BACTERIAL STRAINS, PLASMIDS, METHOD OF PRODUCING BACTERIAL STRAINS CAPABLE OF CHEMOLITHOTROPHIC ARSENITES OXIDATION AND USES THEREOF

Abstract

The invention provides novel strains Agrobacterium tumefaciens KKP 2039p and Paracoccus alcaliphilus KKP 2040p, the plasmid pSinA and its functional derivative, method for producing bacterial strains capable of chemolithotrophic arsenite oxidation and novel bacterial strains produced by this method. The invention also relates to the composition, comprising the novel bacterial strain or the plasmid pSinA and the use of these novel strains, as well as the method of bioaugmentation of an arsenic contaminated environment, particularly the method for the removal of arsenic from waters.

Description

RELATED APPLICATIONS AND INCORPORATION BY REFERENCE

[0001] This application is a continuation-in-part application of international patent application Serial No. PCT/1132013/055577 filed Jul. 8, 2013, which published as PCT Publication No. WO 2014/009867 on Jan. 16, 2014, which claims benefit of Polish patent application Serial No. P.399883 filed Jul. 10, 2012..

[0002] The foregoing applications, and all documents cited therein or during their prosecution ("appln cited documents") and all documents cited or referenced in the appin cited documents, and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets fur any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

FIELD OF THE INVENTION

[0003] The invention provides novel strains Agrobacterium tumefaciens KKP 2039p and Paracoccus alcaliphilus KKP 2040p, the plasmid pSinA and its functional derivative, a method for producing bacterial strains capable of chemolithotrophic arsenite oxidation, and novel bacterial strains produced by this method. The invention also provides a composition comprising a novel bacterial strain or plasmid pSinA or its functional derivative and the use of these novel strains as well as the method of bioaugmentation of an arsenic-contaminated environment, particularly the method for the removal of arsenic from waters.

BACKGROUND OF THE INVENTION

[0004] Arsenic is among the elements which are widely distributed in the Earth's crust, where it is present in trace amounts, mainly in the soil and minerals. Under the influence of natural processes and human activities, arsenic is also released to waters and air. The presence of arsenic compounds in drinking water sources poses a threat to human and animal health. The most dramatic effects of the influence of arsenic are observed in Bangladesh and in Western Bengali in India, where, according to the World Health Organization (WHO), over 50 million inhabitants are exposed to the consumption of drinking water contaminated with this toxic element.

[0005] Biological removal of arsenic from contaminated areas seems to be a necessary complement to many traditional, chemical methods of remediation. The use of such methods as coagulation or filtration is associated with the removal of not only arsenic, but also other elements present in the treated environment. Current studies on biological systems for arsenic removal, mainly focus on the use of the potential of microorganisms and plants (Kostal et al., 2004, Tripathi et. al., 2007).

[0006] Effective purification of an arsenic-contaminated waters is associated with the removal of both inorganic forms of arsenic (As III and As V). While arsenates can be efficiently and selectively precipitated on strong adsorbents (Pattanayak et al., 2000), in the case of arsenites there is no possibility of using selective oxidants without side effects to the environment. Microbial oxidation of As (III) becomes therefore an alternative to chemical oxidation. Lievermont et al. (2003) proposed an efficient, low input, two-step technology for arsenic removal from waters with the use of Herminiimonas arsenicoxidans ULPAs1 bacteria, The authors have demonstrated that the strain ULPAs1, immobilised on alginate deposit, can efficiently oxidise even 100 mg/L of As (III) and may be applied in technologies for the removal of arsenic, where initial oxidation of contaminated waters is required.

[0007] The known applications of arsenite-oxidising bacteria in bioremediation processes are so far limited to laboratory studies and ex situ methods. The known ways of bioremediation of areas contaminated with arsenic by in situ methods do not fulfil their functions, because bacteria introduced into the "new" environment are not able to survive in the new conditions. This is mainly due to the existence of physico-chemical conditions other than laboratory and to the interspecific competition with the indigenous microflora. The proposed solution to this problem is the biostimulation of indigenous microflora or the use of genetically modified organisms.

[0008] Yang et al. (2010) relates to a lab constructed vector, derivative of the plasmid pBBR1MCS-5, carrying genes for the large and small subunits of arsenite oxidase. This vector contains the gene for resistance to gentamicin and its use requires an application of selection pressure of gentamicin at concentration of 60 mg /L. Because of this, an introduction of bacteria harbouring such plasmid into the environment carries the risk of dissemination of genes for gentamicin resistance, and also involves the risk of instability of such strains in the environment. The vector of Yang et al. (2010) is used for constructing strains useful in bioremediation of arsenic, but it only works when introduced into strains originally capable of arsenite oxidation, and it only increases the efficiency of the already existing process. This vector does not cause the acquisition of a new ability, which is the possibility of catalysing the oxidation reaction of As (III) to As (V).

[0009] The proposed use of genetically modified organisms involves the introduction of foreign genes carried by them, such as marker genes for antibiotic resistance or encoding the green fluorescent protein (Gfp) into the natural environment, which is unacceptable for social reasons and undesirable for environmental reasons, as well as causing the loss of plasmids in case of the absence of selection pressure for the chosen markers in the natural environment.

[0010] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention.

SUMMARY OF THE INVENTION

[0011] It is desirable for the microorganisms capable of arsenite oxidation to also show resistance to the presence of other heavy metals in the environment.

[0012] Sinorhizobium sp. M14 strain was isolated from microbial mats from a gold mine in Zloty Stok (Drewniak et al., 2008). This strain can grow chemolithoautotrophically using arsenites as the source of energy and can mobilise arsenic from arsenopyrite (Drewniak et al, 2010). Strain M14 carries two megaplasmids: 109 kbp plasmid named pSinA and about 300 kbp plasmid named pSinB (Drewniak, 2009). Partial sequence of the plasmid pSinA was revealed in the GenBank NCBI database under the accession number GU990088.1 (the revealed sequence corresponded only to nucleotides 21498 to 48497 of SEQ ID NO: 1 according to the present invention).

[0013] The aim of the present invention is to overcome the indicated inconveniences and to provide novel bacterial strains, plasmids, and methods enabling the introduction of a plasmid. into a bacterial strain, especially an indigenous strain, in order to produce stable, improved. strains, capable of arsenite oxidation, which, are furthermore characterized by an increased resistance to other heavy metals. Such strains may be simultaneously deprived of undesirable marker genes, such as antibiotic resistance genes. The aim of the invention is also to provide novel bacterial strains capable of arsenite oxidation, but not accumulating arsenic, compositions comprising them, and their use.

[0014] The essence of this invention is thus based on an unexpected finding, that it is possible to use the natural plasmid pSinA of Sinorhizobium sp. M14 to produce stable bacterial strains of various species of bacteria, capable of arsenite oxidation, preferably not bearing any undesirable marker genes, as well as on the development of a method for producing novel bacterial strains, using strains comprising this plasmid or plasmid pSinA. Surprisingly, it has been found that plasmid pSinA introduced into bacterial strains and species other than Sinorhizobium sp. is fully functional and stably maintained in them and enables such bacteria to chemolithotrophically oxidize arsenites. Moreover, it was unexpectedly found that unlike the Sinorhizobium sp. M14 strain, the new obtained strains comprising the plasmid do not accumulate arsenic inside their cells, but allow it to be processed, leading to the obtaining of biomass free of harmful arsenic.

[0015] Accordingly, it is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.

[0016] It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes", "included", "including", and the like; and that terms such as "consisting essentially of" and "consists essentially of" have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0017] These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.

DEPOSITS

[0018] The Deposits with the IAFB Collection of Industrial Microorganisms of the Institute of Agricultural and Food Biotechnology in Warsaw, Poland, under deposit accession numbers KKP2039p and KKP2040p were made pursuant to the terms of the Budapest Treaty. Upon issuance of a patent, all restrictions upon the deposit will be removed, and the deposit is intended to meet the requirements of 37 CFR §§1.801-1.809. The deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced if necessary during that period.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings.

[0020] FIG. 1. Shows the genetic organization of the plasmid pSinA. In the diagram, different modules of the plasmid backbone and phenotypic regions have been described: REP/STA and REP/STA2--replication-stabilization modules, TRA/TRB--conjugation module, ARS--arsenic metabolism module, HMR--arsenic resistance module, and TOXIN/ANTITOXIN module. RepABC system (replication and partitioning system--active separation) MRS system (muitimer resolution system) and PHD-DOC system (addiction system--toxin/antitoxin) are located within the REP/STA. module.

[0021] FIG. 2A-C. Shows a comparison of the ability to oxidise arsenites by wild-type strains (wt) Agrobacterium tumefaciens LBA288 and Paracoccus alcaliphilus JCM7364R and their derivatives Agrobacterium tumelaciens, deposited as KKP 2039p (D10), and Paracoccus alcaliphihus, deposited as KKP 2040p (C10) harbouring the plasmid pSinA. In order to compare the abilities of the investigated strains to oxidise arsenites to arsenates, cultures were carried out in minimal MSM medium containing 5 mM (375 ppm) of sodium arsenite, (A) and (B) show the content of As(III) and As(V) in culture fluids collected from the cultures every 24 hours. (A) shows a comparison of kinetics of arsenite oxidation carried out by the A. tumefaciens LBA288 strain and its derivative, the A. tumefaciens (D10) strain with pSinA; (B) shows a comparison of kinetics of arsenite oxidation carried out by the P. alcaliphilus JCM7364R strain and its derivative P. alcaliphilus (C10) with pSinA; (C) shows a comparison between the minimal inhibitory concentration (MIC) values for As(III) of the wild-type strains A. tumefaciens LBA288 and P. alcaliphilus JCM7364R, and their respective derivatives harbouring the plasmid pSinA: A. tumefaciens KKP 2039p (D10) and P. alcaliphilus KKP 2040p (C10).

[0022] FIG. 3. Shows a graph illustrating the frequency of conjugative transfer of the plasmid pSinA from the cells of the Sinorhizobium sp. M14 strain to the cells of indigenous bacteria. In the experiment, two soil samples were used: (I) coming from the Zloty Potok area and designated as ZP and (II) coming from Potok Trujaca and designated as PT. .box-solid.--indicates the Sinorhizobium sp. M14 strain (donor of the plasmid pSinA); .box-solid.--indigenous microflora, capable of arsenite oxidation, comprising bacteria of the genera: Brevundimonas sp., Stenotrophomonas sp., and Pseudomonas sp. for the soil I (ZP) and (ii) Achromobacter sp. Acidovorax sp., Acinetobacter sp. Brevundimonas sp., Microbacterium sp., Pseudomonas sp., and Stenotrophomonas sp. for the soil II (PT); .box-solid.--transconjugants harbouring the plasmid pSinA--derivatives of the indigenous bacteria, including bacteria of the genus Sinorhizobium sp. and Pseudomonas sp. for the soil I (ZP) and Brevandimonas sp., Sinorhizobium sp. and Pseudomonas sp. for the soil II (PT).

[0023] FIG. 4. Shows a comparison of the efficiency of arsenite removal out of the cell carried out by the wild-type strain Sinorhizobium sp. M14 and the newly created strains harbouring pSinA plasmid: Agrobacterium tumefaciens KKP 2039p (D10) and Paracoccus alcaliphilus KKP 2040p (C10). In order to compare the efficiency of the investigated strains to oxidize As(III) to As(V) and to remove the resulting arsenates, cultures were carried out in minimal MSM medium containing 5 mM (375 ppm) of sodium arsenite. As(V) content in culture fluids collected from the cultures every 24 hours is shown on the graph.

[0024] FIG. 5A-B. Photograph from the observations and analysis of granules of high electron density in the cells of Sinorhizobium sp. M14. A--Transmission Electron Microscopy. B--X-ray analysis.

[0025] FIG. 6. Shows a graph illustrating the frequency of conjugative transfer of the plasmid pSinA from the produced strains harbouring this plasmid: Agrobacterium tumefaciens KKP 2039p (D10) and Paracoccus alcaliphilus KKP 2040p (C10) to the cells of indigenous bacteria. In the experiment, a soil sample from the Zloty Potok area was used. The frequency of conjugal transfer was assessed after 15 days of incubation at room temperature. .box-solid.--indicates the rate of conjugal transfer of the plasmid pSinA when Agrobacterium tumefaciens KKP 2039p (D10) was used as the donor; .box-solid.--indicates the rate of conjugal transfer of the plasmid pSinA when Paracoccus alcaliphilus KKP 2040p (C10) was used as the donor;

[0026] FIG. 7. Shows a comparison of the efficiency of arsenite removal out of the cell carried out by wild-type strains (wt) Escherichia coli TOP10, Agrobacterium tumefaciens LBA288 and Paracoccus aminovorans JCM7685, and their derivatives Escherichia coli AIO, Agrobacterium tumefaciens AIO1 and Paracoccus aminovorans AIO2 harbouring the plasmid pAIO1. In order to compare the efficiency of the investigated strains to oxidize As(III) to As(V) and to remove the resulting arsenates, cultures were carried out in minimal MSM medium containing 2 mM (150 ppm) of sodium arsenite.

[0027] FIG. 8. Shows a comparison of MICs--minimal concentration of As(III), inhibiting the growth of the wild-type strains, and their derivatives harbouring the plasmid pARS1. In order to compare the MICs for As(III), cultures were carried out in LB medium, with various concentrations of sodium arsenite (up to 20 mM). After 48 h of cultivation at 30° C., optical density of the cultures (OD₆₀₀nm measurements of absorbance at 600 nm) was monitored.

DETAILED DESCRIPTION OF THE INVENTION

[0028] The present invention concerns the novel strains Agrobacterium tumefaciens (D10) deposited under the number KKP2039p on the 30, Mar. 2012 and Paracoccus alcaliphilus (C10) deposited under the number KKP2040p on the 30, Mar. 2012 in the IAFB Collection of Industrial Microorganisms of the Institute of Agricultural and Food Biotechnology in Warsaw, Poland and functional derivatives (variants) thereof.

[0029] The term variant (derivative) of the novel strain or strains produced by the method according to the invention is to be understood a mutant strain or strain obtained by culturing the deposited strain or the strains produced by the method according to the invention as the starting material, which may comprise the plasmid pSinA shown in SEQ ID NO: 1 and is capable of chemolithotrophic arsenite oxidation.

[0030] Furthermore, the invention relates to the isolated plasmid pSinA shown in SEQ ID NO: 1 or its functional derivative.

[0031] The term `derivative of the plasmid` or `functional derivative of the plasmid` may comprise plasmids having a nucleotide sequence coding for open reading frames, encoding products comprising an amino-acid or a nucleotide sequence identical or highly homologous to the sequences coded by the original plasmid e.g. pSinA, wherein the coding sequences or other plasmid sequences which have been modified e.g. by substitution, replacement, deletion or insertion, such that it does not essentially alter the activity of the products of these open reading frames, and enables the maintenance of functional features carried by the original plasmid e.g. pSinA, such as the ability to chemolithotrophically oxidize arsenites and the resistance to arsenates [As(V)] and arsenites [AS(III)]. A highly homologous sequence means that the sequence is homologous, preferably identical in at least 70%, preferably 80%, more preferably 90%, the most preferably, in at least 95%.

[0032] The invention relates to the use of novel strains: Agrobacterium tumefaciens KKP 2039p and Paracoccus alcaliphilus KKP 2040p, harbouring the natural plasmid pSinA of Sinorhizobium sp. M14 and the use of the plasmid pSinA of Sinorhizobium sp. M14 alone or its functional derivative, carrying: (i) all the genes necessary for chemolithoautotrophic arsenite oxidation, (ii) heavy metal resistance genes, and (iii) genes coding for the replication-stabilization system (with partitioning--active separation), multimer resolution system, and addiction toxin-antitoxin system providing stable maintenance of the plasmid in bacterial cells, for constructing bacterial strains capable of chemolithotrophic oxidation of arsenites. Such strains or the plasmid are useful in bioremediation, including the direct application in the process of bioaugmentation of the microflora of an arsenic-contaminated environments. Such strains may also be used to produce other strains capable of chemolithoautotrophic oxidation of arsenites or to improve the strains that already possess such a characteristic. The complete sequence of the plasmid pSinA of Sinorhizobium sp. M14 has been shown in SEQ ID NO: 1. The presented solution enables the construction of strains useful for the removal of arsenic from the contaminated environments, without the use of genetic manipulations and introduction of common risk genes (e.g. resistance to antibiotics) into circulation in the environment. By the invention, it is possible to introduce the plasmid pSinA to the cells of indigenous strains isolated from given environment and to construct stable strains capable of arsenite oxidation. Moreover, the invention allows for the conduction of a method for selection and monitoring of the strains harbouring the pSinA plasmid.

[0033] The invention therefore relates to the method for producing bacterial strains capable of chemolithotrophic arsenite oxidation, comprising the following steps: a) obtaining the recipient strain, and b) introduction of the plasmid pSinA, shown in SEQ ID NO: 1 or its functional derivative into the recipient strain. In the preferred method, step b) is carried out by:

[0034] (i) triparental mating using a donor strain, containing the plasmid pSinA shown in SEQ ID NO: 1 or its functional derivative and a helper strain carrying a helper plasmid, or,

[0035] (ii) biparental mating using a donor strain, containing the plasmid pSinA shown in SEQ ID NO: 1 or its functional derivative.

[0036] The preferred donor strain in this method is Agrobacterium tumefaciens (D10) deposited under the number KKP 2039p or Paracoccus alcaliphilus (C10) deposited under the number KKP 2040p.

[0037] In the preferred method for producing bacterial strains capable of chemolithotrophic arsenite oxidation in step a) of obtaining the recipient strain, a gene encoding an additional selection marker, preferably, coding for resistance to antibiotics, is additionally introduced into the recipient strain. More preferably, the gene coding for an additional selection marker is introduced on a plasmid, prefrably by triparental mating with a bacterial strain harbouring the plasmid containing a gene coding for the additional selection marker and the helper strain, containing a helper plasmid.

[0038] In the preferred method for producing bacterial strains capable of chemolithotrophic arsenite oxidation the recipient is a bacterial strain isolated from the natural environment, preferably from an arsenic-contaminated environment, a particularly preferred recipient strain being a bacterial strain belonging to Alphaproteobacteria and Gammaproteobacteria.

[0039] The invention relates to the construction of strains capable of chemolithotrophic oxidation of As(III). By the use of the pSinA plasmid, its derivative or the strains: Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, it is possible to construct bacterial strains capable of carrying out such reactions, starting from the strains which originally did not possess the entire gene apparatus, necessary for arsenite oxidation.

[0040] The invention provides for the construction of strains basing on bacteria isolated from various arsenic-contaminated environments, without limitation by the latitude. Due to the fact that the plasmid pSinA. is capable of replication in bacterial cells belonging to Alphaproteobacteria and Gammaproteobacteria, it may be used in practically any environment. It is commonly known that the bacteria belonging to Alphaproteobacteria and Gammaproteobacteria are generally found in every environment studied.

[0041] The invention also relates to the composition, comprising the novel bacterial strain Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, a novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to the invention or the plasmid pSinA shown in SEQ ID NO: 1, or its functional derivative.

[0042] In another aspect, the invention relates to the use of the novel bacterial strain Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, a novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to the invention or the plasmid pSinA shown in SEQ ID NO: 1, or its functional derivative or a combination thereof, for constructing bacterial strains capable of chemolithotrophic arsenite oxidation.

[0043] Furthermore, the invention relates to the use of the novel bacterial strain Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, a novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to the invention, the plasmid pSinA shown in SEQ ID NO: 1, or its functional derivative, the composition according to the invention, or a combination thereof, in the processes of biological removal of arsenic.

[0044] In the preferred embodiment, biological removal of arsenic may comprise bioremediation or biometallurgy of arsenic.

[0045] By "bioremediation" it is to be understood the conversion of harmful substances present in the environment to less toxic or completely safe metabolites, using microorganisms or higher organisms.

[0046] According to the invention, "bioaugmentation" means the introduction into the natural or degraded environment, of selected strains/a composition of microorganisms in order to increase the performance and capabilities of the course of a given process.

[0047] By "biometallurgy" it is to be understood the technology for metal recovery from metal ores and metal industry wastes.

[0048] In another aspect, the invention relates to the method of bioaugmentaion of an arsenic-contaminated environment, which may comprise the step of introducing the novel bacterial strain Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, a novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method. according to the invention, or the plasmid pSinA, shown in SEQ ID NO: 1, or its functional derivative, the composition according to the invention or a combination thereof, into the arsenic contaminated environment.

[0049] The invention therefore relates to the method of introducing the plasmid pSinA directly into an environment as a part of bioaugmentation with the strain Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, Sinorhizobium sp. M14, a bacterial strain capable of chemolithotrophic arsenite oxidation, obtained by the method according to the invention, comprising the plasmid pSinA shown in SEQ ID NO: 1, or its functional derivative, the plasmid pSinA or the composition according to the invention.

[0050] In case there is no possibility of directly constructing arsenite oxidizing strains based on the indigenous microflora, the plasmid can be introduced into the environment through the methods of bioaugmentation. A strain harbouring the plasmid pSinA or its derivative, or the composition according to the invention, is introduced into the soil and/or water contaminated. with arsenic compounds and as a result of natural conjugation, the plasmid is transferred to the cells of indigenous microorganisms (autochthonous microorganisms).

[0051] The advantage of the bacterial strains comprising the plasmid pSinA, shown in SEQ ID NO: 1, or its functional derivative produced by the method according to the invention, is their stable maintenance of the plasmid introduced. Such strains are unable to get rid of it even in the absence of selection pressure i.e. in the absence of arsenic in the medium, as a result of possession of genes encoding the toxin and antitoxin system on the plasmid, providing for stable maintenance of the plasmid in bacteria. Particularly preferred in bioaugmentation, is the use of the Agrobacterium tumefaciens KKP 2039p strain, a derivative of A. tumefaciens--a bacteria recognised as environmentally safe and approved for use in soil and water environments. Moreover, an advantage of newly produced bacterial strains comprising the plasmid pSinA, like Agrobacterium tumefaciens KKP 2039p (D10), Paracoccus alcaliphilus KKP 2040p (C10), in contrast to the parental strain--Sinorhizobium sp. M14, is the ability to oxidize (up to ˜400 mg/L) arsenites to arsenates with 100% efficiency or close to 100%, as well as the lack of accumulation of arsenic inside the cells.

[0052] The invention also relates to the method of removing or recovering arsenic through chemolithotrophic arsenite oxidation, in which the chemolithotrophic arsenite oxidation step is carried out by the novel strain Agrobacteriun tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p, a novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to the invention, the composition according to the invention, containing strains capable of chemolithotrophic arsenite oxidation, or a combination thereof.

[0053] In the preferred method of removing or recovering arsenic, the step of chemolithotrophic arsenite oxidation is followed by the step of arsenate removal e.g. by precipitation of the resulting arsenates in the form of an insoluble, stable precipitant or by adsorption of arsenates. For the precipitation or adsorption and effective removal of arsenates, among others, burnt lime (CaO) (Twidwell et al.. 1999), calcium hydroxide Ca(OH)₂ (Bothe, Brown 1999) or bog iron ores may be used.

[0054] The invention also relates to the method of selection and identification of transconjugants, obtained as the result of bi- and triparental mating, based on the phenotypic characteristics encoded by the plasmid pSinA.

[0055] In another aspect, the invention relates to a plasmid comprising the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1 or its functional derivative.

[0056] Such plasmid is a derivative of the plasmid pSinA, which may comprise the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1, i.e. the aio module, comprising aioXSRABmoeA genes, and may be used as a plasmid or as a sequence fragment integrated into the bacterial genome for constructing strains capable of arsenite oxidation.

[0057] The invention also relates to a bacterial strain comprising a plasmid, which may comprise the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1 or its functional derivative, or a bacterial strain comprisisng such a nucleotide sequence, comprising the fragment 24376-34453 of SEQ ID NO: 1 or its functional derivative integrated into the bacterial genome of the strain. The strains containing the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1 or its functional derivative will be capable of arsenite oxidation and/or arsenate production.

[0058] The invention also relates to the use of a plasmid comprising the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1 or its functional derivative, or a bacterial strain, which may comprise the nucleotide sequence corresponding to nucleotides 24376-34453 of SEQ ID NO: 1 or its functional derivative, or a bacterial strain comprising such a nucleotide sequence, comprising the fragment 24376-34453 of SEQ ID NO: 1 or its functional derivative integrated into the bacterial genome, for arsenite oxidation and arsenate production.

[0059] In a further aspect, the invention relates to a plasmid comprising the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1 or its functional derivative.

[0060] Such plasmid is a derivative of the plasmid pSinA, which may comprise the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1, i.e. the arS module, comprising arsR1C1C2BtrkAmsfarsHarsR2 genes, and may be used as a plasmid or as a sequence fragment integrated into the bacterial genome, for constructing strains resistant to arsenic, both As (III) and As (V), and for increasing resistance to arsenic, particularly in relation to the original strain, into which such a sequence is to be introduced.

[0061] The invention also relates to a bacterial strain comprising a plasmid comprising the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1 or its functional derivative, or a bacterial strain comprising such a nucleotide sequence, comprising the fragment 43229-50772 of SEQ ID NO: 1 or its functional derivative integrated into the bacterial genome of the strain. The strains comprising the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1 or its functional derivative will have an increased resistance to arsenic and/or will acquire the resistance to arsenic, both As (III) and As (V), particularly in comparison with the original strain.

[0062] The invention also relates to the use of a plasmid comprising the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1 or its functional derivative, or a strain comprising a plasmid, which may comprise the nucleotide sequence corresponding to nucleotides 43229-50772 of SEQ ID NO: 1 or its functional derivative, or a bacterial strain comprising such a nucleotide sequence, comprising the fragment 43229-50772 of SEQ ID NO: 1 or its functional derivative integrated into the bacterial genome, for producing a strain with an increased resistance to arsenic, both As (III) and As (V), particularly in comparison with the original strain.

[0063] The following examples are presented merely to illustrate the invention and to clarify its various aspects, but are not intended to be limitative, and should not be equated with all its scope, which is defined in the appended claims.

[0064] In the following examples, unless it was otherwise indicated, standard materials and methods described in Sambrook and Russell. 2001. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York. were used, or the manufacturers' instructions for specific materials and methods were followed.

[0065] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.

[0066] The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.

EXAMPLES

Example 1

Characteristics of Plasmid pSinA and Determination of its Complete Sequence

[0067] Plasmid pSinA, of the size of 109 kbp, was isolated from the Sinorhizobium sp. M14 strain (Drewniak et al., 2008, Drewniak et al. 2010.) In order to sequence the plasmid, plasmid pSinA was isolated from 200 ml of overnight culture of Sinorhizobium sp. M14 by alkaline lysis method. Plasmid pSinA was sequenced by pyrosequencing method, using "shotgun" strategy on the GS FLX Titanium (454) sequencer (in the Oligo Pl. centre). For the construction of DNA library, approx. 5 μg of pSinA DNA was used and reagent kits provided by the manufacturer were applied (GS FLX Titanium Library Preparation Kit, Roche). The constructed library was sequenced and assembled using the software from the Newbler de novo assembler package (Roche). The obtained sequences were then assembled into contigs using Seqman software from Lasergene package (DNAStar). Annotation of the plasmid (identification of the open reading frames and determination of their potential functions) were performed using Artemis program and BLAST programs (from the NCBI database).

[0068] Sequencing of the plasmid pSinA showed that it is a DNA particle of the size of 108 938 by and the GC-content of 59.5%. It may comprise 103 open reading frames (ORF), which constitute 89% of the sequence of the plasmid. Table 1, below, features a detailed description of the identified ORFs within SEQ ID NO: 1.

TABLE-US-00001 TABLE 1 Determination of the potential coding sequences of the plasmid pSinA in reference to SEQ ID NO: 1. Coding sequence The greatest similarity (BLASTP program) ORF (start-stop Protein size GenBank No codon)* (aa) Predicted protein function Identity % Organism number 1 189-1463 424 Replication initiation protein 90 (380/424) Agrobacterium rhizogenes NP_066713 (RepA) (pRi1724) 2 1567-2571 334 Replication initiation protein 71 (236/335) Agrobacterium rhizogenes NP_066714 (RepB) (pRi1724) 3 2740-3951 403 Replication initiation protein 73 (288/399) Rhizobium etli CFN 42 YP_471771 (RepC) (p42a) 4 4297-5457c 386 Integrase family protein (Cre-like 82 (305/372) Rhizobium leguminosarum YP_770909 recombinases) bv. trifolii WSM2304(pRL8) 5 5535-5813 92 Prevent-host-death family protein 84 (77/92) Rhizobium leguminosarum YP_002279248 bv. trifolii WSM2304(pRL8) 6 5800-6231 143 Hypothetical protein (PemK-like 75 (107/143) Brucella ovis ATCC 25840 YP_001257527 protein) 7 6467-7597 376 Protein of unknown function 67 (253/380) Agrobacterium radiobacter YP_002546559 (DUF1612) K84 8 7688-8281 197 Hypothetical protein 97 (179/185) Agrobacterium tumefaciens NP_053264 (pTi) 9 8345-8731 128 Predicted nucleic acid-binding 91 (100/111) Agrobacterium tumefaciens NP_053265 protein (PilT protein-like protein) (pTi) 10 8768-12582c 1271 Putative protein involved in cell 28 (326/1181) Rhizobium etli CIAT 652 YP_001984284 division and chromosome partitioning 11 12767-13393 208 Hypothetical protein 85 (177/209) Rhodopseudomonas palustris YP_532912 BisB18 12 13414-14253 279 Hypothetical protein 34 (87/256) Bacillus thuringiensis ZP_04087111 serovar huazhongensis BGSC 4BD1 13 14474-16219 581 Predicted ATPase (COG5293) 45 (258/585) Nostoc sp. PCC 7120 NR_485895 14 16235-17032 265 Hypothetical protein (transposon) 80 (211/265) Pseudomonas aeruginosa ACD39332 15 17092-17913 273 Hypothetical protein 49 (97/202) Agrobacterium tumefaciens NP_059784 (pTi) 16 18097-21072 991 Hypothetical protein (ATPase 86 (837/978) Labrenzia alexandrii DFL-11 ZP_05114452 involved in DNA repair) 17 21082-21768 228 Putative siderophore biosynthesis- 72 (131/182) Methylobacterium extorquens YP_003066102 associated protein DM4 18 21761-22699 312 Hypothetical protein 84 (244/293) Methylobacterium extorquens YP_ 003066101 DM4 19 22735-23241 168 Hypothetical protein 68 (108/161) Xanthobacter autotrophicus YP_ 001415141 Py2 20 23283-23777 164 Hypothetical protein 92 (150/164) Oceanicola granulosus ZP_01157550 HTCC2516 21 23783-24139c 118 Hypothetical protein 96 (113/118) Rhizobium etli CIAT 894 ZP_ 03526252 22 24660-25877c 405 Molybdenum-biosynthesis protein 84 (338/404) arsenite-oxidising bacterium ABC18312 (MoeA) NT-26 23 26035-26418c 127 c-type cytochrome c552 97 (122/127) Agrobacterium tumefaciens ABB51926 24 26508-29045c 845 large subunit of Arsenite oxidase 99 (831/845) Agrobacterium tumefaciens ABB51928 AioB (previously AoxB)) 25 29058-29585c 175 Small subunit of Arsenite oxidase 98 (171/175) Agrobacterium tumefaciens ABB51929 (AioA (previously AoxA))) 26 29723-31051c 442 Putative transcriptional regulator 97 (428/442) Agrobacterium tumefaciens ABB51925 (AioR (previously AoxR))) 27 31041-32507c 488 Putative sensor histidine kinase 97 (470/488) Agrobacterium tumefaciens ABB51924 (AioS(previously AoxS))) 28 32504-33424c 306 Phosphate/phosphonate ABC 57 (167/295) Xanthobacter autotrophicus YP_001418827 transporter (AioX (previously Py2 PhnD) 29 33604-34296c 230 Phosphate regulon transcriptional 83 (187/127) Agrobacterium vitis S4 YP_002548344 regulatory protein (PhoB) 30 34661-35698 345 Phosphate-binding protein (PstS) 75 (229/306) Alcaligenes faecalis AAQ19844 31 35756-36679 307 Phosphate ABC transporter, inner 75 (227/305) Alcaligenes faecalis AAQ19845 membrane subunit (PstC) 32 36679-37626 315 Phosphate ABC transporter, inner 70 (212/303) Alcaligenes faecalis AAS45094 membrane subunit (PstA) 33 37644-38486 280 phosphate ABC transporter, 75 (195/262) Alcaligenes faecalis AAS45095 ATPase subunit (PstB) 34 38592-39179 231 Phosphate transport system 49 (108/224) Pseudovibrio sp. JE062 ZP_05085295 regulatory protein (PhoU) 35 39203-39865 220 Phosphate regulon transcriptional 40 (88/225) Pseudovibrio sp. JE062 ZP_05085350 regulatory protein (PhoB) 36 39872-40963c 273 Bifunctional protein: N-terminal 47 (130/280) Nitrobacter hamburgensis YP_571847 transcriptional regulator (ArsR) X14 (pPB12) and C-terminal arsenate reductase (ArsC) 37 40850-41803 317 Phosphate/phosphonate ABC 78 (232/300) Xanthobacter YP_001418843 transporter (PhnD) autotrophicus Py2 38 41877-42716 279 Phosphonate ABC transporter, 76 (190/251) Roseobacter sp. AzwK-3b ZP_01904969 ATP-binding protein (PhnC) 39 42716-43531 271 Phosphonate uptake ABC type 75 (197/266) Fulvimarina pelagi ZP_01438481 transporter (PhnE) HTCC2506 40 43531-44349 272 Phosphonate uptake ABC type 70 (187/268) Vibrio metschnikovii CIP ZP_05881311 transporter (PhnE) 69.14 41 44496-44855 119 ArsR family transcriptional 72 (80/112) Rhizobium etli CIAT 894 ZP_03530366 regulator 42 45085-45612 175 Tyrosine arsenate reductase 89 (147/166) Rhizobium etli CIAT 894 ZP_03530368 (ArsC) 43 45717-46151 144 Arsenate reductase (ArsC) 80 (114/143) Sinorhizobium medicae YP_001313767 WSM419 44 46237-47307 356 Arsenite efflux transporter (AsrB) 89 (314/356) Sinorhizobium medicae YP_001313766 WSM419 45 47324-48367 347 FAD-dependent pyridine 62 (206/336) Burkholderia YP_001114753 nucleotide-disulphide vietnamiensis G4 oxidoreductase (TrkA) 46 48317-49537c 406 Major facilitator superfamily 68 (272/404) Rhizobium leguminosarum YP_002976231 (MFS_1) protein bv. trifolii WSM1325 47 49534-50241c 235 NADPH-dependent FMN 84 (196/235) Rhizobium leguminosarum YP_768473 reductase (ArsH) bv. viciae 3841 48 50290-50622c 110 ArsR family transcriptional 65 (63/97) Agrobacterium vitis S4 YP_002547788 regulator 49 50781-51595c 271 Putative universal stress response 34 (92/271) Rhizobium etli CFN 42 YP_472650 protein (UpsA) 50 51610-52875c 421 Putative phosphopyruvate 70 (291/421) Methylococcus capsulatus str. YP_114366 hydratase (enolase) Bath 51 52931-53116c 61 Hypothetical protein 51 (30/59) Rhizobium leguminosarum YP_002279234 bv. trifolii WSM2304 52 53176-53514c 112 Hypothetical protein 92 (94/103) Rhizobium etli IE4771 ZP_03517489 53 53752-55569c 605 ClC sycA-like chloride channel 80 (343/433) Agrobacterium vitis S4 YP_002548815 protein 54 55761-56153c 130 Hypothetical protein 48 (30/63) Burkholderia phytofirmans YP_001893937 PsJN 55 56215-56706 163 Putative Co/Zn/Cd efflux system 71 (109/155) Methylobacterium nodulans YP_002497120 component (CzcD) ORS 2060 56 56763-57551c 262 Predicted permease (DUF81) 76 (177/233) Methylobacterium extorquens YP_003068171 DM4 57 57710-58918c 402 pH-dependent sodium/proton 74 (287/392) Rhizobium etli CFN 42 YP_468132 antiporter 58 59238-59546 102 Hypothetical protein (probable 50 (38/77) Agrobacterium vitis S4 YP_ 002542648 helicase) 59 59529-59969c 146 MerR family transcriptional 100 (146/146) Ochrobactrum anthropi YP_001371693 regulator ATCC 49188 60 60055-60480 141 Mercuric transporter (MerT) 100 (141/141) Ochrobactrum anthropi YP_001371694 ATCC 49188 61 60501-60794 97 Mercuric transport protein 100 (97/97) Ochrobactrum anthropi YP_001371695 periplasmic component (MerP) ATCC 49188 62 61040-63277 745 Mercuric reductase (MerA) 100 (745/745) Ochrobactrum anthropi YP_001371697 ATCC 49188 63 63661-65805c 714 Hypothetical protein (putative 99 (713/714) Ochrobactrum anthropi YP_001371699 phage integrase) ATCC 49188 64 65802-67610c 602 Hypothetical protein (putative 100 (602/602) Ochrobactrum anthropi YP_001371700 phage integrase) ATCC 49188 65 67610-69049c 479 Putative XerD integrase 100 (479/479) Ochrobactrum anthropi YP_001371701 ATCC 49188 66 69480-70514 344 Putative RecA relaxase 62 (209/341) Rhizobium etli CFN 42 YP_471728 67 70577-71182 201 Protein of unknown function 73 (145/201) Agrobacterium rhizogenes NP_066672 (DUF1419) 68 71278-71571c 97 Hypothetical protein 37 (35/95) Agrobacterium tumefaciens NP_053284 69 71747-76921 1724 S-adenosylmethionine-dependent 86 Rhizobium leguminosarum YP_770997 methyltransferase (1445/1687) bv. viciae 3841 70 77344-79101 585 Partitioning protein ParBC 71 (408/578) Agrobacterium rhizogenes YP_001961038 71 79098-79991 297 Hypothetical protein 61 (171/282) Agrobacterium rhizogenes YP_001961040 72 79998-80299 103 Hypothetical protein 43 (38/89) Ochrobactrum anthropi YP_001373171 ATCC 49188 73 80356-80589 77 Hypothetical protein 68 (27/40) Rhizobium etli IE4771 ZP_03514174 74 80683-81270 195 Hypothetical protein 83 (161/194) Agrobacterium rhizogenes YP_001961043 75 81548-82471 307 Conjugal transfer antirestriction 82 (244/300) Rhizobium leguminosarum YP_771003 protein (ArdC) bv. viciae 3841 76 82799-83125 108 Hypothetical protein No significant similarities found 77 83142-83450 102 Protein of unknown function 99 (100/102) Sinorhizobium meliloti YP_001965632 (DUF736) 78 83600-83938 112 Hypothetical protein 61 (69/114) Agrobacterium vitis S4 YP_002551439 79 84033-84302 89 Hypothetical protein No significant similarities found 80 84441-84893c 150 Putative nuclease 64 (96/150) Rhizobium leguminosarum YP_771010 bv. viciae 3841 81 85731-87668c 645 Conjugal transfer coupling protein 82 (508/627) Rhizobium etli CFN 42 YP_471745 (TraG) 82 87655-87870c 71 Conjugal transfer protein (TraD) 80 (56/70) Rhizobium leguminosarum YP_771013 bv. viciae 3841 83 87875-88171c 98 Conjugal transfer protein (TraC) 69 (67/98) Agrobacterium tumefaciens BAB47248 84 88422-91745 1107 Dtr system oriT relaxase (TraA) 78 (855/1109) Agrobacterium tumefaciens BAB47249 85 91742-92308 188 Conjugal transfer pilin processing 55 (102/188) Rhizobium leguminosarum YP_771016

protease (TraF) bv. viciae 3841 86 92298-93464 388 Conjugal transfer protein (TraB) 62 (239/388) Rhizobium sp. NGR234 NP_443826 87 93482-94093 203 Conjugal transfer protein (TraH) 71 (144/205) Rhizobium leguminosarum YP_770822 bv. viciae 3841 88 94126-94746c 206 Hypothetical protein 71 (144/205) Rhizobium leguminosarum YP_770822 bv. viciae 3841 89 94747-95502c 251 Hypothetical protein 65 (165/255) Rhodopseudomonas palustris ZP_ 06357667 DX-1 90 96193-96897 234 Putative LuxR-type transcriptional 51 (119/234) Sinorhizobium meliloti YP_001965652 regulator protein (TraR) 91 96912-97211c 99 TraR antiactivator (TraM) 52 (51/99) Agrobacterium tumefaciens NP_053353 92 97764-98483 239 AHL-dependent transcriptional 59 (134/231) Rhizobium leguminosarum AF210630_2 regulator similar to LuxR 93 98601-99263 220 Conjugation factor synthase 62 (136/221) Rhizobium etli Brasil 5 ZP_03504772 (TraI) 94 99303-100598c 431 Conjugal transfer protein (TrbI) 76 (328/432) Sinorhizobium meliloti SM11 YP_001965654 95 100611-101054c 147 Conjugal transfer protein (TrbH) 70 (100/143) Rhizobium leguminosarum YP_771025 bv. viciae 3841 96 101058-101888c 276 Conjugal transfer protein (TrbG) 86 (237/276) Sinorhizobium meliloti SM11 YP_001965656 97 101904-102566c 220 Conjugal transfer protein (TrbF) 92 (201/220) Rhizobium leguminosarum YP_771027 bv. viciae 3841 98 102588-103769c 393 Conjugal transfer protein (TrbL) 87 (327/380) Rhizobium etli IE4771 ZP_03519561 99 103944-104747c 267 Conjugal transfer/entry exclusion 87(205/238) Rhizobium leguminosarum AAO21104 protein (TrbJ) bv. viciae 100 104740-107175c 811 Conjugal transfer protein (TrbE) 89 (719/809) Rhizobium leguminosarum YP_771030 bv. viciae 3841 101 107186-107485c 99 Conjugal transfer protein (TrbD) 78 (77/99) Rhizobium etli CFN 42 YP_471765 102 107478-107870c 130 Conjugal transfer protein (TrbC) 74 (97/132) Rhizobium leguminosarum YP_771032 bv. viciae 3841 103 107860-108825c 321 Conjugal transfer protein (TrbB) 90 (288/321) Sinorhizobium meliloti SM11 YP_001965665 *The numbers in the coding sequence correspond to the nucleotide numbers in SEQ ID NO: 1

[0069] The determined genetic organization of the plasmid pSinA has been presented in FIG. 1. The obtained, complete sequence of plasmid pSinA has been shown in SEQ ID NO: 1.

Example 2

Construction of the Agrobacterium tumefaciens and Paracoccus alcaliphilus Strains Capable of Chemolithotrophic Arsenite Oxidation

[0070] In order to demonstrate that the plasmid pSinA can be used for constructing strains capable of arsenite oxidation, the plasmid pSinA was introduced into two strains belonging to Alphaproteobacteria. For the construction, two strains have been selected: Agrobacterium tumefaciens LBA288 and Paracoccus alcaliphilus JCM7364R, incapable of arsenite oxidation and susceptible to As (III) (1 mM of sodium arsenite inhibits the growth of both strains). As a method for introducing plasmid DNA, bi- and triparental mating, described in Sambrook and Russel (2001), was used.

[0071] In order to allow the introduction of the pSinA plasmid into the selected strains, one must know their phenotypic characteristics that can be used as markers for selection, enabling the elimination of the cells of the plasmid donor. In case none of the phenotypic traits encoded by the recipient strain can be used, it should be appropriately modified (example 2A) or an appropriate method for identification of transconjugants should be applied (example 2B).

Example 2A

Construction of Strains Resistant to Tetracycline

[0072] The A. tumefaciens LBA288 strain does not carry any phenotypic characteristics that enable the use of an appropriate selection pressure to eliminate the cells of the plasmid donor. In accordance with the above, in order to establish an adequate method for selection, plasmid pBBR1MCS3 (Kovach et al., 1995), carrying a gene for tetracycline resistance, was introduced into its cells. The Sinorhizobium sp. M14 strain is susceptible to tetracycline, which allows for the removal of the cells of the donor strain in conjugation. The plasmid pBBR1MCS3 (introduced into Escherichia coli TG 1 cells beforehand) was introduced into the cells of the A. tumefaciens LBA288 strain, by triparental mating, in which the pRK2013 helper plasmid (Ditta et al. 1980) (introduced into Escherichia coli TG1 cells beforehand) was used. The helper plasmid facilitates conjugation in case of strains, carrying genes responsible for the transfer only, and not for mobilization to the transfer. The conjugation was carried out according to Sambrook and Russel (2001), and for the selection of transconjugants, LB medium supplemented with tetracycline (20 μg/ml) (eliminating the cells of the recipient) and rifampicin (50 μg/ml) (eliminating the cells of the donor strain and of the strain harbouring the helper plasmid--in both cases Escherichia coli TG1) was used. The prepared donor cultures (E. coli TG1 with the plasmid pBBR1MCS3), the helper strain (E. coli TG1 with the plasmid pRK2013) and the recipient (A. tumefaciens LBA288) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB medium. After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and appropriate dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with tetracycline and rifampicin, and then incubated for 48 h at 30° C. As a result of conjugation, transconjugants, derivatives of A. tumefaciens LBA288 harbouring the plasmid pBBR1MCS3, were obtained. For further analysis, one strain, named A. tumefaciens PBBR-Tc, was selected. The obtained strain was then used as the recipient strain in conjugation with Sinorhizobium sp. M14 strain.

Introduction of the Plasmid pSinA into the Cells of Strains Resistant to Tetracycline Production of A. tumefaciens D10 Strain (Deposited as KKP2039p)

[0073] In order to introduce the plasmid pSinA into the cells of the A. tumefaciens PBBRR-Tc strain, triparental mating was applied again (with the use of the pRK2013 helper plasmid, introduced into E. coli TG1 cells) and additionally, biparental mating. In both of these types of conjugation, the Sinorhizobium sp. M14 strain was used as the donor, capable of arsenite oxidation and resistant to As (III) (up to 20 mM) and susceptible to tetracycline. For the selection of transconjugants, LB medium (Sambrook and Russel, 2001), supplemented with 2.5 mM As(III) and tetracycline (20 μg/ml) was used. The prepared cultures of the donor (Sinorhizobium sp. M14 with the plasmid pSinA), the helper strain (E. coli TG1 with the plasmid pRK2013) (in case of triparental mating) and the recipient (A. tumefaciens PBBR-Tc) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB medium (Sambrook and Russel, 2001). After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with tetracycline and sodium arsenite, and then incubated for 48 h at 30° C. Potential transconjugants were subjected to the following analyses:

[0074] 1. physiological analysis to determine the ability to oxidize As (III) in modified MSM medium (Drewniak et al., 2008)--in order to determine the ability to oxidize As (III), potential transconfugant strains were cultivated in MSM medium supplemented with arsenites (the sole energy source) at 30° C. After 5 days of incubation under aerobic conditions, 500 μl of the culture were collected and added to 500 μl of 0,1 M solution of silver nitrate. The result of the reaction between AgNO₃ and As (III) or As (V) is the formation of a coloured precipitate. A brown precipitate indicates the presence of Ag₃AsO₄ (silver orthoarsenate), while a yellow precipitate indicates the presence of Ag₃AsO₃ (silver arsenite). In case of testing for the ability to oxidise arsenites, the presence of a brown precipitate indicates that As (III) was oxidised to As (V).

[0075] 2. DNA-DNA hybridization (Southern blot)--in order to identify plasmid pSinA genes in the genomes of potential transconjugants. Fragments of the genes located on the plasmid pSinA, amplified by PCR (using the primers shown in Table 2) and labelled with digoxigenin were used as probes. Hybridization was carried out against the plasmid DNA isolated from transconjugants, obtained by alkaline lysis and visualised by DNA electrophoresis.

[0076] 3. PCR analyses--in order to identify plasmid pSinA genes in the genomes of potential transconjugants, PCR was performed using primers, described in Table 2.

[0077] 4. visualization of plasmids of potential transconjugants obtained by alkaline lysis and visualized by DNA electrophoresis.

[0078] For the hybridization analysis and PCR analysis, genes and primers presented in Table 2 were used.

TABLE-US-00002 TABLE 2 Sequences of the primers used in PCR amplification of plasmid pSinA genes and chromosomal 16S rRNA genes Position in the genome of Gene plasmid pSinA, in reference name Primer Sequence to SEQ ID NO: 1 aoxB aoxBF CCACTTCTGCATCGTCGGC 26701-26721 T aoxBR GTCGGTGTCGGATAGGCCA 28954-28974 T repA repAF CGTGCGCTATCTTCAGACG 188-208 G repAR GCTTGAGTTCTTCGTAGTCC 1709-1729 traI traIF GTGCTCATCGGAGTGAATG 98200-98220 G traIR GACATCAAGGATCTCGGCT 99912-99932 A orf12 12F GCAATCGGTCTCACAAGAG 12122-12142 G 12R AAGGCGCACATCAGCTCGA 14139-14159 A 16SrRNA 27F AGAGTTTGATCMTGGCTCA Universal primers for G amplification of 1492R GGTTACCTTGTTACGACTT bacterial 16S rRNA genes

[0079] In both types of conjugation (bi- and tri-parental), transconjugants harbouring the plasmid pSinA were obtained. For further analysis, the A. tumefaciens D10 strain from biparental mating (deposited as KKP2039p) was chosen. This strain was capable of arsenite oxidation and of using them as an electron donor (energy source) (FIG. 2A). In addition, this strain has increased its tolerance to As(III) (FIG. 2C). To verify whether the constructed strain stably maintains the plasmid, a series of passages (4-6 times) in media without selection pressure was performed. The obtained results showed that the constructed A. tumefaciens D10 strain stably maintains the plasmid pSinA. After about 60 generations of growth in conditions without selection pressure (without arsenic) no plasmid-less cells were observed.

Example 2B

[0080] In case we do not want to apply selection pressure associated with the use of antibiotics, there is a possibility of indirect selection of transconjugants harbouring plasmid pSinA or its derivative. For this purpose, bi- or triparental mating is carried out using minimal MSM medium as the selection medium, and sodium arsenite as the sole compound for the selection of potential transconjugants. Subsequently, an identification of approx. 100-200 randomly selected colonies of potential transconjugants is performed. Identification of the appropriate strains is performed using the analyses described in Example 2A.

Example 3

Construction of the Paracoccus alcaliphilus Strain, Capable of Chemolithotrophic Arsenite Oxidation

[0081] The strains into which the plasmid pSinA was introduced (e.g. A. tumefaciens deposited as KKP2039p (D10)) can also be used to construct further strains capable of arsenite oxidation. In order to confirm this assumption, the A. tumefaciens D10 strain was used for the transfer of the plasmid pSinA to the Paracoccus alcaliphilus JCM7364R strain (Bartosik et al., 2002). This strain is incapable of arsenite oxidation and is susceptible to As (111) (1 mM of sodium arsenite inhibits its growth). As the method for introducing plasmid DNA, biparental mating, described in Sambrook and Russel (2001) was used.

Construction of the P. alcaliphilus Strain, Resistant to Kanamycin

[0082] Because the P. alcaliphilus JCM7364R. strain carries no phenotypic characteristics that allow for the application of an adequate selection pressure to eliminate the cells of the plasmid donor, genetic manipulations were performed, involving introduction of the plasmid pBBR1MCS2. (Kovach et al., 1995), carrying resistance to kanamycin, into the cells of the P. alcaliphilus JCM73641 strain. The A. tumefaciens KKP2039p (D10) strain that was used as the donor in conjugation, is susceptible to kanamycin, which allowed for the removal of the cells of the donor strain in conjugation.

[0083] The plasmid pBBR1MCS2 introduced beforehand, into Escherichia coli TG1 cells was introduced into the cells of the P. alcaliphilus JCM7364 strain using triparental mating, in which the pRK2013 helper plasmid (Ditta et al. 1980) (introduced into Escherichia coli TG1 cells, beforehand) was used. Conjugation was carried out according to Sambrook and Russel (2001), and LB medium supplemented with kanamycin (50 μg/ml), which eliminates the cells of the recipient, and with rifampicin (50 μg/ml), which allows for the elimination of the cells of the donor strain and of the strain harbouring the helper plasmid--in both cases Escherichia coli TG1, was used for the selection of transconjugants. The prepared donor cultures (E. coli TG1 with the pBBR1MCS2 plasmid), the helper strain (E. coli TG1 with the pRK2013 plasmid) and the recipient (P. alcaliphilus JCM364R) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB medium (Sambrook and Russel, 2001). After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and appropriate dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with kanamycin and rifampicin, and then incubated for 48h at 30° C. As a result of conjugation, transconjugants, derivatives of P. alcaliphilus JCM7364R harbouring the plasmid pBBR1MCS2, were obtained. For further analysis, one strain, named P. alcaliphilus PBBR-Km, was selected. The obtained strain was then used as the recipient strain in conjugation with A. tumefaciens D10 (deposited as KKP 2039p).

Introduction of the Plasmid pSinA of A. tumefaciens KKP 2039p (D10) to P. alcaliphilus PBBR-Km. Production of the Paracoccus alcaliphilus KKP 2040p (C10) Strain.

[0084] In order to introduce the pSinA plasmid into the cells of the constructed P. alcaliphilus PBBR-Km strain, triparental mating was applied (using the pRK2013 helper plasmid, introduced into E. coli TG1 cells). The A. tumefaciens D10 strain, capable of arsenite oxidation and resistant to As (III) (up to 15 mM) and susceptible to kanamycin was used as the donor. For the selection of transconjugants, LB medium supplemented with 2.5 mM As(III) and kanamycin (50 μg/ml) was used. The prepared cultures of the donor (A. tumefaciens D10 with the plasmid pSinA), the helper strain (E. coli TG1 with the pRK2013 plasmid), and the recipient (P. alcaliphilus PBBR-Km) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB medium. After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with kanamycin and sodium arsenite, and then incubated for 48 h at 30° C. Potential transconjugants were subjected to analyses analogous to those in Example 2A.

[0085] As a result of conjugation, P. alcaliphilus transconjugants harbouring the plasmid pSinA were obtained. For further analysis, the P. alcaliphilus C10 strain was chosen. This strain acquired the ability to oxidise arsenites and to use them as an electron donor (energy source) (FIG. 2B). In addition, this strain has increased its tolerance to As(III) (FIG. 2C). To verify whether the constructed strain stably maintains the plasmid, a series of passages (4-6 times) in media without selection pressure was performed. The obtained results showed that the constructed P. alcaliphilus C10 strain stably maintains the plasmid pSinA. After about 60 generations of growth in conditions without selection pressure (without arsenic) no plasmid-less cells were observed.

Example 4

Introduction of the Plasmid to the Cells of Indigenous Microflora of Arsenic Contaminated Environments by means of Bioaugmentation with Sinorhizobium sp. M14 Strain

[0086] In order to demonstrate that the plasmid pSinA can be used in bioaugmentation of indigenous microflora of arsenic contaminated environments, an experiment was conducted on two different soil samples coming from the gold mine area in Zloty Stok. The soil designated as ZP (I) came from the vicinity of the Zloty Potok and contained from 1149,3 to 1241 mg of As/kg of soil. The soil designated as PT (II) came from the vicinity of the Potok Trujaca and contained from 528 to 532 mg of As/kg of soil. The experiment was carried out for 60 days in microcosms, supplemented with 100 g of non-sterile soil, to which the Sinorhizobium sp. M14 strain was added. The soil not enriched with the M14 strain was used as the control. At the beginning of the experiment, and every 15 days, samples of soil were collected, and the bacteria were plated on solid MSM medium (Drewniak et al., 2008) with 5mM sodium arsenite. The grown cultures were passaged to LB medium with 5 mM As(III) and to liquid MSM medium with 5 mM of As(III). In order to verify whether the grown colonies (potential transconjugants) harbour the plasmid pSinA, the following analyses were performed: (i) physiological analysis to determine the ability to oxidize As(III) on the modified MSM medium; (ii) DNA-DNA hybridization (Southern blot) in order to identify pSinA plasmid genes in the genomes of potential transconjugants; (iii) PCR analyses, in order to identify plasmid pSinA genes in the genomes of potential transconjugants; (iv) visualization of plasmids and megaplasmids of potential transconjugants. For the hybridization analysis and PCR analysis, genes and primers presented in Table 2 were used.

[0087] After 60 days of cultivation, in both soil samples, transconjugants harbouring the plasmid pSinA were identified. Depending on the type of soil, transconjugants constituted for 25-40% of all arsenite-oxidising bacteria isolated from microcosms (FIG. 3). In Table 3 below, a list of identified strains, to which the plasmid pSinA has been introduced, has been presented.

TABLE-US-00003 TABLE 3 Taxonomic classification of the obtained soil transconjugants harbouring the plasmid pSinA Similarity to the sequences Name of Taxonomic group deposited in the GenBank the strain database (GenBank no) and identity [%] Soil transconjugants harbouring the plasmid pSinA, isolated from the soil ZP (I) SZP1 Alphaproteobacteria Ensifer adhaerens strain REG34 (EU647697.1) [100%] SZP2 Alphaproteobacteria Sinorhizobium sp. S1-2B (AY505137.1) [99%] SZP3 Alphaproteobacteria Sinorhizobium sp. TB8-2 (AY505141.1) [99%] SZP4 Gammaproteobacteria Pseudomonas marginalis strain LMG 2238 (HE586396.1) [97%] Soil transconjugants harbouring the plasmid pSinA, isolated from the soil PT (II) SPT1 Gammaproteobacteria Pseudomonas sp. PSA A4(4) (DQ628969.1) [97%] SPT2 Gaimmaproteobacteria Pseudomonas jessenii strain Gd4F (GU391474.1) [99%] SPT3 Gai,,aproteobacteria Pseudomonas sp. BIHB 813 (EF437218.1) [99%] SPT4 Alphaproteobacteria Brevundimonas sp. sp, CCBAU (JF772569.1) [99%] SPT5Gammaproteobacteria Pseudomonas sp. 0S8 (EF491958.1) [99%]

[0088] Among the transconjugants harbouring the pSinA plasmid, there are strains classified as Alpha- and Gammaproteobacteria. All the constructed strains were capable of arsenite oxidation and of using them as an electron donor (energy source), and stably maintained the plasmid pSinA (after about 60 generations of growth in a medium without selection pressure).

[0089] The obtained results indicate the possibilities of a horizontal transfer of arsenic metabolism genes using the plasmid pSinA. This plasmid can be transferred between species belonging to Alphaproteobacteria and Gammaproteobacteria due to the presence of a broad host range replication system and conjugational transfer system. Due to the presence of a set of genes responsible for the arsenite metabolism, the strains harbouring the plasmid pSinA are characterised by high tolerance to arsenic compounds and are capable of arsenite oxidation.

Example 5

Analysis of the Accumulations of Arsenic by the Strains Harbouring the Plasmid pSinA and Oxidation Performance Analysis

[0090] Oxidation performance analysis was carried out for the Sinorhizobium sp. M14, A. tumefaciens KKP 2039p (D10) and P. alcaliphilus KKP 2040p (C10) strains. Growth experiment and the performance analysis were carried out in MSM medium, enriched with arsenites as the sole source of energy, at 22° C. for 120 hours. From culture fluids, initially containing 5 mM (375 ppm) of sodium arsenite, samples were collected every 24 hours, and As(III) and As(V) content was determined (Drewniak et al., 2008),

[0091] The performance analysis of arsenite oxidation to arsenates revealed, that the initial Sinorhizobium sp. M14 strain completely oxidizes arsenites to arsenates, which are partially removed out of the cell, and partially accumulated inside the cell. Of the initial concentration of 388 mg/L, of As(III), after 120 hours of incubation, 155 mg/L of As (V) remained (FIG. 4), which, as the As (III) content was zero, indicates that part of arsenic is accumulated in/on the Sinorhizobium sp. M14 cells. In order to verify whether the Sinorhizobium sp. M14 strain accumulates arsenic, cells cultured in MSM medium supplemented with arsenites were observed under transmission electron microscope (TEM) and were subjected to X-ray analysis. It was observed that, in the M14 cells, circular granules of high electron density are present (FIG. 5). All the cells cultured in medium supplemented with arsenic contained at least two "granules" each, and more than 90% contained three to five of them. No granules were observed in the cells cultured in medium without the addition of arsenic. The conducted analysis showed that the granules present in the Sinorhizobium sp. M14 cells contain mainly arsenic, iron and molybdenum (FIG. 5)

[0092] Oxidation performance analysis of the A. tumefaciens KKP 2039p and P. alcaliphilus KKP 2040p strains showed, that both strains, after 120 hours of cultivation, completely oxidize arsenites to arsenates, all of which are removed out of the cell (FIG. 4). On the basis of the data obtained, it has been found that, unlike the Sinorhizobium sp. M14 strain, from which the plasmid pSinA originates, the Agrobacterium tumefaciens KKP 2039p, and Paracoccus alcaliphilus KKP 2040p strains, do not accumulate arsenic in their produced biomass and they show increased efficiency of oxidation of As (III) to As (V).

Example 6

Introduction of the Plasmid to the Cells of Indigenous Microflora of Arsenic Contaminated Environments by means of Bioaugmentation with the A. tumefaciens KKP 2039p (D10) Strain

[0093] In order to demonstrate that the newly constructed A. tumefaciens KKP 2039p strain and the plasmid pSinA introduced into its cells can be used in bioaugmentation of the indigenous microflora of arsenic contaminated environments, an experiment was conducted on soil samples coming from the gold mine area in Zloty Stok, designated as ZP (I). The experiment was carried out for 15 days in 100 ml of liquid MSM medium (Drewniak et al., 2008), supplemented with 10 g of non-sterile soil, to which A. tumefaciens KKP 2039p was added. After 15 days of incubation at room temperature, samples of soil were collected and the bacteria were plated on solid MSM medium with 5 mM sodium arsenite. The grown cultures were passaged to LB medium with 5 mM As(III) and to liquid MSM medium with 5 mM of As(III). In order to verify whether the grown colonies (potential transconjugants) harbour the plasmid pSinA, their ability to oxidize As(III) was tested in modified MSM medium. All strains [the donor (A. tumefaciens KKP 2039p) and potential transconjugants] capable of arsenite oxidation were then subjected to detailed analyses: (i) verification of the presence of the plasmid pSinA through the identification of plasmid pSinA genes (aoxB, repA, traI, orf12) in the genomes of potential transconjugants using PCR; (ii) identification of the donor strain (A. tumefaciens KKP 2039p) and transconjugants, by analysis of restriction fragments of 16S rRNA genes (iii) visualization of plasmids and megaplasmids of potential transconjugants. For PCR analysis, genes and primers presented in Table 2 were used. The frequency of plasmid pSinA transfer from the cells of A. tumefaciens KKP 2039p to the cells of indigenous bacteria is shown in FIG. 6.

Example 7

Introduction of the Plasmid to the Cells of Indigenous Microflora of Arsenic Contaminated Environments by means of Bioaugmentation with P. alcaliphilus KKP 2040p

[0094] In order to demonstrate that the newly constructed P. alcaliphilus KKP 2040p strain and the plasmid pSinA introduced into its cells can be used in bioaugmentation of the indigenous microflora of arsenic contaminated environments, an experiment was conducted on soil samples coming from the gold mine area in Zloty Stok, designated as ZP (I). The experiment was carried out for 15 days in 100 ml of liquid MSM medium (Drewniak et al., 2008), supplemented with 10 g of non-sterile soil, to which P. alcaliphilus KKP 2040p was added. After 15 days of incubation at room temperature, samples of soil were collected and the bacteria were plated on solid MSM medium with 5 mM sodium arsenite. The grown cultures were passaged to LB medium with 5 mM As(III) and to liquid MSM medium with 5 mM of As(III). In order to verify whether the grown colonies (potential transconiugants) harbour the plasmid pSinA, analyses were carried out as in Example 6. The frequency of plasmid pSinA transfer from the cells of P. alcaliphilus KKP 2040p to the cells of indigenous bacteria is shown in FIG. 6.

Example 8

Construction of the Vector Carrying a Gene Module Coding for the Proteins Involved in Arsenite Oxidation and its use for the Production of Strains Capable of Oxidizing Arsenites

[0095] In order to demonstrate, which genes located on plasmid pSinA (SEQ ID NO: 1) encode proteins responsible for arsenite oxidation, the aio module, comprising aioXSRABmoeA genes, was cloned in the vector pBBR1-MCS2 (Km^r), in the Escherichia coli TOP10 strain, and then its functionality was tested.

[0096] In order to clone the aio module, amplification of a DNA fragment of the size 10077 by (comprising the region from position 24376 to 34453 in the genome of pSinA.) was performed on a DNA template of the plasmid pSinA, isolated by alkaline lysis. For PCR reaction, the following oligonucleotides were used as primers:

[0097] AIOf_XbaI: ggtggctctagaCAGCGGCTTCACACATAGTCCCCAG [position in the genome of plasmid pSinA: 24376-24400; the underlined sequence is the restriction site recognized by the enzyme XbaI (TCTAGA)], and

[0098] AIOr_Bsu15: ggtaTCGATGCACCCACGATGGCGAGAG [position in the genome of plasmid pSinA: 34430-34453; the underlined sequence is the restriction site recognized by the enzyme BsuRI (ClaI) (ATCGAT)] For the amplification, Phusion® High-Fidelity DNA Polymerase (Thermo Scientific) was used.

[0099] The obtained PCR product (10077 bp) was cloned into a plasmid vector: pBBR1MCS-2 (Km^r) (Kovach et al., 1995) digested (linearized) with SmaI. The ligation mixture of the PCR product and the vector pBBR1MCS2 digested with the enzyme SmaI (CCC↓GGG) was introduced, by means of chemical transformation, using the calcium-rubidium method according to Kushner (1978), into the cells of Escherichia coli Top10 strain [mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU gal/K rpsL endA1 nupG]. As the selection medium, complete LB medium with kanamycin (30 μg/ml), IPTG (0.5 μg), and X-gal (40 μg/ml) was used.

[0100] From the pool of the obtained transformants (white colonies resistant to kanamycin) strains that were harbouring a plasmid of the appropriate size: 15221 by [pBBR1MCS2 (5144 bp)+aio module--(10077 bp)] were selected. The presence of the constructed plasmid was confirmed by electrophoretic analysis and sequencing. The Escherichia coli AIO strain (derivative of the E. coli TOP10 strain), harbouring the plasmid pAIO1 (derivative of pBBR1MCS2 with cloned aio module), was selected for further analysis.

[0101] In order to demonstrate that the constructed plasmid pAIO1 can be used for constructing strains capable of arsenite oxidation, the plasmid pAIO1 was introduced into 5 strains belonging to Alphaproteobacteria, Betatproteobacteria and Gammaproteobacteria. For the construction, the following strains were selected:

[0102] (i) Agrobacterium tumefaciens LBA288 and Paracoccus aminovorans JCM7685 (Alphaproteobacteria) as well as Stenotrophomonas sp. LM24R. (Gammaproteobacteria) incapable of arsenite oxidation and susceptible to As (III) (1 mM of sodium arsenite inhibits the growth of these strains),

[0103] (ii) Brevundimonas sp. OS24R (Alphaproteobacteria) and Pseudomonas sp. OS29R (Gammaproteobacteria) incapable of arsenite oxidation, but resistant to As (III).

[0104] As the method for introducing plasmid DNA, triparental mating, described in Sambrook and Russel, 2001, was used. The E. coli AIO strain, harbouring the plasmid pAIO1, carrying the genes for arsenite oxidase and determining kanamycin resistance, was used as the donor. The prepared cultures of the donor (E. coli AIO with the plasmid pAIO1), the helper strain (E. coli TG1 with the plasmid pRK2013) and the recipient (A. tumefaciens LBA288, P. aminovorans JCM7685, Stenotrophomonas sp. LM24R, Brevundimonas sp. OS24R, and Pseudomonas sp. OS29R) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB. After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and appropriate dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with kanamycin (50 μg/ml), which eliminates the cells of the recipient, and rifampicin (50 μg/ml), which allows for the elimination of the cells of the donor strain and of the strain harbouring the helper plasmid. They were subsequently incubated for 48 h at 30° C. Potential transconjugants were subjected to the following analyses:

[0105] (i) verification of the restriction pattern of 16S rRNA genes [isolation of DNA, amplification of 16S rRNA genes using primers 27F and 1492R (Lane, 1991), digestion with the restriction enzyme HaeIII, DNA electrophoresis],

[0106] (ii) analysis for the presence of the plasmid pAIO1in the transconugant cells (alkaline lysis and visualization during DNA electrophoresis),

[0107] (iii) PCR analysis for the presence of arsenite oxidase genes (DNA amplification using primers aoxBF and aoxBR, and electrophoretic analysis of DNA),

[0108] (iv) physiological analysis to determine the ability to oxidize As (III) in modified MSM medium (Drewniak et al., 2008) according to the description presented in Example 2A.

[0109] In all the conjugations, transconjugants harbouring the plasmid pAIO1 were obtained. Physiological analysis with the AgNO₃ test revealed that all derivatives of the wild-type strains, previously incapable of arsenite oxidation, acquired the ability to oxidize arsenites with the introduction of the plasmid pAIO1 [all strains oxidized As(III) to As(V) and a brown precipitate formed in the reaction with AgNO₃].

[0110] In order to confirm that the newly constructed strains, harbouring the plasmid pAIO1, are capable of arsenite oxidation, an analysis of As(III) oxidation efficiency was carried out, on the example of Agrobacterium tumefaciens AIO1 (derivative of A. tumefaciens LBA288 harbouring the plasmid pAIO1) and Paracoccus aminovorans AIO2 (derivative of P. aminovorans JCM7685 harbouring the plasmid pAIO1). Wild-type strains were used as the control. The growth experiment and the performance analysis were carried out in MSM medium, enriched with arsenites as the sole source of energy, and with 0.004% yeast extract as the source of vitamins, at 30° C. for 96 hours. From culture fluids, initially containing 2 mM (150 ppm) of sodium arsenite, samples were collected every 24 hours, and As(III) and As(V) content was determined (Drewniak et al., 2008).

[0111] The performance analysis of oxidation of As(III) to As(V) (FIG. 7) revealed, that the strains harbouring the plasmid pAIO1 are capable of complete arsenite oxidation and production of arsenates already within 72 hours from the beginning of the culture. On the other hand, wild-type strains deprived of the plasmid pAIO1 are not capable of growth d arsenite oxidation, and thus, of producing arsenates.

[0112] The conducted experiments made it possible to confirm that the derivative of the plasmid pSinA, comprising the aio module (sequence from 24376 to 34453) can be used for constructing strains capable of arsenite oxidation.

Example 9

Construction of a Vector Carrying the Gene Module Coding for the Proteins Involved in Resistance to As (III) and its use for the Production of Strains Resistant to Arsenic

[0113] In order to demonstrate, which genes located on the plasmid pSinA (SEQ ID NO: 1) encode proteins responsible for the resistance to arsenites, the ars module, comprising arsR1C1C2BtrkAmsfarsHarsR2 genes, was cloned in the vector pBBR1-MCS2 (Km^r), in the Escherichia coli TOP10 strain, and then its functionality was tested.

[0114] In order to clone the ars module, amplification of a DNA fragment of the size 7544 bp (comprising the region from position 43229 to 50772 in the genome of pSinA) was performed on a DNA template of the plasmid pSinA, isolated by alkaline lysis. For PCR reaction, the following oligonucleotides were used as primers:

[0115] ArsF_Bsu15: ggtggtATCGATGAAAAGCAGGCAGAGGCC [position in the genome of the plasmid pSinA: 43229-43523; the underlined sequence is the restriction site recognized by BsuRI (ClaI) (ATCGAT), that is present in the sequence of plasmid pSinA, while the sequence not present in plasmid pSinA was indicated by lower-case letters], and

[0116] AsR_Xba: gtttctgag ACACTTCTTGACGTAGCCGCAACTAACTC [position in the genome of plasmid pSinA: 50744-50772; the underlined sequence is the restriction site recognized by the enzyme XbaI (TCTAGA)] For the amplification, Phusion® High-Fidelity DNA Polymerase (Thermo Scientific) was used.

[0117] The obtained PCR product (7544 bp) was digested with the enzymes Bsu15I and XbaI, and subsequently, was cloned into the vector pBluescriptKSII(+) (Stratagene) previously cleaved with the restriction enzymes Bsu15I and XbaI. The ligation mixture of the PCR product and the vector pBluescriptKSII(+) was introduced, by means of chemical transformation, using the calcium-rubidium method according to Kushner (1978), into the cells of Escherichia coli TOP10F'strain: F'{lacIqTn10(TetR)}mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK, rpsL endA1 nupG. As the selection medium, complete LB medium with ampicillin (150 μg/ml), IPTG (0.5 μg), X-gal (40 μg/ml) was used. From the pool of the obtained transformants (white colonies resistant to ampicillin), the strains that were harbouring a plasmid of the appropriate size: 10456 bp (pBluescriptKSII(+)--2912+ars module-7544 bp) were selected. The presence of the constructed plasmid was confirmed by electrophoretic analysis and sequencing. The Escherichia coli ARS1 strain (derivative of E. coli TOP10F' strain) harbouring the plasmid pKS_Ars (derivative of pBluescriptKSII with cloned ars module), was selected for further analysis.

[0118] As the use of the plasmid pBluescriptKSII is limited to the strains of Escherichia coli as the only host, ars module was cloned into the broad-host-range plasmid pCM62, carrying resistance to tetracycline (Marx and Lindstrom, 2001). For this purpose, the plasmid pKS_Ars (isolated from Escherichia coli ARS1 by alkaline lysis) was digested with the restriction enzymes VspI, XbaI. Subsequently, the obtained DNA fragment of the size of 7742 bp, containing the module ars, was cloned into the vector pCM62 previously digested with the enzymes VspI and XbaI. The ligation mixture of the DNA fragment of the plasmid pKS-Ars (containing the ars module) and the vector pCM62 was introduced, by means of chemical transformation, into the cells of Escherichia coli TOP10F strain [F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(Str^R) endA1 λ.sup.-]. As the selection medium, complete LB medium with tetracycline (10 μg/ml) was used. From the pool of the obtained transformants (colonies resistant to tetracycline), the strains that were harbouring a plasmid of the appropriate size: 14407 bp (pCM62-6863 bp+ars module-7544 bp) were selected. The presence of the constructed plasmid was confirmed by electrophoretic analysis and sequencing. The Escherichia coli ARS2 strain (derivative of E. coli TOP10F strain) harbouring the plasmid pARS1 (derivative of pCM62 with cloned ars module), was selected for further analysis.

[0119] In order to demonstrate that the constructed plasmid pARS1 can be used for constructing strains with increased resistance to arsenic, the plasmid pARS1 was introduced into Agrobacterium tumefaciens LBA288, susceptible to As (III) (1 mM of sodium arsenite inhibits the growth of LBA2888 cells), Paracoccus aminophilus JCM7686 showing low resistance to As(III) (5 mM of sodium arsenite inhibits the growth of the cells of the JCM7686 strain), and Brevundimonas sp. OS24R showing high resistance to As (III) (10 mM of sodium arsenite inhibits the growth of OS24R cells). As the method for introducing plasmid DNA, triparental mating, described in Sambrook and Russel, 2001, was used. The E. coli ARS1 strain, which harbours the plasmid pARS1, carrying the genes for arsenite oxidase and determining resistance to tetracycline, was used as the donor. The prepared cultures of the donor (E. coli ARS1 with the plasmid pARS1), the helper strain (E. coli TG1 with the plasmid pRK2013) and the recipient (Agrobacterium tumefaciens LBA288, Brevundimonas sp. OS24R, P. aminophilus JCM7686) were mixed in a ratio 1:1:2, and then 100 μl of the mixture were plated on LB. After 24-hour incubation at 30° C., bacterial colonies were washed off the surface of the petri dish with 2 ml of saline solution, and appropriate dilutions (10⁰-10^-3) were plated on selective LB medium, supplemented with tetracycline (10 μg/ml), which eliminates the cells of the recipient, and rifampicin (50 μg/ml), which allows for the elimination of the cells of the donor strain and of the strain harbouring the helper plasmid. They were subsequently incubated for 48 h at 30° C. Potential transconjugants were subjected to the following analyses:

[0120] (i) verification of the restriction pattern of 16S rRNA genes [isolation of DNA, amplification of 16S rRNA genes using primers 27F and 1492R (Lane, 1991), digestion with the restriction enzyme HaeIII, DNA electrophoresis],

[0121] (ii) analysis for the presence of the plasmid pARS1 in the transconjugant cells (alkaline lysis and visualization during DNA electrophoresis),

[0122] (iii) PCR analysis for the presence of cytoplasmic arsenate reductase genes [DNA amplification using primers ParsH-L (TGACGTAGCCGCAACTAACT--position in the genome of pSinA:50745-50764) and ParsH-P (TGGCTTGTGCGAATAAG--position in the genome of pSinA: 50155-50174) and electrophoretic analysis of DNA].

[0123] In all the conjugations, transconjugants harbouring the plasmid pARS1 were obtained. To confirm that the newly constructed strains, harbouring the plasmid pARS1, have an increased resistance to arsenic, analysis of MIC--minimal concentration of As(III), inhibiting the growth of the following strains: Agrobacterium tumefaciens ARS3 (derivative of A. tumefaciens LBA288 harbouring the plasmid pARS1), Brevundimonas sp. ARS4 (derivative of Brevundimonas sp. sp. OS24.P. harbouring the plasmid pARS1), P. aminophilus ARS5 (derivative of P. aminophilus JCM7686 harbouring the plasmid pARS1) was carried out. Wild-type strains were used as the control. Growth experiment and MIC analysis for As(III) was carried out in LB medium, with various concentrations of sodium arsenite (up to 20 mM). After 48 h of cultivation at 30° C., optical density of cultures at OD₆₀₀ nm was monitored. The conducted analysis revealed that all the investigated strains harbouring the plasmid pARS1 increased their tolerance to the presence of sodium arsenite, in relation to their related wild-type strains (FIG. 8). MIC for As(III) for A. tumefaciens LBA288 strain was 1 mM, while for its derivative, comprising the plasmid pARS1, 20 mM; for P. aminophilus JCM7686R strain 5 mM, while for its derivative, containing the plasmid pARS1, 20mM. In turn Brevundinumas sp. OS24R could tolerate the maximum of 10 mM of As(III), and its derivative harbouring the plasmid pARS1 was resistant to 20 mM of As(III). The conducted analyses allowed to confirm that the derivative of the plasmid pSinA, comprising the ars module (sequence from 43229 to 50772) can be used for constructing strains with increased resistance to arsenic.

[0124] In the presented embodiments, the inventors have demonstrated the possibility of using a natural, genetically unmodified plasmid pSinA of its functional derivatives for constructing strains capable of arsenite oxidation, particularly preferably strains not accumulating arsenic compounds. Novel strains were produced: Agrobacterium tumefaciens (D10), deposited under the number KKP 2039p and Paracoccus alcaliphilus (C10) deposited under the number KKP 2040p, which do not accumulate arsenic, and do not store it in their produced biomass, and are characterized by an increased efficiency of oxidation of As (III) to As (V). It was unexpectedly found, that the use of the pSinA plasmid or its functional derivatives is not limited to strains originally capable of arsenite oxidation. Strains that are completely incapable of arsenite oxidation, acquire this ability with the acquisition of the pSinA plasmid. Introduction of the plasmid pSinA into the cells of the host, ensures their acquisition of resistance to arsenites and arsenates, as well as to other heavy metals.

[0125] Moreover, it was demonstrated, that the application of the Agrobacterium tumefaciens KKP 2039p, Paracoccus alcaliphilus KKP 2040p or Sinorhizobium sp. M14 strains, and other strains harbouring the plasmid pSinA, in the removal of arsenic by in situ methods and based on oxidation of As (III) to As (V), ensures the stability of this process. If the introduced strains will not be able to survive in the new conditions, then through the horizontal gene transfer they will pass the plasmid to the cells of indigenous microflora, and this, in turn, will ensure their capability of arsenite oxidation in a specific environment.

[0126] It was also demonstrated that the nucleotide sequence corresponding to nucleotides 24376-34453 in SEQ ID NO: 1 or its functional derivative, which contains the aio module of pSinA, gives the bacterial strains, to which it was introduced, the ability to oxidize arsenites and/or produce arsenates, and therefore this derivative of the plasmid pSinA can be used for producing bacterial strains, which after the introduction of such a sequence acquire the ability to oxidize arsenites and/or produce arsenates and can be used in applications that require such strains.

[0127] It was also demonstrated that the nucleotide sequence corresponding to nucleotides 43229-50772 in SEQ ID NO: 1 or its functional derivative, which contains the ars module of pSinA, gives the bacterial strains, to which it was introduced, an increased resistance to arsenic, and therefore this derivative of the plasmid pSinA can be used for producing bacterial strains, which after the introduction of such a sequence increase their resistance to arsenic and can be used in applications that require such strains.

LITERATURE CITED IN THE DESCRIPTION, INCLUDED HEREIN AS REFERENCES

[0128] Bartosik, D., Baj, J., Piechucka, E., Waker, E., and Wlodarczyk, M. 2002. Comparative characterization of repABC-type replicons of Paracoccus pantotrophus composite plasmids. Plasmid 48: 130-141

[0129] Chwirka J. D., B. M. Thomson and J. M. Stomp. 2000, Removing arsenic from groundwater. J. Am. Water Works Assoc, 92:79-88.

[0130] Ditta G,, S. Stanfield, D. Corbin i D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-51.

[0131] Drewniak, L., 2009. Characterization of arsenic bacteria isolated from Zloty Stok gold mine. PhD thesis. Laboratory of Environmental Pollution Analysis, University of Warsaw. Warsaw

[0132] Drewniak, L., Matlakowska, R., Sklodowska, A., 2008. Arsenite and arsenate metabolism of Sinorhizobium sp. M14 living in the extreme environment of the Zloty Stok gold mine. Geomicrobiology Journal 25 (7-8), 363-370.

[0133] Drewniak, L., Matlakowska, R., Rewerski, B., Sklodowska, A., 2010. Arsenic release from gold mine rocks mediated by the activity of indigenous bacteria. Hydrometallurgy 104, 437-442.

[0134] Driehaus W., R. Seith and M. R. Jekel 1995. Oxidation of arsenic(III) with manganese oxides in water treatment. Water Res. 29:297-305.

[0135] Hooykaas, P. J. J., den Dulk-Ras, H, Schilperoort, R. A. 1980. Molecular mechanism of Ti plasmid mobilization by R plasmids: isolation of Ti plasmids with transposon-insertions in Agrobacterium tumefaciens. Plasmid 4: 64-75.

[0136] Kostal J., R. Yang, C. H. Wu, A. Mulchandani and W. Chen. 2004. Enhanced arsenic accumulation in engineered bacterial cells expressing ArsR. Appl. Environ. Microbiol, 70:4582-7.

[0137] Kovach M. E., Elzer R. H., Hill D. S., Robertson G. T., Farris M. A., Roop R. M. and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176

[0138] Lievremont D., A. N'Negue M, P. Behra and M. C. Lett. 2003. Biological oxidation of arsenite: batch reactor experiments in presence of kutnahorite and chabazite. Chemosphere 51:419-28.

[0139] Pattanayak J., K. Mondal, S. Mathew and S. B. Lalvani. 2000. A parametric evaluation of the removal of As(V) and As(III) by carbon-based adsorbents. Carbon 38:589-596.

[0140] Sambrook, J., Russell, D. W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.

[0141] Simeonova D. D., K. Micheva, D. A. Muller, F. Lagarde, M. C. Lett, V. I. Groudeva and D. Lievremont, 2005. Arsmite oxidation in batch reactors with alginate-immobilized ULPAs1 strain. Biotechnol. Bioeng. 91:441-6.

[0142] Tripathi R. D., S. Srivastava, S. Mishra, N. Singh, R. Tuli, D. K. Gupta and F. J. Maathuis. 2007. Arsenic hazards: strategies for tolerance and remediation by plants. Trends Biotechnol. 25:158-65.

[0143] Wilkie J. A. and J. G. Hering. 1998. Rapid oxidation of geothermal arsenic(III) in streamwaters of the eastern Sierra Nevada. Sci. Technol. 657-662..

[0144] Yang C. Xu L, Yan L. Xu Y. (2010) Construction of a genetically engineered microorganism with high tolerance to arsenite and strong arsenite oxidative ability. J Environ Sci Health A Tox Hazard Subst Environ Eng.; 45(6):732-7.

[0145] The invention is further described by the following numbered paragraphs:

[0146] 1. A novel strain Agrobacterium tumcfaciens deposited in the IAFB Collection of Industrial Microorganisms of Institute of Agricultural and Food Industry under the number KKP 2039p.

[0147] 2. A novel strain Paracoccus alcaliphilus deposited in the The IAFB Collection of Industrial Microorganisms of Institute of Agricultural and Food industry under the number KKP 2040p.

[0148] 3. A plasmid pSinA shown in SEQ ID NO: 1 and its functional derivative.

[0149] 4. A method for producing bacterial strains capable of chemolithotrophic arsenite oxidation, comprising the following steps:

[0150] a) obtaining the recipient strain;

[0151] b) introduction of the plasmid pSinA, shower SEQ ID NO: 1, or its functional derivative into the recipient strain.

[0152] 5. The method according to paragraph 4, characterized in that, the step b) is carried out by:

[0153] (i) triparental mating with the use of a donor strain harbouring the plasmid pSinA, shown in SEQ ID NO: 1 or its functional derivative, and a helper strain harbouring a helper plasmid, or,

[0154] (ii) biparental mating with the use of a donor strain harbouring the plasmid pSinA shown in SEQ ID NO: 1 or its functional derivative.

[0155] 6. The method according to paragraph 4 or 5, characterised in that the donor strain is Agrobacterium tumefaciens deposited under the number KKP 2039p or Paracoccus alcaliphilus deposited under the number KKP 2040p.

[0156] 7. The method for producing bacterial strains according to paragraph 4, wherein in the step a) of the obtaining the recipient strain, a gene encoding a selection marker is additionally introduced into the recipient strain, preferably encoding antibiotic resistance.

[0157] 8. The method for producing bacterial strains according to paragraph 7, wherein the gene encoding the additional selection marker is introduced on a plasmid, preferably by triparental mating with a bacterial strain harbouring the plasmid containing the gene encoding the additional selection marker and with a helper strain harbouring a helper plasmid.

[0158] 9. The method according to claims 4-8, wherein the recipient strain is a bacterial strain isolated from natural environment, preferably from arsenic contaminated environment.

[0159] 10. The method according to claims 4-9, wherein the recipient strain is a bacterial strain belonging to Alphaproteobacteria or Gammaproteobacteria.

[0160] 11. A novel bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to claims 4-10.

[0161] 12. A composition comprising the novel bacterial strain according to claims 1-2, the novel bacterial strain according to paragraph 11, the plasmid according to paragraph 3 or combination thereof.

[0162] 13. Use of the novel bacterial strain according to claims 1-2, the novel bacterial strain according to paragraph 11, the plasmid according to paragraph 3, the composition according to paragraph 12, or combination thereof, for constructing bacterial strains capable of chemolithotrophic arsenite oxidation.

[0163] 14. Use of the novel strain according to claims 1-2, the novel bacterial strain according to paragraph 11, the plasmid according to paragraph 3, the composition according to paragraph 12, or combination thereof, in the processes of biological removal of arsenic.

[0164] 15. The use according to paragraph 14, characterised in that, the biological removal of arsenic comprises bioremediation, preferably bioaugmentation or biometallurgy of arsenic.

[0165] 16. A method of bioaugmentation of arsenic contaminated environment, comprising the step of introducing the novel strain according to claims 1-2 or 11, the plasmid according to paragraph 3, the composition according to paragraph 12, or combination thereof, into an arsenic contaminated environment.

[0166] 17. A method for the removal or recovery of arsenic by chemolithotrophic arsenite oxidation, wherein the step of chemolithotrophic arsenite oxidation is carried out by the novel strain defined in claims 1-2, the novel strain defined in paragraph 11, the composition defined in paragraph 12, or combination thereof.

[0167] 18. The method for the removal or recovery of arsenic according to paragraph 17, wherein the step of chemolithotrophic arsenite oxidation is followed by precipitation of the resulting arsenates in the form of insoluble precipitate and/or adsorption of arsenates, wherein the precipitation or adsorption is preferably carried out using burnt lime (CaO), calcium hydroxide Ca(OH)₂, bog iron ores or combination thereof.

[0168] 19. A plasmid comprising the nucleotide sequence corresponding to nucleotides 24376-34453 in SEQ ID NO: 1 or a functional derivative thereof.

[0169] 20. A bacterial strain comprising the plasmid. defined in paragraph 19 or the nucleotide sequence comprising the fragment 24376-34453 of SEQ ID NO: 1 or a functional derivative thereof.

[0170] 21. Use of the plasmid defined in paragraph 19 or the strain defined in paragraph 20 for arsenite oxidation.

[0171] 22. A plasmid comprising the nucleotide sequence corresponding to nucleotides 43229-50772 in SEQ ID NO: 1 or a functional derivative thereof.

[0172] 23. A bacterial strain comprising the plasmid defined in paragraph 22 or the nucleotide sequence comprising the fragment 43229-50772 of SEQ ID NO: 1 or a functional derivative thereof.

[0173] 24. Use of the plasmid defined in paragraph 22 or the nucleotide sequence comprising the fragment 43229-50772 of SEQ ID NO: 1 or a functional derivative thereof for the production of a strain with increased resistance to arsenic.

[0174] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.

Sequence CWU 1

1

11108938DNASinorhizobium sp. 1aagtcggaga gacggcctgt cggcgtcttg aatatttgcg aacagattgt aagggaagga 60gattttggac gggaatttat accaggctaa atctctggaa acgttgaaaa aaaaggcggc 120acagtttgtt gcatcaaaat gcgttaaggt tttgttaacc ctatttctct tgcggacaga 180cgggaatcgt gcgctatctt cagacggtaa tagcgcgtct gacgctgata aaccgtcttg 240aacctgaggc taaagtgaac gtgatcgaca ggcacatcag tagggcagca acgtccgcac 300atattacgca gcgcgcggaa gctctatccg cgagactccg tgcggtcggt gaacgcgcct 360ttcccccgac cgcgcagaag tcgcttcggt cgttcacctc tggggaggta gccgagatcg 420ttggtgtttc ggatggctac ctgcgtcaac tctccctgga tggcctcggc ccggcacctg 480atatcgggac cggtggccga cgctcctata cacttgaaca aatcaatggc ttgcggcagt 540acctcgccga ggcacgcccc aaggaagcag tgcgtttctg gccccgtcgc cgggagggtg 600aaaaacttca aatcatcact gtcgccaatt ttaagggtgg ctcggccaag accacgacat 660ctctatatct cgcgcagggt ctggcgctcc agggttatcg agtccttgcc atagatcttg 720atccccaggc ctcgctctcc gcgatgtttg gttatcagcc ggaattcgat gttgcggaga 780ataccacgat atacggcgcc atcaggtatg atgaccagcg tgtggcgatg aaagatgtga 840tccgcaagac ctacttcacg ggcattagca tcgttcccgg caatcttgag ctgatggagt 900ttgagcatca gaccccgcga tttatgcttc agaaccgagg acggccagaa gatttgtttt 960tcaggcgtgt cgcaagcgcc attgatcagg tcaaagacga gtacgacatt gtcgttgttg 1020actgccctcc tcagcttggc ttcctcacca tgggtgctct gaatgcagcg acaggaatga 1080ttgtcaccgt ccacccacaa atggtggacg tagcttccat gagccaattt ctcctaatga 1140cgtccgatct tgtctccgta atcgaagagg cgggaggtaa gctcgactat gattttctga 1200ggttccttgt gacccgccat gatccccgag atgtacctga acaggaaatc gtcggtttac 1260ttcgggacgt attcggtacc gatgtgatgg ctgcggcagc atggaaatcg accgcgattg 1320ctaatgccgg tttgaccaag caatctcttt acgagttgtc gcgtggcgcg gtcggtcgat 1380cgacctatga tcgagcgatg gaatccatca gtgccgtgaa tcacgaagct gtcggcctaa 1440tcaatgaagt gtggggtaga tgatggtgct ccactctcaa aagaatcaat cgcttaactt 1500gttgtcagct gacgacgtga tgtcgtcggg gctagtagtt aaacgttctg attggggaaa 1560tgatagatga gcaaacggac tcaatcagtt cgcaatctct ttgccgcagg gcctgatgag 1620gcgccgaccg tggacacacg tcaaccaatg cagcgcgtag cttcaggagc ggttcggtcg 1680ttgaaggaca ctttttcgga agttgagagg gactacgaag aactcaagca aaaagttgct 1740gacggcgctc ttccgattga cctcgatccg tctcttatcg acccatcccc cttcgccgat 1800cgttttgcgg atcaggatgc ttcggctgtc gaagctctca aagcctcttt ccttgagcac 1860gggcaagaaa taccaattct agtacgggct catccgactg agattggccg ttatcagatt 1920tcttatggcc atcgtcgcgt acgagctgcc actgagcttg gtcttaaggt caaggcttac 1980gtgcgcgaac ttagtgacga tcgccttgct gtcgcccaag gcattgaaaa ttcagctcgt 2040gaagatctta cttttataga gcgttcaatg ttcgcgctga aactcgagga aggcgggttt 2100gagaggactc tcattcaaac cgcgttgtcg gttgatcggc aggaagcatc caagctcatc 2160agcgtaggcc gcgcagttcc tggttggctg gccgaagcga taggccgggc tccgaagata 2220ggtcgcccgc ggtggcagga gcttgctgac ggtctgaaaa atgcaggagc ggaaagcaaa 2280gcgcgcaagg ctacaactga caagtctttt ggtcacaaga cttccgatga tcgctttatc 2340gcggttcttc gcgcgataaa ggcgatagat agaccgagcg cggaaaagac gccggtactt 2400tccgcaaagt ctgccgaggg tactaagatc gctaccctcg cggtctccgg cagggtttgt 2460aaaattgaga ttgatagaga tcgggacgag gcgtttgcca agttcgtgat ggatcgaatt 2520cctgatcttt acgagaaatt ccggcagacc gagcccggat ccgaaggtta gagaaggaag 2580aaaccgcaaa agaaaaaggc ccccaaacgt tgccgtcgtg gaagcctctc tcattggtct 2640aagcagcctg agaatcgcat ttccatgaat cccagtcaat agtctttggc accgatttgg 2700tgagctgatt ccttttgccg atcgaaaggt gaaagaaaaa tgcgaagtgg aagtgtaacg 2760acgccattcg ggcggcggcc gatgacgctt gcgttggtca ggacccaatt ccaggcagcg 2820gacatccgta agggaaaagt tgcggacaaa tggaaagtat accgcgatgc ctgcgaagca 2880cgcgcgctac ttggcctgcg cgatagagcg cttgctgtgc tcaacgctct cctgtcgttt 2940tatccagaga cggacctcag cgaagatgcg aaccttgtgg tctttccgtc taatgctcaa 3000ctgagcgcac gagcgaacgg catcgcgggc acgactctga gagagaactt ggctgtattg 3060gtgggtgccg gactgataaa tcgtaacgac agtcccaatg gtaaacgcta cgtgagacgt 3120ggcaaggacg gcgaggtgga gacagcatat gggttcagtc ttgccccatt gcttgcgagg 3180gcggaagaac ttgctctcat ggcgcagcgg gtggccgagg aggcacgacg cttcaaggta 3240gttaaggagc ggacgactat tgcgcgcagg gacgtgcgta agcttatcac ggctgctgtt 3300gaagatggtg cgcctggcga ctgggcgacg atggagacaa tctacatagg ggccgtagca 3360aggcttcgga ccgccaagtc gattgaggcc cttgaatcga tcctggacga actagaacta 3420ttgcgcgaag gtgtactcag cgtattggaa agcaacatct tttcacaaaa aaccgctacc 3480aatgacaacg aaatccgtca gcacatacag aattcaaata ccgaatctat aaatgaattt 3540gaacctagct cagaaaaaga gcagggtggg aaaccgatgt tgaagtcaga ccgactggcc 3600gagccgctaa agagtttccc tattggtttg gtgatgcgag catgccctga aattgcggcc 3660tatgcgcctg gaggccaggt ccagagttgg agggacttga tgtccgcggc agtcgtggtt 3720cggtcgacct tgggagtaag cgcttcagct tatcaggatg cttgcgaggc aatgggcgca 3780gagaatgcgg ccgtcgcgat ggcggcgata cttgagcgag ctgggcacat caattccgct 3840ggtggctatc tccgcgatct tacctccaga acgcgccgcg gtgaattttc gctcggcccg 3900atgataatgg cgcttttgaa agtgaactct ggcggggcta taagtgcgtg atgttcccga 3960taccaggagc tttcggaagc cgtcgattgt agtcagctga ctacaaacta accccctgtt 4020gcagctaagg tttcttaatc acctgcgacg tccatattca ggagtcaaaa cagacgtttg 4080caactgaaat agacgaacgt atttcgaaag tggtaccagc ggtccttttt tccgccgcgc 4140ggtagggtag atagaagctt cagattgctt tgggaaacag agcggcgaaa tgcgcgttga 4200gcatgacctt cgtttatcag ctcgtttttc ccaacgccac ggaaatacgg tttcagtgaa 4260catgctgcca ttgccgtccg gaggacgacg gttcccttat aacaatcgcg tagcccggcc 4320gctccgacgg gtcgcgttgt tgtagtagct tgacgcctgc tgcaccgatc ggtggcgcga 4380ctgctccatc gcctccggca aaggaacgcc ccggtttgcg gcttcggtca aatagcccga 4440ccgcaacccg tgcgcggaaa actcccccgc ctccagcccg gccatcgtcg cccgctgttt 4500gacaatatcg ttgatcgcct tcggatcgag cgcccgacgg gaaacattcc cccagcgatc 4560aatcgcccga aacacactgc cactttcaat cttggcggca acaagccagg cgctcagggc 4620atcaaccggc cggccggtca gaaagacaac ttcatcgctg tcgccgctgc tggtctttgt 4680gcggccgaga tggattgaca gcgagggcag gggagccccg ccctcaacgg cgatcggcgg 4740ctcagtcgtc aactgttccc tgcgcagccc ggcaatctcg ctgcgacggc gcccacccga 4800cgcaaagcca accatcagga tggcgcgatc gcggatgtca cgaaggctct cgctggcaca 4860agtggctagc atttttgcca tgatgtctcc agtgaccgcc ttggcgctct tgcggcggcg 4920ttggcgtggc acggcacgaa cggcgagccg gattgcggac ttaagggcag gggaggcaaa 4980agcgccgtcg aaaccgcgcc acttggtcag tgtcgaccag ttggccagac gccggcgcac 5040ggtatcgggc gcgtgcggcc cggttgatct gagaaagccg ccatctcgaa gggcctggtc 5100aacctcagcc ggcatgccat ggtccggatc ggtttcgcgc ctcgctgggt cccagaggtg 5160atgggcgaca aacttaagga gcagcgcctc gggcgccggc cagggaaggg cgccgccagt 5220cgcggcgtgc gaccaggctt cgagatagcc gagatcggag gtcaacgccc gcagcgtatt 5280ctcacccata ccttcgttga tcaggtgacg cagggtctcg acgtcctggt cggtcaggat 5340ttcggcaagc ttgtcacgtc ggtcgatcgg cagcaccgac gcgatggtgt cgagctgttc 5400ggcgcggttt aaaacattct gggtgacaga cgataccgac aaggtctttt tcgtcatagg 5460acctgtccaa tgctaaatgt gcgtttgcaa aagttacgga aagcccgtat attccggaac 5520aaaggagttc tgccatgacc tcgaccgtga cagcagcagc cgtttccaag aattttggcg 5580cctatcagga tgccgcagtc cgcgagccgg tgattatcac caagaacggc cggccgcgca 5640cggttctgat cgcctatgag gactatctgc gtctggccag acgcgaccgt cgcgtagatc 5700tcaccacggc gatgagtgac gatgaacttg ccgccattga agcgtctcag atggagtcgg 5760gtctcgatca tctcaacgcc gaactgctga cgggcaaaca tgctgccgac tgaaccaaaa 5820gtcggttggg tctttcgtta ttcctatctc tggcactggc agcatctcga aggccgggag 5880gagggcgaca aggaccgccc ggcgctggtg ttggcgattg ttgcgacctt ggacgatggc 5940acgcccgcag tccgtgtcct gccgatcacg cactcgccgc cctctgatcc gagtgacgcg 6000atcgaaatcc cgccggcgac aaaacggcgt cttggactgg acgacgaacg atcctggatt 6060atcctgacgg aaagcaaccg gtttgtctgg ccgggaccgg atgtccggcc cgttgacagc 6120gaaaccggct accttggccc tttgccaccg gcattgttca acgagatcaa gcgccgcttt 6180gtcgaactgg cgcgcggcca gcgtcatcgc gccacgggcc gcagcgaata gcggcttagc 6240tgtggtcgcg gatcttggct ggccgcgtct ttgatctgca atatcgagca aaatgggtcc 6300tttgtgacca tcctagcgcc caattttacc gatttgcggt ctcaaatcaa tcacttccga 6360taagggttac ttatcggggg tcagaagccg caggcccatt tgtcagaagt atagaactct 6420aacaggtata tagatttccc ttaacgaatc atttaccata atttcaatgg tttacgatct 6480cgcgaaattg cccctccaga gcctgttgag gccggtctca gaaacaggcg tcgcacttgc 6540tcgtcttgac gagcgcatcg cccgttctcc cgttggcggg ggctttctcg agcgttccca 6600tttcctcgag gcccatgcct cgctctgggt cgacggtgaa cttgtccatt tggaggacct 6660cgttctgcac gacgcccttc gcgacatccg cgcacccacc cacgaactca ccatcgcccg 6720cgacatcctg aaaacccgcc gtcgcatcgc cgcccatccc ccggcctggg cgctctctgc 6780tcaaggcctc gcctccctct gcgggcaggc gtggcctgca gcatcgtcgg gtgtcgacgg 6840agagagtttg ccggatggca atgttgtcag cgacactcgg ggtggggtag gggaggccga 6900agatcctgat gccgacggtc ttagtgatgc gtttgccgcg atcgatgcgg ttcttgcccg 6960ctcggacgcc gcgattgaag aagcgaagaa gccggggggc gcgaaaaacg cttcggacaa 7020ggatccgttc gtctacgacc tcgactggga tgaggacgag cggctggcgg agtggcaggc 7080cgtgctgacg cggtcccagg atctgccgcc ggtcctgcaa tccatcgtgg cgctcgacgc 7140ctggaatgaa atcgccgtgc tccagcatgc gccgtggctc ggtcggctgc tggctgcctc 7200gatcctgcgc gagagcggcg tcaccaccgg tggccatctc gcagcgatca atgtcgggct 7260caaggctatt cccgtcgatc ggcgccggca tcgtgatcgc gagacgcggt tgctggcgat 7320ttcaagggcg ttggtgattg ccgccgagac ggggctgaag gagcatgatc gcctggtgct 7380ggcgcggcag atgatgatgc gcaaacttga gggacgccgg acgtcatcga ggctgccgga 7440gcttgtcgag ctcgttatgg cgcggccgct gatctcggcc ggcatggtgg caaagacgct 7500tgaggtcaca ccgcagggag cgcgccggat cgttcaggag cttggtttga gggagatgac 7560cgggagaggg aggtttcggg cgtgggggat tgtctagaat gggtcagaac gagatgaaat 7620cgaacgacag gccttgcgct atctataatt cggtcctatc tttcggggtg aattaggagg 7680cgttcggatg gaacatctga caacggcaca ggcggctttt gtggtgggcg cgccgctgga 7740catcttcaag aaggttgtcg agcgcgcgcc gattaagccg caactcgtga agcgaggtgg 7800tcgaagcatt cggcagttcg gtcaagctga gctggtgttt ctccatgcct atgacgaact 7860caaactggcg ctgacgccca agagccaatc cgagttctat gaggcgttgc ggacgacatc 7920cctgaagcgc agtctcgcga aggaagtcgt gttcggcaaa cagcgctacg acatcggtca 7980gcacctagtc ttcgtcgagc gcaagctgaa ggaactcgag aagctcaccg atcaggtcga 8040cctatccggg aaggagccgg tcatccgagg cacgcacatc gaggcgcatc ggatcgctgc 8100tcttctcaac gccggcgcca cggtcgaaga gattcttcgc gactatccct ccttgaagga 8160acaacaggtc gtggcggcgc gcgtctatgc ggaggcgcat ccgaaggcgg gccggccgta 8220cccgaagcaa acggcaaaag ccgccatgcg cgcagccgat cttagcgcgc tggatgactg 8280agcttgaaat acctgctcga tacaaatgtc ctgaaagaga ttggtcgacc cgaaccgcac 8340gagaatgtcg cggcttggct cgatactatc gatgattacc gatctcgcca tcagcgtgat 8400ctcggttcga gagatttcga aaggcatcga gaagaagcgt acgaccgatg acgtcgtggc 8460gaacgcgatc gccaaggctg ccgacgcaat cttcgcggct tatcaaggtc gtattctccc 8520cgtcgacgag cctgtcgcac gccgttgggg tcagatgctc ggtcaatcag ataagaatat 8580cgacgatacc ggcttggccg cgacagcgca ggtgaatgat cttatcatgg tgtcacgcaa 8640cgtcgcggat tttcagggcc ggggcgtcac ggtccttgat ccgttcaaga agcctgccag 8700atctgtgccc tcccaagatg tggcacgatg agcttcgacc ggatcggata agatatctaa 8760attatctcag ccatccacaa ttctgcggaa cggatcacca aacacgtgca gggctaggaa 8820gcgtgcagga tcatatcccg ttgcttttcc tacgtcctga ttggctttga agaccgcgtc 8880tattacctga tctccagcat cccaacgttc caggaaggcc ggaaaccacc tcggtgtaat 8940cgacgaagcg aggggccacg gtgacgccac aaccgtggag catcctcggt ccaacaactg 9000acgcgtaagc ccaattgtca tgtttgccgc agggtgcttg tcgctacggc cgccgctgca 9060gacaaacaaa accacgactc ctacattgcg aagagcgtct gccaagtcag acgcaagaat 9120tcgcaaattg ccttcatcgg aaacctggtg aaaaaacggt tctccatccg ctacgctgcc 9180gtgggcggct atcaccacaa gctgcgagcc ggcgaggtcc tccgggagcg ccgcagcggt 9240attgagggat atattgctcg cctcgaaagt tggctgtaac caacgcccta tgctgctcag 9300cgtgccttct tgattcagat ccgcggaaat ccatgccttt ctggttccat tcgattgcag 9360cggctgtgtg cgggcgcttt ccaaccaaga gagcgatggc gcggaagcga tggcacggct 9420tcgccccgcg aagtcgttgt cgacccagag caaattgaag gccagctgct ggagcttgct 9480gtcggtgaca aagacaacct tgtccggcag cggtgtcgat aggccaagcc tttccgtcga 9540cgtgtaaaac aggttcgctg ttttctcatc gacgccgtat cgatacggga attctttgct 9600ccactgtcgg taatctgaca cggaaaacgt gtttgagggt tcgacacctg gcgtggatgc 9660ggccccattc tccgcatcga gccggatcaa ccggtctttc gcatcgatac cgatcatgac 9720gaaaccagct cccgccgaat gtctttccag catcgaaagt ggttcctctg gccctttgag 9780ggccgaaacc ggttcggatg tggcctgcca gccaggtttg ggcaacgccc tgtcggaaag 9840gagttcaatt gcgagtgcaa cgccgagact cgacgaagcg tcggcttcgt ggccaagaag 9900ctttttgacc accggcacca tcttgcccga atcaaagccg gaatcctccg aatgtcggga 9960tagttctatg cgctcgtgaa ccgcaaaaat ctggtcggcc gtcggtcttg cggaggctgc 10020cgcacgggtc aactgttcga tcggaccctt aagccgctcg acaagggtgt caaagagcgc 10080ctcgtcgtca ggatcgacgt ctatcccggc ctcgcgcgcc caagccaaaa tttgaccgag 10140tatcaatgtt acaggtgcat ggtcgccggc gtacgatgcc gcgcgtcttc ctaggtctac 10200ggcgtcctgc aggagggccg gcaacctcgc acgaaattcg ttcgcgtcgc gaaatccccc 10260tttcagtttc agctggagcg caagcaaatc gagttgaatg tcgtttccgt cagaaagccc 10320gagttcatcg agaaccatgc gggcatgttc ggccatgtgc tctgctgctt tgatgagccc 10380aacgtcccgg aacgtcccgg caagaccgta catctcaatc caaagctggt gcagcgaaac 10440cggtccggcg agcttggccg cacacgcaaa cgcgactaaa gcttcgatag cattacccga 10500gcgccgatag acgtcaccga atacccccca tgcaatacgt tggcgtacgg ggtccaagcc 10560agagcagaga agagcgtgct cggcataatc tcgcgcctcc tggactttgc cgcgccgcga 10620aagctggatg gcgccgacac ccataagttc caggtcagct ggacctagtg attccgacat 10680ggcgatgctg acaccgatgc ttaaccaggc tttgaattcc gccaaatcgt catcggtttc 10740tgcgtcctcc gccagctgag gtagcatggc cttgaacgta gccaccaatc gatcgccact 10800gcacgggaga tcttcgctcg gaaacctcgt tttgccgagt gtaatgggcg cttcccgttc 10860gagccacgcg aacgcggcgc ggtgaaacgc ctcaaacgtc ttgaactctt cagggctgat 10920tgcgtcgacg tcgtcagcct gctggaagtc tatctcgccg gcataagaag acagaatgat 10980gctggcgatt agcgcaattc cgctttgccc agcgacttgc agatcgagaa tccgagctat 11040taacaacctc aatctgcctt ccgcagggtg tgtcgcggcg tagcggaggg gaatctcgac 11100tgcctccgtc aatcgttctg gctcgacgag cgctccgatg ttcccccgtg attgcagtag 11160tatttgttcc ataacgtcga cggtaagaaa cgccttccaa cgcggcggcg acggattttt 11220atgcgccgta acgaggtcga acgcatggag gatcaatccc cgccggagtg cgtcttgcac 11280caatgtctgc tcgatcgtct ccgctcgttg cggataggcg agcgtcagat gtcgcccaac 11340ggtcggatag tcggggggag ttggcgagct caattcgccg gcaaatgcat catagagcgc 11400ggtcagttcg ggttctgcct tacgcgatgc gaggatagcc gacgcatcgg caaacctccc 11460cgccgatttg tgttcggcga atgtgcgatc ggcgaggact ggtgcatttg ggtggtgctg 11520cctgagccgt gcttcaatcg tttgttccaa atccgccgca tctaaacggc ttgccgtgcg 11580aagagcggtc tggaggttct ccatggttga aaggcttggt gcgcaaaggc gcagcaaccg 11640caccgcaaga gcgcccgcgc cagcctcctc ggcgatcttc gccatcgcga gtacgaccgg 11700aggattcgat ttctcatcaa gaggcaggtt ttccagttca tgcagagtct ggccggtgag 11760gcctgcaaga tgtagcaact ggattctgag atttggcttc tcatcatcga agttggcggg 11820gagcgtatcg acttcctgca gcgcaacgcc cagacggcct tcccgtacta agctgctcca 11880ctgcaaagcc cgtacggaga gttcactctg gagatcgttt tcagctgttg ccaggtagac 11940gtctacgtca tcgtggacat cgtgcaacat gtcttgaaga gctgtttgca cgggagcgaa 12000gtgcccgaca tcgatcaaaa aatagctgct gagcctctcg cgcaagcacg acgcgaggtg 12060agcgatttgc ggtacccaga agttctcctc cagagaggat gcagagccta tttcatcggg 12120tgcaatcggt ctcacaagag gggagcggaa aagagccgca ttcagtatga tcatcgcgct 12180gtacggttgc cgtgctgaca tgctctccac gagggctagg gtatcgtggt tttcaagttc 12240gatgatctgg ctctcagcgg gatcgacgcg tccgggatat ctcgctattg ctgctttcat 12300agccttgtcg agggtggcct tcccgccagc ctgatcgcac gacactgccg gagccagcac 12360gagaaatccg gagaacgggt gttcacgatc ggacgtcagc caagacaaaa ttccatcgat 12420gtacagatat aagcgagacg gaagatcgtc gttgcccagg cacattatat cgctaccggt 12480gctcgacgtc cgactagcga atatcggtcg tagatcgtta gagaccggtc gcggcgcggc 12540ctcgtttgta ttttctgacg acgctttgcc attggcatcc atgtggtaac tccggcgatc 12600agcttccaag gttgggccaa ccagattggt tggacgaaaa agtgacccag ttccaacgct 12660cgaatagggg cgtcaggagc caattgcgcg attgtatttg cttgaatagg taatgaaagt 12720cacatcaacc ttgaacgtca gaaaaatgtg tattattttc tgacgcatga aaaccatcac 12780gtctgtcccg gatcagatca tgaagcgcgc ccgcgcgcgc gggcgcggcg tcgtcttcac 12840gccaagtgat tttctggacg tggccgggcg cgcggcagtc gaccaagccc tctcccgatt 12900ggtcaagatc gggaaactcc gtcgcctggc gcgaggcctt tacgacttcc cgaaggttca 12960tccacagctt ggcccgctat cgccggcccc tgatgatgtc gcccacgcat tggcgcgcga 13020gaccgggtcg cagctgcaga ttgcgggcgc gcgggcggcg aatgccctcg gtctctccac 13080gcaggtcccg agcaaaagca cctatctgac caacggtccc tcgcgccggg tcgtgttggg 13140caagcgggtg gtcgatctgc gtcatgcctc gccgaagcat ctgattgctc caggcagtga 13200tgtcggcacc gtcgtgcagg ctcttcgtca tgtcggggcg gtgcgtgcgg ccgatgttgc 13260acaaatcgcg gcgcgccgtc tgtcggccaa tgacaagaaa aagcttgcct caactgcagt 13320ccaggctccc gcttggatgc ggccgacgct cgtctcgatc gccaatgcag catccggtga 13380gctcgatgga tgaggtcccc ctccttccgg cagatgacag ggcacccaat agcttgcgca 13440gtttggtggg cgccgcgggt cagcaagcga ccctacggtc gcgcgggagt atacaaactg 13500gcggtcccta tgggcgctag ttacccgacc aggatcatcc tcgctttccg gagcggtggc 13560gtctgcgcct ttccgaaatg cgacaagcac ctcacctacg acgcgaaggt cggcgatgac 13620acctatgtcg gcgaggcggc ccacattcgc ggcgagaagg cgaccgccgc acgctacgat 13680gcctcgatga ccgatgagga gcgcgacaac gtgcgaaacc tcatctatct ctgcacggat 13740catcatacga tcatcgacaa ggtcgaggcc gattggccga ctccgacgct tctggctctg 13800aaggaaagtc acgagaagca ggttcgtcag gcgatggagg aagccttcgc tgacgtcgcc 13860tttccggaac tgcaaaacgc cgtgtcctgg gtctccaagc aggcgcccgc catcaacggg 13920tcgttcgacc tgatcgcgcc ggacgagaag atcaagaaga acgcgctctc gaacggggcg 13980cggcacatta tcgccgccgg cctgaccgca cgcgtgaccg tcggtgagta tatcgaggcc 14040gaagcacagc ttgattccga tttcccagag cgactgaagg ccggcttcct cgaagaatat 14100tatgcgcggc gaaaggaagg ccataagggc gacgaactat tcgagctgat gtgcgccttc 14160gcccagcgcg gtctgaaacg tcaggcggac aagaccgcag ggatcgcggt gctggtctac 14220ttgttcgaaa tctgcgatgt gttcgagaaa tgatccttcc aaccaaacac atcccgcaga 14280aagaggcgct gatcggagtc ggcgcaaccc ttctggcgca cctaggcggg ccaatgacgg 14340tctccggcct gtgggagcgt ctccgctcag agcctaacgt cggtacgttc gagcgcttcg 14400tcctagcctc caacctgctc tatctcatcg gcgccatcga catcaaagac ggtctgatcg 14460tcaggaccgc atcatgatcc gagccgtacg cgccaaccag aagggctttc acgctgccgc 14520gtttaaggct ggcatcaatc ttgttcttgc cgaccgctcc tcggcagccg gggacaagga 14580cacgacgaac gcccttggga agtcgacgct gatcgaaatc atcgacttct gtctggcgag 14640caacccctcg cccggaaagg gcctgcgcat cgaagccttg cagggctggg ccttcaccct 14700ggagctgacc atcggtggca atgacgtcgc cgtaacgcgg tctcccgacg cgcccgggtt 14760cttcgccgtc gaaggatcga ccgtggggtg gcctgtgcag ccggccccaa acaaggacgg 14820catgccaggg ctcgacacga aaaagtggcg agcagtgctc gcctgggcgt tgttcgggat 14880tagcgacctc gcatctgagt ccggatacaa gccgtctgcc cggtcgttgc tatcctattt 14940cgcgcgaaac caggctgttg cctacaacac cccgttcaaa catttcgaca atcagaagac 15000ctgggacatt caggtccaca atgccttcct gcttgggctc

aactgggaga aggcggccgc 15060ctggcagcag ctgaaggatc agaagaacgc gcttgatgcg ctgaagcagg cgatcaagac 15120aggcgcggtc gatggtgagc ttgcttccct cggtgagctt gaggccgaac gcctgcgtct 15180caccacgcag cttgagcggg aacgcgaagc cctgtccacc tttcgcgttt tgccgcagta 15240tcgcgagatc gaggcacagg cgaacattct cacaagcgag atccacggct tggtaaacgc 15300taatatcgtg gataagcgcc gacttgagcg ttatcgcgag tcagtggtga acgaggatgc 15360accgacggcg gatcgtctcg aagctctgta taacgaagcc ggaatcgcgt taccgggcgc 15420cgttaggaaa actctcgctg atgctcgcgc attcaacgag aagatcgtcg ccaaccgccg 15480cgagttcatt gccagcgaga ttaccgcgct cgaagctgcg gtggtaaatc gcgatgctca 15540ggttgtcact ctgaccgatc gacgcgccgg ttatctcggc gccctggccg gacaaggcgc 15600cctggaggaa ctcacccacc tgcaggaact ccacgctgcg acgcgtctca aggtggatga 15660gctgaccaac aggattaccc agctccgcca gatgaccacc aagtcggaca cgatcaaggt 15720tgaaaccgtt gcgctcaaac gggctgcaat actggattat gaagaacggc gcgcggtgtg 15780gtcccaggca ctgagcctgt tctcggaatt ctccgaggcc ctgtacaatg ctgccgggag 15840actggtgatc gatatcgacg acaccggata caaattcgac gtcgagatag ctggcagtcc 15900cagcgagggt atcagcaaga tgaagatctt ctgctacgac ctcatgctca tctcgttcgc 15960gcgccagcgt ggcctgggca tcgacttcct tattcacgac agcaccatct tcgacggtgt 16020cgacccgcga cagcgcgccc acgcgctcga actggcggcg gcaatgtctg ccaaatatgg 16080cttccaatac atttgcacgc tgaacaccga catggttccg atcaacgatt tttcggcaga 16140cttcgatttc gcatccgtgg tccgcatgcg cctaaccgac accgacccaa gcggtagtct 16200gcttgggttt aggtactgat cggaggcgga gtggatggcg ctattctcgc aagaccaact 16260ggaggccatc gctggcgcgc tcggcgatac ggaggcgggt ttgaccggcc ccgagatcca 16320gcacctgatc gcatcgacca aaatgtccga tccgggggca atgacgaaga gggtccgaat 16380ctacaacgcg tttgctgaaa gtcagaatac caaacgcaac cgaaccaaca ttttgcaatt 16440cattcgtctg gcgatgaagc cagcgcgcta cagccgctct cccgagcgtt atgagccgat 16500gcgcgcactg cttaaccagg cgctcgcatt cgccggcctg gttgtcgatc agactgggga 16560actcaaaaaa gccgagattg cacaaaccct ccccgaagcc cagcgacggg cgcgcgagct 16620gcgggccgat ctggaaggcc gcggcgtcca ccccgatgta ctcaggtttt gccgagccga 16680acttctggca gacaactatt ttcacgccgt ccaggaagca gtgaagagcg tcgccgacaa 16740gatgcgcacg cgcaccgggc tttccgacga cggcgccggg ctggtcgatc gcactcttgg 16800tggcgagcct ccgctcctcg cgatcaatcc gcgcagcacg gtaagcgaac ggagcgagca 16860gagcggcttt gcaaatctcg tgcgcgggac attcgggatg ttccgcaatc ctacagcgca 16920cgatgctcga attcattggg tgatgtcgaa agaggacgca gaagatctgc tgacaatcgt 16980ctcgctcatt catcgtcgcc tcgacagcgc gcatatgccc ccacgagttt aagtgagacc 17040caatgtgaac acgacaattt ggcgaaggag attgtaagat tgggtctaac gatgccgacc 17100acctggcgct acggttctcc gggagcgatg ccgcccttcg ctgcgaacgc ctttaactcg 17160ctgatccaca cgatcgccgg ccaatcggaa tcgtcatggt cgatcttcga gctcttcaag 17220gcgaagttca gcggcggctc gtcttggagt tcgagcgaaa gctgggcgat cagcgatttg 17280cataccgcaa tgatgagggc cgctgacaac gcccccgtat tcatcagcgc gttctgggac 17340ggttgcaccc aagtgcaggc gtcccatccg gaagtcggct tgccggatgc cgatgtcgtc 17400aatcaaatcc tctacgaaca cgaggtccct tacgaggtta ggccgcccgc actgctggcg 17460cgccaccccc agacgccaat cgtcgtacaa gcaccggaga agtctcttgg tgagcgcgcc 17520ttcgccctga tccacgcctc gctggaccag gccgatcgtc tgttgctcga gcagcgtcct 17580cgccaggccg ttcaggagat tctgtggctg ctcgaaaccg tttcgacggc tttccagggc 17640catgaaagcg gagctggcac gatcgaaggg aaatatttca atgagatcat tcgaaccatg 17700cgcaataata atcgcggcag tgcccttgct gaagccctcg gatggatgac gaagatgcac 17760ggatacctat cctccccagg gggcggcggc gttcgccacg gcacccagct tgcggccgat 17820gtctccccta cgctcaggga ggcacacctc tactgcaacc tgacccggag ctatatcaac 17880tacctcctgg ccgaactggc ggaacagaac taatcgcagg agtcagcgat tcgtgttgtt 17940tttcgtacac aagagagtgg acggcgaacc acactatatt gcgccgcgct agtttccgga 18000aatattccta agatggaatg caaggcgctg cgctatcgtg cggttgcatc gcgggcgaca 18060gagcggacaa cagaaggaag tataccaggt gggcgtatga tcagtcgcgg ttcggaatgg 18120catcgttggg agccccatat tcatgcgcct ggcaccgtcc tcaacaatca gttcggtgcg 18180gccgatccct ggggtgcata tctcacatcg ctcgaagggc tgacgccgaa gatcgaagta 18240atcgccgtca cggactatta cgtcaccgat acctacgaac agttccttac ccataaggcc 18300gctggccggt tgccagacgt gaagctgctc tttccgaaca tcgaactgcg cctcgatgtg 18360gcggcaaaga cggggttcgt gaacatccat ctgttggtga gccccgagga cccagatcat 18420gttggcgagg tcaagcggat cctcaagcgc ctgcaattcg gcgcccataa cgatcgcttc 18480gactgcacgc gcgaggagct gatcaagctc ggcaagcgct ccgacaccac gatcaccgaa 18540gacggcgcgg cgctccgcca cggcgcgacc caggtgaagg taaacttcga ccaattgcgc 18600aaagtcatcc atgagagcga atgggcgaaa aagaacgtcc tgatcgctgt cgcgggcggc 18660gctggagacg gcacgtctgg gctgcggcag gctgccgacg cgacgatgcg tcaggaaatc 18720gaaaagttcg ctcacatcat cttttcgagc agcccggcgc agcgcgagtt ctggctcggc 18780cagcgcggtg tgccgatcga ggagctgcgt tcgcgctatg acggctgcaa gccttgcctc 18840catggcagcg attcccacga ccagaaatcg gtgggccagc ctgtcgacag tcgcttttcg 18900tggatcaagg gcgctttaga gttcgatgcc cttcggcagg cctgcatcga ccccgagggt 18960cgtgcctatg tcggcgagca gccgccgcgc tcggcgatgc catcgcaagt gatctcgcat 19020gtcaggatcg acgatgcgga ttgggcgtcc acaccggata tcccgctcaa ccctggcctc 19080gtcgccatca ttggtgctcg ggggtccggc aagaccgcct tggcagacgt catcgcggcg 19140gggtgcgatg caattccccc atccggatgg gacgcggacg agaacaacag tccgtccttc 19200ctggcgcgtg cgcgcaggct tatcagcgat gcgacgacga cgctgacctg gggcggcggc 19260gcaacggtca cccgcgcgct cgacgggagc gatgccaacg gccatatgtc ctttccacgg 19320gcccgctacc tgtcgcagca gtttgtcgag gagctttgct ccgccaaagg cgtctccgac 19380ggtctggtcg aggagatcga gcgcgtgata tacgaatcgc attcgcccga tgatcgcgaa 19440tgggcgctcg acttcgccga gctgcgcgag cagcagacct cccgtttcca acaagcgcgc 19500gagcgcgagg cccaggcgat cgccgacatc tccgaccgta ttgccaccga gttcgagaag 19560gagagcctcg tcgcctcgct gaccaagcag gtcggggaga agaacaagct gatcgccgac 19620tacgctgccg atcgcgcgag gctggtcgta agaggcaccg aagctcaggt cgcccggcat 19680acgcaactca gcgaagccgc tcaaaagctc cgcagcagca tccagaattt tggcaaccaa 19740cgccgcacct tcgtcgcact ccacgacgag gtccgctcca tgcgggcaac cggctcgccg 19800gagatgctgc ggcaggcgca ggcccgtcac gccaatagcg ggctcaacgc cacgcaatgg 19860gacgaattcc tgctgatcta caagggcgac gtcgacaaga gccttacagc ctatgtgaac 19920tgggcggata ccgagatccg taagcttcag ggcgttcccc cgccgcccgg cgatcccaat 19980gtcgcgctca tcgccgacac ggttgatatc tcaacactgc ccctggcgcc aatcatcgcc 20040gaaatgacgc ggctagaagc actgttcagc gcagataagg tggtgcgaga tcaatatacg 20100gcactcacca accgcatcgc gcaggaaaat tccgcgctcc aaacgctgca gacgcgcctt 20160aaagatgcgg aaagggccgc ggcgcgccgc aaggacctgc agaacgaacg tgacgacacc 20220tacggccgcg tattcgaagc tatcatcaac gagcagaata cgctggccgg gctttacgca 20280cccctgatgg cgcgcctcgc ggccgcctcg ggcacgttga agaagctcag cttctcggtc 20340cgccggatcg ccgacgtcca ggcctggggc acctttgccg aggaggagct tctcgaccga 20400cgcaaaaccg gtcccttcta cgggcgcggt tcgctgatcg ctgcggccac ggacgcgctc 20460aactcggcgt gggagacggg atccgcggct gaggtacagt ccgccatgac ggccttcatg 20520gcgaaatatc tgcgagatct gctgacccat gcaccttatg cgccgaccca gcaggcggaa 20580ttccgggctt ggtcgaagca gttcgcgcac tggcttttca gcaccgagca catcactgtc 20640cggtatgaaa tctcctatga cggcgtcgac atccgcaagc tctcacccgg cacgcggggt 20700atcgtgcttc tgttgctcta tctggcgctc gacgattccg acgatcggcc actgatcatt 20760gaccagcctg aagagaatct cgatccgaag tccgtcttcg acgagcttgt cgcgctcttc 20820atcgccgcga aagcaaagcg ccaggtgatc atggtcacgc acaacgccaa cctcgtcatc 20880aacacggacg cggaccagat catcgtcgcc gaagcagggc cgcatcccgc aggcggcctg 20940ccgccgatca gttatgtggc gggcgggctg gagaacgcgg caatccgcaa ggcggtctgc 21000gacatcctcg aaggtggcga agccgctttc cgcgagcgcg cgcggcgcct tcgcgtccgc 21060ctcgacagat aggatagcga gatggttaca cgcgatatcg ccgcctccga tcctcaacag 21120atcttcggct tcctggcgga gcgcggctgg tctcgccaca gcagcgaaga cgcggaccca 21180gacgccatcg tccgcgcgct gggccaactc ggtgatcggc tcgggacgcg cgttccgggt 21240cgtgcgggct cgctcgagga agtcgtcgag ccgcgtgccg ccgatgatgc gcatcctcga 21300tccttgagcg cgcgctacgg cctgggcgcc ctgccgcttc acacggaact cagccatcgc 21360actagaccct gccgttacct ccttctcgga tgtatcgatc cgggatcgcc ggccgcttcg 21420acgatgcttc tcgactggcg gacgctcggc ttttcgcagg aggagcttga ccttctcgaa 21480gacgctccga tccttgttcg caccggtcgg cgctccttct actcgacgat cctgtcgccg 21540ggccgagctt tcttgcggta cgatcccggc tgccttgaag ccttggacga gcgcggccgg 21600acggccctgg cgcttatcga ggaccggatc gccggcgccc actcagaggc gcatcattgg 21660cgccggggcg acatcctcat cattgacaac tggcgcgtcc tgcacgggcg cagtccgtcg 21720gaccgagggt ccggccgccg tctagcaagg attctcatcg atgcctgagg aagtcttcat 21780cgcaatcaac ggcgacgctc tccatacaaa gtcgaaagtt tacatcggcc gagcccttgt 21840tcggaagggc gccagcgatc tagacgaata tcagctctgg gcctcgctcg cgctcgagct 21900gctcggcaaa gccgcgctcg cccggaaaca cccgagcctt gtggtcgatc cgacgcactg 21960gcagtcgatg ttcgtcgccg ccggtatcaa tgtcacgacc gacgtcaaga cgatcaccgc 22020caagaccctg ttcgagcgcc tcgcacacct cgtcccgcgc ttcgacaaga cggtgcagaa 22080attctgccaa gacatcgccg agcgtcgaaa tgccgaactg cactcggccg accttccgtt 22140ccgcaccatg cgtctcgacg cctgggaggc gcgctattgg catgcgtgcg atacgatcct 22200gcaccagatg ggatcgtctc tggagcaatg gcttggggcg gccgatgcca aggcgccccg 22260tcaattgctc gacgaagccg ccaaggccct cgaagcggcg gtcaaacttc gcgtcgaagc 22320tgcaagggaa cagttcgagg cattgaggag ggccgagcgg gaacgtctgg ccgccgaagc 22380cgaattgcgc gagccgcagc atcaggcggg aatcttcaag ggccgctacg acgagatctg 22440gaccgagagc tgcccggcct gcaaatgcag agcgttcatg accggcgagc agaccggtga 22500agatatcagc gaagagcgcg acgagtatgc gatctgggaa atcgtcgacc gcgagttcgt 22560cggcgaagag tttcgctgcc cgacatgcga actcgcgctg atgggaagcg acgaaatcgg 22620cgcgggcgga ctgaactaca tccacgagga ccaacaagag cgcgaaatgg aatacgaggc 22680cgactacggc aacgactgac catcggcgga gaaatataca acggggcaac acacatgccg 22740gtctacttca taggcgagga tgaaaacgga tgctcgccga tcaaggtcgg cgtagccaag 22800gacatcggcc ggcggaagag cgacctgcag accggaaatc cgctcgaact caaactcctc 22860ggttggatca cgtcgcccga cgatttcgag accgagcgcg atctgcaccg tcgcctcgca 22920tcccggcgcg gccgcggcga gtggttctac atcgagccgg ccgacgtcct gcctttcctg 22980atggaggtcg gacagcgtgg tttcgtcgcg aagaatgcgg atgccttcga aatcaccggc 23040tacgatcgcg acgccatccc cgaatatctc ggtgtgtggg aatgggccga cctcgaaatc 23100gacgaatgct gtcccttctg cggatgcctt tgcggcatgc attttcagga cgcctctcag 23160atgtactact gcatccagtg cgacacgctc accgacttct cggaactgtc cccggatgac 23220cgcgacgggc gagaggactg actggcctca agaccaacaa cgaatggggg cataacatga 23280gcatgcaatg gctattggcg cgagcaccgg gattccacgc gctgcccgaa gaggaccgcg 23340cagcgatctt caacttcact ttcctgtgga gcctgttcga ggcccaagtc atgggcaatt 23400ttgcgcgcgc cgatctcatt tgcgcgaagg ccgacgagtg gcaagacgcc ggcacgctcg 23460acgccgacca gtatgatgga gagctggctt attttcgcca gcgctatttc gccaacgggc 23520aattcacgca ccacttcgcc cacctgcatc ttcgccccgc cgatcagccc gacctcgtcc 23580ggtcggtcct cgacgggagc aacaacgacc cgcgcgatcg gctgctgacc gtgctgataa 23640tcgtctggcg ctttcgcaac aatctgttcc acggcgagaa gtggacctac cagctccagg 23700gccagcacgc gaatttcacg cacgccaatg ccgtgttgat gcggctcctc gaacggcatg 23760ggcagttggc agcctgacgg cgtcaggtgc tccccggctt ccgccagaat ggttcgtccg 23820catagatgct gacgcccatc tgtccgcgcg gattttcggc cgcccaagcc agcacctctt 23880cggtcgggac gaccagtctg gtctggccgg tcggctccca gcagttcttg ccggacttca 23940tgtagaagtc tccgacacct tccacgttga tccggccggt gcgcatgcgc cgcaagccga 24000aggccgtgat ctggtacgtc aggacgcctc cgtgggtccg gcgaacaacg gccgccgatc 24060cctcgggttg attgcggtag tagtcttcga tctcggcctc ggtctgacgg gcgcatggcg 24120aaagcttacg gtctggcacg gcaatcctct cgttcggggg ctgtcggccc tccgctgcac 24180acaggcggtg actaatccct ggtggcgaac accttgcgcg ttccctgcat cagcagattt 24240cgtcgatctc gaggcgacga tctagctttg atccagacca attggccctc gtggcaacgc 24300cggcaccatc gttcgtgcag gtagagagcc acgctttggt tgcgctgaaa tcagttagta 24360tctcagcaag ttaagcagcg gcttcacaca tagtccccag aaattccgca tgccccgaag 24420gatctgcttc aaatatttgc cattcaagat gcgtactctg gtctgctttc cagttccgct 24480ccccacagcc gcccgtccat tcacggcgcc atacagccgc tctccggaca caaaccgacc 24540ttcaccgctg agcagtttga gcacgttagc ccctattcga ataacagggt cgaaggttct 24600gatcctttca aggcggcgaa tctcacgctt cgagtggcgc gatgagattt tttaagagat 24660tacccgatgg aaaatggctc gaaacgcaag ggcatgcccc gctctagggt tacgagctcc 24720ggtggcagga ttgccagacc ggcggcttgg gccatgggcg acaggcttcc cgacgatccg 24780cggcccagca ttgccagcac gggagtgcca gaagcgtcgc gactctgaag tcgaacgggg 24840acgaattccg ttcggccctc cttcttgcgc aacccaaagt cggagatcgc cggcatccag 24900acgggatcca aatgctcgat cccggccaca gccctgatcg ccggcagcgc aatcttgtcg 24960agtgtcacgg cggaggccat gggattccca ggcaagccga taaagagcgc cgaccctagc 25020gtgccgaagg aaaccggctt gcccggtcgc atggcgacat caagcacgcc gagcgacccg 25080ccgcagcgtg tgagcgcgtc ccgcacatga tcctcgccac ccctggacat cccgcctgac 25140gtcacgacga tatcgtgctc cgtagcagcg ctgtgaatga tattggtggt cgcctcaatc 25200gtgtccggcg tcgccccgag atcgcggact tcgagccagg gatgcgacag catggaggcg 25260aaaaggtagc gattggaatt atagatctgg ccagccgcca agtgctcacc cggctctttc 25320agttcagagc ctgtcgtaat gaacccgagt cggatctttc gaacgatgga aatccgagac 25380aagcctgcgg ccgcgagcag cgcaatccgg tgtgctgtca gaaccgtccc ggccttgaac 25440agcaaagagt tttggtcgac atcttcgccc gccctgcgga tgttctcgcc tgggcgggga 25500cggtaggcgg tggtgaactg gcgatcatgc cgcgaacatt tttcacggat gatcacggcg 25560tcgaaaccgg ccgggatcat cgcgccggtg aagatttcca cggcctcagc attttcgaaa 25620ctgctgctgc tggcctgatc tccggctgcc actctgtctg cgaccagaaa ggtccaggga 25680ccactgccgg aaaaacccgc cgtgcgaacc gcaaacccgt ccatcgccga atgatcgaag 25740cgcggcaagg cacagggcga gcggatgtcg gcggccacca cgcggccgcc tgcagaaaac 25800agatcgaggt cttcggtagc ggtcacgggc cggcacaggc cgatggcgcg ggccaccgca 25860tcggcaaccg acaacatggg gcgagcagct aaggctcgcc cgcagtcgag agcagcgcgg 25920tcgaacaacg cggcacggtc cgctggcatg taattcatca aggcctccca accacgatta 25980aagggacagg tgtggagatc gcgacctcct ctgtgaggtc gcgacaccag cgcttcacgg 26040ggtgctgatt gttttcaggt aagcgatgac gtcggccaca tcctcgggct tcttcaggcc 26100ggcgaaggcc atcttggttc ccttgatata ggccttggga ttggcgagat actcggtcaa 26160gtgggcttcg tcccaggtcc agccctcttc ggcctttgcc ttgaaggcgg gcgagtagtt 26220gaagccctcg acgcctgcga ccttccggcc gatgatggca ttcagttcag gaccgacctt 26280gttggccgca ccctcgccga cggcatggca ggcggtgcat ttcttgaaaa cgaccgcgcc 26340tttttccgcg tcgccctcgg ccatggcggg ggatgttgca atcaggcaca gtgagactat 26400cgaaaacagt ttccgcattt gtattgtcca tatgtttgaa ggagtgggcg gcgctactgg 26460ccgcccacgt ctggagggaa gagtggcagg ggccactcgc tgtgtcctca agccgaccgg 26520tattctttcg acttgaaggt cagatgagcc acgtttttag gcgcatccga aatcttgcgg 26580atattgcccc aggtctgctt gtagtttggg atgatcaact cgttcgtgcc ggcgctggtc 26640acattgccct gcacgccagt cgggaaaccg aacaacatga aggtttcgcc gcggcgtgcg 26700gtcggtgtcg gataggccat ggcctgggtc gcgccggcat cattgtaaat ctcgacgagg 26760tccccctcct tgagccccgc ttccaccatg tcctccgggt tcatttcgat gaacggatag 26820gggaaccggt ccatgacgaa gtcgttttcc tggtcaagat aagcggattg ccagaccaca 26880ttggcgcgcc cgttgttgat cagatatttg tggttgtcct tctgctgttg cttgcccggt 26940gcctgcagtc cgcgccacgg tgcgtccatg aagcgcgcct tgccatcgtc ggtcgagaac 27000acgccgtcgg tatagagccg ctgggtgccg gcgatcttgc cgtcggcaaa acccgtcgcc 27060ggctcctgga atccgttggt gcccatggcg ctcaggcgct cataggtgac gaattcaccg 27120ccatgagcgt gtctgttgta accgtccatg aaggcgtctt cctcggtctg ccagtcgaag 27180cccttgaact tgccggcata ggcagcgtcg cccatctcgg tcagcacccg ttccatggta 27240ttggctagcc gggcggcgat caggcagtcc ggcatggatt ggccgggcgg gtccatgtag 27300cgctcggtca accgcatccg gcgttcgcca ttcatcgaag tgaggttcat ctcgcccgac 27360gtggccgcag gcaggatgac gtgacaggcc tcgccgatct ttgtcgggat gatgtctata 27420ttgacggcga acagaccacc ctggttgatc gcagcgacga tggcgttcac catggcctcg 27480cggtcgccat agggagcgac gctcatcgca tccttcacca tgtcggtgcg cttcttgtag 27540acgcgcttga actcgtgggc gttgagggtg gtcttgtagt ggtcgcagcc ccaaatgtgg 27600tgcacgcccc cttggccgcc gatcagcaac tggtcgacat aggccgccgg ccggccgaca 27660tgggcgtcgg acgggcgcac ataaccttcc tggtgaccgc cgaggcgaac gacgccaccg 27720ccaggacgac cgatattgcc ggtggcgagg gccagattca ccagcgcgcc gttggtgcgg 27780taattgtcgt tgccccagat caggcccttc tcgtagccga acatgacgcg tcgacgcttg 27840ccgccttcct tcggcatggc aatccattcg gcggctttga tgatctggga ttggtctagc 27900cccgttattt tcgcggcttc ctcgatggat acgcggcacc cttcgacggc atcctcgaaa 27960ttggacaaat gtccaggctt gctgtccgat ccgccacgcg cgggatagag cggcggccgt 28020gctacacctt cccgcaaggt cgatttgtcg atgaattcgc ggtcaaccca gcccttatca 28080gcgatgtatg taaacagcgc attgaatagc gctaggtcgc tgccggaatt gatcgcgaga 28140tgcaggacgt tgtccttgcc agccgtttcc tcgctcgcat tgacggtcac cgtgcggcgc 28200ggatcgacaa tgataatccg gcccgcttca tgcggctcgt ctggcatgat ctgctttttc 28260ttctcgagac tttcgccgcg caggttcggg atccagtgat tgaggaaata gtttgtctgg 28320gtctccagcg cattggtgcc gaccgcgacg atcgtgtcgg ccagttcggc atcctcatag 28380cagttgttca actcgccgac gcccatgtcg cgggtaccgt ggacttccga attataggcc 28440gggcggttgt ggatacggat gttcttgacc ttcatggcct cgaaatagag cttgcccgtg 28500ccccaggtgt tttcgtagcc gcctccggcg ccgccatggt cgaaggccga aacgatcaga 28560gcgtcctcac ccttctcctt gatgatcttc gccgtcacgc gggcgacaag atcaagcgca 28620tcgtcccagc tcgtcggctg catctgtcca tagcgccaga cgaggggatc cgtcaggcgc 28680tgttgctggg tgttgcgggc ttcggaaaag ctcgtttcgg ccatcctggc tccgcgaact 28740gaaccgagac cggtgttcac cacgcattcg tggtccggct tgatgacgac atgaacgtcg 28800cggccatcct gtttgacgac attgtacatg gatggcgaat accaggcgtc agtttccgcc 28860tgttgctgct cggacagatc gacgccgaac acgtttttct gcgggtccgt gccgccctgt 28920ttgttgattg gccaggtgta ggcgtgatag ccgcagccga cgatgcagaa gtggcaggtg 28980acgttgtgct tctttgcgtc cgcgggaatg atcggcagac ggtcgatgtg acgtttgaag 29040gccatgatct tcttccctta tagaacgttg gacaggcggc cgtagatgag ctcatcgacg 29100ccttcggcga agatgtcacc gttatctgcg acgcggagca cgtattgagg caggttctgc 29160gtggactgtc cccagacctg ctggcctccc ttttcagcat cgaacaccga gaagtggccg 29220ggacagttga acgtcttgtt gtcggcggta tagctcagcg gaaaaccctt gtgggggcag 29280atggtagaaa agccgacgat gtcgccatcg ggaccgacgc cgccttccac gcgcgtcccg 29340agtttgagaa gaacgcccga ggcatcttca tcgggatagg cgacgtcgag aggttcgttg 29400agggtgagtt ccgagatgtt ggcgagacga ttggcgggat agtccacgcc ggccgcagcg 29460gtagcggctc ttgcctgtgg cgcgccgacg cccgtgacga cgacactagc gcccgcggcg 29520gccaatgccc ctccgcgtag gaactggcgt cgaccgatat cgaccatgtt tcgacagcgt 29580gacatgcgat cctcctccat tgaatgtcga aggtcgaatt gcaatagctg tgccaacagg 29640tagagggctg atttatcgcg cctttttcgc gaatcttccg tgtgtgggtt cggatttccg 29700aacggccagt aaccaccgtt gttcagttgg ccgaacgttc actagcttct attccgaaac 29760gcgtcatttt ctcccaaagg gtcgtacgag aaatgccgag atgtcctgcg gcctgagaaa 29820tctgtccgcc ggttgcgctt agcgcccgca ggatctgtcg gcgctccgcg gcgtcccgcg 29880catcggagag tgttccgatc cgcggcgtat cagatacttt ggcgacgtcg gggaatagat 29940ccgccggcat cacgagcaga ttttccgaca gagcagcggc gcgttccagc cgattgcgga 30000gctcgcgggc attcccgggc caacagtgtt caagcattgc gtcctcggca agcgtactga 30060tgccccgaac gcgagtctcc ctgatctgca tgatctcctc

gagaaagcgc tgagcgagcc 30120acaggatgtc ttcctgtcgt tcacgcagcg gtgcaagcat gactggaagg gcggaaagac 30180gaaagaacaa gtcctttcga aaggaactgg cgtcgctgcc aatctcctga tgggtggcac 30240agacaatgcg tgccttgaac gggatggatg tttcgctgcc gacccgatga aaccaaccat 30300cctcgatgag acgaagaagt ttcgcctgca gaacaggcgg catatcaccg atctcgtcga 30360gaaagagaat accttcgccg gcacgttccg cgtagccgcg atgaagttgg tgagcacccg 30420taaatgctcc tttctcgtgg ccgaaaagct cgctttccag cagttcggct ggaatggctg 30480cgcagtttac ggcgatgaaa ggggcgagcg cacgctttga taactgatgc agaaacctgg 30540cgctgacttc cttgccagtg ccggtctctc cctgaatgag aacggggagg ggatgagagg 30600cataacgccg caacatctgt tcggcgtcgc gcatggcgcg ggagatgccg agggagctat 30660tgagctcatc ctgccgcttg ctccttaagc ttgatgagac gcgatcgagg aaagccgtca 30720tgtcgaacgg tttggtgatg aagtcgaccg caccactgcg catcagacgc accgcctggt 30780ctatatcggc gtagccagac atgaataaaa agggtgttgc ggtatcgcgg ctggcctggc 30840ggaaaacctc ttcaccattc atgtctggaa ggcggatatc gcaaacgacg aggtcgaacg 30900gttctgatcc gctggcgagc tcgcgcatgg cctgctctcc cttcgtccac catttcacct 30960tgtggccctc aagcgaaagt cgctggatga gcgactctcc catgatggga tcgtcctcga 31020gtatggcgat gcgccctgtt tcacgctgca tggctagttt cctccccagg aatcaatatc 31080ggcaagtgca attcaatgac ggtcaggccg gcttcggtcc ttgacaaacg gatatgtcca 31140ccggcctcat ccaccagctt ccggaccatc cacaggccaa gccctccagc tgactgagcg 31200gccggccatg gatctggcga tgtaaggaca ttagttgcgg ccttcggcag gcccggcccc 31260gtatcggcaa ccgagaggat taacgtcgag ccgtcttcct cgaggcatgt ctccacaaaa 31320atcgtgccgt catcgcccgc agcggcgctt gcgtttagca cgaggttcaa aagtgcttgc 31380cgcacagtag agccgggcag ggcagatatg gtgagattgg atgggctgct cacccagtgc 31440atcgtttgtc tgcggcttat aatgacgggg ccggccagta ggcgcacatc ttccagatcc 31500tgtaggacga gaggctttcc ggagcggtcc ggccggtatg ttgccagtgc tgcctgtaca 31560acatcgcgaa taccgccgag accacgttcc agaagggaca cactggtgct ccgtacgcct 31620tcgtttgccc catgtcgctt caacgtgtcg atggagttga acagtcctcc gagcggatta 31680ttgatctcgt gggccatgct ggatgcgagc cgtcctaaac tggcaagctt ctcttcctcg 31740gccaatcgac gcgtgagtgc gctgcgctgc tgctcggctt gtaccaaagc gttgaagcca 31800tgaaacagat cagcgagttc acccgcgcga tacggaaatt cttcagcggg aatggtgtag 31860ggctgtccgg ccgcaccaga gcgcatgtgt tgtgccaatg tcgccaccgg cctgaccata 31920cgtctggtca agacgtatcc aactgcggca aacacgaatg ccaagacagc attcgtcgca 31980agaagcgtct ggagaacctg gcgcctttcc gcgacaagat gggtgatgtc gaaagaggcg 32040tgtacggtcc cgatcgactt tccctgataa aggagctgcc tgatcccgaa cccggtgttc 32100gactgccatt cgatgcggat ttcatcgtct ttgcctcggt cagcgaaggc cgggggaagt 32160tcggaaagta ccgggatagc gtgcggatcg ctggaagcca gtaccatgcc atcccgtcca 32220gtcacaaccg tctcgatcgg agacacggcc gcaaacatcg tacgggtgcg gtcgagcagg 32280tcataggttt cccatacatc ctgccgcaaa acagccggga taagagcggt ggacaagcca 32340tcgaaatagg ttcccacgac gccgttcaga tgctgttcct gcatgtcatg aaggcgagcc 32400aatacgcgtt cggagatgat gaggctgacg acgatcatca gggatgccac cattaccggg 32460acccgaaccg tcaagggaat gccgcgaacg cgctcgatga ggctcacccc agcctccgaa 32520cccgttccat gttgaccgcg atactttcgt agctttcggg tggaacctga gtgaacccgt 32580caagctggag gcgctcaagc accgttcggc ccagctcgtc gctgtgcatt tgcaggagcg 32640cgtttcttat tctggcaacc ggctggcttt cgcgctgtcg tgcggcggct gcgatgggcg 32700ggaagccgtg ccagtcagac ttcaccagta ccctcgtttt cgagagcagt tccggttcgg 32760tctgtttcat gacttcccag acgtacccat caacgctccc ggaatcggca aggccggaag 32820ccactgcccg gatcacattg cggtggccgt aggtaaaaaa tgacttgcga aagaagcctt 32880cctcggagac gccgcgttcg gccagatagg ttttcgtgac gaggtagccg gaattggaat 32940cggggtcgga gaacgcatgg atatcccccc gacagtcatc aaaggcctgg atgtcacgat 33000gttgaccgac gatgaggtag gattggtaaa gcggcttatc acgccacaat ggcgtggcaa 33060ccagctccag ctcgtcccgg aacttcatga acgggtagcc gcaaatccag gcggcctcaa 33120gattccccga gaccaggagg gcagtgactt cctggtaggt acgctgtgtg acaagttgta 33180cttcttgacc aatagcgcgg actaggtagg cctgtagttc gtccagcact tccaggtcat 33240tcgatagaaa gacgggtgtc aacccaaacc gaatcacgcc aggtcgcggc ggcacggaca 33300gcaactcgct tcccgcaggc gatccggcga agcatatcgc ggacaaagct ccgcctatcg 33360ccatccggcg cgatatacga cacttgtcgg cgtgccgacc gcgcgtgtgg tctcgatttg 33420acaccgacga cctccctcag ctctcctcca gagcctaaat caattgtact gtcttcagac 33480agattgtcca accgctcctc cgggattgag gtgctggttg catggatctc aggatttcgc 33540ccgctaccac ctttttgcaa ctatccggga cgggtgaaga cacagaccgg gagcggtgaa 33600attttacttc aaacctgtat ccattgaata accggcgcct ctaacggtcc ggatcaggtc 33660tggcttgttg gcaaagttaa gggcttttct gagccggccg acatgaacgt cgaccgttct 33720ttcgtctaca tagagatcgt gaccccaaac gccgtcaagg agctgtgctc gggagaagac 33780gcgccccggc gacgccatga gaaaatcgag gagacggaac tcggtcggac cgagcctgac 33840ttcacggcgc tcgcgatgga cacgatggct ttcccggtca agctcgatgt cagcatagcg 33900caaaatggac gagatcaatg ctggtttgga acgcctcagc agagctctca ccctggccat 33960aagttccgga gtcgagaatg gcttcaccag atagtcatcc gcacctgtcg ccaatccccg 34020cacacgctct gtctcctccc cccgtgccgt cagcataatg acggggagcc gctccgtgtt 34080tggtctggcg cgtagacggc ggcaaagttc gattccggat acaccgggaa gcatccaatc 34140cagaattagc agatccggca cgctttcctg cagaactatg tcagcctctt cgccgtggcc 34200gattgtctcg acaaggtatc cttcggcctc gaggttgtag cggagcagaa cactcagcgc 34260ttcctcgtct tcgacgatca tgacctttgg ggacatcagc ttcgctcctt agtttcgcgg 34320ctgtcaggcg atttattaca gtgacacttc agttttgtga caaacgcgaa atatctagaa 34380atctggaaat atgattgtca tcgtgaggat tttgggatat cctgcaaacc tctcgccatc 34440gtgggtgcat cgagagcgac gcatctctac ggttaaattc cggataatat tttcgtcaaa 34500tcatgtatta agcaagtaaa aaacttccaa ctcaaatatc aatctatcta gatataccat 34560actatacttg gttgacataa aactgtcatc caacaatact atgaccgccc tgcgttcgcg 34620gatgtcgcgt tcagcttttc tgaattcaca gagggtcgtc atgacacaca acacgaaaac 34680ctttcgcccg gcgcgcgccg ccttcgcctc ttccgcagct tcgatcgtta ctctcggcct 34740cctcgttgcc ccttcttttg cgcagcaggc accgacagtg ctgatcgacg gctcgagcac 34800cgtattcccc atttccgaag ccatggctga agagttccag aaggctcaag ccggcaaaac 34860cctggtgacc gtcggttctt ctggcacggg cggtggcttc aagaagttct gccgcggcga 34920aaccgacatc accggcgctt cccgaccgat caagtccgac gagatcgaac tgtgcaagca 34980gaacggcgtt gaattcatcg agctgcctgt cgcaatcgat gctctcgcaa cgatcgtaaa 35040cccggcgaac gactgggcga cgtgcatgac cgtcgaggaa ctgaagaaga tttgggagcc 35100tgaagcacag gggaaggtca cgaactggaa ccaggtccgc ggcgaattcc ctgacgccaa 35160gctcggcctc tttggcgccg gcacggattc cggaacctac gactactaca cgttcgccat 35220taacggcaaa gagcatgcca gccgcggcga ctataccgcg accgaggacg acaacatcac 35280gatccagggc gtcggcggcg acaagaatgc gatcggcttc ctgggtctcg cctatctgac 35340cgagaatgct ggcaaggtga aggctgtcga aatcaagcag gccgatggat cgtgcgtggc 35400gccgtccatc gagacagcca ccgacggaac ttaccagccg ctcacccgtc cgcttttcta 35460ttacgcttcc aagaagtcag ccgaagaaaa ggaacatgtg cgtgccttcg cggagttcct 35520tttcgatgcc aagaaccagg aagaactcgt cagcgaggtc ggctatgtcg ccctgcctgc 35580cgaagccgct ggccttgctc tgaagaagtt cgaaaagcgt gtcaccggga gccacttcga 35640aggcggttcc aaggtcggcg tgacggtcac cgacctggtc gccgacgcag ccaactaaca 35700tcccaaccct cccggcagtc gcgagtactc gcggctgccg tcagtggagc tcaagatgcc 35760aacaacgctc gacgcctata ttccaagcga cgcttttctg aaacggcgac gtatcatcga 35820cctgtcgatg cgcgtgttgc ttttcttgtc cgccgctctc tcggtgcttg tcaccgctgc 35880catcgtttac gtgcttgtaa gcgagtcgtg gaatttcttc accgaggttt ccctttggac 35940gttcctgacc gataccgagt ggacgccggt ctttgcgcag cctcgctacg gcattctgcc 36000acttcttaca gcaaccctct gggccgccgg gatcgcgatt ttgatcgcaa tccccttggg 36060aacaagcctc gccgtctacc tcagtgagta tgcgcgcccg gccgtccgcg aaaccgtcaa 36120accggtgctc gaattgctcg gcggcgtgcc gaccgtcgtc tttggttatt tcgctctcct 36180gtttatcact ccactgcttc agacgttcat tcccggcctg accggcttca accttctggc 36240tcccggtatc gtgctcggca tcatgatcat gccctacatc gtctccatca gcgaagacgc 36300gatgcgtgcc gtgccggcct cattgaggga aggcgcttac gctcttggca tgacgaggct 36360gcagacgtcg ttcagggtca tcattccggg tgcgttctcg ggcatcaccg cagcgtatct 36420tctcggaatg tcacgggccg taggcgagac catggtgctt gcaattgccg caggacagaa 36480ccctaatctc accgcagatc ctcgcgaagg cgctgcaacg attacgtcct atatcgtaca 36540gatgagcctc ggtgatctgc cccatggctc gctggcatat caaacgattt tcgctgcagg 36600cctcgcactt ttcgtgctga cccttgtttt caacatcatc ggcttctttc ttcgccgccg 36660cttccgggag gcttactgat ggctatcaca gcagacagcc caatcgtggc tctcgacatc 36720gattcccaga cctcgctcgt caatcgagca cgacgcaacg acttcatatt cgccggcttg 36780ggtctcacca tcttgttcgt ggttatggct ttcttggtcg cgttgatagc cgaccttttc 36840tacgacggac tgggccggat cgattacgcc ttcctgaccg agtttccgtc acggcgaccc 36900gcagatgccg gcatcctttc ggcctgggtc ggaacctgcc tggttatgtt cgtcacggct 36960ttgctggcca ttccgcttgg tgtcggtgcg ggtctttacc tcgaagagta tgcgagaaag 37020aactggatga ccgacgtcat tgaaatcaac gtcaccaatc tcgctggtgt accgtcgatt 37080atctatggtt tgctcgcgct cggcttcttt gtctatctcg ccgatcttgg ccggacggtt 37140ctggtcgcgg gcatggtgct tgcgctgctg atcctgccga tcgtcatcgt tgcgacgaga 37200gaggctataa gggcgatacc gcagacaatc cgcgaaggcg ccttcggtct cggtgcggac 37260aaatggcaga ccatgtggca ttacattctt ccggctgcgc ggcctggtat ccttaccggt 37320gcgatcgtcg gcttgtcccg agccatcggg gaaaccgccc cgatcatcac gatcggcgct 37380ctgaccttca tcgcattcct tcctcctgcg cctgtggatg cgagctttcc ctttatcaac 37440tttgattggc tgaatgcgcc gttcaccgtg atgcccatcc agatgttcaa ctggatatca 37500cggccgcagg cagcgtttca catcaatgcc gccgcgactg gtgttgtcct gatgttcatg 37560acgttgggca tgaatgccgt cgccatctgg atacgcttca ggcttcgacg caatcttggc 37620ctctaactga gatcggacca aaaatgaacg acacttcgac cgtcagtaaa cctgccagag 37680tgggccagca aacaggttca gcgcgcaaca ttctgatcca tcccgaacgc ctgcgcgctg 37740aagtgaggga tctcgatttc tggtacggag aattccacgc gctcaagaag gtcaaccttc 37800ccgttgcgga aaagcaggtt actgctttga tcggcccgtc aggctgcggc aagagcacgc 37860tcttgcgatc gttcaaccgt atgcacgatc tttaccctgg caaccggtac gagggcgcga 37920ttgaactgct gccggaaaag aaaaatttag tggctcaggg catggatccg atcctgatcc 37980gcttgagcat cgggatggtg tttcagaagc caaacccgtt tccgaaatcg atttatgaaa 38040acgttgcagc cggcctgaaa atccgtggca tcaccaagaa gagccttctt gatgagcgag 38100ttgagcaggc tcttcagggc gcggcactct ggaatgaggt gaaggaccgc ctccatcagt 38160cagcctatgg cctttcggga gggcagcaac agcgtttgtg catcgcccgt acgctggccc 38220ccaatcccga aatcattctt ttcgatgaac ccacatcggc tctggacccg atcgccaccg 38280cgaaaatcga ggagctcatc gcggagttgc gagaccagta cacgatcgtc atcgtcacgc 38340acaacatgca gcaggcagcg cggatatcga catacaccgc ctacatgcac ctgggcgaga 38400tgaccgagta caacgcaacg aacgagttct tcacgaatcc gcagaacgaa aaaacgcagc 38460actacatcac cggtcgcttc ggttaagggg gaaacatgac gatggatcac actattcgag 38520ctttcgacga ggaactgcag gacctgaccg gacaagtatc cgatatgggg cgaatcgctg 38580cagcgctcct cgacaagtcc gtcaatgctc tcatcggcaa cgacaagaca ctggcagatg 38640aggtcgtaag ggccgacctt caactcgatg ccatgcagag aaccgccgaa acggcggctg 38700tgcagatcat tgctcgcaga cagcccgtcg cgaacgacct gcgacggatc gtcggggcga 38760tgcgcatggt ttcaaacctg gagcgtgtgg gcgatctcgc caagaacatc gccaagcgcg 38820ctgcaatcat ggatgcttca cttaacaggg gtgttgtctc tgcagggttc agcacattgg 38880ccgaagccgc caaaacgcag ctggctggcg cgctcgatgc tttccagaac aacgacgcga 38940aggcggcatc tcaagtccga ctccaggacg agcacatcga tgtactctat aacggcctct 39000ttcgagaact cctgacatac atgatggaag accagcgctc gatcacattg tgcgctcacc 39060tccttttttg cgccaagaac ctggagcggg tcggagatca tgctaccaat cttgctgaga 39120ccgtcgagta catcgtgacg ggcgatgatg tttcgactga tcgccctcgc gccgaaactg 39180tcgttgcgat ggagtagact tcatgccgag cgtcgttatc gtacaggaag atattggcgt 39240tggctcgatc ctggaagcaa gcttccgcga ggaaggttat atcgccgggg tatgtggact 39300ggccgagcag tgcgaacgta tggtagcaga aaggcaacca gatctggttg ttgtcgattc 39360agtgagccgt gcgaccaatc tccgtcagtc gtttatgaaa atgcgagccc atgtgcgcag 39420aaggcagttg gcgatcatcg tcttgggcgg agaggcgctg cccaagcccc tttttgatgc 39480cggagctgac gattacttgc cgcgcccctt ttccgttcag gaacttctcg ctcgcagcaa 39540tgcgctcctt gagcgttcat gctcgaagac gaccaggata ttgaaccatc gcgagatatc 39600cctgaacgtc gaaacgcaca gggtttcgcg gaagggacgg gagatccacc ttggtccgac 39660ggaatatcgt ctcctgcaga cgatgctgac agaaccgtcg cgactgtttg cgcgtcgcga 39720gattcttgag atggtgtgga acgacaccag ccgggatgaa cgcatcgttg atgtcagcat 39780caagcgattg cggaagtcct tgaacatcgg aagcaaggaa gacgcaattc gtactgtgcg 39840cggctgcggt tacggcctgc agtaatagcg atcagggtag actgtttccg attgccctca 39900actgcgtttg aagggacatc ctgtcgatcg actcgatcgg aagcgcggtg aagacggaga 39960gcctgttggc gatagcgtct gccgcccgtc gaaaggcggc gagcctttgc agttcacttc 40020cctcaacaag cgtgggatcg tcgatagccc agtgcgctgt aaaaggctga ccgggccagg 40080aggggcattg ctcccccgtc agtgtatcgc aaacggtgaa gacgaaatcc atagcgacac 40140ggttgagacc tttgaactcg tcccagctct tgggcctgag gttctcgatt ggacagtcca 40200tcttctgaag tgttgcgagt gtcatcggat gcacctcgct tgcgggaaga tttcctgcag 40260agaacgccgc aaaccgcatc ggcgccatct tgcgcagaat ggcctccgcc atgatcgatc 40320tggcagaatt tgcgcggcat aggaaaagca cattgaaaat gcgtggtacc tgttggtctg 40380gcttggttct ggtcgacgag gttttgccag ccatgggggt aaagtccgtc gccaaaaact 40440cgaccagcct ccagacaagt tcggtgttcg gccgataaat tatcgtggtg ccaacgcgtt 40500gggtctggac cagtccagca cgcttcaaca cgttaagatg agacgacatc gtattttgag 40560gcacatcgag cagtcttcct atgtcgcctg agggcaatcc ctccggcgaa tgatccagga 40620gaagacgcag tgcatcaagt cgggtggttt gcgcgattgc agcaaatgcc tctacgatag 40680ccgatttttc cataagtctg gatatataga ttttcgttta gttgagcaag ttgcgttccc 40740ttggcgggcg acaataaatc cgtatttctg gaaatgtgca gttctgtcat atttctgtgg 40800cgcaagtgcc gaataagcgg gtgtctgttt tggatcgatg gagaacctga tgaaaaagct 40860cgtggccgca ctggcgataa ccgtagcatt tgcaatgcct gctcaggcag aattcaaact 40920cgacgcccgc tacacggatg cggacggtga catggtcgcc gacattccga cggatgccag 40980ccagctcgca gaccctgata cgctggtgtt cgcctataca ccggtcgaag atccggctgt 41040ttacgccgat gtctggaaag gctttctcga tcacctcgcg gaaaagaccg gcaagaaggt 41100tcagtttttc ccggtgcagg aaaacgccgc tcagatcgaa gccatgcggg ccggtcggct 41160gcacgtgtcc ggctttaata ccggttccaa tccgatcgct gtcgcctgtg ccggcttccg 41220gccgtttgca atgatggcct ccaaggacgg cgccttcggc tacgagatgg aaatcattac 41280ttatccaggt tccggggtcg agaagatcga ggatctcaag ggcaagaagc tcgccttcac 41340cgccgagaca tccaactccg gtttcaaggc tccatcggca ttgctgaagt ccgagtacaa 41400gctcgaggcg ggcaaggatt ttgagccggt tttctcgggc aaacatgaca attcggtcct 41460cggcgttgcc aacaaggact acccggctgc ggctgtcgcc aattccgtca tgaagcgcat 41520gatcgcccgt gatgtcgtca aggcggacca gattgtctca atcttcaagt cgcagacgtt 41580cccgaccaca ggttatggcg tggcccacaa tctgaccccg gaactgcagg aaaagatcaa 41640aggtgccttc ttctcctaca actgggaagg ctcggcgctc ctgaaggaat tccagacatc 41700ggagccgccg caggaaagtt tcatcccgat ctccttcaag gaaaactggt ctgtcgttcg 41760ccagatcgat gaagccaacg gcgtcaccta cgcgtgcaaa taagcacgtt tgaccaataa 41820gcgccgggtc gtacgcgacc cggcgcttac tcatgtttta aaggcgggga acgagaatgc 41880tcaggatcac ggggctcacc aaaacctaca aaaccggcga caaggcgctg aacgggatca 41940cattggaaat ccctgccggc caggtggtag gtttgatcgg tccttcggga gccggcaaat 42000ccagtctcat ccgttgcgta aatcgactga ccgaacccac gtcaggcaag atctttctag 42060gcgagcgaga cgtgaccgcg ttgtctcggt ccgatctcag ggtcgcgcgc cgccgtatcg 42120gcatgatctt ccaggaatat gctctggtcg agcggttgac cgtaatggaa aacgtgctct 42180ccggtcggct cggctacgtg cctttctggc gcagtttttt acgccgctac cccgcaggct 42240acgtgcagaa cgcattcgca cttctggagc gcgttggttt gacggcccat gccgacaaac 42300gcgccgatgc tctctcaggc ggtcagcgac agcgcgtcgg tatcgcacgc gcgctggagc 42360aagaccctga actgcttctg gttgatgagc cgaccgcttc gctcgaccct aaaacctcac 42420ggcaaatcat gaggctgatc gtcgagatct gcaaagaacg aaacctgccg gcggtcatca 42480atatccatga cgtcctgttg gcgcaggctt tcgttcaacg gattatcggc ctgcgtgctg 42540gcgaggtagt cttcgacggc acgcctgacc aactcgacac agctgcactc acccgcatct 42600atggcgaaga ggactgggtt gccatgcaga agcaagccca ggatgatgcc gaagaagagc 42660tccttgcagt tattgaacga gaacgggcgg aagagcgctt ggcaggagcc ttgtgatggc 42720ccatgtactc tcgacgagct atccttcggt gtggcggcgg ccaccactgt tcatcaggtc 42780ggcggttttg cgctggctga tctatggggg cgcgctgatt tatatcatcg ttgccgttgc 42840gaccatcgat gtaaactggg cgcgtgccta cgaagggctc gatcgcggct ggcgtttcct 42900tcaaggcttt ctggtcccaa actttaccac gcgctggcgt gatatcgcac agggacttga 42960agagagcctg acgatgacgt tgacttcgac tatcgtcggt atcctcgttt ccatcccgat 43020tggcatcgga ggggcgcgca atcttgcgcc agcgcccgtc tactacgtgt gccgctcaat 43080cattgccatt tcgcgtgcct tccaggagat catcattgcg atcctgctcg ttgcaatgtt 43140cggtttcggc ccgttcgcgg gtttcctgac gctcaccttc gcaacgattg gctttatcgc 43200caagctcctc gctgacgcta tcgaagaaat cgatgaaaag caggcagagg ccatccgtgc 43260caccggcgcg tcttggctgc aactcgtcaa ctatgcggtc caaccacagg taatgccgcg 43320actgataggg ctttcgctct accggtttga catcaatttc cgtgaatcgg ccgtcatcgg 43380catcgtcggg gcaggaggta tcggtgcaac gctcaacacg tcgattgacc gatacgagta 43440cgatagcgcc ggtgctgtgc tgatcctcat tatcgtcatc gtcatgctcg ccgaatacgg 43500ttcgagctta attcgcaagc gggttcaata atgccagttt cacattccct tgatggcagc 43560aagacatggc gcaagctcac gccgagccgc gagctcattc agtggatcgg ttggctgcta 43620ctcgtcgcct tcttcatgtt ctgctggcag atcatgacaa aagatacgat ctgggcgttt 43680atttacgatg cgccccggca aggcggcgac attcttagcc gcgcctttcc acctcgcctg 43740ttttatgtaa gcgagctcat cactccgctt tgggacacgc tcaacatggc gacgcttggg 43800acgctttttg gcactgtgct ggcggtgcct attgctttcc ttgccgctcg caacaccacg 43860cccagcctgc ttgtccttcg gccgatcgca cttttcctga tcgttgcatc acggtccatc 43920aactcgctga tctgggcatt gcttctcgtc tcgatcctgg gacctggact gcttgccggc 43980atcattgcga tcgcccttcg gtcaattggc ttcgtcggaa agctccttta cgaaacgatt 44040gaggagatcg accagaagca ggttgaagct atctcatcca ccggggcaag tcgcatacag 44100gttatcgact acgcgattgt gccgcaggtc ctgccttcgt ttctgggaat taccgtgttc 44160cgctgggaca tcaacatcag ggaatcggcg atcctcggcc tcgtcggtgc aggcgggctc 44220ggcctcaagc ttcagtcctc tttgaacatg ttggcctggc cccaggtaac gacgatcttc 44280atcgtcattc tggccacggt tatcctggcc gagtgggtct cggcagctgt acgcaaggcg 44340ctcgtgtgag cctgtttaac gtcaaggctt tcgggtcccg ggcaaggccg tctgcagtgt 44400tgcagtctaa gttcgtgcgt tcttattcaa agtcgagggc aggcgctgct gaacaaacgt 44460gttgacttcg tccataattc cagtaatctg gatatatgga acaggaacaa gcaattctcg 44520ctcttgcagc gctcgcgcaa ccaacccgtc ttgagacttt tcggttgctc ataaaacacg 44580cgccggaggg gctgccggct ggcgatatag cgcgtgcgct cgtggtgccg caaaatacca 44640tgtcggcgca tttgaacatt ctgtcgcggg ccgggctcgt aacctcgcaa cggcacagca 44700ggatcatcat gtaccgcgct gagctcgaac agcttcgcga tatgacgcta ttccttctga 44760aggaatgctg tggtggatcc gctgaattgt gtgcgccact catcgctgaa ctgacaccgt 44820gctgtgtccc gaccccgcag gaaagtctcg catgagtgcg ctcagggtag aacgattaga 44880cgggagcgat ctcgaatcag gcagcgacat gttccttgct accaagaggg catcgccgct 44940ttttgcctgc ctcgtgttca tcgaagtttg acgggaaaat ctgccagccg cagtgcttgc 45000cacacggcag ctgtcctctc tgcccatcat cggcgacgat catgaaatct acccgaccac 45060taacttaaca cacggatcac agacatgacc gaaaagacct ataacgtgct cttcctgtgc 45120acgggcaatt ccgcacgctc cattcttgcc gaagccatcc

tcaacaagga aggcggcggt 45180cgcttcaagg cttactccgc tggcagtcag ccgaagggcg aagtcaatcc gcacgcgctc 45240aaggaactcg cggcgctcgg ttacgcctca acaggcttct cgtccaagag ctgggatgtg 45300tttgccgagc cgggtgcgcc acagatggat ttcatcttca ccgtttgtga cagtgcagcg 45360ggtgaagctt gcccggtatg gatcggtcac ccgatgacag cccattgggg cgtcgaggat 45420cctgcatctg tcaacggaac cgaagtcgaa attcagcggg cattcgcgca ggcggcgcgg 45480tttctgaaaa atcgtatcac ggcattcctg agccttccgc tcgaatccat tgatcgcctg 45540gccctcgaaa cacggctacg gcagatcgga acgatggaag gaacgaccgg tgttcgggaa 45600gcgaccaatt aaagccagat gacggattcg gccgaagtga agaaacgcgc gccgttaatt 45660cgtcggccct cgacctccat actttctctc cagtcaaaca aaaggcccga cgtcgcatga 45720ccaaccccgt cgatatcgtc atctaccaca acccggactg cggaacttcg cgcaacacgc 45780ttgcgatgat ccgcaacgcc ggcatcgaac cccatgtggt cgagtatctc aagaccccgc 45840cttcgcgcgc gctgctggag cagttgatcg accggatggg aatttctgcg cgtgaccttc 45900ttcgcgaaaa gggaacaccg ttttccgaac tcggtctggg cgacacatcc ttgtcggatg 45960agcaactggt tgatgcaatg atggaacatc ccatcctcat caaccgcccg atcgtcgtca 46020cgcctgccgg tgtcaagctg tgccgaccat cggaagtggt gctggatatc cttccagccg 46080atcagcaggc tgcgtttacc aaggaagatg gcgaagtcgt cgtcgaccag accggtcgtc 46140gcgtggtcta acgtaagtca attcaagctg aacgcgtgtg accgcagtct tcgttgcaag 46200gctgcggacg atgtttatct gccaaggaga gcgccaatgc gtcccgaaga accaacactg 46260cgcctgtcgt ttctcgaccg ctatctgacc gtctggattt ttgccgccat ggcactgggt 46320gtgctgctcg gtaccgtctt taccggcctg cctgcagcgc tcgacagcct ttccgtcggc 46380accaccaata ttccgattgc catcggcctc atcctgatga tgtatccgcc tctggcgaaa 46440gtgcgcttcg aggaattgcc gcaggtgttt gccgacaagc gggttctggc gatttctctc 46500ctgcagaact ggataatcgg tccggtgctg atgtttgcac tggcggtgat ttttctgcgg 46560gactatccgg aatatatgac cggtttgatc ctgatcggtc tcgcccgctg cattgccatg 46620gttctcgtct ggaaccagct tgcaaggggc gacaaccagt atgtcgcggg cctcgttgcc 46680ttcaattcga tcttccagat cctgtttttc agcgtctatg cgtggttctt cctgtccttc 46740ctgcctccgc tgtttggcct tgaaggcagt gtgatcgacg tctcgttctg gacgattgcg 46800gaagcggtgc tgatctatct cggtattccg ttcctcgccg gttacctcac gcgccgcttg 46860ctgactgcga aaaagagcag ggattggtac gagaacgtct tcctgccgaa gatcagcccg 46920atgacgctgg cagcccttct gttcacgatc gtcgccatgt tcagcctgaa gggtggggat 46980gtggtccgcc tgccgggcga tgtggtgatg atcgccattc cgctgacgat ctactttctc 47040atcatgtttc ttgtcagctt ctggatggcg aagtccgtcg gcacggatta tccgcgcacg 47100acagccgttg cctttacggc ggccggcaac aacttcgagc ttgccattgc ggttgccatt 47160gctgcttttg gtttggcctc gccggtcgca tttgccgcgg tgattggccc cttggtcgaa 47220gttccggtgc tgatcttgct ggtgcaactg gcactctgga tgggccgcaa gtattttaca 47280aagtcggccg gaaacccggc tgcgtaaaaa gtaaggaagc gcaatgtctt cggacatttt 47340cgatgtcgtc gtgatcggtg cgggccaggc tggcctcgca tcggcttact atctgcggcg 47400tgccgacgtc agattcgtga tccttgatgc tgaagaaggg cccggtggtg catggcgaca 47460tgcgtggaat tcactccatc tgttttcacc ggcatccttt agctcgctgc cgggatggat 47520gatgccggcg aagaccgagg cggcctatcc gtcaaggaat gaggtggtcg attatctggc 47580gcgctacgag gagcggtatc attttcccat agaacgcccg gtcgcagtga cgtcggtccg 47640caacgtcgaa ggcgctctgg aggtcgtcgc cgatagcaga cagtggcgag cgcgtgccgt 47700tctgagcacg accggcactt ggcgacatcc tttcgttccg gactatgccg gtgcctctgg 47760cttcaagggc gtgcagattc attcggcgga ttatgtctcg gctgatccct ttgtgggcca 47820gcgggtcgcc atcgttggcg gcggaaattc cggggcgcag atacttgccg aagtatcaag 47880ggtcgccgaa accatctggg tcacgcctca ggaaccggtg tttttgcccg atgaagtcga 47940tggacacgtg ctgtttcagc gcgctaccgc acgggtgctt ggcggggaga gtggcccagc 48000agttggcagc cttggtgata ttgtcatggt tcccccggtc cgggacgcac gggatcgcgg 48060cgtgctgggt tcggtgcggc cattctcaaa ctttgatcgg gatggcgtcg tctggcagga 48120cgatactaga agcgatcttg acgccgtcat ctggtgcacc gggtttcggc cagcgctcga 48180tcatctccag gatctcggcg tgatcacgga cgatggcagg gttgatgtgg atgaggggcg 48240ctcgattaag cagccacgcc tttggcttgc cgggtatggg aattggaccg gggctgcctc 48300ggcgacgctt ctggggtcag gccggacggc ccgcgagatg atcccgagac ttgtcgcggc 48360gctgtaggcg cgcaatcccg atgaatgcga caattgcact tgcacccagc gtggtggtaa 48420tgacgagcga ccacagcgtg ccgatatggg ccatggcaaa cgctagcgca aagggtgcgg 48480tggccgacag gatcaaccgt gcggccatga ccttgccttg cagcctgccg tagccatcgc 48540tgccaaacag catcagcggc aaggtaccgg tgacgatgct gaaaagaccg ctgcccaaac 48600cgaagacaac ggcaaaagcc atggctcctg ctaccgacgg agcggtgagg gtcaggatga 48660gtacgccccc ggggatcaat gtggcggcaa tcgttgccaa agcgagcggc ggcagattgc 48720cgccgagcac catgttggca aaccggctca gcacctgcga cggaccaaac agcgtgccga 48780caatggcggc ggtggcccca aggccaagcc ccgacagcag cggcaccata tgcaccagga 48840tcgccgcact gacgagagat tgcagcgaga accccaccac catcagcttg aacccgaact 48900gccggacgtc cgggctgaga cttccctcca cgatctgcgc cgtgccggct tgtttctgtg 48960ctctaccctt ggcaaggccg taagacagcc aggcgtggag cggcaggcag acgagcaagt 49020tgagcgcggc gaacaccagg tagacattct gccaggagag atgggcgtgc agagccgttg 49080tgatgggcca gaagatcgtt gaggcgaagc cggcgatcag ggtcagatag gtgatgctgc 49140gctgggcggt gcgggggctt gcctgcacca gcagcgcgaa ggcggcgcca tattgcacga 49200gattggcggc gatttcgacc acgatcaggg cggcgacgaa gccgctcttg cccggcgcat 49260aggcacagac gatcagcgcg gctgcggcaa tcgcggagcc ggccgtcatc acctgtcctg 49320cgccgaaatg atcaatggcc cggccaaggt agggcgcagt caagccgcct agaagaagtg 49380ccgcggaaag tgcggcgaaa atccactccg tagaccagtt caggtctcgc gccatatcgg 49440gtgcaaggat gctgaaactg tagtagaggg ttccatagcc aatgatctgg gtgaggccca 49500gggcaaggat agtgccgacc ggcgggcgct cgctcatatt gatttcagat ccacgcgctg 49560ttcgagcttt gcggcctctt ccttcctctc gctatagcgg tcggtcaggt agtcggaggc 49620atcgcgggtc agcagtgtga acttcaccag ttcctcgcag acatcgacga cgcgatcata 49680ataggcagag ggtttcatgc gaccctccgt gtcgaactcc tgccaggcct tggcgaccga 49740cgactggttc ggaatggtga tcatccgcat ccaacggccc agtatccgca actgattgac 49800ggcgttgaac gactgcgagc caccggagac ctgcatgacg gccagcgtct ttccctgtgt 49860cggtcgcacc gaaccggtcg tgagggggat ccagtcgatc tgggccttga tgatgccggt 49920catcgcgccg tgccgctcgg ggctgaccca gacatggcct tccgaccaca gagaaagctc 49980gcgcagttcc tgaacctttg ggtctgtatc cggcgctcca tcgggaaggg gcagaccctc 50040gggattgaag atctttacct cgcatccgag gtgctcgaga agccgtgcag cttcttccgc 50100caaaagacgg ctgaacgaaa tctttcgcag cgatccgtag aggatgagga tccgtggctt 50160gtgctgcgaa taagccgggc gaagcgcgtc aaggtcgggc tgggaaatga gatcaagcga 50220ggcggctggc agatcggcca ttggggctac tccgtattgt aggatttagg cgtttgtatt 50280ccggggccgt tatgaatctg atccggcaag ttctgggggc acgtcaccgc cgtcagattg 50340acccgaacaa cagttctcca tcaggaaatg agcgaggccg ttgagggtct cgaagctcgc 50400gctgtagacg atggagcgtg actcccgctg agcactaatc agaccagcat gttccagttc 50460tttgagatga aaggaaatgt tggaaggcga gacgttcaca gcttcggcaa ttatacccgc 50520cgccaatccg cccggaccgg cgacgacgag cttgcgaatg acctgcagtc gggtctgctg 50580tgacagtgcg cgaaacgcat ccaggacctg ccgctcgttc ataaaatcca atcctcgtaa 50640aagcgttcta aggtgccagg atatacaagg cttcggcacc tgcgggggat gatcgtattt 50700cacaccccac ttgttttcat atttcaacta atattgaaat tatgagttag ttgcggctac 50760gtcaagaagt gttttgcccg tcagtggacc agaagcagcg gaagatcggc tgcagccaaa 50820acttcccgcg tttcgtgacc catgagccat tccagccact cgctatgact aaaagccccg 50880gtgaccagaa cgtccgcttt cagggcatcc gcttcacgga cgagctgcgc gccgatcgtt 50940ttgtcggaac ggggcagaat atgaacttct ggtgtgacgc ctgagccttg catcacagta 51000tttagcgtcc tatcggcgtt gctttcatcc gttacgcgaa gtgcgctgac acgttctgcg 51060gcttcgagcc atggtccggc agtctctatt gcgcggcgag ctagatcgct gtctgtgagg 51120cccacggcga catgcgaaaa ccttgcgcgc gctcctgctt tccaaccggg cggaaccagc 51180agaaccggcc ggtgcgccgt gaagatctca gcgtggaaag catcggcggc atccatgttt 51240ctattatgcg acaagacgac gagggcgata tccgcggtcg tctcccgtaa aacggtctgc 51300gcctccggcc cggtaatcgt gcgcaattct atcgaaggcg cttcgggtcg caaaactata 51360ttccattcgc cgaacgcgga tttgatagcg tccgcacgct gttgcagcga gccttcgtca 51420tgggtgcgaa gctcctgcat gtcgatttcc tcgggagggc agacgagatg tgcaggatcg 51480acgatgacat tcaacgcttc gatcgacgag caggtcacgg atgctgccgc cataactgca 51540gcatccatcg ttcccgcgac tgtatcgcct tttgtcagta cagccagaat tctcatgtta 51600gtgctcccat catttcccga accgtgcagc accaccaagt tctgcctcga tctccagcag 51660ccgattgtat ttcgcaatcc ggtcagagcg cgaggctgaa cccgtcttga tctgaccgcc 51720acccatggcg acagcgaaat cggcgatgaa gctgtcttcc gtctcgcccg agcggtgcga 51780aatgacatag ttccagccgg cattacggca gagctggatc gcgctgatcg tctcggtcac 51840cgtgccgatc tggttgagct tgatcagtgc cgcattgcag gccttctcct cgataccctt 51900tgcaatgaag tgggtattgg tgacgaggtt gtcgtccccg acgatctgaa tccggtcgcc 51960gagagcgttg gtgatggcct tgtagccgtc ccaatcgttc tcatcatggc tgtcctcgat 52020cgagacgatc gggaattttt cgacccaggt ctcgaacagg ctgaccatct cctcggacgt 52080cttgtttcct tgcccgctgc gcgtcaggcg atagagcccg tcctcaaaga acgaactggc 52140agcaggatcg agcgcgatag caatatcgtc gcctggccgg tagcctgcgg cctcgattgc 52200ttcgacaatg acctcgcagg cctcctcgtt gctccggagc ttcggtgcaa atccaccttc 52260gtcgccgaca ctggtgctga gaccgcgctt cgacaggata gatttcaggg catgaaacgt 52320ctcggcccca aaacggaggg cttcagcaaa tgttggcgca ccatgcgggt agagcatgaa 52380ttcctggaaa tccatgccgg aatcggcgtg catgccgcca ttgagcacgt tcatcatggg 52440gatgggcaga tggacggccc caacgccacc cagataggcg taaagaggaa ggtcgtggct 52500tgcggcggcg gcccggcaga gcgcctggga aaccccaagg atggcattgg ctccaagctc 52560ggatttgttc ggcgagccgt cgagttcgat cattgccgcg tcgagcgccg cttgatgtga 52620aggatcccgt cccttcagaa gaggagcgat ccgctgattg acattgtcga cggctttacg 52680aacgcccttg ccaccatagc ggctggcgtc accgtcgcgc agttccacgg cctcgttggc 52740gccagtggag gcgccggagg gaacggacga ggtgccgaca atgccattgt cgagatgaac 52800gctgacgcga agcgtcggat taccccgcga atcgaggatc tccagggcgg tgatgttttc 52860gatgaaggct ctcatggact tgctcctgct gccgagatgg cggctttagt gctttccaat 52920cgggaaatcc ctagattggg cggttggcat cttctatttc tttttctcga tctgatcgaa 52980acgaccggta ctcccaccga cctgtttgag ggtttcgtcg tcgccatacc tcctccagcc 53040agaatacgtg atcatcgact ggtataactg gaaaccaggc gtaccactcg cgccacaagc 53100attgttcctt caccatggcc caatcctccc agttgttatc tcttggtctt aagccctgta 53160cgcgacgagc acggctcatc ccgcgatcat cacgacaccg agccagttcg gaagtgtcag 53220gcgttcgccg aggaacagga cggcaaagat ggaaacgaag acaaccgaca acatgtcgat 53280cggcgcgacg cgggccgcgt cgccaagctt cagcgctcga aaatagcaaa tccaggatgc 53340gccggtcgcg aggcctgaaa gcacaaggaa taaccagctt ctgctggaga ccgacgacgg 53400ctcctgccag ttgccggtga tatagaccat catcccagcg gcgagcagaa tgacgatggt 53460acgaatgaag gtggcgaatt cggagttcga cgccgatctt ggcgaagatc gctgtcagcg 53520ctgcaaagcc tgctgacatg agagcccaca ggggccagct ggcaaggagg cttttcatgt 53580cgcttgtcct tgcccaatga gccgtatcaa cgtgagacca gcaaacagtc cagccatcga 53640aagcaccagc gaagccaagc aagcgtgcgg cggcaatatt gacggcgtgc cgggaaacac 53700cacccaaacc cgctccgagg aacacgatca gatagaccaa gaccgtctcc ttcaggatgt 53760cgtgactttg agtgcttctg ccgccgccac gttgtgatgg acgacgtccc actgttccag 53820gtgcttgtag acgatcacct tgtttttcag gagcgcgcca tgagtccggc agaattcctc 53880aagcttgtcg cgcgacgcaa tcatctcgac gcacatggtc agatccggat tggggatttc 53940gaaaccctcg tcctgaagct tgccgctgtt cgaatatccg aagtgtgtat ggtgagcgac 54000ggcattcata attcctgctg acttcgcctg caggaccagt tctcgataga gcggcttggc 54060accaaaccag ctactcttgc ctgaggtctt ctcccgcggt ttcatataga tacggaccat 54120gccgatttcg gtggaatgca gcctgtgttg cgtcacgatg atgggccttt cggtgagggt 54180tgcggtggta gcaagggacc ggagccggac cttgccgaca aagtcgccga gcgcattggc 54240gttcatgtcg cgcatatggc gaaccgagat gtcaggagga atgtcgttgg ccgcagctgt 54300cttcggcacg cccacgcgct gcgaaaggta gatgctggaa tggccgctgc agaggtaggc 54360aacgaagcag gcgaccgcga tgtagacgga gtgggttgcc ccgaaaagct cgatgcccat 54420gatcatgcaa gcgagcggcg tgttggtcgc gcccgcgaag acggcgacga aaccgagagc 54480ggcaaatagg tccggtggcg caccgagaac gcccgcgaca gcactgccga gagccgcacc 54540gacgaagaac agcggcgtca cctcaccacc cttgaagcca gcgcttagag tgatgatcgt 54600gaacagaccc ttccaggccc aactccagta atcgatgtga tctgggcgga agaagccgag 54660gatcgttgca tcctcgggat tgggggacca taccccaagc cccagatatt ctcgtgttcc 54720aagggcgtag accaagccaa gcaggatcaa gcttgcgaga accggacgca gcggggcata 54780gggcaggatg gccttgtagg cggacgatgc caggtgagaa agttctgcga agaaatgcgc 54840tgccagtcca aaggccacgg aggcaatcac aaccttcagc atcagcacgg cgtcgaggtg 54900aaagccgatg ccttcaccag cgccgctcag ataggcgatg gcataatgtg tatgcccaat 54960gctccaggcg tggcaggtcc agtctgcgac aatggcggcc agcaaggcag gaagcaatgc 55020ctcgtattgc atccggccaa ttgtcaggac ttccaaggca aagaccgcgc cggcaatagg 55080cgtgccgaag actgcaccaa acccggccgc aatgcctgcc atcaacagga tacgaatgtc 55140ggcggatgtc agtttaaaga ccttaccgaa ggcgctcgca aggctgccgc ctagctgcac 55200ggcggttccc tcgcgtccag ctgaaccgcc gaccagatgg gtcagcacgg ttgtgacgag 55260gatgaacgga gccatgcgca gtggcacgcc gccacccggc tcgtggattt gatcgacgat 55320cagattgttg ccgccctcgg cggacttgcc aaactttccg taggcccaca ccatagcaaa 55380gccagccact ggcatacaga agatcagcca aggaaactcg aaccgtagtt ctgtcgcccg 55440atcaaggctc cagaggaaca gagcaacgag cgatccgacg gctattgcca tcggaatgac 55500aatggcgatc cactttgcga gactgcggat ttgctgaaaa cgaaggccga ataatgatgc 55560gagcgtcatg cgaaagacac tccaccaaaa ctgtcagcag atatgagaaa acacagaaaa 55620tgaattccag acacgaccct actccttcgc gttatgcgcg ttgagtagga gtcatcagct 55680tcatcgagga agcggttcgg cgtaatgccc ggcagaatcc attaccgttg aggttaaata 55740ccgttggaaa gtaactagag tcaaggtccc tcatcccgct catcggagtg atcccgtgca 55800gatagggcaa gacagactgc ggcgatcacc gggacggtga acaggccggc tatcgtgatg 55860agctgcattt catggcccca actcaaagtc cgcccaaatc gggtagcggt cggaagcgac 55920gtcggttgtg tcattgctgg cgactgcgta tcccacggcg cgtcagcaag gcgcttgctg 55980gcaagcaggt agtcggaacg gaaagtcatg aactccgtat tcgtgaaacc gcgtgccggg 56040acagtcggcg tcggagtggc ttcaaggctg ttaccgacgt ccacgaaacc ggcccgcaac 56100aacccggcta tcgtggtcct gtccgctgtg ccgtcctcac gggtgtagcg catacgatat 56160cgtgcaggca gcaatgccag atcgtcaggc tcaggatcat ccggcgcgac ggaattgaag 56220tcgccgccaa tcagggtcag tgtggatttc cttgaggatg cctccgtgaa cctgttgatc 56280ctgcttgcgc ttggatggtc gcttcgcaac cgcgtgcgcg ttggcgtggc tctggctctg 56340atcttgctcg ttcccggaat cgcgacgttg tggactacct atcagagcct tatggcgccc 56400gttccgcccc agccgttcct gttggcagtc acaggcacgg gggcgcttgc agtcaacctt 56460tcctgtgcat ttctgctgac agctttccgt cacgagaacg gtagcctgac gagggccgcg 56520ttcctttcgg cgcgcaatga cgcgcttgcc aatatagcaa tcatcgtggc cggtatcgtc 56580acggcctacg cctggcattc cgcctggccg gaccttatcg ttggcctgga gattgccgga 56640atgaacatgg acgccgcccg cgaggtctgg caagccgctc ggaaggaaca cgccgctgcg 56700gcttgaagcg attgtcggtg ggtattccaa aggcgaaagc tgcggacgca tgattaccag 56760gttcacgcat gccgccatac cttcacggca gagatcagca gaatggcggc aagcgccgga 56820aggagcaagg ccgtcggcac gacaccgagc aactgcccgc caatgaaggc gccagctatc 56880gagccgagcg ccatgacgat gaggaatgtc ttgttgcgag cgacaacaga gaagctttgg 56940tcccggctgt agcgcgtaaa gccgaccagc atcgtcggca ggctgacagc aagggagagg 57000ctgcccgcga gtttaatatc tgcaccgaac agcagcacga gcgttgggat gagaagttcg 57060ccgccggcaa cgcccaggag cgaggcgact acaccgatta ccagacctgc caaaatgcca 57120gcgacaatct gcgtcgtgcc agtcacgagg ccagctccgg cggttgcatc gtggccgaac 57180aacagcacca ctgcgatgac gattagcagc accgcgatca ccttatacag gttttccgat 57240ctgaggcggg ttgcccagcc cgcgccaaac catgcaccaa gaagacttcc agccagcagg 57300ttgacgacaa tagtccagtg cgcgacgatc tgatccagtg gaacggtcgc tgcccggaac 57360ggcaaagcga atgcaacgac aacgaggctc attgctttgt tgaggatgac cgcttcgagt 57420gccgcgtacc gaaacaggcc gatgagcagc ggcaggcgga actccgctcc acccagaccg 57480atgaggccgc cgagcgttcc gatcacggca ccccagatga aggctgttgc cgaacgaatc 57540ttacccgtca tttcttgcct cgtatgggtc ggtgcgctgg tgaaatggtc gcggcacgct 57600tggtggagtt catgtcaaag ggactgttgg agcgaaagcg ttttcagaga tcgtatgaca 57660gcgcagcgtt cgatctgcgc tgcgccatcg ttgtaatccg tataaatgtt cacgatattt 57720gatttttgac cgatcgacga tcagacatcc tgagcaggat gtatccgctc actccggcga 57780tgattgatcc gcctaggatg ccgaacttga cccgatcctg catgacgggg tcctcgaacg 57840cgagcaggcc aatgaacaag ctcatcgtga acccaattcc gcagagaagg gagacgccca 57900gtgtctgtcc ccagctggcc gcggcgggca attccgccca tccgcttcga accatgacaa 57960aaactgttcc gaaaatgccg agcagcttgc caagaacgag accggcacca acacccagcg 58020ttaatggctc gatcagagtt gctggcgata cacctgcgaa cgaaacgcct gcatttgcaa 58080agccgaagat cggaacgatg agaaatgcca cgggcttgtg cagaccatgt tccagcttgt 58140gaagcggcga agccgctggc gttgcctcag gagtgccggg agtaagacgg atggggatcg 58200ttagtgcgag aagaacgccg gcaagcgttg cgtgaacgcc tgacatcaaa acaagaaccc 58260acaggaccgc ccccaggacg agaaatggcc aaagccgcat caccccaagg cggttgaaaa 58320gcaccagatt cccgatcaca agtgcggccc caccaagggc gtacagattg acatcggccg 58380tataaaacag cgcaatgacg atgaccgcgc ccagatcgtc aatgatggca agcgttgcca 58440gaaagatttt cagtgatgcc ggcaccctcg gtcccagcag cgaaagcacc ccgagtgcaa 58500aggcgatatc ggttgccgac ggaatggccc agccgcgcag ggcggcaggg ttctcgtagt 58560tgaaggcgat ataaatcagc gccggaacga ccatgccacc ggctgcagcg gctcccggca 58620gaatgcggcg gctccagctc gagagctggc catcgagcat ttcgcgcttg atctccaggc 58680ctaccagcag gaaaaagact gccatcagcg cgtcgttgat ccaatgctgt acgctcagcg 58740gtccaacata gacatgcagg agtgcgaaat attggtcggc aaaaggtgaa tttgccacga 58800tgatggcgag tagcgcgact gccataagca ccaggccgcc tgatgcctca ttgtcgagga 58860actgacgaag cgtagagtta atgcgacccc gcaacgggcg ggactgaatt gtggacatag 58920atctgcgtcc tctgtgcaag agttgttgtt gttctccgta atagggggat ccctggcgca 58980cgcagcacac gccatagcat tcaatatatt catcaattgt gcagatggcc agcaaaaccg 59040gtacttcctc ggacagaacc gggatccctg cacctctgca atacgactca gacatctgga 59100gatttcgtga gcaggtctgc ggcaggaaac ggccgacggg acgggctaac aaggattaga 59160actgcctttc ggaggtgcga tggtcagcaa gcagcgactt ggatcgcccc acccgcaagc 59220gaaccaattc cgctctcatg cgatggcgtc ctggcccagg tccgatcttc cacgatcaac 59280ccgcaagggg tccgctagca ggctgcggcc gctcatggct ttgccatcgc ggtgatcgcg 59340cccgtccccg tgcctttttg gagccatcga gcgggattgg cccgctcccg gatggagcct 59400tcgaaatgtc gcacgatctt gtcctcgcac agtcccacgc cttccagctt tcccgtgacc 59460tgatggtccc ggtcaccgtc ttcgaggtcg acggcgaata tggcgtttat ctgaacagtc 59520aagctgtctc actggcattt cgctgagctc gccggctccc ggaacagcgt ctcgatcagc 59580ggacattccc gccgattgcc ttctgtgcat tgggccacca cgtccttcag cactcgctcc 59640atgcgtttca ggtcggcgat cttttcacgc acgtcgtcga gatgcgcggc ggcaacggcg 59700cttgcctcgg cgcagggctg gtcgcgctcg tcgacgaggc gcagcagttc acggacttca 59760tcgagggaga agccgagctc gcgcgcccgc aagacgaagc gaagccgtcg ctcgtgggtg 59820ctgtcgtagc tgcgatagcc gctcgccgtg cgcggcggct ccggcaggag gccgaccttc 59880tcgtaatagc ggaccgtctc cagattgcac cctgtgcgct gtgcgagttc ggcgcgcttg 59940aggcctttca cgccagcgtg atcgcgcatc caaaaatacc ccttgaccct gtagttgcta 60000cagaccgcac attagcgcct ggataggttt tcgacaagaa gagcgaggtc gaacatgaat 60060gcatcccgac acggaccagc agacgttgca ccgactgcgg caaacctgac gacgccagag 60120cgaagcgagg ccgggcgaca gcgcctggtc gccgtcggcg gcatactcgg cgccatcgcc 60180gcctcgtcct gttgcatcat tccgctcgtc ctgttcagcc

tcggcatcgg cggcgcctgg 60240atcggcaatc tgacggcgct tgcgccctac aagccactgt ttgtcgccgc aacggcgggc 60300atgctcggct acggcttcta ccttgtctac tggaagccgc gacaggcctg tgccgatggg 60360gctgcctgca cgcgcgccgt ccccagccgc ctcgttcaga tcgcgctctg gttcgcgacc 60420gtactcgtcg ccgctgcttt cgccttcgac tacgtcgcgc cgctgctgct ttccgcctga 60480caccaagagg agactacccc atgaggaaga gtttgagcgc tttcactttg atcgcgtcgg 60540tgatgactgc gcctgccgcc ttcgccgccg aacgcactgt gacgtttgcc gtcgacaaca 60600tgacctgcgc ctcgtgcccc tacatcgtga agaccacgat ggcggcaatc cccggtgtcg 60660cgaaggtgac cgtctccttc gaggcgaagt ccgcgaccgt gaccttcgac gacgctaaga 60720cgagcaccga tgccatcgca gccgccagca tgaatgctgg ttatccggcc cacccgacgc 60780agcaaggcag ctagatgact gatcgcgccg taatccgcgc aggtgccgtt ggcgccgtcc 60840tcgccgcgat ctgctgcgcg gcgccgctcc tcgccgtcgg cctgtctctg gcgggtcttg 60900gcacgtggct gacaggtgtg ggtgcagtgg tgcttcccct gatcgtcgcg ggcttcggct 60960tcggcgcgtg ggggccccat catcgccggg caagagccac ggcctatgag acgaagattc 61020gcaaggaagg cgtgaagcca tgaacgattg ctgtgcaacc tcctcccggg acaacccggc 61080cgtttctcag cccgcgacac tggcgagctt tgccgttcga ccgggcgtaa cgtttccgga 61140ttggtcggcg gtcacgtcgc ctgtggtcaa gaacgctctg caggcgatgg tcgggtccga 61200ccacgtgctc aatcgctgga gcggttacga tcccgccacc gacagggtgc gtgttgcgtt 61260gctccgactc tacgccgacc acgggggtgc cccgaccata agcgcgcttg cggagcgtac 61320aaaactcagt gagatggtca tccggccact gctcgacgag ctccgccggc gcgacctcgt 61380cgttctcgat ggcgagctga tcgtcggcgc ctatccgttc agcgatcata acaccggcca 61440tcgggtcact ctggacggac gcacgctgaa tgcaatgtgc gcggtcgacg cgctgggcat 61500cggtgccatg accgatcgcg acaccgcgat cgcctcgccc tgcggccatt gcggcgcact 61560gatccggatc accacgcagg accgagggcg ggcactcgcc gacgtcgagc cacagtcggc 61620cgtcatgtgg cagagcgtcc gttatgaagg cggctgcgcc gcgagctcgc tctgcgcgac 61680gaccgctttt ttctgctcgg acgagcatct ttccgcctgg cgcgacgaac gttccaccga 61740cgagccaggt ttccggctgt cgatcgagga aggactggaa gccggccgtg ctctgttcgg 61800gccgagcctc gctggtctcg atgtggcgtc gaagagcctg gtggtcgcca accgaccctt 61860gcgcacaaac ggtcgcaatg gaggcgctta cgatctcgtc gtcatcggcg ccggctcggc 61920cggcttctcg gcctcgatca cggccgccga tcagggcgca caggtggcgc tcatcggcag 61980tggcaccatc ggcggcacct gcgtcaatgt cggctgcgtg ccgtcgaaga ccctgatccg 62040cgcggccgag acgcttcata acgctcgcgt ggcggcacgt tttgccggca ttactgctga 62100agccgaactg acagactggc gcggaaccgt tcgtcagaag gacacgctcg tgtctgggct 62160gcgccaggcc aaatacgcgg acctgctccc cgcgtacaat ggtatcgcct atcgcgacgg 62220gccggctcgc ctcctcgacg gcggtgtcga agttgacggc gcgcgtattg ccgctggcaa 62280gatcattatc gcaaccggcg cgcggccggc agttcctgct attcctggcc tcgagaccgt 62340accgtatctc accagtacga cggcgctcga cctcgaggaa ctgccgcgat cgctgctggt 62400gatcggcggc ggttatatcg gcgcggagct cgcccagatg ttcgcccgtg ccggcgtcaa 62460ggtgaccctc gtctgccggt cccgactgct ccccgaggcc gagcccgaga tcggcgcggc 62520gctcacgggg tatttcgagg atgaaggcat caccgttatc tccggcatcg cttaccgcgc 62580gatccgcaaa accgagggcc gagcgtcact gaccgtcacg cgtgacggtc acgatgtcca 62640gatcgacgcc gatcaggtgc tgatcaccac gggccgcacg cccaacatcg aaggccttgg 62700gctggccgag cacgggatca ccgtctcggc gaagggcggc atcgtggtcg acgaccgcat 62760gcgcacgacc aaggctggcg tctatgccgc cggcgacgtc accggccgcg accagttcgt 62820ctacatggcc gcctatggcg ccaagctcgc cgccaagaac gccctcaatg gcgacagcct 62880gcgctacgat aacagcgcca tgcccgctat cgtcttcacc gatccgcagg tcgcaagcgt 62940aggtctcacc gaggcggcgg cgcgtgcggc cgggcatgag atccgcgttt cgacgatcgg 63000tctcgatcag gtgccgcgcg cactcgccgc ccgcgacact cgtgggctta tcaagctcgt 63060ggccgatgct gctggcggtc gtttgctcgg cgcccacatc ctcgcgccgg aaggtgccga 63120cagcattcag accgcggctc tcgcgatccg ccagggtctc accgtcgatg acctcgcgga 63180cacgatcttt ccttacctca ccacggtcga ggggctgaag ctcgcagcac tttcgttcgg 63240caaggacatc gccaaactct cctgctgcgc cgggtgagca caatcggcgt caagggcgtt 63300tcctgccgat gatcggtatg acgtcggcgg tgcggttatc gcgccgccgt tccataagct 63360ggcacagcgc gcggacttga cgatgctggg cgagcacggt ttcgacggcg cgccgctcct 63420gttcggcccg ggccgtcccc gccggccgat ccgtcgcgtt gcgccgggct ctcgactcgg 63480caactgcatg gcggaaggct tccagcacct cggaagcgcg gttcgcggtc gcgcgactga 63540cacctgcctc gatggccaga ttcacaaccg tcagcctgcc atcagccacg cgggggcacc 63600cataaaggag gcgcgccatc gcctcacgaa gcgcctgttc cgtggctgca ctgaccggct 63660tcatgatgtg cgttccttca acggcgcgat gagcctgcgt tttctgtcgt tgtccaggcg 63720cagcgcttcg cgttgcagcg gggagagacg cttgtcggcg agaagatcct ccgcctgtgc 63780aatggaggct tcccatggcg ggagatgtcg ctcgacgagg caggcgttgg gacatcggtc 63840gggcgcgcat cgcgacagga ccggcaccga ggctgaaggt ttctcagact cccgcaggca 63900gagcgccgtc aatgggtcga agaagcagtc gttcagatat ccgacatgca gcgtgcgcgc 63960cagatgcgcc agcatcgcct tcaggcgctt gcgatcggcc agttgccccg gaagcgggcc 64020gagttcgcgg ccgacccgct ccagttccac gccgacgcgc ttaccggcgg gtccgcctgg 64080accgtgaccg cgtcgatggt tttcgaagta gtcgatgatg tcgtcgagtt gtccgagcgc 64140cagttcctgt tcgacctcct gcctgaagcc ggatgcggac gagccggcat agccgttgaa 64200catggccacg gaggcgtgct tgtactggat tttgccggcg acaaccccga agggccggtt 64260cgcgatgtac caggccagcg ttcgcctgaa ctgacgggtg ttgaagcgcc agacgtcttc 64320tcccactcgg gggatcacag gactatcgtc cgcgccatat cgctcatcga gatgttctcg 64380gaattggttg atcttcttgg cgatgagtat cggcgtctcg gcattgttcg tctcgcggtc 64440gtcaagggca agccatagcc gctctgtccc cgcattccgg cggaatcgtt ccgaaagacg 64500ctcggcaacc cggatcgcct ggacggcggc ctcgatggtg atccattcga cctgttcgcc 64560gcgagcgccg cgatccttcc aggtcacgcc ctcgatcgcc agcctttctg ttcgcccgtc 64620ccggtcgaga ttccgtttca ggcagccgga tcgcagcgac tgcacctcac cgtcgcgcat 64680gcccgtcaga tagcaacaca cgatataggc ggccgtctgc aggtgccgtt cttcccgcgc 64740caggctgatg gcatcgaagc gctcccgcca cggtcgcccc gtgtcgggat ccggggagat 64800cggcgtgtcc atcccgccca cctcgaaccc aagctcgtcg acagcatcat gaaccatcga 64860caacagggcc ggatctttgt ggacggtggt gagatgcagc ccgcattgca tcgtcaggag 64920cttcagattg atgacctcgc catcaaacct gccgccccgc gacaatctgc cggtcagccc 64980cccgatcgaa agaggtcttt cccagacagg aatgcctctt ccttcctcgc gacgcttgtc 65040gatccaggag gccagcatta ccgcgggccg cgtgtggcgg gcgcgcgagc gtgctgcgaa 65100ccggctgttc agtgcatcgg cttcagcccg ggcagtgaag atgtcgtcgc agaggtgctc 65160gacatatttc aaggcccatc gcagcattgc gccgatgacc ggctccggga tgcgcgcggt 65220ccggttttcc gaacagcgcg ttccctggcc ggttgcccga tagaccggtc ggccgcgcca 65280cggggtgaag gtgatgccac cgcacgtcag atagggcgcc aggcgatgaa gctggacgat 65340gggcctgagg cacacaccca cgcgccccgg cgtgatcggc cgcgcccggt gatgggtcgc 65400gtatgcatcg atcaaatcct gatcgacgtt tgccagatcg agcttgccga tccgcgagcg 65460cacgaagtcc aggaaccggc gcagcgtcgc aagcgcagta tggccggaga ctggccgcaa 65520ccgcggctca ccgtcggcgc gccgttcatt catccaggca tagatgtatt ccttcgcaag 65580caaccgctct gccgcgcagg ggatcacgcc gaagtcgacc gttcgaaagg cctttctggc 65640catgttgaac atcgccggcg ccatatccca gacatcatcg ccgaaccgcg agagcgccgc 65700tcggtcggta ccatccctga gaggcatcga agccaaaacg atgtcgtcat cgaccctgag 65760gcgtgagacg gcacgctcat cgttcaaagg agaggtagtg gtcatgagcc gtaagcctcc 65820ggcggaagat agagcaaccg cgccgaggat tctgccgcct caacccgtgc gcctccgacg 65880acggaggacg ggaacatcgg cagaatttgc tccgtgatcc tgcggtatgg ccgatcgaat 65940ttctcgttcc agtcgccaga aggcaacgcc tcccgcagct cgtccatgaa cgcctggaac 66000gcgatcagcg ccggtagttt ccgtgcggta atgaccgcgt tggagcattc caggcacccc 66060cagaacggcg tcggacaggc ttcgccttcc cgaccgaaag ggctgacgcg gaagttgctg 66120cacgccgcca gccaaagatc ctgctctccg tccaggagcg ggccgatctt ttccgacggc 66180accggcagcc cggtcgcgtc ggctgaggtt cgcagccggg cttcatccgc gggcacaacg 66240atccaaggtc gcagagccgg cgccatcgcg tcggtcagtg cctcgactat cgtctgctca 66300tgcagatgcc gaagggcggg gatgtcggca taatggttgg ccgccaccgc taccgtgtgg 66360ccgacggcaa agttctccaa ctgccctccg gtccgcttat accagtcagc cttctgggtc 66420ttgcgcagcc tggagagatt gagcgccagc gattttccgg cgtcatcgac gattccgtac 66480ttctcgacaa acgcggccac gcaggtcccc agctttttcg gcgacgacag gcgccccggc 66540ttccaggtga tccagagctt gctcgatcca gtgtgctgcc gagccttttc cgtcagcttg 66600atcgccagcc gcaggacggc tccgggcgtc tcccgtccgc catcgcggac acgcaagcgc 66660ttccactggg catgatgcgc gcgccgcttt cgatactcga tctcgacata accccggttg 66720ggattgcgca agcagtcagc ctcaagccca cgcagcgctt cgatctccat gccggtcgtc 66780aaggacagcc agacgaggaa gccgacgaca tcgtaccggg tcagatggaa gccggcatgc 66840agttcctcga ccggaggcgg ctcgagcccg catctatgag cgtggtagcg cagattgtcg 66900aacagcgcgc cttccccggc gactactccc gccgtcacaa tctgttcgac cactaggtca 66960tagcgacggc gcaattctgg atcacggcct acatccagaa gtgggggagg cagagcctcg 67020cccgtcgcta tccggtcgcg agcctcgatg atctggcgca tcgctgcctg cagcaacgtc 67080gaggcaatcc tcccactgta ggcatcgcgc ggctttgaga cgccgtgctc gccgtgaccg 67140atgtatttca ggcgcaacag tgtttcgggc ggaagccttt caggattgag ctcggcggcg 67200acgcgcagca ccccgatcag agcaccgagc acattgcgct gattgggtcg ctcgccgccg 67260ttctgctcca gccagtcctc ataggcattg attaccgccg gagttaagtc gtcgagacga 67320cgaggtttta ccgacgcccc ttccaggaac agccagaacc gccgcagacg gcggataaag 67380gtgcctgcgg ttttccagag tggtgccggc cccatccggt ggagatactc ctgcaggaat 67440ggcgcaacct catgggtcag cgccgtcagc ggccaggaag acagattgac gtcgatcctc 67500ccggcatctt ccgtccgaag gacgaagacg agcggatttt gcggattttc ctcttgagtg 67560tcgaacaatt cgattccaac tgggaaggtg gcacgacgac cgcgtttcat cacaggggtc 67620caccagcatt aacgcgcagt tcccaggcct cgaccgcagc gtcgatcatt tcctggcttt 67680cttccatgca atccaggtag atgtgagtgc tttcgatgcg gctatggccc agcaaacgct 67740gcaacttcag aagaggatcg ccaatcaagc ggcggtacgc cgcgccgata tgggatcggc 67800gttcgtcgag tacccatccg atctgttcac gcacgagcag cgacagcata tgaaccgcaa 67860aggtgtggcg catcatgtgc ggagtgacgt cgaggtcgat cccgaaccgc ctgcaccgta 67920cgcttgccct ccggaagacc acctcccaag cggccggggg catgggccgc gccccttccg 67980ccagccaaag acacaatggt tcggatgttt ccgcccatac caagcggctg cgttcgcgcg 68040gcgccagcac gtcgacactg gctcgaactg tgtccttttc cagaaggagc cttccccgat 68100cgtggctgac gacacggatc ggatgttcga ttgacctatt gcgcggttgc gaaaggcgca 68160tgaggacatt ggtccgttcc aacgccgcgt attcatgcag acgcttcagc acgcgctcgg 68220gcaagcggat ctcgcgcccc ttgctaccct tggcaatggc cggcgccagt cggaaagatc 68280ggctcctcaa tgcaccgacc ggctccgtcc tcgggaactc gatccagagc agacttgccg 68340cttcctggag ccgcaggccc gtcgtgacga gcaattcggc gaacaacgca ttgcgctcgc 68400tgttgcggcc ctgccaggtg ggatcctcgc tcccgtctgg aagacgacca cgcaagccga 68460tctcgcgaaa caggagatac cgatccaggg aaaggaaccg gatatcgcgt gtccgtgcgc 68520cgcgctcggt ggcaacattg gcagcgaccg ctatggcccc gccgccgttc gtccgtcgcc 68580atgattgccg ataggtgaaa ggcgatttgg cgatcattcc ctcttcaaga gcccatcggt 68640aaagcttgtc gagcgctgct accgaccggt tccagctcgc ggccgagatg cgcgccggag 68700gaagcgccag acgtcgcgcc gcatggaagg ctgcgacatc gtgccgatca gccgcccaga 68760gggctctgtt gtctcggcgc tcggcaagaa agcgcatcca gatcaggata tcccaaccat 68820aggcgcgcaa gctgttgggc gaacgaaccc ccaacgtggg gcaagctcga aagaaccggt 68880tcaggtcgtg atcgtagctg tcgtcatcgc caagaatgaa cggcatgccg tccacgaggt 68940tcagcttctc ggcggctgcg acttcatcca ccgacagcct gtggacgacg ccatcaaccg 69000taacagactg ccgcagcgtc gaaagatccg tgaagaagag ctggggcatc ctgttctcct 69060cggccgcgat tttcccgccg ggacgggctc gagcccgtcc cggcgggaaa atcgcatcgc 69120ctcacctcaa gcgaagggga atgtcgtcaa cgttgatcgt gtgctgcgaa cgtcacagcg 69180gtaagacaga acacagagtc aggataatgg cgtccttccc tctgacgaga tcgacgaggc 69240gacgacctcg aggtcattca tgaattttat ccctgggcgg ctcattgagc cgctttgccg 69300ttccggctga cgctggcgag cggcatgccg caagggacgc ttcgccatgg ccggtgcaaa 69360tttgcacctt gcaggccatg cccttgcggc ttttgctctt cgcgtccgtc agaagctggc 69420ccgcaaaatg cgggaaggaa agcaatgata aattagccgc cacgcggccg gagaagaaaa 69480tgaagagaga cgagatcgag cgactccggg atacagtggg ttgtcaagcg gtattggaaa 69540aggctgggtt tgcccttgat ggcaaggaaa gtaccaagcg agcgatgaag tatcgccgcg 69600gtagcgagat cattatcgtc acccatgccg gccggggatg gtttgatcct ctcagtgacg 69660ccaagggcga tatcttcggt ttggtgacca ccctggaggg ctgtaatttc ccggagggat 69720gtatgcgggt cgccgagcta tcggggttgc ggccatctga tcttgtctgg aacaaggaca 69780ccgtcgagac gatcagccta gtctcgactg ctgaagattg ggcgcgccga cgatcgcctt 69840cggccggttc tgccagctgg cgttatcttc gatggcaaag gtcactcccc gcatttgtca 69900tccgggcggc gatcaaccgc aatctgctgc gcgaggggcc ttacggtagc atttgggcag 69960cccatactga tcaccatgga aaagtgagcg gttgggaggg gcgtgggccc gattggcgcg 70020gcttcgcgaa gggtggcgcc aagatcctgt ttcggctcgg cgctgaccac gccactcgat 70080tgtgtgtcac cgaggctgct atcgatgcga tgagtttggc cgcaattgag ggaatgcgcg 70140acggaacgct gtatctcagc acaggcggtg gctgggcgcc agccaccgca gccgcactgc 70200gccggcttgg tcagcggccc gacatacagc ttgtggcagc aacagacggc aattctcaag 70260gtgatgtttt tgctgatcgg ctgcgcatcc tcgccgagga tctcggctgt tcgtggcttc 70320gcctgcgtcc ccacgccgac gactggaatg aggttttgaa gcaaatggag aaggaaaaga 70380cccaaagaag ggtggaaaaa ggaggcgtgc cgcctgcacg cccgccgcat caagggaggc 70440ttcgcccggc tgcaccggcc cttgacccgg ccgacgggca ggccggcgtt ccggaaggtg 70500tcaaggagga ctgaagagga aggcgaggtc gtgaggatct cggcacttcg gtccggcaaa 70560cccgaaggaa cagccaatgt ccaaccatac cataattcga aagatctttg aggggcgtgc 70620gacccgtcag cagatgttct cgcttttcga tcgccatgcc aagcgaccca cgcggggcca 70680cgatgaacca gcagcgctct acgccggtga gtggttcgaa atttcggaag ccgaacacga 70740ctacatgttc gagatcctgc cgccgctgtg gatctgcggc tctacgttcg ccatgcgcga 70800attcatgacg ggttcggtaa cctcggtgtt ctttgccctc aggatcgatg ggctgatccg 70860ttacttccac ggttactgcg atcttttcga cagctcgaac gtcgaagcga tgagactggc 70920catcatcgag cgcgaaagcc gacccgtccg aacaatcacg cgcgatgaac gtcttgagca 70980tatctggagc atcacggcgg acgcctaccg cggctatgcc ggcgatcgct ggccgcctgc 71040agcgcgaggg cagcgcaccg tcatgctctg gtgcacggct aagggaacga cgctgaagct 71100gctcaccgat ttgaccgaag acgaggtagc ggccaagctc ccggttcagt tccgttatct 71160ccccgacgcc attgcggctt gagggaggat gagatgcttt cgttcccgct cgaaaaagta 71220cgcgaggttc tcgatcgcgg tcgggtcgac gctgaggcaa atggcggctt tcgcaattta 71280catcacgggc tcctgcccgg cgaaagtgaa cagccaggcc tctgacttgt cggagataac 71340ggcgtctatc tgatgtcgaa ctgcaagctg cccgagggta tcaggccgct cgtgatctac 71400gccgaagagt gcgacccaaa cacaaatgaa gactggtttc acgtcaagcg cgccacgttc 71460ggcggcgatg atggtgttga gttttttaat ggtgcttctc tggaggccat gatggccgcc 71520agtcctaccg caagccacct ctcgatcgtt ttccacgacg acgcgatgca cttgtcgctc 71580atcacgccgc agtaggcacc gtcggccgct tcaagccaac ccaaaatcgc ctctctcagc 71640acggtcaagc cggcgctcac gcaccgtcga tgtcgtgcgc tggcaccaca aggagaaacc 71700ccatgagtaa taaccttttt cactcgatcg gcctgatacc ctcgacatgt ttggcagttc 71760tgccctctca tccggactaa gcattggcat ccccatttgt ggaggcttcg agccggttgc 71820cgctaacgat gacgatcccg atccgacacc tccctctcct cccttaatgc cttctccaaa 71880acgcgcgata gccaaagcgt cgcgaccggc ccttccaagc cagatggaac gggcaaactt 71940ctatctcgat ggcgatgatc gtcgtcttgc tacgacgtgg aaggagcgcg cgctcaccaa 72000tgtcgccgcc attctgaccg caaatgagat tgagcgaaac gacgtaccca tcacgcgcga 72060gcaccagaaa gtgctgatcc gctttaccgg cttcggcgcc ggcgagctcg ccaatggcat 72120gttccgtcgg ccgggcgagg tcgatttccg caaaggctgg gacgatattg gttcttcgct 72180cgagcgcgcg gtttgcgaga gcgattacgc gtcgcttgcc cgctgcaccc aatatgcgca 72240tttcacgccg gagttcatta tccgcgcaat ctgggctggg gtccggaaac tgggctggcg 72300cggcggccgg gtgctcgaac cgggtatcgg cacggggctg ttccctgccc tgatgccgca 72360accctatcgc gacgccgcct atgtgaccgg gatcgagctc gatccggtca ccgcccgcat 72420cgcccgcctg cttcagccga aggcgcggat catcaatggc gattttgccc gcacggatct 72480ggcaccgatc tacgatctcg ccatcggcaa tccacccttc tccgatcgca ccgtccgctc 72540ggaccgcgct taccggtcgc ttggccttcg tttgcacgac tatttcatcg ctcggtcgat 72600tgacatgctg aagcccggcg cgctcgccgc cttcgtcacc tcacatggca ccatggacaa 72660ggccgatacc acggcacgcg agcatatcgc caagtcggcc gacttgatcg gggcaatccg 72720gttgcccgaa ggcagctttc gccgtgacgc cggcacggat gtcgttgtcg acatcctctt 72780cttccgcaag cgcaagcccg gagagccgga gggaaatcag ctgtggctcg atatcgatga 72840aatcaggccg gccaccgagg acgaaggcgc catcagggtc aatcgctggt ttggtcggca 72900tccggacttc gtgctcggca cacacgccct gacctccggc ccgttcggcg agacctacac 72960atgccggccc cgcgatgacg aggatctcga cgccgccctc gccgctgcaa tcgatctatt 73020gccggccgat ctctatgacg gcgagccgac accgatcgat attgatctgg aggaagaact 73080cggcgagatc gtcgatctgc agccgagagg cggctccgtt cgcgagggca gcttcttcct 73140cgaccggtcg aagggcctga tgcagatgct cgacggctcg gccgtgccgg tcaccgtccg 73200caaaggtcgc acgggtaatg gggtcccgga aaagcacgtc cggatcgtct caaagctgat 73260cctgatccgc gatgcagtgc gcgaggtcct gaaggcgcag gaagccgatc ggccatggcg 73320cgatctccag gtgcgattgc gcatcgcctg gtcgagtttt gtgcgcgatt tcgggccgat 73380caaccacaca gtcgtttccg ttcaagagga tatcgagacc ggcgaggtca aggaaacgca 73440tcgccaaccg aacctcgcac cgttccgcga cgatcccgat tgctggctgg tcgcctcgat 73500cgaggactac gatctggaga cggacacggc gaaaccgggg ccgatttttt ccgaacgcgt 73560gattgctccg ccggccgccc cgacgattac ctcacctgcc gatgcgctcg ccgtcgtgct 73620gaatgaacga ggccacgtcg atatcgacca tgtcgcggag ctgttgcaca gcgatccggc 73680tgatgtggtc gacgagctgg gcgaggccat cttccgcgat ccggccgatg gatcgtggaa 73740gacggcggac ggatatctct caggggccgt ccgcacaaag ctcgccgccg cgcaggcagc 73800ggtcgagctc gaccccgcct atgagcgcaa tgtccgcgcc ctccaggagg tccagccggc 73860tgatctccgg ccatccgaca tcacagcccg cctcggcgca ccttggatcc cggccgccga 73920tgtcgtcgcc ttcgtcaggc aaaagatgga ggcggaaatc cgcatctacc acatgccgga 73980gcttggttcc tggacggtgg acgcacggca gttcggttac agcgccgctg gcacatcgga 74040atggggaacg agccgccgcc acgccggcga cctgctgtct gacgcgctga atagccgggt 74100ccctcagatc ttcgacgtgt tcaaggatgc ggacggcgag cgccgggtcc tcaatgtcgt 74160tgacaccgaa gccgcgcgcg acaagctcca aaggatcaag caggcattcc aggactgggt 74220ctggaccgat ccggatcgaa ccgaccggct ggcccgcgat tacaatgacc gtttcaacaa 74280catcgcgccg aggaaattcg acggctccca cctgagactc cctggcgcct ctggcgcctt 74340tattttgtat gggcaccaga aacgcggcat ctggcggatc atcgccgatg gctcgaccta 74400tcttgcccat gccgtcggcg ccggtaagac gatgaccatg gcggcagcca tcatggagca 74460gcgccggctt ggcctgatcg ccaaggcgat gctggtcgtg cccggccatt gccttgcgca 74520ggcggcgcgc gagtttctag gactctatcc aaatgcccgc attctcgttg ccgacgagac 74580caacttcacc aaagacaagc gtgcccggtt tctgtctcgt gcggcgactg caacgtggga 74640tgcgatcatc atcacgcatt cggcgttccg tttcatcgcc gtgccctcaa ccttcgagca 74700acagatgatt caggacgagt tgcagctcta tgaggatctg ctgaccaagg tcgacagcga 74760ggaccgcgtt tcgcgcaagc gcctcgaacg gctgaaggaa ggtcttcagg agcggctcga 74820aggcttggcg acccgcaagg acgaccttct gaccatctcc gaaatgggcg tcgatcagat 74880cgtcgtcgac gaggcacagg agttccgcaa gctgtccttc gccaccaaca tgtcgacgct 74940aaagggcatc gatccgaacg gctcgcagcg cgcctgggat ctctatgtca aatcccgcta 75000cgtcgaaacg aagaaccccg gccgctcact ggtgctcgct tccggcacgc cgataacgaa 75060tacgctcggc gaaatgtttt cgatccagcg cctgctcggc catgctgcgc ttgccgaacg 75120cggattgcac gagttcgacg cctgggcctc ctgcttcggc gacacgacca ccgaactcga 75180aatccagcct tcgggcaaat acaagccggt cagccgcttt gcgtcgttcg tgaacgtgcc 75240ggagctgatc gccatgttcc gctcgtttgc cgatgtggtg

atgccggatg acctgcggca 75300atacgtgaag gtgcccaaca tctcgaccgg ccggcggcag atcatgacgg ccaagccgac 75360ggcactgttc aagacctatc agcagaccct cggcagcagg atcaaggcga tcgagcagcg 75420cgagggtccc gccaagcccg gcgacgacat cctgctgtcc gtcatcactg atgggcgcca 75480tgcggcgatc gacctgcgcc tcgtcatgcc ggcggctgaa aacgaggaga acaacaagct 75540caatctgctc gtccgcaatg cctacgggat ctggaaggat accggcgagg cgatctatcg 75600acgccccgac ggcaaagact tcgatctacc aggggctgcc cagatgatct tctccgatct 75660cggcacgatc aatgtcgaaa agtcccgcgg cttctcggcc taccgcttca tccgcgacga 75720gctgatccgg cttggggtgc cgggatcgca aatcgccttc atgcaggact acaagaagac 75780cgaagccaag cagcgactgt tcggcgatgt cagggccggc aaggttcgtt tcctgatagg 75840ctcgtctgaa acgatgggca cgggcgtgaa cgctcaagcg cggctgaagg cgctccatca 75900cctcgatgtg ccatggctgc cgtcgcagat cgaacagcga gaaggccgga tcgtccgtca 75960gggcaaccag cacgaagagg tcgatatctt cgcttatgcc acagagggtt cgctcgatgc 76020cagcatgtgg caaaacaacg agcgtaaagc ccggttcatt gccgcggccc tgtcgggaga 76080tacctcgatc aggcggctcg aagacgttgg cgaaggggcg gccaaccagt ttgccatggc 76140caaggcgatc gcatccggtg atgaacggtt gatgcagaag gcaggcttgg aggccgatat 76200cgcacggctc gagcggctgc gggccgccca cgaggacgat caatatgccg tccgtcggca 76260gatgcgcgat gcagagcgcg aaatcgaggt ctcagcccgg cggatcgccg aaatcggcca 76320ggacatcgcg cggcttcagt cgaccaccgg cgacgccttc acgatgacgg ttctaggtaa 76380agaacatgcc gagcgcaagg aggccggccg ggcgttgatg aaggagatac tcacactgct 76440gcagctccag caggagggtg aagttcatct ggcgacgatc ggcggcttca atctcgttta 76500tgatggtgag cggttcggca agggcgacgg ctatcgctac gagacgctgc ttcggcgtac 76560cggtgcggac tacgagatcg atctggcgat cacggtgacg ccgctgggcg caatctcacg 76620gctggagcat ggactcggcg gcttcgagga ggaacagcgt cagtatcgct ggcggctcga 76680cgaggccgag cgccggctga gttcgtatca gtcgcgcatc ggcggcgctt tccagttcgg 76740cgatgagctc ggcgccaaga agaagcaact tcgcgagatc gaggaagaac tggctgcatc 76800cgccatcgca ggctttttgc ctgggctcca ttccagtcgt ggcatcgacg aaggatcgcg 76860ggtagagact tgtaatttct cgacctcatc catgtctgat gatcacttcc cgttcagatg 76920atgtcctgca aatggcgctt ggcaatggct ttcggagtcg tccgggttag acaaagggcg 76980ctcccttcgc gggtcgagcg ccctttttgc gttttcgttt cctggcaagg tcctgcgtgc 77040cattcgcgcc gcagcgtgcg cgggccagcc cttcaataga ggaatggagg agaaggagga 77100gggaaagaac cgattgctga tcgatcctcc tgccgacgca gctgctcaac cgccacctgc 77160gccatcccgg ctactcgtcc ttcgcagggc tgtcagcccc gcttgttctt cgcagcaggg 77220atgctcggtc gcagttgcgt cagtccggcc gatcagcggt ccgggagatg tcttcgagaa 77280aaatgaagac aggaagggcc ggcatggcgc cggtccggaa ctctctagac aaggacaaat 77340cccatgcaaa tcatcaaggt tgacccgcgc gcgttgaagg aaaaccccga ccggatgcgc 77400cagtcgaagt cgtcgccgca ggccgatgcg ctgatgctgg ccacgatcaa ggccgtcggc 77460atcgttcagc cgccggtggt cgcaccggaa acggatggcg gaaatggtta tatcattgac 77520gccggccatc gccgtgtgcg ccttgccatc gccgcaggcc tcgaagaaat cgaaatcctc 77580gtcgttgatg cagccaacga caacggcgcg atgcgttcca tggtcgagaa cagcgttcgc 77640gaagcgctca atccggtaga ccaatggcga ggtgttgaac gccttgttgc actaggctgg 77700acagaggaag cgatcgccgt cgctcttgct cttcccgtcc gccagatccg caagctgcgc 77760ctgcttgcca atgtcctgcc agctatgctg gagcagatgg cgctgggcga catgccgtcc 77820gagcagcagc tacgggtgat cgcggccgcg ggccaagtcg atcagaaaga agtctggaag 77880gcgcacaagc caaagaaggg tgatacggcg ccatggtggc agatcgccaa tgcgctgacg 77940aaaaagcgca tgtatgccag ggacgcgagc ttcggtgacg atctggctca ggcctacggc 78000atcgaatggg tggaggatct cttcgcaccg gccgacgagg acggccgcta caccaccaat 78060gtcgaaggtt ttcttggcgc ccagcacgaa tggatgacga acaatctgcc gaaacgcggc 78120gcgatcgtcg aggtcaacag ctggggccag ccggaactgc cgaaaaaggg atcccaagtt 78180tacggcaagc cgtccaagtc cgaccatacg gcgctctacc tcgatcgtga cggcaaggtc 78240cagaccgtgc attaccgcat gcccgaggcg gcgaagccga agggtgctgt tggcgacgga 78300tcggtcactg gcggcgatga caccgacgca gtcgccacgc cgaaagcccg gcccgacgtc 78360acgcagaagg gccacgacat gatcggcgat ttccgcactg atgccctgca cgatgcgctc 78420ggtcgcgcgc cgatcgagga tgatatgctg atggcgctga tggtcctggc gttcgccggc 78480cagaatgtcc gcatcgactc cggcgcagat ggcaccttgt acggcggcaa gcgcttctcg 78540cgtcatgccg tcggactgtt tgacgagcat ggcaagctcg ccttcgatca ggacacgctt 78600cggatcgccg cccgctcggt gctgatcgac gtcctctcgt gccggcgggg catgtcgaac 78660agcggcatgg tcgcgcgctt cgccggcgag gctattggcg ccgacgcttt cctgccaaac 78720atgggctcaa aggacttcct cttgtgcttg tcgcgtcagg cactggaagc ctcttgcgcc 78780gaggcatcgg tccagccgcg cccgaaggtc cgcgaaaccc gcgcggcact cgtcgagcat 78840ttcgcgtacg aacacttcgt gcatgcgtcg gcccgcttcg caccgcctgc cgacgagttg 78900ctcgagtgga tccgggcagg cgcggacacg ggtggcatcg gcgccacgcc ccaggatgaa 78960ggggaaagcc gtaccgatga tccatcggta gatcagccag aacacaatac cgacgatgtg 79020gtcgaaggcg aaactgagga tgcggatctg cccgaccatg atgtgcatga cgaagacgtc 79080gatcagaggg ttgcagcatg accgccgcct tccagtcgaa catgacacca cccacccccg 79140atcatttggg ggtggagttt gccaccactg cggacggcct gcccgtggcc cgcatcggtg 79200acctggtcct tgccatggtc acatcacaga gcggctttgc ttttattgca agcgcccgtg 79260cgatccgtcg gccactcgca gatctgacgc gcgccgactt catcgggcat gacggccggg 79320tggcggatga agcagagttc cgggcccgtg tcgccgagac cgctggtcac aaacgcgatc 79380tggccaaact gaaccgcatg caaacccgca tttcggccag cacaccatgg ggcggatcgc 79440agagagcggt cgtgtacgcc gagggcgtcg tcgcccacat gacatcaggg catgggggct 79500tccatctgtc gacagagcgc aatgccaagg tccatccgct gctgcggaag gatatgccct 79560ggtacgagga agactgcgaa tgggcgatcg tagcgatctg ctttccggac ctgttcacca 79620cctatgagcg gtcgatggct gagaagaccg tccgcaatac ttggcccgac gcctgggaga 79680aaatccatgg gcgtgcgctc gccgagggcg agagctgggc caaggatcgc cgggcgttcg 79740atcagcgtca tgccgtcgac ttcatagtca cgtcggcaat cttgtccgat cagcgccccg 79800gcatgacgga ggtcgtggcg aagatcggcg gaggccatat ccgcggtggc gaagaacgcc 79860gatttctggt ggcaagcgac gaatatgcgg ggcgggggcg gttcggcttc gtcatcgatc 79920tcgcgcgcca cgctgaatat gatggcccct cctccttcat tggctggaga aaccgggggg 79980atgggtcatg atcgacatcc gcctattgag gccgctggcg aaagcaatcg gcgcccggcg 80040cgagacccag cggcatctcg attgtctgac tcgccagatt gcggcgcgcg ccgcaagaca 80100ggcgaccaca gtgaaggtcc ggagccgcgc gcggcaccgg tccagtcccc gtctctacca 80160tcgggagatc gtcgaccgcc ttgccttcga gcgctgggtc gaactcgaca tgatcgcctg 80220caggctggcg atgcaggagc aggtcatcgg ggcgttcctg catcgcgacc gcgagcctgt 80280gctgcatccg gcgatatagg aggacccgaa gcgaaaggac ctggcgatgt cctacccggc 80340tgcgatgtca tcgtcatggt gggcttggcc atgtctgtcg cttgccttgg gattgatatc 80400ggacccgtgg cggactgccc ttcttgttcg ctgcggtctg aaccggcggc cggtcgtttc 80460aaggccgctt gcgcgccgcg gggcggccga tccagcctct ctgcgcgagg gcaggctcgc 80520ggtctgctca ggtcaagacc tgctggcccg caaccctacc ctgctggctc agccagatcg 80580gacctgtgaa gccacccgtc ccttgccggt tcctggtcgt ccgcatcgaa gggcagaccg 80640gcacgggccg gaaccgcttc gcaagccaag gaaggaacag acatggccaa gccctctacc 80700cccaatcgct ccaacaccag gtcgtcgcaa tcccgcaaag gtgcaaccct cgaaatggtc 80760cgcctcacat gccccgacgc cacccaggcg tccaagatcg cgacaagctt cggcacggca 80820gtcgtcgaca gcgatggcat ccgcagcctt cacgagcggc tgatcgtcga gaccgccgaa 80880agtctgtccg aaggcctcgg cgagaaggcg atgcagatcc acctccagcg catcgtcggg 80940tcctttgtcg gatccgcgca tggcgccggg caattctact cccgcgccgt cacagaggcg 81000cgcgacgcaa cggccaaggc gtccaacgat gcccgtgacg aggatctcga tggtccggtc 81060ggctatgaca gcgccgccca gcgcaagcgg gagttcgcgg ccgacatggg tgtccaatcg 81120cacgccctgc gcatggcagc cgagggcgca gtcgcggctt acgaacaggt catcggcgag 81180acctggaagc ccttcgaccg gccggtcgaa aatccgggcg catcactcga ccgcaaagca 81240gccgaagctc agttggccgc tttcggataa cacattggcg gggtcgcacc ccgccctttc 81300ttcatgttcc gaggcaggcc ctcgcagggg cccgcctttt ctcatgtcaa aaatgaaagc 81360tgggtgcgcg cctatcgcgg cccgtcccgc tcggcggtcc tgcaggagcc gggcacccat 81420gcaacggctt tgccgtcctc cacgctgttg cggccgttcc ggtgcatggc cgcaccatcg 81480cccctgactt cggacctccg tgacggaccg cgacaggcgc ggtcttcaag aaaaggagaa 81540ggaagtcatg gccaggaaaa cggataaaga tcgcatcgat atctacaccc ggatcacaga 81600tcggatcatt gaggatctcg aacagggcgt gcgtccctgg atgaaaccat ggagcgctgc 81660caacaccggt ggccggatca cccggcccgt gcgacacaac ggcctcccct attccggcat 81720gaacgtggtg ctcctgtggt cggagcaggt atcgcggggc ttcgcgtcgt cgatgtggat 81780gacgttcaag caatccctcg aactgggcgg ggccgtgcgc aagggcgaga ccggctcgac 81840cgtcgtcttc gccagccgct tcaccaagtc cgaagcggac gggaatggca acgaggttga 81900tcgggagatc ccgttcctga aggcctattc ggtgttcaac gtcgagcagg tcgacggtct 81960gccccaaagc tattatgcgc cgccggccaa ggtcgttgat ccgatcgcgc ggctcgagag 82020cgtcgatcgc tttttccgca ataccggcgc agtcatccgt cacgggggca accaagccta 82080ctactccccg gtcatggact atatccagat gccgcccttt gagtcgtttc gcgatgcagg 82140cggatacgcg gctgtgctca gccatgaggc gacccactgg acggcggcgg agaatcgggt 82200gggacgtgac ctatcgcgct atgcaaagga ccggaccgag cgggcacggg aagaactcat 82260tgcagaactc ggcagttgct tcctctgcgc cgatcttggc atcgcaccgg agctcgaacc 82320gcggccggat catgcatcct atctgcagtc gtggctctcg gtgctggcca acgacaggcg 82380ggctatcttc caggcggcgg ctcatgcgca gcgcgctgtg aatttcctgc attccttgca 82440gccggaagtg gatgtgaagg ctgcggcctg acgctcaggc gcggtcgtta ccaccggtgg 82500cggccgcgtg attttcatca tgttggtcct tgagaccctg cgcaatgtca gcatccagcc 82560ttccccagat cgacggtttc tgagcgtcgg atttgggttt acgggatggt ttgcgctcaa 82620tgatgaacgg cttggtctgc tgacgcattg atcctccagg cagcgatttg cgagcgcaac 82680gatatcgcaa tgggcgcagt cagcaagcgg gccagtgttg acaggcacgg cttgtccccc 82740gattgaggca gtgcagcacc ggtctgaggg ggcgtagcgc aggatgccat tcgtgcccat 82800ggcgaatgcg gcggaacgcc attgccatat cccttcacgt cagagtttcc ggcaacccat 82860ctgcgggctc gataaggcat gtctgaccgg agaccggctg cgcctcaatc gttttcccgc 82920aacggcaagc cgtaaatttc ttaccccgga gcccacctac cccactcgac aagtcgagcg 82980gggaccccag ctcggctcct cctctcccac taacaaatct gcgacttgcc gccctccatt 83040tcattccggc cttatcaggt gcggtccgat catcaccggt cctttgacag ctatcgaggt 83100cgcgatgggc gcggcccgaa catgagaaaa ggaatacgac aatggcaacc atcggcacat 83160tcacctccac cgaaaacggc ttcaccggct ccatccgcac gctcgccctc aacgtcaagg 83220cccgcatcgc ccgggtcgaa accccctccg acaagggccc gcagttccgc gtctacgctg 83280gcagcgtcga gctgggcgcc gcctggcaga aaacctcaga acagggccgc gactacctct 83340cggtcaagct cgacgatccg agcttcccgg ctcctatcta cgcaacgctc gccgaagttg 83400aaggcgagga tggcctccag ctcatctggt cccgcccgaa ccgggactga ttgacatcac 83460ggggctccgc cgccggcgga gccttctcct ctgccgagaa ctcaaagcag taccctgcat 83520cgagccaggt cctgcttttt tggtggcata ccgagacggg ggatatgctg ctcagatcgg 83580gcgagggtgc cgggccggaa tgacggcgtc aaggacgagc ggttccccca atttcgcgcg 83640aacgctcttt gagcgcccgc acgaaatcgg ctcccccact cgccgccgct ggcggtcgca 83700tccgcgatcc ctgaccccgc catcccgccc cgccctgcga tgtcgtcttt cacaaactca 83760aggagatggg acgatgacga tcgaacagca catcgaagaa ctgcgcgccg agctcaagaa 83820cgcatgcgac gctgcggagc gcggcgagat ccagaccgag ctggacctgg ctcaagcgga 83880gttggcaatc atcacggcag agcaggacgg aagcgttgat gccgagccgc ccttctgagg 83940gcggtagacg acacagccag gcgtggtctc tgtgtaaggt gtcgaaaggc cgagacattg 84000caccgcgtcc ttgtcgagct aggccatcga catcagggat gttgcagtcc ggtcgtcggg 84060cagcaactca tcgccatcag aattttcccc gccgcttcgc gtctcctcgc gcgccaaaat 84120tcaggtgtcg ataagtcctc cgcttcgctg cggccgtacc gatgcaatcc tccttgtccc 84180ggcctgcggc cgatccctgc gatgtccgca atcgacaagg agaaaccacc atgcaacgcc 84240tcgcgcaatt cctggccgcc acaggccgca agctttcttc ccttggcaag gtgatcggtc 84300acattttccg caagggcaaa ctcggcctga agctcgcgat caagatcccg ttcttcgtcg 84360agatcgagat ctcctttgaa acagattgga gcaggcgccg ataacggcgt tgtgcaacgg 84420ccagcaatcg tgggccggtt tcagcaccag ggctgtctac ggcccgtcca ggttctggcc 84480aggccttccg atacgaggat atcgccgaga ctcctgccgt cacggatgag gacgcggagc 84540ttgcgaccgt atctgtcttc gtcgcgtccg ggccatgcgc gaagcttgaa ggacccctga 84600ttgaccagtt cgatcaggcg atcggtcgct cgatttccaa gcgccagctc cgttgcgcat 84660ttcggctcac tgatctcggg agcatcgata tcggcaattc ggatttttgc gccctcaatc 84720cagagagtat ctccgtccac gacgcaggcg aagcgatcac caccataaca tttccggtat 84780gtcgtctctg gactgatgac cgagctcgca gcctcggcga ctggagtgag cccaaatatg 84840tgagagccca gcgcgcagcc ggatactgcg atcgcgacga tgatccttct cacggggtaa 84900cggacctctg gcagaccgct atggtcgctt ctctacaatt ccatggctct caatttcaat 84960gcgatccgtc agagatggtt ttcatatcgc tcttcggtgc agctggcgca aacgccactg 85020cgagctttcc cgatcacgta tgttgcgccg agttgattgt acggtatccc cggtggcgtt 85080tttgcctgac gagatcaagg aacaattcaa ccgcgtcttt ctcttgctcg aagtgatgaa 85140gctttagctg gcctctggtg ccgatgcgtc cccaacgccg cataagacag gcctctccga 85200agagggtcgg ctcgatcgat atggcataga agcgtgccat attcttctca gcatccgtgc 85260gttcgatata gaggtgatag ggctgggcga tcatggtgag aggatcgcgc aatcgggcct 85320atgcgtccaa cgacagttgt gaatcgatgg tcggggaatg attcagtttt gtgaagtatg 85380gacagacgga gcaccgggcg gtccgccttt ggcgtacggc tctattcgct ggagcgaacg 85440aagccgagct gtggtcttcg ccgatcccgg taacgatcct cccgcgatag ccgactgcca 85500ttgatcagta tcccaggtaa ccgagaatat cggcgccaca atagtcggct tgctcgtctg 85560gatgaacgat gagatcaccg gtcgtgacat ccaccaaagc gctatcgctt tcgcgaacga 85620tggcctcaat ttgatggacg cggcattctt cgatggcctc ttctaccgtg acctgtgcct 85680cgcaggcttc ccaatatctc atcgcccggt ctctggattt gggttctccc tcagaccttg 85740atttccaatg gtccacggtt tccatggaag cggttatcgc caacgcagga cttcatgtcg 85800gctcgccgga accacatcgc gcgaccgcat cgaagcggcg catttccccc ggtgaacaca 85860atctgctcat cggcacgcat tcgcaggact tcgtgcggct ggatcaatgg tcggctggca 85920agttgctttg atcgggttcg tgacgaaccc ctcgcctgaa agctgcggct gacctggtcg 85980atctcgactg tcgttgttcc acaacgccgg gagatatagt ccgcggtctc cggatcgttg 86040atcgctgaga aactgatcca gctcgcgctt tcgaaccact tgctggtggc gtcgcgtccg 86100ccataggttt cgcgcatctg gccgatcgac tgatagatca tgagaagcgt gatcccgtac 86160tttcggccgg catcgcgtgc cgtctcaagg atcctcatga aacccaggcg agcgacctcg 86220tcgagaagga agagagcgcg tcccggcatc gccccgtcac gattatagat ggcgttcagg 86280aatgagccga tgatcacccg cgccagacct ccgtgggttt ccagcgtttt gagatccagt 86340gcgacgaaca cgtcggtcgt tcccgacgcg atgtcatcgg tcgaaaaggt cgaaccggac 86400acgagaccgg catagttcgg atagctcagc caatgtgttt ctttgatcgc attggcatag 86460acaccggaaa atgtctccgg cgtcatgttc acgaacgctg caacgttctc ctttacgaaa 86520tcggactcgg agttgtcgta gatttcctga agccgcgccc gcagctttgg ctccggttcc 86580gagaggttca tgcggacggt ccgcagcgtc tgattcttct tttccgtatg accggacagg 86640cagacatcgg cgatgatcgc cgtcagcagc tgcaagccgg acgcccgaaa gaaatcgtcc 86700cggacgccgc taacgcggcc gctctcgctc atgatccagg aggcgaccgc agcgatatcc 86760tcttccttcg tcccgccatg ctgaccgatc cagtcgaggg cattaaaccc gatatcggga 86820tctttcgggt cgagcacgat gacatcacgg ccggccttaa tccgatgcgc cttgaccatc 86880ggcgccacct cattggatgg atcaagtacg atcagcgtgc cgccccattt cagcgccgtt 86940ggaattgtca ccgacgtagt cttgaaaccg ccggagcccg cgaacacgat gccatgcgac 87000gatccgaacg aaccatcgaa gcagagcagc ggtgacttgc ccccggtgcc ccatgtctca 87060ggctgatcgg cccgaaacga gagtgccgcc gtgctgtcgc gatcgacacg ataccgctcg 87120ccgatcacga tgccgccgcc gtctgcgaac agtttctctg cttccggcag tttcatccat 87180tccgcctcgc catgcagcgc gcgtttaccg cggatgcgtt tcggctcgga acgcgagaat 87240gcggcgttgc cgatcaccgc gacgcgcagc gcgaacatgc cagagaacag agctgcggca 87300gcacctgtca ttgttgccgg gtcgacgtag gacaggatcg acctggccgc aggcgcctgt 87360ccggcaaatt gcgaaagtcg cattccttcc cgaacgacgg caatggcgat gacggcgccc 87420gatccggcag cgacgcccca ccctgcggtc ttgatgttga ccgatccctg ggcactgagg 87480agaaagatca gcccgatcgc agcacttgcg atatagggca gcgacagtcc gattcggccg 87540agggtcaatt tggcctctgc cgtttttccg aaactggcga gccactgttc gatccccggc 87600aacatcagtg cgatggcgat catcaccagc ggcggaacaa cggcgagcag gatcctattc 87660gctgtcattg ccgaatgcct ccgcgccgat tgcgatcaga cgggatcgct ccgcctcatc 87720ggccttgatc ctcgtcttcg cttcgatcaa cagaccgagc aacagcgcgc gtttttcata 87780gcgcagtcct gccttgacga tcaggccgcc caattcgatc ttctcgcggg catccttctt 87840tcttgcctct gctgtggtca gccgctgcat ccgctcaagc ctcgccagcc tggcccgcag 87900ccgcgccagc actgagcgac gttgccgacg atgttccggt cgctccagcg gcactctttt 87960cttttccgtt cgatccggct ttggttccgc gaaaccgctt cgccacgtcc tcgaacgctg 88020cctgaaggtc ggcgtcgtcg acttcgatct ctccaagtcc ggccttcagc gcaatgcggc 88080cgatgcgttc ggcgtcacgc gtttccgctt gcttcagctg ttcttgcagg cgggcaagtt 88140cttcgcggat tttcgacgtt ggcttcttca tcggaatgca atctccagtc atgtccgtgg 88200aatgatggga tgagggtccc cgattttttc ccggcaggac aggtacaaat ttgtacctcg 88260ccaaagcgtc agcatttggc gaatgatccc gccgctcgac aagagcggat ccaagggcgc 88320aattatacgt cgctgacgcg acgttctgct tttgccccct ggtggggtca cctcttgcga 88380tcaacctgtt gatttcgttt gcaagaagga gcgctccacc cgtggccgtc ccgcatttct 88440cagtcagcat cgtcgcccgt ggctctggcc gcagcgcagt gctgtctgcg gcctaccggc 88500actgcgccag gatggactac gagcgggaag cacgcacgat cgactacaca ggcaagcagg 88560gtcttctgca cgaggagttc gtcatccctg ctgatgcgcc agactggctc cgcaccatga 88620tcgccgatcg ctcggtctcg ggtgcctcgg aggcgttctg gaacaaggtc gaggcgttcg 88680agaaacgggt cgatgcccaa ctcgccaagg acatcaccat cgcgctgccg atcgagctct 88740cctccgagca gaacatcgcg ctgatgcaag acttcgttgc cgagcatctt acgacgaagg 88800gtatggttgc agactgggtc tatcacgatg cacctggcaa cccgcatgtc cacctgatga 88860cgacattgcg gcctctgagc gaggacgggt tcggtgccaa gaaggtcact gttcgtggat 88920cagacggcca gcccatgcgc aatgacgccg gcaaaatcat ctatgaactc tgggcgggtg 88980gcgccgagga cttcaatgcc tttcgtgacg gatggttcgc tgtccagaac cggcacctgg 89040cgcttgccgg gctggatatc cgcatcgatg gccgatcctt cgaaaagcag ggtatcgagc 89100tgacacccac aattcatatc ggcgtcggcg cgacagccat cgagcgaaaa tcagaaatgg 89160aaaaccggct ggcgacagct gggtcacgta agcttgagcg gatcgaattg caggaggagc 89220ggcgcgcgga gaatgtccgg cgcatccagc gcaatcccgg tattgtgctc gatctgatca 89280cccgggagag aagcgttttc gacaaccagg acgtggcgaa aatcctccat cgctatgtcg 89340acgacgcggc cctcttccag agtctgatgg cgcggatcat gcagcatctg gacgtgctgc 89400gcctcgattg cgagcggatc aactttacct ctggtgtcag gacgccagcg cggtacacga 89460cgcgcgagat gatccgcctt gaggccgaga tggcaaaccg gtcgatctgg ctgtcgcagc 89520gatcatcaca tggcgtccgt cagaagatca tcgaggcggt gttcgagcgc cataagcgcc 89580tctcggatga gcagaaaacg gccatcgagc acgttgcagg tcaagagcgg attgcagccg 89640tgatcggccg cgccggcgcc ggcaagacca cgatgatgaa ggcggcgcgc gaggcctggg 89700aagcggccgg ctatcgtgtc gttggcgccg ccctggcggg aaaggcggcc gaaggattgg 89760aaaaggaagc gggtattctt tcccgcacat tatcctcctg ggaactccgc tgggcccaag 89820gtcgcgatca gctcgacgac aagacagtca tggtcctcga cgaagccggc atggtctctt 89880cgaagcagat ggcactgctt gtcgaagagg caacggtgcg aggggcaaag ctcattctca 89940tcggtgatcc cgaacagctg cagccgatcg aggcaggtgc cgccttcagg gccatcactg 90000atcgcatcgg ctacgccgaa ctcgaaacca tctatcgcca gcgcgagcaa tggatgcgcg 90060acgcgtcact cgatctcgcc cgcggcaaca tcgccaaggc tgtcgagtcc tacagcgcaa 90120acggtcggat gatgggatcg accttgaagt cacaagctgt cgaaaacctt atttccgatt 90180ggaaccgcga gtacgatccg gcccattcct cgctgatcct cgcacacctt cgccgcgacg 90240tgcggatgct caataccctg gcgcgcgcca agctggtcga gcgcggcctt gtcgatgacg 90300gtcacgcctt caaaaccgaa gatggtgtcc gccatttcgc

tgctggagat cggatcgtct 90360tcctcaagaa tgaaagctcg cttggcgtca agaacggcat gctggccaag gtggtggaag 90420ccaccccggg gcgtatcgtt gccgaaattg gtgaaggcga acatcgcaaa gctatcagcg 90480tagagcagcg gttctacaac aatgtcgatc atggatatgc gaccacgatc cataagagtc 90540agggggcgac cgtcgacagg gtcaaggttc tggcctcgct ctccctcgat cgtcacctga 90600cctatgtggc gatgacccgt catcgagagg atatcggcgt ctattatggc gcgcgatcct 90660tcgccaaggc gggcggcctg gccgagcttt tatcgcgtac gaactcaaag gaaacgacgc 90720tcgactacga gaagggcgcc ttctatcgcg cggcccttcg cttcgccgac gcgcgcggcc 90780tgcatctggt caatgtcgcg cgcaccctcg ttcgcgaccg cctcgactgg accgttcgcc 90840agaaacagaa gctctttgat ctcaccgccc gcttggcgac gatccgcgca cagctcggtc 90900tcaagggccc gaatacccaa gtgacctcga aacccgacat ggaggcaaag ccaatggtat 90960caggcatcac gacgttcccg aaatcgatcg accatgccgt tgaggatcgc ctagtcgccg 91020atccgggttt gaagaagcaa tggcaggagg tcacgacacg ctttatccaa gtcttcgccg 91080agccggagac cgcgttcaag gcggtcaatg tcgatgccat gctgaaagat ccggcaagag 91140cgcagacaac gcttgcgaag atcgcagctg agccggaaag gtttggagcg ctcaagggca 91200agaccggcat cttcgccgga gcgaatgaga aggcggcgcg cgacacggcg cttgtcaacg 91260cgcctgcctt ggcgcgaaac ctcgagcgct atgtgacggc gcgcgtcgag gcggagcgca 91320agcatgaagc gcaagagcgg gcaatccgcc tcaaggtctc catcgacatc cctgccctct 91380cgccatcggc caggcagacg cttgagcgga tccgcgatgc gatcgatcgc aacgatcttt 91440ctgccggtct cgaatatgcg ctggccgaca gaaacgtgaa agctgagctt gaaggctttg 91500ccaaggccgt gtccgagcgt ttcggagaac gcagcctgct gccgatctcg gcaaaagatg 91560caaacggcga gacctttcac aaaataacgg ccgggatgac cccttcgcag aaaagcgaag 91620tgaagtcggc ctggaacagc atgcgcactg tgcagcaact cgccgcgcac gagcgcacca 91680cgctggcatt gaagcaggct gaaacagcgc ggcaaaccca gactaagggg ctttctctga 91740aatgatattg gcgatgcctg aaagcactgc gatgtctcgt caacgaagct ccgcattgat 91800tacgttatcg gtggctgccg gcctgctgat cgtcttcttt gcggcgggtc ggattggtgg 91860tctgcgcgtc aacatgacgc cgagtgagcc gctcggcctc tggcgcatta ttccgctgac 91920gcgcgcggcc cggtccggcg atacagtttt cgtctgcccg cctgacaatg ccgccatgcg 91980cgaggcgagg cagcgcggat atctccgccc gggactttgc cccggtgggt tcgcaccgtt 92040gatcaagaca gtcatcgcgt tggcgggaca gcgcgtggac gtcaccgatc gcatcgccat 92100tgatggcgta ccgatcgcca gatcccgcat catggagaag gacggacagg ggcgatctct 92160acggcacgat caaagcgaaa tggtgcggcc cggagaggta tatttgcatt ccaacttcat 92220cggctcatgg gattcccggt atttcgggcc ggtacctgtt tcaggtgtgc tcggtctggc 92280gcaagaggtg ttgacctatg cgccgtgagg tcaggatgac tgccgttctc gtcccgcttg 92340ccgtggtcgc cggggcggtt ggctggagcg gccaggcgtt cctgctccct gcggcaacac 92400tcttcccgct tctgtgggcg cgatcaccaa cgcggatcgc agcggccctc gtcgcggccg 92460gctatttcct ggcggcgtca cggggtttgc catccggcgt cgcagagttc tttgctgagg 92520atctctgggt cagcctcagt ttctgggtcg cggcggcatc gtctttcgtt gctgtccatg 92580cggcgctttg gacgatgcgg tcgggctcgg caaaatcagc acgctatctg ctcatcttgg 92640ctctcaccgg tctgccgcca ctcggcatca caggctgggc gcatccgctg acggcggccg 92700gcatactgtt tccagaatgg ggatggtggg ggcttgtcgc gttgacagcc ggcctgatcg 92760gtctcgtaac ccggatcggg ccggctatcg ccattgccct gtcaggtcta tggctttggt 92820ccgccgcatc ggggacaaat cagattcttc cggaggggtg gcgtggtgtc gaccttgaaa 92880tgggcgcgag tctcggccgc gatcaatccc ttcgacttca acgtgacctg gtgacggctg 92940ttcggcaggc tgccggaaca cgagagaccg tcgtcgtgct tcccgagagc acactgggct 93000tctggacgcc aacgcttgaa cgtttctggc ggaatgagct gcaaggaacg cacgtgactg 93060tagtcgccgg cgcggcggtc gtcgatgcgg ttggctacga caacgtcatg gtggccatcg 93120atgcgcatgg ggggcgtgtc ctctatcgcg agcgcatgcc tgtgccggtt tcgatgtggc 93180gtccatggga gcgatggaca ggagagactg gcggcgcccg cgccaacctc ttggccaatc 93240ccgtcgtcga ggtcgcgggc cgaaagatcg cgcctcttat ctgctacgag cagctcgtac 93300tgtggcccat tctccagtcg atgctacacc gacccgacgc gatcgttttg atcggcaatg 93360gctggtggac gacgggtggc aacatcgtcg ccatccagcg cgctagcgcc aaagcctggt 93420ccgctctgtt cggcgttccc cttgtgattt ccttcaatac ctgaactttg gagccttcgt 93480catggatgct gcctttatcg cggaatgcgc cgatctctcc ctgaaacccg ccatcgtcga 93540gcagttcgta gccgctgtcg gtcctggcga tcccctggct gtcacggtca aatccggagg 93600gcggctcatc cttgtaccaa aaccgaagac cccagacgag gcaatggagg tcatacgcca 93660gtatgtcgga caggccgtcg tgcgtgtggg cctgacacag ttcccggcgg gtgtcggcgt 93720gaaggacgcg tccgcgctga aaccagatct ggttgaccca tgcgaaaatc ttcgcatggg 93780gacgaggatg ttttcaaaga tcatgcgcat cgtttcaaag tggtatggca acccaacgag 93840cagtgaggtg cttccgcaga tcttcgaaga tgccgtttac gcctggaaca ccggccagtt 93900cgaaggtgaa agcgtgtttc aggcggagga tccaggtggt acaatcgtcg atcggaagga 93960agtttcttcg gatgccgcag acaaacctgc tgatgccacc gcctcccaga gcgaagggga 94020gccctcagac gaaaaggagg ttggaaccgc gggaattcgg gtcgatttgt cccggatcgg 94080tgggcagaag tagtgctgta tccgacttcg acgacaggta aaatatcagg gatcaggttc 94140gacaattgcg acattgaggt cgttcagtac atcagccaga cccggcgcgc ggatcagctt 94200cgtcgtgcgg accgccttca gttttccaat agctcgatcg aacactgcaa ggttggtgtg 94260gccgttgagc cgagacgggt agatgatgcc gtccacctgg ctgtcgtgtt cattgaaggc 94320gaccgcccac ttccgtgcga gggattgctt tgagcccttc gcgacatccg tcggcacacc 94380catcttgatc ggcccgtcgt ctcgaagatc gaccatcatc agcggattga tgacctcgat 94440ctctgcgaaa ttgcggtcgt acaattcgga ttcagctatc ggcaggtcgc cgaggacccc 94500atcgcgctga tcgcgcagga cggcttcgag aaagcacacc ttcactgtat cgcccaaata 94560gagcaccccg aaccggttag cgaattttcg ccggcgtgga tcgctgaaac ggctcggcgt 94620cttaccgaag cctagcggat cggggtatgt gcccagatag atgcgaccga accgaagtcc 94680ggccgcgacc gtatgaaggt gaaggctcgc attcgcaaag ccgggaggcg gcagaacacg 94740tgccattcag cggaaatctc gaccaatgct ctcgacaacc tcgagcgctt gctcggcccg 94800tccccgctcc aatgcctggc gacctgtcag tccgtccagc tctccgtggg gctggaccag 94860gaagcggtaa accgcccaag ctccgcccag tcgctcgtgg agcgttgcaa gcgctgcaaa 94920cggcttgcca tcggcatcga tctgccaatc cgggaagcga aagccgcgtt tcgcgccatc 94980cagccccaat accagtccgg tctggcgctt tgaattcacc gttacccgtg tcgtgccaag 95040cagcttggcg aattcgtcgg cattcagcat gtcagtgccg ctgaggacct cagcagcctt 95100tatgcgtccc cgcgcccgtg cggccaccaa cgcctgctcc aattccggat ccagtgcatc 95160gttctcctct acgacaggca ccgttgtcat ttccaccgcc tcaacgggag tgacaaccat 95220ctcaccttcg gaatcgacat cgacacggaa gctgaccggg tggccagcag aacggctttt 95280tgcgatcgct tgaccatatt cctggaggag cgccttgacg cgattgggat tgccggtcag 95340ggcttttgat gcattgtccg ggatcttgat cttgaaggcg gctctcccct tcgccagcgg 95400ggcggcgcct gtggtcagga aaaaagccat ggattcagcg cccggttttt cgcgcccgct 95460tgcaccgtca cgtatgctgg ttttggactt cagagatgcc atctctcacc ctccgttcgg 95520agagctatat atggcaaggt tggttaagtt cgtcaagttg gtaaagagcg tagcgctcct 95580gatcttctgt gtcctgattg cggctacgtg gacgactgcg gagtgatcga cgacaatcat 95640ggttgatgca ggtcgtcgag gatttctttc ggggatgatg tatcaagcag cggtagggca 95700gaaacctttt ccccgatcgc tgtcatctgt tcgacggtca tgcgatgtct cacaggcagg 95760tcgccgaaaa ccccgagagc ctgagcttca cgttcgaggg cagcgcgtat gatatcgtcc 95820ggtctgcgcc cgacacgggc cgcaatttta cgggcaagct gctcggtgtc gtgggtaagc 95880tgcaacatgg gttcgctcta aatgggtcct tccatgtaaa gcatttctca aaacaatgac 95940agatttctgc tcaggggcca tgaagctgag atcgcttggc caattgtgag ctgacacgtt 96000ttccgcgagt aagcaaaatc cgtggtttgc aattccgaga aaacgattta gaaaaccatt 96060ccttgatggt caacttacgc gattgaatat gccttattct ttgccagatc actgttcgca 96120cgcgtcgcga tccttctgac tgcgacgcat tccgccactg cggaacaggt gcgatccaca 96180gggagattat ggatgtcaaa ctgggtcgag aaactgctgg atatcaccgt gatcggaaat 96240gatcagtcca tggtcaaggg cgctctggcg aatcttgctg atcggttcga ttttgtgggc 96300tatgccttcg tcaacattcg tccggggcag acctatgcgg tctccaacta cgatatcgac 96360tggcagaaaa tctatgacac gctggactac cggttcatcg atccggtcat gcggcaggcc 96420cagcttataa ggcgcgcttt cgcctggtct ggcgaagccg acaagagctc gctgtcaaaa 96480gagcagaaaa acttcttttc gaaagccgct gattttaaca ttcgctcggg cgtttccatc 96540ccggtcgcca ccgccaacgg tgcgatgtcc atgctgacct ttgcatcggc gaagccttcg 96600cttgccagtg atatggagat cgatgcgatt atggctgcct cagcggtcgc ccagcttcat 96660acgcgtcttg agcacatgcg ggtcacgccc tccatcgagg aaaagatcgt cttgacgccg 96720aagcaggtga actacattcg ctggctgtcg cttggcaaaa cggtcgaggt gatcgctgaa 96780ctggagcagg caaagtatgc tggcgtccgc tctgcgattg acgatgtcag aacgcgctac 96840aatctggcca atcatgcgca ggtggtggct ttggctatac gacgcggcct gatttaggct 96900gatctggcgt atcaggcctt gggcgtatag cccagaatgt gcagcagggt cgtcagggct 96960gacatttgcg cgtgcatcct gatggttgcc tcgagatagg caatattggc atcgccaaga 97020agctccttac cggctttaac gtcagccggc agttcattga acagattttc tgcccgctcc 97080aacagtttgc gatgttcacg gatcgcatcg atcgtgagac gctcgacaag cggtgacgga 97140agcccatgca ggagccctat cagcggcttc agatcgactg cctcgccatt caatcggtcg 97200tcggcgtcca tgttcaactc ccaaaacagg aatgcgcggt tcgcccccgc atagttcctg 97260acccctggcg atcggggagt ttgtaaccga gcacactcag cccatggacc tttagttccg 97320aggaacctgg acatacgtcc acggctcccc gaccataggt cgaggaattc ggcgccctaa 97380cggcgggcac caaaccggtg tgcttcgggt tacaaagccc ggaggcagcg cgtactgcct 97440caccagcgct tatagcgacc taaccacatc cgcgccaccg cagatttgtt ggcgtccgag 97500gtcggctcgc ggccagcgat tgaagaagga gactggaggc gttgtcgctt tggtgtccaa 97560aatgaaacgg gtgatcgtcc aatagtcaaa cgaagttaac ctcggcattg cgatgcctct 97620cctcgccgtg aagttgcgtt tgaaccacga aagcaatcag gctacagcac gatcccttga 97680agttctgcat cgccgccgaa atcggttggc tgatcattcg atctctgcgg cggattgtca 97740ggtcgcagtg ctggaagcgg atattgacac gatctctcgc cgatttttcc gacgttaagg 97800aacgccttgc aaagacgggc tcggtgacgg aagcgctcca tttcatacag tcggtctatc 97860gcgtcgattt cataacctac caccttgctt cgacggtgat cggtgatttt gatgctccgt 97920tcgtacgcac gacctacccg gatgcgtggg tatccaccta tctgttgaag ggctatgtca 97980ccatcgatcc tgtcgcgcgg gagggctttt tgcgccagct gccattcgat tggcgagaac 98040tcgacgtcac gcccgagatg ctgatgtttc tggaagacgc aatacgccat gggatcggcc 98100gttttggttt ttccatcccg atatcggata aagccggccg tcgcgccatc ctctctttga 98160attcgaacgc ctccgccgaa gactgggagg atctggtcag tgctcatcgg agtgaatggg 98220gcgatctcgc gtatctcgtc caccagatgg cagtgttcga gctacatgga gcgagcgatc 98280cgatcccggc tttaagtccg cgggaacgtg agtgcctcta ctggagcgcg ctcggcaagg 98340attacaagga tatcgcgctt attctcggcc tttcgcatca cacgacccgc agctacatca 98400agtcggcgag gacaaaactc ggttgcgcca cgatctcggc ggcggccact cttgccctga 98460agctacgcgt gatcacgata tgagccgacc gcccgccagt ctttgacaat acccgcatat 98520gggtctgacc atatgcggga atatctggct cctccgccaa gcggcatctt ccagccaaga 98580tcaacagctg gagataaacc ttgttcattc tggttcaagc gcatcaatac acccgttatc 98640aggctctcat ggatcaggca tttcgcctgc gaaaacgcgt ctttcacgac cagctcggat 98700gggccgtcac aatcgacggt gattgcgagc gcgacgaata cgatgctctg cggccggctt 98760acctgatgtg gtgcaatgat cgcgcggatc gcctttatgg aaccctgcgg ctgatgccaa 98820ccaccggccc gacgcttctc tacgacgtct tccgcaacac gtttgcgggt gcaaacctga 98880ttgcacccgg tatctatgag ggaacgagaa tgtgcctcga tgaggaaaca ctttccgtgg 98940atttcccgag cctggaaacg ggcaaggctt tcggcatgct gttgctggct ttgtgcgaat 99000gcggattgtc gcacggtatc gagacgctgg tgtcgaacta cgagccgcac ctagcgcgcg 99060tctatcgtcg ggcggggctc gccgttgaag aggttggccg cgcagacggc tatggtcgct 99120ctccggtttg ctgcggtatc ttcgaagttt cagaggaagt tcgcacgcgc atgcagcagg 99180cgcttggtgt cgcggctccc ctttatgcag gatatcggcc gcgcaaaaat gcagccagcg 99240agcccgtgcg catatctgcc tgatccagga gttgtcccaa ggcggttgcg gcaacatgtg 99300cctcaaccgc cataatttcc gggaaagaca atgtcctggt cgacgagaac gttgaacttg 99360tagcccggcc ggatctggat ggtgggctga acattcagat tcttggaaat cgtctgctcc 99420gcgacgcggc cgaaggtctc cgcaaagttc ctgcgtgccg cgtcagaggc tgtatcctgt 99480gtggcgaggg tggaactcgc cggaaccgcc atatcgatgc cggtaccaat cagtgcaaca 99540agcgccgccg aaccgaaggt gcggaaatag tgattattga ccttgtcaga gaacccgcca 99600tagccctgcg agtctgttcc agccatgccg ccgatctgca gtgtagagcc attcgggaag 99660atgacatccg tccagacgac cagaacgcgg ctttggccaa acgagacctt gctgtcatag 99720cgtccgagta gtttggtacc ctgcggaatg agaagaaaat gcccggtggc gctgtcgtag 99780atgtgctggc tcacctgcgc tgtgatccgg cccggcaaat cggagatgat gccggtaatc 99840atggtggccg ggatgacgga gccgcgcttc aattcatagc gtgactgttg gggtacaacc 99900tggttcggca ggtagccgag atccttgatg tcggcgttga agaaatcttc cttcgaagtc 99960tgtccgttcg gatcggcatt ctggcccatc aaacccgatt tcatggccgc ggcgtagaga 100020tcagaggcgc cgttattggt ggtcggctgc cggtctgttg tcctggtgtt gctggagata 100080tttcccagct ccgagatttt gaccttcagc ggcgagtcaa acgcagtcgc acgggcctga 100140aggctggcca tccgctgtcg ctgctgttca cgcaggactt gttcgcgctg ttcgcggcga 100200agtcgggcca accattcttc ttccgactcc atttgcggtc ggcgctcttc tcgtgcctgc 100260tgctttatct gctcttcttc aatcggcttg gcctccacct gtgtctgggt tgctggcgtg 100320ggctggaata cgggctgctc ttcgcgatcc ccgatgatgc cgtctttcac cccgcgcttc 100380atctgatcag cgaaggtcga ggccgggacg ttcgagcctg cttcatccgg aattctgtcg 100440ccgaaccgca gtccccggga tgagatgccg tagacaagga caccggcgac gacgactgcg 100500ataccgatgc caaagaacac cggcaggcga ttgagccgtt tcatgccctt ttcctgcgcg 100560gcgctgctcg gattgccgag ctggagcgac tggaccatat ctgtctctcc ttagtttcgc 100620ttcattaatg aaagcgggct cgccggcgtg gcgccacctg atgacacaga ataggcccgc 100680ccaagctcaa gcgtctcgct ggaaagcctc actagtacct gtccgtcgat gtcgatcaac 100740gagtatgcca gttcgatcgg tttggcggtg tctttccccg agcgtgcctt gtcatccgtt 100800atgacagtga aaccccaccc ttttaacgcg gcttcgagcg cggccgcgaa atctgatgcg 100860tcgctgtgaa gcctgatcgg cgtggcggtt gaccctgcct gctcggcata acgtccagct 100920atgtcgccgg cgatcgcgct tgcggcgggg cctgttacag tcgaaggcgc ggggctcgtc 100980gtgagcgcgt ctgttccggt ctggcaacca gagagaagaa cggcagcgac aaagggaaaa 101040aggcaaaggc gcatcgatca gcctccccgt cggatggtga ttttctgctg acgccagccg 101100acgccggaaa cgaggacagc cttgtcgata ttgtagtcga taatcatcat attgttcttc 101160atgcgataat tgacgatccg gttttgcccg ccagagacca cgaagaggac cggcgcatcc 101220tgaccggata gtgcgcgcgg aaactgaatg taggtcttct gcccgtctga atagacgcgc 101280ttcggcttcc agggcgcgct gccactcaga gaataggcga aggcaagttg ctctggcggc 101340acgccgccgt cggaattggt catcgtctga atacgagcat taatgtcgga cagtctcgtc 101400gcggcctctt ccggatactc gaagccgacg cgggccatgt actggttcgg gtgcgatttg 101460agctggatat gataggtgcg tcttgaggtc gtcaccacca tcgacgtcac cagacccgcc 101520tcagacggtt tgacgatcag gtgaattgcc tgcccccctg cagcaccgga tgttgccggc 101580tcgaccttcc agcgcaccgt gtccccgaca agcacgtcgc gcacgatctc cccaccctga 101640agctcgatgt cgcagacctg taaaggtgag cagacgacag acggctgcgt ctcaccgaac 101700aggaagatga cttttccgtc agcgcccgtt gtcaccagtc cccgctgccc acgccatttg 101760ttggagagcg tggttccctt agcctcattc gtcgtcaggc tctgggcaaa acccgatgtc 101820gtcgccgtga ccaaaagcgc aagtgcggtc atgcagcaaa gcgctgcccg atttaacctt 101880gtattcattg aagtcccctg cccttacagt tgcgcggtcc agtcgaagtc cttgacatag 101940aggccgatgg gattgagccg gatcgtcgcc tcgtcctggg gcgcggtgat cgccaccgtg 102000gctatgccgc gaaatcggcg tgtcgcaatt tccttgccct tgcggtcccg ttcgtactca 102060gtccagtcga tctgataggt ctggttagac agcgcgacga tgttgttcac ctcgatggcg 102120acggtcgcat tcacggcctt ttcgaatggc gagttgccgc ggaaccaggc attgatcttt 102180tgggtcgagg gatcgcttgt cctaagaagc gcataggtcc tgtcgatgta ttgcttctgc 102240acgacggcat caggcgtgat agagcggaaa ctggtgataa agccgccaag cgtggcccgg 102300atgaccctgg catcggcata ttcgatctgc tggggaaatc cggcggagac ggtgtttccc 102360agcttgtcga cctcgacgat gtacggcacg agtttgacct gcgtgctcag atacagtgag 102420tagccaaaac tgattaccgc catgccgagg ctcaagatgc cgaccgtccg ccatgcggag 102480gctgccctta cgtaagaacc gtatcgttcc gaccattcct gccttgcggc aagatacggg 102540ttctctgggg cgcgttgcgc tgccatattg ttttccctgc cttaaattta cgatttgtcc 102600tgccgctccg gcggctgacc gggcgaggct cccttgccac gagcctggtc gagcttcgcg 102660ttagccaggc caaggatgga gccggcatag gccccgggcg acccgatcgc cttctctttg 102720gctgcggatc ctgcggcttg tgctcctgaa ccaaagctag cgccaatccc gcgaagagta 102780gcgccggcgg tcgaagaccc cgccgcccgt gccgattgtg ctgctgcata tcctgcccca 102840gcagcgccag ccgcaagaaa agcggcgcct gcagcgaagg aagcgccctg gccgccatgg 102900cgaatagtct ccatgccgcc agtgacggac gctccctgaa cgacaccctg gataatgttc 102960ggcacgtaca tggcgatgat gaacaccacg acggcgatgc cggcgatcgc aagtgcggtc 103020tgaaattgat cgccgatatt tggttcgttg gcgagcccga ttagtacctc ggaaccaata 103080cgggagatca taacgagcgc catcagtttc atgccgaccg aaaacgcgta gaccagatat 103140cggacagcaa agtccttggt gaacgacgag ccgccaagcc caagcatgat catcccggcg 103200agaaggccaa gatacatctc gaccatgacg gagacaaaga ttgctgcgac gagtgaaaat 103260gcgatcaccg tcacgaccat tgcaaatgcg gccgatatcg ccagtgcatt atcctcgaaa 103320agtccgaact gcactttcgc tgacatcttc gttgctaccg tcagaccggc attgaagacg 103380tctgcaggtg aggccgtacc tcctccggca ccgatctgaa aaagactgtc caccacggct 103440ttggcgaatg tcggtccttg cgtcagcacg aaggcaaaga atcccacaaa catgatccgc 103500ctgacgagct cggcgaacca gctgtccagt gatgcggcct gcaatgccaa ccaaacagcg 103560gcaattccaa tctcgatggt ggcgagaatc cagaagagag atttcgccgc gtccatcacg 103620gtggtctccc accctttggc cgcggttgta atctgggtct gaagagacgt cagaacagag 103680ccttcctgcg caaaagccgg gtgagcaatc acgacaggaa cggtgacaag tagcagagcg 103740acccgcaatt cgctgttgga gatcgtcatt ggttcaccat tcgaccttca tcttctctcc 103800gccagaagtc gggtaggtct tcgacgaacc gaaaaatgtt gcgcggaggt gttgcgcctc 103860ctgtttctcg gacatcagga accatagccc ggcgctgccg acagcgagca aagatgcgac 103920tgcgatcaag atcagcttcg ttctcaccat tcgaccttca tcttttcgcc gccggaggtg 103980gacggtgctg cgccgttgaa gaattccttc cgccgagctt gtgccagatc cttgtcggtc 104040tgctcgcttt gcagccacgt ccccatcatc gtcatctgct gggatacgag accacgcagc 104100ttttgcgttt gcgcaacctg ctgcgctgca atctcgtggc cgacctggag agctttcatt 104160tggccatcgg ccgattccga catgtttcgg agcgagtcca tcgtatcctc ctcgctgtcg 104220aactgctcag ccgtcaggct tgcggccttg agtgtgctgg cgatggtgtc gcgattggta 104280tcagaccaac tggcatagtt tgaggacagg tctgtcccgc tggcggcggc agtctgtaga 104340tcggcatagg attgaaagcg ctgcttcagc acatcatccg cgctccccat agagaaagag 104400atgctctgtc cctgatcgac gatatcccgc agccggttga ggtcgttttc gacttggccc 104460cagatgtgat cgggcagctg cgccgtgttt tgcagcatat tctcgtagat gttcagctgg 104520ttttggatct gctcggccaa ctgactgatc tgtgtcagct gattgtcgac ttgcaggccg 104580gagcttttaa ggaggtcgac gagctgtgca ttgttggcaa gctgtgtcca ctcggttgca 104640gcgcccgtcg ctgagccggc aaatgctggt gccgaagcgc agactgcaaa agctgccacg 104700atagcggtcg cggattttct tctgagcgat aggatatggt caggcatagc gattgatccc 104760tctttcattg agccattggg tcggccagtc tttgccgtag gttgagagaa gttcccggat 104820ccgagcgagg tcggctttgc cggaagcacc gacgaaggag agggtgagcg gccccagcgc 104880catatcgaaa aggcggcgtc cgtccggcga cgtcacgtaa tattcccgct ttggaatggc 104940ggctgcgacg atttcgattt ggcgaggatt aaagccgatg cgctcataga attctcgtgt 105000cccggactcg cgtgcagccc cattcgggag gcagatcttg gttgggcagg attccttcag 105060gacatcgatg atgcccgaac gctctgcgtc cgaaattgac tgagtggcga gaacgacggc 105120gcagtttgcc tttcgcagca ccttcagcca ctcgcggatt ttgtcgcgga aaaccgggtg 105180gccgagcatc agccaagcct catcgagaat gatgaggctt ggtgcccccg tgagccgctt 105240ttcgatcctg cgaaacagat aggtcagcac ggggacgaga tttcgctcgc ccatattcat 105300cagttgctcg atctcgaagc actggaattg accgagggtc agcgaatcct gttcagcgtc 105360gagaagctgg cccatggggc cgtcaacagt atagtggtgc

agcgcgtcct tgatctcccg 105420catctgcacg ccactcacaa aatccgacag cgaccggcct ggagcccccg ccatcaaacc 105480gatctgccga gatatggcgt ttcggtggtc cgggttgacc gtgacaccct gcagggagac 105540gagtgtttcg atccactcgg aagcccaggc gcggtcggtc tcggtcgaga ggtcggagag 105600agggcaaaag gcaagcctag ccccctcccc tgcctcgccg ccgatttcgt aatgattacc 105660atcaacggcc agcgtcagcg gcagaataga gttgcctttg tcgaaggcga aaacctgcgc 105720acccttatac cggcgaaatt gcgctgcgat gagcgcgaga agcgttgact tgccggaacc 105780ggttggtccg aaaataagcg tatgcccgac atcatccaca tgaaggttca gtcggaaggg 105840tgacgatccg gaagccacct gcgtcagtgg cggcgcgtcc ggtggataga acgggcaggg 105900cgcaagtgga ctgcccgacc agacggaatt gagggggatg aggtccgcga ggttgcgggt 105960gtttatcagc ggttcccgga tattgcagta ccagttgcct ggcaggctcc cgaggaatgc 106020gtccgtcgca ttcaacgtct cgatccgcgc gccaaatccc tcagcctgga tcaaccttcg 106080aaccgactca gctttatcgg cgagcttttc tctgctctcg tcgaatagaa tgatgaccgg 106140cgtgtagtag ccataagcga ccagctgcga agaagcctcg gcgatcgcgt cttcagtctc 106200agcgaccatg gccattgcgt cctggtcaac cgatcggctt tgcgtctgga agagttggtc 106260gaagaacggc cgcaccttct gttgccattt cttgcgcgtg cgctccaacc gctgtttggc 106320ttcctcggca tccagaaaga taaagcgtga cgaccagcga taggtgagcg gcaagagatc 106380gaggctattc aagatgcctg gccagctctc ggccggcaaa ccgtcgatcg caatcgcgct 106440gaggaaccgg ttttcgactt tcggggtaag gccgtgctct agctccgcgg tcgccagcca 106500atccaaatac atgggaattt caggcagaca gactgggtgg ttttcaccgg tgatgcagaa 106560ccggatgaac tggaacagct catcgtagcg ggcaatgcgg gtgccaccgc gttccggcac 106620ctcacgcgtc cgcatacgct caatggagat gacgttgccg aggtattgct caatctctcg 106680ggtggagcgc ctgaaactgt cgagcaccgt gtcggcatag gtcgccgtcc ggctctcagt 106740gtccgagtag atataacgcg tgacgccaga tcgccggcgc tcgggagggc gatatgtcag 106800gacgagcgca tgccggctct cgaaatgccc gcgctcttgt tcgaagtgct tgcgccgctc 106860atcatcgatc attcgagtga cagcatcggg gaaatgactg cgttccgcag aaggatagtc 106920agttgttggg atgcgcacgg cctcgacctg gatcatccag ccggaaccta gccgtgaaag 106980gatcgtattg atctgacggg acagatcgtt gcgctcgaaa tccgtggcgc tctcggagtc 107040agggccggca aaataccacc ccgccatgag acttccgtcc ttgagaagaa tggtcccatt 107100gtcgaccagt ccggcatagg gcacgagatc ggcgaacgac ggtgcagacg ggcgaaggga 107160acacaaagcg accatcatgg cacctctaaa aacgccgcca cggcgaagac gtgggcaggt 107220agtgatgccg gtagcgcaaa tgccgcacgt agacatgacg catgagggga tcggattttg 107280ccatcatgcg cagtgcgccg acgatcacga accagatggc gatgccgaac agcgctgaat 107340acagggtgag cacgacgaag atcaggatga tcgccaccag ccctgtgaca agcaggagct 107400ctcggtctgc ccccatcagc agattcggtc gtgaaagagc gcggtgaatg cgattgcgtt 107460ggagagcgga atgcggctca cccattggcc ccctcccctc ttgcaacgga catcggctgg 107520gaaacggtcc ctggcaaact tgtggcagtg atgccgatcg acgcgccggt cgcaccgaac 107580agtccgacaa tcgtcgtcgc ccccagcagg ataccggcga ccagtacgat gtagacgagg 107640cgtcgcgcga aatcgttgag ctcgccgccg aagatcagca ttccgccggc gatcgccatg 107700gcggcgaggg caattgctcc tgcgactggc ccagtgatgg attcctgaat ctgttcaagc 107760ggcccctccc agggaagact cccaccggaa ctggcaaggg ctggcgcggc aagcgccgcg 107820cagaacatcg cagcgagcag tccgaggcga aaagagcgat tatgcagcat gaatgtcctc 107880atcaatttga gcgtaatgtt cggtctggta ccggctaccg ctgaagccct cgacattgat 107940gacctctcgt acccgtctcc ccctccccgc gcgctcgatc gagatgacaa gatcaacggc 108000ctcgccgatc acagcctgca tcggttgctg gctgacctcg gcggtcagtt gctccagacg 108060acgcaaggcg gacatggcgg tattggagtg gacggtggtg acgccaccgg gatggccagt 108120attccaggct ttcagcagcg ttagtgcggc gccgtcgcgg acttcgccaa cgatgatgcg 108180gtcgggacgg aggcgcatgg tgctcttgag cagtcgcgcc atatcgatcg tgtcactggt 108240atgcaggcac accgcattct ctgccgcaca ccggatttcc gcagtatctt caagaatgac 108300catgcggtcg tccggagctg aggctatgat ttcggcaatt acggcattgg ccagtgtcgt 108360tttgcccgag ccagttccgc ccgcaattac gatgttaagc cgattggcga ttgcgctcct 108420aatgactgcg gcttgggcct ccgtcatcac cttgtcagcg acataatcgt caagcgggat 108480cagccgtgac gctcgccgcc ggatcgtgaa cgttggggac gcaacaaccg ggggcagcag 108540cccttcaaag cggtgcccgc caatgggaag ttcgcccgaa atgatcggcc gctcttcgtc 108600cgcctcagat tgaagagcgt gtgcgacgga gccgatgact gtttccgctg ctgtcgccgc 108660catctcaccc gcgggcgcaa tgccctgccc taaccgctcg ataaaaactc tgccgtctgg 108720gttgagcatg atctcgacga ccccagggtc gtcgagggcg atacatagac gatcgcccag 108780tgcttcttga agcttgcgca caaggcggga atgcgactga agcattgcga cgttctcctc 108840gctgattgat ttgggggaga aaaaagcggg acggcaccaa gctgtccacg tacaaatttg 108900tacctcgcga ttctctgtcg tttcctgcac ggtggcgc 108938

Claims

1. An isolated or novel bacteria strain Agrobacterium tumefaciens deposited in the IAFB Collection of Industrial Microorganisms of Institute of Agricultural and Food Industry under the number KKP 2039p.

2. An isolated or novel bacteria strain Paracoccus alcaliphilus deposited in the The IAFB Collection of Industrial Microorganisms of Institute of Agricultural and Food Industry under the number KKP 2040p.

3. A novel or isolated or non-naturally occurring plasmid pSinA having a nucleotide sequence shown in SEQ ID NO: 1.

4. A method for producing a bacterial strain capable of chemolithotrophic arsenite oxidation, comprising introducing the plasmid of claim 3 into the bacterial strain.

5. The method according to claim 4, wherein the introducing is carried out by a process comprising: (i) triparental mating with the use of a donor strain harbouring the plasmid, and a helper strain harbouring a helper plasmid, or, (ii) biparental mating with the use of a donor strain harbouring the plasmid.

6. The method according to claim 5 wherein the donor strain is i Agrobacterium tumefaciens deposited under the number KKP 2039p or Paracoccus alcaliphilus deposited under the number KKP 2040p.

7. The method according to claim 4, including introducing a gene encoding a selection marker into the bacterial strain.

8. The method of claim 7 wherein the selection marker comprises antibiotic resistance.

9. The method according to claim 7, wherein the introducing is by a plasmid.

10. The method of claim 9 wherein the introducing is by triparental mating including a bacterial strain harbouring the plasmid containing the gene encoding the selection marker and a helper strain harbouring a helper plasmid.

11. The method according to claim 4, wherein the bacterial strain is isolated from a natural environment.

12. The method of claim 4 wherein the bacterial strain is isolated from an arsenic contaminated environment.

13. The method according to claim 4, wherein the bacterial strain is an Alphaproteobacteria or Gammaproteobacteria bacterial strain.

14. An isolated, novel non-naturally occurring bacterial strain capable of chemolithotrophic arsenite oxidation, produced by the method according to claim 4.

15. A composition comprising the novel bacterial strain according to claim 1.

16. A composition comprising the novel bacterial strain according to claim 2.

17. A composition comprising the isolated, novel, non-naturally occurring bacterial strain according to claim 14.

18. A composition comprising a novel, non-naturally occurring, isolated bacteria containing the plasmid according to claim 3.

19. A method of bioaugmentation of arsenic contaminated environment, comprising introducing the isolated novel strain according to claim 1, or the isolated novel strain according to claim 2, or the novel, non-naturally occurring isolated strain of 14, or a bacteria harbouring the plasmid according to claim 3, or the composition according to claim 15, or the composition according to claim 16, or the composition according to claim 17, or the composition according to claim 18, or a combination thereof, into an arsenic contaminated environment.

20. A method for the removal or recovery of arsenic comprising chemolithotrophic arsenite oxidation by the isolated novel strain according to claim 1, or the isolated novel strain according to claim 2, or the novel, non-naturally occurring isolated strain of 14, or a bacteria harbouring the plasmid according to claim 3, or the composition according to claim 15, or the composition according to claim 16, or the composition according to claim 17, or the composition according to claim 18, or a combination thereof.

21. The method according to claim 20, wherein the chemolithotrophic arsenite oxidation is followed by precipitation of the resulting arsenates and/or adsorption of arsenates.

22. The method according to claim 21 wherein the precipitation or adsorption is carried out using burnt lime (CaO), calcium hydroxide Ca(OH)₂, bog iron ores or a combination thereof.

23. An isolated or novel or non-naturally occurring plasmid comprising the nucleotide sequence corresponding to nucleotides 24376-34453 in SEQ ID NO: 1.

24. An isolated or novel or non-naturally occurring bacterial strain comprising the plasmid of claim 23 or the nucleotides 24376-34453 of SEQ ID NO: 1.

25. Use of the plasmid defined in claim 23 or the strain defined in claim 24 for arsenite oxidation.

26. An isolated or novel or non-naturally plasmid comprising the nucleotide sequence corresponding to nucleotides 43229-50772 in SEQ ID NO: 1.

27. An isolated or novel or non-naturally bacterial strain comprising the plasmid of claim 26, or the nucleotides 43229-50772 of SEQ ID NO: 1.

28. Use of the plasmid defined in claim 26 or the nucleotide sequence comprising the 43229-50772 of SEQ ID NO: 1 for the production of a strain with increased resistance to arsenic.

29. Use of the novel strain according to claim 1 or 2, the novel non-naturally occurring isolated strain bacterial strain according to claim 14, the plasmid according to claim 3, the composition according to claim 15 or 16, or combination thereof, in the processes of biological removal of arsenic characterized in that the removal of arsenic comprises bioaugmentation or biometallurgy of arsenic.

30. Use of the isolated novel bacterial strain according to claim 1 or 2, the novel, non-naturally occurring bacterial strain according to claim 14, the plasmid according to claim 3, the composition according to claim 15 or 16, or combination thereof, for constructing bacterial strains capable of chemolithotrophic arsenite oxidation.

Images