Microbial Bioreaction Process

Abstract

A cis- or trans-stilbenoid of the general formula (1): in which each of R¹, R², R³, R⁴ and R⁵ is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, is produced by cultivating a micro-organism producing said stilbenoid, in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which (e.g. as which) said stilbenoid accumulates. The second phase may be said stilbenoid or a free or encapsulated solvent compatible with the growth of the micro-organism, for instance an ester.

Description

FIELD OF THE INVENTION

[0001] This invention relates generally to a bioreactor process in which a stilbenoid (i.e a hydroxystilbene) is produced using a two phase cultivation medium.

BACKGROUND OF THE INVENTION

[0002] There have recently been proposed recombinant micro-organisms that have the capacity to produce certain stilbenoids of the general formula 1:

##STR00001##

wherein each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy. Examples of such compounds include resveratrol (only R³ being hydroxy) and pinosylvin (all of the R groups being hydrogen), see for instance WO2006/089898.

[0003] EP1181383 describes the in-situ extraction of a micro-organism fermentation product into an encapsulated organic solvent, the purpose being to prevent inhibition of production of the fermentation product caused by the product itself by sequestering it into the encapsulated solvent. This is therefore an approach to address the problem of a poor yield of the desired product.

[0004] U.S. Pat. No. 4,865,973 also tackles the problem of low metabolite yields due to product inhibition, this time by extraction of ethanol during cultivation of Saccaromyces cerevisiae yeast into a non-encapsulated solvent such as dodecylacetate.

[0005] US2004/0229326 again tackles the problem of product inhibition, this time in relation to aromatic compounds such as cinnamic acid, using a two phase extractive fermentation based on one or more of several defined solvents which include methyl decanoate.

[0006] Similarly, EP1715032 discloses a two phase fermentation using yeast to produce aroma compounds such as 2-phenylethanol with propylene glycol as extracting solvent to avoid product inhibition.

[0007] In fermentations to produce the stilbenoids with which the invention is concerned there is no problem relating to product inhibition however, as the existing strains of micro-organisms produce these compounds only in very small yields and it is not disclosed that they are secreted into the culture medium. Also, we have found that the solubility limit of the compounds is too low for product inhibition to become a problem.

[0008] Teachings such as WO2004/092344 describe biphasic reaction media for carrying out cell free enzymatic or other conversions, but this is of little relevance since there is no exposure of micro-organisms to the biphasic system.

SUMMARY OF THE INVENTION

[0009] Previously described micro-organisms have not been disclosed to release stilbenoids into the culture medium, as opposed to accumulating it within the micro-organism cells, although we have found that strains that we have described can do so. Also, a higher yield of stilbenoid compounds is desirable compared to that released into the culture medium by previously described micro-organisms. Strains of yeast and of other fungi or of bacteria which we have developed are such that the concentration of hydroxystilbene secreted into the medium by the micro-organisms is so high as to reach saturation, leading to precipitation of the product.

[0010] Accordingly, the invention provides in a first aspect a method for the production of a cis- or trans-stilbenoid of the general formula 1:

##STR00002##

in which each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is performed in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which (e.g. as which) said stilbenoid accumulates.

[0011] The second phase in which the stilbenoid accumulates may be composed of the stilbenoid itself. The stilbenoid may then be recovered at least in part simply by separating the accumulated solids from the fermentation, normally followed by further purification steps.

[0012] However, the stilbenoid may also deposit onto vessel walls, stirrer shafts, sensor, baffles and other apparatus constituents. If it is desired to prevent this, the second phase may be a solvent for the stilbenoid which is compatible with the fermentation requirements of the micro-organism. This will prevent accumulating solids disturbing fermentation process control and down-stream processing, desirably preventing precipitation without reduction of the hydroxystilbene yield.

[0013] Preferably, one of said first and second phases is dispersed within the other and preferably the first (aqueous) phase is continuous and the second phase is dispersed.

[0014] Said stilbenoid may be resveratrol (only R³═OH), pinosylvin (all R groups are hydrogen) or piceatannol (only R³ and either R² or R⁴ is OH). Preferably, not more than 3 of the R groups are hydroxy. Preferably, the stilbenoid is trans.

[0015] Said second phase is preferably a liquid. Optionally, said second phase is a micro-encapsulated liquid. Preferably, said liquid or micro-encapsulated liquid comprises or consists of an ester. Said ester is suitably of the general formula R⁶--COO--R⁷, and R⁶ is H or an aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms and R⁷ is an aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or a heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an aromatic or heteroaromatic moiety of from 5 to 16 carbon atoms. R⁷ may have from 3 to 9 carbon atoms. R⁶ may have from 1 to 4 carbon atoms. Alternatively, R⁶ may have from 6 to 12 carbon atoms and R⁷ may have from 1 to 6 carbon atoms. For instance, the solvent may be methyl decanoate, propyl decanoate or butyl decanoate or the corresponding undecanoate or dodecanoate esters.

[0016] Preferably, said ester is an octyl acetate, especially n-octyl acetate.

[0017] Optionally, said liquid comprises or further comprises an alkane. It may consist of a said alkane and a said ester.

[0018] Said alkane may be a C₆ to C₁₆ straight or branched chain alkane, e.g. a C_9-14 alkane, e.g. a C₁₂ alkane. Preferably, said alkane is n-dodecane.

[0019] Preferably, said micro-organism, when cultivated in said aqueous phase without said immiscible phase, is capable of producing said stilbenoid in an amount sufficient to reach a saturated concentration thereof in said aqueous phase and to precipitate therefrom.

[0020] Methods according to the invention may further comprise separating said second phase and extracting said stilbenoid therefrom.

[0021] In a second aspect, the invention provides a method for producing an extraction solvent tolerant micro-organism strain producing a metabolite comprising:

(a) cultivating a starting micro-organism in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which said metabolite accumulates, one of said first and second phases preferably being dispersed within the other, said second phase comprising a first solvent component to which the micro-organism is more tolerant and a first concentration of a second solvent component to which the micro-organism is less tolerant, (b) recovering progeny micro-organism from said cultivation (a), and (c) culturing said progeny micro-organism in a said multi-phase system in which the concentration of said second solvent component is increased above said first concentration.

[0022] In a further aspect, the invention provides A method for the production of a cis- or trans-stilbenoid of the general formla 1, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is conducted in a culture medium comprising or consisting of an aqueous phase and produces an amount of said stilbenoid (e.g. resveratrol) released from the micro-organisms into the culture medium which exceeds the solubility limit of said stilbenoid in said aqueous phase.

[0023] The method may be operated such that said stilbenoid precipitates from said culture medium. Alternatively, the cultivation is performed in a said culture medium which is a multi-phase system comprising at least said aqueous phase containing said micro-organism and a liquid solvent immiscible with said aqueous phase in which said stilbenoid accumulates.

[0024] Then it is optional whether said liquid solvent forms a liquid-liquid interface with said aqueous phase or is separated therefrom by encapsulation. Preferably, one of said aqueous phase and said liquid solvent is dispersed within the other and preferably the aqueous phase is continuous and said liquid solvent is dispersed therein.

[0025] All preferred features of the first aspect of the invention also apply in relation to the second aspect and this further aspect also.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0026] The micro-organisms used may be naturally occurring, or recombinant micro-organisms, or may be micro-organisms obtained by directed evolution from a starting naturally occurring or recombinant micro-organism. Repeated cultivation of micro-organism cells in a two phase system as described herein will generally produce evolved cells more suited to withstanding the conditions.

[0027] Micro-organisms that may be employed include fungi, including both filamentous fungi and yeasts, and bacteria. Yeasts are preferred, especially strains of S. cerevisiae.

[0028] The micro-organism may be one having an operative metabolic pathway comprising at least one enzyme activity, said pathway producing a said stilbenoid or an oligomeric or glycosidically-bound derivative thereof from a precursor aromatic acid of the general formula 2:

##STR00003##

wherein each R group is as defined above.

[0029] For instance, the micro-organism may be one producing resveratrol from coumaric acid, producing pinosylvin from cinnamic acid, and/or producing piceatannol from caffeic acid.

[0030] The transformation of the said aromatic acid to the compound of Formula 1 may be by the action of an exogenous stilbene synthase expressed in said micro-organism, usually in conjunction with a suitable aromatic acid-CoA ligase serving to form the CoA thioester of the aromatic acid which together with malonyl-CoA acts as a substrate for the stilbene synthase.

[0031] Stilbene synthases are rather promiscuous enzymes that can accept a variety of physiological and non-physiological substrates. For instance, addition of various phenylpropanoid CoA starter esters led to formation of several products in vitro in Ikuro Abe et al., 2004 and Morita et al., 2001. Likewise it has been shown that resveratrol synthase from rhubarb (Rheum tartaricum) indeed synthesized a small amount of pinosylvin when cinnamoyl-CoA was used as substrate instead of coumaroyl-CoA (Samappito et al., 2003).

[0032] Micro-organisms producing resveratrol for use in the invention may be as described in WO2006/089898. In particular, the micro-organism may be one having an operative metabolic pathway comprising at least one enzyme activity, said pathway producing resveratrol, or an oligomeric or glycosidically-bound derivative thereof, from 4-coumaric acid.

[0033] Micro-organisms producing pinosylvin for use in the invention may be as described in WO2008/009728 and therefore may be one that has an operative metabolic pathway comprising at least one enzyme activity, said pathway producing pinosylvin, or an oligomeric or glycosidically-bound derivative thereof, from cinnamic acid.

[0034] Malonyl-CoA for said stilbenoid forming reaction may be produced endogenously.

[0035] The stilbene synthase may be expressed in said said micro-organism from nucleic acid coding for said enzyme which is not native to the micro-organism and may be resveratrol synthase (EC 2.3.1.95) from a plant belonging to the genus of Arachis, a plant belonging to the genus of Rheum, or a plant belonging to the genus of Vitus or any one of the genera Artocarpus, Clintonia, Morus, Vaccinium, Pinus, Picea, Lilium, Eucalyptus, Parthenocissus, Cissus, Calochortus, Polygonum, Gnetum, Artocarpus, Nothofagus, Phoenix, Festuca, Carex, Veratrum, Bauhinia or Pterolobium or may be a pinosylvin synthase (EC 2.3.1.146) from a plant belonging to the genus of Pinus, e.g. P. sylvestris, P. strobes, P. densiflora, P. taeda, a plant belonging to the genus Picea, or any one of the genus Eucalyptus.

[0036] For the preferential production of pinosylvin, the stilbene synthase may be one which exhibits a higher turnover rate with cinnamoyl-CoA as a substrate than it does with 4-coumaroyl-CoA as a substrate, e.g. by a factor of at least 1.5 or at least 2. Thus, in further preferred embodiments, said stilbene synthase is a pinosylvin synthase, suitably from a tree species such as a species of Pinus, Eucalyptus, Picea or Maclura. In particular, the stilbene synthase may be a pinosylvin synthase (EC 2.3.1.146) from a plant belonging to the genus of Pinus, e.g. P. sylvestris, P. strobes, P. densiflora, P. taeda, a plant belonging to the genus of Picea, or any one of the genus Eucalyptus.

[0037] The aromatic acid precursor may be produced in the micro-organism or may be supplied externally thereto, production by the micro-organism generally being preferred. Such aromatic acid precursors are generally producible in the micro-organism from a suitable amino acid precursor by the action of an enzyme such as a phenylalanine ammonia lyase or tyrosine ammonia lyase. The genes for the production of these enzymes may be recombinantly expressed in the micro-organism.

[0038] Thus, in certain preferred embodiments, said L-phenylalanine ammonia lyase is a L-phenylalanine ammonia lyase (EC 4.3.1.5) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica, e.g. B. napes, B. rapa, a plant belonging to the genus of Citrus, e.g. C. reticulata, C. clementines, C. limon, a plant belonging to the genus of Phaseolus, e.g. P. coccineus, P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. banksiana, P. monticola, P. pinaster, P. sylvestris, P. taeda, a plant belonging to the genus of Populus, e.g. P. balsamifera, P. deltoides, P. Canadensis, P. kitakamiensis, P. tremuloides, a plant belonging to the genus of Solanum, e.g. S. tuberosum, a plant belonging to the genus of Prunus, e.g. P. avium, P. persica, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays or other plant genera e.g. Agastache, Ananas, Asparagus, Bromheadia, Bambusa, Beta, Betula, Cucumis, Camellia, Capsicum, Cassia, Catharanthus, Cicer, Citrullus, Coffea, Cucurbita, Cynodon, Daucus, Dendrobium, Dianthus, Digitalis, Dioscorea, Eucalyptus, Gallus, Ginkgo, Glycine, Hordeum, Helianthus, Ipomoea, Lactuca, Lithospermum, Lotus, Lycopersicon, Medicago, Malus, Manihot, Medicago, Mesembryanthemum, Nicotiana, Olea, Oryza, Pisum, Persea, Petroselinum, Phalaenopsis, Phyllostachys, Physcomitrella, Picea, Pyrus, Quercus, Raphanus, Rehmannia, Rubus, Sorghum, Sphenostylis, Stellaria, Stylosanthes, Triticum, Trifolium, Triticum, Vaccinium, Vigna, Zinnia. The micro-organism might be a fungus belonging to the genus Agaricus, e.g. A. bisporus, a fungus belonging to the genus Aspergillus, e.g. A. oryzae, A. nidulans, A. fumigatus, a fungus belonging to the genus Ustilago, e.g. U. maydis, a bacterium belonging to the genus Rhodobacter, e.g. R. capsulatus, a bacterium belonging to the genus Streptomyces, e.g. S. maritimus, a bacterium belonging to the genus Photorhabdus, e.g. P. luminescens, a yeast belonging to the genus Rhodotorula, e.g. R. rubra.

[0039] A suitable tyrosine ammonia lyase (EC 4.3.1.5) may be derived from yeast or bacteria. Suitably, the tyrosine ammonia lyase is from the yeast Rhodotorula rubra or from the bacterium Rhodobacter capsulatus.

[0040] Where the immediate product of the conversion of amino acid to aromatic acid is an aromatic acid that is not suitable as the immediate precursor of the desired stilbenoid, it may be converted to a more appropriate aromatic acid enzymatically by the micro-organism. For instance, cinammic acid may be converted to coumaric acid by a cinnamate-4-hydroxylase (C4H). Thus, said 4-coumaric acid may be produced from trans-cinnamic acid by a cinnamate 4-hydroxylase, which preferably is expressed in said micro-organism from nucleic acid coding for said enzyme which is not native to the micro-organism.

[0041] In certain preferred embodiments, said cinnamate-4-hydroxylase is a cinnamate-4-hydroxylase (EC 1.14.13.11) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Citrus, e.g. C. sinensis, C. x paradisi, a plant belonging to the genus of Phaseolus, e.g. P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. taeda, a plant belonging to the genus of Populus, e.g. P. deltoides, P. tremuloides, P. trichocarpa, a plant belonging to the genus of Solanum, e.g. S. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Ammi, Avicennia, Camellia, Camptotheca, Catharanthus, Glycine, Helianthus, Lotus, Mesembryanthemum, Physcomitrella, Ruta, Saccharum, Vigna. The micro-organism might be a fungus belonging to the genus Aspergillus, e.g. A. oryzae.

[0042] The conversion of the aromatic acid precursor into its CoA derivative may be performed by a suitable endogenous or recombinantly expressed enzyme. Both cinnamoyl-CoA and coumaroyl-CoA may be formed in a reaction catalysed by an enzyme in which ATP and CoA are substrates and ADP is a product by a 4-coumarate-CoA ligase (also referred to as 4-coumaroyl-CoA ligase). Known 4-coumarate-CoA ligase enzymes accept either 4-coumaric acid or cinnamic acid as substrates and produce the corresponding CoA derivatives. Generally, such enzymes are known as `4-coumarate-CoA ligase` whether they show higher activity with 4-coumaric acid as substrate or with cinnamic acid as substrate. However, we refer here to enzymes having that substrate preference as `cinnamate-CoA ligase` enzymes (or cinnamoyl-CoA-ligase). One such enzyme is described for instance in Aneko et al., 2003.

[0043] Said 4-coumarate-CoA ligase or cinnamate-CoA ligase may be a 4-coumarate-CoA ligase/cinnamate-CoA ligase (EC 6.2.1.12) from a plant, a micro-organism or a nematode. The plant may belong to the genus of Abies, e.g. A. beshanzuensis, B. firma, B. holophylla, a plant belonging to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica, e.g. B. napes, B. rapa, B. oleracea, a plant belonging to the genus of Citrus, e.g. C. sinensis, a plant belonging to the genus of Larix, e.g. L. decidua, L. gmelinii, L. griffithiana, L. himalaica, L. kaempferi, L. laricina, L. mastersiana, L. occidentalis, L. potaninii, L. sibirica, L. speciosa, a plant belonging to the genus of Phaseolus, e.g. P. acutifolius, P. coccineus, a plant belonging to the genus of Pinus, e.g. P. armandii P. banksiana, P. pinaster, a plant belonging to the genus of Populus, e.g. P. balsamifera, P. tomentosa, P. tremuloides, a plant belonging to the genus of Solanum, e.g. S. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Agastache, Amorpha, Cathaya, Cedrus, Crocus, Festuca, Glycine, Juglans, Keteleeria, Lithospermum, Lolium, Lotus, Lycopersicon, Malus, Medicago, Mesembryanthemum, Nicotiana, Nothotsuga, Oryza, Pelargonium, Petroselinum, Physcomitrella, Picea, Prunus, Pseudolarix, Pseudotsuga, Rosa, Rubus, Ryza, Saccharum, Suaeda, Thellungiella, Triticum, Tsuga. The micro-organism might be a filamentous fungi belonging to the genus Aspergillus, e.g. A. flavus, A. nidulans, A. oryzae, A. fumigatus, a filamentous fungus belonging to the genus Neurospora, e.g. N. crassa, a fungus belonging to the genus Yarrowia, e.g. Y. lipolytica, a fungus belonging to the genus of Mycosphaerella, e.g. M. graminicola, a bacterium belonging to the genus of Mycobacterium, e.g. M. bovis, M. leprae, M. tuberculosis, a bacterium belonging to the genus of Neisseria, e.g. N. meningitidis, a bacterium belonging to the genus of Streptomyces, e.g. S. coelicolor, a bacterium belonging to the genus of Rhodobacter, e.g. R. capsulatus, a nematode belonging to the genus Ancylostoma, e.g. A. ceylanicum, a nematode belonging to the genus Caenorhabditis, e.g. C. elegans, a nematode belonging to the genus Haemonchus, e.g. H. contortus, a nematode belonging to the genus Lumbricus, e.g. L. rubellas, a nematode belonging to the genus Meilodogyne, e.g. M. hapla, a nematode belonging to the genus Strongyloidus, e.g. S. rattii, S. stercoralis, a nematode belonging to the genus Pristionchus, e.g. P. pacificus.

[0044] Optionally, one may express, over express, or recombinantly express in said organism an NADPH:cytochrome P450 reductase (CPR). This may be a plant CPR. Alternatively, a native NADPH:cytochrome P450 reductase (CPR) may be overexpressed in said micro-organism. Optionally, said NADPH:cytochrome P450 reductase is a NADPH:cytochrome P450 reductase (EC 1.6.2.4) from a plant belonging to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Citrus, e.g. C. sinensis, C. x paradisi, a plant belonging to the genus of Phaseolus, e.g. P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. taeda, a plant belonging to the genus of Populus, e.g. P. deltoides, P. tremuloides, P. trichocarpa, a plant belonging to the genus of Solanum, e.g. S. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Ammi, Avicennia, Camellia, Camptotheca, Catharanthus, Glycine, Helianthus, Lotus, Mesembryanthemum, Physcomitrella, Ruta, Saccharum, Vigna.

[0045] Because, as described above, for the production of pinosylvin, production of cinnamic acid by a PAL enzyme and also its conversion on to pinosylvin is preferred to either the production of coumaric acid from tyrosine by a substrate promiscuous PAL or by conversion of cinnamic acid by a C4H enzyme, micro-organisms for use in the invention to produce pinosylvin preferably have a PAL which favours phenylalanine as a substrate (thus producing cinnamic acid) over tyrosine (from which it would produce coumaric acid). Preferably, therefore, the ratio K_m(phenylalanine)/K_m(tyrosine) for the PAL is less than 1:1, preferably less 1:5, e.g. less than 1:10. As usual, K_m is the molar concentration of the substrate (phenylalanine or tyrosine respectively) that produces half the maximal rate of product formation (V_max).

