Patent application title: ANTI-LGR5 ANTIBODIES AND USES THEREOF
Inventors:
IPC8 Class: AC07K1628FI
USPC Class:
1 1
Class name:
Publication date: 2019-08-15
Patent application number: 20190248889
Abstract:
The invention provides anti-LgR5 antibodies and methods of using the
same.Claims:
1. An isolated antibody that binds to LgR5, wherein the antibody
comprises: a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 12,
HVR-H2 comprising the amino acid sequence of SEQ ID NO: 13, HVR-H3
comprising the amino acid sequence of SEQ ID NO: 14, HVR-L1 comprising
the amino acid sequence of SEQ ID NO: 9, HVR-L2 comprising the amino acid
sequence of SEQ ID NO: 10, and HVR-L3 comprising the amino acid sequence
of SEQ ID NO: 11; or b) HVR-H1 comprising the amino acid sequence of SEQ
ID NO: 18, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 19,
HVR-H3 comprising the amino acid sequence of SEQ ID NO: 20, HVR-L1
comprising the amino acid sequence of SEQ ID NO: 15, HVR-L2 comprising
the amino acid sequence of SEQ ID NO: 16, and HVR-L3 comprising the amino
acid sequence of SEQ ID NO: 17.
2. The antibody of claim 1, comprising: a) (i) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 6; (ii) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 5; or (iii) a VH sequence as in (i) and a VL sequence as in (ii); or b) (i) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 8; (ii) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 7; or (iii) a VH sequence as in (i) and a VL sequence as in (ii).
3. The antibody of claim 1 or claim 2, comprising a VH sequence of SEQ ID NO: 6 or SEQ ID NO: 8.
4. The antibody of any one of the preceding claims, comprising a VL sequence of SEQ ID NO: 7 or SEQ ID NO: 9.
5. An antibody comprising a VH sequence of SEQ ID NO: 6 and a VL sequence of SEQ ID NO: 5.
6. An antibody comprising a VH sequence of SEQ ID NO: 8 and a VL sequence of SEQ ID NO: 7.
7. The antibody of any one of the preceding claims, which is a monoclonal antibody.
8. The antibody of claim 7, which is a mouse, rabbit, human, humanized, or chimeric antibody.
9. The antibody of any one of claims 1 to 8, which is an IgG selected from IgG1, IgG2a, IgG2b, IgG3, and IgG4.
10. Isolated nucleic acid encoding the antibody of any one of the preceding claims.
11. A host cell comprising the nucleic acid of claim 10.
12. A method of producing an antibody comprising culturing the host cell of claim 11 so that the antibody is produced.
13. An immunoconjugate comprising the antibody of any one of claims 1 to 9 and a cytotoxic agent.
14. A pharmaceutical formulation comprising the immunoconjugate of claim 13 and a pharmaceutically acceptable carrier.
15. The antibody of any one of claims 1 to 9 conjugated to a label.
16. The antibody of claim 15, wherein the label is a positron emitter.
17. The antibody of claim 16, wherein the positron emitter is .sup.89Zr.
18. A method of detecting human LgR5 in a biological sample comprising contacting the biological sample with the anti-LgR5 antibody of any one of claims 1 to 9 and 15 to 17 under conditions permissive for binding of the anti-LgR5 antibody to human LgR5, and detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the biological sample.
19. The method of claim 18, wherein the anti-LgR5 antibody is an antibody of claim 4 or claim 5.
20. The method of claim 18 or claim 19, wherein the biological sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
21. A method for detecting a LgR5-positive cancer comprising (i) administering a labeled anti-LgR5 antibody to a subject having or suspected of having a LgR5-positive cancer, wherein the labeled anti-LgR5 antibody comprises the anti-LgR5 antibody of any one of claims 1 to 9, and (ii) detecting the labeled anti-LgR5 antibody in the subject, wherein detection of the labeled anti-LgR5 antibody indicates a LgR5-positive cancer in the subject.
22. The method of claim 21, wherein the labeled anti-LgR5 antibody is an antibody of claim 4 or claim 5 that is labeled.
23. The method of claim 21 or claim 22, wherein the labeled anti-LgR5 antibody comprises an anti-LgR5 antibody conjugated to a positron emitter.
24. The method of claim 23, wherein the positron emitter is .sup.89Zr.
25. A method of identifying a cancer patient as having a LgR5-positive cancer, comprising contacting a cancer sample from the patient with the anti-LgR5 antibody of any one of claims 1 to 9 and 15 to 17 under conditions permissive for binding of the anti-LgR5 antibody to human LgR5, and detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the cancer sample.
26. The method of claim 25, wherein the cancer patient is identified as having a LgR5-positive cancer if a complex is between the anti-LgR5 antibody and human LgR5 in the cancer sample is detected.
27. A method of selecting a cancer patient for treatment with an immunoconjugate comprising an anti-LgR5 antibody, comprising determining the level of LgR5 expression in a cancer sample from the patient using immunohistochemistry (IHC), wherein an elevated level of LgR5 expression indicates that the cancer patient is more likely to benefit from treatment with an immunoconjugate comprising an anti-LgR5 antibody.
28. The method of claim 27, wherein an elevated level of LgR5 expression is 2+ or 3+ staining by IHC.
29. The method of claim 28, wherein an elevated level of LgR5 expression is 3+ staining by IHC.
30. The method of any one of claims 27 to 29, wherein IHC is performed using an antibody of any one of claims 1 to 9 and 15 to 17.
31. A method of selecting a cancer patient for treatment with an immunoconjugate comprising an anti-LgR5 antibody, comprising contacting a cancer sample from the patient with the anti-LgR5 antibody of any one of claims 1 to 9 and 15 to 17 under conditions permissive for binding of the anti-LgR5 antibody to human LgR5, and detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the cancer sample.
32. The method of claim 31, wherein the cancer patient is selected if a complex is between the anti-LgR5 antibody and human LgR5 in the cancer sample is detected.
33. A method of treating a cancer patient comprising administering to the patient a therapeutically effective amount of an immunoconjugate comprising an anti-LgR5 antibody, wherein a cancer sample from the patient has been determined to have an elevated level of LgR5 expression using immunohistochemistry (IHC).
34. The method of claim 33, wherein an elevated level of LgR5 expression is 2+ or 3+ staining by IHC.
35. The method of claim 34, wherein an elevated level of LgR5 expression is 3+ staining by IHC.
36. The method of any one of claims 33 to 35, wherein IHC is performed using an antibody of any one of claims 1 to 9 and 15 to 17.
37. The method of any one of claims 27 to 36, wherein the immunoconjugate comprises an anti-LgR5 antibody comprising: a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 55, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 56, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 57, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 52; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 53; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 54; or b) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 73, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 74, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 75, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 70; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 71; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 72; or c) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 79, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 80, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 81, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 76; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 77; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 78; or d) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 85, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 86, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 87, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 82; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 83; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 84.
38. The method of claim 37, wherein the anti-LgR5 antibody comprises: a) a VH sequence of SEQ ID NO: 33 and a VL sequence of SEQ ID NO: 32; or b) a VH sequence of SEQ ID NO: 51 and a VL sequence of SEQ ID NO: 50.
39. The method of any one of claims 27 to 38, wherein the immunoconjugate comprises an anti-LgR5 antibody conjugated to a cytotoxic agent.
40. The method of any one of claims 25 to 39, wherein the cancer sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
Description:
[0001] This application is a divisional of U.S. patent application Ser.
No. 15/363,045, filed Nov. 29, 2016, which is a continuation of
International Application No. PCT/US2015/035111, filed Jun. 10, 2015,
which claims the benefit of U.S. Provisional Application No. 62/010,637,
filed Jun. 11, 2014, each of which is incorporated by reference herein in
its entirety for any purpose.
SEQUENCE LISTING
[0002] The present application is filed with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled "2019-04-17_01146-0035-01US_SequenceListing.txt" created on Apr. 17, 2019, which is 125,349 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to anti-LgR5 antibodies and methods of using the same.
BACKGROUND
[0004] The cancer stem cell hypothesis posits that similar to normal tissue, a distinct subset of specialized cells has the capacity to self-renew and continuously populates the tumor. Cancer stem cells (CSCs) are implicated in tumor initiation, progression, metastasis and relapse making them desirable targets for therapeutic intervention.
[0005] One of the most well-characterized tissue stem cell populations is the leucine-rich repeat-containing G protein-coupled receptor 5 (Lgr5) crypt cells in the gastrointestinal tract which give rise to all the differentiated cell types within the homeostatic intestinal epithelia. LgR5 is a seven-transmembrane protein found on the surface of actively cycling intestinal stem cells (ISCs). Human LgR5 is a 907 amino acid protein, of which .about.540 amino acids are predicted to be in the extracellular space following cleavage of the amino-terminal signal sequence. LgR5 comprises 17 imperfect leucine-rich repeat motifs in the ectodomain, and a cysteine-rich region located between the leucine-rich repeats and the first transmembrane domain.
[0006] LgR5-expressing ISCs are sensitive to Wnt modulation and are primarily responsible for homeostatic regeneration of the intestinal epithelium. Elimination of LgR5-expressing cells in mice does not affect homeostasis of intestinal epithelium, however, suggesting that other cell types can compensate for loss of this cell population. Tian et al., Nature 478: 255-259 (2011). R-spondins enhance WNT signaling by WNT3A, and all four R-spondins, RSPO1, RSPO2, RSPO3, and RSPO4, are able to bind to LgR5. Lau et al., Nature 476: 293-297 (2011).
[0007] LgR5+ cells are proposed also to serve as the cells of origin for intestinal cancers and act as CSCs suggesting that elimination of the LgR5+ cells could have a profound impact on tumor growth and maintenance.
[0008] Lineage tracing of APC mutant tumors from LgR5+ cells demonstrates that multiple cell types in intestinal tumors are derived from an LgR5+ progenitor. Moreover LgR5+ cells are proposed to initiate and continuously contribute progeny to the tumor mass, suggesting that elimination of the LgR5+ cells could have a profound impact on tumor growth and maintenance. However, a long-standing issue in determining the expression of LgR5 has been the lack of a quality Immunohistochemistry (IHC) reactive antibody.
[0009] There is a need in the art for agents that target LgR5 for the diagnosis and treatment of LgR5-associated conditions, such as cancer. The invention fulfills that need and provides other benefits.
SUMMARY
[0010] Anti-LgR5 antibodies and immunoconjugates and methods of using the same are provided. Anti-LgR5 antibodies useful for immunohistochemistry are provided.
[0011] In some embodiments, an isolated antibody that binds to LgR5 is provided. In some embodiments, the antibody comprises: (a) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 14, HVR-L3 comprising the amino acid sequence of SEQ ID NO: 11, and HVR-H2 comprising the amino acid sequence of SEQ ID NO: 13; or (b) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 20, HVR-L3 comprising the amino acid sequence of SEQ ID NO: 17, and HVR-H2 comprising the amino acid sequence of SEQ ID NO: 19. In some embodiments, the antibody comprises: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 12, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 13, and HVR-H3 comprising the amino acid sequence of SEQ ID NO: 14; or (b) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 18, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 19, and HVR-H3 comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody comprises: (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 9, HVR-L2 comprising the amino acid sequence of SEQ ID NO: 10, and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 11; or (b) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 15, HVR-L2 comprising the amino acid sequence of SEQ ID NO: 16, and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 17.
[0012] In some embodiments, the antibody comprises: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 12, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 13, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 14, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 9, HVR-L2 comprising the amino acid sequence of SEQ ID NO: 10, and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 11; or (b) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 18, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 19, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 20, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 15, HVR-L2 comprising the amino acid sequence of SEQ ID NO: 16, and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 17.
[0013] In some embodiments, the antibody comprises: (a)(i) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 6; (ii) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 5; or (iii) a VH sequence as in (i) and a VL sequence as in (ii); or (b)(i) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 8; (ii) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 7; or (iii) a VH sequence as in (i) and a VL sequence as in (ii).
[0014] In some embodiments, the antibody comprises a VH sequence of SEQ ID NO: 6 or SEQ ID NO: 8. In some embodiments, the antibody comprises a VL sequence of SEQ ID NO: 7 or SEQ ID NO: 9.
[0015] In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a mouse, rabbit, human, humanized, or chimeric antibody. In some embodiments, the antibody is an IgG selected from IgG1, IgG2a, IgG2b, IgG3, and IgG4.
[0016] In some embodiments, nucleic acids encloding an antibody described herein are provided. In some embodiments, a host cell comprising a nucleic acid encloding an antibody described herein is provided. In some embodiments, methods of producing antibodies are provided, comprising culturing a host cell comprising a nucleic acid encloding an antibody described herein.
[0017] In some embodiments, an immunoconjugate is provided comprising an antibody described herein and a cytotoxic agent. In some embodiments, a pharmaceutical formulation is provided comprising an immunoconjugate comprising an antibody described herein and a cytotoxic agent and a pharmaceutically acceptable carrier.
[0018] In some embodiments, an antibody described herein conjugated to a label is provided. In some embodiments, the label is a positron emitter. In some embodiments, the positron emitter is .sup.89Zr.
[0019] In some embodiments, a method of detecting human LgR5 in a biological sample is provided. In some embodiments, the method comprises contacting the biological sample with an anti-LgR5 antibody described herein under conditions permissive for binding of the anti-LgR5 antibody to human LgR5. In some embodiments, the method further comprises detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the biological sample. In some embodiments, the biological sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
[0020] In some embodiments, methods for detecting a LgR5-positive cancer are provided. In some embodiments, a method comprises (i) administering a labeled anti-LgR5 antibody to a subject having or suspected of having a LgR5-positive cancer, wherein the labeled anti-LgR5 antibody comprises an anti-LgR5 antibody described herein, and (ii) detecting the labeled anti-LgR5 antibody in the subject, wherein detection of the labeled anti-LgR5 antibody indicates a LgR5-positive cancer in the subject. In some embodiments, the labeled anti-LgR5 antibody comprises an anti-LgR5 antibody conjugated to a positron emitter. In some embodiments, the positron emitter is .sup.89Zr.
[0021] In some embodiments, methods of identifying a cancer patient as having a LgR5-positive cancer are provided. In some embodiments, the method comprises contacting a cancer sample from the patient with an anti-LgR5 antibody described herein under conditions permissive for binding of the anti-LgR5 antibody to human LgR5. In some embodiments, the method further comprises detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the cancer sample. In some embodiments, the cancer patient is identified as having a LgR5-positive cancer if a complex is between the anti-LgR5 antibody and human LgR5 in the cancer sample is detected. In some embodiments, the cancer sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
[0022] In some embodiments, methods of selecting cancer patients for treatment with an immunoconjugate comprising an anti-LgR5 antibody are provided. In some embodiments, a method comprises determining the level of LgR5 expression in a cancer sample from the patient using immunohistochemistry (IHC). In some embodiments, an elevated level of LgR5 expression indicates that the cancer patient is more likely to benefit from treatment with an immunoconjugate comprising an anti-LgR5 antibody. In some embodiments, an elevated level of LgR5 expression is 2+ or 3+ staining by IHC. In some embodiments, an elevated level of LgR5 expression is 3+ staining by IHC. In some embodiments, IHC is performed using an antibody described herein. In some embodiments, the cancer sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
[0023] In some embodiments, a method of selecting a cancer patient for treatment with an immunoconjugate comprising an anti-LgR5 antibody are provided, wherein the method comprises contacting a cancer sample from the patient with an anti-LgR5 antibody described herein under conditions permissive for binding of the anti-LgR5 antibody to human LgR5, and detecting whether a complex is formed between the anti-LgR5 antibody and human LgR5 in the cancer sample. In some embodiments, the cancer patient is selected if a complex is between the anti-LgR5 antibody and human LgR5 in the cancer sample is detected. In some embodiments, the cancer sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
[0024] In some embodiments, methods of treating cancer patients are provided, comprising administering to the patient a therapeutically effective amount of an an immunoconjugate comprising an anti-LgR5 antibody, wherein a cancer sample from the patient has been determined to have an elevated level of LgR5 expression using immunohistochemistry (IHC). In some embodiments, an elevated level of LgR5 expression is 2+ or 3+ staining by IHC. In some embodiments, an elevated level of LgR5 expression is 3+ staining by IHC. In some embodiments, IHC is performed using an antibody described herein. In some embodiments, the cancer sample is a colon cancer sample, a colorectal cancer sample, small intestine cancer sample, endometrial cancer sample, pancreatic cancer sample, or ovarian cancer sample.
[0025] In some embodiments, the immunoconjugate comprises an anti-LgR5 antibody comprising: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 55, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 56, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 57, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 52; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 53; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 54; or (b) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 73, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 74, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 75, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 70; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 71; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 72; or (c) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 79, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 80, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 81, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 76; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 77; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 78; or (d) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 85, HVR-H2 comprising the amino acid sequence of SEQ ID NO: 86, HVR-H3 comprising the amino acid sequence of SEQ ID NO: 87, HVR-L1 comprising the amino acid sequence of SEQ ID NO: 82; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 83; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 84. In some embodiments, the immunoconjugate comprises an anti-LgR5 antibody comprising (a) a VH sequence of SEQ ID NO: 33 and a VL sequence of SEQ ID NO: 32; or (b) a VH sequence of SEQ ID NO: 51 and a VL sequence of SEQ ID NO: 50. In some embodiments, the immunoconjugate comprises an anti-LgR5 antibody conjugated to a cytotoxic agent.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1 shows a graphic representation of the levels of human LgR5 gene expression in various tissues, as described in Example A. The inset in FIG. 1 shows a graphic representation of the levels of human LgR5 gene expression in normal colon tissues and colon tumors, as described in Example A.
[0027] FIG. 2 shows expression of LgR5 in colon tumors by in situ hybridization, as described in Example B.
[0028] FIGS. 3A and 3B show (A) the prevalence of various levels of LgR5 expression in a colon tumor tissue microarray, and (B) the heterogeneity of LgR5 expression in three cores from each colorectal adenocarcinoma sample, both determined by in situ hybridization, as described in Example B.
[0029] FIGS. 4A and 4B show an alignment of the (A) light chain and (B) heavy chain of antibody LGR5.1-12 and antibody LGR5.26-1. The contact region, Chothia, and Kabat complementarity determining regions (CDRs, also referred to as hypervariable regions, or HVRs) are indicated. The Kabat HVRs are underlined.
[0030] FIGS. 5A, 5B, and 5C show staining of (A) colon tissue, (B) hair follicle, and (C) spinal cord with antibody LGR5.1-12, as described in Example E.
[0031] FIGS. 6A, 6B, 6C, and 6D show detection of LgR5 on the surface of (A) LoVo X 1.1 xenograft tumor cells and (B) D5124 xenograft tumor cells by FACS using antibody YW353, and staining of (C) LoVo X 1.1 xenograft tumors and (D) D5124 xenograft tumors by immunohistochemistry, using antibody LGR5.1-12, as described in Example F.
[0032] FIGS. 7A, 7B, 7C, and 7D show exemplary 0, 1+, 2+, and 3+ staining of colon tumors using antibody LGR5.1-12, as described in Example G.
[0033] FIGS. 8A and 8B show staining of a CXF233 xenograft tumor sample using (A) antibody LGR5.1-12 and (B) antibody LGR5.26-1, as described in Example H.
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
I. Definitions
[0034] An "acceptor human framework" for the purposes herein is a framework comprising the amino acid sequence of a light chain variable domain (VL) framework or a heavy chain variable domain (VH) framework derived from a human immunoglobulin framework or a human consensus framework, as defined below. An acceptor human framework "derived from" a human immunoglobulin framework or a human consensus framework may comprise the same amino acid sequence thereof, or it may contain amino acid sequence changes. In some embodiments, the number of amino acid changes are 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less. In some embodiments, the VL acceptor human framework is identical in sequence to the VL human immunoglobulin framework sequence or human consensus framework sequence.
[0035] "Affinity" refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity" refers to intrinsic binding affinity which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Specific illustrative and exemplary embodiments for measuring binding affinity are described in the following.
[0036] An "affinity matured" antibody refers to an antibody with one or more alterations in one or more hypervariable regions (HVRs), compared to a parent antibody which does not possess such alterations, such alterations resulting in an improvement in the affinity of the antibody for antigen.
[0037] The terms "anti-LgR5 antibody" and "an antibody that binds to LgR5" refer to an antibody that is capable of binding LgR5 with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting LgR5. In one embodiment, the extent of binding of an anti-LgR5 antibody to an unrelated, non-LgR5 protein is less than about 10% of the binding of the antibody to LgR5 as measured, e.g., by a radioimmunoassay (RIA) or by scatchard analysis or by surface plasmon resonance, such as, for example, Biacore.
[0038] In certain embodiments, an antibody that binds to LgR5 has a dissociation constant (Kd) of .ltoreq.1 .mu.M, .ltoreq.100 nM, .ltoreq.10 nM, .ltoreq.5 Nm, .ltoreq.4 nM, .ltoreq.3 nM, .ltoreq.2 nM, .ltoreq.1 nM, .ltoreq.0.1 nM, .ltoreq.0.01 nM, or .ltoreq.0.001 nM (e.g., 10.sup.-8M or less, e.g. from 10.sup.-8 M to 10.sup.-13M, e.g., from 10.sup.-9M to 10.sup.-13 M). In certain embodiments, an anti-LgR5 antibody binds to an epitope of LgR5 that is conserved among LgR5 from different species.
[0039] The term "antibody" is used herein in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
[0040] The term "antibody drug conjugate" (ADC) as used herein is equivalent to the term "immunoconjugate".
[0041] An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody and that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.
[0042] An "antibody that binds to the same epitope" as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more. An exemplary competition assay is provided herein.
[0043] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth/proliferation. Examples of cancer include, but are not limited to, carcinoma, lymphoma (e.g., Hodgkin's and non-Hodgkin's lymphoma), blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
[0044] The term "chimeric" antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
[0045] The "class" of an antibody refers to the type of constant domain or constant region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA.sub.1, and IgA.sub.2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called .alpha., .delta., .epsilon., .gamma., and .mu., respectively.
[0046] The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents a cellular function and/or causes cell death or destruction. Cytotoxic agents include, but are not limited to, radioactive isotopes (e.g., At.sup.211, I.sup.131, I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153, Bi.sup.212, P.sup.32, Pb.sup.212 and radioactive isotopes of Lu); chemotherapeutic agents or drugs (e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents); growth inhibitory agents; enzymes and fragments thereof such as nucleolytic enzymes; antibiotics; toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof; and the various antitumor or anticancer agents disclosed below.
[0047] "Effector functions" refer to those biological activities attributable to the Fc region of an antibody, which vary with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g. B cell receptor); and B cell activation.
[0048] An "effective amount" of an agent, e.g., a pharmaceutical formulation, refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
[0049] The term "epitope" refers to the particular site on an antigen molecule to which an antibody binds.
[0050] The term "Fc region" herein is used to define a C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region. The term includes native sequence Fc regions and variant Fc regions. In one embodiment, a human IgG heavy chain Fc region extends from Cys226, or from Pro230, to the carboxyl-terminus of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc region may or may not be present. Unless otherwise specified herein, numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also called the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991.
[0051] "Framework" or "FR" refers to variable domain residues other than hypervariable region (HVR) residues. The FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.
[0052] The terms "full length antibody," "intact antibody," and "whole antibody" are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
[0053] The term "glycosylated forms of LgR5" refers to naturally occurring forms of LgR5 that are post-translationally modified by the addition of carbohydrate residues.
[0054] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
[0055] A "human antibody" is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
[0056] A "rabbit antibody" is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a rabbit or a rabbit cell or derived from a non-rabbit source that utilizes rabbit antibody repertoires or other rabbit antibody-encoding sequences.
[0057] A "human consensus framework" is a framework which represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences. Generally, the subgroup of sequences is a subgroup as in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda Md. (1991), vols. 1-3. In one embodiment, for the VL, the subgroup is subgroup kappa I as in Kabat et al., supra. In one embodiment, for the VH, the subgroup is subgroup III as in Kabat et al., supra.
[0058] A "humanized" antibody refers to a chimeric antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.
[0059] The term "hypervariable region" or "HVR," as used herein, refers to each of the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops ("hypervariable loops"). Generally, native four-chain antibodies comprise six HVRs; three in the VH (H1, H2, H3), and three in the VL (L1, L2, L3). HVRs generally comprise amino acid residues from the hypervariable loops and/or from the "complementarity determining regions" (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition. Exemplary hypervariable loops occur at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2), and 96-101 (H3). (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987).) Exemplary CDRs (CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3) occur at amino acid residues 24-34 of L1, 50-56 of L2, 89-97 of L3, 31-35B of H1, 50-65 of H2, and 95-102 of H3. (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991).) With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops. CDRs also comprise "specificity determining residues," or "SDRs," which are residues that contact antigen. SDRs are contained within regions of the CDRs called abbreviated-CDRs, or a-CDRs. Exemplary a-CDRs (a-CDR-L1, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2, and a-CDR-H3) occur at amino acid residues 31-34 of L1, 50-55 of L2, 89-96 of L3, 31-35B of H1, 50-58 of H2, and 95-102 of H3. (See Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008).) Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al., supra.
[0060] An "immunoconjugate" is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent. An immunoconjugate is equivalent to the term "antibody drug conjugate" (ADC).
[0061] An "individual" or "patient" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.
[0062] An "isolated antibody" is one which has been separated from a component of its natural environment. In some embodiments, an antibody is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC). For review of methods for assessment of antibody purity, see, e.g., Flatman et al., J. Chromatogr. B 848:79-87 (2007).
[0063] An "isolated nucleic acid" refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.
[0064] "Isolated nucleic acid encoding an anti-LgR5 antibody" refers to one or more nucleic acid molecules encoding antibody heavy and light chains (or fragments thereof), including such nucleic acid molecule(s) in a single vector or separate vectors, and such nucleic acid molecule(s) present at one or more locations in a host cell.
[0065] The term "LgR5," as used herein, refers to any native, mature LgR5 which results from processing of an LgR5 precursor protein in a cell. The term includes LgR5 from any vertebrate source, including mammals such as primates (e.g. humans and cynomolgus or rhesus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated. The term also includes naturally occurring variants of LgR5, e.g., splice variants or allelic variants. The amino acid sequence of an exemplary human LgR5 precursor protein, with signal sequence (amino acids 1-21) is shown in SEQ ID NO: 21. The amino acid sequence of an exemplary mature human LgR5 is shown in SEQ ID NO: 22. The predicted sequence for amino acids 33 to 907 of an exemplary cynomolgus monkey LgR5 is shown in SEQ ID NO: 23. The amino acid sequences for exemplary rat LgR5 precursor (with signal sequence, amino acids 1-21) and mature sequences are shown in SEQ ID NOs: 24 and 25, respectively. The amino acid sequences for exemplary mouse LgR5 precursor (with signal sequence, amino acids 1-21) and mature sequences are shown in SEQ ID NOs: 26 and 27, respectively.
[0066] The term "LgR5-positive cancer" refers to a cancer comprising cells that express LgR5 on their surface. For the purposes of determining whether a cell expresses LgR5 on the surface, LgR5 mRNA expression is considered to correlate to LgR5 expression on the cell surface. In some embodiments, expression of LgR5 mRNA is determined by a method selected from in situ hybridization and RT-PCR (including quantitative RT-PCR). Alternatively, expression of LgR5 on the cell surface can be determined, for example, using antibodies to LgR5 in a method such as immunohistochemistry, FACS, etc.
[0067] The term "LgR5-positive cancer cell" refers to a cancer cell that expresses LgR5 on its surface.
[0068] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
[0069] A "naked antibody" refers to an antibody that is not conjugated to a heterologous moiety (e.g., a cytotoxic moiety) or radiolabel. The naked antibody may be present in a pharmaceutical formulation.
[0070] "Native antibodies" refer to naturally occurring immunoglobulin molecules with varying structures. For example, native IgG antibodies are heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From N- to C-terminus, each heavy chain has a variable region (VH), also called a variable heavy domain or a heavy chain variable domain, followed by three constant domains (CH1, CH2, and CH3). Similarly, from N- to C-terminus, each light chain has a variable region (VL), also called a variable light domain or a light chain variable domain, followed by a constant light (CL) domain. The light chain of an antibody may be assigned to one of two types, called kappa (.kappa.) and lambda (.lamda.), based on the amino acid sequence of its constant domain.
[0071] The term "package insert" is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
[0072] "Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or may be compiled from the source code. The ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
[0073] In situations where ALIGN-2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:
100 times the fraction X/Y
[0074] where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
[0075] The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
[0076] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
[0077] A "platinum complex" as used herein refers to anti-cancer chemotherapy drugs such as, for example, but not limited to, cisplatin, oxaliplatin, carboplatin, iproplatin, satraplatin, CI-973, AZ0473, DWA2114R, nedaplatin, and sprioplatin, which exert efficacy against tumors based on their ability to covalently bind to DNA.
