Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: PRODUCTION OF CLOSED LINEAR DNA

Inventors:  Vanessa Hill (Surrey, GB)
IPC8 Class: AC12Q168FI
USPC Class: 435 912
Class name: Nucleotide polynucleotide (e.g., nucleic acid, oligonucleotide, etc.) acellular exponential or geometric amplification (e.g., pcr, etc.)
Publication date: 2015-11-19
Patent application number: 20150329902



Abstract:

An in vitro process for the production of closed linear deoxyribonucleic acid (DNA) comprises (a) contacting a DNA template comprising at least one protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of the template; and (b) contacting amplified DNA produced in (a) with at least one protelomerase under conditions promoting production of closed linear DNA. A kit provides components necessary in the process.

Claims:

1. A kit suitable for use in an in vitro cell-free process for production of a closed linear deoxyribonucleic acid (DNA), comprising at least one DNA polymerase and at least one protelomerase.

2. The kit according to claim 1, wherein said DNA polymerase is a strand displacement-type DNA polymerase.

3. The kit according to claim 2, wherein said DNA polymerase is a rolling circle amplification (RCA) DNA polymerase.

4. The kit according to claim 3, wherein said DNA polymerase is phi29 of SEQ ID NO: 2 or a variant thereof which comprises at least 80% identity to full-length SEQ ID NO: 2.

5. The kit according to claim 1, wherein said protelomerase is bacteriophage N15 TelN of SEQ ID NO: 15 or a variant thereof which comprises at least 80% identity to full-length SEQ ID NO:15.

6. The kit according to claim 1, further comprising dNTPs, suitable buffers and one or more primers.

7. The kit according to claim 6, wherein said primers are random primers.

8. The kit according to claim 6, wherein said primers are specific primers.

9. The kit according to claim 6, wherein said primers comprise chemically modified nucleotides.

10. The kit according to claim 1, further comprising a pyrophosphatase.

11. Concatameric DNA comprising multiple repeats of a DNA template, said DNA template comprising at least one protelomerase target sequence.

12. The concatameric DNA of claim 11, wherein said DNA template comprises one or more expression cassettes flanked on either side by protelomerase target sequence.

13. The concatameric DNA of claim 12, wherein said expression cassette comprises a eukaryotic promoter operably linked to a sequence encoding an mRNA or protein.

14. The concatameric DNA of claim 12, wherein said expression cassette further comprises a eukaryotic transcription termination sequence.

15. The concatameric DNA of claim 12, wherein the expression cassette lacks one or more bacterial or vector sequences selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers; and (iii) unmethylated CpG motifs.

16. The concatameric DNA of claim 11, wherein the concatamer comprises 10 or more units of amplified DNA template.

17. The concatameric DNA of claim 11, wherein the concatamer is at least 5 kb in size.

18. The concatameric DNA of claim 11, wherein said DNA is linear single stranded DNA with multiple repeats of template DNA.

19. The concatameric DNA of claim 11, wherein said DNA is in vitro.

20. The concatameric DNA of claim 11, wherein said DNA template comprises more than one protelomerase target sequence.

Description:

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This Application is a divisional of U.S. patent application Ser. No. 13/146,350 filed on Jul. 23, 2012, which is a national phase application under 35 U.S.C. §371 that claims priority to International Application No. PCT/GB2010/000165 filed Feb. 1, 2010, which claims priority to GB Patent Application 0901593.4 filed on Jan. 30, 2009. The above applications in their entirety are hereby incorporated by reference for all purposes and made a part of the present disclosure.

FIELD OF THE INVENTION

[0002] The present invention relates to an in vitro, cell-free process for the production of closed linear deoxyribonucleic acid (DNA).

BACKGROUND OF THE INVENTION

[0003] Traditional cell-based processes for amplification of DNA in large quantities are costly. For example, use of bacteria requires their growth in large volumes in expensive fermenters that are required to be maintained in a sterile state in order to prevent contamination of the culture. The bacteria also need to be lysed to release the amplified DNA and the DNA needs to be cleaned and purified from other bacterial components. In particular, where DNA vaccines or other therapeutic DNA agents are produced, high purity is required to eliminate the presence of endotoxins which are toxic to mammals.

[0004] In addition to the issues of cost, use of bacteria can in many cases present difficulties for fidelity of the amplification process. In the complex biochemical environment of the bacterial cell, it is difficult to control the quality and yields of the desired DNA product. The bacteria may occasionally alter the required gene cloned within the amplified DNA and render it useless for the required purpose. Recombination events may also lead to problems in faithful production of a DNA of interest. Cell-free enzymatic processes for amplification of DNA avoid the requirement for use of a host cell, and so are advantageous.

[0005] For example, the manufacture of medicinal DNA cassettes relies on almost exclusively on their insertion into bacterial plasmids and their amplification in bacterial fermentation processes.

[0006] This current state of the art process limits opportunities for improving the manufacture of such DNA medicines in a number of ways. In addition, the plasmid product is essentially a crude DNA molecule in that it contains nucleotide sequences not required for its medicinal function. Accordingly, in the field of production of DNA products, such as DNA medicines, there is a need to provide improved methods for amplification of DNA in large quantities. In particular, there is a need to provide improved methods for amplification of specific forms of DNA, such as closed linear DNAs. Closed linear DNA molecules have particular utility for therapeutic applications, as they have improved stability and safety over other forms of DNA.

SUMMARY OF THE INVENTION

[0007] The present invention relates to a process for in vitro, cell-free production of linear covalently closed DNA (closed linear DNA). The process allows for enhanced production of linear covalently closed DNA compared to current methodologies involving cellular processes and amplification within plasmids. This significantly increases process productivity while reducing the cost of product purification.

[0008] According to the present invention, production of linear covalently closed DNA from a DNA template is carried out enzymatically in the absence of a host cell. The template DNA comprises at least one protelomerase target sequence. The template DNA is contacted with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of the template. DNA amplified from the template is contacted with at least one protelomerase under conditions promoting production of closed linear DNA.

[0009] Accordingly, the present invention provides an in vitro cell-free process for production of a closed linear deoxyribonucleic acid (DNA) comprising:

[0010] (a) contacting a DNA template comprising at least one protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of said template; and

[0011] (b) contacting amplified DNA produced in (a) with at least one protelomerase under conditions promoting production of closed linear DNA.

[0012] The invention further relates to a kit providing components necessary in the process of the invention. Thus, the invention provides a kit comprising at least one DNA polymerase and at least one protelomerase and instructions for use in a process of the invention.

BRIEF DESCRIPTION OF FIGURES

[0013] FIG. 1: Replication of linear covalently closed DNA in bacteriophages and the role of protelomerase. A. Depiction of extrachromosomal bacteriophage linear covalently closed DNA. *=Centre of palindromic sequence of telomere. The R sequence is an inverted palindromic repeat of the L sequence. B. Replication of bacteriophage DNA in host: Bubble indicates DNA strand replication. Synthesis of the complementary strand to R and L leads to identical double stranded RL sequences. C. Products formed by action of protelomerase. Protelomerase binds to the RL sequence and cuts and ligates the opposite strands at the centre point of the palindromic sequence to reform the telomeres and complete the replication of the original linear covalently closed DNA.

[0014] FIG. 2: The action of Escherichia coli phage N15 protelomerase (TelN) on circular double stranded DNA containing its target site, telRL. TelRL is an inverted palindrome with 28 bp right (telR) (SEQ ID NO:37) and left (telL) (SEQ ID NO:38) arms indicated by the arrows. The sequences underlined indicate imperfections in the telRL palindrome. A central 22 bp perfect inverted palindrome TelO (SEQ ID NO:17) is required for the binding of the enzyme, TelN. TelN cleaves this 22 bp sequence at its mid-point and joins the ends of the complementary strands to form covalently closed ends.

[0015] FIG. 3: Comparison of protelomerase target sequences in found in various organisms. The boxed sequences show the extent of perfect or imperfect palindromic sequence. Underlining shows imperfections in the palindrome. The base pair sequences highlighted are common to all protelomerase target sequences indicating their importance to protelomerase binding and action. A. Escherichia coli phage N15 (SEQ ID NO:25). B. Klebsiella phage Phi KO2 (SEQ ID NO:26). C. Yersinia phage Py54 (SEQ ID NO:27). D. Halomonas phage Phi HAP (SEQ ID NO:24). E. Vibrio phage VP882 (SEQ ID NO:28). F. Borrelia burgdorferi plasmid lpB31.16 (SEQ ID NO:29). The boxed sequences show the extent of perfect or imperfect palindromic sequence for each bacteriophage. G. The consensus inverse palindromic sequence for bacteriophage protelomerase binding and action is shown in SEQ ID NO:16. This is a 22 base pair perfect inverted repeat sequence (11 base pairs either side of the cut site). The consensus sequence is derived from the conserved highlighted residues shown for A-E. Conserved base pairs and their positions in the palindrome are indicated. Dashes indicate flexibility in sequence composition i.e. where bases may be N (A, T, C or G).

[0016] FIG. 4: Specific process for in vitro amplification of a linear double stranded covalently closed DNA using an RCA strand displacement DNA polymerase in combination with TelN protelomerase. A. Closed linear DNA template. R and L represent the DNA sequences of the right and left arms of the TelN protelomerase binding sequence. B. Denaturation of starting template to form circular single stranded DNA. C. Primer binding. D-E. Rolling circle amplification from single stranded DNA template by an RCA strand displacement DNA polymerase. F. Formation of long concatemeric double stranded DNA comprising single units of amplified template separated by protelomerase binding sequences (RL). G. Contacting with TelN protelomerase specific to RL sequence. Protelomerase cleaves concatameric DNA at RL site and ligates complementary strands to produce amplified copies of the original linear covalently closed DNA template.

[0017] FIG. 5: Excision of DNA cassette expressing gene of interest from a long double stranded DNA molecule to create a closed linear DNA cassette. A. Linear double standed DNA molecule containing a DNA cassette containing gene of interest flanked by protelomerase target sequences. B. Excision of the DNA cassette as a linear covalently closed DNA molecule.

[0018] FIG. 6: Amplification of closed linear DNA and reporter gene expression for "doggybone" expression cassette.

[0019] A. Confirmation of TelN cleavage of RCA amplified concatamers to form closed linear DNA by agarose gel electrophoresis. Lanes 1 to 3 show RCA amplified pUC18. Lane 1: 3 microlitres undigested RCA amplified pUC18. Lane 2: 2 microlitres RCA amplified pUC18 digested with Pvul. Lane 3: 2 microlitres RCA amplified pUC18 treated with TelN (negative control). Lanes 4 to 6 show RCA amplified pUC18 telRL. Lane 4: 3 microlitres undigested RCA amplified pUC18 telRL. Lane 5: 1 microlitre RCA amplified pUC18 telRL digested with Pvul. Lane 6: 4 microlitres RCA amplified pUC18 telRL treated with TelN. The 2.7 kb closed linear DNA generated on treatment with TelN is indicated. Flanking lanes are DNA size markers.

[0020] B. Lab-On-A-Chip (LOC) analysis showing resistance of closed linear DNA to thermal denaturation. Lane 1: DNA size marker. Lanes 2 and 3: 100 ng PCR DOG. Lanes 4 and 5: 100 ng denatured PCR DOG. Lanes 6 and 7: "doggybone" DNA -100 ng pGL DOG treated with TelN. Lanes 6 and 7: "doggybone DNA"--100ng pGL DOG treated with TelN and denatured.

[0021] C. Validation of expression of closed linear DNA in cells by transfection. y axis: mean Firefly/Renilla ratio; x-axis: linear DNA constructs used in transfection. PCR pGL: open linear PCR fragment from pGL4.13 across luc gene. PCR DOG: open linear PCR fragment amplified from pGL DOG using primers flanking the telRL sites. "doggy MP" : closed linear DNA from pGL DOG isolated from mini-prep DNA digested with PvuI (to remove contaminating vector DNA) and cleaved with TelN. "doggy RCA" : closed linear DNA from pGL DOG amplified by RCA digested with PvuI and cleaved with TelN.

DESCRIPTION OF SEQUENCES

[0022] SEQ ID NO:1 is the nucleic acid sequence of a Bacillus bacteriophage phi29 DNA polymerase.

[0023] SEQ ID NO: 2 is the amino acid sequence of a Bacillus bacteriophage phi29 DNA polymerase encoded by SEQ ID NO: 1.

[0024] SEQ ID NO: 3 is the amino acid sequence of a Pyrococcus sp Deep Vent DNA polymerase.

[0025] SEQ ID NO: 4 is the nucleic acid sequence of Bacillus stearothermophilus DNA polymerase I.

[0026] SEQ ID NO: 5 is the amino acid sequence of Bacillus stearothermophilus DNA polymerase I encoded by SEQ ID NO: 4.

[0027] SEQ ID NO: 6 is the nucleic acid sequence of a Halomonas phage phiHAP-1 protelomerase nucleic acid sequence.

[0028] SEQ ID NO: 7 is the amino acid sequence of a Halomonas phage phiHAP-1 protelomerase encoded by SEQ ID NO: 6.

[0029] SEQ ID NO: 8 is the nucleic acid sequence of a Yersinia phage PY54 protelomerase.

[0030] SEQ ID NO: 9 is the amino acid sequence of a Yersinia phage PY54 protelomerase encoded by SEQ ID NO: 8.

[0031] SEQ ID NO: 10 is the nucleic acid sequence of a Klebsiella phage phiKO2 protelomerase.

[0032] SEQ ID NO: 11 is the amino acid sequence of a Klebsiella phage phiKO2 protelomerase encoded by SEQ ID NO: 10.

[0033] SEQ ID NO: 12 is the nucleic acid sequence of a Vibrio phage VP882 protelomerase.

[0034] SEQ ID NO: 13 is the amino acid sequence of a Vibrio phage VP882 protelomerase encoded by SEQ ID NO: 12.

[0035] SEQ ID NO: 14 is the nucleic acid sequence of an Escherichia coli bacteriophage N15 protelomerase (telN) and secondary immunity repressor (cA) nucleic acid sequence.

[0036] SEQ ID NO: 15 is the amino acid sequence of an Escherichia coli bacteriophage N15 protelomerase (telN) encoded by SEQ ID NO: 14

[0037] SEQ ID NO: 16 is a consensus nucleic acid sequence for a perfect inverted repeat present in bacteriophage protelomerase target sequences.

[0038] SEQ ID NO: 17 is a 22 base perfect inverted repeat nucleic acid sequence from E. coli phage N15 and Klebsiella phage phiKO2.

[0039] SEQ ID NO: 18 is a 22 base perfect inverted repeat nucleic acid sequence from Yersinia phage PY54.

[0040] SEQ ID NO: 19 is a 22 base perfect inverted repeat nucleic acid sequence from Halomonas phage phiHAP-1.

[0041] SEQ ID NO: 20 is a 22 base perfect inverted repeat nucleic acid sequence from Vibrio phage VP882.

[0042] SEQ ID NO: 21 is a 14 base perfect inverted repeat nucleic acid sequence from Borrelia burgdorferi plasmid lpB31.16.

[0043] SEQ ID NO: 22 is a 24 base perfect inverted repeat nucleic acid sequence from Vibrio phage VP882.

[0044] SEQ ID NO: 23 is a 42 base perfect inverted repeat nucleic acid sequence from Yersinia phage PY54.

[0045] SEQ ID NO: 24 is a 90 base perfect inverted repeat nucleic acid sequence from Halomonas phage phiHAP-1.

[0046] SEQ ID NO: 25 is a nucleic acid sequence from E. coli phage N15 comprising a protelomerase target sequence.

[0047] SEQ ID NO: 26 is a nucleic acid sequence from Klebsiella phage phiKO2 comprising a protelomerase target sequence.

[0048] SEQ ID NO: 27 is a nucleic acid sequence from Yersinia phage PY54 comprising a protelomerase target sequence.

[0049] SEQ ID NO: 28 is a nucleic acid sequence from Vibrio phage VP882 comprising a protelomerase target sequence.

[0050] SEQ ID NO: 29 is a nucleic acid sequence from Borrelia burgdorferi plasmid lpB31.16 comprising a protelomerase target sequence.

[0051] SEQ ID NO: 30 is a modified oligonucleotide primer used in amplification of TelN.

[0052] SEQ ID NO: 31 is a modified oligonucleotide primer used in amplification of TelN.

[0053] SEQ ID NO: 32 is a synthetic oligonucleotide containing the TelN recognition site telRL.

[0054] SEQ ID NO: 33 is a synthetic oligonucleotide containing the TelN recognition site telRL.

[0055] SEQ ID NO: 34 is a primer sequence used in amplification of PCR DOG.

[0056] SEQ ID NO: 35 is a primer sequence used in amplification of PCR DOG.

DETAILED DESCRIPTION OF THE INVENTION

[0057] The present invention relates to processes for the production of linear double stranded covalently closed DNA i.e closed linear DNA molecules. Closed linear DNA molecules typically comprise covalently closed ends also described as hairpin loops, where base-pairing between complementary DNA strands is not present. The hairpin loops join the ends of complementary DNA strands. Structures of this type typically form at the telomeric ends of chromosomes in order to protect against loss or damage of chromosomal DNA by sequestering the terminal nucleotides in a closed structure. In examples of closed linear DNA molecules described herein, hairpin loops flank complementary base-paired DNA strands, forming a "doggy-bone" shaped structure (as shown in FIG. 1).

[0058] The processes of the present invention provide for high throughput production of closed linear DNA molecules by incorporating a single processing step converting amplified DNA into closed linear DNA. In addition, the processes of the present invention are carried out in an in vitro cell-free environment, and as such are not limited to use of DNA templates having extraneous sequences necessary for bacterial propagation. As outlined below, the process of the invention can therefore be used to produce closed linear DNA molecules which lack problematic vector sequences and are particularly suitable for therapeutic uses.

[0059] Closed DNA molecules have particular utility as therapeutic agents i.e. DNA medicines which can be used to express a gene product in vivo. This is because their covalently closed structure prevents attack by enzymes such as exonucleases, leading to enhanced stability and longevity of gene expression as compared to "open" DNA molecules with exposed DNA ends. Linear double stranded open-ended cassettes have been demonstrated to be inefficient with respect to gene expression when introduced into host tissue. This has been attributed to cassette instability due to the action of exonucleases in the extracellular space.

[0060] Sequestering DNA ends inside covalently closed structures also has other advantages. The DNA ends are prevented from integrating with genomic DNA and so closed linear DNA molecules are of improved safety. Also, the closed linear structure prevents concatamerisation of DNA molecules inside host cells and thus expression levels of the gene product can be regulated in a more sensitive manner. The present invention provides an in vitro cell-free process for production of closed linear DNA molecules that comprises template-directed DNA amplification, and specific processing of amplified DNA by protelomerase.

[0061] Typically, the process of the invention may be used for production of DNA for in vitro expression in a host cell, particularly in DNA vaccines. DNA vaccines typically encode a modified form of an infectious organism's DNA. DNA vaccines are administered to a subject where they then express the selected protein of the infectious organism, initiating an immune response against that protein which is typically protective. DNA vaccines may also encode a tumour antigen in a cancer immunotherapy approach.

[0062] A DNA vaccine may comprise a nucleic acid sequence encoding an antigen for the treatment or prevention of a number of conditions including but not limited to cancer, allergies, toxicity and infection by a pathogen such as, but not limited to, fungi, viruses including Human Papilloma Viruses (HPV), HIV, HSV2/HSV1, Influenza virus (types A, B and C), Polio virus, RSV virus, Rhinoviruses, Rotaviruses, Hepatitis A virus, Norwalk Virus Group, Enteroviruses, Astroviruses, Measles virus, Parainfluenza virus, Mumps virus, Varicella-Zoster virus, Cytomegalovirus, Epstein-Barr virus, Adenoviruses, Rubella virus, Human T-cell Lymphoma type I virus (HTLV-I), Hepatitis B virus (HBV), Hepatitis C virus (HCV), Hepatitis D virus, Pox virus, Marburg and Ebola; bacteria including Mycobacterium tuberculosis, Chlamydia, Neisseria gonorrhoeae, Shigella, Salmonella, Vibrio cholerae, Treponema pallidum, Pseudomonas, Bordetella pertussis, Brucella, Franciscella tularensis, Helicobacter pylori, Leptospira interrogans, Legionella pneumophila, Yersinia pestis, Streptococcus (types A and B), Pneumococcus, Meningococcus, Haemophilus influenza (type b), Toxoplasma gondii, Campylobacteriosis, Moraxella catarrhalis, Donovanosis, and Actinomycosis; fungal pathogens including Candidiasis and Aspergillosis; parasitic pathogens including Taenia, Flukes, Roundworms, Amoebiasis, Giardiasis, Cryptosporidium, Schistosoma, Pneumocystis carinii, Trichomoniasis and Trichinosis.

[0063] DNA vaccines may comprise a nucleic acid sequence encoding an antigen from a member of the adenoviridae (including for instance a human adenovirus), herpesviridae (including for instance HSV-1, HSV-2, EBV, CMV and VZV), papovaviridae (including for instance HPV), poxviridae (including for instance smallpox and vaccinia), parvoviridae (including for instance parvovirus B 19), reoviridae (including for instance a rotavirus), coronaviridae (including for instance SARS), flaviviridae (including for instance yellow fever, West Nile virus, dengue, hepatitis C and tick-borne encephalitis), picornaviridae (including polio, rhinovirus, and hepatitis A), togaviridae (including for instance rubella virus), filoviridae (including for instance Marburg and Ebola), paramyxoviridae (including for instance a parainfluenza virus, respiratory syncitial virus, mumps and measles), rhabdoviridae (including for instance rabies virus), bunyaviridae (including for instance Hantaan virus), orthomyxoviridae (including for instance influenza A, B and C viruses), retroviridae (including for instance HIV and HTLV) and hepadnaviridae (including for instance hepatitis B).

[0064] The antigen may be from a pathogen responsible for a veterinary disease and in particular may be from a viral pathogen, including, for instance, a Reovirus (such as African Horse sickness or Bluetongue virus) and Herpes viruses (including equine herpes). The antigen may be one from Foot and Mouth Disease virus, Tick borne encephalitis virus, dengue virus, SARS, West Nile virus and Hantaan virus. The antigen may be from an immunodeficiency virus, and may, for example, be from SIV or a feline immunodeficiency virus.

[0065] DNA vaccines produced by the process of the invention may also comprise a nucleic acid sequence encoding tumour antigens. Examples of tumour associated antigens include, but are not limited to, cancer-testes antigens such as members of the MAGE family (MAGE 1, 2, 3 etc), NY-ESO-1 and SSX-2, differentation antigens such as tyrosinase, gp100, PSA, Her-2 and CEA, mutated self antigens and viral tumour antigens such as E6 and/or E7 from oncogenic HPV types. Further examples of particular tumour antigens include MART-1, Melan-A, p97, beta-HCG, GaINAc, MAGE-1, MAGE-2, MAGE-4, MAGE-12, MUC1, MUC2, MUC3, MUC4, MUC18, CEA, DDC, PIA, EpCam, melanoma antigen gp75, Hker 8, high molecular weight melanoma antigen, K19, Tyr1, Tyr2, members of the pMel 17 gene family, c-Met, PSM (prostate mucin antigen), PSMA (prostate specific membrane antigen), prostate secretary protein, alpha-fetoprotein, CA125, CA19.9, TAG-72, BRCA-1 and BRCA-2 antigen.

[0066] Also, the process of the invention may produce other types of therapeutic DNA molecules e.g. those used in gene therapy. For example, such DNA molecules can be used to express a functional gene where a subject has a genetic disorder caused by a dysfunctional version of that gene. Examples of such diseases include Duchenne muscular dystrophy, cystic fibrosis, Gaucher' s Disease, and adenosine deaminase (ADA) deficiency. Other diseases where gene therapy may be useful include inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardivascular disease, hypercholestemia, various blood disorders including various anaemias, thalassemia and haemophilia, and emphysema. For the treatment of solid tumors, genes encoding toxic peptides (i.e., chemotherapeutic agents such as ricin, diptheria toxin and cobra venom factor), tumor suppressor genes such as p53, genes coding for mRNA sequences which are antisense to transforming oncogenes, antineoplastic peptides such as tumor necrosis factor (TNF) and other cytokines, or transdominant negative mutants of transforming oncogenes, may be expressed.

[0067] Other types of therapeutic DNA molecules are also contemplated for production by the process of the invention. For example, DNA molecules which are transcribed into an active RNA form, for example a small interfering RNA (siRNA) may be produced according to the process of the invention.

[0068] In embodiments directed to production of DNA molecules having therapeutic utility, the DNA template will typically comprise an expression cassette comprising one or more promoter or enhancer elements and a gene or other coding sequence which encodes an mRNA or protein of interest. In particular embodiments directed to generation of DNA vaccine molecules or DNA molecules for gene therapy, the DNA template comprises an expression cassette consisting of a eukaryotic promoter operably linked to a sequence encoding a protein of interest, and optionally an enhancer and/or a eukaryotic transcription termination sequence. Typically, the DNA template may be in the form of a vector commonly used to house a gene e.g. an extrachromosomal genetic element such as a plasmid.

[0069] A "promoter" is a nucleotide sequence which initiates and regulates transcription of a polynucleotide. Promoters can include inducible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (where expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. It is intended that the term "promoter" or "control element" includes full-length promoter regions and functional (e.g., controls transcription or translation) segments of these regions.

[0070] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a nucleic acid sequence is capable of effecting the expression of that sequence when the proper enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the nucleic acid sequence and the promoter sequence can still be considered "operably linked" to the coding sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation of the promoter element and the DNA sequence of interest which allows for initiation of transcription of the DNA sequence of interest upon recognition of the promoter element by a transcription complex.

[0071] According to the present invention, closed linear DNA molecules are generated by the action of protelomerase on DNA amplified from a DNA template comprising at least one protelomerase target sequence. A protelomerase target sequence is any DNA sequence whose presence in a DNA template allows for its conversion into a closed linear DNA by the enzymatic activity of protelomerase. In other words, the protelomerase target sequence is required for the cleavage and religation of double stranded DNA by protelomerase to form covalently closed linear DNA.

[0072] Typically, a protelomerase target sequence comprises any perfect palindromic sequence i.e any double-stranded DNA sequence having two-fold rotational symmetry, also described herein as a perfect inverted repeat. As shown in FIG. 3, the protelomerase target sequences from various mesophilic bacteriophages, and a bacterial plasmid all share the common feature of comprising a perfect inverted repeat. The length of the perfect inverted repeat differs depending on the specific organism. In Borrelia burgdorferi, the perfect inverted repeat is 14 base pairs in length. In various mesophilic bacteriophages, the perfect inverted repeat is 22 base pairs or greater in length. Also, in some cases, e.g E. coli N15, the central perfect inverted palindrome is flanked by inverted repeat sequences, i.e forming part of a larger imperfect inverted palindrome (see FIGS. 2 and 3; the underlined bases indicate where the symmetry of the inverted repeats is interrupted).

[0073] A protelomerase target sequence as used in the invention preferably comprises a double stranded palindromic (perfect inverted repeat) sequence of at least 14 base pairs in length. Preferred perfect inverted repeat sequences include the sequences of SEQ ID NOs: 16 to 21 and variants thereof. SEQ ID NO: 16 (NCATNNTANNCGNNTANNATGN) is a 22 base consensus sequence for a mesophilic bacteriophage perfect inverted repeat. As shown in FIG. 3, base pairs of the perfect inverted repeat are conserved at certain positions between different bacteriophages, while flexibility in sequence is possible at other positions. Thus, SEQ ID NO: 16 is a minimum consensus sequence for a perfect inverted repeat sequence for use with a bacteriophage protelomerase in the process of the present invention.

[0074] Within the consensus defined by SEQ ID NO: 16, SEQ ID NO: 17 (CCATTATACGCGCGTATAATGG) is a particularly preferred perfect inverted repeat sequence for use with E. coli phage N15 (SEQ ID NO: 15), and Klebsiella phage Phi KO2 (SEQ ID NO: 11) protelomerases. Also within the consensus defined by SEQ ID NO: 16, SEQ ID NOs: 18 to 20:

TABLE-US-00001 SEQ ID NO: 18 (GCATACTACGCGCGTAGTATGC), SEQ ID NO: 19 (CCATACTATACGTATAGTATGG), SEQ ID NO: 20 (GCATACTATACGTATAGTATGC),

are particularly preferred perfect inverted repeat sequences for use respectively with protelomerases from Yersinia phage PY54 (SEQ ID NO: 9), Halomonas phage phiHAP-1 (SEQ ID NO: 7), and Vibrio phage VP882 (SEQ ID NO: 13). SEQ ID NO: 21 (ATTATATATATAAT) is a particularly preferred perfect inverted repeat sequence for use with a Borrelia burgdorferi protelomerase. This perfect inverted repeat sequence is from a linear covalently closed plasmid, 1pB31.16 comprised in Borrelia burgdorferi. This 14 base sequence is shorter than the 22bp consensus perfect inverted repeat for bacteriophages (SEQ ID NO: 16), indicating that bacterial protelomerases may differ in specific target sequence requirements to bacteriophage protelomerases. However, all protelomerase target sequences share the common structural motif of a perfect inverted repeat.

[0075] The perfect inverted repeat sequence may be greater than 22bp in length depending on the requirements of the specific protelomerase used in the process of the invention. Thus, in some embodiments, the perfect inverted repeat may be at least 30, at least 40, at least 60, at least 80 or at least 100 base pairs in length. Examples of such perfect inverted repeat sequences include SEQ ID NOs: 22 to 24 and variants thereof.

TABLE-US-00002 SEQ ID NO: 22 (GGCATACTATACGTATAGTATGCC) SEQ ID NO: 23 (ACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGT) SEQ ID NO: 24 (CCTATATTGGGCCACCTATGTATGCACAGTTCGCCCATACTATACGT ATAGTATGGGCGAACTGTGCATACATAGGTGGCCCAATATAGG)

[0076] SEQ ID NOs: 22 to 24 and variants thereof are particularly preferred for use respectively with protelomerases from Vibrio phage VP882 (SEQ ID NO: 13), Yersinia phage PY54 (SEQ ID NO: 9) and Halomonas phage phi HAP-1 (SEQ ID NO: 7).

[0077] The perfect inverted repeat may be flanked by additional inverted repeat sequences. The flanking inverted repeats may be perfect or imperfect repeats i.e may be completely symmetrical or partially symmetrical. The flanking inverted repeats may be contiguous with or non-contiguous with the central palindrome. The protelomerase target sequence may comprise an imperfect inverted repeat sequence which comprises a perfect inverted repeat sequence of at least 14 base pairs in length. An example is SEQ ID NO: 29. The imperfect inverted repeat sequence may comprise a perfect inverted repeat sequence of at least 22 base pairs in length. An example is SEQ ID NO: 25.

[0078] Particularly preferred protelomerase target sequences comprise the sequences of SEQ ID NOs: 25 to 29 or variants thereof.

TABLE-US-00003 SEQ ID NO: 25: (TATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTG TGTGCTGATA) SEQ ID NO: 26 (ATGCGCGCATCCATTATACGCGCGTATAATGGCGATAATACA) SEQ ID NO: 27 (TAGTCACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGG TTACTG) SEQ ID NO: 28: (GGGATCCCGTTCCATACATACATGTATCCATGTGGCATACTATACG TATAGTATGCCGATGTTACATATGGTATCATTCGGGATCCCGTT) SEQ ID NO: 29 (TACTAAATAAATATTATATATATAATTTTTTATTAGTA)

[0079] The sequences of SEQ ID NOs: 25 to 29 comprise perfect inverted repeat sequences as described above, and additionally comprise flanking sequences from the relevant organisms. A protelomerase target sequence comprising the sequence of SEQ ID NO: 25 or a variant thereof is preferred for use in combination with E. coli N15 TelN protelomerase of SEQ ID NO: 15 and variants thereof. A protelomerase target sequence comprising the sequence of SEQ ID NO: 26 or a variant thereof is preferred for use in combination with Klebsiella phage Phi K02 protelomerase of SEQ ID NO: 11 and variants thereof. A protelomerase target sequence comprising the sequence of SEQ ID NO: 27 or a variant thereof is preferred for use in combination with Yersinia phage PY54 protelomerase of SEQ ID NO: 9 and variants thereof. A protelomerase target sequence comprising the sequence of SEQ ID NO: 28 or a variant thereof is preferred for use in combination with Vibrio phage VP882 protelomerase of SEQ ID NO: 13 and variants thereof. A protelomerase target sequence comprising the sequence of SEQ ID NO: 29 or a variant thereof is preferred for use in combination with a Borrelia burgdorferi protelomerase.

[0080] Variants of any of the palindrome or protelomerase target sequences described above include homologues or mutants thereof. Mutants include truncations, substitutions or deletions with respect to the native sequence. A variant sequence is any sequence whose presence in the DNA template allows for its conversion into a closed linear DNA by the enzymatic activity of protelomerase. This can readily be determined by use of an appropriate assay for the formation of closed linear DNA. Any suitable assay described in the art may be used. An example of a suitable assay is described in Deneke et al, PNAS (2000) 97, 7721-7726. Preferably, the variant allows for protelomerase binding and activity that is comparable to that observed with the native sequence. Examples of preferred variants of palindrome sequences described herein include truncated palindrome sequences that preserve the perfect repeat structure, and remain capable of allowing for formation of closed linear DNA. However, variant protelomerase target sequences may be modified such that they no longer preserve a perfect palindrome, provided that they are able to act as substrates for protelomerase activity.

[0081] It should be understood that the skilled person would readily be able to identify suitable protelomerase target sequences for use in the invention on the basis of the structural principles outlined above. Candidate protelomerase target sequences can be screened for their ability to promote formation of closed linear DNA using the assays described above.

[0082] The DNA template may comprise more than one protelomerase target sequence, for example, two, three, four, five, ten or more protelomerase target sequences. Use of multiple protelomerase target sequences can allow for excision of short closed linear DNAs comprising sequences of interest from a larger DNA molecule. In particular, one or more sequences of interest in the DNA template may be flanked on either side (i.e 5' and 3') by a protelomerase target sequence. The two flanking protelomerase sequences can then mediate excision of each short sequence of interest from the amplified DNA as a closed linear DNA, subject to the action of protelomerase (as shown in FIG. 5). The DNA template may comprise one or more sequences of interest (preferably expression cassettes) flanked on either side by protelomerase target sequences. The DNA template may comprise two, three, four, five or more sequences of interest flanked by protelomerase target sequences as described above.

[0083] In a preferred embodiment, the process of the invention uses a DNA template comprising an expression cassette flanked on either side by a protelomerase target sequence. The expression cassette preferably comprises a eukaryotic promoter operably linked to a coding sequence of interest, and optionally a eukaryotic transcription termination sequence. In this embodiment, following amplification of the template DNA, and contacting with protelomerase according to the invention, the expression cassette is released from the amplified template as a closed linear DNA. Unnecessary sequences in the template DNA are concomitantly deleted as a result from the product.

[0084] Such unnecessary or extraneous sequences (also described as bacterial or vector sequences) may include bacterial origins of replication, bacterial selection markers (e.g antibiotic resistance genes), and unmethylated CpG dinucleotides. Deletion of such sequences creates a "minimal" expression cassette which does not contain extraneous genetic material. Also, bacterial sequences of the type described above can be problematic in some therapeutic approaches. For example, within a mammalian cell, bacterial/plasmid DNA can cause the cloned gene to switch off such that sustained expression of the protein of interest cannot be achieved. Also, antibiotic resistance genes used in bacterial propagation can cause a risk to human health. Furthermore, bacterial plasmid/vector DNA may trigger an unwanted non-specific immune response. A specific characteristic of bacterial DNA sequences, the presence of unmethylated cytosine-guanine dinucleotides, typically known as CpG motifs, may also lead to undesired immune responses.

[0085] In some embodiments, particularly where the closed linear DNA product is a DNA vaccine, CpG motifs may be retained in the sequence of the product. This is because they can have a beneficial adjuvant effect on the immune response to the encoded protein.

[0086] Thus, the invention provides an in vitro process for the production of a closed linear expression cassette DNA. This process comprises a) contacting a DNA template comprising at least one expression cassette flanked on either side by a protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of said template; and b) contacting amplified DNA produced in a) with at least one protelomerase under conditions promoting formation of a closed linear expression cassette DNA. The closed linear expression cassette DNA product may comprise, consist or consist essentially of a eukaryotic promoter operably linked to a coding sequence of interest, and optionally a eukaryotic transcription termination sequence. The closed linear expression cassette DNA product may additionally lack one or more bacterial or vector sequences, typically selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers (typically antibiotic resistance genes) and (iii) unmethylated CpG motifs.

[0087] As outlined above, any DNA template comprising at least one protelomerase target sequence may be amplified according to the process of the invention. Thus, although production of DNA vaccines and other therapeutic DNA molecules is preferred, the process of the invention may be used to produce any type of closed linear DNA. The DNA template may be a double stranded (ds) or a single stranded (ss) DNA. A double stranded DNA template may be an open circular double stranded DNA, a closed circular double stranded DNA, an open linear double stranded DNA or a closed linear double stranded DNA. Preferably, the template is a closed circular double stranded DNA. Closed circular dsDNA templates are particularly preferred for use with RCA DNA polymerases. A circular dsDNA template may be in the form of a plasmid or other vector typically used to house a gene for bacterial propagation. Thus, the process of the invention may be used to amplify any commercially available plasmid or other vector, such as a commercially available DNA medicine, and then convert the amplified vector DNA into closed linear DNA.

[0088] An open circular dsDNA may be used as a template where the DNA polymerase is a strand displacement polymerase which can initiate amplification from at a nicked DNA strand. In this embodiment, the template may be previously incubated with one or more enzymes which nick a DNA strand in the template at one or more sites. A closed linear dsDNA may also be used as a template. The closed linear dsDNA template (starting material) may be identical to the closed linear DNA product. Where a closed linear DNA is used as a template, it may be incubated under denaturing conditions to form a single stranded circular DNA before or during conditions promoting amplification of the template DNA.

[0089] As outlined above, the DNA template typically comprises an expression cassette as described above, i.e comprising, consisting or consisting essentially of a eukaryotic promoter operably linked to a sequence encoding a protein of interest, and optionally a eukaryotic transcription termination sequence. Optionally the expression cassette may be a minimal expression cassette as defined above, i.e lacking one or more bacterial or vector sequences, typically selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers (typically antibiotic resistance genes) and (iii) unmethylated CpG motifs.

[0090] The DNA template may be provided in an amount sufficient for use in the process by any method known in the art. For example, the DNA template may be produced by the polymerase chain reaction (PCR). Where the DNA template is a dsDNA, it may be provided for the amplification step as denatured single strands by prior incubation at a temperature of at least 94 degrees centigrade. Thus, the process of the invention preferably comprises a step of denaturing a dsDNA template to provide single stranded DNA. Alternatively, the dsDNA template may be provided in double-stranded form. The whole or a selected portion of the DNA template may be amplified in the reaction.

[0091] The DNA template is contacted with at least one DNA polymerase under conditions promoting amplification of said template. Any DNA polymerase may be used. Any commercially available DNA polymerase is suitable for use in the process of the invention. Two, three, four, five or more different DNA polymerases may be used, for example one which provides a proof reading function and one or more others which do not. DNA polymerases having different mechanisms may be used e.g strand displacement type polymerases and DNA polymerases replicating DNA by other methods. A suitable example of a DNA polymerase that does not have strand displacement activity is T4 DNA polymerase.

[0092] It is preferred that a DNA polymerase is highly stable, such that its activity is not substantially reduced by prolonged incubation under process conditions. Therefore, the enzyme preferably has a long half-life under a range of process conditions including but not limited to temperature and pH. It is also preferred that a DNA polymerase has one or more characteristics suitable for a manufacturing process. The DNA polymerase preferably has high fidelity, for example through having proof-reading activity. Furthermore, it is preferred that a DNA polymerase displays high processivity, high strand-displacement activity and a low Km for dNTPs and DNA. A DNA polymerase may be capable of using circular and/or linear DNA as template. The DNA polymerase may be capable of using dsDNA or ssdNA as a template. It is preferred that a DNA polymerase does not display non-specific exonuclease activity.

[0093] The skilled person can determine whether or not a given DNA polymerase displays characteristics as defined above by comparison with the properties displayed by commercially available DNA polymerases, e.g phi29, DeepVent® and Bacillus stearothermophilus (Bst) DNA polymerase I, SEQ ID NOs: 2, 3 and 5 respectively. Bst DNA polymerase I is commercially available from New England Biolabs, Inc. Where a high processivity is referred to, this typically denotes the average number of nucleotides added by a DNA polymerase enzyme per association/dissociation with the template, i.e the length of primer extension obtained from a single association event.

[0094] Strand displacement-type polymerases are preferred. Preferred strand displacement-type polymerases are Phi 29 (SEQ ID NO: 2), Deep Vent® (SEQ ID NO: 3) and Bst DNA polymerase I (SEQ ID NO: 5) or variants of any thereof. Variants of SEQ ID NOs: 2, 3 and 5 may be as defined below in relation to protelomerase enzymes. The term "strand displacement" is used herein to describe the ability of a DNA polymerase to displace complementary strands on encountering a region of double stranded DNA during DNA synthesis. It should be understood that strand displacement amplication methods differ from PCR-based methods in that cycles of denaturation are not essential for efficient DNA amplification, as double-stranded DNA is not an obstacle to continued synthesis of new DNA strands. In contrast, PCR methods require cycles of denaturation (i.e elevating temperature to 94 degrees centigrade or above) during the amplification process to melt double-stranded DNA and provide new single stranded templates.

[0095] A strand displacement DNA polymerase used in the method of the invention preferably has a processivity (primer extension length) of at least 20 kb, more preferably, at least 30 kb, at least 50 kb, or at least 70 kb or greater. In particularly preferred embodiments, the strand displacement DNA polymerase has a processivity that is comparable to, or greater than phi29 DNA polymerase.

[0096] A preferred strand displacement replication process is rolling circle amplification (RCA). The term RCA describes the ability of RCA-type DNA polymerases (also referred to herein as RCA polymerases) to continuously progress around a circular DNA template strand whilst extending a hybridised primer. This leads to formation of linear single stranded products with multiple repeats of amplified DNA. These linear single stranded products serve as the basis for multiple hybridisation, primer extension and strand displacement events, resulting in formation of concatameric double stranded DNA products, again comprising multiple repeats of amplified DNA. There are thus multiple copies of each amplified "single unit" DNA in the concatameric double stranded DNA products.

[0097] RCA polymerases are particularly preferred for use in the process of the present invention. The products of RCA-type strand displacement replication processes conventionally require complex processing to release single unit DNAs. Beneficially, according to the present invention, use of protelomerase catalytic functions allows this processing to be carried out in a single step. The use of protelomerase also directly generates the desired closed linear DNA structure without need for additional processing step(s) to form molecules having this structure.

[0098] In order to allow for amplification according to the invention, it is preferred that the DNA template is also contacted with one or more primers. The primers may be non-specific (i.e random in sequence) or may be specific for one or more sequences comprised within the DNA template. It is preferred that the primers are of random sequence so as to allow for non-specific initiation at any site on the DNA template. This allows for high efficiency of amplification through multiple initiation reactions from each template strand. Examples of random primers are hexamers, heptamers, octamers, nonamers, decamers or sequences greater in length, for example of 12, 15, 18, 20 or 30 nucleotides in length. A random primer may be of 6 to 30, 8 to 30 or 12 to 30 nucleotides in length. Random primers are typically provided as a mix of oligonucleotides which are representative of all potential combinations of e.g. hexamers, heptamers, octamers or nonamers in the DNA template.

[0099] In other embodiments, the primers are specific. This means they have a sequence which is complementary to a sequence in the DNA template from which initiation of amplification is desired. In this embodiment, a pair of primers may be used to specifically amplify a portion of the DNA template which is internal to the two primer binding sites. Primers may be unlabelled, or may comprise one or more labels, for example radionuclides or fluorescent dyes. Primers may also comprise chemically modified nucleotides. Primer lengths/sequences may typically be selected based on temperature considerations i.e as being able to bind to the template at the temperature used in the amplification step.

[0100] The contacting of the DNA template with the DNA polymerase and one or more primers takes place under conditions promoting annealing of primers to the DNA template. The conditions include the presence of single-stranded DNA allowing for hybridisation of the primers. The conditions also include a temperature and buffer allowing for annealing of the primer to the template. Appropriate annealing/hybridisation conditions may be selected depending on the nature of the primer. An example of preferred annealing conditions used in the present invention include a buffer 30 mM Tris-HCl pH 7.5, 20 mM KCl, 8 mM MgCl2. The annealing may be carried out following denaturation by gradual cooling to the desired reaction temperature.

[0101] Once the DNA template is contacted with the DNA polymerase and one or more primers, there is then a step of incubation under conditions promoting amplification of said template. Preferably, the conditions promote amplification of said template by displacement of replicated strands through strand displacement replication of another strand. The conditions comprise use of any temperature allowing for amplification of DNA, commonly in the range of 20 to 90 degrees centigrade. A preferred temperature range may be about 20 to about 40 or about 25 to about 35 degrees centigrade.

[0102] Typically, an appropriate temperature is selected based on the temperature at which a specific DNA polymerase has optimal activity. This information is commonly available and forms part of the general knowledge of the skilled person. For example, where phi29 DNA polymerase is used, a suitable temperature range would be about 25 to about 35 degrees centigrade, preferably about 30 degrees centigrade. The skilled person would routinely be able to identify a suitable temperature for efficient amplification according to the process of the invention. For example, the process could be carried out at a range of temperatures, and yields of amplified DNA could be monitored to identify an optimal temperature range for a given DNA polymerase.

[0103] Other conditions promoting amplification of the DNA template comprise the presence of a DNA polymerase and one or more primers. The conditions also include the presence of all four dNTPs, ATP, TTP, CTP and GTP, suitable buffering agents/pH and other factors which are required for enzyme performance or stability. Suitable conditions include any conditions used to provide for activity of DNA polymerase enzymes known in the art.

[0104] For example, the pH may be within the range of 3 to 10, preferably 5 to 8 or about 7, such as about 7.5. pH may be maintained in this range by use of one or more buffering agents. Such buffers include, but are not restricted to MES, Bis-Tris, ADA, ACES, PIPES, MOBS, MOPS, MOPSO, Bis-Tris Propane, BES, TES, HEPES, DIPSO, TAPSO, Trizma, HEPPSO, POPSO, TEA, EPPS, Tricine, Gly-Gly, Bicine, HEPBS, TAPS, AMPD, TABS, AMPSO, CHES, CAPSO, AMP, CAPS, CABS, phosphate, citric acid-sodium hydrogen phosphate, citric acid-sodium citrate, sodium acetate-acetic acid, imidazole and sodium carbonate-sodium bicarbonate. The reaction may also comprise salts of divalent metals such as but not limited to salts of magnesium (Mg2+) and manganese (Mn2+), including chlorides, acetates and sulphates. Salts of monovalent metals may also be included, such as sodium salts and potassium salts, for example potassium chloride. Other salts that may be included are ammonium salts, in particular ammonium sulphate.

[0105] Detergents may also be included. Examples of suitable detergents include Triton X-100, Tween 20 and derivatives of either thereof. Stabilising agents may also be included in the reaction. Any suitable stabilising agent may be used, in particular, bovine serum albumin (BSA) and other stabilising proteins. Reaction conditions may also be improved by adding agents that relax DNA and make template denaturation easier. Such agents include, for example, dimethyl sulphoxide (DMSO), formamide, glycerol and betaine.

[0106] It should be understood that the skilled person is able to modify and optimise amplification and incubation conditions for the process of the invention on the basis of their general knowledge Likewise the specific concentrations of particular agents may be selected on the basis of previous examples in the art and further optimised on the basis of general knowledge. As an example, a suitable reaction buffer used in RCA-based methods in the art is 50 mM Tris HCl, pH 7.5, 10 mM MgCl2, 20 mM (NH4)2SO4, 5% glycerol, 0.2 mM BSA, 1 mM dNTPs. A preferred reaction buffer used in the RCA amplification of the invention is 35 mM Tris-HCl, 50 mM KCl, 14 mM MgCl2, 10 mM (NH4)2 SO4, 4 mM DTT, 1 mM dNTP. This buffer is particularly suitable for use with phi29 RCA polymerase.

[0107] The reaction conditions may also comprise use of one or more additional proteins. The DNA template may be amplified in the presence of at least one pyrophosphatase, such as Yeast Inorganic pyrophosphatase. Two, three, four, five or more different pyrophosphatases may be used. These enzymes are able to degrade pyrophosphate generated by the DNA polymerase from dNTPs during strand replication. Build up of pyrophosphate in the reaction can cause inhibition of DNA polymerases and reduce speed and efficiency of DNA amplification. Pyrophosphatases can break down pyrophosphate into non-inhibitory phosphate. An example of a suitable pyrophosphatase for use in the process of the present invention is Saccharomyces cerevisiae pyrophosphatase, available commercially from New England Biolabs, Inc

[0108] Any single-stranded binding protein (SSBP) may be used in the process of the invention, to stabilise single-stranded DNA. SSBPs are essential components of living cells and participate in all processes that involve ssDNA, such as DNA replication, repair and recombination. In these processes, SSBPs bind to transiently formed ssDNA and may help stabilise ssDNA structure. An example of a suitable SSBP for use in the process of the present invention is T4 gene 32 protein, available commercially from New England Biolabs, Inc.

[0109] In addition to the amplification step, the process of the invention also comprises a processing step for production of closed linear DNA. Amplified DNA is contacted with at least one protelomerase under conditions promoting production of closed linear DNA. This simple processing step based on protelomerase is advantageous over other methods used for production of closed linear DNA molecules. The amplification and processing steps can be carried out simultaneously or concurrently. However, preferably, the amplification and processing steps are carried out sequentially with the processing step being carried out subsequent to the amplification step (i.e on amplified DNA).

[0110] A protelomerase used in the invention is any polypeptide capable of cleaving and rejoining a template comprising a protelomerase target site in order to produce a covalently closed linear DNA molecule. Thus, the protelomerase has DNA cleavage and ligation functions. Enzymes having protelomerase-type activity have also been described as telomere resolvases (for example in Borrelia burgdorferi). A typical substrate for protelomerase is circular double stranded DNA. If this DNA contains a protelomerase target site, the enzyme can cut the DNA at this site and ligate the ends to create a linear double stranded covalently closed DNA molecule. The requirements for protelomerase target sites are discussed above. As also outlined above, the ability of a given polypeptide to catalyse the production of closed linear DNA from a template comprising a protelomerase target site can be determined using any suitable assay described in the art.

[0111] Protelomerase enzymes have been described in bacteriophages. In some lysogenic bacteria, bacteriophages exist as extrachromosomal DNA comprising linear double strands with covalently closed ends. The replication of this DNA and the maintenance of the covalently closed ends (or telomeric ends) are dependent on the activity of the enzyme, protelomerase. The role of protelomerase in the replication of the viral DNA is illustrated in FIG. 1. An example of this catalytic activity is provided by the enzyme, TelN from the bacteriophage, N15 that infects Escherichia coli. TelN recognises a specific nucleotide sequence in the circular double stranded DNA. This sequence is a slightly imperfect inverted palindromic structure termed telRL comprising two halves, telR and telL, flanking a 22 base pair inverted perfect repeat (telO) (see FIG. 2). Two telRL sites are formed in the circular double stranded DNA by the initial activity of specific DNA polymerase acting on the linear prophage DNA. TelN converts this circular DNA into two identical linear prophage DNA molecules completing the replication cycle. telR and telL comprise the closed ends of the linear prophage DNA enabling the DNA to be replicated further in the same way.

[0112] The process of the invention requires use of at least one protelomerase. The process of the invention may comprise use of more than one protelomerase, such as two, three, four, five or more different protelomerases. Examples of suitable protelomerases include those from bacteriophages such as phiHAP-1 from Halomonas aquamarina (SEQ ID NO: 7), PY54 from Yersinia enterolytica (SEQ ID NO: 9), phiKO2 from Klebsiella oxytoca (SEQ ID NO: 11) and VP882 from Vibrio sp. (SEQ ID NO: 13), and N15 from Escherichia coli (SEQ ID NO: 15), or variants of any thereof. Use of bacteriophage N15 protelomerase (SEQ ID NO: 15) or a variant thereof is particularly preferred.

[0113] Variants of SEQ ID NOs: 7, 9, 11, 13 and 15 include homologues or mutants thereof. Mutants include truncations, substitutions or deletions with respect to the native sequence. A variant must produce closed linear DNA from a template comprising a protelomerase target site as described above.

[0114] Any homologues mentioned herein are typically a functional homologue and are typically at least 40% homologous to the relevant region of the native protein. Homology can be measured using known methods. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, 387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0115] The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

[0116] A variant polypeptide comprises (or consists of) sequence which has at least 40% identity to the native protein. In preferred embodiments, a variant sequence may be at least 55%, 65%, 70%, 75%, 80%, 85%, 90% and more preferably at least 95%, 97% or 99% homologous to a particular region of the native protein over at least 20, preferably at least 30, for instance at least 40, 60, 100, 200, 300, 400 or more contiguous amino acids, or even over the entire sequence of the variant. Alternatively, the variant sequence may be at least 55%, 65%, 70%, 75%, 80%, 85%, 90% and more preferably at least 95%, 97% or 99% homologous to full-length native protein. Typically the variant sequence differs from the relevant region of the native protein by at least, or less than, 2, 5, 10, 20, 40, 50 or 60 mutations (each of which can be substitutions, insertions or deletions). A variant sequence of the invention may have a percentage identity with a particular region of the full-length native protein which is the same as any of the specific percentage homology values (i.e. it may have at least 40%, 55%, 80% or 90% and more preferably at least 95%, 97% or 99% identity) across any of the lengths of sequence mentioned above.

[0117] Variants of the native protein also include truncations. Any truncation may be used so long as the variant is still able to produce closed linear DNA as described above. Truncations will typically be made to remove sequences that are non-essential for catalytic activity and/or do not affect conformation of the folded protein, in particular folding of the active site. Truncations may also be selected to improve solubility of the protelomerase polypeptide. Appropriate truncations can routinely be identified by systematic truncation of sequences of varying length from the N- or C-terminus.

[0118] Variants of the native protein further include mutants which have one or more, for example, 2, 3, 4, 5 to 10, 10 to 20, 20 to 40 or more, amino acid insertions, substitutions or deletions with respect to a particular region of the native protein. Deletions and insertions are made preferably outside of the catalytic domain. Insertions are typically made at the N- or C-terminal ends of a sequence derived from the native protein, for example for the purposes of recombinant expression. Substitutions are also typically made in regions that are non-essential for catalytic activity and/or do not affect conformation of the folded protein. Such substitutions may be made to improve solubility or other characteristics of the enzyme. Although not generally preferred, substitutions may also be made in the active site or in the second sphere, i.e. residues which affect or contact the position or orientation of one or more of the amino acids in the active site. These substitutions may be made to improve catalytic properties.

[0119] Substitutions preferably introduce one or more conservative changes, which replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume. The amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace. Alternatively, the conservative change may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid. Conservative amino acid changes are well known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table A.

TABLE-US-00004 TABLE A Chemical properties of amino acids Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral Asp polar, hydrophilic, Pro hydrophobic, neutral charged (-) Glu polar, hydrophilic, Gln polar, hydrophilic, neutral charged (-) Phe aromatic, hydrophobic, Arg polar, hydrophilic, neutral charged (+) Gly aliphatic, neutral Ser polar, hydrophilic, neutral His aromatic, polar, hydrophilic, Thr polar, hydrophilic, neutral charged (+) Ile aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral Lys polar, hydrophilic, Trp aromatic, hydrophobic, charged (+) neutral Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic

[0120] It is particularly preferred that the variant is able to produce closed linear DNA as described above with an efficiency that is comparable to, or the same as the native protein.

[0121] As outlined above, it is preferred that the amplification of DNA according to the process of the invention is carried out by a strand displacement DNA polymerase, more preferably an RCA DNA polymerase. The combination of an RCA DNA polymerase and a protelomerase in an in vitro cell free process allows for surprising efficiency and simplicity in the production of closed linear DNA.

[0122] As discussed above, long linear single stranded DNA molecules are initially formed in strand displacement reactions which then serve as new templates, such that double stranded molecules are formed (FIG. 4). The double stranded molecules comprise a continuous series of tandem units of the amplified DNA formed by the processive action of strand displacement polymerases (a concatamer). These concatameric DNA products comprise multiple repeats of the amplified template DNA. A concatamer generated in the process of the invention therefore comprises multiple units of sequence amplified from the DNA template. The concatamer may comprise 10, 20, 50, 100, 200, 500 or 1000 or more units of amplified sequence, depending on the length of the single unit which is to be amplified. The concatamer may be at least 5 kb, at least 10 kb, at least 20 kb, more preferably at least 30 kb, at least 50 kb, or at least 70 kb or greater in size.

[0123] In many embodiments, for example in the production of DNA medicines, the amplified DNA will be required for use as a single unit. Therefore, such concatamers require processing to release single units of the amplified DNA. In order to convert this concatemeric DNA into single units of amplified DNA, it needs to be precisely cut and the ends of the paired strands require religation. Conventionally, this could be done by incorporation of restriction endonuclease sites into the DNA template. Thus, restriction endonucleases could be incubated with concatamers to cleave at their recognition sites and release single units. The open linear double stranded DNA formed by the action of restriction endonucleases could then be incubated with a DNA ligase enzyme to covalently close the single unit DNAs.

[0124] According to the present invention, the processing of concatameric DNA into closed linear single unit DNAs is achieved by use of a single enzyme, protelomerase. This represents an advantageous simplicity and economy in a process for generation of closed linear DNA molecules. Firstly, cleavage and religation of single units is achieved by incubation with a single enzyme. Secondly, the single units are also released having the desired closed linear structure, and so additional processing steps to generate this structure (i.e from a covalently closed circular single unit DNA) are not required.

[0125] The DNA amplified from the DNA template is incubated with at least one protelomerase under conditions promoting production of closed linear DNA. In other words, the conditions promote the cleavage and religation of a double stranded DNA comprising a protelomerase target sequence to form a covalently closed linear DNA with hairpin ends. Conditions promoting production of closed linear DNA comprise use of any temperature allowing for production of closed linear DNA, commonly in the range of 20 to 90 degrees centigrade. The temperature may preferably be in a range of 25 to 40 degrees centigrade, such as about 25 to about 35 degrees centigrade, or about 30 degrees centigrade. Appropriate temperatures for a specific protelomerase may be selected according to the principles outlined above in relation to temperature conditions for DNA polymerases. A suitable temperature for use with E. coli bacteriophage TelN protelomerase of SEQ ID NO: 15 is about 25 to about 35 degrees centigrade, such as about 30 degrees centigrade.

[0126] Conditions promoting production of closed linear DNA also comprise the presence of a protelomerase and suitable buffering agents/pH and other factors which are required for enzyme performance or stability. Suitable conditions include any conditions used to provide for activity of protelomerase enzymes known in the art. For example, where E. coli bacteriophage TelN protelomerase is used, a suitable buffer may be 20 mM TrisHCl, pH 7.6; 5 mM CaCl2; 50 mM potassium glutamate; 0.1 mM EDTA; 1 mM Dithiothreitol (DTT). Agents and conditions to maintain optimal activity and stability may also be selected from those listed for DNA polymerases.

[0127] In some embodiments, it may be possible to use the same conditions for activity of protelomerase as are used for DNA amplification. In particular, use of the same conditions is described where DNA amplification and processing by protelomerase are carried out simultaneously or concurrently. In other embodiments, it may be necessary to change reaction conditions where conditions used to provide optimal DNA polymerase activity lead to sub-optimal protelomerase activity. Removal of specific agents and change in reaction conditions may be achievable by filtration, dialysis and other methods known in the art. The skilled person would readily be able to identify conditions allowing for optimal DNA polymerase activity and/or protelomerase activity.

[0128] In a particularly preferred embodiment, for use in amplification of DNA by an RCA DNA polymerase, preferably phi29, the DNA amplification is carried out under buffer conditions substantially identical to or consisting essentially of 35 mM Tris-HCl, 50 mM KCl, 14 mM MgCl2, 10 mM (NH4)2 SO4, 4 mM DTT, 1 mM dNTP at a temperature of 25 to 35 degrees centigrade, such as about 30 degrees centigrade. The processing step with protelomerase may then preferably be carried out with TelN, and/or preferably under buffer conditions substantially identical to or consisting essentially of 20 mM TrisHCl, pH 7.6; 5 mM CaCl2; 50 mM potassium glutamate; 0.1 mM EDTA; 1 mM Dithiothreitol (DTT) at a temperature of 25 to 35 degrees centigrade, such as about 30 degrees centigrade.

[0129] All enzymes and proteins for use in the process of the invention may be produced recombinantly, for example in bacteria. Any means known to the skilled person allowing for recombinant expression may be used. A plasmid or other form of expression vector comprising a nucleic acid sequence encoding the protein of interest may be introduced into bacteria, such that they express the encoded protein. For example, for expression of SEQ ID NOs: 2, 5, 7, 9, 11, 13 or 15, the vector may comprise the sequence of SEQ ID NOs: 1, 4, 6, 8, 10, 12 or 14 respectively. The expressed protein will then typically be purified, for example by use of an affinity tag, in a sufficient quantity and provided in a form suitable for use in the process of the invention. Such methodology for recombinant protein production is routinely available to the skilled person on the basis of their general knowledge. The above discussion applies to the provision of any protein discussed herein.

[0130] Amplified DNA obtained by contacting of the DNA template with a DNA polymerase may be purified prior to contacting with a protelomerase. Thus, the process of the invention may further comprise a step of purifying DNA amplified from the DNA template. However, in a preferred embodiment, the process is carried out without purification of amplified DNA prior to contacting with protelomerase. This means the amplification and processing steps can be carried out consecutively, typically in the same container or solution. In some such embodiments, the process involves the addition of a buffer providing for protelomerase activity i.e. to provide conditions promoting formation of closed linear DNA.

[0131] Following production of closed linear DNA by the action of protelomerase, the process of the invention may further comprise a step of purifying the linear covalently closed DNA product. The purification referred to above will typically be performed to remove any undesired products. Purification may be carried out by any suitable means known in the art. For example, processing of amplified DNA or linear covalently closed DNA may comprise phenol/chloroform nucleic acid purification or the use of a column which selectively binds nucleic acid, such as those commercially available from Qiagen. The skilled person can routinely identify suitable purification techniques for use in isolation of amplified DNA.

[0132] Once linear covalently closed DNA has been generated and purified in a sufficient quantity, the process may further comprise its formulation as a DNA composition, for example a therapeutic DNA composition. A therapeutic DNA composition will comprise a therapeutic DNA molecule of the type referred to above. Such a composition will comprise a therapeutically effective amount of the DNA in a form suitable for administration by a desired route e.g. an aerosol, an injectable composition or a formulation suitable for oral, mucosal or topical administration.

[0133] Formulation of DNA as a conventional pharmaceutical preparation may be done using standard pharmaceutical formulation chemistries and methodologies, which are available to those skilled in the art. Any pharmaceutically acceptable carrier or excipient may be used. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like, may be present in the excipient or vehicle. These excipients, vehicles and auxiliary substances are generally pharmaceutical agents which may be administered without undue toxicity and which, in the case of vaccine compositions will not induce an immune response in the individual receiving the composition. A suitable carrier may be a liposome.

[0134] Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. It is also preferred, although not required, that the preparation will contain a pharmaceutically acceptable excipient that serves as a stabilizer, particularly for peptide, protein or other like molecules if they are to be included in the composition. Examples of suitable carriers that also act as stabilizers for peptides include, without limitation, pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, and the like. Other suitable carriers include, again without limitation, starch, cellulose, sodium or calcium phosphates, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycols (PEGs), and combination thereof. A thorough discussion of pharmaceutically acceptable excipients, vehicles and auxiliary substances is available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991), incorporated herein by reference.

[0135] The process of the invention is carried out in an in vitro cell-free environment. Thus, the process is carried out in the absence of a host cell and typically comprises use of purified enzymatic components. Accordingly, the amplification of a template DNA and processing by protelomerase is typically carried out by contacting the reaction components in solution in a suitable container. Optionally, particular components may be provided in immobilised form, such as attached to a solid support.

[0136] It should be understood that the process of the invention may be carried out at any scale. However, it is preferred that the process is carried out to amplify DNA at a commercial or industrial scale i.e generating amplified DNA in milligramme or greater quantities. It is preferred that the process generates at least one milligramme, at least 10 milligrammes, at least 20 milligrammes, at least 50 milligrammes or at least 100 milligrammes of amplified DNA. The final closed linear DNA product derived from the amplified DNA may also preferably be generated in milligramme or greater quantities. It is preferred that the process generates al least one milligramme, at least 2 milligrammes, at least 5 milligrammes, at least 10 milligrammes, at least 20 milligrammes, at least 50 milligrammes, or at least 100 milligrammes of closed linear DNA.

[0137] The invention further provides a kit comprising components required to carry out the process of the invention. This kit comprises at least one DNA polymerase and at least one protelomerase and optionally instructions for use in a process as described herein. The kit may comprise two, three, four, five or more different DNA polymerases. Preferably, the kit comprises at least one strand displacement-type DNA polymerase, still more preferably an RCA DNA polymerase. It is particularly preferred that the kit comprises phi29 DNA polymerase (SEQ ID NO: 2), Deep Vent® DNA polymerase (SEQ ID NO: 3) or Bst 1 DNA polymerase (SEQ ID NO: 5) or a variant of any thereof. In some embodiments, DNA polymerases that replicate DNA by other methods may also be included. The kit comprises at least one protelomerase. The kit may comprise two, three, four or more different protelomerases. The protelomerases may be selected from any of SEQ ID NOs: 5, 7, 9, 11, 13 or 15 or variants of any thereof. It is particularly preferred that the kit comprises E. coli N15 TelN (SEQ ID NO: 15) or a variant thereof.

[0138] The kit may also comprise at least one single stranded binding protein (SSBP). A preferred SSBP is T4 gene 32 protein available commercially from New England Biolabs, Inc. Two, three, four or more different SSBPs may be included in the kit. The kit may further comprise a pyrophosphatase. A preferred pyrophosphatase is S. cerevisiae pyrophosphatase, available commercially from New England Biolabs, Inc. In some embodiments, two, three, four, five or more different pyrophosphatases may be included. The kit may comprise any DNA polymerase, protelomerase, SSBP or pyrophosphatase described herein. The kit may also comprise dNTPs, suitable buffers and other factors which are required for DNA polymerase and/or protelomerase enzyme performance or stability as described above.

EXAMPLES

Example 1

Expression of TelN and Generation of Vector Constructs Comprising Protelomerase Target Sequences

[0139] TelN was PCR amplified from the commercially available cloning vector pJAZZ (Lucigen) using modified oligonucleotide primers:

TABLE-US-00005 (SEQ ID NO: 30) PT1F 5' ATGAGCAAGGTAAAAATCGGTG 3' (SEQ ID NO: 31) PT1R 5' TTAGCTGTAGTACGTTTCCCAT 3'

for directional in frame cloning into the commercially available pQE-30 vector (Qiagen). This system allows inducible expression of 6X N-terminal His tagged proteins from a lac promoter whilst providing strong repression in trans from the lacI-expressing plasmid pREP4. A number of putative recombinant clones were identified in E. coli M15, and validated by sequencing to show in frame insertion of TelN. Six clones were further characterised in small scale induction experiments. All clones expressed a protein of 74.5 kDa corresponding in molecular weight to recombinant TelN protelomerase.

[0140] TelN was expressed from E. coli M15 pREP4 by inducing protein expression from pQE-30 with IPTG, and induced cells were sonicated (6 bursts of 30 seconds at 100%) and centrifuged (30 min at 25000 g) to yield insoluble and insoluble fractions from the cell lysate. Gel analysis showed presence of TelN in the soluble fraction. Purfication of TelN was carried out on a HisTrap column using an Akta Prime system (GE Healthcare) with elution using a 0-100% (0.5M) imidazole gradient. Purified TelN was dialysed to remove imidazole and stored in a buffer of 10 mM Tris HCl pH 7.4, 75 mM NaCl, 1 mM DTT, 0.1 mM EDTA and 50% glycerol.

[0141] Vector constructs allowing for validation of TelN activity were created by directional cloning of synthetic oligonucleotides containing the TelN recognition site telRL:

TABLE-US-00006 RL1 (SEQ ID NO: 32) 5'AGCTTTATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTAT TGTGTGCTGATAG 3' RL2 (SEQ ID NO: 33) 5'GATCCTATCAGCACACAATAGTCCATTATACGCGCGTATAATGGGCAAT TGTGTGCTGATAA 3'

into the BamHI and HindIII sites of plasmids pUC18 and pBR329. pUC18 has Genbank accession number L09136, and may be obtained commercially from Fermentas Cat no. SD0051; pBR329 has Genbank Accession number J01753 and may be obtained commercially from DSMZ Cat no. 5590].

[0142] Additionally, for transfection studies, two copies of the telRL recognition site were cloned into the luciferase expression plasmid pGL4.13 (Promega) at the unique SacI and BamHI restriction sites flanking the expression cassette for the firefly luciferase gene. The first telRL site was cloned into the unique SacI site upstream from the SV40 promoter following reannealing of telRL synthetic oligonucleotides with SacI overhangs. The second telRL site was cloned downstream of the SV40 polyadenylation signal in the unique BamHI site using telRL synthetic oligonucleotides with BamHI overhangs. The resulting construct was denoted pGL DOG since it allows for the formation of a covalently closed linear (doggybone) DNA encoding luciferase to be expressed in mammalian cells.

Example 2

Validation of TelN Cleavage

[0143] Cleavage of supercoiled, circular pUC18 telRL and pGL DOG vector constructs by TelN was validated. 100 ng of each substrate was incubated with 4.5 pmol TelN for 1 hour 40 minutes at 30 degrees centigrade. The reaction was performed in TelN buffer [10 mM Tris HCl pH 7.6, 5 mM CaCl2, 50 mM potassium glutamate, 0.1 mM EDTA, 1 mM DTT].

[0144] Cleavage products were visualised by native agarose gel electrophoresis. Incubation of supercoiled, circular pUC18 telRL with TelN released a 2.7 kb linear fragment indicating cleavage. Incubation of supercoiled, circular pGL DOG with TelN released two fragments of 2.4 kb indicating cleavage at the two telRL sites.

[0145] Additionally, pUC18 telRL and pGL DOG were linearised by restriction digestion and then incubated with TelN to further validate specific cleavage at telRL. 100 ng pUC18 telRL was linearised with Xmn1 and then incubated with TelN. This released expected fragments of 1.9 kb and 0.8 kb. 100 ng pGL DOG was linearised with Pvul and then incubated with TelN. This released expected fragments of 2.4 kb, 1.6 kb and 0.7 kb. Similarly, pGL DOG linearised with Pst1 and then incubated with TelN released expected fragments of 2.4 kb, 1.1 kb and another 1.1 kb. This demonstrated the endonuclease activity of TelN on circular and linear DNA substrates comprising a protelomerase target sequence.

[0146] In a preliminary assessment of cleavage activity, it was found that an excess of TelN at 3.4 pmol cut at least 200 ng pUC18 telRL in 1 hour. In a time course experiment, the same amount of DNA was cut within around 10 minutes.

Example 3

Validation of Rejoining Activity of TelN and Formation of Closed Linear DNA

[0147] Validation of the closed linear DNA structure of the products of TelN cleavage was carried out using denaturing gel electrophoresis. pGL DOG was incubated with TelN as in Example 3. A synthetic PCR product (PCR DOG) corresponding to the region contained within the doggybone, but having open DNA ends was used as a control. The PCR DOG linear fragment was amplified from pGL DOG using primers flanking the telRL sites:

TABLE-US-00007 Sac pGL (SEQ ID NO: 34) 5' GTGCAAGTGCAGGTGCCAGAAC 3'; Bam pGL (SEQ ID NO: 35) 5' GATAAAGAAGACAGTCATAAGTGCGGC 3'.

[0148] On a native agarose gel [0.8% agarose in TAE buffer (40 mM Tris-acetate, 1 mM EDTA)], the 2.4 kb cleavage product obtained by incubation of 100 ng pGL DOG with TelN migrated to a similar size as PCR DOG (2.7 kb), since both products remain double-stranded.

[0149] However, when run on a denaturing agarose gel [1% agarose in H2O run in 50 mM NaOH, 0.1 mM EDTA and neutralised post-run in 1M Tris HCl pH 7.6, 1.5M NaCl] allowing denaturation and separation of double-stranded DNA into single-stranded DNA, the TelN "doggybone" fragment migrated at a higher molecular weight [ca. 5 kb] than the open-ended PCR control or pUC18 telRL linearised with XmnI (both 2.7 kb).

[0150] This difference in migration indicated the formation of a closed linear "doggybone" structure by TelN. Denaturation of a "doggybone" structure would produce single-stranded open circles which migrate more slowly through the gel than the linear single strands released on denaturation of an open-ended linear PCR product.

[0151] Validation of the closed linear structure of products formed by TelN was also shown on analysis of thermal denaturation by Lab-On-a-Chip (LOC) capillary electrophoresis. LOC analysis represents a capillary electrophoresis platform for the rapid separation of biological molecules. The Agilent Bioanalyzer with DNA 7500 chips, (Agilent, UK) can be used for the separation and approximate sizing of DNA fragments up to 7000 bp.

[0152] This chip system does not detect single stranded DNA. Heat denaturation (95° C. for 5 mins) and rapid (<1° C./s) cooling 1° C./s of conventional double stranded DNA under low salt conditions e.g. in H2O, results in single stranded DNA that cannot be visualised on the LOC system. However, DNA ends that are covalently joined in "doggybone" DNA (resulting from cleavage by TelN) cannot be separated following denaturation and therefore reanneal to reform double stranded DNA that remains visible. Comparison of heat denatured DNA that has been rapidly cooled therefore allows discrimination between covalently closed linear (ccl) doggybone DNA and conventional open linear (ol) double stranded DNA.

[0153] DNA samples (100 ng) in H2O were denatured (95° C. for 5 mins), rapidly cooled (<1° C./s) to 4° C. in thin walled PCR tubes in a thermal cycler (Biorad I-cycler, Biorad, UK). For comparison with TelN cleavage, samples were first incubated in 1×Tel N buffer with 1 microlitre purified protelomerase enzyme at 30° C. for 10 min. Control samples were treated identically but without enzyme. Samples (1 microlitre) were analysed using an Agilent Bioanalyser with DNA 7500 chips in accordance with manufacturer's instructions.

[0154] Results are shown in FIG. 6B. These show that closed linear "doggybone" DNA obtained by incubation of pGL DOG with TelN is resistant to thermal denaturation as compared with equivalent conventional open linear DNA (PCR DOG). Equivalent resistance against heat denaturation was also obtained using RCA amplified doggybone DNA resulting from RCA amplification and TelN cleavage.

[0155] In other experiments, TelN cleavage was carried out on the open-ended PCR DOG. This resulted in the formation of the thermostable cleavage product "doggybone" DNA of 2.8 kb, and thermostable "doggybone" ends of 0.09 and 0.14 kb.

[0156] The estimated sizes of "doggybone" and PCR DOG in LOC analysis ranged from 2.8 kb to 3.0 kb and 3.1-3.5 kb respectively compared with sequence data that predicted approximate sizes of 2.4 kb and 2.7 kb. This reflects conformational based differences in migration that occur in non-denaturing LOC analysis.

Example 4

Formation of Closed Linear DNA from Concatameric DNA Formed by RCA (Rolling Circle Amplification)

[0157] An in vitro cell free process for amplifying a DNA template and converting the amplified DNA into closed linear "doggybone" DNAs was carried out. RCA using phi29 enzyme from Bacillus subtilis phage phi29 and random hexamers as primers was used under various conditions to amplify covalently closed plasmid templates with and without the telRL site. This led to the amplification of concatameric DNA via the processive strand displacement activity of phi29. Initial work was performed using a TempliPhi kit (GE Healthcare) in accordance with manufacturer's instructions. However this was later substituted by an in house process (using phi29 supplied from NEB) resulting in higher product yields with increased purity.

[0158] Denaturation of 40 pg-200 ng closed circular template and annealing of primers was carried out in 10 microlitres of Annealing / denaturation buffer, 30 mM Tris-HCl pH 7.5, 20 mM KCL, 8 mM MgCl2, 20 micromolar random hexamers. Denaturation and annealing was carried out by heating to 95° C. for 1 min, followed by cooling to room temp over 30 min.

[0159] 10 microlitres reaction buffer [35 mM Tris-HCl, 50 mM KCl, 14 mM MgCl2, 10 mM (NH4)2 SO4, 4 mM DTT, 10U phi29, 0.002U PPi (Yeast Inorganic pyrophosphatase), 1 mM dNTP] was then added to 10 microlitres of annealed DNA/primer reaction.

[0160] The 20 microlitre reactions were incubated at 30° C. for 18 hrs. A sample was run on gel to check for formation of concatamers and then the reaction mixture was digested with restriction enzyme or TelN to check products.

[0161] Concatameric DNA amplified by RCA was then incubated with TelN. Typically, the RCA amplified DNA substrate was diluted in water and 10×TelN buffer to a final volume of 20 microlitres. Results for pUC18 telRL are shown in FIG. 6A.

[0162] As can be seen from the gel in lane 1, the undigested concatameric amplified DNA forms a mesh which does not enter the gel. However, TelN was able to cleave the RCA material resulting in release of a 2.7 kb doggybone fragment (lane 6). Confirmation that the DNA amplified by RCA was the starting template used in the reaction was achieved by restriction digestion with Pvu 1 (lanes 2 and 5). pUC18 (no telRL) served as a negative control for TelN activity (lane 3).

[0163] Similarly, in other experiments, RCA generated concatamers of pGL DOG were also cleaved by TelN. Accordingly, the process of the invention was shown to be effective in amplifying closed linear DNA from a starting template. Further, it was possible to amplify closed linear DNA in a simple manner using RCA polymerase and protelomerase in sequential steps, without need for intervening purification of amplified DNA.

Example 5

Expression of Amplified Closed Linear DNA

[0164] Transfection experiments using HeLa cells were performed to investigate expression of a luciferase reporter gene from closed linear "doggybone" DNA produced in accordance with the invention. Covalently closed circular DNA and the linear PCR DOG control were used as controls.

[0165] Transfection was carried out at 60% confluence in 20 mm diameter wells in RPMI and used Transfectam® (Promega) in accordance with manufacturer's instructions. Each transfection used 400 ng of construct DNA. Transfection frequency was normalised within and between experiments by inclusion of an internal control using 40 ng of the Renilla luciferase-expressing plasmid pGL4.73 (containing the hRluc gene from Renilla reniformis) in each transfection. Firefly luciferase (luminescence from Photinus pyralis) and Renilla luciferase activity was measured sequentially using the Dual-Luciferase® Reporter (DLR®) Assay System (Promega). Relative light units were measured using a GloMax Multi Luminometer (Promega) and results were expressed as the ratio of Firefly luciferase /Renilla luciferase. All experiments were carried out in triplicate.

[0166] Constructs tested in transfection were as follows:

[0167] pGL4.13 luc control DNA

[0168] pGL4.73 hRluc

[0169] PCR DOG

[0170] PCR control (fragment from pGL4.13 across luc gene) pGL DOG (pGL4.13 containing 2 telRL sites)

[0171] "doggybone" MP (pGL DOG isolated from mini-prep DNA digested with PvuI (to remove contaminating vector DNA) followed by TelN cleavage)

[0172] "doggybone" RCA (pGL DOG amplified by RCA digested with PvuI then cleaved with TelN)

[0173] RCA pGL DOG--concatameric DNA produced in the initial RCA amplification of pGL DOG.

[0174] Results are shown in FIG. 6C. Closed linear DNA, including that amplified by RCA was shown to express luciferase at higher levels than the open linear PCR constructs. This demonstrates that closed linear DNA produced in accordance with the invention may be used to successfully express luciferase when introduced into mammalian cells.

SEQUENCES OF THE INVENTION

TABLE-US-00008

[0175] TABLE A Bacillus bacteriophage phi29 DNA polymerase nucleic acid sequence (SEQ ID NO: 1) atgaagcata tgccgagaaa gatgtatagt tgtgactttg agacaactac taaagtggaa 60 gactgtaggg tatgggcgta tggttatatg aatatagaag atcacagtga gtacaaaata 120 ggtaatagcc tggatgagtt tatggcgtgg gtgttgaagg tacaagctga tctatatttc 180 cataacctca aatttgacgg agcttttatc attaactggt tggaacgtaa tggttttaag 240 tggtcggctg acggattgcc aaacacatat aatacgatca tatctcgcat gggacaatgg 300 tacatgattg atatatgttt aggctacaaa gggaaacgta agatacatac agtgatatat 360 gacagcttaa agaaactacc gtttcctgtt aagaagatag ctaaagactt taaactaact 420 gttcttaaag gtgatattga ttaccacaaa gaaagaccag tcggctataa gataacaccc 480 gaagaatacg cctatattaa aaacgatatt cagattattg cggaacgtct gttaattcag 540 tttaagcaag gtttagaccg gatgacagca ggcagtgaca gtctaaaagg tttcaaggat 600 attataacca ctaagaaatt caaaaaggtg tttcctacat tgagtcttgg actcgataag 660 gaagtgagat acgcctatag aggtggtttt acatggttaa atgataggtt caaagaaaaa 720 gaaatcggag aaggcatggt cttcgatgtt aatagtctat atcctgcaca gatgtatagc 780 cgtctccttc catatggtga acctatagta ttcgagggta aatacgtttg ggacgaagat 840 tacccactac acatacagca tatcagatgt gagttcgaat tgaaagaggg ctatataccc 900 actatacaga taaaaagaag taggttttat aaaggtaatg agtacctaaa aagtagcggc 960 ggggagatag ccgacctctg gttgtcaaat gtagacctag aattaatgaa agaacactac 1020 gatttatata acgttgaata tatcagcggc ttaaaattta aagcaactac aggtttgttt 1080 aaagatttta tagataaatg gacgtacatc aagacgacat cagaaggagc gatcaagcaa 1140 ctagcaaaac tgatgttaaa cagtctatac ggtaaattcg ctagtaaccc tgatgttaca 1200 gggaaagtcc cttatttaaa agagaatggg gcgctaggtt tcagacttgg agaagaggaa 1260 acaaaagacc ctgtttatac acctatgggc gttttcatca ctgcatgggc tagatacacg 1320 acaattacag cggcacaggc ttgttatgat cggataatat actgtgatac tgacagcata 1380 catttaacgg gtacagagat acctgatgta ataaaagata tagttgaccc taagaaattg 1440 ggatactggg cacatgaaag tacattcaaa agagttaaat atctgagaca gaagacctat 1500 atacaagaca tctatatgaa agaagtagat ggtaagttag tagaaggtag tccagatgat 1560 tacactgata taaaatttag tgttaaatgt gcgggaatga ctgacaagat taagaaagag 1620 gttacgtttg agaatttcaa agtcggattc agtcggaaaa tgaagcctaa gcctgtgcaa 1680 gtgccgggcg gggtggttct ggttgatgac acattcacaa tcaaataa 1728 Bacillus bacteriophage phi29 DNA polymerase amino acid sequence (SEQ ID NO: 2) MKHMPRKMYS CDFETTTKVE DCRVWAYGYM NIEDHSEYKI GNSLDEFMAW VLKVQADLYF 60 HNLKFDGAFI INWLERNGFK WSADGLPNTY NTIISRMGQW YMIDICLGYK GKRKIHTVIY 120 DSLKKLPFPV KKIAKDFKLT VLKGDIDYHK ERPVGYKITP EEYAYIKNDI QIIAERLLIQ 180 FKQGLDRMTA GSDSLKGFKD IITTKKFKKV FPTLSLGLDK EVRYAYRGGF TWLNDRFKEK 240 EIGEGMVFDV NSLYPAQMYS RLLPYGEPIV FEGKYVWDED YPLHIQHIRC EFELKEGYIP 300 TIQIKRSRFY KGNEYLKSSG GEIADLWLSN VDLELMKEHY DLYNVEYISG LKFKATTGLF 360 KDFIDKWTYI KTTSEGAIKQ LAKLMLNSLY GKFASNPDVT GKVPYLKENG ALGFRLGEEE 420 TKDPVYTPMG VFITAWARYT TITAAQACYD RIIYCDTDSI HLTGTEIPDV IKDIVDPKKL 480 GYWAHESTFK RVKYLRQKTY IQDIYMKEVD GKLVEGSPDD YTDIKFSVKC AGMTDKIKKE 540 VTFENFKVGF SRKMKPKPVQ VPGGVVLVDD TFTIK 575

TABLE-US-00009 TABLE B Pyrococcus sp Deep Vent DNA polymerase amino acid sequence (SEQ ID NO: 3) MILDADYITE DGKPIIRIFK KENGEFKVEY DRNFRPYIYA LLKDDSQIDE VRKITAERHG 60 KIVRIIDAEK VRKKFLGRPI EVWRLYFEHP QDVPAIRDKI REHSAVIDIF EYDIPFAKRY 120 LIDKGLIPME GDEELKLLAF DIETLYHEGE EFAKGPIIMI SYADEEEAKV ITWKKIDLPY 180 VEVVSSEREM IKRFLKVIRE KDPDVIITYN GDSFDLPYLV KRAEKLGIKL PLGRDGSEPK 240 MQRLGDMTAV EIKGRIHFDL YHVIRRTINL PTYTLEAVYE AIFGKPKEKV YAHEIAEAWE 300 TGKGLERVAK YSMEDAKVTY ELGREFFPME AQLSRLVGQP LWDVSRSSTG NLVEWYLLRK 360 AYERNELAPN KPDEREYERR LRESYAGGYV KEPEKGLWEG LVSLDFRSLY PSIIITHNVS 420 PDTLNREGCR EYDVAPEVGH KFCKDFPGFI PSLLKRLLDE RQEIKRKMKA SKDPIEKKML 480 DYRQRAIKIL ANSYYGYYGY AKARWYCKEC AESVTAWGRE YIEFVRKELE EKFGFKVLYI 540 DTDGLYATIP GAKPEEIKKK ALEFVDYINA KLPGLLELEY EGFYVRGFFV TKKKYALIDE 600 EGKIITRGLE IVRRDWSEIA KETQAKVLEA ILKHGNVEEA VKIVKEVTEK LSKYEIPPEK 660 LVIYEQITRP LHEYKAIGPH VAVAKRLAAR GVKVRPGMVI GYIVLRGDGP ISKRAILAEE 720 FDLRKHKYDA EYYIENQVLP AVLRILEAFG YRKEDLRWQK TKQTGLTAWL NIKKK 775

TABLE-US-00010 TABLE C Bacillus stearothermophilus DNA polymerase I (polA) nucleic acid sequence(SEQ ID NO: 4) atgaagaaga agctagtact aattgatggc aacagtgtgg cataccgcgc cttttttgcc 60 ttgccacttt tgcataacga caaaggcatt catacgaatg cggtttacgg gtttacgatg 120 atgttgaaca aaattttggc ggaagaacaa ccgacccatt tacttgtagc gtttgacgcc 180 ggaaaaacga cgttccggca tgaaacgttt caagagtata aaggcggacg gcaacaaact 240 cccccggaac tgtccgagca gtttccgctg ttgcgcgagc tattaaaagc gtaccgcatt 300 cccgcttatg aacttgatca ttacgaagcg gacgatatta tcgggacgct cgctgcccgc 360 gctgagcaag aagggtttga agtgaaaatc atttccggcg accgcgattt aacccagctc 420 gcctcccgtc atgtgacggt cgatattacg aaaaaaggga ttaccgacat tgagccgtat 480 acgccagaga ccgttcgcga aaaatacggc ctgactccgg agcaaatagt ggatttaaaa 540 ggattgatgg gcgataaatc cgacaacatc ccgggcgtgc ccggcatcgg ggaaaaaacg 600 gcggtcaagc tgctgaagca atttggtacg gtggaaaatg tgctcgcatc gattgatgag 660 gtgaaagggg aaaaactgaa agaaaacttg cgccaacacc gggatttagc tctcttgagc 720 aaacagctgg cgtccatttg ccgcgacgcc ccggttgagc tgtcgttaga tgacattgtc 780 tacgaaggac aagaccgcga aaaagtcatc gcgttattta aagaactcgg gtttcagtcg 840 ttcttggaaa aaatggccgc gccggcagcc gaaggggaga aaccgcttga ggagatggag 900 tttgccatcg ttgacgtcat taccgaagag atgcttgccg acaaggcagc gcttgtcgtt 960 gaggtgatgg aagaaaacta ccacgatgcc ccgattgtcg gaatcgcact agtgaacgag 1020 catgggcgat tttttatgcg cccggagacc gcgctggctg attcgcaatt tttagcatgg 1080 cttgccgatg aaacgaagaa aaaaagcatg tttgacgcca agcgggcagt cgttgcctta 1140 aagtggaaag gaattgagct tcgcggcgtc gcctttgatt tattgctcgc tgcctatttg 1200 ctcaatccgg ctcaagatgc cggcgatatc gctgcggtgg cgaaaatgaa acaatatgaa 1260 gcggtgcggt cggatgaagc ggtctatggc aaaggcgtca agcggtcgct gccggacgaa 1320 cagacgcttg ctgagcatct cgttcgcaaa gcggcagcca tttgggcgct tgagcagccg 1380 tttatggacg atttgcggaa caacgaacaa gatcaattat taacgaagct tgagcagccg 1440 ctggcggcga ttttggctga aatggaattc actggggtga acgtggatac aaagcggctt 1500 gaacagatgg gttcggagct cgccgaacaa ctgcgtgcca tcgagcagcg catttacgag 1560 ctagccggcc aagagttcaa cattaactca ccaaaacagc tcggagtcat tttatttgaa 1620 aagctgcagc taccggtgct gaagaagacg aaaacaggct attcgacttc ggctgatgtg 1680 cttgagaagc ttgcgccgca tcatgaaatc gtcgaaaaca ttttgcatta ccgccagctt 1740 ggcaaactgc aatcaacgta tattgaagga ttgttgaaag ttgtgcgccc tgataccggc 1800 aaagtgcata cgatgttcaa ccaagcgctg acgcaaactg ggcggctcag ctcggccgag 1860 ccgaacttgc aaaacattcc gattcggctc gaagaggggc ggaaaatccg ccaagcgttc 1920 gtcccgtcag agccggactg gctcattttc gccgccgatt actcacaaat tgaattgcgc 1980 gtcctcgccc atatcgccga tgacgacaat ctaattgaag cgttccaacg cgatttggat 2040 attcacacaa aaacggcgat ggacattttc catgtgagcg aagaggaagt cacggccaac 2100 atgcgccgcc aggcaaaggc cgttaacttc ggtatcgttt acggaattag cgattacgga 2160 ttggcgcaaa acttgaacat tacgcgcaaa gaagctgccg aatttatcga acgttacttc 2220 gccagctttc cgggcgtaaa gcagtatatg gaaaacattg tgcaagaagc gaaacagaaa 2280 ggatatgtga caacgctgtt gcatcggcgc cgctatttgc ctgatattac aagccgcaat 2340 ttcaacgtcc gcagttttgc agagcggacg gccatgaaca cgccaattca aggaagcgcc 2400 gctgacatta ttaaaaaagc gatgattgat ttagcggcac ggctgaaaga agagcagctt 2460 caggctcgtc ttttgctgca agtgcatgac gagctcattt tggaagcgcc aaaagaggaa 2520 attgagcgat tatgtgagct tgttccggaa gtgatggagc aggccgttac gctccgcgtg 2580 ccgctgaaag tcgactacca ttacggccca acatggtatg atgccaaata a 2631 Bacillus stearothermophilus DNA polymerase I (polA) amino acid sequence(SEQ ID NO: 5) MKKKLVLIDG NSVAYRAFFA LPLLHNDKGI HTNAVYGFTM MLNKILAEEQ PTHLLVAFDA 60 GKTTFRHETF QEYKGGRQQT PPELSEQFPL LRELLKAYRI PAYELDHYEA DDIIGTLAAR 120 AEQEGFEVKI ISGDRDLTQL ASRHVTVDIT KKGITDIEPY TPETVREKYG LTPEQIVDLK 180 GLMGDKSDNI PGVPGIGEKT AVKLLKQFGT VENVLASIDE VKGEKLKENL RQHRDLALLS 240 KQLASICRDA PVELSLDDIV YEGQDREKVI ALFKELGFQS FLEKMAAPAA EGEKPLEEME 300 FAIVDVITEE MLADKAALVV EVMEENYHDA PIVGIALVNE HGRFFMRPET ALADSQFLAW 360 LADETKKKSM FDAKRAVVAL KWKGIELRGV AFDLLLAAYL LNPAQDAGDI AAVAKMKQYE 420 AVRSDEAVYG KGVKRSLPDE QTLAEHLVRK AAAIWALEQP FMDDLRNNEQ DQLLTKLEQP 480 LAAILAEMEF TGVNVDTKRL EQMGSELAEQ LRAIEQRIYE LAGQEFNINS PKQLGVILFE 540 KLQLPVLKKT KTGYSTSADV LEKLAPHHEI VENILHYRQL GKLQSTYIEG LLKVVRPDTG 600 KVHTMFNQAL TQTGRLSSAE PNLQNIPIRL EEGRKIRQAF VPSEPDWLIF AADYSQIELR 660 VLAHIADDDN LIEAFQRDLD IHTKTAMDIF HVSEEEVTAN MRRQAKAVNF GIVYGISDYG 720 LAQNLNITRK EAAEFIERYF ASFPGVKQYM ENIVQEAKQK GYVTTLLHRR RYLPDITSRN 780 FNVRSFAERT AMNTPIQGSA ADIIKKAMID LAARLKEEQL QARLLLQVHD ELILEAPKEE 840 IERLCELVPE VMEQAVTLRV PLKVDYHYGP TWYDAK 876

TABLE-US-00011 TABLE D Halomonas phage phiHAP-1 protelomerase nucleic acid sequence (SEQ ID NO: 6) atgagcggtg agtcacgtag aaaggtcgat ttagcggaat tgatagagtg gttgctcagc 60 gagatcaaag agatcgacgc cgatgatgag atgccacgta aagagaaaac caagcgcatg 120 gcgcggctgg cacgtagctt caaaacgcgc ctgcatgatg acaagcgccg caaggattct 180 gagcggatcg cggtcacgac ctttcgccgc tacatgacag aagcgcgcaa ggcggtgact 240 gcgcagaact ggcgccatca cagcttcgac cagcagatcg agcggctggc cagccgctac 300 ccggcttatg ccagcaagct ggaagcgctc ggcaagctga ccgatatcag cgccattcgt 360 atggcccacc gcgagctgct cgaccagatc cgcaacgatg acgacgctta tgaggacatc 420 cgggcgatga agctggacca tgaaatcatg cgccacctga cgttgagctc tgcacagaaa 480 agcacgctgg ctgaagaggc cagcgagacg ctggaagagc gcgcggtgaa cacggtcgag 540 atcaactacc actggttgat ggagacggtt tacgagctgc tgagtaaccg ggagagaatg 600 gtcgatgggg agtatcgcgg ctttttcagt tacctagcgc ttgggctggc gctggccacc 660 gggcgtcgct cgatcgaggt gctgaagacc ggacggatca cgaaggtggg cgagtatgag 720 ctggagttca gcggccaggc gaaaaagcgc ggcggcgtcg actatagcga ggcttaccac 780 atttataccc tggtgaaagc tgacctggtg atcgaagcgt gggatgagct tcgctcgctg 840 ccggaagctg ctgagctgca gggcatggac aacagcgatg tgaaccgccg cacggcgaag 900 acgctcaaca cgctcactaa gcggatcttt aacaacgatg agcgcgtttt caaggacagc 960 cgggcgatct gggcgcggct ggtgtttgag ctgcacttct cgcgcgacaa gcgctggaag 1020 aaagtcaccg aggacgtgtt ctggcgtgag atgctggggc atgaggacat ggatacacag 1080 cgcagctacc gcgcctttaa aatcgactac gacgagccgg atcaagccga ccaggaagat 1140 tacgaacacg ctagccgcct cgccgcgctg caggcgctgg acggccatga gcagcttgag 1200 agcagcgacg cccaggcgcg tgtgcatgcc tgggtgaaag cgcagatcga gcaggagcct 1260 gacgcgaaaa ttacgcagtc tctgatcagc cgggagctgg gcgtttatcg ccctgccata 1320 aaagcgtacc tggagctggc gcgagaggcg ctcgacgcgc cgaacgtcga tctggacaag 1380 gtcgcggcgg cagtgccgaa ggaaqtagcc gaggcgaagc cccggctgaa cgcccaccca 1440 caaggggatg gcaggtgggt cggggtggct tcaatcaacg gggtggaagt tgcacgggtg 1500 ggcaaccagg caggccggat cgaagcgatg aaagcggcct ataaagcggc gggtgggcgc 1560 tga 1563 Halomonas phage phiHAP-1 protelomerase amino acid sequence (SEQ ID NO: 7) MSGESRRKVD LAELIEWLLS EIKEIDADDE MPRKEKTKRM ARLARSFKTR LHDDKRRKDS 60 ERIAVTTFRR YMTEARKAVT AQNWRHHSFD QQIERLASRY PAYASKLEAL GKLTDISAIR 120 MAHRELLDQI RNDDDAYEDI RAMKLDHEIM RHLTLSSAQK STLAEEASET LEERAVNTVE 180 INYHWLMETV YELLSNRERM VDGEYRGFFS YLALGLALAT GRRSIEVLKT GRITKVGEYE 240 LEFSGQAKKR GGVDYSEAYH IYTLVKADLV IEAWDELRSL PEAAELQGMD NSDVNRRTAK 300 TLNTLTKRIF NNDERVFKDS RAIWARLVFE LHFSRDKRWK KVTEDVFWRE MLGHEDMDTQ 360 RSYRAFKIDY DEPDQADQED YEHASRLAAL QALDGHEQLE SSDAQARVHA WVKAQIEQEP 420 DAKITQSLIS RELGVYRPAI KAYLELAREA LDAPNVDLDK VAAAVPKEVA EAKPRLNAHP 480 QGDGRWVGVA SINGVEVARV GNQAGRIEAM KAAYKAAGGR 520

TABLE-US-00012 TABLE E Yersinia phage PY54 protelomerase nucleic acid sequence (SEQ ID NO: 8) atgaaaatcc attttcgcga tttagttagt ggtttagtta aagagatcga tgaaatagaa 60 aaatcagacc gggcgcaggg tgacaaaact cggcgttatc agggcgcggc cagaaagttc 120 aaaaatgccg tgtttatgga taaacggaaa tatcgcggta acggtatgaa gaatagaata 180 tcgttaacaa catttaataa atatttaagt cgagcacgtt ctcggtttga agaaaggctt 240 caccatagtt ttcctcaatc tatagcaact atctcaaata aatatcctgc attcagcgaa 300 ataataaaag atctggataa tagacccgct catgaagtta gaataaaact taaagaatta 360 ataactcatc ttgaatccgg tgttaattta ttagaaaaaa taggtagctt agggaaaata 420 aaaccatcta cagctaaaaa aatagttagc ttaaaaaaaa tgtacccatc atgggctaat 480 gatctagata ctttaattag tactgaagat gctacagaat tacaacaaaa gttagagcaa 540 gggaccgacc tacttaacgc attacattct ctaaaagtaa accatgaagt tatgtatgca 600 ttaacgatgc agccttctga cagagctgca ttaaaagcta ggcatgacgc tgcccttcac 660 tttaaaaagc gtaacatcgt acctatcgat tatcccggct atatgcaacg aatgacggac 720 atactacatc ttccagatat agcttttgaa gattcgatgg catcacttgc ccctttagca 780 tttgctctag cagctgctag cggtcgcaga caaattgaaa tactaattac tggtgagttt 840 gacgccaaaa ataaaagcat cattaaattt tctggacaag caaaaaaaag aatggccgtt 900 tcaggtggac attatgaaat atacagtcta attgactcag agctattcat tcaacggtta 960 gagtttttac gttctcatag ctcaatactt cgattacaaa atttggaaat agcacatgat 1020 gaacatcgta ctgaactatc tgttattaac ggttttgtag ccaaaccttt aaatgatgca 1080 gcaaaacagt tctttgtcga tgacagaaga gtatttaaag atacccgtgc aatttacgct 1140 cgcatagcat atgaaaaatg gtttagaaca gatcctcgct gggcgaagtg cgacgaagat 1200 gttttcttct ctgaattatt aggccatgac gacccagata ctcagctggc atataaacaa 1260 ttcaagctgg taaatttcaat ccaaaatgg acacctaata tatcagatga aaaccctcgg 1320 ttagctgcac ttcaagagctt gacaatgat atgcccggcc tagcacgtgg cgatgcggca 1380 gttcgcatac atgagtgggtt aaagagcaa ctggcgcaga accctgcggc aaaaataact 1440 gcataccaaa tcaagaaaaat ttaaattgt cgaaatgact tggccagccg atacatggca 1500 tggtgtgctg acgcgctaggg gttgttatt ggtgatgatg gacaggcaag gccagaagaa 1560 ctcccaccat cgctcgtgctt gatattaac gctgatgaca ctgacgctga agaagatgaa 1620 atagaggaag actttactgat gaggaaata gacgacaccg aattcgacgt atcagataac 1680 gccagtgatg aagataagccc gaagataaa cctcgctttg cagcaccaat tcgtagaagt 1740 gaggactctt ggctgattaaa tttgaattt gctggcaagc aatatagctg ggagggtaat 1800 gccgaaagtg ttatcgatgcg atgaaacaa gcatggactg aaaatatgga gtaa 1854 Yersinia phage PY54 protelomerase amino acid sequence (SEQ ID NO: 9) MKIHFRDLVS GLVKEIDEIE KSDRAQGDKT RRYQGAARKF KNAVFMDKRK YRGNGMKNRI 60 SLTTFNKYLS RARSRFEERL HHSFPQSIAT ISNKYPAFSE IIKDLDNRPA HEVRIKLKEL 120 ITHLESGVNL LEKIGSLGKI KPSTAKKIVS LKKMYPSWAN DLDTLISTED ATELQQKLEQ 180 GTDLLNALHS LKVNHEVMYA LTMQPSDRAA LKARHDAALH FKKRNIVPID YPGYMQRMTD 240 ILHLPDIAFE DSMASLAPLA FALAAASGRR QIEILITGEF DAKNKSIIKF SGQAKKRMAV 300 SGGHYEIYSL IDSELFIQRL EFLRSHSSIL RLQNLEIAHD EHRTELSVIN GFVAKPLNDA 360 AKQFFVDDRR VFKDTRAIYA RIAYEKWFRT DPRWAKCDED VFFSELLGHD DPDTQLAYKQ 420 FKLVNFNPKW TPNISDENPR LAALQELDND MPGLARGDAA VRIHEWVKEQ LAQNPAAKIT 480 AYQIKKNLNC RNDLASRYMA WCADALGVVI GDDGQARPEE LPPSLVLDIN ADDTDAEEDE 540 IEEDFTDEEI DDTEFDVSDN ASDEDKPEDK PRFAAPIRRS EDSWLIKFEF AGKQYSWEGN 600 AESVIDAMKQ AWTENME 617

TABLE-US-00013 TABLE F Klebsiella phage phiKO2 protelomerase nucleic acid sequence (SEQ ID NO: 10) atgcgtaagg tgaaaattgg tgagctaatc aattcgcttg tgagcgaggt cgaggcaatc 60 gatgcctctg atcgtccgca aggcgataaa acgaagaaaa ttaaagccgc agcattaaaa 120 tataagaatg cattatttaa tgacaaaaga aagtttcgcg gtaaaggttt agaaaaaaga 180 atttctgcca acacgttcaa ctcgtatatg agtcgggcaa ggaaaagatt tgatgataga 240 ttgcatcata actttgaaaa gaatgtaatt aaactatcag aaaaatatcc tttatatagt 300 gaagaattat cttcgtggct ttctatgcct gcggcatcaa ttagacagca tatgtcaaga 360 ttgcaagcca agctaaaaga gataatgcca ttggcagaag acttatccaa tataaagatt 420 ggtacaaaaa atagcgaagc aaaaataaat aaactcgcta ataaatatcc tgaatggcaa 480 ttcgctatta gtgatttaaa tagcgaagat tggaaggata aaagagatta tctttataaa 540 ctattccaac aaggttcttc gctcctggaa gacttgaata acctgaaagt aaaccatgag 600 gttctctatc atctgcagct tagttctgcc gagcgaacct ctatccagca gcgctgggcc 660 aacgtcctca gcgagaaaaa gcgcaacgtt gtcgtgattg actatccgcg ctatatgcag 720 gccatctacg atataatcaa caagcctata gtttcgttcg atttgactac tcgtcgtggt 780 atggccccgc tggcgttcgc ccttgccgcg ctatctggtc gccgaatgat tgaaatcatg 840 ctccagggtg aattttccgt cgcaggtaaa tatacagtaa cattcctggg gcaagctaaa 900 aaacgctcgg aagataaagg tatatcaagg aaaatatata ccttatgcga cgctacttta 960 tttgttagtt tggtaaatga acttcgctca tgccccgctg ctgcggattt tgatgaagta 1020 ataaaaggat atggcgaaaa tgacactcgc tcagaaaatg ggcgtattaa tgcaattctc 1080 gctacagctt ttaatccgtg ggtaaaaact ttcttaggcg atgaccgccg cgtttataaa 1140 gatagccgcg ctatttacgc ccgtattgcc tatgaaatgt tcttccgcgt tgaccctcgg 1200 tggaagaatg ttgatgagga tgtattcttc atggagattc tcggccatga cgatgaaaac 1260 acccaactgc actataagca gtttaaattg gctaacttct ccagaacatg gcgaccaaat 1320 gtcggcgagg agaatgcccg cctagcggcg ctgcaaaagc tggatagcat gatgccagat 1380 tttgccaggg gcgacgccgg ggttcgtatt catgagaccg tgaagcagct ggtggagcag 1440 gacccatcga taaaaatcac aaacagcacc ctgcgaccgt ttaacttcag taccaggctg 1500 attcctcgct acctggagtt tgccgccgat gcattgggcc agttcgtcgg tgaaaatggg 1560 caatggcaac tgaaggatga ggcgcctgca atagtcctgc ctgatgagga aattcttgag 1620 cctatggacg acgtcgatct cgatgacgaa aaccatgatg atgaaacgct ggatgacgat 1680 gagatcgaag tggacgaaag cgaaggagag gaactggagg aagcgggcga cgctgaagag 1740 gccgaggtgg ctgaacagga agagaagcac cctggcaagc caaactttaa agcgccgagg 1800 gataatggcg atggtaccta catggtggaa tttgaattcg gtggccgtca ttacgcctgg 1860 tccggtgccg ccggtaatcg ggtagaggca atgcaatctg cctggagtgc ctacttcaag 1920 tga 1923 Klebsiella phage phiKO2 protelomerase amino acid sequence (SEQ ID NO: 11) MRKVKIGELI NSLVSEVEAI DASDRPQGDK TKKIKAAALK YKNALFNDKR KFRGKGLEKR 60 ISANTFNSYM SRARKRFDDR LHHNFEKNVI KLSEKYPLYS EELSSWLSMP AASIRQHMSR 120 LQAKLKEIMP LAEDLSNIKI GTKNSEAKIN KLANKYPEWQ FAISDLNSED WKDKRDYLYK 180 LFQQGSSLLE DLNNLKVNHE VLYHLQLSSA ERTSIQQRWA NVLSEKKRNV VVIDYPRYMQ 240 AIYDIINKPI VSFDLTTRRG MAPLAFALAA LSGRRMIEIM LQGEFSVAGK YTVTFLGQAK 300 KRSEDKGISR KIYTLCDATL FVSLVNELRS CPAAADFDEV IKGYGENDTR SENGRINAIL 360 ATAFNPWVKT FLGDDRRVYK DSRAIYARIA YEMFFRVDPR WKNVDEDVFF MEILGHDDEN 420 TQLHYKQFKL ANFSRTWRPN VGEENARLAA LQKLDSMMPD FARGDAGVRI HETVKQLVEQ 480 DPSIKITNST LRPFNFSTRL IPRYLEFAAD ALGQFVGENG QWQLKDEAPA IVLPDEEILE 540 PMDDVDLDDE NHDDETLDDD EIEVDESEGE ELEEAGDAEE AEVAEQEEKH PGKPNFKAPR 600 DNGDGTYMVE FEFGGRHYAW SGAAGNRVEA MQSAWSAYFK 640

TABLE-US-00014 TABLE G Vibrio phage VP882 protelomerase nucleic acid sequence (SEQ ID NO: 12) atgagcggcg aaagtagaca aaaggtaaac ctcgaggagt taataaatga gctcgtcgag 60 gaggtgaaaa ccatcgatga caatgaggcg attactcggt ctgaaaaaac caagttgatc 120 accagggcgg cgactaaatt caagaccaag ctgcacgacg ataagcgccg gaaggatgcg 180 accagaatcg ctctgagcac ctatcgtaag tacatgacaa tggccagggc agcagttact 240 gagcagaact ggaaacacca cagtctcgag cagcagatag agcggctggc caaaaagcac 300 ccgcaatacg ctgagcagct ggtggccatc ggggccatgg ataacatcac cgagttgcgc 360 ctggcgcatc gcgacctcct gaagagcatc aaggacaacg atgaagcctt cgaggatatc 420 cgcagcatga agttagacca cgaggtaatg cgccatctga cgctacccag tgcgcaaaag 480 gcgagactgg cagaggaagc cgccgaggcg ttgaccgaga agaaaaccgc cacggtcgac 540 atcaactatc acgagctgat ggccggcgtg gtggagctgt tgaccaagaa gaccaagacg 600 gtcggcagcg acagcaccta cagcttcagc cggctggcgc ttggtattgg cctggctacc 660 ggtcgtcgtt ctatcgagat actgaagcag ggcgagttca aaaaggtgga tgagcagcgg 720 ctcgagttct ctggccaagc gaaaaagcgc ggcggtgccg actattcaga gacctatacc 780 atttacaccc tggtcgactc cgacctggta ctgatggcgc tgaagaacct gcgagagttg 840 ccagaagttc gcgcactgga tgagtacgac caactgggcg agattaagcg gaacgacgcc 900 atcaataaac gctgtgcaaa aacgctcaac caaaccgcca agcagttctt tggcagcgac 960 gagcgcgtgt tcaaagatag tcgtgccatc tgggcgcgtc tggcttatga gttgtttttt 1020 caacgtgatc cgcgctggaa aaagaaagac gaggacgttt tctggcagga gatgctgggc 1080 cacgaggaca tcgagactca gaaagcctat aagcaattca aggtcgacta cagcgaacct 1140 gagcagccgg tgcacaagcc tggcaaattt aagagcagag ctgaagccct cgcggcgctc 1200 gactcaaatg aggacattac cacccgctca tccatggcca agatccacga ctgggtgaaa 1260 gagcgtattg cggaagaccc cgaggcgaac atcacacagt cactcatcac ccgggaactg 1320 ggctcaggcc gtaaggtgat caaggactac ctcgacctgg ctgacgatgc ccttgctgtg 1380 gtgaatactc ctgtcgatga cgcagtcgtc gaggttccag ctgatgtgcc ggcagcagaa 1440 aaacagccga agaaagcgca gaagcccaga ctcgtggctc accaggttga tgatgagcac 1500 tgggaagcct gggcgctggt ggaaggcgag gaggtggcca gggtgaaaat caagggcacc 1560 cgcgttgagg caatgacagc cgcatgggag gccagccaaa aggcactcga tgactaa 1617 Vibrio phage VP882 protelomerase amino acid sequence (SEQ ID NO: 13) MSGESRQKVN LEELINELVE EVKTIDDNEA ITRSEKTKLI TRAATKFKTK LHDDKRRKDA 60 TRIALSTYRK YMTMARAAVT EQNWKHHSLE QQIERLAKKH PQYAEQLVAI GAMDNITELR 120 LAHRDLLKSI KDNDEAFEDI RSMKLDHEVM RHLTLPSAQK ARLAEEAAEA LTEKKTATVD 180 INYHELMAGV VELLTKKTKT VGSDSTYSFS RLALGIGLAT GRRSIEILKQ GEFKKVDEQR 240 LEFSGQAKKR GGADYSETYT IYTLVDSDLV LMALKNLREL PEVRALDEYD QLGEIKRNDA 300 INKRCAKTLN QTAKQFFGSD ERVFKDSRAI WARLAYELFF QRDPRWKKKD EDVFWQEMLG 360 HEDIETQKAY KQFKVDYSEP EQPVHKPGKF KSRAEALAAL DSNEDITTRS SMAKIHDWVK 420 ERIAEDPEAN ITQSLITREL GSGRKVIKDY LDLADDALAV VNTPVDDAW EVPADVPAAE 480 KQPKKAQKPR LVAHQVDDEH WEAWALVEGE EVARVKIKGT RVEAMTAAWE ASQKALDD 538

TABLE-US-00015 TABLE H Escherichia coli bacteriophage N15 telomerase (telN) and secondary immunity repressor (cA) nucleic acid sequence (SEQ ID NO: 14) catatgcact atatcatatc tcaattacgg aacatatcag cacacaattg cccattatac 60 gcgcgtataa tggactattg tgtgctgata aggagaacat aagcgcagaa caatatgtat 120 ctattccggt gttgtgttcc tttgttattc tgctattatg ttctcttata gtgtgacgaa 180 agcagcataa ttaatcgtca cttgttcttt gattgtgtta cgatatccag agacttagaa 240 acgggggaac cgggatgagc aaggtaaaaa tcggtgagtt gatcaacacg cttgtgaatg 300 aggtagaggc aattgatgcc tcagaccgcc cacaaggcga caaaacgaag agaattaaag 360 ccgcagccgc acggtataag aacgcgttat ttaatgataa aagaaagttc cgtgggaaag 420 gattgcagaa aagaataacc gcgaatactt ttaacgccta tatgagcagg gcaagaaagc 480 ggtttgatga taaattacat catagctttg ataaaaatat taataaatta tcggaaaagt 540 atcctcttta cagcgaagaa ttatcttcat ggctttctat gcctacggct aatattcgcc 600 agcacatgtc atcgttacaa tctaaattga aagaaataat gccgcttgcc gaagagttat 660 caaatgtaag aataggctct aaaggcagtg atgcaaaaat agcaagacta ataaaaaaat 720 atccagattg gagttttgct cttagtgatt taaacagtga tgattggaag gagcgccgtg 780 actatcttta taagttattc caacaaggct ctgcgttgtt agaagaacta caccagctca 840 aggtcaacca tgaggttctg taccatctgc agctaagccc tgcggagcgt acatctatac 900 agcaacgatg ggccgatgtt ctgcgcgaga agaagcgtaa tgttgtggtt attgactacc 960 caacatacat gcagtctatc tatgatattt tgaataatcc tgcgacttta tttagtttaa 1020 acactcgttc tggaatggca cctttggcct ttgctctggc tgcggtatca gggcgaagaa 1080 tgattgagat aatgtttcag ggtgaatttg ccgtttcagg aaagtatacg gttaatttct 1140 cagggcaagc taaaaaacgc tctgaagata aaagcgtaac cagaacgatt tatactttat 1200 gcgaagcaaa attattcgtt gaattattaa cagaattgcg ttcttgctct gctgcatctg 1260 atttcgatga ggttgttaaa ggatatggaa aggatgatac aaggtctgag aacggcagga 1320 taaatgctat tttagcaaaa gcatttaacc cttgggttaa atcatttttc ggcgatgacc 1380 gtcgtgttta taaagatagc cgcgctattt acgctcgcat cgcttatgag atgttcttcc 1440 gcgtcgatcc acggtggaaa aacgtcgacg aggatgtgtt cttcatggag attctcggac 1500 acgacgatga gaacacccag ctgcactata agcagttcaa gctggccaac ttctccagaa 1560 cctggcgacc tgaagttggg gatgaaaaca ccaggctggt ggctctgcag aaactggacg 1620 atgaaatgcc aggctttgcc agaggtgacg ctggcgtccg tctccatgaa accgttaagc 1680 agctggtgga gcaggaccca tcagcaaaaa taaccaacag cactctccgg gcctttaaat 1740 ttagcccgac gatgattagc cggtacctgg agtttgccgc tgatgcattg gggcagttcg 1800 ttggcgagaa cgggcagtgg cagctgaaga tagagacacc tgcaatcgtc ctgcctgatg 1860 aagaatccgt tgagaccatc gacgaaccgg atgatgagtc ccaagacgac gagctggatg 1920 aagatgaaat tgagctcgac gagggtggcg gcgatgaacc aaccgaagag gaagggccag 1980 aagaacatca gccaactgct ctaaaacccg tcttcaagcc tgcaaaaaat aacggggacg 2040 gaacgtacaa gatagagttt gaatacgatg gaaagcatta tgcctggtcc ggccccgccg 2100 atagccctat ggccgcaatg cgatccgcat gggaaacgta ctacagctaa aagaaaagcc 2160 accggtgtta atcggtggct tttttattga ggcctgtccc tacccatccc ctgcaaggga 2220 cggaaggatt aggcggaaac tgcagctgca actacggaca tcgccgtccc gactgcaggg 2280 acttccccgc gtaaagcggg gcttaaattc gggctggcca accctatttt tctgcaatcg 2340 ctggcgatgt tagtttcgtg gatagcgttt ccagcttttc aatggccagc tcaaaatgtg 2400 ctggcagcac cttctccagt tccgtatcaa tatcggtgat cggcagctct ccacaagaca 2460 tactccggcg accgccacga actacatcgc gcagcagctc ccgttcgtag acacgcatgt 2520 tgcccagagc cgtttctgca gccgttaata tccggcgcac gtcggcgatg attgccggga 2580 gatcatccac ggttattggg ttcggtgatg ggttcctgca ggcgcggcgg agagccatcc 2640 agacgccgct aacccatgcg ttacggtact gaaaactttg tgctatgtcg tttatcaggc 2700 ccgaagttct tctttctgcc gccagtccag tggttcaccg gcgttcttag gctcaggctc 2760 gacaaaagca tactcgccgt ttttccggat agctggcaga acctcgttcg tcacccactt 2820 gcggaaccgc caggctgtcg tcccctgttt caccgcgtcg cggcagcgga ggattatggt 2880 gtagagacca gattccgata ccacatttac ttccctggcc atccgatcaa gtttttgtgc 2940 ctcggttaaa ccgagggtca atttttcatc atgatccagc ttacgcaatg catcagaagg 3000 gttggctata ttcaatgcag cacagatatc cagcgccaca aaccacgggt caccaccgac 3060 aagaaccacc cgtatagggt ggctttcctg aaatgaaaag acggagagag ccttcattgc 3120 gcctccccgg atttcagctg ctcagaaagg gacagggagc agccgcgagc ttcctgcgtg 3180 agttcgcgcg cgacctgcag aagttccgca gcttcctgca aatacagcgt ggcctcataa 3240 ctggagatag tgcggtgagc agagcccaca agcgcttcaa cctgcagcag gcgttcctca 3300 atcgtctcca gcaggccctg ggcgtttaac tgaatctggt tcatgcgatc acctcgctga 3360 ccgggatacg ggctgacaga acgaggacaa aacggctggc gaactggcga cgagcttctc 3420 gctcggatga tgcaatggtg gaaaggcggt ggatatggga ttttttgtcc gtgcggacga 3480 cagctgcaaa tttgaatttg aacatggtat gcattcctat cttgtatagg gtgctaccac 3540 cagagttgag aatctctata ggggtggtag cccagacagg gttctcaaca ccggtacaag 3600 aagaaaccgg cccaaccgaa gttggcccca tctgagccac cataattcag gtatgcgcag 3660 atttaacaca caaaaaaaca cgctggcgcg tgttgtgcgc ttcttgtcat tcggggttga 3720 gaggcccggc tgcagatttt gctgcagcgg ggtaactcta ccgccaaagc agaacgcacg 3780 tcaataattt aggtggatat tttaccccgt gaccagtcac gtgcacaggt gtttttatag 3840 tttgctttac tgactgatca gaacctgatc agttattgga gtccggtaat cttattgatg 3900 accgcagcca ccttagatgt tgtctcaaac cccatacggc cacgaatgag ccactggaac 3960 ggaatagtca gcaggtacag cggaacgaac cacaaacggt tcagacgctg ccagaacgtc 4020 gcatcacgac gttccatcca ttcggtattg tcgac 4055 Escherichia coli bacteriophage N15 telomerase amino acid sequence (SEQ ID NO: 15) MSKVKIGELI NTLVNEVEAI DASDRPQGDK TKRIKAAAAR YKNALFNDKR KFRGKGLQKR 60 ITANTFNAYM SRARKRFDDK LHHSFDKNIN KLSEKYPLYS EELSSWLSMP TANIRQHMSS 120 LQSKLKEIMP LAEELSNVRI GSKGSDAKIA RLIKKYPDWS FALSDLNSDD WKERRDYLYK 180 LFQQGSALLE ELHQLKVNHE VLYHLQLSPA ERTSIQQRWA DVLREKKRNV VVIDYPTYMQ 240 SIYDILNNPA TLFSLNTRSG MAPLAFALAA VSGRRMIEIM FQGEFAVSGK YTVNFSGQAK 300 KRSEDKSVTR TIYTLCEAKL FVELLTELRS CSAASDFDEV VKGYGKDDTR SENGRINAIL 360 AKAFNPWVKS FFGDDRRVYK DSRAIYARIA YEMFFRVDPR WKNVDEDVFF MEILGHDDEN 420 TQLHYKQFKL ANFSRTWRPE VGDENTRLVA LQKLDDEMPG FARGDAGVRL HETVKQLVEQ 480 DPSAKITNST LRAFKFSPTM ISRYLEFAAD ALGQFVGENG QWQLKIETPA IVLPDEESVE 540 TIDEPDDESQ DDELDEDEIE LDEGGGDEPT EEEGPEEHQP TALKPVFKPA KNNGDGTYKI 600 EFEYDGKHYA WSGPADSPMA AMRSAWETYY S 631

Sequence CWU 1

1

4211728DNAArtificial SequenceBacillus bacteriophage phi29 DNA polymerase nucleic acid sequence 1atgaagcata tgccgagaaa gatgtatagt tgtgactttg agacaactac taaagtggaa 60gactgtaggg tatgggcgta tggttatatg aatatagaag atcacagtga gtacaaaata 120ggtaatagcc tggatgagtt tatggcgtgg gtgttgaagg tacaagctga tctatatttc 180cataacctca aatttgacgg agcttttatc attaactggt tggaacgtaa tggttttaag 240tggtcggctg acggattgcc aaacacatat aatacgatca tatctcgcat gggacaatgg 300tacatgattg atatatgttt aggctacaaa gggaaacgta agatacatac agtgatatat 360gacagcttaa agaaactacc gtttcctgtt aagaagatag ctaaagactt taaactaact 420gttcttaaag gtgatattga ttaccacaaa gaaagaccag tcggctataa gataacaccc 480gaagaatacg cctatattaa aaacgatatt cagattattg cggaacgtct gttaattcag 540tttaagcaag gtttagaccg gatgacagca ggcagtgaca gtctaaaagg tttcaaggat 600attataacca ctaagaaatt caaaaaggtg tttcctacat tgagtcttgg actcgataag 660gaagtgagat acgcctatag aggtggtttt acatggttaa atgataggtt caaagaaaaa 720gaaatcggag aaggcatggt cttcgatgtt aatagtctat atcctgcaca gatgtatagc 780cgtctccttc catatggtga acctatagta ttcgagggta aatacgtttg ggacgaagat 840tacccactac acatacagca tatcagatgt gagttcgaat tgaaagaggg ctatataccc 900actatacaga taaaaagaag taggttttat aaaggtaatg agtacctaaa aagtagcggc 960ggggagatag ccgacctctg gttgtcaaat gtagacctag aattaatgaa agaacactac 1020gatttatata acgttgaata tatcagcggc ttaaaattta aagcaactac aggtttgttt 1080aaagatttta tagataaatg gacgtacatc aagacgacat cagaaggagc gatcaagcaa 1140ctagcaaaac tgatgttaaa cagtctatac ggtaaattcg ctagtaaccc tgatgttaca 1200gggaaagtcc cttatttaaa agagaatggg gcgctaggtt tcagacttgg agaagaggaa 1260acaaaagacc ctgtttatac acctatgggc gttttcatca ctgcatgggc tagatacacg 1320acaattacag cggcacaggc ttgttatgat cggataatat actgtgatac tgacagcata 1380catttaacgg gtacagagat acctgatgta ataaaagata tagttgaccc taagaaattg 1440ggatactggg cacatgaaag tacattcaaa agagttaaat atctgagaca gaagacctat 1500atacaagaca tctatatgaa agaagtagat ggtaagttag tagaaggtag tccagatgat 1560tacactgata taaaatttag tgttaaatgt gcgggaatga ctgacaagat taagaaagag 1620gttacgtttg agaatttcaa agtcggattc agtcggaaaa tgaagcctaa gcctgtgcaa 1680gtgccgggcg gggtggttct ggttgatgac acattcacaa tcaaataa 17282575PRTArtificial SequenceBacillus bacteriophage phi29 DNA polymerase amino acid sequence 2Met Lys His Met Pro Arg Lys Met Tyr Ser Cys Asp Phe Glu Thr Thr 1 5 10 15 Thr Lys Val Glu Asp Cys Arg Val Trp Ala Tyr Gly Tyr Met Asn Ile 20 25 30 Glu Asp His Ser Glu Tyr Lys Ile Gly Asn Ser Leu Asp Glu Phe Met 35 40 45 Ala Trp Val Leu Lys Val Gln Ala Asp Leu Tyr Phe His Asn Leu Lys 50 55 60 Phe Asp Gly Ala Phe Ile Ile Asn Trp Leu Glu Arg Asn Gly Phe Lys 65 70 75 80 Trp Ser Ala Asp Gly Leu Pro Asn Thr Tyr Asn Thr Ile Ile Ser Arg 85 90 95 Met Gly Gln Trp Tyr Met Ile Asp Ile Cys Leu Gly Tyr Lys Gly Lys 100 105 110 Arg Lys Ile His Thr Val Ile Tyr Asp Ser Leu Lys Lys Leu Pro Phe 115 120 125 Pro Val Lys Lys Ile Ala Lys Asp Phe Lys Leu Thr Val Leu Lys Gly 130 135 140 Asp Ile Asp Tyr His Lys Glu Arg Pro Val Gly Tyr Lys Ile Thr Pro 145 150 155 160 Glu Glu Tyr Ala Tyr Ile Lys Asn Asp Ile Gln Ile Ile Ala Glu Arg 165 170 175 Leu Leu Ile Gln Phe Lys Gln Gly Leu Asp Arg Met Thr Ala Gly Ser 180 185 190 Asp Ser Leu Lys Gly Phe Lys Asp Ile Ile Thr Thr Lys Lys Phe Lys 195 200 205 Lys Val Phe Pro Thr Leu Ser Leu Gly Leu Asp Lys Glu Val Arg Tyr 210 215 220 Ala Tyr Arg Gly Gly Phe Thr Trp Leu Asn Asp Arg Phe Lys Glu Lys 225 230 235 240 Glu Ile Gly Glu Gly Met Val Phe Asp Val Asn Ser Leu Tyr Pro Ala 245 250 255 Gln Met Tyr Ser Arg Leu Leu Pro Tyr Gly Glu Pro Ile Val Phe Glu 260 265 270 Gly Lys Tyr Val Trp Asp Glu Asp Tyr Pro Leu His Ile Gln His Ile 275 280 285 Arg Cys Glu Phe Glu Leu Lys Glu Gly Tyr Ile Pro Thr Ile Gln Ile 290 295 300 Lys Arg Ser Arg Phe Tyr Lys Gly Asn Glu Tyr Leu Lys Ser Ser Gly 305 310 315 320 Gly Glu Ile Ala Asp Leu Trp Leu Ser Asn Val Asp Leu Glu Leu Met 325 330 335 Lys Glu His Tyr Asp Leu Tyr Asn Val Glu Tyr Ile Ser Gly Leu Lys 340 345 350 Phe Lys Ala Thr Thr Gly Leu Phe Lys Asp Phe Ile Asp Lys Trp Thr 355 360 365 Tyr Ile Lys Thr Thr Ser Glu Gly Ala Ile Lys Gln Leu Ala Lys Leu 370 375 380 Met Leu Asn Ser Leu Tyr Gly Lys Phe Ala Ser Asn Pro Asp Val Thr 385 390 395 400 Gly Lys Val Pro Tyr Leu Lys Glu Asn Gly Ala Leu Gly Phe Arg Leu 405 410 415 Gly Glu Glu Glu Thr Lys Asp Pro Val Tyr Thr Pro Met Gly Val Phe 420 425 430 Ile Thr Ala Trp Ala Arg Tyr Thr Thr Ile Thr Ala Ala Gln Ala Cys 435 440 445 Tyr Asp Arg Ile Ile Tyr Cys Asp Thr Asp Ser Ile His Leu Thr Gly 450 455 460 Thr Glu Ile Pro Asp Val Ile Lys Asp Ile Val Asp Pro Lys Lys Leu 465 470 475 480 Gly Tyr Trp Ala His Glu Ser Thr Phe Lys Arg Val Lys Tyr Leu Arg 485 490 495 Gln Lys Thr Tyr Ile Gln Asp Ile Tyr Met Lys Glu Val Asp Gly Lys 500 505 510 Leu Val Glu Gly Ser Pro Asp Asp Tyr Thr Asp Ile Lys Phe Ser Val 515 520 525 Lys Cys Ala Gly Met Thr Asp Lys Ile Lys Lys Glu Val Thr Phe Glu 530 535 540 Asn Phe Lys Val Gly Phe Ser Arg Lys Met Lys Pro Lys Pro Val Gln 545 550 555 560 Val Pro Gly Gly Val Val Leu Val Asp Asp Thr Phe Thr Ile Lys 565 570 575 3775PRTArtificial SequencePyrococcus sp Deep Vent DNA polymerase amino acid sequence 3Met Ile Leu Asp Ala Asp Tyr Ile Thr Glu Asp Gly Lys Pro Ile Ile 1 5 10 15 Arg Ile Phe Lys Lys Glu Asn Gly Glu Phe Lys Val Glu Tyr Asp Arg 20 25 30 Asn Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Lys Asp Asp Ser Gln Ile 35 40 45 Asp Glu Val Arg Lys Ile Thr Ala Glu Arg His Gly Lys Ile Val Arg 50 55 60 Ile Ile Asp Ala Glu Lys Val Arg Lys Lys Phe Leu Gly Arg Pro Ile 65 70 75 80 Glu Val Trp Arg Leu Tyr Phe Glu His Pro Gln Asp Val Pro Ala Ile 85 90 95 Arg Asp Lys Ile Arg Glu His Ser Ala Val Ile Asp Ile Phe Glu Tyr 100 105 110 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro 115 120 125 Met Glu Gly Asp Glu Glu Leu Lys Leu Leu Ala Phe Asp Ile Glu Thr 130 135 140 Leu Tyr His Glu Gly Glu Glu Phe Ala Lys Gly Pro Ile Ile Met Ile 145 150 155 160 Ser Tyr Ala Asp Glu Glu Glu Ala Lys Val Ile Thr Trp Lys Lys Ile 165 170 175 Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys 180 185 190 Arg Phe Leu Lys Val Ile Arg Glu Lys Asp Pro Asp Val Ile Ile Thr 195 200 205 Tyr Asn Gly Asp Ser Phe Asp Leu Pro Tyr Leu Val Lys Arg Ala Glu 210 215 220 Lys Leu Gly Ile Lys Leu Pro Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 Met Gln Arg Leu Gly Asp Met Thr Ala Val Glu Ile Lys Gly Arg Ile 245 250 255 His Phe Asp Leu Tyr His Val Ile Arg Arg Thr Ile Asn Leu Pro Thr 260 265 270 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu 275 280 285 Lys Val Tyr Ala His Glu Ile Ala Glu Ala Trp Glu Thr Gly Lys Gly 290 295 300 Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu 325 330 335 Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu 340 345 350 Val Glu Trp Tyr Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala 355 360 365 Pro Asn Lys Pro Asp Glu Arg Glu Tyr Glu Arg Arg Leu Arg Glu Ser 370 375 380 Tyr Ala Gly Gly Tyr Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Gly 385 390 395 400 Leu Val Ser Leu Asp Phe Arg Ser Leu Tyr Pro Ser Ile Ile Ile Thr 405 410 415 His Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Arg Glu Tyr 420 425 430 Asp Val Ala Pro Glu Val Gly His Lys Phe Cys Lys Asp Phe Pro Gly 435 440 445 Phe Ile Pro Ser Leu Leu Lys Arg Leu Leu Asp Glu Arg Gln Glu Ile 450 455 460 Lys Arg Lys Met Lys Ala Ser Lys Asp Pro Ile Glu Lys Lys Met Leu 465 470 475 480 Asp Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly 485 490 495 Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu 500 505 510 Ser Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Phe Val Arg Lys Glu 515 520 525 Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly 530 535 540 Leu Tyr Ala Thr Ile Pro Gly Ala Lys Pro Glu Glu Ile Lys Lys Lys 545 550 555 560 Ala Leu Glu Phe Val Asp Tyr Ile Asn Ala Lys Leu Pro Gly Leu Leu 565 570 575 Glu Leu Glu Tyr Glu Gly Phe Tyr Val Arg Gly Phe Phe Val Thr Lys 580 585 590 Lys Lys Tyr Ala Leu Ile Asp Glu Glu Gly Lys Ile Ile Thr Arg Gly 595 600 605 Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln 610 615 620 Ala Lys Val Leu Glu Ala Ile Leu Lys His Gly Asn Val Glu Glu Ala 625 630 635 640 Val Lys Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Ile 645 650 655 Pro Pro Glu Lys Leu Val Ile Tyr Glu Gln Ile Thr Arg Pro Leu His 660 665 670 Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Arg Leu Ala 675 680 685 Ala Arg Gly Val Lys Val Arg Pro Gly Met Val Ile Gly Tyr Ile Val 690 695 700 Leu Arg Gly Asp Gly Pro Ile Ser Lys Arg Ala Ile Leu Ala Glu Glu 705 710 715 720 Phe Asp Leu Arg Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn 725 730 735 Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Ala Phe Gly Tyr Arg 740 745 750 Lys Glu Asp Leu Arg Trp Gln Lys Thr Lys Gln Thr Gly Leu Thr Ala 755 760 765 Trp Leu Asn Ile Lys Lys Lys 770 775 42631DNAArtificial SequenceBacillus stearothermophilus DNA polymerase I (polA) nucleic acid sequence 4atgaagaaga agctagtact aattgatggc aacagtgtgg cataccgcgc cttttttgcc 60ttgccacttt tgcataacga caaaggcatt catacgaatg cggtttacgg gtttacgatg 120atgttgaaca aaattttggc ggaagaacaa ccgacccatt tacttgtagc gtttgacgcc 180ggaaaaacga cgttccggca tgaaacgttt caagagtata aaggcggacg gcaacaaact 240cccccggaac tgtccgagca gtttccgctg ttgcgcgagc tattaaaagc gtaccgcatt 300cccgcttatg aacttgatca ttacgaagcg gacgatatta tcgggacgct cgctgcccgc 360gctgagcaag aagggtttga agtgaaaatc atttccggcg accgcgattt aacccagctc 420gcctcccgtc atgtgacggt cgatattacg aaaaaaggga ttaccgacat tgagccgtat 480acgccagaga ccgttcgcga aaaatacggc ctgactccgg agcaaatagt ggatttaaaa 540ggattgatgg gcgataaatc cgacaacatc ccgggcgtgc ccggcatcgg ggaaaaaacg 600gcggtcaagc tgctgaagca atttggtacg gtggaaaatg tgctcgcatc gattgatgag 660gtgaaagggg aaaaactgaa agaaaacttg cgccaacacc gggatttagc tctcttgagc 720aaacagctgg cgtccatttg ccgcgacgcc ccggttgagc tgtcgttaga tgacattgtc 780tacgaaggac aagaccgcga aaaagtcatc gcgttattta aagaactcgg gtttcagtcg 840ttcttggaaa aaatggccgc gccggcagcc gaaggggaga aaccgcttga ggagatggag 900tttgccatcg ttgacgtcat taccgaagag atgcttgccg acaaggcagc gcttgtcgtt 960gaggtgatgg aagaaaacta ccacgatgcc ccgattgtcg gaatcgcact agtgaacgag 1020catgggcgat tttttatgcg cccggagacc gcgctggctg attcgcaatt tttagcatgg 1080cttgccgatg aaacgaagaa aaaaagcatg tttgacgcca agcgggcagt cgttgcctta 1140aagtggaaag gaattgagct tcgcggcgtc gcctttgatt tattgctcgc tgcctatttg 1200ctcaatccgg ctcaagatgc cggcgatatc gctgcggtgg cgaaaatgaa acaatatgaa 1260gcggtgcggt cggatgaagc ggtctatggc aaaggcgtca agcggtcgct gccggacgaa 1320cagacgcttg ctgagcatct cgttcgcaaa gcggcagcca tttgggcgct tgagcagccg 1380tttatggacg atttgcggaa caacgaacaa gatcaattat taacgaagct tgagcagccg 1440ctggcggcga ttttggctga aatggaattc actggggtga acgtggatac aaagcggctt 1500gaacagatgg gttcggagct cgccgaacaa ctgcgtgcca tcgagcagcg catttacgag 1560ctagccggcc aagagttcaa cattaactca ccaaaacagc tcggagtcat tttatttgaa 1620aagctgcagc taccggtgct gaagaagacg aaaacaggct attcgacttc ggctgatgtg 1680cttgagaagc ttgcgccgca tcatgaaatc gtcgaaaaca ttttgcatta ccgccagctt 1740ggcaaactgc aatcaacgta tattgaagga ttgttgaaag ttgtgcgccc tgataccggc 1800aaagtgcata cgatgttcaa ccaagcgctg acgcaaactg ggcggctcag ctcggccgag 1860ccgaacttgc aaaacattcc gattcggctc gaagaggggc ggaaaatccg ccaagcgttc 1920gtcccgtcag agccggactg gctcattttc gccgccgatt actcacaaat tgaattgcgc 1980gtcctcgccc atatcgccga tgacgacaat ctaattgaag cgttccaacg cgatttggat 2040attcacacaa aaacggcgat ggacattttc catgtgagcg aagaggaagt cacggccaac 2100atgcgccgcc aggcaaaggc cgttaacttc ggtatcgttt acggaattag cgattacgga 2160ttggcgcaaa acttgaacat tacgcgcaaa gaagctgccg aatttatcga acgttacttc 2220gccagctttc cgggcgtaaa gcagtatatg gaaaacattg tgcaagaagc gaaacagaaa 2280ggatatgtga caacgctgtt gcatcggcgc cgctatttgc ctgatattac aagccgcaat 2340ttcaacgtcc gcagttttgc agagcggacg gccatgaaca cgccaattca aggaagcgcc 2400gctgacatta ttaaaaaagc gatgattgat ttagcggcac ggctgaaaga agagcagctt 2460caggctcgtc ttttgctgca agtgcatgac gagctcattt tggaagcgcc aaaagaggaa 2520attgagcgat tatgtgagct tgttccggaa gtgatggagc aggccgttac gctccgcgtg 2580ccgctgaaag tcgactacca ttacggccca acatggtatg atgccaaata a 26315876PRTArtificial SequenceBacillus stearothermophilus DNA polymerase I (polA) amino acid sequence 5Met Lys Lys Lys Leu Val Leu Ile Asp Gly Asn Ser Val Ala Tyr Arg 1 5 10 15 Ala Phe Phe Ala Leu Pro Leu Leu His Asn Asp Lys Gly Ile His Thr 20 25 30 Asn Ala Val Tyr Gly Phe Thr Met Met Leu Asn Lys Ile Leu Ala Glu 35 40 45 Glu Gln Pro Thr His Leu Leu Val Ala Phe Asp Ala Gly Lys Thr Thr 50 55 60 Phe Arg His Glu Thr Phe Gln Glu Tyr Lys Gly Gly Arg Gln Gln Thr 65 70 75 80 Pro Pro Glu Leu Ser Glu Gln Phe Pro Leu Leu Arg Glu Leu Leu Lys 85 90 95 Ala Tyr Arg Ile Pro Ala Tyr Glu Leu Asp His Tyr Glu Ala Asp Asp 100 105 110 Ile Ile Gly Thr Leu Ala Ala Arg Ala Glu Gln Glu Gly Phe Glu Val 115 120 125 Lys Ile Ile Ser Gly Asp Arg Asp Leu Thr Gln Leu Ala Ser Arg His 130 135 140 Val Thr Val Asp Ile Thr Lys Lys Gly Ile Thr Asp Ile Glu Pro Tyr 145 150 155 160 Thr Pro Glu Thr Val Arg Glu Lys Tyr Gly Leu Thr Pro Glu Gln Ile 165 170 175 Val Asp Leu Lys Gly Leu Met Gly Asp Lys Ser Asp Asn Ile Pro Gly 180 185 190 Val Pro Gly Ile Gly Glu Lys Thr Ala Val Lys Leu Leu Lys Gln Phe 195 200 205 Gly Thr Val Glu Asn Val Leu Ala Ser Ile Asp Glu Val Lys Gly Glu 210 215

220 Lys Leu Lys Glu Asn Leu Arg Gln His Arg Asp Leu Ala Leu Leu Ser 225 230 235 240 Lys Gln Leu Ala Ser Ile Cys Arg Asp Ala Pro Val Glu Leu Ser Leu 245 250 255 Asp Asp Ile Val Tyr Glu Gly Gln Asp Arg Glu Lys Val Ile Ala Leu 260 265 270 Phe Lys Glu Leu Gly Phe Gln Ser Phe Leu Glu Lys Met Ala Ala Pro 275 280 285 Ala Ala Glu Gly Glu Lys Pro Leu Glu Glu Met Glu Phe Ala Ile Val 290 295 300 Asp Val Ile Thr Glu Glu Met Leu Ala Asp Lys Ala Ala Leu Val Val 305 310 315 320 Glu Val Met Glu Glu Asn Tyr His Asp Ala Pro Ile Val Gly Ile Ala 325 330 335 Leu Val Asn Glu His Gly Arg Phe Phe Met Arg Pro Glu Thr Ala Leu 340 345 350 Ala Asp Ser Gln Phe Leu Ala Trp Leu Ala Asp Glu Thr Lys Lys Lys 355 360 365 Ser Met Phe Asp Ala Lys Arg Ala Val Val Ala Leu Lys Trp Lys Gly 370 375 380 Ile Glu Leu Arg Gly Val Ala Phe Asp Leu Leu Leu Ala Ala Tyr Leu 385 390 395 400 Leu Asn Pro Ala Gln Asp Ala Gly Asp Ile Ala Ala Val Ala Lys Met 405 410 415 Lys Gln Tyr Glu Ala Val Arg Ser Asp Glu Ala Val Tyr Gly Lys Gly 420 425 430 Val Lys Arg Ser Leu Pro Asp Glu Gln Thr Leu Ala Glu His Leu Val 435 440 445 Arg Lys Ala Ala Ala Ile Trp Ala Leu Glu Gln Pro Phe Met Asp Asp 450 455 460 Leu Arg Asn Asn Glu Gln Asp Gln Leu Leu Thr Lys Leu Glu Gln Pro 465 470 475 480 Leu Ala Ala Ile Leu Ala Glu Met Glu Phe Thr Gly Val Asn Val Asp 485 490 495 Thr Lys Arg Leu Glu Gln Met Gly Ser Glu Leu Ala Glu Gln Leu Arg 500 505 510 Ala Ile Glu Gln Arg Ile Tyr Glu Leu Ala Gly Gln Glu Phe Asn Ile 515 520 525 Asn Ser Pro Lys Gln Leu Gly Val Ile Leu Phe Glu Lys Leu Gln Leu 530 535 540 Pro Val Leu Lys Lys Thr Lys Thr Gly Tyr Ser Thr Ser Ala Asp Val 545 550 555 560 Leu Glu Lys Leu Ala Pro His His Glu Ile Val Glu Asn Ile Leu His 565 570 575 Tyr Arg Gln Leu Gly Lys Leu Gln Ser Thr Tyr Ile Glu Gly Leu Leu 580 585 590 Lys Val Val Arg Pro Asp Thr Gly Lys Val His Thr Met Phe Asn Gln 595 600 605 Ala Leu Thr Gln Thr Gly Arg Leu Ser Ser Ala Glu Pro Asn Leu Gln 610 615 620 Asn Ile Pro Ile Arg Leu Glu Glu Gly Arg Lys Ile Arg Gln Ala Phe 625 630 635 640 Val Pro Ser Glu Pro Asp Trp Leu Ile Phe Ala Ala Asp Tyr Ser Gln 645 650 655 Ile Glu Leu Arg Val Leu Ala His Ile Ala Asp Asp Asp Asn Leu Ile 660 665 670 Glu Ala Phe Gln Arg Asp Leu Asp Ile His Thr Lys Thr Ala Met Asp 675 680 685 Ile Phe His Val Ser Glu Glu Glu Val Thr Ala Asn Met Arg Arg Gln 690 695 700 Ala Lys Ala Val Asn Phe Gly Ile Val Tyr Gly Ile Ser Asp Tyr Gly 705 710 715 720 Leu Ala Gln Asn Leu Asn Ile Thr Arg Lys Glu Ala Ala Glu Phe Ile 725 730 735 Glu Arg Tyr Phe Ala Ser Phe Pro Gly Val Lys Gln Tyr Met Glu Asn 740 745 750 Ile Val Gln Glu Ala Lys Gln Lys Gly Tyr Val Thr Thr Leu Leu His 755 760 765 Arg Arg Arg Tyr Leu Pro Asp Ile Thr Ser Arg Asn Phe Asn Val Arg 770 775 780 Ser Phe Ala Glu Arg Thr Ala Met Asn Thr Pro Ile Gln Gly Ser Ala 785 790 795 800 Ala Asp Ile Ile Lys Lys Ala Met Ile Asp Leu Ala Ala Arg Leu Lys 805 810 815 Glu Glu Gln Leu Gln Ala Arg Leu Leu Leu Gln Val His Asp Glu Leu 820 825 830 Ile Leu Glu Ala Pro Lys Glu Glu Ile Glu Arg Leu Cys Glu Leu Val 835 840 845 Pro Glu Val Met Glu Gln Ala Val Thr Leu Arg Val Pro Leu Lys Val 850 855 860 Asp Tyr His Tyr Gly Pro Thr Trp Tyr Asp Ala Lys 865 870 875 61563DNAArtificial SequenceHalomonas phage phiHAP-1 protelomerase nucleic acid sequence 6atgagcggtg agtcacgtag aaaggtcgat ttagcggaat tgatagagtg gttgctcagc 60gagatcaaag agatcgacgc cgatgatgag atgccacgta aagagaaaac caagcgcatg 120gcgcggctgg cacgtagctt caaaacgcgc ctgcatgatg acaagcgccg caaggattct 180gagcggatcg cggtcacgac ctttcgccgc tacatgacag aagcgcgcaa ggcggtgact 240gcgcagaact ggcgccatca cagcttcgac cagcagatcg agcggctggc cagccgctac 300ccggcttatg ccagcaagct ggaagcgctc ggcaagctga ccgatatcag cgccattcgt 360atggcccacc gcgagctgct cgaccagatc cgcaacgatg acgacgctta tgaggacatc 420cgggcgatga agctggacca tgaaatcatg cgccacctga cgttgagctc tgcacagaaa 480agcacgctgg ctgaagaggc cagcgagacg ctggaagagc gcgcggtgaa cacggtcgag 540atcaactacc actggttgat ggagacggtt tacgagctgc tgagtaaccg ggagagaatg 600gtcgatgggg agtatcgcgg ctttttcagt tacctagcgc ttgggctggc gctggccacc 660gggcgtcgct cgatcgaggt gctgaagacc ggacggatca cgaaggtggg cgagtatgag 720ctggagttca gcggccaggc gaaaaagcgc ggcggcgtcg actatagcga ggcttaccac 780atttataccc tggtgaaagc tgacctggtg atcgaagcgt gggatgagct tcgctcgctg 840ccggaagctg ctgagctgca gggcatggac aacagcgatg tgaaccgccg cacggcgaag 900acgctcaaca cgctcactaa gcggatcttt aacaacgatg agcgcgtttt caaggacagc 960cgggcgatct gggcgcggct ggtgtttgag ctgcacttct cgcgcgacaa gcgctggaag 1020aaagtcaccg aggacgtgtt ctggcgtgag atgctggggc atgaggacat ggatacacag 1080cgcagctacc gcgcctttaa aatcgactac gacgagccgg atcaagccga ccaggaagat 1140tacgaacacg ctagccgcct cgccgcgctg caggcgctgg acggccatga gcagcttgag 1200agcagcgacg cccaggcgcg tgtgcatgcc tgggtgaaag cgcagatcga gcaggagcct 1260gacgcgaaaa ttacgcagtc tctgatcagc cgggagctgg gcgtttatcg ccctgccata 1320aaagcgtacc tggagctggc gcgagaggcg ctcgacgcgc cgaacgtcga tctggacaag 1380gtcgcggcgg cagtgccgaa ggaagtagcc gaggcgaagc cccggctgaa cgcccaccca 1440caaggggatg gcaggtgggt cggggtggct tcaatcaacg gggtggaagt tgcacgggtg 1500ggcaaccagg caggccggat cgaagcgatg aaagcggcct ataaagcggc gggtgggcgc 1560tga 15637520PRTArtificial SequenceHalomonas phage phiHAP-1 protelomerase amino acid sequence 7Met Ser Gly Glu Ser Arg Arg Lys Val Asp Leu Ala Glu Leu Ile Glu 1 5 10 15 Trp Leu Leu Ser Glu Ile Lys Glu Ile Asp Ala Asp Asp Glu Met Pro 20 25 30 Arg Lys Glu Lys Thr Lys Arg Met Ala Arg Leu Ala Arg Ser Phe Lys 35 40 45 Thr Arg Leu His Asp Asp Lys Arg Arg Lys Asp Ser Glu Arg Ile Ala 50 55 60 Val Thr Thr Phe Arg Arg Tyr Met Thr Glu Ala Arg Lys Ala Val Thr 65 70 75 80 Ala Gln Asn Trp Arg His His Ser Phe Asp Gln Gln Ile Glu Arg Leu 85 90 95 Ala Ser Arg Tyr Pro Ala Tyr Ala Ser Lys Leu Glu Ala Leu Gly Lys 100 105 110 Leu Thr Asp Ile Ser Ala Ile Arg Met Ala His Arg Glu Leu Leu Asp 115 120 125 Gln Ile Arg Asn Asp Asp Asp Ala Tyr Glu Asp Ile Arg Ala Met Lys 130 135 140 Leu Asp His Glu Ile Met Arg His Leu Thr Leu Ser Ser Ala Gln Lys 145 150 155 160 Ser Thr Leu Ala Glu Glu Ala Ser Glu Thr Leu Glu Glu Arg Ala Val 165 170 175 Asn Thr Val Glu Ile Asn Tyr His Trp Leu Met Glu Thr Val Tyr Glu 180 185 190 Leu Leu Ser Asn Arg Glu Arg Met Val Asp Gly Glu Tyr Arg Gly Phe 195 200 205 Phe Ser Tyr Leu Ala Leu Gly Leu Ala Leu Ala Thr Gly Arg Arg Ser 210 215 220 Ile Glu Val Leu Lys Thr Gly Arg Ile Thr Lys Val Gly Glu Tyr Glu 225 230 235 240 Leu Glu Phe Ser Gly Gln Ala Lys Lys Arg Gly Gly Val Asp Tyr Ser 245 250 255 Glu Ala Tyr His Ile Tyr Thr Leu Val Lys Ala Asp Leu Val Ile Glu 260 265 270 Ala Trp Asp Glu Leu Arg Ser Leu Pro Glu Ala Ala Glu Leu Gln Gly 275 280 285 Met Asp Asn Ser Asp Val Asn Arg Arg Thr Ala Lys Thr Leu Asn Thr 290 295 300 Leu Thr Lys Arg Ile Phe Asn Asn Asp Glu Arg Val Phe Lys Asp Ser 305 310 315 320 Arg Ala Ile Trp Ala Arg Leu Val Phe Glu Leu His Phe Ser Arg Asp 325 330 335 Lys Arg Trp Lys Lys Val Thr Glu Asp Val Phe Trp Arg Glu Met Leu 340 345 350 Gly His Glu Asp Met Asp Thr Gln Arg Ser Tyr Arg Ala Phe Lys Ile 355 360 365 Asp Tyr Asp Glu Pro Asp Gln Ala Asp Gln Glu Asp Tyr Glu His Ala 370 375 380 Ser Arg Leu Ala Ala Leu Gln Ala Leu Asp Gly His Glu Gln Leu Glu 385 390 395 400 Ser Ser Asp Ala Gln Ala Arg Val His Ala Trp Val Lys Ala Gln Ile 405 410 415 Glu Gln Glu Pro Asp Ala Lys Ile Thr Gln Ser Leu Ile Ser Arg Glu 420 425 430 Leu Gly Val Tyr Arg Pro Ala Ile Lys Ala Tyr Leu Glu Leu Ala Arg 435 440 445 Glu Ala Leu Asp Ala Pro Asn Val Asp Leu Asp Lys Val Ala Ala Ala 450 455 460 Val Pro Lys Glu Val Ala Glu Ala Lys Pro Arg Leu Asn Ala His Pro 465 470 475 480 Gln Gly Asp Gly Arg Trp Val Gly Val Ala Ser Ile Asn Gly Val Glu 485 490 495 Val Ala Arg Val Gly Asn Gln Ala Gly Arg Ile Glu Ala Met Lys Ala 500 505 510 Ala Tyr Lys Ala Ala Gly Gly Arg 515 520 8 1854DNAArtificial SequenceYersinia phage PY54 protelomerase nucleic acid sequence 8atgaaaatcc attttcgcga tttagttagt ggtttagtta aagagatcga tgaaatagaa 60aaatcagacc gggcgcaggg tgacaaaact cggcgttatc agggcgcggc cagaaagttc 120aaaaatgccg tgtttatgga taaacggaaa tatcgcggta acggtatgaa gaatagaata 180tcgttaacaa catttaataa atatttaagt cgagcacgtt ctcggtttga agaaaggctt 240caccatagtt ttcctcaatc tatagcaact atctcaaata aatatcctgc attcagcgaa 300ataataaaag atctggataa tagacccgct catgaagtta gaataaaact taaagaatta 360ataactcatc ttgaatccgg tgttaattta ttagaaaaaa taggtagctt agggaaaata 420aaaccatcta cagctaaaaa aatagttagc ttaaaaaaaa tgtacccatc atgggctaat 480gatctagata ctttaattag tactgaagat gctacagaat tacaacaaaa gttagagcaa 540gggaccgacc tacttaacgc attacattct ctaaaagtaa accatgaagt tatgtatgca 600ttaacgatgc agccttctga cagagctgca ttaaaagcta ggcatgacgc tgcccttcac 660tttaaaaagc gtaacatcgt acctatcgat tatcccggct atatgcaacg aatgacggac 720atactacatc ttccagatat agcttttgaa gattcgatgg catcacttgc ccctttagca 780tttgctctag cagctgctag cggtcgcaga caaattgaaa tactaattac tggtgagttt 840gacgccaaaa ataaaagcat cattaaattt tctggacaag caaaaaaaag aatggccgtt 900tcaggtggac attatgaaat atacagtcta attgactcag agctattcat tcaacggtta 960gagtttttac gttctcatag ctcaatactt cgattacaaa atttggaaat agcacatgat 1020gaacatcgta ctgaactatc tgttattaac ggttttgtag ccaaaccttt aaatgatgca 1080gcaaaacagt tctttgtcga tgacagaaga gtatttaaag atacccgtgc aatttacgct 1140cgcatagcat atgaaaaatg gtttagaaca gatcctcgct gggcgaagtg cgacgaagat 1200gttttcttct ctgaattatt aggccatgac gacccagata ctcagctggc atataaacaa 1260ttcaagctgg taaatttcaa tccaaaatgg acacctaata tatcagatga aaaccctcgg 1320ttagctgcac ttcaagagct tgacaatgat atgcccggcc tagcacgtgg cgatgcggca 1380gttcgcatac atgagtgggt taaagagcaa ctggcgcaga accctgcggc aaaaataact 1440gcataccaaa tcaagaaaaa tttaaattgt cgaaatgact tggccagccg atacatggca 1500tggtgtgctg acgcgctagg ggttgttatt ggtgatgatg gacaggcaag gccagaagaa 1560ctcccaccat cgctcgtgct tgatattaac gctgatgaca ctgacgctga agaagatgaa 1620atagaggaag actttactga tgaggaaata gacgacaccg aattcgacgt atcagataac 1680gccagtgatg aagataagcc cgaagataaa cctcgctttg cagcaccaat tcgtagaagt 1740gaggactctt ggctgattaa atttgaattt gctggcaagc aatatagctg ggagggtaat 1800gccgaaagtg ttatcgatgc gatgaaacaa gcatggactg aaaatatgga gtaa 18549617PRTArtificial SequenceYersinia phage PY54 protelomerase amino acid sequence 9Met Lys Ile His Phe Arg Asp Leu Val Ser Gly Leu Val Lys Glu Ile 1 5 10 15 Asp Glu Ile Glu Lys Ser Asp Arg Ala Gln Gly Asp Lys Thr Arg Arg 20 25 30 Tyr Gln Gly Ala Ala Arg Lys Phe Lys Asn Ala Val Phe Met Asp Lys 35 40 45 Arg Lys Tyr Arg Gly Asn Gly Met Lys Asn Arg Ile Ser Leu Thr Thr 50 55 60 Phe Asn Lys Tyr Leu Ser Arg Ala Arg Ser Arg Phe Glu Glu Arg Leu 65 70 75 80 His His Ser Phe Pro Gln Ser Ile Ala Thr Ile Ser Asn Lys Tyr Pro 85 90 95 Ala Phe Ser Glu Ile Ile Lys Asp Leu Asp Asn Arg Pro Ala His Glu 100 105 110 Val Arg Ile Lys Leu Lys Glu Leu Ile Thr His Leu Glu Ser Gly Val 115 120 125 Asn Leu Leu Glu Lys Ile Gly Ser Leu Gly Lys Ile Lys Pro Ser Thr 130 135 140 Ala Lys Lys Ile Val Ser Leu Lys Lys Met Tyr Pro Ser Trp Ala Asn 145 150 155 160 Asp Leu Asp Thr Leu Ile Ser Thr Glu Asp Ala Thr Glu Leu Gln Gln 165 170 175 Lys Leu Glu Gln Gly Thr Asp Leu Leu Asn Ala Leu His Ser Leu Lys 180 185 190 Val Asn His Glu Val Met Tyr Ala Leu Thr Met Gln Pro Ser Asp Arg 195 200 205 Ala Ala Leu Lys Ala Arg His Asp Ala Ala Leu His Phe Lys Lys Arg 210 215 220 Asn Ile Val Pro Ile Asp Tyr Pro Gly Tyr Met Gln Arg Met Thr Asp 225 230 235 240 Ile Leu His Leu Pro Asp Ile Ala Phe Glu Asp Ser Met Ala Ser Leu 245 250 255 Ala Pro Leu Ala Phe Ala Leu Ala Ala Ala Ser Gly Arg Arg Gln Ile 260 265 270 Glu Ile Leu Ile Thr Gly Glu Phe Asp Ala Lys Asn Lys Ser Ile Ile 275 280 285 Lys Phe Ser Gly Gln Ala Lys Lys Arg Met Ala Val Ser Gly Gly His 290 295 300 Tyr Glu Ile Tyr Ser Leu Ile Asp Ser Glu Leu Phe Ile Gln Arg Leu 305 310 315 320 Glu Phe Leu Arg Ser His Ser Ser Ile Leu Arg Leu Gln Asn Leu Glu 325 330 335 Ile Ala His Asp Glu His Arg Thr Glu Leu Ser Val Ile Asn Gly Phe 340 345 350 Val Ala Lys Pro Leu Asn Asp Ala Ala Lys Gln Phe Phe Val Asp Asp 355 360 365 Arg Arg Val Phe Lys Asp Thr Arg Ala Ile Tyr Ala Arg Ile Ala Tyr 370 375 380 Glu Lys Trp Phe Arg Thr Asp Pro Arg Trp Ala Lys Cys Asp Glu Asp 385 390 395 400 Val Phe Phe Ser Glu Leu Leu Gly His Asp Asp Pro Asp Thr Gln Leu 405 410 415 Ala Tyr Lys Gln Phe Lys Leu Val Asn Phe Asn Pro Lys Trp Thr Pro 420 425 430 Asn Ile Ser Asp Glu Asn Pro Arg Leu Ala Ala Leu Gln Glu Leu Asp 435 440 445 Asn Asp Met Pro Gly Leu Ala Arg Gly Asp Ala Ala Val Arg Ile His 450 455 460 Glu Trp Val Lys Glu Gln Leu Ala Gln Asn Pro Ala Ala Lys Ile Thr 465 470 475 480 Ala Tyr Gln Ile Lys Lys Asn Leu Asn Cys Arg Asn Asp Leu Ala Ser 485 490 495 Arg Tyr Met Ala Trp Cys Ala Asp Ala Leu Gly Val Val Ile Gly Asp 500 505 510 Asp Gly Gln Ala Arg Pro Glu Glu Leu Pro Pro Ser Leu Val Leu Asp 515 520 525 Ile Asn Ala Asp Asp Thr Asp Ala Glu Glu Asp Glu Ile Glu Glu Asp 530 535 540 Phe Thr Asp Glu Glu Ile Asp Asp Thr Glu Phe

Asp Val Ser Asp Asn 545 550 555 560 Ala Ser Asp Glu Asp Lys Pro Glu Asp Lys Pro Arg Phe Ala Ala Pro 565 570 575 Ile Arg Arg Ser Glu Asp Ser Trp Leu Ile Lys Phe Glu Phe Ala Gly 580 585 590 Lys Gln Tyr Ser Trp Glu Gly Asn Ala Glu Ser Val Ile Asp Ala Met 595 600 605 Lys Gln Ala Trp Thr Glu Asn Met Glu 610 615 101923DNAArtificial SequenceKlebsiella phage phiKO2 protelomerase nucleic acid sequence 10atgcgtaagg tgaaaattgg tgagctaatc aattcgcttg tgagcgaggt cgaggcaatc 60gatgcctctg atcgtccgca aggcgataaa acgaagaaaa ttaaagccgc agcattaaaa 120tataagaatg cattatttaa tgacaaaaga aagtttcgcg gtaaaggttt agaaaaaaga 180atttctgcca acacgttcaa ctcgtatatg agtcgggcaa ggaaaagatt tgatgataga 240ttgcatcata actttgaaaa gaatgtaatt aaactatcag aaaaatatcc tttatatagt 300gaagaattat cttcgtggct ttctatgcct gcggcatcaa ttagacagca tatgtcaaga 360ttgcaagcca agctaaaaga gataatgcca ttggcagaag acttatccaa tataaagatt 420ggtacaaaaa atagcgaagc aaaaataaat aaactcgcta ataaatatcc tgaatggcaa 480ttcgctatta gtgatttaaa tagcgaagat tggaaggata aaagagatta tctttataaa 540ctattccaac aaggttcttc gctcctggaa gacttgaata acctgaaagt aaaccatgag 600gttctctatc atctgcagct tagttctgcc gagcgaacct ctatccagca gcgctgggcc 660aacgtcctca gcgagaaaaa gcgcaacgtt gtcgtgattg actatccgcg ctatatgcag 720gccatctacg atataatcaa caagcctata gtttcgttcg atttgactac tcgtcgtggt 780atggccccgc tggcgttcgc ccttgccgcg ctatctggtc gccgaatgat tgaaatcatg 840ctccagggtg aattttccgt cgcaggtaaa tatacagtaa cattcctggg gcaagctaaa 900aaacgctcgg aagataaagg tatatcaagg aaaatatata ccttatgcga cgctacttta 960tttgttagtt tggtaaatga acttcgctca tgccccgctg ctgcggattt tgatgaagta 1020ataaaaggat atggcgaaaa tgacactcgc tcagaaaatg ggcgtattaa tgcaattctc 1080gctacagctt ttaatccgtg ggtaaaaact ttcttaggcg atgaccgccg cgtttataaa 1140gatagccgcg ctatttacgc ccgtattgcc tatgaaatgt tcttccgcgt tgaccctcgg 1200tggaagaatg ttgatgagga tgtattcttc atggagattc tcggccatga cgatgaaaac 1260acccaactgc actataagca gtttaaattg gctaacttct ccagaacatg gcgaccaaat 1320gtcggcgagg agaatgcccg cctagcggcg ctgcaaaagc tggatagcat gatgccagat 1380tttgccaggg gcgacgccgg ggttcgtatt catgagaccg tgaagcagct ggtggagcag 1440gacccatcga taaaaatcac aaacagcacc ctgcgaccgt ttaacttcag taccaggctg 1500attcctcgct acctggagtt tgccgccgat gcattgggcc agttcgtcgg tgaaaatggg 1560caatggcaac tgaaggatga ggcgcctgca atagtcctgc ctgatgagga aattcttgag 1620cctatggacg acgtcgatct cgatgacgaa aaccatgatg atgaaacgct ggatgacgat 1680gagatcgaag tggacgaaag cgaaggagag gaactggagg aagcgggcga cgctgaagag 1740gccgaggtgg ctgaacagga agagaagcac cctggcaagc caaactttaa agcgccgagg 1800gataatggcg atggtaccta catggtggaa tttgaattcg gtggccgtca ttacgcctgg 1860tccggtgccg ccggtaatcg ggtagaggca atgcaatctg cctggagtgc ctacttcaag 1920tga 192311640PRTArtificial SequenceKlebsiella phage phiKO2 protelomerase amino acid sequence 11Met Arg Lys Val Lys Ile Gly Glu Leu Ile Asn Ser Leu Val Ser Glu 1 5 10 15 Val Glu Ala Ile Asp Ala Ser Asp Arg Pro Gln Gly Asp Lys Thr Lys 20 25 30 Lys Ile Lys Ala Ala Ala Leu Lys Tyr Lys Asn Ala Leu Phe Asn Asp 35 40 45 Lys Arg Lys Phe Arg Gly Lys Gly Leu Glu Lys Arg Ile Ser Ala Asn 50 55 60 Thr Phe Asn Ser Tyr Met Ser Arg Ala Arg Lys Arg Phe Asp Asp Arg 65 70 75 80 Leu His His Asn Phe Glu Lys Asn Val Ile Lys Leu Ser Glu Lys Tyr 85 90 95 Pro Leu Tyr Ser Glu Glu Leu Ser Ser Trp Leu Ser Met Pro Ala Ala 100 105 110 Ser Ile Arg Gln His Met Ser Arg Leu Gln Ala Lys Leu Lys Glu Ile 115 120 125 Met Pro Leu Ala Glu Asp Leu Ser Asn Ile Lys Ile Gly Thr Lys Asn 130 135 140 Ser Glu Ala Lys Ile Asn Lys Leu Ala Asn Lys Tyr Pro Glu Trp Gln 145 150 155 160 Phe Ala Ile Ser Asp Leu Asn Ser Glu Asp Trp Lys Asp Lys Arg Asp 165 170 175 Tyr Leu Tyr Lys Leu Phe Gln Gln Gly Ser Ser Leu Leu Glu Asp Leu 180 185 190 Asn Asn Leu Lys Val Asn His Glu Val Leu Tyr His Leu Gln Leu Ser 195 200 205 Ser Ala Glu Arg Thr Ser Ile Gln Gln Arg Trp Ala Asn Val Leu Ser 210 215 220 Glu Lys Lys Arg Asn Val Val Val Ile Asp Tyr Pro Arg Tyr Met Gln 225 230 235 240 Ala Ile Tyr Asp Ile Ile Asn Lys Pro Ile Val Ser Phe Asp Leu Thr 245 250 255 Thr Arg Arg Gly Met Ala Pro Leu Ala Phe Ala Leu Ala Ala Leu Ser 260 265 270 Gly Arg Arg Met Ile Glu Ile Met Leu Gln Gly Glu Phe Ser Val Ala 275 280 285 Gly Lys Tyr Thr Val Thr Phe Leu Gly Gln Ala Lys Lys Arg Ser Glu 290 295 300 Asp Lys Gly Ile Ser Arg Lys Ile Tyr Thr Leu Cys Asp Ala Thr Leu 305 310 315 320 Phe Val Ser Leu Val Asn Glu Leu Arg Ser Cys Pro Ala Ala Ala Asp 325 330 335 Phe Asp Glu Val Ile Lys Gly Tyr Gly Glu Asn Asp Thr Arg Ser Glu 340 345 350 Asn Gly Arg Ile Asn Ala Ile Leu Ala Thr Ala Phe Asn Pro Trp Val 355 360 365 Lys Thr Phe Leu Gly Asp Asp Arg Arg Val Tyr Lys Asp Ser Arg Ala 370 375 380 Ile Tyr Ala Arg Ile Ala Tyr Glu Met Phe Phe Arg Val Asp Pro Arg 385 390 395 400 Trp Lys Asn Val Asp Glu Asp Val Phe Phe Met Glu Ile Leu Gly His 405 410 415 Asp Asp Glu Asn Thr Gln Leu His Tyr Lys Gln Phe Lys Leu Ala Asn 420 425 430 Phe Ser Arg Thr Trp Arg Pro Asn Val Gly Glu Glu Asn Ala Arg Leu 435 440 445 Ala Ala Leu Gln Lys Leu Asp Ser Met Met Pro Asp Phe Ala Arg Gly 450 455 460 Asp Ala Gly Val Arg Ile His Glu Thr Val Lys Gln Leu Val Glu Gln 465 470 475 480 Asp Pro Ser Ile Lys Ile Thr Asn Ser Thr Leu Arg Pro Phe Asn Phe 485 490 495 Ser Thr Arg Leu Ile Pro Arg Tyr Leu Glu Phe Ala Ala Asp Ala Leu 500 505 510 Gly Gln Phe Val Gly Glu Asn Gly Gln Trp Gln Leu Lys Asp Glu Ala 515 520 525 Pro Ala Ile Val Leu Pro Asp Glu Glu Ile Leu Glu Pro Met Asp Asp 530 535 540 Val Asp Leu Asp Asp Glu Asn His Asp Asp Glu Thr Leu Asp Asp Asp 545 550 555 560 Glu Ile Glu Val Asp Glu Ser Glu Gly Glu Glu Leu Glu Glu Ala Gly 565 570 575 Asp Ala Glu Glu Ala Glu Val Ala Glu Gln Glu Glu Lys His Pro Gly 580 585 590 Lys Pro Asn Phe Lys Ala Pro Arg Asp Asn Gly Asp Gly Thr Tyr Met 595 600 605 Val Glu Phe Glu Phe Gly Gly Arg His Tyr Ala Trp Ser Gly Ala Ala 610 615 620 Gly Asn Arg Val Glu Ala Met Gln Ser Ala Trp Ser Ala Tyr Phe Lys 625 630 635 640 121617DNAArtificial SequenceVibrio phage VP882 protelomerase nucleic acid sequence 12atgagcggcg aaagtagaca aaaggtaaac ctcgaggagt taataaatga gctcgtcgag 60gaggtgaaaa ccatcgatga caatgaggcg attactcggt ctgaaaaaac caagttgatc 120accagggcgg cgactaaatt caagaccaag ctgcacgacg ataagcgccg gaaggatgcg 180accagaatcg ctctgagcac ctatcgtaag tacatgacaa tggccagggc agcagttact 240gagcagaact ggaaacacca cagtctcgag cagcagatag agcggctggc caaaaagcac 300ccgcaatacg ctgagcagct ggtggccatc ggggccatgg ataacatcac cgagttgcgc 360ctggcgcatc gcgacctcct gaagagcatc aaggacaacg atgaagcctt cgaggatatc 420cgcagcatga agttagacca cgaggtaatg cgccatctga cgctacccag tgcgcaaaag 480gcgagactgg cagaggaagc cgccgaggcg ttgaccgaga agaaaaccgc cacggtcgac 540atcaactatc acgagctgat ggccggcgtg gtggagctgt tgaccaagaa gaccaagacg 600gtcggcagcg acagcaccta cagcttcagc cggctggcgc ttggtattgg cctggctacc 660ggtcgtcgtt ctatcgagat actgaagcag ggcgagttca aaaaggtgga tgagcagcgg 720ctcgagttct ctggccaagc gaaaaagcgc ggcggtgccg actattcaga gacctatacc 780atttacaccc tggtcgactc cgacctggta ctgatggcgc tgaagaacct gcgagagttg 840ccagaagttc gcgcactgga tgagtacgac caactgggcg agattaagcg gaacgacgcc 900atcaataaac gctgtgcaaa aacgctcaac caaaccgcca agcagttctt tggcagcgac 960gagcgcgtgt tcaaagatag tcgtgccatc tgggcgcgtc tggcttatga gttgtttttt 1020caacgtgatc cgcgctggaa aaagaaagac gaggacgttt tctggcagga gatgctgggc 1080cacgaggaca tcgagactca gaaagcctat aagcaattca aggtcgacta cagcgaacct 1140gagcagccgg tgcacaagcc tggcaaattt aagagcagag ctgaagccct cgcggcgctc 1200gactcaaatg aggacattac cacccgctca tccatggcca agatccacga ctgggtgaaa 1260gagcgtattg cggaagaccc cgaggcgaac atcacacagt cactcatcac ccgggaactg 1320ggctcaggcc gtaaggtgat caaggactac ctcgacctgg ctgacgatgc ccttgctgtg 1380gtgaatactc ctgtcgatga cgcagtcgtc gaggttccag ctgatgtgcc ggcagcagaa 1440aaacagccga agaaagcgca gaagcccaga ctcgtggctc accaggttga tgatgagcac 1500tgggaagcct gggcgctggt ggaaggcgag gaggtggcca gggtgaaaat caagggcacc 1560cgcgttgagg caatgacagc cgcatgggag gccagccaaa aggcactcga tgactaa 161713538PRTArtificial SequenceVibrio phage VP882 protelomerase amino acid sequence 13Met Ser Gly Glu Ser Arg Gln Lys Val Asn Leu Glu Glu Leu Ile Asn 1 5 10 15 Glu Leu Val Glu Glu Val Lys Thr Ile Asp Asp Asn Glu Ala Ile Thr 20 25 30 Arg Ser Glu Lys Thr Lys Leu Ile Thr Arg Ala Ala Thr Lys Phe Lys 35 40 45 Thr Lys Leu His Asp Asp Lys Arg Arg Lys Asp Ala Thr Arg Ile Ala 50 55 60 Leu Ser Thr Tyr Arg Lys Tyr Met Thr Met Ala Arg Ala Ala Val Thr 65 70 75 80 Glu Gln Asn Trp Lys His His Ser Leu Glu Gln Gln Ile Glu Arg Leu 85 90 95 Ala Lys Lys His Pro Gln Tyr Ala Glu Gln Leu Val Ala Ile Gly Ala 100 105 110 Met Asp Asn Ile Thr Glu Leu Arg Leu Ala His Arg Asp Leu Leu Lys 115 120 125 Ser Ile Lys Asp Asn Asp Glu Ala Phe Glu Asp Ile Arg Ser Met Lys 130 135 140 Leu Asp His Glu Val Met Arg His Leu Thr Leu Pro Ser Ala Gln Lys 145 150 155 160 Ala Arg Leu Ala Glu Glu Ala Ala Glu Ala Leu Thr Glu Lys Lys Thr 165 170 175 Ala Thr Val Asp Ile Asn Tyr His Glu Leu Met Ala Gly Val Val Glu 180 185 190 Leu Leu Thr Lys Lys Thr Lys Thr Val Gly Ser Asp Ser Thr Tyr Ser 195 200 205 Phe Ser Arg Leu Ala Leu Gly Ile Gly Leu Ala Thr Gly Arg Arg Ser 210 215 220 Ile Glu Ile Leu Lys Gln Gly Glu Phe Lys Lys Val Asp Glu Gln Arg 225 230 235 240 Leu Glu Phe Ser Gly Gln Ala Lys Lys Arg Gly Gly Ala Asp Tyr Ser 245 250 255 Glu Thr Tyr Thr Ile Tyr Thr Leu Val Asp Ser Asp Leu Val Leu Met 260 265 270 Ala Leu Lys Asn Leu Arg Glu Leu Pro Glu Val Arg Ala Leu Asp Glu 275 280 285 Tyr Asp Gln Leu Gly Glu Ile Lys Arg Asn Asp Ala Ile Asn Lys Arg 290 295 300 Cys Ala Lys Thr Leu Asn Gln Thr Ala Lys Gln Phe Phe Gly Ser Asp 305 310 315 320 Glu Arg Val Phe Lys Asp Ser Arg Ala Ile Trp Ala Arg Leu Ala Tyr 325 330 335 Glu Leu Phe Phe Gln Arg Asp Pro Arg Trp Lys Lys Lys Asp Glu Asp 340 345 350 Val Phe Trp Gln Glu Met Leu Gly His Glu Asp Ile Glu Thr Gln Lys 355 360 365 Ala Tyr Lys Gln Phe Lys Val Asp Tyr Ser Glu Pro Glu Gln Pro Val 370 375 380 His Lys Pro Gly Lys Phe Lys Ser Arg Ala Glu Ala Leu Ala Ala Leu 385 390 395 400 Asp Ser Asn Glu Asp Ile Thr Thr Arg Ser Ser Met Ala Lys Ile His 405 410 415 Asp Trp Val Lys Glu Arg Ile Ala Glu Asp Pro Glu Ala Asn Ile Thr 420 425 430 Gln Ser Leu Ile Thr Arg Glu Leu Gly Ser Gly Arg Lys Val Ile Lys 435 440 445 Asp Tyr Leu Asp Leu Ala Asp Asp Ala Leu Ala Val Val Asn Thr Pro 450 455 460 Val Asp Asp Ala Val Val Glu Val Pro Ala Asp Val Pro Ala Ala Glu 465 470 475 480 Lys Gln Pro Lys Lys Ala Gln Lys Pro Arg Leu Val Ala His Gln Val 485 490 495 Asp Asp Glu His Trp Glu Ala Trp Ala Leu Val Glu Gly Glu Glu Val 500 505 510 Ala Arg Val Lys Ile Lys Gly Thr Arg Val Glu Ala Met Thr Ala Ala 515 520 525 Trp Glu Ala Ser Gln Lys Ala Leu Asp Asp 530 535 144055DNAArtificial SequenceEscherichia coli bacteriophage N15 telomerase (telN) and secondary immunity repressor (cA) nucleic acid sequence 14catatgcact atatcatatc tcaattacgg aacatatcag cacacaattg cccattatac 60gcgcgtataa tggactattg tgtgctgata aggagaacat aagcgcagaa caatatgtat 120ctattccggt gttgtgttcc tttgttattc tgctattatg ttctcttata gtgtgacgaa 180agcagcataa ttaatcgtca cttgttcttt gattgtgtta cgatatccag agacttagaa 240acgggggaac cgggatgagc aaggtaaaaa tcggtgagtt gatcaacacg cttgtgaatg 300aggtagaggc aattgatgcc tcagaccgcc cacaaggcga caaaacgaag agaattaaag 360ccgcagccgc acggtataag aacgcgttat ttaatgataa aagaaagttc cgtgggaaag 420gattgcagaa aagaataacc gcgaatactt ttaacgccta tatgagcagg gcaagaaagc 480ggtttgatga taaattacat catagctttg ataaaaatat taataaatta tcggaaaagt 540atcctcttta cagcgaagaa ttatcttcat ggctttctat gcctacggct aatattcgcc 600agcacatgtc atcgttacaa tctaaattga aagaaataat gccgcttgcc gaagagttat 660caaatgtaag aataggctct aaaggcagtg atgcaaaaat agcaagacta ataaaaaaat 720atccagattg gagttttgct cttagtgatt taaacagtga tgattggaag gagcgccgtg 780actatcttta taagttattc caacaaggct ctgcgttgtt agaagaacta caccagctca 840aggtcaacca tgaggttctg taccatctgc agctaagccc tgcggagcgt acatctatac 900agcaacgatg ggccgatgtt ctgcgcgaga agaagcgtaa tgttgtggtt attgactacc 960caacatacat gcagtctatc tatgatattt tgaataatcc tgcgacttta tttagtttaa 1020acactcgttc tggaatggca cctttggcct ttgctctggc tgcggtatca gggcgaagaa 1080tgattgagat aatgtttcag ggtgaatttg ccgtttcagg aaagtatacg gttaatttct 1140cagggcaagc taaaaaacgc tctgaagata aaagcgtaac cagaacgatt tatactttat 1200gcgaagcaaa attattcgtt gaattattaa cagaattgcg ttcttgctct gctgcatctg 1260atttcgatga ggttgttaaa ggatatggaa aggatgatac aaggtctgag aacggcagga 1320taaatgctat tttagcaaaa gcatttaacc cttgggttaa atcatttttc ggcgatgacc 1380gtcgtgttta taaagatagc cgcgctattt acgctcgcat cgcttatgag atgttcttcc 1440gcgtcgatcc acggtggaaa aacgtcgacg aggatgtgtt cttcatggag attctcggac 1500acgacgatga gaacacccag ctgcactata agcagttcaa gctggccaac ttctccagaa 1560cctggcgacc tgaagttggg gatgaaaaca ccaggctggt ggctctgcag aaactggacg 1620atgaaatgcc aggctttgcc agaggtgacg ctggcgtccg tctccatgaa accgttaagc 1680agctggtgga gcaggaccca tcagcaaaaa taaccaacag cactctccgg gcctttaaat 1740ttagcccgac gatgattagc cggtacctgg agtttgccgc tgatgcattg gggcagttcg 1800ttggcgagaa cgggcagtgg cagctgaaga tagagacacc tgcaatcgtc ctgcctgatg 1860aagaatccgt tgagaccatc gacgaaccgg atgatgagtc ccaagacgac gagctggatg 1920aagatgaaat tgagctcgac gagggtggcg gcgatgaacc aaccgaagag gaagggccag 1980aagaacatca gccaactgct ctaaaacccg tcttcaagcc tgcaaaaaat aacggggacg 2040gaacgtacaa gatagagttt gaatacgatg gaaagcatta tgcctggtcc ggccccgccg 2100atagccctat ggccgcaatg cgatccgcat gggaaacgta ctacagctaa aagaaaagcc 2160accggtgtta atcggtggct tttttattga ggcctgtccc tacccatccc ctgcaaggga 2220cggaaggatt aggcggaaac tgcagctgca actacggaca tcgccgtccc gactgcaggg 2280acttccccgc gtaaagcggg gcttaaattc gggctggcca accctatttt tctgcaatcg 2340ctggcgatgt tagtttcgtg gatagcgttt ccagcttttc aatggccagc tcaaaatgtg 2400ctggcagcac cttctccagt tccgtatcaa tatcggtgat cggcagctct ccacaagaca 2460tactccggcg accgccacga actacatcgc gcagcagctc ccgttcgtag acacgcatgt 2520tgcccagagc cgtttctgca gccgttaata tccggcgcac gtcggcgatg attgccggga 2580gatcatccac ggttattggg ttcggtgatg ggttcctgca ggcgcggcgg agagccatcc 2640agacgccgct aacccatgcg ttacggtact gaaaactttg tgctatgtcg tttatcaggc 2700ccgaagttct tctttctgcc gccagtccag tggttcaccg gcgttcttag gctcaggctc 2760gacaaaagca tactcgccgt ttttccggat agctggcaga acctcgttcg tcacccactt 2820gcggaaccgc caggctgtcg tcccctgttt caccgcgtcg cggcagcgga

ggattatggt 2880gtagagacca gattccgata ccacatttac ttccctggcc atccgatcaa gtttttgtgc 2940ctcggttaaa ccgagggtca atttttcatc atgatccagc ttacgcaatg catcagaagg 3000gttggctata ttcaatgcag cacagatatc cagcgccaca aaccacgggt caccaccgac 3060aagaaccacc cgtatagggt ggctttcctg aaatgaaaag acggagagag ccttcattgc 3120gcctccccgg atttcagctg ctcagaaagg gacagggagc agccgcgagc ttcctgcgtg 3180agttcgcgcg cgacctgcag aagttccgca gcttcctgca aatacagcgt ggcctcataa 3240ctggagatag tgcggtgagc agagcccaca agcgcttcaa cctgcagcag gcgttcctca 3300atcgtctcca gcaggccctg ggcgtttaac tgaatctggt tcatgcgatc acctcgctga 3360ccgggatacg ggctgacaga acgaggacaa aacggctggc gaactggcga cgagcttctc 3420gctcggatga tgcaatggtg gaaaggcggt ggatatggga ttttttgtcc gtgcggacga 3480cagctgcaaa tttgaatttg aacatggtat gcattcctat cttgtatagg gtgctaccac 3540cagagttgag aatctctata ggggtggtag cccagacagg gttctcaaca ccggtacaag 3600aagaaaccgg cccaaccgaa gttggcccca tctgagccac cataattcag gtatgcgcag 3660atttaacaca caaaaaaaca cgctggcgcg tgttgtgcgc ttcttgtcat tcggggttga 3720gaggcccggc tgcagatttt gctgcagcgg ggtaactcta ccgccaaagc agaacgcacg 3780tcaataattt aggtggatat tttaccccgt gaccagtcac gtgcacaggt gtttttatag 3840tttgctttac tgactgatca gaacctgatc agttattgga gtccggtaat cttattgatg 3900accgcagcca ccttagatgt tgtctcaaac cccatacggc cacgaatgag ccactggaac 3960ggaatagtca gcaggtacag cggaacgaac cacaaacggt tcagacgctg ccagaacgtc 4020gcatcacgac gttccatcca ttcggtattg tcgac 405515631PRTArtificial SequenceEscherichia coli bacteriophage N15 telomerase amino acid sequence 15Met Ser Lys Val Lys Ile Gly Glu Leu Ile Asn Thr Leu Val Asn Glu 1 5 10 15 Val Glu Ala Ile Asp Ala Ser Asp Arg Pro Gln Gly Asp Lys Thr Lys 20 25 30 Arg Ile Lys Ala Ala Ala Ala Arg Tyr Lys Asn Ala Leu Phe Asn Asp 35 40 45 Lys Arg Lys Phe Arg Gly Lys Gly Leu Gln Lys Arg Ile Thr Ala Asn 50 55 60 Thr Phe Asn Ala Tyr Met Ser Arg Ala Arg Lys Arg Phe Asp Asp Lys 65 70 75 80 Leu His His Ser Phe Asp Lys Asn Ile Asn Lys Leu Ser Glu Lys Tyr 85 90 95 Pro Leu Tyr Ser Glu Glu Leu Ser Ser Trp Leu Ser Met Pro Thr Ala 100 105 110 Asn Ile Arg Gln His Met Ser Ser Leu Gln Ser Lys Leu Lys Glu Ile 115 120 125 Met Pro Leu Ala Glu Glu Leu Ser Asn Val Arg Ile Gly Ser Lys Gly 130 135 140 Ser Asp Ala Lys Ile Ala Arg Leu Ile Lys Lys Tyr Pro Asp Trp Ser 145 150 155 160 Phe Ala Leu Ser Asp Leu Asn Ser Asp Asp Trp Lys Glu Arg Arg Asp 165 170 175 Tyr Leu Tyr Lys Leu Phe Gln Gln Gly Ser Ala Leu Leu Glu Glu Leu 180 185 190 His Gln Leu Lys Val Asn His Glu Val Leu Tyr His Leu Gln Leu Ser 195 200 205 Pro Ala Glu Arg Thr Ser Ile Gln Gln Arg Trp Ala Asp Val Leu Arg 210 215 220 Glu Lys Lys Arg Asn Val Val Val Ile Asp Tyr Pro Thr Tyr Met Gln 225 230 235 240 Ser Ile Tyr Asp Ile Leu Asn Asn Pro Ala Thr Leu Phe Ser Leu Asn 245 250 255 Thr Arg Ser Gly Met Ala Pro Leu Ala Phe Ala Leu Ala Ala Val Ser 260 265 270 Gly Arg Arg Met Ile Glu Ile Met Phe Gln Gly Glu Phe Ala Val Ser 275 280 285 Gly Lys Tyr Thr Val Asn Phe Ser Gly Gln Ala Lys Lys Arg Ser Glu 290 295 300 Asp Lys Ser Val Thr Arg Thr Ile Tyr Thr Leu Cys Glu Ala Lys Leu 305 310 315 320 Phe Val Glu Leu Leu Thr Glu Leu Arg Ser Cys Ser Ala Ala Ser Asp 325 330 335 Phe Asp Glu Val Val Lys Gly Tyr Gly Lys Asp Asp Thr Arg Ser Glu 340 345 350 Asn Gly Arg Ile Asn Ala Ile Leu Ala Lys Ala Phe Asn Pro Trp Val 355 360 365 Lys Ser Phe Phe Gly Asp Asp Arg Arg Val Tyr Lys Asp Ser Arg Ala 370 375 380 Ile Tyr Ala Arg Ile Ala Tyr Glu Met Phe Phe Arg Val Asp Pro Arg 385 390 395 400 Trp Lys Asn Val Asp Glu Asp Val Phe Phe Met Glu Ile Leu Gly His 405 410 415 Asp Asp Glu Asn Thr Gln Leu His Tyr Lys Gln Phe Lys Leu Ala Asn 420 425 430 Phe Ser Arg Thr Trp Arg Pro Glu Val Gly Asp Glu Asn Thr Arg Leu 435 440 445 Val Ala Leu Gln Lys Leu Asp Asp Glu Met Pro Gly Phe Ala Arg Gly 450 455 460 Asp Ala Gly Val Arg Leu His Glu Thr Val Lys Gln Leu Val Glu Gln 465 470 475 480 Asp Pro Ser Ala Lys Ile Thr Asn Ser Thr Leu Arg Ala Phe Lys Phe 485 490 495 Ser Pro Thr Met Ile Ser Arg Tyr Leu Glu Phe Ala Ala Asp Ala Leu 500 505 510 Gly Gln Phe Val Gly Glu Asn Gly Gln Trp Gln Leu Lys Ile Glu Thr 515 520 525 Pro Ala Ile Val Leu Pro Asp Glu Glu Ser Val Glu Thr Ile Asp Glu 530 535 540 Pro Asp Asp Glu Ser Gln Asp Asp Glu Leu Asp Glu Asp Glu Ile Glu 545 550 555 560 Leu Asp Glu Gly Gly Gly Asp Glu Pro Thr Glu Glu Glu Gly Pro Glu 565 570 575 Glu His Gln Pro Thr Ala Leu Lys Pro Val Phe Lys Pro Ala Lys Asn 580 585 590 Asn Gly Asp Gly Thr Tyr Lys Ile Glu Phe Glu Tyr Asp Gly Lys His 595 600 605 Tyr Ala Trp Ser Gly Pro Ala Asp Ser Pro Met Ala Ala Met Arg Ser 610 615 620 Ala Trp Glu Thr Tyr Tyr Ser 625 630 1622DNAArtificial Sequence22 base consensus sequence for a mesophilic bacteriophage perfect inverted repeat 16ncatnntann cgnntannat gn 221722DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with E.coli phage N15 and Klebsiella phage Phi KO2 protelomerases 17ccattatacg cgcgtataat gg 221822DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Yersinia phage PY54 protelomerase 18gcatactacg cgcgtagtat gc 221922DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Halomonas phage phiHAP-1 protelomerase 19ccatactata cgtatagtat gg 222022DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Vibrio phage VP882 protelomerase 20gcatactata cgtatagtat gc 222114DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with a Borrelia burgdorferi protelomerase 21attatatata taat 142224DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Vibrio phage VP882 protelomerase 22ggcatactat acgtatagta tgcc 242342DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Yersinia phage PY54 protelomerase 23acctatttca gcatactacg cgcgtagtat gctgaaatag gt 422490DNAArtificial Sequenceparticularly preferred perfect inverted repeat sequence for use with Halomonas phage phiHAP-1 protelomerase 24cctatattgg gccacctatg tatgcacagt tcgcccatac tatacgtata gtatgggcga 60actgtgcata cataggtggc ccaatatagg 902556DNAArtificial SequenceParticularly preferred protelomerase target sequence 25tatcagcaca caattgccca ttatacgcgc gtataatgga ctattgtgtg ctgata 562642DNAArtificial SequenceParticularly preferred protelomerase target sequence 26atgcgcgcat ccattatacg cgcgtataat ggcgataata ca 422752DNAArtificial SequenceParticularly preferred protelomerase target sequence 27tagtcaccta tttcagcata ctacgcgcgt agtatgctga aataggttac tg 522890DNAArtificial SequenceParticularly preferred protelomerase target sequence 28gggatcccgt tccatacata catgtatcca tgtggcatac tatacgtata gtatgccgat 60gttacatatg gtatcattcg ggatcccgtt 902938DNAArtificial SequenceParticularly preferred protelomerase target sequence 29tactaaataa atattatata tataattttt tattagta 383022DNAArtificial SequencePT1F primer 30atgagcaagg taaaaatcgg tg 223122DNAArtificial SequencePT1R primer 31ttagctgtag tacgtttccc at 223262DNAArtificial SequenceRL1 32agctttatca gcacacaatt gcccattata cgcgcgtata atggactatt gtgtgctgat 60ag 623362DNAArtificial SequenceRL2 33gatcctatca gcacacaata gtccattata cgcgcgtata atgggcaatt gtgtgctgat 60aa 623422DNAArtificial SequenceSac pGL 34gtgcaagtgc aggtgccaga ac 223527DNAArtificial SequenceBam pGL 35gataaagaag acagtcataa gtgcggc 273656DNAArtificial SequenceComplememt to SEQ ID NO 25 36tatcagcaca caatagtcca ttatacgcgc gtataatggg caattgtgtg ctgata 563756DNAArtificial SequencetelR 37tatcagcaca caattgccca ttatacgcgc gtataatggg caattgtgtg ctgata 563856DNAArtificial SequencetelL 38tatcagcaca caatagtcca ttatacgcgc gtataatgga ctattgtgtg ctgata 563942DNAArtificial SequenceComplement of SEQ ID NO 26 39tgtattatcg ccattatacg cgcgtataat ggatgcgcgc at 424052DNAArtificial SequenceComplement of SEQ ID NO 27 40cagtaaccta tttcagcata ctacgcgcgt agtatgctga aataggtgac ta 524190DNAArtificial SequenceComplement of SEQ ID NO 28 41aacgggatcc cgaatgatac cacatgtaac atcggcatac tatacgtata gtatgccaca 60tggatacatg tatgtatgga acgggatccc 904238DNAArtificial SequenceComplement of SEQ ID NO 29 42tactaataaa aaattatata tataatattt atttagta 38


Patent applications by Vanessa Hill, Surrey GB

Patent applications in class Acellular exponential or geometric amplification (e.g., PCR, etc.)

Patent applications in all subclasses Acellular exponential or geometric amplification (e.g., PCR, etc.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Images included with this patent application:
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
PRODUCTION OF CLOSED LINEAR DNA diagram and imagePRODUCTION OF CLOSED LINEAR DNA diagram and image
Similar patent applications:
DateTitle
2016-03-10Production of tailored pha copolymers from natural gas
2016-05-05Production of polypeptides without secretion signal in bacillus
2016-02-18Production of pyripyropenes from dry biomass
2016-03-03Glucose production method and glucose produced by said method
2016-05-26Nucleic acid amplification/detection device and nucleic acid inspection device using same
New patent applications in this class:
DateTitle
2019-05-16Methods for amplifying nucleic acid using tag-mediated displacement
2019-05-16Method and device for polymerase chain reaction
2018-01-25Novel processes for the production of oligonucleotides
2018-01-25Assay and other reactions involving droplets
2018-01-25Novel use
New patent applications from these inventors:
DateTitle
2012-11-08Production of closed linear dna
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Marshall Medoff
2Anthony P. Burgard
3Mark J. Burk
4Robin E. Osterhout
5Rangarajan Sampath
Website © 2025 Advameg, Inc.