[0046] Except where micro-encapsulation is used, in choosing a solvent to act as the water immiscible phase in the cultivation, there generally will be some tension between opposing requirements for a solvent that does not hamper the growth of the micro-organism and one that successfully extracts the hydroxystilbene product. Generally, the less miscible with water is the solvent, the less it will interfere with the micro-organism growth, but the less effective it will be in extracting the hydroxystilbene.

[0047] The rate at which the system is agitated will also have an effect, greater agitation tending to increase the interference of the solvent with the growth of the micro-organism. The toxicity of the water immiscible material for the micro-organism may therefore be regarded as being divided into a direct toxic effect due to the concentration of the immiscible solvent in the aqueous medium and a phase toxicity due to the physical presence of the immiscible phase which can exert effects by nutrient extraction, limited access to nutrients due to emulsion formation, cell coating, attraction to the interface and, the most detrimental effect, disruption of cell membranes.

[0048] The rate of agitation employed should therefore be balanced against the nature of the immiscible solvent material.

[0049] However, optionally, the solvent is physically separated from the aqueous phase by micro-encapsulation, as described in Stark et al, 2003 and EP1181383 using for instance solvent filled alginate micro-spheres of for instance 1-4 mm diameter. The encapsulating material is chosen to be permeable to the stilbenoid. This can prevent phase toxicity, although the aqueous phase may remain saturated with the solvent. This allows a more free choice of solvent on the basis of its extractive power for the stilbenoid having regard to the stilbenoid solubility therein and its partition coefficient for the stilbenoid.

[0050] The solvent is preferably one in which the micro-organism of interest, if necessary after adaptation as described in Example 12, is able to grow in an aqueous phase culture medium in liquid-liquid interface contact with the said solvent at a growth rate of at least 50% of the growth rate obtainable in the aqueous phase culture medium without the solvent being present. Such a solvent may be referred to as a biocompatible solvent.

[0051] Preferred solvents have a partition coefficient logP between water and octanol of not more than 4.4, preferably not more than 4.0. Such solvents are generally suitable for all of the stilbenoids. However, for the most hydrophobic stilbenoids, especially pinosylvin, a logP value of up to 7.5 may be used, e.g. up to 6.5.

[0052] Having regard particularly for their extraction affinity for more polar hydroxy stilbenes, preferred solvents are esters, especially esters of the general formula R⁶--COO--R⁷, where R⁶ is H or an optionally substituted aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms, or an optionally substituted aromatic or heteroaromatic moiety of from 5 to 6 carbon atoms, and R⁷ is an optionally substituted aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or an optionally substituted heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an optionally substituted aromatic or heteroaromatic moiety of from 5 to 16 carbon atoms. Suitably, R⁹ has from 3 to 9 carbon atoms. Suitably the ester is formed between a short chain acid and a long chain alcohol, e.g. where R⁶ has from 1 to 4 carbon atoms and R⁷ has from 6 to 12 carbon atoms.

[0053] Said ester is preferably an octyl acetate, e.g. n-octyl acetate (logP=3.7). Alternatives include hexyl, heptyl, nonyl (logP=4.2) and decyl acetates, and the corresponding formates and propionates.

[0054] Alternatively, esters formed between long chain acids and short chain alcohols may be used, e.g. where R⁶ may have from 6 to 12 carbon atoms and R⁹ may have from 1 to 6 carbon atoms. For instance, the solvent may be methyl decanoate (logP=4.3), propyl decanoate or butyl decanoate or the corresponding undecanoate or dodecanoate esters.

[0055] Also, long chain ketones such as a C₈ to C₁₂ ketones, e.g. undecanone may be used. These may be of the formula R⁸COR⁹ where R⁸ and R⁹ independently may be an optionally substituted aliphatic straight or branched chain hydrocarbon moiety, e.g. where R⁸ is C_1-5, more preferably C_1-3, and R⁹ is C₇-12.

[0056] Other suitable solvents may be as described in U.S. Pat. No. 4,865,973. Except where these overlap with those described above however they are in general less preferred. They include double bond unsaturated aliphatic alcohols having 12 or more carbon atoms, saturated branched chain aliphatic alcohols having 14 or more carbon atoms or mixtures thereof (e.g. guerbet alcohols), double bond unsaturated aliphatic acids having 12 or more carbon atoms, aliphatic and aromatic mono- di- or tri-esters having 12 or more carbon atoms, aliphatic noncyclic ketones and aliphatic aldehydes having 12 or more carbon atoms.

[0057] Examples include:

oleyl alcohol, (cis-9-octadecen-1-ol), phytol (3,7,11,15-tetramethyl-2-hexadecen-1-ol), isophytol (3,7,11,15-tetramethyl-1-hexadecen-3-ol), isostearyl alcohol e.g. the commercial product sold under the trademark ADOL 66, isocetyl alcohol e.g. the commercial product sold under the trademark Eutanol G-16, octyl dodecanol e.g. the commercial product sold under the trademark Eutanol G, oleic acid (cis-9-octadecenoic acid), linoleic acid, (9,11-octadecadienoic acid), ricinoleic acid, (12-hydroxy-9-octadecenoic acid), dodecyl acetate (CH₃COO(CH₂)₁₁), butyl dodecanoate, (CH₃(CH₂)₁₀COOC₄H₉), dibutyl sebacate (C₄H₉OOC(CH₂)₈H₁₇COOC₄H₉, di (2-ethylhexyl)sebacate, (C₈H₁₇OOC(CH₂)₈COOC₈H₁₇), dibutyl adipate (C₄H₉OOC(CH₂)₄COOC₄H₉), di(2-ethylhexyl)adipate, (C₈H₁₇OOC(CH₂)₄COOC₈H₁₇), di(2-ethylhexyl)phthalate, (C₈H₁₇OOCC₆H₄COOC₈H₁₇), di(3,5,5-trimethyhexyl), phthalate (C₈H₁₇OOCC₆H₄COOC₈H₁₇), glyceroltrideca-([CH₃(CH₂)₈COOCH₂]₂CHOCO(CH₂)₈CH₃)noate, 2-dodecanone (CH₃CO(CH₂)₉CH₃), dodecanal (CH₃(CH₂)10CHO), the commercial product sold under the trademark ADOL 85 NF (69 percent oleyl alcohol), the commercial product sold under the trademark ADOL 330 (62 percent oleyl alcohol), and the commercial product sold under the trademark HD oleyl alcohol (commercial oleyl alcohol).

[0058] Generally, all the solvents described above may be used in any admixture with one or more others.

[0059] For the production of pinosylvin, which is the least polar of the hydroxystilbenes of formula 1, an alkane may be used. This may be a C₆ to C₁₆ (e.g. C₉ to C₁₄) straight or branched chain alkane such as a nonane, decane, undecane, dodecane or higher, e.g. n-dodecane. However, used by itself, n-dodecane does not have sufficient polarity to be a good extractant for resveratrol and more hydroxylated compounds.

[0060] On the other hand, the esters are less well tolerated by certain micro-organisms as regards toxicity and in some cases can steer hydroxystilbene production towards resveratrol and away from pinosylvin.

[0061] For the mixed production of resveratrol and pinosylvin for instance, it is therefore preferred to use a mixture of a said ester and a said alkane, e.g. octyl acetate and n-dodecane.

[0062] Micro-organisms that do not fully tolerate a particular solvent such as octyl acetate may be evolved to do so by methods described briefly above.

[0063] In the present context the term "micro-organism" relates to microscopic organisms, including bacteria, microscopic fungi, including yeast. More specifically, the micro-organism may be a fungus, and more specifically a filamentous fungus belonging to the genus of Aspergillus, e.g. A. niger, A. awamori, A. oryzae, A. nidulans, a yeast belonging to the genus of Saccharomyces, e.g. S. cerevisiae, S. kluyveri, S. bayanus, S. exiguus, S. sevazzi, S. uvarum, a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var. marxianus, K. thermotolerans, a yeast belonging to the genus Candida, e.g. C. utilis C. tropicalis, C. albicans, C. lipolytica, C. versatilis, a yeast belonging to the genus Pichia, e.g. P. stipidis, P. pastoris, P. sorbitophila, or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Pichia, Yarrowia, Zygosaccharomyces or Schizosaccharomyces. Concerning other micro-organisms a non-exhaustive list of suitable filamentous fungi is: a species belonging to the genus Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, and Trichoderma.

[0064] Concerning bacteria a non-exhaustive list of suitable bacteria is follows: a species belonging to the genus Bacillus, a species belonging to the genus Escherichia, a species belonging to the genus Lactobacillus, a species belonging to the genus Lactococcus, a species belonging to the genus Corynebacterium, a species belonging to the genus Acetobacter, a species belonging to the genus Acinetobacter, a species belonging to the genus Pseudomonas, etc.

[0065] The preferred micro-organisms of the invention may be S. cerevisiae, A. niger, A. nidulans, A. oryzae, E. coli, L. lactis or B. subtilis.

[0066] The constructed and engineered micro-organism can be cultivated using commonly known processes, including chemostat, batch, fed-batch cultivations, etc.

[0067] Stilbenoids produced as described herein may optionally be isolated or purified and suitable methods include solvent extraction with n-hexane, followed by sequential extraction with 100% ether, acetone, methanol and water, and chromatographic purification on a silicagel column using a n-hexane/ethyl acetate (2/1) system.

[0068] The micro-organism may be fed with a carbon substrate which is optionally selected from the group of fermentable carbon substrates consisting of monosaccharides, oligosaccharides and polysaccharides, e.g. glucose, fructose, galactose, xylose, arabinose, mannose, sucrose, lactose, erythrose, threose, and/or ribose. Said carbon substrate may additionally or alternatively be selected from the group of non-fermentable carbon substrates including ethanol, acetate, glycerol, and/or lactate. Said non-fermentable carbon substrate may additionally or alternatively be selected from the group of amino acids and may be phenylalanine and/or tyrosine.

BRIEF DESCRIPTION OF THE DRAWINGS

[0069] To assist in the ready understanding of the above decription of the invention reference has been made to the accompanying drawings in which are shown:

[0070] FIG. 1A: Fermentation profile for PALCPR-control (see Example 3): CO₂-evolution (CO2 Vol %), O₂ consumption (O₂ Vol %) and dissolved oxygen (PO₂% Sat) are shown.

[0071] FIG. 1B: Fermentation profile for PALCPR-solvent (see Example 3): CO₂-evolution (CO2 Vol %), O₂ consumption (O₂ Vol %) and dissolved oxygen (PO₂% Sat) are shown.

