Methods and Compositions for Plant Pest Control

Abstract

Provided are methods and compositions to improve fungal disease resistance in various crop plants. Also provided are combinations of compositions and methods to improve fungal disease resistance in various crop plants.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This U.S. Non-provisional patent application claims the benefit of U.S. Provisional Patent Application No. 61/757,291, which was filed Jan. 28, 2013 and is incorporated herein by reference in its entirety.

INCORPORATION OF SEQUENCE LISTING

[0002] A text file of the Sequence Listing contained in the file named "MON58632C_SEQ_LISTING.TXT" which is 94,742 bytes (measured in MS-Windows.RTM.) size and which was created on Jan. 27, 2014, is electronically filed herewith and is incorporated herein by reference in its entirety. This Sequence Listing consists of SEQ ID NO:1-147.

BACKGROUND

[0003] Powdery mildews are fungal diseases that affect a wide range of plants including cereals, grasses, vegetables, ornamentals, weeds, shrubs, fruit trees, broad-leaved shade and forest trees, that is caused by different species of fungi in the order Erysiphales. The disease is characterized by spots or patches of white to grayish, talcum-powder-like growth that produce tiny, pinhead-sized, spherical fruiting structures (the cleistothecia or overwintering bodies of the fungus), that are first white, later yellow-brown and finally black. The fungi that cause powdery mildews are host specific and cannot survive without the proper host plant. They produce mycelium (fungal threads) that grow only on the surface of the plant and feed by sending haustoria, or root-like structures, into the epidermal cells of the plant. The fungi overwinter on plant debris as cleistothecia or mycelia. In the spring, the cleistothecia produce spores that are moved to susceptible hosts by rain, wind or insects.

[0004] Powdery mildew disease is particularly prevalent in temperate and humid climates, where they frequently cause significant yield losses and quality reductions in various agricultural settings including greenhouse and field farming. This affects key cereals (e.g. barley and wheat), horticultural crops (e.g. grapevine, pea and tomato) and economically important ornamentals (e.g. roses). Limited access to natural sources of resistance to powdery mildews, rapid changes in pathogen virulence and the time consuming introgression of suitable resistance genes into elite varieties has led to the widespread use of fungicides to control the disease. This has not surprisingly led to the evolution and spread of fungicide resistance, which is especially dramatic amongst the most economically important powdery mildews.

[0005] Downy mildew diseases are caused by oomycete microbes from the family Peronosporaceae that are parasites of plants. Peronosporaceae are obligate biotrophic plant pathogens and parasitize their host plants as an intercellular mycelium using haustoria to penetrate the host cells. The downy mildews reproduce asexually by forming sporangia on distinctive white sporangiophores usually formed on the lower surface of infected leaves. These constitute the "downy mildew" and the initial symptoms appear on leaves as light green to yellow spots. The sporangia are wind-dispersed to the surface of other leaves. Depending on the genus, the sporangia may germinate by forming zoospores or by germ-tube. In the latter case, the sporangia behave like fungal conidia and are often referred to as such. Sexual reproduction is via oospores.

[0006] Most Peronosporaceae are pathogens of herbaceous dicots. Some downy mildew genera have relatively restricted host ranges, e.g. Basidiophora, Paraperonospora, Protobremia and Bremia on Asteraceae; Perofascia and Hyaloperonospora almost exclusively on Brassicaceae; Viennotia, Graminivora, Poakatesthia, Sclerospora and Peronosclerospora on Poaceae, Plasmoverna on Ranunculaceae. However, the largest genera, Peronospora and Plasmopara, have very wide host ranges.

[0007] Rusts (Pucciniales, formerly Uredinales) are obligate biotrophic parasites of vascular plants. Rusts affect a variety of plants; leaves, stems, fruits and seeds and is most commonly seen as coloured powder, composed of tiny aeciospores which land on vegetation producing pustules, or uredia, that form on the lower surfaces. During late spring or early summer, yellow orange or brown, hairlike or ligulate structures called telia grow on the leaves or emerge from bark of woody hosts. These telia produce teliospores which will germinate into aerial basidiospores, spreading and causing further infection.

SUMMARY

[0008] The present embodiments provide for compositions comprising polynucleotide molecules and methods for treating a plant to alter or regulate gene or gene transcript expression in the plant, for example, by providing RNA or DNA for inhibition of expression. Various aspects provide compositions comprising polynucleotide molecules and related methods for topically applying such compositions to plants to regulate endogenous BAX inhibitor 1 (BI-1) genes in a plant cell. The polynucleotides, compositions, and methods disclosed herein are useful in decreasing levels of BI-1 transcript and improving fungal disease resistance of a plant. Provided herein are compositions and methods that increase plant resistance to powdery mildew, downy mildew, rust infection or other fungal pathogens by suppression of plant BAX inhibitor 1 (BI-1) genes.

[0009] In one aspect, polynucleotide molecules are provided in compositions that can permeate or be absorbed into living plant tissue to initiate localized, partially systemic, or systemic gene inhibition or regulation. In certain embodiments, the polynucleotide molecules ultimately provide to a plant, or allow the in planta production of, RNA that is capable of hybridizing under physiological conditions in a plant cell to RNA transcribed from a target endogenous gene or target transgene in the plant cell, thereby effecting regulation of the endogenous BI-1 target gene. In certain embodiments, regulation of the BI-1 target genes, such as by silencing or suppression of the target gene, leads to the upregulation of another gene that is itself affected or regulated by decreasing the BI-1 target gene's expression.

[0010] In certain aspects or embodiments, the topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant or plant part according to the methods described herein does not necessarily result in nor require the exogenous polynucleotide's integration into a chromosome of the plant. In certain aspects or embodiments, the topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant or plant part according to the methods described herein does not necessarily result in nor require transcription of the exogenous polynucleotide from DNA integrated into a chromosome of the plant. In certain embodiments, topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant according to the methods described herein also does not necessarily require that the exogenous polynucleotide be physically bound to a particle, such as in biolistic mediated introduction of polynucleotides associated with a gold or tungsten particles into internal portions of a plant, plant part, or plant cell. An exogenous polynucleotide used in certain methods and compositions provided herein can optionally be associated with an operably linked promoter sequence in certain embodiments of the methods provided herein. However, in other embodiments, an exogenous polynucleotide used in certain methods and compositions provided herein is not associated with an operably linked promoter sequence. Also, in certain embodiments, an exogenous polynucleotide used in certain methods and compositions provided herein is not operably linked to a viral vector.

[0011] In certain embodiments, methods for improving fungal disease resistance in a plant comprising topically applying compositions comprising a polynucleotide and a transfer agent that suppress the target BI-1 gene are provided. In certain embodiments, methods for selectively suppressing the target BI-1 gene by topically applying the polynucleotide composition to a plant surface at one or more selected seed, vegetative, or reproductive stage(s) of plant growth are provided. Such methods can provide for gene suppression in a plant or plant part on an as needed or as desired basis. In certain embodiments, methods for selectively suppressing the target BI-1 gene by topically applying the polynucleotide composition to a plant surface at one or more pre-determined seed, vegetative, or reproductive stage(s) of plant growth are provided. Such methods can provide for BI-1 gene suppression in a plant or plant part that obviates any undesired or unnecessary effects of suppressing the genes expression at certain seed, vegetative, or reproductive stage(s) of plant development.

[0012] In certain embodiments, methods for selectively improving fungal disease resistance in a plant by topically applying the polynucleotide composition to the plant surface at one or more selected seed, vegetative, or reproductive stage(s) are provided. Such methods can provide for improved fungal disease resistance in a plant or plant part on an as needed or as desired basis. In certain embodiments, methods for selectively improving fungal disease resistance in a plant by topically applying the polynucleotide composition to the plant surface at one or more predetermined seed, vegetative, or reproductive stage(s) are provided. Such methods can provide for improving fungal disease resistance in a plant or plant part that obviates any undesired or unnecessary effects of suppressing BI-1 gene expression at certain seed, vegetative, or reproductive stage(s) of plant development.

[0013] Methods and compositions that provide for the topical application of certain polynucleotides in the presence of transfer agents can be used to suppress BAX inhibitor 1 (BI-1) gene expression in an optimal manner. Topically induced BI-1 gene suppression methods and compositions provided herein can control the timing and degree of BI-1 knockdown to achieve fungal control while minimizing deleterious pleotropic effects in the host plant. In certain embodiments, the compositions provided herein can be applied on an "as needed" basis upon scouting for the occurrence of fungal disease. In certain embodiments, the compositions can be applied in a manner that obviates any deleterious effects on yield or other characteristics that can be associated with suppression of BI-1 gene expression in a crop plant. The applied polynucleotides are complementary to the BI-1 target host gene in plants and their topical application leads to suppression of the BI-1 gene.

[0014] Provided herein are compositions and methods for controlling plant fungal diseases. Plant fungal diseases that can be controlled with the methods and compositions provided herein include, but are not limited to, obligate biotrophic powdery mildew, downy mildew, and rust fungal infestations in plants. Plant fungal diseases that can be controlled with the methods and compositions provided herein also include, but are not limited to, fungal pathogens such as those causing anthracnose stalk rot, Diplodia Stalk or Ear Rot, Gibberella Stalk or Ear Rot, and Fusarium Stalk Rot in corn, or causing Take-all in wheat, Fusarium head blight in barley and wheat, or causing rice blast. In certain embodiments, methods and compositions for reducing expression of one or more host plant BI-1 polynucleotide and/or protein molecules in one or more cells or tissues of the plant such that the plant is rendered less susceptible to fungal infections from the order Erysiphales, the family Peronosporaceae or the order Pucciniales, are provided. In certain embodiments, nucleotide and amino acid sequences of plant BAX inhibitor 1 (BI-1) genes which can be downregulated by methods and compositions provided herein to increase plant resistance to powdery mildew, downy mildew, rust infection, or fungal pathogens such as those causing anthracnose stalk rot, Diplodia Stalk or Ear Rot, Gibberella Stalk or Ear Rot, and Fusarium Stalk Rot in corn, or causing Take-all in wheat, Fusarium head blight in barley and wheat, or causing rice blast are disclosed. Examples of powdery mildew fungi of the order Erysiphales which are controlled by the compositions and methods provided herein include, but are not limited to, Blumeria graminis f. sp. hordei, Blumeria graminis forma specialis (f. sp.) tritici, Golovinomyces orontii, Golovinomyces cichoracearum, Oidium neolycopersici, Oidium lycopersici, Erysiphe pisi, Erisyphe necator and Sphaerotheca fuliginea among others. Examples of downy mildew of the family Peronosporaceae include Pseudoperonospora humuli, Pseudoperonospora cubensis, Plasmopara viticola, Peronospora tabacina, Bremia lactucae, and Plasmopara halstedii. Examples of rusts of the order Pucciniales which are controlled by the compositions and methods provided herein include, but are not limited to, Phakopsora meibomiae, Phakopsora pachyrhizi, Puccinia graminis, Puccinia recondita, Uromyces phaseoli and Uromyces appendeculatus. Other examples of fungal pathogens which are controlled by the compositions and methods provided herein include, but are not limited to, Colletotrichum graminicola, Stenocarpella (or Diplodia) maydis, Gibberella zeae, Fusarium moniliforme, Gaeumannomyces graminis, Fusarium graminearum, Magnaporthe grisea (also known as Pyricularia grisea or Pyricularia oryzae), Septoria nodorum, and Septoria tritici.

[0015] Examples of plants protected by the compositions and methods provided herein include, but are not limited to, barley, rye, wheat, rice, oats, corn, sorghum, switchgrass, and sugar cane.

[0016] Also provided are methods and compositions where topically induced reductions in BI-1 transcript or protein levels are used to achieve fungal disease control while minimizing deleterious pleotropic effects in the host plant. Such methods and compositions provide for optimized levels of BI-1 gene inhibition and/or optimized timing of BI-1 gene inhibition.

[0017] Polynucleotides that can be used to suppress a BI-1 include, but are not limited to, any of: i) polynucleotides comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or to a transcript of the gene of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32 or Example 5; or ii) polynucleotides comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a polynucleotide of SEQ ID NO:33-106, 109-140, or 142-146 as provided herein.

[0018] Certain embodiments are directed to a method for producing a plant exhibiting an improvement in fungal disease resistance comprising topically applying to a plant surface a composition that comprises:

a. at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene; and b. a transfer agent, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments of the methods, the polynucleotide molecule comprises sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA. In certain embodiments of the methods, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: (a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments of the methods, the composition comprises any combination of two or more polynucleotide molecules. In certain embodiments of the methods, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the methods, the composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments of the methods, the composition further comprises a non-polynucleotide herbicidal molecule and the plant is resistant to the herbicidal molecule. In certain embodiments of the methods, the transfer agent comprises an organosilicone preparation. In certain embodiments of the methods, the polynucleotide is not operably linked to a viral vector. In certain embodiments of the methods, the polynucleotide is not integrated into the plant chromosome.

[0019] Further embodiments are directed to: a plant made according to the above-described methods; progeny of the plant that exhibit fungal disease resistance; seed of the plant, wherein seed from the plant exhibits fungal disease resistance; and a processed product of the plant, the progeny plant, or the seed, wherein the processed product exhibits fungal disease resistance. In certain embodiments, the processed product exhibits an improved attribute relative to a processed product of an untreated control plant and the improved attribute results from the improved fungal disease resistance. An improved attribute of a processed product can include, but is not limited to, decreased mycotoxin content, improved nutritional content, improved storage characteristics, improved flavor, improved consistency, and the like when compared to a processed product obtained from an untreated plant or plant part.

[0020] Additional embodiments are directed to compositions comprising a polynucleotide molecule that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the polynucleotide is not operably linked to a promoter; and, b) a transfer agent. In certain embodiments of the composition, the polynucleotide is selected from the group consisting of wherein the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the composition: (a) the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments of the composition, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the composition, the composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments of the composition, the transfer agent is an organosilicone preparation. In certain embodiments of the composition, the polynucleotide is not physically bound to a biolistic particle.

[0021] Other embodiments are directed to a method of making a composition comprising the step of combining at least: a) a polynucleotide molecule comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of a plant, wherein the polynucleotide is not operably linked to a promoter or a viral vector; and, b) a transfer agent. In certain embodiments of the methods, the polynucleotide is obtained by in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, the methods further comprises combining with the polynucleotide and the transfer agent at least one of a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, an insecticide, a fungicide, and/or a nematocide. In certain embodiments of the methods, the transfer agent is an organosilicone preparation.

[0022] Yet another embodiment is directed to a method of identifying a polynucleotide for improving fungal disease resistance in a plant comprising; a) selecting a population of polynucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of a plant; b) topically applying to a surface of at least one of the plants a composition comprising at least one polynucleotide from the population and an transfer agent to obtain a treated plant; and, c) identifying a treated plant that exhibits suppression of the BAX inhibitor 1 (BI-1) gene or exhibits an improvement in fungal disease resistance, thereby identifying a polynucleotide that improves fungal disease resistance in the plant. In certain embodiments of the methods, the polynucleotide is selected from the group consisting of wherein the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

[0023] A further embodiment is directed to a plant comprising an exogenous polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the exogenous polynucleotide is not operably linked to a promoter or to a viral vector, is not integrated into the chromosomal DNA of the plant, and is not found in a non-transgenic plant; and, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the plant further comprises an organosilicone compound or a component thereof. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

[0024] An additional embodiment is directed to a plant part comprising an exogenous polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the exogenous polynucleotide is not operably linked to a promoter or to a viral vector and is not found in a non-transgenic plant; and, wherein the plant part exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the plant part further comprises an organosilicone compound or a component thereof. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: a) the plant part is a barley plant part, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant part is a rice plant part, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant part is a wheat plant part, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant part is a soybean plant part, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant part is a corn plant part, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant part is a sorghum plant part, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant part is a pepper plant part, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant part is a grape plant part, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant part is a tomato plant part, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant part is a lettuce plant part, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant part is a cucumber plant part, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant part is a cotton plant part, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the plant part is a flower, meristem, ovule, stem, tuber, fruit, anther, pollen, leaf, root, or seed. In certain embodiments, the plant part is a seed. Also provided are processed plant products obtained from the plant parts that exhibit an improved attribute relative to a processed plant product of an untreated control plant and wherein the improved attribute results from the improved disease tolerance. In certain embodiments, the processed product is a meal, a pulp, a feed, or a food product.

[0025] Another embodiment is directed to a plant that exhibits an improvement in fungal disease resistance, wherein the plant was topically treated with a composition that comprises: a. at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene; and, b. a transfer agent; and, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the transfer agent is an organosilicone preparation.

[0026] Certain embodiments are directed to a method for providing a seed that produces a plant exhibiting an improvement in fungal disease resistance comprising: a) soaking the seed in a liquid composition that comprises at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene, wherein the seed produces a plant exhibiting an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In some embodiments, the liquid composition further comprises a transfer agent. In certain embodiments, the polynucleotide comprises sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: (a) the seed is a barley seed, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the seed is a rice seed, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the seed is a wheat seed, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the seed is a soybean seed, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the seed is a corn seed, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the seed is a sorghum seed, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the seed is a pepper seed, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the seed is a grape seed, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the seed is a tomato seed, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the seed is a lettuce seed, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the seed is a cucumber seed, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the seed is a cotton seed, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the liquid composition comprises any combination of two or more polynucleotide molecules. In certain embodiments, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the methods, the composition further comprises an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments, the transfer agent comprises an organosilicone preparation. In certain embodiments, the polynucleotide is not operably linked to a viral vector. In certain embodiments, the polynucleotide is not integrated into the plant chromosome.

[0027] Further embodiments are directed to: a plant grown from a seed treated according to the above-described methods; progeny of the plant that exhibit fungal disease resistance; seed of the plant, wherein seed from the plant exhibits fungal disease resistance; and a processed product of the plant, the progeny plant, or the seed, wherein the processed product exhibits fungal disease resistance. In certain embodiments, the processed product exhibits an improved attribute relative to a processed product of an untreated control plant and the improved attribute results from the improved fungal disease resistance. An improved attribute of a processed product can include, but is not limited to, decreased mycotoxin content, improved nutritional content, improved storage characteristics, improved flavor, improved consistency, and the like when compared to a processed product obtained from an untreated plant or plant part.

[0028] Also provided herein are transgenic plants, plant parts, plant cells, and processed plant products containing a transgene comprising a heterologous promoter that is operably linked to a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or transcript of the BI-1 gene. Such transgenes can be integrated into the genome of the transgenic plant or provided in recombinant viral genomes that can be propagated in the plant. In certain embodiments, the transgene confers an improvement in fungal disease resistance and/or nematode resistance to the transgenic plants or plant parts that contain the transgene. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a polynucleotide selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146 or comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or to a transcript of the gene of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: (a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the transgenic plant part is a flower, meristem, ovule, stem, tuber, fruit, anther, pollen, leaf, root, or seed. Processed plant products containing the transgene include, but are not limited to, a meal a pulp, a feed, or a food product obtainable from the transgenic plant parts. In certain embodiments, the processed plant products exhibit an improved attribute relative to a processed plant product of an untreated control plant and wherein the improved attribute results from the improved fungal disease resistance and/or nematode resistance conferred by the transgene. In certain embodiments, the processed product is a meal, a pulp, a feed, or a food product. Also provided herein are methods for obtaining transgenic plants exhibiting an improvement in fungal disease resistance and/or nematode resistance comprising the steps of introducing any of the aforementioned transgenes into the genome of a plant and selecting for a transgenic plant wherein expression of an endogenous BAX inhibitor 1 (BI-1) gene is suppressed, thereby obtaining a plant exhibiting an improvement in fungal disease resistance and/or nematode resistance. Also provided herein are methods for improving fungal disease resistance and/or nematode resistance in plants that comprise growing transgenic plants comprising any of the aforementioned transgenes wherein expression of an endogenous BI-1 gene is suppressed in the presence of fungi and/or nematodes, wherein fungal disease resistance and/or nematode resistance of the transgenic plants is improved in comparison to a control plant that lack a transgene that suppresses an endogenous BI-1 gene in the control plant.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1A, B. Panel A. shows a graph of cyst counts for Soy Cyst Nematode (SCN) disease measurement at twenty eight days after treatment and inoculation with SCN. Panel B. shows a graph of gall weights.

[0030] FIG. 2. presents the gall rating results for Root Knot Nematode (RKN) disease measured as % root mass galled for dsRNA treatments (or controls) followed by inoculation with vermiform eggs.

DETAILED DESCRIPTION

I. Definitions

[0031] The following definitions and methods are provided to better define the present embodiments and to guide those of ordinary skill in the art in the practice of the present embodiments. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0032] Where a term is provided in the singular, the inventors also contemplate aspects described by the plural of that term.

[0033] As used herein, the terms "DNA," "DNA molecule," and "DNA polynucleotide molecule" refer to a single-stranded DNA or double-stranded DNA molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule.

[0034] As used herein, the terms "DNA sequence," "DNA nucleotide sequence," and "DNA polynucleotide sequence" refer to the nucleotide sequence of a DNA molecule.

