COMPOSITION FOR PREVENTION OR TREATMENT OF INTRACTABLE EPILEPSY COMPRISING mTOR INHIBITOR

Abstract

Provided is a use of the prophylaxis, amelioration or therapy of intractable epilepsy, for example, Focal Cortical Dysplasia (FCD).

Description

TECHNICAL FIELD

[0001] The present invention relates to the prophylaxis, amelioration or therapy of intractable epilepsy, for example, Focal Cortical Dysplasia (FCD). Also, the present invention relates to a biomarker panel for diagnosing intractable epilepsy, especially pediatric intractable epilepsy, and a method for diagnosing intractable epilepsy using the same.

BACKGROUND ART

[0002] Epilepsy is a group of chronic neurological diseases characterized by repetitive seizures induced by excessive electric activity in some neurons within a short time, with the consequent incurrence of neurobiological, mental, perceptual, and social changes.

[0003] Epilepsy that is insensitive to anti-epileptic drugs developed thus far is called intractable epilepsy, and accounts for about 20% of all epilepsy cases diagnosed each year. Malformations of cortical developments (MCD) such as Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME) and Tuberous Sclerosis Complex (TSC), Hippocampal Sclerosis (HS), and Sturge-Weber Syndrome (SWS) are known as common causes of intractable epilepsy.

[0004] Insensitive to available antiepileptic drugs, intractable epilepsy requires neurosurgical treatment to resect a brain lesion to control epilepsy. Hence, there is a need for a technique for molecular biological diagnosis specific for malformations of cortical development or Hippocampal Sclerosis, both causative of intractable epilepsy.

[0005] FCD is an important cause of epilepsy that is difficult to control with available antiepileptic drugs, and this condition accounts for as much as 50% of juvenile patients undergoing epilepsy surgery. FCD is a sporadic developmental malformation of the cerebral cortex and is characterized by the disorganized structure of the cerebral cortex or cytological abnormalities of the neurons in focally affected regions.

[0006] Although surgical resection of FCD renders approximately 60% of patients seizure free, a significant portion of Focal Cortical Dysplasia patients continues to have seizures. Due to the lack of understanding of the molecular genetic etiology, the development of novel and more effective FCD therapies remains elusive. A long-held but unproven hypothesis is that FCD is caused by somatic mutations occurring in affected brain regions during brain development. However, no such mutations have been identified.

[0007] FCD can be classified into several types based on histopathology. In particular, FCD type II (FCDII) shows a homogenous pathology, characterized by disrupted cortical lamination, and dysmorphic neurons or balloon cells (Epilepsia 52, 158-174 (2011)). FCDII is diagnosed in 29-39% of all FCD patients who undergo epilepsy surgery (Brain 129, 1907-1916 (2006)). Although an association between human papilloma virus and FCDII has been reported, the molecular genetic etiology of FCDII remains poorly understood. Interestingly, the brain MRIs of FCDII patients are occasionally reported to be normal; however, microscopic examinations of surgical specimens reveal scattered dysmorphic cells surrounded by an abundance of normally appearing cells. These radiological and histopathological findings suggest that only a small fraction of cells containing somatic mutations exist in surgically resected tissue, and that these mutations might not be efficiently detected through capillary Sanger sequencing or typical whole exome sequencing (WES) with an average read depth of 100-150.times..

[0008] Against this background, the present inventors have identified FCD-specific somatic mutations in the brain tissues of FCD patients undergoing epilepsy surgery, using deep sequencing strategies such as deep whole exome sequencing, hybrid capture sequencing, and amplicon sequencing, established a transgenic animal with FCD, using the somatic mutations, and found that the administration of an mTOR inhibitor to the transgenic animal restrains FCD symptoms, leading to the present disclosure.

DISCLOSURE

Technical Problem

[0009] An object of the present disclosure is to provide a kit or method for preventing, ameliorating or treating intractable epilepsy caused by the brain somatic mutations in components of the PI3K-AKT-mTOR pathway, or by Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME), Hippocampal Sclerosis (HS) or Sturge-Weber Syndrome (SWS), using an mTOR inhibitor as an active ingredient.

[0010] Another object of the present disclosure is to provide the use of an mTOR in preventing, ameliorating, or treating intractable epilepsy or a disease causing intractable epilepsy. Here, the intractable epilepsy may be caused by FCD. In particular, FCD may be associated with cerebral somatic mutation.

[0011] A further object of the present disclosure is to provide a pharmaceutical or food composition for preventing, ameliorating or treating intractable epilepsy caused by brain somatic mutations in components of the PI3K-AKT-mTOR pathway or by Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME), Hippocampal Sclerosis (HS) or Sturge-Weber Syndrome (SWS), comprising an mTOR inhibitor as an active ingredient.

[0012] A still further object of the present disclosure is to provide a diagnostic kit for intractable epilepsy, comprising an agent capable of detecting a mutation present in a gene or protein involved in a PI3K-AKT-mTOR pathway.

[0013] Still another object of the present disclosure is to provide a method for diagnosing intractable epilepsy, comprising detecting a mutation present in a gene or protein involved in the PI3K-AKT-mTOR pathway in a sample from a subject, using the diagnostic kit.

[0014] Yet a further object of the present disclosure is to provide a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway.

[0015] Yet another object of the present disclosure is to provide a biomarker panel for the diagnosis of intractable epilepsy, comprising a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway.

[0016] Still yet another object of the present disclosure is to provide a composition for inducing intractable epilepsy, comprising a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway.

[0017] An additional object of the present disclosure is to provide a transgenic animal with intractable epilepsy, into which a gene or protein involved in the PI3K-AKT-mTOR pathway is introduced.

[0018] Another additional object of the present disclosure is to provide a method for inducing intractable epilepsy, comprising introducing a gene or protein involved in the PI3K-AKT-mTOR pathway into cells, ex vivo.

Technical Solution

[0019] The present disclosure addresses use of an mTOR inhibitor in the prophylaxis, amelioration or therapy of intractable epilepsy or a causative disease of intractable epilepsy. Here, the intractable epilepsy may be caused by FCD. More particularly, the FCD may be FCD associated with brain somatic mutation.

[0020] Also, the present disclosure addresses a biomarker panel for the diagnosis of intractable epilepsy, and a diagnostic method of intractable epilepsy using the same. Within the scope of diseases causative of intractable epilepsy. Malformations of cortical developments (MCD) such as Focal Cortical Dysplasia (particularly, FCD type II), Hemimegalencephaly (HME) and Tuberous Sclerosis Complex (TSC), Hippocampal Sclerosis (HS), and Sturge-Weber Syndrome (SWS) fall

[0021] Hereinafter, a detailed description will be given of the present invention.

[0022] Intensive and thorough research and analysis of tissue samples resected from brains of patients with intractable epilepsy caused by Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME), Hippocampal Sclerosis (HS), or Sturge-Weber Syndrome (SWS) resulted in the finding that brain somatic mutations specific for components of the PI3K-AKT-mTOR pathway exist and that the mutations can be used as a biomarker panel for diagnosing intractable epilepsy. Also, the present inventors discovered the fact that cells into which the mutations are introduced overexpress mTOR, inducing intractable epilepsy, and succeeded in developing a method useful in preventing, ameliorating or treating Focal Cortical Dysplasia (FCD), Tuberous Sclerosis Complex (TSC), Hemimegalencephaly (HME), Hippocampal Sclerosis (HS) or Sturge-Weber Syndrome (SWS), and the intractable epilepsy caused by Focal Cortical Dysplasia (FCD), Tuberous Sclerosis Complex (TSC), Hemimegalencephaly (HME), Hippocampal Sclerosis (HS) or Sturge-Weber Syndrome (SWS).

[0023] In the present disclosure, brain tissue, saliva and blood samples were obtained from FCD-caused intractable epilepsy patients undergoing epilepsy surgery, and nucleotide sequencing revealed nine different mTOR gene mutations specifically present in patients with FCD-caused intractable epilepsy, nine mTOR protein mutations corresponding thereto, and six different genetic mutations in components of the PI3K-AKT-mTOR pathway and six corresponding protein mutations corresponding thereto (Table 1).

TABLE-US-00001 TABLE 1 Mutation on No. Gene mTOR Gene mTOR Protein Remark 1 mTOR C616T R206C Cytosine (C) at position 616 .fwdarw. Thymine (T) Arginine (R) at position 206.fwdarw. Cysteine (C) 2 mTOR G1871A R624H Guanine(G) at position 1871 .fwdarw. Adenine(A) Arginine(R) at position 624 .fwdarw. Histidine (H) 3 mTOR T4348G Y1450D Thymine (T) at position 4348 .fwdarw. Guanine(G) Tyrosine (Y) at position 1450 .fwdarw. Aspartic acid (D) 4 mTOR T4447C C1483R Thymine(T) at position 4447 .fwdarw. Cytosine(C) Cysteine(C) at position 1483 .fwdarw. Arginine(R) 5 mTOR G5126A R1709H Guanine(G) at position 5126 .fwdarw. Adenine(A) Arginine(R) at position 1709.fwdarw. Histidine(H) 6 mTOR C5930A T1977K Cytosine(C) at position 5930.fwdarw. Adenine(A) Threonine (T) at position 1977 .fwdarw. Lysine (K) 7 mTOR C6577T R2193C Cytosine(C) at position6577 .fwdarw. Thymine(T) Arginine(R) at position 2193.fwdarw. cysteine(C) 8 mTOR C6644T S2215F Cytosine(C) at position 6644.fwdarw. Thymine(T) Serine (S) at position2215 .fwdarw. Phenylalanine (F) 9 mTOR T7280C L2427P Thymine(T) at position 7280.fwdarw.Cytosine(C) Leucine (L) at position 2427 .fwdarw. Proline (P) 10 mTOR T7280A L2427Q Thymine(T) at position 7280.fwdarw. Adenine(A) Leucine (L) at position 2427.fwdarw. Glutamine (Q) 11 TSC1 C64T R22W Cytosine(C) at position 64.fwdarw. Thymine(T) Arginine(R) at position 22.fwdarw. Tryptophan (W) 12 TSC1 C610T R204C Cytosine(C) at position 610.fwdarw. Thymine(T) Arginine(R) at position 204.fwdarw. cysteine(C) 13 TSC1 G2432T R811L Guanine(G) at position 2432.fwdarw. Thymine(T) Arginine(R) at position 811.fwdarw. Leucine (L) 14 TSC2 G4639A V1547I Guanine(G) at position 4639 .fwdarw. Adenine(A) Valine (V) at position 1547.fwdarw. Isoleucine (I) 15 AKT3 G740A R247H Guanine(G) at position 740 .fwdarw. Adenine(A) Arginine(R) at position 247 .fwdarw. Histidine(H) 16 PIK3CA G3052A D1018N Guanine(G) at position 3052.fwdarw.Adenine(A) Aspartic acid (D) at position 1018.fwdarw. Asparagine (N)

[0024] The identified mutations were specifically detected in the brain tissue samples, but were negative for all available saliva and blood samples from mutation-positive patients. In addition, at least one of the nine different mTOR mutations was found in all FCD patients, with an allelic frequency of 1.26 to 12.6%.

[0025] In the present disclosure, mTOR mutant constructs expressing the mutations were obtained, and cells, after transfection of the mTOR mutant constructs thereinto, were analyzed for mTOR protein activation in terms of the phosphorylation of an S6 protein and the activity of mTOR kinase. As a result, an increase in the phosphorylation of S6 phosphorylation (FIG. 2a) and the activation of mTOR kinase (FIG. 2n) was identified, indicating that the hyperactivation of the mTOR pathway induces the phosphorylation of S6.

[0026] In addition, treatment with rapamycin, everolimus, or compounds of Chemical Formulas 1 to 4 was discovered to reduce the phosphorylation of S6 in the cells with the hyperactivated mTOR pathway due to the transfection of the mTOR mutant constructs thereinto (FIGS. 9a to 9c).

[0027] Meanwhile, the induction of FCD by the mTOR mutations provided by the present disclosure was confirmed by observing a significantly elevated level of phosphorylated S6 protein and an increased soma size of neurons in pathological brain samples of patients with FCD-caused intractable epilepsy (mTOR gene mutation) (FIGS. 2c to 2e), and by significant disruption of neuronal migration and a significantly increased level of phosphorylated S6 in the cortex of mTOR mutant construct-injected mice at embryonic day 14 (FIGS. 11b and 11c).

[0028] In the present disclosure, the lateral ventricles of embryonic mice were electroporated with mTOR mutant constructs carrying the genetic mutations at embryonic day 14 (E14), and video-electroencephalographic (video-EEG) monitoring of the mice was performed starting 3 weeks after birth. As a result, spontaneous seizure with epileptic discharge was detected in mice transfected with plasmids carrying the mTOR mutant genes of the present disclosure (FIGS. 12a and 12b). Further, it was observed that the soma sizes of GFP-positive neurons were greatly increased in affected cortical regions of electroporated mice carrying mTOR mutant constructs, showing an abnormal neuronal morphology similar to cytomegalic neurons. (FIG. 3d).

[0029] In addition, the animal models with spontaneous seizures or abnormal neurons, when administered with rapamycin, were observed to significantly decrease in the onset frequency of behavioral and electrographic seizures (FIG. 3c) and in the soma size of abnormal neurons (FIG. 3d).

[0030] In the present disclosure, it is revealed not only that the genetic or protein mutations are specifically detected in FCD patient samples, but also that the mutations can induce FCD. Further, an mTOR inhibitor, for example, rapamycin, everolimus, and compounds of Chemical Formulas 1 to 4, is found to suppress intractable epilepsy associated with the mTOR mutations, such as mTOR hyperactivation, spontaneous seizures, behavioral seizures, electrographic seizures and generation of abnormal neurons in FCD.

[0031] In the following Example section, mTOR mutant constructs carrying the somatic mutations were obtained and transfected into cells, with the consequence of an increased level of S6K phosphorylation, which explains the activation of mTOR. Rapamycin decreased the phosphorylation. The data suggest that given the mutations, mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or proteins activate the mTOR pathway, thus inducing epilepsy.

[0032] According to another embodiment thereof, the present disclosure addresses a biomarker panel for the diagnosis of intractable epilepsy, comprising mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or proteins carrying the mutations. Further, the present disclosure provides a diagnostic kit for detecting the biomarker panel genes or proteins in a sample from a subject, and a diagnostic method using the same. Moreover, the present disclosure provides a technique for constructing an epilepsy model, comprising inducing intractable epilepsy with the genetic or protein mutations.

[0033] Also, the present disclosure addresses the prophylaxis, amelioration or therapy of intractable epilepsy, and a composition, a kit or a method for preventing, ameliorating or treating malformations of cortical developments, Hippocampal Sclerosis, or Sturge-Weber Syndrome, such as FCD, Hemimegalencephaly, and Tuberous Sclerosis Complex, which are common causes of intractable epilepsy. A particular embodiment of the present disclosure relates to the prophylaxis, therapy and/or amelioration of brain somatic mutation-associated intractable epilepsy.

[0034] In detail, the intractable epilepsy of the present disclosure includes epilepsy caused by the brain somatic mutation of genes involved in the PI3K-AKT-mTOR pathway, and epilepsy caused by malformations of cortical developments, Hippocampal Sclerosis, or Sturge-Weber Syndrome, such as FCD, Hemimegalencephaly and Tuberous Sclerosis Complex.

[0035] As used herein, the term "epilepsy" refers to a group of chronic neurological diseases characterized by repetitive seizures induced by excessive electric discharge in some neurons within a short time. The term "intractable epilepsy" means epilepsy that is insensitive to available antiepileptic drugs. Forms of intractable epilepsy may be those that are caused by Malformations of Cortical Developments (MCD), Hippocampal Sclerosis (HS), or Sturge-Weber Syndrome (SWS), such as Focal Cortical Dysplasia (FCD), Hemimegalencephaly (HME), and Tuberous Sclerosis Complex (TSC).

[0036] In the normal development of the cerebral cortex, neurons migrate from one region of the brain to another to form a laminar structure. The term "Focal Cortical Dysplasia" or "FCD", as used herein, is a congenital abnormality of brain development where the neurons in one area of the brain fail to migrate in the proper formation in utero and thus fail to form a normal laminar structure. Etiologically, FCD is accounted for by the failure of normal development in some region of the cerebrum or by the generation of some dysmorphic neurons even in a region that seems to develop normally, as observed in radiographic images. FCD occurs sporadically and is characterized by dysmorphic neurons and disrupted cortical lamination in affected cortical regions.

[0037] The brain somatic mutations associated with FCD may be mutations on mTOR genes or protein.

[0038] mTOR (mammalian target of rapamycin) protein, encoded by the FRAP1 gene in humans, is a serine/threonine protein kinase, which is functionally involved in cell growth, cell proliferation, cell death, cell survival, protein synthesis, and transcription, and belongs to the phosphatidylinositol 3-kinase-related kinase protein family. In the present disclosure, nucleotide and protein sequences of wild-type mTOR genes are represented by SEQ ID NOs. 1 and 2, respectively.

[0039] As used herein, the term "brain somatic mutation" means an alteration at one or more positions of the nucleotide sequence of a wild-type gene. In this context, it may be a nucleotide mutation of mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or an amino acid mutation of proteins corresponding to the genes. By way of example, an alteration may occur on the nucleotide sequence of the wild-type mTOR gene represented by SEQ ID NO. 1. As shown in Table 1, the brain somatic mutation may be a substitution at one or more selected from the group consisting of positions 616, 1871, 4348, 4447, 5126, 5930, 6577, 6644, 7280 and 7280 of the nucleotide sequence of SEQ ID NO. 1.

[0040] Alternatively, the brain somatic mutation of the present disclosure may be an alteration at one or more positions of the amino acid sequence of the wild-type mTOR protein of SEQ ID NO. 2. On the amino acid sequence of SEQ ID NO. 2, for example, the mutation may include at least one selected from the group consisting of substitutions from arginine (R) at position 206 to cysteine (C), from R at position 624 to H, from Y at position 1450 to D, from C at position 1483 to R, from R at position 1709 to H, from T at position 1977 to K, from R at position 2193 to C, from S at position 2215 to F, from L at position 2427 to P, and from L at position 2427 to Q. The substituted amino acids may be encoded by the genetic codes resulting from mutations at corresponding positions on the nucleotide sequence of SEQ ID NO. 1. The base mutations and corresponding amino acid mutations are listed in Table 1.

[0041] As used herein, the term "TSC1 mutant gene" refers to a TSC1 gene in which a mutation occurs on the wild-type TSC1 nucleotide sequence of SEQ ID NO. 3. Particularly, it may be a gene containing at least one mutation selected from substitutions from cytosine (C) at position 64 to thymine (T), from cytosine (C) at position 610 to thymine (T), and from guanine (G) at position 2432 to thymine (T) on the nucleotide sequence of SEQ ID NO. 3.

[0042] As used herein, the term "TSC1 mutant protein" refers to a TSC1 protein in which a mutation occurs on the wild-type TSC1 amino acid sequence of SEQ ID NO. 4. Particularly, it may be a protein containing at least one mutation selected from substitutions from arginine (R) at position 22 to tryptophan (W), from arginine (R) at position 204 to cysteine (C), and from arginine (R) at position 811 to leucine (L) on the amino acid sequence of SEQ ID NO. 4.

[0043] The term "TSC2 mutant gene", as used herein, refers to a gene in which a mutation occurs on the wild-type TSC2 nucleotide sequence of SEQ ID NO. 5. Particularly, it may be a gene containing a substitution from guanine (G) at position 4639 to adenine (A) on the nucleotide sequence of SEQ ID NO. 5.

[0044] The term "TSC2 mutant protein", as used herein, refers to a TSC2 protein in which a mutation occurs on the wild-type TSC2 amino acid sequence of SEQ ID NO. 6. Particularly, it may be a protein containing a mutation from valine (V) at position 1547 to isoleucine (I) on the amino acid sequence of SEQ ID NO. 6.

[0045] The term "AKT3 mutant gene", as used herein, refers to a gene in which a mutation occurs on the wild-type AKT3 nucleotide sequence of SEQ ID NO. 7. Particularly, it may be a gene containing a substitution from guanine (G) at position 740 to adenine (A) on the nucleotide sequence of SEQ ID NO. 7.

[0046] The term "AKT3 mutant protein", as used herein, refers to a TSC2 protein in which a mutation occurs on the wild-type AKT3 amino acid sequence of SEQ ID NO. 8. Particularly, it may be a protein containing a mutation from arginine (R) at position 247 to histidine (H) on the amino acid sequence of SEQ ID NO. 8.

[0047] The term "PIK3CA mutant gene", as used herein, refers to a gene in which a mutation occurs on the wild-type TSC2 nucleotide sequence of SEQ ID NO. 9. Particularly, it may be a gene containing a substitution from guanine (G) at position 3052 to adenine (A) on the nucleotide sequence of SEQ ID NO. 9.

[0048] The term "PIK3CA mutant protein", as used herein, refers to a TSC2 protein in which a mutation occurs on the wild-type TSC2 amino acid sequence of SEQ ID NO. 10. Particularly, it may be a protein containing a mutation from aspartic acid (D) at position 1018 to asparagine (N) on the amino acid sequence of SEQ ID NO. 10.

[0049] In addition, the mutated proteins may contain additional mutations, so long as they do not entirely alter the activity of the molecules. Amino acid substitutions of proteins or peptides that preserve all of the activity of the molecules are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). If necessary, the mTOR mutant proteins may be modified by, for example, phosphorylation, sulfation, acrylation, glycosylation, methylation, and/or famesylation.

[0050] Examples of the mTOR inhibitor available in the present disclosure include those listed in the disclosures of the following Patent Application Nos. Danaferber cancer institute PCT/US09/005656; Dolcetta, Diego U.S. Ser. No. 14/400,469; Exelixis PCT/US10/030354, U.S. Ser. No. 13/989,366, U.S. Ser. No. 12/784,254, U.S. Ser. No. 13/322,160, U.S. Ser. No. 13/988,948, U.S. Ser. No. 13/988,903, U.S. Ser. No. 13/989,156, U.S. Ser. No. 13/989,330, PCT/US12/042582, PCT/US10/035638, PCT/US10/035639; Sanofi U.S. Ser. No. 13/381,571, U.S. Ser. No. 14/374,838; Infinity Pharmaceuticals U.S. Ser. No. 12/199,689, U.S. Ser. No. 11/965,688, KR20097015914; Intellikine U.S. Ser. No. 12/586,241, PCT/US09/005958, PCT/US09/005959, PCT/US09/049983, PCT/US09/049969, U.S. Ser. No. 14/238,426, U.S. Ser. No. 12/920,970, U.S. Ser. No. 12/920,966, U.S. Ser. No. 14/619,556; Takeda Pharmaceutical Company Limited PCT/US10/000234, U.S. Ser. No. 12/841,940, U.S. Ser. No. 12/657,853, U.S. Ser. No. 12/657,854; S*Bio Pte Ltd U.S. Ser. No. 13/001,099; Schering Corporation PCT/US10/030350; The Reagents of The University of California EP2012175019; Xuanzhu Pharma Corporation Limited EP2013836950; KR20130049854; Signal RX Pharmaceuticals EP2009703974; Semafore Pharmaceuticals U.S. Ser. No. 11/962,612, U.S. Ser. No. 11/111,201, U.S. Ser. No. 10/818,145; Kudos Pharmaceuticals U.S. Ser. No. 13/014,275, U.S. Ser. No. 13/307,342, U.S. Ser. No. 11/842,927, U.S. Ser. No. 11/361,599, U.S. Ser. No. 11/817,134, PCT/GB06/000671; AstraZeneca U.S. Ser. No. 11/667,064, U.S. Ser. No. 11/842,930, U.S. Ser. No. 11/844,092, U.S. Ser. No. 12/160,752, U.S. Ser. No. 12/170,128, U.S. Ser. No. 12/668,056, U.S. Ser. No. 12/668,059, U.S. Ser. No. 12/252,081, U.S. Ser. No. 12/301,722, U.S. Ser. No. 12/299,369, U.S. Ser. No. 12/299,359, U.S. Ser. No. 12/441,298, U.S. Ser. No. 12/441,305, U.S. Ser. No. 12/441,299, U.S. Ser. No. 12/441,301, U.S. Ser. No. 12/668,060, PCT/GB07/003414, PCT/GB07/003417, PCT/GB07/003454, PCT/GB07/003493, PCT/GB07/003497; Ariad Pharmaceuticals U.S. Ser. No. 10/862,149, U.S. Ser. No. 13/463,951, U.S. Ser. No. 14/266,291; Merck Sharp & Dohme Limited U.S. Ser. No. 13/263,193, U.S. Ser. No. 13/379,685, U.S. Ser. No. 13/520,274, U.S. Ser. No. 13/818,153, U.S. Ser. No. 13/818,177, U.S. Ser. No. 13/876,192, U.S. Ser. No. 14/234,837, PCT/US12/047522; Wyeth U.S. Ser. No. 12/251,712, U.S. Ser. No. 12/354,027, U.S. Ser. No. 12/470,521, U.S. Ser. No. 13/950,584, U.S. Ser. No. 13/718,928, U.S. Ser. No. 14/477,650, U.S. Ser. No. 12/470,525, U.S. Ser. No. 12/050,445, U.S. Ser. No. 12/044,500, U.S. Ser. No. 12/473,605, U.S. Ser. No. 12/276,459, U.S. Ser. No. 12/363,013, U.S. Ser. No. 12/361,607, U.S. Ser. No. 12/397,590, U.S. Ser. No. 12/473,658, U.S. Ser. No. 12/506,291, U.S. Ser. No. 12/556,833, U.S. Ser. No. 12/558,661; Norvartis U.S. Ser. No. 12/599,131, U.S. Ser. No. 12/792,471, U.S. Ser. No. 12/792,187, U.S. Ser. No. 13/073,652; F. Hoffmann-La-Roche AG EP2012177885, U.S. Ser. No. 13/738,829, U.S. Ser. No. 12/890,810, U.S. Ser. No. 13/568,707, EP2010769036, PCT/EP10/067162; Genentech Inc U.S. Ser. No. 11/951,203, U.S. Ser. No. 12/821,998, U.S. Ser. No. 12/943,284.

[0051] In detail, mTOR inhibitors useful for the present disclosure may be as follows: AMG954, AZD8055, AZD2014, BEZ235, BGT226, rapamycin, everolimus, sirolimus, CC-115, CC-223, LY3023414, P7170, DS-7423, OSI-027, GSK2126458, PF-04691502, PF-05212384, temsirolimus, INK128, MLN0128, MLN1117, ridaforolimus, Metformin, XL765, SAR245409, SF1126, VS5584, GDC0980, and GSK2126458. Further examples of the mTOR inhibitors includes those listed in WO2012/104776, KR 10-1472607B, WO2010/039740, U.S. Pat. No. 8,846,670, U.S. Pat. No. 8,263,633, and WO2010/002954.

[0052] According to some embodiments of the present disclosure, the mTOR inhibitor may be at least one selected from the group consisting of rapamycin or a salt thereof, everolimus or a salt thereof, a compound of Chemical Formula 1 or a salt thereof, a compound of Chemical Formula 2 or a salt thereof, a compound of Chemical Formula 3 or a salt thereof, and a compound of Chemical Formula 4 or a salt thereof.

[0053] As used herein, the term "rapamycin" refers to a macrolide lactone compound, known as sirolimus, which has immunosuppressant functions. Rapamycin is commercialized as a drug for preventing rejection of transplanted organs. Also, it is used as a therapeutic agent for pneumonia, immunoinflammatory skin disorders such as systemic lupus erythematosus and psoriasis, immunoinflammatory bowel disorders, orbital inflammation, restenosis, and rheumatoid arthritis, and as an anti-cancer agent. However, nowhere has the application of rapamycin to the prevention or treatment of brain somatic mutation-associated FCD been reported in previous documents.

[0054] As used herein, the term "everolimus" refers to a drug for treating kidney cancer. It is used when the antiangiogenic drug SUNItinib or sorafenib is no longer effective. Also, everolimus is approved for the treatment of subependymal giant cell astrocytoma associated with Tuberous Sclerosis (TS) in patients who are not suitable candidates for surgical intervention. However, to date there have been no reports on the use of everolimus in the prevention or treatment of brain somatic mutation-associated FCD.

[0055] The compounds of Chemical Formulas 1 to 4 are known as inhibitors active against mTOR; however, applicability to the prevention or treatment of brain somatic mutation-associated FCD has not been known at all.

[0056] Rapamycin, everolimus, and the compounds of Chemical Formulas 1 to 4 are useful in the present disclosure, and their derivatives or mimics, pharmaceutically acceptable salts thereof, and hydrates are also fall within the scope of drugs available for the present disclosure

[0057] The pharmaceutically acceptable salts or hydrates may be salts or hydrates derived from inorganic acids or organic acids. Examples of pharmaceutically acceptable salts include salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, acetic acid, glycolic acid, lactic acid, pyruvic acid, malonic acid, succinic acid, glutaric acid, fumaric acid, malic acid, mandelic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, benzoic acid, hydroxybenzoic acid, phenylacetic acid, cinnamic acid, salicylic acid, methane sulfonic acid, benzene sulfonic acid, and toluene sulfonic acid, but are not limited thereto. The hydrates may refer to those formed by binding rapamycin, everolimus or the compounds of Chemical Formulas 1 to 4 with water molecules.

[0058] As used herein, the term "treatment" or "therapy" refers to any action resulting in improvement or mitigation in the symptoms of a disease of interest, a reduction in affected area, the suppression or delay of the onset or progression of disease, the amelioration, mitigation, or stabilization of a disease state, partial or complete recovery, prolonged survival, and other beneficial alterations. In this regard, the term is intended to include the mitigation, amelioration, reduction or cure of symptoms of brain somatic mutation-associated FCD thanks to the administration of the mTOR inhibitor of the present disclosure into patients.

[0059] The symptoms of brain somatic mutation-associated FCD occur as neurons in an area of the brain fail to migrate in the proper formation during brain development, and are exemplified by spontaneous seizures, behavioral seizures, electrographic seizures, and the generation of abnormal neurons in the cerebral cortex.

[0060] Accordingly, the treatment according to the present disclosure may mean a significant decrease in the onset frequency of spontaneous seizures, behavioral seizures, and electrographic seizures and in the number or soma size of abnormal neurons in the cerebral cortex thanks to the administration of an mTOR inhibitor, for example, rapamycin, everolimus, and/or the compounds of Chemical Formulas 1 to 4, into patients with brain somatic mutation-associated FCD.

[0061] Depending on modalities and regimens of the pharmaceutical composition of the present disclosure, an effective amount of the mTOR inhibitor may be suitably determined by those skilled in the art.

[0062] For example, the pharmaceutical composition may comprise the mTOR inhibitor in an amount of 0.1 to 10% by weight based on the total weight of the composition, and particularly in an amount of 0.5 to 5% by weight.

[0063] The pharmaceutical composition of the present disclosure may comprise the mTOR inhibitor alone or in combination with a pharmaceutically acceptable additive. The pharmaceutically acceptable additive is an additive that is typically useful for formulations, examples of which include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. Examples of pharmaceutically acceptable excipients available in the present disclosure include a lubricant, a humectant, a sweetener, an aromatic, an emulsifier, a flavoring agent, a suspending agent, and a preservative, but are not limited thereto. That is, pharmaceutically acceptable additives available in the pharmaceutical composition of the present disclosure may be selected according to the purpose of use by those skilled in the art without difficulty, and their amounts may be determined within the range that does not hinder the purpose and effect of the present disclosure.

[0064] The therapeutically effective amount of the pharmaceutical composition of the present disclosure may vary depending on various factors including a patient's state, and weight, the severity of disease, the dosage form of drug, the route of administration, the time of administration, etc. For a preferable effect, the active ingredient of the present disclosure may be administered in an amount of from 1 to 1000 mg/kg a day, preferably in an amount of from 50 to 500 mg/kg, and more preferably in an amount of 150 to 300 mg/kg. The composition of the present disclosure may be administered in a single dose or may be divided into multiple doses. Accordingly, the dosage does not limit the present disclosure in any aspect.

[0065] The pharmaceutical composition of the present disclosure may be administered to mammals such as rats, mice, livestock and humans via various routes. All of the administration methods are known, and, for example, the dosage may be administered orally, rectally, intravenously, intramuscularly, subcutaneously, or intracerebroventricularly.

[0066] Another embodiment of the present disclosure pertains to a food composition for preventing or ameliorating brain somatic mutation-associated FCD, comprising at least one selected from the group consisting of the mTOR inhibitors, for example, rapamycin or a salt thereof, everolimus or a salt thereof, the compound of Chemical Formula 1 or a salt thereof, the compound of Chemical Formula 2 or a salt thereof, the compound of Chemical Formula 3 or a salt thereof, and the compound of Chemical Formula 4 or a salt thereof. The compounds of Chemical Formulas 1 to 4 are as defined above.

[0067] The food composition may be added to foods, without change or together with other food or food ingredients, and used properly according to typical modalities. The mTOR inhibitor useful in the present disclosure may be determined suitably according to the purpose of use (prevention, health or therapeutic treatment). For a general food composition, the active ingredient may be contained in an amount of 0.01 to 10 parts by weight, based on 100 parts by weight of the composition, and particularly in an amount of 0.05 to 1 parts by weight. However, the content of the mTOR inhibitor may be below the range in a food composition that is intended for long-term ingestion with the aim of improving or controlling health.

[0068] The food composition may be applied to a health food for the prevention or amelioration of brain somatic mutation-associated FCD. There are no particular limitations on the kind of health food to which the composition of the present invention can be added. Examples of such a health food include meats, sausages, breads, chocolates, candies, snacks, confectionery, pizzas, ramen noodles, other noodles, gums, dairy products such as ice cream, various soups, beverages, teas, drinks, alcoholic beverages, vitamin complexes, etc., and all kinds of commonly accepted health foods. In addition, the food composition of the present disclosure may further comprise a cytologically acceptable additive. Although not significantly important, the content of the sitologically acceptable additive may generally be determined within a range of 0.01 to 0.1 parts by weight, based on 100 parts by weight of the composition of the present disclosure.

[0069] Another embodiment of the present disclosure addresses a kit or composition for the diagnosis of intractable epilepsy or a causative disease thereof, comprising an agent capable of detecting a mutation in a gene or protein involved in the PI3K-AKT-mTOR pathway, or a method for the diagnosis of intractable epilepsy or a causative disease thereof, using the same.

[0070] Another embodiment of the present disclosure addresses a biomarker panel for the diagnosis of intractable epilepsy, comprising a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway. A further embodiment of the present disclosure addresses a composition for inducing intractable epilepsy, comprising a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway.

[0071] The term "diagnosis", as used herein, refers to identifying the presence or characteristics of a pathological condition. For the purpose of the present disclosure, "diagnosis" may mean identifying the onset of intractable epilepsy, and furthermore, the progression or aggravation of the disease.

[0072] As used herein, the terms "diagnostic marker" "marker for diagnosis" and "diagnosis marker" are intended to indicate a substance that is found specifically in a sample of a patient with intractable epilepsy and the detection of which accounts for the onset of intractable epilepsy. For the purpose of the present disclosure, the diagnostic marker of the present disclosure may mean mutant genes or proteins of mTOR, TSC1, TSC2, AKT3 and PIK3CA, which are present specifically in the affected brain regions of intractable epilepsy patients.

[0073] As used herein, the term "biomarker panel" is intended to include one or more of the biomarkers disclosed in the present disclosure. The biomarker panel can be detected using a detection agent (or reagent) that can directly or indirectly associate with or bind to a biomarker protein or gene present in a sample.

[0074] The brain somatic mutant associated with intractable epilepsy in accordance with the present disclosure may be a mutant of a gene or protein involved in the PI3K-AKT-mTOR pathway. For example, mutants of mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or proteins may be available. These mutant genes or proteins are as described above.

[0075] In a particular embodiment, the agent capable of detecting a substitution may be a primer, a probe or an antisense nucleic acid that is specific for a substitution region.

[0076] Another embodiment of the present disclosure addresses a method for providing information on the diagnosis of intractable epilepsy, comprising:

[0077] (a) treating a sample of a subject with the diagnostic kit;

[0078] (b) detecting in the sample a biomarker panel containing at least one selected from the group consisting of the substitutions listed in Table 1; and

[0079] (c) determining the onset of intractable epilepsy if the biomarker panel containing one or more of the substitutions is detected.

[0080] Also, contemplated in accordance with another aspect of the present disclosure is a diagnostic kit for intractable epilepsy, comprising an agent capable of detecting the amino acid substitutions listed in Table 1.

[0081] In a particular embodiment, the agent capable of detecting the substitutions may be an antibody or aptamer specific for a substitution region.

[0082] According to another aspect, the present disclosure relates to a method for providing information on the diagnosis of intractable epilepsy, comprising:

[0083] (a) treating a sample of a subject with the diagnostic kit;

[0084] (b) detecting in the sample a biomarker panel containing at least one selected from the group consisting of the mutations listed in Table 1; and

[0085] (c) determining the onset of intractable epilepsy if the biomarker panel containing one or more of the substitutions is detected.

[0086] In a particular embodiment, the sample may be a brain tissue sample from the subject.

[0087] Another aspect of the present disclosure addresses a biomarker panel for the diagnosis of intractable epilepsy, comprising the mutant protein or the mutant gene.

[0088] The term "agent capable of detecting a substitution", as used in the context of the detection of substitutions on nucleotide sequences, means a substance useful for detecting a substitution (mutation) on the nucleotide sequences of mTOR, TSC1, TSC2, AKT3 or PIK3CA in the sample. For example, the agent may be a primer, probe, or an antisense oligonucleotide capable of binding specifically or complementarily to a nucleotide sequence carrying a substitution. Particularly, the primer, the probe or the antisense oligonucleotide may specifically bind to the stretch carrying a substitution, but not to a wild-type sequence.

[0089] The term "complementary" as used herein means a level of complementarity sufficient to selectively hybridize with the nucleotide sequence under certain particular hybridization or annealing conditions, and particularly under physiological conditions, and is intended to include both substantial complementarity and perfect complementarity, particularly perfect complementarity.

[0090] In some embodiments of the present disclosure, the agent for detecting a substitution region of a gene may be an antisense oligonucleotide. The term "antisense oligonucleotide", as used herein, encompasses a nucleic acid-based molecule complementary to a target mutation region to form a duplex with the mutation region. It is applicable to the detection of the gene biomarker panel of the present disclosure.

[0091] In other embodiments of the present disclosure, the agent for detecting a substitution region of a gene may be a primer or a probe. Because nucleotide sequences of mTOR, TSC1, TSC2, AKT3 and PIK3CA mutant genes useful in the present disclosure are revealed, a primer or a probe for specifically amplifying a predetermined region of the gene can be designed on the basis of the nucleotide sequences.

[0092] As used herein, the term "primer" refers to a short nucleic acid strand, typically 7 to 50 bases long, having a free 3' hydroxyl group, which forms a base pair with a complementary template so as to serve as a starting point for the production of a new template strand. Primers are typically synthesized, but may be naturally occurring nucleic acids. The sequence of a primer need not be completely consistent with that of a target template, and may be accepted if it is sufficiently complementary to hybridize with the template. DNA synthesis or replication requires a suitable buffer, proper temperatures, polymerizing enzymes (DNA polymerase or reverse transcriptase), and four kinds of nucleotide triphosphates, in addition to primers. In the present disclosure, sense and antisense primers specific for mTOR polynucleotide can be used for PCR amplification so that the PCR products can be used to diagnose epilepsy. The length of the sense and antisense primers may be suitably altered depending on the information known in the art. Particularly, the primers useful in the present disclosure may be those applicable to the amplification of a mutant region of the gene provided by the present disclosure.

[0093] In other embodiments of the present disclosure, the agent for detecting a substitution region of a gene may be a probe. The term "probe", as used herein, is intended to refer to a fragment of a nucleotide sequence, such as RNA or DNA, ranging in length from ones to hundreds of bases, which can bind specifically to an mRNA of interest and which is tagged with a label for detecting the mRNA of interest. The probe useful in the present disclosure may be constructed in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, or RNA probes. In an embodiment of the present disclosure, the diagnosis of epilepsy may be achieved by determining whether a probe complementary to the mTOR mutant polynucleotide of the present disclosure hybridizes with the nucleotide sequence of interest. The selection of suitable probes and hybridization conditions may be modified according to information known in the art.

[0094] The primers or probes useful in the present disclosure may be chemically synthesized using a phosphoramidite solid support method or other well-known techniques. Their nucleotide sequences may be modified using various means known in the art, so long as their fundamental properties remain unchanged. Illustrative, non-limiting examples of the modification include methylation, capping, substitution of natural nucleotides with one or more homologues, and alternation between nucleotides.

[0095] The term "agent for detecting a substitution", as used in the context of the detection of a substitution on an amino acid sequence, refers to a substance useful for detecting a mutant region of a biomarker panel protein in a sample of a patient. Particularly, the agent may be an antibody or aptamer specific for a protein composed of an amino acid sequence carrying a mutation provided by the present disclosure. In some embodiments, the antibody may be monoclonal or polyclonal.

[0096] The term "antibody", as used herein, refers to a specific protein molecule that indicates an antigenic region. With respect to the purposes of the present invention, the antibody binds specifically to a mutant region of the biomarker panel protein of the present disclosure. This antibody can be produced from a protein that is encoded by the mutant gene, typically cloned into an expression vector using a conventional method. Also, partial peptides being producible from the protein which is encoded by the mutant gene fall within the scope of the antibody. To function as an antibody, the partial peptide is required to contain at least 7 amino acid residues, preferably 9 or more amino acid residues, and more preferably 12 or more amino acid residues. No particular limitations are imposed on the form of the antibodies of the present disclosure. Among them are polyclonal antibodies, monoclonal antibodies and fragments thereof which contain a paratope, and all immunoglobulin antibodies. Further, special antibodies such as humanized antibodies are also within the scope of the present invention.

[0097] In addition, the antibodies of the present disclosure which are used to detect the marker diagnostic of intractable epilepsy include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. The functional fragments of antibody molecules refer to fragments retaining at least an antigen-binding function, and include F.sub.ab, F.sub.(ab'), F.sub.(ab')2, F.sub.v and the like.

[0098] The agent for detecting a biomarker panel gene or protein in accordance with the present disclosure may be embodied into a kit. The kit according to the present disclosure is capable of detecting a biomarker panel gene or a protein. The kit of the present invention may comprise a primer, a probe or an antisense oligonucleotide for detecting a biomarker panel gene, or an antibody or an aptamer for detecting a biomarker panel protein, and one or more compositions, agents or devices suitable for analysis.

[0099] For instance, the kit for detecting a biomarker panel gene in accordance with the present disclosure may be a kit for diagnosing intractable epilepsy comprising elements necessary for DNA chip function. The DNA chip kit may comprise a substrate to which an agent for detecting a biomarker panel gene is immobilized, and a reagent, an agent and an enzyme for constructing a fluorescence-labeled probe. In addition, the substrate may contain an agent for quantitatively detecting a control gene or a fragment thereof. In addition, the kit designed to detect a biomarker panel gene may be a kit comprising elements necessary for PCR. Such a PCR kit may comprise a pair of primers specific for each of the mTOR mutant genes, test tubes or other suitable containers, reaction buffers (various pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Tag-polymerase, a DNase inhibitor, an RNase inhibitor, DEPC-water, sterile water, and so on. In addition, the kit may further comprise a pair of primers specific for a gene useful as a quantitative control. Particularly, the kit may be a multiple PCR kit for simultaneously amplifying and analyzing biomarker panel genes through multiple PCR.

[0100] Alternatively, the kit for detecting a biomarker panel protein may comprise antibodies and elements necessary for the immunological detection of the antibodies, including a support, a suitable buffer, a coloring enzyme- or fluorescent-labeled secondary antibody, and a coloring substrate. Examples of the support include a nitrocellulose membrane, a 96-well plate made of polyvinyl resin or polystyrene resin, and slide glass. Among the coloring enzymes are peroxidase and alkaline phosphatase. FITC or RITC may be used as a fluorescent. ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)) or OPD (o-phenylenediamine), or TMB (tetramethyl benzidine) is suitable as the coloring substrate.

[0101] Genomic DNA or total protein available in the method for detecting a biomarker panel in a sample of a subject according to the present disclosure may be separated using a process known in the art.

[0102] The term "a sample of a subject", as used herein, is intended to encompass specimens including tissues and cells in which the biomarker panel gene or protein can be detected. Particularly, the sample may be a brain tissue sample, but is not limited thereto.

[0103] According to some embodiments of the present disclosure, the method for detecting a biomarker panel gene in a sample of a subject comprises amplifying a nucleic acid from the sample and determining the base sequence of the amplified nucleic acid.

[0104] The amplification of the nucleic acid may be achieved by polymerase chain reaction (PCR), multiplex PCR, touchdown PCR, hot start PCR, nested PCR, booster PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE) PCR, inverse PCR, vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR), ligase chain reaction, repair chain reaction, transcription-mediated amplification, self-sustained sequence replication, or selective amplification of target polynucleotide sequences.

[0105] To determine the base sequence of the amplified nucleic acid, Sanger sequencing, Maxam-Gilbert sequencing, Shotgun sequencing, pyrosequencing, hybridization by microarray, allele-specific PCR, dynamic allele-specific hybridization (DASH), PCR extension assay, TaqMan technique, automated DNA sequencing, or next-generation DNA sequencing may be used. The next-generation DNA sequencing may be performed using a DNA analyzing system widely known in the art, for example, 454 GS FLX manufactured by Roche, Genome Analyzer manufactured by Illumina, SOLid Platform manufactured by Applied Biosystems, etc.

[0106] The detection of a biomarker panel protein in a sample of a patient may be performed by Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistostaining, immunoprecipitation assay, complement fixation assay, FACS, or protein chip assay using an antibody or aptamer specifically detecting the corresponding amino acid mutation. With the analysis methods, an antigen-antibody complex between the mTOR mutant protein and the antibody thereof can be identified, and intractable epilepsy can be diagnosed by examining the antigen-antibody complex between the mutant protein and the antibody thereof.

[0107] As used herein, the term "antigen-antibody complex" is intended to refer to a product formed by the binding of a mutant protein to an antibody specific thereto. The antigen-antibody complex thus formed may be quantitatively determined by measuring the signal intensity of a detection label.

[0108] The detection label may be selected from a group consisting of enzymes, fluorescents, ligands, luminescents, microparticles, redox molecules, and radioactive isotopes, but not strictly limited thereto. If an enzyme is used as the detection label, available enzymes may include .beta.-glucuronidase, .beta.-D-glycosidase, .beta.-D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholinesterase, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decarboxylase, .beta.-lactamase or the like, but are not limited thereto. Examples of the fluorescents may include fluorescein, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, fluorescamine or the like, but are not limited thereto. The ligand may be exemplified by biotin derivatives, but is not limited thereto. Among the luminescents may be acridinium ester, luciferin, and luciferase. Representative of the microparticles are colloidal gold and colored latex, without limitation thereto. The redox molecules may include ferrocene, ruthenium complex, biologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone, K.sub.4W(CN).sub.8, [Os(bpy).sub.3].sup.2+, [RU(bpy).sub.3].sup.2+, [MO(CN).sub.8].sup.4- or the like, but are not limited thereto. The radioactive isotope may be exemplified by, but are not limited to, .sup.3H, .sup.14C, .sup.32P, .sup.35S, .sup.36Cl, .sup.51Cr, .sup.57Co, .sup.58Co, .sup.59Fe, .sup.90Y, .sup.125I, .sup.131I, .sup.186Re or the like.

[0109] In one exemplary embodiment, the measurement of an antigen-antibody complex between a biomarker panel protein and an antibody thereof may be achieved through an ELISA assay. In this regard, various kinds of ELISA assay may be employed, including direct ELISA using a labeled antibody that recognizes antigen attached to a solid support, indirect ELISA using a labeled antibody that recognizes a capture antibody from the complex of the antibody that recognizes an antigen attached to the solid support, direct sandwich ELISA using a labeled antibody that recognizes the antigen of an antigen-antibody complex attached to the solid support, and indirect sandwich ELISA, in which an antibody recognizing the antigen of an antigen-antibody complex attached to a solid support is detected by a labeled secondary antibody.

[0110] Most useful is a sandwich ELISA assay in which an antibody attached to a solid support is reacted with a sample and then captured by a labeled antibody recognizing the antigen of an antigen-antibody complex to perform enzymatic staining or by a labeled secondary antibody recognizing the antigen of an antigen-antibody complex to perform enzymatic staining. The onset of intractable epilepsy can be determined by identifying the formation of a complex between the biomarker panel and the antibody.

[0111] In another embodiment, Western blotting may be carried out using one or more antibodies active against the biomarker panel. For example, total proteins are isolated from a sample and separated according to size via electrophoresis. The electrophoresed proteins are then transferred onto a nitrocellulose membrane and reacted with the antibody. Quantitative analysis of the formed antigen-antibody complex with a labeled antibody makes it possible to determine the onset of intractable epilepsy, based on the expression level of the mutant protein encoded by the mutant gene. Such detection may be carried out by investigating an antigen-antibody complex between a mutant protein and an antibody thereof.

[0112] Also, available in accordance with still another embodiment of the present disclosure is a protein chip in which an array of antibodies against biomarker panel proteins is immobilized at predetermined loci and high density on a substrate. The protein chip assay may comprise isolating total proteins from a sample, hybridizing the isolated proteins with the protein chip to form an antigen-antibody complex, reading the information displayed on the protein chip to identify the presence of a protein of interest, and determining the onset of intractable epilepsy.

[0113] When an mTOR mutant gene or protein is detected using any of the detection methods, diagnosis can be made of the onset of intractable epilepsy caused by malformations of cortical developments.

[0114] According to another aspect thereof, the present disclosure addresses a technique of constructing an epilepsy model, comprising inducing intractable epilepsy with the genetic mutation and protein mutation.

[0115] A particular embodiment pertains to a composition for inducing intractable epilepsy, comprising at least one selected from among mTOR, TSC1, TSC2, AKT3, and PIK3CA mutant genes or proteins.

[0116] Also, contemplated in accordance with another aspect of the present disclosure is an intractable epilepsy-induced animal into which a mutant gene or protein of at least one selected from among mTOR, TSC1, TSC2, AKT3 and PIK3CA is introduced.

[0117] In accordance with another aspect thereof, the present disclosure pertains to a method for inducing intractable epilepsy, comprising introducing a mutant gene or protein of at least one selected from among mTOR, TSC1, TSC2, AKT3 and PIK3CA into a cell, ex vivo.

[0118] As used herein, the term "induction" means effecting a change from a normal state into a pathological state. For the purpose of the present disclosure, the term "induction" as used in conjunction with epilepsy refers to induction of the onset of intractable epilepsy from a healthy state.

[0119] In some embodiments, epilepsy-induced cells can be prepared by introducing a mutant gene or protein of at least one of mTOR, TSC1, TSC2, AKT3, and PIK3CA into cells. The cells include brain cells or embryos. The cells into which the mutant gene or protein is introduced may be developed into an intractable epilepsy-induced animal. When the mutant gene or protein is introduced, mTOR hyperactivation may occur, causing a failure in neuronal migration and a significant increase in S6K phosphorylation, with the consequent induction of epilepsy.

[0120] mTOR, TSC1, TSC2, AKT3, and PIK3CA mutant proteins with mutations on their wild-type amino acid sequences may be obtained from natural sources by extraction and purification using a method widely known in the art. Otherwise, the mutant proteins can be prepared by chemical synthesis (Merrifield, J. Amer. Chem. Soc. 85:2149-2156, 1963) or by recombinant DNA technology.

[0121] For chemical synthesis, a polypeptide synthetic method widely known in the art may be used. In recombinant DNA technology, a nucleic acid encoding a protein having a mutation on its amino acid sequence is inserted into a suitable expression vector, which is then transformed into host cells. They are cultured to express the mutant protein, followed by recovering the mutant protein, having a mutation on the amino acid sequence thereof, from the host cells. After being expressed in selected host cells, the mutant protein can be isolated and purified using a typical biochemical separation technique, for example, treatment with a protein precipitant (salting-out), centrifugation, sonication, ultrafiltration, dialysis, various chromatographic techniques such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, and affinity chromatography. Typically, the techniques are used in combination to achieve a protein of high purity.

[0122] Nucleotide sequences coding for mTOR, TSC1, TSC2, AKT3, and/or PIK3CA proteins with a mutation on their wild-type amino acid sequences can be isolated from natural sources or prepared by chemical synthesis. Nucleic acids having such nucleotide sequences may be single- or double-stranded, and may be DNA molecules (genome, cDNA) or RNA molecules. For the chemical synthesis of nucleic acids, synthetic methods widely known in the art, such as those described in the literature (Engels and Uhlmann, Agnew(?) Chem. Int. Ed. Engl. 37:73-127, 1988) may be used, as exemplified by triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods, oligonucleotide synthesis on solid supports or the like.

[0123] In a particular embodiment of the present disclosure, the mutant protein or gene may be introduced into cells, embryos or animals with the aid of a recombinant vector.

[0124] The term "vector", as used herein, refers to a means for introducing a nucleotide sequence encoding a protein of interest into a host cell. Plasmid vectors, cosmid vectors, and viral vectors fall within the scope of such a vector. A suitable expression vector may include a signal sequence or leader sequence for membrane targeting or secretion, in addition to regulatory elements such as a promoter, an operator, an initiation codon, a termination codon, a polyadenylation signal, and an enhancer, and may be constructed into various structures depending on the purpose. The initiation codon and the termination codon may be generally considered a portion of a nucleotide sequence encoding a protein of interest, necessarily functional in an individual to whom a genetic construct has been administered, and must be in a frame together with the coding sequence. The promoter may be generally constitutive or inducible. Further, the expression vector may include a selectable marker for selecting host cells containing the vector. For a replicable expression vector, a replication origin is necessary. A vector may replicate by itself, or may be incorporated into a host genomic DNA.

[0125] In a particular embodiment, a vector carrying a gene is designed so that the gene is irreversibly incorporated into the genome of a host cell and is stably expressed for a long time in the cell.

[0126] The mutant protein or gene of the present disclosure may be introduced into cells, particularly brain cells. In addition, it may be introduced into embryos, preferably embryos at the stage of brain formation and development.

[0127] No particular limitations are imposed on the method of introducing proteins or genes. For example, a vector may be inserted into cells, using a method such as transformation, transfection or transduction. The vector introduced into cells continuously expresses a gene inserted thereinto in the cells so as to produce a mutant protein having a mutation on its wild-type amino acid sequence.

[0128] As used herein, the term "epilepsy-induced animal" is intended to refer to a non-human animal that is transformed to exhibit increased intracellular mTOR protein activity compared to normal cells. The transformation may be induced by introducing a vector expressing at least one mutant protein of mTOR, TSC1, TSC2, AKT3 and/or PIK3CA into cells. The transgenic animal with intractable epilepsy can be effectively used as an intractable epilepsy animal model.

[0129] As used herein, the term "animal model" or "disease model" is intended to refer to an animal that suffers from a disease similar to a specific human disease and thus can be used as a model for the study of etiology and pathogenesis. For use as an animal model, an animal should support prediction of the same effect as in humans and should be easily and reproducibly constructed. In addition, the disease of the animal model should have the same etiology as in humans, or should progress in a pattern similar to that in humans. Accordingly, mammalian vertebrates, which are similar in body structure to humans, for example with respect to the internal organs, immune system, and body temperature, and which suffer from diseases such as hypertension, cancer, immunodeficiency, etc. are suitable as animal models. The animals are particularly mammals, such as horses, sheep, pigs, goats, camels, antelopes, dogs, rabbits, mice, rats, guinea pigs, and hamsters, and more particularly rodents such as mice, rats, guinea pigs, and hamsters. A mouse is most frequently used in studying human diseases because of its various advantages including small size, potent fertility, easy feeding management, high resistance to disease, hereditary uniformity, and variety of strains. Another advantage for acceptance for use as an animal model is that mice can be transformed to exhibit diseases or symptoms identical or similar to those in humans.

[0130] The animal model of the present disclosure is an epilepsy model constructed by gene manipulation to express at least one of mutant proteins of mTOR, TSC1, TSC2, AKT3 and/or PIK3CA. Exhibiting the ability to induce intractable epilepsy, the mutant protein or gene of the present disclosure can be introduced into cells or embryos to construct an intractable epilepsy model.

[0131] In the present disclosure, for example, at least one of mutant proteins or genes of mTOR, TSC1, TSC2, AKT3 and PIK3CA is introduced into an animal embryo which can then be developed into an animal in which intractable epilepsy is induced. The mutant protein or gene can be introduced into embryos with the aid of a vector carrying the gene. No particular limitations are imposed on the technique of introducing the vector into an embryo. Particularly, the vector may be introduced into an embryo at the stage of cerebral cortex formation.

[0132] The animal model with epilepsy according to the present disclosure can be effectively applied to the study of gene functions, molecular mechanisms of epilepsy, and novel anti-epileptic drugs.

[0133] Another aspect of the present disclosure addresses a composition, a kit and a method for preventing, ameliorating or treating intractable epilepsy or a disease causative of intractable epilepsy. The disease causative of intractable epilepsy includes malformations of cortical developments (MCD) such as FCD, Hemimegalencephaly and Tuberous Sclerosis Complex, Hippocampal Sclerosis (HS), and Sturge-Weber Syndrome (SWS).

Advantageous Effects

[0134] As described above, the administration of an mTOR inhibitor, for example, rapamycin, everolimus, and/or the compounds of Chemical Formulas 1 to 4, into patients with brain somatic mutation-associated FCD can bring about a significant decrease in the frequency of onset of brain somatic mutation-associated intractable epilepsy or its causes, for example, spontaneous seizures, behavioral seizures, and electrographic seizures, and in the number or soma size of abnormal neurons in the cerebral cortex. In addition, the present disclosure provides a biomarker panel effective for the diagnosis of intractable epilepsy and a technique for the diagnosis of intractable epilepsy using the same. Moreover, intractable epilepsy can be induced in accordance with the present disclosure, and epilepsy animal models thus constructed make it possible to study genetic functions, the molecular mechanisms of epilepsy, and novel anti-epileptic drugs.

DESCRIPTION OF DRAWINGS

[0135] FIG. 1a shows post-operative brain MRI images of patients carrying mTOR mutations (FCD4, FCD6), and H&E staining of pathological samples from the patients. The arrowheads (white) indicate resected brain regions and the arrows (black) indicate cytomegalic neurons (Scale bar=50 um).

[0136] FIG. 1b shows sites of mTOR-associated somatic mutations as found in FCD patients through deep sequencing.

[0137] FIG. 1c shows evolutionarily conserved amino acid residues responsible for the mTOR-associated somatic mutations on the mTOR sequences.

[0138] FIG. 2a shows the results of Western blot analysis of S6 phosphorylation in mTOR mutation-expressing HEK293T cells. "P-S6" stands for phosphorylated S6 proteins, "S6" for S6 proteins, and "Flag" for flag proteins. "20% serum" represents a positive control with mTOR activity after exposure to 20% serum for 1 hr.

[0139] FIG. 2b shows the results of an in-vitro kinase assay for mTOR proteins in HEK293 cells expressing the mTOR mutations of the present disclosure.

[0140] FIG. 2c shows the results of an immunohistochemical assay for S6 phosphorylation level and soma size in pathological samples from patients with FCD-caused intractable epilepsy.

[0141] FIG. 2d shows the mean numbers of phosphorylated S6 proteins in representative cortical regions of patients with FCD-caused intractable epilepsy (number of counted cells=197-1182 per case).

[0142] FIG. 2e shows the mean soma sizes of neurons in representative cortical regions of patients with FCD-caused intractable epilepsy.

[0143] FIG. 3a shows schematic views of a procedure for electroporating embryos in utero at embryonic day 14 (E14) with a plasmid carrying mTOR mutations, followed by screening only mice exhibiting fluorescence with a flashlight (Electron Microscopy Science, USA) after birth, monitoring the mice for seizures through video-electroencephalography (video-EEG), and examining the effect of rapamycin after the onset of seizures. The "in-utero electroporation (E14)" schematically shows the electroporation of a plasmid carrying mTOR mutations at embryonic day 14, the "GFP screening at birth (P0)" schematically shows monitoring only of fluorescence-exhibiting mice with a flashlight (Electron Microscopy Science, USA) after the electroporated embryos are delivered, and the "Video-EEG monitoring (>3 weeks)" schematically shows recording video-EEG with implanted electrodes after video monitoring of seizure onset from the time of weaning (>3 weeks).

[0144] FIG. 3b shows the presence of spontaneous seizures in mice carrying mTOR mutations of the present disclosure, based on video-EEG recording. The "No. of GFP+pups" represents the number of mice that expressed GFP as a result of the introduction of mTOR mutations thereinto, and the "No. of mice with seizure" represents the number of mice that underwent seizures as a result of the introduction of mTOR mutations thereinto.

[0145] FIG. 3c shows frequencies of spontaneous seizures in mice carrying mTOR mutations of the present disclosure before and after rapamycin treatment. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test).

[0146] FIG. 3d shows changes in the soma size of GFP-positive neurons in mice carrying mTOR mutations of the present disclosure before and after rapamycin treatment.

[0147] FIG. 4 is a schematic view of the experimental design of the present disclosure, showing deep sequencing analysis in tissues from FCD patients, and in-vitro and in-vivo functional analysis.

[0148] FIG. 5a shows algorithms used to exploit brain-specific mutations using both Virmid (Genome Biology, 14(8), R90 (2013)) and MuTect software (Nature Biotechnology, 31, 213 (2013)) with regard to the deep sequencing results.

[0149] FIG. 5b shows sequencing counts of reference (Ref) and mutant (Mut) alleles, and percentages of mutated alleles from deep whole exome sequencing and amplicon sequencing of FCD patient samples.

[0150] FIG. 6 shows somatic mutations of FCD, found by deep whole exome sequencing, as colored bars in the collapsed mode of an Integrative Genomic Viewer (IGV).

[0151] FIG. 7 shows brain MRI images from FCD patients. Arrows highlight the affected cortical regions.

[0152] FIG. 8 shows domain organizations and 3-D structures of the mTOR kinase prepared using PyMol 1 (the PyMOL Molecular Graphics System, Schrodinger, LLC). "FAT" stands for FRAP, ATM, and TRRAP domains of mTOR, "FRB" for FKBP12-rapamycin binding domain, and "KD" for N and C lobes of the kinase domain. The activation and catalytic loops are indicated in red and blue, respectively. ATPrS and Mg.sup.2+ are shown as sticks and spheres, respectively. Identified mutation sites in FCD patients are labeled in red.

[0153] FIG. 9a shows the effects of rapamycin on HEK293K cells expressing mTOR mutations.

[0154] FIG. 9b shows the effects of rapamycin on HEK293K cells expressing mTOR mutations. "P-S6K" represents phosphorylated S6 proteins and "S6K" represents S6 proteins.

[0155] FIG. 9c shows the effects of the compounds of Chemical Formulas 1 to 4 and everolimus on HEK293K cells expressing mTOR mutations. "P-S6K" represents phosphorylated S6 proteins and "S6K" represents S6 proteins.

[0156] FIG. 10 shows the enrichment of the mTOR mutant allele of the present disclosure, as analyzed by Sanger sequencing after cytomegalic neurons with increased S6 phosphorylation, obtained from pathological tissues of patients with FCD-caused intractable epilepsy, are microdissected. NeuN-positive cytomegalic neurons with increased S6 phosphorylation are labeled with yellow dots. "LCM" represents cytomegalic cells microdissected through laser capture microdissection. For a control, bulk genomic DNA, extracted from brain samples without enrichment, was used. Scale bar, 100 .mu.m.

[0157] FIG. 11a is a schematic view of the procedure for in-utero electroporation with a plasmid carrying mTOR mutations of the present disclosure at E14, followed by the analysis of brain coronal sections at E18.

[0158] FIG. 11b shows images of coronal sections of mouse brains electroporated with mTOR mutants of the present disclosure, representing the disruption of neuronal migrations and mTOR activity. "CP" stands for cortical plate, "IZ" for intermediate zone, "SVZ" for subventricular zone, "VZ" for ventricular zone, "Wild type" for the insertion of a wild-type mTOR plasmid, and "Relative intensity value" for the relative intensity of a GFP (green fluorescent protein) in each case.

[0159] FIG. 11c shows mTOR activity in the developing mouse neocortex after the introduction of the mTOR mutations of the present disclosure (Scale bars, 20 .mu.m, Error bars, s.e.m.).

[0160] FIG. 12a shows video-EEG records of spontaneous seizures in mice expressing the mTOR mutations of the present disclosure. "LF" stands for left frontal, "RF" for right frontal, "LT" for left temporal, and "RT" for right temporal.

[0161] FIG. 12b shows interictal spikes and nonconvulsive electrographic seizures in mice expressing the mTOR mutations of the present disclosure.

[0162] FIG. 12c shows a change in the frequency of interictal spikes in mice expressing the mTOR mutations of the present disclosure before and after rapamycin treatment.

[0163] FIG. 12d shows a change in the frequency of nonconvulsive electrographic seizures in mice expressing the mTOR mutations of the present disclosure before and after rapamycin treatment.

[0164] FIG. 12e shows the time of seizure onset in mice carrying a wild-type mTOR gene or a mTOR mutant of the present disclosure. (n=8-20 for each group). Error bars, s.e.m.

[0165] FIGS. 13 and 14 show the results of the treatment of HEK293T cells, expressing the mTOR mutations of the disclosure, with various mTOR inhibitors. "P-S6K" stands for phosphorylated S6 kinase, and "S6K" for S6 kinase.

[0166] FIG. 15 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant TSC-1. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6 kinase and "S6K" for S6 kinase.

[0167] FIG. 16 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant TSC-2. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6 kinase and "S6K" for S6 kinase.

[0168] FIG. 17 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant AKT3. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6K kinase and "S6K" for S6K kinase.

[0169] FIG. 18 shows the association of p.Arg22Trp and p.Arg204Cys mutations of TSC-1 with mTOR hyperactivation, as analyzed in Example 9. Immunoprecipitation assay results are given to identify the mechanism of TSC1 mutant-induced mTOR hyperactivation. "Empty" indicates non-treated cells.

[0170] FIG. 19 shows the results of the GTP-agarose pull down assay according to Example 9. The activity level of the TSC complex was analyzed by measuring the level of GTP-bound Rheb, a substrate of the TSC complex.

[0171] FIG. 20 shows results of the treatment of mutant mTOR-expressing HEK293T cells with rapamycin. **p<0.01 and ***p<0.001 (comparison with wild-type, n=3-5 for each group, one-way ANOVA with Bonferroni's post test)

[0172] FIG. 21 shows the results of the treatment of mutant mTOR-expressing HEK293T cells with rapamycin. "P-S6K" stands for phosphorylated S6 kinase, and "S6K" for S6 kinase.

[0173] FIG. 22 shows the results of the treatment of mutant mTOR-expressing HEK293T cells with the compounds of Chemical Formulas 1 to 4, and everolimus. "P-S6" stands for phosphorylated S6, and "S6" for S6 protein.

[0174] FIGS. 23a and 23b show the results of Western blot analysis of wild-type or mutant mTOR-expressing HEK293T cells before and after treatment with 6 different drugs according to Example 10. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6 kinase, and "S6K" for S6 kinase.

[0175] FIGS. 24a and 24b show the results of Western blot analysis of wild-type or mutant TSC1-expressing HEK293T cells before and after treatment with 6 different drugs. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6 kinase, and "S6K" for S6 kinase.

[0176] FIGS. 25a and 25b show the results of Western blot analysis of wild-type or mutant TSC1-expressing HEK293T cells before and after treatment with 6 different drugs. (-) and (+) indicate a control and rapamycin treatment (200 nM), respectively. "P-S6K" stands for phosphorylated S6 kinase, and "S6K" for S6 kinase.

[0177] FIGS. 26a and 26c show pathological samples from all FCD patients identified as carrying TSC1 and TSC2 mutations. "Non-FCD" stands for samples with normal brains, "P-S6" for phosphorylated S6 proteins, "NeuN" for a neuronal marker, and "Merge" for merged images of P-S6 and NeuN.

[0178] FIGS. 26b and 26d show percentages of cells expressing phosphorylated S6 in 4-5 cortical regions.

[0179] FIGS. 26e and 26f show the soma sizes of neuronal marker(NeuN)-positive neurons. *p<0.05, **P<0.001, ***P<0.0001 [relative to Non-FCD samples, one-way ANOVA with Bonferroni posttest]. Error bars, s.e.m. Scale bars, 50 um.

[0180] FIG. 27a shows the disruption of neuronal migration in TSC mouse models, resulting in malformations of cortical developments. "Control" indicates the absence of sgRNA, and red letters indicate percentages of cells expressing the plasmids. Scale bars, 250 um. FIG. 27b shows the distribution of electroporated cells in the cortex. *p<0.05, ***P<0.0001 [Two-way ANOVA with Bonferroni posttest]. Error bars, s.e.m.

[0181] FIG. 28 shows electrographic seizures measured in TSC mouse models with spontaneous seizures after administration with rapamycin. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test)

MODE FOR INVENTION

[0182] A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed as limiting the present invention.

Example 1: Identification of Gene by Whole Exome Sequencing, and Confirmation

Example 1-1: Identification of 3 Candidate mTOR Mutations from 4 Patients Through Whole Exome Sequencing

[0183] Deep whole exome sequencing (read depth 412-668.times.) was performed on brain tissue samples from four FCDII patients (designated FCD3, FCD4, FCD6, and FCD23, respectively). Selection was made of three candidate genetic mutations that were found simultaneously using the two algorithms Virmid and Mutect.

[0184] To obtain data of the whole exome sequencing, libraries of sequences were prepared using the Agilent library preparation protocols (Agilent Human All Exon 50 Mb kit) according to the manufacturer's instructions. The libraries were subjected to sequencing on Hiseq2000 (Ilumina). For more accurate analysis, sequencing was carried out with a read depth of about 500.times., five-times higher than the general sequencing depth. The sequencing data was prepared into a file that can be analyzed using the Best Practices Pipeline suggested by Broad Institute (https://www.broadinstitute.org/gatk/).

Example 1-2: Confirmation of 3 Gene Mutant Candidates by Site-Specific Amplicon Sequencing and Identification of One Genetic Mutation (L2427P)

[0185] Site-specific amplicon was performed for the candidate mutations--(read depth, 100-347, 499.times.). The samples were obtained from the same brain tissue block through biological replication, thereby minimizing any unexpected sequencing artifacts or erroneous calls that can mimic low-frequency somatic mutations. For the site-specific amplicon sequencing, the samples were determined to have a mutation when the percentage of mutated reads exceeded 1%.

[0186] Site-Specific Amplicon Sequencing

[0187] Two pairs of primers carrying two target regions of mTOR target gene codon sites (amino acids Cys1483 and Leu2427) were designed (Table 2).

TABLE-US-00002 TABLE 2 SEQ ID Target region primer NO Chr1:11174301~ Forward 5'-TAGGTTACAGGCCTGGATGG- 11 Chr1:11174513 3' Reverse 5'-CTTGGCCTCCCAAAATGTTA- 12 3' Chr1:11217133~ Forward 5'-TCCAGGCTACCTGGTATGAGA- 13 Chr1:11217344 3' reverse 5'-GCCTTCCTTTCAAATCCAAA- 14 3'

[0188] Each primer had a patient-specific index, and only a single index was assigned to the sample from one patient so as to indicate patient origins of the base sequences upon the analysis of genetic mutations. PCR was performed on the target regions using the primers to amplify the nucleotide sequences of the two target regions. Subsequently, a DNA library was constructed using a Truseq DNA kit (Illumina) and libraries of the target genes were sequenced again on a Miseq sequencer (Illumina) (median read depth 135,424.times.). Using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml), the sequences were aligned to a reference genome to generate analyzable files (bam files).

Example 1-3: Sequencing Analysis Results

[0189] The use of two different sequencing platforms in biological replicates, as shown in FIG. 5a, revealed recurrent mTOR c.7280T>C encoding p.Leu2427Pro in two patients. The allelic frequencies in the affected brains, as shown in FIG. 5b, ranged from 9.6 to 12.6% in FCD4 and from 6.9 to 7.3% in FCD6.

[0190] In addition, the mutation was negative in blood samples, as shown in FIGS. 5b and 6.

Example 2: Search of mTOR-Specific Gene Mutation in Large Cohort

[0191] Based on the data of mTOR-specific genetic mutations obtained from 4 patients in Example 1, deep sequencing of the mTOR gene was performed for a large FCDII cohort including 73 patients.

Example 2-1: Collection of Patient Samples and Extraction of Genomic DNA

[0192] From 73 focal cortical dysplasia (FCD)-caused intractable epilepsy patients undergoing epilepsy surgery, surgical brain tissues (1-2 g), saliva (1-2 ml), blood (about 5 ml), and formalin-fixed, paraffin-embedded brain samples were obtained with the consent thereof (Neurosurgery Dept. and Neurology Dept. of Severance Children's Hospital, Seoul, Korea). Genomic DNA was extracted from the freshly frozen brain, blood, saliva, and formalin-fixed, paraffin-embedded brain tissues using the following kits according to the instructions of the manufacturers:

[0193] Brain tissue: Qiamp mini DNA kit (Qiagen, USA), blood: Flexigene DNA kit (Qiagen, USA), saliva: prepIT2P purification kit (DNA Genotek, USA), formalin-fixed, paraffin-embedded brain tissue: Qiamp mini FFPE DNA kit (Qiagen, USA).

Example 2-2: Sequencing

[0194] Hybrid capture sequencing of brain tissue samples from 73 FCDII patients were performed (read depth, 100-17,700.times.). PCR-based amplicon sequencing was carried out through site-specific amplicon sequencing (read depth, 100-347,499.times., 73 patients) and mTOR amplicon sequencing (read depth, 100-20,210.times., 59 patients).

[0195] For hybrid capture sequencing, an mTOR-specific probe was designed using SureDesign online tools (Agilent Technologies). Sequencing libraries were prepared using Agilent library preparation protocols according to the manufacturer's instructions. Sequencing was conducted using Hiseq2500 (Illumina) (median read depth 515.times.). The data obtained from the sequencing was prepared into analyzable files (bam files) using the Broad Institute best practice pipeline (https://www.broadinstitute.org/gatk/).

[0196] For mTOR amplicon sequencing, extracted genomic DNA was sequenced using customized MTOR amplicon (Truseq custom amplicon kit, Illumina) designed with illumine design studio (http://designstudio.illumina.com). DNA library preparation was performed according to the manufacturer's instructions. The libraries were sequenced on a Miseq sequencer (Illumina) (median read depth 1,647.times.). Analyzable bam files were generated using the BWA-MEM algorithm (http://bio-bwa.sourceforge.net).

Example 2-3: Sequencing Result

[0197] In order to find brain-specific, de novosomatic mutations, blood-brain paired whole exome sequencing data sets were analyzed using both Virmid (http://sourceforge.net/projects/virmid/) and Mutect (http://www.broadinstitute.org/cancer/cga/mutect). Only the somatic mutations that were commonly found in the two analytic approaches were used in subsequent experiments.

[0198] Of the mutations commonly found in the hybrid capture sequencing and the PCR-based amplicon sequencing, only those meeting selection standards (depth 100 or greater, and 3 or more mutated calls (mapping quality 30 or higher) were selected as disease-related candidates.

[0199] For all 2508 CRAM files (compressed files) downloaded from the 1000 Genomes Project FTP, 9 somatic mutation positions were found (chr1:11298590 for c.1871G>A, chr1:11217330 for c.4348T>G, chr1:11217231 for c.4447T>C, chr1:11199365 for c.5126G>A, chr1:11188164 for c.5930C>A, chr1:11184640 for c.6577C>T, chr1:11184573 for c.6644C>T, chr1:11174395 for c.7280T>C and c.7280T>A). All of the 9 genomic positions were negative for the somatic mutations meeting the selection standards. Accordingly, the gene mutations identified in the present disclosure were found to be disease-specific.

Example 2-4: Sequencing Result

[0200] Overlapping mutations in both hybrid capture sequencing (73 patients) and mTOR amplicon sequencing (59 patients) were detected in order to obtain a total of 9 true candidate variants (inclusive of mutations found in Example 1).

[0201] To rigorously exclude any potential sequence artifacts and erroneous calls, variants were considered as true only when identified variants (>1% mutated reads) were reproducible in both hybrid capture and amplicon sequencing as well as in multi-samples.

[0202] This analysis, as shown in FIG. 1b, revealed another 10 FCDII patients carrying 8 different somatic mutations in MTOR: mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p.Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427Gln). In total, 15.6% of the participants (12/77) were positive for 9 different brain somatic mutations in mTOR (Table 3).

TABLE-US-00003 TABLE 3 Age upon mTOR gene mTOR protein Patient Surgery Sex Pathology mutation mutation FCD 5 years F Consistent with FCDIIa c.7280T > C p.Leu2427Pro 4 2 months (Cortical dyslamination/ Dysmorphic neurons) FCD 5 years F Consistent with FCDIIa c.7280T > C p.Leu2427Pro 6 (Cortical dyslamination/ Dysmorphic neurons) FCD 7 years F Consistent with FCDIIa C.6577C > T p.Arg2193Cys 91 1 month (Cortical dyslamination/ Dysmorphic neurons) FCD 1 year M Consistent with FCDIIa c.1871G > A p.Arg624His 104 2 months (Cortical dyslamination/ Dysmorphic neurons) FCD 3 years M Consistent with FCDIIa c.5126G > A p.Arg1709His 105 7 months (Cortical dyslamination/ Dysmorphic neurons) FCD 7 years F Consistent with FCDIIb C.6644C > T p.Ser2215Phe 107 3 months (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 10 years F Consistent with FCDIIb c.7280T > A p.Leu2427Gln 113 (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 7 years M Consistent with FCDIIb c.5930C > A p.Thr1977Lys 116 9 months (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 11 months M Consistent with FCDIIb c.4348T > G p.Tyr1450Asp 121 (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 4 years F Consistent with FCDIIb c.4447T > C p.Cys1483Arg 128 4 months (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 2 years F Consistent with FCDIIb c.6644C > T p.Ser2215Phe 143 10 months (Cortical dyslamination/ Dysmorphic neurons/balloon cells) FCD 4 years F Consistent with FCDIIb c.5930C > A p.Thr1977Lys 145 1 month (Cortical dyslamination/ Dysmorphic neurons/balloon cells)

[0203] All identified mutations were negative for all available saliva and blood samples from mutation-positive patients. 100% of the exomes from the 1000 Genomes database were mutation-negative. Among the mutations, p.Thr1977Lys, p.Ser2215Phe, and p.Leu2427Pro were recurrently found in two patients. All mutation-positive patients were found to have a single mTOR mutation. The allelic frequencies of identified mutations range from 1.26% to 12.6%. As can be seen in FIG. 1c, the affected amino acids are evolutionarily conserved.

Example 3: Identification of mTOR Mutation-Induced mTOR Hyperactivation

[0204] To determine whether mTOR p.Tyr1450Asp, p.Cys1483Arg, p.Leu2427Gln, and p.Leu2427Pro lead to mTOR hyperactivation, HEK293T cells were transfected with wild-type or mutant mTOR vectors, and S6 phosphorylation, a well-known biomarker of mTOR activation along with S6K phosphorylation, was subjected to Western blot analysis.

Example 3-1: Mutagenesis and mTOR Mutant Construct

[0205] A pcDNA3.1 flag-tagged wild-type mTOR construct was provided from Dr. Kun-Liang Guan at University of California, San Diego. This construct was used to generate mTOR mutant vectors (Y1450D, C1483R, L2427Q and L2427P) with a QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA).

[0206] To construct pCIG-mTOR mutant-IRES-EGFP vectors, an annealing primer set [forward primer 5'-AATTCCAATTGCCCGGGCTTAAGATCGATACGCGTA-3' (SEQ ID NO. 15) and reverse primer 5'-ccggtacgcgtatcgatcttaagcccgggcaattgg-3' (SEQ ID NO. 16)] were inserted into pCIG2 (CAG promoter-MCS-IRES-EGFP) to generate pCIG-C1 having new restriction enzyme sites MfeI and MluI. Using the primers [hmTOR-MfeI-flag-F; gATcACAATTGTGGCCACCATGGACTACAAGGACGACGATGACAAGatgc (SEQ ID NO. 17) and hmTOR-MluI-R;tgatcaACGCGTttaccagaaagggcaccagccaatatagc (SEQ ID NO. 18)], PCR fragments corresponding to wild-type and mutated mTOR genes were subcloned into the MfeI and MluI sites of pCIG-C1 to construct pCIG-mTOR wild type-IRES-EGFP and pCIG-mTOR mutant-IRES-EGFP vectors, respectively. Primers for mutagenesis are listed in Table 4, below.

TABLE-US-00004 TABLE 4 SEQ ID Name Primer NO Y1450D Forward 5'-TCGTGCAGTTTCTCATCCCAGGTAGC 19 CTGGATC-3' Reverse 5'-GATCCAGGCTACCTGGGATGAGAAAC 20 TGCACGA-3' C1483R Forward 5'-GGCCTCGAGGCGGCGCATGCGGC-3' 21 Reverse 5'-GCCGCATGCGCCGCCTCGAGGCC-3' 22 L2427Q Forward 5'-GTCTATGACCCCTTGCAGAACTGGAG 23 GCTGATG-3' Reverse 5'-CATCAGCCTCCAGTTCTGCAAGGGGT 24 CATAGAC-3' L2427P Forward GTCTATGACCCCTTGCCGAACTGGAGGCT 25 GATG Reverse CATCAGCCTCCAGTTCGGCAAGGGGTCAT 26 AGAC

Example 3-2. Transfection with Wild-Type and Mutant mTOR Vectors and Western Blot

[0207] HEK293T cells (Thermo Scientific) was cultured in DMEM (Dulbecco's Modified Eagle's Medium) containing 10% FBS at 37.degree. C. and 5% CO.sub.2. The cells were transfected with empty flag-tagged vector, flag-tagged mTOR wild type, and flag-tagged mTOR mutants using jetPRIME transfection reagent (Polyplus, France). The cells were serum-starved with DMEM containing 0.1% FBS for 24 hours after transfection and then incubated at 37.degree. C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour. The cells were lysed with PBS containing 1% Triton X-100 and Halt protease and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA).

[0208] Proteins were resolved by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). They were washed 4 times with TBST. The membranes were each incubated overnight at 4.degree. C. with primary antibodies including a 1/1000 dilution of anti-phospho-S6 ribosomal protein (5364, Cell Signaling Technology, USA), anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA), and anti-flag M2 (8164, Cell Signaling Technology, USA) in TBST. After incubation, the membranes were washed 4 times with TBST. They were incubated with a 1/5000 dilution of HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) for 2 hours at room temperature. After washing with TBST, immunodetection was performed using ECL reaction reagents.

Example 3-3. Monitoring of S6 Phosphorylation Level in Mutant mTOR-Expression Cell

[0209] An in vitro mTOR kinase assay was performed. To this end, the kinase activity of mTOR was assayed using a K-LISA mTOR activity kit (CBA055, Calbiochem, USA) according to the manufacturer's protocol. The transfected cells (HEK293T cells) were lysed with TBS containing 1% Tween 20, Halt protease, and phosphatase inhibitor cocktail. One mg of total lysates was pre-cleared by adding 15 .mu.l of protein G-beads (10004D, Life technologies, USA), and incubated at 4.degree. C. for 15 min. Anti-flag antibodies were added to the pre-cleared lysates and incubated overnight at 4.degree. C. Then, 50 .mu.l of 20% slurry protein G-beads was added and incubated at 4.degree. C. for 90 min. The supernatant was carefully discarded. The pelleted beads were washed 4 times with 500 .mu.l of lysis buffer and once with the 1.times. kinase buffer of the K-LISA mTOR activity kit (K-LISA mTOR activity kit). The pelleted beads were resuspended in 50 .mu.l of 2.times. kinase buffer and 50 .mu.l of mTOR substrate (p70S6K-GST fusion protein), followed by incubation at 30.degree. C. for 30 min. The reaction mixture was incubated in a glutathione-coated 96-well plate and incubated at 30.degree. C. for 30 min. The phosphorylated substrate was detected using an anti-p70S6K-pT389 antibody, an HRP antibody-conjugate and a TMB substrate. Relative activities were measured by reading the absorbance at 450 nm.

[0210] As is understood from the data of FIGS. 2a and 9b, S6 phosphorylation was robustly increased in mutant mTOR-expressing cells.

[0211] Wild-type and mutant mTOR proteins were pulled down from MTOR wild-type and mutant-expressing HEK293T cells, respectively, and assayed in vitro for mTOR kinase activity. As shown in FIG. 2b, pCys1483Arg, p.Leu2427Gln, and p.Leu2427Pro mTOR proteins had constitutively increased kinase activity.

Example 3-4. Change in S6K Phosphorylation after Drug Treatment

[0212] After treatment with drugs (rapamycin, everolimus, compounds of Chemical Formulas 1 to 4), the mutant mTOR-expressing cells were analyzed for S6K phosphorylation.

[0213] Transfection of mTOR mutants into HEK293T cells was carried out in the same manner as in Example 3-2. Then, the cells were serum-starved with DMEM containing 0.1% FBS for 24 hours and incubated at 37.degree. C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour, followed by treatment with rapamycin, everolimus, or compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458); Torin was purchased from TOCRIS, INK128, AZD8055, and GSK2126458 were provided from Selleckchem, and everolimus was purchased from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 9.

[0214] As can be seen in FIGS. 9a and 9b, the phosphorylation of S6K in mutant mTOR-expressing cells was inhibited by rapamycin treatment.

[0215] In addition, the mutant mTOR-expressing cells were monitored for S6K phosphorylation after treatment with everolimus or the compounds of Chemical Formulas 1 to 4.

[0216] Likewise, everolimus or the compounds of Chemical Formulas 1 to 4 inhibited the phosphorylation of S6K in the mutant mTOR-expressing cells, as shown in FIG. 9c.

Example 3-5. Change of S6K Phosphorylation with Various mTOR Inhibitors

[0217] Cells expressing various mTOR mutations were treated in the same manner as in Example 3-2 with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 and monitored for S6K phosphorylation. The mTOR mutations were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P, and L2427Q.

[0218] Briefly, the mutant mTOR-expressing cells were monitored for S6K phosphorylation level after treatment with everolimus or the compounds of Chemical Formulas 1 to 4. The results are depicted in FIGS. 13 and 14. As shown, the phosphorylation of S6K in all the mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4.

Example 4: mTOR Hyperactivation Induced by mTOR Mutation

Example 4-1: Immunostaining of Brain Tissue Section of FCD Patient

[0219] To determine whether the affected brains of FCDII patients carrying mutations are associated with mTOR hyperactivation, immunostaining was performed for S6 phosphorylation and NeuN (a neuronal marker) in brain tissue sections obtained from FCDII patients carrying the p.Leu2427Pro mutation.

[0220] Brain specimens that did not exhibit any malformations in cortical development (non-MCD) were collected in the operating room from the tumor-free margin of individual patients with glioblastoma as part of a planned resection, and were pathologically conformed to be normal brains without tumors. Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissues blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C. Cryostat-cut sections (10 um thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology), and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen). DAPI included in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DM13000 B inverted microscope. Cells positive for NeuN were counted using a 10.times. objective lens; 4-5 fields were acquired per subject within neuron-rich regions, and 100 or more cells were scored per region. The number of DAPI-positive cells represents total cell counts. Neuronal cell sizes were measured in NeuN-positive cells using the automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/).

[0221] As seen in FIG. 2c, the results showed a marked increase in the number of neuronal cells positive for phosphorylated S6 in FCDII patients (FCD4 and FCD6) carrying p.Leu2427Pro mutation, but not in non-FCD brains, as shown in FIG. 2d. In addition, the cell sizes of phosphorylated S6-positive neurons were measured, and a robust increase in the soma size in pathological samples was observed, as shown in FIG. 2e.

Example 4-2: Microdissection of S6 Phosphorylation-Increased, Cytomegalic Neurons in Brain Tissue of FCD Patient and Subsequent Sanger Sequencing

[0222] Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C. Cryostat-cut sections (10 um thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen).

[0223] DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. After immunofluorescence staining, phosphorylated S6 immunoreactive neurons (n=about 20 per case) were microdissected with a PALM Laser capture system (Carl Zeiss, Germany) and collected in an adhesive cap (Carl Zeiss, Germany).

[0224] Thereafter, genomic DNA was extracted from the collected neurons using a QiAamp microkit (Qiagen, USA), and mutation regions (mTOR c.7280T>C) were amplified by PCR using the primers: sense 5'-CCCAGGCACTTGATGATACTC-3' (SEQ ID NO. 27) and antisense, 5'-CTTGCTITGGGTGGAGAGTT-3' (SEQ ID NO. 28).

[0225] The PCR products thus obtained were purified with a MEGAquick spin total fragment purification kit (Intron, Korea), followed by Sanger sequencing with the aid of the BioDye Terminator and an automatic sequencer system (Applied Biosystems).

[0226] As shown in FIG. 10, moreover, the microdissection of cytomegalic neurons positive for phosphorylated S6 in the same pathological tissues showed the enrichment of the p.Leu2427Pro mutant allele in Sanger sequencing. These results suggest that the identified mTOR mutations are strongly associated with both the aberrant mTOR activation and the dysregulation of neuronal growth.

Example 5: Effect of mTOR Hyperactivation on Cerebral Development in Animal Model

[0227] The recurrent mutation p.Leu2427Pro was selected for in vivo functional analysis. in utero electroporation of mTOR mutant constructs was performed to analyze the effect of the mTOR mutations on cortical radial neuronal migration and S6 phosphorylation in mice.

Example 5-1: Construction of Animal Model

[0228] Timed pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4 L/min of oxygen and isoflurane vaporizer gauge 3 during surgery).

[0229] The uterine horns were exposed, and a lateral ventricle of each embryo was injected using pulled glass capillaries with 2 .mu.g/ml of Fast Green (F7252, Sigma, USA) combined with 2-3 .mu.g of mTOR mutant plasmids, constructed in Example 3-1, carrying mTOR C1483Y, mTOR E2419K, and mTOR L2427P mutants. Plasmids were electroporated on the head of the embryo by discharging 50 V with the ECM830 eletroporator (BTX-Harvard apparatus) in five electric pulses of 100 ms at 900-ms intervals.

Example 5-2: Image Analysis of Mouse Model

[0230] Embryonic mice were electroporated at embryonic day 14 (E14). Then, their brains were harvested after 4 days of development (E18) and fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C.

[0231] Cryostat-cut sections (30 um thick) were collected and placed on glass slides. DAPI, included in a mounting solution (P36931, Life Technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope or a Zeiss LSM510 confocal microscope. Fluorescence intensities reflecting the distribution of electroporated cells within the cortex were converted into gray values and measured from the ventricular zone (VZ) to the cortical plate (CP, using ImageJ software (http://rsbweb.nih.gov/ij/). Mander's co-localization analysis was carried out using Fiji software (http://fiji.sc/wiki/index.php/Colocalization_Analysis).

Example 5-3: Experiment Result

[0232] As shown in FIG. 11a, mTOR wild-type or p.Leu2427Pro constructs containing an IRES-GFP reporter were electroporated into the developing mouse cortex at embryonic day (E) 14, and measured for cortical radial migration and the S6 phosphorylation of GFP-positive neurons at E18.

[0233] It was observed, as shown in FIG. 11b, that brain sections expressing the mTOR mutant construct showed a significant decrease in GFP-positive cells in the cortical plate (CP) and an increase in GFP-positive cells in the intermediate zone (IZ), the subventricular zone (SVZ), and the ventricular zone (VZ), thereby indicating the disruption of cortical radial neuronal migration.

[0234] In addition, as shown in FIG. 11c, mTOR mutant expressing GFP-positive cells were observed to coexist with cells having an elevated level of S6 phosphorylation in brain sections. These findings suggest that the identified mTOR mutations cause the aberrant activation of mTOR kinase protein and the disruption of proper cortical development in vivo.

Example 6: Identification of mTOR Hyperactivation-Induced Disease Phenotype in Animal Model

Example 6-1. Identification of Spontaneous Seizure and Abnormal Neurons in Animal Model

[0235] A determination was made to see whether the focal cortical expression of mTOR induces spontaneous seizures in mice after in utero electroporation. Subsequent to in utero electroporation at E14, properly delivered mice pups at birth that showed GFP signals on the electroporated cortical region were selected, as shown in FIG. 3a.

[0236] Thereafter, continuous video-electroencephalographic monitoring of the mice was performed starting 3 weeks after birth. After weaning, the mice were monitored by video-recoding for 12 hrs per day until tonic-clonic seizures were observed. Then, mice with seizures were monitored using video-electroencephalography for 6 hrs per day over two days to characterize the spontaneous seizures with epileptic discharge.

[0237] Briefly, after weaning (>3 weeks), seizures were observed only through video monitoring. Thereafter, electrodes for recoding electroencephalograms were surgically implanted. A total of five electrodes were located in the epidural layer: based on the bregma, two electrodes on the frontal lobes (AP+2.8 mm, ML.+-.1.5 mm), two electrodes on the temporal lobes (AP-2.4 mm, ML.+-.2.4 mm), and one electrode on the cerebellum. After more than 4 days of recovery from surgery, EGG signals were recorded between 6 p.m. and 2 a.m. for 2-5 days (6 hrs per day). Signals were amplified with an amplifier (GRASS model 9 EEG/Polysomnograph, GRASS technologies, USA), and analyzed with the pCLAMP program (Molecular Devices, USA). Alternatively, a RHD2000 amplifier and board (Intan Technologies, USA) and MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab) were used for analysis.

[0238] For EGG analysis, 10-12 h continuous recording data was analyzed for interictal spike and nonconvulsive electrographic seizure counts. 1-min samples were selected from the data at standardized preset time points separated by exactly 1 h.

[0239] Each 1-min sample was assessed for the number of interictal epileptiform spikes and nonconvulsive electrographic seizures therein by an observer who was unaware of the treatment of the mice. Interictal spikes were defined as fast (<200 ms) epileptiform wave forms that occurred regularly and were at least twice the amplitude of the background activity. Nonconvulsive electrographic seizure episodes were counted when the EEG recording showed at least two connected spike-wave complexes (1-4 Hz) with amplitudes as at least twice as background, and were observed simultaneously in the majority of the four recording channels per mouse.

[0240] Surprisingly, as shown in FIGS. 3b and 12a, more than 90% of the mice expressing mTOR mutant constructs displayed spontaneous seizures with epileptic discharge, including high-voltage fast activity, high-voltage spikes and waves, and low-voltage fast activity. These mutant mice also showed interictal spikes and electrographic seizures (FIG. 12b). The mice in which spontaneous seizures were induced were observed to exhibit systemic tonic-clonic seizures consisting of a tonic phase, a clonic phase, and a postictal phase, similar to those found in FCDII patients. Further, brain waves are characterized by synchronized multi-waves of low-voltage, fast activity in the tonic phase, high-voltage standing waves in the clonic phase, and synchronized attenuated amplitudes in the postictal phase. However, neither spontaneous seizures with epileptic discharges nor electrographic seizure were observed in control mice electroporated with the mTOR wild-type construct, as shown in FIG. 3b.

[0241] The average seizure onset of p.Leu2427Pro mice started on average roughly 6 weeks after birth (FIG. 12e), which is approximately equivalent to that of human FCDII patients (.about.4 years). The seizure frequency was about 6 events per day (FIG. 3c).

[0242] After the confirmation of seizures, investigation was made to see whether the mice electroporated with mTOR mutant constructs showed abnormal neuronal morphology, such as cytomegalic neurons.

[0243] It was observed that the soma sizes of GFP-positive neurons were greatly increased in affected cortical regions of electroporated mice carrying mTOR mutations (FIG. 3d).

Example 6-2. Effect of Drug on Spontaneous Seizure and Abnormal Neuron

[0244] Animal models with spontaneous seizures or abnormal neurons were monitored after administration with rapamycin.

[0245] Briefly, rapamycin or everolimus (LC Labs, USA) was dissolved in 100% ethanol to give a 20 mg/ml stock solution and stored at -20.degree. C. Immediately before injection, the stock solution was diluted in 5% polyethyleneglycol 400 and 5% Tween80 to yield final concentrations of 1 mg/ml rapamycin and 4% ethanol. Mice were injected with 1 to 10 mg/kg rapamycin for 2 weeks (10 mg/kg/d intraperitoneal injection, two weeks).

[0246] Rapamycin, as shown in FIGS. 3c, 12c and 12d, almost completely freed the mTOR mutant construct-carrying mice from spontaneous seizures, with a simultaneous dramatic decrease in the onset frequency of interictal spikes and nonconvulsive electrographic seizure.

[0247] Also, abnormal soma sizes of neurons were reduced in the animal model administered with rapamycin, as shown in FIG. 3d.

Example 7: Identification of Mutation in Intractable Epilepsy Patient by Sequencing

[0248] Genomic DNA was extracted in substantially the same manner as that of Example 2 from samples from a total of 77 patients, listed in Examples 1 and 2, and subjected to hybrid capture sequencing and PCR-based amplicon sequencing. Of mutations found in both the sequencing analyses, those that met the selection standards (a total read depth of 100 or more, 3 or more mutated calls, and a mapping quality score of 30 or more) were detected in TSC1, TSC2, AKT3, and PIK3CA.

[0249] TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Val1547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn).

[0250] In eight of 51 patients negative for mTOR mutations, TSC1, TSC2, AKT3, and PIK3CA gene mutations were detected only in affected brain regions. Accordingly, 21 of a total of 77 intractable epilepsy patients were found to have mutations only in affected brain regions.

[0251] mTOR c.616C>T (p.Arg206Cys) mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p.Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427Gln); TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Val1547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn).

TABLE-US-00005 TABLE 5 PCR Hybrid amplicon Capture sequencing Disease/ Age at Modified Modified % Mutated % Mutated gender surgery phathology MRI result protein nucleotide Amino acid allele allele FCD 5 yr Cortical No abnormal MTOR c.7280T > C p.Leu2427Pro 7.94% 12.6% 4/female 2 m dyslamination, signal intensity Dysmorphic neurons, consistent with FCDIIa FCD 5 yr Cortical No abnormal MTOR c.7280T > C p.Leu2427Pro 6.90% 7.28% 6/female dyslamination, signal intensity Dysmorphic neurons, consistent with FCDIIa FCD 6 yr Cortical Cortical TSC1 c.610C > T p.Arg204Cys 1.75% 1.0% 64/female 9 m dyslamination, dysplasia Dysmorphic involving left neurons, fronto-parietal consistent with lobe FCDIIa HME 2 yr Cortical laminar Rt. PIK3CA c.3052G > A p.Asp1018Asn 1.03% 2.30% 66/male 8 m disturbance with hemimega- large giant neurons lencephDaly SWS 11 m Cortical Difuse brain MTOR c.616C > T p.Arg206Cys 3.93% 3.45% 77/male dyslamination, atrophy, Right Dysmorphic hemisphere neurons, consistent with FCDIIa FCD 12 yr Cortical No abnormal TSC1 c.64C > T p.Arg22Trp 2.81% 2.0% 81/female dyslamination, signal intensity Dysmorphic neurons, consistent with FCDIIa HS86/male 13 yr Hippocampal Suggestive of AKT3 c.740G > A p.Arg247His 1.72% .sup. 10% 2 m sclerosis HS, left. FCD 7 yr Cortical Volume MTOR C.6577C > T p.Arg2193Cys 2.99% 1.26% 91/female 1 m dyslamination, decrease of the Dysmorphic left cerebral neurons, hemisphere consistent with and multifocal FCDIIa lesions in the WM FCD 10 yr Cortical Subependymal TSC2 c.4639C > T p.Val1547Ile 1.19% 1.55% 94/female 3 m dyslamination, heterotopia, Rt Dysmorphic peri-trigone neurons, area consistent with FCDIIa FCD 14 yr Cortical No abnormal TSC1 c.64C > T p.Arg22Trp 2.52% 1.98% 98/male 3 m dyslamination, signal intensity Dysmorphic neurons, consistent with FCDIIa FCD 1 yr Cortical Cortical MTOR c.1871G > A p.Arg624His 1.80% 4.41% 104/male 2 m dyslamination, dysplasia Dysmorphic involving right neurons, precentral and consistent with postcentral FCDIIa gyri, FCD 3 yr Cortical No abnormal MTOR c.5126G > A p.Arg1709His 1.63% 1.52% 105/male 7 m dyslamination, signal intensity Dysmorphic neurons, consistent with FCDIIa FCD 7 yr Cortical Cortical MTOR C.6644C > T p.Ser2215Phe 2.41% 2.11% 107/female 3 m dyslamination, Dysplasia dysmorphic involving left neurons, balloon occipitoparietal cells, consistent with lobe and FCDIIb precentral gyrus FCD 10 yr Cortical Cortical MTOR c.7280T > A p.Leu2427Gln 3.05% 5.11% 113/female dyslamination, dysplasia dysmorphic involving left neurons, balloon occipital and cells, consistent with parietal lobe FCDIIb FCD 7 yr Cortical Cortical MTOR c.5930C > A p.Thr1977Lys 3.25% 2.93% 116/male 9 m dyslamination, dysplasia dysmorphic involving left neurons, balloon superior frontal cells, consistent with gyrus FCDIIb FCD 11 m Cortical Cortical MTOR c.4348T>G p.Tyr1450Asp 2.64% 3.76% 121/male dyslamination, dysplasia dysmorphic involving neurons, balloon entire right cells, consistent with lobe and left FCDIIb superior/middle frontal gyrus FCD 12 yr Cortical Cortical TSC1 c.64C > T p.Arg22Trp 2.21% 1.37% 123/female 4 m dyslamination, Dysplasia dysmorphic involving right neurons, balloon frontal lobe cells, consistent with FCDIIb FCD 4 yr Cortical Cortical MTOR c.4447T > C p.Cys1483Arg 6.38% 9.77% 128/female 4 m dyslamination, dysplasia, right dysmorphic frontal lobe neurons, balloon cells, consistent with FCDIIb HME141female 1 yr Cortical laminar Lt. TSC1 c.2432G > T p.Arg811Leu 1.03% 1.68% 9 m disturbance with hemimega- large giant neurons lencephaly FCD 2 yr Cortical No abnormal MTOR C.6644C > T p.Ser2215Phe 2.82% 2.33% 143/female 10 m dyslamination, signal intensity dysmorphic neurons, balloon cells, consistent with FCDIIb FCD 4 yr Cortical Cortical MTOR c.5930C > A p.Thr1977Lys 1.46% 1.51% 145/female 1 m dyslamination, dysplasia dysmorphic involving left neurons, balloon precentral cells, consistent with gyrus FCDIIb

Example 8: In Vivo Analysis of mTOR Hyperactivation

8-1. Mutagenesis and Construction of TSC1, TSC2, and AKT3 Mutant Constructs

[0252] pcDNA3 carrying HA-tagged wild-type TSC1, TSC2 or AKT3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA). The construct was used to generate mutant vectors with a QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA).

[0253] pcDNA3 carrying HA-tagged wild-type TSC1, TSC2 or AKT3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA). In the pcDNA3 TSC1, TSC2, AKT3 wild-type vector, the mutagenesis of TSC-1 R22W and R204C was achieved by use of TSC-1 R22W-F and R22W-R primers for R22W mutagenesis and by use of TSC-1 R204C-F and R204C-R primers for R204C mutagenesis. TSC-2 V1547I-F and V1547I-R primers were used for TSC-2 V15471 mutagenesis in the pcDNA3 TSC2 wild-type vector. For the mutagenesis of AKT3 R247H in the pcDNA3 AKT3 wild-type vector, R247H-F and R247H-R primer were designed.

[0254] A QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA) was used to create point mutations. Because each primer has a site-specific point mutation sequence, a mutation is induced in copies of the sequence upon PCR. Primers useful for the mutagenesis are listed in Table 6, below.

TABLE-US-00006 TABLE 6 Location SEQ n of ID gene Modification Primer NO TSC- C64T R22W TSC-1 gtcacgtcgtcccacacacc 29 1 R22W-F cagcatg TSC-1 catgctgggtgtgtgggacg 30 R22W-R acgtgac C610T R204C TSC-1 ctttcatactgtaatgagaa 31 R204C-F cacaaaaaggagacgaagtt gca TSC-1 tgcaacttcgtctccttttt 32 R204C-R gtgttctcattacagtatga aag TSC- G4639A V1547I TSC-2 tctccaacatacaggatggc 33 2 V1547I- gatcttgtgggtg F TSC-2 cacccacaagatcgccatcc 34 V1547I- tgtatgttggaga R AKT3 G740A R247H AKT3 caccatagaaacgtgtgtgg 35 R247H-F tcctcagagaacacc AKT3 ggtgttctctgaggaccaca 36 R247H-R cacgtttctatggtg

8-2. Cell Culture, Transfection, and Western Blot

[0255] In order to examine whether TSC-1, TSC-2 or AKT3 mutation causes the aberrant activation of mTOR, wild-type or mutant vectors were transfected into HEK293T and the phosphorylation of SK6, widely known as an mTOR gene marker, was analyzed by Western blotting.

[0256] Briefly, HEK293T cells (Thermo Scientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% FBS at 37.degree. C. and 5% CO.sub.2. The cells were transfected with empty flag-tagged vector, HA-tagged TSC1 wild-type, HA-tagged TSC2 wild-type, HA-tagged AKT3 wild-type, HA-tagged TSC1 mutant, HA-tagged TSC2 mutant and HA-tagged AKT3 mutant, respectively, using jetPRIME transfection reagent (Polyplus, France).

[0257] The cells were serum-starved with 0.1% FBS in DMEM for 24 hours after transfection and then incubated at 37.degree. C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour. The cells were lysed with PBS containing 1% Triton X-100 and Halt protease and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA). Proteins were resolved by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). They were washed 4 times with TBST. The membranes were incubated overnight with primary antibodies including a 1/1000 dilution of anti-phospho-S6 ribosomal protein (5364, Cell Signaling Technology, USA), anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA), and anti-flag M2 (8164, Cell Signaling Technology, USA) in TBST at 4.degree. C., respectively. After incubation, the membranes were washed 4 times with TBST. They were incubated with a 1/5000 dilution of HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) for 2 hours at room temperature. After washing with TBST, immunodetection was performed using ECL reaction reagents.

8-3. Treatment of Mutant-Expressing Cells with Rapamycin and Western Blot

[0258] After treatment with rapamycin, the mutant-expressing cells of Example 8-2 were monitored for S6K phosphorylation.

[0259] Briefly, HEK293T cells were transfected with mTOR, TSC1, TSC2, or AKT3 mutants in the same manner as in Example 8-2. The transfected cells were starved for 24 hrs with empty DMEM and incubated at 37.degree. C. and 5% CO.sub.2 for 1 hr with rapamycin in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2, followed by Western blotting in the same manner as in Example 2-2.

8-4. Experiment Data

[0260] In order to examine whether the p.Arg22Trp and p.Arg204Cys mutations of TSC-1, the p.Val1547Ile mutation of TSC-2, or the p.Arg247His mutation of AKT3 induces mTOR activation, HEK293T cells were transfected with vectors carrying TSC1, TSC2, and AKT3 wild-type and mutants, and S6K phosphorylation, a well-known index for mTOR mutation, was monitored via Western blotting. The mutant-expressing cells were treated with rapamycin before monitoring the phosphorylation of S6K, as described in Examples 8-2 and 8-3. The results are depicted in FIGS. 15 to 17, and can be described for individual mutant genes) as follows:

[0261] (1) In Vitro Activity of TSC-1 Mutant

[0262] As can be seen in FIG. 15, S6K phosphorylation was increased in cells expressing mutant TSC-1, and reduced by rapamycin treatment.

[0263] (2) In Vitro Activity of TSC-2 Mutant

[0264] As can be seen in FIG. 16, S6K phosphorylation was increased in cells expressing mutant TSC-2, and reduced by rapamycin treatment.

[0265] (3) In Vitro Activity of AKT3 Mutant

[0266] As can be seen in FIG. 17, S6K phosphorylation was increased in cells expressing mutant AKT3, and reduced by rapamycin treatment.

Example 9: Activation of mTOR Pathway by TSC1 and TSC2 Mutants

9-1: Immunoprecipitation Assay

[0267] To examine whether mutations in TSC1 and TSC2 disrupt the formation of the TSC complex, immunoprecipitation assays were conducted on wild-type and mutant TSC1 or TSC2-expressing HEK293T cells. In this regard, TSC1 and TSC2 mutant proteins prepared in the same manner as in Example 8-3 were incubated overnight with an anti-TSC2 antibody (3990, Cell signaling Technology, USA) or an anti-myc antibody (2276, cell signaling technology, USA), and then with protein A+G magnetic beads for 2 hrs. After washing with PBS containing 1% Triton-X100, the beads were incubated in an SDS buffer at 37.degree. C. for 10 min. After being eluted, proteins were resolved on SDS/PAGE gel and transferred to a PVDF membrane. Immunoblotting was performed in the same manner as in Example 2-3.

[0268] The results are depicted in FIG. 18. It was found that the TSC-1 p.Arg22Trp and p.Arg204Cys mutations located near the TSC2 binding domain strongly inhibited TSC1 binding to TSC2. These data imply that the TSC1 mutant disrupted the formation of the TSC complex, leading to the hyperactivation of mTOR kinase.

9-2: GTP-Agarose Pull Down Assay

[0269] Cells were harvested in a lysis buffer (20 mM Tris-HCl pH: 7.5, 5 mM MgCl2, 2 mM PMSF, 20 .mu.g/mL leupeptin, 10 .mu.g/mL aprotinin, 150 mM NaCl and 0.1% Triton X-100) and then lysed by sonication for 15 sec. The cell lysates were centrifuged at 4.degree. C. and 13,000 g. The supernatant was separated and incubated with 100 .mu.l of GTP-agarose beads (Sigma-Aldrich, cat no. G9768) at 4.degree. C. for 30 min. The beads were washed with a lysis buffer and again incubated overnight with the supernatant. GTP-bound proteins were extracted and visualized by immunoblots.

[0270] The expression of GTP-bound Rheb protein was found to decrease in wild-type TSC2-expressing cells, but not in TSC2 p.Val1547Ile mutant-expressing cells because the GAP (GTPase activating protein) activity of TSC2 was decreased (FIG. 19 (2 FIG. 2)), suggesting that the TSC2 mutant reduces the function of the GAP domain, thereby activating the mTOR pathway.

Example 10: Monitoring of S6K Phosphorylation Level in Drug-Treated, Mutant mTOR-Expressing Cells

10-1. Mutant mTOR-Expressing Cell

[0271] Mutant mTOR-expressing cells were treated with drugs (rapamycin, everolimus, compounds of Chemical Formulas 1 to 4) and monitored for S6K phosphorylation level.

[0272] In this regard, HEK293T cells were transfected with the mutants in the same manners as in Examples 8-2 and 8-3, serum-starved for 24 hrs with 01.% FBS in DMEM, and incubated at 37.degree. C. and 5% CO.sub.2 for 1 hr with 1 mM MgCl.sub.2 and CaCl.sub.2 in PBS before treatment with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458): Torin was purchased from TOCRIS; INK128, AZD8055 and GSK2126458 were from Selleckchem; and everolimus was from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 2-4.

[0273] As is understood from the data of FIGS. 20 and 21, S6K phosphorylation was inhibited in mutant mTOR-expressing cells. Briefly, FIG. 20 shows levels of S6K phosphorylation in cells respectively expressing the mOTR mutants C1483R, L2427P and L2427Q after rapamycin treatment. FIG. 21 shows levels of S6K phosphorylation in mTOR mutation Y1450D-expressing cells after rapamycin treatment.

[0274] FIG. 22 shows levels of S6 in mTOR mutation L2427P-expressing cells after treatment with 0, 25, 50, 100, and 200 nM of rapamycin.

[0275] S6K phosphorylation was monitored following treatment with everolimus, or the compounds of Chemical Formulas 1 to 4. As can be seen in FIG. 22, the phosphorylation of S6 in mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4. A distinct decrease in S6 phosphorylation was apparent at a concentration of 50 nM or higher.

Example 10-2. Change of S6K Phosphorylation with Various mTOR Inhibitors

[0276] Cells expressing various mTOR mutations were treated in the same manner as in Example 9-1 with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4, and monitored for S6K phosphorylation. The mTOR variants were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P, and L2427Q.

[0277] Briefly, the mutant mTOR-expressing cells were monitored for S6K phosphorylation level after treatment with everolimus or the compounds of Chemical Formulas 1 to 4. The results are depicted in FIGS. 23a and 23b. As shown, the phosphorylation of S6K in all the mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4.

Example 11: Monitoring of S6K Phosphorylation in TSC1 or TSC2 Mutant-Expressing Cells Treated with Drugs

[0278] HEK293T cells were transfected with TSC1 or TSC2 mutants in the same manner as in Example 8, serum-starved for 24 hrs with 01.% FBS in DMEM, and incubated at 37.degree. C. and 5% CO.sub.2 for 1 hr with 1 mM MgCl.sub.2 and CaCl.sub.2 in PBS.

[0279] Thereafter, the cells were treated with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458): Torin was purchased from Tocris; INK128, AZD8055 and GSK2126458 were from Selleckchem; and everolimus was from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 10.

[0280] The TSC1 or TSC2 mutant-expressing cells were treated with rapamycin and monitored for S6K phosphorylation. The results are depicted in FIGS. 24a and 24b for the TSC1 mutant and in FIGS. 25a and 25b for the TSC2 mutant.

[0281] As is understood from the data of FIGS. 24a, 24b, 25a and 25b, S6K phosphorylation in TSC1 or TSC2 mutant-expressing cells was inhibited by rapamycin. Also, S6K phosphorylation was monitored in the TSC1 or TSC2-expressing cells following treatment with everolimus or the compounds of Chemical Formulas 1 to 4. As can be seen, everolimus or compounds of Chemical Formulas 1 to 4 was found to inhibit the phosphorylation of S6K in TSC1 or TSC2 mutant-expressing cells.

Example 12: Immunostaining of Brain Tissue Section of FCD Patient

[0282] To determine whether the affected brains of FCDII patients carrying mutations are associated with mTOR hyperactivation, immunostaining was performed for S6 phosphorylation and NeuN (a neuronal marker) in brain tissue sections obtained from FCD patients carrying the p.Leu2427Pro mutation.

[0283] Non-malformations of cortical development (non-MCD) brain specimens were collected in the operating room from the tumor-free margin of individual patients with glioblastoma as part of a planned resection, which was pathologically conformed as a normal brain without tumors. Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissues blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C. Cryostat-cut sections (10 um thick) were collected and placed on glass slides. FFPE slides were deparaffinized and rehydrated to remove paraffin. Then, a heat-induced retrieval process was performed on the deparaffinized FFPE slides using a citrate buffer to enhance the staining intensity of the antibodies. The slides were then blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen).

[0284] DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope. Cells positive for NeuN were counted using a 10.times. objective lens; 4-5 fields were acquired per subject within neuron-rich regions, and 100 or more cells were scored per region. The number of DAPI-positive cells represents total cell counts. Neuronal cell sizes were measured in NeuN-positive cells using the automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/). The experimental results are given in FIGS. 26a to 26f.

[0285] As seen in FIGS. 2a to 26f, the results showed a marked increase in the number of neuronal cells positive for phosphorylated S6 in FCD patients #64, 81, 94, 98, and 128 carrying TSC1 or TSC2 mutations, but not in non-FCD brains. In addition, the results revealed a robust increase in the number of neuronal cells that were positive for phosphorylated S6 in patients carrying TSC1 and TSC2 mutations compared with non-FCD brains, as shown in FIGS. 26b and 26d, and in the soma size of phosphorylated S6-positive neurons in the pathological samples, as shown in FIGS. 26e and 26f.

Example 13: Construction of TSC1 or TSC2 Mouse Model

13-1: Construction of TSC1- or TSC2-Targeting CRISPR/Cas9 Vector

[0286] A commercially available pX330 plasmid (Addgene, #42230) was used as an initial template. Using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, Calif.), the sgRNA (single guide ribonucleotide) cloning site was modified to change the restriction enzyme recognition site BbsI (GAAGAC) to BsaI (GGTCTC). Subsequently, sgRNAs, targeting respective TSC1 and TSC2 genes, was inserted, the sequences of which are as follows.

TABLE-US-00007 TSC1: 5'-TGCTGGACTCCTCCACACTG-3' (SEQ ID NO. 37) TSC2: 5'-AATCCCAGGTGTGCAGAAGG-3' (SEQ ID NO. 38)

[0287] To generate a plasmid carrying an mCherry fluorescent reporter (U6-sgRNA-Cas9-IRES-mCherry), IRES-mCherry was amplified PCR with the IRES3-mCherry-CL plasmid serving as a template. After PCR amplification, the IRES-mCherry was inserted between the Cas9 sequence and the NLS of px330.

Example 13-2. Construction of Mouse Model

[0288] First, the TSC1- or TSC2-targeting U6-sgRNA-Cas9-IRES-mCherry plasmid, prepared in Example 19-1, was diluted at a ratio of 3:1 with pCAG-Dsred (Addgene #11151) to enhance red signals. Timed pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4 L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation). The uterine horns were exposed, and the lateral ventricle of each embryo was injected using pulled glass capillaries with 2 .mu.g/ml of Fast Green (F7252, Sigma, USA) combined with 2-3 .mu.g of the mixture of the two plasmids. Plasmids were electroporated on the head of the embryo by discharging 50 V with the ECM830 eletroporator (BTX-Harvard apparatus) in five electric pulses of 100 ms at 900-ms intervals. After delivery, selection was made of the mouse pups that exhibited fluorescence, screened using a flashlight (Electron Microscopy Science, USA).

13-3: Assay for Neuronal Migration in TSC1 or TSC2 Mouse Model

[0289] Brains were harvested from adult mice (P>56) prepared in Example 13-2, fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C.

[0290] Cryostat-cut sections (30 um thick) were collected and placed on glass slides. DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. Images were acquired using a Zeiss LSM780 confocal microscope. Fluorescence intensities, reflecting the distribution of electroporated cells within the cortex, were converted into gray values and measured from layer II/III to layer V/VI using ImageJ software (http://rsbweb.nih.gov/ij/).

[0291] As can be seen in FIGS. 27a and 27b, dsRed-positive neurons in brain tissue sections of the TSC mouse models were decreased in the cortical layer II/III and increased in the layer II and layer V/VI, indicating that the radial migration of cortical neurons was prevented.

13-4: Video-Electroencephalography Monitoring

[0292] After weaning (>3 weeks), the mice were observed for seizures through video monitoring. Thereafter, electrodes for recoding electroencephalograms were surgically implanted. A total of five electrodes were located in the epidural layer: based on the bregma, two electrodes on the frontal lobes (AP+2.8 mm, ML.+-.1.5 mm), two electrodes on the temporal lobes (AP-2.4 mm, ML.+-.2.4 mm), and one electrode on the cerebellum. After 4 days of recovery from surgery, EGG signals were recorded for 6 hrs per day between 6 p.m. and 2 a.m. over 2-5 days. Signals were amplified using an RHD2000 amplifier and board (Intan Technologies, USA) and analyzed using MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

[0293] The mice whose brains exhibited local TSC1- or TSC2-knockout resulting from use of the CRISPR/Cas9 plasmid displayed spontaneous seizures with epileptic discharges, including high-voltage fast activity, high-voltage spikes and waves, and low-voltage fast activity. The mice in which spontaneous seizures were induced were observed to exhibit systemic tonic-clonic seizures consisting of a tonic phase, a clonic phase, and a postictal phase, similar to those found in FCDII patients. Further, brain waves are characterized by synchronized multi-waves of low-voltage, fast activity in the tonic phase, high-voltage standing waves in the clonic phase, and synchronized attenuated amplitudes in the postictal phase. The seizure frequency was about 10 events per day.

13-5: Soma Size of Neurons in TSC1 or TSC2 Mouse Model

[0294] After EGG monitoring, the brains of the mice were excised by perfusion fixation using a phosphate-buffered (PB) 4% paraformaldehyde solution with the aid of a Masterflex compact peristaltic pump (Cole-Parmer international, USA). The brains were fixed in a freshly prepared phosphate-buffered (PB) 4% paraformaldehyde solution, cryoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at -80.degree. C. Cryostat-cut sections (30 um thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: mouse antibody to NeuN (1:500 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibody: Alexa Fluor 488-conjugated goat antibody to mouse (1:200 dilution; A11008, Invitrogen). DAPI included in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Zeiss LSM780 confocal microscope. Neuronal cell sizes were measured using ImageJ software (http://rsbweb.nih.gov/ij/).

[0295] Neurons were found to significantly increase in soma size for the mice with the local TSC1- or TSC2-knockout by use of the CRISPR/Cas9 plasmid, compared to normal neurons, but remained unchanged in size for the mice into which the plasmid was electroporated without sgRNA, which was consistent with the dysmorphic neurons of patients with Malformations of Cortical Developments.

Example 14: Effect of Drug on Spontaneous Seizure in TSC2 Mouse Model

[0296] The animal models exhibiting spontaneous seizures were monitored after administration with rapamycin. Briefly, rapamycin (LC Labs, USA) was dissolved in 100% ethanol to give a 20 mg/ml stock solution, and stored at -20.degree. C. Immediately before injection, the stock solution was diluted in 5% polyethyleneglycol 400 and 5% Tween80 to final concentrations of 1 mg/ml rapamycin and 4% ethanol. Mice were injected with 1 to 10 mg/kg rapamycin for 2 weeks (10 mg/kg/d intraperitoneal injection).

[0297] Rapamycin, as shown in FIG. 28, almost completely freed the animal models from spontaneous seizures.

Sequence CWU 1

1

3817650DNAHomo sapiensgene(1)..(7650)wild type mTOR 1atgcttggaa ccggacctgc cgccgccacc accgctgcca ccacatctag caatgtgagc 60gtcctgcagc agtttgccag tggcctaaag agccggaatg aggaaaccag ggccaaagcc 120gccaaggagc tccagcacta tgtcaccatg gaactccgag agatgagtca agaggagtct 180actcgcttct atgaccaact gaaccatcac atttttgaat tggtttccag ctcagatgcc 240aatgagagga aaggtggcat cttggccata gctagcctca taggagtgga aggtgggaat 300gccacccgaa ttggcagatt tgccaactat cttcggaacc tcctcccctc caatgaccca 360gttgtcatgg aaatggcatc caaggccatt ggccgtcttg ccatggcagg ggacactttt 420accgctgagt acgtggaatt tgaggtgaag cgagccctgg aatggctggg tgctgaccgc 480aatgagggcc ggagacatgc agctgtcctg gttctccgtg agctggccat cagcgtccct 540accttcttct tccagcaagt gcaacccttc tttgacaaca tttttgtggc cgtgtgggac 600cccaaacagg ccatccgtga gggagctgta gccgcccttc gtgcctgtct gattctcaca 660acccagcgtg agccgaagga gatgcagaag cctcagtggt acaggcacac atttgaagaa 720gcagagaagg gatttgatga gaccttggcc aaagagaagg gcatgaatcg ggatgatcgg 780atccatggag ccttgttgat ccttaacgag ctggtccgaa tcagcagcat ggagggagag 840cgtctgagag aagaaatgga agaaatcaca cagcagcagc tggtacacga caagtactgc 900aaagatctca tgggcttcgg aacaaaacct cgtcacatta cccccttcac cagtttccag 960gctgtacagc cccagcagtc aaatgccttg gtggggctgc tggggtacag ctctcaccaa 1020ggcctcatgg gatttgggac ctcccccagt ccagctaagt ccaccctggt ggagagccgg 1080tgttgcagag acttgatgga ggagaaattt gatcaggtgt gccagtgggt gctgaaatgc 1140aggaatagca agaactcgct gatccaaatg acaatcctta atttgttgcc ccgcttggct 1200gcattccgac cttctgcctt cacagatacc cagtatctcc aagataccat gaaccatgtc 1260ctaagctgtg tcaagaagga gaaggaacgt acagcggcct tccaagccct ggggctactt 1320tctgtggctg tgaggtctga gtttaaggtc tatttgcctc gcgtgctgga catcatccga 1380gcggccctgc ccccaaagga cttcgcccat aagaggcaga aggcaatgca ggtggatgcc 1440acagtcttca cttgcatcag catgctggct cgagcaatgg ggccaggcat ccagcaggat 1500atcaaggagc tgctggagcc catgctggca gtgggactaa gccctgccct cactgcagtg 1560ctctacgacc tgagccgtca gattccacag ctaaagaagg acattcaaga tgggctactg 1620aaaatgctgt ccctggtcct tatgcacaaa ccccttcgcc acccaggcat gcccaagggc 1680ctggcccatc agctggcctc tcctggcctc acgaccctcc ctgaggccag cgatgtgggc 1740agcatcactc ttgccctccg aacgcttggc agctttgaat ttgaaggcca ctctctgacc 1800caatttgttc gccactgtgc ggatcatttc ctgaacagtg agcacaagga gatccgcatg 1860gaggctgccc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagtggccat 1920gctcatgtgg ttagccagac cgcagtgcaa gtggtggcag atgtgcttag caaactgctc 1980gtagttggga taacagatcc tgaccctgac attcgctact gtgtcttggc gtccctggac 2040gagcgctttg atgcacacct ggcccaggcg gagaacttgc aggccttgtt tgtggctctg 2100aatgaccagg tgtttgagat ccgggagctg gccatctgca ctgtgggccg actcagtagc 2160atgaaccctg cctttgtcat gcctttcctg cgcaagatgc tcatccagat tttgacagag 2220ttggagcaca gtgggattgg aagaatcaaa gagcagagtg cccgcatgct ggggcacctg 2280gtctccaatg ccccccgact catccgcccc tacatggagc ctattctgaa ggcattaatt 2340ttgaaactga aagatccaga ccctgatcca aacccaggtg tgatcaataa tgtcctggca 2400acaataggag aattggcaca ggttagtggc ctggaaatga ggaaatgggt tgatgaactt 2460tttattatca tcatggacat gctccaggat tcctctttgt tggccaaaag gcaggtggct 2520ctgtggaccc tgggacagtt ggtggccagc actggctatg tagtagagcc ctacaggaag 2580taccctactt tgcttgaggt gctactgaat tttctgaaga ctgagcagaa ccagggtaca 2640cgcagagagg ccatccgtgt gttagggctt ttaggggctt tggatcctta caagcacaaa 2700gtgaacattg gcatgataga ccagtcccgg gatgcctctg ctgtcagcct gtcagaatcc 2760aagtcaagtc aggattcctc tgactatagc actagtgaaa tgctggtcaa catgggaaac 2820ttgcctctgg atgagttcta cccagctgtg tccatggtgg ccctgatgcg gatcttccga 2880gaccagtcac tctctcatca tcacaccatg gttgtccagg ccatcacctt catcttcaag 2940tccctgggac tcaaatgtgt gcagttcctg ccccaggtca tgcccacgtt ccttaacgtc 3000attcgagtct gtgatggggc catccgggaa tttttgttcc agcagctggg aatgttggtg 3060tcctttgtga agagccacat cagaccttat atggatgaaa tagtcaccct catgagagaa 3120ttctgggtca tgaacacctc aattcagagc acgatcattc ttctcattga gcaaattgtg 3180gtagctcttg ggggtgaatt taagctctac ctgccccagc tgatcccaca catgctgcgt 3240gtcttcatgc atgacaacag cccaggccgc attgtctcta tcaagttact ggctgcaatc 3300cagctgtttg gcgccaacct ggatgactac ctgcatttac tgctgcctcc tattgttaag 3360ttgtttgatg cccctgaagc tccactgcca tctcgaaagg cagcgctaga gactgtggac 3420cgcctgacgg agtccctgga tttcactgac tatgcctccc ggatcattca ccctattgtt 3480cgaacactgg accagagccc agaactgcgc tccacagcca tggacacgct gtcttcactt 3540gtttttcagc tggggaagaa gtaccaaatt ttcattccaa tggtgaataa agttctggtg 3600cgacaccgaa tcaatcatca gcgctatgat gtgctcatct gcagaattgt caagggatac 3660acacttgctg atgaagagga ggatcctttg atttaccagc atcggatgct taggagtggc 3720caaggggatg cattggctag tggaccagtg gaaacaggac ccatgaagaa actgcacgtc 3780agcaccatca acctccaaaa ggcctggggc gctgccagga gggtctccaa agatgactgg 3840ctggaatggc tgagacggct gagcctggag ctgctgaagg actcatcatc gccctccctg 3900cgctcctgct gggccctggc acaggcctac aacccgatgg ccagggatct cttcaatgct 3960gcatttgtgt cctgctggtc tgaactgaat gaagatcaac aggatgagct catcagaagc 4020atcgagttgg ccctcacctc acaagacatc gctgaagtca cacagaccct cttaaacttg 4080gctgaattca tggaacacag tgacaagggc cccctgccac tgagagatga caatggcatt 4140gttctgctgg gtgagagagc tgccaagtgc cgagcatatg ccaaagcact acactacaaa 4200gaactggagt tccagaaagg ccccacccct gccattctag aatctctcat cagcattaat 4260aataagctac agcagccgga ggcagcggcc ggagtgttag aatatgccat gaaacacttt 4320ggagagctgg agatccaggc tacctggtat gagaaactgc acgagtggga ggatgccctt 4380gtggcctatg acaagaaaat ggacaccaac aaggacgacc cagagctgat gctgggccgc 4440atgcgctgcc tcgaggcctt gggggaatgg ggtcaactcc accagcagtg ctgtgaaaag 4500tggaccctgg ttaatgatga gacccaagcc aagatggccc ggatggctgc tgcagctgca 4560tggggtttag gtcagtggga cagcatggaa gaatacacct gtatgatccc tcgggacacc 4620catgatgggg cattttatag agctgtgctg gcactgcatc aggacctctt ctccttggca 4680caacagtgca ttgacaaggc cagggacctg ctggatgctg aattaactgc gatggcagga 4740gagagttaca gtcgggcata tggggccatg gtttcttgcc acatgctgtc cgagctggag 4800gaggttatcc agtacaaact tgtccccgag cgacgagaga tcatccgcca gatctggtgg 4860gagagactgc agggctgcca gcgtatcgta gaggactggc agaaaatcct tatggtgcgg 4920tcccttgtgg tcagccctca tgaagacatg agaacctggc tcaagtatgc aagcctgtgc 4980ggcaagagtg gcaggctggc tcttgctcat aaaactttag tgttgctcct gggagttgat 5040ccgtctcggc aacttgacca tcctctgcca acagttcacc ctcaggtgac ctatgcctac 5100atgaaaaaca tgtggaagag tgcccgcaag atcgatgcct tccagcacat gcagcatttt 5160gtccagacca tgcagcaaca ggcccagcat gccatcgcta ctgaggacca gcagcataag 5220caggaactgc acaagctcat ggcccgatgc ttcctgaaac ttggagagtg gcagctgaat 5280ctacagggca tcaatgagag cacaatcccc aaagtgctgc agtactacag cgccgccaca 5340gagcacgacc gcagctggta caaggcctgg catgcgtggg cagtgatgaa cttcgaagct 5400gtgctacact acaaacatca gaaccaagcc cgcgatgaga agaagaaact gcgtcatgcc 5460agcggggcca acatcaccaa cgccaccact gccgccacca cggccgccac tgccaccacc 5520actgccagca ccgagggcag caacagtgag agcgaggccg agagcaccga gaacagcccc 5580accccatcgc cgctgcagaa gaaggtcact gaggatctgt ccaaaaccct cctgatgtac 5640acggtgcctg ccgtccaggg cttcttccgt tccatctcct tgtcacgagg caacaacctc 5700caggatacac tcagagttct caccttatgg tttgattatg gtcactggcc agatgtcaat 5760gaggccttag tggagggggt gaaagccatc cagattgata cctggctaca ggttatacct 5820cagctcattg caagaattga tacgcccaga cccttggtgg gacgtctcat tcaccagctt 5880ctcacagaca ttggtcggta ccacccccag gccctcatct acccactgac agtggcttct 5940aagtctacca cgacagcccg gcacaatgca gccaacaaga ttctgaagaa catgtgtgag 6000cacagcaaca ccctggtcca gcaggccatg atggtgagcg aggagctgat ccgagtggcc 6060atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 6120gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 6180ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 6240gcccaagagt ggtgcaggaa gtacatgaaa tcagggaatg tcaaggacct cacccaagcc 6300tgggacctct attatcatgt gttccgacga atctcaaagc agctgcctca gctcacatcc 6360ttagagctgc aatatgtttc cccaaaactt ctgatgtgcc gggaccttga attggctgtg 6420ccaggaacat atgaccccaa ccagccaatc attcgcattc agtccatagc accgtctttg 6480caagtcatca catccaagca gaggccccgg aaattgacac ttatgggcag caacggacat 6540gagtttgttt tccttctaaa aggccatgaa gatctgcgcc aggatgagcg tgtgatgcag 6600ctcttcggcc tggttaacac ccttctggcc aatgacccaa catctcttcg gaaaaacctc 6660agcatccaga gatacgctgt catcccttta tcgaccaact cgggcctcat tggctgggtt 6720ccccactgtg acacactgca cgccctcatc cgggactaca gggagaagaa gaagatcctt 6780ctcaacatcg agcatcgcat catgttgcgg atggctccgg actatgacca cttgactctg 6840atgcagaagg tggaggtgtt tgagcatgcc gtcaataata cagctgggga cgacctggcc 6900aagctgctgt ggctgaaaag ccccagctcc gaggtgtggt ttgaccgaag aaccaattat 6960acccgttctt tagcggtcat gtcaatggtt gggtatattt taggcctggg agatagacac 7020ccatccaacc tgatgctgga ccgtctgagt gggaagatcc tgcacattga ctttggggac 7080tgctttgagg ttgctatgac ccgagagaag tttccagaga agattccatt tagactaaca 7140agaatgttga ccaatgctat ggaggttaca ggcctggatg gcaactacag aatcacatgc 7200cacacagtga tggaggtgct gcgagagcac aaggacagtg tcatggccgt gctggaagcc 7260tttgtctatg accccttgct gaactggagg ctgatggaca caaataccaa aggcaacaag 7320cgatcccgaa cgaggacgga ttcctactct gctggccagt cagtcgaaat tttggacggt 7380gtggaacttg gagagccagc ccataagaaa acggggacca cagtgccaga atctattcat 7440tctttcattg gagacggttt ggtgaaacca gaggccctaa ataagaaagc tatccagatt 7500attaacaggg ttcgagataa gctcactggt cgggacttct ctcatgatga cactttggat 7560gttccaacgc aagttgagct gctcatcaaa caagcgacat cccatgaaaa cctctgccag 7620tgctatattg gctggtgccc tttctggtaa 765022549PRTHomo sapiensPEPTIDE(1)..(2549)wild type mTOR 2Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser 1 5 10 15 Ser Asn Val Ser Val Leu Gln Gln Phe Ala Ser Gly Leu Lys Ser Arg 20 25 30 Asn Glu Glu Thr Arg Ala Lys Ala Ala Lys Glu Leu Gln His Tyr Val 35 40 45 Thr Met Glu Leu Arg Glu Met Ser Gln Glu Glu Ser Thr Arg Phe Tyr 50 55 60 Asp Gln Leu Asn His His Ile Phe Glu Leu Val Ser Ser Ser Asp Ala65 70 75 80 Asn Glu Arg Lys Gly Gly Ile Leu Ala Ile Ala Ser Leu Ile Gly Val 85 90 95 Glu Gly Gly Asn Ala Thr Arg Ile Gly Arg Phe Ala Asn Tyr Leu Arg 100 105 110 Asn Leu Leu Pro Ser Asn Asp Pro Val Val Met Glu Met Ala Ser Lys 115 120 125 Ala Ile Gly Arg Leu Ala Met Ala Gly Asp Thr Phe Thr Ala Glu Tyr 130 135 140 Val Glu Phe Glu Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg145 150 155 160 Asn Glu Gly Arg Arg His Ala Ala Val Leu Val Leu Arg Glu Leu Ala 165 170 175 Ile Ser Val Pro Thr Phe Phe Phe Gln Gln Val Gln Pro Phe Phe Asp 180 185 190 Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gln Ala Ile Arg Glu Gly 195 200 205 Ala Val Ala Ala Leu Arg Ala Cys Leu Ile Leu Thr Thr Gln Arg Glu 210 215 220 Pro Lys Glu Met Gln Lys Pro Gln Trp Tyr Arg His Thr Phe Glu Glu225 230 235 240 Ala Glu Lys Gly Phe Asp Glu Thr Leu Ala Lys Glu Lys Gly Met Asn 245 250 255 Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn Glu Leu Val 260 265 270 Arg Ile Ser Ser Met Glu Gly Glu Arg Leu Arg Glu Glu Met Glu Glu 275 280 285 Ile Thr Gln Gln Gln Leu Val His Asp Lys Tyr Cys Lys Asp Leu Met 290 295 300 Gly Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe Thr Ser Phe Gln305 310 315 320 Ala Val Gln Pro Gln Gln Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr 325 330 335 Ser Ser His Gln Gly Leu Met Gly Phe Gly Thr Ser Pro Ser Pro Ala 340 345 350 Lys Ser Thr Leu Val Glu Ser Arg Cys Cys Arg Asp Leu Met Glu Glu 355 360 365 Lys Phe Asp Gln Val Cys Gln Trp Val Leu Lys Cys Arg Asn Ser Lys 370 375 380 Asn Ser Leu Ile Gln Met Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala385 390 395 400 Ala Phe Arg Pro Ser Ala Phe Thr Asp Thr Gln Tyr Leu Gln Asp Thr 405 410 415 Met Asn His Val Leu Ser Cys Val Lys Lys Glu Lys Glu Arg Thr Ala 420 425 430 Ala Phe Gln Ala Leu Gly Leu Leu Ser Val Ala Val Arg Ser Glu Phe 435 440 445 Lys Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro 450 455 460 Pro Lys Asp Phe Ala His Lys Arg Gln Lys Ala Met Gln Val Asp Ala465 470 475 480 Thr Val Phe Thr Cys Ile Ser Met Leu Ala Arg Ala Met Gly Pro Gly 485 490 495 Ile Gln Gln Asp Ile Lys Glu Leu Leu Glu Pro Met Leu Ala Val Gly 500 505 510 Leu Ser Pro Ala Leu Thr Ala Val Leu Tyr Asp Leu Ser Arg Gln Ile 515 520 525 Pro Gln Leu Lys Lys Asp Ile Gln Asp Gly Leu Leu Lys Met Leu Ser 530 535 540 Leu Val Leu Met His Lys Pro Leu Arg His Pro Gly Met Pro Lys Gly545 550 555 560 Leu Ala His Gln Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro Glu Ala 565 570 575 Ser Asp Val Gly Ser Ile Thr Leu Ala Leu Arg Thr Leu Gly Ser Phe 580 585 590 Glu Phe Glu Gly His Ser Leu Thr Gln Phe Val Arg His Cys Ala Asp 595 600 605 His Phe Leu Asn Ser Glu His Lys Glu Ile Arg Met Glu Ala Ala Arg 610 615 620 Thr Cys Ser Arg Leu Leu Thr Pro Ser Ile His Leu Ile Ser Gly His625 630 635 640 Ala His Val Val Ser Gln Thr Ala Val Gln Val Val Ala Asp Val Leu 645 650 655 Ser Lys Leu Leu Val Val Gly Ile Thr Asp Pro Asp Pro Asp Ile Arg 660 665 670 Tyr Cys Val Leu Ala Ser Leu Asp Glu Arg Phe Asp Ala His Leu Ala 675 680 685 Gln Ala Glu Asn Leu Gln Ala Leu Phe Val Ala Leu Asn Asp Gln Val 690 695 700 Phe Glu Ile Arg Glu Leu Ala Ile Cys Thr Val Gly Arg Leu Ser Ser705 710 715 720 Met Asn Pro Ala Phe Val Met Pro Phe Leu Arg Lys Met Leu Ile Gln 725 730 735 Ile Leu Thr Glu Leu Glu His Ser Gly Ile Gly Arg Ile Lys Glu Gln 740 745 750 Ser Ala Arg Met Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile 755 760 765 Arg Pro Tyr Met Glu Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys 770 775 780 Asp Pro Asp Pro Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala785 790 795 800 Thr Ile Gly Glu Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp 805 810 815 Val Asp Glu Leu Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser 820 825 830 Leu Leu Ala Lys Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val 835 840 845 Ala Ser Thr Gly Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu 850 855 860 Leu Glu Val Leu Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly Thr865 870 875 880 Arg Arg Glu Ala Ile Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro 885 890 895 Tyr Lys His Lys Val Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala 900 905 910 Ser Ala Val Ser Leu Ser Glu Ser Lys Ser Ser Gln Asp Ser Ser Asp 915 920 925 Tyr Ser Thr Ser Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp 930 935 940 Glu Phe Tyr Pro Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg945 950 955 960 Asp Gln Ser Leu Ser His His His Thr Met Val Val Gln Ala Ile Thr 965 970 975 Phe Ile Phe Lys Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln 980 985 990 Val Met Pro Thr Phe Leu Asn Val Ile Arg Val Cys Asp Gly Ala Ile 995 1000 1005 Arg Glu Phe Leu Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val Lys 1010 1015 1020 Ser His Ile Arg Pro Tyr Met Asp Glu Ile Val Thr Leu Met Arg Glu1025 1030 1035 1040 Phe Trp Val Met Asn Thr Ser Ile Gln Ser Thr Ile Ile Leu Leu Ile 1045 1050 1055 Glu Gln Ile Val Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro 1060 1065 1070 Gln Leu Ile Pro His Met Leu Arg Val Phe Met His Asp Asn Ser Pro 1075 1080 1085 Gly Arg Ile Val Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe Gly 1090 1095 1100 Ala Asn Leu Asp Asp Tyr Leu His Leu Leu Leu Pro Pro Ile Val Lys1105 1110 1115 1120 Leu Phe Asp Ala Pro Glu Ala Pro Leu Pro Ser Arg Lys Ala Ala Leu 1125 1130 1135 Glu Thr Val Asp Arg Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala 1140 1145 1150 Ser Arg Ile Ile His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu 1155 1160 1165 Leu Arg Ser Thr Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu 1170 1175 1180 Gly Lys Lys Tyr Gln Ile Phe Ile Pro Met Val Asn Lys Val Leu

Val1185 1190 1195 1200 Arg His Arg Ile Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile 1205 1210 1215 Val Lys Gly Tyr Thr Leu Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr 1220 1225 1230 Gln His Arg Met Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly 1235 1240 1245 Pro Val Glu Thr Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn 1250 1255 1260 Leu Gln Lys Ala Trp Gly Ala Ala Arg Arg Val Ser Lys Asp Asp Trp1265 1270 1275 1280 Leu Glu Trp Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser 1285 1290 1295 Ser Pro Ser Leu Arg Ser Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro 1300 1305 1310 Met Ala Arg Asp Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu 1315 1320 1325 Leu Asn Glu Asp Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala 1330 1335 1340 Leu Thr Ser Gln Asp Ile Ala Glu Val Thr Gln Thr Leu Leu Asn Leu1345 1350 1355 1360 Ala Glu Phe Met Glu His Ser Asp Lys Gly Pro Leu Pro Leu Arg Asp 1365 1370 1375 Asp Asn Gly Ile Val Leu Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala 1380 1385 1390 Tyr Ala Lys Ala Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro 1395 1400 1405 Thr Pro Ala Ile Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln 1410 1415 1420 Gln Pro Glu Ala Ala Ala Gly Val Leu Glu Tyr Ala Met Lys His Phe1425 1430 1435 1440 Gly Glu Leu Glu Ile Gln Ala Thr Trp Tyr Glu Lys Leu His Glu Trp 1445 1450 1455 Glu Asp Ala Leu Val Ala Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp 1460 1465 1470 Asp Pro Glu Leu Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly 1475 1480 1485 Glu Trp Gly Gln Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val 1490 1495 1500 Asn Asp Glu Thr Gln Ala Lys Met Ala Arg Met Ala Ala Ala Ala Ala1505 1510 1515 1520 Trp Gly Leu Gly Gln Trp Asp Ser Met Glu Glu Tyr Thr Cys Met Ile 1525 1530 1535 Pro Arg Asp Thr His Asp Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu 1540 1545 1550 His Gln Asp Leu Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg 1555 1560 1565 Asp Leu Leu Asp Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser 1570 1575 1580 Arg Ala Tyr Gly Ala Met Val Ser Cys His Met Leu Ser Glu Leu Glu1585 1590 1595 1600 Glu Val Ile Gln Tyr Lys Leu Val Pro Glu Arg Arg Glu Ile Ile Arg 1605 1610 1615 Gln Ile Trp Trp Glu Arg Leu Gln Gly Cys Gln Arg Ile Val Glu Asp 1620 1625 1630 Trp Gln Lys Ile Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu 1635 1640 1645 Asp Met Arg Thr Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly 1650 1655 1660 Arg Leu Ala Leu Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp1665 1670 1675 1680 Pro Ser Arg Gln Leu Asp His Pro Leu Pro Thr Val His Pro Gln Val 1685 1690 1695 Thr Tyr Ala Tyr Met Lys Asn Met Trp Lys Ser Ala Arg Lys Ile Asp 1700 1705 1710 Ala Phe Gln His Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala 1715 1720 1725 Gln His Ala Ile Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His 1730 1735 1740 Lys Leu Met Ala Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn1745 1750 1755 1760 Leu Gln Gly Ile Asn Glu Ser Thr Ile Pro Lys Val Leu Gln Tyr Tyr 1765 1770 1775 Ser Ala Ala Thr Glu His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala 1780 1785 1790 Trp Ala Val Met Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn 1795 1800 1805 Gln Ala Arg Asp Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala Asn 1810 1815 1820 Ile Thr Asn Ala Thr Thr Ala Ala Thr Thr Ala Ala Thr Ala Thr Thr1825 1830 1835 1840 Thr Ala Ser Thr Glu Gly Ser Asn Ser Glu Ser Glu Ala Glu Ser Thr 1845 1850 1855 Glu Asn Ser Pro Thr Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp 1860 1865 1870 Leu Ser Lys Thr Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly Phe 1875 1880 1885 Phe Arg Ser Ile Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu 1890 1895 1900 Arg Val Leu Thr Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn1905 1910 1915 1920 Glu Ala Leu Val Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu 1925 1930 1935 Gln Val Ile Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu 1940 1945 1950 Val Gly Arg Leu Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His 1955 1960 1965 Pro Gln Ala Leu Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr Thr 1970 1975 1980 Thr Ala Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu1985 1990 1995 2000 His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu 2005 2010 2015 Ile Arg Val Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu 2020 2025 2030 Glu Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe 2035 2040 2045 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr 2050 2055 2060 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu2065 2070 2075 2080 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp 2085 2090 2095 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser 2100 2105 2110 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro 2115 2120 2125 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr 2130 2135 2140 Asp Pro Asn Gln Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu2145 2150 2155 2160 Gln Val Ile Thr Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly 2165 2170 2175 Ser Asn Gly His Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu 2180 2185 2190 Arg Gln Asp Glu Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu 2195 2200 2205 Leu Ala Asn Asp Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln Arg 2210 2215 2220 Tyr Ala Val Ile Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val2225 2230 2235 2240 Pro His Cys Asp Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys 2245 2250 2255 Lys Lys Ile Leu Leu Asn Ile Glu His Arg Ile Met Leu Arg Met Ala 2260 2265 2270 Pro Asp Tyr Asp His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu 2275 2280 2285 His Ala Val Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp 2290 2295 2300 Leu Lys Ser Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr2305 2310 2315 2320 Thr Arg Ser Leu Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu 2325 2330 2335 Gly Asp Arg His Pro Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys 2340 2345 2350 Ile Leu His Ile Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg 2355 2360 2365 Glu Lys Phe Pro Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr 2370 2375 2380 Asn Ala Met Glu Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys2385 2390 2395 2400 His Thr Val Met Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala 2405 2410 2415 Val Leu Glu Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met 2420 2425 2430 Asp Thr Asn Thr Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser 2435 2440 2445 Tyr Ser Ala Gly Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly 2450 2455 2460 Glu Pro Ala His Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His2465 2470 2475 2480 Ser Phe Ile Gly Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys 2485 2490 2495 Ala Ile Gln Ile Ile Asn Arg Val Arg Asp Lys Leu Thr Gly Arg Asp 2500 2505 2510 Phe Ser His Asp Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu 2515 2520 2525 Ile Lys Gln Ala Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly 2530 2535 2540 Trp Cys Pro Phe Trp2545 33495DNAHomo sapiensgene(1)..(3495)wild type TSC1 3atggcccaac aagcaaatgt cggggagctt cttgccatgc tggactcccc catgctgggt 60gtgcgggacg acgtgacagc tgtctttaaa gagaacctca attctgaccg tggccctatg 120cttgtaaaca ccttggtgga ttattacctg gaaaccagct ctcagccggc attgcacatc 180ctgaccacct tgcaagagcc acatgacaag cacctcttgg acaggattaa cgaatatgtg 240ggcaaagccg ccactcgttt atccatcctc tcgttactgg gtcatgtcat aagactgcag 300ccatcttgga agcataagct ctctcaagca cctcttttgc cttctttact aaaatgtctc 360aagatggaca ctgacgtcgt tgtcctcaca acaggcgtct tggtgttgat aaccatgcta 420ccaatgattc cacagtctgg gaaacagcat cttcttgatt tctttgacat ttttggccgt 480ctgtcatcat ggtgcctgaa gaaaccaggc cacgtggcgg aagtctatct cgtccatctc 540catgccagtg tgtacgcact ctttcatcgc ctttatggaa tgtacccttg caacttcgtc 600tcctttttgc gttctcatta cagtatgaaa gaaaacctgg agacttttga agaagtggtc 660aagccaatga tggagcatgt gcgaattcat ccggaattag tgactggatc caaggaccat 720gaactggacc ctcgaaggtg gaagagatta gaaactcatg atgttgtgat cgagtgtgcc 780aaaatctctc tggatcccac agaagcctca tatgaagatg gctattctgt gtctcaccaa 840atctcagccc gctttcctca tcgttcagcc gatgtcacca ccagccctta tgctgacaca 900cagaatagct atgggtgtgc tacttctacc ccttactcca cgtctcggct gatgttgtta 960aatatgccag ggcagctacc tcagactctg agttccccat cgacacggct gataactgaa 1020ccaccacaag ctactctttg gagcccatct atggtttgtg gtatgaccac tcctccaact 1080tctcctggaa atgtcccacc tgatctgtca cacccttaca gtaaagtctt tggtacaact 1140gcaggtggaa aaggaactcc tctgggaacc ccagcaacct ctcctcctcc agccccactc 1200tgtcattcgg atgactacgt gcacatttca ctcccccagg ccacagtcac accccccagg 1260aaggaagaga gaatggattc tgcaagacca tgtctacaca gacaacacca tcttctgaat 1320gacagaggat cagaagagcc acctggcagc aaaggttctg tcactctaag tgatcttcca 1380gggtttttag gtgatctggc ctctgaagaa gatagtattg aaaaagataa agaagaagct 1440gcaatatcta gagaactttc tgagatcacc acagcagagg cagagcctgt ggttcctcga 1500ggaggctttg actctccctt ttaccgagac agtctcccag gttctcagcg gaagacccac 1560tcggcagcct ccagttctca gggcgccagc gtgaaccctg agcctttaca ctcctccctg 1620gacaagcttg ggcctgacac accaaagcaa gcctttactc ccatagacct gccctgcggc 1680agtgctgatg aaagccctgc gggagacagg gaatgccaga cttctttgga gaccagtatc 1740ttcactccca gtccttgtaa aattccacct ccgacgagag tgggctttgg aagcgggcag 1800cctcccccgt atgatcatct ttttgaggtg gcattgccaa agacagccca tcattttgtc 1860atcaggaaga ctgaggagct gttaaagaaa gcaaaaggaa acacagagga agatggtgtg 1920ccctctacct ccccaatgga agtgctggac agactgatac agcagggagc agacgcgcac 1980agcaaggagc tgaacaagtt gcctttaccc agcaagtctg tcgactggac ccactttgga 2040ggctctcctc cttcagatga gatccgcacc ctccgagacc agttgctttt actgcacaac 2100cagttactct atgagcgttt taagaggcag cagcatgccc tccggaacag gcggctcctc 2160cgcaaggtga tcaaagcagc agctctggag gaacataatg ctgccatgaa agatcagttg 2220aagttacaag agaaggacat ccagatgtgg aaggttagtc tgcagaaaga acaagctaga 2280tacaatcagc tccaggagca gcgtgacact atggtaacca agctccacag ccagatcaga 2340cagctgcagc atgaccgaga ggaattctac aaccagagcc aggaattaca gacgaagctg 2400gaggactgca ggaacatgat tgcggagctg cggatagaac tgaagaaggc caacaacaag 2460gtgtgtcaca ctgagctgct gctcagtcag gtttcccaaa agctctcaaa cagtgagtcg 2520gtccagcagc agatggagtt cttgaacagg cagctgttgg ttcttgggga ggtcaacgag 2580ctctatttgg aacaactgca gaacaagcac tcagatacca caaaggaagt agaaatgatg 2640aaagccgcct atcggaaaga gctagaaaaa aacagaagcc atgttctcca gcagactcag 2700aggcttgata cctcccaaaa acggattttg gaactggaat ctcacctggc caagaaagac 2760caccttcttt tggaacagaa gaaatatcta gaggatgtca aactccaggc aagaggacag 2820ctgcaggccg cagagagcag gtatgaggct cagaaaagga taacccaggt gtttgaattg 2880gagatcttag atttatatgg caggttggag aaagatggcc tcctgaaaaa acttgaagaa 2940gaaaaagcag aagcagctga agcagcagaa gaaaggcttg actgttgtaa tgacgggtgc 3000tcagattcca tggtagggca caatgaagag gcatctggcc acaacggtga gaccaagacc 3060cccaggccca gcagcgcccg gggcagtagt ggaagcagag gtggtggagg cagcagcagc 3120agcagcagcg agctttctac cccagagaaa cccccacacc agagggcagg cccattcagc 3180agtcggtggg agacgactat gggagaagcg tctgccagca tccccaccac tgtgggctca 3240cttcccagtt caaaaagctt cctgggtatg aaggctcgag agttatttcg taataagagc 3300gagagccagt gtgatgagga cggcatgacc agtagccttt ctgagagcct aaagacagaa 3360ctgggcaaag acttgggtgt ggaagccaag attcccctga acctagatgg ccctcacccg 3420tctcccccga ccccggacag tgttggacag ctacatatca tggactacaa tgagactcat 3480catgaacaca gctaa 349541164PRTHomo sapiensPEPTIDE(1)..(1164)wild type TSC1 4Met Ala Gln Gln Ala Asn Val Gly Glu Leu Leu Ala Met Leu Asp Ser 1 5 10 15 Pro Met Leu Gly Val Arg Asp Asp Val Thr Ala Val Phe Lys Glu Asn 20 25 30 Leu Asn Ser Asp Arg Gly Pro Met Leu Val Asn Thr Leu Val Asp Tyr 35 40 45 Tyr Leu Glu Thr Ser Ser Gln Pro Ala Leu His Ile Leu Thr Thr Leu 50 55 60 Gln Glu Pro His Asp Lys His Leu Leu Asp Arg Ile Asn Glu Tyr Val65 70 75 80 Gly Lys Ala Ala Thr Arg Leu Ser Ile Leu Ser Leu Leu Gly His Val 85 90 95 Ile Arg Leu Gln Pro Ser Trp Lys His Lys Leu Ser Gln Ala Pro Leu 100 105 110 Leu Pro Ser Leu Leu Lys Cys Leu Lys Met Asp Thr Asp Val Val Val 115 120 125 Leu Thr Thr Gly Val Leu Val Leu Ile Thr Met Leu Pro Met Ile Pro 130 135 140 Gln Ser Gly Lys Gln His Leu Leu Asp Phe Phe Asp Ile Phe Gly Arg145 150 155 160 Leu Ser Ser Trp Cys Leu Lys Lys Pro Gly His Val Ala Glu Val Tyr 165 170 175 Leu Val His Leu His Ala Ser Val Tyr Ala Leu Phe His Arg Leu Tyr 180 185 190 Gly Met Tyr Pro Cys Asn Phe Val Ser Phe Leu Arg Ser His Tyr Ser 195 200 205 Met Lys Glu Asn Leu Glu Thr Phe Glu Glu Val Val Lys Pro Met Met 210 215 220 Glu His Val Arg Ile His Pro Glu Leu Val Thr Gly Ser Lys Asp His225 230 235 240 Glu Leu Asp Pro Arg Arg Trp Lys Arg Leu Glu Thr His Asp Val Val 245 250 255 Ile Glu Cys Ala Lys Ile Ser Leu Asp Pro Thr Glu Ala Ser Tyr Glu 260 265 270 Asp Gly Tyr Ser Val Ser His Gln Ile Ser Ala Arg Phe Pro His Arg 275 280 285 Ser Ala Asp Val Thr Thr Ser Pro Tyr Ala Asp Thr Gln Asn Ser Tyr 290 295 300 Gly Cys Ala Thr Ser Thr Pro Tyr Ser Thr Ser Arg Leu Met Leu Leu305 310 315 320 Asn Met Pro Gly Gln Leu Pro Gln Thr Leu Ser Ser Pro Ser Thr Arg 325 330 335 Leu Ile Thr Glu Pro Pro Gln Ala Thr Leu Trp Ser Pro Ser Met Val 340 345 350 Cys Gly Met Thr Thr Pro Pro Thr Ser Pro Gly Asn Val Pro Pro Asp 355 360 365 Leu Ser His Pro Tyr Ser Lys Val Phe Gly Thr Thr Ala Gly Gly Lys 370 375 380 Gly Thr Pro Leu Gly Thr Pro Ala Thr Ser Pro Pro Pro Ala Pro Leu385 390 395 400 Cys His Ser Asp Asp Tyr Val His Ile Ser Leu Pro Gln Ala Thr Val 405 410 415 Thr Pro Pro Arg Lys Glu Glu Arg Met Asp Ser Ala Arg Pro Cys Leu 420 425 430 His Arg Gln His His Leu Leu Asn Asp Arg Gly Ser Glu Glu Pro Pro 435 440 445 Gly Ser Lys Gly Ser Val Thr Leu Ser Asp Leu Pro Gly Phe Leu Gly 450 455 460 Asp Leu Ala Ser Glu Glu Asp Ser Ile Glu Lys Asp Lys Glu Glu Ala465 470 475 480 Ala Ile Ser Arg Glu Leu Ser Glu Ile Thr Thr Ala Glu Ala Glu Pro 485 490 495 Val Val Pro Arg Gly Gly Phe Asp Ser Pro Phe Tyr Arg Asp Ser Leu

500 505 510 Pro Gly Ser Gln Arg Lys Thr His Ser Ala Ala Ser Ser Ser Gln Gly 515 520 525 Ala Ser Val Asn Pro Glu Pro Leu His Ser Ser Leu Asp Lys Leu Gly 530 535 540 Pro Asp Thr Pro Lys Gln Ala Phe Thr Pro Ile Asp Leu Pro Cys Gly545 550 555 560 Ser Ala Asp Glu Ser Pro Ala Gly Asp Arg Glu Cys Gln Thr Ser Leu 565 570 575 Glu Thr Ser Ile Phe Thr Pro Ser Pro Cys Lys Ile Pro Pro Pro Thr 580 585 590 Arg Val Gly Phe Gly Ser Gly Gln Pro Pro Pro Tyr Asp His Leu Phe 595 600 605 Glu Val Ala Leu Pro Lys Thr Ala His His Phe Val Ile Arg Lys Thr 610 615 620 Glu Glu Leu Leu Lys Lys Ala Lys Gly Asn Thr Glu Glu Asp Gly Val625 630 635 640 Pro Ser Thr Ser Pro Met Glu Val Leu Asp Arg Leu Ile Gln Gln Gly 645 650 655 Ala Asp Ala His Ser Lys Glu Leu Asn Lys Leu Pro Leu Pro Ser Lys 660 665 670 Ser Val Asp Trp Thr His Phe Gly Gly Ser Pro Pro Ser Asp Glu Ile 675 680 685 Arg Thr Leu Arg Asp Gln Leu Leu Leu Leu His Asn Gln Leu Leu Tyr 690 695 700 Glu Arg Phe Lys Arg Gln Gln His Ala Leu Arg Asn Arg Arg Leu Leu705 710 715 720 Arg Lys Val Ile Lys Ala Ala Ala Leu Glu Glu His Asn Ala Ala Met 725 730 735 Lys Asp Gln Leu Lys Leu Gln Glu Lys Asp Ile Gln Met Trp Lys Val 740 745 750 Ser Leu Gln Lys Glu Gln Ala Arg Tyr Asn Gln Leu Gln Glu Gln Arg 755 760 765 Asp Thr Met Val Thr Lys Leu His Ser Gln Ile Arg Gln Leu Gln His 770 775 780 Asp Arg Glu Glu Phe Tyr Asn Gln Ser Gln Glu Leu Gln Thr Lys Leu785 790 795 800 Glu Asp Cys Arg Asn Met Ile Ala Glu Leu Arg Ile Glu Leu Lys Lys 805 810 815 Ala Asn Asn Lys Val Cys His Thr Glu Leu Leu Leu Ser Gln Val Ser 820 825 830 Gln Lys Leu Ser Asn Ser Glu Ser Val Gln Gln Gln Met Glu Phe Leu 835 840 845 Asn Arg Gln Leu Leu Val Leu Gly Glu Val Asn Glu Leu Tyr Leu Glu 850 855 860 Gln Leu Gln Asn Lys His Ser Asp Thr Thr Lys Glu Val Glu Met Met865 870 875 880 Lys Ala Ala Tyr Arg Lys Glu Leu Glu Lys Asn Arg Ser His Val Leu 885 890 895 Gln Gln Thr Gln Arg Leu Asp Thr Ser Gln Lys Arg Ile Leu Glu Leu 900 905 910 Glu Ser His Leu Ala Lys Lys Asp His Leu Leu Leu Glu Gln Lys Lys 915 920 925 Tyr Leu Glu Asp Val Lys Leu Gln Ala Arg Gly Gln Leu Gln Ala Ala 930 935 940 Glu Ser Arg Tyr Glu Ala Gln Lys Arg Ile Thr Gln Val Phe Glu Leu945 950 955 960 Glu Ile Leu Asp Leu Tyr Gly Arg Leu Glu Lys Asp Gly Leu Leu Lys 965 970 975 Lys Leu Glu Glu Glu Lys Ala Glu Ala Ala Glu Ala Ala Glu Glu Arg 980 985 990 Leu Asp Cys Cys Asn Asp Gly Cys Ser Asp Ser Met Val Gly His Asn 995 1000 1005 Glu Glu Ala Ser Gly His Asn Gly Glu Thr Lys Thr Pro Arg Pro Ser 1010 1015 1020 Ser Ala Arg Gly Ser Ser Gly Ser Arg Gly Gly Gly Gly Ser Ser Ser1025 1030 1035 1040 Ser Ser Ser Glu Leu Ser Thr Pro Glu Lys Pro Pro His Gln Arg Ala 1045 1050 1055 Gly Pro Phe Ser Ser Arg Trp Glu Thr Thr Met Gly Glu Ala Ser Ala 1060 1065 1070 Ser Ile Pro Thr Thr Val Gly Ser Leu Pro Ser Ser Lys Ser Phe Leu 1075 1080 1085 Gly Met Lys Ala Arg Glu Leu Phe Arg Asn Lys Ser Glu Ser Gln Cys 1090 1095 1100 Asp Glu Asp Gly Met Thr Ser Ser Leu Ser Glu Ser Leu Lys Thr Glu1105 1110 1115 1120 Leu Gly Lys Asp Leu Gly Val Glu Ala Lys Ile Pro Leu Asn Leu Asp 1125 1130 1135 Gly Pro His Pro Ser Pro Pro Thr Pro Asp Ser Val Gly Gln Leu His 1140 1145 1150 Ile Met Asp Tyr Asn Glu Thr His His Glu His Ser 1155 1160 55424DNAHomo sapiensgene(1)..(5424)wild type TSC2 5atggccaaac caacaagcaa agattcaggc ttgaaggaga agtttaagat tctgttggga 60ctgggaacac cgaggccaaa tcccaggtct gcagagggta aacagacgga gtttatcatc 120accgcggaaa tactgagaga actgagcatg gaatgtggcc tcaacaatcg catccggatg 180atagggcaga tttgtgaagt cgcaaaaacc aagaaatttg aagagcacgc agtggaagca 240ctctggaagg cggtcgcgga tctgttgcag ccggagcggc cgctggaggc ccggcacgcg 300gtgctggctc tgctgaaggc catcgtgcag gggcagggcg agcgtttggg ggtcctcaga 360gccctcttct ttaaggtcat caaggattac ccttccaacg aagaccttca cgaaaggctg 420gaggttttca aggccctcac agacaatggg agacacatca cctacttgga ggaagagctg 480gctgactttg tcctgcagtg gatggatgtt ggcttgtcct cggaattcct tctggtgctg 540gtgaacttgg tcaaattcaa tagctgttac ctcgacgagt acatcgcaag gatggttcag 600atgatctgtc tgctgtgcgt ccggaccgcg tcctctgtgg acatagaggt ctccctgcag 660gtgctggacg ccgtggtctg ctacaactgc ctgccggctg agagcctccc gctgttcatc 720gttaccctct gtcgcaccat caacgtcaag gagctctgcg agccttgctg gaagctgatg 780cggaacctcc ttggcaccca cctgggccac agcgccatct acaacatgtg ccacctcatg 840gaggacagag cctacatgga ggacgcgccc ctgctgagag gagccgtgtt ttttgtgggc 900atggctctct ggggagccca ccggctctat tctctcagga actcgccgac atctgtgttg 960ccatcatttt accaggccat ggcatgtccg aacgaggtgg tgtcctatga gatcgtcctg 1020tccatcacca ggctcatcaa gaagtatagg aaggagctcc aggtggtggc gtgggacatt 1080ctgctgaaca tcatcgaacg gctccttcag cagctccaga ccttggacag cccggagctc 1140aggaccatcg tccatgacct gttgaccacg gtggaggagc tgtgtgacca gaacgagttc 1200cacgggtctc aggagagata ctttgaactg gtggagagat gtgcggacca gaggcctgag 1260tcctccctcc tgaacctgat ctcctataga gcgcagtcca tccacccggc caaggacggc 1320tggattcaga acctgcaggc gctgatggag agattcttca ggagcgagtc ccgaggcgcc 1380gtgcgcatca aggtgctgga cgtgctgtcc tttgtgctgc tcatcaacag gcagttctat 1440gaggaggagc tgattaactc agtggtcatc tcgcagctct cccacatccc cgaggataaa 1500gaccaccagg tccgaaagct ggccacccag ttgctggtgg acctggcaga gggctgccac 1560acacaccact tcaacagcct gctggacatc atcgagaagg tgatggcccg ctccctctcc 1620ccacccccgg agctggaaga aagggatgtg gccgcatact cggcctcctt ggaggatgtg 1680aagacagccg tcctggggct tctggtcatc cttcagacca agctgtacac cctgcctgca 1740agccacgcca cgcgtgtgta tgagatgctg gtcagccaca ttcagctcca ctacaagcac 1800agctacaccc tgccaatcgc gagcagcatc cggctgcagg cctttgactt cctgttgctg 1860ctgcgggccg actcactgca ccgcctgggc ctgcccaaca aggatggagt cgtgcggttc 1920agcccctact gcgtctgcga ctacatggag ccagagagag gctctgagaa gaagaccagc 1980ggcccccttt ctcctcccac agggcctcct ggcccggcgc ctgcaggccc cgccgtgcgg 2040ctggggtccg tgccctactc cctgctcttc cgcgtcctgc tgcagtgctt gaagcaggag 2100tctgactgga aggtgctgaa gctggttctg ggcaggctgc ctgagtccct gcgctataaa 2160gtgctcatct ttacttcccc ttgcagtgtg gaccagctgt gctctgctct ctgctccatg 2220ctttcaggcc caaagacact ggagcggctc cgaggcgccc cagaaggctt ctccagaact 2280gacttgcacc tggccgtggt tccagtgctg acagcattaa tctcttacca taactacctg 2340gacaaaacca aacagcgcga gatggtctac tgcctggagc agggcctcat ccaccgctgt 2400gccagccagt gcgtcgtggc cttgtccatc tgcagcgtgg agatgcctga catcatcatc 2460aaggcgctgc ctgttctggt ggtgaagctc acgcacatct cagccacagc cagcatggcc 2520gtcccactgc tggagttcct gtccactctg gccaggctgc cgcacctcta caggaacttt 2580gccgcggagc agtatgccag tgtgttcgcc atctccctgc cgtacaccaa cccctccaag 2640tttaatcagt acatcgtgtg tctggcccat cacgtcatag ccatgtggtt catcaggtgc 2700cgcctgccct tccggaagga ttttgtccct ttcatcacta agggcctgcg gtccaatgtc 2760ctcttgtctt ttgatgacac ccccgagaag gacagcttca gggcccggag tactagtctc 2820aacgagagac ccaagagtct gaggatagcc agacccccca aacaaggctt gaataactct 2880ccacccgtga aagaattcaa ggagagctct gcagccgagg ccttccggtg ccgcagcatc 2940agtgtgtctg aacatgtggt ccgcagcagg atacagacgt ccctcaccag tgccagcttg 3000gggtctgcag atgagaactc cgtggcccag gctgacgata gcctgaaaaa cctccacctg 3060gagctcacgg aaacctgtct ggacatgatg gctcgatacg tcttctccaa cttcacggct 3120gtcccgaaga ggtctcctgt gggcgagttc ctcctagcgg gtggcaggac caaaacctgg 3180ctggttggga acaagcttgt cactgtgacg acaagcgtgg gaaccgggac ccggtcgtta 3240ctaggcctgg actcggggga gctgcagtcc ggcccggagt cgagctccag ccccggggtg 3300catgtgagac agaccaagga ggcgccggcc aagctggagt cccaggctgg gcagcaggtg 3360tcccgtgggg cccgggatcg ggtccgttcc atgtcggggg gccatggtct tcgagttggc 3420gccctggacg tgccggcctc ccagttcctg ggcagtgcca cttctccagg accacggact 3480gcaccagccg cgaaacctga gaaggcctca gctggcaccc gggttcctgt gcaggagaag 3540acgaacctgg cggcctatgt gcccctgctg acccagggct gggcggagat cctggtccgg 3600aggcccacag ggaacaccag ctggctgatg agcctggaga acccgctcag ccctttctcc 3660tcggacatca acaacatgcc cctgcaggag ctgtctaacg ccctcatggc ggctgagcgc 3720ttcaaggagc accgggacac agccctgtac aagtcactgt cggtgccggc agccagcacg 3780gccaaacccc ctcctctgcc tcgctccaac acagtggcct ctttctcctc cctgtaccag 3840tccagctgcc aaggacagct gcacaggagc gtttcctggg cagactccgc cgtggtcatg 3900gaggagggaa gtccgggcga ggttcctgtg ctggtggagc ccccagggtt ggaggacgtt 3960gaggcagcgc taggcatgga caggcgcacg gatgcctaca gcaggtcgtc ctcagtctcc 4020agccaggagg agaagtcgct ccacgcggag gagctggttg gcaggggcat ccccatcgag 4080cgagtcgtct cctcggaggg tggccggccc tctgtggacc tctccttcca gccctcgcag 4140cccctgagca agtccagctc ctctcccgag ctgcagactc tgcaggacat cctcggggac 4200cctggggaca aggccgacgt gggccggctg agccctgagg ttaaggcccg gtcacagtca 4260gggaccctgg acggggaaag tgctgcctgg tcggcctcgg gcgaagacag tcggggccag 4320cccgagggtc ccttgccttc cagctccccc cgctcgccca gtggcctccg gccccgaggt 4380tacaccatct ccgactcggc cccatcacgc aggggcaaga gagtagagag ggacgcctta 4440aagagcagag ccacagcctc caatgcagag aaagtgccag gcatcaaccc cagtttcgtg 4500ttcctgcagc tctaccattc ccccttcttt ggcgacgagt caaacaagcc aatcctgctg 4560cccaatgagt cacagtcctt tgagcggtcg gtgcagctcc tcgaccagat cccatcatac 4620gacacccaca agatcgccgt cctgtatgtt ggagaaggcc agagcaacag cgagctcgcc 4680atcctgtcca atgagcatgg ctcctacagg tacacggagt tcctgacggg cctgggccgg 4740ctcatcgagc tgaaggactg ccagccggac aaggtgtacc tgggaggcct ggacgtgtgt 4800ggtgaggacg gccagttcac ctactgctgg cacgatgaca tcatgcaagc cgtcttccac 4860atcgccaccc tgatgcccac caaggacgtg gacaagcacc gctgcgacaa gaagcgccac 4920ctgggcaacg actttgtgtc cattgtctac aatgactccg gtgaggactt caagcttggc 4980accatcaagg gccagttcaa ctttgtccac gtgatcgtca ccccgctgga ctacgagtgc 5040aacctggtgt ccctgcagtg caggaaagac atggagggcc ttgtggacac cagcgtggcc 5100aagatcgtgt ctgaccgcaa cctgcccttc gtggcccgcc agatggccct gcacgcaaat 5160atggcctcac aggtgcatca tagccgctcc aaccccaccg atatctaccc ctccaagtgg 5220attgcccggc tccgccacat caagcggctc cgccagcgga tctgcgagga agccgcctac 5280tccaacccca gcctacctct ggtgcaccct ccgtcccata gcaaagcccc tgcacagact 5340ccagccgagc ccacacctgg ctatgaggtg ggccagcgga agcgcctcat ctcctcggtg 5400gaggacttca ccgagtttgt gtga 542461807PRTHomo sapiensPEPTIDE(1)..(1807)wild type TSC2 6Met Ala Lys Pro Thr Ser Lys Asp Ser Gly Leu Lys Glu Lys Phe Lys 1 5 10 15 Ile Leu Leu Gly Leu Gly Thr Pro Arg Pro Asn Pro Arg Ser Ala Glu 20 25 30 Gly Lys Gln Thr Glu Phe Ile Ile Thr Ala Glu Ile Leu Arg Glu Leu 35 40 45 Ser Met Glu Cys Gly Leu Asn Asn Arg Ile Arg Met Ile Gly Gln Ile 50 55 60 Cys Glu Val Ala Lys Thr Lys Lys Phe Glu Glu His Ala Val Glu Ala65 70 75 80 Leu Trp Lys Ala Val Ala Asp Leu Leu Gln Pro Glu Arg Pro Leu Glu 85 90 95 Ala Arg His Ala Val Leu Ala Leu Leu Lys Ala Ile Val Gln Gly Gln 100 105 110 Gly Glu Arg Leu Gly Val Leu Arg Ala Leu Phe Phe Lys Val Ile Lys 115 120 125 Asp Tyr Pro Ser Asn Glu Asp Leu His Glu Arg Leu Glu Val Phe Lys 130 135 140 Ala Leu Thr Asp Asn Gly Arg His Ile Thr Tyr Leu Glu Glu Glu Leu145 150 155 160 Ala Asp Phe Val Leu Gln Trp Met Asp Val Gly Leu Ser Ser Glu Phe 165 170 175 Leu Leu Val Leu Val Asn Leu Val Lys Phe Asn Ser Cys Tyr Leu Asp 180 185 190 Glu Tyr Ile Ala Arg Met Val Gln Met Ile Cys Leu Leu Cys Val Arg 195 200 205 Thr Ala Ser Ser Val Asp Ile Glu Val Ser Leu Gln Val Leu Asp Ala 210 215 220 Val Val Cys Tyr Asn Cys Leu Pro Ala Glu Ser Leu Pro Leu Phe Ile225 230 235 240 Val Thr Leu Cys Arg Thr Ile Asn Val Lys Glu Leu Cys Glu Pro Cys 245 250 255 Trp Lys Leu Met Arg Asn Leu Leu Gly Thr His Leu Gly His Ser Ala 260 265 270 Ile Tyr Asn Met Cys His Leu Met Glu Asp Arg Ala Tyr Met Glu Asp 275 280 285 Ala Pro Leu Leu Arg Gly Ala Val Phe Phe Val Gly Met Ala Leu Trp 290 295 300 Gly Ala His Arg Leu Tyr Ser Leu Arg Asn Ser Pro Thr Ser Val Leu305 310 315 320 Pro Ser Phe Tyr Gln Ala Met Ala Cys Pro Asn Glu Val Val Ser Tyr 325 330 335 Glu Ile Val Leu Ser Ile Thr Arg Leu Ile Lys Lys Tyr Arg Lys Glu 340 345 350 Leu Gln Val Val Ala Trp Asp Ile Leu Leu Asn Ile Ile Glu Arg Leu 355 360 365 Leu Gln Gln Leu Gln Thr Leu Asp Ser Pro Glu Leu Arg Thr Ile Val 370 375 380 His Asp Leu Leu Thr Thr Val Glu Glu Leu Cys Asp Gln Asn Glu Phe385 390 395 400 His Gly Ser Gln Glu Arg Tyr Phe Glu Leu Val Glu Arg Cys Ala Asp 405 410 415 Gln Arg Pro Glu Ser Ser Leu Leu Asn Leu Ile Ser Tyr Arg Ala Gln 420 425 430 Ser Ile His Pro Ala Lys Asp Gly Trp Ile Gln Asn Leu Gln Ala Leu 435 440 445 Met Glu Arg Phe Phe Arg Ser Glu Ser Arg Gly Ala Val Arg Ile Lys 450 455 460 Val Leu Asp Val Leu Ser Phe Val Leu Leu Ile Asn Arg Gln Phe Tyr465 470 475 480 Glu Glu Glu Leu Ile Asn Ser Val Val Ile Ser Gln Leu Ser His Ile 485 490 495 Pro Glu Asp Lys Asp His Gln Val Arg Lys Leu Ala Thr Gln Leu Leu 500 505 510 Val Asp Leu Ala Glu Gly Cys His Thr His His Phe Asn Ser Leu Leu 515 520 525 Asp Ile Ile Glu Lys Val Met Ala Arg Ser Leu Ser Pro Pro Pro Glu 530 535 540 Leu Glu Glu Arg Asp Val Ala Ala Tyr Ser Ala Ser Leu Glu Asp Val545 550 555 560 Lys Thr Ala Val Leu Gly Leu Leu Val Ile Leu Gln Thr Lys Leu Tyr 565 570 575 Thr Leu Pro Ala Ser His Ala Thr Arg Val Tyr Glu Met Leu Val Ser 580 585 590 His Ile Gln Leu His Tyr Lys His Ser Tyr Thr Leu Pro Ile Ala Ser 595 600 605 Ser Ile Arg Leu Gln Ala Phe Asp Phe Leu Leu Leu Leu Arg Ala Asp 610 615 620 Ser Leu His Arg Leu Gly Leu Pro Asn Lys Asp Gly Val Val Arg Phe625 630 635 640 Ser Pro Tyr Cys Val Cys Asp Tyr Met Glu Pro Glu Arg Gly Ser Glu 645 650 655 Lys Lys Thr Ser Gly Pro Leu Ser Pro Pro Thr Gly Pro Pro Gly Pro 660 665 670 Ala Pro Ala Gly Pro Ala Val Arg Leu Gly Ser Val Pro Tyr Ser Leu 675 680 685 Leu Phe Arg Val Leu Leu Gln Cys Leu Lys Gln Glu Ser Asp Trp Lys 690 695 700 Val Leu Lys Leu Val Leu Gly Arg Leu Pro Glu Ser Leu Arg Tyr Lys705 710 715 720 Val Leu Ile Phe Thr Ser Pro Cys Ser Val Asp Gln Leu Cys Ser Ala 725 730 735 Leu Cys Ser Met Leu Ser Gly Pro Lys Thr Leu Glu Arg Leu Arg Gly 740 745 750 Ala Pro Glu Gly Phe Ser Arg Thr Asp Leu His Leu Ala Val Val Pro 755 760 765 Val Leu Thr Ala Leu Ile Ser Tyr His Asn Tyr Leu Asp Lys Thr Lys 770 775 780 Gln Arg Glu Met Val Tyr Cys Leu Glu Gln Gly Leu Ile His Arg Cys785 790 795 800 Ala Ser Gln Cys Val Val Ala Leu Ser Ile Cys Ser Val Glu Met Pro 805 810 815 Asp Ile Ile Ile Lys Ala Leu Pro Val Leu Val Val Lys Leu Thr His 820 825 830 Ile Ser Ala Thr Ala Ser Met Ala Val Pro Leu Leu Glu Phe Leu Ser 835 840 845 Thr Leu Ala Arg Leu Pro His Leu Tyr Arg Asn Phe Ala Ala Glu Gln 850 855 860 Tyr Ala Ser Val Phe Ala Ile Ser Leu Pro Tyr Thr Asn Pro Ser Lys865 870 875 880 Phe Asn Gln Tyr Ile Val Cys Leu Ala His His Val Ile Ala Met Trp 885 890

895 Phe Ile Arg Cys Arg Leu Pro Phe Arg Lys Asp Phe Val Pro Phe Ile 900 905 910 Thr Lys Gly Leu Arg Ser Asn Val Leu Leu Ser Phe Asp Asp Thr Pro 915 920 925 Glu Lys Asp Ser Phe Arg Ala Arg Ser Thr Ser Leu Asn Glu Arg Pro 930 935 940 Lys Ser Leu Arg Ile Ala Arg Pro Pro Lys Gln Gly Leu Asn Asn Ser945 950 955 960 Pro Pro Val Lys Glu Phe Lys Glu Ser Ser Ala Ala Glu Ala Phe Arg 965 970 975 Cys Arg Ser Ile Ser Val Ser Glu His Val Val Arg Ser Arg Ile Gln 980 985 990 Thr Ser Leu Thr Ser Ala Ser Leu Gly Ser Ala Asp Glu Asn Ser Val 995 1000 1005 Ala Gln Ala Asp Asp Ser Leu Lys Asn Leu His Leu Glu Leu Thr Glu 1010 1015 1020 Thr Cys Leu Asp Met Met Ala Arg Tyr Val Phe Ser Asn Phe Thr Ala1025 1030 1035 1040 Val Pro Lys Arg Ser Pro Val Gly Glu Phe Leu Leu Ala Gly Gly Arg 1045 1050 1055 Thr Lys Thr Trp Leu Val Gly Asn Lys Leu Val Thr Val Thr Thr Ser 1060 1065 1070 Val Gly Thr Gly Thr Arg Ser Leu Leu Gly Leu Asp Ser Gly Glu Leu 1075 1080 1085 Gln Ser Gly Pro Glu Ser Ser Ser Ser Pro Gly Val His Val Arg Gln 1090 1095 1100 Thr Lys Glu Ala Pro Ala Lys Leu Glu Ser Gln Ala Gly Gln Gln Val1105 1110 1115 1120 Ser Arg Gly Ala Arg Asp Arg Val Arg Ser Met Ser Gly Gly His Gly 1125 1130 1135 Leu Arg Val Gly Ala Leu Asp Val Pro Ala Ser Gln Phe Leu Gly Ser 1140 1145 1150 Ala Thr Ser Pro Gly Pro Arg Thr Ala Pro Ala Ala Lys Pro Glu Lys 1155 1160 1165 Ala Ser Ala Gly Thr Arg Val Pro Val Gln Glu Lys Thr Asn Leu Ala 1170 1175 1180 Ala Tyr Val Pro Leu Leu Thr Gln Gly Trp Ala Glu Ile Leu Val Arg1185 1190 1195 1200 Arg Pro Thr Gly Asn Thr Ser Trp Leu Met Ser Leu Glu Asn Pro Leu 1205 1210 1215 Ser Pro Phe Ser Ser Asp Ile Asn Asn Met Pro Leu Gln Glu Leu Ser 1220 1225 1230 Asn Ala Leu Met Ala Ala Glu Arg Phe Lys Glu His Arg Asp Thr Ala 1235 1240 1245 Leu Tyr Lys Ser Leu Ser Val Pro Ala Ala Ser Thr Ala Lys Pro Pro 1250 1255 1260 Pro Leu Pro Arg Ser Asn Thr Val Ala Ser Phe Ser Ser Leu Tyr Gln1265 1270 1275 1280 Ser Ser Cys Gln Gly Gln Leu His Arg Ser Val Ser Trp Ala Asp Ser 1285 1290 1295 Ala Val Val Met Glu Glu Gly Ser Pro Gly Glu Val Pro Val Leu Val 1300 1305 1310 Glu Pro Pro Gly Leu Glu Asp Val Glu Ala Ala Leu Gly Met Asp Arg 1315 1320 1325 Arg Thr Asp Ala Tyr Ser Arg Ser Ser Ser Val Ser Ser Gln Glu Glu 1330 1335 1340 Lys Ser Leu His Ala Glu Glu Leu Val Gly Arg Gly Ile Pro Ile Glu1345 1350 1355 1360 Arg Val Val Ser Ser Glu Gly Gly Arg Pro Ser Val Asp Leu Ser Phe 1365 1370 1375 Gln Pro Ser Gln Pro Leu Ser Lys Ser Ser Ser Ser Pro Glu Leu Gln 1380 1385 1390 Thr Leu Gln Asp Ile Leu Gly Asp Pro Gly Asp Lys Ala Asp Val Gly 1395 1400 1405 Arg Leu Ser Pro Glu Val Lys Ala Arg Ser Gln Ser Gly Thr Leu Asp 1410 1415 1420 Gly Glu Ser Ala Ala Trp Ser Ala Ser Gly Glu Asp Ser Arg Gly Gln1425 1430 1435 1440 Pro Glu Gly Pro Leu Pro Ser Ser Ser Pro Arg Ser Pro Ser Gly Leu 1445 1450 1455 Arg Pro Arg Gly Tyr Thr Ile Ser Asp Ser Ala Pro Ser Arg Arg Gly 1460 1465 1470 Lys Arg Val Glu Arg Asp Ala Leu Lys Ser Arg Ala Thr Ala Ser Asn 1475 1480 1485 Ala Glu Lys Val Pro Gly Ile Asn Pro Ser Phe Val Phe Leu Gln Leu 1490 1495 1500 Tyr His Ser Pro Phe Phe Gly Asp Glu Ser Asn Lys Pro Ile Leu Leu1505 1510 1515 1520 Pro Asn Glu Ser Gln Ser Phe Glu Arg Ser Val Gln Leu Leu Asp Gln 1525 1530 1535 Ile Pro Ser Tyr Asp Thr His Lys Ile Ala Val Leu Tyr Val Gly Glu 1540 1545 1550 Gly Gln Ser Asn Ser Glu Leu Ala Ile Leu Ser Asn Glu His Gly Ser 1555 1560 1565 Tyr Arg Tyr Thr Glu Phe Leu Thr Gly Leu Gly Arg Leu Ile Glu Leu 1570 1575 1580 Lys Asp Cys Gln Pro Asp Lys Val Tyr Leu Gly Gly Leu Asp Val Cys1585 1590 1595 1600 Gly Glu Asp Gly Gln Phe Thr Tyr Cys Trp His Asp Asp Ile Met Gln 1605 1610 1615 Ala Val Phe His Ile Ala Thr Leu Met Pro Thr Lys Asp Val Asp Lys 1620 1625 1630 His Arg Cys Asp Lys Lys Arg His Leu Gly Asn Asp Phe Val Ser Ile 1635 1640 1645 Val Tyr Asn Asp Ser Gly Glu Asp Phe Lys Leu Gly Thr Ile Lys Gly 1650 1655 1660 Gln Phe Asn Phe Val His Val Ile Val Thr Pro Leu Asp Tyr Glu Cys1665 1670 1675 1680 Asn Leu Val Ser Leu Gln Cys Arg Lys Asp Met Glu Gly Leu Val Asp 1685 1690 1695 Thr Ser Val Ala Lys Ile Val Ser Asp Arg Asn Leu Pro Phe Val Ala 1700 1705 1710 Arg Gln Met Ala Leu His Ala Asn Met Ala Ser Gln Val His His Ser 1715 1720 1725 Arg Ser Asn Pro Thr Asp Ile Tyr Pro Ser Lys Trp Ile Ala Arg Leu 1730 1735 1740 Arg His Ile Lys Arg Leu Arg Gln Arg Ile Cys Glu Glu Ala Ala Tyr1745 1750 1755 1760 Ser Asn Pro Ser Leu Pro Leu Val His Pro Pro Ser His Ser Lys Ala 1765 1770 1775 Pro Ala Gln Thr Pro Ala Glu Pro Thr Pro Gly Tyr Glu Val Gly Gln 1780 1785 1790 Arg Lys Arg Leu Ile Ser Ser Val Glu Asp Phe Thr Glu Phe Val 1795 1800 1805 71398DNAHomo sapiensgene(1)..(1398)wild type AKT3 7atgagcgatg ttaccattgt gaaagaaggt tgggttcaga agaggggaga atatataaaa 60aactggaggc caagatactt ccttttgaag acagatggct cattcatagg atataaagag 120aaacctcaag atgtggattt accttatccc ctcaacaact tttcagtggc aaaatgccag 180ttaatgaaaa cagaacgacc aaagccaaac acatttataa tcagatgtct ccagtggact 240actgttatag agagaacatt tcatgtagat actccagagg aaagggaaga atggacagaa 300gctatccagg ctgtagcaga cagactgcag aggcaagaag aggagagaat gaattgtagt 360ccaacttcac aaattgataa tataggagag gaagagatgg atgcctctac aacccatcat 420aaaagaaaga caatgaatga ttttgactat ttgaaactac taggtaaagg cacttttggg 480aaagttattt tggttcgaga gaaggcaagt ggaaaatact atgctatgaa gattctgaag 540aaagaagtca ttattgcaaa ggatgaagtg gcacacactc taactgaaag cagagtatta 600aagaacacta gacatccctt tttaacatcc ttgaaatatt ccttccagac aaaagaccgt 660ttgtgttttg tgatggaata tgttaatggg ggcgagctgt ttttccattt gtcgagagag 720cgggtgttct ctgaggaccg cacacgtttc tatggtgcag aaattgtctc tgccttggac 780tatctacatt ccggaaagat tgtgtaccgt gatctcaagt tggagaatct aatgctggac 840aaagatggcc acataaaaat tacagatttt ggactttgca aagaagggat cacagatgca 900gccaccatga agacattctg tggcactcca gaatatctgg caccagaggt gttagaagat 960aatgactatg gccgagcagt agactggtgg ggcctagggg ttgtcatgta tgaaatgatg 1020tgtgggaggt tacctttcta caaccaggac catgagaaac tttttgaatt aatattaatg 1080gaagacatta aatttcctcg aacactctct tcagatgcaa aatcattgct ttcagggctc 1140ttgataaagg atccaaataa acgccttggt ggaggaccag atgatgcaaa agaaattatg 1200agacacagtt tcttctctgg agtaaactgg caagatgtat atgataaaaa gcttgtacct 1260ccttttaaac ctcaagtaac atctgagaca gatactagat attttgatga agaatttaca 1320gctcagacta ttacaataac accacctgaa aaatgtcagc aatcagattg tggcatgctg 1380ggtaactgga aaaaataa 13988465PRTHomo sapiensPEPTIDE(1)..(465)wild type AKT3 8Met Ser Asp Val Thr Ile Val Lys Glu Gly Trp Val Gln Lys Arg Gly 1 5 10 15 Glu Tyr Ile Lys Asn Trp Arg Pro Arg Tyr Phe Leu Leu Lys Thr Asp 20 25 30 Gly Ser Phe Ile Gly Tyr Lys Glu Lys Pro Gln Asp Val Asp Leu Pro 35 40 45 Tyr Pro Leu Asn Asn Phe Ser Val Ala Lys Cys Gln Leu Met Lys Thr 50 55 60 Glu Arg Pro Lys Pro Asn Thr Phe Ile Ile Arg Cys Leu Gln Trp Thr65 70 75 80 Thr Val Ile Glu Arg Thr Phe His Val Asp Thr Pro Glu Glu Arg Glu 85 90 95 Glu Trp Thr Glu Ala Ile Gln Ala Val Ala Asp Arg Leu Gln Arg Gln 100 105 110 Glu Glu Glu Arg Met Asn Cys Ser Pro Thr Ser Gln Ile Asp Asn Ile 115 120 125 Gly Glu Glu Glu Met Asp Ala Ser Thr Thr His His Lys Arg Lys Thr 130 135 140 Met Asn Asp Phe Asp Tyr Leu Lys Leu Leu Gly Lys Gly Thr Phe Gly145 150 155 160 Lys Val Ile Leu Val Arg Glu Lys Ala Ser Gly Lys Tyr Tyr Ala Met 165 170 175 Lys Ile Leu Lys Lys Glu Val Ile Ile Ala Lys Asp Glu Val Ala His 180 185 190 Thr Leu Thr Glu Ser Arg Val Leu Lys Asn Thr Arg His Pro Phe Leu 195 200 205 Thr Ser Leu Lys Tyr Ser Phe Gln Thr Lys Asp Arg Leu Cys Phe Val 210 215 220 Met Glu Tyr Val Asn Gly Gly Glu Leu Phe Phe His Leu Ser Arg Glu225 230 235 240 Arg Val Phe Ser Glu Asp Arg Thr Arg Phe Tyr Gly Ala Glu Ile Val 245 250 255 Ser Ala Leu Asp Tyr Leu His Ser Gly Lys Ile Val Tyr Arg Asp Leu 260 265 270 Lys Leu Glu Asn Leu Met Leu Asp Lys Asp Gly His Ile Lys Ile Thr 275 280 285 Asp Phe Gly Leu Cys Lys Glu Gly Ile Thr Asp Ala Ala Thr Met Lys 290 295 300 Thr Phe Cys Gly Thr Pro Glu Tyr Leu Ala Pro Glu Val Leu Glu Asp305 310 315 320 Asn Asp Tyr Gly Arg Ala Val Asp Trp Trp Gly Leu Gly Val Val Met 325 330 335 Tyr Glu Met Met Cys Gly Arg Leu Pro Phe Tyr Asn Gln Asp His Glu 340 345 350 Lys Leu Phe Glu Leu Ile Leu Met Glu Asp Ile Lys Phe Pro Arg Thr 355 360 365 Leu Ser Ser Asp Ala Lys Ser Leu Leu Ser Gly Leu Leu Ile Lys Asp 370 375 380 Pro Asn Lys Arg Leu Gly Gly Gly Pro Asp Asp Ala Lys Glu Ile Met385 390 395 400 Arg His Ser Phe Phe Ser Gly Val Asn Trp Gln Asp Val Tyr Asp Lys 405 410 415 Lys Leu Val Pro Pro Phe Lys Pro Gln Val Thr Ser Glu Thr Asp Thr 420 425 430 Arg Tyr Phe Asp Glu Glu Phe Thr Ala Gln Thr Ile Thr Ile Thr Pro 435 440 445 Pro Glu Lys Cys Gln Gln Ser Asp Cys Gly Met Leu Gly Asn Trp Lys 450 455 460 Lys46593207DNAHomo sapiensgene(1)..(3207)wild type PIK3CA 9atgcctccac gaccatcatc aggtgaactg tggggcatcc acttgatgcc cccaagaatc 60ctagtagaat gtttactacc aaatggaatg atagtgactt tagaatgcct ccgtgaggct 120acattaataa ccataaagca tgaactattt aaagaagcaa gaaaataccc cctccatcaa 180cttcttcaag atgaatcttc ttacattttc gtaagtgtta ctcaagaagc agaaagggaa 240gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 300gtaattgaac cagtaggcaa ccgtgaagaa aagatcctca atcgagaaat tggttttgct 360atcggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtaca ggacttccga 420agaaatattc tgaacgtttg taaagaagct gtggatctta gggacctcaa ttcacctcat 480agtagagcaa tgtatgtcta tcctccaaat gtagaatctt caccagaatt gccaaagcac 540atatataata aattagataa agggcaaata atagtggtga tctgggtaat agtttctcca 600aataatgaca agcagaagta tactctgaaa atcaaccatg actgtgtacc agaacaagta 660attgctgaag caatcaggaa aaaaactcga agtatgttgc tatcctctga acaactaaaa 720ctctgtgttt tagaatatca gggcaagtat attttaaaag tgtgtggatg tgatgaatac 780ttcctagaaa aatatcctct gagtcagtat aagtatataa gaagctgtat aatgcttggg 840aggatgccca atttgatgtt gatggctaaa gaaagccttt attctcaact gccaatggac 900tgttttacaa tgccatctta ttccagacgc atttccacag ctacaccata tatgaatgga 960gaaacatcta caaaatccct ttgggttata aatagtgcac tcagaataaa aattctttgt 1020gcaacctacg tgaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc 1080taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat 1140cccaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcgtgctgct 1200cgactttgcc tttccatttg ctctgttaaa ggccgaaagg gtgctaaaga ggaacactgt 1260ccattggcat ggggaaatat aaacttgttt gattacacag acactctagt atctggaaaa 1320atggctttga atctttggcc agtacctcat ggattagaag atttgctgaa ccctattggt 1380gttactggat caaatccaaa taaagaaact ccatgcttag agttggagtt tgactggttc 1440agcagtgtgg taaagttccc agatatgtca gtgattgaag agcatgccaa ttggtctgta 1500tcccgagaag caggatttag ctattcccac gcaggactga gtaacagact agctagagac 1560aatgaattaa gggaaaatga caaagaacag ctcaaagcaa tttctacacg agatcctctc 1620tctgaaatca ctgagcagga gaaagatttt ctatggagtc acagacacta ttgtgtaact 1680atccccgaaa ttctacccaa attgcttctg tctgttaaat ggaattctag agatgaagta 1740gcccagatgt attgcttggt aaaagattgg cctccaatca aacctgaaca ggctatggaa 1800cttctggact gtaattaccc agatcctatg gttcgaggtt ttgctgttcg gtgcttggaa 1860aaatatttaa cagatgacaa actttctcag tatttaattc agctagtaca ggtcctaaaa 1920tatgaacaat atttggataa cttgcttgtg agatttttac tgaagaaagc attgactaat 1980caaaggattg ggcacttttt cttttggcat ttaaaatctg agatgcacaa taaaacagtt 2040agccagaggt ttggcctgct tttggagtcc tattgtcgtg catgtgggat gtatttgaag 2100cacctgaata ggcaagtcga ggcaatggaa aagctcatta acttaactga cattctcaaa 2160caggagaaga aggatgaaac acaaaaggta cagatgaagt ttttagttga gcaaatgagg 2220cgaccagatt tcatggatgc tctacagggc tttctgtctc ctctaaaccc tgctcatcaa 2280ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg 2340ttgaattggg agaacccaga catcatgtca gagttactgt ttcagaacaa tgagatcatc 2400tttaaaaatg gggatgattt acggcaagat atgctaacac ttcaaattat tcgtattatg 2460gaaaatatct ggcaaaatca aggtcttgat cttcgaatgt taccttatgg ttgtctgtca 2520atcggtgact gtgtgggact tattgaggtg gtgcgaaatt ctcacactat tatgcaaatt 2580cagtgcaaag gcggcttgaa aggtgcactg cagttcaaca gccacacact acatcagtgg 2640ctcaaagaca agaacaaagg agaaatatat gatgcagcca ttgacctgtt tacacgttca 2700tgtgctggat actgtgtagc taccttcatt ttgggaattg gagatcgtca caatagtaac 2760atcatggtga aagacgatgg acaactgttt catatagatt ttggacactt tttggatcac 2820aagaagaaaa aatttggtta taaacgagaa cgtgtgccat ttgttttgac acaggatttc 2880ttaatagtga ttagtaaagg agcccaagaa tgcacaaaga caagagaatt tgagaggttt 2940caggagatgt gttacaaggc ttatctagct attcgacagc atgccaatct cttcataaat 3000cttttctcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca 3060tacattcgaa agaccctagc cttagataaa actgagcaag aggctttgga gtatttcatg 3120aaacaaatga atgatgcaca tcatggtggc tggacaacaa aaatggattg gatcttccac 3180acaattaaac agcatgcatt gaactga 3207101068PRTHomo sapiensPEPTIDE(1)..(1068)wild type PIK3CA 10Met Pro Pro Arg Pro Ser Ser Gly Glu Leu Trp Gly Ile His Leu Met 1 5 10 15 Pro Pro Arg Ile Leu Val Glu Cys Leu Leu Pro Asn Gly Met Ile Val 20 25 30 Thr Leu Glu Cys Leu Arg Glu Ala Thr Leu Ile Thr Ile Lys His Glu 35 40 45 Leu Phe Lys Glu Ala Arg Lys Tyr Pro Leu His Gln Leu Leu Gln Asp 50 55 60 Glu Ser Ser Tyr Ile Phe Val Ser Val Thr Gln Glu Ala Glu Arg Glu65 70 75 80 Glu Phe Phe Asp Glu Thr Arg Arg Leu Cys Asp Leu Arg Leu Phe Gln 85 90 95 Pro Phe Leu Lys Val Ile Glu Pro Val Gly Asn Arg Glu Glu Lys Ile 100 105 110 Leu Asn Arg Glu Ile Gly Phe Ala Ile Gly Met Pro Val Cys Glu Phe 115 120 125 Asp Met Val Lys Asp Pro Glu Val Gln Asp Phe Arg Arg Asn Ile Leu 130 135 140 Asn Val Cys Lys Glu Ala Val Asp Leu Arg Asp Leu Asn Ser Pro His145 150 155 160 Ser Arg Ala Met Tyr Val Tyr Pro Pro Asn Val Glu Ser Ser Pro Glu 165 170 175 Leu Pro Lys His Ile Tyr Asn Lys Leu Asp Lys Gly Gln Ile Ile Val 180 185 190 Val Ile Trp Val Ile Val Ser Pro Asn Asn Asp Lys Gln Lys Tyr Thr 195 200 205 Leu Lys Ile Asn His Asp Cys Val Pro Glu Gln Val Ile Ala Glu Ala 210 215 220 Ile Arg Lys Lys Thr Arg Ser Met Leu Leu Ser Ser Glu Gln Leu Lys225 230 235 240 Leu Cys Val Leu Glu Tyr Gln Gly Lys Tyr Ile Leu Lys Val Cys Gly 245 250 255 Cys Asp Glu Tyr Phe Leu Glu Lys Tyr Pro Leu Ser Gln Tyr Lys Tyr 260 265 270 Ile Arg Ser Cys Ile Met Leu Gly Arg Met Pro Asn Leu Met Leu Met 275 280 285 Ala

Lys Glu Ser Leu Tyr Ser Gln Leu Pro Met Asp Cys Phe Thr Met 290 295 300 Pro Ser Tyr Ser Arg Arg Ile Ser Thr Ala Thr Pro Tyr Met Asn Gly305 310 315 320 Glu Thr Ser Thr Lys Ser Leu Trp Val Ile Asn Ser Ala Leu Arg Ile 325 330 335 Lys Ile Leu Cys Ala Thr Tyr Val Asn Val Asn Ile Arg Asp Ile Asp 340 345 350 Lys Ile Tyr Val Arg Thr Gly Ile Tyr His Gly Gly Glu Pro Leu Cys 355 360 365 Asp Asn Val Asn Thr Gln Arg Val Pro Cys Ser Asn Pro Arg Trp Asn 370 375 380 Glu Trp Leu Asn Tyr Asp Ile Tyr Ile Pro Asp Leu Pro Arg Ala Ala385 390 395 400 Arg Leu Cys Leu Ser Ile Cys Ser Val Lys Gly Arg Lys Gly Ala Lys 405 410 415 Glu Glu His Cys Pro Leu Ala Trp Gly Asn Ile Asn Leu Phe Asp Tyr 420 425 430 Thr Asp Thr Leu Val Ser Gly Lys Met Ala Leu Asn Leu Trp Pro Val 435 440 445 Pro His Gly Leu Glu Asp Leu Leu Asn Pro Ile Gly Val Thr Gly Ser 450 455 460 Asn Pro Asn Lys Glu Thr Pro Cys Leu Glu Leu Glu Phe Asp Trp Phe465 470 475 480 Ser Ser Val Val Lys Phe Pro Asp Met Ser Val Ile Glu Glu His Ala 485 490 495 Asn Trp Ser Val Ser Arg Glu Ala Gly Phe Ser Tyr Ser His Ala Gly 500 505 510 Leu Ser Asn Arg Leu Ala Arg Asp Asn Glu Leu Arg Glu Asn Asp Lys 515 520 525 Glu Gln Leu Lys Ala Ile Ser Thr Arg Asp Pro Leu Ser Glu Ile Thr 530 535 540 Glu Gln Glu Lys Asp Phe Leu Trp Ser His Arg His Tyr Cys Val Thr545 550 555 560 Ile Pro Glu Ile Leu Pro Lys Leu Leu Leu Ser Val Lys Trp Asn Ser 565 570 575 Arg Asp Glu Val Ala Gln Met Tyr Cys Leu Val Lys Asp Trp Pro Pro 580 585 590 Ile Lys Pro Glu Gln Ala Met Glu Leu Leu Asp Cys Asn Tyr Pro Asp 595 600 605 Pro Met Val Arg Gly Phe Ala Val Arg Cys Leu Glu Lys Tyr Leu Thr 610 615 620 Asp Asp Lys Leu Ser Gln Tyr Leu Ile Gln Leu Val Gln Val Leu Lys625 630 635 640 Tyr Glu Gln Tyr Leu Asp Asn Leu Leu Val Arg Phe Leu Leu Lys Lys 645 650 655 Ala Leu Thr Asn Gln Arg Ile Gly His Phe Phe Phe Trp His Leu Lys 660 665 670 Ser Glu Met His Asn Lys Thr Val Ser Gln Arg Phe Gly Leu Leu Leu 675 680 685 Glu Ser Tyr Cys Arg Ala Cys Gly Met Tyr Leu Lys His Leu Asn Arg 690 695 700 Gln Val Glu Ala Met Glu Lys Leu Ile Asn Leu Thr Asp Ile Leu Lys705 710 715 720 Gln Glu Lys Lys Asp Glu Thr Gln Lys Val Gln Met Lys Phe Leu Val 725 730 735 Glu Gln Met Arg Arg Pro Asp Phe Met Asp Ala Leu Gln Gly Phe Leu 740 745 750 Ser Pro Leu Asn Pro Ala His Gln Leu Gly Asn Leu Arg Leu Glu Glu 755 760 765 Cys Arg Ile Met Ser Ser Ala Lys Arg Pro Leu Trp Leu Asn Trp Glu 770 775 780 Asn Pro Asp Ile Met Ser Glu Leu Leu Phe Gln Asn Asn Glu Ile Ile785 790 795 800 Phe Lys Asn Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Ile 805 810 815 Ile Arg Ile Met Glu Asn Ile Trp Gln Asn Gln Gly Leu Asp Leu Arg 820 825 830 Met Leu Pro Tyr Gly Cys Leu Ser Ile Gly Asp Cys Val Gly Leu Ile 835 840 845 Glu Val Val Arg Asn Ser His Thr Ile Met Gln Ile Gln Cys Lys Gly 850 855 860 Gly Leu Lys Gly Ala Leu Gln Phe Asn Ser His Thr Leu His Gln Trp865 870 875 880 Leu Lys Asp Lys Asn Lys Gly Glu Ile Tyr Asp Ala Ala Ile Asp Leu 885 890 895 Phe Thr Arg Ser Cys Ala Gly Tyr Cys Val Ala Thr Phe Ile Leu Gly 900 905 910 Ile Gly Asp Arg His Asn Ser Asn Ile Met Val Lys Asp Asp Gly Gln 915 920 925 Leu Phe His Ile Asp Phe Gly His Phe Leu Asp His Lys Lys Lys Lys 930 935 940 Phe Gly Tyr Lys Arg Glu Arg Val Pro Phe Val Leu Thr Gln Asp Phe945 950 955 960 Leu Ile Val Ile Ser Lys Gly Ala Gln Glu Cys Thr Lys Thr Arg Glu 965 970 975 Phe Glu Arg Phe Gln Glu Met Cys Tyr Lys Ala Tyr Leu Ala Ile Arg 980 985 990 Gln His Ala Asn Leu Phe Ile Asn Leu Phe Ser Met Met Leu Gly Ser 995 1000 1005 Gly Met Pro Glu Leu Gln Ser Phe Asp Asp Ile Ala Tyr Ile Arg Lys 1010 1015 1020 Thr Leu Ala Leu Asp Lys Thr Glu Gln Glu Ala Leu Glu Tyr Phe Met1025 1030 1035 1040 Lys Gln Met Asn Asp Ala His His Gly Gly Trp Thr Thr Lys Met Asp 1045 1050 1055 Trp Ile Phe His Thr Ile Lys Gln His Ala Leu Asn 1060 1065 1120DNAArtificial SequenceC1483 sense primer 11taggttacag gcctggatgg 201220DNAArtificial SequenceC1483 antisense primer 12cttggcctcc caaaatgtta 201321DNAArtificial SequenceL2427 sense primer 13tccaggctac ctggtatgag a 211420DNAArtificial SequenceL2427 antisense primer 14gccttccttt caaatccaaa 201536DNAArtificial Sequenceannealing forward primer for pCIG-mTOR mutant- IRES-EGFP 15aattccaatt gcccgggctt aagatcgata cgcgta 361636DNAArtificial Sequenceannealing reverse primer for pCIG-mTOR mutant- IRES-EGFP 16ccggtacgcg tatcgatctt aagcccgggc aattgg 361750DNAArtificial Sequenceforward primer for pCIG-mTOR mutant-IRES-EGFP 17gatcacaatt gtggccacca tggactacaa ggacgacgat gacaagatgc 501841DNAArtificial Sequencereverse primer for pCIG-mTOR mutant-IRES-EGFP 18tgatcaacgc gtttaccaga aagggcacca gccaatatag c 411933DNAArtificial SequenceY1450D sense primer 19tcgtgcagtt tctcatccca ggtagcctgg atc 332033DNAArtificial SequenceY1450D antisense primer 20gatccaggct acctgggatg agaaactgca cga 332123DNAArtificial SequenceC1483R sense primer 21ggcctcgagg cggcgcatgc ggc 232223DNAArtificial SequenceC1483R antisense primer 22gccgcatgcg ccgcctcgag gcc 232333DNAArtificial SequenceL2427Q sense primer 23gtctatgacc ccttgcagaa ctggaggctg atg 332433DNAArtificial SequenceL2427Q antisense primer 24catcagcctc cagttctgca aggggtcata gac 332533DNAArtificial SequenceL2427P sense primer 25gtctatgacc ccttgccgaa ctggaggctg atg 332633DNAArtificial SequenceL2427P antisense primer 26catcagcctc cagttcggca aggggtcata gac 332721DNAArtificial Sequence7280T sense primer 27cccaggcact tgatgatact c 212820DNAArtificial Sequence7280T antisense primer 28cttgctttgg gtggagagtt 202927DNAArtificial SequenceTSC-1 R22W-F primer 29gtcacgtcgt cccacacacc cagcatg 273027DNAArtificial SequenceTSC-1 R22W-R primer 30catgctgggt gtgtgggacg acgtgac 273143DNAArtificial SequenceTSC-1 R204C-F primer 31ctttcatact gtaatgagaa cacaaaaagg agacgaagtt gca 433243DNAArtificial SequenceTSC-1 R204C-R primer 32tgcaacttcg tctccttttt gtgttctcat tacagtatga aag 433333DNAArtificial SequenceTSC-2 V1547I-F primer 33tctccaacat acaggatggc gatcttgtgg gtg 333433DNAArtificial SequenceTSC-2 V1547I-R primer 34cacccacaag atcgccatcc tgtatgttgg aga 333535DNAArtificial SequenceAKT3 R247H-F primer 35caccatagaa acgtgtgtgg tcctcagaga acacc 353635DNAArtificial SequenceAKT3 R247H-R primer 36ggtgttctct gaggaccaca cacgtttcta tggtg 353720DNAArtificial SequenceDNA sequence corresponding to TSC1 targetting sgRNA 37tgctggactc ctccacactg 203820DNAArtificial SequenceDNA sequence corresponding to TSC2 targetting sgRNA 38aatcccaggt gtgcagaagg 20

Claims

1. A method for preventing or treating an intractable epilepsy or a disease causing intractable epilepsy, comprising administering an effective amount of a mTOR inhibitor as an active ingredient. to a subject in need.

2. The method of claim 1, wherein the intractable epilepsy is caused by Focal Cortical Dysplasia (FCD).

3. The method of claim 1, wherein the intractable epilepsy is caused by cerebral somatic mutation-associated with FCD.

4. The method of claim 1, wherein the mTOR inhibitor is selected from the group consisting of AMG954, AZD8055, AZD2014, BEZ235, BGT226, Everolimus, Sirolimus, CC-115, CC-223, LY3023414, P7170, DS-7423, OSI-027, GSK2126458, PF-04691502, PF-05212384, Temsirolimus, INK128, MLN0128, MLN1117, Ridaforolimus, Metformin, XL765, SAR245409, SF1126, VS5584, GDC0980 and GSK2126458, and a pharmaceutically-acceptable salts thereof.

5. The method of claim 1, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin or its salts, Everolimus and its salts, the compounds represented by chemical formulae 1 to 4 and their salts: ##STR00001##

6. The method of claim 3, wherein the cerebral somatic mutation comprises at least one selected from the group consisting of amino acid substitutions of from arginine (R) at position 206 to cysteine (C), from R at position 624 to H, from Y at position 1450 to D, from C at position 1483 to R, from R at position 1709 to H, from T at position 1977 to K, from R at position 2193 to C, from S at position 2215 to F, from L at position 2427 to P, and from L at position 2427 to Q in an amino acid of SEQ ID NO: 2, amino acid substitutions of from arginine (R) at position 22 to tryptophan (W), from R at position 204 to C, and from R at position 811 to L in an amino acid of SEQ ID NO: 4, amino acid substitution of from valine (V) at position 1547 to isoleucine (I) in an amino acid of SEQ ID NO: 6, amino acid substitution of from arginine (R) at position 247 to histidine (H) in an amino acid of SEQ ID NO: 8, and amino acid substitution of from aspartic acid (D) at position 1018 to asparagine (N) in an amino acid of SEQ ID NO: 10.

7. The method of claim 1, wherein the cerebral somatic mutation include at least one selected from the group consisting of nucleotide mutations of from Cytosine (C) at position 616 to Thymine (T), from Guanine (G) at position 1871 to Adenine (A), from Thymine (T) at position 4348 to Guanine (G), from Thymine (T) at position 4447 to Cytosine (C), from Guanine (G) at position 5126 to Adenine (A), from Cytosine (C) at position 5930 to Adenine (A), from Cytosine (C) at position 6577 to Thymine (T), from Cytosine (C) at position 6644 to Thymine (T), from Thymine (T) at position 7280 to Cytosine (C), from Thymine (T) at position 7280 to Adenine (A) in an amino acid of SEQ ID NO: 1, nucleotide mutations of from Cytosine (C) at position 64 to Thymine (T), from Cytosine (C) at position 610 to Thymine (T), and from Guanine (G) at position 2432 to Thymine (T) in an amino acid of SEQ ID NO: 3, nucleotide mutation of from Guanine (G) at position 4639 to Adenine (A) in an amino acid of SEQ ID NO: 5, nucleotide mutation of from Guanine (G) at position 740 to Adenine (A) in an amino acid of SEQ ID NO: 7, and nucleotide mutation of from Guanine (G) at position 3052 to Adenine (A) in an amino acid of SEQ ID NO: 9.

8. The method of claim 1, further comprising a compound selected from the group consisting of a pharmaceutically acceptable diluent, excipient, stabilizing agent, surfactant, gelling agent, pH adjusting agent, anti-oxidant and preservative.

9. The method of claim 3, wherein the cerebral somatic mutation is an amino acid substitution or a nucleotide mutation encoding the amino acid in mTOR, TSC1, TSC2, AKT3, or PIK3CA protein or gene encoding the protein.

10-16. (canceled)

17. A method for diagnosing an intractable epilepsy or a disease causing intractable epilepsy, comprising: (a) treating a sample of a subject with a diagnostic kit comprising an agent detecting at least one amino acid substitution or an agent detecting at least one nucleotide mutation encoding the amino acid substitution; (b) detecting in the sample a biomarker panel comprising at least one amino acid substitution or at least one nucleotide mutation encoding the amino acid substitution, wherein the at least one amino acid substitution, wherein the amino acid substitutions is at least one selected from the group consisting of amino acid substitutions of from arginine (R) at position 206 to cysteine (C), from R at position 624 to H, from Y at position 1450 to D, from C at position 1483 to R, from R at position 1709 to H, from T at position 1977 to K, from R at position 2193 to C, from S at position 2215 to F, from L at position 2427 to P, and from L at position 2427 to Q in an amino acid of SEQ ID NO: 2, amino acid substitutions of from arginine (R) at position 22 to tryptophan (W), from R at position 204 to C, and from R at position 811 to L in an amino acid of SEQ ID NO: 4, amino acid substitution of from valine (V) at position 1547 to isoleucine (I) in an amino acid of SEQ ID NO: 6, amino acid substitution of from arginine (R) at position 247 to histidine (H) in an amino acid of SEQ ID NO: 8, and amino acid substitution of from aspartic acid (D) at position 1018 to asparagine (N) in an amino acid of SEQ ID NO: 10; and (c) determining the onset of intractable epilepsy if the biomarker panel containing one or more of amino acid substitutions is detected.

18. The method of claim 17, wherein the sample is brain tissue.

19. The method of claim 17, wherein the amino acid substitution is selected from the group consisting of an amino acid substitution of from Cytosine (C) at position 616 to Thymine (T) in an amino acid of SEQ ID NO: 2, an amino acid substitution of from arginine (R) at position 22 to tryptophan (W) in an amino acid of SEQ ID NO: 4, an amino acid substitution of from valine (V) at position 1547 to isoleucine (I) in an amino acid of SEQ ID NO: 6, an amino acid substitution of from arginine (R) at position 247 to histidine (H) in an amino acid of SEQ ID NO: 8, and an amino acid substitution of from aspartic acid (D) at position 1018 to asparagine (N) in an amino acid of SEQ ID NO: 10.

20. The method of claim 17, wherein the nucleotide mutation is at least one selected from the group consisting of a nucleotide mutation of Cytosine (C) at position 616 to Thymine (T) in an amino acid of SEQ ID NO: 1, nucleotide mutation of from Cytosine (C) at position 64 to Thymine (T) in an amino acid of SEQ ID NO: 3, nucleotide mutation of from Guanine (G) at position 4639 to Adenine (A) in an amino acid of SEQ ID NO: 5, nucleotide mutation of from Guanine (G) at position 740 to Adenine (A) in an amino acid of SEQ ID NO: 7, and nucleotide mutation of from Guanine (G) at position 3052 to Adenine (A) in an amino acid of SEQ ID NO: 9.

21. The method of claim 17, wherein the agent detecting the nucleotide mutation is a primer, a probe or an antisense nucleic acid that is specific for a mutation region.

22. The method of claim 17, wherein the agent detecting the amino acid substitution is an antibody or an aptamer that is specific for a substitution region.

23. An animal with an intractable epilepsy or a disease causing intractable epilepsy which is induced by a protein or a polynucleotide, wherein the protein is selected from the group consisting of a protein comprising an amino acid substitution of from Cytosine (C) at position 616 to Thymine (T) in an amino acid of SEQ ID NO: 2, an amino acid substitution of from arginine (R) at position 22 to tryptophan (W) in an amino acid of SEQ ID NO: 4, an amino acid substitution of from valine (V) at position 1547 to isoleucine (I) in an amino acid of SEQ ID NO: 6, an amino acid substitution of from arginine (R) at position 247 to histidine (H) in an amino acid of SEQ ID NO: 8, and an amino acid substitution of from aspartic acid (D) at position 1018 to asparagine (N) in an amino acid of SEQ ID NO: 10, or the polynucleotide that is selected from the group consisting of a polynucleotide comprising a nucleotide mutation of Cytosine (C) at position 616 to Thymine (T) in an amino acid of SEQ ID NO: 1, nucleotide mutation of from Cytosine (C) at position 64 to Thymine (T) in an amino acid of SEQ ID NO: 3, nucleotide mutation of from Guanine (G) at position 4639 to Adenine (A) in an amino acid of SEQ ID NO: 5, nucleotide mutation of from Guanine (G) at position 740 to Adenine (A) in an amino acid of SEQ ID NO: 7, and nucleotide mutation of from Guanine (G) at position 3052 to Adenine (A) in an amino acid of SEQ ID NO: 9.

24. (canceled)