[0072] FIG. 2: Fermentation profile for PALCPR-evolved-I (Example 4): CO₂-evolution (CO2 Vol %), O₂ consumption (O₂ Vol %) and dissolved oxygen (PO₂% Sat) are shown.

[0073] FIG. 3: Fermentation profile for PALCPR-evolved-II (Example 5): CO₂-evolution (CO2 Vol %), O₂ consumption (O₂ Vol %) and dissolved oxygen (PO₂% Sat) are shown.

[0074] FIG. 4: Fermentation profile for PALCPR-evolved-III (Example 6): CO₂-evolution (CO2 Vol %), O₂ consumption (O₂ Vol %) and dissolved oxygen (PO₂% Sat) are shown.

[0075] FIG. 5: Principle of two-phase fermentation. A: extraction of stilbenoids into solvent phase with low stirring and hence physical separate phases; B: extraction of stilbenoids into solvent phase with high stirring stirring and hence with mixed phases.

[0076] FIG. 6: Structure of the fused divergent TEF1-TDH3 promoters referred to in Example 9.

[0077] FIG. 7: Structure of a plasmid vector pESC-HIS-4CL-VST1 containing galactose inducible promotors Gal1/Gal10 referred to in Example 9 (VII).

[0078] FIG. 8: Structure of a plasmid vector pESC-HIS-TDH3-4CL-TEF-VST1 referred to in Example 9(VII).

[0079] FIG. 9: History plot of parameters of cultivation measured in Example 10.

[0080] FIG. 10: History plot of parameters of cultivation measured in Example 11.

EXAMPLES

Example 1

Expression of the PAL-Pathway to Resveratrol in S. Cerevisiae Strain Overexpressing Native S. Cerevisiae NADP-Cytochrome P450 Reductase (CPR)

[0081] A yeast strain FSSC-PAL2C4H4CL2VST1-pADH1CPR1 was used. This is a strain of S. cerevisiae having introduced therein genes expressing PAL2 from A. thaliana, C4H from A. thaliana, 4CL2 from A. thaliana, and VST1 from Vitis vinifera with overexpressed CPR from A. thaliana (see WO2006/089898 and WO2008/009728 for details). In summary construction of the strain is described further below and is divided in parts A, B, C, D and E.

A: Construction of a strain overexpressing native S. cerevisiae NADP-cytochrome P450 reductase (CPR).

[0082] The native promoter of S. cerevisae NADP-cytochrome P450 reductase CPR1 gene (encoded by YHR042W) was replaced with the constitutive S. cerevisiae alcohol dehydrogenase ADH1 promoter via chromosomal promoter exchange using the "bi-partite" PCR-based allele replacement method. Primers A and B were used to generate fragment CPR1-UP (Table 1) via PCR at a melting temperature of 56° C. using S. cereveisiae genomic DNA as template. Primers C and D were then used to generate fragment CPR1-S via PCR at a melting temperature of 56° C. using S. cerevisiae genomic DNA as template. Fragments AD1 (klURA 3' end fused to promoter ADH1) and AD2 (promoter ADH1 fused to KlURA 5' end) were generated via PCR using primers AD-fw and Int3' and Int5' and AD-rv at a melting temperature of 56° C. and 56° C., respectively. Plasmid pWAD1 was used as template for generation of fragment AD1 and plasmid pWAD2 was used for generating fragment AD2.

[0083] Fragments CPR_UP were then fused to fragment AD2 using fusion PCR with primers A and Int3' at a melting temperature of 56° C. resulting in fusion fragment 1 (bi-partite substrate 1). A second fusion PCR was used to fuse fragments AD1 and CPR-S with Int5' and primer D at a melting temperature of 56° C. resulting in fusion fragment 2 (bi-partite substrate 2).

[0084] Fusion fragments 1 and 2 (bi-partite substrates 1 and 2) were purified on agarose gel and used for co-transformation of S. cerevisiae strain FS01528 (Mata, ura3 h is 3) and the transformants were plated on SC-URA plates and incubated for 2-4 days at 30° C. Transformants were streak purified on SC-ura plates and incubated another 2 days at 30° C. and then plated onto 5-FOA (5-fluoroorotic acid) plates. After incubation for 2 days at 30° C. "pop-out" colonies appeared, which were streak purified on a new 5-FOA-plate and incubated another 2 days at 30° C. and then finally transferred to a rich medium plate YPD. The resulting colonies were analyzed for the presence of fragment of size 1700-1800 base pairs using yeast colony PCR with primers A and AD-rev and a melting temperature at 55° C. and an elongation time of 1 minute and 45 seconds. One of the positive colonies from the colony PCR containing the new replaced ADH1 promoter in front of the CPR1 gene was named FSpADH1-CPR (Mata ura3 his3 pADH1-CPR1) strain.

TABLE-US-00001 TABLE 1 Primers and fragments used in the "bi-partite" PCR- based allele replacement method to exchange native S. cerevisie CPR1 promoter with S. cerevisiae ADH1 promoter Primers A 5'-GTATTCTATATCCACGCCTGCAAAC 3' .sup.*1 B 5'-AGTACATACAGGGAACGTCCCTACAGGAACGCAAACTTAAGCTAC 3' .sup.*2 C 5'-GCATACAATCAACTATCTCATATACAATGCCGTTTGGAATAGACAACACC 3' .sup.*3 D 5'-GCTTCCGCATTACAAATAAAGTCTTCAA 3' .sup.*4 AD-fw 5'-GGACGTTCCCTGTATGTACTAGGGGGATCGAAGAAATGATGG 3' .sup.*5 Int3' 5'-GAGCAATGAACCCAATAACGAAATC 3' .sup.*6 Int5' 5'-CTTGACGTTCGTTCGACTGATGAGC 3' .sup.*7 AD-rv 5'-TGTATATGAGATAGTTGATTGTATGC 3' .sup.*8 Fragments CPR-UP generated from primers A and B (CPR1 gene fragment upstream of start codon (ATG)) CPR-S generated from primers C and D (CPR1 gene fragment containing start codon (ATG)) AD1 (ADH1 promoter coupled to two thirds of K.lactis URA3 towards the 5' end generated from primers AD-fw and Int3') AD2(Two thirds of K.lactis URA3 towards the 3' end coupled to the ADH1 promoter. Generated from primers Int5' and AD- rv) Fusion fragment 1 (CPR-UP fragment fused to AD2 fragment) Fusion fragment 2 (AD1 fragment fused to CPR-S fragment) .sup.*1 SEQ ID NO: 1 .sup.*2 SEQ ID NO: 2 .sup.*3 SEQ ID NO: 3 .sup.*4 SEQ ID NO: 4 .sup.*5 SEQ ID NO: 5 .sup.*6 SEQ ID NO: 6 .sup.*7 SEQ ID NO: 7 .sup.*8 SEQ ID NO: 8

B: Isolation of genes encoding PAL, C4H, 4CL, and VST1

[0085] Phenylalanine ammonia lyase (PAL2), cinnamate 4-hydroxylase (C4H), 4-coumarate:CoenzymeA ligase (4CL1) were isolated as described previously (WO2006/089898) via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany).

[0086] 4-coumarate:CoenzymeA ligase (4CL2) (see WO2006/089898 and PCT/EP2007/057484 for details) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the forward primer 5'-GCGAATTCTTATGACGACACAAGATGTGATAGTCAATGAT-3' SEQ ID NO: 9 containing an EcoR1 restriction site and reverse primer 5'-GCACTAGTATCCTAGTTCATTAATCCATTTGCTAGT-CTTGCT-3' SEQ ID NO:10 containing a Spe1 restriction site.

[0087] The VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al, 1993) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence (see WO2006/089898 and WO2008/009728 for details) was used as template to generate a synthetic gene optimized for expression in S. cerevisiae. The synthetic VST1 gene was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xho1 restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

C: Construction of a Yeast Vector for Expression of PAL and C4H

[0088] Plasmid, pESC-URA-PAL-C4H, containing the genes encoding PAL and C4H under the control of the divergent GAL1/GAL10 promoter was constructed as described in Example 3 of WO2006/089898.

D: Construction of a Yeast Vector for Expression of 4CL

[0089] The gene encoding 4CL1 and 4CL2 were isolated as described in previously. The amplified 4CL1 PCR-product was digested with Xba1/BamH1 and ligated into Spe1/BglII digested pESC-TRP vector (Stratagene), resulting in vector pESC-TRP-4CL. The amplified 4CL2 PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2. Two different clones of pESC-TRP-4CL1 and pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

E: Construction of Yeast Vectors for Expression of 4CL and VST

[0090] The gene encoding VST from Vitis vinifera (grape) was isolated as described previously. The purified BamH1/Xho1 digested VST gene fragment was ligated into BamH1/Xho1 digested pESC-HIS-4CL2 plasmid or pESC-trp-4CL1 plasmid (example 15). The resulting plasmids, pESC-HIS-4CL2-VST and pESC-TRP-4CL1-VST contained the genes encoding 4CL1, 4CL2 and VST under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST was verified by sequencing of two different clones of pESC-HIS-4CL2-VST and pESC-TRP-4CL1-VST.

[0091] FSpADH1-CPR (Mata ura3 his3 pADH1-CPR1) as described previously was co-transformed with the vectors pESC-URA-PAL-C4H and pESC-HIS-4CL2-VST, resulting in the strain FSSC-PALC4H₄CL2VST-pADH1CPR1 (Mata ura3 his3 pADH1-CPR1, pESC-URA-PAL-C4H, pESC-HIS-4CL2-VST).

Example 2

Adaptation of Strain PALCPR to the Presence of Solvents

[0092] Yeast strain FSSC-PAL2C₄H₄CL2VST1-pADH1CPR1 as described in the previous example was subjected to a train of batch fermentations in a fermentor from Applikon containing defined medium according to Verduyn et al. (1992), containing: 10.0 g/L (NH₄)₂SO₄; 3.0 g/L KH₂PO₄; 0.5 g/L MgSO₄.7H₂O; trace metals and vitamins with the aim of adapting it to the presence of solvents. The working volume was 1 L and the gas flowrate was set at 1.5 l/m, temperature was uncontrolled and pH was set at 5.5. The first fermentation contained 10 g/l glucose and 50 g/l galactose, and stirring rate was kept low to prevent mixing of the medium- and solvent phase, as illustrated in FIG. 5A in which is seen a fermentor vessel 10 containing the two separated phases 12 (aqueous) and 14 (solvent) agitated by a stirrer 16 at below 200 rpm. After consumption of the glucose and at the onset of galactose consumption, a mixture of 10 ml octylacetate and 40 ml dodecane was added. Consumption of galactose continued and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain using similar fermentation conditions as to the previous one, but now with addition of a mixture of 50 ml octylacetate and 100 ml dodecane. Indeed the cells were able to grow in the presence of said solvent mixture, and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain, using similar conditions as to the previous one, but now the stirring rate was increased to 1000 rpm halfway through the consumption of galactose, causing mixing of the solvent phase with the medium phase as illustrated in FIG. 5B. Indeed the cells remained able to grow when the phases were mixed and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain using similar conditions as to the previous one, but now with addition of a mixture of 100 ml octylacetate and 100 ml dodecane. The increase of the octylacetate to 100 ml caused the arrest of cell growth, indicated by a halt in galactose consumption, and therefore the amount of dodecane was increased to 200 ml, in order to further obscure the toxic effect of octylacetate. Indeed the cells were now able to grow in the presence of said solvent mixture at high stirring rate. The strain was harvested and stored in 15% glycerol at -80° C.

Example 3

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of Strain PALCPR

[0093] The last harvested strain as described in previous example was grown in two independent batch cultures with a working volume of 1 liter, containing defined medium according to Verduyn et al. (1992), containing: 10.0 g/L (NH₄)₂SO₄; 3.0 g/L KH₂PO₄; 0.5 g/L MgSO₄.7H₂O; trace metals and vitamins and 10 g/l glucose and 100 g/l galactose as the carbon sources. Antifoam (300 μl/L, Sigma A-8436) was added to avoid foaming. The carbon source was autoclaved separately from the mineral medium and afterwards added to the fermentor. In addition, the vitamin and trace metal solutions were added to the fermentor by sterile filtration following autoclaving and cooling of the medium. The fermentor system was from Sartorius BBI systems and consisted of a baffled 3-liter reactor vessel with 1 liter working volume equipped with Biostat B Plus controller. The reactor vessel was equipped with one lower-fitted Rushton turbine which was rotating eventually at 1000 rpm, the temperature was kept at 30±1° C., and the pH was kept at 5.5±0.2 by automatic addition of 2M KOH. The gasflow was controlled by a mass flow controller and was set to 1.5 vvm (1.5 l/min). The off-gas was led through a cooled condenser, and was analyzed for O₂ and CO₂ (Model 1308, Innova, Denmark). The initial batch cultures were started by inoculation of the medium with a pre-grown strain that was harvested in the exponential phase and stored at -80° C. in 15% glycerol. The cells were allowed to fully consume the glucose at a stirring speed of 1000 rpm, and the average dissolved oxygen content was kept above 70% of saturated air. After approximately 20 hrs, at the onset of galactose consumption, the stirring rate was turned down to 300 rpm, and to one culture a mixture of 200 ml dodecane and 100 ml of octylacetate was slowly added. This cultivation will further be referred to as PALCPR-solvent, whereas the cultivation without addition of solvent will be referred to as PALCPR-control.

[0094] Upon addition of the solvent mixture to the PALCPR-solvent culture the CO₂ production halted temporarily, but recovered again after 5 minutes. Moreover, the CO₂-production in the PALCPR-control culture also ceased temporarily and recovered soon, indicating that this was more the result of the hampered oxygen transfer imposed by the lowered stirrer speed. The stirrer speed was increased in steps of 100 rpm to 1000 rpm over a period of 5 hours. In order to enable comparison of production of stilbenoids in both cultures, the PALCPR-control culture was subjected to the same conditioning regime. In both cultures the cells kept growing exponentially with concomitant production of CO₂.

[0095] The cells in the PALCPR-control culture consumed the galactose in 17 hours, whereas the galactose in the PALCPR-solvent culture was depleted after a little less than 25 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.23 1/h for the cells in the PALCPR-control culture, and 0.13 1/h for the cells in the PALCPR-solvent culture (FIGS. 1A and 1B). The final biomass content was 27.5 g/l in the PALCPR-control culture and 19.6 g/l in the PALCPR-solvent culture.

[0096] For the determination of stilbenoids, samples were taken at the point of galactose depletion. For the PALCPR-solvent culture, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC as follows:

[0097] For quantitative analysis of cinnamic acid, coumaric acid, resveratrol and pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) prior to uv-diode-array detection at λ=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 3 micrometer C18 (100×2.00 mm) column was used at 60° C. As mobile phase a gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.4 ml/min. The gradient profile was linear from 15% acetonitrile to 100% acetonitrile over 20 min. The elution time was approximately and 5.0-5.2 minutes for resveratrol and 8.8-8.9 minutes for trans-pinosylvin.

[0098] The total concentration of stilbenoid intermediates that was produced was then calculated by multiplying the concentrations in the upper phase with a factor of 0.3 and then adding them to the concentrations that were observed in the lower phase. For the PALCPR-control culture, two aliquots of 10 ml of cell broth were collected, and one aliquot was vigorously mixed with 10 ml of 100% of ethanol. The solubility of stilbenoids in ethanol is far higher than in water and thus ensures the determination of levels of stilbenoids that would normally exceed the aquous solubility. Furthermore, stilbenoids that possibly would be bound to the cell-membranes would be recovered as well. Thus this ethanol-washed aliquot would represent the total amount of stilbenoids produced in PALCPR-control and can be compared to the total amount of stilbenoids produced in the PALCPR-solvent culture. Indeed, a similar ethanol wash performed on the solvent phase did not result in an increase in the titers of stilbenoid- and stilbenoid intermediates, indicating that the solvent phase truly captured all the polar intermediates present in the medium broth or attached to cell membranes. Both aliquots were directly subjected to centrifugation at 3500 g, and the supernatant was analyzed for their content of stilbenoids and their intermediates.

The results are shown in the following table:

TABLE-US-00002 Coumaric acid Resveratrol Cinnamic acid Pinosylvin (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) PALCPR-solvent Upper phase (0.3 L) -- 24.23; 36.2 20.72; 56.9 55.84; 95.2 Lower phase (1 L) -- 12.79; 63.8 4.72; 43.1 0.85; 4.8 Total produced in 1 L -- 20.09; 100 10.93; 100 17.6; 100 PALCPR-control Supernatant, ethanol -- 20.01 9.70 22.63 Supernatant, no ethanol -- 11.43 3.59 1.74

[0099] The results demonstrated that the PALCPR strain was able to grow in the presence of a solvent mixture containing 200 ml dodecane, and 100 ml octylacetate, growth rate and biomass yield were Blighty impaired compared to the control fermentation without solvents, however, production of stilbenoids and intermediates was not substantially affected and total titers were similar to the control culture. The solvent mixture was able to capture 95% of the stilbenoid pinosylvin and 36% of the more polar stilbenoid resveratrol. Obviously, the non-polar dodecane fraction in the solvent mixture sufficiently obscured the toxic effects on cells of the more polar and hence more toxic octylaceate fraction. The polarity of the mixture was indeed sufficiently high to capture almost all of the stilbenoid pinosylvin, but did not fully capture the more polar stilbenoid resveratrol.

[0100] The PALCPR control culture produced a persitent brown precipitate that settled on the inner vessel wall and baffles, and moreover fouled vital fermentor parts such as the stirrer shaft, gas-outlet, pH- and dO probe that would endanger a proper control of the fermentation process parts sstirrer shaf precipitates on said fermentor components. The PALCPR-solvent culture, however, did not show fouling of said fermentor components. Instead, a creamy/gelly substance was formed that remained in the fermentation broth, but manifested as an interface between the medium and the solvent phase after centrifugation. This "third" phase did not contain substantial amounts of stilbenoids or intermediates and could be discarded relatively easily.

Example 4

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of an Evolved Strain of PALCPR

[0101] The solvent mixture described in the previous example was not capable to capture all resveratrol produced, therefore a fermentation was initiated to adapt the cells to grow in the presence of a solvent mixture that contained solely the more polar and thus more toxic solvent octylacetate. The cells of the PALCPR-solvent culture described in the previous example were taken as starting point because the presence of the solvent mixture would possibly have already evoked adaptation of cells to solvents. For that, cells of the culture described in the previous example were harvested during mid-exponential-phase and stored at -80° C. in 15% glycerol and subsequently a fermentor, containing the same medium as described in the previous example with 10 g/l glucose and 100 g/l galactose, was then inoculated with cells of said PALCPR-solvent culture. The cells were allowed to fully consume the glucose at a stirring speed of 1000 rpm with an average dissolved oxygen content of above 70% of saturated air. At the onset of galactose consumption, the stirring rate was turned down to 300 rpm, after which slowly 100 ml of octylacetate was added.

[0102] Upon addition of octylacetate consumption of galactose was immediately arrested, the dissolved oxygen content increased to almost 99% of saturated air, O₂-- consumption and CO₂ production halted, all indicating that proliferation of cells arrested. However after approximately 170 hours, the CO₂ signal slowly increased, Dissolved oxygen slowly decreased, indicating that cells started to grow. Galactose consumption indeed commenced again. A small arrest in CO₂ production again occurred after 20 hours which, however, recovered after 5 hours, after which the cells grew exponentially with concomitant production of CO₂, consumption of galactose within less than 40 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.062 1/h (FIG. 2). The final biomass concentration was 21.6 g/l.

[0103] For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00003 Evolved PALCPR in Coumaric acid Resveratrol Cinnamic acid Pinosylvin 2-phase fermentation (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) Upper phase (0.1 L) 233.4; 18.0 163.0; 92.6 408.0; 52.5 32.0; 100 Lower phase (1 L) 106.3; 82.0 1.3; 7.4 36.9; 47.5 0; 0 Total produced in 1 L 129.64; 100 17.6; 100 77.7; 100 3.2; 100

[0104] The results demonstrated clearly that strain PALCPR was able to adapt after 170 hours to the presence of 100 ml octylacetate. Though the growth rate was indeed lower than the PALCPR-control- and PALCPR-solvent culture in the previous example, the final biomass concentration was similar to said cultures.

[0105] The solvent mixture was now able to capture 100% of the stilbenoid pinosylvin and 92% of the more polar stilbenoid resveratrol. That result demonstrated that the polarity of the mixture was indeed sufficiently high to capture both the stilbenoids pinosylvin and resveratrol almost fully to completion. The total amount of resveratrol produced was comparable with the PALCPR-control and PALCPR-solvent cultures in the previous example, however, the culture now produced relatively high amounts of the intermediate coumaric acid, substantial amounts of cinnamic acid and very minor amounts of the stilbenoid pinosylvin. Possibly the observed change in product profile could be the result of the solvent that drained the intermediates away from the cells, thereby changing the intracellular concentrations in the cells and with that influence the product pattern through the kinetic properties of the enzymes. In case that a resveratrol producing strain is preferred, the addition of a solvent clearly could simplify down-stream processing by capturing the reveratrol, and at the same time impairing production of other similar stilbenoids.

[0106] Moreover, similar to the PALCPR-solvent culture in previous example, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded.

Example 5

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of a Further Evolved Strain of PALCPR

[0107] The evolved PALCPR-evolved-I strain described in the previous example still displayed a long lag-phase to adapt to the solvent phase. In order to further improve said strain in terms of length of lag-phase and growth rate, a 25 ml aliquot of the exponentional growing PALCPR-evolved-I strain was used to inoculate a fermentor, containing a similar medium as described in the previous example. However, the medium now only contained 100 g/l galactose and did contain 100 ml of octylacetate from the beginning of the fermentation. In addition, the stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose only commenced after approximately 40 hours, indicated by a slow increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO₂, and consumed the galactose within less than 90 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.041 1/h (FIG. 3). The final biomass concentration was 21.5 g/l. The strain is referred to as PALCPR-evolved-II.

[0108] For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by multiplying the concentrations in the upper phase with a factor of 0.3 and then adding them up to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00004 Evolved PALCPR in Coumaric acid Resveratrol Cinnamic acid Pinosylvin 2-phase fermentation (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) Upper phase (0.1 L) 383.9; 59.3 210.4; 91.3 163.4; 88.6 30.7; 100 Lower phase (1 L) 26.3; 40.7 2.0; 8.7 2.1; 11.4 0; 0 Total produced in 1 L 64.7; 100 23.0; 100 18.4; 100 3.1; 100

[0109] The results demonstrated clearly that strain PALCPR-evolved-II was able to grow on a medium that contained 100 ml of octyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 40 hours was already considerably shorter than the 170 hrs described in the previous example, though at the expense of the growth rate that decreased to 0.041 1/h and with that galactose was depleted only after approximately 90 hours. Though the growth rate was indeed lower than the PALCPR-evolved-I culture in the previous example, the final biomass concentration was similar to said culture.

[0110] The solvent mixture was able to capture 100% of the stilbenoid pinosylvin and 91% of the more polar stilbenoid resveratrol. The total amount of resveratrol produced was higher than the PALCPR-evolved-I culture and the PALCPR-control and PALCPR-solvent cultures in the previous examples. However, the culture now produced lower amounts of the intermediates coumaric acid and cinnamic acid, which could be a result of the adaptation of the cells to the solvent.

[0111] Moreover, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded.

Example 6

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of an Even Further Evolved Strain of PALCPR.

[0112] The evolved PALCPR-evolved-II strain described in the previous example still displayed a shorter lag-phase than PALCPR-evolved-I but the growth rate was rather low with 0.041 1/h. Therefore, to further improve said strain in terms of both length of lag-phase and growth rate, a 50 ml aliquot of the exponentional growing PALCPR-evolved-II strain was used to inoculate a fermentor, containing a similar medium as described in the previous example (thus containing 100 g/l galactose 100 ml of octylacetate from the beginning of the fermentation). The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose already commenced after less then 20 hours, indicated by a slow increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells further grew exponentially with concomitant production of CO₂, and now consumed the galactose within approximately 50 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.091 1/h (FIG. 4). The final biomass concentration was 18.9 g/l. The strain is referred to as PALCPR-evolved-III.

[0113] For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00005 Evolved PALCPR in Coumaric acid Resveratrol Cinnamic acid Pinosylvin 2-phase fermentation (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) Upper phase (0.1 L) 105.8; 40.0 223.6; 90.3 298.7; 71.3 167.9; 90.3 Lower phase (1 L) 15.9; 60.0 2.4; 9.7 12.0; 28.7 1.8; 9.7 Total produced in 1 L 26.5; 100 24.8; 100 41.9; 100 18.6; 100

[0114] The results demonstrated clearly that strain PALCPR-evolved-III was able to grow on a medium that contained 100 ml of octyl acetate from the beginning with the stirring speed immediately set at 800 rpm. The lag-phase of 20 hours was shortened further compared to the 40 hours lag-phase described in the previous example, and this time the growth rate increased from 0.041 1/h to 0.091 1/h. Concommitantly the galactose was depleted only after approximately 90 hours. Though the growth rate was indeed lower than the PALCPR-evolved-I culture in the previous example, the final biomass concentration was similar to said culture.

[0115] The solvent mixture was able to capture 100% of the stilbenoid pinosylvin and 91% of the more polar stilbenoid resveratrol. The total amount of resveratrol produced was similar to the PALCPR-evolved-II culture but higher than the PALCPR-control and PALCPR-solvent cultures in the previous examples. However, compared to the PALCPR-evolved-III culture, the PALCPR-evolved-III culture produced lower amounts of coumaric acid, higher amounts of cinnamic acid, and considerably higher amounts of pinosylvin. The change in the overall product profile of the phenylpropanoid imtermediates could be the result of a further adaptation of the cells to the solvent.

[0116] Moreover, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded.

Example 7

Stilbenoid Production in Aspergillus Nidulans AR1 Aspergillus Nidulans AR1 has Deleted the Following Genes Genes argB2, pyrG89, veA.

[0117] a) Construction of a Filamentous Fungal Expression Vector, with argB (Ornithine Carbamoyltransferase) Marker.

[0118] The gene encoding argB including the homologous promoter and terminator sequence was amplified from Aspergillus nidulans AR1 genomic DNA using forward primer 5-CG GAATTC ATA CGC GGT TTT TTG GGG TAG TCA-3 (SEQ ID NO: 11) and the reverse primer 5-CG CCCGGG TAT GCC ACC TAC AGC CAT TGC GAA-3 (SEQ ID NO: 12) with the 5' overhang containing the restriction sites EcoRI and XmaI respectively. The incorporated restriction sites in the PCR product allowed insertion into pUC19 (New England biolabs, Ipswich, Mass.) digested with EcoRI and XmaI giving pUC19-argB.

[0119] The trpC (Indole-3-glycerol phosphate synthase) terminator was amplified from A. nidulans genomic DNA using forward primer 5-GC GGATCC ATA GGG CGC TTA CAC AGT ACA CGA-3 (SEQ ID NO: 13) and the reverse primer 5-CGGAGAGGGCGCGCCCGTGGCGGCCGC GGA TCC ACT TAA CGT TAC TGA-3 SEQ ID NO: 14 with the 5' overhang containing the restriction site BamHI and a 27 base pair adaptamer respectively.

[0120] The gpdA (glyceraldehyde-3-phosphate dehydrogenase) promoter was amplified from A. nidulans AR1 genomic DNA using forward primer 5-GCGGCCGCCACGGGCGCGCCCTCTCCG GCG GTA GTG ATG TCT GCT CAA-3 (SEQ ID NO: 15) and the reverse primer 5-CG AAGCTT TAT AAT TCC CTT GTA TCT CTA CAC-3 SEQ ID NO:16 with the 5' overhang containing a 27 base pair adaptamer and the restriction site HindIII respectively.

The fusion PCR product of fragment trpC and gpdA with the incorporated restriction sites allow insertion into pUC19-argB digested with BamHI and HindIII yielding pAT3. b) Construction of a filamentous fungal expression vector with pyrG (orotidine-5'-monophosphate decarboxylase) marker for expression of C4H (Cinnamate-4-hydroxylase) in A. nidulans AR1.

[0121] The gene encoding C4H was reamplified from the yeast plasmid pESC-URA-PAL2-C4H (WO2006089898) using the forward primer 5-CG G CGCG C ATA ATG GAC CTC CTC TTG CTG GAG-3 SEQ ID NO:17 and the reverse primer 5-GG GC GGCC GC TTA TTA ACA GTT CCT TGG TTT CAT AAC G-3 SEQ ID NO: 18 with the 5' overhang containing the restriction sites BssHII and NotI respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and NotI giving pAT3-C4H. The construct was verified by restriction enzyme cut and sequencing. The argB marker was removed by using the two following restriction enzymes BsiWI and PciI.

[0122] The gene encoding pyrG including the homologous promoter and terminator sequence was reamplified from Aspergillus fumigatus genomic DNA using the forward primer 5-CGT GTAC AATA TTA AT TAA CGAGA GCG AT CGC AAT AAC CGT ATT ACC GCC TTT GAG-3 SEQ ID NO: 19 and reverse primer 5-CGA CATG TAT TCC CGG GAA GAT CTC ATG GTC A-3 SEQ ID NO: 20 with the 5' overhang containing the restriction sites BsrGI, PacI, AsiSI in the forward primer and PciI in the reverse primer. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BsiWI and PciI giving pAT3-C4H-pyrG. The construct was verified by restriction enzyme cut and sequencing.

c) Construction of a Filamentous Fungal Expression Vector With argB Marker for Expression of 4CL1 (4-Coumarate-CoA Ligase) in A. Nidulans AR1

[0123] The gene encoding 4CL1 was reamplified from the yeast plasmid pESC-TRP-4CL1-VST1 using the forward primer 5-GCGGAGAGGGCGCG ATG GCG CCA CAA GAA CAA GCA-3 SEQ ID NO: 21 and the reverse primer 5-TGGATCCGCGGCCGC TCA CAA TCC ATT TGC TAG TTT TGC-3 SEQ ID NO: 22. The 4CL1 gene was inserted into a pAT3 vector digested with BssHII and NotI using the In-Fusion® PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pAT3-4CL1. The construct was verified by restriction enzyme cut and sequencing.

d) Construction of a Filamentous Fungal Expression Vector with argB Marker for Expression of VST1 (Resveratrol Synthase) in A. Nidulans AR1

[0124] The gene encoding VST1 was reamplified from the yeast plasmid pESC-TRP-4CL1-VST1 using the forward primer 5-CG G CGCG C ATA ATG GCA TCC GTA GAG GAG TTC-3 SEQ ID NO: 23 and the reverse primer 5-GG GC GGCC GC TTA TCA TTA GTT AGT GAC AGT TGG AA-3 SEQ ID NO: 24 with the 5' overhang containing the restriction sites BssHII and NotI respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and NotI giving pAT3-VST1. The construct was verified by restriction enzyme cut and sequencing.

e) Expression of the Pathway Leading to Pinosylvin in A. Nidulans AR1 (the Strain has Deletions (argB2, pyrG89, veA1)) using C4H, 4CL1 and VST1.

[0125] The transformation of the A. nidulans AR1 fungal cell was conducted in accordance with methods known in the art by protoplastation using cell wall lysing enzymes (glucanex, novozymes) Tilburn et al., 1983. Random integration of C4H, 4CL1 and VST1 was conducted in two steps. Plasmid pAT3-4CL1 and pAT3-VST1 were linearized using restriction enzyme BmrI and integrated in the genome by co-transformation according to Guerra et al., 2006 utilizing the auxotrophic marker argB. A transformant containing a 4CL1 and VST1 expression cassette was isolated and a successive transformation with pAT3-C4H-pyrG, which was linearized with BmrI, gave a recombinant A. nidulans strain containing C4H, 4CL1 and VST1.

Example 8

Stilbenoid Production in Escherichia Coli

a) Construction of a Bacterial Vector for Expression of PAL2 in Escherichia Coli.

[0126] The plasmids that were used in the following examples contained one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system is based upon dominant markers, e.g. resistance against ampicilin and kanamycin. In addition, the plasmids contained promoter- and terminator sequences that allowed the expression of the recombinant genes. Furthermore, the plasmids contained suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants. In this example the plasmids contained either the ampicilin resistance gene, designated as pET16b (Novagen), or the kanamycin resistance gene, designated as pET26b (Novagen).

[0127] The gene encoding PAL2, isolated as described previously, was reamplified by PCR from the plasmid pESC-URA-PAL2 using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector that contained the T7 promoter. The resulting plasmid, pET16B-PAL2, contained the gene encoding PAL2 under the control of the T7 promoter.

b) Construction of a Bacterial Vector for Expression of 4CL1 and VST1 in Escherichia Coli.

[0128] The gene encoding 4CL1, isolated as described previously, was reamplified by PCR from the plasmid pESC-URA-4CL1-VST1, using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET26B vector. The resulting plasmid, pET26B-4CL1, contained the gene encoding for 4CL1 under the control of the T7 promoter from Lactobacillus lactis.

[0129] The gene encoding VST1, isolated as described in previosly, was reamplified by PCR from the plasmid pESC-URA-4CL1-VST1 using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector. The resulting plasmid, pET16B-VST1, contained the gene encoding VST1 under the control of the T7 promoter. The T7 promoter and the gene encoding VST1 were reamplified as one fragment by PCR from the plasmid pET16B-VST1 using forward and reverse primers, with 5' overhangs containing suitable restriction sites.

[0130] The introduction of said restriction sites at the 5' and 3' ends of the DNA fragment allowed ligation of the restricted PCR product into the digested plasmid pET26B-4CL1. The resulting plasmid, pET26B-4CL1-VST1, contained the genes encoding 4CL1 and VST1, each under the control of their individual T7 promoter. The sequence of the genes encoding 4CL1 and VST1 was verified by sequencing of two different clones of pET26B-4CL1-VST1.

c) Expression of the Pathway to Pinosylvin in Escherichia Coli

[0131] Escherichia coli strains were transformed with the vectors described in (a) and (b), separately or in combination. The transformation of the bacterial cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium containing the antibiotics ampicilin and kanamycin and streak purified on the same medium.

[0132] Escherichia coli strain BL21 (DE3) was transformed separately with the vector pET16B-PAL2 (a), yielding the strain FSEC-PAL2; and with pET26B-4CL1-VST1 (b), yielding strain FSEC-4CL1VST1. In addition, Escherichia coli strain BL21 (DE3) was co-transformed with pET16B-PAL2 (a) and pET26B-4CL1-VST1 (n), and the transformed strain was named FSEC-PAL24CL1VST1.

Example 9

Construction of Strain FS09229, Containing the Phenylpropanoid Pathway with Glucose-Constitutive Promoters

I) Isolation of Genes Encoding PAL C4H, 4CL2 and VST1

[0133] 4-coumarate:CoenzymeA ligase (4CL2) SEQ ID NO: 25 (Hamberger and Hahlbrock 2004; Ehlting et al., 1999;) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using suitable primers.

[0134] The PAL2 gene encoding Arabidopsis thaliana resveratrol phenylalanine ammonia lyase (Cochrane et al., 2004) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence was used as template to generate a synthetic gene codon (SEQ ID NO: 26) optimized for expression in S. cerevisiae. The synthetic PAL2 gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-CAC TAA AGG GCG GCC GCA TGG ACC AAA TTG AAG CA-3 SEQ ID NO: 27 and reverse primer 5-AAT TAA GAG CTC AGA TCT TTA GCA GAT TGG AAT AGG TG-3 SEQ ID NO: 28 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

[0135] The C4H gene encoding Arabidopsis thaliana cinnamate-4-hydroxylase (Hamberger and Hahlbrock 2004; Ehlting et al., 1999) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence was used as template to generate a synthetic gene (SEQ ID NO: 29) (S codon optimized for expression in S. cerevisiae. The synthetic C4H gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG G-3 SEQ ID NO:30 and reverse primer 5-AGT AGA TGG AGT AGA TGG AGT AGA TGG AGT AGA TGG ACA ATT TCT GGG TTT CAT G-3 SEQ ID NO: 31 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

[0136] The ATR2 gene encoding Arabidopsis thaliana P450 reductase was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence was used as template to generate a synthetic gene (SEQ ID NO: 32) codon optimized for expression in S. cerevisiae. The synthetic C4H gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-CCA TCT ACT CCA TCT ACT CCA TCT ACT CCA TCT ACT AGG AGG AGC GGT TCG G-3 SEQ ID NO:33 and reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO:34 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

[0137] The VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al., 1993) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence was used as template to generate a synthetic gene codon optimized for expression in S. cerevisiae. The synthetic VST1 gene (SEQ ID NO: 35) was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was amplified using forward primer 5-CCG GAT CCT CAT GGC ATC CGT CGA AGA GTT CAG G-3 SEQ ID NO: 36 and reverse primer 5-CGC TCG AGT TTT AGT TAG TAA CTG TGG GAA CGC TAT GC-3 SEQ ID NO:37 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

II) Construction of a Yeast Vector for Galactose Induced Expression of 4CL2 and VST1

[0138] The gene encoding 4CL2 was isolated as described in section I. The amplified 4CL2 PCR-product using forward primer 5-GCG AAT TCT TAT GAC GAC ACA AGA TGT GAT AGT CAA TGA T-3 SEQ ID NO:38 and reverse primer 5-GCA CTA GTA TCC TAG TTC ATT AAT CCA TTT GCT AGT CTT GC-3 SEQ ID NO:39 was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2.

[0139] Two different clones of pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

[0140] The gene encoding VST1 was isolated as described in section I. The amplified synthetic VST1 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-HIS-4CL2. The resulting plasmid, pESC-HIS-4CL2-VST1, contained the genes encoding 4CL2 and VST1 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-HIS-4CL2-VST1 (SEQ ID NO: 40).

III) Construction of a Yeast Vector for Galactose Induced Expression of PAL2 and C4H:ATR2 Fusion Gene

[0141] The gene encoding PAL2 was isolated as described in section I. The amplified PAL2 PCR-product was inserted into NotI/BglII digested pESC-URA vector Stratagene), resulting in vector pESC-URA-PAL2. Two different clones of pESC-URA-PAL2 were sequenced to verify the sequence of the cloned gene.

[0142] The genes encoding C4H and ATR2 were isolated as described in section I. C4H was amplified using forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG G-3 SEQ ID NO:41 and reverse primer 5-AGT AGA TGG AGT AGA TGG AGT AGA TGG AGT AGA TGG ACA ATT TCT GGG TTT CAT G-3 SEQ ID NO:42. ATR2 was amplified using forward primer 5-CCA TCT ACT CCA TCT ACT CCA TCT ACT CCA TCT ACT AGG AGG AGC GGT TCG G-3 SEQ ID NO:43 and reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO:44.

[0143] The amplified PCR products C4H and ATR2 were used as templates for the creation of the fusion gene C4H:ATR2 using the forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG G-3 SEQ ID NO:41 and the reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO:44.

[0144] The Fusion gene C4H:ATR2 gene was inserted into XhoI/KpnI digested pESC-URA-PAL2 by Infusion® technology (stratagene, La jolla, USA). The resulting plasmid, pESC-URA-PAL2-C4H:ATR2, contained the genes encoding PAL2 and C4H:ATR2 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding C4H:ATR2 was verified by sequencing of two different clones of pESC-URA-PAL2-C4H:ATR2(SEQ ID NO: 45).

IV) Construction of Strong Constitutive Promoter Fragment TDH3

[0145] The 600 base pair TDH3 (GPD) promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG SEQ ID NO: 46 containing a Sad restriction site and the reverse primer 5'-CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA SEQ ID NO:47 containing a Xba1 restriction site. The amplified TDH3 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.

V) Construction of Constitutive Strong Promoter Fragment TEF1

[0146] The 400 base pair TEF1 promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'-GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT SEQ ID NO:48 containing a Sac1 restriction site and the reverse primer 5'-CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A SEQ ID NO:49 containing a Xba1 restriction site. The amplified TEF1 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEF1.

VI) Construction of Fused Divergent Constitutive TEF1 and TDH3 Promoter Fragment

[0147] A divergent fusion fragment (FIG. 1) between TEF1 promoter and TDH3 promoter was constructed starting from PRS416-TEF1 and PRS416-TDH3.

[0148] The 600 base pair TDH3 fragment was reamplified from PRS416-TDH3 using the forward primer 5' TTGCGTATTGGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC SEQ ID NO: 50 containing the underlined overhang for fusion PCR to TEF1 fragment and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 51 containing the underlined BamH1 restriction site. This resulted in a fragment ready for fusion to the below TEF1 fragment.

[0149] The 400 base pair TEF1 fragment including a 277 base pair spacer upstream of the Sad restriction site was reamplified from PRS416-TEF1 using the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 52 containing the underlined EcoR1 restriction site and the reverse primer 5' TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC SEQ ID NO: 53 containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.