[0078] As used herein, "treatment" (and grammatical variations thereof such as "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, anti-LgR5 antibodies are used to delay development of a disease or to slow the progression of a disease.
[0079] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs). (See, e.g., Kindt et al. Kuby Immunology, 6.sup.th ed., W.H. Freeman and Co., page 91 (2007).) A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).
[0080] The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors."
II. Compositions and Methods
[0081] In one aspect, the invention is based, in part, on antibodies that bind to LgR5 and immunoconjugates comprising such antibodies. Antibodies and immunoconjugates of the invention are useful, e.g., for the diagnosis or treatment of LgR5-positive cancers.
[0082] A. Exemplary Anti-LgR5 Antibodies
[0083] In some embodiments, the invention provides isolated antibodies that bind to LgR5. LgR5 is is a seven-transmembrane protein found, for example, on the surface of actively cycling intestinal stem cells. LgR5 is expressed in about 77% of colon tumor sections examined. See, e.g., PCT Publication No. WO 2013/149159. An exemplary naturally occurring human LgR5 precursor protein sequence, with signal sequence (amino acids 1-21) is provided in SEQ ID NO: 21, and the corresponding mature LgR5 protein sequence is shown in SEQ ID NO: 22 (corresponding to amino acids 22-907 of SEQ ID NO: 21).
[0084] In some embodiments, the invention provides isolated antibodies that bind to an epitope within amino acids 22 to 322 of human LgR5. In some embodiments, the invention provides isolated antibodies that bind to an epitope within the human LgR5 extracellular domain that is outside of amino acids 22 to 322. In some embodiments, the invention provides isolated antibodies that bind to an epitope within amino acids 323 to 558 of human LgR5.
Antibody .alpha.LgR5.1-12 and Other Embodiments
[0085] In one aspect, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:14; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO:11.
[0086] In one aspect, the invention provides an antibody comprising at least one, at least two, or all three VH HVR sequences selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:14. In one embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:14. In another embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:14 and HVR-L3 comprising the amino acid sequence of SEQ ID NO:11. In a further embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:14, HVR-L3 comprising the amino acid sequence of SEQ ID NO:11, and HVR-H2 comprising the amino acid sequence of SEQ ID NO:13. In a further embodiment, the antibody comprises (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:14.
[0087] In another aspect, the invention provides an antibody comprising at least one, at least two, or all three VL HVR sequences selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:11. In one embodiment, the antibody comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:11.
[0088] In another aspect, an antibody of the invention comprises (a) a VH domain comprising at least one, at least two, or all three VH HVR sequences selected from (i) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12, (ii) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13, and (iii) HVR-H3 comprising an amino acid sequence selected from SEQ ID NO:14; and (b) a VL domain comprising at least one, at least two, or all three VL HVR sequences selected from (i) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9, (ii) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:11.
[0089] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:14; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO:11.
[0090] In any of the above embodiments, an anti-LgR5 antibody is humanized. In one embodiment, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a human acceptor framework, e.g. a human immunoglobulin framework or a human consensus framework. In some embodiments, an anti-LgR5 antibody comprises the HVRs described above and rabbit framework regions.
[0091] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:6. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO:6. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VH sequence of SEQ ID NO:6, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:12, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:13, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:14.
[0092] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:5. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO:5. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VL sequence of SEQ ID NO:5, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:9; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:10; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:11.
[0093] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO:6 and SEQ ID NO:5, respectively, including post-translational modifications of those sequences.
[0094] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:6 and a VL sequence of SEQ ID NO:5. In some embodiments, an antibody that competes with an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:6 and a VL sequence of SEQ ID NO:5 for binding to human LgR5 is provided. In some embodiments, an antibody that competes with an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:6 and a VL sequence of SEQ ID NO:5 for binding to human LgR5 is provided. In some embodiments, an antibody that binds an epitope within the LgR5 extracellular domain that is outside of amino acids 22 to 322 is provided. In some embodiments, an antibody that does not compete for binding to human LgR5 with antibody either huYW353 or 8E11. In some embodiments, an antibody that binds to an epitope within amino acids 323 to 558 of human LgR5 is provided.
[0095] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG1 antibody or other antibody class or isotype as defined herein.
[0096] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below:
Antibody .alpha.LgR5.26-1 and Other Embodiments
[0097] In one aspect, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO:16; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO:17.
[0098] In one aspect, the invention provides an antibody comprising at least one, at least two, or all three VH HVR sequences selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20. In one embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:20. In another embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:20, and HVR-L3 comprising the amino acid sequence of SEQ ID NO:17. In a further embodiment, the antibody comprises HVR-H3 comprising the amino acid sequence of SEQ ID NO:20, HVR-L3 comprising the amino acid sequence of SEQ ID NO:17, and HVR-H2 comprising the amino acid sequence of SEQ ID NO:19. In a further embodiment, the antibody comprises (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20.
[0099] In another aspect, the invention provides an antibody comprising at least one, at least two, or all three VL HVR sequences selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:16; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:17. In one embodiment, the antibody comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:16; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:17.
[0100] In another aspect, an antibody of the invention comprises (a) a VH domain comprising at least one, at least two, or all three VH HVR sequences selected from (i) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18, (ii) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19, and (iii) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20; and (b) a VL domain comprising at least one, at least two, or all three VL HVR sequences selected from (i) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15, (ii) HVR-L2 comprising the amino acid sequence of SEQ ID NO:16, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:17.
[0101] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO:16; and (0 HVR-L3 comprising an amino acid sequence selected from SEQ ID NO:17.
[0102] In any of the above embodiments, an anti-LgR5 antibody is humanized. In one embodiment, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises an acceptor human framework, e.g. a human immunoglobulin framework or a human consensus framework. In some embodiments, an anti-LgR5 antibody comprises the HVRs described above and rabbit framework regions.
[0103] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:8. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO:8. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VH sequence of SEQ ID NO:8, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:18, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO:19, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO:20.
[0104] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:7. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO:7. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VL sequence of SEQ ID NO:7, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO:15; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO:8; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO:17.
[0105] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO:8 and SEQ ID NO:7, respectively, including post-translational modifications of those sequences.
[0106] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:8 and a VL sequence of SEQ ID NO:7. In some embodiments, an antibody that competes with an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:8 and a VL sequence of SEQ ID NO:7 for binding to human LgR5 is provided. In some embodiments, an antibody that competes with an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO:8 and a VL sequence of SEQ ID NO:7 for binding to an epitope within amino acids 22 to 322 of human LgR5 is provided.
[0107] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG2a antibody or other antibody class or isotype as defined herein.
[0108] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below:
Antibody 8E11 and Other Embodiments
[0109] In some embodiments, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 55; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 56; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 57; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 52; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 53; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO: 54.
[0110] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 55; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 56; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 57; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 52; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 53; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO: 54.
[0111] In any of the above embodiments, an anti-LgR5 antibody is humanized. In one embodiment, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a human acceptor framework, e.g. a human immunoglobulin framework or a human consensus framework. In certain embodiments, the human acceptor framework is the human VL kappa IV consensus (VL.sub.KIV) framework and/or the VH framework VH.sub.1. In certain embodiments, the human acceptor framework is the human VL kappa IV consensus (VL.sub.KIV) framework and/or the VH framework VH.sub.1 comprising an R71S mutation and an A78V mutation in heavy chain framework region FR3.
[0112] In some embodiments, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a heavy chain framework FR3 sequence selected from SEQ ID NOs: 65 to 68. In some embodiments, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a heavy chain framework FR3 sequence of SEQ ID NO: 66. In some such embodiments, the heavy chain variable domain framework is a modified human VH.sub.1 framework having an FR3 sequence selected from SEQ ID NOs: 65 to 68. In some such embodiments, the heavy chain variable domain framework is a modified human VH.sub.1 framework having an FR3 sequence of SEQ ID NO: 66.
[0113] In some embodiments, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a light chain framework FR3 sequence of SEQ ID NO: 61. In some such embodiments, the heavy chain variable domain framework is a modified VL kappa IV consensus (VL.sub.KIV) framework having an FR3 sequence of SEQ ID NO: 61.
[0114] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 31, 33, 35, 37, 39, 41, 43, and 45. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from SEQ ID NOs: 31, 33, 35, 37, 39, 41, 43, and 45 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in a sequence selected from SEQ ID NOs: 31, 33, 35, 37, 39, 41, 43, and 45. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in a sequence selected from SEQ ID NOs: 31, 33, 35, 37, 39, 41, 43, and 45. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0115] In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 31. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 33. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 35. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 37. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 39. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 41. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 43. In some embodiments, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 45.
[0116] Optionally, the anti-LgR5 antibody comprises the VH sequence selected from SEQ ID NOs: 31, 33, 35, 37, 39, 41, 43, and 45, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 55, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 56, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 57.
[0117] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 30, 32, 34, 36, 38, 40, 42, and 44. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from SEQ ID NOs: 30, 32, 34, 36, 38, 40, 42, and 44 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in an amino acid sequence selected from SEQ ID NOs: 30, 32, 34, 36, 38, 40, 42, and 44. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in an amino acid sequence selected from SEQ ID NOs: 30, 32, 34, 36, 38, 40, 42, and 44. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0118] In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 32. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 34. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 36. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 38. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 40. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 42. In some embodiments, an anti-LgR5 antibody comprises a light chain variable domain (VL) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 44.
[0119] Optionally, the anti-LgR5 antibody comprises the VL sequence of an amino acid sequence selected from SEQ ID NOs: 30, 32, 34, 36, 38, 40, 42, and 44, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 52; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 53; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 54.
[0120] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 31 and SEQ ID NO: 30, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 33 and SEQ ID NO: 32, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 35 and SEQ ID NO: 34, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 37 and SEQ ID NO: 36, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 39 and SEQ ID NO: 39, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 41 and SEQ ID NO: 40, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 43 and SEQ ID NO: 42, respectively, including post-translational modifications of those sequences. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 45 and SEQ ID NO: 44, respectively, including post-translational modifications of those sequences.
[0121] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO: 33 and a VL sequence of SEQ ID NO: 32. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 22-323. In some embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 1-312.
[0122] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab').sub.2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG1 antibody or other antibody class or isotype as defined herein.
[0123] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below.
Antibody YW353 and Other Embodiments
[0124] In one aspect, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 85; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 86; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 87; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 82; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 83; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO: 84.
[0125] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 85; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 86; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 87; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 82; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 83; and (f) HVR-L3 comprising an amino acid sequence selected from SEQ ID NO: 84.
[0126] In any of the above embodiments, an anti-LgR5 antibody is a human antibody.
[0127] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 26. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 51 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO: 51. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in SEQ ID NO: 51. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VH sequence of SEQ ID NO: 51, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 85, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 86, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 87.
[0128] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 50. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 50 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in SEQ ID NO: 50. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in SEQ ID NO: 50. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs). Optionally, the anti-LgR5 antibody comprises the VL sequence of SEQ ID NO: 50, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 82; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 83; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 84.
[0129] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 51 and SEQ ID NO: 50, respectively, including post-translational modifications of those sequences.
[0130] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO: 51 and a VL sequence of SEQ ID NO: 50. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 22-123. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 1-102.
[0131] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG2a antibody or other antibody class or isotype as defined herein.
[0132] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below.
Antibody 3G12 and Other Embodiments
[0133] In some embodiments, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 73; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 74; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 75; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 70; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 71; and (0 HVR-L3 comprising the amino acid sequence of SEQ ID NO: 72.
[0134] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 73; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 74; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 75; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 70; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 71; and (f) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 72.
[0135] In any of the above embodiments, an anti-LgR5 antibody is humanized. In one embodiment, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a human acceptor framework, e.g. a human immunoglobulin framework or a human consensus framework. In certain embodiments, the human acceptor framework is the human VL kappa consensus (VL.sub.K) framework and/or the human VH subgroup 3 consensus (VH.sub.3) framework.
[0136] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 47. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 47 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 47. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 47. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0137] Optionally, the anti-LgR5 antibody comprises the VH sequence of SEQ ID NO: 47, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 73, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 74, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 75.
[0138] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 46. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 46 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 46. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 46. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0139] Optionally, the anti-LgR5 antibody comprises the VL sequence of SEQ ID NO: 46, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 70; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 71; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 72.
[0140] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 47 and SEQ ID NO: 46, respectively, including post-translational modifications of those sequences.
[0141] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO: 47 and a VL sequence of SEQ ID NO: 46. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 324-423. In some embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 303-402. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 324-555. In some embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 303-534.
[0142] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG1 antibody or other antibody class or isotype as defined herein.
[0143] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below.
Antibody 2H6 and Other Embodiments
[0144] In some embodiments, the invention provides an anti-LgR5 antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 79; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 80; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 81; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 76; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 77; and (f) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 78.
[0145] In another aspect, the invention provides an antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 79; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 80; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 81; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 76; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 77; and (f) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 78.
[0146] In any of the above embodiments, an anti-LgR5 antibody is humanized. In one embodiment, an anti-LgR5 antibody comprises HVRs as in any of the above embodiments, and further comprises a human acceptor framework, e.g. a human immunoglobulin framework or a human consensus framework. In certain embodiments, the human acceptor framework is the human VL kappa consensus (VL.sub.K) framework and/or the human VH subgroup 3 (VH.sub.3) framework.
[0147] In another aspect, an anti-LgR5 antibody comprises a heavy chain variable domain (VH) sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 49. In certain embodiments, a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 49 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 49. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 49. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0148] Optionally, the anti-LgR5 antibody comprises the VH sequence of SEQ ID NO: 49, including post-translational modifications of that sequence. In a particular embodiment, the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 79, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 80, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 81.
[0149] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 48. In certain embodiments, a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 48 contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-LgR5 antibody comprising that sequence retains the ability to bind to LgR5. In certain embodiments, a total of 1 to 10 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 48. In certain embodiments, a total of 1 to 5 amino acids have been substituted, inserted and/or deleted in the amino acid sequence of SEQ ID NO: 48. In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the HVRs (i.e., in the FRs).
[0150] Optionally, the anti-LgR5 antibody comprises the VL sequence of the amino acid sequence of SEQ ID NO: 48, including post-translational modifications of that sequence. In a particular embodiment, the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 77; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 78.
[0151] In another aspect, an anti-LgR5 antibody is provided, wherein the antibody comprises a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above. In one embodiment, the antibody comprises the VH and VL sequences in SEQ ID NO: 49 and SEQ ID NO: 48, respectively, including post-translational modifications of those sequences.
[0152] In a further aspect, the invention provides an antibody that binds to the same epitope as an anti-LgR5 antibody provided herein. For example, in certain embodiments, an antibody is provided that binds to the same epitope as an anti-LgR5 antibody comprising a VH sequence of SEQ ID NO: 49 and a VL sequence of SEQ ID NO: 48. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 324-423. In some embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 303-402. In certain embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 21 from, within, or overlapping amino acids 324-555. In some embodiments, an antibody is provided that binds to an epitope of SEQ ID NO: 22 from, within, or overlapping amino acids 303-534.
[0153] In a further aspect of the invention, an anti-LgR5 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-LgR5 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full length antibody, e.g., an IgG1 antibody or other antibody class or isotype as defined herein.
[0154] In a further aspect, an anti-LgR5 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections 1-7 below:
[0155] 1. Antibody Affinity
[0156] In certain embodiments, an antibody provided herein has a dissociation constant (Kd) of .ltoreq.1 .mu.M, .ltoreq.100 nM, .ltoreq.10 nM, .ltoreq.1 nM, .ltoreq.0.1 nM, .ltoreq.0.01 nM, or .ltoreq.0.001 nM, and optionally is .gtoreq.10.sup.-13 M. (e.g. 10.sup.-8 M or less, e.g. from 10.sup.-8M to 10.sup.-13M, e.g., from 10.sup.-9M to 10.sup.-13 M).
[0157] In one embodiment, Kd is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay. Solution binding affinity of Fabs for antigen is measured by equilibrating Fab with a minimal concentration of (.sup.125I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (see, e.g., Chen et al., J. Mol. Biol. 293:865-881(1999)). To establish conditions for the assay, MICROTITER.RTM. multi-well plates (Thermo Scientific) are coated overnight with 5 .mu.g/ml of a capturing anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to five hours at room temperature (approximately 23.degree. C.). In a non-adsorbent plate (Nunc #269620), 100 pM or 26 pM [.sup.125I]-antigen are mixed with serial dilutions of a Fab of interest (e.g., consistent with assessment of the anti-VEGF antibody, Fab-12, in Presta et al., Cancer Res. 57:4593-4599 (1997)). The Fab of interest is then incubated overnight; however, the incubation may continue for a longer period (e.g., about 65 hours) to ensure that equilibrium is reached. Thereafter, the mixtures are transferred to the capture plate for incubation at room temperature (e.g., for one hour). The solution is then removed and the plate washed eight times with 0.1% polysorbate 20 (TWEEN-20.RTM.) in PBS. When the plates have dried, 150 .mu.l/well of scintillant (MICROSCINT-20.TM.; Packard) is added, and the plates are counted on a TOPCOUNT.TM. gamma counter (Packard) for ten minutes. Concentrations of each Fab that give less than or equal to 20% of maximal binding are chosen for use in competitive binding assays.
[0158] In some embodiments, Kd is measured using surface plasmon resonance assays using a BIACORE.RTM.-2000 or a BIACORE.RTM.-3000 (BIAcore, Inc., Piscataway, N.J.) at 25.degree. C. with immobilized antigen CMS chips at .about.10 response units (RU). Briefly, carboxymethylated dextran biosensor chips (CMS, BIACORE, Inc.) are activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. Antigen is diluted with 10 mM sodium acetate, pH 4.8, to 5 .mu.g/ml (.about.0.2 .mu.M) before injection at a flow rate of 5 .mu.l/minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1 M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% polysorbate 20 (TWEEN-20.TM.) surfactant (PBST) at 25.degree. C. at a flow rate of approximately 25 .mu.l/min. Association rates (k.sub.on) and dissociation rates (k.sub.off) are calculated using a simple one-to-one Langmuir binding model (BIACORE.RTM. Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgrams. The equilibrium dissociation constant (Kd) is calculated as the ratio k.sub.off/k.sub.on. See, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999). If the on-rate exceeds 10.sup.6 M.sup.-1 s.sup.-1 by the surface plasmon resonance assay above, then the on-rate can be determined by using a fluorescent quenching technique that measures the increase or decrease in fluorescence emission intensity (excitation=295 nm; emission=340 nm, 16 nm band-pass) at 25.degree. C. of a 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2, in the presence of increasing concentrations of antigen as measured in a spectrometer, such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-AMINCO.TM. spectrophotometer (ThermoSpectronic) with a stirred cuvette.
[0159] 2. Antibody Fragments
[0160] In certain embodiments, an antibody provided herein is an antibody fragment. Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab')2, Fv, and scFv fragments, and other fragments described below. For a review of certain antibody fragments, see Hudson et al. Nat. Med. 9:129-134 (2003). For a review of scFv fragments, see, e.g., Pluckthun, in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-Verlag, New York), pp. 269-315 (1994); see also WO 93/16185; and U.S. Pat. Nos. 5,571,894 and 5,587,458. For discussion of Fab and F(ab')2 fragments comprising salvage receptor binding epitope residues and having increased in vivo half-life, see U.S. Pat. No. 5,869,046.
[0161] Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, for example, EP 404,097; WO 1993/01161; Hudson et al., Nat. Med. 9:129-134 (2003); and Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat. Med. 9:129-134 (2003).
[0162] Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain embodiments, a single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, Mass.; see, e.g., U.S. Pat. No. 6,248,516 B1).
[0163] Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells (e.g. E. coli or phage), as described herein.
[0164] 3. Chimeric and Humanized Antibodies
[0165] In certain embodiments, an antibody provided herein is a chimeric antibody. Certain chimeric antibodies are described, e.g., in U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). In one example, a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region. In a further example, a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
[0166] In certain embodiments, a chimeric antibody is a humanized antibody. Typically, a non-human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. Generally, a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody, and FRs (or portions thereof) are derived from human antibody sequences. A humanized antibody optionally will also comprise at least a portion of a human constant region. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR residues are derived), e.g., to restore or improve antibody specificity or affinity.
[0167] Humanized antibodies and methods of making them are reviewed, e.g., in Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008), and are further described, e.g., in Riechmann et al., Nature 332:323-329 (1988); Queen et al., Proc. Nat'l Acad. Sci. USA 86:10029-10033 (1989); U.S. Pat. Nos. 5,821,337, 7,527,791, 6,982,321, and 7,087,409; Kashmiri et al., Methods 36:25-34 (2005) (describing SDR (a-CDR) grafting); Padlan, Mol. Immunol. 28:489-498 (1991) (describing "resurfacing"); Dall'Acqua et al., Methods 36:43-60 (2005) (describing "FR shuffling"); and Osbourn et al., Methods 36:61-68 (2005) and Klimka et al., Br. J. Cancer, 83:252-260 (2000) (describing the "guided selection" approach to FR shuffling).
[0168] Human framework regions that may be used for humanization include but are not limited to: framework regions selected using the "best-fit" method (see, e.g., Sims et al. J. Immunol. 151:2296 (1993)); framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions (see, e.g., Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al. J. Immunol., 151:2623 (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008)); and framework regions derived from screening FR libraries (see, e.g., Baca et al., J. Biol. Chem. 272:10678-10684 (1997) and Rosok et al., J. Biol. Chem. 271:22611-22618 (1996)).
[0169] 4. Human Antibodies
[0170] In certain embodiments, an antibody provided herein is a human antibody. Human antibodies can be produced using various techniques known in the art. Human antibodies are described generally in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450-459 (2008).
[0171] Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal's chromosomes. In such transgenic mice, the endogenous immunoglobulin loci have generally been inactivated. For review of methods for obtaining human antibodies from transgenic animals, see Lonberg, Nat. Biotech. 23:1117-1125 (2005). See also, e.g., U.S. Pat. Nos. 6,075,181 and 6,150,584 describing XENOMOUSE.TM. technology; U.S. Pat. No. 5,770,429 describing HuMABO technology; U.S. Pat. No. 7,041,870 describing K-M MOUSE.RTM. technology, and U.S. Patent Application Publication No. US 2007/0061900, describing VELOCIMOUSE.RTM. technology). Human variable regions from intact antibodies generated by such animals may be further modified, e.g., by combining with a different human constant region.
[0172] Human antibodies can also be made by hybridoma-based methods. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al., J. Immunol., 147: 86 (1991).) Human antibodies generated via human B-cell hybridoma technology are also described in Li et al., Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006). Additional methods include those described, for example, in U.S. Pat. No. 7,189,826 (describing production of monoclonal human IgM antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26(4):265-268 (2006) (describing human-human hybridomas). Human hybridoma technology (Trioma technology) is also described in Vollmers and Brandlein, Histology and Histopathology, 20(3):927-937 (2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27(3):185-91 (2005).
[0173] Human antibodies may also be generated by isolating Fv clone variable domain sequences selected from human-derived phage display libraries. Such variable domain sequences may then be combined with a desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.
[0174] 5. Library-Derived Antibodies
[0175] Antibodies of the invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, a variety of methods are known in the art for generating phage display libraries and screening such libraries for antibodies possessing the desired binding characteristics. Such methods are reviewed, e.g., in Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al., ed., Human Press, Totowa, N.J., 2001) and further described, e.g., in the McCafferty et al., Nature 348:552-554; Clackson et al., Nature 352: 624-628 (1991); Marks et al., J. Mol. Biol. 222: 581-597 (1992); Marks and Bradbury, in Methods in Molecular Biology 248:161-175 (Lo, ed., Human Press, Totowa, N.J., 2003); Sidhu et al., J. Mol. Biol. 338(2): 299-310 (2004); Lee et al., J. Mol. Biol. 340(5): 1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); and Lee et al., J. Immunol. Methods 284(1-2): 119-132(2004).
[0176] In certain phage display methods, repertoires of VH and VL genes are separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be screened for antigen-binding phage as described in Winter et al., Ann. Rev. Immunol., 12: 433-455 (1994). Phage typically display antibody fragments, either as single-chain Fv (scFv) fragments or as Fab fragments. Libraries from immunized sources provide high-affinity antibodies to the immunogen without the requirement of constructing hybridomas. Alternatively, the naive repertoire can be cloned (e.g., from human) to provide a single source of antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al., EMBO J 12: 725-734 (1993). Finally, naive libraries can also be made synthetically by cloning unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro, as described by Hoogenboom and Winter, J. Mol. Biol., 227: 381-388 (1992). Patent publications describing human antibody phage libraries include, for example: U.S. Pat. No. 5,750,373, and US Patent Publication Nos. 2005/0079574, 2005/0119455, 2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936, and 2009/0002360.
[0177] Antibodies or antibody fragments isolated from human antibody libraries are considered human antibodies or human antibody fragments herein.
[0178] 6. Multispecific Antibodies
[0179] In certain embodiments, an antibody provided herein is a multispecific antibody, e.g. a bispecific antibody. Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites. In certain embodiments, one of the binding specificities is for LgR5 and the other is for any other antigen. In certain embodiments, bispecific antibodies may bind to two different epitopes of LgR5. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express LgR5. Bispecific antibodies can be prepared as full length antibodies or antibody fragments.
[0180] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs having different specificities (see Milstein and Cuello, Nature 305: 537 (1983)), WO 93/08829, and Traunecker et al., EMBO J. 10: 3655 (1991)), and "knob-in-hole" engineering (see, e.g., U.S. Pat. No. 5,731,168). Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc-heterodimeric molecules (WO 2009/089004A1); cross-linking two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980, and Brennan et al., Science, 229: 81 (1985)); using leucine zippers to produce bi-specific antibodies (see, e.g., Kostelny et al., J. Immunol., 148(5):1547-1553 (1992)); using "diabody" technology for making bispecific antibody fragments (see, e.g., Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); and using single-chain Fv (sFv) dimers (see, e.g., Gruber et al., J. Immunol., 152:5368 (1994)); and preparing trispecific antibodies as described, e.g., in Tutt et al. J. Immunol. 147: 60 (1991).
[0181] Engineered antibodies with three or more functional antigen binding sites, including "Octopus antibodies," are also included herein (see, e.g. US 2006/0025576A1).
[0182] The antibody or fragment herein also includes a "Dual Acting FAb" or "DAF" comprising an antigen binding site that binds to LgR5 as well as another, different antigen (see, US 2008/0069820, for example).
[0183] 7. Antibody Variants
[0184] In certain embodiments, amino acid sequence variants of the antibodies provided herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of the antibody. Amino acid sequence variants of an antibody may be prepared by introducing appropriate modifications into the nucleotide sequence encoding the antibody, or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into and/or substitutions of residues within the amino acid sequences of the antibody. Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g., antigen-binding.
[0185] a) Substitution, Insertion, and Deletion Variants
[0186] In certain embodiments, antibody variants having one or more amino acid substitutions are provided. Sites of interest for substitutional mutagenesis include the HVRs and FRs. Conservative substitutions are shown in Table 1 under the heading of "preferred substitutions." More substantial changes are provided in Table 1 under the heading of "exemplary substitutions," and as further described below in reference to amino acid side chain classes. Amino acid substitutions may be introduced into an antibody of interest and the products screened for a desired activity, e.g., retained/improved antigen binding, decreased immunogenicity, or improved ADCC or CDC.
TABLE-US-00001 TABLE 1 Original Exemplary Preferred Residue Substitutions Substitutions Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Asp, Lys; Arg Gln Asp (D) Glu; Asn Glu Cys (C) Ser; Ala Ser Gln (Q) Asn; Glu Asn Glu (E) Asp; Gln Asp Gly (G) Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe; Norleucine Leu Leu (L) Norleucine; Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Trp; Leu; Val; Ile; Ala; Tyr Tyr Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Val; Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala; Norleucine Leu
[0187] Amino acids may be grouped according to common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile;
[0188] (2) neutral hydrophilic: Cy s, Ser, Thr, Asn, Gln;
[0189] (3) acidic: Asp, Glu;
[0190] (4) basic: His, Lys, Arg;
[0191] (5) residues that influence chain orientation: Gly, Pro;
[0192] (6) aromatic: Trp, Tyr, Phe.
[0193] Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
[0194] One type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody). Generally, the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and/or will have substantially retained certain biological properties of the parent antibody. An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g. binding affinity).
[0195] Alterations (e.g., substitutions) may be made in HVRs, e.g., to improve antibody affinity. Such alterations may be made in HVR "hotspots," i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol. 207:179-196 (2008)), and/or SDRs (a-CDRs), with the resulting variant VH or VL being tested for binding affinity. Affinity maturation by constructing and reselecting from secondary libraries has been described, e.g., in Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al., ed., Human Press, Totowa, N.J., (2001).) In some embodiments of affinity maturation, diversity is introduced into the variable genes chosen for maturation by any of a variety of methods (e.g., error-prone PCR, chain shuffling, or oligonucleotide-directed mutagenesis). A secondary library is then created. The library is then screened to identify any antibody variants with the desired affinity. Another method to introduce diversity involves HVR-directed approaches, in which several HVR residues (e.g., 4-6 residues at a time) are randomized. HVR residues involved in antigen binding may be specifically identified, e.g., using alanine scanning mutagenesis or modeling. CDR-H3 and CDR-L3 in particular are often targeted.
