Patent application title: YEAST ORGANISM PRODUCING ISOBUTANOL AT A HIGH YIELD
Inventors:
IPC8 Class: AC12P716FI
USPC Class:
1 1
Class name:
Publication date: 2018-06-28
Patent application number: 20180179557
Abstract:
The present invention provides recombinant microorganisms comprising an
isobutanol producing metabolic pathway and methods of using said
recombinant microorganisms to produce isobutanol. In various aspects of
the invention, the recombinant microorganisms may comprise a modification
resulting in the reduction of pyruvate decarboxylase and/or
glycerol-3-phosphate dehydrogenase activity. In various embodiments
described herein, the recombinant microorganisms may be microorganisms of
the Saccharomyces clade, Crabtree-negative yeast microorganisms,
Crabtree-positive yeast microorganisms, post-WGD (whole genome
duplication) yeast microorganisms, pre-WGD (whole genome duplication)
yeast microorganisms, and non-fermenting yeast microorganisms.Claims:
1. A method of producing isobutanol, comprising: a) providing a
recombinant microorganism comprising an isobutanol producing metabolic
pathway, wherein the recombinant microorganism has been engineered to
contain one or more modifications in a transcriptional regulator of a PDC
gene; b) cultivating the microorganism in a culture medium containing a
feedstock providing the carbon source, until a recoverable quantity of
the isobutanol is produced; and c) recovering the isobutanol.
2. The method of claim 1, wherein the microorganism comprises an isobutanol producing metabolic pathway comprising the following substrate to product conversions: (i) pyruvate to acetolactate; (ii) acetolactate to 2,3-dihydroxyisovalerate; (iii) 2,3-dihydroxyisovalerate to .alpha.-ketoisovalerate; (iv) .alpha.-ketoisovalerate to isobutyraldehyde; and (v) isobutyraldehyde to isobutanol.
3. The method of claim 1, wherein the microorganism expresses (a) an acetolactate synthase to catalyze the conversion of pyruvate to acetolactate; (b) a ketol-acid reductoisomerase to catalyze the conversion of acetolactate to 2,3-dihydroxyisovalerate; (c) a dihydroxyacid dehydratase to catalyze the conversion of 2,3-dihydroxyisovalerate to .alpha.-ketoisovalerate; (d) an .alpha.-ketoisovalerate decarboxylase to catalyze the conversion of .alpha.-ketoisovalerate to isobutyraldehyde; and (e) an alcohol dehydrogenase to catalyze the conversion of isobutyraldehyde to isobutanol.
4. The method of claim 1, wherein the microorganism is selected to produce isobutanol at a yield of greater than about 10 percent theoretical.
5. The method of claim 1, wherein the microorganism is selected to produce isobutanol at a yield of greater than about 20 percent theoretical.
6. The method of claim 1, wherein the microorganism is selected to produce isobutanol at a yield of greater than about 50 percent theoretical.
7. The method of claim 1, wherein the PDC gene is PDC1 or PDC5.
8. The method of claim 1, wherein the PDC gene is PDC1 and PDC5.
9. The method of claim 1, wherein the one or more modifications of the transcriptional regulator of a PDC gene result in a reduction of pyruvate decarboxylase gene transcription.
10. The method of claim 1, wherein the transcriptional regulator of a PDC gene is PDC2.
11. The method of claim 10, wherein the one or more modifications of PDC2 result in a decreased PDC2 activity.
12. The method of claim 11, wherein the one or more modifications in PDC2 result in a loss of function mutation.
13. The method of claim 10, wherein the one or more modifications in PDC2 decrease expression from a PDC1 or a PDC5 promoter.
14. The method of claim 13, wherein the one or more modifications in PDC2 decrease expression from a PDC1 and a PDC5 promoter.
15. The method of claim 10, wherein the one or more modifications in PDC2 decrease expression of PDC1 or PDC5.
16. The method of claim 15, wherein the one or more modifications in PDC2 decrease expression of PDC1 and PDC5.
17. The method of claim 10, wherein the one or more modifications in PDC2 inhibit expression of PDC1 or PDC5.
18. The method of claim 17, wherein the one or more modifications in PDC2 inhibit expression of PDC1 and PDC5.
19. The method of claim 1, wherein the recombinant microorganism comprises one or more complete deletions of pyruvate decarboxylase genes resulting in a reduction of pyruvate decarboxylase activity of a polypeptide encoded by said gene.
20. The method of claim 1, wherein said recombinant microorganism has reduced endogenous PDC activity as compared to the corresponding recombinant microorganism that has not been engineered to have reduced endogenous PDC activity.
21. A method in accordance with claim 1, wherein the microorganism is a yeast microorganism of the Saccharomyces clade.
22. The method of claim 1, wherein the recombinant microorganism grows on glucose independently of C2-compounds at a growth rate substantially equivalent to the growth rate of a parental microorganism without altered PDC activity.
23. The method of claim 1, wherein the microorganism is a Saccharomyces sensu stricto yeast microorganism.
24. The method of claim 23, wherein the Saccharomyces sensu stricto yeast microorganism is selected from one of the species: S. cerevisiae, S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis or hybrids thereof.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser. No. 14/482,308, filed Sep. 10, 2014, which is a continuation of U.S. application Ser. No. 13/907,394, filed May 31, 2013, now abandoned, which is a continuation of U.S. application Ser. No. 12/820,505, filed Jun. 22, 2010, which issued as U.S. Pat. No. 8,455,239, which claims the benefit and priority of U.S. Provisional Application Ser. No. 61/219,173, filed Jun. 22, 2009, and is a continuation-in-part of U.S. application Ser. No. 12/696,645, filed Jan. 29, 2010, which is a divisional of U.S. application Ser. No. 12/343,375, filed Dec. 23, 2008, which issued as U.S. Pat. No. 8,017,375, which claims the benefit of U.S. Provisional Application Ser. No. 61/016,483, filed Dec. 23, 2007, all of which are herein incorporated by reference in their entireties for all purposes.
DESCRIPTION OF THE TEXT FILE SUBMITTED ELECRTONICALLY
[0002] The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: GEVO_027_11US_SeqList.txt, date recorded: Feb. 15, 2018, file size 436 kilobytes).
TECHNICAL FIELD
[0003] Metabolically engineered microorganisms and methods of producing such organisms are provided. Also provided are methods of producing metabolites that are biofuels by contacting a suitable substrate with metabolically engineered microorganisms and enzymatic preparations there from.
BACKGROUND
[0004] Biofuels have a long history ranging back to the beginning of the 20th century. As early as 1900, Rudolf Diesel demonstrated at the World Exhibition in Paris, France, an engine running on peanut oil. Soon thereafter, Henry Ford demonstrated his Model T running on ethanol derived from corn. Petroleum-derived fuels displaced biofuels in the 1930s and 1940s due to increased supply, and efficiency at a lower cost. Market fluctuations in the 1970s coupled to the decrease in US oil production led to an increase in crude oil prices and a renewed interest in biofuels. Today, many interest groups, including policy makers, industry planners, aware citizens, and the financial community, are interested in substituting petroleum-derived fuels with biomass-derived biofuels. The leading motivations for developing biofuels are of economical, political, and environmental nature.
[0005] One is the threat of `peak oil`, the point at which the consumption rate of crude oil exceeds the supply rate, thus leading to significantly increased fuel cost results in an increased demand for alternative fuels. In addition, instability in the Middle East and other oil-rich regions has increased the demand for domestically produced biofuels. Also, environmental concerns relating to the possibility of carbon dioxide related climate change is an important social and ethical driving force which is starting to result in government regulations and policies such as caps on carbon dioxide emissions from automobiles, taxes on carbon dioxide emissions, and tax incentives for the use of biofuels.
[0006] Ethanol is the most abundant fermentatively produced fuel today but has several drawbacks when compared to gasoline. Butanol, in comparison, has several advantages over ethanol as a fuel: it can be made from the same feedstocks as ethanol but, unlike ethanol, it is compatible with gasoline at any ratio and can also be used as a pure fuel in existing combustion engines without modifications. Unlike ethanol, butanol does not absorb water and can thus be stored and distributed in the existing petrochemical infrastructure. Due to its higher energy content which is close to that of gasoline, the fuel economy (miles per gallon) is better than that of ethanol. Also, butanol-gasoline blends have lower vapor pressure than ethanol-gasoline blends, which is important in reducing evaporative hydrocarbon emissions.
[0007] Isobutanol has the same advantages as butanol with the additional advantage of having a higher octane number due to its branched carbon chain. Isobutanol is also useful as a commodity chemical and is also a precursor to isobutylene and isobutylene-derived fuels and chemicals. Isobutanol has been produced recombinantly in yeast microorganisms expressing a heterologous metabolic pathway (See, e.g., WO/2007/050671 to Donaldson et al., and WO/2008/098227 to Liao et al.). However, these yeast microorganisms fall short of commercial relevance due to their low performance characteristics, including low productivity, low titer, low yield, and the requirement for oxygen during the fermentation process. One of the primary reasons for the sub-optimal performance observed in existing isobutanol-producing microorganisms is the undesirable conversion of pathway intermediates to unwanted by-products.
[0008] Thus, there is an existing need to identify and reduce and/or eliminate the metabolic processes catalyzing the conversion of isobutanol pathway intermediates to unwanted by-products. The present inventors have addressed this need by providing recombinant microorganisms with reduced pyruvate decarboxylase (PDC) activity and reduced glycerol-3-phosphate dehydrogenase (GPD) activity.
SUMMARY OF THE INVENTION
[0009] The present inventors have observed that by combining the expression of a cytosolically localized acetolactate synthase enzyme with reduced pyruvate decarboxylase (PDC) activity and/or reduced glycerol-3-phosphate dehydrogenase (GPD) activity, an unexpectedly high flux from pyruvate to acetolactate can be achieved. Thus, the invention provides yeast cells that are engineered to exhibit an efficient conversion of pyruvate to acetolactate in the cytoplasm due to suppression of competing metabolic pathways. Therefore, as would be understood in the art, the present invention has utility for the production of any acetolactate-derived product, including, but not limited to, isobutanol, 2-butanol, 1-butanol, 2-butanone, 2,3-butanediol, valine, leucine, and 3-methyl-1-butanol.
[0010] Accordingly, in a first aspect, the invention provides a recombinant microorganism, such as a yeast cell, comprising a cytosolically-localized polypeptide having acetolactate synthase activity wherein the yeast cell is substantially free of an enzyme having pyruvate decarboxylase (PDC) activity and/or glycerol-3-phosphate dehydrogenase (GPD) activity, and wherein the cell converts pyruvate to acetolactate.
[0011] Thus, in various embodiments described herein, the present invention provides recombinant microorganisms engineered to include reduced pyruvate decarboxylase (PDC) activity as compared to a parental microorganism. In one embodiment, PDC activity is eliminated. PDC catalyzes the decarboxylation of pyruvate to acetaldehyde, which is reduced to ethanol by alcohol dehydrogenases via the oxidation of NADH to NAD+. In one embodiment, the recombinant microorganism includes a mutation in at least one PDC gene resulting in a reduction of PDC activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion of a PDC gene resulting in a reduction of PDC activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism comprises a complete deletion of a PDC gene resulting in a reduction of PDC activity of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with at least one PDC gene resulting in a reduction of PDC activity of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of PDC gene transcription. In yet another embodiment, the recombinant microorganism comprises mutations in all PDC genes resulting in a reduction of PDC activity of the polypeptides encoded by said genes. In another embodiment, the recombinant microorganism includes partial deletions of all PDC genes resulting in a reduction of PDC activity of the polypeptides encoded by said genes. In yet another embodiment, the recombinant microorganism comprises a deletion of all PDC genes resulting in the elimination of PDC activity of the polypeptides encoded by said genes.
[0012] In additional embodiments, the present invention provides recombinant microorganisms engineered to exhibit reduced glycerol-3-phosphate dehydrogenase (GPD) activity as compared to a parental microorganism. In one embodiment, GPD activity is eliminated. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) via the oxidation of NADH to NAD.sup.+. Glycerol is produced from G3P by Glycerol-3-phosphatase (GPP). In one embodiment, the recombinant microorganism includes a mutation in at least one GPD gene resulting in a reduction of GPD activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion of a GPD gene resulting in a reduction of GPD activity of a polypeptide encoded by the gene. In another embodiment, the recombinant microorganism comprises a complete deletion of a GPD gene resulting in a reduction of GPD activity of a polypeptide encoded by the gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with at least one GPD gene resulting in a reduction of GPD activity of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of GPD gene transcription. In another embodiment, the recombinant microorganism includes partial deletions of all GPD genes resulting in a reduction of GPD activity of the polypeptides encoded by said genes. In yet another embodiment, the recombinant microorganism comprises mutations in all GPD genes resulting in a reduction of GPD activity of the polypeptides encoded by said genes. In yet another embodiment, the recombinant microorganism comprises a deletion of all GPD genes resulting in the elimination of GPDs activity of the polypeptides encoded by said genes.
[0013] In an exemplary embodiment, the present invention provides a recombinant microorganism engineered to exhibit reduced pyruvate decarboxylase (PDC) activity and reduced glycerol-3-phosphate dehydrogenase (GPD) activity as compared to a parental microorganism.
[0014] In additional embodiments, the present invention provides recombinant microorganisms engineered to exhibit reduced pyruvate dehydrogenase (PDH) activity as compared to a parental microorganism. In one embodiment, the recombinant microorganism is engineered to have reduced pyruvate decarboxylase (PDC) activity and reduced pyruvate dehydrogenase (PDH) activity. In another embodiment, the recombinant microorganism is engineered to have reduced glycerol-3-phosphate dehydrogenase (GPD) activity and reduced pyruvate dehydrogenase (PDH) activity. In yet another embodiment, the recombinant microorganism is engineered to have reduced pyruvate decarboxylase (PDC) activity, reduced glycerol-3-phosphate dehydrogenase (GPD) activity, and reduced pyruvate dehydrogenase (PDH) activity.
[0015] In various embodiments described herein, the present invention provides recombinant microorganisms, including, but not limited to those, that comprise an isobutanol producing metabolic pathway. In some embodiments, the recombinant microorganisms can be engineered to express an isobutanol producing metabolic pathway comprising at least one exogenous gene that catalyzes a step in the conversion of pyruvate to isobutanol. In one embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least two exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least three exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least four exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising five exogenous genes.
[0016] In various embodiments described herein, isobutanol producing metabolic pathway comprises at least one exogenous gene that catalyzes a step in the conversion of pyruvate to isobutanol. In one embodiment, the exogenous gene encodes a polypeptide selected from the group consisting of acetolactate synthase (ALS), ketol-acid reductoisomerase (KARI), dihydroxyacid dehydratase (DHAD), 2-keto-acid decarboxylase (KIVD), and alcohol dehydrogenase (ADH). In another embodiment, the exogenous gene encodes an acetolactate synthase (ALS). In an exemplary embodiment, the acetolactate synthase is a cytosolically-localized acetolactate synthase. In one specific embodiment, the cytosolically-localized acetolactate synthase is encoded by the Lactococcus lactis gene alsS. In another specific embodiment, the cytosolically-localized acetolactate synthase is encoded by the Bacillus subtilis gene alsS.
[0017] In additional embodiments, the recombinant microorganism comprises an isobutanol producing metabolic pathway comprising genes encoding an NADH-dependent KARI and an NADH-dependent ADH. In one embodiment, the KARI and/or the ADH show at least a 10-fold higher catalytic efficiency using NADH as the cofactor as compared to the wild-type E. coli KARI ilvC and a native E. coli ADH yqhD, respectively. In another embodiment, the KARI and/or the ADH have been modified or mutated to be NADH-dependent. In yet another embodiment, the KARI and/or the ADH has been identified in nature with increased activity using NADH as a cofactor as compared to the wild-type E. coli KARI ilvC and a native E. coli ADH yqhD, respectively.
[0018] In some embodiments, the invention provides a recombinant microorganism comprising an isobutanol producing metabolic pathway, wherein said recombinant microorganism comprises a reduction in pyruvate decarboxylase (PDC) activity as compared to a parental microorganism. In additional embodiments, the recombinant microorganism comprises a reduction in glycerol-3-phosphate dehydrogenase (GPD) activity as compared to a parental microorganism. In yet other embodiments, the recombinant microorganism comprises a reduction in pyruvate decarboxylase (PDC) activity and glycerol-3-phosphate dehydrogenase (GPD) activity as compared to a parental microorganism. In still yet other embodiments, the recombinant microorganism comprises a reduction in pyruvate decarboxylase (PDC) activity, a reduction in glycerol-3-phosphate dehydrogenase (GPD) activity, and a reduction in pyruvate dehydrogenase (PDH) activity as compared to a parental microorganism.
[0019] In various embodiments described herein, the present invention provides recombinant microorganisms that comprise a pathway for the fermentation of isobutanol from a pentose sugar. In one embodiment, the pentose sugar is xylose. In one embodiment, the recombinant microorganism is engineered to express a functional xylose isomerase (XI). In another embodiment, the recombinant microorganism further comprises a deletion or disruption of a native gene encoding for an enzyme that catalyzes the conversion of xylose to xylitol. In one embodiment, the native gene is xylose reductase (XR). In another embodiment, the native gene is xylitol dehydrogenase (XDH). In yet another embodiment, both native genes are deleted or disrupted. In yet another embodiment, the recombinant microorganism further engineered to express, xylulose kinase which catalyzes the conversion of xylulose to xylulose-5-phosphate.
[0020] In some embodiments, the microorganisms of the present invention are engineered to grow on glucose independently of C2-compounds at a growth rate substantially equivalent to the growth rate of a parental microorganism without altered PDC activity.
[0021] In various embodiments described herein, the recombinant microorganisms may be microorganisms of the Saccharomyces clade, Saccharomyces sensu stricto microorganisms, Crabtree-negative yeast microorganisms, Crabtree-positive yeast microorganisms, post-WGD (whole genome duplication) yeast microorganisms, pre-WGD (whole genome duplication) yeast microorganisms, and non-fermenting yeast microorganisms.
[0022] In some embodiments, the recombinant microorganisms may be yeast recombinant microorganisms of the Saccharomyces clade.
[0023] In some embodiments, the recombinant microorganisms may be Saccharomyces sensu stricto microorganisms. In one embodiment, the Saccharomyces sensu stricto is selected from the group consisting of S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids thereof.
[0024] In some embodiments, the recombinant microorganisms may be Crabtree-negative recombinant yeast microorganisms. In one embodiment, the Crabtree-negative yeast microorganism is classified into a genera selected from the group consisting of Kluyveromyces, Pichia, Hansenula, or Candida. In additional embodiments, the Crabtree-negative yeast microorganism is selected from Kluyveromyces lactis, Kluyveromyces marxianus, Pichia anomala, Pichia stipitis, P. kudriavzevii, Hansenula anomala, Candida utilis and Kluyveromyces waltii.
[0025] In some embodiments, the recombinant microorganisms may be Crabtree-positive recombinant yeast microorganisms. In one embodiment, the Crabtree-positive yeast microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Candida, Pichia and Schizosaccharomyces. In additional embodiments, the Crabtree-positive yeast microorganism is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, Saccharomyces kluyveri, Kluyveromyces thermotolerans, Candida glabrata, Z. bailli, Z. rouxii, Debaryomyces hansenii, Pichia pastorius, Schizosaccharomyces pombe, and Saccharomyces uvarum.
[0026] In some embodiments, the recombinant microorganisms may be post-WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the post-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces or Candida. In additional embodiments, the post-WGD yeast is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, and Candida glabrata.
[0027] In some embodiments, the recombinant microorganisms may be pre-WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the pre-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Debaryomyces, Hansenula, Pachysolen, Yarrowia and Schizosaccharomyces. In additional embodiments, the pre-WGD yeast is selected from the group consisting of Saccharomyces kluyveri, Kluyveromyces thermotolerans, Kluyveromyces marxianus, Kluyveromyces waltii, Kluyveromyces lactis, Candida tropicalis, Pichia pastoris, Pichia anomala, Pichia stipitis, Debaryomyces hansenii, Hansenula anomala, Pachysolen tannophilis, Yarrowia lipolytica, and Schizosaccharomyces pombe.
[0028] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, or Myxozyma.
[0029] In another aspect, the present invention provides methods of producing isobutanol using a recombinant microorganism of the invention. In one embodiment, the method includes cultivating the recombinant microorganism in a culture medium containing a feedstock providing the carbon source until a recoverable quantity of the isobutanol is produced and optionally, recovering the isobutanol. In one embodiment, the microorganism is selected to produce isobutanol from a carbon source at a yield of at least about 5 percent theoretical. In another embodiment, the microorganism is selected to produce isobutanol at a yield of at least about 10 percent, at least about 15 percent, about least about 20 percent, at least about 25 percent, at least about 30 percent, at least about 35 percent, at least about 40 percent, at least about 45 percent, at least about 50 percent, at least about 55 percent, at least about 60 percent, at least about 65 percent, at least about 70 percent, at least about 75 percent, at least about 80 percent, at least about 85 percent, at least about 90 percent, or at least about 95 percent theoretical.
[0030] In one embodiment, the microorganism is selected to produce isobutanol from a carbon source at a specific productivity of at least about 0.7 mg/L/hr per OD. In another embodiment, the microorganism is selected to produce isobutanol from a carbon source at a specific productivity of at least about 1 mg/L/hr per OD, at least about 10 mg/L/hr per OD, at least about 50 mg/L/hr per OD, at least about 100 mg/L/hr per OD, at least about 250 mg/L/hr per OD, or at least about 500 mg/L/hr per OD.
BRIEF DESCRIPTION OF DRAWINGS
[0031] Illustrative embodiments of the invention are illustrated in the drawings, in which:
[0032] FIG. 1 illustrates an exemplary embodiment of an isobutanol pathway.
[0033] FIG. 2 illustrates production of pyruvate via glycolysis, together with an isobutanol pathway which converts pyruvate to isobutanol and a PDC pathway which converts pyruvate to acetaldehyde and carbon dioxide.
[0034] FIG. 3 illustrates an isobutanol pathway receiving additional pyruvate to form isobutanol at higher yield due to the deletion or reduction of the PDC pathway.
[0035] FIG. 4 illustrates an isobutanol pathway receiving additional pyruvate to form isobutanol at higher yield due to deletion or reduction of the PDC pathway and the deletion or reduction of the GPD pathway.
[0036] FIG. 5 illustrates the carbon source composition and feeding rate over time during chemostat evolution of the S. cerevisiae Pdc-minus strain GEVO1584. This graph shows how the acetate was decreased over a period of 480 hours from 0.375 g/L to 0 g/L. It also shows the total feeding rate. Higher feeding rate meant that growth rate was higher. Since the chemostat contained 200 ml of culture, dilution rate can be calculated by dividing the feeding rate by 200 ml.
[0037] FIG. 6 illustrates growth of evolved Pdc-minus mutant strain GEVO1863 in YPD compared to the parental strain, GEVO1187.
[0038] FIG. 7 illustrates that the evolved PCD mutant, GEVO1863, does not produce ethanol in YPD medium, unlike the parental strain GEVO1187.
[0039] FIG. 8 illustrates a schematic map of plasmid pGV1503.
[0040] FIG. 9 illustrates a schematic map of plasmid pGV1537.
[0041] FIG. 10 illustrates a schematic map of plasmid pGV1429.
[0042] FIG. 11 illustrates a schematic map of plasmid pGV1430.
[0043] FIG. 12 illustrates a schematic map of plasmid pGV1431.
[0044] FIG. 13 illustrates a schematic map of plasmid pGV1472.
[0045] FIG. 14 illustrates a schematic map of plasmid pGV1473.
[0046] FIG. 15 illustrates a schematic map of plasmid pGV1475.
[0047] FIG. 16 illustrates a schematic map of plasmid pGV1254.
[0048] FIG. 17 illustrates a schematic map of plasmid pGV1295.
[0049] FIG. 18 illustrates a schematic map of plasmid pGV1390.
[0050] FIG. 19 illustrates a schematic map of plasmid pGV1438.
[0051] FIG. 20 illustrates a schematic map of plasmid pGV1590.
[0052] FIG. 21 illustrates a schematic map of plasmid pGV1726.
[0053] FIG. 22 illustrates a schematic map of plasmid pGV1727.
[0054] FIG. 23 illustrates a schematic map of plasmid pGV1056.
[0055] FIG. 24 illustrates a schematic map of plasmid pGV1062.
[0056] FIG. 25 illustrates a schematic map of plasmid pGV1102.
[0057] FIG. 26 illustrates a schematic map of plasmid pGV1103.
[0058] FIG. 27 illustrates a schematic map of plasmid pGV1104.
[0059] FIG. 28 illustrates a schematic map of plasmid pGV1106.
[0060] FIG. 29 illustrates a schematic map of plasmid pGV1649.
[0061] FIG. 30 illustrates a schematic map of plasmid pGV1664.
[0062] FIG. 31 illustrates a schematic map of plasmid pGV1672.
[0063] FIG. 32 illustrates a schematic map of plasmid pGV1673.
[0064] FIG. 33 illustrates a schematic map of plasmid pGV1677.
[0065] FIG. 34 illustrates a schematic map of plasmid pGV1679.
[0066] FIG. 35 illustrates a schematic map of plasmid pGV1683.
[0067] FIG. 36 illustrates a schematic map of plasmid pGV1565.
[0068] FIG. 37 illustrates a schematic map of plasmid pGV1568.
[0069] FIG. 38 illustrates a schematic map of plasmid pGV2082.
[0070] FIG. 39 illustrates a schematic map of plasmid pGV2114.
[0071] FIG. 40 illustrates a schematic map of plasmid pGV2117.
[0072] FIG. 41 illustrates a schematic map of plasmid pGV2118.
DETAILED DESCRIPTION
[0073] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the microorganism" includes reference to one or more microorganisms, and so forth.
[0074] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
[0075] Any publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.
[0076] The term "microorganism" includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.
[0077] "Bacteria", or "eubacteria", refers to a domain of prokaryotic organisms. Bacteria include at least 11 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic+non-photosynthetic Gram-negative bacteria (includes most "common" Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; (11) Thermotoga and Thermosipho thermophiles.
[0078] "Gram-negative bacteria" include cocci, nonenteric rods, and enteric rods. The genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fusobacterium.
[0079] "Gram positive bacteria" include cocci, nonsporulating rods, and sporulating rods. The genera of gram positive bacteria include, for example, Actinomyces, Bacillus, Clostridium, Corynebacterium, Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces.
[0080] The term "genus" is defined as a taxonomic group of related species according to the Taxonomic Outline of Bacteria and Archaea (Garrity, G. M., Lilburn, T. G., Cole, J. R., Harrison, S. H., Euzeby, J., and Tindall, B. J. (2007) The Taxonomic Outline of Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State University Board of Trustees. [http://www.taxonomicoutline.org/]).
[0081] The term "species" is defined as a collection of closely related organisms with greater than 97% 16S ribosomal RNA sequence homology and greater than 70% genomic hybridization and sufficiently different from all other organisms so as to be recognized as a distinct unit.
[0082] The term "recombinant microorganism," "modified microorganism," and "recombinant host cell" are used interchangeably herein and refer to microorganisms that have been genetically modified to express or over-express endogenous polynucleotides, or to express heterologous polynucleotides, such as those included in a vector, or which have an alteration in expression of an endogenous gene. By "alteration" it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or activity of one or more polypeptides or polypeptide subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the alteration. For example, the term "alter" can mean "inhibit," but the use of the word "alter" is not limited to this definition.
[0083] The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired product encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantitated by PCR or by northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). Protein encoded by a selected sequence can be quantitated by various methods, e.g., by ELISA, by assaying for the biological activity of the protein, or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay, using antibodies that are recognize and bind reacting the protein. See Sambrook et al., 1989, supra. The polynucleotide generally encodes a target enzyme involved in a metabolic pathway for producing a desired metabolite. It is understood that the terms "recombinant microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0084] The term "wild-type microorganism" describes a cell that occurs in nature, i.e. a cell that has not been genetically modified. A wild-type microorganism can be genetically modified to express or overexpress a first target enzyme. This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or overexpress a second target enzyme. In turn, the microorganism modified to express or overexpress a first and a second target enzyme can be modified to express or overexpress a third target enzyme.
[0085] Accordingly, a "parental microorganism" functions as a reference cell for successive genetic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule in to the reference cell. The introduction facilitates the expression or overexpression of a target enzyme. It is understood that the term "facilitates" encompasses the activation of endogenous polynucleotides encoding a target enzyme through genetic modification of e.g., a promoter sequence in a parental microorganism. It is further understood that the term "facilitates" encompasses the introduction of heterologous polynucleotides encoding a target enzyme in to a parental microorganism
[0086] The term "engineer" refers to any manipulation of a microorganism that result in a detectable change in the microorganism, wherein the manipulation includes but is not limited to inserting a polynucleotide and/or polypeptide heterologous to the microorganism and mutating a polynucleotide and/or polypeptide native to the microorganism. The term "metabolically engineered" or "metabolic engineering" involves rational pathway design and assembly of biosynthetic genes, genes associated with operons, and control elements of such polynucleotides, for the production of a desired metabolite. "Metabolically engineered" can further include optimization of metabolic flux by regulation and optimization of transcription, translation, protein stability and protein functionality using genetic engineering and appropriate culture condition including the reduction of, disruption, or knocking out of, a competing metabolic pathway that competes with an intermediate leading to a desired pathway.
[0087] The terms "metabolically engineered microorganism" and "modified microorganism" are used interchangeably herein and refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0088] The term "mutation" as used herein indicates any modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the modified microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are the results of artificial selection pressure. In still other embodiments, the mutations in the microorganism genome are the result of genetic engineering.
[0089] The term "biosynthetic pathway", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical reactions for converting one chemical species into another. Gene products belong to the same "metabolic pathway" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e., metabolite) between the same substrate and metabolite end product.
[0090] The term "heterologous" as used herein with reference to molecules and in particular enzymes and polynucleotides, indicates molecules that are expressed in an organism other than the organism from which they originated or are found in nature, independently of the level of expression that can be lower, equal or higher than the level of expression of the molecule in the native microorganism.
[0091] On the other hand, the term "native" or "endogenous" as used herein with reference to molecules, and in particular enzymes and polynucleotides, indicates molecules that are expressed in the organism in which they originated or are found in nature, independently of the level of expression that can be lower equal or higher than the level of expression of the molecule in the native microorganism. It is understood that expression of native enzymes or polynucleotides may be modified in recombinant microorganisms.
[0092] The term "feedstock" is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.
[0093] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term "substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a metabolically engineered microorganism as described herein.
[0094] The term "C2-compound" as used as a carbon source for engineered yeast microorganisms with mutations in all pyruvate decarboxylase (PDC) genes resulting in a reduction of pyruvate decarboxylase activity of said genes refers to organic compounds comprised of two carbon atoms, including but not limited to ethanol and acetate.
[0095] The term "fermentation" or "fermentation process" is defined as a process in which a microorganism is cultivated in a culture medium containing raw materials, such as feedstock and nutrients, wherein the microorganism converts raw materials, such as a feedstock, into products. The term "cell dry weight" or "CDW" refers to the weight of the microorganism after the water contained in the microorganism has been removed using methods known to one skilled in the art. CDW is reported in grams.
[0096] The term "biofuel" refers to a fuel in which all carbon contained within the fuel is derived from biomass and is biochemically converted, at least in part, in to a fuel by a microorganism. A biofuel is further defined as a non-ethanol compound which contains less than 0.5 oxygen atoms per carbon atom. A biofuel is a fuel in its own right, but may be blended with petroleum-derived fuels to generate a fuel. A biofuel may be used as a replacement for petrochemically-derived gasoline, diesel fuel, or jet fuel.
[0097] The term "volumetric productivity" or "production rate" is defined as the amount of product formed per volume of medium per unit of time. Volumetric productivity is reported in gram per liter per hour (g/L/h).
[0098] The term "specific productivity" or "specific production rate" is defined as the amount of product formed per volume of medium per unit of time per amount of cells. Volumetric productivity is reported in gram or milligram per liter per hour per OD (g/L/h/OD).
[0099] The term "yield" is defined as the amount of product obtained per unit weight of raw material and may be expressed as g product per g substrate (g/g). Yield may be expressed as a percentage of the theoretical yield. "Theoretical yield" is defined as the maximum amount of product that can be generated per a given amount of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to isobutanol is 0.41 g/g. As such, a yield of isobutanol from glucose of 0.39 g/g would be expressed as 95% of theoretical or 95% theoretical yield.
[0100] The term "titer" is defined as the strength of a solution or the concentration of a substance in solution. For example, the titer of a biofuel in a fermentation broth is described as g of biofuel in solution per liter of fermentation broth (g/L).
[0101] A "facultative anaerobic organism" or a "facultative anaerobic microorganism" is defined as an organism that can grow in either the presence or in the absence of oxygen.
[0102] A "strictly anaerobic organism" or a "strictly anaerobic microorganism" is defined as an organism that cannot grow in the presence of oxygen and which does not survive exposure to any concentration of oxygen.
[0103] An "anaerobic organism" or an "anaerobic microorganism" is defined as an organism that cannot grow in the presence of oxygen.
[0104] "Aerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is sufficiently high for an aerobic or facultative anaerobic microorganism to use as a terminal electron acceptor.
[0105] In contrast, "Anaerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. Anaerobic conditions may be achieved by sparging a fermentation medium with an inert gas such as nitrogen until oxygen is no longer available to the microorganism as a terminal electron acceptor. Alternatively, anaerobic conditions may be achieved by the microorganism consuming the available oxygen of the fermentation until oxygen is unavailable to the microorganism as a terminal electron acceptor. Methods for the production of isobutanol under anaerobic conditions are described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527), the disclosures of which are herein incorporated by reference in their entireties for all purposes.
[0106] "Aerobic metabolism" refers to a biochemical process in which oxygen is used as a terminal electron acceptor to make energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism occurs e.g. via glycolysis and the TCA cycle, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.
[0107] In contrast, "anaerobic metabolism" refers to a biochemical process in which oxygen is not the final acceptor of electrons contained in NADH. Anaerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate level phosphorylation, in which the electrons from NADH are utilized to generate a reduced product via a "fermentative pathway."
[0108] In "fermentative pathways", NAD(P)H donates its electrons to a molecule produced by the same metabolic pathway that produced the electrons carried in NAD(P)H. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis transfers its electrons to acetaldehyde, yielding ethanol. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain. For example, above certain glucose concentrations, Crabtree-positive yeasts produce large amounts of ethanol under aerobic conditions.
[0109] The term "byproduct" or "by-product" means an undesired product related to the production of a biofuel or biofuel precursor. Byproducts are generally disposed as waste, adding cost to a production process.
[0110] The term "substantially free" when used in reference to the presence or absence of enzymatic activities (PDC, GPD, PDH, etc.) in carbon pathways that compete with the desired metabolic pathway (e.g. an isobutanol-producing metabolic pathway) means the level of the enzyme is substantially less than that of the same enzyme in the wild-type host, wherein less than about 50% of the wild-type level is preferred and less than about 30% is more preferred. The activity may be less than about 20%, less than about 10%, less than about 5%, or less than about 1% of wild-type activity.
[0111] The term "non-fermenting yeast" is a yeast species that fails to demonstrate an anaerobic metabolism in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway such as the production of ethanol and CO.sub.2 from glucose. Non-fermentative yeast can be identified by the "Durham Tube Test" (J. A. Barnett, R. W. Payne, and D. Yarrow. 2000. Yeasts Characteristics and Identification. 3.sup.rd edition. p. 28-29. Cambridge University Press, Cambridge, UK.) or by monitoring the production of fermentation productions such as ethanol and CO.sub.2.
[0112] The term "polynucleotide" is used herein interchangeably with the term "nucleic acid" and refers to an organic polymer composed of two or more monomers including nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA. The term "nucleotide" refers to any of several compounds that consist of a ribose or deoxyribose sugar joined to a purine or a pyrimidine base and to a phosphate group, and that are the basic structural units of nucleic acids. The term "nucleoside" refers to a compound (as guanosine or adenosine) that consists of a purine or pyrimidine base combined with deoxyribose or ribose and is found especially in nucleic acids. The term "nucleotide analog" or "nucleoside analog" refers, respectively, to a nucleotide or nucleoside in which one or more individual atoms have been replaced with a different atom or with a different functional group. Accordingly, the term polynucleotide includes nucleic acids of any length, DNA, RNA, analogs and fragments thereof. A polynucleotide of three or more nucleotides is also called nucleotidic oligomer or oligonucleotide.
[0113] It is understood that the polynucleotides described herein include "genes" and that the nucleic acid molecules described herein include "vectors" or "plasmids." Accordingly, the term "gene", also called a "structural gene" refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions, including introns, 5'-untranslated region (UTR), and 3'-UTR, as well as the coding sequence.
[0114] The term "operon" refers to two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified (i.e., increased, decreased, or eliminated) by modifying the common promoter. Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and/or the ability to function in alternative environmental conditions.
[0115] A "vector" is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are "episomes," that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an agrobacterium or a bacterium.
[0116] "Transformation" refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including chemical transformation (e.g. lithium acetate transformation), electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), or agrobacterium mediated transformation.
[0117] The term "enzyme" as used herein refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide, but can include enzymes composed of a different molecule including polynucleotides.
[0118] The term "protein," "peptide," or "polypeptide" as used herein indicates an organic polymer composed of two or more amino acidic monomers and/or analogs thereof. As used herein, the term "amino acid" or "amino acidic monomer" refers to any natural and/or synthetic amino acids including glycine and both D or L optical isomers. The term "amino acid analog" refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, or with a different functional group. Accordingly, the term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called a protein oligomer or oligopeptide
[0119] The term "homolog", used with respect to an original enzyme or gene of a first family or species, refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes.
[0120] A protein has "homology" or is "homologous" to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second protein if the two proteins have "similar" amino acid sequences. (Thus, the term "homologous proteins" is defined to mean that the two proteins have similar amino acid sequences).
[0121] The term "analog" or "analogous" refers to nucleic acid or protein sequences or protein structures that are related to one another in function only and are not from common descent or do not share a common ancestral sequence. Analogs may differ in sequence but may share a similar structure, due to convergent evolution. For example, two enzymes are analogs or analogous if the enzymes catalyze the same reaction of conversion of a substrate to a product, are unrelated in sequence, and irrespective of whether the two enzymes are related in structure.
[0122] As used herein and as would be understood by one of ordinary skill in the art, "reduced activity and/or expression" of an endogenous protein such an enzyme can mean either a reduced specific catalytic activity of the protein (e.g. reduced activity) and/or decreased concentrations of the protein in the cell (e.g. reduced expression), while "deleted activity and/or expression" of an endogenous protein such an enzyme can mean either no or negligible specific catalytic activity of the enzyme (e.g. deleted activity) and/or no or negligible concentrations of the enzyme in the cell (e.g. deleted expression).
[0123] The term "reduced pyruvate decarboxylase activity" means either a decreased concentration of the pyruvate decarboxylase enzyme in the cell or reduced or no specific catalytic activity of the pyruvate decarboxylase enzyme.
[0124] The term "reduced glycerol-3-phosphate dehydrogenase activity" means either a decreased concentration of the glycerol-3-phosphate dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the glycerol-3-phosphate dehydrogenase enzyme.
[0125] The term "reduced pyruvate dehydrogenase activity" means either a decreased concentration of the pyruvate dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the pyruvate dehydrogenase enzyme.
[0126] The term "reduced xylose reductase activity" means either a decreased concentration of the xylose reductase enzyme in the cell or reduced or no specific catalytic activity of the xylose reductase enzyme.
[0127] The term "reduced xylitol dehydrogenase activity" means either a decreased concentration of xylitol dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the xylitol dehydrogenase enzyme.
The Microorganism in General
[0128] Native producers of 1-butanol, such as Clostridium acetobutylicum, are known, but these organisms also generate byproducts such as acetone, ethanol, and butyrate during fermentations. Furthermore, these microorganisms are relatively difficult to manipulate, with significantly fewer tools available than in more commonly used production hosts such as E. coli and yeast (e.g. S. cerevisiae).
[0129] Yeast cells produce pyruvate from sugars, which is then utilized in a number of pathways of cellular metabolism. Yeast cells can be engineered to produce a number of desirable products with the initial biosynthetic pathway step being conversion of endogenous pyruvate to acetolactate. The present inventors have observed that by combining the expression of a cytosolically localized acetolactate synthase enzyme with reduced pyruvate decarboxylase (PDC) activity and/or reduced glycerol-3-phosphate dehydrogenase (GPD) activity, an unexpectedly high flux from pyruvate to acetolactate can be achieved. Thus, the invention provides yeast cells that are engineered to exhibit an efficient conversion of pyruvate to acetolactate in the cytoplasm due to suppression of competing metabolic pathways. Therefore, as would be understood in the art, the present invention has utility for the production of any acetolactate-derived product, including, but not limited to, isobutanol, 2-butanol, 1-butanol, 2-butanone, 2,3-butanediol, valine, leucine, and 3-methyl-1-butanol.
[0130] Engineered biosynthetic pathways for synthesis of isobutanol are described in commonly owned and co-pending applications U.S. Ser. No. 12/343,375 (published as US 2009/0226991), U.S. Ser. No. 12/696,645, U.S. Ser. No. 12/610,784, PCT/US09/62952 (published as WO/2010/051527), and PCT/US09/69390, all of which are herein incorporated by reference in their entireties for all purposes. Additional pathways have been described for the synthesis of 1-butanol (See, e.g., commonly owned U.S. Provisional Application Nos. 60/940,877 and 60/945,576, as well as WO/2010/017230 and WO/2010/031772), 2-butanol (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), 2-butanone (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), 2,3-butanediol (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), valine (See, e.g., WO/2001/021772, and McCourt et al., 2006, Amino Acids 31: 173-210), leucine (See, e.g., WO/2001/021772, and McCourt et al., 2006, Amino Acids 31: 173-210), pantothenic acid (See, e.g., WO/2001/021772), and 3-methyl-1-butanol (See, e.g., WO/2008/098227, Atsumi et al., 2008, Nature 451: 86-89, and Connor et al., 2008, Appl. Environ. Microbiol. 74: 5769-5775). Each of these pathways shares the common intermediate acetolactate. Therefore, the product yield from these biosynthetic pathways will in part depend upon the amount of acetolactate that is available to downstream enzymes of said biosynthetic pathways.
[0131] In various embodiments described herein, the present invention provides recombinant microorganisms that comprise an isobutanol producing metabolic pathway. Recombinant microorganisms provided herein can express a plurality of heterologous and/or native target enzymes involved in pathways for the production isobutanol from a suitable carbon source.
[0132] Accordingly, metabolically "engineered" or "modified" microorganisms are produced via the introduction of genetic material into a host or parental microorganism of choice and/or by modification of the expression of native genes, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and/or the modification of the expression of native genes the parental microorganism acquires new properties, e.g. the ability to produce a new, or greater quantities of, an intracellular metabolite. As described herein, the introduction of genetic material into and/or the modification of the expression of native genes in a parental microorganism results in a new or modified ability to produce isobutanol. The genetic material introduced into and/or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of isobutanol and may also include additional elements for the expression and/or regulation of expression of these genes, e.g. promoter sequences.
[0133] In addition to the introduction of a genetic material into a host or parental microorganism, an engineered or modified microorganism can also include alteration, disruption, deletion or knocking-out of a gene or polynucleotide to alter the cellular physiology and biochemistry of the microorganism. Through the alteration, disruption, deletion or knocking-out of a gene or polynucleotide the microorganism acquires new or improved properties (e.g., the ability to produce a new metabolite or greater quantities of an intracellular metabolite, improve the flux of a metabolite down a desired pathway, and/or reduce the production of byproducts).
[0134] Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., isobutanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.
[0135] Exemplary metabolites include glucose, pyruvate, and isobutanol. The metabolite isobutanol can be produced by a recombinant microorganism metabolically engineered to express or over-express a metabolic pathway that converts pyruvate to isobutanol. An exemplary metabolic pathway that converts pyruvate to isobutanol may be comprised of an acetohydroxy acid synthase (ALS), a ketolacid reductoisomerase (KARI), a dihyroxy-acid dehydratase (DHAD), a 2-keto-acid decarboxylase (KIVD), and an alcohol dehydrogenase (ADH). Exemplary metabolic pathways that convert pyruvate to isobutanol are disclosed in WO/2007/050671, WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9.
[0136] Accordingly, provided herein are recombinant microorganisms that produce isobutanol and in some aspects may include the elevated expression of target enzymes such as ALS, KARI, DHAD, KIVD, and ADH.
[0137] The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutation and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art.
[0138] Due to the inherent degeneracy of the genetic code, other polynucleotides which encode substantially the same or functionally equivalent polypeptides can also be used to clone and express the polynucleotides encoding such enzymes.
[0139] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, a process sometimes called "codon optimization" or "controlling for species codon bias."
[0140] Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (see also, Murray et al. (1989) Nucl. Acids Res. 17:477-508) can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et al. (1996) Nucl. Acids Res. 24: 216-218). Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891, and the references cited therein.
[0141] Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as they modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.
[0142] In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.
[0143] As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences have at least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In one embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0144] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art (see, e.g., Pearson W. R. Using the FASTA program to search protein and DNA sequence databases, Methods in Molecular Biology, 1994, 25:365-89, hereby incorporated herein by reference).
[0145] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0146] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG contains programs such as "Gap" and "Bestfit" which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutant protein thereof. See, e.g., GCG Version 6.1.
[0147] A typical algorithm used comparing a molecule sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul, S. F., et al. (1990) "Basic local alignment search tool." J. Mol. Biol. 215:403-410; Gish, W. and States, D. J. (1993) "Identification of protein coding regions by database similarity search." Nature Genet. 3:266-272; Madden, T. L., et al. (1996) "Applications of network BLAST server" Meth. Enzymol. 266:131-141; Altschul, S. F., et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs." Nucleic Acids Res. 25:3389-3402; Zhang, J. and Madden, T. L. (1997) "PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation." Genome Res. 7:649-656), especially blastp or tblastn (Altschul, S. F., et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs." Nucleic Acids Res. 25:3389-3402). Typical parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size: 11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62.
[0148] When searching a database containing sequences from a large number of different organisms, it is typical to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, W. R. (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA" Meth. Enzymol. 183:63-98). For example, a percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1, hereby incorporated herein by reference.
[0149] The disclosure provides metabolically engineered microorganisms comprising a biochemical pathway for the production of isobutanol from a suitable substrate at a high yield. A metabolically engineered microorganism of the disclosure comprises one or more recombinant polynucleotides within the genome of the organism or external to the genome within the organism. The microorganism can comprise a reduction, disruption or knockout of a gene found in the wild-type organism and/or introduction of a heterologous polynucleotide and/or expression or overexpression of an endogenous polynucleotide.
[0150] In one aspect, the disclosure provides a recombinant microorganism comprising elevated expression of at least one target enzyme as compared to a parental microorganism or encodes an enzyme not found in the parental organism. In another or further aspect, the microorganism comprises a reduction, disruption or knockout of at least one gene encoding an enzyme that competes with a metabolite necessary for the production of isobutanol. The recombinant microorganism produces at least one metabolite involved in a biosynthetic pathway for the production of isobutanol. In general, the recombinant microorganisms comprises at least one recombinant metabolic pathway that comprises a target enzyme and may further include a reduction in activity or expression of an enzyme in a competitive biosynthetic pathway. The pathway acts to modify a substrate or metabolic intermediate in the production of isobutanol. The target enzyme is encoded by, and expressed from, a polynucleotide derived from a suitable biological source. In some embodiments, the polynucleotide comprises a gene derived from a prokaryotic or eukaryotic source and recombinantly engineered into the microorganism of the disclosure. In other embodiments, the polynucleotide comprises a gene that is native to the host organism.
[0151] It is understood that a range of microorganisms can be modified to include a recombinant metabolic pathway suitable for the production of isobutanol. In various embodiments, microorganisms may be selected from yeast microorganisms. Yeast microorganisms for the production of isobutanol may be selected based on certain characteristics:
[0152] One characteristic may include the property that the microorganism is selected to convert various carbon sources into isobutanol. The term "carbon source" generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Carbon sources include, but are not limited to, biomass hydrolysates, starch, sucrose, cellulose, hemicellulose, xylose, and lignin, as well as monomeric components of these substrates. Carbon sources can comprise various organic compounds in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, etc. These include, for example, various monosaccharides such as glucose, dextrose (D-glucose), maltose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinate, lactate, acetate, ethanol, etc., or mixtures thereof. Photosynthetic organisms can additionally produce a carbon source as a product of photosynthesis. In some embodiments, carbon sources may be selected from biomass hydrolysates and glucose. The term "biomass" as used herein refers primarily to the stems, leaves, and starch-containing portions of green plants, and is mainly comprised of starch, lignin, cellulose, hemicellulose, and/or pectin. Biomass can be decomposed by either chemical or enzymatic treatment to the monomeric sugars and phenols of which it is composed (Wyman, C. E. 2003 Biotechnological Progress 19:254-62). This resulting material, called biomass hydrolysate, is neutralized and treated to remove trace amounts of organic material that may adversely affect the biocatalyst, and is then used as a feed stock for fermentations using a biocatalyst.
[0153] Accordingly, in one embodiment, the recombinant microorganism herein disclosed can convert a variety of carbon sources to products, including but not limited to glucose, galactose, mannose, xylose, arabinose, lactose, sucrose, and mixtures thereof.
[0154] The recombinant microorganism may thus further include a pathway for the fermentation of isobutanol from five-carbon (pentose) sugars including xylose. Most yeast species metabolize xylose via a complex route, in which xylose is first reduced to xylitol via a xylose reductase (XR) enzyme. The xylitol is then oxidized to xylulose via a xylitol dehydrogenase (XDH) enzyme. The xylulose is then phosphorylated via a xylulokinase (XK) enzyme. This pathway operates inefficiently in yeast species because it introduces a redox imbalance in the cell. The xylose-to-xylitol step uses NADH as a cofactor, whereas the xylitol-to-xylulose step uses NADPH as a cofactor. Other processes must operate to restore the redox imbalance within the cell. This often means that the organism cannot grow anaerobically on xylose or other pentose sugar. Accordingly, a yeast species that can efficiently ferment xylose and other pentose sugars into a desired fermentation product is therefore very desirable.
[0155] Thus, in one embodiment, the recombinant is engineered to express a functional exogenous xylose isomerase. Exogenous xylose isomerases functional in yeast are known in the art. See, e.g., Rajgarhia et al, US20060234364, which is herein incorporated by reference in its entirety. In another embodiment, the exogenous xylose isomerase gene is operatively linked to promoter and terminator sequences that are functional in the yeast cell.
[0156] In another embodiment, the recombinant microorganism has a deletion or disruption of a native gene that encodes for an enzyme (e.g. XR and/or XDH) that catalyzes the conversion of xylose to xylitol. Thus, in one embodiment, the recombinant microorganism is engineered to exhibit reduced xylose reductase (XR) activity. In another embodiment, the recombinant microorganism is engineered to exhibit reduced xylitol dehydrogenase (XDH) activity. In yet another embodiment, the recombinant microorganism also contains a functional, exogenous xylulokinase (XK) gene operatively linked to promoter and terminator sequences that are functional in the yeast cell. In one embodiment, the xylulokinase (XK) gene is overexpressed.
[0157] In one embodiment, the microorganism has reduced or no pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to acetaldehyde, which is then reduced to ethanol by ADH via an oxidation of NADH to NAD+. Ethanol production is the main pathway to oxidize the NADH from glycolysis. Deletion of this pathway increases the pyruvate and the reducing equivalents (NADH) available for the isobutanol pathway. Accordingly, deletion of PDC genes further increases the yield of isobutanol.
[0158] In another embodiment, the microorganism has reduced or no glycerol-3-phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) via the oxidation of NADH to NAD+. Glycerol is then produced from G3P by Glycerol-3-phosphatase (GPP). Glycerol production is a secondary pathway to oxidize excess NADH from glycolysis. Reduction or elimination of this pathway increases the pyruvate and reducing equivalents (NADH) available for the isobutanol pathway. Thus, deletion of GPD genes further increases the yield of isobutanol.
[0159] In yet another embodiment, the microorganism has reduced or no PDC activity and reduced or no GPD activity.
[0160] Another characteristic may include the property that the wild-type or parental microorganism is non-fermenting. In other words, it cannot metabolize a carbon source anaerobically while the yeast is able to metabolize a carbon source in the presence of oxygen. Non-fermenting yeast refers to both naturally occurring yeasts as well as genetically modified yeast. During anaerobic fermentation with fermentative yeast, the main pathway to oxidize the NADH from glycolysis is through the production of ethanol. Ethanol is produced by alcohol dehydrogenase (ADH) via the reduction of acetaldehyde, which is generated from pyruvate by pyruvate decarboxylase (PDC). Thus, in one embodiment, a fermentative yeast can be engineered to be non-fermentative by the reduction or elimination of the native PDC activity. Thus, most of the pyruvate produced by glycolysis is not consumed by PDC and is available for the isobutanol pathway. Deletion of this pathway increases the pyruvate and the reducing equivalents available for the isobutanol pathway. Fermentative pathways contribute to low yield and low productivity of isobutanol. Accordingly, deletion of PDC may increase yield and productivity of isobutanol.
[0161] A third characteristic may include the property that the biocatalyst is selected to convert various carbon sources into isobutanol.
[0162] In one embodiment, the yeast microorganisms may be selected from the "Saccharomyces Yeast Clade", defined as an ascomycetous yeast taxonomic class by Kurtzman and Robnett in 1998 ("Identification and phylogeny of ascomycetous yeast from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences." Antonie van Leeuwenhoek 73: 331-371, See FIG. 2 of Leeuwenhoek reference). They were able to determine the relatedness of approximately 500 yeast species by comparing the nucleotide sequence of the D1/D2 domain at the 5' end of the gene encoding the large ribosomal subunit 26S. In pair-wise comparisons of the D1/D2 nucleotide sequences of S. cerevisiae and the two most distant yeast from S. cerevisiae, K. lactis and K. marxianus, share greater than 80% identity.
[0163] The term "Saccharomyces sensu stricto" taxonomy group is a cluster of yeast species that are highly related to S. cerevisiae (Rainieri, S. et al 2003. Saccharomyces Sensu Stricto: Systematics, Genetic Diversity and Evolution. J. Biosci Bioengin 96(1)1-9. Saccharomyces sensu stricto yeast species include but are not limited to S. cerevisiae, S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids derived from these species (Masneuf et al. 1998. New Hybrids between Saccharomyces Sensu Stricto Yeast Species Found Among Wine and Cider Production Strains. Yeast 7(1)61-72).
[0164] An ancient whole genome duplication (WGD) event occurred during the evolution of the hemiascomycete yeast and was discovered using comparative genomic tools (Kellis et al 2004 "Proof and evolutionary analysis of ancient genome duplication in the yeast S. cerevisiae." Nature 428:617-624. Dujon et al 2004 "Genome evolution in yeasts." Nature 430:35-44. Langkjaer et al 2003 "Yeast genome duplication was followed by asynchronous differentiation of duplicated genes." Nature 428:848-852. Wolfe and Shields 1997 "Molecular evidence for an ancient duplication of the entire yeast genome." Nature 387:708-713.) Using this major evolutionary event, yeast can be divided into species that diverged from a common ancestor following the WGD event (termed "post-WGD yeast" herein) and species that diverged from the yeast lineage prior to the WGD event (termed "pre-WGD yeast" herein).
[0165] Accordingly, in one embodiment, the yeast microorganism may be selected from a post-WGD yeast genus, including but not limited to Saccharomyces and Candida. The favored post-WGD yeast species include: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, and C. glabrata.
[0166] In another embodiment, the yeast microorganism may be selected from a pre-whole genome duplication (pre-WGD) yeast genus including but not limited to Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Yarrowia and, Schizosaccharomyces. Representative pre-WGD yeast species include: S. kluyveri, K. thermotolerans, K. marxianus, K. waltii, K. lactis, C. tropicalis, P. pastoris, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, D. hansenii, H. anomala, Y. lipolytica, and S. pombe.
[0167] A yeast microorganism may be either Crabtree-negative or Crabtree-positive. A yeast cell having a Crabtree-negative phenotype is any yeast cell that does not exhibit the Crabtree effect. The term "Crabtree-negative" refers to both naturally occurring and genetically modified organisms. Briefly, the Crabtree effect is defined as the inhibition of oxygen consumption by a microorganism when cultured under aerobic conditions due to the presence of a high concentration of glucose (e.g., 50 g-glucose L.sup.-1). In other words, a yeast cell having a Crabtree-positive phenotype continues to ferment irrespective of oxygen availability due to the presence of glucose, while a yeast cell having a Crabtree-negative phenotype does not exhibit glucose mediated inhibition of oxygen consumption.
[0168] Accordingly, in one embodiment the yeast microorganism may be selected from yeast with a Crabtree-negative phenotype including but not limited to the following genera: Kluyveromyces, Pichia, Issatchenkia, Hansenula, and Candida. Crabtree-negative species include but are not limited to: K. lactis, K. marxianus, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, H. anomala, and C. utilis.
[0169] In another embodiment, the yeast microorganism may be selected from a yeast with a Crabtree-positive phenotype, including but not limited to Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Pichia and Schizosaccharomyces. Crabtree-positive yeast species include but are not limited to: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, S. kluyveri, K. thermotolerans, C. glabrata, Z. bailli, Z. rouxii, D. hansenii, P. pastorius, and S. pombe.
[0170] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, or Myxozyma.
[0171] In one embodiment, a yeast microorganism is engineered to convert a carbon source, such as glucose, to pyruvate by glycolysis and the pyruvate is converted to isobutanol via an engineered isobutanol pathway (See, e.g., WO/2007/050671, WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9). Alternative pathways for the production of isobutanol have been described in WO/2007/050671 and in Dickinson et al., Journal of Biological Chemistry 273:25751-15756 (1998).
[0172] Accordingly, in one embodiment, the engineered isobutanol pathway to convert pyruvate to isobutanol can be comprised of the following reactions:
1. 2 pyruvate.fwdarw.acetolactate+CO.sub.2 2. acetolactate+NAD(P)H.fwdarw.2,3-dihydroxyisovalerate+NAD(P)+ 3. 2,3-dihydroxyisovalerate.fwdarw.alpha-ketoisovalerate 4. alpha-ketoisovalerate.fwdarw.isobutyraldehyde+CO.sub.2 5. isobutyraldehyde+NAD(P)H.fwdarw.isobutanol+NAD(P).sup.+
[0173] These reactions are carried out by the enzymes 1) Acetolactate Synthase (ALS), 2) Keto-acid Reducto-Isomerase (KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) Keto-isovalerate decarboxylase (KIVD), and 5) an Alcohol dehydrogenase (ADH).
[0174] In another embodiment, the yeast microorganism is engineered to overexpress these enzymes. For example, these enzymes can be encoded by native genes. Alternatively, these enzymes can be encoded by heterologous genes. For example, ALS can be encoded by the alsS gene of B. subtilis, alsS of L. lactis, or the ilvK gene of K. pneumonia. For example, KARI can be encoded by the ilvC genes of E. coli, C. glutamicum, M. maripaludis, or Piromyces sp E2. For example, DHAD can be encoded by the ilvD genes of E. coli, C. glutamicum, or L. lactis. KIVD can be encoded by the kivD gene of L. lactis. ADH can be encoded by ADH2, ADH6, or ADH7 of S. cerevisiae.
[0175] In one embodiment, pathway steps 2 and 5 may be carried out by KARI and ADH enzymes that utilize NADH (rather than NADPH) as a co-factor. Such enzymes are described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527), which are herein incorporated by reference in their entireties for all purposes. The present inventors have found that utilization of NADH-dependent KARI and ADH enzymes to catalyze pathway steps 2 and 5, respectively, surprisingly enables production of isobutanol under anaerobic conditions. Thus, in one embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2, 3-dihydroxyisovalerate. In another embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol. In yet another embodiment, the recombinant microorganisms of the present invention may use both an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2, 3-dihydroxyisovalerate, and an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol.
[0176] The yeast microorganism of the invention may be engineered to have increased ability to convert pyruvate to isobutanol. In one embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutyraldehyde. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to keto-isovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to 2, 3-dihydroxyisovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to acetolactate.
[0177] Furthermore, any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof)) may be optimized by genetic/protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. Such action allows those of ordinary skill in the art to optimize the enzymes for expression and activity in yeast.
[0178] In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes, including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. stipitis, Torulaspora spp, including T. pretoriensis, Schizosaccharomyces spp., including S. pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp., or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.
Methods in General
Identification of PDC in a Yeast Microorganism
[0179] Any method can be used to identify genes that encode for enzymes with pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to form acetaldehyde. Generally, homologous or similar PDC genes and/or homologous or similar PDC enzymes can be identified by functional, structural, and/or genetic analysis. In most cases, homologous or similar PDC genes and/or homologous or similar PDC enzymes will have functional, structural, or genetic similarities. Techniques known to those skilled in the art may be suitable to identify homologous genes and homologous enzymes. Generally, analogous genes and/or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a PDC gene by PCR using primers based on a published sequence of a gene/enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among PDC genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity, then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein. Furthermore, PDC activity can be determined phenotypically. For example, ethanol production under fermentative conditions can be assessed. A lack of ethanol production may be indicative of a yeast microorganism with no PDC activity. Examples of yeast pyruvate decarboxylase genes that may be targeted for disruption may be found in U.S. Pat. No. 7,326,550. Target genes for disruption include, but are not limited, to PDC1 (GenBank Accession No. CAA97573.1), PDC5 (GenBank Accession No. CAA97705.1), and PDC6 (GenBank Accession No. CAA97089.1) from S. cerevisiae, as well as genes encoding pyruvate decarboxylases from K. lactis (GenBank Accession No. CAA59953.1), K. marxianus (AAA35267.1), P. stipitis (GenBank Accession No. AAC03164.3), C. glabrata (AAN77243.1), S. pombe (GenBank Accession No. NP_592796.2), and Y. lipolytica (CAG80835.1). Other target genes, such as those encoding pyruvate decarboxylase proteins having at least about 50-55%, 55%-60%, 60-65%, 65%-70%, 75-80%, 80-85%, 85%-90%, 90%-95%, or at least about 98% sequence identity to the S. cerevisiae pyruvate decarboxylases may be identified in the literature and in bioinformatics databases well known to the skilled person.
Identification of GPD in a Yeast Microorganism
[0180] Any method can be used to identify genes that encode for enzymes with glycerol-3-phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) with the corresponding oxidation of NADH to NAD+. Generally, homologous or similar GPD genes and/or homologous or similar GPD enzymes can be identified by functional, structural, and/or genetic analysis. In most cases, homologous or similar GPD genes and/or homologous or similar GPD enzymes will have functional, structural, or genetic similarities. Techniques known to those skilled in the art may be suitable to identify homologous genes and homologous enzymes. Generally, analogous genes and/or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a GPD gene by PCR using primers based on a published sequence of a gene/enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among GPD genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity, then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein. Furthermore, GPD activity can be determined phenotypically. For example, glycerol production under fermentative conditions can be assessed. A lack of glycerol production may be indicative of a yeast microorganism with no GPD activity. Examples of yeast glycerol-3-phosphate dehydrogenase genes that may be targeted for disruption may be found in US 2009/0053782. Other target genes, such as those encoding glycerol-3-phosphate dehydrogenase proteins having at least about 50-55%, 55%-60%, 60-65%, 65%-70%, 75-80%, 80-85%, 85%-90%, 90%-95%, or at least about 98% sequence identity to the S. cerevisiae glycerol-3-phosphate dehydrogenases may be identified in the literature and in bioinformatics databases well known to the skilled person.
Genetic Insertions and Deletions
[0181] Any method can be used to introduce a nucleic acid molecule into yeast and many such methods are well known. For example, transformation and electroporation are common methods for introducing nucleic acid into yeast cells. See, e.g., Gietz et al., Nucleic Acids Res. 27:69-74 (1992); Ito et al., J. Bacteriol. 153:163-168 (1983); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991).
[0182] In an embodiment, the integration of a gene of interest into a DNA fragment or target gene of a yeast microorganism occurs according to the principle of homologous recombination. According to this embodiment, an integration cassette containing a module comprising at least one yeast marker gene and/or the gene to be integrated (internal module) is flanked on either side by DNA fragments homologous to those of the ends of the targeted integration site (recombinogenic sequences). After transforming the yeast with the cassette by appropriate methods, a homologous recombination between the recombinogenic sequences may result in the internal module replacing the chromosomal region in between the two sites of the genome corresponding to the recombinogenic sequences of the integration cassette. (Orr-Weaver et al., Proc Natl Acad Sci USA 78:6354-6358 (1981))
[0183] In an embodiment, the integration cassette for integration of a gene of interest into a yeast microorganism includes the heterologous gene under the control of an appropriate promoter and terminator together with the selectable marker flanked by recombinogenic sequences for integration of a heterologous gene into the yeast chromosome. In an embodiment, the heterologous gene includes an appropriate native gene desired to increase the copy number of a native gene(s). The selectable marker gene can be any marker gene used in yeast, including but not limited to, HIS3, TRP1, LEU2, URA3, bar, ble, hph, and kan. The recombinogenic sequences can be chosen at will, depending on the desired integration site suitable for the desired application.
[0184] In another embodiment, integration of a gene into the chromosome of the yeast microorganism may occur via random integration (Kooistra, R., Hooykaas, P. J. J., Steensma, H. Y. 2004. Yeast 21: 781-792).
[0185] Additionally, in an embodiment, certain introduced marker genes are removed from the genome using techniques well known to those skilled in the art. For example, URA3 marker loss can be obtained by plating URA3 containing cells in FOA (5-fluoro-orotic acid) containing medium and selecting for FOA resistant colonies (Boeke, J. et al, 1984, Mol. Gen. Genet, 197, 345-47).
[0186] The exogenous nucleic acid molecule contained within a yeast cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state that can stably be passed on ("inherited") to daughter cells. Such extra-chromosomal genetic elements (such as plasmids, etc.) can additionally contain selection markers that ensure the presence of such genetic elements in daughter cells. Moreover, the yeast cells can be stably or transiently transformed. In addition, the yeast cells described herein can contain a single copy, or multiple copies of a particular exogenous nucleic acid molecule as described above.
Reduction of Enzymatic Activity
[0187] Yeast microorganisms within the scope of the invention may have reduced enzymatic activity such as reduced pyruvate decarboxylase activity. The term "reduced" as used herein with respect to a particular enzymatic activity refers to a lower level of enzymatic activity than that measured in a comparable yeast cell of the same species. The term reduced also refers to the elimination of enzymatic activity than that measured in a comparable yeast cell of the same species. Thus, yeast cells lacking pyruvate decarboxylase activity are considered to have reduced pyruvate decarboxylase activity since most, if not all, comparable yeast strains have at least some pyruvate decarboxylase activity. Such reduced enzymatic activities can be the result of lower enzyme concentration, lower specific activity of an enzyme, or a combination thereof. Many different methods can be used to make yeast having reduced enzymatic activity. For example, a yeast cell can be engineered to have a disrupted enzyme-encoding locus using common mutagenesis or knock-out technology. See, e.g., Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Stems, Cold Spring Harbor Press (1998). In addition, certain point-mutation(s) can be introduced which results in an enzyme with reduced activity.
[0188] Alternatively, antisense technology can be used to reduce enzymatic activity. For example, yeast can be engineered to contain a cDNA that encodes an antisense molecule that prevents an enzyme from being made. The term "antisense molecule" as used herein encompasses any nucleic acid molecule that contains sequences that correspond to the coding strand of an endogenous polypeptide. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.
[0189] Yeast having a reduced enzymatic activity can be identified using many methods. For example, yeast having reduced pyruvate decarboxylase activity can be easily identified using common methods, which may include, for example, measuring ethanol formation via gas chromatography.
Overexpression of Heterologous Genes
[0190] Methods for overexpressing a polypeptide from a native or heterologous nucleic acid molecule are well known. Such methods include, without limitation, constructing a nucleic acid sequence such that a regulatory element promotes the expression of a nucleic acid sequence that encodes the desired polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Thus, regulatory elements include, without limitation, promoters, enhancers, and the like. For example, the exogenous genes can be under the control of an inducible promoter or a constitutive promoter. Moreover, methods for expressing a polypeptide from an exogenous nucleic acid molecule in yeast are well known. For example, nucleic acid constructs that are used for the expression of exogenous polypeptides within Kluyveromyces and Saccharomyces are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529, for Kluyveromyces and, e.g., Gellissen et al., Gene 190(1):87-97 (1997) for Saccharomyces). Yeast plasmids have a selectable marker and an origin of replication. In addition certain plasmids may also contain a centromeric sequence. These centromeric plasmids are generally a single or low copy plasmid. Plasmids without a centromeric sequence and utilizing either a 2 micron (S. cerevisiae) or 1.6 micron (K. lactis) replication origin are high copy plasmids. The selectable marker can be either prototrophic, such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance, such as, bar, ble, hph, or kan.
[0191] In another embodiment, heterologous control elements can be used to activate or repress expression of endogenous genes. Additionally, when expression is to be repressed or eliminated, the gene for the relevant enzyme, protein or RNA can be eliminated by known deletion techniques.
[0192] As described herein, any yeast within the scope of the disclosure can be identified by selection techniques specific to the particular enzyme being expressed, over-expressed or repressed. Methods of identifying the strains with the desired phenotype are well known to those skilled in the art. Such methods include, without limitation, PCR, RT-PCR, and nucleic acid hybridization techniques such as Northern and Southern analysis, altered growth capabilities on a particular substrate or in the presence of a particular substrate, a chemical compound, a selection agent and the like. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of the encoded polypeptide. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular yeast cell contains that encoded enzyme. Further, biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting a product produced as a result of the expression of the enzymatic polypeptide. For example, transforming a cell with a vector encoding acetolactate synthase and detecting increased acetolactate concentrations compared to a cell without the vector indicates that the vector is both present and that the gene product is active. Methods for detecting specific enzymatic activities or the presence of particular products are well known to those skilled in the art. For example, the presence of acetolactate can be determined as described by Hugenholtz and Starrenburg, Appl. Microbiol. Biotechnol. 38:17-22 (1992).
Increase of Enzymatic Activity
[0193] Yeast microorganisms of the invention may be further engineered to have increased activity of enzymes. The term "increased" as used herein with respect to a particular enzymatic activity refers to a higher level of enzymatic activity than that measured in a comparable yeast cell of the same species. For example, overexpression of a specific enzyme can lead to an increased level of activity in the cells for that enzyme. Increased activities for enzymes involved in glycolysis or the isobutanol pathway would result in increased productivity and yield of isobutanol.
[0194] Methods to increase enzymatic activity are known to those skilled in the art. Such techniques may include increasing the expression of the enzyme by increased copy number and/or use of a strong promoter, introduction of mutations to relieve negative regulation of the enzyme, introduction of specific mutations to increase specific activity and/or decrease the Km for the substrate, or by directed evolution. See, e.g., Methods in Molecular Biology (vol. 231), ed. Arnold and Georgiou, Humana Press (2003).
Carbon Source
[0195] The biocatalyst herein disclosed can convert various carbon sources into isobutanol. The term "carbon source" generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Carbon sources include, but are not limited to, biomass hydrolysates, starch, sucrose, cellulose, hemicellulose, xylose, and lignin, as well as monomeric components of these substrates. Carbon sources can comprise various organic compounds in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, etc. These include, for example, various monosaccharides such as glucose, dextrose (D-glucose), maltose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinate, lactate, acetate, ethanol, etc., or mixtures thereof. Photosynthetic organisms can additionally produce a carbon source as a product of photosynthesis. In some embodiments, carbon sources may be selected from biomass hydrolysates and glucose.
[0196] The term "C2-compound" as used as a carbon source for engineered yeast microorganisms with mutations in all pyruvate decarboxylase (PDC) genes resulting in a reduction of pyruvate decarboxylase activity of said genes refers to organic compounds comprised of two carbon atoms, including but not limited to ethanol and acetate
[0197] The term "feedstock" is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.
[0198] The term "traditional carbohydrates" refers to sugars and starches generated from specialized plants, such as sugar cane, corn, and wheat. Frequently, these specialized plants concentrate sugars and starches in portions of the plant, such as grains, that are harvested and processed to extract the sugars and starches. Traditional carbohydrates are used as food and also to a lesser extent as carbon sources for fermentation processes to generate biofuels, such as and chemicals
[0199] The term "biomass" as used herein refers primarily to the stems, leaves, and starch-containing portions of green plants, and is mainly comprised of starch, lignin, cellulose, hemicellulose, and/or pectin. Biomass can be decomposed by either chemical or enzymatic treatment to the monomeric sugars and phenols of which it is composed (Wyman, C. E. 2003 Biotechnological Progress 19:254-62). This resulting material, called biomass hydrolysate, is neutralized and treated to remove trace amounts of organic material that may adversely affect the biocatalyst, and is then used as a feed stock for fermentations using a biocatalyst.
[0200] The term "starch" as used herein refers to a polymer of glucose readily hydrolyzed by digestive enzymes. Starch is usually concentrated in specialized portions of plants, such as potatoes, corn kernels, rice grains, wheat grains, and sugar cane stems.
[0201] The term "lignin" as used herein refers to a polymer material, mainly composed of linked phenolic monomeric compounds, such as p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol, which forms the basis of structural rigidity in plants and is frequently referred to as the woody portion of plants. Lignin is also considered to be the non-carbohydrate portion of the cell wall of plants.
[0202] The term "cellulose" as used herein refers is a long-chain polymer polysaccharide carbohydrate of beta-glucose of formula (C6H10O5)n, usually found in plant cell walls in combination with lignin and any hem icellulose.
[0203] The term "hemicellulose" refers to a class of plant cell-wall polysaccharides that can be any of several heteropolymers. These include xylane, xyloglucan, arabinoxylan, arabinogalactan, glucuronoxylan, glucomannan and galactomannan. Monomeric components of hemicellulose include, but are not limited to: D-galactose, L-galactose, D-mannose, L-rhamnose, L-fucose, D-xylose, L-arabinose, and D-glucuronic acid. This class of polysaccharides is found in almost all cell walls along with cellulose. Hemicellulose is lower in weight than cellulose and cannot be extracted by hot water or chelating agents, but can be extracted by aqueous alkali. Polymeric chains of hemicellulose bind pectin and cellulose in a network of cross-linked fibers forming the cell walls of most plant cells.
Microorganism Characterized by Producing Isobutanol at High Yield
[0204] For a biocatalyst to produce isobutanol most economically, it is desired to produce a high yield. Preferably, the only product produced is isobutanol. Extra products lead to a reduction in product yield and an increase in capital and operating costs, particularly if the extra products have little or no value. Extra products also require additional capital and operating costs to separate these products from isobutanol.
[0205] The microorganism may convert one or more carbon sources derived from biomass into isobutanol with a yield of greater than 5% of theoretical. In one embodiment, the yield is greater than 10%. In one embodiment, the yield is greater than 50% of theoretical. In one embodiment, the yield is greater than 60% of theoretical. In another embodiment, the yield is greater than 70% of theoretical. In yet another embodiment, the yield is greater than 80% of theoretical. In yet another embodiment, the yield is greater than 85% of theoretical. In yet another embodiment, the yield is greater than 90% of theoretical. In yet another embodiment, the yield is greater than 95% of theoretical. In still another embodiment, the yield is greater than 97.5% of theoretical.
[0206] More specifically, the microorganism converts glucose, which can be derived from biomass into isobutanol with a yield of greater than 5% of theoretical. In one embodiment, the yield is greater than 10% of theoretical. In one embodiment, the yield is greater than 50% of theoretical. In one embodiment the yield is greater than 60% of theoretical. In another embodiment, the yield is greater than 70% of theoretical. In yet another embodiment, the yield is greater than 80% of theoretical. In yet another embodiment, the yield is greater than 85% of theoretical. In yet another embodiment the yield is greater than 90% of theoretical. In yet another embodiment, the yield is greater than 95% of theoretical. In still another embodiment, the yield is greater than 97.5% of theoretical
Microorganism Expressing a Cytosolically Localized Acetolactate Synthase (ALS)
[0207] In yeasts such as S. cerevisiae, the native acetolactate synthase, encoded in S. cerevisiae by the ILV2 gene, is naturally expressed in the yeast mitochondria. Unlike the endogenous acetolactate synthase of yeast, expression of heterologous, acetolactate synthases such as the B. subtilis alsS and the L. lactis alsS in yeast occurs in the yeast cytosol (i.e. cytosolically-localized). Thus, cytosolic expression of acetolactate synthase is achieved by transforming a yeast with a gene encoding an acetolactate synthase protein (EC 2.2.1.6).
[0208] ALS homologs that could be cytosolically expressed and localized in yeast are predicted to lack a mitochondrial targeting sequence as analyzed using mitoprot (Claros et al., 1996, Eur. J. Biochem 241: 779-86). Such cytosolically localized ALS proteins can be used as the first step in the isobutanol pathway. ALS homologs include, but are not limited to, the following: the Serratia marcescens ALS (GenBank Accession No. ADH43113.1) (probability of mitochondrial localization 0.07), the Enterococcus faecalis ALS (GenBank Accession No. NP_814940) (probability of mitochondrial localization 0.21), the Leuconostoc mesenteroides (GenBank Accession No. YP_818010.1) (probability of mitochondrial localization 0.21), the Staphylococcus aureus ALS (GenBank Accession No. YP_417545) (probability of mitochondrial localization 0.13), the Burkholderia cenocepacia ALS (GenBank Accession No. YP_624435) (probability of mitochondrial localization 0.15), Trichoderma atroviride ALS (SEQ ID NO: 77) probability of mitochondrial localization 0.19), Talaromyces stipitatus ALS (SEQ ID NO: 78) (probability of mitochondrial localization 0.19), and Magnaporthe grisea ALS (GenBank Accession No. EDJ99221) (probability of mitochondrial localization 0.02).
[0209] In alternative embodiments described herein, an ALS enzyme that is predicted to be mitochondrially localized may be mutated or modified to remove or modify an N-terminal mitochondrial targeting sequence (MTS) to remove or eliminate its ability to target the ALS enzyme to the mitochondria. Removal of the MTS can increase cytosolic localization of the ALS and/or increase the cytosolic activity of the ALS as compared to the parental ALS.
[0210] Methods for gene expression in yeasts are known in the art (See, e.g., Methods in Enzymology, 2004, Vol 194, Guide to Yeast Genetics and Molecular and Cell Biology). As is understood in the art, the expression of heterologous, prokaryotic genes in yeast typically requires a promoter, operably linked to a coding region of interest, and a transcriptional terminator. A number of yeast promoters can be used in constructing expression cassettes for genes encoding an acetolactate synthase, including, but not limited to constitutive promoters FBA, GPD1, ADH1, and GPM, and the inducible promoters GAL1, GAL10, and CUP1. Suitable transcriptional terminators include, but are not limited to FBA, GPD, GPM, ERG10, GAL1, CYC1, and ADH1.
Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Isobutanol Pathway and a Pdc-Minus Phenotype
[0211] In yeast, the conversion of pyruvate to acetaldehyde is a major drain on the pyruvate pool (FIG. 2), and, hence, a major source of competition with the isobutanol pathway. This reaction is catalyzed by the pyruvate decarboxylase (PDC) enzyme. Reduction of this enzymatic activity in the yeast microorganism results in an increased availability of pyruvate and reducing equivalents to the isobutanol pathway and may improve isobutanol production and yield in a yeast microorganism that expresses a pyruvate-dependent isobutanol pathway (FIG. 3).
[0212] Reduction of PDC activity can be accomplished by 1) mutation or deletion of a positive transcriptional regulator for the structural genes encoding for PDC or 2) mutation or deletion of all PDC genes in a given organism. The term "transcriptional regulator" can specify a protein or nucleic acid that works in trans to increase or to decrease the transcription of a different locus in the genome. For example, in S. cerevisiae, the PDC2 gene, which encodes for a positive transcriptional regulator of PDC1,5,6 genes can be deleted; a S. cerevisiae in which the PDC2 gene is deleted is reported to have only .about.10% of wildtype PDC activity (Hohmann, Mol Gen Genet, 241:657-666 (1993)). Alternatively, for example, all structural genes for PDC (e.g. in S. cerevisiae, PDC1, PDC5, and PDC6, or in K. lactis, PDC1) are deleted.
[0213] Crabtree-positive yeast strains such as S. cerevisiae strain that contains disruptions in all three of the PDC alleles no longer produce ethanol by fermentation. However, a downstream product of the reaction catalyzed by PDC, acetyl-CoA, is needed for anabolic production of necessary molecules. Therefore, the Pdc-mutant is unable to grow solely on glucose, and requires a two-carbon carbon source, either ethanol or acetate, to synthesize acetyl-CoA. (Flikweert M T, de Swaaf M, van Dijken J P, Pronk J T. FEMS Microbiol Lett. 1999 May 1; 174(1):73-9. PMID:10234824 and van Maris A J, Geertman J M, Vermeulen A, Groothuizen M K, Winkler A A, Piper M D, van Dijken J P, Pronk J T. Appl Environ Microbiol. 2004 January; 70(1):159-66. PMID: 14711638).
[0214] Thus, in an embodiment, such a Crabtree-positive yeast strain may be evolved to generate variants of the PDC mutant yeast that do not have the requirement for a two-carbon molecule and has a growth rate similar to wild type on glucose. Any method, including chemostat evolution or serial dilution may be utilized to generate variants of strains with deletion of three PDC alleles that can grow on glucose as the sole carbon source at a rate similar to wild type (van Maris et al., Directed Evolution of Pyruvate Decarboxylase-Negative Saccharomyces cerevisiae, Yielding a C2-Independent, Glucose-Tolerant, and Pyruvate-Hyperproducing Yeast, Applied and Environmental Microbiology, 2004, 70(1), 159-166).
Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Isobutanol Pathway and a PDC-Minus GPD-Minus Phenotype
[0215] Another pathway for NADH oxidation is through the production of glycerol. Dihydroxyacetone-phosphate, an intermediate of glycolysis is reduced to glycerol 3-phosphate by glycerol 3-phosphate dehydrogenase (GPD). Glycerol 3-phosphatase (GPP) converts glycerol 3-phosphate to glycerol. This pathway consumes carbon from glucose as well as reducing equivalents (NADH) resulting in less pyruvate and reducing equivalents available for the isobutanol pathway. These pathways contribute to low yield and low productivity of isobutanol. Accordingly, deletions of PDC and GPD would increase yield and productivity of isobutanol. As exemplified in Examples 9 and 13, the yield may increase to 70% by the additional deletion of GPD. In an embodiment, a yeast microorganism may include a recombinant microorganism having an engineered pathway to convert a carbon source, such as glucose, to isobutanol.
[0216] Looking at FIG. 4, an additional deletion of GPD results in a reduction in the production of glycerol 3-phosphate and glycerol. This results in an increase in the amount of carbon from glucose being converted to pyruvate and also a decrease in the consumption of reducing equivalents. Both of these factors combined results in a further increase in yield of isobutanol.
[0217] Yield of isobutanol can be increased also by reduction of the glycerol 3-phosphate dehydrogenase (GPD, EC1.1.1.8) activity, which is involved in the production of glycerol (FIG. 2). This enzyme catalyzes the reduction of the glycolysis intermediate, dihydroxyacetone-phosphate, to glycerol 3-phosphate. In this reaction, an NADH is oxidized to NAD+. Therefore, glycerol production would be a drain on the reducing equivalent (NADH) as well as on the carbon from glucose. This pathway can be eliminated by deleting the glycerol-3-phosphate dehydrogenases (e.g. GPD1 and GPD2 in S. cerevisiae, GPD1 in K. lactis) in the yeast.
[0218] Additionally, activities of other gene products may function as drains on metabolic intermediates. For example, reductions of the following activities may increase yield of isobutanol. Pyruvate dehydrogenase (PDH) activity, supplied by a multi-gene product complex, represents another route of pyruvate dissimilation. Reduction of PDH activity may increase pyruvate availability. Branched-chain amino acid transaminase (EC 2.6.1.42) interconverts valineketo-isovalerate in the cytosol, and may therefore reduce or limit available keto-isovalerate to isobutanol pathway. 3-methyl-2-oxobutanoate hydroxymethyltransferase (EC 2.1.2.11) directs the isobutanol pathway intermediate, keto-isovalerate, to the coenzyme A synthesis pathway. Alphaisopropylmalate isomerase (EC 4.1.3.12) directs the isobutanol pathway intermediate, keto-isovalerate, to the synthesis of leucine. Therefore, all of these enzymatic activities represent possible additional targets for disruption, deletion, or both.
Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Balanced Isobutanol Pathway and a PDC-Minus GPD-Minus Phenotype
[0219] To further increase yield from the pathway the imbalance in the use of reducing equivalents need to be corrected. Glycolysis generates 2 moles NADHs and 2 moles of pyruvate per mole of glucose, while the isobutanol pathway consumes either 2 NADPHs or 1 NADH and 1 NADPH for every 2 moles of pyruvate utilized. KARI enzymes typically use NADPH. There exists both an NADH and NADPH dependent alcohol dehydrogenase that can be used for the isobutanol pathway. For example, S. cerevisiae Adh2p is an NADH-dependent enzyme that is able to reduce isobutyraldehyde to isobutanol. Alternatively, this conversion can be performed by S. cerevisiae Adh6p or Adh7p, which are NADPH-dependent alcohol dehydrogenases. The additional NADPH can be obtained from the pentose phosphate pathway, but this results in a reduced yield as only 5 moles of pyruvate is generated from 3 moles of glucose, while glycolysis generates 6 moles of pyruvate from 3 moles of glucose.
[0220] This imbalance can be balanced in several ways. In one embodiment, glycolysis can be engineered to generate NADPH instead of NADH. This is accomplished by replacing the endogenous NAD+-dependent glyceraldehydes 3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) with an NADP+-dependent GAPDH (EC 1.2.1.13). Such NADP+-dependent GAPDHs have been identified in bacteria (i.e. gapB in B. subtilis), yeast (GDP1 in K. lactis) and plants. (Fillinger et al., J Biol Chem. 275:14031-14037, Verho et al., Biochemistry, 41:13833-13838) This may result in glycolysis producing 2 moles of NADPH which balances the 2 moles of NADPH that are consumed by the isobutanol pathway utilizing an NADPH-dependent alcohol dehydrogenase. See, for example, Richard, et al, U.S. Patent Application Publication Number US 2005/0106734 A1. In addition to balancing the pathway, this method may result in the reduction of available NADH and hence a reduction in the ability of the glycerol 3-phosphate dehydrogenase to generate glycerol.
[0221] In a second embodiment, an NADP.sup.+-dependent GAPDH is co-expressed with the endogenous NAD.sup.+-dependent GAPDH. This may allow the production of both NADPH and NADH from glycolysis and balance the consumption of 1 mole of NADPH and 1 mole of NADH by an isobutanol pathway utilizing an NADH-dependent alcohol dehydrogenase.
[0222] In yet another embodiment, the NADPH-dependent KARI enzyme in the pathway is engineered to use NADH. This has been shown with the E. coli KARI (ilvC) (Rane M J and Calvo K C, Arch Biochem Biophys., 338(1):83-89). Alternatively, a KARI from Methanococcus species can be used. These KARI enzymes have been reported to be able to utilize NADH with roughly 60% the activity with NADPH (Xing et al., Journal of Bacteriology 1990). The use of these NADH-utilizing ilvC in combination with an NADH-dependent alcohol dehydrogenase also balances the NADH/NADPH imbalance.
[0223] Furthermore any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof) may be subject to directed evolution using methods known to those of skill in the art. Such action allows those of skill in the art to optimize the enzymes for expression and activity in yeast.
[0224] In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes, including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. stipitis, Torulaspora pretoriensis, Schizosaccharomyces spp., incl. Schizosaccharomyces pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp. or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.
Microorganism Characterized by Balanced Isobutanol Pathway
[0225] In the various embodiments described herein, the engineered metabolic pathway may be balanced with respect to NADH and NADPH as compared to a native or unmodified metabolic isobutanol pathway from a corresponding parental microorganism, wherein the native or unmodified metabolic pathway is not balanced with respect to NADH and NADPH.
[0226] The ideal production microorganism produces a desirable product at close to theoretical yield. For example the ideal isobutanol producing organism produces isobutanol according to the following equation: 1 glucose.fwdarw.isobutanol+2 CO.sub.2+H.sub.2O.
[0227] Accordingly, 66% of the glucose carbon results in isobutanol, while 33% is lost as CO.sub.2. In exemplary metabolic pathways for the conversion of pyruvate to isobutanol described by Atsumi et al. (WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9), two of the five enzymes used to convert pyruvate into isobutanol according to the metabolic pathway outlined in FIG. 1 require the reduced cofactor nicotinamide adenine dinucleotide phosphate (NADPH). NADPH is produced only sparingly by the cell--the reduced cofactor nicotinamide adenine dinucleotide (NADH) is the preferred equivalent. Respiration is required to produce NADPH in the large quantities required to support high-level production of isobutanol.
[0228] Even if competing pathways can be eliminated or reduced in activity by metabolic engineering, yield is limited to about 83% of theoretical. Carbon loss to carbon dioxide (CO.sub.2) remains the main limitation on yield in the aforementioned metabolic pathway for the production of isobutanol. Reducing the oxygen uptake rate (OUR) of the cells should decrease the loss of carbon to CO.sub.2 because it decreases the metabolic flux through the CO.sub.2-generating tricarboxylic acid (TCA) cycle and/or pentose phosphate pathway (PPP). However, a modified microorganism utilizing the aforementioned metabolic pathway for the production of isobutanol exhibits drastically decreased specific productivity under conditions where the OUR is decreased and isobutanol production under anaerobic conditions may not be possible.
[0229] The decreased yield and the loss of productivity upon O.sub.2 limitation indicate that the strain uses one or more metabolic pathways to generate the NADPH needed to support isobutanol production. In a modified cell utilizing the aforementioned metabolic pathway the production of isobutanol from glucose results in an imbalance between the cofactors reduced during glycolysis and the cofactors oxidized during the conversion of pyruvate to isobutanol. While glycolysis produces two moles of NADH, the isobutanol pathway consumes two moles of NADPH. This leads to a deficit of two moles of NADPH and overproduction of two moles of NADH per isobutanol molecule produced, a state described henceforth as cofactor imbalance.
[0230] The terms "cofactor balance" or "balanced with respect to cofactor usage" refer to a recombinant microorganism comprising a metabolic pathway converting a carbon source to a fermentation product and a modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing said fermentation product from a carbon source and wherein the re-oxidation or re-reduction of said redox cofactors does not require the pentose phosphate pathway, the TCA cycle or the generation of additional fermentation products.
[0231] Stated another way, the terms "cofactor balance" or "balanced with respect to cofactor usage" can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source and wherein said re-oxidation or re-reduction of all redox cofactors does not require the production of byproducts or co-products.
[0232] Stated another way, the terms "cofactor balance" or "balanced with respect to cofactor usage" can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source under anaerobic conditions and wherein the production of additional fermentation products is not required for re-oxidation or re-reduction of redox cofactors.
[0233] Stated another way, the terms "cofactor balance" or "balanced with respect to cofactor usage" can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source and wherein said modification increases production of said fermentation product under anaerobic conditions compared to the parental or wild type microorganism and wherein additional fermentation products are not required for the regeneration of said redox cofactors.
[0234] The cell has several options for resolving a cofactor imbalance. One is to change the relative fluxes going from glucose through glycolysis and through the pentose phosphate pathway (PPP). For each glucose molecule metabolized through the PPP, two moles of NADPH are generated in addition to the two moles of NADH that are generated through glycolysis (a total of 4 reducing equivalents). Therefore, use of the PPP results in the generation of excess reducing equivalents since only two moles are consumed during the production of isobutanol. Under anaerobic conditions, and without an alternate electron acceptor, the cell has no way to reoxidize or regenerate these extra cofactors to NADP+ and metabolism thus stops. The excess reducing equivalents must instead be utilized for energy production through aerobic respiration which is only possible under aerobic conditions or for the production of byproducts. Another result of the flux through the PPP is that one additional molecule of CO.sub.2 is lost per molecule of glucose consumed, which limits the yield of isobutanol that can be achieved under aerobic conditions.
[0235] Another way the cell can generate NADPH is via the TCA cycle. Flux through the TCA cycle results in carbon loss through CO.sub.2 and in production of NADH in addition to the NADPH required for the isobutanol pathway. The NADH would have to be utilized for energy production through respiration under aerobic conditions (and without an alternate electron acceptor) or for the production of byproducts. In addition, the TCA cycle likely is not functional under anaerobic conditions and is therefore unsuitable for the production of stoichiometric amounts of NADPH in an anaerobic isobutanol process.
[0236] An economically competitive isobutanol process requires a high yield from a carbon source. Lower yield means that more feedstock is required to produce the same amount of isobutanol. Feedstock cost is the major component of the overall operating cost, regardless of the nature of the feedstock and its current market price. From an economical perspective, this is important because the cost of isobutanol is dependent on the cost of the biomass-derived sugars. An increase in feedstock cost results in an increase in isobutanol cost. Thus, it is desirable to utilize NADH-dependent enzymes for the conversion of pyruvate to isobutanol.
[0237] An enzyme is "NADH-dependent" if it catalyzes the reduction of a substrate coupled to the oxidation of NADH with a catalytic efficiency that is greater than the reduction of the same substrate coupled to the oxidation of NADPH at equal substrate and cofactor concentrations.
[0238] Thus, in one embodiment of the invention, a microorganism is provided in which cofactor usage is balanced during the production of a fermentation product.
[0239] In a specific aspect, a microorganism is provided in which cofactor usage is balanced during the production of isobutanol, in this case, production of isobutanol from pyruvate utilizes the same cofactor that is produced during glycolysis.
[0240] In another embodiment, a microorganism is provided in which cofactor usage is balanced during the production of a fermentation product and the microorganism produces the fermentation product at a higher yield compared to a modified microorganism in which the cofactor usage in not balanced.
[0241] In a specific aspect, a microorganism is provided in which cofactor usage is balanced during the production of isobutanol and the microorganism produces isobutanol at a higher yield compared to a modified microorganism in which the cofactor usage in not balanced.
[0242] In yet another embodiment, a modified microorganism in which cofactor usage is balanced during the production of a fermentation product may allow the microorganism to produce said fermentation product under anaerobic conditions at higher rates, and yields as compared to a modified microorganism in which the cofactor usage in not balanced during production of a fermentation product.
[0243] In a specific aspect, a modified microorganism in which cofactor usage is balanced during the production of isobutanol may allow the microorganism to produce isobutanol under anaerobic conditions at higher rates, and yields as compared to a modified microorganism in which the cofactor usage is not balanced during production of isobutanol.
[0244] One compound to be produced by the recombinant microorganism according to the present invention is isobutanol. However, the present invention is not limited to isobutanol. The invention may be applicable to any metabolic pathway that is imbalanced with respect to cofactor usage. One skilled in the art is able to identify pathways that are imbalanced with respect to cofactor usage and apply this invention to provide recombinant microorganisms in which the same pathway is balanced with respect to cofactor usage. One skilled in the art will recognize that the identified pathways may be of longer or shorter length, contain more or fewer genes or proteins, and require more or fewer cofactors than the exemplary isobutanol pathway. Further, one skilled in the art will recognize that in certain embodiments, such as a recombinant microbial host that produces an excess of NADPH, certain embodiments of the present invention may be adapted to convert NADPH to NADH.
Microorganisms Characterized by Providing Cofactor Balance Via Engineered Enzymes
[0245] Conversion of one mole of glucose to two moles of pyruvate via glycolysis leads to the production of two moles of NADH. A metabolic pathway that converts pyruvate to a target product that consumes either two moles of NADPH or one mole of NADH and one mole of NADPH leads to cofactor imbalance. One example of such a metabolic pathway is the isobutanol metabolic pathway described by Atsumi et al. (Atsumi et al., 2008, Nature 451: 86-9), which converts two moles of pyruvate to one mole of isobutanol. In this five enzyme pathway, two enzymes are dependent upon NADPH: (1) KARI and (2) ADH, encoded by the E. coli ilvC and E. coli yqhD, respectively.
[0246] To resolve this cofactor imbalance, the present invention provides a recombinant microorganism in which the NADPH-dependent enzymes KARI and ADH are replaced with enzymes that preferentially depend on NADH (i.e. KARI and ADH enzymes that are NADH-dependent).
[0247] To further resolve this cofactor imbalance, the present invention in another embodiment provides recombinant microorganisms wherein the NADH-dependent KARI and ADH enzymes are overexpressed.
[0248] In one aspect, such enzymes may be identified in nature. In an alternative aspect, such enzymes may be generated by protein engineering techniques including but not limited to directed evolution or site-directed mutagenesis.
[0249] In one embodiment, the two NADPH-dependent enzymes within an isobutanol biosynthetic pathway that converts pyruvate to isobutanol may be replaced with ones that utilize NADH. These two enzymes may be KARI and an alcohol dehydrogenase (ADH).
[0250] In another embodiment, two NADH-dependent enzymes that catalyze the same reaction as the NADH-dependent enzymes are overexpressed. These two enzymes may be KARI and an alcohol dehydrogenase.
[0251] In one aspect, NADH-dependent KARI and ADH enzymes are identified in nature. In another aspect, the NADPH-dependent KARI and ADH enzymes may be engineered using protein engineering techniques including but not limited to directed evolution and site-directed mutagenesis.
[0252] There exist two basic options for engineering NADH-dependent isobutyraldehyde dehydrogenases or ketol-acid reductoisomerases: (1) increase the NADH-dependent activity of an NADPH-dependent enzyme that is active towards the substrate of interest and/or (2) increase the activity of an NADH-dependent enzyme that is not sufficiently active towards the substrate of interest.
[0253] There exist two basic options for engineering NADH-dependent isobutyraldehyde dehydrogenases or ketol-acid reductoisomerases: (1) increase the NADH-dependent activity of an NADPH-dependent enzyme that is active towards the substrate of interest and/or (2) increase the activity of an NADH-dependent enzyme that is not sufficiently active towards the substrate of interest.
NADH-Dependent KARI Enzymes
[0254] As shown in FIG. 1, the ketol-acid reductoisomerase (KARI) enzyme of the isobutanol biosynthetic pathway as disclosed by Atsumi et al. (Atsumi et al., 2008, Nature 45: 86-9), requires the cofactor nicotinamide dinucleotide phosphate (NADPH) to convert acetolactate to 2, 3-dihydroxyisovalerate. However, under anaerobic conditions, NADPH is produced only sparingly by the cell--nicotinamide adenine dinucleotide (NADH) is the preferred equivalent. Therefore, oxygen is required to produce NADPH in the large quantities to support high-level production of isobutanol. Thus, the production of isobutanol is feasible only under aerobic conditions and the maximum yield that can be achieved with this pathway is limited. Accordingly, KARI enzymes that preferentially utilize NADH rather than NADPH are desirable.
[0255] Other biosynthetic pathways utilize KARI enzymes for the conversion of acetolactate to 2, 3-dihydroxyisovalerate. For example, KARI enzymes convert acetolactate to 2, 3-dihydroxyisovalerate as part of the biosynthetic pathway for the production of 3-methyl-1-butanol (Atsumi et al., 2008, Nature 45: 86-9).
[0256] Yet other biosynthetic pathways utilize KARI to convert 2-aceto-2-hydroxy-butyrate to 2, 3-dihydroxy-3-methylvalerate. This reaction is part of the biosynthetic pathway for the production of 2-methyl-1-butanol. (Atsumi et al., 2008, Nature 45: 86-9).
[0257] As used herein, the term "KARI" or "KARI enzyme" or "ketol-acid reductoisomerase" are used interchangeably herein to refer to an enzyme that catalyzes the conversion of acetolactate to 2, 3-dihydroxyisovalerate and/or the conversion of 2-aceto-2-hydroxy-butyrate to 2, 3-dihydroxy-3-methylvalerate. Moreover, these terms can be used interchangeably herein with the terms "acetohydroxy acid isomeroreductase" and "acetohydroxy acid reductoisomerase."
[0258] Enzymes for use in the compositions and methods of the invention include any enzyme having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or the ability to convert 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. Such enzymes include, but are not limited to, the E. coli ilvC gene product and the S. cerevisiae ILV5 gene product, and the KARI enzyme from Piromyces sp, Buchnera aphidicola, Spinacia oleracea, Oryza sativa, Chlamydomonas reinhardtii, Neurospora crassa, Schizosaccharomyces pombe, Laccaria bicolor, Ignicoccus hospitalis, Picrophilus torridus, Acidiphilium cryptum, Cyanobacteria/Synechococcus sp., Zymomonas mobilis, Bacteroides thetaiotaomicron, Methanococcus maripaludis, Vibrio fischeri, Shewanella sp, Gramella forsetti, Psychromonas ingrhamaii, and Cytophaga hutchinsonii.
[0259] KARI sequences are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank Nos: NP_418222 and NC_000913, Saccharomyces cerevisiae (GenBank Nos: NP_013459 and NC_001144, Methanococcus maripaludis (GenBank Nos: CAF30210 and BX957220, and Bacillus subtilis (GenBank Nos: CAB14789 and Z99118) and the KARI enzymes from Piromyces sp (GenBank No: CAA76356), Buchnera aphidicola (GenBank No: AAF13807), Spinacia oleracea (GenBank Nos: Q01292 and CAA40356), Oryza sativa (GenBank No: NP_001056384) Chlamydomonas reinhardtii (GenBank No: XP_001702649), Neurospora crassa (GenBank No: XP_961335), Schizosaccharomyces pombe (GenBank No: NP_001018845), Laccaria bicolor (GenBank No: XP_001880867), Ignicoccus hospitalis (GenBank No: YP_001435197), Picrophilus torridus (GenBank No: YP_023851), Acidiphilium cryptum (GenBank No: YP_001235669), Cyanobacteria/Synechococcus sp. (GenBank No: YP_473733), Zymomonas mobilis (GenBank No: YP_162876), Bacteroides thetaiotaomicron (GenBank No: NP_810987), Methanococcus maripaludis (GenBank No: YP_001097443), Vibrio fischeri (GenBank No: YP_205911), Shewanella sp (GenBank No: YP_732498), Gramella forsetti (GenBank No: YP_862142), Psychromonas ingrhamaii (GenBank No: YP_942294), and Cytophaga hutchinsonii (GenBank No: YP_677763).
[0260] As will be understood by one of ordinary skill in the art, modified KARI enzymes may be obtained by recombinant or genetic engineering techniques that are routine and well-known in the art. Mutant KARI enzymes can, for example, be obtained by mutating the gene or genes encoding the KARI enzyme of interest by site-directed or random mutagenesis. Such mutations may include point mutations, deletion mutations and insertional mutations. For example, one or more point mutations (e.g., substitution of one or more amino acids with one or more different amino acids) may be used to construct mutant KARI enzymes of the invention.
[0261] Ketol-acid reductoisomerase (KARI) catalyzes the reduction of acetolactate to 2, 3-dihydroxyisovalerate. The two-step reaction involves an alkyl migration and a ketone reduction that occurs at a single active site on the enzyme without dissociation of any reaction intermediates. The enzyme is NADPH-dependent. The cofactor specificity may be expanded or switched so that it will utilize both cofactors and preferentially NADH during the production of isobutanol. A study published in 1997 (Rane, M. J. and K. C. Calvo, Archives of Biochemistry and Biophysics, 1997. 338: p. 83-89) describes a supposed cofactor-switched KARI quadruplet variant of the E. coli ilvC gene product with mutations R68D, K69L, K75V and R76D). However, in-house studies indicate that although the ratio NADH/NADPH was 2.5, the specific activity of this variant on NADH was actually worse than wildtype, rendering this enzyme not suited for the purpose of this disclosure.
Modified or Mutated KARI Enzymes
[0262] In accordance with the invention, any number of mutations can be made to the KARI enzymes, and in a preferred aspect, multiple mutations can be made to result in an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. Such mutations include point mutations, frame shift mutations, deletions, and insertions, with one or more (e.g., one, two, three, or four, etc.) point mutations preferred.
[0263] Mutations may be introduced into the KARI enzymes of the present invention using any methodology known to those skilled in the art. Mutations may be introduced randomly by, for example, conducting a PCR reaction in the presence of manganese as a divalent metal ion cofactor. Alternatively, oligonucleotide directed mutagenesis may be used to create the mutant KARI enzymes which allows for all possible classes of base pair changes at any determined site along the encoding DNA molecule. In general, this technique involves annealing an oligonucleotide complementary (except for one or more mismatches) to a single stranded nucleotide sequence coding for the KARI enzyme of interest. The mismatched oligonucleotide is then extended by DNA polymerase, generating a double-stranded DNA molecule which contains the desired change in sequence in one strand. The changes in sequence can, for example, result in the deletion, substitution, or insertion of an amino acid. The double-stranded polynucleotide can then be inserted into an appropriate expression vector, and a mutant or modified polypeptide can thus be produced. The above-described oligonucleotide directed mutagenesis can, for example, be carried out via PCR.
[0264] The invention further includes homologous KARI enzymes which are 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to a wild-type KARI enzyme (e.g., encoded by the Ec_ilvC gene or S. cerevisiae ilv5 gene) and exhibit an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. Also included within the invention are KARI enzymes which are 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to a KARI enzyme comprising the amino acid sequence set out in SEQ ID NO: 56 and exhibit an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. The invention also includes nucleic acid molecules which encode the above described KARI enzymes.
[0265] The invention also includes fragments of KARI enzymes which comprise at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acid residues and retain one or more activities associated with KARI enzymes. Such fragments may be obtained by deletion mutation, by recombinant techniques that are routine and well-known in the art, or by enzymatic digestion of the KARI enzyme(s) of interest using any of a number of well-known proteolytic enzymes. The invention further includes nucleic acid molecules which encode the above described mutant KARI enzymes and KARI enzyme fragments.
[0266] By a protein or protein fragment having an amino acid sequence at least, for example, 50% "identical" to a reference amino acid sequence it is intended that the amino acid sequence of the protein is identical to the reference sequence except that the protein sequence may include up to 50 amino acid alterations per each 100 amino acids of the amino acid sequence of the reference protein. In other words, to obtain a protein having an amino acid sequence at least 50% identical to a reference amino acid sequence, up to 50% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 50% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino (N-) and/or carboxy (C-) terminal positions of the reference amino acid sequence and/or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence and/or in one or more contiguous groups within the reference sequence. As a practical matter, whether a given amino acid sequence is, for example, at least 50% identical to the amino acid sequence of a reference protein can be determined conventionally using known computer programs such as those described above for nucleic acid sequence identity determinations, or using the CLUSTAL W program (Thompson, J. D., et al., Nucleic Acids Res. 22:4673 4680 (1994)).
[0267] In one aspect, amino acid substitutions are made at one or more of the above identified positions (i.e., amino acid positions equivalent or corresponding to A71, R76, S78, or Q110 of E. coli IlvC). Thus, the amino acids at these positions may be substituted with any other amino acid including Ala, Asn, Arg, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val. A specific example of a KARI enzyme which exhibits an increased ability to utilize NADH includes an E. coli IlvC KARI enzyme in which (1) the alanine at position 71 has been replaced with a serine, (2) the arginine at position 76 has been replaced with an aspartic acid, (3) the serine at position 78 has been replaced with an aspartic acid, and/or (4) the glutamine at position 110 has been replaced with valine (as described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527).
[0268] Polypeptides having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate for use in the invention may be isolated from their natural prokaryotic or eukaryotic sources according to standard procedures for isolating and purifying natural proteins that are well-known to one of ordinary skill in the art (see, e.g., Houts, G. E., et al., J. Virol. 29:517 (1979)). In addition, polypeptides having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate may be prepared by recombinant DNA techniques that are familiar to one of ordinary skill in the art (see, e.g., Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci. USA 85:3372 3376 (1988)).
[0269] In accordance with the invention, one or more mutations may be made in any KARI enzyme of interest in order to increase the ability of the enzyme to utilize NADH, or confer other properties described herein upon the enzyme, in accordance with the invention. Such mutations include point mutations, frame shift mutations, deletions and insertions. Preferably, one or more point mutations, resulting in one or more amino acid substitutions, are used to produce KARI enzymes having an enhanced or increased ability to utilize NADH, particularly to facilitate the conversion of acetolactate to 2,3-dihydroxyisovalerate and/or the conversion of 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. In a preferred aspect of the invention, one or more mutations at positions equivalent or corresponding to position A71 (e.g., A71S), R76 (e.g., R76D), S78 (e.g. S78D), and/or Q110 (e.g. Q110V) and/or D146 (e.g. D146G), and/or G185 (e.g. G185R) and/or K433 (e.g. K433E) of the E. coli IlvC KARI enzyme may be made to produce the desired result in other KARI enzymes of interest.
[0270] The corresponding positions of the KARI enzymes identified herein (e.g. E. coli IlvC may be readily identified for other KARI enzymes by one of skill in the art. Thus, given the defined region and the assays described in the present application, one with skill in the art can make one or a number of modifications which would result in an increased ability to utilize NADH, particularly for the conversion of acetolactate to 2,3-dihydroxyisovalerate, in any KARI enzyme of interest.
[0271] In a preferred embodiment, the modified or mutated KARI enzymes have from 1 to 4 amino acid substitutions in amino acid regions involved in cofactor specificity as compared to the wild-type KARI enzyme proteins. In other embodiments, the modified or mutated KARI enzymes have additional amino acid substitutions at other positions as compared to the respective wild-type KARI enzymes. Thus, modified or mutated KARI enzymes may have at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 different residues in other positions as compared to the respective wild-type KARI enzymes. As will be appreciated by those of skill in the art, the number of additional positions that may have amino acid substitutions will depend on the wild-type KARI enzyme used to generate the variants. Thus, in some instances, up to 50 different positions may have amino acid substitutions.
[0272] The nucleotide sequences for several KARI enzymes are known. For instance, the sequences of KARI enzymes are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank No: NP_418222), Saccharomyces cerevisiae (GenBank Nos: NP_013459, Methanococcus maripaludis (GenBank No: YP_001097443), Bacillus subtilis (GenBank Nos: CAB14789), and the KARI enzymes from Piromyces sp (GenBank No: CAA76356), Buchnera aphidicola (GenBank No: AAF13807), Spinacia oleracea (GenBank Nos: Q01292 and CAA40356), Oryza sativa (GenBank No: NP_001056384) Chlamydomonas reinhardtii (GenBank No: XP_001702649), Neurospora crassa (GenBank No: XP_961335), Schizosaccharomyces pombe (GenBank No: NP_001018845), Laccaria bicolor (GenBank No: XP 001880867), Ignicoccus hospitalis (GenBank No: YP_001435197), Picrophilus torridus (GenBank No: YP_023851), Acidiphilium cryptum (GenBank No: YP_001235669), Cyanobacteria/Synechococcus sp. (GenBank No: YP_473733), Zymomonas mobilis (GenBank No: YP_162876), Bacteroides thetaiotaomicron (GenBank No: NP_810987), Methanococcus maripaludis (GenBank No: YP_001097443), Vibrio fischeri (GenBank No: YP_205911), Shewanella sp (GenBank No: YP_732498), Gramella forsetti (GenBank No: YP_862142), Psychromonas ingrhamaii (GenBank No: YP_942294), and Cytophaga hutchinsonii (GenBank No: YP_677763)
Improved NADH-Dependent Activity
[0273] In one aspect, the NADH-dependent activity of the modified or mutated KARI enzyme is increased.
[0274] In a preferred embodiment, the catalytic efficiency of the modified or mutated KARI enzyme is improved for the cofactor NADH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5% as compared to the wild-type or parental KARI for NADH. More preferably the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 15% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 25% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 50% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 75% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 100% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 300% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 500% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 1000% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5000% as compared to the wild-type or parental KARI for NADH.
[0275] In a preferred embodiment, the catalytic efficiency of the modified or mutated KARI enzyme with NADH is increased with respect to the catalytic efficiency of the wild-type or parental enzyme with NADPH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 10% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 25% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 50% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 75%, 85%, 95% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH.
[0276] In a preferred embodiment, the K.sub.M of the KARI enzyme for NADH is decreased relative to the wild-type or parental enzyme. A change in K.sub.M is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 10 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 30 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme.
[0277] In a preferred embodiment, the k.sub.cat of the KARI enzyme with NADH is increased relative to the wild-type or parental enzyme. A change in k.sub.cat is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 50% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 100% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 200% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme.
Cofactor Switch
[0278] In preferred embodiments, the cofactor specificity of the modified or mutated KARI enzyme is altered such that there is a cofactor switch from NADPH to NADH. In other words, these modified or mutated KARI enzymes will have an increase in NADH-dependent activity and a substantially simultaneous decrease in NADPH dependent activity. Thus, the methods of the present invention can be used to change the cofactor preference from NADPH to NADH.
[0279] "Cofactor specificity" is a measure of the specificity of an enzyme for one cofactor over another. Thus, the methods of the present invention may be used to alter the cofactor preference of the target enzyme, such that the preference for the less favored cofactor is increased by 20%, 50%, 100%, 300%, 500%, 1000%, up to 2000%. For example, a number of reductase enzymes have been described that favor NADPH over NADH (see WO/2002/022526; WO/2002/029019; Mittl et al., 1994, Protein Sci., 3: 1504-14; Banta et al., (2002) Protein Eng., 15: 131-140; all of which are hereby incorporated by reference in their entirety). As the availability of NADPH is often limiting, both in vivo and in vitro, the overall activity of the target protein is often limited. For target proteins that prefer NADPH as a cofactor, it would be desirable to alter the cofactor specificity of the target protein (e.g. a KARI enzyme) to a cofactor that is more readily available, such as NADH.
[0280] In a preferred embodiment, the cofactor specificity of the KARI enzyme is switched. By "switched" herein is meant, that the cofactor preference (in terms of catalytic efficiency (k.sub.cat/K.sub.M) of the KARI enzyme is changed to another cofactor Preferably, in one embodiment, by switching cofactor specificity, activity in terms of catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor preferred by the wild-type KARI enzyme is reduced, while the activity with the less preferred cofactor is increased. This can be achieved, for example by increasing the k.sub.cat for less preferred cofactor over the preferred cofactor or by decreasing K.sub.M for the less preferred cofactor over the preferred cofactor or both.
[0281] In a preferred embodiment, the KARI enzyme is modified or a mutated to become NADH-dependent. The term "NADH-dependent" refers to the property of an enzyme to preferentially use NADH as the redox cofactor. An NADH-dependent enzyme has a higher catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor NADH than with the cofactor NADPH as determined by in vitro enzyme activity assays. Accordingly, the term "NADPH-dependent" refers to the property of an enzyme to preferentially use NADPH as the redox cofactor. An NADPH dependent enzyme has a higher catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor NADPH than with the cofactor NADH as determined by in vitro enzyme activity assays.
[0282] In a preferred embodiment, the catalytic efficiency of the KARI enzyme for NADH is enhanced relative to the catalytic efficiency with NADPH. The term "catalytic efficiency" describes the ratio of the rate constant k.sub.cat over the Michaelis-Menten constant K.sub.M. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:10 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In another embodiment, the modified or mutated KARI enzyme exhibits at least about a 1:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In yet another embodiment, the modified or mutated KARI enzyme exhibits at least about a 10:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In yet another embodiment, the modified or mutated KARI enzyme exhibits at least about a 100:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In an exemplary embodiment, the modified or mutated KARI enzyme exhibits at least about a 100:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH.
[0283] In a preferred embodiment, the K.sub.M of the KARI enzyme for NADH is decreased relative to the K.sub.M of the KARI enzyme for NADPH. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 10:1 ratio of K.sub.M for NADH over K.sub.M for NADPH. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:1 ratio of K.sub.M for NADH over K.sub.M for NADPH. In a preferred embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:10 ratio of K.sub.M for NADH over K.sub.M for NADPH. In yet another embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:20, 1:100, 1:1000 ratio of K.sub.M for NADH over K.sub.M for NADPH.
[0284] In another preferred embodiment, the k.sub.cat of the KARI enzyme with NADH is increased relative to k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 0.8:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 1:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In a preferred embodiment, modified or mutated KARI enzymes of the present invention may show greater than 10:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 100:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH.
Identification of Corresponding Amino Acid Substitutions in Homologous Enzymes
[0285] An amino acid sequence alignment of 22 KARIs (including E. coli IlvC, spinach KARI and rice KARI) was described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527). Various KARIs aligned with the E. coli KARI sequence at amino acid positions 71, 76, 78, and 110 and this allows to conclude that the beneficial mutations found for E. coli KARI confer the same effects in these KARI enzymes.
[0286] A structure alignment of E. coli KARI (PDB ID NO. 1YRL) with rice KARI (PDB ID NO. 3FR8) as a representative of the shorter loop group has been performed and the sites of useful mutations in the E. coli context corresponded reasonably well with specific residues in the context of the shorter loop: Ser165, Lys166, and Ser167. Ser165 of (corresponding to A71 in E. coli) therefore may be substituted with aspartate. A charge reversal at position K166 (corresponding to position R76D) may yield the same result. Ser167 may correspond to Ser78 and a mutation to aspartate corresponds to a beneficial mutation at Q110, and thus can be transferable in the aligned KARIs.
NADH-Dependent ADH Enzymes
[0287] Several alcohol dehydrogenases may be suitable candidates for conversion into an NADH-dependent isobutyraldehyde dehydrogenase. Among the exemplary enzymes for conversion are S. cerevisiae ADH1, Zymomonas mobilis ADHII, E. coli YqhD, herein referred to as Ec_YqhD, and S. cerevisiae ADH7.
[0288] As described in WO/2008/098227, the S. cerevisiae ADH2 gene is expected to be functionally expressed from pSA55 and required for catalyzing the final step of the isobutanol biosynthetic pathway, namely the conversion of isobutyraldehyde to isobutanol. Thus, no isobutanol should be produced with the plasmid combination lacking ADH2 as adhE is deleted in JCL260. However, the results of a fermentation using a strain without overexpression of any gene encoding an enzyme with ADH activity for the conversion of isobutyraldehyde to isobutanol showed that overexpression of an ADH enzyme is not required for isobutanol production in E. coli. In fact, isobutanol production for the system lacking ADH2 was higher than for the system with ADH2 expression. Volumetric productivity and titer showed 42% increase, specific productivity showed 18% increase and yield 12% increase. This suggests strongly that a native E. coli dehydrogenase is responsible for the conversion of isobutyraldehyde to isobutanol.
[0289] Surprisingly, this last step of the isobutanol biosynthetic pathway was found to be carried out by a native E. coli dehydrogenase. Approximately .about.80% of the isobutyraldehyde reduction activity is due to Ec_YqhD under certain culture conditions. Available literature on Ec_YqhD suggests that while it does prefer long-chain alcohols, it also utilizes NADPH (versus NADH) (Perez et al., 2008, J. Biol. Chem. 283: 7346-53).
[0290] Switching the cofactor specificity of an NADPH-dependent alcohol dehydrogenase may be complicated by the fact that cofactor binding induces a conformational change, resulting in an anhydrous binding pocket that facilitates hydride transfer from the reduced cofactor to the aldehyde (Leskovac et al., 2002, Fems Yeast Research, 2: 481-94; Reid et al., 1994, Critical Reviews in Microbiology, 20: p. 13-56). Mutations that are beneficial for binding NADH may have deleterious effects with respect to this conformational change.
[0291] Alternatively, isobutyraldehyde reduction activity of an NADH-dependent enzyme with little native activity towards this substrate may be increased. This approach has the advantages that (1) several specialized enzymes exist in nature that are highly active under fermentative conditions, (2) the binding sites of several of these enzymes are known, (3) mutational studies indicate that substrate specificity can easily be altered to achieve high activity on a new substrate.
[0292] Several alcohol dehydrogenase enzymes may be suitable candidates for conversion into an NADH-dependent isobutyraldehyde dehydrogenase: S. cerevisiae ADH1 and Zymomonas mobilis ADHII are NADH-dependent enzymes responsible for the conversion of acetaldehyde to ethanol under anaerobic conditions. These enzymes are highly active. The substrate specificity for these enzymes has been analyzed (Leskovac et al., 2002, Fems Yeast Research, 2: 481-94; Rellos et al., 1997, Protein Expression and Purification, 9: 89-90), the amino acid residues comprising the substrate binding pocket are known (Leskovac et al., 2002, Fems Yeast Research, 2: 481-94; Rellos et al., 1997, Protein Expression and Purification, 9: 89-90), and attempts to alter the substrate specificity by mutation have revealed that the substrate specificity can be altered (Rellos et al., 1997, Protein Expression and Purification, 9: 89-90; Green et al., 1993, J. Biol. Chem., 268: 7792-98). Ec_YqhD and S. cerevisiae ADH7 are NADPH-dependent enzymes whose physiological functions are not as well understood. Ec_YqhD has been implicated in the protection of the cell from peroxide-derived aldehydes (Perez et al., 2008, J. Biol. Chem. 283: 7346-53). The substrate specificity of both enzymes is understood, and amino acids lining the substrate binding pocket are known (Perez et al., 2008, J. Biol. Chem. 283: 7346-53). Based on the known amino acid residues implicated in substrate binding (S. cerevisiae ADH1, Z. mobilis ADHII) or the cofactor binding site (Ec_yqhD), sites with the highest likelihood of affecting desired enzyme features such as substrate specificity or cofactor specificity may be mutated to generate the desired function.
[0293] One approach to increase activity of enzymes with NADH as the cofactor is saturation mutagenesis with NNK libraries at each of the residues that interact with the cofactor. These libraries can be screened for activity in the presence of NADPH and NADH in order to identify which single mutations contribute to increased activity on NADH and altered specificity for NADH over NADPH. Combinations of mutations at aforementioned residues can be investigated by any method known in the art. For example, a combinatorial library of mutants may be designed based on the results of the saturation mutagenesis studies. For example, a combinatorial library of mutants may be designed including only those mutations that do not lead to decrease in NADH-dependent activity.
[0294] Another approach to increase the NADH-dependent activity of the enzyme is to perform saturation mutagenesis of a first amino acid that interacts with the cofactor, then isolate the mutant with the highest activity using NADH as the cofactor, then perform saturation mutagenesis of a second amino acid that interacts with the cofactor, and so on. Similarly, a limited number of amino acids that interact with the cofactor may be targeted for randomization simultaneously and then be screened for improved activity with NADH as the cofactor. The selected, best mutant can then be subjected to the same procedure again and this approach may be repeated iteratively until the desired result is achieved.
[0295] Another approach is to use random oligonucleotide mutagenesis to generate diversity by incorporating random mutations, encoded on a synthetic oligonucleotide, into the cofactor binding region of the enzyme. The number of mutations in individual enzymes within the population may be controlled by varying the length of the target sequence and the degree of randomization during synthesis of the oligonucleotides. The advantages of this more defined approach are that all possible amino acid mutations and also coupled mutations can be found.
[0296] If the best variants from the experiments described above are not sufficiently active with NADH as the cofactor, directed evolution via error-prone PCR may be used to obtain further improvements. Error-prone PCR mutagenesis of the first domain containing the cofactor binding pocket may be performed followed by screening for ADH activity with NADH and/or increased specificity for NADH over NADPH as the cofactor.
[0297] Surprisingly, alcohol dehydrogenase enzymes that are not known to catalyze the reduction of isobutyraldehyde to isobutanol were identified that catalyze this reaction. Thus, in another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,3-propanediol dehydrogenase. In yet another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,2-propanediol dehydrogenase. Preferred enzymes of this disclosure include enzymes listed in Table 1 of co-pending and commonly owned U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527). These enzymes exhibit NADH-dependent isobutyraldehyde reduction activity, measured as Unit per minute per mg of crude cell lysate (U min.sup.-1 mg.sup.-1) that is approximately six-fold to seven-fold greater than the corresponding NADPH-dependent isobutyraldehyde reduction activity.
[0298] In addition to exhibiting increased activity with NADH as the cofactor as compared to the NADPH, alcohol dehydrogenases of the present invention may further be more active as compared to the native E. coli alcohol dehydrogenase Ec_YqhD. In particular, alcohol dehydrogenases of the present invention may exhibit increased activity and/or decreased K.sub.M values with NADH as the cofactor as compared to Ec_YqhD with NADPH as the cofactor. Exemplary enzymes that exhibit greater NADH-dependent alcohol dehydrogenase activity than the NADPH-dependent alcohol dehydrogenase activity are listed include the Drosophila melanogaster ADH, the L. lactis adhA, K. pneumoniae dhaT, and E. coli fucO (see Table 1 of U.S. Ser. No. 12/610,784).
[0299] Alcohol dehydrogenases of the present disclosure may also be utilized in metabolically-modified microorganisms that include recombinant biochemical pathways useful for producing additional alcohols such as 2-methyl-1-butanol, 3-methyl-1-butanol, 2-phenylethanol, 1-propanol, or 1-butanol via conversion of a suitable substrate by a modified microorganism.
[0300] Microorganisms producing such compounds have been described (WO/2008/098227). For example, these alcohols can be 1-propanol, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol or 2-phenylethanol and are generally produced from a metabolite comprising a 2-keto acid. In some aspects, the 2-keto acid includes 2-ketobutyrate, 2-ketovalerate, 2-keto-3-methylvalerate, 2-keto-4-methyl-pentanoate, or phenylpyruvate. The 2-ketoacid is converted to the respective aldehyde by a 2-ketoacid decarboxylase. For example, 2-ketobutyrate is converted to 1-propanal, 2-ketovalerate is converted to 1-butanal, 2-keto-3-methylvalerate is converted to 2-methyl-1-butanol, 2-keto-4-methyl-pentanoate is converted to 3-methyl-1-butanal, and phenylpyruvate is converted to phenylethanal by a 2-ketoacid decarboxylase. Thus, the recombinant microorganism includes elevated expression or activity of a 2-keto-acid decarboxylase, as compared to a parental microorganism. The 2-keto-acid decarboxylase may be encoded by kivD from Lactococcus lactis, or homologs thereof. The 2-keto-acid decarboxylase can be encoded by a polynucleotide derived from a gene selected from kivD from L. lactis, or homologs thereof.
[0301] In earlier publications (See, e.g., WO/2008/098227), only NADPH-dependent alcohol dehydrogenases are described that convert the aforementioned aldehyde to an alcohol. In particular, S. cerevisiae Adh2p is described that converts the aldehyde to the respective aldehyde.
[0302] Thus, in one embodiment of this disclosure, a microorganism is provided in which the cofactor dependent final step for the conversion of the aldehyde to the respective alcohol is catalyzed by an NADH-dependent alcohol dehydrogenase. In particular, NADH-dependent alcohol dehydrogenases are disclosed that catalyze the reduction aldehydes to alcohols, for example, of 1-propanal to 1propanol, 1-butanal to 1-butanol, 2-methyl-1-butanal to 2-methyl-1-butanol, 3-methyl-1-butanal to 3-methyl-1-butanol, or phenylethanal to phenylethanol.
[0303] In a specific aspect, such an alcohol dehydrogenase may be encoded by the Drosophila melanogaster alcohol dehydrogenase Dm_Adh or homologs thereof. In another specific aspect, such an alcohol dehydrogenase may be encoded by the Lactococcus lactis alcohol dehydrogenase (LI_AdhA) or homologs thereof.
[0304] Surprisingly, alcohol dehydrogenase enzymes that are not known to catalyze the reduction of isobutyraldehyde to isobutanol were identified that catalyze this reaction. Thus, in another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,3-propanediol dehydrogenase. In yet another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,2-propanediol dehydrogenase.
[0305] In another embodiment, a method of producing an alcohol is provided. The method includes providing a recombinant microorganism provided herein; culturing the microorganism of in the presence of a suitable substrate or metabolic intermediate and under conditions suitable for the conversion of the substrate to an alcohol; and detecting the production of the alcohol. In various aspects, the alcohol is selected from 1-propanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1-butanol, and 2-phenylethanol. In another aspect, the substrate or metabolic intermediate includes a 2-keto acid-derived aldehyde, such as 1-propanal, 1-butanal, 2-methyl-1-butanal, 3-methyl-1-butanal, or phenylethanal.
Recombinant Host Cells Comprising a NADH-Dependent KARI and/or ADH Enzymes
[0306] In an additional aspect, the present invention is directed to recombinant host cells (i.e. metabolically "engineered" or "modified" microorganisms) comprising NADH-dependent KARI and/or ADH enzymes of the invention. Recombinant microorganisms provided herein can express a plurality of additional heterologous and/or native target enzymes involved in pathways for the production of beneficial metabolites such as isobutanol from a suitable carbon source.
[0307] Accordingly, metabolically "engineered" or "modified" microorganisms are produced via the introduction of genetic material (i.e. a NADH-dependent KARI and/or ADH enzymes) into a host or parental microorganism of choice, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and/or the modification of the expression of native genes the parental microorganism acquires new properties, e.g. the ability to produce a new, or greater quantities of, an intracellular metabolite. As described herein, the introduction of genetic material and/or the modification of the expression of native genes into a parental microorganism results in a new or modified ability to produce beneficial metabolites such as isobutanol. The genetic material introduced into and/or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of isobutanol and may also include additional elements for the expression and/or regulation of expression of these genes, e.g. promoter sequences.
[0308] Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., 1-propanol, 1-butanol, isobutanol, 2-methyl-1-butanol, 3-methyl-1-butanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.
[0309] Exemplary metabolites include glucose, pyruvate, 1-propanol, 1-butanol, isobutanol, 2-methyl-1-butanol, and 3-methyl-1-butanol.
[0310] The metabolite 1-propanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 1-propanol. An exemplary metabolic pathway that converts pyruvate to 1-propanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
[0311] The metabolite 1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 3-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 3-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
[0312] The metabolite isobutanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to isobutanol. An exemplary metabolic pathway that converts pyruvate to isobutanol may be comprised of a acetohydroxy acid synthase (ALS) enzyme encoded by, for example, alsS from B. subtilis, a ketolacid reductoisomerase (KARI) of the present invention, a dihydroxy-acid dehydratase (DHAD), encoded by, for example ilvD from E. coli or L. lactis, a 2-keto-acid decarboxylase (KIVD) encoded by, for example kivd from L. lactis, and an alcohol dehydrogenase (ADH) of the present invention.
[0313] The metabolite 3-methyl-1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 3-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 3-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
[0314] The metabolite 2-methyl-1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 2-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 2-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451: 86-9), the disclosures of which are herein incorporated by reference in their entireties. In an exemplary embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
[0315] The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutation and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art. In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.
Microorganism Characterized by Increased Capacity to Produce Intermediates of the Isobutanol Pathway
[0316] As a consequence of increased yield of isobutanol, it follows that this yeast microorganism exhibits a higher capacity to produce the intermediates of the isobutanol pathway including, but not limited to, acetolactate, 2,3-dihydroxyisovalerate, keto-isovalerate, and isobutyraldehyde.
Method of Using Microorganism for High-Yield Isobutanol Fermentation
[0317] In a method to produce isobutanol from a carbon source at high yield, the yeast microorganism is cultured in an appropriate culture medium containing a carbon source.
[0318] Another exemplary embodiment provides a method for producing isobutanol comprising a recombinant yeast microorganism of the invention in a suitable culture medium containing a carbon source that can be converted to isobutanol by the yeast microorganism of the invention.
[0319] In certain embodiments, the method further includes isolating isobutanol from the culture medium. For example, isobutanol may be isolated from the culture medium by any method known to those skilled in the art, such as distillation, pervaporation, or liquid-liquid extraction.
EXAMPLES
General Methods
[0320] Sample Preparation:
[0321] Samples (2 mL) from the fermentation broth were stored at -20.degree. C. for later substrate and product analysis. Prior to analysis, samples were thawed and then centrifuged at 14,000.times.g for 10 min. The supernatant was filtered through a 0.2 .mu.m filter. Analysis of substrates and products was performed using authentic standards (>99%, obtained from Sigma-Aldrich), and a 5-point calibration curve (with 1-pentanol as an internal standard for analysis by gas chromatography).
[0322] Determination of Optical Density and Cell Dry Weight:
[0323] The optical density of the yeast cultures was determined at 600 nm using a DU 800 spectrophotometer (Beckman-Coulter, Fullerton, Calif., USA). Samples were diluted as necessary to yield an optical density of between 0.1 and 0.8. The cell dry weight was determined by centrifuging 50 mL of culture prior to decanting the supernatant. The cell pellet was washed once with 50 mL of milliQ H2O, centrifuged and the pellet was washed again with 25 mL of milliQ H2O. The cell pellet was then dried at 80.degree. C. for at least 72 hours. The cell dry weight was calculated by subtracting the weight of the centrifuge tube from the weight of the centrifuge tube containing the dried cell pellet.
[0324] Gas Chromatography:
[0325] Analysis of ethanol and isobutanol was performed on a HP 5890 gas chromatograph fitted with a DB-FFAP column (Agilent Technologies; 30 m length, 0.32 mm ID, 0.25 .mu.M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200.degree. C. for the injector, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 70.degree. C./minute gradient to 235.degree. C., and then hold for 2.5 min.
[0326] High Performance Liquid Chromatography:
[0327] Analysis of glucose and organic acids was performed on a HP-1100 High Performance Liquid Chromatography system equipped with an Aminex HPX-87H Ion Exclusion column (Bio-Rad, 300.times.7.8 mm) or equivalent and an H.sup.+ cation guard column (Bio-Rad) or equivalent. Organic acids were detected using an HP-1100 UV detector (210 nm, 8 nm 360 nm reference) while glucose was detected using an HP-1100 refractive index detector. The column temperature was 60.degree. C. This method was Isocratic with 0.008N sulfuric acid in water as mobile phase. Flow was set at 0.6 mL/min. Injection size was 20 .mu.L and the run time was 30 minutes.
[0328] Anaerobic Batch Fermentations:
[0329] Anaerobic batch cultivations were performed at 30.degree. C. in stoppered 100 mL serum bottles. A total of 20 mL of synthetic medium with an initial glucose concentration of 20 g-glucose L.sup.-1 was used (Kaiser et al., Methods in Yeast Genetics, a Cold Spring Harbor Laboratory Manual (1994)). 2 mL samples are taken at 24 and 48 hours. The fermentation is ended after 48 hours or when all glucose is consumed. Samples are processed and analyzed by Gas Chromatography and/or High Performance Liquid Chromatography as described above.
[0330] Yeast Transformations--K. lactis:
[0331] Transformations were performed by electroporation according to Kooistra et al., Yeast 21:781-792 (2004).
[0332] Lithium Acetate transformations of S. cerevisiae strains were transformed by the Lithium Acetate method (Gietz et al., Nucleic Acids Res. 27:69-74 (1992). Cells were collected from overnight cultures grown in 50 mL of defined (SC) ethanol media at an OD.sub.600 of approximately 0.8 to 1.0 by centrifugation at 2700 rcf for 2 minutes at room temperature. The cell pellet was resuspended in 50 mL sterile water, collected by centrifugation (2700 rcf; 2 min; room temp.), and resuspended in 25 mL sterile water. The cells were collected by centrifugation (2700 rcf; 2 min; room temp.) and resuspended in 1 mL 100 mM lithium acetate. The cell suspension was transferred to a sterile 1.5 mL tube and collected by centrifugation at full speed for 10 seconds. The cells were resuspended in 100 mM lithium acetate with a volume four times the volume of the cell pellet (e.g. 400 .mu.L for 100 .mu.L cell pellet). To the prepared DNA Mix (72 .mu.l 50% PEG, 10 .mu.l 1M Lithium Acetate, 3 .mu.l boiled salmon sperm DNA, and 5 .mu.l of each plasmid), 15 .mu.l of the cell suspension was added and mixed by vortexing with five short pulses. The cell/DNA suspensions were incubated at 30.degree. C. for 30 minutes and at 42.degree. C. for 22 minutes. The cells were collected by centrifugation for 10 seconds at full speed and resuspended in 100 .mu.l SOS (1M Sorbitol, 0.34% (w/v) Yeast Extract, 0.68% (w/v) Peptone, 6.5 mM CaCl). The cell suspensions were top spread over appropriate selective agar plates.
[0333] Yeast Colony PCR:
[0334] Yeast cells were taken from agar medium and transferred to 30 .mu.l 0.2% SDS and heated for 4 mins at 90.degree. C. The cells were spun down and 1 .mu.l of the supernatant was used for PCR using standard Taq (NEB).
[0335] Molecular Biology:
[0336] Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook & Russell).
[0337] Media:
[0338] YP: contains 1% (w/v) yeast extract, 2% (w/v) peptone. YPD is YP containing 2% (w/v) glucose, YPE is YP containing 2% (w/v) Ethanol.
[0339] SC+Complete: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco.TM. Yeast Nitrogen Base. 0.076 g/L histidine, 0.076 g/L tryptophan, 0.380 g/L leucine, and 0.076 g/L uracil.
[0340] SC-HWUL: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco.TM. Yeast Nitrogen Base
[0341] SC-WLU: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco.TM. Yeast Nitrogen Base without amino acids, and 0.076 g/L histidine.
[0342] SC-HWU: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco.TM. Yeast Nitrogen Base without amino acids, and 0.380 g/L leucine.
[0343] SC-Ethanol-HWU: 2% (w/v) ethanol, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco.TM. Yeast Nitrogen Base, and 0.380 g/L leucine.
[0344] Solid versions of the above described media contain 2% (w/v) agar.
Strains, Plasmids and Primer Sequences
[0345] Table 1 details the genotype of strains disclosed herein:
TABLE-US-00001 GEVO No. Genotype and/or Reference GEVO1187 S. cerevisiae CEN.PK MAT a ho his3-leu2 trp1 ura3 PDC1 PDC5 PDC6 GEVO1188 S. cerevisiae CEN.PK MAT alpha ho his3-leu2 trp1 ura3 PDC1 PDC5 PDC6 GEVO1287.sup.1 K. lactis MAT.alpha. uraA1 trp1 leur2 lysA1 ade1 lac4-8 [pKD1] (ATCC #87365) GEVO1537.sup.2 S. cerevisiae HO/HO pdc1::Tn5ble/pdc1::Tn5ble pdc5::Tn5ble/pdc5::Tn5ble pdc6::APT1/pdc6::APT1 HIS3/HIS, LEU2/LEU2, URA3/URA3, TRP1/TRP1 Gevo1538 S. cerevisiae MAT a/.alpha., HIS3, LEU2, TRP1, URA3, pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO GEVO1581 S. cerevisiae MAT a/alpha, his3/his3, trp1/trp1, ura3/ura3, LEU2/LEU2, pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Gevo1715 S. cerevisiae MAT a, leu2, ura3, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho GEVO1584 S. cerevisiae MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho- GEVO1742 K. lactis MAT.alpha. uraA1 trp1 leur2 lysA1 ade1 lac4-8 [pKD1] Klpdc1.DELTA.::pGV1537 (G418.sup.R)] GEVO1794 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ll-kivd; Sc- Adh7:KmURA3 integrated} GEVO1818 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ec-ilvC- deltaN; Ec-ilvD-deltaN(codon opt for K. lactis):Sc-LEU2 integrated} {Ll-kivd; Sc- Adh7:KmURA3 integrated} GEVO1829 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ec-ilvC- deltaN; Ec-ilvD-deltaN(codon opt for K. lactis):Sc-LEU2 integrated} {Ll-kivd; Sc- Adh7:KmURA3 integrated} {ScCUP1-1 promoter:Bs alsS, TRP1 random integrated} Gevo1863 S. cerevisiae MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho-, chemostat-evolved to be C2-independent. .sup.1same as ATCC200826 .sup.2The strains Gevo1537 and Gevo1538 were originally designated GG570 (derived from strain T2-3D) and was obtained from Paul van Heusden from the University of Leiden, the Netherlands. For complete references for both strains, see: Flikweert, M.T. et al., (1996) Yeast 12: 247-257.
[0346] Table 2 outlines the plasmids disclosed herein:
TABLE-US-00002 GEVO No. FIG. Genotype or Reference pGV1056 23 bla(amp.sup.r) S.c. TDH3 promoter - polylinker - CYC1 terminator CEN6/ARSH4 HIS3 pUC ori pGV1062 24 bla(amp.sup.r) S.c. TDH3 promoter - polylinker - CYC1 terminator CEN6/ARSH4 URA3 pUC ori pGV1102 25 bla(amp.sup.r) S.c. TEF1 promoter - HA tag - polylinker - CYC1 terminator 2micron URA3 pUC ori pGV1103 26 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2micron HIS3 pUC ori pGV1104 27 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2micron TRP1 pUC ori pGV1106 28 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2micron URA3 pUC ori pGV1254 16 bla(amp.sup.r) S.c. TEF1 promoter - HA-L.l. KIVD - S.c. TDH3 promoter - myc - S.c. ADH2 - CYC1 terminator 2micron URA3 pUC ori pGV1295 17 bla(amp.sup.r) S.c. TDH3 promoter - myc-ilvC - CYC1 terminator 2micron TRP1 pUC ori pGV1390 18 bla(amp.sup.r) S.c. CUP1-1 promoter - L.l. alsS - CYC1 terminator 2micron HIS3 pUC ori pGV1438 19 bla(amp.sup.r) S.c. TDH3 promoter - myc-ilvD - CYC1 terminator 2micron LEU2 pUC ori pGV1503 8 bla(amp.sup.r) S.c. TEF1 promoter - KanR pUC ori pGV1537 9 bla(amp.sup.r) S.c. TEF1 promoter - KanR pUC ori K. lactis PDC1 5' region - Pm/I - K. lactis PDC1 3' region pGV1429 10 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6micron TRP1 pUC ori pGV1430 11 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6micron LEU2 pUC ori pGV1431 12 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6micron K.m. URA3 pUC ori pGV1472 13 bla(amp.sup.r) S.c. TEF1 promoter - AU1(x2)-L.l. alsS - CYC1 terminator 1.6micron LEU2 pUC ori pGV1473 14 bla(amp.sup.r) S.c. TEF1 promoter - AU1(x2)-E.c. ilvD - S.c. TDH3 promoter - myc-E.c. ilvC - CYC1 terminator 1.6micron TRP1 pUC ori pGV1475 15 bla(amp.sup.r) S.c. TEF1 promoter - HA-L.l. KIVD - S.c. TDH3 promoter - myc-S.c. ADH7 - CYC1 terminator 1.6micron K.m. URA3 pUC ori pGV1590 20 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator 1.6micron K.m. URA3 pUC ori pGV1726 21 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator TRP1 pUC ori pGV1727 22 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN - S.c. TDH3 promoter - E.c. ilvC deltaN - CYC1 terminator LEU2 pUC ori pGV1649 29 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator 2micron TRP1 pUC ori pGV1664 30 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator 2micron URA3 pUC ori pGV1672 31 bla(amp.sup.r) S.c. CUP1-1 promoter - polylinker - CYC1 terminator CEN6/ARSH4 TRP1 pUC ori pGV1673 32 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator CEN6/ARSH4 TRP1 pUC ori pGV1677 33 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN - S.c. TDH3 promoter - E.c. ilvC deltaN - CYC1 terminator 2micron HIS3 pUC ori pGV1679 34 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN - S.c. TDH3 promoter - E.c. ilvC deltaN - CYC1 terminator CEN6/ARSH4 HIS3 pUC ori pGV1683 35 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator CEN6/ARSH4 URA3 pUC ori
[0347] Table 3 outlines the primers sequences disclosed herein:
TABLE-US-00003 SEQ ID No. Name NO: Sequence 489 MAT common 30 AGTCACATCAAGATCGTTTATGG 490 MAT alpha 31 GCACGGAATATGGGACTACTTCG 491 MAT a 32 ACTCCACTTCAAGTAAGAGTTTG 838 pGV1423-seq1 (838) 33 TATTGTCTCATGAGCGGATAC 965 KlPDC1 -616 FOR 34 ACAACGAGTGTCATGGGGAGAGG AAGAGG 966 KlPDC1 +2528 REV 35 GATCTTCGGCTGGGTCATGTGAG GCGG 995 KlPDC1 internal 36 ACGCTGAACACGTTGGTGTCTTG C 996 KlPDC1 internal 37 AACCCTTAGCAGCATCGGCAACC 1010 Kl-PDC1-prom-seq-c 38 TATTCATGGGCCAATACTACG 1006 Kl-PDC1-prom-3c 39 GTAGAAGACGTCACCTGGTA GACCAAAGATG 1009 Kl-PDC1-term-5c 40 CATCGTGACGTCGCTCA ATTGACTGCTGCTAC 1016 Kl-PDC1-prom-5-v2 41 ACTAAGCGACACGTGCG (1016) GTTTCTGTGGTATAG 1017 KI-PDC1-term-3c-v2 42 GAAACCGCACGTGTCGCT (1017) TAGTTTACATTTCTTTCC 1019 TEF1prom-5c (1019) 43 TTTGAAGTGGTACGGCGATG 1321 Bs-alsS-Q-A5 (1321) 44 AATCATATCGAACACGATGC 1324 Bs-alsS-Q-B3 (1324) 45 AGCTGGTCTGGTGATTCTAC 1325 Ec-ilvC-dN-Q-A5 46 TATCACCGTAGTGATGGTTG (1325) 1328 Ec-ilvC-dN-Q-B3 47 GTCAGCAGTTTCTTATCATCG (1328) 1330 Ec-ilvD-dN-co-KI- 48 GCGAAACTTACTTGACGTTC Q-A3 (1330) 1331 Ec-ilvD-dN-co-KI- 49 ACTTTGGACGATGATAGAGC Q-B5 (1331) 1334 Ll-kivd-co-Ec-Q-A3 50 GCGTTAGATGGTACGAAATC (1334) 1335 Ll-kivd-co-Ec-Q-B5 51 CTTCTAACACTAGCGACCAG (1335) 1338 Sc-ADH7-Q-A3 (1338) 52 AAAGATGATGAGCAAACGAC 1339 Sc-ADH7-Q-B5 (1339) 53 CGAGCAATACTGTACCAATG 1375 HO +1300 F 54 TCACGGATGATTTCCAGGGT 1376 HO +1761 R 55 CACCTGCGTTGTTACCACAA
Example 1: Construction and Confirmation of PDC Deletion in K. lactis
[0348] The purpose of this Example is to describe how a PDC-deletion variant of a member of the Saccharomyces clade, Crabtree-negative yeast, pre-WGD yeast K. lactis was constructed and confirmed.
[0349] Construction of plasmid pGV1537: Plasmid pGV1537 (SEQ ID NO: 1) was constructed by the following series of steps. All PCR reactions carried out to generate pGV1537 used KOD polymerase (Novagen, Inc., Gibbstown, N.J.) and standard reaction conditions according to the manufacturer. A first round of two PCR reactions was carried out, wherein one PCR reaction contained primers 1006 and 1016 and used approximately 100 ng of genomic DNA from K. lactis strain GEVO1287 as a template. The other first-round PCR reaction contained primers 1017 and 1009 and approximately 100 ng of genomic DNA from K. lactis strain GEVO1287 as a template. The two resulting PCR products (approximately 530 bp and 630 bp in size, respectively) were gel purified using a Zymo Research Gel DNA Extraction kit (Zymo Research, Orange, Calif.) according to manufacturer's instructions and eluted into 10 .mu.L of water. Two (2) microliters of each eluted PCR product were then used as a template for a final round of KOD polymerase-catalyzed PCR, which also included primers 1006 plus 1009. The resulting product was purified (Zymo Research DNA Clean & Concentrate kit, Zymo Research, Orange, Calif.), digested to completion with the enzymes MfeI and AatII, and the resulting product gel purified and eluted as described above. This DNA was ligated into the vector pGV1503 (FIG. 8), which had been digested with EcoRI plus AatII, treated with calf alkaline phosphatase, and gel purified as described above. Colonies arising from transformation of the ligated DNA were screened by restriction digest analysis and confirmed by DNA sequencing reactions using primers 838, 1010, and 1019. Correct recombinant DNA resulting from the ligation and subsequent analysis was named pGV1537 (FIG. 9).
[0350] Construction of a K. lactis Klpdc1.DELTA. Strain:
[0351] Strain GEVO1287 was transformed with PmlI-digested, linearized plasmid pGV1537. Transformation was carried out by electroporation with approximately 300 ng of linearized pGV1537, essentially as described by Kooistra et al. (Kooistra, R., Hooykaas, P. J. J., and Steensman, H. Y. (2004) "Efficient gene targeting in Kluyveromyces lactis". Yeast 21:781-792). Transformed cells were selected by plating onto YPD plates containing 0.2 mg/mL geneticin (G418). Colonies arising from the transformation were further selected by patching colonies onto YPD plates and then replica plating onto YPD containing 5 .mu.M (final concentration) of the respiratory inhibitor Antimycin A, as Pdc-variants of K. lactis are unable to grow on glucose in the presence of Antimycin A (Bianchi, M., et al., (1996). "The petite negative yeast Kluyveromyces lactis has a single gene expressing pyruvate decarboxylase activity". Molecular Microbiology 19(1):27-36) and can therefore be identified by this method. Of the 83 G418-resistant colonies patched onto YPD+Antimycin A, six colonies (.about.7%) were unable to grow and were therefore identified as candidate Klpdc1::pGV1537 disruption strains.
[0352] Confirmation of a K. lactis Klpdc1.DELTA. Strain by Colony PCR:
[0353] Candidate Klpdc1::pGV1537 disruption strains were confirmed by colony PCR analysis. To do so, genomic DNA from candidate lines was obtained by the following method. A small amount (equivalent to a matchhead) of yeast cells were resuspended in 50 .mu.L of 0.2% SDS and heated to 95.degree. C. for 6 minutes. The suspension was pelleted by centrifugation (30 sec, 16,000.times.g) and 1 .mu.L of the supernatant was used as template in 50 .mu.L PCR reactions. In addition to standard components, the reactions contained Triton X-100 at a final concentration of 1.5% and DMSO at a final concentration of 5%. The various primer sets used, and the expected amplicon sizes expected, are indicated in Table EX1-1. By these analyses, a correct Klpdc1.DELTA.::pGV1537 strain was identified and was named GEVO1742.
TABLE-US-00004 TABLE EX1-1 Primer pairs and expected amplicon sizes predicted for colony PCR screening of candidate Klpdc1.DELTA.::pGV1537 cells. Expected product size for Expected product size Primer Pair Klpdc1.DELTA.::pGV1537 for KIPDC1+ 965 & 838 796 bp (none) 1019 & 966 947 bp (none) 995 & 996 (none) 765 bp
[0354] Confirmation of GEVO1742 Klpdc1.DELTA.::pGV1537 by Fermentation:
[0355] Strains of K. lactis lacking KlPdc1p (Klpdc1.DELTA.) have been shown to produce significantly lower levels of ethanol when grown on glucose (Bianchi, M., et al., (1996). "The petite negative yeast Kluyveromyces lactis has a single gene expressing pyruvate decarboxylase activity". Molecular Microbiology 19(1):27-36). To confirm this phenotype, fermentations with strains GEVO1287 and GEVO1742 were carried out. Briefly, a saturated overnight (3 mL) culture of each strain grown in YPD was inoculated into 25 mL of YPD at a starting OD.sub.600 of 0.1 and grown aerobically in a loosely-capped flask in a shaker for 24 hours at 30.degree. C., 250 rpm. Following growth, 2 mL of culture were collected, the cells pelleted by centrifugation (5 minutes, 14,000.times.g) and the supernatant subjected to analysis by gas chromatography and liquid chromatography. A summary of the data from these analyses is summarized in Table EX1-2. The strongly diminished production of ethanol and the increased accumulation of pyruvate in the fermentation medium are characteristic of K. lactis strains in which PDC1 has been deleted. Thus, these observations confirm the molecular genetics conclusions that strain GEVO1742 is in fact Klpdc1.DELTA..
TABLE-US-00005 TABLE EX1-2 Ethanol and pyruvate produced and glucose consumed in aerobic fermentations of GEVO1287 and GEVO1742. Ethanol Pyruvate Glucose produced produced consumed STRAIN (g/L) (g/L) (g/L) GEVO1287 8.129 (not detected) 17.56 GEVO1742 0.386 1.99 5.25
Example 2: Construction and Confirmation of PDC Deletion in S. cerevisiae
[0356] The purpose of this Example is to describe how a PDC deletion variant of a member of the Saccharomyces sensu stricto yeast group, the Saccharomyces yeast clade, a Crabtree-positive yeast, and a post-WGD yeast, S. cerevisiae was constructed and confirmed.
[0357] Strains GEVO1537 and GEVO1538 were incubated in 1% potassium acetate for 3-4 days which induces sporulation. The resulting haploid spores were recovered by random spore analysis. Briefly, a culture of sporulating cells was examined microscopically to ensure that a sufficient fraction of cells had sporulated (>10%). Five (5) mL of a culture of sporulated cells were collected by centrifugation (5 minutes at 3000.times.g) and washed once in 1 mL of water. The cells were resuspended in 5 mL water to which was added 0.5 mL of a 1 mg/mL solution (freshly made) of Zymolyase-T (in water) as well as 10 .mu.L of .beta.-mercaptoethanol. The cell suspension was incubated overnight at 30.degree. C. in a shaker at 50 rpm. Five mL of 1.5% Triton X-100 were added and the mixture was incubated on ice for 15 minutes. The solution was sonicated three times for 30 seconds per cycle at 50% power, with 2 minutes rest on ice in between sonication cycles. The suspension was centrifuged (1200.times.g, 5 minutes) and washed twice with 5 mL of water. The final cell pellet was resuspended in 1 mL water and cells were plated to YP+2% EtOH.
[0358] Following this procedure, the separate individual spores, were plated onto solid medium to obtain colonies, all of genotype HO pdc1::Tn5ble pdc5::Tn5ble pdc6:APT1 HIS3 LEU2 TRP1 URA3 and of unknown mating type. Some fraction of the cells were (homozygous) diploid due to the HO+ gene status and resultant mating type switching and re-mating to form diploids.
[0359] The genotype of the mating type locus of the putative Pdc-minus colonies was confirmed by PCR using Taq DNA polymerase (New England BioLabs, Ipswich, Mass.) under standard conditions using primers specific for the MAT a locus (primers #489 and #491) or MAT .alpha. locus (primers #490 and #491). Colonies that generated a single PCR product with one of the two possible primer sets primer set and no product when tested with the other were putative haploid Pdc-minus strains. To confirm the mating type, such strains were crossed to Gevo1187 and Gevo1188 (CEN.PK). Resulting diploid progeny were selected on medium containing glucose (to select for the presence of PDC+ genes introduced by CEN.PK background) and also lacking at least one of the following nutrients: histidine, leucine, tryptophan, or uracil (to select for the appropriate prototrophy as provided by the wild-type allele of the corresponding gene from the Gevo1537 or GEVO1538 background.
[0360] Diploid cells were sporulated and germinated on agar plates containing YP+2% ethanol (to permit growth of Pdc-minus isolates). To identify Pdc-minus candidates, viable colonies were streaked on to YPD agar plates and colonies that were inviable on glucose were isolated. Inability to grow on glucose confirms that these candidates are pdc1::ble and pdc5::ble. The pdc6::apt1 was confirmed their ability to grow on YP+Ethanol plates containing the antibiotic G418. The genotype of the mating type locus of the putative Pdc-minus colonies was confirmed by PCR using Taq DNA polymerase (New England BioLabs, Ipswich, Mass.) under standard conditions using primers specific for the MAT a locus (primers #489 and #491) or MAT .alpha. locus (primers #490 and #491). The presence of a product from both sets of PCR reactions indicated that both mating type alleles were present in the population, as a consequence of mating type allele switching by an active HO-encoded enzyme. The presence of a PCR product for one set of MAT locus-specific primers but not the other indicated that the strain lacks this activity and was therefore ho-. Based upon these analyses, six candidates colonies were identified as ho-strains and one candidate #4 was HO.
[0361] These Pdc-minus strains were streaked to SC+Ethanol plates lacking one of: leucine, histidine, tryptophan, or uracil, to determine presence of auxotrophic mutations within these strains. One Pdc-minus strain, GEVO1581, was auxotrophic for histidine, uracil, and tryptophan, and thus carried three of the makers (his3, ura3, and trp1). Another Pdc-minus strain, GEVO1715, was auxotrophic for uracil and leucine and thus carried the two markers, ura3 and leu2.
[0362] GEVO1581 and GEVO1715 were screened by RFLP analysis to verify the presence of the ho allele. A 447 bp portion of the HO locus was amplified by PCR that contained the codon that is altered in the ho allele (H475L) using primers 1375 and 1376. This mutation introduces an AluI restriction site, and consequently, digestion with AluI (New England BioLabs, Ipswich, Mass.) yielded either a 447 bp fragment (HO) or a 122 bp fragment plus a 325 bp fragment (ho). Based upon RFLP analysis, GEVO1581 was HO and GEVO1715 was ho.
[0363] To obtain a Pdc-minus strain with all four auxotrophic markers, GEVO1715 was crossed to GEVO1188 and diploids generated as described above. The resulting diploid was sporulated and Pdc-minus candidates were isolated by plating onto YP+Ethanol containing both Phleomycin and G418. These candidates were then streaked onto YPD agar plates and tested for their inviability on glucose. Those that did not grow on glucose were isolated as this phenotype, in addition to their resistance to Phleomycin and G418 confirms that these candidates are pdc1::ble, pdc5::ble and pdc6::apt1. These isolates were streaked to SC+Ethanol plates lacking one of: leucine, histidine, tryptophan, or uracil, to determine presence of auxotrophic mutations within these strains. One of these Pdc-minus strains, GEVO1584, was auxotrophic for histidine, uracil, tryptophan and leucine and thus carried all four markers, his3, ura3, trp1, and leu2. GEVO1584 was also confirmed to be MATa and ho by colony PCR and RFLP analysis, respectively, as described above.
TABLE-US-00006 TABLE EX2-1 Summary table of S. cerevisiae Pdc-minus strains obtained GEVO No. GENOTYPE STRAIN SOURCE 1537 MAT a/.alpha., HIS3, LEU2, TRP1, URA3, Strain GG570 from Paul van pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, Heusden, Univ. of Leiden, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Netherlands 1538 MAT a/.alpha., HIS3, LEU2, TRP1, URA3, Strain GG570 from Paul van pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, Heusden, Univ. of Leiden, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Netherlands 1581 MAT a/.alpha., his3/his3, trp1/trp1, ura3/ura3, candidate #4 LEU2/LEU2, pdc1::ble/pdc1::ble, GEVO1537xGEVO1187 pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO 1584 MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, candidate #201 pdc6::apt1(kanR), ho GEVO1715xGEVO1188 1715 MAT a, leu2, ura3, pdc1::ble, pdc5::ble, candidate #104 GEVO1187x pdc6::apt1(kanR), ho GEVO1537
Example 3: Other Pdc-Minus S. cerevisiae Strains
[0364] S. cerevisiae engineered to be deficient in PDC activity have been previously described: (Flikweert, M. T., van der Zanden, L., Janssen, W. M. T. M, Steensma, van Dijken J. P., Pronk J. T. (1996) Yeast 12(3):247-57). Such strains may be obtained from these sources.
Example 4: Chemostat Evolution of S. cerevisiae PDC Triple-Mutant
[0365] This example demonstrates that a PDC deletion variant of a member Saccharomyces sensu stricto yeast group, the Saccharomyces clade yeast, Crabtree-positive, post-WGD yeast, S. cerevisiae, can be evolved so that it does not have the requirement for a two-carbon molecule and has a growth rate similar to the parental strain on glucose.
[0366] A DasGip fermentor vessel was sterilized and filled with 200 ml of YNB (Yeast Nitrogen Base; containing per liter of distilled water: 6.7 g YNB without amino acids from Difco, the following were added per liter of medium: 0.076 g histidine, 0.076 g tryptophan, 0.380 g leucine, and/or 0.076 g uracil; medium was adjusted pH to 5 by adding a few drops of HCL or KOH) and contained 2% w/v ethanol. The vessel was installed and all probes were calibrated according to DasGip instructions. The vessel was also attached to an off-gas analyzer of the DasGip system, as well as to a mass spectrometer. Online measurements of oxygen, carbon dioxide, isobutanol, and ethanol were taken throughout the experiment. The two probes that were inside the vessel measured pH and dissolved oxygen levels at all times. A medium inlet and an outlet were also set up on the vessel. The outlet tube was placed at a height just above the 200 ml level, and the pump rate was set to maximum. This arrangement helped maintain the volume in the vessel at 200 ml. Air was sparged into the fermentor at 12 standard liters per hour (slph) at all times. The temperature of the vessel was held constant at 31.8.degree. C. and the agitation rate was kept at 300 rpm. The off-gas was analyzed for CO.sub.2, O.sub.2, ethanol and isobutanol concentrations. The amount of carbon dioxide (X.sub.CO2) and oxygen (X.sub.O2) levels in the off-gas were used to assess the metabolic state of the cells. An increase X.sub.CO2 levels and decrease in X.sub.O2 levels indicated an increase in growth rate and glucose consumption rate. The ethanol levels were monitored to ensure that there was no contamination, either from other yeast cells or from potential revertants of the mutant strain since the S. cerevisiae PDC triple-mutant (GEVO1584) does not produce ethanol. The minimum pH in the vessel was set to 5, and a base control was set up to pump in potassium hydroxide into the vessel when the pH dropped below 5.
[0367] GEVO1584 was inoculated into 10 ml of YNB medium with 2% w/v ethanol as the carbon source. The culture was incubated at 30.degree. C. overnight with shaking. The overnight culture was used to inoculate the DasGip vessel. Initially, the vessel was run in batch mode, to build up a high cell density. When about 3 g CDW/L of cell biomass was reached, the vessel was switched to chemostat mode and the dilution of the culture began. The medium pumped into the vessel was YNB with 7.125 g/L glucose and 0.375 g/L of acetate (5% carbon equivalent). The initial dilution rate was set to 0.1 h.sup.-1, but as the cell density started dropping, the dilution rate was decreased to 0.025 h.sup.-1 to avoid washout. GEVO1584 was mating type a. A PCR check for the mating type of the chemostat population several days into the experiment indicated that the strain still present was mating type a.
[0368] The culture in the chemostat was stabilized and the dilution rate increased to 0.1 h.sup.-1. After steady state was reached at the 0.1 h.sup.-1 dilution rate, the concentration of acetate was slowly decreased. This was achieved by using a two pump system, effectively producing a gradient pumping scheme. Initially pump A was pumping YNB with 7.125 g/L glucose, and 0.6 g/L of acetate at a rate of 12.5 mL/h and pump C was pumping YNB with only 7.125 g/L glucose at a rate of 7.5 mL/h. The combined acetate going into the vessel was 0.375 g/L. Then, over a period of 3 weeks, the rate of pump A was slowly decreased and the rate of pump C was increased by the same amount so that the combined rate of feeding was always 20 mL/h. When the rate of pump A dropped below 3 mL/h the culture started to slowly wash out. To avoid complete washout the dilution rate was decreased to 0.075 h.sup.-1 from 0.1 h.sup.-1 (FIG. 5). At this dilution rate, the rate of pump A was finally reduced to 0, and the evolved strain was able to grow on glucose only. Over the period of about five weeks, a sample was occasionally removed, either from the vessel directly or from the effluent line. Samples were analyzed for glucose, acetate, and pyruvate using HPLC, and were plated on YNB with glucose, YNB with ethanol, and YNB (w/o uracil) plus glucose or ethanol as negative control. Strains isolated from the chemostat did not grow on the YNB plates without uracil. OD.sub.600 was taken regularly to make sure the chemostat did not wash out. Freezer stocks of samples of the culture were made regularly for future characterization of the strains.
[0369] To characterize growth of the evolved strains YNB, YPD (yeast extract, peptone, dextrose), and YPE (yeast extract, peptone, ethanol) were used with various concentrations of glucose or ethanol. The growth characterization was performed in either snap-cap test tubes or 48-well plates (7.5 ml). The snap-cap test tubes were not closed completely so that air would vent in/out of the tubes, and the 48-well plates were covered with an air permeable membrane to allow for oxygen transfer. To check for contaminations, YPD or YPE agar plates were used with the antibiotics G418 and Phleomycin. The PDC triple mutant strain (GEVO1584) has both G418 and Phleomycin resistance markers, so the progeny of that strain were able to grow on the antibiotics. Single colonies isolated from each chemostat sample were studied for growth rates. A single colony isolated from the 35-day chemostat population was selected because of high growth rates on glucose as a sole carbon source, was resistant to both G418 and Phleomycin, and grew without the need for ethanol or acetate. The single colony was further evolved through 24 successive serial transfers in test tubes on YPD at 30.degree. C., 250 rpm shaking. The resulting strain, GEVO1863, grew similarly to the wild-type yeast parent on glucose (FIG. 6), did not produce ethanol (FIG. 7), and did not require ethanol or acetate for growth.
Example 5: Isobutanol Production in Pdc-Plus K. lactis
[0370] This example demonstrates isobutanol production in a member of the Saccharomyces clade, Crabtree-negative, pre-WGD yeast, K lactis.
[0371] The isobutanol production pathway was cloned in a K. lactis vector-based expression system: a SacI-MluI fragment containing the TEF1 promoter. Lactococcus lactis alsS and part of the CYC1 terminator sequence was cloned into the same sites of the K. lactis expression plasmid, pGV1430 (FIG. 11), to generate pGV1472 (FIG. 13, SEQ ID NO: 2). A SacI-MluI fragment containing the TEF1 promoter, E. coli ilvD, TDH3 promoter, E. coli ilvC, and part of the CYC1 terminator was cloned into the same sites of the K. lactis expression plasmid, pGV1429 (FIG. 10), to generate pGV1473 (FIG. 14, SEQ ID NO: 3). A BssHII-NotI fragment containing the TEF1 promoter, L. lactis kivD, TDH3 promoter and S. cerevisiae ADH7. ScAdh7 was cloned into the K. lactis expression plasmid, pGV1431 (FIG. 12), to obtain pGV1475 (FIG. 15, SEQ ID NO: 4).
[0372] The K. lactis strain GEVO1287 was transformed with the above plasmids, pGV1472, pGV1473, and pGV1475 (Table EX5-1) to express the isobutanol pathway. As a control, K. lactis GEVO1287 was also transformed with empty vectors pGV1430, pGV1429, and pGV1431 (Table EX5-1).
TABLE-US-00007 TABLE EX5-1 K. lactis clones expressing an isobutanol pathway clone Host Plasmid 1 Plasmid 2 Plasmid 3 ALS KARI DHAD KIVD ADH iB165 GEVO1287 pGV1430 pGV1429 pGV1431 -- -- -- -- -- iB173 GEVO1287 pGV1472 pGV1473 pGV1475 Ptef1- Ec. Ec. ilvD Ll. Sc. Ll. ilvC Kivd Adh7 alsS
[0373] Transformed cells were grown overnight and transferred to 100 mL fermentation bottles using 20 mL SC-WLU medium. Two mL samples were taken at 24 and 48 hours for GC analysis. At each time point, 2 mL of a 20% glucose was added after removing samples for GC analysis. At 48 hours the fermentation was ended. GC samples were processed as described. Results are shown in Table EX5-2 Up to 0.25 g/L isobutanol was produced in K. lactis transformed with an isobutanol pathway whereas the control strain without the pathway only produced 0.022 g/L in 48 hours.
TABLE-US-00008 TABLE EX5-2 K. lactis fermentation results Isobutanol titer Isobutanol yield clone (mg/L) (% theoretical) Ethanol (g/L) iB165 0.022 0.13 11.4 iB173 0.25 1.5 12.6
[0374] To determine if isobutanol titers can be increased by using a rich complex media, fermentations were performed as described above with iB165 (vector only control) and iB173 using YPD instead of SC-WLU medium. In addition, fermentations were also carried out in 250 mL screw-cap flasks (microaerobic conditions) and in 125 mL metal-cap flasks (aerobic conditions). Samples were taken at 24, 48, and 72 and the isobutanol levels obtained are shown in Table EX5-3.
TABLE-US-00009 TABLE EX5-3 K. lactis fermentation results using YPD Isobutanol titer Isobutanol yield Ethanol clone Condition (mg/L) (% theoretical) (g/L) iB165 Anaerobic 66 0.4 27.4 iB165 Microaerobic 117 0.7 24.5 iB165 Aerobic 104 0.6 11.7 iB173 Anaerobic 297 1.8 25.8 iB173 Microaerobic 436 2.6 23.4 iB173 Aerobic 452 2.7 13.4
Example 6: Isobutanol Production in Pdc Plus S. cerevisiae
[0375] This example demonstrates isobutanol production in a member of Saccharomyces sensu stricto group, Saccharomyces clade, Crabtree-positive, post-WGD yeast, S. cerevisiae.
[0376] Various plasmids carrying the isobutanol production pathway were constructed for expression of this metabolic pathway in a Pdc-plus variant of S. cerevisiae, GEVO1187. Plasmids pGV1254 (FIG. 16; SEQ ID NO: 10), pGV1295 (FIG. 17; SEQ ID NO: 11) pGV1390 (FIG. 18; SEQ ID NO: 12), and pGV1438 (FIG. 19; SEQ ID NO: 13) were high copy S. cerevisiae plasmids that together expressed the five genes of the isobutanol pathway (TABLE EX6-1). pGV1390 was generated by cloning a SalI-BamHI fragment containing the L. lactis alsS (SEQ ID NO: 5) into the high copy S. cerevisiae expression plasmid, pGV1387, where the L. lactis alsS would be expressed under the CUP1 promoter. pGV1295 was generated by cloning a SalI-BamHI fragment containing the E. coli ilvC (SEQ ID NO: 6) into the high copy S. cerevisiae expression plasmid, pGV1266, where the E. coli ilvC would be expressed using the TDH3 promoter. pGV1438 was generated by cloning a SalI-BamHI fragment containing the E. coli ilvD (SEQ ID NO: 7) into the high copy S. cerevisiae expression plasmid, pGV1267, where the E. coli ilvD would be expressed using the TDH3 promoter. pGV1254 was made by cloning an EcoRI (filled in by Klenow polymerase treatment)-XhoI fragment containing the TDH3 promoter and S. cerevisiae ADH2 from pGV1241 into the BamHI (filled in by Klenow) and XhoI sites of pGV1186. pGV1186 was made by cloning a SalI-BamHI fragment containing the L. lactis kivD (SEQ ID NO: 8) into a high copy S. cerevisiae expression plasmid, pGV1102, where the L. lactis kivD would be expressed using the TEF1 promoter. pGV1241 was made by cloning a SalI-BamHI fragment containing the S. cerevisiae ADH2 (SEQ ID NO: 9) into a high copy S. cerevisiae expression plasmid, pGV1106, where the S. cerevisiae ADH2 would be expressed using the TDH3 promoter.