[0035] As used herein, the term "gene" refers to any portion of a nucleic acid that provides for expression of a transcript or encodes a transcript. A "gene" thus includes, but is not limited to, a promoter region, 5' untranslated regions, transcript encoding regions that can include intronic regions, and 3' untranslated regions.

[0036] As used herein, the terms "RNA," "RNA molecule," and "RNA polynucleotide molecule" refer to a single-stranded RNA or double-stranded RNA molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions.

[0037] Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5' to 3' direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations .sctn. 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.

[0038] As used herein, a "plant surface" refers to any exterior portion of a plant. Plant surfaces thus include, but are not limited to, the surfaces of flowers, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. A plant surface can be on a portion of a plant that is attached to other portions of a plant or on a portion of a plant that is detached from the plant.

[0039] As used herein, the phrase "polynucleotide is not operably linked to a promoter" refers to a polynucleotide that is not covalently linked to a polynucleotide promoter sequence that is specifically recognized by either a DNA dependent RNA polymerase II protein or by a viral RNA dependent RNA polymerase in such a manner that the polynucleotide will be transcribed by the DNA dependent RNA polymerase II protein or viral RNA dependent RNA polymerase. A polynucleotide that is not operably linked to a promoter can be transcribed by a plant RNA dependent RNA polymerase.

[0040] As used herein, SEQ ID NO:, though displayed in the Sequence Listing in the form of ssDNA or ssRNA, encompass dsDNA equivalents, dsRNA equivalents, ssRNA as shown or equivalents, ssRNA complements, ssDNA as shown or equivalents, and ssDNA complements.

[0041] As used herein, a first nucleic-acid sequence is "operably" connected or "linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an RNA and/or protein-coding sequence if the promoter provides for transcription or expression of the RNA or coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, are in the same reading frame.

[0042] As used herein, the phrase "organosilicone preparation" refers to a liquid comprising one or more organosilicone compounds, wherein the liquid or components contained therein, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enable the polynucleotide to enter a plant cell. Examples of organosilicone preparations include, but are not limited to, preparations marketed under the trade names "Silwet.RTM." or "BREAK-THRU.RTM." and preparations provided in Table 1. In certain embodiments, an organosilicone preparation can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide suppression of target gene expression in the plant cell.

[0043] As used herein, the phrase "provides for an improvement in fungal disease resistance" refers to any measurable increase in a plants resistance to fungal damage. In certain embodiments, an improvement in fungal disease resistance in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant is a plant that has not undergone treatment with polynucleotide and a transfer agent. Such control plants would include, but are not limited to, untreated plants or mock treated plants.

[0044] As used herein, the phrase "provides for a reduction", when used in the context of a transcript or a protein in a plant or plant part, refers to any measurable decrease in the level of transcript or protein in a plant or plant part. In certain embodiments, a reduction of the level of a transcript in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.

[0045] As used herein, the phrase "wherein said plant does not comprise a transgene" refers to a plant that lacks either a DNA molecule comprising a promoter that is operably linked to a polynucleotide or a recombinant viral vector.

[0046] As used herein, the phrase "suppressing expression" or "suppression", when used in the context of a gene, refers any measurable decrease in the amount and/or activity of a product encoded by the gene. Thus, expression of a gene can be suppressed when there is a reduction in levels of a transcript from the gene, a reduction in levels of a protein encoded by the gene, a reduction in the activity of the transcript from the gene, a reduction in the activity of a protein encoded by the gene, any one of the preceding conditions, or any combination of the preceding conditions. In this context, the activity of a transcript includes, but is not limited to, its ability to be translated into a protein and/or to exert any RNA-mediated biologic or biochemical effect. In this context, the activity of a protein includes, but is not limited to, its ability to exert any protein-mediated biologic or biochemical effect. In certain embodiments, a suppression of gene expression in a plant or plant part can be determined in a comparison of gene product levels or activities in a treated plant to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.

[0047] As used herein, the term "transcript" corresponds to any RNA that is produced from a gene by the process of transcription. A transcript of a gene can thus comprise a primary transcription product which can contain introns or can comprise a mature RNA that lacks introns.

[0048] As used herein, the term "liquid" refers to both homogeneous mixtures such as solutions and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.

II. Overview

[0049] The hypersensitive reaction (HR) in plants is a form of programmed cell death involved in many developmental processes and stress responses including disease resistance to pathogens.

[0050] The protein BAX inhibitor 1 (BI-1), localized at the endoplasmic reticulum and the nuclear envelope in both plants and animals, is a negative regulator of programmed cell death. The silencing of BAX inhibitor 1 increases the resistance of barley to powdery mildew infection.

[0051] Provided herein are certain methods and polynucleotide compositions that can be applied to living plant cells/tissues to suppress expression of target genes and that provide improved fungal disease resistance to a crop plant. Also provided herein are plants and plant parts exhibiting fungal disease resistance as well as processed products of such plants or plant parts. The compositions may be topically applied to the surface of a plant, such as to the surface of a leaf, and include a transfer agent. Aspects of the method can be applied to various crops, for example, including but not limited to: i) row crop plants including, but are not limited to, corn, barley, sorghum, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) that include fruit trees and plants. Fruit trees produced by such processes include, but are not limited to, citrus and apple trees. Plants produced by such processes include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants.

[0052] Without being bound by theory, the compositions and methods of the present embodiments are believed to operate through one or more of the several natural cellular pathways involved in RNA-mediated gene suppression as generally described in Brodersen and Voinnet (2006), Trends Genetics, 22:268-280; Tomari and Zamore (2005) Genes & Dev., 19:517-529; Vaucheret (2006) Genes Dev., 20:759-771; Meins et al. (2005) Annu. Rev. Cell Dev. Biol., 21:297-318; and Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53. RNA-mediated gene suppression generally involves a double-stranded RNA (dsRNA) intermediate that is formed intra-molecularly within a single RNA molecule or inter-molecularly between two RNA molecules. This longer dsRNA intermediate is processed by a ribonuclease of the RNAase III family (Dicer or Dicer-like ribonuclease) to one or more shorter double-stranded RNAs, one strand of which is incorporated into the RNA-induced silencing complex ("RISC"). For example, the siRNA pathway involves the cleavage of a longer double-stranded RNA intermediate to small interfering RNAs ("siRNAs"). The size of siRNAs is believed to range from about 19 to about 25 base pairs, but the most common classes of siRNAs in plants include those containing 21 to 24 base pairs (See, Hamilton et al. (2002) EMBO J., 21:4671-4679).

Polynucleotides

[0053] As used herein, "polynucleotide" refers to a DNA or RNA molecule containing multiple nucleotides and generally refers both to "oligonucleotides" (a polynucleotide molecule of 18-25 nucleotides in length) and longer polynucleotides of 26 or more nucleotides. Embodiments include compositions including oligonucleotides having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (e. g., polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a target gene including coding or non-coding or both coding and non-coding portions of the target gene). Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs.

[0054] Polynucleotide compositions used in the various embodiments include compositions including oligonucleotides, polynucleotides, or a mixture of both, including: RNA or DNA or RNA/DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In certain embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In certain embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In certain embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, U.S. Patent Publication 2011/0171287, U.S. Patent Publication 2011/0171176, U.S. Patent Publication 2011/0152353, U.S. Patent Publication 2011/0152346, and U.S. Patent Publication 2011/0160082, which are herein incorporated by reference. Illustrative examples include, but are not limited to, the naturally occurring phosphodiester backbone of an oligonucleotide or polynucleotide which can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in oligonucleotide or polynucleotide synthesis, and oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (e. g., fluorescein or rhodamine) or other label (e. g., biotin).

[0055] Polynucleotides can be single- or double-stranded RNA, single- or double-stranded DNA, double-stranded DNA/RNA hybrids, and modified analogues thereof. In certain embodiments, the polynucleotides that provide single-stranded RNA in the plant cell may be: (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, and (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In certain embodiments, these polynucleotides can comprise both ribonucleic acid residues and deoxyribonucleic acid residues. In certain embodiments, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In certain embodiments of the methods, the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In certain embodiments where the polynucleotide is a dsRNA, the anti-sense strand will comprise at least 18 nucleotides that are essentially complementary to the target gene. In certain embodiments the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. In certain embodiments, the polynucleotides can be operably linked to a promoter--generally a promoter functional in a plant, for example, a pol II promoter, a pol III promoter, a pol IV promoter, or a pol V promoter.

[0056] The polynucleotide molecules of the present embodiments are designed to modulate expression by inducing regulation or suppression of an endogenous gene in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene of a plant or to the sequence of RNA transcribed from an endogenous gene of a plant, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to herein as "a trigger, or triggers". By "essentially identical" or "essentially complementary" it is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide) have sufficient identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (e.g. the transcript) to suppress expression of the endogenous gene (e.g. to effect a reduction in levels or activity of the gene transcript and/or encoded protein). Polynucleotides of the methods and compositions provided herein need not have 100 percent identity to a complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (i.e. the transcript) to suppress expression of the endogenous gene (i.e. to effect a reduction in levels or activity of the gene transcript or encoded protein). Thus, in certain embodiments, the polynucleotide or a portion thereof is designed to be essentially identical to, or essentially complementary to, a sequence of at least 18 or 19 contiguous nucleotides in either the target gene or messenger RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an "essentially identical" polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides in either the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an "essentially complementary" polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene.

[0057] In certain embodiments, polynucleotides used in the methods and compositions provided herein can be essentially identical or essentially complementary to any of: i) conserved regions of BAX inhibitor 1 (BI-1) genes of both monocot and dicot plants; ii) conserved regions of BAX inhibitor 1 (BI-1) genes of monocot plants; or iii) conserved regions of BAX inhibitor 1 (BI-1) genes of dicot plants. Such polynucleotides that are essentially identical or essentially complementary to such conserved regions can be used to improve fungal disease resistance by suppressing expression of BAX inhibitor 1 (BI-1) genes in any of: i) both dicot and monocot plants, including, but not limited to, corn, barley, wheat, sorghum, rice, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape; ii) monocot plants, including, but not limited to, corn, barley, wheat, sorghum, switchgrass, and rice, and; or iii) dicot plants, including, but not limited to, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape. Conserved regions of dicot and monocot plant BAX inhibitor 1 (BI-1) genes of SEQ ID NO: 2, 4, 6, 7, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32 can be targeted by essentially identical or essentially complementary polynucleotides.

[0058] Polynucleotides containing mismatches to the target gene or transcript can thus be used in certain embodiments of the compositions and methods provided herein. In certain embodiments, a polynucleotide can comprise at least 19 contiguous nucleotides that are essentially identical or essentially complementary to said gene or said transcript or comprises at least 19 contiguous nucleotides that are essentially identical or essentially complementary to the target gene or target gene transcript. In certain embodiments, a polynucleotide of 19 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 20 or more nucleotides that contains a contiguous 19 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 21 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1, 2, or 3 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 22 or more nucleotides that contains a contiguous 21 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1, 2, or 3 mismatches to the target gene or transcript. In designing polynucleotides with mismatches to an endogenous target gene or to an RNA transcribed from the target gene, mismatches of certain types and at certain positions that are more likely to be tolerated can be used. In certain embodiments, mismatches formed between adenine and cytosine or guanosine and uracil residues are used as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. In certain embodiments, mismatches in 19 base pair overlap regions can be at the low tolerance positions 5, 7, 8 or 11 (from the 5' end of a 19 nucleotide target) with well tolerated nucleotide mismatch residues, at medium tolerance positions 3, 4, and 12-17, and/or at the high tolerance nucleotide positions at either end of the region of complementarity (i.e. positions 1, 2, 18, and 19) as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. It is further anticipated that tolerated mismatches can be empirically determined in assays where the polynucleotide is applied to the plants via the methods provided herein and the treated plants assayed for suppression of BAX inhibitor 1 (BI-1) expression or appearance of fungal disease resistance.

[0059] In certain embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene coding or non-coding sequence of a BI-1 target gene. In other embodiments, the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given BAX inhibitor 1 (BI-1) target gene. In certain embodiments, the polynucleotide can thus comprise at least 18 contiguous nucleotides that are identical or complementary to SEQ ID NO: 33-106, 108-140, or 142-146. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.

[0060] In certain embodiments, polynucleotide compositions and methods provided herein typically effect regulation or modulation (e. g., suppression) of gene expression during a period during the life of the treated plant of at least 1 week or longer and typically in systemic fashion. For instance, within days of treating a plant leaf with a polynucleotide composition as described herein, primary and transitive siRNAs can be detected in other leaves lateral to and above the treated leaf and in apical tissue. In certain embodiments, methods of systemically suppressing expression of a gene in a plant, the methods comprising treating said plant with a composition comprising at least one polynucleotide and a transfer agent, wherein said polynucleotide comprises at least 18 or at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a gene or a transcript encoding a BAX inhibitor 1 (BI-1) gene of the plant are provided, whereby expression of the gene in said plant or progeny thereof is systemically suppressed in comparison to a control plant that has not been treated with the composition.

[0061] Compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple genes, or to multiple segments of one or more genes. In certain embodiments, compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.

[0062] In certain embodiments, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in tandem fashion. In another embodiment, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in inverted repeat fashion (forming an at least partially self-complementary strand). The polynucleotide can include both tandem and inverted-repeat copies. Whether arranged in tandem or inverted repeat fashion, each copy can be directly contiguous to the next, or pairs of copies can be separated by an optional spacer of one or more nucleotides. The optional spacer can be unrelated sequence (i. e., not essentially identical to or essentially complementary to the copies, nor essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides of the endogenous target gene or RNA transcribed from the endogenous target gene). Alternatively the optional spacer can include sequence that is complementary to a segment of the endogenous target gene adjacent to the segment that is targeted by the copies. In certain embodiments, the polynucleotide includes two copies of a nucleotide sequence of between about 20 to about 30 nucleotides, where the two copies are separated by a spacer no longer than the length of the nucleotide sequence.

Tiling

[0063] Polynucleotide trigger molecules can be identified by "tiling" gene targets in random length fragments, e.g. 200-300 polynucleotides in length, with partially overlapping regions, e.g. 25 or so nucleotide overlapping regions along the length of the target gene. Multiple gene target sequences can be aligned and polynucleotide sequence regions with homology in common are identified as potential trigger molecules for multiple targets. Multiple target sequences can be aligned and sequence regions with poor homology are identified as potential trigger molecules for selectively distinguishing targets. To selectively suppress a single gene, trigger sequences may be chosen from regions that are unique to the target gene either from the transcribed region or the non-coding regions, e.g., promoter regions, 3' untranslated regions, introns and the like.

[0064] Polynucleotides fragments are designed along the length of the full length coding and untranslated regions of a BI-1 gene or family member as contiguous overlapping fragments of 200-300 polynucleotides in length or fragment lengths representing a percentage of the target gene. These fragments are applied topically (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine the relative effectiveness in providing the fungal disease resistance phenotype. Fragments providing the desired activity may be further subdivided into 50-60 polynucleotide fragments which are evaluated for providing the fungal disease resistance phenotype. The 50-60 base fragments with the desired activity may then be further subdivided into 19-30 base fragments which are evaluated for providing the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or in combination in one or more pools to determine effective trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

[0065] Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the least homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in providing the fungal disease resistance phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by least homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by least homology, and again evaluated for induction of the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or again evaluated in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

[0066] Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the most homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the fungal disease resistance phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by most homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by most homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments may be utilized singly, or in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

[0067] Also, provided herein are methods for identifying a preferred polynucleotide for improving fungal disease in a plant. Populations of candidate polynucleotides that are essentially identical or essentially complementary to a BI-1 gene or transcript of the gene can be generated by a variety of approaches, including but not limited to, any of the tiling, least homology, or most homology approaches provided herein. Such populations of polynucleotides can also be generated or obtained from any of the polynucleotides or genes provided herewith in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33-106, 108-140, or 142-146. Such populations of polynucleotides can also be generated or obtained from any genes that are orthologous to the genes or proteins provided herewith as SEQ ID NO: 1-32. Such polynucleotides can be topically applied to a surface of plants in a composition comprising at least one polynucleotide from said population and a transfer agent to obtain treated plants. Treated plants that exhibit suppression of the BI-1 gene and/or exhibit an improvement in fungal disease resistance are identified, thus identifying a preferred polynucleotide that improves fungal disease in a plant. Suppression of the gene can be determined by any assay for the levels and/or activity of a gene product (i.e. transcript or protein). Suitable assays for transcripts include, but are not limited to, semi-quantitative or quantitative reverse transcriptase PCR.RTM. (qRT-PCR) assays. Suitable assays for proteins include, but are not limited to, semi-quantitative or quantitative immunoassays, biochemical activity assays, or biological activity assays. In certain embodiments, the polynucleotides can be applied alone. In other embodiments, the polynucleotides can be applied in pools of multiple polynucleotides. When a pool of polynucleotides provides for suppression of the BI-1 gene and/or an improvement in fungal disease resistance are identified, the pool can be de-replicated and retested as necessary or desired to identify one or more preferred polynucleotide(s) that improves fungal disease resistance in a plant.

[0068] Methods of making polynucleotides are well known in the art. Such methods of making polynucleotides can include in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, RNA molecules can be made by either in vivo or in vitro synthesis from DNA templates where a suitable promoter is operably linked to the polynucleotide and a suitable DNA-dependent RNA polymerase is provided. DNA-dependent RNA polymerases include, but are not limited to, E. coli or other bacterial RNA polymerases as well as the bacteriophage RNA polymerases such as the T7, T3, and SP6 RNA polymerases. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3' end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5' end that encodes a bacteriophage T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA. Alternatively, dsRNA molecules can be produced from expression cassettes in bacterial cells that have regulated or deficient RNase III enzyme activity. Long polynucleotide molecules can also be assembled from multiple RNA or DNA fragments. In some embodiments design parameters such as Reynolds score (Reynolds et al. Nature Biotechnology 22, 326-330 (2004) and Tuschl rules (Pei and Tuschl, Nature Methods 3(9): 670-676, 2006) are known in the art and are used in selecting polynucleotide sequences effective in gene silencing. In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.

[0069] While there is no upper limit on the concentrations and dosages of polynucleotide molecules that can be useful in the methods and compositions provided herein, lower effective concentrations and dosages will generally be sought for efficiency. The concentrations can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. In one embodiment, a useful treatment for herbaceous plants using 25-mer polynucleotide molecules is about 1 nanomole (nmol) of polynucleotide molecules per plant, for example, from about 0.05 to 1 nmol polynucleotides per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of polynucleotides per plant. In certain embodiments, about 40 to about 50 nmol of a ssDNA polynucleotide are applied. In certain embodiments, about 0.5 nmol to about 2 nmol of a dsRNA is applied. In certain embodiments, a composition containing about 0.5 to about 2.0 mg/mL, or about 0.14 mg/mL of dsRNA or ssDNA (21-mer) is applied. In certain embodiments, a composition of about 0.5 to about 1.5 mg/mL of a long dsRNA polynucleotide (i.e. about 50 to about 200 or more nucleotides) is applied. In certain embodiments, about 1 nmol to about 5 nmol of a dsRNA is applied to a plant. In certain embodiments, the polynucleotide composition as topically applied to the plant contains the at least one polynucleotide at a concentration of about 0.01 to about 10 milligrams per milliliter, or about 0.05 to about 2 milligrams per milliliter, or about 0.1 to about 2 milligrams per milliliter. Very large plants, trees, or vines may require correspondingly larger amounts of polynucleotides. When using long dsRNA molecules that can be processed into multiple oligonucleotides, lower concentrations can be used. To illustrate certain embodiments, the factor 1.times., when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of polynucleotide molecule per plant; 10.times., 8 nmol of polynucleotide molecule per plant; and 100.times., 80 nmol of polynucleotide molecule per plant.

[0070] The polynucleotide compositions of certain embodiments are useful in compositions, such as liquids that comprise polynucleotide molecules, alone or in combination with other components either in the same liquid or in separately applied liquids that provide a transfer agent. As used herein, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e. g., seeds, leaves, stems, roots, flowers, or fruits, to permeation by the polynucleotide molecules into plant cells. The transfer of polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. The polynucleotide transfer agent enables a pathway for polynucleotides through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the composition into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) an organic solvent or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of the method can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e. g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e. g., plant-sourced oils, crop oils (such as those listed in the 9.sup.th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com can be used, e. g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine. Transfer agents include, but are not limited to, organosilicone preparations.

[0071] In certain embodiments, an organosilicone preparation that is commercially available as Silwet.RTM. L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.3 to about 1 percent by weight (wt percent) or about 0.5 to about 1% by weight (wt percent) is used or provided.

[0072] In certain embodiments, any of the commercially available organosilicone preparations provided in the following Table 1 can be used as transfer agents in a polynucleotide composition. In certain embodiments where an organosilicone preparation of Table 1 is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation of the following Table 1 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.