[0196] In certain embodiments, substitutions, insertions, or deletions may occur within one or more HVRs so long as such alterations do not substantially reduce the ability of the antibody to bind antigen. For example, conservative alterations (e.g., conservative substitutions as provided herein) that do not substantially reduce binding affinity may be made in HVRs. Such alterations may be outside of HVR "hotspots" or SDRs. In certain embodiments of the variant VH and VL sequences provided above, each HVR either is unaltered, or contains no more than one, two or three amino acid substitutions.
[0197] A useful method for identification of residues or regions of an antibody that may be targeted for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells (1989) Science, 244:1081-1085. In this method, a residue or group of target residues (e.g., charged residues such as arg, asp, his, lys, and glu) are identified and replaced by a neutral or negatively charged amino acid (e.g., alanine or polyalanine) to determine whether the interaction of the antibody with antigen is affected. Further substitutions may be introduced at the amino acid locations demonstrating functional sensitivity to the initial substitutions. Alternatively, or additionally, a crystal structure of an antigen-antibody complex is used to identify contact points between the antibody and antigen. Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution. Variants may be screened to determine whether they contain the desired properties.
[0198] Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue. Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g. for ADEPT) or a polypeptide which increases the serum half-life of the antibody.
[0199] b) Glycosylation Variants
[0200] In certain embodiments, an antibody provided herein is altered to increase or decrease the extent to which the antibody is glycosylated. Addition or deletion of glycosylation sites to an antibody may be conveniently accomplished by altering the amino acid sequence such that one or more glycosylation sites is created or removed.
[0201] Where the antibody comprises an Fc region, the carbohydrate attached thereto may be altered. Native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al. TIBTECH 15:26-32 (1997). The oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the "stem" of the biantennary oligosaccharide structure. In some embodiments, modifications of the oligosaccharide in an antibody of the invention may be made in order to create antibody variants with certain improved properties.
[0202] In one embodiment, antibody variants are provided having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region. For example, the amount of fucose in such antibody may be from 1% to 80%, from 1% to 65%, from 5% to 65% or from 20% to 40%. The amount of fucose is determined by calculating the average amount of fucose within the sugar chain at Asn297, relative to the sum of all glycostructures attached to Asn 297 (e.g. complex, hybrid and high mannose structures) as measured by MALDI-TOF mass spectrometry, as described in WO 2008/077546, for example. Asn297 refers to the asparagine residue located at about position 297 in the Fc region (Eu numbering of Fc region residues); however, Asn297 may also be located about .+-.3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300, due to minor sequence variations in antibodies. Such fucosylation variants may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd). Examples of publications related to "defucosylated" or "fucose-deficient" antibody variants include: US 2003/0157108; WO 2000/61739; WO 2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US 2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO 2003/085119; WO 2003/084570; WO 2005/035586; WO 2005/035778; WO2005/053742; WO2002/031140; Okazaki et al. J. Mol. Biol. 336:1239-1249 (2004); Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004). Examples of cell lines capable of producing defucosylated antibodies include Lec13 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys. 249:533-545 (1986); US Pat Appl No US 2003/0157108 A1, Presta, L; and WO 2004/056312 A1, Adams et al., especially at Example 11), and knockout cell lines, such as alpha-1,6-fucosyltransferase gene, FUT8, knockout CHO cells (see, e.g., Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al., Biotechnol. Bioeng., 94(4):680-688 (2006); and WO2003/085107).
[0203] Antibodies variants are further provided with bisected oligosaccharides, e.g., in which a biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc. Such antibody variants may have reduced fucosylation and/or improved ADCC function. Examples of such antibody variants are described, e.g., in WO 2003/011878 (Jean-Mairet et al.); U.S. Pat. No. 6,602,684 (Umana et al.); and US 2005/0123546 (Umana et al.). Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CDC function. Such antibody variants are described, e.g., in WO 1997/30087 (Patel et al.); WO 1998/58964 (Raju, S.); and WO 1999/22764 (Raju, S.).
[0204] c) Fc Region Variants
[0205] In certain embodiments, one or more amino acid modifications may be introduced into the Fc region of an antibody provided herein, thereby generating an Fc region variant. The Fc region variant may comprise a human Fc region sequence (e.g., a human IgG1, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification (e.g. a substitution) at one or more amino acid positions.
[0206] In certain embodiments, an antibody variant possesses some but not all effector functions, which make it a desirable candidate for applications in which the half life of the antibody in vivo is important yet certain effector functions (such as complement and ADCC) are unnecessary or deleterious. In vitro and/or in vivo cytotoxicity assays can be conducted to confirm the reduction/depletion of CDC and/or ADCC activities. For example, Fc receptor (FcR) binding assays can be conducted to ensure that the antibody lacks Fc.gamma.R binding (hence likely lacking ADCC activity), but retains FcRn binding ability. The primary cells for mediating ADCC, NK cells, express Fc(RIII only, whereas monocytes express Fc(RI, Fc(RII and Fc(RIII. FcR expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991). Non-limiting examples of in vitro assays to assess ADCC activity of a molecule of interest is described in U.S. Pat. No. 5,500,362 (see, e.g. Hellstrom, I. et al. Proc. Nat'l Acad. Sci. USA 83:7059-7063 (1986)) and Hellstrom, I et al., Proc. Nat'l Acad. Sci. USA 82:1499-1502 (1985); U.S. Pat. No. 5,821,337 (see Bruggemann, M. et al., J. Exp. Med. 166:1351-1361 (1987)). Alternatively, non-radioactive assays methods may be employed (see, for example, ACTI.TM. non-radioactive cytotoxicity assay for flow cytometry (CellTechnology, Inc. Mountain View, Calif.; and CytoTox 96.RTM. non-radioactive cytotoxicity assay (Promega, Madison, Wis.). Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and Natural Killer (NK) cells. Alternatively, or additionally, ADCC activity of the molecule of interest may be assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al. Proc. Nat'l Acad Sci. USA 95:652-656 (1998). C1q binding assays may also be carried out to confirm that the antibody is unable to bind C1q and hence lacks CDC activity. See, e.g., C1q and C3c binding ELISA in WO 2006/029879 and WO 2005/100402. To assess complement activation, a CDC assay may be performed (see, for example, Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996); Cragg, M. S. et al., Blood 101:1045-1052 (2003); and Cragg, M. S. and M. J. Glennie, Blood 103:2738-2743 (2004)). FcRn binding and in vivo clearance/half life determinations can also be performed using methods known in the art (see, e.g., Petkova, S. B. et al., Int'l. Immunol. 18(12):1759-1769 (2006)).
[0207] Antibodies with reduced effector function include those with substitution of one or more of Fc region residues 238, 265, 269, 270, 297, 327 and 329 (U.S. Pat. No. 6,737,056). Such Fc mutants include Fc mutants with substitutions at two or more of amino acid positions 265, 269, 270, 297 and 327, including the so-called "DANA" Fc mutant with substitution of residues 265 and 297 to alanine (U.S. Pat. No. 7,332,581).
[0208] Certain antibody variants with improved or diminished binding to FcRs are described. (See, e.g., U.S. Pat. No. 6,737,056; WO 2004/056312, and Shields et al., J. Biol. Chem. 9(2): 6591-6604 (2001).)
[0209] In certain embodiments, an antibody variant comprises an Fc region with one or more amino acid substitutions which improve ADCC, e.g., substitutions at positions 298, 333, and/or 334 of the Fc region (EU numbering of residues).
[0210] In some embodiments, alterations are made in the Fc region that result in altered (i.e., either improved or diminished) Clq binding and/or Complement Dependent Cytotoxicity (CDC), e.g., as described in U.S. Pat. No. 6,194,551, WO 99/51642, and Idusogie et al. J. Immunol. 164: 4178-4184 (2000).
[0211] Antibodies with increased half lives and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgGs to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)), are described in US2005/0014934A1 (Hinton et al.). Those antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to FcRn. Such Fc variants include those with substitutions at one or more of Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, e.g., substitution of Fc region residue 434 (U.S. Pat. No. 7,371,826).
[0212] See also Duncan & Winter, Nature 322:738-40 (1988); U.S. Pat. Nos. 5,648,260; 5,624,821; and WO 94/29351 concerning other examples of Fc region variants.
[0213] d) Cysteine Engineered Antibody Variants
[0214] In certain embodiments, it may be desirable to create cysteine engineered antibodies, e.g., "thioMAbs," in which one or more residues of an antibody are substituted with cysteine residues. In particular embodiments, the substituted residues occur at accessible sites of the antibody. By substituting those residues with cysteine, reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein. In certain embodiments, any one or more of the following residues may be substituted with cysteine: V205 (Kabat numbering) of the light chain; A118 (EU numbering) of the heavy chain; and 5400 (EU numbering) of the heavy chain Fc region. Cysteine engineered antibodies may be generated as described, e.g., in U.S. Pat. No. 7,521,541.
[0215] e) Antibody Derivatives
[0216] In certain embodiments, an antibody provided herein may be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available. The moieties suitable for derivatization of the antibody include but are not limited to water soluble polymers. Non-limiting examples of water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof. Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water. The polymer may be of any molecular weight, and may be branched or unbranched. The number of polymers attached to the antibody may vary, and if more than one polymer are attached, they can be the same or different molecules. In general, the number and/or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, whether the antibody derivative will be used in a therapy under defined conditions, etc.
[0217] In another embodiment, conjugates of an antibody and nonproteinaceous moiety that may be selectively heated by exposure to radiation are provided. In one embodiment, the nonproteinaceous moiety is a carbon nanotube (Kam et al., Proc. Natl. Acad. Sci. USA 102: 11600-11605 (2005)). The radiation may be of any wavelength, and includes, but is not limited to, wavelengths that do not harm ordinary cells, but which heat the nonproteinaceous moiety to a temperature at which cells proximal to the antibody-nonproteinaceous moiety are killed.
[0218] B. Recombinant Methods and Compositions
[0219] Antibodies may be produced using recombinant methods and compositions, e.g., as described in U.S. Pat. No. 4,816,567. In one embodiment, isolated nucleic acid encoding an anti-LgR5 antibody described herein is provided. Such nucleic acid may encode an amino acid sequence comprising the VL and/or an amino acid sequence comprising the VH of the antibody (e.g., the light and/or heavy chains of the antibody). In a further embodiment, one or more vectors (e.g., expression vectors) comprising such nucleic acid are provided. In a further embodiment, a host cell comprising such nucleic acid is provided. In one such embodiment, a host cell comprises (e.g., has been transformed with): (1) a vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and an amino acid sequence comprising the VH of the antibody, or (2) a first vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and a second vector comprising a nucleic acid that encodes an amino acid sequence comprising the VH of the antibody. In one embodiment, the host cell is eukaryotic, e.g. a Chinese Hamster Ovary (CHO) cell or lymphoid cell (e.g., YO, NSO, Sp20 cell). In one embodiment, a method of making an anti-LgR5 antibody is provided, wherein the method comprises culturing a host cell comprising a nucleic acid encoding the antibody, as provided above, under conditions suitable for expression of the antibody, and optionally recovering the antibody from the host cell (or host cell culture medium).
[0220] For recombinant production of an anti-LgR5 antibody, nucleic acid encoding an antibody, e.g., as described above, is isolated and inserted into one or more vectors for further cloning and/or expression in a host cell. Such nucleic acid may be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).
[0221] Suitable host cells for cloning or expression of antibody-encoding vectors include prokaryotic or eukaryotic cells described herein. For example, antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed. For expression of antibody fragments and polypeptides in bacteria, see, e.g., U.S. Pat. Nos. 5,648,237, 5,789,199, and 5,840,523. (See also Charlton, Methods in Molecular Biology, Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, N.J., 2003), pp. 245-254, describing expression of antibody fragments in E. coli.) After expression, the antibody may be isolated from the bacterial cell paste in a soluble fraction and can be further purified.
[0222] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors, including fungi and yeast strains whose glycosylation pathways have been "humanized," resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22:1409-1414 (2004), and Li et al., Nat. Biotech. 24:210-215 (2006).
[0223] Suitable host cells for the expression of glycosylated antibody are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera frugiperda cells.
[0224] Plant cell cultures can also be utilized as hosts. See, e.g., U.S. Pat. Nos. 5,959,177, 6,040,498, 6,420,548, 7,125,978, and 6,417,429 (describing PLANTIBODIES.TM. technology for producing antibodies in transgenic plants).
[0225] Vertebrate cells may also be used as hosts. For example, mammalian cell lines that are adapted to grow in suspension may be useful. Other examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7); human embryonic kidney line (293 or 293 cells as described, e.g., in Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK); mouse sertoli cells (TM4 cells as described, e.g., in Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor (MMT 060562); TRI cells, as described, e.g., in Mather et al., Annals NY. Acad. Sci. 383:44-68 (1982); MRC 5 cells; and FS4 cells. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR.sup.- CHO cells (Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); and myeloma cell lines such as Y0, NS0 and Sp2/0. For a review of certain mammalian host cell lines suitable for antibody production, see, e.g., Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, N.J.), pp. 255-268 (2003).
[0226] C. Assays
[0227] Anti-LgR5 antibodies provided herein may be identified, screened for, or characterized for their physical/chemical properties and/or biological activities by various assays known in the art.
[0228] In one aspect, an antibody of the invention is tested for its antigen binding activity, e.g., by known methods such as ELISA, FACS or Western blot.
[0229] In another aspect, competition assays may be used to identify an antibody that competes with any of the antibodies described herein for binding to LgR5. In certain embodiments, such a competing antibody binds to the same epitope (e.g., a linear or a conformational epitope) that is bound by an antibody described herein. Detailed exemplary methods for mapping an epitope to which an antibody binds are provided in Morris (1996) "Epitope Mapping Protocols," in Methods in Molecular Biology vol. 66 (Humana Press, Totowa, N.J.).
[0230] In an exemplary competition assay, immobilized LgR5 is incubated in a solution comprising a first labeled antibody that binds to LgR5 (e.g., any of the antibodies described herein) and a second unlabeled antibody that is being tested for its ability to compete with the first antibody for binding to LgR5. The second antibody may be present in a hybridoma supernatant. As a control, immobilized LgR5 is incubated in a solution comprising the first labeled antibody but not the second unlabeled antibody. After incubation under conditions permissive for binding of the first antibody to LgR5, excess unbound antibody is removed, and the amount of label associated with immobilized LgR5 is measured. If the amount of label associated with immobilized LgR5 is substantially reduced in the test sample relative to the control sample, then that indicates that the second antibody is competing with the first antibody for binding to LgR5. See Harlow and Lane (1988)Antibodies: A Laboratory Manual ch.14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
[0231] D. Immunoconjugates
[0232] The invention also provides immunoconjugates comprising an anti-LgR5 antibody herein conjugated to one or more cytotoxic agents, such as chemotherapeutic agents or drugs, growth inhibitory agents, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes (i.e., a radio conjugate).
[0233] Immunoconjugates allow for the targeted delivery of a drug moiety to a tumor, and, in some embodiments intracellular accumulation therein, where systemic administration of unconjugated drugs may result in unacceptable levels of toxicity to normal cells (Polakis P. (2005) Current Opinion in Pharmacology 5:382-387).
[0234] Antibody-drug conjugates (ADC) are targeted chemotherapeutic molecules which combine properties of both antibodies and cytotoxic drugs by targeting potent cytotoxic drugs to antigen-expressing tumor cells (Teicher, B. A. (2009) Current Cancer Drug Targets 9:982-1004), thereby enhancing the therapeutic index by maximizing efficacy and minimizing off-target toxicity (Carter, P. J. and Senter P. D. (2008) The Cancer Jour. 14(3):154-169; Chari, R. V. (2008) Acc. Chem. Res. 41:98-107.
[0235] The ADC compounds of the invention include those with anticancer activity. In some embodiments, the ADC compounds include an antibody conjugated, i.e. covalently attached, to the drug moiety. In some embodiments, the antibody is covalently attached to the drug moiety through a linker. The antibody-drug conjugates (ADC) of the invention selectively deliver an effective dose of a drug to tumor tissue whereby greater selectivity, i.e. a lower efficacious dose, may be achieved while increasing the therapeutic index ("therapeutic window").
[0236] The drug moiety (D) of the antibody-drug conjugates (ADC) may include any compound, moiety or group that has a cytotoxic or cytostatic effect. Drug moieties may impart their cytotoxic and cytostatic effects by mechanisms including but not limited to tubulin binding, DNA binding or intercalation, and inhibition of RNA polymerase, protein synthesis, and/or topoisomerase. Exemplary drug moieties include, but are not limited to, a maytansinoid, dolastatin, auristatin, calicheamicin, pyrrolobenzodiazepine (PBD), nemorubicin and its derivatives, PNU-159682, anthracycline, duocarmycin, vinca alkaloid, taxane, trichothecene, CC1065, camptothecin, elinafide, and stereoisomers, isosteres, analogs, and derivatives thereof that have cytotoxic activity.
[0237] E. Methods and Compositions for Diagnostics and Detection
[0238] In certain embodiments, any of the anti-LgR5 antibodies provided herein is useful for detecting the presence of LgR5 in a biological sample. The term "detecting" as used herein encompasses quantitative or qualitative detection. A "biological sample" comprises, e.g., a cell or tissue (e.g., biopsy material, including cancerous or potentially cancerous colon, colorectal, small intestine, endometrial, pancreatic, or ovarian tissue).
[0239] In one embodiment, an anti-LgR5 antibody for use in a method of diagnosis or detection is provided. In a further aspect, a method of detecting the presence of LgR5 in a biological sample is provided. In certain embodiments, the method comprises contacting the biological sample with an anti-LgR5 antibody as described herein under conditions permissive for binding of the anti-LgR5 antibody to LgR5, and detecting whether a complex is formed between the anti-LgR5 antibody and LgR5 in the biological sample. Such method may be an in vitro or in vivo method. In one embodiment, an anti-LgR5 antibody is used to select subjects eligible for therapy with an anti-LgR5 antibody, e.g. where LgR5 is a biomarker for selection of patients. In a further embodiment, the biological sample is a cell or tissue (e.g., biopsy material, including cancerous or potentially cancerous colon, colorectal, small intestine, endometrial, pancreatic, or ovarian tissue).
[0240] In a further embodiment, an anti-LgR5 antibody is used in vivo to detect, e.g., by in vivo imaging, an LgR5-positive cancer in a subject, e.g., for the purposes of diagnosing, prognosing, or staging cancer, determining the appropriate course of therapy, or monitoring response of a cancer to therapy. One method known in the art for in vivo detection is immuno-positron emission tomography (immuno-PET), as described, e.g., in van Dongen et al., The Oncologist 12:1379-1389 (2007) and Verel et al., J. Nucl. Med. 44:1271-1281 (2003). In such embodiments, a method is provided for detecting an LgR5-positive cancer in a subject, the method comprising administering a labeled anti-LgR5 antibody to a subject having or suspected of having an LgR5-positive cancer, and detecting the labeled anti-LgR5 antibody in the subject, wherein detection of the labeled anti-LgR5 antibody indicates an LgR5-positive cancer in the subject. In certain of such embodiments, the labeled anti-LgR5 antibody comprises an anti-LgR5 antibody conjugated to a positron emitter, such as .sup.68Ga, .sup.18F, .sup.64Cu, .sup.86Y, .sup.76Br, .sup.89Zr, and .sup.124I. In a particular embodiment, the positron emitter is .sup.89Zr. Nonlimiting exemplary methods of making and using .sup.89Zr-labeled antibodies are described, e.g., in PCT Publication No. WO 2011/056983. In some embodiments, the labeled anti-LgR5 antibody is a cysteine engineered antibody conjugated to one or more zirconium complexes. See, e.g., WO 2011/056983.
[0241] In further embodiments, a method of diagnosis or detection comprises contacting a first anti-LgR5 antibody immobilized to a substrate with a biological sample to be tested for the presence of LgR5, exposing the substrate to a second anti-LgR5 antibody, and detecting whether the second anti-LgR5 is bound to a complex between the first anti-LgR5 antibody and LgR5 in the biological sample. A substrate may be any supportive medium, e.g., glass, metal, ceramic, polymeric beads, slides, chips, and other substrates. In certain embodiments, a biological sample comprises a cell or tissue (e.g., biopsy material, including cancerous or potentially cancerous colon, colorectal, small intestine, endometrial, pancreatic or ovarian tissue). In certain embodiments, the first or second anti-LgR5 antibody is any of the antibodies described herein. In such embodiments, the second anti-LgR5 antibody may be .alpha.LgR5.1-12 or antibodies derived from .alpha.LgR5.1-12 as described herein. In such embodiments, the second anti-LgR5 antibody may be .alpha.LgR5.26-1 or antibodies derived from .alpha.LgR5.26-1 as described herein.
[0242] Exemplary disorders that may be diagnosed or detected according to any of the above embodiments include LgR5-positive cancers, such as LgR5-positive colorectal cancer (including adenocarcinoma), LgR5-positive small intestine cancer (including adenocarcinoma, sarcoma (e.g., leiomyosarcoma), carcinoid tumors, gastrointestnal stromal tumor, and lymphoma) LgR5-positive ovarian cancer (including ovarian serous adenocarcinoma), LgR5-positive pancreatic cancer (including pancreatic ductal adenocarcinoma), and LgR5-positive endometrial cancer.
[0243] In some embodiments, an LgR5-positive cancer is a cancer that receives a LgR5 immunohistochemistry (IHC) score greater than "0," which corresponds to very weak or no staining, under the conditions described herein in the Examples (see, e.g., Examples F, H, and I). In another embodiment, a LgR5-positive cancer expresses LgR5 at a 1+, 2+ or 3+ level, as defined under the conditions described herein in the Examples (see, e.g., Examples F, H, and I). In some embodiments, one or more cell lines may be used as a control for staining level. For example, in some embodiments, a cell line shown in Table 4 in Example I may be used as a control for staining level. For example, in some embodiments, cell line SW480, RKO, COLO741, HCT-15, CX-1, HT-29, SW1116, HCA-7, and/or COLO-205 may be used as a control for 0 staining; cell line SW948, CACO-2, and/or C2BBel may be used as a control for 1+ staining; and/or cell line T84, SW1463, SK-CO-1, and/or LOVO may be used as a control for 2+ staining. In some embodiments, an LgR5-positive cancer is a cancer that receives an H score of 50 or greater, as defined under the conditions described herein in Example H (corresponding to an overall score of 1+, 2+ or 3+ using 50%+ criteria). In some embodiments, a LgR5-positive cancer is a cancer that receives an H score of 10 or greater, as defined under the conditions described herein in Example H (corresponding to an overall score of 1+, 2+, or 3+ using 10%+ criteria).
[0244] In some embodiments, an LgR5-positive cancer is a cancer that expresses LgR5 according to a reverse-transcriptase PCR (RT-PCR) assay that detects LgR5 mRNA. In some embodiments, the RT-PCR is quantitative RT-PCR.
[0245] In certain embodiments, labeled anti-LgR5 antibodies are provided. Labels include, but are not limited to, labels or moieties that are detected directly (such as fluorescent, chromophoric, electron-dense, chemiluminescent, and radioactive labels), as well as moieties, such as enzymes or ligands, that are detected indirectly, e.g., through an enzymatic reaction or molecular interaction. Exemplary labels include, but are not limited to, the radioisotopes .sup.32P, .sup.14C, .sup.125I, .sup.3H, and .sup.131I, fluorophores such as rare earth chelates or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, luceriferases, e.g., firefly luciferase and bacterial luciferase (U.S. Pat. No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, horseradish peroxidase (HRP), alkaline phosphatase, .beta.-galactosidase, glucoamylase, lysozyme, saccharide oxidases, e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase, heterocyclic oxidases such as uricase and xanthine oxidase, coupled with an enzyme that employs hydrogen peroxide to oxidize a dye precursor such as HRP, lactoperoxidase, or microperoxidase, biotin/avidin, spin labels, bacteriophage labels, stable free radicals, and the like. In another embodiment, a label is a positron emitter. Positron emitters include but are not limited to .sup.68Ga, .sup.18F, .sup.64Cu, .sup.86Y, .sup.76Br, .sup.89Zr, and .sup.124I. In a particular embodiment, a positron emitter is .sup.89Zr.
[0246] F. Pharmaceutical Formulations
[0247] Pharmaceutical formulations of an anti-LgR5 antibody or immunoconjugate as described herein are prepared by mixing such antibody or immunoconjugate having the desired degree of purity with one or more optional pharmaceutically acceptable carriers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG). Exemplary pharmaceutically acceptable carriers herein further include insterstitial drug dispersion agents such as soluble neutral-active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20 (HYLENEX.RTM., Baxter International, Inc.). Certain exemplary sHASEGPs and methods of use, including rHuPH20, are described in US Patent Publication Nos. 2005/0260186 and 2006/0104968. In one aspect, a sHASEGP is combined with one or more additional glycosaminoglycanases such as chondroitinases.
[0248] Exemplary lyophilized antibody or immunoconjugate formulations are described in U.S. Pat. No. 6,267,958. Aqueous antibody or immunoconjugate formulations include those described in U.S. Pat. No. 6,171,586 and WO2006/044908, the latter formulations including a histidine-acetate buffer.
[0249] The formulation herein may also contain more than one active ingredient as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, in some instances, it may be desirable to further provide Avastin.RTM. (bevacizumab), e.g., for the treatment of LgR5-positive cancer such as LgR5-positive colon cancer or LgR5-positive colorectal cancer.
[0250] Active ingredients may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
[0251] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody or immunoconjugate, which matrices are in the form of shaped articles, e.g. films, or microcapsules.
[0252] The formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
[0253] G. Therapeutic Methods and Compositions
[0254] Any of the anti-LgR5 antibodies or immunoconjugates provided herein may be used in methods, e.g., therapeutic methods.
[0255] In one aspect, an anti-LgR5 antibody or immunoconjugate provided herein is used in a method of inhibiting proliferation of a LgR5-positive cell, the method comprising exposing the cell to the anti-LgR5 antibody or immunoconjugate under conditions permissive for binding of the anti-LgR5 antibody or immunoconjugate to LgR5 on the surface of the cell, thereby inhibiting the proliferation of the cell. In certain embodiments, the method is an in vitro or an in vivo method. In further embodiments, the cell is a colon, colorectal, small intestine, ovarian, pancreatic, or endometrial cell.
[0256] In some embodiments, an anti-LgR5 antibody or immunoconjugate provided herein is used in a method of treating cancer that comprises a mutation in a Kras gene and/or a mutation in an adenomatous polyposis coli (APC) gene in at least a portion of the cells of the cancer. In various embodiments, the cancer is selected from colon, colorectal, small intestine, ovarian, pancreatic, and endometrial cancer. In some embodiments, an anti-LgR5 antibody or immunoconjugate provided herein is used in a method of treating a colon or colorectal cancer that comprises a mutation in a Kras gene and/or a mutation in an APC gene in at least a portion of the cells of the cancer. Nonlimiting exemplary Kras mutations found in cancers (including colon and colorectal cancers) include mutations at Kras codon 12 (e.g., G12D, G12V, G12R, G12C, G12S, and G12A), codon 13 (e.g., G13D and G13C), codon 61 (e.g., G61H, G61L, G61E, and G61K), and codon 146. See, e.g., Yokota, Anticancer Agents Med. Chem., 12: 163-171 (2012); Wicki et al., Swiss Med. Wkly, 140: w13112 (2010). Nonlimiting exemplary APC mutations found in cancers include mutations in the mutation cluster region (MCR), such as stop codons and frameshift mutations that result in a truncated APC gene product. See, e.g., Chandra et al., PLoS One, 7: e34479 (2012); and Kohler et al., Hum. Mol. Genet., 17: 1978-1987 (2008).
[0257] In some embodiments, a method of treating cancer comprises administering an anti-LgR5 antibody or immunoconjugate to a subject, wherein the subject has a cancer comprising a Kras mutation and/or an APC mutation in at least a portion of the cancer cells. In some embodiments, the cancer is selected from colon, colorectal, small intestine, ovarian, pancreatic, and endometrial cancer. In some embodiments, the cancer is colon and/or colorectal cancer. In some embodiments, the subject has previously been determined to have a cancer comprising a Kras mutation and/or an APC mutation in at least a portion of the cancer cells. In some embodiments, the cancer is LgR5-positive.