[0377] GEVO1187 was transformed with plasmids as shown in Table EX6-1. As a defective isobutanol pathway control, cells were transformed with pGV1056 (FIG. 23, empty vector control) instead of pGV1390. The transformants were plated onto appropriate selection plates. Single colonies from the transformation were isolated and tested for isobutanol production by fermentation.
TABLE-US-00010 TABLE EX6-1 Plasmid pGV# Promoter Gene Plasmid type marker pGV1254 Sc TEF1 L. lactis kivD High copy Sc URA3 pGV1295 Sc TDH3 E. coli ilvC High copy Sc TRP1 pGV1390 Sc CUP1 L. lactis alsS High copy Sc HIS3 pGV1438 Sc TDH3 E. coli ilvD High copy Sc LEU1
[0378] The cells were grown overnight and anaerobic batch fermentations were carried out as described in General Methods. SC-HWUL was used as the media. 2 mL samples were taken at 24, 48 and 72 hours for GC At each time point, the cultures were fed 2 mL of a 40% glucose solution. The fermentation was ended after 72 hours. Samples were processed and analyzed as described. The results are shown in Table EX6-2. As shown, isobutanol was produced in GEVO1187 transformed with the isobutanol-pathway containing plasmids.
TABLE-US-00011 TABLE EX6-2 Isobutanol production in S. cerevisiae, GEVO1187, after 72 hours Isobutanol Ethanol Titer Yield Titer Yield Strain Plasmids [g L.sup.-1] [%] [gL.sup.-1] [%] GEVO1187 pGV1254, pGV1438, 0.13 0.31 31 60 pGV1390, pGV1438 GEVO1187 pGV1056, pGV1295, 0.04 0.10 42 82 pGV1438, pGV1254
[0379] This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces clade, Crabtree-negative, pre-WGD yeast, K. lactis.
[0380] Description of Plasmids pGV1590, pGV1726, pGV1727:
[0381] pGV1590 (FIG. 20, SEQ ID NO: 14) is a K. lactis expression plasmid used to express L. lactis kivD (under TEF1 promoter) and S. cerevisiae ADH7 (under TDH3 promoter). This plasmid also carries the K. marxianus URA3 gene and the 1.6 micron replication origin that allow for DNA replication in K. lactis. pGV1726 (FIG. 21, SEQ ID NO: 15) is a yeast integration plasmid carrying the TRP1 marker and expressing B. subtilis alsS using the CUP1 promoter. pGV1727 (FIG. 22, SEQ ID NO: 16) is a yeast integration plasmid carrying the LEU2 marker and expressing E. coli ilvD under the TEF1 promoter and E. coli ilvC under the TDH3 promoter. Neither pGV1726 or pGV1727 carry a yeast replication origin.
[0382] Construction of GEVO1829, a K. lactis Strain with Pathway Integrated:
[0383] The isobutanol pathway was introduced into the Pdc-minus K. lactis strain GEVO1742 by random integrations of the pathway genes. GEVO1742 was transformed with the Acc65I-NgoMIV fragment of pGV1590 containing the L. lactis kivd and S. cerevisiae ADH7 but without the yeast replication origin, to generate GEVO1794. The presence of both L. lactis kivd and S. cerevisiae ADH7 was confirmed by colony PCR using primer sets 1334+1335 and 1338+1339, respectively. GEVO1794 was transformed with pGV1727, a yeast integration plasmid carrying E. coli ilvD (under the TEF1 promoter) and E. coli ilvC (under TDH3 promoter), that had been linearized by digesting with BcgI. The resulting strain, GEVO1818, was confirmed by colony PCR for the presence of E. coli ilvD and E. coli ilvC using primer sets 1330+1331 and 1325+1328, respectively. GEVO1818 was then transformed with pGV1726, a yeast integration plasmid carrying B. subtilis alsS (under the CUP1 promoter), that had been linearized by digesting with AhdI to generate GEVO1829. The presence of B. subtilis alsS was confirmed by colony PCR using primers 1321+1324.
[0384] Aerobic fermentations were carried out to test isobutanol production by the Pdc-minus strain carrying the isobutanol pathway, GEVO1829. The Pdc-minus strain without the isobutanol pathway, GEVO1742, was used as a control. These strains were cultured in YPD overnight at 30.degree. C., 250 rpm, then diluted into 20 mL fresh YPD in a 125 mL flask and grown at 30.degree. C., 250 rpm. 2 mL samples were taken at 24 and 48 hours, cells pelleted for 5 minutes at 14,000.times.g and the supernatant was analyzed for isobutanol by GC. In addition glucose concentrations were analyzed by LC. The results are shown in Table EX7-1. At 48 hours, the OD of the GEVO1742 strain had reached over 8.5 while the OD of the GEVO1829 was less than 5. GEVO1829 consumed around 15.7 g/L glucose while GEVO1742 consumed roughly 7.7 g/L glucose. GEVO1829 produced 0.17 g/L isobutanol while GEVO1742 did not produce any isobutanol above media background.
TABLE-US-00012 TABLE EX7-1 K. lactis fermentation results Isobutanol titer Isobutanol yield Ethanol Clone (mg/L) (% theoretical) (mg/L) GEVO1742 0 0 17 GEVO1829 170 2.6 53
Example 8A: Isobutanol Production in Pdc-Minus S. cerevisiae GEVO1581
[0385] This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
[0386] Strain GEVO1581 with the three genes encoding PDC activity deleted (pdc1.DELTA., pdc5.DELTA., and pdc6.DELTA.) was used to produce isobutanol. Isobutanol pathway enzymes were encoded by genes cloned into three plasmids. pGV1103 (FIG. 26, SEQ ID NO: 20), pGV1104 (FIG. 27, SEQ ID NO: 21) and pGV1106 (FIG. 28, SEQ ID NO: 22) were empty high copy expression vectors that carry as marker genes, URA3, HIS3 and TRP1, respectively. The B. subtilis alsS gene, express using the CUP1 promoter, was encoded on either a low copy CEN plasmid, pGV1673 (FIG. 32, SEQ ID NO: 26) or a high copy plasmid, pGV1649 (FIG. 29, SEQ ID NO: 23). Both of these plasmids used TRP1 as a marker gene. E. coli ilvD (expressed using the TEF1 promoter) and E. coli ilvC (expressed using the TDH3 promoter) were expressed off of the high copy plasmid pGV1677 (FIG. 33, SEQ ID NO: 27). This plasmid utilized HIS3 as a marker gene. L. lactis kivD (expressed using the TEF1 promoter) and S. cerevisiae ADH7 (expressed using the TDH3 promoter) were expressed off of the high copy plasmid pGV1664 (FIG. 30, SEQ ID NO: 24). This plasmid utilized URA3 as a marker gene. Combination of these plasmids (Table EX8-1) to reconstitute the isobutanol pathway were introduced into GEVO1581 by lithium acetate transformation (described in General Methods).
TABLE-US-00013 TABLE EX8-1 Plasmids transformed into GEVO1581 Fermentation # Strain Plasmids Notes iB250 GEVO1581 pGV1103, Vector Control pGV1104, pGV1106 iB251 GEVO1581 pGV1677, iBuOH Pathway, alsS on pGV1649, 2 micron plasmid pGV1664 iB252 GEVO1581 pGV1677, iBuOH Pathway, alsS on pGV1673, CEN plasmid pGV1664
[0387] Fermentation experiments were carried out with GEVO1581 transformed with plasmids according to Table EX8-1 to determine the amount of isobutanol produced (titer) and the percentage of isobutanol to consumed glucose (yield).
[0388] Fermentations with Transformants of GEVO1581:
[0389] Using cells grown in 3 mL defined (SC-Ethanol) medium, 20 mL cultures were inoculated with transformants of GEVO1581 (3 independent colonies per transformation set) to an OD.sub.600 of approximately 0.1. The cultures were incubated at 30.degree. C. at 250 RPM in 125 mL metal cap flasks until they reached an OD.sub.600 of approximately 1. Glucose was added to a final concentration of 5% and a 2 mL aliquot was removed from each sample (T=0 sample). The OD.sub.600 of each sample was measured, the cells in each sample were pelleted by centrifugation (14,000.times.g, 5 min), and the supernatant from each sample was stored at -20.degree. C. The remaining cultures were incubated at 30.degree. C. at 125 RPM for another 48 hours. Samples (2 mL) were removed after 24 and 48 hours and prepared as just described. The samples were thawed, and prepared as described in General Methods. Three individual transformants were used for each set of plasmids during the fermentations. The amount of glucose consumed and the amount of pyruvate, glycerol, ethanol, and isobutanol produced after 48 hours are listed in Table EX8A-2.
TABLE-US-00014 TABLE EX8A-2 48 hour time point data are shown as an average of three replicates Glucose consumed Isobutanol Yield (g/L) (mg/L) (% theoretical) iB250 3.6 .+-. .7.sup. 4.7 .+-. 0.00 0.31 .+-. 0.04 iB251 2.8 .+-. 1.6 122 .+-. 41 11.0 .+-. 5.0 iB252 1.2 .+-. .5 62 .+-. 11 12.8 .+-. 2.8
[0390] Again using cells grown in 3 mL defined (SC-Ethanol) medium, 20 mL cultures were inoculated with transformants of GEVO1581 to an OD.sub.600 of approximately 0.1. The cultures were incubated at 30.degree. C. at 250 RPM in 125 mL metal cap flasks until they reached an OD.sub.600 of approximately 1. Biomass was pelleted and resuspended in 20 ml media with 2% glucose as the sole carbon source and a 2 mL aliquot was removed from each sample (T=0 sample). The OD.sub.600 of each sample was measured and each sample was stored at -20.degree. C. The remaining cultures were incubated at 30.degree. C. at 125 RPM for another 48 hours. Samples (2 mL) were removed after 24 and 48 hours and stored at -20.degree. C. The samples were thawed, and prepared as described in General Methods. The amounts of ethanol and isobutanol produced after 48 hours are listed in Table EX8A-3.
TABLE-US-00015 TABLE EX8A-3 48 hour time point data for fermentation in glucose, shown as an average of three replicates Isobutanol Isobutanol yield Ethanol Ethanol yield (mg/L) (% theoretical) (mg/L) (% theoretical) iB250 0 0 0 0 iB251 210 3.5 110 1.8
Example 8B: Isobutanol Production in Pdc-Minus S. cerevisiae GEVO1584
[0391] This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade, Crabtree-positive yeast, WGD yeast, S. cerevisiae.
[0392] GEVO1581 is a diploid strain, thus, a second backcross of a Pdc-minus yeast into the CEN.PK background was performed, yielding a Pdc-minus haploid strain GEVO1584 with the required auxotrophic markers for plasmid propagation.
[0393] Transformations of Gevo1584:
[0394] The following combinations of plasmids were transformed into GEVO1584 (Table EX8B-1) using lithium acetate transformation (described in General Methods) followed by selection on appropriate minimal media. pGV1672 (FIG. 31, SEQ ID NO: 25), pGV1056 (FIG. 23, SEQ ID NO: 17), and pGV1062 (FIG. 24, SEQ ID NO: 18) were empty low copy CEN expression vectors that carry as marker genes, TRP1, HIS3, and URA3. pGV1103 (FIG. 26, SEQ ID NO: 20), pGV1104 (FIG. 27, SEQ ID NO: 21) and pGV1102 (FIG. 25, SEQ ID NO: 19) were empty high copy expression vectors that carry as marker genes, URA3, HIS3 and TRP1, respectively. The isobutanol pathway was expressed off of low copy CEN plasmids pGV1673 (FIG. 32, SEQ ID NO: 26), pGV1679 (FIG. 34, SEQ ID NO: 28) and pGV1683 (FIG. 35, SEQ ID NO: 29). pGV1673 carried the B. subtilis alsS under the CUP1 promoter and utilized the TRP1 marker gene. pGV1679 carried the E. coli ilvD and E. coli ilvC genes expressed using the TEF1 and TDH3 promoters, respectively, and utilized the HIS3 marker gene. pGV1683 carried the L. lactis kivd and the S. cerevisiae ADH7 genes expressed using the TEF1 and TDH3 promoters, respectively, and utilized the URA3 marker gene. The isobutanol pathway was also expressed off of high copy plasmids pGV1649 (FIG. 29, SEQ ID NO: 23), pGV1677 (FIG. 33, SEQ ID NO: 27) and pGV1664 (FIG. 30, SEQ ID NO: 24). pGV1649 carried the B. subtilis alsS under the CUP1 promoter and utilized the TRP1 marker gene. pGV1677 carried the E. coli ilvD and E. coli ilvC genes expressed using the TEF1 and TDH3 promoters, respectively, and utilized the HIS3 marker gene. pGV1664 carried the L. lactis kivd and the S. cerevisiae ADH7 genes expressed using the TEF1 and TDH3 promoters, respectively, and utilized the URA3 marker gene.
TABLE-US-00016 TABLE EX8B-1 Fermentation # Strain Plasmids Notes iB300 GEVO1584 pGV1672, Vector Control pGV1056, (CEN plasmids) pGV1062 iB301 GEVO1584 pGV1673, Isobutanol pathway pGV1679, (CEN plasmids) pGV1683 iB302 GEVO1584 pGV1103, Vector Control pGV1104, (2.mu. plasmids) pGV1102 iB303 GEVO1584 pGV1677, Isobutanol pathway pGV1649, (2.mu. plasmids) pGV1664
[0395] Fermentations with Transformants of GEVO1584:
[0396] Using cells grown in 3 mL defined (SC) media containing ethanol (SC+Ethanol-HWU), 200 mL cultures were inoculated with transformants of GEVO1584 and incubated in SC+Ethanol-HWU at 30.degree. C. at 250 RPM in 500 mL shake flasks for 72 hours. The OD.sub.600 values measured after 72 hours ranged from 1.4 to 3.5. The cultures were diluted 1:10 into fresh 250 mL SC+Ethanol-HWU media and incubated at 30.degree. C. at 250 RPM in 500 mL shake for 24 hours. The cells were collected by centrifugation at 3000 RPM for 3 minutes and resuspended in 20 mL SC+Glucose-HWU media in 125 mL metal cap flasks. 250 .mu.L of 100% ethanol was added to each culture to bring the concentration of ethanol to 1%. A 2 mL aliquot was removed, the OD.sub.600 was measured using 100 .mu.L, and the remaining aliquot was centrifuged to pellet cells (14,000.times.g, 5 min) and the supernatants were stored at -20.degree. C. The cultures were incubated at 125 rpm at 30.degree. C. A 2 mL aliquot was removed from each culture after 24 and 48 hours of incubation, and the OD.sub.600 was measured as before (see Table 3, t=24 and t=48) and the sample centrifuged and stored as described above. The samples were thawed, and the samples were prepared and analyzed via GC and HPLC as described in General Methods. Results are shown in Table EX8B-2.
TABLE-US-00017 TABLE EX8B-2 48 hour time point data are shown as an average of three replicates Isobutanol Glucose Ethanol Titer Consumed Consumed Yield Fermentation # (g/L) (g/L) (g/L) (% theor.)] iB300 Vector Control 0.012 .+-. 0.003 9.75 .+-. 4.17 2.47 .+-. 0.30 0.30% (CEN plasmids) iB301 Isobutanol 0.392 .+-. 0.087 9.31 .+-. 5.03 0.95 .+-. 0.64 10.27% pathway (CEN plasmids) iB302 Vector Control 0.013 .+-. 0.006 8.61 .+-. 4.51 0.64 + 0.17 0.37% (2.mu. plasmids) iB303 Isobutanol 0.248 .+-. 0.032 9.51 .+-. 1.25 0.77 .+-. 0.59 6.36% pathway (2.mu. plasmids)
[0397] All Pdc-minus yeast (GEVO1584) consumed approximately 10 g/L of glucose and less than 2 g/L of ethanol after 48 hours. All strains accumulated .about.1.5 g/L pyruvate, except for those carrying the isobutanol pathway on 2p plasmids (<0.5 g/L). The accumulation of pyruvate and failure of the yeast to produce ethanol from glucose is confirmation that all lacked PDC activity. After 48 hours, the Pdc-minus yeast with the isobutanol pathway encoded on 2.mu. plasmids generated 0.248.+-.0.032 g/L isobutanol at a theoretical yield of 6.36% of the consumed glucose (Table EX8B-2). The CEN plasmid isobutanol pathway strain generated 0.392.+-.0.087 g/L isobutanol at a yield of 10.27% (Table EX8B-2). Isobutanol titers were well above the equivalent vector control strains.
Example 9: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis
[0398] In yeast, excess NADH is oxidized to NAD+ through the generation of glycerol. The key enzyme involved in this reaction is the glycerol 3-phosphate dehydrogenase. Deletion of the gene encoding this protein, KI-Gpd1p, would eliminate loss of NADH as well as carbons from glucose. This would lead to an increased yield of isobutanol.
[0399] The PDC-minus K. lactis strain, GEVO1488, is engineered to delete GPD1 gene of K. lactis. This PDC-minus GPD-minus strain is transformed with pGV1565 and pGV1568 (FIG. 36 and FIG. 37). These transformants are then subjected to anaerobic batch fermentation and samples analyzed as described. As shown in Table EX9-1, the additional deletion of GPD1 is expected to result in a significant increase in isobutanol yield.
Example 10:: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
[0400] Yield is further increased by the use of a pathway in which there is a balanced usage of NADH and NADPH. This balance is accomplished by the use of an engineered ilvC which is able to utilize NADH and the NADH-dependent alcohol dehydrogenase, Adh2. These constructs are used to express the isobutanol pathway in a PDC-minus and GPD-minus K. lactis. This strain is subjected to anaerobic batch fermentation as described above and samples are analyzed for isobutanol. As shown in Table EX9-1, the yield of isobutanol using this pathway in a PDC-minus K. lactis is expected to result in a significant increase in yield.
Example 11: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
[0401] An alternative route to balancing the NADH and NADPH usage is to overexpress an NADP.sup.+-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in addition to the endogenous NAD.sup.+-dependent GAPDH, such that both NADH and NADPH are generated from glycolysis. The isobutanol pathway can utilize an NADPH-dependent KARI enzyme and the NADH-dependent Adh2p. In this case, PDC-minus and GPD-minus K. lactis is transformed with a construct expressing a NADP+-dependent GAPDH and an isobutanol pathway using Adh2. This strain is subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX9-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
Example 12: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
[0402] Yet another alternative route to balancing the NADH and NADPH usage is to replace the endogenous NAD.sup.+-dependent GAPDH with an NADP.sup.+-dependent GAPDH in a PDC-minus and GPD-minus K. lactis. This strain is transformed with the isobutanol pathway and subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX9-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
TABLE-US-00018 TABLE EX9-1 Isobutanol productivity in K. lactis strains after 48 hours. (Listed numbers for the pdc-minus strains are expected numbers). Isobutanol Ethanol Titer Yield Titer Yield Genotype Plasmid [g L.sup.-1] [%] [g L.sup.-1] [%] PDC+ pathway genes 0.25 1.5 12.6 62 GPD+ pdc- pathway genes 8.2 50 0.01 0.05 GPD+ pdc- pathway genes 11.5 70 0.01 0.05 gpd- pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADH utilizing pathway) pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADH and NADPH production from glycolysis) pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADPH production from glycolysis)
Example 13: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus and GPD-Minus S. cerevisiae
[0403] The PDC-minus S. cerevisiae strain is engineered to delete both GPD1 and GPD2. This PDC-minus GPD-minus strain is transformed with plasmids expressing the isobutanol pathway in S. cerevisiae. These transformants are then subjected to anaerobic batch fermentation and samples analyzed as described. As is seen in Table EX13-1, the additional deletions of GPD1 and GPD2 is expected to result in a significant increase in isobutanol yield.
Example 14: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus and GPD-Minus S. cerevisiae with Balanced Isobutanol Pathway
[0404] Yield is further increased by the use of a pathway in which there is balanced usage of NADH and NADPH usage. This balance is accomplished by the use of an engineered KARI which is able to utilize NADH and the NADH-dependent alcohol dehydrogenase, Adh2p. These constructs are used to express the isobutanol pathway in a PDC-minus and GPD-minus S. cerevisiae. This strain is subjected to anaerobic batch fermentation as described above and samples are analyzed for isobutanol. As shown in Table EX13-1, the yield of isobutanol using this pathway in a PDC-minus S. cerevisiae is expected to result in a significant increase in yield.
Example 15: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus GPD-Minus S. cerevisiae with Balanced Isobutanol Pathway
[0405] An alternative route to balancing the NADH and NADPH usage is to overexpress an NADP.sup.+-dependent glyceraldehydes 3-phosphate dehydrogenase (GAPDH) in addition to the endogenous NAD.sup.+-dependent GAPDH, such that both NADH and NADPH are generated from glycolysis. The isobutanol pathway can utilize an NADPH-dependent KARI enzyme and the NADH-dependent Adh2. In this case, PDC-minus and GPD-minus S. cerevisiae is transformed with a construct expressing a NADP.sup.+-dependent GAPDH and an isobutanol pathway using Adh2. This strain is subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX13-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
Example 16: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus S. cerevisiae with Balanced Isobutanol Pathway
[0406] Yet another alternative route to balancing the NADH and NADPH usage is to replace the endogenous NAD.sup.+-dependent GAPDH with an NADP.sup.+-dependent GAPDH in a PDC-minus and GPD-minus S. cerevisiae. This strain is transformed with the isobutanol pathway and subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX13-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
TABLE-US-00019 TABLE EX13-1 Isobutanol productivity in S. cerevisiae strains after 48 hours. (Listed numbers for the pdc-minus strains are expected numbers). Isobutanol Ethanol Titer Yield Titer Yield Genotype Plasmid [g L.sup.-1] [%] [g L.sup.-1] [%] WT pathway genes 0.13 0.31 31 60 pdc- pathway genes 8.2 50 0.01 0.05 pdc- pathway genes 9.9 70 0.01 0.05 gpd- pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADH utilizing pathway) pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADH and NADPH production from glycolysis) pdc- balanced pathway 13.2 80 0.01 0.05 gpd- (NADPH production from glycolysis)
Example 17: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus GPD-Minus Evolved K. lactis with Balanced Isobutanol Pathway
[0407] In an embodiment, the yield for isobutanol may be increased by further engineering yeast microorganism to reduce production of minor byproducts. Isobutanol may be produced at a yield of about 90% theoretical.
Example 18: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus GPD-Minus Evolved S. cerevisiae with Balanced Isobutanol Pathway
[0408] In another embodiment, the yield for isobutanol may be increased by further engineering a yeast microorganism to reduce production of minor byproducts. Isobutanol may be produced at a yield of about 90% theoretical.
General Methods for Examples 19-24
[0409] Sample Preparation:
[0410] Samples were prepared from various timepoints for analysis by liquid chromatography and gas chromatography. 2 mL of media was removed and centrifuged at 14,000.times.g for 10 min. The supernatant was removed and stored at 4.degree. C. until analysis.
[0411] Determination of Optical Density:
[0412] The optical density of the yeast cultures was determined at 600 nm using a DU 800 spectrophotometer (Beckman-Coulter, Fullerton, Calif., USA). Samples were diluted as necessary to yield an optical density of between 0.1 and 0.8.
[0413] Gas Chromatography:
[0414] Analysis of ethanol and isobutanol was performed on a HP 5890 gas chromatograph fitted with a ZB-FFAP column (Phenomenex; 30 m length, 0.32 mm ID, 0.25 .mu.M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200.degree. C. for the injector with Agilent cyclo-splitter insert, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 70.degree. C./minute gradient to 235.degree. C., and then hold until a final run time of 5.54 min. Injection volume was 0.5 .mu.l, with a split ratio of 50:1; Helium flow rate was approximately 2.3 ml/min using a constant pressure of 0.88 bar.
[0415] High Performance Liquid Chromatography:
[0416] Analysis of glucose and organic acids was performed on a HP-1100 High Performance Liquid Chromatography system equipped with two Rezex RFQ-"Fast Fruit" columns in series (Phenomenex, 100.times.7.8 mm, 8 .mu.m particles), or equivalent, and an H.sup.+ cation guard column (Bio-Rad) or equivalent. Pyruvate and HMF were detected using an HP-1100 UV detector (210 nm, 8 nm 360 nm reference) while all other organic acids and glucose were detected using an HP-1100 refractive index detector. The column and RI temperatures were 60.degree. C. This method was Isocratic with 0.018N sulfuric acid in water as mobile phase. Flow was set at 1.1 mL/min. Injection size was 20 .mu.L and the run time was 15 minutes
[0417] Lithium Acetate transformations of S. cerevisiae strains were transformed by the Lithium Acetate method (Gietz et al., Nucleic Acids Res. 27:69-74 (1992). Cells were collected from overnight cultures grown in 50 mL of defined (SC) ethanol media at an OD.sub.600 of approximately 0.8 to 1.0 by centrifugation at 2700 rcf for 2 minutes at room temperature. The cell pellet was resuspended in 50 mL sterile water, collected by centrifugation (2700 rcf; 2 min; room temp.), and resuspended in 25 mL sterile water. The cells were collected by centrifugation (2700 rcf; 2 min; room temp.) and resuspended in 1 mL 100 mM lithium acetate. The cell suspension was transferred to a sterile 1.5 mL tube and collected by centrifugation at full speed for 10 seconds. The cells were resuspended in 100 mM lithium acetate with a volume four times the volume of the cell pellet (e.g. 400 .mu.L for 100 .mu.L cell pellet). To the prepared DNA Mix (72 .mu.l 50% PEG, 10 .mu.l 1M Lithium Acetate, 3 .mu.l boiled salmon sperm DNA, and 5 .mu.l of each plasmid), 15 .mu.l of the cell suspension was added and mixed by vortexing with five short pulses. The cell/DNA suspensions were incubated at 30.degree. C. for 30 minutes and at 42.degree. C. for 22 minutes. The cells were collected by centrifugation for 10 seconds at full speed and resuspended in 100 .mu.l SOS (1M Sorbitol, 0.34% (w/v) Yeast Extract, 0.68% (w/v) Peptone, 6.5 mM CaCl). The cell suspensions were top spread over appropriate selective agar plates.
[0418] Yeast Colony PCR:
[0419] Yeast cells were taken from agar medium and transferred to 30 .mu.l 0.2% SDS and heated for 4 mins at 90.degree. C. The cells were spun down and 1 .mu.l of the supernatant was used for PCR using standard Taq (NEB).
[0420] Molecular Biology:
[0421] Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook & Russell).
[0422] Media:
[0423] YP: contains 1% (w/v) yeast extract, 2% (w/v) peptone.
[0424] YPD is YP containing 2% (w/v) glucose, YPE is YP containing 2% (w/v) Ethanol.
[0425] YPD80 medium (Difco) is YP containing 80 g/L glucose, 0.2 g/L G418 antibiotic, 20 .mu.M CuSO.sub.4, and 1% ethanol.
[0426] SC+Complete: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco.TM. Yeast Nitrogen Base. 0.076 g/L histidine, 0.076 g/L tryptophan, 0.380 g/L leucine, and 0.076 g/L uracil.
[0427] Solid versions of the above described media contain 2% (w/v) agar.
Strains, Plasmids and Primer Sequences for Examples 19-24
TABLE-US-00020
[0428] TABLE EX 19-1 Genotype of strains for Examples 19-24. GEVO No. Genotype and/or Reference GEVO2712 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::{P.sub.CUP1-Bs_alsS2, TRP1} pdc5::{P.sub.TEF1:Sc_ILV3.DELTA.N P.sub.TDH3:Ec_ilvC_coSc.sup.Q110V, LEU2} pdc6::{P.sub.TEF1: Ll_kivd2_coEc P.sub.TDH3:Dm_ADH, URA3}, evolved for C2 supplement-independence, glucose tolerance and faster growth GEVO2843 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1.DELTA.::P.sub.CUP1:[Bs_alsS1_coSc:T.sub.CYC1: P.sub.PGK1: Ll_kivD2: P.sub.ENO2: Sp_HIS5] pdc5.DELTA.::[LEU2-bla-P.sub.TEF1: ILV3.DELTA.N: P.sub.TDH3: Ec_ilvC_coSc.sup.Q110V] pdc6.DELTA.::[URA3: bla; P.sub.TEF1: Ll_kivD2: P.sub.TDH3: Dm_ADH] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO2962 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::PCUP1-Bs_alsS_coSc- TCYC1-PPGK1-Ll_kivd-PENO2-Sp_HIS5 pdc5::LEU2-bla-PTEF1-ILV3.DELTA.N-PTDH3- ilvC_coSc_Q110V pdc6::URA3-bla-PTEF1-Ll_kivd-PTDH3-DmADH {evolved for C2 supplement-independence, glucose tolerance and faster growth} pGV2227 GEVO2994 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1- P.sub.PGK1-Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3059 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.- ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF- Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA- 1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3061 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.- ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF- Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA- 1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3124 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-L- l_adhA-P.sub.FBA1- Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3128 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::P.sub.CCW12-Hph gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1- Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3158 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-L- l_adhA-P.sub.FBA1- Sc_TRP1 [pGV2227] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3159 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-L- l_adhA-P.sub.FBA1- Sc_TRP1 [pGV2082] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3160 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::P.sub.CCW12-Hph gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1- Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3.DELTA.N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 [pGV2247] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3532 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3 gpd2::T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.- ENO2-Sp_HIS5 pdc5::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc6::P.sub.TEF1-Ll_ilvD_P.sub.TDH3-Ec_ilvC_coSc.sup.P2D1- .sup.A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} (first described here)
TABLE-US-00021 TABLE EX 19-2 Plasmids disclosed for Examples 19-24. GEVO No. Genotype or Reference pGV2082 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc_Q110V-P.sub.TPI1-G- 418R-P.sub.PGK1-Ll_kivD2_coEc- P.sub.ENO2-Dm_ADH, 2.mu. ori, bla, pUC-ori. pGV2227 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc.sup.Q110V-P.sub.TP- I1-G418R-P.sub.PGK1-Ll_kivd2_coEc- PDC1-3'region-P.sub.ENO2-Ll_adhA 2.mu. bla, pUC-ori pGV2247 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.TPI1- -G418R-P.sub.PGK1- Ll_kivD2_coEc-P.sub.ENO2-Ll_adhA, 2.mu. ori, bla, pUC-ori. pGV2563 P.sub.TEF1-Ll_ilvD_coSc, P.sub.TDH3-Ec_ilvC_coSc.sup.P2D1-A1-his8, P.sub.ENO2-Ll_adhA_coSc.sup.RE1-his8, 2.mu.-ori, pUC ori, bla, G418r
Example 19: Isobutanol Production in Pdc-Yeast
[0429] This example demonstrates isobutanol production at greater than 30% yield in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast S. cerevisiae.
[0430] GEVO2962 is a modified yeast biocatalyst that contains genes within the chromosome of the biocatalyst which encode a pathway of enzymes that convert pyruvate into isobutanol. GEVO2962 is GEVO2843 transformed with pGV2227 (SEQ ID NO: 57), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD2 (Lactococcus lactis kivD), and LI_AdhA (Lactococcus lactis adhA). The strain GEVO2843 is PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO2843 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) and Dm_ADH (Drosophila melanogaster ADH, SEQ ID NO: 60) under the TEF1 and TDH3 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (SEQ ID NO: 61) and Sc_ILV3.DELTA.N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
[0431] When the biocatalyst GEVO2962 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30.degree. C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO2962 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium (Difco) at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 1 L of YPD80 medium in a 2.8 L baffled Fernbach flask. The seed flask culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm.
[0432] A portion of the flask seed culture was transferred to a 2 L DasGip seed fermenter containing about 750 mL of YPD80 medium to achieve a 1 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 5.0 through addition of base, temperature at 30.degree. C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 1000 rpm and 2 sL/h air flow overlay. Cells were grown until the OD.sub.600 was about 10. Some of the seed fermenter culture was then transferred to a 2 L DasGip fermenter vessel containing about 1100 mL of YPD80. The vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at about 30.degree. C., dissolved oxygen, and agitation. Initially, during the cell growth phase, the vessel was agitated with a variable agitation of 400-600 rpm using a 10 sL/h air sparge until the OD.sub.600 was about 8. Cell growth continued for approximately 16 hrs, after which time, the agitation was fixed at 600 rpm with 5 sL/h airflow. The dissolved oxygen was approximately zero throughout this experiment with an OTR of about 4-8 mM/h. Continuous measurement of the fermentor vessel off-gas by mass spectrometer analysis was performed for oxygen, isobutanol, ethanol, and carbon dioxide throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration, and isobutanol concentration in the broth.
[0433] At about 48 h intervals throughout the 470 h experiment, the fermenter whole broth was removed from the fermenter, cells were separated from the broth using centrifugation at about 20.degree. C. and 4000.times.g in 500 mL centrifuge bottles. The cell pellets were resuspended in fresh YPD medium that contained 80 g/L glucose, 0.2 g/L G418 antibiotic, 20 .mu.M CuSO.sub.4, and 1% ethanol and returned to the fermenter. At six points throughout the fermentation, about 1 L of a flask culture of GEVO2962 at about 7 OD.sub.600 was concentrated to 50-100 mL by centrifugation and then added to the fermenter vessel aseptically.
[0434] The fermenter vessel was attached by tubing to a smaller 400 mL fermenter vessel that served as a flash tank and operated in a recirculation loop with the fermenter. Whole fermentation broth was recirculated between the flash tank and fermenter at a rate of about 10-30 mL per min. The volume in the flash tank was approximately 100 mL and the hydraulic retention time in the flash tank was about 3-10 minutes. Heat and vacuum were applied to the flash tank. The vacuum level applied to the flash tank was initially set at about 60 mBar and the flash tank was set at approximately 36.degree. C. Generally, the vacuum ranged from 50-65 mBar and the flash tank temperature ranged from 35.degree. C. to 37.degree. C. throughout the experiment. Vapor from the heated flash tank was condensed into a collection vessel as distillate. Whole fermentation broth was continuously returned from the flash tank back to the fermentation vessel. When the concentration of isobutanol in the broth dropped below 1.5 g/L, the flash recycle system was turned off. The flash recycle was turned back on when the broth concentration of isobutanol reached above 2.5 g/L.
[0435] The distillate recovered in the experiment was strongly enriched for isobutanol. Isobutanol formed an azeotrope with water and lead to a two phase distillate: an isobutanol rich top phase and an isobutanol lean bottom phase. Distillate samples were analyzed by GC for isobutanol concentration.
[0436] Isobutanol production reached a maximum at around 470 hrs with a total effective titer of about 111 g/L. The isobutanol production rate was about 0.24 g/L/h on average over the course of the experiment. The percent theoretical yield of isobutanol was approximately 36% at the end of the experiment.
Example 20: Isobutanol Production in Pdc-Gpd-Yeast
[0437] This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
[0438] The modified yeast biocatalyst, GEVO3158, encodes a heterologous pathway of enzymes that convert pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3158 is GEVO3124 transformed with pGV2247 (SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD (Lactococcus lactis kivD), and LI_adhA (Lactococcus lactis adhA). The strain GEVO3124 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3124 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc, and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3.DELTA.N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
[0439] GEVO3124 was generated by deletion of GPD2 using Hph as marker in strain GEVO3059. Deletion of GPD2 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD2 5' and 3' targeting sequences. This gpd2::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD2 5' targeting sequence was amplified from pGV2164 (SEQ ID NO: 69), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD2 3' targeting sequence was also amplified. Second, the GPD2 5' targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD2 3' targeting sequence were stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3059 recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates. Twelve colonies were re-streaked for singles and colony PCRs were performed in single colony isolates to test for correct 5' and 3' junctions and the loss of GPD2.
[0440] GEVO3059 was generated by deletion of GPD1 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD1 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5' bipartite fragment contained the GPD1_5' targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3' truncated and was generated by PCR with pGV2359 (SEQ ID NO: 72) as template. The 3' bipartite fragment contained KI_URA3_5' truncated-T.sub.KI.sub._.sub.URA3-GPD1_3' targeting sequence and was generated by PCR with pGV2157 (SEQ ID NO: 73) as template. The 3' truncated and 5' truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5' and 3' bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
[0441] GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc, (Lactococcus lactis ilvD, SEQ ID NO: 65) and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, into the PDC6 locus of GEVO2843. This integration replaced the LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) and the Dm_ADH (Drosophila melanogaster ADH, SEQ ID NO: 60) that were present at the PDC6 locus in GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712
[0442] When the biocatalyst GEVO3158 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30.degree. C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3158 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm.
[0443] A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30.degree. C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.7 mM/h by reducing agitation to a fixed 250-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
[0444] Isobutanol production reached a maximum at around 7 days with a titer of about 10 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 3.7 g/L and 10 g/L, was approximately 74% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 10 g/L, was approximately 52% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0.5 g/L and 10 g/L, was approximately 61% maximum theoretical.
Example 21: Isobutanol Production in Pdc-Gpd-Yeast
[0445] This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
[0446] The modified yeast biocatalyst, GEVO3159, encodes a heterologous pathway of enzymes that convert pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3159 is GEVO3124 transformed with pGV2082 (SEQ ID NO: 67), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD2 (Lactococcus lactis kivD), and Dm_ADH (Drosophila melanogaster ADH).
[0447] The strain GEVO3124 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3124 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3.DELTA.N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
[0448] GEVO3124 was generated by deletion of GPD2 using Hph as marker in strain GEVO3059. Deletion of GPD2 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD2 5' and 3' targeting sequences. This gpd2::Hph disruption cassette was generated by multiple rounds of SOE-PCR. First, the GPD2 5' targeting sequence was amplified from pGV2164 (SEQ ID NO: 69), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the HPH ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD2 3' targeting sequence was also amplified. Second, the GPD2 5' targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD2 3' targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3059 recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates. Twelve colonies were re-streaked for singles and colony PCRs were performed in single colony isolates to test for correct 5' and 3' junctions and the loss of GPD2.
[0449] GEVO3059 was generated by deletion of GPD1 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD1 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5' bipartite fragment contained the GPD1_5' targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3' truncated and was generated by PCR with pGV2359 (SEQ ID NO: 72) as template. The 3' bipartite fragment contained KI_URA3_5' truncated-T.sub.KI.sub._.sub.URA3-GPD1_3' targeting sequence and was generated by PCR with pGV2175 (SEQ ID NO: 73) as template. The 3' truncated and 5' truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5' and 3' bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
[0450] GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58 and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
[0451] When the biocatalyst GEVO3159 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30.degree. C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3159 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm.
[0452] A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30.degree. C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.7 mM/h by reducing agitation to a fixed 250-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
[0453] Isobutanol production reached a maximum at around 5 days with a titer of about 8.5 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 3.2 g/L and 8.5 g/L, was approximately 75% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 8.5 g/L, was approximately 48% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 1 g/L and 8.5 g/L, was approximately 58% maximum theoretical.
Example 22: Isobutanol Production in Pdc- Gpd-, Co-Factor Balanced Yeast
[0454] This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
[0455] The recombinant yeast microorganism, GEVO3160, encodes a heterologous biosynthetic pathway that converts pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3160 is GEVO3128 transformed with pGV2247(SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_P2D1-A1 (Escherichia coli ilvC variant), LI_ilvD (Lactococcus lactis ilvD), LI_kivD (Lactococcus lactis kivD), and LI_adhA (Lactococcus lactis adhA). The strain GEVO3128 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3128 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3.DELTA.N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
[0456] GEVO3128 was generated by deletion of GPD1 using Hph as marker in strain GEVO3061. To obtain a gpd1 gpd2 double deletion, deletion of GPD1 was pursued in the gpd2::KI_URA3 deletion strains GEVO3061 Deletion of GPD1 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD1 5' and 3' targeting sequences. This gpd1::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD1 5' targeting sequence was amplified from pGV2163 (SEQ ID NO: 74), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD1 3' targeting sequence was amplified by PCR. Second, the GPD1 5' targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD1 3' targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3061, recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates
[0457] GEVO3061 was generated by deletion of GPD2 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD2 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5' bipartite fragment contained the GPD2_5' targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3' truncated and was generated by PCR with pGV2360 (SEQ ID NO: 75) as template. The 3' bipartite fragment contained KI_URA3_5' truncated-T.sub.KI.sub._.sub.URA3-GPD2_3' targeting sequence and was generated by PCR with pGV2381(SEQ ID NO: 76) as a template. The 3' truncated and 5' truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5' and 3' bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
[0458] GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
[0459] When the biocatalyst GEVO3160 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30.degree. C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3160 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm.
[0460] A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell density. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30.degree. C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.4 mM/h by reducing agitation to a fixed 200 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC. Isobutanol production reached a maximum at around 7 days with a titer of about 10.5 g/L.
[0461] Yield of the fermentation, calculated when the titer of isobutanol was between 5.7 g/L and 10.2 g/L, was approximately 74% of theoretical (max yield calculation). Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 10.5 g/L, was approximately 48% of theoretical (yield calculation including growth of biomass). Yield of the fermentation, calculated when the titer of isobutanol was between 0.6 g/L and 10.5 g/L, was approximately 57% of theoretical (yield calculation for production phase only).
Example 23: Isobutanol Production in Pdc- Gpd-Yeast
[0462] This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
[0463] The recombinant yeast microorganism, GEVO3160, encodes a heterologous biosynthetic pathway that converts pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3160 is GEVO3128 transformed with pGV2247 (SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_P2D1-A1 (Escherichia coli ilvC variant), LI_ilvD (Lactococcus lactis ilvD), LI_kivD (Lactococcus lactis kivD), and LI_adhA (Lactococcus lactis adhA). The strain GEVO3128 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3128 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3.DELTA.N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
[0464] GEVO3128 was generated by deletion of GPD1 using Hph as marker in strain GEVO3061. To obtain a gpd1 gpd2 double deletion, deletion of GPD1 was pursued in the gpd2::KI_URA3 deletion strains GEVO3061 Deletion of GPD1 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD1 5' and 3' targeting sequences. This gpd1::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD1 5' targeting sequence was amplified from pGV2163 (SEQ ID NO: 74), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD1 3' targeting sequence was amplified by PCR. Second, the GPD1 5' targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD1 3' targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3061, recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates
[0465] GEVO3061 was generated by deletion of GPD2 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD2 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5' bipartite fragment contained the GPD2_5' targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3' truncated and was generated by PCR with pGV2360 (SEQ ID NO: 75) as template. The 3' bipartite fragment contained KI_URA3_5' truncated-T.sub.KI.sub._.sub.URA3-GPD2_3' targeting sequence and was generated by PCR with pGV2381 (SEQ ID NO: 76) as template. The 3' truncated and 5' truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5' and 3' bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
[0466] GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
[0467] When the biocatalyst GEVO3160 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30.degree. C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3160 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30.degree. C. shaker at 250 rpm.
[0468] A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30.degree. C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.3-0.8 mM/h by reducing agitation to a fixed 180-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
[0469] Isobutanol production reached a maximum at around 7 days with a titer of about 14 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 7.2 g/L and 12.6 g/L, was approximately 71% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 14 g/L, was approximately 52% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0.5 g/L and 14 g/L, was approximately 60% maximum theoretical.
Example 24: Isobutanol Production in Pdc- Gpd-Yeast
[0470] This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
[0471] GEVO3647 contains P.sub.ADH1-Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) with two copies of the Lactococcus lactis kivD gene (SEQ ID NO: 59) integrated at the PDC1 locus. The strain is a transformation product of the parent strain GEVO3532 with plasmid pGV2563 (SEQ ID NO: 68).
[0472] Medium used for the fermentation was YP+80 g/L glucose+1% v/v Ethanol +0.2 g/L G418. The medium was filter sterilized using a 1 L bottle top Corning PES 0.22 .mu.m filter (431174). Medium was pH adjusted 6.0 in the fermenter vessels using 6N KOH. Table EX 15-1 outlines medium components per liter of Di-H.sub.2O.
[0473] Inoculum cultures were started from patch plates and placing them in 500 mL baffled flasks containing 80 ml YP+20 g/L glucose+1% v/v ethanol+0.2 g/L G418 medium. The cultures were incubated for 32.5 h at 30.degree. C. in an orbital shaker at 250 rpm. Cell density after incubation was as at OD.sub.600 of 2.5. Batch fermentations were conducted using a 2 L top drive motor DasGip vessel with a working volume of 1.2 L per vessel. The operating conditions are summarized in Table EX15-1 below.
TABLE-US-00022 TABLE EX15-1 Process control parameters. Initial volume mL 1200 Temperature .degree. C. 30 pH 6.0 Growth Phase (0-32 hours): Oxygen transfer rate (OTR) mM/h 10.0 Air flow (overlay) slph 5.0 Agitation rpm 900 Dissolved oxygen (DO) % Not controlled Production phase (32-84.3 hours): Oxygen transfer rate (OTR) mM/h 0.5 Air flow (overlay) slph 5.0 Agitation rpm 300 Dissolved oxygen (DO) % Not controlled
[0474] Fermenter vessels were sterilized, along with the appropriate dissolved oxygen probes and pH probes, for 60 minutes at 121.degree. C. pH probes were calibrated prior to sterilization however, dissolved oxygen probes were calibrated post sterilization in order to achieve complete polarization prior to calibration. Table EX15-1 outlines the process control parameters used during the fermentation. Note that pH was controlled using 6N KOH and 2N H.sub.2SO.sub.4.
[0475] The fermentation was run for 84.3 h. Vessels were sampled every 6-10 h or 3 times daily. Sterile 5 mL syringes were used to collect 3 mL of fermenter broth via a sterile sample port. The sample was placed in a 2 mL microfuge tube and a portion was used to measure cell density (OD.sub.600) on a Genesys 10 spectrophotometer (Thermo Scientific). The remaining sample was filtered through a 0.22 .mu.m Corning filter. The supernatant from each vessel was refrigerated in a 96-well deep well plate, and stored at 4.degree. C. prior to gas and liquid chromatography analysis.
[0476] Analysis of volatile organic compounds, including ethanol and isobutanol was performed on a HP 5890/6890/7890 gas chromatograph fitted with an HP 7673 Autosampler, a DB-FFAP column (J&W; 30 m length, 0.32 mm ID, 0.25-.mu.M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200.degree. C. for the injector, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 70.degree. C./minute gradient to 230.degree. C., and then hold for 2.5 min. Analysis was performed using authentic standards (>99%, obtained from Sigma-Aldrich, and a 5-point calibration curve with 1-pentanol as the internal standard).
[0477] Analysis of organic acid metabolites was performed on an HP-1200 High Performance Liquid Chromatography system equipped with two Restek RFQ 150.times.4.6 mm columns in series. Organic acid metabolites were detected using an HP-1100 UV detector (210 nm) and refractive index. The column temperature was 60.degree. C. This method was isocratic with 0.0180 N H2504 in Milli-Q water as mobile phase. Flow was set to 1.1 mL/min. Injection volume was 20 .mu.L and run time was 16 min. Analysis was performed using authentic standards (>99%, obtained from Sigma-Aldrich, with the exception of DHIV (2,3-dihydroxy-3-methyl-butanoate, CAS 1756-18-9), which was custom synthesized at Caltech (Cioffi, E. et al. Anal Biochem 104 pp. 485 (1980)), and a 5-point calibration curve.
[0478] Additionally, on-line continuous measurement of the fermenter vessel off-gas by GC-MS analysis was performed for oxygen, isobutanol, ethanol, carbon dioxide, and nitrogen throughout the experiment.
[0479] At the end of the fermentation, the isobutanol titer had reached 6.4 g/L. Yield of the fermentation, calculated over the entire production phase, i.e. from 32 to 84.3 hours, was approximately 71% of theoretical.
Example 25: Cytosolic ALS Homologs that Support Isobutanol Production
[0480] This example demonstrates isobutanol production using expression of cytosolically localized ALS genes in the presence of the rest of the isobutanol pathway. The ALS genes were integrated into the PDC1 locus of S. cerevisiae strain GEVO1187 and isobutanol production was achieved by expression from plasmid of the other genes in the isobutanol pathway. Isobutanol production in strains carrying the ALS genes from T. atroviride (Ta_ALS) and T. stipitatus (Ts_ALS) was compared to isobutanol production in strains carrying the ALS gene from B. subtilis (either Bs_alsS2 or Bs_alsS1_coSc). Strains, and plasmids are listed in Tables EX16-1 and EX16-2, respectively.
TABLE-US-00023 TABLE EX16-1 Genotype of strains disclosed herein GEVO No. Genotype Gevo 1187 S. cerevisiae, CEN.PK; MATa ura3 leu2 his3 trp1 Gevo 2280 S. cerevisiae MATa ura3 leu2 his3 trp1 ADE2 pdc1::P.sub.CUP1-1-Bs_AlsS2, TRP1 Note that this is TRP1+. Transformed with plasmid pGV1730. Original isolate A2 Gevo 2618 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Bs_AlsS1_coSc, TRP1. Transformed with plasmid pGV2114. Gevo 2621 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Ta_Als, TRP1. Transformed with plasmid pGV2117. Gevo 2622 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Ts_Als, TRP1. Transformed with plasmid pGV2118.
TABLE-US-00024 TABLE EX16-2 Plasmids disclosed herein Plasmid name Relevant Genes/Usage Genotype pGV1730 Integration plasmid that will integrate P.sub.CUP1-1:Bs_alsS2, pUC ORI, P.sub.CUP1-1:Bs_alsS2 into PDC1 using Amp.sup.R , TRP1, PDC1 3'- digestion with NruI for targeting. This fragment-NruI-PDC1 5'- was the parent vector for cloning the fragment. ALS homologs. pGV1773 Vector with Bacillus subtilis AlsS P.sub.PDC1:Bs_AlsS1_coSc, codon optimized for S. cerevisiae. P.sub.TDH3:Ll_kivD, P.sub.ADH1:Sc_ADH7_coSc, URA3 5'-end, pUC ORI, kan.sup.R. pGV1802 DNA2.0 plasmid carrying the Ta_ALS_coSc in DNA 2.0 Trichoderma atroviride ALS. vector pGV1803 DNA2.0 plasmid carrying the Ts_ALS_coSc in DNA 2.0 Talaromyces stipitatus ALS. vector pGV2082 High copy 2.mu. plasmid with 4 Ec_ilvC_coSc.sup.Q110V, isobutanol pathway genes without an Ll_ilvD_coSc, Ll_kivD2_coEc, ALS gene. and Dm_ADH, 2.mu. ori, bla, G418R. pGV2114 Integration plasmid that will integrate P.sub.CUP1-1:Bs_alsS1_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3'- for targeting. It carries the Bacillus fragment-NruI-PDC1 5'- subtilis AlsS gene codon optimized fragment. for S. cerevisiae. pGV2117 Integration plasmid that will integrate P.sub.CUP1-1:Ta_ALS_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3'- for targeting. It carries the fragment-NruI-PDC1 5'- Trichoderma atroviride ALS gene fragment. codon optimized for S. cerevisiae. pGV2118 Integration plasmid that will integrate P.sub.CUP1-1:Ts_ALS_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3'- for targeting. It carries the fragment-NruI-PDC1 5'- Talaromyces stipitatus ALS gene fragment. codon optimized for S. cerevisiae.
Materials and Methods for Example 25
[0481] Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3.sup.rd ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press).
[0482] Cloning techniques included digestion with restriction enzymes, gel purification of DNA fragments (using the Zymoclean Gel DNA Recovery Kit, Cat# D4002, Zymo Research Corp, Orange, Calif.), ligations of two DNA fragments (using the Roche rapid ligation kit, Cat#11 635 379 001, Roche Diagnostics, Mannheim, Germany), Klenow treatment of fragments to give blunt ends (using the NEB DNA Polymerase I, Large (Klenow), cat# M0210S, Ipswich, Mass.), and bacterial transformations into chemically competent E. coli cells made at GEVO (TOP10). Plasmid DNA was purified from E. coli cells using the Qiagen QIAprep Spin Miniprep Kit (Cat#27106, Qiagen, Valencia, Calif.).
[0483] PCR was performed on an Eppendorf Mastercycler (Cat#71086, Novagen, Madison Wis.). The following PCR program was followed for all primer sets unless otherwise noted: 94.degree. C. for 2 min then 40 cycles of (94.degree. C. 30 sec, 54.degree. C. 30 sec, 72.degree. C. 1 min) then 72.degree. C. for 10 min. Yeast colony PCR used the FailSafe.TM. PCR System EPICENTRE.RTM. Biotechnologies, Madison, Wis.; Catalog #FS99250). A PCR cocktail containing 15 .mu.l of Master Mix E buffer, 10.5 .mu.l water, 2 .mu.l of each primer at 10 .mu.M concentration, 0.5 .mu.l polymerase enzyme mix from the kit was added to a 0.2 mL PCR tube for each sample (30 .mu.l each). For each candidate a small amount of cells was added to the reaction tube using a sterile P10 pipette tip. Presence of the positive PCR product was assessed using agarose gel electrophoresis. The following primer pairs were used. Primers 1432 and 1433 for the 5'-ends of all integrations (800 bp band), primers 1435 and 2233 for the 3'-ends of pGV2114 integrations (1.1 Kb band), primers 1435 and 2234 for the 3'-end of the pGV2115 integrations (1.1 Kb band), primers 1435 and 2236 for the 3'-ends of the pGV2117 integrations (1.1 Kb band), primers 1435 and 2237 for the 3'-ends of the pGV2118 integrations (1.1 Kb band).
[0484] Transformation of integration plasmids was performed according to the lithium acetate protocol described above. Integration plasmids were digested with NruI, checked by gel electrophoresis for complete digestion and used directly from digestion. Integrative transformants were selected by plating the transformed cells on SCD-Trp agar medium. Once the transformants were single colony purified they were maintained on SCD-Trp plates. Once transformants were screened by PCR as described above for proper integration, each strain was transformed with the plasmid pGV2082. Transformants were plated to YPD plates containing 0.2 g/L G418.
[0485] SCD-Trp: 20 g/L glucose, 14 g/L Sigma.TM. Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco.TM. Yeast Nitrogen Base. 0.076 g/L histidine, 0.380 g/L leucine, and 0.076 g/L uracil.
Fermentations
[0486] Strains with integrated ALS genes expressed from the CUP1 promoter were transformed with pGV2082 (which carries the other 4 isobutanol pathway genes Ec_ilvC_coScQ110V (SEQ ID NO: 61), LI_ilvD (SEQ ID NO: 65), LI_kivd2_coEc (SEQ ID NO: 59), and Dm_ADH (SEQ ID NO: 60)). Strains were patched onto YPD plates containing 0.2 mg/mL G418. The following morning cells were removed from the plate with a sterile toothpick and resuspended in 4 mL of YPD with 0.2 mg/mL G418. The OD.sub.600 was determined for each culture. Cells were added to 50 mL YP with 5% dextrose and 0.2 mg/mL G418 such that a final OD.sub.600 of 0.1 was obtained. 1 mL of media was removed and the OD.sub.600 for this undiluted sample determined, leftover media was stored at 4.degree. C. to act as media blank for the analytics submission, and to act as the t=0 sample for the fermentation. At t=24 h, 2 mL of media was removed and 25 .mu.L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 50% glucose containing 0.2 mg/mL G418 was added to a final concentration of 100 g/L glucose. 1 mL of supernatant was analyzed by gas chromatography as described above. At t=48 h, 2 mL of media was removed and 25 .mu.L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 50% glucose plus water (with 0.2 mg/mL G418) were added to give a final concentration of glucose of 100 g/L. 1 mL of supernatant was analyzed by gas chromatography. At t=72 h, 2 mL of media was removed and 25 .mu.L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 1 mL of supernatant was analyzed by gas chromatography and high performance liquid chromatography.
Yeast Strain Construction
[0487] GEVO2280 was constructed by transforming GEVO1187 with the integration plasmid pGV1730. The plasmid pGV1730 was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol. Transformants were selected by plating to SCGal-Trp plates. Individual integrants were verified using colony PCR with primers 1432 and 1433 to detect proper integration at the 5'-end (803 bp fragment) and primers 1220 and 1435 to detect proper integration at the 3'-end (772 bp).
[0488] GEVO2618 was constructed by transforming GEVO1187 with the integration plasmid pGV2114. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. Correct integration was verified with colony PCR using primers 1432 and 1433 to check the 5'-end of the integration (800 bp band) and primers 1435 and 2233 for the 3'-end of pGV2114 integration (1,100 bp band).
[0489] GEVO2621 was constructed by transforming GEVO1187 with the integration plasmid pGV2117. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. integration was verified with colony PCR using primers 1432 and 1433 to check the 5'-end of the integration (800 bp band) and primers 1435 and 2236 for the 3'-end of pGV2117 integration (1,100 bp band).
[0490] GEVO2622 was constructed by transforming GEVO1187 with the integration plasmids pGV2118. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. Twelve transformants were single colony purified. Correct integration was verified with colony PCR using primers 1432 and 1433 to check the 5'-end of the integration (800 bp band) and primers 1435 and 2237 for the 3'-end of pGV2118 integration (1,100 bp band).
[0491] Each ALS-containing strain was transformed with the 4 component pathway plasmid, pGV2082 (SEQ ID NO: 67), as described above. Control strains GEVO2280 (Bs_alsS2) and GEVO1187 (no ALS) were also transformed with pGV2082. Transformants were single colony purified and maintained on YPD plates with 0.2 mg/mL G418.
Plasmid Construction
[0492] Construction of Plasmid pGV2082.
[0493] The plasmid pGV2044 carries the genes Ec_ilvC_coSc.sup.Q110V, Bs_AlsS2, LI_ilvD_coSc and Dm_ADH. The plasmid pGV2082 was created from pGV2044 by replacing the Bs_AlsS2 with LI_kivD2_coEc as follows: the LI_kivD2_coEc gene and associated PGK1 promoter were removed from pGV2047 by digestion with AvrII and NcoI. The 2530 bp fragment was purified by gel electrophoresis and the fragment was prepared using the Zymoclean kit described above. Plasmid pGV2044 was digested with EcoRI and SbfI to remove the Bs_AlsS2 gene and associated CUP1 promoter and the 11275 bp vector fragment was gel purified. The vector and insert were treated with Klenow fragment to produce blunt ends. The pGV2044 vector fragment and the P.sub.PGK1:LI_kivD2_coEc insert were ligated using standard methods in an approximately 5:1 insert:vector molar ratio and transformed into TOP10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with the following enzymes: EcoRV to give correct fragments of 6.3 and 7.5 kb, EcoRV plus NruI to give correct fragments of 2.9, 3.4, and 7.5 kb), EcoRI plus NcoI to give correct fragments of 2.5 and 11.2 Kb.
[0494] pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1773 was digested with BamHI and SalI and the 1.7 Kb fragment containing the Bs_AlsS_coSc was gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1773 insert fragment using the Roche rapid ligation kit in a ratio of 5:1 insert to vector ratio and transformed into TOP10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with ScaI plus PstI to give correct fragments of 2.7, 1.7, 1.4 and 0.9 Kb, AflII to give correct fragments of 1.5 and 5.1 kb, NaeI plus StuI to give correct fragments of 1.4, 5.2 kb.
[0495] Construction of pGV2117: pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1802 was digested with BamHI and SalI and the 1.8 kb fragment containing the Ta_ALS was gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1802 insert fragment using the Roche rapid ligation kit in a ration of 5:1 insert to vector ratio and transformed into TOP-10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with BamHI plus StuI to give correct fragments of 1.4 and 5.2 kb, SalI plus PstI to give correct fragments of 0.7 and 5.9 kb, and AhdI to give correct fragments of 1.9 and 4.7 kb.
[0496] Construction of pGV2118:
[0497] pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1803 was digested with BamHI and SalI and the 1.8 kb fragment containing the Ts_ALS gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1803 insert fragment using the Roche rapid ligation kit in a ration of 5:1 insert to vector ratio and transformed into TOP-10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with NaeI to give correct bands of 2.9 and 3.7 kb, EcoRV to give correct bands of 0.7 and 5.9 kb, and HpaI plus SacI to give correct bands of 1.9 and 4.7 kb.
Results
[0498] Fermentations of GEVO1187, GEVO2280, GEVO2618, GEVO2621, GEVO2622 and transformed with pGV2082 were carried out as described above (except G418 was not added to the glucose at 24 h). In this experiment strains containing the ALS genes Ta_ALS_coSc and Ts_ALS_coSc produced more isobutanol than the strain containing the Bs_Als2. The Bs_Als1_coSc produced the most isobutanol. Table EX16-3 shows the final OD, glucose consumption, and isobutanol titer for each of the strains. The integration of the cytosolic genes Ta_ALS_coSc and Ts_ALS_coSc led to production of isobutanol that was in each case 6-fold above that of a strain without an integrated ALS gene, demonstrating that these strains are producing isobutanol using a cytosolic pathway.
TABLE-US-00025 TABLE EX16-3 Results of fermentation with cytosolic ALS homologs, at 72 h Glucose consumed Isobutanol produced Strain OD.sub.600 g/L g/L GEVO1187 10.9 .+-. 0.3 233 .+-. 36 0.3 .+-. 0.0 GEVO2280 9.9 .+-. 0.3 274 .+-. 26 1.3 .+-. 0.11 GEVO2618 9.4 .+-. 0.2 138 .+-. 9 2.6 .+-. .09 GEVO2621 9.9 .+-. 0.3 161 .+-. 52 1.9 .+-. .18 GEVO2622 10.8 .+-. 0.6 182 .+-. 47 1.8 .+-. .15
[0499] The foregoing detailed description has been given for clearness of understanding only and no unnecessary limitations should be understood there from as modifications will be obvious to those skilled in the art.
[0500] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.
[0501] The disclosures, including the claims, figures and/or drawings, of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entireties.
Sequence CWU
1
1
7814831DNAArtificial SequenceSynthetic polynucleotide 1gcttagttta
catttctttc ccaagtttaa ttcaatttct tcaacaaaga tttagagagt 60atacttgcgc
cgtcatcata ctggctgcct ttccgtttca tcaataaata tatgtattct 120ctaattaatt
ttatgctcat aatatatcgg ttgcacgaga tggtcattcc gatggtttca 180gactctagtt
aaaagaagaa gctagatgct gataatattg atttcggatg ttactgattg 240aatattttga
gctattataa taatatcaac aaagaaaatt ttaacgtggg ttgattctta 300ggtttaaaaa
gacccatcgt atatctcacc aaatatcggt accgtattcg aaggataagg 360actaacgact
taatctctaa cttgtggtaa ctaaatttag tcctttatct acaatttctc 420tatagagcat
tcaacaaaga ttgtggtttt tatctatcaa gtattattcc attactatta 480atgtacttat
aaaattctgt atatgaagag tatcaagaaa actgtgactt ctccacatca 540gtatagtaaa
gccaacaaag gggatacctt tgcagttgta gcaactattg gcgtaaacgt 600ttcaaatggg
gtaaaagaaa gaaataaaga gtatatcgtt catatatatc atttagaaat 660caaatcacta
aaattcgatt agttcttagc gttggtagca gcagtcaatt cgagctcata 720gcttcaaaat
gtttctactc cttttttact cttccagatt ttctcggact ccgcgcatcg 780ccgtaccact
tcaaaacacc caagcacagc atactaaatt tcccctcttt cttcctctag 840ggtgtcgtta
attacccgta ctaaaggttt ggaaaagaaa aaagagaccg cctcgtttct 900ttttcttcgt
cgaaaaaggc aataaaaatt tttatcacgt ttctttttct tgaaaatttt 960ttttttgatt
tttttctctt tcgatgacct cccattgata tttaagttaa taaacggtct 1020tcaatttctc
aagtttcagt ttcatttttc ttgttctatt acaacttttt ttacttcttg 1080ctcattagaa
agaaagcata gcaatctaat ctaagttttc tagtatgatt gaacaagatg 1140gattgcacgc
aggttctccg gccgcttggg tggagaggct attcggctat gactgggcac 1200aacagacaat
cggctgctct gatgccgccg tgttccggct gtcagcgcag gggcgcccgg 1260ttctttttgt
caagaccgac ctgtccggtg ccctgaatga actgcaggac gaggcagcgc 1320ggctatcgtg
gctggccacg acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg 1380aagcgggaag
ggactggctg ctattgggcg aagtgccggg gcaggatctc ctgtcatctc 1440accttgctcc
tgccgagaaa gtatccatca tggctgatgc aatgcggcgg ctgcatacgc 1500ttgatccggc
tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta 1560ctcggatgga
agccggtctt gtcgatcagg atgatctgga cgaagagcat caggggctcg 1620cgccagccga
actgttcgcc aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg 1680tgacccatgg
cgatgcctgc ttgccgaata tcatggtgga aaatggccgc ttttctggat 1740tcatcgactg
tggccggctg ggtgtggcgg accgctatca ggacatagcg ttggctaccc 1800gtgatattgc
tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg ctttacggta 1860tcgccgctcc
cgattcgcag cgcatcgcct tctatcgcct tcttgacgag ttcttctgaa 1920ccggtagagt
tctccgagaa caagcagagg ttcgagtgta ctcggatcag aagttacaag 1980ttgatcgttt
atatataaac tatacagaga tgttagagtg taatggcatt gcgtaagctt 2040ggcgtaatca
tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca 2100caacatacga
gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact 2160cacattaatt
gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct 2220gcattaatga
atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc 2280ttcctcgctc
actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 2340ctcaaaggcg
gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 2400agcaaaaggc
cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 2460taggctccgc
ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 2520cccgacagga
ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 2580tgttccgacc
ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 2640gctttctcat
agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 2700gggctgtgtg
cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 2760tcttgagtcc
aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 2820gattagcaga
gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 2880cggctacact
agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 2940aaaaagagtt
ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 3000tgtttgcaag
cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 3060ttctacgggg
tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 3120attatcaaaa
aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 3180ctaaagtata
tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 3240tatctcagcg
atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 3300aactacgata
cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 3360acgctcaccg
gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 3420aagtggtcct
gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 3480agtaagtagt
tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt 3540ggtgtcacgc
tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg 3600agttacatga
tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt 3660tgtcagaagt
aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc 3720tcttactgtc
atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc 3780attctgagaa
tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa 3840taccgcgcca
catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg 3900aaaactctca
aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc 3960caactgatct
tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag 4020gcaaaatgcc
gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt 4080cctttttcaa
tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 4140tgaatgtatt
tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc 4200acctgacgtc
acctggtaga ccaaagatgg tttgaacttc gacttgcttt aatctttcga 4260acaagtaacg
acctaatgta atttcagaca ttgtaattta agttggtttt gagttgtagt 4320tttatcctta
atattaatag ttaatactat aatatgtttg gctttagtgg atggtttttg 4380aggtaatcaa
aagtatataa ttaagattat gattaagaca tgatgggaaa ctctagccat 4440tacagataat
catgcccatg tatttatact ttatctgagt taactaaaaa aaatagaaag 4500gtcatattca
ccacccagcc agccctgcct ctcacctcac tctcccccct taatggataa 4560ttgacacaag
tggtactact attccaacct taagatattc atgggccaat actacgtata 4620caccttaaaa
ggttgaatct tttcacaaat attgcataat ctatcccatg gttctacata 4680gcaaatacag
aatatgcaaa atacaggaca cgcacaaggg ccagcaatgg ttagctaatt 4740tgaataattt
ccaataccat gaaattatcc caccttttac cttggttgac tctcatttcc 4800gattttctat
accacagaaa ccgcacgtgt c
483127441DNAArtificial SequenceSynthetic polynucleotide 2ccagttaact
gtgggaatac tcaggtatcg taagatgcaa gagttcgaat ctcttagcaa 60ccattatttt
tttcctcaac ataacgagaa cacacagggg cgctatcgca cagaatcaaa 120ttcgatgact
ggaaattttt tgttaatttc agaggtcgcc tgacgcatat acctttttca 180actgaaaaat
tgggagaaaa aggaaaggtg agagcgccgg aaccggcttt tcatatagaa 240tagagaagcg
ttcatgacta aatgcttgca tcacaatact tgaagttgac aatattattt 300aaggacctat
tgttttttcc aataggtggt tagcaatcgt cttactttct aacttttctt 360accttttaca
tttcagcaat atatatatat atatttcaag gatataccat tctaatgtct 420gcccctaaga
agatcgtcgt tttgccaggt gaccacgttg gtcaagaaat cacagccgaa 480gccattaagg
ttcttaaagc tatttctgat gttcgttcca atgtcaagtt cgatttcgaa 540aatcatttaa
ttggtggtgc tgctatcgat gctacaggtg ttccacttcc agatgaggcg 600ctggaagcct
ccaagaaggc tgatgccgtt ttgttaggtg ctgtgggtgg tcctaaatgg 660ggtaccggta
gtgttagacc tgaacaaggt ttactaaaaa tccgtaaaga acttcaattg 720tacgccaact
taagaccatg taactttgca tccgactctc ttttagactt atctccaatc 780aagccacaat
ttgctaaagg tactgacttc gttgttgtca gagaattagt gggaggtatt 840tactttggta
agagaaagga agacgatggt gatggtgtcg cttgggatag tgaacaatac 900accgttccag
aagtgcaaag aatcacaaga atggccgctt tcatggccct acaacatgag 960ccaccattgc
ctatttggtc cttggataaa gctaatgttt tggcctcttc aagattatgg 1020agaaaaactg
tggaggaaac catcaagaac gaattcccta cattgaaggt tcaacatcaa 1080ttgattgatt
ctgccgccat gatcctagtt aagaacccaa cccacctaaa tggtattata 1140atcaccagca
acatgtttgg tgatatcatc tccgatgaag cctccgttat cccaggttcc 1200ttgggtttgt
tgccatctgc gtccttggcc tctttgccag acaagaacac cgcatttggt 1260ttgtacgaac
catgccacgg ttctgctcca gatttgccaa agaataaggt caaccctatc 1320gccactatct
tgtctgctgc aatgatgttg aaattgtcat tgaacttgcc tgaagaaggt 1380aaggccattg
aagatgcagt taaaaaggtt ttggatgcag gtatcagaac tggtgattta 1440ggtggttcca
acagtaccac cgaagtcggt gatgctgtcg ccgaagaagt taagaaaatc 1500cttgcttaaa
aagattctct ttttttatga tatttgtaca taaactttat aaatgaaatt 1560cataatagaa
acgacacgaa attacaaaat ggaatatgtt catagggtag acgaaactat 1620atacgcaatc
tacatacatt tatcaagaag gagaaaaagg aggatgtaaa ggaatacagg 1680taagcaaatt
gatactaatg gctcaacgtg ataaggaaaa agaattgcac tttaacatta 1740atattgacaa
ggaggagggc accacacaaa aagttaggtg taacagaaaa tcatgaaact 1800atgattccta
atttatatat tggaggattt tctctaaaaa aaaaaaaata caacaaataa 1860aaaacactca
atgacctgac catttgatgg agttgccggc gatcacagcg gacggtggtg 1920gcatgatggg
gcttgcgatg ctatgtttgt ttgttttgtg atgatgtata ttattattga 1980aaaacgatat
cagacatttg tctgataatg cttcattatc agacaaatgt ctgatatcgt 2040ttggagaaaa
agaaaaggaa aacaaactaa atatctacta tataccactg tattttatac 2100taatgacttt
ctacgcctag tgtcaccctc tcgtgtaccc attgaccctg tatcggcgcg 2160ttgcctcgcg
ttcctgtacc atatattttt gtttatttag gtattaaaat ttactttcct 2220catacaaata
ttaaattcac caaacttctc aaaaactaat tattcgtagt tacaaactct 2280attttacaat
cacgtttatt caaccattct acatccaata accaaaatgc ccatgtacct 2340ctcagcgaag
tccaacggta ctgtccaata ttctcattaa atagtctttc atctatatat 2400cagaaggtaa
ttataattag agatttcgaa tcattaccgt gccgattcgc acgctgcaac 2460ggcatgcatc
actaatgaaa agcatacgac gcctgcgtct gacatgcact cattctgaag 2520aagattctgg
gcgcgtttcg ttctcgtttt cctctgtata ttgtactctg gtggacaatt 2580tgaacataac
gtctttcacc tcgccattct caataatggg ttccaattct atccaggtag 2640cggttaattg
acggtgctta agccgtatgc tcactctaac gctaccgttg tccaaacaac 2700ggaccccttt
gtgacgggtg taagacccat catgaagtaa aacatctcta acggtatgga 2760aaagagtggt
acggtcaagt ttcctggcac gagtcaattt tccctcttcg tgtagatcgg 2820taccggccgc
aaattaaagc cttcgagcgt cccaaaacct tctcaagcaa ggttttcagt 2880ataatgttac
atgcgtacac gcgtctgtac agaaaaaaaa gaaaaatttg aaatataaat 2940aacgttctta
atactaacat aactataaaa aaataaatag ggacctagac ttcaggttgt 3000ctaactcctt
ccttttcggt tagagcggat gtggggggag ggcgtgaatg taagcgtgac 3060ataactaatt
acatgactcg agcggccgcg gatcctcaat aaaactcttc aggcaataat 3120ttttctgcta
atttaatgtt atcagaatag tccaaaggaa cgtcaattac tactggtcca 3180gtagtatctg
ggattgattt aagaatttca gcaagttctt ctttgctgtg tgcacggtaa 3240ccttttgctc
ccattgcttc agcatatttt acgtaatcaa catagccaaa atcaacggct 3300gctgaacgac
catatttcat ttcttcttgg aatttaacca tatcataatg gccgtcattc 3360cagataattt
gaacgattgg aagattcaaa cgtacagctg tttccaactc ttgccctgtg 3420aaaaggaagc
ctccatcacc agagtgtgaa taaacttttt tacctgggcg caacaatgcg 3480gctgtaattg
cccaaggaag tgcaactcca agtgtttgca ttccgtttga gaagaggaga 3540tgacgtggtt
cgtatgattt gaaatgacgt gccatccaaa tgtagagtga acctacgtca 3600acggttactg
tttcatcatc tttaacgatt tcttggaaag tgctgaccaa atcaagaggg 3660tgcattctac
cttcttcagt attttcagta tcaaattcgt gttgctcagc aacttcatga 3720aggccatcga
gataatcttt tgttcctttt ggaattttgt atccacgaac agctggtaaa 3780agattatcca
atgttgctgc gatatcacca attaattcac gttctggttg gtagtaagta 3840tcaatttcag
caatggcatt atcaataacg ataattcgac tatcaatttc tgcattccag 3900ttacgagctt
catattcaat tgggtcataa ccaacagcaa taacaaggtc agaacgtttc 3960agaagcatat
ctcctggttg attgcggaaa agaccgatac gtccataaaa agtatgttct 4020aaatcatgtg
aaataacccc tgcaccttgg aatgtttcaa cgacaggaat attaacatga 4080gttaatagat
tacgcaatga tgaagcgact ttagcatctg aagcaccagc tccaaccaaa 4140attactggca
atacagcatt tttaattgct tgtgctaaat aattaatgtc atcaatagag 4200gcattcccca
ttttagggtc tgaaagtggt tgaatggcct tgattgatac ttcggcatcc 4260gttacatctt
gggggattga taagaaagtt gcacctggat gtcctgattt tgcaatacga 4320taagcgttgg
caattgattc agaaagtgta tcagggtcaa gaacttctgc tgaatatttt 4380gttgctgatt
gcatcattcc agcattatcc attgattggt gcgcacgttt aagacggtca 4440cttcgtttaa
cttgtccacc gatagccaaa atagcatcac cttctgaagt cgcggtcaaa 4500agcggagtcg
caaggtttga tacaccaggc ccactcgtaa caactactac accaggttcg 4560ccagtcaaac
gaccaacagc ttgagccatg aaagcagctc cttgctcatg acgagtcacg 4620accatttgag
ggccttcttc attttctaat aaatcaaaaa cccggtcaat ttttgctcct 4680ggaatcccaa
atacatactt cactttatgg ttaatcaaac tatcgacaac caagttcgcc 4740ccaaattgtt
tctcagacat gtcgacaccg atatacctgt atgtgtcacc accaatgtat 4800ctataagtat
ccatgctagt tctagaaaac ttagattaga ttgctatgct ttctttctaa 4860tgagcaagaa
gtaaaaaaag ttgtaataga acaagaaaaa tgaaactgaa acttgagaaa 4920ttgaagaccg
tttattaact taaatatcaa tgggaggtca tcgaaagaga aaaaaatcaa 4980aaaaaaaatt
ttcaagaaaa agaaacgtga taaaaatttt tattgccttt ttcgacgaag 5040aaaaagaaac
gaggcggtct cttttttctt ttccaaacct ttagtacggg taattaacga 5100caccctagag
gaagaaagag gggaaattta gtatgctgtg cttgggtgtt ttgaagtggt 5160acggcgatgc
gcggagtccg agaaaatctg gaagagtaaa aaaggagtag aaacattttg 5220aagctatgag
ctccagcttt tgttcccttt agtgagggtt aattgcgcgc ttggcgtaat 5280catggtcata
gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatag 5340gagccggaag
cataaagtgt aaagcctggg gtgcctaatg agtgaggtaa ctcacattaa 5400ttgcgttgcg
ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 5460gaatcggcca
acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 5520tcactgactc
gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 5580cggtaatacg
gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 5640gccagcaaaa
ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 5700gcccccctga
cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 5760gactataaag
ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 5820ccctgccgct
taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 5880atagctcacg
ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 5940tgcacgaacc
ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 6000ccaacccggt
aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 6060gagcgaggta
tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 6120ctagaaggac
agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 6180ttggtagctc
ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 6240agcagcagat
tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 6300ggtctgacgc
tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 6360aaaggatctt
cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 6420tatatgagta
aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 6480cgatctgtct
atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 6540tacgggaggg
cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac 6600cggctccaga
tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 6660ctgcaacttt
atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 6720gttcgccagt
taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 6780gctcgtcgtt
tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 6840gatcccccat
gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 6900gtaagttggc
cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 6960tcatgccatc
cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 7020aatagtgtat
gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 7080cacatagcag
aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 7140caaggatctt
accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 7200cttcagcatc
ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 7260ccgcaaaaaa
gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 7320aatattattg
aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 7380tttagaaaaa
taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 7440t
744138949DNAArtificial SequenceSynthetic polynucleotide 3caggcaagtg
cacaaacaat acttaaataa atactactca gtaataacct atttcttagc 60atttttgacg
aaatttgcta ttttgttaga gtcttttaca ccatttgtct ccacacctcc 120gcttacatca
acaccaataa cgccatttaa tctaagcgca tcaccaacat tttctggcgt 180cagtccacca
gctaacataa aatgtaagct ttcggggctc tcttgccttc caacccagtc 240agaaatcgag
ttccaatcca aaagttcacc tgtcccacct gcttctgaat caaacaaggg 300aataaacgaa
tgaggtttct gtgaagctgc actgagtagt atgttgcagt cttttggaaa 360tacgagtctt
ttaataactg gcaaaccgag gaactcttgg tattcttgcc acgactcatc 420tccatgcagt
tggacgatat caatgccgta atcattgacc agagccaaaa catcctcctt 480aggttgatta
cgaaacacgc caaccaagta tttcggagtg cctgaactat ttttatatgc 540ttttacaaga
cttgaaattt tccttgcaat aaccgggtca attgttctct ttctattggg 600cacacatata
atacccagca agtcagcatc ggaatctaga gcacattctg cggcctctgt 660gctctgcaag
ccgcaaactt tcaccaatgg accagaacta cctgtgaaat taataacaga 720catactccaa
gctgcctttg tgtgcttaat cacgtatact cacgtgctca atagtcacca 780atgccctccc
tcttggccct ctccttttct tttttcgacc gaattaattc ttaatcggca 840aaaaaagaaa
agctccggat caagattgta cgtaaggtga caagctattt ttcaataaag 900aatatcttcc
actactgcca tctggcgtca taactgcaaa gtacacatat attacgatgc 960tgtctattaa
atgcttccta tattatatat atagtaatgt cgttgacgtc gccggcgatc 1020acagcggacg
gtggtggcat gatggggctt gcgatgctat gtttgtttgt tttgtgatga 1080tgtatattat
tattgaaaaa cgatatcaga catttgtctg ataatgcttc attatcagac 1140aaatgtctga
tatcgtttgg agaaaaagaa aaggaaaaca aactaaatat ctactatata 1200ccactgtatt
ttatactaat gactttctac gcctagtgtc accctctcgt gtacccattg 1260accctgtatc
ggcgcgttgc ctcgcgttcc tgtaccatat atttttgttt atttaggtat 1320taaaatttac
tttcctcata caaatattaa attcaccaaa cttctcaaaa actaattatt 1380cgtagttaca
aactctattt tacaatcacg tttattcaac cattctacat ccaataacca 1440aaatgcccat
gtacctctca gcgaagtcca acggtactgt ccaatattct cattaaatag 1500tctttcatct
atatatcaga aggtaattat aattagagat ttcgaatcat taccgtgccg 1560attcgcacgc
tgcaacggca tgcatcacta atgaaaagca tacgacgcct gcgtctgaca 1620tgcactcatt
ctgaagaaga ttctgggcgc gtttcgttct cgttttcctc tgtatattgt 1680actctggtgg
acaatttgaa cataacgtct ttcacctcgc cattctcaat aatgggttcc 1740aattctatcc
aggtagcggt taattgacgg tgcttaagcc gtatgctcac tctaacgcta 1800ccgttgtcca
aacaacggac ccctttgtga cgggtgtaag acccatcatg aagtaaaaca 1860tctctaacgg
tatggaaaag agtggtacgg tcaagtttcc tggcacgagt caattttccc 1920tcttcgtgta
gatcggtacc ggccgcaaat taaagccttc gagcgtccca aaaccttctc 1980aagcaaggtt
ttcagtataa tgttacatgc gtacacgcgt ctgtacagaa aaaaaagaaa 2040aatttgaaat
ataaataacg ttcttaatac taacataact ataaaaaaat aaatagggac 2100ctagacttca
ggttgtctaa ctccttcctt ttcggttaga gcggatgtgg ggggagggcg 2160tgaatgtaag
cgtgacataa ctaattacat gactcgagcg gccgcggatc cttaacccgc 2220aacagcaata
cgtttcatat ctgtcatata gccgcgcagt ttcttaccta cctgctcaat 2280cgcatggctg
cgaatcgctt cgttcacatc acgcagttgc ccgttatcta ccgcgccttc 2340cggaatagct
ttacccaggt cgcccggttg cagctctgcc ataaacggtt tcagcaacgg 2400cacacaagcg
taagagaaca gatagttacc gtactcagcg gtatcagaga taaccacgtt 2460catttcgtac
agacgcttac gggcgatggt gttggcaatc agcggcagct cgtgcagtga 2520ttcataatat
gcagactctt caatgatgcc ggaatcgacc atggtttcga acgccagttc 2580aacgcccgct
ttcaccatcg caatcatcag tacgccttta tcgaagtact cctgctcgcc 2640gattttgcct
tcatactgcg gcgcggtttc aaacgcggtt ttgccggtct cttcacgcca 2700ggtcagcagt
ttcttatcat cgttggccca gtccgccatc ataccggaag agaattcgcc 2760ggagatgatg
tcgtccatat gtttctggaa caggggtgcc atgatctctt tcagctgttc 2820agaaagcgca
taagcacgca gtttcgccgg gttagagaga cggtccatca tcagggtgat 2880gccgccctgt
ttcagtgctt cggtgatggt ttcccaaccg aactgaatca gtttttctgc 2940gtatgctgga
tcggtacctt cttccaccag cttgtcgaag cacagcagag agccagcctg 3000caacataccg
cacaggatgg tttgctcgcc catcaggtca gatttcactt ccgcaacgaa 3060ggacgattcc
agcacacccg cacggtgacc accggttgca gccgcccagg ctttggcaat 3120cgccatgcct
tcgcctttcg gatcgttttc cgggtgaacg gcaatcagcg tcggtacgcc 3180gaacccacgt
ttgtactctt cacgcacttc ggtgcctggg catttcggcg caaccatcac 3240tacggtgata
tctttacgga tctgctcgcc cacttcgacg atgttgaaac cgtgcgagta 3300gcccagcgcc
gcgccgtctt tcatcagtgg ctgtacggtg cgcactacat cagagtgctg 3360cttgtccggc
gtcaggttaa tcaccagatc cgcctgtggg atcagttctt cgtaagtacc 3420cactttaaaa
ccattttcgg tcgctttacg ccaggacgcg cgcttctcgg caatcgcttc 3480tttacgcaga
gcgtaggaga tatcgagacc agaatcacgc atgttcaggc cctggttcag 3540accctgtgcg
ccacagccga cgatgactac ttttttaccc tgaaggtagc tcgcgccatc 3600ggcgaattca
tcgcggccca taaagcgaca tttgcccagc tgtgccagct gctggcgcag 3660attcagtgta
ttgaagtagt tagccatgtc gacaccatct tcttctgaga tgagtttttg 3720ttccatgcta
gttctagaat ccgtcgaaac taagttctgg tgttttaaaa ctaaaaaaaa 3780gactaactat
aaaagtagaa tttaagaagt ttaagaaata gatttacaga attacaatca 3840atacctaccg
tctttatata cttattagtc aagtagggga ataatttcag ggaactggtt 3900tcaacctttt
ttttcagctt tttccaaatc agagagagca gaaggtaata gaaggtgtaa 3960gaaaatgaga
tagatacatg cgtgggtcaa ttgccttgtg tcatcattta ctccaggcag 4020gttgcatcac
tccattgagg ttgtgcccgt tttttgcctg tttgtgcccc tgttctctgt 4080agttgcgcta
agagaatgga cctatgaact gatggttggt gaagaaaaca atattttggt 4140gctgggattc
tttttttttc tggatgccag cttaaaaagc gggctccatt atatttagtg 4200gatgccagga
ataaactgtt cacccagaca cctacgatgt tatatattct gtgtaacccg 4260ccccctattt
tgggcatgta cgggttacag cagaattaaa aggctaattt tttgactaaa 4320taaagttagg
aaaatcacta ctattaatta tttacgtatt ctttgaaatg gcgagtattg 4380ataatgataa
actgagctag atctgggccg cggatcctta accccccagt ttcgatttat 4440cgcgcaccgc
gcctttgtcg gcgctggttg ccaggctggc ataagcacgc agggcaaagg 4500agacctgacg
ttcacgattt ttcggcgtcc aggctttgtc acctcgagcg tcctgcgctt 4560cacgacgcgc
cgccagttcg gcatcgctta cctgtaactg aatgccacgg ttcgggatgt 4620cgatagcgat
caggtcacca tcttcaatca ggccaatgct gccgccgctt gccgcttccg 4680gtgagacgtg
gccgatggaa agaccagagg tgccaccaga gaaacgaccg tcggtgatca 4740gcgcacaggc
tttgccgaga cccattgatt tcaggaagct ggttgggtag agcatttcct 4800gcatccccgg
accgcctttc gggccttcat agcgaattac taccacatct ccggcgacaa 4860ctttaccgcc
gagaatcgct tctaccgcat cgtcctggct ttcgtacact ttcgccgggc 4920cggtgaattt
gaggatgctg tcatcgacgc ctgccgtttt cacgatgcag ccgttttccg 4980caaagttacc
gtagagcacc gccaggccgc cgtctttgct gtaggcgtgt tccagcgagc 5040ggatacagcc
attggcgcga tcgtcgtcca gcgtatccca acggcaatct tgcgagaatg 5100cctgtgtggt
acgaatgcct gcaggacctg cgcggaacat attttttacc gcgtcatcct 5160gggtcagcat
aacgtcgtat tgttccagcg tttgcggcaa cgtcaggcca agtacgtttt 5220tcacatcacg
gttcagtaac cccgcgcgat ccagttcgcc gagaataccg ataacaccac 5280cagcacggtg
aacatcttcc atatggtatt tctgggtgct cggcgcaact ttacacagct 5340gtggaacctt
gcgggaaagc ttatcgatat cactcatggt gaagtcgatt tccgcttcct 5400gcgccgccgc
cagcaggtga agtacggtgt tagtcgatcc acccatcgcg atatccagcg 5460tcatggcgtt
ttcaaacgcc gccttactgg cgatattacg cggcagtgca ctttcgtcgt 5520tttgctcgta
ataacgtttg gtcaattcaa caatgcgttt accagcatta aggaacagct 5580gcttacggtc
ggcgtgggtt gccagcagcg agccgttgcc cggctgcgac aggcccagcg 5640cttcggtcag
gcagttcatt gagttagcgg taaacatccc ggagcaggaa ccgcaggtcg 5700gacacgcgga
acgttcaacc tgatcgctct gggagtcaga tactttcggg tctgcgccct 5760ggatcatcgc
atcaaccaga tcgagcttga tgatctgatc ggaaagtttg gttttcccgg 5820cctccatcgg
gccgccggaa acaaagatca ccggaatatt caggcgcagg gaagccatca 5880gcatccccgg
ggtgattttg tcgcagttag agatgcagac catggcgtcg gcgcagtggg 5940cgttgaccat
atactcaacg gaatcagcga tcagttcgcg agatggcagt gaataaagca 6000tccccccgtg
gcccatggca atcccatcat ccaccgcaat ggtgttgaac tctttggcaa 6060cgccgccagc
cgcttcaatt tgttcggcga ccagtttacc gagatcgcgc agatggacgt 6120gacccggtac
aaattgggtg aacgagttca caaccgcgat aatcggctta ccgaaatcgg 6180cgtcggtcat
tccggtggcg cgccacagcg cacgagcacc cgccatatta cgaccatgag 6240tggtggtggc
ggaacggtac ttaggcatgt cgacaccgat atacctgtat gtgtcaccac 6300caatgtatct
ataagtatcc atgctagttc tagaaaactt agattagatt gctatgcttt 6360ctttctaatg
agcaagaagt aaaaaaagtt gtaatagaac aagaaaaatg aaactgaaac 6420ttgagaaatt
gaagaccgtt tattaactta aatatcaatg ggaggtcatc gaaagagaaa 6480aaaatcaaaa
aaaaaatttt caagaaaaag aaacgtgata aaaattttta ttgccttttt 6540cgacgaagaa
aaagaaacga ggcggtctct tttttctttt ccaaaccttt agtacgggta 6600attaacgaca
ccctagagga agaaagaggg gaaatttagt atgctgtgct tgggtgtttt 6660gaagtggtac
ggcgatgcgc ggagtccgag aaaatctgga agagtaaaaa aggagtagaa 6720acattttgaa
gctatgagct ccagcttttg ttccctttag tgagggttaa ttgcgcgctt 6780ggcgtaatca
tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca 6840caacatagga
gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact 6900cacattaatt
gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct 6960gcattaatga
atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc 7020ttcctcgctc
actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 7080ctcaaaggcg
gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 7140agcaaaaggc
cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 7200taggctccgc
ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 7260cccgacagga
ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 7320tgttccgacc
ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 7380gctttctcat
agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 7440gggctgtgtg
cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 7500tcttgagtcc
aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 7560gattagcaga
gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 7620cggctacact
agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 7680aaaaagagtt
ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 7740tgtttgcaag
cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 7800ttctacgggg
tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 7860attatcaaaa
aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 7920ctaaagtata
tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 7980tatctcagcg
atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 8040aactacgata
cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 8100acgctcaccg
gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 8160aagtggtcct
gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 8220agtaagtagt
tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt 8280ggtgtcacgc
tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg 8340agttacatga
tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt 8400tgtcagaagt
aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc 8460tcttactgtc
atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc 8520attctgagaa
tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa 8580taccgcgcca
catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg 8640aaaactctca
aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc 8700caactgatct
tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag 8760gcaaaatgcc
gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt 8820cctttttcaa
tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 8880tgaatgtatt
tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc 8940acctgacgt
894948800DNAArtificial SequenceSynthetic polynucleotide 4ctgattggaa
agaccattct gctttacttt tagagcatct tggtcttctg agctcattat 60acctcaatca
aaactgaaat taggtgcctg tcacggctct ttttttactg tacctgtgac 120ttcctttctt
atttccaagg atgctcatca caatacgctt ctagatctat tatgcattat 180aattaatagt
tgtagctaca aaaggtaaaa gaaagtccgg ggcaggcaac aatagaaatc 240ggcaaaaaaa
actacagaaa tactaagagc ttcttcccca ttcagtcatc gcatttcgaa 300acaagagggg
aatggctctg gctagggaac taaccaccat cgcctgactc tatgcactaa 360ccacgtgact
acatatatgt gatcgttttt aacatttttc aaaggctgtg tgtctggctg 420tttccattaa
ttttcactga ttaagcagtc atattgaatc tgagctcatc accaacaaga 480aatactaccg
taaaagtgta aaagttcgtt taaatcattt gtaaactgga acagcaagag 540gaagtatcat
cagctagccc cataaactaa tcaaaggagg atgtctacta agagttactc 600ggaaagagca
gctgctcata gaagtccagt tgctgccaag cttttaaact tgatggaaga 660gaagaagtca
aacttatgtg cttctcttga tgttcgtaaa acagcagagt tgttaagatt 720agttgaggtt
ttgggtccat atatctgtct attgaagaca catgtagata tcttggagga 780tttcagcttt
gagaatacca ttgtgccgtt gaagcaatta gcagagaaac acaagttttt 840gatatttgaa
gacaggaagt ttgccgacat tgggaacact gttaaattac aatacacgtc 900tggtgtatac
cgtatcgccg aatggtctga tatcaccaat gcacacggtg tgactggtgc 960gggcattgtt
gctggtttga agcaaggtgc cgaggaagtt acgaaagaac ctagagggtt 1020gttaatgctt
gccgagttat cgtccaaggg gtctctagcg cacggtgaat acactcgtgg 1080gaccgtggaa
attgccaaga gtgataagga ctttgttatt ggatttattg ctcaaaacga 1140tatgggtgga
agagaagagg gctacgattg gttgatcatg acgccaggtg ttggtcttga 1200tgacaaaggt
gatgctttgg gacaacaata cagaactgtg gatgaagttg ttgccggtgg 1260atcagacatc
attattgttg gtagaggtct tttcgcaaag ggaagagatc ctgtagtgga 1320aggtgagaga
tacagaaagg cgggatggga cgcttacttg aagagagtag gcagatccgc 1380ttaagagttc
tccgagaaca agcagaggtt cgagtgtact cggatcagaa gttacaagtt 1440gatcgtttat
atataaacta tacagagatg ttagagtgta atggcattgc gtgccggcga 1500tcacagcgga
cggtggtggc atgatggggc ttgcgatgct atgtttgttt gttttgtgat 1560gatgtatatt
attattgaaa aacgatatca gacatttgtc tgataatgct tcattatcag 1620acaaatgtct
gatatcgttt ggagaaaaag aaaaggaaaa caaactaaat atctactata 1680taccactgta
ttttatacta atgactttct acgcctagtg tcaccctctc gtgtacccat 1740tgaccctgta
tcggcgcgtt gcctcgcgtt cctgtaccat atatttttgt ttatttaggt 1800attaaaattt
actttcctca tacaaatatt aaattcacca aacttctcaa aaactaatta 1860ttcgtagtta
caaactctat tttacaatca cgtttattca accattctac atccaataac 1920caaaatgccc
atgtacctct cagcgaagtc caacggtact gtccaatatt ctcattaaat 1980agtctttcat
ctatatatca gaaggtaatt ataattagag atttcgaatc attaccgtgc 2040cgattcgcac
gctgcaacgg catgcatcac taatgaaaag catacgacgc ctgcgtctga 2100catgcactca
ttctgaagaa gattctgggc gcgtttcgtt ctcgttttcc tctgtatatt 2160gtactctggt
ggacaatttg aacataacgt ctttcacctc gccattctca ataatgggtt 2220ccaattctat
ccaggtagcg gttaattgac ggtgcttaag ccgtatgctc actctaacgc 2280taccgttgtc
caaacaacgg acccctttgt gacgggtgta agacccatca tgaagtaaaa 2340catctctaac
ggtatggaaa agagtggtac ggtcaagttt cctggcacga gtcaattttc 2400cctcttcgtg
tagatcggta ccggccgcaa attaaagcct tcgagcgtcc caaaaccttc 2460tcaagcaagg
ttttcagtat aatgttacat gcgtacacgc gtctgtacag aaaaaaaaga 2520aaaatttgaa
atataaataa cgttcttaat actaacataa ctataaaaaa ataaataggg 2580acctagactt
caggttgtct aactccttcc ttttcggtta gagcggatgt ggggggaggg 2640cgtgaatgta
agcgtgacat aactaattac atgactcgag cggccgccta tttatggaat 2700ttcttatcat
aatcgaccaa agtaaatctg tatttgacgt ctccgctttc catccttgta 2760aaggcatggc
tgacgccttc ttcgctgatc ggaagttttt ccacccatat tttgacattc 2820ttttcggaaa
ctaatttcaa tagttgttcg atttccttcc tagatccgat agcactgctt 2880gagattgata
ctcccattag gcccaacggt tttaaaacaa gcttttcatt aacttcagga 2940gcagcaattg
aaacgatgga gcctccaatc ttcataatct taacgatact gtcaaaatta 3000actttcgaca
aagatgatga gcaaacgaca agaaggtcca aagcgttaga gtattgttct 3060gtccagcctt
tatcctccaa catagcaata tagtgatcag caccgagttt catagaatcc 3120tcccgcttgg
agtggcctcg cgaaaacgca taaacctcgg ctcccatagc tttagccaac 3180agaatcccca
tatgcccaat accaccgatg ccaacaatac ctaccctctt acctggacca 3240cagccatttc
ttagtagtgg agagaaaact gtaataccac cacacaataa tggagcggct 3300agcggacttg
gaatattttc tggtatttga atagcaaagt gttcatgaag cctcacgtgg 3360gaggcaaagc
ctccttgtga aatgtagccg tccttgtaag gagtccacat agtcaaaacg 3420tggtcattgg
tacagtattg ctcgttgtca cttttgcaac gttcacactc aaaacacgcc 3480aaggcttggg
caccaacacc aacacggtca ccgattttta ccccagtgtg gcacttggat 3540ccaaccttca
ccacgcggcc aattatttca tgtccaagga tttgattttc tgggactgga 3600ccccaattac
caacggctat atgaaaatca gatccgcaga taccacaggc ttcaatttca 3660acatcaacgt
catgatcgcc aaagggtttt gggtcaaaac tcactaattt aggatgcttc 3720caatcctttg
cgttggaaat accgatgccc tgaaattttt ctgggtaaag catgtcgaca 3780ccatcttctt
ctgagatgag tttttgttcc atgctagttc tagaatccgt cgaaactaag 3840ttctggtgtt
ttaaaactaa aaaaaagact aactataaaa gtagaattta agaagtttaa 3900gaaatagatt
tacagaatta caatcaatac ctaccgtctt tatatactta ttagtcaagt 3960aggggaataa
tttcagggaa ctggtttcaa cctttttttt cagctttttc caaatcagag 4020agagcagaag
gtaatagaag gtgtaagaaa atgagataga tacatgcgtg ggtcaattgc 4080cttgtgtcat
catttactcc aggcaggttg catcactcca ttgaggttgt gcccgttttt 4140tgcctgtttg
tgcccctgtt ctctgtagtt gcgctaagag aatggaccta tgaactgatg 4200gttggtgaag
aaaacaatat tttggtgctg ggattctttt tttttctgga tgccagctta 4260aaaagcgggc
tccattatat ttagtggatg ccaggaataa actgttcacc cagacaccta 4320cgatgttata
tattctgtgt aacccgcccc ctattttggg catgtacggg ttacagcaga 4380attaaaaggc
taattttttg actaaataaa gttaggaaaa tcactactat taattattta 4440cgtattcttt
gaaatggcga gtattgataa tgataaactg aggatcctta ggatttattc 4500tgttcagcaa
acagcttgcc cattttcttc agtaccttcg gtgcgccttc tttcgccagg 4560atcagttcga
tccagtacat acggttcgga tcggcctggg cctctttcat cacgctcaca 4620aattcgtttt
cggtacgcac aattttagac acaacacggt cctcagttgc gccgaaggac 4680tccggcagtt
tagagtagtt ccacataggg atatcgttgt aagactggtt cggaccgtgg 4740atctcacgct
caacggtgta gccgtcattg ttaataatga agcaaatcgg gttgatcttt 4800tcacgaattg
ccagacccag ttcctgtacg gtcagctgca gggaaccgtc accgatgaac 4860agcagatgac
gagattcttt atcagcgatc tgagagccca gcgctgccgg gaaagtatag 4920ccaatgctac
cccacagcgg ctgaccgata aaatggcttt tggatttcag aaagatagaa 4980gacgcgccga
aaaagctcgt accttgttcc gccacgatgg tttcattgct ctgggtcagg 5040ttctccacgg
cctgccacag gcgatcctgg gacagcagtg cgttagatgg tacgaaatct 5100tcttgctttt
tgtcaatgta tttgccttta tactcgattt cggacaggtc cagcagagag 5160ctgatcaggc
tttcgaagtc gaagttctgg atacgctcgt tgaagatttt accctcgtcg 5220atgttcaggc
taatcatttt gttttcgttc agatggtgag tgaatgcacc ggtagaagag 5280tcggtcagtt
taacgcccag catcaggatg aagtccgcag attcaacaaa ttctttcagg 5340ttcggttcgc
tcagagtacc gttgtagatg cccaggaaag acggcagagc ctcgtcaaca 5400gaggacttgc
cgaagttcag ggtggtaatc ggcagtttgg ttttgctgat gaattgggtc 5460acggtcttct
ccagaccaaa agaaatgatt tcgtggccgg tgatcacgat tggtttcttt 5520gcgtttttca
gagactcctg gattttgttc aggatttcct ggtcgctagt gttagaagtg 5580gagttttctt
tcttcagcgg caggctcggt ttttccgctt tagctgccgc aacatccaca 5640ggcaggttga
tgtaaactgg tttgcgttct ttcagcagcg cagacagaac gcggtcgatt 5700tccacagtag
cgttctctgc agtcagcagc gtacgtgccg cagtcacagg ttcatgcatt 5760ttcatgaagt
gtttgaaatc gccgtcagcc agagtgtggt ggacgaattt accttcgttc 5820tgaactttgc
tcgttgggct gcctacgatc tccaccaccg gcaggttttc ggcgtaggag 5880cccgccagac
cgttgacggc gctcagttcg ccaacaccga aagtggtcag aaatgccgcg 5940gctttcttgg
tacgtgcata accatctgcc atgtagcttg cgttcagttc gttagcgtta 6000cccacccatt
tcatgtcttt atgagagatg atctgatcca ggaactgcag attgtaatca 6060cccggaacgc
cgaagatttc ttcgataccc agttcatgca gacggtccag cagataatca 6120ccaacagtat
acatgtcgac acccgcatag tcaggaacat cgtatgggta catgctagtt 6180ctagaaaact
tagattagat tgctatgctt tctttctaat gagcaagaag taaaaaaagt 6240tgtaatagaa
caagaaaaat gaaactgaaa cttgagaaat tgaagaccgt ttattaactt 6300aaatatcaat
gggaggtcat cgaaagagaa aaaaatcaaa aaaaaaattt tcaagaaaaa 6360gaaacgtgat
aaaaattttt attgcctttt tcgacgaaga aaaagaaacg aggcggtctc 6420ttttttcttt
tccaaacctt tagtacgggt aattaacgac accctagagg aagaaagagg 6480ggaaatttag
tatgctgtgc ttgggtgttt tgaagtggta cggcgatgcg cggagtccga 6540gaaaatctgg
aagagtaaaa aaggagtaga aacattttga agctatgagc tccagctttt 6600gttcccttta
gtgagggtta attgcgcgct tggcgtaatc atggtcatag ctgtttcctg 6660tgtgaaattg
ttatccgctc acaattccac acaacatagg agccggaagc ataaagtgta 6720aagcctgggg
tgcctaatga gtgaggtaac tcacattaat tgcgttgcgc tcactgcccg 6780ctttccagtc
gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga 6840gaggcggttt
gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg 6900tcgttcggct
gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag 6960aatcagggga
taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc 7020gtaaaaaggc
cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca 7080aaaatcgacg
ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt 7140ttccccctgg
aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc 7200tgtccgcctt
tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc 7260tcagttcggt
gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc 7320ccgaccgctg
cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact 7380tatcgccact
ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg 7440ctacagagtt
cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta 7500tctgcgctct
gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca 7560aacaaaccac
cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa 7620aaaaaggatc
tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg 7680aaaactcacg
ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc 7740ttttaaatta
aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg 7800acagttacca
atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat 7860ccatagttgc
ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg 7920gccccagtgc
tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa 7980taaaccagcc
agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca 8040tccagtctat
taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc 8100gcaacgttgt
tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt 8160cattcagctc
cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa 8220aagcggttag
ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat 8280cactcatggt
tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct 8340tttctgtgac
tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga 8400gttgctcttg
cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag 8460tgctcatcat
tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga 8520gatccagttc
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca 8580ccagcgtttc
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg 8640cgacacggaa
atgttgaata ctcatactct tcctttttca atattattga agcatttatc 8700agggttattg
tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag 8760gggttccgcg
cacatttccc cgaaaagtgc cacctgacgt
880051677DNAArtificial SequenceSynthetic polynucleotide 5gtcgacatgt
ctgagaaaca atttggggcg aacttggttg tcgatagttt gattaaccat 60aaagtgaagt
atgtatttgg gattccagga gcaaaaattg accgggtttt tgatttatta 120gaaaatgaag
aaggccctca aatggtcgtg actcgtcatg agcaaggagc tgctttcatg 180gctcaagctg
ttggtcgttt gactggcgaa cctggtgtag tagttgttac gagtgggcct 240ggtgtatcaa
accttgcgac tccgcttttg accgcgactt cagaaggtga tgctattttg 300gctatcggtg
gacaagttaa acgaagtgac cgtcttaaac gtgcgcacca atcaatggat 360aatgctggaa
tgatgcaatc agcaacaaaa tattcagcag aagttcttga ccctgataca 420ctttctgaat
caattgccaa cgcttatcgt attgcaaaat caggacatcc aggtgcaact 480ttcttatcaa
tcccccaaga tgtaacggat gccgaagtat caatcaaggc cattcaacca 540ctttcagacc
ctaaaatggg gaatgcctct attgatgaca ttaattattt agcacaagca 600attaaaaatg
ctgtattgcc agtaattttg gttggagctg gtgcttcaga tgctaaagtc 660gcttcatcat
tgcgtaatct attaactcat gttaatattc ctgtcgttga aacattccaa 720ggtgcagggg
ttatttcaca tgatttagaa catacttttt atggacgtat cggtcttttc 780cgcaatcaac
caggagatat gcttctgaaa cgttctgacc ttgttattgc tgttggttat 840gacccaattg
aatatgaagc tcgtaactgg aatgcagaaa ttgatagtcg aattatcgtt 900attgataatg
ccattgctga aattgatact tactaccaac cagaacgtga attaattggt 960gatatcgcag
caacattgga taatctttta ccagctgttc gtggatacaa aattccaaaa 1020ggaacaaaag
attatctcga tggccttcat gaagttgctg agcaacacga atttgatact 1080gaaaatactg
aagaaggtag aatgcaccct cttgatttgg tcagcacttt ccaagaaatc 1140gttaaagatg
atgaaacagt aaccgttgac gtaggttcac tctacatttg gatggcacgt 1200catttcaaat
catacgaacc acgtcatctc ctcttctcaa acggaatgca aacacttgga 1260gttgcacttc
cttgggcaat tacagccgca ttgttgcgcc caggtaaaaa agtttattca 1320cactctggtg
atggaggctt ccttttcaca gggcaagagt tggaaacagc tgtacgtttg 1380aatcttccaa
tcgttcaaat tatctggaat gacggccatt atgatatggt taaattccaa 1440gaagaaatga
aatatggtcg ttcagcagcc gttgattttg gctatgttga ttacgtaaaa 1500tatgctgaag
caatgggagc aaaaggttac cgtgcacaca gcaaagaaga acttgctgaa 1560attcttaaat
caatcccaga tactactgga ccagtagtaa ttgacgttcc tttggactat 1620tctgataaca
ttaaattagc agaaaaatta ttgcctgaag agttttattg aggatcc
167761488DNAArtificial SequenceSynthetic polynucleotide 6gtcgacatgg
ctaactactt caatacactg aatctgcgcc agcagctggc acagctgggc 60aaatgtcgct
ttatgggccg cgatgaattc gccgatggcg cgagctacct tcagggtaaa 120aaagtagtca
tcgtcggctg tggcgcacag ggtctgaacc agggcctgaa catgcgtgat 180tctggtctcg
atatctccta cgctctgcgt aaagaagcga ttgccgagaa gcgcgcgtcc 240tggcgtaaag
cgaccgaaaa tggttttaaa gtgggtactt acgaagaact gatcccacag 300gcggatctgg
tgattaacct gacgccggac aagcagcact ctgatgtagt gcgcaccgta 360cagccactga
tgaaagacgg cgcggcgctg ggctactcgc acggtttcaa catcgtcgaa 420gtgggcgagc
agatccgtaa agatatcacc gtagtgatgg ttgcgccgaa atgcccaggc 480accgaagtgc
gtgaagagta caaacgtggg ttcggcgtac cgacgctgat tgccgttcac 540ccggaaaacg
atccgaaagg cgaaggcatg gcgattgcca aagcctgggc ggctgcaacc 600ggtggtcacc
gtgcgggtgt gctggaatcg tccttcgttg cggaagtgaa atctgacctg 660atgggcgagc
aaaccatcct gtgcggtatg ttgcaggctg gctctctgct gtgcttcgac 720aagctggtgg
aagaaggtac cgatccagca tacgcagaaa aactgattca gttcggttgg 780gaaaccatca
ccgaagcact gaaacagggc ggcatcaccc tgatgatgga ccgtctctct 840aacccggcga
aactgcgtgc ttatgcgctt tctgaacagc tgaaagagat catggcaccc 900ctgttccaga
aacatatgga cgacatcatc tccggcgaat tctcttccgg tatgatggcg 960gactgggcca
acgatgataa gaaactgctg acctggcgtg aagagaccgg caaaaccgcg 1020tttgaaaccg
cgccgcagta tgaaggcaaa atcggcgagc aggagtactt cgataaaggc 1080gtactgatga
ttgcgatggt gaaagcgggc gttgaactgg cgttcgaaac catggtcgat 1140tccggcatca
ttgaagagtc tgcatattat gaatcactgc acgagctgcc gctgattgcc 1200aacaccatcg
cccgtaagcg tctgtacgaa atgaacgtgg ttatctctga taccgctgag 1260tacggtaact
atctgttctc ttacgcttgt gtgccgttgc tgaaaccgtt tatggcagag 1320ctgcaaccgg
gcgacctggg taaagctatt ccggaaggcg cggtagataa cgggcaactg 1380cgtgatgtga
acgaagcgat tcgcagccat gcgattgagc aggtaggtaa gaaactgcgc 1440ggctatatga
cagatatgaa acgtattgct gttgcgggtt aaggatcc
148871863DNAArtificial SequenceSynthetic polynucleotide 7gtcgacatgc
ctaagtaccg ttccgccacc accactcatg gtcgtaatat ggcgggtgct 60cgtgcgctgt
ggcgcgccac cggaatgacc gacgccgatt tcggtaagcc gattatcgcg 120gttgtgaact
cgttcaccca atttgtaccg ggtcacgtcc atctgcgcga tctcggtaaa 180ctggtcgccg
aacaaattga agcggctggc ggcgttgcca aagagttcaa caccattgcg 240gtggatgatg
ggattgccat gggccacggg gggatgcttt attcactgcc atctcgcgaa 300ctgatcgctg
attccgttga gtatatggtc aacgcccact gcgccgacgc catggtctgc 360atctctaact
gcgacaaaat caccccgggg atgctgatgg cttccctgcg cctgaatatt 420ccggtgatct
ttgtttccgg cggcccgatg gaggccggga aaaccaaact ttccgatcag 480atcatcaagc
tcgatctggt tgatgcgatg atccagggcg cagacccgaa agtatctgac 540tcccagagcg
atcaggttga acgttccgcg tgtccgacct gcggttcctg ctccgggatg 600tttaccgcta
actcaatgaa ctgcctgacc gaagcgctgg gcctgtcgca gccgggcaac 660ggctcgctgc
tggcaaccca cgccgaccgt aagcagctgt tccttaatgc tggtaaacgc 720attgttgaat
tgaccaaacg ttattacgag caaaacgacg aaagtgcact gccgcgtaat 780atcgccagta
aggcggcgtt tgaaaacgcc atgacgctgg atatcgcgat gggtggatcg 840actaacaccg
tacttcacct gctggcggcg gcgcaggaag cggaaatcga cttcaccatg 900agtgatatcg
ataagctttc ccgcaaggtt ccacagctgt gtaaagttgc gccgagcacc 960cagaaatacc
atatggaaga tgttcaccgt gctggtggtg ttatcggtat tctcggcgaa 1020ctggatcgcg
cggggttact gaaccgtgat gtgaaaaacg tacttggcct gacgttgccg 1080caaacgctgg
aacaatacga cgttatgctg acccaggatg acgcggtaaa aaatatgttc 1140cgcgcaggtc
ctgcaggcat tcgtaccaca caggcattct cgcaagattg ccgttgggat 1200acgctggacg
acgatcgcgc caatggctgt atccgctcgc tggaacacgc ctacagcaaa 1260gacggcggcc
tggcggtgct ctacggtaac tttgcggaaa acggctgcat cgtgaaaacg 1320gcaggcgtcg
atgacagcat cctcaaattc accggcccgg cgaaagtgta cgaaagccag 1380gacgatgcgg
tagaagcgat tctcggcggt aaagttgtcg ccggagatgt ggtagtaatt 1440cgctatgaag
gcccgaaagg cggtccgggg atgcaggaaa tgctctaccc aaccagcttc 1500ctgaaatcaa
tgggtctcgg caaagcctgt gcgctgatca ccgacggtcg tttctctggt 1560ggcacctctg
gtctttccat cggccacgtc tcaccggaag cggcaagcgg cggcagcatt 1620ggcctgattg
aagatggtga cctgatcgct atcgacatcc cgaaccgtgg cattcagtta 1680caggtaagcg
atgccgaact ggcggcgcgt cgtgaagcgc aggacgctcg aggtgacaaa 1740gcctggacgc
cgaaaaatcg tgaacgtcag gtctcctttg ccctgcgtgc ttatgccagc 1800ctggcaacca
gcgccgacaa aggcgcggtg cgcgataaat cgaaactggg gggttaagga 1860tcc
186381659DNAArtificial SequenceSynthetic polynucleotide 8gtcgacatgt
atactgttgg tgattatctg ctggaccgtc tgcatgaact gggtatcgaa 60gaaatcttcg
gcgttccggg tgattacaat ctgcagttcc tggatcagat catctctcat 120aaagacatga
aatgggtggg taacgctaac gaactgaacg caagctacat ggcagatggt 180tatgcacgta
ccaagaaagc cgcggcattt ctgaccactt tcggtgttgg cgaactgagc 240gccgtcaacg
gtctggcggg ctcctacgcc gaaaacctgc cggtggtgga gatcgtaggc 300agcccaacga
gcaaagttca gaacgaaggt aaattcgtcc accacactct ggctgacggc 360gatttcaaac
acttcatgaa aatgcatgaa cctgtgactg cggcacgtac gctgctgact 420gcagagaacg
ctactgtgga aatcgaccgc gttctgtctg cgctgctgaa agaacgcaaa 480ccagtttaca
tcaacctgcc tgtggatgtt gcggcagcta aagcggaaaa accgagcctg 540ccgctgaaga
aagaaaactc cacttctaac actagcgacc aggaaatcct gaacaaaatc 600caggagtctc
tgaaaaacgc aaagaaacca atcgtgatca ccggccacga aatcatttct 660tttggtctgg
agaagaccgt gacccaattc atcagcaaaa ccaaactgcc gattaccacc 720ctgaacttcg
gcaagtcctc tgttgacgag gctctgccgt ctttcctggg catctacaac 780ggtactctga
gcgaaccgaa cctgaaagaa tttgttgaat ctgcggactt catcctgatg 840ctgggcgtta
aactgaccga ctcttctacc ggtgcattca ctcaccatct gaacgaaaac 900aaaatgatta
gcctgaacat cgacgagggt aaaatcttca acgagcgtat ccagaacttc 960gacttcgaaa
gcctgatcag ctctctgctg gacctgtccg aaatcgagta taaaggcaaa 1020tacattgaca
aaaagcaaga agatttcgta ccatctaacg cactgctgtc ccaggatcgc 1080ctgtggcagg
ccgtggagaa cctgacccag agcaatgaaa ccatcgtggc ggaacaaggt 1140acgagctttt
tcggcgcgtc ttctatcttt ctgaaatcca aaagccattt tatcggtcag 1200ccgctgtggg
gtagcattgg ctatactttc ccggcagcgc tgggctctca gatcgctgat 1260aaagaatctc
gtcatctgct gttcatcggt gacggttccc tgcagctgac cgtacaggaa 1320ctgggtctgg
caattcgtga aaagatcaac ccgatttgct tcattattaa caatgacggc 1380tacaccgttg
agcgtgagat ccacggtccg aaccagtctt acaacgatat ccctatgtgg 1440aactactcta
aactgccgga gtccttcggc gcaactgagg accgtgttgt gtctaaaatt 1500gtgcgtaccg
aaaacgaatt tgtgagcgtg atgaaagagg cccaggccga tccgaaccgt 1560atgtactgga
tcgaactgat cctggcgaaa gaaggcgcac cgaaggtact gaagaaaatg 1620ggcaagctgt
ttgctgaaca gaataaatcc taaggatcc
165991059DNAArtificial SequenceSynthetic polynucleotide 9gtcgacatgt
ctattccaga aactcaaaaa gccattatct tctacgaatc caacggcaag 60ttggagcata
aggatatccc agttccaaag ccaaagccca acgaattgtt aatcaacgtc 120aagtactctg
gtgtctgcca caccgatttg cacgcttggc atggtgactg gccattgcca 180actaagttac
cattagttgg tggtcacgaa ggtgccggtg tcgttgtcgg catgggtgaa 240aacgttaagg
gctggaagat cggtgactac gccggtatca aatggttgaa cggttcttgt 300atggcctgtg
aatactgtga attgggtaac gaatccaact gtcctcacgc tgacttgtct 360ggttacaccc
acgacggttc tttccaagaa tacgctaccg ctgacgctgt tcaagccgct 420cacattcctc
aaggtactga cttggctgaa gtcgcgccaa tcttgtgtgc tggtatcacc 480gtatacaagg
ctttgaagtc tgccaacttg agagcaggcc actgggcggc catttctggt 540gctgctggtg
gtctaggttc tttggctgtt caatatgcta aggcgatggg ttacagagtc 600ttaggtattg
atggtggtcc aggaaaggaa gaattgttta cctcgctcgg tggtgaagta 660ttcatcgact
tcaccaaaga gaaggacatt gttagcgcag tcgttaaggc taccaacggc 720ggtgcccacg
gtatcatcaa tgtttccgtt tccgaagccg ctatcgaagc ttctaccaga 780tactgtaggg
cgaacggtac tgttgtcttg gttggtttgc cagccggtgc aaagtgctcc 840tctgatgtct
tcaaccacgt tgtcaagtct atctccattg tcggctctta cgtggggaac 900agagctgata
ccagagaagc cttagatttc tttgccagag gtctagtcaa gtctccaata 960aaggtagttg
gcttatccag tttaccagaa atttacgaaa agatggagaa gggccaaatt 1020gctggtagat
acgttgttga cacttctaaa taaggatcc
1059109761DNAArtificial SequenceSynthetic polynucleotide 10tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac
agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg
aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact
tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt
aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac
atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat
gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact
ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt
gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa
ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta
ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt
gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag
aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac
taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca
aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg
tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc
tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa
ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca
gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc
ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa
ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa
tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa
atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact
attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc
actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa
tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc
gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt
cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtcgcg
ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860cctcttcgct
attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920taacgccagg
gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980acgactcact
atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040aaccttctca
agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100aaaaagaaaa
atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160aatagggacc
tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220gggagggcgt
gaatgtaagc gtgacataac taattacatg actcgagcgg ccgcggatcc 2280ttatttagaa
gtgtcaacaa cgtatctacc agcaatttgg cccttctcca tcttttcgta 2340aatttctggt
aaactggata agccaactac ctttattgga gacttgacta gacctctggc 2400aaagaaatct
aaggcttctc tggtatcagc tctgttcccc acgtaagagc cgacaatgga 2460gatagacttg
acaacgtggt tgaagacatc agaggagcac tttgcaccgg ctggcaaacc 2520aaccaagaca
acagtaccgt tcgccctaca gtatctggta gaagcttcga tagcggcttc 2580ggaaacggaa
acattgatga taccgtgggc accgccgttg gtagccttaa cgactgcgct 2640aacaatgtcc
ttctctttgg tgaagtcgat gaatacttca ccaccgagcg aggtaaacaa 2700ttcttccttt
cctggaccac catcaatacc taagactctg taacccatcg ccttagcata 2760ttgaacagcc
aaagaaccta gaccaccagc agcaccagaa atggccgccc agtggcctgc 2820tctcaagttg
gcagacttca aagccttgta tacggtgata ccagcacaca agattggcgc 2880gacttcagcc
aagtcagtac cttgaggaat gtgagcggct tgaacagcgt cagcggtagc 2940gtattcttgg
aaagaaccgt cgtgggtgta accagacaag tcagcgtgag gacagttgga 3000ttcgttaccc
aattcacagt attcacaggc catacaagaa ccgttcaacc atttgatacc 3060ggcgtagtca
ccgatcttcc agcccttaac gttttcaccc atgccgacaa cgacaccggc 3120accttcgtga
ccaccaacta atggtaactt agttggcaat ggccagtcac catgccaagc 3180gtgcaaatcg
gtgtggcaga caccagagta cttgacgttg attaacaatt cgttgggctt 3240tggctttgga
actgggatat ccttatgctc caacttgccg ttggattcgt agaagataat 3300ggctttttga
gtttctggaa tagacatgtc gacaccatct tcttctgaga tgagtttttg 3360ttccatgcta
gttctagaat ccgtcgaaac taagttctgg tgttttaaaa ctaaaaaaaa 3420gactaactat
aaaagtagaa tttaagaagt ttaagaaata gatttacaga attacaatca 3480atacctaccg
tctttatata cttattagtc aagtagggga ataatttcag ggaactggtt 3540tcaacctttt
ttttcagctt tttccaaatc agagagagca gaaggtaata gaaggtgtaa 3600gaaaatgaga
tagatacatg cgtgggtcaa ttgccttgtg tcatcattta ctccaggcag 3660gttgcatcac
tccattgagg ttgtgcccgt tttttgcctg tttgtgcccc tgttctctgt 3720agttgcgcta
agagaatgga cctatgaact gatggttggt gaagaaaaca atattttggt 3780gctgggattc
tttttttttc tggatgccag cttaaaaagc gggctccatt atatttagtg 3840gatgccagga
ataaactgtt cacccagaca cctacgatgt tatatattct gtgtaacccg 3900ccccctattt
tgggcatgta cgggttacag cagaattaaa aggctaattt tttgactaaa 3960taaagttagg
aaaatcacta ctattaatta tttacgtatt ctttgaaatg gcgagtattg 4020ataatgataa
actgaggatc cttaggattt attctgttca gcaaacagct tgcccatttt 4080cttcagtacc
ttcggtgcgc cttctttcgc caggatcagt tcgatccagt acatacggtt 4140cggatcggcc
tgggcctctt tcatcacgct cacaaattcg ttttcggtac gcacaatttt 4200agacacaaca
cggtcctcag ttgcgccgaa ggactccggc agtttagagt agttccacat 4260agggatatcg
ttgtaagact ggttcggacc gtggatctca cgctcaacgg tgtagccgtc 4320attgttaata
atgaagcaaa tcgggttgat cttttcacga attgccagac ccagttcctg 4380tacggtcagc
tgcagggaac cgtcaccgat gaacagcaga tgacgagatt ctttatcagc 4440gatctgagag
cccagcgctg ccgggaaagt atagccaatg ctaccccaca gcggctgacc 4500gataaaatgg
cttttggatt tcagaaagat agaagacgcg ccgaaaaagc tcgtaccttg 4560ttccgccacg
atggtttcat tgctctgggt caggttctcc acggcctgcc acaggcgatc 4620ctgggacagc
agtgcgttag atggtacgaa atcttcttgc tttttgtcaa tgtatttgcc 4680tttatactcg
atttcggaca ggtccagcag agagctgatc aggctttcga agtcgaagtt 4740ctggatacgc
tcgttgaaga ttttaccctc gtcgatgttc aggctaatca ttttgttttc 4800gttcagatgg
tgagtgaatg caccggtaga agagtcggtc agtttaacgc ccagcatcag 4860gatgaagtcc
gcagattcaa caaattcttt caggttcggt tcgctcagag taccgttgta 4920gatgcccagg
aaagacggca gagcctcgtc aacagaggac ttgccgaagt tcagggtggt 4980aatcggcagt
ttggttttgc tgatgaattg ggtcacggtc ttctccagac caaaagaaat 5040gatttcgtgg
ccggtgatca cgattggttt ctttgcgttt ttcagagact cctggatttt 5100gttcaggatt
tcctggtcgc tagtgttaga agtggagttt tctttcttca gcggcaggct 5160cggtttttcc
gctttagctg ccgcaacatc cacaggcagg ttgatgtaaa ctggtttgcg 5220ttctttcagc
agcgcagaca gaacgcggtc gatttccaca gtagcgttct ctgcagtcag 5280cagcgtacgt
gccgcagtca caggttcatg cattttcatg aagtgtttga aatcgccgtc 5340agccagagtg
tggtggacga atttaccttc gttctgaact ttgctcgttg ggctgcctac 5400gatctccacc
accggcaggt tttcggcgta ggagcccgcc agaccgttga cggcgctcag 5460ttcgccaaca
ccgaaagtgg tcagaaatgc cgcggctttc ttggtacgtg cataaccatc 5520tgccatgtag
cttgcgttca gttcgttagc gttacccacc catttcatgt ctttatgaga 5580gatgatctga
tccaggaact gcagattgta atcacccgga acgccgaaga tttcttcgat 5640acccagttca
tgcagacggt ccagcagata atcaccaaca gtatacatgt cgacacccgc 5700atagtcagga
acatcgtatg ggtacatgct agttctagaa aacttagatt agattgctat 5760gctttctttc
taatgagcaa gaagtaaaaa aagttgtaat agaacaagaa aaatgaaact 5820gaaacttgag
aaattgaaga ccgtttatta acttaaatat caatgggagg tcatcgaaag 5880agaaaaaaat
caaaaaaaaa attttcaaga aaaagaaacg tgataaaaat ttttattgcc 5940tttttcgacg
aagaaaaaga aacgaggcgg tctctttttt cttttccaaa cctttagtac 6000gggtaattaa
cgacacccta gaggaagaaa gaggggaaat ttagtatgct gtgcttgggt 6060gttttgaagt
ggtacggcga tgcgcggagt ccgagaaaat ctggaagagt aaaaaaggag 6120tagaaacatt
ttgaagctat gagctccagc ttttgttccc tttagtgagg gttaattgcg 6180cgcttggcgt
aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 6240ccacacaaca
taggagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagg 6300taactcacat
taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 6360cagctgcatt
aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 6420tccgcttcct
cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 6480gctcactcaa
aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 6540atgtgagcaa
aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 6600ttccataggc
tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 6660cgaaacccga
caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 6720tctcctgttc
cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 6780gtggcgcttt
ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 6840aagctgggct
gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 6900tatcgtcttg
agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 6960aacaggatta
gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 7020aactacggct
acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 7080ttcggaaaaa
gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 7140ttttttgttt
gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 7200atcttttcta
cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 7260atgagattat
caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 7320tcaatctaaa
gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 7380gcacctatct
cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 7440tagataacta
cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga 7500gacccacgct
caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag 7560cgcagaagtg
gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa 7620gctagagtaa
gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc 7680atcgtggtgt
cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca 7740aggcgagtta
catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg 7800atcgttgtca
gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat 7860aattctctta
ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc 7920aagtcattct
gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 7980gataataccg
cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg 8040gggcgaaaac
tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt 8100gcacccaact
gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca 8160ggaaggcaaa
atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata 8220ctcttccttt
ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac 8280atatttgaat
gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 8340gtgccacctg
aacgaagcat ctgtgcttca ttttgtagaa caaaaatgca acgcgagagc 8400gctaattttt
caaacaaaga atctgagctg catttttaca gaacagaaat gcaacgcgaa 8460agcgctattt
taccaacgaa gaatctgtgc ttcatttttg taaaacaaaa atgcaacgcg 8520agagcgctaa
tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac 8580gcgagagcgc
tattttacca acaaagaatc tatacttctt ttttgttcta caaaaatgca 8640tcccgagagc
gctatttttc taacaaagca tcttagatta ctttttttct cctttgtgcg 8700ctctataatg
cagtctcttg ataacttttt gcactgtagg tccgttaagg ttagaagaag 8760gctactttgg
tgtctatttt ctcttccata aaaaaagcct gactccactt cccgcgttta 8820ctgattacta
gcgaagctgc gggtgcattt tttcaagata aaggcatccc cgattatatt 8880ctataccgat
gtggattgcg catactttgt gaacagaaag tgatagcgtt gatgattctt 8940cattggtcag
aaaattatga acggtttctt ctattttgtc tctatatact acgtatagga 9000aatgtttaca
ttttcgtatt gttttcgatt cactctatga atagttctta ctacaatttt 9060tttgtctaaa
gagtaatact agagataaac ataaaaaatg tagaggtcga gtttagatgc 9120aagttcaagg
agcgaaaggt ggatgggtag gttatatagg gatatagcac agagatatat 9180agcaaagaga
tacttttgag caatgtttgt ggaagcggta ttcgcaatat tttagtagct 9240cgttacagtc
cggtgcgttt ttggtttttt gaaagtgcgt cttcagagcg cttttggttt 9300tcaaaagcgc
tctgaagttc ctatactttc tagagaatag gaacttcgga ataggaactt 9360caaagcgttt
ccgaaaacga gcgcttccga aaatgcaacg cgagctgcgc acatacagct 9420cactgttcac
gtcgcaccta tatctgcgtg ttgcctgtat atatatatac atgagaagaa 9480cggcatagtg
cgtgtttatg cttaaatgcg tacttatatg cgtctattta tgtaggatga 9540aaggtagtct
agtacctcct gtgatattat cccattccat gcggggtatc gtatgcttcc 9600ttcagcacta
ccctttagct gttctatatg ctgccactcc tcaattggat tagtctcatc 9660cttcaatgct
atcatttcct ttgatattgg atcatactaa gaaaccatta ttatcatgac 9720attaacctat
aaaaataggc gtatcacgag gccctttcgt c
9761117990DNAArtificial SequenceSynthetic polynucleotide 11tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaacg
acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240atatgtgtac
tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300aaatagcttg
tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360gaattaattc
ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420tgagcacgtg
agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480atttcacagg
tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540cagaatgtgc
tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600agagaacaat
tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660atagttcagg
cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720ttttggctct
ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780ggcaagaata
ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840actgcaacat
actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900attcagaagc
aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960gaaggcaaga
gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020atgttggtga
tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080agacaaatgg
tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140aggttattac
tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200aataccgcac
agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260ttgttaaaat
tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320atcggcaaaa
tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380gtttggaaca
agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440gtctatcagg
gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500aggtgccgta
aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560ggaaagccgg
cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680ccgctacagg
gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860cgcgcgtaat
acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920agcgtcccaa
aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980tgtacagaaa
aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040taaaaaaata
aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100cggatgtggg
gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagcgg 2160ccgcggatcc
ttaacccgca acagcaatac gtttcatatc tgtcatatag ccgcgcagtt 2220tcttacctac
ctgctcaatc gcatggctgc gaatcgcttc gttcacatca cgcagttgcc 2280cgttatctac
cgcgccttcc ggaatagctt tacccaggtc gcccggttgc agctctgcca 2340taaacggttt
cagcaacggc acacaagcgt aagagaacag atagttaccg tactcagcgg 2400tatcagagat
aaccacgttc atttcgtaca gacgcttacg ggcgatggtg ttggcaatca 2460gcggcagctc
gtgcagtgat tcataatatg cagactcttc aatgatgccg gaatcgacca 2520tggtttcgaa
cgccagttca acgcccgctt tcaccatcgc aatcatcagt acgcctttat 2580cgaagtactc
ctgctcgccg attttgcctt catactgcgg cgcggtttca aacgcggttt 2640tgccggtctc
ttcacgccag gtcagcagtt tcttatcatc gttggcccag tccgccatca 2700taccggaaga
gaattcgccg gagatgatgt cgtccatatg tttctggaac aggggtgcca 2760tgatctcttt
cagctgttca gaaagcgcat aagcacgcag tttcgccggg ttagagagac 2820ggtccatcat
cagggtgatg ccgccctgtt tcagtgcttc ggtgatggtt tcccaaccga 2880actgaatcag
tttttctgcg tatgctggat cggtaccttc ttccaccagc ttgtcgaagc 2940acagcagaga
gccagcctgc aacataccgc acaggatggt ttgctcgccc atcaggtcag 3000atttcacttc
cgcaacgaag gacgattcca gcacacccgc acggtgacca ccggttgcag 3060ccgcccaggc
tttggcaatc gccatgcctt cgcctttcgg atcgttttcc gggtgaacgg 3120caatcagcgt
cggtacgccg aacccacgtt tgtactcttc acgcacttcg gtgcctgggc 3180atttcggcgc
aaccatcact acggtgatat ctttacggat ctgctcgccc acttcgacga 3240tgttgaaacc
gtgcgagtag cccagcgccg cgccgtcttt catcagtggc tgtacggtgc 3300gcactacatc
agagtgctgc ttgtccggcg tcaggttaat caccagatcc gcctgtggga 3360tcagttcttc
gtaagtaccc actttaaaac cattttcggt cgctttacgc caggacgcgc 3420gcttctcggc
aatcgcttct ttacgcagag cgtaggagat atcgagacca gaatcacgca 3480tgttcaggcc
ctggttcaga ccctgtgcgc cacagccgac gatgactact tttttaccct 3540gaaggtagct
cgcgccatcg gcgaattcat cgcggcccat aaagcgacat ttgcccagct 3600gtgccagctg
ctggcgcaga ttcagtgtat tgaagtagtt agccatgtcg acaccatctt 3660cttctgagat
gagtttttgt tccatgctag ttctagaatc cgtcgaaact aagttctggt 3720gttttaaaac
taaaaaaaag actaactata aaagtagaat ttaagaagtt taagaaatag 3780atttacagaa
ttacaatcaa tacctaccgt ctttatatac ttattagtca agtaggggaa 3840taatttcagg
gaactggttt caaccttttt tttcagcttt ttccaaatca gagagagcag 3900aaggtaatag
aaggtgtaag aaaatgagat agatacatgc gtgggtcaat tgccttgtgt 3960catcatttac
tccaggcagg ttgcatcact ccattgaggt tgtgcccgtt ttttgcctgt 4020ttgtgcccct
gttctctgta gttgcgctaa gagaatggac ctatgaactg atggttggtg 4080aagaaaacaa
tattttggtg ctgggattct ttttttttct ggatgccagc ttaaaaagcg 4140ggctccatta
tatttagtgg atgccaggaa taaactgttc acccagacac ctacgatgtt 4200atatattctg
tgtaacccgc cccctatttt gggcatgtac gggttacagc agaattaaaa 4260ggctaatttt
ttgactaaat aaagttagga aaatcactac tattaattat ttacgtattc 4320tttgaaatgg
cgagtattga taatgataaa ctgagctaga tctgggcccg agctccagct 4380tttgttccct
ttagtgaggg ttaattgcgc gcttggcgta atcatggtca tagctgtttc 4440ctgtgtgaaa
ttgttatccg ctcacaattc cacacaacat aggagccgga agcataaagt 4500gtaaagcctg
gggtgcctaa tgagtgaggt aactcacatt aattgcgttg cgctcactgc 4560ccgctttcca
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 4620ggagaggcgg
tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 4680cggtcgttcg
gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 4740cagaatcagg
ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 4800accgtaaaaa
ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 4860acaaaaatcg
acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 4920cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 4980acctgtccgc
ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 5040atctcagttc
ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 5100agcccgaccg
ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 5160acttatcgcc
actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 5220gtgctacaga
gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg 5280gtatctgcgc
tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 5340gcaaacaaac
caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 5400gaaaaaaagg
atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 5460acgaaaactc
acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 5520tccttttaaa
ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 5580ctgacagtta
ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 5640catccatagt
tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 5700ctggccccag
tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 5760caataaacca
gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 5820ccatccagtc
tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 5880tgcgcaacgt
tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 5940cttcattcag
ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 6000aaaaagcggt
tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 6060tatcactcat
ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 6120gcttttctgt
gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 6180cgagttgctc
ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 6240aagtgctcat
cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 6300tgagatccag
ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 6360tcaccagcgt
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 6420gggcgacacg
gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 6480atcagggtta
ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 6540taggggttcc
gcgcacattt ccccgaaaag tgccacctga acgaagcatc tgtgcttcat 6600tttgtagaac
aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc 6660atttttacag
aacagaaatg caacgcgaaa gcgctatttt accaacgaag aatctgtgct 6720tcatttttgt
aaaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga 6780gctgcatttt
tacagaacag aaatgcaacg cgagagcgct attttaccaa caaagaatct 6840atacttcttt
tttgttctac aaaaatgcat cccgagagcg ctatttttct aacaaagcat 6900cttagattac
tttttttctc ctttgtgcgc tctataatgc agtctcttga taactttttg 6960cactgtaggt
ccgttaaggt tagaagaagg ctactttggt gtctattttc tcttccataa 7020aaaaagcctg
actccacttc ccgcgtttac tgattactag cgaagctgcg ggtgcatttt 7080ttcaagataa
aggcatcccc gattatattc tataccgatg tggattgcgc atactttgtg 7140aacagaaagt
gatagcgttg atgattcttc attggtcaga aaattatgaa cggtttcttc 7200tattttgtct
ctatatacta cgtataggaa atgtttacat tttcgtattg ttttcgattc 7260actctatgaa
tagttcttac tacaattttt ttgtctaaag agtaatacta gagataaaca 7320taaaaaatgt
agaggtcgag tttagatgca agttcaagga gcgaaaggtg gatgggtagg 7380ttatataggg
atatagcaca gagatatata gcaaagagat acttttgagc aatgtttgtg 7440gaagcggtat
tcgcaatatt ttagtagctc gttacagtcc ggtgcgtttt tggttttttg 7500aaagtgcgtc
ttcagagcgc ttttggtttt caaaagcgct ctgaagttcc tatactttct 7560agagaatagg
aacttcggaa taggaacttc aaagcgtttc cgaaaacgag cgcttccgaa 7620aatgcaacgc
gagctgcgca catacagctc actgttcacg tcgcacctat atctgcgtgt 7680tgcctgtata
tatatataca tgagaagaac ggcatagtgc gtgtttatgc ttaaatgcgt 7740acttatatgc
gtctatttat gtaggatgaa aggtagtcta gtacctcctg tgatattatc 7800ccattccatg
cggggtatcg tatgcttcct tcagcactac cctttagctg ttctatatgc 7860tgccactcct
caattggatt agtctcatcc ttcaatgcta tcatttcctt tgatattgga 7920tcatattaag
aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 7980ccctttcgtc
7990128167DNAArtificial SequenceSynthetic polynucleotide 12tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgactcg 2340agcggccgcg
gatcctcaat aaaactcttc aggcaataat ttttctgcta atttaatgtt 2400atcagaatag
tccaaaggaa cgtcaattac tactggtcca gtagtatctg ggattgattt 2460aagaatttca
gcaagttctt ctttgctgtg tgcacggtaa ccttttgctc ccattgcttc 2520agcatatttt
acgtaatcaa catagccaaa atcaacggct gctgaacgac catatttcat 2580ttcttcttgg
aatttaacca tatcataatg gccgtcattc cagataattt gaacgattgg 2640aagattcaaa
cgtacagctg tttccaactc ttgccctgtg aaaaggaagc ctccatcacc 2700agagtgtgaa
taaacttttt tacctgggcg caacaatgcg gctgtaattg cccaaggaag 2760tgcaactcca
agtgtttgca ttccgtttga gaagaggaga tgacgtggtt cgtatgattt 2820gaaatgacgt
gccatccaaa tgtagagtga acctacgtca acggttactg tttcatcatc 2880tttaacgatt
tcttggaaag tgctgaccaa atcaagaggg tgcattctac cttcttcagt 2940attttcagta
tcaaattcgt gttgctcagc aacttcatga aggccatcga gataatcttt 3000tgttcctttt
ggaattttgt atccacgaac agctggtaaa agattatcca atgttgctgc 3060gatatcacca
attaattcac gttctggttg gtagtaagta tcaatttcag caatggcatt 3120atcaataacg
ataattcgac tatcaatttc tgcattccag ttacgagctt catattcaat 3180tgggtcataa
ccaacagcaa taacaaggtc agaacgtttc agaagcatat ctcctggttg 3240attgcggaaa
agaccgatac gtccataaaa agtatgttct aaatcatgtg aaataacccc 3300tgcaccttgg
aatgtttcaa cgacaggaat attaacatga gttaatagat tacgcaatga 3360tgaagcgact
ttagcatctg aagcaccagc tccaaccaaa attactggca atacagcatt 3420tttaattgct
tgtgctaaat aattaatgtc atcaatagag gcattcccca ttttagggtc 3480tgaaagtggt
tgaatggcct tgattgatac ttcggcatcc gttacatctt gggggattga 3540taagaaagtt
gcacctggat gtcctgattt tgcaatacga taagcgttgg caattgattc 3600agaaagtgta
tcagggtcaa gaacttctgc tgaatatttt gttgctgatt gcatcattcc 3660agcattatcc
attgattggt gcgcacgttt aagacggtca cttcgtttaa cttgtccacc 3720gatagccaaa
atagcatcac cttctgaagt cgcggtcaaa agcggagtcg caaggtttga 3780tacaccaggc
ccactcgtaa caactactac accaggttcg ccagtcaaac gaccaacagc 3840ttgagccatg
aaagcagctc cttgctcatg acgagtcacg accatttgag ggccttcttc 3900attttctaat
aaatcaaaaa cccggtcaat ttttgctcct ggaatcccaa atacatactt 3960cactttatgg
ttaatcaaac tatcgacaac caagttcgcc ccaaattgtt tctcagacat 4020gtcgacaccg
atatacctgt atgtgtcacc accaatgtat ctataagtat ccatgctagc 4080cctaggttta
tgtgatgatt gattgattga ttgtacagtt tgtttttctt aatatctatt 4140tcgatgactt
ctatatgata ttgcactaac aagaagatat tataatgcaa ttgatacaag 4200acaaggagtt
atttgcttct cttttatatg attctgacaa tccatattgc gttggtagtc 4260ttttttgctg
gaacggttca gcggaaaaga cgcatcgctc tttttgcttc tagaagaaat 4320gccagcaaaa
gaatctcttg acagtgactg acagcaaaaa tgtctttttc taactagtaa 4380caaggctaag
atatcagcct gaaataaagg gtggtgaagt aataattaaa tcatccgtat 4440aaacctatac
acatatatga ggaaaaataa tacaaaagtg ttttaaatac agatacatac 4500atgaacatat
gcacgtatag cgcccaaatg tcggtaatgg gatcggcgag ctccagcttt 4560tgttcccttt
agtgagggtt aattgcgcgc ttggcgtaat catggtcata gctgtttcct 4620gtgtgaaatt
gttatccgct cacaattcca cacaacatag gagccggaag cataaagtgt 4680aaagcctggg
gtgcctaatg agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc 4740gctttccagt
cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 4800agaggcggtt
tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 4860gtcgttcggc
tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 4920gaatcagggg
ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 4980cgtaaaaagg
ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 5040aaaaatcgac
gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 5100tttccccctg
gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 5160ctgtccgcct
ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5220ctcagttcgg
tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5280cccgaccgct
gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 5340ttatcgccac
tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 5400gctacagagt
tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 5460atctgcgctc
tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5520aaacaaacca
ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 5580aaaaaaggat
ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 5640gaaaactcac
gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 5700cttttaaatt
aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 5760gacagttacc
aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 5820tccatagttg
cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 5880ggccccagtg
ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 5940ataaaccagc
cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6000atccagtcta
ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 6060cgcaacgttg
ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6120tcattcagct
ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6180aaagcggtta
gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6240tcactcatgg
ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 6300ttttctgtga
ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6360agttgctctt
gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 6420gtgctcatca
ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 6480agatccagtt
cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 6540accagcgttt
ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 6600gcgacacgga
aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 6660cagggttatt
gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 6720ggggttccgc
gcacatttcc ccgaaaagtg ccacctgaac gaagcatctg tgcttcattt 6780tgtagaacaa
aaatgcaacg cgagagcgct aatttttcaa acaaagaatc tgagctgcat 6840ttttacagaa
cagaaatgca acgcgaaagc gctattttac caacgaagaa tctgtgcttc 6900atttttgtaa
aacaaaaatg caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc 6960tgcattttta
cagaacagaa atgcaacgcg agagcgctat tttaccaaca aagaatctat 7020acttcttttt
tgttctacaa aaatgcatcc cgagagcgct atttttctaa caaagcatct 7080tagattactt
tttttctcct ttgtgcgctc tataatgcag tctcttgata actttttgca 7140ctgtaggtcc
gttaaggtta gaagaaggct actttggtgt ctattttctc ttccataaaa 7200aaagcctgac
tccacttccc gcgtttactg attactagcg aagctgcggg tgcatttttt 7260caagataaag
gcatccccga ttatattcta taccgatgtg gattgcgcat actttgtgaa 7320cagaaagtga
tagcgttgat gattcttcat tggtcagaaa attatgaacg gtttcttcta 7380ttttgtctct
atatactacg tataggaaat gtttacattt tcgtattgtt ttcgattcac 7440tctatgaata
gttcttacta caattttttt gtctaaagag taatactaga gataaacata 7500aaaaatgtag
aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga tgggtaggtt 7560atatagggat
atagcacaga gatatatagc aaagagatac ttttgagcaa tgtttgtgga 7620agcggtattc
gcaatatttt agtagctcgt tacagtccgg tgcgtttttg gttttttgaa 7680agtgcgtctt
cagagcgctt ttggttttca aaagcgctct gaagttccta tactttctag 7740agaataggaa
cttcggaata ggaacttcaa agcgtttccg aaaacgagcg cttccgaaaa 7800tgcaacgcga
gctgcgcaca tacagctcac tgttcacgtc gcacctatat ctgcgtgttg 7860cctgtatata
tatatacatg agaagaacgg catagtgcgt gtttatgctt aaatgcgtac 7920ttatatgcgt
ctatttatgt aggatgaaag gtagtctagt acctcctgtg atattatccc 7980attccatgcg
gggtatcgta tgcttccttc agcactaccc tttagctgtt ctatatgctg 8040ccactcctca
attggattag tctcatcctt caatgctatc atttcctttg atattggatc 8100atctaagaaa
ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc 8160tttcgtc
8167139598DNAArtificial SequenceSynthetic polynucleotide 13tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accatatcga
ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc 240accattatgg
gaaatgcttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca 300ttgagtgttt
tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat 360taggaatcgt
agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc 420ttgtcaatat
taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc 480aatttgctta
cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt 540agattgcgta
tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg 600tttctattat
gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct 660ttttaagcaa
ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg 720ttggaaccac
ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct 780tcaatggcct
taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac 840aagatagtgg
cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat 900ggttcgtaca
aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc 960aacaaaccca
aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg 1020ttgctggtga
ttataatacc atttaggtgg gttgggttct taactaggat catggcggca 1080gaatcaatca
attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc 1140acagtttttc
tccataatct tgaagaggcc aaaagattag ctttatccaa ggaccaaata 1200ggcaatggtg
gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact 1260tctggaacgg
tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc 1320ttaccaaagt
aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca 1380aattgtggct
tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt 1440aagttggcgt
acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca 1500ctaccggtac
cccatttagg accagccaca gcacctaaca aaacggcatc aaccttcttg 1560gaggcttcca
gcgcctcatc tggaagtggg acacctgtag catcgatagc agcaccacca 1620attaaatgat
tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga 1680accttaatgg
cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc 1740ttcttagggg
cagacatagg ggcagacatt agaatggtat atccttgaaa tatatatata 1800tattgctgaa
atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat 1860tggaaaaaac
aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat 1920ttagtcatga
acgcttctct attctatatg aaaagccggt tccggcctct cacctttcct 1980ttttctccca
atttttcagt tgaaaaaggt atatgcgtca ggcgacctct gaaattaaca 2040aaaaatttcc
agtcatcgaa tttgattctg tgcgatagcg cccctgtgtg ttctcgttat 2100gttgaggaaa