TABLE-US-00001 TABLE 1 Name CAS number Manufacturer .sup.1,2 BREAK-THRU .RTM. S 321 na Evonik Industries AG BREAK-THRU .RTM. S 200 67674-67-3 Evonik Industries AG BREAK-THRU .RTM. OE 68937-55-3 Evonik Industries AG 441 BREAK-THRU .RTM. S 278 27306-78-1 Evonik Goldschmidt BREAK-THRU .RTM. S 243 na Evonik Industries AG Silwet .RTM. L-77 27306-78-1 Momentive Performance Materials Silwet .RTM. HS 429 na Momentive Performance Materials Silwet .RTM. HS 312 na Momentive Performance Materials BREAK-THRU .RTM. S 233 134180-76-0 Evonik Industries AG Silwet .RTM. HS 508 Momentive Performance Materials Silwet .RTM. HS 604 Momentive Performance Materials .sup.1 Evonik Industries AG, Essen, Germany .sup.2 Momentive Performance Materials, Albany, New York

[0073] Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase "effective organosilicone compound" is used to describe any organosilicone compound that is found in an organosilicone preparation that enables a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide mediated suppression of a target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length "n" of about "7.5". In certain embodiments, the average chain length "n" can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.

##STR00001##

[0074] One organosilicone compound believed to be ineffective comprises the formula:

##STR00002##

[0075] In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.

[0076] In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise a salt such as ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate. Ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate can be provided in the polynucleotide composition at a concentration of about 0.5% to about 5% (w/v). An ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate concentration of about 1% to about 3%, or about 2% (w/v) can also be used in the polynucleotide compositions that comprise an organosilicone preparation. In certain embodiments, the polynucleotide compositions can comprise an ammonium salt at a concentration greater or equal to 300 millimolar. In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise ammonium sulfate at concentrations from about 80 to about 1200 mM or about 150 mM to about 600 mM.

[0077] In certain embodiments, the polynucleotide compositions can also comprise a phosphate salt. Phosphate salts used in the compositions include, but are not limited to, calcium, magnesium, potassium, or sodium phosphate salts. In certain embodiments, the polynucleotide compositions can comprise a phosphate salt at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of about 5 millimolar, about 10 millimolar, or about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a sodium phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise a sodium phosphate buffer at a pH of about 6.8.

[0078] In certain embodiments, other useful transfer agents or adjuvants to transfer agents that can be used in polynucleotide compositions provided herein include surfactants and/or effective molecules contained therein. Surfactants and/or effective molecules contained therein include, but are not limited to, sodium or lithium salts of fatty acids (such as tallow or tallowamines or phospholipids) and organosilicone surfactants. In certain embodiments, the polynucleotide compositions that comprise a transfer agent are formulated with counter-ions or other molecules that are known to associate with nucleic acid molecules. Illustrative examples include, tetraalkyl ammonium ions, trialkyl ammonium ions, sulfonium ions, lithium ions, and polyamines such as spermine, spermidine, or putrescine. In certain embodiments, the polynucleotide compositions are formulated with a non-polynucleotide herbicide. Non-polynucleotide herbicidal molecules include, but are not limited to, glyphosate, auxin-like benzoic acid herbicides including dicamba, chloramben and TBA, glufosinate, auxin-like herbicides including phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide, sulfonylureas, imidazolinones, bromoxynil, delapon, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibiting herbicides.

[0079] In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the BI-1 target gene or transcript will comprise the predominant nucleic acid in the composition. Thus in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98%, or 100% of the nucleic acids provided in the composition by either mass or molar concentration. However, in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition by either mass or molar concentration. Also provided are compositions where the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to 100%, about 10% to 100%, about 20% to about 100%, about 30% to about 50%, or about 50% to a 100% of the nucleic acids provided in the composition by either mass or molar concentration.

[0080] Polynucleotides comprising ssDNA, dsDNA, ssRNA, dsRNA, or RNA/DNA hybrids that are essentially identical or complementary to certain plant target genes or transcripts and that can be used in compositions containing transfer agents that include, but are not limited to, organosilicone preparations, to suppress those target genes when topically applied to plants are disclosed in co-assigned U.S. patent application Ser. No. 13/042,856. Various polynucleotide herbicidal molecules, compositions comprising those polynucleotide herbicidal molecules and transfer agents that include, but are not limited to, organosilicone preparations, and methods whereby herbicidal effects are obtained by the topical application of such compositions to plants are also disclosed in co-assigned U.S. patent application Ser. No. 13/042,856 (U.S. Patent Application Publication No. 20110296556), and those polynucleotide herbicidal molecules, compositions, and methods are incorporated herein by reference in their entireties. Genes encoding proteins that can provide tolerance to an herbicide and/or that are targets of a herbicide are collectively referred to herein as "herbicide target genes". Herbicide target genes include, but are not limited to, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), a glyphosate oxidoreductase (GOX), a glyphosate decarboxylase, a glyphosate-N-acetyl transferase (GAT), a dicamba monooxygenase, a phosphinothricin acetyltransferase, a 2,2-dichloropropionic acid dehalogenase, an acetohydroxyacid synthase, an acetolactate synthase, a haloarylnitrilase, an acetyl-coenzyme A carboxylase (ACCase), a dihydropteroate synthase, a phytoene desaturase (PDS), a protoporphyrin IX oxygenase (PPO), a hydroxyphenylpyruvate dioxygenase (HPPD), a para-aminobenzoate synthase, a glutamine synthase, a cellulose synthase, a beta tubulin, and a serine hydroxymethyltransferase gene. The effects of applying certain compositions comprising polynucleotides that are essentially identical or complementary to certain herbicide target genes and transfer agents on plants containing the herbicide target genes was shown to be potentiated or enhanced by subsequent application of an herbicide that targets the same gene as the polynucleotide in co-assigned U.S. patent application Ser. No. 13/042,856. For example, compositions comprising polynucleotides targeting the EPSPS herbicide target gene were potentiated by glyphosate in experiments disclosed in co-assigned U.S. patent application Ser. No. 13/042,856.

[0081] In certain embodiments of the compositions and methods disclosed herein, the composition comprising a polynucleotide and a transfer agent can thus further comprise a second polynucleotide comprising at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a transcript to a protein that confers resistance to a herbicide. In certain embodiments, the second polynucleotide does not comprise a polynucleotide that is essentially identical or essentially complementary to a transcript encoding a protein of a target plant that confers resistance to said herbicidal molecule. Thus, in a non-limiting embodiment, the second polynucleotide could be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to a herbicide in a weed (such as an EPSPS encoding transcript) but would not be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to that same herbicide in a crop plant.

[0082] In certain embodiments, the polynucleotide compositions that comprise a transfer agent can comprise glycerin. Glycerin can be provided in the composition at a concentration of about 0.1% to about 1% (w/v or v/v). A glycerin concentration of about 0.4% to about 0.6%, or about 0.5% (w/v or v/v) can also be used in the polynucleotide compositions that comprise a transfer agent.

[0083] In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise organic solvents. Such organic solvents include, but are not limited to, DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions).

[0084] In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise naturally derived or synthetic oils with or without surfactants or emulsifiers. Such oils include, but are not limited to, plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on line at www.herbicide.adjuvants.com), paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.

[0085] In some embodiments, methods include one or more applications of the composition comprising a polynucleotide and a transfer agent or one or more effective components contained therein. In certain embodiments of the methods, one or more applications of a transfer agent or one or more effective components contained therein can precede one or more applications of the composition comprising a polynucleotide and a transfer agent. In embodiments where a transfer agent and/or one or more effective molecules contained therein is used either by itself as a pre-treatment or as part of a composition that includes a polynucleotide, embodiments of the polynucleotide molecules are double-stranded RNA oligonucleotides, single-stranded RNA oligonucleotides, double-stranded RNA polynucleotides, single-stranded RNA polynucleotides, double-stranded DNA oligonucleotides, single-stranded DNA oligonucleotides, double-stranded DNA polynucleotides, single-stranded DNA polynucleotides, chemically modified RNA or DNA oligonucleotides or polynucleotides or mixtures thereof.

[0086] Compositions and methods described herein are useful for modulating or suppressing the expression of an endogenous BAX inhibitor 1 (BI-1) target gene or transgenic BAX inhibitor 1 (BI-1) target gene in a plant cell or plant. In certain embodiments of the methods and compositions provided herein, expression of BI-1 target genes can be suppressed completely, partially and/or transiently to result in an improvement in fungal disease resistance. In various embodiments, a BAX inhibitor 1 (BI-1) target gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. Compositions can include polynucleotides and oligonucleotides designed to target multiple BAX inhibitor 1 (BI-1) genes, or multiple segments of one or more BAX inhibitor 1 (BI-1) genes. The target gene can include multiple consecutive segments of a target BAX inhibitor 1 (BI-1) gene, multiple non-consecutive segments of a BAX inhibitor 1 (BI-1) target gene, multiple alleles of a target gene, or multiple BAX inhibitor 1 (BI-1) target genes from one or more species. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, the endogenous BAX inhibitor 1 (BI-1) plant genes of SEQ ID NO: or. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode proteins that are orthologous to the proteins encoded by SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode the proteins of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31.

[0087] Target genes and plants containing those target genes can be obtained from: i) row crop plants including, but are not limited to, corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) include fruit trees and plants that include, but are not limited to, citrus, apples, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. Such row crop, vegetable, culinary, fruit, tree, or ornamental plants improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are provided herein. Such row crop, vegetable, culinary, fruit, tree, or ornamental plant parts or processed plant products exhibiting improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are also provided herein. Such plant parts can include, but are not limited to, flowers, stems, tubers, fruit, anthers, meristems, ovules, pollen, leaves, or seeds. Such processed plant products obtained from the plant parts can include, but are not limited to, a meal, a pulp, a feed, or a food product.

[0088] In some embodiments, a method for modulating or suppressing expression of an BAX inhibitor 1 (BI-1) gene in a plant including (a) conditioning of a plant to permeation by polynucleotides and (b) treatment of the plant with the polynucleotide molecules, wherein the polynucleotide molecules include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the BAX inhibitor 1 (BI-1) target gene in either anti-sense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene is provided. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and polynucleotide application are performed in separate steps, the conditioning can precede or can follow the polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one polynucleotide molecule application can be performed on the same plant. In embodiments of the method, the segment can be cloned or identified from (a) coding (protein-encoding), (b) non-coding (promoter and other gene related molecules), or (c) both coding and non-coding parts of the BAX inhibitor 1 (BI-1) target gene. Non-coding parts include DNA, such as promoter regions or the RNA transcribed by the DNA that provide RNA regulatory molecules, including but not limited to: introns, 5' or 3' untranslated regions, and microRNAs (miRNA), trans-acting siRNAs, natural anti-sense siRNAs, and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and riboswitches. In certain embodiments where the polynucleotide used in the composition comprises a promoter sequence essentially identical to, or essentially complementary to at least 18 contiguous nucleotides of the promoter of the endogenous target gene, the promoter sequence of the polynucleotide is not operably linked to another sequence that is transcribed from the promoter sequence.

[0089] Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to a plant or plant part by any convenient method, e.g., spraying or coating with a powder, or with a liquid composition comprising any of an emulsion, suspension, or solution. Such topically applied sprays or coatings can be of either all or of any a portion of the surface of the plant or plant part. Similarly, compositions that comprise a transfer agent or other pre-treatment can in certain embodiments be applied to the plant or plant part by any convenient method, e. g., spraying or wiping a solution, emulsion, or suspension. Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to plant parts that include, but are not limited to, flowers, stems, tubers, meristems, ovules, fruit, anthers, pollen, leaves, or seeds.

[0090] Application of compositions comprising a polynucleotide and a transfer agent to seeds is specifically provided herein. Seeds can be contacted with such compositions by spraying, misting, immersion, and the like.

[0091] In certain embodiments, application of compositions comprising a polynucleotide and a transfer agent to plants, plant parts, or seeds in particular can provide for an improvement in fungal disease resistance in progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds. In certain embodiments, progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds will exhibit an improvement in an improvement in fungal disease resistance that results from suppressing expression of an BI-1 gene. In certain embodiments, the methods and compositions provided herein can provide for an improvement in an improvement in fungal disease resistance in progeny plants or seeds as a result of epigenetically inherited suppression of BI-1 expression. In certain embodiments, such progeny plants exhibit an improvement in an improvement in fungal disease resistance from epigenetically inherited suppression of BI-1 gene expression that is not caused by a transgene where the polynucleotide is operably linked to a promoter, a viral vector, or a copy of the polynucleotide that is integrated into a non-native location in the chromosomal DNA of the plant. Without seeking to be limited by theory, progeny plants or seeds derived from those treated plants, plant parts, or seeds can exhibit an improvement in an improvement in fungal disease resistance through an epigenetic mechanism that provides for propagation of an epigenetic condition where suppression of BI-1 gene expression occurs in the progeny plants, plant parts, or plant seeds. In certain embodiments, progeny plants or seeds exhibiting an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression can also exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene of the plant. Plant parts, including seeds, of the progeny plants that exhibit an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression, can also in certain embodiments exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene. In certain embodiments, DNA methylation levels in DNA encoding the endogenous BI-1 gene can be compared in plants that exhibit the an improvement in fungal disease resistance and control plants that do not exhibit an improvement in fungal disease resistance to correlate the presence of the an improvement in fungal disease resistance to epigenetically inherited suppression of BI-1 gene expression and to identify plants that comprise the epigenetically inherited improvement in fungal disease resistance.

[0092] Various methods of spraying compositions on plants or plant parts can be used to topically apply to a plant surface a composition comprising a polynucleotide that comprises a transfer agent. In the field, a composition can be applied with a boom that extends over the crops and delivers the composition to the surface of the plants or with a boomless sprayer that distributes a composition across a wide area. Agricultural sprayers adapted for directional, broadcast, or banded spraying can also be used in certain embodiments. Sprayers adapted for spraying particular parts of plants including, but not limited to, leaves, the undersides of leaves, flowers, stems, male reproductive organs such as tassels, meristems, pollen, ovules, and the like can also be used. Compositions can also be delivered aerially, such as by a crop dusting airplane. In certain embodiments, the spray can be delivered with a pressurized backpack sprayer calibrated to deliver the appropriate rate of the composition. In certain embodiments, such a backpack sprayer is a carbon dioxide pressurized sprayer with a 11015 flat fan or equivalent spray nozzle with a customized single nozzle assembly (to minimize waste) at a spray pressure of about 0.25 MPa and/or any single nozzle sprayer providing an effective spray swath of 60 cm above the canopy of 3 to 12 inch tall growing plants can be used. Plants in a greenhouse or growth chamber can be treated using a track sprayer or laboratory sprayer with a 11001XR or equivalent spray nozzle to deliver the sample solution at a determined rate. In some embodiments, a non-limiting rate is about 140 L/ha at about 0.25 MPa pressure.

[0093] In certain embodiments, it is also contemplated that a plant part can be sprayed with the composition comprising a polynucleotide that comprises a transfer agent. Such plant parts can be sprayed either pre- or post-harvest to provide for an improvement in fungal disease resistance in the plant part that results from suppression of BI-1 gene expression. Compositions can be topically applied to plant parts attached to a plant by a spray as previously described. Compositions can be topically applied to plant parts that are detached from a plant by a spray as previously described or by an alternative method. Alternative methods for applying compositions to detached parts include, but are not limited to, passing the plant parts through a spray by a conveyor belt or trough, or immersing the plant parts in the composition.

[0094] Compositions comprising polynucleotides and transfer agents can be applied to plants or plant parts at one or more developmental stages as desired and/or as needed. Application of compositions to pre-germination seeds and/or to post-germination seedlings is provided in certain embodiments. Seeds can be treated with polynucleotide compositions provided herein by methods including, but not limited to, spraying, immersion, or any process that provides for coating, imbibition, and/or uptake of the polynucleotide composition by the seed. Seeds can be treated with polynucleotide compositions using seed batch treatment systems or continuous flow treatment systems. Seed coating systems are at least described in U.S. Pat. Nos. 6,582,516, 5,891,246, 4,079,696, and 4,023,525. Seed treatment can also be effected in laboratory or commercial scale treatment equipment such as a tumbler, a mixer, or a pan granulator. A polynucleotide composition used to treat seeds can contain one or more other desirable components including, but not limited to liquid diluents, binders to serve as a matrix for the polynucleotide, fillers for protecting the seeds during stress conditions, and plasticizers to improve flexibility, adhesion and/or spreadability of the coating. In addition, for oily polynucleotide compositions containing little or no filler, drying agents such as calcium carbonate, kaolin or bentonite clay, perlite, diatomaceous earth or any other adsorbent material can be added. Use of such components in seed treatments is described in U.S. Pat. No. 5,876,739. Additional ingredients can be incorporated into the polynucleotide compositions used in seed treatments. Such ingredients include but are not limited to: conventional sticking agents, dispersing agents such as methylcellulose (Methocel A15LV or Methocel A15C, for example, serve as combined dispersant/sticking agents for use in seed treatments), polyvinyl alcohol (e.g., Elvanol 51-05), lecithin (e.g., Yelkinol P), polymeric dispersants (e.g., polyvinylpyrrolidone/vinyl acetate PVPNA S-630), thickeners (e.g., clay thickeners such as Van Gel B to improve viscosity and reduce settling of particle suspensions), emulsion stabilizers, surfactants, antifreeze compounds (e.g., urea), dyes, colorants, and the like that can be combined with compositions comprising a polynucleotide and a transfer agent. Further ingredients used in compositions that can be applied to seeds can be found in McCutcheon's, vol. 1, "Emulsifiers and Detergents," MC Publishing Company, Glen Rock, N.J., U.S.A., 1996 and in McCutcheon's, vol. 2, "Functional Materials," MC Publishing Company, Glen Rock, N.J., U.S.A., 1996. Methods of applying compositions to seeds and pesticidal compositions that can be used to treat seeds are described in US patent application publication 20080092256, which is incorporated herein by reference in its entirety.

[0095] Application of the compositions in early, mid-, and late vegetative stages of plant development is provided in certain embodiments. Application of the compositions in early, mid-, and late reproductive stages is also provided in certain embodiments. Application of the compositions to plant parts at different stages of maturation is also provided.

[0096] The following examples are included to demonstrate certain embodiments. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLES

Example 1. BI-1 Target Gene Sequences

[0097] Target BI-1 genes at least occur in the genome of plants provided in Table 2. The BI-1 genes and provided in Table 2 or their corresponding transcripts, can be used as targets of polynucleotide compositions comprising a polynucleotide that of at least 18 contiguous nucleotides that are essentially identical or essentially complementary to those genes or transcripts. The genes and proteins provided in Table 2, or sequences contained within those genes provided herewith in Example 5 can also be used to obtain orthologous BI-1 genes from plants not listed in Table 2. Such orthologous genes and their transcripts can then serve as targets of polynucleotides provided herein or as a source of polynucleotides that are specifically designed to target the orthologous genes or transcripts.

TABLE-US-00002 TABLE 2 BAX inhibitor 1 (BI-1) sequences from various plants that are useful targets for topical suppression to control fungal pathogens. SEQ ID NO: 1 Arabidopsis thaliana Arabidopsis BI-1 protein SEQ ID NO: 2 Arabidopsis thaliana Arabidopsis BI-1 gene SEQ ID NO: 3 Lactuca sativa Lettuce BI-1 protein SEQ ID NO: 4 Lactuca sativa Lettuce BI-1 gene SEQ ID NO: 5 Solanum lycopersicum Tomato BI-1 protein SEQ ID NO: 6 Solanum lycopersicum Tomato BI-1 gene SEQ ID NO: 7 Vitis vinifera Grape BI-1 protein SEQ ID NO: 8 Vitis vinifera Grape BI-1 gene SEQ ID NO: 9 Capsicum annuum Pepper BI-1 protein SEQ ID NO: 10 Capsicum annuum Pepper BI-1 gene SEQ ID NO: 11 Glycine max Soybean BI-1 protein SEQ ID NO: 12 Glycine max Soybean BI-1 gene SEQ ID NO: 13 Sorghum bicolor Sorghum BI-1 protein SEQ ID NO: 14 Sorghum bicolor Sorghum BI-1 gene SEQ ID NO: 15 Zea mays Corn BI-1 protein SEQ ID NO: 16 Zea mays Corn BI-1 gene SEQ ID NO: 17 Triticum aestivum Wheat BI-1 protein SEQ ID NO: 18 Triticum aestivum Wheat BI-1 gene SEQ ID NO: 19 Triticum aestivum Wheat BI-1 protein SEQ ID NO: 20 Triticum aestivum Wheat BI-1 gene SEQ ID NO: 21 Glycine max Soybean BI-2 protein SEQ ID NO: 22 Glycine max Soybean BI-2 gene SEQ ID NO: 23 Hordeum vulgare Barley BI-1 protein SEQ ID NO: 24 Hordeum vulgare Barley BI-1 gene SEQ ID NO: 25 Oryza sativa subsp. Rice BI-1 protein Japonica SEQ ID NO: 26 Oryza sativa subsp. Rice BI-1 gene Japonica SEQ ID NO: 27 Cucumis sativus BI-1 protein SEQ ID NO: 28 Cucumis sativus BI-1 gene SEQ ID NO: 29 Cucumis sativus Cucumber BI-1 protein SEQ ID NO: 30 Cucumis sativus Cucumber BI-1 gene SEQ ID NO: 31 Gossypium hirsutum Cotton BI-1 protein SEQ ID NO: 32 Gossypium hirsutum Cotton BI-1 gene

[0098] Table 2 contains the target BI-1 DNA sequences from the indicated plant species. For each gene having a DNA sequence provided in Table 2, polynucleotides such as single stranded or double stranded DNA or RNA fragments in sense and/or antisense orientation will be mixed with an organosilicone preparation. These compositions will be topically applied to plants to effect expression of the target genes in the specified plant to obtain the plants that exhibit disease resistance. In particular, plants that are resistant to powdery mildew, downy mildew, rust and/or other fungal infections will be obtained through the application of such compositions.

Example 2. Identification of Orthologous BI-1 Genes

[0099] The sequences disclosed in SEQ ID NO: 1 through 32, along with the phylogenetic method for functional assignment described above, can be used to efficiently identify and clone BI-1 homologs useful for the control on pathogens causing powdery mildews, downy mildews or rusts, from other plant species not explicitly described here.

Example 3. Polynucleotides that can be Used to Reduce BI-1 Expression in Various Plants

[0100] Examples of polynucleotides that can be used to reduce expression of BI-1 genes in various plants is provided herewith as SEQ ID NOS: 33-106, 109-140, and 142-146. Other regions of BI-1 genes can also be targeted to modify expression including the use of antisense DNA oligonucleotides against coding regions and/or targeting promoter regions using sense/antisense dsRNA, sense or antisense ssDNA as well as sense/antisense double stranded DNA. For example, a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32 can be used to downregulate expression of those BI-1 genes.

Example 4. Topical Oligonucleotide Application and Powdery Mildew Testing Methods

[0101] Barley seeds are planted in 2 inch pots in the greenhouse. Five days later, barley seedlings are sprayed with polynucleotides such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water. Two to 4 days post spraying, seedlings will be infected with dry spores of barley powdery mildew (Blumeria graminis f. sp. hordei) and 7 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.

[0102] Cucumber seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. When the first true leaf is fully expanded and the second leaf is opening, a polynucleotide solution such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest is applied to the first true leaf or the cotyledons. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 Silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water. Two days later the entire cucumber plant is inoculated with a shower of dry spores of cucumber powdery mildew (Sphaerotheca fuliginea) shaken off diseased plants. Disease severity will be evaluated on the treated leaf and succeeding leaves 10 days later and at subsequent intervals.

[0103] Tomato seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. Two weeks old tomato seedlings are treated with 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.2-0.5% L77 silwet, 50 mM NaPO.sub.4, 1% ammonium sulfate in a final volume of 30 microliters of water. Two to 4 days post spraying plants are innoculated with dry spores of tomato powdery mildew (Oidium neolycopersici) and 13 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.

Example 5. Control of Powdery Mildew with Oligonucleotide Applications

[0104] Barley plants were treated with control and oligonucleotide containing solutions essentially as indicated in Example 4. More specifically, Barley seeds (Perry variety) are planted about 1/4'' into soil in 2 inch pots in the growth chamber and grown at 25.degree. C. with a 16 hr light cycle in 50% humidity. Before polynucleotide application the plants are randomized. Application of polynucleotides (either ssDNA oligos and/or dsRNA) is performed by pipet application where 5 .mu.L of solution containing nucleotides is applied to both sides of the first leaf. The nucleotide solution applied consists of .about.3-15 nm of each ssDNA oligonucleotide or .about.0.5-1 nm dsRNA, 0.1-0.3% Silwet L-77, 5 mM NaPO4, and 1% AMS in Gibco ultra pure water. Two days post treatment seedlings are infected with barley powdery mildew (Blumeria graminis f. sp. hordei). The growth chamber settings for the infection are as follows: 23.degree. C., with a 12 hr light cycle in 70% humidity. At seven days post infection disease severity is scored for the percentage of leaf area covered with powdery mildew.

[0105] Data is analyzed using Anova Single Factor Analysis (.alpha.=0.1). The 1/2 LSD is calculated and custom error bars created for the bar graphs. Percent disease reduction is compared to formulation blank and nucleic acid control

[0106] Experiments were conducted using pools of polynucleotides from the following Table 3.

TABLE-US-00003 TABLE 3 Polynucleotides Se- Se- SEQ quence quence ID Type name Sequence Length NO: anti- T5895 TCAGGGCAATGTGTAGGTAAGCACC 25 93 sense DNA anti- T5896 AGCATTGTCAGCATCCCGCCGATGT 25 94 sense DNA anti- T5897 TTCCAGGAGGGCTGCACCCATCAGC 25 95 sense DNA anti- T5898 CAATCAGAGGTCCAACCGAAGCCCC 25 96 sense DNA anti- T5899 CTTGGGTCAAAGTCTATGGCAAGCT 25 97 sense DNA anti- T5900 TCCGACAAACCCTGTCACGAGGATG 25 98 sense DNA anti- T5901 AGAAGCACCCAAAGGCGATGGCGGT 25 99 sense DNA anti- T5902 CGCTTGGCGATGATGGCGGCGCCAG 25 100 sense DNA anti- T5903 GCCACCGAGGTACAGGTACTCCCTG 25 101 sense DNA anti- T5904 GGATCGACAGGCCAGACGAGAGCA 25 102 sense G DNA anti- T5905 GACGTGACAAACTGCAGCCAGAGCA 25 103 sense DNA anti- T5906 GCTGCCAGAGGAGTGGCCAAAGATG 25 104 sense DNA anti- T5907 GGCCAAAGTAAACCTCAAACATGAA 25 105 sense DNA anti- T5908 ACCATGTACCCCAGGAAGATCAACA 25 106 sense DNA anti- T4211 GGGGTGCTGGAGAGGCCCAGGTGG 24 107 sense DNA sense T4211_S CCACCTGGGCCTCTCCAGCACCCC 24 108 anti- T5909 CTCGATGATCTCCTGCGTGTCGTAC 25 109 sense DNA anti- T4223A_ GACCCCCTCTTCCTCTTCTTCTTG 24 110 sense AS DNA anti- T4223B_ CGTTCTTGAGCATGATGATGAGGA 24 111 sense AS DNA anti- T4223C_ GCAACAAAGTCGGTGAAGAGG 21 112 sense AS DNA anti- T4223D_ GTCAGCATCCCGCCGATGTTCAG 23 113 sense AS DNA anti- T4223E_ CCACGGCAGATGAGGCCAGTGCA 23 114 sense AS DNA anti- T4223F_ TAAACGAGCTTGAGGTGGGACTG 23 115 sense AS DNA anti- T4223G_ AACTGCAGCCAGAGCAGGATCG 22 116 sense AS DNA anti- T4223H_ AGCAGGCCACCGAGGTACAGGT 22 117 sense AS DNA anti- T4223I_ GGCGGCGCCAGAGAAGCACCC 21 118 sense AS DNA dsRNA T5942 ATGGACGCCTTCTACTCGACCTCGTC 150 119 GGCGGCGGCGAGCGGCTGGGGCCA CGACTCCCTCAAGAACTTCCGCCAGA TCTCCCCCGCCGTGCAGTCCCACCTC AAGCTCGTTTACCTGACTCTATGCTTT GCACTGGCCTCATCTGCCGTG dsRNA T5943 AGGGCGCACCATGGCGACATGGACT 150 120 ACATCAAGCACGCCCTCACCCTCTTC ACCGACTTTGTTGCCGTCCTCGTCCG AGTCCTCATCATCATGCTCAAGAACG CAGGCGACAAGTCGGAGGACAAGA AGAAGAGGAAGAGGGGGTCCTGA dsRNA T5944 CGCTTGTGTCGGAACTATCGCCTGGA 150 121 TGTTCTCGGTGCCAGTCTATGAGGAG AGGAAGAGGTTTGGGCTGCTGATGG GTGCAGCCCTCCTGGAAGGGGCTTC GGTTGGACCTCTGATTGAGCTTGCCA TAGACTTTGACCCAAGCATCCT

[0107] Table 4 provides a summary of the results obtained.

TABLE-US-00004 TABLE 4 Powdery Mildew control results Anova: Single Factor SUMMARY Average Percent Oligos Disease Groups in pool Count Sum Area Variance Non Treated 10 256 25.6 480.2667 Blank 10 321 32.1 405.2111 MLO_T4211.sup.1 SEQ ID NO: 10 6 0.6 0.266667 107 BI1_T5895-98 SEQ ID NO: 10 14 1.4 1.6 93, 94, 95, 96 BI1_T5899-02 SEQ ID NO: 10 31 3.1 14.98889 97, 98, 99, 100 BI1_T5903-06 SEQ ID NO: 10 42 4.2 56.17778 101, 102, 103, 104 BI1_T5907-09 SEQ ID NO: 10 78 7.8 52.17778 105, 106, 109 .sup.1A positive control oligonucleotide that suppresses the endogenous barley Mildew Resistance Locus O (MLO) gene and provides fungal disease control.

Example 6. Topical Oligonucleotide Application and Nematode Testing Methods

Application of Oligonucleotides to Seeds for Nematode Control

[0108] Cucumber seeds are soaked approximately 5-72 hours in nucleotides, either ssDNA and/or dsRNA oligos directed to the promoter and/or the coding region of a target of interest. Optionally, seeds can be soaked in water for a few hours prior to soaking in oligonucleotide solution. Soaking solution consists of 20 nm of each ssDNA nucleotide or 0.03-1 nm dsRNA, 0.1% silwet L77, 50 mM NaPO4 in a final volume 200 uL in water. The radicals of the cucumber seeds emerge within 72 hours, after which the seeds are placed on germination paper until root length is approximately 2 inches. Seedlings are transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand is added to each vial and seedlings are planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons are just above the sand and then tilting back to cover the radicals with sand. 3.3 ml water is added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN are inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants is performed 10 to 12 days after inoculation by washing sand off the roots. A root gall rating and visual phytotoxicity rating is assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating is then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Visual phytotoxicity scale is also assigned (Vis. tox; visual reduction in root mass compared to the control): rs1=mild stunting; rs2=moderate stunting; rs3=severe stunting.

[0109] Experiments in soybeans using soy cyst nematodes (SCN) are similar to RKN assays except for the following changes. After 5-72 hours of soaking soybean seeds are planted in 100% sand in two inch square plastic pots. Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Seven days after planting the soybean seed, the nematode soybean cyst nematode (SCN) inoculum (1000 vermiform eggs or 1000 J2s) are applied to the pot. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Twenty eight days after inoculation the test is harvested and cysts counted.

[0110] Experiments in corn using lesion nematodes are similar to above except for the following changes. After 5-72 hours of soaking, corn seeds are planted in a sand:Turface mix 2:1 in 4 inch deep pots (Turface.TM. MVP, Profile Products, LLC., Buffalo Grove, Ill.). Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Inoculum of 2 gm of roots P. scribneri infested corn roots are applied to seedings and removed from the pot after 7 days. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours after inoculation. After the 24 hour restricted watering, normal sub-irrigation watering as needed is done for the duration of the test. 12-14 days post inoculation, plants are harvested and nematodes extracted for 6 days from the cut up roots in a mist tent.

[0111] RKN and SCN J2s are prepared from hatchbowls using the following solutions: RKN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate; SCN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate, 1430 mg zinc sulfate.

[0112] Hatchbowls are autoclaved 6 oz bowls, lined with screen mesh and paper filter. Approximately 20 ml of appropriate hatch solution is poured into each bowl. Eggs are then place in the bowls and covered with foil. The bowls are then placed in a 25.degree. C. incubator overnight. The next day the hatched J2's are extracted, additional solution added as needed and replaced in the incubator. Each bowl is used for 2 weeks and then disposed.

Example 7. Protection of Soybean from Soy Cyst Nematode (SCN)

[0113] Soybean cotyledons of the variety W82 were treated with the treatments indicated in Table 5 by topical application of the oligonucleotide solution in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.20% Silwet.TM. (wt percent). Approximately 50 .mu.l of solution containing the ssDNA oligonucleotides of Table 6, in pools of 4 ssDNAs/pool, was applied to each cotyledon of the plants and 4 plants were subjected to each treatment. One day following treatment, the plants were infected with approximately 1000 vermiform eggs of Soy Cyst Nematode applied directly to the pot. Twenty eight days after inoculation the root weights and cyst counts were recorded. ANOVA analysis for cyst count is provided in Table 8 and root weight is in Table 10. FIG. 1 shows the bar chart for cyst count and root weight.

TABLE-US-00005 TABLE 5 Treatments Treatment # Description Oligo Final Conc. 1 Bi1-1 pool 1 AS coding 80 nmol/4 .times. 10 .mu.L 2 Bi1-1 pool 2 AS coding 80 nmol/4 .times. 10 .mu.L 3 Bi1-1 pool 3 AS coding 80 nmol/4 .times. 10 .mu.L 4 Bi 1-2 pool 4 AS coding 80 nmol/4 .times. 10 .mu.L 5 Bi1-2 pool 5 AS coding 80 nmol/4 .times. 10 .mu.L 6 GFP AS control 80 nmol/4 .times. 10 .mu.L 7 Mock treated no Silwet L-77 8 Formulation

TABLE-US-00006 TABLE 6 Oligonucleotides used SEQ ID Pool NO Sequence Maps to ID 122 TTGAATCGAAGAAGGAATTGAAGGAGTCCAT Soybean 1 Bil-1 SEQ ID NO 12 123 AGGTAAGCCCCAACAGCCGCAGCAACCA Soybean 1 Bil-1 SEQ ID NO 12 124 CTCTTTTCCTCTCTTCAAAAGGAGGTGTC Soybean 1 Bil-1 SEQ ID NO 12 125 TGCACTAAAGATAAGGCTTGGATCGAT Soybean 1 Bil-1 SEQ ID NO 12 126 ATCCAGAAGAAACCAAGCCACCAAGGT Soybean 2 Bil-1 SEQ ID NO 12 127 CCTACAAACACCAAAAGCCCAAAGTAC Soybean 2 Bil-1 SEQ ID NO 12 128 ACTGCAACCAAATCGGTAAACAAGGTCAA Soybean 2 Bil-1 SEQ ID NO 12 129 TCAATCTCTCCTCTTCTTTTTCTTC Soybean 2 Bil-1 SEQ ID NO 12 130 TCAAGGGACCAACGAAGGCTAATTTCG Soybean 3 Bil-1 SEQ ID NO 12 131 GGCTTTGAATTTCAACACCCCTAATT Soybean 3 Bil-1 SEQ ID NO 12 132 GCTTGCAATCGGAGAAACACAAATTT Soybean 3 Bil-1 SEQ ID NO 12 133 ATGGGGACTTGAAGAAAGTGTCCAT Soybean 4 Bil-2 SEQ ID NO 22 134 TAAAATAAACCAGTTTGATGTGATTCTG Soybean 4 Bil-2 SEQ ID NO 22 135 TGCTCCCAATGGAAGCCACCGTGGTGA Soybean 4 Bil-2 SEQ ID NO 22 136 AATCAGAGGTCCAATGGAAGCACCCTGA Soybean 4 Bil-2 SEQ ID NO 22 137 GCCTTGCAACTAAGGCTACTGCAGAAAA Soybean 5 Bil-2 SEQ ID NO 22 138 AGAGCTATAGAGCCCCCAAAGAGAGAGG Soybean 5 Bil-2 SEQ ID NO 22 139 TCCAGGTCACCAAAGTGAGCCCTCTCA Soybean 5 Bil-2 SEQ ID NO 22 140 CTTCTCATTTCTCTTAGATGAATTATT Soybean 5 Bil-2 SEQ ID NO 22 141 GTTGTAGTTGTACTCCATCTTATTG GFP Control

TABLE-US-00007 TABLE 7 Cyst counts trt# rep1 rep2 rep3 rep4 avg 1 143.0 109.0 90.0 111.0 113.3 2 42.0 46.0 44.0 31.0 40.8 3 78.0 197.0 193.0 101.0 142.3 4 138.0 75.0 80.0 51.0 86.0 5 141.0 136.0 92.0 107.0 119.0 6 72.0 67.0 75.0 95.0 77.3 7 83.0 128.0 52.0 103.0 91.5 8 179.0 122.0 165.0 184.0 162.5

TABLE-US-00008 TABLE 8 ANOVA Single Factor analysis of Cyst counts Anova: Single Factor SUMMARY Groups Count Sum Average Variance Row 1 4 453 113.25 482.9167 Row 2 4 163 40.75 44.91667 Row 3 4 569 142.25 3800.917 Row 4 4 344 86 1362 Row 5 4 476 119 548.6667 Row 6 4 309 77.25 150.9167 Row 7 4 366 91.5 1032.333 Row 8 4 650 162.5 793.6667 ANOVA Source of Var- iation SS df MS F P-value F crit Be- 41568.88 7 5938.411 5.782054 0.000521 2.422629 tween Groups Within 24649 24 1027.042 Groups Total 66217.88 31 std of 22.6 df = 1.711 diff lsd 38.8 1/2 lsd 19.4

TABLE-US-00009 TABLE 9 Root Weight trt# rep1 rep2 rep3 rep4 avg 1 16.0 18.4 14.8 18.8 17.0 2 13.5 16.7 18.6 4.0 13.2 3 5.6 15.1 11.7 10.5 10.7 4 14.8 14.1 12.6 12.4 13.5 5 12.9 13.1 14.1 12.4 13.1 6 15.8 17.0 19.8 16.9 17.4 7 15.6 15.1 14.0 11.5 14.1 8 14.2 16.2 17.2 14.8 15.6

TABLE-US-00010 TABLE 10 ANOVA analysis of root weight Anova: Single Factor SUMMARY Treatment Count Sum Average Variance 1 4 68 17 3.68 2 4 52.8 13.2 42.04667 3 4 42.9 10.725 15.46917 4 4 53.9 13.475 1.355833 5 4 52.5 13.125 0.509167 6 4 69.5 17.375 2.909167 7 4 56.2 14.05 3.336667 8 4 62.4 15.6 1.84 ANOVA Source of Var- iation SS df MS F P-value F crit Be- 138.1888 7 19.74125 2.219781 0.068719 2.422629 tween Treatm. Within 213.44 24 8.893333 Treat- ment Total 351.6288 31 std of 2.1 df = 1.711 diff lsd 3.6 1/2 lsd 1.8

Example 8. Protection of Cucumber from Root Knot Nematode (RKN)

[0114] Cucumber seed were soaked for 72 hr in dsRNA polynucleotide solution directed to the coding sequence of soybean Bi-1 gene. Soaking solution consisted of 0.01-1 nm dsRNA, 0.2% Silwet L77, 20 mM NaPO4 in a final volume 200 uL in water as outlined in Table 11. The radicals of the cucumber seeds emerged within 72 hours, after which the seeds were placed on germination paper until root length was approximately 2 inches. Seedlings were transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand was added to each vial and seedlings were planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons were just above the sand and then tilting back to cover the radicals with sand. 3.3 ml water was added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN were inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants was performed 10 to 12 days after inoculation by washing sand off the roots.

[0115] A root gall rating and visual phytotoxicity rating was assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating was then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Table 11 summarizes the treatments performed and Table 12 shows the gall rating results. These results are also graphically displayed in FIG. 2.

TABLE-US-00011 TABLE 11 Treatments SEQ Volume Trigger ID Conc of each Treatment# type Trigger NOs (nmol/.mu.L) dsRNA 1 dsRNA Bi-1 142 0.0172 0.70 0.06 nmol 143 0.022 0.55 (0.012 nmol 144 0.0148 0.81 each) 145 0.0195 0.62 146 0.0216 0.56 2 dsRNA Bi-1 142 0.0172 1.74 0.15 nmol 143 0.022 1.36 (0.03 nmol 144 0.0148 2.03 each) 145 0.0195 1.54 146 0.0216 1.39 3 dsRNA GFP 147 0.0157 3.82 control 0.06 nmol 4 dsRNA GFP 147 0.0157 9.55 control 0.15 nmol 5 Mock, no Silwet 6 Formulation

TABLE-US-00012 TABLE 12 RKN Assay Results Treatment No. Treatment Score % AVG St Dev 1 Bax1 dsRNA 15 25 10 10 15 7.071067812 coding .06 nmol (.012 nmol each) 2 Bax1 dsRNA 10 40 5 20 18.76 15.47847968 coding .15 nmol (0.03 nmol each) 3 GFP dsRNA 15 40 50 20 31.25 16.52 control .06 nmol 4 GFP dsRNA 50 65 57.50 10.61 control .15 nmol 5 Mock no 25 50 40 40 38.75 10.31 silwet 6 Formulation 50 30 70 30 45 19.15

Sequence CWU 1

1

1471247PRTArabidopsis thaliana 1Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Pro Gly Ser Arg Ser 1 5 10 15 Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala Val 20 25 30 Gln Asn His Leu Lys Arg Val Tyr Leu Thr Leu Cys Cys Ala Leu Val 35 40 45 Ala Ser Ala Phe Gly Ala Tyr Leu His Val Leu Trp Asn Ile Gly Gly 50 55 60 Ile Leu Thr Thr Ile Gly Cys Ile Gly Thr Met Ile Trp Leu Leu Ser 65 70 75 80 Cys Pro Pro Tyr Glu His Gln Lys Arg Leu Ser Leu Leu Phe Val Ser 85 90 95 Ala Val Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Lys Val Ala Ile 100 105 110 Asp Val Asp Pro Ser Ile Leu Ile Thr Ala Phe Val Gly Thr Ala Ile 115 120 125 Ala Phe Val Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg Glu 130 135 140 Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Met Leu Met 145 150 155 160 Trp Leu Gln Phe Ala Ser Ser Ile Phe Gly Gly Ser Ala Ser Ile Phe 165 170 175 Lys Phe Glu Leu Tyr Phe Gly Leu Leu Ile Phe Val Gly Tyr Met Val 180 185 190 Val Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met Asp 195 200 205 Tyr Val Lys His Ser Leu Thr Leu Phe Thr Asp Phe Val Ala Val Phe 210 215 220 Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Asp Lys Glu Glu 225 230 235 240 Lys Lys Lys Lys Arg Arg Asn 245 21149DNAArabidopsis thaliana 2aatattttca ttaatcgatt ctcaaagtca agcaaaaaaa acgaaacaat ggatgcgttc 60tcttccttct tcgattctca acctggtagc agaagctgga gctatgattc tcttaaaaac 120ttccgtcaga tttctccagc cgttcagaat catcttaaac gggtttattt gaccttatgt 180tgtgctcttg tggcgtctgc ctttggagct tacctccatg tgctctggaa tatcggcggt 240attcttacaa cgattggatg tattggaact atgatttggc tcctttcatg tcctccttat 300gaacaccaaa aaaggctttc tcttctgttt gtgtctgctg ttcttgaagg tgcttctgtt 360ggccccttga tcaaagtggc aattgatgtt gacccaagca tccttatcac tgcatttgtt 420ggaactgcga tagcgtttgt ctgtttctca gcagcagcaa tgttagcaag acgcagggag 480tatctctacc ttggaggact gctttcatct ggcttgtcta tgctaatgtg gctccagttt 540gcctcttcaa tctttggtgg ctctgcatct atctttaagt ttgagttgta ctttggactt 600ttgatctttg tgggatacat ggtggtggac acacaagaga ttatagaaaa ggcacacctc 660ggtgacatgg actatgtaaa acattcgttg acccttttca ctgactttgt agctgtgttt 720gttcggattc tcatcataat gttgaagaac tcagcagata aagaagagaa gaagaagaaa 780aggagaaact gaggggatgt aaagtaaatt taactttatg gttgttatcg tgtgtggcca 840ctttgaagat attacttgtt agcactctct attggtgacc agacatgttt ccactaaaaa 900ggatctgctt gtttcacttc tgcacaagta ccatcttcag attgtaaatg actcgagtgt 960tgttcttctt ttcataaact tttgttcttt aagagtttgg ttctactgat tgcatcttac 1020caagctaaga ataatgtagg aaaatgataa tcctgtttaa attttctaaa atgtgtgcat 1080ttcagattct cacagttgca acatttgcta ttgcttggaa gttgtaatcg aaaaataact 1140tgcaatttc 11493250PRTLactuca sativa 3Met Glu Ser Phe Ser Ser Phe Phe Asp Ser Gln Ser Arg Ser Ala Ser 1 5 10 15 Pro Asn Ser Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser 20 25 30 Pro Leu Val Gln Thr His Leu Lys Gln Val Tyr Leu Ser Leu Cys Cys 35 40 45 Ala Leu Met Ala Ser Ala Val Gly Ala Tyr Leu His Ile Leu Trp Asn 50 55 60 Ile Gly Gly Leu Leu Thr Thr Phe Gly Thr Leu Gly Cys Met Phe Trp 65 70 75 80 Leu Leu Ala Thr Pro Gln Tyr Gln Glu Gln Lys Arg Val Ser Leu Leu 85 90 95 Met Ala Ser Ser Leu Leu Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp 100 105 110 Leu Ala Ile Glu Phe Asp Pro Ser Ile Leu Val Ser Ala Phe Met Gly 115 120 125 Thr Ala Ile Ala Phe Ala Cys Phe Ser Gly Ala Ala Met Leu Ala Arg 130 135 140 Arg Arg Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser 145 150 155 160 Ile Leu Phe Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Val 165 170 175 Ala Leu Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly 180 185 190 Tyr Met Val Val Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly 195 200 205 Asp Leu Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Ile 210 215 220 Ala Val Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu 225 230 235 240 Arg Glu Glu Lys Lys Lys Lys Arg Arg Asp 245 250 41251DNALactuca sativa 4ggcgacttcg cgaaactacc ggattactta actatgtctg caaacgtgta ctataaatat 60cgcatatttt cttcccccaa aagtcatcgg ttcaatacca aaatttcata gttctttgtt 120ttcttcaact accatggaat cattctcatc gttcttcgat tcacaatcgc gatcggcttc 180tccaaacagc tggacctacg attctctcaa gaatttccgt caaatctctc ccttagttca 240gactcatctc aaacaggttt acctctcact atgttgtgct ctcatggcat ctgcagttgg 300ggcttacctt cacatcctat ggaacatcgg tggccttcta accaccttcg gaacgttggg 360ctgcatgttt tggctactcg ccactccaca atatcaagag caaaaaagag tctctctatt 420aatggcatct tctcttctcc aaggagcctc catcggtcct ctaatcgact tagccataga 480atttgaccca agcatcttgg tgagcgcgtt catgggaact gcaatcgcat ttgcttgttt 540ctcaggagct gccatgttag caagacgcag agagtatctt tatcttggag gtcttctttc 600ttctggtgtt tcaatccttt tctggttaca ttttgcctca tcaatctttg gtggctctgt 660tgcccttttc aaatttgagt tgtactttgg gctgttggtg tttgttgggt acatggtggt 720tgacacccaa gatatcattg aaaaggctca tcttggagat ttggattatg tgaaacatgc 780tcttacgctt ttcactgatt tcattgctgt ttttgttcgc attcttatca tcatgttgaa 840gaattcggct gaaagagaag agaagaagaa gaagaggagg gattagggtg tttgtgaatg 900agaaaaatgt gaagctttct gactacaaat aaaatgcgat gtagttgtta cttttgtgta 960gtacattgtt ttttttaaca tgagtgacgt atatgtccta tgtcaatttg agattatgtg 1020attaaaccct tataaaccca acaatctatc tcaatgtggg gttatttaaa ttatcccatg 1080tactcgatcc aagtgtttaa aagctcatta cattacatta tcttcgaata ctaataattt 1140atcgtattca catgcgtatg gggtttccta ctttactagt acattacccc agatttttaa 1200gaccaagttg aattgcattt ttaagtactc ctaattttgt gcaaaccacg t 12515248PRTSolanum lycopersicum 5Met Glu Gly Phe Thr Ser Phe Phe Asp Ser Gln Ser Ala Ser Arg Asn 1 5 10 15 Arg Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Leu 20 25 30 Val Gln Thr His Leu Lys Gln Val Tyr Leu Thr Leu Cys Cys Ala Leu 35 40 45 Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly 50 55 60 Gly Leu Leu Thr Thr Met Ala Cys Met Gly Ser Met Val Trp Leu Leu 65 70 75 80 Ser Ala Pro Pro Tyr Gln Glu Gln Lys Arg Val Ala Leu Leu Met Ala 85 90 95 Ala Ala Leu Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Glu Leu Gly 100 105 110 Ile Asn Phe Asp Pro Ser Ile Val Phe Gly Ala Phe Val Gly Cys Ala 115 120 125 Val Val Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg 130 135 140 Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Leu Leu 145 150 155 160 Phe Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Met Ala Val 165 170 175 Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Ile 180 185 190 Val Phe Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met 195 200 205 Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val 210 215 220 Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ala Ser Glu Lys Glu 225 230 235 240 Glu Lys Lys Lys Lys Arg Arg Asn 245 61127DNASolanum lycopersicum 6caacgcctta caggcagacg actttcgcat atcggtatag caaacataac attgtctacg 60ttcagataaa tatcctttgc tcatttcagt tccaaaaact cgaagaagaa gaagaagaga 120acaatggaag gtttcacatc gttcttcgac tcgcaatctg cctctcgcaa ccgctggagt 180tatgattctc tcaaaaactt ccgccagatc tcacctctcg ttcaaactca tctcaagcag 240gtgtacctta cgctatgctg tgctttagtg gcatcggctg ctggggctta ccttcacatt 300ctatggaata tcggtggcct cctcacaaca atggcttgca tgggaagcat ggtgtggctt 360ctctcagctc ctccttatca agagcaaaaa agggtggctc ttctgatggc agctgcactt 420tttgaaggcg cctctattgg tcctctgatt gagctgggca ttaacttcga tccaagcatt 480gtgtttggcg cttttgtagg ttgtgctgtg gtttttggtt gcttctcagc tgctgccatg 540ttggcaaggc gcagggagta cttgtacctc gggggccttc tttcatctgg cgtctccctt 600ctcttctggt tgcactttgc atcctccatt tttggtggtt ccatggctgt tttcaagttt 660gagttgtatt ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt 720attgagaagg ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca 780gattttgtcg ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag 840gaagagaaga agaagaagag gagaaactag atttgcttct caacttgtgg tttccataac 900tccttgtgtt cacctgaaac aagcatgtta atagtttgat acttgcttca ctttagcata 960ggctgtgatg taatgtcgtg tgacatgcca ttatggctgt gtgattgagc atctagcctt 1020tttatcttct aaagcttttt tcttaacatt gataaggaaa gttccttgtg ataacattta 1080agaccatttt aatttctcct ttctcattca aaaaaaaaaa aaaaaaa 11277248PRTVitis vinifera 7Met Glu Ala Phe Ser Ala Phe Phe Asp Ser Gln Ser Ser Ser Arg Ser 1 5 10 15 Gly Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala 20 25 30 Val Gln Thr His Leu Lys Gln Val Tyr Leu Ser Leu Cys Cys Ala Leu 35 40 45 Ile Ala Ser Ala Ala Gly Ala Tyr Leu His Leu Leu Trp Asn Ile Gly 50 55 60 Gly Leu Leu Thr Thr Phe Ala Cys Phe Gly Ser Ile Ile Trp Leu Leu 65 70 75 80 Ser Ala Pro Ser Tyr Glu Glu Lys Lys Arg Val Ser Leu Leu Met Ala 85 90 95 Val Ala Leu Phe Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala 100 105 110 Ile Glu Ile Asp Pro Ser Ile Leu Val Ser Ala Phe Val Gly Thr Ala 115 120 125 Val Ala Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg 130 135 140 Glu Tyr Leu Tyr Leu Gly Gly Val Leu Ser Ser Gly Leu Ser Ile Leu 145 150 155 160 Phe Trp Leu His Phe Ala Ser Ser Leu Phe Gly Gly Ser Thr Ala Ile 165 170 175 Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Met 180 185 190 Val Val Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly Asp Arg 195 200 205 Asp Tyr Val Lys His Ser Leu Leu Leu Phe Thr Asp Phe Ala Ala Val 210 215 220 Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Ser 225 230 235 240 Glu Lys Lys Lys Lys Arg Arg Asn 245 81097DNAVitis vinifera 8aaagaggatt gttggaatta ggttttcaat ggaggcgttc tctgcgtttt tcgattcaca 60atcgagctca aggagcggtt ggacctacga ttcactcaag aatttccgcc agatttctcc 120tgccgttcaa actcatctca agcaggttta tctctccctg tgctgtgcct tgattgcatc 180tgctgcagga gcttacctgc atcttctctg gaatattggt ggccttctta ctacttttgc 240atgctttgga agcatcatat ggctactctc tgcaccttca tatgaagaga aaaagagggt 300ttcactattg atggctgtgg ccctttttca aggagcctct atcggtcctt tgattgactt 360ggctattgaa attgacccaa gcattcttgt tagtgctttt gtgggaactg cagtggcctt 420tggctgtttc tctgcggctg caatgttggc aaggcgcaga gagtacctgt acttgggagg 480ggttctttcg tctggcctct ccatcctttt ctggttgcac tttgcctcct cgttgtttgg 540gggatccact gccatcttta agtttgagtt gtattttgga ctgttggtgt ttgtgggcta 600catggtagta gacacccagg acataataga gaaagcccat ctcggggatc gggactatgt 660gaaacattct ctcctccttt tcactgattt tgctgcagtt tttgttcgaa tcctgattat 720catgttgaag aactcggctg aaaagagtga gaagaagaag aaaaggagaa attgaatgat 780gggagactaa tgagcttaac ttgaactctg gttgaacaaa acaagagatt gtgtatgaac 840ttgatgcttg tttctttctt tcccctaagt gagattatga tttttgaaac atgtgatacg 900ctgggcgcta tggcagtgta catacgaatt gctcggttat gacattctgc atgttttaat 960atatggggtt ggttttaaat aagaggacac tcgaatttgt tataatttga gaaacagttt 1020gtatttcaaa atagaaacgg ttttctgtta aaaatttcta atattgcaag gaaaattgaa 1080tgtgatatat ttttttt 10979248PRTCapsicum annuum 9Met Glu Gly Phe Thr Ser Phe Phe Glu Ser Gln Ser Ala Ser Arg Ser 1 5 10 15 Arg Trp Asn Tyr Asp Ala Leu Lys Asn Phe His Gln Ile Ser Pro Arg 20 25 30 Val Gln Thr His Leu Lys Gln Val Tyr Leu Thr Leu Cys Cys Ala Leu 35 40 45 Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly 50 55 60 Gly Phe Leu Thr Thr Leu Ala Cys Ile Gly Ser Met Val Trp Leu Leu 65 70 75 80 Ala Thr Pro Pro Tyr Gln Glu Gln Lys Arg Val Ala Leu Leu Met Ala 85 90 95 Ala Ala Leu Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Glu Leu Gly 100 105 110 Ile Asn Phe Asp Pro Ser Ile Val Leu Gly Ala Phe Val Gly Cys Gly 115 120 125 Val Val Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg 130 135 140 Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Leu Leu 145 150 155 160 Met Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ala Met Ala Leu 165 170 175 Phe Lys Phe Glu Val Tyr Phe Gly Phe Leu Val Phe Val Gly Tyr Ile 180 185 190 Val Phe Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met 195 200 205 Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val 210 215 220 Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ala Phe Glu Lys Glu 225 230 235 240 Glu Lys Lys Lys Lys Arg Arg Asn 245 10747DNACapsicum annuum 10atggagggtt tcacgtcgtt cttcgaatcg caatcggctt ctcgcagtcg ctggaattat 60gatgctctca aaaacttcca tcagatctct cctcgtgttc aaactcatct caaacaggtc 120tacctcacac tatgctgtgc tttagtcgca tcagctgctg gggcttacct tcacattctt 180tggaacatcg gtggcttcct cacaacactg gcttgcattg gaagcatggt gtggcttctg 240gcaactcctc cttatcaaga gcaaaaaagg gtggcacttc tgatggcagc tgcactcttt 300gaaggcgctt caattggtcc tctgattgaa ctgggcatca acttcgaccc aagcattgtg 360cttggtgctt ttgtaggttg tggtgtggtt tttggttgct tctcagctgc tgccatgttg 420gcaaggcgca gggagtactt gtaccttgga ggccttcttt catctggtgt ctccctcctc 480atgtggttgc actttgcatc ctccattttt ggtggtgcca tggccctttt caagtttgag 540gtgtattttg gtttcttggt gtttgtgggc tacatagttt ttgacaccca agaaatcatt 600gagaaggctc acttgggtga tatggattac gtcaagcatg cactcaccct cttcacagat 660tttgttgcag tctttgtgcg gattttgatc atcatgttga agaatgcatt tgagaaggaa 720gagaagaaga agaagaggag aaactag 74711244PRTGlycine max 11Met Asp Ser Phe Asn Ser Phe Phe Asp Ser Thr Asn Arg Trp Asn Tyr 1 5 10 15 Asp Thr Leu Lys Asn Phe Arg Gln Ile Ser Pro Val Val Gln Asn His 20 25 30 Leu Lys Gln Val Tyr Phe Thr Leu Cys Phe Ala Val Val Ala Ala Ala 35 40 45 Val Gly Ala Tyr Leu His Val Leu Leu Asn Ile Gly Gly Phe Leu Thr 50 55 60 Thr Val Ala Cys Val Gly Ser Ser Val Trp Leu Leu Ser Thr Pro Pro 65 70 75 80 Phe Glu Glu Arg Lys Arg Val Thr Leu Leu Met Ala Ala Ser Leu Phe 85 90 95 Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala Ile Gln Ile Asp 100 105 110 Pro Ser Leu Ile Phe Ser Ala Phe Val Gly Thr Ser Leu Ala Phe Ala 115 120 125 Cys Phe Ser Gly Ala Ala Leu Val Ala Arg Arg Arg Glu Tyr Leu Tyr 130 135 140 Leu Gly Gly Leu Val Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu His 145 150 155 160 Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu Phe Lys Phe Glu 165 170 175 Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Ile Val Val Asp Thr

180 185 190 Gln Glu Ile Val Glu Arg Ala His Leu Gly Asp Leu Asp Tyr Val Lys 195 200 205 His Ala Leu Thr Leu Phe Thr Asp Leu Val Ala Val Phe Val Arg Ile 210 215 220 Leu Val Ile Met Leu Lys Asn Ser Ala Glu Arg Asn Glu Lys Lys Lys 225 230 235 240 Lys Arg Arg Asp 121077DNAGlycine max 12tttttttttt ttttttttaa cgtaaaaatt tatcttatta gagaactcaa aacatgtcaa 60catgtactag tgtactactg atataaagca aacaaacgac taaactgcac agttggagca 120agcttaacaa gtgaacaaca ctgtatagac agctgtttta agtattacag tccaagggag 180ttgaagtgtt aactgagcag attggtaaga aaatcaatct ctcctcttct ttttcttctc 240attcctctca gccgaattct tcaacataat aacaagaatc cggacaaaaa ctgcaaccaa 300atcggtaaac aaggtcaagg catgctttac atagtccaga tcgcccaagt gtgccctctc 360aactatttct tgggtgtcta ctacaatgta acctacaaac accaaaagcc caaagtacaa 420ctcaaactta aagagagctg ttgaacctcc aaagatggaa gaagcaaagt gcaaccagag 480aaggatggac aatccagaag aaaccaagcc accaaggtac aggtactccc tacgcctagc 540aaccaaagct gctcctgaga agcatgcaaa ggccaaggat gttcccacaa atgcactaaa 600gataaggctt ggatcgattt gaatagccaa atctatcaag ggtccaatag aggcaccctg 660aaacagtgat gcggccatca acaaagtcac tcttttcctc tcttcaaaag gaggtgtcga 720gagtaaccaa acactgcttc ccacgcatgc cactgtagta agaaaacccc caatgttcaa 780gaggacatga aggtaagccc caacagccgc agcaaccacg gcgaaacaca gagtaaaata 840aacctgcttg aggtgattct gaacgaccgg agaaatttga cggaagtttt tgagagtatc 900gtaattccat cggtttgttg aatcgaagaa ggaattgaag gagtccattg cttgcaatcg 960gagaaacaca aatttggtta atgacggata tggctttgaa tttcaacacc cctaatttat 1020acttcaatca agggaccaac gaaggctaat ttcgcagaag gttccactta agattcc 107713258PRTSorghum bicolor 13Met Asp Ala Phe Tyr Ser Thr Ser Ser Ser Ser Ser Ser Ser Gly Pro 1 5 10 15 Tyr Gly Ala Ala Ala Tyr Gly Gly Ser Gly Trp Gly Tyr Asp Ser Leu 20 25 30 Lys Asn Phe Arg Gln Ile Ser Pro Ala Val Gln Thr His Leu Lys Leu 35 40 45 Val Tyr Leu Thr Leu Cys Val Ala Leu Ala Ser Ser Ala Leu Gly Ala 50 55 60 Tyr Leu His Val Val Trp Asn Ile Gly Gly Met Leu Thr Met Leu Gly 65 70 75 80 Cys Val Gly Ser Ile Ala Trp Leu Phe Ser Val Pro Val Tyr Glu Glu 85 90 95 Arg Lys Arg Tyr Gly Leu Leu Met Ala Ala Ala Leu Leu Glu Gly Ala 100 105 110 Ser Val Gly Pro Leu Ile Lys Leu Ala Val Glu Phe Asp Pro Ser Ile 115 120 125 Leu Val Thr Ala Phe Val Gly Thr Ala Ile Ala Phe Ala Cys Phe Ser 130 135 140 Cys Ala Ala Val Val Ala Lys Arg Arg Glu Tyr Leu Tyr Leu Gly Gly 145 150 155 160 Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu Gln Phe Ala Ala 165 170 175 Ser Ile Phe Gly His Ser Thr Ser Thr Phe Met Phe Glu Val Tyr Phe 180 185 190 Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp Thr Gln Glu Ile 195 200 205 Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile Lys His Ala Leu 210 215 220 Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg Ile Leu Val Ile 225 230 235 240 Met Leu Lys Asn Ala Ala Asp Lys Ser Glu Asp Lys Lys Arg Lys Lys 245 250 255 Arg Ser 141326DNASorghum bicolor 14agatcaaatc aaatccacga gacgagaaca aaacctggtt ccgacccagc acgagacacg 60actcctccat tccaaatcca aatccatcca ttcccccttt gcgtgtggtg cgaggcccac 120cgatcccatc cgatccgatc catttcgcgt cgcgtctacc agagggatca cgacacaccc 180gccgccggag ccggaagaga gagagagaga gatggacgcg ttctactcga cctcctcgtc 240gtcgtcgtcc tcggggccgt acggcgcggc ggcgtacggc ggcagcggct ggggctacga 300ctcgctcaag aacttccgcc agatcagccc cgccgtccag acccacctca agctcgttta 360cctgaccctc tgcgtggcgc tggcctcgtc ggcgctgggc gcttacctgc acgtcgtctg 420gaacatcggc gggatgctga ccatgctcgg ctgcgtcggc agtatcgcct ggctcttctc 480ggtgcccgtc tacgaggaga ggaagaggta cggactgctg atggcggctg ccctcctgga 540aggggcttcg gttggacccc tcatcaagct ggccgtggaa tttgacccaa gcatcctggt 600gacagcgttt gtgggaactg ccattgcgtt cgcgtgcttc tcttgcgcgg ccgtggttgc 660caagcgcagg gagtacctct acctgggcgg gctgctctct tcggggctct ccatcctgct 720ctggctgcag ttcgccgcct ccatctttgg ccactccact agcaccttca tgtttgaggt 780ttactttggg ctgcttatct tcctgggata catggtgtac gacacgcagg agatcatcga 840gagggcgcac cacggcgaca tggactacat caagcacgcc ctcaccctct tcaccgactt 900cgtggctgtc cttgtccgca tcctcgtcat catgctcaag aacgcggctg acaagtcgga 960ggacaagaag aggaagaaga ggtcgtgagc ggtctcacct gtgcgtaagt gcaacactga 1020aggaaggaaa ggcacggcgg gctgcctgct gctactagta gtacaatata tatgaatatg 1080aatcgaagct cctgcatatt atatatagga ggagtaactg ggtgcttgtg atggaactga 1140aagaaagtgt ttcttcgttt tcttgctctc ttattagtct gttagttgtc ctgtaaattg 1200agtctggtaa ggttttgttg cataaacgat acgagcgctg caacaaattg gatctgcttg 1260ccggtgtttt ccggcctgaa aactctgaag atggatggaa tgcgattaag aatgttgcct 1320ttgcac 132615252PRTZea mays 15Met Asp Ala Phe Phe Ser Ala Ser Ser Ala Ser Ala Pro Tyr Gly Tyr 1 5 10 15 Gly Ala Gly Gly Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile 20 25 30 Thr Pro Ala Val Gln Thr His Leu Lys Leu Val Tyr Leu Thr Leu Cys 35 40 45 Ala Ala Leu Ala Ser Ser Ala Val Gly Ala Tyr Leu His Val Val Trp 50 55 60 Asn Ile Gly Gly Thr Leu Thr Met Leu Gly Cys Val Gly Ser Ile Ala 65 70 75 80 Trp Leu Phe Ser Val Pro Val Tyr Glu Glu Arg Lys Arg Tyr Gly Leu 85 90 95 Leu Met Ala Ala Ala Leu Leu Glu Gly Ala Ser Val Gly Pro Leu Val 100 105 110 Lys Leu Ala Val Glu Phe Asp Pro Ser Ile Leu Val Thr Ala Phe Val 115 120 125 Gly Thr Ala Ile Ala Phe Ala Cys Phe Thr Gly Ala Ala Met Val Ala 130 135 140 Arg Arg Arg Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu 145 150 155 160 Ser Ile Leu Leu Trp Leu Gln Leu Ala Gly Ser Ile Phe Gly His Ser 165 170 175 Ala Thr Ser Phe Met Phe Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu 180 185 190 Gly Tyr Val Val Tyr Asp Thr Gln Glu Ile Ile Glu Arg Ala His Arg 195 200 205 Gly Asp Met Asp His Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe 210 215 220 Val Ala Val Leu Val Arg Val Leu Val Ile Met Leu Lys Asn Gly Ala 225 230 235 240 Asp Lys Ser Glu Asp Lys Lys Arg Lys Lys Arg Ser 245 250 161173DNAZea mays 16tcgtccttct ccttcccacc gccacgccac gccacgccac gccggctcgg tacatatact 60agcctgcctc gatcggcctc cctcgcattc cccctcgatc ggcctccctc ccccaagatc 120ctccactcga tcccaaacaa accaacaaat ccatccatcg cacatggacg cgttcttctc 180ggcctcctcc gcgtcggcgc cctacggcta cggcgccggc ggatggagct acgactcgct 240caagaacttc cgccagatca cccccgccgt ccagacccac ctcaagctcg tctacctcac 300cctgtgcgcg gcgctggcct cgtcggcggt gggcgcttac ctgcacgtgg tctggaacat 360cggcggtacg ctgacaatgc tcggttgcgt cggcagcatc gcctggctct tctcggtgcc 420cgtctacgag gagaggaaga ggtatgggct gctgatggcg gctgccctcc tggaaggcgc 480ttcggtcgga cccctcgtca agctcgccgt ggaatttgac ccaagcatcc tggtgacggc 540gttcgtgggg actgccatcg cgttcgcgtg cttcaccggc gcggccatgg tggccaggcg 600cagggagtac ctctacctgg gtgggctgct ctcgtcgggg ctctccatcc tgctctggct 660gcagctagcc ggctccatct tcggccactc cgcaaccagc ttcatgttcg aggtctactt 720cgggctgctc atcttcctgg gctacgtggt gtacgacacg caggagatca tcgagagggc 780gcaccgcggc gacatggacc acgtcaagca cgccctcacc ctcttcacag acttcgtggc 840cgtcctcgtc cgcgtcctcg tcatcatgct caagaacggg gccgacaagt cggaggacaa 900gaagaggaag aagaggtcgt gagcgcgtcg agaagggaag ctcttccact tccacatatg 960cataggagta actgctgggg ttccttcctg gggtggaagt gtggaactga gctgagtgtt 1020cagaagtgtt cctttgttcg gcacctttgt tctcttcctc tcttgatgag tctgtaaata 1080gctatgtcaa tctggttaag cttggtttgg ttgcctgtgc ctgtgttcgc tggcctttgg 1140atagaatgca aattaaagat gttgctattg cac 117317247PRTTriticum aestivum 17Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly 1 5 10 15 Tyr Asp Ser Leu Lys Asn Phe Arg Glu Ile Ser Pro Ala Val Gln Ser 20 25 30 His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser 35 40 45 Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu 50 55 60 Thr Met Leu Ala Cys Ile Gly Thr Ile Ala Trp Met Phe Ser Val Pro 65 70 75 80 Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu 85 90 95 Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe 100 105 110 Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe 115 120 125 Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu 130 135 140 Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu 145 150 155 160 Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe 165 170 175 Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp 180 185 190 Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile 195 200 205 Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg 210 215 220 Ile Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys 225 230 235 240 Lys Lys Arg Lys Arg Arg Ser 245 18744DNATriticum aestivum 18atggacgcct tctactcgac ctcgtcggcg gcggccagcg gatggggcta cgactccctc 60aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatt 180ggcgggatgc tgacaatgct cgcgtgtatc ggaaccatcg cctggatgtt ctcggtgcca 240gtctatgagg agaggaagag gtttgggctg ctgatgggtg cagccctcct ggaaggggct 300tcagttggac ctctgattga gcttgccata gactttgacc caagcatcct cgtgacaggg 360tttgtcggaa ccgccatcgc cttcgggtgc ttctctggcg ccgccatcat cgccaagcgc 420agggagtacc tgtacctcgg cggcctgctc tcctctggcc tgtcgatcct gctctggctg 480cagtttgcca cgtccatctt tggccactcc tctggcagct tcatgtttga ggtctacttt 540ggcctgttga tcttcctggg gtacatggtg tacgacacgc aggagatcat cgagagggcg 600caccacggtg acatggacta catcaagcac gcgctcaccc tcttcaccga cttcgtcgcc 660gtcctcgtcc gcatcctcat catcatgctc aagaacgcag gcgacaagtc ggaggacaag 720aagaagagga agaggaggtc ctga 74419247PRTTriticum aestivum 19Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly 1 5 10 15 Tyr Asp Ser Leu Lys Asn Phe Arg Glu Ile Ser Pro Ala Val Gln Ser 20 25 30 His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser 35 40 45 Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu 50 55 60 Thr Met Leu Ala Cys Val Gly Thr Ile Ala Trp Met Phe Ser Val Pro 65 70 75 80 Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu 85 90 95 Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe 100 105 110 Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe 115 120 125 Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu 130 135 140 Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu 145 150 155 160 Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe 165 170 175 Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp 180 185 190 Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile 195 200 205 Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg 210 215 220 Ile Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys 225 230 235 240 Lys Lys Arg Lys Arg Arg Ser 245 20744DNATriticum aestivum 20atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcta cgactccctc 60aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatc 180ggtgggatgc tgacaatgct cgcgtgtgtt ggaaccatcg cctggatgtt ctctgtgcca 240gtctatgagg agaggaagag gtttgggctg ctgatgggtg cagccctcct ggaaggggct 300tcggttggac ctctgattga gcttgccata gactttgacc caagtatcct cgtgacaggg 360tttgtcggaa ccgccatcgc cttcgggtgc ttctctggcg ccgccatcat cgccaagcgc 420agggagtacc tgtacctcgg tggcctgctc tcctccggcc tgtcgatcct gctctggctg 480cagtttgcca cgtccatctt tggccactcc tctggcagct tcatgtttga ggtttacttt 540ggcctgttga tctttctggg atacatggtg tacgacacgc aggagatcat cgagagggcg 600caccacggcg acatggacta catcaagcac gcgctcaccc tcttcaccga ctttgtcgcc 660gtcctcgtcc ggatcctcat catcatgctc aagaacgcag gcgacaagtc ggaggacaag 720aagaagagga agaggaggtc ctga 74421246PRTGlycine max 21Met Asp Thr Phe Phe Lys Ser Pro Ser Ser Ser Ser Ser Arg Ser Ser 1 5 10 15 Trp Ser Tyr Asp Thr Leu Lys Asn Phe Arg Glu Ile Ser Pro Leu Val 20 25 30 Gln Asn His Ile Lys Leu Val Tyr Phe Thr Leu Cys Cys Ala Val Val 35 40 45 Ala Ala Ala Val Gly Ala Phe Leu His Val Leu Trp Asn Ile Gly Gly 50 55 60 Phe Leu Thr Thr Val Ala Ser Ile Gly Ser Met Phe Trp Leu Leu Ser 65 70 75 80 Thr Pro Pro Phe Glu Glu Gln Lys Arg Leu Ser Leu Leu Met Ala Ser 85 90 95 Ala Leu Phe Gln Gly Ala Ser Ile Gly Pro Leu Ile Gly Leu Ala Phe 100 105 110 Ala Ile Asp Pro Gly Leu Ile Ile Gly Ala Phe Val Ala Thr Ser Leu 115 120 125 Ala Phe Ala Cys Phe Ser Ala Val Ala Leu Val Ala Arg Arg Arg Glu 130 135 140 Tyr Pro Tyr Leu Gly Gly Leu Leu Ser Ser Trp Leu Ser Ile Leu Met 145 150 155 160 Trp Leu His Ser Asp Ser Ser Leu Phe Gly Gly Ser Ile Ala Leu Phe 165 170 175 Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Val Ile 180 185 190 Val Asp Thr Gln Val Ile Ile Glu Arg Ala His Phe Gly Asp Leu Asp 195 200 205 Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Leu Ala Ala Ile Phe 210 215 220 Val Arg Ile Leu Asn Ile Met Leu Asn Asn Ser Ser Lys Arg Asn Glu 225 230 235 240 Lys Lys Arg Arg Arg Asp 245 221051DNAGlycine max 22tttttttttt ttttttgaaa caaaggcagt aaataatcat ttggaagaac ctgtccgcaa 60gtttatacta tatattatga ttattagcaa atacatatga aaatgtttaa aagaaatcct 120gacatttacc attacagcaa acacatagct aactactaac tacacaaggg gaccaacaac 180ttctaaacag ctaattatgt attctctaca aaccaaatta ctctacacat agcaatcggt 240caacctatta atctctcctc ctcttcttct catttctctt agatgaatta ttcaacatta 300tattaagaat tcgcacaaag attgcagcca aatcagtgaa cagtgtcaat gcatgcttaa 360cataatccag gtcaccaaag tgagccctct caatgattac ttgagtgtct actataacgt 420agcccacaaa caccaaaagc ccaaagtaca actcaaattt gaatagagct atagagcccc 480caaagagaga ggaatcagag tgcaaccaca taagaatgga aagccaagaa gaaagcaaac 540caccaaggta ggggtactcc cttcgccttg caactaaggc tactgcagaa aagcaagcaa 600aagccaaaga agttgccaca aatgcgccaa tgataaggcc aggatcaatg gcaaaagcca 660aaccaatcag aggtccaatg gaagcaccct gaaacagggc cgaagccatc aacagagaca 720acctcttctg ctcttcaaaa gggggtgtag atagcaacca aaacatgctc ccaatggaag 780ccaccgtggt gagaaaaccg ccaatgttcc acagaacatg aaggaaggct ccaacagcag 840cagccaccac agcgcaacat aacgtaaaat aaaccagttt gatgtgattc tgaacgagcg 900gagagatctc gcggaaattc ttgagagtat cgtaactcca gctgcttcta gaagaagaag 960acgatgggga cttgaagaaa gtgtccatcg aaaacaagga atcaaatcgt atcgttttcg 1020tgatgtgatt attacaagca caattggttc c

105123247PRTHordeum vulgare 23Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly 1 5 10 15 His Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala Val Gln Ser 20 25 30 His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser 35 40 45 Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu 50 55 60 Thr Met Leu Ala Cys Val Gly Thr Ile Ala Trp Met Phe Ser Val Pro 65 70 75 80 Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu 85 90 95 Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe 100 105 110 Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe 115 120 125 Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu 130 135 140 Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu 145 150 155 160 Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe 165 170 175 Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp 180 185 190 Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile 195 200 205 Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg 210 215 220 Val Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys 225 230 235 240 Lys Lys Arg Lys Arg Arg Ser 245 241177DNAHordeum vulgare 24gagcggagaa ggcgaaaaac agaaggagaa aaatccaccc caaaacgcga gcgcaggaca 60agcgaggaac cttgcgtgcg aggcgaggcc gccccgctcc gattcgattc gacgcgcagg 120cgcaggcgca gggatggacg ccttctactc gacctcgtcg gcggcggcga gcggctgggg 180ccacgactcc ctcaagaact tccgccagat ctcccccgcc gtgcagtccc acctcaagct 240cgtttacctg actctatgct ttgcactggc ctcatctgcc gtgggtgctt acctacacat 300tgccctgaac atcggcggga tgctgacaat gctcgcttgt gtcggaacta tcgcctggat 360gttctcggtg ccagtctatg aggagaggaa gaggtttggg ctgctgatgg gtgcagccct 420cctggaaggg gcttcggttg gacctctgat tgagcttgcc atagactttg acccaagcat 480cctcgtgaca gggtttgtcg gaaccgccat cgcctttggg tgcttctctg gcgccgccat 540catcgccaag cgcagggagt acctgtacct cggtggcctg ctctcgtctg gcctgtcgat 600cctgctctgg ctgcagtttg ccacgtccat ctttggccac tcctctggca gcttcatgtt 660tgaggtttac tttggcctgt tgatcttcct ggggtacatg gtgtacgaca cgcaggagat 720catcgagagg gcgcaccatg gcgacatgga ctacatcaag cacgccctca ccctcttcac 780cgactttgtt gccgtcctcg tccgagtcct catcatcatg ctcaagaacg caggcgacaa 840gtcggaggac aagaagaaga ggaagaggag gtcctgaacg tttttcccgc acatgtagat 900accgtcaccg ccgccgctac tggtaccccc ccccccgcta agtacgtagt aggaattaag 960ctggcgcagt aacttggcgc cgtgccatcc ttgttaattt gtgttcgtgt gaaccttgtg 1020tgagtctgct gctgctgatg aagcttttgc agccgcccgt ctgcgttccg aatctcttgt 1080gttgttgtta ctgtcaggat aatgaatcga acgaaacctg agacgatttg gttttggttt 1140ggtttgcgaa gaacatggct acgcttgttt gtgaatg 117725249PRTOryza sativa 25Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Tyr Gly Ala Ala Ala Ser 1 5 10 15 Gly Trp Gly Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala 20 25 30 Val Gln Ser His Leu Lys Leu Val Tyr Leu Thr Leu Cys Val Ala Leu 35 40 45 Ala Ala Ser Ala Val Gly Ala Tyr Leu His Val Ala Leu Asn Ile Gly 50 55 60 Gly Met Leu Thr Met Leu Gly Cys Val Gly Ser Ile Ala Trp Leu Phe 65 70 75 80 Ser Val Pro Val Phe Glu Glu Arg Lys Arg Phe Gly Ile Leu Leu Ala 85 90 95 Ala Ala Leu Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Lys Leu Ala 100 105 110 Val Asp Phe Asp Ser Ser Ile Leu Val Thr Ala Phe Val Gly Thr Ala 115 120 125 Ile Ala Phe Gly Cys Phe Thr Cys Ala Ala Ile Val Ala Lys Arg Arg 130 135 140 Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu 145 150 155 160 Leu Trp Leu Gln Phe Ala Ala Ser Ile Phe Gly His Ser Thr Gly Ser 165 170 175 Phe Met Phe Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met 180 185 190 Val Tyr Asp Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met 195 200 205 Asp Tyr Ile Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val 210 215 220 Leu Val Arg Ile Leu Val Ile Met Leu Lys Asn Ala Ser Asp Lys Ser 225 230 235 240 Glu Glu Lys Lys Arg Lys Lys Arg Ser 245 261191DNAOryza sativa 26ttccttttta tccgacgatt caaaaaattc gaagccatcc accaacgaag aaaaaaaaaa 60gggagaaaaa aaaatccacg cacactttgc gtgcgaggcg aggcggttcg attcgagagg 120agagagagag agagagagag agagagagat ggacgccttc tactcgacct cgtcggcgta 180cggagcggcg gcgagcggct ggggctacga ctcgctgaag aacttccgcc agatctcccc 240cgccgtccag tcccacctca agctcgttta cctgacacta tgcgtcgccc tggctgcgtc 300ggcggtgggc gcatacctgc acgtcgcctt gaacatcggc gggatgttga ctatgctcgg 360gtgcgtgggg agcatcgcct ggttgttctc ggtgcctgtc tttgaggaga ggaagaggtt 420tgggattctc ttggccgctg ccctgctgga aggggcttca gttgggcctc tgatcaagct 480tgctgtagac tttgactcaa gcattctcgt aacagcattt gttggaactg ccattgcatt 540tgggtgcttc acttgcgctg ccatcgttgc caagcgtagg gagtacctct accttggtgg 600tttgctctct tctggcctct ccatcctgct ctggctgcag tttgccgcat ccatctttgg 660ccactccacc ggcagcttca tgtttgaggt ttactttggc ctgttgatct tcctggggta 720catggtgtat gacacgcagg agatcatcga gagggctcac cacggtgaca tggactacat 780caagcacgca ctcaccctct tcactgactt cgtggccgtc cttgtccgga tcctcgtcat 840catgctcaag aacgcgtctg acaagtcgga ggagaagaag aggaagaaga ggtcttgaga 900gcttctcttc ccgctttgca cataagaaaa aaccaccgcg gctattgcct ctacgtatta 960tgacagagcc gcacttcaac tgggttttat ggtgaataca agttcttttg cattttgttg 1020atacggtgtg aatcttctca ggtttgtcgt cgtagtagct ttgcaaatac tagcatgcta 1080catgacacgg atctttctgt aatggtggtc gcgttgatcg aaacgtgaaa acacatcttc 1140atttgcgact aatttgtttg ccttttggtg attgatgatg atcctttccc c 119127250PRTCucumis sativus 27Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Ser Gly Ser Arg Thr 1 5 10 15 Arg Trp Ser His Glu Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala 20 25 30 Val Gln Ser His Leu Gln Arg Val Tyr Leu Thr Leu Gly Cys Ala Leu 35 40 45 Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly 50 55 60 Gly Phe Leu Thr Thr Leu Ala Thr Ile Gly Cys Ile Thr Trp Leu Met 65 70 75 80 Ala Thr Pro Pro Tyr Glu Glu Lys Lys Arg Ala Ser Ile Leu Leu Gly 85 90 95 Ala Ala Leu Leu Glu Gly Ala Ser Ile Gly Pro Leu Ile Ser Leu Ala 100 105 110 Ile Asp Phe Asp Pro Ser Val Leu Val Ser Ala Phe Val Gly Thr Ala 115 120 125 Val Ala Phe Cys Cys Phe Ser Gly Ala Ala Leu Leu Ala Arg Arg Arg 130 135 140 Glu Phe Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Met Leu 145 150 155 160 Leu Trp Leu His Phe Ala Ser Ser Leu Phe Gly Gly Ser Thr Ala Leu 165 170 175 Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Met 180 185 190 Val Val Asp Thr Gln Glu Ile Ile Glu Met Ala His Met Gly Asp Met 195 200 205 Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Ile Ala Val 210 215 220 Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Asn 225 230 235 240 Glu Arg Glu Arg Lys Lys Lys Arg Arg Asp 245 250 28753DNACucumis sativus 28atggacgcat tctcttcttt cttcgattct caatctggat ccagaacccg ctggagtcat 60gaatctctca agaacttccg gcagatttcg cccgccgttc aatctcatct tcagcgggtt 120tatctcactc ttggttgtgc tttggttgca tctgctgctg gagcttatct gcatatactt 180tggaatattg gtggttttct tacaacactt gcaactatcg gatgtattac atggctaatg 240gccactcctc cttatgaaga gaaaaagagg gcctctattt tacttggggc tgctcttctc 300gaaggggctt ccattggtcc tttgatcagt ctggctattg attttgaccc aagtgttctg 360gtgagcgctt tcgtgggaac tgcggttgcc ttttgttgtt tctcaggagc agccttgttg 420gcaagacgta gagaattcct ttatctcggt ggcttacttt cttccggtgt atccatgtta 480ctctggttac atttcgcctc ctctttattc ggtggttcta ctgccctttt caagtttgag 540ttgtactttg ggctgttggt ttttgttggc tacatggtag ttgatactca ggaaataatt 600gagatggcac atatgggtga tatggattat gtgaaacatg cattaactct cttcactgat 660ttcattgcgg tgtttgtccg aattctcatt ataatgctaa agaactctgc tgagaagaac 720gagagggaga ggaagaagaa gaggagggac tga 75329249PRTCucumis sativus 29Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Gln Pro Ser Thr Asn 1 5 10 15 Pro Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Val 20 25 30 Val Gln Ser His Leu His Gln Val Tyr Leu Thr Leu Gly Cys Ala Leu 35 40 45 Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly 50 55 60 Gly Ile Leu Thr Ala Leu Ala Gly Ile Gly Cys Ile Thr Trp Leu Met 65 70 75 80 Ala Thr Pro Pro Tyr Glu Glu Arg Lys Arg Leu Ser Met Leu Met Ala 85 90 95 Ala Ala Leu Leu Glu Gly Ala Ser Ile Gly Pro Leu Ile Gly Leu Ala 100 105 110 Ile Glu Ile Asp Pro Ser Val Leu Val Ser Ala Phe Val Gly Thr Ala 115 120 125 Val Ala Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg 130 135 140 Glu Phe Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Ile Ser Met Leu 145 150 155 160 Leu Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu 165 170 175 Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Leu Phe Val Gly Tyr Met 180 185 190 Val Val Asp Thr Gln Glu Ile Ile Glu Arg Ala His Leu Gly Asp Met 195 200 205 Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Gly Val 210 215 220 Phe Val Arg Leu Leu Ile Ile Met Val Arg Asn Ser Val Glu Lys Asn 225 230 235 240 Glu Glu Lys Lys Lys Lys Arg Arg Asp 245 30750DNACucumis sativus 30atggatgcct tttcatcttt cttcgattct caacaacctt ctacaaaccc ttggacctac 60gattctctca agaatttccg gcagatttcc cccgtcgttc aatctcatct ccaccaggtt 120taccttactc tgggttgtgc tttggttgca tctgctgctg gagcttatct ccatattctg 180tggaacattg gcggaatcct cactgcactt gctggtattg gatgcatcac atggctaatg 240gccactcctc cttatgaaga gagaaagagg ctttctatgt taatggcggc tgctcttctt 300gaaggagcat caattggtcc tttgattggg ttggctatcg agattgatcc aagtgttctg 360gtcagtgcct ttgtgggaac tgctgtggct tttggttgtt tctctgcagc agccatgttg 420gcaagacgta gagaattcct ttacctgggt ggcttacttt cttctgggat atccatgtta 480ctctggttgc atttcgcttc atctatattc ggtggttcta ctgctctttt caagtttgag 540ttgtactttg ggctattgct gtttgtgggc tacatggtag ttgatactca agaaataatc 600gagagggctc atcttggtga tatggactat gtgaagcatg ccctgactct tttcactgat 660ttcgttggtg ttttcgtccg acttctcatt attatggtaa ggaactcggt agagaagaat 720gaggagaaaa agaagaagag gagggactaa 75031247PRTGossypium hirsutum 31Met Gly Thr Phe Ser Ser Phe Phe Asp Ser Gln Ser Arg Ser Gln Trp 1 5 10 15 Asn Tyr Asn Thr Leu Lys Asn Phe Arg Gln Ile Ser Pro Ile Val Gln 20 25 30 Thr His Leu Lys Lys Val Tyr Met Thr Leu Cys Cys Met Leu Val Ala 35 40 45 Ser Ala Phe Gly Ala Tyr Leu His Ile Ile Trp Asn Ile Gly Gly Tyr 50 55 60 Leu Thr Thr Phe Ala Cys Phe Gly Ala Ile Ile Trp Leu Arg Ser Thr 65 70 75 80 Pro Pro Cys Gln Glu Gln Lys Arg Val Ser Leu Leu Met Ala Ser Ala 85 90 95 Val Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala Ile Gln 100 105 110 Ile Asp Pro Ser Val Leu Val Ala Ala Phe Val Gly Thr Ala Leu Ala 115 120 125 Phe Ala Cys Phe Ser Arg Ala Ala Met Leu Ala Arg Arg Arg Glu Tyr 130 135 140 Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Met Leu Leu Trp 145 150 155 160 Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu Phe Lys 165 170 175 Met Glu Ile Tyr Leu Gly Leu Leu Val Phe Val Gly Tyr Met Val Val 180 185 190 Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly Asp Leu Asp Tyr 195 200 205 Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Phe Val 210 215 220 Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Gly Glu Arg 225 230 235 240 Gln Lys Lys Lys Arg Ser Asp 245 32934DNAGossypium hirsutum 32aacgaacgat gggcacgttc tcgtctttct tcgattctca atcgagaagc cagtggaatt 60acaacactct caagaatttc cgtcagatct ctccgattgt tcaaacgcat ctcaaaaagg 120tttatatgac cctatgttgt atgcttgttg cctctgcctt tggggcttat cttcatataa 180tttggaacat tgggggttac ctcacgacat ttgcatgctt tggagccata atttggctcc 240gttctacccc tccttgtcaa gagcaaaaga gggtttctct tctaatggca tcagcagttt 300ttgaaggagc ttcaattggt cctctaattg acttggccat tcaaattgac ccaagtgttc 360tggtagctgc attcgtggga acagcattgg cctttgcatg cttttcaaga gctgccatgt 420tagcaaggcg gagagagtac ctctaccttg gtggcttgct ttcatctggt gtgtccatgc 480ttctctggtt gcattttgct tcttctatct ttggtggttc tacagccctc tttaagatgg 540agatctactt agggctcttg gtgtttgttg gctacatggt agtggacaca caagacataa 600ttgagaaggc acacttgggt gatctggatt atgtaaagca tgctttgaca ctttttactg 660atttcgttgc cgtatttgtt cgcattctga taatcatgtt gaaaaattca gctgagaagg 720gtgagagaca gaagaagaag aggagtgact aaatcataaa gcaccctatg gaataggctt 780ctcatctaat cctccgtgtt gaactctatt tttaatacaa gttttatttc ttgattccat 840tgtgaataca tgtgttgata tacgggaagg ttaggtcttt actgtttctg tttcttcggt 900ggtttttctg atatggaacc tttaaactaa tgac 934331127DNALactuca sativa 33caacgcctta caggcagacg actttcgcat atcggtatag caaacataac attgtctacg 60ttcagataaa tatcctttgc tcatttcagt tccaaaaact cgaagaagaa gaagaagaga 120acaatggaag gtttcacatc gttcttcgac tcgcaatctg cctctcgcaa ccgctggagt 180tatgattctc tcaaaaactt ccgccagatc tcacctctcg ttcaaactca tctcaagcag 240gtgtacctta cgctatgctg tgctttagtg gcatcggctg ctggggctta ccttcacatt 300ctatggaata tcggtggcct cctcacaaca atggcttgca tgggaagcat ggtgtggctt 360ctctcagctc ctccttatca agagcaaaaa agggtggctc ttctgatggc agctgcactt 420tttgaaggcg cctctattgg tcctctgatt gagctgggca ttaacttcga tccaagcatt 480gtgtttggcg cttttgtagg ttgtgctgtg gtttttggtt gcttctcagc tgctgccatg 540ttggcaaggc gcagggagta cttgtacctc gggggccttc tttcatctgg cgtctccctt 600ctcttctggt tgcactttgc atcctccatt tttggtggtt ccatggctgt tttcaagttt 660gagttgtatt ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt 720attgagaagg ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca 780gattttgtcg ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag 840gaagagaaga agaagaagag gagaaactag atttgcttct caacttgtgg tttccataac 900tccttgtgtt cacctgaaac aagcatgtta atagtttgat acttgcttca ctttagcata 960ggctgtgatg taatgtcgtg tgacatgcca ttatggctgt gtgattgagc atctagcctt 1020tttatcttct aaagcttttt tcttaacatt gataaggaaa gttccttgtg ataacattta 1080agaccatttt aatttctcct ttctcattca aaaaaaaaaa aaaaaaa 112734200DNALactuca sativa 34ccaccgatgt tccataggat gtgaaggtaa gccccaactg cagatgccat gagagcacaa 60catagtgaga ggtaaacctg tttgagatga gtctgaacta agggagagat ttgacggaaa 120ttcttgagag aatcgtaggt ccagctgttt ggagaagccg atcgcgattg tgaatcgaag 180aacgatgaga atgattccat 20035200DNALactuca sativa 35ttgggctgtt ggtgtttgtt gggtacatgg tggttgacac ccaagatatc attgaaaagg 60ctcatcttgg agatttggat tatgtgaaac atgctcttac gcttttcact gatttcattg 120ctgtttttgt tcgcattctt atcatcatgt tgaagaattc ggctgaaaga gaagagaaga 180agaagaagag gagggattag 20036200DNALactuca sativa 36ctaatccctc ctcttcttct tcttctcttc tctttcagcc gaattcttca acatgatgat

60aagaatgcga acaaaaacag caatgaaatc agtgaaaagc gtaagagcat gtttcacata 120atccaaatct ccaagatgag ccttttcaat gatatcttgg gtgtcaacca ccatgtaccc 180aacaaacacc aacagcccaa 20037200DNASolanum lycopersicum 37atggaaggtt tcacatcgtt cttcgactcg caatctgcct ctcgcaaccg ctggagttat 60gattctctca aaaacttccg ccagatctca cctctcgttc aaactcatct caagcaggtg 120taccttacgc tatgctgtgc tttagtggca tcggctgctg gggcttacct tcacattcta 180tggaatatcg gtggcctcct 20038200DNASolanum lycopersicum 38aggaggccac cgatattcca tagaatgtga aggtaagccc cagcagccga tgccactaaa 60gcacagcata gcgtaaggta cacctgcttg agatgagttt gaacgagagg tgagatctgg 120cggaagtttt tgagagaatc ataactccag cggttgcgag aggcagattg cgagtcgaag 180aacgatgtga aaccttccat 20039200DNASolanum lycopersicum 39ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt attgagaagg 60ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca gattttgtcg 120ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag gaagagaaga 180agaagaagag gagaaactag 20040200DNASolanum lycopersicum 40ctagtttctc ctcttcttct tcttctcttc cttctcagat gcattcttta acatgatgat 60cagaatccgc acaaaaacag cgacaaaatc tgtgaaaagg gtcaatgcat gcttaacgta 120atccatatca cccaagtgag ccttctcaat aatttcttgg gtgtcaaaga cgatgtagcc 180cacaaacacc aagagtccaa 20041200DNAVitis vinifera 41atggaggcgt tctctgcgtt tttcgattca caatcgagct caaggagcgg ttggacctac 60gattcactca agaatttccg ccagatttct cctgccgttc aaactcatct caagcaggtt 120tatctctccc tgtgctgtgc cttgattgca tctgctgcag gagcttacct gcatcttctc 180tggaatattg gtggccttct 20042200DNAVitis vinifera 42agaaggccac caatattcca gagaagatgc aggtaagctc ctgcagcaga tgcaatcaag 60gcacagcaca gggagagata aacctgcttg agatgagttt gaacggcagg agaaatctgg 120cggaaattct tgagtgaatc gtaggtccaa ccgctccttg agctcgattg tgaatcgaaa 180aacgcagaga acgcctccat 20043200DNAVitis vinifera 43ttggactgtt ggtgtttgtg ggctacatgg tagtagacac ccaggacata atagagaaag 60cccatctcgg ggatcgggac tatgtgaaac attctctcct ccttttcact gattttgctg 120cagtttttgt tcgaatcctg attatcatgt tgaagaactc ggctgaaaag agtgagaaga 180agaagaaaag gagaaattga 20044200DNAVitis vinifera 44tcaatttctc cttttcttct tcttctcact cttttcagcc gagttcttca acatgataat 60caggattcga acaaaaactg cagcaaaatc agtgaaaagg aggagagaat gtttcacata 120gtcccgatcc ccgagatggg ctttctctat tatgtcctgg gtgtctacta ccatgtagcc 180cacaaacacc aacagtccaa 20045200DNACapsicum annuum 45atggagggtt tcacgtcgtt cttcgaatcg caatcggctt ctcgcagtcg ctggaattat 60gatgctctca aaaacttcca tcagatctct cctcgtgttc aaactcatct caaacaggtc 120tacctcacac tatgctgtgc tttagtcgca tcagctgctg gggcttacct tcacattctt 180tggaacatcg gtggcttcct 20046200DNACapsicum annuum 46aggaagccac cgatgttcca aagaatgtga aggtaagccc cagcagctga tgcgactaaa 60gcacagcata gtgtgaggta gacctgtttg agatgagttt gaacacgagg agagatctga 120tggaagtttt tgagagcatc ataattccag cgactgcgag aagccgattg cgattcgaag 180aacgacgtga aaccctccat 20047200DNACapsicum annuum 47ttggtttctt ggtgtttgtg ggctacatag tttttgacac ccaagaaatc attgagaagg 60ctcacttggg tgatatggat tacgtcaagc atgcactcac cctcttcaca gattttgttg 120cagtctttgt gcggattttg atcatcatgt tgaagaatgc atttgagaag gaagagaaga 180agaagaagag gagaaactag 20048200DNACapsicum annuum 48ctagtttctc ctcttcttct tcttctcttc cttctcaaat gcattcttca acatgatgat 60caaaatccgc acaaagactg caacaaaatc tgtgaagagg gtgagtgcat gcttgacgta 120atccatatca cccaagtgag ccttctcaat gatttcttgg gtgtcaaaaa ctatgtagcc 180cacaaacacc aagaaaccaa 20049200DNAGlycine max 49atggactcct tcaattcctt cttcgattca acaaaccgat ggaattacga tactctcaaa 60aacttccgtc aaatttctcc ggtcgttcag aatcacctca agcaggttta ttttactctg 120tgtttcgccg tggttgctgc ggctgttggg gcttaccttc atgtcctctt gaacattggg 180ggttttctta ctacagtggc 20050200DNAGlycine max 50gccactgtag taagaaaacc cccaatgttc aagaggacat gaaggtaagc cccaacagcc 60gcagcaacca cggcgaaaca cagagtaaaa taaacctgct tgaggtgatt ctgaacgacc 120ggagaaattt gacggaagtt tttgagagta tcgtaattcc atcggtttgt tgaatcgaag 180aaggaattga aggagtccat 20051200DNAGlycine max 51ttgggctttt ggtgtttgta ggttacattg tagtagacac ccaagaaata gttgagaggg 60cacacttggg cgatctggac tatgtaaagc atgccttgac cttgtttacc gatttggttg 120cagtttttgt ccggattctt gttattatgt tgaagaattc ggctgagagg aatgagaaga 180aaaagaagag gagagattga 20052200DNAGlycine max 52tcaatctctc ctcttctttt tcttctcatt cctctcagcc gaattcttca acataataac 60aagaatccgg acaaaaactg caaccaaatc ggtaaacaag gtcaaggcat gctttacata 120gtccagatcg cccaagtgtg ccctctcaac tatttcttgg gtgtctacta caatgtaacc 180tacaaacacc aaaagcccaa 20053200DNASorghum bicolor 53atggacgcgt tctactcgac ctcctcgtcg tcgtcgtcct cggggccgta cggcgcggcg 60gcgtacggcg gcagcggctg gggctacgac tcgctcaaga acttccgcca gatcagcccc 120gccgtccaga cccacctcaa gctcgtttac ctgaccctct gcgtggcgct ggcctcgtcg 180gcgctgggcg cttacctgca 20054200DNASorghum bicolor 54tgcaggtaag cgcccagcgc cgacgaggcc agcgccacgc agagggtcag gtaaacgagc 60ttgaggtggg tctggacggc ggggctgatc tggcggaagt tcttgagcga gtcgtagccc 120cagccgctgc cgccgtacgc cgccgcgccg tacggccccg aggacgacga cgacgaggag 180gtcgagtaga acgcgtccat 20055200DNASorghum bicolor 55ggctgcttat cttcctggga tacatggtgt acgacacgca ggagatcatc gagagggcgc 60accacggcga catggactac atcaagcacg ccctcaccct cttcaccgac ttcgtggctg 120tccttgtccg catcctcgtc atcatgctca agaacgcggc tgacaagtcg gaggacaaga 180agaggaagaa gaggtcgtga 20056200DNASorghum bicolor 56tcacgacctc ttcttcctct tcttgtcctc cgacttgtca gccgcgttct tgagcatgat 60gacgaggatg cggacaagga cagccacgaa gtcggtgaag agggtgaggg cgtgcttgat 120gtagtccatg tcgccgtggt gcgccctctc gatgatctcc tgcgtgtcgt acaccatgta 180tcccaggaag ataagcagcc 20057200DNAZea mays 57atggacgcgt tcttctcggc ctcctccgcg tcggcgccct acggctacgg cgccggcgga 60tggagctacg actcgctcaa gaacttccgc cagatcaccc ccgccgtcca gacccacctc 120aagctcgtct acctcaccct gtgcgcggcg ctggcctcgt cggcggtggg cgcttacctg 180cacgtggtct ggaacatcgg 20058200DNAZea mays 58ccgatgttcc agaccacgtg caggtaagcg cccaccgccg acgaggccag cgccgcgcac 60agggtgaggt agacgagctt gaggtgggtc tggacggcgg gggtgatctg gcggaagttc 120ttgagcgagt cgtagctcca tccgccggcg ccgtagccgt agggcgccga cgcggaggag 180gccgagaaga acgcgtccat 20059200DNAZea mays 59ggctgctcat cttcctgggc tacgtggtgt acgacacgca ggagatcatc gagagggcgc 60accgcggcga catggaccac gtcaagcacg ccctcaccct cttcacagac ttcgtggccg 120tcctcgtccg cgtcctcgtc atcatgctca agaacggggc cgacaagtcg gaggacaaga 180agaggaagaa gaggtcgtga 20060200DNAZea mays 60tcacgacctc ttcttcctct tcttgtcctc cgacttgtcg gccccgttct tgagcatgat 60gacgaggacg cggacgagga cggccacgaa gtctgtgaag agggtgaggg cgtgcttgac 120gtggtccatg tcgccgcggt gcgccctctc gatgatctcc tgcgtgtcgt acaccacgta 180gcccaggaag atgagcagcc 20061200DNATriticum aestivum 61atggacgcct tctactcgac ctcgtcggcg gcggccagcg gatggggcta cgactccctc 60aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatt 180ggcgggatgc tgacaatgct 20062200DNATriticum aestivum 62agcattgtca gcatcccgcc aatgttcagg gcaatgtgca ggtaagcacc cacggcagat 60gaggccaggg caaagcatag ggtcaggtaa acgagcttga ggtgggactg cacggcgggg 120gagatctcgc ggaagttctt gagggagtcg tagccccatc cgctggccgc cgccgacgag 180gtcgagtaga aggcgtccat 20063200DNATriticum aestivum 63tgttgatctt cctggggtac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60acggtgacat ggactacatc aagcacgcgc tcaccctctt caccgacttc gtcgccgtcc 120tcgtccgcat cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180agaggaagag gaggtcctga 20064200DNATRiticum aestivum 64tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60gatgatgagg atgcggacga ggacggcgac gaagtcggtg aagagggtga gcgcgtgctt 120gatgtagtcc atgtcaccgt ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180gtaccccagg aagatcaaca 20065200DNATriticum aestivum 65atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcta cgactccctc 60aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatc 180ggtgggatgc tgacaatgct 20066200DNATriticum aestivum 66agcattgtca gcatcccacc gatgttcagg gcaatgtgca ggtaagcacc cacggcagat 60gaggccaggg caaagcatag ggtcaggtaa acgagcttga ggtgggactg cacggcgggg 120gagatctcgc ggaagttctt gagggagtcg tagccccagc cgctcgccgc cgccgacgag 180gtcgagtaga aggcgtccat 20067200DNATriticum aestivum 67tgttgatctt tctgggatac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60acggcgacat ggactacatc aagcacgcgc tcaccctctt caccgacttt gtcgccgtcc 120tcgtccggat cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180agaggaagag gaggtcctga 20068200DNATriticum aestivum 68tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60gatgatgagg atccggacga ggacggcgac aaagtcggtg aagagggtga gcgcgtgctt 120gatgtagtcc atgtcgccgt ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180gtatcccaga aagatcaaca 20069200DNAGlycine max 69atggacactt tcttcaagtc cccatcgtct tcttcttcta gaagcagctg gagttacgat 60actctcaaga atttccgcga gatctctccg ctcgttcaga atcacatcaa actggtttat 120tttacgttat gttgcgctgt ggtggctgct gctgttggag ccttccttca tgttctgtgg 180aacattggcg gttttctcac 20070200DNAGlycine max 70gtgagaaaac cgccaatgtt ccacagaaca tgaaggaagg ctccaacagc agcagccacc 60acagcgcaac ataacgtaaa ataaaccagt ttgatgtgat tctgaacgag cggagagatc 120tcgcggaaat tcttgagagt atcgtaactc cagctgcttc tagaagaaga agacgatggg 180gacttgaaga aagtgtccat 20071200DNAGlycine max 71actttgggct tttggtgttt gtgggctacg ttatagtaga cactcaagta atcattgaga 60gggctcactt tggtgacctg gattatgtta agcatgcatt gacactgttc actgatttgg 120ctgcaatctt tgtgcgaatt cttaatataa tgttgaataa ttcatctaag agaaatgaga 180agaagaggag gagagattaa 20072200DNAGlycine max 72ttaatctctc ctcctcttct tctcatttct cttagatgaa ttattcaaca ttatattaag 60aattcgcaca aagattgcag ccaaatcagt gaacagtgtc aatgcatgct taacataatc 120caggtcacca aagtgagccc tctcaatgat tacttgagtg tctactataa cgtagcccac 180aaacaccaaa agcccaaagt 20073200DNAHordeum vulgare 73atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcca cgactccctc 60aagaacttcc gccagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgact 120ctatgctttg cactggcctc atctgccgtg ggtgcttacc tacacattgc cctgaacatc 180ggcgggatgc tgacaatgct 20074200DNAHordeum vulgare 74agcattgtca gcatcccgcc gatgttcagg gcaatgtgta ggtaagcacc cacggcagat 60gaggccagtg caaagcatag agtcaggtaa acgagcttga ggtgggactg cacggcgggg 120gagatctggc ggaagttctt gagggagtcg tggccccagc cgctcgccgc cgccgacgag 180gtcgagtaga aggcgtccat 20075200DNAHordeum vulgare 75tgttgatctt cctggggtac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60atggcgacat ggactacatc aagcacgccc tcaccctctt caccgacttt gttgccgtcc 120tcgtccgagt cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180agaggaagag gaggtcctga 20076200DNAHordeum vulgare 76tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60gatgatgagg actcggacga ggacggcaac aaagtcggtg aagagggtga gggcgtgctt 120gatgtagtcc atgtcgccat ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180gtaccccagg aagatcaaca 20077200DNAOryza sativa 77atggacgcct tctactcgac ctcgtcggcg tacggagcgg cggcgagcgg ctggggctac 60gactcgctga agaacttccg ccagatctcc cccgccgtcc agtcccacct caagctcgtt 120tacctgacac tatgcgtcgc cctggctgcg tcggcggtgg gcgcatacct gcacgtcgcc 180ttgaacatcg gcgggatgtt 20078200DNAOryza sativa 78aacatcccgc cgatgttcaa ggcgacgtgc aggtatgcgc ccaccgccga cgcagccagg 60gcgacgcata gtgtcaggta aacgagcttg aggtgggact ggacggcggg ggagatctgg 120cggaagttct tcagcgagtc gtagccccag ccgctcgccg ccgctccgta cgccgacgag 180gtcgagtaga aggcgtccat 20079200DNAOryza sativa 79gcctgttgat cttcctgggg tacatggtgt atgacacgca ggagatcatc gagagggctc 60accacggtga catggactac atcaagcacg cactcaccct cttcactgac ttcgtggccg 120tccttgtccg gatcctcgtc atcatgctca agaacgcgtc tgacaagtcg gaggagaaga 180agaggaagaa gaggtcttga 20080200DNAOryza sativa 80tcaagacctc ttcttcctct tcttctcctc cgacttgtca gacgcgttct tgagcatgat 60gacgaggatc cggacaagga cggccacgaa gtcagtgaag agggtgagtg cgtgcttgat 120gtagtccatg tcaccgtggt gagccctctc gatgatctcc tgcgtgtcat acaccatgta 180ccccaggaag atcaacaggc 20081200DNACucumis sativus 81atggacgcat tctcttcttt cttcgattct caatctggat ccagaacccg ctggagtcat 60gaatctctca agaacttccg gcagatttcg cccgccgttc aatctcatct tcagcgggtt 120tatctcactc ttggttgtgc tttggttgca tctgctgctg gagcttatct gcatatactt 180tggaatattg gtggttttct 20082200DNACucumis sativus 82agaaaaccac caatattcca aagtatatgc agataagctc cagcagcaga tgcaaccaaa 60gcacaaccaa gagtgagata aacccgctga agatgagatt gaacggcggg cgaaatctgc 120cggaagttct tgagagattc atgactccag cgggttctgg atccagattg agaatcgaag 180aaagaagaga atgcgtccat 20083200DNACucumis sativus 83tgttggtttt tgttggctac atggtagttg atactcagga aataattgag atggcacata 60tgggtgatat ggattatgtg aaacatgcat taactctctt cactgatttc attgcggtgt 120ttgtccgaat tctcattata atgctaaaga actctgctga gaagaacgag agggagagga 180agaagaagag gagggactga 20084200DNACucumis sativus 84tcagtccctc ctcttcttct tcctctccct ctcgttcttc tcagcagagt tctttagcat 60tataatgaga attcggacaa acaccgcaat gaaatcagtg aagagagtta atgcatgttt 120cacataatcc atatcaccca tatgtgccat ctcaattatt tcctgagtat caactaccat 180gtagccaaca aaaaccaaca 20085200DNACucumis sativus 85atggatgcct tttcatcttt cttcgattct caacaacctt ctacaaaccc ttggacctac 60gattctctca agaatttccg gcagatttcc cccgtcgttc aatctcatct ccaccaggtt 120taccttactc tgggttgtgc tttggttgca tctgctgctg gagcttatct ccatattctg 180tggaacattg gcggaatcct 20086200DNACucumis sativus 86aggattccgc caatgttcca cagaatatgg agataagctc cagcagcaga tgcaaccaaa 60gcacaaccca gagtaaggta aacctggtgg agatgagatt gaacgacggg ggaaatctgc 120cggaaattct tgagagaatc gtaggtccaa gggtttgtag aaggttgttg agaatcgaag 180aaagatgaaa aggcatccat 20087200DNACucumis sativus 87ggctattgct gtttgtgggc tacatggtag ttgatactca agaaataatc gagagggctc 60atcttggtga tatggactat gtgaagcatg ccctgactct tttcactgat ttcgttggtg 120ttttcgtccg acttctcatt attatggtaa ggaactcggt agagaagaat gaggagaaaa 180agaagaagag gagggactaa 20088200DNACucumis sativus 88ttagtccctc ctcttcttct ttttctcctc attcttctct accgagttcc ttaccataat 60aatgagaagt cggacgaaaa caccaacgaa atcagtgaaa agagtcaggg catgcttcac 120atagtccata tcaccaagat gagccctctc gattatttct tgagtatcaa ctaccatgta 180gcccacaaac agcaatagcc 20089200DNAGossypium hirsutum 89atgggcacgt tctcgtcttt cttcgattct caatcgagaa gccagtggaa ttacaacact 60ctcaagaatt tccgtcagat ctctccgatt gttcaaacgc atctcaaaaa ggtttatatg 120accctatgtt gtatgcttgt tgcctctgcc tttggggctt atcttcatat aatttggaac 180attgggggtt acctcacgac 20090200DNAGossypium hirsutum 90gtcgtgaggt aacccccaat gttccaaatt atatgaagat aagccccaaa ggcagaggca 60acaagcatac aacatagggt catataaacc tttttgagat gcgtttgaac aatcggagag 120atctgacgga aattcttgag agtgttgtaa ttccactggc ttctcgattg agaatcgaag 180aaagacgaga acgtgcccat 20091200DNAGossypium hirsutum 91ggctcttggt gtttgttggc tacatggtag tggacacaca agacataatt gagaaggcac 60acttgggtga tctggattat gtaaagcatg ctttgacact ttttactgat ttcgttgccg 120tatttgttcg cattctgata atcatgttga aaaattcagc tgagaagggt gagagacaga 180agaagaagag gagtgactaa 20092200DNAGossypium hirsutum 92ttagtcactc ctcttcttct tctgtctctc acccttctca gctgaatttt tcaacatgat 60tatcagaatg cgaacaaata cggcaacgaa atcagtaaaa agtgtcaaag catgctttac 120ataatccaga tcacccaagt gtgccttctc aattatgtct tgtgtgtcca ctaccatgta 180gccaacaaac accaagagcc 2009325DNAHordeum vulgare 93tcagggcaat gtgtaggtaa gcacc 259425DNAHordeum vulgare 94agcattgtca gcatcccgcc gatgt

259525DNAHordeum vulgare 95caatcagagg tccaaccgaa gcccc 259625DNAHordeum vulgare 96caatcagagg tccaaccgaa gcccc 259725DNAHordeum vulgare 97cttgggtcaa agtctatggc aagct 259825DNAHordeum vulgare 98tccgacaaac cctgtcacga ggatg 259925DNAHordeum vulgare 99agaagcaccc aaaggcgatg gcggt 2510025DNAHordeum vulgare 100cgcttggcga tgatggcggc gccag 2510125DNAHordeum vulgare 101gccaccgagg tacaggtact ccctg 2510225DNAHordeum vulgare 102ggatcgacag gccagacgag agcag 2510325DNAHordeum vulgare 103gacgtgacaa actgcagcca gagca 2510425DNAHordeum vulgare 104gctgccagag gagtggccaa agatg 2510525DNAHordeum vulgare 105ggccaaagta aacctcaaac atgaa 2510625DNAHordeum vulgare 106accatgtacc ccaggaagat caaca 2510725DNAHordeum vulgare 107ctcgatgatc tcctgcgtgt cgtac 2510824DNAHordeum vulgare 108ccacctgggc ctctccagca cccc 2410924DNAHordeum vulgare 109ggggtgctgg agaggcccag gtgg 2411024DNAHordeum vulgare 110gaccccctct tcctcttctt cttg 2411124DNAHordeum vulgare 111cgttcttgag catgatgatg agga 2411221DNAHordeum vulgare 112gcaacaaagt cggtgaagag g 2111323DNAHordeum vulgare 113gtcagcatcc cgccgatgtt cag 2311423DNAHordeum vulgare 114ccacggcaga tgaggccagt gca 2311523DNAHordeum vulgare 115taaacgagct tgaggtggga ctg 2311622DNAHordeum vulgare 116aactgcagcc agagcaggat cg 2211722DNAHordeum vulgare 117agcaggccac cgaggtacag gt 2211821DNAHordeum vulgare 118ggcggcgcca gagaagcacc c 21119150RNAHordeum vulgare 119auggacgccu ucuacucgac cucgucggcg gcggcgagcg gcuggggcca cgacucccuc 60aagaacuucc gccagaucuc ccccgccgug cagucccacc ucaagcucgu uuaccugacu 120cuaugcuuug cacuggccuc aucugccgug 150120150RNAHordeum vulgare 120agggcgcacc auggcgacau ggacuacauc aagcacgccc ucacccucuu caccgacuuu 60guugccgucc ucguccgagu ccucaucauc augcucaaga acgcaggcga caagucggag 120gacaagaaga agaggaagag gggguccuga 150121150RNAHordeum vulgare 121cgcuuguguc ggaacuaucg ccuggauguu cucggugcca gucuaugagg agaggaagag 60guuugggcug cugaugggug cagcccuccu ggaaggggcu ucgguuggac cucugauuga 120gcuugccaua gacuuugacc caagcauccu 15012231DNAArtificial sequenceSynthetic 122ttgaatcgaa gaaggaattg aaggagtcca t 3112328DNAArtificial sequenceSynthetic 123aggtaagccc caacagccgc agcaacca 2812429DNAArtificial sequenceSynthetic 124ctcttttcct ctcttcaaaa ggaggtgtc 2912527DNAArtificial sequenceSynthetic 125tgcactaaag ataaggcttg gatcgat 2712627DNAArtificial sequenceSynthetic 126atccagaaga aaccaagcca ccaaggt 2712727DNAArtificial sequenceSynthetic 127cctacaaaca ccaaaagccc aaagtac 2712829DNAArtificial sequenceSynthetic 128actgcaacca aatcggtaaa caaggtcaa 2912925DNAArtificial sequenceSynthetic 129tcaatctctc ctcttctttt tcttc 2513027DNAArtificial sequenceSynthetic 130tcaagggacc aacgaaggct aatttcg 2713126DNAArtificial sequenceSynthetic 131ggctttgaat ttcaacaccc ctaatt 2613226DNAArtificial sequenceSynthetic 132gcttgcaatc ggagaaacac aaattt 2613325DNAArtificial sequenceSynthetic 133atggggactt gaagaaagtg tccat 2513428DNAArtificial sequenceSynthetic 134taaaataaac cagtttgatg tgattctg 2813527DNAArtificial sequenceSynthetic 135tgctcccaat ggaagccacc gtggtga 2713628DNAArtificial sequenceSynthetic 136aatcagaggt ccaatggaag caccctga 2813728DNAArtificial sequenceSynthetic 137gccttgcaac taaggctact gcagaaaa 2813828DNAArtificial sequenceSynthetic 138agagctatag agcccccaaa gagagagg 2813927DNAArtificial sequenceSynthetic 139tccaggtcac caaagtgagc cctctca 2714027DNAArtificial sequenceSynthetic 140cttctcattt ctcttagatg aattatt 2714125DNAArtificial sequenceSynthetic 141gttgtagttg tactccatct tattg 25142200RNACucumber 142acuaucggau guauuacaug gcuaauggcc acuccuccuu augaagagaa aaagagggcc 60ucuauuuuac uuggggcugc ucuucucgaa ggggcuucca uugguccuuu gaucagucug 120gcuauugauu uugacccaag uguucuggug agcgcuuucg ugggaacugc gguugccuuu 180uguuguuucu caggagcagc 200143200RNACucumber 143cuuuaucucg guggcuuacu uucuuccggu guauccaugu uacucugguu acauuucgcc 60uccucuuuau ucggugguuc uacugcccuu uucaaguuug aguuguacuu ugggcuguug 120guuuuuguug gcuacauggu aguugauacu caggaaauaa uugagauggc acauaugggu 180gauauggauu augugaaaca 200144200RNACucumber 144auggaugccu uuucaucuuu cuucgauucu caacaaccuu cuacaaaccc uuggaccuac 60gauucucuca agaauuuccg gcagauuucc cccgucguuc aaucucaucu ccaccagguu 120uaccuuacuc uggguugugc uuugguugca ucugcugcug gagcuuaucu ccauauucug 180uggaacauug gcggaauccu 200145200RNACucumber 145auuggaugca ucacauggcu aauggccacu ccuccuuaug aagagagaaa gaggcuuucu 60auguuaaugg cggcugcucu ucuugaagga gcaucaauug guccuuugau uggguuggcu 120aucgagauug auccaagugu ucuggucagu gccuuugugg gaacugcugu ggcuuuuggu 180uguuucucug cagcagccau 200146200RNACucumber 146cuuuaccugg guggcuuacu uucuucuggg auauccaugu uacucugguu gcauuucgcu 60ucaucuauau ucggugguuc uacugcucuu uucaaguuug aguuguacuu ugggcuauug 120cuguuugugg gcuacauggu aguugauacu caagaaauaa ucgagagggc ucaucuuggu 180gauauggacu augugaagca 200147202RNAAqueoria victoria 147guucgagggc gauacccugg ugaaucgcau cgagcugacc ggcaccgauu ucaaggagga 60uggcaacauc cugggcaaua agauggagua caacuacaac gcccacaaug uguacaucau 120gaccgacaag gccaagaaug gcaucaaggu gaacuucaag auccgccaca acaucgagga 180uggcagcgug cagcuggccg ac 202

Claims

1. A method for producing a plant exhibiting an improvement in fungal disease resistance comprising topically applying to a plant surface a composition that comprises: (a) at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of said gene, wherein said polynucleotide is not operably linked to a promoter or a viral vector and wherein said polynucleotide is not integrated into the plant chromosome; and, (b) a transfer agent, wherein said plant exhibits an improvement in fungal disease resistance that results from suppression of said BAX inhibitor 1 (BI-1) gene.

2. The method of claim 1, wherein said polynucleotide molecule comprises sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA.

3. The method of claim 1, wherein said polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.

4. The method of claim 3, wherein: (a) said plant is a barley plant, said gene or said transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) said plant is a rice plant, said gene or said transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) said plant is a wheat plant, said gene or said transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) said plant is a soybean plant, said gene or said transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) said plant is a corn plant, said gene or said transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) said plant is a sorghum plant, said gene or said transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) said plant is a pepper plant, said gene or said transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) said plant is a grape plant, said gene or said transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) said plant is a tomato plant, said gene or said transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) said plant is a lettuce plant, said gene or said transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) said plant is a cucumber plant, said gene or said transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) said plant is a cotton plant, said gene or said transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

5. The method of claim 1, wherein said composition comprises any combination of two or more polynucleotide molecules.

6. The method of claim 1, wherein said polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length.

7. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.

8. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule and said plant is resistant to said herbicidal molecule.

9. The method of claim 1, wherein said transfer agent comprises an organosilicone preparation.

10-18. (canceled)

19. A composition comprising a polynucleotide molecule that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of said gene, wherein said polynucleotide is not operably linked to a promoter; and, b) a transfer agent.

20. The composition of claim 19, wherein said polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.

21. The composition of claim 19, wherein: a) said gene or said transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) said gene or said transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) said gene or said transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) said gene or said transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) said gene or said transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) said gene or said transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) said gene or said transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) said gene or said transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) said gene or said transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) said gene or said transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) said gene or said transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) said gene or said transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

22. The composition of claim 19, wherein said polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length.

23. The composition of claim 19, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.

24. The composition of claim 19, wherein said transfer agent is an organosilicone preparation

25. The composition of claim 19, wherein said polynucleotide is not physically bound to a biolistic particle.

26. A plant comprising an exogenous polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of said gene, wherein said exogenous polynucleotide is not operably linked to a promoter or to a viral vector, is not integrated into the chromosomal DNA of the plant, and is not found in a non-transgenic plant; and, wherein said plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene.

27. The plant of claim 26, wherein said plant further comprises an organosilicone compound or a component thereof.

28. The plant of claim 26, wherein said polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.

29. The plant of claim 26, wherein: a) said plant is a barley plant, said gene or said transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) said plant is a rice plant, said gene or said transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) said plant is a wheat plant, said gene or said transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) said plant is a soybean plant, said gene or said transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) said plant is a corn plant, said gene or said transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) said plant is a sorghum plant, said gene or said transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) said plant is a pepper plant, said gene or said transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) said plant is a grape plant, said gene or said transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) said plant is a tomato plant, said gene or said transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) said plant is a lettuce plant, said gene or said transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) said plant is a cucumber plant, said gene or said transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) said plant is a cotton plant, said gene or said transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and said polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or said polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

30. A progeny plant of said plant of claim 26, wherein said progeny plant exhibits said improvement in fungal disease resistance.

31. A seed of said plant of claim 26, wherein said seed exhibits said improvement in fungal disease resistance.

32. A processed product of said plant of claim 26, wherein said processed product exhibits an improved attribute relative to a processed product of an untreated control plant and wherein said improved attribute results from said fungal disease resistance.

33. A processed product of said progeny plant of claim 30, wherein said processed product exhibits an improved attribute relative to a processed product of an untreated control plant and wherein said improved attribute results from said fungal disease resistance.

34. A processed product of said seed of claim 31, wherein said processed product exhibits an improved attribute relative to a processed product of an untreated control plant and wherein said improved attribute results from said fungal disease resistance.