[0258] Presence of various biomarkers in a sample can be analyzed by a number of methodologies, many of which are known in the art and understood by the skilled artisan, including, but not limited to, immunohistochemistry ("IHC"), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, fluorescence activated cell sorting ("FACS"), MassARRAY, proteomics, quantitative blood based assays (as for example Serum ELISA), biochemical enzymatic activity assays, in situ hybridization, Southern analysis, Northern analysis, whole genome sequencing, polymerase chain reaction ("PCR") including quantitative real time PCR ("qRT-PCR") and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like, RNA-Seq, FISH, microarray analysis, gene expression profiling, and/or serial analysis of gene expression ("SAGE"), as well as any one of the wide variety of assays that can be performed by protein, gene, and/or tissue array analysis. Typical protocols for evaluating the status of genes and gene products are found, for example in Ausubel et al., eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). Multiplexed immunoassays such as those available from Rules Based Medicine or Meso Scale Discovery ("MSD") may also be used.
[0259] Inhibition of cell proliferation in vitro may be assayed using the CellTiter-Glo' Luminescent Cell Viability Assay, which is commercially available from Promega (Madison, Wis.). That assay determines the number of viable cells in culture based on quantitation of ATP present, which is an indication of metabolically active cells. See Crouch et al. (1993) J Immunol. Meth. 160:81-88, U.S. Pat. No. 6,602,677. The assay may be conducted in 96- or 384-well format, making it amenable to automated high-throughput screening (HTS). See Cree et al. (1995) AntiCancer Drugs 6:398-404. The assay procedure involves adding a single reagent (CellTiter-Glo.RTM. Reagent) directly to cultured cells. This results in cell lysis and generation of a luminescent signal produced by a luciferase reaction. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in culture. Data can be recorded by luminometer or CCD camera imaging device. The luminescence output is expressed as relative light units (RLU).
[0260] In another aspect, an anti-LgR5 antibody or immunoconjugate for use as a medicament is provided. In further aspects, an anti-LgR5 antibody or immunoconjugate for use in a method of treatment is provided. In certain embodiments, an anti-LgR5 antibody or immunoconjugate for use in treating LgR5-positive cancer is provided. In certain embodiments, the invention provides an anti-LgR5 antibody or immunoconjugate for use in a method of treating an individual having a LgR5-positive cancer, the method comprising administering to the individual an effective amount of the anti-LgR5 antibody or immunoconjugate. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below.
[0261] In a further aspect, the invention provides for the use of an anti-LgR5 antibody or immunoconjugate in the manufacture or preparation of a medicament. In one embodiment, the medicament is for treatment of LgR5-positive cancer. In a further embodiment, the medicament is for use in a method of treating LgR5-positive cancer, the method comprising administering to an individual having LgR5-positive cancer an effective amount of the medicament. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below.
[0262] In a further aspect, the invention provides a method for treating LgR5-positive cancer. In one embodiment, the method comprises administering to an individual having such LgR5-positive cancer an effective amount of an anti-LgR5 antibody or immunoconjugate. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, as described below.
[0263] An LgR5-positive cancer according to any of the above embodiments may be, e.g., LgR5-positive colon or colorectal cancer (including adenocarcinoma), LgR5-positive small intestine cancer (including adenocarcinoma, sarcoma (e.g., leiomyosarcoma), carcinoid tumors, gastrointestinal stromal tumor, and lymphoma), LgR5-positive ovarian cancer (including ovarian serous adenocarcinoma), LgR5-positive pancreatic cancer (including pancreatic ductal adenocarcinoma), and LgR5-positive endometrial cancer.
[0264] In some embodiments, an LgR5-positive cancer is a cancer that receives a LgR5 immunohistochemistry (IHC) score greater than "0," which corresponds to very weak or no staining, under the conditions described herein in the Examples (see, e.g., Examples F, H, and I). In another embodiment, a LgR5-positive cancer expresses LgR5 at a 1+, 2+ or 3+ level, as defined under the conditions described herein in the Examples (see, e.g., Examples F, H, and I). In some embodiments, one or more cell lines may be used as a control for staining level. For example, in some embodiments, a cell line shown in Table 4 in Example I may be used as a control for staining level. For example, in some embodiments, cell line SW480, RKO, COLO741, HCT-15, CX-1, HT-29, SW1116, HCA-7, and/or COLO-205 may be used as a control for 0 staining; cell line SW948, CACO-2, and/or C2BBel may be used as a control for 1+ staining; and/or cell line T84, SW1463, SK-CO-1, and/or LOVO may be used as a control for 2+ staining. In some embodiments, an LgR5-positive cancer is a cancer that receives an H score of 50 or greater, as defined under the conditions described herein in Example H (corresponding to an overall score of 1+, 2+ or 3+ using 50%+ criteria). In some embodiments, a LgR5-positive cancer is a cancer that receives an H score of 10 or greater, as defined under the conditions described herein in Example H (corresponding to an overall score of 1+, 2+, or 3+ using 10%+ criteria).
[0265] In some embodiments, an LgR5-positive cancer is a cancer that expresses LgR5 according to a reverse-transcriptase PCR (RT-PCR) assay that detects LgR5 mRNA. In some embodiments, the RT-PCR is quantitative RT-PCR.
[0266] An "individual" according to any of the above embodiments may be a human.
[0267] In a further aspect, the invention provides pharmaceutical formulations comprising any of the anti-LgR5 antibodies or immunoconjugate provided herein, e.g., for use in any of the above therapeutic methods. In one embodiment, a pharmaceutical formulation comprises any of the anti-LgR5 antibodies or immunoconjugates provided herein and a pharmaceutically acceptable carrier. In another embodiment, a pharmaceutical formulation comprises any of the anti-LgR5 antibodies or immunoconjugates provided herein and at least one additional therapeutic agent, e.g., as described below.
[0268] Antibodies or immunoconjugates of the invention can be used either alone or in combination with other agents in a therapy. For instance, an antibody or immunoconjugate of the invention may be co-administered with at least one additional therapeutic agent. In certain embodiments, an additional therapeutic agent is Avastin.RTM. (bevacizumab), e.g., for the treatment of LgR5-positive cancer such as LgR5-positive colon cancer or LgR5-positive colorectal cancer.
[0269] Such combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate administration, in which case, administration of the antibody or immunoconjugate of the invention can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent and/or adjuvant. Antibodies or immunoconjugates of the invention can also be used in combination with radiation therapy.
[0270] An antibody or immunoconjugate (and any additional therapeutic agent) can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, e.g. by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
[0271] Antibodies or immunoconjugates would be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The antibody or immunoconjugate need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents depends on the amount of antibody or immunoconjugate present in the formulation, the type of disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as described herein, or about from 1 to 99% of the dosages described herein, or in any dosage and by any route that is empirically/clinically determined to be appropriate.
[0272] For the prevention or treatment of disease, the appropriate dosage of an antibody or immunoconjugate (when used alone or in combination with one or more other additional therapeutic agents) will depend on the type of disease to be treated, the type of antibody or immunoconjugate, the severity and course of the disease, whether the antibody or immunoconjugate is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody or immunoconjugate, and the discretion of the attending physician. The antibody or immunoconjugate is suitably administered to the patient at one time or over a series of treatments. Depending on the type and severity of the disease, about 1 .mu.g/kg to 15 mg/kg (e.g. 0.1 mg/kg-10 mg/kg) of antibody or immunoconjugate can be an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. One typical daily dosage might range from about 1 .mu.g/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment would generally be sustained until a desired suppression of disease symptoms occurs. One exemplary dosage of the antibody or immunoconjugate would be in the range from about 0.05 mg/kg to about 10 mg/kg. Thus, one or more doses of about 0.5 mg/kg, 2.0 mg/kg, 4.0 mg/kg or 10 mg/kg (or any combination thereof) may be administered to the patient. Such doses may be administered intermittently, e.g. every week or every three weeks (e.g. such that the patient receives from about two to about twenty, or e.g. about six doses of the antibody). An initial higher loading dose, followed by one or more lower doses may be administered. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
[0273] It is understood that any of the above formulations or therapeutic methods may be carried out using both an immunoconjugate and an anti-LgR5 antibody.
[0274] H. Articles of Manufacture
[0275] In another aspect, an article of manufacture containing materials useful for the treatment, prevention and/or diagnosis of the disorders described above is provided. The article of manufacture comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is by itself or combined with another composition effective for treating, preventing and/or diagnosing the disorder and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is an anti-LgR5 antibody or immunoconjugate. The label or package insert indicates that the composition is used for treating the condition of choice. Moreover, the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the composition comprises an antibody or immunoconjugate; and (b) a second container with a composition contained therein, wherein the composition comprises a further cytotoxic or otherwise therapeutic agent. The article of manufacture in this embodiment may further comprise a package insert indicating that the compositions can be used to treat a particular condition. Alternatively, or additionally, the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution or dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
III. EXAMPLES
[0276] The following are examples of methods and compositions of the invention. It is understood that various other embodiments may be practiced, given the general description provided above.
[0277] A. Human LgR5 Gene Expression
[0278] Human LgR5 gene expression was analyzed using a proprietary database containing gene expression information (GeneExpress.RTM., Gene Logic Inc., Gaithersburg, Md.). Graphical analysis of the GeneExpress.RTM. database was conducted using a microarray profile viewer. FIG. 1 is a graphic representation of human LgR5 gene expression in various tissues. The scale on the y-axis indicates gene expression levels based on hybridization signal intensity. Dots appear both to the left and to the right of the line extending from the name of each listed tissue. The dots appearing to the left of the line represent gene expression in normal tissue, and the dots appearing to the right of the line represent gene expression in tumor and diseased tissue. FIG. 1 shows increased LgR5 gene expression in certain tumor or diseased tissues relative to their normal counterparts. In particular, LgR5 is substantially overexpressed in colorectal, endometrial, and ovarian tumors. FIG. 1, inset, shows that LgR5 is overexpressed in at least the following colon tumors: adenocarcinoma, benign tumors, and metastatic colon tumors, and also in tissue with a colon tumor content of less than 50% ("low tumor" in FIG. 1 inset); but is not overexpressed in normal colon, Crohn's disease, or ulcerative colitis. Human LgR5 expression is much lower in normal tissues, with low levels of expression in normal brain, muscle, ovarian, and placental tissues.
[0279] B. Prevalence of Human LgR5 in Colon Tumors
[0280] To evaluate the expression of LgR5 in colorectal cancer, 57 primary colorectal adenocarcinomas were acquired from multiple sources (Asterand, Detroit, Mich.; Bio-Options, Fullerton, Calif.; University of Michigan, Ann Arbor, Mich.; Cytomyx, Rockville, Md.; Cooperative Human Tissue Network, Nashville, Tenn.; Indivumed, Hamburg, Germany; ProteoGenex, Culver City, Calif.). Forty-four percent of samples were from men, and the average age of the patients was 66 years (range 31 to 93 years). Tissue microarrays (TMAs) were assembled using duplicate cores as described in Bubendorf L, et al., J Pathol. 2001 September; 195(1):72-9, and included five normal colorectal mucosa samples from matched cases.
[0281] LgR5 expression was determined by in situ hybridization using the oligonucleotide probes shown in Table 2. See, e.g., Jubb A M, et al., Methods Mol Biol 2006; 326:255-64. ISH for .beta.-actin was used to confirm mRNA integrity in colorectal cancer tissues prior to analysis.
TABLE-US-00002 TABLE 2 Primer sequences for isotopic in situ hybridization probes. Anti- Nucleotides sense Genbank Complementary (AS) or Forward Primer Reverse Primer Gene Accession to Probe Sense (S) (5' to 3') (5' to 3') Lgr5 NM_003667 508 AS ACCAACTGCATCCT ACCGAGTTTCACCT AAACTG (SEQ ID CAGCTC (SEQ ID NO: 92) NO: 93) Lgr5 NM_003667 496 S ACATTGCCCTGTTG ACTGCTCTGATATA CTCTTC (SEQ ID CTCAATC (SEQ ID NO: 94) NO: 95)
[0282] LgR5 hybridization intensity was scored by a trained pathologist according to the scheme below, taking into account the intensity (silver grains) as well as breadth of staining.
[0283] 0 (negative): very weak or no hybridization in >90% of tumor cells
[0284] 1+ (mild): predominant hybridization pattern is weak
[0285] 2+ (moderate): predominant hybridization pattern is moderately strong in the majority (>50%) of neoplastic cells
[0286] 3+ (strong): predominant hybridization pattern is strong in the majority (>50%) of neoplastic cells Sense probes were used to control for the specificity of hybridization.
[0287] FIG. 2 shows exemplary colon tumor sections with 1+, 2+, and 3+ levels of staining. The top panels show dark field images and the bottom panels show bright field images. The deposition of silver grains in the dark field images indicates hybridization of the probe and expression of LgR5 mRNA. .about.77% (41/53) of colon tumor sections analyzed were LgR5 positive, showing staining at the 1+, 2+, or 3+ levels, with 34% (18/53) showing 2+ or 3+ staining. Four of the 57 samples analyzed were noninformative for LgR5 expression.
[0288] To evaluate the significance of Lgr5 expression in colon tumors, a population-based series of patients who had undergone surgical resections for colorectal adenocarcinoma was compiled retrospectively from the pathology archives at St James' University Hospital (Leeds, UK) from 1988 to 2003. Tissue microarrays (TMAs) were constructed with one core of normal mucosa and three cores of adenocarcinoma per patient as described in Bubendorf L, et al., J Pathol. 2001 September; 195(1):72-9. ISH was performed and scored as described above. The heterogeneity of expression across three cores from the same tumor was also determined, and is expressed as the proportion of tumors that showed a particular level of discordance in one of the three cores. For example, if three cores had scores of +1, +3, and +3, one of the three cores from that tumor is discordant by 2.
[0289] FIG. 3A shows the prevalence of 0, 1+, 2+, and 3+ levels of LgR5 staining in the colon tumor tissue microarray, measured by in situ hybridization. 75% of the colon tumor tissues showed staining at the 1+, 2+, or 3+ levels, with 37% showing 2+ or 3+ staining. FIG. 3B shows the heterogeneity of LgR5 expression. 67% of tumors showed no heterogeneity across the three cores. 32% shows a discordance of 1 in one of the three cores, and only 1% showed a discordance greater than 1.
[0290] C. Commercially Available Antibodies Not Suitable for Immunohistochemistry
[0291] A long-standing issue in determining the expression of Lgr5 was the lack of a quality Immunohistochemistry (IHC) reactive antibody. RNA expression of Lgr5 has been limitedly examined previously; however, there is little data about the normal tissue expression pattern in humans outside of the stomach, colon, and hair follicle.
[0292] Six different commercial antibodies that are marketed as IHC antibodies were tested for suitability as antibodies for immunohistochemistry. Rabbit polyclonal antibody MC-1235 (MBL International Corp., Woburn, Mass.) was tested for binding to LgR5 expressed on the surface of 293 cells, and no LgR5 detection was observed. Rabbit polyclonal antibody MC-1236 (MBL International Corp., Woburn, Mass.) was able to stain LgR5 when it was overexpressed on 293 cells, but no specific LgR5 staining was observed on LoVo colon cancer cells, compared to 293 cells transfected with vector only. Further, brain tissue stained with MC-1236 showed a high level of staining within blood vessels, suggesting possible background staining of serum.
[0293] Rabbit monoclonal antibody 2495-1 (Epitomics, Burlingame, Calif.) was found to specifically stain LgR5 expressed on the surface of 293 cells. LoVo and D5124 colon cancer cells showed weak cytoplasmic staining, and some SW116 colon cancer cells showed very weak staining. Human colon and small intestine tissues showed weak staining in the epithelial compartment, characterized as broadly diffuse cytoplasmic staining throughout the intestinal crypt. No specific staining in the basal portion of the crypt was noted, however, and no membrane-specific staining was observed in any of the cell lines or tissues tested.
[0294] Three additional commercial antibodies were tested for specific LgR5 staining: rabbit polyclonal antibody HPA012530 (Sigma-Aldrich, St. Louis, Mo.), rabbit monoclonal antibody LS-C105455 (LifeSpan BioSciences, Inc., Seattle, Wash.), and mouse monoclonal antibody TA503316 (OriGene, Rockville, Md.). None of the antibodies showed specific membranous staining of normal human small intestine and/or colon tissue samples, nor was LgR5 detected in the crypt base in those tissues.
[0295] D. Rabbit Monoclonal Antibody Generation
[0296] After several failed attempts to develop IHC reactive antibodies in mice, we generated an IHC reactive antibody in rabbits. Rabbits were immunized with an LgR5 extracellular domain (ECD) huFc (SEQ ID NO: 96) fusion protein, which was produced in CHO cells. Serum titers against LgR5 using test bleeds were evaluated using standard protocols. Two rabbits were found to have a good immune response, and were chosen as the candidate for splenectomy and monoclonal fusion.
[0297] Splenectomies were performed, splenocytes were isolated, and 200.times.10.sup.6 lymphocyte cells were fused with 100.times.10.sup.6 fusion partner cells and plated onto 96-well plates (Epitomics, Burlingame, Calif.). The plates were cultured under standard conditions.
[0298] Plates were screened using a standard ELISA protocol, with plates coated with LgR5 extracellular domain (ECD)-huFc fusion. Three clones were selected and expanded into 24-well plates. Thirty-six of the expanded clones were tested by ELISA and immunohistochemistry (IHC) using 293 cells expressing human or mouse LgR5.
[0299] After further testing, including determining whether the clones produced antibodies that recognized LgR5 on human intestine crypt base columnar cells, antibodies 1-12 and 26-1 were selected for cloning. Briefly, mRNA from hybridoma cells was isolated using TuboCapture Kit (Qiagen: Catalog #72232) following the manufacturer's instructions and then reverse transcribed into cDNA using oligo-dT primer. The variable region of the heavy chain (VH) was PCR amplified. The entire light chain (LC) was PCR. The PCR-amplified VH region was digested using restriction enzymes HindIII and Kpnl. The PCR-amplified LC was digested using restriction enzymes HindIII and NotI. Digested products were purified using Qiagen QIAquick PCR Purification Kit (catalog #28014). After purification, the VH and LC were ligated into heavy or light chain expression vectors and transformed into DH5a cells (MC Lab, catalog #DA-100). Transformed colonies were picked and inserts were confirmed by expected size using the corresponding restriction enzymes. Plasmids with inserts of the expected size were sequenced using TT5 primer. The sequences of the heavy chain variable region and the light chain variable region are showin in FIG. 4, and in SEQ ID NOs: 6 and 5, respectively, for antibody 1-12; and in FIG. 4, and in SEQ ID NOs: 8 and 7, respectively, for antibody 26-1.
[0300] Light chain and heavy chain expression vectors were co-transfected into CHO cells and purified from the cell culture supernatants using Protein A.
[0301] E. Antibody Epitope Determination
[0302] A FACS competition assay was used to map the epitopes recognized by antibodies 1-12 and 26-1. Briefly, human LgR5 was expressed in 293 cells and competition assays were performed using antibody huYW353 (heavy chain and light chain sequences shown in SEQ ID NOs: 98 and 88, respectively), which has previously been shown to bind to an epitope on LgR5 comprising amino aicds 22 to 122, and antibody 8E11 (heavy and light chain variable regions shown in SEQ ID NOs: 29 and 28, respectively), which has previously been shown to bind to an epitope on LgR5 comprising amino acids 22 to 322.
[0303] Antibody 26-1 was found to compete for LgR5 binding with huYW353 and 8E11, while antibody 1-12 did not compete for LgR5 binding with either huYW353 or 8E11. (Data not shown.) Thus, it appears that antibody 26-1 binds an epitope in the region of amino acids 22 to 322 of human LgR5, while antibody 1-12 binds an epitope outside of that region.
[0304] F. Detection of LgR5 on Normal Tissues
[0305] Antibody LGR5.1-12 was used to detect expression of LgR5 on normal human tissues. Immunohistochemistry (IHC) for Lgr5 was performed on a Dako Universal Autostainer (Dako, Carpinteria, Calif.). Briefly, formalin-fixed, paraffin-embedded whole tissue and tissue microarray sections were deparaffinized and antigen unmasking was performed in a PT Module (Thermo Scientific, Kalamazoo, Mich.) with Target Retrieval pH 6 (Dako) at 99.degree. C. for 20 minutes. Endogenous peroxidase was inhibited with treatment of 3% H202 in PBS for 4 minutes and endogenous biotin was blocked using the Avidin/Biotin blocking kit (Vector Labs, Burlingame, Calif.). Endogenous IgGs were blocked using 10% donkey serum in 3% BSA/PBS and primary antibody to Lgr5 (LGR5.1-12) was incubated at 4 .mu.g/ml for 60 minutes at room temperature. Biotinylated donkey anti-rabbit IgG (Jackson Immunoresearch, West Grove, Pa.) was incubated for 30 minutes at room temperature followed by treatment with Vectastain ABC Elite-HRP (Vector Labs) for 30 minutes at room temperature. Antibody binding was detected with Metal enhanced DAB (Pierce Rockford, Ill.) for 5 minutes at room temperature and sections were counterstained with Mayer's Hematoxylin (Rowley Biochemical, Danvers, Mass.).
[0306] Antibody LGR5.1-12 stained normal intestinal crypts in the expected pattern. See FIG. 5A. Moderate staining was also observed in hair follicle (FIG. 5B), and weak staining was observed in fallopian tube, endometrium, adrenal gland, and spinal cord (FIG. 5C).
[0307] G. Detection of LgR5 on Xenograft Tumors
[0308] Tumors isolated from LoVo X 1.1 and D5124 xenograft model mice were analyzed by flow cytometry to determine surface expression of LgR5 using antibody YW353. Briefly, Lovo1.1 or D5124 tumors were harvested and treated with 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS) with a collagenase enzyme mixture. Tumors were incubated for 15 minutess at 37.degree. C., and cells were washed in PBS with 1% BSA. Cells were spun down and resuspended in ammonium chloride-potassium lysis buffer to lyse the red blood cells. Cells were washed in PBS with 1% BSA and RRMI 1640 media with 10% fetal bovin serum (FBS). Cells were resuspended in fluorescence-activated cell sorting buffer (PBS with 1% BSA) and incubated for 45 minutes with anti-LgR5 antibody, followed by a 30 minute incubation with anti human secondary antibody conjugated to PE. Analysis was performed with a FACSCalibur.TM. flow cytometer (BD Biosciences).
[0309] FIG. 6 shows the results of that experiment. LgR5 on the surface of (A) LoVo X 1.1 xenograft tumor cells and (B) D5124 xenograft tumor cells was detectable by FACS using antibody YW353. By immunohistochemistry, expression of LgR5 was 2+ for both (C) LoVo X 1.1 xenograft tumors and (D) D5124 xenograft tumors, using antibody LGR5.1-12. At the top of the panels shown in (C) are the percentages of cells in the field showing each level of staining.
[0310] H. Prevalence of LgR5 on Colon Tumors by Immunohistochemistry
[0311] To determine the prevelance of LgR5 in colon tumors, immunohistochemistry was performed on a tissue microarray containing cores from 143 different colon tumors, using antibody LGR5.1-12, as described above in Example (E).
[0312] Forty percent of the colon tumors were positive for LgR5, with 29% (41/143) scoring 1+, 9% (13/143) scoring 2+, and 2% (3/143) scoring 3+, using the following criteria:
[0313] 0=no staining,
[0314] 1+=weak staining,
[0315] 2+=moderate staining, and
[0316] 3+=strong staining.
[0317] The remaining colon tumors (86/143) scored 0 by IHC using antibody LGR5.1-12. FIG. 7A to D shows exemplary 0, 1+, 2+, and 3+ staining of colon tumors using antibody LGR5.1-12.
[0318] Substantial heterogeneity in IHC staining was observed. IHC was therefore performed on 19 colon cancer tumor sections using antibody LGR5.1-12. Three of the sections were negative for LgR5 expression; in two sections, greater than 50% of the cells were positive for LgR5; the remaining sections showed between 0 and 50% staining. Table 3 shows the percentage of cells in each section that stained at each level, and the overall score using a 50% criteria (i.e., 50% or more of the cells are positive for LgR5) or a 10% criteria (i.e., 10% of the cells are positive for LgR5). For comparison, the staining observed in the D5124 and LoVo xengraft tumors described above are also included. H score is equal to (% cells staining at 1+)+(% cells staining at 2+).times.2+(% cells staining at 3+).times.3. H score takes into consideration the percentage of cells at each staining intensity.
TABLE-US-00003 TABLE 3 Immunohistochemistry of colon tumor sections using antibody LGR5.1-12 Overall score Overall score (50%+ (10%+ Sample 0 +1 +2 +3 H-score criteria) criteria) HP-2889 40 45 15 0 75 1+ 1+ HP-9328 80 17 3 0 23 0 1+ HP-11394 85 10 5 0 20 0 1+ HP-19862 85 0 15 0 30 0 2+ HP-19882 75 25 0 0 25 0 1+ HP-20531 60 40 0 0 40 0 1+ HP-21638 25 65 10 0 85 1+ 1+ HP-23099 85 15 0 0 15 0 1+ HP-23301 15 20 65 0 150 2+ 2+ HP-23302 50 45 5 0 55 1+ 1+ HP-23433 55 5 35 5 90 0 2+ HP-23451 95 5 0 0 5 0 0 HP-24574 75 10 15 0 40 0 2+ HP-24583 100 0 0 0 0 0 0 HP-24586 85 10 5 0 20 0 1+ HP-24589 100 0 0 0 0 0 0 HP-24592 90 10 0 0 10 0 1+ HP-24671 100 0 0 0 0 0 0 HP-24672 95 5 0 0 5 0 0 D5124 xeno 10 20 70 0 160 2+ 2+ model LOVO xeno 45 20 25 10 100 2+ 2+ model
[0319] These results demonstrate that antibody LGR5.1-12 is able to detect LgR5 expression in colon tumors. In summary, Lgr5 RNA and protein expression is observed within multiple normal tissue compartments and although heterogeneous, Lgr5 is expressed in colon tumors.
[0320] I. Immunohistochemistry with Antibody LGR5.26-1
[0321] Staining with antibody LGR5.26-1 was compared to staining with antibody LGR5.1-12 in CXF233 (human colon tumor model; Oncotest) xenograft tumors and in various colon cancer cell lines. Immunohistochemistry (IHC) for Lgr5 was performed on a Dako Universal Autostainer (Dako, Carpinteria, Calif.). Briefly, formalin-fixed, paraffin-embedded tumor tissue were deparaffinized and antigen unmasking was performed in a PT Module (Thermo Scientific, Kalamazoo, Mich.) with Target Retrieval pH 6 (Dako) at 99.degree. C. for 20 minutes. Endogenous peroxidase was inhibited with treatment of 3% H202 in PBS for 4 minutes and endogenous biotin was blocked using the Avidin/Biotin blocking kit (Vector Labs, Burlingame, Calif.). Endogenous IgGs were blocked using 10% donkey serum in 3% BSA/PBS and primary antibody to Lgr5 (LGR5.1-12 or 26-1) was incubated at 4 .mu.g/ml for 60 minutes at room temperature. Biotinylated donkey anti-rabbit IgG (Jackson Immunoresearch, West Grove, Pa.) was incubated for 30 minutes at room temperature followed by treatment with Vectastain ABC Elite-HRP (Vector Labs) for 30 minutes at room temperature. Antibody binding was detected with Metal enhanced DAB (Pierce Rockford, Ill.) for 5 minutes at room temperature and sections were counterstained with Mayer's Hematoxylin (Rowley Biochemical, Danvers, Mass.).
[0322] As shown in FIG. 8, antibody LGR5.1-12 (A) and antibody LGR5.26-1 (B) shows similar staining patterns in a CXF233 xenograft tumor sample.
[0323] Each cell line was also characterized by lgr5 gene expression using RNAseq data into the following levels of expression: none, very low, low, moderate, and high. In addition, LgR5 levels were determined in the cell lines by IHC, substantially as described above. The results of that experiment are shown in Table 4.
TABLE-US-00004 TABLE 4 IHC staining of colon cancer cell lines using antibodies LGR5.1-12 and LGR5.26-1 RNAseq expression Cell Line FACS Ab1-12 Ab26-1 None SW480 0 0 None RKO 0 0 None COLO741 0 0 Very low HCT-15 0 0 Very low CX-1 0 0 Very low HT-29 0 0 Very low SW403 2+ (60%) 1+ (65%) Low SW1116 0 0 Low HCA-7 0 0 Low COLO-205 0 0 Low LS180 - 0 1+ (10%) Low SW948 1+ (15%) 1+ (10%) Moderate CACO-2 1+ (15%) 1+ (15%) Moderate T84 2+ (40%) 2+ (40%) Moderate KM-12 2+ (25%) 1+ (60%) Moderate C2BBel 1+ (10%) 1+ (15%) High DLD-1 - 0 1+ (10%) High SW620 - 0 1+ (20%) High SW1463 +/- 2+ (50%) 2+ (25%) High SK-CO-1 +/- 2+ (80%) 2+ (85%) High LS174T - 0 0 High LOVO ++ 2+ (50%) 2+ (50%)
[0324] Both antibody LGR5.1-12 and antibody LGR5.26-1 were able to detect LgR5 on the surface of many different colon cancer cell lines.
[0325] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated in their entirety by reference.
TABLE-US-00005 TABLE OF SEQUENCES SEQ ID NO Description Sequence 1 .alpha.LgR5.1-12 light AYDMTQTPAS VEVAVGGTVT IKCQASQSIG SNLAWYQQKP chain GQPPKLLIYG ASNLASGVSS RFKGSGSGTE FTLTISDLEC ADAATYYCQT TYGSSSDGFF WTFGGGTEVV VKGDPVAPTV LIFPPAADQV ATGTVTIVCV ANKYFPDVTV TWEVDGTTQT TGIENSKTPQ NSADCTYNLS STLTLTSTQY NSHKEYTCKV TQGTTSVVQS FNRGDC 2 .alpha.LgR5.1-12 heavy QSLEESGGGL VQPEGSLTLT CTASGFSFSR TYWICWDRQA chain PGKGLEWIAC IYAGGSDNTY YASWAKGRFT ISKTSSTTVT LQVTSLTAAD TATYFCARYY AGSSEYFNLW GPGTLVTVSS ASTKGPSVFP LAPCCGDTPS STVTLGCLVK GYLPEPVTVT WNSGTLTNGV RTFPSVRQSS GLYSLSSVVS VTSSSQPVTC NVAHPATNTK VDKTVAPSTC SKPTCPPPEL LGGPSVFIFP PKPKDTLMIS RTPEVTCVVV DVSQDDPEVQ FTWYINNEQV RTARPPLREQ QFNSTIRVVS TLPIAHQDWL RGKEFKCKVH NKALPAPIEK TISKARGQPL EPKVYTMGPP REELSSRSVS LTCMINGFYP SDISVEWEKN GKAEDNYKTT PAVLDSDGSY FLYSKLSVPT SEWQRGDVFT CSVMHEALHN HYTQKSISRS PGK 3 .alpha.LgR5.26-1 light AFELTQTPSS VEAAVGGTVT IKCQASQSIS VGLAWYQQKP chain GQPPKLLIYK ASTLASGVPS RFKGSRSGTE FTLTISDLEC ADAATYYCQS YYDSSTTANV FGGGTEVVVK GDPVAPTVLI FPPAADQVAT GTVTIVCVAN KYFPDVTVTW EVDGTTQTTG IENSKTPQNS ADCTYNLSST LTLTSTQYNS HKEYTCKVTQ GTTSVVQSFN RGDC 4 .alpha.LgR5.26-1 heavy QSLEESGGDL VKPGGTLTLT CTASGIDFSY YSYMCWVRQA chain PGKGLEWIAC IYAGTSGSTY YASWAKGRFT ISKTSSTTVT LQMISLTAAD TATYFCARSY YTFGVNGYAW DLWGPGTLVT VSSASTKGPS VFPLAPCCGD TPSSTVTLGC LVKGYLPEPV TVTWNSGTLT NGVRTFPSVR QSSGLYSLSS VVSVTSSSQP VTCNVAHPAT NTKVDKTVAP STCSKPTCPP PELLGGPSVF IFPPKPKDTL MISRTPEVTC VVVDVSQDDP EVQFTWYINN EQVRTARPPL REQQFNSTIR VVSTLPIAHQ DWLRGKEFKC KVHNKALPAP IEKTISKARG QPLEPKVYTM GPPREELSSR SVSLTCMING FYPSDISVEW EKNGKAEDNY KTTPAVLDSD GSYFLYSKLS VPTSEWQRGD VFTCSVMHEA LHNHYTQKSI SRSPGK 5 .alpha.LgR5.1-12 light AYDMTQTPAS VEVAVGGTVT IKCQASQSIG SNLAWYQQKP chain variable GQPPKLLIYG ASNLASGVSS RFKGSGSGTE FTLTISDLEC region ADAATYYCQT TYGSSSDGFF WTFGGGTEVV VK 6 .alpha.LgR5.1-12 heavy QSLEESGGGL VQPEGSLTLT CTASGFSFSR TYWICWDRQA chain variable PGKGLEWIAC IYAGGSDNTY YASWAKGRFT ISKTSSTTVT region LQVTSLTAAD TATYFCARYY AGSSEYFNLW GPGTLVTVSS 7 .alpha.LgR5.26-1 light AFELTQTPSS VEAAVGGTVT IKCQASQSIS VGLAWYQQKP chain variable GQPPKLLIYK ASTLASGVPS RFKGSRSGTE FTLTISDLEC region ADAATYYCQS YYDSSTTANV FGGGTEVVVK 8 .alpha.LgR5.26-1 heavy QSLEESGGDL VKPGGTLTLT CTASGIDFSY YSYMCWVRQA chain variable PGKGLEWIAC IYAGTSGSTY YASWAKGRFT ISKTSSTTVT region LQMISLTAAD TATYFCARSY YTFGVNGYAW DLWGPGTLVT VSS 9 .alpha.LgR5.1-12 QASQSIGSNL A HVR-L1 10 .alpha.LgR5.1-12 GASNLAS HVR-L2 11 .alpha.LgR5.1-12 QTTYGSSSDG FFWT HVR-L3 12 .alpha.LgR5.1-12 RTYWIC HVR-H1 13 .alpha.LgR5.1-12 CIYAGGSDNT YYASWAK HVR-H2 14 .alpha.LgR5.1-12 YYAGSSEYFN L HVR-H3 15 .alpha.LgR5. 26-1 QASQSISVGL A HVR-L1 16 .alpha.LgR5. 26-1 KASTLAS HVR-L2 17 .alpha.LgR5. 26-1 QSYYDSSTTA NV HVR-L3 18 .alpha.LgR5. 26-1 YYSYMC HVR-H1 19 .alpha.LgR5. 26-1 CIYAGTSGST YYASWAK HVR-H2 20 .alpha.LgR5. 26-1 SYYTFGVNGY AWDL HVR-H3 21 Human LgR5 MDTSRLGVLL SLPVLLQLAT GGSSPRSGVL LRGCPTHCHC precursor; EPDGRMLLRV DCSDLGLSEL PSNLSVFTSY LDLSMNNISQ LGR5_human LLPNPLPSLR FLEELRLAGN ALTYIPKGAF TGLYSLKVLM NP_003658; LQNNQLRHVP TEALQNLRSL QSLRLDANHI SYVPPSCFSG signal sequence = LHSLRHLWLD DNALTEIPVQ AFRSLSALQA MTLALNKIHH amino acids 1-21; IPDYAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD 22 to 558 are LNYNNLDEFP TAIRTLSNLK ELGFHSNNIR SIPEKAFVGN extracellular PSLITIHFYD NPIQFVGRSA FQHLPELRTL TLNGASQITE domain (ECD) FPDLTGTANL ESLTLTGAQI SSLPQTVCNQ LPNLQVLDLS YNLLEDLPSF SVCQKLQKID LRHNEIYEIK VDTFQQLLSL RSLNLAWNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPIT GLHGLTHLKL TGNHALQSLI SSENFPELKV IEMPYAYQCC AFGVCENAYK ISNQWNKGDN SSMDDLHKKD AGMFQAQDER DLEDFLLDFE EDLKALHSVQ CSPSPGPFKP CEHLLDGWLI RIGVWTIAVL ALTCNALVTS TVFRSPLYIS PIKLLIGVIA AVNMLTGVSS AVLAGVDAFT FGSFARHGAW WENGVGCHVI GFLSIFASES SVFLLTLAAL ERGFSVKYSA KFETKAPFSS LKVIILLCAL LALTMAAVPL LGGSKYGASP LCLPLPFGEP STMGYMVALI LLNSLCFLMM TIAYTKLYCN LDKGDLENIW DCSMVKHIAL LLFTNCILNC PVAFLSFSSL INLTFISPEV IKFILLVVVP LPACLNPLLY ILFNPHFKED LVSLRKQTYV WTRSKHPSLM SINSDDVEKQ SCDSTQALVT FTSSSITYDL PPSSVPSPAY PVTESCHLSS VAFVPCL 22 Human LgR5 GSSPRSGVL LRGCPTHCHC EPDGRMLLRV DCSDLGLSEL mature, without PSNLSVFTSY LDLSMNNISQ LLPNPLPSLR FLEELRLAGN signal sequence; ALTYIPKGAF TGLYSLKVLM LQNNQLRHVP TEALQNLRSL amino acids 22 to QSLRLDANHI SYVPPSCFSG LHSLRHLWLD DNALTEIPVQ 907 AFRSLSALQA MTLALNKIHH IPDYAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD LNYNNLDEFP TAIRTLSNLK ELGFHSNNIR SIPEKAFVGN PSLITIHFYD NPIQFVGRSA FQHLPELRTL TLNGASQITE FPDLTGTANL ESLTLTGAQI SSLPQTVCNQ LPNLQVLDLS YNLLEDLPSF SVCQKLQKID LRHNEIYEIK VDTFQQLLSL RSLNLAWNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPIT GLHGLTHLKL TGNHALQSLI SSENFPELKV IEMPYAYQCC AFGVCENAYK ISNQWNKGDN SSMDDLHKKD AGMFQAQDER DLEDFLLDFE EDLKALHSVQ CSPSPGPFKP CEHLLDGWLI RIGVWTIAVL ALTCNALVTS TVFRSPLYIS PIKLLIGVIA AVNMLTGVSS AVLAGVDAFT FGSFARHGAW WENGVGCHVI GFLSIFASES SVFLLTLAAL ERGFSVKYSA KFETKAPFSS LKVIILLCAL LALTMAAVPL LGGSKYGASP LCLPLPFGEP STMGYMVALI LLNSLCFLMM TIAYTKLYCN LDKGDLENIW DCSMVKHIAL LLFTNCILNC PVAFLSFSSL INLTFISPEV IKFILLVVVP LPACLNPLLY ILFNPHFKED LVSLRKQTYV WTRSKHPSLM SINSDDVEKQ SCDSTQALVT FTSSSITYDL PPSSVPSPAY PVTESCHLSS VAFVPCL 23 Cynomolgus GCPTHCHCEP DGRMLLRVDC SDLGLSELPS NLSVFTSYLD monkey LgR5 LSMNNISQLL PNPLPSLRFL EELRLAGNAL TYIPKGAFTG partial sequence, LYSLKVLMLQ NNQLRQVPTE ALQNLRSLQS LRLDANHISY predicted; VPPSCFSGLH SLRHLWLDDN ALTEIPVQAF RSLSALQAMT predicted to LALNKIHHIP DYAFGNLSSL VVLHLHNNRI HSLGKKCFDG correspond to LHSLETLDLN YNNLDEFPTA IRTLSNLKEL GFHSNNIRSI amino acids 33 to PEKAFVGNPS LITIHFYDNP IQFVGRSAFQ HLPELRTLTL 907 of full-length NGASQITEFP DLTGTANLES LTLTGAQISS LPQTVCNQLP precursor NLQVLDLSYN LLEDLPSFSV CQKLQKIDLR HNEIYEIKVD TFQQLLSLRS LNLAWNKIAI IHPNAFSTLP SLIKLDLSSN LLSSFPVTGL HGLTHLKLTG NHALQSLISS ENFPELKIIE MPYAYQCCAF GVCENAYKIS NQWNKGDNSS MDDLHKKDAG MFQVQDERDL EDFLLDFEED LKALHSVQCS PSPGPFKPCE HLLDGWLIRI GVWTIAVLAL TCNALVTSTV FRSPLYISPI KLLIGVIAVV NMLTGVSSAV LAGVDAFTFG SFARHGAWWE NGVGCQVIGF LSIFASESSV FLLTLAALER GFSVKCSAKF ETKAPFSSLK VIILLCALLA LTMAAVPLLG GSEYGASPLC LPLPFGEPST TGYMVALILL NSLCFLMMTI AYTKLYCNLD KGDLENIWDC SMVKHIALLL FTNCILYCPV AFLSFSSLLN LTFISPEVIK FILLVIVPLP ACLNPLLYIL FNPHFKEDLV SLGKQTYFWT RSKHPSLMSI NSDDVEKQSC DSTQALVTFT SSSIAYDLPP SSVPSPAYPV TESCHLSSVA FVPCL 24 Rat LgR5 MDTSRVRMLL SLLALLQLVA AGSPPRPDTM PRGCPSYCHC precursor; ELDGRMLLRV DCSDLGLSEL PSNLSVFTSY LDLSMNNISQ LGR5_rat LPASLLHRLR FLEELRLAGN ALTHIPKGAF AGLHSLKVLM NP_001100254; LQNNQLRQVP EEALQNLRSL QSLRLDANHI SYVPPSCFSG signal sequence = LHSLRHLWLD DNALTDVPVQ AFRSLSALQA MTLALNKIHH ammo acids 1-21 IADHAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD LNYNNLDEFP TAIKTLSNLK ELGFHSNNIR SIPERAFVGN PSLITIHFYD NPIQFVGISA FQHLPELRTL TLNGASQITE FPDLTGTATL ESLTLTGAKI SSLPQTVCDQ LPNLQVLDLS YNLLEDLPSL SGCQKLQKID LRHNEIYEIK GGTFQQLFNL RSLNLARNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPVT GLHGLTHLKL TGNRALQSLI PSANFPELKI IEMPYAYQCC AFGGCENVYK IPNQWNKDDS SSVDDLRKKD AGLFQVQDER DLEDFLLDFE EDLKVLHSVQ CSPPPGPFKP CEHLFGSWLI RIGVWTTAVL ALSCNALVAF TVFRTPLYIS SIKLLIGVIA VVDILMGVSS AILAVVDTFT FGSFAQHGAW WEGGIGCQIV GFLSIFASES SVFLLTLAAL ERGFSVKCSS KFEMKAPLSS LKAIILLCVL LALTIATVPL LGGSEYNASP LCLPLPFGEP STTGYMVALV LLNSLCFLIM TIAYTRLYCS LEKGELENLW DCSMVKHTAL LLFTNCILYC PVAFLSFSSL LNLTFISPEV IKFILLVIVP LPACLNPLLY IVFNPHFKED MGSLGKQTRF WTRAKHPSLL SINSDDVEKR SCDSTQALVS FTHASIAYDL PSDSGSSPAY PMTESCHLSS VAFVPCL 25 Rat LgR5 mature, GSPPRPDTM PRGCPSYCHC ELDGRMLLRV DCSDLGLSEL without signal PSNLSVFTSY LDLSMNNISQ LPASLLHRLR FLEELRLAGN sequence; amino ALTHIPKGAF AGLHSLKVLM LQNNQLRQVP EEALQNLRSL acids 22 to 907 QSLRLDANHI SYVPPSCFSG LHSLRHLWLD DNALTDVPVQ AFRSLSALQA MTLALNKIHH IADHAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD LNYNNLDEFP TAIKTLSNLK ELGFHSNNIR SIPERAFVGN PSLITIHFYD NPIQFVGISA FQHLPELRTL TLNGASQITE FPDLTGTATL ESLTLTGAKI SSLPQTVCDQ LPNLQVLDLS YNLLEDLPSL SGCQKLQKID LRHNEIYEIK GGTFQQLFNL RSLNLARNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPVT GLHGLTHLKL TGNRALQSLI PSANFPELKI IEMPYAYQCC AFGGCENVYK IPNQWNKDDS SSVDDLRKKD AGLFQVQDER DLEDFLLDFE EDLKVLHSVQ CSPPPGPFKP CEHLFGSWLI RIGVWTTAVL ALSCNALVAF TVFRTPLYIS SIKLLIGVIA VVDILMGVSS AILAVVDTFT FGSFAQHGAW WEGGIGCQIV GFLSIFASES SVFLLTLAAL ERGFSVKCSS KFEMKAPLSS LKAIILLCVL LALTIATVPL LGGSEYNASP LCLPLPFGEP STTGYMVALV LLNSLCFLIM TIAYTRLYCS LEKGELENLW DCSMVKHTAL LLFTNCILYC PVAFLSFSSL LNLTFISPEV IKFILLVIVP LPACLNPLLY IVFNPHFKED MGSLGKQTRF WTRAKHPSLL SINSDDVEKR SCDSTQALVS FTHASIAYDL PSDSGSSPAY PMTESCHLSS VAFVPCL 26 Mouse LgR5 MDTSCVHMLL SLLALLQLVA AGSSPGPDAI PRGCPSHCHC precursor; ELDGRMLLRV DCSDLGLSEL PSNLSVFTSY LDLSMNNISQ LGR5_mouse LPASLLHRLC FLEELRLAGN ALTHIPKGAF TGLHSLKVLM NM_034325; LQNNQLRQVP EEALQNLRSL QSLRLDANHI SYVPPSCFSG signal sequence = LHSLRHLWLD DNALTDVPVQ AFRSLSALQA MTLALNKIHH amino acids 1-21 IADYAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD LNYNNLDEFP TAIKTLSNLK ELGFHSNNIR SIPERAFVGN PSLITIHFYD NPIQFVGVSA FQHLPELRTL TLNGASHITE FPHLTGTATL ESLTLTGAKI SSLPQAVCDQ LPNLQVLDLS YNLLEDLPSL SGCQKLQKID LRHNEIYEIK GSTFQQLFNL RSLNLAWNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPVT GLHGLTHLKL TGNRALQSLI PSANFPELKI IEMPSAYQCC AFGGCENVYK ISNQWNKDDG NSVDDLHKKD AGLFQVQDER DLEDFLLDFE EDLKALHSVQ CSPSPGPFKP CEHLFGSWLI RIGVWTTAVL ALSCNALVAL TVFRTPLYIS SIKLLIGVIA VVDILMGVSS AVLAAVDAFT FGRFAQHGAW WEDGIGCQIV GFLSIFASES SIFLLTLAAL ERGFSVKCSS KFEVKAPLFS LRAIVLLCVL LALTIATIPL LGGSKYNASP LCLPLPFGEP STTGYMVALV LLNSLCFLIM TIAYTKLYCS LEKGELENLW DCSMVKHIAL LLFANCILYC PVAFLSFSSL LNLTFISPDV IKFILLVIVP LPSCLNPLLY IVFNPHFKED MGSLGKHTRF WMRSKHASLL SINSDDVEKR SCESTQALVS FTHASIAYDL PSTSGASPAY PMTESCHLSS VAFVPCL 27 Mouse LgR5 GSSPGPDAI PRGCPSHCHC ELDGRMLLRV DCSDLGLSEL mature, without PSNLSVFTSY LDLSMNNISQ LPASLLHRLC FLEELRLAGN signal sequence; ALTHIPKGAF TGLHSLKVLM LQNNQLRQVP EEALQNLRSL amino acids 22 to QSLRLDANHI SYVPPSCFSG LHSLRHLWLD DNALTDVPVQ 907 AFRSLSALQA MTLALNKIHH IADYAFGNLS SLVVLHLHNN RIHSLGKKCF DGLHSLETLD LNYNNLDEFP TAIKTLSNLK ELGFHSNNIR SIPERAFVGN PSLITIHFYD NPIQFVGVSA FQHLPELRTL TLNGASHITE FPHLTGTATL ESLTLTGAKI SSLPQAVCDQ LPNLQVLDLS YNLLEDLPSL SGCQKLQKID LRHNEIYEIK GSTFQQLFNL RSLNLAWNKI AIIHPNAFST LPSLIKLDLS SNLLSSFPVT GLHGLTHLKL TGNRALQSLI
PSANFPELKI IEMPSAYQCC AFGGCENVYK ISNQWNKDDG NSVDDLHKKD AGLFQVQDER DLEDFLLDFE EDLKALHSVQ CSPSPGPFKP CEHLFGSWLI RIGVWTTAVL ALSCNALVAL TVFRTPLYIS SIKLLIGVIA VVDILMGVSS AVLAAVDAFT FGRFAQHGAW WEDGIGCQIV GFLSIFASES SIFLLTLAAL ERGFSVKCSS KFEVKAPLFS LRAIVLLCVL LALTIATIPL LGGSKYNASP LCLPLPFGEP STTGYMVALV LLNSLCFLIM TIAYTKLYCS LEKGELENLW DCSMVKHIAL LLFANCILYC PVAFLSFSSL LNLTFISPDV IKFILLVIVP LPSCLNPLLY IVFNPHFKED MGSLGKHTRF WMRSKHASLL SINSDDVEKR SCESTQALVS FTHASIAYDL PSTSGASPAY PMTESCHLSS VAFVPCL 28 mu8E11 light NIVLTQSPAS LAVSLGQRAT ISCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPARFSGSG SRTDFTLTID region PVEADDAATY YCQQNYEDPF TFGSGTKVEI KR 29 mu8E11 heavy QVQLQQSGTE LMKPGASVKI SCKATGYTFS AYWIEWIKQR chain variable PGHGLEWIGE ILPGSDSTDY NEKFKVKATF SSDTSSNTVY region IQLNSLTYED SAVYYCARGG HYGSLDYWGQ GTTLKVSS 30 hu8E11.v1 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SGTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 31 hu8E11.v1 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TSDTSTSTVY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 32 hu8E11.v2 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SGTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 33 hu8E11.v2 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRATF TSDTSTSTVY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 34 hu8E11.v3 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SRTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 35 hu8E11.v3 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TSDTSTSTVY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 36 hu8E11.v4 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SRTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 37 hu8E11.v4 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRATF TSDTSTSTVY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 38 hu8E11.v5 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SGTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 39 hu8E11.v5 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TRDTSTSTAY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 40 hu8E11.v6 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SGTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 41 hu8E11.v6 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TADTSTSTAY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 42 hu8E11.v7 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SRTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 43 hu8E11.v7 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TRDTSTSTAY variable region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 44 hu8E11.v8 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain variable QQKPGQPPKL LIYLASNLES GVPDRFSGSG SRTDFTLTIS region SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KR 45 hu8E11.v8 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain variable PGQGLEWIGE ILPGSDSTDY NEKFKVRVTI TADTSTSTAY region LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSS 46 mu3G12 light DVVMTQTPLS LPVSLGDQAS ISCRSSQSLV HSNGNTYLQW chain variable YLQKPGQSPK LLIYKVSNRF SGVPDRFSGS GSGTDFTLKI region SRVEAEDLGI YFCSQSTHFP YTFGGGTKLE IKR 47 mu3G12 heavy QVQLQQPGAE MVKPGASVKL SCKASVDTFN SYWMHWVKQR chain variable PGQGLEWIGE INPSNGRTNY IEKFKNRATV TVDKSSSTAF region MQLSSLTSED SAVYYCATGW YFDVWGAGTT VTVSS 48 mu2H6 light DIVMTQSPSS LTVTAGEKVT MSCKSSQSLL NSGNQKNYLT chain variable WFQQKPGQPP KLLIYWASTR ESGVPDRFTG SGSGTDFTLT region ISNVQAEDLA VYYCQNDYSF PFTFGQGTKV EIKR 49 mu2H6 heavy EVQLQQSGPE LVKPGTSMKI SCKASGYSFT GYTMNWVKQS chain variable HKNGLEWIGL INCYNGGTNY NQKFKGKATL TVDKSSSTAF region MELLSLTSED SAVYYCARGG STMITPRFAY WGQGTLVTVS S 50 YW353 light DIQMTQSPSS LSASVGDRVT ITCRASQDVS TAVAWYQQKP chain variable GKAPKLLIYS ASFLYSGVPS RFSGSGSGTD FTLTISSLQP region EDFATYYCQQ SYTTPPTFGQ GTKVEIKR 51 YW353 heavy EVQLVESGGG LVQPGGSLRL SCAASGFTFT SYSISWVRQA chain variable PGKGLEWVAE IYPPGGYTDY ADSVKGRFTI SADTSKNTAY region LQMNSLRAED TAVYYCAKAR LFFDYWGQGT LVTVSS 52 mu8E11 HVR L1 RASESVDNYG NSFMH 53 mu8E11 HVR L2 LASNLES 54 mu8E11 HVR L3 QQNYEDPFT 55 mu8E11 HVR H1 GYTFSAYWIE 56 mu8E11 HVR H2 EILPGSDSTD YNEKFKV 57 mu8E11 HVR H3 GGHYGSLDY 58 Hu8E11 light DIVMTQSPDS LAVSLGERAT INC chain (LC) framework 1 (FR1) 59 Hu8E11 LC FR2 WYQQKPGQPP KLLIY 60 Hu8E11.v1 LC GVPDRFSGSG SGTDFTLTIS SLQAEDVAVY YC FR3 Hu8E11.v2 LC FR3 Hu8E11.v5 LC FR3 Hu8E11.v6 LC FR3 61 Hu8E11.v3 LC GVPDRFSGSG SRTDFTLTIS SLQAEDVAVY YC FR3 Hu8E11.v4 LC FR3 Hu8E11.v7 LC FR3 Hu8E11.v8 LC FR3 62 Hu8E11 LC FR4 FGQGTKVEIK R 63 Hu8E11 heavy EVQLVQSGAE VKKPGASVKV SCKAS chain (HC) framework1 (FR1) 64 Hu8E11 HC FR2 WVRQAPGQGL EWIG 65 Hu8E11.v1 HC RVTITSDTST STVYLELSSL RSEDTAVYYC AR FR3 Hu8E11.v3 HC FR3 66 Hu8E11.v2 HC RATFTSDTST STVYLELSSL RSEDTAVYYC AR FR3 Hu8E11.v4 HC FR3 67 Hu8E11.v5 HC RVTITRDTST STAYLELSSL RSEDTAVYYC AR FR3 Hu8E11.v7 HC FR3 68 Hu8E11.v6 HC RVTITADTST STAYLELSSL RSEDTAVYYC AR FR3 Hu8E11.v8 HC FR3 69 Hu8E11 HC FR4 WGQGTLVTVS S 70 mu3G12 HVR L1 RSSQSLVHSN GNTYLQ 71 mu3G12 HVR L2 KVSNRFS 72 mu3G12 HVR L3 SQSTHFPYT 73 mu3G12 HVR H1 VDTFNSYWMH 74 mu3G12 HVR H2 EINPSNGRTN YIEKFKN 75 mu3G12 HVR H3 GWYFDV 76 mu2H6 HVR L1 KSSQSLLNSG NQKNYLT 77 mu2H6 HVR L2 WASTRES 78 mu2H6 HVR L3 QNDYSFPFT 79 mu2H6 HVR H1 GYSFTGYTMN 80 mu2H6 HVR H2 LINCYNGGTN YNQKFKG 81 mu2H6 HVR H3 GGSTMITPRF AY 82 YW353 HVR L1 PASQDVSTAV A 83 YW353 HVR L2 SASFLYS 84 YW353 HVR L3 QQSYTTPPT 85 YW353 HVR H1 GFTFTSYSIS 86 YW353 HVR H2 EIYPPGGYTD YADSVKG 87 YW353 HVR H3 ARLFFDY 88 hu8E11.v2 light DIVMTQSPDS LAVSLGERAT INCRASESVD NYGNSFMHWY chain QQKPGQPPKL LIYLASNLES GVPDRFSGSG SGTDFTLTIS SLQAEDVAVY YCQQNYEDPF TFGQGTKVEI KRTVAAPSVF IFPPSDEQLK SGTASVVCLL NNFYPREAKV QWKVDNALQS GNSQESVTEQ DSKDSTYSLS STLTLSKADY EKHKVYACEV THQGLSSPVT KSFNRGEC 89 hu8E11.v2 heavy EVQLVQSGAE VKKPGASVKV SCKASGYTFS AYWIEWVRQA chain PGQGLEWIGE ILPGSDSTDY NEKFKVRATF TSDTSTSTVY LELSSLRSED TAVYYCARGG HYGSLDYWGQ GTLVTVSSAS TKGPSVFPLA PSSKSTSGGT AALGCLVKDY FPEPVTVSWN SGALTSGVHT FPAVLQSSGL YSLSSVVTVP SSSLGTQTYI CNVNHKPSNT KVDKKVEPKS CDKTHTCPPC PAPELLGGPS VFLFPPKPKD TLMISRTPEV TCVVVDVSHE DPEVKFNWYV DGVEVHNAKT KPREEQYNST YRVVSVLTVL HQDWLNGKEY KCKVSNKALP APIEKTISKA KGQPREPQVY TLPPSREEMT KNQVSLTCLV KGFYPSDIAV EWESNGQPEN NYKTTPPVLD SDGSFFLYSK LTVDKSRWQQ GNVFSCSVMH EALHNHYTQK SLSLSPGK 90 YW353 light DIQMTQSPSS LSASVGDRVT ITCRASQDVS TAVAWYQQKP chain GKAPKLLIYS ASFLYSGVPS RFSGSGSGTD FTLTISSLQP EDFATYYCQQ SYTTPPTFGQ GTKVEIKRTV AAPSVFIFPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC 91 YW353 heavy EVQLVESGGG LVQPGGSLRL SCAASGFTFT SYSISWVRQA chain PGKGLEWVAE IYPPGGYTDY ADSVKGRFTI SADTSKNTAY LQMNSLRAED TAVYYCAKAR LFFDYWGQGT LVTVSSASTK GPSVFPLAPS SKSTSGGTAA LGCLVKDYFP EPVTVSWNSG ALTSGVHTFP AVLQSSGLYS LSSVVTVPSS SLGTQTYICN VNHKPSNTKV DKKVEPKSCD KTHTCPPCPA PELLGGPSVF LFPPKPKDTL MISRTPEVTC VVVDVSHEDP EVKFNWYVDG VEVHNAKTKP REEQYNSTYR VVSVLTVLHQ DWLNGKEYKC KVSNKALPAP IEKTISKAKG QPREPQVYTL PPSREEMTKN QVSLTCLVKG FYPSDIAVEW ESNGQPENNY KTTPPVLDSD GSFFLYSKLT VDKSRWQQGN VFSCSVMHEA LHNHYTQKSL SLSPGK
92 Antisense forward ACCAACTGCATCCTAAACTG primer 93 Antisense reverse ACCGAGTTTCACCTCAGCTC primer 94 Sense forward ACATTGCCCTGTTGCTCTTC primer 95 Sense reverse ACTGCTCTGATATACTCAATC primer 96 LgR5 ECD huFc GSSPRSGVLL RGCPTHCHCE PDGRMLLRVD CSDLGLSELP (1 to 537 are SNLSVFTSYL DLSMNNISQL LPNPLPSLRF LEELRLAGNA LgR5 ECD) LTYIPKGAFT GLYSLKVLML QNNQLRHVPT EALQNLRSLQ SLRLDANHIS YVPPSCFSGL HSLRHLWLDD NALTEIPVQA FRSLSALQAM TLALNKIHHI PDYAFGNLSS LVVLHLHNNR IHSLGKKCFD GLHSLETLDL NYNNLDEFPT AIRTLSNLKE LGFHSNNIRS IPEKAFVGNP SLITIHFYDN PIQFVGRSAF QHLPELRTLT LNGASQITEF PDLTGTANLE SLTLTGAQIS SLPQTVCNQL PNLQVLDLSY NLLEDLPSFS VCQKLQKIDL RHNEIYEIKV DTFQQLLSLR SLNLAWNKIA IIHPNAFSTL PSLIKLDLSS NLLSSFPITG LHGLTHLKLT GNHALQSLIS SENFPELKVI EMPYAYQCCA FGVCENAYKI SNQWNKGDNS SMDDLHKKDA GMFQAQDERD LEDFLLDFEE DLKALHSVQC SPSPGPFKPC EHLLDGWGRA QVTDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMISRTP EVTCVVVDVS HEDPEVKFNW YVDGVEVHNA KTKPREEQYN STYRVVSVLT VLHQDWLNGK EYKCKVSNKA LPAPIEKTIS KAKGQPREPQ VYTLPPSREE MTKNQVSLTC LVKGFYPSDI AVEWESNGQP ENNYKTTPPV LDSDGSFFLY SKLTVDKSRW QQGNVFSCSV MHEALHNHYT QKSLSLSPGK
Sequence CWU
1
1
961216PRTOryctolagus cuniculus 1Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser
Val Glu Val Ala Val Gly1 5 10
15Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Asn
20 25 30Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40
45Tyr Gly Ala Ser Asn Leu Ala Ser Gly Val Ser Ser Arg Phe
Lys Gly 50 55 60Ser Gly Ser Gly Thr
Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys65 70
75 80Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Thr
Thr Tyr Gly Ser Ser Ser 85 90
95Asp Gly Phe Phe Trp Thr Phe Gly Gly Gly Thr Glu Val Val Val Lys
100 105 110Gly Asp Pro Val Ala
Pro Thr Val Leu Ile Phe Pro Pro Ala Ala Asp 115
120 125Gln Val Ala Thr Gly Thr Val Thr Ile Val Cys Val
Ala Asn Lys Tyr 130 135 140Phe Pro Asp
Val Thr Val Thr Trp Glu Val Asp Gly Thr Thr Gln Thr145
150 155 160Thr Gly Ile Glu Asn Ser Lys
Thr Pro Gln Asn Ser Ala Asp Cys Thr 165
170 175Tyr Asn Leu Ser Ser Thr Leu Thr Leu Thr Ser Thr
Gln Tyr Asn Ser 180 185 190His
Lys Glu Tyr Thr Cys Lys Val Thr Gln Gly Thr Thr Ser Val Val 195
200 205Gln Ser Phe Asn Arg Gly Asp Cys
210 2152443PRTOryctolagus cuniculus 2Gln Ser Leu Glu Glu
Ser Gly Gly Gly Leu Val Gln Pro Glu Gly Ser1 5
10 15Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser
Phe Ser Arg Thr Tyr 20 25
30Trp Ile Cys Trp Asp Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45Ala Cys Ile Tyr Ala Gly Gly Ser
Asp Asn Thr Tyr Tyr Ala Ser Trp 50 55
60Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr65
