HIGH EXPRESSION CEREAL PHYTASE GENE

Abstract

The present invention provides mutant cereal plants and mature grain thereof, characterised by enhanced levels of the enzyme phytase in the grain, and methods for inducing, detecting and selecting the mutant cereal plants. The invention further relates to animal feed comprising said grain having enhanced amounts of phytase.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a Continuation application of U.S. Ser. No. 14/110,763 filed Jan. 23, 2014, which is a 371 of international application of PCT/EP2012/057515 filed Apr. 25, 2012, which claims benefit of U.S. Provisional Application No. 61/479,689, filed Apr. 27, 2011, which is herein incorporated by reference in its entirety.

TECHNICAL FIELD OF THE INVENTION

[0002] The present invention relates to mutant cereal plants and mature grain thereof, characterised by an enhancer polynucleotide capable of directed enhanced expression of a operably-linked gene, in particular a operably-linked gene encoding the enzyme phytase, causing enhanced levels of phytase in the grain. The invention further relates to animal feed comprising said cereal grain having enhanced amounts of phytase.

BACKGROUND DESCRIPTION OF THE INVENTION

[0003] Phytases (myo-inositol hexakisphosphate phosphohydrolase) [EC 3.1.3.26 and EC 3.1.3.8] are phosphatases that initiate the sequential liberation of orthophosphate groups from phytate (InsP6, myo-inositol 1,2,3,4,5,6-hexakisphosphate), providing phosphate, inositol phosphates and inositol required for a range of cellular activities (Brinch-Pedersen et al., 2002). A number of enzymes with phytase activity are known from plants, animals and microorganisms (Dvorakova, 1998).

[0004] Phytases are of particular importance during seed germination where they mobilize phosphate from phytate, the major reserve of phosphorus (P) in plant seeds accounting for .about.70% of the total P (Lott, 1984). Different plant species have developed various strategies for phytase mediated degradation of phytate during germination. Among cereals, barley (Hordeum vulgare L.), wheat (Triticum aestivum and durum L.) and rye (Secale cereale L.) synthesize and accumulate phytase during grain development and the mature seed has a significant level of preformed phytase activity. Levels of phytase activity of 582, 1193 and 5130 U kg.sup.-1 have been detected in mature grain of barley, wheat and rye respectively (Eeckhout and de Paepe, 1994). Preformed phytase catalyses the first wave of phytate hydrolysis during early germination. Other cereals possess little (maize (Zea mays L.) .about.41 U kg.sup.-1) or close to no (rice (Oryza sativa L.)) preformed phytase activity in the mature seed and depend entirely on de novo synthesis during germination (Eeckhout and de Paepe, 1994).

[0005] The spatial and temporal regulation of phytase biosynthesis in plant seeds has profound effects on phosphate bioavailability when dry grains are used as food and feed. Monogastric animals such as pigs, poultry and humans have little or no phytase activity in their digestive tracts and thus depend on either a phosphate supplement or on the presence of the enzyme phytase in their diet, in order to meet their nutritional phosphate requirements. In most cases the amount of preformed phytase activity in mature cereal grain is not sufficient to ensure sufficient phytate degradation when included in animal feed. As a consequence, most of the cereal grain phytate consumed by an animal is excreted, thereby adding to the phosphate load on the environment which can be massive in areas with intense livestock production. One current solution to this problem has been to supplement animal feed, on a large scale, with inorganic phosphate, in order to meet an animal's need for phosphate. However, this solution can only continue in the short term since phosphate is a non-renewable resource, which will be depleted within a few decades. An alternative solution relies on the addition of phytase enzyme, in particular microbial-derived phytase, to feed intended for intense pig and poultry production. It has become common practise to include the enzyme phytase in pre-mixes for addition to animal fodder, and animal fodder, which is an additional cost factor. Thus there exists a need for alternative cheaper methods for enhancing the bioavailability of phosphate in cereals used for animal feed.

[0006] A DNA sequence comprising a coding sequence for wheat phytase has been deposited in GenBank (AX298209). Patent application (WO2001/083763A2) describes said wheat phytase as a 66 kDa PAPhy with the same temperature and pH optima as PHYI (Rasmussen et al., 2004), and describes the production of transgenic wheat plants comprising said coding sequence.

SUMMARY OF THE INVENTION

[0007] According to a first embodiment, the present invention provides a mutant cereal plant comprising a polynucleotide selected from any one of:

[0008] a. ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2] wherein V is any nucleotide other than T, more preferably where V is C or G,

[0009] b. polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 5, 6, 14, 15 and 44,

[0010] c. polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 1, 5, 6, 14, 15 and 44, wherein said polynucleotide is operably linked to a second polynucleotide encoding a polypeptide, wherein said polynucleotide is capable of enhancing gene expression in a grain of said plant, and, and wherein said cereal is selected from Avena L species, Hordeum L species; Oryza L species; Secale L species; Sorghum L species; Triticum aestivum, Triticum durum; Triticum spelta and Zea species.

[0011] In a further embodiment, the polypeptide of the mutant cereal plant is phytase [EC 3.1.3.26 and EC 3.1.3.8] and has myo-inositol hexakisphosphate phosphohydrolase activity.

[0012] Further to the first embodiment according to (a), the genomic DNA of the mutant cereal plant comprises a first polynucleotide located 5' upstream of a second polynucleotide, and operably-linked to the second polynucleotide, wherein said first polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], and wherein said second polynucleotide encodes a phytase polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity.

[0013] Further to the above embodiments, the mutant cereal plant is selected from Avena sativa, (Oats); Hordeum vulgare (Barley); Oryza sativa (rice); Secale cereale (Rye); Sorghum bicolor; Triticum aestivum, Triticum durum, Triticum spelta (wheat species); Zea mays (maize).

[0014] Further to the above embodiments, the mutant cereal plant is a Triticum spp., and the phytase polypeptide has an amino acid sequence having at least 70% sequence identity to a sequence selected from SEQ ID NO: 18, 20, and 22.

[0015] Further to the above embodiments, the mutant cereal plant is a Secale spp., and the phytase polypeptide has an amino acid sequence having at least 70% sequence identity to a sequence selected from SEQ ID NO: 26 or 28.

[0016] Further to the above embodiments, the mutant cereal plant is a Hordeum spp., and the phytase polypeptide has an amino acid sequence having at least 70% sequence identity to a sequence selected from SEQ ID NO: 30.

[0017] Further to the above embodiments, the mutant cereal plant is selected from a mutant of Triticum aestivum having Deposit No: PTA-11732 [TaHighPhy 01], and PTA-11731 [TaHighPhy 02]; and a mutant of Secale cereale having Deposit No PTA-11730 [ScHighPhy 01], said plants being deposited with ATCC Patent Depository, 10801 University Blvd., Manassas, Va. 20110,

[0018] Further to the above embodiments, the mutant cereal plant is a grain.

[0019] According to a second embodiment, the invention provides a plant part (e.g. grain or caryopsis) derived from a mutant cereal plant of the first embodiment or further embodiments of the invention.

[0020] According to a third embodiment, the invention teaches the use of grain derived from a mutant cereal plant according to the first or further embodiments of the invention, for the manufacture of a composition, wherein said composition is any one of: a milled grain composition; animal fodder; and steam-pelleted animal fodder.

[0021] According to a fourth embodiment, the invention provides a composition comprising a mutant cereal plant according to the first or further embodiments of the invention, wherein said composition is any one of: a milled grain composition; animal fodder and steam-pelleted animal fodder.

[0022] According to a fifth embodiment, the invention teaches a use of a composition, comprising a mutant cereal plant, according to the fourth embodiment as animal fodder.

[0023] According to a sixth embodiment, the invention teaches a method for detecting a mutant cereal plant, said plant comprising a polynucleotide selected from one of:

[0024] a) ACA VGA GTC ATG CAT [SEQ ID NO: 1];

[0025] b) a polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 5, 6, 12, 14 and 15, and

[0026] c) polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 1, 5, 6, 12, 14 and 15, wherein said polynucleotide is operably linked to a second polynucleotide encoding a polypeptide, and wherein said polynucleotide is capable of enhancing gene expression in a grain of said plant, comprising the steps of: (i) isolating genomic DNA from said plant, and (ii) detecting the presence of the nucleotide V at the 5' end of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], wherein said polynucleotide is comprised in said genomic DNA.

[0027] According to a seventh embodiment, the invention teaches a method for inducing and selecting a mutant cereal plant, said plant comprising a polynucleotide selected from one of:

TABLE-US-00001 [SEQ ID NO: 1] a) ACA VGA GTC ATG CAT;



[0028] b) a polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 5, 6, 12, 14 and 15, and

[0029] c) polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 1, 5, 6, 12, 14 and 15, wherein said polynucleotide is operably linked to a second polynucleotide encoding a polypeptide, and wherein said polynucleotide is capable of enhancing gene expression in a grain of said plant, comprising the steps of: (i) treating a cereal plant, or plant part thereof, with a chemical mutagen; (ii) growing and/or multiplying the treated plant, or plant part; (iii) isolating genomic DNA from said plant or progeny thereof, and (d) detecting the presence of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], wherein said polynucleotide is comprised in said genomic DNA.

[0030] Further to the sixth or seventh embodiments, the genomic DNA comprises a first polynucleotide located 5' upstream of and operably-linked to a second polynucleotide, wherein the first polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], and wherein the second polynucleotide encodes a phytase polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity.

[0031] Further to the sixth or seventh embodiments, the cereal is selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum monococcum; and Zea spp.

[0032] Further to the sixth or seventh embodiments, the cereal is selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum monococcum; and Zea spp, and the amino acid sequence of the phytase polypeptide has at least 70% sequence identity to a sequence selected from SEQ ID NO: 18, 20, 22, 24, 26, 28, and 30.

[0033] Further to the sixth or seventh embodiments, the cereal is selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum monococcum; and Zea spp, and the amino acid sequence of the phytase polypeptide has at least 70% sequence identity to a sequence selected from SEQ ID NO: 18, 20, 22, 24, 26, 28, and 30, wherein said polypeptide is encoded by a polynucleotide having a nucleotide sequence having at least 70% sequence identity to a sequence selected from SEQ ID NO: 17, 19, 21, 23, 25, 27, 29, and nucleotides 2091-4090 of 45, respectively.

DETAILED DESCRIPTION OF THE INVENTION

[0034] Listing of the figures:

[0035] FIG. 1. Phytase activity in mature whole grain derived from 52 individual lines of wheat (Triticum aestivum).

[0036] FIG. 2. Phytase activity in mature whole grain, bran and endosperm fractions of grain derived from 52 individual lines of wheat (Triticum aestivum).

[0037] FIG. 3. Cartoon showing the exon-intron structure of a TaPAPhy a1 gene isolated from Triticum aestivum cv Skagen (TaG2) corresponding to SEQ ID NO: 45.

[0038] FIG. 4. Pair wise comparison of the nucleotide sequence of the 1000 bp 5'flanking promoter region of phytase genes amplified from 9 T. aestivum cultivars and the corresponding promoter region from two HighPhy T. aestivum cultivars. The upper comparison counts differences, whereas the lower comparison shows the identity in percent.

[0039] FIG. 5. Pair wise comparison of the nucleotide sequence of the 288 bp 5'flanking promoter region of phytase genes amplified from eight T. aestivum cultivars, two T. tauschii accession lines (NGB90403; NGB9855), and the corresponding promoter regions from two HighPhy T. aestivum cultivars. The upper comparison counts differences, whereas the lower comparison shows the identity in percent.

[0040] FIG. 6. Multiple alignment of the start codon and 288 bp 5' flanking promoter region 7 T. aestivum cultivars (cv Skagen; cv Bob White; cv Pentium; cv Flair; cv landrace 01; cv Landrace 02; cv Spelt, which share SEQ ID NO: 7), two T. tauschii accession lines (NGB90403; NGB9855, which share SEQ ID NO: 8), and the corresponding promoter regions from two HighPhy T. aestivum lines (HighPhy 01; HighPhy 02 which share SEQ ID NO: 5). The 5'flanking promoter region of the T. aestivum cv Skagen is represented by both the lambda clone TaG2 and a PCR amplicon, with SEQ ID NO: 7. The enhancer sequence [ACA CGA GTC ATG CAT] in the HighPhy 01 and 02 cultivars is located a position: -247 to -237 in the 5' flanking region. Note that SEQ ID NO: 5, 7 and 8 are identical to the corresponding sequences in FIG. 6, but with the exception that the last 3 nucleotides (ATG) of each corresponding sequence in FIG. 6 are excluded from the sequence given in the SEQ ID NO listing.

[0041] FIG. 7. Multiple alignment of the start codon and 5'flanking promoter region 5 wild type T. aestivum cultivars (TaPAPhy_a1: NormPhy [SEQ ID NO: 9]; TaPAPhy_a3 [SEQ ID NO: 10], TaPAPhy_a4 [SEQ ID NO: 11]; TaPAPhy_a5; TaPAPhy_a6) and the corresponding promoter region from a High Phytase T. aestivum line (TaPaPhy_a1: HighPhy [SEQ ID NO: 6]). The 5'flanking promoter region of the T. monococcum (TmPAPhy_a1 [SEQ ID NO: 12]); Hordeum vulgare (HvPAPhy_a1 [SEQ ID NO: 13]) and high and normal phytase Secale cereale (ScPAPhy_a1 HighPhy [SEQ ID NO: 15]) and (ScPAPhy_a1 NormPhy [SEQ ID NO: 16]). Note that SEQ ID NO: 6, 9, 10, 11, 13, 13, 15 and 16 are identical to the corresponding sequences in FIG. 7, but with the exception that that the last 3 nucleotides (ATG) of each corresponding sequence in FIG. 6 excluded from the sequence given in the SEQ ID NO listing.

[0042] The nucleotide sequence of the polynucleotides comprised within the NormalPhy element and the HighPhy enhancer element are included in the alignment.

[0043] FIG. 8. Phytase activity in mature whole grain derived from 5 individual lines of rye (Secale cereale). One line (LPP03) has low phytase activity and 4 lines have medium to high phytase activity.

[0044] FIG. 9. Phytase activities in Bob White wild type (BW) and HighPhy T. aestivum (HIGHPHY) wheat flour after 0, 10, 20 and 40 min of incubation at 80.degree. C. in 100% relative humidity.

[0045] FIG. 10. Phytase activities in HighPhy Secale cereale (rye) flour after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of incubation at 80.degree. C. in 100% relative humidity.

[0046] FIG. 11. Phytate content in Bob White wild type (BW) and HighPhy T. aestivum (HIGHPHY) wheat dough during the fermentation

[0047] FIG. 12. Percentage residual phytate in flour of Bob White wild type and HighPhy T. aestivum (HIGHPHY) wheat after 0.5, 1, 1.5, 2 and 3 hrs of fermentation.

[0048] FIG. 13. UPGMA tree of the HIGHPHY and TaPAPhy_a1, _a2 and a_3 genes.

ABBREVIATIONS

[0049] AS-PCR: Allele specific--polymerase chain reaction; CTP: cytosine 5'-triphosphate; dNTP: Deoxynucleotide Triphosphate; PAPhy: Purple acid phosphates (PAP) with phytase activity; also called PAP phytases

(PAPhy);

[0050] Pfu: plaque forming units; SNP: single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide (A, T, C, or G) in the genome differs between members of a species or paired chromosomes in an individual 1.times.SSPE buffer: 150 mM Sodium Chloride, 10 mM Sodium Hydrogen Phosphate, 1 mM EDTA, pH 7.4); SPP: species; V: is the nucleotide A or C or G (not T), where B is the nucleotide in the complementary sequence.

DEFINITIONS

[0051] Cereal: A plant belonging to the Poaceae family, in particular a plant belonging to the Genus and species thereof: Avena L (e.g. Avena sativa, Oats); Hordeum L e.g. Hordeum vulgare, Barley); Oryza L (e.g. Oryza sativa, rice); Secale L (e.g. Secale cereale, Rye); Sorghum L (e.g. Sorghum bicolor); Triticum (e.g. Triticum aestivum, Triticum durum; Triticum monococcum, Triticum spelta, wheat); Zea (e.g. Zea mays, maize). Promoter operably-linked to a gene: a promoter is a DNA molecule that is located on the same DNA strand and upstream (towards the 5' region of the sense strand) of the transcriptional start site of a down-stream gene, where the operational function of the promoter is to regulate the expression of the down-stream gene to which it is operably-linked. DNA molecules, whose function is to regulate expression of a down-stream gene, typically comprise a smaller DNA molecule that acts as an "enhancer", the enhancer serving to modulate expression levels of the down-stream gene. An "Enhancer" is characterised by a conserved nucleotide sequence, often comprising various conserved sequence motifs whose function is to modulate gene expression levels. A gene is defined to include a polynucleotide molecule comprising coding and optionally non-coding sequence(s), the coding sequence(s) encoding a polypeptide, e.g. phytase. Triticum aestivum: line of T. aestivum, cultivar of T. aestivum is a cultivated variety of T. aestivum that has been created or selected intentionally for specific desirable characteristics and maintained through cultivation. Sequence identity: Identity can be measured as percent identity. The term "percent sequence identity" indicates a quantitative measure of the degree of homology between two nucleotide sequences of equal length. When the two sequences to be compared are not of equal length, they are aligned to give the best possible fit, by allowing the insertion of gaps or, alternatively, truncation at the ends of the nucleotide sequences. The (Nref-Ndlf)100 can be calculated as <Nref>, wherein Nd[iota]f is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. The percent sequence identity between one or more sequence may also be based on alignments using the clustalW software (http://www.ebi.ac.uk/clustalW/index.html).

DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

[0052] It is recognised that, in most cases, the amount of preformed phytase activity in mature cereal grain is not sufficient to ensure sufficient phytate degradation when included in animal feed. It is further recognised that bread dough having a low phytate content has superior mixing properties, and the resulting bread has a higher nutritional value, due to an enhanced availability of minerals, including inorganic phosphate. One solution to this problem has been to produce genetically modified cereal plants having higher levels of phytase in the grain, for example by expressing a transgene encoding a heterologous or homologous gene encoding phytase. Current agricultural policy in many parts of the world, in particular Europe, has restricted the growth of transgenic crop plants. Furthermore, organic farming, based on methods that are internationally regulated and legally enforced by many nations, are not certified to use genetically modified plants or feed enzymes derived from microbial phytases. Accordingly, there remains a need for non-transgenic plants producing grain having a high phytase phenotype. The present invention addresses this need.

I. A Polynucleotide Acting as an Enhancer of Grain-Specific Gene Expression in Mutant Cereal Plant

[0053] One embodiment of the invention provides a mutant cereal plant whose genome comprises an enhancer polynucleotide having the nucleotide sequence:

TABLE-US-00002 [SEQ ID NO: 1] ACA VGA GTC ATG CAT, or [SEQ ID NO: 2] T AGA ACA VGA GTC ATG CAT,

wherein said polynucleotide is capable of enhancing grain-specific gene expression. The enhancer polynucleotide comprises a mutation whereby the nucleotide V is any nucleotide other than T (i.e. C or G or A), as compared to the corresponding polynucleotide in a wild type cereal plant having normal wild type levels of phytase (e.g. the enhancer in the wild type normal phytase polynucleotide ACA TGA GTC ATG CAT [SEQ ID NO: 3] from wheat). In a preferred embodiment, the enhancer polynucleotide has SEQ ID NO: 1, wherein the nucleotide residue designated as V, is either G or C.

[0054] A series of four overlapping motifs have been identified in the polynucleotide having the sequence:

TABLE-US-00003 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA

which comprises the enhancer of the wild type wheat phytase gene. These motifs include an "odd base palindrome sequence" and a "GCN4 motif", a "skn-1 motif" and a "palindomic RY-repeat". The odd base palindrome and GCN4 motif have been shown to interact with Opaque2, a maize basic leucine zipper (bZIP) transcription factor that is involved in the regulation of seed storage protein expression [3,4], whereas the RY-repeat has been shown to interact with transcription factors containing the B3 domain.

[0055] Cereal plants comprising the mutant enhancer polynucleotide, show enhanced grain-specific expression of an operably-linked gene located down-stream of the enhancer polynucleotide, indicating that the mutant polynucleotide acts to regulate enhanced gene expression in a tissue-specific manner. Proteins encoded by the operably-linked gene, whose expression in cereal plants is regulated by a structurally- and operably-linked upstream promoter polynucleotide molecule comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, accumulate enhanced levels of the encoded protein in the grain when compared to wild-type cereal plants having the wild-type enhancer sequence (see Example 1 and 7).

[0056] The enhancer polynucleotide according to the invention is further characterised by an altered expression pattern of its operably-linked gene in the grain. The enhancer causes both increased gene expression throughout the grain, but also preferential expression in the endosperm tissue of the grain, which constitutes the majority of the grain as measured by weight (Example 1 and 13). The enhanced gene expression leads to enhanced levels of the gene-encoded proteins in the endosperm of the grain, having the advantage that down-stream grain processing steps, such a dehusking/milling does not lead to a loss the protein as is the case for proteins expressed in the aleurone tissue, and outer layers/coat of the grain.

II. A Mutant Cereal Plant, Whose Genome has a Promoter Polynucleotide Comprising an Enhancer of Grain-Specific Gene Expression

[0057] A further embodiment of the invention provides a mutant cereal plant, whose genome comprises a promoter polynucleotide molecule, said molecule comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2. The mutant cereal plant of the invention is a member of the Poaceae family, preferably belonging to the Genus L, and Species (spp) thereof of the following: Avena L (e.g. Avena sativa); Hordeum L (e.g. Hordeum vulgare); Oryza L (e.g. Oryza sativa); Secale L (e.g. Secale cereale); Sorghum L (e.g. sorghum bicolor); Triticum spp selected from Triticum aestivum, Triticum durum, and Triticum spelta; and Zea (e.g. Zea mays).

[0058] In one example, the mutant cereal plant is a mutant Triticum aestivum, whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Triticum aestivum may comprise a promoter polynucleotide having SEQ ID NO: 5 or 6 or 44, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 2. Wheat plants comprising a promoter having SEQ ID NO: 5 or 6 show enhanced endosperm-specific expression of a operably-linked gene located down-stream of this promoter, indicating that the promoter acts to regulate enhanced gene expression in a tissue-specific manner. The corresponding promoter polynucleotide in wild-type Triticum aestivum cv's and Triticum tauschii that lack the enhancing properties of the mutant are provided as SEQ ID NO: 7, 10 and 11 and in 8 respectively.

[0059] In one example, the mutant cereal plant is a mutant Secale cereale whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Secale cereale may comprise a promoter polynucleotide having SEQ ID NO: 15, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 2. The corresponding promoter polynucleotide in wild-type Secale cereale that lacks the enhancing properties of the mutant is provided as SEQ ID NO: 16.

[0060] In one example, the mutant cereal plant is a mutant Hordeum vulgare whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Hordeum vulgare may comprise a promoter polynucleotide having SEQ ID NO: 14, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 1. The corresponding promoter polynucleotide in wild-type Hordeum vulgare that lacks the enhancing properties of the mutant is provided as SEQ ID NO: 13.

III. A Mutant Wheat Plant with High Phytase Grain

[0061] A further embodiment of the invention provides a mutant cereal plant comprising a promoter polynucleotide, said promoter comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, wherein said promoter polynucleotide lies upstream and is operably linked to a cognate phytase gene encoding a polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity (phytase [EC 3.1.3.26 and EC 3.1.3.8]). In one example, the cereal plant is a mutant Triticum aestivum plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 5 or 6, or 44, and the cognate phytase gene encodes a polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90, 95 or 98% sequence identity to a sequence selected from SEQ ID NO: 18, 20, and 22. In a further embodiment, said phytase polypeptide having an amino acid sequence selected from SEQ ID NO: 18, 20, and 22 is encoded by a polynucleotide having a nucleotide sequence that has at least 70, 75, 80, 85, 90, 95 or 98% sequence identity to a sequence selected from SEQ ID NO: 17, 19, 21, and 45 (nucleotides 2091-4090), respectively.

[0062] In one example, the cereal plant is a mutant Secale cereale plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 15, and the cognate phytase gene encodes a phytase polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90 or 95% sequence identity to a SEQ ID NO: 26 or 28. In a further embodiment, said phytase polypeptide having an amino acid sequence of SEQ ID NO: 26 or 28 is encoded by a polynucleotide having nucleotide sequence that has at least 70, 75, 80, 85, 90 or 95% sequence identity to SEQ ID NO: 25 or 27, respectively.

[0063] In one example, the cereal plant is a mutant Hordeum vulgare plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 14, and the cognate phytase gene encodes a phytase polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90 or 95% sequence identity to a SEQ ID NO: 30. In a further embodiment, said phytase polypeptide having an amino acid sequence of SEQ ID NO: 30 is encoded by a polynucleotide having nucleotide sequence that has at least 70, 75, 80, 85, 90 or 95% sequence identity to SEQ ID NO: 29.

III. Methods for Detecting a Cereal Germplasm Comprising the HighPhy SNP

[0064] The polynucleotide:

TABLE-US-00004 ACA.sup.VGAGTCATGCATG

in genomic DNA of a cereal plant e.g. Triticum spp, characteristic of the HighPhy SNP, can be detected using standard DNA analysis protocols (see Example 5). For example, amplification of genomic DNA comprising the HighPhy SNP with the forward TTTCAAGCTACACTTTGTAGAACAC [SEQ ID NO: 39] and reverse GCACTAGCCAAGTTTGGACG [SEQ ID NO: 40] primers will generate a 66 bp PCR product when using Taq polymerase, whereas amplification of genomic DNA comprising a "wildtype cereal" with wild-type levels of normal phytase will give a similar product with forward TTTCAAGCTACACTTTGTAGAACAT [SEQ ID NO: 41] and reverse GCACTAGCCAAGTTTGGACG [SEQ ID NO: 42] primers (where the second primer [SEQ ID NO: 42] is universal).

IV Methods for Inducing and Selecting Cereal Germplasm Comprising the HighPhy SNP

[0065] HighPhy cereals (e.g. Triticum spp) can be generated by mutagenesis and subsequent screening for individuals where the polynucleotide:

[0066] ACA TGA GTC ATG CAT, corresponding to the wild type (NormPhy) enhancer, in the cereal genome has been converted into the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT, where V can be A or C or G.

[0067] In one embodiment the mutagenesis is carried out with sodium azide which preferentially generates A:T to G:C substitutions in the cereal, barley (8). Screening mutagenized populations for the desired mutation could be done by allele specific polymerase chain reaction (AS-PCR), as described in Example 6.

[0068] In an alternative embodiment, mutagenesis is carried out on cereal grain using methylene Methyl Sulphonate (MMS) to generate a population of M1 plants with random point mutations in their genome. MMS treatment leads to errors during DNA replication and thus introduces mutations. Typically this means T/A nucleotides within a sequence are converted to G/C by transversion. The M1 plants are self-fertilised and the M2 seed harvested and sown. The M2 germplasm will allow recessive and lethal alleles to be recovered as heterozygotes. DNA is individually extracted from M2 plants into 96 well plates and their seed stored for further propagation. To increase throughput of analysis, the M2 DNA samples are 8.times. pooled and amplified, using gene specific primers, located up- and down-stream of the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT that is to be detected. Preferably each primer carries a different fluorescent label. For example, the forward strand may be labelled with FAM [5-Carboxyfluorescein; 3',6'-Dihydroxy-3-oxospiro[2-benzofuran-1,9'-xanthene]-5-carboxylic acid, CAS #: 76823-03-5] and the reverse strand with HEX [HEX being a hexa-chloro derivative of FAM]. In the presence of a mutant, the amplification products when heated and cooled will form mismatched heteroduplexes between the wild type and mutated DNA. To enable identification of the point mutations induced by EMS, the amplification products are incubated with a plant endonuclease called CEL I which preferentially cleaves at sites of heteroduplex mismatches that occur between wild-type and mutant DNA. The cleavage products are size-separated on a DNA sequencing instrument, for example a capillary DNA sequencer and the fluorescently labelled traces are analysed. The differential end-labelling of the amplification products permits the two cleavage fragments to be observed and to identify the position of the mismatch. When a mutation is detected in the pooled DNA, the DNA samples in the pool are individually sequenced to identify the specific plant carrying the mutation.

[0069] The amount of phytase enzyme in the grain of plants having the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT in their genome, is then determined to confirm that the selected mutant has the high phytase phenotype, for example by employing the phytase assay described in Example 1.

V Use of High-Phytase Cereal Grain for Producing a Composition

[0070] Processing of cereal grain (for example wheat of rye grain) having phytase activity in accordance with the present invention, is carried out using traditional processing steps including one or more of the following steps:

[0071] i. Cleaning/conditioning cereal grain: First the grain is cleaned. For example the grain may be passed through magnets and/or metal detectors to remove any metal contamination. Machines can be used to separate any other seeds, stones or dust that may have got mixed with the wheat.

[0072] ii. Gristing grain: The cleaned and conditioned grain is blended with other types of grain in different proportions to make different kinds of flour.

[0073] The gristed grain passes through special rollers called break rolls. They break each grain into its three parts: cereal grain germ, bran and endosperm. Sieves sift the three separated parts into different streams.

[0074] iii Mixing: The bran, germ and endosperm fractions, having been separated out, can optionally be blended, and can be milled to make different types of milled cereal grain composition, such as Wholemeal flour using all parts of the grain; Brown flour contains about 85% of the original grain, but with some bran and germ removed; and White flour is made from the endosperm only. A flour mix comprising flour prepared from high-phytase cereal grains of the invention has particular value for bread making, due to the rapid degradation of phytate during dough fermentation (see Example 12) that confers both improved dough mixing properties and enhances the nutritional value (by increasing mineral uptake from the diet, in particular zinc, iron, calcium and and inorganic phosphate ions) of the bread produced with the dough.

[0075] iv. Steam pelleting: Milled cereal grain composition may be combined with other fodder ingredients in a steam-pelleting machine, where the components are exposed to steam at a temperature of about 80.degree. C.-90.degree. C. for a period of time sufficient to reduce the microbial population to levels safe for animal consumption, and the product is converted to dried pellets. Steam pelleted animal feed prepared from HighPhy cereal grain of the invention retain sufficiently high levels of phytase activity following steam-treatment, that addition of supplementary phytase granules can be avoided.

VI A Composition Comprising High-Phytase Cereal Grain

[0076] In a further embodiment, the present invention provides animal fodder comprising grain derived from the mutant cereal plant of the present invention (for example a wheat, rye or barley high-phytase mutant), where the grain are characterized by enhanced levels of phytase. Animal fodder comprising grain from the mutant wheat plant have the advantage, that the need to supplement the fodder with phytase is considerably reduced and preferably avoided, and at the same time the added high phytase cereal grain has the advantage that it is not classified as genetically modified material.

VII A Wild-Type Triticum aestivum Gene TaPAPhy_a1

[0077] In a further embodiment, the present invention provides an isolated full-length Triticum aestivum gene TaPAPhy_a1 (SEQ ID NO: 45), comprising a promoter sequence (SEQ ID NO: 7) and down-stream coding sequence comprising 5 exons and 4 introns (FIG. 3). Part, or all, of the isolated TaPAPhy_a1 gene can be used for the construction of gene constructs for transformation into wheat.

Example 1

Phytase Activity of Different Triticum aestivum Cultivars

[0078] 1.1 Comparative Levels of Total Phytase Enzymatic Activity in Mature Wheat Grain

[0079] The phytase activity was measured in mature seeds of 52 individual cultivars or lines of wheat (Triticum aestivum). Mature seeds were milled and protein was extracted from 0.250 g of flour by adding 2.5 ml 220 mM Na-acatete buffer (pH 5.5) including 68 mM CaCl.sub.2 and Tween 20 (100 mg/1). The suspension was vortexed for 1 hour at room temperature and subsequently centrifuged at 3000.times.g for 10 min. The supernatant was collected and assayed for phytase activity as described by Engelen et al., 1994 [1]. One phytase unit (U) is defined as 1 .mu.mol of Pi released upon phytate hydrolysis at 37.degree. C. at the enzymes pH optimum.

[0080] Phytase activity ranged from .about.650 to .about.1900 FTU/kg in grain from 50 of the wheat lines (FIG. 1). Similar levels of phytase activity have previously been reported [2], in 13 individual wheat lines. However in two lines, HIGHGPHY01 and HIGHPHY02, the level of phytase activity was .about.6000 FTU/kg and .about.4300 FTU/kg respectively, exceeding all other wheat lines analysed.

[0081] 2.2 Distribution of Phytase Enzymatic Activity in Mature Wheat Grain

[0082] The distribution of phytase activity between outer layers and endosperm tissues of wheat grain derived from HIGHPHY wheat lines and wild type wheat lines was determined. The wheat grain samples were milled and divided into outer bran and inner endosperm fractions. The phytase activities were measured in each fraction (FIG. 2). In wild-type wheat grains with a total activity on 1200 FTU/kg, phytase activity was mainly localised in the bran fraction with 3500 FTU/kg, while phytase activity in endosperm tissue was about .about.600 FTU/kg. A significantly different distribution was seen in HIGHPHY01 grain, where the activity in the endosperm was 6900 FTU/kg, exceeding the level of phytase activity in both bran (5300 FTU/kg) and whole grains (6300 FTU/kg).

Example 2

Isolation of a Wheat Phytase Gene

[0083] 2.1 Construction of a Genomic Library from Genomic DNA from Triticum aestivum, Cv Skagen:

[0084] A genomic library of DNA extracted from Triticum aestivum, cultivar Skagen, was generated using the Lambda Fix II/Xho I Partial Fill-In Vector Kit (Agilent Technologies-Stratagene Products) according to the manufacturer's instructions. The initial library was titered and the size found to be 5.times.10.sup.6 pfu. Given the constraints of the vector, which will accommodate inserts of 9-23 kb, this corresponds to 45000-115000 Mb or 2.8-7.2 times the size of the wheat genome. The library was amplified on 150 120.times.120 mm NZY agar plates according to the manufacturer's instructions to achieve a final titer of 3.times.10.sup.6 pfu/.mu.L.

[0085] 2.2 Screening a Triticum aestivum, Cv Skagen Genomic Library for a Phytase Gene:

[0086] The amplified library was plated out on 240.times.240 mm NZY agar plates at a density of 600 pfu/cm.sup.2. Plaque lifts were performed with Hybond N+ membranes (GE Healthcare), and the DNA was fixed on the membrane by alkaline denaturation and UV cross linking. The membranes were prehybridized in 0.25 M sodium phosphate buffer, pH 7.2, with 7% SDS and 0.17 mg/mL salmon sperm DNA at 65.degree. C. for two hours in rolling tubes. The membranes were then hybridised in a solution comprising the radiolabelled Triticeae PAPhy specific Probe (20 microcuries), 0.25 M sodium phosphate buffer, pH 7.2, with 7% SDS at 65.degree. C. overnight. Preparation of the probe is set out below. Ten membranes were washed at a time for 15 min in the hybridization tubes at 65.degree. C. with 1.times.SSPE buffer followed by one wash for one hour at 65.degree. C. in 1 L 1.times.SSPE buffer and 10 seconds in room temperature 1.times.SSPE. Finally the membranes were blot dried on filter paper for 10 min and sealed in plastic envelopes.

[0087] X-ray films were exposed with the membranes at -80.degree. C., and the developed films subsequently analysed radiolabel signals. Positive clones were cut from the original plate and isolated by successive rounds of plaque screenings.

[0088] 2.3 a Triticeae PAPhy Phytase Gene Specific Probe:

[0089] A 20 .mu.Ci .sup.32P labelled probe was generated by PCR using [.alpha.P32]dCTP and the primers:

TABLE-US-00005 (SEQ ID NO: 31) PAP ex3 Fw: CTTGAGCCTGGGACGAAGT and (SEQ ID NO: 32) PAP ex3 Rv: GAGAAGGACCCGCTCTCC,

[0090] and a template consisting of a plasmid comprising a cDNA molecule whose nucleotide sequence encoded the wheat Purple Acid Phosphatase Phytase b (TaPAPhy_b). The primers amplified a portion of the cDNA molecule whose nucleotide sequence corresponds to the highly conserved third exon of the Triticeae PAPhy_b gene. The amplified sequence generated a DNA probe of 479 nucleotides in length. Remaining unincorporated dNTPs were removed with an Illustra MicroSpin G-50 Column (GE Healthcare). The probe was denaturated by boiling followed by shock cooling in 500 .mu.L of 10 .mu.g/.mu.L sonicated salmon sperm DNA.

[0091] 2.4 Isolation and Characterisation of Triticeae PAPhy Phytase Gene:

[0092] Isolated lambda (2) clones, selected by the Triticeae PAPhy specific probe, were amplified on five to twenty 82 mm diameter NZY agar plates and .lamda. DNA was isolated from the phage harvested from the plates using the Lambda midi kit (Qiagen) according to the manufacturer's instructions.

[0093] One isolated .lamda. clone, comprising the genomic DNA molecule designated TaG2, was sequenced (SEQ ID NO: 45) and found to comprise a polynucleotide comprising a 2000 bp promoter region having the sequence (SEQ ID NO: 43).

Example 3

Amplification and Characterization of Phytase Gene Promotors from Different Triticum aestivum and Triticum tauschii Cultivars

[0094] 3.1 Isolation of Phytase Gene Promoters by PCR

[0095] Genomic DNA was isolated from 10 cultivars of T. aestivum and 2 accessions of T. tauschii (also known as Ae. Tauschii), as shown in table 1.

TABLE-US-00006 TABLE 1 Cultivars and accessions from which the TaPAPhy_a1 promoter was amplified. Cultivar/accession Notes Bob White T. aestivum model cultivar Skagen T. aestivum commercial cultivar Flair T. aestivum commercial cultivar Spelt T. aestivum spp spelta commercial sample Pentium T. aestivum commercial cultivar Landrace 01 T. aestivum Landrace Landrace 02 T. aestivum Landrace HighPhy 01 Novel high phytase T. aestivum cultivar HighPhy 02 Novel high phytase T. aestivum cultivar NGB90403 T. tauschii NGB9855 T. tauschii

[0096] TaPAPhy_a1 promoter region was amplified from genomic DNA isolated from each of the above cultivars using primer pairs based on the sequence of the high phytase gene, designated, .lamda. clone: TaG2. The first primer pair was designed for amplifying the first exon and 2041 bp 5' upstream flanking region (promoter) of the TaPAPhy_a1 gene:

TABLE-US-00007 (SEQ ID NO: 33) TaPAPhy_a1-pro-ex1 Fw: TTATGTGTCCGCGTGAAGTG and (SEQ ID NO: 34) TaPAPhy_a1-pro-ex1 Rv: ACCAAGAGTCAATGCCATCC

[0097] An additional primer pair was designed to amplify a shorter sequence which includes 288 bp of the 5' flanking region (promoter) and 147 bp of the first exon of the TaPAPhy_a1 gene:

TABLE-US-00008 (SEQ ID NO: 35) TaPAPhy_a1 -311 cons Fw: TTTGGACGAGCCATAGCTGCATA and (SEQ ID NO: 36) TaPAPhy_a1 167 Rv: CGCTGCACCCGGGGGTCCGT

[0098] The latter primer pair was used with cultivars where the first primer pair failed to yield an amplification product.

[0099] PCR was performed with Herculase II (Agilent Technologies--Stratagene Products) according to the manufacturer's instructions, but with the modification that 6% DMSO was used in the reaction mixture.

[0100] Amplicons of the expected size were isolated from agarose gels and cloned in the pCR4Blunt TOPO vector (Invitrogen) and sequenced.

[0101] 3.2 Characterization of the Promoter Region of Isolated T. aestivum and T. tauschii Phytase Genes--Alignment of 1000 bp

[0102] The long PCR amplicon, (corresponding to 2041 bp 5' upstream flanking promoter region the first exon and of the TaPAPhy_a1 gene) was obtained from 10 cultivars of T. aestivum, whereas only the short amplicon (corresponding to 147 bp of the first exon and 288 bp of the 5' flanking promoter region of the TaPAPhy_a1 gene) was obtained from two accessions of T. tauschii. The 1000 bp 5'flanking region and start codon of each of the T. aestivum genes were aligned, and used for a pair wise comparison (see FIG. 4).

[0103] The T. aestivum PAPhy phytase gene (in .lamda. clone TaG2) and the PCR amplicon obtained from amplifying genomic DNA from the same cultivar, Skagen, had the same nucleotide sequence, and are included in FIG. 4. The nucleotide sequence of the 1000 bp 5'flanking promoter region of each of the T. aestivum genes share at least 99.7% identity, whereas the nucleotide sequence of the corresponding promoter regions from two HighPhy cultivars only share 97.7-98.1% sequence identity to the other T. aestivum genes. The nucleotide sequence of the promoter regions of the two HighPhy cultivars [SEQ ID NO: 5 and 6], however, share 99.8% sequence identity with each other, differing in nucleotide sequence by only two base pairs. A polynucleotide comprising a .about.2000 bp promoter region from the HighPhy cultivars, corresponding to the promoter region of the wild type T. aestivum PAPhy phytase gene, has the nucleotide sequence (SEQ ID NO: 44).

[0104] 3.3 Characterization of the Promoter Region of Isolated T. aestivum and T. tauschii Phytase Genes--Alignment of 288 bp

[0105] The 288 bp 5'flanking region and start codon of each of the T. aestivum genes together with the corresponding sequence from T. tauschii were aligned, and used for a pair wise comparison (FIG. 5).

[0106] The amplified 288 bp 5'flanking promoter region from each of: wild-type T. aestivum cultivars; HighPhy T. aestivum cultivars; and T. tauschii cultivars shared nucleotide sequence identity within each of the three groups. However, the nucleotide sequence of the promoter regions of the two HighPhy T. aestivum cultivars differs from the wild-type 9 T. aestivum cultivars in two nucleotides, and differs from the two T. tauschii cultivars in 3 nucleotides. In turn the nucleotide sequence of the promoter regions from the two T. tauschii cultivars differs from wild-type T. aestivum cultivars in 3 nucleotides.

[0107] It can be seen from the alignment in FIG. 6, that the 5'flanking promoter region of the two HighPhy T. aestivum cultivars [SEQ ID NO: 5] comprises a single nucleotide polymorphism (SNP) (-244 T.fwdarw.C), that is unique to these HighPhy cultivars, when compared to the wild type cultivars [SEQ ID NO: 7 and 8].

Example 4

Genomic Context of the SNP in HighPhy T. aestivum Cultivars

[0108] Sequence analyses of the immediate surroundings of the HighPhy SNP reveals sequence motifs known to be involved in gene regulation. Consider first the sequence found in wild type T. aestivum (wheat) cultivars (wt):

TABLE-US-00009 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA

[0109] It consists of four overlapping motifs:

[0110] In bold font, the odd base palindrome sequence reported by [3];

[0111] In enlarged font, GCN4 motif, involved in endosperm specific gene expression [4];

[0112] In italic font, the skn-1 motif reported by [5];

[0113] In underlined font, the palindomic RY-repeat identical to that reported by [6].

[0114] Note that the skn-1 and GCN4 motifs are contained within the odd base palindrome. The odd base palindrome and GCN4 motif have been shown to interact with Opaque2, a maize basic leucine zipper (bZIP) transcription factor involved in the regulation of seed storage proteins [3,4], whereas the RY-repeat has been shown to interact with transcription factors containing the B3 domain. It is known to be an enhancer of seed-specific expression and a repressor of vegetative expression in A. thaliana [7].

[0115] Consider now the sequence from the HighPhy T. aestivum cultivars:

TABLE-US-00010 ##STR00001##

[0116] The mutation, identified by the elevated "C", abolishes the odd base palindrome and the GCN4 motif, but leaves the skn-1 motif and the RY-repeat unchanged. A new motif, boxed, is thereby introduced. This motif shows similarity to the G-box CACGTG (1) but lacks the highly conserved palindromic nature of the G-box, and represents a completely novel motif, acting as a cis-acting regulatory element. This mutation, found in HighPhy T. aestivum cultivars, is either the result of the abolition of the odd base palindrome or the result of the introduction of the novel motif

Example 5

Method for Detecting the HighPhy SNP in the Genome of Cereal Plants

[0117] The SNP in the genome of a cereal plant that is located in a polynucleotide comprising the enhancer element having the nucleotide sequence

TABLE-US-00011 CGAGTCATGCATGGGA

was detected using the technique of "High Resolution Amplicon Melting Analysis" [10]. PCR was performed in 10 .quadrature.L volumes in a LightCycler (Roche Applied Systems) with programmed transitions of 20.degree. C./s unless otherwise indicated. The amplification mixture included 50 ng genomic DNA as template, 200 .quadrature.M each deoxynucleotide triphosphate (dNTP), 0.4 U KlenTaq1 polymerase (ABPeptides), 88 ng TaqStart antibody (ClonTech), 3 mM MgCl2, 50 mM Tris (pH 8.3), 500 ng/.quadrature.L bovine serum albumin, 0.5 .quadrature.M primers located upstream and downstream of the SNP and 1-10 .quadrature.M LCGreen, in order to amplify an polynucleotide of around 40-300 nucleotides in length. Melting analysis was performed on the LightCycler. After amplification, the samples are heated momentarily in the LightCycler to 94.degree. C. and cooled to 40.degree. C. The LightCycler capillary is then transferred to the high-resolution melting instrument and heated at 0.3.degree. C./s. Sample temperature and fluorescence signals are converted to 16-bit digital signals, which are then analysed to detect the SNP.

Example 6

Method for Inducing and Selecting Wheat Germplasm Comprising the HighPhy SNP and Grain with High Levels of the Enzyme Phytase

[0118] HighPhy wheat can be generated by mutagenesis and subsequent screening for individuals where the polynucleotide TGAGTCATGCATG, corresponding to the wild type (NormPhy) element, in the wheat genome has been converted into the mutant (HighPhy) element CGAGTCATGCATG. The mutagenesis is carried out with sodium azide which preferentially generates A:T to G:C substitutions in barley (8). Screening mutagenized populations for the desired mutation could be done by allele specific polymerase chain reaction (AS-PCR).

[0119] Procedure: Wheat grains are presoaked for 15 hours in demineralised water at 5.degree. C. and then treated with an oxygenated solution of 1 mM sodium azide at pH 3 for 2 hours. The grains are washed and sown out, and grown to mature plants. Genomic DNA is isolated from leaves of each individual plant before the plant begins to senesce, using a standard DNA extraction procedure [9], whereas grains are harvested at maturity. Grains from individual plants are kept apart and labelled so they can be matched with the corresponding DNA isolates. The DNA isolates are screened by AS-PCR using the following primer pair:

TABLE-US-00012 [SEQ ID NO: 37] HighPhy Fw: 5'CAAGCTACACTTTGTAGAACAC 3' [SEQ ID NO: 38] PAPhy Rv: 5'CGCTGCACCCGGGGGTCCGT 3'

[0120] The first 21 nucleotides of the HighPhy Fw primer anneal 5' to the HighPhy enhancer polynucleotide, whereas the 3'C nucleotide anneals to the actual SNP, this SNP being the distinguishing nucleotide between the HighPhy and NormPhy element polynucleotides. The PAPhy Rv primer anneals to a highly conserved part of the coding sequence of the PAPhy phytase gene, and can thus be expected to anneal to all known loci in the genome containing the wheat PAPhy phytase gene. The AS-PCR is performed using a non-proofreading polymerase to ensure specificity, and detection of the SNP. A series of replicate AS-PCR, using the HighPhy Fw primer and PAPhy Rv primer pair, are performed under conditions of increasing stringency (e.g. increasing PCR annealing temperature), on control genomic DNA samples isolated from HIGHPHY01 wheat grain of the invention and a wildtype NormPhy wheat plant. Under selected conditions of stringency, AS-PCR is then performed on DNA isolated from HighPhy mutation positive plants to amplify an amplicon of 300 to 700 bp in length, which can be identified by agarose gel electrophoresis, whereas plants lacking the HighPhy mutation will not produce an amplicon. The amplified product is then cloned and sequenced to confirm that the presence of the mutant (HighPhy) element CGAGTCATGCATG in the genomic DNA isolate. AS-PCR conditions that are sufficiently stringent to selectively amplify HighPhy mutation positive plants, are then employed to screen genomic DNA isolated from each individual mutagenized plant. Grain from HighPhy mutation positive plants can then be cultivated further to generate sufficient grain for subsequence breeding and crop production.

Example 7

Phytase Activity of Different Secale cereale Cultivars

[0121] 7.1 Comparative Levels of Total Phytase Enzymatic Activity in Mature Secale cereale (Rye) Grain

[0122] The phytase activity was measured in mature seeds of 5 individual cultivars rye, as described for seeds of Triticum aestivum, detailed in Example 1.1. Phytase activity ranged from .about.1600 to .about.6000 FTU/kg in grain from the 5 rye line (FIG. 8). In one line, LPPO3, the level of phytase activity was 1600 FTU/kg, which was lower than levels measured in the other 4 lines, of which one line had 6000 FTU/kg.

Example 8

Amplification and Characterization of Phytase Gene Promotors from Different Secale cereale and Hordeum vulgare Cultivars

[0123] 8.1 Isolation of Phytase Gene Promoters by PCR

[0124] Genomic DNA was isolated from Secale cereale and Hordeum vulgare cultivars and the phytase gene promoter was amplified by PCR as described in Example 3.1.

Example 9

Structural Characterisation of Cereal Phytase Enzymes and the Coding Sequence of their Cognate Genes

[0125] The promoter of the invention comprising an enhancer polynucleotide having SEQ ID NO: 1 or 2, is structurally and operably linked to a polynucleotide molecule comprising a coding sequence encoding a phytase enzyme. The polynucleotide molecule in the genome of a cereal plant encoding a phytase enzyme comprises a coding sequence (comprising one or more exon) and a non-coding sequence (comprising one or more intron). The amino sequence and the nucleotide sequence of the coding sequence encoding a phytase enzyme derived from the Triticum aestivum cv., (Ta); Secale cereale cv (Sc); and Hordeum vulgare cv., (Hv) are as follows:

[0126] TaPAPhy_a1 phytase (SEQ ID NO: 18) encoded by TaPAPhy_a1 cDNA (SEQ ID NO: 17);

[0127] TaPAPhy_a2 phytase (SEQ ID NO: 20) encoded by TaPAPhy_a2 cDNA (SEQ ID NO: 19);

[0128] TaPAPhy_a3 phytase (SEQ ID NO: 22) encoded by TaPAPhy_a3 cDNA (SEQ ID NO: 21);

[0129] TmPAPhy_a4 phytase (SEQ ID NO: 24) encoded by TmPAPhy_a4 cDNA (SEQ ID NO: 23);

[0130] ScPAPhy_a1 phytase (SEQ ID NO: 26) encoded by ScPAPhy_a1 cDNA (SEQ ID NO: 25);

[0131] ScPAPhy_a2 phytase (SEQ ID NO: 28) encoded by ScPAPhy_a1 cDNA (SEQ ID NO: 26);

[0132] HvPAPhy_a1 phytase (SEQ ID NO: 30) encoded by HvPAPhy_a1 cDNA (SEQ ID NO: 29);

[0133] The phytase enzyme in mutant HighPhy Triticum aestivum has an amino acid sequence similar to the phytase enzyme in wild type Triticum aestivum cv's Bobwhite and Skagen. Their amino acid sequences differ by the deletion of three amino acid residues and the substitution of three residues in the HighPhy cultivar when compared to cv's Bobwhite and Skagen, these differences being located within the 120 residue long signal peptide region at the amino-terminus. The substitutions are conservative, G.fwdarw.A and S.fwdarw.T.

Example 10

Stability of Phytase Activity in Wheat Flour Subjected to Steam Treatment

[0134] Animal feed comprising milled cereal grain, is commonly subjected to steam pelleting, which is a two-step process of conditioning followed by pelleting. During conditioning the milled feed is mixed and simultaneously heated to about 80.degree. C. and its moisture content is increased by exposure to steam. The experimental set up used in this example simulates the combination of heat and moisture used during conditioning.

[0135] The experimental setup consisted of a GFL 1083 water bath with a plastic tray floating on the surface of the water and occupying approximately half of the surface area of the water. A thermometer, placed inside the tray, was used to monitor the headspace temperature before and after incubation. The water bath was equipped with a thermostat and a lid so a constant temperature and steam-filled headspace with 100% relative humidity could be maintained. The water bath was set to 80.degree. C., and once this temperature was reached, it was allowed to equilibrate for one hour. The headspace temperature was found to be 80.degree. C. at this point.

[0136] Eight to nine grams of sample wheat grains were milled on a Retsch RM100 mortar grinder mill, and the resulting flour was distributed in weighing boats, 500 mg in each. The steam treatment consisted of incubating the weighing boats with samples on the plastic tray for various periods of time. The lid of the water bath remained closed for the duration of the incubation and the temperature of 80.degree. C. in the headspace was verified before and after each incubation. Following steam treatment, the wheat flour samples were dessicated overnight in an exicator with silica gel.

[0137] Once dried, the phytase activity of the wheat flour samples was assayed using the assay described by (Engelen, Vanderheeft, Randerheeft & Smidt, 1994 [1])

[0138] Two measurements, (A) and (B), of phytase activities of wild type wheat (T. aestivum cv. Bobwhite (BW)) and HighPhy (HIGHPHY) wheat, after 0, 10, 20 and 40 min of incubation at 80.degree. C. at 100% relative humidity, are shown in FIG. 9. At t=0, the phytase activities of BW and HIGHPHY were 1286 and 4311 FTU/kg, respectively. After 10 min of incubation, HIGHPHY still exhibited a very substantial phytase activity of 3046 FTU/kg, while BW only exhibited 940 FTU/kg. After 20 min of incubation, HIGHPHY had 1801 FTU/kg residual phytase activity, still higher than the starting level in BW, while in BW the activity was only 667 FTU/kg. The most extreme incubation of 40 min reduced phytase activity in the HIGHPHY to 962 FTU/kg, while levels in BW were reduced to 476 FTU/kg.

[0139] The experimental conditions used to test phytate stability were more extreme than those of commercial steam-pelleting, where the duration of steam treatment of normally around 1 minute. It is thus expected that the residual phytase activity in pelleted feed made from HighPhy cereal grains of the invention will lie above the level at which supplementary phytase is required (circa 2500 FTU/kg).

Example 11

Stability of Phytase Activity in HighPhy Secale cereale (Rye) Subjected to Steam Treatment

[0140] Grain of HighPhy rye were milled and the resulting flour was subjected to simulated conditioning, using the same experimental set up as used for wheat flour in example 10. A single measurement of phytase activity of HighPhy rye, after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of incubation at 80.degree. C. at 100% relative humidity, are shown in FIG. 10. At t=0, the phytase activities of HighPhy rye was 4013 FTU/kg, and after 10 min still exhibited a very substantial phytase activity of 3818 FTU/kg. After 30 min of incubation phytase activities in the flour dropped to 1746 FTU/kg.

Example 12

Enhanced Phytate Degradation in High-Phy Wheat Flour

[0141] Phytase degradation during fermentation of dough improves its nutritional and bread-making quality, since phytase degradation enhances inorganic phosphate levels and mineral content in bread, and is known to improve dough mixing quality. Dough made from HighPhy wheat is shown to provide these advantages.

[0142] Wild type wheat (T. aestivum cv Bobwhite (BW)) and HighPhy wheat (HP) grains were milled on a Retsch RM100 mortar grinder mill. The phytate content in the resulting flour was determined using the procedure described by (Vaintraub & Lapteva, 1988). Flour (250 mg) was mixed with 0.1 ml of bakers yeast water stock (dry yeast in 3 mg/ml water). An additional 0.2 ml of water was added to form a dough. The dough was fermented at 25.degree. C. for 0.5, 1, 3 and 3 hrs. After fermentation, the phytate content was determined again, using the same procedure (Vaintraub and Lapteva, 1988).

[0143] The initial phytate content of HP wheat flour was a little higher than that of BW wheat (FIG. 11). However during fermentation, phytate levels were decreased to a lower level in flour from HP than BW wheat. Thus, phytate levels were reduced significantly more during fermentation in wheat dough from HP in comparison to dough from BW, both in terms of percentage and in the final phytate levels. Already after 0.5 hr, phytate was reduced more in HP than in BW wheat (FIG. 12 and table 2). After 3 hrs, only .about.44% of the initial phytate was left in the HP wheat, whereas .about.68% was left in the wild type BW wheat.

TABLE-US-00013 TABLE 2 Percent residual phytate (IP6) in dough of wild-type (BW) and HighPhy (HP) wheat flour BW HP Time residual IP6 (%) residual IP6 (%) 0 100 100 0.5 97.8 85.9 1.0 91.9 82.7 1.5 86.2 66.9 2.0 73.8 53.6 3.0 68.3 43.8

Example 13

The HighPhy Enhancer in the Barley Phytase Gene Confers Both Aleurone and Endosperm-Specific Expression in Developing Barley Grain

[0144] 13.1 Cloning of Promoter-GUS Constructs for Examination of the HighPhy Mutation:

[0145] The HighPhy mutation was introduced in the pCLEAN-G185-PAPhy_a construct with the mutagenic primers:

TABLE-US-00014 (SEQ ID No. 46) HvPAPhy_a SDmut Fw 5'GTAGAACACGAGCCATGCATGAGAC3' (SEQ ID No. 47) HvPAPhy_a SDmut Rv 5'TGGCTCGTGTTCTACAAAATGTAGC3'

[0146] This yielded the pCLEAN-G185-HP-PAPhy_a construct.

[0147] The two constructs pCLEAN-G185-PAPhy_a and pCLEAN-G185-HP-PAPhy_a were further modified to serve as promoter-reporter gene constructs. To achieve this, the PAPhy_a coding open reading frame and terminator was replaced by the UidA open reading frame followed by the NOS terminator. The cloning was performed with the "In-Fusion" technology as described in (Zhu, Cai, Hall and Freeman, 2007). This approach ensured seamless joining of the promoter and reporter gene so the start codon context was preserved.

[0148] The vector backbone and promoter of both constructs were amplified using the primers:

TABLE-US-00015 (SEQ ID No. 48) Cis to GUS Fw 5' TCGAGTCGACGTTCCTTGAC3' (SEQ ID No. 49) Cis to GUS Rv 5' GTTGATGTTGTTGCTTGGCATTG3'

[0149] The UidA and NOS terminator were amplified from pGUSN which is a pUC18 plasmid comprising an UidA gene and a downstream NOS terminator, using the primers:

TABLE-US-00016 GUS Fw m. overhang (SEQ ID No. 50) 5' AGCAACAACATCAACATGTTACGTCCTGTAGAAACC3' GUS Rv m. overhang (SEQ ID No. 52) 5' GGAACGTCGACTCGACTATGACCATGATTACGAATTCC3'

[0150] Performing the In-Fusion with the resulting amplicons gave the two GUS reporter constructs, pCLEAN-G185-wt-proGUS (SEQ ID No. 52) and pCLEAN-G185-HP-proGUS (SEQ ID No. 54).

[0151] 13.2: Constructing Randomized Phytase Gene Enhancer Element Sequences to Confirm the Criticality of the Promoter Enhancer Element Comprising the HighPhy Mutation.

[0152] The enhancer element motifs surrounding the HighPhy mutation were removed by sequence randomization by taking the 20 bp corresponding to SEQ ID 4 in the pCLEAN-G185-PAPhy_a construct and subjecting the sequence to a nucleotide randomizer (http://molbiol.ru/eng/scripts/(01_16.html) using settings designed to preserve the nucleotide ratios of the original sequence. The resulting sequence, 5' gcatacgaagcatagtacga3', was only identical to the original in three nucleotide positions and did not contain any regulatory elements known by PlantCARE*. The original 20 bp in pCLEAN-G185-wt-proGUS was replaced by the randomized sequence as described by Zhu and co-workers using the primers:

TABLE-US-00017 Kill triad Fw (SEQ ID No. 56) 5' gcatacgaagcatagtacgaCGTAGGCGTCCAAACTTTG3'; Kill triad Rv (SEQ ID No. 57) 5' tcgtactatgcttcgtatgcCTACAAAATGTAGCTTGAAATTAAAG AG3'

[0153] The resulting construct was pCLEAN-G185-KOtriad-proGUS (SEQ ID No. 58).

[0154] 13.3 Transient Expression in Developing Barley Endosperm and Aleurone:

[0155] The three constructs were individually introduced into developing (from 14 to 35 days after pollination) barley endosperm and aleurone cells by particle gun bombardment. Immature barley seeds were sterilized, and cultured on media and bombarded in a DuPont PDS 1100 helium biolistic delivery system using the procedures described in (BrinchPedersen, Galili, Knudsen, & Holm, 1996). Expression of the uidA gene was assayed in the plant tissues two days after bombardment, using the gus reaction buffer, as described in Jefferson, Kavanagh, & Bevan, 1987. Gus expression was scored by localizing blue spots on the bombarded tissues.

[0156] In tissues bombarded with the pCLEAN-G185-wt-proGUS plasmid, blue spots were mainly identified in the aleurone layers, with very limited expression in the endosperm. In pCLEAN-G185-HP-proGUS bombarded tissues more expression could be observed in the endosperm tissue. No expression was detected in grain bombarded with the pCLEAN-G185-KOtriad-proGUS. These data confirm that the HighPhy mutation in the context of the barley phytase gene enhancer confers both aleurone and endosperm-specific expression

Example 14

Identification of the Wild Type Locus in the Wheat Genome Corresponding to the HighPhy Phytase Gene

[0157] The mutant gene was aligned to the three homeologous PAPhy_a genes from the wild type cultivar "Chinese spring". The alignment was adjusted to include only the exons and introns of the gene. An UPGMA tree was generated with 1000 bootstrap replications (FIG. 13). The tree clearly points to TaPAPhy_a1 as the wild type locus corresponding to the HighPhy gene.

[0158] 14.1 Chromosomal Mapping of the TaPAPhy_a1 Gene:

[0159] Wheat chromosomal mapping was performed using the Chinese Spring nullisomic-tetrasomic lines described by (Kimber & Sears, 1979. There are 42 possible nullisomic-tetrasomic lines, of which two were missing in the present set of lines (the nullisomic (N) 2A tetrasomic (T) 2B and the N4BT4D lines), but their absence did not compromise the mapping. The following primers where designed to specifically amplify a 522 basepair segment of the TaPAPhy_a1 gene:

TABLE-US-00018 Forward 5'GAGATTCCGAGACCAACGAA3' Reverse 5'TTTGCCTCCACTCTGCCTAC3'

[0160] The amplicon was exclusively absent from two lines nulisomic for chromosome 5D and tetrasomic for chromosome 5A and 5B respectively (N5DT5A and N5DT5B). Thus, TaPAPhy_a1 maps to chromosome 5D.

LITERATURE CITED

[0161] [1] Engelen A J, Heeft F C yen der, Randsdorp P H G, Smit E L C (1994) Simple and rapid determination of phytase activity. J AOAC Internat 77: 760-764.

[0162] [2] Eeckhout W, Depaepe M (1994) Total phosphorus, phytate-phosphorus and phytase activity in plant feedstuffs. Anim Feed Sci Tech 47: 19-29.

[0163] [3] Depater S, Katagiri F, Kijne J, Chua N H (1994) Bzip Proteins Bind to A Palindromic Sequence Without An Acgt Core Located in A Seed-Specific Element of the Pea Lectin Promoter. Plant Journal 6: 133-140

[0164] [4] Wu C Y, Suzuki A, Washida H, Takaiwa F (1998) The GCN4 motif in a rice glutelin gene is essential for endosperm-specific gene expression and is activated by Opaque-2 in transgenic rice plants. Plant Journal 14: 673-683

[0165] [5] Blackwell T K, Bowerman B, Priess J R, Weintraub H (1994) Formation of A Monomeric Dna-Binding Domain by Skn-1 Bzip and Homeodomain Elements. Science 266: 621-628

[0166] [6) Baumlein H, Nagy I, Villarroel R, Inze D, Wobus U (1992) Cis-Analysis of A Seed Protein Gene Promoter--the Conservative Ry Repeat Catgcatg Within the Legumin Box Is Essential for Tissue-Specific Expression of A Legumin Gene. Plant Journal 2: 233-239

[0167] [7] Fujiwaraa, T., Nambara, E., Yamagishi, K., Goto, D. B., Naito, S. (2002) Storage Proteins. The Arabidopsis Book, 2002 American Society of Plant Biologists.

[0168] [8] Olsen, O., et al. Proc. Natl. Acad. Sci. USA (1993) Vol. 90, pp. 8043-8047.

[0169] [9] Sambrook, Fritsch and Maniatis (2001) Molecular Cloning: A Laboratory Manual (2nd Edition) Cold Spring Harbor Laboratory Press.

[0170] [10] Wittwer, C. T., et al., (2003) High resolution genotyping by amplicon melting analysis using LCgreen Clinical Chemistry: 49:6 853-860.

[0171] BrinchPedersen, H., Galili, G., Knudsen, S., & Holm, P. B. (1996). Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase. Plant Molecular Biology, 32(4), 611-620.

[0172] Engelen, A. J., Vanderheeft, F. C., Randsdorp, P. H. G., & Smit, E. L. C. (1994). Simple and Rapid-Determination of Phytase Activity. Journal of Aoac International, 77(3), 760-764.

[0173] Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). GUS FUSIONS--BETA-GLUCURONIDASE AS A SENSITIVE AND VERSATILE GENE FUSION MARKER IN HIGHER-PLANTS. Embo Journal, 6(13), 3901-3907.

[0174] Kimber, G., & Sears, E. G. (1979). Use of wheat aneuploids. Basic Life Sciences, 13, 427. Vaintraub, I. A., & Lapteva, N. A. (1988). COLORIMETRIC DETERMINATION OF PHYTATE IN UNPURIFIED EXTRACTS OF SEEDS AND THE PRODUCTS OF THEIR PROCESSING. Analytical Biochemistry, 175(1), 227-230. doi: 10.1016/0003-2697(88)90382-x

[0175] Zhu, B. G., Cai, G. F., Hall, E. O., & Freeman, G. J. (2007). In-Fusion (TM) assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations. Biotechniques, 43(3), 356-359. doi: 10.2144/000112536

[0176] PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences:

[0177] Magali Lescot, Patrice Dehais, Gert Thijs, Kathleen Marchal, Yves Moreau, Yves Van de Peer, Pierre Rouze and Stephane Rombauts Nucleic Acids Res. 2002 Jan. 1; 30(1): 325-327

Sequence CWU 1

1

59115DNATriticum aestivummutant cereal enhancer(1)..(15)modified_base(4)..(4)V = C, G or A 1acavgagtca tgcat 15219DNATriticum aestivummutant cereal enhancer(1)..(19)modified_base(8)..(8)V = C, G or A 2tagaacavga gtcatgcat 19315DNATriticum aestivumwild type cereal enhancer(1)..(15) 3acatgagtca tgcat 15420DNATriticum aestivumWild type enhancer(1)..(20) 4aacatgagtc atgcatggga 205288DNATriticum aestivumHigh Phy TaPAPhy mutant promoter(1)..(288)Mutant promoter and 5' untranslated region 5ttttgttgct tgcgctttag tttcaagcta cactttgtag aacacgagtc atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct gcctgcgcgt tcacaaggca ccaaagcgca 120ggcggcaaag tttgctcgtt tattatcttg gcggtccaag atgggcggca ggttccagac 180gatggacgaa gacccaccga gttccacttc cggctccaac ctcctctgcc cgattcatat 240aagtttcctg ccaaaggcat cccaattctg tcaatgccaa gcaacaac 2886271DNATriticum aestivumHigh Phy TaPAPhy mutant Promoter(1)..(271)TaPAPhy_a1 mutant promoter and 5' untranslated region 6tagtttcaag ctacactttg tagaacacga gtcatgcatg ggacgaaggc gtccaaactt 60ggctagtgca gctgcctgcg cgttcacaag gcaccaaagc gcaggcggca aagtttgctc 120gtttattatc ttggcggtcc aagatgggcg gcaggttcca gacgatggac gaagacccac 180cgagttccac ttccggctcc aacctcctct gcccgattca tataagtttc ctgccaaagg 240catcccaatt ctgtcaatgc caagcaacaa c 2717288DNATriticum aestivumWild typeTaPAPhy Promoter(1)..(288)Wild typeTaPAPhy Promoter and 5' untranslated region 7ttttgttgct tgcgctttag tttcaagcta cactttgtag aacatgagtc atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct gcctgcgcgt tcacaaggca ccaaagcgca 120ggcggcaaag tttgctcgtt tattatcttg gcggtccaag atgggcggca ggttccagac 180gatggacgaa gacccaccga gttccacttc cggctccaac ctcctctgcc cgattcatat 240aagtttcctg ccaaaggcat tccaattctg tcaatgccaa gcaacaac 2888288DNATriticum tauschiiWild type TtPAPhy promoter(1)..(288)Wild typeTtPAPhy Promoter and 5' untranslated region 8ttttgttgct tgcgctttag tttcaagcta cattttgtag aacatgagtc atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct gcgtgcgcgt tcacaaggca ccaaagcgca 120ggcggcaaag tttgctcgtt tattatcttg gcggtccaag atgggcggca ggttccagac 180gatggacgaa gacccaccga gttccacttc cggctccaac ctcctctgcc cgattcatat 240aagtttcctg ccaaaggcat cccaattctg tcaatgccaa gcaacaac 2889271DNATriticum aestivumWild type TaPAPhy_a1 promoter(1)..(271)Wild typeTaPAPhy_a1 Promoter and 5' untranslated region 9tagtttcaag ctacactttg tagaacatga gtcatgcatg ggacgaaggc gtccaaactt 60ggctagtgca gctgcctgcg cgttcacaag gcaccaaagc gcaggcggca aagtttgctc 120gtttattatc ttggcggtcc aagatgggcg gcaggttcca gacgatggac gaagacccac 180cgagttccac ttccggctcc aacctcctct gcccgattca tataagtttc ctgccaaagg 240cattccaatt ctgtcaatgc caagcaacaa c 27110287DNATriticum aestivumWild type TaPAPhy_a3 promoter(1)..(287)Wild type TaPAPhy_a3 promoter and 5' non-coding region 10tagtttcaag ctacattttg tagaacatga gtcatgcatg ggacgaaggt gtccaaagtc 60caaactcggc tagtgcagct gcctgcacgt tctgacgttc acaaggcacc aaagcgcagg 120cggcaaactt tgctcgttta ttatctcgcc ggtccaagat gggcggcaag ttctagacgc 180tggacgaaga cccaccgaat tccatttccg gctcccaacc tcctctgccc gattcctgta 240agtttcctgc caaaatcatc ccaattctct caatgccaag caacacc 28711240DNATriticum aestivumWild type TaPAPhy_a4 promoter(1)..(240)Wild type TaPAPhy_a4 promoter and 5' non-coding region 11tattttcaag ctacattttg tagaacatga gtcatgcatg ggacgaaggt ggccaaagtc 60caaacttggc aggcggcaaa gtttgctcgt ttatcatctt gccggtccaa gatgggcggc 120aggttccagg cgatggacga agacccaccg agtcccactt ccggctccca acctcctctg 180cccgattcat ataagtttcc tgccaaaggc atcctaattc tgtcaatacc aagcaacaac 24012278DNATriticum monococcumHigh Phy TmPAPhy mutant promoter(1)..(278)High Phy TmPAPhy mutant promoter and 5' untranslated region 12tagtttcaag ctacattttg tagaacagga gtcatgcatg gacgaaggtg tccaaagtcc 60aaacttggct agcgcagctg cctgcacgtt cacaaggcac caaagcgcag gcggcaaagt 120ttgctcgttt attatcttgc cggtccaaga cgggcggcag gttccagacg atggacgaag 180acccaccgaa ttccatttcc ggctcccaac ctcctctgcc cgattcctac aagtttcctg 240ccaaaggcat cccaattctg tcaatgccaa gcaacgcc 27813262DNAHordeum vulgareWild type HvPAPhy promoter(1)..(262)Wild type HvPAPhy promoter and 5' untranslated region 13taatttcaag ctacattttg tagaacatga gccatgcatg agacgtaggc gtccaaactt 60tggctagcgc agctgcatgc acgtccacaa ggcaccaaag gcgcaggcgg caactttgct 120cgtttatttt cttgcgggtc caagatgagt tccagaccat ggacgaattc cacttcgggc 180tcccaatctc ctctgccgga ttcctataag tttcctgcca agaagcatcc caatcccctc 240aatgccaagc aacaacatca ac 26214262DNAHordeum vulgareHigh Phy HvPAPhy mutant promoter(1)..(262)High Phy HvPAPhy mutant promoter and 5' non-coding region 14taatttcaag ctacattttg tagaacacga gccatgcatg agacgtaggc gtccaaactt 60tggctagcgc agctgcatgc acgtccacaa ggcaccaaag gcgcaggcgg caactttgct 120cgtttatttt cttgcgggtc caagatgagt tccagaccat ggacgaattc cacttcgggc 180tcccaatctc ctctgccgga ttcctataag tttcctgcca agaagcatcc caatcccctc 240aatgccaagc aacaacatca ac 26215270DNASecale cerealeHighPhy ScPAPhy_a1 promoter(1)..(270)HighPhy ScPAPhy_a1 promoter and 5' non-coding region 15tagtttcaag ctacattttc tagaacacga gtcatgcatg ggacgaaggt gtccaaagtc 60caaacttggc ttttgtgcag ctgcctgcac gttcacaagg caccaaagcg caggcggcaa 120acttaatttg ctcgttcatt atcttgctgg tccaagatgg gcggcaggtt gcacccaccg 180agttccactt ccggctccca atctcctgtg cctgattcct ataagtttcc tgccaaaagc 240atcccaattc tgtcaatgcc aagcaacaac 27016280DNASecale cerealeWild type ScPAPhy_a2 promoter(1)..(280)Wild type ScPAPhy_a2 promoter and 5' non-coding region 16agtttcaagc tacattttgt agaacatgag tcatgcatgg gacgaaggtg tccaaagtcc 60aaacttggct tttgtgcagc tgcctgcacg ttcacaaggc accaaagcgc aggcggcaaa 120ctttgctcgt tcattatctt gctggtccaa gatgggcggc aggttgcaga agatggacga 180agacccaccg agttccactt ccggctccca atcgcctctg cccgattcct ataagtttcc 240tgccaaaggc atcccaattc tgtcaatgcc aagcaacaac 280171749DNATriticum aestivumTaPAPhy_a1 phytase cDNA(1)..(1749)CDS(27)..(1670)Coding sequence for phytase 17caattctgtc aatgccaagc aacaac atg tgg tgg ggg tcg ctg ctg ctg ctg 53 Met Trp Trp Gly Ser Leu Leu Leu Leu 1 5 ctg ctg ctc gcg gcc gcg gtg gcg gcg gct gct gag ccg gcg tcg acg 101Leu Leu Leu Ala Ala Ala Val Ala Ala Ala Ala Glu Pro Ala Ser Thr 10 15 20 25 ctc acg ggc ccg tca cgg ccg gtc acg gtg gcg ctg cgg gaa gac agg 149Leu Thr Gly Pro Ser Arg Pro Val Thr Val Ala Leu Arg Glu Asp Arg 30 35 40 ggc cac gcg gtg gac ctg ccg gac acg gac ccc cgg gtg cag cgc cgg 197Gly His Ala Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg 45 50 55 gcc acg ggc tgg gct ccc gag cag atc gcc gtc gcg ctc tcc gcc gct 245Ala Thr Gly Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala 60 65 70 ccc acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag atg ggc 293Pro Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly 75 80 85 ggc acc gtc aag ccg ctg gac ccc ggc acg gtc ggc agc gtc gtg cgc 341Gly Thr Val Lys Pro Leu Asp Pro Gly Thr Val Gly Ser Val Val Arg 90 95 100 105 tac ggg ctc gcc gcc gat tct ttg gtt cgc cag gcc agc ggc gac gcg 389Tyr Gly Leu Ala Ala Asp Ser Leu Val Arg Gln Ala Ser Gly Asp Ala 110 115 120 ctc gtg tac agc cag ctc tac ccc ttc gag ggt ctc cag aac tac acc 437Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr 125 130 135 tcc ggc atc atc cac cac gtc cgc ctc caa ggg ctt gag cct gcg acg 485Ser Gly Ile Ile His His Val Arg Leu Gln Gly Leu Glu Pro Ala Thr 140 145 150 aag tac tac tac cag tgc ggc gac ccg gcc ctc ccg ggg gcg atg agc 533Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Ala Met Ser 155 160 165 gcc gtc cac gcg ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac 581Ala Val His Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr 170 175 180 185 ccg ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc 629Pro Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr 190 195 200 acc tcc acc gtg gac cac atg gcg agc aac cgg ccg gac ctg gtc ctc 677Thr Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp Leu Val Leu 205 210 215 ctc gtc ggc gac gtg tgc tac gcc aac atg tac ctc acc aac ggc acc 725Leu Val Gly Asp Val Cys Tyr Ala Asn Met Tyr Leu Thr Asn Gly Thr 220 225 230 gga gcg gac tgc tac tcg tgc gcg ttc ggc aag tcg acg ccc atc cac 773Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His 235 240 245 gag acg tac cag ccg cgc tgg gac tac tgg gga agg tac atg gag gcg 821Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala 250 255 260 265 gtg acg tcg ggg acg ccg atg atg gtg gtg gaa ggg aac cat gag ata 869Val Thr Ser Gly Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile 270 275 280 gag gag cag atc ggg aac aag acg ttc gcg gcc tac cgc tcc cgg ttc 917Glu Glu Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe 285 290 295 gcg ttc ccg tcg acg gag agc ggg tcc ttc tcc ccc ttc tac tac tcg 965Ala Phe Pro Ser Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser 300 305 310 ttc gac gcc ggc ggg atc cat ttc ctc atg ctc ggc gcc tac gcc gac 1013Phe Asp Ala Gly Gly Ile His Phe Leu Met Leu Gly Ala Tyr Ala Asp 315 320 325 tac ggc agg tca ggg gag cag tac aga tgg ctg gag aag gac ctg gcg 1061Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ala 330 335 340 345 aag gtg gac agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg cac gcg 1109Lys Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp His Ala 350 355 360 cca tgg tac acc acc tac aag gct cac tac agg gag gtg gag tgc atg 1157Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met 365 370 375 aga gtg gcc atg gag gag ctg ctc tac tcc cac ggc ctc gac atc gcc 1205Arg Val Ala Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala 380 385 390 ttc acc ggc cat gtg cac gcg tat gag cgc tcc aac cgg gtg ttc aac 1253Phe Thr Gly His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn 395 400 405 tac acg ctg gac ccg tgc ggc gcc gtg cac atc tcg gtg ggc gac ggc 1301Tyr Thr Leu Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly 410 415 420 425 ggg aac cgc gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac 1349Gly Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His 430 435 440 tgc ccg gac ccg cgg ccc aag ccc aac gcc ttc atc ggc ggc ttc tgc 1397Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys 445 450 455 gcc tcc aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc tgg gac 1445Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys Trp Asp 460 465 470 cgg cag ccg gac tac agc gcc tac cgg gag agc agc ttc ggc cac ggc 1493Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly 475 480 485 atc ctc gag gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg 1541Ile Leu Glu Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg 490 495 500 505 aac cag gac cac tac ggg agc gcc gga gat gag att tac att gtc cgg 1589Asn Gln Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg 510 515 520 gag ccg cac agg tgc ttg cac aag cac aac tcg agc agg ccg gca cac 1637Glu Pro His Arg Cys Leu His Lys His Asn Ser Ser Arg Pro Ala His 525 530 535 ggt cga tca aac acc aca cgg gaa tcg gga ggt taaccgttgt accactggag 1690Gly Arg Ser Asn Thr Thr Arg Glu Ser Gly Gly 540 545 tagatcgcgt ggtgtaatgg caactgtata gacggttcgc ccaagcgtgg aaataaaaa 1749 18548PRTTriticum aestivum 18Met Trp Trp Gly Ser Leu Leu Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu 50 55 60 Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85 90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 Leu Val Arg Gln Ala Ser Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Ala Ser Asn Arg Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys Tyr 210 215 220 Ala Asn Met Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys 275 280 285 Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Leu Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Gln 325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470

475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Leu His 515 520 525 Lys His Asn Ser Ser Arg Pro Ala His Gly Arg Ser Asn Thr Thr Arg 530 535 540 Glu Ser Gly Gly 545 191743DNATriticum aestivumTaPAPhy_a2 Phytase cDNA(1)..(1743)CDS(22)..(1665)CDS encoding phytase 19ctctcaatgc caagcaacac c atg tgg tgg ggg tcg ctg cgg ctg ctg ctg 51 Met Trp Trp Gly Ser Leu Arg Leu Leu Leu 1 5 10 ctg ctc gcg gcg gcg gtg gcg gcg gct gct gag ccg gcg tcg acg ctc 99Leu Leu Ala Ala Ala Val Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu 15 20 25 acc ggc ccg tcg cgg ccg gtg acg gtg gcg ctg cgg aaa gac agg ggc 147Thr Gly Pro Ser Arg Pro Val Thr Val Ala Leu Arg Lys Asp Arg Gly 30 35 40 cac gcg gtg gac ctg ccg gac acg gac ccc cgg gtg cag cgc cgg gcc 195His Ala Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala 45 50 55 acg ggc tgg gct ccc gag cag atc acc gtc gcg ctc tcc gcc gct ccc 243Thr Gly Trp Ala Pro Glu Gln Ile Thr Val Ala Leu Ser Ala Ala Pro 60 65 70 acc tct gcc tgg gtc tcc tgg atc acc ggc gaa ttc cag atg ggc ggc 291Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly 75 80 85 90 acc gtc aag ccg ctg aac ccc ggc acg gtc gcc agc gtc gtg cgc tac 339Thr Val Lys Pro Leu Asn Pro Gly Thr Val Ala Ser Val Val Arg Tyr 95 100 105 ggg ctc gcc gcc gat tct ttg gtt cac gag gcc acc ggc gac gcg ctc 387Gly Leu Ala Ala Asp Ser Leu Val His Glu Ala Thr Gly Asp Ala Leu 110 115 120 gtg tac agc cag ctc tac ccc ttc gag ggc ctc cag aac tac acc tcc 435Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser 125 130 135 ggc atc atc cac cac gtc cgc ctc caa ggg ctt gag cct gcg acg aag 483Gly Ile Ile His His Val Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys 140 145 150 tac tac tac cag tgc ggc gac ccg ggc atc ccg ggg gcg atg agc gcc 531Tyr Tyr Tyr Gln Cys Gly Asp Pro Gly Ile Pro Gly Ala Met Ser Ala 155 160 165 170 gtc cac gcg ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac ccg 579Val His Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro 175 180 185 ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acc 627Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr 190 195 200 tcg acc gtg gac cac atg gtc agc aac cgg ccc gac ctg gtc ctc ctc 675Ser Thr Val Asp His Met Val Ser Asn Arg Pro Asp Leu Val Leu Leu 205 210 215 gtc ggc gac gtg tgc tac gcc aac atg tac ctc acc aac ggc acc gga 723Val Gly Asp Val Cys Tyr Ala Asn Met Tyr Leu Thr Asn Gly Thr Gly 220 225 230 gcg gac tgc tac tcg tgc gcg ttc ggc aag tcg acg ccc atc cac gag 771Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu 235 240 245 250 acg tac cag ccg cgc tgg gac tac tgg gga agg tac atg gag gcg gtg 819Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val 255 260 265 acg tcg ggc acg ccg atg atg gtg gtg gaa ggg aac cat gag ata gag 867Thr Ser Gly Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile Glu 270 275 280 gag cag atc ggc aac aag acg ttc gcg gcc tac cgc tcc cgg ttc gcg 915Glu Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala 285 290 295 ttc ccg tcg acg gag agc ggc tcc ttc tcc ccc ttc tac tac tcg ttc 963Phe Pro Ser Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe 300 305 310 gac gcc ggc ggg atc cat ttc atc atg ctc gcc gcc tac gcc gat tac 1011Asp Ala Gly Gly Ile His Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr 315 320 325 330 agc agg tca ggg gag cag tac aga tgg ctg gtg aag gac ctg gcg aag 1059Ser Arg Ser Gly Glu Gln Tyr Arg Trp Leu Val Lys Asp Leu Ala Lys 335 340 345 gtg gac agg gcg gtg acc ccc tgg ctg gtc gcc ggc tgg cac gcg cca 1107Val Asp Arg Ala Val Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro 350 355 360 tgg tac acc acc tac aag gct cac tac agg gag gtg gag tgc atg aga 1155Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg 365 370 375 gtg gcc atg gag gag ctg ctc tac tcc cac ggc ctc gac atc gcc ttc 1203Val Ala Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe 380 385 390 acc ggc cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac tac 1251Thr Gly His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr 395 400 405 410 acg ctg gac ccg tgc ggc gcg gtg cac atc tcg gtg ggc gac ggc ggg 1299Thr Leu Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly Gly 415 420 425 aac cgg gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc 1347Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys 430 435 440 ccg gac ccg cgg ccc aag ccc aac gcc ttc atc ggc tgc ttc tgc gcc 1395Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Cys Phe Cys Ala 445 450 455 ttc aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc tgg gac cgg 1443Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg 460 465 470 cag ccg gac tac agc gcc tac cgg gag agc agc ttc ggc cac ggc atc 1491Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile 475 480 485 490 ctc gag gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg aac 1539Leu Glu Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg Asn 495 500 505 cag gac cac tac gga agc gcc gga gat gag att tac att gtc cgg gag 1587Gln Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu 510 515 520 ccg cac agg tgc ttg cac aag cac aac tcg acc agg ccg gca cac ggt 1635Pro His Arg Cys Leu His Lys His Asn Ser Thr Arg Pro Ala His Gly 525 530 535 cga caa aac acc aca cgg gaa tcg gga ggt taactgctgt actgctggag 1685Arg Gln Asn Thr Thr Arg Glu Ser Gly Gly 540 545 tagatcgcgc ggtgtaatgg caactttata gatgattcgc ccaagcgtgg aaataaaa 174320548PRTTriticum aestivum 20Met Trp Trp Gly Ser Leu Arg Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg Lys Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu 50 55 60 Gln Ile Thr Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asn 85 90 95 Pro Gly Thr Val Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 Leu Val His Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Gly Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Val Ser Asn Arg Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys Tyr 210 215 220 Ala Asn Met Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys 275 280 285 Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr Ser Arg Ser Gly Glu Gln 325 330 335 Tyr Arg Trp Leu Val Lys Asp Leu Ala Lys Val Asp Arg Ala Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro Asn Ala Phe Ile Gly Cys Phe Cys Ala Phe Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Leu His 515 520 525 Lys His Asn Ser Thr Arg Pro Ala His Gly Arg Gln Asn Thr Thr Arg 530 535 540 Glu Ser Gly Gly 545 211734DNATriticum aestivumTaPAPhy_a3 phytase cDNA(1)..(1734)CDS(22)..(1638)phytase coding sequence 21ctgtcaatac caagcaacaa c atg tgg tgg ggg tcg ctg cgg ctg ctg ctg 51 Met Trp Trp Gly Ser Leu Arg Leu Leu Leu 1 5 10 ctg ctc gcg gcg gcg gtg gcg gcg gct gct gag cca gcg tcg acg ctc 99Leu Leu Ala Ala Ala Val Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu 15 20 25 acg ggg ccg tcg cgg ccg gtg acg gtg acg ctt cgg gaa gac agg ggc 147Thr Gly Pro Ser Arg Pro Val Thr Val Thr Leu Arg Glu Asp Arg Gly 30 35 40 cac gcg gtg gac ctg ccg gac acg gac ccc cgg gtg cag cgc cgg gcc 195His Ala Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala 45 50 55 acg ggc tgg gct ccc gag cag atc gcc gtc gcg ctc tcc gcc gct ccc 243Thr Gly Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala Pro 60 65 70 acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag atg ggc ggc 291Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly 75 80 85 90 acc gtc aag ccg ctg gac ccc ggc acg gtc gcc agc gtc gtg cgc tac 339Thr Val Lys Pro Leu Asp Pro Gly Thr Val Ala Ser Val Val Arg Tyr 95 100 105 ggg ctc gcc gcc gat tct ttg gtt cgc cag gcc acc ggc gac gcg ctc 387Gly Leu Ala Ala Asp Ser Leu Val Arg Gln Ala Thr Gly Asp Ala Leu 110 115 120 gtg tac agc cag ctc tac ccc ttc gag ggc ctc cag aac tac acc tcc 435Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser 125 130 135 ggc atc atc cac cac gtc cgc ctc caa ggg ctt gag cct gcg acg aag 483Gly Ile Ile His His Val Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys 140 145 150 tac tac tac cag tgt ggc gac ccg gcc ctc ccg ggg gcg atg agc gcc 531Tyr Tyr Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Ala Met Ser Ala 155 160 165 170 gtc cac gcg ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac ccg 579Val His Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro 175 180 185 ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acg 627Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr 190 195 200 tcg acc gtg gac cac atg gcg agc aac cgg ccg gac ctg gtc ctc ctc 675Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp Leu Val Leu Leu 205 210 215 ctc ggt gac gtc agc tac gcc aac ctg tac ctc acc aac ggc acc gga 723Leu Gly Asp Val Ser Tyr Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly 220 225 230 gcg gac tgc tac tcg tgc gcg ttc ggc aag tcc acg ccc atc cac gag 771Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu 235 240 245 250 acg tac cag ccg cgc tgg gac tac tgg gga agg tac atg gag gcg gtg 819Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val 255 260 265 acg tcg ggg acg ccg atg gtg gtg gtg gag ggg aac cat gag ata gag 867Thr Ser Gly Thr Pro Met Val Val Val Glu Gly Asn His Glu Ile Glu 270 275 280 gag cag atc ggc aac aag acg ttc gcg gcc tac cgc tcc cgg ttc gcg 915Glu Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala 285 290 295 ttc ccg tcg acg gag agc ggg tcc ttc tcc ccc ttc tac tac tcg ttc 963Phe Pro Ser Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe 300 305 310 gac gcc ggg ggg atc cat ttc gtc atg ctc ggc gcc tac gcc gac tac 1011Asp Ala Gly Gly Ile His Phe Val Met Leu Gly Ala Tyr Ala Asp Tyr 315 320 325 330 ggc agg tca ggg gag cag tac aga tgg ctc gag aag gac ctg gcg aag 1059Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys 335 340 345 gtg gac agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg cac gcg cca 1107Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro 350 355 360 tgg tac acc acc tat aag gct cac tac agg gag gtg gag tgc atg aga 1155Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg 365 370 375 gtg gcc atg gag gag ctg ctc tac tcc cac ggc ctc gac atc gcc ttc 1203Val Ala Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe 380 385 390

acc ggc cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac tac 1251Thr Gly His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr 395 400 405 410 acg ctg gac ccg tgc ggc gcc gtg cac atc tcg gtg ggc gac ggc ggg 1299Thr Leu Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly Gly 415 420 425 aac cgc gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc 1347Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys 430 435 440 ccg gaa ccg cgg gcc aag ccc aac gcc ttc atc ggc ggc ttc tgc gcc 1395Pro Glu Pro Arg Ala Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala 445 450 455 ttt aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc tgg gac cgg 1443Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg 460 465 470 cag ccg gac tac agc gcc tac cgg gag agc agc ttc ggc cac ggc atc 1491Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile 475 480 485 490 ctc gag gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg aac 1539Leu Glu Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg Asn 495 500 505 cag gac atg tac ggg agc gcc gga gat gag att tac att gtc cgg gag 1587Gln Asp Met Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu 510 515 520 ccc cac agg tgc ttg cac aaa cac aac tcg acc agg ccg aca cac ggt 1635Pro His Arg Cys Leu His Lys His Asn Ser Thr Arg Pro Thr His Gly 525 530 535 cga taaaacatca cacgggaatc tggaggtact actggagtaa acctcccggt 1688Arg gtaataatgg caactattga cggttcgtcc aagcgtggaa ataaaa 173422539PRTTriticum aestivum 22Met Trp Trp Gly Ser Leu Arg Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Thr Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu 50 55 60 Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85 90 95 Pro Gly Thr Val Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 Leu Val Arg Gln Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Ala Ser Asn Arg Pro Asp Leu Val Leu Leu Leu Gly Asp Val Ser Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Val Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys 275 280 285 Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Val Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Gln 325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Glu Pro Arg Ala Lys 435 440 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala Phe Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Leu His 515 520 525 Lys His Asn Ser Thr Arg Pro Thr His Gly Arg 530 535 231730DNATriticum monococcumTmPAPhy_a1 phytase cDNA(1)..(1730)CDS(17)..(1651)Phytase coding sequence 23aatgccaagc aacgcc atg tgg tgg ggg gcg ctg cag ctg ctg ctg ctg ctc 52 Met Trp Trp Gly Ala Leu Gln Leu Leu Leu Leu Leu 1 5 10 gtg gcg gcg gct gct gag ccg gcg tcg acg ctc acc ggc ccg tcg cgg 100Val Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg 15 20 25 ccg gtg acg gtg gcg ctg cgg aaa gac agg ggc cac gcg gtg gac ctg 148Pro Val Thr Val Ala Leu Arg Lys Asp Arg Gly His Ala Val Asp Leu 30 35 40 ccg gac acg gac ccc cgg gtg cag cgc cgg gcc acg ggc tgg gct ccc 196Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro 45 50 55 60 gag cag atc acc gtc gcg ctc tcc gcc gct ccc acc tct gcc tgg gtc 244Glu Gln Ile Thr Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val 65 70 75 tcc tgg atc acc ggg gaa ttc cag atg ggc ggc aca gtc aag ccg ctg 292Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu 80 85 90 cac ccc ggc acg gtc gcc agc gtc gtg cgc tac ggg ctc gcc gcc gat 340His Pro Gly Thr Val Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp 95 100 105 tct ttg gtt cgc gag gcc acc ggc gac gcg ctt gtg tac agc cag ctc 388Ser Leu Val Arg Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu 110 115 120 tac ccc ttc gag ggc ctc cag aac tac acc tcc ggc atc atc cac cac 436Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His 125 130 135 140 gtc cgc ctc caa ggg ctt gag cct gcg acg aag tac tac tac cag tgc 484Val Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys 145 150 155 ggc gac ccg ggc atc ccg ggg gcg atg agc gcc gtc cac gcg ttc cgg 532Gly Asp Pro Gly Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg 160 165 170 acg atg ccg gcg gtg ggg ccg cgg agc tac ccg ggg agg atc gcc gtg 580Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val 175 180 185 gtg gga gac ctc ggg ctc acg tac aac acc acc tcc acc gtg gac cac 628Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His 190 195 200 atg gtc agc aac cgg ccg gac ctg gtc ctc ctc gtc ggc gac gtg tgc 676Met Val Ser Asn Arg Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys 205 210 215 220 tac gcc aac atg tac ctc acc aac ggc acc gga gcg gac tgc tac tcg 724Tyr Ala Asn Met Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser 225 230 235 tgc gcg ttc ggc aag tcg acg ccc atc cac gag acg tac cag ccg cgc 772Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg 240 245 250 tgg gac tac tgg gga agg tac atg gag gcg gtg acg tcg ggg acg ccg 820Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro 255 260 265 atg atg gtg gtg gaa ggg aac cat gag atc gag gag cag atc cgc aac 868Met Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Arg Asn 270 275 280 agg acg ttc gcg gcc tac cgc tcc cgg ttc gcg ttc ccg tcg acg gag 916Arg Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu 285 290 295 300 agc ggc tcc ttc tcc ccc ttc tac tac tcc ttc gac gcc ggc ggg atc 964Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile 305 310 315 cat ttc gtc atg ctc gcc gcg tac gcc gac tac agc agg tca ggg gag 1012His Phe Val Met Leu Ala Ala Tyr Ala Asp Tyr Ser Arg Ser Gly Glu 320 325 330 cag tac aga tgg ctg aag aag gac ctg gcg aag gtg gac agg gcg gtg 1060Gln Tyr Arg Trp Leu Lys Lys Asp Leu Ala Lys Val Asp Arg Ala Val 335 340 345 acc ccc tgg ctg gtc gcc ggc tgg cac gcg cca tgg tac acc acc tac 1108Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr 350 355 360 aag gct cac tac agg gag gtg gag tgc atg aga gtg gcc atg gag gag 1156Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu 365 370 375 380 ctg ctc tac tcc cac ggc ctc gac atc gcc ttc acc ggc cat gtg cac 1204Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His 385 390 395 gcg tac gag cgc tcc aac cgg gtg ttc aac tac acg ctg gac ccg tgc 1252Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys 400 405 410 ggc gcg gtg cac atc tcg gtg ggc gac ggc ggg aac cgg gag aag atg 1300Gly Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met 415 420 425 gcc acc acc cac gcc gac gag ccg ggg cac tgc ccg gac ccg cgg ccc 1348Ala Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro 430 435 440 aag ccc aac gcc ttc atc ggc ggc ttc tgc gcc tcc aac ttc acg tcc 1396Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser 445 450 455 460 ggc ccg gcc gcc ggc agg ttc tgc tgg gac cgg cag ccg gac tac agc 1444Gly Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser 465 470 475 gcc tac cgg gaa agc agc ttc ggc cac ggc atc ctc gag gtg aag aac 1492Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn 480 485 490 gag acg cac gct ctg tgg aga tgg cac agg aac cag gac cac tac gga 1540Glu Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His Tyr Gly 495 500 505 agc gcc gga gat gag att tac att gtc cgg gag ccg cac agg tgc ttg 1588Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Leu 510 515 520 cac aag cac aac tcg acc agg ccg gca cac ggt cga caa aac acc aca 1636His Lys His Asn Ser Thr Arg Pro Ala His Gly Arg Gln Asn Thr Thr 525 530 535 540 cgg gaa tcg gga ggc taactgctgt actgctggag tagatcgcgc ggtgtaatgg 1691Arg Glu Ser Gly Gly 545 caactatata gacggttcgc ccaagcgtgg aaataaaaa 173024545PRTTriticum monococcum 24Met Trp Trp Gly Ala Leu Gln Leu Leu Leu Leu Leu Val Ala Ala Ala 1 5 10 15 Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro Val Thr Val 20 25 30 Ala Leu Arg Lys Asp Arg Gly His Ala Val Asp Leu Pro Asp Thr Asp 35 40 45 Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu Gln Ile Thr 50 55 60 Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser Trp Ile Thr 65 70 75 80 Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu His Pro Gly Thr 85 90 95 Val Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser Leu Val Arg 100 105 110 Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu 115 120 125 Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val Arg Leu Gln 130 135 140 Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro Gly 145 150 155 160 Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr Met Pro Ala 165 170 175 Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp Leu 180 185 190 Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met Val Ser Asn 195 200 205 Arg Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys Tyr Ala Asn Met 210 215 220 Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly 225 230 235 240 Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp 245 250 255 Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met Met Val Val 260 265 270 Glu Gly Asn His Glu Ile Glu Glu Gln Ile Arg Asn Arg Thr Phe Ala 275 280 285 Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser Gly Ser Phe 290 295 300 Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His Phe Val Met 305 310 315 320 Leu Ala Ala Tyr Ala Asp Tyr Ser Arg Ser Gly Glu Gln Tyr Arg Trp 325 330 335 Leu Lys Lys Asp Leu Ala Lys Val Asp Arg Ala Val Thr Pro Trp Leu 340 345 350 Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr 355 360 365 Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr Ser 370 375 380 His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala Tyr Glu Arg 385 390 395 400 Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly Ala Val His 405 410 415 Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala Thr Thr His 420 425 430 Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala 435 440 445 Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala 450 455 460 Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu 465 470 475 480 Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu Thr His Ala 485 490 495 Leu Trp Arg Trp His Arg Asn Gln Asp His

Tyr Gly Ser Ala Gly Asp 500 505 510 Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Leu His Lys His Asn 515 520 525 Ser Thr Arg Pro Ala His Gly Arg Gln Asn Thr Thr Arg Glu Ser Gly 530 535 540 Gly 545 251744DNASecale cerealeScPAPhy_a1 phytase cDNA(1)..(1744)CDS(17)..(1639) 25aatgccaagc aacaac atg tgg cgg ggg tcg ctg cgg ctg ctg ctg ctg ctc 52 Met Trp Arg Gly Ser Leu Arg Leu Leu Leu Leu Leu 1 5 10 gcg gcg gcg gtg acg gcg gct gct gag ccg ggg tcg acg ctc atg ggc 100Ala Ala Ala Val Thr Ala Ala Ala Glu Pro Gly Ser Thr Leu Met Gly 15 20 25 ccg tca cgg ccg gtt acg gtg gcg ctg cgg gaa gac agg ggc cac gcg 148Pro Ser Arg Pro Val Thr Val Ala Leu Arg Glu Asp Arg Gly His Ala 30 35 40 gtg gac ctg ccg gac acg gac ccg cgg gtg cag cgc cgg gca aat ggc 196Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Asn Gly 45 50 55 60 tgg gct cct gag cag atc gcc gtc gcg ctc tcc gct gct ccc acc tct 244Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser 65 70 75 gcc tgg gtc tcc tgg atc aca ggg gaa ttc cag atg ggc ggc acc gtc 292Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val 80 85 90 aag ccg ctg gac ccc ggc acg gtc ggt agc gtc gtg cgc tac ggg ctc 340Lys Pro Leu Asp Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu 95 100 105 gcc gcc gat tct ttg gtt cgt gtg gcc acc ggc gac gcg ctc gtg tac 388Ala Ala Asp Ser Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr 110 115 120 agc cag ctc tac cca ttc gag ggc ctc cag aac tac acc tcc ggc atc 436Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile 125 130 135 140 atc cac cac gtc cgc ctc caa ggg ctt gag cct ggg acg aag tac tac 484Ile His His Val Arg Leu Gln Gly Leu Glu Pro Gly Thr Lys Tyr Tyr 145 150 155 tac cag tgc ggc gac ccg gcc ctc ccg ggg gcg atg agc gcc gtc cac 532Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Ala Met Ser Ala Val His 160 165 170 gcg ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac ccg ggg agg 580Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg 175 180 185 atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acc tcc acc 628Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr 190 195 200 gtg gac cac atg gtg agc aac cgg ccg gac ctg gtg gtc ctc gtc ggc 676Val Asp His Met Val Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly 205 210 215 220 gac gtg agc tac gcc aac ctg tac ctc acc aac ggc acc gga gcg gac 724Asp Val Ser Tyr Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp 225 230 235 tgc tac tcg tgc gcg ttc ggc aag tcg acg ccc atc cac gag acg tac 772Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr 240 245 250 cag ccg cgc tgg gac tac tgg ggg agg tac atg gag gcg gtg acg tcg 820Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser 255 260 265 ggg acg ccg atg atg gtg gtg gag ggg aac cat gag ata gag gag cag 868Gly Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln 270 275 280 atc ggt aaa aag acg ttc gag gcg tac cgc tcc cgg ttc gcg ttc ccg 916Ile Gly Lys Lys Thr Phe Glu Ala Tyr Arg Ser Arg Phe Ala Phe Pro 285 290 295 300 tcg gcg gag agc ggg tcc ttc tcc ccc ttc tac tac tcc ttc gac gcc 964Ser Ala Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala 305 310 315 ggc ggg atc cat ttc atc atg ctc gcc gcc tac gac gac tac agc agg 1012Gly Gly Ile His Phe Ile Met Leu Ala Ala Tyr Asp Asp Tyr Ser Arg 320 325 330 tca gga gag cag tac cga tgg ctg gag aag gac ctg tcg aag gtg gac 1060Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ser Lys Val Asp 335 340 345 agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg cac gcg cca tgg tac 1108Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr 350 355 360 acc acc tac aag gct cac tac agg gag gtg gag tgc atg aga gtg tcc 1156Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ser 365 370 375 380 atg gag gag ctg ctc tac tcc cac ggc ctc gac atc gcc ttc acc ggc 1204Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly 385 390 395 cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac tac acg ctg 1252His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu 400 405 410 gac ccg tgc ggt gcc gtg cac atc tcg gtg ggc gac ggc ggg aac cgc 1300Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg 415 420 425 gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc ccg gac 1348Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp 430 435 440 ccg cgg ccc aag ccc aac gcc ttc atc ggc ggc ttc tgc ggc ttt aac 1396Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn 445 450 455 460 ttc acg tcc ggc ccg gcc gcc gga agg tac tgc tgg gac cgg cag ccg 1444Phe Thr Ser Gly Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro 465 470 475 gac tac agc gcc tac cgg gag agc agc ttt ggc cac ggc atc ctc gag 1492Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu 480 485 490 gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg aac cag gac 1540Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp 495 500 505 atg tac ggg agc gcc gga gat gag att tac att gtc cgg gag ccg gag 1588Met Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu 510 515 520 agg tgc ttg cac aag cac aag cac aac tcg acc agg ccg gca cac ggc 1636Arg Cys Leu His Lys His Lys His Asn Ser Thr Arg Pro Ala His Gly 525 530 535 540 cga taaacaccac gcgggaatcg ggaggttaac tgctgtactg ctggagtaga 1689Arg tcgcgcggtg taatgacaac tatatagacg gttcgccaaa gcgtggaaat aaaaa 174426541PRTSecale cereale 26Met Trp Arg Gly Ser Leu Arg Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Thr Ala Ala Ala Glu Pro Gly Ser Thr Leu Met Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Asn Gly Trp Ala Pro Glu 50 55 60 Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85 90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Val Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly Asp Val Ser Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Lys Lys 275 280 285 Thr Phe Glu Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Ile Met Leu Ala Ala Tyr Asp Asp Tyr Ser Arg Ser Gly Glu Gln 325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ser Lys Val Asp Arg Ser Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ser Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu Arg Cys Leu His 515 520 525 Lys His Lys His Asn Ser Thr Arg Pro Ala His Gly Arg 530 535 540 271734DNASecale cerealeScPAPhy_a2 phytase cDNA(1)..(1734)CDS(14)..(1630)Phytase coding sequence 27aatgccaagc aac atg tgg ctg ggg tcg ctg cgg ctg ctg ctg ctg ctc 49 Met Trp Leu Gly Ser Leu Arg Leu Leu Leu Leu Leu 1 5 10 gcg gcg gcg gtg acg gcg gct gct gag ccg gcg tcc acg ctc atg ggc 97Ala Ala Ala Val Thr Ala Ala Ala Glu Pro Ala Ser Thr Leu Met Gly 15 20 25 ccg tca cgg ccg gtt acg gtg gcg ctg cgg gaa gac agg ggc cac gcg 145Pro Ser Arg Pro Val Thr Val Ala Leu Arg Glu Asp Arg Gly His Ala 30 35 40 gtg gac ctg ccg gac acg gac ccg cgg gtg cag cgc cgg gca aat ggc 193Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Asn Gly 45 50 55 60 tgg gct cct gag cag atc gcc gtc gcg ctc tcc gct gct ccc acc tct 241Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser 65 70 75 gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag atg ggt ggc acc gtc 289Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val 80 85 90 aag ccg ctg gac ccc ggc acg gtc ggt agc gtc gtg cgc tac gga ctc 337Lys Pro Leu Asp Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu 95 100 105 gcc gcc gat tct ttg gtt cgc gtg gcc acc ggc gac gcg ctc gtg tac 385Ala Ala Asp Ser Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr 110 115 120 agc cag ctc tac ccc ttc gag ggc ctc cag aac tac acc tcc ggc atc 433Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile 125 130 135 140 atc cac cac gtc cgc ctc caa ggg ctt gag cct ggg acg aag tac tac 481Ile His His Val Arg Leu Gln Gly Leu Glu Pro Gly Thr Lys Tyr Tyr 145 150 155 tac cag tgc ggc gac ccg gcc ctc ccg ggg acg atg agc gcc gtc cac 529Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Thr Met Ser Ala Val His 160 165 170 gcg ttc cgg acg atg ccg gcg gtc ggg ccg cgg agc tac ccg ggg agg 577Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg 175 180 185 atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acc tcc acc 625Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr 190 195 200 gtg gac cac atg atg agc aac cgg ccg gat ctg gtc gtc ctc gtc ggc 673Val Asp His Met Met Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly 205 210 215 220 gac gtg agc tac gcc aac ctg tac ctc acc aac ggc acc gga gcg gac 721Asp Val Ser Tyr Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp 225 230 235 tgc tac tcg tgc gcg ttc ggc aag tcg acg ccc atc cac gag acg tac 769Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr 240 245 250 cag ccg cgc tgg gac tac tgg gga agg tac atg gag gcg gtg acg tcg 817Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser 255 260 265 ggc acg ccg atg atg gtg gtg gag ggg aac cat gag ata gag gag cag 865Gly Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln 270 275 280 atc ggc aaa aag acg ttc gag gcg tac cgc tcc cgg ttc gcg ttt ccg 913Ile Gly Lys Lys Thr Phe Glu Ala Tyr Arg Ser Arg Phe Ala Phe Pro 285 290 295 300 tcg gcg gag aac ggg tcc ttc tcc ccc ttc tac tac tcc ttc gac gcc 961Ser Ala Glu Asn Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala 305 310 315 ggc ggg atc cat ttc atc atg ctc gcc gcc tac gcc gac tac agc aag 1009Gly Gly Ile His Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr Ser Lys 320 325 330 tca ggg gag cag tac aga tgg ctg gag aag gac ctg gca aag gtg gac 1057Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp 335 340 345 agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg cac gcg cca tgg tac 1105Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr 350 355 360 acc acc tac aag gct cac tac agg gag gtg gag tgc atg aga gtg gcc 1153Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala 365 370 375 380 atg gag gag ctg ctc tac tcc cac ggc ctg gac atc gct ttc acc ggc 1201Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly 385 390 395 cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac tac acg ctg 1249His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu 400 405 410 gat ccg tgc ggc gcc gtg cac atc tcg gtg ggc gac ggc ggg aac cgc 1297Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg 415 420 425

gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc ccg gac 1345Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp 430 435 440 ccg cgg ccc aag ccc aac gcc ttc atc ggc ggc ttc tgc ggc ttt aac 1393Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn 445 450 455 460 ttc acg tcc ggc ccg gcc gcc ggc agg tac tgc tgg gac cgg cag ccg 1441Phe Thr Ser Gly Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro 465 470 475 gac tac agc gcc tac cgg gag agc agc ttc ggc cac ggc atc ctc gag 1489Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu 480 485 490 gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg aac cag gac 1537Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp 495 500 505 atg tac ggg agc gcc gga gat gag att tac att gtc cgg gag ccg gag 1585Met Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu 510 515 520 agg tgc ttg cac aag cac aac tcg acc agg ccg gca cac ggc cga 1630Arg Cys Leu His Lys His Asn Ser Thr Arg Pro Ala His Gly Arg 525 530 535 taaacaccac gcgggaatcg ggagcttaac tgctgtactg ctggagtaga tcgcgcggtg 1690taatgataac tatatagacg gttcgcccaa gcgtggaaat aaaa 173428539PRTSecale cereale 28Met Trp Leu Gly Ser Leu Arg Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Thr Ala Ala Ala Glu Pro Ala Ser Thr Leu Met Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg Arg Ala Asn Gly Trp Ala Pro Glu 50 55 60 Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85 90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu Pro Gly Thr Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Met Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly Asp Val Ser Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Lys Lys 275 280 285 Thr Phe Glu Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Asn 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr Ser Lys Ser Gly Glu Gln 325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu Arg Cys Leu His 515 520 525 Lys His Asn Ser Thr Arg Pro Ala His Gly Arg 530 535 291773DNAHordeum vulgareHvPAPhy_a1 phytase cDNA(1)..(1773)CDS(40)..(1650)Phytase coding sequence 29agcatcccaa tcctctcaat gccaagcaac aacatcaac atg tgg tgg ggg tcg 54 Met Trp Trp Gly Ser 1 5 ctg ctg ctg ctc gcg gcg gcg gtg gcg gtg gct gcc gct gag ccg ccg 102Leu Leu Leu Leu Ala Ala Ala Val Ala Val Ala Ala Ala Glu Pro Pro 10 15 20 tcg acg ctc gct ggc ccg tcg cgg ccg gtg acg gtg acg ccg cgg gaa 150Ser Thr Leu Ala Gly Pro Ser Arg Pro Val Thr Val Thr Pro Arg Glu 25 30 35 aac agg ggc cac gcg gtg gac ctg ccg gac acg gac ccc cgg gtg cag 198Asn Arg Gly His Ala Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln 40 45 50 cgc cgg gcc acg ggc tgg gct ccc gag cag gtc gcc gtc gcg ctc tcc 246Arg Arg Ala Thr Gly Trp Ala Pro Glu Gln Val Ala Val Ala Leu Ser 55 60 65 gcc gct ccc acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag 294Ala Ala Pro Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln 70 75 80 85 atg ggc ggc acc gtg aag ccg ctg gac ccc cgc acg gtc ggc agc gtc 342Met Gly Gly Thr Val Lys Pro Leu Asp Pro Arg Thr Val Gly Ser Val 90 95 100 gtg cgc tac ggg ctc gcc gcc gac tct ttg gtt cgc gag gcc acc ggc 390Val Arg Tyr Gly Leu Ala Ala Asp Ser Leu Val Arg Glu Ala Thr Gly 105 110 115 gac gcg ctc gtg tac agc cag ctc tac ccc ttc gag ggc ctc cac aac 438Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly Leu His Asn 120 125 130 tac acc tcc ggc atc atc cac cac gtc cgc ctc caa ggg ctt gag cct 486Tyr Thr Ser Gly Ile Ile His His Val Arg Leu Gln Gly Leu Glu Pro 135 140 145 ggg acc aag tac tac tac cag tgc ggc gac ccg gcc atc ccg ggg gcg 534Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro Ala Ile Pro Gly Ala 150 155 160 165 atg agc gcc gtc cac gcg ttc cgg acg atg ccg gcg gcg ggg ccg cgg 582Met Ser Ala Val His Ala Phe Arg Thr Met Pro Ala Ala Gly Pro Arg 170 175 180 agc tac ccg ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac 630Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr 185 190 195 aac acc acc tcg acc gtg gac cac atg acg agc aac cgg ccg gac ctg 678Asn Thr Thr Ser Thr Val Asp His Met Thr Ser Asn Arg Pro Asp Leu 200 205 210 gtc gtc ctc gtc ggc gac gtc agc tac gcc aac atg tac ctc acc aac 726Val Val Leu Val Gly Asp Val Ser Tyr Ala Asn Met Tyr Leu Thr Asn 215 220 225 ggc acc gga acg gac tgc tac tcc tgc tcc ttc ggc aag tca acg ccc 774Gly Thr Gly Thr Asp Cys Tyr Ser Cys Ser Phe Gly Lys Ser Thr Pro 230 235 240 245 atc cac gaa acc tac cag ccg cgc tgg gac tac tgg gga agg tac atg 822Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met 250 255 260 gag ccg gtg acg tcg agc acg ccg atg atg gtg gtg gaa ggg aac cac 870Glu Pro Val Thr Ser Ser Thr Pro Met Met Val Val Glu Gly Asn His 265 270 275 gag ata gag gag cag atc ggc aac aag acg ttc gcg gcc tac cgc tcc 918Glu Ile Glu Glu Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg Ser 280 285 290 cgg ttc gcg ttc ccg tcg gcg gag agc ggg tcc ttc tcc ccc ttc tac 966Arg Phe Ala Phe Pro Ser Ala Glu Ser Gly Ser Phe Ser Pro Phe Tyr 295 300 305 tac tcc ttc gac gcc ggc ggg atc cac ttc atc atg ctc ggc gcc tac 1014Tyr Ser Phe Asp Ala Gly Gly Ile His Phe Ile Met Leu Gly Ala Tyr 310 315 320 325 gcc gac tac ggc agg tca ggg gag cag tac aga tgg ctg gag aag gac 1062Ala Asp Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp 330 335 340 ctg gcg aag gtg gac agg tcg gtg acc ccc tgg ctg gtg gcc ggc tgg 1110Leu Ala Lys Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp 345 350 355 cac gcg cca tgg tac acc acg tac aag gct cac tac agg gag gtg gag 1158His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu 360 365 370 tgc atg aga gtg gcc atg gag gag ctg ctc tac tcc cac ggc ctc gac 1206Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp 375 380 385 atc gcc ttc acc ggc cat gtg cac gcg tac gag cgc tcc aac cgg gtg 1254Ile Ala Phe Thr Gly His Val His Ala Tyr Glu Arg Ser Asn Arg Val 390 395 400 405 ttc aac tac acg ctg gac ccg tgc ggc gcc gtg tac atc tcg gtg ggc 1302Phe Asn Tyr Thr Leu Asp Pro Cys Gly Ala Val Tyr Ile Ser Val Gly 410 415 420 gac ggc ggg aac cgg gag aag atg gcc acc acc cac gcc gac gag ccg 1350Asp Gly Gly Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro 425 430 435 ggg cac tgc ccg gac ccg cgg cca aag ccc aac gcc ttc att gcc ggc 1398Gly His Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Ala Gly 440 445 450 ttc tgc gcc ttt aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc 1446Phe Cys Ala Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys 455 460 465 tgg gac cgg cag ccg gac tac agc gcg tac cgg gag agc agc ttc ggc 1494Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly 470 475 480 485 cat ggc atc ctc gag gtg aag aac gag acg cac gct ctg tgg aga tgg 1542His Gly Ile Leu Glu Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp 490 495 500 cac agg aac cag gac ctg tac ggg agc gcc gga gat gag att tac att 1590His Arg Asn Gln Asp Leu Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile 505 510 515 gtt cgg gag ccg gag agg tgc ttg cac aag cac aac tcg acc agg ccc 1638Val Arg Glu Pro Glu Arg Cys Leu His Lys His Asn Ser Thr Arg Pro 520 525 530 gca cac ggt ccg taaaaatggc aactacagac ggttcgccca agccggagat 1690Ala His Gly Pro 535 taactgttct accactactg gagtatatcg ccccgtgcaa taatggcaac tatagacggt 1750tcgcccatgc gtggaaataa aaa 177330537PRTHordeum vulgare 30Met Trp Trp Gly Ser Leu Leu Leu Leu Ala Ala Ala Val Ala Val Ala 1 5 10 15 Ala Ala Glu Pro Pro Ser Thr Leu Ala Gly Pro Ser Arg Pro Val Thr 20 25 30 Val Thr Pro Arg Glu Asn Arg Gly His Ala Val Asp Leu Pro Asp Thr 35 40 45 Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu Gln Val 50 55 60 Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser Trp Ile 65 70 75 80 Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp Pro Arg 85 90 95 Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser Leu Val 100 105 110 Arg Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe 115 120 125 Glu Gly Leu His Asn Tyr Thr Ser Gly Ile Ile His His Val Arg Leu 130 135 140 Gln Gly Leu Glu Pro Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro 145 150 155 160 Ala Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr Met Pro 165 170 175 Ala Ala Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp 180 185 190 Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met Thr Ser 195 200 205 Asn Arg Pro Asp Leu Val Val Leu Val Gly Asp Val Ser Tyr Ala Asn 210 215 220 Met Tyr Leu Thr Asn Gly Thr Gly Thr Asp Cys Tyr Ser Cys Ser Phe 225 230 235 240 Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr 245 250 255 Trp Gly Arg Tyr Met Glu Pro Val Thr Ser Ser Thr Pro Met Met Val 260 265 270 Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys Thr Phe 275 280 285 Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser Gly Ser 290 295 300 Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His Phe Ile 305 310 315 320 Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Gln Tyr Arg 325 330 335 Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser Val Thr Pro Trp 340 345 350 Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His 355 360 365 Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr 370 375 380 Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala Tyr Glu 385 390 395 400 Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly Ala Val 405 410 415 Tyr Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala Thr Thr 420 425 430 His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys Pro Asn 435 440 445 Ala Phe Ile Ala Gly Phe Cys Ala Phe Asn Phe Thr Ser Gly Pro Ala 450 455 460 Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg 465 470 475 480 Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu Thr His 485 490 495 Ala Leu Trp Arg Trp His Arg Asn Gln Asp Leu Tyr Gly Ser Ala Gly 500 505 510 Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu Arg Cys Leu His Lys His 515 520 525 Asn Ser Thr Arg Pro Ala His Gly Pro 530 535 3119DNATriticum sp.Triticum spp PAPhy gene forward primer(1)..(19)PAP ex3 Fw primer 31cttgagcctg ggacgaagt

193218DNATriticum sp.Triticum spp PAPhy gene reverse primer(1)..(18)PAP ex3 Rv primer 32gagaaggacc cgctctcc 183320DNATriticum sp.Triticum spp PAPhy promoter forward primer(1)..(20)TaPAPhy_a1-pro-ex1 Fw 33ttatgtgtcc gcgtgaagtg 203420DNATriticum sp.Triticum spp PAPhy promoter reverse primer(1)..(20)TaPAPhy_a1-pro-ex1 Rv 34accaagagtc aatgccatcc 203523DNATriticum sp.Triticum spp PAPhy promoter forward primer 2(1)..(23)TaPAPhy_a1 -311 cons Fw 35tttggacgag ccatagctgc ata 233620DNATriticum sp.Triticum spp PAPhy promoter reverse primer 2(1)..(20)TaPAPhy_a1 167 Rv 36cgctgcaccc gggggtccgt 203722DNATriticum sp.Triticum spp PAPhy enhancer forward primer(1)..(22)AS-PCR enhancer forward primer 37caagctacac tttgtagaac ac 223820DNATriticum sp.Triticum spp PAPhy gene reverse primer(1)..(20)AS-PCR enhancer reverse primer 38cgctgcaccc gggggtccgt 203925DNATriticum sp.HighPhy SNP forward primer(1)..(25) 39tttcaagcta cactttgtag aacac 254020DNATriticum sp.HighPhy SNP reverse primer(1)..(20) 40gcactagcca agtttggacg 204125DNATriticum sp.Wildtype Phy SNP forward primer(1)..(25) 41tttcaagcta cactttgtag aacat 254220DNATriticum sp.Wildtype Phy SNP reverse primer(1)..(20) 42gcactagcca agtttggacg 20432090DNATriticum aestivumWild type TaPAPhy-a1 promoter(1)..(2090)Wild type TaPAPhy-a1 promoter and 5' untranslated region 43aactcatgct cctaatgtga agcataaaat tatgtgtccg cgtgaagtgc atgtgtactc 60catgaaaaac ctataaaatg agaaaaccca aaaaaactag aaaaatcttt gcaaaatcca 120aaaacctaaa aaaaatcccc caaaaaagat tcatgtggag gtgtacgcta tgtggcgaca 180actgaatgca ccacgtggcg cggtcgtgtg ctcacaccgg ggaaagtgcc accgtggggt 240accccctaat tatttgctcc aaaagtttgt tgctttgtaa aaaagttata aatcaaacat 300aatgggcctg atctcattca gctcgaactc cacacacaaa gctagatcga atgctctaac 360tttgcgaagc tggaatccat cgtctccaag aggcctagtg cgatttttcg aagctagtat 420ttcatgattt aaaaattcac tatgtttatg aacaactctc gactagagag tattcttagt 480aatgtgataa gagtaacaca acgatttttt taatataggt ttggtttgca attgtattga 540tagagcgaga cctaatccta tttgggaagg cctcaggtag ttaggacggt tgtagctcag 600tcgaggtcag tttgagtcgt aatgcaactc ttcgcacttg acttcaaaat gacttggggc 660tattgaaagg tccaaaagca acgatgtcgc cgatgagttt attcaaagtg agagtacatg 720tccatgaggc taagagaagg ggtgccttga caaattatca agactgcacc aaggcgatgg 780taggatatga gaggtatgat gataagtcta tatccatgag tccataaaag tagtcaaagg 840tggatccata gtccatggta cattaatcat tttcatccat gtgtgaatgg acctttagct 900agttgggcct catttagatt tgggctcatt tccttctata cttcattctt gactctcttt 960ttttttgcga aaaggattag atctcttata aaaattcatc ggaggtacaa agtatctcaa 1020acataataaa aactacatcg agattccgag accaacgaac gaccaccact gccactagaa 1080taagctgctg acgcgccacc ggagccgcct tgaccttgtc aatgacagcc gggaagtctt 1140cacgcacgta cccctaagga ccaacgctct ggagtcgcag tcgtcgccat tgaacgcttg 1200catagatctg aagcatttga caccaaatct cgccacatga cgagaaaacg ctaaccccac 1260cgccccaaga agacaacaag aatctatgtc ggagctccgt caactaccca gatgagtgaa 1320ctcgaggagg atcggagccc ggaagacaaa ctcgaagaag aagccttgcc atccacccga 1380aggccgcacc tatgaggact aaaaaaacct aacctaattt tttttgataa aagaagggtt 1440ttccccttcc gattttcatt aaagaaaacc aaaccaaacc taaactacta accggagcga 1500aggcatcggg attctcgtcc gcgccaccgg ccgccggagc ggtaggcaga gtggaggcaa 1560atccacggac tcaccggtga agtctagagg ggtctagccg cctaggatca ttatgggagg 1620taaacaagag tgatttcaat gttgactttg acctttcatt ttttgccttc tccttttatt 1680tgttgaccat gcaattttgc ttggacttct attaatcttg ttaatggagt tggatatatg 1740cgttgatcgt tttagacctt attcaccggc ttgaactttt ttggacgagc catagctgca 1800tattttgttg cttgcgcttt agtttcaagc tacactttgt agaacatgag tcatgcatgg 1860gacgaaggcg tccaaacttg gctagtgcag ctgcctgcgc gttcacaagg caccaaagcg 1920caggcggcaa agtttgctcg tttattatct tggcggtcca agatgggcgg caggttccag 1980acgatggacg aagacccacc gagttccact tccggctcca acctcctctg cccgattcat 2040ataagtttcc tgccaaaggc attccaattc tgtcaatgcc aagcaacaac 2090442060DNATriticum aestivumHighPhy mutant TaPAPhy-a1 promoter(1)..(2060)HighPhy mutant TaPAPhy-a1 promoter and 5' untranslated region 44ttatgtgtcc gcgtgaagtg catctgtact ccatgaaaaa cctataaaat gagaaaaccc 60aaaaaaaact agaaaaatct ttgcaaaatc caaaaaccta aaaaaaatcc cccaaaaaag 120attcatgtgg aggtgtacgc tatgtggcga caactgaatg caccacgtgg cgcggtcgtg 180tgctcacacc ggggaaagtg ccaccgtggg gtacccccta attatttgct ccaaaagttt 240gttgctttgt aaaaaaaata taaatcaaac ataatgggcc tgatctcatt cagctcgaac 300tccacacaca aagctagatc gaatgctcta actttgcgaa gctggaatcc atcgtctcca 360agaggcctag tgcgattttt cgaagctagt atttcatgat ttaaaaattc actatgttta 420tgaacaactc tcgactagag agtattctta gtaatgtgat aagagtaaca cagcgatttt 480tttaatatag gttcggtttg caattgtatt gatagagcga gacctaatcc tatttgggaa 540ggcctcaggt agttaggacg gttgtagctc agtcgaggtc agtttgagtc gtaatgcaac 600tcttcgcact tgacttcaaa atgacttggg gctattgaaa ggtccaaaag caacgatgtc 660gccgatgagt ttattcaaag tgagagtaca tgtccatgag gctaagagaa ggggtgcctt 720gacaaattat caagactgca ccaaggcgat ggtaggatat gagaggtatg atgataagtc 780tatatccatg agtccataaa agtagtcaag ggtggatcca tagtccatgg tacattaatc 840attttcatcc atgtgtgaat ggacctttag ctagttgggc ctcatttaga tttgggctca 900tttccttcta gacttcattc ttgactcttt tttttgcgaa aaggattaga tctcttataa 960aaattcatcg gaggtacaaa gtatctcaaa cataataaaa actacatcga gattccgagc 1020ccaacgaacg accaccactg ccactagaat aagctgctga cgcgccaccg gagccgcctt 1080gaccttgtca atgacagccg ggaagtcttc acgcacgtac ccctaaggat cgacgctttg 1140gagtcgcagt cattgccatt gaacacttgc atagatctga agcatttgac accaaatctc 1200gccacatgac gagaaaccct aaccccaccg ccccaagaag acaacaagaa tctacgtcgg 1260agctccgtca actacccaga tgagtgaact cgaggaggat cggagcccgg aagacaaact 1320cgaagaagaa gccttgccat ccacccgaag gccgcactta cgaggactaa aaaaacctaa 1380cctaaatttt tttttgataa aagaagggtt ttccccttcc gattttcatt aaagaaaacc 1440aaacctaacc taaactacta accggagcga aggcatcggg attctcgtcc gcgccatcgg 1500ccgccggagc ggtaggcaga gtggaggcaa atccacggac tcaccggtga agtctggagg 1560ggtctagccg tctaggatca ttatgggagg taaacaagag tgatttcaat gttgactttg 1620acctttcatt ttttgccttc tccttttatt tgttgaccat gcaattttgc ttggacttct 1680attaatcttg ttaatggagt tggatatatg cgttgatcgt tttagacctt attcaccggc 1740ttgaactttt ttggacgagc catagctgca tattttgttg cttgcgcttt agtttcaagc 1800tacactttgt agaacacgag tcatgcatgg gacgaaggcg tccaaacttg gctagtgcag 1860ctgcctgcgc gttcacaagg caccaaagcg caggcggcaa agtttgctcg tttattatct 1920tggcggtcca agatgggcgg caggttccag acgatggacg aagacccacc gagttccact 1980tccggctcca acctcctctg cccgattcat ataagtttcc tgccaaaggc atcccaattc 2040tgtcaatgcc aagcaacaac 2060454814DNATriticum aestivumpromoter(1)..(2090)Promoter and '5' untranslated region 45aactcatgct cctaatgtga agcataaaat tatgtgtccg cgtgaagtgc atgtgtactc 60catgaaaaac ctataaaatg agaaaaccca aaaaaactag aaaaatcttt gcaaaatcca 120aaaacctaaa aaaaatcccc caaaaaagat tcatgtggag gtgtacgcta tgtggcgaca 180actgaatgca ccacgtggcg cggtcgtgtg ctcacaccgg ggaaagtgcc accgtggggt 240accccctaat tatttgctcc aaaagtttgt tgctttgtaa aaaagttata aatcaaacat 300aatgggcctg atctcattca gctcgaactc cacacacaaa gctagatcga atgctctaac 360tttgcgaagc tggaatccat cgtctccaag aggcctagtg cgatttttcg aagctagtat 420ttcatgattt aaaaattcac tatgtttatg aacaactctc gactagagag tattcttagt 480aatgtgataa gagtaacaca acgatttttt taatataggt ttggtttgca attgtattga 540tagagcgaga cctaatccta tttgggaagg cctcaggtag ttaggacggt tgtagctcag 600tcgaggtcag tttgagtcgt aatgcaactc ttcgcacttg acttcaaaat gacttggggc 660tattgaaagg tccaaaagca acgatgtcgc cgatgagttt attcaaagtg agagtacatg 720tccatgaggc taagagaagg ggtgccttga caaattatca agactgcacc aaggcgatgg 780taggatatga gaggtatgat gataagtcta tatccatgag tccataaaag tagtcaaagg 840tggatccata gtccatggta cattaatcat tttcatccat gtgtgaatgg acctttagct 900agttgggcct catttagatt tgggctcatt tccttctata cttcattctt gactctcttt 960ttttttgcga aaaggattag atctcttata aaaattcatc ggaggtacaa agtatctcaa 1020acataataaa aactacatcg agattccgag accaacgaac gaccaccact gccactagaa 1080taagctgctg acgcgccacc ggagccgcct tgaccttgtc aatgacagcc gggaagtctt 1140cacgcacgta cccctaagga ccaacgctct ggagtcgcag tcgtcgccat tgaacgcttg 1200catagatctg aagcatttga caccaaatct cgccacatga cgagaaaacg ctaaccccac 1260cgccccaaga agacaacaag aatctatgtc ggagctccgt caactaccca gatgagtgaa 1320ctcgaggagg atcggagccc ggaagacaaa ctcgaagaag aagccttgcc atccacccga 1380aggccgcacc tatgaggact aaaaaaacct aacctaattt tttttgataa aagaagggtt 1440ttccccttcc gattttcatt aaagaaaacc aaaccaaacc taaactacta accggagcga 1500aggcatcggg attctcgtcc gcgccaccgg ccgccggagc ggtaggcaga gtggaggcaa 1560atccacggac tcaccggtga agtctagagg ggtctagccg cctaggatca ttatgggagg 1620taaacaagag tgatttcaat gttgactttg acctttcatt ttttgccttc tccttttatt 1680tgttgaccat gcaattttgc ttggacttct attaatcttg ttaatggagt tggatatatg 1740cgttgatcgt tttagacctt attcaccggc ttgaactttt ttggacgagc catagctgca 1800tattttgttg cttgcgcttt agtttcaagc tacactttgt agaacatgag tcatgcatgg 1860gacgaaggcg tccaaacttg gctagtgcag ctgcctgcgc gttcacaagg caccaaagcg 1920caggcggcaa agtttgctcg tttattatct tggcggtcca agatgggcgg caggttccag 1980acgatggacg aagacccacc gagttccact tccggctcca acctcctctg cccgattcat 2040ataagtttcc tgccaaaggc attccaattc tgtcaatgcc aagcaacaac atg tgg 2096 Met Trp 1 tgg ggg tcg ctg ctg ctg ctg ctg ctg ctc gcg gcc gcg gtg gcg gcg 2144Trp Gly Ser Leu Leu Leu Leu Leu Leu Leu Ala Ala Ala Val Ala Ala 5 10 15 gct gct gag ccg gcg tcg acg ctc acg ggc ccg tca cgg ccg gtc acg 2192Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro Val Thr 20 25 30 gtg gcg ctg cgg gaa gac agg ggc cac gcg gtg gac ctg ccg gac acg 2240Val Ala Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro Asp Thr 35 40 45 50 gac ccc cgg gtg cag cgc cgg gcc acg ggc tgg gct ccc gag cag atc 2288Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu Gln Ile 55 60 65 gcc gtc gcg ctc tcc gcc gct ccc acc tct gcc tgg gtc tcc tgg atc 2336Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser Trp Ile 70 75 80 acc ggt agtaatctgc tcaccggact ctgattcctg ggttggatgg cattgactct 2392Thr Gly tggttccgca ggg gaa ttc cag atg ggc ggc acc gtc aag ccg ctg gac 2441 Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85 90 95 ccc ggc acg gtc ggc agc gtc gtg cgc tac ggg ctc gcc gcc gat tct 2489Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 ttg gtt cgc cag gcc agc ggc gac gcg ctc gtg tac agc cag ctc tac 2537Leu Val Arg Gln Ala Ser Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 ccc ttc gag ggt ctc cag aac tac acc tcc ggc atc atc cac cac gtc 2585Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 cgc ctc caa ggt gaccgccgtc gttcgttgat cccctgttcc acaatcaatt 2637Arg Leu Gln Gly 145 tttttttttg catatttttt gggagtgcaa tgaagtatct gcatgcaggg ctt gag 2693 Leu Glu 150 cct gcg acg aag tac tac tac cag tgc ggc gac ccg gcc ctc ccg ggg 2741Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly 155 160 165 gcg atg agc gcc gtc cac gcg ttc cgg acg atg ccg gcg gtg ggg ccg 2789Ala Met Ser Ala Val His Ala Phe Arg Thr Met Pro Ala Val Gly Pro 170 175 180 cgg agc tac ccg ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg 2837Arg Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr 185 190 195 tac aac acc acc tcc acc gtg gac cac atg gcg agc aac cgg ccg gac 2885Tyr Asn Thr Thr Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp 200 205 210 ctg gtc ctc ctc gtc ggc gac gtg tgc tac gcc aac atg tac ctc acc 2933Leu Val Leu Leu Val Gly Asp Val Cys Tyr Ala Asn Met Tyr Leu Thr 215 220 225 230 aac ggc acc gga gcg gac tgc tac tcg tgc gcg ttc ggc aag tcg acg 2981Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr 235 240 245 ccc atc cac gag acg tac cag ccg cgc tgg gac tac tgg gga agg tac 3029Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr 250 255 260 atg gag gcg gtg acg tcg ggg acg ccg atg atg gtg gtg gaa ggg aac 3077Met Glu Ala Val Thr Ser Gly Thr Pro Met Met Val Val Glu Gly Asn 265 270 275 cat gag ata gag gag cag atc ggg aac aag acg ttc gcg gcc tac cgc 3125His Glu Ile Glu Glu Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg 280 285 290 tcc cgg ttc gcg ttc ccg tcg acg gag agc ggg tcc ttc tcc ccc ttc 3173Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser Gly Ser Phe Ser Pro Phe 295 300 305 310 tac tac tcg ttc gac gcc ggc ggg atc cat ttc ctc atg ctc ggc gcc 3221Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His Phe Leu Met Leu Gly Ala 315 320 325 tac gcc gac tac ggc agg tca ggg gag cag tac aga tgg ctg gag aag 3269Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys 330 335 340 gac ctg gcg aag gtg gac agg tcg gtg acg ccg tgg ctg gtc gcc ggc 3317Asp Leu Ala Lys Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly 345 350 355 tgg cac gcg cca tgg tac acc acc tac aag gct cac tac agg gag gtg 3365Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val 360 365 370 gag tgc atg aga gtg gcc atg gag gag ctg ctc tac tcc cac ggc ctc 3413Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr Ser His Gly Leu 375 380 385 390 gac atc gcc ttc acc ggc cat gta aca cct caa tca cac cct ctg act 3461Asp Ile Ala Phe Thr Gly His Val Thr Pro Gln Ser His Pro Leu Thr 395 400 405 gac acg gat cga cct acc tcc gtt ctc tgg aca ttg gca agc agc cga 3509Asp Thr Asp Arg Pro Thr Ser Val Leu Trp Thr Leu Ala Ser Ser Arg 410 415 420 gag tga tca ctc gct tgc tgt gtg atg cag gtg cac gcg tat gag cgc 3557Glu Ser Leu Ala Cys Cys Val Met Gln Val His Ala Tyr Glu Arg 425 430 435 tcc aac cgg gtg ttc aac tac acg ctg gac ccg tgc ggc gcc gtg cac 3605Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly Ala Val His 440 445 450 atc tcg gtg ggc gac ggc ggg aac cgc gag aag atg gcc acc acc cac 3653Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala Thr Thr His 455 460 465 gcc gac gag ccg ggg cac tgc ccg gac ccg cgg ccc aag ccc aac gcc 3701Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala 470 475 480 485 ttc atc ggc ggc ttc tgc gcc tcc aac ttc acg tcc ggc ccg gcc gcc 3749Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala 490 495 500 ggc agg ttc tgc tgg gac cgg cag ccg gac tac agc gcc tac cgg gag 3797Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu 505 510 515 agc agc ttc ggc cac ggc atc ctc gag gta cgtacgtacg aggaaaacaa 3847Ser Ser Phe Gly His Gly Ile Leu Glu Val 520 525 gatcgaagag aattctgacc agctagatat atggttcgtt tgaccgatgt gagacgacgc 3907aattggttca cgcaggtg aag aac gag acg cac gct ctg tgg aga tgg cac 3958 Lys Asn Glu Thr His Ala Leu Trp Arg Trp His 530 535 agg aac cag gac cac tac ggg agc gcc gga gat gag att tac att gtc 4006Arg Asn Gln Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val 540 545 550

cgg gag ccg cac agg tgc ttg cac aag cac aac tcg agc agg ccg gca 4054Arg Glu Pro His Arg Cys Leu His Lys His Asn Ser Ser Arg Pro Ala 555 560 565 570 cac ggt cga tca aac acc aca cgg gaa tcg gga ggt taaccgttgt 4100His Gly Arg Ser Asn Thr Thr Arg Glu Ser Gly Gly 575 580 accactggag tagatcgcgt ggtgtaatgg caactgtata gacggttcgc ccaagcgtgg 4160aaataaaaag ttataccaac taaaacatgg attgggcagt gctaggcgct ggccggccgg 4220ccggcccaaa tttccaacgg tcgtgctagc cgcccgacac cagtcgcact ggccgttgga 4280tctagcaaaa aaaaaaaaaa accggttcgc gaagctcccc accccaccca caatctcgcg 4340cagctaaccc cgttgccgcg ctcaccctcc acctgggcgg cgacaccctc cacctatgcc 4400cgccggcgct cgtccttggt ttcgtgcgtt tctgctccgg tgctcccctc ctgggctgaa 4460cgcgaggtgg aaaaacacat cgacggccag gatgaaccaa aaacggttaa taacgagggg 4520cacgatcgtc tttgttgccc cgcgtatagc cgtcgaggag cccagggagg cccgtacgag 4580cccggttaga tcgtatgccc ggccgtatac gtatttgtat atggcggcgt ttcgtgcacg 4640cgtggagccg cccgcgcgtg gggcagcacg tgtcacgggt agattccaaa atcgtcccat 4700catataaatg tggacggcaa ccacctccgg ccgcatcgcc caccattccc ccccgccgca 4760tcgtctccct ctccccactc ccaattcccc actccgtttc ctctccaaca ttct 48144625DNAHordeum vulgareHvPAPhy_a SDmut Fw primer(1)..(25)HvPAPhy_a SDmut Fw primer for mutant enhancer 46gtagaacacg agccatgcat gagac 254725DNAHordeum vulgareHvPAPhy_a SDmut Rv primer(1)..(25)HvPAPhy_a SDmut Rv primer for mutant enhancer 47tggctcgtgt tctacaaaat gtagc 254820DNAHordeum vulgareCis to GUS Fw primer(1)..(20) 48tcgagtcgac gttccttgac 204923DNAHordeum vulgareCis to GUS Rv primer(1)..(23) 49gttgatgttg ttgcttggca ttg 235036DNAEscherichia coliGUS Fw m. overhang primer(1)..(36) 50agcaacaaca tcaacatgtt acgtcctgta gaaacc 365138DNAEscherichia coliGUS Rv m. overhang primer(1)..(38) 51ggaacgtcga ctcgactatg accatgatta cgaattcc 38528132DNAHordeum vulgarepCLEAN-G185-wt-proGUS(1)..(8132)Vector backbone, pCLEAN-G185(1)..(2599)HvPAPhy_a promoter(2600)..(4799)CDS(4800)..(6611)UidA gene encoding GUS 52catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 60tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 120gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 180ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 240cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 300caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 360ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 420taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 480taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac 540cttcggaaga agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 600tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 660gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 720catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa 780atcaatctaa agtatatatg tgtaacattg gtctagtgat tagaaaaact catcgagcat 840caaatgaaac tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg 900tttctgtaat gaaggagaaa actcaccgag gcagttccat aggatggcaa gatcctggta 960tcggtctgcg attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa 1020aataaggtta tcaagtgaga aatcaccatg agtgacgact gaatccggtg agaatggcaa 1080aagtttatgc atttctttcc agacttgttc aacaggccag ccattacgct cgtcatcaaa 1140atcactcgca tcaaccaaac cgttattcat tcgtgattgc gcctgagcga gacgaaatac 1200gcgatcgctg ttaaaaggac aattacaaac aggaatcgaa tgcaaccggc gcaggaacac 1260tgccagcgca tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc 1320tgttttccct gggatcgcag tggtgagtaa ccatgcatca tcaggagtac ggataaaatg 1380cttgatggtc ggaagaggca taaattccgt cagccagttt agtctgacca tctcatctgt 1440aacaacattg gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt 1500cccatacaat cggtagattg tcgcacctga ttgcccgaca ttatcgcgag cccatttata 1560cccatataaa tcagcatcca tgttggaatt taatcgcggc cttgagcaag acgtttcccg 1620ttgaatatgg ctcataacac cccttgtatt actgtttatg taagcagaca gttttattgt 1680tcatgatgat atatttttat cttgtgcaat gtaacatcag agattttgag acacaacgtg 1740gctttgttga ataaatcgaa cttttgctga gttgaaggat cagatcacgc atcttcccga 1800caacgcagac cgttccgtgg caaagcaaaa gttcaaaatc accaactggt ccacctacaa 1860caaagctctc atcaaccgtg gctccctcac tttctggctg gatgatgggg cgattcaggc 1920gatccccatc caacagcccg ccgtcgagcg ggctttttta tccccggaag cctgtggata 1980gagggtagtt atccacgtga aaccgctaat gccccgcaaa gccttgattc acggggcttt 2040ccggcccgct ccaaaaacta tccacgtgaa atcgctaatc agggtacgtg aaatcgctaa 2100tcggagtacg tgaaatcgct aataaggtca cgtgaaatcg ctaatcaaaa aggcacgtga 2160gaacgctaat agccctttca gatcaacagc ttgcaaacac ccctcgctcc ggcaagtagt 2220tacagcaagt agtatgttca attagctttt caattatgaa tatatatatc aattattggt 2280cgcccttggc ttgtggacaa tgcgctacgc gcaccggctc cgcccgtgga caaccgcaag 2340cggttgccca ccgtcgagcg cctttgccca caacccggcg gccggccgca acagatcgtt 2400ttataaattt ttttttttga aaaagaaaaa gcccgaaagg cggcaacctc tcgggcttct 2460ggatttccga tccccggaat tagatccgtt taaactacgt aagatcttgg caggatatat 2520tgtggtgtaa acgttcctgc ggcggtcgag atggatcttg gcaggatata ttgtggtgta 2580aacgttcctg cggccgcatc ttgggcaaca tatcaggggc agcgccattg ccctgcgact 2640gacggcggcg gtggaggagc ttggggcaga catgagctga gaacgacgag agagaggagt 2700ggtggcgggc gagacagagg agcgacatga ttgaagaaga gcagcgggat tgaggattag 2760ggattcctgc gattttacac ttgacctctc cataaaagat tggcctaatc gaagctgaga 2820acgtggaggt caacaagtgg tcaaacgagc ctgtacgcac cgcatacgag caacagtgat 2880cggattttca cgtcacatcg tatatagtga tcgtaaaagc catattctaa agttggatga 2940ccgtattgtg cttccatgtc aactgcaagg accgtgagtg tatttatctc taaaatataa 3000atcaaatata atggtgggct tcttcagacc tcattcagct caaaatccgc ccatgaagcc 3060aatttgaatg ctctaacttt tgcgaagctg gaatctattg tatccaagac tagtgttttc 3120aaagatagtc ttttcggaat ttcaaaatca ctatgtgtgt tcgtcgtatg aacaactctc 3180gactagagag tattcttaat aatgcgataa gagtataaca taacaatttt tttgaatgta 3240ggtttagttg gtctccatgg agcgagacct agtcctattt ggggaggcct ctcgtagttt 3300ggatggacat agttctgtcg gttcaggttg taatgcaact cctcgcactt gactctaaaa 3360tgacttaggc tattgaaagg cccaaaaaca atagtattct tcccttgagt tcattcaagt 3420gagagtatat gtccatgggg ctaagagaag gggtcccttg acaaatgatc aaggttgcgc 3480aaggtgatga taggtatatt ggtaaatctg tatccacgag ttcatgaagt attcaaaggt 3540gggggtctat agtccatggt acatcaatca tttccaccca tgtatgaatg ggcctttggc 3600tagttgggct catttagatt tgggctcagt tacttcttgc cttaaatatt gactttgaca 3660tttcattttg gtttcccttt ttatttgttg accatgataa tttgcttggc cttttattta 3720attttttatg gttttgatta ttttttaaac acaatacaga cgaaaacatt catgtacaca 3780cacatgcatt catctttatg aacatacaca tccacatcat gtccctatca tcttgaaatt 3840tatgaagtca tagtagacac ctagtcgtcg aggggaattc tcctcggatt gaatgtgtat 3900cgtcgaaaat tgtgaaataa atgtgagcgc caggacttga atcttgatgg actaggataa 3960cacagtttct ctaaccatcc aaccgtatgt tggttcgcga tagtttggat tgcttaccac 4020atgtgtcatg tggttgctag gacttccatt aatctggccg aaccttgtta attgagttgg 4080atatttcttg accattttag accttattaa gagcatcttc aacaacagtg taaaaaatcc 4140gcgcccaata aatttttagc gcgccactgt agcactttta aagcgcgggg acggaagcat 4200cttcaataga cacgcgctaa tgcggcgccc aatccacccc ggtccagcga cccacccaca 4260acagctcaga gtttgctgcg cgcgcaagcc ggcacaccaa atatgctgtc cgcgatagcg 4320tttttaagcg cgtgcccaaa attttttagt gcgagcacag ttttgcagcg tctgttggag 4380ctgttcggcg ccaaaaaacg aatcttttaa cgcgcggtgt agttttgagg cgtctgttgg 4440agatggtcta accggcttga accgtgttga aaaaaaaacc cggcttgaat ttttgttgac 4500gagccatagt tgcatattac gtacgttact tgctctttaa tttcaagcta cattttgtag 4560aacatgagcc atgcatgaga cgtaggcgtc caaactttgg ctagcgcagc tgcatgcacg 4620tccacaaggc accaaaggcg caggcggcaa ctttgctcgt ttattttctt gcgggtccaa 4680gatgagttcc agaccatgga cgaattccac ttcgggctcc caatctcctc tgccggattc 4740ctataagttt cctgccaaga agcatcccaa tcccctcaat gccaagcaac aacatcaac 4799atg tta cgt cct gta gaa acc cca acc cgt gaa atc aaa aaa ctc gac 4847Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 ggc ctg tgg gca ttc agt ctg gat cgc gaa aac tgt gga att gat cag 4895Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 cgt tgg tgg gaa agc gcg tta caa gaa agc cgg gca att gct gtg cca 4943Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 ggc agt ttt aac gat cag ttc gcc gat gca gat att cgt aat tat gcg 4991Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca 5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc gat gcg gtc act cat tac ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag ggc ggc tat acg 5135Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc gat gtc acg ccg tat gtt att gcc ggg aaa agt gta 5183Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 cgt atc acc gtt tgt gtg aac aac gaa ctg aac tgg cag act atc ccg 5231Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 ccg gga atg gtg att acc gac gaa aac ggc aag aaa aag cag tct tac 5279Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 ttc cat gat ttc ttt aac tat gcc gga atc cat cgc agc gta atg ctc 5327Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 tac acc acg ccg aac acc tgg gtg gac gat atc acc gtg gtg acg cat 5375Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc 5423Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 aat ggt gat gtc agc gtt gaa ctg cgt gat gcg gat caa cag gtg gtt 5471Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 gca act gga caa ggc act agc ggg act ttg caa gtg gtg aat ccg cac 5519Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc tat gaa ctg tgc gtc aca gcc 5567Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa agc cag aca gag tgt gat atc tac ccg ctt cgc gtc ggc atc cgg 5615Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 tca gtg gca gtg aag ggc gaa cag ttc ctg att aac cac aaa ccg ttc 5663Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 tac ttt act ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa 5711Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg gac tgg 5759Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac cct tac gct gaa gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc atc gtg gtg att gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc tct tta ggc att ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac agc gaa gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 aac cac cca agc gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 6047Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa gca acg 6095Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc aat gta atg ttc 6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 tgc gac gct cac acc gat acc atc agc gat ctc ttt gat gtg ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa agc ggc gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg att atc atc acc gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tca atg tac acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc agc gcc gtc gtc 6431Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc tcg caa ggc ata 6479Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg atc ttc act cgc gac cgc aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 ccg aag tcg gcg gct ttt ctg ctg caa aaa cgc tgg act ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag gga ggc aaa caa tga atcaacaact 6621Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600 ctcctggcgc accatcgtcg gctacagcct cgggaattgc taccgagctc gaatttcccc 6681gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 6741atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 6801atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 6861gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 6921atgttactag atcgggaatt cgtaatcatg gtcatagtcg agtcgacgtt ccttgacagg 6981atatattggc gggtaaacta agtcgctgta tgtgtttgtt tgagatcctc tagggcatgc 7041aggctcgcgg cggacgcacg acgccggggc gagaccatag gcgatctcct aaatcaatag 7101tagctgtaac ctcgaagcgt ttcacttgta acaacgattg agaatttttg tcataaaatt 7161gaaatacttg gttcgcattt ttgtcatccg cggtcagccg caattctgac gaactgccca 7221tttagctgga gatgattgta catccttcac gtgaaaattt ctcaagcgct gtgaacaagg 7281gttcagattt tagattgaaa ggtgagccgt tgaaacacgt tcttcttgtc gatgacgacg 7341tcgctatgcg gcatcttatt attgaatacc ttacgatcca cgccttcaaa gtgaccgcgg 7401tagccgacag cacccagttc acaagagtac tctcttccgc gacggtcgat gtcgtggttg 7461ttgatctaaa tttaggtcgt gaagatgggc tcgagatcgt tcgtaatctg gcggcaaagt 7521ctgatattcc aatcataatt atcagtggcg accgccttga ggagacggat aaagttgttg 7581cactcgagct aggagcaagt gattttatcg ctaagccgtt cagtatcaga gagtttctag 7641cacgcattcg ggttgccttg cgcgtgcgcc ccaacgttgt ccgctccaaa gaccgacggt 7701ctttttgttt tactgactgg acacttaatc tcaggcaacg tcgcttgatg tccgaagctg 7761gcggtgaggt gaaacttacg gcaggtgagt tcaatcttct cctcgcgttt ttagagaaac 7821cccgcgacgt tctatcgcgc gagcaacttc tcattgccag tcgagtacgc gacgaggagg 7881tttatgacag gagtatagat gttctcattt tgaggctgcg ccgcaaactt gaggcggatc 7941cgtcaagccc tcaactgata aaaacagcaa gaggtgccgg ttatttcttt gacgcggacg

8001tgcaggtttc gcacgggggg acgatggcag cctgagccaa ttgcatttgc ctcttaatta 8061tctggctcaa agggtgactg aggagtaagc gatgtgccca tcacactgcg catgcaagct 8121gatctggatc t 813253603PRTHordeum vulgare 53Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600 548132DNAHordeum vulgarepCLEAN-G185-HP-proGUS(1)..(8132)Vector backbone, pCLEAN-G185(1)..(2599)HighPhy HvPAPhy_a promoter(2600)..(4799)HighPhy enhancer mutation(4565)..(4565)CDS(4800)..(6611)UidA gene (encoding GUS) 54catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 60tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 120gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 180ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 240cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 300caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 360ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 420taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 480taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac 540cttcggaaga agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 600tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 660gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 720catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa 780atcaatctaa agtatatatg tgtaacattg gtctagtgat tagaaaaact catcgagcat 840caaatgaaac tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg 900tttctgtaat gaaggagaaa actcaccgag gcagttccat aggatggcaa gatcctggta 960tcggtctgcg attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa 1020aataaggtta tcaagtgaga aatcaccatg agtgacgact gaatccggtg agaatggcaa 1080aagtttatgc atttctttcc agacttgttc aacaggccag ccattacgct cgtcatcaaa 1140atcactcgca tcaaccaaac cgttattcat tcgtgattgc gcctgagcga gacgaaatac 1200gcgatcgctg ttaaaaggac aattacaaac aggaatcgaa tgcaaccggc gcaggaacac 1260tgccagcgca tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc 1320tgttttccct gggatcgcag tggtgagtaa ccatgcatca tcaggagtac ggataaaatg 1380cttgatggtc ggaagaggca taaattccgt cagccagttt agtctgacca tctcatctgt 1440aacaacattg gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt 1500cccatacaat cggtagattg tcgcacctga ttgcccgaca ttatcgcgag cccatttata 1560cccatataaa tcagcatcca tgttggaatt taatcgcggc cttgagcaag acgtttcccg 1620ttgaatatgg ctcataacac cccttgtatt actgtttatg taagcagaca gttttattgt 1680tcatgatgat atatttttat cttgtgcaat gtaacatcag agattttgag acacaacgtg 1740gctttgttga ataaatcgaa cttttgctga gttgaaggat cagatcacgc atcttcccga 1800caacgcagac cgttccgtgg caaagcaaaa gttcaaaatc accaactggt ccacctacaa 1860caaagctctc atcaaccgtg gctccctcac tttctggctg gatgatgggg cgattcaggc 1920gatccccatc caacagcccg ccgtcgagcg ggctttttta tccccggaag cctgtggata 1980gagggtagtt atccacgtga aaccgctaat gccccgcaaa gccttgattc acggggcttt 2040ccggcccgct ccaaaaacta tccacgtgaa atcgctaatc agggtacgtg aaatcgctaa 2100tcggagtacg tgaaatcgct aataaggtca cgtgaaatcg ctaatcaaaa aggcacgtga 2160gaacgctaat agccctttca gatcaacagc ttgcaaacac ccctcgctcc ggcaagtagt 2220tacagcaagt agtatgttca attagctttt caattatgaa tatatatatc aattattggt 2280cgcccttggc ttgtggacaa tgcgctacgc gcaccggctc cgcccgtgga caaccgcaag 2340cggttgccca ccgtcgagcg cctttgccca caacccggcg gccggccgca acagatcgtt 2400ttataaattt ttttttttga aaaagaaaaa gcccgaaagg cggcaacctc tcgggcttct 2460ggatttccga tccccggaat tagatccgtt taaactacgt aagatcttgg caggatatat 2520tgtggtgtaa acgttcctgc ggcggtcgag atggatcttg gcaggatata ttgtggtgta 2580aacgttcctg cggccgcatc ttgggcaaca tatcaggggc agcgccattg ccctgcgact 2640gacggcggcg gtggaggagc ttggggcaga catgagctga gaacgacgag agagaggagt 2700ggtggcgggc gagacagagg agcgacatga ttgaagaaga gcagcgggat tgaggattag 2760ggattcctgc gattttacac ttgacctctc cataaaagat tggcctaatc gaagctgaga 2820acgtggaggt caacaagtgg tcaaacgagc ctgtacgcac cgcatacgag caacagtgat 2880cggattttca cgtcacatcg tatatagtga tcgtaaaagc catattctaa agttggatga 2940ccgtattgtg cttccatgtc aactgcaagg accgtgagtg tatttatctc taaaatataa 3000atcaaatata atggtgggct tcttcagacc tcattcagct caaaatccgc ccatgaagcc 3060aatttgaatg ctctaacttt tgcgaagctg gaatctattg tatccaagac tagtgttttc 3120aaagatagtc ttttcggaat ttcaaaatca ctatgtgtgt tcgtcgtatg aacaactctc 3180gactagagag tattcttaat aatgcgataa gagtataaca taacaatttt tttgaatgta 3240ggtttagttg gtctccatgg agcgagacct agtcctattt ggggaggcct ctcgtagttt 3300ggatggacat agttctgtcg gttcaggttg taatgcaact cctcgcactt gactctaaaa 3360tgacttaggc tattgaaagg cccaaaaaca atagtattct tcccttgagt tcattcaagt 3420gagagtatat gtccatgggg ctaagagaag gggtcccttg acaaatgatc aaggttgcgc 3480aaggtgatga taggtatatt ggtaaatctg tatccacgag ttcatgaagt attcaaaggt 3540gggggtctat agtccatggt acatcaatca tttccaccca tgtatgaatg ggcctttggc 3600tagttgggct catttagatt tgggctcagt tacttcttgc cttaaatatt gactttgaca 3660tttcattttg gtttcccttt ttatttgttg accatgataa tttgcttggc cttttattta 3720attttttatg gttttgatta ttttttaaac acaatacaga cgaaaacatt catgtacaca 3780cacatgcatt catctttatg aacatacaca tccacatcat gtccctatca tcttgaaatt 3840tatgaagtca tagtagacac ctagtcgtcg aggggaattc tcctcggatt gaatgtgtat 3900cgtcgaaaat tgtgaaataa atgtgagcgc caggacttga atcttgatgg actaggataa 3960cacagtttct ctaaccatcc aaccgtatgt tggttcgcga tagtttggat tgcttaccac 4020atgtgtcatg tggttgctag gacttccatt aatctggccg aaccttgtta attgagttgg 4080atatttcttg accattttag accttattaa gagcatcttc aacaacagtg taaaaaatcc 4140gcgcccaata aatttttagc gcgccactgt agcactttta aagcgcgggg acggaagcat 4200cttcaataga cacgcgctaa tgcggcgccc aatccacccc ggtccagcga cccacccaca 4260acagctcaga gtttgctgcg cgcgcaagcc ggcacaccaa atatgctgtc cgcgatagcg 4320tttttaagcg cgtgcccaaa attttttagt gcgagcacag ttttgcagcg tctgttggag 4380ctgttcggcg ccaaaaaacg aatcttttaa cgcgcggtgt agttttgagg cgtctgttgg 4440agatggtcta accggcttga accgtgttga aaaaaaaacc cggcttgaat ttttgttgac 4500gagccatagt tgcatattac gtacgttact tgctctttaa tttcaagcta cattttgtag 4560aacacgagcc atgcatgaga cgtaggcgtc caaactttgg ctagcgcagc tgcatgcacg 4620tccacaaggc accaaaggcg caggcggcaa ctttgctcgt ttattttctt gcgggtccaa 4680gatgagttcc agaccatgga cgaattccac ttcgggctcc caatctcctc tgccggattc 4740ctataagttt cctgccaaga agcatcccaa tcccctcaat gccaagcaac aacatcaac 4799atg tta cgt cct gta gaa acc cca acc cgt gaa atc aaa aaa ctc gac 4847Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 ggc ctg tgg gca ttc agt ctg gat cgc gaa aac tgt gga att gat cag 4895Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 cgt tgg tgg gaa agc gcg tta caa gaa agc cgg gca att gct gtg cca 4943Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 ggc agt ttt aac gat cag ttc gcc gat gca gat att cgt aat tat gcg 4991Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca 5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc gat gcg gtc act cat tac ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag ggc ggc tat acg 5135Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc gat gtc acg ccg tat gtt att gcc ggg aaa agt gta 5183Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 cgt atc acc gtt tgt gtg aac aac gaa ctg aac tgg cag act atc ccg 5231Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 ccg gga atg gtg att acc gac gaa aac ggc aag aaa aag cag tct tac 5279Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 ttc cat gat ttc ttt aac tat gcc gga atc cat cgc agc gta atg ctc 5327Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 tac acc acg ccg aac acc tgg gtg gac gat atc acc gtg gtg acg cat 5375Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc 5423Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 aat ggt gat gtc agc gtt gaa ctg cgt gat gcg gat caa cag gtg gtt 5471Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 gca act gga caa ggc act agc ggg act ttg caa gtg gtg aat ccg cac 5519Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc tat gaa ctg tgc gtc aca gcc 5567Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa agc cag aca gag tgt gat atc tac ccg ctt cgc gtc ggc atc cgg 5615Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 tca gtg gca gtg aag ggc gaa cag ttc ctg att aac cac aaa ccg ttc 5663Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 tac ttt act ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa 5711Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg gac tgg 5759Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac cct tac gct gaa gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc atc gtg gtg att gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc tct tta ggc att ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac agc gaa gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 aac cac cca agc gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 6047Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa gca acg 6095Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc aat gta atg ttc 6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 tgc gac gct cac acc gat acc atc agc gat ctc ttt gat gtg ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa agc ggc gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg att atc atc acc gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tca atg tac acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala

515 520 525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc agc gcc gtc gtc 6431Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc tcg caa ggc ata 6479Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg atc ttc act cgc gac cgc aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 ccg aag tcg gcg gct ttt ctg ctg caa aaa cgc tgg act ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag gga ggc aaa caa tga atcaacaact 6621Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600 ctcctggcgc accatcgtcg gctacagcct cgggaattgc taccgagctc gaatttcccc 6681gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 6741atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 6801atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 6861gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 6921atgttactag atcgggaatt cgtaatcatg gtcatagtcg agtcgacgtt ccttgacagg 6981atatattggc gggtaaacta agtcgctgta tgtgtttgtt tgagatcctc tagggcatgc 7041aggctcgcgg cggacgcacg acgccggggc gagaccatag gcgatctcct aaatcaatag 7101tagctgtaac ctcgaagcgt ttcacttgta acaacgattg agaatttttg tcataaaatt 7161gaaatacttg gttcgcattt ttgtcatccg cggtcagccg caattctgac gaactgccca 7221tttagctgga gatgattgta catccttcac gtgaaaattt ctcaagcgct gtgaacaagg 7281gttcagattt tagattgaaa ggtgagccgt tgaaacacgt tcttcttgtc gatgacgacg 7341tcgctatgcg gcatcttatt attgaatacc ttacgatcca cgccttcaaa gtgaccgcgg 7401tagccgacag cacccagttc acaagagtac tctcttccgc gacggtcgat gtcgtggttg 7461ttgatctaaa tttaggtcgt gaagatgggc tcgagatcgt tcgtaatctg gcggcaaagt 7521ctgatattcc aatcataatt atcagtggcg accgccttga ggagacggat aaagttgttg 7581cactcgagct aggagcaagt gattttatcg ctaagccgtt cagtatcaga gagtttctag 7641cacgcattcg ggttgccttg cgcgtgcgcc ccaacgttgt ccgctccaaa gaccgacggt 7701ctttttgttt tactgactgg acacttaatc tcaggcaacg tcgcttgatg tccgaagctg 7761gcggtgaggt gaaacttacg gcaggtgagt tcaatcttct cctcgcgttt ttagagaaac 7821cccgcgacgt tctatcgcgc gagcaacttc tcattgccag tcgagtacgc gacgaggagg 7881tttatgacag gagtatagat gttctcattt tgaggctgcg ccgcaaactt gaggcggatc 7941cgtcaagccc tcaactgata aaaacagcaa gaggtgccgg ttatttcttt gacgcggacg 8001tgcaggtttc gcacgggggg acgatggcag cctgagccaa ttgcatttgc ctcttaatta 8061tctggctcaa agggtgactg aggagtaagc gatgtgccca tcacactgcg catgcaagct 8121gatctggatc t 813255603PRTHordeum vulgare 55Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600 5639DNAHordeum vulgareKill triad Fw primer(1)..(39)Kill triad Fw primer to randomise mutant enhancer 56gcatacgaag catagtacga cgtaggcgtc caaactttg 395748DNAHordeum vulgareKill triad Rv primer(1)..(48)Kill triad Rv primer to randomise mutant enhancer 57tcgtactatg cttcgtatgc ctacaaaatg tagcttgaaa ttaaagag 48588132DNAHordeum vulgarepCLEAN-G185-KOtriad-ProGUS(1)..(8132)Vector backbone, pCLEAN-G185(1)..(2599)KOtriad HvPAPhy_a promoter(2600)..(4799)Randomized sequence replacing the enhancer triad (GCN4, skn1, RY-element)(4561)..(4580)CDS(4800)..(6611)UidA gene (encoding GUS) 58catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 60tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 120gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 180ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 240cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 300caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 360ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 420taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 480taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac 540cttcggaaga agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 600tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 660gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 720catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa 780atcaatctaa agtatatatg tgtaacattg gtctagtgat tagaaaaact catcgagcat 840caaatgaaac tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg 900tttctgtaat gaaggagaaa actcaccgag gcagttccat aggatggcaa gatcctggta 960tcggtctgcg attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa 1020aataaggtta tcaagtgaga aatcaccatg agtgacgact gaatccggtg agaatggcaa 1080aagtttatgc atttctttcc agacttgttc aacaggccag ccattacgct cgtcatcaaa 1140atcactcgca tcaaccaaac cgttattcat tcgtgattgc gcctgagcga gacgaaatac 1200gcgatcgctg ttaaaaggac aattacaaac aggaatcgaa tgcaaccggc gcaggaacac 1260tgccagcgca tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc 1320tgttttccct gggatcgcag tggtgagtaa ccatgcatca tcaggagtac ggataaaatg 1380cttgatggtc ggaagaggca taaattccgt cagccagttt agtctgacca tctcatctgt 1440aacaacattg gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt 1500cccatacaat cggtagattg tcgcacctga ttgcccgaca ttatcgcgag cccatttata 1560cccatataaa tcagcatcca tgttggaatt taatcgcggc cttgagcaag acgtttcccg 1620ttgaatatgg ctcataacac cccttgtatt actgtttatg taagcagaca gttttattgt 1680tcatgatgat atatttttat cttgtgcaat gtaacatcag agattttgag acacaacgtg 1740gctttgttga ataaatcgaa cttttgctga gttgaaggat cagatcacgc atcttcccga 1800caacgcagac cgttccgtgg caaagcaaaa gttcaaaatc accaactggt ccacctacaa 1860caaagctctc atcaaccgtg gctccctcac tttctggctg gatgatgggg cgattcaggc 1920gatccccatc caacagcccg ccgtcgagcg ggctttttta tccccggaag cctgtggata 1980gagggtagtt atccacgtga aaccgctaat gccccgcaaa gccttgattc acggggcttt 2040ccggcccgct ccaaaaacta tccacgtgaa atcgctaatc agggtacgtg aaatcgctaa 2100tcggagtacg tgaaatcgct aataaggtca cgtgaaatcg ctaatcaaaa aggcacgtga 2160gaacgctaat agccctttca gatcaacagc ttgcaaacac ccctcgctcc ggcaagtagt 2220tacagcaagt agtatgttca attagctttt caattatgaa tatatatatc aattattggt 2280cgcccttggc ttgtggacaa tgcgctacgc gcaccggctc cgcccgtgga caaccgcaag 2340cggttgccca ccgtcgagcg cctttgccca caacccggcg gccggccgca acagatcgtt 2400ttataaattt ttttttttga aaaagaaaaa gcccgaaagg cggcaacctc tcgggcttct 2460ggatttccga tccccggaat tagatccgtt taaactacgt aagatcttgg caggatatat 2520tgtggtgtaa acgttcctgc ggcggtcgag atggatcttg gcaggatata ttgtggtgta 2580aacgttcctg cggccgcatc ttgggcaaca tatcaggggc agcgccattg ccctgcgact 2640gacggcggcg gtggaggagc ttggggcaga catgagctga gaacgacgag agagaggagt 2700ggtggcgggc gagacagagg agcgacatga ttgaagaaga gcagcgggat tgaggattag 2760ggattcctgc gattttacac ttgacctctc cataaaagat tggcctaatc gaagctgaga 2820acgtggaggt caacaagtgg tcaaacgagc ctgtacgcac cgcatacgag caacagtgat 2880cggattttca cgtcacatcg tatatagtga tcgtaaaagc catattctaa agttggatga 2940ccgtattgtg cttccatgtc aactgcaagg accgtgagtg tatttatctc taaaatataa 3000atcaaatata atggtgggct tcttcagacc tcattcagct caaaatccgc ccatgaagcc 3060aatttgaatg ctctaacttt tgcgaagctg gaatctattg tatccaagac tagtgttttc 3120aaagatagtc ttttcggaat ttcaaaatca ctatgtgtgt tcgtcgtatg aacaactctc 3180gactagagag tattcttaat aatgcgataa gagtataaca taacaatttt tttgaatgta 3240ggtttagttg gtctccatgg agcgagacct agtcctattt ggggaggcct ctcgtagttt 3300ggatggacat agttctgtcg gttcaggttg taatgcaact cctcgcactt gactctaaaa 3360tgacttaggc tattgaaagg cccaaaaaca atagtattct tcccttgagt tcattcaagt 3420gagagtatat gtccatgggg ctaagagaag gggtcccttg acaaatgatc aaggttgcgc 3480aaggtgatga taggtatatt ggtaaatctg tatccacgag ttcatgaagt attcaaaggt 3540gggggtctat agtccatggt acatcaatca tttccaccca tgtatgaatg ggcctttggc 3600tagttgggct catttagatt tgggctcagt tacttcttgc cttaaatatt gactttgaca 3660tttcattttg gtttcccttt ttatttgttg accatgataa tttgcttggc cttttattta 3720attttttatg gttttgatta ttttttaaac acaatacaga cgaaaacatt catgtacaca 3780cacatgcatt catctttatg aacatacaca tccacatcat gtccctatca tcttgaaatt 3840tatgaagtca tagtagacac ctagtcgtcg aggggaattc tcctcggatt gaatgtgtat 3900cgtcgaaaat tgtgaaataa atgtgagcgc caggacttga atcttgatgg actaggataa 3960cacagtttct ctaaccatcc aaccgtatgt tggttcgcga tagtttggat tgcttaccac 4020atgtgtcatg tggttgctag gacttccatt aatctggccg aaccttgtta attgagttgg 4080atatttcttg accattttag accttattaa gagcatcttc aacaacagtg taaaaaatcc 4140gcgcccaata aatttttagc gcgccactgt agcactttta aagcgcgggg acggaagcat 4200cttcaataga cacgcgctaa tgcggcgccc aatccacccc ggtccagcga cccacccaca 4260acagctcaga gtttgctgcg cgcgcaagcc ggcacaccaa atatgctgtc cgcgatagcg 4320tttttaagcg cgtgcccaaa attttttagt gcgagcacag ttttgcagcg tctgttggag 4380ctgttcggcg ccaaaaaacg aatcttttaa cgcgcggtgt agttttgagg cgtctgttgg 4440agatggtcta accggcttga accgtgttga aaaaaaaacc cggcttgaat ttttgttgac 4500gagccatagt tgcatattac gtacgttact tgctctttaa tttcaagcta cattttgtag 4560gcatacgaag catagtacga cgtaggcgtc caaactttgg ctagcgcagc tgcatgcacg 4620tccacaaggc accaaaggcg caggcggcaa ctttgctcgt ttattttctt gcgggtccaa 4680gatgagttcc agaccatgga cgaattccac ttcgggctcc caatctcctc tgccggattc 4740ctataagttt cctgccaaga agcatcccaa tcccctcaat gccaagcaac aacatcaac 4799atg tta cgt cct gta gaa acc cca acc cgt gaa atc aaa aaa ctc gac 4847Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 ggc ctg tgg gca ttc agt ctg gat cgc gaa aac tgt gga att gat cag 4895Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 cgt tgg tgg gaa agc gcg tta caa gaa agc cgg gca att gct gtg cca 4943Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 ggc agt ttt aac gat cag ttc gcc gat gca gat att cgt aat tat gcg 4991Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca 5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc gat gcg gtc act cat tac ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag ggc ggc tat acg 5135Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc gat gtc acg ccg tat gtt att gcc ggg aaa agt gta 5183Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 cgt atc acc gtt tgt gtg aac aac gaa ctg aac tgg cag act atc ccg 5231Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 ccg gga atg gtg att acc gac gaa aac ggc aag aaa aag cag tct tac 5279Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 ttc cat gat ttc ttt aac tat gcc gga atc cat cgc agc gta atg ctc 5327Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 tac acc acg ccg aac acc tgg gtg gac gat atc acc gtg gtg acg cat 5375Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc 5423Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 aat ggt gat gtc agc gtt gaa ctg cgt gat gcg gat caa cag gtg gtt 5471Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 gca act gga caa ggc act agc ggg act ttg caa gtg gtg aat ccg cac 5519Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc tat gaa ctg tgc gtc aca gcc 5567Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa agc cag aca gag tgt gat atc tac ccg ctt cgc gtc ggc atc cgg 5615Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 tca gtg gca gtg aag ggc gaa cag ttc ctg att aac cac aaa ccg ttc 5663Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285

tac ttt act ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa 5711Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg gac tgg 5759Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac cct tac gct gaa gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc atc gtg gtg att gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc tct tta ggc att ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac agc gaa gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 aac cac cca agc gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 6047Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa gca acg 6095Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc aat gta atg ttc 6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 tgc gac gct cac acc gat acc atc agc gat ctc ttt gat gtg ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa agc ggc gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg att atc atc acc gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tca atg tac acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc agc gcc gtc gtc 6431Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc tcg caa ggc ata 6479Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg atc ttc act cgc gac cgc aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 ccg aag tcg gcg gct ttt ctg ctg caa aaa cgc tgg act ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag gga ggc aaa caa tga atcaacaact 6621Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600 ctcctggcgc accatcgtcg gctacagcct cgggaattgc taccgagctc gaatttcccc 6681gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 6741atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 6801atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 6861gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 6921atgttactag atcgggaatt cgtaatcatg gtcatagtcg agtcgacgtt ccttgacagg 6981atatattggc gggtaaacta agtcgctgta tgtgtttgtt tgagatcctc tagggcatgc 7041aggctcgcgg cggacgcacg acgccggggc gagaccatag gcgatctcct aaatcaatag 7101tagctgtaac ctcgaagcgt ttcacttgta acaacgattg agaatttttg tcataaaatt 7161gaaatacttg gttcgcattt ttgtcatccg cggtcagccg caattctgac gaactgccca 7221tttagctgga gatgattgta catccttcac gtgaaaattt ctcaagcgct gtgaacaagg 7281gttcagattt tagattgaaa ggtgagccgt tgaaacacgt tcttcttgtc gatgacgacg 7341tcgctatgcg gcatcttatt attgaatacc ttacgatcca cgccttcaaa gtgaccgcgg 7401tagccgacag cacccagttc acaagagtac tctcttccgc gacggtcgat gtcgtggttg 7461ttgatctaaa tttaggtcgt gaagatgggc tcgagatcgt tcgtaatctg gcggcaaagt 7521ctgatattcc aatcataatt atcagtggcg accgccttga ggagacggat aaagttgttg 7581cactcgagct aggagcaagt gattttatcg ctaagccgtt cagtatcaga gagtttctag 7641cacgcattcg ggttgccttg cgcgtgcgcc ccaacgttgt ccgctccaaa gaccgacggt 7701ctttttgttt tactgactgg acacttaatc tcaggcaacg tcgcttgatg tccgaagctg 7761gcggtgaggt gaaacttacg gcaggtgagt tcaatcttct cctcgcgttt ttagagaaac 7821cccgcgacgt tctatcgcgc gagcaacttc tcattgccag tcgagtacgc gacgaggagg 7881tttatgacag gagtatagat gttctcattt tgaggctgcg ccgcaaactt gaggcggatc 7941cgtcaagccc tcaactgata aaaacagcaa gaggtgccgg ttatttcttt gacgcggacg 8001tgcaggtttc gcacgggggg acgatggcag cctgagccaa ttgcatttgc ctcttaatta 8061tctggctcaa agggtgactg aggagtaagc gatgtgccca tcacactgcg catgcaagct 8121gatctggatc t 813259603PRTHordeum vulgare 59Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595 600

Claims

1-15. (canceled)

16: A Tricticum variety capable of producing an average phytase endosperm content of greater than 4300 FTU/kg, produced by the following: a) obtaining a Tricticum plant which has been identified as having a nucleotide at the 5' end of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine. b) breeding said Tricticum plant comprising said nucleotide sequence with a second Tricticum variety plant which produces an average phytase content of about 1200 FTU/kg, to produce grains, c) growing at least one Tricticum plant from said grains; d) assaying said grains to confirm the presence of said nucleotide sequence in that said variety produces an average phytase endosperm content of greater than 4300 FTU/kg.

17: The variety of claim 16 wherein said Tricticum plant has been identified by a) obtaining a sample of nucleic acids from a Tricticum plant or portion thereof; b) detecting in said sample the presence of the nucleotide t the 5' end of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine.

18: The plant or variety according to claim 17, wherein said sample of nucleic acids comprises a first polynucleotide located 5' upstream of and operably linked to a second polynucleotide, wherein said first polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG CAT (SEQ ID NO:1) [SEQ ID NO:1] wherein V is a cytosine, and wherein said second polynucleotide encodes a phytase polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity.

19: A population of Tricticum plants grown from variety of claim 16 and having an average phytase grain content of greater than 4300 FTU/kg.

20: Grain having an average phytase content of greater than 4300FTU/kg, said grain harvested from the population of claim 19.

21: A method of producing a milled cereal composition having an average phytase content of greater than 4300FTU/kg, comprising: Obtaining the grain of claim 20 and milling said grain to produce a milled cereal composition.

22: The method of claim 21 further comprising the step of cleaning or conditioning the grain.

23: The method of claim 21 further comprising the step of gristing the grain.

24: The method of claim 21 further comprising the step of breaking the grain into its cereal parts cereal grain germ, bran and endosperm.

25: The method of claim 21 wherein said milled composition is flour.

26: A milled grain composition produced by the method of claim 21.

27: The method of claim 21 further comprising the step a combining said cereal grain composition with fodder ingredients to form an animal feed.

28: The method of claim 21 further comprising the step of reducing the microbial population in said animal feed.

29: The method of claim 28 where said microbial population is reduced by introducing said animal feed to a using a steam pelleting machine for a sufficient time to reduce the microbial population to safe levels for animal consumption.

30: The method of claim 28 further comprising the step of pelleting said animal feed.

31: An animal feed comprising the milled cereal gain with an average phytase activity of about 4300 FTU/kg produced by the method of claim 21.

32: Flour having an average phytase activity of about 4300 FTU/kg produced by the method of claim 21.

33: Bread dough with enhanced inorganic phosphate levels and mineral content and improved dough mixing made from the flour of claim 32.

34: A Tricticum variety produced by the following: a) Obtaining a plant with capable of producing an average phytase endosperm content of greater than 4300 FTU/kg; b) Cultivating said plant to produce sufficient grain for breeding; c) Growing said grain d) Determining the presence of a nucleotide sequence ACA VGA GTC ATG CAT (SEQ ID NO: 1), and wherein said V is a cytosine said plant producing an average phytase endosperm content of greater than 4300 FTU/kg; e) Repeating steps c and d until a variety with an average average phytase endosperm content of greater than 4300 FTU/kg is created.

35: A Tricticum plant wherein an ancestor of said plant is the plant of claim 16.

36: A cultivated Tricticum variety having a nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine, capable of producing grain with an average phytase endosperm content of greater than 4300 FTU/kg.

Images