Phytophthora Resistant Plants Belonging to the Solanaceae Family

Abstract

Provided herein is a plant belonging to the Solanaceae family wherein said plant includes a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said genes or a reduced activity of proteins encoded by said genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora.

Description

[0001] The present invention relates to Phytophthora resistance plants belonging to Solanaceae family wherein said resistance is encoded by a combination of two genes. The present invention further relates to the use of these genes providing Phytophthora resistance plants belonging to Solanaceae family, the genes themselves and proteins encoded by the present genes.

[0002] The plant pathogen Phytophthora is a genus of plant-damaging Oomycetes (water molds), whose member species are capable of causing large economic losses on crops worldwide, as well as environmental damage in natural ecosystems. The genus was first described by Heinrich Anton de Bary in 1875. Approximately 100 species have been described, although and estimate of 100 to 500 undiscovered Phytophthora species are suspected to exist.

[0003] Phytophthora pathogens are mostly pathogens of dicotyledons and generally are host-specific parasites. Many species of Phytophthora are plant pathogens of considerable economic importance. Phytophthora infestans was the infective agent of the potato blight that caused the Great Irish Famine (1845-1849), and still remains the most destructive pathogen of solanaceous crops, including tomato and potato. The soya bean root and stem rot agent, Phytophthora sojae, has also caused longstanding problems for the agricultural industry. In general, plant diseases caused by this genus are difficult to control chemically, and thus the growth of resistant cultivars is the main management strategy. Other important Phytophthora diseases are: Phytophthora cactorum--causes rhododendron root rot affecting rhododendrons, azaleas and causes bleeding canker in hardwood trees; Phytophthora capsici--infects Cucurbitaceae fruits, such as cucumbers and squash, Phytophthora cinnamomi--causes cinnamon root rot affecting woody ornamentals including arborvitae, azalea, Phytophthora fragariae--causes red root rot affecting strawberries; Phytophthora kernoviae--pathogen of beech and rhododendron, also occurring on other trees and shrubs including oak, and holm oak, Phytophthora megakarya--one of the cocoa black pod disease species, is invasive and probably responsible for the greatest cocoa crop loss in Africa; Phytophthora palmivora--causes fruit rot in coconuts and betel nuts, Phytophthora ramorum, Phytophthora quercina--causes oak death, and Phytophthora sojae--causes soybean root rot.

[0004] Phytophthora is sometimes referred to as a fungal-like organism but it is classified under a different kingdom: Chromalveolata (formerly Stramenopila and previously Chromista). Phytophthora is morphologically very similar to true fungi yet its evolutionary history is quite distinct. In contrast to fungi, chromalveolatas are more closely related to plants than animals. Whereas fungal cell walls are made primarily of chitin, chromalveolata cell walls are constructed mostly of cellulose. Ploidy levels are different between these two groups; Phytophthora have diploid (paired) chromosomes in the vegetative (growing, non-reproductive) stage of life, Fungi are almost always haploid in this state. Biochemical pathways also differ, notably the highly conserved.

[0005] Phytophthoras may reproduce sexually or asexually. In many species, sexual structures have never been observed, or have only been observed in laboratory matings. In homothallic species, sexual structures occur in single culture. Heterothallic species have mating strains, designated as A1 and A2. When mated, antheridia introduce gametes into oogonia, either by the oogonium passing through the antheridium (amphigyny) or by the antheridium attaching to the proximal (lower) half of the oogonium (paragyny), and the union producing oospores. Like animals, but not like most true fungi, meiosis is gametic, and somatic nuclei are diploid. Asexual (mitotic) spore types are chlamydospores, and sporangia which produce zoospores. Chlamydospores are usually spherical and pigmented, and may have a thickened cell wall to aid in its role as a survival structure. Sporangia may be retained by the subtending hyphae (non-caducous) or be shed readily by wind or water tension (caducous) acting as dispersal structures. Also, sporangia may release zoospores, which have two unlike flagella which they use to swim towards a host plant.

[0006] The Solanaceae, or nightshades, are an economically important family of flowering plants. The family ranges from herbs to trees, and includes a number of important agricultural crops, medicinal plants, spices, weeds, and ornamentals. Many members of the family contain potent alkaloids, and some are highly toxic.

[0007] The family belongs to the order Solanales, in the asterid group dicotyledons (Magnoliopsida). The solanaceae family consists of approximately 98 genera and some 2,700 species, with a great diversity of habitats, morphology and ecology.

[0008] The family has a worldwide distribution being present on all continents except Antarctica. The greatest diversity in species is found in South America and Central America. Solanaceae includes a number of commonly collected or cultivated species. Perhaps the most economically important genus of the family is Solanum, which contains the potato (Solanum tuberosum, in fact, another common name of the family is the "potato family"), the tomato (Solanum lycopersicum), and the aubergine or eggplant (Solanum melongena). Another important genus Capsicum produce both chilli peppers and bell peppers.

[0009] The genus Physalis produces the so-called groundcherries, as well as the tomatillo (Physalis philadelphica), the Cape gooseberry and the Chinese lantern. The genus Lycium contains the boxthorns and the wolfberry Lycium barbarum. Nicotiana contains, among other species, the plant that produces tobacco. Some other important members of Solanaceae include a number of ornamental plants such as Petunia, Browallia and Lycianthes, the source of psychoactive alkaloids, Datura, Mandragora (mandrake), and Atropa belladonna (deadly nightshade). Certain species are universally known for their medicinal uses, their psychotropic effects or for being poisonous.

[0010] With the exception of tobacco (Nicotianoideae) and petunia (Petunioideae), most of the economically important genera are contained in the subfamily Solanoideae. Finally, but not less importantly, the solanaceas include many model organisms which are important in the investigation of fundamental biological questions at a cellular, molecular and genetic level, such as tobacco and the petunia.

[0011] Considering the economic importance of many plant members of the Solanaceae family and the destructive effect of the plant pathogen Phytophthora on many members of this family, it is an object, amongst other objects, of the present invention to provide Phytophthora resistant plants.

[0012] The above object, amongst other objects, is met by the present invention by providing plants, uses, proteins and genes as outlined in the appended claims.

[0013] Specifically, the above object, amongst other objects, is met, according to a first aspect, by plants belonging to the Solanaceae family wherein the present plants comprise a genetic trait providing Phytophthora resistance and wherein the present resistance trait is encoded by a combination of at least two genes having a reduced expression, or reduced transcription, of the present genes or a reduced activity of proteins encoded by the present genes as compared to the plant belonging to Solanaceae family being susceptible to Phytophthora.

[0014] According to a preferred embodiment of this first aspect of the present invention, the present plants belonging to the Solanaceae family are selected from the group consisting of potato, petunia, tomato, aubergine, eggplant, tobacco and pepper, more preferably potato, petunia and tomato.

[0015] According to an especially preferred embodiment of this first aspect, the present invention relates to potato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 1 and SEQ ID No. 2 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 1 and SEQ ID No. 2, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

[0016] According to another especially preferred embodiment of this first aspect, the present invention relates to petunia, the present Phytophthora resistance is resistance to Phytophthora nicotianae and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 3 and SEQ ID No. 4 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 3 and SEQ ID No. 4, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

[0017] According to another especially preferred embodiment of this first aspect, the present invention relates to tomato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 5 and SEQ ID No. 6 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 5 and SEQ ID No. 6, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

[0018] According to yet another especially preferred embodiment of this first aspect, the present invention relates to a plant belonging to the Solanaceae family wherein the present plant comprises a genetic trait providing Phytophthora resistance, wherein the present resistance trait is obtainable by down regulating the activity of combination of two genes or reducing the activity of proteins encoded by the present genes in a Phytophthora susceptible plant, wherein the present two genes encode the combinations of SEQ ID Nos. 1 and 2 or SEQ ID Nos. 3 and 4 or SEQ ID Nos. 5 and 6 or proteins having at least 80%, 85%, or 90% sequence identity therewith such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

[0019] According to a further preferred embodiment, the present plant belonging to the Solanaceae family is selected from the group consisting of potato, petunia and tomato.

[0020] Given the advantageous properties of the present genes for providing Phytophthora resistance plants, the present invention relates, according to a second aspect, to the use of genes encoding the combinations of SEQ ID Nos. 1 and 2 or SEQ ID Nos. 3 and 4 or SEQ ID Nos. 5 and 6 or proteins having at least 80%, 85%, or 90% sequence identity therewith, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity, for providing Phytophthora resistance in plants belonging to the Solanaceae family.

[0021] According to a further preferred embodiment, the present use for providing Phytophthora resistance in plants belonging to the Solanaceae family comprises reduced expression, or reduced transcription, of the present genes or a reduced activity of proteins encoded by the present genes as compared to the plant belonging to Solanaceae family being susceptible to Phytophthora.

[0022] According to a further preferred embodiment of this second aspect, the present plants belonging to the Solanaceae family are selected from the group consisting of potato, petunia and tomato. More preferably, the present Phytophthora resistance is Phytophthora infestans in potato and/or tomato, or Phytophthora nicotianae in petunia.

[0023] Given the Phytophthora resistance providing properties of the present proteins and genes, the present invention relates according a third aspect to proteins and genes suitable for providing Phytophthora resistance to plants. Specifically, the present invention relates according to this third aspect to proteins selected from the group consisting of SEQ ID No. 1, 2, 3, 4, 5, 6 and protein having at least 80%, 85%, or 90% sequence identity therewith, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

[0024] According to a preferred embodiment of this third aspect, the present invention relates to coding sequences, or genes encoding cDNA sequence, selected from the group consisting of SEQ ID No. 7, 8, 9, 10, 11, 12 and sequences having at least 80%, 85%, or 90% sequence identity therewith such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity. Preferably the present coding sequene, or genes encoding cDNA sequence, is an isolated sequence.

[0025] The invention is further illustrated in the examples below, with reference to the figures, wherein:

[0026] FIG. 1 shows a detached leaf assay of control potato plants after infection with Phytophthora infestans, wherein all leaves are infected by Phytophthora infestans.

[0027] FIG. 2 shows a detached leaf assay of SEQ ID NOS. 7 & 8 silenced potato plants after infection with Phytophthora infestans, wherein each leaf is from an independent plant. FIG. 2a shows leaves from plants silenced with a middle construct, silencing both SEQ ID NOS. 7&8. FIG. 2b shows leaves from chimeric silenced plants.

[0028] FIG. 3 shows the percentage of plants which are infected by Phytophthora infestans, wherein the first bar shows a control group (about 10% is partially) infected, the second bar shows plants of which only SEQ ID NO 7 is silenced (about 10% partially infected), the third bar shows plants of which both SEQ ID NO 7 and 8 is silenced in the middle part of the respective sequences (about 50% clean), the fourth bar shows plants of which both SEQ ID NO 7 and 8 is silenced at the 5' end (about 40% clean).

[0029] FIG. 4 shows the percentages of living petunia plants after inoculation with Phytophthora nicotianae, wherein the first bar shows wild type control plant (0% living), the second bar shows SEQ ID NO 9 mutants (20% living plants), the third bar shows SEQ ID NO 10 mutants (20% living plants) and the fourth bar shows double mutants, i.e. both SEQ ID NO 9 and 10 (45% living plants).

[0030] FIG. 5 shows leaves of tomato plants from a Phytophthora infestans disease test.

EXAMPLES

Example 1

Potato

RNAi Constructs Targeting Potato SEQ ID NOS. 7 and 8

[0031] 3 different RNAi constructs were made, harboring/targeting:

1. 5' end of SEQ ID NO 7: equivalent to coding sequence -159-200 (-159 from start means in 5'utr). 2. Chimera of 5' end of SEQ ID NOS. 7 and 8: equivalent to coding sequence 4-199+1-204. 3. Middle part of SEQ ID NO. 7 (highly homologous to middle of SEQ ID NO 8): equivalent to coding sequence 334-743.

[0032] The fragments were amplified from genomic DNA and cloned into the pENTR-D-TOPO vector. For the chimeric construct, 2 fragments were coupled using primers with complementary overhangs, and subsequent extension and amplification to create the fused fragment. Fragments were transferred using a Gateway LR reaction to the RNAi vector pK7GWiWG2 (Karimi et al., 2002, Trends Plant Sci 7), creating an inverted repeat with hairpin structure. Because the pK7GWiWG2 vector requires Streptomycin for bacterial selection, and the Agrobacterium strain used for potato transformation (LBA4404) already carries a Streptomycin selection marker, the complete RNAi (hairpin) cassette was transferred to a different plant transformation vector, pGreen0029 (bacterial as well as plant selection marker=Kanamycin) (Hellens et al., 2000, Plant Mol Biol 42). The final constructs allow stable expression of a 35S-promoter driven hairpin RNA that forms a silencing-inducing dsRNA, after the hairpin-loop forming intron gets spliced out. At least six independent T1 transformants were maintained for each construct.

Phytophthora infestans Assay Details

[0033] Detached leaves were taken from T1 (first generation transgenics) plants, and placed in a tray with 100% RH with petioles in wet cotton-wool or Oasis. Phytophthora infestans (P. inf) zoospores/sporangia were harvested from P. inf cultures (rye-sucrose-agar plates), and a 10 ul drop of spore suspension containing 10e3 sporangia (10e5/ml) was placed on each side of the midvein. Trays were incubated at 18 C. Leaf infection rates were scored on day 11, as 1. Completely infected/overgrown, 2. Partially infected (10-50% area), and 3. Clean (<10% area).

[0034] As shown in FIGS. 1 and 2, the double silenced (SEQ ID NO. 7 & 8) plants of FIG. 2a show that only 50% is infected, the double silenced (chimeric) plants of FIG. 2b show that only 60% is infected, whereas the control group of FIG. 1 shows that all plants were infected. As shown in FIG. 3, 40 to 50% of the both SEQ ID NO. 7 and SEQ ID NO. 8 silenced plants are clean, whereas the plants having only SEQ ID NO. 7 silenced only 10% of the plants score partially infected. Accordingly, silencing of both SEQ ID NO. 7 and 8 provides resistance to Phytophthora infestans.

Example 2

Petunia

[0035] Transposon insertion lines were identified from a collection/library (Vandenbussche et al., 2008, Plant Journal 54). 2 dTph1 transposon insertion alleles were found in SEQ ID NO 9 and 3 dTph1 transposon insertion alleles in SEQ ID NO 10. Several crosses were made to generate double mutants.

Phytophthora nicotianae Assay Details

[0036] Plants were grown in standard potting soil, individually potted, at 23 C.

[0037] P. nicotianae spores were harvested from cultures (lima-bean-agar or V8-agar plates), and 2 ml of spore suspension containing 10e4 (assay Sept) spores was dripped onto the soil with each plant. Plant collapse was monitored regularly.

[0038] As shown in FIG. 4, double mutants, i.e. plants having mutations in both SEQ ID NO 9 and SEQ ID NO 10 have a percentage of living plants of 45%, whereas the percentage of living plants of single mutants (mutant in SEQ ID NO. 9 or SEQ ID NO. 10) is only 20%.

Example 3

Tomato

[0039] Tomato plants were transformed with two constructs, either for providing over expression of both SEQ ID NO. 11 and 12, or for providing silencing of both SEQ ID NO. 11 and 12.

[0040] Tomato SEQ ID NO. 11 silencing constructs were generated using Gateway cloning of a 300 bp fragment identical to the middle part of the CDS of SEQ ID NO. 11.

Sequence:

TABLE-US-00001

[0041] TTGGGTGAACAAGGACAACATATGGCTATCAATTATTATCCTCCTTGT CCACAACCAGAACTTACTTATGGGCTTCCGGCCCATACTGATCCAAAT TCACTTACAATTCTTCTTCAAGACTTGCAAGTTGCGGGTCTTCAAGTT CTTAAAGATGGCAAATGGTTAGCTGTAAAACCTCAACCTGACGCCTTT GTCATTAATCTTGGGGATCAATTGCAGGCAGTAAGTAACGGTAAGTAC AGAAGTGTATGGCATCGAGCTATTGTGAATTCAGATCAAGCTAGGATG TCAGTGGCTTCGTTT

Using Primers:

TABLE-US-00002

[0042] S. Lycopersicum AttB1-F aaaaagcaggcttcttgggtgaacaaggacaaca S. Lycopersicum AttB2-R agaaagctgggtaaaacgaagccactgacatcc

[0043] The generated ENTRY vector was Gateway cloned into the pHellsgate12 binary vector. Following Agrobacterium transformation according standard procedure for tomato. The silencing constructs were able to silence both SEQ ID NO. 11 and 12, due to similarities in the sequences.

[0044] Offspring from transformed tomato plants were subjected to a disease test by inoculation of Phytophthora infestans isolate US11. 7 days after inoculation the plants were visually analysed by scoring leaves on a visual scale from 1 to 9, wherein 1 means susceptible and 9 means resistant. As a control for susceptible the plants TS33, TS19 and OT9 were used. As control for resistant the known resistant wild accession LA1269 is used. Per plant 8 leaves were measured. Table below provides the average score from the 8 leaves per plant.

TABLE-US-00003 LA1269 RC 8.7 TS33 VC 1.3 TS19 VC 1.5 OT9 VC 2.0 551-06-01 overexpres 2.8 551-06-02 overexpres 3.3 551-06-03 overexpres 3.0 551-06-07 overexpres 1.5 551-06-08 overexpres 2.3 551-06-09 overexpres 2.3 551-06-12 overexpres 2.3 556-02-01 silencing 6.5 556-02-02 silencing 8.5 556-02-03 silencing 8.3 556-02-06 silencing 7.3 556-02-11 silencing 7.3 556-01-01 silencing 7.8 556-01-02 silencing 8.3 556-01-03 silencing 8.5 556-01-04 silencing 8.5 556-01-05 silencing 8.5 556-01-06 silencing 6.0 556-01-07 silencing 5.5 556-01-08 silencing 8.5 556-01-09 silencing 7.0 556-01-10 silencing 8.5 556-01-11 Silencing 8.8 556-01-12 Silencing 7.8

[0045] In the table is shown that the SEQ ID NO. 11 and 12 overexpressing plants are susceptible for isolate US11. The silenced plant provides significant higher scores than the susceptible control LA1269. For example plant 556-01-08 has an average score of 8.5. A sample of this plant is shown in FIG. 5 in box G10, and is not infected similar to resistant control plant LA1296 as shown in box D8. Accordingly, silencing of both SEQ ID NO. 11 and 12 provides resistance to Phytophthora infestans.

Sequence CWU 1

1

151337PRTSolanum tuberosum 1Met Glu Thr Lys Val Ile Ser Ser Gly Ile His His Ser Thr Leu Pro 1 5 10 15 Gln Ser Tyr Ile Arg Pro Glu Ser Asp Arg Pro Arg Leu Ser Asp Val 20 25 30 Val Asp Cys Glu Asn Val Pro Ile Ile Asp Leu Gly Cys Gly Asp Gln 35 40 45 Ala Gln Ile Ile Arg Leu Ile Gly Glu Ala Cys Gln Thr Tyr Gly Phe 50 55 60 Phe Gln Val Ile Asn His Gly Val Pro Lys Glu Val Val Glu Lys Met 65 70 75 80 Leu Gly Val Ala Gly Glu Phe Phe Asn Leu Pro Val Glu Glu Lys Leu 85 90 95 Lys Leu Tyr Ser Asp Asp Pro Ser Lys Thr Met Arg Leu Ser Thr Ser 100 105 110 Phe Asn Val Lys Lys Glu Thr Val His Asn Trp Arg Asp Tyr Leu Arg 115 120 125 Leu His Cys His Pro Leu Glu Lys Tyr Ala Pro Glu Trp Pro Ser Asn 130 135 140 Pro Ser Ser Phe Arg Asp Ile Val Ser Arg Tyr Cys Thr Glu Val Arg 145 150 155 160 Gln Leu Gly Phe Arg Leu Glu Glu Ala Ile Ala Glu Ser Leu Gly Leu 165 170 175 Glu Lys Glu Cys Ile Lys Asp Val Leu Gly Glu Gln Gly Gln His Met 180 185 190 Ala Ile Asn Phe Tyr Pro Pro Cys Pro Gln Pro Glu Leu Thr Tyr Gly 195 200 205 Leu Pro Ala His Thr Asp Pro Asn Ser Leu Thr Ile Leu Leu Gln Asp 210 215 220 Leu Gln Val Ser Gly Leu Gln Val Leu Lys Asp Gly Lys Trp Leu Ala 225 230 235 240 Val Lys Pro Gln Pro Asp Ala Phe Val Ile Asn Leu Gly Asp Gln Leu 245 250 255 Gln Ala Val Ser Asn Gly Lys Tyr Lys Ser Val Trp His Arg Ala Ile 260 265 270 Val Asn Ser Asp Gln Ala Arg Met Ser Val Ala Ser Phe Leu Cys Pro 275 280 285 Cys Asp Ser Ala Lys Ile Ser Ala Pro Lys Leu Leu Thr Glu Asp Gly 290 295 300 Ser Pro Val Ile Tyr Gln Asp Phe Thr Tyr Ala Glu Tyr Tyr Lys Lys 305 310 315 320 Phe Trp Ser Arg Asn Leu Asp Gln Glu His Cys Leu Glu Leu Phe Lys 325 330 335 Asn 2342PRTSolanum tuberosum 2Met Glu Thr Thr Ser Val Leu Ser Gly Gly Phe Asn His Ser Thr Leu 1 5 10 15 Pro Glu Ser Tyr Val Arg Pro Glu Ser Gln Arg Pro Arg Met Ser Glu 20 25 30 Val Val Asp Arg Asp Asp Leu Val Pro Val Ile Asp Met Ser Cys Thr 35 40 45 Asp Arg Asn Val Ile Val His Gln Ile Gly Glu Ala Cys Arg Leu Tyr 50 55 60 Gly Phe Phe Gln Val Ile Asn His Gly Val Ser Lys Lys Val Met Asp 65 70 75 80 Glu Met Leu Gly Val Ala His Glu Phe Phe Lys Leu Pro Val Glu Glu 85 90 95 Lys Met Lys Leu Tyr Ser Asp Asp Pro Ser Lys Thr Met Arg Leu Ser 100 105 110 Thr Ser Phe Asn Val Lys Lys Glu Thr Val His Asn Trp Arg Asp Tyr 115 120 125 Leu Arg Leu His Cys Tyr Pro Leu Asp Lys Tyr Ala Pro Glu Trp Pro 130 135 140 Ser Asn Pro Pro Ser Phe Arg Glu Ile Val Ser Lys Tyr Cys Met Glu 145 150 155 160 Val Arg Gln Val Gly Tyr Arg Leu Glu Glu Ala Ile Ser Glu Ser Leu 165 170 175 Gly Leu Glu Lys Asp Cys Ile Lys Asn Val Leu Gly Glu Gln Gly Gln 180 185 190 His Met Ala Ile Asn Phe Tyr Pro Pro Cys Pro Gln Pro Glu Leu Thr 195 200 205 Tyr Gly Leu Pro Ala His Thr Asp Pro Asn Ala Ile Thr Ile Leu Leu 210 215 220 Gln Asp Leu Gln Val Ala Gly Leu Gln Val Leu Lys Asp Gly Glu Trp 225 230 235 240 Leu Ser Ile Lys Pro Gln Pro Asp Ala Phe Val Ile Asn Leu Gly Asp 245 250 255 Gln Leu Glu Ala Leu Ser Asn Gly Lys Tyr Lys Ser Ile Trp His Arg 260 265 270 Ala Ile Val Asn Ser Asp Lys Ala Arg Met Ser Val Ala Ser Phe Leu 275 280 285 Cys Pro Asn Asp Cys Ser Ile Ile Ser Ala Pro Lys Thr Leu Ile Glu 290 295 300 Asp Gly Ser Ser Ala Ile Tyr Arg Asp Phe Thr Tyr Thr Glu Tyr Tyr 305 310 315 320 Asp Lys Phe Trp Ser Arg Asn Leu Asp Gln Glu Tyr Cys Leu Glu Leu 325 330 335 Phe Lys Asn Asp Gly Thr 340 3340PRTPetunia 3Met Glu Ser Asn Val Ile Ser Ser Gly Thr Lys Tyr Thr Asn Leu Pro 1 5 10 15 Lys Ser Tyr Val Arg Pro Glu Ser Gln Arg Pro Arg Leu Ser Glu Val 20 25 30 Asp Asp Cys Gln Asp Asn Ile Pro Val Ile Asp Leu Cys Cys Arg Asp 35 40 45 Asn Asn Val Ile Ile Gln Gln Ile Glu Glu Ala Cys Arg Leu Tyr Gly 50 55 60 Phe Phe Gln Val Ile Asn His Gly Val Pro Lys Lys Leu Ile Glu Glu 65 70 75 80 Met Leu Gly Val Ala His Glu Phe Phe Lys Leu Pro Val Glu Glu Lys 85 90 95 Met Lys Leu Tyr Ser Asp Asp Pro Ser Lys Thr Met Arg Leu Ser Thr 100 105 110 Ser Phe Asn Val Lys Lys Glu Thr Val His Asn Trp Arg Asp Tyr Leu 115 120 125 Arg Leu His Cys Tyr Pro Leu Glu Lys Tyr Ala Pro Glu Trp Pro Ser 130 135 140 Thr Pro Ser Ser Phe Arg Glu Ile Val Ser Arg Tyr Cys Ile Glu Val 145 150 155 160 Arg Gln Leu Gly Tyr Arg Leu Gln Glu Ala Ile Ser Glu Ser Leu Gly 165 170 175 Leu Glu Lys Asp Cys Ile Lys Asn Ile Leu Gly Glu Gln Gly Gln His 180 185 190 Met Ala Val Asn Tyr Tyr Pro Pro Cys Pro Glu Pro Glu Leu Thr Tyr 195 200 205 Gly Leu Pro Ala His Thr Asp Pro Asn Ala Leu Thr Ile Leu Leu Gln 210 215 220 Asp Leu Gln Val Ala Gly Leu Gln Val Leu Lys Asp Gly Lys Trp Leu 225 230 235 240 Ser Val Lys Pro Arg Ala Asn Ala Phe Val Ile Asn Leu Gly Asp Gln 245 250 255 Leu Gln Ala Leu Ser Asn Gly Lys Tyr Arg Ser Val Trp His Arg Ala 260 265 270 Ile Val Asn Ser Asp Lys Pro Arg Leu Ser Val Ala Ser Phe Leu Cys 275 280 285 Pro Ser Asp Cys Ala Ile Ile Ser Ala Pro Lys Thr Leu Thr Glu Asp 290 295 300 Gly Ser Pro Thr Ile Tyr Arg Asp Phe Thr Tyr Pro Glu Tyr Tyr Lys 305 310 315 320 Lys Phe Trp Ser Arg Asn Leu Asp Gln Glu His Cys Met Glu Leu Phe 325 330 335 Lys Lys Gly Ser 340 4337PRTPetunia 4Met Glu Thr Lys Val Leu Ser Ser Gly Ile Arg His Ser Thr Leu Pro 1 5 10 15 Gln Asn Tyr Val Arg Pro Lys Ser Asp Arg Pro Arg Leu Ser Glu Val 20 25 30 Ala Asn Cys Glu Asn Val Pro Val Ile Asp Leu Gly Cys Ala Asp Arg 35 40 45 Thr Leu Ile Ile His Gln Ile Ser Glu Ala Cys Arg Leu Tyr Gly Phe 50 55 60 Phe Gln Val Ile Asn His Gly Val Pro Lys Lys Ile Val Glu Glu Met 65 70 75 80 Leu Glu Ile Ala Gly Glu Phe Phe Arg Leu Pro Val Glu Glu Lys Leu 85 90 95 Lys Leu Tyr Ser Asp Asp Pro Ser Lys Thr Met Arg Leu Ser Thr Ser 100 105 110 Phe Asn Val Lys Lys Glu Thr Val His Asn Trp Arg Asp Tyr Leu Arg 115 120 125 Leu His Cys Tyr Pro Leu Glu Lys Tyr Ala Pro Glu Trp Pro Ser Asn 130 135 140 Pro Ser Ser Phe Arg Glu Ile Val Ser Arg Tyr Cys Thr Glu Val Arg 145 150 155 160 Gln Leu Gly Phe Arg Leu Gln Glu Ala Ile Ala Glu Ser Leu Gly Leu 165 170 175 Glu Lys Glu Cys Ile Lys Asp Val Leu Gly Glu Gln Gly Gln His Met 180 185 190 Ala Ile Asn Phe Tyr Pro Pro Cys Pro Glu Pro Glu Leu Thr Tyr Gly 195 200 205 Leu Pro Ala His Thr Asp Pro Asn Ala Leu Thr Ile Leu Leu Gln Asp 210 215 220 Leu Gln Val Ala Gly Leu Gln Val Leu Lys Asp Gly Lys Trp Leu Ala 225 230 235 240 Val Lys Pro Gln Pro Asp Ala Phe Val Val Asn Leu Gly Asp Gln Leu 245 250 255 Gln Ala Val Ser Asn Gly Arg Tyr Lys Ser Val Trp His Arg Ala Val 260 265 270 Val Asn Thr Glu Asn Ala Arg Met Ser Val Ala Ser Phe Leu Cys Pro 275 280 285 Cys Asp Ser Ala Lys Ile Ser Ala Pro Lys Leu Leu Thr Asp Asp Gly 290 295 300 Ser Pro Ile Ile Tyr Arg Asp Phe Thr Tyr Ala Glu Tyr Tyr Lys Lys 305 310 315 320 Phe Trp Ser Arg Asn Leu Asp Gln Glu His Cys Leu Glu Leu Phe Lys 325 330 335 Asn 5337PRTSolanum lycopersicum 5Met Glu Thr Lys Val Ile Ser Ser Gly Ile Asn His Ser Thr Leu Pro 1 5 10 15 Gln Ser Tyr Ile Arg Pro Glu Ser Asp Arg Pro Arg Leu Ser Glu Val 20 25 30 Val Asp Cys Glu Asn Val Pro Ile Ile Asp Leu Ser Cys Gly Asp Gln 35 40 45 Ala Gln Ile Ile Arg Gln Ile Gly Glu Ala Cys Gln Thr Tyr Gly Phe 50 55 60 Phe Gln Val Ile Asn His Gly Val Pro Lys Glu Val Val Glu Lys Met 65 70 75 80 Leu Gly Val Ala Gly Glu Phe Phe Asn Leu Pro Val Glu Glu Lys Leu 85 90 95 Lys Leu Tyr Ser Asp Asp Pro Ser Lys Thr Met Arg Leu Ser Thr Ser 100 105 110 Phe Asn Val Lys Lys Glu Thr Val His Asn Trp Arg Asp Tyr Leu Arg 115 120 125 Leu His Cys Tyr Pro Leu Glu Lys Tyr Ala Pro Glu Trp Pro Ser Asn 130 135 140 Pro Ser Ser Phe Arg Glu Ile Val Ser Arg Tyr Cys Arg Glu Ile Arg 145 150 155 160 Gln Leu Gly Phe Arg Leu Glu Glu Ala Ile Ala Glu Ser Leu Gly Leu 165 170 175 Asp Lys Glu Cys Ile Lys Asp Val Leu Gly Glu Gln Gly Gln His Met 180 185 190 Ala Ile Asn Tyr Tyr Pro Pro Cys Pro Gln Pro Glu Leu Thr Tyr Gly 195 200 205 Leu Pro Ala His Thr Asp Pro Asn Ser Leu Thr Ile Leu Leu Gln Asp 210 215 220 Leu Gln Val Ala Gly Leu Gln Val Leu Lys Asp Gly Lys Trp Leu Ala 225 230 235 240 Val Lys Pro Gln Pro Asp Ala Phe Val Ile Asn Leu Gly Asp Gln Leu 245 250 255 Gln Ala Val Ser Asn Gly Lys Tyr Arg Ser Val Trp His Arg Ala Ile 260 265 270 Val Asn Ser Asp Gln Ala Arg Met Ser Val Ala Ser Phe Leu Cys Pro 275 280 285 Cys Asp Ser Ala Lys Ile Ser Ala Pro Lys Leu Leu Thr Glu Asp Gly 290 295 300 Ser Pro Val Ile Tyr Gln Asp Phe Thr Tyr Ala Glu Tyr Tyr Asn Lys 305 310 315 320 Phe Trp Ser Arg Asn Leu Asp Gln Gln His Cys Leu Glu Leu Phe Lys 325 330 335 Asn 6320PRTSolanum lycopersicum 6Met Met Thr Thr Thr Ser Val Leu Ser Ser Gly Phe Asn His Ser Thr 1 5 10 15 Leu Pro Gln Ser Tyr Val Arg Pro Glu Ser Gln Arg Pro Cys Met Ser 20 25 30 Glu Val Val Asp Ser Asp Asp Leu Val Pro Val Ile Asp Met Ser Cys 35 40 45 Thr Asp Arg Asn Val Ile Val His Gln Ile Gly Glu Ala Cys Arg Leu 50 55 60 Tyr Gly Phe Phe Gln Val Ile Asn His Gly Val Ser Lys Lys Ala Met 65 70 75 80 Asp Glu Met Leu Gly Thr Met Arg Leu Ser Thr Ser Phe Asn Val Lys 85 90 95 Lys Glu Thr Val His Asn Trp Arg Asp Tyr Leu Arg Leu His Cys Tyr 100 105 110 Pro Leu Asp Lys Tyr Ala Pro Glu Trp Pro Ser Asn Pro Pro Ser Phe 115 120 125 Arg Glu Ile Val Ser Lys Tyr Cys Met Glu Val Arg Glu Leu Gly Tyr 130 135 140 Arg Leu Glu Glu Ala Ile Ser Glu Ser Leu Gly Leu Glu Lys Asp Cys 145 150 155 160 Ile Lys Asn Val Leu Gly Glu Gln Gly Gln His Met Ala Ile Asn Phe 165 170 175 Tyr Pro Gln Cys Pro Gln Pro Glu Leu Thr Tyr Gly Leu Pro Ala His 180 185 190 Thr Asp Pro Asn Ala Ile Thr Ile Leu Leu Gln Asp Leu Gln Val Ala 195 200 205 Gly Leu Gln Val Leu Lys Asp Gly Lys Trp Leu Ser Ile Lys Pro Gln 210 215 220 Pro Asn Ala Phe Val Ile Asn Leu Gly Asp Gln Leu Glu Ala Leu Ser 225 230 235 240 Asn Gly Lys Tyr Lys Ser Ile Trp His Arg Ala Ile Val Asn Ser Asp 245 250 255 Lys Ala Arg Met Ser Val Ala Ser Phe Leu Cys Pro Asn Asp Cys Ser 260 265 270 Ile Ile Ser Ala Pro Lys Thr Leu Thr Glu Asp Gly Ser Ser Ala Ile 275 280 285 Tyr Arg Asp Phe Thr Tyr Ala Glu Tyr Tyr Glu Lys Phe Trp Ser Arg 290 295 300 Asn Leu Asp Gln Glu Tyr Cys Leu Glu Leu Phe Lys Asn Asp Gly Thr 305 310 315 320 71014DNASolanum tuberosum 7atggaaacga aagttatttc cagcggaatc caccactcta ctctccctca aagttacatc 60cgacccgaat ccgataggcc acgtctatcg gatgtggtcg attgcgaaaa tgttccaata 120attgacttag gttgcggaga ccaagctcaa ataatccgtc taattggaga agcttgtcaa 180acttatggtt tctttcaggt aattaatcat ggtgtaccaa aggaagttgt agagaaaatg 240ctaggggtag ctggggaatt tttcaatcta ccagtagaag agaagctaaa attgtattca 300gatgatcctt caaagaccat gagattatct actagtttta atgttaaaaa ggagacagtt 360cataattgga gagattatct cagacttcat tgtcatcctc tggagaaata tgctcctgaa 420tggccttcta atccatcgtc tttcagggat atcgtgagca gatattgcac ggaagttcga 480caactcggat ttagattgga ggaagccata gcagagagcc tgggcttaga gaaagagtgt 540attaaagatg tattgggaga acaaggccaa catatggcta tcaattttta tcctccttgt 600ccacaaccag aactcacata tgggcttccg gcccatactg atccaaattc acttacaatt 660cttcttcaag acttgcaagt ttctggtctt caagttctta aagatggtaa atggttggct 720gtcaaacctc aaccagatgc ctttgtcatt aatcttggtg atcaattgca ggcagtaagt 780aacggtaagt acaaaagtgt atggcatcga gctattgtga attcagatca agctaggatg 840tcagtggctt cgttcctatg tccgtgcgat agcgcgaaaa tcagtgctcc aaaactcctg 900acagaagatg gatctccagt catttatcag gacttcacgt atgctgagta ttacaagaag 960ttctggagca ggaatttgga ccaggaacat tgtttggaac ttttcaagaa ttaa 101481029DNASolanum tuberosum 8atggaaacaa caagtgttct ttccggtgga ttcaaccact caaccctccc tgaatcttac 60gttcgacctg aatcccaaag accccgcatg tctgaagttg ttgatcgtga tgatcttgtt 120ccagttatcg atatgtcttg tactgatagg aacgttatcg ttcatcaaat tggcgaagct 180tgtcgccttt atgggttttt ccaggtgata aatcacggtg tatcaaagaa ggttatggat 240gaaatgttgg gggtagctca tgaatttttt aagcttccag tggaagaaaa gatgaaattg 300tactcagatg atccatcaaa gactatgaga ttatcaacta gttttaatgt taagaaggaa 360actgttcata attggagaga ttatcttagg ctacactgtt atcctttgga caaatatgcc 420cctgaatggc cttctaatcc tccttctttc agggaaatag tgagcaaata ttgcatggaa 480gttagacaag ttggatatag attagaagaa gcaatatcag agagcctagg gctcgagaaa 540gattgtatta aaaatgtgtt gggtgaacaa ggacaacata tggctatcaa tttttatcct 600ccatgtccac aacctgaact aacttatggg ttaccagccc atacagatcc aaatgcaatt 660acaattcttc ttcaagattt gcaagtggct ggccttcaag ttcttaagga tggagaatgg 720ttatctatta aacctcaacc

tgatgccttt gtcatcaatc ttggtgatca attggaggca 780ttgagtaatg gaaagtataa aagtatatgg catagagcta ttgtaaattc agataaagca 840aggatgtctg tggcttcttt cctctgtccc aatgattgtt ccattatcag tgctccaaaa 900accttaattg aagatggatc ttcagccatt tatcgagatt tcacttatac tgaatattat 960gacaaatttt ggagcaggaa tttagaccag gaatattgtt tagaactttt caagaacgat 1020ggaacctag 102991014DNAPetunia 9atggaaacaa aagttctttc aagtggaatc cgtcattcta ccctccctca aaattatgtc 60cgacccaaat ccgataggcc acgtctttca gaagtggcca attgtgaaaa cgttccagtt 120attgacttgg gttgtgctga cagaactctc ataattcatc aaattagcga agcctgtcgt 180ctttatggtt ttttccaggt aataaaccat ggtgtaccaa aaaaaatagt tgaggaaatg 240ctagagatag ctggggagtt ttttaggcta ccagttgaag agaagcttaa gttgtattca 300gatgaccctt caaagaccat gagattatca actagtttta atgtaaagaa ggagacggtg 360cacaattgga gagattatct cagacttcat tgttatcctc tggagaaata tgctcctgaa 420tggccttcaa atccttcatc tttcagggaa atcgtgagca gatattgcac ggaagttcga 480caacttggat tcagattgca agaagccata gcagaaagct taggcttaga gaaagagtgt 540ataaaggatg tgttaggtga acaaggtcaa catatggcta taaactttta tcctccatgc 600ccagaaccag aactcactta cgggctgcca gcccataccg atccaaatgc tcttacaatt 660cttcttcaag acttgcaagt agctggtctc caagttctta aagatggcaa atggttggct 720gtcaaacctc agcccgatgc ctttgttgtt aatctcggtg atcaactgca ggcagtgagt 780aacggaaggt acaaaagcgt atggcatcga gctgttgtaa atacagaaaa tgccaggatg 840tctgtggctt cgttcttatg tccctgtgat agtgcaaaaa tcagtgctcc aaaactcctc 900actgatgatg gatctccaat aatttatcgg gacttcacgt atgcagagta ttacaagaag 960ttctggagca ggaatttgga ccaagaacat tgtttggaac ttttcaagaa ttaa 1014101023DNAPetunia 10atggaatcta atgttatttc cagcggaacc aaatacacaa acctccctaa aagttatgtt 60cgcccagaat cccaacgacc tcggttatct gaagtagacg attgccaaga taatattcca 120gttattgatt tgtgttgcag agacaataac gttatcattc aacaaattga agaagcttgt 180cgtctttatg gcttttttca ggtaataaac catggtgtac caaagaaact aatagaggaa 240atgctagggg tagctcatga gtttttcaag ctaccagtgg aagagaagat gaagttgtac 300tcagatgatc catcaaagac catgagatta tcaacaagtt ttaatgtgaa gaaggaaact 360gttcataatt ggagagacta tcttagattg cactgctatc ctttggagaa atatgcccct 420gaatggcctt ctactccctc ttctttcagg gaaatcgtta gcagatattg catagaagtt 480cgacaacttg gatatagatt acaagaagca atatcagaga gcttaggcct agagaaagat 540tgtataaaaa atatattggg tgaacaaggt caacatatgg ctgttaatta ttaccctcca 600tgtccagaac cagaactaac ttatggtttg ccagcccata ctgatcctaa tgcccttact 660atacttcttc aagacttgca agtagcaggt cttcaagttc tcaaggatgg taaatggtta 720tctgtgaaac ctcgggccaa tgcctttgtc atcaatcttg gtgatcaatt gcaggcgctg 780agtaatggaa aatatagaag tgtatggcac agagctatag taaattcaga caaaccaagg 840ctgtcagtgg cttctttctt gtgtcctagt gattgtgcga taatcagtgc tccaaaaacc 900ttaactgaag atgggtctcc aaccatttat cgggatttca cgtatccaga atattacaag 960aaattttgga gcagaaattt agatcaagaa cactgtatgg aacttttcaa gaaaggaagc 1020tag 1023111014DNASolanum lycopersicum 11atggaaacca aagttatttc tagcggaatc aaccactcta ctcttcctca aagttacatc 60cgacccgaat ccgatagacc acgtctatcg gaagtggtcg attgtgaaaa tgttccaata 120attgacttaa gttgcggaga tcaagctcaa ataattcgtc aaattggaga agcttgtcaa 180acttatggtt tctttcaggt aattaatcat ggtgtaccaa aggaagttgt agagaaaatg 240ctaggggtag ctggggaatt tttcaattta ccagtagaag agaaactaaa attatattca 300gatgatcctt caaagaccat gagattatca acaagtttta atgttaaaaa ggagacagtt 360cataattgga gagattatct cagacttcat tgttatcctc tagagaagta tgctcctgaa 420tggccttcta atccatcatc tttcagggaa atcgtgagca gatattgcag ggaaattcgt 480caactcggat ttagattaga agaagccata gcagaaagcc tggggttaga taaagagtgt 540ataaaagatg tattgggtga acaaggacaa catatggcta tcaattatta tcctccttgt 600ccacaaccag aacttactta tgggcttccg gcccatactg atccaaattc acttacaatt 660cttcttcaag acttgcaagt tgcgggtctt caagttctta aagatggcaa atggttagct 720gtaaaacctc aacctgacgc ctttgtcatt aatcttgggg atcaattgca ggcagtaagt 780aacggtaagt acagaagtgt atggcatcga gctattgtga attcagatca agctaggatg 840tcagtggctt cgtttctatg tccgtgtgat agcgcgaaaa tcagtgcacc aaagctgctg 900acagaagatg gatctccagt gatttatcaa gactttacgt atgctgagta ttacaacaag 960ttctggagca ggaatttgga ccagcaacat tgtttggaac ttttcaagaa ctaa 101412963DNASolanum lycopersicum 12atgatgacaa caacaagtgt tctttctagt ggattcaacc actcaaccct ccctcaatct 60tacgttcgac ctgaatctca aagaccttgc atgtctgaag ttgttgatag cgacgatctt 120gtcccagtca ttgatatgtc ttgtactgat aggaacgtta tcgttcatca aatcggtgaa 180gcttgtcgtc tttatgggtt ttttcaggtg ataaatcacg gtgtgtcgaa gaaggcgatg 240gatgaaatgt tagggactat gagattatca actagtttta atgttaagaa ggaaactgtt 300cataattgga gagattatct taggctacat tgttatcctt tggacaaata tgcccctgaa 360tggccttcta atcctccttc tttcagggaa atagtaagca aatattgcat ggaagttaga 420gagcttggat atagattgga agaagcaata tcagagagct tagggcttga gaaggattgt 480ataaaaaatg tgttaggtga acaaggacaa catatggcta tcaattttta tcctcagtgt 540ccacaacctg aattaactta tgggttacca gcccatacag atccaaatgc aattacaatt 600cttcttcaag atttgcaagt ggctggcctt caagttctta aggatggaaa atggttatct 660attaaacctc agcctaatgc ctttgtcatc aatcttggtg atcaattgga ggcgttgagt 720aatgggaagt ataaaagtat atggcataga gctattgtaa attcagacaa agcaaggatg 780tctgtggctt cttttctctg tcccaatgat tgttccatta tcagtgctcc aaaaacctta 840actgaagatg gatcttctgc aatttatcga gatttcactt atgctgaata ttatgaaaaa 900ttctggagca ggaatttaga tcaggaatat tgtttagaac tttttaagaa cgatggaacc 960tag 9631334DNAArtificial SequenceS. Lycopersicum AttB1-F primer 13aaaaagcagg cttcttgggt gaacaaggac aaca 341433DNAArtificial SequenceS.Lycopersicum AttB2-R primer 14agaaagctgg gtaaaacgaa gccactgaca tcc 3315303DNAArtificial Sequencesilencing construct for SEQ ID Nos 11 and 12 15ttgggtgaac aaggacaaca tatggctatc aattattatc ctccttgtcc acaaccagaa 60cttacttatg ggcttccggc ccatactgat ccaaattcac ttacaattct tcttcaagac 120ttgcaagttg cgggtcttca agttcttaaa gatggcaaat ggttagctgt aaaacctcaa 180cctgacgcct ttgtcattaa tcttggggat caattgcagg cagtaagtaa cggtaagtac 240agaagtgtat ggcatcgagc tattgtgaat tcagatcaag ctaggatgtc agtggcttcg 300ttt 303

Claims

1.-11. (canceled)

12. An isolated potato plant which is resistant to Phytophthora infestans comprising a non-natural modification introduced into its genome that results in: reduced expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, or reduced activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, as compared to a potato plant that is not resistant to Phytophthora infestans.

13. The potato plant as claimed in claim 12, wherein the modification is gene silencing.

14. The potato plant as claimed in claim 13, wherein genes having the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 are silenced.

15. The potato plant as claimed in claim 12, wherein the modification results in reduced activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2 as compared to a potato plant that is not resistant to Phytophthora infestans.

16. The potato plant as claimed in claim 12, wherein the modification results in reduced activity of proteins having the amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2 as compared to a potato plant that is not resistant to Phytophthora infestans.

17. A seed, tissue, or plant part of the potato plant according to claim 12, wherein the seed, tissue, or plant part comprises the modification that results in: reduced expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, or reduced activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, as compared to a potato plant that is not resistant to Phytophthora infestans.

18. A method for obtaining a potato plant which is resistant to Phytophthora infestans, the method comprising modifying the potato plant by: reducing expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, or reducing activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, as compared to a potato plant that is not resistant to Phytophthora infestans.

19. The method of claim 18, wherein the modification comprises reducing expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2 as compared to a potato plant that is not resistant to Phytophthora infestans, and wherein the modification is effected through gene silencing.

20. The method of claim 19, wherein genes having the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 are silenced.

21. The method of claim 18, wherein the modification comprises reducing activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2 as compared to a potato plant that is not resistant to Phytophthora infestans.

22. A potato plant produced from the method according to claim 18, wherein the plant has: reduced expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, or reduced activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, as compared to a potato plant that is not resistant to Phytophthora infestans.

23. A seed, tissue, or plant part of the potato plant according to claim 22, wherein the seed, tissue, or plant part has: reduced expression or transcription of genes encoding proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, or reduced activity of proteins having at least 90% sequence identity to SEQ ID NO: 1 and SEQ ID NO: 2, as compared to a potato plant that is not resistant to Phytophthora infestans.