70 75 80Leu Gln Val Thr Ser
Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys 85
90 95Ala Arg Tyr Tyr Ala Gly Ser Ser Glu Tyr Phe
Asn Leu Trp Gly Pro 100 105
110Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
115 120 125Phe Pro Leu Ala Pro Cys Cys
Gly Asp Thr Pro Ser Ser Thr Val Thr 130 135
140Leu Gly Cys Leu Val Lys Gly Tyr Leu Pro Glu Pro Val Thr Val
Thr145 150 155 160Trp Asn
Ser Gly Thr Leu Thr Asn Gly Val Arg Thr Phe Pro Ser Val
165 170 175Arg Gln Ser Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Ser Val Thr 180 185
190Ser Ser Ser Gln Pro Val Thr Cys Asn Val Ala His Pro Ala
Thr Asn 195 200 205Thr Lys Val Asp
Lys Thr Val Ala Pro Ser Thr Cys Ser Lys Pro Thr 210
215 220Cys Pro Pro Pro Glu Leu Leu Gly Gly Pro Ser Val
Phe Ile Phe Pro225 230 235
240Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr
245 250 255Cys Val Val Val Asp
Val Ser Gln Asp Asp Pro Glu Val Gln Phe Thr 260
265 270Trp Tyr Ile Asn Asn Glu Gln Val Arg Thr Ala Arg
Pro Pro Leu Arg 275 280 285Glu Gln
Gln Phe Asn Ser Thr Ile Arg Val Val Ser Thr Leu Pro Ile 290
295 300Ala His Gln Asp Trp Leu Arg Gly Lys Glu Phe
Lys Cys Lys Val His305 310 315
320Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Arg
325 330 335Gly Gln Pro Leu
Glu Pro Lys Val Tyr Thr Met Gly Pro Pro Arg Glu 340
345 350Glu Leu Ser Ser Arg Ser Val Ser Leu Thr Cys
Met Ile Asn Gly Phe 355 360 365Tyr
Pro Ser Asp Ile Ser Val Glu Trp Glu Lys Asn Gly Lys Ala Glu 370
375 380Asp Asn Tyr Lys Thr Thr Pro Ala Val Leu
Asp Ser Asp Gly Ser Tyr385 390 395
400Phe Leu Tyr Ser Lys Leu Ser Val Pro Thr Ser Glu Trp Gln Arg
Gly 405 410 415Asp Val Phe
Thr Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 420
425 430Thr Gln Lys Ser Ile Ser Arg Ser Pro Gly
Lys 435 4403214PRTOryctolagus cuniculus 3Ala Phe
Glu Leu Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly1 5
10 15Gly Thr Val Thr Ile Lys Cys Gln
Ala Ser Gln Ser Ile Ser Val Gly 20 25
30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu
Ile 35 40 45Tyr Lys Ala Ser Thr
Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly 50 55
60Ser Arg Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu
Glu Cys65 70 75 80Ala
Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Asp Ser Ser Thr
85 90 95Thr Ala Asn Val Phe Gly Gly
Gly Thr Glu Val Val Val Lys Gly Asp 100 105
110Pro Val Ala Pro Thr Val Leu Ile Phe Pro Pro Ala Ala Asp
Gln Val 115 120 125Ala Thr Gly Thr
Val Thr Ile Val Cys Val Ala Asn Lys Tyr Phe Pro 130
135 140Asp Val Thr Val Thr Trp Glu Val Asp Gly Thr Thr
Gln Thr Thr Gly145 150 155
160Ile Glu Asn Ser Lys Thr Pro Gln Asn Ser Ala Asp Cys Thr Tyr Asn
165 170 175Leu Ser Ser Thr Leu
Thr Leu Thr Ser Thr Gln Tyr Asn Ser His Lys 180
185 190Glu Tyr Thr Cys Lys Val Thr Gln Gly Thr Thr Ser
Val Val Gln Ser 195 200 205Phe Asn
Arg Gly Asp Cys 2104446PRTOryctolagus cuniculus 4Gln Ser Leu Glu Glu
Ser Gly Gly Asp Leu Val Lys Pro Gly Gly Thr1 5
10 15Leu Thr Leu Thr Cys Thr Ala Ser Gly Ile Asp
Phe Ser Tyr Tyr Ser 20 25
30Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45Ala Cys Ile Tyr Ala Gly Thr Ser
Gly Ser Thr Tyr Tyr Ala Ser Trp 50 55
60Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr65
70 75 80Leu Gln Met Ile Ser
Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys 85
90 95Ala Arg Ser Tyr Tyr Thr Phe Gly Val Asn Gly
Tyr Ala Trp Asp Leu 100 105
110Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
115 120 125Pro Ser Val Phe Pro Leu Ala
Pro Cys Cys Gly Asp Thr Pro Ser Ser 130 135
140Thr Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Leu Pro Glu Pro
Val145 150 155 160Thr Val
Thr Trp Asn Ser Gly Thr Leu Thr Asn Gly Val Arg Thr Phe
165 170 175Pro Ser Val Arg Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val 180 185
190Ser Val Thr Ser Ser Ser Gln Pro Val Thr Cys Asn Val Ala
His Pro 195 200 205Ala Thr Asn Thr
Lys Val Asp Lys Thr Val Ala Pro Ser Thr Cys Ser 210
215 220Lys Pro Thr Cys Pro Pro Pro Glu Leu Leu Gly Gly
Pro Ser Val Phe225 230 235
240Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
245 250 255Glu Val Thr Cys Val
Val Val Asp Val Ser Gln Asp Asp Pro Glu Val 260
265 270Gln Phe Thr Trp Tyr Ile Asn Asn Glu Gln Val Arg
Thr Ala Arg Pro 275 280 285Pro Leu
Arg Glu Gln Gln Phe Asn Ser Thr Ile Arg Val Val Ser Thr 290
295 300Leu Pro Ile Ala His Gln Asp Trp Leu Arg Gly
Lys Glu Phe Lys Cys305 310 315
320Lys Val His Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser
325 330 335Lys Ala Arg Gly
Gln Pro Leu Glu Pro Lys Val Tyr Thr Met Gly Pro 340
345 350Pro Arg Glu Glu Leu Ser Ser Arg Ser Val Ser
Leu Thr Cys Met Ile 355 360 365Asn
Gly Phe Tyr Pro Ser Asp Ile Ser Val Glu Trp Glu Lys Asn Gly 370
375 380Lys Ala Glu Asp Asn Tyr Lys Thr Thr Pro
Ala Val Leu Asp Ser Asp385 390 395
400Gly Ser Tyr Phe Leu Tyr Ser Lys Leu Ser Val Pro Thr Ser Glu
Trp 405 410 415Gln Arg Gly
Asp Val Phe Thr Cys Ser Val Met His Glu Ala Leu His 420
425 430Asn His Tyr Thr Gln Lys Ser Ile Ser Arg
Ser Pro Gly Lys 435 440
4455112PRTOryctolagus cuniculus 5Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser
Val Glu Val Ala Val Gly1 5 10
15Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Asn
20 25 30Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40
45Tyr Gly Ala Ser Asn Leu Ala Ser Gly Val Ser Ser Arg Phe
Lys Gly 50 55 60Ser Gly Ser Gly Thr
Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys65 70
75 80Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Thr
Thr Tyr Gly Ser Ser Ser 85 90
95Asp Gly Phe Phe Trp Thr Phe Gly Gly Gly Thr Glu Val Val Val Lys
100 105 1106120PRTOryctolagus
cuniculus 6Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly
Ser1 5 10 15Leu Thr Leu
Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Arg Thr Tyr 20
25 30Trp Ile Cys Trp Asp Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Ile 35 40
45Ala Cys Ile Tyr Ala Gly Gly Ser Asp Asn Thr Tyr Tyr Ala Ser Trp 50
55 60Ala Lys Gly Arg Phe Thr Ile Ser Lys
Thr Ser Ser Thr Thr Val Thr65 70 75
80Leu Gln Val Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr
Phe Cys 85 90 95Ala Arg
Tyr Tyr Ala Gly Ser Ser Glu Tyr Phe Asn Leu Trp Gly Pro 100
105 110Gly Thr Leu Val Thr Val Ser Ser
115 1207110PRTOryctolagus cuniculus 7Ala Phe Glu Leu Thr
Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly1 5
10 15Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln
Ser Ile Ser Val Gly 20 25
30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile
35 40 45Tyr Lys Ala Ser Thr Leu Ala Ser
Gly Val Pro Ser Arg Phe Lys Gly 50 55
60Ser Arg Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys65
70 75 80Ala Asp Ala Ala Thr
Tyr Tyr Cys Gln Ser Tyr Tyr Asp Ser Ser Thr 85
90 95Thr Ala Asn Val Phe Gly Gly Gly Thr Glu Val
Val Val Lys 100 105
1108123PRTOryctolagus cuniculus 8Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu
Val Lys Pro Gly Gly Thr1 5 10
15Leu Thr Leu Thr Cys Thr Ala Ser Gly Ile Asp Phe Ser Tyr Tyr Ser
20 25 30Tyr Met Cys Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile 35 40
45Ala Cys Ile Tyr Ala Gly Thr Ser Gly Ser Thr Tyr Tyr Ala
Ser Trp 50 55 60Ala Lys Gly Arg Phe
Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr65 70
75 80Leu Gln Met Ile Ser Leu Thr Ala Ala Asp
Thr Ala Thr Tyr Phe Cys 85 90
95Ala Arg Ser Tyr Tyr Thr Phe Gly Val Asn Gly Tyr Ala Trp Asp Leu
100 105 110Trp Gly Pro Gly Thr
Leu Val Thr Val Ser Ser 115 120911PRTOryctolagus
cuniculus 9Gln Ala Ser Gln Ser Ile Gly Ser Asn Leu Ala1 5
10107PRTOryctolagus cuniculus 10Gly Ala Ser Asn Leu Ala
Ser1 51114PRTOryctolagus cuniculus 11Gln Thr Thr Tyr Gly
Ser Ser Ser Asp Gly Phe Phe Trp Thr1 5
10126PRTOryctolagus cuniculus 12Arg Thr Tyr Trp Ile Cys1
51317PRTOryctolagus cuniculus 13Cys Ile Tyr Ala Gly Gly Ser Asp Asn Thr
Tyr Tyr Ala Ser Trp Ala1 5 10
15Lys1411PRTOryctolagus cuniculus 14Tyr Tyr Ala Gly Ser Ser Glu Tyr
Phe Asn Leu1 5 101511PRTOryctolagus
cuniculus 15Gln Ala Ser Gln Ser Ile Ser Val Gly Leu Ala1 5
10167PRTOryctolagus cuniculus 16Lys Ala Ser Thr Leu Ala
Ser1 51712PRTOryctolagus cuniculus 17Gln Ser Tyr Tyr Asp
Ser Ser Thr Thr Ala Asn Val1 5
10186PRTOryctolagus cuniculus 18Tyr Tyr Ser Tyr Met Cys1
51917PRTOryctolagus cuniculus 19Cys Ile Tyr Ala Gly Thr Ser Gly Ser Thr
Tyr Tyr Ala Ser Trp Ala1 5 10
15Lys2014PRTOryctolagus cuniculus 20Ser Tyr Tyr Thr Phe Gly Val Asn
Gly Tyr Ala Trp Asp Leu1 5 1021907PRTHomo
sapiens 21Met Asp Thr Ser Arg Leu Gly Val Leu Leu Ser Leu Pro Val Leu
Leu1 5 10 15Gln Leu Ala
Thr Gly Gly Ser Ser Pro Arg Ser Gly Val Leu Leu Arg 20
25 30Gly Cys Pro Thr His Cys His Cys Glu Pro
Asp Gly Arg Met Leu Leu 35 40
45Arg Val Asp Cys Ser Asp Leu Gly Leu Ser Glu Leu Pro Ser Asn Leu 50
55 60Ser Val Phe Thr Ser Tyr Leu Asp Leu
Ser Met Asn Asn Ile Ser Gln65 70 75
80Leu Leu Pro Asn Pro Leu Pro Ser Leu Arg Phe Leu Glu Glu
Leu Arg 85 90 95Leu Ala
Gly Asn Ala Leu Thr Tyr Ile Pro Lys Gly Ala Phe Thr Gly 100
105 110Leu Tyr Ser Leu Lys Val Leu Met Leu
Gln Asn Asn Gln Leu Arg His 115 120
125Val Pro Thr Glu Ala Leu Gln Asn Leu Arg Ser Leu Gln Ser Leu Arg
130 135 140Leu Asp Ala Asn His Ile Ser
Tyr Val Pro Pro Ser Cys Phe Ser Gly145 150
155 160Leu His Ser Leu Arg His Leu Trp Leu Asp Asp Asn
Ala Leu Thr Glu 165 170
175Ile Pro Val Gln Ala Phe Arg Ser Leu Ser Ala Leu Gln Ala Met Thr
180 185 190Leu Ala Leu Asn Lys Ile
His His Ile Pro Asp Tyr Ala Phe Gly Asn 195 200
205Leu Ser Ser Leu Val Val Leu His Leu His Asn Asn Arg Ile
His Ser 210 215 220Leu Gly Lys Lys Cys
Phe Asp Gly Leu His Ser Leu Glu Thr Leu Asp225 230
235 240Leu Asn Tyr Asn Asn Leu Asp Glu Phe Pro
Thr Ala Ile Arg Thr Leu 245 250
255Ser Asn Leu Lys Glu Leu Gly Phe His Ser Asn Asn Ile Arg Ser Ile
260 265 270Pro Glu Lys Ala Phe
Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe 275
280 285Tyr Asp Asn Pro Ile Gln Phe Val Gly Arg Ser Ala
Phe Gln His Leu 290 295 300Pro Glu Leu
Arg Thr Leu Thr Leu Asn Gly Ala Ser Gln Ile Thr Glu305
310 315 320Phe Pro Asp Leu Thr Gly Thr
Ala Asn Leu Glu Ser Leu Thr Leu Thr 325
330 335Gly Ala Gln Ile Ser Ser Leu Pro Gln Thr Val Cys
Asn Gln Leu Pro 340 345 350Asn
Leu Gln Val Leu Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu Pro 355
360 365Ser Phe Ser Val Cys Gln Lys Leu Gln
Lys Ile Asp Leu Arg His Asn 370 375
380Glu Ile Tyr Glu Ile Lys Val Asp Thr Phe Gln Gln Leu Leu Ser Leu385
390 395 400Arg Ser Leu Asn
Leu Ala Trp Asn Lys Ile Ala Ile Ile His Pro Asn 405
410 415Ala Phe Ser Thr Leu Pro Ser Leu Ile Lys
Leu Asp Leu Ser Ser Asn 420 425
430Leu Leu Ser Ser Phe Pro Ile Thr Gly Leu His Gly Leu Thr His Leu
435 440 445Lys Leu Thr Gly Asn His Ala
Leu Gln Ser Leu Ile Ser Ser Glu Asn 450 455
460Phe Pro Glu Leu Lys Val Ile Glu Met Pro Tyr Ala Tyr Gln Cys
Cys465 470 475 480Ala Phe
Gly Val Cys Glu Asn Ala Tyr Lys Ile Ser Asn Gln Trp Asn
485 490 495Lys Gly Asp Asn Ser Ser Met
Asp Asp Leu His Lys Lys Asp Ala Gly 500 505
510Met Phe Gln Ala Gln Asp Glu Arg Asp Leu Glu Asp Phe Leu
Leu Asp 515 520 525Phe Glu Glu Asp
Leu Lys Ala Leu His Ser Val Gln Cys Ser Pro Ser 530
535 540Pro Gly Pro Phe Lys Pro Cys Glu His Leu Leu Asp
Gly Trp Leu Ile545 550 555
560Arg Ile Gly Val Trp Thr Ile Ala Val Leu Ala Leu Thr Cys Asn Ala
565 570 575Leu Val Thr Ser Thr
Val Phe Arg Ser Pro Leu Tyr Ile Ser Pro Ile 580
585 590Lys Leu Leu Ile Gly Val Ile Ala Ala Val Asn Met
Leu Thr Gly Val 595 600 605Ser Ser
Ala Val Leu Ala Gly Val Asp Ala Phe Thr Phe Gly Ser Phe 610
615 620Ala Arg His Gly Ala Trp Trp Glu Asn Gly Val
Gly Cys His Val Ile625 630 635
640Gly Phe Leu Ser Ile Phe Ala Ser Glu Ser Ser Val Phe Leu Leu Thr
645 650 655Leu Ala Ala Leu
Glu Arg Gly Phe Ser Val Lys Tyr Ser Ala Lys Phe 660
665 670Glu Thr Lys Ala Pro Phe Ser Ser Leu Lys Val
Ile Ile Leu Leu Cys 675 680 685Ala
Leu Leu Ala Leu Thr Met Ala Ala Val Pro Leu Leu Gly Gly Ser 690
695 700Lys Tyr Gly Ala Ser Pro Leu Cys Leu Pro
Leu Pro Phe Gly Glu Pro705 710 715
720Ser Thr Met Gly Tyr Met Val Ala Leu Ile Leu Leu Asn Ser Leu
Cys 725 730 735Phe Leu Met
Met Thr Ile Ala Tyr Thr Lys Leu Tyr Cys Asn Leu Asp 740
745 750Lys Gly Asp Leu Glu Asn Ile Trp Asp Cys
Ser Met Val Lys His Ile 755 760
765Ala Leu Leu Leu Phe Thr Asn Cys Ile Leu Asn Cys Pro Val Ala Phe 770
775 780Leu Ser Phe Ser Ser Leu Ile Asn
Leu Thr Phe Ile Ser Pro Glu Val785 790
795 800Ile Lys Phe Ile Leu Leu Val Val Val Pro Leu Pro
Ala Cys Leu Asn 805 810
815Pro Leu Leu Tyr Ile Leu Phe Asn Pro His Phe Lys Glu Asp Leu Val
820 825 830Ser Leu Arg Lys Gln Thr
Tyr Val Trp Thr Arg Ser Lys His Pro Ser 835 840
845Leu Met Ser Ile Asn Ser Asp Asp Val Glu Lys Gln Ser Cys
Asp Ser 850 855 860Thr Gln Ala Leu Val
Thr Phe Thr Ser Ser Ser Ile Thr Tyr Asp Leu865 870
875 880Pro Pro Ser Ser Val Pro Ser Pro Ala Tyr
Pro Val Thr Glu Ser Cys 885 890
895His Leu Ser Ser Val Ala Phe Val Pro Cys Leu 900
90522886PRTHomo sapiens 22Gly Ser Ser Pro Arg Ser Gly Val Leu
Leu Arg Gly Cys Pro Thr His1 5 10
15Cys His Cys Glu Pro Asp Gly Arg Met Leu Leu Arg Val Asp Cys
Ser 20 25 30Asp Leu Gly Leu
Ser Glu Leu Pro Ser Asn Leu Ser Val Phe Thr Ser 35
40 45Tyr Leu Asp Leu Ser Met Asn Asn Ile Ser Gln Leu
Leu Pro Asn Pro 50 55 60Leu Pro Ser
Leu Arg Phe Leu Glu Glu Leu Arg Leu Ala Gly Asn Ala65 70
75 80Leu Thr Tyr Ile Pro Lys Gly Ala
Phe Thr Gly Leu Tyr Ser Leu Lys 85 90
95Val Leu Met Leu Gln Asn Asn Gln Leu Arg His Val Pro Thr
Glu Ala 100 105 110Leu Gln Asn
Leu Arg Ser Leu Gln Ser Leu Arg Leu Asp Ala Asn His 115
120 125Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly
Leu His Ser Leu Arg 130 135 140His Leu
Trp Leu Asp Asp Asn Ala Leu Thr Glu Ile Pro Val Gln Ala145
150 155 160Phe Arg Ser Leu Ser Ala Leu
Gln Ala Met Thr Leu Ala Leu Asn Lys 165
170 175Ile His His Ile Pro Asp Tyr Ala Phe Gly Asn Leu
Ser Ser Leu Val 180 185 190Val
Leu His Leu His Asn Asn Arg Ile His Ser Leu Gly Lys Lys Cys 195
200 205Phe Asp Gly Leu His Ser Leu Glu Thr
Leu Asp Leu Asn Tyr Asn Asn 210 215
220Leu Asp Glu Phe Pro Thr Ala Ile Arg Thr Leu Ser Asn Leu Lys Glu225
230 235 240Leu Gly Phe His
Ser Asn Asn Ile Arg Ser Ile Pro Glu Lys Ala Phe 245
250 255Val Gly Asn Pro Ser Leu Ile Thr Ile His
Phe Tyr Asp Asn Pro Ile 260 265
270Gln Phe Val Gly Arg Ser Ala Phe Gln His Leu Pro Glu Leu Arg Thr
275 280 285Leu Thr Leu Asn Gly Ala Ser
Gln Ile Thr Glu Phe Pro Asp Leu Thr 290 295
300Gly Thr Ala Asn Leu Glu Ser Leu Thr Leu Thr Gly Ala Gln Ile
Ser305 310 315 320Ser Leu
Pro Gln Thr Val Cys Asn Gln Leu Pro Asn Leu Gln Val Leu
325 330 335Asp Leu Ser Tyr Asn Leu Leu
Glu Asp Leu Pro Ser Phe Ser Val Cys 340 345
350Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn Glu Ile Tyr
Glu Ile 355 360 365Lys Val Asp Thr
Phe Gln Gln Leu Leu Ser Leu Arg Ser Leu Asn Leu 370
375 380Ala Trp Asn Lys Ile Ala Ile Ile His Pro Asn Ala
Phe Ser Thr Leu385 390 395
400Pro Ser Leu Ile Lys Leu Asp Leu Ser Ser Asn Leu Leu Ser Ser Phe
405 410 415Pro Ile Thr Gly Leu
His Gly Leu Thr His Leu Lys Leu Thr Gly Asn 420
425 430His Ala Leu Gln Ser Leu Ile Ser Ser Glu Asn Phe
Pro Glu Leu Lys 435 440 445Val Ile
Glu Met Pro Tyr Ala Tyr Gln Cys Cys Ala Phe Gly Val Cys 450
455 460Glu Asn Ala Tyr Lys Ile Ser Asn Gln Trp Asn
Lys Gly Asp Asn Ser465 470 475
480Ser Met Asp Asp Leu His Lys Lys Asp Ala Gly Met Phe Gln Ala Gln
485 490 495Asp Glu Arg Asp
Leu Glu Asp Phe Leu Leu Asp Phe Glu Glu Asp Leu 500
505 510Lys Ala Leu His Ser Val Gln Cys Ser Pro Ser
Pro Gly Pro Phe Lys 515 520 525Pro
Cys Glu His Leu Leu Asp Gly Trp Leu Ile Arg Ile Gly Val Trp 530
535 540Thr Ile Ala Val Leu Ala Leu Thr Cys Asn
Ala Leu Val Thr Ser Thr545 550 555
560Val Phe Arg Ser Pro Leu Tyr Ile Ser Pro Ile Lys Leu Leu Ile
Gly 565 570 575Val Ile Ala
Ala Val Asn Met Leu Thr Gly Val Ser Ser Ala Val Leu 580
585 590Ala Gly Val Asp Ala Phe Thr Phe Gly Ser
Phe Ala Arg His Gly Ala 595 600
605Trp Trp Glu Asn Gly Val Gly Cys His Val Ile Gly Phe Leu Ser Ile 610
615 620Phe Ala Ser Glu Ser Ser Val Phe
Leu Leu Thr Leu Ala Ala Leu Glu625 630
635 640Arg Gly Phe Ser Val Lys Tyr Ser Ala Lys Phe Glu
Thr Lys Ala Pro 645 650
655Phe Ser Ser Leu Lys Val Ile Ile Leu Leu Cys Ala Leu Leu Ala Leu
660 665 670Thr Met Ala Ala Val Pro
Leu Leu Gly Gly Ser Lys Tyr Gly Ala Ser 675 680
685Pro Leu Cys Leu Pro Leu Pro Phe Gly Glu Pro Ser Thr Met
Gly Tyr 690 695 700Met Val Ala Leu Ile
Leu Leu Asn Ser Leu Cys Phe Leu Met Met Thr705 710
715 720Ile Ala Tyr Thr Lys Leu Tyr Cys Asn Leu
Asp Lys Gly Asp Leu Glu 725 730
735Asn Ile Trp Asp Cys Ser Met Val Lys His Ile Ala Leu Leu Leu Phe
740 745 750Thr Asn Cys Ile Leu
Asn Cys Pro Val Ala Phe Leu Ser Phe Ser Ser 755
760 765Leu Ile Asn Leu Thr Phe Ile Ser Pro Glu Val Ile
Lys Phe Ile Leu 770 775 780Leu Val Val
Val Pro Leu Pro Ala Cys Leu Asn Pro Leu Leu Tyr Ile785
790 795 800Leu Phe Asn Pro His Phe Lys
Glu Asp Leu Val Ser Leu Arg Lys Gln 805
810 815Thr Tyr Val Trp Thr Arg Ser Lys His Pro Ser Leu
Met Ser Ile Asn 820 825 830Ser
Asp Asp Val Glu Lys Gln Ser Cys Asp Ser Thr Gln Ala Leu Val 835
840 845Thr Phe Thr Ser Ser Ser Ile Thr Tyr
Asp Leu Pro Pro Ser Ser Val 850 855
860Pro Ser Pro Ala Tyr Pro Val Thr Glu Ser Cys His Leu Ser Ser Val865
870 875 880Ala Phe Val Pro
Cys Leu 88523875PRTMacaca fascicularis 23Gly Cys Pro Thr
His Cys His Cys Glu Pro Asp Gly Arg Met Leu Leu1 5
10 15Arg Val Asp Cys Ser Asp Leu Gly Leu Ser
Glu Leu Pro Ser Asn Leu 20 25
30Ser Val Phe Thr Ser Tyr Leu Asp Leu Ser Met Asn Asn Ile Ser Gln
35 40 45Leu Leu Pro Asn Pro Leu Pro Ser
Leu Arg Phe Leu Glu Glu Leu Arg 50 55
60Leu Ala Gly Asn Ala Leu Thr Tyr Ile Pro Lys Gly Ala Phe Thr Gly65
70 75 80Leu Tyr Ser Leu Lys
Val Leu Met Leu Gln Asn Asn Gln Leu Arg Gln 85
90 95Val Pro Thr Glu Ala Leu Gln Asn Leu Arg Ser
Leu Gln Ser Leu Arg 100 105
110Leu Asp Ala Asn His Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly
115 120 125Leu His Ser Leu Arg His Leu
Trp Leu Asp Asp Asn Ala Leu Thr Glu 130 135
140Ile Pro Val Gln Ala Phe Arg Ser Leu Ser Ala Leu Gln Ala Met
Thr145 150 155 160Leu Ala
Leu Asn Lys Ile His His Ile Pro Asp Tyr Ala Phe Gly Asn
165 170 175Leu Ser Ser Leu Val Val Leu
His Leu His Asn Asn Arg Ile His Ser 180 185
190Leu Gly Lys Lys Cys Phe Asp Gly Leu His Ser Leu Glu Thr
Leu Asp 195 200 205Leu Asn Tyr Asn
Asn Leu Asp Glu Phe Pro Thr Ala Ile Arg Thr Leu 210
215 220Ser Asn Leu Lys Glu Leu Gly Phe His Ser Asn Asn
Ile Arg Ser Ile225 230 235
240Pro Glu Lys Ala Phe Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe
245 250 255Tyr Asp Asn Pro Ile
Gln Phe Val Gly Arg Ser Ala Phe Gln His Leu 260
265 270Pro Glu Leu Arg Thr Leu Thr Leu Asn Gly Ala Ser
Gln Ile Thr Glu 275 280 285Phe Pro
Asp Leu Thr Gly Thr Ala Asn Leu Glu Ser Leu Thr Leu Thr 290
295 300Gly Ala Gln Ile Ser Ser Leu Pro Gln Thr Val
Cys Asn Gln Leu Pro305 310 315
320Asn Leu Gln Val Leu Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu Pro
325 330 335Ser Phe Ser Val
Cys Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn 340
345 350Glu Ile Tyr Glu Ile Lys Val Asp Thr Phe Gln
Gln Leu Leu Ser Leu 355 360 365Arg
Ser Leu Asn Leu Ala Trp Asn Lys Ile Ala Ile Ile His Pro Asn 370
375 380Ala Phe Ser Thr Leu Pro Ser Leu Ile Lys
Leu Asp Leu Ser Ser Asn385 390 395
400Leu Leu Ser Ser Phe Pro Val Thr Gly Leu His Gly Leu Thr His
Leu 405 410 415Lys Leu Thr
Gly Asn His Ala Leu Gln Ser Leu Ile Ser Ser Glu Asn 420
425 430Phe Pro Glu Leu Lys Ile Ile Glu Met Pro
Tyr Ala Tyr Gln Cys Cys 435 440
445Ala Phe Gly Val Cys Glu Asn Ala Tyr Lys Ile Ser Asn Gln Trp Asn 450
455 460Lys Gly Asp Asn Ser Ser Met Asp
Asp Leu His Lys Lys Asp Ala Gly465 470
475 480Met Phe Gln Val Gln Asp Glu Arg Asp Leu Glu Asp
Phe Leu Leu Asp 485 490
495Phe Glu Glu Asp Leu Lys Ala Leu His Ser Val Gln Cys Ser Pro Ser
500 505 510Pro Gly Pro Phe Lys Pro
Cys Glu His Leu Leu Asp Gly Trp Leu Ile 515 520
525Arg Ile Gly Val Trp Thr Ile Ala Val Leu Ala Leu Thr Cys
Asn Ala 530 535 540Leu Val Thr Ser Thr
Val Phe Arg Ser Pro Leu Tyr Ile Ser Pro Ile545 550
555 560Lys Leu Leu Ile Gly Val Ile Ala Val Val
Asn Met Leu Thr Gly Val 565 570
575Ser Ser Ala Val Leu Ala Gly Val Asp Ala Phe Thr Phe Gly Ser Phe
580 585 590Ala Arg His Gly Ala
Trp Trp Glu Asn Gly Val Gly Cys Gln Val Ile 595
600 605Gly Phe Leu Ser Ile Phe Ala Ser Glu Ser Ser Val
Phe Leu Leu Thr 610 615 620Leu Ala Ala
Leu Glu Arg Gly Phe Ser Val Lys Cys Ser Ala Lys Phe625
630 635 640Glu Thr Lys Ala Pro Phe Ser
Ser Leu Lys Val Ile Ile Leu Leu Cys 645
650 655Ala Leu Leu Ala Leu Thr Met Ala Ala Val Pro Leu
Leu Gly Gly Ser 660 665 670Glu
Tyr Gly Ala Ser Pro Leu Cys Leu Pro Leu Pro Phe Gly Glu Pro 675
680 685Ser Thr Thr Gly Tyr Met Val Ala Leu
Ile Leu Leu Asn Ser Leu Cys 690 695
700Phe Leu Met Met Thr Ile Ala Tyr Thr Lys Leu Tyr Cys Asn Leu Asp705
710 715 720Lys Gly Asp Leu
Glu Asn Ile Trp Asp Cys Ser Met Val Lys His Ile 725
730 735Ala Leu Leu Leu Phe Thr Asn Cys Ile Leu
Tyr Cys Pro Val Ala Phe 740 745
750Leu Ser Phe Ser Ser Leu Leu Asn Leu Thr Phe Ile Ser Pro Glu Val
755 760 765Ile Lys Phe Ile Leu Leu Val
Ile Val Pro Leu Pro Ala Cys Leu Asn 770 775
780Pro Leu Leu Tyr Ile Leu Phe Asn Pro His Phe Lys Glu Asp Leu
Val785 790 795 800Ser Leu
Gly Lys Gln Thr Tyr Phe Trp Thr Arg Ser Lys His Pro Ser
805 810 815Leu Met Ser Ile Asn Ser Asp
Asp Val Glu Lys Gln Ser Cys Asp Ser 820 825
830Thr Gln Ala Leu Val Thr Phe Thr Ser Ser Ser Ile Ala Tyr
Asp Leu 835 840 845Pro Pro Ser Ser
Val Pro Ser Pro Ala Tyr Pro Val Thr Glu Ser Cys 850
855 860His Leu Ser Ser Val Ala Phe Val Pro Cys Leu865
870 87524907PRTRattus rattus 24Met Asp Thr
Ser Arg Val Arg Met Leu Leu Ser Leu Leu Ala Leu Leu1 5
10 15Gln Leu Val Ala Ala Gly Ser Pro Pro
Arg Pro Asp Thr Met Pro Arg 20 25
30Gly Cys Pro Ser Tyr Cys His Cys Glu Leu Asp Gly Arg Met Leu Leu
35 40 45Arg Val Asp Cys Ser Asp Leu
Gly Leu Ser Glu Leu Pro Ser Asn Leu 50 55
60Ser Val Phe Thr Ser Tyr Leu Asp Leu Ser Met Asn Asn Ile Ser Gln65
70 75 80Leu Pro Ala Ser
Leu Leu His Arg Leu Arg Phe Leu Glu Glu Leu Arg 85
90 95Leu Ala Gly Asn Ala Leu Thr His Ile Pro
Lys Gly Ala Phe Ala Gly 100 105
110Leu His Ser Leu Lys Val Leu Met Leu Gln Asn Asn Gln Leu Arg Gln
115 120 125Val Pro Glu Glu Ala Leu Gln
Asn Leu Arg Ser Leu Gln Ser Leu Arg 130 135
140Leu Asp Ala Asn His Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser
Gly145 150 155 160Leu His
Ser Leu Arg His Leu Trp Leu Asp Asp Asn Ala Leu Thr Asp
165 170 175Val Pro Val Gln Ala Phe Arg
Ser Leu Ser Ala Leu Gln Ala Met Thr 180 185
190Leu Ala Leu Asn Lys Ile His His Ile Ala Asp His Ala Phe
Gly Asn 195 200 205Leu Ser Ser Leu
Val Val Leu His Leu His Asn Asn Arg Ile His Ser 210
215 220Leu Gly Lys Lys Cys Phe Asp Gly Leu His Ser Leu
Glu Thr Leu Asp225 230 235
240Leu Asn Tyr Asn Asn Leu Asp Glu Phe Pro Thr Ala Ile Lys Thr Leu
245 250 255Ser Asn Leu Lys Glu
Leu Gly Phe His Ser Asn Asn Ile Arg Ser Ile 260
265 270Pro Glu Arg Ala Phe Val Gly Asn Pro Ser Leu Ile
Thr Ile His Phe 275 280 285Tyr Asp
Asn Pro Ile Gln Phe Val Gly Ile Ser Ala Phe Gln His Leu 290
295 300Pro Glu Leu Arg Thr Leu Thr Leu Asn Gly Ala
Ser Gln Ile Thr Glu305 310 315
320Phe Pro Asp Leu Thr Gly Thr Ala Thr Leu Glu Ser Leu Thr Leu Thr
325 330 335Gly Ala Lys Ile
Ser Ser Leu Pro Gln Thr Val Cys Asp Gln Leu Pro 340
345 350Asn Leu Gln Val Leu Asp Leu Ser Tyr Asn Leu
Leu Glu Asp Leu Pro 355 360 365Ser
Leu Ser Gly Cys Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn 370
375 380Glu Ile Tyr Glu Ile Lys Gly Gly Thr Phe
Gln Gln Leu Phe Asn Leu385 390 395
400Arg Ser Leu Asn Leu Ala Arg Asn Lys Ile Ala Ile Ile His Pro
Asn 405 410 415Ala Phe Ser
Thr Leu Pro Ser Leu Ile Lys Leu Asp Leu Ser Ser Asn 420
425 430Leu Leu Ser Ser Phe Pro Val Thr Gly Leu
His Gly Leu Thr His Leu 435 440
445Lys Leu Thr Gly Asn Arg Ala Leu Gln Ser Leu Ile Pro Ser Ala Asn 450
455 460Phe Pro Glu Leu Lys Ile Ile Glu
Met Pro Tyr Ala Tyr Gln Cys Cys465 470
475 480Ala Phe Gly Gly Cys Glu Asn Val Tyr Lys Ile Pro
Asn Gln Trp Asn 485 490
495Lys Asp Asp Ser Ser Ser Val Asp Asp Leu Arg Lys Lys Asp Ala Gly
500 505 510Leu Phe Gln Val Gln Asp
Glu Arg Asp Leu Glu Asp Phe Leu Leu Asp 515 520
525Phe Glu Glu Asp Leu Lys Val Leu His Ser Val Gln Cys Ser
Pro Pro 530 535 540Pro Gly Pro Phe Lys
Pro Cys Glu His Leu Phe Gly Ser Trp Leu Ile545 550
555 560Arg Ile Gly Val Trp Thr Thr Ala Val Leu
Ala Leu Ser Cys Asn Ala 565 570
575Leu Val Ala Phe Thr Val Phe Arg Thr Pro Leu Tyr Ile Ser Ser Ile
580 585 590Lys Leu Leu Ile Gly
Val Ile Ala Val Val Asp Ile Leu Met Gly Val 595
600 605Ser Ser Ala Ile Leu Ala Val Val Asp Thr Phe Thr
Phe Gly Ser Phe 610 615 620Ala Gln His
Gly Ala Trp Trp Glu Gly Gly Ile Gly Cys Gln Ile Val625
630 635 640Gly Phe Leu Ser Ile Phe Ala
Ser Glu Ser Ser Val Phe Leu Leu Thr 645
650 655Leu Ala Ala Leu Glu Arg Gly Phe Ser Val Lys Cys
Ser Ser Lys Phe 660 665 670Glu
Met Lys Ala Pro Leu Ser Ser Leu Lys Ala Ile Ile Leu Leu Cys 675
680 685Val Leu Leu Ala Leu Thr Ile Ala Thr
Val Pro Leu Leu Gly Gly Ser 690 695
700Glu Tyr Asn Ala Ser Pro Leu Cys Leu Pro Leu Pro Phe Gly Glu Pro705
710 715 720Ser Thr Thr Gly
Tyr Met Val Ala Leu Val Leu Leu Asn Ser Leu Cys 725
730 735Phe Leu Ile Met Thr Ile Ala Tyr Thr Arg
Leu Tyr Cys Ser Leu Glu 740 745
750Lys Gly Glu Leu Glu Asn Leu Trp Asp Cys Ser Met Val Lys His Thr
755 760 765Ala Leu Leu Leu Phe Thr Asn
Cys Ile Leu Tyr Cys Pro Val Ala Phe 770 775
780Leu Ser Phe Ser Ser Leu Leu Asn Leu Thr Phe Ile Ser Pro Glu
Val785 790 795 800Ile Lys
Phe Ile Leu Leu Val Ile Val Pro Leu Pro Ala Cys Leu Asn
805 810 815Pro Leu Leu Tyr Ile Val Phe
Asn Pro His Phe Lys Glu Asp Met Gly 820 825
830Ser Leu Gly Lys Gln Thr Arg Phe Trp Thr Arg Ala Lys His
Pro Ser 835 840 845Leu Leu Ser Ile
Asn Ser Asp Asp Val Glu Lys Arg Ser Cys Asp Ser 850
855 860Thr Gln Ala Leu Val Ser Phe Thr His Ala Ser Ile
Ala Tyr Asp Leu865 870 875
880Pro Ser Asp Ser Gly Ser Ser Pro Ala Tyr Pro Met Thr Glu Ser Cys
885 890 895His Leu Ser Ser Val
Ala Phe Val Pro Cys Leu 900 90525886PRTRattus
rattus 25Gly Ser Pro Pro Arg Pro Asp Thr Met Pro Arg Gly Cys Pro Ser Tyr1
5 10 15Cys His Cys Glu
Leu Asp Gly Arg Met Leu Leu Arg Val Asp Cys Ser 20
25 30Asp Leu Gly Leu Ser Glu Leu Pro Ser Asn Leu
Ser Val Phe Thr Ser 35 40 45Tyr
Leu Asp Leu Ser Met Asn Asn Ile Ser Gln Leu Pro Ala Ser Leu 50
55 60Leu His Arg Leu Arg Phe Leu Glu Glu Leu
Arg Leu Ala Gly Asn Ala65 70 75
80Leu Thr His Ile Pro Lys Gly Ala Phe Ala Gly Leu His Ser Leu
Lys 85 90 95Val Leu Met
Leu Gln Asn Asn Gln Leu Arg Gln Val Pro Glu Glu Ala 100
105 110Leu Gln Asn Leu Arg Ser Leu Gln Ser Leu
Arg Leu Asp Ala Asn His 115 120
125Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly Leu His Ser Leu Arg 130
135 140His Leu Trp Leu Asp Asp Asn Ala
Leu Thr Asp Val Pro Val Gln Ala145 150
155 160Phe Arg Ser Leu Ser Ala Leu Gln Ala Met Thr Leu
Ala Leu Asn Lys 165 170
175Ile His His Ile Ala Asp His Ala Phe Gly Asn Leu Ser Ser Leu Val
180 185 190Val Leu His Leu His Asn
Asn Arg Ile His Ser Leu Gly Lys Lys Cys 195 200
205Phe Asp Gly Leu His Ser Leu Glu Thr Leu Asp Leu Asn Tyr
Asn Asn 210 215 220Leu Asp Glu Phe Pro
Thr Ala Ile Lys Thr Leu Ser Asn Leu Lys Glu225 230
235 240Leu Gly Phe His Ser Asn Asn Ile Arg Ser
Ile Pro Glu Arg Ala Phe 245 250
255Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe Tyr Asp Asn Pro Ile
260 265 270Gln Phe Val Gly Ile
Ser Ala Phe Gln His Leu Pro Glu Leu Arg Thr 275
280 285Leu Thr Leu Asn Gly Ala Ser Gln Ile Thr Glu Phe
Pro Asp Leu Thr 290 295 300Gly Thr Ala
Thr Leu Glu Ser Leu Thr Leu Thr Gly Ala Lys Ile Ser305
310 315 320Ser Leu Pro Gln Thr Val Cys
Asp Gln Leu Pro Asn Leu Gln Val Leu 325
330 335Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu Pro Ser
Leu Ser Gly Cys 340 345 350Gln
Lys Leu Gln Lys Ile Asp Leu Arg His Asn Glu Ile Tyr Glu Ile 355
360 365Lys Gly Gly Thr Phe Gln Gln Leu Phe
Asn Leu Arg Ser Leu Asn Leu 370 375
380Ala Arg Asn Lys Ile Ala Ile Ile His Pro Asn Ala Phe Ser Thr Leu385
390 395 400Pro Ser Leu Ile
Lys Leu Asp Leu Ser Ser Asn Leu Leu Ser Ser Phe 405
410 415Pro Val Thr Gly Leu His Gly Leu Thr His
Leu Lys Leu Thr Gly Asn 420 425
430Arg Ala Leu Gln Ser Leu Ile Pro Ser Ala Asn Phe Pro Glu Leu Lys
435 440 445Ile Ile Glu Met Pro Tyr Ala
Tyr Gln Cys Cys Ala Phe Gly Gly Cys 450 455
460Glu Asn Val Tyr Lys Ile Pro Asn Gln Trp Asn Lys Asp Asp Ser
Ser465 470 475 480Ser Val
Asp Asp Leu Arg Lys Lys Asp Ala Gly Leu Phe Gln Val Gln
485 490 495Asp Glu Arg Asp Leu Glu Asp
Phe Leu Leu Asp Phe Glu Glu Asp Leu 500 505
510Lys Val Leu His Ser Val Gln Cys Ser Pro Pro Pro Gly Pro
Phe Lys 515 520 525Pro Cys Glu His
Leu Phe Gly Ser Trp Leu Ile Arg Ile Gly Val Trp 530
535 540Thr Thr Ala Val Leu Ala Leu Ser Cys Asn Ala Leu
Val Ala Phe Thr545 550 555
560Val Phe Arg Thr Pro Leu Tyr Ile Ser Ser Ile Lys Leu Leu Ile Gly
565 570 575Val Ile Ala Val Val
Asp Ile Leu Met Gly Val Ser Ser Ala Ile Leu 580
585 590Ala Val Val Asp Thr Phe Thr Phe Gly Ser Phe Ala
Gln His Gly Ala 595 600 605Trp Trp
Glu Gly Gly Ile Gly Cys Gln Ile Val Gly Phe Leu Ser Ile 610
615 620Phe Ala Ser Glu Ser Ser Val Phe Leu Leu Thr
Leu Ala Ala Leu Glu625 630 635
640Arg Gly Phe Ser Val Lys Cys Ser Ser Lys Phe Glu Met Lys Ala Pro
645 650 655Leu Ser Ser Leu
Lys Ala Ile Ile Leu Leu Cys Val Leu Leu Ala Leu 660
665 670Thr Ile Ala Thr Val Pro Leu Leu Gly Gly Ser
Glu Tyr Asn Ala Ser 675 680 685Pro
Leu Cys Leu Pro Leu Pro Phe Gly Glu Pro Ser Thr Thr Gly Tyr 690
695 700Met Val Ala Leu Val Leu Leu Asn Ser Leu
Cys Phe Leu Ile Met Thr705 710 715
720Ile Ala Tyr Thr Arg Leu Tyr Cys Ser Leu Glu Lys Gly Glu Leu
Glu 725 730 735Asn Leu Trp
Asp Cys Ser Met Val Lys His Thr Ala Leu Leu Leu Phe 740
745 750Thr Asn Cys Ile Leu Tyr Cys Pro Val Ala
Phe Leu Ser Phe Ser Ser 755 760
765Leu Leu Asn Leu Thr Phe Ile Ser Pro Glu Val Ile Lys Phe Ile Leu 770
775 780Leu Val Ile Val Pro Leu Pro Ala
Cys Leu Asn Pro Leu Leu Tyr Ile785 790
795 800Val Phe Asn Pro His Phe Lys Glu Asp Met Gly Ser
Leu Gly Lys Gln 805 810
815Thr Arg Phe Trp Thr Arg Ala Lys His Pro Ser Leu Leu Ser Ile Asn
820 825 830Ser Asp Asp Val Glu Lys
Arg Ser Cys Asp Ser Thr Gln Ala Leu Val 835 840
845Ser Phe Thr His Ala Ser Ile Ala Tyr Asp Leu Pro Ser Asp
Ser Gly 850 855 860Ser Ser Pro Ala Tyr
Pro Met Thr Glu Ser Cys His Leu Ser Ser Val865 870
875 880Ala Phe Val Pro Cys Leu
88526907PRTMus musculus 26Met Asp Thr Ser Cys Val His Met Leu Leu Ser Leu
Leu Ala Leu Leu1 5 10
15Gln Leu Val Ala Ala Gly Ser Ser Pro Gly Pro Asp Ala Ile Pro Arg
20 25 30Gly Cys Pro Ser His Cys His
Cys Glu Leu Asp Gly Arg Met Leu Leu 35 40
45Arg Val Asp Cys Ser Asp Leu Gly Leu Ser Glu Leu Pro Ser Asn
Leu 50 55 60Ser Val Phe Thr Ser Tyr
Leu Asp Leu Ser Met Asn Asn Ile Ser Gln65 70
75 80Leu Pro Ala Ser Leu Leu His Arg Leu Cys Phe
Leu Glu Glu Leu Arg 85 90
95Leu Ala Gly Asn Ala Leu Thr His Ile Pro Lys Gly Ala Phe Thr Gly
100 105 110Leu His Ser Leu Lys Val
Leu Met Leu Gln Asn Asn Gln Leu Arg Gln 115 120
125Val Pro Glu Glu Ala Leu Gln Asn Leu Arg Ser Leu Gln Ser
Leu Arg 130 135 140Leu Asp Ala Asn His
Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly145 150
155 160Leu His Ser Leu Arg His Leu Trp Leu Asp
Asp Asn Ala Leu Thr Asp 165 170
175Val Pro Val Gln Ala Phe Arg Ser Leu Ser Ala Leu Gln Ala Met Thr
180 185 190Leu Ala Leu Asn Lys
Ile His His Ile Ala Asp Tyr Ala Phe Gly Asn 195
200 205Leu Ser Ser Leu Val Val Leu His Leu His Asn Asn
Arg Ile His Ser 210 215 220Leu Gly Lys
Lys Cys Phe Asp Gly Leu His Ser Leu Glu Thr Leu Asp225
230 235 240Leu Asn Tyr Asn Asn Leu Asp
Glu Phe Pro Thr Ala Ile Lys Thr Leu 245
250 255Ser Asn Leu Lys Glu Leu Gly Phe His Ser Asn Asn
Ile Arg Ser Ile 260 265 270Pro
Glu Arg Ala Phe Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe 275
280 285Tyr Asp Asn Pro Ile Gln Phe Val Gly
Val Ser Ala Phe Gln His Leu 290 295
300Pro Glu Leu Arg Thr Leu Thr Leu Asn Gly Ala Ser His Ile Thr Glu305
310 315 320Phe Pro His Leu
Thr Gly Thr Ala Thr Leu Glu Ser Leu Thr Leu Thr 325
330 335Gly Ala Lys Ile Ser Ser Leu Pro Gln Ala
Val Cys Asp Gln Leu Pro 340 345
350Asn Leu Gln Val Leu Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu Pro
355 360 365Ser Leu Ser Gly Cys Gln Lys
Leu Gln Lys Ile Asp Leu Arg His Asn 370 375
380Glu Ile Tyr Glu Ile Lys Gly Ser Thr Phe Gln Gln Leu Phe Asn
Leu385 390 395 400Arg Ser
Leu Asn Leu Ala Trp Asn Lys Ile Ala Ile Ile His Pro Asn
405 410 415Ala Phe Ser Thr Leu Pro Ser
Leu Ile Lys Leu Asp Leu Ser Ser Asn 420 425
430Leu Leu Ser Ser Phe Pro Val Thr Gly Leu His Gly Leu Thr
His Leu 435 440 445Lys Leu Thr Gly
Asn Arg Ala Leu Gln Ser Leu Ile Pro Ser Ala Asn 450
455 460Phe Pro Glu Leu Lys Ile Ile Glu Met Pro Ser Ala
Tyr Gln Cys Cys465 470 475
480Ala Phe Gly Gly Cys Glu Asn Val Tyr Lys Ile Ser Asn Gln Trp Asn
485 490 495Lys Asp Asp Gly Asn
Ser Val Asp Asp Leu His Lys Lys Asp Ala Gly 500
505 510Leu Phe Gln Val Gln Asp Glu Arg Asp Leu Glu Asp
Phe Leu Leu Asp 515 520 525Phe Glu
Glu Asp Leu Lys Ala Leu His Ser Val Gln Cys Ser Pro Ser 530
535 540Pro Gly Pro Phe Lys Pro Cys Glu His Leu Phe
Gly Ser Trp Leu Ile545 550 555
560Arg Ile Gly Val Trp Thr Thr Ala Val Leu Ala Leu Ser Cys Asn Ala
565 570 575Leu Val Ala Leu
Thr Val Phe Arg Thr Pro Leu Tyr Ile Ser Ser Ile 580
585 590Lys Leu Leu Ile Gly Val Ile Ala Val Val Asp
Ile Leu Met Gly Val 595 600 605Ser
Ser Ala Val Leu Ala Ala Val Asp Ala Phe Thr Phe Gly Arg Phe 610
615 620Ala Gln His Gly Ala Trp Trp Glu Asp Gly
Ile Gly Cys Gln Ile Val625 630 635
640Gly Phe Leu Ser Ile Phe Ala Ser Glu Ser Ser Ile Phe Leu Leu
Thr 645 650 655Leu Ala Ala
Leu Glu Arg Gly Phe Ser Val Lys Cys Ser Ser Lys Phe 660
665 670Glu Val Lys Ala Pro Leu Phe Ser Leu Arg
Ala Ile Val Leu Leu Cys 675 680
685Val Leu Leu Ala Leu Thr Ile Ala Thr Ile Pro Leu Leu Gly Gly Ser 690
695 700Lys Tyr Asn Ala Ser Pro Leu Cys
Leu Pro Leu Pro Phe Gly Glu Pro705 710
715 720Ser Thr Thr Gly Tyr Met Val Ala Leu Val Leu Leu
Asn Ser Leu Cys 725 730
735Phe Leu Ile Met Thr Ile Ala Tyr Thr Lys Leu Tyr Cys Ser Leu Glu
740 745 750Lys Gly Glu Leu Glu Asn
Leu Trp Asp Cys Ser Met Val Lys His Ile 755 760
765Ala Leu Leu Leu Phe Ala Asn Cys Ile Leu Tyr Cys Pro Val
Ala Phe 770 775 780Leu Ser Phe Ser Ser
Leu Leu Asn Leu Thr Phe Ile Ser Pro Asp Val785 790
795 800Ile Lys Phe Ile Leu Leu Val Ile Val Pro
Leu Pro Ser Cys Leu Asn 805 810
815Pro Leu Leu Tyr Ile Val Phe Asn Pro His Phe Lys Glu Asp Met Gly
820 825 830Ser Leu Gly Lys His
Thr Arg Phe Trp Met Arg Ser Lys His Ala Ser 835
840 845Leu Leu Ser Ile Asn Ser Asp Asp Val Glu Lys Arg
Ser Cys Glu Ser 850 855 860Thr Gln Ala
Leu Val Ser Phe Thr His Ala Ser Ile Ala Tyr Asp Leu865
870 875 880Pro Ser Thr Ser Gly Ala Ser
Pro Ala Tyr Pro Met Thr Glu Ser Cys 885
890 895His Leu Ser Ser Val Ala Phe Val Pro Cys Leu
900 90527886PRTMus musculus 27Gly Ser Ser Pro Gly Pro
Asp Ala Ile Pro Arg Gly Cys Pro Ser His1 5
10 15Cys His Cys Glu Leu Asp Gly Arg Met Leu Leu Arg
Val Asp Cys Ser 20 25 30Asp
Leu Gly Leu Ser Glu Leu Pro Ser Asn Leu Ser Val Phe Thr Ser 35
40 45Tyr Leu Asp Leu Ser Met Asn Asn Ile
Ser Gln Leu Pro Ala Ser Leu 50 55
60Leu His Arg Leu Cys Phe Leu Glu Glu Leu Arg Leu Ala Gly Asn Ala65
70 75 80Leu Thr His Ile Pro
Lys Gly Ala Phe Thr Gly Leu His Ser Leu Lys 85
90 95Val Leu Met Leu Gln Asn Asn Gln Leu Arg Gln
Val Pro Glu Glu Ala 100 105
110Leu Gln Asn Leu Arg Ser Leu Gln Ser Leu Arg Leu Asp Ala Asn His
115 120 125Ile Ser Tyr Val Pro Pro Ser
Cys Phe Ser Gly Leu His Ser Leu Arg 130 135
140His Leu Trp Leu Asp Asp Asn Ala Leu Thr Asp Val Pro Val Gln
Ala145 150 155 160Phe Arg
Ser Leu Ser Ala Leu Gln Ala Met Thr Leu Ala Leu Asn Lys
165 170 175Ile His His Ile Ala Asp Tyr
Ala Phe Gly Asn Leu Ser Ser Leu Val 180 185
190Val Leu His Leu His Asn Asn Arg Ile His Ser Leu Gly Lys
Lys Cys 195 200 205Phe Asp Gly Leu
His Ser Leu Glu Thr Leu Asp Leu Asn Tyr Asn Asn 210
215 220Leu Asp Glu Phe Pro Thr Ala Ile Lys Thr Leu Ser
Asn Leu Lys Glu225 230 235
240Leu Gly Phe His Ser Asn Asn Ile Arg Ser Ile Pro Glu Arg Ala Phe
245 250 255Val Gly Asn Pro Ser
Leu Ile Thr Ile His Phe Tyr Asp Asn Pro Ile 260
265 270Gln Phe Val Gly Val Ser Ala Phe Gln His Leu Pro
Glu Leu Arg Thr 275 280 285Leu Thr
Leu Asn Gly Ala Ser His Ile Thr Glu Phe Pro His Leu Thr 290
295 300Gly Thr Ala Thr Leu Glu Ser Leu Thr Leu Thr
Gly Ala Lys Ile Ser305 310 315
320Ser Leu Pro Gln Ala Val Cys Asp Gln Leu Pro Asn Leu Gln Val Leu
325 330 335Asp Leu Ser Tyr
Asn Leu Leu Glu Asp Leu Pro Ser Leu Ser Gly Cys 340
345 350Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn
Glu Ile Tyr Glu Ile 355 360 365Lys
Gly Ser Thr Phe Gln Gln Leu Phe Asn Leu Arg Ser Leu Asn Leu 370
375 380Ala Trp Asn Lys Ile Ala Ile Ile His Pro
Asn Ala Phe Ser Thr Leu385 390 395
400Pro Ser Leu Ile Lys Leu Asp Leu Ser Ser Asn Leu Leu Ser Ser
Phe 405 410 415Pro Val Thr
Gly Leu His Gly Leu Thr His Leu Lys Leu Thr Gly Asn 420
425 430Arg Ala Leu Gln Ser Leu Ile Pro Ser Ala
Asn Phe Pro Glu Leu Lys 435 440
445Ile Ile Glu Met Pro Ser Ala Tyr Gln Cys Cys Ala Phe Gly Gly Cys 450
455 460Glu Asn Val Tyr Lys Ile Ser Asn
Gln Trp Asn Lys Asp Asp Gly Asn465 470
475 480Ser Val Asp Asp Leu His Lys Lys Asp Ala Gly Leu
Phe Gln Val Gln 485 490
495Asp Glu Arg Asp Leu Glu Asp Phe Leu Leu Asp Phe Glu Glu Asp Leu
500 505 510Lys Ala Leu His Ser Val
Gln Cys Ser Pro Ser Pro Gly Pro Phe Lys 515 520
525Pro Cys Glu His Leu Phe Gly Ser Trp Leu Ile Arg Ile Gly
Val Trp 530 535 540Thr Thr Ala Val Leu
Ala Leu Ser Cys Asn Ala Leu Val Ala Leu Thr545 550
555 560Val Phe Arg Thr Pro Leu Tyr Ile Ser Ser
Ile Lys Leu Leu Ile Gly 565 570
575Val Ile Ala Val Val Asp Ile Leu Met Gly Val Ser Ser Ala Val Leu
580 585 590Ala Ala Val Asp Ala
Phe Thr Phe Gly Arg Phe Ala Gln His Gly Ala 595
600 605Trp Trp Glu Asp Gly Ile Gly Cys Gln Ile Val Gly
Phe Leu Ser Ile 610 615 620Phe Ala Ser
Glu Ser Ser Ile Phe Leu Leu Thr Leu Ala Ala Leu Glu625
630 635 640Arg Gly Phe Ser Val Lys Cys
Ser Ser Lys Phe Glu Val Lys Ala Pro 645
650 655Leu Phe Ser Leu Arg Ala Ile Val Leu Leu Cys Val
Leu Leu Ala Leu 660 665 670Thr
Ile Ala Thr Ile Pro Leu Leu Gly Gly Ser Lys Tyr Asn Ala Ser 675
680 685Pro Leu Cys Leu Pro Leu Pro Phe Gly
Glu Pro Ser Thr Thr Gly Tyr 690 695
700Met Val Ala Leu Val Leu Leu Asn Ser Leu Cys Phe Leu Ile Met Thr705
710 715 720Ile Ala Tyr Thr
Lys Leu Tyr Cys Ser Leu Glu Lys Gly Glu Leu Glu 725
730 735Asn Leu Trp Asp Cys Ser Met Val Lys His
Ile Ala Leu Leu Leu Phe 740 745
750Ala Asn Cys Ile Leu Tyr Cys Pro Val Ala Phe Leu Ser Phe Ser Ser
755 760 765Leu Leu Asn Leu Thr Phe Ile
Ser Pro Asp Val Ile Lys Phe Ile Leu 770 775
780Leu Val Ile Val Pro Leu Pro Ser Cys Leu Asn Pro Leu Leu Tyr
Ile785 790 795 800Val Phe
Asn Pro His Phe Lys Glu Asp Met Gly Ser Leu Gly Lys His
805 810 815Thr Arg Phe Trp Met Arg Ser
Lys His Ala Ser Leu Leu Ser Ile Asn 820 825
830Ser Asp Asp Val Glu Lys Arg Ser Cys Glu Ser Thr Gln Ala
Leu Val 835 840 845Ser Phe Thr His
Ala Ser Ile Ala Tyr Asp Leu Pro Ser Thr Ser Gly 850
855 860Ala Ser Pro Ala Tyr Pro Met Thr Glu Ser Cys His
Leu Ser Ser Val865 870 875
880Ala Phe Val Pro Cys Leu 88528112PRTMus musculus 28Asn
Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly1
5 10 15Gln Arg Ala Thr Ile Ser Cys
Arg Ala Ser Glu Ser Val Asp Asn Tyr 20 25
30Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln
Pro Pro 35 40 45Lys Leu Leu Ile
Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Ala 50 55
60Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu
Thr Ile Asp65 70 75
80Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Asn Tyr
85 90 95Glu Asp Pro Phe Thr Phe
Gly Ser Gly Thr Lys Val Glu Ile Lys Arg 100
105 11029118PRTMus musculus 29Gln Val Gln Leu Gln Gln Ser
Gly Thr Glu Leu Met Lys Pro Gly Ala1 5 10
15Ser Val Lys Ile Ser Cys Lys Ala Thr Gly Tyr Thr Phe
Ser Ala Tyr 20 25 30Trp Ile
Glu Trp Ile Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser Thr
Asp Tyr Asn Glu Lys Phe 50 55 60Lys
Val Lys Ala Thr Phe Ser Ser Asp Thr Ser Ser Asn Thr Val Tyr65
70 75 80Ile Gln Leu Asn Ser Leu
Thr Tyr Glu Asp Ser Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr Trp
Gly Gln Gly Thr 100 105 110Thr
Leu Lys Val Ser Ser 11530112PRTArtificial Sequencehu8E11.v1 light
chain variable region 30Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11031118PRTArtificial
Sequenceshu8E11.v1 heavy chain variable region 31Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11532112PRTArtificial Sequencehu8E11.v2
light chain variable region 32Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11033118PRTArtificial
Sequencehu8E11.v2 heavy chain variable region 33Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Ala Thr Phe Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11534112PRTArtificial Sequencehu8E11.v3
light chain variable region 34Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11035118PRTArtificial
Sequencehu8E11.v3 heavy chain variable region 35Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11536112PRTArtificial Sequencehu8E11.v4
light chain variable region 36Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11037118PRTArtificial
Sequencehu8E11.v4 heavy chain variable region 37Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Ala Thr Phe Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11538112PRTArtificial Sequencehu8E11.v5
light chain variable region 38Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11039118PRTArtificial
Sequencehu8E11.v5 heavy chain variable region 39Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Arg Asp Thr Ser Thr Ser Thr Ala Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11540112PRTArtificial Sequencehu8E11.v6
light chain variable region 40Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11041118PRTArtificial
Sequencehu8E11.v6 heavy chain variable region 41Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Ser Thr Ala Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11542112PRTArtificial Sequencehu8E11.v7
light chain variable region 42Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11043118PRTArtificial
Sequencehu8E11.v7 heavy chain variable region 43Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Arg Asp Thr Ser Thr Ser Thr Ala Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11544112PRTArtificial Sequencehu8E11.v8
light chain variable region 44Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro
Asp 50 55 60Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 11045118PRTArtificial
Sequencehu8E11.v8 heavy chain variable region 45Glu Val Gln Leu Val Gln
Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5
10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Ser Ala Tyr 20 25 30Trp
Ile Glu Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35
40 45Gly Glu Ile Leu Pro Gly Ser Asp Ser
Thr Asp Tyr Asn Glu Lys Phe 50 55
60Lys Val Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Ser Thr Ala Tyr65
70 75 80Leu Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Arg Gly Gly His Tyr Gly Ser Leu Asp Tyr
Trp Gly Gln Gly Thr 100 105
110Leu Val Thr Val Ser Ser 11546113PRTMus musculus 46Asp Val Val
Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5
10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser
Ser Gln Ser Leu Val His Ser 20 25
30Asn Gly Asn Thr Tyr Leu Gln Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45Pro Lys Leu Leu Ile Tyr Lys
Val Ser Asn Arg Phe Ser Gly Val Pro 50 55
60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65
70 75 80Ser Arg Val Glu
Ala Glu Asp Leu Gly Ile Tyr Phe Cys Ser Gln Ser 85
90 95Thr His Phe Pro Tyr Thr Phe Gly Gly Gly
Thr Lys Leu Glu Ile Lys 100 105
110Arg47115PRTMus musculus 47Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Met
Val Lys Pro Gly Ala1 5 10
15Ser Val Lys Leu Ser Cys Lys Ala Ser Val Asp Thr Phe Asn Ser Tyr
20 25 30Trp Met His Trp Val Lys Gln
Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40
45Gly Glu Ile Asn Pro Ser Asn Gly Arg Thr Asn Tyr Ile Glu Lys
Phe 50 55 60Lys Asn Arg Ala Thr Val
Thr Val Asp Lys Ser Ser Ser Thr Ala Phe65 70
75 80Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser
Ala Val Tyr Tyr Cys 85 90
95Ala Thr Gly Trp Tyr Phe Asp Val Trp Gly Ala Gly Thr Thr Val Thr
100 105 110Val Ser Ser
11548114PRTMus musculus 48Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr
Val Thr Ala Gly1 5 10
15Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser
20 25 30Gly Asn Gln Lys Asn Tyr Leu
Thr Trp Phe Gln Gln Lys Pro Gly Gln 35 40
45Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly
Val 50 55 60Pro Asp Arg Phe Thr Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70
75 80Ile Ser Asn Val Gln Ala Glu Asp Leu Ala Val
Tyr Tyr Cys Gln Asn 85 90
95Asp Tyr Ser Phe Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
100 105 110Lys Arg49121PRTMus
musculus 49Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly
Thr1 5 10 15Ser Met Lys
Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20
25 30Thr Met Asn Trp Val Lys Gln Ser His Lys
Asn Gly Leu Glu Trp Ile 35 40
45Gly Leu Ile Asn Cys Tyr Asn Gly Gly Thr Asn Tyr Asn Gln Lys Phe 50
55 60Lys Gly Lys Ala Thr Leu Thr Val Asp
Lys Ser Ser Ser Thr Ala Phe65 70 75
80Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95Ala Arg
Gly Gly Ser Thr Met Ile Thr Pro Arg Phe Ala Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser
115 12050108PRTHomo sapiens 50Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Val Ser Thr Ala 20 25
30Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Ser Ala Ser Phe Leu Tyr Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr
Tyr Tyr Cys Gln Gln Ser Tyr Thr Thr Pro Pro 85
90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
Arg 100 10551116PRTHomo sapiens 51Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Thr Ser Tyr 20 25
30Ser Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ala Glu Ile Tyr Pro Pro Gly
Gly Tyr Thr Asp Tyr Ala Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr65
70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Lys Ala Arg Leu Phe Phe Asp Tyr Trp
Gly Gln Gly Thr Leu Val 100 105
110Thr Val Ser Ser 1155215PRTMus musculus 52Arg Ala Ser Glu Ser
Val Asp Asn Tyr Gly Asn Ser Phe Met His1 5
10 15537PRTMus musculus 53Leu Ala Ser Asn Leu Glu Ser1
5549PRTMus musculus 54Gln Gln Asn Tyr Glu Asp Pro Phe Thr1
55510PRTMus musculus 55Gly Tyr Thr Phe Ser Ala Tyr Trp Ile
Glu1 5 105617PRTMus musculus 56Glu Ile
Leu Pro Gly Ser Asp Ser Thr Asp Tyr Asn Glu Lys Phe Lys1 5
10 15Val579PRTMus musculus 57Gly Gly
His Tyr Gly Ser Leu Asp Tyr1 55823PRTArtificial
SequenceHu8E11 light chain (LC) framework 1 (FR1) 58Asp Ile Val Met Thr
Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly1 5
10 15Glu Arg Ala Thr Ile Asn Cys
205915PRTArtificial SequenceHu8E11 LC FR2 59Trp Tyr Gln Gln Lys Pro Gly
Gln Pro Pro Lys Leu Leu Ile Tyr1 5 10
156032PRTArtificial SequenceHu8E11.v1 LC FR3; Hu8E11.v2 LC
FR3; Hu8E11.v5 LC FR3; Hu8E11.v6 LC FR3 60Gly Val Pro Asp Arg Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5
10 15Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala
Val Tyr Tyr Cys 20 25
306132PRTArtificial SequenceHu8E11.v3 LC FR3; Hu8E11.v4 LC FR3; Hu8E11.v7
LC FR3; Hu8E11.v8 LC FR3 61Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr1 5 10
15Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys
20 25 306211PRTArtificial
SequenceHu8E11 LC FR4 62Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg1
5 106325PRTArtificial SequenceHu8E11 heavy
chain (HC) framework1 (FR1) 63Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Ala Ser 20
256414PRTArtificial SequenceHu8E11 HC FR2 64Trp Val Arg Gln Ala Pro Gly
Gln Gly Leu Glu Trp Ile Gly1 5
106532PRTArtificial SequenceHu8E11.v1 HC FR3; Hu8E11.v3 HC FR3 65Arg Val
Thr Ile Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr Leu Glu1 5
10 15Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys Ala Arg 20 25
306632PRTArtificial SequenceHu8E11.v2 HC FR3; Hu8E11.v4 HC FR3
66Arg Ala Thr Phe Thr Ser Asp Thr Ser Thr Ser Thr Val Tyr Leu Glu1
5 10 15Leu Ser Ser Leu Arg Ser
Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg 20 25
306732PRTArtificial SequenceHu8E11.v5 HC FR3; Hu8E11.v7
HC FR3 67Arg Val Thr Ile Thr Arg Asp Thr Ser Thr Ser Thr Ala Tyr Leu Glu1
5 10 15Leu Ser Ser Leu
Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg 20
25 306832PRTArtificial SequenceHu8E11.v6 HC FR3;
Hu8E11.v8 HC FR3 68Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Ser Thr Ala
Tyr Leu Glu1 5 10 15Leu
Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg 20
25 306911PRTArtificial SequenceHu8E11
HC FR4 69Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser1 5
107016PRTMus musculus 70Arg Ser Ser Gln Ser Leu Val His Ser
Asn Gly Asn Thr Tyr Leu Gln1 5 10
15717PRTMus musculus 71Lys Val Ser Asn Arg Phe Ser1
5729PRTMus musculus 72Ser Gln Ser Thr His Phe Pro Tyr Thr1
57310PRTMus musculus 73Val Asp Thr Phe Asn Ser Tyr Trp Met His1
5 107417PRTMus musculus 74Glu Ile Asn Pro Ser Asn
Gly Arg Thr Asn Tyr Ile Glu Lys Phe Lys1 5
10 15Asn756PRTMus musculus 75Gly Trp Tyr Phe Asp Val1
57617PRTMus musculus 76Lys Ser Ser Gln Ser Leu Leu Asn Ser
Gly Asn Gln Lys Asn Tyr Leu1 5 10
15Thr777PRTMus musculus 77Trp Ala Ser Thr Arg Glu Ser1
5789PRTMus musculus 78Gln Asn Asp Tyr Ser Phe Pro Phe Thr1
57910PRTMus musculus 79Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn1
5 108017PRTMus musculus 80Leu Ile Asn Cys Tyr
Asn Gly Gly Thr Asn Tyr Asn Gln Lys Phe Lys1 5
10 15Gly8112PRTMus musculus 81Gly Gly Ser Thr Met
Ile Thr Pro Arg Phe Ala Tyr1 5
108211PRTHomo sapiens 82Arg Ala Ser Gln Asp Val Ser Thr Ala Val Ala1
5 10837PRTHomo sapiens 83Ser Ala Ser Phe Leu
Tyr Ser1 5849PRTHomo sapiens 84Gln Gln Ser Tyr Thr Thr Pro
Pro Thr1 58510PRTHomo sapiens 85Gly Phe Thr Phe Thr Ser Tyr
Ser Ile Ser1 5 108617PRTHomo sapiens
86Glu Ile Tyr Pro Pro Gly Gly Tyr Thr Asp Tyr Ala Asp Ser Val Lys1
5 10 15Gly877PRTHomo sapiens
87Ala Arg Leu Phe Phe Asp Tyr1 588218PRTArtificial
Sequencehu8E11.v2 light chain 88Asp Ile Val Met Thr Gln Ser Pro Asp Ser
Leu Ala Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr
20 25 30Gly Asn Ser Phe Met His
Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40
45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val
Pro Asp 50 55 60Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70
75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr
Tyr Cys Gln Gln Asn Tyr 85 90
95Glu Asp Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105 110Thr Val Ala Ala Pro
Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 115
120 125Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr 130 135 140Pro Arg Glu
Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser145
150 155 160Gly Asn Ser Gln Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr 165
170 175Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala
Asp Tyr Glu Lys 180 185 190His
Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 195
200 205Val Thr Lys Ser Phe Asn Arg Gly Glu
Cys 210 21589448PRTArtificial Sequencehu8E11.v2 heavy
chain 89Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Lys Val
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ala Tyr 20
25 30Trp Ile Glu Trp Val Arg Gln Ala Pro Gly Gln
Gly Leu Glu Trp Ile 35 40 45Gly
Glu Ile Leu Pro Gly Ser Asp Ser Thr Asp Tyr Asn Glu Lys Phe 50
55 60Lys Val Arg Ala Thr Phe Thr Ser Asp Thr
Ser Thr Ser Thr Val Tyr65 70 75
80Leu Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Gly
Gly His Tyr Gly Ser Leu Asp Tyr Trp Gly Gln Gly Thr 100
105 110Leu Val Thr Val Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro 115 120
125Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130
135 140Cys Leu Val Lys Asp Tyr Phe Pro
Glu Pro Val Thr Val Ser Trp Asn145 150
155 160Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro
Ala Val Leu Gln 165 170
175Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
180 185 190Ser Leu Gly Thr Gln Thr
Tyr Ile Cys Asn Val Asn His Lys Pro Ser 195 200
205Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp
Lys Thr 210 215 220His Thr Cys Pro Pro
Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser225 230
235 240Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser Arg 245 250
255Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
260 265 270Glu Val Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275
280 285Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val Val 290 295 300Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr305
310 315 320Lys Cys Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro Ile Glu Lys Thr 325
330 335Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr Thr Leu 340 345 350Pro
Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 355
360 365Leu Val Lys Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser 370 375
380Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp385
390 395 400Ser Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405
410 415Arg Trp Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His Glu Ala 420 425
430Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
435 440 44590214PRTHomo sapiens 90Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys
Arg Ala Ser Gln Asp Val Ser Thr Ala 20 25
30Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45Tyr Ser Ala Ser
Phe Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro65 70 75
80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Thr Thr Pro Pro
85 90 95Thr Phe Gly Gln Gly Thr
Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100
105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln
Leu Lys Ser Gly 115 120 125Thr Ala
Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130
135 140Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln
Ser Gly Asn Ser Gln145 150 155
160Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser
165 170 175Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180
185 190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser
Pro Val Thr Lys Ser 195 200 205Phe
Asn Arg Gly Glu Cys 21091446PRTHomo sapiens 91Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe Thr Ser Tyr 20 25 30Ser
Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45Ala Glu Ile Tyr Pro Pro Gly Gly Tyr
Thr Asp Tyr Ala Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr65
70 75 80Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95Ala Lys Ala Arg Leu Phe Phe Asp Tyr Trp Gly
Gln Gly Thr Leu Val 100 105
110Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala
115 120 125Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala Leu Gly Cys Leu 130 135
140Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser
Gly145 150 155 160Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser
165 170 175Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr Val Pro Ser Ser Ser Leu 180 185
190Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser
Asn Thr 195 200 205Lys Val Asp Lys
Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr 210
215 220Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
Pro Ser Val Phe225 230 235
240Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
245 250 255Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu Asp Pro Glu Val 260
265 270Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys Thr 275 280 285Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val 290
295 300Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys Glu Tyr Lys Cys305 310 315
320Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser
325 330 335Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 340
345 350Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser
Leu Thr Cys Leu Val 355 360 365Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 370
375 380Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro
Pro Val Leu Asp Ser Asp385 390 395
400Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg
Trp 405 410 415Gln Gln Gly
Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 420
425 430Asn His Tyr Thr Gln Lys Ser Leu Ser Leu
Ser Pro Gly Lys 435 440
4459220DNAArtificial SequenceAntisense forward primer 92accaactgca
tcctaaactg
209320DNAArtificial SequenceAntisense reverse primer 93accgagtttc
acctcagctc
209440DNAArtificial SequenceSense forward primer 94acattgccct gttgctcttc
acattgccct gttgctcttc 409521DNAArtificial
SequenceSense reverse primer 95actgctctga tatactcaat c
2196770PRTArtificial SequenceLgR5 ECD huFc (1
to 537 are LgR5 ECD) 96Gly Ser Ser Pro Arg Ser Gly Val Leu Leu Arg Gly
Cys Pro Thr His1 5 10
15Cys His Cys Glu Pro Asp Gly Arg Met Leu Leu Arg Val Asp Cys Ser
20 25 30Asp Leu Gly Leu Ser Glu Leu
Pro Ser Asn Leu Ser Val Phe Thr Ser 35 40
45Tyr Leu Asp Leu Ser Met Asn Asn Ile Ser Gln Leu Leu Pro Asn
Pro 50 55 60Leu Pro Ser Leu Arg Phe
Leu Glu Glu Leu Arg Leu Ala Gly Asn Ala65 70
75 80Leu Thr Tyr Ile Pro Lys Gly Ala Phe Thr Gly
Leu Tyr Ser Leu Lys 85 90
95Val Leu Met Leu Gln Asn Asn Gln Leu Arg His Val Pro Thr Glu Ala
100 105 110Leu Gln Asn Leu Arg Ser
Leu Gln Ser Leu Arg Leu Asp Ala Asn His 115 120
125Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly Leu His Ser
Leu Arg 130 135 140His Leu Trp Leu Asp
Asp Asn Ala Leu Thr Glu Ile Pro Val Gln Ala145 150
155 160Phe Arg Ser Leu Ser Ala Leu Gln Ala Met
Thr Leu Ala Leu Asn Lys 165 170
175Ile His His Ile Pro Asp Tyr Ala Phe Gly Asn Leu Ser Ser Leu Val
180 185 190Val Leu His Leu His
Asn Asn Arg Ile His Ser Leu Gly Lys Lys Cys 195
200 205Phe Asp Gly Leu His Ser Leu Glu Thr Leu Asp Leu
Asn Tyr Asn Asn 210 215 220Leu Asp Glu
Phe Pro Thr Ala Ile Arg Thr Leu Ser Asn Leu Lys Glu225
230 235 240Leu Gly Phe His Ser Asn Asn
Ile Arg Ser Ile Pro Glu Lys Ala Phe 245
250 255Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe Tyr
Asp Asn Pro Ile 260 265 270Gln
Phe Val Gly Arg Ser Ala Phe Gln His Leu Pro Glu Leu Arg Thr 275
280 285Leu Thr Leu Asn Gly Ala Ser Gln Ile
Thr Glu Phe Pro Asp Leu Thr 290 295
300Gly Thr Ala Asn Leu Glu Ser Leu Thr Leu Thr Gly Ala Gln Ile Ser305
310 315 320Ser Leu Pro Gln
Thr Val Cys Asn Gln Leu Pro Asn Leu Gln Val Leu 325
330 335Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu
Pro Ser Phe Ser Val Cys 340 345
350Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn Glu Ile Tyr Glu Ile
355 360 365Lys Val Asp Thr Phe Gln Gln
Leu Leu Ser Leu Arg Ser Leu Asn Leu 370 375
380Ala Trp Asn Lys Ile Ala Ile Ile His Pro Asn Ala Phe Ser Thr
Leu385 390 395 400Pro Ser
Leu Ile Lys Leu Asp Leu Ser Ser Asn Leu Leu Ser Ser Phe
405 410 415Pro Ile Thr Gly Leu His Gly
Leu Thr His Leu Lys Leu Thr Gly Asn 420 425
430His Ala Leu Gln Ser Leu Ile Ser Ser Glu Asn Phe Pro Glu
Leu Lys 435 440 445Val Ile Glu Met
Pro Tyr Ala Tyr Gln Cys Cys Ala Phe Gly Val Cys 450
455 460Glu Asn Ala Tyr Lys Ile Ser Asn Gln Trp Asn Lys
Gly Asp Asn Ser465 470 475
480Ser Met Asp Asp Leu His Lys Lys Asp Ala Gly Met Phe Gln Ala Gln
485 490 495Asp Glu Arg Asp Leu
Glu Asp Phe Leu Leu Asp Phe Glu Glu Asp Leu 500
505 510Lys Ala Leu His Ser Val Gln Cys Ser Pro Ser Pro
Gly Pro Phe Lys 515 520 525Pro Cys
Glu His Leu Leu Asp Gly Trp Gly Arg Ala Gln Val Thr Asp 530
535 540Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro
Glu Leu Leu Gly Gly545 550 555
560Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile
565 570 575Ser Arg Thr Pro
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 580
585 590Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val His 595 600 605Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 610
615 620Val Val Ser Val Leu Thr Val Leu His Gln
Asp Trp Leu Asn Gly Lys625 630 635
640Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 645 650 655Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 660
665 670Thr Leu Pro Pro Ser Arg Glu Glu Met Thr
Lys Asn Gln Val Ser Leu 675 680
685Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 690
695 700Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val705 710
715 720Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys
Leu Thr Val Asp 725 730
735Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His
740 745 750Glu Ala Leu His Asn His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 755 760
765Gly Lys 770
User Contributions:
Comment about this patent or add new information about this topic: