Patent application title: TRUNCATED VARIANT OF THE MAMMALIAN TARGET FOR RAPAMYCIN (mTOR) PROTEIN
Inventors:
IPC8 Class: AC12N912FI
USPC Class:
1 1
Class name:
Publication date: 2017-05-25
Patent application number: 20170145391
Abstract:
The invention relates to mTORbeta, a splice form of mTOR, nucleic acids
encoding mTOR beta, and antibodies against mTOR beta. The invention also
relates to methods of producing mTOR beta and methods of screening for an
agent that modulates mTOR beta expression and/or activity. The invention
further relates to a method of treating a disease associated with
aberrant expression of mTOR beta by administration of an agent that
alters mTOR activity and/or expression.Claims:
1. An isolated polypeptide which phosphorylates S6K1 and/or 4E-BP1
selected from the group consisting of: (a) an isolated polypeptide
comprising the amino acid sequence of SEQ ID NO: 2; (b) an isolated
polypeptide comprising an amino acid sequence having at least 75%
sequence identity with the amino acid sequence of SEQ ID NO: 2; and (c)
an isolated polypeptide comprising the amino acid sequence encoded by SEQ
ID NO: 1.
2. An isolated polynucleotide selected from the group consisting of: (a) a polynucleotide encoding a polypeptide according to claim 1; (b) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or the complement thereof; (c) a polynucleotide comprising a nucleic acid sequence having at least 80% sequence identity over the entire contiguous sequence of SEQ ID NO: 1 and encoding a protein that phosphorylates S6K1 and/or 4E-BP1; and (d) an isolated nucleic acid molecule which hybridizes to the nucleotide sequence of SEQ ID NO: 1 or the complement thereof under conditions which employ 0.1.times.SSC at 68.degree. C. and encoding a protein which phosphorylates S6K1 and/or 4E-BP1.
3. A polynucleotide according to claim 2, wherein said polynucleotide is operably linked to one or more expression control elements.
4. A vector comprising a polynucleotide according to claim 2.
5. A host cell comprising a polynucleotide according to claim 2.
6. An isolated antibody that specifically binds to a polypeptide according to claim 1.
7. An antibody according to claim 6, wherein said antibody is monoclonal.
8. An antibody according to claim 6, wherein the antibody is humanized.
9. A method for producing a polypeptide comprising culturing a host cell according to claim 5 under conditions in which is expressed.
10. A method of screening for an agent that modulates mTORbeta activity, comprising the following steps: (a) contacting a polypeptide according to claim 1; with a test agent; and (b) detecting any change in the activity of said polypeptide, wherein a change in activity is indicative of an agent capable of modulating mTORbeta activity.
11. A method according to claim 10, wherein the activity is detected by measuring S6K1 and/or 4E-BP1 phosphorylation.
12. A method according to claim 10, wherein the activity is detected by measuring expression of c-Myc protein.
13. A method of screening for an agent that modulates mTORbeta expression and/or activity, comprising the following steps: (a) providing a host cell according to claim 5; (b) contacting said host cell with a test agent; and (c) detecting any change in the expression and/or activity of said polypeptide, wherein a change in expression and/or activity is indicative of an agent capable of modulating mTORbeta expression and/or activity.
14. A method according to claim 13, wherein the activity is detected by measuring S6K1 and/or 4E-BP-1 phosphorylation.
15. A method according to claim 13, wherein the activity is detected by measuring expression of c-Myc protein.
16. A method according to claim 13, wherein the expression is detected by measuring the level of a nucleic acid comprising SEQ ID NO: 1.
17. A method of treating a disease associated with aberrant expression of a polypeptide according to claim 1 comprising administration of an effective amount of an agent to a subject in need thereof, wherein said agent alters the activity and/or expression of said polypeptide.
18. A method according to claim 17, wherein the agent is an antibody that specifically binds to a polypeptide selected from the group consisting of: (a) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2; (b) an isolated polypeptide comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence of SEQ ID NO: 2; and (c) an isolated polypeptide comprising the amino acid sequence encoded by SEQ ID NO: 1.
19. A host cell comprising a polypeptide of claim 1.
Description:
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 14/035,634, filed on Sep. 24, 2013, which is a continuation of U.S. patent application Ser. No. 12/598,394, which issued as U.S. Pat. No. 8,669,347, which is a National Stage application under 35 U.S.C. .sctn.371 of International Application No. PCT/GB2008/001548, filed May 1, 2008, which claims priority to U.S. Provisional Application No. 60/924,145 that was filed on May 1, 2007. The entire contents of U.S. patent application Ser. No. 14/035,634 is hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a truncated variant of the mammalian target for rapamycin (mTOR) protein.
BACKGROUND OF THE INVENTION
[0003] The mammalian target of rapamycin (mTOR) is a serine/threonine kinase, which belongs to a large family of PI3K-related kinases, which also includes DNA-dependent protein kinase, ATM and ATR. Biochemical and genetic studies demonstrated that mTOR integrates growth factor stimulation, energy, and nutrient availability to regulate biosynthetic processes responsible for cell growth, size, and cell cycle progression. The regulation of mTOR kinase activity in response to various extracellular cues has been extensively studied in the last decade. A whole range of cellular proteins with various enzymatic activities, scaffold and adaptor functions have been implicated in signaling to and regulating the activity of mTOR, including protein kinases PKB/Akt and AMPK, tumor suppressors PTEN and tuberous sclerosis complex TSC1/2, small GTP-binding protein Rheb, scaffolding proteins Raptor and Rictor. In an activated state, mTOR transduces signaling and metabolic information by phosphorylating major downstream targets, such as S6Ks, 4E-BP1 and PKB/Akt. Studies from various laboratories indicated that mTOR exists in two functionally distinct complexes, termed mTOR complex 1 (mTORC1) and mTORC2. The mTORC1 contains the core components mTOR, raptor, and mLST8/G.beta.L, and is sensitive to rapamycin. The mTORC2 is believed to be rapamycin insensitive and contains mTOR, Rictor, and mLST8/G.beta.L. Rapamycin and its analogues are currently evaluated as anticancer drugs in a number of clinical trials. In addition, they are now widely used for coating stents to reduce post-stenting restenosis after coronary angioplasty. In contrast to yeasts, which have two TOR genes, mammals possess only one gene, known to encode a single polypeptide with molecular weight of approximately 280 kDa.
[0004] One important downstream target of mTOR is S6K. S6 kinase (p70 S6 kinase (p70.sup.S6k)) is responsible for S6 phosphorylation of the ribosomal S6 protein, which is a component of the 40S subunit of eukaryotic ribosomes (i.e., the cellular machinery responsible for translation of mRNA and protein synthesis). It is also believed to be the major physiological S6 kinase in mammalian cells (Proud, 1996 Trends Biochem. Sci. 21:181-185). The 40S ribosomal protein S6 is a component of the 40S subunit of eukaryotic ribosomes. The S6 protein is phosphorylated in response to certain cellular signaling events such as hormone or growth factor induced cellular proliferation.
[0005] S6 Kinase is activated by a variety of growth factors such as insulin, and mitogens (Alessi et al., 1998 Curr. Biol. 8:69-81). Certain drugs that regulate S6 kinase activity have been identified including rapamycin, which is the most potent inhibitor of S6 kinase (Pullen et al., 1997 FEBS Letters 410:78-82). The structure of and some functions of S6 kinase alpha and S6 kinase beta are disclosed in U.S. Pat. No. 6,830,909, herein incorporated by reference in its entirety.
[0006] S6 kinase has been shown to be both phosphorylated and acetylated. It was found that S6 kinase protein is acetylated both in vivo and in vitro by p300 and P/CAF acetyltransferases. More accurate to say that in conditions under which S6K acetylation is increased (i.e., presence of HDAC inhibitors/overexpression of p300), S6 kinase activity and 412 phosphorylation are reduced. Mutation of the P-loop lysines (which are acetylated by p300 in vitro) to glutamine, which mimics acetylation, results in the complete inactivation of S6Ks and loss of 412 phosphorylation. S6K2 (S6K beta) has also been shown to possesses an AT-hook DNA binding motif. Thus. S6 kinase 2 protein binds to DNA and is thereby activated which in turn stimulates its kinase activity. Therefore, S6K2 is thought to transduce growth-promoting effects in response to mitogens and nutrients. This may involve the regulation of transcription factors and/or chromatin remodeling proteins by phosphorylation, when S6K2 complexes with DNA and is activated by this interaction. Regulation of S6 Kinase protein activity and related methods are disclosed in WO 2007/019421, incorporated herein by reference in its entirety.
SUMMARY OF THE INVENTION
[0007] The present invention relates to a newly discovered splice form of mTOR, called mTOR beta (mTOR.beta.). In particular, the invention provides an isolated polypeptide which phosphorylates S6K1 and/or 4E-BP1 selected from the group consisting of:
(a) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2; (b) an isolated polypeptide comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence of SEQ ID NO: 2; and (c) an isolated polypeptide comprising the amino acid sequence encoded by SEQ ID NO: 1.
[0008] The invention also provides:
[0009] An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide of the invention; (b) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or the complement thereof; (c) a polynucleotide comprising a nucleic acid sequence having at least 80% sequence identity over the entire contiguous sequence of SEQ ID NO: 1 and encoding a protein that phosphorylates S6K1 and/or 4E-BP1; and (d) an isolated nucleic acid molecule which hybridizes to the nucleotide sequence of SEQ ID NO: 1 or the complement thereof under conditions which employ 0.1.times.SSC at 68.degree. C. and encoding a protein which phosphorylates S6K1 and/or 4E-BP1.
[0010] A vector comprising a polynucleotide of the invention.
[0011] A host cell comprising a polypeptide of the invention, a polynucleotide of the invention or a vector of the invention.
[0012] An isolated antibody that specifically binds to a polypeptide of the invention.
[0013] A method for producing a polypeptide comprising culturing a host cell of the invention under conditions in which a polypeptide of the invention or a polypeptide encoded by a polynucleotide of the invention is expressed.
[0014] A method of screening for an agent that modulates mTORbeta activity, comprising the following steps:
(a) contacting a polypeptide of the invention with a test agent; and (b) detecting any change in the activity of said polypeptide, wherein a change in activity is indicative of an agent capable of modulating mTORbeta activity.
[0015] A method of screening for an agent that modulates mTORbeta expression and/or activity, comprising the following steps:
(a) providing a host cell according to claim 5 that comprises or expresses a polypeptide of the invention or a polypeptide encoded by a polynucleotide of the invention; (b) contacting said host cell with a test agent; and (c) detecting any change in the expression and/or activity of said polypeptide, wherein a change in expression and/or activity is indicative of an agent capable of modulating mTORbeta expression and/or activity.
[0016] A method of treating a disease associated with aberrant expression of a polypeptide of the invention comprising administration of an effective amount of an agent to a subject in need thereof, wherein said agent alters the activity and/or expression of said polypeptide.
[0017] An agent that alters activity and/or expression of a polypeptide of the invention for use in the treatment of a disease associated with aberrant expression of said polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows a Western blot analysis of mTOR expression in rat tissues using the C-terminal and F11 anti-mTOR antibodies. Protein extracts (30 .mu.g) of rat tissues were resolved by SDS-PAGE, transferred to a PVDF membrane, and probed with the C-terminal mTOR polyclonal antibodies from Cell Signaling (upper panel). The membrane was then stripped and reprobed with anti-actin antibodies (lower panel).
[0019] FIG. 2 shows a Northern blot analysis of mTOR expression in human tissues. The blot was stripped and reprobed for .beta.-actin expression (lower panel).
[0020] FIG. 3 shows immunoprecipitation of mTOR.beta. from Hep2G, Hek293 and MCF7 cells with the C-terminal anti-mTOR antibodies. The lysates of Hep2G, Hek293 and MCF7 cells were immunoprecipitated with the C-terminal anti-mTOR antibodies (Cell Signaling) and immune complexes probed in Western blotting with the N-terminal anti-mTOR antibodies (Santa Cruz).
[0021] FIG. 4 shows the identification of potential mTOR splice variant in human cell lines by PCR. FIG. 4A shows agarose gels for the total RNA and mTOR beta RNA from Hep2G, HEK293, and MCF7. Total RNA was purified from Hep2G, HEK293 and MCF7 cell lines and converted into first strand DNAs. A set of mTOR specific primers was used in PCR reactions to search for potential splice variants. Amplified fragments were resolved by electrophoresis in 2% agarose gel. The most prominent bands were excised from the gel and sequence analyzed. One set of primers (N1 and C3) consistently amplified a 100 bp fragment from three cell lines. Specific fragments of glyceraldehyde-3-phosphate dehydrogenase (GADPH) and .beta.-actin were amplified and used as loading and quality controls of first strand DNA. FIG. 4B shows the sequence alignment of 100 bp PCR fragments, amplified with N1 and C3 mTOR specific primers. Amplified fragments were sequenced and aligned by Clustal W program. The position of the potential splice fusion is indicated by an arrow. FIG. 4C shows the amino acid sequence of a 100 bp PCR product, amplified with N1 and C3 mTOR specific primers. The arrow indicates the position of a potential splice fusion. The sequences, corresponding to the N-terminal region and the FATN domain of mTOR are underlined.
[0022] FIG. 5 shows the domain organization of the full-length mTOR.alpha. and mTOR.beta. splicing isoform. The location of each domain, including its amino acid position, is indicated. The localization of the epitopes, corresponding to anti-mTOR antibodies is indicated. Regions mediating the interaction of known mTOR binding partners are underlined. There are 20 HEAT motifs (Huntingtin, EF3, A subunit of PP2A and Tor) of 37-43 amino acids each which are implicated in protein-protein interactions. HEAT18 and 19 are sufficient to target mTOR to the ER or Golgi. mTOR dimerizes via these HEAT regions. FAT domain=FRAP/ATM/TRAPP; FATN=FAT domain at N-terminus; FATC=FAT domain at C-terminus. The FATC domain was found to be necessary for mTOR kinase activity and function. FRB (FKBP12-rapamycin binding) domain is a conserved 11 kDa region necessary and sufficient for FKBP12-rapamycin binding. KD=kinase domain, believed to be a PI3K-related domain. RD=regulatory domain.
[0023] FIG. 6 shows that mTOR.beta. is phosphorylated at a serine residue corresponding to Ser2448 of the entire mTOR.alpha. amino acid sequence in response to serum stimulation and phosphorylates S6K1 and 4E-BP1 in in vitro kinase assay. FIG. 6A shows a gel of cells expressing mTOR.beta. upon transfection with pcDNA 3.1 mTOR.beta.. HEK293 cells were transfected with pcDNA3.1 or pcDNA 3.1 mTOR.beta.. One day later, cells were starved for 24 hours and than stimulated with 10% fetal bovine serum for 1 hour. Rapamycin (10 nM) was added 30 minutes before stimulation. Cells were lysed, resolved by SDS-PAGE and immunoblotted with the C-terminal anti-mTOR and pS2448 mTOR antibodies. FIG. 6B shows the results of the mTOR in vitro kinase assay. HEK293 cells were transfected with pcDNA3.1, pcDNA 3.1/FLAG-mTOR.beta. or pcDNA 3.1/FLAG-mTOR.alpha.. Two days later, cells were lysed and immunoprecipitated with anti-FLAG antibody. The immune complexes were used in mTOR in vitro kinase assay with His-4E-BP1 and His-S6K1C as substrates. Kinase reactions were resolved by SDS-PAGE and immunoblotted with phosphospecific antibodies to 4E-BP1 p65 and S6K1 p389. The level of immunoprecipitated FLAG-mTOR.alpha. and FLAG-mTOR.beta. was measured by Western blotting with anti-FLAG.
[0024] FIG. 7 shows the specific interaction of mTOR.beta. with Raptor, Rictor, and G.beta.L. HEK293 cells were transfected with pcDNA3.1-mTOR.beta.-FLAG and pRK-Raptor-HA or pcDNA3.1-mTOR.beta.-FLAG and pRK-Rictor-Myc or pcDNA3.1-mTOR.beta.-FLAG and pcRK-G.beta.L. The supernatants of lysed cells were immunoprecipitated with anti-FLAG antibody or control nonspecific antibody. The immune complexes or total cell lysates from transfected cells (15 .mu.g) were resolved by SDS-PAGE and probed in Western blotting with anti-HA, anti-Rictor, or anti-G.beta.L antibodies.
[0025] FIG. 8 shows that mTOR.beta. is less sensitive to Rapamycin in comparison to mTOR.alpha.. HEK293 cells were transfected with pcDNA3.1, pcDNA 3.1 mTOR.beta., or pcDNA 3.1 mTOR.alpha.. One day later, cells were starved for 24 hours and then stimulated with 10% serum for 1 hour. Various concentrations of Rapamycin were added 30 minutes before stimulation. Cells were lysed, resolved by SDS-PAGE and immunoblotted with the C-terminal mTOR antibody, anti-actin and different phosphospecific antibodies.
[0026] FIG. 9 shows the subcellular localization of mTOR.beta.. Exponentially growing HEK293 cells were fractionated using ProteoExstract Extraction kit (Calbiochem). mTOR.alpha. and mTOR.beta. were immunoprecipitated from all fractions using anti-mTOR C-terminal antibodies and immune complexes resolved by SDS-PAGE and immunoblotted with anti-mTOR N-terminal antibodies. Anti-4EBP1, HSP60, and c-Jun antibodies were used as controls for cytoplasm, membrane, and nuclear fractions, respectively.
[0027] FIG. 10 shows that overexpression of mTOR.beta. but not mTOR.alpha. induces cell proliferation. Hek293 stable cell lines, over-expressing mTOR.beta. wt, mTOR.alpha. wt or EGFP were seeded into a 96 well plate at various densities (250, 500, 1000 and 2000 cells per well) and grown under standard conditions for 7 days. Cell numbers were than measured in each well by a Resosurin based assay. Normalized growth curves for each cell line were calculated using data from six independent experiments (A). Western blot analysis of total cell lysates of stable cell lines with antibodies to c-myc and its transcription targets (B). The level of proteins was densitometrically measured, actin normalized and folds were calculated against EGFP expressing stable cell line (C).
[0028] FIG. 11 shows that mTOR.beta. kinase activity is required for the induction of proliferation. HEK293 stable cell lines, overexpressing mTOR.beta. wt, mTOR.beta. kinase-dead or EGFP were seeded into 96 well plate at various densities (1000, 2000, 4000 and 8000 cells per well) and grown under standard conditions for 5 days. Cell numbers were then measured in each well by Resazurin based assay. Normalized growth curves for each cell line were calculated using data from six independent experiments (A). Western blot analysis of total cell lysates of stable cell lines with antibodies to c-myc and its transcription targets. The level of proteins was densitometrically measured, actin normalized and folds were calculated against EGFP expressing stable cell line (B).
[0029] FIG. 12 shows that mTOR.beta. is critical for G1 progression of the cell cycle. HEK293 cells stably overexpressing mTOR.beta., mTOR.alpha. or EGFP were pulse labeled with BrdU for 30 minutes and chased every 2 hours for 24 hours. The incorporation of BrdU was measured by FACS analysis. Duration of G1, S and G2 phases of cell cycle observed for each cell line is presented on graph. SD, p=0.05.
[0030] FIG. 13 shows that overexpression of mTOR.beta. protects cells from starvation-induced cell death (A). mTOR.beta. kinase activity is required for mediating pro-survival effect (B). Hek293 stable cell lines, overexpressing mTOR.beta. wt, mTOR.alpha. wt, mTOR.beta. kinase dead or EGFP were serum starved for 60 hours. Cell survival was assessed by the Trypan Blue dye exclusion assay. Data are means.+-.SE of 5 experiments. * P value .ltoreq.0.01.
[0031] FIG. 14 shows that mTOR.beta. overexpression leads to increase in cell oncogenic potential. HEK293 cells stably overexpressing mTOR.beta., mTOR.alpha. or EGFP were plated in a thin layer of agarose in culture medium. After 14 days, colonies were stained using MTT (A). Colonies were counted using Quantity One Software (Bio-Rad) and folds were plotted (B). Data are means.+-.SE of 4 experiments. * P value.ltoreq.0.01.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0032] SEQ ID NO: 1 is the polynucleotide sequence encoding the human mTOR beta splice variant and SEQ ID NO: 2 is the amino acid sequence of the human mTOR beta protein.
[0033] SEQ ID NO: 3 is the polynucleotide sequence encoding the full-length human mTOR alpha protein and SEQ ID NO: 4 is the amino acid sequence of the human mTOR alpha protein.
[0034] SEQ ID Nos 5 to 8 are the primers used in Example 4.
[0035] SEQ ID NO: 9 is an amplified fragment produced by PCR from human MCF7, Keh293 and HEP2G cell lines and SEQ ID NO: 10 is the amino acid sequence encoded by SEQ ID NO: 9.
DETAILED DESCRIPTION OF THE INVENTION
[0036] The present invention is based on the identification and characterization of a new splice form of the mammalian target for rapamycin (mTOR) protein. This is the first time that the existence of a new splice form (termed herein after mTOR beta or mTOR.beta.) of mTOR has been shown. The present invention is based on assays for the mTOR beta protein and studies of its activity.
[0037] It has been determined that mTOR beta is a splice fusion of N-terminal amino acids 1 to 23 and the C-terminal amino acids 1867 to 2549 of the currently known mTOR (hereinafter mTOR.alpha.), which produces a fusion protein 706 amino acids in length (SEQ ID NO: 2). In the fusion protein, the regulatory HEAT and FAT domains are lost. It has also been shown that mRNA transcripts corresponding to mTOR.beta. are highly expressed in heart and liver, while kidney, liver, blood, small, and large intestine have the highest protein level of mTOR.beta.. Furthermore, similarly to the full-length mTOR.alpha., the splice form is also capable to associate with substrate-presenting molecules Raptor, Rictor, and G.beta.L. mTOR.beta. can also phosphorylate S6K1 and 4E-BP1 in vitro. In addition, it was shown that mTOR.beta. is phosphorylated at a serine residue corresponding to Ser2448 (S2448) of the entire mTOR.alpha. amino acid sequence (Ser605 of mTOR.beta.) in response to serum stimulation. Phosphorylation of mTOR.beta. at a serine residue corresponding to Ser2448 of the entire mTOR.alpha. amino acid sequence is sensitive to Rapamycin. Also, it was shown that when compared to mTOR.alpha., mTOR.beta. is less sensitive to Rapamycin.
[0038] As used herein, the term "mTOR beta" (mTOR.beta.) refers to the splice-form of mTOR. For example, the inventors have found that the polypeptide of SEQ ID NO: 2 is a naturally occurring human mTOR beta polypeptide. This protein is thought to be 706 amino acids in length and is encoded by a nucleic acid of SEQ ID NO: 1, approximately 2121 nucleotides in length. As used herein, the term "mTOR alpha" (mTOR.alpha.) refers to full-length mammalian target for rapamycin (mTOR) protein. For example, the human mTOR alpha polypeptide is thought to be a protein approximately 2549 amino acids in length (SEQ ID NO: 4) and is thought to be encoded by a nucleotide of SEQ ID NO: 3.
Polypeptides
[0039] The present invention provides mTOR beta polypeptides.
[0040] A "polypeptide" is used herein in its broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs, or other peptidomimetics. The term "polypeptide" thus includes short peptide sequences and also longer polypeptides and proteins. As used herein, the term "amino acid" refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
[0041] The polypeptides of the present invention are preferably provided in isolated form. As used herein, a protein is said to be isolated when physical, mechanical, or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
[0042] The present invention includes mTOR beta (mTOR.beta.) polypeptides. An mTOR beta polypeptide according to the invention may be a naturally occurring mTOR beta polypeptide, or may be a variant, derivative or fragment thereof as described herein. In one embodiment of the invention, an mTOR beta polypeptide consists of, consists essentially of or comprises the amino acid sequence of SEQ ID NO: 2. In one embodiment of the invention, an mTOR beta polypeptide is a splice fusion between N-terminal amino acids 1 to 23 and the C-terminal amino acids 1867 to 2549 of mTOR.alpha., such as those amino acids in the mTOR.alpha. polypeptide of SEQ ID NO: 4. In another embodiment of the invention, the mTOR beta polypeptide consists of, consists essentially of or comprises a sequence having at least 75% or at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 2 and phosphorylates S6K1 and/or 4E-BP1.
[0043] A polypeptide of the invention may be encoded by a polynucleotide of the invention as described herein, such as by the nucleotide sequence of SEQ ID NO: 1 or by a polynucleotide comprising SEQ ID NO: 1. A polypeptide of the invention may be encoded by a polynucleotide having at least 80% or at least 95% sequence identity over the entire contiguous sequence of SEQ ID NO: 1, or by a polynucleotide that hybridizes to the polynucleotide of SEQ ID NO: 1 under conditions that employ 0.1.times.SSC at 68.degree. C. The polypeptide encoded by such polynucleotides will be capable of phosphorylating S6K1 and/or 4E-BP1.
[0044] The mTOR beta polypeptide may be a naturally occurring mTOR beta polypeptide or a variant, derivative or fragment thereof. The naturally occurring mTOR beta polypeptide may be an mTOR beta polypeptide that is naturally expressed in any species, preferably a mammalian species. For example, a suitable naturally occurring mTOR beta polypeptide may be a mammalian mTOR beta polypeptide from a human, a non-human primate, a rodent (e.g. rat or mouse), a rabbit, a horse, or a livestock animal (e.g. a goat, sheep, pig or cow). The mTOR beta polypeptide may be a rabbit, mouse, rat, porcine, bovine, ovine, equine, human or non-human primate mTOR.beta. polypeptide. Preferably, the mTOR beta polypeptide is a human mTOR beta polypeptide. For example, the amino acid sequence of a human mTOR beta polypeptide is given in SEQ ID NO: 2. The polynucleotide sequence encoding a human mTOR beta polypeptide is given in SEQ ID NO: 1. An mTOR beta polypeptide according to the invention may be any such naturally occurring mTOR beta polypeptide, such as a human polypeptide, or may be an allelic variant thereof. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the disclosed protein.
[0045] The mTOR beta polypeptide may be a variant polypeptide, such as a derivative, analog, polypeptide fragment or mimetic of a naturally occurring mTOR beta peptide. Such a variant polypeptide preferably retains the same biological function or activity as a naturally occurring mTOR beta peptide. The activity may be any activity possessed by a naturally occurring mTOR beta polypeptide. A number of activities of mTOR beta are disclosed herein. A suitable variant polypeptide may have any one or more of these activities. For example, a variant polypeptide may retain the ability to be acetylated and/or the ability to phosphorylate second proteins and/or the ability to bind DNA. For example, a suitable variant polypeptide may induce cMyc impression. A suitable variant polypeptide may be phosphorylated at a serine residue corresponding to S2448 of the entire mTOR.alpha. amino acid sequence of SEQ ID NO: 4 (Ser605 of the mTOR.beta. polypeptide of SEQ ID NO: 2). A suitable variant polypeptide may have the ability to phosphorylate S6K1. A suitable variant polypeptide may have the ability to phosphorylate 4E-BP1. A suitable variant polypeptide may have the ability to phosphorylate S6K1 and 4E-BP1. A suitable variant polypeptide may interact with one, two, or all three of Raptor, Rictor and G.beta.L. A suitable variant polypeptide may induce cell proliferation. A suitable variant polypeptide may protect cells from starvation-induced cell death. A suitable variant polypeptide may increase the oncogenic potential of a cell. A suitable variant polypeptide may decrease the length of the G1 phase of the cell cycle. Methods for assessing these activities are described herein and would be readily understood by the skilled reader. The Examples show how such activities may be assessed and use the polypeptide of SEQ ID NO: 2 as an example. These methods could be readily adapted for use with other polypeptides as described herein.
[0046] An mTOR.beta. polypeptide of the invention may retain one or more functions of a full length mTOR.alpha. polypeptide. These functions may include one or more of: kinase activity; activations through the phosphorylation of a serine residue corresponding to S2448 of the mTOR.alpha. amino acid sequence of SEQ ID NO: 4 (Ser605 of the mTOR.beta. polypeptide of SEQ ID NO: 2); the ability to phosphorylate other proteins, such as the ability to phosphorylate S6K1 and/or the ability to phosphorylate 4E-BP1; the ability to interact with, or bind to, one, two, or all three of Raptor, Rictor and G.beta.L.
[0047] An mTOR beta polypeptide of the invention may retain at least one activity of naturally occurring mTOR beta that is different to that of full length mTOR alpha polypeptide. For example, as described herein, cells expressing mTOR.beta. proliferate faster than cells expressing mTOR.alpha.; expression of mTOR.beta., but not mTOR.alpha., leads to induction of c-Myc protein expression; cells expressing mTOR.beta. have a shorter duration of G1 phase than cells expressing mTOR.alpha.; expression of mTOR.beta., but not mTOR.alpha., protects cells against the effects of serum starvation; expression of mTOR.beta. leads to an increase in cell oncogenic potential compared to cells expressing mTOR.alpha.. An mTOR.beta. polypeptide of the invention may retain any one or more of these differences when compared to an mTOR.alpha. polypeptide.
[0048] Polypeptide variants include, but are not limited to, deletion, addition or substitution variants of a naturally occurring mTOR.beta. polypeptide such as the polypeptide of SEQ ID NO: 2. For example, a suitable variant may be a substitution, deletion or addition variant of such a sequence or may be a fragment of any such sequence. A variant polypeptide may comprise 1, 2, 3, 4, 5, up to 10, up to 20, up to 30, up to 40, up to 50, up to 75 or more amino acid substitutions and/or deletions from a naturally occurring mTOR.beta. polypeptide sequence, such as from SEQ ID NO: 2.
[0049] "Substitution" variants preferably involve the replacement of one or more amino acids with the same number of amino acids and making conservative amino acid substitutions. A polypeptide may have conservative substitution of one or more amino acids with one or more other amino acids. One skilled in the art is aware that various amino acids have similar characteristics. One or more such amino acids of a polypeptide can often be substituted by one or more other such amino acids without eliminating a desired property of that polypeptide (such as acetyltransferase activity). For example, an amino acid may be substituted with an alternative amino acid having similar properties, for example, another basic amino acid, another acidic amino acid, another neutral amino acid, another charged amino acid, another hydrophilic amino acid, another hydrophobic amino acid, another polar amino acid, another aromatic amino acid or another aliphatic amino acid. Some properties of the 20 main amino acids which can be used to select suitable substituents are as follows:
TABLE-US-00001 Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral Asp polar, hydrophilic, charged (-) Pro hydrophobic, neutral Glu polar, hydrophilic, charged (-) Gln polar, hydrophilic, neutral Phe aromatic, hydrophobic, neutral Arg polar, hydrophilic, charged (+) Gly aliphatic, neutral Ser polar, hydrophilic, neutral His aromatic, polar, hydrophilic, charged (+) Thr polar, hydrophilic, neutral Ile aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral Lys polar, hydrophilic, charged(+) Trp aromatic, hydrophobic, neutral Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic
[0050] For example, the amino acids glycine, alanine, valine, leucine, and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids that can often be substituted for one another include phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains), lysine, arginine and histidine (amino acids having basic side chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulphur containing side chains).
[0051] As used herein, a conservative variant refers to alterations in the amino acid sequence that do not adversely affect a biological function or activity of the protein such as a function/activity as described above. For example, conservative variants may retain their ability to be acetylated, the ability to phosphorylate second proteins and the ability to bind DNA. A substitution, insertion, or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function or activity associated with the protein. For example, the overall charge, structure, or hydrophobic/hydrophilic properties of the protein can be altered without adversely affecting a biological activity. Accordingly, the amino acid sequence can be altered, for example to render the polypeptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein.
[0052] Variant polypeptides may have an amino acid sequence having at least about 75% amino acid sequence identity with a naturally occurring mTOR.beta. polypeptide sequence, such as with the entire sequence set forth in SEQ ID NO: 2, more preferably at least about 80%, at least about 90%, at least about 95%, at least about 97%, and most preferably at least about 99% sequence identity. For example, human, mouse and rat TOR share 95% identity on the protein level. Any of these levels of amino acid identity may be present across the full length of the naturally occurring mTOR.beta. polypeptide sequence, or may be present across a subsection of the full length sequence, such as across 50, 100, 150, 200 or more amino acids thereof. Any of these levels of amino acid identity may be present across the full contiguous mTOR.beta. polypeptide sequence. The level of sequence identity may vary in different regions of the mTOR.beta. sequence. For example, a variant mTOR.beta. may have at least 75% amino acid identity across the full length of a naturally occurring mTOR.beta. polypeptide, but may have a higher level of sequence identity within some regions. For example, such a variant polypeptide may retain one or more conserved domains from the naturally occurring sequence.
[0053] Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Fusion proteins, or N-terminal, C-terminal or internal extensions, deletions, or insertions into the polypeptide sequence shall not be construed as affecting homology.
[0054] In connection with amino acid sequences, "sequence identity" refers to sequences which have the stated value when assessed using ClustalW (Thompson et al., 1994, supra) with the following parameters: Pairwise alignment parameters--Method: accurate, Matrix: PAM, Gap open penalty: 10.00, Gap extension penalty: 0.10; Multiple alignment parameters--Matrix: PAM, Gap open penalty: 10.00, % identity for delay: 30, Penalize end gaps: on, Gap separation distance: 0, Negative matrix: no, Gap extension penalty: 0.20, Residue-specific gap penalties: on, Hydrophilic gap penalties: on, Hydrophilic residues: GPSNDQEKR. Sequence identity at a particular residue is intended to include identical residues which have simply been derivatized.
[0055] Preferred "derivatives" or "variants" include those in which instead of the naturally occurring amino acid the amino acid which appears in the sequence is a structural analog thereof. Amino acids used in the sequences may also be derivatized or modified, e.g. labelled, providing the function of the peptide is not significantly adversely affected.
[0056] Derivatives and variants as described above may be prepared during synthesis of the peptide or by post-production modification, or when the peptide is in recombinant form using the known techniques of site-directed mutagenesis, random mutagenesis, or enzymatic cleavage and/or ligation of nucleic acids.
[0057] Deletion and insertion variants of the polypeptides are within the scope of the present invention. Amino acid deletions can be advantageous since the overall length and the molecular weight of a polypeptide can be reduced whilst retaining a desired activity. This can enable the amount of polypeptide required for a particular purpose to be reduced. "Deletion" variants may comprise the deletion of individual amino acids, deletion of small groups of amino acids such as 2, 3, 4 or 5 amino acids, or deletion of larger amino acid regions, such as the deletion of specific amino acid domains or other features. Amino acid insertions relative to a polypeptide can also be made. This may be done to alter the nature of the polypeptide (e.g., to assist in identification, purification or expression). Polypeptides incorporating amino acid changes (whether substitutions, deletions or insertions) relative to the sequence of a polypeptide as defined above can be provided using any suitable techniques. For example, a nucleic acid sequence incorporating a desired sequence change can be provided by site-directed mutagenesis. This can then be used to allow the expression of a polypeptide having a corresponding change in its amino acid sequence.
[0058] The polypeptides of the present invention include naturally occurring mTOR.beta. molecules, such as the polynucleotide having the amino acid sequence disclosed in SEQ ID NO: 2, and amino acid sequence variants of any thereof wherein one or more amino acid residues has been inserted N- or C-terminal to, or within, the disclosed coding sequence. As explained above, the mTOR.beta. polypeptide of SEQ ID NO: 2 is formed by splicing together two fragments from a full length mTOR.alpha. polypeptide. SEQ ID NO: 2 thus comprises amino acids 1 to 23 and 1867-1549 of SEQ ID NO: 4. A variant mTOR.beta. may comprise the equivalent fragments from another mTOR.alpha. polypeptide, such as for another naturally occurring mTOR.alpha. polypeptide. The equivalent amino acids in a related polypeptide may be readily identified by, for example, sequence alignment and comparison. A variant mTOR.beta. may thus be formed by combining an N terminal fragment and a C terminal fragment from a naturally occurring mTOR.alpha. polypeptide. A variant mTOR.beta. polypeptide may also vary in sequence from such N and C terminal fragments. For example, a variant mTOR.beta. polypeptide may have any of the degrees of amino acid sequence identity discussed above when compared to the relevant N and C terminal fragments from any naturally occurring mTOR.alpha. polypeptide.
[0059] A variant mTOR.beta. may comprise different fragments from an mTOR.alpha. polypeptide that can be spliced together to form a polypeptide having mTOR.beta. activity as defined above.
[0060] Using the mTOR.alpha. polypeptide of SEQ ID NO: 4 as an example, the mTOR.beta. polypeptide of the invention may comprise amino acids 1 to 23 of SEQ ID NO: 4, or may comprise more or fewer amino acids from the N-terminal of mTOR.alpha.. A suitable fragment of mTOR.alpha. may start from residue 1 of SEQ ID NO; 4 or may start from a subsequent residue, such as amino acid 2, 3, 4, 5, 6 or a later amino acid. A suitable fragment of mTOR.alpha. may end at residue 23 of SEQ ID NO: 4 or may end at a different residue such as amino acid 18, 19, 20, 21, 22, 24, 25, 26, 27 or 28 or an earlier or later amino acid residue. Any combination of these start and end points may be used to form a suitable fragment. A suitable fragment from the N terminal of mTOR.alpha. may be, for example, 15, 17, 18, 20, 21, 22, 23, 24, 25, 27, 30, 35 or more amino acids in length.
[0061] Similarly, the mTOR.beta. polypeptide may comprise amino acids 1867-2549 of SEQ ID NO: 4, or may comprise more or fewer amino acids from the C-terminal of mTOR.alpha.. A suitable fragment of mTOR.alpha. may start from residue 1867 of SEQ ID NO; 4 or may start from a different residue, such as amino acid 1860, 1861, 1862, 1863, 1864, 1865, 1866, 1868, 1869, 1870, 1871, 1872, 1873 or an earlier or later amino acid. A suitable fragment of mTOR.alpha. may end at residue 2549 of SEQ ID NO: 4 or may end at an earlier residue such as amino acid 2548, 2547, 2546, 2545, 2544 or an earlier amino acid residue. However, it is preferred that the C-terminal fragment of mTOR.alpha. includes the FATC domain located at amino acids 2517 to 2549 of SEQ ID NO: 4. Any combination of these start and end points may be used to form a suitable fragment. A suitable fragment from the C terminal of mTOR.alpha. may be, for example, up to 680, 681, 682, 683, 684, 685, 686, 690, 695, 700 or more amino acids in length.
[0062] The mTOR.beta. polypeptide may comprise any combination of such N-terminal and C-terminal fragments from an mTOR.alpha. polypeptide. Such fragments may be further modified from a naturally occurring sequence by substitution, addition or deletion as described herein.
[0063] As described above, the mTOR.beta. polypeptide will retain at least one function/activity of mTOR.beta., such as at least one function/activity of mTOR.alpha.. As shown in FIG. 5, the mTOR.beta. of SEQ ID NO: 2 retains certain domain from mTOR.alpha., but lacks others. For example, the mTOR.beta. of SEQ ID NO: 2 lacks the regulatory HEAT and FATN domains from mTOR.alpha.. It therefore appears that these domains are unnecessary for the function of mTOR.beta.. The mTOR.beta. polypeptide may therefore lack one, more or all HEAT domains from an mTOR.alpha. polypeptide. The mTOR.beta. may completely lack functional HEAT domains. The mTOR.beta. polypeptide may lack the FATN domain from an mTOR.alpha. polypeptide. The mTOR.beta. polypeptide may lack a functional FAT domain.
[0064] The mTOR.beta. polypeptide of SEQ ID NO:2 does, however, retain other domains from mTOR.alpha.. Amino acids or structural features from these domains may be responsible for the various activities of mTOR.beta.. The mTOR.beta. polypeptide may therefore retain an FRB domain and/or a kinase domain (KD) and/or a regulatory domain and/or an FATC domain. The FRB domain is necessary and sufficient for FKBP12-rapamycin binding. The mTOR.beta. polypeptide may retain an FRB domain. The mTOR.beta. polypeptide may retain an alternative or variant domain that confers FKBP12-rapamycin binding ability. The kinase domain is a P13 kinase-related domain. The mTOR.beta. polypeptide may retain a kinase domain. The mTOR.beta. polypeptide may retain an alternative or variant domain that confers P13 kinase ability. The FATC domain is necessary for mTOR kinase activity and function. The mTOR.beta. polypeptide may retain an FATC domain. The mTOR.beta. polypeptide may retain an alternative or variant domain that confers such mTOR.beta. kinase activity and function. The mTOR.beta. polypeptide may retain two or more of these domains from mTOR.alpha., such as both a kinase domain and an FATC domain. The mTOR.beta. polypeptide may also retain functional binding sites for Raptor and/or Rictor and/or G.beta.L.
[0065] The polypeptides of the invention also include naturally occurring mTOR.beta. molecules such as the polynucleotide having the amino acid sequence disclosed in SEQ ID NO: 2 and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by at least one residue. Such fragments, also referred to as peptides or polypeptides, may contain functional regions of the protein identified as regions of the amino acid sequence which correspond to known protein domains, such as the AT-hook domain, as well as regions of pronounced hydrophilicity. The regions are all easily identifiable by using commonly available protein sequence analysis software such as MacVector (Oxford Molecular).
[0066] Polypeptide "fragments" according to the invention may be made by truncation, e.g. by removal of one or more amino acids from the N and/or C-terminal ends of a polypeptide. Up to 10, up to 20, up to 30, up to 40, up to 50, up to 60, up to 75 or more amino acids may be removed from the N and/or C terminal in this way. Fragments may also be generated by one or more internal deletions.
[0067] A polypeptide of the invention may comprise further additional sequences, for example those encoded by the polynucleotides and vectors described below. The polypeptide may comprise a leader sequence, i.e. a sequence at or near the amino terminus of the polypeptide that functions in targeting or regulation of the polypeptide. For example a sequence may be included in the polypeptide that targets it to particular tissues in the body, or which helps the processing or folding of the polypeptide upon expression. Various such sequences are well known in the art and could be selected by the skilled reader depending upon, for example, the desired properties and production method of the polypeptide.
[0068] A polypeptide may further comprise a tag or label to identify or screen for the polypeptide, or for expression of the polypeptide. Suitable labels include radioisotopes such as .sup.125I, .sup.32P or .sup.35S, fluorescent labels, enzyme labels, or other protein labels such as biotin. Suitable tags may be short amino acid sequences that can be identified by routine screening methods. For example, a short amino acid sequence may be included that is recognised by a particular monoclonal antibody.
[0069] Polypeptides of the invention, as defined herein, may be chemically modified, for example, post-translationally modified. For example they may be glycosylated or comprise modified amino acid residues. They can be in a variety of forms of polypeptide derivatives, including amides and conjugates with polypeptides.
[0070] Chemically modified peptides also include those having one or more residues chemically derivatized by reaction of a functional side group. Such derivatized side groups include those which have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups and formyl groups. Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Peptides may also be modified by phosphorylation, for example 3 amino phosphorylation and by glycosylation for example mannosylation.
[0071] Also included as chemically modified peptides are those which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline may be substituted for proline or homoserine may be substituted for serine.
[0072] Contemplated variants of polypeptides containing and/or derivatives further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR mutagenesis, and the corresponding proteins of other animal species, including but not limited to rabbit, mouse, rat, porcine, bovine, ovine, equine and non-human primate species, and the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example a detectable moiety such as an enzyme or radioisotope).
mTOR Beta Peptide Mimics
[0073] Peptide mimetics may be produced that mimic the three-dimensional structure of mTOR.beta.. Such peptide mimetics may have significant advantages over naturally occurring peptides including, for example, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity and others.
[0074] Such mimetics may have any one or more of the functions or activities of mTOR.beta. discussed above. In one form, mimetics are peptide-containing molecules that mimic elements of mTOR.beta. secondary structure. In another embodiment, the mimetics are capable of binding to cMyc. In an alternate embodiment, the mimetics are able to bind with any one of Raptor, Rictor, and G.beta.L. In yet another embodiment, the mimetics are able to phosphorylate S6K1 and/or 4E-BP1.
[0075] The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, similar to those of antibody and antigen. A peptide mimetic is expected to permit molecular interactions similar to the natural molecule. In another form, peptide analogs are commonly produced in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compounds are also referred to as peptide mimetics or peptidomimetics (Fauchere (1986) Adv. Drug Res. 15, 29-69; Veber & Freidinger (1985) Trends Neurosci. 8, 392-396; Evans et al. (1987) J. Med. Chem. 30, 1229-1239 which are incorporated herein by reference) and are usually developed with the aid of computerized molecular modeling.
[0076] Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect. Generally, peptide mimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a biochemical property or pharmacological activity), but have one or more peptide linkages optionally replaced by a chemical linkage not normally found in peptides by methods known in the art. Labeling of peptide mimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering positions on the peptide mimetic that are predicted by quantitative structure-activity data and molecular modeling. Such non-interfering positions generally are positions that do not form direct contacts with the macromolecules to which the peptide mimetic binds to produce the therapeutic effect. Derivitization (e.g., labeling) of peptide mimetics should not substantially interfere with the desired biological or pharmacological activity of the peptide mimetic.
[0077] The use of peptide mimetics can be enhanced using combinatorial chemistry to create drug libraries. The design of peptide mimetics can be aided by identifying amino acid mutations that increase or decrease binding of a peptide to, for instance, a tumor cell. Approaches that can be used include the yeast two hybrid method (see Chien et al. (1991) Proc. Natl. Acad. Sci. USA 88, 9578-9582) and using the phage display method. The two-hybrid method detects protein-protein interactions in yeast (Fields et al. (1989) Nature 340, 245-246). The phage display method detects the interaction between an immobilized protein and a protein that is expressed on the surface of phages such as lambda and M13 (Amberg et al. (1993) Strategies 6, 2-4; Hogrefe et al. (1993) Gene 128, 119-126). These methods allow positive and negative selection for peptide-protein interactions and the identification of the sequences that determine these interactions.
Nucleic Acid Molecules
[0078] The present invention provides nucleic acid molecules that encode mTOR beta polypeptides.
[0079] As used herein, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides (adenine, guanine, thymine, and/or cytosine) or ribonucleotides, or analogs thereof. Such polynucleotides may be in a single stranded form, or in a double-stranded helix. This term refers only to the primary and secondary structure of the molecule and is not limited to any particular tertiary form. Non-limiting examples of polynucleotides include a gene, a gene fragment, DNA, messenger RNA (mRNA), cDNA, single-stranded RNA or DNA, double-stranded DNA found in linear DNA molecules (e.g., restriction fragments), viruses, chromosomes, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotide sequences such as sequences of double-stranded DNA molecules, may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (e.g., the strand having a sequence homologous to the mRNA).
[0080] A polynucleotide of the invention may be provided in isolated or purified form. As used herein, a nucleic acid molecule is said to be "isolated" when the nucleic acid molecule is substantially separated from contaminant nucleic acid molecules encoding other polypeptides.
[0081] A polynucleotide of the invention may be a polynucleotide (for example an RNA or DNA) that encodes a polypeptide of the invention as defined above. A polynucleotide of the invention may be a polynucleotide that is complementary to a nucleic acid sequence encoding a polypeptide of the invention. A polynucleotide of the invention may be a polynucleotide that hybridizes to a nucleic acid encoding a polypeptide of the invention across the open reading frame under appropriate stringency conditions. A polynucleotide of the invention may be a polynucleotide that encodes a polypeptide that shares at least about 75% or at least about 95% identity with the entire contiguous amino acid sequence of SEQ ID NO: 2. Specifically contemplated are genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbones or including alternative bases whether derived from natural sources or synthesized. Such nucleic acids, however, are defined further as being novel and unobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention.
[0082] A polynucleotide of the invention may be any polynucleotide that encodes a polypeptide as described above. A polynucleotide of the invention may be any polynucleotide that encodes an mTOR.beta. polypeptide. A polynucleotide of the invention may comprise a sequence that encodes the mTOR.beta. polypeptide of SEQ ID NO: 2, a polypeptide comprising or consisting essentially of the mTOR.beta. polypeptide of SEQ ID NO:2, or a variant or fragment of any thereof as described above. A polynucleotide of the invention may comprise, consist essentially or of consist of the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence that varies from SEQ ID NO: 1 only through redundancy in the genetic code, i.e. another nucleic acid sequence that encodes the same polypeptide as SEQ ID NO: 1.
[0083] A nucleic acid "coding sequence" or a nucleic acid sequence which "encodes" a selected polypeptide is a nucleic acid molecule (e.g. DNA or RNA) which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence. For the purposes of the invention, such nucleic acid sequences can include, but are not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA, genomic sequences from viral or prokaryotic DNA or RNA, and even synthetic DNA.
[0084] A polynucleotide of the invention may be a naturally occurring nucleic acid that encodes an mTOR.beta. polypeptide. For example, the polynucleotide of SEQ ID NO: 1 encodes the mTOR.beta. polypeptide of SEQ ID NO: 2. A polynucleotide of the invention may be a variant of such a polypeptide or may encode a variant of a naturally occurring mTOR.beta. polypeptide as described above.
[0085] A polynucleotide of the invention may encode a polypeptide having at least about 75% sequence identity, preferably at least about 80%, at least about 85%, at least about 90%, at least about 95% or more, at least about 97%, or most preferably at least about 99% or more identity with a naturally occurring mTOR.beta. polypeptide, such as with the entire contiguous amino acid sequence of SEQ ID NO: 2. A polynucleotide of the invention may share at least 80%, preferably at least about 85%, at least about 90%, at least about 95% or more, at least about 97% or more, and most preferably 99% sequence identity with a naturally occurring mTOR.beta. polynucleotide sequence, such as with the nucleotide sequence of SEQ ID NO: 1 or other polynucleotides encoding the polypeptide of SEQ ID NO: 2, particularly across the open reading frame.
[0086] Methods of measuring homology or identity are well known in the art and it will be understood by those of skill in the art that in the present context, homology is calculated on the basis of nucleic acid identity. Such homology may exist over a region of at least 15, preferably at least 30, for instance at least 40, 60, 100, 200 or more contiguous nucleotides. Such homology may exist over the entire length of the unmodified mTOR.beta. polynucleotide or polypeptide sequence. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (e.g. used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can also be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10.
[0087] Homology or sequence identity at the nucleotide or amino acid sequence level is preferably determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Altschul et al. (1997) Nucleic Acids Res. 25, 3389-3402 and Karlin et al. (1990) Proc. Natl. Acad. Sci. USA 87, 2264-2268, both fully incorporated by reference) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments, with gaps (non-contiguous) and without gaps (contiguous), between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al. (1994) Nature Genetics 6, 119-129 which is fully incorporated by reference. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter (low complexity) are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al. (1992) Proc. Natl. Acad. Sci. USA 89, 10915-10919, fully incorporated by reference), recommended for query sequences over eighty-five nucleotides or amino acids in length.
[0088] For blastn, the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are +5 and -4, respectively. Four blastn parameters were adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=1 (generates word hits at every wink.sup.th position along the query); and gapw=16 (sets the window width within which gapped alignments are generated). The equivalent Blastp parameter settings were Q=9; R=2; wink=1; and gapw=32. A Bestfit comparison between sequences, available in the GCG package version 10.0, uses DNA parameters GAP=50 (gap creation penalty) and LEN=3 (gap extension penalty) and the equivalent settings in protein comparisons are GAP=8 and LEN=2.
[0089] A variant polynucleotide may differ from a sequence in the relevant polynucleotide by up to 3, up to 5, up to 10, up to 15, up to 20, up to 30, up to 50, up to 100 or more mutations (each of which may be a substitution, deletion or insertion). These mutations may be measured over a region of at least 30, for instance at least 40, 60 or 100 or more contiguous nucleotides of the variant, or across the full length of the variant or the polynucleotide from which it is derived.
[0090] A variant polynucleotide of the invention may hybridize with an mTOR.beta. polynucleotide, such as a naturally occurring mTOR.beta. polynucleotide, such as the polynucleotide of SEQ ID NO: 1, or the complement of any thereof, at a level significantly above background. The signal level generated by the interaction between the variant and the original polynucleotide is typically at least 10 fold, preferably at least 100 fold, as intense as "background hybridisation". The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with .sup.32P. Such a variant may or may not encode a polypeptide of the invention. Preferred molecules are those that hybridize to the complement of SEQ ID NO: 1 and which encode a functional protein, such as an mTOR.beta. polypeptide as defined above. Even more preferred hybridizing molecules are those that hybridize under the above conditions to the complement strand of the open reading frame of SEQ ID NO: 1.
[0091] Such hybridization preferably occurs under stringent conditions. "Stringent conditions" are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at a temperature of at least 50.degree. C., or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer (pH 6.5) with 750 mM NaCl, 75 mM sodium citrate at 42.degree. C. Another example is hybridization in 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulfate at a temperature of at least 42.degree. C., with washes at 42.degree. C. in 0.2.times.SSC and 0.1% SDS. A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal.
[0092] The present invention further provides fragments of the encoding nucleic acid molecule. A polynucleotide of the invention may thus be a fragment of any of the polynucleotides described herein or may encode a fragment polypeptide as described above. As used herein, a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein coding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen to encode an active portion of the protein, the fragment will need to be large enough to encode the functional regions of the protein. If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen to obtain a relatively small number of false positives during probing/priming.
[0093] Polynucleotide "fragments" according to the invention may be made by truncation, e.g. by removal of one or more nucleotides from one or both ends of a polynucleotide. Up to 10, up to 20, up to 30, up to 40, up to 50, up to 75, up to 100, up to 200 or more nucleic acids may be removed from the 3' and/or 5' end of the polynucleotide in this way. Fragments may also be generated by one or more internal deletions.
[0094] Fragments of the nucleic acid molecules of the present invention (i.e., synthetic oligonucleotides) may be used as probes or specific primers for the polymerase chain reaction (PCR), or to synthesize gene sequences encoding proteins of the invention. Such molecules can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci et al. (1981) J. Am. Chem. Soc. 103, 3185-3191 or using automated synthesis methods. In addition, larger DNA segments can readily be prepared by well-known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene. In a preferred embodiment, a nucleic acid molecule of the present invention contains a contiguous open reading frame of at least about 2121 nucleotides.
[0095] A polypeptide of the invention may thus be produced from or delivered in the form of a polynucleotide which encodes, and is capable of expressing, it. Polynucleotides of the invention can be synthesised according to methods well known in the art, as described by way of example in Sambrook et al (1989, Molecular Cloning--a laboratory manual; Cold Spring Harbor Press). That is, polynucleotide sequences coding for the above-described polypeptides can be obtained using recombinant methods, such as by screening cDNA and genomic libraries, or by deriving the coding sequence for a polypeptide from a vector known to include the same. Furthermore, the desired sequences can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. Polynucleotide sequences can also be produced synthetically, rather than cloned.
[0096] The nucleic acid molecules of the present invention may further be modified to contain a detectable label for diagnostic and probe purposes. A variety of such labels is known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides, and the like. A skilled artisan can readily employ any such label to obtain labeled variants of the nucleic acid molecules of the invention. Modifications to the primary structure itself by deletion, addition, or alteration of the amino acids incorporated into the protein sequence during translation can be made without destroying the activity of the protein. Such substitutions or other alterations result in proteins having an amino acid sequence encoded by a nucleic acid falling within the contemplated scope of the present invention.
Vectors and Host Cells
[0097] The polynucleotides of the invention may be provided in a vector, such as an expression vector. The polypeptides, polynucleotides and vectors of the invention may be provided in a host cell.
[0098] The present invention further provides recombinant DNA molecules (rDNA) that contain a coding sequence. As used herein, an rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al. (2001), Molecular Cloning--A Laboratory Manual, Cold Spring Harbor Laboratory Press. In the preferred rDNA molecules, a coding DNA sequence is operably linked to expression control sequences and/or vector sequences. In one embodiment of the invention, the coding sequence contains SEQ ID NO: 1 or fragment thereof. In an alternate embodiment, the coding sequence encodes the polypeptide of SEQ ID NO: 2 or fragment thereof.
[0099] The nucleic acid molecules of the present invention may be provided in the form of an expression cassette which includes control sequences operably linked to the inserted sequence, thus allowing for expression of the polypeptide of the invention in vivo in a targeted subject species. These expression cassettes, in turn, are typically provided within vectors. A suitable vector may be any vector which is capable of carrying a sufficient amount of genetic information, and allowing expression of a polypeptide of the invention.
[0100] Vectors may be used to simplify manipulation of the nucleic acids of the invention, either for preparation of large quantities of nucleic acids for further processing (cloning vectors) or for expression of the polypeptides (expression vectors). Such proteins include mTOR.beta., proteins comprising one or more mutations at any amino acid residue of SEQ ID NO: 2 and derivative polypeptides, thereof. Vectors comprise plasmids, viruses (including phage), and integrated DNA fragments (i.e., fragments that are integrated into the host genome by recombination).
[0101] Once a coding sequence for an mTOR.beta. polypeptide of the invention has been prepared or isolated, it can be cloned into any suitable vector and thereby maintained in a composition of cells, which is substantially free of cells that do not contain any mTOR.beta. coding sequence. As described herein, numerous cloning vectors are known to those of skill in the art. Cloning vectors need not contain expression control sequences.
[0102] The present invention also includes expression vectors that comprise polynucleotide sequences or rDNA molecules of the invention. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for expression of a peptide of the invention. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al. Thus, a polypeptide of the invention may be provided by delivering such a vector to a cell and allowing transcription from the vector to occur. Preferably, a polynucleotide of the invention or for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
[0103] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given regulatory sequence, such as a promoter, operably linked to a nucleic acid sequence is capable of effecting the expression of that sequence when the proper enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the nucleic acid sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0104] The choice of vector and/or expression control sequences to which one of the protein family encoding sequences of the present invention is operably linked depends directly, as is well known in the art, on the functional properties desired, e.g., protein expression, and the host cell to be transformed. A vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably, also expression, of the polynucleotide of the invention e.g. of a structural gene included in the rDNA molecule.
[0105] Expression control elements that are used for regulating the expression of an operably linked protein encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements. Preferably, the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's medium.
[0106] In one embodiment, the vector containing a coding nucleic acid molecule will include a prokaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith. Such replicons are well known in the art. In addition, vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as a drug resistance. Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
[0107] Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli. A promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment of the present invention. Typical of such vector plasmids are pUC8, pUC9, pBR322 and pBR329 (BioRad), pPL and pKK223 (Pharmacia).
[0108] Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can also be used to form vector or rDNA molecules that contain a coding sequence. Eukaryotic cell expression vectors, including viral vectors, are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment. Typical of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d (International Biotechnologies, Inc.), pTDT1 (ATCC), the vector pCDM8 described herein, and the like eukaryotic expression vectors.
[0109] An exemplary eukaryotic expression system is that employing vaccinia virus, which is well-known in the art (see, for example, WO 86/07593). Yeast expression vectors are known in the art (see, for example, U.S. Pat. Nos. 4,446,235 and 4,430,428). Another expression system is vector pHSI, which transforms Chinese hamster ovary cells (see WO 87/02062). Mammalian tissue may be co-transformed with DNA encoding a selectable marker such as dihydrofolate reductase (DHFR) or thymidine kinase and DNA encoding mTOR.beta. or derivative. If wild type DHFR gene is employed, it is preferable to select a host cell, which is deficient in DHFR, thus permitting the use of the DHFR coding sequence as marker for successful transfection in hgt medium, which lacks hypoxanthine, glycine, and thymidine.
[0110] Eukaryotic cell expression vectors used as vectors of the invention or used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in a eukaryotic cell, preferably a drug resistance selection marker. A preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene. (Southern et al. (1982) J. Mol. Anal. Genet. 1, 327-341). Alternatively, the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
[0111] Control sequences in an expression vector may include transcriptional and translational control sequences such as a transcriptional promoter, a sequence encoding suitable ribosome binding sites, and sequences, which control termination of transcription and translation. In one embodiment, the expression vector may include a selection gene to facilitate the stable expression of the mTOR.beta. gene and/or to identify transformed cells. However, the selection gene for maintaining expression can be supplied by a separate vector in co-transformation systems using eukaryotic host cells.
[0112] Suitable vectors generally will contain a replicon (origins of replication, for use in non-integrative vectors) and control sequences, which are derived from species compatible with the intended expression host. By the term "replicable" vector as used herein, it is intended to encompass vectors containing such replicons as well as vectors, which are replicated by integration into the host genome.
[0113] Expression vectors for host cells ordinarily include an origin of replication, a promoter located upstream from the mTOR beta polypeptide coding sequence, together with a ribosome binding site, a polyadenylation site, and a transcriptional termination sequence. An expression vector may comprise transcriptional and translational control sequences. These are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. Those of ordinary skill will appreciate that certain of these sequences are not required for expression in certain hosts. An expression vector for use with microbes need only contain an origin of replication recognized by the host, a promoter that will function in the host, and a selection gene.
[0114] As used herein, a "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded (inclusively) at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes.
[0115] Commonly used promoters are derived from polyoma, bovine papilloma virus, CMV (cytomegalovirus, either murine or human), Rouse sarcoma virus, adenovirus, and simian virus 40 (SV40). Other control sequences (e.g., terminator, polyA, enhancer, or amplification sequences) can also be used.
[0116] An expression vector is constructed so that the mTOR.beta. or derivative polypeptide coding sequence is located in the vector with the appropriate regulatory sequences. The positioning and orientation of the coding sequence with respect to the control sequences is such that the coding sequence is transcribed and translated under the "control" of the control sequences i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence into mRNA. The control sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors previously described. Alternatively, the coding sequence can be cloned directly into an expression vector, which already contains the control sequences and an appropriate restriction site. If the selected host cell is a mammalian cell, the control sequences can be heterologous or homologous to the mTOR.beta. or derivative polypeptide coding sequence and the coding sequence can be either genomic DNA containing introns or cDNA.
[0117] A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide that directs the polypeptide to the cell surface or instructs the host cell to secrete the polypeptide to the extracellular space. This signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes. For instance, alpha-factor, a native yeast protein, is secreted from yeast, and its signal sequence can be attached to heterologous proteins to be secreted into the media (see U.S. Pat. No. 4,546,082). Further, the alpha-factor and its analogs have been found to secrete heterologous proteins from a variety of yeast, such as Saccharomyces and Kluyveromyces (see e.g., EP 88312306.9, EP 0324274, and EP 0301669). An example for use in mammalian cells is the tPA signal used for expressing Factor VIIIc light chain.
[0118] A "heterologous" region of the nucleic acid construct is an identifiable segment of a nucleic acid within a larger nucleic acid molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns or synthetic sequences having codons different from the native gene).
[0119] The vectors and expression cassettes of the present invention may be administered directly as "a naked nucleic acid construct", preferably further comprising flanking sequences homologous to the host cell genome. As used herein, the term "naked DNA" refers to a vector such as a plasmid comprising a polynucleotide of the present invention together with a short promoter region to control its production. It is called "naked" DNA because the vectors are not carried in any delivery vehicle. When such a vector enters a host cell, such as a eukaryotic cell, the proteins it encodes are transcribed and translated within the cell.
[0120] The vector of the invention may thus be a plasmid vector, that is, an autonomously replicating, extrachromosomal circular or linear DNA molecule. Alternatively, the vectors of the present invention may be introduced into suitable host cells using a variety of viral techniques which are known in the art, such as for example infection with recombinant viral vectors such as retroviruses, herpes simplex viruses and adenoviruses. As an alternative to viral vectors, liposomal preparations can alternatively be used to deliver the nucleic acid molecules of the invention or the nucleic acid molecules of the present invention may be encapsulated, adsorbed to, or associated with, particulate carriers.
[0121] The present invention further provides cells that have been modified to express a polypeptide of the invention, such as host cells transformed with a nucleic acid molecule that encodes a polypeptide of the present invention. The host cell can be either prokaryotic or eukaryotic. Eukaryotic cells useful for expression of a protein of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product. Such cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, and lower eukaryotic cells, such as yeast cells. Preferred eukaryotic host cells include, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey, or human cell line. Preferred eukaryotic host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NIH Swiss mouse embryo cells (NIH-3T3) available from the ATCC as CRL 1658, baby hamster kidney cells (BHK), and the like eukaryotic tissue culture cell lines. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation and cell surface expression of a polypeptide. Expression may be achieved in transformed oocytes. A suitable peptide may be expressed in cells of a transgenic non-human animal, preferably a mouse. A transgenic non-human animal expressing a peptide of the invention is included within the scope of the invention. A peptide of the invention may also be expressed in Xenopus laevis oocytes or melanophores.
[0122] Any prokaryotic host can be used to express a polynucleotide, vector or rDNA molecule encoding a polypeptide of the invention. In one embodiment, the preferred prokaryotic host is E. coli.
[0123] Transformation of appropriate cell hosts with a polynucleotide, vector or rDNA molecule of the present invention is accomplished by well-known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed, see, for example, Cohen et al. (1972) Proc. Natl. Acad. Sci. USA 69, 2110; and Sambrook et al. (1989) Molecular Cloning--A Laboratory Manual, Cold Spring Harbor Laboratory Press. With regard to transformation of vertebrate cells with vectors containing rDNAs, electroporation, cationic lipid, or salt treatment methods are typically employed, see, for example, Graham et al. (1973) Virol. 52, 456; Wigler et al. (1979) Proc. Natl. Acad. Sci. USA 76, 1373-1376.
[0124] Successfully transformed cells, i.e., cells that contain a polynucleotide, vector or rDNA molecule of the present invention, can be identified by well-known techniques including the selection for a selectable marker. For example, cells resulting from the introduction of an rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern ((1975) J. Mol. Biol. 98, 503-504) or Berent et al. ((1985) Biotech. 3, 208-209) or the proteins produced from the cell assayed via an immunological method.
[0125] Such cell lines of the invention may be cultured using routine methods to produce a polypeptide of the invention, or may be used therapeutically or prophylactically to deliver polypeptides of the invention to a subject. For example, cell lines capable of secreting a polypeptide of the invention may be administered to a subject. Alternatively, polynucleotides, expression cassettes or vectors of the invention may be administered to a cell from a subject ex vivo and the cell then returned to the body of the subject. For example, methods for the ex vivo delivery and reimplantation of transformed cells into a subject are known (e.g., dextran-mediated transfection, calcium phosphate precipitation, electroporation, and direct microinjection into nuclei).
[0126] Depending on the expression system and host selected, the peptide of interest, such as mTOR.beta. or a variant or derivative thereof, may be produced by growing host cells transformed by an exogenous or heterologous DNA construct, such as an expression vector described above under conditions whereby the polypeptide is expressed. The peptide of interest, such as mTOR.beta. or derivative polypeptides thereof, is then isolated from the host cells and purified. If the expression system secretes the protein or peptide into the growth media, the protein can be purified directly from cell-free media. The selection of the appropriate growth conditions and initial crude recovery methods are within the skill of the art.
[0127] Transformed host cells are cells which have been transformed or transfected either with vectors containing mTOR.beta. or mTOR.beta. derivative polypeptide encoding nucleic acid. The expressed polypeptides may be secreted into the culture supernatant, under the control of suitable processing signals in the expressed peptide (e.g., homologous or heterologous signal sequences).
[0128] A cell has been "transformed" by an exogenous or heterologous nucleic acid when such nucleic acid as been introduced inside the cell. The transforming nucleic acid may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, for example, the transforming nucleic acid may be maintained on an episomal element such as a plasmid or viral vector. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming nucleic acid.
[0129] As used herein, a "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations. As used herein, nucleic acid sequences display "substantial identity" when at least about 85 percent (preferably at least about 90 percent, more preferably at least about 95, more preferably at least about 97 and most preferably at least about 99 percent) of the nucleotides match over the defined length of the nucleotide sequences. Sequences that are substantially identical can be identified in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art.
[0130] Higher eukaryotic cell cultures may be used to express the proteins of the present invention, whether from vertebrate or invertebrate cells, including insects, and the procedures of propagation thereof are known.
Production of Recombinant Proteins Using an rDNA Molecule
[0131] The present invention further provides methods for producing a protein of the invention using nucleic acid molecules herein described. In general terms, the production of a recombinant form of a protein typically involves the following steps. First, a nucleic acid molecule is obtained that encodes a protein of the invention, such as a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid sequence encoding an amino acid of SEQ ID NO: 2 or derivatives thereof. Second, the nucleic acid molecule is then preferably placed in operable linkage with suitable control sequences, as described above, to form an expression unit containing the protein open reading frame.
[0132] The expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant protein. Optionally the recombinant protein is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances where some impurities may be tolerated.
[0133] Each of the foregoing steps can be done in a variety of ways. For example, the desired coding sequences may be obtained from genomic fragments and used directly in appropriate hosts. The construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth above. The control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail earlier. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence to provide an excisable gene to insert into these vectors. A skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant protein.
Antibodies
[0134] Another class of agents of the present invention are antibodies immunoreactive with mTOR beta (mTOR.beta.). In a preferred embodiment, the antibodies are immunoreactive with mTOR beta (mTOR.beta.) but not with mTOR alpha. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies. The antibodies may be polyclonal or monoclonal.
[0135] Antibodies which bind to the active sites of mTOR beta are encompassed in the invention. In one embodiment of the invention, the antibody binds to the active site of mTOR beta that phosphorylates 4E-BP1. In another embodiment of the invention, the antibody binds to the active site of mTOR beta that phosphorylates S6K1. In an alternate embodiment, the antibody binds to the site in mTOR beta that leads to the induction of cMyc expression.
[0136] Antibodies capable of inhibiting the activity of this protein are also encompassed in the invention.
[0137] Antibodies are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides, or proteins of the invention, such as mTOR beta (mTOR.beta.), variants and isolated binding partners, if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents well known in the art, may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or the carboxy terminus with a cysteine residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
[0138] Anti-peptide antibodies can be generated using synthetic peptides corresponding to, for example, the carboxy terminal 15 amino acids of mTOR beta (mTOR.beta.). Antibodies which bind to the phosphorylation site on a kinase can also be generated and include antibodies which bind to the phosphorylation site on the mTOR beta (mTOR.beta.) protein. Synthetic peptides can be as small as 1 to 3 amino acids in length, but are preferably at least 4 or more amino acid residues long. The peptides are coupled to KLH using standard methods and can be immunized into animals such as rabbits. Polyclonal anti-mTOR beta (mTOR.beta.) antibodies can then be purified, for example by using Actigel beads containing the covalently bound peptide.
[0139] While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines, which secrete the desired monoclonal antibodies, may be prepared using the standard method of Kohler and Milstein or modifications, which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten. polypeptide or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid. Of particular interest, are monoclonal antibodies that recognize the FK506/Rapamycin domain, the kinase domain, or the regulatory domain.
[0140] The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera that contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as Fav, .sub.SCFV, Fab, Fab' or F(ab').sub.2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
[0141] Antigen binding fragments such as F(ab)2, Fab and Fv fragments may be used, i.e. antibody fragments from the "variable" regions of an antibody that comprise the antigen binding site. Antibodies may be human, humanized, or chimeric variants of the foregoing. Such antibodies can be less immunogenic when administered to a subject. Methods of producing humanized or chimeric antibodies are well known in the art. The antibodies contemplated also include different isotypes and isotype subclasses (e.g., IgG.sub.1, IgG.sub.2, and IgM). These antibodies can be prepared by raising them in vertebrates, in hybridoma cell lines or other cell lines, or by recombinant means. For references on how to prepare these antibodies, see Harlow & Lane (1988), Antibodies: A Laboratory Manual, Cold Spring Harbor Press.
[0142] The antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of receptor can also be produced in the context of chimeras with multiple species origin.
Methods of Treatment
[0143] This invention also relates to methods for the treatment of a disease associated with aberrant expression of mTOR beta, comprising administration of an effective amount of an agent, to a subject in need thereof, capable of modulating the activity and/or expression of mTOR beta. Such an agent may therefore be used in the treatment (which may be therapeutic and/or prophylactic), diagnosis or prevention of such a disease. The aberrant expression may be, for example, increased expression of mTOR beta or decreased expression of mTOR beta. A suitable agent may be selected depending upon whether the level of mTOR beta is to be supplemented or reduced.
[0144] In one embodiment, the agent is an inhibitor of mTOR beta. Such an inhibitor may act to reduce the amount of mTOR beta that is present, for example by inhibitor or preventing mTOR beta gene expression or protein production or by acting to remove or break down mTOR beta mRNA or protein. Such an inhibitor may act to reduce the activity of mTOR beta, for example any activity or function of mTOR beta as discussed above. A suitable inhibitor may be a molecule that binds to mTOR beta and prevents its function. For example, a suitable inhibitor may be an antibody that binds to mTOR beta. In another embodiment, the agent is an mTOR beta antagonist.
[0145] In another embodiment, the agent is a promoter or activator of mTOR beta. Such an agent may act to increase the amount of mTOR beta protein that is present. For example, the agent may be a polynucleotide, vector, rDNA, polypeptide or host cell as described herein. The agent may act to increase the life span of an mTOR beta mRNA or polypeptide, for example by increasing the resistance of the mRNA or polypeptide to degradation processes within the cell or organism. Such an agent may act to increase the activity or function of mTOR beta, for example any activity or function of mTOR beta as discussed above.
[0146] An effective amount of capable of modulating the activity and/or expression of mTOR beta may be an amount which exerts a suitable effect as described herein. For example, a suitable amount of an mTOR beta inhibitor may be that which is sufficient to exert an inhibitory effect on the activity of mTOR beta. An effective amount may also be an amount that is effective to inhibit the proliferation of cells exhibiting aberrant mTOR beta expression.
[0147] In some embodiments of this method, the disease associated with aberrant expression of mTOR beta is cancer, including, but not limited to, prostate cancer, breast cancer, multiple myeloma, lung cancer, non-small cell lung carcinoma, bone cancer, liver cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia, lymphocytic lymphomas, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, pituitary adenoma, or a combination of one or more of the foregoing cancers. In another embodiment of said method, said abnormal cell growth is a benign proliferative disease, including, but not limited to, psoriasis, benign prostatic hyperplasia, hypertrophy, or restinosis.
[0148] In one embodiment of the invention, the agent is a kinase inhibitor. Exemplary types of kinase inhibitors which can be used in the methods of the invention include, but are not limited to, rapamycin, rapamycin derivatives such as e.g. RAD001 (Lane (2003) Mol. Targets Cancer Therapeut. 259-260), CCI-779 and AP23573.
[0149] In practicing the methods of this invention, these agents may be used alone or in combination with other active or inactive ingredients. The methods of the invention therefore include administration of a polypeptide comprising these agents linked to a cytotoxic agent for the treatment of a disease associated with abnormal cell growth, including cancer. Examples of cytotoxic agents include, but are not limited to, gelonin, ricin, saponin, pseudonomas exotoxin, pokeweed antiviral protein, diphtheria toxin, complement proteins, or any other agent known in the art that is capable of killing a cell upon contact with that cell.
[0150] The present invention also extends to compositions, such as pharmaceutical compositions comprising molecules and agents as described herein. Formulation of a composition comprising a molecule of the invention, such as a polynucleotide, expression cassette, vector, polypeptide, cell or antibody as described above, can be carried out using standard pharmaceutical formulation chemistries and methodologies all of which are readily available to the reasonably skilled artisan. For example, compositions containing one or more molecules of the invention can be combined with one or more pharmaceutically acceptable excipients or vehicles. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like, may be present in the excipient or vehicle. These excipients, vehicles and auxiliary substances are generally pharmaceutical agents that do not induce an immune response in the individual receiving the composition, and which may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients, vehicles and auxiliary substances is available in Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991).
[0151] The present invention thus further provides compositions comprising a molecule as described herein such as a polypeptide of the invention, e.g., mTOR beta or a variant or derivative thereof, and a diluent. Suitable diluents can be aqueous or non-aqueous solvents or a combination thereof, and can comprise additional components, for example water-soluble salts or glycerol, that contribute to the stability, solubility, activity, and/or storage of the protein or polypeptide.
[0152] The pharmaceutical composition may also comprise, consist of, or consist essentially of one or more agents capable of modulating the activity and/or expression of mTOR beta and a pharmaceutically acceptable carrier. Such a composition may comprise an agent to be administered as part of a therapeutic method of the invention as described above. The pharmaceutical compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations that can be used pharmaceutically for delivery to the site of action. Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate, or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension. Examples of such viscosity increasing substances include are sodium carboxymethyl cellulose, sorbitol and dextran. Optionally, the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
[0153] Pharmaceutical compositions of the invention, such as those comprising one or more agents capable modulating the activity and/or expression of mTOR beta, can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intracranial or transdermal or buccal routes. For example, an agent may be administered locally to a tumor or the site of aberrant mTOR beta expression via microinfusion. Alternatively, or concurrently, administration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
[0154] While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Dosages of an agent capable of modulating the activity and/or expression of mTOR beta of the present invention typically comprise about 1.0 ng/kg body weight to about 0.13 mg/kg body weight. In one embodiment, dosages of an agent capable of modulating the activity and/or expression of mTOR beta comprise about 1.0 ng/kg body weight to about 0.1 mg/kg body weight. In a preferred embodiment, dosages for systemic administration comprise about 0.01 .mu.g/kg body weight to about 0.1 mg/kg body weight. In another embodiment, the dosage of an agent capable of modulating the activity and/or expression of mTOR beta comprises less than about 0.1 mg/kg body weight. More preferred dosages for systemic administration comprise about 0.1 .mu.g/kg body weight to about 0.05 mg/kg body weight. In another preferred embodiment, the dosage of an agent capable of modulating the activity and/or expression of mTOR beta comprises less than about 0.05 mg/kg body weight. The most preferred dosages for systemic administration comprise between about 1.0 .mu.g/kg body weight to about 0.01 mg/kg body weight. In other embodiments, the amount of an agent capable of modulating the activity and/or expression of mTOR beta administered is an amount effective to bring the concentration of an agent capable of modulating the activity and/or expression of mTOR beta in the serum to a concentration of about 20.0, 10.0, 5.0, 2.50, 1.25, 0.625, 0.3125, 0.156, 0.078, 0.039, 0.020, 0.010, 0.005, 0.003, 0.0015, 0.0008, 0.0003, or 0.0001 nM. The preferred dosages for direct administration to a site via micro-infusion comprise 1 ng/kg body weight to 1 mg/kg body weight.
[0155] The pharmaceutical formulation for systemic administration according to the invention may be formulated for enteral, parenteral, or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.
[0156] As mentioned above for some methods of the invention, topical administration may be used. Any common topical formulation such as a solution, suspension, gel, ointment or salve and the like may be employed. Preparation of such topical formulations are described in the art of pharmaceutical formulations as exemplified, for example, by Gennaro et al. (2000) Remington's Pharmaceutical Sciences, Mack Publishing. For topical application, the compositions could also be administered as a powder or spray, particularly in aerosol form. In some embodiments, the compositions of this invention may be administered by inhalation. For inhalation therapy, the active ingredients may be in a solution useful for administration by metered dose inhalers or in a form suitable for a dry powder inhaler. In another embodiment, the compositions are suitable for administration by bronchial lavage.
[0157] Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.
[0158] The compositions and methods of the invention for therapeutic purposes can be utilized in vivo, ordinarily in mammals, such as e.g., humans, sheep, horses, cattle, pigs, dogs, cats, rats, and mice or ex vivo. The invention is particularly useful in the treatment of human subjects.
Methods to Identify Agents that Modulate Expression and/or Activity of mTOR Beta
[0159] The present invention also provides for methods identifying (i.e., screening) for an agent that modulates mTOR beta expression and/or activity. In one embodiment of the invention, the agent modulates mTOR beta expression. In another embodiment, the agent modulates mTOR beta activity. A decrease of mTOR expression and/or activity is indicative of an agent that inhibits mTOR beta. An increase of mTOR expression and/or activity is indicative of an agent that stimulates mTOR beta.
[0160] Another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a mTOR beta (mTOR.beta.) protein, such as a protein having the amino acid sequence of SEQ ID NO: 2. Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention. As used herein, an agent is said to modulate the expression of a nucleic acid of the invention, for instance a nucleic acid encoding the protein having the sequence of SEQ ID NO: 2 or a nucleic acid having SEQ ID NO: 1, if it is capable of up- or down-regulating expression of the nucleic acid in a cell.
[0161] The invention thus provides methods for the screening or identification of agents that modulate the activity and/or expression of mTOR beta.
[0162] A method of the invention may comprise the following steps:
(a) providing a polypeptide of the invention (such as a polypeptide of the invention or a polypeptide encoded by a polynucleotide of the invention); (b) contacting said polypeptide with a test agent; and (c) detecting any change in the activity of said polypeptide, wherein a change in activity is indicative of an agent capable of modulating mTOR beta activity.
[0163] Equivalent methods may also be carried out using a polynucleotide of the invention, for example to identify an agent capable of modulating gene expression, or an agent capable of modulating the level of, or transcriptions of, mTOR beta mRNA.
[0164] A method of the invention may be carried out in vitro or in vivo. A method of the invention may be carried out using an isolated (or substantially isolated) or purified (or substantially purified) polypeptide.
[0165] Alternatively a method may be carried out in a cell that comprises the polypeptide. For example, such a method may comprise the following steps:
(a) providing a host cell of the invention, such as a host cell that comprises or expresses a polypeptide of the invention (such as a polypeptide of the invention or a polypeptide encoded by a polynucleotide of the invention); (b) contacting said host cell with a test agent; and (c) detecting any change in the expression and/or activity of said polypeptide, wherein a change in expression and/or activity is indicative of an agent capable of modulating mTOR beta expression and/or activity.
[0166] A particular method may comprise the following steps:
(a) exposing a cell expressing a polypeptide of the invention to the agent; and (b) detecting the change in expression and/or activity of said polypeptide, wherein a change in expression and/or activity is indicative of an agent capable of modulating mTOR beta expression and/or activity.
[0167] In one assay format, cell lines that contain reporter gene fusions between the open reading frame of the mTOR beta (e.g. SEQ ID NO: 1) and any assayable fusion partner may be prepared. Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al., 1990 Anal. Biochem. 188, 245-254). Cell lines containing the reporter gene fusions are then exposed to the agent or a control to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents, which modulate the expression of a nucleic acid encoding the mTOR beta.
[0168] In another assay format, the ability of an agent to modulate mTOR beta expression is based on measuring the expression of proteins such as e.g., c-Myc whose expression is modulated as a result of modulation of mTOR beta expression.
[0169] Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention such as mTOR beta. For instance, mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention. Cell lines are exposed to the agent and/or a polypeptide comprising a mTOR beta to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al. (2001) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.
[0170] Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe: target hybrid and potential probe:non-target hybrids.
[0171] Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al. (2001) or Ausubel et al. (1995) Current Protocols in Molecular Biology, Greene Publishing Company).
[0172] Hybridization conditions are modified using known methods, such as those described by Sambrook et al. (2001) and Ausubel et al. (1995) as required for each probe. Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format. For instance, total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize. Alternatively, nucleic acid fragments comprising at least one, or part of one of the sequences of the invention can be affixed to a solid support, such as a porous glass wafer. The glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize. Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755). By examining for the ability of a given probe to specifically hybridize to an RNA sample from an untreated cell population and from a cell population exposed to the agent, agents which up or down regulate the expression of a nucleic acid encoding the mTOR beta protein.
[0173] The present invention also provides methods for identifying agents that modulate at least one activity of an mTOR beta polypeptide such as the polypeptide of SEQ ID NO: 2. Such methods or assays may utilize any means of monitoring or detecting the desired activity. These assays may include detection of phosphorylation of mTOR beta, detection of phosphorylation of S6K1, detection of phosphorylation of 4E-BP1, monitoring induction of cMyc expression or monitoring for the ability of S6K1 and/or 4E-BP1 to phosphorylate a second protein. In one embodiment of the invention, the activity of mTOR beta is detected based on detecting phosphorylation of PKB/Akt.
[0174] In one format, the specific activity of a protein of the invention, normalized to a standard unit, between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed. Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time. Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
[0175] Antibody probes can be prepared by immunizing suitable mammalian hosts utilizing appropriate immunization protocols using the proteins of the invention or antigen-containing fragments thereof. To enhance immunogenicity, these proteins or fragments can be conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as BSA, KLH or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances, linking reagents such as those supplied by Pierce Chemical Co. may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or the carboxy terminus with a cysteine residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
[0176] While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using standard methods, see e.g., Kohler & Milstein (1992) Biotechnology 24, 524-526 or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies can be screened by immunoassay in which the antigen is the peptide hapten, polypeptide, or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid.
[0177] The desired monoclonal antibodies may be recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonal antibodies or the polyclonal antisera that contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as Fab or Fab' fragments, is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
[0178] The antibodies or fragments may also be produced, using current technology, by recombinant means. Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin. Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin, for instance, humanized antibodies. The antibody can therefore be a humanized antibody or human antibody, as described in U.S. Pat. No. 5,585,089 or Riechmann et al. (1988) Nature 332, 323-327.
[0179] Agents that are assayed in the above method can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc. An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
[0180] As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a non-random basis which takes into account the sequence of the target site or its conformation in connection with the agent's action. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites. For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to or a derivative of any functional consensus site.
[0181] The agents of the present invention can be, as examples, peptides, peptide mimetics, antibodies, antibody fragments, small molecules, vitamin derivatives, as well as carbohydrates. Peptide agents of the invention can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art. In addition, the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.
Methods to Identify Binding Partners
[0182] Another embodiment of the present invention provides methods for use in isolating and identifying binding partners of mTOR beta or derivative. In general, a protein of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention. After mixing, peptides, polypeptides, proteins or other molecules that have become associated with a protein of the invention are separated from the mixture. The binding partner, which bound to the protein of the invention, can then be removed and further analyzed. To identify and isolate a binding partner, the entire protein, for instance a protein comprising the entire amino acid sequence of SEQ ID NO: 2 or a protein encoded by a nucleotide of SEQ ID NO: 1, can be used. Alternatively, a fragment of the protein can be used.
[0183] As used herein, a cellular extract refers to a preparation or fraction that is made from a lysed or disrupted cell. The preferred source of cellular extracts will be cells derived from human skin tissue or the human respiratory tract or cells derived from a biopsy sample of human lung tissue in patients with allergic hypersensitivity. Alternatively, cellular extracts may be prepared from normal tissue or available cell lines, particularly granulocytic cell lines.
[0184] A variety of methods can be used to obtain an extract of a cell. Cells can be disrupted using either physical or chemical disruption methods. Examples of physical disruption methods include, but are not limited to, sonication and mechanical shearing. Examples of chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis. A skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
[0185] Once an extract of a cell is prepared, the extract is mixed with the protein of the invention under conditions in which association of the protein with the binding partner can occur. A variety of conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a human cell. Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the protein with the binding partner.
[0186] After mixing under appropriate conditions, the bound complex is separated from the mixture. A variety of techniques can be utilized to separate the mixture. For example, antibodies specific to a protein of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
[0187] After removal of non-associated cellular constituents found in the extract, the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture. To aid in separating associated binding partner pairs from the mixed extract, the protein of the invention can be immobilized on a solid support. For example, the protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract. The identified binding partners can be either a single protein or a complex made up of two or more proteins. Alternatively, binding partners may be identified using a Far-Western assay according to the procedures of Takayama et al. (1997) Methods Mol. Biol. 69, 171-184 or Sauder et al. (1996) J. Gen. Virol. 77, 991-996 or identified using epitope tagged proteins or GST fusion proteins.
[0188] Alternatively, the nucleic acid molecules of the invention can be used in a yeast two-hybrid system. The yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
[0189] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the agents of the present invention (e.g., nucleic acids and polypeptides) and practice the claimed methods. The following working examples describe embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
EXAMPLES
Example 1: Western Blot Analysis of Rat Tissues with the C-Terminal of mTOR Antibody
[0190] In contrast to yeasts, which have two TOR genes, mammals possess only one gene, known to encode a single polypeptide with molecular weight of approximately 280 kDa. To further elucidate the regulation and downstream signaling of mTOR, a monoclonal antibody (F11) was developed. This antibody (F11) recognizes specifically mTOR in Western blotting, immunoprecipitation and immunofluorescence (data not shown). The fragment of mTOR (350 amino acids in length), corresponding to the HEAT domains, was expressed in bacteria as a GST-fusion protein and used for immunization and screening for specific hybridoma clones. When this generated antibody was used to analyze in Western blotting the total cell lysates from rat tissues and various cell lines, predominantly one immunoreactive band of approximately 280 kDa was observed (see FIG. 1, lower panel). However, when a commercially available mTOR antibody (Cell Signalling) generated against the C-terminal peptide was used, several strong immunoreactive bands were detected (FIG. 1, upper panel). In addition to a 280-kDa band, which is highly abundant in rat brain, there were two strong immunoreactive bands of approximately 80 kDa and 95 kDa. The 80-kDa band is highly expressed in liver, blood, kidney, small, and large intestine, while lung, stomach, spleen, testis, and fat have medium/low level of expression. Interestingly, the 95-kDa band seems to be organ specific as it is only detected at a very high level in liver (see FIG. 1, upper panel). Furthermore, liver and blood possess a relatively weak but distinctive band of approximately 135 kDa. Re-probing of the membrane with anti-actin antibody served as a protein loading control. The detection of mTOR immunoreactive bands with lower molecular weights could be explained by the existence of mTOR splicing forms or by proteolytic degradation of a full-length protein.
Experimental Procedures for Plasmid Construction, siRNA and Expression Studies
[0191] For expression in mammalian cells, the full-length cDNA for mTOR.beta. was cloned into the tagged eukaryotic expression vector pcDNA3.1/FLAG (Invitrogen). Kinase inactive point mutant of mTOR.beta. with the substitution of Asp 514 to Glu (analog of Asp 2357 to Glu in TOR.alpha.) was generated with the use of a site-directed mutagenesis kit (Stratagene) according to manufacturer's recommendations. Transient transfections of cells were carried out with the use of ExGene 500 reagent (Fermentas), under conditions recommended by the manufacturer. The mTOR siRNA was obtained from MWG Biotech (21 nucleotide in length, corresponding to the 2241-2261 region of human mTOR (Kim et al. 2002)). siRNA was transfected into Hek293 cells using Lipofectamine 2000 (Invitrogen) as recommended by manufacturer. The C-terminal region of S6K1 (His-S6K1C, amino acids 332-502) was cloned into pET24a plasmid (Novagene) in-frame with the 6His-tag sequence. The expression and affinity purification of His-S6K1C was carried out in BL21 DE3 cells using NTA-agarose (Qiagene), respectively. pCMV FLAG mTOR.alpha. plasmid was kindly provided by Prof. K. Yonezawa, Kobe, Japan.
Reagents, Antibodies, and Cell Cultures
[0192] Anti-FLAG tag, anti-HA tag and anti-.beta. actin antibodies were purchased from Sigma. The N-terminal anti-mTOR antibody was from SantaCruz. All other antibodies were purchased from Cell Signaling. Human embryonic kidney HEK293 cells, human breast MCF7 and Human liver HepG2 cells were maintained at 37.degree. C. and 5% CO.sub.2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS; Hyclone), 2 mM L-glutamine, 50 units/ml penicillin, and 50 .mu.g/ml streptomycin.
Experimental Procedures for RNA Purification and RT-PCR
[0193] Total RNA was purified from HEK293, MCF7 and HepG2 cell lines using SV Total RNA Isolation System (Promega). The first strand cDNA was synthesized by annealing 10 .mu.g of total RNA and 5 .mu.g of oligo dT primer using ReverAid H Minus First Strand cDNA Synthesis Kit (Fermentas) at 70.degree. C. for 5 minutes. Then RT mix (final 1.times. reaction buffer, 40 U RiboLock ribonuclease inhibitor (Fermentas), and 1 mM dNTP) was added and the solution and incubated for 5 minutes at 25.degree. C. After the addition of RevertAid H Minus Reverse Transcriptase (Fermentas), the 25-.mu.l reaction mix was incubated for 10 minutes at 25.degree. C. and 1 hour at 37.degree. C. The reverse transcriptase reaction was stopped by incubating for 10 minutes at 70.degree. C. The reaction mixture was stored at -20.degree. C. and 1 .mu.l was used for each PCRs. The RT-PCR was performed using a panel of specific primers for mTOR. Specific fragments of glyceraldehyde-3-phosphate dehydrogenase (GADPH) and .beta.-actin were amplified and used as loading and quality controls of first strand DNA.
Example 2: Northern Blot Analysis of mTOR in Human Tissue
[0194] To investigate these possibilities, i.e., the existence of mTOR splicing forms or proteolytic degradation of the full-length protein, a Northern blot analysis of total RNA samples purified from a panel of human tissues (OriGene) was initially performed. The membrane was probed with a DIG-labelled mTOR probe (750 bp), corresponding to its C-terminal coding region. In this analysis, the presence of several bands, which hybridized specifically with the mTOR probe (FIG. 2) were observed. As expected, ubiquitously expressed band of approximately 8.6 Kb, which would correspond to the full-length mTOR transcript, were also observed. In addition, there were several distinct bands in the region of 1.5 to 3.5 Kb that showed high abundance in liver and heart. The strongest signal corresponded to bands of 2.7 Kb and 3.2 Kb. The results obtained in Western and Northern blot analysis strongly implied the existence of mTOR splicing forms. The Northern blot analysis also indicates that mTOR.beta. is highly expressed in heart and liver, while kidney, liver, blood, small and large intestine have the highest protein level of mTOR.beta..
Experimental Procedures for Northern Blot Analysis
[0195] The membrane-containing poly(A).sup.+ RNA samples from various human tissues was purchased from OriGene. The Northern blot analysis was performed using DIG Northern Starter kit (Roche Diagnostics) as recommended by the manufacturer. The mTOR DIG-labeled RNA probe was generated by using a 750 bp PCR product, corresponding to the C-terminal coding region of mTOR, as a template for the in vitro transcription reaction with digoxigenin-11-UTP. The actin probe was supplied by the manufacturer.
Example 3: Immunoprecipitation of mTOR Beta
[0196] To further examine the nature of observed immunoreactive bands, mTOR was immunoprecipitated from Hek293, MCF7, and Hep2G cells using the C-terminal polyclonal antibody (Cell Signalling) and probed immune complexes in Western blotting with the N-terminal mTOR antibody. As shown in FIG. 3, two immunoreactive bands in the range of 280 kDa and 80 kDa were clearly detected in the immunoprecipitates from all three cell lines. However, mTOR was immunoprecipitated mTOR from these cell lines by using F11 Mabs, only one immunoreactive band of 280 kDa was observed (data not shown). The obtained results strongly suggest the existence of a potential mTOR splice form which would possess both the N- and C-terminal sequences and code a protein of approximately 700 amino acids in length. Therefore, the most abundant transcripts of 2.7 Kb and 3.2 Kb, which were detected in mTOR Northern blotting, have the potential to encode a splice variant of 80 kDa.
Experimental Procedures for Immunoprecipitations
[0197] HEK293 cells were washed with ice-cold phosphate-buffered saline (PBS) and extracted with the lysis buffer containing 50 mM HEPES (pH 7.5), 150 mM NaCl, 1% (v/v) Triton X100, 2 mM EDTA, 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 1 mM sodium orthovanadate, and a mixture of protease inhibitors (Roche Applied Science). Whole-cell extracts were centrifuged at 10,000.times.g for 30 minutes at 4.degree. C. Endogenous or transiently expressed proteins were immunoprecipitated with corresponding antibodies immobilized on protein A-Sepharose beads (Amersham Biosciences) for 3 hours at 4.degree. C. The immune complexes were then washed once with Tris-buffered saline containing 0.05% Tween 20 and the Wash Buffer 1 (50 mM HEPES [pH 7.5], 40 mM NaCl, and 2 mM EDTA) with 1% Triton X-100, Wash Buffer 1 with 500 mM LiCl and 0.5% Triton X-100, Wash Buffer 1 with 500 mM LiCl, and Wash Buffer 2 (50 mM HEPES [pH 7.5] and 150 mM NaCl). For Raptor or Rictor immunoprecipitation studies, cells were lysed in ice-cold Buffer B (Buffer A with 0.3% CHAPS instead of Triton X-100). The mTOR immunoprecipitates were washed four times in Buffer B and twice in Wash Buffer 2. The immune complexes were used for immunoblotting or for in vitro kinase reactions.
Example 4: Identification of mTOR Beta
[0198] To prove the existence of mTOR splice form(s), a PCR-based search for corresponding cDNAs by employing a panel of mTOR specific oligonucleotides and several human cell lines was carried out. In this analysis, Hek293 and MCF7 lines were used where a potential splice variant was observed. In addition, the hepatoma cell line Hep2G was also examined, since liver was found to possess several potential mTOR splice variants in Northern and Western blotting. Initially, total RNA was purified from exponentially growing cells using SV Total RNA Isolation System (Promega). Then, equal amounts of RNA purified from each cell line were converted into the first strand cDNA by using ReverAid H Minus First Strand cDNA Synthesis Kit (Fermentas). The quality of generated first strand cDNAs was tested by PCR amplification of actin and GADPH fragments. FIG. 4 shows that nearly equal amount of PCR products for GADPH (570 bp) and .beta.-actin (350 bp) were PCR amplified from cDNA preparations of all cell lines. Extensive PCR analysis of generated first strand cDNAs with various sets of mTOR specific primers produced a panel of amplified fragments. The most prominent bands were excised from the gel and sequenced. Among obtained mTOR sequences, one mTOR sequence which contained a potential splice variant, was identified. This PCR fragment of approximately 100 bp was amplified with the N-terminal primer (N1, ATGCTTGGAACCGGACCTGCCG (SEQ ID NO: 5)) and the second primer, located in the end of FATN domain (C3, TTTGGACAGATCCTCAGTGACCT (SEQ ID NO: 6)). It is important to note that this PCR product was specifically amplified from all three cell lines (see FIG. 4A). As shown in FIG. 4B, the amplified fragments contain sequences corresponding to the N-terminal region and the FATN domain of mTOR. The translation of generated sequences clearly indicates the continuation of the reading frame at the point of a splice site (see FIG. 4C). This splice form of mTOR (mTOR beta) has the potential to encode a protein of 706 amino acids in length, consisting of the extreme N-terminal 23 amino acids and a stretch of 683 amino acids from the C-terminus of mTOR.
[0199] In order to obtain the full-length coding sequence of this potential mTOR splice form, PCR amplifications from generated first strand cDNAs using the extreme N1 (ATGCTTGGAACCGGACCTGCCG (SEQ ID NO: 7)) and C1 (TTACCAGAAAGGGCACCA (SEQ ID NO: 8)) mTOR specific primers were carried out. By this approach, to a band of approximately 2.3 Kb was amplified from Hek293 first strand cDNA. Initial sequence analysis of the amplified band from the N- and the C-terminal ends confirmed the existence of the predicted splice variant of mTOR.
[0200] The amplified PCR product was then fully sequenced and its nucleotide sequence (SEQ ID NO: 1)) was found to have mTOR.beta. specific intron/exon at nucleotides 68 to 72. The obtained sequence has an open reading frame capable to encode a protein of 706 amino residues (SEQ ID NO: 1). The position of a splice fusion between the N-terminal (1-23 aa) and the C-terminal (1867-2549 aa) of mTOR.alpha. is indicated by an arrow.
[0201] The identified splice form of mTOR was termed "mTOR beta (mTOR.beta.)" and the full-length protein (mTOR alpha (mTOR.alpha.)). In contrast to the full-length mTOR.alpha., the mTOR.beta. splice form lacks all HEAT domains and the main part of the FATN domain (see FIG. 5). The HEAT domains have been implicated in mediating protein-protein interactions. In mTOR, the sequences corresponding to HEAT domains were found to interact with Raptor and Rictor, which are key players in mTOR signaling. Moreover, the sequences within the HEAT domain region were shown to localize mTOR to endoplasmic reticulum and Golgi apparatus. Recent studies indicated that FAT domains possess HEAT-like structures and might be also involved in protein-protein interactions. The mTOR.beta. possesses intact FRB (FKBP12/Rapamycin Binding), kinase, and FATC domains. The presence of these domains suggests that mTOR could serve as a protein kinase and its function could be regulated by Rapamycin and its analogs. In addition, mTOR.beta. contains 23 amino acids of unknown function from the extreme N-terminus and the C-terminal part of FATN domain. Bioinformatic analysis of the FATN C-terminal region point towards the presence of a HEAT-like domain, which might facilitate the interactions with regulatory proteins, such as Rictor and Raptor.
Example 5: mTOR.beta. Regulation and Cellular Function
[0202] Following the identification and cloning of mTOR.beta., the work on the investigation of its regulation and cellular functions was initiated. Initially, the full-length of mTOR.beta. was cloned in pcDNA3.1 expression vector in frame with the N-terminal FLAG-tag epitope. To examine the level of expression, molecular weight, and regulation of FLAG-mTOR.beta., Hek293 cells were transiently transfected with pcDNA3.1 or pcDNA3.1/FLAG-mTOR.beta.. One day after transfection, cells were serum-starved for 36 hours and incubated in the presence or absence of Rapamycin for 30 minute. After serum stimulation for one hour, cells were lysed and the lysates were used for Western blotting or immunoprecipitation. When the supernatants of lysed cells were immunoblotted with anti-mTOR polyclonal antibody (Cell Signalling), it was clear that pcDNA3.1/FLAG-mTOR.beta. plasmid directs the expression of the protein with the molecular weight of approximately 80 kDa (see FIG. 6A, lower panel). The expression of endogenous mTOR.beta. is evidently observed in Hek293 cells transfected with pcDNA3.1 or pcDNA3.1/FLAG-mTOR.beta.. Due to the presence of a FLAG epitope, the mobility of FLAG-mTOR.beta. is slightly slower when compared to that of endogenous mTOR.beta.. This analysis also showed that starvation/stimulation of cells with serum do no affect the level or gel mobility of both endogenous and overexpressed mTOR.beta.. No significant changes were also observed after Rapamycin treatment.
[0203] Stimulation of cells with serum or growth factors, such as IGF1 is known to induce phosphorylation of mTOR.alpha. on S2448. Originally, the phosphorylation of mTOR.alpha. at S2448 was found to be mediated by PKB/Akt. However, recent studies have provided strong evidence for the involvement of S6K in phosphorylating S2448. To find whether mTOR.beta. is phosphorylated at a serine residue corresponding to S2448 of the entire mTOR.alpha. amino acid in response to serum stimulation, the obtained lysates from the above experiment were probed with S2448 phosphospecific antibody. As shown in FIG. 6A (upper panel), the phosphorylation of endogenous and overexpressed mTOR.beta. at a serine residue corresponding to S2448 of the entire mTOR.alpha. amino acid sequence is strongly induced by serum stimulation. Moreover, this phosphorylation event is sensitive to Rapamycin. The obtained data demonstrate that similarly to mTOR.alpha., the phosphorylation of mTOR.beta. at a serine residue corresponding to S2448 of the entire mTOR.alpha. amino acid sequence is induced in response to serum stimulation and is sensitive to Rapamycin.
[0204] Is mTOR.beta. able to phosphorylate S6K and 4E-BP1, which are the main physiological substrates for mTOR.alpha.? To answer this question, FLAG-mTOR.beta. or FLAG-TOR.alpha. were immunoprecipitated from transiently transfected Hek293 cells. The immune complexes were then used in mTOR kinase reactions, containing cold ATP and recombinant 4E-BP1 or His-S6K1 C. The kinase reactions were resolved by SDS-PAGE and immunoblotted with phosphospecific antibodies pT389-S6K1 and pS65-4E-BP1. FIG. 6B undoubtedly demonstrates that mTOR.beta. can phosphorylate both S6K1 and 4E-BP1 in vitro, but to a lesser extent than mTOR.alpha..
[0205] Studies from various laboratories indicated that mTOR requires binding partners Raptor and Rictor for the phosphorylation of its downstream substrates: S6K, 4E-BP1 and PKB/Akt. Taking this into account, the interaction of mTOR.beta. with known mTOR binding partners was tested. In this study, HEK293 cells were transiently transfected with pcDNA3.1/FLAG-mTOR.beta. and pRK-Raptor-HA or pcDNA3.1/FLAG-mTOR.beta. and pRK/Rictor-Myc or pcDNA3.1/FLAG-mTOR.beta. and pcRK-G.beta.L. The supernatants of lysed cells were immunoprecipitated with anti-FLAG monoclonal or control nonspecific antibody. The immune complexes or total cell lysates from transfected cells were resolved by SDS-PAGE and immunoblotted with various antibodies. FIG. 7 clearly shows that exogenously expressed Raptor, Rictor, and G.beta.L form specific complexes with mTOR.beta. in vivo. The specificity of interaction was tested by using irrelevant antibody in the immunoprecipitation assay. Thus, similarly to the full-length mTOR.alpha., the splice form is also capable to associate with Raptor, Rictor, and G.beta.L. It can also phosphorylate S6K1 and 4E-BP1 in vitro.
[0206] As mentioned above, mTOR.beta. possesses an intact FRB domain. Therefore, it was interesting to compare the sensitivity of mTOR.alpha. and mTOR.beta. to Rapamycin. In this study, HEK293 cells were transiently transfected with pcDNA 3.1/FLAG-mTOR.beta., pcDNA 3.1/FLAG-mTOR.alpha., or pcDNA3.1. One day later, cells were starved for 24 hours and stimulated with 10% FCS for one (1) hour. Various concentrations of Rapamycin (1 nM, 5 nM and 10 nM) were added 30 minutes before serum stimulation. The supernatants of lysed cells were resolved by SDS-PAGE and immunoblotted with various antibodies. The expression of mTOR.alpha. and mTOR.beta. was confirmed by immunoblotting with the C-terminal polyclonal mTOR antibody (see FIG. 8). Probing the membrane with a panel of phosphospecific antibodies directed against known mTOR phosphorylation sites in S6K1 (pT389) and 4E-BP1 (pS70, pS37/46) indicated that cells expressing mTOR.beta. are less sensitive to Rapamycin, when compared to cells transfected with vector alone or pcDNA31/mTOR.alpha.. Notably, the sensitivity was more obvious in cells treated with low doses of Rapamycin, such as 1 nM.
[0207] Previous studies found mTOR.alpha. mainly in membrane fractions of endoplasmic reticulum and Golgi apparatus. Furthermore, mTOR was also observed on the outer mitochondrial membrane and in the nucleus. Sequences located in the HEAT domain region of full-length mTOR (HEAT domain 18 and 19) have been implicated in mediating its membrane localization. Taking into account that HEAT and FATN domains are not present in mTOR.beta., it was interesting to examine its subcellular localization by fractionation. Exponentially growing HEK293 cells were fractionated using ProteoExstract Extraction kit (Calbiochem). Both, mTOR.alpha. and mTOR.beta. were immunoprecipitated from all fractions using anti-mTOR C-terminal antibodies. The immune complexes were resolved by SDS-PAGE and immunoblotted with anti-mTOR N-terminal antibodies. As expected, mTOR.alpha. is detected in obtained cytoplasmic, nuclear and membrane fractions. In contrast to that, mTOR.beta. is predominantly localized in the cytoplasm (see FIG. 9). The quality of prepared subcellular fractions was analyzed by immunoblotting with anti-4E-BP1, HSP60, and c-Jun antibodies. Currently immunofluorescent analysis is being employed to study subcellular localization of Myc-mTOR.alpha. and mTOR.beta. in transiently transfected Hek293 cells (starved/stimulated and in response to cellular stresses).
[0208] To further investigate the role of mTOR in the regulation of cellular processes, Hek293 stable cell lines, overexpressing mTOR.beta. wild type or mTOR.alpha. wild type, were generated. In addition, a cell line over-expressing EGFP (Enhanced Green Fluorescent Protein), which could be used as a control in mTOR studies, has also developed. Initial examination of generated cell lines indicated that cells expressing wild type mTOR.beta. grow faster, when compared with mTOR.alpha. or GFP expressing cells. Taking this into account, the proliferation rate of generated stable cell lines using a cell proliferation assay from Promega was investigated. Stable cell lines, overexpressing mTOR.beta. wt, mTOR.alpha. wt or EGFP were seeded into a 96 well plate at various densities and grown under standard conditions for 7 days. Cell numbers were than measured in each well by Resosurin based assay. In six independent studies, it was found that mTOR.beta. expressing cells proliferate faster in comparison to control cells (see FIG. 10). In contrast, mTOR.alpha. wt expressing cells showed no difference in proliferation compared to control cells. This confirms a role of mTOR.beta., but not mTOR.alpha. in regulation of cell proliferation.
[0209] To investigate whether mTOR.beta. kinase activity has a role in the regulation of cell proliferation, a similar experiment was carried out in Hek293 cell lines, overexpressing mTOR.beta. wild type, mTOR.beta. kinase dead (KD) mutant or EGFP. Cells were seeded into a 96 well plate at various densities and grown under standard conditions for 5 days. Cell numbers were then measured in each well by Resazurin based assay. In six independent studies, it was found that mTOR.beta. expressing cells proliferate approximately 1.6 times faster in comparison to control cells (see FIG. 11). The obtained data also indicate that mTOR.beta. KD mutant does not have a dominant negative effect on cell proliferation, when expressed in Hek293 cells. It exhibits a slightly opposite effect, as mTOR.beta. KD overexpressing cells grew to some extent faster when compared with EGFP cells.
[0210] It is further thought that the induction of cell proliferation by mTOR.beta. could be transduced by various signaling pathways. One of those pathways, signaling via the proto-oncogene Myc was examined. The proto-oncogene Myc is known to affect growth, proliferation, differentiation, and apoptosis of cells through its ability to regulate the transcription of a vast number of genes. cMyc has been also implicated in the regulation of tumor progression, including genetic stability, migration, and angiogenesis. The expression and function of cMyc protein is therefore tightly controlled. Indeed many different pathways and factors have been identified that modulate cMyc expression at the level of transcription and translation, and its protein function through post-translational modifications. In regulating of cell proliferation, c-Myc controls the expression of genes, which participate in G1/S transition of the cell cycle. Signalling via mTOR pathway makes a major contribution to the cell cycle progression at G1/S stage. Moreover, Rapamycin is a known inhibitor of the G1/S transition of the cell cycle.
[0211] To test whether cMyc is involved in mTOR.beta.-induced proliferation, HEK293 cells were transiently transfected with pEGFP, pcDNA 3.1/mTOR.beta. wt, pcDNA 3.1/mTOR.beta. dead mutant, or pcDNA 3.1/mTOR.alpha. wt. Two days after transfection cells were lysed, separated by SDS-PAGE and immunoblotted with antibodies to c-myc and its transcription targets (e.g. anti-Myc (9E10) monoclonal antibody). The results presented in FIG. 10B, clearly demonstrate that overexpression of mTOR.beta., but not mTOR.alpha. leads to a significant increase in c-Myc protein level. The induction of c-Myc translation is dependent on mTOR.beta. kinase activity, as a kinase dead mutant of mTOR does not stimulate c-Myc expression (FIG. 11B). The expression level of transiently expressed mTOR.alpha., mTOR.beta. wt, and KD mutant was monitored by immunoblotting with the C-term mTOR antibody. Overexpression of mTOR.beta. wt was found to increases the level of Myc expression. It was also found that Hek293 cells, overexpressing mTOR.beta. recover from Sorbitol-induced stress much faster than mTOR.alpha. overexpressing cells.
[0212] To further investigate the role of mTOR.beta. in the cell cycle, Hek293 cells overexpressing mTOR.beta., mTOR.alpha. or EGFP were pulse labeled with BrdU for 30 minutes and chased every 2 hours for 24 hours. Incorporation of BrdU into the cells was measured by FACS analysis. The duration of the G1, S and G2 phases of cell cycle observed for each cell line was determined (see FIG. 12). The duration of S and G2 phases were similar in all three cell groups. However, the duration of the G1 phase was shorter in the mTOR.beta. overexpressing cells than in the mTOR.alpha. or control cells. This suggests that mTOR.beta. is critical for G1 progression of the cell cycle.
[0213] The effects of mTOR.beta. in serum starved cells were also assessed. Hek293 stable cell lines, overexpressing mTOR.beta. wt, mTOR.alpha. wt, mTOR.beta. kinase dead or EGFP were serum starved for 60 hours. Cell survival was assessed by the Trypan Blue dye exclusion assay. It was found that overexpression of mTOR wt protected cells from starvation induced cell death (see FIG. 13A) and that mTOR.beta. kinase activity is required for mediating this effect (see FIG. 13B).
[0214] To further investigate the effect of mTOR.beta. expression on cell oncogenic potential, Hek293 cells stably overexpressing mTOR.beta., mTOR.alpha. or EGFP were plated in a thin layer of agarose in culture medium. After 14 days, colonies were stained using MTT (see FIG. 14A). Colonies were counted using quantity 1 software (Bio-Rad) and folds were plotted (see FIG. 14B). It was found that mTOR.beta. overexpression led to an increase in cell oncogenic potential compared with those cells overexpressing mTOR.alpha. and control cells.
Experimental Procedures for In Vitro Kinase Assay
[0215] mTOR in vitro kinase assay was performed as published previously (Kim et al. 2002). Briefly, the kinase assay was performed in 30 .mu.l at 30.degree. C. for 40 minutes and contained about a quarter of the washed mTOR immunoprecipitates from 5.times.10.sup.6 HEK293 cells, 1 .mu.g of a 4E-BP1 (Calbiochem) or 0.5 .mu.g of recombinant His-S6K1C, 25 mM HEPES-KOH (pH 7.4), 50 mM KCl, 20% glycerol, 10 mM MgCl.sub.2, 4 mM MnCl.sub.2, 1 mM DTT, and 50 .mu.M ATP. The reactions were stopped by adding 5.times. sample buffer and resolved by SDS-PAGE and analyzed by immunoblotting.
Experimental Procedures for Immunoblot Analysis
[0216] Immune complexes or total cell lysates were separated by SDS-PAGE, transferred onto polyvinylidene difluoride membrane (PVDF) and incubated for 1 hour with blocking solution (5% milk, Tris-buffered saline/Tween 0.1%). Blocked membranes were then probed overnight with primary antibodies at 4.degree. C. After extensive washing with Tris-buffered saline with 0.1% Tween, the membranes were incubated for 1 hour with secondary horseradish peroxidase-conjugated antibody at RT. The antigen-antibody complexes were detected using the ECL system (Millipore). When immunoblots had to be re-probed, the membranes were initially stripped (Restore Western Stripping Reagent, Pierce) and incubated with another type of primary antibody.
Experimental Procedures for Subcellular Fractionation
[0217] Subcellular fractionation of HEK293 cells was performed using ProteoExstract Extraction kit (Calbiochem) as recommended by manufacturer. mTOR.alpha. and mTOR.beta. were immunoprecipitated from all fractions using anti-mTOR C-terminal antibodies. Immune complexes were resolved by SDS-PAGE and immunoblotted with anti-mTOR N-terminal antibody. Anti-4E-BP1, HSP60 and c-Jun antibodies were used as controls for cytoplasmic, membrane and nuclear fractions respectively.
Experimental Procedures for Stable Cell Lines Production and Cell Proliferation Assay
[0218] Stable cell lines overexpressing wild type and kinase dead mTOR.beta. were produced by transfecting linearized pcDNA 3.1/FLAG-Tor 13 wt or pcDNA 3.1 FLAG Tor .beta. dead vectors in to HEK293 cells. Cell lines were selected for 10 days on 500 .mu.g/ml genetecin as recommended by manufacturer (Invitrogen). For cell proliferation assay, Hek293 stable cell lines, overexpressing mTOR .beta. wt, mTOR .beta. kinase dead and EGFP were seeded into 96 well plate at various density (250, 500, 1000 and 2000 cell per well) and grown under standard conditions for 5 days. Cell numbers were than measured in each well by Resosurin based assay (Cell Titer Blue Promega)) as recommended by the manufacturer. Normalized growth curves for each cell line were calculated using data from at least six independent experiments).
[0219] While the invention has been described and illustrated herein by references to various specific materials, procedures and examples, it is understood that the invention is not restricted to the particular combinations of material and procedures selected for that purpose. Numerous variations of such details can be implied as will be appreciated by those skilled in the art. It is intended that the specification and examples be considered as exemplary, only, with the true scope and spirit of the invention being indicated by the following claims. All references, patents, and patent applications referred to in this application are herein incorporated by reference in their entirety.
Sequence CWU
1
1
1112121DNAHomo sapiens 1atgcttggaa ccggacctgc cgccgccacc accgctgcca
ccacatctag caatgtgagc 60gtcctgcaga agaaggtcac tgaggatctg tccaaaaccc
tcctgatgta cacggtgcct 120gccgtccagg gcttcttccg ttccatctcc ttgtcacgag
gcaacaacct ccaggataca 180ctcagagttc tcaccttatg gtttgattat ggtcactggc
cagatgtcaa tgaggcctta 240gtggaggggg tgaaagccat ccagattgat acctggctac
aggttatacc tcagctcatt 300gcaagaattg atacgcccag acccttggtg ggacgtctca
ttcaccagct tctcacagac 360attggtcggt accaccccca ggccctcatc tacccactga
cagtggcttc taagtctacc 420acgacagccc ggcacaatgc agccaacaag attctgaaga
acatgtgtga gcacagcaac 480accctggtcc agcaggccat gatggtgagc gaggagctga
tccgagtggc catcctctgg 540catgagatgt ggcatgaagg cctggaagag gcatctcgtt
tgtactttgg ggaaaggaac 600gtgaaaggca tgtttgaggt gctggagccc ttgcatgcta
tgatggaacg gggcccccag 660actctgaagg aaacatcctt taatcaggcc tatggtcgag
atttaatgga ggcccaagag 720tggtgcagga agtacatgaa atcagggaat gtcaaggacc
tcacccaagc ctgggacctc 780tattatcatg tgttccgacg aatctcaaag cagctgcctc
agctcacatc cttagagctg 840caatatgttt ccccaaaact tctgatgtgc cgggaccttg
aattggctgt gccaggaaca 900tatgacccca accagccaat cattcgcatt cagtccatag
caccgtcttt gcaagtcatc 960acatccaagc agaggccccg gaaattgaca cttatgggca
gcaacggaca tgagtttgtt 1020ttccttctaa aaggccatga agatctgcgc caggatgagc
gtgtgatgca gctcttcggc 1080ctggttaaca cccttctggc caatgaccca acatctcttc
ggaaaaacct cagcatccag 1140agatacgctg tcatcccttt atcgaccaac tcgggcctca
ttggctgggt tccccactgt 1200gacacactgc acgccctcat ccgggactac agggagaaga
agaagatcct tctcaacatc 1260gagcatcgca tcatgttgcg gatggctccg gactatgacc
acttgactct gatgcagaag 1320gtggaggtgt ttgagcatgc cgtcaataat acagctgggg
acgacctggc caagctgctg 1380tggctgaaaa gccccagctc cgaggtgtgg tttgaccgaa
gaaccaatta tacccgttct 1440ttagcggtca tgtcaatggt tgggtatatt ttaggcctgg
gagatagaca cccatccaac 1500ctgatgctgg accgtctgag tgggaagatc ctgcacattg
actttgggga ctgctttgag 1560gttgctatga cccgagagaa gtttccagag aagattccat
ttagactaac aagaatgttg 1620accaatgcta tggaggttac aggcctggat ggcaactaca
gaatcacatg ccacacagtg 1680atggaggtgc tgcgagagca caaggacagt gtcatggccg
tgctggaagc ctttgtctat 1740gaccccttgc tgaactggag gctgatggac acaaatacca
aaggcaacaa gcgatcccga 1800acgaggacgg attcctactc tgctggccag tcagtcgaaa
ttttggacgg tgtggaactt 1860ggagagccag cccataagaa aacggggacc acagtgccag
aatctattca ttctttcatt 1920ggagacggtt tggtgaaacc agaggcccta aataagaaag
ctatccagat tattaacagg 1980gttcgagata agctcactgg tcgggacttc tctcatgatg
acactttgga tgttccaacg 2040caagttgagc tgctcatcaa acaagcgaca tcccatgaaa
acctctgcca gtgctatatt 2100ggctggtgcc ctttctggta a
21212706PRTHomo sapiens 2Met Leu Gly Thr Gly Pro
Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser 1 5
10 15 Ser Asn Val Ser Val Leu Gln Lys Lys Val Thr
Glu Asp Leu Ser Lys 20 25
30 Thr Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly Phe Phe Arg
Ser 35 40 45 Ile
Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu Arg Val Leu 50
55 60 Thr Leu Trp Phe Asp Tyr
Gly His Trp Pro Asp Val Asn Glu Ala Leu 65 70
75 80 Val Glu Gly Val Lys Ala Ile Gln Ile Asp Thr
Trp Leu Gln Val Ile 85 90
95 Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu Val Gly Arg
100 105 110 Leu Ile
His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His Pro Gln Ala 115
120 125 Leu Ile Tyr Pro Leu Thr Val
Ala Ser Lys Ser Thr Thr Thr Ala Arg 130 135
140 His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys
Glu His Ser Asn 145 150 155
160 Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu Ile Arg Val
165 170 175 Ala Ile Leu
Trp His Glu Met Trp His Glu Gly Leu Glu Glu Ala Ser 180
185 190 Arg Leu Tyr Phe Gly Glu Arg Asn
Val Lys Gly Met Phe Glu Val Leu 195 200
205 Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr
Leu Lys Glu 210 215 220
Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu Ala Gln Glu 225
230 235 240 Trp Cys Arg Lys
Tyr Met Lys Ser Gly Asn Val Lys Asp Leu Thr Gln 245
250 255 Ala Trp Asp Leu Tyr Tyr His Val Phe
Arg Arg Ile Ser Lys Gln Leu 260 265
270 Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro Lys
Leu Leu 275 280 285
Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr Asp Pro Asn 290
295 300 Gln Pro Ile Ile Arg
Ile Gln Ser Ile Ala Pro Ser Leu Gln Val Ile 305 310
315 320 Thr Ser Lys Gln Arg Pro Arg Lys Leu Thr
Leu Met Gly Ser Asn Gly 325 330
335 His Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu Arg Gln
Asp 340 345 350 Glu
Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu Leu Ala Asn 355
360 365 Asp Pro Thr Ser Leu Arg
Lys Asn Leu Ser Ile Gln Arg Tyr Ala Val 370 375
380 Ile Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly
Trp Val Pro His Cys 385 390 395
400 Asp Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys Lys Lys Ile
405 410 415 Leu Leu
Asn Ile Glu His Arg Ile Met Leu Arg Met Ala Pro Asp Tyr 420
425 430 Asp His Leu Thr Leu Met Gln
Lys Val Glu Val Phe Glu His Ala Val 435 440
445 Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu
Trp Leu Lys Ser 450 455 460
Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr Thr Arg Ser 465
470 475 480 Leu Ala Val
Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg 485
490 495 His Pro Ser Asn Leu Met Leu Asp
Arg Leu Ser Gly Lys Ile Leu His 500 505
510 Ile Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg
Glu Lys Phe 515 520 525
Pro Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr Asn Ala Met 530
535 540 Glu Val Thr Gly
Leu Asp Gly Asn Tyr Arg Ile Thr Cys His Thr Val 545 550
555 560 Met Glu Val Leu Arg Glu His Lys Asp
Ser Val Met Ala Val Leu Glu 565 570
575 Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met Asp
Thr Asn 580 585 590
Thr Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser Tyr Ser Ala
595 600 605 Gly Gln Ser Val
Glu Ile Leu Asp Gly Val Glu Leu Gly Glu Pro Ala 610
615 620 His Lys Lys Thr Gly Thr Thr Val
Pro Glu Ser Ile His Ser Phe Ile 625 630
635 640 Gly Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys
Lys Ala Ile Gln 645 650
655 Ile Ile Asn Arg Val Arg Asp Lys Leu Thr Gly Arg Asp Phe Ser His
660 665 670 Asp Asp Thr
Leu Asp Val Pro Thr Gln Val Glu Leu Leu Ile Lys Gln 675
680 685 Ala Thr Ser His Glu Asn Leu Cys
Gln Cys Tyr Ile Gly Trp Cys Pro 690 695
700 Phe Trp 705 37943DNAHomo sapiens 3acggggcctg
aagcggcggt accggtgctg gcggcggcag ctgaggcctt ggccgaagcc 60gcgcgaacct
cagggcaaga tgcttggaac cggacctgcc gccgccacca ccgctgccac 120cacatctagc
aatgtgagcg tcctgcagca gtttgccagt ggcctaaaga gccggaatga 180ggaaaccagg
gccaaagccg ccaaggagct ccagcactat gtcaccatgg aactccgaga 240gatgagtcaa
gaggagtcta ctcgcttcta tgaccaactg aaccatcaca tttttgaatt 300ggtttccagc
tcagatgcca atgagaggaa aggtggcatc ttggccatag ctagcctcat 360aggagtggaa
ggtgggaatg ccacccgaat tggcagattt gccaactatc ttcggaacct 420cctcccctcc
aatgacccag ttgtcatgga aatggcatcc aaggccattg gccgtcttgc 480catggcaggg
gacactttta ccgctgagta cgtggaattt gaggtgaagc gagccctgga 540atggctgggt
gctgaccgca atgagggccg gagacatgca gctgtcctgg ttctccgtga 600gctggccatc
agcgtcccta ccttcttctt ccagcaagtg caacccttct ttgacaacat 660ttttgtggcc
gtgtgggacc ccaaacaggc catccgtgag ggagctgtag ccgcccttcg 720tgcctgtctg
attctcacaa cccagcgtga gccgaaggag atgcagaagc ctcagtggta 780caggcacaca
tttgaagaag cagagaaggg atttgatgag accttggcca aagagaaggg 840catgaatcgg
gatgatcgga tccatggagc cttgttgatc cttaacgagc tggtccgaat 900cagcagcatg
gagggagagc gtctgagaga agaaatggaa gaaatcacac agcagcagct 960ggtacacgac
aagtactgca aagatctcat gggcttcgga acaaaacctc gtcacattac 1020ccccttcacc
agtttccagg ctgtacagcc ccagcagtca aatgccttgg tggggctgct 1080ggggtacagc
tctcaccaag gcctcatggg atttgggacc tcccccagtc cagctaagtc 1140caccctggtg
gagagccggt gttgcagaga cttgatggag gagaaatttg atcaggtgtg 1200ccagtgggtg
ctgaaatgca ggaatagcaa gaactcgctg atccaaatga caatccttaa 1260tttgttgccc
cgcttggctg cattccgacc ttctgccttc acagataccc agtatctcca 1320agataccatg
aaccatgtcc taagctgtgt caagaaggag aaggaacgta cagcggcctt 1380ccaagccctg
gggctacttt ctgtggctgt gaggtctgag tttaaggtct atttgcctcg 1440cgtgctggac
atcatccgag cggccctgcc cccaaaggac ttcgcccata agaggcagaa 1500ggcaatgcag
gtggacgcca cagtcttcac ttgcatcagc atgctggctc gagcaatggg 1560gccaggcatc
cagcaggata tcaaggagct gctggagccc atgctggcag tgggactaag 1620ccctgccctc
actgcagtgc tctacgacct gagccgtcag attccacagc taaagaagga 1680cattcaagat
gggctactga aaatgctgtc cctggtcctt atgcacaaac cccttcgcca 1740cccaggcatg
cccaagggcc tggcccatca gctggcctct cctggcctca cgaccctccc 1800tgaggccagc
gatgtgggca gcatcactct tgccctccga acgcttggca gctttgaatt 1860tgaaggccac
tctctgaccc aatttgttcg ccactgtgcg gatcatttcc tgaacagtga 1920gcacaaggag
atccgcatgg aggctgcccg cacctgctcc cgcctgctca caccctccat 1980ccacctcatc
agtggccatg ctcatgtggt tagccagacc gcagtgcaag tggtggcaga 2040tgtgcttagc
aaactgctcg tagttgggat aacagatcct gaccctgaca ttcgctactg 2100tgtcttggcg
tccctggacg agcgctttga tgcacacctg gcccaggcgg agaacttgca 2160ggccttgttt
gtggctctga atgaccaggt gtttgagatc cgggagctgg ccatctgcac 2220tgtgggccga
ctcagtagca tgaaccctgc ctttgtcatg cctttcctgc gcaagatgct 2280catccagatt
ttgacagagt tggagcacag tgggattgga agaatcaaag agcagagtgc 2340ccgcatgctg
gggcacctgg tctccaatgc cccccgactc atccgcccct acatggagcc 2400tattctgaag
gcattaattt tgaaactgaa agatccagac cctgatccaa acccaggtgt 2460gatcaataat
gtcctggcaa caataggaga attggcacag gttagtggcc tggaaatgag 2520gaaatgggtt
gatgaacttt ttattatcat catggacatg ctccaggatt cctctttgtt 2580ggccaaaagg
caggtggctc tgtggaccct gggacagttg gtggccagca ctggctatgt 2640agtagagccc
tacaggaagt accctacttt gcttgaggtg ctactgaatt ttctgaagac 2700tgagcagaac
cagggtacac gcagagaggc catccgtgtg ttagggcttt taggggcttt 2760ggatccttac
aagcacaaag tgaacattgg catgatagac cagtcccggg atgcctctgc 2820tgtcagcctg
tcagaatcca agtcaagtca ggattcctct gactatagca ctagtgaaat 2880gctggtcaac
atgggaaact tgcctctgga tgagttctac ccagctgtgt ccatggtggc 2940cctgatgcgg
atcttccgag accagtcact ctctcatcat cacaccatgg ttgtccaggc 3000catcaccttc
atcttcaagt ccctgggact caaatgtgtg cagttcctgc cccaggtcat 3060gcccacgttc
cttaatgtca ttcgagtctg tgatggggcc atccgggaat ttttgttcca 3120gcagctggga
atgttggtgt cctttgtgaa gagccacatc agaccttata tggatgaaat 3180agtcaccctc
atgagagaat tctgggtcat gaacacctca attcagagca cgatcattct 3240tctcattgag
caaattgtgg tagctcttgg gggtgaattt aagctctacc tgccccagct 3300gatcccacac
atgctgcgtg tcttcatgca tgacaacagc ccaggccgca ttgtctctat 3360caagttactg
gctgcaatcc agctgtttgg cgccaacctg gatgactacc tgcatttact 3420gctgcctcct
attgttaagt tgtttgatgc ccctgaagct ccactgccat ctcgaaaggc 3480agcgctagag
actgtggacc gcctgacgga gtccctggat ttcactgact atgcctcccg 3540gatcattcac
cctattgttc gaacactgga ccagagccca gaactgcgct ccacagccat 3600ggacacgctg
tcttcacttg tttttcagct ggggaagaag taccaaattt tcattccaat 3660ggtgaataaa
gttctggtgc gacaccgaat caatcatcag cgctatgatg tgctcatctg 3720cagaattgtc
aagggataca cacttgctga tgaagaggag gatcctttga tttaccagca 3780tcggatgctt
aggagtggcc aaggggatgc attggctagt ggaccagtgg aaacaggacc 3840catgaagaaa
ctgcacgtca gcaccatcaa cctccaaaag gcctggggcg ctgccaggag 3900ggtctccaaa
gatgactggc tggaatggct gagacggctg agcctggagc tgctgaagga 3960ctcatcatcg
ccctccctgc gctcctgctg ggccctggca caggcctaca acccgatggc 4020cagggatctc
ttcaatgctg catttgtgtc ctgctggtct gaactgaatg aagatcaaca 4080ggatgagctc
atcagaagca tcgagttggc cctcacctca caagacatcg ctgaagtcac 4140acagaccctc
ttaaacttgg ctgaattcat ggaacacagt gacaagggcc ccctgccact 4200gagagatgac
aatggcattg ttctgctggg tgagagagct gccaagtgcc gagcatatgc 4260caaagcacta
cactacaaag aactggagtt ccagaaaggc cccacccctg ccattctaga 4320atctctcatc
agcattaata ataagctaca gcagccggag gcagcggccg gagtgttaga 4380atatgccatg
aaacactttg gagagctgga gatccaggct acctggtatg agaaactgca 4440cgagtgggag
gatgcccttg tggcctatga caagaaaatg gacaccaaca aggacgaccc 4500agagctgatg
ctgggccgca tgcgctgcct cgaggccttg ggggaatggg gtcaactcca 4560ccagcagtgc
tgtgaaaagt ggaccctggt taatgatgag acccaagcca agatggcccg 4620gatggctgct
gcagctgcat ggggtttagg tcagtgggac agcatggaag aatacacctg 4680tatgatccct
cgggacaccc atgatggggc attttataga gctgtgctgg cactgcatca 4740ggacctcttc
tccttggcac aacagtgcat tgacaaggcc agggacctgc tggatgctga 4800attaactgca
atggcaggag agagttacag tcgggcatat ggggccatgg tttcttgcca 4860catgctgtcc
gagctggagg aggttatcca gtacaaactt gtccccgagc gacgagagat 4920catccgccag
atctggtggg agagactgca gggctgccag cgtatcgtag aggactggca 4980gaaaatcctt
atggtgcggt cccttgtggt cagccctcat gaagacatga gaacctggct 5040caagtatgca
agcctgtgcg gcaagagtgg caggctggct cttgctcata aaactttagt 5100gttgctcctg
ggagttgatc cgtctcggca acttgaccat cctctgccaa cagttcaccc 5160tcaggtgacc
tatgcctaca tgaaaaacat gtggaagagt gcccgcaaga tcgatgcctt 5220ccagcacatg
cagcattttg tccagaccat gcagcaacag gcccagcatg ccatcgctac 5280tgaggaccag
cagcataagc aggaactgca caagctcatg gcccgatgct tcctgaaact 5340tggagagtgg
cagctgaatc tacagggcat caatgagagc acaatcccca aagtgctgca 5400gtactacagc
gccgccacag agcacgaccg cagctggtac aaggcctggc atgcgtgggc 5460agtgatgaac
ttcgaagctg tgctacacta caaacatcag aaccaagccc gcgatgagaa 5520gaagaaactg
cgtcatgcca gcggggccaa catcaccaac gccaccactg ccgccaccac 5580ggccgccact
gccaccacca ctgccagcac cgagggcagc aacagtgaga gcgaggccga 5640gagcaccgag
aacagcccca ccccatcgcc gctgcagaag aaggtcactg aggatctgtc 5700caaaaccctc
ctgatgtaca cggtgcctgc cgtccagggc ttcttccgtt ccatctcctt 5760gtcacgaggc
aacaacctcc aggatacact cagagttctc accttatggt ttgattatgg 5820tcactggcca
gatgtcaatg aggccttagt ggagggggtg aaagccatcc agattgatac 5880ctggctacag
gttatacctc agctcattgc aagaattgat acgcccagac ccttggtggg 5940acgtctcatt
caccagcttc tcacagacat tggtcggtac cacccccagg ccctcatcta 6000cccactgaca
gtggcttcta agtctaccac gacagcccgg cacaatgcag ccaacaagat 6060tctgaagaac
atgtgtgagc acagcaacac cctggtccag caggccatga tggtgagcga 6120ggagctgatc
cgagtggcca tcctctggca tgagatgtgg catgaaggcc tggaagaggc 6180atctcgtttg
tactttgggg aaaggaacgt gaaaggcatg tttgaggtgc tggagccctt 6240gcatgctatg
atggaacggg gcccccagac tctgaaggaa acatccttta atcaggccta 6300tggtcgagat
ttaatggagg cccaagagtg gtgcaggaag tacatgaaat cagggaatgt 6360caaggacctc
acccaagcct gggacctcta ttatcatgtg ttccgacgaa tctcaaagca 6420gctgcctcag
ctcacatcct tagagctgca atatgtttcc ccaaaacttc tgatgtgccg 6480ggaccttgaa
ttggctgtgc caggaacata tgaccccaac cagccaatca ttcgcattca 6540gtccatagca
ccgtctttgc aagtcatcac atccaagcag aggccccgga aattgacact 6600tatgggcagc
aacggacatg agtttgtttt ccttctaaaa ggccatgaag atctgcgcca 6660ggatgagcgt
gtgatgcagc tcttcggcct ggttaacacc cttctggcca atgacccaac 6720atctcttcgg
aaaaacctca gcatccagag atacgctgtc atccctttat cgaccaactc 6780gggcctcatt
ggctgggttc cccactgtga cacactgcac gccctcatcc gggactacag 6840ggagaagaag
aagatccttc tcaacatcga gcatcgcatc atgttgcgga tggctccgga 6900ctatgaccac
ttgactctga tgcagaaggt ggaggtgttt gagcatgccg tcaataatac 6960agctggggac
gacctggcca agctgctgtg gctgaaaagc cccagctccg aggtgtggtt 7020tgaccgaaga
accaattata cccgttcttt agcggtcatg tcaatggttg ggtatatttt 7080aggcctggga
gatagacacc catccaacct gatgctggac cgtctgagtg ggaagatcct 7140gcacattgac
tttggggact gctttgaggt tgctatgacc cgagagaagt ttccagagaa 7200gattccattt
agactaacaa gaatgttgac caatgctatg gaggttacag gcctggatgg 7260caactacaga
atcacatgcc acacagtgat ggaggtgctg cgagagcaca aggacagtgt 7320catggccgtg
ctggaagcct ttgtctatga ccccttgctg aactggaggc tgatggacac 7380aaataccaaa
ggcaacaagc gatcccgaac gaggacggat tcctactctg ctggccagtc 7440agtcgaaatt
ttggacggtg tggaacttgg agagccagcc cataagaaaa cggggaccac 7500agtgccagaa
tctattcatt ctttcattgg agacggtttg gtgaaaccag aggccctaaa 7560taagaaagct
atccagatta ttaacagggt tcgagataag ctcactggtc gggacttctc 7620tcatgatgac
actttggatg ttccaacgca agttgagctg ctcatcaaac aagcgacatc 7680ccatgaaaac
ctctgccagt gctatattgg ctggtgccct ttctggtaac tggaggccca 7740gatgtgccca
tcacgttttt tctgaggctt ttgtacttta gtaaatgctt ccactaaact 7800gaaaccatgg
tgagaaagtt tgactttgtt aaatattttg aaatgtaaat gaaaagaagt 7860actgtatatt
aaaagttggt ttgaaccaac tttctagctg ctgttgaaga atatattgtc 7920agaaacacaa
ggcttgattt ggt 794342549PRTHomo
sapiens 4Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser
1 5 10 15 Ser Asn
Val Ser Val Leu Gln Gln Phe Ala Ser Gly Leu Lys Ser Arg 20
25 30 Asn Glu Glu Thr Arg Ala Lys
Ala Ala Lys Glu Leu Gln His Tyr Val 35 40
45 Thr Met Glu Leu Arg Glu Met Ser Gln Glu Glu Ser
Thr Arg Phe Tyr 50 55 60
Asp Gln Leu Asn His His Ile Phe Glu Leu Val Ser Ser Ser Asp Ala 65
70 75 80 Asn Glu Arg
Lys Gly Gly Ile Leu Ala Ile Ala Ser Leu Ile Gly Val 85
90 95 Glu Gly Gly Asn Ala Thr Arg Ile
Gly Arg Phe Ala Asn Tyr Leu Arg 100 105
110 Asn Leu Leu Pro Ser Asn Asp Pro Val Val Met Glu Met
Ala Ser Lys 115 120 125
Ala Ile Gly Arg Leu Ala Met Ala Gly Asp Thr Phe Thr Ala Glu Tyr 130
135 140 Val Glu Phe Glu
Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg 145 150
155 160 Asn Glu Gly Arg Arg His Ala Ala Val
Leu Val Leu Arg Glu Leu Ala 165 170
175 Ile Ser Val Pro Thr Phe Phe Phe Gln Gln Val Gln Pro Phe
Phe Asp 180 185 190
Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gln Ala Ile Arg Glu Gly
195 200 205 Ala Val Ala Ala
Leu Arg Ala Cys Leu Ile Leu Thr Thr Gln Arg Glu 210
215 220 Pro Lys Glu Met Gln Lys Pro Gln
Trp Tyr Arg His Thr Phe Glu Glu 225 230
235 240 Ala Glu Lys Gly Phe Asp Glu Thr Leu Ala Lys Glu
Lys Gly Met Asn 245 250
255 Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn Glu Leu Val
260 265 270 Arg Ile Ser
Ser Met Glu Gly Glu Arg Leu Arg Glu Glu Met Glu Glu 275
280 285 Ile Thr Gln Gln Gln Leu Val His
Asp Lys Tyr Cys Lys Asp Leu Met 290 295
300 Gly Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe Thr
Ser Phe Gln 305 310 315
320 Ala Val Gln Pro Gln Gln Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr
325 330 335 Ser Ser His Gln
Gly Leu Met Gly Phe Gly Thr Ser Pro Ser Pro Ala 340
345 350 Lys Ser Thr Leu Val Glu Ser Arg Cys
Cys Arg Asp Leu Met Glu Glu 355 360
365 Lys Phe Asp Gln Val Cys Gln Trp Val Leu Lys Cys Arg Asn
Ser Lys 370 375 380
Asn Ser Leu Ile Gln Met Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala 385
390 395 400 Ala Phe Arg Pro Ser
Ala Phe Thr Asp Thr Gln Tyr Leu Gln Asp Thr 405
410 415 Met Asn His Val Leu Ser Cys Val Lys Lys
Glu Lys Glu Arg Thr Ala 420 425
430 Ala Phe Gln Ala Leu Gly Leu Leu Ser Val Ala Val Arg Ser Glu
Phe 435 440 445 Lys
Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro 450
455 460 Pro Lys Asp Phe Ala His
Lys Arg Gln Lys Ala Met Gln Val Asp Ala 465 470
475 480 Thr Val Phe Thr Cys Ile Ser Met Leu Ala Arg
Ala Met Gly Pro Gly 485 490
495 Ile Gln Gln Asp Ile Lys Glu Leu Leu Glu Pro Met Leu Ala Val Gly
500 505 510 Leu Ser
Pro Ala Leu Thr Ala Val Leu Tyr Asp Leu Ser Arg Gln Ile 515
520 525 Pro Gln Leu Lys Lys Asp Ile
Gln Asp Gly Leu Leu Lys Met Leu Ser 530 535
540 Leu Val Leu Met His Lys Pro Leu Arg His Pro Gly
Met Pro Lys Gly 545 550 555
560 Leu Ala His Gln Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro Glu Ala
565 570 575 Ser Asp Val
Gly Ser Ile Thr Leu Ala Leu Arg Thr Leu Gly Ser Phe 580
585 590 Glu Phe Glu Gly His Ser Leu Thr
Gln Phe Val Arg His Cys Ala Asp 595 600
605 His Phe Leu Asn Ser Glu His Lys Glu Ile Arg Met Glu
Ala Ala Arg 610 615 620
Thr Cys Ser Arg Leu Leu Thr Pro Ser Ile His Leu Ile Ser Gly His 625
630 635 640 Ala His Val Val
Ser Gln Thr Ala Val Gln Val Val Ala Asp Val Leu 645
650 655 Ser Lys Leu Leu Val Val Gly Ile Thr
Asp Pro Asp Pro Asp Ile Arg 660 665
670 Tyr Cys Val Leu Ala Ser Leu Asp Glu Arg Phe Asp Ala His
Leu Ala 675 680 685
Gln Ala Glu Asn Leu Gln Ala Leu Phe Val Ala Leu Asn Asp Gln Val 690
695 700 Phe Glu Ile Arg Glu
Leu Ala Ile Cys Thr Val Gly Arg Leu Ser Ser 705 710
715 720 Met Asn Pro Ala Phe Val Met Pro Phe Leu
Arg Lys Met Leu Ile Gln 725 730
735 Ile Leu Thr Glu Leu Glu His Ser Gly Ile Gly Arg Ile Lys Glu
Gln 740 745 750 Ser
Ala Arg Met Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile 755
760 765 Arg Pro Tyr Met Glu Pro
Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys 770 775
780 Asp Pro Asp Pro Asp Pro Asn Pro Gly Val Ile
Asn Asn Val Leu Ala 785 790 795
800 Thr Ile Gly Glu Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp
805 810 815 Val Asp
Glu Leu Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser 820
825 830 Leu Leu Ala Lys Arg Gln Val
Ala Leu Trp Thr Leu Gly Gln Leu Val 835 840
845 Ala Ser Thr Gly Tyr Val Val Glu Pro Tyr Arg Lys
Tyr Pro Thr Leu 850 855 860
Leu Glu Val Leu Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly Thr 865
870 875 880 Arg Arg Glu
Ala Ile Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro 885
890 895 Tyr Lys His Lys Val Asn Ile Gly
Met Ile Asp Gln Ser Arg Asp Ala 900 905
910 Ser Ala Val Ser Leu Ser Glu Ser Lys Ser Ser Gln Asp
Ser Ser Asp 915 920 925
Tyr Ser Thr Ser Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp 930
935 940 Glu Phe Tyr Pro
Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg 945 950
955 960 Asp Gln Ser Leu Ser His His His Thr
Met Val Val Gln Ala Ile Thr 965 970
975 Phe Ile Phe Lys Ser Leu Gly Leu Lys Cys Val Gln Phe Leu
Pro Gln 980 985 990
Val Met Pro Thr Phe Leu Asn Val Ile Arg Val Cys Asp Gly Ala Ile
995 1000 1005 Arg Glu Phe
Leu Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val 1010
1015 1020 Lys Ser His Ile Arg Pro Tyr Met
Asp Glu Ile Val Thr Leu Met 1025 1030
1035 Arg Glu Phe Trp Val Met Asn Thr Ser Ile Gln Ser Thr
Ile Ile 1040 1045 1050
Leu Leu Ile Glu Gln Ile Val Val Ala Leu Gly Gly Glu Phe Lys 1055
1060 1065 Leu Tyr Leu Pro Gln
Leu Ile Pro His Met Leu Arg Val Phe Met 1070 1075
1080 His Asp Asn Ser Pro Gly Arg Ile Val Ser
Ile Lys Leu Leu Ala 1085 1090 1095
Ala Ile Gln Leu Phe Gly Ala Asn Leu Asp Asp Tyr Leu His Leu
1100 1105 1110 Leu Leu
Pro Pro Ile Val Lys Leu Phe Asp Ala Pro Glu Ala Pro 1115
1120 1125 Leu Pro Ser Arg Lys Ala Ala
Leu Glu Thr Val Asp Arg Leu Thr 1130 1135
1140 Glu Ser Leu Asp Phe Thr Asp Tyr Ala Ser Arg Ile
Ile His Pro 1145 1150 1155
Ile Val Arg Thr Leu Asp Gln Ser Pro Glu Leu Arg Ser Thr Ala 1160
1165 1170 Met Asp Thr Leu Ser
Ser Leu Val Phe Gln Leu Gly Lys Lys Tyr 1175 1180
1185 Gln Ile Phe Ile Pro Met Val Asn Lys Val
Leu Val Arg His Arg 1190 1195 1200
Ile Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile Val Lys
1205 1210 1215 Gly Tyr
Thr Leu Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr Gln 1220
1225 1230 His Arg Met Leu Arg Ser Gly
Gln Gly Asp Ala Leu Ala Ser Gly 1235 1240
1245 Pro Val Glu Thr Gly Pro Met Lys Lys Leu His Val
Ser Thr Ile 1250 1255 1260
Asn Leu Gln Lys Ala Trp Gly Ala Ala Arg Arg Val Ser Lys Asp 1265
1270 1275 Asp Trp Leu Glu Trp
Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys 1280 1285
1290 Asp Ser Ser Ser Pro Ser Leu Arg Ser Cys
Trp Ala Leu Ala Gln 1295 1300 1305
Ala Tyr Asn Pro Met Ala Arg Asp Leu Phe Asn Ala Ala Phe Val
1310 1315 1320 Ser Cys
Trp Ser Glu Leu Asn Glu Asp Gln Gln Asp Glu Leu Ile 1325
1330 1335 Arg Ser Ile Glu Leu Ala Leu
Thr Ser Gln Asp Ile Ala Glu Val 1340 1345
1350 Thr Gln Thr Leu Leu Asn Leu Ala Glu Phe Met Glu
His Ser Asp 1355 1360 1365
Lys Gly Pro Leu Pro Leu Arg Asp Asp Asn Gly Ile Val Leu Leu 1370
1375 1380 Gly Glu Arg Ala Ala
Lys Cys Arg Ala Tyr Ala Lys Ala Leu His 1385 1390
1395 Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro
Thr Pro Ala Ile Leu 1400 1405 1410
Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln Gln Pro Glu Ala
1415 1420 1425 Ala Ala
Gly Val Leu Glu Tyr Ala Met Lys His Phe Gly Glu Leu 1430
1435 1440 Glu Ile Gln Ala Thr Trp Tyr
Glu Lys Leu His Glu Trp Glu Asp 1445 1450
1455 Ala Leu Val Ala Tyr Asp Lys Lys Met Asp Thr Asn
Lys Asp Asp 1460 1465 1470
Pro Glu Leu Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly 1475
1480 1485 Glu Trp Gly Gln Leu
His Gln Gln Cys Cys Glu Lys Trp Thr Leu 1490 1495
1500 Val Asn Asp Glu Thr Gln Ala Lys Met Ala
Arg Met Ala Ala Ala 1505 1510 1515
Ala Ala Trp Gly Leu Gly Gln Trp Asp Ser Met Glu Glu Tyr Thr
1520 1525 1530 Cys Met
Ile Pro Arg Asp Thr His Asp Gly Ala Phe Tyr Arg Ala 1535
1540 1545 Val Leu Ala Leu His Gln Asp
Leu Phe Ser Leu Ala Gln Gln Cys 1550 1555
1560 Ile Asp Lys Ala Arg Asp Leu Leu Asp Ala Glu Leu
Thr Ala Met 1565 1570 1575
Ala Gly Glu Ser Tyr Ser Arg Ala Tyr Gly Ala Met Val Ser Cys 1580
1585 1590 His Met Leu Ser Glu
Leu Glu Glu Val Ile Gln Tyr Lys Leu Val 1595 1600
1605 Pro Glu Arg Arg Glu Ile Ile Arg Gln Ile
Trp Trp Glu Arg Leu 1610 1615 1620
Gln Gly Cys Gln Arg Ile Val Glu Asp Trp Gln Lys Ile Leu Met
1625 1630 1635 Val Arg
Ser Leu Val Val Ser Pro His Glu Asp Met Arg Thr Trp 1640
1645 1650 Leu Lys Tyr Ala Ser Leu Cys
Gly Lys Ser Gly Arg Leu Ala Leu 1655 1660
1665 Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp
Pro Ser Arg 1670 1675 1680
Gln Leu Asp His Pro Leu Pro Thr Val His Pro Gln Val Thr Tyr 1685
1690 1695 Ala Tyr Met Lys Asn
Met Trp Lys Ser Ala Arg Lys Ile Asp Ala 1700 1705
1710 Phe Gln His Met Gln His Phe Val Gln Thr
Met Gln Gln Gln Ala 1715 1720 1725
Gln His Ala Ile Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu
1730 1735 1740 His Lys
Leu Met Ala Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln 1745
1750 1755 Leu Asn Leu Gln Gly Ile Asn
Glu Ser Thr Ile Pro Lys Val Leu 1760 1765
1770 Gln Tyr Tyr Ser Ala Ala Thr Glu His Asp Arg Ser
Trp Tyr Lys 1775 1780 1785
Ala Trp His Ala Trp Ala Val Met Asn Phe Glu Ala Val Leu His 1790
1795 1800 Tyr Lys His Gln Asn
Gln Ala Arg Asp Glu Lys Lys Lys Leu Arg 1805 1810
1815 His Ala Ser Gly Ala Asn Ile Thr Asn Ala
Thr Thr Ala Ala Thr 1820 1825 1830
Thr Ala Ala Thr Ala Thr Thr Thr Ala Ser Thr Glu Gly Ser Asn
1835 1840 1845 Ser Glu
Ser Glu Ala Glu Ser Thr Glu Asn Ser Pro Thr Pro Ser 1850
1855 1860 Pro Leu Gln Lys Lys Val Thr
Glu Asp Leu Ser Lys Thr Leu Leu 1865 1870
1875 Met Tyr Thr Val Pro Ala Val Gln Gly Phe Phe Arg
Ser Ile Ser 1880 1885 1890
Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu Arg Val Leu Thr 1895
1900 1905 Leu Trp Phe Asp Tyr
Gly His Trp Pro Asp Val Asn Glu Ala Leu 1910 1915
1920 Val Glu Gly Val Lys Ala Ile Gln Ile Asp
Thr Trp Leu Gln Val 1925 1930 1935
Ile Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu Val
1940 1945 1950 Gly Arg
Leu Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His 1955
1960 1965 Pro Gln Ala Leu Ile Tyr Pro
Leu Thr Val Ala Ser Lys Ser Thr 1970 1975
1980 Thr Thr Ala Arg His Asn Ala Ala Asn Lys Ile Leu
Lys Asn Met 1985 1990 1995
Cys Glu His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser 2000
2005 2010 Glu Glu Leu Ile Arg
Val Ala Ile Leu Trp His Glu Met Trp His 2015 2020
2025 Glu Gly Leu Glu Glu Ala Ser Arg Leu Tyr
Phe Gly Glu Arg Asn 2030 2035 2040
Val Lys Gly Met Phe Glu Val Leu Glu Pro Leu His Ala Met Met
2045 2050 2055 Glu Arg
Gly Pro Gln Thr Leu Lys Glu Thr Ser Phe Asn Gln Ala 2060
2065 2070 Tyr Gly Arg Asp Leu Met Glu
Ala Gln Glu Trp Cys Arg Lys Tyr 2075 2080
2085 Met Lys Ser Gly Asn Val Lys Asp Leu Thr Gln Ala
Trp Asp Leu 2090 2095 2100
Tyr Tyr His Val Phe Arg Arg Ile Ser Lys Gln Leu Pro Gln Leu 2105
2110 2115 Thr Ser Leu Glu Leu
Gln Tyr Val Ser Pro Lys Leu Leu Met Cys 2120 2125
2130 Arg Asp Leu Glu Leu Ala Val Pro Gly Thr
Tyr Asp Pro Asn Gln 2135 2140 2145
Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu Gln Val Ile
2150 2155 2160 Thr Ser
Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly Ser Asn 2165
2170 2175 Gly His Glu Phe Val Phe Leu
Leu Lys Gly His Glu Asp Leu Arg 2180 2185
2190 Gln Asp Glu Arg Val Met Gln Leu Phe Gly Leu Val
Asn Thr Leu 2195 2200 2205
Leu Ala Asn Asp Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln 2210
2215 2220 Arg Tyr Ala Val Ile
Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly 2225 2230
2235 Trp Val Pro His Cys Asp Thr Leu His Ala
Leu Ile Arg Asp Tyr 2240 2245 2250
Arg Glu Lys Lys Lys Ile Leu Leu Asn Ile Glu His Arg Ile Met
2255 2260 2265 Leu Arg
Met Ala Pro Asp Tyr Asp His Leu Thr Leu Met Gln Lys 2270
2275 2280 Val Glu Val Phe Glu His Ala
Val Asn Asn Thr Ala Gly Asp Asp 2285 2290
2295 Leu Ala Lys Leu Leu Trp Leu Lys Ser Pro Ser Ser
Glu Val Trp 2300 2305 2310
Phe Asp Arg Arg Thr Asn Tyr Thr Arg Ser Leu Ala Val Met Ser 2315
2320 2325 Met Val Gly Tyr Ile
Leu Gly Leu Gly Asp Arg His Pro Ser Asn 2330 2335
2340 Leu Met Leu Asp Arg Leu Ser Gly Lys Ile
Leu His Ile Asp Phe 2345 2350 2355
Gly Asp Cys Phe Glu Val Ala Met Thr Arg Glu Lys Phe Pro Glu
2360 2365 2370 Lys Ile
Pro Phe Arg Leu Thr Arg Met Leu Thr Asn Ala Met Glu 2375
2380 2385 Val Thr Gly Leu Asp Gly Asn
Tyr Arg Ile Thr Cys His Thr Val 2390 2395
2400 Met Glu Val Leu Arg Glu His Lys Asp Ser Val Met
Ala Val Leu 2405 2410 2415
Glu Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met Asp 2420
2425 2430 Thr Asn Thr Lys Gly
Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser 2435 2440
2445 Tyr Ser Ala Gly Gln Ser Val Glu Ile Leu
Asp Gly Val Glu Leu 2450 2455 2460
Gly Glu Pro Ala His Lys Lys Thr Gly Thr Thr Val Pro Glu Ser
2465 2470 2475 Ile His
Ser Phe Ile Gly Asp Gly Leu Val Lys Pro Glu Ala Leu 2480
2485 2490 Asn Lys Lys Ala Ile Gln Ile
Ile Asn Arg Val Arg Asp Lys Leu 2495 2500
2505 Thr Gly Arg Asp Phe Ser His Asp Asp Thr Leu Asp
Val Pro Thr 2510 2515 2520
Gln Val Glu Leu Leu Ile Lys Gln Ala Thr Ser His Glu Asn Leu 2525
2530 2535 Cys Gln Cys Tyr Ile
Gly Trp Cys Pro Phe Trp 2540 2545
522DNAArtificial SequenceDescription of Artificial Sequence Synthetic
N-terminal primer N1 5atgcttggaa ccggacctgc cg
22623DNAArtificial SequenceDescription of Artificial
Sequence Synthetic FATN domain primer C3 6tttggacaga tcctcagtga cct
23722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic extreme N1
primer 7atgcttggaa ccggacctgc cg
22818DNAArtificial SequenceDescription of Artificial Sequence
Synthetic C1 primer 8ttaccagaaa gggcacca
18997DNAHomo sapiensAmplified fragment from PCR of
human MCF7, Hek293 and HEP2G cell lines 9atgcttggaa ccggacctgc
cgccgccacc accgctgcca ccacatctag caatgtgagc 60gtcctgcaga agaaggtcac
tgaggatctg tccaaaa 971032PRTHomo
sapiensTranslated sequence of Amplified fragment from PCR of human
MCF7, Hek293 and HEP2G cell lines 10Met Leu Gly Thr Gly Pro Ala Ala Ala
Thr Thr Ala Ala Thr Thr Ser 1 5 10
15 Ser Asn Val Ser Val Leu Gln Lys Lys Val Thr Glu Asp Leu
Ser Lys 20 25 30
116PRTArtificial SequenceDescription of Artificial Sequence Synthetic
6xHis tag 11His His His His His His1 5
User Contributions:
Comment about this patent or add new information about this topic: