Patent application title: METHODS AND COMPOSITIONS FOR TREATING HIV
Inventors:
IPC8 Class: AA61K3530FI
USPC Class:
1 1
Class name:
Publication date: 2018-07-05
Patent application number: 20180185416
Abstract:
The invention features nucleic acid constructs encoding chimeric immune
T-Cell receptors (CIRs) that are useful for treating HIV in patients. In
general, the CIRs contain an extracellular domain which targets HIV or
HIV infected cells (e.g., the extracellular domain of CD4), a
transmembrane domain, and a cytoplasmic domain for mediating T-Cell
activation (e.g. CD3 zeta and/or the partical extracellular domain of
CD28). The invention also features the use of host cells expressing CIRs
in the treatment of HIV.Claims:
1. A nucleic acid construct encoding a chimeric protein comprising (i) an
extracellular domain of CD4, or a fragment thereof, (ii) a transmembrane
domain, and (iii) a cytoplasmic domain comprising a) the cytoplasmic
domain of the CD3 zeta chain, or a fragment thereof and b) the
cytoplasmic domain of CD28, or a fragment thereof.
2. The nucleic acid construct of claim 1, wherein said chimeric protein is capable of forming a homodimer when expressed in a T cell.
3. The nucleic acid construct of claim 2, wherein the dimerized chimeric proteins are capable of forming at least one disulfide bond.
4. The nucleic acid construct of claim 1, wherein said transmembrane domain comprises a polypeptide selected from the group consisting of the transmembrane domain of the CD3 zeta chain and the transmembrane domain of CD28.
5. The nucleic acid construct of claim 4, wherein said transmembrane domain comprises amino acids 7-30 of SEQ 10 NO:3.
6. (canceled)
7. The nucleic acid construct of claim 1, wherein said extracellular domain of CD4 comprises amino acids 1-372 of SEQ 10 NO:1.
8. The nucleic acid construct of claim 1, wherein said cytoplasmic domain of the CD3 zeta chain comprises amino acids 31-142 of SEQ 10 NO:3.
9. The nucleic acid construct of claim 1, wherein said cytoplasmic domain of CD28 comprises amino acids 127-234 of SEQ 10 NO:2.
10. The nucleic acid construct of claim 1, wherein said cytoplasmic domain comprises the amino acid sequence of SEQ ID NO:10.
11. A nucleic acid construct encoding a chimeric protein comprising (i) an extracellular domain of CD4, or a fragment thereof, (ii) a transmembrane domain, and (iii) a cytoplasmic domain of the CD3 zeta chain, or a fragment thereof, wherein said chimeric protein is capable of forming a homodimer when expressed in a T cell.
12. The nucleic acid construct of claim 11, wherein the chimeric protein, when in a homodimer, is capable of forming at least one disulfide bond with the chimeric protein with which it is dimerized.
13. The nucleic acid construct of claim 11, wherein said transmembrane domain comprises the transmembrane domain of the CD3 zeta chain or the transmembrane domain of CD28.
14. The nucleic acid construct of claim 13, wherein said transmembrane domain comprises amino acids 7-30 of SEQ ID NO:3.
15. (canceled)
16. The nucleic acid construct of claim 11, wherein said extracellular domain of CD4 comprises amino acids 1-372 of SEQ ID NO:1.
17. The nucleic acid construct of claim 11, wherein said cytoplasmic domain of the CD3 zeta chain comprises amino acids 31-142 of SEQ ID NO:3.
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. A host cell comprising the nucleic acid construct of claim 1 and a nucleic acid construct encoding an siRNA.
26. The host cell of claim 25, wherein said siRNA is against CCR5.
27. The host cell of claim 25, wherein said siRNA is against Tat/Rev.
28. A method of treating a patient infected with HIV by administering a composition comprising host cell of claim 22.
29. (canceled)
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional Application No. 61/324,050, filed Apr. 14, 2010, which is hereby incorporated by reference.
BACKGROUND OF THE INVENTION
[0003] The invention relates to the field of treating HIV with modified T-cells.
[0004] In 1984, HIV was shown to be the etiologic agent of AIDS. Since that time, the definition of AIDS has been revised a number of times with regard to what criteria should be included in the diagnosis. However, despite the fluctuation in diagnostic parameters, the simple common denominator of AIDS is the infection with HIV and subsequent development of persistent constitutional symptoms and AIDS-defining diseases such as a secondary infections, neoplasms, and neurologic disease.
[0005] HIV is a human retrovirus of the lentivirus group. The four recognized human retroviruses belong to two distinct groups: the human T lymphotropic (or leukemia) retroviruses, HTLV-1 and HTLV-2, and the human immunodeficiency viruses, HIV-1 and HIV-2. The former are transforming viruses whereas the latter are cytopathic viruses.
[0006] HIV-1 has been identified as the most common cause of AIDS throughout the world. Sequence identity between HIV-2 and HIV-1 is about 40%, with HIV-2 being more closely related to some members of a group of simian immunodeficiency viruses (SIV).
[0007] The main cause of the immune defect in AIDS has been identified as a quantitative and qualitative deficiency in the subset of thymus-derived (T) lymphocytes, the T4 population. This subset of cells is defined phenotypically by the presence of the CD4 surface molecule, which has been demonstrated to be the cellular receptor for HIV. Although the T4 cell is the major cell type infected with HIV, essentially any human cell that expresses the CD4 molecule on its surface is capable of binding to and being infected with HIV.
[0008] Previous attempts to treat patients with "designer" T-cells expressing chimeric immune receptors (CIRs) proved unsuccessful. There exists a need in the art for new therapies for HIV. The present invention addresses this issue and offers advantages over previous attempted therapies.
SUMMARY OF THE INVENTION
[0009] In one aspect, the invention features a nucleic acid construct encoding a chimeric protein that includes (i) an extracellular domain of CD4 (e.g., amino acids 1-372 of SEQ ID NO:1) or a fragment thereof, (ii) a transmembrane domain, and (iii) a cytoplasmic domain that includes the cytoplasmic domain of the CD3 zeta chain (e.g., a polypeptide having the amino acids 31-142 of SEQ ID NO:3), or a fragment thereof, and the cytoplasmic domain of CD28 (e.g., a polypeptide having amino acids 127-234 of SEQ ID NO:2), or a fragment thereof. In one embodiment, the cytoplasmic domain has the amino acid sequence of SEQ ID NO:10.
[0010] In another aspect, the invention features a nucleic acid construct encoding a chimeric protein that includes (i) an extracellular domain of CD4 (e.g., a polypeptide having amino acids 1-372 of SEQ ID NO:1) or a fragment thereof, (ii) a transmembrane domain, and (iii) a cytoplasmic domain of the CD3 zeta chain (e.g., a polypeptide having the amino acids 31-142 of SEQ ID NO:3), or a fragment thereof.
[0011] In either of the foregoing aspects, the chimeric protein can be capable of forming a homodimer when expressed in a T-cell, e.g., through the formation of a disulfide bond.
[0012] Also in either of the foregoing aspects, the transmembrane domain can be the transmembrane domain of the CD3 zeta chain (e.g, a polypeptide having amino acids 7-30 of SEQ ID NO:3) or the transmembrane/partial extracellular domain of CD28.
[0013] Also in either of the foregoing aspects, the chimeric protein can include a c-myc tag (e.g., at the N-terminus).
[0014] In another aspect, the invention features a vector including any of the nucleic acid constructs described above. This vector can also include a nucleic acid construct encoding an siRNA (e.g., against CCR5 or against Tat/Rev).
[0015] In yet another aspect, the invention features a host cell (e.g., a T-cell derived from an uninfected patient or T-cell derived from a patient infected with HIV) containing any of the above nucleic acid constructs or vectors. This host cell can also include a nucleic acid construct encoding an siRNA (e.g., against CCR5 or against Tat/Rev).
[0016] In another aspect, the invention features a method of treating a patient infected with HIV (e.g., HIV-1 or HIV-2) by administering a composition including any of the foregoing host cells. In this aspect, the host cell can be isolated from the patient being treated or from another patient.
[0017] By "specifically binds" is meant an extracellular domain which recognizes and binds an HIV protein, but that does not substantially recognize and bind other molecules in a sample, e.g., a human blood sample.
[0018] By "treating" is meant ameliorating a condition or symptom(s) of the condition (e.g., the symptoms of HIV infection). To "treat HIV" or refers to administering a treatment to a subject infected with HIV to improve the subject's condition. As compared with an equivalent untreated control, such amelioration or degree of treatment is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%, as measured by the subject's HIV viral load.
[0019] By "vector" is meant a DNA molecule, usually derived from a plasmid or bacteriophage, into which fragments of DNA may be inserted or cloned. A recombinant vector will contain one or more unique restriction sites, and may be capable of autonomous replication in a defined host or vehicle organism such that the cloned sequence is reproducible. A vector contains a promoter operably-linked to a gene or coding region such that, upon transfection into a recipient cell, an RNA or an encoded protein or is expressed.
[0020] By "host T-cell" is meant a cell (e.g., a human T-cell isolated from a subject) into which one or more nucleic acid constructs is introduced.
[0021] By "chimeric immune T-cell receptor" or "CIR" is meant a fusion protein which, when expressed in a host T cell, contains an extracellular domain that specifically binds to a target protein and a cytoplasmic domain that modulates activation of the host T-cell.
[0022] By "CD4 extracellular domain" is meant a polypeptide having the N-terminal region of CD4 that is located outside the cell membrane when expressed in a T-cell, e.g., a polypeptide having the amino acid sequence of amino acids 1-372 of SEQ ID NO:1. The term "CD4 extracellular domain" is also meant to include any polypeptide fragment that binds specifically to gp120 and is substantially identical to amino acids 1-372 of SEQ ID NO:1 over the length of the polypeptide fragment.
TABLE-US-00001 Human CD4 Amino Acid sequence SEQ ID NO: 1 LOCUS NP_000607 458 aa linear PRI 18-MAR-2010 DEFINITION T-cell surface glycoprotein CD4 precursor [Homo sapiens]. ACCESSION NP_000607 VERSION NP_000607.1 GI: 10835167 DBSOURCE REFSEQ: accession NM_000616.3 1 MNRGVPFRHL LLVLQLALLP AATQGKKVVL GKKGDTVELT CTASQKKSIQ FHWKNSNQIK 61 ILGNQGSFLT KGPSKLNDRA DSRRSLWDQG NFPLIIKNLK IEDSDTYICE VEDQKEEVQL 121 LVFGLTANSD THLLQGQSLT LTLESPPGSS PSVQCRSPRG KNIQGGKTLS VSQLELQDSG 181 TWTCTVLQNQ KKVEFKIDIV VLAFQKASSI VYKKEGEQVE FSFPLAFTVE KLTGSGELWW 241 QAERASSSKS WITFDLKNKE VSVKRVTQDP KLQMGKKLPL HLTLPQALPQ YAGSGNLTLA 301 LEAKTGKLHQ EVNLVVMRAT QLQKNLTCEV WGPTSPKLML SLKLENKEAK VSKREKAVWV 361 LNPEAGMWQC LLSDSGQVLL ESNIKVLPTW STPVQPMALI VLGGVAGLLL FIGLGIFFCV 421 RCRHRRRQAE RMSQIKRLLS EKKTCQCPHR FQKTCSPI
[0023] By "CD28 cytoplasmic domain" is meant a polypeptide having the C-terminal region of CD28 that is located in the cytoplasm when expressed in a T-cell, e.g., a polypeptide having the amino acid sequence of amino acids 127-234 of SEQ ID NO:2. The term "CD28 cytoplasmic domain" is also meant to include any polypeptide fragment that maintains the ability to modulate activation of T-cells (e.g., as determined using the method titled "killing of HIV infected cells by modified T-cells" below) and is substantially identical to amino acids 127-234 of SEQ ID NO:2 over the length of the polypeptide fragment.
TABLE-US-00002 Human CD28 Amino Acid sequence: SEQ ID NO: 2 LOCUS NP_006130 220 aa linear PRI 11-APR-2010 DEFINITION T-cell-specific surface glycoprotein CD28 precursor [Homo sapiens]. ACCESSION NP_006130 VERSION NP_006130.1 GI: 5453611 DBSOURCE REFSEQ: accession NM_006139.2 1 MLRLLLALNL FPSIQVTGNK ILVKQSPMLV AYDNAVNLSC KYSYNLFSRE FRASLHKGLD 61 SAVEVCVVYG NYSQQLQVYS KTGFNCDGKL GNESVTFYLQ NLYVNQTDIY FCKIEVMYPP 21 PYLDNEKSNG TIIHVKGKHL CPSPLFPGPS KPFWVLVVVG GVLACYSLLV TVAFIIFWVR 181 SKRSRLLHSD YMNMTPRRPG PTRKHYQPYA PPRDFAAYRS
[0024] By "CD3 zeta" is meant a polypeptide having the amino acid sequence of SEQ ID NO:3. The term "CD3 zeta" is also meant to include any polypeptide fragment that maintains the ability to modulate activation of T-cells (e.g., as determined using the method titled "killing of HIV infected cells by modified T-cells" below) and is substantially identical to SEQ ID NO:3 over the length of the protein fragment.
TABLE-US-00003 Human CD3 zeta Amino Acid sequence SEQ ID NO: 3 LOCUS NP_000725 163 aa linear PRI 11-APR-2010 DEFINITION T-cell receptor zeta chain isoform 2 precursor [Homo sapiens]. ACCESSION NP_000725 VERSION NP_000725.1 GI: 4557431 DBSOURCE REFSEQ: accession NM_000734.3 1 MKWKALFTAA ILQAQLPITE AQSFGLLDPK LCYLLDGILF IYGVILTALF LRVKFSRSAD 61 APAYQQGQNQ LYNELNLGRR EEYDVLDKRR GRDPEMGGKP RRKNPQEGLY NELQKDKMAE 121 AYSEIGMKGE RRRGKGHDGL YQGLSTATKD TYDALHMQAL PPR
[0025] By "small interfering RNA" or "siRNA" is meant an isolated RNA molecule, either single-stranded or double stranded that is at least 15 nucleotides, preferably, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length and even up to 50 or 100 nucleotides in length (inclusive of all integers in between). Preferably, the siRNA is capable of mediating RNAi. As used herein the phrase "mediates RNAi" refers to (indicates) the ability to distinguish which RNAs are to be degraded by the RNAi machinery or process. siRNAs are processed from long dsRNAs and are usually double-stranded (e.g., endogenous siRNAs). siRNAs can also include short hairpin RNAs in which both strands of an siRNA duplex are included within a single RNA molecule. These terms include double-stranded RNA, single-stranded RNA, isolated RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.
[0026] By "substantially identical" is meant a nucleic acid or amino acid sequence that, when optimally aligned, for example using the methods described below, share at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with a second nucleic acid or amino acid sequence. "Substantial identity" may be used to refer to various types and lengths of sequence, such as full-length sequence, epitopes or immunogenic peptides, functional domains, coding and/or regulatory sequences, exons, introns, promoters, and genomic sequences. Percent identity between two polypeptides or nucleic acid sequences is determined in various ways that are within the skill in the art, for instance, using publicly available computer software such as Smith Waterman Alignment (Smith and Waterman (1981) J Mol Biol 147:195-7); "BestFit" (Smith and Waterman, Advances in Applied Mathematics, (1981) 482-489) as incorporated into GeneMatcher Plus.TM., Schwarz and Dayhof, Atlas of Protein Sequence and Structure, Dayhof, M.O., Ed (1979) 353-358; BLAST program (Basic Local Alignment Search Tool; (Altschul et al. (1990) J Mol Biol 215: 403-10), BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, or Megalign (DNASTAR) software. In addition, those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In general, for proteins or nucleic acids, the length of comparison can be any length, up to and including full length (e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%). Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
[0027] Other features and advantages of the invention will be apparent from the following Detailed Description, the drawings, and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 is a diagram showing the structure of the indicated chimeric immune T-cell receptors (CIRs).
[0029] FIG. 2 is a diagram showing the organization of an exemplary nucleic acid construct encoding a 2.sup.nd generation CIR and siRNA construct.
[0030] FIG. 3 is a series of graphs showing the cellular surface expression of the indicated CIR. PBMCs were transduced with retrovirus and stained with anti-CD4-FITC and anti-CD8-APC antibodies after four days and analyzed by flow cytometry. % CD8+ cells expressing Hege CIR is 52%, 1.sup.st generation CIR is 44%, and 2.sup.nd generation CIR is 39%. A representative experiment of four is shown.
[0031] FIG. 4A is a pair of graphs showing survival of the indicated cell type when incubated with HIV-infected CEM-SS cells at the indicated ratio. Transduced PBMCs were co-cultured with HIV-infected CEM-SS cells or uninfected CEM-SS cells at an Effector to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells were taken from the cultures at day three and stained with anti-CD4 and anti-CD8 antibodies as described above. Data shown is % modified cells (CD8+CIR+) at each time point. A representative of two experiments is shown.
[0032] FIG. 4B is a pair of graphs showing flow cytometry analysis from day three for Hege CIR cells. Hege CIR T-cells disappear (Hege+HIV, upper right quadrant) when cultured at an E:T ratio of 1:10. % Modifed cells=(Q2/Q2+Q4) is shown in each plot. (Q2 is upper right quadrant and Q4 is lower right quadrant.)
[0033] FIG. 5 is a graph showing survival of Hege CIR cells when incubated with HIV-infected CEM-SS cells at the indicated ratio in the presence and absence of AZT. Transduced PBMCs were co-cultured with HIV-infected CEM-SS cells or uninfected CEM-SS cells at an Effector to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells were taken from the cultures at day three and stained with anti-CD4 and anti-CD8 antibodies as described for FIG. 3. Data shown is % modified cells (CD8+CIR+ cells) from one experiment.
[0034] FIG. 6 is a series of graphs showing expression of the indicated markers on the indicated cells when exposed to HIV. Non-transduced or 1.sup.st and 2.sup.nd generation CIR transduced T-cells were co-cultured with HIV infected CEM-SS cells for two days and stained with anti-CD8 and anti-p24gag antibodies. An aliquot of unstained cells were washed and continued to culture for another nine days and stained with anti-CD8 and anti-p24gag antibodies. A representative of two experiments is shown. At day two, infected CD8+ cells show as a distinct population (circled) in the 1.sup.st and 2.sup.nd generation T-cells compared to non-transduced cells. There is no distinct population of cells seen in non-Td CD8+ cells (day two, upper right quadrant). % modified cells for this experiment is: 1.sup.st generation=67% and 2.sup.nd generation=68%.
[0035] FIG. 7 is a graph showing the percent of specific killing as a function of the ratio of Effector to Target cells. Hege CIR, 1.sup.st, and 2.sup.nd generation T-cells were cultured with .sup.51Cr labeled uninfected or chronically infected with HIV-1 IIIB CEM-SS cells. Cytotoxicity is determined from .sup.51Cr release to the culture media after 18 hrs of co-culture at the indicated ratios of Effector to Target, and % specific killing is calculated as follows: (experimental-control)/(maximal-control).times.100. % modified cells for Hege is 47%, for 1.sup.St generation is 25%, and for 2.sup.nd generation is 47%. Data shown is representative of two experiments. This is calculated by taking mean value of CEM-SS control as spontaneous release=(Expt-control)/(Max-control).
[0036] FIG. 8 is a pair of graphs showing the amount of secretion of the indicated cytokine in the indicate cells types. 1.sup.st and 2.sup.nd generation T-cells were assayed for IL2 or interferon gamma (IFN.gamma.) secretion by culturing for 24 hrs on anti-CD4 (5 .mu.g/ml) coated plates. Data represented as fold change over 1.sup.st generation. IL2 data shown is average.+-.SEM of three experiments. IFN-.gamma. data shown is average.+-.SEM of two experiments. % modified cells are similar for 1.sup.st and 2.sup.nd generation T-cells.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The invention features nucleic acid constructs encoding chimeric immune T-cell receptors (CIRs) that are useful for treating HIV in patients. In general, the CIRs contain an extracellular domain which targets HIV or HIV-infected cells (e.g., the extracellular domain of CD4), a transmembrane domain, and a cytoplasmic domain for mediating T-cell activation (e.g., CD3 zeta and/or the partial extracellular domain of CD28). The invention also features the use of host cells expressing CIRs in the treatment of HIV. When expressed in the host cells, the CIRs can be engineered to homodimerize, thereby increasing their potency. These host cells can also contain nucleic acid constructs encoding siRNA against HIV genes in order to, e.g., disrupt HIV infection of the host T-cells. The structure of a prior art CIR and the structures of CIRs containing the transmembrane domain of CD3 zeta and partially extracellular domain of CD28 are depicted in FIG. 1.
Extracellular Domains
[0038] The CIRs of the invention feature an extracellular domain able to specifically bind HIV and cells infected with HIV. The HIV protein gp120 binds human CD4. Therefore, the extracellular domain of the CIRs of the invention can include the extracellular domain of CD4 (e.g., human CD4 or fragments thereof). Alternatively, the extracellular domain can include any binding moiety specific for HIV and cells infected with HIV, including, HIV specific antibodies (e.g., single-chain Fv antibody fragments that are specific to gp120 or gp41).
[0039] The extracellular domain can optionally include a further protein tag, e.g., a c-myc tag (EQKLISEEDL (SEQ ID NO:4) of human origin, at the N-terminus. The c-myc tag does not obstruct CD4 binding to gp120. Inclusion of c-myc in the sFv based-CIR design does not appear to affect CIR function, but can facilitate future study of the construct.
Cytoplasmic Domains
[0040] The CIRs of the invention also feature a cytoplasmic domain for signaling modulating activation of the host T-cells when bound to HIV or HIV-infected cells. Cytoplasmic domains useful for use in the CIRs of the invention include CD3 zeta, or fragments thereof, and for the cytoplasmic domain of CD28, or fragments thereof. The invention also features the fusion of polypeptides derived from multiple extracellular domains for potentiating activation of T-cells when bound to HIV or HIV-infected cells (e.g., a cytoplasmic domain that includes both active fragments of CD3 zeta and CD28).
Transmembrane Domains
[0041] The CIRs of the invention feature transmembrane domains derived from CD4, CD28, CD3 zeta, or another protein. Furthermore, the transmembrane domain (or the partial extracellular domains, "pEC") can be engineered to facilitate homodimerization of the CIRs when expressed in host T-cells. This can be accomplished, e.g., with the addition or substitution of cysteine residues capable of forming disulfide bonds with a paired molecule.
[0042] The inclusion of the transmembrane region of the zeta chain or the transmembrane and partial extracellular domain of CD28 provides the capability of intermolecular disulfide bonds. CIRs containing these transmembrane/partial extracellular domains are predicted to form disulfide-linked dimers through a cysteine residue located in the transmembrane of zeta or in the proximal cysteine residue located in the partial extracellular domain of CD28 (position 123 of CD28), mimicking the dimer configuration of native zeta and CD28.
siRNA Constructs
[0043] The DNA constructs and host cells of the invention also optionally feature components to suppress HIV infection of host T-cells. Such components include siRNA constructs for suppression of HIV replication. These siRNA constructs can be specific for various HIV targets (reviewed in Morris (2006) Gene Ther 13:553-558; Rossi (2006) Biotechniques Supp1:25-29; Nekhai (2006) Curr Opin Mol Ther 8:52-61; and Cullen (2005) AIDS Rev 7:22-25). One example is an siRNA targeting a highly conserved sequence in an exon common to both tat and rev, has been shown to be effective to prevent virus expression and replication (See, e.g., SEQ ID No. 1). In order to prevent HIV infection of host T-cells, the invention also features components to decrease expression of T cell coreceptors (e.g., CCR5 and CCR4). Such suppression would be expected to hinder infection of host T-cells as people with CCR5.DELTA.32 mutation are resistant to HIV infection. The invention also features the inclusion of multiple siRNA constructs (e.g., constructs against HIV genes and T-cell receptors used for HIV infection). Here, one siRNA construct can block infection and while a second siRNA construct prevents progression of infection.
[0044] Methods of designing and expressing siRNA constructs are well known in the art. For example, the siRNA constructs of the invention can utilize long-hairpin RNA (IhRNA) to express both CCR5 and Tat/Rev siRNAs. Use of a IhRNA is a viable approach in controlling HIV-1 replication since a single long transcript can in theory be processed into multiple siRNAs. Multiple targeting can be achieved from a single long-hairpin precursor, suggesting that multiple siRNAs can be processed from the long hairpins in vivo. The siRNA constructs of the invention can also include a promoter directing expression in host T-cells. Examples of such promoters are U6 and tRNA promoters. Expressing shRNAs from tRNA promoters has several advantages, compared to the more commonly used U6 and H1 promoters: tRNA promoters are smaller, provide a variety of options, and are typically expressed at lower levels. Smaller promoters may be desirable in the nucleic acid constructs of the invention to facilitate inclusion in a vector including a CIR expression construct. An example of a nucleic acid construct containing a CIR and siRNA is set forth in FIG. 2.
TABLE-US-00004 shRNA sequences SEQ ID NO: 5 tat/rev shRNA-sense strand 5'-GCGGAGACAGCGACGAAGAGC-3' Ref: Scherer, L. J., R. Frank, and J. J. Rossi. 2007. Nucleic Acids Res 35: 2620-2628. ccr5 shRNA-sense strand SEQ ID NO: 6 5'-GCCUGGGAGAGCUGGGGAA-3' Ref: Ehsani, Mol Titer Epub ahead of print. shRNA within CIR (SEQ ID NO: 7) -Myc-CD4-CD28-zeta-tcaggtggtggcggttcaggcggaggtggetctggcggtggcggatcg Generic linker (G4S)3 GCCCGGATAGCTCAGTcGGTAGAGCACAGACTTTAATCTGAGGGTCCAGGGTCAAGTCCCTGTTCGGGC GCCA tRNA promoter GCCTGGGAGAGCTGGGGAATTTGTACGTAGTTCCCCAGCTCTCCCAGGC ccr5 shRNA sense shRNA loop ccr5 shRNA antisense ggtggcagtggctccggaggttcaggaagcggcggtagtgggagc generic linker (GGSGS)3 GCGGAGACAGCGACGAAGAGCCTTCCTGTCAGAGCGGAGACAGCGACGAAGAGCTTTTTGAA tat/rev shRNA sense shRNA loop tat/rev shRNA antisense terminator sequence
Nucleic Acid Constructs
[0045] The nucleic acid constructs of the invention are useful for expressing CIRs and siRNA constructs in host T-cells. CIRs and siRNA constructs can be included in a single nucleic acid construct or multiple nucleic acid constructs. In order to facilitate transfection of host cells, the nucleic acid construct can be included in a viral vector (e.g., a retroviral vector or adenoviral vector) or be designed to be transfected into a host cell via electroporation or chemical means (e.g., using a lipid transfection reagent).
[0046] Examples of Nucleic Acid Constructs
TABLE-US-00005 Myc-CD4-zeta (1.sup.st generation (dimer)) SEQ ID NO: 8 ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline) ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4 TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGA AAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTG AGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGC GGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTG ACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGG TCCACCCCGGTGCCTAGGCTGGATCCCAAACTCTGCTACCTGCTGGATGG zeta (Underline) AATCCTCTTCATCTATGGTGTCATTCTCACTGCCTTGTTCCTGAGAGTGA AGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAG CTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGA CAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGA ACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAG GCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCA CGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACG CC Myc-CD4-CD28-zeta (2.sup.nd generation) SEQ ID NO: 9 ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline) ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4 TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAG AAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGC TGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAG GCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAG TGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACAT GGTCCACCCCGGTGCCTAGGAAAATTGAAGTTATGTATCCTCCTCCTTAC CD28 (underline) CTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACA CCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGC TGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTG GCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAG TGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATT ACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTG zeta AAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCA GCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAG AACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGA GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGC ACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGAC GCC
[0047] The amino acid sequence for the CD28 and CD3 zeta portions of the 2.sup.nd generation construct is
TABLE-US-00006 (SEQ ID NO: 10) K I E V Met Y P P P Y L D N E K S N G T I I H V K G K H L C P S P L F P G P S K PF W V L V V V G G V L A C Y S L L V T V A F I I F W V R S K R S R L L H S D Y Met N Met T P R R P G P T R K H Y Q P Y A P P R D F A A Y R S R V K F S R S A D AP A Y Q Q G Q N Q L Y N E L N L G R R E E Y D V L D K R R G R D P E Met G G KP R R K N P Q E G L Y N E L Q K D K Met A E A Y S E I G Met K G E R R R G K GH D G L Y Q G L S T A T K D T Y D A
Host T-Cells
[0048] The host T-cells of the invention can be isolated from, e.g., a patient infected with HIV. The host T-cells are transfected or infected with nucleic acid constructs of the invention (e.g., nucleic acid constructs encoding a CIR and, optionally, one or more siRNA constructs). Prior to administration to a patient the T-cells can be expanded in cell culture. In one embodiment, the modified T-cells are administered to the patient from whom they were originally isolated.
[0049] In one embodiment, PBMCs are isolated by standard techniques and transduced with a CIR. Cells are administered to the patient in a dose of between 10.sup.9 and 10.sup.10 cells (e.g., 10.sup.9, 5.times.10.sup.9, or 10.sup.10 cells). Cells can be isolated once and expanded for multiple administrations or a separate isolation and transduction can be performed with each round of treatment.
[0050] Treatment can be, e.g., a single treatment, monthly treatment, semi-annual treatment, or annual treatment.
Additional Agents
[0051] Additional antiviral can be, for example, a protease inhibitor, a reverse transcriptase inhibitor, an integrase inhibitor, a CCR5 antagonist, a fusion inhibitor, or a second maturation inhibitor. The additional antiviral agent can be, without limitation, azidovudine (AZT), didanosine (dideoxyinosine, ddI), d4T, zalcitabine (dideoxycytosine, ddC), nevirapine, lamivudine (epivir, 3TC), saquinavir (Invirase), ritonavir (Norvir), indinavir (Crixivan), and delavirdine (Rescriptor).
Additional Therapies
[0052] The methods of the invention can be combined with, e.g., lymphodepletion prior to administration of host T-cells. Furthermore, treatment can also include the administration of one or more cytokines, e.g., IL-2, IL-7, and IL-15.
Experimental Results
[0053] Construction of Retroviral Vectors
[0054] The chimeric immune T-cell receptor (CIR) of the prior anti-HIV designer T cell trials had the structure of extracellular domain of CD4 (a polypeptide corresponding to amino acids 1-372 of SEQ ID NO:1), transmembrane domain of CD4 (a polypeptide corresponding to amino acids 373-395 of SEQ ID NO:1) and cytoplasmic domain of zeta (a polypeptide corresponding to amino acids 31-142 of SEQ ID NO:3) (Deeks et al. (2002) Mol Ther 5:788-797, Mitsuyasu et al. (2000) Blood 96:785-793) (herein "Hege CIR", FIG. 1). We also designed a signal one-only CIR that is similar to the Hege CIR except that the transmembrane domain of zeta (a polypeptide corresponding to amino acids residues 7-30 of SEQ ID NO:3) was substituted (1.sup.st generation CIR, FIG. 1). Lastly, we created a construct that integrates CD28 as well as zeta signaling in a two signal format (2.sup.nd generation CIR, FIG. 1). This employs the same extracellular domain of CD4 (a polypeptide corresponding to amino acids 1-372 of SEQ ID NO:1) with a partial extracellular doman/transmembrane domain/cytoplasmic domain of CD28 (a polypeptide corresponding to amino acids 127-234 of SEQ ID NO:2) and is expressed as dimer.
[0055] In addition, a c-myc tag (EQKLISEEDL) of human origin is also included in our constructs at the N-terminus of CD4.
[0056] 1.sup.st and 2.sup.nd generation CIRs were constructed in the MFG retrovirus vector. Retrovirus was created by ping pong between the E+86 ecotropic and PG13 amphotropic cell lines. PG13 is a helper cell line derived from murine fibroblasts that is used to create vector producer cells (VPC) for retroviral production. VPCs were sorted for the highest transgene expression and viral supernatants were harvested as described Beaudoin et al. ((2008) J Virol Methods 148:253-259).
[0057] Expression of CIRs
[0058] Viral supernatants from PG13 VPCs were used to transduce human PBMCs. PBMCs from normal healthy individuals were purified and activated with anti-CD3 antibody (OKT3) and 100 U/ml IL2 for two days and transduced with retrovirus by spinoculation on a retronectin coated plate. We determined the surface expression of CIRs on CD8+ T-cells by double staining for CD8 and CD4 and determined the transduction rate (as % modified cells, FIG. 3). Transduction of activated human T-cells routinely yield 40 to 70% transduction rates with these anti-HIV CIRs.
[0059] We co-cultured transduced or non-transduced T-cells with CEM-SS HIV+(chronically infected with HIV-1 IIIB) or HIV- cells (at an E:T ratio of 1:1 or 1:10). We determined the presence of transduced cells in the culture by staining with anti-CD4 and anti-CD8 antibodies. Co-culture of Hege CIR T-cells with CEM-SS HIV+ cells at an E:T ratio of 1:10 induced cell death and all the Hege CIR cells disappeared from the culture by day 3 (FIG. 4). At an E:T ratio of 1:1, Hege CIR T cells were still present in the culture at day 13, with killing of all target cells in the culture (observed by flow cytometry analysis). Cell death observed in the Hege CIR designer T-cells could be either due to heightened sensitivity to Activation Induced Cell Death (AICD) or to HIV infection. To test this, Hege CIR cells were treated with anti-retroviral drug AZT and co-cultured with HIV infected CEM-SS cells. AZT treated Hege CIR cells did not die when co-cultured with higher target ratio (1:10, FIG. 5). These data suggest that Hege CIR cells become infected with HIV and die by either HIV induced apoptosis or killed by other CIR containing T-cells (fratricide). These data suggest and we hypothesize that one of the reasons for the failure of Hege CIR in the clinical trials could be due to highest susceptibility to HIV infection and elimination from the patients.
[0060] Susceptibility of Designer T-Cells to HIV Infection
[0061] HIV infects CD4+ T-cells by binding to CD4 receptor and a co-receptor (CXCR4 or CCR5). Since CIR has an extracellular CD4 domain, we postulated that this could be used by HIV to infect all CIR+ T-cells, including CD8+ T-cells. HIV infection of CIR+CD8+ cells was determined by co-culturing CIR containing T-cells with HIV+ CEM-SS cells and staining for p24-gag antigen, an indicator of productive infection. After two days of culture, cells were stained with anti-CD8 and anti-p24 gag antibodies. In contrast to non-transduced cultures, CD8+ cells are infected with HIV in transduced cultures (1.sup.st and 2.sup.nd generation) (FIG. 6). At day 11 we did not detect any HIV infected CD8+ cells in either 1.sup.4 or 2.sup.nd generation CIR containing T-cells (FIG. 6).
[0062] Killing of HIV-Infected Cells by Modified T-Cells.
[0063] In order to compare the potencies of Hege CIR, 1.sup.st, and 2.sup.nd generation anti-HIV CIR in killing of target cells, activated T-cells were transduced as described above. Target cells (HIV-infected or uninfected CEM-SS cells) were labeled with .sup.51Cr for 5 hrs (50 .mu.Ci for 1.times.10.sup.6 cells) and co-cultured with transduced T-cells at indicated E:T ratios for 18 hrs. Hege CIR T-cells and our 1.sup.st and 2.sup.nd generation designer T-cells were all equally potent in killing HIV+ target cells (FIG. 7).
[0064] Cytokine Secretion by Modified T-Cells.
[0065] Human T-cells transduced with 1.sup.st and 2.sup.nd generation CIR containing T-cells were tested for their ability to secrete cytokines upon stimulation through the CIR. Transduced or non-transduced T-cells were cultured on anti-CD4 antibody coated plates for 24 hrs. IL2 secretion was measured with an ELISA kit. 2.sup.nd generation T-cells produced more IL2 than 1.sup.st generation T-cells when stimulated with anti-CD4 antibody (FIG. 8). In contrast, IFN.gamma. secretion is similar with anti-CD4 stimulation of 1.sup.st and 2.sup.nd generation designer T-cells, as is typical for T cell signaling.
[0066] Conferring Resistance of Designer T-Cells to HIV Infection
[0067] HIV infects CD4+ T-cells by binding to CD4 receptor and a co-receptor (CXCR4 or CCR5). As shown above, CD8+CIR+ cells (1.sup.st and 2.sup.nd generation) are susceptible to HIV infection (day two, FIG. 6). At day 11 we did not detect any HIV infected CD8+ cells in either 1.sup.st or 2.sup.nd generation T-cells (FIG. 6). These data suggest that modified T-cells could kill other HIV infected modified T-cells. Nevertheless, this is a potential source of loss of effector cells to combat HIV and provides a new reservoir to increase patient HIV load. It is therefore becomes important to eliminate or reduce the potential for HIV to infect modified T-cells.
Other Embodiments
[0068] Various modifications and variations of the described methods and compositions of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific desired embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the fields of medicine, immunology, pharmacology, endocrinology, or related fields are intended to be within the scope of the invention.
[0069] All publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication was specifically and individually incorporated by reference.
Sequence CWU
1
1
121458PRTHomo sapiens 1Met Asn Arg Gly Val Pro Phe Arg His Leu Leu Leu Val
Leu Gln Leu 1 5 10 15
Ala Leu Leu Pro Ala Ala Thr Gln Gly Lys Lys Val Val Leu Gly Lys
20 25 30 Lys Gly Asp Thr
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser 35
40 45 Ile Gln Phe His Trp Lys Asn Ser Asn
Gln Ile Lys Ile Leu Gly Asn 50 55
60 Gln Gly Ser Phe Leu Thr Lys Gly Pro Ser Lys Leu Asn
Asp Arg Ala 65 70 75
80 Asp Ser Arg Arg Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile
85 90 95 Lys Asn Leu Lys
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu 100
105 110 Asp Gln Lys Glu Glu Val Gln Leu Leu
Val Phe Gly Leu Thr Ala Asn 115 120
125 Ser Asp Thr His Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr
Leu Glu 130 135 140
Ser Pro Pro Gly Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly 145
150 155 160 Lys Asn Ile Gln Gly
Gly Lys Thr Leu Ser Val Ser Gln Leu Glu Leu 165
170 175 Gln Asp Ser Gly Thr Trp Thr Cys Thr Val
Leu Gln Asn Gln Lys Lys 180 185
190 Val Glu Phe Lys Ile Asp Ile Val Val Leu Ala Phe Gln Lys Ala
Ser 195 200 205 Ser
Ile Val Tyr Lys Lys Glu Gly Glu Gln Val Glu Phe Ser Phe Pro 210
215 220 Leu Ala Phe Thr Val Glu
Lys Leu Thr Gly Ser Gly Glu Leu Trp Trp 225 230
235 240 Gln Ala Glu Arg Ala Ser Ser Ser Lys Ser Trp
Ile Thr Phe Asp Leu 245 250
255 Lys Asn Lys Glu Val Ser Val Lys Arg Val Thr Gln Asp Pro Lys Leu
260 265 270 Gln Met
Gly Lys Lys Leu Pro Leu His Leu Thr Leu Pro Gln Ala Leu 275
280 285 Pro Gln Tyr Ala Gly Ser Gly
Asn Leu Thr Leu Ala Leu Glu Ala Lys 290 295
300 Thr Gly Lys Leu His Gln Glu Val Asn Leu Val Val
Met Arg Ala Thr 305 310 315
320 Gln Leu Gln Lys Asn Leu Thr Cys Glu Val Trp Gly Pro Thr Ser Pro
325 330 335 Lys Leu Met
Leu Ser Leu Lys Leu Glu Asn Lys Glu Ala Lys Val Ser 340
345 350 Lys Arg Glu Lys Ala Val Trp Val
Leu Asn Pro Glu Ala Gly Met Trp 355 360
365 Gln Cys Leu Leu Ser Asp Ser Gly Gln Val Leu Leu Glu
Ser Asn Ile 370 375 380
Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu Ile 385
390 395 400 Val Leu Gly Gly
Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile 405
410 415 Phe Phe Cys Val Arg Cys Arg His Arg
Arg Arg Gln Ala Glu Arg Met 420 425
430 Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln
Cys Pro 435 440 445
His Arg Phe Gln Lys Thr Cys Ser Pro Ile 450 455
2220PRTHomo sapiens 2Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe
Pro Ser Ile Gln Val 1 5 10
15 Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr
20 25 30 Asp Asn
Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser 35
40 45 Arg Glu Phe Arg Ala Ser Leu
His Lys Gly Leu Asp Ser Ala Val Glu 50 55
60 Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu
Gln Val Tyr Ser 65 70 75
80 Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr
85 90 95 Phe Tyr Leu
Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys 100
105 110 Lys Ile Glu Val Met Tyr Pro Pro
Pro Tyr Leu Asp Asn Glu Lys Ser 115 120
125 Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys
Pro Ser Pro 130 135 140
Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly 145
150 155 160 Gly Val Leu Ala
Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile 165
170 175 Phe Trp Val Arg Ser Lys Arg Ser Arg
Leu Leu His Ser Asp Tyr Met 180 185
190 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr
Gln Pro 195 200 205
Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 210
215 220 3163PRTHomo sapiens 3Met Lys Trp Lys Ala Leu Phe
Thr Ala Ala Ile Leu Gln Ala Gln Leu 1 5
10 15 Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu
Asp Pro Lys Leu Cys 20 25
30 Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr
Ala 35 40 45 Leu
Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr 50
55 60 Gln Gln Gly Gln Asn Gln
Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 65 70
75 80 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly
Arg Asp Pro Glu Met 85 90
95 Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu
100 105 110 Leu Gln
Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys 115
120 125 Gly Glu Arg Arg Arg Gly Lys
Gly His Asp Gly Leu Tyr Gln Gly Leu 130 135
140 Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His
Met Gln Ala Leu 145 150 155
160 Pro Pro Arg 410PRTHomo sapiens 4Glu Gln Lys Leu Ile Ser Glu Glu Asp
Leu 1 5 10 521RNAHuman immunodeficiency
virus 5gcggagacag cgacgaagag c
21619RNAHomo sapiens 6gccugggaga gcuggggaa
197277DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 7tcaggtggtg gcggttcagg
cggaggtggc tctggcggtg gcggatcggc ccggatagct 60cagtcggtag agcacagact
ttaatctgag ggtccagggt caagtccctg ttcgggcgcc 120agcctgggag agctggggaa
tttgtacgta gttccccagc tctcccaggc ggtggcagtg 180gctccggagg ttcaggaagc
ggcggtagtg ggagcgcgga gacagcgacg aagagccttc 240ctgtcagagc ggagacagcg
acgaagagct ttttgaa 27781602DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8atgaaccggg gagtcccttt taggcacttg cttctggtgc tgcaactggc gctcctccca