aaaataatgg ttgctaagag attcgaactc ttgcatctta cgatacctga 2160gtattcccac
agttaactgc ggtcaagata tttcttgaat caggcgcctt agaccgctcg 2220gccaaacaac
caattacttg ttgagaaata gagtataatt atcctataaa tataacgttt 2280ttgaacacac
atgaacaagg aagtacagga caattgattt tgaagagaat gtggattttg 2340atgtaattgt
tgggattcca tttttaataa ggcaataata ttaggtatgt ggatatacta 2400gaagttctcc
tcgaccgtcg atatgcggtg tgaaataccg cacagatgcg taaggagaaa 2460ataccgcatc
aggaaattgt aaacgttaat attttgttaa aattcgcgtt aaatttttgt 2520taaatcagct
cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa 2580gaatagaccg
agatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag 2640aacgtggact
ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt 2700gaaccatcac
cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact aaatcggaac 2760cctaaaggga
gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag 2820gaagggaaga
aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg 2880cgcgtaacca
ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc gcgccattcg 2940ccattcaggc
tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc 3000cagctggcga
aagggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc 3060cagtcacgac
gttgtaaaac gacggccagt gagcgcgcgt aatacgactc actatagggc 3120gaattgggta
ccggccgcaa attaaagcct tcgagcgtcc caaaaccttc tcaagcaagg 3180ttttcagtat
aatgttacat gcgtacacgc gtctgtacag aaaaaaaaga aaaatttgaa 3240atataaataa
cgttcttaat actaacataa ctataaaaaa ataaataggg acctagactt 3300caggttgtct
aactccttcc ttttcggtta gagcggatgt ggggggaggg cgtgaatgta 3360agcgtgacat
aactaattac atgactcgag cggccgcgga tccttaaccc cccagtttcg 3420atttatcgcg
caccgcgcct ttgtcggcgc tggttgccag gctggcataa gcacgcaggg 3480caaaggagac
ctgacgttca cgatttttcg gcgtccaggc tttgtcacct cgagcgtcct 3540gcgcttcacg
acgcgccgcc agttcggcat cgcttacctg taactgaatg ccacggttcg 3600ggatgtcgat
agcgatcagg tcaccatctt caatcaggcc aatgctgccg ccgcttgccg 3660cttccggtga
gacgtggccg atggaaagac cagaggtgcc accagagaaa cgaccgtcgg 3720tgatcagcgc
acaggctttg ccgagaccca ttgatttcag gaagctggtt gggtagagca 3780tttcctgcat
ccccggaccg cctttcgggc cttcatagcg aattactacc acatctccgg 3840cgacaacttt
accgccgaga atcgcttcta ccgcatcgtc ctggctttcg tacactttcg 3900ccgggccggt
gaatttgagg atgctgtcat cgacgcctgc cgttttcacg atgcagccgt 3960tttccgcaaa
gttaccgtag agcaccgcca ggccgccgtc tttgctgtag gcgtgttcca 4020gcgagcggat
acagccattg gcgcgatcgt cgtccagcgt atcccaacgg caatcttgcg 4080agaatgcctg
tgtggtacga atgcctgcag gacctgcgcg gaacatattt tttaccgcgt 4140catcctgggt
cagcataacg tcgtattgtt ccagcgtttg cggcaacgtc aggccaagta 4200cgtttttcac
atcacggttc agtaaccccg cgcgatccag ttcgccgaga ataccgataa 4260caccaccagc
acggtgaaca tcttccatat ggtatttctg ggtgctcggc gcaactttac 4320acagctgtgg
aaccttgcgg gaaagcttat cgatatcact catggtgaag tcgatttccg 4380cttcctgcgc
cgccgccagc aggtgaagta cggtgttagt cgatccaccc atcgcgatat 4440ccagcgtcat
ggcgttttca aacgccgcct tactggcgat attacgcggc agtgcacttt 4500cgtcgttttg
ctcgtaataa cgtttggtca attcaacaat gcgtttacca gcattaagga 4560acagctgctt
acggtcggcg tgggttgcca gcagcgagcc gttgcccggc tgcgacaggc 4620ccagcgcttc
ggtcaggcag ttcattgagt tagcggtaaa catcccggag caggaaccgc 4680aggtcggaca
cgcggaacgt tcaacctgat cgctctggga gtcagatact ttcgggtctg 4740cgccctggat
catcgcatca accagatcga gcttgatgat ctgatcggaa agtttggttt 4800tcccggcctc
catcgggccg ccggaaacaa agatcaccgg aatattcagg cgcagggaag 4860ccatcagcat
ccccggggtg attttgtcgc agttagagat gcagaccatg gcgtcggcgc 4920agtgggcgtt
gaccatatac tcaacggaat cagcgatcag ttcgcgagat ggcagtgaat 4980aaagcatccc
cccgtggccc atggcaatcc catcatccac cgcaatggtg ttgaactctt 5040tggcaacgcc
gccagccgct tcaatttgtt cggcgaccag tttaccgaga tcgcgcagat 5100ggacgtgacc
cggtacaaat tgggtgaacg agttcacaac cgcgataatc ggcttaccga 5160aatcggcgtc
ggtcattccg gtggcgcgcc acagcgcacg agcacccgcc atattacgac 5220catgagtggt
ggtggcggaa cggtacttag gcatgtcgac accatcttct tctgagatga 5280gtttttgttc
catgctagtt ctagaatccg tcgaaactaa gttctggtgt tttaaaacta 5340aaaaaaagac
taactataaa agtagaattt aagaagttta agaaatagat ttacagaatt 5400acaatcaata
cctaccgtct ttatatactt attagtcaag taggggaata atttcaggga 5460actggtttca
accttttttt tcagcttttt ccaaatcaga gagagcagaa ggtaatagaa 5520ggtgtaagaa
aatgagatag atacatgcgt gggtcaattg ccttgtgtca tcatttactc 5580caggcaggtt
gcatcactcc attgaggttg tgcccgtttt ttgcctgttt gtgcccctgt 5640tctctgtagt
tgcgctaaga gaatggacct atgaactgat ggttggtgaa gaaaacaata 5700ttttggtgct
gggattcttt ttttttctgg atgccagctt aaaaagcggg ctccattata 5760tttagtggat
gccaggaata aactgttcac ccagacacct acgatgttat atattctgtg 5820taacccgccc
cctattttgg gcatgtacgg gttacagcag aattaaaagg ctaatttttt 5880gactaaataa
agttaggaaa atcactacta ttaattattt acgtattctt tgaaatggcg 5940agtattgata
atgataaact gagctagatc tgggcccgag ctccagcttt tgttcccttt 6000agtgagggtt
aattgcgcgc ttggcgtaat catggtcata gctgtttcct gtgtgaaatt 6060gttatccgct
cacaattcca cacaacatag gagccggaag cataaagtgt aaagcctggg 6120gtgcctaatg
agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt 6180cgggaaacct
gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt 6240tgcgtattgg
gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc 6300tgcggcgagc
ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg 6360ataacgcagg
aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg 6420ccgcgttgct
ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 6480gctcaagtca
gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 6540gaagctccct
cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 6600ttctcccttc
gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 6660tgtaggtcgt
tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 6720gcgccttatc
cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 6780tggcagcagc
cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 6840tcttgaagtg
gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc 6900tgctgaagcc
agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 6960ccgctggtag
cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat 7020ctcaagaaga
tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac 7080gttaagggat
tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt 7140aaaaatgaag
ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc 7200aatgcttaat
cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg 7260cctgactccc
cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg 7320ctgcaatgat
accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc 7380cagccggaag
ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta 7440ttaattgttg
ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg 7500ttgccattgc
tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct 7560ccggttccca
acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta 7620gctccttcgg
tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg 7680ttatggcagc
actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga 7740ctggtgagta
ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt 7800gcccggcgtc
aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca 7860ttggaaaacg
ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt 7920cgatgtaacc
cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt 7980ctgggtgagc
aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga 8040aatgttgaat
actcatactc ttcctttttc aatattattg aagcatttat cagggttatt 8100gtctcatgag
cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc 8160gcacatttcc
ccgaaaagtg ccacctgaac gaagcatctg tgcttcattt tgtagaacaa 8220aaatgcaacg
cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa 8280cagaaatgca
acgcgaaagc gctattttac caacgaagaa tctgtgcttc atttttgtaa 8340aacaaaaatg
caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta 8400cagaacagaa
atgcaacgcg agagcgctat tttaccaaca aagaatctat acttcttttt 8460tgttctacaa
aaatgcatcc cgagagcgct atttttctaa caaagcatct tagattactt 8520tttttctcct
ttgtgcgctc tataatgcag tctcttgata actttttgca ctgtaggtcc 8580gttaaggtta
gaagaaggct actttggtgt ctattttctc ttccataaaa aaagcctgac 8640tccacttccc
gcgtttactg attactagcg aagctgcggg tgcatttttt caagataaag 8700gcatccccga
ttatattcta taccgatgtg gattgcgcat actttgtgaa cagaaagtga 8760tagcgttgat
gattcttcat tggtcagaaa attatgaacg gtttcttcta ttttgtctct 8820atatactacg
tataggaaat gtttacattt tcgtattgtt ttcgattcac tctatgaata 8880gttcttacta
caattttttt gtctaaagag taatactaga gataaacata aaaaatgtag 8940aggtcgagtt
tagatgcaag ttcaaggagc gaaaggtgga tgggtaggtt atatagggat 9000atagcacaga
gatatatagc aaagagatac ttttgagcaa tgtttgtgga agcggtattc 9060gcaatatttt
agtagctcgt tacagtccgg tgcgtttttg gttttttgaa agtgcgtctt 9120cagagcgctt
ttggttttca aaagcgctct gaagttccta tactttctag agaataggaa 9180cttcggaata
ggaacttcaa agcgtttccg aaaacgagcg cttccgaaaa tgcaacgcga 9240gctgcgcaca
tacagctcac tgttcacgtc gcacctatat ctgcgtgttg cctgtatata 9300tatatacatg
agaagaacgg catagtgcgt gtttatgctt aaatgcgtac ttatatgcgt 9360ctatttatgt
aggatgaaag gtagtctagt acctcctgtg atattatccc attccatgcg 9420gggtatcgta
tgcttccttc agcactaccc tttagctgtt ctatatgctg ccactcctca 9480attggattag
tctcatcctt caatgctatc atttcctttg atattggatc atactaagaa 9540accattatta
tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtc
9598148698DNAArtificial SequenceSynthetic polynucleotide 14ctgattggaa
agaccattct gctttacttt tagagcatct tggtcttctg agctcattat 60acctcaatca
aaactgaaat taggtgcctg tcacggctct ttttttactg tacctgtgac 120ttcctttctt
atttccaagg atgctcatca caatacgctt ctagatctat tatgcattat 180aattaatagt
tgtagctaca aaaggtaaaa gaaagtccgg ggcaggcaac aatagaaatc 240ggcaaaaaaa
actacagaaa tactaagagc ttcttcccca ttcagtcatc gcatttcgaa 300acaagagggg
aatggctctg gctagggaac taaccaccat cgcctgactc tatgcactaa 360ccacgtgact
acatatatgt gatcgttttt aacatttttc aaaggctgtg tgtctggctg 420tttccattaa
ttttcactga ttaagcagtc atattgaatc tgagctcatc accaacaaga 480aatactaccg
taaaagtgta aaagttcgtt taaatcattt gtaaactgga acagcaagag 540gaagtatcat
cagctagccc cataaactaa tcaaaggagg atgtctacta agagttactc 600ggaaagagca
gctgctcata gaagtccagt tgctgccaag cttttaaact tgatggaaga 660gaagaagtca
aacttatgtg cttctcttga tgttcgtaaa acagcagagt tgttaagatt 720agttgaggtt
ttgggtccat atatctgtct attgaagaca catgtagata tcttggagga 780tttcagcttt
gagaatacca ttgtgccgtt gaagcaatta gcagagaaac acaagttttt 840gatatttgaa
gacaggaagt ttgccgacat tgggaacact gttaaattac aatacacgtc 900tggtgtatac
cgtatcgccg aatggtctga tatcaccaat gcacacggtg tgactggtgc 960gggcattgtt
gctggtttga agcaaggtgc cgaggaagtt acgaaagaac ctagagggtt 1020gttaatgctt
gccgagttat cgtccaaggg gtctctagcg cacggtgaat acactcgtgg 1080gaccgtggaa
attgccaaga gtgataagga ctttgttatt ggatttattg ctcaaaacga 1140tatgggtgga
agagaagagg gctacgattg gttgatcatg acgccaggtg ttggtcttga 1200tgacaaaggt
gatgctttgg gacaacaata cagaactgtg gatgaagttg ttgccggtgg 1260atcagacatc
attattgttg gtagaggtct tttcgcaaag ggaagagatc ctgtagtgga 1320aggtgagaga
tacagaaagg cgggatggga cgcttacttg aagagagtag gcagatccgc 1380ttaagagttc
tccgagaaca agcagaggtt cgagtgtact cggatcagaa gttacaagtt 1440gatcgtttat
atataaacta tacagagatg ttagagtgta atggcattgc gtgccggcga 1500tcacagcgga
cggtggtggc atgatggggc ttgcgatgct atgtttgttt gttttgtgat 1560gatgtatatt
attattgaaa aacgatatca gacatttgtc tgataatgct tcattatcag 1620acaaatgtct
gatatcgttt ggagaaaaag aaaaggaaaa caaactaaat atctactata 1680taccactgta
ttttatacta atgactttct acgcctagtg tcaccctctc gtgtacccat 1740tgaccctgta
tcggcgcgtt gcctcgcgtt cctgtaccat atatttttgt ttatttaggt 1800attaaaattt
actttcctca tacaaatatt aaattcacca aacttctcaa aaactaatta 1860ttcgtagtta
caaactctat tttacaatca cgtttattca accattctac atccaataac 1920caaaatgccc
atgtacctct cagcgaagtc caacggtact gtccaatatt ctcattaaat 1980agtctttcat
ctatatatca gaaggtaatt ataattagag atttcgaatc attaccgtgc 2040cgattcgcac
gctgcaacgg catgcatcac taatgaaaag catacgacgc ctgcgtctga 2100catgcactca
ttctgaagaa gattctgggc gcgtttcgtt ctcgttttcc tctgtatatt 2160gtactctggt
ggacaatttg aacataacgt ctttcacctc gccattctca ataatgggtt 2220ccaattctat
ccaggtagcg gttaattgac ggtgcttaag ccgtatgctc actctaacgc 2280taccgttgtc
caaacaacgg acccctttgt gacgggtgta agacccatca tgaagtaaaa 2340catctctaac
ggtatggaaa agagtggtac ggtcaagttt cctggcacga gtcaattttc 2400cctcttcgtg
tagatcggta ccggccgcaa attaaagcct tcgagcgtcc caaaaccttc 2460tcaagcaagg
ttttcagtat aatgttacat gcgtacacgc gtctgtacag aaaaaaaaga 2520aaaatttgaa
atataaataa cgttcttaat actaacataa ctataaaaaa ataaataggg 2580acctagactt
caggttgtct aactccttcc ttttcggtta gagcggatgt ggggggaggg 2640cgtgaatgta
agcgtgacat aactaattac atgagcggcc gcctatttat ggaatttctt 2700atcataatcg
accaaagtaa atctgtattt gacgtctccg ctttccatcc ttgtaaaggc 2760atggctgacg
ccttcttcgc tgatcggaag tttttccacc catattttga cattcttttc 2820ggaaactaat
ttcaatagtt gttcgatttc cttcctagat ccgatagcac tgcttgagat 2880tgatactccc
attaggccca acggttttaa aacaagcttt tcattaactt caggagcagc 2940aattgaaacg
atggagcctc caatcttcat aatcttaacg atactgtcaa aattaacttt 3000cgacaaagat
gatgagcaaa cgacaagaag gtccaaagcg ttagagtatt gttctgtcca 3060gcctttatcc
tccaacatag caatatagtg atcagcaccg agtttcatag aatcctcccg 3120cttggagtgg
cctcgcgaaa acgcataaac ctcggctccc atagctttag ccaacagaat 3180ccccatatgc
ccaataccac cgatgccaac aatacctacc ctcttacctg gaccacagcc 3240atttcttagt
agtggagaga aaactgtaat accaccacac aataatggag cggctagcgg 3300acttggaata
ttttctggta tttgaatagc aaagtgttca tgaagcctca cgtgggaggc 3360aaagcctcct
tgtgaaatgt agccgtcctt gtaaggagtc cacatagtca aaacgtggtc 3420attggtacag
tattgctcgt tgtcactttt gcaacgttca cactcaaaac acgccaaggc 3480ttgggcacca
acaccaacac ggtcaccgat ttttacccca gtgtggcact tggatccaac 3540cttcaccacg
cggccaatta tttcatgtcc aaggatttga ttttctggga ctggacccca 3600attaccaacg
gctatatgaa aatcagatcc gcagatacca caggcttcaa tttcaacatc 3660aacgtcatga
tcgccaaagg gttttgggtc aaaactcact aatttaggat gcttccaatc 3720ctttgcgttg
gaaataccga tgccctgaaa tttttctggg taaagcatgt cgagtcgaaa 3780ctaagttctg
gtgttttaaa actaaaaaaa agactaacta taaaagtaga atttaagaag 3840tttaagaaat
agatttacag aattacaatc aatacctacc gtctttatat acttattagt 3900caagtagggg
aataatttca gggaactggt ttcaaccttt tttttcagct ttttccaaat 3960cagagagagc
agaaggtaat agaaggtgta agaaaatgag atagatacat gcgtgggtca 4020attgccttgt
gtcatcattt actccaggca ggttgcatca ctccattgag gttgtgcccg 4080ttttttgcct
gtttgtgccc ctgttctctg tagttgcgct aagagaatgg acctatgaac 4140tgatggttgg
tgaagaaaac aatattttgg tgctgggatt cttttttttt ctggatgcca 4200gcttaaaaag
cgggctccat tatatttagt ggatgccagg aataaactgt tcacccagac 4260acctacgatg
ttatatattc tgtgtaaccc gccccctatt ttgggcatgt acgggttaca 4320gcagaattaa
aaggctaatt ttttgactaa ataaagttag gaaaatcact actattaatt 4380atttacgtat
tctttgaaat ggcgagtatt gataatgata aactggatcc ttaggattta 4440ttctgttcag
caaacagctt gcccattttc ttcagtacct tcggtgcgcc ttctttcgcc 4500aggatcagtt
cgatccagta catacggttc ggatcggcct gggcctcttt catcacgctc 4560acaaattcgt
tttcggtacg cacaatttta gacacaacac ggtcctcagt tgcgccgaag 4620gactccggca
gtttagagta gttccacata gggatatcgt tgtaagactg gttcggaccg 4680tggatctcac
gctcaacggt gtagccgtca ttgttaataa tgaagcaaat cgggttgatc 4740ttttcacgaa
ttgccagacc cagttcctgt acggtcagct gcagggaacc gtcaccgatg 4800aacagcagat
gacgagattc tttatcagcg atctgagagc ccagcgctgc cgggaaagta 4860tagccaatgc
taccccacag cggctgaccg ataaaatggc ttttggattt cagaaagata 4920gaagacgcgc
cgaaaaagct cgtaccttgt tccgccacga tggtttcatt gctctgggtc 4980aggttctcca
cggcctgcca caggcgatcc tgggacagca gtgcgttaga tggtacgaaa 5040tcttcttgct
ttttgtcaat gtatttgcct ttatactcga tttcggacag gtccagcaga 5100gagctgatca
ggctttcgaa gtcgaagttc tggatacgct cgttgaagat tttaccctcg 5160tcgatgttca
ggctaatcat tttgttttcg ttcagatggt gagtgaatgc accggtagaa 5220gagtcggtca
gtttaacgcc cagcatcagg atgaagtccg cagattcaac aaattctttc 5280aggttcggtt
cgctcagagt accgttgtag atgcccagga aagacggcag agcctcgtca 5340acagaggact
tgccgaagtt cagggtggta atcggcagtt tggttttgct gatgaattgg 5400gtcacggtct
tctccagacc aaaagaaatg atttcgtggc cggtgatcac gattggtttc 5460tttgcgtttt
tcagagactc ctggattttg ttcaggattt cctggtcgct agtgttagaa 5520gtggagtttt
ctttcttcag cggcaggctc ggtttttccg ctttagctgc cgcaacatcc 5580acaggcaggt
tgatgtaaac tggtttgcgt tctttcagca gcgcagacag aacgcggtcg 5640atttccacag
tagcgttctc tgcagtcagc agcgtacgtg ccgcagtcac aggttcatgc 5700attttcatga
agtgtttgaa atcgccgtca gccagagtgt ggtggacgaa tttaccttcg 5760ttctgaactt
tgctcgttgg gctgcctacg atctccacca ccggcaggtt ttcggcgtag 5820gagcccgcca
gaccgttgac ggcgctcagt tcgccaacac cgaaagtggt cagaaatgcc 5880gcggctttct
tggtacgtgc ataaccatct gccatgtagc ttgcgttcag ttcgttagcg 5940ttacccaccc
atttcatgtc tttatgagag atgatctgat ccaggaactg cagattgtaa 6000tcacccggaa
cgccgaagat ttcttcgata cccagttcat gcagacggtc cagcagataa 6060tcaccaacag
tatacatgtc gacaaactta gattagattg ctatgctttc tttctaatga 6120gcaagaagta
aaaaaagttg taatagaaca agaaaaatga aactgaaact tgagaaattg 6180aagaccgttt
attaacttaa atatcaatgg gaggtcatcg aaagagaaaa aaatcaaaaa 6240aaaaattttc
aagaaaaaga aacgtgataa aaatttttat tgcctttttc gacgaagaaa 6300aagaaacgag
gcggtctctt ttttcttttc caaaccttta gtacgggtaa ttaacgacac 6360cctagaggaa
gaaagagggg aaatttagta tgctgtgctt gggtgttttg aagtggtacg 6420gcgatgcgcg
gagtccgaga aaatctggaa gagtaaaaaa ggagtagaaa cattttgaag 6480ctatgagctc
cagcttttgt tccctttagt gagggttaat tgcgcgcttg gcgtaatcat 6540ggtcatagct
gtttcctgtg tgaaattgtt atccgctcac aattccacac aacataggag 6600ccggaagcat
aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc acattaattg 6660cgttgcgctc
actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa 6720tcggccaacg
cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca 6780ctgactcgct
gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 6840taatacggtt
atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 6900agcaaaaggc
caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 6960cccctgacga
gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 7020tataaagata
ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 7080tgccgcttac
cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 7140gctcacgctg
taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 7200acgaaccccc
cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 7260acccggtaag
acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 7320cgaggtatgt
aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 7380gaaggacagt
atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 7440gtagctcttg
atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 7500agcagattac
gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 7560ctgacgctca
gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 7620ggatcttcac
ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 7680atgagtaaac
ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 7740tctgtctatt
tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 7800gggagggctt
accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 7860ctccagattt
atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 7920caactttatc
cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 7980cgccagttaa
tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 8040cgtcgtttgg
tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 8100cccccatgtt
gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 8160agttggccgc
agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 8220tgccatccgt
aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 8280agtgtatgcg
gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 8340atagcagaac
tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 8400ggatcttacc
gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 8460cagcatcttt
tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 8520caaaaaaggg
aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 8580attattgaag
catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt 8640agaaaaataa
acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgt
8698156012DNAArtificial SequenceSynthetic polynucleotide 15caggcaagtg
cacaaacaat acttaaataa atactactca gtaataacct atttcttagc 60atttttgacg
aaatttgcta ttttgttaga gtcttttaca ccatttgtct ccacacctcc 120gcttacatca
acaccaataa cgccatttaa tctaagcgca tcaccaacat tttctggcgt 180cagtccacca
gctaacataa aatgtaagct ttcggggctc tcttgccttc caacccagtc 240agaaatcgag
ttccaatcca aaagttcacc tgtcccacct gcttctgaat caaacaaggg 300aataaacgaa
tgaggtttct gtgaagctgc actgagtagt atgttgcagt cttttggaaa 360tacgagtctt
ttaataactg gcaaaccgag gaactcttgg tattcttgcc acgactcatc 420tccatgcagt
tggacgatat caatgccgta atcattgacc agagccaaaa catcctcctt 480aggttgatta
cgaaacacgc caaccaagta tttcggagtg cctgaactat ttttatatgc 540ttttacaaga
cttgaaattt tccttgcaat aaccgggtca attgttctct ttctattggg 600cacacatata
atacccagca agtcagcatc ggaatctaga gcacattctg cggcctctgt 660gctctgcaag
ccgcaaactt tcaccaatgg accagaacta cctgtgaaat taataacaga 720catactccaa
gctgcctttg tgtgcttaat cacgtatact cacgtgctca atagtcacca 780atgccctccc
tcttggccct ctccttttct tttttcgacc gaattaattc ttaatcggca 840aaaaaagaaa
agctccggat caagattgta cgtaaggtga caagctattt ttcaataaag 900aatatcttcc
actactgcca tctggcgtca taactgcaaa gtacacatat attacgatgc 960tgtctattaa
atgcttccta tattatatat atagtaatgt cgttgacgtc gccggcgaac 1020gtggcgagaa
aggaagggaa gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta 1080gcggtcacgc
tgcgcgtaac caccacaccc gccgcgctta atgcgccgct acagggcgcg 1140tcgcgccatt
cgccattcag gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct 1200tcgctattac
gccagctggc gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg 1260ccagggtttt
cccagtcacg acgttgtaaa acgacggcca gtgagcgcgc gtaatacgac 1320tcactatagg
gcgaattggg taccggccgc aaattaaagc cttcgagcgt cccaaaacct 1380tctcaagcaa
ggttttcagt ataatgttac atgcgtacac gcgtctgtac agaaaaaaaa 1440gaaaaatttg
aaatataaat aacgttctta atactaacat aactataaaa aaataaatag 1500ggacctagac
ttcaggttgt ctaactcctt ccttttcggt tagagcggat gtggggggag 1560ggcgtgaatg
taagcgtgac ataactaatt acatgactcg agcggccgcg gatccctaga 1620gagctttcgt
tttcatgagt tccccgaatt ctttcggaag cttgtcactt gctaaattaa 1680cgttatcact
gtagtcaacc gggacatcaa tgatgacagg cccctcagcg ttcatgcctt 1740gacgcagaac
atctgccagc tggtctggtg attctacgcg taagccagtt gctccgaagc 1800tttccgcgta
tttcacgata tcgatatttc cgaaatcgac cgcagatgta cgattatatt 1860ttttcaattg
ctggaatgca accatgtcat atgtgctgtc gttccataca atgtgtacaa 1920ttggtgcttt
taaacgaact gctgtctcta attccatagc tgagaataag aaaccgccat 1980caccggagac
tgatactact ttttctcccg gtttcaccaa tgaagcgccg attgcccaag 2040gaagcgcaac
gccgagtgtt tgcataccgt tactaatcat taatgttaac ggctcgtagc 2100tgcggaaata
acgtgacatc caaatcgcgt gtgaaccgat atcgcaagtc actgtaacat 2160gatcatcgac
tgcgtttcgc aattctttaa cgatttcaag aggatgcact ctgtctgatt 2220tccaatctgc
aggcacctgc tcaccctcat gcatatattg ttttaaatca gaaaggatct 2280tctgctcacg
ttccgcaaag tctactttca cagcatcgtg ttcgatatga ttgatcgtag 2340atggaatatc
accgatcagt tcaagatccg gctggtaagc atgatcaatg tcagccagaa 2400tctcgtctaa
atggatgatc gtccggtctc cattgacatt ccagaatttc ggatcatatt 2460caattgggtc
atagccgatt gtcagaacaa catcagcctg ctcaagcagc agatcgccag 2520gctggttgcg
gaataaaccg atccggccaa aatactgatc ctctaaatct ctcgtaagag 2580taccggcagc
ttgatatgtt tcaacgaatg gaagctgcac ttttttcaat agcttgcgaa 2640ccgctttaat
cgcttccggt cttccgccct tcatgccgac taaaacgaca ggaagttttg 2700ctgtttgaat
ttttgcaatg gccatactga ttgcgtcatc tgctgcggga ccaagttttg 2760gcgctgcgac
agcacgtacg ttttttgtat ttgtgacttc attcacaaca tcttgcggaa 2820aactcacaaa
agcggcccca gcctgccctg ctgacgctat cctaaacgca tttgtaacag 2880cttccggtat
attttttaca tcttgaactt ctacactgta ttttgtaatc ggctggaata 2940gcgccgcatt
atccaaagat tgatgtgtcc gttttaaacg atctgcacgg atcacgttcc 3000cagcaagcgc
aacgacaggg tcaccttcag tgtttgctgt cagcagtcct gttgccaagt 3060tcgaagcacc
tggtcctgat gtgactaaca cgactcccgg ttttccagtt aaacggccga 3120ctgcttgcgc
cataaatgct gcattttgtt catgccgggc aacgataatt tcaggccctt 3180tatcttgtaa
agcgtcaaat accgcatcaa tttttgcacc tggaatgcca aatacatgtg 3240tgacaccttg
ctccgctaag caatcaacaa caagctccgc ccctctgctt ttcacaaggg 3300atttttgttc
ttttgttgct tttgtcaaca tgtcgacttt atgtgatgat tgattgattg 3360attgtacagt
ttgtttttct taatatctat ttcgatgact tctatatgat attgcactaa 3420caagaagata
ttataatgca attgatacaa gacaaggagt tatttgcttc tcttttatat 3480gattctgaca
atccatattg cgttggtagt cttttttgct ggaacggttc agcggaaaag 3540acgcatcgct
ctttttgctt ctagaagaaa tgccagcaaa agaatctctt gacagtgact 3600gacagcaaaa
atgtcttttt ctaactagta acaaggctaa gatatcagcc tgaaataaag 3660ggtggtgaag
taataattaa atcatccgta taaacctata cacatatatg aggaaaaata 3720atacaaaagt
gttttaaata cagatacata catgaacata tgcacgtata gcgcccaaat 3780gtcggtaatg
ggatcggcga gctccagctt ttgttccctt tagtgagggt taattgcgcg 3840cttggcgtaa
tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 3900acacaacata
ggagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgaggta 3960actcacatta
attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 4020gctgcattaa
tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 4080cgcttcctcg
ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 4140tcactcaaag
gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 4200gtgagcaaaa
ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 4260ccataggctc
cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 4320aaacccgaca
ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 4380tcctgttccg
accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 4440ggcgctttct
catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 4500gctgggctgt
gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 4560tcgtcttgag
tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 4620caggattagc
agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 4680ctacggctac
actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt 4740cggaaaaaga
gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt 4800ttttgtttgc
aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 4860cttttctacg
gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 4920gagattatca
aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc 4980aatctaaagt
atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc 5040acctatctca
gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta 5100gataactacg
atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga 5160cccacgctca
ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg 5220cagaagtggt
cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc 5280tagagtaagt
agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat 5340cgtggtgtca
cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag 5400gcgagttaca
tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 5460cgttgtcaga
agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa 5520ttctcttact
gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa 5580gtcattctga
gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga 5640taataccgcg
ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg 5700gcgaaaactc
tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc 5760acccaactga
tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg 5820aaggcaaaat
gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact 5880cttccttttt
caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat 5940atttgaatgt
atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt 6000gccacctgac
gt
6012168969DNAArtificial SequenceSynthetic polynucleotide 16ccagttaact
gtgggaatac tcaggtatcg taagatgcaa gagttcgaat ctcttagcaa 60ccattatttt
tttcctcaac ataacgagaa cacacagggg cgctatcgca cagaatcaaa 120ttcgatgact
ggaaattttt tgttaatttc agaggtcgcc tgacgcatat acctttttca 180actgaaaaat
tgggagaaaa aggaaaggtg agagcgccgg aaccggcttt tcatatagaa 240tagagaagcg
ttcatgacta aatgcttgca tcacaatact tgaagttgac aatattattt 300aaggacctat
tgttttttcc aataggtggt tagcaatcgt cttactttct aacttttctt 360accttttaca
tttcagcaat atatatatat atatttcaag gatataccat tctaatgtct 420gcccctaaga
agatcgtcgt tttgccaggt gaccacgttg gtcaagaaat cacagccgaa 480gccattaagg
ttcttaaagc tatttctgat gttcgttcca atgtcaagtt cgatttcgaa 540aatcatttaa
ttggtggtgc tgctatcgat gctacaggtg ttccacttcc agatgaggcg 600ctggaagcct
ccaagaaggc tgatgccgtt ttgttaggtg ctgtgggtgg tcctaaatgg 660ggtaccggta
gtgttagacc tgaacaaggt ttactaaaaa tccgtaaaga acttcaattg 720tacgccaact
taagaccatg taactttgca tccgactctc ttttagactt atctccaatc 780aagccacaat
ttgctaaagg tactgacttc gttgttgtca gagaattagt gggaggtatt 840tactttggta
agagaaagga agacgatggt gatggtgtcg cttgggatag tgaacaatac 900accgttccag
aagtgcaaag aatcacaaga atggccgctt tcatggccct acaacatgag 960ccaccattgc
ctatttggtc cttggataaa gctaatgttt tggcctcttc aagattatgg 1020agaaaaactg
tggaggaaac catcaagaac gaattcccta cattgaaggt tcaacatcaa 1080ttgattgatt
ctgccgccat gatcctagtt aagaacccaa cccacctaaa tggtattata 1140atcaccagca
acatgtttgg tgatatcatc tccgatgaag cctccgttat cccaggttcc 1200ttgggtttgt
tgccatctgc gtccttggcc tctttgccag acaagaacac cgcatttggt 1260ttgtacgaac
catgccacgg ttctgctcca gatttgccaa agaataaggt caaccctatc 1320gccactatct
tgtctgctgc aatgatgttg aaattgtcat tgaacttgcc tgaagaaggt 1380aaggccattg
aagatgcagt taaaaaggtt ttggatgcag gtatcagaac tggtgattta 1440ggtggttcca
acagtaccac cgaagtcggt gatgctgtcg ccgaagaagt taagaaaatc 1500cttgcttaaa
aagattctct ttttttatga tatttgtaca taaactttat aaatgaaatt 1560cataatagaa
acgacacgaa attacaaaat ggaatatgtt catagggtag acgaaactat 1620atacgcaatc
tacatacatt tatcaagaag gagaaaaagg aggatgtaaa ggaatacagg 1680taagcaaatt
gatactaatg gctcaacgtg ataaggaaaa agaattgcac tttaacatta 1740atattgacaa
ggaggagggc accacacaaa aagttaggtg taacagaaaa tcatgaaact 1800atgattccta
atttatatat tggaggattt tctctaaaaa aaaaaaaata caacaaataa 1860aaaacactca
atgacctgac catttgatgg agttgccggc gaacgtggcg agaaaggaag 1920ggaagaaagc
gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg 1980taaccaccac
acccgccgcg cttaatgcgc cgctacaggg cgcgtcgcgc cattcgccat 2040tcaggctgcg
caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 2100tggcgaaagg
gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 2160cacgacgttg
taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat 2220tgggtaccgg
ccgcaaatta aagccttcga gcgtcccaaa accttctcaa gcaaggtttt 2280cagtataatg
ttacatgcgt acacgcgtct gtacagaaaa aaaagaaaaa tttgaaatat 2340aaataacgtt
cttaatacta acataactat aaaaaaataa atagggacct agacttcagg 2400ttgtctaact
ccttcctttt cggttagagc ggatgtgggg ggagggcgtg aatgtaagcg 2460tgacataact
aattacatga gcggccgcag atctttaacc cgcaacagca atacgtttca 2520tatctgtcat
atagccgcgc agtttcttac ctacctgctc aatcgcatgg ctgcgaatcg 2580cttcgttcac
atcacgcagt tgcccgttat ctaccgcgcc ttccggaata gctttaccca 2640ggtcgcccgg
ttgcagctct gccataaacg gtttcagcaa cggcacacaa gcgtaagaga 2700acagatagtt
accgtactca gcggtatcag agataaccac gttcatttcg tacagacgct 2760tacgggcgat
ggtgttggca atcagcggca gctcgtgcag tgattcataa tatgcagact 2820cttcaatgat
gccggaatcg accatggttt cgaacgccag ttcaacgccc gctttcacca 2880tcgcaatcat
cagtacgcct ttatcgaagt actcctgctc gccgattttg ccttcatact 2940gcggcgcggt
ttcaaacgcg gttttgccgg tctcttcacg ccaggtcagc agtttcttat 3000catcgttggc
ccagtccgcc atcataccgg aagagaattc gccggagatg atgtcgtcca 3060tatgtttctg
gaacaggggt gccatgatct ctttcagctg ttcagaaagc gcataagcac 3120gcagtttcgc
cgggttagag agacggtcca tcatcagggt gatgccgccc tgtttcagtg 3180cttcggtgat
ggtttcccaa ccgaactgaa tcagtttttc tgcgtatgct ggatcggtac 3240cttcttccac
cagcttgtcg aagcacagca gagagccagc ctgcaacata ccgcacagga 3300tggtttgctc
gcccatcagg tcagatttca cttccgcaac gaaggacgat tccagcacac 3360ccgcacggtg
accaccggtt gcagccgccc aggctttggc aatcgccatg ccttcgcctt 3420tcggatcgtt
ttccgggtga acggcaatca gcgtcggtac gccgaaccca cgtttgtact 3480cttcacgcac
ttcggtgcct gggcatttcg gcgcaaccat cactacggtg atatctttac 3540ggatctgctc
gcccacttcg acgatgttga aaccgtgcga gtagcccagc gccgcgccgt 3600ctttcatcag
tggctgtacg gtgcgcacta catcagagtg ctgcttgtcc ggcgtcaggt 3660taatcaccag
atccgcctgt gggatcagtt cttcgtaagt acccacttta aaaccatttt 3720cggtcgcttt
acgccaggac gcgcgcttct cggcaatcgc ttctttacgc agagcgtagg 3780agatatcgag
accagaatca cgcatgttca ggccctggtt cagaccctgt gcgccacagc 3840cgacgatgac
tactttttta ccctgaaggt agctcgcgcc atcggcgaat tcatcgcggc 3900ccatctcgag
tcgaaactaa gttctggtgt tttaaaacta aaaaaaagac taactataaa 3960agtagaattt
aagaagttta agaaatagat ttacagaatt acaatcaata cctaccgtct 4020ttatatactt
attagtcaag taggggaata atttcaggga actggtttca accttttttt 4080tcagcttttt
ccaaatcaga gagagcagaa ggtaatagaa ggtgtaagaa aatgagatag 4140atacatgcgt
gggtcaattg ccttgtgtca tcatttactc caggcaggtt gcatcactcc 4200attgaggttg
tgcccgtttt ttgcctgttt gtgcccctgt tctctgtagt tgcgctaaga 4260gaatggacct
atgaactgat ggttggtgaa gaaaacaata ttttggtgct gggattcttt 4320ttttttctgg
atgccagctt aaaaagcggg ctccattata tttagtggat gccaggaata 4380aactgttcac
ccagacacct acgatgttat atattctgtg taacccgccc cctattttgg 4440gcatgtacgg
gttacagcag aattaaaagg ctaatttttt gactaaataa agttaggaaa 4500atcactacta
ttaattattt acgtattctt tgaaatggcg agtattgata atgataaact 4560ggatcctcat
ccacccaact tcgatttgtc tcttactgcc cccttatcgg ctgaagtagc 4620caatgaagca
taagccctaa gggcgaaact tacttgacgt tctctatttt taggagtcca 4680agccttatct
cctctggcat cttgtgcttc tcttcttgca gccaattcag cgtctgagac 4740ttgtaattgg
atacctctat ttgggatatc tatggcgatc aaatctccat cttcaatcaa 4800tccaatcgaa
ccaccagaag ctgcctctgg tgatacgtga ccgatactta aacccgaagt 4860gccaccagag
aatctaccgt cagtgataag ggcacaagct tttcctagtc ccatggactt 4920caaaaatgaa
gttgggtaaa gcatttcctg catacctggt cctccctttg gtccctcata 4980tcttatcact
accacgtctc ctgctaccac ctttccgcca agtatagcct caacagcatc 5040gtcttgactt
tcgtaaactt tagcgggtcc agtaaatttc aaaatactat catctacacc 5100agcagttttc
acaatgcaac cattttcagc gaagtttcca tataatactg ctaaaccacc 5160atccttacta
taagcatgct caagcgatct tatacatcca tttgctctat catcgtccaa 5220agtgtcccac
ctacagtctt gcgagaatgc ttgggtggtt ctgatccctg ctggacctgc 5280cctgaacatg
tttttcacgg catcatcttg agttaacatg acatcgtatt gctctaatgt 5340ctgtggaagt
gttaaaccca atacattctt cacatccctg tttaaaagac cggctctgtc 5400caactcccct
aaaataccaa taacccctcc tgcacgatga acgtcttcca tgtgatactt 5460ttgagttgat
ggtgcaacct tacataactg tggaacctta cgtgaaagct tgtcgatatc 5520agacatggtg
aaatctatct cagcttcttg ggctgcagct agaagatgta agaccgtgtt 5580tgtactacca
cccattgcaa tatccaatgt catggcattt tcgaatgcag cctttgaagc 5640tatattcctc
ggtaatgctg attcatcatt ttgttcgtaa taccttttcg ttagttccac 5700aattcttttt
ccggcattta agaacaattg ctttctgtct gcatgggtcg ctaataatga 5760accatttcct
ggttgagata aacctagagc ttcagtcaag caattcatag agttagccgt 5820gaacattcca
ctgcaagaac cacaagttgg acatgcactt ctttcaactt ggtctgactg 5880cgagtctgaa
acttttggat ctgcaccttg aatcattgca tccacaagat caagtttgat 5940gatctgatca
cttaacttag ttttaccagc ctccattggg ccgccagata cgaagattac 6000tgggatgttc
aatctcaagg acgccatcaa cataccaggc gttatcttat cacaattaga 6060gatacaaacc
attgcatcgg cacaatgagc attaaccata tattcgactg agtctgcaat 6120taattctctc
gatggtaaag agtataacat accgccatgc cccatagcta taccgtcgtc 6180cacagcaata
gtattaaact cttttgcgac accacctgca gcttcaattt gttcggcaac 6240aagcttacct
agatcacgca aatggacatg acccggaacg aattgtgtaa aagagttgac 6300gacggcaatg
attggctttc cgaaatctgc atcagtcatg ccagtcatgt cgacaaactt 6360agattagatt
gctatgcttt ctttctaatg agcaagaagt aaaaaaagtt gtaatagaac 6420aagaaaaatg
aaactgaaac ttgagaaatt gaagaccgtt tattaactta aatatcaatg 6480ggaggtcatc
gaaagagaaa aaaatcaaaa aaaaaatttt caagaaaaag aaacgtgata 6540aaaattttta
ttgccttttt cgacgaagaa aaagaaacga ggcggtctct tttttctttt 6600ccaaaccttt
agtacgggta attaacgaca ccctagagga agaaagaggg gaaatttagt 6660atgctgtgct
tgggtgtttt gaagtggtac ggcgatgcgc ggagtccgag aaaatctgga 6720agagtaaaaa
aggagtagaa acattttgaa gctatgagct ccagcttttg ttccctttag 6780tgagggttaa
ttgcgcgctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 6840tatccgctca
caattccaca caacatagga gccggaagca taaagtgtaa agcctggggt 6900gcctaatgag
tgaggtaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 6960ggaaacctgt
cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 7020cgtattgggc
gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 7080cggcgagcgg
tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 7140aacgcaggaa
agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 7200gcgttgctgg
cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 7260tcaagtcaga
ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 7320agctccctcg
tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 7380ctcccttcgg
gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 7440taggtcgttc
gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 7500gccttatccg
gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 7560gcagcagcca
ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 7620ttgaagtggt
ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 7680ctgaagccag
ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 7740gctggtagcg
gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 7800caagaagatc
ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt 7860taagggattt
tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa 7920aaatgaagtt
ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa 7980tgcttaatca
gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 8040tgactccccg
tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 8100gcaatgatac
cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 8160gccggaaggg
ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 8220aattgttgcc
gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 8280gccattgcta
caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 8340ggttcccaac
gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 8400tccttcggtc
ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 8460atggcagcac
tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 8520ggtgagtact
caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 8580ccggcgtcaa
tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 8640ggaaaacgtt
cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 8700atgtaaccca
ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 8760gggtgagcaa
aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 8820tgttgaatac
tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 8880ctcatgagcg
gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 8940acatttcccc
gaaaagtgcc acctgacgt
8969175853DNAArtificial SequenceSynthetic polynucleotide 17tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgcgtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgactcg 2340aggtcgacgg
tatcgataag cttgatatcg aattcctgca gcccggggga tccactagtt 2400ctagaatccg
tcgaaactaa gttctggtgt tttaaaacta aaaaaaagac taactataaa 2460agtagaattt
aagaagttta agaaatagat ttacagaatt acaatcaata cctaccgtct 2520ttatatactt
attagtcaag taggggaata atttcaggga actggtttca accttttttt 2580tcagcttttt
ccaaatcaga gagagcagaa ggtaatagaa ggtgtaagaa aatgagatag 2640atacatgcgt
gggtcaattg ccttgtgtca tcatttactc caggcaggtt gcatcactcc 2700attgaggttg
tgcccgtttt ttgcctgttt gtgcccctgt tctctgtagt tgcgctaaga 2760gaatggacct
atgaactgat ggttggtgaa gaaaacaata ttttggtgct gggattcttt 2820ttttttctgg
atgccagctt aaaaagcggg ctccattata tttagtggat gccaggaata 2880aactgttcac
ccagacacct acgatgttat atattctgtg taacccgccc cctattttgg 2940gcatgtacgg
gttacagcag aattaaaagg ctaatttttt gactaaataa agttaggaaa 3000atcactacta
ttaattattt acgtattctt tgaaatggcg agtattgata atgataaact 3060gagctccagc
ttttgttccc tttagtgagg gttaattgcg cgcttggcgt aatcatggtc 3120atagctgttt
cctgtgtgaa attgttatcc gctcacaatt ccacacaaca taggagccgg 3180aagcataaag
tgtaaagcct ggggtgccta atgagtgagg taactcacat taattgcgtt 3240gcgctcactg
cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg 3300ccaacgcgcg
gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 3360ctcgctgcgc
tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 3420acggttatcc
acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 3480aaaggccagg
aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 3540tgacgagcat
cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 3600aagataccag
gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 3660gcttaccgga
tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 3720acgctgtagg
tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 3780accccccgtt
cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 3840ggtaagacac
gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 3900gtatgtaggc
ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 3960gacagtattt
ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 4020ctcttgatcc
ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 4080gattacgcgc
agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 4140cgctcagtgg
aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 4200cttcacctag
atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 4260gtaaacttgg
tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 4320tctatttcgt
tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 4380gggcttacca
tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 4440agatttatca
gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 4500tttatccgcc
tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 4560agttaatagt
ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 4620gtttggtatg
gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 4680catgttgtgc
aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 4740ggccgcagtg
ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 4800atccgtaaga
tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 4860tatgcggcga
ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 4920cagaacttta
aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 4980cttaccgctg
ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 5040atcttttact
ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 5100aaagggaata
agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 5160ttgaagcatt
tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 5220aaataaacaa
ataggggttc cgcgcacatt tccccgaaaa gtgccacctg ggtccttttc 5280atcacgtgct
ataaaaataa ttataattta aattttttaa tataaatata taaattaaaa 5340atagaaagta
aaaaaagaaa ttaaagaaaa aatagttttt gttttccgaa gatgtaaaag 5400actctagggg
gatcgccaac aaatactacc ttttatcttg ctcttcctgc tctcaggtat 5460taatgccgaa
ttgtttcatc ttgtctgtgt agaagaccac acacgaaaat cctgtgattt 5520tacattttac
ttatcgttaa tcgaatgtat atctatttaa tctgcttttc ttgtctaata 5580aatatatatg
taaagtacgc tttttgttga aattttttaa acctttgttt attttttttt 5640cttcattccg
taactcttct accttcttta tttactttct aaaatccaaa tacaaaacat 5700aaaaataaat
aaacacagag taaattccca aattattcca tcattaaaag atacgaggcg 5760cgtgtaagtt
acaggcaagc gatccgtcct aagaaaccat tattatcatg acattaacct 5820ataaaaatag
gcgtatcacg aggccctttc gtc
5853185778DNAArtificial SequenceSynthetic polynucleotide 18tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac
agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg
aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact
tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt
aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac
atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat
gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact
ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt
gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa
ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta
ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt
gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag
aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac
taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca
aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg
tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc
tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa
ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca
gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc
ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa
ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa
tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa
atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact
attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc
actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa
tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc
gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt
cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtcgcg
ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860cctcttcgct
attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920taacgccagg
gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980acgactcact
atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040aaccttctca
agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100aaaaagaaaa
atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160aatagggacc
tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220gggagggcgt
gaatgtaagc gtgacataac taattacatg actcgaggtc gacggtatcg 2280ataagcttga
tatcgaattc ctgcagcccg ggggatccac tagttctaga atccgtcgaa 2340actaagttct
ggtgttttaa aactaaaaaa aagactaact ataaaagtag aatttaagaa 2400gtttaagaaa
tagatttaca gaattacaat caatacctac cgtctttata tacttattag 2460tcaagtaggg
gaataatttc agggaactgg tttcaacctt ttttttcagc tttttccaaa 2520tcagagagag
cagaaggtaa tagaaggtgt aagaaaatga gatagataca tgcgtgggtc 2580aattgccttg
tgtcatcatt tactccaggc aggttgcatc actccattga ggttgtgccc 2640gttttttgcc
tgtttgtgcc cctgttctct gtagttgcgc taagagaatg gacctatgaa 2700ctgatggttg
gtgaagaaaa caatattttg gtgctgggat tctttttttt tctggatgcc 2760agcttaaaaa
gcgggctcca ttatatttag tggatgccag gaataaactg ttcacccaga 2820cacctacgat
gttatatatt ctgtgtaacc cgccccctat tttgggcatg tacgggttac 2880agcagaatta
aaaggctaat tttttgacta aataaagtta ggaaaatcac tactattaat 2940tatttacgta
ttctttgaaa tggcgagtat tgataatgat aaactgagct ccagcttttg 3000ttccctttag
tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc tgtttcctgt 3060gtgaaattgt
tatccgctca caattccaca caacatagga gccggaagca taaagtgtaa 3120agcctggggt
gcctaatgag tgaggtaact cacattaatt gcgttgcgct cactgcccgc 3180tttccagtcg
ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag 3240aggcggtttg
cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 3300cgttcggctg
cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 3360atcaggggat
aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 3420taaaaaggcc
gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 3480aaatcgacgc
tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 3540tccccctgga
agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 3600gtccgccttt
ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 3660cagttcggtg
taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 3720cgaccgctgc
gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 3780atcgccactg
gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 3840tacagagttc
ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 3900ctgcgctctg
ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 3960acaaaccacc
gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 4020aaaaggatct
caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 4080aaactcacgt
taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 4140tttaaattaa
aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 4200cagttaccaa
tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 4260catagttgcc
tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 4320ccccagtgct
gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 4380aaaccagcca
gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 4440ccagtctatt
aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 4500caacgttgtt
gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 4560attcagctcc
ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 4620agcggttagc
tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 4680actcatggtt
atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 4740ttctgtgact
ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 4800ttgctcttgc
ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 4860gctcatcatt
ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 4920atccagttcg
atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 4980cagcgtttct
gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 5040gacacggaaa
tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 5100gggttattgt
ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 5160ggttccgcgc
acatttcccc gaaaagtgcc acctgggtcc ttttcatcac gtgctataaa 5220aataattata
atttaaattt tttaatataa atatataaat taaaaataga aagtaaaaaa 5280agaaattaaa
gaaaaaatag tttttgtttt ccgaagatgt aaaagactct agggggatcg 5340ccaacaaata
ctacctttta tcttgctctt cctgctctca ggtattaatg ccgaattgtt 5400tcatcttgtc
tgtgtagaag accacacacg aaaatcctgt gattttacat tttacttatc 5460gttaatcgaa
tgtatatcta tttaatctgc ttttcttgtc taataaatat atatgtaaag 5520tacgcttttt
gttgaaattt tttaaacctt tgtttatttt tttttcttca ttccgtaact 5580cttctacctt
ctttatttac tttctaaaat ccaaatacaa aacataaaaa taaataaaca 5640cagagtaaat
tcccaaatta ttccatcatt aaaagatacg aggcgcgtgt aagttacagg 5700caagcgatcc
gtcctaagaa accattatta tcatgacatt aacctataaa aataggcgta 5760tcacgaggcc
ctttcgtc
5778196362DNAArtificial SequenceSynthetic polynucleotide 19tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac
agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg
aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact
tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt
aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac
atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat
gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact
ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt
gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa
ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta
ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt
gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag
aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac
taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca
aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg
tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc
tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa
ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca
gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc
ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa
ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa
tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa
atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact
attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc
actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa
tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc
gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt
cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtcgcg
ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860cctcttcgct
attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920taacgccagg
gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980acgactcact
atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040aaccttctca
agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100aaaaagaaaa
atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160aatagggacc
tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220gggagggcgt
gaatgtaagc gtgacataac taattacatg actcgagcgg ccgcggatcc 2280cgggaattcg
tcgacacccg catagtcagg aacatcgtat gggtacatgc tagttctaga 2340aaacttagat
tagattgcta tgctttcttt ctaatgagca agaagtaaaa aaagttgtaa 2400tagaacaaga
aaaatgaaac tgaaacttga gaaattgaag accgtttatt aacttaaata 2460tcaatgggag
gtcatcgaaa gagaaaaaaa tcaaaaaaaa aattttcaag aaaaagaaac 2520gtgataaaaa
tttttattgc ctttttcgac gaagaaaaag aaacgaggcg gtctcttttt 2580tcttttccaa
acctttagta cgggtaatta acgacaccct agaggaagaa agaggggaaa 2640tttagtatgc
tgtgcttggg tgttttgaag tggtacggcg atgcgcggag tccgagaaaa 2700tctggaagag
taaaaaagga gtagaaacat tttgaagcta tgagctccag cttttgttcc 2760ctttagtgag
ggttaattgc gcgcttggcg taatcatggt catagctgtt tcctgtgtga 2820aattgttatc
cgctcacaat tccacacaac ataggagccg gaagcataaa gtgtaaagcc 2880tggggtgcct
aatgagtgag gtaactcaca ttaattgcgt tgcgctcact gcccgctttc 2940cagtcgggaa
acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc 3000ggtttgcgta
ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 3060cggctgcggc
gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 3120ggggataacg
caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 3180aaggccgcgt
tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 3240cgacgctcaa
gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 3300cctggaagct
ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 3360gcctttctcc
cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 3420tcggtgtagg
tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 3480cgctgcgcct
tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 3540ccactggcag
cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 3600gagttcttga
agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc 3660gctctgctga
agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 3720accaccgctg
gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 3780ggatctcaag
aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 3840tcacgttaag
ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 3900aattaaaaat
gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 3960taccaatgct
taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 4020gttgcctgac
tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 4080agtgctgcaa
tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 4140cagccagccg
gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 4200tctattaatt
gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 4260gttgttgcca
ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 4320agctccggtt
cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 4380gttagctcct
tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 4440atggttatgg
cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 4500gtgactggtg
agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 4560tcttgcccgg
cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 4620atcattggaa
aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 4680agttcgatgt
aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 4740gtttctgggt
gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 4800cggaaatgtt
gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 4860tattgtctca
tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 4920ccgcgcacat
ttccccgaaa agtgccacct gaacgaagca tctgtgcttc attttgtaga 4980acaaaaatgc
aacgcgagag cgctaatttt tcaaacaaag aatctgagct gcatttttac 5040agaacagaaa
tgcaacgcga aagcgctatt ttaccaacga agaatctgtg cttcattttt 5100gtaaaacaaa
aatgcaacgc gagagcgcta atttttcaaa caaagaatct gagctgcatt 5160tttacagaac
agaaatgcaa cgcgagagcg ctattttacc aacaaagaat ctatacttct 5220tttttgttct
acaaaaatgc atcccgagag cgctattttt ctaacaaagc atcttagatt 5280actttttttc
tcctttgtgc gctctataat gcagtctctt gataactttt tgcactgtag 5340gtccgttaag
gttagaagaa ggctactttg gtgtctattt tctcttccat aaaaaaagcc 5400tgactccact
tcccgcgttt actgattact agcgaagctg cgggtgcatt ttttcaagat 5460aaaggcatcc
ccgattatat tctataccga tgtggattgc gcatactttg tgaacagaaa 5520gtgatagcgt
tgatgattct tcattggtca gaaaattatg aacggtttct tctattttgt 5580ctctatatac
tacgtatagg aaatgtttac attttcgtat tgttttcgat tcactctatg 5640aatagttctt
actacaattt ttttgtctaa agagtaatac tagagataaa cataaaaaat 5700gtagaggtcg
agtttagatg caagttcaag gagcgaaagg tggatgggta ggttatatag 5760ggatatagca
cagagatata tagcaaagag atacttttga gcaatgtttg tggaagcggt 5820attcgcaata
ttttagtagc tcgttacagt ccggtgcgtt tttggttttt tgaaagtgcg 5880tcttcagagc
gcttttggtt ttcaaaagcg ctctgaagtt cctatacttt ctagagaata 5940ggaacttcgg
aataggaact tcaaagcgtt tccgaaaacg agcgcttccg aaaatgcaac 6000gcgagctgcg
cacatacagc tcactgttca cgtcgcacct atatctgcgt gttgcctgta 6060tatatatata
catgagaaga acggcatagt gcgtgtttat gcttaaatgc gtacttatat 6120gcgtctattt
atgtaggatg aaaggtagtc tagtacctcc tgtgatatta tcccattcca 6180tgcggggtat
cgtatgcttc cttcagcact accctttagc tgttctatat gctgccactc 6240ctcaattgga
ttagtctcat ccttcaatgc tatcatttcc tttgatattg gatcatacta 6300agaaaccatt
attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg 6360tc
6362206690DNAArtificial SequenceSynthetic polynucleotide 20tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgactcg 2340agcggccgcg
gatcccggga attcgtcgac accatcttct tctgagatga gtttttgttc 2400catgctagtt
ctagaatccg tcgaaactaa gttctggtgt tttaaaacta aaaaaaagac 2460taactataaa
agtagaattt aagaagttta agaaatagat ttacagaatt acaatcaata 2520cctaccgtct
ttatatactt attagtcaag taggggaata atttcaggga actggtttca 2580accttttttt
tcagcttttt ccaaatcaga gagagcagaa ggtaatagaa ggtgtaagaa 2640aatgagatag
atacatgcgt gggtcaattg ccttgtgtca tcatttactc caggcaggtt 2700gcatcactcc
attgaggttg tgcccgtttt ttgcctgttt gtgcccctgt tctctgtagt 2760tgcgctaaga
gaatggacct atgaactgat ggttggtgaa gaaaacaata ttttggtgct 2820gggattcttt
ttttttctgg atgccagctt aaaaagcggg ctccattata tttagtggat 2880gccaggaata
aactgttcac ccagacacct acgatgttat atattctgtg taacccgccc 2940cctattttgg
gcatgtacgg gttacagcag aattaaaagg ctaatttttt gactaaataa 3000agttaggaaa
atcactacta ttaattattt acgtattctt tgaaatggcg agtattgata 3060atgataaact
gagctccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt 3120aatcatggtc
atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 3180taggagccgg
aagcataaag tgtaaagcct ggggtgccta atgagtgagg taactcacat 3240taattgcgtt
gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 3300aatgaatcgg
ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 3360cgctcactga
ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 3420aggcggtaat
acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 3480aaggccagca
aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 3540tccgcccccc
tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 3600caggactata
aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 3660cgaccctgcc
gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 3720ctcatagctc
acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 3780gtgtgcacga
accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 3840agtccaaccc
ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 3900gcagagcgag
gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 3960acactagaag
gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 4020gagttggtag
ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 4080gcaagcagca
gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 4140cggggtctga
cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 4200caaaaaggat
cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 4260gtatatatga
gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 4320cagcgatctg
tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 4380cgatacggga
gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 4440caccggctcc
agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 4500gtcctgcaac
tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 4560gtagttcgcc
agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 4620cacgctcgtc
gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 4680catgatcccc
catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 4740gaagtaagtt
ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 4800ctgtcatgcc
atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 4860gagaatagtg
tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 4920cgccacatag
cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 4980tctcaaggat
cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 5040gatcttcagc
atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 5100atgccgcaaa
aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 5160ttcaatatta
ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 5220gtatttagaa
aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 5280aacgaagcat
ctgtgcttca ttttgtagaa caaaaatgca acgcgagagc gctaattttt 5340caaacaaaga
atctgagctg catttttaca gaacagaaat gcaacgcgaa agcgctattt 5400taccaacgaa
gaatctgtgc ttcatttttg taaaacaaaa atgcaacgcg agagcgctaa 5460tttttcaaac
aaagaatctg agctgcattt ttacagaaca gaaatgcaac gcgagagcgc 5520tattttacca
acaaagaatc tatacttctt ttttgttcta caaaaatgca tcccgagagc 5580gctatttttc
taacaaagca tcttagatta ctttttttct cctttgtgcg ctctataatg 5640cagtctcttg
ataacttttt gcactgtagg tccgttaagg ttagaagaag gctactttgg 5700tgtctatttt
ctcttccata aaaaaagcct gactccactt cccgcgttta ctgattacta 5760gcgaagctgc
gggtgcattt tttcaagata aaggcatccc cgattatatt ctataccgat 5820gtggattgcg
catactttgt gaacagaaag tgatagcgtt gatgattctt cattggtcag 5880aaaattatga
acggtttctt ctattttgtc tctatatact acgtatagga aatgtttaca 5940ttttcgtatt
gttttcgatt cactctatga atagttctta ctacaatttt tttgtctaaa 6000gagtaatact
agagataaac ataaaaaatg tagaggtcga gtttagatgc aagttcaagg 6060agcgaaaggt
ggatgggtag gttatatagg gatatagcac agagatatat agcaaagaga 6120tacttttgag
caatgtttgt ggaagcggta ttcgcaatat tttagtagct cgttacagtc 6180cggtgcgttt
ttggtttttt gaaagtgcgt cttcagagcg cttttggttt tcaaaagcgc 6240tctgaagttc
ctatactttc tagagaatag gaacttcgga ataggaactt caaagcgttt 6300ccgaaaacga
gcgcttccga aaatgcaacg cgagctgcgc acatacagct cactgttcac 6360gtcgcaccta
tatctgcgtg ttgcctgtat atatatatac atgagaagaa cggcatagtg 6420cgtgtttatg
cttaaatgcg tacttatatg cgtctattta tgtaggatga aaggtagtct 6480agtacctcct
gtgatattat cccattccat gcggggtatc gtatgcttcc ttcagcacta 6540ccctttagct
gttctatatg ctgccactcc tcaattggat tagtctcatc cttcaatgct 6600atcatttcct
ttgatattgg atcatctaag aaaccattat tatcatgaca ttaacctata 6660aaaataggcg
tatcacgagg ccctttcgtc
6690216506DNAArtificial SequenceSynthetic polynucleotide 21tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaacg
acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240atatgtgtac
tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300aaatagcttg
tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360gaattaattc
ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420tgagcacgtg
agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480atttcacagg
tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540cagaatgtgc
tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600agagaacaat
tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660atagttcagg
cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720ttttggctct
ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780ggcaagaata
ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840actgcaacat
actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900attcagaagc
aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960gaaggcaaga
gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020atgttggtga
tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080agacaaatgg
tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140aggttattac
tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200aataccgcac
agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260ttgttaaaat
tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320atcggcaaaa
tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380gtttggaaca
agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440gtctatcagg
gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500aggtgccgta
aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560ggaaagccgg
cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680ccgctacagg
gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860cgcgcgtaat
acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920agcgtcccaa
aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980tgtacagaaa
aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040taaaaaaata
aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100cggatgtggg
gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagcgg 2160ccgcggatcc
cgggaattcg tcgacaccat cttcttctga gatgagtttt tgttccatgc 2220tagttctaga
atccgtcgaa actaagttct ggtgttttaa aactaaaaaa aagactaact 2280ataaaagtag
aatttaagaa gtttaagaaa tagatttaca gaattacaat caatacctac 2340cgtctttata
tacttattag tcaagtaggg gaataatttc agggaactgg tttcaacctt 2400ttttttcagc
tttttccaaa tcagagagag cagaaggtaa tagaaggtgt aagaaaatga 2460gatagataca
tgcgtgggtc aattgccttg tgtcatcatt tactccaggc aggttgcatc 2520actccattga
ggttgtgccc gttttttgcc tgtttgtgcc cctgttctct gtagttgcgc 2580taagagaatg
gacctatgaa ctgatggttg gtgaagaaaa caatattttg gtgctgggat 2640tctttttttt
tctggatgcc agcttaaaaa gcgggctcca ttatatttag tggatgccag 2700gaataaactg
ttcacccaga cacctacgat gttatatatt ctgtgtaacc cgccccctat 2760tttgggcatg
tacgggttac agcagaatta aaaggctaat tttttgacta aataaagtta 2820ggaaaatcac
tactattaat tatttacgta ttctttgaaa tggcgagtat tgataatgat 2880aaactgagct
ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca 2940tggtcatagc
tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 3000gccggaagca
taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 3060gcgttgcgct
cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 3120atcggccaac
gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 3180actgactcgc
tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3240gtaatacggt
tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3300cagcaaaagg
ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 3360ccccctgacg
agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 3420ctataaagat
accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 3480ctgccgctta
ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 3540agctcacgct
gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 3600cacgaacccc
ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3660aacccggtaa
gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 3720gcgaggtatg
taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 3780agaaggacag
tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 3840ggtagctctt
gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 3900cagcagatta
cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3960tctgacgctc
agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 4020aggatcttca
cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 4080tatgagtaaa
cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 4140atctgtctat
ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 4200cgggagggct
taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 4260gctccagatt
tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 4320gcaactttat
ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 4380tcgccagtta
atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 4440tcgtcgtttg
gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 4500tcccccatgt
tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 4560aagttggccg
cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 4620atgccatccg
taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 4680tagtgtatgc
ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 4740catagcagaa
ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 4800aggatcttac
cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 4860tcagcatctt
ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 4920gcaaaaaagg
gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 4980tattattgaa
gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 5040tagaaaaata
aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgaacga 5100agcatctgtg
cttcattttg tagaacaaaa atgcaacgcg agagcgctaa tttttcaaac 5160aaagaatctg
agctgcattt ttacagaaca gaaatgcaac gcgaaagcgc tattttacca 5220acgaagaatc
tgtgcttcat ttttgtaaaa caaaaatgca acgcgagagc gctaattttt 5280caaacaaaga
atctgagctg catttttaca gaacagaaat gcaacgcgag agcgctattt 5340taccaacaaa
gaatctatac ttcttttttg ttctacaaaa atgcatcccg agagcgctat 5400ttttctaaca
aagcatctta gattactttt tttctccttt gtgcgctcta taatgcagtc 5460tcttgataac
tttttgcact gtaggtccgt taaggttaga agaaggctac tttggtgtct 5520attttctctt
ccataaaaaa agcctgactc cacttcccgc gtttactgat tactagcgaa 5580gctgcgggtg
cattttttca agataaaggc atccccgatt atattctata ccgatgtgga 5640ttgcgcatac
tttgtgaaca gaaagtgata gcgttgatga ttcttcattg gtcagaaaat 5700tatgaacggt
ttcttctatt ttgtctctat atactacgta taggaaatgt ttacattttc 5760gtattgtttt
cgattcactc tatgaatagt tcttactaca atttttttgt ctaaagagta 5820atactagaga
taaacataaa aaatgtagag gtcgagttta gatgcaagtt caaggagcga 5880aaggtggatg
ggtaggttat atagggatat agcacagaga tatatagcaa agagatactt 5940ttgagcaatg
tttgtggaag cggtattcgc aatattttag tagctcgtta cagtccggtg 6000cgtttttggt
tttttgaaag tgcgtcttca gagcgctttt ggttttcaaa agcgctctga 6060agttcctata
ctttctagag aataggaact tcggaatagg aacttcaaag cgtttccgaa 6120aacgagcgct
tccgaaaatg caacgcgagc tgcgcacata cagctcactg ttcacgtcgc 6180acctatatct
gcgtgttgcc tgtatatata tatacatgag aagaacggca tagtgcgtgt 6240ttatgcttaa
atgcgtactt atatgcgtct atttatgtag gatgaaaggt agtctagtac 6300ctcctgtgat
attatcccat tccatgcggg gtatcgtatg cttccttcag cactaccctt 6360tagctgttct
atatgctgcc actcctcaat tggattagtc tcatccttca atgctatcat 6420ttcctttgat
attggatcat attaagaaac cattattatc atgacattaa cctataaaaa 6480taggcgtatc
acgaggccct ttcgtc
6506226616DNAArtificial SequenceSynthetic polynucleotide 22tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac
agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg
aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact
tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt
aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac
atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat
gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact
ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt
gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa
ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta
ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt
gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag
aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac
taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca
aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg
tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc
tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa
ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca
gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc
ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa
ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa
tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa
atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact
attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc
actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa
tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc
gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt
cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtcgcg
ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860cctcttcgct
attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920taacgccagg
gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980acgactcact
atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040aaccttctca
agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100aaaaagaaaa
atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160aatagggacc
tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220gggagggcgt
gaatgtaagc gtgacataac taattacatg actcgagcgg ccgcggatcc 2280cgggaattcg
tcgacaccat cttcttctga gatgagtttt tgttccatgc tagttctaga 2340atccgtcgaa
actaagttct ggtgttttaa aactaaaaaa aagactaact ataaaagtag 2400aatttaagaa
gtttaagaaa tagatttaca gaattacaat caatacctac cgtctttata 2460tacttattag
tcaagtaggg gaataatttc agggaactgg tttcaacctt ttttttcagc 2520tttttccaaa
tcagagagag cagaaggtaa tagaaggtgt aagaaaatga gatagataca 2580tgcgtgggtc
aattgccttg tgtcatcatt tactccaggc aggttgcatc actccattga 2640ggttgtgccc
gttttttgcc tgtttgtgcc cctgttctct gtagttgcgc taagagaatg 2700gacctatgaa
ctgatggttg gtgaagaaaa caatattttg gtgctgggat tctttttttt 2760tctggatgcc
agcttaaaaa gcgggctcca ttatatttag tggatgccag gaataaactg 2820ttcacccaga
cacctacgat gttatatatt ctgtgtaacc cgccccctat tttgggcatg 2880tacgggttac
agcagaatta aaaggctaat tttttgacta aataaagtta ggaaaatcac 2940tactattaat
tatttacgta ttctttgaaa tggcgagtat tgataatgat aaactgagct 3000ccagcttttg
ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc 3060tgtttcctgt
gtgaaattgt tatccgctca caattccaca caacatagga gccggaagca 3120taaagtgtaa
agcctggggt gcctaatgag tgaggtaact cacattaatt gcgttgcgct 3180cactgcccgc
tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 3240gcgcggggag
aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 3300tgcgctcggt
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 3360tatccacaga
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 3420ccaggaaccg
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 3480agcatcacaa
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 3540accaggcgtt
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 3600ccggatacct
gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 3660gtaggtatct
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 3720ccgttcagcc
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 3780gacacgactt
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 3840taggcggtgc
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 3900tatttggtat
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 3960gatccggcaa
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 4020cgcgcagaaa
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 4080agtggaacga
aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 4140cctagatcct
tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 4200cttggtctga
cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 4260ttcgttcatc
catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 4320taccatctgg
ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 4380tatcagcaat
aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 4440ccgcctccat
ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 4500atagtttgcg
caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 4560gtatggcttc
attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 4620tgtgcaaaaa
agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 4680cagtgttatc
actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 4740taagatgctt
ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 4800ggcgaccgag
ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 4860ctttaaaagt
gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 4920cgctgttgag
atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 4980ttactttcac
cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 5040gaataagggc
gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 5100gcatttatca
gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 5160aacaaatagg
ggttccgcgc acatttcccc gaaaagtgcc acctgaacga agcatctgtg 5220cttcattttg
tagaacaaaa atgcaacgcg agagcgctaa tttttcaaac aaagaatctg 5280agctgcattt
ttacagaaca gaaatgcaac gcgaaagcgc tattttacca acgaagaatc 5340tgtgcttcat
ttttgtaaaa caaaaatgca acgcgagagc gctaattttt caaacaaaga 5400atctgagctg
catttttaca gaacagaaat gcaacgcgag agcgctattt taccaacaaa 5460gaatctatac
ttcttttttg ttctacaaaa atgcatcccg agagcgctat ttttctaaca 5520aagcatctta
gattactttt tttctccttt gtgcgctcta taatgcagtc tcttgataac 5580tttttgcact
gtaggtccgt taaggttaga agaaggctac tttggtgtct attttctctt 5640ccataaaaaa
agcctgactc cacttcccgc gtttactgat tactagcgaa gctgcgggtg 5700cattttttca
agataaaggc atccccgatt atattctata ccgatgtgga ttgcgcatac 5760tttgtgaaca
gaaagtgata gcgttgatga ttcttcattg gtcagaaaat tatgaacggt 5820ttcttctatt
ttgtctctat atactacgta taggaaatgt ttacattttc gtattgtttt 5880cgattcactc
tatgaatagt tcttactaca atttttttgt ctaaagagta atactagaga 5940taaacataaa
aaatgtagag gtcgagttta gatgcaagtt caaggagcga aaggtggatg 6000ggtaggttat
atagggatat agcacagaga tatatagcaa agagatactt ttgagcaatg 6060tttgtggaag
cggtattcgc aatattttag tagctcgtta cagtccggtg cgtttttggt 6120tttttgaaag
tgcgtcttca gagcgctttt ggttttcaaa agcgctctga agttcctata 6180ctttctagag
aataggaact tcggaatagg aacttcaaag cgtttccgaa aacgagcgct 6240tccgaaaatg
caacgcgagc tgcgcacata cagctcactg ttcacgtcgc acctatatct 6300gcgtgttgcc
tgtatatata tatacatgag aagaacggca tagtgcgtgt ttatgcttaa 6360atgcgtactt
atatgcgtct atttatgtag gatgaaaggt agtctagtac ctcctgtgat 6420attatcccat
tccatgcggg gtatcgtatg cttccttcag cactaccctt tagctgttct 6480atatgctgcc
actcctcaat tggattagtc tcatccttca atgctatcat ttcctttgat 6540attggatcat
actaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc 6600acgaggccct
ttcgtc
6616237974DNAArtificial SequenceSynthetic polynucleotide 23tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaacg
acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240atatgtgtac
tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300aaatagcttg
tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360gaattaattc
ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420tgagcacgtg
agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480atttcacagg
tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540cagaatgtgc
tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600agagaacaat
tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660atagttcagg
cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720ttttggctct
ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780ggcaagaata
ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840actgcaacat
actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900attcagaagc
aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960gaaggcaaga
gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020atgttggtga
tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080agacaaatgg
tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140aggttattac
tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200aataccgcac
agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260ttgttaaaat
tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320atcggcaaaa
tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380gtttggaaca
agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440gtctatcagg
gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500aggtgccgta
aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560ggaaagccgg
cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680ccgctacagg
gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860cgcgcgtaat
acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920agcgtcccaa
aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980tgtacagaaa
aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040taaaaaaata
aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100cggatgtggg
gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagcgg 2160ccgcggatcc
ctagagagct ttcgttttca tgagttcccc gaattctttc ggaagcttgt 2220cacttgctaa
attaacgtta tcactgtagt caaccgggac atcaatgatg acaggcccct 2280cagcgttcat
gccttgacgc agaacatctg ccagctggtc tggtgattct acgcgtaagc 2340cagttgctcc
gaagctttcc gcgtatttca cgatatcgat atttccgaaa tcgaccgcag 2400atgtacgatt
atattttttc aattgctgga atgcaaccat gtcatatgtg ctgtcgttcc 2460atacaatgtg
tacaattggt gcttttaaac gaactgctgt ctctaattcc atagctgaga 2520ataagaaacc
gccatcaccg gagactgata ctactttttc tcccggtttc accaatgaag 2580cgccgattgc
ccaaggaagc gcaacgccga gtgtttgcat accgttacta atcattaatg 2640ttaacggctc
gtagctgcgg aaataacgtg acatccaaat cgcgtgtgaa ccgatatcgc 2700aagtcactgt
aacatgatca tcgactgcgt ttcgcaattc tttaacgatt tcaagaggat 2760gcactctgtc
tgatttccaa tctgcaggca cctgctcacc ctcatgcata tattgtttta 2820aatcagaaag
gatcttctgc tcacgttccg caaagtctac tttcacagca tcgtgttcga 2880tatgattgat
cgtagatgga atatcaccga tcagttcaag atccggctgg taagcatgat 2940caatgtcagc
cagaatctcg tctaaatgga tgatcgtccg gtctccattg acattccaga 3000atttcggatc
atattcaatt gggtcatagc cgattgtcag aacaacatca gcctgctcaa 3060gcagcagatc
gccaggctgg ttgcggaata aaccgatccg gccaaaatac tgatcctcta 3120aatctctcgt
aagagtaccg gcagcttgat atgtttcaac gaatggaagc tgcacttttt 3180tcaatagctt
gcgaaccgct ttaatcgctt ccggtcttcc gcccttcatg ccgactaaaa 3240cgacaggaag
ttttgctgtt tgaatttttg caatggccat actgattgcg tcatctgctg 3300cgggaccaag
ttttggcgct gcgacagcac gtacgttttt tgtatttgtg acttcattca 3360caacatcttg
cggaaaactc acaaaagcgg ccccagcctg ccctgctgac gctatcctaa 3420acgcatttgt
aacagcttcc ggtatatttt ttacatcttg aacttctaca ctgtattttg 3480taatcggctg
gaatagcgcc gcattatcca aagattgatg tgtccgtttt aaacgatctg 3540cacggatcac
gttcccagca agcgcaacga cagggtcacc ttcagtgttt gctgtcagca 3600gtcctgttgc
caagttcgaa gcacctggtc ctgatgtgac taacacgact cccggttttc 3660cagttaaacg
gccgactgct tgcgccataa atgctgcatt ttgttcatgc cgggcaacga 3720taatttcagg
ccctttatct tgtaaagcgt caaataccgc atcaattttt gcacctggaa 3780tgccaaatac
atgtgtgaca ccttgctccg ctaagcaatc aacaacaagc tccgcccctc 3840tgcttttcac
aagggatttt tgttcttttg ttgcttttgt caacatgtcg actttatgtg 3900atgattgatt
gattgattgt acagtttgtt tttcttaata tctatttcga tgacttctat 3960atgatattgc
actaacaaga agatattata atgcaattga tacaagacaa ggagttattt 4020gcttctcttt
tatatgattc tgacaatcca tattgcgttg gtagtctttt ttgctggaac 4080ggttcagcgg
aaaagacgca tcgctctttt tgcttctaga agaaatgcca gcaaaagaat 4140ctcttgacag
tgactgacag caaaaatgtc tttttctaac tagtaacaag gctaagatat 4200cagcctgaaa
taaagggtgg tgaagtaata attaaatcat ccgtataaac ctatacacat 4260atatgaggaa
aaataataca aaagtgtttt aaatacagat acatacatga acatatgcac 4320gtatagcgcc
caaatgtcgg taatgggatc ggcgagctcc agcttttgtt ccctttagtg 4380agggttaatt
gcgcgcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 4440tccgctcaca
attccacaca acataggagc cggaagcata aagtgtaaag cctggggtgc 4500ctaatgagtg
aggtaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 4560aaacctgtcg
tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 4620tattgggcgc
tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 4680gcgagcggta
tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 4740cgcaggaaag
aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 4800gttgctggcg
tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 4860aagtcagagg
tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 4920ctccctcgtg
cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 4980cccttcggga
agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 5040ggtcgttcgc
tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 5100cttatccggt
aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 5160agcagccact
ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 5220gaagtggtgg
cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 5280gaagccagtt
accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 5340tggtagcggt
ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 5400agaagatcct
ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 5460agggattttg
gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 5520atgaagtttt
aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg 5580cttaatcagt
gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg 5640actccccgtc
gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc 5700aatgataccg
cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc 5760cggaagggcc
gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa 5820ttgttgccgg
gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc 5880cattgctaca
ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg 5940ttcccaacga
tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc 6000cttcggtcct
ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat 6060ggcagcactg
cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg 6120tgagtactca
accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc 6180ggcgtcaata
cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg 6240aaaacgttct
tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat 6300gtaacccact
cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg 6360gtgagcaaaa
acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg 6420ttgaatactc
atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 6480catgagcgga
tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac 6540atttccccga
aaagtgccac ctgaacgaag catctgtgct tcattttgta gaacaaaaat 6600gcaacgcgag
agcgctaatt tttcaaacaa agaatctgag ctgcattttt acagaacaga 6660aatgcaacgc
gaaagcgcta ttttaccaac gaagaatctg tgcttcattt ttgtaaaaca 6720aaaatgcaac
gcgagagcgc taatttttca aacaaagaat ctgagctgca tttttacaga 6780acagaaatgc
aacgcgagag cgctatttta ccaacaaaga atctatactt cttttttgtt 6840ctacaaaaat
gcatcccgag agcgctattt ttctaacaaa gcatcttaga ttactttttt 6900tctcctttgt
gcgctctata atgcagtctc ttgataactt tttgcactgt aggtccgtta 6960aggttagaag
aaggctactt tggtgtctat tttctcttcc ataaaaaaag cctgactcca 7020cttcccgcgt
ttactgatta ctagcgaagc tgcgggtgca ttttttcaag ataaaggcat 7080ccccgattat
attctatacc gatgtggatt gcgcatactt tgtgaacaga aagtgatagc 7140gttgatgatt
cttcattggt cagaaaatta tgaacggttt cttctatttt gtctctatat 7200actacgtata
ggaaatgttt acattttcgt attgttttcg attcactcta tgaatagttc 7260ttactacaat
ttttttgtct aaagagtaat actagagata aacataaaaa atgtagaggt 7320cgagtttaga
tgcaagttca aggagcgaaa ggtggatggg taggttatat agggatatag 7380cacagagata
tatagcaaag agatactttt gagcaatgtt tgtggaagcg gtattcgcaa 7440tattttagta
gctcgttaca gtccggtgcg tttttggttt tttgaaagtg cgtcttcaga 7500gcgcttttgg
ttttcaaaag cgctctgaag ttcctatact ttctagagaa taggaacttc 7560ggaataggaa
cttcaaagcg tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg 7620cgcacataca
gctcactgtt cacgtcgcac ctatatctgc gtgttgcctg tatatatata 7680tacatgagaa
gaacggcata gtgcgtgttt atgcttaaat gcgtacttat atgcgtctat 7740ttatgtagga
tgaaaggtag tctagtacct cctgtgatat tatcccattc catgcggggt 7800atcgtatgct
tccttcagca ctacccttta gctgttctat atgctgccac tcctcaattg 7860gattagtctc
atccttcaat gctatcattt cctttgatat tggatcatat taagaaacca 7920ttattatcat
gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtc
7974249692DNAArtificial SequenceSynthetic polynucleotide 24ttggatcata
ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca 60cgaggccctt
tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 120tcccggagac
ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc
gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag
agtgcaccat accacagctt ttcaattcaa ttcatcattt tttttttatt 300cttttttttg
atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag
gaaggagcac agacttagat tggtatatat acgcatatgt agtgttgaag 420aaacatgaaa
ttgcccagta ttcttaaccc aactgcacag aacaaaaacc tgcaggaaac 480gaagataaat
catgtcgaaa gctacatata aggaacgtgc tgctactcat cctagtcctg 540ttgctgccaa
gctatttaat atcatgcacg aaaagcaaac aaacttgtgt gcttcattgg 600atgttcgtac
caccaaggaa ttactggagt tagttgaagc attaggtccc aaaatttgtt 660tactaaaaac
acatgtggat atcttgactg atttttccat ggagggcaca gttaagccgc 720taaaggcatt
atccgccaag tacaattttt tactcttcga agacagaaaa tttgctgaca 780ttggtaatac
agtcaaattg cagtactctg cgggtgtata cagaatagca gaatgggcag 840acattacgaa
tgcacacggt gtggtgggcc caggtattgt tagcggtttg aagcaggcgg 900cagaagaagt
aacaaaggaa cctagaggcc ttttgatgtt agcagaattg tcatgcaagg 960gctccctatc
tactggagaa tatactaagg gtactgttga cattgcgaag agcgacaaag 1020attttgttat
cggctttatt gctcaaagag acatgggtgg aagagatgaa ggttacgatt 1080ggttgattat
gacacccggt gtgggtttag atgacaaggg agacgcattg ggtcaacagt 1140atagaaccgt
ggatgatgtg gtctctacag gatctgacat tattattgtt ggaagaggac 1200tatttgcaaa
gggaagggat gctaaggtag agggtgaacg ttacagaaaa gcaggctggg 1260aagcatattt
gagaagatgc ggccagcaaa actaaaaaac tgtattataa gtaaatgcat 1320gtatactaaa
ctcacaaatt agagcttcaa tttaattata tcagttatta ccctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgagcgg 2340ccgcctattt
atggaatttc ttatcataat cgaccaaagt aaatctgtat ttgacgtctc 2400cgctttccat
ccttgtaaag gcatggctga cgccttcttc gctgatcgga agtttttcca 2460cccatatttt
gacattcttt tcggaaacta atttcaatag ttgttcgatt tccttcctag 2520atccgatagc
actgcttgag attgatactc ccattaggcc caacggtttt aaaacaagct 2580tttcattaac
ttcaggagca gcaattgaaa cgatggagcc tccaatcttc ataatcttaa 2640cgatactgtc
aaaattaact ttcgacaaag atgatgagca aacgacaaga aggtccaaag 2700cgttagagta
ttgttctgtc cagcctttat cctccaacat agcaatatag tgatcagcac 2760cgagtttcat
agaatcctcc cgcttggagt ggcctcgcga aaacgcataa acctcggctc 2820ccatagcttt
agccaacaga atccccatat gcccaatacc accgatgcca acaataccta 2880ccctcttacc
tggaccacag ccatttctta gtagtggaga gaaaactgta ataccaccac 2940acaataatgg
agcggctagc ggacttggaa tattttctgg tatttgaata gcaaagtgtt 3000catgaagcct
cacgtgggag gcaaagcctc cttgtgaaat gtagccgtcc ttgtaaggag 3060tccacatagt
caaaacgtgg tcattggtac agtattgctc gttgtcactt ttgcaacgtt 3120cacactcaaa
acacgccaag gcttgggcac caacaccaac acggtcaccg atttttaccc 3180cagtgtggca
cttggatcca accttcacca cgcggccaat tatttcatgt ccaaggattt 3240gattttctgg
gactggaccc caattaccaa cggctatatg aaaatcagat ccgcagatac 3300cacaggcttc
aatttcaaca tcaacgtcat gatcgccaaa gggttttggg tcaaaactca 3360ctaatttagg
atgcttccaa tcctttgcgt tggaaatacc gatgccctga aatttttctg 3420ggtaaagcat
gtcgagtcga aactaagttc tggtgtttta aaactaaaaa aaagactaac 3480tataaaagta
gaatttaaga agtttaagaa atagatttac agaattacaa tcaataccta 3540ccgtctttat
atacttatta gtcaagtagg ggaataattt cagggaactg gtttcaacct 3600tttttttcag
ctttttccaa atcagagaga gcagaaggta atagaaggtg taagaaaatg 3660agatagatac
atgcgtgggt caattgcctt gtgtcatcat ttactccagg caggttgcat 3720cactccattg
aggttgtgcc cgttttttgc ctgtttgtgc ccctgttctc tgtagttgcg 3780ctaagagaat
ggacctatga actgatggtt ggtgaagaaa acaatatttt ggtgctggga 3840ttcttttttt
ttctggatgc cagcttaaaa agcgggctcc attatattta gtggatgcca 3900ggaataaact
gttcacccag acacctacga tgttatatat tctgtgtaac ccgcccccta 3960ttttgggcat
gtacgggtta cagcagaatt aaaaggctaa ttttttgact aaataaagtt 4020aggaaaatca
ctactattaa ttatttacgt attctttgaa atggcgagta ttgataatga 4080taaactggat
ccttaggatt tattctgttc agcaaacagc ttgcccattt tcttcagtac 4140cttcggtgcg
ccttctttcg ccaggatcag ttcgatccag tacatacggt tcggatcggc 4200ctgggcctct
ttcatcacgc tcacaaattc gttttcggta cgcacaattt tagacacaac 4260acggtcctca
gttgcgccga aggactccgg cagtttagag tagttccaca tagggatatc 4320gttgtaagac
tggttcggac cgtggatctc acgctcaacg gtgtagccgt cattgttaat 4380aatgaagcaa
atcgggttga tcttttcacg aattgccaga cccagttcct gtacggtcag 4440ctgcagggaa
ccgtcaccga tgaacagcag atgacgagat tctttatcag cgatctgaga 4500gcccagcgct
gccgggaaag tatagccaat gctaccccac agcggctgac cgataaaatg 4560gcttttggat
ttcagaaaga tagaagacgc gccgaaaaag ctcgtacctt gttccgccac 4620gatggtttca
ttgctctggg tcaggttctc cacggcctgc cacaggcgat cctgggacag 4680cagtgcgtta
gatggtacga aatcttcttg ctttttgtca atgtatttgc ctttatactc 4740gatttcggac
aggtccagca gagagctgat caggctttcg aagtcgaagt tctggatacg 4800ctcgttgaag
attttaccct cgtcgatgtt caggctaatc attttgtttt cgttcagatg 4860gtgagtgaat
gcaccggtag aagagtcggt cagtttaacg cccagcatca ggatgaagtc 4920cgcagattca
acaaattctt tcaggttcgg ttcgctcaga gtaccgttgt agatgcccag 4980gaaagacggc
agagcctcgt caacagagga cttgccgaag ttcagggtgg taatcggcag 5040tttggttttg
ctgatgaatt gggtcacggt cttctccaga ccaaaagaaa tgatttcgtg 5100gccggtgatc
acgattggtt tctttgcgtt tttcagagac tcctggattt tgttcaggat 5160ttcctggtcg
ctagtgttag aagtggagtt ttctttcttc agcggcaggc tcggtttttc 5220cgctttagct
gccgcaacat ccacaggcag gttgatgtaa actggtttgc gttctttcag 5280cagcgcagac
agaacgcggt cgatttccac agtagcgttc tctgcagtca gcagcgtacg 5340tgccgcagtc
acaggttcat gcattttcat gaagtgtttg aaatcgccgt cagccagagt 5400gtggtggacg
aatttacctt cgttctgaac tttgctcgtt gggctgccta cgatctccac 5460caccggcagg
ttttcggcgt aggagcccgc cagaccgttg acggcgctca gttcgccaac 5520accgaaagtg
gtcagaaatg ccgcggcttt cttggtacgt gcataaccat ctgccatgta 5580gcttgcgttc
agttcgttag cgttacccac ccatttcatg tctttatgag agatgatctg 5640atccaggaac
tgcagattgt aatcacccgg aacgccgaag atttcttcga tacccagttc 5700atgcagacgg
tccagcagat aatcaccaac agtatacatg tcgacaaact tagattagat 5760tgctatgctt
tctttctaat gagcaagaag taaaaaaagt tgtaatagaa caagaaaaat 5820gaaactgaaa
cttgagaaat tgaagaccgt ttattaactt aaatatcaat gggaggtcat 5880cgaaagagaa
aaaaatcaaa aaaaaaattt tcaagaaaaa gaaacgtgat aaaaattttt 5940attgcctttt
tcgacgaaga aaaagaaacg aggcggtctc ttttttcttt tccaaacctt 6000tagtacgggt
aattaacgac accctagagg aagaaagagg ggaaatttag tatgctgtgc 6060ttgggtgttt
tgaagtggta cggcgatgcg cggagtccga gaaaatctgg aagagtaaaa 6120aaggagtaga
aacattttga agctatgagc tccagctttt gttcccttta gtgagggtta 6180attgcgcgct
tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc 6240acaattccac
acaacatagg agccggaagc ataaagtgta aagcctgggg tgcctaatga 6300gtgaggtaac
tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 6360tcgtgccagc
tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 6420cgctcttccg
cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 6480gtatcagctc
actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 6540aagaacatgt
gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 6600gcgtttttcc
ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 6660aggtggcgaa
acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 6720gtgcgctctc
ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 6780ggaagcgtgg
cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 6840cgctccaagc
tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 6900ggtaactatc
gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 6960actggtaaca
ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 7020tggcctaact
acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 7080gttaccttcg
gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 7140ggtggttttt
ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 7200cctttgatct
tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 7260ttggtcatga
gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 7320tttaaatcaa
tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc 7380agtgaggcac
ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc 7440gtcgtgtaga
taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata 7500ccgcgagacc
cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg 7560gccgagcgca
gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc 7620cgggaagcta
gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct 7680acaggcatcg
tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa 7740cgatcaaggc
gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt 7800cctccgatcg
ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca 7860ctgcataatt
ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac 7920tcaaccaagt
cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca 7980atacgggata
ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt 8040tcttcggggc
gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc 8100actcgtgcac
ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca 8160aaaacaggaa
ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata 8220ctcatactct
tcctttttca atattattga agcatttatc agggttattg tctcatgagc 8280ggatacatat
ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc 8340cgaaaagtgc
cacctgaacg aagcatctgt gcttcatttt gtagaacaaa aatgcaacgc 8400gagagcgcta
atttttcaaa caaagaatct gagctgcatt tttacagaac agaaatgcaa 8460cgcgaaagcg
ctattttacc aacgaagaat ctgtgcttca tttttgtaaa acaaaaatgc 8520aacgcgagag
cgctaatttt tcaaacaaag aatctgagct gcatttttac agaacagaaa 8580tgcaacgcga
gagcgctatt ttaccaacaa agaatctata cttctttttt gttctacaaa 8640aatgcatccc
gagagcgcta tttttctaac aaagcatctt agattacttt ttttctcctt 8700tgtgcgctct
ataatgcagt ctcttgataa ctttttgcac tgtaggtccg ttaaggttag 8760aagaaggcta
ctttggtgtc tattttctct tccataaaaa aagcctgact ccacttcccg 8820cgtttactga
ttactagcga agctgcgggt gcattttttc aagataaagg catccccgat 8880tatattctat
accgatgtgg attgcgcata ctttgtgaac agaaagtgat agcgttgatg 8940attcttcatt
ggtcagaaaa ttatgaacgg tttcttctat tttgtctcta tatactacgt 9000ataggaaatg
tttacatttt cgtattgttt tcgattcact ctatgaatag ttcttactac 9060aatttttttg
tctaaagagt aatactagag ataaacataa aaaatgtaga ggtcgagttt 9120agatgcaagt
tcaaggagcg aaaggtggat gggtaggtta tatagggata tagcacagag 9180atatatagca
aagagatact tttgagcaat gtttgtggaa gcggtattcg caatatttta 9240gtagctcgtt
acagtccggt gcgtttttgg ttttttgaaa gtgcgtcttc agagcgcttt 9300tggttttcaa
aagcgctctg aagttcctat actttctaga gaataggaac ttcggaatag 9360gaacttcaaa
gcgtttccga aaacgagcgc ttccgaaaat gcaacgcgag ctgcgcacat 9420acagctcact
gttcacgtcg cacctatatc tgcgtgttgc ctgtatatat atatacatga 9480gaagaacggc
atagtgcgtg tttatgctta aatgcgtact tatatgcgtc tatttatgta 9540ggatgaaagg
tagtctagta cctcctgtga tattatccca ttccatgcgg ggtatcgtat 9600gcttccttca
gcactaccct ttagctgttc tatatgctgc cactcctcaa ttggattagt 9660ctcatccttc
aatgctatca tttcctttga ta
9692255439DNAArtificial SequenceSynthetic polynucleotide 25tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaacg
acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240atatgtgtac
tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300aaatagcttg
tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360gaattaattc
ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420tgagcacgtg
agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480atttcacagg
tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540cagaatgtgc
tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600agagaacaat
tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660atagttcagg
cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720ttttggctct
ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780ggcaagaata
ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840actgcaacat
actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900attcagaagc
aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960gaaggcaaga
gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020atgttggtga
tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080agacaaatgg
tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140aggttattac
tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200aataccgcac
agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260ttgttaaaat
tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320atcggcaaaa
tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380gtttggaaca
agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440gtctatcagg
gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500aggtgccgta
aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560ggaaagccgg
cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680ccgctacagg
gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860cgcgcgtaat
acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920agcgtcccaa
aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980tgtacagaaa
aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040taaaaaaata
aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100cggatgtggg
gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagcgg 2160ccgcggatcc
cgggaattcg tcgactttat gtgatgattg attgattgat tgtacagttt 2220gtttttctta
atatctattt cgatgacttc tatatgatat tgcactaaca agaagatatt 2280ataatgcaat
tgatacaaga caaggagtta tttgcttctc ttttatatga ttctgacaat 2340ccatattgcg
ttggtagtct tttttgctgg aacggttcag cggaaaagac gcatcgctct 2400ttttgcttct
agaagaaatg ccagcaaaag aatctcttga cagtgactga cagcaaaaat 2460gtctttttct
aactagtaac aaggctaaga tatcagcctg aaataaaggg tggtgaagta 2520ataattaaat
catccgtata aacctataca catatatgag gaaaaataat acaaaagtgt 2580tttaaataca
gatacataca tgaacatatg cacgtatagc gcccaaatgt cggtaatggg 2640atcggcgagc
tccagctttt gttcccttta gtgagggtta attgcgcgct tggcgtaatc 2700atggtcatag
ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatagg 2760agccggaagc
ataaagtgta aagcctgggg tgcctaatga gtgaggtaac tcacattaat 2820tgcgttgcgc
tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg 2880aatcggccaa
cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct 2940cactgactcg
ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 3000ggtaatacgg
ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 3060ccagcaaaag
gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg 3120cccccctgac
gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 3180actataaaga
taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac 3240cctgccgctt
accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 3300tagctcacgc
tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 3360gcacgaaccc
cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 3420caacccggta
agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 3480agcgaggtat
gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 3540tagaaggaca
gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 3600tggtagctct
tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa 3660gcagcagatt
acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg 3720gtctgacgct
cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa 3780aaggatcttc
acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 3840atatgagtaa
acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc 3900gatctgtcta
tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat 3960acgggagggc
ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc 4020ggctccagat
ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc 4080tgcaacttta
tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag 4140ttcgccagtt
aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg 4200ctcgtcgttt
ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg 4260atcccccatg
ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag 4320taagttggcc
gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt 4380catgccatcc
gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga 4440atagtgtatg
cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc 4500acatagcaga
actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc 4560aaggatctta
ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc 4620ttcagcatct
tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc 4680cgcaaaaaag
ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca 4740atattattga
agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat 4800ttagaaaaat
aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgggtc 4860cttttcatca
cgtgctataa aaataattat aatttaaatt ttttaatata aatatataaa 4920ttaaaaatag
aaagtaaaaa aagaaattaa agaaaaaata gtttttgttt tccgaagatg 4980taaaagactc
tagggggatc gccaacaaat actacctttt atcttgctct tcctgctctc 5040aggtattaat
gccgaattgt ttcatcttgt ctgtgtagaa gaccacacac gaaaatcctg 5100tgattttaca
ttttacttat cgttaatcga atgtatatct atttaatctg cttttcttgt 5160ctaataaata
tatatgtaaa gtacgctttt tgttgaaatt ttttaaacct ttgtttattt 5220ttttttcttc
attccgtaac tcttctacct tctttattta ctttctaaaa tccaaataca 5280aaacataaaa
ataaataaac acagagtaaa ttcccaaatt attccatcat taaaagatac 5340gaggcgcgtg
taagttacag gcaagcgatc cgtcctaaga aaccattatt atcatgacat 5400taacctataa
aaataggcgt atcacgaggc cctttcgtc
5439267146DNAArtificial SequenceSynthetic polynucleotide 26tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaacg
acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240atatgtgtac
tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300aaatagcttg
tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360gaattaattc
ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420tgagcacgtg
agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480atttcacagg
tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540cagaatgtgc
tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600agagaacaat
tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660atagttcagg
cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720ttttggctct
ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780ggcaagaata
ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840actgcaacat
actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900attcagaagc
aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960gaaggcaaga
gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020atgttggtga
tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080agacaaatgg
tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140aggttattac
tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200aataccgcac
agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260ttgttaaaat
tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320atcggcaaaa
tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380gtttggaaca
agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440gtctatcagg
gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500aggtgccgta
aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560ggaaagccgg
cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680ccgctacagg
gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860cgcgcgtaat
acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920agcgtcccaa
aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980tgtacagaaa
aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040taaaaaaata
aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100cggatgtggg
gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagcgg 2160ccgcggatcc
ctagagagct ttcgttttca tgagttcccc gaattctttc ggaagcttgt 2220cacttgctaa
attaacgtta tcactgtagt caaccgggac atcaatgatg acaggcccct 2280cagcgttcat
gccttgacgc agaacatctg ccagctggtc tggtgattct acgcgtaagc 2340cagttgctcc
gaagctttcc gcgtatttca cgatatcgat atttccgaaa tcgaccgcag 2400atgtacgatt
atattttttc aattgctgga atgcaaccat gtcatatgtg ctgtcgttcc 2460atacaatgtg
tacaattggt gcttttaaac gaactgctgt ctctaattcc atagctgaga 2520ataagaaacc
gccatcaccg gagactgata ctactttttc tcccggtttc accaatgaag 2580cgccgattgc
ccaaggaagc gcaacgccga gtgtttgcat accgttacta atcattaatg 2640ttaacggctc
gtagctgcgg aaataacgtg acatccaaat cgcgtgtgaa ccgatatcgc 2700aagtcactgt
aacatgatca tcgactgcgt ttcgcaattc tttaacgatt tcaagaggat 2760gcactctgtc
tgatttccaa tctgcaggca cctgctcacc ctcatgcata tattgtttta 2820aatcagaaag
gatcttctgc tcacgttccg caaagtctac tttcacagca tcgtgttcga 2880tatgattgat
cgtagatgga atatcaccga tcagttcaag atccggctgg taagcatgat 2940caatgtcagc
cagaatctcg tctaaatgga tgatcgtccg gtctccattg acattccaga 3000atttcggatc
atattcaatt gggtcatagc cgattgtcag aacaacatca gcctgctcaa 3060gcagcagatc
gccaggctgg ttgcggaata aaccgatccg gccaaaatac tgatcctcta 3120aatctctcgt
aagagtaccg gcagcttgat atgtttcaac gaatggaagc tgcacttttt 3180tcaatagctt
gcgaaccgct ttaatcgctt ccggtcttcc gcccttcatg ccgactaaaa 3240cgacaggaag
ttttgctgtt tgaatttttg caatggccat actgattgcg tcatctgctg 3300cgggaccaag
ttttggcgct gcgacagcac gtacgttttt tgtatttgtg acttcattca 3360caacatcttg
cggaaaactc acaaaagcgg ccccagcctg ccctgctgac gctatcctaa 3420acgcatttgt
aacagcttcc ggtatatttt ttacatcttg aacttctaca ctgtattttg 3480taatcggctg
gaatagcgcc gcattatcca aagattgatg tgtccgtttt aaacgatctg 3540cacggatcac
gttcccagca agcgcaacga cagggtcacc ttcagtgttt gctgtcagca 3600gtcctgttgc
caagttcgaa gcacctggtc ctgatgtgac taacacgact cccggttttc 3660cagttaaacg
gccgactgct tgcgccataa atgctgcatt ttgttcatgc cgggcaacga 3720taatttcagg
ccctttatct tgtaaagcgt caaataccgc atcaattttt gcacctggaa 3780tgccaaatac
atgtgtgaca ccttgctccg ctaagcaatc aacaacaagc tccgcccctc 3840tgcttttcac
aagggatttt tgttcttttg ttgcttttgt caacatgtcg actttatgtg 3900atgattgatt
gattgattgt acagtttgtt tttcttaata tctatttcga tgacttctat 3960atgatattgc
actaacaaga agatattata atgcaattga tacaagacaa ggagttattt 4020gcttctcttt
tatatgattc tgacaatcca tattgcgttg gtagtctttt ttgctggaac 4080ggttcagcgg
aaaagacgca tcgctctttt tgcttctaga agaaatgcca gcaaaagaat 4140ctcttgacag
tgactgacag caaaaatgtc tttttctaac tagtaacaag gctaagatat 4200cagcctgaaa
taaagggtgg tgaagtaata attaaatcat ccgtataaac ctatacacat 4260atatgaggaa
aaataataca aaagtgtttt aaatacagat acatacatga acatatgcac 4320gtatagcgcc
caaatgtcgg taatgggatc ggcgagctcc agcttttgtt ccctttagtg 4380agggttaatt
gcgcgcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 4440tccgctcaca
attccacaca acataggagc cggaagcata aagtgtaaag cctggggtgc 4500ctaatgagtg
aggtaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 4560aaacctgtcg
tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 4620tattgggcgc
tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 4680gcgagcggta
tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 4740cgcaggaaag
aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 4800gttgctggcg
tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 4860aagtcagagg
tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 4920ctccctcgtg
cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 4980cccttcggga
agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 5040ggtcgttcgc
tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 5100cttatccggt
aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 5160agcagccact
ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 5220gaagtggtgg
cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 5280gaagccagtt
accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 5340tggtagcggt
ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 5400agaagatcct
ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 5460agggattttg
gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 5520atgaagtttt
aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg 5580cttaatcagt
gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg 5640actccccgtc
gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc 5700aatgataccg
cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc 5760cggaagggcc
gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa 5820ttgttgccgg
gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc 5880cattgctaca
ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg 5940ttcccaacga
tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc 6000cttcggtcct
ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat 6060ggcagcactg
cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg 6120tgagtactca
accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc 6180ggcgtcaata
cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg 6240aaaacgttct
tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat 6300gtaacccact
cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg 6360gtgagcaaaa
acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg 6420ttgaatactc
atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 6480catgagcgga
tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac 6540atttccccga
aaagtgccac ctgggtcctt ttcatcacgt gctataaaaa taattataat 6600ttaaattttt
taatataaat atataaatta aaaatagaaa gtaaaaaaag aaattaaaga 6660aaaaatagtt
tttgttttcc gaagatgtaa aagactctag ggggatcgcc aacaaatact 6720accttttatc
ttgctcttcc tgctctcagg tattaatgcc gaattgtttc atcttgtctg 6780tgtagaagac
cacacacgaa aatcctgtga ttttacattt tacttatcgt taatcgaatg 6840tatatctatt
taatctgctt ttcttgtcta ataaatatat atgtaaagta cgctttttgt 6900tgaaattttt
taaacctttg tttatttttt tttcttcatt ccgtaactct tctaccttct 6960ttatttactt
tctaaaatcc aaatacaaaa cataaaaata aataaacaca gagtaaattc 7020ccaaattatt
ccatcattaa aagatacgag gcgcgtgtaa gttacaggca agcgatccgt 7080cctaagaaac
cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 7140ttcgtc
71462710231DNAArtificial SequenceSynthetic polynucleotide 27tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgagcgg 2340ccgcagatct
ttaacccgca acagcaatac gtttcatatc tgtcatatag ccgcgcagtt 2400tcttacctac
ctgctcaatc gcatggctgc gaatcgcttc gttcacatca cgcagttgcc 2460cgttatctac
cgcgccttcc ggaatagctt tacccaggtc gcccggttgc agctctgcca 2520taaacggttt
cagcaacggc acacaagcgt aagagaacag atagttaccg tactcagcgg 2580tatcagagat
aaccacgttc atttcgtaca gacgcttacg ggcgatggtg ttggcaatca 2640gcggcagctc
gtgcagtgat tcataatatg cagactcttc aatgatgccg gaatcgacca 2700tggtttcgaa
cgccagttca acgcccgctt tcaccatcgc aatcatcagt acgcctttat 2760cgaagtactc
ctgctcgccg attttgcctt catactgcgg cgcggtttca aacgcggttt 2820tgccggtctc
ttcacgccag gtcagcagtt tcttatcatc gttggcccag tccgccatca 2880taccggaaga
gaattcgccg gagatgatgt cgtccatatg tttctggaac aggggtgcca 2940tgatctcttt
cagctgttca gaaagcgcat aagcacgcag tttcgccggg ttagagagac 3000ggtccatcat
cagggtgatg ccgccctgtt tcagtgcttc ggtgatggtt tcccaaccga 3060actgaatcag
tttttctgcg tatgctggat cggtaccttc ttccaccagc ttgtcgaagc 3120acagcagaga
gccagcctgc aacataccgc acaggatggt ttgctcgccc atcaggtcag 3180atttcacttc
cgcaacgaag gacgattcca gcacacccgc acggtgacca ccggttgcag 3240ccgcccaggc
tttggcaatc gccatgcctt cgcctttcgg atcgttttcc gggtgaacgg 3300caatcagcgt
cggtacgccg aacccacgtt tgtactcttc acgcacttcg gtgcctgggc 3360atttcggcgc
aaccatcact acggtgatat ctttacggat ctgctcgccc acttcgacga 3420tgttgaaacc
gtgcgagtag cccagcgccg cgccgtcttt catcagtggc tgtacggtgc 3480gcactacatc
agagtgctgc ttgtccggcg tcaggttaat caccagatcc gcctgtggga 3540tcagttcttc
gtaagtaccc actttaaaac cattttcggt cgctttacgc caggacgcgc 3600gcttctcggc
aatcgcttct ttacgcagag cgtaggagat atcgagacca gaatcacgca 3660tgttcaggcc
ctggttcaga ccctgtgcgc cacagccgac gatgactact tttttaccct 3720gaaggtagct
cgcgccatcg gcgaattcat cgcggcccat ctcgagtcga aactaagttc 3780tggtgtttta
aaactaaaaa aaagactaac tataaaagta gaatttaaga agtttaagaa 3840atagatttac
agaattacaa tcaataccta ccgtctttat atacttatta gtcaagtagg 3900ggaataattt
cagggaactg gtttcaacct tttttttcag ctttttccaa atcagagaga 3960gcagaaggta
atagaaggtg taagaaaatg agatagatac atgcgtgggt caattgcctt 4020gtgtcatcat
ttactccagg caggttgcat cactccattg aggttgtgcc cgttttttgc 4080ctgtttgtgc
ccctgttctc tgtagttgcg ctaagagaat ggacctatga actgatggtt 4140ggtgaagaaa
acaatatttt ggtgctggga ttcttttttt ttctggatgc cagcttaaaa 4200agcgggctcc
attatattta gtggatgcca ggaataaact gttcacccag acacctacga 4260tgttatatat
tctgtgtaac ccgcccccta ttttgggcat gtacgggtta cagcagaatt 4320aaaaggctaa
ttttttgact aaataaagtt aggaaaatca ctactattaa ttatttacgt 4380attctttgaa
atggcgagta ttgataatga taaactggat cctcatccac ccaacttcga 4440tttgtctctt
actgccccct tatcggctga agtagccaat gaagcataag ccctaagggc 4500gaaacttact
tgacgttctc tatttttagg agtccaagcc ttatctcctc tggcatcttg 4560tgcttctctt
cttgcagcca attcagcgtc tgagacttgt aattggatac ctctatttgg 4620gatatctatg
gcgatcaaat ctccatcttc aatcaatcca atcgaaccac cagaagctgc 4680ctctggtgat
acgtgaccga tacttaaacc cgaagtgcca ccagagaatc taccgtcagt 4740gataagggca
caagcttttc ctagtcccat ggacttcaaa aatgaagttg ggtaaagcat 4800ttcctgcata
cctggtcctc cctttggtcc ctcatatctt atcactacca cgtctcctgc 4860taccaccttt
ccgccaagta tagcctcaac agcatcgtct tgactttcgt aaactttagc 4920gggtccagta
aatttcaaaa tactatcatc tacaccagca gttttcacaa tgcaaccatt 4980ttcagcgaag
tttccatata atactgctaa accaccatcc ttactataag catgctcaag 5040cgatcttata
catccatttg ctctatcatc gtccaaagtg tcccacctac agtcttgcga 5100gaatgcttgg
gtggttctga tccctgctgg acctgccctg aacatgtttt tcacggcatc 5160atcttgagtt
aacatgacat cgtattgctc taatgtctgt ggaagtgtta aacccaatac 5220attcttcaca
tccctgttta aaagaccggc tctgtccaac tcccctaaaa taccaataac 5280ccctcctgca
cgatgaacgt cttccatgtg atacttttga gttgatggtg caaccttaca 5340taactgtgga
accttacgtg aaagcttgtc gatatcagac atggtgaaat ctatctcagc 5400ttcttgggct
gcagctagaa gatgtaagac cgtgtttgta ctaccaccca ttgcaatatc 5460caatgtcatg
gcattttcga atgcagcctt tgaagctata ttcctcggta atgctgattc 5520atcattttgt
tcgtaatacc ttttcgttag ttccacaatt ctttttccgg catttaagaa 5580caattgcttt
ctgtctgcat gggtcgctaa taatgaacca tttcctggtt gagataaacc 5640tagagcttca
gtcaagcaat tcatagagtt agccgtgaac attccactgc aagaaccaca 5700agttggacat
gcacttcttt caacttggtc tgactgcgag tctgaaactt ttggatctgc 5760accttgaatc
attgcatcca caagatcaag tttgatgatc tgatcactta acttagtttt 5820accagcctcc
attgggccgc cagatacgaa gattactggg atgttcaatc tcaaggacgc 5880catcaacata
ccaggcgtta tcttatcaca attagagata caaaccattg catcggcaca 5940atgagcatta
accatatatt cgactgagtc tgcaattaat tctctcgatg gtaaagagta 6000taacataccg
ccatgcccca tagctatacc gtcgtccaca gcaatagtat taaactcttt 6060tgcgacacca
cctgcagctt caatttgttc ggcaacaagc ttacctagat cacgcaaatg 6120gacatgaccc
ggaacgaatt gtgtaaaaga gttgacgacg gcaatgattg gctttccgaa 6180atctgcatca
gtcatgccag tcatgtcgac aaacttagat tagattgcta tgctttcttt 6240ctaatgagca
agaagtaaaa aaagttgtaa tagaacaaga aaaatgaaac tgaaacttga 6300gaaattgaag
accgtttatt aacttaaata tcaatgggag gtcatcgaaa gagaaaaaaa 6360tcaaaaaaaa
aattttcaag aaaaagaaac gtgataaaaa tttttattgc ctttttcgac 6420gaagaaaaag
aaacgaggcg gtctcttttt tcttttccaa acctttagta cgggtaatta 6480acgacaccct
agaggaagaa agaggggaaa tttagtatgc tgtgcttggg tgttttgaag 6540tggtacggcg
atgcgcggag tccgagaaaa tctggaagag taaaaaagga gtagaaacat 6600tttgaagcta
tgagctccag cttttgttcc ctttagtgag ggttaattgc gcgcttggcg 6660taatcatggt
catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 6720ataggagccg
gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca 6780ttaattgcgt
tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 6840taatgaatcg
gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 6900tcgctcactg
actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6960aaggcggtaa
tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 7020aaaggccagc
aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 7080ctccgccccc
ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 7140acaggactat
aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 7200ccgaccctgc
cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 7260tctcatagct
cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 7320tgtgtgcacg
aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 7380gagtccaacc
cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7440agcagagcga
ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 7500tacactagaa
ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 7560agagttggta
gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 7620tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 7680acggggtctg
acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 7740tcaaaaagga
tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 7800agtatatatg
agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 7860tcagcgatct
gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 7920acgatacggg
agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7980tcaccggctc
cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 8040ggtcctgcaa
ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 8100agtagttcgc
cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 8160tcacgctcgt
cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 8220acatgatccc
ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 8280agaagtaagt
tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 8340actgtcatgc
catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 8400tgagaatagt
gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 8460gcgccacata
gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 8520ctctcaagga
tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 8580tgatcttcag
catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 8640aatgccgcaa
aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 8700tttcaatatt
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 8760tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 8820gaacgaagca
tctgtgcttc attttgtaga acaaaaatgc aacgcgagag cgctaatttt 8880tcaaacaaag
aatctgagct gcatttttac agaacagaaa tgcaacgcga aagcgctatt 8940ttaccaacga
agaatctgtg cttcattttt gtaaaacaaa aatgcaacgc gagagcgcta 9000atttttcaaa
caaagaatct gagctgcatt tttacagaac agaaatgcaa cgcgagagcg 9060ctattttacc
aacaaagaat ctatacttct tttttgttct acaaaaatgc atcccgagag 9120cgctattttt
ctaacaaagc atcttagatt actttttttc tcctttgtgc gctctataat 9180gcagtctctt
gataactttt tgcactgtag gtccgttaag gttagaagaa ggctactttg 9240gtgtctattt
tctcttccat aaaaaaagcc tgactccact tcccgcgttt actgattact 9300agcgaagctg
cgggtgcatt ttttcaagat aaaggcatcc ccgattatat tctataccga 9360tgtggattgc
gcatactttg tgaacagaaa gtgatagcgt tgatgattct tcattggtca 9420gaaaattatg
aacggtttct tctattttgt ctctatatac tacgtatagg aaatgtttac 9480attttcgtat
tgttttcgat tcactctatg aatagttctt actacaattt ttttgtctaa 9540agagtaatac
tagagataaa cataaaaaat gtagaggtcg agtttagatg caagttcaag 9600gagcgaaagg
tggatgggta ggttatatag ggatatagca cagagatata tagcaaagag 9660atacttttga
gcaatgtttg tggaagcggt attcgcaata ttttagtagc tcgttacagt 9720ccggtgcgtt
tttggttttt tgaaagtgcg tcttcagagc gcttttggtt ttcaaaagcg 9780ctctgaagtt
cctatacttt ctagagaata ggaacttcgg aataggaact tcaaagcgtt 9840tccgaaaacg
agcgcttccg aaaatgcaac gcgagctgcg cacatacagc tcactgttca 9900cgtcgcacct
atatctgcgt gttgcctgta tatatatata catgagaaga acggcatagt 9960gcgtgtttat
gcttaaatgc gtacttatat gcgtctattt atgtaggatg aaaggtagtc 10020tagtacctcc
tgtgatatta tcccattcca tgcggggtat cgtatgcttc cttcagcact 10080accctttagc
tgttctatat gctgccactc ctcaattgga ttagtctcat ccttcaatgc 10140tatcatttcc
tttgatattg gatcatctaa gaaaccatta ttatcatgac attaacctat 10200aaaaataggc
gtatcacgag gccctttcgt c
10231289404DNAArtificial SequenceSynthetic polynucleotide 28tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgcgtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgagcgg 2340ccgcagatct
ttaacccgca acagcaatac gtttcatatc tgtcatatag ccgcgcagtt 2400tcttacctac
ctgctcaatc gcatggctgc gaatcgcttc gttcacatca cgcagttgcc 2460cgttatctac
cgcgccttcc ggaatagctt tacccaggtc gcccggttgc agctctgcca 2520taaacggttt
cagcaacggc acacaagcgt aagagaacag atagttaccg tactcagcgg 2580tatcagagat
aaccacgttc atttcgtaca gacgcttacg ggcgatggtg ttggcaatca 2640gcggcagctc
gtgcagtgat tcataatatg cagactcttc aatgatgccg gaatcgacca 2700tggtttcgaa
cgccagttca acgcccgctt tcaccatcgc aatcatcagt acgcctttat 2760cgaagtactc
ctgctcgccg attttgcctt catactgcgg cgcggtttca aacgcggttt 2820tgccggtctc
ttcacgccag gtcagcagtt tcttatcatc gttggcccag tccgccatca 2880taccggaaga
gaattcgccg gagatgatgt cgtccatatg tttctggaac aggggtgcca 2940tgatctcttt
cagctgttca gaaagcgcat aagcacgcag tttcgccggg ttagagagac 3000ggtccatcat
cagggtgatg ccgccctgtt tcagtgcttc ggtgatggtt tcccaaccga 3060actgaatcag
tttttctgcg tatgctggat cggtaccttc ttccaccagc ttgtcgaagc 3120acagcagaga
gccagcctgc aacataccgc acaggatggt ttgctcgccc atcaggtcag 3180atttcacttc
cgcaacgaag gacgattcca gcacacccgc acggtgacca ccggttgcag 3240ccgcccaggc
tttggcaatc gccatgcctt cgcctttcgg atcgttttcc gggtgaacgg 3300caatcagcgt
cggtacgccg aacccacgtt tgtactcttc acgcacttcg gtgcctgggc 3360atttcggcgc
aaccatcact acggtgatat ctttacggat ctgctcgccc acttcgacga 3420tgttgaaacc
gtgcgagtag cccagcgccg cgccgtcttt catcagtggc tgtacggtgc 3480gcactacatc
agagtgctgc ttgtccggcg tcaggttaat caccagatcc gcctgtggga 3540tcagttcttc
gtaagtaccc actttaaaac cattttcggt cgctttacgc caggacgcgc 3600gcttctcggc
aatcgcttct ttacgcagag cgtaggagat atcgagacca gaatcacgca 3660tgttcaggcc
ctggttcaga ccctgtgcgc cacagccgac gatgactact tttttaccct 3720gaaggtagct
cgcgccatcg gcgaattcat cgcggcccat ctcgagtcga aactaagttc 3780tggtgtttta
aaactaaaaa aaagactaac tataaaagta gaatttaaga agtttaagaa 3840atagatttac
agaattacaa tcaataccta ccgtctttat atacttatta gtcaagtagg 3900ggaataattt
cagggaactg gtttcaacct tttttttcag ctttttccaa atcagagaga 3960gcagaaggta
atagaaggtg taagaaaatg agatagatac atgcgtgggt caattgcctt 4020gtgtcatcat
ttactccagg caggttgcat cactccattg aggttgtgcc cgttttttgc 4080ctgtttgtgc
ccctgttctc tgtagttgcg ctaagagaat ggacctatga actgatggtt 4140ggtgaagaaa
acaatatttt ggtgctggga ttcttttttt ttctggatgc cagcttaaaa 4200agcgggctcc
attatattta gtggatgcca ggaataaact gttcacccag acacctacga 4260tgttatatat
tctgtgtaac ccgcccccta ttttgggcat gtacgggtta cagcagaatt 4320aaaaggctaa
ttttttgact aaataaagtt aggaaaatca ctactattaa ttatttacgt 4380attctttgaa
atggcgagta ttgataatga taaactggat cctcatccac ccaacttcga 4440tttgtctctt
actgccccct tatcggctga agtagccaat gaagcataag ccctaagggc 4500gaaacttact
tgacgttctc tatttttagg agtccaagcc ttatctcctc tggcatcttg 4560tgcttctctt
cttgcagcca attcagcgtc tgagacttgt aattggatac ctctatttgg 4620gatatctatg
gcgatcaaat ctccatcttc aatcaatcca atcgaaccac cagaagctgc 4680ctctggtgat
acgtgaccga tacttaaacc cgaagtgcca ccagagaatc taccgtcagt 4740gataagggca
caagcttttc ctagtcccat ggacttcaaa aatgaagttg ggtaaagcat 4800ttcctgcata
cctggtcctc cctttggtcc ctcatatctt atcactacca cgtctcctgc 4860taccaccttt
ccgccaagta tagcctcaac agcatcgtct tgactttcgt aaactttagc 4920gggtccagta
aatttcaaaa tactatcatc tacaccagca gttttcacaa tgcaaccatt 4980ttcagcgaag
tttccatata atactgctaa accaccatcc ttactataag catgctcaag 5040cgatcttata
catccatttg ctctatcatc gtccaaagtg tcccacctac agtcttgcga 5100gaatgcttgg
gtggttctga tccctgctgg acctgccctg aacatgtttt tcacggcatc 5160atcttgagtt
aacatgacat cgtattgctc taatgtctgt ggaagtgtta aacccaatac 5220attcttcaca
tccctgttta aaagaccggc tctgtccaac tcccctaaaa taccaataac 5280ccctcctgca
cgatgaacgt cttccatgtg atacttttga gttgatggtg caaccttaca 5340taactgtgga
accttacgtg aaagcttgtc gatatcagac atggtgaaat ctatctcagc 5400ttcttgggct
gcagctagaa gatgtaagac cgtgtttgta ctaccaccca ttgcaatatc 5460caatgtcatg
gcattttcga atgcagcctt tgaagctata ttcctcggta atgctgattc 5520atcattttgt
tcgtaatacc ttttcgttag ttccacaatt ctttttccgg catttaagaa 5580caattgcttt
ctgtctgcat gggtcgctaa taatgaacca tttcctggtt gagataaacc 5640tagagcttca
gtcaagcaat tcatagagtt agccgtgaac attccactgc aagaaccaca 5700agttggacat
gcacttcttt caacttggtc tgactgcgag tctgaaactt ttggatctgc 5760accttgaatc
attgcatcca caagatcaag tttgatgatc tgatcactta acttagtttt 5820accagcctcc
attgggccgc cagatacgaa gattactggg atgttcaatc tcaaggacgc 5880catcaacata
ccaggcgtta tcttatcaca attagagata caaaccattg catcggcaca 5940atgagcatta
accatatatt cgactgagtc tgcaattaat tctctcgatg gtaaagagta 6000taacataccg
ccatgcccca tagctatacc gtcgtccaca gcaatagtat taaactcttt 6060tgcgacacca
cctgcagctt caatttgttc ggcaacaagc ttacctagat cacgcaaatg 6120gacatgaccc
ggaacgaatt gtgtaaaaga gttgacgacg gcaatgattg gctttccgaa 6180atctgcatca
gtcatgccag tcatgtcgac aaacttagat tagattgcta tgctttcttt 6240ctaatgagca
agaagtaaaa aaagttgtaa tagaacaaga aaaatgaaac tgaaacttga 6300gaaattgaag
accgtttatt aacttaaata tcaatgggag gtcatcgaaa gagaaaaaaa 6360tcaaaaaaaa
aattttcaag aaaaagaaac gtgataaaaa tttttattgc ctttttcgac 6420gaagaaaaag
aaacgaggcg gtctcttttt tcttttccaa acctttagta cgggtaatta 6480acgacaccct
agaggaagaa agaggggaaa tttagtatgc tgtgcttggg tgttttgaag 6540tggtacggcg
atgcgcggag tccgagaaaa tctggaagag taaaaaagga gtagaaacat 6600tttgaagcta
tgagctccag cttttgttcc ctttagtgag ggttaattgc gcgcttggcg 6660taatcatggt
catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 6720ataggagccg
gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca 6780ttaattgcgt
tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 6840taatgaatcg
gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 6900tcgctcactg
actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6960aaggcggtaa
tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 7020aaaggccagc
aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 7080ctccgccccc
ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 7140acaggactat
aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 7200ccgaccctgc
cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 7260tctcatagct
cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 7320tgtgtgcacg
aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 7380gagtccaacc
cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7440agcagagcga
ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 7500tacactagaa
ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 7560agagttggta
gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 7620tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 7680acggggtctg
acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 7740tcaaaaagga
tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 7800agtatatatg
agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 7860tcagcgatct
gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 7920acgatacggg
agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7980tcaccggctc
cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 8040ggtcctgcaa
ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 8100agtagttcgc
cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 8160tcacgctcgt
cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 8220acatgatccc
ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 8280agaagtaagt
tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 8340actgtcatgc
catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 8400tgagaatagt
gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 8460gcgccacata
gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 8520ctctcaagga
tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 8580tgatcttcag
catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 8640aatgccgcaa
aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 8700tttcaatatt
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 8760tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 8820gggtcctttt
catcacgtgc tataaaaata attataattt aaatttttta atataaatat 8880ataaattaaa
aatagaaagt aaaaaaagaa attaaagaaa aaatagtttt tgttttccga 8940agatgtaaaa
gactctaggg ggatcgccaa caaatactac cttttatctt gctcttcctg 9000ctctcaggta
ttaatgccga attgtttcat cttgtctgtg tagaagacca cacacgaaaa 9060tcctgtgatt
ttacatttta cttatcgtta atcgaatgta tatctattta atctgctttt 9120cttgtctaat
aaatatatat gtaaagtacg ctttttgttg aaatttttta aacctttgtt 9180tatttttttt
tcttcattcc gtaactcttc taccttcttt atttactttc taaaatccaa 9240atacaaaaca
taaaaataaa taaacacaga gtaaattccc aaattattcc atcattaaaa 9300gatacgaggc
gcgtgtaagt tacaggcaag cgatccgtcc taagaaacca ttattatcat 9360gacattaacc
tataaaaata ggcgtatcac gaggcccttt cgtc
9404299404DNAArtificial SequenceSynthetic polynucleotide 29tcgcgcgttt
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgcgtg 120ttggcgggtg
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt
cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca
ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg
cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt
cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata
cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata
aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa
gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc
agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca
cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc
gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg
cgggattgct ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg 840gagtaaaaag
gtttggatca ggatttgcgc ctttggatga ggcactttcc agagcggtgg 900tagatctttc
gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag 960gagatctctc
ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag gctagcagaa 1020ttaccctcca
cgttgattgt ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt 1080tcaaggctct
tgcggttgcc ataagagaag ccacctcgcc caatggtacc aacgatgttc 1140cctccaccaa
aggtgttctt atgtagtgac accgattatt taaagctgca gcatacgata 1200tatatacatg
tgtatatatg tatacctatg aatgtcagta agtatgtata cgaacagtat 1260gatactgaag
atgacaaggt aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc 1320tttccttttt
tctttttgct ttttcttttt ttttctcttg aactcgacgg atctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgagcgg 2340ccgcagatct
ttaacccgca acagcaatac gtttcatatc tgtcatatag ccgcgcagtt 2400tcttacctac
ctgctcaatc gcatggctgc gaatcgcttc gttcacatca cgcagttgcc 2460cgttatctac
cgcgccttcc ggaatagctt tacccaggtc gcccggttgc agctctgcca 2520taaacggttt
cagcaacggc acacaagcgt aagagaacag atagttaccg tactcagcgg 2580tatcagagat
aaccacgttc atttcgtaca gacgcttacg ggcgatggtg ttggcaatca 2640gcggcagctc
gtgcagtgat tcataatatg cagactcttc aatgatgccg gaatcgacca 2700tggtttcgaa
cgccagttca acgcccgctt tcaccatcgc aatcatcagt acgcctttat 2760cgaagtactc
ctgctcgccg attttgcctt catactgcgg cgcggtttca aacgcggttt 2820tgccggtctc
ttcacgccag gtcagcagtt tcttatcatc gttggcccag tccgccatca 2880taccggaaga
gaattcgccg gagatgatgt cgtccatatg tttctggaac aggggtgcca 2940tgatctcttt
cagctgttca gaaagcgcat aagcacgcag tttcgccggg ttagagagac 3000ggtccatcat
cagggtgatg ccgccctgtt tcagtgcttc ggtgatggtt tcccaaccga 3060actgaatcag
tttttctgcg tatgctggat cggtaccttc ttccaccagc ttgtcgaagc 3120acagcagaga
gccagcctgc aacataccgc acaggatggt ttgctcgccc atcaggtcag 3180atttcacttc
cgcaacgaag gacgattcca gcacacccgc acggtgacca ccggttgcag 3240ccgcccaggc
tttggcaatc gccatgcctt cgcctttcgg atcgttttcc gggtgaacgg 3300caatcagcgt
cggtacgccg aacccacgtt tgtactcttc acgcacttcg gtgcctgggc 3360atttcggcgc
aaccatcact acggtgatat ctttacggat ctgctcgccc acttcgacga 3420tgttgaaacc
gtgcgagtag cccagcgccg cgccgtcttt catcagtggc tgtacggtgc 3480gcactacatc
agagtgctgc ttgtccggcg tcaggttaat caccagatcc gcctgtggga 3540tcagttcttc
gtaagtaccc actttaaaac cattttcggt cgctttacgc caggacgcgc 3600gcttctcggc
aatcgcttct ttacgcagag cgtaggagat atcgagacca gaatcacgca 3660tgttcaggcc
ctggttcaga ccctgtgcgc cacagccgac gatgactact tttttaccct 3720gaaggtagct
cgcgccatcg gcgaattcat cgcggcccat ctcgagtcga aactaagttc 3780tggtgtttta
aaactaaaaa aaagactaac tataaaagta gaatttaaga agtttaagaa 3840atagatttac
agaattacaa tcaataccta ccgtctttat atacttatta gtcaagtagg 3900ggaataattt
cagggaactg gtttcaacct tttttttcag ctttttccaa atcagagaga 3960gcagaaggta
atagaaggtg taagaaaatg agatagatac atgcgtgggt caattgcctt 4020gtgtcatcat
ttactccagg caggttgcat cactccattg aggttgtgcc cgttttttgc 4080ctgtttgtgc
ccctgttctc tgtagttgcg ctaagagaat ggacctatga actgatggtt 4140ggtgaagaaa
acaatatttt ggtgctggga ttcttttttt ttctggatgc cagcttaaaa 4200agcgggctcc
attatattta gtggatgcca ggaataaact gttcacccag acacctacga 4260tgttatatat
tctgtgtaac ccgcccccta ttttgggcat gtacgggtta cagcagaatt 4320aaaaggctaa
ttttttgact aaataaagtt aggaaaatca ctactattaa ttatttacgt 4380attctttgaa
atggcgagta ttgataatga taaactggat cctcatccac ccaacttcga 4440tttgtctctt
actgccccct tatcggctga agtagccaat gaagcataag ccctaagggc 4500gaaacttact
tgacgttctc tatttttagg agtccaagcc ttatctcctc tggcatcttg 4560tgcttctctt
cttgcagcca attcagcgtc tgagacttgt aattggatac ctctatttgg 4620gatatctatg
gcgatcaaat ctccatcttc aatcaatcca atcgaaccac cagaagctgc 4680ctctggtgat
acgtgaccga tacttaaacc cgaagtgcca ccagagaatc taccgtcagt 4740gataagggca
caagcttttc ctagtcccat ggacttcaaa aatgaagttg ggtaaagcat 4800ttcctgcata
cctggtcctc cctttggtcc ctcatatctt atcactacca cgtctcctgc 4860taccaccttt
ccgccaagta tagcctcaac agcatcgtct tgactttcgt aaactttagc 4920gggtccagta
aatttcaaaa tactatcatc tacaccagca gttttcacaa tgcaaccatt 4980ttcagcgaag
tttccatata atactgctaa accaccatcc ttactataag catgctcaag 5040cgatcttata
catccatttg ctctatcatc gtccaaagtg tcccacctac agtcttgcga 5100gaatgcttgg
gtggttctga tccctgctgg acctgccctg aacatgtttt tcacggcatc 5160atcttgagtt
aacatgacat cgtattgctc taatgtctgt ggaagtgtta aacccaatac 5220attcttcaca
tccctgttta aaagaccggc tctgtccaac tcccctaaaa taccaataac 5280ccctcctgca
cgatgaacgt cttccatgtg atacttttga gttgatggtg caaccttaca 5340taactgtgga
accttacgtg aaagcttgtc gatatcagac atggtgaaat ctatctcagc 5400ttcttgggct
gcagctagaa gatgtaagac cgtgtttgta ctaccaccca ttgcaatatc 5460caatgtcatg
gcattttcga atgcagcctt tgaagctata ttcctcggta atgctgattc 5520atcattttgt
tcgtaatacc ttttcgttag ttccacaatt ctttttccgg catttaagaa 5580caattgcttt
ctgtctgcat gggtcgctaa taatgaacca tttcctggtt gagataaacc 5640tagagcttca
gtcaagcaat tcatagagtt agccgtgaac attccactgc aagaaccaca 5700agttggacat
gcacttcttt caacttggtc tgactgcgag tctgaaactt ttggatctgc 5760accttgaatc
attgcatcca caagatcaag tttgatgatc tgatcactta acttagtttt 5820accagcctcc
attgggccgc cagatacgaa gattactggg atgttcaatc tcaaggacgc 5880catcaacata
ccaggcgtta tcttatcaca attagagata caaaccattg catcggcaca 5940atgagcatta
accatatatt cgactgagtc tgcaattaat tctctcgatg gtaaagagta 6000taacataccg
ccatgcccca tagctatacc gtcgtccaca gcaatagtat taaactcttt 6060tgcgacacca
cctgcagctt caatttgttc ggcaacaagc ttacctagat cacgcaaatg 6120gacatgaccc
ggaacgaatt gtgtaaaaga gttgacgacg gcaatgattg gctttccgaa 6180atctgcatca
gtcatgccag tcatgtcgac aaacttagat tagattgcta tgctttcttt 6240ctaatgagca
agaagtaaaa aaagttgtaa tagaacaaga aaaatgaaac tgaaacttga 6300gaaattgaag
accgtttatt aacttaaata tcaatgggag gtcatcgaaa gagaaaaaaa 6360tcaaaaaaaa
aattttcaag aaaaagaaac gtgataaaaa tttttattgc ctttttcgac 6420gaagaaaaag
aaacgaggcg gtctcttttt tcttttccaa acctttagta cgggtaatta 6480acgacaccct
agaggaagaa agaggggaaa tttagtatgc tgtgcttggg tgttttgaag 6540tggtacggcg
atgcgcggag tccgagaaaa tctggaagag taaaaaagga gtagaaacat 6600tttgaagcta
tgagctccag cttttgttcc ctttagtgag ggttaattgc gcgcttggcg 6660taatcatggt
catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 6720ataggagccg
gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca 6780ttaattgcgt
tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 6840taatgaatcg
gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 6900tcgctcactg
actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6960aaggcggtaa
tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 7020aaaggccagc
aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 7080ctccgccccc
ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 7140acaggactat
aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 7200ccgaccctgc
cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 7260tctcatagct
cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 7320tgtgtgcacg
aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 7380gagtccaacc
cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7440agcagagcga
ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 7500tacactagaa
ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 7560agagttggta
gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 7620tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 7680acggggtctg
acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 7740tcaaaaagga
tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 7800agtatatatg
agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 7860tcagcgatct
gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 7920acgatacggg
agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7980tcaccggctc
cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 8040ggtcctgcaa
ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 8100agtagttcgc
cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 8160tcacgctcgt
cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 8220acatgatccc
ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 8280agaagtaagt
tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 8340actgtcatgc
catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 8400tgagaatagt
gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 8460gcgccacata
gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 8520ctctcaagga
tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 8580tgatcttcag
catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 8640aatgccgcaa
aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 8700tttcaatatt
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 8760tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 8820gggtcctttt
catcacgtgc tataaaaata attataattt aaatttttta atataaatat 8880ataaattaaa
aatagaaagt aaaaaaagaa attaaagaaa aaatagtttt tgttttccga 8940agatgtaaaa
gactctaggg ggatcgccaa caaatactac cttttatctt gctcttcctg 9000ctctcaggta
ttaatgccga attgtttcat cttgtctgtg tagaagacca cacacgaaaa 9060tcctgtgatt
ttacatttta cttatcgtta atcgaatgta tatctattta atctgctttt 9120cttgtctaat
aaatatatat gtaaagtacg ctttttgttg aaatttttta aacctttgtt 9180tatttttttt
tcttcattcc gtaactcttc taccttcttt atttactttc taaaatccaa 9240atacaaaaca
taaaaataaa taaacacaga gtaaattccc aaattattcc atcattaaaa 9300gatacgaggc
gcgtgtaagt tacaggcaag cgatccgtcc taagaaacca ttattatcat 9360gacattaacc
tataaaaata ggcgtatcac gaggcccttt cgtc
94043023DNAArtificial SequenceSynthetic primer 30agtcacatca agatcgttta
tgg 233123DNAArtificial
SequenceSynthetic primer 31gcacggaata tgggactact tcg
233223DNAArtificial SequenceSynthetic primer
32actccacttc aagtaagagt ttg
233321DNAArtificial SequenceSynthetic primer 33tattgtctca tgagcggata c
213429DNAArtificial
SequenceSynthetic primer 34acaacgagtg tcatggggag aggaagagg
293527DNAArtificial SequenceSynthetic primer
35gatcttcggc tgggtcatgt gaggcgg
273624DNAArtificial SequenceSynthetic primer 36acgctgaaca cgttggtgtc ttgc
243723DNAArtificial
SequenceSynthetic primer 37aacccttagc agcatcggca acc
233821DNAArtificial SequenceSynthetic primer
38tattcatggg ccaatactac g
213931DNAArtificial SequenceSynthetic primer 39gtagaagacg tcacctggta
gaccaaagat g 314032DNAArtificial
SequenceSynthetic primer 40catcgtgacg tcgctcaatt gactgctgct ac
324132DNAArtificial SequenceSynthetic primer
41actaagcgac acgtgcggtt tctgtggtat ag
324236DNAArtificial SequenceSynthetic primer 42gaaaccgcac gtgtcgctta
gtttacattt ctttcc 364320DNAArtificial
SequenceSynthetic primer 43tttgaagtgg tacggcgatg
204420DNAArtificial SequenceSynthetic primer
44aatcatatcg aacacgatgc
204520DNAArtificial SequenceSynthetic primer 45agctggtctg gtgattctac
204620DNAArtificial
SequenceSynthetic primer 46tatcaccgta gtgatggttg
204721DNAArtificial SequenceSynthetic primer
47gtcagcagtt tcttatcatc g
214820DNAArtificial SequenceSynthetic primer 48gcgaaactta cttgacgttc
204920DNAArtificial
SequenceSynthetic primer 49actttggacg atgatagagc
205020DNAArtificial SequenceSynthetic primer
50gcgttagatg gtacgaaatc
205120DNAArtificial SequenceSynthetic primer 51cttctaacac tagcgaccag
205220DNAArtificial
SequenceSynthetic primer 52aaagatgatg agcaaacgac
205320DNAArtificial SequenceSynthetic primer
53cgagcaatac tgtaccaatg
205420DNAArtificial SequenceSynthetic primer 54tcacggatga tttccagggt
205520DNAArtificial
SequenceSynthetic primer 55cacctgcgtt gttaccacaa
2056491PRTEscherichia coli 56Met Ala Asn Tyr Phe
Asn Thr Leu Asn Leu Arg Gln Gln Leu Ala Gln 1 5
10 15 Leu Gly Lys Cys Arg Phe Met Gly Arg Asp
Glu Phe Ala Asp Gly Ala 20 25
30 Ser Tyr Leu Gln Gly Lys Lys Val Val Ile Val Gly Cys Gly Ala
Gln 35 40 45 Gly
Leu Asn Gln Gly Leu Asn Met Arg Asp Ser Gly Leu Asp Ile Ser 50
55 60 Tyr Ala Leu Arg Lys Glu
Ala Ile Ala Glu Lys Arg Ala Ser Trp Arg 65 70
75 80 Lys Ala Thr Glu Asn Gly Phe Lys Val Gly Thr
Tyr Glu Glu Leu Ile 85 90
95 Pro Gln Ala Asp Leu Val Ile Asn Leu Thr Pro Asp Lys Gln His Ser
100 105 110 Asp Val
Val Arg Thr Val Gln Pro Leu Met Lys Asp Gly Ala Ala Leu 115
120 125 Gly Tyr Ser His Gly Phe Asn
Ile Val Glu Val Gly Glu Gln Ile Arg 130 135
140 Lys Asp Ile Thr Val Val Met Val Ala Pro Lys Cys
Pro Gly Thr Glu 145 150 155
160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala
165 170 175 Val His Pro
Glu Asn Asp Pro Lys Gly Glu Gly Met Ala Ile Ala Lys 180
185 190 Ala Trp Ala Ala Ala Thr Gly Gly
His Arg Ala Gly Val Leu Glu Ser 195 200
205 Ser Phe Val Ala Glu Val Lys Ser Asp Leu Met Gly Glu
Gln Thr Ile 210 215 220
Leu Cys Gly Met Leu Gln Ala Gly Ser Leu Leu Cys Phe Asp Lys Leu 225
230 235 240 Val Glu Glu Gly
Thr Asp Pro Ala Tyr Ala Glu Lys Leu Ile Gln Phe 245
250 255 Gly Trp Glu Thr Ile Thr Glu Ala Leu
Lys Gln Gly Gly Ile Thr Leu 260 265
270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Leu Arg Ala Tyr
Ala Leu 275 280 285
Ser Glu Gln Leu Lys Glu Ile Met Ala Pro Leu Phe Gln Lys His Met 290
295 300 Asp Asp Ile Ile Ser
Gly Glu Phe Ser Ser Gly Met Met Ala Asp Trp 305 310
315 320 Ala Asn Asp Asp Lys Lys Leu Leu Thr Trp
Arg Glu Glu Thr Gly Lys 325 330
335 Thr Ala Phe Glu Thr Ala Pro Gln Tyr Glu Gly Lys Ile Gly Glu
Gln 340 345 350 Glu
Tyr Phe Asp Lys Gly Val Leu Met Ile Ala Met Val Lys Ala Gly 355
360 365 Val Glu Leu Ala Phe Glu
Thr Met Val Asp Ser Gly Ile Ile Glu Glu 370 375
380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Leu Pro
Leu Ile Ala Asn Thr 385 390 395
400 Ile Ala Arg Lys Arg Leu Tyr Glu Met Asn Val Val Ile Ser Asp Thr
405 410 415 Ala Glu
Tyr Gly Asn Tyr Leu Phe Ser Tyr Ala Cys Val Pro Leu Leu 420
425 430 Lys Pro Phe Met Ala Glu Leu
Gln Pro Gly Asp Leu Gly Lys Ala Ile 435 440
445 Pro Glu Gly Ala Val Asp Asn Gly Gln Leu Arg Asp
Val Asn Glu Ala 450 455 460
Ile Arg Ser His Ala Ile Glu Gln Val Gly Lys Lys Leu Arg Gly Tyr 465
470 475 480 Met Thr Asp
Met Lys Arg Ile Ala Val Ala Gly 485 490
5714056DNAArtificial SequencepGV2227 57ttggatcata ctaagaaacc attattatca
tgacattaac ctataaaaat aggcgtatca 60cgaggccctt tcgtctcgcg cgtttcggtg
atgacggtga aaacctctga cacatgcagc 120tcccggagac ggtcacagct tgtctgtaag
cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc gggtgttggc gggtgtcggg
gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag agtgcaccat accacagctt
ttcaattcaa ttcatcattt tttttttatt 300cttttttttg atttcggttt ctttgaaatt
tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag gaaggagcac agacttagat
tggtatatat acgcatatgg caaattaaag 420ccttcgagcg tcccaaaacc ttctcaagca
aggttttcag tataatgtta catgcgtaca 480cgcgtctgta cagaaaaaaa agaaaaattt
gaaatataaa taacgttctt aatactaaca 540taactataaa aaaataaata gggacctaga
cttcaggttg tctaactcct tccttttcgg 600ttagagcgga tgtgggggga gggcgtgaat
gtaagcgtga cataactaat tacatgactc 660gacctaggtt atttagtaaa atcaatgacc
attcggcctt caatttttcc tgccttcatt 720tcatcaataa tatcattgat ttcttccagt
ttgcgtgtcg caacaattgg ttttacctta 780ccttctgctc caaattgaaa agcttctgcc
aagtcaagtc ttgttccgac aagtgaacct 840gcaacctcca ctccgtcaaa aacaactgtt
ggaactgata aagtcatctc agtattggga 900agtgccacag caaccatttt gcccataggt
ttcaaagaag caaccgcttg ttcaaaagca 960atccttgcaa cagcacaaac tattgcactt
tgcaccccta agccgccagt tattttttta 1020atttcatcaa ctggatttac atcaccagaa
ttgataatca catcagctcc aattttttta 1080gctaaattta atttatcttg attaatatca
acagcaatta cttttgctcc aaaaacattt 1140ttagcatatt gaattgctaa atttccaagt
cctccagcac caaaaattac ttgccaatca 1200ccaggtttta ctcctgatac tttgattgct
ttgtaagttg ttactccagc acaagtaatt 1260gagctagctt caattgggtc aagtccgtca
ggaactttga cagcataatc ggcaacaaca 1320attgcttctt cagccattcc gccatcaact
gaatatcctg catttttaac ttctcgacaa 1380aaagtttcat taccagatac acagtattca
cagtgaccac atccttcaaa gaaccaagcc 1440actgaaaccc gatcaccaac ttgaagcgag
cttacatcag ctccaatttc tttgacaatt 1500ccaattcctt catgaccaag aacagtccct
gctttgttgc cataatcacc tgctgcaacg 1560tgcaaatcgg tatgacagac tccacaatac
tccatgtcaa gcaaagcttc attaggtttg 1620attgctcgaa gttccttttc aacaaggtcc
gcataaccat ctggattgtg tcttactact 1680gctgctttca ttggtaccta ttattgtatg
ttatagtatt agttgcttgg tgttatgaaa 1740gaaactaaga aaagaaaaat aaaataaaaa
taaaagattg agacaaggga agaaaagata 1800caaaataaga attaattaca attgcgtttg
ctataaatac gtttttaaca atcaactctg 1860gtaggaagat aatgcttttt ttttttatat
atgcttggtg ccacttgtca catacaattc 1920tacaaccttc gacaaaaatc caaatgatag
taagatcaaa gccagaaagc aatggagaaa 1980aaaaattaat gaaccacgat gaaccaaatg
atcaatacaa ccaaagaaac taccctagtg 2040aggtgtatgc tgacttggta tcacacttca
tgaattttgc atatggcaaa gtccacgaaa 2100gtgggcttca gaaaaaaggc gtgcggtgtg
tagatgtatc aattagtgga tgccagtttt 2160ggaacgggat tccactttcc gcaagttggt
gcacgtcgtt agtgacataa cgccgcgttc 2220atctttggga agaagcagat gctgagcgag
gaggtactat agagtaaaga accctttcta 2280tacccgcagc cccatggtaa gtgacagtgc
agtaataata tgaaccaatt tatttttcgt 2340tacataaaaa tgcttataaa actttaacta
ataattagag attaaatcgc ggccgcaaaa 2400gatccttagg atttattctg ttcagcaaac
agcttgccca ttttcttcag taccttcggt 2460gcgccttctt tcgccaggat cagttcgatc
cagtacatac ggttcggatc ggcctgggcc 2520tctttcatca cgctcacaaa ttcgttttcg
gtacgcacaa ttttagacac aacacggtcc 2580tcagttgcgc cgaaggactc cggcagttta
gagtagttcc acatagggat atcgttgtaa 2640gactggttcg gaccgtggat ctcacgctca
acggtgtagc cgtcattgtt aataatgaag 2700caaatcgggt tgatcttttc acgaattgcc
agacccagtt cctgtacggt cagctgcagg 2760gaaccgtcac cgatgaacag cagatgacga
gattctttat cagcgatctg agagcccagc 2820gctgccggga aagtatagcc aatgctaccc
cacagcggct gaccgataaa atggcttttg 2880gatttcagaa agatagaaga cgcgccgaaa
aagctcgtac cttgttccgc cacgatggtt 2940tcattgctct gggtcaggtt ctccacggcc
tgccacaggc gatcctggga cagcagtgcg 3000ttagatggta cgaaatcttc ttgctttttg
tcaatgtatt tgcctttata ctcgatttcg 3060gacaggtcca gcagagagct gatcaggctt
tcgaagtcga agttctggat acgctcgttg 3120aagattttac cctcgtcgat gttcaggcta
atcattttgt tttcgttcag atggtgagtg 3180aatgcaccgg tagaagagtc ggtcagttta
acgcccagca tcaggatgaa gtccgcagat 3240tcaacaaatt ctttcaggtt cggttcgctc
agagtaccgt tgtagatgcc caggaaagac 3300ggcagagcct cgtcaacaga ggacttgccg
aagttcaggg tggtaatcgg cagtttggtt 3360ttgctgatga attgggtcac ggtcttctcc
agaccaaaag aaatgatttc gtggccggtg 3420atcacgattg gtttctttgc gtttttcaga
gactcctgga ttttgttcag gatttcctgg 3480tcgctagtgt tagaagtgga gttttctttc
ttcagcggca ggctcggttt ttccgcttta 3540gctgccgcaa catccacagg caggttgatg
taaactggtt tgcgttcttt cagcagcgca 3600gacagaacgc ggtcgatttc cacagtagcg
ttctctgcag tcagcagcgt acgtgccgca 3660gtcacaggtt catgcatttt catgaagtgt
ttgaaatcgc cgtcagccag agtgtggtgg 3720acgaatttac cttcgttctg aactttgctc
gttgggctgc ctacgatctc caccaccggc 3780aggttttcgg cgtaggagcc cgccagaccg
ttgacggcgc tcagttcgcc aacaccgaaa 3840gtggtcagaa atgccgcggc tttcttggta
cgtgcataac catctgccat gtagcttgcg 3900ttcagttcgt tagcgttacc cacccatttc
atgtctttat gagagatgat ctgatccagg 3960aactgcagat tgtaatcacc cggaacgccg
aagatttctt cgatacccag ttcatgcaga 4020cggtccagca gataatcacc aacagtatac
atgtcgagct tgttttatat ttgttgtaaa 4080aagtagataa ttacttcctt gatgatctgt
aaaaaagaga aaaagaaagc atctaagaac 4140ttgaaaaact acgaattaga aaagaccaaa
tatgtatttc ttgcattgac caatttatgc 4200aagtttatat atatgtaaat gtaagtttca
cgaggttcta ctaaactaaa ccaccccctt 4260ggttagaaga aaagagtgtg tgagaacagg
ctgttgttgt cacacgattc ggacaattct 4320gtttgaaaga gagagagtaa cagtacgatc
gaacgaactt tgctctggag atcacagtgg 4380gcatcatagc atgtggtact aaaccctttc
ccgccattcc agaaccttcg attgcttgtt 4440acaaaacctg tgagccgtcg ctaggacctt
gttgtgtgac gaaattggaa gctgcaatca 4500ataggaagac aggaagtcga gcgtgtctgg
gttttttcag ttttgttctt tttgcaaaca 4560aatcacgagc gacggtaatt tctttctcga
taagaggcca cgtgctttat gagggtaaca 4620tcaattcaag aaggagggaa acacttcctt
tttctggccc tgataatagt atgagggtga 4680agccaaaata aaggattcgc gcccaaatcg
gcatctttaa atgcaggtat gcgatagttc 4740ctcactcttt ccttactcac gagtaattct
tgcaaatgcc tattatgcag atgttataat 4800atctgtgcgt cttgagttga gcctagaatt
cttagaaaaa ctcatcgagc atcaaatgaa 4860actgcaattt attcatatca ggattatcaa
taccatattt ttgaaaaagc cgtttctgta 4920atgaaggaga aaactcaccg aggcagttcc
ataggatggc aagatcctgg tatcggtctg 4980cgatcccgac tcgtccaaca tcaatacaac
ctattaattt cccctcgtca aaaataaggt 5040tatcaagtga gaaatcacca tgagtgacga
ctgaatccgg tgagaatggc aaaagcttat 5100gcatttcttt ccagacttgt tcaacaggcc
agccattacg ctcgtcatca aaatcactcg 5160cgtcaaccaa accgttattc attcgtgatt
gcgcctgagc gaggcgaaat acgcgatcgc 5220tgttaaaagg acaattacaa acaggaatcg
aatgcaaccg gcgcaggaac actgccagcg 5280catcaacaat attttcacct gaatcaggat
attcttctaa tacctggaat gctgttttgc 5340cggggatcgc agtggtgagt aaccatgcat
catcaggagt acggacaaaa tgcttgatgg 5400tcggaagagg cataaattcc gtcagccagt
ttagtctgac catctcatct gcaacatcat 5460tggcaacgct acctttgcca tgtttcagaa
acaactctgg cgcatcgggc ttcccataca 5520atcgatagat tgtcgcacct gattgcccga
cattatcgcg agcccattta tacccatata 5580aatcagcatc catgttggaa tttaatcgcg
gcctcgaaac gtgagtcttt tccttaccca 5640tactagtttt tagtttatgt atgtgttttt
tgtagttata gatttaagca agaaaagaat 5700acaaacaaaa aattgaaaaa gattgattta
gaattaaaaa gaaaaatatt tacgtaagaa 5760gggaaaatag taaatgttgc aagttcacta
aactcctaaa ttatgctgcc ctttatattc 5820cctgttacag cagccgagcc aaaggtatat
aggctccttt gcattagcat gcgtaacaaa 5880ccacctgtca gtttcaaccg aggtggtatc
cgagagaatt gtgtgattgc tttaattaat 5940ttcggagaat ctcacatgcc actgaagatt
aaaaactgga tgccagaaaa ggggtgtcca 6000ggtgtaacat caatagagga agctgaaaag
tcttagaacg ggtaatcttc caccaacctg 6060atgggttcct agatataatc tcgaagggaa
taagtagggt gataccgcag aagtgtctga 6120atgtattaag gtcctcacag tttaaatccc
gctcacacta acgtaggatt attataactc 6180aaaaaaatgg cattattcta agtaagttaa
atatccgtaa tctttaaaca gcggccgcgg 6240atcttcatcc tgccactgca attcttttca
tatcggtcat atatcctctc agctttttac 6300ccacctgttc tatagcatgt gaacgaatag
cttcatttac gtctctcagt tggccattgt 6360caaccgctcc ttccggaata gccttcccca
aatcaccagg ttgtaactcg gccatgaagg 6420gctttaacaa cgggacacat gcgtagctaa
ataagtaatt accatattct gcagtgtctg 6480atatgacaac attcatctcg taaagtcttt
ttcttgcaat agtatttgct atcaaaggca 6540attcatgcaa agactcatag tatgcagatt
cttcaatgat accggagtca accatagttt 6600cgaatgcaag ttctacccct gccttcacca
tagctatcat caatactccc ttatcaaagt 6660attcttgttc accaatttta ccttcgtatt
gtggggctgt ctcgaatgcc gtcttgccgg 6720tttcttctct ccacgtcaat aactttttat
catcgtttgc ccaatctgcc atcattcctg 6780aggaaaactc accggagata atatcgtcca
tgtgcttttg gaataatggt gccatgatct 6840cttttagttg ctcagataag gcgtaggctc
ttagcttggc cggatttgaa agtctatcca 6900tcatcaatgt tatgccacct tgtttaagtg
cctcggtgat tgtctcccaa ccaaattgta 6960tcaacttttc agcataggca ggatctgtac
cctcttcgac caatttatca aagcatagta 7020aagaccctgc ctgcaacatt ccgcacagaa
tggtttgttc acccattaag tcactcttga 7080cctcagctac gaaagaactc tctaacacac
ccgctctatg acctccggtt gcggctgccc 7140atgccttcgc aattgccata ccttcacctt
tggggtcatt ttcaggatgt acggcgatca 7200atgtaggtac accaaaaccc ctcttgtact
cctctctgac ttccgtacct gggcactttg 7260gtgcaaccat tacgactgtt atatcttttc
tgatctgctc gcccacttca acgatattaa 7320agccatgaga gtaacctaaa gctgccccat
ccttcatcag cggttgaact gttcttacta 7380cgtctgagtg aaccttatct ggtgttaggt
taatcactaa atctgcctga gggatcagtt 7440cttcgtaagt accaactttg aacccatttt
ccgtcgcttt acgccaggag gccctctttt 7500ctgcaattgc ctctttcctc aatgcatacg
aaatatccag acctgaatct ctcatgttta 7560aaccttggtt tagaccctga gcaccgcagc
caacaattac tactttcttt ccttgcagat 7620aagaagcacc atcagcaaac tcgtcccttc
ccataaatct gcacttaccc agttgagcca 7680attgttgtct caaatttaat gtgttaaaat
agttggccat ctcgagtcga aactaagttc 7740tggtgtttta aaactaaaaa aaagactaac
tataaaagta gaatttaaga agtttaagaa 7800atagatttac agaattacaa tcaataccta
ccgtctttat atacttatta gtcaagtagg 7860ggaataattt cagggaactg gtttcaacct
tttttttcag ctttttccaa atcagagaga 7920gcagaaggta atagaaggtg taagaaaatg
agatagatac atgcgtgggt caattgcctt 7980gtgtcatcat ttactccagg caggttgcat
cactccattg aggttgtgcc cgttttttgc 8040ctgtttgtgc ccctgttctc tgtagttgcg
ctaagagaat ggacctatga actgatggtt 8100ggtgaagaaa acaatatttt ggtgctggga
ttcttttttt ttctggatgc cagcttaaaa 8160agcgggctcc attatattta gtggatgcca
ggaataaact gttcacccag acacctacga 8220tgttatatat tctgtgtaac ccgcccccta
ttttgggcat gtacgggtta cagcagaatt 8280aaaaggctaa ttttttgact aaataaagtt
aggaaaatca ctactattaa ttatttacgt 8340attctttgaa atggcgagta ttgataatga
taaactggat ccgcggccgc ttacagatca 8400gtaacacacc cttccgatgc aggacgggtt
aatttagcga attttgccaa aactcccctg 8460gtggctttcg gagttggctt ctgataatta
gctcttctct ttgcgatttc ttcatcggaa 8520actttcaggg atatagagtt gttgactgca
tctatctcta ttatatcgtc atcttcaact 8580aagccgatta gtccaccctc aacggcttca
ggcacaatat ggccgacaac aaaaccgtga 8640gtgccaccgg agaatctacc atccgtaatt
aacgcgcaac ttttccctaa acccgcacca 8700attaatgctg atgtaggctt cagcatttcg
ggcataccag gtccgccgac gggacctata 8760ttcctaatta ccgctacatc tccagcatgc
aaacgaccag attctatgcc gtcgataaaa 8820tgttgttcac catcaaagac tctggcagtg
cctttgaaga actctccttc tttaccgcta 8880atttttgcta cggaaccccc ttgagctaaa
ttaccgtaca gaatctgcaa gtggccggtg 8940gccttgatag gattctttag tggcctcatg
atatcttgtg agtcgaaatc caagtctagg 9000gcagtctcga cattctcggc taatgtttta
cccgtcacag taaggcagtc accatgcaat 9060tttccttcct ttagaaggta cttaagcact
gctggcaagc ctccaatttt atgcaaatct 9120tccatcatat atttacctga aggtttaaaa
tcacctagta ctggagtaat gtcactaatt 9180ctttggaagt catcctgagt tatttcgaca
cctatcgcgt tagccattgc aataatatgc 9240aagacagcat tagtactacc ccccaagacc
atcacaatgg taatagcgtt ctcgaacgcc 9300tccttagtca ttatatcact aggcttgatg
tctttttcca aaagattctt aatggctaat 9360ccaatctcat cacattcttc ttgtttttct
tgagatactg cagggttcga agaagaatac 9420ggcaatgaca tacctagtgt ttcgatagcg
gcagctaagg tattagctgt gtacatcccc 9480ccacatgccc cttgaccagg aatagcatta
caaataacac cgtgataatc ttcatcagag 9540atattgccgg taattttctg gcctagagat
tcaaaagccg atacgatgtt caatttctca 9600cctttatatt caccgtgttc tattgttcct
ccatacacca taatgcttgg cctattaagt 9660cttgccatac caataataga acctggcata
tttttgtcac aacctgggat ggctacaatt 9720gcatcatagt attcagcgcc agcgttggtt
tcaatagagt cagctataac ttctctggaa 9780acaagggagt atctcattcc caactttcca
tttgctatcc catcagaaac tcctatcgta 9840tgaaattgta agccgatcag accatctgtc
tgatttactg agcttttaat ctttgatcca 9900agggttccta aatgcatgtt gcatggattt
ccatcccagt ccatcgacac tatacccact 9960tgagctttct tgaaatcttc gtctttaaac
ccgatgccgt aatacattgc ctgtgtggcg 10020ggttgtgtgg gatcttgtgt caacgttttg
ctgtacttat tcagttcaac agattcaact 10080ttgccgttat acttaaactc catgtcgaca
aacttagatt agattgctat gctttctttc 10140taatgagcaa gaagtaaaaa aagttgtaat
agaacaagaa aaatgaaact gaaacttgag 10200aaattgaaga ccgtttatta acttaaatat
caatgggagg tcatcgaaag agaaaaaaat 10260caaaaaaaaa attttcaaga aaaagaaacg
tgataaaaat ttttattgcc tttttcgacg 10320aagaaaaaga aacgaggcgg tctctttttt
cttttccaaa cctttagtac gggtaattaa 10380cgacacccta gaggaagaaa gaggggaaat
ttagtatgct gtgcttgggt gttttgaagt 10440ggtacggcga tgcgcggagt ccgagaaaat
ctggaagagt aaaaaaggag tagaaacatt 10500ttgaagctat gagctccagc ttttgttccc
tttagtgagg gttaattgcg cgcttggcgt 10560aatcatggtc atagctgttt cctgtgtgaa
attgttatcc gctcacaatt ccacacaaca 10620taggagccgg aagcataaag tgtaaagcct
ggggtgccta atgagtgagg taactcacat 10680taattgcgtt gcgctcactg cccgctttcc
agtcgggaaa cctgtcgtgc cagctgcatt 10740aatgaatcgg ccaacgcgcg gggagaggcg
gtttgcgtat tgggcgctct tccgcttcct 10800cgctcactga ctcgctgcgc tcggtcgttc
ggctgcggcg agcggtatca gctcactcaa 10860aggcggtaat acggttatcc acagaatcag
gggataacgc aggaaagaac atgtgagcaa 10920aaggccagca aaaggccagg aaccgtaaaa
aggccgcgtt gctggcgttt ttccataggc 10980tccgcccccc tgacgagcat cacaaaaatc
gacgctcaag tcagaggtgg cgaaacccga 11040caggactata aagataccag gcgtttcccc
ctggaagctc cctcgtgcgc tctcctgttc 11100cgaccctgcc gcttaccgga tacctgtccg
cctttctccc ttcgggaagc gtggcgcttt 11160ctcatagctc acgctgtagg tatctcagtt
cggtgtaggt cgttcgctcc aagctgggct 11220gtgtgcacga accccccgtt cagcccgacc
gctgcgcctt atccggtaac tatcgtcttg 11280agtccaaccc ggtaagacac gacttatcgc
cactggcagc agccactggt aacaggatta 11340gcagagcgag gtatgtaggc ggtgctacag
agttcttgaa gtggtggcct aactacggct 11400acactagaag gacagtattt ggtatctgcg
ctctgctgaa gccagttacc ttcggaaaaa 11460gagttggtag ctcttgatcc ggcaaacaaa
ccaccgctgg tagcggtggt ttttttgttt 11520gcaagcagca gattacgcgc agaaaaaaag
gatctcaaga agatcctttg atcttttcta 11580cggggtctga cgctcagtgg aacgaaaact
cacgttaagg gattttggtc atgagattat 11640caaaaaggat cttcacctag atccttttaa
attaaaaatg aagttttaaa tcaatctaaa 11700gtatatatga gtaaacttgg tctgacagtt
accaatgctt aatcagtgag gcacctatct 11760cagcgatctg tctatttcgt tcatccatag
ttgcctgact ccccgtcgtg tagataacta 11820cgatacggga gggcttacca tctggcccca
gtgctgcaat gataccgcga gacccacgct 11880caccggctcc agatttatca gcaataaacc
agccagccgg aagggccgag cgcagaagtg 11940gtcctgcaac tttatccgcc tccatccagt
ctattaattg ttgccgggaa gctagagtaa 12000gtagttcgcc agttaatagt ttgcgcaacg
ttgttgccat tgctacaggc atcgtggtgt 12060cacgctcgtc gtttggtatg gcttcattca
gctccggttc ccaacgatca aggcgagtta 12120catgatcccc catgttgtgc aaaaaagcgg
ttagctcctt cggtcctccg atcgttgtca 12180gaagtaagtt ggccgcagtg ttatcactca
tggttatggc agcactgcat aattctctta 12240ctgtcatgcc atccgtaaga tgcttttctg
tgactggtga gtactcaacc aagtcattct 12300gagaatagtg tatgcggcga ccgagttgct
cttgcccggc gtcaatacgg gataataccg 12360cgccacatag cagaacttta aaagtgctca
tcattggaaa acgttcttcg gggcgaaaac 12420tctcaaggat cttaccgctg ttgagatcca
gttcgatgta acccactcgt gcacccaact 12480gatcttcagc atcttttact ttcaccagcg
tttctgggtg agcaaaaaca ggaaggcaaa 12540atgccgcaaa aaagggaata agggcgacac
ggaaatgttg aatactcata ctcttccttt 12600ttcaatatta ttgaagcatt tatcagggtt
attgtctcat gagcggatac atatttgaat 12660gtatttagaa aaataaacaa ataggggttc
cgcgcacatt tccccgaaaa gtgccacctg 12720aacgaagcat ctgtgcttca ttttgtagaa
caaaaatgca acgcgagagc gctaattttt 12780caaacaaaga atctgagctg catttttaca
gaacagaaat gcaacgcgaa agcgctattt 12840taccaacgaa gaatctgtgc ttcatttttg
taaaacaaaa atgcaacgcg agagcgctaa 12900tttttcaaac aaagaatctg agctgcattt
ttacagaaca gaaatgcaac gcgagagcgc 12960tattttacca acaaagaatc tatacttctt
ttttgttcta caaaaatgca tcccgagagc 13020gctatttttc taacaaagca tcttagatta
ctttttttct cctttgtgcg ctctataatg 13080cagtctcttg ataacttttt gcactgtagg
tccgttaagg ttagaagaag gctactttgg 13140tgtctatttt ctcttccata aaaaaagcct
gactccactt cccgcgttta ctgattacta 13200gcgaagctgc gggtgcattt tttcaagata
aaggcatccc cgattatatt ctataccgat 13260gtggattgcg catactttgt gaacagaaag
tgatagcgtt gatgattctt cattggtcag 13320aaaattatga acggtttctt ctattttgtc
tctatatact acgtatagga aatgtttaca 13380ttttcgtatt gttttcgatt cactctatga
atagttctta ctacaatttt tttgtctaaa 13440gagtaatact agagataaac ataaaaaatg
tagaggtcga gtttagatgc aagttcaagg 13500agcgaaaggt ggatgggtag gttatatagg
gatatagcac agagatatat agcaaagaga 13560tacttttgag caatgtttgt ggaagcggta
ttcgcaatat tttagtagct cgttacagtc 13620cggtgcgttt ttggtttttt gaaagtgcgt
cttcagagcg cttttggttt tcaaaagcgc 13680tctgaagttc ctatactttc tagagaatag
gaacttcgga ataggaactt caaagcgttt 13740ccgaaaacga gcgcttccga aaatgcaacg
cgagctgcgc acatacagct cactgttcac 13800gtcgcaccta tatctgcgtg ttgcctgtat
atatatatac atgagaagaa cggcatagtg 13860cgtgtttatg cttaaatgcg tacttatatg
cgtctattta tgtaggatga aaggtagtct 13920agtacctcct gtgatattat cccattccat
gcggggtatc gtatgcttcc ttcagcacta 13980ccctttagct gttctatatg ctgccactcc
tcaattggat tagtctcatc cttcaatgct 14040atcatttcct ttgata
14056581716DNABacillus subtilis
58atgttgacta aagctacaaa agagcagaaa tcattggtga aaaatagggg tgcagaactt
60gttgtggact gtttggtaga acagggcgta acacatgttt ttggtatccc aggtgcaaaa
120atcgacgccg tgtttgatgc attacaagac aagggtccag aaattattgt tgctagacat
180gagcaaaatg ccgcatttat ggcgcaagct gtaggtaggc ttacaggtaa acctggtgtt
240gtcctagtta cgtctggccc aggagcctcc aatttagcaa ctggtctatt gacagctaat
300actgagggag atcctgtagt tgcgttagcc ggtaatgtaa ttagagctga taggcttaag
360agaactcacc agtctctaga caacgctgct ttattccaac cgatcaccaa gtactcagta
420gaggtacaag acgtaaagaa tatacctgaa gctgtgacaa acgcatttcg tatagcttct
480gctggtcagg ctggtgccgc gtttgtttct tttcctcaag acgttgtcaa tgaagtgacc
540aatactaaaa acgttagagc ggttgcagcc cctaaactag gtccagccgc agacgacgca
600attagcgctg caattgctaa aattcagacg gcgaaactac cagtagtcct tgtcggtatg
660aagggcggaa gaccagaagc aataaaagct gttcgtaagt tattgaagaa agtccaatta
720cctttcgttg agacttacca agcagcaggt actttatcta gagatttaga ggatcagtat
780tttggaagga taggtctatt tagaaaccaa ccaggagatt tactattaga acaagctgat
840gttgtactta ctatcggtta tgatcctata gagtatgacc caaagttttg gaacataaat
900ggggatagaa caattataca tctagacgag ataatcgccg acatcgatca cgcttatcaa
960ccagatttag aactaatcgg agatatcccg tcaacaatca atcatattga acatgatgct
1020gtaaaggttg agttcgctga acgtgagcag aaaatcttat ctgatctaaa gcaatatatg
1080catgagggtg aacaagttcc agcagactgg aaatctgacc gtgcacatcc tttggaaatc
1140gttaaggaac taagaaatgc ggtcgatgat catgtgactg ttacatgtga tatcggttca
1200catgcaattt ggatgtcacg ttattttagg agctacgaac cattaacttt aatgatatct
1260aacgggatgc aaactctggg ggttgcactt ccttgggcta ttggcgctag tttagttaag
1320cccggtgaga aggtggtatc ggtatcaggt gatggtggct ttctgttttc ggctatggaa
1380ttagaaactg cagtccgttt aaaagctccc attgtgcata ttgtctggaa tgattctact
1440tacgacatgg ttgcttttca acagttgaag aaatacaata gaacttcggc tgtagacttt
1500ggtaacatcg atattgtgaa atatgctgag tcttttggcg caacaggcct gagggtggaa
1560agtccagatc agttagctga tgtgttgaga caagggatga atgccgaggg accggtaatc
1620atagatgtgc cagttgacta ctcagacaat attaatttgg cttctgataa acttcctaaa
1680gagtttggcg agctaatgaa gaccaaagcc ttataa
1716591647DNALactococcus lactis 59atgtatactg ttggtgatta tctgctggac
cgtctgcatg aactgggtat cgaagaaatc 60ttcggcgttc cgggtgatta caatctgcag
ttcctggatc agatcatctc tcataaagac 120atgaaatggg tgggtaacgc taacgaactg
aacgcaagct acatggcaga tggttatgca 180cgtaccaaga aagccgcggc atttctgacc
actttcggtg ttggcgaact gagcgccgtc 240aacggtctgg cgggctccta cgccgaaaac
ctgccggtgg tggagatcgt aggcagccca 300acgagcaaag ttcagaacga aggtaaattc
gtccaccaca ctctggctga cggcgatttc 360aaacacttca tgaaaatgca tgaacctgtg
actgcggcac gtacgctgct gactgcagag 420aacgctactg tggaaatcga ccgcgttctg
tctgcgctgc tgaaagaacg caaaccagtt 480tacatcaacc tgcctgtgga tgttgcggca
gctaaagcgg aaaaaccgag cctgccgctg 540aagaaagaaa actccacttc taacactagc
gaccaggaaa tcctgaacaa aatccaggag 600tctctgaaaa acgcaaagaa accaatcgtg
atcaccggcc acgaaatcat ttcttttggt 660ctggagaaga ccgtgaccca attcatcagc
aaaaccaaac tgccgattac caccctgaac 720ttcggcaagt cctctgttga cgaggctctg
ccgtctttcc tgggcatcta caacggtact 780ctgagcgaac cgaacctgaa agaatttgtt
gaatctgcgg acttcatcct gatgctgggc 840gttaaactga ccgactcttc taccggtgca
ttcactcacc atctgaacga aaacaaaatg 900attagcctga acatcgacga gggtaaaatc
ttcaacgagc gtatccagaa cttcgacttc 960gaaagcctga tcagctctct gctggacctg
tccgaaatcg agtataaagg caaatacatt 1020gacaaaaagc aagaagattt cgtaccatct
aacgcactgc tgtcccagga tcgcctgtgg 1080caggccgtgg agaacctgac ccagagcaat
gaaaccatcg tggcggaaca aggtacgagc 1140tttttcggcg cgtcttctat ctttctgaaa
tccaaaagcc attttatcgg tcagccgctg 1200tggggtagca ttggctatac tttcccggca
gcgctgggct ctcagatcgc tgataaagaa 1260tctcgtcatc tgctgttcat cggtgacggt
tccctgcagc tgaccgtaca ggaactgggt 1320ctggcaattc gtgaaaagat caacccgatt
tgcttcatta ttaacaatga cggctacacc 1380gttgagcgtg agatccacgg tccgaaccag
tcttacaacg atatccctat gtggaactac 1440tctaaactgc cggagtcctt cggcgcaact
gaggaccgtg ttgtgtctaa aattgtgcgt 1500accgaaaacg aatttgtgag cgtgatgaaa
gaggcccagg ccgatccgaa ccgtatgtac 1560tggatcgaac tgatcctggc gaaagaaggc
gcaccgaagg tactgaagaa aatgggcaag 1620ctgtttgctg aacagaataa atcctaa
164760771DNADrosophila melanogaster
60atgtcgttta ctttgaccaa caagaacgtg attttcgttg ccggtctggg aggcattggt
60ctggacacca gcaaggagct gctcaagcgc gatctgaaga acctggtgat cctcgaccgc
120attgagaacc cggctgccat tgccgagctg aaggcaatca atccaaaggt gaccgtcacc
180ttctacccct atgatgtgac cgtgcccatt gccgagacca ccaagctgct gaagaccatc
240ttcgcccagc tgaagaccgt cgatgtcctg atcaacggag ctggtatcct ggacgatcac
300cagatcgagc gcaccattgc cgtcaactac actggcctgg tcaacaccac gacggccatt
360ctggacttct gggacaagcg caagggcggt cccggtggta tcatctgcaa cattggatcc
420gtcactggat tcaatgccat ctaccaggtg cccgtctact ccggcaccaa ggccgccgtg
480gtcaacttca ccagctccct ggcgaaactg gcccccatta ccggcgtgac ggcttacact
540gtgaaccccg gcatcacccg caccaccctg gtgcacacgt tcaactcctg gttggatgtt
600gagcctcagg ttgccgagaa gctcctggct catcccaccc agccctcgtt ggcctgcgcc
660gagaacttcg tcaaggctat cgagctgaac cagaacggag ccatctggaa actggacttg
720ggcaccctgg aggccatcca gtggaccaag cactgggact ccggcatcta a
771611476DNAArtificial SequenceEc_ilvC_coSc_Q110V 61atggccaact attttaacac
attaaatttg agacaacaat tggctcaact gggtaagtgc 60agatttatgg gaagggacga
gtttgctgat ggtgcttctt atctgcaagg aaagaaagta 120gtaattgttg gctgcggtgc
tcagggtcta aaccaaggtt taaacatgag agattcaggt 180ctggatattt cgtatgcatt
gaggaaagag gcaattgcag aaaagagggc ctcctggcgt 240aaagcgacgg aaaatgggtt
caaagttggt acttacgaag aactgatccc tcaggcagat 300ttagtgatta acctaacacc
agataaggtt cactcagacg tagtaagaac agttcaaccg 360ctgatgaagg atggggcagc
tttaggttac tctcatggct ttaatatcgt tgaagtgggc 420gagcagatca gaaaagatat
aacagtcgta atggttgcac caaagtgccc aggtacggaa 480gtcagagagg agtacaagag
gggttttggt gtacctacat tgatcgccgt acatcctgaa 540aatgacccca aaggtgaagg
tatggcaatt gcgaaggcat gggcagccgc aaccggaggt 600catagagcgg gtgtgttaga
gagttctttc gtagctgagg tcaagagtga cttaatgggt 660gaacaaacca ttctgtgcgg
aatgttgcag gcagggtctt tactatgctt tgataaattg 720gtcgaagagg gtacagatcc
tgcctatgct gaaaagttga tacaatttgg ttgggagaca 780atcaccgagg cacttaaaca
aggtggcata acattgatga tggatagact ttcaaatccg 840gccaagctaa gagcctacgc
cttatctgag caactaaaag agatcatggc accattattc 900caaaagcaca tggacgatat
tatctccggt gagttttcct caggaatgat ggcagattgg 960gcaaacgatg ataaaaagtt
attgacgtgg agagaagaaa ccggcaagac ggcattcgag 1020acagccccac aatacgaagg
taaaattggt gaacaagaat actttgataa gggagtattg 1080atgatagcta tggtgaaggc
aggggtagaa cttgcattcg aaactatggt tgactccggt 1140atcattgaag aatctgcata
ctatgagtct ttgcatgaat tgcctttgat agcaaatact 1200attgcaagaa aaagacttta
cgagatgaat gttgtcatat cagacactgc agaatatggt 1260aattacttat ttagctacgc
atgtgtcccg ttgttaaagc ccttcatggc cgagttacaa 1320cctggtgatt tggggaaggc
tattccggaa ggagcggttg acaatggcca actgagagac 1380gtaaatgaag ctattcgttc
acatgctata gaacaggtgg gtaaaaagct gagaggatat 1440atgaccgata tgaaaagaat
tgcagtggca ggatga 1476621698DNAArtificial
SequenceSc_ILV3 N20 deletion 62atgaagaagc tcaacaagta ctcgtatatc
atcactgaac ctaagggcca aggtgcgtcc 60caggccatgc tttatgccac cggtttcaag
aaggaagatt tcaagaagcc tcaagtcggg 120gttggttcct gttggtggtc cggtaaccca
tgtaacatgc atctattgga cttgaataac 180agatgttctc aatccattga aaaagcgggt
ttgaaagcta tgcagttcaa caccatcggt 240gtttcagacg gtatctctat gggtactaaa
ggtatgagat actcgttaca aagtagagaa 300atcattgcag actcctttga aaccatcatg
atggcacaac actacgatgc taacatcgcc 360atcccatcat gtgacaaaaa catgcccggt
gtcatgatgg ccatgggtag acataacaga 420ccttccatca tggtatatgg tggtactatc
ttgcccggtc atccaacatg tggttcttcg 480aagatctcta aaaacatcga tatcgtctct
gcgttccaat cctacggtga atatatttcc 540aagcaattca ctgaagaaga aagagaagat
gttgtggaac atgcatgccc aggtcctggt 600tcttgtggtg gtatgtatac tgccaacaca
atggcttctg ccgctgaagt gctaggtttg 660accattccaa actcctcttc cttcccagcc
gtttccaagg agaagttagc tgagtgtgac 720aacattggtg aatacatcaa gaagacaatg
gaattgggta ttttacctcg tgatatcctc 780acaaaagagg cttttgaaaa cgccattact
tatgtcgttg caaccggtgg gtccactaat 840gctgttttgc atttggtggc tgttgctcac
tctgcgggtg tcaagttgtc accagatgat 900ttccaaagaa tcagtgatac tacaccattg
atcggtgact tcaaaccttc tggtaaatac 960gtcatggccg atttgattaa cgttggtggt
acccaatctg tgattaagta tctatatgaa 1020aacaacatgt tgcacggtaa cacaatgact
gttaccggtg acactttggc agaacgtgca 1080aagaaagcac caagcctacc tgaaggacaa
gagattatta agccactctc ccacccaatc 1140aaggccaacg gtcacttgca aattctgtac
ggttcattgg caccaggtgg agctgtgggt 1200aaaattaccg gtaaggaagg tacttacttc
aagggtagag cacgtgtgtt cgaagaggaa 1260ggtgccttta ttgaagcctt ggaaagaggt
gaaatcaaga agggtgaaaa aaccgttgtt 1320gttatcagat atgaaggtcc aagaggtgca
ccaggtatgc ctgaaatgct aaagccttcc 1380tctgctctga tgggttacgg tttgggtaaa
gatgttgcat tgttgactga tggtagattc 1440tctggtggtt ctcacgggtt cttaatcggc
cacattgttc ccgaagccgc tgaaggtggt 1500cctatcgggt tggtcagaga cggcgatgag
attatcattg atgctgataa taacaagatt 1560gacctattag tctctgataa ggaaatggct
caacgtaaac aaagttgggt tgcacctcca 1620cctcgttaca caagaggtac tctatccaag
tatgctaagt tggtttccaa cgcttccaac 1680ggttgtgttt tagatgct
16986314056DNAArtificial SequencepGV2247
63ttggatcata ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca
60cgaggccctt tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc
120tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg
180gcgcgtcagc gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga
240ttgtactgag agtgcaccat accacagctt ttcaattcaa ttcatcattt tttttttatt
300cttttttttg atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg
360aagaacgaag gaaggagcac agacttagat tggtatatat acgcatatgg caaattaaag
420ccttcgagcg tcccaaaacc ttctcaagca aggttttcag tataatgtta catgcgtaca
480cgcgtctgta cagaaaaaaa agaaaaattt gaaatataaa taacgttctt aatactaaca
540taactataaa aaaataaata gggacctaga cttcaggttg tctaactcct tccttttcgg
600ttagagcgga tgtgggggga gggcgtgaat gtaagcgtga cataactaat tacatgactc
660gacctaggtt atttagtaaa atcaatgacc attcggcctt caatttttcc tgccttcatt
720tcatcaataa tatcattgat ttcttccagt ttgcgtgtcg caacaattgg ttttacctta
780ccttctgctc caaattgaaa agcttctgcc aagtcaagtc ttgttccgac aagtgaacct
840gcaacctcca ctccgtcaaa aacaactgtt ggaactgata aagtcatctc agtattggga
900agtgccacag caaccatttt gcccataggt ttcaaagaag caaccgcttg ttcaaaagca
960atccttgcaa cagcacaaac tattgcactt tgcaccccta agccgccagt tattttttta
1020atttcatcaa ctggatttac atcaccagaa ttgataatca catcagctcc aattttttta
1080gctaaattta atttatcttg attaatatca acagcaatta cttttgctcc aaaaacattt
1140ttagcatatt gaattgctaa atttccaagt cctccagcac caaaaattac ttgccaatca
1200ccaggtttta ctcctgatac tttgattgct ttgtaagttg ttactccagc acaagtaatt
1260gagctagctt caattgggtc aagtccgtca ggaactttga cagcataatc ggcaacaaca
1320attgcttctt cagccattcc gccatcaact gaatatcctg catttttaac ttctcgacaa
1380aaagtttcat taccagatac acagtattca cagtgaccac atccttcaaa gaaccaagcc
1440actgaaaccc gatcaccaac ttgaagcgag cttacatcag ctccaatttc tttgacaatt
1500ccaattcctt catgaccaag aacagtccct gctttgttgc cataatcacc tgctgcaacg
1560tgcaaatcgg tatgacagac tccacaatac tccatgtcaa gcaaagcttc attaggtttg
1620attgctcgaa gttccttttc aacaaggtcc gcataaccat ctggattgtg tcttactact
1680gctgctttca ttggtaccta ttattgtatg ttatagtatt agttgcttgg tgttatgaaa
1740gaaactaaga aaagaaaaat aaaataaaaa taaaagattg agacaaggga agaaaagata
1800caaaataaga attaattaca attgcgtttg ctataaatac gtttttaaca atcaactctg
1860gtaggaagat aatgcttttt ttttttatat atgcttggtg ccacttgtca catacaattc
1920tacaaccttc gacaaaaatc caaatgatag taagatcaaa gccagaaagc aatggagaaa
1980aaaaattaat gaaccacgat gaaccaaatg atcaatacaa ccaaagaaac taccctagtg
2040aggtgtatgc tgacttggta tcacacttca tgaattttgc atatggcaaa gtccacgaaa
2100gtgggcttca gaaaaaaggc gtgcggtgtg tagatgtatc aattagtgga tgccagtttt
2160ggaacgggat tccactttcc gcaagttggt gcacgtcgtt agtgacataa cgccgcgttc
2220atctttggga agaagcagat gctgagcgag gaggtactat agagtaaaga accctttcta
2280tacccgcagc cccatggtaa gtgacagtgc agtaataata tgaaccaatt tatttttcgt
2340tacataaaaa tgcttataaa actttaacta ataattagag attaaatcgc ggccgcaaaa
2400gatccttagg atttattctg ttcagcaaac agcttgccca ttttcttcag taccttcggt
2460gcgccttctt tcgccaggat cagttcgatc cagtacatac ggttcggatc ggcctgggcc
2520tctttcatca cgctcacaaa ttcgttttcg gtacgcacaa ttttagacac aacacggtcc
2580tcagttgcgc cgaaggactc cggcagttta gagtagttcc acatagggat atcgttgtaa
2640gactggttcg gaccgtggat ctcacgctca acggtgtagc cgtcattgtt aataatgaag
2700caaatcgggt tgatcttttc acgaattgcc agacccagtt cctgtacggt cagctgcagg
2760gaaccgtcac cgatgaacag cagatgacga gattctttat cagcgatctg agagcccagc
2820gctgccggga aagtatagcc aatgctaccc cacagcggct gaccgataaa atggcttttg
2880gatttcagaa agatagaaga cgcgccgaaa aagctcgtac cttgttccgc cacgatggtt
2940tcattgctct gggtcaggtt ctccacggcc tgccacaggc gatcctggga cagcagtgcg
3000ttagatggta cgaaatcttc ttgctttttg tcaatgtatt tgcctttata ctcgatttcg
3060gacaggtcca gcagagagct gatcaggctt tcgaagtcga agttctggat acgctcgttg
3120aagattttac cctcgtcgat gttcaggcta atcattttgt tttcgttcag atggtgagtg
3180aatgcaccgg tagaagagtc ggtcagttta acgcccagca tcaggatgaa gtccgcagat
3240tcaacaaatt ctttcaggtt cggttcgctc agagtaccgt tgtagatgcc caggaaagac
3300ggcagagcct cgtcaacaga ggacttgccg aagttcaggg tggtaatcgg cagtttggtt
3360ttgctgatga attgggtcac ggtcttctcc agaccaaaag aaatgatttc gtggccggtg
3420atcacgattg gtttctttgc gtttttcaga gactcctgga ttttgttcag gatttcctgg
3480tcgctagtgt tagaagtgga gttttctttc ttcagcggca ggctcggttt ttccgcttta
3540gctgccgcaa catccacagg caggttgatg taaactggtt tgcgttcttt cagcagcgca
3600gacagaacgc ggtcgatttc cacagtagcg ttctctgcag tcagcagcgt acgtgccgca
3660gtcacaggtt catgcatttt catgaagtgt ttgaaatcgc cgtcagccag agtgtggtgg
3720acgaatttac cttcgttctg aactttgctc gttgggctgc ctacgatctc caccaccggc
3780aggttttcgg cgtaggagcc cgccagaccg ttgacggcgc tcagttcgcc aacaccgaaa
3840gtggtcagaa atgccgcggc tttcttggta cgtgcataac catctgccat gtagcttgcg
3900ttcagttcgt tagcgttacc cacccatttc atgtctttat gagagatgat ctgatccagg
3960aactgcagat tgtaatcacc cggaacgccg aagatttctt cgatacccag ttcatgcaga
4020cggtccagca gataatcacc aacagtatac atgtcgagct tgttttatat ttgttgtaaa
4080aagtagataa ttacttcctt gatgatctgt aaaaaagaga aaaagaaagc atctaagaac
4140ttgaaaaact acgaattaga aaagaccaaa tatgtatttc ttgcattgac caatttatgc
4200aagtttatat atatgtaaat gtaagtttca cgaggttcta ctaaactaaa ccaccccctt
4260ggttagaaga aaagagtgtg tgagaacagg ctgttgttgt cacacgattc ggacaattct
4320gtttgaaaga gagagagtaa cagtacgatc gaacgaactt tgctctggag atcacagtgg
4380gcatcatagc atgtggtact aaaccctttc ccgccattcc agaaccttcg attgcttgtt
4440acaaaacctg tgagccgtcg ctaggacctt gttgtgtgac gaaattggaa gctgcaatca
4500ataggaagac aggaagtcga gcgtgtctgg gttttttcag ttttgttctt tttgcaaaca
4560aatcacgagc gacggtaatt tctttctcga taagaggcca cgtgctttat gagggtaaca
4620tcaattcaag aaggagggaa acacttcctt tttctggccc tgataatagt atgagggtga
4680agccaaaata aaggattcgc gcccaaatcg gcatctttaa atgcaggtat gcgatagttc
4740ctcactcttt ccttactcac gagtaattct tgcaaatgcc tattatgcag atgttataat
4800atctgtgcgt cttgagttga gcctagaatt cttagaaaaa ctcatcgagc atcaaatgaa
4860actgcaattt attcatatca ggattatcaa taccatattt ttgaaaaagc cgtttctgta
4920atgaaggaga aaactcaccg aggcagttcc ataggatggc aagatcctgg tatcggtctg
4980cgatcccgac tcgtccaaca tcaatacaac ctattaattt cccctcgtca aaaataaggt
5040tatcaagtga gaaatcacca tgagtgacga ctgaatccgg tgagaatggc aaaagcttat
5100gcatttcttt ccagacttgt tcaacaggcc agccattacg ctcgtcatca aaatcactcg
5160cgtcaaccaa accgttattc attcgtgatt gcgcctgagc gaggcgaaat acgcgatcgc
5220tgttaaaagg acaattacaa acaggaatcg aatgcaaccg gcgcaggaac actgccagcg
5280catcaacaat attttcacct gaatcaggat attcttctaa tacctggaat gctgttttgc
5340cggggatcgc agtggtgagt aaccatgcat catcaggagt acggacaaaa tgcttgatgg
5400tcggaagagg cataaattcc gtcagccagt ttagtctgac catctcatct gcaacatcat
5460tggcaacgct acctttgcca tgtttcagaa acaactctgg cgcatcgggc ttcccataca
5520atcgatagat tgtcgcacct gattgcccga cattatcgcg agcccattta tacccatata
5580aatcagcatc catgttggaa tttaatcgcg gcctcgaaac gtgagtcttt tccttaccca
5640tactagtttt tagtttatgt atgtgttttt tgtagttata gatttaagca agaaaagaat
5700acaaacaaaa aattgaaaaa gattgattta gaattaaaaa gaaaaatatt tacgtaagaa
5760gggaaaatag taaatgttgc aagttcacta aactcctaaa ttatgctgcc ctttatattc
5820cctgttacag cagccgagcc aaaggtatat aggctccttt gcattagcat gcgtaacaaa
5880ccacctgtca gtttcaaccg aggtggtatc cgagagaatt gtgtgattgc tttaattaat
5940ttcggagaat ctcacatgcc actgaagatt aaaaactgga tgccagaaaa ggggtgtcca
6000ggtgtaacat caatagagga agctgaaaag tcttagaacg ggtaatcttc caccaacctg
6060atgggttcct agatataatc tcgaagggaa taagtagggt gataccgcag aagtgtctga
6120atgtattaag gtcctcacag tttaaatccc gctcacacta acgtaggatt attataactc
6180aaaaaaatgg cattattcta agtaagttaa atatccgtaa tctttaaaca gcggccgcgg
6240atcttcatcc tgccactgca attcttttca tatcggtcat atatcctctc agctttttac
6300ccacctgttc tatagcatgt gaacgaatag cttcatttac gtctctcagt tggccattgt
6360caaccgctcc ttccggaata gccttcccca aatcaccagg ttgtaactcg gccatgaagg
6420gctctaacaa cgggacacac gcgtagctaa ataagtaatt accatattct gcagtgtctg
6480atatgacaac attcatctcg taaagtcttt ttcttgcaat agtatttgct atcaaaggca
6540attcatgcaa agactcatag tatgcagatt cttcaatgat accggagtca accatagttt
6600cgaatgcaag ttctacccct gccttcacca tagctatcat caatactccc ttatcaaagt
6660attcttgttc accaatttta ccttcgtatt gtggggctgt ctcgaatgcc gtcttgccgg
6720tttcttctct ccacgtcaat aactttttat catcgtttgc ccaatctgcc atcattcctg
6780aggaaaactc accggagata atatcgtcca tgtgcttttg gaataatggt gccatgatct
6840cttttagttg ctcagataag gcgtaggctc ttagcttggc cggatttgaa agtctatcca
6900tcatcaatgt tatgccacct tgtttaagtg cctcggtgat tgtctcccaa ccaaattgta
6960tcaacttttc agcataggca ggatctgtac cctcttcgac caatttatca aagcatagta
7020aagaccctgc ctgcaacatt ccgcacagaa tggtttgttc acccattaag tcactcttga
7080cctcagctac gaaagaactc tctaacacac ccgctctatg acctccggtt gcggctgccc
7140atgccttcgc tattgccata ccttcacgtt tggggtcatt ttcaggatgt acggcgatca
7200atgtaggtac accaaaaccc ctcttgtact cctctctgac ttccgtacct gggcactttg
7260gcgcaaccat tacgactgtt ataccttttc tgatctgctc gcccacttca acgatattaa
7320agccatgaga gtaacctaaa gctgccccat ccttcatcag cggttgaact gttcttacta
7380cgtctgagtg aaccttatct ggtgttaggt taatcactaa atctgcctga gggatcagtt
7440cttcgtaagt accaactttg aacccatttt ccgtcgcttt acgccaatcg gcatcctttt
7500ctgcaataga ctctttcctc aatgcatacg aaatatccag acctgaatct ctcatgttta
7560aaccttggtt tagaccctga gcaccgcagc caacaattac tactttcttt ccttgcagat
7620aagaagcacc atcagcaaac tcgtcccttc ccataaatct gcacttaccc agttgagcca
7680attgttgtct caaatttaat gtgttaaaat agttggccat gtcgagtcga aactaagttc
7740tggtgtttta aaactaaaaa aaagactaac tataaaagta gaatttaaga agtttaagaa
7800atagatttac agaattacaa tcaataccta ccgtctttat atacttatta gtcaagtagg
7860ggaataattt cagggaactg gtttcaacct tttttttcag ctttttccaa atcagagaga
7920gcagaaggta atagaaggtg taagaaaatg agatagatac atgcgtgggt caattgcctt
7980gtgtcatcat ttactccagg caggttgcat cactccattg aggttgtgcc cgttttttgc
8040ctgtttgtgc ccctgttctc tgtagttgcg ctaagagaat ggacctatga actgatggtt
8100ggtgaagaaa acaatatttt ggtgctggga ttcttttttt ttctggatgc cagcttaaaa
8160agcgggctcc attatattta gtggatgcca ggaataaact gttcacccag acacctacga
8220tgttatatat tctgtgtaac ccgcccccta ttttgggcat gtacgggtta cagcagaatt
8280aaaaggctaa ttttttgact aaataaagtt aggaaaatca ctactattaa ttatttacgt
8340attctttgaa atggcgagta ttgataatga taaactggat ccgcggccgc ttacagatca
8400gtaacacacc cttccgatgc aggacgggtt aatttagcga attttgccaa aactcccctg
8460gtggctttcg gagttggctt ctgataatta gctcttctct ttgcgatttc ttcatcggaa
8520actttcaggg atatagagtt gttgactgca tctatctcta ttatatcgtc atcttcaact
8580aagccgatta gtccaccctc aacggcttca ggcacaatat ggccgacaac aaaaccgtga
8640gtgccaccgg agaatctacc atccgtaatt aacgcgcaac ttttccctaa acccgcacca
8700attaatgctg atgtaggctt cagcatttcg ggcataccag gtccgccgac gggacctata
8760ttcctaatta ccgctacatc tccagcatgc aaacgaccag attctatgcc gtcgataaaa
8820tgttgttcac catcaaagac tctggcagtg cctttgaaga actctccttc tttaccgcta
8880atttttgcta cggaaccccc ttgagctaaa ttaccgtaca gaatctgcaa gtggccggtg
8940gccttgatag gattctttag tggcctcatg atatcttgtg agtcgaaatc caagtctagg
9000gcagtctcga cattctcggc taatgtttta cccgtcacag taaggcagtc accatgcaat
9060tttccttcct ttagaaggta cttaagcact gctggcaagc ctccaatttt atgcaaatct
9120tccatcatat atttacctga aggtttaaaa tcacctagta ctggagtaat gtcactaatt
9180ctttggaagt catcctgagt tatttcgaca cctatcgcgt tagccattgc aataatatgc
9240aagacagcat tagtactacc ccccaagacc atcacaatgg taatagcgtt ctcgaacgcc
9300tccttagtca ttatatcact aggcttgatg tctttttcca aaagattctt aatggctaat
9360ccaatctcat cacattcttc ttgtttttct tgagatactg cagggttcga agaagaatac
9420ggcaatgaca tacctagtgt ttcgatagcg gcagctaagg tattagctgt gtacatcccc
9480ccacatgccc cttgaccagg aatagcatta caaataacac cgtgataatc ttcatcagag
9540atattgccgg taattttctg gcctagagat tcaaaagccg atacgatgtt caatttctca
9600cctttatatt caccgtgttc tattgttcct ccatacacca taatgcttgg cctattaagt
9660cttgccatac caataataga acctggcata tttttgtcac aacctgggat ggctacaatt
9720gcatcatagt attcagcgcc agcgttggtt tcaatagagt cagctataac ttctctggaa
9780acaagggagt atctcattcc caactttcca tttgctatcc catcagaaac tcctatcgta
9840tgaaattgta agccgatcag accatctgtc tgatttactg agcttttaat ctttgatcca
9900agggttccta aatgcatgtt gcatggattt ccatcccagt ccatcgacac tatacccact
9960tgagctttct tgaaatcttc gtctttaaac ccgatgccgt aatacattgc ctgtgtggcg
10020ggttgtgtgg gatcttgtgt caacgttttg ctgtacttat tcagttcaac agattcaact
10080ttgccgttat acttaaactc catgtcgaca aacttagatt agattgctat gctttctttc
10140taatgagcaa gaagtaaaaa aagttgtaat agaacaagaa aaatgaaact gaaacttgag
10200aaattgaaga ccgtttatta acttaaatat caatgggagg tcatcgaaag agaaaaaaat
10260caaaaaaaaa attttcaaga aaaagaaacg tgataaaaat ttttattgcc tttttcgacg
10320aagaaaaaga aacgaggcgg tctctttttt cttttccaaa cctttagtac gggtaattaa
10380cgacacccta gaggaagaaa gaggggaaat ttagtatgct gtgcttgggt gttttgaagt
10440ggtacggcga tgcgcggagt ccgagaaaat ctggaagagt aaaaaaggag tagaaacatt
10500ttgaagctat gagctccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt
10560aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca
10620taggagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagg taactcacat
10680taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt
10740aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct
10800cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
10860aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
10920aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
10980tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
11040caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
11100cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
11160ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
11220gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
11280agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
11340gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
11400acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
11460gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
11520gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
11580cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
11640caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
11700gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
11760cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
11820cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
11880caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
11940gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
12000gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt
12060cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta
12120catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca
12180gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta
12240ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct
12300gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg
12360cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac
12420tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact
12480gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa
12540atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt
12600ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat
12660gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg
12720aacgaagcat ctgtgcttca ttttgtagaa caaaaatgca acgcgagagc gctaattttt
12780caaacaaaga atctgagctg catttttaca gaacagaaat gcaacgcgaa agcgctattt
12840taccaacgaa gaatctgtgc ttcatttttg taaaacaaaa atgcaacgcg agagcgctaa
12900tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac gcgagagcgc
12960tattttacca acaaagaatc tatacttctt ttttgttcta caaaaatgca tcccgagagc
13020gctatttttc taacaaagca tcttagatta ctttttttct cctttgtgcg ctctataatg
13080cagtctcttg ataacttttt gcactgtagg tccgttaagg ttagaagaag gctactttgg
13140tgtctatttt ctcttccata aaaaaagcct gactccactt cccgcgttta ctgattacta
13200gcgaagctgc gggtgcattt tttcaagata aaggcatccc cgattatatt ctataccgat
13260gtggattgcg catactttgt gaacagaaag tgatagcgtt gatgattctt cattggtcag
13320aaaattatga acggtttctt ctattttgtc tctatatact acgtatagga aatgtttaca
13380ttttcgtatt gttttcgatt cactctatga atagttctta ctacaatttt tttgtctaaa
13440gagtaatact agagataaac ataaaaaatg tagaggtcga gtttagatgc aagttcaagg
13500agcgaaaggt ggatgggtag gttatatagg gatatagcac agagatatat agcaaagaga
13560tacttttgag caatgtttgt ggaagcggta ttcgcaatat tttagtagct cgttacagtc
13620cggtgcgttt ttggtttttt gaaagtgcgt cttcagagcg cttttggttt tcaaaagcgc
13680tctgaagttc ctatactttc tagagaatag gaacttcgga ataggaactt caaagcgttt
13740ccgaaaacga gcgcttccga aaatgcaacg cgagctgcgc acatacagct cactgttcac
13800gtcgcaccta tatctgcgtg ttgcctgtat atatatatac atgagaagaa cggcatagtg
13860cgtgtttatg cttaaatgcg tacttatatg cgtctattta tgtaggatga aaggtagtct
13920agtacctcct gtgatattat cccattccat gcggggtatc gtatgcttcc ttcagcacta
13980ccctttagct gttctatatg ctgccactcc tcaattggat tagtctcatc cttcaatgct
14040atcatttcct ttgata
14056641476DNAArtificial SequenceEc_ilvC_coSc_P2D1-A1 64atggccaact
attttaacac attaaatttg agacaacaat tggctcaact gggtaagtgc 60agatttatgg
gaagggacga gtttgctgat ggtgcttctt atctgcaagg aaagaaagta 120gtaattgttg
gctgcggtgc tcagggtcta aaccaaggtt taaacatgag agattcaggt 180ctggatattt
cgtatgcatt gaggaaagag tctattgcag aaaaggatgc cgattggcgt 240aaagcgacgg
aaaatgggtt caaagttggt acttacgaag aactgatccc tcaggcagat 300ttagtgatta
acctaacacc agataaggtt cactcagacg tagtaagaac agttcaaccg 360ctgatgaagg
atggggcagc tttaggttac tctcatggct ttaatatcgt tgaagtgggc 420gagcagatca
gaaaaggtat aacagtcgta atggttgcgc caaagtgccc aggtacggaa 480gtcagagagg
agtacaagag gggttttggt gtacctacat tgatcgccgt acatcctgaa 540aatgacccca
aacgtgaagg tatggcaata gcgaaggcat gggcagccgc aaccggaggt 600catagagcgg
gtgtgttaga gagttctttc gtagctgagg tcaagagtga cttaatgggt 660gaacaaacca
ttctgtgcgg aatgttgcag gcagggtctt tactatgctt tgataaattg 720gtcgaagagg
gtacagatcc tgcctatgct gaaaagttga tacaatttgg ttgggagaca 780atcaccgagg
cacttaaaca aggtggcata acattgatga tggatagact ttcaaatccg 840gccaagctaa
gagcctacgc cttatctgag caactaaaag agatcatggc accattattc 900caaaagcaca
tggacgatat tatctccggt gagttttcct caggaatgat ggcagattgg 960gcaaacgatg
ataaaaagtt attgacgtgg agagaagaaa ccggcaagac ggcattcgag 1020acagccccac
aatacgaagg taaaattggt gaacaagaat actttgataa gggagtattg 1080atgatagcta
tggtgaaggc aggggtagaa cttgcattcg aaactatggt tgactccggt 1140atcattgaag
aatctgcata ctatgagtct ttgcatgaat tgcctttgat agcaaatact 1200attgcaagaa
aaagacttta cgagatgaat gttgtcatat cagacactgc agaatatggt 1260aattacttat
ttagctacgc gtgtgtcccg ttgttagagc ccttcatggc cgagttacaa 1320cctggtgatt
tggggaaggc tattccggaa ggagcggttg acaatggcca actgagagac 1380gtaaatgaag
ctattcgttc acatgctata gaacaggtgg gtaaaaagct gagaggatat 1440atgaccgata
tgaaaagaat tgcagtggca ggatga
1476651713DNAArtificial SequenceLl_ilvD_coSc 65atggagttta agtataacgg
caaagttgaa tctgttgaac tgaataagta cagcaaaacg 60ttgacacaag atcccacaca
acccgccaca caggcaatgt attacggcat cgggtttaaa 120gacgaagatt tcaagaaagc
tcaagtgggt atagtgtcga tggactggga tggaaatcca 180tgcaacatgc atttaggaac
ccttggatca aagattaaaa gctcagtaaa tcagacagat 240ggtctgatcg gcttacaatt
tcatacgata ggagtttctg atgggatagc aaatggaaag 300ttgggaatga gatactccct
tgtttccaga gaagttatag ctgactctat tgaaaccaac 360gctggcgctg aatactatga
tgcaattgta gccatcccag gttgtgacaa aaatatgcca 420ggttctatta ttggtatggc
aagacttaat aggccaagca ttatggtgta tggaggaaca 480atagaacacg gtgaatataa
aggtgagaaa ttgaacatcg tatcggcttt tgaatctcta 540ggccagaaaa ttaccggcaa
tatctctgat gaagattatc acggtgttat ttgtaatgct 600attcctggtc aaggggcatg
tggggggatg tacacagcta ataccttagc tgccgctatc 660gaaacactag gtatgtcatt
gccgtattct tcttcgaacc ctgcagtatc tcaagaaaaa 720caagaagaat gtgatgagat
tggattagcc attaagaatc ttttggaaaa agacatcaag 780cctagtgata taatgactaa
ggaggcgttc gagaacgcta ttaccattgt gatggtcttg 840gggggtagta ctaatgctgt
cttgcatatt attgcaatgg ctaacgcgat aggtgtcgaa 900ataactcagg atgacttcca
aagaattagt gacattactc cagtactagg tgattttaaa 960ccttcaggta aatatatgat
ggaagatttg cataaaattg gaggcttgcc agcagtgctt 1020aagtaccttc taaaggaagg
aaaattgcat ggtgactgcc ttactgtgac gggtaaaaca 1080ttagccgaga atgtcgagac
tgccctagac ttggatttcg actcacaaga tatcatgagg 1140ccactaaaga atcctatcaa
ggccaccggc cacttgcaga ttctgtacgg taatttagct 1200caagggggtt ccgtagcaaa
aattagcggt aaagaaggag agttcttcaa aggcactgcc 1260agagtctttg atggtgaaca
acattttatc gacggcatag aatctggtcg tttgcatgct 1320ggagatgtag cggtaattag
gaatataggt cccgtcggcg gacctggtat gcccgaaatg 1380ctgaagccta catcagcatt
aattggtgcg ggtttaggga aaagttgcgc gttaattacg 1440gatggtagat tctccggtgg
cactcacggt tttgttgtcg gccatattgt gcctgaagcc 1500gttgagggtg gactaatcgg
cttagttgaa gatgacgata taatagagat agatgcagtc 1560aacaactcta tatccctgaa
agtttccgat gaagaaatcg caaagagaag agctaattat 1620cagaagccaa ctccgaaagc
caccagggga gttttggcaa aattcgctaa attaacccgt 1680cctgcatcgg aagggtgtgt
tactgatctg taa 1713661023DNALactococcus
lactis 66ttatttagta aaatcaatga ccattcggcc ttcaattttt cctgccttca
tttcatcaat 60aatatcattg atttcttcca gtttgcgtgt cgcaacaatt ggttttacct
taccttctgc 120tccaaattga aaagcttctg ccaagtcaag tcttgttccg acaagtgaac
ctgcaacctc 180cactccgtca aaaacaactg ttggaactga taaagtcatc tcagtattgg
gaagtgccac 240agcaaccatt ttgcccatag gtttcaaaga agcaaccgct tgttcaaaag
caatccttgc 300aacagcacaa actattgcac tttgcacccc taagccgcca gttatttttt
taatttcatc 360aactggattt acatcaccag aattgataat cacatcagct ccaatttttt
tagctaaatt 420taatttatct tgattaatat caacagcaat tacttttgct ccaaaaacat
ttttagcata 480ttgaattgct aaatttccaa gtcctccagc accaaaaatt acttgccaat
caccaggttt 540tactcctgat actttgattg ctttgtaagt tgttactcca gcacaagtaa
ttgagctagc 600ttcaattggg tcaagtccgt caggaacttt gacagcataa tcggcaacaa
caattgcttc 660ttcagccatt ccgccatcaa ctgaatatcc tgcattttta acttctcgac
aaaaagtttc 720attaccagat acacagtatt cacagtgacc acatccttca aagaaccaag
ccactgaaac 780ccgatcacca acttgaagcg agcttacatc agctccaatt tctttgacaa
ttccaattcc 840ttcatgacca agaacagtcc ctgctttgtt gccataatca cctgctgcaa
cgtgcaaatc 900ggtatgacag actccacaat actccatgtc aagcaaagct tcattaggtt
tgattgctcg 960aagttccttt tcaacaaggt ccgcataacc atctggattg tgtcttacta
ctgctgcttt 1020cat
10236713805DNAArtificial SequencepGV2082 67ttggatcata
ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca 60cgaggccctt
tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 120tcccggagac
ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc
gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag
agtgcaccat accacagctt ttcaattcaa ttcatcattt tttttttatt 300cttttttttg
atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag
gaaggagcac agacttagat tggtatatat acgcatatgg caaattaaag 420ccttcgagcg
tcccaaaacc ttctcaagca aggttttcag tataatgtta catgcgtaca 480cgcgtctgta
cagaaaaaaa agaaaaattt gaaatataaa taacgttctt aatactaaca 540taactataaa
aaaataaata gggacctaga cttcaggttg tctaactcct tccttttcgg 600ttagagcgga
tgtgggggga gggcgtgaat gtaagcgtga cataactaat tacatgactc 660gagcggccgc
ttagatgccg gagtcccagt gcttggtcca ctggatggcc tccagggtgc 720ccaagtccag
tttccagatg gctccgttct ggttcagctc gatagccttg acgaagttct 780cggcgcaggc
caacgagggc tgggtgggat gagccaggag cttctcggca acctgaggct 840caacatccaa
ccaggagttg aacgtgtgca ccagggtggt gcgggtgatg ccggggttca 900cagtgtaagc
cgtcacgccg gtaatggggg ccagtttcgc cagggagctg gtgaagttga 960ccacggcggc
cttggtgccg gagtagacgg gcacctggta gatggcattg aatccagtga 1020cggatccaat
gttgcagatg ataccaccgg gaccgccctt gcgcttgtcc cagaagtcca 1080gaatggccgt
cgtggtgttg accaggccag tgtagttgac ggcaatggtg cgctcgatct 1140ggtgatcgtc
caggatacca gctccgttga tcaggacatc gacggtcttc agctgggcga 1200agatggtctt
cagcagcttg gtggtctcgg caatgggcac ggtcacatca taggggtaga 1260aggtgacggt
cacctttgga ttgattgcct tcagctcggc aatggcagcc gggttctcaa 1320tgcggtcgag
gatcaccagg ttcttcagat cgcgcttgag cagctccttg ctggtgtcca 1380gaccaatgcc
tcccagaccg gcaacgaaaa tcacgttctt gttggtcaaa gtaaacgaca 1440tggtacctat
tattgtatgt tatagtatta gttgcttggt gttatgaaag aaactaagaa 1500aagaaaaata
aaataaaaat aaaagattga gacaagggaa gaaaagatac aaaataagaa 1560ttaattacaa
ttgcgtttgc tataaatacg tttttaacaa tcaactctgg taggaagata 1620atgctttttt
tttttatata tgcttggtgc cacttgtcac atacaattct acaaccttcg 1680acaaaaatcc
aaatgatagt aagatcaaag ccagaaagca atggagaaaa aaaattaatg 1740aaccacgatg
aaccaaatga tcaatacaac caaagaaact accctagtga ggtgtatgct 1800gacttggtat
cacacttcat gaattttgca tatggcaaag tccacgaaag tgggcttcag 1860aaaaaaggcg
tgcggtgtgt agatgtatca attagtggat gccagttttg gaacgggatt 1920ccactttccg
caagttggtg cacgtcgtta gtgacataac gccgcgttca tctttgggaa 1980gaagcagatg
ctgagcgagg aggtactata gagtaaagaa ccctttctat acccgcagcc 2040ccatggtaag
tgacagtgca gtaataatat gaaccaattt atttttcgtt acataaaaat 2100gcttataaaa
ctttaactaa taattagaga ttaaatcgcg gccgcaaaag atccttagga 2160tttattctgt
tcagcaaaca gcttgcccat tttcttcagt accttcggtg cgccttcttt 2220cgccaggatc
agttcgatcc agtacatacg gttcggatcg gcctgggcct ctttcatcac 2280gctcacaaat
tcgttttcgg tacgcacaat tttagacaca acacggtcct cagttgcgcc 2340gaaggactcc
ggcagtttag agtagttcca catagggata tcgttgtaag actggttcgg 2400accgtggatc
tcacgctcaa cggtgtagcc gtcattgtta ataatgaagc aaatcgggtt 2460gatcttttca
cgaattgcca gacccagttc ctgtacggtc agctgcaggg aaccgtcacc 2520gatgaacagc
agatgacgag attctttatc agcgatctga gagcccagcg ctgccgggaa 2580agtatagcca
atgctacccc acagcggctg accgataaaa tggcttttgg atttcagaaa 2640gatagaagac
gcgccgaaaa agctcgtacc ttgttccgcc acgatggttt cattgctctg 2700ggtcaggttc
tccacggcct gccacaggcg atcctgggac agcagtgcgt tagatggtac 2760gaaatcttct
tgctttttgt caatgtattt gcctttatac tcgatttcgg acaggtccag 2820cagagagctg
atcaggcttt cgaagtcgaa gttctggata cgctcgttga agattttacc 2880ctcgtcgatg
ttcaggctaa tcattttgtt ttcgttcaga tggtgagtga atgcaccggt 2940agaagagtcg
gtcagtttaa cgcccagcat caggatgaag tccgcagatt caacaaattc 3000tttcaggttc
ggttcgctca gagtaccgtt gtagatgccc aggaaagacg gcagagcctc 3060gtcaacagag
gacttgccga agttcagggt ggtaatcggc agtttggttt tgctgatgaa 3120ttgggtcacg
gtcttctcca gaccaaaaga aatgatttcg tggccggtga tcacgattgg 3180tttctttgcg
tttttcagag actcctggat tttgttcagg atttcctggt cgctagtgtt 3240agaagtggag
ttttctttct tcagcggcag gctcggtttt tccgctttag ctgccgcaac 3300atccacaggc
aggttgatgt aaactggttt gcgttctttc agcagcgcag acagaacgcg 3360gtcgatttcc
acagtagcgt tctctgcagt cagcagcgta cgtgccgcag tcacaggttc 3420atgcattttc
atgaagtgtt tgaaatcgcc gtcagccaga gtgtggtgga cgaatttacc 3480ttcgttctga
actttgctcg ttgggctgcc tacgatctcc accaccggca ggttttcggc 3540gtaggagccc
gccagaccgt tgacggcgct cagttcgcca acaccgaaag tggtcagaaa 3600tgccgcggct
ttcttggtac gtgcataacc atctgccatg tagcttgcgt tcagttcgtt 3660agcgttaccc
acccatttca tgtctttatg agagatgatc tgatccagga actgcagatt 3720gtaatcaccc
ggaacgccga agatttcttc gatacccagt tcatgcagac ggtccagcag 3780ataatcacca
acagtataca tgtcgagctt gttttatatt tgttgtaaaa agtagataat 3840tacttccttg
atgatctgta aaaaagagaa aaagaaagca tctaagaact tgaaaaacta 3900cgaattagaa
aagaccaaat atgtatttct tgcattgacc aatttatgca agtttatata 3960tatgtaaatg
taagtttcac gaggttctac taaactaaac cacccccttg gttagaagaa 4020aagagtgtgt
gagaacaggc tgttgttgtc acacgattcg gacaattctg tttgaaagag 4080agagagtaac
agtacgatcg aacgaacttt gctctggaga tcacagtggg catcatagca 4140tgtggtacta
aaccctttcc cgccattcca gaaccttcga ttgcttgtta caaaacctgt 4200gagccgtcgc
taggaccttg ttgtgtgacg aaattggaag ctgcaatcaa taggaagaca 4260ggaagtcgag
cgtgtctggg ttttttcagt tttgttcttt ttgcaaacaa atcacgagcg 4320acggtaattt
ctttctcgat aagaggccac gtgctttatg agggtaacat caattcaaga 4380aggagggaaa
cacttccttt ttctggccct gataatagta tgagggtgaa gccaaaataa 4440aggattcgcg
cccaaatcgg catctttaaa tgcaggtatg cgatagttcc tcactctttc 4500cttactcacg
agtaattctt gcaaatgcct attatgcaga tgttataata tctgtgcgtc 4560ttgagttgag
cctagaattc ttagaaaaac tcatcgagca tcaaatgaaa ctgcaattta 4620ttcatatcag
gattatcaat accatatttt tgaaaaagcc gtttctgtaa tgaaggagaa 4680aactcaccga
ggcagttcca taggatggca agatcctggt atcggtctgc gatcccgact 4740cgtccaacat
caatacaacc tattaatttc ccctcgtcaa aaataaggtt atcaagtgag 4800aaatcaccat
gagtgacgac tgaatccggt gagaatggca aaagcttatg catttctttc 4860cagacttgtt
caacaggcca gccattacgc tcgtcatcaa aatcactcgc gtcaaccaaa 4920ccgttattca
ttcgtgattg cgcctgagcg aggcgaaata cgcgatcgct gttaaaagga 4980caattacaaa
caggaatcga atgcaaccgg cgcaggaaca ctgccagcgc atcaacaata 5040ttttcacctg
aatcaggata ttcttctaat acctggaatg ctgttttgcc ggggatcgca 5100gtggtgagta
accatgcatc atcaggagta cggacaaaat gcttgatggt cggaagaggc 5160ataaattccg
tcagccagtt tagtctgacc atctcatctg caacatcatt ggcaacgcta 5220cctttgccat
gtttcagaaa caactctggc gcatcgggct tcccatacaa tcgatagatt 5280gtcgcacctg
attgcccgac attatcgcga gcccatttat acccatataa atcagcatcc 5340atgttggaat
ttaatcgcgg cctcgaaacg tgagtctttt ccttacccat actagttttt 5400agtttatgta
tgtgtttttt gtagttatag atttaagcaa gaaaagaata caaacaaaaa 5460attgaaaaag
attgatttag aattaaaaag aaaaatattt acgtaagaag ggaaaatagt 5520aaatgttgca
agttcactaa actcctaaat tatgctgccc tttatattcc ctgttacagc 5580agccgagcca
aaggtatata ggctcctttg cattagcatg cgtaacaaac cacctgtcag 5640tttcaaccga
ggtggtatcc gagagaattg tgtgattgct ttaattaatt tcggagaatc 5700tcacatgcca
ctgaagatta aaaactggat gccagaaaag gggtgtccag gtgtaacatc 5760aatagaggaa
gctgaaaagt cttagaacgg gtaatcttcc accaacctga tgggttccta 5820gatataatct
cgaagggaat aagtagggtg ataccgcaga agtgtctgaa tgtattaagg 5880tcctcacagt
ttaaatcccg ctcacactaa cgtaggatta ttataactca aaaaaatggc 5940attattctaa
gtaagttaaa tatccgtaat ctttaaacag cggccgcgga tcttcatcct 6000gccactgcaa
ttcttttcat atcggtcata tatcctctca gctttttacc cacctgttct 6060atagcatgtg
aacgaatagc ttcatttacg tctctcagtt ggccattgtc aaccgctcct 6120tccggaatag
ccttccccaa atcaccaggt tgtaactcgg ccatgaaggg ctttaacaac 6180gggacacatg
cgtagctaaa taagtaatta ccatattctg cagtgtctga tatgacaaca 6240ttcatctcgt
aaagtctttt tcttgcaata gtatttgcta tcaaaggcaa ttcatgcaaa 6300gactcatagt
atgcagattc ttcaatgata ccggagtcaa ccatagtttc gaatgcaagt 6360tctacccctg
ccttcaccat agctatcatc aatactccct tatcaaagta ttcttgttca 6420ccaattttac
cttcgtattg tggggctgtc tcgaatgccg tcttgccggt ttcttctctc 6480cacgtcaata
actttttatc atcgtttgcc caatctgcca tcattcctga ggaaaactca 6540ccggagataa
tatcgtccat gtgcttttgg aataatggtg ccatgatctc ttttagttgc 6600tcagataagg
cgtaggctct tagcttggcc ggatttgaaa gtctatccat catcaatgtt 6660atgccacctt
gtttaagtgc ctcggtgatt gtctcccaac caaattgtat caacttttca 6720gcataggcag
gatctgtacc ctcttcgacc aatttatcaa agcatagtaa agaccctgcc 6780tgcaacattc
cgcacagaat ggtttgttca cccattaagt cactcttgac ctcagctacg 6840aaagaactct
ctaacacacc cgctctatga cctccggttg cggctgccca tgccttcgca 6900attgccatac
cttcaccttt ggggtcattt tcaggatgta cggcgatcaa tgtaggtaca 6960ccaaaacccc
tcttgtactc ctctctgact tccgtacctg ggcactttgg tgcaaccatt 7020acgactgtta
tatcttttct gatctgctcg cccacttcaa cgatattaaa gccatgagag 7080taacctaaag
ctgccccatc cttcatcagc ggttgaactg ttcttactac gtctgagtga 7140accttatctg
gtgttaggtt aatcactaaa tctgcctgag ggatcagttc ttcgtaagta 7200ccaactttga
acccattttc cgtcgcttta cgccaggagg ccctcttttc tgcaattgcc 7260tctttcctca
atgcatacga aatatccaga cctgaatctc tcatgtttaa accttggttt 7320agaccctgag
caccgcagcc aacaattact actttctttc cttgcagata agaagcacca 7380tcagcaaact
cgtcccttcc cataaatctg cacttaccca gttgagccaa ttgttgtctc 7440aaatttaatg
tgttaaaata gttggccatc tcgagtcgaa actaagttct ggtgttttaa 7500aactaaaaaa
aagactaact ataaaagtag aatttaagaa gtttaagaaa tagatttaca 7560gaattacaat
caatacctac cgtctttata tacttattag tcaagtaggg gaataatttc 7620agggaactgg
tttcaacctt ttttttcagc tttttccaaa tcagagagag cagaaggtaa 7680tagaaggtgt
aagaaaatga gatagataca tgcgtgggtc aattgccttg tgtcatcatt 7740tactccaggc
aggttgcatc actccattga ggttgtgccc gttttttgcc tgtttgtgcc 7800cctgttctct
gtagttgcgc taagagaatg gacctatgaa ctgatggttg gtgaagaaaa 7860caatattttg
gtgctgggat tctttttttt tctggatgcc agcttaaaaa gcgggctcca 7920ttatatttag
tggatgccag gaataaactg ttcacccaga cacctacgat gttatatatt 7980ctgtgtaacc
cgccccctat tttgggcatg tacgggttac agcagaatta aaaggctaat 8040tttttgacta
aataaagtta ggaaaatcac tactattaat tatttacgta ttctttgaaa 8100tggcgagtat
tgataatgat aaactggatc cgcggccgct tacagatcag taacacaccc 8160ttccgatgca
ggacgggtta atttagcgaa ttttgccaaa actcccctgg tggctttcgg 8220agttggcttc
tgataattag ctcttctctt tgcgatttct tcatcggaaa ctttcaggga 8280tatagagttg
ttgactgcat ctatctctat tatatcgtca tcttcaacta agccgattag 8340tccaccctca
acggcttcag gcacaatatg gccgacaaca aaaccgtgag tgccaccgga 8400gaatctacca
tccgtaatta acgcgcaact tttccctaaa cccgcaccaa ttaatgctga 8460tgtaggcttc
agcatttcgg gcataccagg tccgccgacg ggacctatat tcctaattac 8520cgctacatct
ccagcatgca aacgaccaga ttctatgccg tcgataaaat gttgttcacc 8580atcaaagact
ctggcagtgc ctttgaagaa ctctccttct ttaccgctaa tttttgctac 8640ggaaccccct
tgagctaaat taccgtacag aatctgcaag tggccggtgg ccttgatagg 8700attctttagt
ggcctcatga tatcttgtga gtcgaaatcc aagtctaggg cagtctcgac 8760attctcggct
aatgttttac ccgtcacagt aaggcagtca ccatgcaatt ttccttcctt 8820tagaaggtac
ttaagcactg ctggcaagcc tccaatttta tgcaaatctt ccatcatata 8880tttacctgaa
ggtttaaaat cacctagtac tggagtaatg tcactaattc tttggaagtc 8940atcctgagtt
atttcgacac ctatcgcgtt agccattgca ataatatgca agacagcatt 9000agtactaccc
cccaagacca tcacaatggt aatagcgttc tcgaacgcct ccttagtcat 9060tatatcacta
ggcttgatgt ctttttccaa aagattctta atggctaatc caatctcatc 9120acattcttct
tgtttttctt gagatactgc agggttcgaa gaagaatacg gcaatgacat 9180acctagtgtt
tcgatagcgg cagctaaggt attagctgtg tacatccccc cacatgcccc 9240ttgaccagga
atagcattac aaataacacc gtgataatct tcatcagaga tattgccggt 9300aattttctgg
cctagagatt caaaagccga tacgatgttc aatttctcac ctttatattc 9360accgtgttct
attgttcctc catacaccat aatgcttggc ctattaagtc ttgccatacc 9420aataatagaa
cctggcatat ttttgtcaca acctgggatg gctacaattg catcatagta 9480ttcagcgcca
gcgttggttt caatagagtc agctataact tctctggaaa caagggagta 9540tctcattccc
aactttccat ttgctatccc atcagaaact cctatcgtat gaaattgtaa 9600gccgatcaga
ccatctgtct gatttactga gcttttaatc tttgatccaa gggttcctaa 9660atgcatgttg
catggatttc catcccagtc catcgacact atacccactt gagctttctt 9720gaaatcttcg
tctttaaacc cgatgccgta atacattgcc tgtgtggcgg gttgtgtggg 9780atcttgtgtc
aacgttttgc tgtacttatt cagttcaaca gattcaactt tgccgttata 9840cttaaactcc
atgtcgacaa acttagatta gattgctatg ctttctttct aatgagcaag 9900aagtaaaaaa
agttgtaata gaacaagaaa aatgaaactg aaacttgaga aattgaagac 9960cgtttattaa
cttaaatatc aatgggaggt catcgaaaga gaaaaaaatc aaaaaaaaaa 10020ttttcaagaa
aaagaaacgt gataaaaatt tttattgcct ttttcgacga agaaaaagaa 10080acgaggcggt
ctcttttttc ttttccaaac ctttagtacg ggtaattaac gacaccctag 10140aggaagaaag
aggggaaatt tagtatgctg tgcttgggtg ttttgaagtg gtacggcgat 10200gcgcggagtc
cgagaaaatc tggaagagta aaaaaggagt agaaacattt tgaagctatg 10260agctccagct
tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca 10320tagctgtttc
ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat aggagccgga 10380agcataaagt
gtaaagcctg gggtgcctaa tgagtgaggt aactcacatt aattgcgttg 10440cgctcactgc
ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 10500caacgcgcgg
ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 10560tcgctgcgct
cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 10620cggttatcca
cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 10680aaggccagga
accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 10740gacgagcatc
acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 10800agataccagg
cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 10860cttaccggat
acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 10920cgctgtaggt
atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 10980ccccccgttc
agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 11040gtaagacacg
acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 11100tatgtaggcg
gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 11160acagtatttg
gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 11220tcttgatccg
gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 11280attacgcgca
gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 11340gctcagtgga
acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 11400ttcacctaga
tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 11460taaacttggt
ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 11520ctatttcgtt
catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 11580ggcttaccat
ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 11640gatttatcag
caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 11700ttatccgcct
ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 11760gttaatagtt
tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 11820tttggtatgg
cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 11880atgttgtgca
aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 11940gccgcagtgt
tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 12000tccgtaagat
gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 12060atgcggcgac
cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 12120agaactttaa
aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 12180ttaccgctgt
tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 12240tcttttactt
tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 12300aagggaataa
gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 12360tgaagcattt
atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 12420aataaacaaa
taggggttcc gcgcacattt ccccgaaaag tgccacctga acgaagcatc 12480tgtgcttcat
tttgtagaac aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa 12540tctgagctgc
atttttacag aacagaaatg caacgcgaaa gcgctatttt accaacgaag 12600aatctgtgct
tcatttttgt aaaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca 12660aagaatctga
gctgcatttt tacagaacag aaatgcaacg cgagagcgct attttaccaa 12720caaagaatct
atacttcttt tttgttctac aaaaatgcat cccgagagcg ctatttttct 12780aacaaagcat
cttagattac tttttttctc ctttgtgcgc tctataatgc agtctcttga 12840taactttttg
cactgtaggt ccgttaaggt tagaagaagg ctactttggt gtctattttc 12900tcttccataa
aaaaagcctg actccacttc ccgcgtttac tgattactag cgaagctgcg 12960ggtgcatttt
ttcaagataa aggcatcccc gattatattc tataccgatg tggattgcgc 13020atactttgtg
aacagaaagt gatagcgttg atgattcttc attggtcaga aaattatgaa 13080cggtttcttc
tattttgtct ctatatacta cgtataggaa atgtttacat tttcgtattg 13140ttttcgattc
actctatgaa tagttcttac tacaattttt ttgtctaaag agtaatacta 13200gagataaaca
taaaaaatgt agaggtcgag tttagatgca agttcaagga gcgaaaggtg 13260gatgggtagg
ttatataggg atatagcaca gagatatata gcaaagagat acttttgagc 13320aatgtttgtg
gaagcggtat tcgcaatatt ttagtagctc gttacagtcc ggtgcgtttt 13380tggttttttg
aaagtgcgtc ttcagagcgc ttttggtttt caaaagcgct ctgaagttcc 13440tatactttct
agagaatagg aacttcggaa taggaacttc aaagcgtttc cgaaaacgag 13500cgcttccgaa
aatgcaacgc gagctgcgca catacagctc actgttcacg tcgcacctat 13560atctgcgtgt
tgcctgtata tatatataca tgagaagaac ggcatagtgc gtgtttatgc 13620ttaaatgcgt
acttatatgc gtctatttat gtaggatgaa aggtagtcta gtacctcctg 13680tgatattatc
ccattccatg cggggtatcg tatgcttcct tcagcactac cctttagctg 13740ttctatatgc
tgccactcct caattggatt agtctcatcc ttcaatgcta tcatttcctt 13800tgata
138056811561DNAArtificial SequencepGV2563 68ttggatcata ctaagaaacc
attattatca tgacattaac ctataaaaat aggcgtatca 60cgaggccctt tcgtctcgcg
cgtttcggtg atgacggtga aaacctctga cacatgcagc 120tcccggagac ggtcacagct
tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc gggtgttggc
gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag agtgcaccat
accacagctt ttcaattcaa ttcatcattt tttttttatt 300cttttttttg atttcggttt
ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag gaaggagcac
agacttagat tggtatatat acgcatatgg caaattaaag 420ccttcgagcg tcccaaaacc
ttctcaagca aggttttcag tataatgtta catgcgtaca 480cgcgtctgta cagaaaaaaa
agaaaaattt gaaatataaa taacgttctt aatactaaca 540taactataaa aaaataaata
gggacctaga cttcaggttg tctaactcct tccttttcgg 600ttagagcgga tgtgggggga
gggcgtgaat gtaagcgtga cataactaat tacatgactc 660gacctaggtt agtggtggtg
gtggtggtgc ttcgtgaagt ctataaccat tctaccttca 720atcttccccg ccttcatctc
atcaatgatg tcattgattt cctccaactt tctggtagcg 780acaataggct taaccttccc
ttctgcaccg aattggaaag cttcggccaa atcgagtctt 840gttccaacaa gactacctgc
tacttcaact ccatcaaaca cgactgttgg cacagataat 900gtcatttctg tgtttggcac
agcaacggct accattttgc ccataggctt tagtgaggct 960acagcctgct cgaatgcaat
tctcgcaacg gcacatacaa tcgcggattg aacacctaaa 1020ccgccagtga tctttttgat
ttcgtctaca gggttaacgt caccagagtt aattgtgaca 1080tcagcaccta tctttttggc
aagattgagc ttatcttgat tgatatctac agcgatcacc 1140ttcgcaccaa atacgttttt
ggcgtactgg atagctaagt tgcccaggcc accagctccg 1200aagataactt gccagtctcc
tggcttaacg ccagacacct tgatagcttt gtaagtggtg 1260acgcctgcac aagttataga
tgatgcttct attggatcta ggccatctgg gactttaacg 1320gcataatctg caaccacgat
cgcttcctct gccattccac catcaacgct ataaccagcg 1380tttttgactt ctcggcaaaa
tgtctcgtta cctgacacac agtattcgca atgtccacac 1440ccttcgaaaa accaagcaac
actcactcta tcacctactt ggagagaact aacatcggca 1500ccaatctctt tcacaatacc
tataccttca tgtcctaaaa ctgtccctgc cttgttgccg 1560aaatctccgg cagcaacatg
taggtcagtg tgacagacac cgcagtattc catatccaac 1620aatgcctcat ttggcttaat
ggccctcaac tctttttcta caagatcagc gtacccatca 1680ggattgtgac ggacaactgc
agccttcatg gtacctatta ttgtatgtta tagtattagt 1740tgcttggtgt tatgaaagaa
actaagaaaa gaaaaataaa ataaaaataa aagattgaga 1800caagggaaga aaagatacaa
aataagaatt aattacaatt gcgtttgcta taaatacgtt 1860tttaacaatc aactctggta
ggaagataat gctttttttt tttatatatg cttggtgcca 1920cttgtcacat acaattctac
aaccttcgac aaaaatccaa atgatagtaa gatcaaagcc 1980agaaagcaat ggagaaaaaa
aattaatgaa ccacgatgaa ccaaatgatc aatacaacca 2040aagaaactac cctagtgagg
tgtatgctga cttggtatca cacttcatga attttgcata 2100tggcaaagtc cacgaaagtg
ggcttcagaa aaaaggcgtg cggtgtgtag atgtatcaat 2160tagtggatgc cagttttgga
acgggattcc actttccgca agttggtgca cgtcgttagt 2220gacataacgc cgcgttcatc
tttgggaaga agcagatgct gagcgaggag gtactataga 2280gtaaagaacc ctttctatac
ccgcagcccc atgaattctt agaaaaactc atcgagcatc 2340aaatgaaact gcaatttatt
catatcagga ttatcaatac catatttttg aaaaagccgt 2400ttctgtaatg aaggagaaaa
ctcaccgagg cagttccata ggatggcaag atcctggtat 2460cggtctgcga tcccgactcg
tccaacatca atacaaccta ttaatttccc ctcgtcaaaa 2520ataaggttat caagtgagaa
atcaccatga gtgacgactg aatccggtga gaatggcaaa 2580agcttatgca tttctttcca
gacttgttca acaggccagc cattacgctc gtcatcaaaa 2640tcactcgcgt caaccaaacc
gttattcatt cgtgattgcg cctgagcgag gcgaaatacg 2700cgatcgctgt taaaaggaca
attacaaaca ggaatcgaat gcaaccggcg caggaacact 2760gccagcgcat caacaatatt
ttcacctgaa tcaggatatt cttctaatac ctggaatgct 2820gttttgccgg ggatcgcagt
ggtgagtaac catgcatcat caggagtacg gacaaaatgc 2880ttgatggtcg gaagaggcat
aaattccgtc agccagttta gtctgaccat ctcatctgca 2940acatcattgg caacgctacc
tttgccatgt ttcagaaaca actctggcgc atcgggcttc 3000ccatacaatc gatagattgt
cgcacctgat tgcccgacat tatcgcgagc ccatttatac 3060ccatataaat cagcatccat
gttggaattt aatcgcggcc tcgaaacgtg agtcttttcc 3120ttacccatac tagtttttag
tttatgtatg tgttttttgt agttatagat ttaagcaaga 3180aaagaataca aacaaaaaat
tgaaaaagat tgatttagaa ttaaaaagaa aaatatttac 3240gtaagaaggg aaaatagtaa
atgttgcaag ttcactaaac tcctaaatta tgctgccctt 3300tatattccct gttacagcag
ccgagccaaa ggtatatagg ctcctttgca ttagcatgcg 3360taacaaacca cctgtcagtt
tcaaccgagg tggtatccga gagaattgtg tgattgcttt 3420aattaatttc ggagaatctc
acatgccact gaagattaaa aactggatgc cagaaaaggg 3480gtgtccaggt gtaacatcaa
tagaggaagc tgaaaagtct tagaacgggt aatcttccac 3540caacctgatg ggttcctaga
tataatctcg aagggaataa gtagggtgat accgcagaag 3600tgtctgaatg tattaaggtc
ctcacagttt aaatcccgct cacactaacg taggattatt 3660ataactcaaa aaaatggcat
tattctaagt aagttaaata tccgtaatct ttaaacagcg 3720gccgcagatc cttagtggtg
gtggtggtgg tgtcctgcca ctgcaattct tttcatatcg 3780gtcatatatc ctctcagctt
tttacccacc tgttctatag catgcgaacg aatagcttca 3840tttacgtctc tcagttggcc
attgtcaacc gctccttccg gaatagcctt ccccaaatca 3900ccaggttgta actcggccat
gaagggctct aacaacggga cacacgcgta gctaaataag 3960taattaccat attctgcagt
gtctgatatg acaacattca tctcgtaaag tctttttctt 4020gcaatagtat ttgctatcaa
aggcaattca tgcaaagact catagtatgc agattcttca 4080atgataccgg agtcaaccat
agtttcgaat gcaagttcta cccctgcctt caccatagct 4140atcatcaata ctcccttatc
aaagtattct tgttcaccaa ttttaccttc gtattgtggg 4200gctgtctcga atgccgtctt
gccggtttct tctctccacg tcaataactt tttatcatcg 4260tttgcccaat ctgccatcat
tcctgaggaa aactcaccgg agataatatc gtccatgtgc 4320ttttggaata atggtgccat
gatctctttt agttgctcag ataaggcgta ggctcttagc 4380ttggccggat ttgaaagtct
atccatcatc aatgttatgc caccttgttt aagtgcctcg 4440gtgattgtct cccaaccaaa
ttgtatcaac ttttcagcat aggcaggatc tgtaccctct 4500tcgaccaatt tatcaaagca
tagtaaagac cctgcctgca acattccgca cagaatggtt 4560tgttcaccca ttaagtcact
cttgacctca gctacgaaag aactctctaa cacacccgct 4620ctatgacctc cggttgcggc
tgcccatgcc ttcgctattg ccataccttc acgtttgggg 4680tcattttcag gatgtacggc
gatcaatgta ggtacaccaa aacccctctt gtactcctct 4740ctgacttccg tacctgggca
ctttggcgca accattacga ctgttatacc ttttctgatc 4800tgctcgccca cttcaacgat
attaaagcca tgagagtaac ctaaagctgc cccatccttc 4860atcagcggtt gaactgttct
tactacgtct gagtgaacct tatctggtgt taggttaatc 4920actaaatctg cctgagggat
cagttcttcg taagtaccaa ctttgaaccc attttccgtc 4980gctttacgcc aatcggcatc
cttttctgca atagactctt tcctcaatgc atacgaaata 5040tccagacctg aatctctcat
gtttaaacct tggtttagac cctgagcacc gcagccaaca 5100attactactt tctttccttg
cagataagaa gcaccatcag caaactcgtc ccttcccata 5160aatctgcact tacccagttg
agccaattgt tgtctcaaat ttaatgtgtt aaaatagttg 5220gccatgtcga gtcgaaacta
agttctggtg ttttaaaact aaaaaaaaga ctaactataa 5280aagtagaatt taagaagttt
aagaaataga tttacagaat tacaatcaat acctaccgtc 5340tttatatact tattagtcaa
gtaggggaat aatttcaggg aactggtttc aacctttttt 5400ttcagctttt tccaaatcag
agagagcaga aggtaataga aggtgtaaga aaatgagata 5460gatacatgcg tgggtcaatt
gccttgtgtc atcatttact ccaggcaggt tgcatcactc 5520cattgaggtt gtgcccgttt
tttgcctgtt tgtgcccctg ttctctgtag ttgcgctaag 5580agaatggacc tatgaactga
tggttggtga agaaaacaat attttggtgc tgggattctt 5640tttttttctg gatgccagct
taaaaagcgg gctccattat atttagtgga tgccaggaat 5700aaactgttca cccagacacc
tacgatgtta tatattctgt gtaacccgcc ccctattttg 5760ggcatgtacg ggttacagca
gaattaaaag gctaattttt tgactaaata aagttaggaa 5820aatcactact attaattatt
tacgtattct ttgaaatggc gagtattgat aatgataaac 5880tggatccgcg gccgcttaca
gatcagtaac acacccttcc gatgcaggac gggttaattt 5940agcgaatttt gccaaaactc
ccctggtggc tttcggagtt ggcttctgat aattagctct 6000tctctttgcg atttcttcat
cggaaacttt cagggatata gagttgttga ctgcatctat 6060ctctattata tcgtcatctt
caactaagcc gattagtcca ccctcaacgg cttcaggcac 6120aatatggccg acaacaaaac
cgtgagtgcc accggagaat ctaccatccg taattaacgc 6180gcaacttttc cctaaacccg
caccaattaa tgctgatgta ggcttcagca tttcgggcat 6240accaggtccg ccgacgggac
ctatattcct aattaccgct acatctccag catgcaaacg 6300accagattct atgccgtcga
taaaatgttg ttcaccatca aagactctgg cagtgccttt 6360gaagaactct ccttctttac
cgctaatttt tgctacggaa cccccttgag ctaaattacc 6420gtacagaatc tgcaagtggc
cggtggcctt gataggattc tttagtggcc tcatgatatc 6480ttgtgagtcg aaatccaagt
ctagggcagt ctcgacattc tcggctaatg ttttacccgt 6540cacagtaagg cagtcaccat
gcaattttcc ttcctttaga aggtacttaa gcactgctgg 6600caagcctcca attttatgca
aatcttccat catatattta cctgaaggtt taaaatcacc 6660tagtactgga gtaatgtcac
taattctttg gaagtcatcc tgagttattt cgacacctat 6720cgcgttagcc attgcaataa
tatgcaagac agcattagta ctacccccca agaccatcac 6780aatggtaata gcgttctcga
acgcctcctt agtcattata tcactaggct tgatgtcttt 6840ttccaaaaga ttcttaatgg
ctaatccaat ctcatcacat tcttcttgtt tttcttgaga 6900tactgcaggg ttcgaagaag
aatacggcaa tgacatacct agtgtttcga tagcggcagc 6960taaggtatta gctgtgtaca
tccccccaca tgccccttga ccaggaatag cattacaaat 7020aacaccgtga taatcttcat
cagagatatt gccggtaatt ttctggccta gagattcaaa 7080agccgatacg atgttcaatt
tctcaccttt atattcaccg tgttctattg ttcctccata 7140caccataatg cttggcctat
taagtcttgc cataccaata atagaacctg gcatattttt 7200gtcacaacct gggatggcta
caattgcatc atagtattca gcgccagcgt tggtttcaat 7260agagtcagct ataacttctc
tggaaacaag ggagtatctc attcccaact ttccatttgc 7320tatcccatca gaaactccta
tcgtatgaaa ttgtaagccg atcagaccat ctgtctgatt 7380tactgagctt ttaatctttg
atccaagggt tcctaaatgc atgttgcatg gatttccatc 7440ccagtccatc gacactatac
ccacttgagc tttcttgaaa tcttcgtctt taaacccgat 7500gccgtaatac attgcctgtg
tggcgggttg tgtgggatct tgtgtcaacg ttttgctgta 7560cttattcagt tcaacagatt
caactttgcc gttatactta aactccatgt cgacaaactt 7620agattagatt gctatgcttt
ctttctaatg agcaagaagt aaaaaaagtt gtaatagaac 7680aagaaaaatg aaactgaaac
ttgagaaatt gaagaccgtt tattaactta aatatcaatg 7740ggaggtcatc gaaagagaaa
aaaatcaaaa aaaaaatttt caagaaaaag aaacgtgata 7800aaaattttta ttgccttttt
cgacgaagaa aaagaaacga ggcggtctct tttttctttt 7860ccaaaccttt agtacgggta
attaacgaca ccctagagga agaaagaggg gaaatttagt 7920atgctgtgct tgggtgtttt
gaagtggtac ggcgatgcgc ggagtccgag aaaatctgga 7980agagtaaaaa aggagtagaa
acattttgaa gctatgagct ccagcttttg ttccctttag 8040tgagggttaa ttgcgcgctt
ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 8100tatccgctca caattccaca
caacatagga gccggaagca taaagtgtaa agcctggggt 8160gcctaatgag tgaggtaact
cacattaatt gcgttgcgct cactgcccgc tttccagtcg 8220ggaaacctgt cgtgccagct
gcattaatga atcggccaac gcgcggggag aggcggtttg 8280cgtattgggc gctcttccgc
ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 8340cggcgagcgg tatcagctca
ctcaaaggcg gtaatacggt tatccacaga atcaggggat 8400aacgcaggaa agaacatgtg
agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 8460gcgttgctgg cgtttttcca
taggctccgc ccccctgacg agcatcacaa aaatcgacgc 8520tcaagtcaga ggtggcgaaa
cccgacagga ctataaagat accaggcgtt tccccctgga 8580agctccctcg tgcgctctcc
tgttccgacc ctgccgctta ccggatacct gtccgccttt 8640ctcccttcgg gaagcgtggc
gctttctcat agctcacgct gtaggtatct cagttcggtg 8700taggtcgttc gctccaagct
gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 8760gccttatccg gtaactatcg
tcttgagtcc aacccggtaa gacacgactt atcgccactg 8820gcagcagcca ctggtaacag
gattagcaga gcgaggtatg taggcggtgc tacagagttc 8880ttgaagtggt ggcctaacta
cggctacact agaaggacag tatttggtat ctgcgctctg 8940ctgaagccag ttaccttcgg
aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 9000gctggtagcg gtggtttttt
tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 9060caagaagatc ctttgatctt
ttctacgggg tctgacgctc agtggaacga aaactcacgt 9120taagggattt tggtcatgag
attatcaaaa aggatcttca cctagatcct tttaaattaa 9180aaatgaagtt ttaaatcaat
ctaaagtata tatgagtaaa cttggtctga cagttaccaa 9240tgcttaatca gtgaggcacc
tatctcagcg atctgtctat ttcgttcatc catagttgcc 9300tgactccccg tcgtgtagat
aactacgata cgggagggct taccatctgg ccccagtgct 9360gcaatgatac cgcgagaccc
acgctcaccg gctccagatt tatcagcaat aaaccagcca 9420gccggaaggg ccgagcgcag
aagtggtcct gcaactttat ccgcctccat ccagtctatt 9480aattgttgcc gggaagctag
agtaagtagt tcgccagtta atagtttgcg caacgttgtt 9540gccattgcta caggcatcgt
ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 9600ggttcccaac gatcaaggcg
agttacatga tcccccatgt tgtgcaaaaa agcggttagc 9660tccttcggtc ctccgatcgt
tgtcagaagt aagttggccg cagtgttatc actcatggtt 9720atggcagcac tgcataattc
tcttactgtc atgccatccg taagatgctt ttctgtgact 9780ggtgagtact caaccaagtc
attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 9840ccggcgtcaa tacgggataa
taccgcgcca catagcagaa ctttaaaagt gctcatcatt 9900ggaaaacgtt cttcggggcg
aaaactctca aggatcttac cgctgttgag atccagttcg 9960atgtaaccca ctcgtgcacc
caactgatct tcagcatctt ttactttcac cagcgtttct 10020gggtgagcaa aaacaggaag
gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 10080tgttgaatac tcatactctt
cctttttcaa tattattgaa gcatttatca gggttattgt 10140ctcatgagcg gatacatatt
tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 10200acatttcccc gaaaagtgcc
acctgaacga agcatctgtg cttcattttg tagaacaaaa 10260atgcaacgcg agagcgctaa
tttttcaaac aaagaatctg agctgcattt ttacagaaca 10320gaaatgcaac gcgaaagcgc
tattttacca acgaagaatc tgtgcttcat ttttgtaaaa 10380caaaaatgca acgcgagagc
gctaattttt caaacaaaga atctgagctg catttttaca 10440gaacagaaat gcaacgcgag
agcgctattt taccaacaaa gaatctatac ttcttttttg 10500ttctacaaaa atgcatcccg
agagcgctat ttttctaaca aagcatctta gattactttt 10560tttctccttt gtgcgctcta
taatgcagtc tcttgataac tttttgcact gtaggtccgt 10620taaggttaga agaaggctac
tttggtgtct attttctctt ccataaaaaa agcctgactc 10680cacttcccgc gtttactgat
tactagcgaa gctgcgggtg cattttttca agataaaggc 10740atccccgatt atattctata
ccgatgtgga ttgcgcatac tttgtgaaca gaaagtgata 10800gcgttgatga ttcttcattg
gtcagaaaat tatgaacggt ttcttctatt ttgtctctat 10860atactacgta taggaaatgt
ttacattttc gtattgtttt cgattcactc tatgaatagt 10920tcttactaca atttttttgt
ctaaagagta atactagaga taaacataaa aaatgtagag 10980gtcgagttta gatgcaagtt
caaggagcga aaggtggatg ggtaggttat atagggatat 11040agcacagaga tatatagcaa
agagatactt ttgagcaatg tttgtggaag cggtattcgc 11100aatattttag tagctcgtta
cagtccggtg cgtttttggt tttttgaaag tgcgtcttca 11160gagcgctttt ggttttcaaa
agcgctctga agttcctata ctttctagag aataggaact 11220tcggaatagg aacttcaaag
cgtttccgaa aacgagcgct tccgaaaatg caacgcgagc 11280tgcgcacata cagctcactg
ttcacgtcgc acctatatct gcgtgttgcc tgtatatata 11340tatacatgag aagaacggca
tagtgcgtgt ttatgcttaa atgcgtactt atatgcgtct 11400atttatgtag gatgaaaggt
agtctagtac ctcctgtgat attatcccat tccatgcggg 11460gtatcgtatg cttccttcag
cactaccctt tagctgttct atatgctgcc actcctcaat 11520tggattagtc tcatccttca
atgctatcat ttcctttgat a 11561699043DNAArtificial
SequencepGV2164 69ctgcttaatt aaccgttgat gacagcaatt cgggagggcg aaaaataaaa
actggagcaa 60ggaattacca tcaccgtcac catcaccatc atatcgcctt agcctctagc
catagccatc 120atgcaagcgt gtatcttcta agattcagtc atcatcatta ccgagtttgt
tttccttcac 180atgatgaaga aggtttgagt atgctcgaaa caataagacg acgatggctc
tgccattgtt 240atattacgct tttgcggcga ggtgccgatg ggttgctgag gggaagagtg
tttagcttac 300ggacctattg ccattgttat tccgattaat ctattgttca gcagctcttc
tctaccctgt 360cattctagta tttttttttt tttttttttg gttttacttt tttttcttct
tgcctttttt 420tcttgttact ttttttctag ttttttttcc ttccactaag ctttttcctt
gatttatcct 480tgggttcttc tttctactcc tttagatttt ttttttatat attaattttt
aagtttatgt 540attttggtag attcaattct ctttcccttt ccttttcctt cgctcccctt
ccttatcaga 600gctcgccgat cccattaccg acatttgggc gctatacgtg catatgttca
tgtatgtatc 660tgtatttaaa acacttttgt attatttttc ctcatatatg tgtataggtt
tatacggatg 720atttaattat tacttcacca ccctttattt caggctgata tcttagcctt
gttactagtt 780agaaaaagac atttttgctg tcagtcactg tcaagagatt cttttgctgg
catttcttct 840agaagcaaaa agagcgatgc gtcttttccg ctgaaccgtt ccagcaaaaa
agactaccaa 900cgcaatatgg attgtcagaa tcatataaaa gagaagcaaa taactccttg
tcttgtatca 960attgcattat aatatcttct tgttagtgca atatcatata gaagtcatcg
aaatagatat 1020taagaaaaac aaactgtaca atcaatcaat caatcatcac ataaagtcga
catgttgaca 1080aaagcaacaa aagaacaaaa atcccttgtg aaaagcagag gggcggagct
tgttgttgat 1140tgcttagcgg agcaaggtgt cacacatgta tttggcattc caggtgcaaa
aattgatgcg 1200gtatttgacg ctttacaaga taaagggcct gaaattatcg ttgcccggca
tgaacaaaat 1260gcagcattta tggcgcaagc agtcggccgt ttaactggaa aaccgggagt
cgtgttagtc 1320acatcaggac caggtgcttc gaacttggca acaggactgc tgacagcaaa
cactgaaggt 1380gaccctgtcg ttgcgcttgc tgggaacgtg atccgtgcag atcgtttaaa
acggacacat 1440caatctttgg ataatgcggc gctattccag ccgattacaa aatacagtgt
agaagttcaa 1500gatgtaaaaa atataccgga agctgttaca aatgcgttta ggatagcgtc
agcagggcag 1560gctggggccg cttttgtgag ttttccgcaa gatgttgtga atgaagtcac
aaatacaaaa 1620aacgtacgtg ctgtcgcagc gccaaaactt ggtcccgcag cagatgacgc
aatcagtatg 1680gccattgcaa aaattcaaac agcaaaactt cctgtcgttt tagtcggcat
gaagggcgga 1740agaccggaag cgattaaagc ggttcgcaag ctattgaaaa aagtgcagct
tccattcgtt 1800gaaacatatc aagctgccgg tactcttacg agagatttag aggatcagta
ttttggccgg 1860atcggtttat tccgcaacca gcctggcgat ctgctgcttg agcaggctga
tgttgttctg 1920acaatcggct atgacccaat tgaatatgat ccgaaattct ggaatgtcaa
tggagaccgg 1980acgatcatcc atttagacga gattctggct gacattgatc atgcttacca
gccggatctt 2040gaactgatcg gtgatattcc atctacgatc aatcatatcg aacacgatgc
tgtgaaagta 2100gactttgcgg aacgtgagca gaagatcctt tctgatttaa aacaatatat
gcatgagggt 2160gagcaggtgc ctgcagattg gaaatcagac agagtgcatc ctcttgaaat
cgttaaagaa 2220ttgcgaaacg cagtcgatga tcatgttaca gtgacttgcg atatcggttc
acacgcgatt 2280tggatgtcac gttatttccg cagctacgag ccgttaacat taatgattag
taacggtatg 2340caaacactcg gcgttgcgct tccttgggca atcggcgctt cattggtgaa
accgggagaa 2400aaagtagtat cagtctccgg tgatggcggt ttcttattct cagctatgga
attagagaca 2460gcagttcgtt taaaagcacc aattgtacac attgtatgga acgacagcac
atatgacatg 2520gttgcattcc agcaattgaa aaaatataat cgtacatctg cggtcgattt
cggaaatatc 2580gatatcgtga aatacgcgga aagcttcgga gcaactggct tacgcgtaga
atcaccagac 2640cagctggcag atgttctgcg tcaaggcatg aacgctgagg ggcctgtcat
cattgatgtc 2700ccggttgact acagtgataa cgttaattta gcaagtgaca agcttccgaa
agaattcggg 2760gaactcatga aaacgaaagc tctctaggga tcctcatgta attagttatg
tcacgcttac 2820attcacgccc tccccccaca tccgctctaa ccgaaaagga aggagttaga
caacctgaag 2880tctaggtccc tatttatttt tttatagtta tgttagtatt aagaacgtta
tttatatttc 2940aaatttttct tttttttctg tacagacgcg tgtacgcatg taacattata
ctgaaaacct 3000tgcttgagaa ggttttggga cgctcgaagg ctttaatttg ccctaggctc
aactcaagac 3060gcacagatat tataacatct gcataatagg catttgcaag aattactcgt
gagtaaggaa 3120agagtgagga actatcgcat acctgcattt aaagatgccg atttgggcgc
gaatccttta 3180ttttggcttc accctcatac tattatcagg gccagaaaaa ggaagtgttt
ccctccttct 3240tgaattgatg ttaccctcat aaagcacgtg gcctcttatc gagaaagaaa
ttaccgtcgc 3300tcgtgatttg tttgcaaaaa gaacaaaact gaaaaaaccc agacacgctc
gacttcctgt 3360cttcctattg attgcagctt ccaatttcgt cacacaacaa ggtcctagcg
acggctcaca 3420ggttttgtaa caagcaatcg aaggttctgg aatggcggga aagggtttag
taccacatgc 3480tatgatgccc actgtgatct ccagagcaaa gttcgttcga tcgtactgtt
actctctctc 3540tttcaaacag aattgtccga atcgtgtgac aacaacagcc tgttctcaca
cactcttttc 3600ttctaaccaa gggggtggtt tagtttagta gaacctcgtg aaacttacat
ttacatatat 3660ataaacttgc ataaattggt caatgcaaga aatacatatt tggtcttttc
taattcgtag 3720tttttcaagt tcttagatgc tttctttttc tcttttttac agatcatcaa
ggaagtaatt 3780atctactttt tacaacaaat ataaaacaag ctcgacatgt atactgttgg
tgattatctg 3840ctggaccgtc tgcatgaact gggtatcgaa gaaatcttcg gcgttccggg
tgattacaat 3900ctgcagttcc tggatcagat catctctcat aaagacatga aatgggtggg
taacgctaac 3960gaactgaacg caagctacat ggcagatggt tatgcacgta ccaagaaagc
cgcggcattt 4020ctgaccactt tcggtgttgg cgaactgagc gccgtcaacg gtctggcggg
ctcctacgcc 4080gaaaacctgc cggtggtgga gatcgtaggc agcccaacga gcaaagttca
gaacgaaggt 4140aaattcgtcc accacactct ggctgacggc gatttcaaac acttcatgaa
aatgcatgaa 4200cctgtgactg cggcacgtac gctgctgact gcagagaacg ctactgtgga
aatcgaccgc 4260gttctgtctg cgctgctgaa agaacgcaaa ccagtttaca tcaacctgcc
tgtggatgtt 4320gcggcagcta aagcggaaaa accgagcctg ccgctgaaga aagaaaactc
cacttctaac 4380actagcgacc aggaaatcct gaacaaaatc caggagtctc tgaaaaacgc
aaagaaacca 4440atcgtgatca ccggccacga aatcatttct tttggtctgg agaagaccgt
gacccaattc 4500atcagcaaaa ccaaactgcc gattaccacc ctgaacttcg gcaagtcctc
tgttgacgag 4560gctctgccgt ctttcctggg catctacaac ggtactctga gcgaaccgaa
cctgaaagaa 4620tttgttgaat ctgcggactt catcctgatg ctgggcgtta aactgaccga
ctcttctacc 4680ggtgcattca ctcaccatct gaacgaaaac aaaatgatta gcctgaacat
cgacgagggt 4740aaaatcttca acgagcgtat ccagaacttc gacttcgaaa gcctgatcag
ctctctgctg 4800gacctgtccg aaatcgagta taaaggcaaa tacattgaca aaaagcaaga
agatttcgta 4860ccatctaacg cactgctgtc ccaggatcgc ctgtggcagg ccgtggagaa
cctgacccag 4920agcaatgaaa ccatcgtggc ggaacaaggt acgagctttt tcggcgcgtc
ttctatcttt 4980ctgaaatcca aaagccattt tatcggtcag ccgctgtggg gtagcattgg
ctatactttc 5040ccggcagcgc tgggctctca gatcgctgat aaagaatctc gtcatctgct
gttcatcggt 5100gacggttccc tgcagctgac cgtacaggaa ctgggtctgg caattcgtga
aaagatcaac 5160ccgatttgct tcattattaa caatgacggc tacaccgttg agcgtgagat
ccacggtccg 5220aaccagtctt acaacgatat ccctatgtgg aactactcta aactgccgga
gtccttcggc 5280gcaactgagg accgtgttgt gtctaaaatt gtgcgtaccg aaaacgaatt
tgtgagcgtg 5340atgaaagagg cccaggccga tccgaaccgt atgtactgga tcgaactgat
cctggcgaaa 5400gaaggcgcac cgaaggtact gaagaaaatg ggcaagctgt ttgctgaaca
gaataaatcc 5460taaggatctt ttgcggccta gtattgaatt cttatacagg aaacttaata
gaacaaatca 5520catatttaat ctaatagcca cctgcattgg cacggtgcaa cactacttca
acttcatctt 5580acaaaaagat cacgtgatct gttgtattga actgaaaatt ttttgtttgc
ttctctctct 5640ctctttcatt atgtgagatt taaaaaccag aaactacatc atcgaaaaag
agttttaaac 5700cattacaacc attgcgataa gccctctcaa actataacaa tactgacagt
actaaataat 5760tgcctacttg gcttcacata cgttgcatac gtcgatatag ataataatga
taatgacagc 5820aggattatcg taatacgtaa tagttgaaaa tctcaaaaat gtgtgggtca
ttacgtaaat 5880aatgatagga atgggattct tctatttttc ctttttccat tctagcagcc
gtcgggaaaa 5940cgtggcatcc tctctttcgg gctcaattgg agtcacgctg ccgtgagcat
cctctctttc 6000catatctaac aactgagcac gtaaccaatg gaaaagcatg agcttagcgt
tgctccaaaa 6060aagtattgga tggttaatac catttgtctg ttctcttctg actttgactc
ctcaaaaaaa 6120aaaaatctac aatcaacaga tcgcttcaat tacgccctca caaaaacttt
tttccttctt 6180cttcgcccac gttaaatttt atccctcatg ttgtctaacg gatttctgca
cttgatttat 6240tataaaaaga caaagacata atacttctct atcaatttca gttattgttc
ttccttgcgt 6300tattcttctg ttcttctttt tcttttgtca tatataacca taaccaagta
atacatattc 6360aaaatgtcca caaaatcata taccagtaga gctgagactc atgcaagtcc
ggttgcatcg 6420aaacttttac gtttaatgga tgaaaagaag accaatttgt gtgcttctct
tgacgttcgt 6480tcgactgatg agctattgaa acttgttgaa acgttgggtc catacatttg
ccttttgaaa 6540acacacgttg atatcttgga tgatttcagt tatgagggta ctgtcgttcc
attgaaagca 6600ttggcagaga aatacaagtt cttgatattt gaggacagaa aattcgccga
tatcggtaac 6660acagtcaaat tacaatatac atcgggcgtt taccgtatcg cagaatggtc
tgatatcacc 6720aacgcccacg gggttactgg tgctggtatt gttgctggct tgaaacaagg
tgcgcaagag 6780gtcaccaaag aaccaagggg attattgatg cttgctgaat tgtcttccaa
gggttctcta 6840gcacacggtg aatatactaa gggtaccgaa gcttggcgta atcatggtca
tagctgtttc 6900ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga
agcataaagt 6960gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg
cgctcactgc 7020ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc
caacgcgcgg 7080ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac
tcgctgcgct 7140cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
cggttatcca 7200cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa
aaggccagga 7260accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct
gacgagcatc 7320acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
agataccagg 7380cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
cttaccggat 7440acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca
cgctgtaggt 7500atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
ccccccgttc 7560agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg
gtaagacacg 7620acttatcgcc actggcagca gccactggta acaggattag cagagcgagg
tatgtaggcg 7680gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg
acagtatttg 7740gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc
tcttgatccg 7800gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag
attacgcgca 7860gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
gctcagtgga 7920acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
ttcacctaga 7980tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
taaacttggt 8040ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
ctatttcgtt 8100catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
ggcttaccat 8160ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
gatttatcag 8220caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
ttatccgcct 8280ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
gttaatagtt 8340tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg
tttggtatgg 8400cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc
atgttgtgca 8460aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg
gccgcagtgt 8520tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca
tccgtaagat 8580gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
atgcggcgac 8640cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc
agaactttaa 8700aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc
ttaccgctgt 8760tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca
tcttttactt 8820tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
aagggaataa 8880gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
tgaagcattt 8940atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa
aataaacaaa 9000taggggttcc gcgcacattt ccccgaaaag tgccacctga cgt
9043707721DNAArtificial SequencepGV1954 70ccagttaact
gtgggaatac tcaggtatcg taagatgcaa gagttcgaat ctcttagcaa 60ccattatttt
tttcctcaac ataacgagaa cacacagggg cgctatcgca cagaatcaaa 120ttcgatgact
ggaaattttt tgttaatttc agaggtcgcc tgacgcatat acctttttca 180actgaaaaat
tgggagaaaa aggaaaggtg agagcgccgg aaccggcttt tcatatagaa 240tagagaagcg
ttcatgacta aatgcttgca tcacaatact tgaagttgac aatattattt 300aaggacctat
tgttttttcc aataggtggt tagcaatcgt cttactttct aacttttctt 360accttttaca
tttcagcaat atatatatat atatttcaag gatataccat tctaatgtct 420gcccctaaga
agatcgtcgt tttgccaggt gaccacgttg gtcaagaaat cacagccgaa 480gccattaagg
ttcttaaagc tatttctgat gttcgttcca atgtcaagtt cgatttcgaa 540aatcatttaa
ttggtggtgc tgctatcgat gctacaggtg ttccacttcc agatgaggcg 600ctggaagcct
ccaagaaggc tgatgccgtt ttgttaggtg ctgtgggtgg tcctaaatgg 660ggtaccggta
gtgttagacc tgaacaaggt ttactaaaaa tccgtaaaga acttcaattg 720tacgccaact
taagaccatg taactttgca tccgactctc ttttagactt atctccaatc 780aagccacaat
ttgctaaagg tactgacttc gttgttgtca gagaattagt gggaggtatt 840tactttggta
agagaaagga agacgatggt gatggtgtcg cttgggatag tgaacaatac 900accgttccag
aagtgcaaag aatcacaaga atggccgctt tcatggccct acaacatgag 960ccaccattgc
ctatttggtc cttggataaa gctaatgttt tggcctcttc aagattatgg 1020agaaaaactg
tggaggaaac catcaagaac gaattcccta cattgaaggt tcaacatcaa 1080ttgattgatt
ctgccgccat gatcctagtt aagaacccaa cccacctaaa tggtattata 1140atcaccagca
acatgtttgg tgatatcatc tccgatgaag cctccgttat cccaggttcc 1200ttgggtttgt
tgccatctgc gtccttggcc tctttgccag acaagaacac cgcatttggt 1260ttgtacgaac
catgccacgg ttctgctcca gatttgccaa agaataaggt caaccctatc 1320gccactatct
tgtctgctgc aatgatgttg aaattgtcat tgaacttgcc tgaagaaggt 1380aaggccattg
aagatgcagt taaaaaggtt ttggatgcag gtatcagaac tggtgattta 1440ggtggttcca
acagtaccac cgaagtcggt gatgctgtcg ccgaagaagt taagaaaatc 1500cttgcttaaa
aagattctct ttttttatga tatttgtaca taaactttat aaatgaaatt 1560cataatagaa
acgacacgaa attacaaaat ggaatatgtt catagggtag acgaaactat 1620atacgcaatc
tacatacatt tatcaagaag gagaaaaagg aggatgtaaa ggaatacagg 1680taagcaaatt
gatactaatg gctcaacgtg ataaggaaaa agaattgcac tttaacatta 1740atattgacaa
ggaggagggc accacacaaa aagttaggtg taacagaaaa tcatgaaact 1800atgattccta
atttatatat tggaggattt tctctaaaaa aaaaaaaata caacaaataa 1860aaaacactca
atgacctgac catttgatgg agttgccggc ttgatcgaga atggcagctc 1920ttatatacaa
gttcttttag caagcgccgc tgcattattc aagtctcatc atatgaaatt 1980tctttcgaga
gattgtcata atcaaaaaat tgcataatgc atttcttgca acacattttc 2040tgatataatc
ttaccttaat gcaggtttac gtattagttt ttctaaaaga aacgcgacct 2100ttggatatgg
aggcttttcc cataaacgca tgtagtatgc atttacgatg agaatcaatt 2160tttttccaag
gggcgcaaaa cgcataaacg cataaagtat gcatcagaag gattctcacc 2220tggttgcaac
catacaggtg ttagcgacag taatagaaaa aaaattaaaa taatggtgtt 2280attgttattt
gctttatttc cttggccttt gttgaaggaa ttcgtatacg tattacaaat 2340aactagtatc
gaggaacttg aaagagctga aatttttgca ttcttcttcg gtgattatgc 2400ctaagccaat
gaggtcgccc caaaagaccg caatcttgtc acgaccataa gccatataat 2460cgcgaacaaa
aacccgtttt taggaaggac agaggtccat atcaatataa ttaagaaggc 2520atgttggcct
ctgtttctta atatattcta aataagatgt aaggccttgt aattcagttt 2580gttcacaaaa
ttaaaaactg tttaatgttt tttgttttgt tgtagtattc gagcattaag 2640gataaaaaaa
gcttgtgaat aaaaatcttt cgctaaaaat caatataaga aaatggtaag 2700cagctgaaag
ataataaggt atggttaaag atcacaccac cctcttcaat tagctaagat 2760catagctaaa
ggtacaaaac cgaatacgaa agtaaataaa ttaatcagca taaaattaaa 2820taataaacca
cctaaaatat tagaagctaa tctttaacct ggaagacagg acagaaaagt 2880aattacaaga
acatatgtga aaaaaaatag ttgatatttt aaaccaaatc agaaatttat 2940tatactaaaa
ctatatctat gccaattatt tacctaaaca tctataacct tcaaaagtaa 3000aaaaatacac
aaacgttgaa tcatgagttt tatgttaatt agcggccgca gatcttcatc 3060ctgccactgc
aattcttttc atatcggtca tatatcctct cagcttttta cccacctgtt 3120ctatagcatg
tgaacgaata gcttcattta cgtctctcag ttggccattg tcaaccgctc 3180cttccggaat
agccttcccc aaatcaccag gttgtaactc ggccatgaag ggctttaaca 3240acgggacaca
tgcgtagcta aataagtaat taccatattc tgcagtgtct gatatgacaa 3300cattcatctc
gtaaagtctt tttcttgcaa tagtatttgc tatcaaaggc aattcatgca 3360aagactcata
gtatgcagat tcttcaatga taccggagtc aaccatagtt tcgaatgcaa 3420gttctacccc
tgccttcacc atagctatca tcaatactcc cttatcaaag tattcttgtt 3480caccaatttt
accttcgtat tgtggggctg tctcgaatgc cgtcttgccg gtttcttctc 3540tccacgtcaa
taacttttta tcatcgtttg cccaatctgc catcattcct gaggaaaact 3600caccggagat
aatatcgtcc atgtgctttt ggaataatgg tgccatgatc tcttttagtt 3660gctcagataa
ggcgtaggct cttagcttgg ccggatttga aagtctatcc atcatcaatg 3720ttatgccacc
ttgtttaagt gcctcggtga ttgtctccca accaaattgt atcaactttt 3780cagcataggc
aggatctgta ccctcttcga ccaatttatc aaagcatagt aaagaccctg 3840cctgcaacat
tccgcacaga atggtttgtt cacccattaa gtcactcttg acctcagcta 3900cgaaagaact
ctctaacaca cccgctctat gacctccggt tgcggctgcc catgccttcg 3960caattgccat
accttcacct ttggggtcat tttcaggatg tacggcgatc aatgtaggta 4020caccaaaacc
cctcttgtac tcctctctga cttccgtacc tgggcacttt ggtgcaacca 4080ttacgactgt
tatatctttt ctgatctgct cgcccacttc aacgatatta aagccatgag 4140agtaacctaa
agctgcccca tccttcatca gcggttgaac tgttcttact acgtctgagt 4200gttgcttatc
tggtgttagg ttaatcacta aatctgcctg agggatcagt tcttcgtaag 4260taccaacttt
gaacccattt tccgtcgctt tacgccagga ggccctcttt tctgcaattg 4320cctctttcct
caatgcatac gaaatatcca gacctgaatc tctcatgttt aaaccttggt 4380ttagaccctg
agcaccgcag ccaacaatta ctactttctt tccttgcaga taagaagcac 4440catcagcaaa
ctcgtccctt cccataaatc tgcacttacc cagttgagcc aattgttgtc 4500tcaaatttaa
tgtgttaaaa tagttggcca tctcgactat tgatatagtg tttaagcgaa 4560tgacagaaga
ttaatttctt ggtatgttag gaaagaataa aggagaataa gaataattag 4620aacaatgtag
gatggaaaga aagattatca agcatgccga ctttatatac ttgaacggag 4680gcaaaggatg
caaaattttc tcacatttct ttctgccgtt atgttggaag taagactccc 4740attatcgcaa
tactgcaaca cgaatatgca aaatttgctg agttatcgca gatagttgtt 4800gcaaagatag
cggcgtaggt ggccgcgaaa tggggaattc caaaacaaac ggttttttta 4860ctcctgagaa
atacttgtac gggataatcc agggcctacc acccacgctt cgaggattgg 4920cttttatttt
tttttttttg gtggcgtttt atttctttcc cgctttctgg gacttgtgcg 4980gagttttgag
aggggcgcgc ggcaaaggat tcccaaaacg gaaatcagac gccaatagcc 5040agcactcaaa
gcagttctgg acccattccg attttcccat ttggttcttg cgcgtgctga 5100ttccgacacg
cgcgtctata aatagcatga agtatccgca caccgcagcg ttagtgaggt 5160gagggtggca
gcaagctaat tcccgcatct ggaatctgaa ctgccccttt tggactaacc 5220gtgtggttca
tgggtgggcg aagtgcgcaa cctcgaaggt tttcttttgc gtgtcggatt 5280ttacatccgg
cggtagcgca tgatgccatg gctggctcca gatacatcct cagggcacca 5340gcatctataa
ttagattggc gcaacatggc tggctgcact gctgtcttca cttctttctt 5400tttccggcaa
tgaatgatgt atgttttgtg gcaaaagggt ccgcattgta cctgtttaca 5460gttgagatta
tcgtttttgg tagcccttca ttacggcata acgtattgag ctccagcttt 5520tgttcccttt
agtgagggtt aattgcgcgc ttggcgtaat catggtcata gctgtttcct 5580gtgtgaaatt
gttatccgct cacaattcca cacaacatag gagccggaag cataaagtgt 5640aaagcctggg
gtgcctaatg agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc 5700gctttccagt
cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 5760agaggcggtt
tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5820gtcgttcggc
tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 5880gaatcagggg
ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5940cgtaaaaagg
ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 6000aaaaatcgac
gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 6060tttccccctg
gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 6120ctgtccgcct
ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 6180ctcagttcgg
tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 6240cccgaccgct
gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 6300ttatcgccac
tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 6360gctacagagt
tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 6420atctgcgctc
tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 6480aaacaaacca
ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 6540aaaaaaggat
ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 6600gaaaactcac
gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 6660cttttaaatt
aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 6720gacagttacc
aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 6780tccatagttg
cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 6840ggccccagtg
ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 6900ataaaccagc
cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6960atccagtcta
ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 7020cgcaacgttg
ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 7080tcattcagct
ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 7140aaagcggtta
gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 7200tcactcatgg
ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 7260ttttctgtga
ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 7320agttgctctt
gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 7380gtgctcatca
ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 7440agatccagtt
cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 7500accagcgttt
ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 7560gcgacacgga
aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 7620cagggttatt
gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 7680ggggttccgc
gcacatttcc ccgaaaagtg ccacctgacg t
7721717685DNAArtificial SequencepGV7024 71ttggatcata ctaagaaacc
attattatca tgacattaac ctataaaaat aggcgtatca 60cgaggccctt tcgtctcgcg
cgtttcggtg atgacggtga aaacctctga cacatgcagc 120tcccggagac ggtcacagct
tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc gggtgttggc
gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag agtgcaccat
accacagctt ttcaattcaa ttcatcattt tttttttatt 300cttttttttg atttcggttt
ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag gaaggagcac
agacttagat tggtatatat acgcatatgg caaattaaag 420ccttcgagcg tcccaaaacc
ttctcaagca aggttttcag tataatgtta catgcgtaca 480cgcgtctgta cagaaaaaaa
agaaaaattt gaaatataaa taacgttctt aatactaaca 540taactataaa aaaataaata
gggacctaga cttcaggttg tctaactcct tccttttcgg 600ttagagcgga tgtgggggga
gggcgtgaat gtaagcgtga cataagaatt cttattcctt 660tgccctcgga cgagtgctgg
ggcgtcggtt tccactatcg gcgagtactt ctacacagcc 720atcggtccag acggccgcgc
ttctgcgggc gatttgtgta cgcccgacag tcccggctcc 780ggatcggacg attgcgtcgc
atcgaccctg cgcccaagct gcatcatcga aattgccgtc 840aaccaagctc tgatagagtt
ggtcaagacc aatgcggagc atatacgccc ggaggcgcgg 900cgatcctgca agctccggat
gcctccgctc gaagtagcgc gtctgctgct ccatacaagc 960caaccacggc ctccagaaga
ggatgttggc gacctcgtat tgggaatccc cgaacatcgc 1020ctcgctccag tcaatgaccg
ctgttatgcg gccattgtcc gtcaggacat tgttggagcc 1080gaaatccgca tgcacgaggt
gccggacttc ggggcagtcc tcggcccaaa gcatcagctc 1140atcgagagcc tgcgcgacgg
acgcactgac ggtgtcgtcc atcacagttt gccagtgata 1200cacatgggga tcagcaatcg
cgcatatgaa atcacgccat gtagtgtatt gaccgattcc 1260ttgcggtccg aatgggccga
acccgctcgt ctggctaaga tcggccgcag cgatcgcatc 1320catggcctcc gcgaccggct
ggagaacagc gggcagttcg gtttcaggca ggtcttgcaa 1380cgtgacaccc tgtgcacggc
gggagatgca ataggtcagg ctctcgctga actccccaat 1440gtcaagcact tccggaatcg
ggagcgcggc cgatgcaaag tgccgataaa cataacgatc 1500tttgtagaaa ccatcggcgc
agctatttac ccgcaggaca tatccacgcc ctcctacatc 1560gaagctgaaa gcacgagatt
cttcgccctc cgagagctgc atcaggtcgg agacgctgtc 1620gaacttttcg atcagaaact
tctcgacaga cgtcgcggtg agttcaggct ttttacccat 1680actagttttt agtttatgta
tgtgtttttt gtagttatag atttaagcaa gaaaagaata 1740caaacaaaaa attgaaaaag
attgatttag aattaaaaag aaaaatattt acgtaagaag 1800ggaaaatagt aaatgttgca
agttcactaa actcctaaat tatgctgccc tttatattcc 1860ctgttacagc agccgagcca
aaggtatata ggctcctttg cattagcatg cgtaacaaac 1920cacctgtcag tttcaaccga
ggtggtatcc gagagaattg tgtgattgct ttaattaatt 1980tcggagaatc tcacatgcca
ctgaagatta aaaactggat gccagaaaag gggtgtccag 2040gtgtaacatc aatagaggaa
gctgaaaagt cttagaacgg gtaatcttcc accaacctga 2100tgggttccta gatataatct
cgaagggaat aagtagggtg ataccgcaga agtgtctgaa 2160tgtattaagg tcctcacagt
ttaaatcccg ctcacactaa cgtaggatta ttataactca 2220aaaaaatggc attattctaa
gtaagttaaa tatccgtaat ctttaaacag cggccgcaga 2280tctctcgagt cgaaactaag
ttctggtgtt ttaaaactaa aaaaaagact aactataaaa 2340gtagaattta agaagtttaa
gaaatagatt tacagaatta caatcaatac ctaccgtctt 2400tatatactta ttagtcaagt
aggggaataa tttcagggaa ctggtttcaa cctttttttt 2460cagctttttc caaatcagag
agagcagaag gtaatagaag gtgtaagaaa atgagataga 2520tacatgcgtg ggtcaattgc
cttgtgtcat catttactcc aggcaggttg catcactcca 2580ttgaggttgt gcccgttttt
tgcctgtttg tgcccctgtt ctctgtagtt gcgctaagag 2640aatggaccta tgaactgatg
gttggtgaag aaaacaatat tttggtgctg ggattctttt 2700tttttctgga tgccagctta
aaaagcgggc tccattatat ttagtggatg ccaggaataa 2760actgttcacc cagacaccta
cgatgttata tattctgtgt aacccgcccc ctattttggg 2820catgtacggg ttacagcaga
attaaaaggc taattttttg actaaataaa gttaggaaaa 2880tcactactat taattattta
cgtattcttt gaaatggcga gtattgataa tgataaactg 2940gatccgtcga caaacttaga
ttagattgct atgctttctt tctaatgagc aagaagtaaa 3000aaaagttgta atagaacaag
aaaaatgaaa ctgaaacttg agaaattgaa gaccgtttat 3060taacttaaat atcaatggga
ggtcatcgaa agagaaaaaa atcaaaaaaa aaattttcaa 3120gaaaaagaaa cgtgataaaa
atttttattg cctttttcga cgaagaaaaa gaaacgaggc 3180ggtctctttt ttcttttcca
aacctttagt acgggtaatt aacgacaccc tagaggaaga 3240aagaggggaa atttagtatg
ctgtgcttgg gtgttttgaa gtggtacggc gatgcgcgga 3300gtccgagaaa atctggaaga
gtaaaaaagg agtagaaaca ttttgaagct atgagctcag 3360atctgttaac cttgttttat
atttgttgta aaaagtagat aattacttcc ttgatgatct 3420gtaaaaaaga gaaaaagaaa
gcatctaaga acttgaaaaa ctacgaatta gaaaagacca 3480aatatgtatt tcttgcattg
accaatttat gcaagtttat atatatgtaa atgtaagttt 3540cacgaggttc tactaaacta
aaccaccccc ttggttagaa gaaaagagtg tgtgagaaca 3600ggctgttgtt gtcacacgat
tcggacaatt ctgtttgaaa gagagagagt aacagtacga 3660tcgaacgaac tttgctctgg
agatcacagt gggcatcata gcatgtggta ctaaaccctt 3720tcccgccatt ccagaacctt
cgattgcttg ttacaaaacc tgtgagccgt cgctaggacc 3780ttgttgtgtg acgaaattgg
aagctgcaat caataggaag acaggaagtc gagcgtgtct 3840gggttttttc agttttgttc
tttttgcaaa caaatcacga gcgacggtaa tttctttctc 3900gataagaggc cacgtgcttt
atgagggtaa catcaattca agaaggaggg aaacacttcc 3960tttttctggc cctgataata
gtatgagggt gaagccaaaa taaaggattc gcgcccaaat 4020cggcatcttt aaatgcaggt
atgcgatagt tcctcactct ttccttactc acgagtaatt 4080cttgcaaatg cctattatgc
agatgttata atatctgtgc gtcttgagtt gagcctaggg 4140agctccagct tttgttccct
ttagtgaggg ttaattgcgc gcttggcgta atcatggtca 4200tagctgtttc ctgtgtgaaa
ttgttatccg ctcacaattc cacacaacat aggagccgga 4260agcataaagt gtaaagcctg
gggtgcctaa tgagtgaggt aactcacatt aattgcgttg 4320cgctcactgc ccgctttcca
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 4380caacgcgcgg ggagaggcgg
tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 4440tcgctgcgct cggtcgttcg
gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 4500cggttatcca cagaatcagg
ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 4560aaggccagga accgtaaaaa
ggccgcgttg ctggcgtttt tccataggct ccgcccccct 4620gacgagcatc acaaaaatcg
acgctcaagt cagaggtggc gaaacccgac aggactataa 4680agataccagg cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 4740cttaccggat acctgtccgc
ctttctccct tcgggaagcg tggcgctttc tcatagctca 4800cgctgtaggt atctcagttc
ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 4860ccccccgttc agcccgaccg
ctgcgcctta tccggtaact atcgtcttga gtccaacccg 4920gtaagacacg acttatcgcc
actggcagca gccactggta acaggattag cagagcgagg 4980tatgtaggcg gtgctacaga
gttcttgaag tggtggccta actacggcta cactagaagg 5040acagtatttg gtatctgcgc
tctgctgaag ccagttacct tcggaaaaag agttggtagc 5100tcttgatccg gcaaacaaac
caccgctggt agcggtggtt tttttgtttg caagcagcag 5160attacgcgca gaaaaaaagg
atctcaagaa gatcctttga tcttttctac ggggtctgac 5220gctcagtgga acgaaaactc
acgttaaggg attttggtca tgagattatc aaaaaggatc 5280ttcacctaga tccttttaaa
ttaaaaatga agttttaaat caatctaaag tatatatgag 5340taaacttggt ctgacagtta
ccaatgctta atcagtgagg cacctatctc agcgatctgt 5400ctatttcgtt catccatagt
tgcctgactc cccgtcgtgt agataactac gatacgggag 5460ggcttaccat ctggccccag
tgctgcaatg ataccgcgag acccacgctc accggctcca 5520gatttatcag caataaacca
gccagccgga agggccgagc gcagaagtgg tcctgcaact 5580ttatccgcct ccatccagtc
tattaattgt tgccgggaag ctagagtaag tagttcgcca 5640gttaatagtt tgcgcaacgt
tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 5700tttggtatgg cttcattcag
ctccggttcc caacgatcaa ggcgagttac atgatccccc 5760atgttgtgca aaaaagcggt
tagctccttc ggtcctccga tcgttgtcag aagtaagttg 5820gccgcagtgt tatcactcat
ggttatggca gcactgcata attctcttac tgtcatgcca 5880tccgtaagat gcttttctgt
gactggtgag tactcaacca agtcattctg agaatagtgt 5940atgcggcgac cgagttgctc
ttgcccggcg tcaatacggg ataataccgc gccacatagc 6000agaactttaa aagtgctcat
cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 6060ttaccgctgt tgagatccag
ttcgatgtaa cccactcgtg cacccaactg atcttcagca 6120tcttttactt tcaccagcgt
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 6180aagggaataa gggcgacacg
gaaatgttga atactcatac tcttcctttt tcaatattat 6240tgaagcattt atcagggtta
ttgtctcatg agcggataca tatttgaatg tatttagaaa 6300aataaacaaa taggggttcc
gcgcacattt ccccgaaaag tgccacctga acgaagcatc 6360tgtgcttcat tttgtagaac
aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa 6420tctgagctgc atttttacag
aacagaaatg caacgcgaaa gcgctatttt accaacgaag 6480aatctgtgct tcatttttgt
aaaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca 6540aagaatctga gctgcatttt
tacagaacag aaatgcaacg cgagagcgct attttaccaa 6600caaagaatct atacttcttt
tttgttctac aaaaatgcat cccgagagcg ctatttttct 6660aacaaagcat cttagattac
tttttttctc ctttgtgcgc tctataatgc agtctcttga 6720taactttttg cactgtaggt
ccgttaaggt tagaagaagg ctactttggt gtctattttc 6780tcttccataa aaaaagcctg
actccacttc ccgcgtttac tgattactag cgaagctgcg 6840ggtgcatttt ttcaagataa
aggcatcccc gattatattc tataccgatg tggattgcgc 6900atactttgtg aacagaaagt
gatagcgttg atgattcttc attggtcaga aaattatgaa 6960cggtttcttc tattttgtct
ctatatacta cgtataggaa atgtttacat tttcgtattg 7020ttttcgattc actctatgaa
tagttcttac tacaattttt ttgtctaaag agtaatacta 7080gagataaaca taaaaaatgt
agaggtcgag tttagatgca agttcaagga gcgaaaggtg 7140gatgggtagg ttatataggg
atatagcaca gagatatata gcaaagagat acttttgagc 7200aatgtttgtg gaagcggtat
tcgcaatatt ttagtagctc gttacagtcc ggtgcgtttt 7260tggttttttg aaagtgcgtc
ttcagagcgc ttttggtttt caaaagcgct ctgaagttcc 7320tatactttct agagaatagg
aacttcggaa taggaacttc aaagcgtttc cgaaaacgag 7380cgcttccgaa aatgcaacgc
gagctgcgca catacagctc actgttcacg tcgcacctat 7440atctgcgtgt tgcctgtata
tatatataca tgagaagaac ggcatagtgc gtgtttatgc 7500ttaaatgcgt acttatatgc
gtctatttat gtaggatgaa aggtagtcta gtacctcctg 7560tgatattatc ccattccatg
cggggtatcg tatgcttcct tcagcactac cctttagctg 7620ttctatatgc tgccactcct
caattggatt agtctcatcc ttcaatgcta tcatttcctt 7680tgata
7685724105DNAArtificial
SequencepGV2359 72ctgcttaatt aagatcaggt cagtacaaac gcaacacgaa agaacaaaaa
aagaagaaaa 60cagaaggcca agacagggtc aatgagactg ttgtcctcct actgtcccta
tgtctctggc 120cgatcacgcg ccattgtccc tcagaaacaa atcaaacacc cacaccccgg
gcacccaaag 180tccccaccca caccaccaat acgtaaacgg ggcgccccct gcaggccctc
ctgcgcgcgg 240cctcccgcct tgcttctctc cccttccttt tctttttcca gttttcccta
ttttgtccct 300ttttccgcac aacaagtatc agaatgggtt catcaaatct atccaaccta
attcgcacgt 360agactggctt ggtattggca gtttcgtagt tatatatata ctaccatgag
tgaaactgtt 420acgttacctt aaattctttc tccctttaat tttcttttat cttactctcc
tacataagac 480atcaagaaac aattgtatat tgtacacccc ccccctccac aaacacaaat
attgataata 540taaaggagaa ttcttataca ggaaacttaa tagaacaaat cacatattta
atctaatagc 600cacctgcatt ggcacggtgc aacactactt caacttcatc ttacaaaaag
atcacgtgat 660ctgttgtatt gaactgaaaa ttttttgttt gcttctctct ctctctttca
ttatgtgaga 720tttaaaaacc agaaactaca tcatcgaaaa agagttttaa accattacaa
ccattgcgat 780aagccctctc aaactataac aatactgaca gtactaaata attgcctact
tggcttcaca 840tacgttgcat acgtcgatat agataataat gataatgaca gcaggattat
cgtaatacgt 900aatagttgaa aatctcaaaa atgtgtgggt cattacgtaa ataatgatag
gaatgggatt 960cttctatttt tcctttttcc attctagcag ccgtcgggaa aacgtggcat
cctctctttc 1020gggctcaatt ggagtcacgc tgccgtgagc atcctctctt tccatatcta
acaactgagc 1080acgtaaccaa tggaaaagca tgagcttagc gttgctccaa aaaagtattg
gatggttaat 1140accatttgtc tgttctcttc tgactttgac tcctcaaaaa aaaaaaatct
acaatcaaca 1200gatcgcttca attacgccct cacaaaaact tttttccttc ttcttcgccc
acgttaaatt 1260ttatccctca tgttgtctaa cggatttctg cacttgattt attataaaaa
gacaaagaca 1320taatacttct ctatcaattt cagttattgt tcttccttgc gttattcttc
tgttcttctt 1380tttcttttgt catatataac cataaccaag taatacatat tcaaaatgtc
cacaaaatca 1440tataccagta gagctgagac tcatgcaagt ccggttgcat cgaaactttt
acgtttaatg 1500gatgaaaaga agaccaattt gtgtgcttct cttgacgttc gttcgactga
tgagctattg 1560aaacttgttg aaacgttggg tccatacatt tgccttttga aaacacacgt
tgatatcttg 1620gatgatttca gttatgaggg tactgtcgtt ccattgaaag cattggcaga
gaaatacaag 1680ttcttgatat ttgaggacag aaaattcgcc gatatcggta acacagtcaa
attacaatat 1740acatcgggcg tttaccgtat cgcagaatgg tctgatatca ccaacgccca
cggggttact 1800ggtgctggta ttgttgctgg cttgaaacaa ggtgcgcaag aggtcaccaa
agaaccaagg 1860ggattattga tgcttgctga attgtcttcc aagggttctc tagcacacgg
tgaatatact 1920aagggtaccg aagcttggcg taatcatggt catagctgtt tcctgtgtga
aattgttatc 1980cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc
tggggtgcct 2040aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc
cagtcgggaa 2100acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc
ggtttgcgta 2160ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt
cggctgcggc 2220gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca
ggggataacg 2280caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa
aaggccgcgt 2340tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat
cgacgctcaa 2400gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc
cctggaagct 2460ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc
gcctttctcc 2520cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt
tcggtgtagg 2580tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac
cgctgcgcct 2640tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg
ccactggcag 2700cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca
gagttcttga 2760agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc
gctctgctga 2820agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa
accaccgctg 2880gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa
ggatctcaag 2940aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac
tcacgttaag 3000ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta
aattaaaaat 3060gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt
taccaatgct 3120taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata
gttgcctgac 3180tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc
agtgctgcaa 3240tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac
cagccagccg 3300gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag
tctattaatt 3360gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac
gttgttgcca 3420ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc
agctccggtt 3480cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg
gttagctcct 3540tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc
atggttatgg 3600cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct
gtgactggtg 3660agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc
tcttgcccgg 3720cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc
atcattggaa 3780aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc
agttcgatgt 3840aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc
gtttctgggt 3900gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca
cggaaatgtt 3960gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt
tattgtctca 4020tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt
ccgcgcacat 4080ttccccgaaa agtgccacct gacgt
4105738009DNAArtificial SequencepGV2157 73ttggatcata
ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca 60cgaggccctt
tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 120tcccggagac
ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 180gcgcgtcagc
gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 240ttgtactgag
agtgcaccat accacagctt ttcaattcaa ttcatcattt tttttttatt 300cttttttttg
atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 360aagaacgaag
gaaggagcac agacttagat tggtatatat acgcatatgt agtgttgaag 420aaacatgaaa
ttgcccagta ttcttaaccc aactgcacag aacaaaaacc tgcaggaaac 480gaagataaat
catgtcgaaa gctacatata aggaacgtgc tgctactcat cctagtcctg 540ttgctgccaa
gctatttaat atcatgcacg aaaagcaaac aaacttgtgt gcttcattgg 600atgttcgtac
caccaaggaa ttactggagt tagttgaagc attaggtccc aaaatttgtt 660tactaaaaac
acatgtggat atcttgactg atttttccat ggagggcaca gttaagccgc 720taaaggcatt
atccgccaag tacaattttt tactcttcga agacagaaaa tttgctgaca 780ttggtaatac
agtcaaattg cagtactctg cgggtgtata cagaatagca gaatgggcag 840acattacgaa
tgcacacggt gtggtgggcc caggtattgt tagcggtttg aagcaggcgg 900cagaagaagt
aacaaaggaa cctagaggcc ttttgatgtt agcagaattg tcatgcaagg 960gctccctatc
tactggagaa tatactaagg gtactgttga cattgcgaag agcgacaaag 1020attttgttat
cggctttatt gctcaaagag acatgggtgg aagagatgaa ggttacgatt 1080ggttgattat
gacacccggt gtgggtttag atgacaaggg agacgcattg ggtcaacagt 1140atagaaccgt
ggatgatgtg gtctctacag gatctgacat tattattgtt ggaagaggac 1200tatttgcaaa
gggaagggat gctaaggtag agggtgaacg ttacagaaaa gcaggctggg 1260aagcatattt
gagaagatgc ggccagcaaa actaaaaaac tgtattataa gtaaatgcat 1320gtatactaaa
ctcacaaatt agagcttcaa tttaattata tcagttatta ccctatgcgg 1380tgtgaaatac
cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta 1440atattttgtt
aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 1500ccgaaatcgg
caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 1560ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 1620aaaccgtcta
tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg 1680ggtcgaggtg
ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 1740gacggggaaa
gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 1800ctagggcgct
ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 1860atgcgccgct
acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag 1920ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 1980ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 2040gtgagcgcgc
gtaatacgac tcactatagg gcgaattggg taccggccgc aaattaaagc 2100cttcgagcgt
cccaaaacct tctcaagcaa ggttttcagt ataatgttac atgcgtacac 2160gcgtctgtac
agaaaaaaaa gaaaaatttg aaatataaat aacgttctta atactaacat 2220aactataaaa
aaataaatag ggacctagac ttcaggttgt ctaactcctt ccttttcggt 2280tagagcggat
gtggggggag ggcgtgaatg taagcgtgac ataactaatt acatgactcg 2340agcggccgcg
gatcctcaag catctaaaac acaaccgttg gaagcgttgg aaaccaactt 2400agcatacttg
gatagagtac ctcttgtgta acgaggtgga ggtgcaaccc aactttgttt 2460acgttgagcc
atttccttat cagagactaa taggtcaatc ttgttattat cagcatcaat 2520gataatctca
tcgccgtctc tgaccaaccc gataggacca ccttcagcgg cttcgggaac 2580aatgtggccg
attaagaacc cgtgagaacc accagagaat ctaccatcag tcaacaatgc 2640aacatcttta
cccaaaccgt aacccatcag agcagaggaa ggctttagca tttcaggcat 2700acctggtgca
cctcttggac cttcatatct gataacaaca acggtttttt cacccttctt 2760gatttcacct
ctttccaagg cttcaataaa ggcaccttcc tcttcgaaca cacgtgctct 2820acccttgaag
taagtacctt ccttaccggt aattttaccc acagctccac ctggtgccaa 2880tgaaccgtac
agaatttgca agtgaccgtt ggccttgatt gggtgggaga gtggcttaat 2940aatctcttgt
ccttcaggta ggcttggtgc tttctttgca cgttctgcca aagtgtcacc 3000ggtaacagtc
attgtgttac cgtgcaacat gttgttttca tatagatact taatcacaga 3060ttgggtacca
ccaacgttaa tcaaatcggc catgacgtat ttaccagaag gtttgaagtc 3120accgatcaat
ggtgtagtat cactgattct ttggaaatca tctggtgaca acttgacacc 3180cgcagagtga
gcaacagcca ccaaatgcaa aacagcatta gtggacccac cggttgcaac 3240gacataagta
atggcgtttt caaaagcctc ttttgtgagg atatcacgag gtaaaatacc 3300caattccatt
gtcttcttga tgtattcacc aatgttgtca cactcagcta acttctcctt 3360ggaaacggct
gggaaggaag aggagtttgg aatggtcaaa cctagcactt cagcggcaga 3420agccattgtg
ttggcagtat acataccacc acaagaacca ggacctgggc atgcatgttc 3480cacaacatct
tctctttctt cttcagtgaa ttgcttggaa atatattcac cgtaggattg 3540gaacgcagag
acgatatcga tgtttttaga gatcttcgaa gaaccacatg ttggatgacc 3600gggcaagata
gtaccaccat ataccatgat ggaaggtctg ttatgtctac ccatggccat 3660catgacaccg
ggcatgtttt tgtcacatga tgggatggcg atgttagcat cgtagtgttg 3720tgccatcatg
atggtttcaa aggagtctgc aatgatttct ctactttgta acgagtatct 3780cataccttta
gtacccatag agataccgtc tgaaacaccg atggtgttga actgcatagc 3840tttcaaaccc
gctttttcaa tggattgaga acatctgtta ttcaagtcca atagatgcat 3900gttacatggg
ttaccggacc accaacagga accaaccccg acttgaggct tcttgaaatc 3960ttccttcttg
aaaccggtgg cataaagcat ggcctgggac gcaccttggc ccttaggttc 4020agtgatgata
tacgagtact tgttgagctt cttcatgtcg acaaacttag attagattgc 4080tatgctttct
ttctaatgag caagaagtaa aaaaagttgt aatagaacaa gaaaaatgaa 4140actgaaactt
gagaaattga agaccgttta ttaacttaaa tatcaatggg aggtcatcga 4200aagagaaaaa
aatcaaaaaa aaaattttca agaaaaagaa acgtgataaa aatttttatt 4260gcctttttcg
acgaagaaaa agaaacgagg cggtctcttt tttcttttcc aaacctttag 4320tacgggtaat
taacgacacc ctagaggaag aaagagggga aatttagtat gctgtgcttg 4380ggtgttttga
agtggtacgg cgatgcgcgg agtccgagaa aatctggaag agtaaaaaag 4440gagtagaaac
attttgaagc tatgagctcc agcttttgtt ccctttagtg agggttaatt 4500gcgcgcttgg
cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 4560attccacaca
acataggagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 4620aggtaactca
cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 4680tgccagctgc
attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 4740tcttccgctt
cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 4800tcagctcact
caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 4860aacatgtgag
caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 4920tttttccata
ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 4980tggcgaaacc
cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 5040cgctctcctg
ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 5100agcgtggcgc
tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 5160tccaagctgg
gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 5220aactatcgtc
ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 5280ggtaacagga
ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 5340cctaactacg
gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 5400accttcggaa
aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 5460ggtttttttg
tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 5520ttgatctttt
ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 5580gtcatgagat
tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 5640aaatcaatct
aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 5700gaggcaccta
tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 5760gtgtagataa
ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 5820cgagacccac
gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 5880gagcgcagaa
gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 5940gaagctagag
taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 6000ggcatcgtgg
tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 6060tcaaggcgag
ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 6120ccgatcgttg
tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 6180cataattctc
ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 6240accaagtcat
tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 6300cgggataata
ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 6360tcggggcgaa
aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 6420cgtgcaccca
actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 6480acaggaaggc
aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 6540atactcttcc
tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 6600tacatatttg
aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 6660aaagtgccac
ctgaacgaag catctgtgct tcattttgta gaacaaaaat gcaacgcgag 6720agcgctaatt
tttcaaacaa agaatctgag ctgcattttt acagaacaga aatgcaacgc 6780gaaagcgcta
ttttaccaac gaagaatctg tgcttcattt ttgtaaaaca aaaatgcaac 6840gcgagagcgc
taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc 6900aacgcgagag
cgctatttta ccaacaaaga atctatactt cttttttgtt ctacaaaaat 6960gcatcccgag
agcgctattt ttctaacaaa gcatcttaga ttactttttt tctcctttgt 7020gcgctctata
atgcagtctc ttgataactt tttgcactgt aggtccgtta aggttagaag 7080aaggctactt
tggtgtctat tttctcttcc ataaaaaaag cctgactcca cttcccgcgt 7140ttactgatta
ctagcgaagc tgcgggtgca ttttttcaag ataaaggcat ccccgattat 7200attctatacc
gatgtggatt gcgcatactt tgtgaacaga aagtgatagc gttgatgatt 7260cttcattggt
cagaaaatta tgaacggttt cttctatttt gtctctatat actacgtata 7320ggaaatgttt
acattttcgt attgttttcg attcactcta tgaatagttc ttactacaat 7380ttttttgtct
aaagagtaat actagagata aacataaaaa atgtagaggt cgagtttaga 7440tgcaagttca
aggagcgaaa ggtggatggg taggttatat agggatatag cacagagata 7500tatagcaaag
agatactttt gagcaatgtt tgtggaagcg gtattcgcaa tattttagta 7560gctcgttaca
gtccggtgcg tttttggttt tttgaaagtg cgtcttcaga gcgcttttgg 7620ttttcaaaag
cgctctgaag ttcctatact ttctagagaa taggaacttc ggaataggaa 7680cttcaaagcg
tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg cgcacataca 7740gctcactgtt
cacgtcgcac ctatatctgc gtgttgcctg tatatatata tacatgagaa 7800gaacggcata
gtgcgtgttt atgcttaaat gcgtacttat atgcgtctat ttatgtagga 7860tgaaaggtag
tctagtacct cctgtgatat tatcccattc catgcggggt atcgtatgct 7920tccttcagca
ctacccttta gctgttctat atgctgccac tcctcaattg gattagtctc 7980atccttcaat
gctatcattt cctttgata
8009748990DNAArtificial SequencepGV2163 74ctgcttaatt aagatcaggt
cagtacaaac gcaacacgaa agaacaaaaa aagaagaaaa 60cagaaggcca agacagggtc
aatgagactg ttgtcctcct actgtcccta tgtctctggc 120cgatcacgcg ccattgtccc
tcagaaacaa atcaaacacc cacaccccgg gcacccaaag 180tccccaccca caccaccaat
acgtaaacgg ggcgccccct gcaggccctc ctgcgcgcgg 240cctcccgcct tgcttctctc
cccttccttt tctttttcca gttttcccta ttttgtccct 300ttttccgcac aacaagtatc
agaatgggtt catcaaatct atccaaccta attcgcacgt 360agactggctt ggtattggca
gtttcgtagt tatatatata ctaccatgag tgaaactgtt 420acgttacctt aaattctttc
tccctttaat tttcttttat cttactctcc tacataagac 480atcaagaaac aattgtatat
tgtacacccc ccccctccac aaacacaaat attgataata 540taaaggagct cgccgatccc
attaccgaca tttgggcgct atacgtgcat atgttcatgt 600atgtatctgt atttaaaaca
cttttgtatt atttttcctc atatatgtgt ataggtttat 660acggatgatt taattattac
ttcaccaccc tttatttcag gctgatatct tagccttgtt 720actagttaga aaaagacatt
tttgctgtca gtcactgtca agagattctt ttgctggcat 780ttcttctaga agcaaaaaga
gcgatgcgtc ttttccgctg aaccgttcca gcaaaaaaga 840ctaccaacgc aatatggatt
gtcagaatca tataaaagag aagcaaataa ctccttgtct 900tgtatcaatt gcattataat
atcttcttgt tagtgcaata tcatatagaa gtcatcgaaa 960tagatattaa gaaaaacaaa
ctgtacaatc aatcaatcaa tcatcacata aagtcgacat 1020gttgacaaaa gcaacaaaag
aacaaaaatc ccttgtgaaa agcagagggg cggagcttgt 1080tgttgattgc ttagcggagc
aaggtgtcac acatgtattt ggcattccag gtgcaaaaat 1140tgatgcggta tttgacgctt
tacaagataa agggcctgaa attatcgttg cccggcatga 1200acaaaatgca gcatttatgg
cgcaagcagt cggccgttta actggaaaac cgggagtcgt 1260gttagtcaca tcaggaccag
gtgcttcgaa cttggcaaca ggactgctga cagcaaacac 1320tgaaggtgac cctgtcgttg
cgcttgctgg gaacgtgatc cgtgcagatc gtttaaaacg 1380gacacatcaa tctttggata
atgcggcgct attccagccg attacaaaat acagtgtaga 1440agttcaagat gtaaaaaata
taccggaagc tgttacaaat gcgtttagga tagcgtcagc 1500agggcaggct ggggccgctt
ttgtgagttt tccgcaagat gttgtgaatg aagtcacaaa 1560tacaaaaaac gtacgtgctg
tcgcagcgcc aaaacttggt cccgcagcag atgacgcaat 1620cagtatggcc attgcaaaaa
ttcaaacagc aaaacttcct gtcgttttag tcggcatgaa 1680gggcggaaga ccggaagcga
ttaaagcggt tcgcaagcta ttgaaaaaag tgcagcttcc 1740attcgttgaa acatatcaag
ctgccggtac tcttacgaga gatttagagg atcagtattt 1800tggccggatc ggtttattcc
gcaaccagcc tggcgatctg ctgcttgagc aggctgatgt 1860tgttctgaca atcggctatg
acccaattga atatgatccg aaattctgga atgtcaatgg 1920agaccggacg atcatccatt
tagacgagat tctggctgac attgatcatg cttaccagcc 1980ggatcttgaa ctgatcggtg
atattccatc tacgatcaat catatcgaac acgatgctgt 2040gaaagtagac tttgcggaac
gtgagcagaa gatcctttct gatttaaaac aatatatgca 2100tgagggtgag caggtgcctg
cagattggaa atcagacaga gtgcatcctc ttgaaatcgt 2160taaagaattg cgaaacgcag
tcgatgatca tgttacagtg acttgcgata tcggttcaca 2220cgcgatttgg atgtcacgtt
atttccgcag ctacgagccg ttaacattaa tgattagtaa 2280cggtatgcaa acactcggcg
ttgcgcttcc ttgggcaatc ggcgcttcat tggtgaaacc 2340gggagaaaaa gtagtatcag
tctccggtga tggcggtttc ttattctcag ctatggaatt 2400agagacagca gttcgtttaa
aagcaccaat tgtacacatt gtatggaacg acagcacata 2460tgacatggtt gcattccagc
aattgaaaaa atataatcgt acatctgcgg tcgatttcgg 2520aaatatcgat atcgtgaaat
acgcggaaag cttcggagca actggcttac gcgtagaatc 2580accagaccag ctggcagatg
ttctgcgtca aggcatgaac gctgaggggc ctgtcatcat 2640tgatgtcccg gttgactaca
gtgataacgt taatttagca agtgacaagc ttccgaaaga 2700attcggggaa ctcatgaaaa
cgaaagctct ctagggatcc tcatgtaatt agttatgtca 2760cgcttacatt cacgccctcc
ccccacatcc gctctaaccg aaaaggaagg agttagacaa 2820cctgaagtct aggtccctat
ttattttttt atagttatgt tagtattaag aacgttattt 2880atatttcaaa tttttctttt
ttttctgtac agacgcgtgt acgcatgtaa cattatactg 2940aaaaccttgc ttgagaaggt
tttgggacgc tcgaaggctt taatttgccc taggctcaac 3000tcaagacgca cagatattat
aacatctgca taataggcat ttgcaagaat tactcgtgag 3060taaggaaaga gtgaggaact
atcgcatacc tgcatttaaa gatgccgatt tgggcgcgaa 3120tcctttattt tggcttcacc
ctcatactat tatcagggcc agaaaaagga agtgtttccc 3180tccttcttga attgatgtta
ccctcataaa gcacgtggcc tcttatcgag aaagaaatta 3240ccgtcgctcg tgatttgttt
gcaaaaagaa caaaactgaa aaaacccaga cacgctcgac 3300ttcctgtctt cctattgatt
gcagcttcca atttcgtcac acaacaaggt cctagcgacg 3360gctcacaggt tttgtaacaa
gcaatcgaag gttctggaat ggcgggaaag ggtttagtac 3420cacatgctat gatgcccact
gtgatctcca gagcaaagtt cgttcgatcg tactgttact 3480ctctctcttt caaacagaat
tgtccgaatc gtgtgacaac aacagcctgt tctcacacac 3540tcttttcttc taaccaaggg
ggtggtttag tttagtagaa cctcgtgaaa cttacattta 3600catatatata aacttgcata
aattggtcaa tgcaagaaat acatatttgg tcttttctaa 3660ttcgtagttt ttcaagttct
tagatgcttt ctttttctct tttttacaga tcatcaagga 3720agtaattatc tactttttac
aacaaatata aaacaagctc gacatgtata ctgttggtga 3780ttatctgctg gaccgtctgc
atgaactggg tatcgaagaa atcttcggcg ttccgggtga 3840ttacaatctg cagttcctgg
atcagatcat ctctcataaa gacatgaaat gggtgggtaa 3900cgctaacgaa ctgaacgcaa
gctacatggc agatggttat gcacgtacca agaaagccgc 3960ggcatttctg accactttcg
gtgttggcga actgagcgcc gtcaacggtc tggcgggctc 4020ctacgccgaa aacctgccgg
tggtggagat cgtaggcagc ccaacgagca aagttcagaa 4080cgaaggtaaa ttcgtccacc
acactctggc tgacggcgat ttcaaacact tcatgaaaat 4140gcatgaacct gtgactgcgg
cacgtacgct gctgactgca gagaacgcta ctgtggaaat 4200cgaccgcgtt ctgtctgcgc
tgctgaaaga acgcaaacca gtttacatca acctgcctgt 4260ggatgttgcg gcagctaaag
cggaaaaacc gagcctgccg ctgaagaaag aaaactccac 4320ttctaacact agcgaccagg
aaatcctgaa caaaatccag gagtctctga aaaacgcaaa 4380gaaaccaatc gtgatcaccg
gccacgaaat catttctttt ggtctggaga agaccgtgac 4440ccaattcatc agcaaaacca
aactgccgat taccaccctg aacttcggca agtcctctgt 4500tgacgaggct ctgccgtctt
tcctgggcat ctacaacggt actctgagcg aaccgaacct 4560gaaagaattt gttgaatctg
cggacttcat cctgatgctg ggcgttaaac tgaccgactc 4620ttctaccggt gcattcactc
accatctgaa cgaaaacaaa atgattagcc tgaacatcga 4680cgagggtaaa atcttcaacg
agcgtatcca gaacttcgac ttcgaaagcc tgatcagctc 4740tctgctggac ctgtccgaaa
tcgagtataa aggcaaatac attgacaaaa agcaagaaga 4800tttcgtacca tctaacgcac
tgctgtccca ggatcgcctg tggcaggccg tggagaacct 4860gacccagagc aatgaaacca
tcgtggcgga acaaggtacg agctttttcg gcgcgtcttc 4920tatctttctg aaatccaaaa
gccattttat cggtcagccg ctgtggggta gcattggcta 4980tactttcccg gcagcgctgg
gctctcagat cgctgataaa gaatctcgtc atctgctgtt 5040catcggtgac ggttccctgc
agctgaccgt acaggaactg ggtctggcaa ttcgtgaaaa 5100gatcaacccg atttgcttca
ttattaacaa tgacggctac accgttgagc gtgagatcca 5160cggtccgaac cagtcttaca
acgatatccc tatgtggaac tactctaaac tgccggagtc 5220cttcggcgca actgaggacc
gtgttgtgtc taaaattgtg cgtaccgaaa acgaatttgt 5280gagcgtgatg aaagaggccc
aggccgatcc gaaccgtatg tactggatcg aactgatcct 5340ggcgaaagaa ggcgcaccga
aggtactgaa gaaaatgggc aagctgtttg ctgaacagaa 5400taaatcctaa ggatcttttg
cggcctagta ttgaattctt atacaggaaa cttaatagaa 5460caaatcacat atttaatcta
atagccacct gcattggcac ggtgcaacac tacttcaact 5520tcatcttaca aaaagatcac
gtgatctgtt gtattgaact gaaaattttt tgtttgcttc 5580tctctctctc tttcattatg
tgagatttaa aaaccagaaa ctacatcatc gaaaaagagt 5640tttaaaccat tacaaccatt
gcgataagcc ctctcaaact ataacaatac tgacagtact 5700aaataattgc ctacttggct
tcacatacgt tgcatacgtc gatatagata ataatgataa 5760tgacagcagg attatcgtaa
tacgtaatag ttgaaaatct caaaaatgtg tgggtcatta 5820cgtaaataat gataggaatg
ggattcttct atttttcctt tttccattct agcagccgtc 5880gggaaaacgt ggcatcctct
ctttcgggct caattggagt cacgctgccg tgagcatcct 5940ctctttccat atctaacaac
tgagcacgta accaatggaa aagcatgagc ttagcgttgc 6000tccaaaaaag tattggatgg
ttaataccat ttgtctgttc tcttctgact ttgactcctc 6060aaaaaaaaaa aatctacaat
caacagatcg cttcaattac gccctcacaa aaactttttt 6120ccttcttctt cgcccacgtt
aaattttatc cctcatgttg tctaacggat ttctgcactt 6180gatttattat aaaaagacaa
agacataata cttctctatc aatttcagtt attgttcttc 6240cttgcgttat tcttctgttc
ttctttttct tttgtcatat ataaccataa ccaagtaata 6300catattcaaa atgtccacaa
aatcatatac cagtagagct gagactcatg caagtccggt 6360tgcatcgaaa cttttacgtt
taatggatga aaagaagacc aatttgtgtg cttctcttga 6420cgttcgttcg actgatgagc
tattgaaact tgttgaaacg ttgggtccat acatttgcct 6480tttgaaaaca cacgttgata
tcttggatga tttcagttat gagggtactg tcgttccatt 6540gaaagcattg gcagagaaat
acaagttctt gatatttgag gacagaaaat tcgccgatat 6600cggtaacaca gtcaaattac
aatatacatc gggcgtttac cgtatcgcag aatggtctga 6660tatcaccaac gcccacgggg
ttactggtgc tggtattgtt gctggcttga aacaaggtgc 6720gcaagaggtc accaaagaac
caaggggatt attgatgctt gctgaattgt cttccaaggg 6780ttctctagca cacggtgaat
atactaaggg taccgaagct tggcgtaatc atggtcatag 6840ctgtttcctg tgtgaaattg
ttatccgctc acaattccac acaacatacg agccggaagc 6900ataaagtgta aagcctgggg
tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 6960tcactgcccg ctttccagtc
gggaaacctg tcgtgccagc tgcattaatg aatcggccaa 7020cgcgcgggga gaggcggttt
gcgtattggg cgctcttccg cttcctcgct cactgactcg 7080ctgcgctcgg tcgttcggct
gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 7140ttatccacag aatcagggga
taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 7200gccaggaacc gtaaaaaggc
cgcgttgctg gcgtttttcc ataggctccg cccccctgac 7260gagcatcaca aaaatcgacg
ctcaagtcag aggtggcgaa acccgacagg actataaaga 7320taccaggcgt ttccccctgg
aagctccctc gtgcgctctc ctgttccgac cctgccgctt 7380accggatacc tgtccgcctt
tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 7440tgtaggtatc tcagttcggt
gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 7500cccgttcagc ccgaccgctg
cgccttatcc ggtaactatc gtcttgagtc caacccggta 7560agacacgact tatcgccact
ggcagcagcc actggtaaca ggattagcag agcgaggtat 7620gtaggcggtg ctacagagtt
cttgaagtgg tggcctaact acggctacac tagaaggaca 7680gtatttggta tctgcgctct
gctgaagcca gttaccttcg gaaaaagagt tggtagctct 7740tgatccggca aacaaaccac
cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 7800acgcgcagaa aaaaaggatc
tcaagaagat cctttgatct tttctacggg gtctgacgct 7860cagtggaacg aaaactcacg
ttaagggatt ttggtcatga gattatcaaa aaggatcttc 7920acctagatcc ttttaaatta
aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa 7980acttggtctg acagttacca
atgcttaatc agtgaggcac ctatctcagc gatctgtcta 8040tttcgttcat ccatagttgc
ctgactcccc gtcgtgtaga taactacgat acgggagggc 8100ttaccatctg gccccagtgc
tgcaatgata ccgcgagacc cacgctcacc ggctccagat 8160ttatcagcaa taaaccagcc
agccggaagg gccgagcgca gaagtggtcc tgcaacttta 8220tccgcctcca tccagtctat
taattgttgc cgggaagcta gagtaagtag ttcgccagtt 8280aatagtttgc gcaacgttgt
tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt 8340ggtatggctt cattcagctc
cggttcccaa cgatcaaggc gagttacatg atcccccatg 8400ttgtgcaaaa aagcggttag
ctccttcggt cctccgatcg ttgtcagaag taagttggcc 8460gcagtgttat cactcatggt
tatggcagca ctgcataatt ctcttactgt catgccatcc 8520gtaagatgct tttctgtgac
tggtgagtac tcaaccaagt cattctgaga atagtgtatg 8580cggcgaccga gttgctcttg
cccggcgtca atacgggata ataccgcgcc acatagcaga 8640actttaaaag tgctcatcat
tggaaaacgt tcttcggggc gaaaactctc aaggatctta 8700ccgctgttga gatccagttc
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct 8760tttactttca ccagcgtttc
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag 8820ggaataaggg cgacacggaa
atgttgaata ctcatactct tcctttttca atattattga 8880agcatttatc agggttattg
tctcatgagc ggatacatat ttgaatgtat ttagaaaaat 8940aaacaaatag gggttccgcg
cacatttccc cgaaaagtgc cacctgacgt 8990758990DNAArtificial
SequencepGV2360 75ctgcttaatt aagatcaggt cagtacaaac gcaacacgaa agaacaaaaa
aagaagaaaa 60cagaaggcca agacagggtc aatgagactg ttgtcctcct actgtcccta
tgtctctggc 120cgatcacgcg ccattgtccc tcagaaacaa atcaaacacc cacaccccgg
gcacccaaag 180tccccaccca caccaccaat acgtaaacgg ggcgccccct gcaggccctc
ctgcgcgcgg 240cctcccgcct tgcttctctc cccttccttt tctttttcca gttttcccta
ttttgtccct 300ttttccgcac aacaagtatc agaatgggtt catcaaatct atccaaccta
attcgcacgt 360agactggctt ggtattggca gtttcgtagt tatatatata ctaccatgag
tgaaactgtt 420acgttacctt aaattctttc tccctttaat tttcttttat cttactctcc
tacataagac 480atcaagaaac aattgtatat tgtacacccc ccccctccac aaacacaaat
attgataata 540taaaggagct cgccgatccc attaccgaca tttgggcgct atacgtgcat
atgttcatgt 600atgtatctgt atttaaaaca cttttgtatt atttttcctc atatatgtgt
ataggtttat 660acggatgatt taattattac ttcaccaccc tttatttcag gctgatatct
tagccttgtt 720actagttaga aaaagacatt tttgctgtca gtcactgtca agagattctt
ttgctggcat 780ttcttctaga agcaaaaaga gcgatgcgtc ttttccgctg aaccgttcca
gcaaaaaaga 840ctaccaacgc aatatggatt gtcagaatca tataaaagag aagcaaataa
ctccttgtct 900tgtatcaatt gcattataat atcttcttgt tagtgcaata tcatatagaa
gtcatcgaaa 960tagatattaa gaaaaacaaa ctgtacaatc aatcaatcaa tcatcacata
aagtcgacat 1020gttgacaaaa gcaacaaaag aacaaaaatc ccttgtgaaa agcagagggg
cggagcttgt 1080tgttgattgc ttagcggagc aaggtgtcac acatgtattt ggcattccag
gtgcaaaaat 1140tgatgcggta tttgacgctt tacaagataa agggcctgaa attatcgttg
cccggcatga 1200acaaaatgca gcatttatgg cgcaagcagt cggccgttta actggaaaac
cgggagtcgt 1260gttagtcaca tcaggaccag gtgcttcgaa cttggcaaca ggactgctga
cagcaaacac 1320tgaaggtgac cctgtcgttg cgcttgctgg gaacgtgatc cgtgcagatc
gtttaaaacg 1380gacacatcaa tctttggata atgcggcgct attccagccg attacaaaat
acagtgtaga 1440agttcaagat gtaaaaaata taccggaagc tgttacaaat gcgtttagga
tagcgtcagc 1500agggcaggct ggggccgctt ttgtgagttt tccgcaagat gttgtgaatg
aagtcacaaa 1560tacaaaaaac gtacgtgctg tcgcagcgcc aaaacttggt cccgcagcag
atgacgcaat 1620cagtatggcc attgcaaaaa ttcaaacagc aaaacttcct gtcgttttag
tcggcatgaa 1680gggcggaaga ccggaagcga ttaaagcggt tcgcaagcta ttgaaaaaag
tgcagcttcc 1740attcgttgaa acatatcaag ctgccggtac tcttacgaga gatttagagg
atcagtattt 1800tggccggatc ggtttattcc gcaaccagcc tggcgatctg ctgcttgagc
aggctgatgt 1860tgttctgaca atcggctatg acccaattga atatgatccg aaattctgga
atgtcaatgg 1920agaccggacg atcatccatt tagacgagat tctggctgac attgatcatg
cttaccagcc 1980ggatcttgaa ctgatcggtg atattccatc tacgatcaat catatcgaac
acgatgctgt 2040gaaagtagac tttgcggaac gtgagcagaa gatcctttct gatttaaaac
aatatatgca 2100tgagggtgag caggtgcctg cagattggaa atcagacaga gtgcatcctc
ttgaaatcgt 2160taaagaattg cgaaacgcag tcgatgatca tgttacagtg acttgcgata
tcggttcaca 2220cgcgatttgg atgtcacgtt atttccgcag ctacgagccg ttaacattaa
tgattagtaa 2280cggtatgcaa acactcggcg ttgcgcttcc ttgggcaatc ggcgcttcat
tggtgaaacc 2340gggagaaaaa gtagtatcag tctccggtga tggcggtttc ttattctcag
ctatggaatt 2400agagacagca gttcgtttaa aagcaccaat tgtacacatt gtatggaacg
acagcacata 2460tgacatggtt gcattccagc aattgaaaaa atataatcgt acatctgcgg
tcgatttcgg 2520aaatatcgat atcgtgaaat acgcggaaag cttcggagca actggcttac
gcgtagaatc 2580accagaccag ctggcagatg ttctgcgtca aggcatgaac gctgaggggc
ctgtcatcat 2640tgatgtcccg gttgactaca gtgataacgt taatttagca agtgacaagc
ttccgaaaga 2700attcggggaa ctcatgaaaa cgaaagctct ctagggatcc tcatgtaatt
agttatgtca 2760cgcttacatt cacgccctcc ccccacatcc gctctaaccg aaaaggaagg
agttagacaa 2820cctgaagtct aggtccctat ttattttttt atagttatgt tagtattaag
aacgttattt 2880atatttcaaa tttttctttt ttttctgtac agacgcgtgt acgcatgtaa
cattatactg 2940aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt taatttgccc
taggctcaac 3000tcaagacgca cagatattat aacatctgca taataggcat ttgcaagaat
tactcgtgag 3060taaggaaaga gtgaggaact atcgcatacc tgcatttaaa gatgccgatt
tgggcgcgaa 3120tcctttattt tggcttcacc ctcatactat tatcagggcc agaaaaagga
agtgtttccc 3180tccttcttga attgatgtta ccctcataaa gcacgtggcc tcttatcgag
aaagaaatta 3240ccgtcgctcg tgatttgttt gcaaaaagaa caaaactgaa aaaacccaga
cacgctcgac 3300ttcctgtctt cctattgatt gcagcttcca atttcgtcac acaacaaggt
cctagcgacg 3360gctcacaggt tttgtaacaa gcaatcgaag gttctggaat ggcgggaaag
ggtttagtac 3420cacatgctat gatgcccact gtgatctcca gagcaaagtt cgttcgatcg
tactgttact 3480ctctctcttt caaacagaat tgtccgaatc gtgtgacaac aacagcctgt
tctcacacac 3540tcttttcttc taaccaaggg ggtggtttag tttagtagaa cctcgtgaaa
cttacattta 3600catatatata aacttgcata aattggtcaa tgcaagaaat acatatttgg
tcttttctaa 3660ttcgtagttt ttcaagttct tagatgcttt ctttttctct tttttacaga
tcatcaagga 3720agtaattatc tactttttac aacaaatata aaacaagctc gacatgtata
ctgttggtga 3780ttatctgctg gaccgtctgc atgaactggg tatcgaagaa atcttcggcg
ttccgggtga 3840ttacaatctg cagttcctgg atcagatcat ctctcataaa gacatgaaat
gggtgggtaa 3900cgctaacgaa ctgaacgcaa gctacatggc agatggttat gcacgtacca
agaaagccgc 3960ggcatttctg accactttcg gtgttggcga actgagcgcc gtcaacggtc
tggcgggctc 4020ctacgccgaa aacctgccgg tggtggagat cgtaggcagc ccaacgagca
aagttcagaa 4080cgaaggtaaa ttcgtccacc acactctggc tgacggcgat ttcaaacact
tcatgaaaat 4140gcatgaacct gtgactgcgg cacgtacgct gctgactgca gagaacgcta
ctgtggaaat 4200cgaccgcgtt ctgtctgcgc tgctgaaaga acgcaaacca gtttacatca
acctgcctgt 4260ggatgttgcg gcagctaaag cggaaaaacc gagcctgccg ctgaagaaag
aaaactccac 4320ttctaacact agcgaccagg aaatcctgaa caaaatccag gagtctctga
aaaacgcaaa 4380gaaaccaatc gtgatcaccg gccacgaaat catttctttt ggtctggaga
agaccgtgac 4440ccaattcatc agcaaaacca aactgccgat taccaccctg aacttcggca
agtcctctgt 4500tgacgaggct ctgccgtctt tcctgggcat ctacaacggt actctgagcg
aaccgaacct 4560gaaagaattt gttgaatctg cggacttcat cctgatgctg ggcgttaaac
tgaccgactc 4620ttctaccggt gcattcactc accatctgaa cgaaaacaaa atgattagcc
tgaacatcga 4680cgagggtaaa atcttcaacg agcgtatcca gaacttcgac ttcgaaagcc
tgatcagctc 4740tctgctggac ctgtccgaaa tcgagtataa aggcaaatac attgacaaaa
agcaagaaga 4800tttcgtacca tctaacgcac tgctgtccca ggatcgcctg tggcaggccg
tggagaacct 4860gacccagagc aatgaaacca tcgtggcgga acaaggtacg agctttttcg
gcgcgtcttc 4920tatctttctg aaatccaaaa gccattttat cggtcagccg ctgtggggta
gcattggcta 4980tactttcccg gcagcgctgg gctctcagat cgctgataaa gaatctcgtc
atctgctgtt 5040catcggtgac ggttccctgc agctgaccgt acaggaactg ggtctggcaa
ttcgtgaaaa 5100gatcaacccg atttgcttca ttattaacaa tgacggctac accgttgagc
gtgagatcca 5160cggtccgaac cagtcttaca acgatatccc tatgtggaac tactctaaac
tgccggagtc 5220cttcggcgca actgaggacc gtgttgtgtc taaaattgtg cgtaccgaaa
acgaatttgt 5280gagcgtgatg aaagaggccc aggccgatcc gaaccgtatg tactggatcg
aactgatcct 5340ggcgaaagaa ggcgcaccga aggtactgaa gaaaatgggc aagctgtttg
ctgaacagaa 5400taaatcctaa ggatcttttg cggcctagta ttgaattctt atacaggaaa
cttaatagaa 5460caaatcacat atttaatcta atagccacct gcattggcac ggtgcaacac
tacttcaact 5520tcatcttaca aaaagatcac gtgatctgtt gtattgaact gaaaattttt
tgtttgcttc 5580tctctctctc tttcattatg tgagatttaa aaaccagaaa ctacatcatc
gaaaaagagt 5640tttaaaccat tacaaccatt gcgataagcc ctctcaaact ataacaatac
tgacagtact 5700aaataattgc ctacttggct tcacatacgt tgcatacgtc gatatagata
ataatgataa 5760tgacagcagg attatcgtaa tacgtaatag ttgaaaatct caaaaatgtg
tgggtcatta 5820cgtaaataat gataggaatg ggattcttct atttttcctt tttccattct
agcagccgtc 5880gggaaaacgt ggcatcctct ctttcgggct caattggagt cacgctgccg
tgagcatcct 5940ctctttccat atctaacaac tgagcacgta accaatggaa aagcatgagc
ttagcgttgc 6000tccaaaaaag tattggatgg ttaataccat ttgtctgttc tcttctgact
ttgactcctc 6060aaaaaaaaaa aatctacaat caacagatcg cttcaattac gccctcacaa
aaactttttt 6120ccttcttctt cgcccacgtt aaattttatc cctcatgttg tctaacggat
ttctgcactt 6180gatttattat aaaaagacaa agacataata cttctctatc aatttcagtt
attgttcttc 6240cttgcgttat tcttctgttc ttctttttct tttgtcatat ataaccataa
ccaagtaata 6300catattcaaa atgtccacaa aatcatatac cagtagagct gagactcatg
caagtccggt 6360tgcatcgaaa cttttacgtt taatggatga aaagaagacc aatttgtgtg
cttctcttga 6420cgttcgttcg actgatgagc tattgaaact tgttgaaacg ttgggtccat
acatttgcct 6480tttgaaaaca cacgttgata tcttggatga tttcagttat gagggtactg
tcgttccatt 6540gaaagcattg gcagagaaat acaagttctt gatatttgag gacagaaaat
tcgccgatat 6600cggtaacaca gtcaaattac aatatacatc gggcgtttac cgtatcgcag
aatggtctga 6660tatcaccaac gcccacgggg ttactggtgc tggtattgtt gctggcttga
aacaaggtgc 6720gcaagaggtc accaaagaac caaggggatt attgatgctt gctgaattgt
cttccaaggg 6780ttctctagca cacggtgaat atactaaggg taccgaagct tggcgtaatc
atggtcatag 6840ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg
agccggaagc 6900ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat
tgcgttgcgc 6960tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg
aatcggccaa 7020cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct
cactgactcg 7080ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc
ggtaatacgg 7140ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg
ccagcaaaag 7200gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg
cccccctgac 7260gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg
actataaaga 7320taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac
cctgccgctt 7380accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca
tagctcacgc 7440tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt
gcacgaaccc 7500cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc
caacccggta 7560agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag
agcgaggtat 7620gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac
tagaaggaca 7680gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt
tggtagctct 7740tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa
gcagcagatt 7800acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg
gtctgacgct 7860cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa
aaggatcttc 7920acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat
atatgagtaa 7980acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc
gatctgtcta 8040tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat
acgggagggc 8100ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc
ggctccagat 8160ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc
tgcaacttta 8220tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag
ttcgccagtt 8280aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg
ctcgtcgttt 8340ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg
atcccccatg 8400ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag
taagttggcc 8460gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt
catgccatcc 8520gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga
atagtgtatg 8580cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc
acatagcaga 8640actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc
aaggatctta 8700ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc
ttcagcatct 8760tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc
cgcaaaaaag 8820ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca
atattattga 8880agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat
ttagaaaaat 8940aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt
8990768990DNAArtificial SequencepGV2381 76ctgcttaatt
aagatcaggt cagtacaaac gcaacacgaa agaacaaaaa aagaagaaaa 60cagaaggcca
agacagggtc aatgagactg ttgtcctcct actgtcccta tgtctctggc 120cgatcacgcg
ccattgtccc tcagaaacaa atcaaacacc cacaccccgg gcacccaaag 180tccccaccca
caccaccaat acgtaaacgg ggcgccccct gcaggccctc ctgcgcgcgg 240cctcccgcct
tgcttctctc cccttccttt tctttttcca gttttcccta ttttgtccct 300ttttccgcac
aacaagtatc agaatgggtt catcaaatct atccaaccta attcgcacgt 360agactggctt
ggtattggca gtttcgtagt tatatatata ctaccatgag tgaaactgtt 420acgttacctt
aaattctttc tccctttaat tttcttttat cttactctcc tacataagac 480atcaagaaac
aattgtatat tgtacacccc ccccctccac aaacacaaat attgataata 540taaaggagct
cgccgatccc attaccgaca tttgggcgct atacgtgcat atgttcatgt 600atgtatctgt
atttaaaaca cttttgtatt atttttcctc atatatgtgt ataggtttat 660acggatgatt
taattattac ttcaccaccc tttatttcag gctgatatct tagccttgtt 720actagttaga
aaaagacatt tttgctgtca gtcactgtca agagattctt ttgctggcat 780ttcttctaga
agcaaaaaga gcgatgcgtc ttttccgctg aaccgttcca gcaaaaaaga 840ctaccaacgc
aatatggatt gtcagaatca tataaaagag aagcaaataa ctccttgtct 900tgtatcaatt
gcattataat atcttcttgt tagtgcaata tcatatagaa gtcatcgaaa 960tagatattaa
gaaaaacaaa ctgtacaatc aatcaatcaa tcatcacata aagtcgacat 1020gttgacaaaa
gcaacaaaag aacaaaaatc ccttgtgaaa agcagagggg cggagcttgt 1080tgttgattgc
ttagcggagc aaggtgtcac acatgtattt ggcattccag gtgcaaaaat 1140tgatgcggta
tttgacgctt tacaagataa agggcctgaa attatcgttg cccggcatga 1200acaaaatgca
gcatttatgg cgcaagcagt cggccgttta actggaaaac cgggagtcgt 1260gttagtcaca
tcaggaccag gtgcttcgaa cttggcaaca ggactgctga cagcaaacac 1320tgaaggtgac
cctgtcgttg cgcttgctgg gaacgtgatc cgtgcagatc gtttaaaacg 1380gacacatcaa
tctttggata atgcggcgct attccagccg attacaaaat acagtgtaga 1440agttcaagat
gtaaaaaata taccggaagc tgttacaaat gcgtttagga tagcgtcagc 1500agggcaggct
ggggccgctt ttgtgagttt tccgcaagat gttgtgaatg aagtcacaaa 1560tacaaaaaac
gtacgtgctg tcgcagcgcc aaaacttggt cccgcagcag atgacgcaat 1620cagtatggcc
attgcaaaaa ttcaaacagc aaaacttcct gtcgttttag tcggcatgaa 1680gggcggaaga
ccggaagcga ttaaagcggt tcgcaagcta ttgaaaaaag tgcagcttcc 1740attcgttgaa
acatatcaag ctgccggtac tcttacgaga gatttagagg atcagtattt 1800tggccggatc
ggtttattcc gcaaccagcc tggcgatctg ctgcttgagc aggctgatgt 1860tgttctgaca
atcggctatg acccaattga atatgatccg aaattctgga atgtcaatgg 1920agaccggacg
atcatccatt tagacgagat tctggctgac attgatcatg cttaccagcc 1980ggatcttgaa
ctgatcggtg atattccatc tacgatcaat catatcgaac acgatgctgt 2040gaaagtagac
tttgcggaac gtgagcagaa gatcctttct gatttaaaac aatatatgca 2100tgagggtgag
caggtgcctg cagattggaa atcagacaga gtgcatcctc ttgaaatcgt 2160taaagaattg
cgaaacgcag tcgatgatca tgttacagtg acttgcgata tcggttcaca 2220cgcgatttgg
atgtcacgtt atttccgcag ctacgagccg ttaacattaa tgattagtaa 2280cggtatgcaa
acactcggcg ttgcgcttcc ttgggcaatc ggcgcttcat tggtgaaacc 2340gggagaaaaa
gtagtatcag tctccggtga tggcggtttc ttattctcag ctatggaatt 2400agagacagca
gttcgtttaa aagcaccaat tgtacacatt gtatggaacg acagcacata 2460tgacatggtt
gcattccagc aattgaaaaa atataatcgt acatctgcgg tcgatttcgg 2520aaatatcgat
atcgtgaaat acgcggaaag cttcggagca actggcttac gcgtagaatc 2580accagaccag
ctggcagatg ttctgcgtca aggcatgaac gctgaggggc ctgtcatcat 2640tgatgtcccg
gttgactaca gtgataacgt taatttagca agtgacaagc ttccgaaaga 2700attcggggaa
ctcatgaaaa cgaaagctct ctagggatcc tcatgtaatt agttatgtca 2760cgcttacatt
cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa 2820cctgaagtct
aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt 2880atatttcaaa
tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg 2940aaaaccttgc
ttgagaaggt tttgggacgc tcgaaggctt taatttgccc taggctcaac 3000tcaagacgca
cagatattat aacatctgca taataggcat ttgcaagaat tactcgtgag 3060taaggaaaga
gtgaggaact atcgcatacc tgcatttaaa gatgccgatt tgggcgcgaa 3120tcctttattt
tggcttcacc ctcatactat tatcagggcc agaaaaagga agtgtttccc 3180tccttcttga
attgatgtta ccctcataaa gcacgtggcc tcttatcgag aaagaaatta 3240ccgtcgctcg
tgatttgttt gcaaaaagaa caaaactgaa aaaacccaga cacgctcgac 3300ttcctgtctt
cctattgatt gcagcttcca atttcgtcac acaacaaggt cctagcgacg 3360gctcacaggt
tttgtaacaa gcaatcgaag gttctggaat ggcgggaaag ggtttagtac 3420cacatgctat
gatgcccact gtgatctcca gagcaaagtt cgttcgatcg tactgttact 3480ctctctcttt
caaacagaat tgtccgaatc gtgtgacaac aacagcctgt tctcacacac 3540tcttttcttc
taaccaaggg ggtggtttag tttagtagaa cctcgtgaaa cttacattta 3600catatatata
aacttgcata aattggtcaa tgcaagaaat acatatttgg tcttttctaa 3660ttcgtagttt
ttcaagttct tagatgcttt ctttttctct tttttacaga tcatcaagga 3720agtaattatc
tactttttac aacaaatata aaacaagctc gacatgtata ctgttggtga 3780ttatctgctg
gaccgtctgc atgaactggg tatcgaagaa atcttcggcg ttccgggtga 3840ttacaatctg
cagttcctgg atcagatcat ctctcataaa gacatgaaat gggtgggtaa 3900cgctaacgaa
ctgaacgcaa gctacatggc agatggttat gcacgtacca agaaagccgc 3960ggcatttctg
accactttcg gtgttggcga actgagcgcc gtcaacggtc tggcgggctc 4020ctacgccgaa
aacctgccgg tggtggagat cgtaggcagc ccaacgagca aagttcagaa 4080cgaaggtaaa
ttcgtccacc acactctggc tgacggcgat ttcaaacact tcatgaaaat 4140gcatgaacct
gtgactgcgg cacgtacgct gctgactgca gagaacgcta ctgtggaaat 4200cgaccgcgtt
ctgtctgcgc tgctgaaaga acgcaaacca gtttacatca acctgcctgt 4260ggatgttgcg
gcagctaaag cggaaaaacc gagcctgccg ctgaagaaag aaaactccac 4320ttctaacact
agcgaccagg aaatcctgaa caaaatccag gagtctctga aaaacgcaaa 4380gaaaccaatc
gtgatcaccg gccacgaaat catttctttt ggtctggaga agaccgtgac 4440ccaattcatc
agcaaaacca aactgccgat taccaccctg aacttcggca agtcctctgt 4500tgacgaggct
ctgccgtctt tcctgggcat ctacaacggt actctgagcg aaccgaacct 4560gaaagaattt
gttgaatctg cggacttcat cctgatgctg ggcgttaaac tgaccgactc 4620ttctaccggt
gcattcactc accatctgaa cgaaaacaaa atgattagcc tgaacatcga 4680cgagggtaaa
atcttcaacg agcgtatcca gaacttcgac ttcgaaagcc tgatcagctc 4740tctgctggac
ctgtccgaaa tcgagtataa aggcaaatac attgacaaaa agcaagaaga 4800tttcgtacca
tctaacgcac tgctgtccca ggatcgcctg tggcaggccg tggagaacct 4860gacccagagc
aatgaaacca tcgtggcgga acaaggtacg agctttttcg gcgcgtcttc 4920tatctttctg
aaatccaaaa gccattttat cggtcagccg ctgtggggta gcattggcta 4980tactttcccg
gcagcgctgg gctctcagat cgctgataaa gaatctcgtc atctgctgtt 5040catcggtgac
ggttccctgc agctgaccgt acaggaactg ggtctggcaa ttcgtgaaaa 5100gatcaacccg
atttgcttca ttattaacaa tgacggctac accgttgagc gtgagatcca 5160cggtccgaac
cagtcttaca acgatatccc tatgtggaac tactctaaac tgccggagtc 5220cttcggcgca
actgaggacc gtgttgtgtc taaaattgtg cgtaccgaaa acgaatttgt 5280gagcgtgatg
aaagaggccc aggccgatcc gaaccgtatg tactggatcg aactgatcct 5340ggcgaaagaa
ggcgcaccga aggtactgaa gaaaatgggc aagctgtttg ctgaacagaa 5400taaatcctaa
ggatcttttg cggcctagta ttgaattctt atacaggaaa cttaatagaa 5460caaatcacat
atttaatcta atagccacct gcattggcac ggtgcaacac tacttcaact 5520tcatcttaca
aaaagatcac gtgatctgtt gtattgaact gaaaattttt tgtttgcttc 5580tctctctctc
tttcattatg tgagatttaa aaaccagaaa ctacatcatc gaaaaagagt 5640tttaaaccat
tacaaccatt gcgataagcc ctctcaaact ataacaatac tgacagtact 5700aaataattgc
ctacttggct tcacatacgt tgcatacgtc gatatagata ataatgataa 5760tgacagcagg
attatcgtaa tacgtaatag ttgaaaatct caaaaatgtg tgggtcatta 5820cgtaaataat
gataggaatg ggattcttct atttttcctt tttccattct agcagccgtc 5880gggaaaacgt
ggcatcctct ctttcgggct caattggagt cacgctgccg tgagcatcct 5940ctctttccat
atctaacaac tgagcacgta accaatggaa aagcatgagc ttagcgttgc 6000tccaaaaaag
tattggatgg ttaataccat ttgtctgttc tcttctgact ttgactcctc 6060aaaaaaaaaa
aatctacaat caacagatcg cttcaattac gccctcacaa aaactttttt 6120ccttcttctt
cgcccacgtt aaattttatc cctcatgttg tctaacggat ttctgcactt 6180gatttattat
aaaaagacaa agacataata cttctctatc aatttcagtt attgttcttc 6240cttgcgttat
tcttctgttc ttctttttct tttgtcatat ataaccataa ccaagtaata 6300catattcaaa
atgtccacaa aatcatatac cagtagagct gagactcatg caagtccggt 6360tgcatcgaaa
cttttacgtt taatggatga aaagaagacc aatttgtgtg cttctcttga 6420cgttcgttcg
actgatgagc tattgaaact tgttgaaacg ttgggtccat acatttgcct 6480tttgaaaaca
cacgttgata tcttggatga tttcagttat gagggtactg tcgttccatt 6540gaaagcattg
gcagagaaat acaagttctt gatatttgag gacagaaaat tcgccgatat 6600cggtaacaca
gtcaaattac aatatacatc gggcgtttac cgtatcgcag aatggtctga 6660tatcaccaac
gcccacgggg ttactggtgc tggtattgtt gctggcttga aacaaggtgc 6720gcaagaggtc
accaaagaac caaggggatt attgatgctt gctgaattgt cttccaaggg 6780ttctctagca
cacggtgaat atactaaggg taccgaagct tggcgtaatc atggtcatag 6840ctgtttcctg
tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc 6900ataaagtgta
aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 6960tcactgcccg
ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa 7020cgcgcgggga
gaggcggttt gcgtattggg cgctcttccg cttcctcgct cactgactcg 7080ctgcgctcgg
tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 7140ttatccacag
aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 7200gccaggaacc
gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 7260gagcatcaca
aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 7320taccaggcgt
ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 7380accggatacc
tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 7440tgtaggtatc
tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 7500cccgttcagc
ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 7560agacacgact
tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 7620gtaggcggtg
ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 7680gtatttggta
tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 7740tgatccggca
aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 7800acgcgcagaa
aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 7860cagtggaacg
aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc 7920acctagatcc
ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa 7980acttggtctg
acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta 8040tttcgttcat
ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc 8100ttaccatctg
gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat 8160ttatcagcaa
taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta 8220tccgcctcca
tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt 8280aatagtttgc
gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt 8340ggtatggctt
cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg 8400ttgtgcaaaa
aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc 8460gcagtgttat
cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc 8520gtaagatgct
tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg 8580cggcgaccga
gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga 8640actttaaaag
tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta 8700ccgctgttga
gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct 8760tttactttca
ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag 8820ggaataaggg
cgacacggaa atgttgaata ctcatactct tcctttttca atattattga 8880agcatttatc
agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat 8940aaacaaatag
gggttccgcg cacatttccc cgaaaagtgc cacctgacgt
899077561PRTTrichoderma atraviride 77Met Thr Lys Asp Thr Val Asp Ile Leu
Ile Asp Ser Leu Lys Ala Ala 1 5 10
15 Gly Val Lys Tyr Val Phe Gly Val Pro Gly Ala Lys Ile Asp
Ser Val 20 25 30
Phe Asn Ala Leu Ile Asp His Pro Asp Ile Lys Leu Val Val Cys Arg
35 40 45 His Glu Gln Asn
Ala Ala Phe Ile Ala Ala Ala Met Gly Lys Val Thr 50
55 60 Gly Arg Pro Gly Val Cys Ile Ala
Thr Ser Gly Pro Gly Thr Ser Asn 65 70
75 80 Leu Val Thr Gly Leu Val Thr Ala Thr Asp Glu Gly
Ala Pro Val Val 85 90
95 Ala Ile Val Gly Ser Val Lys Arg Ser Gln Ser Leu Gln Arg Thr His
100 105 110 Gln Ser Leu
Arg Gly Ala Asp Leu Leu Ala Pro Val Thr Lys Lys Val 115
120 125 Val Ser Ala Val Val Glu Asp Gln
Val Ala Glu Ile Met Leu Asp Ala 130 135
140 Phe Arg Val Ala Ala Ala Ser Pro Pro Gly Ala Thr Ala
Val Ser Leu 145 150 155
160 Pro Ile Asp Leu Met Thr Pro Ala Lys Ser Thr Ser Thr Val Thr Ala
165 170 175 Phe Pro Ala Glu
Cys Phe Ile Pro Pro Lys Tyr Gly Lys Ser Pro Glu 180
185 190 Thr Thr Leu Gln Ala Ala Ala Asp Leu
Ile Ser Ala Ala Lys Ala Pro 195 200
205 Val Leu Phe Leu Gly Met Arg Val Ser Glu Ser Asp Asp Thr
Ile Ser 210 215 220
Ala Val His Gly Phe Leu Arg Lys His Pro Val Pro Val Val Glu Thr 225
230 235 240 Phe Gln Ala Ala Gly
Ala Ile Ser Lys Glu Leu Val His Leu Phe Tyr 245
250 255 Gly Arg Ile Gly Leu Phe Ser Asn Gln Pro
Gly Asp Gln Leu Leu Gln 260 265
270 His Ala Asp Leu Val Ile Ala Ile Gly Leu Asp Gln Ala Glu Tyr
Asp 275 280 285 Ala
Asn Met Trp Asn Ala Arg Gly Thr Thr Ile Leu His Val Asp Ile 290
295 300 Gln Pro Ala Asp Phe Val
Ala His Tyr Lys Pro Lys Ile Glu Leu Val 305 310
315 320 Gly Ser Leu Ala Asp Asn Met Thr Asp Leu Thr
Ser Arg Leu Asp Thr 325 330
335 Val Ala Arg Leu Gln Leu Thr Lys Pro Gly Glu Ala Ile Arg Thr Asn
340 345 350 Met Trp
Glu Trp Gln Asn Ser Pro Glu Ala Ser Gly Arg Ser Thr Gly 355
360 365 Pro Val His Pro Leu His Phe
Ile Arg Leu Phe Gln Ser Ile Ile Asp 370 375
380 Pro Ser Thr Thr Val Ile Ser Asp Val Gly Ser Val
Tyr Ile Trp Leu 385 390 395
400 Cys Arg Tyr Phe Tyr Ser Tyr Ala Arg Arg Thr Phe Leu Met Ser Asn
405 410 415 Val Gln Gln
Thr Leu Gly Val Ala Met Pro Trp Ala Ile Gly Val Ser 420
425 430 Leu Ser Gln Thr Pro Pro Ser Ser
Lys Lys Val Val Ser Ile Ser Gly 435 440
445 Asp Gly Gly Phe Met Phe Ser Ser Gln Glu Leu Val Thr
Ala Val Gln 450 455 460
Gln Gly Cys Asn Ile Thr His Phe Ile Trp Asn Asp Gly Lys Tyr Asn 465
470 475 480 Met Val Glu Phe
Gln Glu Val Asn Lys Tyr Gly Arg Ser Ser Gly Val 485
490 495 Asp Leu Gly Gly Val Asp Phe Val Lys
Leu Ala Asp Ser Met Gly Ala 500 505
510 Lys Gly Leu Arg Val Ser Ser Ala Gly Asp Leu Glu Ala Val
Met Lys 515 520 525
Glu Ala Leu Ala Tyr Asp Gly Val Cys Leu Val Asp Ile Glu Ile Asp 530
535 540 Tyr Ser Gln Asn His
Asn Leu Met Met Asp Leu Val Thr Ser Asp Val 545 550
555 560 Ser 78568PRTTalaromyces stipitatus
78Met Ser Asn Arg Asn Pro Ser His Val Ile Val Glu Ser Leu Ser Asn 1
5 10 15 Ala Gly Val Lys
Ile Val Phe Gly Ile Pro Gly Ala Lys Val Asp Gly 20
25 30 Ile Phe Asp Ala Leu Ser Asp His Pro
Thr Ile Lys Leu Ile Val Cys 35 40
45 Arg His Glu Gln Asn Ala Ala Phe Met Ala Ala Ala Val Gly
Arg Leu 50 55 60
Thr Gly Ala Pro Gly Val Cys Leu Val Thr Ser Gly Pro Gly Thr Ser 65
70 75 80 Asn Leu Val Thr Gly
Leu Ala Thr Ala Thr Thr Glu Gly Asp Pro Val 85
90 95 Leu Ala Ile Ala Gly Thr Val Ser Arg Leu
Gln Ala Ala Arg His Thr 100 105
110 His Gln Ser Leu Asp Val Asn Lys Val Leu Glu Gly Val Cys Lys
Ser 115 120 125 Val
Ile Gln Val Gly Val Glu Asp Gln Val Ser Glu Val Ile Ala Asn 130
135 140 Ala Phe Arg His Ala Arg
Gln Phe Pro Gln Gly Ala Thr Ala Val Ala 145 150
155 160 Leu Pro Met Asp Ile Ile Lys Ser Thr Ser Val
Gly Val Pro Pro Phe 165 170
175 Pro Ser Leu Ser Phe Glu Ala Pro Gly Tyr Gly Ser Ser Asn Thr Lys
180 185 190 Leu Cys
Lys Val Ala Val Asp Lys Leu Ile Ala Ala Lys Tyr Pro Val 195
200 205 Ile Leu Leu Gly Met Arg Ser
Ser Asp Pro Glu Ile Val Ala Ser Val 210 215
220 Arg Arg Met Ile Lys Asp His Thr Leu Pro Val Val
Glu Thr Phe Gln 225 230 235
240 Ala Ala Gly Ala Ile Ser Glu Asp Leu Leu His Arg Tyr Tyr Gly Arg
245 250 255 Val Gly Leu
Phe Arg Asn Gln Pro Gly Asp Lys Val Leu Ala Arg Ala 260
265 270 Asp Leu Ile Ile Ala Val Gly Tyr
Asp Pro Tyr Glu Tyr Asp Ala Glu 275 280
285 Thr Trp Asn Val Asn Asn Pro Ala Thr Ile His Asn Ile
Ile His Ile 290 295 300
Asp Tyr Thr His Ser Arg Val Ser Gln His Tyr Met Pro His Val Glu 305
310 315 320 Leu Leu Gly Asn
Pro Ala Asp Ile Val Asp Glu Leu Thr Ala Ser Leu 325
330 335 Gln Ala Leu Lys Pro Asn Phe Trp Ser
Gly Ala Glu Asp Thr Leu Glu 340 345
350 Asn Ile Arg Gln Glu Ile Ala Arg Cys Glu Ala Thr Ala Thr
His Thr 355 360 365
Glu Ser Leu Gln Asp Gly Ala Val Gln Pro Thr His Phe Val Tyr Gln 370
375 380 Leu Arg His Leu Leu
Pro Lys Glu Thr Ile Val Ala Val Asp Val Gly 385 390
395 400 Thr Val Tyr Ile Tyr Met Met Arg Tyr Phe
Gln Thr Tyr Ser Pro Arg 405 410
415 His Leu Leu Cys Ser Asn Gly Gln Gln Thr Leu Gly Val Gly Leu
Pro 420 425 430 Trp
Ala Ile Ala Ala Ser Leu Ile Gln Glu Pro Pro Cys Ser Arg Lys 435
440 445 Val Val Ser Ile Ser Gly
Asp Gly Gly Phe Met Phe Ser Ser Gln Glu 450 455
460 Leu Ala Thr Ala Val Leu Gln Lys Cys Asn Ile
Thr His Phe Ile Trp 465 470 475
480 Asn Asp Ser Gly Tyr Asn Met Val Glu Phe Gln Glu Glu Ala Lys Tyr
485 490 495 Gly Arg
Ser Ser Gly Ile Lys Leu Gly Gly Ile Asp Phe Val Lys Phe 500
505 510 Ala Glu Ala Phe Asp Gly Ala
Arg Gly Phe Arg Ile Asn Ser Thr Lys 515 520
525 Glu Val Lys Glu Val Ile Lys Glu Ala Leu Ala Phe
Glu Gly Val Ala 530 535 540
Ile Val Asp Val Arg Ile Asp Tyr Ser Arg Ser His Glu Leu Met Lys 545
550 555 560 Asp Ile Ile
Pro Lys Asp Tyr Gln 565
User Contributions:
Comment about this patent or add new information about this topic: