CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES, ENCODING NUCLEIC ACID MOLECULES AND USES THEREOF

Abstract

Provided are cytochrome P450 polypeptides, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides. Also provided are nucleic acid molecules encoding the cytochrome P450 polypeptides. Cells containing the nucleic acids and/or the polypeptides are provided as are methods for producing terpenes, such as santalols and bergamotols, by culturing the cells.

Description

RELATED APPLICATIONS

[0001] Benefit of priority is claimed to U.S. Provisional Application Ser. No. 61/796,129, filed Nov. 1, 2012, entitled "CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES, ENCODING NUCLEIC ACID MOLECULES AND USES THEREOF" and to U.S. Provisional Application Ser. No. 61/956,086, filed May 31, 2013, entitled "CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES, ENCODING NUCLEIC ACID MOLECULES AND USES THEREOF." The subject matter of each of the above-noted applications is incorporated by reference in its entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ELECTRONICALLY

[0002] An electronic version of the Sequence Listing is filed herewith, the contents of which are incorporated by reference in their entirety. The electronic file is 301 kilobytes in size, and titled 229SEQPC1.txt.

FIELD OF THE INVENTION

[0003] Provided are cytochrome P450 santalene oxidases, cytochrome P450 bergamotene oxidases and cytochrome P450 reductases, nucleic acid molecules encoding the P450 santalene oxidases, cytochrome P450 bergamotene oxidases and cytochrome P450 reductases, and methods for producing products whose synthesis includes reactions catalyzed by the cytochrome P450 santalene and bergamotene oxidases. Included among the products are santalols and bergamotols and precursors and derivatives thereof.

BACKGROUND

[0004] Sandalwood (Santalum album) is a slow-growing hemi-parasitic tropical tree of great economic value found growing in southern India, Sri Lanka, eastern Indonesia and northern Australia. The timber is highly sought after for its fine grain, high density and excellent carving properties. Sandalwood heartwood has a unique fragrance imparted by the resins and essential oils, including santalols, santalenes and other sesquiterpenoids, in the heartwood. In general, Santalum album heartwood contains up to 6% dry weight sesquiterpene oils. Sandalwood oil predominantly contains the sesquiterpene alcohols .alpha.-santalol, .beta.-santalol, Z-.alpha.-trans-bergamotol and epi-.beta.-santalol, and additionally includes .alpha.-santalene, .beta.-santalene, .alpha.-bergamotene, epi-.beta.-santalene, .beta.-bisabolene, .alpha.-curcumene, .beta.-curcumene and .gamma.-curcumene. Sandalwood oil has a soft, sweet-woody and animal-balsamic odor that is imparted from the terpenoid .beta.-santalol and is highly valued. Sandalwood oil has been obtained by distillation of the heartwood of Santalum species and is used as a perfume ingredient, in incenses and traditional medicine and in pesticides.

[0005] Centuries of over-exploitation has led to the demise of sandalwood in natural stands. Large plantations are being established throughout northern Australia to satisfy demand and conserve remaining reserves. In addition, there is great variation in the amount of heartwood oil produced, even under near-identical growing conditions, due to genetic and environmental factors, such as climate and local conditions. Generally, the price and availability of plant natural extracts depend upon the abundance, oil yield and geographical origins of the plants.

[0006] Although chemical approaches to generate santalols and the other sesquiterpenoids in sandalwood oil have been attempted, the highly complex structures of these compounds have rendered economically viable synthetic processes for their preparation in large quantities unattainable. Thus, there is a need for efficient, cost-effective syntheses of santalols and other sesquiterpenoids that impart the highly sought after sandalwood fragrance for use in the fragrance industry.

[0007] Thus, among the objects herein, is the provision of methods for the production of santalols and other sesquiterpenoids and the resulting products of the methods.

SUMMARY

[0008] Provided herein are nucleic acid molecules encoding cytochrome P450 polypeptides or catalytically active fragments thereof and the encoded polypeptides, and host cells containing such nucleic acid molecules or encoded polypeptides. For example, the encoded cytochrome P450 polypeptide or catalytically active fragment or portion thereof exhibits at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO:50, such as at least 90% sequence identity to SEQ ID NO:50. Also provided are nucleic acid molecules encoding cytochrome P450 reductase polypeptides or catalytically active fragments thereof and the encoded polypeptides, and host cells containing such nucleic acid molecules or encoded polypeptides. For example, the encoded cytochrome reductase polypeptide or catalytically active fragment thereof exhibits at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13, such as at least 90% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13. Any of the nucleic acid molecules provided herein can be cDNA or can be an isolated or purified nucleic acid molecule. Among the nucleic acid molecules and polypeptides provided herein are a set of CYP450s that exhibit santalene/bergamotene oxidase activity, which provide for, among other things, metabolic engineering of sandalwood oil biosynthesis, improvement of sandalwood plantations, and conservation of native sandalwood forests.

[0009] In particular, among the host cells provided herein are host cells that are engineered to contain heterologous nucleic acid encoding any of the cytochrome P450 polypeptides provided herein, whereby the host cells are capable of producing one or more of .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene, epi-.beta.-santalol from epi-.beta.-santalene and .alpha.-trans-bergamotol from .alpha.-trans-bergamotene, such as one or more of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol or (E)-.alpha.-trans-bergamotol. For example, the host cells are also engineered to also contain a santalene synthase as described herein to produce a santalene and/or bergamotene terpene substrate of the encoded cytochrome P450 polypeptide. The host cells also can be engineered to also contain heterologous nucleic acid encoding a cytochrome P450 reductase, such as any provided herein. The host cells is a prokaryotic cell or an eukaryotic cell, such as a bacteria, yeast, insect, plant or mammalian cell. For example, the host cell is a Saccharomyces genus cell, a Pichia genus cell or an Escherichia coli cell. In particular examples herein, the host cell is a Saccharomyces cerevisiae cell. The host cell produces or is modified to produce or overexpress an acyclic pyrophosphate terpene precursor, such as farnesyl diphosphate.

[0010] For example, provided herein are isolated Santalum album cytochrome P450 polypeptides or catalytically active fragments thereof, including cytochrome P450 santalene oxidases or catalytically active fragments thereof and cytochrome P450 bergamotene oxidases or catalytically active fragments thereof. Also provided herein are nucleic acid molecules encoding the cytochrome P450 santalene oxidases and cytochrome P450 bergamotene oxidases or catalytically active fragments thereof. Also provided are modified forms thereof.

[0011] Also provided are nucleic acid molecules encoding cytochrome P450 reductase polypeptides, including modified cytochrome P450 reductase polypeptides. Provided herein are isolated Santalum album cytochrome P450 reductase polypeptides, and host cells containing the polypeptides, where the polypeptides are heterologous to the host cell. Provided are nucleic acid molecules encoding a fusion protein containing a cytochrome P450 enzyme and a second moiety such as a synthase or catalytically active portion thereof.

[0012] Also provided are nucleic acid molecules encoding fusion proteins containing a Santalum album santalene synthase and/or a cytochrome P450 santalene oxidase or bergamotene oxidase and/or a cytochrome P450 reductase, or catalytically active fragments of any of the enzymes. Exemplary of the nucleic acid molecules encoding fusion proteins are nucleic acid molecules encoding a fusion protein containing: a santalene synthase and a cytochrome P450 santalene oxidase; a santalene synthase and a bergamotene oxidase; a cytochrome P450 santalene oxidase and a cytochrome P450 reductase; and a cytochrome P450 bergamotene oxidase and a cytochrome P450 reductase or catalytically active fragments of any the preceding enzymes. The encoded proteins and host cells containing the nucleic acids and/or the proteins are provided.

[0013] Also provided herein are methods for producing any of the encoded cytochrome P450 polypeptides or catalytically active fragments thereof, including methods for producing a cytochrome P450 reductase polypeptide. Also provided herein are methods for production of a santalol, bergamotol and/or mixtures thereof by contacting the cytochrome P450 santalene oxidases and/or cytochrome P450 bergamotene oxidases with a substrate therefor from which these products are produced. The methods can be performed in vitro with isolated reagents or partially isolated reagents or in vivo in a host cell that encodes the enzymes, and optionally a synthase and/or other substrate.

[0014] For example, provided herein are isolated Santalum album cytochrome P450 santalene oxidases or catalytically active fragments thereof. The provided isolated Santalum album cytochrome P450 santalene oxidases catalyze the hydroxylation or monooxygenation of santalene and/or bergamotene. In one example, the provided isolated Santalum album cytochrome P450 santalene oxidases catalyze the formation of a santalol from a santalene and/or a bergamotol from a bergamotene. For example, the isolated Santalum album cytochrome P450 santalene oxidases catalyze the formation of .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene, epi-.beta.-santalol from epi-.beta.-santalene and/or Z-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. For example, the isolated Santalum album cytochrome P450 santalene oxidases catalyze the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol or (E)-.alpha.-trans-bergamotol. Also provided herein are isolated cytochrome P450 santalene oxidases that are members of the CYP76 family.

[0015] Provided herein are isolated nucleic acid molecules encoding a Santalum album cytochrome P450 santalene oxidase polypeptide or a catalytically active fragment thereof. For example, provided herein are isolated nucleic acid molecules (and host cells containing the nucleic acid molecules, which are heterologous to the host cells) encoding a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NO:7, 74, 75, 76 or 77; or a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids that has at least 96% sequence identity to a cytochrome P450 santalene oxidase whose sequence is set forth in SEQ ID NO:7, 74, 75, 76 or 77. In another example provided herein are isolated nucleic acid molecules encoding a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids that has at least 50% sequence identity to a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO:7, 74, 75, 76 or 77. The cytochrome P450 santalene oxidase polypeptide catalyzes the hydroxylation or monooxygenation of santalene and/or bergamotene. For example, the encoded cytochrome P450 santalene oxidase polypeptide exhibits at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a sequence of amino acids set forth in SEQ ID NO:7, 74, 75, 76 or 77.

[0016] Also provided herein are isolated nucleic acid molecules encoding a cytochrome P450 santalene oxidase or a catalytically active fragment thereof selected from among nucleic acid molecules having a sequence of nucleic acids set forth in SEQ ID NO:3, 68, 69, 70 or 71; a sequence of nucleic acids having at least 98% sequence identity to a sequence of nucleic acids set forth in SEQ ID NO:3, 68, 69, 70 or 71; and degenerates thereof. In a particular example, the isolated nucleic acid molecule has the sequence of nucleotides set forth SEQ ID NO:3, 68, 69, 70 or 71. In some examples, the isolated nucleic acid molecules encode a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NO:7, 74, 75, 76 or 77. The provided isolated nucleic acid molecules encode cytochrome P450 santalene oxidase polypeptides that catalyze the formation of a santalol, such as a .alpha.-santalol, .beta.-santalol or epi-.beta.-santalol, from a santalene, such as a .alpha.-santalene, .beta.-santalene or epi-.beta.-santalene, and/or catalyze the hydroxylation or monooxygenation of santalene. In some examples, the encoded cytochrome P450 santalene oxidase polypeptide catalyzes the formation of Z-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. Also provided herein are cytochrome P450 santalene oxidase polypeptides encoded by any of the isolated nucleic acid molecules provided herein.

[0017] For example, provided herein are isolated Santalum album cytochrome P450 bergamotene oxidases or catalytically active fragments thereof. The provided isolated Santalum album cytochrome P450 bergamotene oxidases or catalytically active fragments thereof catalyze the hydroxylation or monooxygenation of bergamotene and/or catalyze the formation of a bergamotol from a bergamotene. For example, the isolated Santalum album cytochrome P450 bergamotene oxidases catalyze the formation of Z-.alpha.-trans-bergamotol or (E)-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. In some examples, the isolated Santalum album cytochrome P450 bergamotene oxidases do not catalyze the hydroxylation of a santalene. In other examples, the isolated Santalum album cytochrome P450 bergamotene oxidases catalyze the hydroxylation of a santalene. Also provided herein are isolated Santalum album cytochrome P450 bergamotene oxidases that are members of the CYP76 family.

[0018] Provided herein are isolated nucleic acid molecules encoding a Santalum album cytochrome P450 bergamotene oxidase polypeptide or a catalytically active fragment thereof. For example, provided herein are isolated nucleic acid molecules encoding a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 or 73; or a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids that has at least 96% sequence identity to a cytochrome P450 polypeptide set forth in SEQ ID NO:6, 8, 9 or 73. In another example, provided herein are isolated nucleic acid molecules encoding a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids that has at least 50% sequence identity to a cytochrome P450 bergamotene oxidase polypeptide set forth in SEQ ID NO:6, 8, 9 or 73. The cytochrome P450 bergamotene oxidase polypeptide catalyzes the hydroxylation or monooxygenation of bergamotene. For example, the encoded cytochrome P450 bergamotene oxidase polypeptide exhibits at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 or 73.

[0019] Also provided herein are isolated nucleic acid molecules encoding a cytochrome P450 bergamotene oxidase polypeptide or a catalytically active fragment thereof having a sequence of nucleic acids set forth in any of SEQ ID NOS:2, 4, 5 or 67; a sequence of nucleic acids having at least 98% sequence identity to a sequence of nucleic acids set forth in any of SEQ ID NOS: 2, 4, 5 or 67; and degenerates thereof. In a particular example, the isolated nucleic acid molecule has sequence of nucleic acids set forth in SEQ ID NO:2, 4, 5 or 67. In some examples, the isolated nucleic acid molecule encodes a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 or 73. The provided isolated nucleic acid molecules encode a cytochrome P450 bergamotene oxidase polypeptide that catalyzes the formation of a bergamotol, such as Z-.alpha.-trans-bergamotol, from a bergamotene, such as .alpha.-trans-bergamotene, and/or catalyzes the hydroxylation or monooxygenation of bergamotene, such as .alpha.-trans-bergamotene. In some examples, the encoded cytochrome P450 bergamotene oxidase does not catalyze the hydroxylation of a santalene. Also provided herein are cytochrome P450 bergamotene oxidase polypeptides encoded by any of the isolated nucleic acid molecules provided herein.

[0020] Also provided herein are isolated nucleic acid molecules encoding a Santalum album cytochrome P450 polypeptide or catalytically active fragments thereof having a sequence of nucleic acids set forth in SEQ ID NO:1 or 72; a sequence of nucleic acids having at least 99% sequence identity to a sequence of nucleic acids set forth in SEQ ID NO:1 or 72; and degenerates thereof. Also provided herein are isolated nucleic acid molecules encoding a cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:50 or 78; or having a sequence of amino acids having at least 99% sequence identity to the sequence of amino acids set forth in SEQ ID NO:50 or 78. Also provided herein are Santalum album cytochrome P450 polypeptides encoded by any of the isolated nucleic acid molecules provided herein.

[0021] Also provided herein are nucleic acid molecules encoding a cytochrome P450 polypeptide or catalytically active fragments thereof having one or more heterologous domains or portions thereof from one or more cytochrome P450s. The domain is selected from among helix A, .beta. strand 1-1, .beta. strand 1-2, helix B, .beta. strand 1-5, helix B', helix C, helix D, .beta. strand 3-1, helix E, helix F, helix G, helix H, .beta. strand 5-1, .beta. strand 5-2, helix I, helix J, helix J', helix K, .beta. strand 1-4, .beta. strand 2-1, .beta. strand 2-2, .beta. strand 1-3, Heme domain, helix L, .beta. strand 3-3, .beta. strand 4-1, .beta. strand 4-2 and .beta. strand 3-2. In some examples, the heterologous domain or a contiguous portion thereof replaces all or a contiguous portion of the corresponding native domain of the cytochrome P450 polypeptide not containing the heterologous domain. For example, the encoded modified cytochrome P450 polypeptide contains all of a heterologous domain of a different cytochrome P450. In other examples, the encoded modified cytochrome P450 polypeptide has at least 50%, 60%, 70%, 80%, 90%, or 95% of contiguous amino acids of a heterologous domain from one or more different cytochrome P450s.

[0022] Provided herein are isolated Santalum album cytochrome P450 reductases or catalytically active fragments thereof. For example, provided herein are isolated Santalum album cytochrome P450 reductases that catalyze the transfer of two electrons from NADPH to an electron acceptor, that is a cytochrome P450, heme oxygenase, cytochrome b.sub.5 or squalene epoxidase. In particular examples, the electron acceptor is a cytochrome P450.

[0023] Also provided herein are isolated nucleic acid molecules encoding a Santalum album cytochrome P450 reductase polypeptide or catalytically active fragments thereof. For example, provided herein are isolated nucleic acid molecules encoding a cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12 or 13; or encoding a cytochrome P450 reductase polypeptide having a sequence of amino acids that has at least 80% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13. In another example, provided herein is an isolated nucleic acid molecule encoding a cytochrome P450 reductase polypeptide that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a sequence of amino acids set forth in SEQ ID NO:12 or 13.

[0024] Also provided herein are isolated nucleic acid molecule having a sequence of nucleic acids set forth in SEQ ID NO:10 or 11; a sequence of nucleic acids having at least 95% sequence identity to a sequence of nucleic acids set forth in SEQ ID NO:10 or 11; and degenerates thereof. For example, provided herein is are isolated nucleic acid molecules having a sequence of nucleic acids set forth in SEQ ID NO:10 or 11. In some examples, the isolated nucleic acid molecules of encode cytochrome P405 reductase polypeptides having a sequence of amino acids that has at least 95% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13. In a particular example, the isolated nucleic acid molecule encodes a cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12 or 13. The provided nucleic acid molecules encode a cytochrome P450 reductase polypeptides catalyze the transfer of two electrons from NADPH to an electron acceptor, such as a cytochrome P450, heme oxygenase, cytochrome b.sub.5 or squalene epoxidase. In a particular example, the electron acceptor is a cytochrome P450. Also provided herein are cytochrome P450 reductase polypeptides encoded by the nucleic acid molecules.

[0025] Also provided herein are nucleic acid molecule encoding a modified Santalum album cytochrome P450 reductase polypeptide or catalytically active fragments thereof. For example, provided here are nucleic acid molecules encoding modified cytochrome P450 reductase polypeptides that contain at least one amino acid replacement, addition or deletion compared to the cytochrome P450 reductase polypeptide not containing the modification. In some examples, the encoded modified cytochrome P450 reductase polypeptide is N- or C-terminally truncated. For example, provide herein are nucleic acid molecules encoding a modified cytochrome P450 reductase polypeptide that is N-terminally truncated. For example, the nucleic acid molecule encodes a modified cytochrome P450 reductase polypeptide that has a sequence of amino acids set forth in SEQ ID NO:14 or 15; or has a sequence of amino acids that is at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:14 or 15. Also provided herein are nucleic acid molecules having a sequence of nucleic acids set forth in SEQ ID NO:63 or 64; a sequence of nucleic acids having at least 95% sequence identity to a sequence of nucleic acids set forth in SEQ ID NO:63 or 64; and degenerates thereof. The provided nucleic acid molecules encode a cytochrome P450 reductase polypeptides catalyze the transfer of two electrons from NADPH to an electron acceptor, such as a cytochrome P450, heme oxygenase, cytochrome b.sub.5 or squalene epoxidase. In a particular example, the electron acceptor is a cytochrome P450. Also provided herein are cytochrome P450 reductase polypeptides encoded by the nucleic acid molecules.

[0026] Provided herein are nucleic acid molecules encoding a fusion protein containing a Santalum album santalene synthase or a catalytically active fragment thereof and/or a cytochrome P450 santalene oxidase or bergamotene oxidase or a catalytically active fragment thereof and/or a cytochrome P450 reductase or a catalytically active fragment thereof.

[0027] Provided herein are nucleic acid molecules encoding a fusion protein containing santalene synthase and a cytochrome P450 santalene oxidase or a catalytically active fragment thereof. The full-length santalene synthase is encoded by a sequence of nucleotides set forth in any of SEQ ID NOS:58-60 and the cytochrome P450 santalene oxidase is encoded b any nucleic acid molecule provided herein that encodes a cytochrome P450 santalene oxidase. In another example, provided herein are nucleic acid molecules encoding a santalene synthase and a cytochrome P450 santalene oxidase,. The santalene synthase has a sequence of amino acids set forth in any of SEQ ID NOS: 17, 52 and 53, and the cytochrome P450 santalene oxidase has a sequence of amino acids set forth in any of SEQ ID NOS:7, 73, 74, 75 and 76.

[0028] Provided herein are nucleic acid molecules encoding a fusion protein containing santalene synthase and a cytochrome P450 bergamotene oxidase or a catalytically active fragment thereof. The santalene synthase has a sequence of nucleotides set forth in any of SEQ ID NOS:58-60 and the cytochrome P450 bergamotene oxidase is any nucleic acid molecule provided herein that encodes a cytochrome P450 bergamotene oxidase. In another example, provided herein are nucleic acid molecules encoding a santalene synthase and a cytochrome P450 bergamotene oxidase. The santalene synthase has a sequence of amino acids set forth in any of SEQ ID NOS: 17, 52 and 53 and the cytochrome P450 bergamotene oxidase has a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 and 73.

[0029] Provided herein are nucleic acid molecules encoding a fusion protein containing a cytochrome P450 or a catalytically active fragment thereof and a cytochrome P450 reductase or a catalytically active fragment thereof, where the cytochrome P450 is any nucleic acid molecule provided herein that encodes a cytochrome P450 oxidase and the cytochrome P450 reductase is any nucleic acid molecule provided herein that encodes a cytochrome P450 reductase. For example, provided herein are nucleic acid molecules encoding a cytochrome P450 that has a sequence of amino acids set forth in any of SEQ ID NOS:6-9 and 73-78 and a cytochrome P450 reductase that has a sequence of amino acids set forth in any of SEQ ID NOS:12-15.

[0030] In some examples, in the nucleic acid molecules provided herein encoding a fusion protein, the santalene synthase and/or cytochrome P450 santalene oxidase or bergamotene oxidase and/or cytochrome P450 reductase are linked directly. In other examples, in the nucleic acid molecules provided herein encoding a fusion protein, the santalene synthase and/or cytochrome P450 santalene oxidase or bergamotene oxidase and/or cytochrome P450 reductase are linked via a linker.

[0031] Also provided herein are vectors containing any nucleic acid molecule provided herein, including nucleic acid molecules encoding cytochrome P450s, such as santalene oxidases and bergamotene oxidases, cytochrome P450 reductases, modified cytochrome P450 reductases and fusion proteins. In some examples, the vector is a prokaryotic vector, a viral vector, or an eukaryotic vector. For example, the vector is a yeast vector. Also provided herein are cells containing any vector provided herein. Also provided herein are cells containing any nucleic acid molecule provided herein, including nucleic acid molecules encoding cytochrome P450s, such as santalene oxidases and bergamotene oxidases, cytochrome P450 reductases, modified cytochrome P450 reductases and fusion proteins. In some examples, the cell is a prokaryotic cell or an eukaryotic cell. In other examples, the cells is selected from among a bacteria, yeast, insect, plant or mammalian cell. In an example, the cell is a yeast cell. Included among yeast cells is a Saccharomyces genus cell and a Pichia genus cell. For example, the cell is a Saccharomyces cerevisiae cell. In another example, the cell is an Escherichia coli cell. Thus, provided are of recombinant cells, including yeast cells, for production of santalols and bergamotol.

[0032] The cells can include nucleic acid encoding a synthase, such as santalene synthase, such as a Santalum album synthase, to catalyze production of a substrate for the P450 enzymes provided herein.

[0033] Also provided herein are cells that express a cytochrome P450 santalene oxidase polypeptide, a cytochrome P450 bergamotene oxidase polypeptide, a cytochrome P450 reductase polypeptide and/or a fusion protein containing a Santalum album santalene synthase and/or a cytochrome P450 santalene oxidase or bergamotene synthase and/or a cytochrome P450 reductase. Also provided herein are transgenic plants containing any vector provided herein. In some examples, the transgenic plant is a tobacco plant.

[0034] Provided herein are methods for producing a cytochrome P450 polypeptide, by: introducing a nucleic acid molecule provided herein that encodes a cytochrome P450 polypeptide or any vector provided herein that encodes a cytochrome P450 polypeptide into a cell; culturing the cell under conditions suitable for expression of the cytochrome P450 polypeptide encoded by the nucleic acid or vector; and, optionally isolating the cytochrome P450 polypeptide.

[0035] Provided herein are methods for producing a cytochrome P450 reductase polypeptide, by: introducing a nucleic acid molecule provided herein that encodes a cytochrome P450 reductase polypeptide or any vector provided herein that encodes a cytochrome P450 reductase polypeptide into a cell; culturing the cell under conditions suitable for expression of the cytochrome P450 reductase polypeptide encoded by the nucleic acid or vector; and, optionally isolating the cytochrome P450 reductase polypeptide.

[0036] Provided herein are methods for production of a santalol, bergamotol and/or mixtures thereof, by: (a) contacting a santalene and/or bergamotene with a cytochrome P450 santalene oxidase or bergamotene oxidase under conditions suitable for the formation of a santalol, bergamotol and/or mixtures thereof; and (b) optionally isolating the santalol, bergamotol and/or mixtures thereof. In some examples, step (a) is effected in vitro or in vivo. For example, step (a) is effected in vivo in a cell transformed with a nucleic acid molecule or vector encoding a cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide, whereby the cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide encoded by the nucleic acid molecule or vector is expressed; and the cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide catalyzes the formation of santalol and/or bergamotol from santalene and/or bergamotene.

[0037] Provided herein is a host cell containing a nucleic acid molecule encoding a cytochrome P450 or cytochrome P450 polypeptide provided herein. The nucleic acid molecule and cytochrome P450 polypeptide is heterologous to the cell. In some examples, the host cell further contains nucleic acid encoding a synthase that produces a terpene substrate of a cytochrome P450. In some examples, the synthase is heterologous to the host cell. In particular examples, the terpene synthase is a santalene synthase, such as a terpene synthase that catalyzes the formation of santalene and/or bergamotene. For example, the terpene synthase has a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 and 53 or a sequence of amino acids that is at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any of SEQ ID NOS:17, 52 and 53. In some examples, the host cell is a prokaryotic cell or an eukaryotic cell that is selected from among a bacteria, yeast, insect, plant or mammalian cell. In a particular example, the host cell is a yeast cell that is a Saccharomyces genus cell or a Pichia genus cell. For example, the host cell is a Saccharomyces cerevisiae cell. In other examples, the host cell is an Escherichia coli cell. In some examples, the host cell produces an acyclic pyrophosphate terpene precursor, such as farnesyl diphosphate. In particular examples, the host cell produces farnesyl diphosphate natively or is modified to produce more farnesyl diphosphate compared to an unmodified cell. Also provided herein is a method for production of a santalol, bergamotol and/or mixtures thereof, said method including the steps of culturing any of the host cell provided herein under conditions suitable for the formation of a santalol, bergamotol and/or mixtures thereof; and optionally isolating the santalol, bergamotol and/or mixtures thereof.

[0038] Provided herein are methods for production of a santalol, bergamotol and/or mixtures thereof, by: (a) contacting an acyclic pyrophosphate terpene precursor with a santalene synthase under conditions suitable for the formation of a santalene and/or bergamotene; (b) contacting the resulting santalene and/or bergamotene with a cytochrome P450 santalene oxidase or bergamotene oxidase under conditions suitable for the formation of a santalol, bergamotol and/or mixture thereof to produce a santalol, bergamotol or mixture thereof; and (c) optionally isolating the santalene and bergamotene produced in step (a) or the santalol, bergamotol, and/or mixtures thereof produced in step (b). In some examples, step (a) and/or step (b) is/are performed in vitro or in vivo. For example, step (a) is performed in vivo in a cell transformed with a nucleic acid molecule encoding a santalene synthase, whereby the santalene synthase encoded by the nucleic acid molecule is expressed; and the santalene synthase catalyzes the formation of santalene and bergamotene from the acyclic pyrophosphate terpene precursor; and/or step (b) is effected in vivo in a cell transformed with a nucleic acid molecule or vector encoding a cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide, whereby the cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide encoded by the nucleic acid molecule or vector is expressed; and the cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide catalyzes the formation of santalol and/or bergamotol from santalene and/or bergamotene. In such examples, the acyclic pyrophosphate terpene precursor can be a farnesyl pyrophosphate. In

[0039] In any of the methods provided herein, the call can be a prokaryotic cell or an eukaryotic cell that is selected from among a bacteria, yeast, insect, plant or mammalian cell. In some examples, the cell is a yeast cell that is a Saccharomyces genus cell or a Pichia genus cell, such as a Saccharomyces cerevisiae cell. In some examples, the cell is modified to produce more FPP compared to an unmodified cell. In some examples of the methods, the cell is modified to produce a santalene synthase. For example, the cell is modified to produce a santalene synthase that has a sequence of amino acids set forth in SEQ ID NO:17, 52 or 53 or a synthase having at least 80%, 85%, 90%, 95% sequence identity therewith.

[0040] In some examples of the methods provided herein the santalene or bergamotene is an .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene. In some examples, the santalol or bergamotol is an .alpha.-santalol, .beta.-santalol, epi-.beta.-santalol or .alpha.-trans-bergamotol. In some examples, the santalol or bergamotol is an (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol or (E)-.alpha.-trans-bergamotol. In further examples of the provided methods, the santalene, bergamotene, santalol, bergamotol or mixtures thereof are isolated by extraction with an organic solvent and/or column chromatography.

[0041] In some examples of the provided methods, santalene and/or bergamotene is contacted with a cytochrome P450 santalene oxidase that is: a cytochrome P450 santalene oxidase polypeptide provided herein; a cytochrome P450 santalene oxidase polypeptide provided herein encoded by any nucleic acid molecule provided herein; a nucleic acid molecule provided herein that encodes a cytochrome P450 santalene oxidase; or a vector provided herein that encodes a cytochrome P450 santalene oxidase, whereby santalol and/or bergamotol are produced.

[0042] In some examples of the provided methods, bergamotene is contacted with a cytochrome P450 bergamotene oxidase that is: a cytochrome P450 bergamotene oxidase polypeptide provided herein; a cytochrome P450 bergamotene oxidase polypeptide provided herein encoded by any nucleic acid molecule provided herein; a nucleic acid molecule provided herein that encodes a cytochrome P450 bergamotene oxidase; or a vector provided herein that encodes a cytochrome P450 bergamotene oxidase, whereby bergamotol is produced.

[0043] Also provided herein are methods for production of a santalol, bergamotol and/or mixtures thereof. Each of steps (a) and (b) can be effected simultaneously or sequentially. In one example, steps (a) and (b) are effected simultaneously with a nucleic acid molecule encoding a fusion polypeptide containing a santalene synthase and a cytochrome P450 santalene oxidase or bergamotene oxidase; or a fusion polypeptide containing a santalene synthase and a cytochrome P450 santalene oxidase or bergamotene oxidase. In particular examples, santalene and/or bergamotene is contacted with a nucleic acid molecule provided herein that encodes a fusion polypeptide; or a fusion polypeptide encoded by a nucleic acid molecule provided herein.

BRIEF DESCRIPTION OF THE FIGURES

[0044] FIG. 1 depicts the chemical structures of (Z)-.alpha.-santalol (1), (E)-.alpha.-santalol (9), (Z)-.beta.-santalol (2), (E)-.beta.-santalol (10), (E)-epi-.beta.-santalol (3), (Z)-epi-.beta.-santalol (11), (Z)-.alpha.-trans-bergamotol (4), (E)-.alpha.-trans-bergamotol (12), .alpha.-santalene (5), .beta.-santalene (6), epi-.beta.-santalene (7) and .alpha.-trans-bergamotene (8).

[0045] FIGS. 2A-2B depict the alignment of the santalene oxidase set forth in SEQ ID NO:7 with the bergamotene oxidases set forth in SEQ ID NOS:6, 8 and 9. A "*" means that the aligned residues are identical, a ":" means that aligned residues are not identical, but are similar and contain conservative amino acids residues at the aligned position, and a "." means that the aligned residues are similar and contain semi-conservative amino acid residues at the aligned position.

[0046] FIGS. 3A-3C depict the alignment of Santalum album cytochrome P450 reductases set forth in SEQ ID NOS:12 and 13 with Arabidopsis thaliana cytochrome P450 reductases set forth in SEQ ID NOS:46 and 58. A "*" means that the aligned residues are identical, a ":" means that aligned residues are not identical, but are similar and contain conservative amino acids residues at the aligned position, and a "." means that the aligned residues are similar and contain semi-conservative amino acid residues at the aligned position.

[0047] FIG. 4 depicts the neighbor joining phylogeny of the predicted protein sequences of SaCYP76F38v1 (SaCYP76-G5), SaCYP76F39v1 (SaCYP76-G10), SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12) and cytochrome P450 enzymes for terpenoid metabolism, as described in Example 4.

[0048] FIGS. 5A-5B depict the alignment of the santalene oxidase set forth in SEQ ID NO:7 and the bergamotene oxidase set forth in SEQ ID NO:6 with cytochrome P450BM-3 set forth in SEQ ID NO:66. A "*" means that the aligned residues are identical, a ":" means that aligned residues are not identical, but are similar and contain conservative amino acids residues at the aligned position, and a "." means that the aligned residues are similar and contain semi-conservative amino acid residues at the aligned position.

[0049] FIGS. 6A-6D depict the GC-MS chromatogram of products extracted from in vivo assays with SaCYP76F38v1 (SaCYP76-G5) (FIG. 6A), SaCYP76F37v1 (SaCYP76-G11) (FIG. 6B), SaCYP76F38v2 (SaCYP76-G12) (FIG. 6C) and empty vector (FIG. 6D) as described in Example 10. The peaks are identified in Table 13.

[0050] FIG. 7 depicts the total ion chromatogram of S. album oil extract. The peaks are identified in Table 13.

[0051] FIGS. 8A-8C depict the GC-MS chromatogram of S. album native oil (FIG. 8A) and of products extracted from in vivo assays with SaCYP76F39v1 (SaCYP76-G10) (FIG. 8B) and empty vector (FIG. 8C) as described in Example 10. The peaks are identified in Table 11.

[0052] FIGS. 9A-9B depict the GC-MS chromatogram of S. album native oil (FIG. 9A) and of products extracted from in vitro assays with SaCYP76F39v1 (SaCYP76-G10) (FIG. 9B) as described in Example 11. The peaks are identified in Table 11.

[0053] FIG. 10 depicts the neighbor-joining phylogeny of the protein sequences of the S. album CYP76Fs and related terpene-modifying cytochrome P450, as described in Example 4. The highlighted CYP76Fs indicated those in clade I (marked with I) and clade II (marked with II).

[0054] FIGS. 11A-11B depict the GC-MS analysis (extracted ion chromatograms) of products formed in vivo in yeast cells expressing SaSSY, SaCPR2 and SaCYP76F39v1 (SaCYP76-G10) (FIG. 11A) and empty vector (FIG. 11B). The peaks are identified in Table 12. Peaks marked with the symbol (*) correspond to farnesol which is also produced in yeast cells without SaCYP76F. Peaks in FIG. 11A marked with the symbol (#) represent yeast in vivo modifications of santalols (see FIGS. 12A and 12B).

[0055] FIGS. 12A-12B depict the GC-MS analysis (extracted ion chromatograms) of sesquiterpenols of natural sandalwood oil sample before (FIG. 12A) and after (FIG. 12B) overnight incubation with yeast cells, which do not contain a SaCYP76F gene. Peaks in FIG. 12B marked with the symbol (#) represent yeast in vivo modifications of santalols independent of SaCYP76F. The peaks are identified in Table 12.

[0056] FIGS. 13A-13D depict the GC-MS analysis (extracted ion chromatograms) of compounds formed in vivo in yeast cells expressing SaSSy, SaCPR2 and SaCYP76F39v2 (SaCYP76-G15) (FIG. 13A), SaCYP76F40 (SaCYP76-G16) (FIG. 13B), SaCYP76F41 (SaCYP76-G17) (FIG. 13C), or SaCYP76F42 (SaCYP76-G13) (FIG. 13D). The peaks are identified in Table 12. Peaks marked with the symbol (*) correspond to farnesol which is produced in yeast cells without SaCYP76F. Peaks marked with the symbol (#) represent yeast in vivo modifications of santalols independent of SaCYP76F.

[0057] FIGS. 14A-14D depict the GC-MS analysis (extracted ion chromatograms) of compounds formed in vivo in yeast cells expressing SaSSy, SaCPR2 and SaCYP76F38v1 (SaCYP76-G5) (FIG. 14A), SaCYP76F38v2 (SaCYP76-G12) (FIG. 14B), SaCYP76F37v1 (SaCYP76-G11) (FIG. 14C), SaCYP76F37v2 (SaCYP76-G14) (FIG. 14D), or SaCYP76F43 (SaCYP76-G18) (FIG. 14E). The peaks are identified in Table 12. Peaks marked with the symbol (*) correspond to farnesol which is produced in yeast cells without SaCYP76F. Peaks marked with the symbol (#) represent yeast in vivo modifications of santalols independent of SaCYP76F.

[0058] FIG. 15A depicts the GC-MS analysis (extracted ion chromatograms) of products formed in vitro with SaCYP76F39v1 (SaCYP76-G10) and a sesquiterpene mixture of .alpha.-, .beta.- and epi-.beta.-santalene and .alpha.-trans-bergamotene (FIG. 15A). FIG. 15B depicts the GC-MS analysis (extracted ion chromatograms) of authentic S. album oil. FIG. 15C depicts the GC-MS analysis (extracted ion chromatograms) from control assays performed with microsomes isolated from yeast cells transformed with an empty vector. The peaks are identified in Table 12.

[0059] FIGS. 16A-16E depict the GC-MS analysis (extracted ion chromatograms) of products formed in vitro with a sesquiterpene mixture of .alpha.-, .beta.- and epi-.beta.-santalene and .alpha.-trans-bergamotene as the substrate and clade I SaCYP76F cDNAs SaCYP76F39v2 (SaCYP76-G15) (FIG. 16A); SaCYP76F40 (SaCYP76-G16) (FIG. 16B); SaCYP76F41 (SaCYP76-G17) (FIG. 16C); SaCYP76F42 (SaCYP76-G13) (FIG. 16D); or empty vector as control (FIG. 16E). The peaks are identified in Table 12.

[0060] FIGS. 17A-17E depict the GC-MS analysis (extracted ion chromatograms) of products formed in vitro with a sesquiterpene mixture of .alpha.-, .beta.- and epi-.beta.-santalene and .alpha.-trans-bergamotene as the substrate and clade II SaCYP76F cDNAs SaCYP76F38v1 (SaCYP76-G5) (FIG. 17A); SaCYP76F38v2 (SaCYP76-G12) (FIG. 17B); SaCYP76F37v1 (SaCYP76-G11) (FIG. 17C); SaCYP76F37v2 (SaCYP76-G14) (FIG. 17D); or empty vector as control (FIG. 17E). The peaks are identified in Table 12.

[0061] FIG. 18 depicts the reduced CO-difference spectra of isolated microsomes containing S. album CYP76F proteins. CO-difference spectra of microsomal fractions from S. cerevisiae harboring a cytochrome P450 or an empty vector are shown. Concentration of SaCYP76F proteins are given based on an extinction coefficient of 91,000 M.sup.-1cm.sup.-1.

[0062] FIGS. 19A-19D depict the GC-MS analysis (extracted ion chromatograms) of a sesquiterpene mixture produced with a recombinant yeast strain expressing SaSSy (FIG. 19A) and fractions separated by TLC (FIGS. 19B-19D). The sesquiterpene mixture and fractions were prepared as described in Example 9. The peaks correspond to: .alpha.-santalene, peak 1; .alpha.-exo-bergamotene, peak 2; epi-.beta.-santalene, peak 3; and .beta.-santalene, peak 4.

[0063] FIGS. 20A-20G depict the GC-MS analysis (extracted ion chromatograms) of products formed in vitro with SaCYP76F39v1 (SaCYP76-G10) or SaCYP76F37v1 (SaCYP76-G11) using partially purified substrates. FIGS. 20A-20C depict product profiles in assays with SaCYP76F39v1 (SaCYP76-G10) using .alpha.-santalene (FIG. 20A), .alpha.-exo-bergamotene (FIG. 20B), or epi-.beta.-santalene and .beta.-santalene (FIG. 20C) as the substrates. FIGS. 20D-20F depict product profiles in assays with SaCYP76F37v1 (SaCYP76-G11) using .alpha.-santalene (FIG. 20D), .alpha.-exo-bergamotene (FIG. 20E), or epi-.beta.-santalene and .beta.-santalene (FIG. 20F) as the substrates. FIG. 20G depicts the extracted ion chromatogram for authentic Santalum album oil. The peaks are identified in Table 12.

[0064] FIGS. 21A-21C depict the alignment of the S. album cytochrome P450s set forth in SEQ ID NOS:6-9 and 73-78. Horizontal arrows indicate the proline region (a), oxygen binding motif (b) and heme binding motif (c). Boxes indicate the substrate recognition sites (SRS) regions originally described by Gotoh (1992) J Biol Chem 267:83-90. A "*" means that the aligned residues are identical, a ":" means that aligned residues are not identical, but are similar and contain conservative amino acids residues at the aligned position, and a "." means that the aligned residues are similar and contain semi-conservative amino acid residues at the aligned position.

DETAILED DESCRIPTION

Outline

[0065] A. Definitions

[0066] B. Overview

[0067] 1. Biosynthesis of Terpenoids

[0068] a. Santalols

[0069] b. Bergamotols

[0070] 2. Cytochrome P450 Enzymes

[0071] a. Structure

[0072] b. Activity

[0073] 3. Cytochrome P450 Reductases

[0074] a. Structure

[0075] b. Activity

[0076] C. Cytochrome P450 polypeptides and encoding nucleic acid molecules

[0077] 1. Cytochrome P450 santalene oxidase polypeptides

[0078] Modified cytochrome P450 santalene oxidase polypeptides

[0079] 2. Cytochrome P450 bergamotene oxidase polypeptides

[0080] Modified cytochrome P450 bergamotene oxidase polypeptides

[0081] 3. Additional modifications

[0082] a. Truncated polypeptides

[0083] b. Polypeptides with altered activities or properties

[0084] c. Domain swaps

[0085] d. Fusion proteins

[0086] D. Cytochrome P450 reductase polypeptides and encoding nucleic acid molecules

[0087] 1. Cytochrome P450 reductase polypeptides

[0088] 2. Modified cytochrome P450 reductase polypeptides

[0089] 3. Additional modifications

[0090] a. Truncated polypeptides

[0091] b. Polypeptides with altered activities or properties

[0092] c. Domain swaps

[0093] d. Fusion proteins

[0094] E. Methods for producing modified cytochrome P450 and cytochrome P450 reductase polypeptides and encoding nucleic acid molecules

[0095] F. Expression of cytochrome P450 and cytochrome P450 reductase polypeptides and encoding nucleic acid molecules

[0096] 1. Isolation of nucleic acid encoding Santalum album cytochrome P450 and cytochrome P450 reductase polypeptides

[0097] 2. Generation of modified nucleic acids

[0098] 3. Vectors and Cells

[0099] 4. Expression systems

[0100] a. Prokaryotic cells

[0101] b. Yeast cells

[0102] c. Plants and plant cells

[0103] d. Insects and insect cells

[0104] e. Mammalian cells

[0105] f. Exemplary host cells

[0106] 5. Purification

[0107] 6. Fusion proteins

[0108] G. Methods for producing terpenoids and methods for detecting such products and the activity of the cytochrome P450 and cytochrome P450 reductase polypeptides

[0109] 1. Synthesis of Santalols and Bergamotols

[0110] a. Oxidation of Santalenes and Bergamotenes

[0111] b. Conversion of acyclic pyrophosphate terpene precursors

[0112] 2. Methods for production

[0113] a. Exemplary cells

[0114] b. Culture of cells

[0115] c. Isolation and assays for detection and identification

[0116] 3. Production of sandalwood oil

[0117] 4. Assays for detecting enzymatic activity of cytochrome P450 and cytochrome P450 reductase polypeptides

[0118] a. Methods for determining the activity of cytochrome P450 polypeptides

[0119] b. Methods for determining the activity of cytochrome P450 reductase polypeptides

[0120] H. Examples

A. DEFINITIONS

[0121] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong. All patents, patent applications, published applications and publications, Genbank sequences, databases, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety. In the event that there are a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

[0122] As used herein, an acyclic pyrophosphate terpene precursor is any acyclic pyrophosphate compound that is a precursor to the production of at least one terpene, including, but not limited, farnesyl-pyrophosphate (FPP), geranyl-pyrophosphate (GPP) and geranylgeranyl-pyrophosphate (GGPP). Acyclic pyrophosphate terpene precursors are thus substrates for terpene synthases.

[0123] As used herein, a terpene is an unsaturated hydrocarbon based on the isoprene unit (C.sub.5H.sub.8), and having a general formula C.sub.5xH.sub.8x, such as C.sub.10H.sub.16. Reference to a terpene includes acyclic, monocyclic and polycyclic terpenes. Terpenes include, but are not limited to, monoterpenes, which contain 10 carbon atoms; sesquiterpenes, which contain 15 carbon atoms; diterpenes, which contain 20 carbon atoms, and triterpenes, which contain 30 carbon atoms. Reference to a terpene also includes stereoisomers of the terpene.

[0124] As used herein, a terpenoid is a chemically modified terpene. In one example, a terpenoid is a terpene that has been chemically modified by addition of a hydroxyl group, such as a santalol or bergamotol. Reference to a terpenoid includes acyclic, monocyclic and polycyclic terpenoids, including monoterpenoids, sesquiterpenoids and diterpenoids. Reference to a terpenoid also includes stereoisomers of the terpenoid.

[0125] As used herein, a terpene synthase is a polypeptide capable of catalyzing the formation of one or more terpenes from a pyrophosphate terpene precursor. In some examples, a terpene synthase catalyzes the formation of one or more terpenes from an acyclic pyrophosphate terpene precursor, for example, FPP, GPP or GGPP, including, but not limited to, santalene synthase. In other examples, a terpene synthase catalyzes the formation of one or more terpenes from an acyclic pyrophosphate terpene precursor, including, but not limited to, santalene synthase.

[0126] As used herein, "cytochrome P450," "cytochrome P450 oxidase," "cytochrome P450 polypeptide," "cytochrome P450 oxidase polypeptide" or "CYP" is a polypeptide capable of catalyzing the monooxygenation of any terpene precursor, including monoterpenes, sesquiterpenes and diterpenes. A cytochrome P450 can catalyze the monooxygenation of a terpene or a mixture of terpenes, resulting in the production one or more terpenoids.

[0127] For purposes herein, cytochrome P450 oxidases provided herein are enzymes with cytochrome P450 oxidase activity and have greater than or greater than about or 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity, when aligned with the cytochrome P450 oxidase sequence set forth in SEQ ID NO:50. Reference to a cytochrome P450 oxidase includes any cytochrome P450 oxidase polypeptide including, but not limited to, a recombinantly produced polypeptide, synthetically produced polypeptide and a cytochrome P450 oxidase polypeptide extracted or isolated from cells or plant matter, including, but not limited to, heartwood of a sandalwood tree. Exemplary of cytochrome P450 oxidase polypeptides include those isolated from Santalum album. Reference to a cytochrome P450 oxidase includes cytochrome P450 oxidase from any genus or species, and included allelic or species variants, variants encoded by splice variants, and other variants thereof, including polypeptides that have at least or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the cytochrome P450 oxidase set forth in SEQ ID NO:50 when aligned therewith. Cytochrome P450 oxidase also includes catalytically active fragments thereof that retain cytochrome P450 oxidase activity.

[0128] As used herein, "cytochrome P450 santalene oxidase" or "cytochrome P450 santalene oxidase polypeptide" is a polypeptide capable of catalyzing the formation of a santalol from a santalene, for example, capable of catalyzing the monooxygenation or hydroxylation of a santalene. A cytochrome P450 santalene oxidase polypeptide can produce one or a mixture of santalols from one or a mixture of santalenes. A cytochrome P450 santalene oxidase polypeptide is also capable of catalyzing the formation of a bergamotol from a bergamotene. For example, a cytochrome P450 santalene oxidase catalyzes the formation of .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene, epi-.beta.-santalol from epi-.beta.-santalene and/or Z-.alpha.-trans-bergamotol or E-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene.

[0129] For purposes herein, cytochrome P450 santalene oxidases provided herein are enzymes with cytochrome P450 santalene oxidase activity and have greater than or greater than about or 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity, when aligned with the cytochrome P450 santalene oxidase sequence set forth in SEQ ID NO:7, 74, 75, 76 or 77. Reference to a cytochrome P450 santalene oxidase includes any cytochrome P450 santalene oxidase polypeptide including, but not limited to, a recombinantly produced polypeptide, synthetically produced polypeptide and a cytochrome P450 santalene oxidase polypeptide extracted or isolated from cells or plant matter, including, but not limited to, heartwood of a sandalwood tree. Exemplary of cytochrome P450 santalene oxidase polypeptides include those isolated from Santalum album. Reference to a cytochrome P450 santalene oxidase includes cytochrome P450 santalene oxidase from any genus or species, and included allelic or species variants, variants encoded by splice variants, and other variants thereof, including polypeptides that have at least or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the cytochrome P450 santalene oxidase set forth in SEQ ID NO:7, 74, 75, 76 or 77 when aligned therewith. Cytochrome P450 santalene oxidase also includes catalytically active fragments thereof that retain cytochrome P450 santalene oxidase activity.

[0130] As used herein, "cytochrome P450 santalene oxidase activity" or "santalene oxidase activity" refers to the ability to catalyze the formation of one or more santalols from one or more santalenes. That is, cytochrome P450 santalene oxidases catalyze the monooxygenation or hydroxylation of santalenes. Cytochrome P450 santalene oxidases also catalyze the hydroxylation of bergamotene. For example, cytochrome P450 santalene oxidases catalyze the formation of .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene, epi-.beta.-santalol from epi-.beta.-santalene and/or Z-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. Methods to assess santalol or bergamotol formation from a reaction of a santalene or bergamotene are well known in the art and described herein. The production of a santalol or bergamotol can be assessed by methods such as, for example, gas chromatography-mass spectrometry (GC-MS) (see Examples below). A cytochrome P450 exhibits cytochrome P450 santalene oxidase activity or the ability to catalyze the formation of santalols or bergamotol from santalenes and bergamotene if the amount of santalols and bergamotol produced from the reaction is at least or at least about 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of terpenoids produced in the reaction.

[0131] As used herein, "cytochrome P450 bergamotene oxidase" or "cytochrome P450 bergamotene oxidase polypeptide" is a polypeptide capable of catalyzing the monooxygenation or hydroxylation of a bergamotene. For example, a cytochrome P450 bergamotene oxidase catalyzes the formation of Z-.alpha.-trans-bergamotol or E-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene.

[0132] For purposes herein, cytochrome P450 bergamotene oxidases provided herein are enzymes with cytochrome P450 bergamotene oxidase activity and have greater than or greater than about or 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity, when aligned with the cytochrome P450 bergamotene oxidase sequence set forth in SEQ ID NO:6, 8, 9 or 73. Reference to a cytochrome P450 bergamotene oxidase includes any cytochrome P450 bergamotene oxidase polypeptide including, but not limited to, a recombinantly produced polypeptide, synthetically produced polypeptide and a cytochrome P450 bergamotene oxidase polypeptide extracted or isolated from cells or plant matter, including, but not limited to, heartwood of a sandalwood tree. Exemplary of cytochrome P450 bergamotene oxidase polypeptides include those isolated from Santalum album. Reference to a cytochrome P450 bergamotene oxidase includes cytochrome P450 bergamotene oxidase from any genus or species, and included allelic or species variants, variants encoded by splice variants, and other variants thereof, including polypeptides that have at least or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the cytochrome P450 bergamotene oxidase set forth in SEQ ID NO: 6, 8, 9 or 73 when aligned therewith. Cytochrome P450 bergamotene oxidase also includes catalytically active fragments thereof that retain cytochrome P450 bergamotene oxidase activity.

[0133] As used herein, "cytochrome P450 bergamotene oxidase activity" or "bergamotene oxidase activity" refers to the ability catalyze the formation of bergamotols from bergamotenes That is, cytochrome P450 bergamotene oxidases catalyze the monooxygenation or hydroxylation of bergamotene. For example, cytochrome P450 bergamotene oxidases catalyze the formation of Z-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. Methods to assess bergamotol formation from a reaction of a bergamotene are well known in the art and described herein. The production of a bergamotol can be assessed by methods such as, for example, gas chromatography-mass spectrometry (GC-MS) (see Examples below). A cytochrome P450 exhibits cytochrome P450 bergamotene oxidase activity or the ability to catalyze the formation of bergamotol from bergamotene if the amount of bergamotol produced from the reaction is at least or at least about 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of terpenoids produced in the reaction.

[0134] As used herein, .alpha.-santalol is a sesquiterpenoid having the following structure or isomers or stereoisomers thereof:

##STR00001##

[0135] As used herein, .beta.-santalol is a sesquiterpenoid having the following structure or isomers or stereoisomers thereof:

##STR00002##

[0136] As used herein, epi-.beta.-santalol is a sesquiterpenoid having the following structure or isomers or stereoisomers thereof:

##STR00003##

[0137] As used herein, Z-.alpha.-trans-bergamotol or Z-.alpha.-exo-bergamotol is a sesquiterpenoid having the following structure or isomers or stereoisomers thereof:

##STR00004##

[0138] As used herein, E-.alpha.-trans-bergamotol or E-.alpha.-exo-bergamotol is a sesquiterpenoid having the following structure or isomers or stereoisomers thereof:

##STR00005##

[0139] As used herein, .alpha.-santalene is a sesquiterpene having the following structure or isomers or stereoisomers thereof:

##STR00006##

[0140] As used herein, .beta.-santalene is a sesquiterpene having the following structure or isomers or stereoisomers thereof:

##STR00007##

[0141] As used herein, epi-.beta.-santalene is a sesquiterpene having the following structure or isomers or stereoisomers thereof:

##STR00008##

[0142] As used herein, .alpha.-trans-bergamotene or .alpha.-exo-bergamotene is a sesquiterpene having the following structure or isomers or stereoisomers thereof:

##STR00009##

[0143] As used herein, "cytochrome P450 reductase" or "CPR" is a polypeptide capable of catalyzing the transfer of two electrons from NADPH to an electron acceptor, such as a cytochrome P450. For purposes herein, cytochrome P450 reductases provided herein are enzymes with cytochrome P450 reductase activity and have greater than or greater than about or 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity, when aligned with the cytochrome P450 reductase sequence set forth in SEQ ID NO:12 or 13. Reference to a cytochrome P450 reductase includes any cytochrome P450 reductase polypeptide including, but not limited to, a recombinantly produced polypeptide, synthetically produced polypeptide and a cytochrome P450 reductase polypeptide extracted or isolated from cells or plant matter, including, but not limited to, heartwood of a sandalwood tree. Exemplary of cytochrome P450 reductase polypeptides include those isolated from Santalum album. Reference to a cytochrome P450 reductase includes a cytochrome P450 reductase from any genus or species, and included allelic or species variants, variants encoded by splice variants, and other variants thereof, including polypeptides that have at least or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the cytochrome P450 reductase set forth in SEQ ID NO:12 or 13 when aligned therewith. Cytochrome P450 reductase also includes catalytically active fragments thereof that retain cytochrome P450 reductase activity.

[0144] As used herein, "cytochrome P450 reductase activity" refers to the ability to catalyze the transfer of two electrons from NADPH to an electron acceptor, such as a cytochrome P450. Methods to assess cytochrome P450 reductase activity are well known in the art and described herein. For example, cytochrome P450 reductase activity can be determined by reduction of an artificial electron receptor, such as cytochrome c.

[0145] As used herein, "wild type" or "native" with reference to a cytochrome P450 or cytochrome P450 reductase refers to a cytochrome P450 polypeptide or cytochrome P450 reductase polypeptide encoded by a native or naturally occurring cytochrome P450 gene or cytochrome P450 reductase gene, including allelic variants, that are present in an organism, including a plant, in nature. Reference to wild type cytochrome P450 or cytochrome P450 reductase without reference to a species is intended to encompass any species of a wild type cytochrome P450 or cytochrome P450 reductase.

[0146] As used herein, species variants refer to variants in polypeptides among different species, including different sandalwood species, such Santalum album, Santalum australocaledonicum, Santalum spicatum and Santalum murrayanum.

[0147] Generally, species variants share at least or at least about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more sequence identity. Corresponding residues between and among species variants can be determined by comparing, generally one-by-one to the same reference sequence, and aligning each sequence with the reference sequence to maximize the number of matching nucleotides or amino acid residues. The position of interest is then given the number assigned in the reference nucleic acid molecule or polypeptide. Alignment can be effected manually or by eye, particularly, where sequence identity is greater than 80%. To determine sequence identity among a plurality of variants, alignments are effected one-by-one against the same reference polypeptide.

[0148] As used herein, an allelic variant or allelic variation references any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and can result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides having altered amino acid sequence. The term "allelic variant" also is used herein to denote a protein encoded by an allelic variant of a gene. Typically the reference form of the gene encodes a wild type form and/or predominant form of a polypeptide from a population or single reference member of a species. Typically, allelic variants, which include variants between and among species typically, have at least 80%, 90% or greater amino acid identity with a wild type and/or predominant form from the same species; the degree of identity depends upon the gene and whether comparison is interspecies or intraspecies. Generally, intraspecies allelic variants have at least about 80%, 85%, 90% or 95% identity or greater with a wild type and/or predominant form, including 96%, 97%, 98%, 99% or greater identity with a wild type and/or predominant form of a polypeptide. Reference to an allelic variant herein generally refers to variations n proteins among members of the same species.

[0149] As used herein, a splice variant refers to a variant produced by differential processing of a primary transcript of genomic DNA that results in more than one type of mRNA.

[0150] As used herein, a "modified cytochrome P450" or "modified cytochrome P450 polypeptide" or "modified CYP" refers to a cytochrome P450 polypeptide that has one or more amino acid differences compared to an unmodified or wild type cytochrome P450 polypeptide. The one or more amino acid differences can be amino acid mutations such as one or more amino acid replacements (substitutions), insertions or deletions, or can be insertions or deletions or replacements of entire domains or portions thereof, and any combination thereof. Modification can be effected by any mutational protocol, including gene shuffling methods. Typically, a modified cytochrome P450 polypeptide has one or more modifications in primary sequence compared to an unmodified cytochrome P450 polypeptide. For example, a modified cytochrome P450 polypeptide provided herein can have at least 1, 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135 or more amino acid differences compared to an unmodified cytochrome P450 polypeptide. Typically, the modified cytochrome P450 polypeptide will have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid replacements, but can include more, particularly when domains or portions thereof are swapped. Any modification is contemplated as long as the resulting polypeptide has at least one cytochrome P450 activity associated with the wild type cytochrome P450, such as, for example, catalytic activity, monooxygenase activity, and/or the ability to catalyze the formation of a terpenoid from a terpene. Generally, the resulting cytochrome P450 polypeptide will have at least 50% sequence identity with the wild type cytochrome P450 polypeptide provided herein.

[0151] As used herein, a "modified cytochrome P450 santalene oxidase" or "modified cytochrome P450 santalene oxidase polypeptide" refers to a cytochrome P450 santalene oxidase polypeptide that has one or more amino acid differences compared to an unmodified or wild type cytochrome P450 santalene oxidase polypeptide. The one or more amino acid differences can be amino acid mutations such as one or more amino acid replacements (substitutions), insertions or deletions, or can be insertions or deletions or replacements of entire domains or portions thereof, and any combination thereof. Modification can be effected by any mutational protocol, including gene shuffling methods. Typically, a modified cytochrome P450 santalene oxidase polypeptide has one or more modifications in primary sequence compared to an unmodified cytochrome P450 santalene oxidase polypeptide. For example, a modified cytochrome P450 santalene oxidase polypeptide provided herein can have at least 1, 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135 or more amino acid differences compared to an unmodified cytochrome P450 santalene oxidase polypeptide. Typically, the modified cytochrome P450 santalene oxidase polypeptide will have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid replacements, but can include more, particularly when domains or portions thereof are swapped. Any modification is contemplated as long as the resulting polypeptide has at least one cytochrome P450 santalene oxidase activity associated with the wild type cytochrome P450 santalene oxidase, such as, for example, catalytic activity, the ability to catalyze the formation of santalols or bergamotols from santalenes or bergamotenes. Generally, the resulting cytochrome P450 polypeptide santalene oxidase will have at least 50% sequence identity with the wild type cytochrome P450 santalene oxidase polypeptide provided herein.

[0152] As used herein, a "modified cytochrome P450 bergamotene oxidase" or "modified cytochrome P450 bergamotene oxidase polypeptide" refers to a cytochrome P450 bergamotene oxidase polypeptide that has one or more amino acid differences compared to an unmodified or wild type cytochrome P450 bergamotene oxidase polypeptide. The one or more amino acid differences can be amino acid mutations such as one or more amino acid replacements (substitutions), insertions or deletions, or can be insertions or deletions or replacements of entire domains or portions thereof, and any combination thereof. Modification can be effected by any mutational protocol, including gene shuffling methods. Typically, a modified cytochrome P450 bergamotene oxidase polypeptide has one or more modifications in primary sequence compared to an unmodified cytochrome P450 bergamotene oxidase polypeptide. For example, a modified cytochrome P450 bergamotene oxidase polypeptide provided herein can have at least 1, 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135 or more amino acid differences compared to an unmodified cytochrome P450 polypeptide. Typically, the modified cytochrome P450 bergamotene oxidase polypeptide will have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid replacements, but can include more, particularly when domains or portions thereof are swapped. Any modification is contemplated as long as the resulting polypeptide has at least one cytochrome P450 bergamotene oxidase activity associated with the wild type cytochrome P450 bergamotene oxidase polypeptide, such as, for example, catalytic activity, the ability to catalyze the formation of bergamotols from bergamotenes. Generally, the resulting cytochrome P450 polypeptide bergamotene oxidase will have at least 50% sequence identity with the wild type cytochrome P450 bergamotene oxidase polypeptide provided herein.

[0153] As used herein, a "modified cytochrome P450 reductase" or "modified CPR" refers to a cytochrome P450 polypeptide that has one or more amino acid differences compared to an unmodified or wild type cytochrome P450 reductase polypeptide. The one or more amino acid differences can be amino acid mutations such as one or more amino acid replacements (substitutions), insertions or deletions, or can be insertions or deletions or replacements of entire domains or portions thereof, and any combination thereof. Modification can be effected by any mutational protocol, including gene shuffling methods. Typically, a modified cytochrome P450 reductase polypeptide has one or more modifications in primary sequence compared to an unmodified cytochrome P450 reductase polypeptide. For example, a modified cytochrome P450 reductase polypeptide provided herein can have at least 1, 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135 or more amino acid differences compared to an unmodified cytochrome P450 reductase polypeptide. Typically, the modified cytochrome P450 reductase polypeptide will have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid replacements, but can include more, particularly when domains or portions thereof are swapped. Any modification is contemplated as long as the resulting polypeptide has at least one cytochrome P450 reductase activity associated with the wild type cytochrome P450 reductase, such as, for example, catalytic activity, the ability to transfer two electrons to an electron receptor, such as a cytochrome P450. Generally, the resulting cytochrome P450 reductase polypeptide will have at least 50% sequence identity with the wild type cytochrome P450 reductase polypeptide provided herein.

[0154] As used herein, corresponding residues refers to residues that occur at aligned loci. Related or variant polypeptides are aligned by any method known to those of skill in the art. Such methods typically maximize matches, and include methods such as manual alignments and those produced by the numerous alignment programs available (for example, BLASTP) and others known to those of skill in the art. By aligning the sequences of polypeptides, one skilled in the art can identify corresponding residues, using conserved and identical amino acid residues as guides. Corresponding positions also can be based on structural alignments, for example by using computer simulated alignments of protein structure. For example, corresponding residues between a cytochrome P450 santalene oxidase synthase and cytochrome P450 bergamotene oxidase synthase are shown in FIGS. 2A-2B and 21A-21C and corresponding residues between Arabidopsis thaliana cytochrome P450 reductases and Santalum album cytochrome P450 reductases are shown in FIG. 3A-3C.

[0155] As used herein, domain or region (typically a sequence of at least three or more, generally 5 or 7 or more amino acids) refers to a portion of a molecule, such as a protein or the encoding nucleic acids, that is structurally and/or functionally distinct from other portions of the molecule and is identifiable. A protein can have one, or more than one, distinct domains. For example, a domain can be identified, defined or distinguished by homology of the sequence therein to related family members, such as other terpene synthases. A domain can be a linear sequence of amino acids or a non-linear sequence of amino acids. Many polypeptides contain a plurality of domains. Such domains are known, and can be identified by, those of skill in the art. For exemplification herein, definitions are provided, but it is understood that it is well within the skill in the art to recognize particular domains by name. If needed, appropriate software can be employed to identify domains. For example, as discussed above, corresponding domains in different cytochrome P450s or cytochrome P450 reductases can be identified by sequence alignments, such as using tools and algorithms well known in the art (for example, BLASTP).

[0156] As used herein, a functional domain refers to those portions of a polypeptide that is recognized by virtue of a functional activity, such as catalytic activity. A functional domain can be distinguished by its function, such as by catalytic activity, or an ability to interact with a biomolecule, such as substrate binding or metal binding. In some examples, a domain independently can exhibit a biological function or property such that the domain independently or fused to another molecule can perform an activity, such as, for example catalytic activity or substrate binding.

[0157] As used herein, a structural domain refers to those portions of a polypeptide chain that can form an independently folded structure within a protein made up of one or more structural motifs.

[0158] As used herein, "heterologous" with respect to an amino acid or nucleic acid sequence refers to portions of a sequence that is not present in a native polypeptide or encoded by a polynucleotide. For example, a portion of amino acids of a polypeptide, such as a domain or region or portion thereof, for a cytochrome P450 santalene oxidase synthase is heterologous thereto if such amino acids is not present in a native or wild type cytochrome P450 santalene oxidase synthase (e.g. as set forth in SEQ ID NO:7), or encoded by the polynucleotide encoding therefor. Polypeptides containing such heterologous amino acids or polynucleotides encoding therefor are referred to as "chimeric polypeptides" or "chimeric polynucleotides," respectively.

[0159] As used herein, the phrase "a property of the modified cytochrome P450 is improved compared to the first cytochrome P450" refers to a desirable change in a property of a modified cytochrome P450 compared to a cytochrome P450 that does not contain the modification(s). Typically, the property or properties are improved such that the amount of a desired terpenoid produced from the reaction of a terpene substrate with the modified cytochrome P450 synthase is increased compared to the amount of the desired terpenoid produced from the reaction of a substrate with a cytochrome P450 synthase that is not so modified. Exemplary properties that can be improved in a modified cytochrome P450 synthase include, for example, terpenoid production, catalytic activity, product distribution, substrate specificity, regioselectivity and stereoselectivity. One or more of the properties can be assessed using methods well known in the art to determine whether the property had been improved (i.e. has been altered to be more desirable for the production of a desired terpenoid or terpenoids).

[0160] As used herein, terpenoid production (also referred to as terpenoid yield) refers to the amount (in weight or weight/volume) of terpenoid produced from the reaction of a terpene with a cytochrome P450. Reference to total terpenoid production refers to the total amount of all terpenoids produced from the reaction, while reference to particular terpenoid production refers to the amount of a particular terpenoid (e.g. .beta.-santalol and .alpha.-santalol), produced from the reaction.

[0161] As used herein, an improved terpenoid production refers to an increase in the total amount of terpenoid (i.e. improved total terpenoid production) or an increase in the particular amount of terpenoid resulting from the reaction of a terpene with a modified cytochrome P450 compared to the amount produced from the reaction of the same terpene with a cytochrome P450 that is not so modified. The amount of terpenoid (total or particular) produced from the reaction of a terpene with a cytochrome P450 can be increased by at least or at least about 1%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the amount of terpenoid produced from the reaction of the same terpene under the same conditions with a cytochrome P450 that is not so modified.

[0162] As used herein, substrate specificity refers to the preference of a cytochrome P450 for one target substrate over another, such as one terpene (e.g. .beta.-santalene, .alpha.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene) over another. Substrate specificity can be assessed using methods well known in the art, such as those that calculate k.sub.cat/K.sub.m. For example, the substrate specificity can be assessed by comparing the relative K.sub.cat/K.sub.m, which is a measure of catalytic efficiency, of the enzyme against various substrates (e.g. .beta.-santalene, .alpha.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene).

[0163] As used herein, altered substrate specificity refers to a change in substrate specificity of a modified cytochrome P450 polypeptide (such as a modified cytochrome P450 santalene oxidase polypeptide or cytochrome P450 bergamotene oxidase polypeptide) compared to a cytochrome P450 that is not so modified (such as, for example, a wild type cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase). The specificity (e.g. k.sub.cat/K.sub.m) of a modified cytochrome P450 polypeptide for a substrate, such as .beta.-santalene, .alpha.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene, can be altered by at least or at least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the specificity of a starting cytochrome P450 for the same substrate.

[0164] As used herein, "improved substrate specificity" refers to a change or alteration in the substrate specificity to a more desired specificity. For example, an improved substrate specificity can include an increase in substrate specificity of a modified cytochrome P450 polypeptide for a desired substrate, such as .beta.-santalene, .alpha.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene. The specificity (e.g. k.sub.cat/K.sub.m) of a modified cytochrome P450 polypeptide for a substrate, such as .beta.-santalene, .alpha.-santalene, epi-.beta.-santalene or .alpha.-trans-bergamotene, can be increased by at least or at least about 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the specificity of a cytochrome P450 that is not so modified.

[0165] As used herein, "product distribution" refers to the relative amounts of different terpenoids produced from the reaction between a terpene, such as .beta.-santalene, and a cytochrome P450, including the cytochrome P450 polypeptides provided herein. The amount of a produced terpenoid can be depicted as a percentage of the total products produced by the cytochrome P450. For example, the product distribution resulting from reaction of .beta.-santalene with a cytochrome P450 santalene oxidase can be 90% (weight/volume) .beta.-santalol and 10% (weight/volume) other compounds. Methods for assessing the type and amount of a terpenoid in a solution are well known in the art and described herein, and include, for example, gas chromatography-mass spectrometry (GC-MS) (see Examples below).

[0166] As used herein, an altered product distribution refers to a change in the relative amount of individual terpenoids produced from the reaction between a terpene, such as .beta.-santalene, and a cytochrome P450, such as cytochrome P450 santalene oxidase. Typically, the change is assessed by determining the relative amount of individual terpenoids produced from the terpene using a first cytochrome P450 (e.g. wild type cytochrome P450) and then comparing it to the relative amount of individual terpenoids produced using a second cytochrome P450 (e.g. a modified cytochrome P450). An altered product distribution is considered to occur if the relative amount of any one or more terpenoids is increased or decreased by at least or by at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more.

[0167] As used herein, an improved product distribution refers to a change in the product distribution to one that is more desirable, i.e. contains more desirable relative amounts of terpenoids. For example, an improved product distribution can contain an increased amount of a desired terpenoid and/or a decreased amount of a terpenoid that is not so desired. The amount of desired terpenoid in an improved production distribution can be increased by at least or by at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more. The amount of a terpenoid that is not desired in an improved production distribution can be decreased by at least or by at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more.

[0168] As used herein, nucleic acids or nucleic acid molecules include DNA, RNA and analogs thereof, including peptide nucleic acids (PNA) and mixtures thereof. Nucleic acids can be single or double-stranded. When referring to probes or primers, which are optionally labeled, such as with a detectable label, such as a fluorescent or radiolabel, single-stranded molecules are contemplated. Such molecules are typically of a length such that their target is statistically unique or of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 14, 16 or 30 contiguous nucleotides of sequence complementary to or identical to a gene of interest. Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids long.

[0169] As used herein, the term polynucleotide means a single- or double-stranded polymer of deoxyribonucleotides or ribonucleotide bases read from the 5' to the 3' end. Polynucleotides include RNA and DNA, and can be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. The length of a polynucleotide molecule is given herein in terms of nucleotides (abbreviated "nt") or base pairs (abbreviated "bp"). The term nucleotides is used for single- and double-stranded molecules where the context permits. When the term is applied to double-stranded molecules it is used to denote overall length and will be understood to be equivalent to the term base pairs. It will be recognized by those skilled in the art that the two strands of a double-stranded polynucleotide can differ slightly in length and that the ends thereof can be staggered; thus all nucleotides within a double-stranded polynucleotide molecule cannot be paired. Such unpaired ends will, in general, not exceed 20 nucleotides in length.

[0170] As used herein, heterologous nucleic acid is nucleic acid that is not normally produced in vivo by the cell in which it is expressed or that is produced by the cell but is at a different locus or expressed differently or that mediates or encodes mediators that alter expression of endogenous nucleic acid, such as DNA, by affecting transcription, translation, or other regulatable biochemical processes. Heterologous nucleic acid is generally not endogenous to the cell into which it is introduced, but has been obtained from another cell or prepared synthetically. Heterologous nucleic acid can be endogenous, but is nucleic acid that is expressed from a different locus or altered in its expression. Generally, although not necessarily, such nucleic acid encodes RNA and proteins that are not normally produced by the cell or in the same way in the cell in which it is expressed. Heterologous nucleic acid, such as DNA, also can be referred to as foreign nucleic acid, such as DNA. Thus, heterologous nucleic acid or foreign nucleic acid includes a nucleic acid molecule not present in the exact orientation or position as the counterpart nucleic acid molecule, such as DNA, is found in a genome. It also can refer to a nucleic acid molecule from another organism or species (i.e., exogenous).

[0171] Any nucleic acid, such as DNA, that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which the nucleic acid is expressed is herein encompassed by heterologous nucleic acid; heterologous nucleic acid includes exogenously added nucleic acid that also is expressed endogenously. Examples of heterologous nucleic acid include, but are not limited to, nucleic acid that encodes traceable marker proteins, such as a protein that confers drug resistance, nucleic acid that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and nucleic acid, such as DNA, that encodes other types of proteins, such as antibodies. Antibodies that are encoded by heterologous nucleic acid can be secreted or expressed on the surface of the cell in which the heterologous nucleic acid has been introduced.

[0172] As used herein, a peptide refers to a polypeptide that is from 2 to 40 amino acids in length.

[0173] As used herein, the amino acids that occur in the various sequences of amino acids provided herein are identified according to their known, three-letter or one-letter abbreviations (Table 1). The nucleotides which occur in the various nucleic acid fragments are designated with the standard single-letter designations used routinely in the art.

[0174] As used herein, an "amino acid" is an organic compound containing an amino group and a carboxylic acid group. A polypeptide contains two or more amino acids. For purposes herein, amino acids include the twenty naturally-occurring amino acids, non-natural amino acids and amino acid analogs (i.e., amino acids in which the .alpha.-carbon has a side chain).

[0175] In keeping with standard polypeptide nomenclature described in J. Biol. Chem., 243: 3557-3559 (1968), and adopted 37 C.F.R. .sctn..sctn. 1.821-1.822, abbreviations for the amino acid residues are shown in Table 1:

TABLE-US-00001 TABLE 1 Table of Correspondence SYMBOL 1-Letter 3-Letter AMINO ACID Y Tyr Tyrosine G Gly Glycine F Phe Phenylalanine M Met Methionine A Ala Alanine S Ser Serine I Ile Isoleucine L Leu Leucine T Thr Threonine V Val Valine P Pro Proline K Lys Lysine H His Histidine Q Gln Glutamine E Glu Glutamic acid Z Glx Glu and/or Gln W Trp Tryptophan R Arg Arginine D Asp Aspartic acid N Asn Asparagine B Asx Asn and/or Asp C Cys Cysteine X Xaa Unknown or other

[0176] All amino acid residue sequences represented herein by formulae have a left to right orientation in the conventional direction of amino-terminus to carboxyl-terminus. In addition, the phrase "amino acid residue" is broadly defined to include the amino acids listed in the Table of Correspondence (Table 1) and modified and unusual amino acids, such as those referred to in 37 C.F.R. .sctn..sctn. 1.821-1.822, and incorporated herein by reference. Furthermore, a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues, to an amino-terminal group such as NH.sub.2 or to a carboxyl-terminal group such as COOH.

[0177] As used herein, "naturally occurring amino acids" refer to the 20 L-amino acids that occur in polypeptides.

[0178] As used herein, "non-natural amino acid" refers to an organic compound containing an amino group and a carboxylic acid group that is not one of the naturally-occurring amino acids listed in Table 1. Non-naturally occurring amino acids thus include, for example, amino acids or analogs of amino acids other than the 20 naturally-occurring amino acids and include, but are not limited to, the D-isostereomers of amino acids. Exemplary non-natural amino acids are known to those of skill in the art and can be included in a modified cytochrome P450 polypeptide or cytochrome P450 reductase polypeptide provided herein.

[0179] As used herein, modification is in reference to modification of the primary sequence of amino acids of a polypeptide or a sequence of nucleotides in a nucleic acid molecule and includes deletions, insertions, and replacements and rearrangements of amino acids and nucleotides. For purposes herein, amino acid replacements (or substitutions), deletions and/or insertions, can be made in any of the cytochrome P450s or cytochrome P450 reductases provided herein. Modifications can be made by making conservative amino acid replacements and also non-conservative amino acid substitutions as well as by insertions, domain swaps and other such changes in primary sequence. For example, amino acid replacements that desirably or advantageously alter properties of the cytochrome P450 or cytochrome P450 reductase can be made. For example, amino acid replacements can be made to the cytochrome P450 santalene oxidase such that the resulting modified cytochrome P450 santalene oxidase can produce more .beta.-santalol from a mixture of santalenes and bergamotenes compared to an unmodified cytochrome P450 santalene oxidase. For example, amino acid replacements can be made to the cytochrome P450 bergamotene oxidase such that the resulting cytochrome P450 bergamotene oxidase can produce more bergamotol from a mixture of santalenes and bergamotenes compared to an unmodified cytochrome P450 bergamotene oxidase. Modifications also can include post-translational modifications or other changes to the molecule that can occur due to conjugation or linkage, directly or indirectly, to another moiety, but when such modifications are contemplated they are referred to as post-translational modifications or conjugates or other such term as appropriate. Methods of modifying a polypeptide are routine to those of skill in the art, and can be performed by standard methods, such as site directed mutations, amplification methods, and gene shuffling methods.

[0180] As used herein, amino acid replacements or substitutions contemplated include, but are not limited to, conservative substitutions, including, but not limited to, those set forth in Table 2. Suitable conservative substitutions of amino acids are known to those of skill in the art and can be made generally without altering the conformation or activity of the polypeptide. Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al. Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub. co., p. 224). Conservative amino acid substitutions are made, for example, in accordance with those set forth in Table 2 as follows:

TABLE-US-00002 TABLE 2 Original residue Conservative substitution Ala (A) Gly; Ser Arg (R) Lys Asn (N) Gln; His Cys (C) Ser Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro His (H) Asn; Gln Ile (I) Leu; Val Leu (L) Ile; Val Lys (K) Arg; Gln; Glu Met (M) Leu; Tyr; Ile Phe (F) Met; Leu; Tyr Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp; Phe Val (V) Ile; Leu; Met

Other conservative substitutions also are contemplated and can be determined empirically or in accord with known conservative substitutions.

[0181] As used herein, a DNA construct is a single or double stranded, linear or circular DNA molecule that contains segments of DNA combined and juxtaposed in a manner not found in nature. DNA constructs exist as a result of human manipulation, and include clones and other copies of manipulated molecules.

[0182] As used herein, a DNA segment is a portion of a larger DNA molecule having specified attributes. For example, a DNA segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, which, when read from the 5' to 3' direction, encodes the sequence of amino acids of the specified polypeptide.

[0183] As used herein, "primary sequence" refers to the sequence of amino acid residues in a polypeptide.

[0184] As used herein, "similarity" between two proteins or nucleic acids refers to the relatedness between the sequence of amino acids of the proteins or the nucleotide sequences of the nucleic acids. Similarity can be based on the degree of identity and/or homology of sequences of residues and the residues contained therein. Methods for assessing the degree of similarity between proteins or nucleic acids are known to those of skill in the art. For example, in one method of assessing sequence similarity, two amino acid or nucleotide sequences are aligned in a manner that yields a maximal level of identity between the sequences. "Identity" refers to the extent to which the amino acid or nucleotide sequences are invariant. Alignment of amino acid sequences, and to some extent nucleotide sequences, also can take into account conservative differences and/or frequent substitutions in amino acids (or nucleotides). Conservative differences are those that preserve the physico-chemical properties of the residues involved. Alignments can be global (alignment of the compared sequences over the entire length of the sequences and including all residues) or local (the alignment of a portion of the sequences that includes only the most similar region or regions).

[0185] As used herein, "at a position corresponding to" or recitation that nucleotides or amino acid positions "correspond to" nucleotides or amino acid positions in a disclosed sequence, such as set forth in the Sequence listing, refers to nucleotides or amino acid positions identified upon alignment with the disclosed sequence to maximize identity using a standard alignment algorithm, such as the GAP algorithm. For purposes herein, alignment of a cytochrome P450 santalene oxidase sequence is to the amino acid sequence set forth in SEQ ID NO:7. For purposes herein, alignment of a cytochrome P450 bergamotene oxidase sequence is to the amino acid sequence set forth in any of SEQ ID NOS:6, 8 or 9, and in particular SEQ ID NO:6. By aligning the sequences, one skilled in the art can identify corresponding residues, for example, using conserved and identical amino acid residues as guides. In general, to identify corresponding positions, the sequences of amino acids are aligned so that the highest order match is obtained (see, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; Carillo et al. (1988) SIAM J Applied Math 48:1073). FIGS. 2A-2B, 3A-3C, 5A-5B and 21A-21C exemplify exemplary alignments and identification of exemplary corresponding residues for replacement.

[0186] As used herein, "sequence identity" refers to the number of identical or similar amino acids or nucleotide bases in a comparison between a test and a reference polypeptide or polynucleotide. Sequence identity can be determined by sequence alignment of nucleic acid or protein sequences to identify regions of similarity or identity. For purposes herein, sequence identity is generally determined by alignment to identify identical residues. The alignment can be local or global. Matches, mismatches and gaps can be identified between compared sequences. Gaps are null amino acids or nucleotides inserted between the residues of aligned sequences so that identical or similar characters are aligned. Generally, there can be internal and terminal gaps. Sequence identity can be determined by taking into account gaps as the number of identical residues/length of the shortest sequence.times.100. When using gap penalties, sequence identity can be determined with no penalty for end gaps (e.g. terminal gaps are not penalized). Alternatively, sequence identity can be determined without taking into account gaps as the number of identical positions/length of the total aligned sequence.times.100.

[0187] As used herein, a "global alignment" is an alignment that aligns two sequences from beginning to end, aligning each letter in each sequence only once. An alignment is produced, regardless of whether or not there is similarity or identity between the sequences. For example, 50% sequence identity based on "global alignment" means that in an alignment of the full sequence of two compared sequences each of 100 nucleotides in length, 50% of the residues are the same. It is understood that global alignment also can be used in determining sequence identity even when the length of the aligned sequences is not the same. The differences in the terminal ends of the sequences will be taken into account in determining sequence identity, unless the "no penalty for end gaps" is selected. Generally, a global alignment is used on sequences that share significant similarity over most of their length. Exemplary algorithms for performing global alignment include the Needleman-Wunsch algorithm (Needleman et al. (1970) J. Mol. Biol. 48: 443). Exemplary programs for performing global alignment are publicly available and include the Global Sequence Alignment Tool available at the National Center for Biotechnology Information (NCBI) website (ncbi.nlm.nih.gov/), and the program available at deepc2.psi.iastate.edu/aat/align/align.html.

[0188] As used herein, a "local alignment" is an alignment that aligns two sequence, but only aligns those portions of the sequences that share similarity or identity. Hence, a local alignment determines if sub-segments of one sequence are present in another sequence. If there is no similarity, no alignment will be returned. Local alignment algorithms include BLAST or Smith-Waterman algorithm (Adv. Appl. Math. 2:482 (1981)). For example, 50% sequence identity based on "local alignment" means that in an alignment of the full sequence of two compared sequences of any length, a region of similarity or identity of 100 nucleotides in length has 50% of the residues that are the same in the region of similarity or identity.

[0189] For purposes herein, sequence identity can be determined by standard alignment algorithm programs used with default gap penalties established by each supplier or manually. Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Whether any two nucleic acid molecules have nucleotide sequences or any two polypeptides have amino acid sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical," or other similar variations reciting a percent identity, can be determined using known computer algorithms based on local or global alignment (see e.g., wikipedia.org/wiki/Sequence_alignment_software, providing links to dozens of known and publicly available alignment databases and programs). Generally, for purposes herein sequence identity is determined using computer algorithms based on global alignment, such as the Needleman-Wunsch Global Sequence Alignment tool available from NCBI/BLAST (blast.ncbi.nlm nih.gov/Blast.cgi?CMD=Web&Page_TYPE=BlastHome); LAlign (William Pearson implementing the Huang and Miller algorithm (Adv. Appl. Math. (1991) 12:337-357)); and program from Xiaoqui Huang available at deepc2.psi.iastate.edu/aat/align/align.html. Generally, when comparing nucleotide sequences herein, an alignment with penalty for end gaps is used. Local alignment also can be used when the sequences being compared are substantially the same length.

[0190] As used herein, the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide. In one non-limiting example, "at least 90% identical to" refers to percent identities from 90 to 100% relative to the reference polypeptides. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polypeptide length of 100 amino acids are compared, no more than 10% (i.e., 10 out of 100) of amino acids in the test polypeptide differs from that of the reference polypeptides. Similar comparisons can be made between a test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g., 10/100 amino acid difference (approximately 90% identity). Differences also can be due to deletions or truncations of amino acid residues. Differences are defined as nucleic acid or amino acid substitutions, insertions or deletions. Depending on the length of the compared sequences, at the level of homologies or identities above about 85-90%, the result reasonably independent of the program and gap parameters set; such high levels of identity can be assessed readily, often without relying on software.

[0191] As used herein, the terms "substantially identical" or "similar" varies with the context as understood by those skilled in the relevant art, but that those of skill can assess such.

[0192] As used herein, an aligned sequence refers to the use of homology (similarity and/or identity) to align corresponding positions in a sequence of nucleotides or amino acids. Typically, two or more sequences that are related by about or 50% or more identity are aligned. An aligned set of sequences refers to 2 or more sequences that are aligned at corresponding positions and can include aligning sequences derived from RNAs, such as ESTs and other cDNAs, aligned with genomic DNA sequence.

[0193] As used herein, substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance. Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art. A substantially chemically pure compound can, however, be a mixture of stereoisomers or isomers. In such instances, further purification might increase the specific activity of the compound.

[0194] As used herein, isolated or purified polypeptide or protein or biologically-active portion thereof is substantially free of cellular material or other contaminating proteins from the cell of tissue from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. Preparations can be determined to be substantially free if they appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as proteolytic and biological activities, of the substance. Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art. A substantially chemically pure compound, however, can be a mixture of stereoisomers. In such instances, further purification might increase the specific activity of the compound.

[0195] As used herein, substantially free of cellular material includes preparations of cytochrome P450s, cytochrome P450 reductases, terpenes or terpenoid products in which the cytochrome P450, cytochrome P450 reductase, terpene or terpenoid product is separated from cellular components of the cells from which it is isolated or produced. In one embodiment, the term substantially free of cellular material includes preparations of cytochrome P450s, cytochrome P450 reductases, terpenes or terpenoid products having less that about or less than 30%, 20%, 10%, 5% or less (by dry weight) of non-cytochrome P450s, cytochrome P450 reductases, terpenes or terpenoid products, including cell culture medium. When the cytochrome P450 or cytochrome P450 reductase is recombinantly produced, it also is substantially free of culture medium, i.e., culture medium represents less than about or at 20%, 10% or 5% of the volume of the cytochrome P450 or cytochrome P450 reductase preparation.

[0196] As used herein, the term substantially free of chemical precursors or other chemicals includes preparations of cytochrome P450 or cytochrome P450 reductase proteins in which the protein is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. The term includes preparations of cytochrome P450 or cytochrome P450 reductase proteins having less than about or less than 30% (by dry weight), 20%, 10%, 5% or less of chemical precursors or non-synthase chemicals or components.

[0197] As used herein, synthetic, with reference to, for example, a synthetic nucleic acid molecule or a synthetic gene or a synthetic peptide refers to a nucleic acid molecule or polypeptide molecule that is produced by recombinant methods and/or by chemical synthesis methods.

[0198] As used herein, production by recombinant methods by using recombinant DNA methods refers to the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.

[0199] As used herein, vector (or plasmid) refers to discrete DNA elements that are used to introduce heterologous nucleic acid into cells for either expression or replication thereof. The vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome. Also contemplated are vectors that are artificial chromosomes, such as bacterial artificial chromosomes, yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vehicles are well known to those of skill in the art.

[0200] As used herein, expression refers to the process by which nucleic acid is transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the nucleic acid is derived from genomic DNA, expression can, if an appropriate eukaryotic host cell or organism is selected, include processing, such as splicing of the mRNA.

[0201] As used herein, an expression vector includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments. Such additional segments can include promoter and terminator sequences, and optionally can include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or can contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.

[0202] As used herein, vector also includes "virus vectors" or "viral vectors." Viral vectors are engineered viruses that are operatively linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells. Viral vectors include, but are not limited to, adenoviral vectors, retroviral vectors and vaccinia virus vectors.

[0203] As used herein, operably or operatively linked when referring to DNA segments means that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates downstream of the promoter and upstream of any transcribed sequences. The promoter is usually the domain to which the transcriptional machinery binds to initiate transcription and proceeds through the coding segment to the terminator.

[0204] As used herein, a "chimeric protein" or "fusion protein" refers to a polypeptide operatively-linked to a different polypeptide. For example, a polypeptide encoded by a nucleic acid sequence containing a coding sequence from one nucleic acid molecule and the coding sequence from another nucleic acid molecule in which the coding sequences are in the same reading frame such that when the fusion construct is transcribed and translated in a host cell, the protein is produced containing the two proteins. The two molecules can be adjacent in the construct or separated by a linker polypeptide that contains, 1, 2, 3, or more, but typically fewer than 10, 9, 8, 7, or 6 amino acids. The protein product encoded by a fusion construct is referred to as a fusion polypeptide. A chimeric or fusion protein provided herein can include one or more santalene synthase polypeptides, or a portion thereof, and/or one or more cytochrome P450 polypeptides, or a portion thereof, and/or one or more cytochrome P450 reductase polypeptides and/or one or more other polypeptides, for any one or more of a transcriptional/translational control signals, signal sequences, a tag for localization, a tag for purification, a protein for identification, part of a domain of an immunoglobulin G, and/or a targeting agent. A chimeric cytochrome P450 polypeptide or cytochrome P450 reductase polypeptide also includes those having their endogenous domains or regions of the polypeptide exchanged with another polypeptide. These chimeric or fusion proteins include those produced by recombinant means as fusion proteins, those produced by chemical means, such as by chemical coupling, through, for example, coupling to sulfhydryl groups, and those produced by any other method whereby at least one polypeptide (i.e. cytochrome P450 or cytochrome P450 reductase), or a portion thereof, is linked, directly or indirectly via linker(s) to another polypeptide.

[0205] As used herein, the term assessing or determining includes quantitative and qualitative determination in the sense of obtaining an absolute value for the activity of a product, and also of obtaining an index, ratio, percentage, visual or other value indicative of the level of the activity. Assessment can be direct or indirect.

[0206] As used herein, recitation that a polypeptide "consists essentially" of a recited sequence of amino acids means that only the recited portion, or a fragment thereof, of the full-length polypeptide is present. The polypeptide can optionally, and generally will, include additional amino acids from another source or can be inserted into another polypeptide

[0207] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to polypeptide, comprising "an amino acid replacement" includes polypeptides with one or a plurality of amino acid replacements.

[0208] As used herein, ranges and amounts can be expressed as "about" a particular value or range. About also includes the exact amount. Hence "about 5%" means "about 5%" and also "5%."

[0209] As used herein, "optional" or "optionally" means that the subsequently described event or circumstance does or does not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, an optional step of isolating a terpene means that the terpene is isolated or is not isolated, or, an optional stop of isolating a terpenoid means that the terpenoid is isolated or is not isolated.

[0210] As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, (1972) Biochem. 11:1726).

[0211] For clarity of disclosure, and not by way of limitation, the detailed description is divided into the subsections that follow.

B. OVERVIEW

[0212] Provided herein are cytochrome P450 enzymes from Santalum album, and variants and modified forms thereof, for production of santalols and other sesquiterpenoids. Such cytochrome P450s catalyze the biosynthetic production of santalols or bergamotols from santalenes and bergamotenes, both of which can be generated biosynthetically from farnesyl pyrophosphate by the enzyme santalene synthase (see, WO 2011/000026 and Jones et al. (2011) J Biol Chem 286:17445-17454. Also provided herein are cytochrome P450 reductases from Santalum album, and variants and modified forms thereof. Also provided herein are methods of making santalols and other sesquiterpenoids from farnesyl diphosphate and/or santalenes and bergamotene. The provided cytochrome P450 enzymes provide for production of these valuable products, including santalols and bergamotols, in commercially useful quantities and in a cost effective and energy efficient manner.

[0213] 1. Biosynthesis of Terpenoids

[0214] Terpenes are a large and diverse class of organic compounds that are produced by a variety of plants from acyclic pyrophosphate isoprene precursors such as geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), and geranylgeranyl pyrophosphate (GGPP). Terpenes are named based on the number of isoprene (C.sub.5H.sub.8) units they contain. For example, monoterpenes are derived from GPP and contain 10 carbons, sesquiterpenes are derived from FPP and contain 15 carbons and diterpenes are derived from GGPP and contain 20 carbons. Terpenes that have been chemically modified are referred to as terpenoids or isoprenoids. Terpenes and terpenoids are the primary constituents of essential oils of plants and are widely used as flavor additives for food, fragrances in perfumery and in traditional and alternative medicine.

[0215] Santalols and bergamotol are sesquiterpenoids that occur in plants, including the heartwood of Santalum species, including Santalum album (Indian Sandalwood, White Sandalwood, Chandana), Santalum austrocaledonicum (Australian Sandalwood) and Santalum spicatum. Bergamotol can additionally be found in plants such as orchids. Santalols and bergamotol are the oxidation products of santalenes and bergamotene, respectively. In S. album, about 90% of the essential oil is composed of the sesquiterpene alcohols (Z)-.alpha.-, (Z)-.beta.-, and (Z)-epi-.beta.-santalol and (Z)-.alpha.-exo-bergamotol. The .alpha.- and .beta.-santalols are the most important contributors to sandalwood oil fragrance. (Z)-.alpha.-Santalol and (Z)-.beta.-santalol are the major components of authentic S. album oil.

[0216] The P450 enzymes provided herein can be employed to produce the sesquiterpene alcohols important for the sandalwood oil fragrance. Santalenes and bergamotene are synthesized biosynthetically from the acyclic pyrophosphate precursor FPP by the terpene synthase santalene synthase (see WO 2011/000026 and Jones et al. (2011) J Biol Chem 286:17445-17454). Santalene synthase is known to produce a mixture of santalenes (i.e. .alpha.-, .beta.-, epi-.beta.-santalene and .alpha.-exo-bergamotene). Exemplary of santalene synthases are Santalum album santalene synthase (SaSSY) set forth in SEQ ID NO:16 and encoding the amino acid sequence set forth in SEQ ID NO:17; Santalum austrocaledonicium santalene synthase (SauSSY, Genbank Accession Nos. HQ343277 or AD087001) set forth in SEQ ID NO:59 and encoding the sequence of amino acids set forth in SEQ ID NO:52; or Santalum spicatum santalene synthase (SspiSSy, Genbank Accession No. HQ343278 or AD087002) set forth in SEQ ID NO: 60 and encoding the sequence of amino acids set forth in SEQ ID NO:53.

[0217] The cytochrome P450 oxidase polypeptides provided herein are found to catalyze the formation of one or more of an .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene, epi-.beta.-santalol from epi-.beta.-santalene and/or .alpha.-trans-bergamotol from .alpha.-trans-bergamotene. Hydroxylation or monooxygenation of terpene substrates by the cytochrome P450 oxidase is generally performed in the presence of a cytochrome reductase. For example, Santalum album cytochrome reductases (SaCPR) provided herein are included in biosynthesis to supply electrons from NADPH to the cytochrome P450. Thus, the pathways for biosynthesis of santalols and bergamotols, including components of sandalwood oil, can be metabolically engineered in host cells by transforming nucleic acid encoding a cytochrome P450 oxidase and cytochrome P450 reductase provided herein in combination with a nucleic acid molecule encoding a santalene synthase.

[0218] a. Santalols

[0219] In particular, santalols responsible for the fragrance of sandalwood oil include .alpha.-santalols (1 and 9), .beta.-santalols (2 and 10) and epi-.beta.-santalols (3 and 11) (see FIG. 1). (Z)-.alpha.-Santalol (Z-.alpha.-santalol; (Z)-5-(1R,2S,6S)-2,3-dimethyltricyclol[2.2.1.0.sup.2,6]heptan-3-yl)-2-met- hylpent-2-en-1-ol; 1) and (E)-.alpha.-Santalol ((E)-5-((1R,2s,6S)-2,3-dimethyltricyclo[2.2.1.02,6]heptan-3-yl)-2-methylp- ent-2-en-1-ol; 9) are synthesized biosynthetically by oxidation of the sesquiterpene .alpha.-santalene 5 (see FIG. 1). (Z)-.beta.-Santalol (Z-p-santalol; (Z)-2-methyl-5-[(1S,2R,4R)-2-methyl-3-methylene-bicyclo[2.2.1]heptan-2-yl- ]pent-2-en-1-ol; 2) and (E)-.beta.-Santalol ((E)-2-methyl-5-((1S,2R,4R)-2-methyl-3-methylenebicyclo[2.2.1]heptan-2-yl- )pent-2-en-1-ol; 10) are synthesized biosynthetically by oxidation of the sesquiterpene .beta.-santalene 6 (see FIG. 1). (E)-epi-.beta.-Santalol ((E)-2-methyl-5-[(1R,2R,4S)-2-methyl-3-methylenebicyclo[2.2.1]heptan-2-yl- )pent-2-en-1-ol; 3) and (Z)-epi-.beta.-Santalol ((Z)-2-methyl-5-((1R,2R,4S)-2-methyl-3-methylenebicyclo[2.2.1]heptan-2-yl- )pent-2-en-1-ol; 11) are synthesized biosynthetically by oxidation of the sesquiterpene epi-.beta.-santalene 7 (see FIG. 1).

##STR00010##

[0220] b. Bergamotol

[0221] (Z)-.alpha.-trans-Bergamotol ((Z)-.alpha.-exo-bergamotol; cis-.alpha.-trans-bergamotol; (2Z)-5-[(1S,5S,6R)-2,6-dimethylbicyclo[3.3.1]hept-2-en-6-yl]-2-methyl-2-p- enten-1-ol; 4) and (E)-.alpha.-trans-Bergamotol ((E)-.alpha.-exo-bergamotol; (E)-5-((1S,5S,6R)-2,6-dimethylbicyclo[3.1.1]hept-2-en-6-yl)-2-methylpent-- 2-en-1-ol; 12) are sesquiterpenoids found in sandalwood oil that are synthesized biosynthetically by oxidation of the sesquiterpene .alpha.-trans-bergamotene 8 (see FIG. 1).

##STR00011##

[0222] 2. Cytochrome P450 Enzymes

[0223] Cytochromes P450 (CYPs) are a superfamily of hemoproteins, or heme-thiolate proteins, that catalyze the singular insertions of oxygen into a diverse range of hydrophobic substrates, often with high regio- and stereoselectivity. Cytochrome P450s are ubiquitous proteins that participate in metabolizing a wide range of compounds. As such, P450s are widespread in nature and are involved in processes such as detoxifying xenobiotics, catabolism of unusual carbon sources and biosynthesis of secondary metabolites. CYPs are noted for their broad substrate specificities and use of oxygen without the need for phosphorylation of adenosine diphosphate (ADP). They can mediate monooxygenations, hydroxylations at nitrogen and sulfur heteroatoms, epoxidations, dehalogenations, deaminations and dealkylations. Particular reactions catalyzed by CYPs include demethylation, hydroxylation, epoxidation, N-oxidation, sulfooxidation, N-, S-, and O-dealkylations, desulfation, deamination, and reduction of azo, nitro, and N-oxide groups.

[0224] Typically, cytochrome P450s are monooxygenases, incorporating one oxygen atom into a substrate. In general, monooxygenations require one or two additional proteins to transfer electrons from NAD(P)H to the heme iron and CYPs are placed in groups or classes based on their electron transfer partner. Class I CYPs, common in bacterial and eukaryotic mitochondrial P450 systems, use a FAD-containing reductase and an iron-sulfer redoxin or ferrodoxin. The FAD-containing reductase transfers electrons from NAD(P)H to the ferrodoxin which in turn reduces the CYP. Class II cytochrome P450s are the most common CYPs in eukaryotes and plants, and also include microsomal and bacterial P450 systems. Class II CYPs use a NADPH:Cytochrome P450 reductase (or cytochrome P450 reductase) to transfer electrons from NAD(P)H to a cytochrome P450. Numerous other classes exist that exploit other electron transfer chains.

[0225] Cytochrome P450s are named using a systematic nomenclature that includes the root symbol CYP followed by number designating the family, a letter designating the subfamily and a number representing the individual gene, for example, CYP76-G5. Families share greater than 40% amino acid sequence identity and subfamilies share greater than 55% amino acid sequence identity.

[0226] Plant cytochrome P450 gene families are very large. For example, total genome sequence examination reveals at least 272 predicted cytochrome P450 genes in Arabidopsis and at least 455 unique cytochrome P450 genes in rice (see, e.g., Nelson et al. (2004) Plant Physiol. 135(2):756-772). Plant CYPs can be localized to the endoplasmic reticulum (ER) and to chloroplasts. In plants, CYPs include a wide range of hydroxylases, epoxidases, peroxidases and oxygenases that largely are based upon Class II monooxygenations. Plant p450s participate in biochemical pathways that include, for example, the synthesis of plant products such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides, and glucosinolates (see, e.g., Chapple (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:311-343).

[0227] a. Structure

[0228] While sequence conservation among cytochrome P450s is relatively low, their general topography and structural fold are highly conserved. There are only 3 absolutely conserved residues among all CYPs, namely the glutamic acid and arginine of the ExxR motif (SEQ ID NO:54) and the heme-binding cysteine. Conserved structural nodules are important for structure and function, and variable regions involved in substrate recognition dictate individual properties (see, e.g., Werck-Reichhart and Feyereisen (2000) Genome Biology 1(6)3000.1-3000.9, Sirim et al. (2010) BMC Structural Biology 10:34 and Baudry et al. (2006) Prot Eng Design & Selection 19:343-353).

[0229] Cytochrome P450s typically contain a helices, designated A through L, and .beta.-pleated sheets, designated 1 through 5, contained within a .beta. domain that is associated with substrate recognition and composed predominately of .beta. sheets and an a domain that contains the catalytic center and is predominantly a helices. The structural regions are as follows, from N-terminus to C-terminus: helix A, .beta. strand 1-1, .beta. strand 1-2, helix B, .beta. strand 1-5, helix B', helix C, helix C', helix D, .beta. strand 3-1, helix E, helix F, helix G, helix H, .beta. strand 5-1, .beta. strand 5-2, helix I, helix J, helix J', helix K, .beta. strand 1-4, .beta. strand 2-1, .beta. strand 2-2, .beta. strand 1-3, helix K', helix K'', Heme domain, helix L, .beta. strand 3-3, .beta. strand 4-1, .beta. strand 4-2 and .beta. strand 3-2 (see, e.g., Werck-Reichhart and Feyereisen (2000) Genome Biology 1(6)3000.1-3000.9).

[0230] Cytochrome P450s are anchored to the endoplasmic reticulum (ER) or chloroplast in plants via a transmembrane helix near the N-terminus of the protein (Chapple (1998) Annu Rev Plant Physiol Plant Mol Biol 49:311-343). The transmembrane helix is typically followed by hinge region containing a series of basic amino acid residues and a proline-rich region containing the consensus sequence (P/I)PGPx(G/P)xP (SEQ ID NO:55). This hinge region allows for optimal orientation of the enzyme in relation to the membrane. Deletion of the proline hinge region resulted in complete loss of activity (Szczesna-Skorupa et al. (1993) Arch Biochem Biophys 304:170-175) and mutation of proline residues to alanine disrupted structure so as to eliminate heme incorporation (Yamazaki et al. (1993) J Biochem 114:652-657).

[0231] The conserved CYP core region is composed of a coil termed the `meander`, a four-helix bundle (helices D, E, I and L), helices J and K and two sets of .beta.-sheets (Werck-Reichhart and Feyereisen (2000) Genome Biology 1(6)3000.1-3000.9). The core region contains the heme-binding loop containing the P450 consensus sequence GRRxCP(A/G) (SEQ ID NO:56) located on the proximal face of the heme just before helix L, with an absolutely conserved cysteine that serves as the 5th ligand for the heme iron. The active site for catalysis is the iron-protoporphryin IX (heme) with the thiolate of the conserved cysteine residue as the fifth ligand; the final coordination site is left to bind and activate molecular oxygen (Groves et al., 1995 In Cytochrome P450: Structure, Mechanism, and Biochemistry (Ed: Ortiz de Montellano) Plenum Press, New York, N.Y., pp. 3-48). The core region also contains the central part of helix I containing the threonine-containing binding pocket for the oxygen molecule required in catalysis having a consensus sequence (A/G)Gx(D/E)T(T/S) (SEQ ID NO:57) which also corresponds to the proton-transfer groove. Finally, the core region contains the absolutely conserved ExxR motif (SEQ ID NO:54) in helix K on the proximal side of heme (see, e.g., Werck-Reichhart and Feyereisen (2000) Genome Biology 1(6)3000.1-3000.9). The proximal face of the enzyme is involved in redox partner recognition and electron transfer to active site. Protons flow into active site channel from distal face. The substrate access channel is located in close contact with the membrane between the F-G loop, A helix and .beta. strands 1-1 and 1-2.

[0232] Cytochrome P450 substrate recognitions sites (SRS) are diverse and include SRS1, the loop region between B and C helices; SRS2, the C-terminal end of the F helix; SRS3, part of the FG loop and N-terminal end of the G helix; SRS4, helix I containing SRS4 extending over the pyrrole ring B in the active site; SRSS, the loop between the K helix and strand 4 of .beta.-sheet 1; and SRS6, the .beta. turn in .beta.-sheet 4.

[0233] b. Function

[0234] Cytochrome P450s catalyze regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures. Cytochrome P450s activate molecular oxygen using an iron-heme center and use a redox electron shuttle to support the oxidation reaction. The general reaction for hydroxylation by the cytochrome P450 system is,

RH+NADPH+H.sup.++O.sub.2.fwdarw.ROH+NADP.sup.++H.sub.2O,

where R represents a substrate compound. As noted, typically, cytochrome P450s are monooxygenases, catalyzing the insertion of one of the atoms of molecular oxygen into a substrate, with the second oxygen being reduced to water. Catalysis involves 1) substrate binding; 2) one-electron reduction of the complex to a ferrous state; 3) binding of molecular oxygen to give the superoxide complex; and 4) a second reduction leading to a short lived activated oxygen species. The activated oxygen attacks the substrate resulting, typically, in monooxygenation of the substrate. Other reactions catalyzed by CYPs include dealkylation, dehydration, dehydrogenation, isomerization, dimerization, carbon-carbon bond cleavage and reduction.

[0235] 3. Cytochrome P450 Reductase

[0236] Cytochrome P450 reductases (NADPH:cytochrome P450 reductase; NADPH-cytochrome P450 oxidoreductase; NADPH:ferrihemoprotein oxidoreductase; NADPH:P450 oxidoreductase; CPR; CYPOR; EC 1.6.2.4) are multidomain enzymes of the diflavin reductase family required for electron transfer from NAD(P)H to cytochrome P450s, heme oxygenases, cytochrome b.sub.5 and squalene epoxidases (Louerat-Orieu et al (1998) Eur J Biochem 258:1040-1049). Plants are known to contain multiple isoforms of cytochrome P450 reductases (see, Ro et al. (2002) Plant Physiology 130:1837-1851; Mizutani and Ohta (1998) Plant Physiology 116:357-367). Generally, at least one CPR is constitutively expressed and the other CPRs are enhanced by environmental stresses such as UV light and pathogen infection. In addition, plant cytochrome P450 reductases can be localized to the ER or to the chloroplast, with the location determined by the corresponding partner cytochrome P450 enzyme.

[0237] a. Structure

[0238] Cytochrome P450 reductases share amino acid sequence homology (about 30% up to about 90%) among different species, including as bacteria, yeast, fungi, plants, fish, insects and mammals (Louerat-Orieu et al (1998) Eur J Biochem 258:1040-1049). Cytochrome P450 reductases contain two functional domains, a hydrophobic N-terminal single .alpha.-helical membrane anchoring domain (amino acids 1-95 of SEQ ID NO:12) and a hydrophilic C-terminal catalytic domain (amino acids 96-704 of SEQ ID NO:12) (Wang et al. (1997) Proc Natl Acad Sci USA 94:8111-8416). The N-terminal domain contains a hydrophobic membrane anchoring domain (amino acids 40-60 of SEQ ID NO:12) that anchors the protein to a membrane, for example, to the ER or chloroplast in plants, thus ensuring the CPR and the CYP are spatially related to allow for electron transfer. The N-terminal domain is not necessary for activity, as the C-terminal soluble domain alone is capable transferring electrons to cytochrome c or other electron acceptors. The C-terminal soluble domain contains two structural domains, a N-terminal flavin mononucleotide (FMN) domain (amino acids of 101-244 SEQ ID NO:12) and a C-terminal flavin adenine dinucleotide (FAD) domain (amino acids 301-704 of SEQ ID NO:12) (Dym and Eisenberg (2001) Protein Science 10:1712-1728). The FMN domain is homologous to flavodoxin that allows for binding to flavin cofactor FMN. The FAD domain that contains binding domains for flavin cofactor FAD and for NADPH, and additionally contains residues necessary for catalytic activity. The FMN and FAD domains are joined by a connecting domain (amino acids 245-300 of SEQ ID NO:12) that is responsible for the relative orientation of the FMN and FAD domains ensuring proper alignment of the two flavin cofactors necessary for efficient electron transfer.

[0239] The N-terminal FMN domain has an antiparallel .beta.-structure while the C-terminal NAD(P) subdomain has the typology typical of pyridine dinucleotide-binding folds. The FMN domain contains a five-stranded .beta.-sheet flanked by five .alpha.-helices, with the FMN positioned at the C-terminal side of the .beta.-sheet. The core of the FAD binding domain is an anti-parallel flattened .beta.-barrel and the NADP(H) binding domain is a parallel five-stranded .beta.-sheet flanked by .alpha.-helices. The connecting domain is composed mainly of .alpha.-helices. The structural regions are as follows, from N-terminus to C-terminus: .alpha.-helix A; .beta.-strand 1; .alpha.-helix B; .beta.-strand 2; .alpha.-helix C; .beta.-strand 3; .alpha.-helix D; .beta.-strand 4; .alpha.-helix E; .beta.-strand 5; .alpha.-helix F; .beta.-strand 6; .beta.-strand 7; .beta.-strand 8, .beta.-strand 9; .beta.-strand 10; .alpha.-helix G; .beta.-strand 11; .beta.-strand 12; .beta.-strand 12'; .alpha.-helix H; .alpha.-helix I; .alpha.-helix J; .alpha.-helix K; .alpha.-helix M; .beta.-strand 13; .beta.-strand 14; .beta.-strand 15; .alpha.-helix N; .beta.-strand 16; .beta.-strand 16'; .beta.-strand 17; .alpha.-helix O; .beta.-strand 18; .alpha.-helix P; .beta.-strand 10; .alpha.-helix Q; .alpha.-helix R; .beta.-strand 20; .alpha.-helix S; .alpha.-helix T; and .beta.-strand 21.

[0240] Cytochrome P450 reductases contain conserved cofactor and substrate binding domains, including FMN-, FAD-, NADPH-binding regions and cytochrome c- and cytochrome P450-binding sites. The P450 and cytochrome c binding sites contains amino acids 232-240 of SEQ ID NO12. The FMN domain contains binding regions for the FMN pyrophosphate (amino acids 98-119 of SEQ ID NO:12) and the FMN isoalloxazine ring (amino acids 161-214 of SEQ ID NO:12). The FAD domain contains binding regions for the FAD pyrophosphate (amino acids 317-353 of SEQ ID NO:12) and the FAD isoalloxazine ring (amino acids 482-505 of SEQ ID NO:12). The FAD binding pocket includes amino acids 344, 482, 484, 485, 500-502, 516-519 and 704 of SEQ ID NO:12 and the FAD binding motif includes amino acids 482, 484 and 485 of SEQ ID NO:12. The FAD domain also contains binding regions for the NADPH ribose and pyrophosphate (amino acids 555-576 of SEQ ID NO:12) and the NADPH nicotinamide (amino acids 651-668 of SEQ ID NO:12). The NADPH binding pocket includes amino acid residues 324, 502, 204, 560, 561, 595, 595, 624, 625, 630, 632 634, 659, 663 and 666 of SEQ ID NO:12. Amino acid residues Ser485, Cys657, Asp702 and Trp704 of SEQ ID NO:12 are the catalytic residues involved in hydride transfer (Hubbard et al. (2001) J Biol Chem 276:29163-29170). Amino acid residues 516, 519 and 522 of SEQ ID NO:12 are involved in the phosphate binding motif (Dym and Eisenberg (2001) Protein Science 10:1712-1728). The .beta..alpha..beta. structure motif is formed from amino acid residues 557, 560-563 and 565 of SEQ ID NO:12 (Dym and Eisenberg (2001) Protein Science 10:1712-1728).

[0241] b. Function

[0242] Cytochrome P450 reductases shuttle two electrons from NAD(P)H to cytochrome P450 through the flavin cofactors FAD and FMN. FAD receives a hydride anion from the two electron donor NAD(P)H and passes the electrons one at a time to FMN. FMN then donates the electrons to the cytochrome P450. Cytochrome P450 uses the electrons, as described above, for the hydroxylation of various substrates.

C. CYTOCHROME P450 POLYPEPTIDES AND NUCLEIC ACID MOLECULES ENCODING THE CYTOCHROME P450 POLYPEPTIDES

[0243] Provided herein are cytochrome P450 polypeptides, including cytochrome P450 santalene oxidase polypeptides and cytochrome P450 bergamotene oxidase polypeptides. Also provided herein are nucleic acid molecules that encode any of the cytochrome P450 polypeptides provided herein. The cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of .alpha.-santalol, .beta.-santalol or epi-.beta.-santalol from .alpha.-santalene, .beta.-santalene or epi-.beta.-santalene, respectively, including, the production of .beta.-santalol from .beta.-santalene. The cytochrome P450 santalene oxidase polypeptides provided herein are also capable of catalyzing the formation of .alpha.-trans-bergamotol from .alpha.-trans-bergamotene. In some examples, the nucleic acid molecules that encode the cytochrome P450 santalene oxidase polypeptides are those that are the same as or substantially the same as those that are isolated from the sandalwood tree Santalum album. In other example, the nucleic acid molecules and encoded cytochrome P450 santalene oxidase polypeptides are variants of those isolated from the sandalwood tree Santalum album. The cytochrome P450 bergamotene oxidase polypeptides provided herein catalyze the formation of .alpha.-trans-bergamotol from .alpha.-trans-bergamotene. In some examples, the nucleic acid molecules that encode the cytochrome P450 bergamotene oxidase polypeptides are those that are the same as those that are isolated from the sandalwood tree Santalum album. In other examples, the nucleic acid molecules and encoded cytochrome P450 bergamotene oxidase polypeptides are variants of those isolated from the sandalwood tree Santalum album.

[0244] Also provided herein are modified cytochrome P450 polypeptides and nucleic acid molecules that encode any of the modified cytochrome P450 polypeptides provided herein. The modifications can be made in any region of a cytochrome P450 polypeptide, including a cytochrome P450 santalene oxidase polypeptide or cytochrome P450 bergamotene oxidase polypeptide, provided the resulting modified cytochrome P450 polypeptide retains at least retains the catalytic activity of the unmodified cytochrome P450 polypeptide. For example, modifications can be made to a cytochrome P450 santalene oxidase polypeptide provided the resulting modified cytochrome P450 santalene oxidase polypeptide retains cytochrome P450 santalene oxidase activity (i.e., the ability to catalyze the hydroxylation of a santalene, namely .alpha.-santalene, .beta.-santalene or epi-.beta.-santalene). In another example, modifications can be made to a cytochrome P450 bergamotene oxidase polypeptide provided the resulting modified cytochrome P450 bergamotene oxidase polypeptide retains cytochrome P450 bergamotene oxidase activity (i.e., the ability to catalyze the hydroxylation of a bergamotene, namely .alpha.-trans-bergamotene).

[0245] The modifications can include, but are not limited to, codon optimization of the nucleic acids and/or changes that results in a single amino acid modification in the encoded polypeptide, such as single or multiple amino acid replacements (substitutions), insertions or deletions, or multiple amino acid modifications, such as multiple amino acid replacements, insertions or deletions, including swaps of regions or domains of the polypeptide. In some examples, entire or partial domains or regions, such as any domain or region described herein below, are exchanged with corresponding domains or regions or portions thereof from another cytochrome P450 polypeptide. Exemplary of modifications are amino acid replacements, including single or multiple amino acid replacements. For example, modified cytochrome P450 polypeptides provided herein can contain at least or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120 or more modified positions compared to the cytochrome P450 polypeptide not containing the modification.

[0246] Provided herein are cytochrome P450 polypeptides from the CYP76 family. Provided herein is a CYP76 cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:50. Also provided herein are cytochrome P450 polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 polypeptide set forth in SEQ ID NO:50. For example, the cytochrome P450 polypeptides provided herein can exhibit at least or at least about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a cytochrome P450 polypeptide set forth in SEQ ID NO:50, providing the resulting cytochrome P450 polypeptide at least retains cytochrome P450 monooxygenase activity (i.e., the ability to catalyze the hydroxylation or monooxygenation of a terpene). Also provided herein are modified cytochrome P450 polypeptides from the CYP76 family. In particular, modified cytochrome P450 polypeptides provided herein contain amino acid replacements or substitutions, additions or deletions, truncations or combinations thereof with reference to the cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:50. It is within the level of one of skill in the art to make such modifications in cytochrome P450 polypeptides or any variant thereof and test each for cytochrome P450 activity described herein, such as monooxygenase activity.

[0247] Also provided herein are CYP76 nucleic acid molecules that have a sequence of amino acids set forth in SEQ ID NO:1, or degenerates thereof, that encode a cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:50. The CYP76 nucleic acid molecule set forth in SEQ ID NO:1 can be used to design primers that are used to identify and/or clone additional CYP proteins. Also provided herein are nucleic acid molecules encoding a cytochrome P450 polypeptide having at least 85% sequence identity to a sequence of nucleotides set forth in SEQ ID NO:1. For example, the nucleic acid molecules provided herein can exhibit at least or about at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to a sequence of nucleotides set forth in SEQ ID NO:1, so long as the encoded cytochrome P450 polypeptide at least retains cytochrome P450 monooxygenase activity (i.e., the ability to catalyze the hydroxylation of a terpene). Also provided herein are degenerate sequences of the sequence set forth in SEQ ID NO:1 encoding a cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:50. Percent identity can be determined by one skilled in the art using standard alignment programs.

[0248] Provided herein are cytochrome P450 SaCYP76F39v1 (CYP76-G10), SaCYP76F42 (CYP76-G13), SaCYP76F39v2 (CYP76-G15), SaCYP76F40 (CYP76-G16) and SaCYP76F41 (CYP76-G17) polypeptides. Provided herein are cytochrome P450 santalene oxidase polypeptides having a sequence of amino acids set forth in SEQ ID NO:7, 74, 75, 76 or 77. Also provided herein are cytochrome P450 santalene oxidase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77. For example, the cytochrome P450 santalene oxidase polypeptides provided herein can exhibit at least or at least about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO: 7, 73, 74, 75 or 76, providing the resulting cytochrome P450 santalene oxidase polypeptides at least retain cytochrome P450 santalene oxidase activity (i.e., the ability to catalyze the hydroxylation of a santalene, namely .alpha.-santalene, .beta.-santalene or epi-.beta.-santalene). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0249] Provided herein are cytochrome P450 SaCYP76F38v1 (CYP76-G5), SaCYP76F37v1 (CYP76-G11), SaCYP76F38v2 (CYP76-G12) and SaCYP76F37v2 (CYP76-G14) polypeptides. Provided herein are cytochrome P450 bergamotene oxidase polypeptides having a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 or 73. Also provided herein are cytochrome P450 bergamotene oxidase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 bergamotene oxidase polypeptide set forth in SEQ ID NO:6, 8, 9 or 73. For example, the cytochrome P450 bergamotene oxidase polypeptides provided herein can exhibit at least or at least about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a cytochrome P450 bergamotene oxidase polypeptide set forth in SEQ ID NO:6, 8, 9 or 73, providing the resulting cytochrome P450 bergamotene oxidase polypeptide at least retains cytochrome P450 bergamotene oxidase activity (i.e., the ability to catalyze the hydroxylation of a bergamotene). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0250] Also provided herein is cytochrome P450 SaCYP76F43 (CYP76-G18) polypeptide. Provided herein is a cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:78. Also provided herein are cytochrome P450 polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 polypeptide set forth in SEQ ID NO:78. For example, the cytochrome P450 polypeptides provided herein can exhibit at least or at least about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a cytochrome P450 polypeptide set forth in SEQ ID NO:78, providing the resulting cytochrome P450 polypeptide at least retains cytochrome P450 monooxygenase activity (i.e., the ability to catalyze the hydroxylation or monooxygenation of a terpene). In particular, modified cytochrome P450 polypeptides provided herein contain amino acid replacements or substitutions, additions or deletions, truncations or combinations thereof with reference to the cytochrome P450 polypeptide having a sequence of amino acids set forth in SEQ ID NO:78. It is within the level of one of skill in the art to make such modifications in cytochrome P450 polypeptides or any variant thereof and test each for cytochrome P450 activity described herein, such as monooxygenase activity.

[0251] Also, in some examples, provided herein are catalytically active fragments of cytochrome P450 polypeptides. In some examples, the active fragments of the cytochrome P450 polypeptides, including the cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase polypeptides, are modified as described above. Such fragments retain one or more properties of a full-length cytochrome P450 polypeptide, including full-length santalene oxidase or cytochrome P450 bergamotene oxidase polypeptides. Typically, the active fragments exhibit cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase activity (i.e., catalyze the formation of santalols and bergamotols, respectively).

[0252] The cytochrome P450s provided herein, including the cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase polypeptides provided herein, can contain other modifications, for example, modifications not in the primary sequence of the polypeptide, including post-translational modifications. For example, modification described herein can be a cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase that is a fusion polypeptide or chimeric polypeptide, including hybrids of different cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase polypeptides or different cytochrome P450 monooxygenases (e.g. contain one or more domains or regions from another cytochrome P450 monooxygenases) and also synthetic cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase polypeptides prepared recombinantly or synthesized or constructed by other methods known in the art based upon the sequence of known polypeptides.

[0253] The cytochrome P450 santalene oxidase polypeptides or cytochrome P450 bergamotene oxidase polypeptides provided herein can be used to catalyze the production of santalols and bergamotols, respectively. Typically, the cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of santalols from santalenes, e.g., they catalyze the hydroxylation of santalenes. In some examples, the cytochrome P450 santalene oxidases also catalyze the formation of bergamotols from bergamotenes. Typically the cytochrome P450 bergamotene oxidase polypeptides provided herein catalyze the formation of bergamotol from bergamotene, e.g., they catalyze the hydroxylation of bergamotene. Reactions can be performed in vivo, such as in a host cell into which the nucleic acid has been introduced. At least one of the polypeptides will be heterologous to the host. Reactions also can be performed in vitro by contacting with enzyme with the appropriate substrate under appropriate conditions.

[0254] Also provided herein are nucleic acid molecules encoding a santalene synthase and a cytochrome P450 santalene oxidase. Also provided herein are nucleic acid molecules encoding a santalene synthase and a cytochrome P450 bergamotene oxidase. In such examples, expression of the nucleic acid molecule in a suitable host, for example, a bacterial or yeast cell, results in expression of santalene synthase and the cytochrome P450 oxidase. Such cells can be used to produce the santalene synthases and the cytochrome P450 oxidases and/or to perform reactions in vivo to produce santalols and bergamotols. For example, santalols and bergamotols can be generated in a host cell from farnesyl diphosphate (FPP), particularly a yeast cell that overproduces the acyclic terpene precursor FPP. In some examples, a nucleic acid molecule encoding a farnesyl diphosphate synthase, such as a Santalum album farnesyl diphosphate synthase, can also be expressed in the suitable host, for example, a bacterial or yeast cell, resulting in over-expression of FPP.

[0255] Also provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 polypeptide and a cytochrome P450 reductase polypeptide. For example, provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 santalene oxidase polypeptide and a cytochrome P450 reductase polypeptide. In another example, provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 bergamotene oxidase polypeptide and a cytochrome P450 reductase polypeptide. The nucleic acid molecules can be in the same vector or plasmid or on different vectors or plasmids. In such examples, expression of the nucleic acid molecule in a suitable host, for example, a bacterial or yeast cell, results in expression of santalene synthase and the cytochrome P450 oxidase. Such cells can be used to produce the santalene synthases and the cytochrome P450 oxidases and/or to perform reactions in vivo to produce santalols and bergamotols. For example, santalols and bergamotols can be generated in a host cell from farnesyl diphosphate (FPP), particularly a yeast cell that overproduces the acyclic terpene precursor FPP.

[0256] 1. Cytochrome P450 Santalene Oxidase Polypeptides

[0257] Provided herein are cytochrome P450 santalene oxidase polypeptides. Also provided herein are nucleic acid molecules that encode any of the cytochrome P450 santalene oxidase polypeptides provided herein. The cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of catalyze the formation of terpenoids found in sandalwood oil, including .alpha.-santalols, .beta.-santalols, epi-.beta.-santalols and .alpha.-trans-bergamotols. The cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of santalols from santalenes. In some examples, the cytochrome P450 santalene oxidase polypeptides provided herein also catalyze the formation of bergamotols from bergamotene. For example, the cytochrome P450 santalene oxidase polypeptides catalyze the formation of .alpha.-santalol from .alpha.-santalene, .beta.-santalol from .beta.-santalene and/or epi-.beta.-santalol from epi-.beta.-santalene (e.g., the cytochrome P450 santalene oxidase polypeptides catalyze the hydroxylation of .alpha.-santalene, .beta.-santalene and/or epi-.beta.-santalene). In a particular example, the cytochrome P450 santalene oxidase polypeptides catalyze the formation of (E)-.alpha.-santalol from .alpha.-santalene, (Z)-.alpha.-santalol from .alpha.-santalene, (E)-.beta.-santalol from .beta.-santalene, (Z)-.beta.-santalol from .beta.-santalene, (E)-epi-.beta.-santalol from epi-.beta.-santalene and/or (Z)-epi-.beta.-santalol from epi-.beta.-santalene. In some examples, the cytochrome P450 santalene oxidase polypeptides provided herein also catalyze the formation of (Z)-.alpha.-trans-bergamotol and/or (E)-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. In a particular example, the cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and/or (E)-.alpha.-trans-bergamotol. In particular, the cytochrome P450 santalene oxidase polypeptides produce (Z) and (E) stereoisomers of .alpha.- and .beta.-santalol in ratios of approximately 1:5 and 1:4, respectively. The cytochrome P450 santalene oxidase polypeptides exhibit narrow substrate specificity, preferring .alpha.-santalene or .beta.-santalene. In some examples, the cytochrome P450 santalene oxidase polypeptides also converted the substrate .alpha.-bisabolol.

[0258] In some examples, the cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of terpenoids found in sandalwood oil, including .alpha.-santalol, .beta.-santalol, epi-.beta.-santalol and .alpha.-trans-bergamotol, from the terpene reaction products of the acyclic precursor farnesyl pyrophosphate and a santalene synthase. For example, the cytochrome P450 santalene oxidase polypeptides provided herein catalyze the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and/or (E)-.alpha.-trans-bergamotol from the terpene reaction products of the acyclic precursor FPP and a santalene synthase, such as Santalum album santalene synthase (SaSSY; SEQ ID NO:16). The cytochrome P450 santalene oxidase polypeptides catalyze the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and/or (E)-.alpha.-trans-bergamotol in different ratios from those of authentic sandalwood oil (see Example 11 and FIGS. 15A and 15B). For example, the main products formed with SaCYP76F39v1 (SaCYP76-G10) were (E)-.alpha.-santalol and (E)-.beta.-santalol while the main compounds of sandalwood oil are (Z)-.alpha.-santalol and (Z)-.beta.-santalol (see FIGS. 15A and 15B).

[0259] For example, provided herein are cytochrome P450 santalene oxidase polypeptides that have a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 and 77. Also provided herein are cytochrome P450 santalene oxidase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 and 77. For example, the cytochrome P450 santalene oxidase polypeptides provided herein can exhibit at least at or about or 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more amino acid sequence identity to a cytochrome P450 santalene oxidase polypeptide set in any of SEQ ID NOS:7, 74, 75, 76 and 77, provided the cytochrome P450 santalene oxidase polypeptides exhibit cytochrome P450 santalene oxidase activity (i.e. catalyze the formation of santalols from santalenes and/or bergamotols from bergamotene). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0260] Provided herein are cytochrome P450 santalene oxidases designated SaCYP76F39v1 (CYP76-G10), SaCYP76F39v2 (CYP76-G15), SaCYP76F40 (CYP76-G16), SaCYP76F41 (CYP76-G17) and SaCYP76F42 (CYP76-G13) that have a sequence of amino acids set forth in SEQ ID NOS:7, 74, 75, 76 and 77, respectively. Also provided herein are active fragments of cytochrome P450 santalene oxidase polypeptides having a sequence of amino acids set forth in any of SEQ ID NO:7, 74, 75, 76 and 77. Such fragments retain one or more properties of a cytochrome P450 santalene oxidase polypeptide. Typically, the active fragments exhibit cytochrome P450 santalene oxidase activity (i.e. the ability to catalyze the formation of santalols from santalenes).

[0261] Also provided herein are nucleic acid molecules that have a sequence of amino acids set forth in any of SEQ ID NOS:3, 68, 69, 70 and 71, or degenerates thereof, that encode a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NOS:7, 74, 75, 76 and 77, respectively. Also provided herein are nucleic acid molecules encoding cytochrome P450 santalene oxidase polypeptides having at least 85% sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:3, 68, 69, 70 and 71. For example, the nucleic acid molecules provided herein can exhibit at least or about at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 95%, 95%, 96%, 97%, 98% or 99% or more sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:3, 68, 69, 70 and 71, so long as the encoded cytochrome P450 santalene oxidase polypeptides exhibits cytochrome P450 santalene oxidase activity (i.e. the ability to catalyze the formation of santalols from santalenes). Also provided herein are degenerate sequences of the sequence set forth in any of SEQ ID NOS:3, 68, 69, 70 and 71 encoding cytochrome P450 santalene oxidase polypeptides having a sequence of amino acids set forth in SEQ ID NO:7, 74, 75, 76 and 77, respectively. Percent identity can be determined by one skilled in the art using standard alignment programs.

[0262] In some examples, the nucleic acid molecules that encode the cytochrome P450 santalene oxidase polypeptides are isolated from the sandalwood tree Santalum album. In other examples, the nucleic acid molecules and encoded cytochrome P450 santalene oxidase polypeptides are variants of those isolated from the sandalwood tree Santalum album.

[0263] In a particular example, the SaCYP76F39v1 (CYP76-G10) polypeptide having a sequence of amino acids set forth in SEQ ID NO:7 catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol in in vivo assays in yeast expressing a santalene synthase (see Example 10.B.2) and in in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate (see Example 11.B.2.a.ii). In in vivo assays, (E)-.beta.-santalol, (E)-.alpha.-santalol and (Z)-.beta.-santalol were the major products (see FIG. 11A). In in vitro assays, (E)-.beta.-santalol and (E)-.alpha.-santalol were the major products (see FIG. 15A). In yet other examples, in in vitro assays with either .alpha.-santalene, .alpha.-trans-bergamotene, or epi-.beta.-santalene and .beta.-santalene, the SaCYP76F39v1 (CYP76-G10) polypeptide catalyzed the formation of (Z)- and (E)-.alpha.-santalol, (Z)- and (E)-.alpha.-trans-bergamotol, and (Z)- and (E)-epi-.beta.-santalol and (Z)- and (E)-.beta.-santalol, respectively (see Example 11.C. and FIGS. 20A-20C). The kinetic properties of the SaCYP76F39v1 (CYP76-G10) polypeptide for .alpha.- and .beta.-santalene as substrates are described in Example 12 below.

[0264] In another example, the SaCYP76F39v2 (CYP76-G15) polypeptide having a sequence of amino acids set forth in SEQ ID NO:74 catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol in in vivo assays in yeast expressing a santalene synthase (see Example 10.B.3 and FIG. 13A). In in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate, the SaCYP76F39v2 (CYP76-G15) polypeptide catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol (see Example 11.B.3.b and FIG. 16A) with (E)-.alpha.-santalol and (E)-.beta.-santalol as the major products.

[0265] In another example, the SaCYP76F40 (CYP76-G16) polypeptide having a sequence of amino acids set forth in SEQ ID NO:75 catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol in in vivo assays in yeast expressing a santalene synthase (see Example 10.B.3 and FIG. 13B). In in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate, the SaCYP76F40 (CYP76-G16) polypeptide catalyzed the formation of (E)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol (see Example 11.B.3.b and FIG. 16B) with (E)-.alpha.-trans-bergamotol and (E)-.beta.-santalol as the major products.

[0266] In another example, the SaCYP76F41 (CYP76-G17) polypeptide having a sequence of amino acids set forth in SEQ ID NO:76 catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol and (E)-.alpha.-trans-bergamotol in in vivo assays in yeast expressing a santalene synthase (see Example 10.B.3 and FIG. 13C). In in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate, the SaCYP76F41 (CYP76-G17) polypeptide catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol (see Example 11.B.3.b and FIG. 16C) with (E)-.alpha.-santalol as the major product.

[0267] In another example, the SaCYP76F42 (CYP76-G13) polypeptide having a sequence of amino acids set forth in SEQ ID NO:77 catalyzed the formation of (Z)-.alpha.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol and (E)-.alpha.-trans-bergamotol in in vivo assays in yeast expressing a santalene synthase (see Example 10.B.3 and FIG. 13D). In in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate, the SaCYP76F42 (CYP76-G13) polypeptide catalyzed the formation of (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol (see Example 11.B.3.b and FIG. 16D) with (E)-.alpha.-trans-bergamotol as the major product.

[0268] Modified Cytochrome P450 Santalene Oxidase Polypeptides

[0269] Also provided herein are modified cytochrome P450 santalene oxidase polypeptides. The modifications, which typically are amino acid insertions, deletions and/or substitutions, can be effected in any region of a cytochrome P450 santalene oxidase polypeptide provided the resulting modified cytochrome P450 santalene oxidase polypeptides at least retain cytochrome P450 santalene oxidase activity. For example, modifications can be made in any region of a cytochrome P450 santalene oxidase provided the resulting modified cytochrome P450 santalene oxidase at least retains cytochrome P450 santalene oxidase activity (i.e., the ability to catalyze the formation of santalols from santalenes). The modifications can be a single amino acid modification, such as single amino acid replacements (substitutions), insertions or deletions, or multiple amino acid modifications, such as multiple amino acid replacements, insertions or deletions. In some examples, entire or partial domains or regions, such as any domain or region described herein below, are exchanged with corresponding domains or regions or portions thereof from another cytochrome P450 polypeptide. Exemplary of modifications are amino acid replacements, including single or multiple amino acid replacements. For example, modified cytochrome P450 santalene oxidase polypeptides provided herein can contain at least or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120 or more modified positions compared to the cytochrome P450 santalene oxidase polypeptide not containing the modification. For example, the modifications described herein can be in a cytochrome P450 santalene oxidase polypeptide having a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 and 77 or any variant thereof, including any that have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77. Based on this description, it is within the level of one of skill in the art to generate a cytochrome P450 santalene oxidase polypeptide containing any one or more of the described mutations, and test each for cytochrome P450 santalene oxidase activity described herein.

[0270] Also, in some examples, provided herein are modified active fragments of cytochrome P450 santalene oxidase polypeptides, that contain any of the modifications provided herein. Such fragments retain on or more properties of a cytochrome P450 santalene oxidase. Typically, the cytochrome P450 santalene oxidase polypeptides exhibit santalene oxidase (i.e., the ability to hydrolyze santalene and/or bergamotene).

[0271] Modifications in a cytochrome P450 santalene oxidase also can be made to a cytochrome P450 santalene oxidase polypeptide that also contains other modifications, including modifications of the primary sequence and modifications not in the primary sequence of the polypeptide. For example, modification described herein can be in a cytochrome P450 santalene oxidase polypeptide that is a fusion polypeptide or chimeric polypeptide, including hybrids of different cytochrome P450 santalene oxidase polypeptides with different cytochrome P450 polypeptides (e.g. contain one or more domains or regions from another cytochrome P450s) and also synthetic cytochrome P450 santalene oxidase polypeptides prepared recombinantly or synthesized or constructed by other methods known in the art based upon the sequence of known polypeptides.

[0272] In some examples, the modifications are amino acid replacements. In further examples, the modified cytochrome P450 santalene oxidase polypeptides provided herein contain one or more modifications in a domain. As described elsewhere herein, the modifications in a domain or structural domain can be by replacement of corresponding heterologous residues from another cytochrome P450 polypeptide.

[0273] To retain cytochrome P450 santalene oxidase activity, modifications typically are not made at those positions necessary for cytochrome P450 santalene oxidase activity, i.e., in the catalytic center or in conserved residues. For example, generally modifications are not made a position corresponding to Glu367, Arg370, Gly445, Arg446, Arg447, Ile448, Cys449, Pro450 or Gly451 with reference to a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77.

[0274] The modified cytochrome P450 santalene oxidase polypeptides can contain two or more modifications, including amino acid replacements or substitutions, insertions or deletions, truncations or combinations thereof. Generally, multiple modifications provided herein can be combined by one of skill in the art so long as the modified cytochrome P450 santalene oxidase polypeptide retains cytochrome P450 santalene oxidase activity.

[0275] Also provided herein are nucleic acid molecules that encode any of the modified cytochrome P450 santalene oxidase polypeptides provided herein. In particular examples, the nucleic acid sequence can be codon optimized, for example, to increase expression levels of the encoded sequence. The particular codon usage is dependent on the host organism in which the modified polypeptide is expressed. One of skill in the art is familiar with optimal codons for expression in bacteria or yeast, including for example E. coli or Saccharomyces cerevisiae. For example, codon usage information is available from the Codon Usage Database available at kazusa.or.jp.codon (see Richmond (2000) Genome Biology, 1:241 for a description of the database). See also, Forsburg (2004) Yeast, 10:1045-1047; Brown et al. (1991) Nucleic Acids Research, 19:4298; Sharp et al. (1988) Nucleic Acids Research, 12:8207-8211; Sharp et al. (1991) Yeast, 657-78. In examples herein, nucleic acid sequences provided herein are codon optimized based on codon usage in Saccharomyces cerevisiae.

[0276] The modified polypeptides and encoding nucleic acid molecules provided herein can be produced by standard recombinant DNA techniques known to one of skill in the art. Any method known in the art to effect mutation of any one or more amino acids in a target protein can be employed. Methods include standard site-directed or random mutagenesis of encoding nucleic acid molecules, or solid phase polypeptide synthesis methods. For example, as described herein, nucleic acid molecules encoding a cytochrome P450 santalene oxidase polypeptide can be subjected to mutagenesis, such as random mutagenesis of the encoding nucleic acid, by error-prone PCR, site-directed mutagenesis, overlap PCR, gene shuffling, or other recombinant methods. The nucleic acid encoding the polypeptides then can be introduced into a host cell to be expressed heterologously. Hence, also provided herein are nucleic acid molecules encoding any of the modified polypeptides provided herein. In some examples, the modified cytochrome P450 santalene oxidase polypeptides are produced synthetically, such as using solid phase or solutions phase peptide synthesis.

[0277] 2. Cytochrome P450 Bergamotene Oxidase Polypeptides

[0278] Provided herein are cytochrome P450 bergamotene oxidase polypeptides. Also provided herein are nucleic acid molecules that encode any of the cytochrome P450 bergamotene oxidase polypeptides provided herein. The cytochrome P450 bergamotene oxidase polypeptides provided herein catalyze the formation of bergamotols from bergamotenes. Typically the cytochrome P450 bergamotene oxidase polypeptides catalyze the formation of (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene (e.g. the cytochrome P450 bergamotene oxidase polypeptides catalyze the hydroxylation of .alpha.-trans-bergamotene). In particular examples, the cytochrome P450 bergamotene oxidase polypeptides catalyze the formation of (E)-.alpha.-trans-bergamotol from .alpha.-trans-bergamotene. In some examples, the cytochrome P450 bergamotene oxidase polypeptides additionally catalyze the formation of minor amounts of (E)-.alpha.-santalol and (E)-.beta.-santalol. The cytochrome P450 bergamotene oxidase polypeptides exhibit narrow substrate specificity, preferring .alpha.-santalene or .beta.-santalene. In some examples, the cytochrome P450 bergamotene oxidase polypeptides also converted the substrate trans-nerolidol.

[0279] For example, provided herein are cytochrome P450 bergamotene oxidase polypeptides that have a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 and 73. Also provided herein are cytochrome P450 bergamotene oxidase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 and 73. For example, the cytochrome P450 bergamotene oxidase polypeptides provided herein can exhibit at least at or about or 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more amino acid sequence identity to a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 and 73, provided the cytochrome P450 bergamotene oxidase polypeptides exhibit cytochrome P450 bergamotene oxidase activity (i.e. catalyze the formation of bergamotols from bergamotenes). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0280] Provided herein are cytochrome P450 bergamotene oxidases designated SaCYP76F38v1 (CYP76-G5), SaCYP76F37v1 (CYP76-G11), SaCYP76F38v2 (CYP76-G11) and SaCYP76F37v2 (CYP76-G14), that have a sequence of amino acids set forth in SEQ ID NOS: 6, 8, 9 and 73, respectively. Also provided herein are active fragments of cytochrome P450 bergamotene oxidase polypeptides having a sequence of amino acids set forth in any of SEQ ID NOS: 6, 8, 9 and 73. Such fragments retain one or more properties of a cytochrome P450 bergamotene oxidase polypeptide. Typically, the active fragments exhibit cytochrome P450 bergamotene oxidase activity (i.e. the ability to catalyze the hydroxylation of bergamotenes from bergamotols).

[0281] In particular examples, the cytochrome P450 bergamotene oxidases provided herein having a sequence of amino acids set forth in SEQ ID NOS: 6, 8, 9 and 73 catalyzed the formation of (E)-.alpha.-trans-bergamotol, (E)-.alpha.-santalol and (E)-.beta.-santalol in in vitro assays with a mixture of .alpha.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene and .beta.-santalene as the substrate. In such examples, (E)-.alpha.-trans-bergamotol was the major product, and (E)-.alpha.-santalol and (E)-.beta.-santalol were minor products (see Example 11.B.3.b and FIGS. 17A-17D). In another example, in in vitro assays with either .alpha.-santalene, .alpha.-trans-bergamotene, or epi-.beta.-santalene and .beta.-santalene, the cytochrome P450 bergamotene oxidase provided herein having a sequence of amino acids set forth in SEQ ID NO:8 catalyzed the formation of (E)-.alpha.-santalol, (E)-.alpha.-trans-bergamotol or (E)-.beta.-santalol, respectively (see Example 11.0 and FIGS. 20D-20F). In yet other examples, the cytochrome P450 bergamotene oxidases provided herein having a sequence of amino acids set forth in SEQ ID NOS: 6, 8, 9 and 73 catalyzed the formation of (E)-.alpha.-trans-bergamotol in in vivo assays in yeast that express santalene synthase (see Example 10.C.2 and FIGS. 14A-14D). The kinetic properties of the SaCYP76F37v1 (SaCYP76-G11) polypeptide for .alpha.- and .beta.-santalene as substrates are described in Example 12 below.

[0282] Also provided herein are nucleic acid molecules that have a sequence of amino acids set forth in any of SEQ ID NOS:2, 4, 5 and 67, or degenerates thereof, that encode a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NOS:6, 8, 9 and 73, respectively. Also provided herein are nucleic acid molecules encoding a cytochrome P450 bergamotene oxidase polypeptide having at least 85% sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:2, 4, 5 and 67. For example, the nucleic acid molecules provided herein can exhibit at least or about at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 95%, 95%, 96%, 97%, 98% or 99% or more sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:2, 4, 5 and 67, so long as the encoded cytochrome P450 bergamotene oxidase polypeptide exhibits cytochrome P450 bergamotene oxidase activity (i.e. the ability to catalyze the formation of bergamotols from bergamotene). Also provided herein are degenerate sequences of the sequence set forth in any of SEQ ID NOS:2, 4, 5 and 67 encoding a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 and 73, respectively. Percent identity can be determined by one skilled in the art using standard alignment programs.

[0283] In some examples, the nucleic acid molecules that encode the cytochrome P450 bergamotene oxidase polypeptides are isolated from the sandalwood tree Santalum album. In other examples, the nucleic acid molecules and encoded cytochrome P450 bergamotene oxidase polypeptides are variants of those isolated from the sandalwood tree Santalum album.

[0284] Modified Cytochrome P450 Bergamotene Oxidase Polypeptides

[0285] Provided herein are modified cytochrome P450 bergamotene oxidase polypeptides. The modifications, which typically are amino acid insertions, deletions and/or substitutions, can be effected in any region of a cytochrome P450 bergamotene oxidase polypeptide provided the resulting modified cytochrome P450 bergamotene oxidase polypeptides at least retain cytochrome P450 bergamotene oxidase activity. For example, modifications can be made in any region of a cytochrome P450 bergamotene oxidase provided the resulting modified cytochrome P450 bergamotene oxidase at least retains cytochrome P450 bergamotene oxidase activity (i.e., the ability to catalyze the formation of a bergamotol from a bergamotene).

[0286] The modifications can be a single amino acid modification, such as single amino acid replacements (substitutions), insertions or deletions, or multiple amino acid modifications, such as multiple amino acid replacements, insertions or deletions. In some examples, entire or partial domains or regions, such as any domain or region described herein below, are exchanged with corresponding domains or regions or portions thereof from another cytochrome P450 bergamotene oxidase polypeptide. Exemplary of modifications are amino acid replacements, including single or multiple amino acid replacements. For example, modified cytochrome P450 bergamotene oxidase polypeptides provided herein can contain at least or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120 or more modified positions compared to the cytochrome P450 polypeptide not containing the modification. For example, the modifications described herein can be in a cytochrome P450 bergamotene oxidase polypeptide having a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 or 73 or any variant thereof, including any that have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 and 73. Based on this description, it is within the level of one of skill in the art to generate a cytochrome P450 bergamotene oxidase polypeptide containing any one or more of the described mutations, and test each for cytochrome P450 bergamotene oxidase activity described herein.

[0287] Also, in some examples, provided herein are modified active fragments of cytochrome P450 bergamotene oxidase polypeptides that contain any of the modifications provided herein. Such fragments retain on or more properties of a cytochrome P450 bergamotene oxidase. Typically, the modified cytochrome P450 bergamotene oxidase polypeptides exhibit bergamotene oxidase activity (i.e., the ability to hydrolyze bergamotene).

[0288] Modifications in a cytochrome P450 bergamotene oxidase polypeptide that also contains other modifications, including modifications of the primary sequence and modifications not in the primary sequence of the polypeptide. For example, modification described herein can be in a cytochrome P450 bergamotene oxidase polypeptide that is a fusion polypeptide or chimeric polypeptide, including hybrids of different cytochrome P450 bergamotene oxidase polypeptides with different cytochrome P450 polypeptides (e.g. contain one or more domains or regions from another cytochrome P450s) and also synthetic cytochrome P450 bergamotene oxidase polypeptides prepared recombinantly or synthesized or constructed by other methods known in the art based upon the sequence of known polypeptides.

[0289] In some examples, the modifications are amino acid replacements. In further examples, the modified cytochrome P450 bergamotene oxidase polypeptides provided herein contain one or more modifications in a domain. As described elsewhere herein, the modifications in a domain or structural domain can be by replacement of corresponding heterologous residues from another cytochrome P450 polypeptide.

[0290] To retain cytochrome P450 bergamotene oxidase activity, modifications typically are not made at those positions necessary for cytochrome P450 activity, i.e., in the catalytic center or in conserved residues. For example, generally modifications are not made a position corresponding to Glu367, Arg370, Gly445, Arg446, Arg447, Ile448, Cys449, Pro450 or Gly451 with reference to a sequence of amino acids set forth in SEQ ID NO:6, 8, 9 or 73.

[0291] The modified cytochrome P450 bergamotene oxidase polypeptides can contain two or more modifications, including amino acid replacements or substitutions, insertions or deletions, truncations or combinations thereof. Generally, multiple modifications provided herein can be combined by one of skill in the art so long as the modified cytochrome P450 bergamotene oxidase polypeptide retains cytochrome P450 bergamotene oxidase activity.

[0292] Also provided herein are nucleic acid molecules that encode any of the modified cytochrome P450 bergamotene oxidase polypeptides provided herein. In particular examples, the nucleic acid sequence can be codon optimized, for example, to increase expression levels of the encoded sequence. The particular codon usage is dependent on the host organism in which the modified polypeptide is expressed. One of skill in the art is familiar with optimal codons for expression in bacteria or yeast, including for example E. coli or Saccharomyces cerevisiae. For example, codon usage information is available from the Codon Usage Database available at kazusa.or.jp.codon (see Richmond (2000) Genome Biology, 1:241 for a description of the database). See also, Forsburg (2004) Yeast, 10:1045-1047; Brown et al. (1991) Nucleic Acids Research, 19:4298; Sharp et al. (1988) Nucleic Acids Research, 12:8207-8211; Sharp et al. (1991) Yeast, 657-78. In examples herein, nucleic acid sequences provided herein are codon optimized based on codon usage in Saccharomyces cerevisiae.

[0293] The modified polypeptides and encoding nucleic acid molecules provided herein can be produced by standard recombinant DNA techniques known to one of skill in the art. Any method known in the art to effect mutation of any one or more amino acids in a target protein can be employed. Methods include standard site-directed or random mutagenesis of encoding nucleic acid molecules, or solid phase polypeptide synthesis methods. For example, as described herein, nucleic acid molecules encoding a cytochrome P450 bergamotene oxidase polypeptide can be subjected to mutagenesis, such as random mutagenesis of the encoding nucleic acid, by error-prone PCR, site-directed mutagenesis, overlap PCR, gene shuffling, or other recombinant methods. The nucleic acid encoding the polypeptides then can be introduced into a host cell to be expressed heterologously. Hence, also provided herein are nucleic acid molecules encoding any of the modified polypeptides provided herein. In some examples, the modified cytochrome P450 bergamotene oxidase polypeptides are produced synthetically, such as using solid phase or solutions phase peptide synthesis.

[0294] 3. Additional Modifications

[0295] Provided herein are cytochrome P450 polypeptides, including cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, that contain additional modifications. For example, modified cytochrome P450 polypeptides include, for example, truncated cytochrome P450 polypeptides, cytochrome P450 polypeptides having altered activities or properties, chimeric cytochrome P450 polypeptides, cytochrome P450 polypeptides containing domain swaps, cytochrome P450 fusion proteins, or cytochrome P450 polypeptides having any modification described elsewhere herein.

[0296] a. Truncated Polypeptides

[0297] Also provided herein are truncated cytochrome P450 polypeptides. The truncated cytochrome P450 polypeptides can be truncated at the N-terminus or C-terminus, so long as the truncated cytochrome P450 polypeptides retain the catalytic activity of a cytochrome P450, such as cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase activity. Typically, the truncated cytochrome P450 santalene oxidase polypeptides exhibit santalene oxidase activity (i.e., the ability to catalyze the hydroxylation of a santalene, namely .alpha.-santalene, .beta.-santalene or epi-.beta.-santalene). Typically, the truncated cytochrome P450 bergamotene oxidase polypeptides exhibit bergamotene oxidase activity (i.e., the ability to catalyze the hydroxylation of a bergamotene). In some examples, the cytochrome P450 polypeptides, including the cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, are truncated at the C-terminus. In other examples, the cytochrome P450 polypeptides, including the cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, are truncated at the N-terminus.

[0298] In some examples, the cytochrome P450 polypeptides, including the cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, are truncated at the N-terminus, C-terminus or both termini of a cytochrome P450 polypeptide provided herein, such as truncation of a sequence of amino acids set forth in any of SEQ ID NOS:6-9. In other examples, any of the modified cytochrome P450 polypeptides provided herein are truncated. The modified cytochrome P450 polypeptides can be truncated at their N-terminus, C-terminus, or both termini. For example, any cytochrome P450 polypeptide provided herein can be truncated by at or about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 or more amino acid residues at the N-terminus, provided the cytochrome P450 polypeptide retains cytochrome P450 activity. In other examples, any cytochrome P450 polypeptide provided herein can be truncated by at or about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 or more amino acid residues at the C-terminus, provided the cytochrome P450 polypeptide retains cytochrome P450 activity.

[0299] b. Polypeptides with Altered Activities or Properties

[0300] The modified cytochrome P450 polypeptides provided herein can also exhibit changes in activities and/or properties. The modified cytochrome P450 polypeptides can exhibit, for example, improved properties, such as increased catalytic activity, increased selectivity, increased substrate specificity, increased substrate binding, increased stability, and/or increased expression in a host cell, and altered properties, such as altered product distribution and altered substrate specificity. Such improved or altered activities can result in increased production of santalols and/or bergamotols.

[0301] In some examples, the modified cytochrome P450 polypeptides have altered substrate specificity. For example, the substrate specificity of a modified cytochrome P450 polypeptide can be altered by at least or at least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the unmodified cytochrome P450 polypeptide. For example, a modified cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase polypeptide can catalyze the monooxygenation of a terpene substrate that is not a santalene or bergamotene. In such examples, the modified cytochrome P450 polypeptides catalyze the formation of terpenoids other than santalols or bergamotols from any suitable terpene substrate. For example, the modified cytochrome P450 polypeptides can produce one or more different monoterpenoids, sesquiterpenoids or diterpenoids other than santalols and bergamotols.

[0302] In some examples, the modified cytochrome P450 polypeptides have an altered terpenoid product distribution. In some examples, altered product distribution results in an increased amount of a desired terpenoid product, and thus product distribution is improved compared to the product distribution of the unmodified cytochrome P450. In other examples, altered product distribution results in an decreased amount of a desired terpenoid product, and thus the product distribution of the modified cytochrome P450 is decreased compared to that of the unmodified cytochrome P450. In one example, the modified cytochrome P450 santalene oxidase produces a different ratio of terpenoid products compared to the unmodified cytochrome P450 santalene oxidase. For example, the amount of a terpenoid produced by the modified cytochrome P450 can be increased or decreased by at least or at least about or 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more compared to the amount of a different terpenoid produced by the unmodified cytochrome P450. For example, the amount of a terpenoid produced by the modified cytochrome P450 santalene oxidase, such as, for example, a .beta.-santalol, can be increased by at least or at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more compared to the amount of a different terpenoid produced by the unmodified cytochrome P450 santalene oxidase, such as, for example, an .alpha.-santalol. In some examples, the modified cytochrome P450 santalene oxidases produce more .beta.-santalol than any other terpenoid compound. In another example, the modified cytochrome P450 bergamotene oxidase produces a different ratio of terpenoid products compared to the unmodified cytochrome P450 bergamotene oxidase. For example, the amount of a terpenoid produced by the modified cytochrome P450 bergamotene oxidase, such as, for example, a .alpha.-trans-bergamotol, can be increased by at least or at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more compared to the amount of a different terpenoid produced by the unmodified cytochrome P450 bergamotene oxidase.

[0303] In some examples, the modified cytochrome P450 polypeptide exhibits a similar, increased and/or improved activity compared to the unmodified cytochrome P450 polypeptide. For example, a modified cytochrome P450 polypeptide exhibits increased terpenoid production compared to an unmodified cytochrome P450 polypeptide. The increased terpenoid production can be an increase in the total amount of terpenoids produced by the modified cytochrome P450 polypeptide or can be an increase in the amount of a particular terpenoid produced by the modified cytochrome P450 polypeptide. For example, the total terpenoid production of a modified cytochrome P450 polypeptide can be increased by at least or at least about 1%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to an unmodified cytochrome P450 polypeptide. In some examples, the total terpenoid production of a modified cytochrome P450 polypeptide is at least or about 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more compared to an unmodified cytochrome P450 polypeptide. In another example, the production of a particular terpenoid by a modified cytochrome P450 polypeptide is increased by at least or at least about 1%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to an unmodified cytochrome P450 polypeptide. In some examples, a modified cytochrome P450 polypeptide produces at least or about 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more of a particular terpenoid product compared to the unmodified cytochrome P450 polypeptide.

[0304] In some examples, the modified cytochrome P450 polypeptide exhibits improved substrate specificity compared to the unmodified cytochrome P450 polypeptide. Substrate specificity of the modified cytochrome P450 polypeptide can be increased by at least or at least about 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the substrate specificity of the unmodified cytochrome P450 polypeptide. For example, the modified cytochrome P450 polypeptide can exhibit increased substrate specificity for a terpene, such as a santalene, compared to a different terpene, such as a bergamotene. In such examples, increased specificity for a santalene results in increased production of santalols and decreased production of a bergamotol.

[0305] In some examples, the modified cytochrome P450 polypeptide, such as a modified cytochrome P450 santalene oxidase polypeptide, exhibits similar or increased or improved santalene oxidase activity compared to the unmodified cytochrome P450 santalene oxidase polypeptide. For example, the modified cytochrome P450 santalene oxidase polypeptide can exhibit increased specificity or selectivity for oxidation of .alpha.-santalene, .beta.-santalene and/or epi-.beta.-santalene compared to the unmodified cytochrome P450 santalene oxidase polypeptide. In some instances of such examples, the modified cytochrome P450 santalene oxidase selectively monooxygenates .beta.-santalene compared to the unmodified cytochrome P450 santalene oxidase. In other examples, the modified cytochrome P450 santalene oxidase polypeptide exhibits reduced selectivity for oxidation of bergamotene compared to the unmodified cytochrome P450 santalene oxidase. For example, the modified cytochrome P450 santalene oxidase exhibits a decrease in activity towards oxidation of bergamotene of at least or at least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more compared to the unmodified cytochrome P450 santalene oxidase.

[0306] In some examples, the modified cytochrome P450 polypeptide, such as a modified cytochrome P450 bergamotene oxidase polypeptide, exhibits similar or increased or improved bergamotene oxidase activity compared to the unmodified cytochrome P450 bergamotene oxidase polypeptide. For example, the modified cytochrome P450 bergamotene oxidase polypeptide can exhibit increased specificity or selectivity for oxidation of .alpha.-trans-bergamotene compared to the unmodified cytochrome P450 bergamotene oxidase.

[0307] c. Domain Swaps

[0308] Provided herein are modified cytochrome P450 polypeptides that are chimeric polypeptides containing a swap (deletion and insertion) by deletion of amino acid residues of one of more domains or regions therein or portions thereof and insertion of a heterologous sequence of amino acids. In some examples, the heterologous sequence is a randomized sequence of amino acids. In other examples, the heterologous sequence is a contiguous sequence of amino acids for the corresponding domain or region or portion thereof from another cytochrome P450. The heterologous sequence that is replaced or inserted generally includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more amino acids. In examples where the heterologous sequence is from a corresponding domain or a portion thereof of another cytochrome P450, the heterologous sequence generally includes at least 50%, 60%, 70%, 80%, 90%, 95% or more contiguous amino acids of the corresponding domain or region or portion. In such an example, adjacent residues to the heterologous corresponding domain or region or portion thereof also can be included in a modified cytochrome P450 polypeptide provided herein.

[0309] In one example of swap mutants provided herein, at least one domain or region or portion thereof of a cytochrome P450 polypeptide is replaced with a contiguous sequence of amino acids for the corresponding domain or region or portions thereof from another cytochrome P450 polypeptide. In some examples, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more domains or regions or portions thereof are replaced with a contiguous sequence of amino acids for the corresponding domain or region or portions thereof from another cytochrome P450 polypeptide.

[0310] Any domain or region or portion thereof of a cytochrome P450 polypeptide can be replaced with a heterologous sequence of amino acids, such as heterologous sequence from the corresponding domain or region from another cytochrome P450. A domain or region can be a structural domain or a functional domain. One of skill in the art is familiar with domains or regions in cytochrome P450s. Functional domains include, for example, the catalytic domain or a portion thereof. A structural domain can include all or a portion of helix A, .beta. strand 1-1, .beta. strand 1-2, helix B, .beta. strand 1-5, helix B', helix C, helix C', helix D, .beta. strand 3-1, helix E, helix F, helix G, helix H, .beta. strand 5-1, .beta. strand 5-2, helix I, helix J, helix J', helix K, .beta. strand 1-4, .beta. strand 2-1, .beta. strand 2-2, .beta. strand 1-3, helix K', helix K'', Heme domain, helix L, .beta. strand 3-3, .beta. strand 4-1, .beta. strand 4-2 and .beta. strand 3-2. One of skill in the art is familiar with various cytochrome P450s and can identify corresponding domains or regions or portions of amino acids thereof.

[0311] Typically, the resulting modified cytochrome P450 polypeptides exhibit cytochrome P450 monooxygenase activity and the ability to produce santalols and/or bergamotols from santalenes and bergamotenes. For example, the modified cytochrome P450 santalene oxidase polypeptides exhibit 50% to 5000%, such as 50% to 120%, 100% to 500% or 110% to 250% of the santalol production from santalene compared to the cytochrome P450 santalene oxidase not containing the modification (e.g. the amino acid replacement or swap of amino acid residues of a domain or region) and/or compared to wild type cytochrome P450 santalene oxidase set forth in SEQ ID NO:7, 74, 75, 76 or 77. Typically, the modified cytochrome P450 santalene oxidase polypeptides exhibit increased santalol production from santalene compared to the cytochrome P450 santalene oxidase not containing the modification, such as compared to the cytochrome P450 santalene oxidase set forth in SEQ ID NO:7, 74, 75, 76 or 77. For example, the modified cytochrome P450 santalene oxidase polypeptides can produce santalols from santalenes in an amount that is at least or about 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 160%, 170%, 180%, 200%, 250%, 300%, 350%, 400%, 500%, 1500%, 2000%, 3000%, 4000%, 5000% of the amount of santalols produced from santalenes by wild type cytochrome P450 santalene oxidase synthase not containing the modification under the same conditions. For example, the santalol production is increased at least 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more.

[0312] In another example, the modified cytochrome P450 bergamotene oxidase polypeptides exhibit 50% to 5000%, such as 50% to 120%, 100% to 500% or 110% to 250% of the bergamotol production from bergamotene compared to the cytochrome P450 bergamotene oxidase not containing the modification (e.g. the amino acid replacement or swap of amino acid residues of a domain or region) and/or compared to wild type cytochrome P450 bergamotene oxidase set forth in SEQ ID NO:6, 8, 9 or 73. Typically, the modified cytochrome P450 bergamotene oxidase polypeptides exhibit increased bergamotol production from bergamotene compared to the cytochrome P450 bergamotene oxidase not containing the modification, such as compared to the cytochrome P450 bergamotene oxidase set forth in SEQ ID NO:6, 8, 9 or 73. For example, the modified cytochrome P450 bergamotene oxidase polypeptides can produce bergamotol from bergamotene in an amount that is at least or about 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 160%, 170%, 180%, 200%, 250%, 300%, 350%, 400%, 500%, 1500%, 2000%, 3000%, 4000%, 5000% of the amount of bergamotol produced from bergamotene by wild type cytochrome P450 bergamotene oxidase synthase not containing the modification under the same conditions. For example, the bergamotol production is increased at least 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more.

[0313] In particular examples herein, modified cytochrome P450 polypeptides provided herein are swap mutants whereby all or a portion of one or more structural domains is replaced with a corresponding structural domain of another cytochrome P450 polypeptide. Table 3 below identifies structural domains of cytochrome P450 santalene oxidase (SEQ ID NO:7) and cytochrome P450 bergamotene oxidase (SEQ ID NO:6) based on alignment of the cytochrome P450 polypeptides with cytochrome P450BM-3, a class II microsomal P450 (SEQ ID NO:66; Accession No. 2HPD; Ravichandran et al. (1993) Science 261:731-736; see also FIGS. 5A-5B). Hence, the corresponding domain can be identified in other cytochrome P450 polypeptides.

TABLE-US-00003 TABLE 3 Structural Domains santalene oxidase bergamotene oxidase structure (SEQ ID NO: 7) (SEQ ID NO: 6) helix A 54-65 54-65 .beta. strand 1-1 67-74 67-74 .beta. strand 1-2 75-82 75-82 helix B 83-91 83-91 .beta. strand 1-5 95-98 95-98 helix B' 101-108 101-108 helix C 124-133 124-133 helix D 149-164 149-164 .beta. strand 3-1 170-173 170-173 helix E 174-189 174-189 helix F 204-218 204-218 helix G 238-265 238-265 helix H 278-285 278-285 .beta. strand 5-1 287-290 287-290 .beta. strand 5-2 291-294 291-294 helix I 297-329 297-329 helix J 330-343 330-343 helix J' 351-358 351-358 helix K 359-371 359-371 .beta. strand 1-4 376-382 376-382 .beta. strand 2-1 383-389 383-389 .beta. strand 2-2 391-397 391-397 .beta. strand 1-3 398-402 398-402 helix K' 403-410 403-410 Heme domain 444-451 444-451 helix L 452-469 452-469 .beta. strand 3-3 470-474 470-474 .beta. strand 4-1 481-485 481-485 .beta. strand 4-2 487-491 487-491 .beta. strand 3-2 493-500 493-500

[0314] Any methods known in the art for generating chimeric polypeptides can be used to replace all or a contiguous portion of a domain or a cytochrome P450 with all or a contiguous portion of the corresponding domain of a second cytochrome P450 (see, U.S. Pat. Nos. 5,824,774, 6,072,045, 7,186,891 and 8,106,260, and U.S. Pat. Pub. No. 20110081703). Also, gene shuffling methods can be employed to generate chimeric polypeptides and/or polypeptides with domain or region swaps.

[0315] For example, corresponding domains or regions of any two cytochrome P450s can be exchanged using any suitable recombinant method known in the art, or by in vitro synthesis. Exemplary of recombinant methods is a two stage overlapping PCR method, such as described herein. In such methods, primers that introduce mutations at a plurality of codon positions in the nucleic acids encoding the targeted domain or portion thereof in the first cytochrome P450 can be employed. The mutations together form the heterologous region (i.e. the corresponding region from the second cytochrome P450). Alternatively, for example, randomized amino acids can be used to replace particular domains or regions. It is understood that primer errors, PCR errors and/or other errors in the cloning or recombinant methods can result in errors such that the resulting swapped or replaced region or domain does not exhibit an amino acid sequence that is identical to the corresponding region from the second cytochrome P450 reductase.

[0316] In an exemplary PCR-based method, the first stage PCR uses (i) a downstream primer that anneals downstream of the region that is being replaced with a mutagenic primer that includes approximately fifteen nucleotides (or an effective number to effect annealing, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 25 nucleotides or more) of homologous sequence on each side of the domain or region to be exchanged or randomized flanking the region to be imported into the target gene, and (ii) an upstream primer that anneals upstream of the region that is being replaced together with an opposite strand mutagenic primer that also includes approximately fifteen nucleotides (or an effective number to effect annealing, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 25 nucleotides or more) of homologous sequence on each side of the domain or region to be exchanged or randomized flanking the region to be imported into the target gene. If a replacement in which a domain or region of a first cytochrome P450 gene is replaced with the corresponding domain or region from a second cytochrome P450 is being performed, nucleotides in the mutagenic primers between the flanking regions from the first cytochrome P450 contain codons for the corresponding region of the second cytochrome P450. In instances where the amino acids in a domain or region are to be randomized, nucleotides of the mutagenic primers between the flanking regions from the first cytochrome P450 contains random nucleotides. An overlapping PCR is then performed to join the two fragments, using the upstream and downstream oligo. The resulting PCR product then can be cloned into any suitable vector for expression of the modified cytochrome P450.

[0317] Further, any of the modified cytochrome P450 polypeptides containing swap mutations herein can contain one or more further amino acid replacements as described herein above.

[0318] d. Additional Variants

[0319] Cytochrome P450 polypeptides provided herein can be modified by any method known to one of skill in the art for generating protein variants, including, but not limited to, DNA or gene shuffling, error prone PCR, overlap PCR or other recombinant methods. In one example, nucleic acid molecules encoding any cytochrome P450 polypeptide or variant cytochrome P450 polypeptide provided herein can be modified by gene shuffling. Gene shuffling involves one or more cycles of random fragmentation and reassembly of at least two nucleotide sequences, followed by screening to select nucleotide sequences encoding polypeptides with desired properties. The recombination can be performed in vitro (see Stemmer et al. (1994) Proc Natl Acad Sci USA 91:10747-10751; Stemmer et al. (1994) Nature 370:389-391; Cramieri et al. (1998) Nature 391:288-291; U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252 and 5,837,458) or in vivo (see, International Pat. Pub. No. WO199707205). The nucleic acid molecules encoding the polypeptides then can be introduced into a host cell to be expressed heterologously and tested for their cytochrome P450 activity by any method described in section G below.

[0320] e. Fusion or Chimeric Proteins

[0321] Nucleic acid molecules provided herein include fusion or chimeric nucleic acid molecules that contain a santalene synthase and a cytochrome P450 polypeptide. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that is capable of catalyzing the formation of a santalol, such as an .alpha.-santalol, .beta.-santalol or epi-.beta.-santalol, from FPP that contains any santalene synthase and cytochrome P450 santalene oxidase polypeptide provided herein. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53 and a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO:7, 74, 75, 76 or 77. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53 and a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO:7, 74, 75, 76 or 77. Also provided herein are nucleic acid molecules encoding a fusion polypeptide that is capable of catalyzing the formation of a bergamotol, such as an .alpha.-trans-bergamotol, from FPP that contains any santalene synthase and cytochrome P450 santalene bergamotene polypeptide provided herein. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53 and a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53 and a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73. The fusion polypeptides can be linked directly or via a linker.

[0322] Nucleic acid molecules provided herein include fusion or chimeric nucleic acid molecules that contain a cytochrome P450 polypeptide and a cytochrome P450 reductase. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. In another example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. The fusion polypeptides can be linked directly or via a linker.

[0323] Nucleic acid molecules provided herein include fusion or chimeric nucleic acid molecules that contain a santalene synthase, cytochrome P450 polypeptide and a cytochrome P450 reductase. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53, a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53, a cytochrome P450 santalene oxidase polypeptide set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. In another example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53, a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53, a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8, 9 or 73 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. The fusion polypeptides can be linked directly or via a linker.

[0324] In another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 and/or a cytochrome P450 reductase, such that, when expressed in a host cell, a bacterial or yeast host cell, a santalene synthase, a cytochrome P450 and/or a cytochrome P450 reductase are expressed. In one example, provided herein is a nucleic acid molecule that encodes a santalene synthase and a cytochrome P450 santalene oxidase. In another example, provided herein is a nucleic acid molecule that encodes a santalene synthase and a cytochrome P450 bergamotene oxidase. In yet another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 santalene oxidase and a cytochrome P450 reductase. In another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 bergamotene oxidase and a cytochrome P450 reductase. Further, when the host cell is capable of producing FPP, the encoded polypeptides catalyze the production of santalols and/or bergamotols.

[0325] Other examples of fusion proteins include, but are not limited to, fusions of a signal sequence, a tag such as for localization, e.g. a his.sub.6 tag or a myc tag, or a tag for purification, for example, a GST fusion, GFP fusion or CBP fusion, and a sequence for directing protein secretion and/or membrane association.

D. CYTOCHROME P450 REDUCTASE POLYPEPTIDES AND ENCODING NUCLEIC ACID MOLECULES

[0326] Provided herein are cytochrome P450 reductase polypeptides. Also provided herein are nucleic acid molecules that encode any of the cytochrome P450 reductase polypeptides provided herein. The cytochrome P450 reductase polypeptides provided herein transfer two electrons from NADPH to a cytochrome P450. In some examples, the nucleic acid molecules that encode the cytochrome P450 reductase polypeptides are those that are the same as those that are isolated from the sandalwood tree Santalum album. In other examples, the nucleic acid molecules and encoded cytochrome P450 reductase polypeptides are variants of those isolated from the sandalwood tree Santalum album.

[0327] Also provided herein are modified cytochrome P450 reductase polypeptides and nucleic acid molecules that encode any of the modified cytochrome P450 reductase polypeptides provided herein. The modifications can be made in any region of a cytochrome P450 reductase polypeptide provided the cytochrome P450 reductase polypeptide at least retains the CPR catalytic activity of the unmodified cytochrome P450 reductase polypeptide. For example, modifications can be made to a cytochrome P450 reductase polypeptide provided that the cytochrome P450 reductase polypeptide retains CPR activity (i.e., the ability to transfer two electrons from NADPH to a cytochrome P450).

[0328] The modifications can include codon optimization of the nucleic acids and/or changes that result in a single amino acid modification in the encoded polypeptide, such as single amino acid replacement (substitutions), insertions or deletions, or multiple amino acid modifications, such as multiple amino acid replacements, insertions or deletions, including swaps of domains or regions of the polypeptide. In some examples, entire or partial domains or regions, such as any domain or region described herein, are exchanged with corresponding domains or regions or portions thereof from another cytochrome P450 reductase polypeptide. Exemplary of modifications are amino acid replacements, including single or multiple amino acid replacements. For example, modified cytochrome P450 reductase polypeptides provided herein can contain at least or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120 or more modified positions compared to the cytochrome P450 reductase polypeptide not containing the modification.

[0329] Provided herein are cytochrome P450 reductase polypeptides having a sequence of amino acids set forth in SEQ ID NO:12 or 13. Also provided herein are cytochrome P450 reductase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13. For example, the cytochrome P450 reductase polypeptides provided herein can exhibit at least at or at least about or 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13, provided that the resulting cytochrome P450 reductase polypeptide at least retains CPR activity (i.e., the ability to transfer two electrons from NADPH to a cytochrome P450). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0330] Also, in some examples, provided herein are catalytically active fragments of cytochrome P450 reductase polypeptides. In some examples, the active fragments of cytochrome P450 reductase polypeptides are modified as described above. Such fragments retain one or more properties of a full-length cytochrome P450 reductase polypeptide. Typically, the active fragments exhibit CPR activity (i.e., the ability to transfer two electrons from NADPH to a cytochrome P450).

[0331] The cytochrome P450 reductase polypeptides provided herein can contain other modifications, for example, modifications not in the primary sequence of the polypeptide, including post-translational modifications. For example, modification described herein can be a cytochrome P450 reductase polypeptide that is a fusion polypeptide or chimeric polypeptide, including hybrids of different cytochrome P450 reductase polypeptides (e.g. contain one or more domains or regions from another cytochrome P450 reductase polypeptide) and also synthetic cytochrome P450 reductase polypeptides prepared recombinantly or synthesized or constructed by other methods known in the art based upon the sequence of known polypeptides.

[0332] The cytochrome P450 reductase polypeptides provided herein can be used to transfer two electrons from NADPH to a cytochrome P450. Reactions can be performed in vivo, such as in a host cell into which the nucleic acid has been introduced. At least one of the polypeptides will be heterologous to the host. Reactions can also be performed in vitro by contacting with enzyme the appropriate substrate under appropriate conditions.

[0333] Also provided herein are nucleic acid molecules encoding a cytochrome P450 polypeptide and a cytochrome P450 reductase polypeptide. For example, provided herein are nucleic acid molecules encoding a cytochrome P450 santalene oxidase polypeptide and a cytochrome P450 reductase polypeptide. In another example, nucleic acid molecules encoding a cytochrome P450 bergamotene synthase polypeptide and a cytochrome P450 reductase polypeptide. Also provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 polypeptide and a cytochrome P450 reductase polypeptide. For example, provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 santalene oxidase polypeptide and a cytochrome P450 reductase polypeptide. In another example, provided herein are nucleic acid molecules encoding a santalene synthase, cytochrome P450 bergamotene oxidase polypeptide and a cytochrome P450 reductase polypeptide. The nucleic acid molecules can be in the same vector or plasmid or on different vectors or plasmids. In such examples, expression of the nucleic acid molecule(s) in a suitable host, for example, a bacterial or yeast cell, results in expression of cytochrome P450 oxidase and cytochrome P450 reductase, or results in expression of santalene synthase, cytochrome P450 oxidase and cytochrome P450 reductase, depending on the included nucleic acid molecules. Such cells can be used to produce the santalene synthases, the cytochrome P450 oxidases and the cytochrome P450 reductases and/or to perform reactions in vivo to produce santalols and bergamotols. For example, santalols and bergamotols can be generated in a host cell from farnesyl diphosphate (FPP), particularly a yeast cell that overproduces the acyclic terpene precursor FPP. In some examples, a nucleic acid molecule encoding a farnesyl diphosphate synthase, such as a Santalum album farnesyl diphosphate synthase, can also be expressed in the suitable host, for example, a bacterial or yeast cell, resulting in over-expression of FPP.

[0334] 1. Cytochrome P450 Reductase Polypeptides

[0335] Provided herein are cytochrome P450 reductase polypeptides. Also provided herein are nucleic acid molecules that encode any of the cytochrome P450 reductase polypeptides provided herein. The cytochrome P450 reductase polypeptides provided herein exhibit CPR activity. Typically, the cytochrome P450 reductase polypeptides provided herein the ability to transfer two electrons from NADPH to a cytochrome P450.

[0336] For example, provided herein are cytochrome P450 reductase polypeptides that have a sequence of amino acids set forth in SEQ ID NO:12 or 13. Also provided herein are cytochrome P450 reductase polypeptides that exhibit at least 60% amino acid sequence identity to a cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12 or 13. For example, the cytochrome P450 reductase polypeptides provided herein can exhibit at least at or about or 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more amino acid sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13, provided the cytochrome P450 reductase polypeptides exhibit cytochrome P450 reductase activity (i.e. transfer two electrons from NADPH to a cytochrome P450). Percent identity can be determined by one skilled in the art using standard alignment programs.

[0337] Also provided herein are active fragments of cytochrome P450 reductase polypeptides having a sequence of amino acids set forth in SEQ ID NO:12 or 13. For example, provided herein are truncated cytochrome P450 reductase polypeptides having a sequence of amino acids set forth in SEQ ID NO:14 or 15. Such fragments retain one or more properties of a cytochrome P450 reductase polypeptide. Typically, the active fragments exhibit cytochrome P450 reductase activity (i.e. transfer two electrons from NADPH to a cytochrome P450).

[0338] Also provided herein are nucleic acid molecules that have a sequence of amino acids set forth in SEQ ID NO:10 or 11, or degenerates thereof, that encode a cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12 or 13, respectively. Also provided herein are nucleic acid molecules encoding a cytochrome P450 reductase polypeptide having at least 85% sequence identity to a sequence of nucleotides set forth in SEQ ID NO:10 or 11. For example, the nucleic acid molecules provided herein can exhibit at least or about at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 95%, 95%, 96%, 97%, 98% or 99% or more sequence identity to a sequence of nucleotides set forth in SEQ ID NO:10 or 11, so long as the encoded cytochrome P450 reductase polypeptide exhibits cytochrome P450 reductase activity (i.e. the ability to transfer two electrons from NADPH to a cytochrome P450). Also provided herein are degenerate sequences of the sequences set forth in SEQ ID NO:10 or 11 encoding a cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12 or 13, respectively. Percent identity can be determined by one skilled in the art using standard alignment programs.

[0339] In some examples, the nucleic acid molecules that encode the cytochrome P450 reductase polypeptides are isolated from the sandalwood tree Santalum album. In other examples, the nucleic acid molecules and encoded cytochrome P450 reductase polypeptides are variants of those isolated from the sandalwood tree Santalum album.

[0340] 2. Modified Cytochrome P450 Reductase Polypeptides

[0341] Provided herein are modified cytochrome P450 reductase polypeptides. The modifications can be made in any region of a cytochrome P450 reductase polypeptide provided the resulting modified cytochrome P450 reductase polypeptides at least retain cytochrome P450 reductase activity (e.g. the ability to transfer two electrons from NADPH to a cytochrome P450).

[0342] The modifications can be a single amino acid modification, such as single amino acid replacements (substitutions), insertions or deletions, or multiple amino acid modifications, such as multiple amino acid replacements, insertions or deletions. In some examples, entire or partial domains or regions, such as any domain or region described herein below, are exchanged with corresponding domains or regions or portions thereof from another cytochrome P450 reductase polypeptide. Exemplary of modifications are amino acid replacements, including single or multiple amino acid replacements. For example, modified cytochrome P450 reductase polypeptides provided herein can contain at least or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 90, 95, 100, 105, 110, 115, 120 or more modified positions compared to the cytochrome P450 reductase polypeptide not containing the modification.

[0343] The modifications described herein can be in any cytochrome P450 reductase polypeptide. For example, the modifications described herein can be in a cytochrome P450 reductase having a sequence of amino acids set forth in any of SEQ ID NOS:12-15 or any variant thereof, including any that have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a cytochrome P450 reductase having a sequence of amino acids set forth in any of SEQ ID NOS:12-15.

[0344] In particular, modified cytochrome P450 reductase polypeptides provided herein contain amino acid replacements or substitutions, additions or deletions, truncations or combinations thereof with reference to the cytochrome P450 reductase polypeptide having a sequence of amino acids set forth in SEQ ID NO:12. It is within the level of one of skill in the art to make such modifications in cytochrome P450 reductase polypeptides, such as any set forth in SEQ ID NOS:12-15 or any variant thereof. Based on this description, it is within the level of one of skill in the art to generate a cytochrome P450 reductase polypeptide containing any one or more of the described mutations, and test each for cytochrome P450 reductase activity described herein, such as the ability to transfer two electrons from NADPH to cytochrome P450.

[0345] Also, in some examples, provided herein are modified active fragments of cytochrome P450 reductase polypeptides that contain any of the modifications provided herein. Such fragments retain on or more properties of a cytochrome P450 reductase, such as the ability to transfer two electrons from NADPH to cytochrome P450. Modifications in a cytochrome P450 reductase polypeptide also can be made to a cytochrome P450 reductase polypeptide that also contains other modifications, including modifications of the primary sequence and modifications not in the primary sequence of the polypeptide. For example, modification described herein can be in a cytochrome P450 reductase polypeptide that is a fusion polypeptide or chimeric polypeptide with different cytochrome P450 reductase polypeptides (e.g. contain one or more domains or regions from another cytochrome P450 reductase s) and also synthetic cytochrome P450 reductase polypeptides prepared recombinantly or synthesized or constructed by other methods known in the art based upon the sequence of known polypeptides.

[0346] In some examples, the modifications are amino acid replacements. In further examples, the modified cytochrome P450 reductase polypeptides provided herein contain one or more modifications in a domain. For example, the modifications in a domain or structural domain can be by replacement of corresponding heterologous residues from another cytochrome P450 reductase polypeptide.

[0347] To retain cytochrome P450 reductase activity, modifications typically are not made at those positions necessary for cytochrome P450 reductase activity, i.e., in the catalytic center or in conserved residues. For example, generally modifications are not made a position corresponding to Ser485, Cys657, Asp702 and Trp704 with reference to a sequence of amino acids set forth in SEQ ID NO:12.

[0348] The modified cytochrome P450 reductase polypeptides provided herein can contain two or more modifications, including amino acid replacements or substitutions, insertions or deletions, truncations or combinations thereof. Generally, multiple modifications provided herein can be combined by one of skill in the art so long as the modified cytochrome P450 reductase polypeptide retains cytochrome P450 reductase activity.

[0349] Also provided herein are nucleic acid molecules that encode any of the modified cytochrome P450 reductase polypeptides provided herein. In particular examples, the nucleic acid sequence can be codon optimized, for example, to increase expression levels of the encoded sequence. The particular codon usage is dependent on the host organism in which the modified polypeptide is expressed. One of skill in the art is familiar with optimal codons for expression in bacteria or yeast, including for example E. coli or Saccharomyces cerevisiae. For example, codon usage information is available from the Codon Usage Database available at, for example, kazusa.or.jp.codon (see, e.g., Richmond (2000) Genome Biology, 1:241 for a description of the database). See also, Forsburg (2004) Yeast, 10:1045-1047; Brown et al. (1991) Nucleic Acids Research, 19:4298; Sharp et al. (1988) Nucleic Acids Research, 12:8207-8211; Sharp et al. (1991) Yeast, 657-78. In examples herein, nucleic acid sequences provided herein are codon optimized based on codon usage in Saccharomyces cerevisiae.

[0350] The modified polypeptides and encoding nucleic acid molecules provided herein can be produced by standard recombinant DNA techniques known to one of skill in the art. Any method known in the art to effect mutation of any one or more amino acids in a target protein can be employed. Methods include standard site-directed or random mutagenesis of encoding nucleic acid molecules, or solid phase polypeptide synthesis methods. For example, as described herein, nucleic acid molecules encoding a cytochrome P450 reductase polypeptide can be subjected to mutagenesis, such as random mutagenesis of the encoding nucleic acid, by error-prone PCR, site-directed mutagenesis, overlap PCR, gene shuffling, or other recombinant methods. The nucleic acid encoding the polypeptides then can be introduced into a host cell to be expressed heterologously. Hence, also provided herein are nucleic acid molecules encoding any of the modified polypeptides provided herein. In some examples, the modified cytochrome P450 reductase polypeptides are produced synthetically, such as using solid phase or solutions phase peptide synthesis.

[0351] 3. Additional Modifications

[0352] Provided herein are cytochrome P450 reductase polypeptides that contain additional modifications. For example, modified cytochrome P450 reductase polypeptides include, for example, truncated cytochrome P450 reductase polypeptides, cytochrome P450 reductase polypeptides having altered activities or properties, chimeric cytochrome P450 reductase polypeptides, cytochrome P450 reductase polypeptides containing domain swaps, cytochrome P450 reductase fusion proteins, or cytochrome P450 reductase polypeptides having any modification described elsewhere herein.

[0353] a. Truncated Polypeptides

[0354] Also provided herein are truncated cytochrome P450 reductase polypeptides. The truncated cytochrome P450 reductase polypeptides can be truncated at the N-terminus or C-terminus, so long as the truncated cytochrome P450 reductase polypeptides retain the catalytic activity of a cytochrome P450 reductase, such as cytochrome P450 reductase activity. Typically, the truncated cytochrome P450 reductase polypeptides exhibit cytochrome P450 reductase activity (i.e., the ability to transfer two electrons from NADPH to cytochrome P450). In some examples, the cytochrome P450 reductase polypeptides are truncated at the C-terminus. In other examples, the cytochrome P450 reductase polypeptides are truncated at the N-terminus.

[0355] In some examples, the cytochrome P450 reductase polypeptides are truncated at the N-terminus, C-terminus or both termini of a cytochrome P450 reductase polypeptide provided herein, such as truncation of a sequence of amino acids set forth in any of SEQ ID NOS:12 or 13. In other examples, any of the modified cytochrome P450 reductase polypeptides provided herein are truncated. The modified cytochrome P450 reductase polypeptides can be truncated at their N-terminus, C-terminus, or both termini. For example, any cytochrome P450 reductase polypeptide provided herein can be truncated by at or about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 or more amino acid residues at the N-terminus, provided the cytochrome P450 reductase polypeptide retains cytochrome P450 reductase activity. In other examples, any cytochrome P450 reductase polypeptide provided herein can be truncated by at or about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 or more amino acid residues at the C-terminus, provided the cytochrome P450 reductase polypeptide retains cytochrome P450 reductase activity. In some examples, cytochrome P450 reductases can be truncated by digestion with pancreatic steapsin or trypsin, which releases the N-terminal hydrophobic anchor.

[0356] For example, provided herein are truncated cytochrome P450 reductase polypeptides having a sequence of amino acids set forth in SEQ ID NO:14 or 15. Also provided herein are truncated cytochrome P450 reductase polypeptides having a sequence of amino acids having at least or at least about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to a truncated cytochrome P450 reductase having a sequence of amino acids set forth in SEQ ID NO:14 or 15, provided the resulting cytochrome P450 reductase polypeptide at least retains cytochrome P450 reductase activity (i.e., the ability to transfer two electrons from NADPH to cytochrome P450). Also provided herein are nucleic acid molecules having a sequence of nucleotides set forth in SEQ ID NOS:63 or 64 that encode the truncated cytochrome P450 reductase polypeptides having a sequence of amino acids set forth in SEQ ID NO:14 or 15, respectively.

[0357] b. Polypeptides with Altered Activities or Properties

[0358] The modified cytochrome P450 reductase polypeptides provided herein can also exhibit changes in activities and/or properties. The modified cytochrome P450 reductase polypeptides can exhibit, for example, improved properties, such as increased catalytic activity, increased stability, and/or increased expression in a host cell. In other examples, the modified cytochrome P450 reductase polypeptide exhibits a similar, increased and/or improved activity compared to the unmodified cytochrome P450 reductase polypeptide.

[0359] c. Domain Swaps

[0360] Provided herein are modified cytochrome P450 reductase polypeptides that are chimeric polypeptides containing a swap (deletion and insertion) by deletion of amino acid residues of one of more domains or regions therein or portions thereof and insertion of a heterologous sequence of amino acids. In some examples, the heterologous sequence is a randomized sequence of amino acids. In other examples, the heterologous sequence is a contiguous sequence of amino acids for the corresponding domain or region or portion thereof from another cytochrome P450 reductase. The heterologous sequence that is replaced or inserted generally includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more amino acids. In examples where the heterologous sequence is from a corresponding domain or a portion thereof of another cytochrome P450 reductase, the heterologous sequence generally includes at least 50%, 60%, 70%, 80%, 90%, 95% or more contiguous amino acids of the corresponding domain or region or portion. In such an example, adjacent residues to the heterologous corresponding domain or region or portion thereof also can be included in a modified cytochrome P450 reductase polypeptide provided herein.

[0361] In one example of swap mutants provided herein, at least one domain or region or portion thereof of a cytochrome P450 reductase polypeptide is replaced with a contiguous sequence of amino acids for the corresponding domain or region or portions thereof from another cytochrome P450 reductase polypeptide. In some examples, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more domains or regions or portions thereof are replaced with a contiguous sequence of amino acids for the corresponding domain or region or portions thereof from another cytochrome P450 reductase polypeptide.

[0362] Any domain or region or portion thereof of a cytochrome P450 reductase polypeptide can be replaced with a heterologous sequence of amino acids, such as heterologous sequence from the corresponding domain or region from another cytochrome P450 reductase. A domain or region can be a structural domain or a functional domain. One of skill in the art is familiar with domains or regions in cytochrome P450 reductases. Functional domains include, for example, the catalytic domain or a portion thereof. A structural domain can include all or a portion of .alpha.-helix A; .beta.-strand 1; .alpha.-helix B; .beta.-strand 2; .alpha.-helix C; .beta.-strand 3; .alpha.-helix D; .beta.-strand 4; .alpha.-helix E; .beta.-strand 5; .alpha.-helix F; .beta.-strand 6; .beta.-strand 7; .beta.-strand 8, .beta.-strand 9; .beta.-strand 10; .alpha.-helix G; .beta.-strand 11; .beta.-strand 12; .beta.-strand 12'; .alpha.-helix H; .alpha.-helix I; .alpha.-helix J; .alpha.-helix K; .alpha.-helix M; .beta.-strand 13; .beta.-strand 14; .beta.-strand 15; .alpha.-helix N; .beta.-strand 16; .beta.-strand 16'; .beta.-strand 17; .alpha.-helix O; .beta.-strand 18; .alpha.-helix P; .beta.-strand 10; .alpha.-helix Q; .alpha.-helix R; .beta.-strand 20; .alpha.-helix S; .alpha.-helix T; and .beta.-strand 21. One of skill in the art is familiar with various cytochrome P450s and can identify corresponding domains or regions or portions of amino acids thereof. Typically, the resulting modified cytochrome P450 reductase polypeptides exhibit cytochrome P450 reductase activity.

[0363] Any methods known in the art for generating chimeric polypeptides can be used to replace all or a contiguous portion of a domain or a cytochrome P450 reductase with all or a contiguous portion of the corresponding domain of a second cytochrome P450 reductase (see, U.S. Pat. Nos. 5,824,774, 6,072,045, 7,186,891 and 8,106,260, and U.S. Pat. Pub. No. 20110081703). Also, gene shuffling methods can be employed to generate chimeric polypeptides and/or polypeptides with domain or region swaps.

[0364] For example, corresponding domains or regions of any two cytochrome P450 reductases can be exchanged using any suitable recombinant method known in the art, or by in vitro synthesis. Exemplary of recombinant methods is a two stage overlapping PCR method, such as described herein. In such methods, primers that introduce mutations at a plurality of codon positions in the nucleic acids encoding the targeted domain or portion thereof in the first cytochrome P450 reductase can be employed; the mutations together form the heterologous region (i.e. the corresponding region from the second cytochrome P450 reductase). Alternatively, for example, randomized amino acids can be used to replace particular domains or regions. It is understood that primer errors, PCR errors and/or other errors in the cloning or recombinant methods can result in errors such that the resulting swapped or replaced region or domain does not exhibit an amino acid sequence that is identical to the corresponding region from the second cytochrome P450 reductase synthase.

[0365] In an exemplary PCR-based method, the first stage PCR uses (i) a downstream primer that anneals downstream of the region that is being replaced with a mutagenic primer that includes approximately fifteen nucleotides (or an effective number to effect annealing, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 25 nucleotides or more) of homologous sequence on each side of the domain or region to be exchanged or randomized flanking the region to be imported into the target gene, and (ii) an upstream primer that anneals upstream of the region that is being replaced together with an opposite strand mutagenic primer that also includes approximately fifteen nucleotides (or an effective number to effect annealing, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 25 nucleotides or more) of homologous sequence on each side of the domain or region to be exchanged or randomized flanking the region to be imported into the target gene. If a replacement in which a domain or region of a first cytochrome P450 reductase gene is replaced with the corresponding domain or region from a second cytochrome P450 reductase is being performed, nucleotides in the mutagenic primers between the flanking regions from the first cytochrome P450 reductase contain codons for the corresponding region of the second cytochrome P450 reductase. In instances where the amino acids in a domain or region are to be randomized, nucleotides of the mutagenic primers between the flanking regions from the first cytochrome P450 reductase contains random nucleotides. An overlapping PCR is then performed to join the two fragments, using the upstream and downstream oligo. The resulting PCR product then can be cloned into any suitable vector for expression of the modified cytochrome P450 reductase.

[0366] Further, any of the modified cytochrome P450 reductase polypeptides containing swap mutations herein can contain one or more further amino acid replacements as described herein above.

[0367] d. Additional Variants

[0368] Cytochrome P450 reductase polypeptides provided herein can be modified by any method known to one of skill in the art for generating protein variants, including, but not limited to, DNA or gene shuffling, error prone PCR, overlap PCR or other recombinant methods. In one example, nucleic acid molecules encoding any cytochrome P450 reductase polypeptide or variant cytochrome P450 reductase polypeptide provided herein can be modified by gene shuffling. Gene shuffling involves one or more cycles of random fragmentation and reassembly of at least two nucleotide sequences, followed by screening to select nucleotide sequences encoding polypeptides with desired properties. The recombination can be performed in vitro (see Stemmer et al. (1994) Proc Natl Acad Sci USA 91:10747-10751; Stemmer et al. (1994) Nature 370:389-391; Cramieri et al. (1998) Nature 391:288-291; U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252 and 5,837,458) or in vivo (see, International Pat. Pub. No. WO199707205). The nucleic acid molecules encoding the polypeptides then can be introduced into a host cell to be expressed heterologously and tested for their cytochrome P450 reductase activity by any method described in section G below.

[0369] e. Fusion or Chimeric Proteins

[0370] Nucleic acid molecules provided herein include fusion or chimeric nucleic acid molecules that contain a cytochrome P450 polypeptide and a cytochrome P450 reductase polypeptide. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that is capable of catalyzing the formation of a santalol or bergamotol, such as an .alpha.-santalol, .beta.-santalol, epi-.beta.-santalol or Z-.alpha.-trans-bergamotol, from santalenes or bergamotene that contains any cytochrome P450 polypeptide and any cytochrome P450 reductase polypeptide provided herein. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a cytochrome P450 polypeptide set forth in any of SEQ ID NOS:6-9 and a cytochrome P450 reductase polypeptide set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a cytochrome P450 polypeptide set forth in any of SEQ ID NOS:6-9 and a cytochrome P450 reductase polypeptide set forth in any of SEQ ID NOS:12-15. The fusion polypeptides can be linked directly or via a linker.

[0371] Nucleic acid molecules provided herein include fusion or chimeric nucleic acid molecules that contain a santalene synthase, cytochrome P450 polypeptide and a cytochrome P450 reductase. For example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53, a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO:7 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53, a cytochrome P450 santalene oxidase polypeptide set forth in SEQ ID NO:7 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. In another example, provided herein are nucleic acid molecules encoding a fusion polypeptide that contains a santalene synthase set forth in any of SEQ ID NOS:17, 52 or 53, a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8 or 9 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. Also provided herein are fusion polypeptides containing a santalene synthase set forth in any of SEQ ID NOS: 17, 52 or 53, a cytochrome P450 bergamotene oxidase polypeptide set forth in any of SEQ ID NOS:6, 8 or 9 and a cytochrome P450 reductase set forth in any of SEQ ID NOS:12-15. The fusion polypeptides can be linked directly or via a linker.

[0372] In another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 and/or a cytochrome P450 reductase, such that, when expressed in a host cell, a bacterial or yeast host cell, a santalene synthase, a cytochrome P450 and/or a cytochrome P450 reductase are expressed. In one another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 santalene oxidase and a cytochrome P450 reductase. In another example, provided herein is a nucleic acid molecule that encodes a santalene synthase, a cytochrome P450 bergamotene oxidase and a cytochrome P450 reductase. Further, when the host cell is capable of producing FPP, the encoded polypeptides catalyze the production of santalols and/or bergamotols.

[0373] Other examples of fusion proteins include, but are not limited to, fusions of a signal sequence, a tag such as for localization, e.g. a his.sub.6 tag or a myc tag, or a tag for purification, for example, a GST fusion, GFP fusion or CBP fusion, and a sequence for directing protein secretion and/or membrane association.

E. METHODS FOR PRODUCING MODIFIED CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES AND ENCODING NUCLEIC ACID MOLECULES

[0374] Provided are methods for producing modified cytochrome P450 and cytochrome P450 reductase polypeptides, including santalene oxidase and bergamotene oxidase polypeptides. The methods can be used to generate cytochrome P450s and cytochrome P450 reductases with desired properties, including, but not limited to, increased catalytic activity, increased selectivity, increased substrate specificity, increased substrate binding, increased stability, increased expression in a host cell, altered product distribution and/or altered substrate specificity. Modified cytochrome P450s and cytochrome P450 reductases can be produced using any method known in the art and, optionally, screened for the desired properties. In particular examples, modified cytochrome P450s and cytochrome P450 reductases with desired properties are generated by mutation in accord with the methods exemplified herein. Thus, provided herein are modified cytochrome P450s and cytochrome P450 reductases and nucleic acid molecules encoding the modified cytochrome P450s and cytochrome P450 reductases that are produced using the methods described herein.

[0375] Exemplary of the methods provided herein are those in which modified cytochrome P450s and cytochrome P450 reductases are produced by replacing one or more endogenous domains or regions of a first cytochrome P450 or cytochrome P450 reductase with the corresponding domain(s) or regions(s) from a second cytochrome P450 or cytochrome P450 reductase (i.e. heterologous domains or regions). In further examples, two or more endogenous domains or regions of a first cytochrome P450 or cytochrome P450 reductase are replaced with the corresponding heterologous domain(s) or regions(s) from two or more other cytochrome P450s or cytochrome P450 reductases, such as a second, third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth cytochrome P450s or cytochrome P450 reductases. Thus, the resulting modified cytochrome P450 or cytochrome P450 reductase can include heterologous domains or regions from 1, 2, 3, 4, 5, 6, 7, 8, 9 or more different cytochrome P450s or cytochrome P450 reductases. In further examples, the methods also or instead include replacing one or more domains or regions of a first cytochrome P450 or cytochrome P450 reductase synthase with randomized amino acid residues.

[0376] Any cytochrome P450 or cytochrome P450 reductase can be used in the methods provided herein. The first cytochrome P450 or cytochrome P450 reductase (i.e. the cytochrome P450 or cytochrome P450 reductase to be modified) can be of the same or different class as the second (or third, fourth, fifth, etc.) cytochrome P450 or cytochrome P450 reductase (i.e. the cytochrome P450(s) or cytochrome P450 reductase(s) from which the heterologous domain(s) or region(s) is derived).

[0377] In practicing the methods provided herein, all or a contiguous portion of an endogenous domain of a first cytochrome P450 or cytochrome P450 reductase can be replaced with all or a contiguous portion of the corresponding heterologous domain from a second cytochrome P450 or cytochrome P450 reductase. For example, 3, 4, 5, 6, 7, 8, 9, 10 or more contiguous amino acids from a domain or region in a first cytochrome P450 or cytochrome P450 reductase can be replaced with 3, 4, 5, 6, 7, 8, 9, 10 or more contiguous amino acids from the corresponding region from a second cytochrome P450 or cytochrome P450 reductase. In some examples, one or more amino acid residues adjacent to the endogenous domain of the first cytochrome P450 or cytochrome P450 reductase also are replaced, and/or one or more amino acid residues adjacent to the heterologous domain also are used in the replacement. Further, the methods provided herein also include methods in which all or a contiguous portion of a first domain and all or a contiguous portion of a second adjacent domain are replaced with the corresponding domains (or portions thereof) from another cytochrome P450 or cytochrome P450 reductase.

[0378] Domains or regions that can be replaced include functional domains or structural domains. Exemplary domains or regions that can be replaced in a cytochrome P450 using the methods described herein include, but are not limited to, structural domains or regions corresponding to helix A, .beta. strand 1-1, .beta. strand 1-2, helix B, .beta. strand 1-5, helix B', helix C, helix C', helix D, .beta. strand 3-1, helix E, helix F, helix G, helix H, .beta. strand 5-1, .beta. strand 5-2, helix I, helix J, helix J', helix K, .beta. strand 1-4, .beta. strand 2-1, .beta. strand 2-2, .beta. strand 1-3, helix K', helix K'', Heme domain, helix L, .beta. strand 3-3, .beta. strand 4-1, .beta. strand 4-2 and .beta. strand 3-2. Any one or more of these domains or regions, or a portion thereof, can be replaced with a corresponding domain from another cytochrome P450 using the methods provided herein. These domains are regions can be identified in any cytochrome P450 using methods well known in the art, such as, for example, by alignment using methods known to those of skill in the art (see, e.g., FIG. 5A-5B). Such methods typically maximize matches, and include methods such as using manual alignments and by using the numerous alignment programs available (for example, BLASTP) and others known to those of skill in the art. By aligning the sequences of the cytochrome P450 set forth in SEQ ID NO:50, and any other cytochrome P450, any of the domains or regions recited above can be identified in any cytochrome P450.

[0379] Exemplary domains or regions that can be replaced in a cytochrome P450 reductase using the methods described herein include, but are not limited to, structural domains or regions corresponding to .alpha.-helix A; .beta.-strand 1; .alpha.-helix B; .beta.-strand 2; .alpha.-helix C; .beta.-strand 3; .alpha.-helix D; .beta.-strand 4; .alpha.-helix E; .beta.-strand 5; .alpha.-helix F; .beta.-strand 6; .beta.-strand 7; .beta.-strand 8, .beta.-strand 9; .beta.-strand 10; .alpha.-helix G; .beta.-strand 11; .beta.-strand 12; .beta.-strand 12'; .alpha.-helix H; .alpha.-helix I; .alpha.-helix J; .alpha.-helix K; .alpha.-helix M; .beta.-strand 13; .beta.-strand 14; .beta.-strand 15; .alpha.-helix N; .beta.-strand 16; .beta.-strand 16'; .beta.-strand 17; .alpha.-helix O; .beta.-strand 18; .alpha.-helix P; .beta.-strand 10; .alpha.-helix Q; .alpha.-helix R; .beta.-strand 20; .alpha.-helix S; .alpha.-helix T; and .beta.-strand 21. These domains are regions can be identified in any cytochrome P450 reductase using methods well known in the art, such as, for example, by alignment using methods known to those of skill in the art (see, e.g., FIGS. 3A-3C). Such methods typically maximize matches, and include methods such as using manual alignments and by using the numerous alignment programs available (for example, BLASTP) and others known to those of skill in the art. By aligning the sequences of the cytochrome P450 reductase set forth in SEQ ID NO:12, and any other cytochrome P450 reductase, any of the domains or regions recited above can be identified in any cytochrome P450 reductase.

[0380] In the methods provided herein, all or a contiguous portion of an endogenous domain of a first cytochrome P450 or cytochrome P450 reductase can be replaced with all or a contiguous portion of the corresponding heterologous domain from a second cytochrome P450 or cytochrome P450 reductase using an suitable recombinant method known in the art as discussed above in Sections C.4.c. and D.3.c.

F. EXPRESSION OF CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES AND ENCODING NUCLEIC ACID MOLECULES

[0381] Cytochrome P450 and cytochrome P450 reductase polypeptides and active fragments thereof, including cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, can be obtained by methods well known in the art for recombinant protein generation and expression. Such cytochrome P450 santalene oxidase polypeptides can be used to produce santalols from santalenes in a host cell from which the cytochrome P450 santalene oxidase is expressed or in vitro following purification of the cytochrome P450 santalene oxidase polypeptide. Such cytochrome P450 bergamotene oxidase polypeptides can be used to produce bergamotols from bergamotenes in a host cell from which the cytochrome P450 bergamotene oxidase is expressed or in vitro following purification of the cytochrome P450 bergamotene oxidase polypeptide. Such cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides can be used to produce santalols or bergamotols from a suitable acyclic pyrophosphate precursor, such as FPP, in a host cell in which a santalene synthase and the cytochrome P450 are expressed. Any method known to those of skill in the art for identification of nucleic acids that encode desired genes can be used to obtain the nucleic acid encoding a cytochrome P450, such as a cytochrome P450 santalene oxidase or cytochrome P450 bergamotene oxidase, or cytochrome P450 reductase. For example, nucleic acid encoding unmodified or wild type cytochrome P450 polypeptides or cytochrome P450 reductase polypeptides can be obtained using well known methods from a plant source, such as Santalum album. Modified cytochrome P450 polypeptides or cytochrome P450 reductase polypeptides then can be engineered using any method known in the art for introducing mutations into unmodified or wild type cytochrome P450 polypeptides or cytochrome P450 reductase polypeptides, including any method described herein, such as random mutagenesis of the encoding nucleic acid by error-prone PCR, site-directed mutagenesis, overlap PCR, or other recombinant methods. The nucleic acids encoding the polypeptides then can be introduced into a host cell to be expressed heterologously.

[0382] In some examples, the cytochrome P450 polypeptides or cytochrome P450 reductase polypeptides provided herein, including cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides, are produced synthetically, such as using sold phase or solution phase peptide synthesis.

[0383] 1. Isolation of Nucleic Acid Encoding Santalum Album Cytochrome P450 and Cytochrome P450 Reductase Polypeptides

[0384] Nucleic acids encoding cytochrome P450s or cytochrome P450 reductases, such as cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase, can be cloned or isolated using any available methods known in the art for cloning and isolating nucleic acid molecules. Such methods include PCR amplification of nucleic acids and screening of libraries, including nucleic acid hybridization screening. In some examples, methods for amplification of nucleic acids can be used to isolate nucleic acid molecules encoding a cytochrome P450 or cytochrome P450 reductase polypeptide, including for example, polymerase chain reaction (PCR) methods. A nucleic acid containing material can be used as a starting material from which a cytochrome P450 or cytochrome P450 reductase-encoding nucleic acid molecule can be isolated. For example, DNA and mRNA preparations from Santalum species, including but not limited to Santalum album can be used to obtain cytochrome P450 or cytochrome P450 reductase genes. Nucleic acid libraries also can be used as a source of starting material. Primers can be designed to amplify a cytochrome P450 or cytochrome P450 reductase-encoding molecule, such as a cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase-encoding molecule. For example, primers can be designed based on known nucleic acid sequences encoding a cytochrome P450 such as those set forth in SEQ ID NOS:22-25. In another example, primers can be designed based on known nucleic acid sequences encoding a cytochrome P450 reductase such as those set forth in SEQ ID NOS:40-41. Nucleic acid molecules generated by amplification can be sequenced and confirmed to encode a cytochrome P450 or cytochrome P450 reductase polypeptide. The nucleic acid molecules provided herein can be used to identify related nucleic acid molecules in other species.

[0385] Additional nucleotide sequences can be joined to a cytochrome P450 or cytochrome P450 reductase-encoding nucleic acid molecule, including linker sequences containing restriction endonuclease sites for the purpose of cloning the synthetic gene into a vector, for example, a protein expression vector or a vector designed for the amplification of the core protein coding DNA sequences. Furthermore, additional nucleotide sequences specifying functional DNA elements can be operatively linked to a cytochrome P450 or cytochrome P450 reductase-encoding nucleic acid molecule. Still further, nucleic acid encoding other moieties or domains also can be included so that the resulting synthase is a fusion protein. For example, nucleic acids encoding other enzymes, such as FPP synthase or santalene synthase, or protein purification tags, such as His or Flag tags.

[0386] 2. Generation of Modified Nucleic Acid

[0387] Nucleic acid encoding a cytochrome P450 or cytochrome P450 reductase, such as a modified cytochrome P450 santalene oxidase polypeptides, modified cytochrome P450 bergamotene oxidase polypeptides or modified cytochrome P450 reductase polypeptides, can be prepared or generated using any method known in the art to effect mutation. Methods for modification include standard rational and/or random mutagenesis of encoding nucleic acid molecules (using e.g., error prone PCR, random site-directed saturation mutagenesis, DNA shuffling or rational site-directed mutagenesis, such as, for example, mutagenesis kits (e.g. QuikChange available from Stratagene)). In addition, routine recombinant DNA techniques can be used to generate nucleic acids encoding polypeptides that contain heterologous amino acid. For example, nucleic acid encoding chimeric polypeptides or polypeptides containing heterologous amino acid sequence, can be generated using a two-step PCR method, such as described above, and/or using restriction enzymes and cloning methodologies for routine subcloning of the desired chimeric polypeptide components.

[0388] Once generated, the nucleic acid molecules can be expressed in cells to generate modified cytochrome P450 or cytochrome P450 reductase polypeptides using any method known in the art. The modified cytochrome P450 or cytochrome P450 reductase polypeptides, such as modified cytochrome P450 santalene oxidase polypeptides, modified cytochrome P450 bergamotene oxidase polypeptides or modified cytochrome P450 reductase polypeptides, then can be assessed by screening for a desired property or activity, for example, for the ability to produce a terpenoid from a terpene substrate. In particular examples, modified cytochrome P450 or cytochrome P450 reductase polypeptides with desired properties are generated by mutation and screened for a property in accord with the examples exemplified herein. Typically, in instances where a modified cytochrome P450 santalene oxidase polypeptide is generated, the modified cytochrome P450 santalene oxidase polypeptides produce a santalol from a santalene. Typically, in instances where a modified cytochrome P450 bergamotene oxidase polypeptide is generated, the modified cytochrome P450 bergamotene oxidase polypeptides produce a bergamotol from a bergamotene.

[0389] 3. Vectors and Cells

[0390] For recombinant expression of one or more of the cytochrome P450 or cytochrome P450 reductase polypeptides provided herein, including cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides, the nucleic acid containing all or a portion of the nucleotide sequence encoding the synthase can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein coding sequence. Depending upon the expression system used, the necessary transcriptional and translational signals also can be supplied by the native promoter for a cytochrome P450 or cytochrome P450 reductase gene, and/or their flanking regions. Thus, also provided herein are vectors that contain nucleic acid encoding any cytochrome P450 or cytochrome P450 reductase polypeptide provided herein. Exemplary vectors include but are not limited to pESC-LEU, pESC-LEU2d, and pYEDP60.

[0391] Cells, including prokaryotic and eukaryotic cells, containing the vector also are provided. Also provided are host cells containing nucleic acid molecules encoding cytochrome P450 polypeptides provided herein, including cytochrome P450 santalene oxidases, cytochrome P450 bergamotene oxidases and cytochrome P450 reductases. Such cells and host cells include bacterial cells, yeast cells, fungal cells, Archea, plant cells, insect cells and animal cells. In particular examples, the cells or host cells are yeast cells, such as Saccharomyces cerevisiae or Pichia pastoris cells. In particular examples, the cells or host cells are Saccharomyces cerevisiae cells that express an acyclic pyrophosphate terpene precursor, such as farnesyl diphosphate (FPP). In some examples, the cells or host cells containing a cytochrome P450 provided herein can be modified to produce more FPP than an unmodified cell.

[0392] The cells are used to produce a cytochrome P450 or cytochrome P450 reductase polypeptide, such as cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides, by growing the above-described cells under conditions whereby the encoded cytochrome P450 or cytochrome P450 reductase is expressed by the cell. In some examples, the cytochrome P450 polypeptide, such as cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptide, are heterologous to the cell. In some instances, the expressed cytochrome P450 and/or cytochrome P450 reductases are purified. In other instances, the expressed cytochrome P450s and cytochrome P450 reductases, convert one or more santalenes or bergamotenes to one or more santalols or bergamotols in the host cell. In some examples, a santalene synthase, a cytochrome P450 santalene oxidase and a cytochrome P450 reductase are expressed thereby converting the acyclic pyrophosphate terpene precursor FPP to santalol. In other examples, a santalene synthase, a cytochrome P450 bergamotene oxidase and a cytochrome P450 reductase are expressed thereby converting the acyclic pyrophosphate terpene precursor FPP to bergamotol.

[0393] Any method known to those of skill in the art for the insertion of DNA fragments into a vector can be used to construct expression vectors containing a chimeric gene containing appropriate transcriptional/translational control signals and protein coding sequences. These methods can include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of nucleic acid sequences encoding a cytochrome P450 or cytochrome P450 reductase polypeptide or modified cytochrome P450 or cytochrome P450 reductase polypeptide, or domains, derivatives, fragments or homologs thereof, can be regulated by a second nucleic acid sequence so that the genes or fragments thereof are expressed in a host transformed with the recombinant DNA molecule(s). For example, expression of the proteins can be controlled by any promoter/enhancer known in the art. In one embodiment, the promoter is not native to the genes for a cytochrome P450 or cytochrome P450 reductase protein. Promoters that can be used include but are not limited to prokaryotic, yeast, mammalian and plant promoters. The type of promoter depends upon the expression system used, described in more detail below.

[0394] In one embodiment, a vector is used that contains a promoter operably linked to nucleic acids encoding a cytochrome P450 or cytochrome P450 reductase polypeptide or modified cytochrome P450 or cytochrome P450 reductase polypeptide, or a domain, fragment, derivative or homolog, thereof, one or more origins of replication, and optionally, one or more selectable markers (e.g., an antibiotic resistance gene). Vectors and systems for expression of cytochrome P450 or cytochrome P450 reductase polypeptides are described.

[0395] 4. Expression Systems

[0396] Cytochrome P450 or cytochrome P450 reductase polypeptides, including cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides (modified and unmodified) can be produced by any methods known in the art for protein production including in vitro and in vivo methods such as, for example, the introduction of nucleic acid molecules encoding the cytochrome P450 or cytochrome P450 reductase (e.g. cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase) into a host cell or host plant for in vivo production or expression from nucleic acid molecules encoding the cytochrome P450 or cytochrome P405 reductases (e.g. cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase) in vitro. Cytochrome P450 or cytochrome P450 reductase polypeptides such as cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase and modified cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides can be expressed in any organism suitable to produce the required amounts and forms of a synthase polypeptide. Expression hosts include prokaryotic and eukaryotic organisms such as E. coli, yeast, plants, insect cells, mammalian cells, including human cell lines and transgenic animals. Expression hosts can differ in their protein production levels as well as the types of post-translational modifications that are present on the expressed proteins. The choice of expression host can be made based on these and other factors, such as regulatory and safety considerations, production costs and the need and methods for purification.

[0397] Expression in eukaryotic hosts can include expression in yeasts such as those from the Saccharomyces genus (e.g. Saccharomyces cerevisiae) and Pichia genus (e.g. Pichia pastoris), insect cells such as Drosophila cells and lepidopteran cells, plants and plant cells such as citrus, tobacco, corn, rice, algae, and lemna. Eukaryotic cells for expression also include mammalian cells lines such as Chinese hamster ovary (CHO) cells or baby hamster kidney (BHK) cells. Eukaryotic expression hosts also include production in transgenic animals, for example, including production in serum, milk and eggs.

[0398] Many expression vectors are available and known to those of skill in the art for the expression of a cytochrome P450 or cytochrome P450 reductase, such as cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase. Exemplary of expression vectors are those encoding a santalene synthase and a FPP synthase, including the vectors described in Example 7. The choice of expression vector is influenced by the choice of host expression system. Such selection is well within the level of skill of the skilled artisan. In general, expression vectors can include transcriptional promoters and optionally enhancers, translational signals, and transcriptional and translational termination signals. Expression vectors that are used for stable transformation typically have a selectable marker which allows selection and maintenance of the transformed cells. In some cases, an origin of replication can be used to amplify the copy number of the vectors in the cells.

[0399] Cytochrome P450 or cytochrome P450 reductase polypeptides, including cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides and modified cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides, also can be used or expressed as protein fusions. For example, a fusion can be generated to add additional functionality to a polypeptide. Examples of fusion proteins include, but are not limited to, fusions of a signal sequence, a tag such as for localization, e.g. a his.sub.6 tag or a myc tag, or a tag for purification, for example, a GST fusion, GFP fusion or CBP fusion, and a sequence for directing protein secretion and/or membrane association.

[0400] Methods of production of cytochrome P450 and cytochrome P450 reductase polypeptides, including cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase polypeptides, can include co-expression of an acyclic pyrophosphate terpene precursor, such as FPP, in the host cell. In some instances, the host cell naturally expresses FPP. Such a cell can be modified to express greater quantities of FPP (see e.g. U.S. Pat. Nos. 6,531,303, 6,689,593, 7,838,279 and 7,842,497). In other instances, a host cell that does not naturally produce FPP is modified genetically to produce FPP.

[0401] a. Prokaryotic Cells

[0402] Prokaryotes, especially E. coli, provide a system for producing large amounts of the cytochrome P450 and cytochrome P450 reductase polypeptides provided herein. Transformation of E. coli is a simple and rapid technique well known to those of skill in the art. Exemplary expression vectors for transformation of E. coli cells, include, for example, the pGEM expression vectors, the pQE expression vectors, and the pET expression vectors (see, U.S. Pat. No. 4,952,496; available from Novagen, Madison, Wis.; see, also literature published by Novagen describing the system). Such plasmids include pET 11a, which contains the T7lac promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene; pET 12a-c, which contains the T7 promoter, T7 terminator, and the E. coli ompT secretion signal; pET 15b and pET19b (Novagen, Madison, Wis.), which contain a His-Tag.TM. leader sequence for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column, the T7-lac promoter region and the T7 terminator; pACYC-Duet (Novagen, Madison, Wis.; SEQ ID NO:45).

[0403] Expression vectors for E. coli can contain inducible promoters that are useful for inducing high levels of protein expression and for expressing proteins that exhibit some toxicity to the host cells. Exemplary prokaryotic promoters include, for example, the .beta.-lactamase promoter (Jay et al., (1981) Proc. Natl. Acad. Sci. USA 78:5543) and the tac promoter (DeBoer et al., (1983) Proc. Natl. Acad. Sci. USA 80:21-25); see also "Useful Proteins from Recombinant Bacteria": in Scientific American 242:79-94 (1980)). Examples of inducible promoters include the lac promoter, the trp promoter, the hybrid tac promoter, the T7 and SP6 RNA promoters and the temperature regulated .lamda.P.sub.L promoter.

[0404] Cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, can be expressed in the cytoplasmic environment of E. coli. The cytoplasm is a reducing environment and for some molecules, this can result in the formation of insoluble inclusion bodies. Reducing agents such as dithiothreitol and .beta.-mercaptoethanol and denaturants (e.g., such as guanidine-HCl and urea) can be used to resolubilize the proteins. An alternative approach is the expression of cytochrome P450s and cytochrome P450 reductases in the periplasmic space of bacteria which provides an oxidizing environment and chaperonin-like and disulfide isomerases leading to the production of soluble protein. Typically, a leader sequence is fused to the protein to be expressed which directs the protein to the periplasm. The leader is then removed by signal peptidases inside the periplasm. Examples of periplasmic-targeting leader sequences include the pelB leader from the pectate lyase gene and the leader derived from the alkaline phosphatase gene. In some cases, periplasmic expression allows leakage of the expressed protein into the culture medium. The secretion of proteins allows quick and simple purification from the culture supernatant. Proteins that are not secreted can be obtained from the periplasm by osmotic lysis. Similar to cytoplasmic expression, in some cases proteins can become insoluble and denaturants and reducing agents can be used to facilitate solubilization and refolding. Temperature of induction and growth also can influence expression levels and solubility. Typically, temperatures between 25.degree. C. and 37.degree. C. are used. Mutations also can be used to increase solubility of expressed proteins. Typically, bacteria produce aglycosylated proteins.

[0405] b. Yeast Cells

[0406] Yeast systems, such as, but not limited to, those from the Saccharomyces genus (e.g. Saccharomyces cerevisiae), Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis, and Pichia pastoris can be used to express the cytochrome P450s and cytochrome P450 reductases, such as cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides and modified cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, provided herein. Yeast expression systems also can be used to produce terpenes whose reactions are catalyzed by the synthases. Yeast can be transformed with episomal replicating vectors or by stable chromosomal integration by homologous recombination. In some examples, inducible promoters are used to regulate gene expression. Exemplary promoter sequences for expression of cytochrome P450 and cytochrome P450 reductase polypeptides in yeast include, among others, promoters for metallothionine, 3-phosphoglycerate kinase (Hitzeman et al. (1980) J. Biol. Chem. 255:2073), or other glycolytic enzymes (Hess et al. (1968) J. Adv. Enzyme Reg. 7:149; and Holland et al. (1978) Biochem. 17:4900), such as enolase, glyceraldehyde phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.

[0407] Other suitable vectors and promoters for use in yeast expression are further described in Hitzeman, EPA-73,657 or in Fleer et al. (1991) Gene, 107:285-195; and van den Berg et al. (1990) Bio/Technology, 8:135-139. Another alternative includes, but is not limited to, the glucose-repressible ADH2 promoter described by Russell et al. (J. Biol. Chem. 258:2674, 1982) and Beier et al. (Nature 300:724, 1982), or a modified ADH1 promoter. Shuttle vectors replicable in yeast and E. coli can be constructed by, for example, inserting DNA sequences from pBR322 for selection and replication in E. coli (Amp.sup.r gene and origin of replication) into the above-described yeast vectors.

[0408] Yeast expression vectors can include a selectable marker such as LEU2, TRP1, HIS3, and URA3 for selection and maintenance of the transformed DNA. Exemplary vectors include pESC-Leu, pESC-Leu2D, pESC-His and pYEDP60. Proteins expressed in yeast are often soluble and co-expression with chaperonins, such as Bip and protein disulfide isomerase, can improve expression levels and solubility. Additionally, proteins expressed in yeast can be directed for secretion using secretion signal peptide fusions such as the yeast mating type alpha-factor secretion signal from Saccharomyces cerevisiae and fusions with yeast cell surface proteins such as the Aga2p mating adhesion receptor or the Arxula adeninivorans glucoamylase. A protease cleavage site (e.g., the Kex-2 protease) can be engineered to remove the fused sequences from the polypeptides as they exit the secretion pathway.

[0409] Yeast naturally express the required proteins, including FPP synthase (ERG20; which can produce FPP) for the mevalonate-dependent isoprenoid biosynthetic pathway. Thus, expression of the cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides provided herein, in yeast cells can result in the production of sesquiterpenes, such as santalenes and bergamotenes from FPP, and santalols and bergamotols. Exemplary yeast cells for the expression of cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, include yeast modified to express increased levels of FPP. For example, yeast cells can be modified to produce less squalene synthase or less active squalene synthase (e.g. erg9 mutants; see e.g. U.S. Pat. Nos. 6,531,303 and 6,689,593). This results in accumulation of FPP in the host cell at higher levels compared to wild type yeast cells, which in turn can result in increased yields of sesquiterpenes and sesquiterpenoids (e.g. santalenes, bergamotenes, santalols and bergamotols). In another example, yeast cells can be modified to produce more FPP synthase by introduction of a FPP synthase gene, such as SaFPPS from Santalum album (SEQ ID NO:18). In some examples, the native FPP gene in such yeast can be deleted. Other modifications that enable increased production of FPP in yeast include, for example, but are not limited to, modifications that increase production of acetyl CoA, inactivate genes that encode enzymes that use FPP and GPP as substrate and overexpress HMG-CoA reductases, as described in U.S. Pat. No. 7,842,497. Exemplary modified yeast cells include, but are not limited to, YPH499 (MATa, ura3-52, lys2-801, ade2-101, trpl-.DELTA.63, his3-.DELTA.200, leu2-.DELTA.1), WAT11 (MATa, ade2-1, his3-11,-15; leu2-3,-112, ura3-1, canR, cyr+; containing chromosomally integrated Arabidopsis NADPH-dependent P450 reductase ATR1; see Pompon et al. (1995) Toxicol Lett 82-83:815-822; Ro et al. (2005) Proc Natl Acad Sci USA 102:8060-8065); and BY4741 (MATa, his3.DELTA.1, leu2.DELTA.0, met15.DELTA.0, ura3.DELTA.0; ATCC #201388), modified Saccharomyces cerevisiae strains CALI5-1 (ura3, leu2, his3, trp1, .DELTA. erg9::HIS3, HMG2cat/TRP1::rDNA, dpp1, sue), ALX7-95 (ura3, his3, trp1, .DELTA.erg9::HIS3, HMG2cat/TRP1::rDNA, dpp1 sue), ALX11-30 (ura3, trp1, erg9.sup.def25, HMG2cat/TRP1::rDNA, dpp1, sue), which are known and described in one or more of U.S. Pat. Nos. 6,531,303, 6,689,593, 7,838,279, 7,842,497, and U.S. Pat. publication Nos. 20040249219 and 20110189717.

[0410] c. Plants and Plant Cells

[0411] Transgenic plant cells and plants can be used for the expression of cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides provided herein. Expression constructs are typically transferred to plants using direct DNA transfer such as microprojectile bombardment and PEG-mediated transfer into protoplasts, and with agrobacterium-mediated transformation. Expression vectors can include promoter and enhancer sequences, transcriptional termination elements, and translational control elements. Expression vectors and transformation techniques are usually divided between dicot hosts, such as Arabidopsis and tobacco, and monocot hosts, such as corn and rice. Examples of plant promoters used for expression include the cauliflower mosaic virus promoter, the nopaline synthase promoter, the ribose bisphosphate carboxylase promoter and the ubiquitin and UBQ3 promoters. Selectable markers such as hygromycin, phosphomannose isomerase and neomycin phosphotransferase are often used to facilitate selection and maintenance of transformed cells. Transformed plant cells can be maintained in culture as cells, aggregates (callus tissue) or regenerated into whole plants. Transgenic plant cells also can include algae engineered to produce proteins (see, for example, Mayfield et al. (2003) Proc Natl Acad Sci USA 100:438-442). Transformed plants include, for example, plants selected from the genera Nicotiana, Solanum, Sorghum, Arabidopsis, Medicago (alfalfa), Gossypium (cotton) and Brassica (rape). In some examples, the plant belongs to the species of Nicotiana tabacum, and is transformed with vectors that overexpress a cytochrome P450 and/or a cytochrome P450 reductase, such as described in U.S. Pat. Pub. No. 20090123984 and U.S. Pat. No. 7,906,710.

[0412] d. Insects and Insect Cells

[0413] Insects and insect cells, particularly a baculovirus expression system, can be used for expressing cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides provided herein (see, for example, Muneta et al. (2003) J. Vet. Med. Sci. 65(2):219-223). Insect cells and insect larvae, including expression in the haemolymph, express high levels of protein and are capable of most of the post-translational modifications used by higher eukaryotes. Baculoviruses have a restrictive host range which improves the safety and reduces regulatory concerns of eukaryotic expression. Typically, expression vectors use a promoter such as the polyhedrin promoter of baculovirus for high level expression. Commonly used baculovirus systems include baculoviruses such as Autographa californica nuclear polyhedrosis virus (AcNPV), and the Bombyx mori nuclear polyhedrosis virus (BmNPV) and an insect cell line such as Sf9 derived from Spodoptera frugiperda (see, e.g., Mizutani and Ohta (1998) Plant Physiology 116:357-367), Pseudaletia unipuncta (A7S) and Danaus plexippus (DpN1). For high level expression, the nucleotide sequence of the molecule to be expressed is fused immediately downstream of the polyhedrin initiation codon of the virus. Mammalian secretion signals are accurately processed in insect cells and can be used to secrete the expressed protein into the culture medium. In addition, the cell lines Pseudaletia unipuncta (A7S) and Danaus plexippus (DpN1) produce proteins with glycosylation patterns similar to mammalian cell systems.

[0414] An alternative expression system in insect cells is the use of stably transformed cells. Cell lines such as the Schnieder 2 (S2) and Kc cells (Drosophila melanogaster) and C7 cells (Aedes albopictus) can be used for expression. The Drosophila metallothionein promoter can be used to induce high levels of expression in the presence of heavy metal induction with cadmium or copper. Expression vectors are typically maintained by the use of selectable markers such as neomycin and hygromycin.

[0415] e. Mammalian Expression

[0416] Mammalian expression systems can be used to express cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides provided herein and also can be used to produce terpenes whose reactions are catalyzed by the synthases. Expression constructs can be transferred to mammalian cells by viral infection such as adenovirus or by direct DNA transfer such as liposomes, calcium phosphate, DEAE-dextran and by physical means such as electroporation and microinjection. Expression vectors for mammalian cells typically include an mRNA cap site, a TATA box, a translational initiation sequence (Kozak consensus sequence) and polyadenylation elements. Such vectors often include transcriptional promoter-enhancers for high level expression, for example the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter, and the long terminal repeat of Rous sarcoma virus (RSV). These promoter-enhancers are active in many cell types. Tissue and cell-type promoters and enhancer regions also can be used for expression. Exemplary promoter/enhancer regions include, but are not limited to, those from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha-fetoprotein, alpha 1-antitrypsin, beta-globin, myelin basic protein, myosin light chain-2 and gonadotropic releasing hormone gene control. Selectable markers can be used to select for and maintain cells with the expression construct. Examples of selectable marker genes include, but are not limited to, hygromycin B phosphotransferase, adenosine deaminase, xanthine-guanine phosphoribosyl transferase, aminoglycoside phosphotransferase, dihydrofolate reductase and thymidine kinase. Fusion with cell surface signaling molecules such as TCR-.zeta. and Fc.sub..epsilon.RI-.gamma. can direct expression of the proteins in an active state on the cell surface.

[0417] Many cell lines are available for mammalian expression including mouse, rat human, monkey, and chicken and hamster cells. Exemplary cell lines include, but are not limited to, BHK (i.e. BHK-21 cells), 293-F, CHO, CHO Express (CHOX; Excellgene), Balb/3T3, HeLa, MT2, mouse NSO (non-secreting) and other myeloma cell lines, hybridoma and heterohybridoma cell lines, lymphocytes, fibroblasts, Sp2/0, COS, NIH3T3, HEK293, 293S, 293T, 2B8, and HKB cells. Cell lines also are available adapted to serum-free media which facilitates purification of secreted proteins from the cell culture media. One such example is the serum free EBNA-1 cell line (Pham et al. (2003) Biotechnol. Bioeng. 84:332-42).

[0418] f. Exemplary Host Cells

[0419] Exemplary host cells for expression of a cytochrome p450 polypeptide provided herein, such as a cytochrome P450 santalene oxidase, cytochrome P450 bergamotene oxidase or cytochrome P450 reductase, include prokaryotic and eukaryotic cells. Typically, the host cell produces an acyclic pyrophosphate terpene precursor. For example, the host cell produces farnesyl diphosphate. In some examples, the host cell can be a cell line that produces FPP as part of the mevalonate-dependent isoprenoid biosynthetic pathway (e.g. fungi, including yeast cells, and animal cells) or the mevalonate-independent isoprenoid biosynthetic pathway (e.g. bacteria and higher plants). In some examples, the host cell produces farnesyl diphosphate natively. In other examples, the host cell is modified to produce more farnesyl diphosphate compared to an unmodified cell. Exemplary host cells include bacteria, yeast, insect, plant and mammalian cells. In particular examples, the host cell is a yeast cell. For example, the yeast cell is a Saccharomyces genus cell, such as a Saccharomyces cerevisiae cell. In another example, the yeast cell is a Pichia genus cell, such as a Pichia pastoris cell. In other particular examples, the host cell is an Escherichia coli cell.

[0420] In particular examples, the host cell has been modified to overproduce FPP. Exemplary of such cells are modified yeast cells. For example, yeast cells that have been modified to produce less squalene synthase or less active squalene synthase (e.g. erg9 mutants; see e.g. U.S. Pat. Nos. 6,531,303 and 6,689,593) are useful in the methods provided herein to produce labdenediol diphosphate. Reduced squalene synthase activity results in accumulation of FPP in the host cell at higher levels compared to wild type yeast cells. Exemplary modified yeast cells include, but are not limited to, modified Saccharomyces cerevisiae strains YPH499 (MATa, ura3-52, lys2-801, ade2-101, trp1-.DELTA.63, his3-.DELTA.200, leu2-.DELTA.1), WAT11 (MATa, ade2-1, his3-11,-15; leu2-3,-112, ura3-1, canR, cyr+; containing chromosomally integrated Arabidopsis NADPH-dependent P450 reductase ATR1; see Pompon et al. (1995) Toxicol Lett 82-83:815-822; Ro et al. (2005) Proc Natl Acad Sci USA 102:8060-8065); and BY4741 (MATa, his3.DELTA.1, leu2.DELTA.0, met15.DELTA.0, ura3.DELTA.0; ATCC #201388). The use of such host cells for expression of a cytochrome P450 polypeptide provided herein allows for increased yields of the precursor FPP and thus allows for increased yields of santalenes and bergamotenes.

[0421] Provided herein are host cells containing any cytochrome P450 polypeptide or catalytically active fragment thereof provided herein. Provided herein are host cells containing a cytochrome P450 polypeptide or a catalytically active fragment thereof. In some examples, the host cell contains a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72. In other examples, the host cell contains a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72. In other examples, the host cell contains nucleic acid encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78. In yet other examples, the host cell contains nucleic acid encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78.

[0422] Provided herein are host cells containing a cytochrome P450 santalene oxidase or a catalytically active fragment thereof. In some examples, the host cell contains a cytochrome P450 santalene oxidase or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:3, 68, 69, 70 or 71. In other examples, the host cell contains a cytochrome P450 santalene oxidase or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:3, 68, 69, 70 or 71. In other examples, the host cell contains nucleic acid encoding a cytochrome P450 santalene oxidase or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77. In yet other examples, the host cell contains nucleic acid encoding a cytochrome P450 santalene oxidase or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:7, 74, 75, 76 or 77.

[0423] Provided herein are host cells containing a cytochrome P450 bergamotene oxidase or a catalytically active fragment thereof. In some examples, the host cell contains a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:2, 4, 5 or 67. In other examples, the host cell contains a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:2, 4, 5 or 67. In other examples, the host cell contains nucleic acid encoding a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 or 73. In yet other examples, the host cell contains nucleic acid encoding a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:6, 8, 9 or 73.

[0424] In some examples, any of the host cells provided herein containing a cytochrome P450 or catalytically active fragment thereof can further contain a terpene synthase. Provided herein are host cells containing a cytochrome P450 or catalytically active fragment thereof and a terpene synthase. In such examples, the terpene synthase can be a santalene synthase. For example, the terpene synthase is a santalene synthase having a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a santalene synthase having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a nucleic acid molecule encoding a santalene synthase. The encoding nucleic acid molecule has a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60, or a nucleic acid molecule encoding a santalene synthase. The nucleic acid molecule has at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% percent identity to a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60.

[0425] Provided herein are host cells containing a cytochrome P450 or catalytically active fragment thereof and a santalene synthase having a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a santalene synthase having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a nucleic acid molecule encoding a santalene synthase. The nucleic acid molecule has a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60, or a nucleic acid molecule encoding a santalene synthase. The nucleic acid molecule has at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% percent identity to a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60. In such examples, the cytochrome P450 or catalytically active fragment thereof is a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78.

[0426] In one example, provided herein is a host cell that contains a cytochrome P450 polypeptide or catalytically active fragment thereof and a santalene synthase. In another example, provided herein is a host cell that contains a cytochrome P450 santalene oxidase or catalytically active fragment thereof and a santalene synthase. In yet another example, provided herein is a host cell that contains a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof and a santalene synthase. Also provided herein are host cells containing a cytochrome P450 or catalytically active fragment thereof and a terpene synthase that further contain a cytochrome P450 reductase or catalytically active fragment thereof. In such examples, the terpene synthase can be a santalene synthase. For example, the terpene synthase is a santalene synthase having a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a santalene synthase having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:17, 52 or 53, or a nucleic acid molecule encoding a santalene synthase. The nucleic acid molecule has a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60, or a nucleic acid molecule encoding a santalene synthase. The nucleic acid molecule has at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% percent identity to a sequence of nucleotides set forth in any of SEQ ID NOS:16, 59 or 60. In such examples, the cytochrome P450 reductase or catalytically active fragment thereof is a cytochrome P450 reductase or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:10 or 11, or a cytochrome P450 reductase or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:10 or 11, ora nucleic acid molecule encoding a cytochrome P450 reductase or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:12-15 or a nucleic acid molecule encoding a cytochrome P450 reductase or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:12-15. In such examples, the cytochrome P450 or catalytically active fragment thereof is a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78.

[0427] In one example, provided herein is a host cell containing a cytochrome P450 polypeptide or catalytically active fragment thereof, a santalene synthase and a cytochrome P450 reductase or catalytically active fragment thereof. In another example, provided herein is a host cell containing a cytochrome P450 santalene oxidase or catalytically active fragment thereof, a santalene synthase and a cytochrome P450 reductase or catalytically active fragment thereof. In yet another example, provided herein is a host cell containing a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof, a santalene synthase and a cytochrome P450 reductase or catalytically active fragment thereof.

[0428] Provided herein are host cells containing a cytochrome P450 reductase or a catalytically active fragment thereof. In some examples, the host cell contains a cytochrome P450 reductase or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:10 or 11. In other examples, the host cell contains a cytochrome P450 reductase or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:10 or 11. In other examples, the host cell contains nucleic acid encoding a cytochrome P450 reductase or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:12-15. In yet other examples, the host cell contains nucleic acid encoding a cytochrome P450 reductase or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:12-15.

[0429] In some examples, the host cell containing a cytochrome P450 reductase or catalytically active fragment thereof further contains a cytochrome P450 or catalytically active fragment thereof. For example, provided herein are host cells containing a cytochrome P450 reductase or a catalytically active fragment thereof and a cytochrome P450 or catalytically active fragment thereof. In such examples, the cytochrome P450 or catalytically active fragment thereof is a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a cytochrome P450 polypeptide or catalytically active fragment thereof has a sequence of nucleic acids that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of nucleotides set forth in any of SEQ ID NOS:1-5 and 67-72, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78, or a nucleic acid molecule encoding a cytochrome P450 polypeptide or catalytically active fragment thereof that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent sequence identity to a sequence of amino acids set forth in any of SEQ ID NOS:6-9, 50 and 73-78.

[0430] In one example, provided herein is a host cell containing a cytochrome P450 polypeptide or catalytically active fragment thereof and a cytochrome P450 reductase or catalytically active fragment thereof. In another example, provided herein is a host cell containing a cytochrome P450 santalene oxidase or catalytically active fragment thereof and a cytochrome P450 reductase or catalytically active fragment thereof. In yet another example, provided herein is a host cell containing a cytochrome P450 bergamotene oxidase or catalytically active fragment thereof and a cytochrome P450 reductase or catalytically active fragment thereof.

[0431] 5. Purification

[0432] Methods for purification of cytochrome P450s and cytochrome P450 reductases, such as cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, from host cells depend on the chosen host cells and expression systems. For secreted molecules, proteins are generally purified from the culture media after removing the cells. For intracellular expression, cells can be lysed and the proteins purified from the extract. When transgenic organisms such as transgenic plants and animals are used for expression, tissues or organs can be used as starting material to make a lysed cell extract. Additionally, transgenic animal production can include the production of polypeptides in milk or eggs, which can be collected, and if necessary the proteins can be extracted and further purified using standard methods in the art.

[0433] Cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, can be purified using standard protein purification techniques known in the art including but not limited to, SDS-PAGE, size fraction and size exclusion chromatography, ammonium sulfate precipitation, chelate chromatography and ionic exchange chromatography. Expression constructs also can be engineered to add an affinity tag such as a myc epitope, GST fusion or His.sub.6 and affinity purified with myc antibody, glutathione resin, and Ni-resin, respectively, to a protein. Purity can be assessed by any method known in the art including gel electrophoresis and staining and spectrophotometric techniques.

[0434] 6. Fusion Proteins

[0435] Fusion proteins containing a cytochrome P450s and cytochrome P450 reductases, including cytochrome P450 santalene oxidase polypeptides, cytochrome P450 bergamotene oxidase polypeptides and cytochrome P450 reductase polypeptides, and one or more other polypeptides also are provided. Linkage of a cytochrome P450 or cytochrome P450 reductase polypeptide with another polypeptide can be effected directly or indirectly via a linker. In one example, linkage can be by chemical linkage, such as via heterobifunctional agents or thiol linkages or other such linkages. Fusion also can be effected by recombinant means. Fusion of a cytochrome P450 or cytochrome P450 reductase, such as a cytochrome P450 santalene oxidase polypeptide, cytochrome P450 bergamotene oxidase polypeptide and cytochrome P450 reductase polypeptide, to another polypeptide can be to the N- or C- terminus of the cytochrome P450 santalene oxidase polypeptide, cytochrome P450 bergamotene oxidase polypeptide and cytochrome P450 reductase polypeptide.

[0436] A fusion protein can be produced by standard recombinant techniques. For example, DNA fragments coding for the different polypeptide sequences can be ligated together in-frame in accordance with conventional techniques, e.g., by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, e.g., Ausubel et al. (eds.) Current Protocols in Molecular Biology, John Wiley & Sons, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A cytochrome P450 santalene oxidase polypeptide-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the cytochrome P450 santalene oxidase protein. A cytochrome P450 bergamotene oxidase polypeptide-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the cytochrome P450 bergamotene oxidase protein. In some examples, a cytochrome P450 polypeptide-encoding nucleic acid can be cloned into such an expression vector such that the cytochrome P450 is linked in frame to a santalene synthase polypeptide-encoding nucleic acid. For example, a cytochrome P450 santalene oxidase or bergamotene oxidase polypeptide-encoding nucleic acid can be cloned into such an expression vector such that the cytochrome P450 santalene oxidase or bergamotene oxidase is linked in frame to a santalene synthase polypeptide-encoding nucleic acid. The cytochrome P450 and santalene synthases can be linked directly, without a linker, or alternatively, linked indirectly in-frame with a linker.

G. METHODS FOR PRODUCING TERPENOIDS AND METHODS FOR DETECTING SUCH PRODUCTS AND THE ACTIVITY OF THE CYTOCHROME P450 AND CYTOCHROME P450 REDUCTASE POLYPEPTIDES

[0437] The cytochrome P450 polypeptides provided herein can be used to, and assessed for their ability to, produce terpenoids, including monoterpenoids, sesquiterpenoids and diterpenoids, from any suitable terpene substrate, including monoterpenes, sesquiterpenes and diterpenes. Typically, the cytochrome P450 santalene oxidases provided herein produce santalols from santalenes and the cytochrome P450 bergamotene oxidases provided herein produce bergamotols from bergamotenes. Any method known to one of skill in the art can be used to produce terpenoids catalyzed by the cytochrome P450 polypeptides provided herein. The ability of the cytochrome P450 polypeptides provided herein to catalyze the formation of terpenoids from terpene substrates can be assessed using these methods. Terpenoid products analyzed by GC-MS and can be identified based on matches of the MS fragmentation patterns with entries in the NIST and Wiley libraries (for example, as described in Example 6 below).

[0438] The cytochrome P450 reductase polypeptides provided herein can be used to, and assessed for their ability to, transfer two electrons from NADPH to any suitable electron receptor, including cytochrome P450s, cytochrome c, heme oxygenases, cytochrome b.sub.5 and squalene epoxidases.

[0439] Other activities and properties of the cytochrome P450 and cytochrome P450 reductase polypeptides, such as the cytochrome P450 santalene oxidases, cytochrome P450 bergamotene oxidases and cytochrome P450 reductases provided herein, also can be assessed using methods and assays well known in the art. In addition to assessing the activity of the cytochrome P450 and cytochrome P450 reductase polypeptides and their ability to catalyze the formation of terpenoids, the kinetics of the reaction, increased substrate specificity, altered substrate utilization and/or altered product distribution (as compared to another cytochrome P450 and cytochrome P450 reductase polypeptide) can be assessed using methods well known in the art. For example, the amount and type of terpenoids produced from santalenes or bergamotenes by the santalene oxidase and bergamotene oxidase polypeptides provided herein can be assessed by gas chromatography methods (e.g. GC-MS), such as those described in Example 6, and compared to the MS fragmentation patterns with entries in the NIST and Wiley libraries (see Example 6). Products can also be identified by comparison with compounds of authentic sandalwood oil.

[0440] Provided below are methods for the production of santalols, including (Z)-.alpha.-santalol, (E)-.alpha.-santalol, (Z)-.beta.-santalol, (E)-.beta.-santalol, (Z)-epi-.beta.-santalol and (E)-epi-.beta.-santalol, and (E)-.alpha.-trans-bergamotol and (Z)-.alpha.-trans-bergamotol, where production of the santalols and bergamotols is catalyzed by the cytochrome P450 and cytochrome P450 reductase polypeptides provided herein. Also provided herein are methods for assessing the activity of the cytochrome P450 and cytochrome P450 reductase polypeptides provided herein.

[0441] 1. Synthesis of Santalols and Bergamotols

[0442] The cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides provided herein can be used to catalyze the formation of santalols and bergamotols from the terpene substrates santalenes and bergamotenes. In some examples, the cytochrome P450 santalene oxidases are expressed in cells that produce or overexpress a santalene synthase and FPP, such that santalols are produced as described elsewhere herein. In other examples, the cytochrome P450 bergamotene oxidases are expressed in cells that produce of overexpress a santalene synthase, such that bergamotols are produced as described elsewhere herein. In other examples, the cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides provided herein are expressed and purified form any suitable host cells, such as any described in Section E. The purified cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides are then combined in vitro with santalenes and bergamotenes to produce santalols and bergamotols.

[0443] a. Oxidation of Santalenes and Bergamotenes

[0444] In some examples, the cytochrome P450 santalene oxidase polypeptides provided herein are overexpressed and purified as described in Section E above. The cytochrome P450 santalene oxidase is then incubated with one or more terpene substrates, including .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and/or .alpha.-trans-bergamotene, and one or more of .alpha.-santalol, .beta.-santalol and epi-.beta.-santalol, and .alpha.-trans-bergamotol, such as (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol, are produced. Alternatively, the cytochrome P450 santalene oxidase polypeptides provided herein expressed in host cells that also produce terpene substrates, including .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and/or .alpha.-trans-bergamotene, resulting in the production of one or more of .alpha.-santalol, .beta.-santalol and epi-.beta.-santalol, and .alpha.-trans-bergamotol, such as (E)-.alpha.-santalol, (Z)-.alpha.-santalol, (E)-.beta.-santalol, (Z)-.beta.-santalol, (E)-epi-.beta.-santalol, (Z)-epi-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (E)-.alpha.-trans-bergamotol. Production of santalols and bergamotols and quantification of the amount of product are then determined using any method provided herein, such as gas chromatography-mass spectroscopy (e.g. GC-MS), gas chromatography-flame ionization detection (GC-FID) and liquid chromatography-mass spectroscopy (LC-MS). Mass spectrometry patterns can be compared to the MS fragmentation patterns with entries in the NIST and Wiley libraries, such as described in Example 6, or by comparison with known terpenoids in sandalwood oil.

[0445] In other examples, the cytochrome P450 bergamotene oxidase polypeptides provided herein are overexpressed and purified as described in Section E above. The cytochrome P450 bergamotene oxidase is then incubated with one or more terpene substrates, including .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and/or .alpha.-trans-bergamotene, and one or more of (E)-.alpha.-trans-bergamotol or (Z)-.alpha.-trans-bergamotol is produced. In some examples, small amounts of .alpha.-santalol, .beta.-santalol and/or epi-.beta.-santalol are also produced. Alternatively, the cytochrome P450 bergamotene oxidase polypeptides provided herein expressed in host cells that also produce terpene substrates, including .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and/or .alpha.-trans-bergamotene, resulting in the production of (E)-.alpha.-trans-bergamotol or (Z)-.alpha.-trans-bergamotol. In some examples, small amounts of .alpha.-santalol, .beta.-santalol and/or epi-.beta.-santalol are also produced. Production of bergamotols and quantification of the amount of product are then determined using any method provided herein, such as gas chromatography-mass spectroscopy (e.g. GC-MS), gas chromatography-flame ionization detection (GC-FID) and liquid chromatography-mass spectroscopy (LC-MS). Mass spectrometry patterns can be compared to the MS fragmentation patterns with entries in the NIST and Wiley libraries, such as described in Example 6, or by comparison with known terpenoids in sandalwood oil.

[0446] b. Conversion of Acyclic Pyrophosphate Terpene Precursors

[0447] In some examples, terpenoids can be generated biosynthetically from acyclic pyrophosphate terpene precursors, such as geranyl pyrophosphate, farnesyl pyrophosphate and geranylgeranyl pyrophosphate, by expression of a cytochrome P450 monooxygenase in a host cell that produces the acyclic pyrophosphate terpene precursor and a terpene synthase. Suitable host cells are described in Section E above. In one example, santalols and bergamotols are generated biosynthetically by expression of a cytochrome P450 santalene oxidase in a host cell that produces FPP and santalene synthase (see Example 10). In another example, bergamotols are generated biosynthetically by expression of a cytochrome P450 bergamotene oxidase in a host cell that produces FPP and santalene synthase (see Example 10). Production of santalols and bergamotols and quantification of the amount of products are then determined using any method provided herein, such as gas chromatography-mass spectroscopy (e.g. GC-MS), gas chromatography-flame ionization detection (GC-FID) and liquid chromatography-mass spectroscopy (LC-MS). Mass spectrometry patterns can be compared to the MS fragmentation patterns with entries in the NIST and Wiley libraries, such as described in Example 6, or by comparison with known terpenoids in sandalwood oil.

[0448] In another example, terpenoids can be generated from acyclic pyrophosphate terpene precursors by 1) incubating an acyclic pyrophosphate terpene precursor with a terpene synthase and 2) incubating the reaction products with a cytochrome P450 monooxygenase. In some examples, the reaction products of the acyclic pyrophosphate terpene precursor with the terpene synthase are isolated. In other examples, the cytochrome P450 monooxygenase is added directly to the first reaction mixture without previous purification. The two steps can be performed simultaneously or sequentially. Terpenoids produced by the reaction can be identified and quantified using any method provided herein, such as gas chromatography-mass spectroscopy (e.g. GC-MS), gas chromatography-flame ionization detection (GC-FID) and liquid chromatography-mass spectroscopy (LC-MS). Mass spectrometry patterns can be compared to the MS fragmentation patterns with entries in the NIST and Wiley libraries, such as described in Example 6, or by comparison with known terpenoids in sandalwood oil.

[0449] 2. Methods for Production

[0450] a. Exemplary Cells

[0451] Santalols and bergamotols can be produced by expressing a cytochrome P450 synthase polypeptide and/or a cytochrome P450 reductase polypeptide provided herein in a cell line that produces FPP as part of the mevalonate-dependent isoprenoid biosynthetic pathway (e.g. fungi, including yeast cells, and animal cells) or the mevalonate-independent isoprenoid biosynthetic pathway (e.g. bacteria and higher plants). In particular examples, santalols are produced by expressing a cytochrome P450 santalene oxidase polypeptide provided herein and a santalene synthase polypeptide in a cell line that has been modified to overproduce FPP. In other examples, bergamotols are produced by expressing a cytochrome P450 bergamotene oxidase polypeptide provided herein and a santalene synthase polypeptide in a cell line that has been modified to overproduce FPP. Exemplary of such cells are modified yeast cells. For example, yeast cells that have been modified to produce less squalene synthase or less active squalene synthase (e.g. erg9 mutants; see e.g. U.S. Pat. Nos. 6,531,303 and 6,689,593) are useful in the methods provided herein to produce labdenediol diphosphate. Reduced squalene synthase activity results in accumulation of FPP in the host cell at higher levels compared to wild type yeast cells, thus allowing for increased yields of santalenes and bergamotenes. Exemplary modified yeast cells include, but are not limited to, modified Saccharomyces cerevisiae strains YPH499 (MATa, ura3-52, lys2-801, ade2-101, trp1-.DELTA.63, his3-.DELTA.200, leu2-.DELTA.1), WAT11 (MATa, ade2-1, his3-11,-15; leu2-3,-112, ura3-1, canR, cyr+; containing chromosomally integrated Arabidopsis NADPH-dependent P450 reductase ATR1; see Pompon et al. (1995) Toxicol Lett 82-83:815-822; Ro et al. (2005) Proc Natl Acad Sci USA 102:8060-8065); and BY4741 (MATa, his3.DELTA.1, leu2.DELTA.0, met15.DELTA.0, ura3.DELTA.0; ATCC #201388).

[0452] b. Culture of Cells

[0453] In exemplary methods, a cytochrome P450 provided herein is expressed in a host cell line that has been modified to overexpress farnesyl diphosphate and a santalene synthase, whereby upon expression of the cytochrome P450, farnesyl diphosphate is converted to santalols and bergamotols. In other exemplary methods, a cytochrome P450 provided herein and a santalene synthase are expressed in a host cell line that has been modified to overexpress farnesyl diphosphate whereby upon expression of both proteins, farnesyl diphosphate is converted to santalols or bergamotols. The cytochrome P450 and santalene synthase can be expressed separately, or together, as a fusion protein described elsewhere herein. cytochrome P450 and santalene synthase can be expressed simultaneously or sequentially. The host cell is cultured using any suitable method well known in the art. In some examples, such as for high throughput screening of cell expressing various cytochrome P450s, the cells expressing the cytochrome P450 are cultured in individual wells of a 96-well plate. In other examples where the host cell is yeast, the cell expressing the cytochrome P450 polypeptides, santalene synthase and FPP is cultured using fermentation methods such as those described below.

[0454] A variety of fermentation methodologies can be used for the production of santalols and bergamotols from yeast cells expressing the cytochrome P450 polypeptides provided herein. For example, large scale production can be effected by either batch or continuous fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired microorganism or microorganisms and fermentation is permitted to occur without further addition of nutrients. Typically, the concentration of the carbon source in a batch fermentation is limited, and factors such as pH and oxygen concentration are controlled. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped. Within batch cultures cells typically modulate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die.

[0455] A variation on the standard batch system is the Fed-Batch system, which is similar to a typical batch system with the exception that nutrients are added as the fermentation progresses. Fed-Batch systems are useful when catabolite repression tends to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Also, the ability to feed nutrients will often result in higher cell densities in Fed-Batch fermentation processes compared to Batch fermentation processes. Factors such as pH, dissolved oxygen, nutrient concentrations, and the partial pressure of waste gases such as CO are generally measured and controlled in Fed-Batch fermentations.

[0456] Production of the santalols or bergamotols also can be accomplished with continuous fermentation. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. This system generally maintains the cultures at a constant high density where cells are primarily in their log phase of growth. Continuous fermentation allows for modulation of any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by the medium turbidity, is kept constant. Continuous systems aim to maintain steady state growth conditions and thus the cell loss due to the medium removal must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art.

[0457] Following cell culture, the cell culture medium then can be harvested to obtain the produced santalols and bergamotols.

[0458] c. Isolation and Assays for Detection and Identification

[0459] The santalols and bergamotols produced using the methods above with the cytochrome P450 polypeptides provided herein can be isolated and assessed by any method known in the art. In one example, the cell culture medium is extracted with an organic solvent to partition any terpenes or terpenoids produced into the organic layer. Production of santalols and/or bergamotols can be assessed and/or the santalols and/or bergamotols isolated from other products using any method known in the art, such as, for example, gas chromatography or column chromatography. For example, the organic layer can be analyzed by GC-MS.

[0460] The quantity of santalols and/or bergamotols produced can be determined by any known standard chromatographic technique useful for separating and analyzing organic compounds. For example, santalol and/or bergamotol production can be assayed by any known chromatographic technique useful for the detection and quantification of hydrocarbons, such as santalol and/or bergamotol and other terpenoids, including, but not limited to, gas chromatography mass spectrometry (GC-MS), gas chromatography using a flame ionization detector (GC-FID), capillary GC-MS, high performance liquid chromatography (HPLC) and column chromatography. Typically, these techniques are carried out in the presence of known internal standards which are used to quantify the amount of the terpenoid produced. For example, terpenoids, including sesquiterpenoids, such as santalol and/or bergamotol, can be identified by comparison of retention times and mass spectra to those of authentic standards in gas chromatography with mass spectrometry detection. Typical standards include, but are not limited to, santalols and/or bergamotols. In other examples, quantification can be achieved by gas chromatography with flame ionization detection based upon calibration curves with known amounts of authentic standards and normalization to the peak area of an internal standard. These chromatographic techniques allow for the identification of any terpene present in the organic layer, including, for example, other terpenoids produced by the cytochrome P450s.

[0461] In some examples, kinetics of santalol and/or bergamotol production can be determined by synthase assays in which radioactive isoprenoid substrates, such as .sup.3H FPP or .sup.14C FPP, are used with varying concentrations of synthase. The products are extracted into an organic layer and radioactivity is measured using a liquid scintillation counter. Kinetic constants are determined from direct fits of the Michaelis-Menton equation to the data.

[0462] 3. Production of Sandalwood Oil

[0463] The cytochrome P450 santalene oxidase and cytochrome P450 bergamotene oxidase polypeptides provided herein can be used to produce sandalwood oil. For example, the cytochrome P450 santalene oxidases can be expressed in cells that produce or overexpress a santalene synthase, such that santalols and bergamotol, including .alpha.-santalol, .beta.-santalol and epi-.beta.-santalol, and Z-.alpha.-trans-bergamotol, are produced as described elsewhere herein. The terpenoid products can be compared to those found in authentic sandalwood oil from S. album by GC-MS analysis, for example, as described in Example 8.

[0464] 4. Assays for Detecting Enzymatic Activity of Cytochrome P450 and Cytochrome P450 Reductase Polypeptides

[0465] a. Methods for Determining the Activity of Cytochrome P450 Polypeptides

[0466] One of skill in the art is familiar with methods and assays to detect the enzymatic activity of cytochrome P450 polypeptides. Cytochrome P450 polypeptides can be expressed in yeast or purified from microsomal membrane fractions. Cytochrome P450 monooxygenase activity can be determined in vitro by incubation of a cytochrome P450 polypeptide with various monoterpene, sesquiterpene and diterpene substrates, as described in Example 11. Reaction products, including ratios of the products, can be determined by any method known to one of skill in the art, including GC-MS, GC-FID, LC-MS, comparison to known standards, and proton and carbon nuclear magnetic resonance (NMR). Alternatively, activity can be determined in vivo by addition of terpene substrates to yeast cultures of the cytochrome P450s and identifying products as described above. Total P450 content in microsomes can be quantified by CO differential absorption spectroscopy (see Guengerich et al. (2009) Nat Protoc 4:1245-1251 and Example 8).

[0467] Enzyme kinetics can be determined in vitro in the presence of NADPH and CPR. In such assays, CPR is included in limited amounts, e.g., 0.1 U, for determination of enzyme activity and 5 milliunits for determination relative activities and kinetic parameters. Assays can be performed over a range of substrate concentrations and product formation can be determined by GC-MS. Add terpene directly to yeast cultures

[0468] b. Methods for Determining the Activity of Cytochrome P450 Reductase Polypeptides

[0469] One of skill in the art is familiar with methods and assays to detect the enzymatic activity of cytochrome P450 reductase polypeptides. In one example, CPR activity can be determined using an assay that detects for C4H (cinnamate 4-hydroxylase) activity, for example, as described in Ro et al. (2001) Plant Physiology 126:317-329. C4H is a heme-thiolate protein that catalyzes the formation of p-coumarate from cinnamic acid. This assay can be used in vivo by expression of the cytochrome P450 reductase in yeast cells in the presence of C4H (see also, Ro et al. (2002) Plant Physiology 130:1837-1851). C4H activity is determined by detection of p-coumaric acid formation by HPLC (Mizutani et al. (1993) Plant Cell Physiology 34:481-488).

[0470] In order to assess CPR activity in vitro, CPRs can be purified from yeast microsomal fractions, such as described in Pompon et al. ((1996) Methods Enzymol 272:51-64) and Example 8 below. Total P450 content in microsomes can be quantified by CO differential absorption spectroscopy (Omura and Sato (1964) J Biol Chem 239:2370-2378; Mizutani and Ohta (1998) Plant Physiology 116:357-367). FAD and FMN content can be determined as described in Faeder and Siegel (1973) Anal Biochem 53:332-336. CPR activity in vitro can be assessed by a variety of assays known to one of skill in the art. For example, activity can be determined using the C4H assay described above. In another example, activity is determined by measuring reduction of an artificial electron receptor, such as cytochrome c or oxidized ferricyanide (Xia et al. (2011) J Biol Chem 286:16246-16260; Hamdane et al. (2009) J Biol Chem 284:11374-11384; Shen et al. (1989) J Biol Chem 264:7584-7589). Formation of reduced cytochrome c is measured using a spectrophotometer and calculating the rate of reduction from A.sub.550 change using an extinction coefficient (.SIGMA.=21 mM.sup.-1 cm.sup.-1) (Imai (1976) J Biochem 80:267-276). Another assay that be used to detect CPR is the ethoxycoumarin O-de-ethylase activity reporter assay in P450 2B4 reconstituted systems (Louerat-Orieu et al (1998) Eur J Biochem 258:1040-1049).

[0471] The subcellular membrane localization site, e.g., whether the CPR is located in the ER or the chloroplast, of a cytochrome P450 reductase polypeptide can be determined by expressing CPR with GFP-fused to its C-terminus in Arabidopsis under the control of cauliflower mosaic virus 35S promoter (see, Ro et al. (2002) Plant Physiology 130:1837-1851). Independently transformed T1 and T2 seedlings are then screened for the presence of GFP by fluorescence microscopy and confocal microscopy (see Ro et al. (2002) Plant Physiology 130:1837-1851) or by immunoblot analysis of microsomal proteins of seedlings. The functionality of the CPR in the GFP-CPR fusions can be verified using the C4H assay.

G. EXAMPLES

[0472] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.

Example 1

Cloning and Sequencing of Santalum Album cDNA

[0473] In this example, RNA was extracted from wood samples of Sandalwood (Santalum album) trees and cDNA was generated and sequenced.

A. Isolation and Extraction of S. album RNA

[0474] Several 25 mm holes were drilled into the lower stems of mature Santalum album trees growing on land managed by the Forest Products Commission of Western Australia. Wood samples from the heartwood-sapwood transition zone were collected and frozen immediately in liquid nitrogen. RNA was extracted from 10 g tissue using a protocol modified from Kolosova et al., (2004) BioTechniques 36:821-824. After precipitation with LiCl, RNA was stored at -80.degree. C. until cDNA synthesis.

B. Generation of S. Album cDNA Library

[0475] S. album xylem total RNA (1.4 .mu.g) was reverse transcribed with SuperScript III reverse transcriptase (Invitrogen) at 42.degree. C. for 1 hour using the SMART-Creator kit with the pDNR-LIB vector (Clontech; SEQ ID NO:20). The ligation mixture was transformed by electroporation into 25 .mu.L of phage resistant electrocompetent E. coli cells and Sanger sequenced at the Genome Sciences Centre, Vancouver, Canada.

C. 454 Pyr Sequencing and Sanger Sequencing

[0476] Two cDNA libraries from Santalum album cores were prepared and sequenced with Sanger technologies generating 11,520 paired end sequences. One plate of 454 Titanium sequencing was done on both libraries and generated 902,111 reads. Assembly was effected using the 454 and Sanger sequences with Newbler assembler v2.6 (454 Life Sciences, Roche Diagnostics) with default parameters. This generated 31,461 contigs (isotigs).

Example 2

Identification of Nucleic Acid Encoding S. Album Cytochrome P450 Polypeptides

[0477] Cytochrome P450 encoding genes were identified by comparing the assembled sequences (from Example 1) against a set of known plant P450 encoding genes from the CYP76 families of P450 proteins using a BLASTx search (blast.ncbi.nlm.nih.gov; Altschul et al. (1990) J Mol Biol 215:403-410).

[0478] Table 4 below provides a summary of 7 isotigs identified in the BLASTx search (blast.ncbi.nlm nih.gov; Altschul et al. (1990) J Mol Biol 215:403-410), including the isotig, lowest E-value, the gene ID of the match in the P450 database, the CYP450 family and the number of reads. The E-value (Expect Value) describes the number of matches expected to occur randomly with a given score. In general, the smaller E-value, the more likely the match is significant.

TABLE-US-00004 TABLE 4 Summary of CYP450 transcripts Identity to Gene Lowest E- ID of the value match in the with match P450 database in P450 CrCYP76B6 CYP450 Number of # Query data base (CAC80883) Family reads 1 isotig05182 8.34E-142 71% SaCYP76 910 2 isotig05183 2.68E-145 71% SaCYP76 763 3 isotig05184 1.61E-78 52% SaCYP76 470 4 isotig06871 1.23E-126 83% SaCYP76 110 5 isotig06872 9.19E-156 83% SaCYP76 118 6 isotig14788 1.53E-93 86% SaCYP76 11 7 isotig29133 1.49E-52 60% SaCYP76 1

[0479] Transcripts from this family were the most abundant in the EST database and cluster into four different groups. Group 1 is represented by 3 isotigs (numbers 1-3 in Table 4) with a total of 2,143 reads including 1,107 unique sequences generating a final assembled sequence of 1917 base pairs (bp) with an open reading frame (ORF) of 1530 bp. Group 2 is represented by 2 isotigs (numbers 4-5 in Table 4), had 228 reads with 140 unique reads generating an assembled sequence of 1776 bp and an ORF of 1530 bp. Group 3 (number 6 in Table 7) was represented by 11 reads generating a partial sequence of 1200 bp. Group 4 (number 7 in Table 7) is a singleton of 277 bp with several stop codons along the sequence.

Example 3

Isolation of Cytochrome P450 Encoding cDNA

[0480] Group 1 and Group 2 cDNA molecules (numbers 1-5 in the table above) of the CYP76 family identified in Example 2, were selected for cDNA isolation.

A. Cloning of Members of the CYP76 Family

[0481] Full-length cDNA molecules were amplified by polymerase chain reaction (PCR) with Phusion Hot Start II DNA Polymerase (Thermo Scientific) of S. album cDNA (set forth in SEQ ID NO:1) prepared as described in Example 1 using gene specific primers designed according to the ORF of Group 1 and Group 2 (set forth in Table 5 below). PCR conditions were as follows:

[0482] 98.degree. C. for 3 min;

[0483] 2 cycles of: 98.degree. C. for 10 sec, Tm -2.degree. C. for 20 sec, 72.degree. C. for 30 sec;

[0484] 30 cycles of: 98.degree. C. for 10 sec, Tm for 20 sec, 72.degree. C. for 30 sec;

[0485] Final extension at 72.degree. C. for 7 min

with a Tm of 55.degree. C. for Isogroup 1 and a Tm of 52.degree. C. for Isogroup 2. The PCR products were gel purified and cloned into the pJET1.2 vector (Fermentas, SEQ ID NO:21) according to the manufacturer's instructions. E. coli .alpha.-Select chemically competent cells (Bioline) were used for cloning and plasmid propagation. All constructs were verified by DNA sequencing.

TABLE-US-00005 TABLE 5 Primers for amplification of cytochrome P450 cDNA SEQ ID Primer Sequence NO Isogroup 1 ATGGACTTCTTAAGTTTTATCCTGTTTG 22 Forward Isogroup 1 TTACCCCCGGATCGGGACAG 23 Reverse Isogroup 2 ATGGACTTCTTAAGTTGTATCCTG 24 Forward Isogroup 2 TTACCCCCGGATTGGGACAG 25 Reverse

[0486] Amplification with primers for Isogroup 1 resulted in a single unique cDNA clone designated SaCYP76F38v1 (SaCYP76-G5). Amplification with primers from Isogroup 2 resulted in 3 different cDNA clones designated: SaCYP76F39v1 (SaCYP76-G10), SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12). A second amplification with primers from Isogroup 2 resulted in 6 additional different cDNA clones, designated SaCYP76F37v2 (SaCYP76-G14), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17), SaCYP76F42 (SaCYP76-G13) and SaCYP76F43 (SaCYP76-G18). The SEQ ID NOS of the sequences of the nucleic acids and the encoded amino acids are set forth in Table 6 below. The translated amino acid sequences encoded by the 10 isolated cDNA molecules share between 93% and 99% identity (see Table 7 below) and between 1.0 and 6.6% divergence. Pair distances were prepared with ClustalW (slow/accurate, Gonnet weight matrix) (ebi.ac.uk/clustalw; European Bioinformatics Institute).

TABLE-US-00006 TABLE 6 Cytochrome P450 Polypeptides Nucleic acid Amino acid Cytochrome P450 SEQ ID NO SEQ ID NO SaCYP76F38v1 (SaCYP76-G5) 2 6 SaCYP76F39v1 (SaCYP76-G10) 3 7 SaCYP76F37v1 (SaCYP76-G11) 4 8 SaCYP76F38v2 (SaCYP76-G12) 5 9 SaCYP76F37v2 (SaCYP76-G14) 67 73 SaCYP76F39v2 (SaCYP76-G15) 68 74 SaCYP76F40 (SaCYP76-G16) 69 75 SaCYP76F41 (SaCYP76-G17) 70 76 SaCYP76F42 (SaCYP76-G13) 71 77 SaCYP76F43 (SaCYP76-G18) 72 78

TABLE-US-00007 TABLE 7 Percent amino acid identity for cytochrome P450s from the CYP76 family SaCYP76 F38v1 F39v1 F37v1 F38v2 F37v2 F39v2 F40 F41 F42 F43 SaCYP76F38v1 100 94 97 99 98 93 94 96 95 96 SaCYP76F39v1 100 95 94 95 99 98 96 95 95 SaCYP76F37v1 100 98 99 95 94 95 94 95 SaCYP76F38v2 100 99 94 94 96 95 95 SaCYP76F37v2 100 95 93 95 94 95 SaCYP76F39v2 100 98 95 94 95 SaCYP76F40 100 97 96 95 SaCYP76F41 100 97 94 SaCYP76F42 100 96 SaCYP76F43 100

Example 4

Sequence and Phylogenetic Analysis of SaCYP76 Proteins

[0487] A BLASTx search of the deduced amino acid sequences against the GenBank non-redundant protein database (blast.ncbi.nlm.nih.gov; Altschul et al. (1990) J Mol Biol 215:403-410) identified a putative cytochrome P450 from Vitis vinifera (GenBank Accession No. XP_002281735; SEQ ID NO:26) that has 62% to 64% sequence identity to the S. album CYPs and a CYP76B6 geraniol hydroxylase from Catharanthus roseus (GenBank Accession No. CAC80883; Collu et al. (2001) FEBS Lett 308:215-220; SEQ ID NO:27) that has 54% to 55% sequence identity to the S. album CYPs. Protein alignment of the full length protein sequences was made with ClustalW (ebi.ac.uk/clustalw; European Bioinformatics Institute).

[0488] Phylogenetic trees were constructed with MEGA version 4 (Centre for Evolutionary Medicine and Informatics; Tamura et al., 2007 Mol Biol Evol 24:1596-1599) employing the neighbor joining (NJ) method with default parameters. Bootstrap (500 replications) confidence values over 50% are displayed at branch points. The neighbor-joining phylogeny of the predicted protein sequences of the initial four S. album CYP clones SaCYP76F38v1 (SaCYP76-G5), SaCYP76F39v1 (SaCYP76-G10), SaCYP76F37v1 (SaCYP76-G11) SaCYP76F38v2 (SaCYP76-G12) and cytochrome P450 enzymes for terpenoid metabolism in other species is set forth in FIG. 4. The SaCYP76 genes, which form a separate cluster in this phylogeny, are most closely related to the CYP76B cluster that includes geraniol/nerol hydroxylases from different species. Accession numbers of the amino acid sequences included in the phylogeny in FIG. 4, in addition to the S. album CYP76 P450 clones SaCYP76F38v1 (SaCYP76-G5), SaCYP76F39v1 (SaCYP76-G10), SaCYP76F37v1 (SaCYP76-G11) SaCYP76F38v2 (SaCYP76-G12) provided herein, included: Helianthus tuberosus CYP76B1 (CAA71178; SEQ ID NO:28); Catharanthus roseus CYP76B6 (CAC80883; SEQ ID NO:27); Swertia mussotii CYP76B6 (ACZ48680; SEQ ID NO:29); Persea americana CYP71A1 (P24465; SEQ ID NO:30); Mentha.times.piperita CYP71A32 (Q947B7; SEQ ID NO:31); Artemisia annua CYP71AV1 (ABB82944; SEQ ID NO:32); Cichorium intybus CYP71AV8 (ADM86719; SEQ ID NO:33); Lactuca sativa CYP71BL1 (AEI59780; SEQ ID NO:34); Nicotiana tabacum CYP71D20 (Q94FM7; SEQ ID NO:35); Mentha.times.piperita CYP71D13 (Q9XHE7; SEQ ID NO:36); Mentha spicata CYP71D18 (Q6WKZ1; SEQ ID NO:37); Catharanthus roseus CYP72A1 (Q05047; SEQ ID NO:38); and Oryza sativa CYP76M7 (AK105913; SEQ ID NO:39).

[0489] A second neighbor joining phylogenetic tree was constructed with all 10 S. album CYP76F proteins and related terpene-modifying cytochrome P450s members of the CYP71 clan, using Picea sitchensis PsCYP720B4 (ADR78276; SEQ ID NO:79) as an outgroup. The phylogenetic tree is set forth in FIG. 10. The S. album CYP76F proteins fell into two separate clades and were closest to the CYP76B cluster of other species. Clade I santalene/bergamotene oxidases included SaCYP76F39v1 (SaCYP76-G10), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13). Clade II bergamotene oxidases included SaCYP76F37v1 (SaCYP76-G11), SaCYP76F37v2 (SaCYP76-G14), SaCYP76F38v1 (SaCYP76-G5) and SaCYP76F38v2 (SaCYP76-G12). Accession numbers of the amino acid sequences for other terpene-modifying CYPs included in the phylogenetic tree in FIG. 10, in addition to the S. album CYP76 P450 clones, include CaCYP76B4 Camptotheca acuminate putative geraniol-10-hydroxylase (AES93118; SEQ ID NO:80); CrCYP76B6 Catharanthus roseus geraniol 10-hydroxylase (Q8VWZ7; SEQ ID NO:81); SmCYP76B4 Swertia mussotii geraniol 10-hydroxylase (D1MI46; SEQ ID NO:82); OsCYP76M7 Oryza sativa ent-cassadiene C11a-hydroxylase (NP_001047185; SEQ ID NO:83); MpCYP71A32 Mentha.times.piperita menthofuran synthase (Q947B7; SEQ ID NO:84); PaCYP71A1 Persea americana (P24465; SEQ ID NO:85); CiCYP71AV8 Cichoriium intybus valencene oxidase (ADM86719; SEQ ID NO:86); MpCYP71D13 Mentha.times.gracilis (-)-limonene-3-hydroxylase (AY281027; SEQ ID NO:87); NtCYP71D20 Nicotiana tabacum 5-epi-aristocholene-1,3-dihydroxylase (AF368376; SEQ ID NO:88); and GaCYP706B1 Gossypium arboretum (+)-delta-cadinene-8-hydroxylase (AAK60517; SEQ ID NO:89).

Example 5

Cytochrome P450 Reductase

[0490] Cytochrome P450 reductase encoding genes were identified by comparing the assembled sequences with a set of known plant cytochrome P450 reductases from Arabidopsis (CAB58575.1 (SEQ ID NO:58) and CAB58576.1 (SEQ ID NO:46)). Full length cDNA genes SaCPR1 and SaCPR2 were amplified by polymerase chain reaction (PCR) with Phusion Hot Start II DNA Polymerase (Thermo Scientific) of S. album cDNA prepared as described in Example 1 with gene specific primers designed according to the ORF of the cytochrome P450 reductase (set forth in Table 8).

TABLE-US-00008 TABLE 8 Primers for PCR of cytochrome P450 reductase genes SEQ ID Primer Sequence Tm NO SaCPR1 ATG AGT TCG AGC TCG GAG CTA TG 57 40 Forward SaCPR1 TCA CCA CAC ATC CCG TAA ATA CCT 57 41 Reverse TC SaCPR2 ATG CAA TTG AGC TCC GTC AAG 58 61 Forward SaCPR2 TCA CCA CAC ATC CCG TAA ATA CCT 58 62 Reverse TCC

PCR conditions were as follows:

[0491] 98.degree. C. for 3 min;

[0492] 2 cycles of: 98.degree. C. for 10 sec, Tm -2.degree. C. for 20 sec, 72.degree. C. for 30 sec;

[0493] 30 cycles of: 98.degree. C. for 10 sec, Tm for 20 sec, 72.degree. C. for 30 sec;

[0494] Final extension at 72.degree. C. for 7 min

The PCR products were gel purified and cloned directly into the pET28b(+) vector (SEQ ID NO:51) or first cloned into pJET vector and then subcloned into expression vectors. E. coli .alpha.-Select chemically competent cells (Bioline) were used for cloning and plasmid propagation. All constructs were verified by DNA sequencing. PCR amplification resulted in two S. album cytochrome P450 reductase (CPR) clones designated CPR1 and CPR2, having nucleic acid sequences set forth in SEQ ID NOS:10 and 11, respectively, encoding the proteins set forth in SEQ ID NO:12 and 13. The two CPR nucleic acid sequences share 70% sequence identity and the two CPR proteins share 82% sequence identity.

[0495] The web-based BlastX program (Altschul et al., (1990) J. Mol. Biol. 215:403-410) was then used to compare the sequence of the identified with sequences in the GenBank database. The CPR sequences share 79% sequence homology with the Vitis vinifera predicted cytochrome P450 reductase-like protein (Genbank Accession No. XP_002270732; SEQ ID NO:42), 78% sequence homology with the Gossypium hirsutum cytochrome P450 reductase (Genbank Accession No. ACN54324; SEQ ID NO:43) and 75% sequence homology with the Artemisia annua cytochrome P450 reductase (Genbank Accession No. ABI98819; SEQ ID NO:44).

[0496] Truncated CPRs were generated containing amino acids 44-692 of SEQ ID NO:12 (truncated protein sequence set forth in SEQ ID NO:14; nucleic acid sequence set forth in SEQ ID NO:63) and amino acids 61-704 of SEQ ID NO:13 (truncated protein sequence set forth in SEQ ID NO:15; nucleic acid sequence set forth in SEQ ID NO:64).

[0497] Activity of recombinant SaCPR was assayed using the Cytochrome C Reductase (NADPH) assay kit (Sigma).

Example 6

Gas Chromatography-Mass Spectrometry Analysis

[0498] Gas chromatography-mass spectrometry (GC-MS) analysis was used to analyze the oxidation products of the S. album cytochrome P450s and S. album oil.

A. SGE Solgel-Wax Capillary Column

[0499] GC-MS analysis was performed on a Agilent 6890A/5973N GC-MS system containing a SGE Solgel-Wax capillary column (30 m.times.0.25 mm ID.times.0.25.mu.m thickness) in SIM-scan mode (scan: m/z 40-400; SIM: m/z 93, 94, 119, 136, 122, 202 and 204 [dwell time 50]. Volumes of 2 .mu.L samples were injected in pulsed splitless mode at 250.degree. C. with a column flow of 1 mL/min helium and 50 psi pulse pressure for 0.5 min with the following program: 40.degree. C. for 2 min, ramp of 8.degree. C. per min to 100.degree. C., 15.degree. C. per min to 250.degree. C., hold 5 min.

[0500] Alternatively, the following program was also used to analyze the products of S. album SaCYP76F39v1 (SaCYP76-G10) and S. album oil: volumes of 2 .mu.L samples were injected in pulsed splitless mode at 250.degree. C. with a column flow of 0.8 mL/min helium and 10 psi pulse pressure for 0.05 min with the following program: 40.degree. C. for 3 min, 10.degree. C. per min to 100.degree. C., 2.degree. C. per min to 250.degree. C., hold 10 min.

[0501] Product identification was based on best match of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil and Kovats index values.

B. HP5 and DB-Wax Fused Silica Column

[0502] GC-MS analysis was performed on a Agilent 7890A/5975C GC-MS system operating in electron ionization selected ion monitoring (SIM)-scan mode. Samples were analyzed on an HP5 (non-polar; 30 m.times.0.25 mm ID.times.0.25 .mu.m thickness) and a DB-Wax fused silica column (polar; 30 m.times.0.25 mm ID.times.0.25 .mu.m thickness). In both cases, the injector was operated in pulsed splitless mode at with the injector temperature maintained at 250.degree. C. Helium gas was used as the carrier gas with a flow rate of 0.8 mL/min and pulsed pressure set at 25 psi for 0.5 min. Scan range: m/z 40-500; SIM: m/z 93, 94, 105, 107, 119, 122 and 202 [dwell time 50 msec].

The oven program for the HP5 column was:

[0503] 40.degree. C. for 3 min, ramp of 10.degree. C. per min to 130.degree. C., 2.degree. C. per min to 180.degree. C., 50.degree. C. per min to 300.degree. C., hold 300.degree. C. for 10 min.

The oven program for the DB-wax column was:

[0504] 40.degree. C. for 3 min, ramp of 10.degree. C. per min to 130.degree. C., 2.degree. C. per min to 200.degree. C., 50.degree. C. per min to 250.degree. C., hold 250.degree. C. for 15 min.

[0505] Chemstation software was used for data acquisition and processing. Compounds were identified by comparison of mass spectral with authentic samples and the NIST/EPA/NIH mass spectral library v2.0 and by comparison of retention indices with those appearing in Valder et al. (2003) J Essent Oil Res 15:178-186 and Sciarrone et al. (2011) J Chromatogr A 1218:5374.

Example 7

Expression in Bacteria and Yeast

[0506] The S. album FPP synthase, santalene synthase, cytochrome P450 SaCYP76F38v1 (SaCYP76-G5) and cytochrome P450 reductase genes were cloned into a pCDF-Duet (Novagen) and pACYC-Duet (Novagen) bacterial expression vectors. Genes encoding the full length S. album cytochrome CYP76F P450s, cytochrome P450 reductase, santalene synthase and farnesyl diphosphate synthase were cloned into various yeast expression vectors to allow expression in the Saccharomyces cerevisiae yeast strain BY4741 (MATa his3.DELTA.1 leu2.DELTA.0 met15.DELTA.0 ura3.DELTA.0; ATCC #201388).

A. Bacterial Expression Vectors

[0507] Genes encoding FPP synthase (SEQ ID NO:18) and santalene synthase (SEQ ID NO:16), previously characterized from S. album (see, International PCT application No. WO2011000026 and Jones et al. (2011) J Biol Chem 286:17445-17454), were cloned into the bacterial expression vector pCDF-Duet (Novagen, SEQ ID NO:65) generating pCDF-Duet:SaFPPS:SaSSy. Genes encoding SaCPR (SEQ ID NO:11) and SaCYP76F38v1 (SaCYP76-G5) gene (SEQ ID NO:2) were cloned into the bacterial expression vector pACYC-Duet (Novagen, SEQ ID NO:45) generating pACYC-Duet:SaCPR:SaCYP76F38v1. These expression vectors are dual expression vectors that allow co-expression of two target genes via two multiple cloning sites.

[0508] pCDF-Duet:SaFPPS:SaSSy, which has a streptomycin selectable marker, was transformed into chemically competent C41 (DE3) E. coli cells (Avidis). These cells were grown up and rendered chemically competent again using calcium chloride, and transformed with the pACYC-Duet:SaCPR:SaCYP76F38v1, which has a chloramphenicol selectable marker. Both antibiotics were used to select for colonies containing both duet vectors. These colonies were grown overnight in a rich media (terrific broth) at 16.degree. C. and protein expression was initiated through the addition of IPTG. Cytochrome P450 protein expression was supplemented with 5-amino-levulinic acid to aid in porphyrin synthesis, and evidenced by a reddening of the cell pellet.

B. Generation of Yeast Expression Vectors

[0509] 1. S. Album Cytochrome P450s

[0510] The S. album CYP76F full length cDNAs identified in Table 6 above were sub-cloned into the yeast expression vector pYeDP60 (Cullin and Pompon (1988) Gene 65:203-217; Pompon et al. (1996) Methods Enzymol 272:51-64; Abecassis et al. (2003) Methods Mol Biol 231:165-173) following the uracil-excision (USER) cloning technique of Hamann and Moller (2007) Protein Expr Purif 56:121-127. The pYeDP60 vector contains a URA marker. The resulting constructs are set forth in Table 9 below.

[0511] 2. S. Album Santalene Synthase and Farnesyl Diphosphate Synthase

[0512] Santalene synthase encoding cDNA (SaSSY, SEQ ID NO:16) and farnesyl diphosphate synthase encoding cDNA (SaFPPS, SEQ ID NO:18) were cloned into the NotI-Bgl II and BamHI-XhoI sites, respectively, of the galactose inducible expression vectors pESC-LEU (Stratagene, SEQ ID NO:47) or pESC-LEU2d (see, Ro et al. (2008) BMC Biotechnology 8:83) by in-Fusion Cloning (Clontech) following the manufacturer's instructions. Additional vectors were generated containing only the SaSSy gene (SEQ ID NO:16). The pESC-LEU and pESC-LEU2d vectors contain a LEU marker and the pESC-LEU2d vector is a high copy number vector containing a deletion in the Leu2 promoter. The resulting constructs are set forth in Table 9 below.

[0513] 3. Cytochrome P450 Reductase

[0514] Cytochrome P450 reductase encoding cDNA (SaCPR, SEQ ID NO:11), identified in Example 3, was cloned into the EcoRi-NotI sites of pESC-HIS vector (Stratagene, SEQ ID NO:49) by in-Fusion Cloning (Clontech) following the manufacturer's instructions. The resulting constructs are summarized in Table 9 below.

TABLE-US-00009 TABLE 9 Yeast expression vectors Construct ID Marker Description (MCS = multiple cloning site) pESC- -LEU MCS1 contains S. album Santalene LEU:SaG1:SaG2 Synthase (SaSSY) MCS2 contains S. album FPPS (SaFPPS) pESC- -LEU MCS1 contains S. album Santalene LEU2d:SaG1:SaG2 Synthase (SaSSY) MCS2 contains S. album FPPS (SaFPPS) pESC-LEU:SaSSY -LEU MCS1 contains S. album Santalene Synthase (SaSSY) pESC- -LEU MCS1 contains S. album Santalene LEU2d:SaSSY Synthase (SaSSY) pESC-His:SaCPR -HIS MCS1 contains S. album cytochrome P450 reductase (SaCPR) pYEDP60:F38v1 -URA pYEDP60 contains S. album SaCYP76F38v1 (SaCYP76-G5) pYEDP60:F39v1 -URA pYEDP60 contains S. album SaCYP76F39v1 (SaCYP76-G10) pYEDP60:F37v1 -URA pYEDP60 contains S. album SaCYP76F37v1 (SaCYP76-G11) pYEDP60:F38v2 -URA pYEDP60 contains S. album SaCYP76F38v2 (SaCYP76-G12) pYEDP60:F37v2 -URA pYEDP60 contains S. album SaCYP76F37v2 (SaCYP76-G14) pYEDP60:F39v2 -URA pYEDP60 contains S. album SaCYP76F39v2 (SaCYP76-G15) pYEDP60:F40 -URA pYEDP60 contains S. album SaCYP76F40 (SaCYP76-G16) pYEDP60:F41 -URA pYEDP60 contains S. album SaCYP76F41 (SaCYP76-G17) pYEDP60:F42 -URA pYEDP60 contains S. album SaCYP76F42 (SaCYP76-G13) pYEDP60:F43 -URA pYEDP60 contains S. album SaCYP76F43 (SaCYP76-G18)

C. Yeast Transformation and Expression

[0515] All constructs were transformed into the Saccharomyces cerevisiae yeast strain BY4741 (MATa his3.DELTA.1 leu2.DELTA.0 met15.DELTA.0 ura3.DELTA.0; ATCC #201388) using the LiCl method as described in Gietz et al. (1992) Nucleic Acids Res 20:1425. Transformed yeast were selected on plates with appropriate synthetic drop-out selection medium and grown at 30.degree. C. for 48 hours.

[0516] 1. Expression of Santalene Synthase

[0517] Production of santalenes and bergamotene was evaluated using constructs encoding the S. album santalene synthase. Yeast cells expressing the high copy number construct pESC-LEU2d:SaSSY produced about twice the amount of santalenes and bergamotene as determined by GC-MS (as described in Example 6A) compared to yeast cells expressing the pESC-LEU:SaSSY construct. No differences were observed between the cells expressing the santalene synthase in the presence or absence of farnesyl diphosphate synthase, indicating that FPP produced by yeast enzymes was accessible for S. album santalene synthase to produce santalenes and bergamotene. The high copy number construct pESC-LEU2d:SaSSY was used for further experiments.

[0518] 2. Expression of Santalene Synthase and Cytochrome P450 Reductase

[0519] The pESC-LEU2d:SaSSY construct encoding santalene synthase and the pESC-His:SaCPR construct encoding S. album cytochrome P450 reductase (SaCPR) were co-transformed into the yeast strain BY4741. SaCPR was included to supply electrons from NADPH to the CYP450.

Example 8

Microsome Preparation

[0520] In order to purify the S. album cytochrome P450 enzymes for use in in vitro assays, microsomes were prepared. Microsomes contain fragmented endoplasmic reticulum (ER) which contains cytochrome P450. Thus, purification of microsomes results in concentrated and isolated cytochrome P450. CO spectra of recombinant P450s encoded by the S. album CYP76F P450s was measured according to Guengerich et al. (2009) Nat Protoc 4:1245-1251.

[0521] Microsome membranes were prepared from 250 mL yeast cultures according to Pompom et al. (1996) Methods Enzymol 2(71):51-64. In brief, a 5 mL overnight culture was used to inoculate 50 mL of SD-selective media starting at an OD600 of 0.2 and grown at 30.degree. C., 170 rpm for 24 hours. A volume of 200 mL YPDE medium (1% yeast extract, 2% bacto-peptone, 5% ethanol, 2% dextrose) was inoculated with the 50 mL culture and incubated for another 24 hours at 30.degree. C., 170 rpm. Cells were collected by centrifugation for 10 min at 1,000.times.g and induced with 2% galactose in 250 mL YP medium at 30.degree. C., 170 rpm for 12-16 hours. For microsome isolation, yeast cells were pelleted by centrifugation at 2,000.times.g for 10 min, washed once with 5 mL TEK (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 100 mM KCl) and resuspended in TES2 buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 600 mM Sorbitol, 5 mM DTT and 0.25 mM PMSF). All subsequent steps were performed at 4.degree. C. Yeast cell walls were disrupted mechanically using acid-washed glass beads (425-600 .mu.m, Sigma) and vigorous manual shaking for 3.times.30 sec. The cell homogenate was centrifuged at 10,000.times.g for 15 min followed by ultracentrifugation of the supernatant at 100,000.times.g for 1 hour to collect membranes. Microsomes were resuspended and homogenized in a buffer containing 50 mM Tris-HCl buffer pH 7.5, 1 mM EDTA and 30% (v/v) glycerol, and used directly for enzyme assays or stored at -80.degree. C.

[0522] Microsome preparations for all ten S. album CYP76Fs except SaCYP76F43 (SaCYP76-G18) displayed characteristic P450 CO difference spectra (see FIG. 18). The P450 content of the microsomal preparations ranged from 0.2 to 1.6 .mu.M. Microsome preparations were screened for P450 activity as described in Example 11 below.

Example 9

Generation and Isolation of Sesquiterpene Olefins

[0523] The sesquiterpene olefins .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and .alpha.-trans-bergamotene are not commercially available but can be produced by expression of S. album santalene synthase (SaSSY; SEQ ID NO:16) in yeast as described in Jones et al. (2011) J Biol Chem 286:17445-17454.

[0524] A sesquiterpene oil containing .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and .alpha.-trans-bergamotene was produced in an industrial scale fermentation. The mixture was separated using silver nitrate impregnated TLC plates according to Daramwar et al. (Analyst 137:4564-4570 (2012)). Fractions were scraped from the TLC plates and the sesquiterpenes were eluted with pentane followed by GC-MS analysis for purity. The extracted ion chromatograms are shown in FIGS. 19A-19D for the oil containing .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and .alpha.-trans-bergamotene (FIG. 19A), .alpha.-santalene (peak 1, FIG. 19B), .alpha.-trans-bergamotene (peak 2, FIG. 19C) and epi-.beta.-santalene and .beta.-santalene (peaks 3 and 4, FIG. 19D). The isolated sesquiterpenes were used in in vitro assays in Example 11 below.

Example 10

Functional Characterization of S. Album Cytochrome P450 Activity in S. Cerevisiae

[0525] The S. cerevisiae yeast host strain containing active santalene synthase and cytochrome P450 reductase described in Example 7.C.2. was used to express the S. album cytochrome CYP76F P450s identified in Example 2 above. Activity was assessed by measurement of in vivo formation of oxidation products as described in Section A below. Each S. album CYP76F in a pYeDP60 vector was transformed individually into the yeast host cell expressing santalene synthase and CPR. A control strain was generated that contained the empty pYeDP60 vector.

A. In Vivo P450 Assays in Yeast

[0526] For in vivo assays, yeast were grown overnight at 30.degree. C. in 5 mL of 2% dextrose and minimal selective media. The next day, a 50 mL culture was initiated at a starting OD600 of 0.2 and grown at 30.degree. C. with shaking at 170 rpm until the culture reached an OD600 of 0.6-0.8. Protein expression was initiated by transfer into minimal selective media with 2% galactose and grown for about 14-16 hours. Yeast cells were harvested by centrifugation at 1,000.times.g for 10 min and washed once with 5 mL sterile ddH.sub.2O. Cells were extracted twice with 2 mL hexane: ethyl acetate (85:15) using about 250 .mu.L acid-washed glass beads (425-600 .mu.m, Sigma) and vortexing for 1 min. Pooled extracts were transferred to a clean test-tube containing anhydrous Na.sub.2SO.sub.4 and evaporated under a gentle stream of N.sub.2 gas to about 200 .mu.L. The samples were transferred to a GC glass vial for GC-MS analysis (as described in Example 6) or stored at -80.degree. C.

B. Clade I Santalum Album P450s

[0527] Clade I S. album P450s SaCYP76F39v1 (SaCYP76-G10), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) were assayed for their activity in vivo with GC-MS analysis as described in Example 6A or 6B.

[0528] 1. SaCYP76F39v1 (SaCYP76-G10) with GC-MS Analysis as Described in Example 6A

[0529] Co-expression of santalene synthase and SaCYP76F39v1 (SaCYP76-G10) resulted in the detection of 11 product peaks identified as .alpha.-, .beta.- and epi-.beta.-santalol and .alpha.-trans-bergamotol (see FIGS. 8A-8B and Table 11 below). Nine (9) of the 11 products were also detected in the S. album oil, albeit in different ratios, as shown in FIGS. 8A and 8B. The products were identified based on matches of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil and Kovats index values (See FIG. 8A and Table 11). The main components of S. album oil are .alpha.-santalol, Z-.alpha.-trans-bergamotol, E-cis, epi-.beta.-santalol and trans-.beta.-santalol whereas the main products from SaCYP76F39v1 (SaCYP76-G10) are cis-.alpha.-santalol, .alpha.-santalol and trans-.beta.-santalol. These differences can be due to different physiological conditions, such as pH, under which the SaSSy and SaP450 enzymes are active in the yeast cells and in the trees, or they can be due to changes in the ratios of products over time. The products monitored in yeast were formed and accumulated over a period of hours, while oil extracted from trees is potentially the product of years of accumulation. Farnesol (labeled #), which is produced by yeast independent of the expression of santalene synthase, and dodecanoic acid (labeled *), which is extracted from yeast, were also observed (see FIGS. 8B and 8C).

TABLE-US-00010 TABLE 11 Terpenoids identified in in vivo assay with SaCYP76F39v1 (SaCYP76-G10) and S. album oil Re- Compounds tention Retention Products detected from detected in Peak Time Index.sup.1 SaCYP76F39v1 S. album oil 1 32.23 2169 unknown isomer of traces .alpha.-trans-bergamotol 2 35.2 2214 unknown Yes 3 35.8 2228 unknown isomer of .alpha.-santalol No 4 38.5 2294 cis-.alpha.-santalol Yes 5a 39.1 2308 unknown isomer of .alpha.-santalol No 5b 39.1 2308 .alpha.-trans-bergamotol Yes 6 40.0 2331 unknown isomer of .alpha.-santalol Yes 7 40.4 2341 unknown isomer of Yes .alpha.-trans-bergamotol 8 41.1 2359 Epi-.beta.-santalol Yes 9 41.7 2374 .beta.-santalol Yes 10 42.7 2399 unknown isomer of .beta.-santalol Yes 11 43.2 2412 unknown isomer of .beta.-santalol Yes *Dodecanoic acid, extracted from yeast; # Farnesol, product of yeast. .sup.1Linear retention indices (LRI) measured on a SGE Solgel-Wax column

[0530] 2. SaCYP76F39v1 (SaCYP76-G10) with GC-MS Analysis as Described in Example 6B

[0531] Co-expression of santalene synthase and SaCYP76F39v1 (SaCYP76-G10) resulted in the detection of eight products identified as (Z)- and (E)-.alpha.-santalol (peaks 5 and 7), (Z)- and (E)-.beta.-santalol (peaks 6 and 8), (Z)- and (E)-epi-.beta.-santalol (peaks 9 and 11) and (Z)- and (E)-.alpha.-trans-bergamotol (peaks 10 and 12) (see FIG. 11A). Table 12 below sets forth the peak number, compound and linear retention indices for the DBwax column and the HP5 column. Product identification was based on best match of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil and Kovats index values. As shown in the figure, the product peak for (Z)-.alpha.-trans-bergamotol overlapped with a peak corresponding to (E,E)-farnesol, which was produced in yeast independent of SaCYP76F39v1 (SaCYP76-G10) (see FIG. 11B).

[0532] A fraction of the sesquiterpenols produced were modified to unidentified compounds (identified with hash tags (#) in FIG. 11A). When untransformed yeast cells were incubated with authentic sandalwood oil, the same unknown compounds were identified implying that these unidentified compounds are not direct products of SaCYP76F39v1 (SaCYP76-G10) but are produced by an endogenous activity of yeast converting sandalwood sesquiterpenols (see FIGS. 12A-12B).

TABLE-US-00011 TABLE 12 Retention indices of sesquiterpenes and sesquiterpenols LRI.sup.1 LRI.sup.2 Peak Compound DBwax HP5 1 .alpha.-santalene 1579 1423 2 .alpha.-trans-bergamotene 1592 1437 3 epi-.beta.-santalene 1637 1450 4 .beta.-santalene 1652 1463 5 (Z)-.alpha.-santalol 2343 1676 6 (Z)-.alpha.-trans-bergamotol 2353 1692 7 (E)-.alpha.-santalol 2382 1697 8 (E)-.alpha.-trans-bergamotol 2389 1711 9 (Z)-epi-.beta.-santalol 2409 1703 10 (Z)-.beta.-santalol 2423 1717 11 (E)-epi-.beta.-santalol (tentative) 2452 1726 12 (E)-.beta.-santalol 2465 1738 .sup.1Linear retention indices (LRI) measured on a DBwax column. .sup.2Linear retention indices (LRI) measured on a HP5 column.

[0533] 3. SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13)

[0534] SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) were assayed for their ability to oxidize sesquiterpenes using the in vivo assay described above with GC-MS analysis described in Example 6B. Co-expression of santalene synthase and SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) or SaCYP76F42 (SaCYP76-G13) gave product profiles with nearly identical ratios to those observed for SaCYP76F39v1 (SaCYP76-G10) (see Table 12 and FIGS. 13A-13D).

C. Clade II Santalum Album P450s

[0535] Clade II S. album P450s SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5) were assayed for their activity in vivo with GC-MS analysis as described in Example 6A or 6B.

[0536] 1. SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12) with GC-MS Analysis as Described in Example 6A

[0537] Co-expression of santalene synthase with SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) or SaCYP76F38v2 (SaCYP76-G12) in the recombinant yeast system resulted in virtually identical products (see FIGS. 6A, 6B and 6C and Table 13 below). The products were identified based on matches of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil (See FIG. 7 and Table 13). Peaks 1 and 7, which were observed for SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12), correspond to .alpha.-trans-bergamotol, possibly representing different isomers. Peaks 1 and 7 were also observed for S. album oil (see FIG. 7 and Table 13). A third peak (labeled #) with a retention time of approximately 18 minutes was identified as farnesol, which is produced by yeast independent of the expression of santalene synthase and SaCYP76, as observed by its expression in the control cells containing an empty vector (FIG. 6D).

TABLE-US-00012 TABLE 13 Terpenoids identified in in vivo assay with SaCYP76-F38v1, -F37v1, -F38v2 and S. album oil Compounds Retention Products detected from detected in Peak Time CYP76-F38v1, -F37v1, -F38v2 S. album oil 1 17.64 unknown isomer of .alpha.-trans-bergamotol traces 4 18.00 cis-.alpha.-santalol Yes 5b 18.05 .alpha.-trans-bergamotol Yes 7 18.15 unknown isomer of .alpha.-trans-bergamotol Yes 8 18.40 Epi-.beta.-santalol Yes 9 18.50 .beta.-santalol Yes # Farnesol, product of yeast. .sup.1Linear retention indices (LRI) measured on a SGE Solgel-Wax column

[0538] 2. SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) or SaCYP76F38v2 (SaCYP76-G12) or SaCYP76F37v2 (SaCYP76-G14)

[0539] SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) or SaCYP76F38v2 (SaCYP76-G12) or SaCYP76F37v2 (SaCYP76-G14) were assayed for their ability to oxidize sesquiterpenes using the in vivo assay described above with GC-MS analysis described in Example 6B. Co-expression of santalene synthase with SaCYP76F38v1 (SaCYP76-G5), SaCYP76F37v1 (SaCYP76-G11) or SaCYP76F38v2 (SaCYP76-G12) or SaCYP76F37v2 (SaCYP76-G14) in the recombinant yeast system resulted in mostly E-.alpha.-trans-bergamotene (peak 8 in Table 12) with only traces of (E)-.alpha.-santalol and (E)-.beta.-santalol (peaks 7 and 12 in Table 12) (see Table 12 and FIGS. 14A-14D)

D. SaCYP76F43 (SaCYP76-G18)

[0540] SaCYP76F43 (SaCYP76-G18) was assayed for its ability to oxidize sesquiterpenes using the in vivo assay described above with GC-MS analysis described in Example 6B. No activity was observed after co-expression of santalene synthase with SaCYP76F43 (SaCYP76-G18) (see FIG. 14E).

E. SaCPR1 and SaCPR2

[0541] To test if SaCPR1 and SaCPR2, which are 70% identical at the protein level, could affect changes in the product profiles, both CPRs were tested as indicated in Example 6B with representative class I and class II SaCYP76Fs SaCYP76F39v1 and SaCYP76F38v1. No differences were observed in the products and relative abundances as compared to those described in Sections B.2. and C.2. above.

Example 11

In Vitro Enzymatic Assays

[0542] Yeast microsomes containing a S. album cytochrome P450 and a cytochrome P450 reductase, generated in Example 8, were assayed for their ability to oxidize santalenes and bergamotene using either A) a coupled enzyme assay with the in vitro reaction products of SaSSy and FPP; B) an isolated mixture of santalenes and bergamotene as the substrate; or C) individual santalenes or bergamotene as the substrate.

A. Oxidation of Santalenes and Bergamotene Using a Coupled Enzyme Assay

[0543] Coupled enzyme assays with S. album santalene synthase (SaSSy) expressed in bacteria (Jones et al. (2011) J Biol Chem 286:17445-17454) were initiated with 50 .mu.g of His.sub.6-tag purified SaSSy and 70 .mu.M farnesyl pyrophosphate (FPP) in TPS buffer (25 mM HEPES pH 7.5, 5 mM MgCl.sub.2, 1 mM DTT) in a volume of 450 .mu.L. The assays were incubated for 30 min at 30.degree. C. followed by the addition of 50 .mu.L of the microsome preparation containing a S. album cytochrome P450 and a cytochrome P450 reductase and 0.8 mM NADPH. The reaction was incubated for an additional 1 hour at 30.degree. C. and was stopped by extraction with 500 .mu.L hexane/ethyl acetate (85:15). The organic layer was concentrated under a gentle stream of N.sub.2 gas to about 100 .mu.L and analyzed by GC-MS analysis (as described in 6A above) or was stored at -80.degree. C.

[0544] 1. SaCYP76F38v1 (SaCYP76-G5)

[0545] The coupled enzyme assay was performed in vitro with SaCYP76F38v1 (SaCYP76-G5) and compared to the in vivo results to verify the utility of the assay. GC-MS analysis of the reaction products from the coupled assay showed the same two peaks identified in the in vivo assay in Example 8. In both assays, SaCYP76F38v1 (SaCYP76-G5) catalyzed the hydroxylation of bergamotene into Z-.alpha.-trans-bergamotol but did not catalyze the oxidation of any santalenes.

B. Oxidation of a Mixture of Santalenes and Bergamotene

[0546] S. album P450s were assayed for their sesquiterpene oxidase activities using a mixture of santalenes and bergamotene as the substrate.

[0547] 1. Assays

[0548] Two different in vitro assays were used to screen the S. album CYP76Fs for sesquiterpene oxidase activity.

[0549] a. In Vitro Assay 1

[0550] Assays were performed in 400 .mu.L reaction volumes containing 150 .mu.L potassium phosphate buffer 100 mM (pH 7.5), 20 .mu.L 20 mM NADPH, 1 .mu.L of 25 mM santalene/bergamotene mixture [containing .alpha.-santalene, epi-.beta.-santalene, .beta.-santalene, .alpha.-bergamotene] and 80 pmol of the microsomes preparation (prepared as described in Example 8). The reactions were incubated at 30.degree. C. for 1 hour and stopped by adding 500 .mu.L hexane:ethyl acetate (85:15) followed by vortexing for 30 seconds. The organic layer was concentrated under a gentle stream of N.sub.2 gas to about 100 .mu.L and analyzed by GC-MS analysis (as described in Example 6A above) or was stored at -80.degree. C.

[0551] b. In Vitro Assay 2

[0552] Assays were performed in 400 .mu.L reaction volumes containing 50 mM potassium phosphate pH 7.5, 0.8 mM NADPH and 40 .mu.M of substrate. Enzyme reactions were initiated by adding 50 .mu.L of the microsomes preparation (prepared in Example 8), incubated at 30.degree. C. for 2 hours with shaking and stopped by adding 500 .mu.L hexane. The organic layer was transferred to a new GC vial and concentrated under a gentle stream of N.sub.2 gas to about 100 .mu.L and analyzed by GC-MS analysis (as described in Example 6B above).

[0553] 2. Clade I Santalum Album P450s

[0554] Microsomes containing clade I S. album P450s SaCYP76F39v1 (SaCYP76-G10), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) were assayed for their sesquiterpene oxidize activity using the assays set forth above using a mixture of santalenes and bergamotene as the substrate.

[0555] a. SaCYP76F39v1 (SaCYP76-G10)

[0556] The in vitro sesquiterpene oxidase activity Clade I S. album P450 SaCYP76F39v1 (SaCYP76-G10) was assessed using both assays described above.

[0557] i. Initial Experiment Using In Vitro Assay 1

[0558] Microsomes containing SaCYP76F39v1 (SaCYP76-G10) were assayed for their activity using the assay described in Section B.1.a. above. GC-MS analysis revealed eight different product peaks that were identified as santalols (see FIG. 9B, peaks correspond to those in Table 11 above). Product identification was based on best match of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil (FIG. 9A) and Kovats index values.

[0559] ii. Assay Using In Vitro Assay 2

[0560] Microsomes containing SaCYP76F39v1 (SaCYP76-G10) were assayed for their activity using the assay described in Section B. above. GC-MS analysis of the reaction products revealed that SaCYP76F39v1 (SaCYP76-G10) catalyzed the hydroxylation of .alpha.-santalene, .beta.-santalene, epi-.beta.-santalene and .alpha.-trans-bergamotene, leading to 8 different compounds identified as (Z)- and (E)-.alpha.-santalol, (Z)- and (E)-.beta.-santalol, (Z)- and (E)-epi-.beta.-santalol and (Z)- and (E)-.alpha.-trans-bergamotol (see FIG. 15A and Table 12). The product profile was compared to an authentic sandalwood oil sample (see Table 12 and FIG. 15B), which showed identical retention times and mass spectra for all 8 compounds but in different ratios. SaCYP76F39v1 (SaCYP76-G10) produced (E)-.alpha.-santalol and (Z)-.alpha.-santalol in a ratio of approximately 5:1, and (E)-.beta.-santalol and (Z)-.beta.-santalol in a ratio of approximately 4:1. The main products formed with SaCYP76F39v1 (SaCYP76-G10) were (E)-.alpha.-santalol and (E)-.beta.-santalol while the main compounds of sandalwood oil are (Z)-.alpha.-santalol and (Z)-.beta.-santalol. No product was formed in the absence of NADPH or with microsomes from yeast carrying an empty vector (see FIG. 15C).

[0561] b. SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13)

[0562] Microsomes containing SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) were assayed for their activity using the assay described in Section B. above. GC-MS analysis of the reaction products revealed that SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) gave product profiles similar to those observed for SaCYP76F39v1 (SaCYP76-G10) (see Table 12 and FIGS. 16A-16D). The major products observed for SaCYP76F40 (SaCYP76-G16) and SaCYP76F42 (SaCYP76-G13) were (E)-.alpha.-trans-bergamotol (or (E)-.alpha.-exo-bergamotol) and (E)-.beta.-santalol.

[0563] 3. Clade II S. Album P450s

[0564] Microsomes containing clade II S. album P450s SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5) were assayed for their sesquiterpene oxidize activity using the assays set forth above using a mixture of santalenes and bergamotene as the substrate.

[0565] a. SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12)

[0566] Microsomes containing SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F38v2 (SaCYP76-G12) were assayed for their activity using the assay described in Section B.1.a. above. GC-MS analysis of the reaction products revealed one product peak that was absent in the control reaction (microsomes containing only vector control). The product peak was identified as Z-.alpha.-trans-bergamotol based on best match of its MS fragmentation pattern with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.) and by comparison with compounds of authentic S. album oil.

[0567] b. SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5)

[0568] Microsomes containing SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5) were assayed for their activity using the assay described in Section Bib. above. GC-MS analysis of the reaction products revealed that SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5) produced three compounds, which were identified as (E)-.alpha.-trans-bergamotol (or (E)-.alpha.-exo-bergamotol) as the major product, and (E)-.alpha.-santalol and (E)-.beta.-santalol as minor products (see Table 12 and FIGS. 17A-17D).

[0569] 4. SaCYP76F43 (SaCYP76-G18)

[0570] Microsomes containing SaCYP76F43 (SaCYP76-G18) were assayed for their activity using the assay described in Section B. above using a mixture of santalenes and bergamotene as the substrate. No activity was observed (see FIG. 17E) possibly due to low expression in yeast as evidenced by the corresponding CO difference spectrum (see FIG. 18).

C. Oxidation of Individual Sesquiterpenes

[0571] Microsome preparations containing candidate P450 were assayed for their capacity to oxidize individual sesquiterpenes. The sesquiterpenes were isolated as described in Example 9 above. Three fractions containing mainly .alpha.-santalene, .alpha.-trans-bergamotene, or epi-.beta.-santalene and .beta.-santalene were used as individual substrates in assays containing clade I P450 SaCYP76F39v1 (SaCYP76-G10) or clade II P450 SaCYP76F37v1 (SaCYP76-G11). The assays were performed as described in Section B.1.b. above and products were identified by comparison to authentic standards (see Table 12 and FIG. 20G).

[0572] Reaction of SaCYP76F39v1 (SaCYP76-G10) with .alpha.-santalene produced (Z)- and (E)-.alpha.-santalol while only (E)-.alpha.-santalol was produced with SaCYP76F37v1 (SaCYP76-G11) (see FIG. 20A versus FIG. 20D). With .alpha.-trans-bergamotene, SaCYP76F39v1 (SaCYP76-G10) produced (Z)- and (E)-.alpha.-trans-bergamotol while only (E)-.alpha.-trans-bergamotol formation was observed for SaCYP76F37v1 (SaCYP76-G11) (see FIG. 20B versus FIG. 20E). SaCYP76F39v1 (SaCYP76-G10) gave four products (Z)- and (E)-epi-.beta.-santalol and (Z)- and (E)-.beta.-santalol in assays with epi-.beta.-santalene and .beta.-santalene whereas only (E)-.beta.-santalol was detected in assays with SaCYP76F37v1 (SaCYP76-G11) (see FIG. 20C versus FIG. 20F). These results confirm the activities observed with microsome in vitro assays with the mixture of santalenes and bergamotene (Section B above).

Summary of Results from Examples 10 and 11

Clade I S. Album P450 Santalene/Bergamotene Oxidases

[0573] Clade I S. album P450s SaCYP76F39v1 (SaCYP76-G10), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) catalyzed the oxidation of santalenes and bergamotene producing the (Z) and (E) stereoisomers of .alpha.-, .beta.- and epi-.beta.-santalols and bergamotols. The P450 ratios of (Z) and (E) stereoisomers of .alpha.- and .beta.-santalol were approximately 1:5 and 1:4, respectively. Thus SaCYP76F39v1 (SaCYP76-G10), SaCYP76F39v2 (SaCYP76-G15), SaCYP76F40 (SaCYP76-G16), SaCYP76F41 (SaCYP76-G17) and SaCYP76F42 (SaCYP76-G13) were identified as a santalene/bergamotene oxidases.

Clade II S. Album P450 Bergamotene Oxidases

[0574] Clade II S. album P450s SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 (SaCYP76-G5) primarily catalyzed the oxidation of bergamotene into bergamotol, with (E)-.alpha.-trans-bergamotol as the major product and minor amounts of (E)-.alpha.-santalol and (E)-.beta.-santalol observed. SaCYP76F37v1 (SaCYP76-G11), SaCYP76F38v2 (SaCYP76-G12), SaCYP76F37v2 (SaCYP76-G14) and SaCYP76F38v1 were identified as bergamotene oxidases.

Example 12

Kinetic Properties

[0575] To test the kinetics of the clade I and clade II SaCYP76F enzymes, kinetic assays were performed with SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F39v1 (SaCYP76-G10) with .alpha.-santalene or .beta.-santalene as the substrate. Assays were performed in 400 .mu.L reaction volumes containing 50 mM potassium phosphate pH 7.5, 0.8 mM NADPH and substrate concentrations of 12 to 138 .mu.M of .alpha.-santalene or .beta.-santalene. Enzyme reactions were initiated by adding either 17 pmol of SaCYP7639v1 or 35 pmol of SaCYP7637v1, incubated at 30.degree. C. for 20 minutes with shaking and stopped by adding 500 .mu.L hexane. The organic layer was transferred to a new GC vial and concentrated under a gentle stream of N.sub.2 gas to about 100 .mu.L and analyzed by GC-MS analysis (as described in Example 6B above). Kinetic data were evaluated using tools described in Hernandez and Ruiz ((1998) Bioinformatics. 14:227-228).

[0576] The apparent K.sub.m values, k.sub.cat values and k.sub.cat/K.sub.m values for SaCYP76F39v1 (SaCYP76-G10) and SaCYP76F37v1 (SaCYP76-G11) with .alpha.-santalene and .beta.-santalene are set forth in Table 14 below.

TABLE-US-00013 TABLE 14 Kinetic constants for SaCYP76F39v1 and SaCYP76F37v1 .alpha.-santalene P450 K.sub.m (.mu.M) k.sub.cat (s.sup.-1) k.sub.cat/K.sub.m (s.sup.-1 M.sup.-1) SaCYP76F39v1 25.92 .+-. 0.11 1.12 4.3 .times. 10.sup.4 (SaCYP76-G10) SaCYP76F37v1 133 .+-. 0.41 0.2 1.5 .times. 10.sup.3 (SaCYP76-G11) .beta.-santalene P450 K.sub.m (.mu.M) k.sub.cat k.sub.cat/K.sub.m SaCYP76F39v1 34.82 .+-. 0.41 1.17 3.3 .times. 10.sup.4 (SaCYP76-G10) SaCYP76F37v1 157 .+-. 0.17 0.13 8.1 .times. 10.sup.2 (SaCYP76-G11)

Example 13

Substrate Specificity

A. Substrate Specificity of Clade I and Clade II SaCYP76F Enzymes

[0577] To test the range of substrates used by the clade I and clade II SaCYP76F enzymes, yeast microsomes containing SaCYP76F37v1 (SaCYP76-G11) and SaCYP76F39v1 (SaCYP76-G10) were assayed for their ability to convert various sesquiterpenes, including the substrates .alpha.-santalene and .beta.-santalene and 7 additional sesquiterpenes which resemble santalenes in the acyclic isoprenyl side chain, including .alpha.-curcumene, zingiberine, .beta.-bisabolene, .beta.-sesquiphellandrene, .alpha.-bisabolol, trans-.beta.-farnesene and trans-nerolidol. Each substrate was tested using the in vitro assay described in Example 11.B.1.b above.

[0578] The results are shown in Table 15 below, which sets forth the substrates, including their structures, and the relative activities which represent the rate of product formation relative to product formation by SaCYP76F39v1 (SaCYP76-G10) with .beta.-santalene. As shown in the table, SaCYP76F39v1 (SaCYP76-G10) and SaCYP76F37v1 (SaCYP76-G11) exhibited narrow substrate selectivity, with both preferring santalenes, including .alpha.-santalene or .beta.-santalene, as substrates. SaCYP76F39v1 (SaCYP76-G10) efficiently converted only the two santalenes and had low activity with .alpha.-bisabolol. SaCYP76F39v1 (SaCYP76-G10) did not use .alpha.-curcumene, zingiberene, .beta.-bisabolene, .beta.-sesquiphellandrene, trans-.beta.-farnesene or trans-nerolidol as a substrate. Similarly, SaCYP76F37v1 (SaCYP76-G11) was selectively active with the two santalenes and trans-nerolidol.

TABLE-US-00014 TABLE 15 Relative activities of SaCYP76F39v1 and SaCYP76F37v1 with various sesquiterpene substrates. SaCYP76F39v1 SaCYP76F37v1 (SaCYP76-G10) (SaCYP76-G11) Substrate [%]* [%]* .alpha.-santalene ##STR00012## 99.8 17.3 .beta.-santalene ##STR00013## 100 17.7 .alpha.-curcumene ##STR00014## 0 0 zingiberene ##STR00015## 0 0 .beta.-bisabolene ##STR00016## 0 0 .beta.-sesquiphellandrene ##STR00017## 0 0 .alpha.-bisabolol ##STR00018## 9.4 0 trans-farnesene ##STR00019## 0 0 trans-nerolidol ##STR00020## 0 11.3 *Relative activities represent rate of product formation relative to product formation by SaCYP76F39v1 with .beta.-santalene

B. Oxidation of Various Mono- and Sesquiterpenes Substrates

[0579] Yeast microsomes containing S. album cytochrome P450 SaCYP76F38v1 (SaCYP76-G5) and cytochrome P450 reductase were directly assayed for their capacity to oxidize different mono- and sesquiterpene substrates, including linalool, geraniol, nerol, nerolidol and bisabolol. The reaction mixtures contained 50 mM potassium phosphate, 0.8 mM NADPH and 60 to 80 .mu.M of the terpene substrate in a total volume of 350 .mu.L. Enzyme reactions were started by adding 50 .mu.L of the microsome preparation, incubated at 30.degree. C. for 1 hour with shaking and stopped by extraction with 500 .mu.L of hexane/ethyl acetate (85:15). The organic layer was concentrated under a gentle stream of N.sub.2 gas to about 100 .mu.L and analyzed by GC-MS analysis as described in Example 6. Results were compared to vector control. The reaction products were identified based on matches of the MS fragmentation patterns with entries in the NIST and Wiley libraries (Wiley Registry.RTM. 9.sup.th Edition/NIST 2011; Fred W. McLafferty, John Wiley & Sons, Inc.).

[0580] 1. SaCYP76F38v1 (SaCYP76-G5)

[0581] Reaction of SaCYP76F38v1 (SaCYP76-G5) with linalool resulted in two products: Peak 1, retention time of at approximately 17.5 minutes and Peak 2, retention time of approximately 18.5 minutes. Linalool had a retention time of approximately 10.5. The best matches for the MS fragmentation patterns of Peaks 1 and 2 correspond to 3,8-dimethyl-1,7-octadien-6-ol and 8-hydroxylinalool, respectively. Reaction of SaCYP76F38v1 (SaCYP76-G5) with geraniol resulted in one product with a retention time of approximately 21 minutes. Geraniol had a retention time of approximately 14 minutes. The best match for this peak's MS fragmentation pattern corresponds to trans,trans-2,6-dimethyl-2,6-octadiene-1,8 diol. Reaction of SaCYP76F38v1 (SaCYP76-G5) with nerol resulted in one product with a retention time of approximately 20.8 minutes, whereas nerol had a retention time of approximately 13.4 minutes. The best match for this peak's MS fragmentation pattern corresponds to 2,6-dimethyl-2,6-octadiene-1,8 diol. Reaction of SaCYP76F38v1 (SaCYP76-G5) with nerolidol resulted in two products, with retention times of approximately 21.3 and 22.3 minutes, whereas nerolidol had a retention time of approximately 16.1 minute. Reaction of SaCYP76F38v1 (SaCYP76-G5) with bisabolol resulted in one product having a retention time of approximately 25.2 with bisabolol having a retention time of approximately 17.6. The MS fragmentation patterns of products formed by reaction of SaCYP76F38v1 (SaCYP76-G5) with nerolidol and bisabolol did not match with known substances in the MS fragmentation pattern databases.

[0582] 2. SaCYP76F39v1 (SaCYP76-G10)

[0583] CYP76-G10 also catalyzed the hydroxylation of linalool, nerol and bisabolol in vitro. In each case, product formation was the same as that catalyzed by CYP76-G5 described above.

Since modifications will be apparent to those of skill in this art, it is intended that this invention be limited only by the scope of the appended claims.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 89 <210> SEQ ID NO 1 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76 ORF <400> SEQUENCE: 1 atggacttct taagttttat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg taggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aaaggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacctca tactggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cagaactcct ccggaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaaa aaacctggtc caagaggccg acttgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccgat ccgggggtaa 1530 <210> SEQ ID NO 2 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v1 (CYP76-G5) <400> SEQUENCE: 2 atggacttct taagttttat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cagaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccgat ccgggggtaa 1530 <210> SEQ ID NO 3 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F39v1 (CYP76-G10) <400> SEQUENCE: 3 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactratgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 4 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F37v1 (CYP76-G11) <400> SEQUENCE: 4 atggacttct taagttgtat cctgtctgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gaccctgcgg aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 5 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v2 (CYP76-G12) <400> SEQUENCE: 5 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 6 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v1 (CYP76-G5) <400> SEQUENCE: 6 Met Asp Phe Leu Ser Phe Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 7 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F39v1 (CYP76-G10) <400> SEQUENCE: 7 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 8 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F37v1 (CYP76-G11) <400> SEQUENCE: 8 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 9 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v2 (CYP76-G12) <400> SEQUENCE: 9 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 10 <211> LENGTH: 2079 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 <400> SEQUENCE: 10 atgagttcga gctcggagct atggaaatcg atcggctcgg cgctgggggt gtctccaccg 60 ccggcatggg ccgaggagtg ggcggcggtg atcgtcacca cgtccgcggc gctgatcgta 120 ggtttcgtga tgttcatgtg gcggagatcg ggcgagaagt ccaaggaatt gaggcctgtg 180 gtggcgctga aggcggcgcc gatcgaggcg gaggaggacg atggcgaggt tgactcgggg 240 aagactaagg tcactgtgtt cttcggtacg cagactggca ctgccgaagg gttcgctaag 300 gctttggcag aagagatcaa ggcaagatat gaaaaagcag tcgtcaaagt ggttgacctg 360 gatgattatg ctgcagatga tgatcaatat ggagaaaaat tgaaaaatga gacgctgaca 420 tttttcatgg tggccactta tggtgatgga gaaccaaccg ataatgctgc aagattttac 480 aaatggttta ctgaggagaa agaaagggaa gcttggttac agcagctgac ttatggcatt 540 tttggtctgg gaaatcgtca atatgaacat tttaataaga tagcaaaggt gcttgatgaa 600 cagcttactg aacaaggtgc aaagcgtctc attcaggttg gtttaggtga tgatgatcag 660 tgcatcgagg atgatttttc tgcttggcgt gaactactgt ggccagagtt agatcaatta 720 ctccggggtg atgatggtgc gaattctgtg tctactccct atacagctgc tgttcctgaa 780 taccgagtgg tgatccatga tcctactatc acttcatctg aggataaatc cttagccacg 840 gccaatgggg ctgctttatt tgacattcac catccatgca gagttaaggt tgctgttcaa 900 agagagcttc acaaagctga ctctgaccgc tcttgcatac atttggagtt tgatatatca 960 ggcacgggtc ttatgtatga aacgggagac catgtgggtg tttacgctga aaattgtgtt 1020 gagactgttg aagaagcagg aaagctgttg ggccaacctt tagatttgct cttttctgtt 1080 cacactgaca aggatgatgg tacatctctt gagagctcat tgccccctcc ttttcctggt 1140 ccttgcactc ttcgcactgc actgtttcaa tatgcagatc tattgaaccc tcctaggaag 1200 gctgctttag ttgccctggc agctcatgca gttgaaccat ctgaggcaga cagacttaaa 1260 tttttgtcat cacctcaggg aaaggatgag tatgcgaaat gggttgttgg cagtcaaaga 1320 agcctccttg aggtgatggc tgagttcccg tcaataaaag ttccccttgg tgtgtttttt 1380 gccgctgtgg ccccccgcct acagcctcgc tactattcaa tctcatcatc gcctaggttc 1440 tcctctgacc gggttcatgt aacctgcgct ttagtttatg gccctagtcc aacaggcaga 1500 attcacagag gggtgtgttc cacctggatg aagaatgcag ttcctctaga agaaagccgt 1560 gagtgtagct gggctcctat atttattagg acatctaatt ttaagctacc agctaatcct 1620 tctaccccag ttatcatggt cggccctggt actggcttgg ctccgtttag aggattccta 1680 caggaaagga tggccttgtt agaaggcagt gctcaacttg gtcctgcttt acttttcttt 1740 ggatgtagaa atcgaaggat ggattttatt tacgaggatg aactcaacaa tttcgtcgaa 1800 caaggtgtga tatcagagtt gattgttgca ttctcgaggg acgggccaac caaggagtac 1860 gttcagcata agatgatgga taaagctgca tatatatgga gtctaatctc tcagggggct 1920 tatctttatg tctgtggtga tgcaaagggg atggctagag atgttcatcg aactttgcat 1980 actcttgttc aacaacagga gagcgtggac tcatcaaaag cagagtcaat agtgaagaag 2040 cttcagatgg atggacgata tctaagagat gtttggtaa 2079 <210> SEQ ID NO 11 <211> LENGTH: 2115 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 <400> SEQUENCE: 11 atgcaattga gctccgtcaa gctaatccct ttggatctca tgacggctat tttcaacggc 60 ggtgggagcc ccgccggctc cggggaggcc ctgtcgatgc tgctggagaa tcgggaggtg 120 gtggtggcgc tcacgacgtc gctcgcggtg ctcatcgggt gcgtgttcgc gtacctgtgg 180 cggttctcga gctcccagaa ggcggtggcg gcggctaagg gcgtagaggt tgcgaggaag 240 ccggtgatcg ggaaggaatc ggaggcggcg gaggtggatg acggaaagaa gaaggtgacc 300 atcttcttcg ggacgcagac tggaacagcc gaagggttcg ccaaggcgct ggttgaggag 360 gcaaaagcac gctatgagaa ggccattttt aaattggttg atttggatga ttatgctgcc 420 gaggatgatg aatatgagga gaagttgaaa aaagagaaat tcgctttatt ctttttagcc 480 acatatggag atggtgagcc tactgacaat gcagcgaggt tctataaatg gtttactgag 540 gaaaatgaaa gtggagagtg gctccaaaag cttcagttcg gagtgtttgg ccttggcaac 600 aggcaatacg agcatttcaa caaggttgca aaggttgtgg atgagattct tgctgagcaa 660 ggtgggaagc gcctggttcc agtgggtctt ggagatgatg atcaatgcat tgaagatgac 720 ttcactgcat ggcgtgaatt agtgtggccc gagttggata aattgctcct agatgaggat 780 gatgcaactg tttctacccc ttatactgct tctgtacctg aataccgggt tgtatttcat 840 gattctcctg atgattatct gcagaagaac tctagtaatg caaatggtca ttcgatgcat 900 gatgctcagc atccatgcag ggctaatgtt gctgtgagga gggagcttca ttcgccttta 960 tctgatcgtt cttgcactca tctagaattt gacattgctg gaactggact tgcgtatgaa 1020 acaggggacc atgttggtgt gtgctgtgag aatttacctg aagttgtgga agaggctgaa 1080 agggtactgg gtttgtcacc aggcatctac ttttccatcc atgctgataa agaggatggc 1140 acaccacttg gaagttcctt gccaccactt tttccaccat gtactttaag aactgcacta 1200 actcaacatg ctgatcttct aagttttcct aaaaaggctg cgttgcttgc tttagcagct 1260 catgcttctg atccaagtga agcggatagg ttgaaatatc ttgcatctcc tgcaggaaag 1320 gatgaatatg cacagtgggt tgttgcaagt cagagaagcc ttctagaagt aatggctgaa 1380 ttcccttcgg cgaagccccc acttggagtt ttgtttgctg cagttgctcc acgattgcag 1440 ccacgattct attcgatctc atcctctcca aagattgcac catctaggat acatgttact 1500 tgcgcattag tatatgataa aacaccaact gggcgaattc acaagggagt gtgctcaact 1560 tggatgaaga atgcgatgcc ccgggaagaa agccacgatt gcagctgggc tcccattttt 1620 gttaggcaat ctaatttcaa gctcccttca aatacatcgg tgcctgtcat catgattggt 1680 cctggcacgg ggttggctcc tttcaggggc tttctacagg aaagattagc actgaaagaa 1740 gctggagttg aactgggacc tgcaatatta ttctttgggt gcaggaaccg taaaatggat 1800 tacatttatg aggatgagtt ggcacacttt gttgaagccg gtgcgctctc tgagttgatc 1860 gtggctttct cacgggaagg accagccaaa cagtatgtcc agcataagat gatggaaaag 1920 gcctcagaaa tctggaacat gatttccgat ggaggttatg tatatgtatg tggtgatgcc 1980 aaaggcatgg ccaaagatgt ccaccgggcg ctccatacaa ttgttcacga acagggatct 2040 ctagacaatt ccaagacaga gagcatggtg aagaatctcc aaatgaatgg aaggtattta 2100 cgggatgtgt ggtga 2115 <210> SEQ ID NO 12 <211> LENGTH: 692 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 <400> SEQUENCE: 12 Met Ser Ser Ser Ser Glu Leu Trp Lys Ser Ile Gly Ser Ala Leu Gly 1 5 10 15 Val Ser Pro Pro Pro Ala Trp Ala Glu Glu Trp Ala Ala Val Ile Val 20 25 30 Thr Thr Ser Ala Ala Leu Ile Val Gly Phe Val Met Phe Met Trp Arg 35 40 45 Arg Ser Gly Glu Lys Ser Lys Glu Leu Arg Pro Val Val Ala Leu Lys 50 55 60 Ala Ala Pro Ile Glu Ala Glu Glu Asp Asp Gly Glu Val Asp Ser Gly 65 70 75 80 Lys Thr Lys Val Thr Val Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu 85 90 95 Gly Phe Ala Lys Ala Leu Ala Glu Glu Ile Lys Ala Arg Tyr Glu Lys 100 105 110 Ala Val Val Lys Val Val Asp Leu Asp Asp Tyr Ala Ala Asp Asp Asp 115 120 125 Gln Tyr Gly Glu Lys Leu Lys Asn Glu Thr Leu Thr Phe Phe Met Val 130 135 140 Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr 145 150 155 160 Lys Trp Phe Thr Glu Glu Lys Glu Arg Glu Ala Trp Leu Gln Gln Leu 165 170 175 Thr Tyr Gly Ile Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn 180 185 190 Lys Ile Ala Lys Val Leu Asp Glu Gln Leu Thr Glu Gln Gly Ala Lys 195 200 205 Arg Leu Ile Gln Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp 210 215 220 Asp Phe Ser Ala Trp Arg Glu Leu Leu Trp Pro Glu Leu Asp Gln Leu 225 230 235 240 Leu Arg Gly Asp Asp Gly Ala Asn Ser Val Ser Thr Pro Tyr Thr Ala 245 250 255 Ala Val Pro Glu Tyr Arg Val Val Ile His Asp Pro Thr Ile Thr Ser 260 265 270 Ser Glu Asp Lys Ser Leu Ala Thr Ala Asn Gly Ala Ala Leu Phe Asp 275 280 285 Ile His His Pro Cys Arg Val Lys Val Ala Val Gln Arg Glu Leu His 290 295 300 Lys Ala Asp Ser Asp Arg Ser Cys Ile His Leu Glu Phe Asp Ile Ser 305 310 315 320 Gly Thr Gly Leu Met Tyr Glu Thr Gly Asp His Val Gly Val Tyr Ala 325 330 335 Glu Asn Cys Val Glu Thr Val Glu Glu Ala Gly Lys Leu Leu Gly Gln 340 345 350 Pro Leu Asp Leu Leu Phe Ser Val His Thr Asp Lys Asp Asp Gly Thr 355 360 365 Ser Leu Glu Ser Ser Leu Pro Pro Pro Phe Pro Gly Pro Cys Thr Leu 370 375 380 Arg Thr Ala Leu Phe Gln Tyr Ala Asp Leu Leu Asn Pro Pro Arg Lys 385 390 395 400 Ala Ala Leu Val Ala Leu Ala Ala His Ala Val Glu Pro Ser Glu Ala 405 410 415 Asp Arg Leu Lys Phe Leu Ser Ser Pro Gln Gly Lys Asp Glu Tyr Ala 420 425 430 Lys Trp Val Val Gly Ser Gln Arg Ser Leu Leu Glu Val Met Ala Glu 435 440 445 Phe Pro Ser Ile Lys Val Pro Leu Gly Val Phe Phe Ala Ala Val Ala 450 455 460 Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Phe 465 470 475 480 Ser Ser Asp Arg Val His Val Thr Cys Ala Leu Val Tyr Gly Pro Ser 485 490 495 Pro Thr Gly Arg Ile His Arg Gly Val Cys Ser Thr Trp Met Lys Asn 500 505 510 Ala Val Pro Leu Glu Glu Ser Arg Glu Cys Ser Trp Ala Pro Ile Phe 515 520 525 Ile Arg Thr Ser Asn Phe Lys Leu Pro Ala Asn Pro Ser Thr Pro Val 530 535 540 Ile Met Val Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu 545 550 555 560 Gln Glu Arg Met Ala Leu Leu Glu Gly Ser Ala Gln Leu Gly Pro Ala 565 570 575 Leu Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp Phe Ile Tyr Glu 580 585 590 Asp Glu Leu Asn Asn Phe Val Glu Gln Gly Val Ile Ser Glu Leu Ile 595 600 605 Val Ala Phe Ser Arg Asp Gly Pro Thr Lys Glu Tyr Val Gln His Lys 610 615 620 Met Met Asp Lys Ala Ala Tyr Ile Trp Ser Leu Ile Ser Gln Gly Ala 625 630 635 640 Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His 645 650 655 Arg Thr Leu His Thr Leu Val Gln Gln Gln Glu Ser Val Asp Ser Ser 660 665 670 Lys Ala Glu Ser Ile Val Lys Lys Leu Gln Met Asp Gly Arg Tyr Leu 675 680 685 Arg Asp Val Trp 690 <210> SEQ ID NO 13 <211> LENGTH: 704 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 <400> SEQUENCE: 13 Met Gln Leu Ser Ser Val Lys Leu Ile Pro Leu Asp Leu Met Thr Ala 1 5 10 15 Ile Phe Asn Gly Gly Gly Ser Pro Ala Gly Ser Gly Glu Ala Leu Ser 20 25 30 Met Leu Leu Glu Asn Arg Glu Val Val Val Ala Leu Thr Thr Ser Leu 35 40 45 Ala Val Leu Ile Gly Cys Val Phe Ala Tyr Leu Trp Arg Phe Ser Ser 50 55 60 Ser Gln Lys Ala Val Ala Ala Ala Lys Gly Val Glu Val Ala Arg Lys 65 70 75 80 Pro Val Ile Gly Lys Glu Ser Glu Ala Ala Glu Val Asp Asp Gly Lys 85 90 95 Lys Lys Val Thr Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu Gly 100 105 110 Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg Tyr Glu Lys Ala 115 120 125 Ile Phe Lys Leu Val Asp Leu Asp Asp Tyr Ala Ala Glu Asp Asp Glu 130 135 140 Tyr Glu Glu Lys Leu Lys Lys Glu Lys Phe Ala Leu Phe Phe Leu Ala 145 150 155 160 Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr Lys 165 170 175 Trp Phe Thr Glu Glu Asn Glu Ser Gly Glu Trp Leu Gln Lys Leu Gln 180 185 190 Phe Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn Lys 195 200 205 Val Ala Lys Val Val Asp Glu Ile Leu Ala Glu Gln Gly Gly Lys Arg 210 215 220 Leu Val Pro Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp Asp 225 230 235 240 Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu Leu Asp Lys Leu Leu 245 250 255 Leu Asp Glu Asp Asp Ala Thr Val Ser Thr Pro Tyr Thr Ala Ser Val 260 265 270 Pro Glu Tyr Arg Val Val Phe His Asp Ser Pro Asp Asp Tyr Leu Gln 275 280 285 Lys Asn Ser Ser Asn Ala Asn Gly His Ser Met His Asp Ala Gln His 290 295 300 Pro Cys Arg Ala Asn Val Ala Val Arg Arg Glu Leu His Ser Pro Leu 305 310 315 320 Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ala Gly Thr Gly 325 330 335 Leu Ala Tyr Glu Thr Gly Asp His Val Gly Val Cys Cys Glu Asn Leu 340 345 350 Pro Glu Val Val Glu Glu Ala Glu Arg Val Leu Gly Leu Ser Pro Gly 355 360 365 Ile Tyr Phe Ser Ile His Ala Asp Lys Glu Asp Gly Thr Pro Leu Gly 370 375 380 Ser Ser Leu Pro Pro Leu Phe Pro Pro Cys Thr Leu Arg Thr Ala Leu 385 390 395 400 Thr Gln His Ala Asp Leu Leu Ser Phe Pro Lys Lys Ala Ala Leu Leu 405 410 415 Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu Ala Asp Arg Leu Lys 420 425 430 Tyr Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr Ala Gln Trp Val Val 435 440 445 Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala Glu Phe Pro Ser Ala 450 455 460 Lys Pro Pro Leu Gly Val Leu Phe Ala Ala Val Ala Pro Arg Leu Gln 465 470 475 480 Pro Arg Phe Tyr Ser Ile Ser Ser Ser Pro Lys Ile Ala Pro Ser Arg 485 490 495 Ile His Val Thr Cys Ala Leu Val Tyr Asp Lys Thr Pro Thr Gly Arg 500 505 510 Ile His Lys Gly Val Cys Ser Thr Trp Met Lys Asn Ala Met Pro Arg 515 520 525 Glu Glu Ser His Asp Cys Ser Trp Ala Pro Ile Phe Val Arg Gln Ser 530 535 540 Asn Phe Lys Leu Pro Ser Asn Thr Ser Val Pro Val Ile Met Ile Gly 545 550 555 560 Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg Leu 565 570 575 Ala Leu Lys Glu Ala Gly Val Glu Leu Gly Pro Ala Ile Leu Phe Phe 580 585 590 Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr Glu Asp Glu Leu Ala 595 600 605 His Phe Val Glu Ala Gly Ala Leu Ser Glu Leu Ile Val Ala Phe Ser 610 615 620 Arg Glu Gly Pro Ala Lys Gln Tyr Val Gln His Lys Met Met Glu Lys 625 630 635 640 Ala Ser Glu Ile Trp Asn Met Ile Ser Asp Gly Gly Tyr Val Tyr Val 645 650 655 Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val His Arg Ala Leu His 660 665 670 Thr Ile Val His Glu Gln Gly Ser Leu Asp Asn Ser Lys Thr Glu Ser 675 680 685 Met Val Lys Asn Leu Gln Met Asn Gly Arg Tyr Leu Arg Asp Val Trp 690 695 700 <210> SEQ ID NO 14 <211> LENGTH: 649 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 truncated <400> SEQUENCE: 14 Met Phe Met Trp Arg Arg Ser Gly Glu Lys Ser Lys Glu Leu Arg Pro 1 5 10 15 Val Val Ala Leu Lys Ala Ala Pro Ile Glu Ala Glu Glu Asp Asp Gly 20 25 30 Glu Val Asp Ser Gly Lys Thr Lys Val Thr Val Phe Phe Gly Thr Gln 35 40 45 Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Ala Glu Glu Ile Lys 50 55 60 Ala Arg Tyr Glu Lys Ala Val Val Lys Val Val Asp Leu Asp Asp Tyr 65 70 75 80 Ala Ala Asp Asp Asp Gln Tyr Gly Glu Lys Leu Lys Asn Glu Thr Leu 85 90 95 Thr Phe Phe Met Val Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn 100 105 110 Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Glu Lys Glu Arg Glu Ala 115 120 125 Trp Leu Gln Gln Leu Thr Tyr Gly Ile Phe Gly Leu Gly Asn Arg Gln 130 135 140 Tyr Glu His Phe Asn Lys Ile Ala Lys Val Leu Asp Glu Gln Leu Thr 145 150 155 160 Glu Gln Gly Ala Lys Arg Leu Ile Gln Val Gly Leu Gly Asp Asp Asp 165 170 175 Gln Cys Ile Glu Asp Asp Phe Ser Ala Trp Arg Glu Leu Leu Trp Pro 180 185 190 Glu Leu Asp Gln Leu Leu Arg Gly Asp Asp Gly Ala Asn Ser Val Ser 195 200 205 Thr Pro Tyr Thr Ala Ala Val Pro Glu Tyr Arg Val Val Ile His Asp 210 215 220 Pro Thr Ile Thr Ser Ser Glu Asp Lys Ser Leu Ala Thr Ala Asn Gly 225 230 235 240 Ala Ala Leu Phe Asp Ile His His Pro Cys Arg Val Lys Val Ala Val 245 250 255 Gln Arg Glu Leu His Lys Ala Asp Ser Asp Arg Ser Cys Ile His Leu 260 265 270 Glu Phe Asp Ile Ser Gly Thr Gly Leu Met Tyr Glu Thr Gly Asp His 275 280 285 Val Gly Val Tyr Ala Glu Asn Cys Val Glu Thr Val Glu Glu Ala Gly 290 295 300 Lys Leu Leu Gly Gln Pro Leu Asp Leu Leu Phe Ser Val His Thr Asp 305 310 315 320 Lys Asp Asp Gly Thr Ser Leu Glu Ser Ser Leu Pro Pro Pro Phe Pro 325 330 335 Gly Pro Cys Thr Leu Arg Thr Ala Leu Phe Gln Tyr Ala Asp Leu Leu 340 345 350 Asn Pro Pro Arg Lys Ala Ala Leu Val Ala Leu Ala Ala His Ala Val 355 360 365 Glu Pro Ser Glu Ala Asp Arg Leu Lys Phe Leu Ser Ser Pro Gln Gly 370 375 380 Lys Asp Glu Tyr Ala Lys Trp Val Val Gly Ser Gln Arg Ser Leu Leu 385 390 395 400 Glu Val Met Ala Glu Phe Pro Ser Ile Lys Val Pro Leu Gly Val Phe 405 410 415 Phe Ala Ala Val Ala Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser 420 425 430 Ser Ser Pro Arg Phe Ser Ser Asp Arg Val His Val Thr Cys Ala Leu 435 440 445 Val Tyr Gly Pro Ser Pro Thr Gly Arg Ile His Arg Gly Val Cys Ser 450 455 460 Thr Trp Met Lys Asn Ala Val Pro Leu Glu Glu Ser Arg Glu Cys Ser 465 470 475 480 Trp Ala Pro Ile Phe Ile Arg Thr Ser Asn Phe Lys Leu Pro Ala Asn 485 490 495 Pro Ser Thr Pro Val Ile Met Val Gly Pro Gly Thr Gly Leu Ala Pro 500 505 510 Phe Arg Gly Phe Leu Gln Glu Arg Met Ala Leu Leu Glu Gly Gly Ala 515 520 525 Gln Leu Gly Pro Ala Leu Leu Phe Phe Gly Cys Arg Asn Arg Arg Met 530 535 540 Asp Phe Ile Tyr Glu Asp Glu Leu Asn Asn Phe Val Glu Gln Gly Val 545 550 555 560 Ile Ser Glu Leu Ile Val Ala Phe Ser Arg Asp Gly Pro Thr Lys Glu 565 570 575 Tyr Val Gln His Lys Met Met Asp Lys Ala Ala Tyr Ile Trp Ser Leu 580 585 590 Ile Ser Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met 595 600 605 Ala Arg Asp Val His Arg Thr Leu His Thr Leu Val Gln Gln Gln Glu 610 615 620 Ser Val Asp Ser Ser Lys Ala Glu Ser Ile Val Lys Lys Leu Gln Met 625 630 635 640 Asp Gly Arg Tyr Leu Arg Asp Val Trp 645 <210> SEQ ID NO 15 <211> LENGTH: 645 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 truncated <400> SEQUENCE: 15 Met Arg Phe Ser Ser Ser Gln Lys Ala Val Ala Ala Ala Lys Gly Val 1 5 10 15 Glu Val Ala Arg Lys Pro Val Ile Gly Lys Glu Ser Glu Ala Ala Glu 20 25 30 Val Asp Asp Gly Lys Lys Lys Val Thr Ile Phe Phe Gly Thr Gln Thr 35 40 45 Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala 50 55 60 Arg Tyr Glu Lys Ala Ile Phe Lys Leu Val Asp Leu Asp Asp Tyr Ala 65 70 75 80 Ala Glu Asp Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Lys Phe Ala 85 90 95 Leu Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala 100 105 110 Ala Arg Phe Tyr Lys Trp Phe Thr Glu Glu Asn Glu Ser Gly Glu Trp 115 120 125 Leu Gln Lys Leu Gln Phe Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr 130 135 140 Glu His Phe Asn Lys Val Ala Lys Val Val Asp Glu Ile Leu Ala Glu 145 150 155 160 Gln Gly Gly Lys Arg Leu Val Pro Val Gly Leu Gly Asp Asp Asp Gln 165 170 175 Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu 180 185 190 Leu Asp Lys Leu Leu Leu Asp Glu Asp Asp Ala Thr Val Ser Thr Pro 195 200 205 Tyr Thr Ala Ser Val Pro Glu Tyr Arg Val Val Phe His Asp Ser Pro 210 215 220 Asp Asp Tyr Leu Gln Lys Asn Ser Ser Asn Ala Asn Gly His Ser Met 225 230 235 240 His Asp Ala Gln His Pro Cys Arg Ala Asn Val Ala Val Arg Arg Glu 245 250 255 Leu His Ser Pro Leu Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp 260 265 270 Ile Ala Gly Thr Gly Leu Ala Tyr Glu Thr Gly Asp His Val Gly Val 275 280 285 Cys Cys Glu Asn Leu Pro Glu Val Val Glu Glu Ala Glu Arg Val Leu 290 295 300 Gly Leu Ser Pro Gly Ile Tyr Phe Ser Ile His Ala Asp Lys Glu Asp 305 310 315 320 Gly Thr Pro Leu Gly Ser Ser Leu Pro Pro Leu Phe Pro Pro Cys Thr 325 330 335 Leu Arg Thr Ala Leu Thr Gln His Ala Asp Leu Leu Ser Phe Pro Lys 340 345 350 Lys Ala Ala Leu Leu Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu 355 360 365 Ala Asp Arg Leu Lys Tyr Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr 370 375 380 Ala Gln Trp Val Val Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala 385 390 395 400 Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Leu Phe Ala Ala Val 405 410 415 Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser Ser Pro Lys 420 425 430 Ile Ala Pro Ser Arg Ile His Val Thr Cys Ala Leu Val Tyr Asp Lys 435 440 445 Thr Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met Lys 450 455 460 Asn Ala Met Pro Arg Glu Glu Ser His Asp Cys Ser Trp Ala Pro Ile 465 470 475 480 Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asn Thr Ser Val Pro 485 490 495 Val Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe 500 505 510 Leu Gln Glu Arg Leu Ala Leu Lys Glu Ala Gly Val Glu Leu Gly Pro 515 520 525 Ala Ile Leu Phe Phe Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr 530 535 540 Glu Asp Glu Leu Ala His Phe Val Glu Ala Gly Ala Leu Ser Glu Leu 545 550 555 560 Ile Val Ala Phe Ser Arg Glu Gly Pro Ala Lys Gln Tyr Val Gln His 565 570 575 Lys Met Met Glu Lys Ala Ser Glu Ile Trp Asn Met Ile Ser Asp Gly 580 585 590 Gly Tyr Val Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val 595 600 605 His Arg Ala Leu His Thr Ile Val His Glu Gln Gly Ser Leu Asp Asn 610 615 620 Ser Lys Thr Glu Ser Met Val Lys Asn Leu Gln Met Asn Gly Arg Tyr 625 630 635 640 Leu Arg Asp Val Trp 645 <210> SEQ ID NO 16 <211> LENGTH: 1710 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Santalene synthase (SaSSY) <400> SEQUENCE: 16 atggattctt ccaccgccac cgccatgaca gctccattca ttgatcctac tgatcatgtg 60 aatctcaaaa ctgatacgga tgcctcagag aatcgaagga tgggaaatta taaacccagc 120 atttggaatt atgatttttt acaatcactt gcaactcatc acaatattgt ggaagagagg 180 catctaaagc tagctgagaa gctgaagggc caagtgaagt ttatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggcttgggct aaaccaccta 300 tttgagacag agatcaagga agcgctgttt agtatttaca aggatgggag caatggatgg 360 tggtttggcc accttcatgc gacatctctc cgatttaggc tgctacgaca gtgtgggctt 420 tttattcccc aagatgtgtt taaaacgttc caaaacaaga ctggggaatt tgatatgaaa 480 ctttgtgaca acgtaaaagg gctgctgagc ttatatgaag cttcatactt gggatggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcaccacca agtgcttgaa aagtgcatgg 600 gaaaatatat ccgaaaagtg gttagccaaa agagtgaagc atgcattggc tttgcctttg 660 cattggagag tccctcgaat cgaagctaga tggttcattg aggcatatga gcaagaagcg 720 aatatgaacc caacactact caaactcgca aaattagact ttaatatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcca ggaataattt actgcagagc tatatgtgga gctgcgcgat tgcttccgac 900 ccgaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtt 960 gacgatggat atgacgtcta tggttcaatc gacgaacttg atctctacac aagctccgtt 1020 gaaaggtgga gctgtgtgga aattgacaag ttgccaaaca cgttaaaatt aatttttatg 1080 tctatgttca acaagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaat 1140 agcatcccta cttttatcaa agcgtgggtt gaacagtgta aatcatacca gaaagaagca 1200 agatggttcc acgggggaca cacgcctcca ttggaagaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttaatcacg ggctacgtgg caatcgctga gaacgaggct 1320 gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg atataggaac gtctccggat gagatggcaa gaggcgataa tctgaagtca 1440 atccattgtt acatgaacga aactggggct tccgaggaag ttgctcgtga gcacataaag 1500 ggagtaatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacggatagc tggacaaagg ttgatatgaa gtccgttttg 1680 atcgacccta ttcctctcgg cgaggagtag 1710 <210> SEQ ID NO 17 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Santalene synthase (SaSSY) <400> SEQUENCE: 17 Met Asp Ser Ser Thr Ala Thr Ala Met Thr Ala Pro Phe Ile Asp Pro 1 5 10 15 Thr Asp His Val Asn Leu Lys Thr Asp Thr Asp Ala Ser Glu Asn Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45 Ser Leu Ala Thr His His Asn Ile Val Glu Glu Arg His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Lys Phe Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Leu Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Ile 100 105 110 Tyr Lys Asp Gly Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Asn Lys Thr Gly Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Val Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Tyr 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Thr 180 185 190 Thr Lys Cys Leu Lys Ser Ala Trp Glu Asn Ile Ser Glu Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Ala 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Gly Tyr Asp Val Tyr Gly Ser Ile Asp Glu Leu Asp Leu Tyr 325 330 335 Thr Ser Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Ser Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Glu Gln Cys Lys Ser Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Phe His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Val Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Ile Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Glu Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Val Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 18 <211> LENGTH: 1029 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Farnesyl diphosphate synthase (SaFPPS) <400> SEQUENCE: 18 atgggcgatc ggaaaaccaa atttctcgag gcctactctg tcttgaaatc ggagctcctc 60 cgggaccctg ctttcaattt tacagacgct tcccgtcaat gggtcgaccg gatgctggac 120 tacaatgtgc ctggagggaa actgaatcga gggctctcag tgattgacag ctatgagttg 180 ctgaaagaag gaaaagagct aactgatgat gaaatatttc ttgcatctgc actcggttgg 240 tgcattgaat ggcttcaagc atattttctt gttctcgatg atattatgga tggctctcat 300 acacgccgag gtcagccttg ttggttcagg ttgcctgagg ttggtctgat tgctgtaaat 360 gatggcataa tgcttcgcaa ccacatccca agaattctca agaagcactt caaaaataag 420 ccttattatg tggaactgtt ggatttattt aatgaggtcg agttccaaac aacttcagga 480 cagatgatag atttgataac cacgcttgaa gggcagaaag atctttcaaa gtattcaatg 540 cctattcacc atcgcattgt tcagtataaa actgcttatt actcctttta ccttccggtt 600 gcttgtgcac tgcttatgtc aggtgagaat ctggacagcc acactgaagt ggagaaaatc 660 cttgttgaaa tgggaaccta ttttcaagta caggatgatt acctggactg ctttggtcat 720 cctgatgtca ttggaaagat tggaacagat attgaagatt ttaagtgttc ttggttggtt 780 gtaaaagcgt tggaactttc caacgaggaa cagaagaaat tattatatga gaactatggg 840 aaagccgatg aagccagcgt tgcaaaagta aaggcacttt ataaggaact tgaccttgag 900 ggtgcatttg tggagtacga gaatgctagt tatgagaaga taatcagctc aattgaggtg 960 cagccaagca aagcagtaca agcagtgctg aaatcctttt tggcgaagat atacaagcgg 1020 cagaagtag 1029 <210> SEQ ID NO 19 <211> LENGTH: 342 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Farnesyl diphosphate synthase (SaFPPS) <400> SEQUENCE: 19 Met Gly Asp Arg Lys Thr Lys Phe Leu Glu Ala Tyr Ser Val Leu Lys 1 5 10 15 Ser Glu Leu Leu Arg Asp Pro Ala Phe Asn Phe Thr Asp Ala Ser Arg 20 25 30 Gln Trp Val Asp Arg Met Leu Asp Tyr Asn Val Pro Gly Gly Lys Leu 35 40 45 Asn Arg Gly Leu Ser Val Ile Asp Ser Tyr Glu Leu Leu Lys Glu Gly 50 55 60 Lys Glu Leu Thr Asp Asp Glu Ile Phe Leu Ala Ser Ala Leu Gly Trp 65 70 75 80 Cys Ile Glu Trp Leu Gln Ala Tyr Phe Leu Val Leu Asp Asp Ile Met 85 90 95 Asp Gly Ser His Thr Arg Arg Gly Gln Pro Cys Trp Phe Arg Leu Pro 100 105 110 Glu Val Gly Leu Ile Ala Val Asn Asp Gly Ile Met Leu Arg Asn His 115 120 125 Ile Pro Arg Ile Leu Lys Lys His Phe Lys Asn Lys Pro Tyr Tyr Val 130 135 140 Glu Leu Leu Asp Leu Phe Asn Glu Val Glu Phe Gln Thr Thr Ser Gly 145 150 155 160 Gln Met Ile Asp Leu Ile Thr Thr Leu Glu Gly Gln Lys Asp Leu Ser 165 170 175 Lys Tyr Ser Met Pro Ile His His Arg Ile Val Gln Tyr Lys Thr Ala 180 185 190 Tyr Tyr Ser Phe Tyr Leu Pro Val Ala Cys Ala Leu Leu Met Ser Gly 195 200 205 Glu Asn Leu Asp Ser His Thr Glu Val Glu Lys Ile Leu Val Glu Met 210 215 220 Gly Thr Tyr Phe Gln Val Gln Asp Asp Tyr Leu Asp Cys Phe Gly His 225 230 235 240 Pro Asp Val Ile Gly Lys Ile Gly Thr Asp Ile Glu Asp Phe Lys Cys 245 250 255 Ser Trp Leu Val Val Lys Ala Leu Glu Leu Ser Asn Glu Glu Gln Lys 260 265 270 Lys Leu Leu Tyr Glu Asn Tyr Gly Lys Ala Asp Glu Ala Ser Val Ala 275 280 285 Lys Val Lys Ala Leu Tyr Lys Glu Leu Asp Leu Glu Gly Ala Phe Val 290 295 300 Glu Tyr Glu Asn Ala Ser Tyr Glu Lys Ile Ile Ser Ser Ile Glu Val 305 310 315 320 Gln Pro Ser Lys Ala Val Gln Ala Val Leu Lys Ser Phe Leu Ala Lys 325 330 335 Ile Tyr Lys Arg Gln Lys 340 <210> SEQ ID NO 20 <211> LENGTH: 4160 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pDNR-LIB vector <400> SEQUENCE: 20 gcggccgcat aacttcgtat agcatacatt atacgaagtt atcagtcgac ggtaccggac 60 atatgcccgg gaattcggcc attacggcct gcaggatccg aaaaaacctc ccacacctcc 120 ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 180 ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 240 tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggatccggc 300 cgcctcggcc ctcgagaagc tttctagacc attcgtttgg cgcgcgggcc cagtaggtaa 360 gtgaacatgg tcatagctgt ttccctagga gatcctggta tgactagtgc ttggattctc 420 accaataaaa aacgcccggc ggcaaccgag cgttctgaac aaatccagat ggagttctga 480 ggtcattact ggatctatca acaggagtcc aagcgagctc gatatcaaat tacgccccgc 540 cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca tggaagccat 600 cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg ccttgcgtat 660 aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc acgtttaaat 720 caaaactggt gaaactcacc cagggattgg ctgagacgaa aaacatattc tcaataaacc 780 ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa tatatgtgta 840 gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt tcagtttgct 900 catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca ccgtctttca 960 ttgccatacg aaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg 1020 gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa 1080 cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat 1140 gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct 1200 tagctcctga aagatccata acttcgtata gcatacatta tacgaagtta tgcggccgcg 1260 acgtcaatgc caataggata tcggcatttt cttttgcgtt tttatttgtt aactgttaat 1320 tgtccttgtt caaggatgct gtctttgaca acagatgttt tcttgccttt gatgttcagc 1380 aggaagctag gcgcaaacgt tgattgtttg tctgcgtaga atcctctgtt tgtcatatag 1440 cttgtaatca cgacattgtt tcctttcgct tgaggtacag cgaagtgtga gtaagtaaag 1500 gttacatcgt taggatcaag atccattttt aacacaaggc cagttttgtt cagcggcttg 1560 tatgggccag ttaaagaatt agaaacataa ccaagcatgt aaatatcgtt agacgtaatg 1620 ccgtcaatcg tcatttttga tccgcgggag tcagtgaaca ggtaccattt gccgttcatt 1680 ttaaagacgt tcgcgcgttc aatttcatct gttactgtgt tagatgcaat cagcggtttc 1740 atcacttttt tcagtgtgta atcatcgttt agctcaatca taccgagagc gccgtttgct 1800 aactcagccg tgcgtttttt atcgctttgc agaagttttt gactttcttg acggaagaat 1860 gatgtgcttt tgccatagta tgctttgtta aataaagatt cttcgccttg gtagccatct 1920 tcagttccag tgtttgcttc aaatactaag tatttgtggc ctttatcttc tacgtagtga 1980 ggatctctca gcgtatggtt gtcgcctgag ctgtagttgc cttcatcgat gaactgctgt 2040 acattttgat acgtttttcc gtcaccgtca aagattgatt tataatcctc tacaccgttg 2100 atgttcaaag agctgtctga tgctgatacg ttaacttgtg cagttgtcag tgtttgtttg 2160 ccgtaatgtt taccggagaa atcagtgtag aataaacgga tttttccgtc agatgtaaat 2220 gtggctgaac ctgaccattc ttgtgtttgg tcttttagga tagaatcatt tgcatcgaat 2280 ttgtcgctgt ctttaaagac gcggccagcg tttttccagc tgtcaataga agtttcgccg 2340 actttttgat agaacatgta aatcgatgtg tcatccgcat ttttaggatc tccggctaat 2400 gcaaagacga tgtggtagcc gtgatagttt gcgacagtgc cgtcagcgtt ttgtaatggc 2460 cagctgtccc aaacgtccag gccttttgca gaagagatat ttttaattgt ggacgaatcg 2520 aactcaggaa cttgattttt tcattttttt gctgttcagg gatttgcagc atatcatggc 2580 gtgtaatatg ggaaatgccg tatgtttcct tatatggctt ttggttcgtt tctttcgcaa 2640 acgcttgagt tgcgcctcct gccagcagtg cggtagtaaa ggttaatact gttgcttgtt 2700 ttgcaaactt tttgatgttc atcgttcatg tctccttttt tatgtactgt gttagcggtc 2760 tgcttcttcc agccctcctg tttgaagatg gcaagttagt tacgcacaat aaaaaaagac 2820 ctaaaatatg taaggggtga cgccaaagta tacactttgc cctttacaca ttttaggtct 2880 tgcctgcttt atcagtaaca aacccgcgcg atttactttt cgacctcatt ctattagact 2940 ctcgtttgga ttgcaactgg tctattttcc tcttttgttt gatagaaaat cataaaagga 3000 tttgcagact acgggcctaa agaactaaaa aatctatctg tttcttttca ttctctgtat 3060 tttttatagt ttctgttgca tgggcataaa gttgcctttt taatcacaat tcagaaaata 3120 tcataatatc tcatttcact aaataatagt gaacggcagg tatatgtggc gcgcctaagc 3180 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 3240 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 3300 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 3360 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 3420 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 3480 gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc caccacttca 3540 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 3600 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 3660 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 3720 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 3780 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 3840 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 3900 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 3960 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 4020 tatcccctga ttctgtggat aaccgtatta ccgccttacg cgtgtaaaac gacggccagt 4080 agatctgtaa tacgactcac tatagggcgc tagctcgccg cagccgaacg accgagcgca 4140 gcgagtcagt gagcgaggaa 4160 <210> SEQ ID NO 21 <211> LENGTH: 2974 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pJET1.2 vector <400> SEQUENCE: 21 gcccctgcag ccgaattata ttatttttgc caaataattt ttaacaaaag ctctgaagtc 60 ttcttcattt aaattcttag atgatacttc atctggaaaa ttgtcccaat tagtagcatc 120 acgctgtgag taagttctaa accatttttt tattgttgta ttatctctaa tcttactact 180 cgatgagttt tcggtattat ctctattttt aacttggagc aggttccatt cattgttttt 240 ttcatcatag tgaataaaat caactgcttt aacacttgtg cctgaacacc atatccatcc 300 ggcgtaatac gactcactat agggagagcg gccgccagat cttccggatg gctcgagttt 360 ttcagcaaga tatctttcta gaagatctcc tacaatattc tcagctgcca tggaaaatcg 420 atgttcttct tttattctct caagattttc aggctgtata ttaaaactta tattaagaac 480 tatgctaacc acctcatcag gaaccgttgt aggtggcgtg ggttttcttg gcaatcgact 540 ctcatgaaaa ctacgagcta aatattcaat atgttcctct tgaccaactt tattctgcat 600 tttttttgaa cgaggtttag agcaagcttc aggaaactga gacaggaatt ttattaaaaa 660 tttaaatttt gaagaaagtt cagggttaat agcatccatt ttttgctttg caagttcctc 720 agcattctta acaaaagacg tctcttttga catgtttaaa gtttaaacct cctgtgtgaa 780 attgttatcc gctcacaatt ccacacatta tacgagccgg aagcataaag tgtaaagcct 840 ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg ccaattgctt 900 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 960 gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 1020 ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 1080 caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 1140 aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 1200 atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 1260 cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 1320 ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 1380 gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 1440 accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 1500 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 1560 cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 1620 gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 1680 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 1740 aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 1800 actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 1860 taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 1920 gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 1980 tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 2040 ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 2100 accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 2160 agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 2220 acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 2280 tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 2340 cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 2400 tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 2460 ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 2520 gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 2580 tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 2640 ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 2700 gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 2760 cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 2820 gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 2880 ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 2940 cattaaccta taaaaatagg cgtatcacga ggcc 2974 <210> SEQ ID NO 22 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 1 Forward Primer <400> SEQUENCE: 22 atggacttct taagttttat cctgtttg 28 <210> SEQ ID NO 23 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 1 Reverse Primer <400> SEQUENCE: 23 ttacccccgg atcgggacag 20 <210> SEQ ID NO 24 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 2 Forward Primer <400> SEQUENCE: 24 atggacttct taagttgtat cctg 24 <210> SEQ ID NO 25 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 2 Reverse Primer <400> SEQUENCE: 25 ttacccccgg attgggacag 20 <210> SEQ ID NO 26 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Vitis vinifera <220> FEATURE: <223> OTHER INFORMATION: putative cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: XP_002281735 <309> DATABASE ENTRY DATE: 2011-12-07 <400> SEQUENCE: 26 Met Glu Leu Leu Ser Cys Leu Leu Cys Phe Leu Ala Ala Trp Thr Ser 1 5 10 15 Ile Tyr Ile Met Phe Ser Ala Arg Arg Gly Arg Lys His Ala Ala His 20 25 30 Lys Leu Pro Pro Gly Pro Val Pro Leu Pro Ile Ile Gly Ser Leu Leu 35 40 45 Asn Leu Gly Asn Arg Pro His Glu Ser Leu Ala Asn Leu Ala Lys Thr 50 55 60 Tyr Gly Pro Ile Met Thr Leu Lys Leu Gly Tyr Val Thr Thr Ile Val 65 70 75 80 Ile Ser Ser Ala Pro Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu 85 90 95 Ser Phe Cys Asn Arg Ser Ile Pro Asp Ala Ile Arg Ala Ala Lys His 100 105 110 Asn Gln Leu Ser Met Ala Trp Leu Pro Val Ser Thr Thr Trp Arg Ala 115 120 125 Leu Arg Arg Thr Cys Asn Ser His Leu Phe Thr Pro Gln Lys Leu Asp 130 135 140 Ser Asn Thr His Leu Arg His Gln Lys Val Gln Glu Leu Leu Ala Asn 145 150 155 160 Val Glu Gln Ser Cys Gln Ala Gly Gly Pro Val Asp Ile Gly Gln Glu 165 170 175 Ala Phe Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Ile Phe Ser Val 180 185 190 Asp Leu Val Asp Pro Ile Ser Glu Thr Ala Gln Glu Phe Lys Glu Leu 195 200 205 Val Arg Gly Val Met Glu Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Ile Asp Pro Gln Ser Ile Arg Arg Arg Leu 225 230 235 240 Thr Ile Tyr Phe Gly Arg Met Ile Glu Ile Phe Asp Arg Met Ile Lys 245 250 255 Gln Arg Leu Gln Leu Arg Lys Asn Gln Gly Ser Ile Ala Ser Ser Asp 260 265 270 Val Leu Asp Val Leu Leu Asn Ile Ser Glu Asp Asn Ser Ser Glu Ile 275 280 285 Glu Arg Ser His Met Glu His Leu Leu Leu Asp Leu Phe Ala Ala Gly 290 295 300 Thr Asp Thr Thr Ser Ser Thr Leu Glu Trp Ala Met Ala Glu Leu Leu 305 310 315 320 His Asn Pro Glu Thr Leu Leu Lys Ala Arg Met Glu Leu Leu Gln Thr 325 330 335 Ile Gly Gln Asp Lys Gln Val Lys Glu Ser Asp Ile Ser Arg Leu Pro 340 345 350 Tyr Leu Gln Ala Val Val Lys Glu Thr Phe Arg Leu His Pro Ala Val 355 360 365 Pro Phe Leu Leu Pro Arg Arg Val Glu Gly Asp Ala Asp Ile Asp Gly 370 375 380 Phe Ala Val Pro Lys Asn Ala Gln Val Leu Val Asn Ala Trp Ala Ile 385 390 395 400 Gly Arg Asp Pro Asn Thr Trp Glu Asn Pro Asn Ser Phe Val Pro Glu 405 410 415 Arg Phe Leu Gly Leu Asp Met Asp Val Lys Gly Gln Asn Phe Glu Leu 420 425 430 Ile Pro Phe Gly Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala 435 440 445 Ile Arg Met Val His Leu Met Leu Ala Ser Leu Ile His Ser Tyr Asp 450 455 460 Trp Lys Leu Glu Asp Gly Val Thr Pro Glu Asn Met Asn Met Glu Glu 465 470 475 480 Arg Tyr Gly Ile Ser Leu Gln Lys Ala Gln Pro Leu Gln Ala Leu Pro 485 490 495 Val Arg Val <210> SEQ ID NO 27 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAC80883 <309> DATABASE ENTRY DATE: 2001-11-22 <400> SEQUENCE: 27 Met Asp Tyr Leu Thr Ile Ile Leu Thr Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Tyr Glu Ala Phe Ser Tyr Leu Ser Arg Arg Thr Lys Asn Leu Pro Pro 20 25 30 Gly Pro Ser Pro Leu Pro Phe Ile Gly Ser Leu His Leu Leu Gly Asp 35 40 45 Gln Pro His Lys Ser Leu Ala Lys Leu Ser Lys Lys His Gly Pro Ile 50 55 60 Met Ser Leu Lys Leu Gly Gln Ile Thr Thr Ile Val Ile Ser Ser Ser 65 70 75 80 Thr Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe Ser Ser 85 90 95 Arg Ser Val Pro Asn Ala Leu His Ala His Asn Gln Phe Lys Phe Ser 100 105 110 Val Val Trp Leu Pro Val Ala Ser Arg Trp Arg Ser Leu Arg Lys Val 115 120 125 Leu Asn Ser Asn Ile Phe Ser Gly Asn Arg Leu Asp Ala Asn Gln His 130 135 140 Leu Arg Thr Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg Lys Asn 145 150 155 160 Ser Gln Ser Gly Glu Ala Val Asp Val Gly Arg Ala Ala Phe Arg Thr 165 170 175 Ser Leu Asn Leu Leu Ser Asn Leu Ile Phe Ser Lys Asp Leu Thr Asp 180 185 190 Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp Asn Ile 195 200 205 Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Phe Phe Pro Leu Leu 210 215 220 Glu Lys Val Asp Pro Gln Gly Ile Arg His Arg Met Thr Ile His Phe 225 230 235 240 Gly Glu Val Leu Lys Leu Phe Gly Gly Leu Val Asn Glu Arg Leu Glu 245 250 255 Gln Arg Arg Ser Lys Gly Glu Lys Asn Asp Val Leu Asp Val Leu Leu 260 265 270 Thr Thr Ser Gln Glu Ser Pro Glu Glu Ile Asp Arg Thr His Ile Glu 275 280 285 Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ser 290 295 300 Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Asp Lys Met 305 310 315 320 Lys Lys Thr Gln Asp Glu Leu Ala Gln Val Ile Gly Arg Gly Lys Thr 325 330 335 Ile Glu Glu Ser Asp Ile Asn Arg Leu Pro Tyr Leu Arg Cys Val Met 340 345 350 Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Phe Leu Ile Pro Arg 355 360 365 Lys Val Glu Gln Ser Val Glu Val Cys Gly Tyr Asn Val Pro Lys Gly 370 375 380 Ser Gln Val Leu Val Asn Ala Trp Ala Ile Gly Arg Asp Glu Thr Val 385 390 395 400 Trp Asp Asp Ala Leu Ala Phe Lys Pro Glu Arg Phe Met Glu Ser Glu 405 410 415 Leu Asp Ile Arg Gly Arg Asp Phe Glu Leu Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Leu Arg Thr Val Pro Leu 435 440 445 Met Leu Gly Ser Leu Leu Asn Ser Phe Asn Trp Lys Leu Glu Gly Gly 450 455 460 Met Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile Thr Leu 465 470 475 480 Gln Lys Ala His Pro Leu Arg Ala Val Pro Ser Thr Leu 485 490 <210> SEQ ID NO 28 <211> LENGTH: 477 <212> TYPE: PRT <213> ORGANISM: Helianthus tuberosus <220> FEATURE: <223> OTHER INFORMATION: CYP76B1 7-ethoxycoumarin O-deethylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAA71178 <309> DATABASE ENTRY DATE: 1997-12-12 <400> SEQUENCE: 28 His Glu Trp Val Leu Gly Val Gly Lys Pro Lys Asn Leu Pro Pro Gly 1 5 10 15 Pro Thr Arg Leu Pro Ile Ile Gly Asn Leu His Leu Leu Gly Ala Leu 20 25 30 Pro His Gln Ser Leu Ala Lys Leu Ala Lys Ile His Gly Pro Ile Met 35 40 45 Ser Leu Gln Leu Gly Gln Ile Thr Thr Leu Val Ile Ser Ser Ala Thr 50 55 60 Ala Ala Glu Glu Val Leu Lys Lys Gln Asp Leu Ala Phe Ser Thr Arg 65 70 75 80 Asn Val Pro Asp Ala Val Arg Ala Tyr Asn His Glu Arg His Ser Ile 85 90 95 Ser Phe Leu His Val Cys Thr Glu Trp Arg Thr Leu Arg Arg Ile Val 100 105 110 Ser Ser Asn Ile Phe Ser Asn Ser Ser Leu Glu Ala Lys Gln His Leu 115 120 125 Arg Ser Lys Lys Val Glu Glu Leu Ile Ala Tyr Cys Arg Lys Ala Ala 130 135 140 Leu Ser Asn Glu Asn Val His Ile Gly Arg Ala Ala Phe Arg Thr Ser 145 150 155 160 Leu Asn Leu Leu Ser Asn Thr Ile Phe Ser Lys Asp Leu Thr Asp Pro 165 170 175 Tyr Glu Asp Ser Ala Ser Gly Lys Glu Phe Arg Glu Val Ile Thr Asn 180 185 190 Ile Met Val Asp Ser Ala Lys Thr Asn Leu Val Asp Val Phe Pro Val 195 200 205 Leu Lys Arg Ile Asp Pro Gln Gly Ile Lys Arg Gly Met Ala Arg His 210 215 220 Phe Ser Lys Val Leu Gly Ile Phe Asp Gln Leu Ile Glu Glu Arg Met 225 230 235 240 Arg Thr Gly Arg Phe Glu Gln Gly Asp Val Leu Asp Val Cys Leu Lys 245 250 255 Met Met Gln Asp Asn Pro Asn Glu Phe Asn His Thr Asn Ile Lys Ala 260 265 270 Leu Phe Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ile Thr 275 280 285 Ile Glu Trp Ala Met Thr Glu Leu Leu Arg Lys Pro His Ile Met Ser 290 295 300 Lys Ala Lys Glu Glu Leu Glu Lys Val Ile Gly Lys Gly Ser Ile Val 305 310 315 320 Lys Glu Asp Asp Val Leu Arg Leu Pro Tyr Leu Ser Cys Ile Val Lys 325 330 335 Glu Val Leu Arg Leu His Pro Pro Ser Pro Leu Leu Leu Pro Arg Lys 340 345 350 Val Val Thr Gln Val Glu Leu Ser Gly Tyr Thr Ile Pro Ala Gly Thr 355 360 365 Leu Val Phe Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Thr Val Trp 370 375 380 Asp Asp Ser Leu Glu Phe Lys Pro Gln Arg Phe Leu Glu Ser Arg Leu 385 390 395 400 Asp Val Arg Gly His Asp Phe Asp Leu Ile Pro Phe Gly Ala Gly Arg 405 410 415 Arg Ile Cys Pro Gly Ile Pro Leu Ala Thr Arg Met Val Pro Ile Met 420 425 430 Leu Gly Ser Leu Leu Asn Asn Phe Asp Trp Lys Ile Asp Thr Lys Val 435 440 445 Pro Tyr Asp Val Leu Asp Met Thr Glu Lys Asn Gly Thr Thr Ile Ser 450 455 460 Lys Ala Lys Pro Leu Cys Val Val Pro Ile Pro Leu Asn 465 470 475 <210> SEQ ID NO 29 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Swertia mussotii <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol 10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ACZ48680 <309> DATABASE ENTRY DATE: 2010-09-02 <400> SEQUENCE: 29 Met Asp Phe Asp Phe Leu Thr Ile Ala Ile Gly Phe Leu Phe Thr Ile 1 5 10 15 Thr Leu Tyr Gln Ala Leu Asn Phe Phe Ser Arg Lys Ser Lys Asn Leu 20 25 30 Pro Pro Gly Pro Ser Pro Leu Pro Leu Ile Gly Asn Leu His Leu Leu 35 40 45 Gly Asp Gln Pro His Lys Ser Leu Ala Lys Leu Ala Lys Lys His Gly 50 55 60 Pro Ile Met Gly Leu Gln Leu Gly Gln Val Thr Thr Ile Val Val Thr 65 70 75 80 Ser Ser Gly Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe 85 90 95 Ser Ser Arg Ser Ile Pro Asn Ala Ile His Ala His Asp Gln Tyr Lys 100 105 110 Tyr Ser Val Ile Trp Leu Pro Val Ala Ser Arg Trp Arg Gly Leu Arg 115 120 125 Lys Ala Leu Asn Ser Asn Met Phe Ser Gly Asn Arg Leu Asp Ala Asn 130 135 140 Gln His Leu Arg Ser Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg 145 150 155 160 Lys Ser Ser Gln Thr Gly Asp Ala Ile Asp Val Gly Arg Ala Ala Phe 165 170 175 Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Met Phe Ser Lys Asp Leu 180 185 190 Thr Asp Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp 195 200 205 Asn Val Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr Phe Pro 210 215 220 Leu Leu Asp Lys Val Asp Pro Gln Gly Ile Arg Lys Arg Met Thr Ile 225 230 235 240 His Phe Gly Lys Ile Leu Glu Leu Phe Gly Gly Leu Ile Asp Glu Arg 245 250 255 Leu Gln Gln Lys Lys Ala Lys Gly Val Asn Asp Asp Val Leu Asp Val 260 265 270 Leu Leu Thr Thr Ser Glu Glu Ser Pro Glu Glu Ile Asp Arg Thr His 275 280 285 Ile Gln Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr 290 295 300 Ser Ser Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Glu 305 310 315 320 Lys Met Lys Ala Ala Gln Ala Glu Leu Ala Gln Val Ile Gly Lys Gly 325 330 335 Lys Ala Val Glu Glu Ala Asp Leu Ala Arg Leu Pro Tyr Leu Arg Cys 340 345 350 Ala Ile Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Leu Leu Ile 355 360 365 Pro Arg Arg Thr Glu Gln Glu Val Glu Val Cys Gly Tyr Thr Val Pro 370 375 380 Lys Asn Ser Gln Val Leu Val Asn Val Trp Ala Ile Ser Arg Asp Asp 385 390 395 400 Ala Ile Trp Lys Asp Pro Leu Ser Phe Lys Pro Glu Arg Phe Leu Glu 405 410 415 Ser Glu Leu Glu Met Arg Gly Lys Asp Phe Glu Leu Ile Pro Phe Gly 420 425 430 Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Val Arg Met Val 435 440 445 Pro Val Met Leu Gly Ser Leu Leu Asn Ser Phe Asp Trp Lys Leu Glu 450 455 460 Gly Gly Ile Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile 465 470 475 480 Thr Leu Gln Lys Ala His Pro Leu Arg Ala Val Ala Thr Pro Leu 485 490 495 <210> SEQ ID NO 30 <211> LENGTH: 502 <212> TYPE: PRT <213> ORGANISM: Persea americana <220> FEATURE: <223> OTHER INFORMATION: CYP71A1 cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P24465 <309> DATABASE ENTRY DATE: 2010-11-02 <400> SEQUENCE: 30 Met Ala Ile Leu Val Ser Leu Leu Phe Leu Ala Ile Ala Leu Thr Phe 1 5 10 15 Phe Leu Leu Lys Leu Asn Glu Lys Arg Glu Lys Lys Pro Asn Leu Pro 20 25 30 Pro Ser Pro Pro Asn Leu Pro Ile Ile Gly Asn Leu His Gln Leu Gly 35 40 45 Asn Leu Pro His Arg Ser Leu Arg Ser Leu Ala Asn Glu Leu Gly Pro 50 55 60 Leu Ile Leu Leu His Leu Gly His Ile Pro Thr Leu Ile Val Ser Thr 65 70 75 80 Ala Glu Ile Ala Glu Glu Ile Leu Lys Thr His Asp Leu Ile Phe Ala 85 90 95 Ser Arg Pro Ser Thr Thr Ala Ala Arg Arg Ile Phe Tyr Asp Cys Thr 100 105 110 Asp Val Ala Phe Ser Pro Tyr Gly Glu Tyr Trp Arg Gln Val Arg Lys 115 120 125 Ile Cys Val Leu Glu Leu Leu Ser Ile Lys Arg Val Asn Ser Tyr Arg 130 135 140 Ser Ile Arg Glu Glu Glu Val Gly Leu Met Met Glu Arg Ile Ser Gln 145 150 155 160 Ser Cys Ser Thr Gly Glu Ala Val Asn Leu Ser Glu Leu Leu Leu Leu 165 170 175 Leu Ser Ser Gly Thr Ile Thr Arg Val Ala Phe Gly Lys Lys Tyr Glu 180 185 190 Gly Glu Glu Glu Arg Lys Asn Lys Phe Ala Asp Leu Ala Thr Glu Leu 195 200 205 Thr Thr Leu Met Gly Ala Phe Phe Val Gly Asp Tyr Phe Pro Ser Phe 210 215 220 Ala Trp Val Asp Val Leu Thr Gly Met Asp Ala Arg Leu Lys Arg Asn 225 230 235 240 His Gly Glu Leu Asp Ala Phe Val Asp His Val Ile Asp Asp His Leu 245 250 255 Leu Ser Arg Lys Ala Asn Gly Ser Asp Gly Val Glu Gln Lys Asp Leu 260 265 270 Val Asp Val Leu Leu His Leu Gln Lys Asp Ser Ser Leu Gly Val His 275 280 285 Leu Asn Arg Asn Asn Leu Lys Ala Val Ile Leu Asp Met Phe Ser Gly 290 295 300 Gly Thr Asp Thr Thr Ala Val Thr Leu Glu Trp Ala Met Ala Glu Leu 305 310 315 320 Ile Lys His Pro Asp Val Met Glu Lys Ala Gln Gln Glu Val Arg Arg 325 330 335 Val Val Gly Lys Lys Ala Lys Val Glu Glu Glu Asp Leu His Gln Leu 340 345 350 His Tyr Leu Lys Leu Ile Ile Lys Glu Thr Leu Arg Leu His Pro Val 355 360 365 Ala Pro Leu Leu Val Pro Arg Glu Ser Thr Arg Asp Val Val Ile Arg 370 375 380 Gly Tyr His Ile Pro Ala Lys Thr Arg Val Phe Ile Asn Ala Trp Ala 385 390 395 400 Ile Gly Arg Asp Pro Lys Ser Trp Glu Asn Ala Glu Glu Phe Leu Pro 405 410 415 Glu Arg Phe Val Asn Asn Ser Val Asp Phe Lys Gly Gln Asp Phe Gln 420 425 430 Leu Ile Pro Phe Gly Ala Gly Arg Arg Gly Cys Pro Gly Ile Ala Phe 435 440 445 Gly Ile Ser Ser Val Glu Ile Ser Leu Ala Asn Leu Leu Tyr Trp Phe 450 455 460 Asn Trp Glu Leu Pro Gly Asp Leu Thr Lys Glu Asp Leu Asp Met Ser 465 470 475 480 Glu Ala Val Gly Ile Thr Val His Met Lys Phe Pro Leu Gln Leu Val 485 490 495 Ala Lys Arg His Leu Ser 500 <210> SEQ ID NO 31 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71A32 (+)-pulegone 9-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q947B7 <309> DATABASE ENTRY DATE: 2012-09-05 <400> SEQUENCE: 31 Met Ala Ala Leu Leu Val Phe Phe Ser Val Ser Leu Ile Leu Leu Ala 1 5 10 15 Val Leu Phe His Lys Arg Lys Ser Ser Leu Ser Ser Arg Lys Arg Pro 20 25 30 Pro Pro Ser Pro Leu Arg Leu Pro Val Ile Gly His Phe His Leu Ile 35 40 45 Gly Ala Leu Ser His Arg Ser Phe Thr Ser Leu Ser Lys Arg Tyr Gly 50 55 60 Glu Val Met Leu Leu His Phe Gly Ser Ala Pro Val Leu Val Ala Ser 65 70 75 80 Ser Ala Ala Ala Ala Arg Glu Ile Met Lys Asn Gln Asp Val Ile Phe 85 90 95 Ala Ser Arg Pro Arg Leu Ser Ile Phe Asp Arg Leu Met Tyr Ser Gly 100 105 110 Lys Gly Val Ala Phe Ala Pro Tyr Gly Glu His Trp Arg Asn Ala Arg 115 120 125 Ser Met Cys Met Leu Gln Leu Leu Ser Ala Lys Arg Val Gln Ser Phe 130 135 140 Gly Gly Ile Arg Glu Glu Glu Thr Ser Ala Met Ile Glu Lys Ile Arg 145 150 155 160 Arg Ser Lys Pro Thr Thr Val Val Asn Leu Ser Glu Met Phe Met Ala 165 170 175 Leu Thr Asn Gly Val Ile His Arg Ala Val Leu Gly Arg Lys Gly Asp 180 185 190 Gly Gly Asp Asp Phe Asn Arg Ile Leu Ile Lys Val Ile Lys Leu Leu 195 200 205 Gly Ser Phe Asn Val Gly Asp Tyr Val Pro Trp Leu Ser Trp Ile Asn 210 215 220 Arg Ile Asn Gly Val Asp Ala Glu Val Glu Lys Val Gly Thr Lys Leu 225 230 235 240 Asp Gly Ser Met Glu Gly Ile Leu Arg Lys Tyr Arg Arg Lys Lys Val 245 250 255 Gly Asp Asp Glu Thr Asn Phe Val Asp Thr Leu Leu Gln Phe Gln Arg 260 265 270 Glu Ser Lys Asp Thr Asp Pro Val Glu Asp Asp Val Ile Lys Ala Leu 275 280 285 Ile Phe Asp Met Val Ser Ala Gly Thr Asp Thr Thr Phe Ala Ala Leu 290 295 300 Glu Trp Thr Met Ala Glu Leu Ile Lys Asn Pro Arg Thr Leu Lys Thr 305 310 315 320 Leu Gln Asn Glu Val Arg Glu Val Ser Arg Asn Lys Gly Gly Ile Thr 325 330 335 Glu Asp Asp Val Asp Lys Met Pro Tyr Leu Lys Ala Val Ser Lys Glu 340 345 350 Ile Leu Arg Leu His Pro Pro Phe Ala Ile Leu Leu Pro Arg Glu Leu 355 360 365 Thr Gln Asp Ala Asn Met Leu Gly Tyr Asp Ile Pro Arg Gly Thr Val 370 375 380 Val Leu Val Asn Asn Trp Ala Ile Ser Arg Asp Pro Ser Leu Trp Glu 385 390 395 400 Asn Pro Glu Glu Phe Arg Pro Glu Arg Phe Leu Glu Thr Ser Ile Asp 405 410 415 Tyr Lys Gly Leu His Phe Glu Met Leu Pro Phe Gly Ser Gly Arg Arg 420 425 430 Gly Cys Pro Gly Ser Thr Phe Ala Met Ala Leu Tyr Glu Leu Ala Leu 435 440 445 Ser Lys Leu Val Asn Glu Phe Asp Phe Arg Leu Gly Asn Gly Asp Arg 450 455 460 Ala Glu Asp Leu Asp Met Thr Glu Ala Pro Gly Phe Val Val His Lys 465 470 475 480 Lys Ser Pro Leu Leu Val Leu Ala Thr Pro Arg Gln Ser 485 490 <210> SEQ ID NO 32 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Artemisia annua <220> FEATURE: <223> OTHER INFORMATION: CYP71AV1 amorpha-4,11-diene C-12 oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ABB82944 <309> DATABASE ENTRY DATE: 2006-04-13 <400> SEQUENCE: 32 Met Lys Ser Ile Leu Lys Ala Met Ala Leu Ser Leu Thr Thr Ser Ile 1 5 10 15 Ala Leu Ala Thr Ile Leu Leu Phe Val Tyr Lys Phe Ala Thr Arg Ser 20 25 30 Lys Ser Thr Lys Lys Ser Leu Pro Glu Pro Trp Arg Leu Pro Ile Ile 35 40 45 Gly His Met His His Leu Ile Gly Thr Thr Pro His Arg Gly Val Arg 50 55 60 Asp Leu Ala Arg Lys Tyr Gly Ser Leu Met His Leu Gln Leu Gly Glu 65 70 75 80 Val Pro Thr Ile Val Val Ser Ser Pro Lys Trp Ala Lys Glu Ile Leu 85 90 95 Thr Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr Leu Thr Gly 100 105 110 Glu Ile Val Leu Tyr His Asn Thr Asp Val Val Leu Ala Pro Tyr Gly 115 120 125 Glu Tyr Trp Arg Gln Leu Arg Lys Ile Cys Thr Leu Glu Leu Leu Ser 130 135 140 Val Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu Glu Cys Trp 145 150 155 160 Asn Leu Val Gln Glu Ile Lys Ala Ser Gly Ser Gly Arg Pro Val Asn 165 170 175 Leu Ser Glu Asn Val Phe Lys Leu Ile Ala Thr Ile Leu Ser Arg Ala 180 185 190 Ala Phe Gly Lys Gly Ile Lys Asp Gln Lys Glu Leu Thr Glu Ile Val 195 200 205 Lys Glu Ile Leu Arg Gln Thr Gly Gly Phe Asp Val Ala Asp Ile Phe 210 215 220 Pro Ser Lys Lys Phe Leu His His Leu Ser Gly Lys Arg Ala Arg Leu 225 230 235 240 Thr Ser Leu Arg Lys Lys Ile Asp Asn Leu Ile Asp Asn Leu Val Ala 245 250 255 Glu His Thr Val Asn Thr Ser Ser Lys Thr Asn Glu Thr Leu Leu Asp 260 265 270 Val Leu Leu Arg Leu Lys Asp Ser Ala Glu Phe Pro Leu Thr Ser Asp 275 280 285 Asn Ile Lys Ala Ile Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr 290 295 300 Ser Ser Ser Thr Ile Glu Trp Ala Ile Ser Glu Leu Ile Lys Cys Pro 305 310 315 320 Lys Ala Met Glu Lys Val Gln Ala Glu Leu Arg Lys Ala Leu Asn Gly 325 330 335 Lys Glu Lys Ile His Glu Glu Asp Ile Gln Glu Leu Ser Tyr Leu Asn 340 345 350 Met Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Leu Pro Leu Val 355 360 365 Leu Pro Arg Glu Cys Arg Gln Pro Val Asn Leu Ala Gly Tyr Asn Ile 370 375 380 Pro Asn Lys Thr Lys Leu Ile Val Asn Val Phe Ala Ile Asn Arg Asp 385 390 395 400 Pro Glu Tyr Trp Lys Asp Ala Glu Ala Phe Ile Pro Glu Arg Phe Glu 405 410 415 Asn Ser Ser Ala Thr Val Met Gly Ala Glu Tyr Glu Tyr Leu Pro Phe 420 425 430 Gly Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn 435 440 445 Val Gln Leu Pro Leu Ala Asn Ile Leu Tyr His Phe Asn Trp Lys Leu 450 455 460 Pro Asn Gly Val Ser Tyr Asp Gln Ile Asp Met Thr Glu Ser Ser Gly 465 470 475 480 Ala Thr Met Gln Arg Lys Thr Glu Leu Leu Leu Val Pro Ser Phe 485 490 495 <210> SEQ ID NO 33 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Cichorium intybus <220> FEATURE: <223> OTHER INFORMATION: CYP71AV8 valencene oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADM86719 <309> DATABASE ENTRY DATE: 2011-01-24 <400> SEQUENCE: 33 Met Glu Ile Ser Ile Pro Thr Thr Leu Gly Leu Ala Val Ile Ile Phe 1 5 10 15 Ile Ile Phe Lys Leu Leu Thr Arg Thr Thr Ser Lys Lys Asn Leu Leu 20 25 30 Pro Glu Pro Trp Arg Leu Pro Ile Ile Gly His Met His His Leu Ile 35 40 45 Gly Thr Met Pro His Arg Gly Val Met Glu Leu Ala Arg Lys His Gly 50 55 60 Ser Leu Met His Leu Gln Leu Gly Glu Val Ser Thr Ile Val Val Ser 65 70 75 80 Ser Pro Arg Trp Ala Lys Glu Val Leu Thr Thr Tyr Asp Ile Thr Phe 85 90 95 Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu Ile Val Ala Tyr His Asn 100 105 110 Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg 115 120 125 Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn Lys Lys Val Lys Ser Phe 130 135 140 Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn Leu Val Lys Asp Ile Arg 145 150 155 160 Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys 165 170 175 Met Ile Ala Thr Ile Leu Ser Arg Ala Ala Phe Gly Lys Gly Ile Lys 180 185 190 Asp Gln Met Lys Phe Thr Glu Leu Val Lys Glu Ile Leu Arg Leu Thr 195 200 205 Gly Gly Phe Asp Val Ala Asp Ile Phe Pro Ser Lys Lys Leu Leu His 210 215 220 His Leu Ser Gly Lys Arg Ala Lys Leu Thr Asn Ile His Asn Lys Leu 225 230 235 240 Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu His Pro Gly Asn Arg Thr 245 250 255 Ser Ser Ser Gln Glu Thr Leu Leu Asp Val Leu Leu Arg Leu Lys Glu 260 265 270 Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn Val Lys Ala Val Ile Leu 275 280 285 Asp Met Phe Gly Ala Gly Thr Asp Thr Ser Ser Ala Thr Ile Glu Trp 290 295 300 Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg Ala Met Glu Lys Val Gln 305 310 315 320 Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu 325 330 335 Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu 340 345 350 Arg Leu His Pro Pro Leu Pro Leu Val Met Pro Arg Glu Cys Arg Glu 355 360 365 Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile 370 375 380 Val Asn Val Phe Ala Ile Asn Arg Asp Pro Glu Tyr Trp Lys Asp Ala 385 390 395 400 Glu Thr Phe Met Pro Glu Arg Phe Glu Asn Ser Pro Ile Thr Val Met 405 410 415 Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys 420 425 430 Pro Gly Ala Ala Leu Gly Leu Ala Asn Val Glu Leu Pro Leu Ala His 435 440 445 Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu 450 455 460 Asp Leu Asp Met Thr Glu Ser Phe Gly Ala Thr Val Gln Arg Lys Thr 465 470 475 480 Glu Leu Leu Leu Val Pro Thr Asp Phe Gln Thr Leu Thr Ala Ser Thr 485 490 495 <210> SEQ ID NO 34 <211> LENGTH: 490 <212> TYPE: PRT <213> ORGANISM: Lactuca sativa <220> FEATURE: <223> OTHER INFORMATION: CYP71BL1 costunolide synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AEI59780 <309> DATABASE ENTRY DATE: 2011-06-26 <400> SEQUENCE: 34 Met Glu Pro Leu Thr Ile Val Ser Leu Ala Val Ala Ser Phe Leu Leu 1 5 10 15 Phe Ala Phe Trp Ala Leu Ser Pro Lys Thr Ser Lys Asn Leu Pro Pro 20 25 30 Gly Pro Pro Lys Leu Pro Ile Ile Gly Asn Ile His Gln Leu Lys Ser 35 40 45 Pro Thr Pro His Arg Val Leu Arg Asn Leu Ala Lys Lys Tyr Gly Pro 50 55 60 Ile Met His Leu Gln Leu Gly Gln Val Ser Thr Val Val Val Ser Thr 65 70 75 80 Pro Arg Leu Ala Arg Glu Ile Met Lys Thr Asn Asp Ile Ser Phe Ala 85 90 95 Asp Arg Pro Thr Thr Thr Thr Ser Gln Ile Phe Phe Tyr Lys Ala Gln 100 105 110 Asp Ile Gly Trp Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Met Lys Lys 115 120 125 Ile Cys Thr Leu Glu Leu Leu Ser Ala Lys Lys Val Arg Ser Phe Ser 130 135 140 Ser Ile Arg Glu Glu Glu Leu Arg Arg Ile Ser Lys Val Leu Glu Ser 145 150 155 160 Lys Ala Gly Thr Pro Val Asn Phe Thr Glu Met Thr Val Glu Met Val 165 170 175 Asn Asn Val Ile Cys Lys Ala Thr Leu Gly Asp Ser Cys Lys Asp Gln 180 185 190 Ala Thr Leu Ile Glu Val Leu Tyr Asp Val Leu Lys Thr Leu Ser Ala 195 200 205 Phe Asn Leu Ala Ser Tyr Tyr Pro Gly Leu Gln Phe Leu Asn Val Ile 210 215 220 Leu Gly Lys Lys Ala Lys Trp Leu Lys Met Gln Lys Gln Leu Asp Asp 225 230 235 240 Ile Leu Glu Asp Val Leu Lys Glu His Arg Ser Lys Gly Arg Asn Lys 245 250 255 Ser Asp Gln Glu Asp Leu Val Asp Val Leu Leu Arg Val Lys Asp Thr 260 265 270 Gly Gly Leu Asp Phe Thr Val Thr Asp Glu His Val Lys Ala Val Val 275 280 285 Leu Asp Met Leu Thr Ala Gly Thr Asp Thr Ser Ser Ala Thr Leu Glu 290 295 300 Trp Ala Met Thr Glu Leu Met Arg Asn Pro His Met Met Lys Arg Ala 305 310 315 320 Gln Glu Glu Val Arg Ser Val Val Lys Gly Asp Thr Ile Thr Glu Thr 325 330 335 Asp Leu Gln Ser Leu His Tyr Leu Lys Leu Ile Val Lys Glu Thr Leu 340 345 350 Arg Leu His Ala Pro Thr Pro Leu Leu Val Pro Arg Glu Cys Arg Gln 355 360 365 Ala Cys Asn Val Asp Gly Tyr Asp Ile Pro Ala Lys Thr Lys Ile Leu 370 375 380 Val Asn Ala Trp Ala Cys Gly Thr Asp Pro Asp Ser Trp Lys Asp Ala 385 390 395 400 Glu Ser Phe Ile Pro Glu Arg Phe Glu Asn Cys Pro Ile Asn Tyr Met 405 410 415 Gly Ala Asp Phe Glu Phe Ile Pro Phe Gly Ala Gly Arg Arg Ile Cys 420 425 430 Pro Gly Leu Thr Phe Gly Leu Ser Met Val Glu Tyr Pro Leu Ala Asn 435 440 445 Phe Leu Tyr His Phe Asp Trp Lys Leu Pro Asn Gly Leu Lys Pro His 450 455 460 Glu Leu Asp Ile Thr Glu Ile Thr Gly Ile Ser Thr Ser Leu Lys His 465 470 475 480 Gln Leu Lys Ile Val Pro Ile Leu Lys Ser 485 490 <210> SEQ ID NO 35 <211> LENGTH: 504 <212> TYPE: PRT <213> ORGANISM: Nicotiana tabacum <220> FEATURE: <223> OTHER INFORMATION: CYP71D20 5-epiaristolochene 1,3-dihydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q94FM7 <309> DATABASE ENTRY DATE: 2012-04-18 <400> SEQUENCE: 35 Met Gln Phe Phe Ser Leu Val Ser Ile Phe Leu Phe Leu Ser Phe Leu 1 5 10 15 Phe Leu Leu Arg Lys Trp Lys Asn Ser Asn Ser Gln Ser Lys Lys Leu 20 25 30 Pro Pro Gly Pro Trp Lys Ile Pro Ile Leu Gly Ser Met Leu His Met 35 40 45 Ile Gly Gly Glu Pro His His Val Leu Arg Asp Leu Ala Lys Lys Tyr 50 55 60 Gly Pro Leu Met His Leu Gln Leu Gly Glu Ile Ser Ala Val Val Val 65 70 75 80 Thr Ser Arg Asp Met Ala Lys Glu Val Leu Lys Thr His Asp Val Val 85 90 95 Phe Ala Ser Arg Pro Lys Ile Val Ala Met Asp Ile Ile Cys Tyr Asn 100 105 110 Gln Ser Asp Ile Ala Phe Ser Pro Tyr Gly Asp His Trp Arg Gln Met 115 120 125 Arg Lys Ile Cys Val Met Glu Leu Leu Asn Ala Lys Asn Val Arg Ser 130 135 140 Phe Ser Ser Ile Arg Arg Asp Glu Val Val Arg Leu Ile Asp Ser Ile 145 150 155 160 Arg Ser Asp Ser Ser Ser Gly Glu Leu Val Asn Phe Thr Gln Arg Ile 165 170 175 Ile Trp Phe Ala Ser Ser Met Thr Cys Arg Ser Ala Phe Gly Gln Val 180 185 190 Leu Lys Gly Gln Asp Ile Phe Ala Lys Lys Ile Arg Glu Val Ile Gly 195 200 205 Leu Ala Glu Gly Phe Asp Val Val Asp Ile Phe Pro Thr Tyr Lys Phe 210 215 220 Leu His Val Leu Ser Gly Met Lys Arg Lys Leu Leu Asn Ala His Leu 225 230 235 240 Lys Val Asp Ala Ile Val Glu Asp Val Ile Asn Glu His Lys Lys Asn 245 250 255 Leu Ala Ala Gly Lys Ser Asn Gly Ala Leu Gly Gly Glu Asp Leu Ile 260 265 270 Asp Val Leu Leu Arg Leu Met Asn Asp Thr Ser Leu Gln Phe Pro Ile 275 280 285 Thr Asn Asp Asn Ile Lys Ala Val Ile Val Asp Met Phe Ala Ala Gly 290 295 300 Thr Glu Thr Ser Ser Thr Thr Thr Val Trp Ala Met Ala Glu Met Met 305 310 315 320 Lys Asn Pro Ser Val Phe Thr Lys Ala Gln Ala Glu Val Arg Glu Ala 325 330 335 Phe Arg Asp Lys Val Ser Phe Asp Glu Asn Asp Val Glu Glu Leu Lys 340 345 350 Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Ser 355 360 365 Pro Leu Leu Val Pro Arg Glu Cys Arg Glu Asp Thr Asp Ile Asn Gly 370 375 380 Tyr Thr Ile Pro Ala Lys Thr Lys Val Met Val Asn Val Trp Ala Leu 385 390 395 400 Gly Arg Asp Pro Lys Tyr Trp Asp Asp Ala Glu Ser Phe Lys Pro Glu 405 410 415 Arg Phe Glu Gln Cys Ser Val Asp Phe Phe Gly Asn Asn Phe Glu Phe 420 425 430 Leu Pro Phe Gly Gly Gly Arg Arg Ile Cys Pro Gly Met Ser Phe Gly 435 440 445 Leu Ala Asn Leu Tyr Leu Pro Leu Ala Gln Leu Leu Tyr His Phe Asp 450 455 460 Trp Lys Leu Pro Thr Gly Ile Met Pro Arg Asp Leu Asp Leu Thr Glu 465 470 475 480 Leu Ser Gly Ile Thr Ile Ala Arg Lys Gly Gly Leu Tyr Leu Asn Ala 485 490 495 Thr Pro Tyr Gln Pro Ser Arg Glu 500 <210> SEQ ID NO 36 <211> LENGTH: 500 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71D13 (-)-(4S)-Limonene-3-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q9XHE7 <309> DATABASE ENTRY DATE: 2006-11-28 <400> SEQUENCE: 36 Met Glu Leu Gln Ile Ser Ser Ala Ile Ile Ile Leu Val Val Thr Tyr 1 5 10 15 Thr Ile Ser Leu Leu Ile Ile Lys Gln Trp Arg Lys Pro Lys Pro Gln 20 25 30 Glu Asn Leu Pro Pro Gly Pro Pro Lys Leu Pro Leu Ile Gly His Leu 35 40 45 His Leu Leu Trp Gly Lys Leu Pro Gln His Ala Leu Ala Ser Val Ala 50 55 60 Lys Gln Tyr Gly Pro Val Ala His Val Gln Leu Gly Glu Val Phe Ser 65 70 75 80 Val Val Leu Ser Ser Arg Glu Ala Thr Lys Glu Ala Met Lys Leu Val 85 90 95 Asp Pro Ala Cys Ala Asp Arg Phe Glu Ser Ile Gly Thr Lys Ile Met 100 105 110 Trp Tyr Asp Asn Asp Asp Ile Ile Phe Ser Pro Tyr Ser Val His Trp 115 120 125 Arg Gln Met Arg Lys Ile Cys Val Ser Glu Leu Leu Ser Ala Arg Asn 130 135 140 Val Arg Ser Phe Gly Phe Ile Arg Gln Asp Glu Val Ser Arg Leu Leu 145 150 155 160 Gly His Leu Arg Ser Ser Ala Ala Ala Gly Glu Ala Val Asp Leu Thr 165 170 175 Glu Arg Ile Ala Thr Leu Thr Cys Ser Ile Ile Cys Arg Ala Ala Phe 180 185 190 Gly Ser Val Ile Arg Asp His Glu Glu Leu Val Glu Leu Val Lys Asp 195 200 205 Ala Leu Ser Met Ala Ser Gly Phe Glu Leu Ala Asp Met Phe Pro Ser 210 215 220 Ser Lys Leu Leu Asn Leu Leu Cys Trp Asn Lys Ser Lys Leu Trp Arg 225 230 235 240 Met Arg Arg Arg Val Asp Ala Ile Leu Glu Ala Ile Val Glu Glu His 245 250 255 Lys Leu Lys Lys Ser Gly Glu Phe Gly Gly Glu Asp Ile Ile Asp Val 260 265 270 Leu Phe Arg Met Gln Lys Asp Ser Gln Ile Lys Val Pro Ile Thr Thr 275 280 285 Asn Ala Ile Lys Ala Phe Ile Phe Asp Thr Phe Ser Ala Gly Thr Glu 290 295 300 Thr Ser Ser Thr Thr Thr Leu Trp Val Met Ala Glu Leu Met Arg Asn 305 310 315 320 Pro Glu Val Met Ala Lys Ala Gln Ala Glu Val Arg Ala Ala Leu Lys 325 330 335 Gly Lys Thr Asp Trp Asp Val Asp Asp Val Gln Glu Leu Lys Tyr Met 340 345 350 Lys Ser Val Val Lys Glu Thr Met Arg Met His Pro Pro Ile Pro Leu 355 360 365 Ile Pro Arg Ser Cys Arg Glu Glu Cys Glu Val Asn Gly Tyr Thr Ile 370 375 380 Pro Asn Lys Ala Arg Ile Met Ile Asn Val Trp Ser Met Gly Arg Asn 385 390 395 400 Pro Leu Tyr Trp Glu Lys Pro Glu Thr Phe Trp Pro Glu Arg Phe Asp 405 410 415 Gln Val Ser Arg Asp Phe Met Gly Asn Asp Phe Glu Phe Ile Pro Phe 420 425 430 Gly Ala Gly Arg Arg Ile Cys Pro Gly Leu Asn Phe Gly Leu Ala Asn 435 440 445 Val Glu Val Pro Leu Ala Gln Leu Leu Tyr His Phe Asp Trp Lys Leu 450 455 460 Ala Glu Gly Met Asn Pro Ser Asp Met Asp Met Ser Glu Ala Glu Gly 465 470 475 480 Leu Thr Gly Ile Arg Lys Asn Asn Leu Leu Leu Val Pro Thr Pro Tyr 485 490 495 Asp Pro Ser Ser 500 <210> SEQ ID NO 37 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Mentha spicata <220> FEATURE: <223> OTHER INFORMATION: CYP71D18 (-)-(4S)-Limonene-6-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q6WKZ1 <309> DATABASE ENTRY DATE: 2012-04-18 <400> SEQUENCE: 37 Met Glu Leu Asp Leu Leu Ser Ala Ile Ile Ile Leu Val Ala Thr Tyr 1 5 10 15 Ile Val Ser Leu Leu Ile Asn Gln Trp Arg Lys Ser Lys Ser Gln Gln 20 25 30 Asn Leu Pro Pro Ser Pro Pro Lys Leu Pro Val Ile Gly His Leu His 35 40 45 Phe Leu Trp Gly Gly Leu Pro Gln His Val Phe Arg Ser Ile Ala Gln 50 55 60 Lys Tyr Gly Pro Val Ala His Val Gln Leu Gly Glu Val Tyr Ser Val 65 70 75 80 Val Leu Ser Ser Ala Glu Ala Ala Lys Gln Ala Met Lys Val Leu Asp 85 90 95 Pro Asn Phe Ala Asp Arg Phe Asp Gly Ile Gly Ser Arg Thr Met Trp 100 105 110 Tyr Asp Lys Asp Asp Ile Ile Phe Ser Pro Tyr Asn Asp His Trp Arg 115 120 125 Gln Met Arg Arg Ile Cys Val Thr Glu Leu Leu Ser Pro Lys Asn Val 130 135 140 Arg Ser Phe Gly Tyr Ile Arg Gln Glu Glu Ile Glu Arg Leu Ile Arg 145 150 155 160 Leu Leu Gly Ser Ser Gly Gly Ala Pro Val Asp Val Thr Glu Glu Val 165 170 175 Ser Lys Met Ser Cys Val Val Val Cys Arg Ala Ala Phe Gly Ser Val 180 185 190 Leu Lys Asp Gln Gly Ser Leu Ala Glu Leu Val Lys Glu Ser Leu Ala 195 200 205 Leu Ala Ser Gly Phe Glu Leu Ala Asp Leu Tyr Pro Ser Ser Trp Leu 210 215 220 Leu Asn Leu Leu Ser Leu Asn Lys Tyr Arg Leu Gln Arg Met Arg Arg 225 230 235 240 Arg Leu Asp His Ile Leu Asp Gly Phe Leu Glu Glu His Arg Glu Lys 245 250 255 Lys Ser Gly Glu Phe Gly Gly Glu Asp Ile Val Asp Val Leu Phe Arg 260 265 270 Met Gln Lys Gly Ser Asp Ile Lys Ile Pro Ile Thr Ser Asn Cys Ile 275 280 285 Lys Gly Phe Ile Phe Asp Thr Phe Ser Ala Gly Ala Glu Thr Ser Ser 290 295 300 Thr Thr Ile Ser Trp Ala Leu Ser Glu Leu Met Arg Asn Pro Ala Lys 305 310 315 320 Met Ala Lys Val Gln Ala Glu Val Arg Glu Ala Leu Lys Gly Lys Thr 325 330 335 Val Val Asp Leu Ser Glu Val Gln Glu Leu Lys Tyr Leu Arg Ser Val 340 345 350 Leu Lys Glu Thr Leu Arg Leu His Pro Pro Phe Pro Leu Ile Pro Arg 355 360 365 Gln Ser Arg Glu Glu Cys Glu Val Asn Gly Tyr Thr Ile Pro Ala Lys 370 375 380 Thr Arg Ile Phe Ile Asn Val Trp Ala Ile Gly Arg Asp Pro Gln Tyr 385 390 395 400 Trp Glu Asp Pro Asp Thr Phe Arg Pro Glu Arg Phe Asp Glu Val Ser 405 410 415 Arg Asp Phe Met Gly Asn Asp Phe Glu Phe Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu His Phe Gly Leu Ala Asn Val Glu Ile 435 440 445 Pro Leu Ala Gln Leu Leu Tyr His Phe Asp Trp Lys Leu Pro Gln Gly 450 455 460 Met Thr Asp Ala Asp Leu Asp Met Thr Glu Thr Pro Gly Leu Ser Gly 465 470 475 480 Pro Lys Lys Lys Asn Val Cys Leu Val Pro Thr Leu Tyr Lys Ser Pro 485 490 495 <210> SEQ ID NO 38 <211> LENGTH: 524 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP72A1 Secologanin synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q05047 <309> DATABASE ENTRY DATE: 2012-09-05 <400> SEQUENCE: 38 Met Glu Met Asp Met Asp Thr Ile Arg Lys Ala Ile Ala Ala Thr Ile 1 5 10 15 Phe Ala Leu Val Met Ala Trp Ala Trp Arg Val Leu Asp Trp Ala Trp 20 25 30 Phe Thr Pro Lys Arg Ile Glu Lys Arg Leu Arg Gln Gln Gly Phe Arg 35 40 45 Gly Asn Pro Tyr Arg Phe Leu Val Gly Asp Val Lys Glu Ser Gly Lys 50 55 60 Met His Gln Glu Ala Leu Ser Lys Pro Met Glu Phe Asn Asn Asp Ile 65 70 75 80 Val Pro Arg Leu Met Pro His Ile Asn His Thr Ile Asn Thr Tyr Gly 85 90 95 Arg Asn Ser Phe Thr Trp Met Gly Arg Ile Pro Arg Ile His Val Met 100 105 110 Glu Pro Glu Leu Ile Lys Glu Val Leu Thr His Ser Ser Lys Tyr Gln 115 120 125 Lys Asn Phe Asp Val His Asn Pro Leu Val Lys Phe Leu Leu Thr Gly 130 135 140 Val Gly Ser Phe Glu Gly Ala Lys Trp Ser Lys His Arg Arg Ile Ile 145 150 155 160 Ser Pro Ala Phe Thr Leu Glu Lys Leu Lys Ser Met Leu Pro Ala Phe 165 170 175 Ala Ile Cys Tyr His Asp Met Leu Thr Lys Trp Glu Lys Ile Ala Glu 180 185 190 Lys Gln Gly Ser His Glu Val Asp Ile Phe Pro Thr Phe Asp Val Leu 195 200 205 Thr Ser Asp Val Ile Ser Lys Val Ala Phe Gly Ser Thr Tyr Glu Glu 210 215 220 Gly Gly Lys Ile Phe Arg Leu Leu Lys Glu Leu Met Asp Leu Thr Ile 225 230 235 240 Asp Cys Met Arg Asp Val Tyr Ile Pro Gly Trp Ser Tyr Leu Pro Thr 245 250 255 Lys Arg Asn Lys Arg Met Lys Glu Ile Asn Lys Glu Ile Thr Asp Met 260 265 270 Leu Arg Phe Ile Ile Asn Lys Arg Met Lys Ala Leu Lys Ala Gly Glu 275 280 285 Pro Gly Glu Asp Asp Leu Leu Gly Val Leu Leu Glu Ser Asn Ile Gln 290 295 300 Glu Ile Gln Lys Gln Gly Asn Lys Lys Asp Gly Gly Met Ser Ile Asn 305 310 315 320 Asp Val Ile Glu Glu Cys Lys Leu Phe Tyr Phe Ala Gly Gln Glu Thr 325 330 335 Thr Gly Val Leu Leu Thr Trp Thr Thr Ile Leu Leu Ser Lys His Pro 340 345 350 Glu Trp Gln Glu Arg Ala Arg Glu Glu Val Leu Gln Ala Phe Gly Lys 355 360 365 Asn Lys Pro Glu Phe Glu Arg Leu Asn His Leu Lys Tyr Val Ser Met 370 375 380 Ile Leu Tyr Glu Val Leu Arg Leu Tyr Pro Pro Val Ile Asp Leu Thr 385 390 395 400 Lys Ile Val His Lys Asp Thr Lys Leu Gly Ser Tyr Thr Ile Pro Ala 405 410 415 Gly Thr Gln Val Met Leu Pro Thr Val Met Leu His Arg Glu Lys Ser 420 425 430 Ile Trp Gly Glu Asp Ala Met Glu Phe Asn Pro Met Arg Phe Val Asp 435 440 445 Gly Val Ala Asn Ala Thr Lys Asn Asn Val Thr Tyr Leu Pro Phe Ser 450 455 460 Trp Gly Pro Arg Val Cys Leu Gly Gln Asn Phe Ala Leu Leu Gln Ala 465 470 475 480 Lys Leu Gly Leu Ala Met Ile Leu Gln Arg Phe Lys Phe Asp Val Ala 485 490 495 Pro Ser Tyr Val His Ala Pro Phe Thr Ile Leu Thr Val Gln Pro Gln 500 505 510 Phe Gly Ser His Val Ile Tyr Lys Lys Leu Glu Ser 515 520 <210> SEQ ID NO 39 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <220> FEATURE: <223> OTHER INFORMATION: CYP76M7 cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: BAG97435 <309> DATABASE ENTRY DATE: 2008-12-04 <400> SEQUENCE: 39 Met Glu Asn Ser Gln Val Trp Leu Leu Trp Gly Ala Leu Ser Val Ala 1 5 10 15 Val Leu Phe Tyr Leu Ser Thr Leu Arg Arg Arg Tyr Ala Gly Gly Lys 20 25 30 Pro Leu Pro Pro Gly Pro Thr Pro Leu Pro Leu Ile Gly Asn Leu His 35 40 45 Leu Ala Gly Gly Thr Phe His His Lys Leu Arg Asp Leu Ala Arg Val 50 55 60 His Gly Pro Val Met Thr Leu Lys Leu Gly Leu Ala Thr Asn Val Val 65 70 75 80 Ile Ser Ser Arg Glu Ala Ala Ile Glu Ala Tyr Thr Lys Tyr Asp Arg 85 90 95 His Leu Ala Ala Arg Ala Thr Pro Asp Thr Phe Arg Ala Cys Gly Phe 100 105 110 Ala Asp Arg Ser Met Val Phe Ile Pro Ser Ser Asp Pro Gln Trp Lys 115 120 125 Ala Leu Arg Gly Ile Gln Gly Ser His Val Phe Thr Pro Arg Gly Leu 130 135 140 Ala Ala Val Arg Pro Ile Arg Glu Arg Lys Val Gly Asp Leu Ile Ala 145 150 155 160 Tyr Leu Arg Ala His Ala Gly Glu Glu Val Leu Leu Gly Gln Ala Met 165 170 175 Tyr Thr Gly Leu Leu Asn Leu Val Ser Phe Ser Tyr Phe Ser Ile Asp 180 185 190 Ile Val Asp Met Gly Ser Gln Met Ala Arg Asp Leu Arg Glu Val Val 195 200 205 Asp Asp Ile Ile Ser Val Val Gly Lys Pro Asn Ile Ser Asp Phe Tyr 210 215 220 Pro Phe Leu Arg Pro Leu Asp Leu Gln Gly Leu Arg Arg Trp Thr Thr 225 230 235 240 Lys Arg Phe Asn Arg Val Phe Ser Ile Met Gly Asp Ile Ile Asp Arg 245 250 255 Arg Leu Ala His Ile Arg Asp Gly Lys Pro Arg His Asp Asp Phe Leu 260 265 270 Asp Ser Leu Leu Glu Leu Met Ala Thr Gly Lys Met Glu Arg Val Asn 275 280 285 Val Val Asn Met Leu Phe Glu Ala Phe Val Ala Gly Val Asp Thr Met 290 295 300 Ala Leu Thr Leu Glu Trp Val Met Ala Glu Leu Leu His Asn Pro Ala 305 310 315 320 Ile Met Ala Arg Val Arg Ala Glu Leu Ser Asp Val Leu Gly Gly Lys 325 330 335 Glu Ala Val Glu Glu Ala Asp Ala Ala Arg Leu Pro Tyr Leu Gln Ala 340 345 350 Val Leu Lys Glu Ala Met Arg Leu His Pro Val Gly Ala Leu Leu Leu 355 360 365 Pro His Phe Ala Ala Glu Asp Gly Val Glu Ile Gly Gly Tyr Ala Val 370 375 380 Pro Arg Gly Ser Thr Val Leu Phe Asn Ala Trp Ala Ile Met Arg Asp 385 390 395 400 Pro Ala Ala Trp Glu Arg Pro Asp Glu Phe Val Pro Glu Arg Phe Leu 405 410 415 Gly Arg Ser Pro Pro Leu Asp Phe Arg Gly Lys Asp Val Glu Phe Met 420 425 430 Pro Phe Gly Ser Gly Arg Arg Leu Cys Pro Gly Leu Pro Leu Ala Glu 435 440 445 Arg Val Val Pro Phe Ile Leu Ala Ser Met Leu His Thr Phe Glu Trp 450 455 460 Lys Leu Pro Gly Gly Met Thr Ala Glu Asp Val Asp Val Ser Glu Lys 465 470 475 480 Phe Lys Ser Ala Asn Val Leu Ala Val Pro Leu Lys Ala Val Pro Val 485 490 495 Leu Ile Lys <210> SEQ ID NO 40 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR1 Forward Primer <400> SEQUENCE: 40 atgagttcga gctcggagct atg 23 <210> SEQ ID NO 41 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR1 Reverse Primer <400> SEQUENCE: 41 tcaccacaca tcccgtaaat accttc 26 <210> SEQ ID NO 42 <211> LENGTH: 705 <212> TYPE: PRT <213> ORGANISM: Vitis vinifera <220> FEATURE: <223> OTHER INFORMATION: Predicted cytochrome P450 reductase-like protein <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: XP_002270732 <309> DATABASE ENTRY DATE: 2011-12-07 <400> SEQUENCE: 42 Met Gln Ser Ser Ser Val Lys Val Ser Pro Phe Asp Leu Met Ser Ala 1 5 10 15 Ile Ile Lys Gly Ser Met Asp Gln Ser Asn Val Ser Ser Glu Ser Gly 20 25 30 Gly Ala Ala Ala Met Val Leu Glu Asn Arg Glu Phe Ile Met Ile Leu 35 40 45 Thr Thr Ser Ile Ala Val Leu Ile Gly Cys Val Val Val Leu Ile Trp 50 55 60 Arg Arg Ser Gly Gln Lys Gln Ser Lys Thr Pro Glu Pro Pro Lys Pro 65 70 75 80 Leu Ile Val Lys Asp Leu Glu Val Glu Val Asp Asp Gly Lys Gln Lys 85 90 95 Val Thr Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu Gly Phe Ala 100 105 110 Lys Ala Leu Ala Glu Glu Ala Lys Ala Arg Tyr Glu Lys Ala Ile Phe 115 120 125 Lys Val Val Asp Leu Asp Asp Tyr Ala Gly Asp Asp Asp Glu Tyr Glu 130 135 140 Glu Lys Leu Lys Lys Glu Thr Leu Ala Phe Phe Phe Leu Ala Thr Tyr 145 150 155 160 Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr Lys Trp Phe 165 170 175 Ala Glu Gly Lys Glu Arg Gly Glu Trp Leu Gln Asn Leu Lys Tyr Gly 180 185 190 Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn Lys Val Ala 195 200 205 Lys Val Val Asp Asp Ile Ile Thr Glu Gln Gly Gly Lys Arg Ile Val 210 215 220 Pro Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp Asp Phe Ala 225 230 235 240 Ala Trp Arg Glu Leu Leu Trp Pro Glu Leu Asp Gln Leu Leu Arg Asp 245 250 255 Glu Asp Asp Ala Thr Thr Val Ser Thr Pro Tyr Thr Ala Ala Val Leu 260 265 270 Glu Tyr Arg Val Val Phe His Asp Pro Glu Gly Ala Ser Leu Gln Asp 275 280 285 Lys Ser Trp Gly Ser Ala Asn Gly His Thr Val His Asp Ala Gln His 290 295 300 Pro Cys Arg Ala Asn Val Ala Val Arg Lys Glu Leu His Thr Pro Ala 305 310 315 320 Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ser Gly Thr Gly 325 330 335 Leu Thr Tyr Glu Thr Gly Asp His Val Gly Val Tyr Cys Glu Asn Leu 340 345 350 Pro Glu Thr Val Glu Glu Ala Glu Arg Leu Leu Gly Phe Ser Pro Asp 355 360 365 Val Tyr Phe Ser Ile His Thr Glu Arg Glu Asp Gly Thr Pro Leu Ser 370 375 380 Gly Ser Ser Leu Ser Pro Pro Phe Pro Pro Cys Thr Leu Arg Thr Ala 385 390 395 400 Leu Thr Arg Tyr Ala Asp Val Leu Ser Ser Pro Lys Lys Ser Ala Leu 405 410 415 Val Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu Ala Asp Arg Leu 420 425 430 Lys Tyr Leu Ala Ser Pro Ser Gly Lys Asp Glu Tyr Ala Gln Trp Val 435 440 445 Val Ala Ser Gln Arg Ser Leu Leu Glu Ile Met Ala Glu Phe Pro Ser 450 455 460 Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala Val Ala Pro Arg Leu 465 470 475 480 Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Lys Met Val Pro Ser 485 490 495 Arg Ile His Val Thr Cys Ala Leu Val Cys Asp Lys Met Pro Thr Gly 500 505 510 Arg Ile His Lys Gly Ile Cys Ser Thr Trp Met Lys Tyr Ala Val Pro 515 520 525 Leu Glu Glu Ser Gln Asp Cys Ser Trp Ala Pro Ile Phe Val Arg Gln 530 535 540 Ser Asn Phe Lys Leu Pro Ala Asp Thr Ser Val Pro Ile Ile Met Ile 545 550 555 560 Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg 565 570 575 Phe Ala Leu Lys Glu Ala Gly Ala Glu Leu Gly Ser Ser Ile Leu Phe 580 585 590 Phe Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr Glu Asp Glu Leu 595 600 605 Asn Gly Phe Val Glu Ser Gly Ala Leu Ser Glu Leu Ile Val Ala Phe 610 615 620 Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val Gln His Lys Met Met Glu 625 630 635 640 Lys Ala Ser Asp Ile Trp Asn Val Ile Ser Gln Gly Gly Tyr Ile Tyr 645 650 655 Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His Arg Thr Leu 660 665 670 His Thr Ile Leu Gln Glu Gln Gly Ser Leu Asp Ser Ser Lys Ala Glu 675 680 685 Ser Met Val Lys Asn Leu Gln Met Thr Gly Arg Tyr Leu Arg Asp Val 690 695 700 Trp 705 <210> SEQ ID NO 43 <211> LENGTH: 710 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ACN54324 <309> DATABASE ENTRY DATE: 2009-12-31 <400> SEQUENCE: 43 Met Asp Ser Ser Ser Ser Ser Ser Ser Ser Gly Pro Ser Pro Leu Asp 1 5 10 15 Leu Met Ser Ala Leu Val Lys Ala Lys Met Asp Pro Ser Asn Ala Ser 20 25 30 Ser Asp Ser Ala Ala Gln Val Thr Thr Val Leu Phe Glu Asn Arg Glu 35 40 45 Phe Val Met Ile Leu Thr Thr Ser Ile Ala Val Leu Ile Gly Cys Val 50 55 60 Val Ile Leu Ile Trp Arg Arg Ser Ala Ser Gln Lys Pro Lys Gln Ile 65 70 75 80 Gln Leu Pro Leu Lys Pro Ser Ile Ile Lys Glu Pro Glu Leu Glu Val 85 90 95 Asp Asp Gly Lys Lys Lys Val Thr Ile Leu Phe Gly Thr Gln Thr Gly 100 105 110 Thr Ala Glu Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg 115 120 125 Tyr Glu Lys Ala Thr Phe Asn Ile Val Asp Leu Asp Asp Tyr Ala Ala 130 135 140 Asp Asp Glu Glu Tyr Glu Glu Lys Met Lys Lys Asp Asn Leu Ala Phe 145 150 155 160 Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala 165 170 175 Arg Phe Tyr Lys Trp Phe Thr Glu Gly Lys Glu Arg Gly Glu Trp Leu 180 185 190 Gln Asn Met Lys Tyr Gly Ile Phe Gly Leu Gly Asn Lys Gln Tyr Glu 195 200 205 His Phe Asn Lys Val Ala Lys Val Val Asp Glu Leu Leu Thr Glu Gln 210 215 220 Gly Ala Lys Arg Ile Val Pro Leu Gly Leu Gly Asp Asp Asp Gln Cys 225 230 235 240 Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu Leu 245 250 255 Asp Gln Leu Leu Arg Asp Glu Asp Asp Ala Thr Val Ser Thr Pro Tyr 260 265 270 Thr Ala Ala Val Leu Glu Tyr Arg Val Val Phe Tyr Asp Pro Ala Asp 275 280 285 Ala Pro Leu Glu Asp Lys Asn Trp Ser Asn Ala Asn Gly His Ala Thr 290 295 300 Tyr Asp Ala Gln His Pro Cys Arg Ser Asn Val Ala Val Arg Lys Glu 305 310 315 320 Leu His Ala Pro Glu Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp 325 330 335 Ile Ala Gly Thr Gly Leu Ser Tyr Glu Thr Gly Asp His Val Gly Val 340 345 350 Tyr Cys Glu Asn Leu Asp Glu Val Val Asp Glu Ala Leu Ser Leu Leu 355 360 365 Gly Leu Ser Pro Asp Thr Tyr Phe Ser Val His Thr Asp Lys Glu Asp 370 375 380 Gly Thr Pro Leu Gly Gly Ser Ser Leu Pro Ser Ser Phe Pro Pro Cys 385 390 395 400 Thr Leu Arg Thr Ala Leu Ala Arg Tyr Ala Asp Leu Leu Ser Ser Pro 405 410 415 Lys Lys Ala Ala Leu Leu Ala Leu Ala Ala His Ala Ser Asp Pro Thr 420 425 430 Glu Ala Asp Arg Leu Arg His Leu Ala Ser Pro Ala Gly Lys Asp Glu 435 440 445 Tyr Ala Gln Trp Ile Val Ala Asn Gln Arg Ser Leu Leu Glu Val Met 450 455 460 Ala Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala 465 470 475 480 Val Ala Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro 485 490 495 Arg Leu Ala Pro Ser Arg Ile His Val Thr Cys Ala Leu Val Tyr Glu 500 505 510 Lys Thr Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met 515 520 525 Lys Asn Ala Val Ser Ser Gly Lys Ser Asp Asp Cys Gly Trp Ala Pro 530 535 540 Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Thr Lys Val 545 550 555 560 Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly 565 570 575 Phe Leu Gln Glu Arg Leu Ala Leu Lys Glu Ala Gly Ala Glu Leu Gly 580 585 590 Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Lys Met Asp Phe Ile 595 600 605 Tyr Glu Asp Glu Leu Asn Asn Phe Val Asn Ser Gly Ala Leu Ser Glu 610 615 620 Leu Val Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val Gln 625 630 635 640 His Lys Met Met Glu Lys Ala Lys Asp Ile Trp Asp Met Ile Ser Gln 645 650 655 Gly Gly Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp 660 665 670 Val His Arg Ala Leu His Thr Ile Phe Gln Glu Gln Gly Ser Leu Asp 675 680 685 Ser Ser Lys Ala Glu Ser Met Val Lys Asn Leu Gln Met Ser Gly Arg 690 695 700 Tyr Leu Arg Asp Val Trp 705 710 <210> SEQ ID NO 44 <211> LENGTH: 704 <212> TYPE: PRT <213> ORGANISM: Artemisia annua <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ABI98819 <309> DATABASE ENTRY DATE: 2009-09-15 <400> SEQUENCE: 44 Met Gln Ser Thr Thr Ser Val Lys Leu Ser Pro Phe Asp Leu Met Thr 1 5 10 15 Ala Leu Leu Asn Gly Lys Val Ser Phe Asp Thr Ser Asn Thr Ser Asp 20 25 30 Thr Asn Ile Pro Leu Ala Val Phe Met Glu Asn Arg Glu Leu Leu Met 35 40 45 Ile Leu Thr Thr Ser Val Ala Val Leu Ile Gly Cys Val Val Val Leu 50 55 60 Val Trp Arg Arg Ser Ser Ser Ala Ala Lys Lys Ala Ala Glu Ser Pro 65 70 75 80 Val Ile Val Val Pro Lys Lys Val Thr Glu Asp Glu Val Asp Asp Gly 85 90 95 Arg Lys Lys Val Thr Val Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu 100 105 110 Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg Tyr Glu Lys 115 120 125 Ala Val Phe Lys Val Ile Asp Leu Asp Asp Tyr Ala Ala Glu Asp Asp 130 135 140 Glu Tyr Glu Glu Lys Leu Lys Lys Glu Ser Leu Ala Phe Phe Phe Leu 145 150 155 160 Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr 165 170 175 Lys Trp Phe Thr Glu Gly Glu Glu Lys Gly Glu Trp Leu Asp Lys Leu 180 185 190 Gln Tyr Ala Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn 195 200 205 Lys Ile Ala Lys Val Val Asp Glu Lys Leu Val Glu Gln Gly Ala Lys 210 215 220 Arg Leu Val Pro Val Gly Met Gly Asp Asp Asp Gln Cys Ile Glu Asp 225 230 235 240 Asp Phe Thr Ala Trp Lys Glu Leu Val Trp Pro Glu Leu Asp Gln Leu 245 250 255 Leu Arg Asp Glu Asp Asp Thr Ser Val Ala Thr Pro Tyr Thr Ala Ala 260 265 270 Val Ala Glu Tyr Arg Val Val Phe His Asp Lys Pro Glu Thr Tyr Asp 275 280 285 Gln Asp Gln Leu Thr Asn Gly His Ala Val His Asp Ala Gln His Pro 290 295 300 Cys Arg Ser Asn Val Ala Val Lys Lys Glu Leu His Ser Pro Leu Ser 305 310 315 320 Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ser Asn Thr Gly Leu 325 330 335 Ser Tyr Glu Thr Gly Asp His Val Gly Val Tyr Val Glu Asn Leu Ser 340 345 350 Glu Val Val Asp Glu Ala Glu Lys Leu Ile Gly Leu Pro Pro His Thr 355 360 365 Tyr Phe Ser Val His Ala Asp Asn Glu Asp Gly Thr Pro Leu Gly Gly 370 375 380 Ala Ser Leu Pro Pro Pro Phe Pro Pro Cys Thr Leu Arg Lys Ala Leu 385 390 395 400 Ala Ser Tyr Ala Asp Val Leu Ser Ser Pro Lys Lys Ser Ala Leu Leu 405 410 415 Ala Leu Ala Ala His Ala Thr Asp Ser Thr Glu Ala Asp Arg Leu Lys 420 425 430 Phe Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr Ala Gln Trp Ile Val 435 440 445 Ala Ser His Arg Ser Leu Leu Glu Val Met Glu Ala Phe Pro Ser Ala 450 455 460 Lys Pro Pro Leu Gly Val Phe Phe Ala Ser Val Ala Pro Arg Leu Gln 465 470 475 480 Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Phe Ala Pro Asn Arg 485 490 495 Ile His Val Thr Cys Ala Leu Val Tyr Glu Gln Thr Pro Ser Gly Arg 500 505 510 Val His Lys Gly Val Cys Ser Thr Trp Met Lys Asn Ala Val Pro Met 515 520 525 Thr Glu Ser Gln Asp Cys Ser Trp Ala Pro Ile Tyr Val Arg Thr Ser 530 535 540 Asn Phe Arg Leu Pro Ser Asp Pro Lys Val Pro Val Ile Met Ile Gly 545 550 555 560 Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg Leu 565 570 575 Ala Gln Lys Glu Ala Gly Thr Glu Leu Gly Thr Ala Ile Leu Phe Phe 580 585 590 Gly Cys Arg Asn Arg Lys Val Asp Phe Ile Tyr Glu Asp Glu Leu Asn 595 600 605 Asn Phe Val Glu Thr Gly Ala Leu Ser Glu Leu Val Thr Ala Phe Ser 610 615 620 Arg Glu Gly Ala Thr Lys Glu Tyr Val Gln His Lys Met Thr Gln Lys 625 630 635 640 Ala Ser Asp Ile Trp Asn Leu Leu Ser Glu Gly Ala Tyr Leu Tyr Val 645 650 655 Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val His Arg Thr Leu His 660 665 670 Thr Ile Val Gln Glu Gln Gly Ser Leu Asp Ser Ser Lys Ala Glu Leu 675 680 685 Tyr Val Lys Asn Leu Gln Met Ala Gly Arg Tyr Leu Arg Asp Val Trp 690 695 700 <210> SEQ ID NO 45 <211> LENGTH: 4008 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pACYC-Duet vector <400> SEQUENCE: 45 ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180 taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga gatatacata 300 tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360 ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420 cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480 cctctaaacg ggtcttgagg ggttttttgc tgaaacctca ggcatttgag aagcacacgg 540 tcacactgct tccggtagtc aataaaccgg taaaccagca atagacataa gcggctattt 600 aacgaccctg ccctgaaccg acgaccgggt cgaatttgct ttcgaatttc tgccattcat 660 ccgcttatta tcacttattc aggcgtagca ccaggcgttt aagggcacca ataactgcct 720 taaaaaaatt acgccccgcc ctgccactca tcgcagtact gttgtaattc attaagcatt 780 ctgccgacat ggaagccatc acagacggca tgatgaacct gaatcgccag cggcatcagc 840 accttgtcgc cttgcgtata atatttgccc atagtgaaaa cgggggcgaa gaagttgtcc 900 atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc tgagacgaaa 960 aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta acacgccaca 1020 tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact ccagagcgat 1080 gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact atcccatatc 1140 accagctcac cgtctttcat tgccatacgg aactccggat gagcattcat caggcgggca 1200 agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt ctttaaaaag 1260 gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga ctgaaatgcc 1320 tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc agtgattttt 1380 ttctccattt tagcttcctt agctcctgaa aatctcgata actcaaaaaa tacgcccggt 1440 agtgatctta tttcattatg gtgaaagttg gaacctctta cgtgccgatc aacgtctcat 1500 tttcgccaaa agttggccca gggcttcccg gtatcaacag ggacaccagg atttatttat 1560 tctgcgaagt gatcttccgt cacaggtatt tattcggcgc aaagtgcgtc gggtgatgct 1620 gccaacttac tgatttagtg tatgatggtg tttttgaggt gctccagtgg cttctgtttc 1680 tatcagctgt ccctcctgtt cagctactga cggggtggtg cgtaacggca aaagcaccgc 1740 cggacatcag cgctagcgga gtgtatactg gcttactatg ttggcactga tgagggtgtc 1800 agtgaagtgc ttcatgtggc aggagaaaaa aggctgcacc ggtgcgtcag cagaatatgt 1860 gatacaggat atattccgct tcctcgctca ctgactcgct acgctcggtc gttcgactgc 1920 ggcgagcgga aatggcttac gaacggggcg gagatttcct ggaagatgcc aggaagatac 1980 ttaacaggga agtgagaggg ccgcggcaaa gccgtttttc cataggctcc gcccccctga 2040 caagcatcac gaaatctgac gctcaaatca gtggtggcga aacccgacag gactataaag 2100 ataccaggcg tttcccctgg cggctccctc gtgcgctctc ctgttcctgc ctttcggttt 2160 accggtgtca ttccgctgtt atggccgcgt ttgtctcatt ccacgcctga cactcagttc 2220 cgggtaggca gttcgctcca agctggactg tatgcacgaa ccccccgttc agtccgaccg 2280 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gaaagacatg caaaagcacc 2340 actggcagca gccactggta attgatttag aggagttagt cttgaagtca tgcgccggtt 2400 aaggctaaac tgaaaggaca agttttggtg actgcgctcc tccaagccag ttacctcggt 2460 tcaaagagtt ggtagctcag agaaccttcg aaaaaccgcc ctgcaaggcg gttttttcgt 2520 tttcagagca agagattacg cgcagaccaa aacgatctca agaagatcat cttattaatc 2580 agataaaata tttctagatt tcagtgcaat ttatctcttc aaatgtagca cctgaagtca 2640 gccccatacg atataagttg taattctcat gttagtcatg ccccgcgccc accggaagga 2700 gctgactggg ttgaaggctc tcaagggcat cggtcgagat cccggtgcct aatgagtgag 2760 ctaacttaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg 2820 ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgcca 2880 gggtggtttt tcttttcacc agtgagacgg gcaacagctg attgcccttc accgcctggc 2940 cctgagagag ttgcagcaag cggtccacgc tggtttgccc cagcaggcga aaatcctgtt 3000 tgatggtggt taacggcggg atataacatg agctgtcttc ggtatcgtcg tatcccacta 3060 ccgagatgtc cgcaccaacg cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg 3120 ccatctgatc gttggcaacc agcatcgcag tgggaacgat gccctcattc agcatttgca 3180 tggtttgttg aaaaccggac atggcactcc agtcgccttc ccgttccgct atcggctgaa 3240 tttgattgcg agtgagatat ttatgccagc cagccagacg cagacgcgcc gagacagaac 3300 ttaatgggcc cgctaacagc gcgatttgct ggtgacccaa tgcgaccaga tgctccacgc 3360 ccagtcgcgt accgtcttca tgggagaaaa taatactgtt gatgggtgtc tggtcagaga 3420 catcaagaaa taacgccgga acattagtgc aggcagcttc cacagcaatg gcatcctggt 3480 catccagcgg atagttaatg atcagcccac tgacgcgttg cgcgagaaga ttgtgcaccg 3540 ccgctttaca ggcttcgacg ccgcttcgtt ctaccatcga caccaccacg ctggcaccca 3600 gttgatcggc gcgagattta atcgccgcga caatttgcga cggcgcgtgc agggccagac 3660 tggaggtggc aacgccaatc agcaacgact gtttgcccgc cagttgttgt gccacgcggt 3720 tgggaatgta attcagctcc gccatcgccg cttccacttt ttcccgcgtt ttcgcagaaa 3780 cgtggctggc ctggttcacc acgcgggaaa cggtctgata agagacaccg gcatactctg 3840 cgacatcgta taacgttact ggtttcacat tcaccaccct gaattgactc tcttccgggc 3900 gctatcatgc cataccgcga aaggttttgc gccattcgat ggtgtccggg atctcgacgc 3960 tctcccttat gcgactcctg cattaggaaa ttaatacgac tcactata 4008 <210> SEQ ID NO 46 <211> LENGTH: 712 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <223> OTHER INFORMATION: NADPH cytochrome P450 reductase <400> SEQUENCE: 46 Met Ser Ser Ser Ser Ser Ser Ser Thr Ser Met Ile Asp Leu Met Ala 1 5 10 15 Ala Ile Ile Lys Gly Glu Pro Val Ile Val Ser Asp Pro Ala Asn Ala 20 25 30 Ser Ala Tyr Glu Ser Val Ala Ala Glu Leu Ser Ser Met Leu Ile Glu 35 40 45 Asn Arg Gln Phe Ala Met Ile Val Thr Thr Ser Ile Ala Val Leu Ile 50 55 60 Gly Cys Ile Val Met Leu Val Trp Arg Arg Ser Gly Ser Gly Asn Ser 65 70 75 80 Lys Arg Val Glu Pro Leu Lys Pro Leu Val Ile Lys Pro Arg Glu Glu 85 90 95 Glu Ile Asp Asp Gly Arg Lys Lys Val Thr Ile Phe Phe Gly Thr Gln 100 105 110 Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Gly Glu Glu Ala Lys 115 120 125 Ala Arg Tyr Glu Lys Thr Arg Phe Lys Ile Val Asp Leu Asp Asp Tyr 130 135 140 Ala Ala Asp Asp Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Asp Val 145 150 155 160 Ala Phe Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn 165 170 175 Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Gly Asn Asp Arg Gly Glu 180 185 190 Trp Leu Lys Asn Leu Lys Tyr Gly Val Phe Gly Leu Gly Asn Arg Gln 195 200 205 Tyr Glu His Phe Asn Lys Val Ala Lys Val Val Asp Asp Ile Leu Val 210 215 220 Glu Gln Gly Ala Gln Arg Leu Val Gln Val Gly Leu Gly Asp Asp Asp 225 230 235 240 Gln Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Ala Leu Trp Pro 245 250 255 Glu Leu Asp Thr Ile Leu Arg Glu Glu Gly Asp Thr Ala Val Ala Thr 260 265 270 Pro Tyr Thr Ala Ala Val Leu Glu Tyr Arg Val Ser Ile His Asp Ser 275 280 285 Glu Asp Ala Lys Phe Asn Asp Ile Thr Leu Ala Asn Gly Asn Gly Tyr 290 295 300 Thr Val Phe Asp Ala Gln His Pro Tyr Lys Ala Asn Val Ala Val Lys 305 310 315 320 Arg Glu Leu His Thr Pro Glu Ser Asp Arg Ser Cys Ile His Leu Glu 325 330 335 Phe Asp Ile Ala Gly Ser Gly Leu Thr Met Lys Leu Gly Asp His Val 340 345 350 Gly Val Leu Cys Asp Asn Leu Ser Glu Thr Val Asp Glu Ala Leu Arg 355 360 365 Leu Leu Asp Met Ser Pro Asp Thr Tyr Phe Ser Leu His Ala Glu Lys 370 375 380 Glu Asp Gly Thr Pro Ile Ser Ser Ser Leu Pro Pro Pro Phe Pro Pro 385 390 395 400 Cys Asn Leu Arg Thr Ala Leu Thr Arg Tyr Ala Cys Leu Leu Ser Ser 405 410 415 Pro Lys Lys Ser Ala Leu Val Ala Leu Ala Ala His Ala Ser Asp Pro 420 425 430 Thr Glu Ala Glu Arg Leu Lys His Leu Ala Ser Pro Ala Gly Lys Asp 435 440 445 Glu Tyr Ser Lys Trp Val Val Glu Ser Gln Arg Ser Leu Leu Glu Val 450 455 460 Met Ala Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala 465 470 475 480 Gly Val Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser Ser 485 490 495 Pro Lys Ile Ala Glu Thr Arg Ile His Val Thr Cys Ala Leu Val Tyr 500 505 510 Glu Lys Met Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp 515 520 525 Met Lys Asn Ala Val Pro Tyr Glu Lys Ser Glu Lys Leu Phe Leu Gly 530 535 540 Arg Pro Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Ser 545 550 555 560 Lys Val Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe 565 570 575 Arg Gly Phe Leu Gln Glu Arg Leu Ala Leu Val Glu Ser Gly Val Glu 580 585 590 Leu Gly Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp 595 600 605 Phe Ile Tyr Glu Glu Glu Leu Gln Arg Phe Val Glu Ser Gly Ala Leu 610 615 620 Ala Glu Leu Ser Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr 625 630 635 640 Val Gln His Lys Met Met Asp Lys Ala Ser Asp Ile Trp Asn Met Ile 645 650 655 Ser Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala 660 665 670 Arg Asp Val His Arg Ser Leu His Thr Ile Ala Gln Glu Gln Gly Ser 675 680 685 Met Asp Ser Thr Lys Ala Glu Gly Phe Val Lys Asn Leu Gln Thr Ser 690 695 700 Gly Arg Tyr Leu Arg Asp Val Trp 705 710 <210> SEQ ID NO 47 <211> LENGTH: 7745 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pESC-LEU vector <400> SEQUENCE: 47 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc 240 accattatgg gaaatgcttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca 300 ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat 360 taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc 420 ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc 480 aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt 540 agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg 600 tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct 660 ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg 720 ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct 780 tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac 840 aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat 900 ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc 960 aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg 1020 ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca 1080 gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc 1140 acagtttttc tccataatct tgaagaggcc aaaagattag ctttatccaa ggaccaaata 1200 ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact 1260 tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc 1320 ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca 1380 aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt 1440 aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca 1500 ctaccggtac cccatttagg accacccaca gcacctaaca aaacggcatc agccttcttg 1560 gaggcttcca gcgcctcatc tggaagtgga acacctgtag catcgatagc agcaccacca 1620 attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga 1680 accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc 1740 ttcttagggg cagacattag aatggtatat ccttgaaata tatatatata tattgctgaa 1800 atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat tggaaaaaac 1860 aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat ttagtcatga 1920 acgcttctct attctatatg aaaagccggt tccggcgctc tcacctttcc tttttctccc 1980 aatttttcag ttgaaaaagg tatatgcgtc aggcgacctc tgaaattaac aaaaaatttc 2040 cagtcatcga atttgattct gtgcgatagc gcccctgtgt gttctcgtta tgttgaggaa 2100 aaaaataatg gttgctaaga gattcgaact cttgcatctt acgatacctg agtattccca 2160 cagttaactg cggtcaagat atttcttgaa tcaggcgcct tagaccgctc ggccaaacaa 2220 ccaattactt gttgagaaat agagtataat tatcctataa atataacgtt tttgaacaca 2280 catgaacaag gaagtacagg acaattgatt ttgaagagaa tgtggatttt gatgtaattg 2340 ttgggattcc atttttaata aggcaataat attaggtatg tagatatact agaagttctc 2400 ctcgaccgtc gatatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 2460 caggaaattg taaacgttaa tattttgtta aaattcgcgt taaatttttg ttaaatcagc 2520 tcatttttta accaataggc cgaaatcggc aaaatccctt ataaatcaaa agaatagacc 2580 gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa gaacgtggac 2640 tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg tgaaccatca 2700 ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg 2760 agcccccgat ttagagcttg acggggaaag ccggcgaacg tggcgagaaa ggaagggaag 2820 aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc 2880 accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgc 2940 gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag ctgaattgga 3000 gcgacctcat gctatacctg agaaagcaac ctgacctaca ggaaagagtt actcaagaat 3060 aagaattttc gttttaaaac ctaagagtca ctttaaaatt tgtatacact tatttttttt 3120 ataacttatt taataataaa aatcataaat cataagaaat tcgcttattt agaagtgtca 3180 acaacgtatc taccaacgat ttgacccttt tccatctttt cgtaaatttc tggcaaggta 3240 gacaagccga caaccttgat tggagacttg accaaacctc tggcgaagaa ttgttaatta 3300 agagctcaga tcttatcgtc gtcatccttg taatccatcg atactagtgc ggccgccctt 3360 tagtgagggt tgaattcgaa ttttcaaaaa ttcttacttt ttttttggat ggacgcaaag 3420 aagtttaata atcatattac atggcattac caccatatac atatccatat acatatccat 3480 atctaatctt acttatatgt tgtggaaatg taaagagccc cattatctta gcctaaaaaa 3540 accttctctt tggaactttc agtaatacgc ttaactgctc attgctatat tgaagtacgg 3600 attagaagcc gccgagcggg tgacagccct ccgaaggaag actctcctcc gtgcgtcctc 3660 gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg cgccgcactg ctccgaacaa 3720 taaagattct acaatactag cttttatggt tatgaagagg aaaaattggc agtaacctgg 3780 ccccacaaac cttcaaatga acgaatcaaa ttaacaacca taggatgata atgcgattag 3840 ttttttagcc ttatttctgg ggtaattaat cagcgaagcg atgatttttg atctattaac 3900 agatatataa atgcaaaaac tgcataacca ctttaactaa tactttcaac attttcggtt 3960 tgtattactt cttattcaaa tgtaataaaa gtatcaacaa aaaattgtta atatacctct 4020 atactttaac gtcaaggaga aaaaaccccg gatccgtaat acgactcact atagggcccg 4080 ggcgtcgaca tggaacagaa gttgatttcc gaagaagacc tcgagtaagc ttggtaccgc 4140 ggctagctaa gatccgctct aaccgaaaag gaaggagtta gacaacctga agtctaggtc 4200 cctatttatt tttttatagt tatgttagta ttaagaacgt tatttatatt tcaaattttt 4260 cttttttttc tgtacagacg cgtgtacgca tgtaacatta tactgaaaac cttgcttgag 4320 aaggttttgg gacgctcgaa gatccagctg cattaatgaa tcggccaacg cgcggggaga 4380 ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 4440 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 4500 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 4560 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 4620 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 4680 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 4740 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc 4800 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 4860 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 4920 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 4980 acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc 5040 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 5100 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa 5160 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 5220 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt 5280 ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 5340 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 5400 atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc 5460 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata 5520 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc 5580 cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc 5640 aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 5700 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa 5760 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca 5820 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt 5880 tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt 5940 tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg 6000 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga 6060 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc 6120 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg 6180 acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag 6240 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 6300 gttccgcgca catttccccg aaaagtgcca cctgaacgaa gcatctgtgc ttcattttgt 6360 agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt 6420 tacagaacag aaatgcaacg cgaaagcgct attttaccaa cgaagaatct gtgcttcatt 6480 tttgtaaaac aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc 6540 atttttacag aacagaaatg caacgcgaga gcgctatttt accaacaaag aatctatact 6600 tcttttttgt tctacaaaaa tgcatcccga gagcgctatt tttctaacaa agcatcttag 6660 attacttttt ttctcctttg tgcgctctat aatgcagtct cttgataact ttttgcactg 6720 taggtccgtt aaggttagaa gaaggctact ttggtgtcta ttttctcttc cataaaaaaa 6780 gcctgactcc acttcccgcg tttactgatt actagcgaag ctgcgggtgc attttttcaa 6840 gataaaggca tccccgatta tattctatac cgatgtggat tgcgcatact ttgtgaacag 6900 aaagtgatag cgttgatgat tcttcattgg tcagaaaatt atgaacggtt tcttctattt 6960 tgtctctata tactacgtat aggaaatgtt tacattttcg tattgttttc gattcactct 7020 atgaatagtt cttactacaa tttttttgtc taaagagtaa tactagagat aaacataaaa 7080 aatgtagagg tcgagtttag atgcaagttc aaggagcgaa aggtggatgg gtaggttata 7140 tagggatata gcacagagat atatagcaaa gagatacttt tgagcaatgt ttgtggaagc 7200 ggtattcgca atattttagt agctcgttac agtccggtgc gtttttggtt ttttgaaagt 7260 gcgtcttcag agcgcttttg gttttcaaaa gcgctctgaa gttcctatac tttctagaga 7320 ataggaactt cggaatagga acttcaaagc gtttccgaaa acgagcgctt ccgaaaatgc 7380 aacgcgagct gcgcacatac agctcactgt tcacgtcgca cctatatctg cgtgttgcct 7440 gtatatatat atacatgaga agaacggcat agtgcgtgtt tatgcttaaa tgcgtactta 7500 tatgcgtcta tttatgtagg atgaaaggta gtctagtacc tcctgtgata ttatcccatt 7560 ccatgcgggg tatcgtatgc ttccttcagc actacccttt agctgttcta tatgctgcca 7620 ctcctcaatt ggattagtct catccttcaa tgctatcatt tcctttgata ttggatcata 7680 ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt 7740 tcgtc 7745 <210> SEQ ID NO 48 <400> SEQUENCE: 48 000 <210> SEQ ID NO 49 <211> LENGTH: 6705 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pESC-HIS vector <400> SEQUENCE: 49 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240 gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300 ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360 tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420 atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480 aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540 atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600 cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660 ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720 ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780 ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840 gagtaaaaag gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900 tagatctttc gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960 gagatctctc ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020 ttaccctcca cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080 tcaaggctct tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140 cctccaccaa aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200 tatatacatg tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260 gatactgaag atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320 tttccttttt tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380 tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440 atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500 ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560 ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620 aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680 ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740 gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800 ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860 atgcgccgct acagggcgcg tccattcgcc attcaggctg cgcaactgtt gggaagggcg 1920 atcggtgcgg gcctcttcgc tattacgcca gctgaattgg agcgacctca tgctatacct 1980 gagaaagcaa cctgacctac aggaaagagt tactcaagaa taagaatttt cgttttaaaa 2040 cctaagagtc actttaaaat ttgtatacac ttattttttt tataacttat ttaataataa 2100 aaatcataaa tcataagaaa ttcgcttatt tagaagtgtc aacaacgtat ctaccaacga 2160 tttgaccctt ttccatcttt tcgtaaattt ctggcaaggt agacaagccg acaaccttga 2220 ttggagactt gaccaaacct ctggcgaaga attgttaatt aagagctcag atcttatcgt 2280 cgtcatcctt gtaatccatc gatactagtg cggccgccct ttagtgaggg ttgaattcga 2340 attttcaaaa attcttactt tttttttgga tggacgcaaa gaagtttaat aatcatatta 2400 catggcatta ccaccatata catatccata tacatatcca tatctaatct tacttatatg 2460 ttgtggaaat gtaaagagcc ccattatctt agcctaaaaa aaccttctct ttggaacttt 2520 cagtaatacg cttaactgct cattgctata ttgaagtacg gattagaagc cgccgagcgg 2580 gtgacagccc tccgaaggaa gactctcctc cgtgcgtcct cgtcttcacc ggtcgcgttc 2640 ctgaaacgca gatgtgcctc gcgccgcact gctccgaaca ataaagattc tacaatacta 2700 gcttttatgg ttatgaagag gaaaaattgg cagtaacctg gccccacaaa ccttcaaatg 2760 aacgaatcaa attaacaacc ataggatgat aatgcgatta gttttttagc cttatttctg 2820 gggtaattaa tcagcgaagc gatgattttt gatctattaa cagatatata aatgcaaaaa 2880 ctgcataacc actttaacta atactttcaa cattttcggt ttgtattact tcttattcaa 2940 atgtaataaa agtatcaaca aaaaattgtt aatatacctc tatactttaa cgtcaaggag 3000 aaaaaacccc ggatccgtaa tacgactcac tatagggccc gggcgtcgac atggaacaga 3060 agttgatttc cgaagaagac ctcgagtaag cttggtaccg cggctagcta agatccgctc 3120 taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat ttttttatag 3180 ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacagac 3240 gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg ggacgctcga 3300 agatccagct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc 3360 gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 3420 tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 3480 agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 3540 cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 3600 ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 3660 tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 3720 gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 3780 gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 3840 gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 3900 ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 3960 ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 4020 ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 4080 gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 4140 ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 4200 tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 4260 ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 4320 gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 4380 tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 4440 cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 4500 ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 4560 gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 4620 caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 4680 gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 4740 ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 4800 tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 4860 caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 4920 tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 4980 cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 5040 ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 5100 aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 5160 tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 5220 gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 5280 gaaaagtgcc acctgaacga agcatctgtg cttcattttg tagaacaaaa atgcaacgcg 5340 agagcgctaa tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac 5400 gcgaaagcgc tattttacca acgaagaatc tgtgcttcat ttttgtaaaa caaaaatgca 5460 acgcgagagc gctaattttt caaacaaaga atctgagctg catttttaca gaacagaaat 5520 gcaacgcgag agcgctattt taccaacaaa gaatctatac ttcttttttg ttctacaaaa 5580 atgcatcccg agagcgctat ttttctaaca aagcatctta gattactttt tttctccttt 5640 gtgcgctcta taatgcagtc tcttgataac tttttgcact gtaggtccgt taaggttaga 5700 agaaggctac tttggtgtct attttctctt ccataaaaaa agcctgactc cacttcccgc 5760 gtttactgat tactagcgaa gctgcgggtg cattttttca agataaaggc atccccgatt 5820 atattctata ccgatgtgga ttgcgcatac tttgtgaaca gaaagtgata gcgttgatga 5880 ttcttcattg gtcagaaaat tatgaacggt ttcttctatt ttgtctctat atactacgta 5940 taggaaatgt ttacattttc gtattgtttt cgattcactc tatgaatagt tcttactaca 6000 atttttttgt ctaaagagta atactagaga taaacataaa aaatgtagag gtcgagttta 6060 gatgcaagtt caaggagcga aaggtggatg ggtaggttat atagggatat agcacagaga 6120 tatatagcaa agagatactt ttgagcaatg tttgtggaag cggtattcgc aatattttag 6180 tagctcgtta cagtccggtg cgtttttggt tttttgaaag tgcgtcttca gagcgctttt 6240 ggttttcaaa agcgctctga agttcctata ctttctagag aataggaact tcggaatagg 6300 aacttcaaag cgtttccgaa aacgagcgct tccgaaaatg caacgcgagc tgcgcacata 6360 cagctcactg ttcacgtcgc acctatatct gcgtgttgcc tgtatatata tatacatgag 6420 aagaacggca tagtgcgtgt ttatgcttaa atgcgtactt atatgcgtct atttatgtag 6480 gatgaaaggt agtctagtac ctcctgtgat attatcccat tccatgcggg gtatcgtatg 6540 cttccttcag cactaccctt tagctgttct atatgctgcc actcctcaat tggattagtc 6600 tcatccttca atgctatcat ttcctttgat attggatcat ctaagaaacc attattatca 6660 tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtc 6705 <210> SEQ ID NO 50 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76 ORF <400> SEQUENCE: 50 Met Asp Phe Leu Ser Phe Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Arg Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Leu Ile 290 295 300 Leu Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 51 <211> LENGTH: 5368 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pET28(+) vector <400> SEQUENCE: 51 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180 cgacggagct cgaattcgga tcccgaccca tttgctgtcc accagtcatg ctagccatat 240 ggctgccgcg cggcaccagg ccgctgctgt gatgatgatg atgatggctg ctgcccatgg 300 tatatctcct tcttaaagtt aaacaaaatt atttctagag gggaattgtt atccgctcac 360 aattccccta tagtgagtcg tattaatttc gcgggatcga gatctcgatc ctctacgccg 420 gacgcatcgt ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg 480 acatcaccga tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg 540 tgggtatggt ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac 600 cattccttgc ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc 660 aggagtcgca taagggagag cgtcgagatc ccggacacca tcgaatggcg caaaaccttt 720 cgcggtatgg catgatagcg cccggaagag agtcaattca gggtggtgaa tgtgaaacca 780 gtaacgttat acgatgtcgc agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg 840 gtgaaccagg ccagccacgt ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg 900 gagctgaatt acattcccaa ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg 960 attggcgttg ccacctccag tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt 1020 aaatctcgcg ccgatcaact gggtgccagc gtggtggtgt cgatggtaga acgaagcggc 1080 gtcgaagcct gtaaagcggc ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc 1140 attaactatc cgctggatga ccaggatgcc attgctgtgg aagctgcctg cactaatgtt 1200 ccggcgttat ttcttgatgt ctctgaccag acacccatca acagtattat tttctcccat 1260 gaagacggta cgcgactggg cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg 1320 ctgttagcgg gcccattaag ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa 1380 tatctcactc gcaatcaaat tcagccgata gcggaacggg aaggcgactg gagtgccatg 1440 tccggttttc aacaaaccat gcaaatgctg aatgagggca tcgttcccac tgcgatgctg 1500 gttgccaacg atcagatggc gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc 1560 gttggtgcgg atatctcggt agtgggatac gacgataccg aagacagctc atgttatatc 1620 ccgccgttaa ccaccatcaa acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc 1680 ttgctgcaac tctctcaggg ccaggcggtg aagggcaatc agctgttgcc cgtctcactg 1740 gtgaaaagaa aaaccaccct ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc 1800 gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1860 cgcaattaat gtaagttagc tcactcatta ggcaccggga tctcgaccga tgcccttgag 1920 agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact 1980 tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat 2040 tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt 2100 cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg 2160 cgagaagcag gccattatcg ccggcatggc ggccccacgg gtgcgcatga tcgtgctcct 2220 gtcgttgagg acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc 2280 gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac 2340 atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg 2400 caccattatg ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac 2460 atctgtatta acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat 2520 ccataccgcc agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt 2580 aacccgtatc gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa 2640 tcccccttac acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg 2700 ctttatcaga agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga 2760 acaggcagac atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct 2820 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac 2880 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt 2940 tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg 3000 cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatatg cggtgtgaaa 3060 taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca 3120 ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 3180 taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 3240 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 3300 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 3360 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 3420 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 3480 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 3540 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 3600 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 3660 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 3720 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 3780 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 3840 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 3900 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaac aataaaactg 3960 tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct 4020 tgctctaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 4080 cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg 4140 ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 4200 gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 4260 actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta 4320 ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 4380 cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 4440 gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 4500 cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataaactttt gccattctca 4560 ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 4620 aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 4680 gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 4740 aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 4800 tttttctaag aattaattca tgagcggata catatttgaa tgtatttaga aaaataaaca 4860 aataggggtt ccgcgcacat ttccccgaaa agtgccacct gaaattgtaa acgttaatat 4920 tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga 4980 aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc 5040 agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac 5100 cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc 5160 gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 5220 gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag 5280 ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 5340 gccgctacag ggcgcgtccc attcgcca 5368 <210> SEQ ID NO 52 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum austrocaledonicum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase (SauSSy) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADO87001 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 52 Met Asp Ser Ser Thr Ala Thr Ala Met Thr Ala Pro Phe Ile Asp Pro 1 5 10 15 Thr Asp His Val Asn Leu Lys Thr Asp Thr Asp Ala Ser Glu Asn Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45 Ser Leu Ala Thr His His Asn Ile Val Glu Glu Arg His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Lys Phe Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Arg Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Ile 100 105 110 Tyr Lys Asp Glu Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Asn Lys Thr Gly Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Val Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Tyr 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Ala 180 185 190 Thr Lys Tyr Leu Lys Ser Ala Trp Glu Asn Ile Ser Glu Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Ala 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Ala Tyr Asp Val Tyr Gly Ser Met Asp Glu Leu Asp Leu Tyr 325 330 335 Thr Ser Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Ser Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Gln Gln Cys Lys Ser Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Phe His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Val Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Ile Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Gly Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Val Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 53 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum spicatum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase (SspiSSy) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADO87002 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 53 Met Asp Ser Ser Thr Ala Thr Ala Thr Thr Ala Pro Phe Ile Asp His 1 5 10 15 Thr Asp His Val Asn Leu Lys Ile Asp Asn Asp Ser Ser Glu Ser Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45 Ser Leu Ala Ile His His Asn Ile Val Glu Glu Lys His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Met Ser Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Gln Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Val 100 105 110 Tyr Lys Asp Gly Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Ser Lys Thr Asp Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Ile Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Phe 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Ala 180 185 190 Thr Lys Tyr Leu Lys Asn Ala Trp Glu Asn Ile Ser Gln Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Glu 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Ala Tyr Asp Val Tyr Gly Ser Met Asp Glu Leu Asp His Tyr 325 330 335 Thr Tyr Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Gly Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Glu Gln Cys Lys Ala Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Tyr His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Ile Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Met Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Glu Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Ile Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 54 <211> LENGTH: 4 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: ExxR motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (2)...(3) <223> OTHER INFORMATION: Xaa = any amino acid <400> SEQUENCE: 54 Glu Xaa Xaa Arg 1 <210> SEQ ID NO 55 <211> LENGTH: 8 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER INFORMATION: Xaa = Pro or Ile <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 5, 7 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 6 <223> OTHER INFORMATION: Xaa = Pro or Gly <400> SEQUENCE: 55 Xaa Pro Gly Pro Xaa Xaa Xaa Pro 1 5 <210> SEQ ID NO 56 <211> LENGTH: 7 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 4 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 7 <223> OTHER INFORMATION: Xaa = Gly or Ala <400> SEQUENCE: 56 Gly Arg Arg Xaa Cys Pro Xaa 1 5 <210> SEQ ID NO 57 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER INFORMATION: Xaa = Ala or Gly <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 3 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 4 <223> OTHER INFORMATION: Xaa = Asp or Glu <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 6 <223> OTHER INFORMATION: Xaa = Thr or Ser <400> SEQUENCE: 57 Xaa Gly Xaa Xaa Thr Xaa 1 5 <210> SEQ ID NO 58 <211> LENGTH: 692 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <223> OTHER INFORMATION: NADPH cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAB58575.1 <309> DATABASE ENTRY DATE: 1999-10-19 <400> SEQUENCE: 58 Met Thr Ser Ala Leu Tyr Ala Ser Asp Leu Phe Lys Gln Leu Lys Ser 1 5 10 15 Ile Met Gly Thr Asp Ser Leu Ser Asp Asp Val Val Leu Val Ile Ala 20 25 30 Thr Thr Ser Leu Ala Leu Val Ala Gly Phe Val Val Leu Leu Trp Lys 35 40 45 Lys Thr Thr Ala Asp Arg Ser Gly Glu Leu Lys Pro Leu Met Ile Pro 50 55 60 Lys Ser Leu Met Ala Lys Asp Glu Asp Asp Asp Leu Asp Leu Gly Ser 65 70 75 80 Gly Lys Thr Arg Val Ser Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala 85 90 95 Glu Gly Phe Ala Lys Ala Leu Ser Glu Glu Ile Lys Ala Arg Tyr Glu 100 105 110 Lys Ala Ala Val Lys Val Ile Asp Leu Asp Asp Tyr Ala Ala Asp Asp 115 120 125 Asp Gln Tyr Glu Glu Lys Leu Lys Lys Glu Thr Leu Ala Phe Phe Cys 130 135 140 Val Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe 145 150 155 160 Ser Lys Trp Phe Thr Glu Glu Asn Glu Arg Asp Ile Lys Leu Gln Gln 165 170 175 Leu Ala Tyr Gly Val Phe Ala Leu Gly Asn Arg Gln Tyr Glu His Phe 180 185 190 Asn Lys Ile Gly Ile Val Leu Asp Glu Glu Leu Cys Lys Lys Gly Ala 195 200 205 Lys Arg Leu Ile Glu Val Gly Leu Gly Asp Asp Asp Gln Ser Ile Glu 210 215 220 Asp Asp Phe Asn Ala Trp Lys Glu Ser Leu Trp Ser Glu Leu Asp Lys 225 230 235 240 Leu Leu Lys Asp Glu Asp Asp Lys Ser Val Ala Thr Pro Tyr Thr Ala 245 250 255 Val Ile Pro Glu Tyr Arg Val Val Thr His Asp Pro Arg Phe Thr Thr 260 265 270 Gln Lys Ser Met Glu Ser Asn Val Ala Asn Gly Asn Thr Thr Ile Asp 275 280 285 Ile His His Pro Cys Arg Val Asp Val Ala Val Gln Lys Glu Leu His 290 295 300 Thr His Glu Ser Asp Arg Ser Cys Ile His Leu Glu Phe Asp Ile Ser 305 310 315 320 Arg Thr Gly Ile Thr Tyr Glu Thr Gly Asp His Val Gly Val Tyr Ala 325 330 335 Glu Asn His Val Glu Ile Val Glu Glu Ala Gly Lys Leu Leu Gly His 340 345 350 Ser Leu Asp Leu Val Phe Ser Ile His Ala Asp Lys Glu Asp Gly Ser 355 360 365 Pro Leu Glu Ser Ala Val Pro Pro Pro Phe Pro Gly Pro Cys Thr Leu 370 375 380 Gly Thr Gly Leu Ala Arg Tyr Ala Asp Leu Leu Asn Pro Pro Arg Lys 385 390 395 400 Ser Ala Leu Val Ala Leu Ala Ala Tyr Ala Thr Glu Pro Ser Glu Ala 405 410 415 Glu Lys Leu Lys His Leu Thr Ser Pro Asp Gly Lys Asp Glu Tyr Ser 420 425 430 Gln Trp Ile Val Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala Ala 435 440 445 Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala Ile Ala 450 455 460 Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Cys Gln Asp Trp 465 470 475 480 Ala Pro Ser Arg Val His Val Thr Ser Ala Leu Val Tyr Gly Pro Thr 485 490 495 Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met Lys Asn 500 505 510 Ala Val Pro Ala Glu Lys Ser His Glu Cys Ser Gly Ala Pro Ile Phe 515 520 525 Ile Arg Ala Ser Asn Phe Lys Leu Pro Ser Asn Pro Ser Thr Pro Ile 530 535 540 Val Met Val Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu 545 550 555 560 Gln Glu Arg Met Ala Leu Lys Glu Asp Gly Glu Glu Leu Gly Ser Ser 565 570 575 Leu Leu Phe Phe Gly Cys Arg Asn Arg Gln Met Asp Phe Ile Tyr Glu 580 585 590 Asp Glu Leu Asn Asn Phe Val Asp Gln Gly Val Ile Ser Glu Leu Ile 595 600 605 Met Ala Phe Ser Arg Glu Gly Ala Gln Lys Glu Tyr Val Gln His Lys 610 615 620 Met Met Glu Lys Ala Ala Gln Val Trp Asp Leu Ile Lys Glu Glu Gly 625 630 635 640 Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His 645 650 655 Arg Thr Leu His Thr Ile Val Gln Glu Gln Glu Gly Val Ser Ser Ser 660 665 670 Glu Ala Glu Ala Ile Val Lys Lys Leu Gln Thr Glu Gly Arg Tyr Leu 675 680 685 Arg Asp Val Trp 690 <210> SEQ ID NO 59 <211> LENGTH: 1713 <212> TYPE: DNA <213> ORGANISM: Santalum austrocaledonicum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: HQ343277 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 59 atggattctt ccaccgccac cgccatgaca gctccattca ttgatcctac tgatcatgtg 60 aatctcaaaa ctgatactga tgcctcagag aatcgaagga tggggaatta taaacccagc 120 atttggaatt atgatttttt acaatcactt gcaactcatc acaatattgt ggaagagagg 180 catctaaagc tagctgagaa gctgaagggc caagtgaagt ttatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggctcgggct aaaccaccga 300 tttgagacag agatcaagga agcgctattt agtatttata aggacgagag caatggatgg 360 tggtttggcc accttcatgc gacatctctc cgatttaggc tgctacgaca gtgtgggctt 420 tttatccccc aggatgtgtt taaaacgttc caaaacaaaa ctggtgaatt tgatatgaaa 480 ctgtgtgaca acgtaaaagg gctgctgagc ttatatgaag cttcatactt gggatggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcgccacca agtacttgaa aagtgcatgg 600 gaaaatatat ctgaaaagtg gttagccaaa agagtgaagc atgcattggc tttacctttg 660 cattggagag tccctcgaat cgaagctaga tggttcattg aggcatatga gcaagaagcg 720 aatatgaacc caacactact caaactcgca aaattagact ttaatatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcta ggaataattt actgcaaagc tatatgtgga gctgcgcgat tgcttccgac 900 ccgaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtt 960 gatgatgcat atgacgtcta tggttcaatg gacgaacttg atctctacac aagctccgtt 1020 gaaaggtgga gctgtgtaga aattgacaag ttgccaaaca cgttaaaatt gatttttatg 1080 tctatgttta ataagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaat 1140 agcatcccta cttttatcaa agcgtgggtt caacagtgta aatcatacca gaaagaagca 1200 agatggttcc acgggggaca cacgcctccg ttggaagaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttgatcacc ggctacgtgg caatcgctga gaacgaggct 1320 gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg atataggaac gtctccggat gagatggcaa gaggcgataa tctgaagtca 1440 atccattgtt acatgaacgg aactggggct tccgaggaag ttgctcgtga gcacataaag 1500 ggagtaatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacggatagc tggacaaagg ttgatatgaa gtccgttttg 1680 attgacccta ttcctctcgg cgaggagtag taa 1713 <210> SEQ ID NO 60 <211> LENGTH: 1713 <212> TYPE: DNA <213> ORGANISM: Santalum spicatum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: HQ343278 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 60 atggattctt ccaccgccac cgccacgaca gctccattta ttgatcatac tgatcatgtg 60 aatcttaaaa ttgataatga ttcctccgag agtcgaagga tgggcaatta taaacccagt 120 atttggaatt atgattttct gcaatcactt gcaatccatc acaatattgt ggaagagaag 180 catctaaagc tagctgagaa gctgaagggc caagtgatgt ctatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggcttgggct aaaccaccaa 300 tttgagacag agatcaagga agccctattt agtgtttaca aggatgggag caatggatgg 360 tggtttggcc accttcatgc aacatctctt cgatttaggc tactacgaca gtgtgggctt 420 tttatccccc aggatgtgtt taaaacgttc cagagcaaaa ctgatgaatt tgatatgaaa 480 ctgtgtgaca acataaaagg gttgttgagc ttgtatgaag cttcattcct ggggtggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcgccacca agtacttgaa aaatgcatgg 600 gaaaatatat cccaaaagtg gctagccaaa agagtgaagc atgcactggc tttgcctctg 660 cactggagag tccctcgaat cgaggctaga tggttcattg aggcatatga gcaagaagag 720 aacatgaacc caacactact caaacttgca aaattagact ttaacatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcta ggaataattt actgcaaagc tatatgtgga gctgcgcgat tgcttccgac 900 ccaaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtg 960 gacgatgcat atgatgtcta tggttcaatg gatgaacttg atcactacac atactccgtt 1020 gaaaggtgga gctgtgtaga aattgacaag ctgccaaaca cgttaaaatt gatttttatg 1080 tctatgttca acaagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaac 1140 ggcatcccta cttttatcaa agcatgggtt gaacagtgta aagcatacca gaaagaggca 1200 agatggtacc atgggggaca cacgcctcca ttggaggaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttgatcacc ggctacatcg caatcgctga gaacgaggct 1320 gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg acatgggaac gtctccggac gagatggcaa gaggtgacaa tctgaagtca 1440 atccactgtt acatgaacga aactggggct tctgaggaag ttgctcgtga gcacataaaa 1500 ggaataatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacagatagc tggacaaagg ttgatatgaa gtctgttttg 1680 atcgacccta ttcctctcgg cgaggagtag taa 1713 <210> SEQ ID NO 61 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR2 forward primer <400> SEQUENCE: 61 atgcaattga gctccgtcaa g 21 <210> SEQ ID NO 62 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR2 reverse primer <400> SEQUENCE: 62 tcaccacaca tcccgtaaat accttcc 27 <210> SEQ ID NO 63 <211> LENGTH: 1950 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 truncated <400> SEQUENCE: 63 atgttcatgt ggcggagatc gggcgagaag tccaaggaat tgaggcctgt ggtggcgctg 60 aaggcggcgc cgatcgaggc ggaggaggac gatggcgagg ttgactcggg gaagactaag 120 gtcactgtgt tcttcggtac gcagactggc actgccgaag ggttcgctaa ggctttggca 180 gaagagatca aggcaagata tgaaaaagca gtcgtcaaag tggttgacct ggatgattat 240 gctgcagatg atgatcaata tggagaaaaa ttgaaaaatg agacgctgac atttttcatg 300 gtggccactt atggtgatgg agaaccaacc gataatgctg caagatttta caaatggttt 360 actgaggaga aagaaaggga agcttggtta cagcagctga cttatggcat ttttggtctg 420 ggaaatcgtc aatatgaaca ttttaataag atagcaaagg tgcttgatga acagcttact 480 gaacaaggtg caaagcgtct cattcaggtt ggtttaggtg atgatgatca gtgcatcgag 540 gatgattttt ctgcttggcg tgaactactg tggccagagt tagatcaatt actccggggt 600 gatgatggtg cgaattctgt gtctactccc tatacagctg ctgttcctga ataccgagtg 660 gtgatccatg atcctactat cacttcatct gaggataaat ccttagccac ggccaatggg 720 gctgctttat ttgacattca ccatccatgc agagttaagg ttgctgttca aagagagctt 780 cacaaagctg actctgaccg ctcttgcata catttggagt ttgatatatc aggcacgggt 840 cttatgtatg aaacgggaga ccatgtgggt gtttacgctg aaaattgtgt tgagactgtt 900 gaagaagcag gaaagctgtt gggccaacct ttagatttgc tcttttctgt tcacactgac 960 aaggatgatg gtacatctct tgagagctca ttgccccctc cttttcctgg tccttgcact 1020 cttcgcactg cactgtttca atatgcagat ctattgaacc ctcctaggaa ggctgcttta 1080 gttgccctgg cagctcatgc agttgaacca tctgaggcag acagacttaa atttttgtca 1140 tcacctcagg gaaaggatga gtatgcgaaa tgggttgttg gcagtcaaag aagcctcctt 1200 gaggtgatgg ctgagttccc gtcaataaaa gttccccttg gtgtgttttt tgccgctgtg 1260 gccccccgcc tacagcctcg ctactattca atctcatcat cgcctaggtt ctcctctgac 1320 cgggttcatg taacctgcgc tttagtttat ggccctagtc caacaggcag aattcacaga 1380 ggggtgtgtt ccacctggat gaagaatgca gttcctctag aagaaagccg tgagtgtagc 1440 tgggctccta tatttattag gacatctaat tttaagctac cagctaatcc ttctacccca 1500 gttatcatgg tcggccctgg tactggcttg gcaccgttta gaggattcct acaggaaagg 1560 atggccctgt tagaaggcgg tgctcaactt ggtcctgctt tacttttctt tggatgtaga 1620 aatcgaagga tggattttat ttacgaggat gaactcaaca atttcgtcga acaaggtgtg 1680 atatcagagt tgattgttgc attctcgagg gacgggccaa ccaaggagta cgttcagcat 1740 aagatgatgg ataaagctgc atatatatgg agtctaatct ctcagggggc ttatctttat 1800 gtctgtggtg atgcaaaggg gatggctaga gatgttcatc gaactttgca tactcttgtt 1860 caacaacagg agagcgtgga ctcatcaaaa gcagagtcaa tagtgaagaa gcttcagatg 1920 gatggacgat atctaagaga tgtttggtaa 1950 <210> SEQ ID NO 64 <211> LENGTH: 1938 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 truncated <400> SEQUENCE: 64 atgcggttct cgagctccca gaaggcggtg gcggcggcta agggcgtaga ggttgcgagg 60 aagccggtga tcgggaagga atcggaggcg gcggaggtgg atgacggaaa gaagaaggtg 120 accatcttct tcgggacgca gactggaaca gccgaagggt tcgccaaggc gctggttgag 180 gaggcaaaag cacgctatga gaaggccatt tttaaattgg ttgatttgga tgattatgct 240 gccgaggatg atgaatatga ggagaagttg aaaaaagaga aattcgcttt attcttttta 300 gccacatatg gagatggtga gcctactgac aatgcagcga ggttctataa atggtttact 360 gaggaaaatg aaagtggaga gtggctccaa aagcttcagt tcggagtgtt tggccttggc 420 aataggcaat acgagcattt caacaaggtt gcaaaggttg tggatgagat tcttgctgag 480 caaggtggga agcgcctggt tccagtgggt cttggagatg atgatcaatg cattgaagat 540 gacttcactg catggcgtga attagtgtgg cccgagttgg ataaattgct cctagatgag 600 gatgatgcaa ctgtttctac cccttatact gcttctgtac cggaataccg ggttgtattt 660 catgattctc ctgatgatta tctgcagaag aactctagta atgcaaatgg tcattcgatg 720 catgatgctc agcatccatg cagggctaat gttgctgtga ggagggagct tcattcgcct 780 ttatctgatc gttcttgcac tcatctagaa tttgacattg ctggaactgg acttgcgtat 840 gaaacagggg accatgttgg tgtgtgctgt gagaatttac ctgaagttgt ggaagaggct 900 gaaagggtac tgggtttgtc accaggcatc tacttttcca tccatgctga taaagaggat 960 ggcacaccac ttggaagttc cttgccacca ctttttccac catgtacttt aagaactgca 1020 ctaactcaac atgctgatct tctaagtttt cctaaaaagg ctgcgttgct tgctttagca 1080 gctcatgctt ctgatccaag tgaagcggat aggttgaaat atcttgcatc tcctgcagga 1140 aaggatgaat atgcacagtg ggttgttgca agtcagagaa gccttctaga agtaatggct 1200 gaattccctt cggcgaagcc cccacttgga gttttgtttg ctgcagttgc tccacgattg 1260 cagccacgat tctattcgat ctcatcctct ccaaagattg caccatctag gatacatgtt 1320 acttgcgcat tagtatatga taaaacacca actgggcgaa ttcacaaggg agtgtgctca 1380 acttggatga agaatgcgat gccccgggaa gaaagccacg attgcagctg ggctcccatt 1440 tttgttaggc aatctaattt caagctccct tcaaatacat cggtgcctgt catcatgatt 1500 ggtcctggca cggggttggc tcctttcagg ggctttctac aggaaagatt agcactgaaa 1560 gaagctggag ttgaactggg acctgcaata ttattctttg ggtgcaggaa ccgtaaaatg 1620 gattacattt atgaggatga gttggcacac tttgttgaag ccggtgcgct ctctgagttg 1680 atcgtggctt tctcacggga aggaccagcc aaacagtatg tccagcataa gatgatggaa 1740 aaggcctcag aaatctggaa catgatttcc gatggaggtt atgtatatgt atgtggtgat 1800 gccaaaggca tggccaaaga tgtccaccgg gcgctccata caattgttca cgaacaggga 1860 tctctagaca attccaagac agagagcatg gtgaagaatc tccaaatgaa tggaaggtat 1920 ttacgggatg tgtggtga 1938 <210> SEQ ID NO 65 <211> LENGTH: 3781 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pCDF-Duet vector <400> SEQUENCE: 65 ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180 taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga gatatacata 300 tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360 ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420 cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480 cctctaaacg ggtcttgagg ggttttttgc tgaaacctca ggcatttgag aagcacacgg 540 tcacactgct tccggtagtc aataaaccgg taaaccagca atagacataa gcggctattt 600 aacgaccctg ccctgaaccg acgaccgggt catcgtggcc ggatcttgcg gcccctcggc 660 ttgaacgaat tgttagacat tatttgccga ctaccttggt gatctcgcct ttcacgtagt 720 ggacaaattc ttccaactga tctgcgcgcg aggccaagcg atcttcttct tgtccaagat 780 aagcctgtct agcttcaagt atgacgggct gatactgggc cggcaggcgc tccattgccc 840 agtcggcagc gacatccttc ggcgcgattt tgccggttac tgcgctgtac caaatgcggg 900 acaacgtaag cactacattt cgctcatcgc cagcccagtc gggcggcgag ttccatagcg 960 ttaaggtttc atttagcgcc tcaaatagat cctgttcagg aaccggatca aagagttcct 1020 ccgccgctgg acctaccaag gcaacgctat gttctcttgc ttttgtcagc aagatagcca 1080 gatcaatgtc gatcgtggct ggctcgaaga tacctgcaag aatgtcattg cgctgccatt 1140 ctccaaattg cagttcgcgc ttagctggat aacgccacgg aatgatgtcg tcgtgcacaa 1200 caatggtgac ttctacagcg cggagaatct cgctctctcc aggggaagcc gaagtttcca 1260 aaaggtcgtt gatcaaagct cgccgcgttg tttcatcaag ccttacggtc accgtaacca 1320 gcaaatcaat atcactgtgt ggcttcaggc cgccatccac tgcggagccg tacaaatgta 1380 cggccagcaa cgtcggttcg agatggcgct cgatgacgcc aactacctct gatagttgag 1440 tcgatacttc ggcgatcacc gcttccctca tactcttcct ttttcaatat tattgaagca 1500 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 1560 aaatagctag ctcactcggt cgctacgctc cgggcgtgag actgcggcgg gcgctgcgga 1620 cacatacaaa gttacccaca gattccgtgg ataagcaggg gactaacatg tgaggcaaaa 1680 cagcagggcc gcgccggtgg cgtttttcca taggctccgc cctcctgcca gagttcacat 1740 aaacagacgc ttttccggtg catctgtggg agccgtgagg ctcaaccatg aatctgacag 1800 tacgggcgaa acccgacagg acttaaagat ccccaccgtt tccggcgggt cgctccctct 1860 tgcgctctcc tgttccgacc ctgccgttta ccggatacct gttccgcctt tctcccttac 1920 gggaagtgtg gcgctttctc atagctcaca cactggtatc tcggctcggt gtaggtcgtt 1980 cgctccaagc tgggctgtaa gcaagaactc cccgttcagc ccgactgctg cgccttatcc 2040 ggtaactgtt cacttgagtc caacccggaa aagcacggta aaacgccact ggcagcagcc 2100 attggtaact gggagttcgc agaggatttg tttagctaaa cacgcggttg ctcttgaagt 2160 gtgcgccaaa gtccggctac actggaagga cagatttggt tgctgtgctc tgcgaaagcc 2220 agttaccacg gttaagcagt tccccaactg acttaacctt cgatcaaacc acctccccag 2280 gtggtttttt cgtttacagg gcaaaagatt acgcgcagaa aaaaaggatc tcaagaagat 2340 cctttgatct tttctactga accgctctag atttcagtgc aatttatctc ttcaaatgta 2400 gcacctgaag tcagccccat acgatataag ttgtaattct catgttagtc atgccccgcg 2460 cccaccggaa ggagctgact gggttgaagg ctctcaaggg catcggtcga gatcccggtg 2520 cctaatgagt gagctaactt acattaattg cgttgcgctc actgcccgct ttccagtcgg 2580 gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 2640 gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag ctgattgccc 2700 ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgctggtttg ccccagcagg 2760 cgaaaatcct gtttgatggt ggttaacggc gggatataac atgagctgtc ttcggtatcg 2820 tcgtatccca ctaccgagat gtccgcacca acgcgcagcc cggactcggt aatggcgcgc 2880 attgcgccca gcgccatctg atcgttggca accagcatcg cagtgggaac gatgccctca 2940 ttcagcattt gcatggtttg ttgaaaaccg gacatggcac tccagtcgcc ttcccgttcc 3000 gctatcggct gaatttgatt gcgagtgaga tatttatgcc agccagccag acgcagacgc 3060 gccgagacag aacttaatgg gcccgctaac agcgcgattt gctggtgacc caatgcgacc 3120 agatgctcca cgcccagtcg cgtaccgtct tcatgggaga aaataatact gttgatgggt 3180 gtctggtcag agacatcaag aaataacgcc ggaacattag tgcaggcagc ttccacagca 3240 atggcatcct ggtcatccag cggatagtta atgatcagcc cactgacgcg ttgcgcgaga 3300 agattgtgca ccgccgcttt acaggcttcg acgccgcttc gttctaccat cgacaccacc 3360 acgctggcac ccagttgatc ggcgcgagat ttaatcgccg cgacaatttg cgacggcgcg 3420 tgcagggcca gactggaggt ggcaacgcca atcagcaacg actgtttgcc cgccagttgt 3480 tgtgccacgc ggttgggaat gtaattcagc tccgccatcg ccgcttccac tttttcccgc 3540 gttttcgcag aaacgtggct ggcctggttc accacgcggg aaacggtctg ataagagaca 3600 ccggcatact ctgcgacatc gtataacgtt actggtttca cattcaccac cctgaattga 3660 ctctcttccg ggcgctatca tgccataccg cgaaaggttt tgcgccattc gatggtgtcc 3720 gggatctcga cgctctccct tatgcgactc ctgcattagg aaattaatac gactcactat 3780 a 3781 <210> SEQ ID NO 66 <211> LENGTH: 471 <212> TYPE: PRT <213> ORGANISM: Bacillus megaterium <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450BM-3 <400> SEQUENCE: 66 Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys Asn 1 5 10 15 Leu Pro Leu Leu Asn Thr Asp Lys Pro Val Gln Ala Leu Met Lys Ile 20 25 30 Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala Pro Gly Arg Val 35 40 45 Thr Arg Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp Glu 50 55 60 Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu Lys Phe Val Arg Asp 65 70 75 80 Phe Ala Gly Asp Gly Leu Phe Thr Ser Trp Thr His Glu Lys Asn Trp 85 90 95 Lys Lys Ala His Asn Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala Met 100 105 110 Lys Gly Tyr His Ala Met Met Val Asp Ile Ala Val Gln Leu Val Gln 115 120 125 Lys Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu Asp 130 135 140 Met Thr Arg Leu Thr Leu Asp Thr Ile Gly Leu Cys Gly Phe Asn Tyr 145 150 155 160 Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr Ser 165 170 175 Met Val Arg Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala Asn 180 185 190 Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys Arg Gln Phe Gln Glu Asp 195 200 205 Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg Lys 210 215 220 Ala Ser Gly Glu Gln Ser Asp Asp Leu Leu Thr His Met Leu Asn Gly 225 230 235 240 Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile Arg Tyr 245 250 255 Gln Ile Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly Leu 260 265 270 Leu Ser Phe Ala Leu Tyr Phe Leu Val Lys Asn Pro His Val Leu Gln 275 280 285 Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro Ser 290 295 300 Tyr Lys Gln Val Lys Gln Leu Lys Tyr Val Gly Met Val Leu Asn Glu 305 310 315 320 Ala Leu Arg Leu Trp Pro Thr Ala Pro Ala Phe Ser Leu Tyr Ala Lys 325 330 335 Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp Glu 340 345 350 Leu Met Val Leu Ile Pro Gln Leu His Arg Asp Lys Thr Ile Trp Gly 355 360 365 Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn Pro Ser Ala 370 375 380 Ile Pro Gln His Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala Cys 385 390 395 400 Ile Gly Gln Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu Gly Met 405 410 415 Met Leu Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu Asp 420 425 430 Ile Lys Glu Thr Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys Ala 435 440 445 Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro Ser Pro Ser Thr Glu 450 455 460 Gln Ser Ala Lys Lys Val Arg 465 470 <210> SEQ ID NO 67 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F37v2 (CYP76-G14) <400> SEQUENCE: 67 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 68 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F39v2 (CYP76-G15) <400> SEQUENCE: 68 atggacttct taagttgtat cctgtctgtt ttgttcgcgt gggcgctggt tcgagctctc 60 cgtaaacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccatcc ccgacgccgt tcgagcctat ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 69 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F40 (CYP76-G16) <400> SEQUENCE: 69 atggacttct taagttgtat cctgtctgtt ttgttcgcgt gggcgctggt tcgagctctc 60 cgtaaacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 70 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F41 (CYP76-G17) <400> SEQUENCE: 70 atggacttct taagttgtat cctgtttgtt ttgttcgcat gggcgctggt tcatgctctc 60 cgtacacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 71 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F42 (CYP76-G13) <400> SEQUENCE: 71 atggacttct taagttgtat cctgtctgtt ttgttcgcat gggcgctggt tcgagctctc 60 cgtacacttt ctagaggttc caaagctgcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggcg 180 ctggccaaat cctacgatcc catcatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaagtc ctaccgtagc caaagaggtt cttcaaaaac aagacgtcgc cttctgtaac 300 cgaaccaccc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcga aagataagca actcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcagaagc tcgacgagct ccttgccagg 480 gtggcagaga gcagcctggt cggggcagcg gtggatatag gcgcggtagc tttcgtgacg 540 agtctaaact tgctatccaa cacagtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatgaagga ggtggtgtgg ggaatcatgg aggaagccgg gaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggatacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 72 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F43 (CYP76-G18) <400> SEQUENCE: 72 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcga aagataagca actcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcagaagc tcgacgagct ccttgccagg 480 gtggcagaga gcagcctggt cggggcagcg gtggatatag gcgcggtagc tttcgtgacg 540 agtctaaact tgctatccaa cacagtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatgaagga ggtggtgtgg ggaatcatgg aggaagccgg gaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggatacg ccgtcggatg 720 acgggtaatt tcgggaaaat gttggaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattcttga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacctct tactggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga ctgaactcct ccggaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 73 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F37v2 (CYP76-G14) <400> SEQUENCE: 73 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 74 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F39v2 (CYP76-G15) <400> SEQUENCE: 74 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Lys Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Ile Pro Asp Ala Val Arg Ala Tyr Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 75 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F40 (CYP76-G16) <400> SEQUENCE: 75 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Lys Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 76 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F41 (CYP76-G17) <400> SEQUENCE: 76 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val His Ala Leu Arg Thr Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 77 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F42 (CYP76-G13) <400> SEQUENCE: 77 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Ala Leu Ala Lys Ser 50 55 60 Tyr Asp Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Ser Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Gln Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Ala Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Val Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Lys Glu Val 195 200 205 Val Trp Gly Ile Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 78 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F43 (CYP76-G18) <400> SEQUENCE: 78 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Gln Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Ala Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Val Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Lys Glu Val 195 200 205 Val Trp Gly Ile Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Asn Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Leu Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Leu Leu 290 295 300 Leu Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 79 <211> LENGTH: 483 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: CYP720B4 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank ADR78276 <309> DATABASE ENTRY DATE: 2011-12-08 <400> SEQUENCE: 79 Met Ala Pro Met Ala Asp Gln Ile Ser Leu Leu Leu Val Val Phe Thr 1 5 10 15 Val Ala Val Ala Leu Leu His Leu Ile His Arg Trp Trp Asn Ile Gln 20 25 30 Arg Gly Pro Lys Met Ser Asn Lys Glu Val His Leu Pro Pro Gly Ser 35 40 45 Thr Gly Trp Pro Leu Ile Gly Glu Thr Phe Ser Tyr Tyr Arg Ser Met 50 55 60 Thr Ser Asn His Pro Arg Lys Phe Ile Asp Asp Arg Glu Lys Arg Tyr 65 70 75 80 Asp Ser Asp Ile Phe Ile Ser His Leu Phe Gly Gly Arg Thr Val Val 85 90 95 Ser Ala Asp Pro Gln Phe Asn Lys Phe Val Leu Gln Asn Glu Gly Arg 100 105 110 Phe Phe Gln Ala Gln Tyr Pro Lys Ala Leu Lys Ala Leu Ile Gly Asn 115 120 125 Tyr Gly Leu Leu Ser Val His Gly Asp Leu Gln Arg Lys Leu His Gly 130 135 140 Ile Ala Val Asn Leu Leu Arg Phe Glu Arg Leu Lys Val Asp Phe Met 145 150 155 160 Glu Glu Ile Gln Asn Leu Val His Ser Thr Leu Asp Arg Trp Ala Asp 165 170 175 Met Lys Glu Ile Ser Leu Gln Asn Glu Cys His Gln Met Val Leu Asn 180 185 190 Leu Met Ala Lys Gln Leu Leu Asp Leu Ser Pro Ser Lys Glu Thr Ser 195 200 205 Asp Ile Cys Glu Leu Phe Val Asp Tyr Thr Asn Ala Val Ile Ala Ile 210 215 220 Pro Ile Lys Ile Pro Gly Ser Thr Tyr Ala Lys Gly Leu Lys Ala Arg 225 230 235 240 Glu Leu Leu Ile Lys Lys Ile Ser Glu Met Ile Lys Glu Arg Arg Asn 245 250 255 His Pro Glu Val Val His Asn Asp Leu Leu Thr Lys Leu Val Glu Glu 260 265 270 Gly Leu Ile Ser Asp Glu Ile Ile Cys Asp Phe Ile Leu Phe Leu Leu 275 280 285 Phe Ala Gly His Glu Thr Ser Ser Arg Ala Met Thr Phe Ala Ile Lys 290 295 300 Phe Leu Thr Tyr Cys Pro Lys Ala Leu Lys Gln Met Lys Glu Glu His 305 310 315 320 Asp Ala Ile Leu Lys Ser Lys Gly Gly His Lys Lys Leu Asn Trp Asp 325 330 335 Asp Tyr Lys Ser Met Ala Phe Thr Gln Cys Val Ile Asn Glu Thr Leu 340 345 350 Arg Leu Gly Asn Phe Gly Pro Gly Val Phe Arg Glu Ala Lys Glu Asp 355 360 365 Thr Lys Val Lys Asp Cys Leu Ile Pro Lys Gly Trp Val Val Phe Ala 370 375 380 Phe Leu Thr Ala Thr His Leu His Glu Lys Phe His Asn Glu Ala Leu 385 390 395 400 Thr Phe Asn Pro Trp Arg Trp Gln Leu Asp Lys Asp Val Pro Asp Asp 405 410 415 Ser Leu Phe Ser Pro Phe Gly Gly Gly Ala Arg Leu Cys Pro Gly Ser 420 425 430 His Leu Ala Lys Leu Glu Leu Ser Leu Phe Leu His Ile Phe Ile Thr 435 440 445 Arg Phe Ser Trp Glu Ala Arg Ala Asp Asp Arg Thr Ser Tyr Phe Pro 450 455 460 Leu Pro Tyr Leu Thr Lys Gly Phe Pro Ile Ser Leu His Gly Arg Val 465 470 475 480 Glu Asn Glu <210> SEQ ID NO 80 <211> LENGTH: 501 <212> TYPE: PRT <213> ORGANISM: Camptotheca acuminate <220> FEATURE: <223> OTHER INFORMATION: CYP76B4 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AES93118 <309> DATABASE ENTRY DATE: 2011-11-09 <400> SEQUENCE: 80 Met Asp Ile Met Asp Phe Met Ser Phe Phe Ile Met Phe Phe Gly His 1 5 10 15 Leu Gln Ile Val Ser Ser Pro Thr Thr Ala Ala Ser Cys Lys Gly Cys 20 25 30 Lys Lys Ala Ser Thr Gly Pro Lys Pro Phe Pro Val Ile Gly Asn Leu 35 40 45 Leu Asp Val Val Gly Asn Gln Pro His Lys Ser Leu Ala Asn Leu Ala 50 55 60 Lys Thr His Gly Pro Leu Met Thr Leu Lys Leu Gly Gln Ile Thr Thr 65 70 75 80 Val Val Val Ser Ser Ser Thr Met Ala Lys Gln Ile Leu Gln Asn His 85 90 95 Asp Leu Tyr Phe Ser Asn Arg Tyr Thr Arg Asp Ala Ile Arg Ala Leu 100 105 110 Asn Gln Asp Gln Phe Ser Val Ile Trp Leu Pro Val Val Thr Arg Trp 115 120 125 Arg Asn Leu Arg Lys Ile Leu Asn Leu Tyr Met Leu Ser Thr Glu Arg 130 135 140 Leu Gly Ala Asn Gln Pro Ile Arg Cys Gln Lys Val Glu Glu Leu Ile 145 150 155 160 Ala Tyr Val Arg Gln Ser Cys Gln Ala Ser Val Ser Val Asp Ile Gly 165 170 175 Gln Ala Ala Phe Arg Thr Met Ile Asn Leu Thr Ser Lys Thr Ile Phe 180 185 190 Ser Val Asp Leu Ala Asp Pro Ser Ser Asp Thr Ala Gln Glu Leu Lys 195 200 205 Glu Leu Phe Trp Arg Ile Met Glu Glu Leu Gly Lys Pro Asn Leu Ala 210 215 220 Asp Tyr Phe Pro Val Leu Arg Lys Leu Asp Pro Gln Gly Ile Arg Arg 225 230 235 240 Arg Thr Thr Ile His Phe Ala Lys Val Phe Asp Leu Phe Asp Arg Met 245 250 255 Ile Asp Gln Arg Leu Glu Leu Leu Arg Ser Asp Asp Cys Cys Thr Gly 260 265 270 Asn Asp Leu Leu Asp Ser Leu Leu Asn Ile Ser Gln Asn Asn Ser Asp 275 280 285 Glu Ile Asp Gln Asn Gln Ile Lys Arg Met Leu Met Asp Val Phe Ile 290 295 300 Ala Ala Thr Asp Thr Thr Ser Ser Thr Leu Glu Trp Ala Met Thr Glu 305 310 315 320 Leu Leu Arg Asn Pro Glu Thr Leu Leu Lys Ala Lys Ala Glu Leu Gln 325 330 335 Gln Ile Val Gly Lys Gly Lys Leu Val Glu Glu Leu Asp Ile Ala Arg 340 345 350 Leu Pro Tyr Leu Gln Ala Ile Val Lys Glu Thr Phe Arg Leu His Thr 355 360 365 Thr Val Pro Phe Leu Ile Pro Arg Gln Val Asp Glu Asp Val Glu Val 370 375 380 Cys Gly Phe Thr Val Pro Lys Gly Ala Gln Val Leu Val Asn Ala Trp 385 390 395 400 Ala Ile Gly His Asp Pro Ser Ile Trp Pro Lys Pro Asp Ser Phe Met 405 410 415 Pro Glu Arg Phe Leu Glu Ser Glu Val Asp Val Arg Gly Leu Asp Phe 420 425 430 Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile Cys Pro Gly Ser Ala 435 440 445 Leu Ala Leu Arg Met Leu His Leu Met Leu Gly Ser Leu Ile Asn Ser 450 455 460 Phe Asp Trp Arg Leu Glu Asp Gly Ile Ala Pro Asn Asp Met Asp Met 465 470 475 480 Glu Glu Lys Phe Gly Leu Ser Leu Gln Lys Ala Arg Pro Leu Leu Phe 485 490 495 Ala Pro Val His Ile 500 <210> SEQ ID NO 81 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank Q8VWZ7 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 81 Met Asp Tyr Leu Thr Ile Ile Leu Thr Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Tyr Glu Ala Phe Ser Tyr Leu Ser Arg Arg Thr Lys Asn Leu Pro Pro 20 25 30 Gly Pro Ser Pro Leu Pro Phe Ile Gly Ser Leu His Leu Leu Gly Asp 35 40 45 Gln Pro His Lys Ser Leu Ala Lys Leu Ser Lys Lys His Gly Pro Ile 50 55 60 Met Ser Leu Lys Leu Gly Gln Ile Thr Thr Ile Val Ile Ser Ser Ser 65 70 75 80 Thr Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe Ser Ser 85 90 95 Arg Ser Val Pro Asn Ala Leu His Ala His Asn Gln Phe Lys Phe Ser 100 105 110 Val Val Trp Leu Pro Val Ala Ser Arg Trp Arg Ser Leu Arg Lys Val 115 120 125 Leu Asn Ser Asn Ile Phe Ser Gly Asn Arg Leu Asp Ala Asn Gln His 130 135 140 Leu Arg Thr Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg Lys Asn 145 150 155 160 Ser Gln Ser Gly Glu Ala Val Asp Val Gly Arg Ala Ala Phe Arg Thr 165 170 175 Ser Leu Asn Leu Leu Ser Asn Leu Ile Phe Ser Lys Asp Leu Thr Asp 180 185 190 Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp Asn Ile 195 200 205 Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Phe Phe Pro Leu Leu 210 215 220 Glu Lys Val Asp Pro Gln Gly Ile Arg His Arg Met Thr Ile His Phe 225 230 235 240 Gly Glu Val Leu Lys Leu Phe Gly Gly Leu Val Asn Glu Arg Leu Glu 245 250 255 Gln Arg Arg Ser Lys Gly Glu Lys Asn Asp Val Leu Asp Val Leu Leu 260 265 270 Thr Thr Ser Gln Glu Ser Pro Glu Glu Ile Asp Arg Thr His Ile Glu 275 280 285 Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ser 290 295 300 Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Asp Lys Met 305 310 315 320 Lys Lys Thr Gln Asp Glu Leu Ala Gln Val Ile Gly Arg Gly Lys Thr 325 330 335 Ile Glu Glu Ser Asp Ile Asn Arg Leu Pro Tyr Leu Arg Cys Val Met 340 345 350 Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Phe Leu Ile Pro Arg 355 360 365 Lys Val Glu Gln Ser Val Glu Val Cys Gly Tyr Asn Val Pro Lys Gly 370 375 380 Ser Gln Val Leu Val Asn Ala Trp Ala Ile Gly Arg Asp Glu Thr Val 385 390 395 400 Trp Asp Asp Ala Leu Ala Phe Lys Pro Glu Arg Phe Met Glu Ser Glu 405 410 415 Leu Asp Ile Arg Gly Arg Asp Phe Glu Leu Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Leu Arg Thr Val Pro Leu 435 440 445 Met Leu Gly Ser Leu Leu Asn Ser Phe Asn Trp Lys Leu Glu Gly Gly 450 455 460 Met Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile Thr Leu 465 470 475 480 Gln Lys Ala His Pro Leu Arg Ala Val Pro Ser Thr Leu 485 490 <210> SEQ ID NO 82 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Swertia mussotii <220> FEATURE: <223> OTHER INFORMATION: CYP76B4 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank D1MI46 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 82 Met Asp Phe Asp Phe Leu Thr Ile Ala Ile Gly Phe Leu Phe Thr Ile 1 5 10 15 Thr Leu Tyr Gln Ala Leu Asn Phe Phe Ser Arg Lys Ser Lys Asn Leu 20 25 30 Pro Pro Gly Pro Ser Pro Leu Pro Leu Ile Gly Asn Leu His Leu Leu 35 40 45 Gly Asp Gln Pro His Lys Ser Leu Ala Lys Leu Ala Lys Lys His Gly 50 55 60 Pro Ile Met Gly Leu Gln Leu Gly Gln Val Thr Thr Ile Val Val Thr 65 70 75 80 Ser Ser Gly Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe 85 90 95 Ser Ser Arg Ser Ile Pro Asn Ala Ile His Ala His Asp Gln Tyr Lys 100 105 110 Tyr Ser Val Ile Trp Leu Pro Val Ala Ser Arg Trp Arg Gly Leu Arg 115 120 125 Lys Ala Leu Asn Ser Asn Met Phe Ser Gly Asn Arg Leu Asp Ala Asn 130 135 140 Gln His Leu Arg Ser Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg 145 150 155 160 Lys Ser Ser Gln Thr Gly Asp Ala Ile Asp Val Gly Arg Ala Ala Phe 165 170 175 Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Met Phe Ser Lys Asp Leu 180 185 190 Thr Asp Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp 195 200 205 Asn Val Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr Phe Pro 210 215 220 Leu Leu Asp Lys Val Asp Pro Gln Gly Ile Arg Lys Arg Met Thr Ile 225 230 235 240 His Phe Gly Lys Ile Leu Glu Leu Phe Gly Gly Leu Ile Asp Glu Arg 245 250 255 Leu Gln Gln Lys Lys Ala Lys Gly Val Asn Asp Asp Val Leu Asp Val 260 265 270 Leu Leu Thr Thr Ser Glu Glu Ser Pro Glu Glu Ile Asp Arg Thr His 275 280 285 Ile Gln Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr 290 295 300 Ser Ser Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Glu 305 310 315 320 Lys Met Lys Ala Ala Gln Ala Glu Leu Ala Gln Val Ile Gly Lys Gly 325 330 335 Lys Ala Val Glu Glu Ala Asp Leu Ala Arg Leu Pro Tyr Leu Arg Cys 340 345 350 Ala Ile Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Leu Leu Ile 355 360 365 Pro Arg Arg Thr Glu Gln Glu Val Glu Val Cys Gly Tyr Thr Val Pro 370 375 380 Lys Asn Ser Gln Val Leu Val Asn Val Trp Ala Ile Ser Arg Asp Asp 385 390 395 400 Ala Ile Trp Lys Asp Pro Leu Ser Phe Lys Pro Glu Arg Phe Leu Glu 405 410 415 Ser Glu Leu Glu Met Arg Gly Lys Asp Phe Glu Leu Ile Pro Phe Gly 420 425 430 Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Val Arg Met Val 435 440 445 Pro Val Met Leu Gly Ser Leu Leu Asn Ser Phe Asp Trp Lys Leu Glu 450 455 460 Gly Gly Ile Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile 465 470 475 480 Thr Leu Gln Lys Ala His Pro Leu Arg Ala Val Ala Thr Pro Leu 485 490 495 <210> SEQ ID NO 83 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <220> FEATURE: <223> OTHER INFORMATION: CYP76M7 ent-cassadiene C11a-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: NCBI NP_001047185 <309> DATABASE ENTRY DATE: 2010-06-08 <400> SEQUENCE: 83 Met Glu Asn Ser Gln Val Trp Leu Leu Trp Gly Ala Leu Ser Val Ala 1 5 10 15 Val Leu Phe Tyr Leu Ser Thr Leu Arg Arg Arg Tyr Ala Gly Gly Lys 20 25 30 Pro Leu Pro Pro Gly Pro Thr Pro Leu Pro Leu Ile Gly Asn Leu His 35 40 45 Leu Ala Gly Gly Thr Phe His His Lys Leu Arg Asp Leu Ala Arg Val 50 55 60 His Gly Pro Val Met Thr Leu Lys Leu Gly Leu Ala Thr Asn Val Val 65 70 75 80 Ile Ser Ser Arg Glu Ala Ala Ile Glu Ala Tyr Thr Lys Tyr Asp Arg 85 90 95 His Leu Ala Ala Arg Ala Thr Pro Asp Thr Phe Arg Ala Cys Gly Phe 100 105 110 Ala Asp Arg Ser Met Val Phe Ile Pro Ser Ser Asp Pro Gln Trp Lys 115 120 125 Ala Leu Arg Gly Ile Gln Gly Ser His Val Phe Thr Pro Arg Gly Leu 130 135 140 Ala Ala Val Arg Pro Ile Arg Glu Arg Lys Val Gly Asp Leu Ile Ala 145 150 155 160 Tyr Leu Arg Ala His Ala Gly Glu Glu Val Leu Leu Gly Gln Ala Met 165 170 175 Tyr Thr Gly Leu Leu Asn Leu Val Ser Phe Ser Tyr Phe Ser Ile Asp 180 185 190 Ile Val Asp Met Gly Ser Gln Met Ala Arg Asp Leu Arg Glu Val Val 195 200 205 Asp Asp Ile Ile Ser Val Val Gly Lys Pro Asn Ile Ser Asp Phe Tyr 210 215 220 Pro Phe Leu Arg Pro Leu Asp Leu Gln Gly Leu Arg Arg Trp Thr Thr 225 230 235 240 Lys Arg Phe Asn Arg Val Phe Ser Ile Met Gly Asp Ile Ile Asp Arg 245 250 255 Arg Leu Ala His Ile Arg Asp Gly Lys Pro Arg His Asp Asp Phe Leu 260 265 270 Asp Ser Leu Leu Glu Leu Met Ala Thr Gly Lys Met Glu Arg Val Asn 275 280 285 Val Val Asn Met Leu Phe Glu Ala Phe Val Ala Gly Val Asp Thr Met 290 295 300 Ala Leu Thr Leu Glu Trp Val Met Ala Glu Leu Leu His Asn Pro Ala 305 310 315 320 Ile Met Ala Arg Val Arg Ala Glu Leu Ser Asp Val Leu Gly Gly Lys 325 330 335 Glu Ala Val Glu Glu Ala Asp Ala Ala Arg Leu Pro Tyr Leu Gln Ala 340 345 350 Val Leu Lys Glu Ala Met Arg Leu His Pro Val Gly Ala Leu Leu Leu 355 360 365 Pro His Phe Ala Ala Glu Asp Gly Val Glu Ile Gly Gly Tyr Ala Val 370 375 380 Pro Arg Gly Ser Thr Val Leu Phe Asn Ala Trp Ala Ile Met Arg Asp 385 390 395 400 Pro Ala Ala Trp Glu Arg Pro Asp Glu Phe Val Pro Glu Arg Phe Leu 405 410 415 Gly Arg Ser Pro Pro Leu Asp Phe Arg Gly Lys Asp Val Glu Phe Met 420 425 430 Pro Phe Gly Ser Gly Arg Arg Leu Cys Pro Gly Leu Pro Leu Ala Glu 435 440 445 Arg Val Val Pro Phe Ile Leu Ala Ser Met Leu His Thr Phe Glu Trp 450 455 460 Lys Leu Pro Gly Gly Met Thr Ala Glu Asp Val Asp Val Ser Glu Lys 465 470 475 480 Phe Lys Ser Ala Asn Val Leu Ala Val Pro Leu Lys Ala Val Pro Val 485 490 495 Leu Ile Lys <210> SEQ ID NO 84 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71A32 menthofuran synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Uniprot Q947B7 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 84 Met Ala Ala Leu Leu Val Phe Phe Ser Val Ser Leu Ile Leu Leu Ala 1 5 10 15 Val Leu Phe His Lys Arg Lys Ser Ser Leu Ser Ser Arg Lys Arg Pro 20 25 30 Pro Pro Ser Pro Leu Arg Leu Pro Val Ile Gly His Phe His Leu Ile 35 40 45 Gly Ala Leu Ser His Arg Ser Phe Thr Ser Leu Ser Lys Arg Tyr Gly 50 55 60 Glu Val Met Leu Leu His Phe Gly Ser Ala Pro Val Leu Val Ala Ser 65 70 75 80 Ser Ala Ala Ala Ala Arg Glu Ile Met Lys Asn Gln Asp Val Ile Phe 85 90 95 Ala Ser Arg Pro Arg Leu Ser Ile Phe Asp Arg Leu Met Tyr Ser Gly 100 105 110 Lys Gly Val Ala Phe Ala Pro Tyr Gly Glu His Trp Arg Asn Ala Arg 115 120 125 Ser Met Cys Met Leu Gln Leu Leu Ser Ala Lys Arg Val Gln Ser Phe 130 135 140 Gly Gly Ile Arg Glu Glu Glu Thr Ser Ala Met Ile Glu Lys Ile Arg 145 150 155 160 Arg Ser Lys Pro Thr Thr Val Val Asn Leu Ser Glu Met Phe Met Ala 165 170 175 Leu Thr Asn Gly Val Ile His Arg Ala Val Leu Gly Arg Lys Gly Asp 180 185 190 Gly Gly Asp Asp Phe Asn Arg Ile Leu Ile Lys Val Ile Lys Leu Leu 195 200 205 Gly Ser Phe Asn Val Gly Asp Tyr Val Pro Trp Leu Ser Trp Ile Asn 210 215 220 Arg Ile Asn Gly Val Asp Ala Glu Val Glu Lys Val Gly Thr Lys Leu 225 230 235 240 Asp Gly Ser Met Glu Gly Ile Leu Arg Lys Tyr Arg Arg Lys Lys Val 245 250 255 Gly Asp Asp Glu Thr Asn Phe Val Asp Thr Leu Leu Gln Phe Gln Arg 260 265 270 Glu Ser Lys Asp Thr Asp Pro Val Glu Asp Asp Val Ile Lys Ala Leu 275 280 285 Ile Phe Asp Met Val Ser Ala Gly Thr Asp Thr Thr Phe Ala Ala Leu 290 295 300 Glu Trp Thr Met Ala Glu Leu Ile Lys Asn Pro Arg Thr Leu Lys Thr 305 310 315 320 Leu Gln Asn Glu Val Arg Glu Val Ser Arg Asn Lys Gly Gly Ile Thr 325 330 335 Glu Asp Asp Val Asp Lys Met Pro Tyr Leu Lys Ala Val Ser Lys Glu 340 345 350 Ile Leu Arg Leu His Pro Pro Phe Ala Ile Leu Leu Pro Arg Glu Leu 355 360 365 Thr Gln Asp Ala Asn Met Leu Gly Tyr Asp Ile Pro Arg Gly Thr Val 370 375 380 Val Leu Val Asn Asn Trp Ala Ile Ser Arg Asp Pro Ser Leu Trp Glu 385 390 395 400 Asn Pro Glu Glu Phe Arg Pro Glu Arg Phe Leu Glu Thr Ser Ile Asp 405 410 415 Tyr Lys Gly Leu His Phe Glu Met Leu Pro Phe Gly Ser Gly Arg Arg 420 425 430 Gly Cys Pro Gly Ser Thr Phe Ala Met Ala Leu Tyr Glu Leu Ala Leu 435 440 445 Ser Lys Leu Val Asn Glu Phe Asp Phe Arg Leu Gly Asn Gly Asp Arg 450 455 460 Ala Glu Asp Leu Asp Met Thr Glu Ala Pro Gly Phe Val Val His Lys 465 470 475 480 Lys Ser Pro Leu Leu Val Leu Ala Thr Pro Arg Gln Ser 485 490 <210> SEQ ID NO 85 <211> LENGTH: 502 <212> TYPE: PRT <213> ORGANISM: Persea americana <220> FEATURE: <223> OTHER INFORMATION: CYP71A1 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Uniprot P24465 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 85 Met Ala Ile Leu Val Ser Leu Leu Phe Leu Ala Ile Ala Leu Thr Phe 1 5 10 15 Phe Leu Leu Lys Leu Asn Glu Lys Arg Glu Lys Lys Pro Asn Leu Pro 20 25 30 Pro Ser Pro Pro Asn Leu Pro Ile Ile Gly Asn Leu His Gln Leu Gly 35 40 45 Asn Leu Pro His Arg Ser Leu Arg Ser Leu Ala Asn Glu Leu Gly Pro 50 55 60 Leu Ile Leu Leu His Leu Gly His Ile Pro Thr Leu Ile Val Ser Thr 65 70 75 80 Ala Glu Ile Ala Glu Glu Ile Leu Lys Thr His Asp Leu Ile Phe Ala 85 90 95 Ser Arg Pro Ser Thr Thr Ala Ala Arg Arg Ile Phe Tyr Asp Cys Thr 100 105 110 Asp Val Ala Phe Ser Pro Tyr Gly Glu Tyr Trp Arg Gln Val Arg Lys 115 120 125 Ile Cys Val Leu Glu Leu Leu Ser Ile Lys Arg Val Asn Ser Tyr Arg 130 135 140 Ser Ile Arg Glu Glu Glu Val Gly Leu Met Met Glu Arg Ile Ser Gln 145 150 155 160 Ser Cys Ser Thr Gly Glu Ala Val Asn Leu Ser Glu Leu Leu Leu Leu 165 170 175 Leu Ser Ser Gly Thr Ile Thr Arg Val Ala Phe Gly Lys Lys Tyr Glu 180 185 190 Gly Glu Glu Glu Arg Lys Asn Lys Phe Ala Asp Leu Ala Thr Glu Leu 195 200 205 Thr Thr Leu Met Gly Ala Phe Phe Val Gly Asp Tyr Phe Pro Ser Phe 210 215 220 Ala Trp Val Asp Val Leu Thr Gly Met Asp Ala Arg Leu Lys Arg Asn 225 230 235 240 His Gly Glu Leu Asp Ala Phe Val Asp His Val Ile Asp Asp His Leu 245 250 255 Leu Ser Arg Lys Ala Asn Gly Ser Asp Gly Val Glu Gln Lys Asp Leu 260 265 270 Val Asp Val Leu Leu His Leu Gln Lys Asp Ser Ser Leu Gly Val His 275 280 285 Leu Asn Arg Asn Asn Leu Lys Ala Val Ile Leu Asp Met Phe Ser Gly 290 295 300 Gly Thr Asp Thr Thr Ala Val Thr Leu Glu Trp Ala Met Ala Glu Leu 305 310 315 320 Ile Lys His Pro Asp Val Met Glu Lys Ala Gln Gln Glu Val Arg Arg 325 330 335 Val Val Gly Lys Lys Ala Lys Val Glu Glu Glu Asp Leu His Gln Leu 340 345 350 His Tyr Leu Lys Leu Ile Ile Lys Glu Thr Leu Arg Leu His Pro Val 355 360 365 Ala Pro Leu Leu Val Pro Arg Glu Ser Thr Arg Asp Val Val Ile Arg 370 375 380 Gly Tyr His Ile Pro Ala Lys Thr Arg Val Phe Ile Asn Ala Trp Ala 385 390 395 400 Ile Gly Arg Asp Pro Lys Ser Trp Glu Asn Ala Glu Glu Phe Leu Pro 405 410 415 Glu Arg Phe Val Asn Asn Ser Val Asp Phe Lys Gly Gln Asp Phe Gln 420 425 430 Leu Ile Pro Phe Gly Ala Gly Arg Arg Gly Cys Pro Gly Ile Ala Phe 435 440 445 Gly Ile Ser Ser Val Glu Ile Ser Leu Ala Asn Leu Leu Tyr Trp Phe 450 455 460 Asn Trp Glu Leu Pro Gly Asp Leu Thr Lys Glu Asp Leu Asp Met Ser 465 470 475 480 Glu Ala Val Gly Ile Thr Val His Met Lys Phe Pro Leu Gln Leu Val 485 490 495 Ala Lys Arg His Leu Ser 500 <210> SEQ ID NO 86 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Cichoriium intybus <220> FEATURE: <223> OTHER INFORMATION: CYP71AV8 valencene oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank ADM86719 <309> DATABASE ENTRY DATE: 2011-01-24 <400> SEQUENCE: 86 Met Glu Ile Ser Ile Pro Thr Thr Leu Gly Leu Ala Val Ile Ile Phe 1 5 10 15 Ile Ile Phe Lys Leu Leu Thr Arg Thr Thr Ser Lys Lys Asn Leu Leu 20 25 30 Pro Glu Pro Trp Arg Leu Pro Ile Ile Gly His Met His His Leu Ile 35 40 45 Gly Thr Met Pro His Arg Gly Val Met Glu Leu Ala Arg Lys His Gly 50 55 60 Ser Leu Met His Leu Gln Leu Gly Glu Val Ser Thr Ile Val Val Ser 65 70 75 80 Ser Pro Arg Trp Ala Lys Glu Val Leu Thr Thr Tyr Asp Ile Thr Phe 85 90 95 Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu Ile Val Ala Tyr His Asn 100 105 110 Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg 115 120 125 Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn Lys Lys Val Lys Ser Phe 130 135 140 Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn Leu Val Lys Asp Ile Arg 145 150 155 160 Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys 165 170 175 Met Ile Ala Thr Ile Leu Ser Arg Ala Ala Phe Gly Lys Gly Ile Lys 180 185 190 Asp Gln Met Lys Phe Thr Glu Leu Val Lys Glu Ile Leu Arg Leu Thr 195 200 205 Gly Gly Phe Asp Val Ala Asp Ile Phe Pro Ser Lys Lys Leu Leu His 210 215 220 His Leu Ser Gly Lys Arg Ala Lys Leu Thr Asn Ile His Asn Lys Leu 225 230 235 240 Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu His Pro Gly Asn Arg Thr 245 250 255 Ser Ser Ser Gln Glu Thr Leu Leu Asp Val Leu Leu Arg Leu Lys Glu 260 265 270 Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn Val Lys Ala Val Ile Leu 275 280 285 Asp Met Phe Gly Ala Gly Thr Asp Thr Ser Ser Ala Thr Ile Glu Trp 290 295 300 Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg Ala Met Glu Lys Val Gln 305 310 315 320 Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu 325 330 335 Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu 340 345 350 Arg Leu His Pro Pro Leu Pro Leu Val Met Pro Arg Glu Cys Arg Glu 355 360 365 Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile 370 375 380 Val Asn Val Phe Ala Ile Asn Arg Asp Pro Glu Tyr Trp Lys Asp Ala 385 390 395 400 Glu Thr Phe Met Pro Glu Arg Phe Glu Asn Ser Pro Ile Thr Val Met 405 410 415 Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys 420 425 430 Pro Gly Ala Ala Leu Gly Leu Ala Asn Val Glu Leu Pro Leu Ala His 435 440 445 Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu 450 455 460 Asp Leu Asp Met Thr Glu Ser Phe Gly Ala Thr Val Gln Arg Lys Thr 465 470 475 480 Glu Leu Leu Leu Val Pro Thr Asp Phe Gln Thr Leu Thr Ala Ser Thr 485 490 495 <210> SEQ ID NO 87 <211> LENGTH: 1732 <212> TYPE: DNA <213> ORGANISM: Mentha x gracilis <220> FEATURE: <223> OTHER INFORMATION: CYP71D13 (-)-limonene-3-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AY281027 <309> DATABASE ENTRY DATE: 2003-11-07 <400> SEQUENCE: 87 aataatggag ctccagattt cgtcggcaat tataatcctc gtcgcaacat tcgtcgcatc 60 cctcctaatc aagcaatggc gaaaatcgga atcccaacaa aacctgcccc cgggcccgcc 120 gaagctgccg ctggtcggcc acctccacct cctatggggg aagctgccgc agcacgcgat 180 ggccgacatg gccaagaagt acggccccgt cacccacgtg cagctcggcg aggtcttctc 240 cgtcgtcctt tcgtcgcgag aagcgacgaa agaggcgatg aagctgctcg accccgcgtg 300 cgcggacagg ttcgagagca tcgggacgag gatcatgtgg tacgacaacg acgacatcat 360 cttcagcccg tacagcgacc actggcgcca gatgcgcaag atatgcgtct ctgagctcct 420 cagtgcccgc aacgtacggt ccttcgggtt catccgtcag gacgagatgt cgcgcctcct 480 ccgccacctc cagtcgtcgg cgggggagac cgtcgacatg acagagagga tagcgacgct 540 tacgtgctcc atcatctgta gggcggcgtt cggggccatc atcaacgatc acgaggagct 600 tgtggagttg gtgaaggact cgctgagcat ggcgtcaggg tttgagcttg ctgacttgtt 660 cccctcctcc aaactcctca acttgctctg ctggaacaag agcaagttgt ggaggatgcg 720 ccgccgcgtc gacaccatcc tcgaggccat cgtggaggag cacaagctca agaagagcgg 780 cgagtttggc ggtgaagaca tcatcgacgt cctcttcaga atgcagaagg acagccagat 840 caaagtcccc atcaccacca atgccatcaa agccttcatc ttcgacacgt tctcagcagg 900 gactgagacc tcgtcgacca ccaccttatg ggtgatggca gagctgatga ggaatccggc 960 agtgatggcg aaggcgcagg cggaggtgag agcggcactg aaggggaaga cgagtgtgga 1020 tgtggatgac gtgcaggagc tcaagtacat gaaatcggtg gtgaaggaga caatgaggat 1080 gcaccccccg atcccgttga tcccgagatc atgcagagaa gaatgcgagg ttaacggata 1140 taaaattccg aacaaggcta ggatcatgat caacgtctgg tctatgggaa ggaatcccct 1200 ctactgggaa aagccggaga ccttttggcc cgaaagattc gaccaagttt cgagggattt 1260 catgggaagc gatttcgagt tcatcccgtt tggagcggga agaagaatct gccccggttt 1320 gaatttcggg ctggccaacg tcgaggttcc attggcacaa cttctttacc acttcgactg 1380 gaaattagcg gaaggaatga agccttcgga tatggacatg tccgaggccg aaggccttac 1440 cggaataaga aagaacaatc ttctactggt tcccacaccc tacaatcctt cctcatgatc 1500 aataatcttt tactccttca aataaagagt gcatatacat atatgtacat gtagctcagg 1560 gttataaata agcaaatatg taacttttcc ctttttgaac tctattatgt aatccaaaac 1620 tagcatgtca tgtatctagg tttcaattca tatgcataat tttgtgcatg tattacccca 1680 gtagtgatgt ggttaatgcc cgagaccttt gtggtaaaaa aaaaaaaaaa aa 1732 <210> SEQ ID NO 88 <211> LENGTH: 1515 <212> TYPE: DNA <213> ORGANISM: Nicotiana tabacum <220> FEATURE: <223> OTHER INFORMATION: CYP71D20 5-epi-aristocholene-1,3-dihydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AF368376 <309> DATABASE ENTRY DATE: 2005-09-20 <400> SEQUENCE: 88 atgcaattct tcagcttggt ttccattttc ctattcctat ctttcctatt tctgttgagg 60 aaatggaaga actccaatag ccaaagcaaa aaattgccac caggtccatg gaaaatacca 120 atactaggaa gtatgcttca tatgattggt ggagaaccgc accatgtcct tagagattta 180 gccaaaaaat atggaccact tatgcacctt cagttaggtg aaatttctgc agttgtggtt 240 acttctaggg acatggcaaa agaagtgcta aaaactcatg acgtcgtttt tgcatctagg 300 cctaaaattg tagccatgga cattatctgt tataaccagt ccgacattgc ctttagccct 360 tatggcgacc actggagaca aatgcgtaaa atttgtgtca tggaacttct caatgcaaag 420 aatgttcggt ctttcagctc catcagacgt gatgaagtcg ttcgtctcat tgactctatc 480 cggtcagatt cttcttcagg tgagctagtt aattttacgc agaggatcat ttggtttgca 540 agctccatga cgtgtagatc agcatttggg caagtactca aggggcaaga catatttgcc 600 aaaaagatca gagaagtaat aggattagca gaaggctttg atgtggtaga catcttccct 660 acatacaagt ttcttcatgt tctcagtggg atgaagcgta aacttttgaa tgcccacctt 720 aaggtagacg ccattgttga ggatgtcatc aacgagcaca agaaaaatct tgcagctggc 780 aagagtaatg gcgcattagg aggcgaagat ctaattgatg tcctactgag acttatgaat 840 gacacaagtc ttcaatttcc catcaccaac gacaatatca aagctgttat tgttgacatg 900 tttgctgccg gaacagaaac ttcatcaaca acaactgtat gggctatggc tgaaatgatg 960 aagaatccaa gtgtattcac caaagctcaa gcagaagtgc gagaagcctt tagggacaaa 1020 gtatcttttg atgaaaatga tgtggaggag ctgaaatact taaagttagt cattaaagaa 1080 actttgagac ttcatccacc gtctccactt ttggtcccaa gagaatgcag ggaagatacg 1140 gatataaacg gctacactat tcctgcgaag accaaagtta tggttaatgt ttgggcattg 1200 ggaagagatc caaaatattg ggatgacgcg gaaagcttta agccagagag atttgagcaa 1260 tgctctgtgg atttttttgg taataatttt gagtttcttc cctttggcgg tggacggaga 1320 atttgtcctg gaatgtcatt tggtttagct aatctttact tgccattggc tcaattactc 1380 tatcactttg actggaaact cccaaccgga atcatgccaa gagacttaga cttgaccgaa 1440 ttatcgggaa taactattgc tagaaagggt ggcctttact taaatgccac tccttatcaa 1500 ccttctcgag agtaa 1515 <210> SEQ ID NO 89 <211> LENGTH: 536 <212> TYPE: PRT <213> ORGANISM: Gossypium arboretum <220> FEATURE: <223> OTHER INFORMATION: CYP706B1 (+)-delta-cadinene-8-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AAK60517 <309> DATABASE ENTRY DATE: 2001-11-01 <400> SEQUENCE: 89 Met Leu Gln Ile Ala Phe Ser Ser Tyr Ser Trp Leu Leu Thr Ala Ser 1 5 10 15 Asn Gln Lys Asp Gly Met Leu Phe Pro Val Ala Leu Ser Phe Leu Val 20 25 30 Ala Ile Leu Gly Ile Ser Leu Trp His Val Trp Thr Ile Arg Lys Pro 35 40 45 Lys Lys Asp Ile Ala Pro Leu Pro Pro Gly Pro Arg Gly Leu Pro Ile 50 55 60 Val Gly Tyr Leu Pro Tyr Leu Gly Thr Asp Asn Leu His Leu Val Phe 65 70 75 80 Thr Asp Leu Ala Ala Ala Tyr Gly Pro Ile Tyr Lys Leu Trp Leu Gly 85 90 95 Asn Lys Leu Cys Val Val Ile Ser Ser Ala Pro Leu Ala Lys Glu Val 100 105 110 Val Arg Asp Asn Asp Ile Thr Phe Ser Glu Arg Asp Pro Pro Val Cys 115 120 125 Ala Lys Ile Ile Thr Phe Gly Leu Asn Asp Ile Val Phe Asp Ser Tyr 130 135 140 Ser Ser Pro Asp Trp Arg Met Lys Arg Lys Val Leu Val Arg Glu Met 145 150 155 160 Leu Ser His Ser Ser Ile Lys Ala Cys Tyr Gly Leu Arg Arg Glu Gln 165 170 175 Val Leu Lys Gly Val Gln Asn Val Ala Gln Ser Ala Gly Lys Pro Ile 180 185 190 Asp Phe Gly Glu Thr Ala Phe Leu Thr Ser Ile Asn Ala Met Met Ser 195 200 205 Met Leu Trp Gly Gly Lys Gln Gly Gly Glu Arg Lys Gly Ala Asp Val 210 215 220 Trp Gly Gln Phe Arg Asp Leu Ile Thr Glu Leu Met Val Ile Leu Gly 225 230 235 240 Lys Pro Asn Val Ser Asp Ile Phe Pro Val Leu Ala Arg Phe Asp Ile 245 250 255 Gln Gly Leu Glu Lys Glu Met Thr Lys Ile Val Asn Ser Phe Asp Lys 260 265 270 Leu Phe Asn Ser Met Ile Glu Glu Arg Glu Asn Phe Ser Asn Lys Leu 275 280 285 Ser Lys Glu Asp Gly Asn Thr Glu Thr Lys Asp Phe Leu Gln Leu Leu 290 295 300 Leu Asp Leu Lys Gln Lys Asn Asp Ser Gly Ile Ser Ile Thr Met Asn 305 310 315 320 Gln Val Lys Ala Leu Leu Met Asp Ile Val Val Gly Gly Thr Asp Thr 325 330 335 Thr Ser Thr Met Met Glu Trp Thr Met Ala Glu Leu Ile Ala Asn Pro 340 345 350 Glu Ala Met Lys Lys Val Lys Gln Glu Ile Asp Asp Val Val Gly Ser 355 360 365 Asp Gly Ala Val Asp Glu Thr His Leu Pro Lys Leu Arg Tyr Leu Asp 370 375 380 Ala Ala Val Lys Glu Thr Phe Arg Leu His Pro Pro Met Pro Leu Leu 385 390 395 400 Val Pro Arg Cys Pro Gly Asp Ser Ser Asn Val Gly Gly Tyr Ser Val 405 410 415 Pro Lys Gly Thr Arg Val Phe Leu Asn Ile Trp Cys Ile Gln Arg Asp 420 425 430 Pro Gln Leu Trp Glu Asn Pro Leu Glu Phe Lys Pro Glu Arg Phe Leu 435 440 445 Thr Asp His Glu Lys Leu Asp Tyr Leu Gly Asn Asp Ser Arg Tyr Met 450 455 460 Pro Phe Gly Ser Gly Arg Arg Met Cys Ala Gly Val Ser Leu Gly Glu 465 470 475 480 Lys Met Leu Tyr Ser Ser Leu Ala Ala Met Ile His Ala Tyr Asp Trp 485 490 495 Asn Leu Ala Asp Gly Glu Glu Asn Asp Leu Ile Gly Leu Phe Gly Ile 500 505 510 Ile Met Lys Lys Lys Lys Pro Leu Ile Leu Val Pro Thr Pro Arg Pro 515 520 525 Ser Asn Leu Gln His Tyr Met Lys 530 535

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 89 <210> SEQ ID NO 1 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76 ORF <400> SEQUENCE: 1 atggacttct taagttttat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg taggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aaaggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacctca tactggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cagaactcct ccggaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaaa aaacctggtc caagaggccg acttgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccgat ccgggggtaa 1530 <210> SEQ ID NO 2 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v1 (CYP76-G5) <400> SEQUENCE: 2 atggacttct taagttttat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cagaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccgat ccgggggtaa 1530 <210> SEQ ID NO 3 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F39v1 (CYP76-G10) <400> SEQUENCE: 3 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactratgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 4 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F37v1 (CYP76-G11) <400> SEQUENCE: 4 atggacttct taagttgtat cctgtctgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gaccctgcgg aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500

cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 5 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v2 (CYP76-G12) <400> SEQUENCE: 5 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 6 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v1 (CYP76-G5) <400> SEQUENCE: 6 Met Asp Phe Leu Ser Phe Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 7 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F39v1 (CYP76-G10) <400> SEQUENCE: 7 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu

370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 8 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F37v1 (CYP76-G11) <400> SEQUENCE: 8 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 9 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76F38v2 (CYP76-G12) <400> SEQUENCE: 9 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 10 <211> LENGTH: 2079 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 <400> SEQUENCE: 10 atgagttcga gctcggagct atggaaatcg atcggctcgg cgctgggggt gtctccaccg 60 ccggcatggg ccgaggagtg ggcggcggtg atcgtcacca cgtccgcggc gctgatcgta 120

ggtttcgtga tgttcatgtg gcggagatcg ggcgagaagt ccaaggaatt gaggcctgtg 180 gtggcgctga aggcggcgcc gatcgaggcg gaggaggacg atggcgaggt tgactcgggg 240 aagactaagg tcactgtgtt cttcggtacg cagactggca ctgccgaagg gttcgctaag 300 gctttggcag aagagatcaa ggcaagatat gaaaaagcag tcgtcaaagt ggttgacctg 360 gatgattatg ctgcagatga tgatcaatat ggagaaaaat tgaaaaatga gacgctgaca 420 tttttcatgg tggccactta tggtgatgga gaaccaaccg ataatgctgc aagattttac 480 aaatggttta ctgaggagaa agaaagggaa gcttggttac agcagctgac ttatggcatt 540 tttggtctgg gaaatcgtca atatgaacat tttaataaga tagcaaaggt gcttgatgaa 600 cagcttactg aacaaggtgc aaagcgtctc attcaggttg gtttaggtga tgatgatcag 660 tgcatcgagg atgatttttc tgcttggcgt gaactactgt ggccagagtt agatcaatta 720 ctccggggtg atgatggtgc gaattctgtg tctactccct atacagctgc tgttcctgaa 780 taccgagtgg tgatccatga tcctactatc acttcatctg aggataaatc cttagccacg 840 gccaatgggg ctgctttatt tgacattcac catccatgca gagttaaggt tgctgttcaa 900 agagagcttc acaaagctga ctctgaccgc tcttgcatac atttggagtt tgatatatca 960 ggcacgggtc ttatgtatga aacgggagac catgtgggtg tttacgctga aaattgtgtt 1020 gagactgttg aagaagcagg aaagctgttg ggccaacctt tagatttgct cttttctgtt 1080 cacactgaca aggatgatgg tacatctctt gagagctcat tgccccctcc ttttcctggt 1140 ccttgcactc ttcgcactgc actgtttcaa tatgcagatc tattgaaccc tcctaggaag 1200 gctgctttag ttgccctggc agctcatgca gttgaaccat ctgaggcaga cagacttaaa 1260 tttttgtcat cacctcaggg aaaggatgag tatgcgaaat gggttgttgg cagtcaaaga 1320 agcctccttg aggtgatggc tgagttcccg tcaataaaag ttccccttgg tgtgtttttt 1380 gccgctgtgg ccccccgcct acagcctcgc tactattcaa tctcatcatc gcctaggttc 1440 tcctctgacc gggttcatgt aacctgcgct ttagtttatg gccctagtcc aacaggcaga 1500 attcacagag gggtgtgttc cacctggatg aagaatgcag ttcctctaga agaaagccgt 1560 gagtgtagct gggctcctat atttattagg acatctaatt ttaagctacc agctaatcct 1620 tctaccccag ttatcatggt cggccctggt actggcttgg ctccgtttag aggattccta 1680 caggaaagga tggccttgtt agaaggcagt gctcaacttg gtcctgcttt acttttcttt 1740 ggatgtagaa atcgaaggat ggattttatt tacgaggatg aactcaacaa tttcgtcgaa 1800 caaggtgtga tatcagagtt gattgttgca ttctcgaggg acgggccaac caaggagtac 1860 gttcagcata agatgatgga taaagctgca tatatatgga gtctaatctc tcagggggct 1920 tatctttatg tctgtggtga tgcaaagggg atggctagag atgttcatcg aactttgcat 1980 actcttgttc aacaacagga gagcgtggac tcatcaaaag cagagtcaat agtgaagaag 2040 cttcagatgg atggacgata tctaagagat gtttggtaa 2079 <210> SEQ ID NO 11 <211> LENGTH: 2115 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 <400> SEQUENCE: 11 atgcaattga gctccgtcaa gctaatccct ttggatctca tgacggctat tttcaacggc 60 ggtgggagcc ccgccggctc cggggaggcc ctgtcgatgc tgctggagaa tcgggaggtg 120 gtggtggcgc tcacgacgtc gctcgcggtg ctcatcgggt gcgtgttcgc gtacctgtgg 180 cggttctcga gctcccagaa ggcggtggcg gcggctaagg gcgtagaggt tgcgaggaag 240 ccggtgatcg ggaaggaatc ggaggcggcg gaggtggatg acggaaagaa gaaggtgacc 300 atcttcttcg ggacgcagac tggaacagcc gaagggttcg ccaaggcgct ggttgaggag 360 gcaaaagcac gctatgagaa ggccattttt aaattggttg atttggatga ttatgctgcc 420 gaggatgatg aatatgagga gaagttgaaa aaagagaaat tcgctttatt ctttttagcc 480 acatatggag atggtgagcc tactgacaat gcagcgaggt tctataaatg gtttactgag 540 gaaaatgaaa gtggagagtg gctccaaaag cttcagttcg gagtgtttgg ccttggcaac 600 aggcaatacg agcatttcaa caaggttgca aaggttgtgg atgagattct tgctgagcaa 660 ggtgggaagc gcctggttcc agtgggtctt ggagatgatg atcaatgcat tgaagatgac 720 ttcactgcat ggcgtgaatt agtgtggccc gagttggata aattgctcct agatgaggat 780 gatgcaactg tttctacccc ttatactgct tctgtacctg aataccgggt tgtatttcat 840 gattctcctg atgattatct gcagaagaac tctagtaatg caaatggtca ttcgatgcat 900 gatgctcagc atccatgcag ggctaatgtt gctgtgagga gggagcttca ttcgccttta 960 tctgatcgtt cttgcactca tctagaattt gacattgctg gaactggact tgcgtatgaa 1020 acaggggacc atgttggtgt gtgctgtgag aatttacctg aagttgtgga agaggctgaa 1080 agggtactgg gtttgtcacc aggcatctac ttttccatcc atgctgataa agaggatggc 1140 acaccacttg gaagttcctt gccaccactt tttccaccat gtactttaag aactgcacta 1200 actcaacatg ctgatcttct aagttttcct aaaaaggctg cgttgcttgc tttagcagct 1260 catgcttctg atccaagtga agcggatagg ttgaaatatc ttgcatctcc tgcaggaaag 1320 gatgaatatg cacagtgggt tgttgcaagt cagagaagcc ttctagaagt aatggctgaa 1380 ttcccttcgg cgaagccccc acttggagtt ttgtttgctg cagttgctcc acgattgcag 1440 ccacgattct attcgatctc atcctctcca aagattgcac catctaggat acatgttact 1500 tgcgcattag tatatgataa aacaccaact gggcgaattc acaagggagt gtgctcaact 1560 tggatgaaga atgcgatgcc ccgggaagaa agccacgatt gcagctgggc tcccattttt 1620 gttaggcaat ctaatttcaa gctcccttca aatacatcgg tgcctgtcat catgattggt 1680 cctggcacgg ggttggctcc tttcaggggc tttctacagg aaagattagc actgaaagaa 1740 gctggagttg aactgggacc tgcaatatta ttctttgggt gcaggaaccg taaaatggat 1800 tacatttatg aggatgagtt ggcacacttt gttgaagccg gtgcgctctc tgagttgatc 1860 gtggctttct cacgggaagg accagccaaa cagtatgtcc agcataagat gatggaaaag 1920 gcctcagaaa tctggaacat gatttccgat ggaggttatg tatatgtatg tggtgatgcc 1980 aaaggcatgg ccaaagatgt ccaccgggcg ctccatacaa ttgttcacga acagggatct 2040 ctagacaatt ccaagacaga gagcatggtg aagaatctcc aaatgaatgg aaggtattta 2100 cgggatgtgt ggtga 2115 <210> SEQ ID NO 12 <211> LENGTH: 692 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 <400> SEQUENCE: 12 Met Ser Ser Ser Ser Glu Leu Trp Lys Ser Ile Gly Ser Ala Leu Gly 1 5 10 15 Val Ser Pro Pro Pro Ala Trp Ala Glu Glu Trp Ala Ala Val Ile Val 20 25 30 Thr Thr Ser Ala Ala Leu Ile Val Gly Phe Val Met Phe Met Trp Arg 35 40 45 Arg Ser Gly Glu Lys Ser Lys Glu Leu Arg Pro Val Val Ala Leu Lys 50 55 60 Ala Ala Pro Ile Glu Ala Glu Glu Asp Asp Gly Glu Val Asp Ser Gly 65 70 75 80 Lys Thr Lys Val Thr Val Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu 85 90 95 Gly Phe Ala Lys Ala Leu Ala Glu Glu Ile Lys Ala Arg Tyr Glu Lys 100 105 110 Ala Val Val Lys Val Val Asp Leu Asp Asp Tyr Ala Ala Asp Asp Asp 115 120 125 Gln Tyr Gly Glu Lys Leu Lys Asn Glu Thr Leu Thr Phe Phe Met Val 130 135 140 Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr 145 150 155 160 Lys Trp Phe Thr Glu Glu Lys Glu Arg Glu Ala Trp Leu Gln Gln Leu 165 170 175 Thr Tyr Gly Ile Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn 180 185 190 Lys Ile Ala Lys Val Leu Asp Glu Gln Leu Thr Glu Gln Gly Ala Lys 195 200 205 Arg Leu Ile Gln Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp 210 215 220 Asp Phe Ser Ala Trp Arg Glu Leu Leu Trp Pro Glu Leu Asp Gln Leu 225 230 235 240 Leu Arg Gly Asp Asp Gly Ala Asn Ser Val Ser Thr Pro Tyr Thr Ala 245 250 255 Ala Val Pro Glu Tyr Arg Val Val Ile His Asp Pro Thr Ile Thr Ser 260 265 270 Ser Glu Asp Lys Ser Leu Ala Thr Ala Asn Gly Ala Ala Leu Phe Asp 275 280 285 Ile His His Pro Cys Arg Val Lys Val Ala Val Gln Arg Glu Leu His 290 295 300 Lys Ala Asp Ser Asp Arg Ser Cys Ile His Leu Glu Phe Asp Ile Ser 305 310 315 320 Gly Thr Gly Leu Met Tyr Glu Thr Gly Asp His Val Gly Val Tyr Ala 325 330 335 Glu Asn Cys Val Glu Thr Val Glu Glu Ala Gly Lys Leu Leu Gly Gln 340 345 350 Pro Leu Asp Leu Leu Phe Ser Val His Thr Asp Lys Asp Asp Gly Thr 355 360 365 Ser Leu Glu Ser Ser Leu Pro Pro Pro Phe Pro Gly Pro Cys Thr Leu 370 375 380 Arg Thr Ala Leu Phe Gln Tyr Ala Asp Leu Leu Asn Pro Pro Arg Lys 385 390 395 400 Ala Ala Leu Val Ala Leu Ala Ala His Ala Val Glu Pro Ser Glu Ala 405 410 415 Asp Arg Leu Lys Phe Leu Ser Ser Pro Gln Gly Lys Asp Glu Tyr Ala 420 425 430 Lys Trp Val Val Gly Ser Gln Arg Ser Leu Leu Glu Val Met Ala Glu 435 440 445 Phe Pro Ser Ile Lys Val Pro Leu Gly Val Phe Phe Ala Ala Val Ala 450 455 460 Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Phe 465 470 475 480 Ser Ser Asp Arg Val His Val Thr Cys Ala Leu Val Tyr Gly Pro Ser 485 490 495

Pro Thr Gly Arg Ile His Arg Gly Val Cys Ser Thr Trp Met Lys Asn 500 505 510 Ala Val Pro Leu Glu Glu Ser Arg Glu Cys Ser Trp Ala Pro Ile Phe 515 520 525 Ile Arg Thr Ser Asn Phe Lys Leu Pro Ala Asn Pro Ser Thr Pro Val 530 535 540 Ile Met Val Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu 545 550 555 560 Gln Glu Arg Met Ala Leu Leu Glu Gly Ser Ala Gln Leu Gly Pro Ala 565 570 575 Leu Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp Phe Ile Tyr Glu 580 585 590 Asp Glu Leu Asn Asn Phe Val Glu Gln Gly Val Ile Ser Glu Leu Ile 595 600 605 Val Ala Phe Ser Arg Asp Gly Pro Thr Lys Glu Tyr Val Gln His Lys 610 615 620 Met Met Asp Lys Ala Ala Tyr Ile Trp Ser Leu Ile Ser Gln Gly Ala 625 630 635 640 Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His 645 650 655 Arg Thr Leu His Thr Leu Val Gln Gln Gln Glu Ser Val Asp Ser Ser 660 665 670 Lys Ala Glu Ser Ile Val Lys Lys Leu Gln Met Asp Gly Arg Tyr Leu 675 680 685 Arg Asp Val Trp 690 <210> SEQ ID NO 13 <211> LENGTH: 704 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 <400> SEQUENCE: 13 Met Gln Leu Ser Ser Val Lys Leu Ile Pro Leu Asp Leu Met Thr Ala 1 5 10 15 Ile Phe Asn Gly Gly Gly Ser Pro Ala Gly Ser Gly Glu Ala Leu Ser 20 25 30 Met Leu Leu Glu Asn Arg Glu Val Val Val Ala Leu Thr Thr Ser Leu 35 40 45 Ala Val Leu Ile Gly Cys Val Phe Ala Tyr Leu Trp Arg Phe Ser Ser 50 55 60 Ser Gln Lys Ala Val Ala Ala Ala Lys Gly Val Glu Val Ala Arg Lys 65 70 75 80 Pro Val Ile Gly Lys Glu Ser Glu Ala Ala Glu Val Asp Asp Gly Lys 85 90 95 Lys Lys Val Thr Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu Gly 100 105 110 Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg Tyr Glu Lys Ala 115 120 125 Ile Phe Lys Leu Val Asp Leu Asp Asp Tyr Ala Ala Glu Asp Asp Glu 130 135 140 Tyr Glu Glu Lys Leu Lys Lys Glu Lys Phe Ala Leu Phe Phe Leu Ala 145 150 155 160 Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr Lys 165 170 175 Trp Phe Thr Glu Glu Asn Glu Ser Gly Glu Trp Leu Gln Lys Leu Gln 180 185 190 Phe Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn Lys 195 200 205 Val Ala Lys Val Val Asp Glu Ile Leu Ala Glu Gln Gly Gly Lys Arg 210 215 220 Leu Val Pro Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp Asp 225 230 235 240 Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu Leu Asp Lys Leu Leu 245 250 255 Leu Asp Glu Asp Asp Ala Thr Val Ser Thr Pro Tyr Thr Ala Ser Val 260 265 270 Pro Glu Tyr Arg Val Val Phe His Asp Ser Pro Asp Asp Tyr Leu Gln 275 280 285 Lys Asn Ser Ser Asn Ala Asn Gly His Ser Met His Asp Ala Gln His 290 295 300 Pro Cys Arg Ala Asn Val Ala Val Arg Arg Glu Leu His Ser Pro Leu 305 310 315 320 Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ala Gly Thr Gly 325 330 335 Leu Ala Tyr Glu Thr Gly Asp His Val Gly Val Cys Cys Glu Asn Leu 340 345 350 Pro Glu Val Val Glu Glu Ala Glu Arg Val Leu Gly Leu Ser Pro Gly 355 360 365 Ile Tyr Phe Ser Ile His Ala Asp Lys Glu Asp Gly Thr Pro Leu Gly 370 375 380 Ser Ser Leu Pro Pro Leu Phe Pro Pro Cys Thr Leu Arg Thr Ala Leu 385 390 395 400 Thr Gln His Ala Asp Leu Leu Ser Phe Pro Lys Lys Ala Ala Leu Leu 405 410 415 Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu Ala Asp Arg Leu Lys 420 425 430 Tyr Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr Ala Gln Trp Val Val 435 440 445 Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala Glu Phe Pro Ser Ala 450 455 460 Lys Pro Pro Leu Gly Val Leu Phe Ala Ala Val Ala Pro Arg Leu Gln 465 470 475 480 Pro Arg Phe Tyr Ser Ile Ser Ser Ser Pro Lys Ile Ala Pro Ser Arg 485 490 495 Ile His Val Thr Cys Ala Leu Val Tyr Asp Lys Thr Pro Thr Gly Arg 500 505 510 Ile His Lys Gly Val Cys Ser Thr Trp Met Lys Asn Ala Met Pro Arg 515 520 525 Glu Glu Ser His Asp Cys Ser Trp Ala Pro Ile Phe Val Arg Gln Ser 530 535 540 Asn Phe Lys Leu Pro Ser Asn Thr Ser Val Pro Val Ile Met Ile Gly 545 550 555 560 Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg Leu 565 570 575 Ala Leu Lys Glu Ala Gly Val Glu Leu Gly Pro Ala Ile Leu Phe Phe 580 585 590 Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr Glu Asp Glu Leu Ala 595 600 605 His Phe Val Glu Ala Gly Ala Leu Ser Glu Leu Ile Val Ala Phe Ser 610 615 620 Arg Glu Gly Pro Ala Lys Gln Tyr Val Gln His Lys Met Met Glu Lys 625 630 635 640 Ala Ser Glu Ile Trp Asn Met Ile Ser Asp Gly Gly Tyr Val Tyr Val 645 650 655 Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val His Arg Ala Leu His 660 665 670 Thr Ile Val His Glu Gln Gly Ser Leu Asp Asn Ser Lys Thr Glu Ser 675 680 685 Met Val Lys Asn Leu Gln Met Asn Gly Arg Tyr Leu Arg Asp Val Trp 690 695 700 <210> SEQ ID NO 14 <211> LENGTH: 649 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 truncated <400> SEQUENCE: 14 Met Phe Met Trp Arg Arg Ser Gly Glu Lys Ser Lys Glu Leu Arg Pro 1 5 10 15 Val Val Ala Leu Lys Ala Ala Pro Ile Glu Ala Glu Glu Asp Asp Gly 20 25 30 Glu Val Asp Ser Gly Lys Thr Lys Val Thr Val Phe Phe Gly Thr Gln 35 40 45 Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Ala Glu Glu Ile Lys 50 55 60 Ala Arg Tyr Glu Lys Ala Val Val Lys Val Val Asp Leu Asp Asp Tyr 65 70 75 80 Ala Ala Asp Asp Asp Gln Tyr Gly Glu Lys Leu Lys Asn Glu Thr Leu 85 90 95 Thr Phe Phe Met Val Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn 100 105 110 Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Glu Lys Glu Arg Glu Ala 115 120 125 Trp Leu Gln Gln Leu Thr Tyr Gly Ile Phe Gly Leu Gly Asn Arg Gln 130 135 140 Tyr Glu His Phe Asn Lys Ile Ala Lys Val Leu Asp Glu Gln Leu Thr 145 150 155 160 Glu Gln Gly Ala Lys Arg Leu Ile Gln Val Gly Leu Gly Asp Asp Asp 165 170 175 Gln Cys Ile Glu Asp Asp Phe Ser Ala Trp Arg Glu Leu Leu Trp Pro 180 185 190 Glu Leu Asp Gln Leu Leu Arg Gly Asp Asp Gly Ala Asn Ser Val Ser 195 200 205 Thr Pro Tyr Thr Ala Ala Val Pro Glu Tyr Arg Val Val Ile His Asp 210 215 220 Pro Thr Ile Thr Ser Ser Glu Asp Lys Ser Leu Ala Thr Ala Asn Gly 225 230 235 240 Ala Ala Leu Phe Asp Ile His His Pro Cys Arg Val Lys Val Ala Val 245 250 255 Gln Arg Glu Leu His Lys Ala Asp Ser Asp Arg Ser Cys Ile His Leu 260 265 270 Glu Phe Asp Ile Ser Gly Thr Gly Leu Met Tyr Glu Thr Gly Asp His 275 280 285 Val Gly Val Tyr Ala Glu Asn Cys Val Glu Thr Val Glu Glu Ala Gly 290 295 300 Lys Leu Leu Gly Gln Pro Leu Asp Leu Leu Phe Ser Val His Thr Asp 305 310 315 320

Lys Asp Asp Gly Thr Ser Leu Glu Ser Ser Leu Pro Pro Pro Phe Pro 325 330 335 Gly Pro Cys Thr Leu Arg Thr Ala Leu Phe Gln Tyr Ala Asp Leu Leu 340 345 350 Asn Pro Pro Arg Lys Ala Ala Leu Val Ala Leu Ala Ala His Ala Val 355 360 365 Glu Pro Ser Glu Ala Asp Arg Leu Lys Phe Leu Ser Ser Pro Gln Gly 370 375 380 Lys Asp Glu Tyr Ala Lys Trp Val Val Gly Ser Gln Arg Ser Leu Leu 385 390 395 400 Glu Val Met Ala Glu Phe Pro Ser Ile Lys Val Pro Leu Gly Val Phe 405 410 415 Phe Ala Ala Val Ala Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser 420 425 430 Ser Ser Pro Arg Phe Ser Ser Asp Arg Val His Val Thr Cys Ala Leu 435 440 445 Val Tyr Gly Pro Ser Pro Thr Gly Arg Ile His Arg Gly Val Cys Ser 450 455 460 Thr Trp Met Lys Asn Ala Val Pro Leu Glu Glu Ser Arg Glu Cys Ser 465 470 475 480 Trp Ala Pro Ile Phe Ile Arg Thr Ser Asn Phe Lys Leu Pro Ala Asn 485 490 495 Pro Ser Thr Pro Val Ile Met Val Gly Pro Gly Thr Gly Leu Ala Pro 500 505 510 Phe Arg Gly Phe Leu Gln Glu Arg Met Ala Leu Leu Glu Gly Gly Ala 515 520 525 Gln Leu Gly Pro Ala Leu Leu Phe Phe Gly Cys Arg Asn Arg Arg Met 530 535 540 Asp Phe Ile Tyr Glu Asp Glu Leu Asn Asn Phe Val Glu Gln Gly Val 545 550 555 560 Ile Ser Glu Leu Ile Val Ala Phe Ser Arg Asp Gly Pro Thr Lys Glu 565 570 575 Tyr Val Gln His Lys Met Met Asp Lys Ala Ala Tyr Ile Trp Ser Leu 580 585 590 Ile Ser Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met 595 600 605 Ala Arg Asp Val His Arg Thr Leu His Thr Leu Val Gln Gln Gln Glu 610 615 620 Ser Val Asp Ser Ser Lys Ala Glu Ser Ile Val Lys Lys Leu Gln Met 625 630 635 640 Asp Gly Arg Tyr Leu Arg Asp Val Trp 645 <210> SEQ ID NO 15 <211> LENGTH: 645 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 truncated <400> SEQUENCE: 15 Met Arg Phe Ser Ser Ser Gln Lys Ala Val Ala Ala Ala Lys Gly Val 1 5 10 15 Glu Val Ala Arg Lys Pro Val Ile Gly Lys Glu Ser Glu Ala Ala Glu 20 25 30 Val Asp Asp Gly Lys Lys Lys Val Thr Ile Phe Phe Gly Thr Gln Thr 35 40 45 Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala 50 55 60 Arg Tyr Glu Lys Ala Ile Phe Lys Leu Val Asp Leu Asp Asp Tyr Ala 65 70 75 80 Ala Glu Asp Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Lys Phe Ala 85 90 95 Leu Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala 100 105 110 Ala Arg Phe Tyr Lys Trp Phe Thr Glu Glu Asn Glu Ser Gly Glu Trp 115 120 125 Leu Gln Lys Leu Gln Phe Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr 130 135 140 Glu His Phe Asn Lys Val Ala Lys Val Val Asp Glu Ile Leu Ala Glu 145 150 155 160 Gln Gly Gly Lys Arg Leu Val Pro Val Gly Leu Gly Asp Asp Asp Gln 165 170 175 Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu 180 185 190 Leu Asp Lys Leu Leu Leu Asp Glu Asp Asp Ala Thr Val Ser Thr Pro 195 200 205 Tyr Thr Ala Ser Val Pro Glu Tyr Arg Val Val Phe His Asp Ser Pro 210 215 220 Asp Asp Tyr Leu Gln Lys Asn Ser Ser Asn Ala Asn Gly His Ser Met 225 230 235 240 His Asp Ala Gln His Pro Cys Arg Ala Asn Val Ala Val Arg Arg Glu 245 250 255 Leu His Ser Pro Leu Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp 260 265 270 Ile Ala Gly Thr Gly Leu Ala Tyr Glu Thr Gly Asp His Val Gly Val 275 280 285 Cys Cys Glu Asn Leu Pro Glu Val Val Glu Glu Ala Glu Arg Val Leu 290 295 300 Gly Leu Ser Pro Gly Ile Tyr Phe Ser Ile His Ala Asp Lys Glu Asp 305 310 315 320 Gly Thr Pro Leu Gly Ser Ser Leu Pro Pro Leu Phe Pro Pro Cys Thr 325 330 335 Leu Arg Thr Ala Leu Thr Gln His Ala Asp Leu Leu Ser Phe Pro Lys 340 345 350 Lys Ala Ala Leu Leu Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu 355 360 365 Ala Asp Arg Leu Lys Tyr Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr 370 375 380 Ala Gln Trp Val Val Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala 385 390 395 400 Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Leu Phe Ala Ala Val 405 410 415 Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser Ser Pro Lys 420 425 430 Ile Ala Pro Ser Arg Ile His Val Thr Cys Ala Leu Val Tyr Asp Lys 435 440 445 Thr Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met Lys 450 455 460 Asn Ala Met Pro Arg Glu Glu Ser His Asp Cys Ser Trp Ala Pro Ile 465 470 475 480 Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asn Thr Ser Val Pro 485 490 495 Val Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe 500 505 510 Leu Gln Glu Arg Leu Ala Leu Lys Glu Ala Gly Val Glu Leu Gly Pro 515 520 525 Ala Ile Leu Phe Phe Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr 530 535 540 Glu Asp Glu Leu Ala His Phe Val Glu Ala Gly Ala Leu Ser Glu Leu 545 550 555 560 Ile Val Ala Phe Ser Arg Glu Gly Pro Ala Lys Gln Tyr Val Gln His 565 570 575 Lys Met Met Glu Lys Ala Ser Glu Ile Trp Asn Met Ile Ser Asp Gly 580 585 590 Gly Tyr Val Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val 595 600 605 His Arg Ala Leu His Thr Ile Val His Glu Gln Gly Ser Leu Asp Asn 610 615 620 Ser Lys Thr Glu Ser Met Val Lys Asn Leu Gln Met Asn Gly Arg Tyr 625 630 635 640 Leu Arg Asp Val Trp 645 <210> SEQ ID NO 16 <211> LENGTH: 1710 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Santalene synthase (SaSSY) <400> SEQUENCE: 16 atggattctt ccaccgccac cgccatgaca gctccattca ttgatcctac tgatcatgtg 60 aatctcaaaa ctgatacgga tgcctcagag aatcgaagga tgggaaatta taaacccagc 120 atttggaatt atgatttttt acaatcactt gcaactcatc acaatattgt ggaagagagg 180 catctaaagc tagctgagaa gctgaagggc caagtgaagt ttatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggcttgggct aaaccaccta 300 tttgagacag agatcaagga agcgctgttt agtatttaca aggatgggag caatggatgg 360 tggtttggcc accttcatgc gacatctctc cgatttaggc tgctacgaca gtgtgggctt 420 tttattcccc aagatgtgtt taaaacgttc caaaacaaga ctggggaatt tgatatgaaa 480 ctttgtgaca acgtaaaagg gctgctgagc ttatatgaag cttcatactt gggatggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcaccacca agtgcttgaa aagtgcatgg 600 gaaaatatat ccgaaaagtg gttagccaaa agagtgaagc atgcattggc tttgcctttg 660 cattggagag tccctcgaat cgaagctaga tggttcattg aggcatatga gcaagaagcg 720 aatatgaacc caacactact caaactcgca aaattagact ttaatatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcca ggaataattt actgcagagc tatatgtgga gctgcgcgat tgcttccgac 900 ccgaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtt 960 gacgatggat atgacgtcta tggttcaatc gacgaacttg atctctacac aagctccgtt 1020 gaaaggtgga gctgtgtgga aattgacaag ttgccaaaca cgttaaaatt aatttttatg 1080 tctatgttca acaagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaat 1140 agcatcccta cttttatcaa agcgtgggtt gaacagtgta aatcatacca gaaagaagca 1200 agatggttcc acgggggaca cacgcctcca ttggaagaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttaatcacg ggctacgtgg caatcgctga gaacgaggct 1320

gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg atataggaac gtctccggat gagatggcaa gaggcgataa tctgaagtca 1440 atccattgtt acatgaacga aactggggct tccgaggaag ttgctcgtga gcacataaag 1500 ggagtaatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacggatagc tggacaaagg ttgatatgaa gtccgttttg 1680 atcgacccta ttcctctcgg cgaggagtag 1710 <210> SEQ ID NO 17 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Santalene synthase (SaSSY) <400> SEQUENCE: 17 Met Asp Ser Ser Thr Ala Thr Ala Met Thr Ala Pro Phe Ile Asp Pro 1 5 10 15 Thr Asp His Val Asn Leu Lys Thr Asp Thr Asp Ala Ser Glu Asn Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45 Ser Leu Ala Thr His His Asn Ile Val Glu Glu Arg His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Lys Phe Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Leu Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Ile 100 105 110 Tyr Lys Asp Gly Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Asn Lys Thr Gly Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Val Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Tyr 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Thr 180 185 190 Thr Lys Cys Leu Lys Ser Ala Trp Glu Asn Ile Ser Glu Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Ala 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Gly Tyr Asp Val Tyr Gly Ser Ile Asp Glu Leu Asp Leu Tyr 325 330 335 Thr Ser Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Ser Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Glu Gln Cys Lys Ser Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Phe His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Val Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Ile Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Glu Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Val Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 18 <211> LENGTH: 1029 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Farnesyl diphosphate synthase (SaFPPS) <400> SEQUENCE: 18 atgggcgatc ggaaaaccaa atttctcgag gcctactctg tcttgaaatc ggagctcctc 60 cgggaccctg ctttcaattt tacagacgct tcccgtcaat gggtcgaccg gatgctggac 120 tacaatgtgc ctggagggaa actgaatcga gggctctcag tgattgacag ctatgagttg 180 ctgaaagaag gaaaagagct aactgatgat gaaatatttc ttgcatctgc actcggttgg 240 tgcattgaat ggcttcaagc atattttctt gttctcgatg atattatgga tggctctcat 300 acacgccgag gtcagccttg ttggttcagg ttgcctgagg ttggtctgat tgctgtaaat 360 gatggcataa tgcttcgcaa ccacatccca agaattctca agaagcactt caaaaataag 420 ccttattatg tggaactgtt ggatttattt aatgaggtcg agttccaaac aacttcagga 480 cagatgatag atttgataac cacgcttgaa gggcagaaag atctttcaaa gtattcaatg 540 cctattcacc atcgcattgt tcagtataaa actgcttatt actcctttta ccttccggtt 600 gcttgtgcac tgcttatgtc aggtgagaat ctggacagcc acactgaagt ggagaaaatc 660 cttgttgaaa tgggaaccta ttttcaagta caggatgatt acctggactg ctttggtcat 720 cctgatgtca ttggaaagat tggaacagat attgaagatt ttaagtgttc ttggttggtt 780 gtaaaagcgt tggaactttc caacgaggaa cagaagaaat tattatatga gaactatggg 840 aaagccgatg aagccagcgt tgcaaaagta aaggcacttt ataaggaact tgaccttgag 900 ggtgcatttg tggagtacga gaatgctagt tatgagaaga taatcagctc aattgaggtg 960 cagccaagca aagcagtaca agcagtgctg aaatcctttt tggcgaagat atacaagcgg 1020 cagaagtag 1029 <210> SEQ ID NO 19 <211> LENGTH: 342 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: Farnesyl diphosphate synthase (SaFPPS) <400> SEQUENCE: 19 Met Gly Asp Arg Lys Thr Lys Phe Leu Glu Ala Tyr Ser Val Leu Lys 1 5 10 15 Ser Glu Leu Leu Arg Asp Pro Ala Phe Asn Phe Thr Asp Ala Ser Arg 20 25 30 Gln Trp Val Asp Arg Met Leu Asp Tyr Asn Val Pro Gly Gly Lys Leu 35 40 45 Asn Arg Gly Leu Ser Val Ile Asp Ser Tyr Glu Leu Leu Lys Glu Gly 50 55 60 Lys Glu Leu Thr Asp Asp Glu Ile Phe Leu Ala Ser Ala Leu Gly Trp 65 70 75 80 Cys Ile Glu Trp Leu Gln Ala Tyr Phe Leu Val Leu Asp Asp Ile Met 85 90 95 Asp Gly Ser His Thr Arg Arg Gly Gln Pro Cys Trp Phe Arg Leu Pro 100 105 110 Glu Val Gly Leu Ile Ala Val Asn Asp Gly Ile Met Leu Arg Asn His 115 120 125 Ile Pro Arg Ile Leu Lys Lys His Phe Lys Asn Lys Pro Tyr Tyr Val 130 135 140 Glu Leu Leu Asp Leu Phe Asn Glu Val Glu Phe Gln Thr Thr Ser Gly 145 150 155 160 Gln Met Ile Asp Leu Ile Thr Thr Leu Glu Gly Gln Lys Asp Leu Ser 165 170 175 Lys Tyr Ser Met Pro Ile His His Arg Ile Val Gln Tyr Lys Thr Ala 180 185 190 Tyr Tyr Ser Phe Tyr Leu Pro Val Ala Cys Ala Leu Leu Met Ser Gly 195 200 205 Glu Asn Leu Asp Ser His Thr Glu Val Glu Lys Ile Leu Val Glu Met 210 215 220 Gly Thr Tyr Phe Gln Val Gln Asp Asp Tyr Leu Asp Cys Phe Gly His 225 230 235 240 Pro Asp Val Ile Gly Lys Ile Gly Thr Asp Ile Glu Asp Phe Lys Cys 245 250 255 Ser Trp Leu Val Val Lys Ala Leu Glu Leu Ser Asn Glu Glu Gln Lys 260 265 270 Lys Leu Leu Tyr Glu Asn Tyr Gly Lys Ala Asp Glu Ala Ser Val Ala 275 280 285 Lys Val Lys Ala Leu Tyr Lys Glu Leu Asp Leu Glu Gly Ala Phe Val 290 295 300 Glu Tyr Glu Asn Ala Ser Tyr Glu Lys Ile Ile Ser Ser Ile Glu Val 305 310 315 320 Gln Pro Ser Lys Ala Val Gln Ala Val Leu Lys Ser Phe Leu Ala Lys 325 330 335

Ile Tyr Lys Arg Gln Lys 340 <210> SEQ ID NO 20 <211> LENGTH: 4160 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pDNR-LIB vector <400> SEQUENCE: 20 gcggccgcat aacttcgtat agcatacatt atacgaagtt atcagtcgac ggtaccggac 60 atatgcccgg gaattcggcc attacggcct gcaggatccg aaaaaacctc ccacacctcc 120 ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 180 ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 240 tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggatccggc 300 cgcctcggcc ctcgagaagc tttctagacc attcgtttgg cgcgcgggcc cagtaggtaa 360 gtgaacatgg tcatagctgt ttccctagga gatcctggta tgactagtgc ttggattctc 420 accaataaaa aacgcccggc ggcaaccgag cgttctgaac aaatccagat ggagttctga 480 ggtcattact ggatctatca acaggagtcc aagcgagctc gatatcaaat tacgccccgc 540 cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca tggaagccat 600 cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg ccttgcgtat 660 aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc acgtttaaat 720 caaaactggt gaaactcacc cagggattgg ctgagacgaa aaacatattc tcaataaacc 780 ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa tatatgtgta 840 gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt tcagtttgct 900 catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca ccgtctttca 960 ttgccatacg aaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg 1020 gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa 1080 cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat 1140 gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct 1200 tagctcctga aagatccata acttcgtata gcatacatta tacgaagtta tgcggccgcg 1260 acgtcaatgc caataggata tcggcatttt cttttgcgtt tttatttgtt aactgttaat 1320 tgtccttgtt caaggatgct gtctttgaca acagatgttt tcttgccttt gatgttcagc 1380 aggaagctag gcgcaaacgt tgattgtttg tctgcgtaga atcctctgtt tgtcatatag 1440 cttgtaatca cgacattgtt tcctttcgct tgaggtacag cgaagtgtga gtaagtaaag 1500 gttacatcgt taggatcaag atccattttt aacacaaggc cagttttgtt cagcggcttg 1560 tatgggccag ttaaagaatt agaaacataa ccaagcatgt aaatatcgtt agacgtaatg 1620 ccgtcaatcg tcatttttga tccgcgggag tcagtgaaca ggtaccattt gccgttcatt 1680 ttaaagacgt tcgcgcgttc aatttcatct gttactgtgt tagatgcaat cagcggtttc 1740 atcacttttt tcagtgtgta atcatcgttt agctcaatca taccgagagc gccgtttgct 1800 aactcagccg tgcgtttttt atcgctttgc agaagttttt gactttcttg acggaagaat 1860 gatgtgcttt tgccatagta tgctttgtta aataaagatt cttcgccttg gtagccatct 1920 tcagttccag tgtttgcttc aaatactaag tatttgtggc ctttatcttc tacgtagtga 1980 ggatctctca gcgtatggtt gtcgcctgag ctgtagttgc cttcatcgat gaactgctgt 2040 acattttgat acgtttttcc gtcaccgtca aagattgatt tataatcctc tacaccgttg 2100 atgttcaaag agctgtctga tgctgatacg ttaacttgtg cagttgtcag tgtttgtttg 2160 ccgtaatgtt taccggagaa atcagtgtag aataaacgga tttttccgtc agatgtaaat 2220 gtggctgaac ctgaccattc ttgtgtttgg tcttttagga tagaatcatt tgcatcgaat 2280 ttgtcgctgt ctttaaagac gcggccagcg tttttccagc tgtcaataga agtttcgccg 2340 actttttgat agaacatgta aatcgatgtg tcatccgcat ttttaggatc tccggctaat 2400 gcaaagacga tgtggtagcc gtgatagttt gcgacagtgc cgtcagcgtt ttgtaatggc 2460 cagctgtccc aaacgtccag gccttttgca gaagagatat ttttaattgt ggacgaatcg 2520 aactcaggaa cttgattttt tcattttttt gctgttcagg gatttgcagc atatcatggc 2580 gtgtaatatg ggaaatgccg tatgtttcct tatatggctt ttggttcgtt tctttcgcaa 2640 acgcttgagt tgcgcctcct gccagcagtg cggtagtaaa ggttaatact gttgcttgtt 2700 ttgcaaactt tttgatgttc atcgttcatg tctccttttt tatgtactgt gttagcggtc 2760 tgcttcttcc agccctcctg tttgaagatg gcaagttagt tacgcacaat aaaaaaagac 2820 ctaaaatatg taaggggtga cgccaaagta tacactttgc cctttacaca ttttaggtct 2880 tgcctgcttt atcagtaaca aacccgcgcg atttactttt cgacctcatt ctattagact 2940 ctcgtttgga ttgcaactgg tctattttcc tcttttgttt gatagaaaat cataaaagga 3000 tttgcagact acgggcctaa agaactaaaa aatctatctg tttcttttca ttctctgtat 3060 tttttatagt ttctgttgca tgggcataaa gttgcctttt taatcacaat tcagaaaata 3120 tcataatatc tcatttcact aaataatagt gaacggcagg tatatgtggc gcgcctaagc 3180 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 3240 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 3300 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 3360 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 3420 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 3480 gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc caccacttca 3540 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 3600 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 3660 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 3720 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 3780 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 3840 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 3900 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 3960 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 4020 tatcccctga ttctgtggat aaccgtatta ccgccttacg cgtgtaaaac gacggccagt 4080 agatctgtaa tacgactcac tatagggcgc tagctcgccg cagccgaacg accgagcgca 4140 gcgagtcagt gagcgaggaa 4160 <210> SEQ ID NO 21 <211> LENGTH: 2974 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pJET1.2 vector <400> SEQUENCE: 21 gcccctgcag ccgaattata ttatttttgc caaataattt ttaacaaaag ctctgaagtc 60 ttcttcattt aaattcttag atgatacttc atctggaaaa ttgtcccaat tagtagcatc 120 acgctgtgag taagttctaa accatttttt tattgttgta ttatctctaa tcttactact 180 cgatgagttt tcggtattat ctctattttt aacttggagc aggttccatt cattgttttt 240 ttcatcatag tgaataaaat caactgcttt aacacttgtg cctgaacacc atatccatcc 300 ggcgtaatac gactcactat agggagagcg gccgccagat cttccggatg gctcgagttt 360 ttcagcaaga tatctttcta gaagatctcc tacaatattc tcagctgcca tggaaaatcg 420 atgttcttct tttattctct caagattttc aggctgtata ttaaaactta tattaagaac 480 tatgctaacc acctcatcag gaaccgttgt aggtggcgtg ggttttcttg gcaatcgact 540 ctcatgaaaa ctacgagcta aatattcaat atgttcctct tgaccaactt tattctgcat 600 tttttttgaa cgaggtttag agcaagcttc aggaaactga gacaggaatt ttattaaaaa 660 tttaaatttt gaagaaagtt cagggttaat agcatccatt ttttgctttg caagttcctc 720 agcattctta acaaaagacg tctcttttga catgtttaaa gtttaaacct cctgtgtgaa 780 attgttatcc gctcacaatt ccacacatta tacgagccgg aagcataaag tgtaaagcct 840 ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg ccaattgctt 900 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 960 gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 1020 ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 1080 caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 1140 aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 1200 atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 1260 cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 1320 ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 1380 gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 1440 accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 1500 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 1560 cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 1620 gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 1680 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 1740 aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 1800 actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 1860 taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 1920 gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 1980 tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 2040 ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 2100 accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 2160 agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 2220 acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 2280 tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 2340 cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 2400 tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 2460 ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 2520 gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 2580 tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 2640

ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 2700 gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 2760 cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 2820 gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 2880 ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 2940 cattaaccta taaaaatagg cgtatcacga ggcc 2974 <210> SEQ ID NO 22 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 1 Forward Primer <400> SEQUENCE: 22 atggacttct taagttttat cctgtttg 28 <210> SEQ ID NO 23 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 1 Reverse Primer <400> SEQUENCE: 23 ttacccccgg atcgggacag 20 <210> SEQ ID NO 24 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 2 Forward Primer <400> SEQUENCE: 24 atggacttct taagttgtat cctg 24 <210> SEQ ID NO 25 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Group 2 Reverse Primer <400> SEQUENCE: 25 ttacccccgg attgggacag 20 <210> SEQ ID NO 26 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Vitis vinifera <220> FEATURE: <223> OTHER INFORMATION: putative cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: XP_002281735 <309> DATABASE ENTRY DATE: 2011-12-07 <400> SEQUENCE: 26 Met Glu Leu Leu Ser Cys Leu Leu Cys Phe Leu Ala Ala Trp Thr Ser 1 5 10 15 Ile Tyr Ile Met Phe Ser Ala Arg Arg Gly Arg Lys His Ala Ala His 20 25 30 Lys Leu Pro Pro Gly Pro Val Pro Leu Pro Ile Ile Gly Ser Leu Leu 35 40 45 Asn Leu Gly Asn Arg Pro His Glu Ser Leu Ala Asn Leu Ala Lys Thr 50 55 60 Tyr Gly Pro Ile Met Thr Leu Lys Leu Gly Tyr Val Thr Thr Ile Val 65 70 75 80 Ile Ser Ser Ala Pro Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu 85 90 95 Ser Phe Cys Asn Arg Ser Ile Pro Asp Ala Ile Arg Ala Ala Lys His 100 105 110 Asn Gln Leu Ser Met Ala Trp Leu Pro Val Ser Thr Thr Trp Arg Ala 115 120 125 Leu Arg Arg Thr Cys Asn Ser His Leu Phe Thr Pro Gln Lys Leu Asp 130 135 140 Ser Asn Thr His Leu Arg His Gln Lys Val Gln Glu Leu Leu Ala Asn 145 150 155 160 Val Glu Gln Ser Cys Gln Ala Gly Gly Pro Val Asp Ile Gly Gln Glu 165 170 175 Ala Phe Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Ile Phe Ser Val 180 185 190 Asp Leu Val Asp Pro Ile Ser Glu Thr Ala Gln Glu Phe Lys Glu Leu 195 200 205 Val Arg Gly Val Met Glu Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Ile Asp Pro Gln Ser Ile Arg Arg Arg Leu 225 230 235 240 Thr Ile Tyr Phe Gly Arg Met Ile Glu Ile Phe Asp Arg Met Ile Lys 245 250 255 Gln Arg Leu Gln Leu Arg Lys Asn Gln Gly Ser Ile Ala Ser Ser Asp 260 265 270 Val Leu Asp Val Leu Leu Asn Ile Ser Glu Asp Asn Ser Ser Glu Ile 275 280 285 Glu Arg Ser His Met Glu His Leu Leu Leu Asp Leu Phe Ala Ala Gly 290 295 300 Thr Asp Thr Thr Ser Ser Thr Leu Glu Trp Ala Met Ala Glu Leu Leu 305 310 315 320 His Asn Pro Glu Thr Leu Leu Lys Ala Arg Met Glu Leu Leu Gln Thr 325 330 335 Ile Gly Gln Asp Lys Gln Val Lys Glu Ser Asp Ile Ser Arg Leu Pro 340 345 350 Tyr Leu Gln Ala Val Val Lys Glu Thr Phe Arg Leu His Pro Ala Val 355 360 365 Pro Phe Leu Leu Pro Arg Arg Val Glu Gly Asp Ala Asp Ile Asp Gly 370 375 380 Phe Ala Val Pro Lys Asn Ala Gln Val Leu Val Asn Ala Trp Ala Ile 385 390 395 400 Gly Arg Asp Pro Asn Thr Trp Glu Asn Pro Asn Ser Phe Val Pro Glu 405 410 415 Arg Phe Leu Gly Leu Asp Met Asp Val Lys Gly Gln Asn Phe Glu Leu 420 425 430 Ile Pro Phe Gly Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala 435 440 445 Ile Arg Met Val His Leu Met Leu Ala Ser Leu Ile His Ser Tyr Asp 450 455 460 Trp Lys Leu Glu Asp Gly Val Thr Pro Glu Asn Met Asn Met Glu Glu 465 470 475 480 Arg Tyr Gly Ile Ser Leu Gln Lys Ala Gln Pro Leu Gln Ala Leu Pro 485 490 495 Val Arg Val <210> SEQ ID NO 27 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAC80883 <309> DATABASE ENTRY DATE: 2001-11-22 <400> SEQUENCE: 27 Met Asp Tyr Leu Thr Ile Ile Leu Thr Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Tyr Glu Ala Phe Ser Tyr Leu Ser Arg Arg Thr Lys Asn Leu Pro Pro 20 25 30 Gly Pro Ser Pro Leu Pro Phe Ile Gly Ser Leu His Leu Leu Gly Asp 35 40 45 Gln Pro His Lys Ser Leu Ala Lys Leu Ser Lys Lys His Gly Pro Ile 50 55 60 Met Ser Leu Lys Leu Gly Gln Ile Thr Thr Ile Val Ile Ser Ser Ser 65 70 75 80 Thr Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe Ser Ser 85 90 95 Arg Ser Val Pro Asn Ala Leu His Ala His Asn Gln Phe Lys Phe Ser 100 105 110 Val Val Trp Leu Pro Val Ala Ser Arg Trp Arg Ser Leu Arg Lys Val 115 120 125 Leu Asn Ser Asn Ile Phe Ser Gly Asn Arg Leu Asp Ala Asn Gln His 130 135 140 Leu Arg Thr Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg Lys Asn 145 150 155 160 Ser Gln Ser Gly Glu Ala Val Asp Val Gly Arg Ala Ala Phe Arg Thr 165 170 175 Ser Leu Asn Leu Leu Ser Asn Leu Ile Phe Ser Lys Asp Leu Thr Asp 180 185 190 Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp Asn Ile 195 200 205 Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Phe Phe Pro Leu Leu 210 215 220 Glu Lys Val Asp Pro Gln Gly Ile Arg His Arg Met Thr Ile His Phe 225 230 235 240 Gly Glu Val Leu Lys Leu Phe Gly Gly Leu Val Asn Glu Arg Leu Glu 245 250 255 Gln Arg Arg Ser Lys Gly Glu Lys Asn Asp Val Leu Asp Val Leu Leu 260 265 270 Thr Thr Ser Gln Glu Ser Pro Glu Glu Ile Asp Arg Thr His Ile Glu 275 280 285 Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ser 290 295 300 Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Asp Lys Met 305 310 315 320 Lys Lys Thr Gln Asp Glu Leu Ala Gln Val Ile Gly Arg Gly Lys Thr 325 330 335 Ile Glu Glu Ser Asp Ile Asn Arg Leu Pro Tyr Leu Arg Cys Val Met 340 345 350 Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Phe Leu Ile Pro Arg 355 360 365 Lys Val Glu Gln Ser Val Glu Val Cys Gly Tyr Asn Val Pro Lys Gly 370 375 380

Ser Gln Val Leu Val Asn Ala Trp Ala Ile Gly Arg Asp Glu Thr Val 385 390 395 400 Trp Asp Asp Ala Leu Ala Phe Lys Pro Glu Arg Phe Met Glu Ser Glu 405 410 415 Leu Asp Ile Arg Gly Arg Asp Phe Glu Leu Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Leu Arg Thr Val Pro Leu 435 440 445 Met Leu Gly Ser Leu Leu Asn Ser Phe Asn Trp Lys Leu Glu Gly Gly 450 455 460 Met Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile Thr Leu 465 470 475 480 Gln Lys Ala His Pro Leu Arg Ala Val Pro Ser Thr Leu 485 490 <210> SEQ ID NO 28 <211> LENGTH: 477 <212> TYPE: PRT <213> ORGANISM: Helianthus tuberosus <220> FEATURE: <223> OTHER INFORMATION: CYP76B1 7-ethoxycoumarin O-deethylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAA71178 <309> DATABASE ENTRY DATE: 1997-12-12 <400> SEQUENCE: 28 His Glu Trp Val Leu Gly Val Gly Lys Pro Lys Asn Leu Pro Pro Gly 1 5 10 15 Pro Thr Arg Leu Pro Ile Ile Gly Asn Leu His Leu Leu Gly Ala Leu 20 25 30 Pro His Gln Ser Leu Ala Lys Leu Ala Lys Ile His Gly Pro Ile Met 35 40 45 Ser Leu Gln Leu Gly Gln Ile Thr Thr Leu Val Ile Ser Ser Ala Thr 50 55 60 Ala Ala Glu Glu Val Leu Lys Lys Gln Asp Leu Ala Phe Ser Thr Arg 65 70 75 80 Asn Val Pro Asp Ala Val Arg Ala Tyr Asn His Glu Arg His Ser Ile 85 90 95 Ser Phe Leu His Val Cys Thr Glu Trp Arg Thr Leu Arg Arg Ile Val 100 105 110 Ser Ser Asn Ile Phe Ser Asn Ser Ser Leu Glu Ala Lys Gln His Leu 115 120 125 Arg Ser Lys Lys Val Glu Glu Leu Ile Ala Tyr Cys Arg Lys Ala Ala 130 135 140 Leu Ser Asn Glu Asn Val His Ile Gly Arg Ala Ala Phe Arg Thr Ser 145 150 155 160 Leu Asn Leu Leu Ser Asn Thr Ile Phe Ser Lys Asp Leu Thr Asp Pro 165 170 175 Tyr Glu Asp Ser Ala Ser Gly Lys Glu Phe Arg Glu Val Ile Thr Asn 180 185 190 Ile Met Val Asp Ser Ala Lys Thr Asn Leu Val Asp Val Phe Pro Val 195 200 205 Leu Lys Arg Ile Asp Pro Gln Gly Ile Lys Arg Gly Met Ala Arg His 210 215 220 Phe Ser Lys Val Leu Gly Ile Phe Asp Gln Leu Ile Glu Glu Arg Met 225 230 235 240 Arg Thr Gly Arg Phe Glu Gln Gly Asp Val Leu Asp Val Cys Leu Lys 245 250 255 Met Met Gln Asp Asn Pro Asn Glu Phe Asn His Thr Asn Ile Lys Ala 260 265 270 Leu Phe Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ile Thr 275 280 285 Ile Glu Trp Ala Met Thr Glu Leu Leu Arg Lys Pro His Ile Met Ser 290 295 300 Lys Ala Lys Glu Glu Leu Glu Lys Val Ile Gly Lys Gly Ser Ile Val 305 310 315 320 Lys Glu Asp Asp Val Leu Arg Leu Pro Tyr Leu Ser Cys Ile Val Lys 325 330 335 Glu Val Leu Arg Leu His Pro Pro Ser Pro Leu Leu Leu Pro Arg Lys 340 345 350 Val Val Thr Gln Val Glu Leu Ser Gly Tyr Thr Ile Pro Ala Gly Thr 355 360 365 Leu Val Phe Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Thr Val Trp 370 375 380 Asp Asp Ser Leu Glu Phe Lys Pro Gln Arg Phe Leu Glu Ser Arg Leu 385 390 395 400 Asp Val Arg Gly His Asp Phe Asp Leu Ile Pro Phe Gly Ala Gly Arg 405 410 415 Arg Ile Cys Pro Gly Ile Pro Leu Ala Thr Arg Met Val Pro Ile Met 420 425 430 Leu Gly Ser Leu Leu Asn Asn Phe Asp Trp Lys Ile Asp Thr Lys Val 435 440 445 Pro Tyr Asp Val Leu Asp Met Thr Glu Lys Asn Gly Thr Thr Ile Ser 450 455 460 Lys Ala Lys Pro Leu Cys Val Val Pro Ile Pro Leu Asn 465 470 475 <210> SEQ ID NO 29 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Swertia mussotii <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol 10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ACZ48680 <309> DATABASE ENTRY DATE: 2010-09-02 <400> SEQUENCE: 29 Met Asp Phe Asp Phe Leu Thr Ile Ala Ile Gly Phe Leu Phe Thr Ile 1 5 10 15 Thr Leu Tyr Gln Ala Leu Asn Phe Phe Ser Arg Lys Ser Lys Asn Leu 20 25 30 Pro Pro Gly Pro Ser Pro Leu Pro Leu Ile Gly Asn Leu His Leu Leu 35 40 45 Gly Asp Gln Pro His Lys Ser Leu Ala Lys Leu Ala Lys Lys His Gly 50 55 60 Pro Ile Met Gly Leu Gln Leu Gly Gln Val Thr Thr Ile Val Val Thr 65 70 75 80 Ser Ser Gly Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe 85 90 95 Ser Ser Arg Ser Ile Pro Asn Ala Ile His Ala His Asp Gln Tyr Lys 100 105 110 Tyr Ser Val Ile Trp Leu Pro Val Ala Ser Arg Trp Arg Gly Leu Arg 115 120 125 Lys Ala Leu Asn Ser Asn Met Phe Ser Gly Asn Arg Leu Asp Ala Asn 130 135 140 Gln His Leu Arg Ser Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg 145 150 155 160 Lys Ser Ser Gln Thr Gly Asp Ala Ile Asp Val Gly Arg Ala Ala Phe 165 170 175 Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Met Phe Ser Lys Asp Leu 180 185 190 Thr Asp Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp 195 200 205 Asn Val Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr Phe Pro 210 215 220 Leu Leu Asp Lys Val Asp Pro Gln Gly Ile Arg Lys Arg Met Thr Ile 225 230 235 240 His Phe Gly Lys Ile Leu Glu Leu Phe Gly Gly Leu Ile Asp Glu Arg 245 250 255 Leu Gln Gln Lys Lys Ala Lys Gly Val Asn Asp Asp Val Leu Asp Val 260 265 270 Leu Leu Thr Thr Ser Glu Glu Ser Pro Glu Glu Ile Asp Arg Thr His 275 280 285 Ile Gln Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr 290 295 300 Ser Ser Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Glu 305 310 315 320 Lys Met Lys Ala Ala Gln Ala Glu Leu Ala Gln Val Ile Gly Lys Gly 325 330 335 Lys Ala Val Glu Glu Ala Asp Leu Ala Arg Leu Pro Tyr Leu Arg Cys 340 345 350 Ala Ile Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Leu Leu Ile 355 360 365 Pro Arg Arg Thr Glu Gln Glu Val Glu Val Cys Gly Tyr Thr Val Pro 370 375 380 Lys Asn Ser Gln Val Leu Val Asn Val Trp Ala Ile Ser Arg Asp Asp 385 390 395 400 Ala Ile Trp Lys Asp Pro Leu Ser Phe Lys Pro Glu Arg Phe Leu Glu 405 410 415 Ser Glu Leu Glu Met Arg Gly Lys Asp Phe Glu Leu Ile Pro Phe Gly 420 425 430 Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Val Arg Met Val 435 440 445 Pro Val Met Leu Gly Ser Leu Leu Asn Ser Phe Asp Trp Lys Leu Glu 450 455 460 Gly Gly Ile Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile 465 470 475 480 Thr Leu Gln Lys Ala His Pro Leu Arg Ala Val Ala Thr Pro Leu 485 490 495 <210> SEQ ID NO 30 <211> LENGTH: 502 <212> TYPE: PRT <213> ORGANISM: Persea americana <220> FEATURE: <223> OTHER INFORMATION: CYP71A1 cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P24465 <309> DATABASE ENTRY DATE: 2010-11-02 <400> SEQUENCE: 30 Met Ala Ile Leu Val Ser Leu Leu Phe Leu Ala Ile Ala Leu Thr Phe 1 5 10 15 Phe Leu Leu Lys Leu Asn Glu Lys Arg Glu Lys Lys Pro Asn Leu Pro 20 25 30 Pro Ser Pro Pro Asn Leu Pro Ile Ile Gly Asn Leu His Gln Leu Gly

35 40 45 Asn Leu Pro His Arg Ser Leu Arg Ser Leu Ala Asn Glu Leu Gly Pro 50 55 60 Leu Ile Leu Leu His Leu Gly His Ile Pro Thr Leu Ile Val Ser Thr 65 70 75 80 Ala Glu Ile Ala Glu Glu Ile Leu Lys Thr His Asp Leu Ile Phe Ala 85 90 95 Ser Arg Pro Ser Thr Thr Ala Ala Arg Arg Ile Phe Tyr Asp Cys Thr 100 105 110 Asp Val Ala Phe Ser Pro Tyr Gly Glu Tyr Trp Arg Gln Val Arg Lys 115 120 125 Ile Cys Val Leu Glu Leu Leu Ser Ile Lys Arg Val Asn Ser Tyr Arg 130 135 140 Ser Ile Arg Glu Glu Glu Val Gly Leu Met Met Glu Arg Ile Ser Gln 145 150 155 160 Ser Cys Ser Thr Gly Glu Ala Val Asn Leu Ser Glu Leu Leu Leu Leu 165 170 175 Leu Ser Ser Gly Thr Ile Thr Arg Val Ala Phe Gly Lys Lys Tyr Glu 180 185 190 Gly Glu Glu Glu Arg Lys Asn Lys Phe Ala Asp Leu Ala Thr Glu Leu 195 200 205 Thr Thr Leu Met Gly Ala Phe Phe Val Gly Asp Tyr Phe Pro Ser Phe 210 215 220 Ala Trp Val Asp Val Leu Thr Gly Met Asp Ala Arg Leu Lys Arg Asn 225 230 235 240 His Gly Glu Leu Asp Ala Phe Val Asp His Val Ile Asp Asp His Leu 245 250 255 Leu Ser Arg Lys Ala Asn Gly Ser Asp Gly Val Glu Gln Lys Asp Leu 260 265 270 Val Asp Val Leu Leu His Leu Gln Lys Asp Ser Ser Leu Gly Val His 275 280 285 Leu Asn Arg Asn Asn Leu Lys Ala Val Ile Leu Asp Met Phe Ser Gly 290 295 300 Gly Thr Asp Thr Thr Ala Val Thr Leu Glu Trp Ala Met Ala Glu Leu 305 310 315 320 Ile Lys His Pro Asp Val Met Glu Lys Ala Gln Gln Glu Val Arg Arg 325 330 335 Val Val Gly Lys Lys Ala Lys Val Glu Glu Glu Asp Leu His Gln Leu 340 345 350 His Tyr Leu Lys Leu Ile Ile Lys Glu Thr Leu Arg Leu His Pro Val 355 360 365 Ala Pro Leu Leu Val Pro Arg Glu Ser Thr Arg Asp Val Val Ile Arg 370 375 380 Gly Tyr His Ile Pro Ala Lys Thr Arg Val Phe Ile Asn Ala Trp Ala 385 390 395 400 Ile Gly Arg Asp Pro Lys Ser Trp Glu Asn Ala Glu Glu Phe Leu Pro 405 410 415 Glu Arg Phe Val Asn Asn Ser Val Asp Phe Lys Gly Gln Asp Phe Gln 420 425 430 Leu Ile Pro Phe Gly Ala Gly Arg Arg Gly Cys Pro Gly Ile Ala Phe 435 440 445 Gly Ile Ser Ser Val Glu Ile Ser Leu Ala Asn Leu Leu Tyr Trp Phe 450 455 460 Asn Trp Glu Leu Pro Gly Asp Leu Thr Lys Glu Asp Leu Asp Met Ser 465 470 475 480 Glu Ala Val Gly Ile Thr Val His Met Lys Phe Pro Leu Gln Leu Val 485 490 495 Ala Lys Arg His Leu Ser 500 <210> SEQ ID NO 31 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71A32 (+)-pulegone 9-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q947B7 <309> DATABASE ENTRY DATE: 2012-09-05 <400> SEQUENCE: 31 Met Ala Ala Leu Leu Val Phe Phe Ser Val Ser Leu Ile Leu Leu Ala 1 5 10 15 Val Leu Phe His Lys Arg Lys Ser Ser Leu Ser Ser Arg Lys Arg Pro 20 25 30 Pro Pro Ser Pro Leu Arg Leu Pro Val Ile Gly His Phe His Leu Ile 35 40 45 Gly Ala Leu Ser His Arg Ser Phe Thr Ser Leu Ser Lys Arg Tyr Gly 50 55 60 Glu Val Met Leu Leu His Phe Gly Ser Ala Pro Val Leu Val Ala Ser 65 70 75 80 Ser Ala Ala Ala Ala Arg Glu Ile Met Lys Asn Gln Asp Val Ile Phe 85 90 95 Ala Ser Arg Pro Arg Leu Ser Ile Phe Asp Arg Leu Met Tyr Ser Gly 100 105 110 Lys Gly Val Ala Phe Ala Pro Tyr Gly Glu His Trp Arg Asn Ala Arg 115 120 125 Ser Met Cys Met Leu Gln Leu Leu Ser Ala Lys Arg Val Gln Ser Phe 130 135 140 Gly Gly Ile Arg Glu Glu Glu Thr Ser Ala Met Ile Glu Lys Ile Arg 145 150 155 160 Arg Ser Lys Pro Thr Thr Val Val Asn Leu Ser Glu Met Phe Met Ala 165 170 175 Leu Thr Asn Gly Val Ile His Arg Ala Val Leu Gly Arg Lys Gly Asp 180 185 190 Gly Gly Asp Asp Phe Asn Arg Ile Leu Ile Lys Val Ile Lys Leu Leu 195 200 205 Gly Ser Phe Asn Val Gly Asp Tyr Val Pro Trp Leu Ser Trp Ile Asn 210 215 220 Arg Ile Asn Gly Val Asp Ala Glu Val Glu Lys Val Gly Thr Lys Leu 225 230 235 240 Asp Gly Ser Met Glu Gly Ile Leu Arg Lys Tyr Arg Arg Lys Lys Val 245 250 255 Gly Asp Asp Glu Thr Asn Phe Val Asp Thr Leu Leu Gln Phe Gln Arg 260 265 270 Glu Ser Lys Asp Thr Asp Pro Val Glu Asp Asp Val Ile Lys Ala Leu 275 280 285 Ile Phe Asp Met Val Ser Ala Gly Thr Asp Thr Thr Phe Ala Ala Leu 290 295 300 Glu Trp Thr Met Ala Glu Leu Ile Lys Asn Pro Arg Thr Leu Lys Thr 305 310 315 320 Leu Gln Asn Glu Val Arg Glu Val Ser Arg Asn Lys Gly Gly Ile Thr 325 330 335 Glu Asp Asp Val Asp Lys Met Pro Tyr Leu Lys Ala Val Ser Lys Glu 340 345 350 Ile Leu Arg Leu His Pro Pro Phe Ala Ile Leu Leu Pro Arg Glu Leu 355 360 365 Thr Gln Asp Ala Asn Met Leu Gly Tyr Asp Ile Pro Arg Gly Thr Val 370 375 380 Val Leu Val Asn Asn Trp Ala Ile Ser Arg Asp Pro Ser Leu Trp Glu 385 390 395 400 Asn Pro Glu Glu Phe Arg Pro Glu Arg Phe Leu Glu Thr Ser Ile Asp 405 410 415 Tyr Lys Gly Leu His Phe Glu Met Leu Pro Phe Gly Ser Gly Arg Arg 420 425 430 Gly Cys Pro Gly Ser Thr Phe Ala Met Ala Leu Tyr Glu Leu Ala Leu 435 440 445 Ser Lys Leu Val Asn Glu Phe Asp Phe Arg Leu Gly Asn Gly Asp Arg 450 455 460 Ala Glu Asp Leu Asp Met Thr Glu Ala Pro Gly Phe Val Val His Lys 465 470 475 480 Lys Ser Pro Leu Leu Val Leu Ala Thr Pro Arg Gln Ser 485 490 <210> SEQ ID NO 32 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Artemisia annua <220> FEATURE: <223> OTHER INFORMATION: CYP71AV1 amorpha-4,11-diene C-12 oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ABB82944 <309> DATABASE ENTRY DATE: 2006-04-13 <400> SEQUENCE: 32 Met Lys Ser Ile Leu Lys Ala Met Ala Leu Ser Leu Thr Thr Ser Ile 1 5 10 15 Ala Leu Ala Thr Ile Leu Leu Phe Val Tyr Lys Phe Ala Thr Arg Ser 20 25 30 Lys Ser Thr Lys Lys Ser Leu Pro Glu Pro Trp Arg Leu Pro Ile Ile 35 40 45 Gly His Met His His Leu Ile Gly Thr Thr Pro His Arg Gly Val Arg 50 55 60 Asp Leu Ala Arg Lys Tyr Gly Ser Leu Met His Leu Gln Leu Gly Glu 65 70 75 80 Val Pro Thr Ile Val Val Ser Ser Pro Lys Trp Ala Lys Glu Ile Leu 85 90 95 Thr Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr Leu Thr Gly 100 105 110 Glu Ile Val Leu Tyr His Asn Thr Asp Val Val Leu Ala Pro Tyr Gly 115 120 125 Glu Tyr Trp Arg Gln Leu Arg Lys Ile Cys Thr Leu Glu Leu Leu Ser 130 135 140 Val Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu Glu Cys Trp 145 150 155 160 Asn Leu Val Gln Glu Ile Lys Ala Ser Gly Ser Gly Arg Pro Val Asn 165 170 175 Leu Ser Glu Asn Val Phe Lys Leu Ile Ala Thr Ile Leu Ser Arg Ala 180 185 190 Ala Phe Gly Lys Gly Ile Lys Asp Gln Lys Glu Leu Thr Glu Ile Val 195 200 205 Lys Glu Ile Leu Arg Gln Thr Gly Gly Phe Asp Val Ala Asp Ile Phe 210 215 220 Pro Ser Lys Lys Phe Leu His His Leu Ser Gly Lys Arg Ala Arg Leu

225 230 235 240 Thr Ser Leu Arg Lys Lys Ile Asp Asn Leu Ile Asp Asn Leu Val Ala 245 250 255 Glu His Thr Val Asn Thr Ser Ser Lys Thr Asn Glu Thr Leu Leu Asp 260 265 270 Val Leu Leu Arg Leu Lys Asp Ser Ala Glu Phe Pro Leu Thr Ser Asp 275 280 285 Asn Ile Lys Ala Ile Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr 290 295 300 Ser Ser Ser Thr Ile Glu Trp Ala Ile Ser Glu Leu Ile Lys Cys Pro 305 310 315 320 Lys Ala Met Glu Lys Val Gln Ala Glu Leu Arg Lys Ala Leu Asn Gly 325 330 335 Lys Glu Lys Ile His Glu Glu Asp Ile Gln Glu Leu Ser Tyr Leu Asn 340 345 350 Met Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Leu Pro Leu Val 355 360 365 Leu Pro Arg Glu Cys Arg Gln Pro Val Asn Leu Ala Gly Tyr Asn Ile 370 375 380 Pro Asn Lys Thr Lys Leu Ile Val Asn Val Phe Ala Ile Asn Arg Asp 385 390 395 400 Pro Glu Tyr Trp Lys Asp Ala Glu Ala Phe Ile Pro Glu Arg Phe Glu 405 410 415 Asn Ser Ser Ala Thr Val Met Gly Ala Glu Tyr Glu Tyr Leu Pro Phe 420 425 430 Gly Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn 435 440 445 Val Gln Leu Pro Leu Ala Asn Ile Leu Tyr His Phe Asn Trp Lys Leu 450 455 460 Pro Asn Gly Val Ser Tyr Asp Gln Ile Asp Met Thr Glu Ser Ser Gly 465 470 475 480 Ala Thr Met Gln Arg Lys Thr Glu Leu Leu Leu Val Pro Ser Phe 485 490 495 <210> SEQ ID NO 33 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Cichorium intybus <220> FEATURE: <223> OTHER INFORMATION: CYP71AV8 valencene oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADM86719 <309> DATABASE ENTRY DATE: 2011-01-24 <400> SEQUENCE: 33 Met Glu Ile Ser Ile Pro Thr Thr Leu Gly Leu Ala Val Ile Ile Phe 1 5 10 15 Ile Ile Phe Lys Leu Leu Thr Arg Thr Thr Ser Lys Lys Asn Leu Leu 20 25 30 Pro Glu Pro Trp Arg Leu Pro Ile Ile Gly His Met His His Leu Ile 35 40 45 Gly Thr Met Pro His Arg Gly Val Met Glu Leu Ala Arg Lys His Gly 50 55 60 Ser Leu Met His Leu Gln Leu Gly Glu Val Ser Thr Ile Val Val Ser 65 70 75 80 Ser Pro Arg Trp Ala Lys Glu Val Leu Thr Thr Tyr Asp Ile Thr Phe 85 90 95 Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu Ile Val Ala Tyr His Asn 100 105 110 Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg 115 120 125 Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn Lys Lys Val Lys Ser Phe 130 135 140 Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn Leu Val Lys Asp Ile Arg 145 150 155 160 Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys 165 170 175 Met Ile Ala Thr Ile Leu Ser Arg Ala Ala Phe Gly Lys Gly Ile Lys 180 185 190 Asp Gln Met Lys Phe Thr Glu Leu Val Lys Glu Ile Leu Arg Leu Thr 195 200 205 Gly Gly Phe Asp Val Ala Asp Ile Phe Pro Ser Lys Lys Leu Leu His 210 215 220 His Leu Ser Gly Lys Arg Ala Lys Leu Thr Asn Ile His Asn Lys Leu 225 230 235 240 Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu His Pro Gly Asn Arg Thr 245 250 255 Ser Ser Ser Gln Glu Thr Leu Leu Asp Val Leu Leu Arg Leu Lys Glu 260 265 270 Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn Val Lys Ala Val Ile Leu 275 280 285 Asp Met Phe Gly Ala Gly Thr Asp Thr Ser Ser Ala Thr Ile Glu Trp 290 295 300 Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg Ala Met Glu Lys Val Gln 305 310 315 320 Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu 325 330 335 Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu 340 345 350 Arg Leu His Pro Pro Leu Pro Leu Val Met Pro Arg Glu Cys Arg Glu 355 360 365 Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile 370 375 380 Val Asn Val Phe Ala Ile Asn Arg Asp Pro Glu Tyr Trp Lys Asp Ala 385 390 395 400 Glu Thr Phe Met Pro Glu Arg Phe Glu Asn Ser Pro Ile Thr Val Met 405 410 415 Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys 420 425 430 Pro Gly Ala Ala Leu Gly Leu Ala Asn Val Glu Leu Pro Leu Ala His 435 440 445 Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu 450 455 460 Asp Leu Asp Met Thr Glu Ser Phe Gly Ala Thr Val Gln Arg Lys Thr 465 470 475 480 Glu Leu Leu Leu Val Pro Thr Asp Phe Gln Thr Leu Thr Ala Ser Thr 485 490 495 <210> SEQ ID NO 34 <211> LENGTH: 490 <212> TYPE: PRT <213> ORGANISM: Lactuca sativa <220> FEATURE: <223> OTHER INFORMATION: CYP71BL1 costunolide synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AEI59780 <309> DATABASE ENTRY DATE: 2011-06-26 <400> SEQUENCE: 34 Met Glu Pro Leu Thr Ile Val Ser Leu Ala Val Ala Ser Phe Leu Leu 1 5 10 15 Phe Ala Phe Trp Ala Leu Ser Pro Lys Thr Ser Lys Asn Leu Pro Pro 20 25 30 Gly Pro Pro Lys Leu Pro Ile Ile Gly Asn Ile His Gln Leu Lys Ser 35 40 45 Pro Thr Pro His Arg Val Leu Arg Asn Leu Ala Lys Lys Tyr Gly Pro 50 55 60 Ile Met His Leu Gln Leu Gly Gln Val Ser Thr Val Val Val Ser Thr 65 70 75 80 Pro Arg Leu Ala Arg Glu Ile Met Lys Thr Asn Asp Ile Ser Phe Ala 85 90 95 Asp Arg Pro Thr Thr Thr Thr Ser Gln Ile Phe Phe Tyr Lys Ala Gln 100 105 110 Asp Ile Gly Trp Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Met Lys Lys 115 120 125 Ile Cys Thr Leu Glu Leu Leu Ser Ala Lys Lys Val Arg Ser Phe Ser 130 135 140 Ser Ile Arg Glu Glu Glu Leu Arg Arg Ile Ser Lys Val Leu Glu Ser 145 150 155 160 Lys Ala Gly Thr Pro Val Asn Phe Thr Glu Met Thr Val Glu Met Val 165 170 175 Asn Asn Val Ile Cys Lys Ala Thr Leu Gly Asp Ser Cys Lys Asp Gln 180 185 190 Ala Thr Leu Ile Glu Val Leu Tyr Asp Val Leu Lys Thr Leu Ser Ala 195 200 205 Phe Asn Leu Ala Ser Tyr Tyr Pro Gly Leu Gln Phe Leu Asn Val Ile 210 215 220 Leu Gly Lys Lys Ala Lys Trp Leu Lys Met Gln Lys Gln Leu Asp Asp 225 230 235 240 Ile Leu Glu Asp Val Leu Lys Glu His Arg Ser Lys Gly Arg Asn Lys 245 250 255 Ser Asp Gln Glu Asp Leu Val Asp Val Leu Leu Arg Val Lys Asp Thr 260 265 270 Gly Gly Leu Asp Phe Thr Val Thr Asp Glu His Val Lys Ala Val Val 275 280 285 Leu Asp Met Leu Thr Ala Gly Thr Asp Thr Ser Ser Ala Thr Leu Glu 290 295 300 Trp Ala Met Thr Glu Leu Met Arg Asn Pro His Met Met Lys Arg Ala 305 310 315 320 Gln Glu Glu Val Arg Ser Val Val Lys Gly Asp Thr Ile Thr Glu Thr 325 330 335 Asp Leu Gln Ser Leu His Tyr Leu Lys Leu Ile Val Lys Glu Thr Leu 340 345 350 Arg Leu His Ala Pro Thr Pro Leu Leu Val Pro Arg Glu Cys Arg Gln 355 360 365 Ala Cys Asn Val Asp Gly Tyr Asp Ile Pro Ala Lys Thr Lys Ile Leu 370 375 380 Val Asn Ala Trp Ala Cys Gly Thr Asp Pro Asp Ser Trp Lys Asp Ala 385 390 395 400 Glu Ser Phe Ile Pro Glu Arg Phe Glu Asn Cys Pro Ile Asn Tyr Met 405 410 415 Gly Ala Asp Phe Glu Phe Ile Pro Phe Gly Ala Gly Arg Arg Ile Cys 420 425 430 Pro Gly Leu Thr Phe Gly Leu Ser Met Val Glu Tyr Pro Leu Ala Asn

435 440 445 Phe Leu Tyr His Phe Asp Trp Lys Leu Pro Asn Gly Leu Lys Pro His 450 455 460 Glu Leu Asp Ile Thr Glu Ile Thr Gly Ile Ser Thr Ser Leu Lys His 465 470 475 480 Gln Leu Lys Ile Val Pro Ile Leu Lys Ser 485 490 <210> SEQ ID NO 35 <211> LENGTH: 504 <212> TYPE: PRT <213> ORGANISM: Nicotiana tabacum <220> FEATURE: <223> OTHER INFORMATION: CYP71D20 5-epiaristolochene 1,3-dihydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q94FM7 <309> DATABASE ENTRY DATE: 2012-04-18 <400> SEQUENCE: 35 Met Gln Phe Phe Ser Leu Val Ser Ile Phe Leu Phe Leu Ser Phe Leu 1 5 10 15 Phe Leu Leu Arg Lys Trp Lys Asn Ser Asn Ser Gln Ser Lys Lys Leu 20 25 30 Pro Pro Gly Pro Trp Lys Ile Pro Ile Leu Gly Ser Met Leu His Met 35 40 45 Ile Gly Gly Glu Pro His His Val Leu Arg Asp Leu Ala Lys Lys Tyr 50 55 60 Gly Pro Leu Met His Leu Gln Leu Gly Glu Ile Ser Ala Val Val Val 65 70 75 80 Thr Ser Arg Asp Met Ala Lys Glu Val Leu Lys Thr His Asp Val Val 85 90 95 Phe Ala Ser Arg Pro Lys Ile Val Ala Met Asp Ile Ile Cys Tyr Asn 100 105 110 Gln Ser Asp Ile Ala Phe Ser Pro Tyr Gly Asp His Trp Arg Gln Met 115 120 125 Arg Lys Ile Cys Val Met Glu Leu Leu Asn Ala Lys Asn Val Arg Ser 130 135 140 Phe Ser Ser Ile Arg Arg Asp Glu Val Val Arg Leu Ile Asp Ser Ile 145 150 155 160 Arg Ser Asp Ser Ser Ser Gly Glu Leu Val Asn Phe Thr Gln Arg Ile 165 170 175 Ile Trp Phe Ala Ser Ser Met Thr Cys Arg Ser Ala Phe Gly Gln Val 180 185 190 Leu Lys Gly Gln Asp Ile Phe Ala Lys Lys Ile Arg Glu Val Ile Gly 195 200 205 Leu Ala Glu Gly Phe Asp Val Val Asp Ile Phe Pro Thr Tyr Lys Phe 210 215 220 Leu His Val Leu Ser Gly Met Lys Arg Lys Leu Leu Asn Ala His Leu 225 230 235 240 Lys Val Asp Ala Ile Val Glu Asp Val Ile Asn Glu His Lys Lys Asn 245 250 255 Leu Ala Ala Gly Lys Ser Asn Gly Ala Leu Gly Gly Glu Asp Leu Ile 260 265 270 Asp Val Leu Leu Arg Leu Met Asn Asp Thr Ser Leu Gln Phe Pro Ile 275 280 285 Thr Asn Asp Asn Ile Lys Ala Val Ile Val Asp Met Phe Ala Ala Gly 290 295 300 Thr Glu Thr Ser Ser Thr Thr Thr Val Trp Ala Met Ala Glu Met Met 305 310 315 320 Lys Asn Pro Ser Val Phe Thr Lys Ala Gln Ala Glu Val Arg Glu Ala 325 330 335 Phe Arg Asp Lys Val Ser Phe Asp Glu Asn Asp Val Glu Glu Leu Lys 340 345 350 Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Ser 355 360 365 Pro Leu Leu Val Pro Arg Glu Cys Arg Glu Asp Thr Asp Ile Asn Gly 370 375 380 Tyr Thr Ile Pro Ala Lys Thr Lys Val Met Val Asn Val Trp Ala Leu 385 390 395 400 Gly Arg Asp Pro Lys Tyr Trp Asp Asp Ala Glu Ser Phe Lys Pro Glu 405 410 415 Arg Phe Glu Gln Cys Ser Val Asp Phe Phe Gly Asn Asn Phe Glu Phe 420 425 430 Leu Pro Phe Gly Gly Gly Arg Arg Ile Cys Pro Gly Met Ser Phe Gly 435 440 445 Leu Ala Asn Leu Tyr Leu Pro Leu Ala Gln Leu Leu Tyr His Phe Asp 450 455 460 Trp Lys Leu Pro Thr Gly Ile Met Pro Arg Asp Leu Asp Leu Thr Glu 465 470 475 480 Leu Ser Gly Ile Thr Ile Ala Arg Lys Gly Gly Leu Tyr Leu Asn Ala 485 490 495 Thr Pro Tyr Gln Pro Ser Arg Glu 500 <210> SEQ ID NO 36 <211> LENGTH: 500 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71D13 (-)-(4S)-Limonene-3-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q9XHE7 <309> DATABASE ENTRY DATE: 2006-11-28 <400> SEQUENCE: 36 Met Glu Leu Gln Ile Ser Ser Ala Ile Ile Ile Leu Val Val Thr Tyr 1 5 10 15 Thr Ile Ser Leu Leu Ile Ile Lys Gln Trp Arg Lys Pro Lys Pro Gln 20 25 30 Glu Asn Leu Pro Pro Gly Pro Pro Lys Leu Pro Leu Ile Gly His Leu 35 40 45 His Leu Leu Trp Gly Lys Leu Pro Gln His Ala Leu Ala Ser Val Ala 50 55 60 Lys Gln Tyr Gly Pro Val Ala His Val Gln Leu Gly Glu Val Phe Ser 65 70 75 80 Val Val Leu Ser Ser Arg Glu Ala Thr Lys Glu Ala Met Lys Leu Val 85 90 95 Asp Pro Ala Cys Ala Asp Arg Phe Glu Ser Ile Gly Thr Lys Ile Met 100 105 110 Trp Tyr Asp Asn Asp Asp Ile Ile Phe Ser Pro Tyr Ser Val His Trp 115 120 125 Arg Gln Met Arg Lys Ile Cys Val Ser Glu Leu Leu Ser Ala Arg Asn 130 135 140 Val Arg Ser Phe Gly Phe Ile Arg Gln Asp Glu Val Ser Arg Leu Leu 145 150 155 160 Gly His Leu Arg Ser Ser Ala Ala Ala Gly Glu Ala Val Asp Leu Thr 165 170 175 Glu Arg Ile Ala Thr Leu Thr Cys Ser Ile Ile Cys Arg Ala Ala Phe 180 185 190 Gly Ser Val Ile Arg Asp His Glu Glu Leu Val Glu Leu Val Lys Asp 195 200 205 Ala Leu Ser Met Ala Ser Gly Phe Glu Leu Ala Asp Met Phe Pro Ser 210 215 220 Ser Lys Leu Leu Asn Leu Leu Cys Trp Asn Lys Ser Lys Leu Trp Arg 225 230 235 240 Met Arg Arg Arg Val Asp Ala Ile Leu Glu Ala Ile Val Glu Glu His 245 250 255 Lys Leu Lys Lys Ser Gly Glu Phe Gly Gly Glu Asp Ile Ile Asp Val 260 265 270 Leu Phe Arg Met Gln Lys Asp Ser Gln Ile Lys Val Pro Ile Thr Thr 275 280 285 Asn Ala Ile Lys Ala Phe Ile Phe Asp Thr Phe Ser Ala Gly Thr Glu 290 295 300 Thr Ser Ser Thr Thr Thr Leu Trp Val Met Ala Glu Leu Met Arg Asn 305 310 315 320 Pro Glu Val Met Ala Lys Ala Gln Ala Glu Val Arg Ala Ala Leu Lys 325 330 335 Gly Lys Thr Asp Trp Asp Val Asp Asp Val Gln Glu Leu Lys Tyr Met 340 345 350 Lys Ser Val Val Lys Glu Thr Met Arg Met His Pro Pro Ile Pro Leu 355 360 365 Ile Pro Arg Ser Cys Arg Glu Glu Cys Glu Val Asn Gly Tyr Thr Ile 370 375 380 Pro Asn Lys Ala Arg Ile Met Ile Asn Val Trp Ser Met Gly Arg Asn 385 390 395 400 Pro Leu Tyr Trp Glu Lys Pro Glu Thr Phe Trp Pro Glu Arg Phe Asp 405 410 415 Gln Val Ser Arg Asp Phe Met Gly Asn Asp Phe Glu Phe Ile Pro Phe 420 425 430 Gly Ala Gly Arg Arg Ile Cys Pro Gly Leu Asn Phe Gly Leu Ala Asn 435 440 445 Val Glu Val Pro Leu Ala Gln Leu Leu Tyr His Phe Asp Trp Lys Leu 450 455 460 Ala Glu Gly Met Asn Pro Ser Asp Met Asp Met Ser Glu Ala Glu Gly 465 470 475 480 Leu Thr Gly Ile Arg Lys Asn Asn Leu Leu Leu Val Pro Thr Pro Tyr 485 490 495 Asp Pro Ser Ser 500 <210> SEQ ID NO 37 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Mentha spicata <220> FEATURE: <223> OTHER INFORMATION: CYP71D18 (-)-(4S)-Limonene-6-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q6WKZ1 <309> DATABASE ENTRY DATE: 2012-04-18 <400> SEQUENCE: 37 Met Glu Leu Asp Leu Leu Ser Ala Ile Ile Ile Leu Val Ala Thr Tyr 1 5 10 15 Ile Val Ser Leu Leu Ile Asn Gln Trp Arg Lys Ser Lys Ser Gln Gln 20 25 30 Asn Leu Pro Pro Ser Pro Pro Lys Leu Pro Val Ile Gly His Leu His 35 40 45

Phe Leu Trp Gly Gly Leu Pro Gln His Val Phe Arg Ser Ile Ala Gln 50 55 60 Lys Tyr Gly Pro Val Ala His Val Gln Leu Gly Glu Val Tyr Ser Val 65 70 75 80 Val Leu Ser Ser Ala Glu Ala Ala Lys Gln Ala Met Lys Val Leu Asp 85 90 95 Pro Asn Phe Ala Asp Arg Phe Asp Gly Ile Gly Ser Arg Thr Met Trp 100 105 110 Tyr Asp Lys Asp Asp Ile Ile Phe Ser Pro Tyr Asn Asp His Trp Arg 115 120 125 Gln Met Arg Arg Ile Cys Val Thr Glu Leu Leu Ser Pro Lys Asn Val 130 135 140 Arg Ser Phe Gly Tyr Ile Arg Gln Glu Glu Ile Glu Arg Leu Ile Arg 145 150 155 160 Leu Leu Gly Ser Ser Gly Gly Ala Pro Val Asp Val Thr Glu Glu Val 165 170 175 Ser Lys Met Ser Cys Val Val Val Cys Arg Ala Ala Phe Gly Ser Val 180 185 190 Leu Lys Asp Gln Gly Ser Leu Ala Glu Leu Val Lys Glu Ser Leu Ala 195 200 205 Leu Ala Ser Gly Phe Glu Leu Ala Asp Leu Tyr Pro Ser Ser Trp Leu 210 215 220 Leu Asn Leu Leu Ser Leu Asn Lys Tyr Arg Leu Gln Arg Met Arg Arg 225 230 235 240 Arg Leu Asp His Ile Leu Asp Gly Phe Leu Glu Glu His Arg Glu Lys 245 250 255 Lys Ser Gly Glu Phe Gly Gly Glu Asp Ile Val Asp Val Leu Phe Arg 260 265 270 Met Gln Lys Gly Ser Asp Ile Lys Ile Pro Ile Thr Ser Asn Cys Ile 275 280 285 Lys Gly Phe Ile Phe Asp Thr Phe Ser Ala Gly Ala Glu Thr Ser Ser 290 295 300 Thr Thr Ile Ser Trp Ala Leu Ser Glu Leu Met Arg Asn Pro Ala Lys 305 310 315 320 Met Ala Lys Val Gln Ala Glu Val Arg Glu Ala Leu Lys Gly Lys Thr 325 330 335 Val Val Asp Leu Ser Glu Val Gln Glu Leu Lys Tyr Leu Arg Ser Val 340 345 350 Leu Lys Glu Thr Leu Arg Leu His Pro Pro Phe Pro Leu Ile Pro Arg 355 360 365 Gln Ser Arg Glu Glu Cys Glu Val Asn Gly Tyr Thr Ile Pro Ala Lys 370 375 380 Thr Arg Ile Phe Ile Asn Val Trp Ala Ile Gly Arg Asp Pro Gln Tyr 385 390 395 400 Trp Glu Asp Pro Asp Thr Phe Arg Pro Glu Arg Phe Asp Glu Val Ser 405 410 415 Arg Asp Phe Met Gly Asn Asp Phe Glu Phe Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu His Phe Gly Leu Ala Asn Val Glu Ile 435 440 445 Pro Leu Ala Gln Leu Leu Tyr His Phe Asp Trp Lys Leu Pro Gln Gly 450 455 460 Met Thr Asp Ala Asp Leu Asp Met Thr Glu Thr Pro Gly Leu Ser Gly 465 470 475 480 Pro Lys Lys Lys Asn Val Cys Leu Val Pro Thr Leu Tyr Lys Ser Pro 485 490 495 <210> SEQ ID NO 38 <211> LENGTH: 524 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP72A1 Secologanin synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Q05047 <309> DATABASE ENTRY DATE: 2012-09-05 <400> SEQUENCE: 38 Met Glu Met Asp Met Asp Thr Ile Arg Lys Ala Ile Ala Ala Thr Ile 1 5 10 15 Phe Ala Leu Val Met Ala Trp Ala Trp Arg Val Leu Asp Trp Ala Trp 20 25 30 Phe Thr Pro Lys Arg Ile Glu Lys Arg Leu Arg Gln Gln Gly Phe Arg 35 40 45 Gly Asn Pro Tyr Arg Phe Leu Val Gly Asp Val Lys Glu Ser Gly Lys 50 55 60 Met His Gln Glu Ala Leu Ser Lys Pro Met Glu Phe Asn Asn Asp Ile 65 70 75 80 Val Pro Arg Leu Met Pro His Ile Asn His Thr Ile Asn Thr Tyr Gly 85 90 95 Arg Asn Ser Phe Thr Trp Met Gly Arg Ile Pro Arg Ile His Val Met 100 105 110 Glu Pro Glu Leu Ile Lys Glu Val Leu Thr His Ser Ser Lys Tyr Gln 115 120 125 Lys Asn Phe Asp Val His Asn Pro Leu Val Lys Phe Leu Leu Thr Gly 130 135 140 Val Gly Ser Phe Glu Gly Ala Lys Trp Ser Lys His Arg Arg Ile Ile 145 150 155 160 Ser Pro Ala Phe Thr Leu Glu Lys Leu Lys Ser Met Leu Pro Ala Phe 165 170 175 Ala Ile Cys Tyr His Asp Met Leu Thr Lys Trp Glu Lys Ile Ala Glu 180 185 190 Lys Gln Gly Ser His Glu Val Asp Ile Phe Pro Thr Phe Asp Val Leu 195 200 205 Thr Ser Asp Val Ile Ser Lys Val Ala Phe Gly Ser Thr Tyr Glu Glu 210 215 220 Gly Gly Lys Ile Phe Arg Leu Leu Lys Glu Leu Met Asp Leu Thr Ile 225 230 235 240 Asp Cys Met Arg Asp Val Tyr Ile Pro Gly Trp Ser Tyr Leu Pro Thr 245 250 255 Lys Arg Asn Lys Arg Met Lys Glu Ile Asn Lys Glu Ile Thr Asp Met 260 265 270 Leu Arg Phe Ile Ile Asn Lys Arg Met Lys Ala Leu Lys Ala Gly Glu 275 280 285 Pro Gly Glu Asp Asp Leu Leu Gly Val Leu Leu Glu Ser Asn Ile Gln 290 295 300 Glu Ile Gln Lys Gln Gly Asn Lys Lys Asp Gly Gly Met Ser Ile Asn 305 310 315 320 Asp Val Ile Glu Glu Cys Lys Leu Phe Tyr Phe Ala Gly Gln Glu Thr 325 330 335 Thr Gly Val Leu Leu Thr Trp Thr Thr Ile Leu Leu Ser Lys His Pro 340 345 350 Glu Trp Gln Glu Arg Ala Arg Glu Glu Val Leu Gln Ala Phe Gly Lys 355 360 365 Asn Lys Pro Glu Phe Glu Arg Leu Asn His Leu Lys Tyr Val Ser Met 370 375 380 Ile Leu Tyr Glu Val Leu Arg Leu Tyr Pro Pro Val Ile Asp Leu Thr 385 390 395 400 Lys Ile Val His Lys Asp Thr Lys Leu Gly Ser Tyr Thr Ile Pro Ala 405 410 415 Gly Thr Gln Val Met Leu Pro Thr Val Met Leu His Arg Glu Lys Ser 420 425 430 Ile Trp Gly Glu Asp Ala Met Glu Phe Asn Pro Met Arg Phe Val Asp 435 440 445 Gly Val Ala Asn Ala Thr Lys Asn Asn Val Thr Tyr Leu Pro Phe Ser 450 455 460 Trp Gly Pro Arg Val Cys Leu Gly Gln Asn Phe Ala Leu Leu Gln Ala 465 470 475 480 Lys Leu Gly Leu Ala Met Ile Leu Gln Arg Phe Lys Phe Asp Val Ala 485 490 495 Pro Ser Tyr Val His Ala Pro Phe Thr Ile Leu Thr Val Gln Pro Gln 500 505 510 Phe Gly Ser His Val Ile Tyr Lys Lys Leu Glu Ser 515 520 <210> SEQ ID NO 39 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <220> FEATURE: <223> OTHER INFORMATION: CYP76M7 cytochrome P450 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: BAG97435 <309> DATABASE ENTRY DATE: 2008-12-04 <400> SEQUENCE: 39 Met Glu Asn Ser Gln Val Trp Leu Leu Trp Gly Ala Leu Ser Val Ala 1 5 10 15 Val Leu Phe Tyr Leu Ser Thr Leu Arg Arg Arg Tyr Ala Gly Gly Lys 20 25 30 Pro Leu Pro Pro Gly Pro Thr Pro Leu Pro Leu Ile Gly Asn Leu His 35 40 45 Leu Ala Gly Gly Thr Phe His His Lys Leu Arg Asp Leu Ala Arg Val 50 55 60 His Gly Pro Val Met Thr Leu Lys Leu Gly Leu Ala Thr Asn Val Val 65 70 75 80 Ile Ser Ser Arg Glu Ala Ala Ile Glu Ala Tyr Thr Lys Tyr Asp Arg 85 90 95 His Leu Ala Ala Arg Ala Thr Pro Asp Thr Phe Arg Ala Cys Gly Phe 100 105 110 Ala Asp Arg Ser Met Val Phe Ile Pro Ser Ser Asp Pro Gln Trp Lys 115 120 125 Ala Leu Arg Gly Ile Gln Gly Ser His Val Phe Thr Pro Arg Gly Leu 130 135 140 Ala Ala Val Arg Pro Ile Arg Glu Arg Lys Val Gly Asp Leu Ile Ala 145 150 155 160 Tyr Leu Arg Ala His Ala Gly Glu Glu Val Leu Leu Gly Gln Ala Met 165 170 175 Tyr Thr Gly Leu Leu Asn Leu Val Ser Phe Ser Tyr Phe Ser Ile Asp 180 185 190 Ile Val Asp Met Gly Ser Gln Met Ala Arg Asp Leu Arg Glu Val Val 195 200 205 Asp Asp Ile Ile Ser Val Val Gly Lys Pro Asn Ile Ser Asp Phe Tyr 210 215 220

Pro Phe Leu Arg Pro Leu Asp Leu Gln Gly Leu Arg Arg Trp Thr Thr 225 230 235 240 Lys Arg Phe Asn Arg Val Phe Ser Ile Met Gly Asp Ile Ile Asp Arg 245 250 255 Arg Leu Ala His Ile Arg Asp Gly Lys Pro Arg His Asp Asp Phe Leu 260 265 270 Asp Ser Leu Leu Glu Leu Met Ala Thr Gly Lys Met Glu Arg Val Asn 275 280 285 Val Val Asn Met Leu Phe Glu Ala Phe Val Ala Gly Val Asp Thr Met 290 295 300 Ala Leu Thr Leu Glu Trp Val Met Ala Glu Leu Leu His Asn Pro Ala 305 310 315 320 Ile Met Ala Arg Val Arg Ala Glu Leu Ser Asp Val Leu Gly Gly Lys 325 330 335 Glu Ala Val Glu Glu Ala Asp Ala Ala Arg Leu Pro Tyr Leu Gln Ala 340 345 350 Val Leu Lys Glu Ala Met Arg Leu His Pro Val Gly Ala Leu Leu Leu 355 360 365 Pro His Phe Ala Ala Glu Asp Gly Val Glu Ile Gly Gly Tyr Ala Val 370 375 380 Pro Arg Gly Ser Thr Val Leu Phe Asn Ala Trp Ala Ile Met Arg Asp 385 390 395 400 Pro Ala Ala Trp Glu Arg Pro Asp Glu Phe Val Pro Glu Arg Phe Leu 405 410 415 Gly Arg Ser Pro Pro Leu Asp Phe Arg Gly Lys Asp Val Glu Phe Met 420 425 430 Pro Phe Gly Ser Gly Arg Arg Leu Cys Pro Gly Leu Pro Leu Ala Glu 435 440 445 Arg Val Val Pro Phe Ile Leu Ala Ser Met Leu His Thr Phe Glu Trp 450 455 460 Lys Leu Pro Gly Gly Met Thr Ala Glu Asp Val Asp Val Ser Glu Lys 465 470 475 480 Phe Lys Ser Ala Asn Val Leu Ala Val Pro Leu Lys Ala Val Pro Val 485 490 495 Leu Ile Lys <210> SEQ ID NO 40 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR1 Forward Primer <400> SEQUENCE: 40 atgagttcga gctcggagct atg 23 <210> SEQ ID NO 41 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR1 Reverse Primer <400> SEQUENCE: 41 tcaccacaca tcccgtaaat accttc 26 <210> SEQ ID NO 42 <211> LENGTH: 705 <212> TYPE: PRT <213> ORGANISM: Vitis vinifera <220> FEATURE: <223> OTHER INFORMATION: Predicted cytochrome P450 reductase-like protein <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: XP_002270732 <309> DATABASE ENTRY DATE: 2011-12-07 <400> SEQUENCE: 42 Met Gln Ser Ser Ser Val Lys Val Ser Pro Phe Asp Leu Met Ser Ala 1 5 10 15 Ile Ile Lys Gly Ser Met Asp Gln Ser Asn Val Ser Ser Glu Ser Gly 20 25 30 Gly Ala Ala Ala Met Val Leu Glu Asn Arg Glu Phe Ile Met Ile Leu 35 40 45 Thr Thr Ser Ile Ala Val Leu Ile Gly Cys Val Val Val Leu Ile Trp 50 55 60 Arg Arg Ser Gly Gln Lys Gln Ser Lys Thr Pro Glu Pro Pro Lys Pro 65 70 75 80 Leu Ile Val Lys Asp Leu Glu Val Glu Val Asp Asp Gly Lys Gln Lys 85 90 95 Val Thr Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu Gly Phe Ala 100 105 110 Lys Ala Leu Ala Glu Glu Ala Lys Ala Arg Tyr Glu Lys Ala Ile Phe 115 120 125 Lys Val Val Asp Leu Asp Asp Tyr Ala Gly Asp Asp Asp Glu Tyr Glu 130 135 140 Glu Lys Leu Lys Lys Glu Thr Leu Ala Phe Phe Phe Leu Ala Thr Tyr 145 150 155 160 Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr Lys Trp Phe 165 170 175 Ala Glu Gly Lys Glu Arg Gly Glu Trp Leu Gln Asn Leu Lys Tyr Gly 180 185 190 Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn Lys Val Ala 195 200 205 Lys Val Val Asp Asp Ile Ile Thr Glu Gln Gly Gly Lys Arg Ile Val 210 215 220 Pro Val Gly Leu Gly Asp Asp Asp Gln Cys Ile Glu Asp Asp Phe Ala 225 230 235 240 Ala Trp Arg Glu Leu Leu Trp Pro Glu Leu Asp Gln Leu Leu Arg Asp 245 250 255 Glu Asp Asp Ala Thr Thr Val Ser Thr Pro Tyr Thr Ala Ala Val Leu 260 265 270 Glu Tyr Arg Val Val Phe His Asp Pro Glu Gly Ala Ser Leu Gln Asp 275 280 285 Lys Ser Trp Gly Ser Ala Asn Gly His Thr Val His Asp Ala Gln His 290 295 300 Pro Cys Arg Ala Asn Val Ala Val Arg Lys Glu Leu His Thr Pro Ala 305 310 315 320 Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ser Gly Thr Gly 325 330 335 Leu Thr Tyr Glu Thr Gly Asp His Val Gly Val Tyr Cys Glu Asn Leu 340 345 350 Pro Glu Thr Val Glu Glu Ala Glu Arg Leu Leu Gly Phe Ser Pro Asp 355 360 365 Val Tyr Phe Ser Ile His Thr Glu Arg Glu Asp Gly Thr Pro Leu Ser 370 375 380 Gly Ser Ser Leu Ser Pro Pro Phe Pro Pro Cys Thr Leu Arg Thr Ala 385 390 395 400 Leu Thr Arg Tyr Ala Asp Val Leu Ser Ser Pro Lys Lys Ser Ala Leu 405 410 415 Val Ala Leu Ala Ala His Ala Ser Asp Pro Ser Glu Ala Asp Arg Leu 420 425 430 Lys Tyr Leu Ala Ser Pro Ser Gly Lys Asp Glu Tyr Ala Gln Trp Val 435 440 445 Val Ala Ser Gln Arg Ser Leu Leu Glu Ile Met Ala Glu Phe Pro Ser 450 455 460 Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala Val Ala Pro Arg Leu 465 470 475 480 Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Lys Met Val Pro Ser 485 490 495 Arg Ile His Val Thr Cys Ala Leu Val Cys Asp Lys Met Pro Thr Gly 500 505 510 Arg Ile His Lys Gly Ile Cys Ser Thr Trp Met Lys Tyr Ala Val Pro 515 520 525 Leu Glu Glu Ser Gln Asp Cys Ser Trp Ala Pro Ile Phe Val Arg Gln 530 535 540 Ser Asn Phe Lys Leu Pro Ala Asp Thr Ser Val Pro Ile Ile Met Ile 545 550 555 560 Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg 565 570 575 Phe Ala Leu Lys Glu Ala Gly Ala Glu Leu Gly Ser Ser Ile Leu Phe 580 585 590 Phe Gly Cys Arg Asn Arg Lys Met Asp Tyr Ile Tyr Glu Asp Glu Leu 595 600 605 Asn Gly Phe Val Glu Ser Gly Ala Leu Ser Glu Leu Ile Val Ala Phe 610 615 620 Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val Gln His Lys Met Met Glu 625 630 635 640 Lys Ala Ser Asp Ile Trp Asn Val Ile Ser Gln Gly Gly Tyr Ile Tyr 645 650 655 Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His Arg Thr Leu 660 665 670 His Thr Ile Leu Gln Glu Gln Gly Ser Leu Asp Ser Ser Lys Ala Glu 675 680 685 Ser Met Val Lys Asn Leu Gln Met Thr Gly Arg Tyr Leu Arg Asp Val 690 695 700 Trp 705 <210> SEQ ID NO 43 <211> LENGTH: 710 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ACN54324 <309> DATABASE ENTRY DATE: 2009-12-31 <400> SEQUENCE: 43 Met Asp Ser Ser Ser Ser Ser Ser Ser Ser Gly Pro Ser Pro Leu Asp 1 5 10 15 Leu Met Ser Ala Leu Val Lys Ala Lys Met Asp Pro Ser Asn Ala Ser 20 25 30 Ser Asp Ser Ala Ala Gln Val Thr Thr Val Leu Phe Glu Asn Arg Glu 35 40 45 Phe Val Met Ile Leu Thr Thr Ser Ile Ala Val Leu Ile Gly Cys Val 50 55 60

Val Ile Leu Ile Trp Arg Arg Ser Ala Ser Gln Lys Pro Lys Gln Ile 65 70 75 80 Gln Leu Pro Leu Lys Pro Ser Ile Ile Lys Glu Pro Glu Leu Glu Val 85 90 95 Asp Asp Gly Lys Lys Lys Val Thr Ile Leu Phe Gly Thr Gln Thr Gly 100 105 110 Thr Ala Glu Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg 115 120 125 Tyr Glu Lys Ala Thr Phe Asn Ile Val Asp Leu Asp Asp Tyr Ala Ala 130 135 140 Asp Asp Glu Glu Tyr Glu Glu Lys Met Lys Lys Asp Asn Leu Ala Phe 145 150 155 160 Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala 165 170 175 Arg Phe Tyr Lys Trp Phe Thr Glu Gly Lys Glu Arg Gly Glu Trp Leu 180 185 190 Gln Asn Met Lys Tyr Gly Ile Phe Gly Leu Gly Asn Lys Gln Tyr Glu 195 200 205 His Phe Asn Lys Val Ala Lys Val Val Asp Glu Leu Leu Thr Glu Gln 210 215 220 Gly Ala Lys Arg Ile Val Pro Leu Gly Leu Gly Asp Asp Asp Gln Cys 225 230 235 240 Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu Leu 245 250 255 Asp Gln Leu Leu Arg Asp Glu Asp Asp Ala Thr Val Ser Thr Pro Tyr 260 265 270 Thr Ala Ala Val Leu Glu Tyr Arg Val Val Phe Tyr Asp Pro Ala Asp 275 280 285 Ala Pro Leu Glu Asp Lys Asn Trp Ser Asn Ala Asn Gly His Ala Thr 290 295 300 Tyr Asp Ala Gln His Pro Cys Arg Ser Asn Val Ala Val Arg Lys Glu 305 310 315 320 Leu His Ala Pro Glu Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp 325 330 335 Ile Ala Gly Thr Gly Leu Ser Tyr Glu Thr Gly Asp His Val Gly Val 340 345 350 Tyr Cys Glu Asn Leu Asp Glu Val Val Asp Glu Ala Leu Ser Leu Leu 355 360 365 Gly Leu Ser Pro Asp Thr Tyr Phe Ser Val His Thr Asp Lys Glu Asp 370 375 380 Gly Thr Pro Leu Gly Gly Ser Ser Leu Pro Ser Ser Phe Pro Pro Cys 385 390 395 400 Thr Leu Arg Thr Ala Leu Ala Arg Tyr Ala Asp Leu Leu Ser Ser Pro 405 410 415 Lys Lys Ala Ala Leu Leu Ala Leu Ala Ala His Ala Ser Asp Pro Thr 420 425 430 Glu Ala Asp Arg Leu Arg His Leu Ala Ser Pro Ala Gly Lys Asp Glu 435 440 445 Tyr Ala Gln Trp Ile Val Ala Asn Gln Arg Ser Leu Leu Glu Val Met 450 455 460 Ala Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala 465 470 475 480 Val Ala Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro 485 490 495 Arg Leu Ala Pro Ser Arg Ile His Val Thr Cys Ala Leu Val Tyr Glu 500 505 510 Lys Thr Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met 515 520 525 Lys Asn Ala Val Ser Ser Gly Lys Ser Asp Asp Cys Gly Trp Ala Pro 530 535 540 Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Thr Lys Val 545 550 555 560 Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly 565 570 575 Phe Leu Gln Glu Arg Leu Ala Leu Lys Glu Ala Gly Ala Glu Leu Gly 580 585 590 Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Lys Met Asp Phe Ile 595 600 605 Tyr Glu Asp Glu Leu Asn Asn Phe Val Asn Ser Gly Ala Leu Ser Glu 610 615 620 Leu Val Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val Gln 625 630 635 640 His Lys Met Met Glu Lys Ala Lys Asp Ile Trp Asp Met Ile Ser Gln 645 650 655 Gly Gly Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp 660 665 670 Val His Arg Ala Leu His Thr Ile Phe Gln Glu Gln Gly Ser Leu Asp 675 680 685 Ser Ser Lys Ala Glu Ser Met Val Lys Asn Leu Gln Met Ser Gly Arg 690 695 700 Tyr Leu Arg Asp Val Trp 705 710 <210> SEQ ID NO 44 <211> LENGTH: 704 <212> TYPE: PRT <213> ORGANISM: Artemisia annua <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ABI98819 <309> DATABASE ENTRY DATE: 2009-09-15 <400> SEQUENCE: 44 Met Gln Ser Thr Thr Ser Val Lys Leu Ser Pro Phe Asp Leu Met Thr 1 5 10 15 Ala Leu Leu Asn Gly Lys Val Ser Phe Asp Thr Ser Asn Thr Ser Asp 20 25 30 Thr Asn Ile Pro Leu Ala Val Phe Met Glu Asn Arg Glu Leu Leu Met 35 40 45 Ile Leu Thr Thr Ser Val Ala Val Leu Ile Gly Cys Val Val Val Leu 50 55 60 Val Trp Arg Arg Ser Ser Ser Ala Ala Lys Lys Ala Ala Glu Ser Pro 65 70 75 80 Val Ile Val Val Pro Lys Lys Val Thr Glu Asp Glu Val Asp Asp Gly 85 90 95 Arg Lys Lys Val Thr Val Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu 100 105 110 Gly Phe Ala Lys Ala Leu Val Glu Glu Ala Lys Ala Arg Tyr Glu Lys 115 120 125 Ala Val Phe Lys Val Ile Asp Leu Asp Asp Tyr Ala Ala Glu Asp Asp 130 135 140 Glu Tyr Glu Glu Lys Leu Lys Lys Glu Ser Leu Ala Phe Phe Phe Leu 145 150 155 160 Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr 165 170 175 Lys Trp Phe Thr Glu Gly Glu Glu Lys Gly Glu Trp Leu Asp Lys Leu 180 185 190 Gln Tyr Ala Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe Asn 195 200 205 Lys Ile Ala Lys Val Val Asp Glu Lys Leu Val Glu Gln Gly Ala Lys 210 215 220 Arg Leu Val Pro Val Gly Met Gly Asp Asp Asp Gln Cys Ile Glu Asp 225 230 235 240 Asp Phe Thr Ala Trp Lys Glu Leu Val Trp Pro Glu Leu Asp Gln Leu 245 250 255 Leu Arg Asp Glu Asp Asp Thr Ser Val Ala Thr Pro Tyr Thr Ala Ala 260 265 270 Val Ala Glu Tyr Arg Val Val Phe His Asp Lys Pro Glu Thr Tyr Asp 275 280 285 Gln Asp Gln Leu Thr Asn Gly His Ala Val His Asp Ala Gln His Pro 290 295 300 Cys Arg Ser Asn Val Ala Val Lys Lys Glu Leu His Ser Pro Leu Ser 305 310 315 320 Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile Ser Asn Thr Gly Leu 325 330 335 Ser Tyr Glu Thr Gly Asp His Val Gly Val Tyr Val Glu Asn Leu Ser 340 345 350 Glu Val Val Asp Glu Ala Glu Lys Leu Ile Gly Leu Pro Pro His Thr 355 360 365 Tyr Phe Ser Val His Ala Asp Asn Glu Asp Gly Thr Pro Leu Gly Gly 370 375 380 Ala Ser Leu Pro Pro Pro Phe Pro Pro Cys Thr Leu Arg Lys Ala Leu 385 390 395 400 Ala Ser Tyr Ala Asp Val Leu Ser Ser Pro Lys Lys Ser Ala Leu Leu 405 410 415 Ala Leu Ala Ala His Ala Thr Asp Ser Thr Glu Ala Asp Arg Leu Lys 420 425 430 Phe Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr Ala Gln Trp Ile Val 435 440 445 Ala Ser His Arg Ser Leu Leu Glu Val Met Glu Ala Phe Pro Ser Ala 450 455 460 Lys Pro Pro Leu Gly Val Phe Phe Ala Ser Val Ala Pro Arg Leu Gln 465 470 475 480 Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Phe Ala Pro Asn Arg 485 490 495 Ile His Val Thr Cys Ala Leu Val Tyr Glu Gln Thr Pro Ser Gly Arg 500 505 510 Val His Lys Gly Val Cys Ser Thr Trp Met Lys Asn Ala Val Pro Met 515 520 525 Thr Glu Ser Gln Asp Cys Ser Trp Ala Pro Ile Tyr Val Arg Thr Ser 530 535 540 Asn Phe Arg Leu Pro Ser Asp Pro Lys Val Pro Val Ile Met Ile Gly 545 550 555 560 Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg Leu 565 570 575 Ala Gln Lys Glu Ala Gly Thr Glu Leu Gly Thr Ala Ile Leu Phe Phe 580 585 590 Gly Cys Arg Asn Arg Lys Val Asp Phe Ile Tyr Glu Asp Glu Leu Asn 595 600 605 Asn Phe Val Glu Thr Gly Ala Leu Ser Glu Leu Val Thr Ala Phe Ser

610 615 620 Arg Glu Gly Ala Thr Lys Glu Tyr Val Gln His Lys Met Thr Gln Lys 625 630 635 640 Ala Ser Asp Ile Trp Asn Leu Leu Ser Glu Gly Ala Tyr Leu Tyr Val 645 650 655 Cys Gly Asp Ala Lys Gly Met Ala Lys Asp Val His Arg Thr Leu His 660 665 670 Thr Ile Val Gln Glu Gln Gly Ser Leu Asp Ser Ser Lys Ala Glu Leu 675 680 685 Tyr Val Lys Asn Leu Gln Met Ala Gly Arg Tyr Leu Arg Asp Val Trp 690 695 700 <210> SEQ ID NO 45 <211> LENGTH: 4008 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pACYC-Duet vector <400> SEQUENCE: 45 ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180 taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga gatatacata 300 tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360 ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420 cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480 cctctaaacg ggtcttgagg ggttttttgc tgaaacctca ggcatttgag aagcacacgg 540 tcacactgct tccggtagtc aataaaccgg taaaccagca atagacataa gcggctattt 600 aacgaccctg ccctgaaccg acgaccgggt cgaatttgct ttcgaatttc tgccattcat 660 ccgcttatta tcacttattc aggcgtagca ccaggcgttt aagggcacca ataactgcct 720 taaaaaaatt acgccccgcc ctgccactca tcgcagtact gttgtaattc attaagcatt 780 ctgccgacat ggaagccatc acagacggca tgatgaacct gaatcgccag cggcatcagc 840 accttgtcgc cttgcgtata atatttgccc atagtgaaaa cgggggcgaa gaagttgtcc 900 atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc tgagacgaaa 960 aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta acacgccaca 1020 tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact ccagagcgat 1080 gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact atcccatatc 1140 accagctcac cgtctttcat tgccatacgg aactccggat gagcattcat caggcgggca 1200 agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt ctttaaaaag 1260 gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga ctgaaatgcc 1320 tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc agtgattttt 1380 ttctccattt tagcttcctt agctcctgaa aatctcgata actcaaaaaa tacgcccggt 1440 agtgatctta tttcattatg gtgaaagttg gaacctctta cgtgccgatc aacgtctcat 1500 tttcgccaaa agttggccca gggcttcccg gtatcaacag ggacaccagg atttatttat 1560 tctgcgaagt gatcttccgt cacaggtatt tattcggcgc aaagtgcgtc gggtgatgct 1620 gccaacttac tgatttagtg tatgatggtg tttttgaggt gctccagtgg cttctgtttc 1680 tatcagctgt ccctcctgtt cagctactga cggggtggtg cgtaacggca aaagcaccgc 1740 cggacatcag cgctagcgga gtgtatactg gcttactatg ttggcactga tgagggtgtc 1800 agtgaagtgc ttcatgtggc aggagaaaaa aggctgcacc ggtgcgtcag cagaatatgt 1860 gatacaggat atattccgct tcctcgctca ctgactcgct acgctcggtc gttcgactgc 1920 ggcgagcgga aatggcttac gaacggggcg gagatttcct ggaagatgcc aggaagatac 1980 ttaacaggga agtgagaggg ccgcggcaaa gccgtttttc cataggctcc gcccccctga 2040 caagcatcac gaaatctgac gctcaaatca gtggtggcga aacccgacag gactataaag 2100 ataccaggcg tttcccctgg cggctccctc gtgcgctctc ctgttcctgc ctttcggttt 2160 accggtgtca ttccgctgtt atggccgcgt ttgtctcatt ccacgcctga cactcagttc 2220 cgggtaggca gttcgctcca agctggactg tatgcacgaa ccccccgttc agtccgaccg 2280 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gaaagacatg caaaagcacc 2340 actggcagca gccactggta attgatttag aggagttagt cttgaagtca tgcgccggtt 2400 aaggctaaac tgaaaggaca agttttggtg actgcgctcc tccaagccag ttacctcggt 2460 tcaaagagtt ggtagctcag agaaccttcg aaaaaccgcc ctgcaaggcg gttttttcgt 2520 tttcagagca agagattacg cgcagaccaa aacgatctca agaagatcat cttattaatc 2580 agataaaata tttctagatt tcagtgcaat ttatctcttc aaatgtagca cctgaagtca 2640 gccccatacg atataagttg taattctcat gttagtcatg ccccgcgccc accggaagga 2700 gctgactggg ttgaaggctc tcaagggcat cggtcgagat cccggtgcct aatgagtgag 2760 ctaacttaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg 2820 ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgcca 2880 gggtggtttt tcttttcacc agtgagacgg gcaacagctg attgcccttc accgcctggc 2940 cctgagagag ttgcagcaag cggtccacgc tggtttgccc cagcaggcga aaatcctgtt 3000 tgatggtggt taacggcggg atataacatg agctgtcttc ggtatcgtcg tatcccacta 3060 ccgagatgtc cgcaccaacg cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg 3120 ccatctgatc gttggcaacc agcatcgcag tgggaacgat gccctcattc agcatttgca 3180 tggtttgttg aaaaccggac atggcactcc agtcgccttc ccgttccgct atcggctgaa 3240 tttgattgcg agtgagatat ttatgccagc cagccagacg cagacgcgcc gagacagaac 3300 ttaatgggcc cgctaacagc gcgatttgct ggtgacccaa tgcgaccaga tgctccacgc 3360 ccagtcgcgt accgtcttca tgggagaaaa taatactgtt gatgggtgtc tggtcagaga 3420 catcaagaaa taacgccgga acattagtgc aggcagcttc cacagcaatg gcatcctggt 3480 catccagcgg atagttaatg atcagcccac tgacgcgttg cgcgagaaga ttgtgcaccg 3540 ccgctttaca ggcttcgacg ccgcttcgtt ctaccatcga caccaccacg ctggcaccca 3600 gttgatcggc gcgagattta atcgccgcga caatttgcga cggcgcgtgc agggccagac 3660 tggaggtggc aacgccaatc agcaacgact gtttgcccgc cagttgttgt gccacgcggt 3720 tgggaatgta attcagctcc gccatcgccg cttccacttt ttcccgcgtt ttcgcagaaa 3780 cgtggctggc ctggttcacc acgcgggaaa cggtctgata agagacaccg gcatactctg 3840 cgacatcgta taacgttact ggtttcacat tcaccaccct gaattgactc tcttccgggc 3900 gctatcatgc cataccgcga aaggttttgc gccattcgat ggtgtccggg atctcgacgc 3960 tctcccttat gcgactcctg cattaggaaa ttaatacgac tcactata 4008 <210> SEQ ID NO 46 <211> LENGTH: 712 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <223> OTHER INFORMATION: NADPH cytochrome P450 reductase <400> SEQUENCE: 46 Met Ser Ser Ser Ser Ser Ser Ser Thr Ser Met Ile Asp Leu Met Ala 1 5 10 15 Ala Ile Ile Lys Gly Glu Pro Val Ile Val Ser Asp Pro Ala Asn Ala 20 25 30 Ser Ala Tyr Glu Ser Val Ala Ala Glu Leu Ser Ser Met Leu Ile Glu 35 40 45 Asn Arg Gln Phe Ala Met Ile Val Thr Thr Ser Ile Ala Val Leu Ile 50 55 60 Gly Cys Ile Val Met Leu Val Trp Arg Arg Ser Gly Ser Gly Asn Ser 65 70 75 80 Lys Arg Val Glu Pro Leu Lys Pro Leu Val Ile Lys Pro Arg Glu Glu 85 90 95 Glu Ile Asp Asp Gly Arg Lys Lys Val Thr Ile Phe Phe Gly Thr Gln 100 105 110 Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Gly Glu Glu Ala Lys 115 120 125 Ala Arg Tyr Glu Lys Thr Arg Phe Lys Ile Val Asp Leu Asp Asp Tyr 130 135 140 Ala Ala Asp Asp Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Asp Val 145 150 155 160 Ala Phe Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn 165 170 175 Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Gly Asn Asp Arg Gly Glu 180 185 190 Trp Leu Lys Asn Leu Lys Tyr Gly Val Phe Gly Leu Gly Asn Arg Gln 195 200 205 Tyr Glu His Phe Asn Lys Val Ala Lys Val Val Asp Asp Ile Leu Val 210 215 220 Glu Gln Gly Ala Gln Arg Leu Val Gln Val Gly Leu Gly Asp Asp Asp 225 230 235 240 Gln Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Ala Leu Trp Pro 245 250 255 Glu Leu Asp Thr Ile Leu Arg Glu Glu Gly Asp Thr Ala Val Ala Thr 260 265 270 Pro Tyr Thr Ala Ala Val Leu Glu Tyr Arg Val Ser Ile His Asp Ser 275 280 285 Glu Asp Ala Lys Phe Asn Asp Ile Thr Leu Ala Asn Gly Asn Gly Tyr 290 295 300 Thr Val Phe Asp Ala Gln His Pro Tyr Lys Ala Asn Val Ala Val Lys 305 310 315 320 Arg Glu Leu His Thr Pro Glu Ser Asp Arg Ser Cys Ile His Leu Glu 325 330 335 Phe Asp Ile Ala Gly Ser Gly Leu Thr Met Lys Leu Gly Asp His Val 340 345 350 Gly Val Leu Cys Asp Asn Leu Ser Glu Thr Val Asp Glu Ala Leu Arg 355 360 365 Leu Leu Asp Met Ser Pro Asp Thr Tyr Phe Ser Leu His Ala Glu Lys 370 375 380 Glu Asp Gly Thr Pro Ile Ser Ser Ser Leu Pro Pro Pro Phe Pro Pro 385 390 395 400 Cys Asn Leu Arg Thr Ala Leu Thr Arg Tyr Ala Cys Leu Leu Ser Ser 405 410 415 Pro Lys Lys Ser Ala Leu Val Ala Leu Ala Ala His Ala Ser Asp Pro 420 425 430

Thr Glu Ala Glu Arg Leu Lys His Leu Ala Ser Pro Ala Gly Lys Asp 435 440 445 Glu Tyr Ser Lys Trp Val Val Glu Ser Gln Arg Ser Leu Leu Glu Val 450 455 460 Met Ala Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala 465 470 475 480 Gly Val Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser Ser 485 490 495 Pro Lys Ile Ala Glu Thr Arg Ile His Val Thr Cys Ala Leu Val Tyr 500 505 510 Glu Lys Met Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp 515 520 525 Met Lys Asn Ala Val Pro Tyr Glu Lys Ser Glu Lys Leu Phe Leu Gly 530 535 540 Arg Pro Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Ser 545 550 555 560 Lys Val Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe 565 570 575 Arg Gly Phe Leu Gln Glu Arg Leu Ala Leu Val Glu Ser Gly Val Glu 580 585 590 Leu Gly Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp 595 600 605 Phe Ile Tyr Glu Glu Glu Leu Gln Arg Phe Val Glu Ser Gly Ala Leu 610 615 620 Ala Glu Leu Ser Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr 625 630 635 640 Val Gln His Lys Met Met Asp Lys Ala Ser Asp Ile Trp Asn Met Ile 645 650 655 Ser Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala 660 665 670 Arg Asp Val His Arg Ser Leu His Thr Ile Ala Gln Glu Gln Gly Ser 675 680 685 Met Asp Ser Thr Lys Ala Glu Gly Phe Val Lys Asn Leu Gln Thr Ser 690 695 700 Gly Arg Tyr Leu Arg Asp Val Trp 705 710 <210> SEQ ID NO 47 <211> LENGTH: 7745 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pESC-LEU vector <400> SEQUENCE: 47 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc 240 accattatgg gaaatgcttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca 300 ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat 360 taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc 420 ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc 480 aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt 540 agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg 600 tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct 660 ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg 720 ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct 780 tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac 840 aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat 900 ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc 960 aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg 1020 ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca 1080 gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc 1140 acagtttttc tccataatct tgaagaggcc aaaagattag ctttatccaa ggaccaaata 1200 ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact 1260 tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc 1320 ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca 1380 aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt 1440 aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca 1500 ctaccggtac cccatttagg accacccaca gcacctaaca aaacggcatc agccttcttg 1560 gaggcttcca gcgcctcatc tggaagtgga acacctgtag catcgatagc agcaccacca 1620 attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga 1680 accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc 1740 ttcttagggg cagacattag aatggtatat ccttgaaata tatatatata tattgctgaa 1800 atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat tggaaaaaac 1860 aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat ttagtcatga 1920 acgcttctct attctatatg aaaagccggt tccggcgctc tcacctttcc tttttctccc 1980 aatttttcag ttgaaaaagg tatatgcgtc aggcgacctc tgaaattaac aaaaaatttc 2040 cagtcatcga atttgattct gtgcgatagc gcccctgtgt gttctcgtta tgttgaggaa 2100 aaaaataatg gttgctaaga gattcgaact cttgcatctt acgatacctg agtattccca 2160 cagttaactg cggtcaagat atttcttgaa tcaggcgcct tagaccgctc ggccaaacaa 2220 ccaattactt gttgagaaat agagtataat tatcctataa atataacgtt tttgaacaca 2280 catgaacaag gaagtacagg acaattgatt ttgaagagaa tgtggatttt gatgtaattg 2340 ttgggattcc atttttaata aggcaataat attaggtatg tagatatact agaagttctc 2400 ctcgaccgtc gatatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 2460 caggaaattg taaacgttaa tattttgtta aaattcgcgt taaatttttg ttaaatcagc 2520 tcatttttta accaataggc cgaaatcggc aaaatccctt ataaatcaaa agaatagacc 2580 gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa gaacgtggac 2640 tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg tgaaccatca 2700 ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg 2760 agcccccgat ttagagcttg acggggaaag ccggcgaacg tggcgagaaa ggaagggaag 2820 aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc 2880 accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgc 2940 gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag ctgaattgga 3000 gcgacctcat gctatacctg agaaagcaac ctgacctaca ggaaagagtt actcaagaat 3060 aagaattttc gttttaaaac ctaagagtca ctttaaaatt tgtatacact tatttttttt 3120 ataacttatt taataataaa aatcataaat cataagaaat tcgcttattt agaagtgtca 3180 acaacgtatc taccaacgat ttgacccttt tccatctttt cgtaaatttc tggcaaggta 3240 gacaagccga caaccttgat tggagacttg accaaacctc tggcgaagaa ttgttaatta 3300 agagctcaga tcttatcgtc gtcatccttg taatccatcg atactagtgc ggccgccctt 3360 tagtgagggt tgaattcgaa ttttcaaaaa ttcttacttt ttttttggat ggacgcaaag 3420 aagtttaata atcatattac atggcattac caccatatac atatccatat acatatccat 3480 atctaatctt acttatatgt tgtggaaatg taaagagccc cattatctta gcctaaaaaa 3540 accttctctt tggaactttc agtaatacgc ttaactgctc attgctatat tgaagtacgg 3600 attagaagcc gccgagcggg tgacagccct ccgaaggaag actctcctcc gtgcgtcctc 3660 gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg cgccgcactg ctccgaacaa 3720 taaagattct acaatactag cttttatggt tatgaagagg aaaaattggc agtaacctgg 3780 ccccacaaac cttcaaatga acgaatcaaa ttaacaacca taggatgata atgcgattag 3840 ttttttagcc ttatttctgg ggtaattaat cagcgaagcg atgatttttg atctattaac 3900 agatatataa atgcaaaaac tgcataacca ctttaactaa tactttcaac attttcggtt 3960 tgtattactt cttattcaaa tgtaataaaa gtatcaacaa aaaattgtta atatacctct 4020 atactttaac gtcaaggaga aaaaaccccg gatccgtaat acgactcact atagggcccg 4080 ggcgtcgaca tggaacagaa gttgatttcc gaagaagacc tcgagtaagc ttggtaccgc 4140 ggctagctaa gatccgctct aaccgaaaag gaaggagtta gacaacctga agtctaggtc 4200 cctatttatt tttttatagt tatgttagta ttaagaacgt tatttatatt tcaaattttt 4260 cttttttttc tgtacagacg cgtgtacgca tgtaacatta tactgaaaac cttgcttgag 4320 aaggttttgg gacgctcgaa gatccagctg cattaatgaa tcggccaacg cgcggggaga 4380 ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 4440 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 4500 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 4560 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 4620 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 4680 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 4740 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc 4800 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 4860 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 4920 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 4980 acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc 5040 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 5100 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa 5160 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 5220 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt 5280 ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 5340 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 5400 atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc 5460 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata 5520 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc 5580

cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc 5640 aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 5700 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa 5760 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca 5820 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt 5880 tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt 5940 tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg 6000 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga 6060 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc 6120 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg 6180 acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag 6240 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 6300 gttccgcgca catttccccg aaaagtgcca cctgaacgaa gcatctgtgc ttcattttgt 6360 agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt 6420 tacagaacag aaatgcaacg cgaaagcgct attttaccaa cgaagaatct gtgcttcatt 6480 tttgtaaaac aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc 6540 atttttacag aacagaaatg caacgcgaga gcgctatttt accaacaaag aatctatact 6600 tcttttttgt tctacaaaaa tgcatcccga gagcgctatt tttctaacaa agcatcttag 6660 attacttttt ttctcctttg tgcgctctat aatgcagtct cttgataact ttttgcactg 6720 taggtccgtt aaggttagaa gaaggctact ttggtgtcta ttttctcttc cataaaaaaa 6780 gcctgactcc acttcccgcg tttactgatt actagcgaag ctgcgggtgc attttttcaa 6840 gataaaggca tccccgatta tattctatac cgatgtggat tgcgcatact ttgtgaacag 6900 aaagtgatag cgttgatgat tcttcattgg tcagaaaatt atgaacggtt tcttctattt 6960 tgtctctata tactacgtat aggaaatgtt tacattttcg tattgttttc gattcactct 7020 atgaatagtt cttactacaa tttttttgtc taaagagtaa tactagagat aaacataaaa 7080 aatgtagagg tcgagtttag atgcaagttc aaggagcgaa aggtggatgg gtaggttata 7140 tagggatata gcacagagat atatagcaaa gagatacttt tgagcaatgt ttgtggaagc 7200 ggtattcgca atattttagt agctcgttac agtccggtgc gtttttggtt ttttgaaagt 7260 gcgtcttcag agcgcttttg gttttcaaaa gcgctctgaa gttcctatac tttctagaga 7320 ataggaactt cggaatagga acttcaaagc gtttccgaaa acgagcgctt ccgaaaatgc 7380 aacgcgagct gcgcacatac agctcactgt tcacgtcgca cctatatctg cgtgttgcct 7440 gtatatatat atacatgaga agaacggcat agtgcgtgtt tatgcttaaa tgcgtactta 7500 tatgcgtcta tttatgtagg atgaaaggta gtctagtacc tcctgtgata ttatcccatt 7560 ccatgcgggg tatcgtatgc ttccttcagc actacccttt agctgttcta tatgctgcca 7620 ctcctcaatt ggattagtct catccttcaa tgctatcatt tcctttgata ttggatcata 7680 ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt 7740 tcgtc 7745 <210> SEQ ID NO 48 <400> SEQUENCE: 48 000 <210> SEQ ID NO 49 <211> LENGTH: 6705 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pESC-HIS vector <400> SEQUENCE: 49 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240 gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300 ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360 tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420 atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480 aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540 atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600 cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660 ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720 ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780 ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840 gagtaaaaag gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900 tagatctttc gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960 gagatctctc ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020 ttaccctcca cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080 tcaaggctct tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140 cctccaccaa aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200 tatatacatg tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260 gatactgaag atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320 tttccttttt tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380 tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440 atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500 ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560 ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620 aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680 ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740 gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800 ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860 atgcgccgct acagggcgcg tccattcgcc attcaggctg cgcaactgtt gggaagggcg 1920 atcggtgcgg gcctcttcgc tattacgcca gctgaattgg agcgacctca tgctatacct 1980 gagaaagcaa cctgacctac aggaaagagt tactcaagaa taagaatttt cgttttaaaa 2040 cctaagagtc actttaaaat ttgtatacac ttattttttt tataacttat ttaataataa 2100 aaatcataaa tcataagaaa ttcgcttatt tagaagtgtc aacaacgtat ctaccaacga 2160 tttgaccctt ttccatcttt tcgtaaattt ctggcaaggt agacaagccg acaaccttga 2220 ttggagactt gaccaaacct ctggcgaaga attgttaatt aagagctcag atcttatcgt 2280 cgtcatcctt gtaatccatc gatactagtg cggccgccct ttagtgaggg ttgaattcga 2340 attttcaaaa attcttactt tttttttgga tggacgcaaa gaagtttaat aatcatatta 2400 catggcatta ccaccatata catatccata tacatatcca tatctaatct tacttatatg 2460 ttgtggaaat gtaaagagcc ccattatctt agcctaaaaa aaccttctct ttggaacttt 2520 cagtaatacg cttaactgct cattgctata ttgaagtacg gattagaagc cgccgagcgg 2580 gtgacagccc tccgaaggaa gactctcctc cgtgcgtcct cgtcttcacc ggtcgcgttc 2640 ctgaaacgca gatgtgcctc gcgccgcact gctccgaaca ataaagattc tacaatacta 2700 gcttttatgg ttatgaagag gaaaaattgg cagtaacctg gccccacaaa ccttcaaatg 2760 aacgaatcaa attaacaacc ataggatgat aatgcgatta gttttttagc cttatttctg 2820 gggtaattaa tcagcgaagc gatgattttt gatctattaa cagatatata aatgcaaaaa 2880 ctgcataacc actttaacta atactttcaa cattttcggt ttgtattact tcttattcaa 2940 atgtaataaa agtatcaaca aaaaattgtt aatatacctc tatactttaa cgtcaaggag 3000 aaaaaacccc ggatccgtaa tacgactcac tatagggccc gggcgtcgac atggaacaga 3060 agttgatttc cgaagaagac ctcgagtaag cttggtaccg cggctagcta agatccgctc 3120 taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat ttttttatag 3180 ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacagac 3240 gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg ggacgctcga 3300 agatccagct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc 3360 gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 3420 tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 3480 agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 3540 cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 3600 ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 3660 tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 3720 gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 3780 gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 3840 gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 3900 ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 3960 ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 4020 ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 4080 gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 4140 ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 4200 tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 4260 ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 4320 gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 4380 tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 4440 cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 4500 ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 4560 gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 4620 caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 4680 gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 4740 ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 4800

tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 4860 caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 4920 tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 4980 cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 5040 ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 5100 aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 5160 tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 5220 gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 5280 gaaaagtgcc acctgaacga agcatctgtg cttcattttg tagaacaaaa atgcaacgcg 5340 agagcgctaa tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac 5400 gcgaaagcgc tattttacca acgaagaatc tgtgcttcat ttttgtaaaa caaaaatgca 5460 acgcgagagc gctaattttt caaacaaaga atctgagctg catttttaca gaacagaaat 5520 gcaacgcgag agcgctattt taccaacaaa gaatctatac ttcttttttg ttctacaaaa 5580 atgcatcccg agagcgctat ttttctaaca aagcatctta gattactttt tttctccttt 5640 gtgcgctcta taatgcagtc tcttgataac tttttgcact gtaggtccgt taaggttaga 5700 agaaggctac tttggtgtct attttctctt ccataaaaaa agcctgactc cacttcccgc 5760 gtttactgat tactagcgaa gctgcgggtg cattttttca agataaaggc atccccgatt 5820 atattctata ccgatgtgga ttgcgcatac tttgtgaaca gaaagtgata gcgttgatga 5880 ttcttcattg gtcagaaaat tatgaacggt ttcttctatt ttgtctctat atactacgta 5940 taggaaatgt ttacattttc gtattgtttt cgattcactc tatgaatagt tcttactaca 6000 atttttttgt ctaaagagta atactagaga taaacataaa aaatgtagag gtcgagttta 6060 gatgcaagtt caaggagcga aaggtggatg ggtaggttat atagggatat agcacagaga 6120 tatatagcaa agagatactt ttgagcaatg tttgtggaag cggtattcgc aatattttag 6180 tagctcgtta cagtccggtg cgtttttggt tttttgaaag tgcgtcttca gagcgctttt 6240 ggttttcaaa agcgctctga agttcctata ctttctagag aataggaact tcggaatagg 6300 aacttcaaag cgtttccgaa aacgagcgct tccgaaaatg caacgcgagc tgcgcacata 6360 cagctcactg ttcacgtcgc acctatatct gcgtgttgcc tgtatatata tatacatgag 6420 aagaacggca tagtgcgtgt ttatgcttaa atgcgtactt atatgcgtct atttatgtag 6480 gatgaaaggt agtctagtac ctcctgtgat attatcccat tccatgcggg gtatcgtatg 6540 cttccttcag cactaccctt tagctgttct atatgctgcc actcctcaat tggattagtc 6600 tcatccttca atgctatcat ttcctttgat attggatcat ctaagaaacc attattatca 6660 tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtc 6705 <210> SEQ ID NO 50 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CYP76 ORF <400> SEQUENCE: 50 Met Asp Phe Leu Ser Phe Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Arg Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Leu Ile 290 295 300 Leu Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 51 <211> LENGTH: 5368 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pET28(+) vector <400> SEQUENCE: 51 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180 cgacggagct cgaattcgga tcccgaccca tttgctgtcc accagtcatg ctagccatat 240 ggctgccgcg cggcaccagg ccgctgctgt gatgatgatg atgatggctg ctgcccatgg 300 tatatctcct tcttaaagtt aaacaaaatt atttctagag gggaattgtt atccgctcac 360 aattccccta tagtgagtcg tattaatttc gcgggatcga gatctcgatc ctctacgccg 420 gacgcatcgt ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg 480 acatcaccga tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg 540 tgggtatggt ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac 600 cattccttgc ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc 660 aggagtcgca taagggagag cgtcgagatc ccggacacca tcgaatggcg caaaaccttt 720 cgcggtatgg catgatagcg cccggaagag agtcaattca gggtggtgaa tgtgaaacca 780 gtaacgttat acgatgtcgc agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg 840 gtgaaccagg ccagccacgt ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg 900 gagctgaatt acattcccaa ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg 960 attggcgttg ccacctccag tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt 1020 aaatctcgcg ccgatcaact gggtgccagc gtggtggtgt cgatggtaga acgaagcggc 1080 gtcgaagcct gtaaagcggc ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc 1140 attaactatc cgctggatga ccaggatgcc attgctgtgg aagctgcctg cactaatgtt 1200 ccggcgttat ttcttgatgt ctctgaccag acacccatca acagtattat tttctcccat 1260 gaagacggta cgcgactggg cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg 1320 ctgttagcgg gcccattaag ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa 1380 tatctcactc gcaatcaaat tcagccgata gcggaacggg aaggcgactg gagtgccatg 1440 tccggttttc aacaaaccat gcaaatgctg aatgagggca tcgttcccac tgcgatgctg 1500 gttgccaacg atcagatggc gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc 1560 gttggtgcgg atatctcggt agtgggatac gacgataccg aagacagctc atgttatatc 1620 ccgccgttaa ccaccatcaa acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc 1680 ttgctgcaac tctctcaggg ccaggcggtg aagggcaatc agctgttgcc cgtctcactg 1740 gtgaaaagaa aaaccaccct ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc 1800 gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1860 cgcaattaat gtaagttagc tcactcatta ggcaccggga tctcgaccga tgcccttgag 1920 agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact 1980 tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat 2040 tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt 2100 cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg 2160

cgagaagcag gccattatcg ccggcatggc ggccccacgg gtgcgcatga tcgtgctcct 2220 gtcgttgagg acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc 2280 gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac 2340 atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg 2400 caccattatg ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac 2460 atctgtatta acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat 2520 ccataccgcc agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt 2580 aacccgtatc gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa 2640 tcccccttac acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg 2700 ctttatcaga agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga 2760 acaggcagac atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct 2820 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac 2880 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt 2940 tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg 3000 cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatatg cggtgtgaaa 3060 taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca 3120 ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 3180 taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 3240 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 3300 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 3360 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 3420 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 3480 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 3540 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 3600 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 3660 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 3720 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 3780 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 3840 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 3900 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaac aataaaactg 3960 tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct 4020 tgctctaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 4080 cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg 4140 ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 4200 gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 4260 actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta 4320 ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 4380 cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 4440 gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 4500 cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataaactttt gccattctca 4560 ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 4620 aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 4680 gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 4740 aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 4800 tttttctaag aattaattca tgagcggata catatttgaa tgtatttaga aaaataaaca 4860 aataggggtt ccgcgcacat ttccccgaaa agtgccacct gaaattgtaa acgttaatat 4920 tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga 4980 aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc 5040 agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac 5100 cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc 5160 gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 5220 gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag 5280 ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 5340 gccgctacag ggcgcgtccc attcgcca 5368 <210> SEQ ID NO 52 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum austrocaledonicum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase (SauSSy) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADO87001 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 52 Met Asp Ser Ser Thr Ala Thr Ala Met Thr Ala Pro Phe Ile Asp Pro 1 5 10 15 Thr Asp His Val Asn Leu Lys Thr Asp Thr Asp Ala Ser Glu Asn Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45 Ser Leu Ala Thr His His Asn Ile Val Glu Glu Arg His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Lys Phe Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Arg Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Ile 100 105 110 Tyr Lys Asp Glu Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Asn Lys Thr Gly Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Val Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Tyr 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Ala 180 185 190 Thr Lys Tyr Leu Lys Ser Ala Trp Glu Asn Ile Ser Glu Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Ala 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Ala Tyr Asp Val Tyr Gly Ser Met Asp Glu Leu Asp Leu Tyr 325 330 335 Thr Ser Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Ser Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Gln Gln Cys Lys Ser Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Phe His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Val Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Ile Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Gly Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Val Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 53 <211> LENGTH: 569 <212> TYPE: PRT <213> ORGANISM: Santalum spicatum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase (SspiSSy) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: ADO87002 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 53 Met Asp Ser Ser Thr Ala Thr Ala Thr Thr Ala Pro Phe Ile Asp His 1 5 10 15 Thr Asp His Val Asn Leu Lys Ile Asp Asn Asp Ser Ser Glu Ser Arg 20 25 30 Arg Met Gly Asn Tyr Lys Pro Ser Ile Trp Asn Tyr Asp Phe Leu Gln 35 40 45

Ser Leu Ala Ile His His Asn Ile Val Glu Glu Lys His Leu Lys Leu 50 55 60 Ala Glu Lys Leu Lys Gly Gln Val Met Ser Met Phe Gly Ala Pro Met 65 70 75 80 Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln Arg Leu Gly 85 90 95 Leu Asn His Gln Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Val 100 105 110 Tyr Lys Asp Gly Ser Asn Gly Trp Trp Phe Gly His Leu His Ala Thr 115 120 125 Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro Gln 130 135 140 Asp Val Phe Lys Thr Phe Gln Ser Lys Thr Asp Glu Phe Asp Met Lys 145 150 155 160 Leu Cys Asp Asn Ile Lys Gly Leu Leu Ser Leu Tyr Glu Ala Ser Phe 165 170 175 Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Ala 180 185 190 Thr Lys Tyr Leu Lys Asn Ala Trp Glu Asn Ile Ser Gln Lys Trp Leu 195 200 205 Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp Arg Val 210 215 220 Pro Arg Ile Glu Ala Arg Trp Phe Ile Glu Ala Tyr Glu Gln Glu Glu 225 230 235 240 Asn Met Asn Pro Thr Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Met 245 250 255 Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp 260 265 270 Val Thr Thr Gly Leu Asp Lys Leu Ala Phe Ala Arg Asn Asn Leu Leu 275 280 285 Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp Pro Lys Phe Lys 290 295 300 Leu Ala Arg Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val 305 310 315 320 Asp Asp Ala Tyr Asp Val Tyr Gly Ser Met Asp Glu Leu Asp His Tyr 325 330 335 Thr Tyr Ser Val Glu Arg Trp Ser Cys Val Glu Ile Asp Lys Leu Pro 340 345 350 Asn Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355 360 365 Val Gly Leu Arg Val Gln His Glu Arg Gly Tyr Asn Gly Ile Pro Thr 370 375 380 Phe Ile Lys Ala Trp Val Glu Gln Cys Lys Ala Tyr Gln Lys Glu Ala 385 390 395 400 Arg Trp Tyr His Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405 410 415 Asn Gly Leu Val Ser Ile Gly Phe Pro Leu Leu Leu Ile Thr Gly Tyr 420 425 430 Ile Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu 435 440 445 Pro Asp Leu Leu His Tyr Ser Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455 460 Met Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys Ser 465 470 475 480 Ile His Cys Tyr Met Asn Glu Thr Gly Ala Ser Glu Glu Val Ala Arg 485 490 495 Glu His Ile Lys Gly Ile Ile Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505 510 Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr Phe Asn 515 520 525 Leu Asn Ser Val Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530 535 540 Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met Lys Ser Val Leu 545 550 555 560 Ile Asp Pro Ile Pro Leu Gly Glu Glu 565 <210> SEQ ID NO 54 <211> LENGTH: 4 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: ExxR motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (2)...(3) <223> OTHER INFORMATION: Xaa = any amino acid <400> SEQUENCE: 54 Glu Xaa Xaa Arg 1 <210> SEQ ID NO 55 <211> LENGTH: 8 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER INFORMATION: Xaa = Pro or Ile <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 5, 7 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 6 <223> OTHER INFORMATION: Xaa = Pro or Gly <400> SEQUENCE: 55 Xaa Pro Gly Pro Xaa Xaa Xaa Pro 1 5 <210> SEQ ID NO 56 <211> LENGTH: 7 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 4 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 7 <223> OTHER INFORMATION: Xaa = Gly or Ala <400> SEQUENCE: 56 Gly Arg Arg Xaa Cys Pro Xaa 1 5 <210> SEQ ID NO 57 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: motif <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER INFORMATION: Xaa = Ala or Gly <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 3 <223> OTHER INFORMATION: Xaa = any amino acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 4 <223> OTHER INFORMATION: Xaa = Asp or Glu <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 6 <223> OTHER INFORMATION: Xaa = Thr or Ser <400> SEQUENCE: 57 Xaa Gly Xaa Xaa Thr Xaa 1 5 <210> SEQ ID NO 58 <211> LENGTH: 692 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <223> OTHER INFORMATION: NADPH cytochrome P450 reductase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: CAB58575.1 <309> DATABASE ENTRY DATE: 1999-10-19 <400> SEQUENCE: 58 Met Thr Ser Ala Leu Tyr Ala Ser Asp Leu Phe Lys Gln Leu Lys Ser 1 5 10 15 Ile Met Gly Thr Asp Ser Leu Ser Asp Asp Val Val Leu Val Ile Ala 20 25 30 Thr Thr Ser Leu Ala Leu Val Ala Gly Phe Val Val Leu Leu Trp Lys 35 40 45 Lys Thr Thr Ala Asp Arg Ser Gly Glu Leu Lys Pro Leu Met Ile Pro 50 55 60 Lys Ser Leu Met Ala Lys Asp Glu Asp Asp Asp Leu Asp Leu Gly Ser 65 70 75 80 Gly Lys Thr Arg Val Ser Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala 85 90 95 Glu Gly Phe Ala Lys Ala Leu Ser Glu Glu Ile Lys Ala Arg Tyr Glu 100 105 110 Lys Ala Ala Val Lys Val Ile Asp Leu Asp Asp Tyr Ala Ala Asp Asp 115 120 125 Asp Gln Tyr Glu Glu Lys Leu Lys Lys Glu Thr Leu Ala Phe Phe Cys 130 135 140 Val Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe 145 150 155 160 Ser Lys Trp Phe Thr Glu Glu Asn Glu Arg Asp Ile Lys Leu Gln Gln 165 170 175 Leu Ala Tyr Gly Val Phe Ala Leu Gly Asn Arg Gln Tyr Glu His Phe 180 185 190 Asn Lys Ile Gly Ile Val Leu Asp Glu Glu Leu Cys Lys Lys Gly Ala 195 200 205 Lys Arg Leu Ile Glu Val Gly Leu Gly Asp Asp Asp Gln Ser Ile Glu 210 215 220 Asp Asp Phe Asn Ala Trp Lys Glu Ser Leu Trp Ser Glu Leu Asp Lys 225 230 235 240 Leu Leu Lys Asp Glu Asp Asp Lys Ser Val Ala Thr Pro Tyr Thr Ala 245 250 255

Val Ile Pro Glu Tyr Arg Val Val Thr His Asp Pro Arg Phe Thr Thr 260 265 270 Gln Lys Ser Met Glu Ser Asn Val Ala Asn Gly Asn Thr Thr Ile Asp 275 280 285 Ile His His Pro Cys Arg Val Asp Val Ala Val Gln Lys Glu Leu His 290 295 300 Thr His Glu Ser Asp Arg Ser Cys Ile His Leu Glu Phe Asp Ile Ser 305 310 315 320 Arg Thr Gly Ile Thr Tyr Glu Thr Gly Asp His Val Gly Val Tyr Ala 325 330 335 Glu Asn His Val Glu Ile Val Glu Glu Ala Gly Lys Leu Leu Gly His 340 345 350 Ser Leu Asp Leu Val Phe Ser Ile His Ala Asp Lys Glu Asp Gly Ser 355 360 365 Pro Leu Glu Ser Ala Val Pro Pro Pro Phe Pro Gly Pro Cys Thr Leu 370 375 380 Gly Thr Gly Leu Ala Arg Tyr Ala Asp Leu Leu Asn Pro Pro Arg Lys 385 390 395 400 Ser Ala Leu Val Ala Leu Ala Ala Tyr Ala Thr Glu Pro Ser Glu Ala 405 410 415 Glu Lys Leu Lys His Leu Thr Ser Pro Asp Gly Lys Asp Glu Tyr Ser 420 425 430 Gln Trp Ile Val Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala Ala 435 440 445 Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala Ile Ala 450 455 460 Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Cys Gln Asp Trp 465 470 475 480 Ala Pro Ser Arg Val His Val Thr Ser Ala Leu Val Tyr Gly Pro Thr 485 490 495 Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp Met Lys Asn 500 505 510 Ala Val Pro Ala Glu Lys Ser His Glu Cys Ser Gly Ala Pro Ile Phe 515 520 525 Ile Arg Ala Ser Asn Phe Lys Leu Pro Ser Asn Pro Ser Thr Pro Ile 530 535 540 Val Met Val Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu 545 550 555 560 Gln Glu Arg Met Ala Leu Lys Glu Asp Gly Glu Glu Leu Gly Ser Ser 565 570 575 Leu Leu Phe Phe Gly Cys Arg Asn Arg Gln Met Asp Phe Ile Tyr Glu 580 585 590 Asp Glu Leu Asn Asn Phe Val Asp Gln Gly Val Ile Ser Glu Leu Ile 595 600 605 Met Ala Phe Ser Arg Glu Gly Ala Gln Lys Glu Tyr Val Gln His Lys 610 615 620 Met Met Glu Lys Ala Ala Gln Val Trp Asp Leu Ile Lys Glu Glu Gly 625 630 635 640 Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His 645 650 655 Arg Thr Leu His Thr Ile Val Gln Glu Gln Glu Gly Val Ser Ser Ser 660 665 670 Glu Ala Glu Ala Ile Val Lys Lys Leu Gln Thr Glu Gly Arg Tyr Leu 675 680 685 Arg Asp Val Trp 690 <210> SEQ ID NO 59 <211> LENGTH: 1713 <212> TYPE: DNA <213> ORGANISM: Santalum austrocaledonicum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: HQ343277 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 59 atggattctt ccaccgccac cgccatgaca gctccattca ttgatcctac tgatcatgtg 60 aatctcaaaa ctgatactga tgcctcagag aatcgaagga tggggaatta taaacccagc 120 atttggaatt atgatttttt acaatcactt gcaactcatc acaatattgt ggaagagagg 180 catctaaagc tagctgagaa gctgaagggc caagtgaagt ttatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggctcgggct aaaccaccga 300 tttgagacag agatcaagga agcgctattt agtatttata aggacgagag caatggatgg 360 tggtttggcc accttcatgc gacatctctc cgatttaggc tgctacgaca gtgtgggctt 420 tttatccccc aggatgtgtt taaaacgttc caaaacaaaa ctggtgaatt tgatatgaaa 480 ctgtgtgaca acgtaaaagg gctgctgagc ttatatgaag cttcatactt gggatggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcgccacca agtacttgaa aagtgcatgg 600 gaaaatatat ctgaaaagtg gttagccaaa agagtgaagc atgcattggc tttacctttg 660 cattggagag tccctcgaat cgaagctaga tggttcattg aggcatatga gcaagaagcg 720 aatatgaacc caacactact caaactcgca aaattagact ttaatatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcta ggaataattt actgcaaagc tatatgtgga gctgcgcgat tgcttccgac 900 ccgaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtt 960 gatgatgcat atgacgtcta tggttcaatg gacgaacttg atctctacac aagctccgtt 1020 gaaaggtgga gctgtgtaga aattgacaag ttgccaaaca cgttaaaatt gatttttatg 1080 tctatgttta ataagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaat 1140 agcatcccta cttttatcaa agcgtgggtt caacagtgta aatcatacca gaaagaagca 1200 agatggttcc acgggggaca cacgcctccg ttggaagaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttgatcacc ggctacgtgg caatcgctga gaacgaggct 1320 gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg atataggaac gtctccggat gagatggcaa gaggcgataa tctgaagtca 1440 atccattgtt acatgaacgg aactggggct tccgaggaag ttgctcgtga gcacataaag 1500 ggagtaatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacggatagc tggacaaagg ttgatatgaa gtccgttttg 1680 attgacccta ttcctctcgg cgaggagtag taa 1713 <210> SEQ ID NO 60 <211> LENGTH: 1713 <212> TYPE: DNA <213> ORGANISM: Santalum spicatum <220> FEATURE: <223> OTHER INFORMATION: santalene synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: HQ343278 <309> DATABASE ENTRY DATE: 2011-05-17 <400> SEQUENCE: 60 atggattctt ccaccgccac cgccacgaca gctccattta ttgatcatac tgatcatgtg 60 aatcttaaaa ttgataatga ttcctccgag agtcgaagga tgggcaatta taaacccagt 120 atttggaatt atgattttct gcaatcactt gcaatccatc acaatattgt ggaagagaag 180 catctaaagc tagctgagaa gctgaagggc caagtgatgt ctatgtttgg ggcaccaatg 240 gagccgttag caaagctgga gcttgtggat gtggttcaaa ggcttgggct aaaccaccaa 300 tttgagacag agatcaagga agccctattt agtgtttaca aggatgggag caatggatgg 360 tggtttggcc accttcatgc aacatctctt cgatttaggc tactacgaca gtgtgggctt 420 tttatccccc aggatgtgtt taaaacgttc cagagcaaaa ctgatgaatt tgatatgaaa 480 ctgtgtgaca acataaaagg gttgttgagc ttgtatgaag cttcattcct ggggtggaag 540 ggtgaaaaca tcctagatga agccaaggcc ttcgccacca agtacttgaa aaatgcatgg 600 gaaaatatat cccaaaagtg gctagccaaa agagtgaagc atgcactggc tttgcctctg 660 cactggagag tccctcgaat cgaggctaga tggttcattg aggcatatga gcaagaagag 720 aacatgaacc caacactact caaacttgca aaattagact ttaacatggt gcaatcaatt 780 catcagaaag agattgggga attagcaagg tggtgggtga ctactggctt ggataagtta 840 gcctttgcta ggaataattt actgcaaagc tatatgtgga gctgcgcgat tgcttccgac 900 ccaaagttca aacttgctag agaaactatt gtcgaaatcg gaagtgtact cacagttgtg 960 gacgatgcat atgatgtcta tggttcaatg gatgaacttg atcactacac atactccgtt 1020 gaaaggtgga gctgtgtaga aattgacaag ctgccaaaca cgttaaaatt gatttttatg 1080 tctatgttca acaagaccaa tgaggttggc cttcgagtcc agcatgagcg aggctacaac 1140 ggcatcccta cttttatcaa agcatgggtt gaacagtgta aagcatacca gaaagaggca 1200 agatggtacc atgggggaca cacgcctcca ttggaggaat atagcttgaa tggacttgtt 1260 tccataggat tccctctctt gttgatcacc ggctacatcg caatcgctga gaacgaggct 1320 gcactggata aagtgcaccc ccttcctgat cttctgcact actcctccct ccttagtcgc 1380 ctcatcaatg acatgggaac gtctccggac gagatggcaa gaggtgacaa tctgaagtca 1440 atccactgtt acatgaacga aactggggct tctgaggaag ttgctcgtga gcacataaaa 1500 ggaataatcg aggagaattg gaaaatactg aatcagtgct gctttgatca atctcagttt 1560 caggagcctt ttataacctt caatttgaac tctgttcgag ggtctcattt cttctatgaa 1620 tttggggatg gctttggggt gacagatagc tggacaaagg ttgatatgaa gtctgttttg 1680 atcgacccta ttcctctcgg cgaggagtag taa 1713 <210> SEQ ID NO 61 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR2 forward primer <400> SEQUENCE: 61 atgcaattga gctccgtcaa g 21 <210> SEQ ID NO 62 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: SaCPR2 reverse primer <400> SEQUENCE: 62 tcaccacaca tcccgtaaat accttcc 27

<210> SEQ ID NO 63 <211> LENGTH: 1950 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR1 truncated <400> SEQUENCE: 63 atgttcatgt ggcggagatc gggcgagaag tccaaggaat tgaggcctgt ggtggcgctg 60 aaggcggcgc cgatcgaggc ggaggaggac gatggcgagg ttgactcggg gaagactaag 120 gtcactgtgt tcttcggtac gcagactggc actgccgaag ggttcgctaa ggctttggca 180 gaagagatca aggcaagata tgaaaaagca gtcgtcaaag tggttgacct ggatgattat 240 gctgcagatg atgatcaata tggagaaaaa ttgaaaaatg agacgctgac atttttcatg 300 gtggccactt atggtgatgg agaaccaacc gataatgctg caagatttta caaatggttt 360 actgaggaga aagaaaggga agcttggtta cagcagctga cttatggcat ttttggtctg 420 ggaaatcgtc aatatgaaca ttttaataag atagcaaagg tgcttgatga acagcttact 480 gaacaaggtg caaagcgtct cattcaggtt ggtttaggtg atgatgatca gtgcatcgag 540 gatgattttt ctgcttggcg tgaactactg tggccagagt tagatcaatt actccggggt 600 gatgatggtg cgaattctgt gtctactccc tatacagctg ctgttcctga ataccgagtg 660 gtgatccatg atcctactat cacttcatct gaggataaat ccttagccac ggccaatggg 720 gctgctttat ttgacattca ccatccatgc agagttaagg ttgctgttca aagagagctt 780 cacaaagctg actctgaccg ctcttgcata catttggagt ttgatatatc aggcacgggt 840 cttatgtatg aaacgggaga ccatgtgggt gtttacgctg aaaattgtgt tgagactgtt 900 gaagaagcag gaaagctgtt gggccaacct ttagatttgc tcttttctgt tcacactgac 960 aaggatgatg gtacatctct tgagagctca ttgccccctc cttttcctgg tccttgcact 1020 cttcgcactg cactgtttca atatgcagat ctattgaacc ctcctaggaa ggctgcttta 1080 gttgccctgg cagctcatgc agttgaacca tctgaggcag acagacttaa atttttgtca 1140 tcacctcagg gaaaggatga gtatgcgaaa tgggttgttg gcagtcaaag aagcctcctt 1200 gaggtgatgg ctgagttccc gtcaataaaa gttccccttg gtgtgttttt tgccgctgtg 1260 gccccccgcc tacagcctcg ctactattca atctcatcat cgcctaggtt ctcctctgac 1320 cgggttcatg taacctgcgc tttagtttat ggccctagtc caacaggcag aattcacaga 1380 ggggtgtgtt ccacctggat gaagaatgca gttcctctag aagaaagccg tgagtgtagc 1440 tgggctccta tatttattag gacatctaat tttaagctac cagctaatcc ttctacccca 1500 gttatcatgg tcggccctgg tactggcttg gcaccgttta gaggattcct acaggaaagg 1560 atggccctgt tagaaggcgg tgctcaactt ggtcctgctt tacttttctt tggatgtaga 1620 aatcgaagga tggattttat ttacgaggat gaactcaaca atttcgtcga acaaggtgtg 1680 atatcagagt tgattgttgc attctcgagg gacgggccaa ccaaggagta cgttcagcat 1740 aagatgatgg ataaagctgc atatatatgg agtctaatct ctcagggggc ttatctttat 1800 gtctgtggtg atgcaaaggg gatggctaga gatgttcatc gaactttgca tactcttgtt 1860 caacaacagg agagcgtgga ctcatcaaaa gcagagtcaa tagtgaagaa gcttcagatg 1920 gatggacgat atctaagaga tgtttggtaa 1950 <210> SEQ ID NO 64 <211> LENGTH: 1938 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: CPR2 truncated <400> SEQUENCE: 64 atgcggttct cgagctccca gaaggcggtg gcggcggcta agggcgtaga ggttgcgagg 60 aagccggtga tcgggaagga atcggaggcg gcggaggtgg atgacggaaa gaagaaggtg 120 accatcttct tcgggacgca gactggaaca gccgaagggt tcgccaaggc gctggttgag 180 gaggcaaaag cacgctatga gaaggccatt tttaaattgg ttgatttgga tgattatgct 240 gccgaggatg atgaatatga ggagaagttg aaaaaagaga aattcgcttt attcttttta 300 gccacatatg gagatggtga gcctactgac aatgcagcga ggttctataa atggtttact 360 gaggaaaatg aaagtggaga gtggctccaa aagcttcagt tcggagtgtt tggccttggc 420 aataggcaat acgagcattt caacaaggtt gcaaaggttg tggatgagat tcttgctgag 480 caaggtggga agcgcctggt tccagtgggt cttggagatg atgatcaatg cattgaagat 540 gacttcactg catggcgtga attagtgtgg cccgagttgg ataaattgct cctagatgag 600 gatgatgcaa ctgtttctac cccttatact gcttctgtac cggaataccg ggttgtattt 660 catgattctc ctgatgatta tctgcagaag aactctagta atgcaaatgg tcattcgatg 720 catgatgctc agcatccatg cagggctaat gttgctgtga ggagggagct tcattcgcct 780 ttatctgatc gttcttgcac tcatctagaa tttgacattg ctggaactgg acttgcgtat 840 gaaacagggg accatgttgg tgtgtgctgt gagaatttac ctgaagttgt ggaagaggct 900 gaaagggtac tgggtttgtc accaggcatc tacttttcca tccatgctga taaagaggat 960 ggcacaccac ttggaagttc cttgccacca ctttttccac catgtacttt aagaactgca 1020 ctaactcaac atgctgatct tctaagtttt cctaaaaagg ctgcgttgct tgctttagca 1080 gctcatgctt ctgatccaag tgaagcggat aggttgaaat atcttgcatc tcctgcagga 1140 aaggatgaat atgcacagtg ggttgttgca agtcagagaa gccttctaga agtaatggct 1200 gaattccctt cggcgaagcc cccacttgga gttttgtttg ctgcagttgc tccacgattg 1260 cagccacgat tctattcgat ctcatcctct ccaaagattg caccatctag gatacatgtt 1320 acttgcgcat tagtatatga taaaacacca actgggcgaa ttcacaaggg agtgtgctca 1380 acttggatga agaatgcgat gccccgggaa gaaagccacg attgcagctg ggctcccatt 1440 tttgttaggc aatctaattt caagctccct tcaaatacat cggtgcctgt catcatgatt 1500 ggtcctggca cggggttggc tcctttcagg ggctttctac aggaaagatt agcactgaaa 1560 gaagctggag ttgaactggg acctgcaata ttattctttg ggtgcaggaa ccgtaaaatg 1620 gattacattt atgaggatga gttggcacac tttgttgaag ccggtgcgct ctctgagttg 1680 atcgtggctt tctcacggga aggaccagcc aaacagtatg tccagcataa gatgatggaa 1740 aaggcctcag aaatctggaa catgatttcc gatggaggtt atgtatatgt atgtggtgat 1800 gccaaaggca tggccaaaga tgtccaccgg gcgctccata caattgttca cgaacaggga 1860 tctctagaca attccaagac agagagcatg gtgaagaatc tccaaatgaa tggaaggtat 1920 ttacgggatg tgtggtga 1938 <210> SEQ ID NO 65 <211> LENGTH: 3781 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pCDF-Duet vector <400> SEQUENCE: 65 ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180 taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga gatatacata 300 tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360 ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420 cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480 cctctaaacg ggtcttgagg ggttttttgc tgaaacctca ggcatttgag aagcacacgg 540 tcacactgct tccggtagtc aataaaccgg taaaccagca atagacataa gcggctattt 600 aacgaccctg ccctgaaccg acgaccgggt catcgtggcc ggatcttgcg gcccctcggc 660 ttgaacgaat tgttagacat tatttgccga ctaccttggt gatctcgcct ttcacgtagt 720 ggacaaattc ttccaactga tctgcgcgcg aggccaagcg atcttcttct tgtccaagat 780 aagcctgtct agcttcaagt atgacgggct gatactgggc cggcaggcgc tccattgccc 840 agtcggcagc gacatccttc ggcgcgattt tgccggttac tgcgctgtac caaatgcggg 900 acaacgtaag cactacattt cgctcatcgc cagcccagtc gggcggcgag ttccatagcg 960 ttaaggtttc atttagcgcc tcaaatagat cctgttcagg aaccggatca aagagttcct 1020 ccgccgctgg acctaccaag gcaacgctat gttctcttgc ttttgtcagc aagatagcca 1080 gatcaatgtc gatcgtggct ggctcgaaga tacctgcaag aatgtcattg cgctgccatt 1140 ctccaaattg cagttcgcgc ttagctggat aacgccacgg aatgatgtcg tcgtgcacaa 1200 caatggtgac ttctacagcg cggagaatct cgctctctcc aggggaagcc gaagtttcca 1260 aaaggtcgtt gatcaaagct cgccgcgttg tttcatcaag ccttacggtc accgtaacca 1320 gcaaatcaat atcactgtgt ggcttcaggc cgccatccac tgcggagccg tacaaatgta 1380 cggccagcaa cgtcggttcg agatggcgct cgatgacgcc aactacctct gatagttgag 1440 tcgatacttc ggcgatcacc gcttccctca tactcttcct ttttcaatat tattgaagca 1500 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 1560 aaatagctag ctcactcggt cgctacgctc cgggcgtgag actgcggcgg gcgctgcgga 1620 cacatacaaa gttacccaca gattccgtgg ataagcaggg gactaacatg tgaggcaaaa 1680 cagcagggcc gcgccggtgg cgtttttcca taggctccgc cctcctgcca gagttcacat 1740 aaacagacgc ttttccggtg catctgtggg agccgtgagg ctcaaccatg aatctgacag 1800 tacgggcgaa acccgacagg acttaaagat ccccaccgtt tccggcgggt cgctccctct 1860 tgcgctctcc tgttccgacc ctgccgttta ccggatacct gttccgcctt tctcccttac 1920 gggaagtgtg gcgctttctc atagctcaca cactggtatc tcggctcggt gtaggtcgtt 1980 cgctccaagc tgggctgtaa gcaagaactc cccgttcagc ccgactgctg cgccttatcc 2040 ggtaactgtt cacttgagtc caacccggaa aagcacggta aaacgccact ggcagcagcc 2100 attggtaact gggagttcgc agaggatttg tttagctaaa cacgcggttg ctcttgaagt 2160 gtgcgccaaa gtccggctac actggaagga cagatttggt tgctgtgctc tgcgaaagcc 2220 agttaccacg gttaagcagt tccccaactg acttaacctt cgatcaaacc acctccccag 2280 gtggtttttt cgtttacagg gcaaaagatt acgcgcagaa aaaaaggatc tcaagaagat 2340 cctttgatct tttctactga accgctctag atttcagtgc aatttatctc ttcaaatgta 2400 gcacctgaag tcagccccat acgatataag ttgtaattct catgttagtc atgccccgcg 2460 cccaccggaa ggagctgact gggttgaagg ctctcaaggg catcggtcga gatcccggtg 2520 cctaatgagt gagctaactt acattaattg cgttgcgctc actgcccgct ttccagtcgg 2580 gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 2640 gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag ctgattgccc 2700

ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgctggtttg ccccagcagg 2760 cgaaaatcct gtttgatggt ggttaacggc gggatataac atgagctgtc ttcggtatcg 2820 tcgtatccca ctaccgagat gtccgcacca acgcgcagcc cggactcggt aatggcgcgc 2880 attgcgccca gcgccatctg atcgttggca accagcatcg cagtgggaac gatgccctca 2940 ttcagcattt gcatggtttg ttgaaaaccg gacatggcac tccagtcgcc ttcccgttcc 3000 gctatcggct gaatttgatt gcgagtgaga tatttatgcc agccagccag acgcagacgc 3060 gccgagacag aacttaatgg gcccgctaac agcgcgattt gctggtgacc caatgcgacc 3120 agatgctcca cgcccagtcg cgtaccgtct tcatgggaga aaataatact gttgatgggt 3180 gtctggtcag agacatcaag aaataacgcc ggaacattag tgcaggcagc ttccacagca 3240 atggcatcct ggtcatccag cggatagtta atgatcagcc cactgacgcg ttgcgcgaga 3300 agattgtgca ccgccgcttt acaggcttcg acgccgcttc gttctaccat cgacaccacc 3360 acgctggcac ccagttgatc ggcgcgagat ttaatcgccg cgacaatttg cgacggcgcg 3420 tgcagggcca gactggaggt ggcaacgcca atcagcaacg actgtttgcc cgccagttgt 3480 tgtgccacgc ggttgggaat gtaattcagc tccgccatcg ccgcttccac tttttcccgc 3540 gttttcgcag aaacgtggct ggcctggttc accacgcggg aaacggtctg ataagagaca 3600 ccggcatact ctgcgacatc gtataacgtt actggtttca cattcaccac cctgaattga 3660 ctctcttccg ggcgctatca tgccataccg cgaaaggttt tgcgccattc gatggtgtcc 3720 gggatctcga cgctctccct tatgcgactc ctgcattagg aaattaatac gactcactat 3780 a 3781 <210> SEQ ID NO 66 <211> LENGTH: 471 <212> TYPE: PRT <213> ORGANISM: Bacillus megaterium <220> FEATURE: <223> OTHER INFORMATION: cytochrome P450BM-3 <400> SEQUENCE: 66 Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys Asn 1 5 10 15 Leu Pro Leu Leu Asn Thr Asp Lys Pro Val Gln Ala Leu Met Lys Ile 20 25 30 Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala Pro Gly Arg Val 35 40 45 Thr Arg Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp Glu 50 55 60 Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu Lys Phe Val Arg Asp 65 70 75 80 Phe Ala Gly Asp Gly Leu Phe Thr Ser Trp Thr His Glu Lys Asn Trp 85 90 95 Lys Lys Ala His Asn Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala Met 100 105 110 Lys Gly Tyr His Ala Met Met Val Asp Ile Ala Val Gln Leu Val Gln 115 120 125 Lys Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu Asp 130 135 140 Met Thr Arg Leu Thr Leu Asp Thr Ile Gly Leu Cys Gly Phe Asn Tyr 145 150 155 160 Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr Ser 165 170 175 Met Val Arg Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala Asn 180 185 190 Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys Arg Gln Phe Gln Glu Asp 195 200 205 Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg Lys 210 215 220 Ala Ser Gly Glu Gln Ser Asp Asp Leu Leu Thr His Met Leu Asn Gly 225 230 235 240 Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile Arg Tyr 245 250 255 Gln Ile Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly Leu 260 265 270 Leu Ser Phe Ala Leu Tyr Phe Leu Val Lys Asn Pro His Val Leu Gln 275 280 285 Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro Ser 290 295 300 Tyr Lys Gln Val Lys Gln Leu Lys Tyr Val Gly Met Val Leu Asn Glu 305 310 315 320 Ala Leu Arg Leu Trp Pro Thr Ala Pro Ala Phe Ser Leu Tyr Ala Lys 325 330 335 Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp Glu 340 345 350 Leu Met Val Leu Ile Pro Gln Leu His Arg Asp Lys Thr Ile Trp Gly 355 360 365 Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn Pro Ser Ala 370 375 380 Ile Pro Gln His Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala Cys 385 390 395 400 Ile Gly Gln Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu Gly Met 405 410 415 Met Leu Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu Asp 420 425 430 Ile Lys Glu Thr Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys Ala 435 440 445 Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro Ser Pro Ser Thr Glu 450 455 460 Gln Ser Ala Lys Lys Val Arg 465 470 <210> SEQ ID NO 67 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F37v2 (CYP76-G14) <400> SEQUENCE: 67 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tccactccat ggtttggtta 360 ccggtttcga cccgttggcg gacccttcga aagataagca actcccacat cttcagtagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttaccagg 480 gtggcggaga gcagcctggt cggggcagtg gtggatatag gcgcggtggc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 68 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F39v2 (CYP76-G15) <400> SEQUENCE: 68 atggacttct taagttgtat cctgtctgtt ttgttcgcgt gggcgctggt tcgagctctc 60 cgtaaacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccatcc ccgacgccgt tcgagcctat ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacttct tactggacct atttgcggcg gggagtgata cgacttcgag caccgtcgaa 960 tgggcgatga cggaactcct ccgcaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggcccaga aaacctggtc caagaggccg acttgccccg gcttccctac 1080 ttacaggccg tggtgaagga aactttcagg ctccaccctc cggtgccgct gctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200

atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc agagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 ccgttcggcg gagggaggag gatttgcccc ggattaccgc tggcgataag gatggtgcat 1380 ttgatgttag gatcgctgat ccatgggttt cggtggaagg tggatgacga tggaatgggt 1440 tcgccggaga ccgccatgga catggatgaa aagttcggca ttactttaca gaaggcgaag 1500 cccttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 69 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F40 (CYP76-G16) <400> SEQUENCE: 69 atggacttct taagttgtat cctgtctgtt ttgttcgcgt gggcgctggt tcgagctctc 60 cgtaaacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agacgaagga ggtggtgtgg gggatgatgg aggaggccgg aaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggattcg ccgtcggatg 720 acgggttatt tcgggaaaat gttggaagtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 70 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F41 (CYP76-G17) <400> SEQUENCE: 70 atggacttct taagttgtat cctgtttgtt ttgttcgcat gggcgctggt tcatgctctc 60 cgtacacttt ctagaggttc caaagctgcc agcgggaggc ttccgccggg gccagtcccg 120 tggccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggag 180 ctggccaaat cctacggccc cataatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaactc ctaccgtagc caaagaggtt cttcaaaaac aagacgttgc cttctctaac 300 cgaaccactc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcgg aagataagca attcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcggaagc tcgacgagct ccttgccaga 480 gtggcggaga gcagcctggt cggggcagtg gtggatatgg gcgcggtagc tttcttgacg 540 agtctaaact tgctatccaa caccgtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatggagga ggtggtgtgg gggatcacgg aggaggccgg gaggcccaat 660 ttggtggatt attttccggt gctgcgaagg ctcgatccgc aggggacacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 71 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F42 (CYP76-G13) <400> SEQUENCE: 71 atggacttct taagttgtat cctgtctgtt ttgttcgcat gggcgctggt tcgagctctc 60 cgtacacttt ctagaggttc caaagctgcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct gttaaaactc gggaacaaac cacacaagtc attggcggcg 180 ctggccaaat cctacgatcc catcatgtgt ctcaaacttg gtcacatgac cacaattgtc 240 atctcaagtc ctaccgtagc caaagaggtt cttcaaaaac aagacgtcgc cttctgtaac 300 cgaaccaccc ctgacgccgt tcgagcccac ggacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcga aagataagca actcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcagaagc tcgacgagct ccttgccagg 480 gtggcagaga gcagcctggt cggggcagcg gtggatatag gcgcggtagc tttcgtgacg 540 agtctaaact tgctatccaa cacagtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatgaagga ggtggtgtgg ggaatcatgg aggaagccgg gaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggatacg ccgtcggatg 720 atgggttatt tcgggaaaat gttcgaggtt ttcggggata tcattgacga gcggcttgaa 780 ttgagaaagc aacaaagtga tggtgattcc ccagctgcta caactaatga tgtgttggac 840 gttcttctga atattattga agacgctgaa attgaagaaa agcctaatag aactgatgtc 900 gaacacttca tagtggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga cggaactcct ccgtaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggcccaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320 cctttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tggctgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 72 <211> LENGTH: 1530 <212> TYPE: DNA <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F43 (CYP76-G18) <400> SEQUENCE: 72 atggacttct taagttgtat cctgtttgtt ttattcgcgt gggcacttgt tcgggctctc 60 cctacacttt ctagaggttc caaagcagcc ggcgggaggc ttccgccggg gccagtcccg 120 ttgccggtgg tgggaaacct attaaaactc gggagcaaac cacacaagtc gctggcggag 180 ctggccaaat cctacggtcc tataatgtgt ctcaaactag gtcacataat cacaattgtc 240 atctcaactc ctaccgtcgc caaagaggtt ctccaaaaac aagacgtcgc cttctgtaac 300 cgaaccatcc ctgacgccgt tcgagcccac agacacgacc tctactccat ggcttggtta 360 ccggtttcca cccgttggcg gaccctgcga aagataagca actcccacat cttcactagc 420 caaaggctcg atgaaaacca ccacctccgg cggcagaagc tcgacgagct ccttgccagg 480 gtggcagaga gcagcctggt cggggcagcg gtggatatag gcgcggtagc tttcgtgacg 540 agtctaaact tgctatccaa cacagtgttt tcgaaggatt tggtcgaacc aggattgggg 600 gctgtgcagg agatgaagga ggtggtgtgg ggaatcatgg aggaagccgg gaggcccaat 660 ttggtggatt atttcccggt gctgcggagg ctcgatccgc aggggatacg ccgtcggatg 720 acgggtaatt tcgggaaaat gttggaggtt ttcggggata tcattgacga gcggcttgaa 780 tggagaaagc aacaaagtga tggtgattcc ccagctggta caactaatga tgtgttggac 840 gttcttctga atattcttga agacgctgaa atcgaagaaa agcctaatag aactgatgtc 900 gaacacctct tactggacct atttgtggcg gggagtgata cgacttccag caccgtcgaa 960 tgggcgatga ctgaactcct ccggaaaccg gagactctgg agagagcccg gtcggagctc 1020 catgagacca tcggccctaa aaacctggtc caagaggccg acatgccccg gctcccctac 1080 ttacaggccg tggtgaaaga aactttccgg ctccaccctc cggtgccgct cctactcccc 1140 cgcactgcgg agaaggacgc cgaactctgc ggcttcacgg tccccgcagg ggctcaaatc 1200 atggtgaacg cgtgggcgat cgggagagat cccgggacat gggaggaccc ggagtcattc 1260 ttgccggaga gattcttggg gtcggatgtg gacgtgaagg ggaggagttt cgagctgatt 1320

ccgttcggcg gagggaggag gatttgcccc ggattacctc tggcgataag gatggtgcat 1380 ttgatgttag gatcactgat ccatgggttc cggtggaagg tgtttgacga tggaatgggg 1440 tcgccggaga ctgcgatgga catggatgag aagtttggca tcactttaca gaaggcgaag 1500 tcgttgtgcg ctgtcccaat ccgggggtaa 1530 <210> SEQ ID NO 73 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F37v2 (CYP76-G14) <400> SEQUENCE: 73 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu His Ser Met Val Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Ser Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Thr Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 74 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F39v2 (CYP76-G15) <400> SEQUENCE: 74 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Lys Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Ile Pro Asp Ala Val Arg Ala Tyr Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Leu 290 295 300 Leu Asp Leu Phe Ala Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Glu Asn Leu Val Gln Glu 340 345 350 Ala Asp Leu Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Asp Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Pro Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 75 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F40 (CYP76-G16) <400> SEQUENCE: 75 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Lys Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110

Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Thr Lys Glu Val 195 200 205 Val Trp Gly Met Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Tyr Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 76 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F41 (CYP76-G17) <400> SEQUENCE: 76 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val His Ala Leu Arg Thr Leu Ser Arg Gly Ser Lys Ala Ala Ser Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Trp Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Ser Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Arg Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Val Val Asp Met Gly Ala Val 165 170 175 Ala Phe Leu Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Glu Glu Val 195 200 205 Val Trp Gly Ile Thr Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Thr Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 77 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F42 (CYP76-G13) <400> SEQUENCE: 77 Met Asp Phe Leu Ser Cys Ile Leu Ser Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Arg Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Asn Lys Pro His Lys Ser Leu Ala Ala Leu Ala Lys Ser 50 55 60 Tyr Asp Pro Ile Met Cys Leu Lys Leu Gly His Met Thr Thr Ile Val 65 70 75 80 Ile Ser Ser Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Thr Pro Asp Ala Val Arg Ala His Gly His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Gln Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Ala Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Val Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Lys Glu Val 195 200 205 Val Trp Gly Ile Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Met Gly Tyr Phe Gly Lys Met Phe Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Leu Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Ala Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Ile Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Phe Ile 290 295 300 Val Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320

Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Ala Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 78 <211> LENGTH: 509 <212> TYPE: PRT <213> ORGANISM: Santalum album <220> FEATURE: <223> OTHER INFORMATION: SaCYP76F43 (CYP76-G18) <400> SEQUENCE: 78 Met Asp Phe Leu Ser Cys Ile Leu Phe Val Leu Phe Ala Trp Ala Leu 1 5 10 15 Val Arg Ala Leu Pro Thr Leu Ser Arg Gly Ser Lys Ala Ala Gly Gly 20 25 30 Arg Leu Pro Pro Gly Pro Val Pro Leu Pro Val Val Gly Asn Leu Leu 35 40 45 Lys Leu Gly Ser Lys Pro His Lys Ser Leu Ala Glu Leu Ala Lys Ser 50 55 60 Tyr Gly Pro Ile Met Cys Leu Lys Leu Gly His Ile Ile Thr Ile Val 65 70 75 80 Ile Ser Thr Pro Thr Val Ala Lys Glu Val Leu Gln Lys Gln Asp Val 85 90 95 Ala Phe Cys Asn Arg Thr Ile Pro Asp Ala Val Arg Ala His Arg His 100 105 110 Asp Leu Tyr Ser Met Ala Trp Leu Pro Val Ser Thr Arg Trp Arg Thr 115 120 125 Leu Arg Lys Ile Ser Asn Ser His Ile Phe Thr Ser Gln Arg Leu Asp 130 135 140 Glu Asn His His Leu Arg Arg Gln Lys Leu Asp Glu Leu Leu Ala Arg 145 150 155 160 Val Ala Glu Ser Ser Leu Val Gly Ala Ala Val Asp Ile Gly Ala Val 165 170 175 Ala Phe Val Thr Ser Leu Asn Leu Leu Ser Asn Thr Val Phe Ser Lys 180 185 190 Asp Leu Val Glu Pro Gly Leu Gly Ala Val Gln Glu Met Lys Glu Val 195 200 205 Val Trp Gly Ile Met Glu Glu Ala Gly Arg Pro Asn Leu Val Asp Tyr 210 215 220 Phe Pro Val Leu Arg Arg Leu Asp Pro Gln Gly Ile Arg Arg Arg Met 225 230 235 240 Thr Gly Asn Phe Gly Lys Met Leu Glu Val Phe Gly Asp Ile Ile Asp 245 250 255 Glu Arg Leu Glu Trp Arg Lys Gln Gln Ser Asp Gly Asp Ser Pro Ala 260 265 270 Gly Thr Thr Asn Asp Val Leu Asp Val Leu Leu Asn Ile Leu Glu Asp 275 280 285 Ala Glu Ile Glu Glu Lys Pro Asn Arg Thr Asp Val Glu His Leu Leu 290 295 300 Leu Asp Leu Phe Val Ala Gly Ser Asp Thr Thr Ser Ser Thr Val Glu 305 310 315 320 Trp Ala Met Thr Glu Leu Leu Arg Lys Pro Glu Thr Leu Glu Arg Ala 325 330 335 Arg Ser Glu Leu His Glu Thr Ile Gly Pro Lys Asn Leu Val Gln Glu 340 345 350 Ala Asp Met Pro Arg Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr 355 360 365 Phe Arg Leu His Pro Pro Val Pro Leu Leu Leu Pro Arg Thr Ala Glu 370 375 380 Lys Asp Ala Glu Leu Cys Gly Phe Thr Val Pro Ala Gly Ala Gln Ile 385 390 395 400 Met Val Asn Ala Trp Ala Ile Gly Arg Asp Pro Gly Thr Trp Glu Asp 405 410 415 Pro Glu Ser Phe Leu Pro Glu Arg Phe Leu Gly Ser Asp Val Asp Val 420 425 430 Lys Gly Arg Ser Phe Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile 435 440 445 Cys Pro Gly Leu Pro Leu Ala Ile Arg Met Val His Leu Met Leu Gly 450 455 460 Ser Leu Ile His Gly Phe Arg Trp Lys Val Phe Asp Asp Gly Met Gly 465 470 475 480 Ser Pro Glu Thr Ala Met Asp Met Asp Glu Lys Phe Gly Ile Thr Leu 485 490 495 Gln Lys Ala Lys Ser Leu Cys Ala Val Pro Ile Arg Gly 500 505 <210> SEQ ID NO 79 <211> LENGTH: 483 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: CYP720B4 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank ADR78276 <309> DATABASE ENTRY DATE: 2011-12-08 <400> SEQUENCE: 79 Met Ala Pro Met Ala Asp Gln Ile Ser Leu Leu Leu Val Val Phe Thr 1 5 10 15 Val Ala Val Ala Leu Leu His Leu Ile His Arg Trp Trp Asn Ile Gln 20 25 30 Arg Gly Pro Lys Met Ser Asn Lys Glu Val His Leu Pro Pro Gly Ser 35 40 45 Thr Gly Trp Pro Leu Ile Gly Glu Thr Phe Ser Tyr Tyr Arg Ser Met 50 55 60 Thr Ser Asn His Pro Arg Lys Phe Ile Asp Asp Arg Glu Lys Arg Tyr 65 70 75 80 Asp Ser Asp Ile Phe Ile Ser His Leu Phe Gly Gly Arg Thr Val Val 85 90 95 Ser Ala Asp Pro Gln Phe Asn Lys Phe Val Leu Gln Asn Glu Gly Arg 100 105 110 Phe Phe Gln Ala Gln Tyr Pro Lys Ala Leu Lys Ala Leu Ile Gly Asn 115 120 125 Tyr Gly Leu Leu Ser Val His Gly Asp Leu Gln Arg Lys Leu His Gly 130 135 140 Ile Ala Val Asn Leu Leu Arg Phe Glu Arg Leu Lys Val Asp Phe Met 145 150 155 160 Glu Glu Ile Gln Asn Leu Val His Ser Thr Leu Asp Arg Trp Ala Asp 165 170 175 Met Lys Glu Ile Ser Leu Gln Asn Glu Cys His Gln Met Val Leu Asn 180 185 190 Leu Met Ala Lys Gln Leu Leu Asp Leu Ser Pro Ser Lys Glu Thr Ser 195 200 205 Asp Ile Cys Glu Leu Phe Val Asp Tyr Thr Asn Ala Val Ile Ala Ile 210 215 220 Pro Ile Lys Ile Pro Gly Ser Thr Tyr Ala Lys Gly Leu Lys Ala Arg 225 230 235 240 Glu Leu Leu Ile Lys Lys Ile Ser Glu Met Ile Lys Glu Arg Arg Asn 245 250 255 His Pro Glu Val Val His Asn Asp Leu Leu Thr Lys Leu Val Glu Glu 260 265 270 Gly Leu Ile Ser Asp Glu Ile Ile Cys Asp Phe Ile Leu Phe Leu Leu 275 280 285 Phe Ala Gly His Glu Thr Ser Ser Arg Ala Met Thr Phe Ala Ile Lys 290 295 300 Phe Leu Thr Tyr Cys Pro Lys Ala Leu Lys Gln Met Lys Glu Glu His 305 310 315 320 Asp Ala Ile Leu Lys Ser Lys Gly Gly His Lys Lys Leu Asn Trp Asp 325 330 335 Asp Tyr Lys Ser Met Ala Phe Thr Gln Cys Val Ile Asn Glu Thr Leu 340 345 350 Arg Leu Gly Asn Phe Gly Pro Gly Val Phe Arg Glu Ala Lys Glu Asp 355 360 365 Thr Lys Val Lys Asp Cys Leu Ile Pro Lys Gly Trp Val Val Phe Ala 370 375 380 Phe Leu Thr Ala Thr His Leu His Glu Lys Phe His Asn Glu Ala Leu 385 390 395 400 Thr Phe Asn Pro Trp Arg Trp Gln Leu Asp Lys Asp Val Pro Asp Asp 405 410 415 Ser Leu Phe Ser Pro Phe Gly Gly Gly Ala Arg Leu Cys Pro Gly Ser 420 425 430 His Leu Ala Lys Leu Glu Leu Ser Leu Phe Leu His Ile Phe Ile Thr 435 440 445 Arg Phe Ser Trp Glu Ala Arg Ala Asp Asp Arg Thr Ser Tyr Phe Pro 450 455 460 Leu Pro Tyr Leu Thr Lys Gly Phe Pro Ile Ser Leu His Gly Arg Val 465 470 475 480 Glu Asn Glu <210> SEQ ID NO 80 <211> LENGTH: 501

<212> TYPE: PRT <213> ORGANISM: Camptotheca acuminate <220> FEATURE: <223> OTHER INFORMATION: CYP76B4 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AES93118 <309> DATABASE ENTRY DATE: 2011-11-09 <400> SEQUENCE: 80 Met Asp Ile Met Asp Phe Met Ser Phe Phe Ile Met Phe Phe Gly His 1 5 10 15 Leu Gln Ile Val Ser Ser Pro Thr Thr Ala Ala Ser Cys Lys Gly Cys 20 25 30 Lys Lys Ala Ser Thr Gly Pro Lys Pro Phe Pro Val Ile Gly Asn Leu 35 40 45 Leu Asp Val Val Gly Asn Gln Pro His Lys Ser Leu Ala Asn Leu Ala 50 55 60 Lys Thr His Gly Pro Leu Met Thr Leu Lys Leu Gly Gln Ile Thr Thr 65 70 75 80 Val Val Val Ser Ser Ser Thr Met Ala Lys Gln Ile Leu Gln Asn His 85 90 95 Asp Leu Tyr Phe Ser Asn Arg Tyr Thr Arg Asp Ala Ile Arg Ala Leu 100 105 110 Asn Gln Asp Gln Phe Ser Val Ile Trp Leu Pro Val Val Thr Arg Trp 115 120 125 Arg Asn Leu Arg Lys Ile Leu Asn Leu Tyr Met Leu Ser Thr Glu Arg 130 135 140 Leu Gly Ala Asn Gln Pro Ile Arg Cys Gln Lys Val Glu Glu Leu Ile 145 150 155 160 Ala Tyr Val Arg Gln Ser Cys Gln Ala Ser Val Ser Val Asp Ile Gly 165 170 175 Gln Ala Ala Phe Arg Thr Met Ile Asn Leu Thr Ser Lys Thr Ile Phe 180 185 190 Ser Val Asp Leu Ala Asp Pro Ser Ser Asp Thr Ala Gln Glu Leu Lys 195 200 205 Glu Leu Phe Trp Arg Ile Met Glu Glu Leu Gly Lys Pro Asn Leu Ala 210 215 220 Asp Tyr Phe Pro Val Leu Arg Lys Leu Asp Pro Gln Gly Ile Arg Arg 225 230 235 240 Arg Thr Thr Ile His Phe Ala Lys Val Phe Asp Leu Phe Asp Arg Met 245 250 255 Ile Asp Gln Arg Leu Glu Leu Leu Arg Ser Asp Asp Cys Cys Thr Gly 260 265 270 Asn Asp Leu Leu Asp Ser Leu Leu Asn Ile Ser Gln Asn Asn Ser Asp 275 280 285 Glu Ile Asp Gln Asn Gln Ile Lys Arg Met Leu Met Asp Val Phe Ile 290 295 300 Ala Ala Thr Asp Thr Thr Ser Ser Thr Leu Glu Trp Ala Met Thr Glu 305 310 315 320 Leu Leu Arg Asn Pro Glu Thr Leu Leu Lys Ala Lys Ala Glu Leu Gln 325 330 335 Gln Ile Val Gly Lys Gly Lys Leu Val Glu Glu Leu Asp Ile Ala Arg 340 345 350 Leu Pro Tyr Leu Gln Ala Ile Val Lys Glu Thr Phe Arg Leu His Thr 355 360 365 Thr Val Pro Phe Leu Ile Pro Arg Gln Val Asp Glu Asp Val Glu Val 370 375 380 Cys Gly Phe Thr Val Pro Lys Gly Ala Gln Val Leu Val Asn Ala Trp 385 390 395 400 Ala Ile Gly His Asp Pro Ser Ile Trp Pro Lys Pro Asp Ser Phe Met 405 410 415 Pro Glu Arg Phe Leu Glu Ser Glu Val Asp Val Arg Gly Leu Asp Phe 420 425 430 Glu Leu Ile Pro Phe Gly Gly Gly Arg Arg Ile Cys Pro Gly Ser Ala 435 440 445 Leu Ala Leu Arg Met Leu His Leu Met Leu Gly Ser Leu Ile Asn Ser 450 455 460 Phe Asp Trp Arg Leu Glu Asp Gly Ile Ala Pro Asn Asp Met Asp Met 465 470 475 480 Glu Glu Lys Phe Gly Leu Ser Leu Gln Lys Ala Arg Pro Leu Leu Phe 485 490 495 Ala Pro Val His Ile 500 <210> SEQ ID NO 81 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Catharanthus roseus <220> FEATURE: <223> OTHER INFORMATION: CYP76B6 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank Q8VWZ7 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 81 Met Asp Tyr Leu Thr Ile Ile Leu Thr Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Tyr Glu Ala Phe Ser Tyr Leu Ser Arg Arg Thr Lys Asn Leu Pro Pro 20 25 30 Gly Pro Ser Pro Leu Pro Phe Ile Gly Ser Leu His Leu Leu Gly Asp 35 40 45 Gln Pro His Lys Ser Leu Ala Lys Leu Ser Lys Lys His Gly Pro Ile 50 55 60 Met Ser Leu Lys Leu Gly Gln Ile Thr Thr Ile Val Ile Ser Ser Ser 65 70 75 80 Thr Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe Ser Ser 85 90 95 Arg Ser Val Pro Asn Ala Leu His Ala His Asn Gln Phe Lys Phe Ser 100 105 110 Val Val Trp Leu Pro Val Ala Ser Arg Trp Arg Ser Leu Arg Lys Val 115 120 125 Leu Asn Ser Asn Ile Phe Ser Gly Asn Arg Leu Asp Ala Asn Gln His 130 135 140 Leu Arg Thr Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg Lys Asn 145 150 155 160 Ser Gln Ser Gly Glu Ala Val Asp Val Gly Arg Ala Ala Phe Arg Thr 165 170 175 Ser Leu Asn Leu Leu Ser Asn Leu Ile Phe Ser Lys Asp Leu Thr Asp 180 185 190 Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp Asn Ile 195 200 205 Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Phe Phe Pro Leu Leu 210 215 220 Glu Lys Val Asp Pro Gln Gly Ile Arg His Arg Met Thr Ile His Phe 225 230 235 240 Gly Glu Val Leu Lys Leu Phe Gly Gly Leu Val Asn Glu Arg Leu Glu 245 250 255 Gln Arg Arg Ser Lys Gly Glu Lys Asn Asp Val Leu Asp Val Leu Leu 260 265 270 Thr Thr Ser Gln Glu Ser Pro Glu Glu Ile Asp Arg Thr His Ile Glu 275 280 285 Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr Ser Ser 290 295 300 Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Asp Lys Met 305 310 315 320 Lys Lys Thr Gln Asp Glu Leu Ala Gln Val Ile Gly Arg Gly Lys Thr 325 330 335 Ile Glu Glu Ser Asp Ile Asn Arg Leu Pro Tyr Leu Arg Cys Val Met 340 345 350 Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Phe Leu Ile Pro Arg 355 360 365 Lys Val Glu Gln Ser Val Glu Val Cys Gly Tyr Asn Val Pro Lys Gly 370 375 380 Ser Gln Val Leu Val Asn Ala Trp Ala Ile Gly Arg Asp Glu Thr Val 385 390 395 400 Trp Asp Asp Ala Leu Ala Phe Lys Pro Glu Arg Phe Met Glu Ser Glu 405 410 415 Leu Asp Ile Arg Gly Arg Asp Phe Glu Leu Ile Pro Phe Gly Ala Gly 420 425 430 Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Leu Arg Thr Val Pro Leu 435 440 445 Met Leu Gly Ser Leu Leu Asn Ser Phe Asn Trp Lys Leu Glu Gly Gly 450 455 460 Met Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile Thr Leu 465 470 475 480 Gln Lys Ala His Pro Leu Arg Ala Val Pro Ser Thr Leu 485 490 <210> SEQ ID NO 82 <211> LENGTH: 495 <212> TYPE: PRT <213> ORGANISM: Swertia mussotii <220> FEATURE: <223> OTHER INFORMATION: CYP76B4 geraniol-10-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank D1MI46 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 82 Met Asp Phe Asp Phe Leu Thr Ile Ala Ile Gly Phe Leu Phe Thr Ile 1 5 10 15 Thr Leu Tyr Gln Ala Leu Asn Phe Phe Ser Arg Lys Ser Lys Asn Leu 20 25 30 Pro Pro Gly Pro Ser Pro Leu Pro Leu Ile Gly Asn Leu His Leu Leu 35 40 45 Gly Asp Gln Pro His Lys Ser Leu Ala Lys Leu Ala Lys Lys His Gly 50 55 60 Pro Ile Met Gly Leu Gln Leu Gly Gln Val Thr Thr Ile Val Val Thr 65 70 75 80 Ser Ser Gly Met Ala Lys Glu Val Leu Gln Lys Gln Asp Leu Ala Phe 85 90 95 Ser Ser Arg Ser Ile Pro Asn Ala Ile His Ala His Asp Gln Tyr Lys 100 105 110 Tyr Ser Val Ile Trp Leu Pro Val Ala Ser Arg Trp Arg Gly Leu Arg 115 120 125 Lys Ala Leu Asn Ser Asn Met Phe Ser Gly Asn Arg Leu Asp Ala Asn 130 135 140

Gln His Leu Arg Ser Arg Lys Val Gln Glu Leu Ile Ala Tyr Cys Arg 145 150 155 160 Lys Ser Ser Gln Thr Gly Asp Ala Ile Asp Val Gly Arg Ala Ala Phe 165 170 175 Arg Thr Ser Leu Asn Leu Leu Ser Asn Thr Met Phe Ser Lys Asp Leu 180 185 190 Thr Asp Pro Tyr Ser Asp Ser Ala Lys Glu Phe Lys Asp Leu Val Trp 195 200 205 Asn Val Met Val Glu Ala Gly Lys Pro Asn Leu Val Asp Tyr Phe Pro 210 215 220 Leu Leu Asp Lys Val Asp Pro Gln Gly Ile Arg Lys Arg Met Thr Ile 225 230 235 240 His Phe Gly Lys Ile Leu Glu Leu Phe Gly Gly Leu Ile Asp Glu Arg 245 250 255 Leu Gln Gln Lys Lys Ala Lys Gly Val Asn Asp Asp Val Leu Asp Val 260 265 270 Leu Leu Thr Thr Ser Glu Glu Ser Pro Glu Glu Ile Asp Arg Thr His 275 280 285 Ile Gln Arg Met Cys Leu Asp Leu Phe Val Ala Gly Thr Asp Thr Thr 290 295 300 Ser Ser Thr Leu Glu Trp Ala Met Ser Glu Met Leu Lys Asn Pro Glu 305 310 315 320 Lys Met Lys Ala Ala Gln Ala Glu Leu Ala Gln Val Ile Gly Lys Gly 325 330 335 Lys Ala Val Glu Glu Ala Asp Leu Ala Arg Leu Pro Tyr Leu Arg Cys 340 345 350 Ala Ile Lys Glu Thr Leu Arg Ile His Pro Pro Val Pro Leu Leu Ile 355 360 365 Pro Arg Arg Thr Glu Gln Glu Val Glu Val Cys Gly Tyr Thr Val Pro 370 375 380 Lys Asn Ser Gln Val Leu Val Asn Val Trp Ala Ile Ser Arg Asp Asp 385 390 395 400 Ala Ile Trp Lys Asp Pro Leu Ser Phe Lys Pro Glu Arg Phe Leu Glu 405 410 415 Ser Glu Leu Glu Met Arg Gly Lys Asp Phe Glu Leu Ile Pro Phe Gly 420 425 430 Ala Gly Arg Arg Ile Cys Pro Gly Leu Pro Leu Ala Val Arg Met Val 435 440 445 Pro Val Met Leu Gly Ser Leu Leu Asn Ser Phe Asp Trp Lys Leu Glu 450 455 460 Gly Gly Ile Ala Pro Lys Asp Leu Asp Met Glu Glu Lys Phe Gly Ile 465 470 475 480 Thr Leu Gln Lys Ala His Pro Leu Arg Ala Val Ala Thr Pro Leu 485 490 495 <210> SEQ ID NO 83 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <220> FEATURE: <223> OTHER INFORMATION: CYP76M7 ent-cassadiene C11a-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: NCBI NP_001047185 <309> DATABASE ENTRY DATE: 2010-06-08 <400> SEQUENCE: 83 Met Glu Asn Ser Gln Val Trp Leu Leu Trp Gly Ala Leu Ser Val Ala 1 5 10 15 Val Leu Phe Tyr Leu Ser Thr Leu Arg Arg Arg Tyr Ala Gly Gly Lys 20 25 30 Pro Leu Pro Pro Gly Pro Thr Pro Leu Pro Leu Ile Gly Asn Leu His 35 40 45 Leu Ala Gly Gly Thr Phe His His Lys Leu Arg Asp Leu Ala Arg Val 50 55 60 His Gly Pro Val Met Thr Leu Lys Leu Gly Leu Ala Thr Asn Val Val 65 70 75 80 Ile Ser Ser Arg Glu Ala Ala Ile Glu Ala Tyr Thr Lys Tyr Asp Arg 85 90 95 His Leu Ala Ala Arg Ala Thr Pro Asp Thr Phe Arg Ala Cys Gly Phe 100 105 110 Ala Asp Arg Ser Met Val Phe Ile Pro Ser Ser Asp Pro Gln Trp Lys 115 120 125 Ala Leu Arg Gly Ile Gln Gly Ser His Val Phe Thr Pro Arg Gly Leu 130 135 140 Ala Ala Val Arg Pro Ile Arg Glu Arg Lys Val Gly Asp Leu Ile Ala 145 150 155 160 Tyr Leu Arg Ala His Ala Gly Glu Glu Val Leu Leu Gly Gln Ala Met 165 170 175 Tyr Thr Gly Leu Leu Asn Leu Val Ser Phe Ser Tyr Phe Ser Ile Asp 180 185 190 Ile Val Asp Met Gly Ser Gln Met Ala Arg Asp Leu Arg Glu Val Val 195 200 205 Asp Asp Ile Ile Ser Val Val Gly Lys Pro Asn Ile Ser Asp Phe Tyr 210 215 220 Pro Phe Leu Arg Pro Leu Asp Leu Gln Gly Leu Arg Arg Trp Thr Thr 225 230 235 240 Lys Arg Phe Asn Arg Val Phe Ser Ile Met Gly Asp Ile Ile Asp Arg 245 250 255 Arg Leu Ala His Ile Arg Asp Gly Lys Pro Arg His Asp Asp Phe Leu 260 265 270 Asp Ser Leu Leu Glu Leu Met Ala Thr Gly Lys Met Glu Arg Val Asn 275 280 285 Val Val Asn Met Leu Phe Glu Ala Phe Val Ala Gly Val Asp Thr Met 290 295 300 Ala Leu Thr Leu Glu Trp Val Met Ala Glu Leu Leu His Asn Pro Ala 305 310 315 320 Ile Met Ala Arg Val Arg Ala Glu Leu Ser Asp Val Leu Gly Gly Lys 325 330 335 Glu Ala Val Glu Glu Ala Asp Ala Ala Arg Leu Pro Tyr Leu Gln Ala 340 345 350 Val Leu Lys Glu Ala Met Arg Leu His Pro Val Gly Ala Leu Leu Leu 355 360 365 Pro His Phe Ala Ala Glu Asp Gly Val Glu Ile Gly Gly Tyr Ala Val 370 375 380 Pro Arg Gly Ser Thr Val Leu Phe Asn Ala Trp Ala Ile Met Arg Asp 385 390 395 400 Pro Ala Ala Trp Glu Arg Pro Asp Glu Phe Val Pro Glu Arg Phe Leu 405 410 415 Gly Arg Ser Pro Pro Leu Asp Phe Arg Gly Lys Asp Val Glu Phe Met 420 425 430 Pro Phe Gly Ser Gly Arg Arg Leu Cys Pro Gly Leu Pro Leu Ala Glu 435 440 445 Arg Val Val Pro Phe Ile Leu Ala Ser Met Leu His Thr Phe Glu Trp 450 455 460 Lys Leu Pro Gly Gly Met Thr Ala Glu Asp Val Asp Val Ser Glu Lys 465 470 475 480 Phe Lys Ser Ala Asn Val Leu Ala Val Pro Leu Lys Ala Val Pro Val 485 490 495 Leu Ile Lys <210> SEQ ID NO 84 <211> LENGTH: 493 <212> TYPE: PRT <213> ORGANISM: Mentha x piperita <220> FEATURE: <223> OTHER INFORMATION: CYP71A32 menthofuran synthase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Uniprot Q947B7 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 84 Met Ala Ala Leu Leu Val Phe Phe Ser Val Ser Leu Ile Leu Leu Ala 1 5 10 15 Val Leu Phe His Lys Arg Lys Ser Ser Leu Ser Ser Arg Lys Arg Pro 20 25 30 Pro Pro Ser Pro Leu Arg Leu Pro Val Ile Gly His Phe His Leu Ile 35 40 45 Gly Ala Leu Ser His Arg Ser Phe Thr Ser Leu Ser Lys Arg Tyr Gly 50 55 60 Glu Val Met Leu Leu His Phe Gly Ser Ala Pro Val Leu Val Ala Ser 65 70 75 80 Ser Ala Ala Ala Ala Arg Glu Ile Met Lys Asn Gln Asp Val Ile Phe 85 90 95 Ala Ser Arg Pro Arg Leu Ser Ile Phe Asp Arg Leu Met Tyr Ser Gly 100 105 110 Lys Gly Val Ala Phe Ala Pro Tyr Gly Glu His Trp Arg Asn Ala Arg 115 120 125 Ser Met Cys Met Leu Gln Leu Leu Ser Ala Lys Arg Val Gln Ser Phe 130 135 140 Gly Gly Ile Arg Glu Glu Glu Thr Ser Ala Met Ile Glu Lys Ile Arg 145 150 155 160 Arg Ser Lys Pro Thr Thr Val Val Asn Leu Ser Glu Met Phe Met Ala 165 170 175 Leu Thr Asn Gly Val Ile His Arg Ala Val Leu Gly Arg Lys Gly Asp 180 185 190 Gly Gly Asp Asp Phe Asn Arg Ile Leu Ile Lys Val Ile Lys Leu Leu 195 200 205 Gly Ser Phe Asn Val Gly Asp Tyr Val Pro Trp Leu Ser Trp Ile Asn 210 215 220 Arg Ile Asn Gly Val Asp Ala Glu Val Glu Lys Val Gly Thr Lys Leu 225 230 235 240 Asp Gly Ser Met Glu Gly Ile Leu Arg Lys Tyr Arg Arg Lys Lys Val 245 250 255 Gly Asp Asp Glu Thr Asn Phe Val Asp Thr Leu Leu Gln Phe Gln Arg 260 265 270 Glu Ser Lys Asp Thr Asp Pro Val Glu Asp Asp Val Ile Lys Ala Leu 275 280 285 Ile Phe Asp Met Val Ser Ala Gly Thr Asp Thr Thr Phe Ala Ala Leu 290 295 300 Glu Trp Thr Met Ala Glu Leu Ile Lys Asn Pro Arg Thr Leu Lys Thr 305 310 315 320 Leu Gln Asn Glu Val Arg Glu Val Ser Arg Asn Lys Gly Gly Ile Thr 325 330 335

Glu Asp Asp Val Asp Lys Met Pro Tyr Leu Lys Ala Val Ser Lys Glu 340 345 350 Ile Leu Arg Leu His Pro Pro Phe Ala Ile Leu Leu Pro Arg Glu Leu 355 360 365 Thr Gln Asp Ala Asn Met Leu Gly Tyr Asp Ile Pro Arg Gly Thr Val 370 375 380 Val Leu Val Asn Asn Trp Ala Ile Ser Arg Asp Pro Ser Leu Trp Glu 385 390 395 400 Asn Pro Glu Glu Phe Arg Pro Glu Arg Phe Leu Glu Thr Ser Ile Asp 405 410 415 Tyr Lys Gly Leu His Phe Glu Met Leu Pro Phe Gly Ser Gly Arg Arg 420 425 430 Gly Cys Pro Gly Ser Thr Phe Ala Met Ala Leu Tyr Glu Leu Ala Leu 435 440 445 Ser Lys Leu Val Asn Glu Phe Asp Phe Arg Leu Gly Asn Gly Asp Arg 450 455 460 Ala Glu Asp Leu Asp Met Thr Glu Ala Pro Gly Phe Val Val His Lys 465 470 475 480 Lys Ser Pro Leu Leu Val Leu Ala Thr Pro Arg Gln Ser 485 490 <210> SEQ ID NO 85 <211> LENGTH: 502 <212> TYPE: PRT <213> ORGANISM: Persea americana <220> FEATURE: <223> OTHER INFORMATION: CYP71A1 <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Uniprot P24465 <309> DATABASE ENTRY DATE: 2013-04-03 <400> SEQUENCE: 85 Met Ala Ile Leu Val Ser Leu Leu Phe Leu Ala Ile Ala Leu Thr Phe 1 5 10 15 Phe Leu Leu Lys Leu Asn Glu Lys Arg Glu Lys Lys Pro Asn Leu Pro 20 25 30 Pro Ser Pro Pro Asn Leu Pro Ile Ile Gly Asn Leu His Gln Leu Gly 35 40 45 Asn Leu Pro His Arg Ser Leu Arg Ser Leu Ala Asn Glu Leu Gly Pro 50 55 60 Leu Ile Leu Leu His Leu Gly His Ile Pro Thr Leu Ile Val Ser Thr 65 70 75 80 Ala Glu Ile Ala Glu Glu Ile Leu Lys Thr His Asp Leu Ile Phe Ala 85 90 95 Ser Arg Pro Ser Thr Thr Ala Ala Arg Arg Ile Phe Tyr Asp Cys Thr 100 105 110 Asp Val Ala Phe Ser Pro Tyr Gly Glu Tyr Trp Arg Gln Val Arg Lys 115 120 125 Ile Cys Val Leu Glu Leu Leu Ser Ile Lys Arg Val Asn Ser Tyr Arg 130 135 140 Ser Ile Arg Glu Glu Glu Val Gly Leu Met Met Glu Arg Ile Ser Gln 145 150 155 160 Ser Cys Ser Thr Gly Glu Ala Val Asn Leu Ser Glu Leu Leu Leu Leu 165 170 175 Leu Ser Ser Gly Thr Ile Thr Arg Val Ala Phe Gly Lys Lys Tyr Glu 180 185 190 Gly Glu Glu Glu Arg Lys Asn Lys Phe Ala Asp Leu Ala Thr Glu Leu 195 200 205 Thr Thr Leu Met Gly Ala Phe Phe Val Gly Asp Tyr Phe Pro Ser Phe 210 215 220 Ala Trp Val Asp Val Leu Thr Gly Met Asp Ala Arg Leu Lys Arg Asn 225 230 235 240 His Gly Glu Leu Asp Ala Phe Val Asp His Val Ile Asp Asp His Leu 245 250 255 Leu Ser Arg Lys Ala Asn Gly Ser Asp Gly Val Glu Gln Lys Asp Leu 260 265 270 Val Asp Val Leu Leu His Leu Gln Lys Asp Ser Ser Leu Gly Val His 275 280 285 Leu Asn Arg Asn Asn Leu Lys Ala Val Ile Leu Asp Met Phe Ser Gly 290 295 300 Gly Thr Asp Thr Thr Ala Val Thr Leu Glu Trp Ala Met Ala Glu Leu 305 310 315 320 Ile Lys His Pro Asp Val Met Glu Lys Ala Gln Gln Glu Val Arg Arg 325 330 335 Val Val Gly Lys Lys Ala Lys Val Glu Glu Glu Asp Leu His Gln Leu 340 345 350 His Tyr Leu Lys Leu Ile Ile Lys Glu Thr Leu Arg Leu His Pro Val 355 360 365 Ala Pro Leu Leu Val Pro Arg Glu Ser Thr Arg Asp Val Val Ile Arg 370 375 380 Gly Tyr His Ile Pro Ala Lys Thr Arg Val Phe Ile Asn Ala Trp Ala 385 390 395 400 Ile Gly Arg Asp Pro Lys Ser Trp Glu Asn Ala Glu Glu Phe Leu Pro 405 410 415 Glu Arg Phe Val Asn Asn Ser Val Asp Phe Lys Gly Gln Asp Phe Gln 420 425 430 Leu Ile Pro Phe Gly Ala Gly Arg Arg Gly Cys Pro Gly Ile Ala Phe 435 440 445 Gly Ile Ser Ser Val Glu Ile Ser Leu Ala Asn Leu Leu Tyr Trp Phe 450 455 460 Asn Trp Glu Leu Pro Gly Asp Leu Thr Lys Glu Asp Leu Asp Met Ser 465 470 475 480 Glu Ala Val Gly Ile Thr Val His Met Lys Phe Pro Leu Gln Leu Val 485 490 495 Ala Lys Arg His Leu Ser 500 <210> SEQ ID NO 86 <211> LENGTH: 496 <212> TYPE: PRT <213> ORGANISM: Cichoriium intybus <220> FEATURE: <223> OTHER INFORMATION: CYP71AV8 valencene oxidase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank ADM86719 <309> DATABASE ENTRY DATE: 2011-01-24 <400> SEQUENCE: 86 Met Glu Ile Ser Ile Pro Thr Thr Leu Gly Leu Ala Val Ile Ile Phe 1 5 10 15 Ile Ile Phe Lys Leu Leu Thr Arg Thr Thr Ser Lys Lys Asn Leu Leu 20 25 30 Pro Glu Pro Trp Arg Leu Pro Ile Ile Gly His Met His His Leu Ile 35 40 45 Gly Thr Met Pro His Arg Gly Val Met Glu Leu Ala Arg Lys His Gly 50 55 60 Ser Leu Met His Leu Gln Leu Gly Glu Val Ser Thr Ile Val Val Ser 65 70 75 80 Ser Pro Arg Trp Ala Lys Glu Val Leu Thr Thr Tyr Asp Ile Thr Phe 85 90 95 Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu Ile Val Ala Tyr His Asn 100 105 110 Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg 115 120 125 Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn Lys Lys Val Lys Ser Phe 130 135 140 Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn Leu Val Lys Asp Ile Arg 145 150 155 160 Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys 165 170 175 Met Ile Ala Thr Ile Leu Ser Arg Ala Ala Phe Gly Lys Gly Ile Lys 180 185 190 Asp Gln Met Lys Phe Thr Glu Leu Val Lys Glu Ile Leu Arg Leu Thr 195 200 205 Gly Gly Phe Asp Val Ala Asp Ile Phe Pro Ser Lys Lys Leu Leu His 210 215 220 His Leu Ser Gly Lys Arg Ala Lys Leu Thr Asn Ile His Asn Lys Leu 225 230 235 240 Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu His Pro Gly Asn Arg Thr 245 250 255 Ser Ser Ser Gln Glu Thr Leu Leu Asp Val Leu Leu Arg Leu Lys Glu 260 265 270 Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn Val Lys Ala Val Ile Leu 275 280 285 Asp Met Phe Gly Ala Gly Thr Asp Thr Ser Ser Ala Thr Ile Glu Trp 290 295 300 Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg Ala Met Glu Lys Val Gln 305 310 315 320 Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu 325 330 335 Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu 340 345 350 Arg Leu His Pro Pro Leu Pro Leu Val Met Pro Arg Glu Cys Arg Glu 355 360 365 Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile 370 375 380 Val Asn Val Phe Ala Ile Asn Arg Asp Pro Glu Tyr Trp Lys Asp Ala 385 390 395 400 Glu Thr Phe Met Pro Glu Arg Phe Glu Asn Ser Pro Ile Thr Val Met 405 410 415 Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys 420 425 430 Pro Gly Ala Ala Leu Gly Leu Ala Asn Val Glu Leu Pro Leu Ala His 435 440 445 Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu 450 455 460 Asp Leu Asp Met Thr Glu Ser Phe Gly Ala Thr Val Gln Arg Lys Thr 465 470 475 480 Glu Leu Leu Leu Val Pro Thr Asp Phe Gln Thr Leu Thr Ala Ser Thr 485 490 495 <210> SEQ ID NO 87 <211> LENGTH: 1732 <212> TYPE: DNA <213> ORGANISM: Mentha x gracilis <220> FEATURE:

<223> OTHER INFORMATION: CYP71D13 (-)-limonene-3-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AY281027 <309> DATABASE ENTRY DATE: 2003-11-07 <400> SEQUENCE: 87 aataatggag ctccagattt cgtcggcaat tataatcctc gtcgcaacat tcgtcgcatc 60 cctcctaatc aagcaatggc gaaaatcgga atcccaacaa aacctgcccc cgggcccgcc 120 gaagctgccg ctggtcggcc acctccacct cctatggggg aagctgccgc agcacgcgat 180 ggccgacatg gccaagaagt acggccccgt cacccacgtg cagctcggcg aggtcttctc 240 cgtcgtcctt tcgtcgcgag aagcgacgaa agaggcgatg aagctgctcg accccgcgtg 300 cgcggacagg ttcgagagca tcgggacgag gatcatgtgg tacgacaacg acgacatcat 360 cttcagcccg tacagcgacc actggcgcca gatgcgcaag atatgcgtct ctgagctcct 420 cagtgcccgc aacgtacggt ccttcgggtt catccgtcag gacgagatgt cgcgcctcct 480 ccgccacctc cagtcgtcgg cgggggagac cgtcgacatg acagagagga tagcgacgct 540 tacgtgctcc atcatctgta gggcggcgtt cggggccatc atcaacgatc acgaggagct 600 tgtggagttg gtgaaggact cgctgagcat ggcgtcaggg tttgagcttg ctgacttgtt 660 cccctcctcc aaactcctca acttgctctg ctggaacaag agcaagttgt ggaggatgcg 720 ccgccgcgtc gacaccatcc tcgaggccat cgtggaggag cacaagctca agaagagcgg 780 cgagtttggc ggtgaagaca tcatcgacgt cctcttcaga atgcagaagg acagccagat 840 caaagtcccc atcaccacca atgccatcaa agccttcatc ttcgacacgt tctcagcagg 900 gactgagacc tcgtcgacca ccaccttatg ggtgatggca gagctgatga ggaatccggc 960 agtgatggcg aaggcgcagg cggaggtgag agcggcactg aaggggaaga cgagtgtgga 1020 tgtggatgac gtgcaggagc tcaagtacat gaaatcggtg gtgaaggaga caatgaggat 1080 gcaccccccg atcccgttga tcccgagatc atgcagagaa gaatgcgagg ttaacggata 1140 taaaattccg aacaaggcta ggatcatgat caacgtctgg tctatgggaa ggaatcccct 1200 ctactgggaa aagccggaga ccttttggcc cgaaagattc gaccaagttt cgagggattt 1260 catgggaagc gatttcgagt tcatcccgtt tggagcggga agaagaatct gccccggttt 1320 gaatttcggg ctggccaacg tcgaggttcc attggcacaa cttctttacc acttcgactg 1380 gaaattagcg gaaggaatga agccttcgga tatggacatg tccgaggccg aaggccttac 1440 cggaataaga aagaacaatc ttctactggt tcccacaccc tacaatcctt cctcatgatc 1500 aataatcttt tactccttca aataaagagt gcatatacat atatgtacat gtagctcagg 1560 gttataaata agcaaatatg taacttttcc ctttttgaac tctattatgt aatccaaaac 1620 tagcatgtca tgtatctagg tttcaattca tatgcataat tttgtgcatg tattacccca 1680 gtagtgatgt ggttaatgcc cgagaccttt gtggtaaaaa aaaaaaaaaa aa 1732 <210> SEQ ID NO 88 <211> LENGTH: 1515 <212> TYPE: DNA <213> ORGANISM: Nicotiana tabacum <220> FEATURE: <223> OTHER INFORMATION: CYP71D20 5-epi-aristocholene-1,3-dihydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AF368376 <309> DATABASE ENTRY DATE: 2005-09-20 <400> SEQUENCE: 88 atgcaattct tcagcttggt ttccattttc ctattcctat ctttcctatt tctgttgagg 60 aaatggaaga actccaatag ccaaagcaaa aaattgccac caggtccatg gaaaatacca 120 atactaggaa gtatgcttca tatgattggt ggagaaccgc accatgtcct tagagattta 180 gccaaaaaat atggaccact tatgcacctt cagttaggtg aaatttctgc agttgtggtt 240 acttctaggg acatggcaaa agaagtgcta aaaactcatg acgtcgtttt tgcatctagg 300 cctaaaattg tagccatgga cattatctgt tataaccagt ccgacattgc ctttagccct 360 tatggcgacc actggagaca aatgcgtaaa atttgtgtca tggaacttct caatgcaaag 420 aatgttcggt ctttcagctc catcagacgt gatgaagtcg ttcgtctcat tgactctatc 480 cggtcagatt cttcttcagg tgagctagtt aattttacgc agaggatcat ttggtttgca 540 agctccatga cgtgtagatc agcatttggg caagtactca aggggcaaga catatttgcc 600 aaaaagatca gagaagtaat aggattagca gaaggctttg atgtggtaga catcttccct 660 acatacaagt ttcttcatgt tctcagtggg atgaagcgta aacttttgaa tgcccacctt 720 aaggtagacg ccattgttga ggatgtcatc aacgagcaca agaaaaatct tgcagctggc 780 aagagtaatg gcgcattagg aggcgaagat ctaattgatg tcctactgag acttatgaat 840 gacacaagtc ttcaatttcc catcaccaac gacaatatca aagctgttat tgttgacatg 900 tttgctgccg gaacagaaac ttcatcaaca acaactgtat gggctatggc tgaaatgatg 960 aagaatccaa gtgtattcac caaagctcaa gcagaagtgc gagaagcctt tagggacaaa 1020 gtatcttttg atgaaaatga tgtggaggag ctgaaatact taaagttagt cattaaagaa 1080 actttgagac ttcatccacc gtctccactt ttggtcccaa gagaatgcag ggaagatacg 1140 gatataaacg gctacactat tcctgcgaag accaaagtta tggttaatgt ttgggcattg 1200 ggaagagatc caaaatattg ggatgacgcg gaaagcttta agccagagag atttgagcaa 1260 tgctctgtgg atttttttgg taataatttt gagtttcttc cctttggcgg tggacggaga 1320 atttgtcctg gaatgtcatt tggtttagct aatctttact tgccattggc tcaattactc 1380 tatcactttg actggaaact cccaaccgga atcatgccaa gagacttaga cttgaccgaa 1440 ttatcgggaa taactattgc tagaaagggt ggcctttact taaatgccac tccttatcaa 1500 ccttctcgag agtaa 1515 <210> SEQ ID NO 89 <211> LENGTH: 536 <212> TYPE: PRT <213> ORGANISM: Gossypium arboretum <220> FEATURE: <223> OTHER INFORMATION: CYP706B1 (+)-delta-cadinene-8-hydroxylase <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: Genbank AAK60517 <309> DATABASE ENTRY DATE: 2001-11-01 <400> SEQUENCE: 89 Met Leu Gln Ile Ala Phe Ser Ser Tyr Ser Trp Leu Leu Thr Ala Ser 1 5 10 15 Asn Gln Lys Asp Gly Met Leu Phe Pro Val Ala Leu Ser Phe Leu Val 20 25 30 Ala Ile Leu Gly Ile Ser Leu Trp His Val Trp Thr Ile Arg Lys Pro 35 40 45 Lys Lys Asp Ile Ala Pro Leu Pro Pro Gly Pro Arg Gly Leu Pro Ile 50 55 60 Val Gly Tyr Leu Pro Tyr Leu Gly Thr Asp Asn Leu His Leu Val Phe 65 70 75 80 Thr Asp Leu Ala Ala Ala Tyr Gly Pro Ile Tyr Lys Leu Trp Leu Gly 85 90 95 Asn Lys Leu Cys Val Val Ile Ser Ser Ala Pro Leu Ala Lys Glu Val 100 105 110 Val Arg Asp Asn Asp Ile Thr Phe Ser Glu Arg Asp Pro Pro Val Cys 115 120 125 Ala Lys Ile Ile Thr Phe Gly Leu Asn Asp Ile Val Phe Asp Ser Tyr 130 135 140 Ser Ser Pro Asp Trp Arg Met Lys Arg Lys Val Leu Val Arg Glu Met 145 150 155 160 Leu Ser His Ser Ser Ile Lys Ala Cys Tyr Gly Leu Arg Arg Glu Gln 165 170 175 Val Leu Lys Gly Val Gln Asn Val Ala Gln Ser Ala Gly Lys Pro Ile 180 185 190 Asp Phe Gly Glu Thr Ala Phe Leu Thr Ser Ile Asn Ala Met Met Ser 195 200 205 Met Leu Trp Gly Gly Lys Gln Gly Gly Glu Arg Lys Gly Ala Asp Val 210 215 220 Trp Gly Gln Phe Arg Asp Leu Ile Thr Glu Leu Met Val Ile Leu Gly 225 230 235 240 Lys Pro Asn Val Ser Asp Ile Phe Pro Val Leu Ala Arg Phe Asp Ile 245 250 255 Gln Gly Leu Glu Lys Glu Met Thr Lys Ile Val Asn Ser Phe Asp Lys 260 265 270 Leu Phe Asn Ser Met Ile Glu Glu Arg Glu Asn Phe Ser Asn Lys Leu 275 280 285 Ser Lys Glu Asp Gly Asn Thr Glu Thr Lys Asp Phe Leu Gln Leu Leu 290 295 300 Leu Asp Leu Lys Gln Lys Asn Asp Ser Gly Ile Ser Ile Thr Met Asn 305 310 315 320 Gln Val Lys Ala Leu Leu Met Asp Ile Val Val Gly Gly Thr Asp Thr 325 330 335 Thr Ser Thr Met Met Glu Trp Thr Met Ala Glu Leu Ile Ala Asn Pro 340 345 350 Glu Ala Met Lys Lys Val Lys Gln Glu Ile Asp Asp Val Val Gly Ser 355 360 365 Asp Gly Ala Val Asp Glu Thr His Leu Pro Lys Leu Arg Tyr Leu Asp 370 375 380 Ala Ala Val Lys Glu Thr Phe Arg Leu His Pro Pro Met Pro Leu Leu 385 390 395 400 Val Pro Arg Cys Pro Gly Asp Ser Ser Asn Val Gly Gly Tyr Ser Val 405 410 415 Pro Lys Gly Thr Arg Val Phe Leu Asn Ile Trp Cys Ile Gln Arg Asp 420 425 430 Pro Gln Leu Trp Glu Asn Pro Leu Glu Phe Lys Pro Glu Arg Phe Leu 435 440 445 Thr Asp His Glu Lys Leu Asp Tyr Leu Gly Asn Asp Ser Arg Tyr Met 450 455 460 Pro Phe Gly Ser Gly Arg Arg Met Cys Ala Gly Val Ser Leu Gly Glu 465 470 475 480 Lys Met Leu Tyr Ser Ser Leu Ala Ala Met Ile His Ala Tyr Asp Trp 485 490 495 Asn Leu Ala Asp Gly Glu Glu Asn Asp Leu Ile Gly Leu Phe Gly Ile 500 505 510 Ile Met Lys Lys Lys Lys Pro Leu Ile Leu Val Pro Thr Pro Arg Pro 515 520 525 Ser Asn Leu Gln His Tyr Met Lys 530 535

Claims

1. A host cell, comprising a nucleic acid molecule encoding a cytochrome P450 oxidase polypeptide or a catalytically active portion thereof, wherein: (a) the encoded cytochrome P450 oxidase polypeptide or catalytically active portion thereof exhibits at least 85% sequence identity to a P450 oxidase polypeptide set forth in SEQ ID NO:6, 7, 8, 9, 50, 74, 75, 76, or 77, or a corresponding catalytically active portion thereof; (b) the encoded cytochrome P450 oxidase or catalytically active fragment thereof catalyzes hydroxylation or monooxygenation of santalene and/or bergamotene; and (c) the nucleic acid molecule is heterologous to the host cell.

2. The host cell of claim 1, wherein the encoded cytochrome P450 oxidase polypeptide exhibits at least 95% sequence identity to the cytochrome P450 oxidase polypeptide set forth in SEQ ID NO:6, 7, 8, 9, 50, 74, 75, 76, or 77.

3. The host cell of claim 1, wherein the encoded cytochrome P450 oxidase polypeptide or catalytically active portion thereof is a Santalum album P450 oxidase polypeptide.

4. The host cell of claim 1, wherein the cytochrome P450 oxidase polypeptide or catalytically active fragment catalyzes formation of a santalol from a santalene, or a bergamotol from a bergamotene.

5. The host cell of claim 1, wherein the nucleic acid molecule comprises a sequence of nucleotides selected from among: (a) a sequence of nucleic acids set forth in any of SEQ ID NO:2, 3, 4, 5, 67, 68, 69, 70, or 71; (b) a sequence of nucleic acids encoding a protein having at least 85% sequence identity to a protein encoded by the sequence of nucleic acids set forth in any of SEQ ID NO:2, 3, 4, 5, 67, 68, 69, 70, or 71; and (c) a sequence of nucleic acids comprising degenerate codons of one or more codons in the sequence of nucleic acids of (a) or (b).

6. The host cell of claim 5, wherein the sequence of nucleic acid has at least 95% sequence identity to a sequence of nucleic acids set forth in any of SEQ ID NO:2, 3, 4, 5, 67, 68, 69, 70, or 71.

7. The host cell of claim 1, comprising a nucleic acid molecule encoding a cytochrome P450 reductase or a catalytically active portion thereof, wherein: (a) the encoded cytochrome P450 reductase or catalytically active portion thereof exhibits at least 95% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13; (b) the encoded cytochrome P450 reductase polypeptide or catalytically active fragment thereof catalyzes transfer of two electrons from NADPH to an electron acceptor; and (c) the nucleic acid molecule is heterologous to the host cell.

8. The host cell of claim 1, further comprising a nucleic acid molecule encoding a santalene synthase comprising the sequence of amino acids set forth in any of SEQ ID NO:17, 52, or 53, or a sequence of amino acids that is at least 95% identical to any of SEQ ID NO:17, 52, or 53, or a catalytically active fragment thereof.

9. The host cell of claim 1, wherein the cell is a prokaryotic cell or an eukaryotic cell.

10. The host cell of claim 1, wherein the cell produces farnesyl diphosphate natively or is modified to produce more farnesyl diphosphate compared to an unmodified cell.

11. A host cell, comprising: (a) a nucleic acid molecule encoding a cytochrome P450 oxidase polypeptide or a catalytically active portion thereof, wherein: the encoded cytochrome P450 oxidase polypeptide or catalytically active portion thereof exhibits at least 85% sequence identity to SEQ ID NO:6, 7, 8, 9, 50, 74, 75, 76, or 77; and (ii) the encoded cytochrome P450 oxidase polypeptide or catalytically active fragment thereof catalyzes hydroxylation or monooxygenation of santalene and/or bergamotene; (b) a nucleic acid molecule encoding a cytochrome P450 reductase or catalytically active portion thereof, wherein the encoded cytochrome P450 reductase or catalytically active portion thereof comprises the sequence of amino acids set forth in SEQ ID NO:12 or 13, or a sequence of amino acids that has at least 95% sequence identity to a cytochrome P450 reductase polypeptide set forth in SEQ ID NO:12 or 13; and (c) a nucleic acid molecule encoding a santalene synthase, wherein the encoded santalene synthase comprises the sequence of amino acids set forth in any of SEQ ID NO:17, 52, or 53 or a sequence of amino acids that is at least 95% identical to any of SEQ ID NO:17, 52, or 53 or a catalytically active fragment thereof, wherein: at least one of the nucleic acid molecules set forth in (a) or (b) is heterologous to the host cell.

12. The host cell of claim 11, wherein the cell is a prokaryotic cell or an eukaryotic cell.

13. The host cell of claim 11, wherein the cell produces farnesyl diphosphate natively or is modified to produce more farnesyl diphosphate compared to an unmodified cell.

14. An isolated nucleic acid molecule encoding a cytochrome P450 oxidase polypeptide or a catalytically active portion thereof, wherein: (a) the nucleic acid molecule is cDNA; (b) the encoded cytochrome P450 oxidase polypeptide or catalytically active portion thereof exhibits at least 85% sequence identity to SEQ ID NO:6, 7, 8, 9, 50, 74, 75, 76, or 77; and (c) the encoded cytochrome P450 oxidase or catalytically active fragment thereof catalyzes hydroxylation or monooxygenation of santalene and/or bergamotene.

15. The nucleic acid molecule of claim 14, wherein the encoded cytochrome P450 oxidase polypeptide exhibits at least 95% sequence identity to SEQ ID NO:6, 7, 8, 9, 50, 74, 75, 76, or 77.

16. A vector, comprising the nucleic acid molecule of claim 14.

17. A host cell, comprising a vector of claim 16.

18. A method for producing a cytochrome P450 oxidase polypeptide or a catalytically active fragment thereof, comprising: (a) culturing the cells of claim 1 under conditions suitable for expression of the cytochrome P450 oxidase polypeptide; and (b) optionally isolating the cytochrome P450 oxidase polypeptide.

19. A method for producing a santalol, bergamotol and/or mixtures thereof, comprising: (a) culturing a host cell of claim 11 under conditions suitable for the formation of a santalol, bergamotol and/or mixtures thereof; wherein the host cell of claim 11 expresses the nucleic acid molecules of part (a), (b) and (c); and (b) optionally isolating the santalol, bergamotol and/or mixtures thereof.

20. The host cell of claim 1, wherein the encoded cytochrome P450 oxidase polypeptide or catalytically active fragment thereof comprises a sequence of amino acids set forth in SEQ ID NO:7.