60gcagccactc agggagagca gaagctgatc tccgaggagg acctgaagaa agtggtgctg
120ggcaaaaaag gggatacagt ggaactgacc tgtacagctt cccagaagaa gagcatacaa
180ttccactgga aaaactccaa ccagataaag attctgggaa atcagggctc cttcttaact
240aaaggtccat ccaagctgaa tgatcgcgct gactcaagaa gaagcctttg ggaccaagga
300aactttcccc tgatcatcaa gaatcttaag atagaagact cagatactta catctgtgaa
360gtggaggacc agaaggagga ggtgcaattg ctagtgttcg gattgactgc caactctgac
420acccacctgc ttcaggggca gagcctgacc ctgaccttgg agagcccccc tggtagtagc
480ccctcagtgc aatgtaggag tccaaggggt aaaaacatac agggggggaa gaccctctcc
540gtgtctcagc tggagctcca ggatagtggc acctggacat gcactgtctt gcagaaccag
600aagaaggtgg agttcaaaat agacatcgtg gtgctagctt tccagaaggc ctccagcata
660gtctataaga aagaggggga acaggtggag ttctccttcc cactcgcctt tacagttgaa
720aagctgacgg gcagtggcga gctgtggtgg caggcggaga gggcttcctc ctccaagtct
780tggatcacct ttgacctgaa gaacaaggaa gtgtctgtaa aacgggttac ccaggaccct
840aagctccaga tgggcaagaa gctcccgctc cacctcaccc tgccccaggc cttgcctcag
900tatgctggct ctggaaacct caccctggcc cttgaagcga aaacaggaaa gttgcatcag
960gaagtgaacc tggtggtgat gagagccact cagctccaga aaaatttgac ctgtgaggtg
1020tggggaccca cctcccctaa gctgatgctg agcttgaaac tggagaacaa ggaggcaaag
1080gtctcgaagc gggagaaggc ggtgtgggtg ctgaaccctg aggcggggat gtggcagtgt
1140ctgctgagtg actcgggaca ggtcctgctg gaatccaaca tcaaggttct gcccacatgg
1200tccaccccgg tgcctaggct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc
1260atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac
1320gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga
1380gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg
1440agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag
1500gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt
1560taccagggtc tcagtacagc caccaaggac acctacgacg cc
160291851DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 9atgaaccggg gagtcccttt taggcacttg
cttctggtgc tgcaactggc gctcctccca 60gcagccactc agggagagca gaagctgatc
tccgaggagg acctgaagaa agtggtgctg 120ggcaaaaaag gggatacagt ggaactgacc
tgtacagctt cccagaagaa gagcatacaa 180ttccactgga aaaactccaa ccagataaag
attctgggaa atcagggctc cttcttaact 240aaaggtccat ccaagctgaa tgatcgcgct
gactcaagaa gaagcctttg ggaccaagga 300aactttcccc tgatcatcaa gaatcttaag
atagaagact cagatactta catctgtgaa 360gtggaggacc agaaggagga ggtgcaattg
ctagtgttcg gattgactgc caactctgac 420acccacctgc ttcaggggca gagcctgacc
ctgaccttgg agagcccccc tggtagtagc 480ccctcagtgc aatgtaggag tccaaggggt
aaaaacatac agggggggaa gaccctctcc 540gtgtctcagc tggagctcca ggatagtggc
acctggacat gcactgtctt gcagaaccag 600aagaaggtgg agttcaaaat agacatcgtg
gtgctagctt tccagaaggc ctccagcata 660gtctataaga aagaggggga acaggtggag
ttctccttcc cactcgcctt tacagttgaa 720aagctgacgg gcagtggcga gctgtggtgg
caggcggaga gggcttcctc ctccaagtct 780tggatcacct ttgacctgaa gaacaaggaa
gtgtctgtaa aacgggttac ccaggaccct 840aagctccaga tgggcaagaa gctcccgctc
cacctcaccc tgccccaggc cttgcctcag 900tatgctggct ctggaaacct caccctggcc
cttgaagcga aaacaggaaa gttgcatcag 960gaagtgaacc tggtggtgat gagagccact
cagctccaga aaaatttgac ctgtgaggtg 1020tggggaccca cctcccctaa gctgatgctg
agcttgaaac tggagaacaa ggaggcaaag 1080gtctcgaagc gggagaaggc ggtgtgggtg
ctgaaccctg aggcggggat gtggcagtgt 1140ctgctgagtg actcgggaca ggtcctgctg
gaatccaaca tcaaggttct gcccacatgg 1200tccaccccgg tgcctaggaa aattgaagtt
atgtatcctc ctccttacct agacaatgag 1260aagagcaatg gaaccattat ccatgtgaaa
gggaaacacc tttgtccaag tcccctattt 1320cccggacctt ctaagccctt ttgggtgctg
gtggtggttg gtggagtcct ggcttgctat 1380agcttgctag taacagtggc ctttattatt
ttctgggtga ggagtaagag gagcaggctc 1440ctgcacagtg actacatgaa catgactccc
cgccgccccg ggcccacccg caagcattac 1500cagccctatg ccccaccacg cgacttcgca
gcctatcgct ccagagtgaa gttcagcagg 1560agcgcagacg cccccgcgta ccagcagggc
cagaaccagc tctataacga gctcaatcta 1620ggacgaagag aggagtacga tgttttggac
aagagacgtg gccgggaccc tgagatgggg 1680ggaaagccga gaaggaagaa ccctcaggaa
ggcctgtaca atgaactgca gaaagataag 1740atggcggagg cctacagtga gattgggatg
aaaggcgagc gccggagggg caaggggcac 1800gatggccttt accagggtct cagtacagcc
accaaggaca cctacgacgc c 185110211PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
10Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser 1
5 10 15 Asn Gly Thr Ile
Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro 20
25 30 Leu Phe Pro Gly Pro Ser Lys Pro Phe
Trp Val Leu Val Val Val Gly 35 40
45 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe
Ile Ile 50 55 60
Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met 65
70 75 80 Asn Met Thr Pro Arg
Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro 85
90 95 Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr
Arg Ser Arg Val Lys Phe 100 105
110 Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln
Leu 115 120 125 Tyr
Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp 130
135 140 Lys Arg Arg Gly Arg Asp
Pro Glu Met Gly Gly Lys Pro Arg Arg Lys 145 150
155 160 Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln
Lys Asp Lys Met Ala 165 170
175 Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys
180 185 190 Gly His
Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr 195
200 205 Tyr Asp Ala 210
1115PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 11Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1
5 10 15
1215PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 12Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser 1
5 10 15
User Contributions:
Comment about this patent or add new information about this topic: