacg agtacatcga 2220gaagctggcc accatctatt ggttcacagt ggagtttggc ctgtgcaagc agggcgatag 2280catcaaggcc tacggagcag gactgctgtc tagcttcggc gagctgcagt attgtctgtc 2340cgagaagcca aagctgctgc ccctggagct ggagaagacc gccatccaga actacaccgt 2400gacagagttc cagcccctgt actatgtggc cgagtctttt aacgatgcca aggagaaggt 2460gagaaatttc gccgccacaa tccctaggcc cttcagcgtg cggtacgacc cttataccca 2520gaggatcgag gtgctggata atacacagca gctgaagatc ctggctgact caatcaatag 2580cgaaatcgga atcctgtgct ccgccctgca gaaaatcaaa tgaggtaccg atccagacat 2640gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2700tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2760agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2820tttttaagga tccctgggat gggatgtgga atccttctag atttcttttg taatatttat 2880aaagtgctct cagcaaggta tcaaaatggc aaaattgtga gtaactatcc tcctttcatt 2940ttgggaagaa gatgaggcat gaagagaatt cagacagaaa cttactcaga ccaggggagg 3000cagaaactaa gcagagagga aaatgaccaa gagttagccc tgggcatgga atgtgaaaga 3060accctaaacg tgacttggaa ataatgccca aggtatattc cattctccgg gatttgttgg 3120cattttcttg aggtgaagaa ttgcagaata cattctttaa tgtgacctac atatttaccc 3180atgggaggaa gtctgctcct ggactcttga gattcagtca taaagcccag gccagggaaa 3240taatgtaagt ctgcaggccc ctgtcatcag taggattagg gagaagagtt ctcagtagaa 3300aacagggagg ctggagagaa aagaatggtt aatgttaacg ttaatataac tagaaagact 3360gcagaactta ggactgattt ttatttgaat ccttaaaaaa aaaaatttct tatgaaaata 3420gtacatggct cttaggagac agaacttatt gtacagagga acagcgtgag agtcagagtg 3480atcccagaac aggtcctggc tccatcctgc acatagtttt ggtgctgctg gcaatacggt 3540ccccacaact gtgggaaggg gttaggggca gggatctcat caggaaagca taggggttta 3600aagttcttta tagagcactt agaagattga gaatccacaa attatattaa taacaaacaa 3660agtagtgtcg tgttatatag taaatgtgaa tttgcagaca catttaggga aaagttataa 3720ttaaaaaaat aggctgtata tatacctgca ggtctagata cgtagataag tagcatggcg 3780ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc tctctgcgcg 3840ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 3900cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 394364912DNAHomo sapiens 64atgtccactg cggtcctgga aaacccaggc ttgggcagga aactctctga ctttggacag 60gaaacaagct atattgaaga caactgcaat caaaatggtg ccatatcact gatcttctca 120ctcaaagaag aagttggtgc attggccaaa gtattgcgct tatttgagga gaatgatgta 180aacctgaccc acattgaatc tagaccttct cgtttaaaga aagatgagta tgaatttttc 240acccatttgg ataaacgtag cctgcctgct ctgacaaaca tcatcaagat cttgaggcat 300gacattggtg ccactgtcca tgagctttca cgagataaga agaaagacac agtgccctgg 360ttcccaagaa ccattcaaga gctggacaga tttgccaatc agattctcag ctatggagcg 420gaactggatg ctgaccaccc tggttttaaa gatcctgtgt accgtgcaag acggaagcag 480tttgctgaca ttgcctacaa ctaccgccat gggcagccca

tccctcgagt ggaatacatg 540gaggaagaaa agaaaacatg gggcacagtg ttcaagactc tgaagtcctt gtataaaacc 600catgcttgct atgagtacaa tcacattttt ccacttcttg aaaagtactg tggcttccat 660gaagataaca ttccccagct ggaagacgtt tctcagttcc tgcagacttg cactggtttc 720cgcctccgac ctgtggctgg cctgctttcc tctcgggatt tcttgggtgg cctggccttc 780cgagtcttcc actgcacaca gtacatcaga catggatcca agcccatgta tacccccgaa 840cctgacatct gccatgagct gttgggacat gtgcccttgt tttcagatcg cagctttgcc 900cagttttccc ag 91265912DNAArtificial Sequencefrom start codon to end of exon 8 of silently altered PAH coding sequence 65atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc ag 91266447DNAHomo sapiens 66gaaattggcc ttgcctctct gggtgcacct gatgaataca ttgaaaagct cgccacaatt 60tactggttta ctgtggagtt tgggctctgc aaacaaggag actccataaa ggcatatggt 120gctgggctcc tgtcatcctt tggtgaatta cagtactgct tatcagagaa gccaaagctt 180ctccccctgg agctggagaa gacagccatc caaaattaca ctgtcacgga gttccagccc 240ctctattacg tggcagagag ttttaatgat gccaaggaga aagtaaggaa ctttgctgcc 300acaatacctc ggcccttctc agttcgctac gacccataca cccaaaggat tgaggtcttg 360gacaataccc agcagcttaa gattttggct gattccatta acagtgaaat tggaatcctt 420tgcagtgccc tccagaaaat aaagtaa 44767447DNAArtificial Sequencefrom start of exon 9 to stop codon of silently altered PAH coding sequence 67gagatcggac tggcatctct gggagcacct gacgagtaca tcgagaagct ggccaccatc 60tattggttca cagtggagtt tggcctgtgc aagcagggcg atagcatcaa ggcctacgga 120gcaggactgc tgtctagctt cggcgagctg cagtattgtc tgtccgagaa gccaaagctg 180ctgcccctgg agctggagaa gaccgccatc cagaactaca ccgtgacaga gttccagccc 240ctgtactatg tggccgagtc ttttaacgat gccaaggaga aggtgagaaa tttcgccgcc 300acaatcccta ggcccttcag cgtgcggtac gacccttata cccagaggat cgaggtgctg 360gataatacac agcagctgaa gatcctggct gactcaatca atagcgaaat cggaatcctg 420tgctccgccc tgcagaaaat caaatga 4476815DNAArtificial Sequencemodification to glucocorticoid binding site 68acgctgttct tcgcc 1569800DNAHomo sapiens 69tatcttccat ttactgagtg tttatgtgga agaactgtac taaattttaa tgcatttctt 60tattcctatt cttaaaacct tccagcaagg tggctctacc accctctttt ccgagcttca 120ggagcagttg tgcgaatagc tggagaacac caggctggat ttaaacccag atcgctctta 180catttgctct ttacctgctg tgctcagcgt tcacgtgccc tctagctgta gttttctgaa 240gtcagcgcac agcaaggcag tgtgcttaga ggttaacaga agggaaaaca acaacaacaa 300aaatctaaat gagaatcctg actgtttcag ctgggggtaa ggggggcgga ttattcatat 360aattgttata ccagacggtc gcaggcttag tccaattgca gagaactcgc ttcccaggct 420tctgagagtc ccggaagtgc ctaaacctgt ctaatcgacg gggcttgggt ggcccgtcgc 480tccctggctt cttcccttta cccagggcgg gcagcgaagt ggtgcctcct gcgtccccca 540caccctccct cagcccctcc cctccggccc gtcctgggca ggtgacctgg agcatccggc 600aggctgccct ggcctcctgc gtcaggacaa cgcccacgag gggcgttact gtgcggagat 660gcaccacgca agagacaccc tttgtaactc tcttctcctc cctagtgcga ggttaaaacc 720ttcagcccca cgtgctgttt gcaaacctgc ctgtacctga ggccctaaaa agccagagac 780ctcactcccg gggagccagc 80070800DNAHomo sapiens 70tccactgcgg tcctggaaaa cccaggcttg ggcaggaaac tctctgactt tggacaggtg 60agccacggca gcctgagctg ctcagttagg ggaatttggg cctccagaga aagagatccg 120aagactgctg gtgcttcctg gtttcataag ctcagtaaga agtctgaatt cgttggaagc 180tgatgagaat atccaggaag tcaacagaca aatgtcctca acaattgttt ctaagtagga 240gaacatctgt cctcggtggc tttcacagga atgaatgacc attgctttag ggggttgggg 300atctggcctc cagaactgcc accaattagc tgtgtgtctt tggacaagtt actgtccctc 360tctgttgtct gtttactctt ctgtacactg aaggggctgg tccctaatga tctgggatgg 420gatgtggaat ccttctagat ttcttttgta atatttataa agtgctctca gcaaggtatc 480aaaatggcaa aattgtgagt aactatcctc ctttcatttt gggaagaaga tgaggcatga 540agagaattca gacagaaact tactcagacc aggggaggca gaaactaagc agagaggaaa 600atgaccaaga gttagccctg ggcatggaat gtgaaagaac cctaaacgtg acttggaaat 660aatgcccaag gtatattcca ttctccggga tttgttggca ttttcttgag gtgaagaatt 720gcagaataca ttctttaatg tgacctacat atttacccat gggaggaagt ctgctcctgg 780actcttgaga ttcagtcata 8007116DNAArtificial Sequencetargeted integration restriction cassette 71tacgtacgat cgtcga 1672800DNAHomo sapiens 72aatggttcca aaattttcta tggttaagaa tcacctggga tggttttgaa atggcagatt 60ctaagacaac ttgattcaac aggtttaggt aaagcccagg gaactgcatt ataagaagga 120atcacctgta attttggagt caagatccaa ggaacactca ttgagaaaca ctgatttaca 180aagtgcatgg agagaaatgg agcaagtgaa gggggatcag catggtgaaa tataggctgt 240taggagtgct attgactaac tgtctggtga ctggaccaga gtaaatcttt tactttgcaa 300gaaacaggac taaattccca tattatgtcc atagcaaagg gaattatgta gaaaaattga 360taattaggag cctgagttct tgaccagcct ccactaccta tgtggcctca ggtgagttat 420tttctccctt tggctctaag ttttccccat ctgtaatgta agggagttta actagatgag 480cactaaggac aaatcaattt ctgtgagtca attattatga aataccatgt gggcatcaaa 540tgccaagtgg aaagcataga taaagaagtg attgtgcacc tgggctgagg ggaacaaaca 600tttcctaaga gaattgagac ccaaaagagc ctttaaggaa ggtgagatct tggaaaggga 660aatttggtga atactctaat gaggagctaa aaaggcaaga aagaaagcag cttggctgga 720aaggaggttc ctgtaggtgg gcctccagag attcggtacc acagaaactg ccaaacatca 780gcaagaagcc atggggatgg 80073800DNAHomo sapiens 73agcgtttgag ggattctaaa tagaaggaca agagtaaaaa tgtcaggctg gatcgatgca 60ggccactaag aaatggattc aggtgatggc agtgggaaga aaggacctga tgcccagagg 120catttctgga gaagatgaga tcagacttgt gattggctga acacacactg tagtggggtg 180gggtttaggg ggtgactcaa cttcaagccc aggtacattc aagtctgaat tgccctagtc 240aaaagtggca tctgtggatg tgtatcagaa atatcttact tttcttggaa gccaacagga 300gaaaagagtg ctaccaagtg aactagagac aggaatatct tttgtcattt caaggaaact 360ggaaagaaga aggctcagta ttctttagta ggaagaagac ttaagtcaga gactcatctg 420tacctctctg gcagggttta aaagggggaa gaggaataga ggctgcaaga gattgtgatt 480catggacagt atgcagagat caaatgacct gggttcagat cctggctcca ctgctaactg 540tgtaactata ggcaagttcc ttaacctctc taagccttaa tcttgtcatc aataaaaggg 600ggcacttggt gcctaataaa acctacctct taggttgttg ccaaattaca tgagataatc 660caaatcaagt gcttattata atacccagaa attataggct ctaaataaat gtttatatag 720gctctaaata aatgaagttt tttagaaaga taacatcatg atcaaaatgg gatatttaac 780agtttagtct tccatttcat 8007472DNAArtificial Sequence2A element 74agatctggca gcggagaggg cagaggaagt cttctaacat gcggtgacgt ggaggagaat 60cccggcccta gg 72758PRTArtificial SequenceRibosomal skipping peptide consensus sequenceVARIANT(1)..(1)D or GVARIANT(2)..(2)V or IVARIANT(4)..(4)any amino acid residue 75Xaa Xaa Glu Xaa Asn Pro Gly Pro1 57618PRTArtificial SequenceT2A peptide 76Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro1 5 10 15Gly Pro7719PRTArtificial SequenceP2A peptide 77Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn1 5 10 15Pro Gly Pro7854DNAArtificial SequenceT2A element 78gagggcagag gaagtcttct aacatgcggt gacgtggagg agaatcccgg ccct 547957DNAArtificial SequenceP2A element 79gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacct 57801489DNAArtificial SequencePAH intron-inserted silently altered coding sequence (human HBB first intron) 80atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggttggtat caaggttaca agacaggttt aaggagacca atagaaactg 960ggcatgtgga gacagagaag actcttgggt ttctgatagg cactgactct ctctgcctat 1020tggtctattt tcccaccctt aggagatcgg actggcatct ctgggagcac ctgacgagta 1080catcgagaag ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg 1140cgatagcatc aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg 1200tctgtccgag aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta 1260caccgtgaca gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga 1320gaaggtgaga aatttcgccg ccacaatccc taggcccttc agcgtgcggt acgaccctta 1380tacccagagg atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat 1440caatagcgaa atcggaatcc tgtgctccgc cctgcagaaa atcaaatga 1489811475DNAArtificial SequencePAH intron-inserted silently altered coding sequence (mouse HBB first intron) 81atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggttggtat ccaggttaca aggcagctca caagaagaag ttgggtgctt 960ggagacagag gtctgctttc cagcagacac taactttcag tgtcccctgt ctatgtttcc 1020ctttttagga gatcggactg gcatctctgg gagcacctga cgagtacatc gagaagctgg 1080ccaccatcta ttggttcaca gtggagtttg gcctgtgcaa gcagggcgat agcatcaagg 1140cctacggagc aggactgctg tctagcttcg gcgagctgca gtattgtctg tccgagaagc 1200caaagctgct gcccctggag ctggagaaga ccgccatcca gaactacacc gtgacagagt 1260tccagcccct gtactatgtg gccgagtctt ttaacgatgc caaggagaag gtgagaaatt 1320tcgccgccac aatccctagg cccttcagcg tgcggtacga cccttatacc cagaggatcg 1380aggtgctgga taatacacag cagctgaaga tcctggctga ctcaatcaat agcgaaatcg 1440gaatcctgtg ctccgccctg cagaaaatca aatga 1475821451DNAArtificial SequencePAH intron-inserted silently altered coding sequence (MVM intron) 82atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc agaagaggta agggtttaag ggatggttgg ttggtggggt attaatgttt 960aattacctgg agcacctgcc tgaaatcact ttttttcagg ttgggagatc ggactggcat 1020ctctgggagc acctgacgag tacatcgaga agctggccac catctattgg ttcacagtgg 1080agtttggcct gtgcaagcag ggcgatagca tcaaggccta cggagcagga ctgctgtcta 1140gcttcggcga gctgcagtat tgtctgtccg agaagccaaa gctgctgccc ctggagctgg 1200agaagaccgc catccagaac tacaccgtga cagagttcca gcccctgtac tatgtggccg 1260agtcttttaa cgatgccaag gagaaggtga gaaatttcgc cgccacaatc cctaggccct 1320tcagcgtgcg gtacgaccct tatacccaga ggatcgaggt gctggataat acacagcagc 1380tgaagatcct ggctgactca atcaatagcg aaatcggaat cctgtgctcc gccctgcaga 1440aaatcaaatg a 1451831607DNAArtificial SequencepHMI-hPAH-hAC-008 editing element 83atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggagatcgg actggcatct ctgggagcac ctgacgagta catcgagaag 960ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg cgatagcatc 1020aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg tctgtccgag 1080aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta caccgtgaca 1140gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga gaaggtgaga 1200aatttcgccg ccacaatccc taggcccttc agcgtgcggt acgaccctta tacccagagg 1260atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat caatagcgaa 1320atcggaatcc tgtgctccgc cctgcagaaa atcaaatgag aattcaaggc ctctcgagcc 1380tctagaacta tagtgagtcg tattacgtag atccagacat gataagatac attgatgagt 1440ttggacaaac cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg 1500ctattgcttt atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca 1560ttcattttat gtttcaggtt cagggggagg tgtgggaggt tttttaa 1607841719DNAArtificial SequencepHMI-hPAH-h1C-007 editing element 84ctgacctctt ctcttcctcc cacagggcgg taccagatct ggcagcggag agggcagagg 60aagtcttcta acatgcggtg acgtggagga gaatcccggc cctaggggta ccatgtccac 120cgctgtgctg gagaaccctg ggctggggag gaaactgtca gacttcgggc aggagacttc 180atacattgag gataactgta accagaatgg cgccatctct ctgatcttca gcctgaagga 240ggaagtgggc gccctggcaa aggtgctgcg cctgtttgag gagaacgacg tgaatctgac 300ccacatcgag tcccggcctt ctagactgaa gaaggacgag tacgagttct ttacccacct 360ggataagcgg tccctgccag ccctgacaaa catcatcaag atcctgaggc acgacatcgg 420agcaaccgtg cacgagctgt ctcgggacaa gaagaaggat accgtgccct ggttccctcg 480gacaatccag gagctggata gatttgccaa ccagatcctg tcttacggag cagagctgga 540cgcagatcac cctggcttca aggacccagt gtatcgggcc cggagaaagc agtttgccga 600tatcgcctac aattataggc acggacagcc aatccctcgc gtggagtata tggaggagga 660gaagaagacc tggggcacag tgttcaagac cctgaagagc ctgtacaaga cacacgcctg 720ctacgagtat aaccacatct tccccctgct ggagaagtat tgtggctttc acgaggacaa 780tatccctcag ctggaggacg tgagccagtt cctgcagacc tgcacaggct ttaggctgag 840gccagtggca ggactgctga gctcccggga cttcctggga ggactggcct tcagagtgtt 900tcactgcacc cagtacatca ggcacggctc caagccaatg tatacaccag agcccgacat 960ctgtcacgag ctgctgggcc acgtgcccct gtttagcgat agatccttcg cccagttttc 1020ccaggagatc ggactggcat ctctgggagc acctgacgag tacatcgaga agctggccac 1080catctattgg ttcacagtgg agtttggcct gtgcaagcag ggcgatagca tcaaggccta 1140cggagcagga ctgctgtcta gcttcggcga gctgcagtat tgtctgtccg agaagccaaa 1200gctgctgccc ctggagctgg agaagaccgc catccagaac tacaccgtga cagagttcca 1260gcccctgtac tatgtggccg agtcttttaa cgatgccaag gagaaggtga gaaatttcgc 1320cgccacaatc cctaggccct tcagcgtgcg gtacgaccct tatacccaga ggatcgaggt 1380gctggataat acacagcagc tgaagatcct ggctgactca atcaatagcg aaatcggaat 1440cctgtgctcc gccctgcaga

aaatcaaatg agaattcaag gcctctcgag cctctagaac 1500tatagtgagt cgtattacgt agatccagac atgataagat acattgatga gtttggacaa 1560accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga tgctattgct 1620ttatttgtaa ccattataag ctgcaataaa caagttaaca acaacaattg cattcatttt 1680atgtttcagg ttcaggggga ggtgtgggag gttttttaa 1719853227DNAArtificial SequencepHMI-hPAH-hAC-008 correction genome from 5' homology arm to 3' homology arm 85tatcttccat ttactgagtg tttatgtgga agaactgtac taaattttaa tgcatttctt 60tattcctatt cttaaaacct tccagcaagg tggctctacc accctctttt ccgagcttca 120ggagcagttg tgcgaatagc tggagaacac caggctggat ttaaacccag atcgctctta 180catttgctct ttacctgctg tgctcagcgt tcacgtgccc tctagctgta gttttctgaa 240gtcagcgcac agcaaggcag tgtgcttaga ggttaacaga agggaaaaca acaacaacaa 300aaatctaaat gagaatcctg actgtttcag ctgggggtaa ggggggcgga ttattcatat 360aattgttata ccagacggtc gcaggcttag tccaattgca gagaactcgc ttcccaggct 420tctgagagtc ccggaagtgc ctaaacctgt ctaatcgacg gggcttgggt ggcccgtcgc 480tccctggctt cttcccttta cccagggcgg gcagcgaagt ggtgcctcct gcgtccccca 540caccctccct cagcccctcc cctccggccc gtcctgggca ggtgacctgg agcatccggc 600aggctgccct ggcctcctgc gtcaggacaa cgcccacgag gggcgttact gtgcggagat 660gcaccacgca agagacaccc tttgtaactc tcttctcctc cctagtgcga ggttaaaacc 720ttcagcccca cgtgctgttt gcaaacctgc ctgtacctga ggccctaaaa agccagagac 780ctcactcccg gggagccagc atgtccaccg ctgtgctgga gaaccctggg ctggggagga 840aactgtcaga cttcgggcag gagacttcat acattgagga taactgtaac cagaatggcg 900ccatctctct gatcttcagc ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc 960tgtttgagga gaacgacgtg aatctgaccc acatcgagtc ccggccttct agactgaaga 1020aggacgagta cgagttcttt acccacctgg ataagcggtc cctgccagcc ctgacaaaca 1080tcatcaagat cctgaggcac gacatcggag caaccgtgca cgagctgtct cgggacaaga 1140agaaggatac cgtgccctgg ttccctcgga caatccagga gctggataga tttgccaacc 1200agatcctgtc ttacggagca gagctggacg cagatcaccc tggcttcaag gacccagtgt 1260atcgggcccg gagaaagcag tttgccgata tcgcctacaa ttataggcac ggacagccaa 1320tccctcgcgt ggagtatatg gaggaggaga agaagacctg gggcacagtg ttcaagaccc 1380tgaagagcct gtacaagaca cacgcctgct acgagtataa ccacatcttc cccctgctgg 1440agaagtattg tggctttcac gaggacaata tccctcagct ggaggacgtg agccagttcc 1500tgcagacctg cacaggcttt aggctgaggc cagtggcagg actgctgagc tcccgggact 1560tcctgggagg actggccttc agagtgtttc actgcaccca gtacatcagg cacggctcca 1620agccaatgta tacaccagag cccgacatct gtcacgagct gctgggccac gtgcccctgt 1680ttagcgatag atccttcgcc cagttttccc aggagatcgg actggcatct ctgggagcac 1740ctgacgagta catcgagaag ctggccacca tctattggtt cacagtggag tttggcctgt 1800gcaagcaggg cgatagcatc aaggcctacg gagcaggact gctgtctagc ttcggcgagc 1860tgcagtattg tctgtccgag aagccaaagc tgctgcccct ggagctggag aagaccgcca 1920tccagaacta caccgtgaca gagttccagc ccctgtacta tgtggccgag tcttttaacg 1980atgccaagga gaaggtgaga aatttcgccg ccacaatccc taggcccttc agcgtgcggt 2040acgaccctta tacccagagg atcgaggtgc tggataatac acagcagctg aagatcctgg 2100ctgactcaat caatagcgaa atcggaatcc tgtgctccgc cctgcagaaa atcaaatgag 2160aattcaaggc ctctcgagcc tctagaacta tagtgagtcg tattacgtag atccagacat 2220gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2280tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2340agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2400tttttaagct ttacgtacga tcgtcgatcc actgcggtcc tggaaaaccc aggcttgggc 2460aggaaactct ctgactttgg acaggtgagc cacggcagcc tgagctgctc agttagggga 2520atttgggcct ccagagaaag agatccgaag actgctggtg cttcctggtt tcataagctc 2580agtaagaagt ctgaattcgt tggaagctga tgagaatatc caggaagtca acagacaaat 2640gtcctcaaca attgtttcta agtaggagaa catctgtcct cggtggcttt cacaggaatg 2700aatgaccatt gctttagggg gttggggatc tggcctccag aactgccacc aattagctgt 2760gtgtctttgg acaagttact gtccctctct gttgtctgtt tactcttctg tacactgaag 2820gggctggtcc ctaatgatct gggatgggat gtggaatcct tctagatttc ttttgtaata 2880tttataaagt gctctcagca aggtatcaaa atggcaaaat tgtgagtaac tatcctcctt 2940tcattttggg aagaagatga ggcatgaaga gaattcagac agaaacttac tcagaccagg 3000ggaggcagaa actaagcaga gaggaaaatg accaagagtt agccctgggc atggaatgtg 3060aaagaaccct aaacgtgact tggaaataat gcccaaggta tattccattc tccgggattt 3120gttggcattt tcttgaggtg aagaattgca gaatacattc tttaatgtga cctacatatt 3180tacccatggg aggaagtctg ctcctggact cttgagattc agtcata 3227863345DNAArtificial SequencepHMI-hPAH-h1C-007 correction genome from 5' homology arm to 3' homology arm 86aatggttcca aaattttcta tggttaagaa tcacctggga tggttttgaa atggcagatt 60ctaagacaac ttgattcaac aggtttaggt aaagcccagg gaactgcatt ataagaagga 120atcacctgta attttggagt caagatccaa ggaacactca ttgagaaaca ctgatttaca 180aagtgcatgg agagaaatgg agcaagtgaa gggggatcag catggtgaaa tataggctgt 240taggagtgct attgactaac tgtctggtga ctggaccaga gtaaatcttt tactttgcaa 300gaaacaggac taaattccca tattatgtcc atagcaaagg gaattatgta gaaaaattga 360taattaggag cctgagttct tgaccagcct ccactaccta tgtggcctca ggtgagttat 420tttctccctt tggctctaag ttttccccat ctgtaatgta agggagttta actagatgag 480cactaaggac aaatcaattt ctgtgagtca attattatga aataccatgt gggcatcaaa 540tgccaagtgg aaagcataga taaagaagtg attgtgcacc tgggctgagg ggaacaaaca 600tttcctaaga gaattgagac ccaaaagagc ctttaaggaa ggtgagatct tggaaaggga 660aatttggtga atactctaat gaggagctaa aaaggcaaga aagaaagcag cttggctgga 720aaggaggttc ctgtaggtgg gcctccagag attcggtacc acagaaactg ccaaacatca 780gcaagaagcc atggggatgg aagcttctga cctcttctct tcctcccaca gggcggtacc 840agatctggca gcggagaggg cagaggaagt cttctaacat gcggtgacgt ggaggagaat 900cccggcccta ggggtaccat gtccaccgct gtgctggaga accctgggct ggggaggaaa 960ctgtcagact tcgggcagga gacttcatac attgaggata actgtaacca gaatggcgcc 1020atctctctga tcttcagcct gaaggaggaa gtgggcgccc tggcaaaggt gctgcgcctg 1080tttgaggaga acgacgtgaa tctgacccac atcgagtccc ggccttctag actgaagaag 1140gacgagtacg agttctttac ccacctggat aagcggtccc tgccagccct gacaaacatc 1200atcaagatcc tgaggcacga catcggagca accgtgcacg agctgtctcg ggacaagaag 1260aaggataccg tgccctggtt ccctcggaca atccaggagc tggatagatt tgccaaccag 1320atcctgtctt acggagcaga gctggacgca gatcaccctg gcttcaagga cccagtgtat 1380cgggcccgga gaaagcagtt tgccgatatc gcctacaatt ataggcacgg acagccaatc 1440cctcgcgtgg agtatatgga ggaggagaag aagacctggg gcacagtgtt caagaccctg 1500aagagcctgt acaagacaca cgcctgctac gagtataacc acatcttccc cctgctggag 1560aagtattgtg gctttcacga ggacaatatc cctcagctgg aggacgtgag ccagttcctg 1620cagacctgca caggctttag gctgaggcca gtggcaggac tgctgagctc ccgggacttc 1680ctgggaggac tggccttcag agtgtttcac tgcacccagt acatcaggca cggctccaag 1740ccaatgtata caccagagcc cgacatctgt cacgagctgc tgggccacgt gcccctgttt 1800agcgatagat ccttcgccca gttttcccag gagatcggac tggcatctct gggagcacct 1860gacgagtaca tcgagaagct ggccaccatc tattggttca cagtggagtt tggcctgtgc 1920aagcagggcg atagcatcaa ggcctacgga gcaggactgc tgtctagctt cggcgagctg 1980cagtattgtc tgtccgagaa gccaaagctg ctgcccctgg agctggagaa gaccgccatc 2040cagaactaca ccgtgacaga gttccagccc ctgtactatg tggccgagtc ttttaacgat 2100gccaaggaga aggtgagaaa tttcgccgcc acaatcccta ggcccttcag cgtgcggtac 2160gacccttata cccagaggat cgaggtgctg gataatacac agcagctgaa gatcctggct 2220gactcaatca atagcgaaat cggaatcctg tgctccgccc tgcagaaaat caaatgagaa 2280ttcaaggcct ctcgagcctc tagaactata gtgagtcgta ttacgtagat ccagacatga 2340taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 2400tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 2460ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt 2520tttaagcttt acgtacgatc gtcgaagcgt ttgagggatt ctaaatagaa ggacaagagt 2580aaaaatgtca ggctggatcg atgcaggcca ctaagaaatg gattcaggtg atggcagtgg 2640gaagaaagga cctgatgccc agaggcattt ctggagaaga tgagatcaga cttgtgattg 2700gctgaacaca cactgtagtg gggtggggtt tagggggtga ctcaacttca agcccaggta 2760cattcaagtc tgaattgccc tagtcaaaag tggcatctgt ggatgtgtat cagaaatatc 2820ttacttttct tggaagccaa caggagaaaa gagtgctacc aagtgaacta gagacaggaa 2880tatcttttgt catttcaagg aaactggaaa gaagaaggct cagtattctt tagtaggaag 2940aagacttaag tcagagactc atctgtacct ctctggcagg gtttaaaagg gggaagagga 3000atagaggctg caagagattg tgattcatgg acagtatgca gagatcaaat gacctgggtt 3060cagatcctgg ctccactgct aactgtgtaa ctataggcaa gttccttaac ctctctaagc 3120cttaatcttg tcatcaataa aagggggcac ttggtgccta ataaaaccta cctcttaggt 3180tgttgccaaa ttacatgaga taatccaaat caagtgctta ttataatacc cagaaattat 3240aggctctaaa taaatgttta tataggctct aaataaatga agttttttag aaagataaca 3300tcatgatcaa aatgggatat ttaacagttt agtcttccat ttcat 3345873637DNAArtificial SequencepHMI-hPAH-hAC-008 correction genome from 5' ITR to 3' ITR 87ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct atcttccatt tactgagtgt ttatgtggaa 240gaactgtact aaattttaat gcatttcttt attcctattc ttaaaacctt ccagcaaggt 300ggctctacca ccctcttttc cgagcttcag gagcagttgt gcgaatagct ggagaacacc 360aggctggatt taaacccaga tcgctcttac atttgctctt tacctgctgt gctcagcgtt 420cacgtgccct ctagctgtag ttttctgaag tcagcgcaca gcaaggcagt gtgcttagag 480gttaacagaa gggaaaacaa caacaacaaa aatctaaatg agaatcctga ctgtttcagc 540tgggggtaag gggggcggat tattcatata attgttatac cagacggtcg caggcttagt 600ccaattgcag agaactcgct tcccaggctt ctgagagtcc cggaagtgcc taaacctgtc 660taatcgacgg ggcttgggtg gcccgtcgct ccctggcttc ttccctttac ccagggcggg 720cagcgaagtg gtgcctcctg cgtcccccac accctccctc agcccctccc ctccggcccg 780tcctgggcag gtgacctgga gcatccggca ggctgccctg gcctcctgcg tcaggacaac 840gcccacgagg ggcgttactg tgcggagatg caccacgcaa gagacaccct ttgtaactct 900cttctcctcc ctagtgcgag gttaaaacct tcagccccac gtgctgtttg caaacctgcc 960tgtacctgag gccctaaaaa gccagagacc tcactcccgg ggagccagca tgtccaccgc 1020tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg agacttcata 1080cattgaggat aactgtaacc agaatggcgc catctctctg atcttcagcc tgaaggagga 1140agtgggcgcc ctggcaaagg tgctgcgcct gtttgaggag aacgacgtga atctgaccca 1200catcgagtcc cggccttcta gactgaagaa ggacgagtac gagttcttta cccacctgga 1260taagcggtcc ctgccagccc tgacaaacat catcaagatc ctgaggcacg acatcggagc 1320aaccgtgcac gagctgtctc gggacaagaa gaaggatacc gtgccctggt tccctcggac 1380aatccaggag ctggatagat ttgccaacca gatcctgtct tacggagcag agctggacgc 1440agatcaccct ggcttcaagg acccagtgta tcgggcccgg agaaagcagt ttgccgatat 1500cgcctacaat tataggcacg gacagccaat ccctcgcgtg gagtatatgg aggaggagaa 1560gaagacctgg ggcacagtgt tcaagaccct gaagagcctg tacaagacac acgcctgcta 1620cgagtataac cacatcttcc ccctgctgga gaagtattgt ggctttcacg aggacaatat 1680ccctcagctg gaggacgtga gccagttcct gcagacctgc acaggcttta ggctgaggcc 1740agtggcagga ctgctgagct cccgggactt cctgggagga ctggccttca gagtgtttca 1800ctgcacccag tacatcaggc acggctccaa gccaatgtat acaccagagc ccgacatctg 1860tcacgagctg ctgggccacg tgcccctgtt tagcgataga tccttcgccc agttttccca 1920ggagatcgga ctggcatctc tgggagcacc tgacgagtac atcgagaagc tggccaccat 1980ctattggttc acagtggagt ttggcctgtg caagcagggc gatagcatca aggcctacgg 2040agcaggactg ctgtctagct tcggcgagct gcagtattgt ctgtccgaga agccaaagct 2100gctgcccctg gagctggaga agaccgccat ccagaactac accgtgacag agttccagcc 2160cctgtactat gtggccgagt cttttaacga tgccaaggag aaggtgagaa atttcgccgc 2220cacaatccct aggcccttca gcgtgcggta cgacccttat acccagagga tcgaggtgct 2280ggataataca cagcagctga agatcctggc tgactcaatc aatagcgaaa tcggaatcct 2340gtgctccgcc ctgcagaaaa tcaaatgaga attcaaggcc tctcgagcct ctagaactat 2400agtgagtcgt attacgtaga tccagacatg ataagataca ttgatgagtt tggacaaacc 2460acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta 2520tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg 2580tttcaggttc agggggaggt gtgggaggtt ttttaagctt tacgtacgat cgtcgatcca 2640ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 2700acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatccgaaga 2760ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 2820gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 2880atctgtcctc ggtggctttc acaggaatga atgaccattg ctttaggggg ttggggatct 2940ggcctccaga actgccacca attagctgtg tgtctttgga caagttactg tccctctctg 3000ttgtctgttt actcttctgt acactgaagg ggctggtccc taatgatctg ggatgggatg 3060tggaatcctt ctagatttct tttgtaatat ttataaagtg ctctcagcaa ggtatcaaaa 3120tggcaaaatt gtgagtaact atcctccttt cattttggga agaagatgag gcatgaagag 3180aattcagaca gaaacttact cagaccaggg gaggcagaaa ctaagcagag aggaaaatga 3240ccaagagtta gccctgggca tggaatgtga aagaacccta aacgtgactt ggaaataatg 3300cccaaggtat attccattct ccgggatttg ttggcatttt cttgaggtga agaattgcag 3360aatacattct ttaatgtgac ctacatattt acccatggga ggaagtctgc tcctggactc 3420ttgagattca gtcataaacc tgcaggtcta gatacgtaga taagtagcat ggcgggttaa 3480tcattaacta caaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct 3540cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct 3600cagtgagcga gcgagcgcgc agagagggag tggccaa 3637883755DNAArtificial SequencepHMI-hPAH-h1C-007 correction genome from 5' ITR to 3' ITR 88ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgca atggttccaa aattttctat ggttaagaat 240cacctgggat ggttttgaaa tggcagattc taagacaact tgattcaaca ggtttaggta 300aagcccaggg aactgcatta taagaaggaa tcacctgtaa ttttggagtc aagatccaag 360gaacactcat tgagaaacac tgatttacaa agtgcatgga gagaaatgga gcaagtgaag 420ggggatcagc atggtgaaat ataggctgtt aggagtgcta ttgactaact gtctggtgac 480tggaccagag taaatctttt actttgcaag aaacaggact aaattcccat attatgtcca 540tagcaaaggg aattatgtag aaaaattgat aattaggagc ctgagttctt gaccagcctc 600cactacctat gtggcctcag gtgagttatt ttctcccttt ggctctaagt tttccccatc 660tgtaatgtaa gggagtttaa ctagatgagc actaaggaca aatcaatttc tgtgagtcaa 720ttattatgaa ataccatgtg ggcatcaaat gccaagtgga aagcatagat aaagaagtga 780ttgtgcacct gggctgaggg gaacaaacat ttcctaagag aattgagacc caaaagagcc 840tttaaggaag gtgagatctt ggaaagggaa atttggtgaa tactctaatg aggagctaaa 900aaggcaagaa agaaagcagc ttggctggaa aggaggttcc tgtaggtggg cctccagaga 960ttcggtacca cagaaactgc caaacatcag caagaagcca tggggatgga agcttctgac 1020ctcttctctt cctcccacag ggcggtacca gatctggcag cggagagggc agaggaagtc 1080ttctaacatg cggtgacgtg gaggagaatc ccggccctag gggtaccatg tccaccgctg 1140tgctggagaa ccctgggctg gggaggaaac tgtcagactt cgggcaggag acttcataca 1200ttgaggataa ctgtaaccag aatggcgcca tctctctgat cttcagcctg aaggaggaag 1260tgggcgccct ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat ctgacccaca 1320tcgagtcccg gccttctaga ctgaagaagg acgagtacga gttctttacc cacctggata 1380agcggtccct gccagccctg acaaacatca tcaagatcct gaggcacgac atcggagcaa 1440ccgtgcacga gctgtctcgg gacaagaaga aggataccgt gccctggttc cctcggacaa 1500tccaggagct ggatagattt gccaaccaga tcctgtctta cggagcagag ctggacgcag 1560atcaccctgg cttcaaggac ccagtgtatc gggcccggag aaagcagttt gccgatatcg 1620cctacaatta taggcacgga cagccaatcc ctcgcgtgga gtatatggag gaggagaaga 1680agacctgggg cacagtgttc aagaccctga agagcctgta caagacacac gcctgctacg 1740agtataacca catcttcccc ctgctggaga agtattgtgg ctttcacgag gacaatatcc 1800ctcagctgga ggacgtgagc cagttcctgc agacctgcac aggctttagg ctgaggccag 1860tggcaggact gctgagctcc cgggacttcc tgggaggact ggccttcaga gtgtttcact 1920gcacccagta catcaggcac ggctccaagc caatgtatac accagagccc gacatctgtc 1980acgagctgct gggccacgtg cccctgttta gcgatagatc cttcgcccag ttttcccagg 2040agatcggact ggcatctctg ggagcacctg acgagtacat cgagaagctg gccaccatct 2100attggttcac agtggagttt ggcctgtgca agcagggcga tagcatcaag gcctacggag 2160caggactgct gtctagcttc ggcgagctgc agtattgtct gtccgagaag ccaaagctgc 2220tgcccctgga gctggagaag accgccatcc agaactacac cgtgacagag ttccagcccc 2280tgtactatgt ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat ttcgccgcca 2340caatccctag gcccttcagc gtgcggtacg acccttatac ccagaggatc gaggtgctgg 2400ataatacaca gcagctgaag atcctggctg actcaatcaa tagcgaaatc ggaatcctgt 2460gctccgccct gcagaaaatc aaatgagaat tcaaggcctc tcgagcctct agaactatag 2520tgagtcgtat tacgtagatc cagacatgat aagatacatt gatgagtttg gacaaaccac 2580aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt 2640tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt 2700tcaggttcag ggggaggtgt gggaggtttt ttaagcttta cgtacgatcg tcgaagcgtt 2760tgagggattc taaatagaag gacaagagta aaaatgtcag gctggatcga tgcaggccac 2820taagaaatgg attcaggtga tggcagtggg aagaaaggac ctgatgccca gaggcatttc 2880tggagaagat gagatcagac ttgtgattgg ctgaacacac actgtagtgg ggtggggttt 2940agggggtgac tcaacttcaa gcccaggtac attcaagtct gaattgccct agtcaaaagt 3000ggcatctgtg gatgtgtatc agaaatatct tacttttctt ggaagccaac aggagaaaag 3060agtgctacca agtgaactag agacaggaat atcttttgtc atttcaagga aactggaaag 3120aagaaggctc agtattcttt agtaggaaga agacttaagt cagagactca tctgtacctc 3180tctggcaggg tttaaaaggg ggaagaggaa tagaggctgc aagagattgt gattcatgga 3240cagtatgcag agatcaaatg acctgggttc agatcctggc tccactgcta actgtgtaac 3300tataggcaag ttccttaacc tctctaagcc ttaatcttgt catcaataaa agggggcact 3360tggtgcctaa taaaacctac ctcttaggtt gttgccaaat tacatgagat aatccaaatc 3420aagtgcttat tataataccc agaaattata ggctctaaat aaatgtttat ataggctcta 3480aataaatgaa gttttttaga aagataacat catgatcaaa atgggatatt taacagttta 3540gtcttccatt tcataacctg caggtctaga tacgtagata agtagcatgg cgggttaatc 3600attaactaca aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg 3660ctcactgagg ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca 3720gtgagcgagc gagcgcgcag agagggagtg gccaa 37558920DNAHomo sapiens 89ccaaatccca ccagctcact 209021DNAHomo sapiens 90tcccatgaaa ctgaggtgtg a 219120DNAArtificial SequencePAH_Genomic Set 1, primer F 91gctccatcct gcacatagtt 209223DNAArtificial SequencePAH_Genomic Set 1, primer R 92cctatgcttt cctgatgaga tcc

239323DNAArtificial SequencePAH_Genomic Set 1, probe 93ttggtgctgc tggcaatacg gtc 239422DNAArtificial SequenceSV40_FAM Set 1, primer F 94gcaatagcat cacaaatttc ac 229525DNAArtificial SequenceSV40_FAM Set 1, primer R 95gatccagaca tgataagata cattg 259628DNAArtificial SequenceSV40_FAM Set 1, probe 96tcactgcatt ctagttgtgg tttgtcca 289721DNAArtificial SequencePAH_HA Set 1, primer F 97tccagtcacc agacagttag t 219822DNAArtificial SequencePAH_HA Set 1, primer R 98ggagagaaat ggagcaagtg aa 229928DNAArtificial SequencePAH_HA Set 1, probe 99acagcctata tttcaccatg ctgatccc 28100800DNAMus musculus 100agcattagct tccatttatg cagtgtaaat ggtgagaaca gccccgactg aatacccaga 60gcatcatctc gtctgtgtca ttcatgcaca taacatatct cagcgaggtg gcccttctgt 120cctctttgca gagacccagc caccatacta gtacctagag aactggctgg atttcagccc 180cgatacctcc gggcttttgc tcatgttcgc ctcatagggt catctgggtg gttgcctaag 240gaaaagtatg tcatggagac taacttgctt ggcattgaat aaaaggtgag ttgagagtgg 300agcgtgttta aattgcaatc ctgcctctat ttctgtgctt gcagggaaca gtcatcctta 360attgctatcc tccatcatca tcatgattat ttctggtttt tctctggttg cggagaatcc 420atactccagg tattccaatg tctcagcatt gccaggcctg tctgagcgtc aggatgtagg 480tagtctgggc tctctgcctt ctattcttgt ccaggatact ctgccaaaag aatcatgttg 540tggctgccac ccctcccaca aagcctcccg cttgggtcag tccaggactg gagttgggta 600tggactgttc atgtctatcc actgctacgt cagggcaaca cccactgaga gtgaccttgt 660agactgcagt gggagacacc cttcaaaacc tctcctctcc tgtcctgaga gccaggttaa 720aaccatcagc cccgcatcct gagtgcaaac ttttcctaac cctgctgcta agctagacac 780ctcacttact gagagccagc 800101800DNAMus musculus 101gcagctgttg tcctggagaa cggagtcctg agcagaaaac tctcagactt tgggcaggta 60agcctgttgg gcttccactg ctaggagaga attggttccc cacatgtgaa agcagtctgg 120gaaatgctgg tatttccagt ctcctaaggc tactaagaaa tatgacttta tttagaggcg 180aggaaaatgc ccaggaagtc aactgatgag actagtctta acaagttgag gatacagaaa 240gttggggatc tgagctgcta ccaacatctg tgtgtctttg ggtggctcat tggtatcctc 300tgcctattgg ctttatcttc tgtacactga aaggaaatgg ctggtcctta gtcacctggg 360gtgggagtcc ctatctctcc agggatactt attcaatcct ttcttctggg tatcaaaatg 420acaagcttgt aagaaactgt cctctttcgg ctttcaggag gtgatgtcgc atgaagagaa 480tttggggggg gggacttact cagaaccaag gagggagaaa ttaaacagag agggaaatga 540acaggagtta gcccggagcc tgaagcacct tggggattat gctgggggtg gagggaatcc 600attgtcctcc ctagggaggg cttgcagaac atgttctttt ctgtgatatt tgtactttcc 660ccagattgca aatcatggtt tgtacactga gattcagtct ctggaggtaa tatgcctttt 720ctagcttttc cttggacagg actaaggggt tgagggttgc ctggagtcag agaaatttgt 780gttaaagaag gttgatatga 80010222DNAArtificial SequencemPAH_ATG_gDNA_FAM Set 1, primer F 102cagcatcaga agcagaacat tt 2210321DNAArtificial SequencemPAH_ATG_gDNA_FAM Set 1, primer R 103aaagcacatc agcagtttca a 2110429DNAArtificial SequencemPAH_ATG_gDNA_FAM Set 1, probe 104agatgaaagc aactgaacat cgactacga 2910522DNAArtificial SequenceSV40_FAM Set 1, primer F 105gcaatagcat cacaaatttc ac 2210625DNAArtificial SequenceSV40_FAM Set 1, primer R 106gatccagaca tgataagata cattg 2510728DNAArtificial SequenceSV40_FAM Set 1, probe 107tcactgcatt ctagttgtgg tttgtcca 2810821DNAArtificial SequencemPah_1C_LHA_FAM Set 3, primer F 108gcaagctcca gatcaccaat a 2110923DNAArtificial SequencemPah_1C_LHA_FAM Set 3, primer R 109ctgagcaatg cattcagcaa taa 2311024DNAArtificial SequencemPah_1C_LHA_FAM Set 3, probe 110ccctgaacat cccttgacag agca 24111800DNAMus musculus 111agcattagct tccatttatg cagtgtaaat ggtgagaaca gccccgactg aatacccaga 60gcatcatctc gtctgtgtca ttcatgcaca taacatatct cagcgaggtg gcccttctgt 120cctctttgca gagacccagc caccatacta gtacctagag aactggctgg atttcagccc 180cgatacctcc gggcttttgc tcatgttcgc ctcatagggt catctgggtg gttgcctaag 240gaaaagtatg tcatggagac taacttgctt ggcattgaat aaaaggtgag ttgagagtgg 300agcgtgttta aattgcaatc ctgcctctat ttctgtgctt gcagggaaca gtcatcctta 360attgctatcc tccatcatca tcatgattat ttctggtttt tctctggttg cggagaatcc 420atactccagg tattccaatg tctcagcatt gccaggcctg tctgagcgtc aggatgtagg 480tagtctgggc tctctgcctt ctattcttgt ccaggatact ctgccaaaag aatcatgttg 540tggctgccac ccctcccaca aagcctcccg cttgggtcag tccaggactg gagttgggta 600tggactgttc atgtctatcc actgctacgt cagggcaaca cccactgaga gtgaccttgt 660agactgcagt gggagacacc cttcaaaacc tctcctctcc tgtcctgaga gccaggttaa 720aaccatcagc cccgcatcct gagtgcaaac ttttcctaac cctgctgcta agctagacac 780ctcacttact gagagccagc 800112800DNAMus musculus 112gcagctgttg tcctggagaa cggagtcctg agcagaaaac tctcagactt tgggcaggta 60agcctgttgg gcttccactg ctaggagaga attggttccc cacatgtgaa agcagtctgg 120gaaatgctgg tatttccagt ctcctaaggc tactaagaaa tatgacttta tttagaggcg 180aggaaaatgc ccaggaagtc aactgatgag actagtctta acaagttgag gatacagaaa 240gttggggatc tgagctgcta ccaacatctg tgtgtctttg ggtggctcat tggtatcctc 300tgcctattgg ctttatcttc tgtacactga aaggaaatgg ctggtcctta gtcacctggg 360gtgggagtcc ctatctctcc agggatactt attcaatcct ttcttctggg tatcaaaatg 420acaagcttgt aagaaactgt cctctttcgg ctttcaggag gtgatgtcgc atgaagagaa 480tttggggggg gggacttact cagaaccaag gagggagaaa ttaaacagag agggaaatga 540acaggagtta gcccggagcc tgaagcacct tggggattat gctgggggtg gagggaatcc 600attgtcctcc ctagggaggg cttgcagaac atgttctttt ctgtgatatt tgtactttcc 660ccagattgca aatcatggtt tgtacactga gattcagtct ctggaggtaa tatgcctttt 720ctagcttttc cttggacagg actaaggggt tgagggttgc ctggagtcag agaaatttgt 780gttaaagaag gttgatatga 8001133227DNAArtificial Sequence006 vector correction genome 113agcattagct tccatttatg cagtgtaaat ggtgagaaca gccccgactg aatacccaga 60gcatcatctc gtctgtgtca ttcatgcaca taacatatct cagcgaggtg gcccttctgt 120cctctttgca gagacccagc caccatacta gtacctagag aactggctgg atttcagccc 180cgatacctcc gggcttttgc tcatgttcgc ctcatagggt catctgggtg gttgcctaag 240gaaaagtatg tcatggagac taacttgctt ggcattgaat aaaaggtgag ttgagagtgg 300agcgtgttta aattgcaatc ctgcctctat ttctgtgctt gcagggaaca gtcatcctta 360attgctatcc tccatcatca tcatgattat ttctggtttt tctctggttg cggagaatcc 420atactccagg tattccaatg tctcagcatt gccaggcctg tctgagcgtc aggatgtagg 480tagtctgggc tctctgcctt ctattcttgt ccaggatact ctgccaaaag aatcatgttg 540tggctgccac ccctcccaca aagcctcccg cttgggtcag tccaggactg gagttgggta 600tggactgttc atgtctatcc actgctacgt cagggcaaca cccactgaga gtgaccttgt 660agactgcagt gggagacacc cttcaaaacc tctcctctcc tgtcctgaga gccaggttaa 720aaccatcagc cccgcatcct gagtgcaaac ttttcctaac cctgctgcta agctagacac 780ctcacttact gagagccagc atgtccaccg ctgtgctgga gaaccctggg ctggggagga 840aactgtcaga cttcgggcag gagacttcat acattgagga taactgtaac cagaatggcg 900ccatctctct gatcttcagc ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc 960tgtttgagga gaacgacgtg aatctgaccc acatcgagtc ccggccttct agactgaaga 1020aggacgagta cgagttcttt acccacctgg ataagcggtc cctgccagcc ctgacaaaca 1080tcatcaagat cctgaggcac gacatcggag caaccgtgca cgagctgtct cgggacaaga 1140agaaggatac cgtgccctgg ttccctcgga caatccagga gctggataga tttgccaacc 1200agatcctgtc ttacggagca gagctggacg cagatcaccc tggcttcaag gacccagtgt 1260atcgggcccg gagaaagcag tttgccgata tcgcctacaa ttataggcac ggacagccaa 1320tccctcgcgt ggagtatatg gaggaggaga agaagacctg gggcacagtg ttcaagaccc 1380tgaagagcct gtacaagaca cacgcctgct acgagtataa ccacatcttc cccctgctgg 1440agaagtattg tggctttcac gaggacaata tccctcagct ggaggacgtg agccagttcc 1500tgcagacctg cacaggcttt aggctgaggc cagtggcagg actgctgagc tcccgggact 1560tcctgggagg actggccttc agagtgtttc actgcaccca gtacatcagg cacggctcca 1620agccaatgta tacaccagag cccgacatct gtcacgagct gctgggccac gtgcccctgt 1680ttagcgatag atccttcgcc cagttttccc aggagatcgg actggcatct ctgggagcac 1740ctgacgagta catcgagaag ctggccacca tctattggtt cacagtggag tttggcctgt 1800gcaagcaggg cgatagcatc aaggcctacg gagcaggact gctgtctagc ttcggcgagc 1860tgcagtattg tctgtccgag aagccaaagc tgctgcccct ggagctggag aagaccgcca 1920tccagaacta caccgtgaca gagttccagc ccctgtacta tgtggccgag tcttttaacg 1980atgccaagga gaaggtgaga aatttcgccg ccacaatccc taggcccttc agcgtgcggt 2040acgaccctta tacccagagg atcgaggtgc tggataatac acagcagctg aagatcctgg 2100ctgactcaat caatagcgaa atcggaatcc tgtgctccgc cctgcagaaa atcaaatgag 2160aattcaaggc ctctcgagcc tctagaacta tagtgagtcg tattacgtag atccagacat 2220gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt 2280tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca 2340agttaacaac aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt 2400tttttaagct ttacgtacga tcgtcgagca gctgttgtcc tggagaacgg agtcctgagc 2460agaaaactct cagactttgg gcaggtaagc ctgttgggct tccactgcta ggagagaatt 2520ggttccccac atgtgaaagc agtctgggaa atgctggtat ttccagtctc ctaaggctac 2580taagaaatat gactttattt agaggcgagg aaaatgccca ggaagtcaac tgatgagact 2640agtcttaaca agttgaggat acagaaagtt ggggatctga gctgctacca acatctgtgt 2700gtctttgggt ggctcattgg tatcctctgc ctattggctt tatcttctgt acactgaaag 2760gaaatggctg gtccttagtc acctggggtg ggagtcccta tctctccagg gatacttatt 2820caatcctttc ttctgggtat caaaatgaca agcttgtaag aaactgtcct ctttcggctt 2880tcaggaggtg atgtcgcatg aagagaattt gggggggggg acttactcag aaccaaggag 2940ggagaaatta aacagagagg gaaatgaaca ggagttagcc cggagcctga agcaccttgg 3000ggattatgct gggggtggag ggaatccatt gtcctcccta gggagggctt gcagaacatg 3060ttcttttctg tgatatttgt actttcccca gattgcaaat catggtttgt acactgagat 3120tcagtctctg gaggtaatat gccttttcta gcttttcctt ggacaggact aaggggttga 3180gggttgcctg gagtcagaga aatttgtgtt aaagaaggtt gatatga 32271143635DNAArtificial Sequence006 vector correction genome (+ ITRs) 114ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgca gcattagctt ccatttatgc agtgtaaatg 240gtgagaacag ccccgactga atacccagag catcatctcg tctgtgtcat tcatgcacat 300aacatatctc agcgaggtgg cccttctgtc ctctttgcag agacccagcc accatactag 360tacctagaga actggctgga tttcagcccc gatacctccg ggcttttgct catgttcgcc 420tcatagggtc atctgggtgg ttgcctaagg aaaagtatgt catggagact aacttgcttg 480gcattgaata aaaggtgagt tgagagtgga gcgtgtttaa attgcaatcc tgcctctatt 540tctgtgcttg cagggaacag tcatccttaa ttgctatcct ccatcatcat catgattatt 600tctggttttt ctctggttgc ggagaatcca tactccaggt attccaatgt ctcagcattg 660ccaggcctgt ctgagcgtca ggatgtaggt agtctgggct ctctgccttc tattcttgtc 720caggatactc tgccaaaaga atcatgttgt ggctgccacc cctcccacaa agcctcccgc 780ttgggtcagt ccaggactgg agttgggtat ggactgttca tgtctatcca ctgctacgtc 840agggcaacac ccactgagag tgaccttgta gactgcagtg ggagacaccc ttcaaaacct 900ctcctctcct gtcctgagag ccaggttaaa accatcagcc ccgcatcctg agtgcaaact 960tttcctaacc ctgctgctaa gctagacacc tcacttactg agagccagca tgtccaccgc 1020tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg agacttcata 1080cattgaggat aactgtaacc agaatggcgc catctctctg atcttcagcc tgaaggagga 1140agtgggcgcc ctggcaaagg tgctgcgcct gtttgaggag aacgacgtga atctgaccca 1200catcgagtcc cggccttcta gactgaagaa ggacgagtac gagttcttta cccacctgga 1260taagcggtcc ctgccagccc tgacaaacat catcaagatc ctgaggcacg acatcggagc 1320aaccgtgcac gagctgtctc gggacaagaa gaaggatacc gtgccctggt tccctcggac 1380aatccaggag ctggatagat ttgccaacca gatcctgtct tacggagcag agctggacgc 1440agatcaccct ggcttcaagg acccagtgta tcgggcccgg agaaagcagt ttgccgatat 1500cgcctacaat tataggcacg gacagccaat ccctcgcgtg gagtatatgg aggaggagaa 1560gaagacctgg ggcacagtgt tcaagaccct gaagagcctg tacaagacac acgcctgcta 1620cgagtataac cacatcttcc ccctgctgga gaagtattgt ggctttcacg aggacaatat 1680ccctcagctg gaggacgtga gccagttcct gcagacctgc acaggcttta ggctgaggcc 1740agtggcagga ctgctgagct cccgggactt cctgggagga ctggccttca gagtgtttca 1800ctgcacccag tacatcaggc acggctccaa gccaatgtat acaccagagc ccgacatctg 1860tcacgagctg ctgggccacg tgcccctgtt tagcgataga tccttcgccc agttttccca 1920ggagatcgga ctggcatctc tgggagcacc tgacgagtac atcgagaagc tggccaccat 1980ctattggttc acagtggagt ttggcctgtg caagcagggc gatagcatca aggcctacgg 2040agcaggactg ctgtctagct tcggcgagct gcagtattgt ctgtccgaga agccaaagct 2100gctgcccctg gagctggaga agaccgccat ccagaactac accgtgacag agttccagcc 2160cctgtactat gtggccgagt cttttaacga tgccaaggag aaggtgagaa atttcgccgc 2220cacaatccct aggcccttca gcgtgcggta cgacccttat acccagagga tcgaggtgct 2280ggataataca cagcagctga agatcctggc tgactcaatc aatagcgaaa tcggaatcct 2340gtgctccgcc ctgcagaaaa tcaaatgaga attcaaggcc tctcgagcct ctagaactat 2400agtgagtcgt attacgtaga tccagacatg ataagataca ttgatgagtt tggacaaacc 2460acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta 2520tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg 2580tttcaggttc agggggaggt gtgggaggtt ttttaagctt tacgtacgat cgtcgagcag 2640ctgttgtcct ggagaacgga gtcctgagca gaaaactctc agactttggg caggtaagcc 2700tgttgggctt ccactgctag gagagaattg gttccccaca tgtgaaagca gtctgggaaa 2760tgctggtatt tccagtctcc taaggctact aagaaatatg actttattta gaggcgagga 2820aaatgcccag gaagtcaact gatgagacta gtcttaacaa gttgaggata cagaaagttg 2880gggatctgag ctgctaccaa catctgtgtg tctttgggtg gctcattggt atcctctgcc 2940tattggcttt atcttctgta cactgaaagg aaatggctgg tccttagtca cctggggtgg 3000gagtccctat ctctccaggg atacttattc aatcctttct tctgggtatc aaaatgacaa 3060gcttgtaaga aactgtcctc tttcggcttt caggaggtga tgtcgcatga agagaatttg 3120ggggggggga cttactcaga accaaggagg gagaaattaa acagagaggg aaatgaacag 3180gagttagccc ggagcctgaa gcaccttggg gattatgctg ggggtggagg gaatccattg 3240tcctccctag ggagggcttg cagaacatgt tcttttctgt gatatttgta ctttccccag 3300attgcaaatc atggtttgta cactgagatt cagtctctgg aggtaatatg ccttttctag 3360cttttccttg gacaggacta aggggttgag ggttgcctgg agtcagagaa atttgtgtta 3420aagaaggttg atatgacctg caggtctaga tacgtagata agtagcatgg cgggttaatc 3480attaactaca aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg 3540ctcactgagg ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca 3600gtgagcgagc gagcgcgcag agagggagtg gccaa 3635115960DNAHomo sapiens 115gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatctga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 9601161353DNAArtificial SequenceSilently altered PAH coding sequence 116tccaccgctg tgctggagaa ccctgggctg gggaggaaac tgtcagactt cgggcaggag 60acttcataca ttgaggataa ctgtaaccag aatggcgcca tctctctgat cttcagcctg 120aaggaggaag tgggcgccct ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat 180ctgacccaca tcgagtcccg gccttctaga ctgaagaagg acgagtacga gttctttacc 240cacctggata agcggtccct gccagccctg acaaacatca tcaagatcct gaggcacgac 300atcggagcaa ccgtgcacga gctgtctcgg gacaagaaga aggataccgt gccctggttc 360cctcggacaa tccaggagct ggatagattt gccaaccaga tcctgtctta cggagcagag 420ctggacgcag atcaccctgg cttcaaggac ccagtgtatc gggcccggag aaagcagttt 480gccgatatcg cctacaatta taggcacgga cagccaatcc ctcgcgtgga gtatatggag 540gaggagaaga agacctgggg cacagtgttc aagaccctga agagcctgta caagacacac 600gcctgctacg agtataacca catcttcccc ctgctggaga agtattgtgg ctttcacgag 660gacaatatcc ctcagctgga ggacgtgagc cagttcctgc agacctgcac aggctttagg 720ctgaggccag tggcaggact gctgagctcc cgggacttcc tgggaggact ggccttcaga 780gtgtttcact gcacccagta catcaggcac ggctccaagc caatgtatac accagagccc 840gacatctgtc acgagctgct gggccacgtg cccctgttta gcgatagatc cttcgcccag 900ttttcccagg agatcggact ggcatctctg ggagcacctg acgagtacat cgagaagctg 960gccaccatct attggttcac agtggagttt ggcctgtgca agcagggcga tagcatcaag 1020gcctacggag caggactgct gtctagcttc ggcgagctgc agtattgtct gtccgagaag 1080ccaaagctgc tgcccctgga gctggagaag accgccatcc agaactacac cgtgacagag 1140ttccagcccc tgtactatgt ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat 1200ttcgccgcca caatccctag gcccttcagc gtgcggtacg acccttatac ccagaggatc 1260gaggtgctgg ataatacaca gcagctgaag atcctggctg actcaatcaa tagcgaaatc 1320ggaatcctgt gctccgccct gcagaaaatc aaa 1353117910DNAHomo sapiens 117ctgggatggg atgtggaatc cttctagatt tcttttgtaa tatttataaa gtgctctcag 60caaggtatca aaatggcaaa attgtgagta actatcctcc tttcattttg ggaagaagat 120gaggcatgaa gagaattcag acagaaactt actcagacca ggggaggcag aaactaagca 180gagaggaaaa tgaccaagag ttagccctgg gcatggaatg tgaaagaacc ctaaacgtga 240cttggaaata atgcccaagg tatattccat tctccgggat ttgttggcat tttcttgagg 300tgaagaattg cagaatacat tctttaatgt gacctacata tttacccatg ggaggaagtc

360tgctcctgga ctcttgagat tcagtcataa agcccaggcc agggaaataa tgtaagtctg 420caggcccctg tcatcagtag gattagggag aagagttctc agtagaaaac agggaggctg 480gagagaaaag aatggttaat gttaacgtta atataactag aaagactgca gaacttagga 540ctgattttta tttgaatcct taaaaaaaaa atttcttatg aaaatagtac atggctctta 600ggagacagaa cttattgtac agaggaacag cgtgagagtc agagtgatcc cagaacaggt 660cctggctcca tcctgcacat agttttggtg ctgctggcaa tacggtcccc acaactgtgg 720gaaggggtta ggggcaggga tctcatcagg aaagcatagg ggtttaaagt tctttataga 780gcacttagaa gattgagaat ccacaaatta tattaataac aaacaaagta gtgtcgtgtt 840atatagtaaa tgtgaatttg cagacacatt tagggaaaag ttataattaa aaaaataggc 900tgtatatata 9101183713DNAArtificial Sequence032 correction vector genome 118gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatctga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcggtacc agatctggca gcggagaggg 1020cagaggaagt cttctaacat gcggtgacgt ggaggagaat cccggcccta ggggtacctc 1080caccgctgtg ctggagaacc ctgggctggg gaggaaactg tcagacttcg ggcaggagac 1140ttcatacatt gaggataact gtaaccagaa tggcgccatc tctctgatct tcagcctgaa 1200ggaggaagtg ggcgccctgg caaaggtgct gcgcctgttt gaggagaacg acgtgaatct 1260gacccacatc gagtcccggc cttctagact gaagaaggac gagtacgagt tctttaccca 1320cctggataag cggtccctgc cagccctgac aaacatcatc aagatcctga ggcacgacat 1380cggagcaacc gtgcacgagc tgtctcggga caagaagaag gataccgtgc cctggttccc 1440tcggacaatc caggagctgg atagatttgc caaccagatc ctgtcttacg gagcagagct 1500ggacgcagat caccctggct tcaaggaccc agtgtatcgg gcccggagaa agcagtttgc 1560cgatatcgcc tacaattata ggcacggaca gccaatccct cgcgtggagt atatggagga 1620ggagaagaag acctggggca cagtgttcaa gaccctgaag agcctgtaca agacacacgc 1680ctgctacgag tataaccaca tcttccccct gctggagaag tattgtggct ttcacgagga 1740caatatccct cagctggagg acgtgagcca gttcctgcag acctgcacag gctttaggct 1800gaggccagtg gcaggactgc tgagctcccg ggacttcctg ggaggactgg ccttcagagt 1860gtttcactgc acccagtaca tcaggcacgg ctccaagcca atgtatacac cagagcccga 1920catctgtcac gagctgctgg gccacgtgcc cctgtttagc gatagatcct tcgcccagtt 1980ttcccaggag atcggactgg catctctggg agcacctgac gagtacatcg agaagctggc 2040caccatctat tggttcacag tggagtttgg cctgtgcaag cagggcgata gcatcaaggc 2100ctacggagca ggactgctgt ctagcttcgg cgagctgcag tattgtctgt ccgagaagcc 2160aaagctgctg cccctggagc tggagaagac cgccatccag aactacaccg tgacagagtt 2220ccagcccctg tactatgtgg ccgagtcttt taacgatgcc aaggagaagg tgagaaattt 2280cgccgccaca atccctaggc ccttcagcgt gcggtacgac ccttataccc agaggatcga 2340ggtgctggat aatacacagc agctgaagat cctggctgac tcaatcaata gcgaaatcgg 2400aatcctgtgc tccgccctgc agaaaatcaa aggtaagcct atccctaacc ctctcctcgg 2460tctcgattct acgtgatctt gtggaaagga cgaaacaccg gggaattcaa ggcctctcga 2520gcctctagaa tccccgagac gtttcgtctc gggatcacta tagtgagtcg tattacgtac 2580acagtgcagg ggaaagaata gtagagatcc agacatgata agatacattg atgagtttgg 2640acaaaccaca actagaatgc agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat 2700tgctttattt gtaaccatta taagctgcaa taaacaagtt aacaacaaca attgcattca 2760ttttatgttt caggttcagg gggaggtgtg ggaggttttt taactgggat gggatgtgga 2820atccttctag atttcttttg taatatttat aaagtgctct cagcaaggta tcaaaatggc 2880aaaattgtga gtaactatcc tcctttcatt ttgggaagaa gatgaggcat gaagagaatt 2940cagacagaaa cttactcaga ccaggggagg cagaaactaa gcagagagga aaatgaccaa 3000gagttagccc tgggcatgga atgtgaaaga accctaaacg tgacttggaa ataatgccca 3060aggtatattc cattctccgg gatttgttgg cattttcttg aggtgaagaa ttgcagaata 3120cattctttaa tgtgacctac atatttaccc atgggaggaa gtctgctcct ggactcttga 3180gattcagtca taaagcccag gccagggaaa taatgtaagt ctgcaggccc ctgtcatcag 3240taggattagg gagaagagtt ctcagtagaa aacagggagg ctggagagaa aagaatggtt 3300aatgttaacg ttaatataac tagaaagact gcagaactta ggactgattt ttatttgaat 3360ccttaaaaaa aaaatttctt atgaaaatag tacatggctc ttaggagaca gaacttattg 3420tacagaggaa cagcgtgaga gtcagagtga tcccagaaca ggtcctggct ccatcctgca 3480catagttttg gtgctgctgg caatacggtc cccacaactg tgggaagggg ttaggggcag 3540ggatctcatc aggaaagcat aggggtttaa agttctttat agagcactta gaagattgag 3600aatccacaaa ttatattaat aacaaacaaa gtagtgtcgt gttatatagt aaatgtgaat 3660ttgcagacac atttagggaa aagttataat taaaaaaata ggctgtatat ata 37131194139DNAArtificial Sequence032 vector correction genome (+ ITRs) 119ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatctgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cggtaccaga tctggcagcg gagagggcag aggaagtctt ctaacatgcg gtgacgtgga 1260ggagaatccc ggccctaggg gtacctccac cgctgtgctg gagaaccctg ggctggggag 1320gaaactgtca gacttcgggc aggagacttc atacattgag gataactgta accagaatgg 1380cgccatctct ctgatcttca gcctgaagga ggaagtgggc gccctggcaa aggtgctgcg 1440cctgtttgag gagaacgacg tgaatctgac ccacatcgag tcccggcctt ctagactgaa 1500gaaggacgag tacgagttct ttacccacct ggataagcgg tccctgccag ccctgacaaa 1560catcatcaag atcctgaggc acgacatcgg agcaaccgtg cacgagctgt ctcgggacaa 1620gaagaaggat accgtgccct ggttccctcg gacaatccag gagctggata gatttgccaa 1680ccagatcctg tcttacggag cagagctgga cgcagatcac cctggcttca aggacccagt 1740gtatcgggcc cggagaaagc agtttgccga tatcgcctac aattataggc acggacagcc 1800aatccctcgc gtggagtata tggaggagga gaagaagacc tggggcacag tgttcaagac 1860cctgaagagc ctgtacaaga cacacgcctg ctacgagtat aaccacatct tccccctgct 1920ggagaagtat tgtggctttc acgaggacaa tatccctcag ctggaggacg tgagccagtt 1980cctgcagacc tgcacaggct ttaggctgag gccagtggca ggactgctga gctcccggga 2040cttcctggga ggactggcct tcagagtgtt tcactgcacc cagtacatca ggcacggctc 2100caagccaatg tatacaccag agcccgacat ctgtcacgag ctgctgggcc acgtgcccct 2160gtttagcgat agatccttcg cccagttttc ccaggagatc ggactggcat ctctgggagc 2220acctgacgag tacatcgaga agctggccac catctattgg ttcacagtgg agtttggcct 2280gtgcaagcag ggcgatagca tcaaggccta cggagcagga ctgctgtcta gcttcggcga 2340gctgcagtat tgtctgtccg agaagccaaa gctgctgccc ctggagctgg agaagaccgc 2400catccagaac tacaccgtga cagagttcca gcccctgtac tatgtggccg agtcttttaa 2460cgatgccaag gagaaggtga gaaatttcgc cgccacaatc cctaggccct tcagcgtgcg 2520gtacgaccct tatacccaga ggatcgaggt gctggataat acacagcagc tgaagatcct 2580ggctgactca atcaatagcg aaatcggaat cctgtgctcc gccctgcaga aaatcaaagg 2640taagcctatc cctaaccctc tcctcggtct cgattctacg tgatcttgtg gaaaggacga 2700aacaccgggg aattcaaggc ctctcgagcc tctagaatcc ccgagacgtt tcgtctcggg 2760atcactatag tgagtcgtat tacgtacaca gtgcagggga aagaatagta gagatccaga 2820catgataaga tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg 2880ctttatttgt gaaatttgtg atgctattgc tttatttgta accattataa gctgcaataa 2940acaagttaac aacaacaatt gcattcattt tatgtttcag gttcaggggg aggtgtggga 3000ggttttttaa ctgggatggg atgtggaatc cttctagatt tcttttgtaa tatttataaa 3060gtgctctcag caaggtatca aaatggcaaa attgtgagta actatcctcc tttcattttg 3120ggaagaagat gaggcatgaa gagaattcag acagaaactt actcagacca ggggaggcag 3180aaactaagca gagaggaaaa tgaccaagag ttagccctgg gcatggaatg tgaaagaacc 3240ctaaacgtga cttggaaata atgcccaagg tatattccat tctccgggat ttgttggcat 3300tttcttgagg tgaagaattg cagaatacat tctttaatgt gacctacata tttacccatg 3360ggaggaagtc tgctcctgga ctcttgagat tcagtcataa agcccaggcc agggaaataa 3420tgtaagtctg caggcccctg tcatcagtag gattagggag aagagttctc agtagaaaac 3480agggaggctg gagagaaaag aatggttaat gttaacgtta atataactag aaagactgca 3540gaacttagga ctgattttta tttgaatcct taaaaaaaaa atttcttatg aaaatagtac 3600atggctctta ggagacagaa cttattgtac agaggaacag cgtgagagtc agagtgatcc 3660cagaacaggt cctggctcca tcctgcacat agttttggtg ctgctggcaa tacggtcccc 3720acaactgtgg gaaggggtta ggggcaggga tctcatcagg aaagcatagg ggtttaaagt 3780tctttataga gcacttagaa gattgagaat ccacaaatta tattaataac aaacaaagta 3840gtgtcgtgtt atatagtaaa tgtgaatttg cagacacatt tagggaaaag ttataattaa 3900aaaaataggc tgtatatata ctagatacgt agataagtag cctgcaggtc tagatacgta 3960gataagtagc atggcgggtt aatcattaac tacaaggaac ccctagtgat ggagttggcc 4020actccctctc tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc 4080ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc gcagagaggg agtggccaa 413912097DNAArtificial SequenceChymeric MVM intron (ChiMVM) 120gtaagggttt aagggatggt tggttggtgg ggtattaatg tttaattacc tggagcacct 60gcctgaaatc acctgacctc ttctcttcct cccacag 9712197DNAArtificial SequenceSV40 intron 121gtaagtttag tctttttgtc ttttatttca ggtcccggat ccggtggtgg tgcaaatcaa 60agaactgctc ctcagtggat gttgccttta cttctag 97122521DNAArtificial SequenceAdenovirus tripartite leader intron (AdTPL) 122gtcctcactc tcttccgcat cgctgtctgc gagggccagc tgttgggctc gcggttgagg 60acaaactctt cgcggtcttt ccagtactct tggatcggaa acccgtcggc ctccgaacgg 120tactccgcca ccgagggacc tgagcgagtc cgcatcgacc ggatcggaaa acctctcgag 180aaaggcgtct aaccagtcac agtcgcaagg taggctgagc accgtggcgg gcggcagcgg 240gtggcggtcg gggttgtttc tggcggaggt gctgctgatg atgtaattaa agtaggcggt 300cttgagacgg cggatggtcg aggtgaggtg tggcaggctt gagatccagc tgttggggtg 360agtactccct ctcaaaagcg ggcattactt ctgcgctaag attgtcagtt tccaaaaacg 420aggaggattt gatattcacc tggcccgatc tggccataca cttgagtgac aatgacatcc 480actttgcctt tctctccaca ggtgtccact cccaggtcca g 521123124DNAHomo sapiens 123gtaagtatca aggttacaag acaggtttaa ggagaccaat agaaactggg catgtggaga 60cagagaagac tcttgggttt ctgataggca ctgactctct tcctttgtcc tgttcccatt 120tcag 124124230DNAArtificial SequenceAdV/Ig chimeric intron (AdVIgG) 124gtgagtactc cctctcaaaa gcgggcatga cttctgcgct aagattgtca gtttccaaaa 60acgaggagga tttgatattc acctggcccg cggtgatgcc tttgagggtg gccgcgtcca 120tctggtcaga aaagacaatc tttttgttgt caagcttgag gtgtggcagg cttgagatct 180ggccatacac ttgagtgaca atgacatcca ctttgccttt ctctccacag 230125133DNAArtificial SequenceBeta globin Ig heavy chain intron (beta-globinIg) 125gtaagtatca aggttacaag acaggtttaa ggagaccaat agaaactggg cttgtcgaga 60cagagaagac tcttgcgttt ctgataggca cctattggtc ttactgacat ccactttgcc 120tttctctcca cag 13312682DNAArtificial SequenceMVM intron 126gtaagggttt aagggatggt tggttggtgg ggtattaatg tttaattacc tggagcacct 60gcctgaaatc actttttttc ag 82127618DNAArtificial SequenceHCR1 element (OptHCR) 127gtaagtttta tggaatgtga atcataattc aatttttcaa catgcgttag gagggacatt 60tcaaactctt ttttacccta gactttccta ccatcaccca gagtatccag ccaggagggg 120aggggctaga gacaccagaa gtttagcagg gaggagggcg tagggattcg gggaatgaag 180ggatgggatt cagactaggg ccaggaccca gggatggaga gaaagagatg agagtggttt 240gggggcttgg tgacttagag aacagagctg caggctcaga ggcacacagg agtttctggg 300ctggcccggc ccccttccaa cccctcatta tggaatccag cagctgtttg tgtgctgcct 360ctgaagtcca cactgaacaa acttcagcct actcatgtcc catataaggg aaattatgga 420atcagcaaac agcaaacaca cagccctccc tgcctgctga ccttggacct ggggcagagg 480tcagagacct ccttggctct atgccacctc caacatccac tcgacccctt ggaatttcgg 540tggagaggag cagaggttgt cctggcgtgg tttaggtagt gtgagagggc tgaccatgcc 600ttcttctttt tcctacag 618128476DNAHomo sapiens 128gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg cctctttgca 240ccattctaaa gaataacagt gataatttct gggttaaggc aatagcaata tttctgcata 300taaatatttc tgcatataaa ttgtaactga tgtaagaggt ttcatattgc taatagcagc 360tacaatccag ctaccattct gcttttattt tatggttggg ataaggctgg attattctga 420gtccaagcta ggcccttttg ctaatcatgt tcatacctct tatcttcctc ccacag 476129299DNAArtificial SequencetFIX intron (FIX intron) 129gtaagtttcc ttttttaaaa tacattgagt atgcttgcct tttagatata gaaatatctg 60atgctgtctt cttcactaaa ttttgattac atgatttgac agcaatattg aagagtctaa 120cagccagcac gcaggttggc aactactgtg ggaacatcac agattttggc tccatgccct 180aaagagaaat tggctttcag attatttgga ttaaaaacaa agactttctt aagagatgta 240aaattttcat gatgttttct tttttgctaa aactaaagaa ttattctttt acatttcag 299130900DNAArtificial Sequencech2BLood intron (BloodEnh) 130gtaagtagtc tacactgggg ctaagtaaac atttactgag tgaaagaata aatacgtgca 60gaacccagcc aacagagagc atccccggag gtggggccat gccctcaggc actcagagga 120ggcaggcctc tggcagtagc taagcagatt cccgtctcag atgtcagccc tgcccaccct 180tctgtgcccc cccgcccccc tggttggtgt ttgtgggaca gtttccactg tgttgcctgg 240gaaacgaggc atcctgccac caccactccc cacctccggg ctgccaacac ctaccacgcc 300cggcttgggg gttttggctg gtttcccttg tgtcctagtc agcttgagaa accctcggat 360gcactcgcca cttttacagt gtggctttgc tcatctgggt gggaggtact gcctggggtg 420agctcatcac ctctggttcc tcagtgcaag gcactaaagt ctcttggcac tgagttctta 480caacttgttc caggggatat ttggtggttg atggtcacca cccatgtgtc atggtccctg 540agcatccccc gccaccccac tgctccctat tttggcagtt actgtcaccc tctagggatg 600cagggatgca gtttacctat ctagagtgcg gtgatcaggt ggggaagtac aaatggcaat 660tgacagctag agagcttgaa accctcccac ttggctctgc tcaccctgga ctctgggaga 720cctcagctgc ccagcagtgg aggctggggc agcagagggg ccagacctgg gagcccagaa 780gcctggatct gagtctgact cactgctgac ctttgacccc tggaggcttg ggcaagctga 840ggaacttctc tggtcttaat cctgtgggtg actgaccatg ccttcttctt tttcctacag 9001311977DNAArtificial Sequence006-HCR vector PAH coding sequence 131atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gtaagtttta tggaatgtga atcataattc aatttttcaa catgcgttag gagggacatt 120tcaaactctt ttttacccta gactttccta ccatcaccca gagtatccag ccaggagggg 180aggggctaga gacaccagaa gtttagcagg gaggagggcg tagggattcg gggaatgaag 240ggatgggatt cagactaggg ccaggaccca gggatggaga gaaagagatg agagtggttt 300gggggcttgg tgacttagag aacagagctg caggctcaga ggcacacagg agtttctggg 360ctggcccggc ccccttccaa cccctcatta tggaatccag cagctgtttg tgtgctgcct 420ctgaagtcca cactgaacaa acttcagcct actcatgtcc catataaggg aaattatgga 480atcagcaaac agcaaacaca cagccctccc tgcctgctga ccttggacct ggggcagagg 540tcagagacct ccttggctct atgccacctc caacatccac tcgacccctt ggaatttcgg 600tggagaggag cagaggttgt cctggcgtgg tttaggtagt gtgagagggc tgaccatgcc 660ttcttctttt tcctacagga aacttcatac attgaggata actgtaacca gaatggcgcc 720atctctctga tcttcagcct gaaggaggaa gtgggcgccc tggcaaaggt gctgcgcctg 780tttgaggaga acgacgtgaa tctgacccac atcgagtccc ggccttctag actgaagaag 840gacgagtacg agttctttac ccacctggat aagcggtccc tgccagccct gacaaacatc 900atcaagatcc tgaggcacga catcggagca accgtgcacg agctgtctcg ggacaagaag 960aaggataccg tgccctggtt ccctcggaca atccaggagc tggatagatt tgccaaccag 1020atcctgtctt acggagcaga gctggacgca gatcaccctg gcttcaagga cccagtgtat 1080cgggcccgga gaaagcagtt tgccgatatc gcctacaatt ataggcacga acagccaatc 1140cctcgcgtgg agtatatgga ggaggagaag aagacctggg gcacagtgtt caagaccctg 1200aagagcctgt acaagacaca cgcctgctac gagtataacc acatcttccc cctgctggag 1260aagtattgtg gctttcacga ggacaatatc cctcagctgg aggacgtgag ccagttcctg 1320cagacctgca caggctttag gctgaggcca gtggcaggac tgctgagctc ccgggacttc 1380ctgggaggac tggccttcag agtgtttcac tgcacccagt acatcaggca cggctccaag 1440ccaatgtata caccagagcc cgacatctgt cacgagctgc tgggccacgt gcccctgttt 1500agcgatagat ccttcgccca gttttcccag gagatcggac tggcatctct gggagcacct 1560gacgagtaca tcgagaagct ggccaccatc tattggttca cagtggagtt tggcctgtgc 1620aagcagggcg atagcatcaa ggcctacgga gcaggactgc tgtctagctt cggcgagctg 1680cagtattgtc tgtccgagaa gccaaagctg ctgcccctgg agctggagaa gaccgccatc 1740cagaactaca ccgtgacaga gttccagccc ctgtactatg tggccgagtc ttttaacgat 1800gccaaggaga aggtgagaaa tttcgccgcc acaatcccta ggcccttcag cgtgcggtac 1860gacccttata cccagaggat cgaggtgctg gataatacac agcagctgaa gatcctggct 1920gactcaatca atagcgaaat cggaatcctg tgctccgccc tgcagaaaat caaatga 19771321971DNAArtificial Sequence032-HCR vector PAH coding sequence

132tccaccgctg tgctggagaa ccctgggctg gggaggaaac tgtcagactt cgggcaggta 60agttttatgg aatgtgaatc ataattcaat ttttcaacat gcgttaggag ggacatttca 120aactcttttt taccctagac tttcctacca tcacccagag tatccagcca ggaggggagg 180ggctagagac accagaagtt tagcagggag gagggcgtag ggattcgggg aatgaaggga 240tgggattcag actagggcca ggacccaggg atggagagaa agagatgaga gtggtttggg 300ggcttggtga cttagagaac agagctgcag gctcagaggc acacaggagt ttctgggctg 360gcccggcccc cttccaaccc ctcattatgg aatccagcag ctgtttgtgt gctgcctctg 420aagtccacac tgaacaaact tcagcctact catgtcccat ataagggaaa ttatggaatc 480agcaaacagc aaacacacag ccctccctgc ctgctgacct tggacctggg gcagaggtca 540gagacctcct tggctctatg ccacctccaa catccactcg accccttgga atttcggtgg 600agaggagcag aggttgtcct ggcgtggttt aggtagtgtg agagggctga ccatgccttc 660ttctttttcc tacaggaaac ttcatacatt gaggataact gtaaccagaa tggcgccatc 720tctctgatct tcagcctgaa ggaggaagtg ggcgccctgg caaaggtgct gcgcctgttt 780gaggagaacg acgtgaatct gacccacatc gagtcccggc cttctagact gaagaaggac 840gagtacgagt tctttaccca cctggataag cggtccctgc cagccctgac aaacatcatc 900aagatcctga ggcacgacat cggagcaacc gtgcacgagc tgtctcggga caagaagaag 960gataccgtgc cctggttccc tcggacaatc caggagctgg atagatttgc caaccagatc 1020ctgtcttacg gagcagagct ggacgcagat caccctggct tcaaggaccc agtgtatcgg 1080gcccggagaa agcagtttgc cgatatcgcc tacaattata ggcacggaca gccaatccct 1140cgcgtggagt atatggagga ggagaagaag acctggggca cagtgttcaa gaccctgaag 1200agcctgtaca agacacacgc ctgctacgag tataaccaca tcttccccct gctggagaag 1260tattgtggct ttcacgagga caatatccct cagctggagg acgtgagcca gttcctgcag 1320acctgcacag gctttaggct gaggccagtg gcaggactgc tgagctcccg ggacttcctg 1380ggaggactgg ccttcagagt gtttcactgc acccagtaca tcaggcacgg ctccaagcca 1440atgtatacac cagagcccga catctgtcac gagctgctgg gccacgtgcc cctgtttagc 1500gatagatcct tcgcccagtt ttcccaggag atcggactgg catctctggg agcacctgac 1560gagtacatcg agaagctggc caccatctat tggttcacag tggagtttgg cctgtgcaag 1620cagggcgata gcatcaaggc ctacggagca ggactgctgt ctagcttcgg cgagctgcag 1680tattgtctgt ccgagaagcc aaagctgctg cccctggagc tggagaagac cgccatccag 1740aactacaccg tgacagagtt ccagcccctg tactatgtgg ccgagtcttt taacgatgcc 1800aaggagaagg tgagaaattt cgccgccaca atccctaggc ccttcagcgt gcggtacgac 1860ccttataccc agaggatcga ggtgctggat aatacacagc agctgaagat cctggctgac 1920tcaatcaata gcgaaatcgg aatcctgtgc tccgccctgc agaaaatcaa a 1971133174DNAArtificial SequenceID cassette 133ggtaagccta tccctaaccc tctcctcggt ctcgattcta cgtgatcttg tggaaaggac 60gaaacaccgg ggaattcaag gcctctcgag cctctagaat ccccgagacg tttcgtctcg 120ggatcactat agtgagtcgt attacgtaca cagtgcaggg gaaagaatag taga 174134800DNAArtificial Sequence006-HCR vector correction genome 134gcagctgttg tcctggagaa cggagtcctg agcagaaaac tctcagactt tgggcaggta 60agcctgttgg gcttccactg ctaggagaga attggttccc cacatgtgaa agcagtctgg 120gaaatgctgg tatttccagt ctcctaaggc tactaagaaa tatgacttta tttagaggcg 180aggaaaatgc ccaggaagtc aactgatgag actagtctta acaagttgag gatacagaaa 240gttggggatc tgagctgcta ccaacatctg tgtgtctttg ggtggctcat tggtatcctc 300tgcctattgg ctttatcttc tgtacactga aaggaaatgg ctggtcctta gtcacctggg 360gtgggagtcc ctatctctcc agggatactt attcaatcct ttcttctggg tatcaaaatg 420acaagcttgt aagaaactgt cctctttcgg ctttcaggag gtgatgtcgc atgaagagaa 480tttggggggg gggacttact cagaaccaag gagggagaaa ttaaacagag agggaaatga 540acaggagtta gcccggagcc tgaagcacct tggggattat gctgggggtg gagggaatcc 600attgtcctcc ctagggaggg cttgcagaac atgttctttt ctgtgatatt tgtactttcc 660ccagattgca aatcatggtt tgtacactga gattcagtct ctggaggtaa tatgcctttt 720ctagcttttc cttggacagg actaaggggt tgagggttgc ctggagtcag agaaatttgt 780gttaaagaag gttgatatga 8001354253DNAArtificial Sequence006-HCR vector correction genome (+ITRs) 135ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgca gcattagctt ccatttatgc agtgtaaatg 240gtgagaacag ccccgactga atacccagag catcatctcg tctgtgtcat tcatgcacat 300aacatatctc agcgaggtgg cccttctgtc ctctttgcag agacccagcc accatactag 360tacctagaga actggctgga tttcagcccc gatacctccg ggcttttgct catgttcgcc 420tcatagggtc atctgggtgg ttgcctaagg aaaagtatgt catggagact aacttgcttg 480gcattgaata aaaggtgagt tgagagtgga gcgtgtttaa attgcaatcc tgcctctatt 540tctgtgcttg cagggaacag tcatccttaa ttgctatcct ccatcatcat catgattatt 600tctggttttt ctctggttgc ggagaatcca tactccaggt attccaatgt ctcagcattg 660ccaggcctgt ctgagcgtca ggatgtaggt agtctgggct ctctgccttc tattcttgtc 720caggatactc tgccaaaaga atcatgttgt ggctgccacc cctcccacaa agcctcccgc 780ttgggtcagt ccaggactgg agttgggtat ggactgttca tgtctatcca ctgctacgtc 840agggcaacac ccactgagag tgaccttgta gactgcagtg ggagacaccc ttcaaaacct 900ctcctctcct gtcctgagag ccaggttaaa accatcagcc ccgcatcctg agtgcaaact 960tttcctaacc ctgctgctaa gctagacacc tcacttactg agagccagca tgtccaccgc 1020tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg taagttttat 1080ggaatgtgaa tcataattca atttttcaac atgcgttagg agggacattt caaactcttt 1140tttaccctag actttcctac catcacccag agtatccagc caggagggga ggggctagag 1200acaccagaag tttagcaggg aggagggcgt agggattcgg ggaatgaagg gatgggattc 1260agactagggc caggacccag ggatggagag aaagagatga gagtggtttg ggggcttggt 1320gacttagaga acagagctgc aggctcagag gcacacagga gtttctgggc tggcccggcc 1380cccttccaac ccctcattat ggaatccagc agctgtttgt gtgctgcctc tgaagtccac 1440actgaacaaa cttcagccta ctcatgtccc atataaggga aattatggaa tcagcaaaca 1500gcaaacacac agccctccct gcctgctgac cttggacctg gggcagaggt cagagacctc 1560cttggctcta tgccacctcc aacatccact cgaccccttg gaatttcggt ggagaggagc 1620agaggttgtc ctggcgtggt ttaggtagtg tgagagggct gaccatgcct tcttcttttt 1680cctacaggaa acttcataca ttgaggataa ctgtaaccag aatggcgcca tctctctgat 1740cttcagcctg aaggaggaag tgggcgccct ggcaaaggtg ctgcgcctgt ttgaggagaa 1800cgacgtgaat ctgacccaca tcgagtcccg gccttctaga ctgaagaagg acgagtacga 1860gttctttacc cacctggata agcggtccct gccagccctg acaaacatca tcaagatcct 1920gaggcacgac atcggagcaa ccgtgcacga gctgtctcgg gacaagaaga aggataccgt 1980gccctggttc cctcggacaa tccaggagct ggatagattt gccaaccaga tcctgtctta 2040cggagcagag ctggacgcag atcaccctgg cttcaaggac ccagtgtatc gggcccggag 2100aaagcagttt gccgatatcg cctacaatta taggcacgaa cagccaatcc ctcgcgtgga 2160gtatatggag gaggagaaga agacctgggg cacagtgttc aagaccctga agagcctgta 2220caagacacac gcctgctacg agtataacca catcttcccc ctgctggaga agtattgtgg 2280ctttcacgag gacaatatcc ctcagctgga ggacgtgagc cagttcctgc agacctgcac 2340aggctttagg ctgaggccag tggcaggact gctgagctcc cgggacttcc tgggaggact 2400ggccttcaga gtgtttcact gcacccagta catcaggcac ggctccaagc caatgtatac 2460accagagccc gacatctgtc acgagctgct gggccacgtg cccctgttta gcgatagatc 2520cttcgcccag ttttcccagg agatcggact ggcatctctg ggagcacctg acgagtacat 2580cgagaagctg gccaccatct attggttcac agtggagttt ggcctgtgca agcagggcga 2640tagcatcaag gcctacggag caggactgct gtctagcttc ggcgagctgc agtattgtct 2700gtccgagaag ccaaagctgc tgcccctgga gctggagaag accgccatcc agaactacac 2760cgtgacagag ttccagcccc tgtactatgt ggccgagtct tttaacgatg ccaaggagaa 2820ggtgagaaat ttcgccgcca caatccctag gcccttcagc gtgcggtacg acccttatac 2880ccagaggatc gaggtgctgg ataatacaca gcagctgaag atcctggctg actcaatcaa 2940tagcgaaatc ggaatcctgt gctccgccct gcagaaaatc aaatgagaat tcaaggcctc 3000tcgagcctct agaactatag tgagtcgtat tacgtagatc cagacatgat aagatacatt 3060gatgagtttg gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt 3120tgtgatgcta ttgctttatt tgtaaccatt ataagctgca ataaacaagt taacaacaac 3180aattgcattc attttatgtt tcaggttcag ggggaggtgt gggaggtttt ttaagcttta 3240cgtacgatcg tcgagcagct gttgtcctgg agaacggagt cctgagcaga aaactctcag 3300actttgggca ggtaagcctg ttgggcttcc actgctagga gagaattggt tccccacatg 3360tgaaagcagt ctgggaaatg ctggtatttc cagtctccta aggctactaa gaaatatgac 3420tttatttaga ggcgaggaaa atgcccagga agtcaactga tgagactagt cttaacaagt 3480tgaggataca gaaagttggg gatctgagct gctaccaaca tctgtgtgtc tttgggtggc 3540tcattggtat cctctgccta ttggctttat cttctgtaca ctgaaaggaa atggctggtc 3600cttagtcacc tggggtggga gtccctatct ctccagggat acttattcaa tcctttcttc 3660tgggtatcaa aatgacaagc ttgtaagaaa ctgtcctctt tcggctttca ggaggtgatg 3720tcgcatgaag agaatttggg gggggggact tactcagaac caaggaggga gaaattaaac 3780agagagggaa atgaacagga gttagcccgg agcctgaagc accttgggga ttatgctggg 3840ggtggaggga atccattgtc ctccctaggg agggcttgca gaacatgttc ttttctgtga 3900tatttgtact ttccccagat tgcaaatcat ggtttgtaca ctgagattca gtctctggag 3960gtaatatgcc ttttctagct tttccttgga caggactaag gggttgaggg ttgcctggag 4020tcagagaaat ttgtgttaaa gaaggttgat atgacctgca ggtctagata cgtagataag 4080tagcatggcg ggttaatcat taactacaag gaacccctag tgatggagtt ggccactccc 4140tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc 4200tttgcccggg cggcctcagt gagcgagcga gcgcgcagag agggagtggc caa 42531364331DNAArtificial Sequence032-HCR vector correction genome 136gcttcaggag cagttgtgcg aatagctgga gaacaccagg ctggatttaa acccagatcg 60ctcttacatt tgctctttac ctgctgtgct cagcgttcac gtgccctcta gctgtagttt 120tctgaagtca gcgcacagca aggcagtgtg cttagaggtt aacagaaggg aaaacaacaa 180caacaaaaat ctaaatgaga atcctgactg tttcagctgg gggtaagggg ggcggattat 240tcatataatt gttataccag acggtcgcag gcttagtcca attgcagaga actcgcttcc 300caggcttctg agagtcccgg aagtgcctaa acctgtctaa tcgacggggc ttgggtggcc 360cgtcgctccc tggcttcttc cctttaccca gggcgggcag cgaagtggtg cctcctgcgt 420cccccacacc ctccctcagc ccctcccctc cggcccgtcc tgggcaggtg acctggagca 480tccggcaggc tgccctggcc tcctgcgtca ggacaacgcc cacgaggggc gttactgtgc 540ggagatgcac cacgcaagag acaccctttg taactctctt ctcctcccta gtgcgaggtt 600aaaaccttca gccccacgtg ctgtttgcaa acctgcctgt acctgaggcc ctaaaaagcc 660agagacctca ctcccgggga gccagcatgt ccactgcggt cctggaaaac ccaggcttgg 720gcaggaaact ctctgacttt ggacaggtga gccacggcag cctgagctgc tcagttaggg 780gaatttgggc ctccagagaa agagatctga agactgctgg tgcttcctgg tttcataagc 840tcagtaagaa gtctgaattc gttggaagct gatgagaata tccaggaagt caacagacaa 900atgtcctcaa caattgtttc taagtaggag aacatctgtc ctcggtggct ttcacaggaa 960aagcttctga cctcttctct tcctcccaca gggcggtacc agatctggca gcggagaggg 1020cagaggaagt cttctaacat gcggtgacgt ggaggagaat cccggcccta ggggtacctc 1080caccgctgtg ctggagaacc ctgggctggg gaggaaactg tcagacttcg ggcaggtaag 1140ttttatggaa tgtgaatcat aattcaattt ttcaacatgc gttaggaggg acatttcaaa 1200ctctttttta ccctagactt tcctaccatc acccagagta tccagccagg aggggagggg 1260ctagagacac cagaagttta gcagggagga gggcgtaggg attcggggaa tgaagggatg 1320ggattcagac tagggccagg acccagggat ggagagaaag agatgagagt ggtttggggg 1380cttggtgact tagagaacag agctgcaggc tcagaggcac acaggagttt ctgggctggc 1440ccggccccct tccaacccct cattatggaa tccagcagct gtttgtgtgc tgcctctgaa 1500gtccacactg aacaaacttc agcctactca tgtcccatat aagggaaatt atggaatcag 1560caaacagcaa acacacagcc ctccctgcct gctgaccttg gacctggggc agaggtcaga 1620gacctccttg gctctatgcc acctccaaca tccactcgac cccttggaat ttcggtggag 1680aggagcagag gttgtcctgg cgtggtttag gtagtgtgag agggctgacc atgccttctt 1740ctttttccta caggaaactt catacattga ggataactgt aaccagaatg gcgccatctc 1800tctgatcttc agcctgaagg aggaagtggg cgccctggca aaggtgctgc gcctgtttga 1860ggagaacgac gtgaatctga cccacatcga gtcccggcct tctagactga agaaggacga 1920gtacgagttc tttacccacc tggataagcg gtccctgcca gccctgacaa acatcatcaa 1980gatcctgagg cacgacatcg gagcaaccgt gcacgagctg tctcgggaca agaagaagga 2040taccgtgccc tggttccctc ggacaatcca ggagctggat agatttgcca accagatcct 2100gtcttacgga gcagagctgg acgcagatca ccctggcttc aaggacccag tgtatcgggc 2160ccggagaaag cagtttgccg atatcgccta caattatagg cacggacagc caatccctcg 2220cgtggagtat atggaggagg agaagaagac ctggggcaca gtgttcaaga ccctgaagag 2280cctgtacaag acacacgcct gctacgagta taaccacatc ttccccctgc tggagaagta 2340ttgtggcttt cacgaggaca atatccctca gctggaggac gtgagccagt tcctgcagac 2400ctgcacaggc tttaggctga ggccagtggc aggactgctg agctcccggg acttcctggg 2460aggactggcc ttcagagtgt ttcactgcac ccagtacatc aggcacggct ccaagccaat 2520gtatacacca gagcccgaca tctgtcacga gctgctgggc cacgtgcccc tgtttagcga 2580tagatccttc gcccagtttt cccaggagat cggactggca tctctgggag cacctgacga 2640gtacatcgag aagctggcca ccatctattg gttcacagtg gagtttggcc tgtgcaagca 2700gggcgatagc atcaaggcct acggagcagg actgctgtct agcttcggcg agctgcagta 2760ttgtctgtcc gagaagccaa agctgctgcc cctggagctg gagaagaccg ccatccagaa 2820ctacaccgtg acagagttcc agcccctgta ctatgtggcc gagtctttta acgatgccaa 2880ggagaaggtg agaaatttcg ccgccacaat ccctaggccc ttcagcgtgc ggtacgaccc 2940ttatacccag aggatcgagg tgctggataa tacacagcag ctgaagatcc tggctgactc 3000aatcaatagc gaaatcggaa tcctgtgctc cgccctgcag aaaatcaaag gtaagcctat 3060ccctaaccct ctcctcggtc tcgattctac gtgatcttgt ggaaaggacg aaacaccggg 3120gaattcaagg cctctcgagc ctctagaatc cccgagacgt ttcgtctcgg gatcactata 3180gtgagtcgta ttacgtacac agtgcagggg aaagaatagt agagatccag acatgataag 3240atacattgat gagtttggac aaaccacaac tagaatgcag tgaaaaaaat gctttatttg 3300tgaaatttgt gatgctattg ctttatttgt aaccattata agctgcaata aacaagttaa 3360caacaacaat tgcattcatt ttatgtttca ggttcagggg gaggtgtggg aggtttttta 3420actgggatgg gatgtggaat ccttctagat ttcttttgta atatttataa agtgctctca 3480gcaaggtatc aaaatggcaa aattgtgagt aactatcctc ctttcatttt gggaagaaga 3540tgaggcatga agagaattca gacagaaact tactcagacc aggggaggca gaaactaagc 3600agagaggaaa atgaccaaga gttagccctg ggcatggaat gtgaaagaac cctaaacgtg 3660acttggaaat aatgcccaag gtatattcca ttctccggga tttgttggca ttttcttgag 3720gtgaagaatt gcagaataca ttctttaatg tgacctacat atttacccat gggaggaagt 3780ctgctcctgg actcttgaga ttcagtcata aagcccaggc cagggaaata atgtaagtct 3840gcaggcccct gtcatcagta ggattaggga gaagagttct cagtagaaaa cagggaggct 3900ggagagaaaa gaatggttaa tgttaacgtt aatataacta gaaagactgc agaacttagg 3960actgattttt atttgaatcc ttaaaaaaaa aatttcttat gaaaatagta catggctctt 4020aggagacaga acttattgta cagaggaaca gcgtgagagt cagagtgatc ccagaacagg 4080tcctggctcc atcctgcaca tagttttggt gctgctggca atacggtccc cacaactgtg 4140ggaaggggtt aggggcaggg atctcatcag gaaagcatag gggtttaaag ttctttatag 4200agcacttaga agattgagaa tccacaaatt atattaataa caaacaaagt agtgtcgtgt 4260tatatagtaa atgtgaattt gcagacacat ttagggaaaa gttataatta aaaaaatagg 4320ctgtatatat a 43311374737DNAArtificial Sequence032-HCR vector correction genome (+ ITRs) 137ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgct tcaggagcag ttgtgcgaat agctggagaa 240caccaggctg gatttaaacc cagatcgctc ttacatttgc tctttacctg ctgtgctcag 300cgttcacgtg ccctctagct gtagttttct gaagtcagcg cacagcaagg cagtgtgctt 360agaggttaac agaagggaaa acaacaacaa caaaaatcta aatgagaatc ctgactgttt 420cagctggggg taaggggggc ggattattca tataattgtt ataccagacg gtcgcaggct 480tagtccaatt gcagagaact cgcttcccag gcttctgaga gtcccggaag tgcctaaacc 540tgtctaatcg acggggcttg ggtggcccgt cgctccctgg cttcttccct ttacccaggg 600cgggcagcga agtggtgcct cctgcgtccc ccacaccctc cctcagcccc tcccctccgg 660cccgtcctgg gcaggtgacc tggagcatcc ggcaggctgc cctggcctcc tgcgtcagga 720caacgcccac gaggggcgtt actgtgcgga gatgcaccac gcaagagaca ccctttgtaa 780ctctcttctc ctccctagtg cgaggttaaa accttcagcc ccacgtgctg tttgcaaacc 840tgcctgtacc tgaggcccta aaaagccaga gacctcactc ccggggagcc agcatgtcca 900ctgcggtcct ggaaaaccca ggcttgggca ggaaactctc tgactttgga caggtgagcc 960acggcagcct gagctgctca gttaggggaa tttgggcctc cagagaaaga gatctgaaga 1020ctgctggtgc ttcctggttt cataagctca gtaagaagtc tgaattcgtt ggaagctgat 1080gagaatatcc aggaagtcaa cagacaaatg tcctcaacaa ttgtttctaa gtaggagaac 1140atctgtcctc ggtggctttc acaggaaaag cttctgacct cttctcttcc tcccacaggg 1200cggtaccaga tctggcagcg gagagggcag aggaagtctt ctaacatgcg gtgacgtgga 1260ggagaatccc ggccctaggg gtacctccac cgctgtgctg gagaaccctg ggctggggag 1320gaaactgtca gacttcgggc aggtaagttt tatggaatgt gaatcataat tcaatttttc 1380aacatgcgtt aggagggaca tttcaaactc ttttttaccc tagactttcc taccatcacc 1440cagagtatcc agccaggagg ggaggggcta gagacaccag aagtttagca gggaggaggg 1500cgtagggatt cggggaatga agggatggga ttcagactag ggccaggacc cagggatgga 1560gagaaagaga tgagagtggt ttgggggctt ggtgacttag agaacagagc tgcaggctca 1620gaggcacaca ggagtttctg ggctggcccg gcccccttcc aacccctcat tatggaatcc 1680agcagctgtt tgtgtgctgc ctctgaagtc cacactgaac aaacttcagc ctactcatgt 1740cccatataag ggaaattatg gaatcagcaa acagcaaaca cacagccctc cctgcctgct 1800gaccttggac ctggggcaga ggtcagagac ctccttggct ctatgccacc tccaacatcc 1860actcgacccc ttggaatttc ggtggagagg agcagaggtt gtcctggcgt ggtttaggta 1920gtgtgagagg gctgaccatg ccttcttctt tttcctacag gaaacttcat acattgagga 1980taactgtaac cagaatggcg ccatctctct gatcttcagc ctgaaggagg aagtgggcgc 2040cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg aatctgaccc acatcgagtc 2100ccggccttct agactgaaga aggacgagta cgagttcttt acccacctgg ataagcggtc 2160cctgccagcc ctgacaaaca tcatcaagat cctgaggcac gacatcggag caaccgtgca 2220cgagctgtct cgggacaaga agaaggatac cgtgccctgg ttccctcgga caatccagga 2280gctggataga tttgccaacc agatcctgtc ttacggagca gagctggacg cagatcaccc 2340tggcttcaag gacccagtgt atcgggcccg gagaaagcag tttgccgata tcgcctacaa 2400ttataggcac ggacagccaa tccctcgcgt ggagtatatg gaggaggaga agaagacctg 2460gggcacagtg ttcaagaccc tgaagagcct gtacaagaca cacgcctgct acgagtataa 2520ccacatcttc cccctgctgg agaagtattg tggctttcac gaggacaata tccctcagct 2580ggaggacgtg agccagttcc tgcagacctg cacaggcttt aggctgaggc cagtggcagg 2640actgctgagc tcccgggact tcctgggagg actggccttc agagtgtttc actgcaccca 2700gtacatcagg cacggctcca agccaatgta tacaccagag cccgacatct gtcacgagct 2760gctgggccac gtgcccctgt ttagcgatag atccttcgcc cagttttccc aggagatcgg 2820actggcatct ctgggagcac ctgacgagta catcgagaag ctggccacca tctattggtt 2880cacagtggag tttggcctgt gcaagcaggg cgatagcatc aaggcctacg gagcaggact 2940gctgtctagc ttcggcgagc tgcagtattg tctgtccgag aagccaaagc tgctgcccct 3000ggagctggag aagaccgcca tccagaacta caccgtgaca gagttccagc ccctgtacta 3060tgtggccgag tcttttaacg atgccaagga gaaggtgaga aatttcgccg ccacaatccc 3120taggcccttc

agcgtgcggt acgaccctta tacccagagg atcgaggtgc tggataatac 3180acagcagctg aagatcctgg ctgactcaat caatagcgaa atcggaatcc tgtgctccgc 3240cctgcagaaa atcaaaggta agcctatccc taaccctctc ctcggtctcg attctacgtg 3300atcttgtgga aaggacgaaa caccggggaa ttcaaggcct ctcgagcctc tagaatcccc 3360gagacgtttc gtctcgggat cactatagtg agtcgtatta cgtacacagt gcaggggaaa 3420gaatagtaga gatccagaca tgataagata cattgatgag tttggacaaa ccacaactag 3480aatgcagtga aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac 3540cattataagc tgcaataaac aagttaacaa caacaattgc attcatttta tgtttcaggt 3600tcagggggag gtgtgggagg ttttttaact gggatgggat gtggaatcct tctagatttc 3660ttttgtaata tttataaagt gctctcagca aggtatcaaa atggcaaaat tgtgagtaac 3720tatcctcctt tcattttggg aagaagatga ggcatgaaga gaattcagac agaaacttac 3780tcagaccagg ggaggcagaa actaagcaga gaggaaaatg accaagagtt agccctgggc 3840atggaatgtg aaagaaccct aaacgtgact tggaaataat gcccaaggta tattccattc 3900tccgggattt gttggcattt tcttgaggtg aagaattgca gaatacattc tttaatgtga 3960cctacatatt tacccatggg aggaagtctg ctcctggact cttgagattc agtcataaag 4020cccaggccag ggaaataatg taagtctgca ggcccctgtc atcagtagga ttagggagaa 4080gagttctcag tagaaaacag ggaggctgga gagaaaagaa tggttaatgt taacgttaat 4140ataactagaa agactgcaga acttaggact gatttttatt tgaatcctta aaaaaaaaat 4200ttcttatgaa aatagtacat ggctcttagg agacagaact tattgtacag aggaacagcg 4260tgagagtcag agtgatccca gaacaggtcc tggctccatc ctgcacatag ttttggtgct 4320gctggcaata cggtccccac aactgtggga aggggttagg ggcagggatc tcatcaggaa 4380agcatagggg tttaaagttc tttatagagc acttagaaga ttgagaatcc acaaattata 4440ttaataacaa acaaagtagt gtcgtgttat atagtaaatg tgaatttgca gacacattta 4500gggaaaagtt ataattaaaa aaataggctg tatatatacc tgcaggtcta gatacgtaga 4560taagtagcat ggcgggttaa tcattaacta caaggaaccc ctagtgatgg agttggccac 4620tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg cccgacgccc 4680gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agagagggag tggccaa 47371381359DNAArtificial Sequence006-SD.3 vector PAH coding sequence 138atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggagatcgg actggcatct ctgggagcac ctgacgagta catcgagaag 960ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg cgatagcatc 1020aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg tctgtccgag 1080aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta caccgtgaca 1140gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga gaaggtgaga 1200aatttcgccg ccacaatccc taggcccttc agtgtgcgtt acgaccctta tacccagagg 1260atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat caatagcgaa 1320atcggaatcc tgtgctccgc cctgcagaaa atcaaatga 13591391353DNAArtificial Sequence032-SD.3 vector PAH coding sequence 139tccaccgctg tgctggagaa ccctgggctg gggaggaaac tgtcagactt cgggcaggag 60acttcataca ttgaggataa ctgtaaccag aatggcgcca tctctctgat cttcagcctg 120aaggaggaag tgggcgccct ggcaaaggtg ctgcgcctgt ttgaggagaa cgacgtgaat 180ctgacccaca tcgagtcccg gccttctaga ctgaagaagg acgagtacga gttctttacc 240cacctggata agcggtccct gccagccctg acaaacatca tcaagatcct gaggcacgac 300atcggagcaa ccgtgcacga gctgtctcgg gacaagaaga aggataccgt gccctggttc 360cctcggacaa tccaggagct ggatagattt gccaaccaga tcctgtctta cggagcagag 420ctggacgcag atcaccctgg cttcaaggac ccagtgtatc gggcccggag aaagcagttt 480gccgatatcg cctacaatta taggcacgga cagccaatcc ctcgcgtgga gtatatggag 540gaggagaaga agacctgggg cacagtgttc aagaccctga agagcctgta caagacacac 600gcctgctacg agtataacca catcttcccc ctgctggaga agtattgtgg ctttcacgag 660gacaatatcc ctcagctgga ggacgtgagc cagttcctgc agacctgcac aggctttagg 720ctgaggccag tggcaggact gctgagctcc cgggacttcc tgggaggact ggccttcaga 780gtgtttcact gcacccagta catcaggcac ggctccaagc caatgtatac accagagccc 840gacatctgtc acgagctgct gggccacgtg cccctgttta gcgatagatc cttcgcccag 900ttttcccagg agatcggact ggcatctctg ggagcacctg acgagtacat cgagaagctg 960gccaccatct attggttcac agtggagttt ggcctgtgca agcagggcga tagcatcaag 1020gcctacggag caggactgct gtctagcttc ggcgagctgc agtattgtct gtccgagaag 1080ccaaagctgc tgcccctgga gctggagaag accgccatcc agaactacac cgtgacagag 1140ttccagcccc tgtactatgt ggccgagtct tttaacgatg ccaaggagaa ggtgagaaat 1200ttcgccgcca caatccctag gcccttcagt gtgcgttacg acccttatac ccagaggatc 1260gaggtgctgg ataatacaca gcagctgaag atcctggctg actcaatcaa tagcgaaatc 1320ggaatcctgt gctccgccct gcagaaaatc aaa 135314037DNAArtificial Sequence37 bp additional 3' ITR sequence from wtAAV2 140gtagataagt agcatggcgg gttaatcatt aactaca 37141180DNAArtificial Sequence3' ITR with additional 37 bp sequence 141gtagataagt agcatggcgg gttaatcatt aactacaagg aacccctagt gatggagttg 60gccactccct ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga 120cgcccgggct ttgcccgggc ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc 180142800DNAMus musculus 142agcattagct tccatttatg cagtgtaaat ggtgagaaca gccccgactg aatacccaga 60gcatcatctc gtctgtgtca ttcatgcaca taacatatct cagcgaggtg gcccttctgt 120cctctttgca gagacccagc caccatacta gtacctagag aactggctgg atttcagccc 180cgatacctcc gggcttttgc tcatgttcgc ctcatagggt catctgggtg gttgcctaag 240gaaaagtatg tcatggagac taacttgctt ggcattgaat aaaaggtgag ttgagagtgg 300agcgtgttta aattgcaatc ctgcctctat ttctgtgctt gcagggaaca gtcatcctta 360attgctatcc tccatcatca tcatgattat ttctggtttt tctctggttg cggagaatcc 420atactccagg tattccaatg tctcagcatt gccaggcctg tctgagcgtc aggatgtagg 480tagtctgggc tctctgcctt ctattcttgt ccaggatact ctgccaaaag aatcatgttg 540tggctgccac ccctcccaca aagcctcccg cttgggtcag tccaggactg gagttgggta 600tggactgttc atgtctatcc actgctacgt cagggcaaca cccactgaga gtgaccttgt 660agactgcagt gggagacacc cttcaaaacc tctcatctcc tgtcctgaga gccaggttaa 720aaccatcagc cccgcatcct gagtgcaaac ttttcctaac cctgctgcta agctagacac 780ctcacttact gagagccagc 8001431475DNAArtificial Sequence006-HBB1 vector PAH coding sequence 143atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggttggtat ccaggttaca aggcagctca caagaagaag ttgggtgctt 960ggagacagag gtctgctttc cagcagacac taactttcag tgtcccctgt ctatgtttcc 1020ctttttagga gatcggactg gcatctctgg gagcacctga cgagtacatc gagaagctgg 1080ccaccatcta ttggttcaca gtggagtttg gcctgtgcaa gcagggcgat agcatcaagg 1140cctacggagc aggactgctg tctagcttcg gcgagctgca gtattgtctg tccgagaagc 1200caaagctgct gcccctggag ctggagaaga ccgccatcca gaactacacc gtgacagagt 1260tccagcccct gtactatgtg gccgagtctt ttaacgatgc caaggagaag gtgagaaatt 1320tcgccgccac aatccctagg cccttcagcg tgcggtacga cccttatacc cagaggatcg 1380aggtgctgga taatacacag cagctgaaga tcctggctga ctcaatcaat agcgaaatcg 1440gaatcctgtg ctccgccctg cagaaaatca aatga 1475144800DNAMus musculus 144gcagctgttg tcctggagaa cggagtcctg agcagaaaac tctcagactt tgggcaggta 60agcctgttgg gcttccactg ctaggagaga attggttccc cacatgtgaa agcagtctgg 120gaaatgctgg tatttccagt ctcctaaggc tactaagaaa tatgacttta tttagaggcg 180agaaaaatgc ccaggaagtc aactgatgag actagtctta acaagttgag gatacagaaa 240gttggggatc tgagctgcta ccaacatctg tgtgtctttg ggtggctcat tggtatcctc 300tgcctattgg ctttatcttc tgtacactga aaggaaatgg ctggtcctta gtcacctggg 360gtgggagtcc ctatctctcc agggatactt attcaatcct ttcttctggg tatcaaaatg 420acaagcttgt aagaaactgt cctctttcgg ctttcaggag gtgatgtcgc atgaagagaa 480tttggggggg gggacttact cagaaccaag gagggagaaa ttaaacagag agggaaatga 540acaggagtta gcccggagcc tgaagcacct tggggattat gctgggggtg gagggaatcc 600attgtcctcc ctagggaggg cttgcagaac atgttctttt ctgtgatatt tgtactttcc 660ccagattgca aatcatggtt tgtacactga gattcagtct ctggaggtaa tatgcctttt 720ctagcttttc cttggacagg actaaggggt tgagggttgc ctggagtcag agaaatttgt 780gttaaagaag gttgatatga 8001453343DNAArtificial Sequence006-HBB1 vector correction genome 145agcattagct tccatttatg cagtgtaaat ggtgagaaca gccccgactg aatacccaga 60gcatcatctc gtctgtgtca ttcatgcaca taacatatct cagcgaggtg gcccttctgt 120cctctttgca gagacccagc caccatacta gtacctagag aactggctgg atttcagccc 180cgatacctcc gggcttttgc tcatgttcgc ctcatagggt catctgggtg gttgcctaag 240gaaaagtatg tcatggagac taacttgctt ggcattgaat aaaaggtgag ttgagagtgg 300agcgtgttta aattgcaatc ctgcctctat ttctgtgctt gcagggaaca gtcatcctta 360attgctatcc tccatcatca tcatgattat ttctggtttt tctctggttg cggagaatcc 420atactccagg tattccaatg tctcagcatt gccaggcctg tctgagcgtc aggatgtagg 480tagtctgggc tctctgcctt ctattcttgt ccaggatact ctgccaaaag aatcatgttg 540tggctgccac ccctcccaca aagcctcccg cttgggtcag tccaggactg gagttgggta 600tggactgttc atgtctatcc actgctacgt cagggcaaca cccactgaga gtgaccttgt 660agactgcagt gggagacacc cttcaaaacc tctcatctcc tgtcctgaga gccaggttaa 720aaccatcagc cccgcatcct gagtgcaaac ttttcctaac cctgctgcta agctagacac 780ctcacttact gagagccagc atgtccaccg ctgtgctgga gaaccctggg ctggggagga 840aactgtcaga cttcgggcag gagacttcat acattgagga taactgtaac cagaatggcg 900ccatctctct gatcttcagc ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc 960tgtttgagga gaacgacgtg aatctgaccc acatcgagtc ccggccttct agactgaaga 1020aggacgagta cgagttcttt acccacctgg ataagcggtc cctgccagcc ctgacaaaca 1080tcatcaagat cctgaggcac gacatcggag caaccgtgca cgagctgtct cgggacaaga 1140agaaggatac cgtgccctgg ttccctcgga caatccagga gctggataga tttgccaacc 1200agatcctgtc ttacggagca gagctggacg cagatcaccc tggcttcaag gacccagtgt 1260atcgggcccg gagaaagcag tttgccgata tcgcctacaa ttataggcac ggacagccaa 1320tccctcgcgt ggagtatatg gaggaggaga agaagacctg gggcacagtg ttcaagaccc 1380tgaagagcct gtacaagaca cacgcctgct acgagtataa ccacatcttc cccctgctgg 1440agaagtattg tggctttcac gaggacaata tccctcagct ggaggacgtg agccagttcc 1500tgcagacctg cacaggcttt aggctgaggc cagtggcagg actgctgagc tcccgggact 1560tcctgggagg actggccttc agagtgtttc actgcaccca gtacatcagg cacggctcca 1620agccaatgta tacaccagag cccgacatct gtcacgagct gctgggccac gtgcccctgt 1680ttagcgatag atccttcgcc cagttttccc aggttggtat ccaggttaca aggcagctca 1740caagaagaag ttgggtgctt ggagacagag gtctgctttc cagcagacac taactttcag 1800tgtcccctgt ctatgtttcc ctttttagga gatcggactg gcatctctgg gagcacctga 1860cgagtacatc gagaagctgg ccaccatcta ttggttcaca gtggagtttg gcctgtgcaa 1920gcagggcgat agcatcaagg cctacggagc aggactgctg tctagcttcg gcgagctgca 1980gtattgtctg tccgagaagc caaagctgct gcccctggag ctggagaaga ccgccatcca 2040gaactacacc gtgacagagt tccagcccct gtactatgtg gccgagtctt ttaacgatgc 2100caaggagaag gtgagaaatt tcgccgccac aatccctagg cccttcagcg tgcggtacga 2160cccttatacc cagaggatcg aggtgctgga taatacacag cagctgaaga tcctggctga 2220ctcaatcaat agcgaaatcg gaatcctgtg ctccgccctg cagaaaatca aatgagaatt 2280caaggcctct cgagcctcta gaactatagt gagtcgtatt acgtagatcc agacatgata 2340agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa atgctttatt 2400tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa taaacaagtt 2460aacaacaaca attgcattca ttttatgttt caggttcagg gggaggtgtg ggaggttttt 2520taagctttac gtacgatcgt cgagcagctg ttgtcctgga gaacggagtc ctgagcagaa 2580aactctcaga ctttgggcag gtaagcctgt tgggcttcca ctgctaggag agaattggtt 2640ccccacatgt gaaagcagtc tgggaaatgc tggtatttcc agtctcctaa ggctactaag 2700aaatatgact ttatttagag gcgagaaaaa tgcccaggaa gtcaactgat gagactagtc 2760ttaacaagtt gaggatacag aaagttgggg atctgagctg ctaccaacat ctgtgtgtct 2820ttgggtggct cattggtatc ctctgcctat tggctttatc ttctgtacac tgaaaggaaa 2880tggctggtcc ttagtcacct ggggtgggag tccctatctc tccagggata cttattcaat 2940cctttcttct gggtatcaaa atgacaagct tgtaagaaac tgtcctcttt cggctttcag 3000gaggtgatgt cgcatgaaga gaatttgggg ggggggactt actcagaacc aaggagggag 3060aaattaaaca gagagggaaa tgaacaggag ttagcccgga gcctgaagca ccttggggat 3120tatgctgggg gtggagggaa tccattgtcc tccctaggga gggcttgcag aacatgttct 3180tttctgtgat atttgtactt tccccagatt gcaaatcatg gtttgtacac tgagattcag 3240tctctggagg taatatgcct tttctagctt ttccttggac aggactaagg ggttgagggt 3300tgcctggagt cagagaaatt tgtgttaaag aaggttgata tga 33431463751DNAArtificial Sequence006-HBB1 vector correction genome (+ ITRs) 146ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180ggttagggag gtcctgcata tgcggccgca gcattagctt ccatttatgc agtgtaaatg 240gtgagaacag ccccgactga atacccagag catcatctcg tctgtgtcat tcatgcacat 300aacatatctc agcgaggtgg cccttctgtc ctctttgcag agacccagcc accatactag 360tacctagaga actggctgga tttcagcccc gatacctccg ggcttttgct catgttcgcc 420tcatagggtc atctgggtgg ttgcctaagg aaaagtatgt catggagact aacttgcttg 480gcattgaata aaaggtgagt tgagagtgga gcgtgtttaa attgcaatcc tgcctctatt 540tctgtgcttg cagggaacag tcatccttaa ttgctatcct ccatcatcat catgattatt 600tctggttttt ctctggttgc ggagaatcca tactccaggt attccaatgt ctcagcattg 660ccaggcctgt ctgagcgtca ggatgtaggt agtctgggct ctctgccttc tattcttgtc 720caggatactc tgccaaaaga atcatgttgt ggctgccacc cctcccacaa agcctcccgc 780ttgggtcagt ccaggactgg agttgggtat ggactgttca tgtctatcca ctgctacgtc 840agggcaacac ccactgagag tgaccttgta gactgcagtg ggagacaccc ttcaaaacct 900ctcatctcct gtcctgagag ccaggttaaa accatcagcc ccgcatcctg agtgcaaact 960tttcctaacc ctgctgctaa gctagacacc tcacttactg agagccagca tgtccaccgc 1020tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg agacttcata 1080cattgaggat aactgtaacc agaatggcgc catctctctg atcttcagcc tgaaggagga 1140agtgggcgcc ctggcaaagg tgctgcgcct gtttgaggag aacgacgtga atctgaccca 1200catcgagtcc cggccttcta gactgaagaa ggacgagtac gagttcttta cccacctgga 1260taagcggtcc ctgccagccc tgacaaacat catcaagatc ctgaggcacg acatcggagc 1320aaccgtgcac gagctgtctc gggacaagaa gaaggatacc gtgccctggt tccctcggac 1380aatccaggag ctggatagat ttgccaacca gatcctgtct tacggagcag agctggacgc 1440agatcaccct ggcttcaagg acccagtgta tcgggcccgg agaaagcagt ttgccgatat 1500cgcctacaat tataggcacg gacagccaat ccctcgcgtg gagtatatgg aggaggagaa 1560gaagacctgg ggcacagtgt tcaagaccct gaagagcctg tacaagacac acgcctgcta 1620cgagtataac cacatcttcc ccctgctgga gaagtattgt ggctttcacg aggacaatat 1680ccctcagctg gaggacgtga gccagttcct gcagacctgc acaggcttta ggctgaggcc 1740agtggcagga ctgctgagct cccgggactt cctgggagga ctggccttca gagtgtttca 1800ctgcacccag tacatcaggc acggctccaa gccaatgtat acaccagagc ccgacatctg 1860tcacgagctg ctgggccacg tgcccctgtt tagcgataga tccttcgccc agttttccca 1920ggttggtatc caggttacaa ggcagctcac aagaagaagt tgggtgcttg gagacagagg 1980tctgctttcc agcagacact aactttcagt gtcccctgtc tatgtttccc tttttaggag 2040atcggactgg catctctggg agcacctgac gagtacatcg agaagctggc caccatctat 2100tggttcacag tggagtttgg cctgtgcaag cagggcgata gcatcaaggc ctacggagca 2160ggactgctgt ctagcttcgg cgagctgcag tattgtctgt ccgagaagcc aaagctgctg 2220cccctggagc tggagaagac cgccatccag aactacaccg tgacagagtt ccagcccctg 2280tactatgtgg ccgagtcttt taacgatgcc aaggagaagg tgagaaattt cgccgccaca 2340atccctaggc ccttcagcgt gcggtacgac ccttataccc agaggatcga ggtgctggat 2400aatacacagc agctgaagat cctggctgac tcaatcaata gcgaaatcgg aatcctgtgc 2460tccgccctgc agaaaatcaa atgagaattc aaggcctctc gagcctctag aactatagtg 2520agtcgtatta cgtagatcca gacatgataa gatacattga tgagtttgga caaaccacaa 2580ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg tgatgctatt gctttatttg 2640taaccattat aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttc 2700aggttcaggg ggaggtgtgg gaggtttttt aagctttacg tacgatcgtc gagcagctgt 2760tgtcctggag aacggagtcc tgagcagaaa actctcagac tttgggcagg taagcctgtt 2820gggcttccac tgctaggaga gaattggttc cccacatgtg aaagcagtct gggaaatgct 2880ggtatttcca gtctcctaag gctactaaga aatatgactt tatttagagg cgagaaaaat 2940gcccaggaag tcaactgatg agactagtct taacaagttg aggatacaga aagttgggga 3000tctgagctgc taccaacatc tgtgtgtctt tgggtggctc attggtatcc tctgcctatt 3060ggctttatct tctgtacact gaaaggaaat ggctggtcct tagtcacctg gggtgggagt 3120ccctatctct ccagggatac ttattcaatc ctttcttctg ggtatcaaaa tgacaagctt 3180gtaagaaact gtcctctttc ggctttcagg aggtgatgtc gcatgaagag aatttggggg 3240gggggactta ctcagaacca aggagggaga aattaaacag agagggaaat gaacaggagt 3300tagcccggag cctgaagcac cttggggatt atgctggggg tggagggaat ccattgtcct 3360ccctagggag ggcttgcaga acatgttctt ttctgtgata tttgtacttt ccccagattg 3420caaatcatgg

tttgtacact gagattcagt ctctggaggt aatatgcctt ttctagcttt 3480tccttggaca ggactaaggg gttgagggtt gcctggagtc agagaaattt gtgttaaaga 3540aggttgatat gacctgcagg tctagatacg tagataagta gcatggcggg ttaatcatta 3600actacaagga acccctagtg atggagttgg ccactccctc tctgcgcgct cgctcgctca 3660ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga 3720gcgagcgagc gcgcagagag ggagtggcca a 37511471607DNAArtificial Sequence006 vector editing element 147atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggagatcgg actggcatct ctgggagcac ctgacgagta catcgagaag 960ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg cgatagcatc 1020aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg tctgtccgag 1080aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta caccgtgaca 1140gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga gaaggtgaga 1200aatttcgccg ccacaatccc taggcccttc agcgtgcggt acgaccctta tacccagagg 1260atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat caatagcgaa 1320atcggaatcc tgtgctccgc cctgcagaaa atcaaatgag aattcaaggc ctctcgagcc 1380tctagaacta tagtgagtcg tattacgtag atccagacat gataagatac attgatgagt 1440ttggacaaac cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg 1500ctattgcttt atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca 1560ttcattttat gtttcaggtt cagggggagg tgtgggaggt tttttaa 16071481837DNAArtificial Sequence032 vector editing element 148ctgacctctt ctcttcctcc cacagggcgg taccagatct ggcagcggag agggcagagg 60aagtcttcta acatgcggtg acgtggagga gaatcccggc cctaggggta cctccaccgc 120tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg agacttcata 180cattgaggat aactgtaacc agaatggcgc catctctctg atcttcagcc tgaaggagga 240agtgggcgcc ctggcaaagg tgctgcgcct gtttgaggag aacgacgtga atctgaccca 300catcgagtcc cggccttcta gactgaagaa ggacgagtac gagttcttta cccacctgga 360taagcggtcc ctgccagccc tgacaaacat catcaagatc ctgaggcacg acatcggagc 420aaccgtgcac gagctgtctc gggacaagaa gaaggatacc gtgccctggt tccctcggac 480aatccaggag ctggatagat ttgccaacca gatcctgtct tacggagcag agctggacgc 540agatcaccct ggcttcaagg acccagtgta tcgggcccgg agaaagcagt ttgccgatat 600cgcctacaat tataggcacg gacagccaat ccctcgcgtg gagtatatgg aggaggagaa 660gaagacctgg ggcacagtgt tcaagaccct gaagagcctg tacaagacac acgcctgcta 720cgagtataac cacatcttcc ccctgctgga gaagtattgt ggctttcacg aggacaatat 780ccctcagctg gaggacgtga gccagttcct gcagacctgc acaggcttta ggctgaggcc 840agtggcagga ctgctgagct cccgggactt cctgggagga ctggccttca gagtgtttca 900ctgcacccag tacatcaggc acggctccaa gccaatgtat acaccagagc ccgacatctg 960tcacgagctg ctgggccacg tgcccctgtt tagcgataga tccttcgccc agttttccca 1020ggagatcgga ctggcatctc tgggagcacc tgacgagtac atcgagaagc tggccaccat 1080ctattggttc acagtggagt ttggcctgtg caagcagggc gatagcatca aggcctacgg 1140agcaggactg ctgtctagct tcggcgagct gcagtattgt ctgtccgaga agccaaagct 1200gctgcccctg gagctggaga agaccgccat ccagaactac accgtgacag agttccagcc 1260cctgtactat gtggccgagt cttttaacga tgccaaggag aaggtgagaa atttcgccgc 1320cacaatccct aggcccttca gcgtgcggta cgacccttat acccagagga tcgaggtgct 1380ggataataca cagcagctga agatcctggc tgactcaatc aatagcgaaa tcggaatcct 1440gtgctccgcc ctgcagaaaa tcaaaggtaa gcctatccct aaccctctcc tcggtctcga 1500ttctacgtga tcttgtggaa aggacgaaac accggggaat tcaaggcctc tcgagcctct 1560agaatccccg agacgtttcg tctcgggatc actatagtga gtcgtattac gtacacagtg 1620caggggaaag aatagtagag atccagacat gataagatac attgatgagt ttggacaaac 1680cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg ctattgcttt 1740atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca ttcattttat 1800gtttcaggtt cagggggagg tgtgggaggt tttttaa 18371492225DNAArtificial Sequence006-HCR vector editing element 149atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gtaagtttta tggaatgtga atcataattc aatttttcaa catgcgttag gagggacatt 120tcaaactctt ttttacccta gactttccta ccatcaccca gagtatccag ccaggagggg 180aggggctaga gacaccagaa gtttagcagg gaggagggcg tagggattcg gggaatgaag 240ggatgggatt cagactaggg ccaggaccca gggatggaga gaaagagatg agagtggttt 300gggggcttgg tgacttagag aacagagctg caggctcaga ggcacacagg agtttctggg 360ctggcccggc ccccttccaa cccctcatta tggaatccag cagctgtttg tgtgctgcct 420ctgaagtcca cactgaacaa acttcagcct actcatgtcc catataaggg aaattatgga 480atcagcaaac agcaaacaca cagccctccc tgcctgctga ccttggacct ggggcagagg 540tcagagacct ccttggctct atgccacctc caacatccac tcgacccctt ggaatttcgg 600tggagaggag cagaggttgt cctggcgtgg tttaggtagt gtgagagggc tgaccatgcc 660ttcttctttt tcctacagga aacttcatac attgaggata actgtaacca gaatggcgcc 720atctctctga tcttcagcct gaaggaggaa gtgggcgccc tggcaaaggt gctgcgcctg 780tttgaggaga acgacgtgaa tctgacccac atcgagtccc ggccttctag actgaagaag 840gacgagtacg agttctttac ccacctggat aagcggtccc tgccagccct gacaaacatc 900atcaagatcc tgaggcacga catcggagca accgtgcacg agctgtctcg ggacaagaag 960aaggataccg tgccctggtt ccctcggaca atccaggagc tggatagatt tgccaaccag 1020atcctgtctt acggagcaga gctggacgca gatcaccctg gcttcaagga cccagtgtat 1080cgggcccgga gaaagcagtt tgccgatatc gcctacaatt ataggcacga acagccaatc 1140cctcgcgtgg agtatatgga ggaggagaag aagacctggg gcacagtgtt caagaccctg 1200aagagcctgt acaagacaca cgcctgctac gagtataacc acatcttccc cctgctggag 1260aagtattgtg gctttcacga ggacaatatc cctcagctgg aggacgtgag ccagttcctg 1320cagacctgca caggctttag gctgaggcca gtggcaggac tgctgagctc ccgggacttc 1380ctgggaggac tggccttcag agtgtttcac tgcacccagt acatcaggca cggctccaag 1440ccaatgtata caccagagcc cgacatctgt cacgagctgc tgggccacgt gcccctgttt 1500agcgatagat ccttcgccca gttttcccag gagatcggac tggcatctct gggagcacct 1560gacgagtaca tcgagaagct ggccaccatc tattggttca cagtggagtt tggcctgtgc 1620aagcagggcg atagcatcaa ggcctacgga gcaggactgc tgtctagctt cggcgagctg 1680cagtattgtc tgtccgagaa gccaaagctg ctgcccctgg agctggagaa gaccgccatc 1740cagaactaca ccgtgacaga gttccagccc ctgtactatg tggccgagtc ttttaacgat 1800gccaaggaga aggtgagaaa tttcgccgcc acaatcccta ggcccttcag cgtgcggtac 1860gacccttata cccagaggat cgaggtgctg gataatacac agcagctgaa gatcctggct 1920gactcaatca atagcgaaat cggaatcctg tgctccgccc tgcagaaaat caaatgagaa 1980ttcaaggcct ctcgagcctc tagaactata gtgagtcgta ttacgtagat ccagacatga 2040taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 2100tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 2160ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt 2220tttaa 22251502455DNAArtificial Sequence032-HCR vector editing element 150ctgacctctt ctcttcctcc cacagggcgg taccagatct ggcagcggag agggcagagg 60aagtcttcta acatgcggtg acgtggagga gaatcccggc cctaggggta cctccaccgc 120tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg taagttttat 180ggaatgtgaa tcataattca atttttcaac atgcgttagg agggacattt caaactcttt 240tttaccctag actttcctac catcacccag agtatccagc caggagggga ggggctagag 300acaccagaag tttagcaggg aggagggcgt agggattcgg ggaatgaagg gatgggattc 360agactagggc caggacccag ggatggagag aaagagatga gagtggtttg ggggcttggt 420gacttagaga acagagctgc aggctcagag gcacacagga gtttctgggc tggcccggcc 480cccttccaac ccctcattat ggaatccagc agctgtttgt gtgctgcctc tgaagtccac 540actgaacaaa cttcagccta ctcatgtccc atataaggga aattatggaa tcagcaaaca 600gcaaacacac agccctccct gcctgctgac cttggacctg gggcagaggt cagagacctc 660cttggctcta tgccacctcc aacatccact cgaccccttg gaatttcggt ggagaggagc 720agaggttgtc ctggcgtggt ttaggtagtg tgagagggct gaccatgcct tcttcttttt 780cctacaggaa acttcataca ttgaggataa ctgtaaccag aatggcgcca tctctctgat 840cttcagcctg aaggaggaag tgggcgccct ggcaaaggtg ctgcgcctgt ttgaggagaa 900cgacgtgaat ctgacccaca tcgagtcccg gccttctaga ctgaagaagg acgagtacga 960gttctttacc cacctggata agcggtccct gccagccctg acaaacatca tcaagatcct 1020gaggcacgac atcggagcaa ccgtgcacga gctgtctcgg gacaagaaga aggataccgt 1080gccctggttc cctcggacaa tccaggagct ggatagattt gccaaccaga tcctgtctta 1140cggagcagag ctggacgcag atcaccctgg cttcaaggac ccagtgtatc gggcccggag 1200aaagcagttt gccgatatcg cctacaatta taggcacgga cagccaatcc ctcgcgtgga 1260gtatatggag gaggagaaga agacctgggg cacagtgttc aagaccctga agagcctgta 1320caagacacac gcctgctacg agtataacca catcttcccc ctgctggaga agtattgtgg 1380ctttcacgag gacaatatcc ctcagctgga ggacgtgagc cagttcctgc agacctgcac 1440aggctttagg ctgaggccag tggcaggact gctgagctcc cgggacttcc tgggaggact 1500ggccttcaga gtgtttcact gcacccagta catcaggcac ggctccaagc caatgtatac 1560accagagccc gacatctgtc acgagctgct gggccacgtg cccctgttta gcgatagatc 1620cttcgcccag ttttcccagg agatcggact ggcatctctg ggagcacctg acgagtacat 1680cgagaagctg gccaccatct attggttcac agtggagttt ggcctgtgca agcagggcga 1740tagcatcaag gcctacggag caggactgct gtctagcttc ggcgagctgc agtattgtct 1800gtccgagaag ccaaagctgc tgcccctgga gctggagaag accgccatcc agaactacac 1860cgtgacagag ttccagcccc tgtactatgt ggccgagtct tttaacgatg ccaaggagaa 1920ggtgagaaat ttcgccgcca caatccctag gcccttcagc gtgcggtacg acccttatac 1980ccagaggatc gaggtgctgg ataatacaca gcagctgaag atcctggctg actcaatcaa 2040tagcgaaatc ggaatcctgt gctccgccct gcagaaaatc aaaggtaagc ctatccctaa 2100ccctctcctc ggtctcgatt ctacgtgatc ttgtggaaag gacgaaacac cggggaattc 2160aaggcctctc gagcctctag aatccccgag acgtttcgtc tcgggatcac tatagtgagt 2220cgtattacgt acacagtgca ggggaaagaa tagtagagat ccagacatga taagatacat 2280tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat 2340ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag ttaacaacaa 2400caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt tttaa 24551511723DNAArtificial Sequence006-HBB1 vector editing element 151atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggttggtat ccaggttaca aggcagctca caagaagaag ttgggtgctt 960ggagacagag gtctgctttc cagcagacac taactttcag tgtcccctgt ctatgtttcc 1020ctttttagga gatcggactg gcatctctgg gagcacctga cgagtacatc gagaagctgg 1080ccaccatcta ttggttcaca gtggagtttg gcctgtgcaa gcagggcgat agcatcaagg 1140cctacggagc aggactgctg tctagcttcg gcgagctgca gtattgtctg tccgagaagc 1200caaagctgct gcccctggag ctggagaaga ccgccatcca gaactacacc gtgacagagt 1260tccagcccct gtactatgtg gccgagtctt ttaacgatgc caaggagaag gtgagaaatt 1320tcgccgccac aatccctagg cccttcagcg tgcggtacga cccttatacc cagaggatcg 1380aggtgctgga taatacacag cagctgaaga tcctggctga ctcaatcaat agcgaaatcg 1440gaatcctgtg ctccgccctg cagaaaatca aatgagaatt caaggcctct cgagcctcta 1500gaactatagt gagtcgtatt acgtagatcc agacatgata agatacattg atgagtttgg 1560acaaaccaca actagaatgc agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat 1620tgctttattt gtaaccatta taagctgcaa taaacaagtt aacaacaaca attgcattca 1680ttttatgttt caggttcagg gggaggtgtg ggaggttttt taa 17231521607DNAArtificial Sequence006-SD.3 vector editing element 152atgtccaccg ctgtgctgga gaaccctggg ctggggagga aactgtcaga cttcgggcag 60gagacttcat acattgagga taactgtaac cagaatggcg ccatctctct gatcttcagc 120ctgaaggagg aagtgggcgc cctggcaaag gtgctgcgcc tgtttgagga gaacgacgtg 180aatctgaccc acatcgagtc ccggccttct agactgaaga aggacgagta cgagttcttt 240acccacctgg ataagcggtc cctgccagcc ctgacaaaca tcatcaagat cctgaggcac 300gacatcggag caaccgtgca cgagctgtct cgggacaaga agaaggatac cgtgccctgg 360ttccctcgga caatccagga gctggataga tttgccaacc agatcctgtc ttacggagca 420gagctggacg cagatcaccc tggcttcaag gacccagtgt atcgggcccg gagaaagcag 480tttgccgata tcgcctacaa ttataggcac ggacagccaa tccctcgcgt ggagtatatg 540gaggaggaga agaagacctg gggcacagtg ttcaagaccc tgaagagcct gtacaagaca 600cacgcctgct acgagtataa ccacatcttc cccctgctgg agaagtattg tggctttcac 660gaggacaata tccctcagct ggaggacgtg agccagttcc tgcagacctg cacaggcttt 720aggctgaggc cagtggcagg actgctgagc tcccgggact tcctgggagg actggccttc 780agagtgtttc actgcaccca gtacatcagg cacggctcca agccaatgta tacaccagag 840cccgacatct gtcacgagct gctgggccac gtgcccctgt ttagcgatag atccttcgcc 900cagttttccc aggagatcgg actggcatct ctgggagcac ctgacgagta catcgagaag 960ctggccacca tctattggtt cacagtggag tttggcctgt gcaagcaggg cgatagcatc 1020aaggcctacg gagcaggact gctgtctagc ttcggcgagc tgcagtattg tctgtccgag 1080aagccaaagc tgctgcccct ggagctggag aagaccgcca tccagaacta caccgtgaca 1140gagttccagc ccctgtacta tgtggccgag tcttttaacg atgccaagga gaaggtgaga 1200aatttcgccg ccacaatccc taggcccttc agtgtgcgtt acgaccctta tacccagagg 1260atcgaggtgc tggataatac acagcagctg aagatcctgg ctgactcaat caatagcgaa 1320atcggaatcc tgtgctccgc cctgcagaaa atcaaatgag aattcaaggc ctctcgagcc 1380tctagaacta tagtgagtcg tattacgtag atccagacat gataagatac attgatgagt 1440ttggacaaac cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg 1500ctattgcttt atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca 1560ttcattttat gtttcaggtt cagggggagg tgtgggaggt tttttaa 16071531837DNAArtificial Sequence032-SD.3 vector editing element 153ctgacctctt ctcttcctcc cacagggcgg taccagatct ggcagcggag agggcagagg 60aagtcttcta acatgcggtg acgtggagga gaatcccggc cctaggggta cctccaccgc 120tgtgctggag aaccctgggc tggggaggaa actgtcagac ttcgggcagg agacttcata 180cattgaggat aactgtaacc agaatggcgc catctctctg atcttcagcc tgaaggagga 240agtgggcgcc ctggcaaagg tgctgcgcct gtttgaggag aacgacgtga atctgaccca 300catcgagtcc cggccttcta gactgaagaa ggacgagtac gagttcttta cccacctgga 360taagcggtcc ctgccagccc tgacaaacat catcaagatc ctgaggcacg acatcggagc 420aaccgtgcac gagctgtctc gggacaagaa gaaggatacc gtgccctggt tccctcggac 480aatccaggag ctggatagat ttgccaacca gatcctgtct tacggagcag agctggacgc 540agatcaccct ggcttcaagg acccagtgta tcgggcccgg agaaagcagt ttgccgatat 600cgcctacaat tataggcacg gacagccaat ccctcgcgtg gagtatatgg aggaggagaa 660gaagacctgg ggcacagtgt tcaagaccct gaagagcctg tacaagacac acgcctgcta 720cgagtataac cacatcttcc ccctgctgga gaagtattgt ggctttcacg aggacaatat 780ccctcagctg gaggacgtga gccagttcct gcagacctgc acaggcttta ggctgaggcc 840agtggcagga ctgctgagct cccgggactt cctgggagga ctggccttca gagtgtttca 900ctgcacccag tacatcaggc acggctccaa gccaatgtat acaccagagc ccgacatctg 960tcacgagctg ctgggccacg tgcccctgtt tagcgataga tccttcgccc agttttccca 1020ggagatcgga ctggcatctc tgggagcacc tgacgagtac atcgagaagc tggccaccat 1080ctattggttc acagtggagt ttggcctgtg caagcagggc gatagcatca aggcctacgg 1140agcaggactg ctgtctagct tcggcgagct gcagtattgt ctgtccgaga agccaaagct 1200gctgcccctg gagctggaga agaccgccat ccagaactac accgtgacag agttccagcc 1260cctgtactat gtggccgagt cttttaacga tgccaaggag aaggtgagaa atttcgccgc 1320cacaatccct aggcccttca gtgtgcgtta cgacccttat acccagagga tcgaggtgct 1380ggataataca cagcagctga agatcctggc tgactcaatc aatagcgaaa tcggaatcct 1440gtgctccgcc ctgcagaaaa tcaaaggtaa gcctatccct aaccctctcc tcggtctcga 1500ttctacgtga tcttgtggaa aggacgaaac accggggaat tcaaggcctc tcgagcctct 1560agaatccccg agacgtttcg tctcgggatc actatagtga gtcgtattac gtacacagtg 1620caggggaaag aatagtagag atccagacat gataagatac attgatgagt ttggacaaac 1680cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg ctattgcttt 1740atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca ttcattttat 1800gtttcaggtt cagggggagg tgtgggaggt tttttaa 1837

Claims

1. A method for correcting a mutation in a phenylalanine hydroxylase (PAH) gene in a cell, the method comprising transducing the cell with a replication-defective adeno-associated virus (AAV) comprising: (a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus, wherein the cell is transduced without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.

2. The method of claim 1, wherein the cell is a hepatocyte, a renal cell, or a cell in the brain, pituitary gland, adrenal gland, pancreas, urinary bladder, gallbladder, colon, small intestine, or breast, optionally wherein the cell is in a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject.

3. (canceled)

4. A method for treating a subject having a disease or disorder associated with a PAH gene mutation, the method comprising administering to the subject an effective amount of a replication-defective AAV comprising: (a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus, wherein an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease is not co-administered to the subject, optionally wherein the subject or disorder is phenylketonuria, and optionally wherein the subject is a human subject.

5. (canceled)

6. (canceled)

7. The method of claim 1, wherein the editing element comprises at least a portion of a PAH coding sequence, or the editing element comprises a PAH coding sequence, optionally wherein: the PAH coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23; the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24; the PAH coding sequence is silently altered; and/or the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143.

8-12. (canceled)

13. The method of claim 1, wherein the editing element comprises a PAH intron-inserted coding sequence, optionally wherein the PAH intron-inserted coding sequence comprises a nonnative intron inserted in a PAH coding sequence, optionally wherein: the nonnative intron is selected from the group consisting of a first intron of a hemoglobin beta gene and a minute virus in mice (MVM) intron; the nonnative intron consists of a nucleotide sequence at least 90% identical to any one of SEQ ID NOs: 28-30, and 120-130; the nonnative intron consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 28-30, and 120-130; the PAH intron-inserted coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23; and/or the PAH intron-inserted coding sequence comprises from 5' to 3': a first portion of a PAH coding sequence, the intron, and a second portion of a PAH coding sequence, wherein the first portion and the second portion, when spliced together, form a complete PAH coding sequence, optionally wherein: the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24; the PAH coding sequence is silently altered; the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143; the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and/or the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67; and/or the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 64 or 65, and the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 66 or 67.

14-23. (canceled)

24. The method of claim 1, wherein the editing element comprises from 5' to 3': a ribosomal skipping element, and the PAH coding sequence or the PAH intron-inserted coding sequence, optionally wherein: the editing element further comprises a polyadenylation sequence 3' to the PAH coding sequence or the PAH intron-inserted coding sequence, optionally wherein the polyadenylation sequence is an exogenous polyadenylation sequence, optionally wherein the exogenous polyadenylation sequence is an SV40 polyadenylation sequence, optionally wherein the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34; the nucleotide 5' to the target locus is in an exon of the PAH gene; the nucleotide 5' to the target locus is in exon 1 of the PAH gene; the editing element further comprises a splice acceptor 5' to the ribosomal skipping element, optionally wherein the nucleotide 5' to the target locus is in an intron of the PAH gene, optionally intron 1 of the PAH gene; and/or the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35.

25-33. (canceled)

34. The method of claim 1, optionally wherein: the 5' homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region; the 3' homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region; the first genomic region is located in a first editing window, and the second genomic region is located in a second editing window, optionally wherein: the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45; the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45; and/or the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36, and the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45; the first genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 36; the second genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 45; and/or each of the 5' and 3' homology arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides.

35-42. (canceled)

43. The method of claim 1, wherein the 5' homology arm comprises: C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -181 of the PAH gene, G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, C corresponding to nucleotide -433 of the PAH gene, C corresponding to nucleotide -432 of the PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene, A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and/or A corresponding to nucleotide -203 of the PAH gene.

44. The method of claim 1, wherein the 5' homology arm comprises: (a) C corresponding to nucleotide -2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and G corresponding to nucleotide 9 of the PAH gene; (b) A corresponding to nucleotide -467 of the PAH gene, and A corresponding to nucleotide -465 of the PAH gene; (c) A corresponding to nucleotide -181 of the PAH gene; (d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene; (e) G corresponding to nucleotide 194 of the PAH gene; (f) C corresponding to nucleotide -433 of the PAH gene, and C corresponding to nucleotide -432 of the PAH gene; (g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and/or (h) A corresponding to nucleotide -341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and A corresponding to nucleotide -203 of the PAH gene.

45. The method of claim 44, wherein the 5' homology arm comprises the modifications of (c) and (d), (f) and (g), and/or (b) and (h).

46. The method of claim 1, wherein: the 5' homology arm consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 36-44, 111, 115, and 142; the 3' homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 45, 112, 117, 144; the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145; the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146; the correction genome consists of the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146; and/or the correction genome further comprises a 5' inverted terminal repeat (5' ITR) nucleotide sequence 5' of the 5' homology arm nucleotide sequence, and a 3' inverted terminal repeat (3' ITR) nucleotide sequence 3' of the 3' homology arm nucleotide sequence, optionally wherein: the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19; the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21; or the 5' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26, and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27.

47-54. (canceled)

55. The method of claim 1, wherein the AAV capsid comprises an AAV Clade F capsid protein.

56. The method of claim 55, wherein the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17, optionally wherein: the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G, optionally wherein: (a) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (b) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (c) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (d) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (e) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, optionally wherein the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.

57-59. (canceled)

60. The method of claim 55, wherein the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17, optionally wherein: the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G, optionally wherein: (a) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (b) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (c) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (d) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (e) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, optionally wherein the capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17.

61-63. (canceled)

64. The method of claim 55, wherein the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, optionally wherein: the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L; the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C; or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G optionally wherein: (a) the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; (b) the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y; (c) the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K; (d) the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; (e) the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G; (f) the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M; (g) the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R; (h) the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R; or (i) the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is optionally wherein the capsid protein comprises the amino acid sequence of amino acids C, 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.

65-67. (canceled)

68. The method of claim 1, wherein the integration efficiency of the editing element into the target locus is at least 1% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions; or the allelic frequency of integration of the editing element into the target locus is at least 0.5% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.

69. (canceled)

70. A replication-defective adeno-associated virus (AAV) comprising: (a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5' homology arm nucleotide sequence 5' of the editing element having homology to a first genomic region 5' to the target locus; and (iii) a 3' homology arm nucleotide sequence 3' of the editing element having homology to a second genomic region 3' to the target locus.

71-133. (canceled)

134. A pharmaceutical composition comprising an AAV of claim 70.

135. A packaging system for recombinant preparation of a replication-defective AAV, wherein the packaging system comprises: (a) a Rep nucleotide sequence encoding one or more AAV Rep proteins; (b) a Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins; and (c) a correction genome as set forth in claim 1, wherein the packaging system is operative in a cell for enclosing the correction genome in the capsid to form the AAV.

136-153. (canceled)

154. A method for recombinant preparation of a replication-defective AAV, the method comprising introducing the packaging system of claim 135 into a cell under conditions operative for enclosing the correction genome in the capsid to form the AAV.