[0150] The 600 base pair TEF1 fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 54 and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 55, resulting in the divergent fragment <=TEF1/TDH3=> (SEQ ID NO: 56).

VII) Construction of a Yeast Vector for Constitutive Expression Induced of 4CL2 and VST1 pesc-HIS-TDH3-4CL2-TEF-VST1

[0151] The vector pESC-HIS-4CL2-VST1 (FIG. 2) with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoR1 and BamH1 to remove the GAL1/GAL10 promoters.

[0152] The divergent constitutive <=TEF1/TDH3=> promoter fragment (Sequence ID 56) was reamplified with forward primers 5' ATGAATTC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 57 and reverse primers AT GGA TCC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA A SEQ ID NO: 58 to reverse the orientation of TEF and TDH3 promoters in the final construct, that is to revert construct pESC-HIS-TEF1-4CL2-TDH3-VST1 into pESC-HIS-TDH3-4CL2-TEF1-VST1. The reamplified fragment was sequentially digested with EcoR1 and BamH1 and ligated into the above vector without the GAL1/Gal10 fragment. This resulted in a vector pesc-HIS-TDH3-4CL2-TEF1-VST1 (FIG. 3) with replaced promoters, from GAL1/Gal10 to TDH3/TEF1 (SEQ ID NO: 59).

VIII) Marker Exchange of the Expression Vector pesc-HIS-TDH3-4CL2-TEF-VST1

[0153] The vector pesc-HIS-TDH3-4CL2-TEF-VST1 with divergent constitutive TDH3/TEF1 promoters was used as template for amplification by PCR with forward primer 5-TCG ACG GAT CTA TGC GGT GTG AAA TAC C-3 (SEQ ID NO: 60) and reverse primer 5-ACT CTC AGT ACA ATC TGC TCT GAT GCC G-3 (SEQ ID NO: 61) removing the His3 expression cassette.

[0154] The Ura3 expression cassette was amplified by PCR using forward primer 5-AGA GCAGATTGTA CTGAGAGT CAT CAG AGC AGA TTG TAC TGA GAG TGC-3 (SEQ ID NO: 62) and reverse primer 5-CAC ACC GCA TAG ATC CGT CGA GGA TTT TGC CGA TTT CGG CCT ATT GG-3 (SEQ ID NO: 63) and template pESC-URA-PAL2-C4H:ATR2. The two PCR fragments were fused by Infusion® technology (stratagene, La Jolla, USA). This resulted in vector pesc-URA-TDH3-4CL2-TEF-VST1 with replaced auxotrophic marker, from his3 to ura3 (SEQ ID NO: 64).

IX) Construction of a Yeast Vector for Constitutive Expression of PAL2 and C4H:ATR2 Fusion Gene

[0155] The vector pESC-URA-PAL2-C4H:ATR2 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with NotI and XhoI to remove the GAL1/GAL10 promoters.

[0156] The divergent constitutive <=TEF1/TDH3=> promoter fragment was re-amplified with forward primer 5-TTC CAG CAA TAA CAA ATC CAT TTT GTA TCT AGA AAA CTT AGA TTA GAT TG-3 SEQ ID NO: 65 and reverse primer 5-CAT TGC TTC AAT TTG GTC CAT TTT GTA TCT AGA ATC CGT CGA AAC TAA GT-3 SEQ ID NO: 66. The PCR product was sequentially inserted into the above vector without the GAL1/Gal10 fragment using Infusion® technology (stratagene, La Jolla, USA). This resulted in a vector pESC-URA-TDH3-PAL2-TEF1-C4H:ATR2 with replaced promoters, from GAL1/Gal10 to TEF1/TDH3 (SEQ ID NO: 67).

X) Marker Exchange of the Expression Vector pESC-URA-TDH3-PAL2-TEF1-C4H:ATR2

[0157] The vector pESC-URA-TDH3-PAL2-TEF1-C4H:ATR2 with divergent constitutive TDH3/TEF1 promoters was used as template for amplification by PCR with forward primer 5-TGA AAT ACC GCA CAG ATG-3 (SEQ ID NO: 68) and reverse primer 5-CTC TCA GTA CAA TCT GCT-3 (SEQ ID NO: 69) removing the Ura3 expression cassette.

[0158] The His3 expression cassette was amplified by PCR using forward primer 5-AGC AGA TTG TAC TGA GAG GAG CTT GGT GAG CGC TAG GA-3 (SEQ ID NO: 70) and reverse primer 5-C ATC TGT GCG GTA TTT CAC GGT ATT TTC TCC TTA CGC ATC-3 (SEQ ID NO: 71) and template pESC-HIS-4CL2-VST1. The two PCR fragments were fused by Infusion® technology (stratagene, La Jolla, USA). This resulted in vector pESC-HIS-TDH3-PAL2-TEF1-C4H:ATR2 with replaced auxotrophic marker, from his3 to ura3 (SEQ ID NO: 72).

X1) Expression of the Pathway to Resveratrol in the Yeast S. Cerevisiae using PAL2, C4H:ATR2, 4CL2 and VST1

[0159] Yeast strains FS01529 containing the appropriate genetic markers were transformed with the vectors described in sections VIII and X giving FS09229. The transformation of the yeast cell was conducted in accordance with methods known in the art by using competent cells, an alternative being for instance, electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 10

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of a Further Evolved Strain of PALCPR

[0160] The evolved PALCPR-evolved-III strain described in the previous example was grown in the presence of nonyl-acetate, a similar solvent as octylacetate with one additional carbon atom. A 1 ml aliquot of a glycerol stock that was made from an exponentional growing PALCPR-evolved-III strain was used to inoculate a fermentor, containing a similar medium as described in the previous example, containing only 100 g/l galactose and 100 ml of nonyl-acetate from the beginning of the fermentation. The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose only commenced after approximately 70 hours, indicated by a slow increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO₂, and consumed the galactose within less than 40 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.098 1/h (FIG. 9). The final biomass concentration was 36.7 g/l. The cultivation will be referred to as PALCPR-solvent. As a control-experiment said strain was grown in the similar medium without the addition of nonylacetate. Upon inoculation of the fermentor, consumption of galactose commenced already after approximately 40 hours, indicated by an increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO₂, and consumed the galactose within less than 30 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.17 1/h. The final biomass concentration was 25.4 g/l. The cultivation will be referred to as PALCPR-control.

[0161] For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper nonylacetate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00006 Coumaric acid Resveratrol Cinnamic acid Pinosylvin (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) PALCPR-solvent Upper phase (0.1 L) -- 8.27; 100 252.82; 29.6 -- Lower phase (1 L) -- 0.0; 0.0 60.05; 70.4 -- Total produced in 1 L -- 0.83; 100 85.33; 100 -- PALCPR-control Supernatant -- 0.48 76.36 --

[0162] The results demonstrated that strain PALCPR-evolved-III was able to grow on a medium that contained 100 ml of nonyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 70 hours was already considerably longer than the lag-phase of the PALCPR-control fermentation and also a bit longer then a similar fermentation in the presence of octylacetate described in a previous example. The growth rate of 0.098 1/h was similar to the cultivation in the presence of octylacetate and considerably lower than the PALCPR-control fermentation. Surprisingly the biomass concentration was higher than both PALCPR-control and the octylacetate fermentation.

[0163] In both the PALCPR-solvent and PALCPR-control fermentation, only cinnamic acid and resveratrol was produced. The stilbenoid profiles differ therewith with previous described control- and solvent fermentations, which could be due to the difference between inocculating with either a fresh culture (previous examples) or with a glycerol stock (this example). Nevertheless, the solvent mixture was able to capture 100% of the stilbenoid resveratrol whereas only 25% of cinnamic acid was captured. The total amount of resveratrol produced was slightly higher than the PALCPR-control in this example Moreover, the culture produced none of the intermediates coumaric acid and pinosylvin, which could be a result of a further adaptation of the cells to the solvent.

Example 11

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Batch Culture of a Non-Evolved Strain Containing the Phenylpropanoid Pathway

[0164] The non-evolved FS09229 strain described in previous examples was grown in the presence of nonyl-acetate. A 1 ml aliquot of a glycerol stock that was made fr0m an exponentional growing FS09229 strain was used to inoculate a fermentor, containing a similar medium as described in the previous example, but now containing 100 g/l glucose and 100 ml of nonyl-acetate from the beginning of the fermentation. The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, a long lag-phase of approximately 70 hrs set-in, during which an apparent adaptation to the solvent took place. Consumption of glucose only then commenced, indicated by a slow increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO₂, and consumed the glucose within less than 25 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.176 1/h (FIG. 10). The final biomass concentration was 15.5 g/l. The cultivation will be referred to as FS09229-solvent. As a control-experiment said strain was grown in the similar medium without the addition of nonyl-acetate. Upon inoculation of the fermentor, consumption of glucose commenced already after approximately 10 hours, indicated by an increase in CO₂ signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO₂, and consumed the glucose within less than 20 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.22 1/h (FIG. 3). The final biomass concentration was 12.8 g/l. The cultivation will be referred to as FS09229-control.

[0165] For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper nonylacetate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00007 Coumaric acid Resveratrol Cinnamic acid Pinosylvin (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) FS09229-solvent Upper phase (0.1 L) -- 160.39; 95.1 39.29; 42.2 373.24; 100 Lower phase (1 L) -- 0.83; 4.9 53.83; 57.8 0.0; 0.0 Total produced in 1 L -- 16.87; 100 9.31; 100 37.32 FS09229-control Supernatant -- 43.89 57.81 8.5

The results demonstrated that also the non-evolved strain FS09229 was able to grow on a medium that contained 100 ml of nonyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 70 hours was already considerably longer than the lag-phase of the FS09229-control fermentation, but rather similar to the fermentation with PALCPR-evolved-III strain described in previous examples. The growth rate of 0.176 1/h was only slightly lower then the FS09229-control cultivation, whereas the biomass concentrations were similar.

[0166] In both the FS09229-solvent and FS09229-control fermentation, only cinnamic acid, pinosylvin and resveratrol was produced. The solvent mixture was able to capture 95% of the stilbenoid resveratrol, 100% of the stilbenoid pinosylvin and 42% of cinnamic acid. The total amount of resveratrol produced was, however lower than the FS09229-control culture, whereas the cinnamic acid- and pinosylvin concentrations were higher. Said difference in the profile of phenylpropanoid pathway intermediates could be a result of a-non optimal adaptation of the cells to the solvent.

[0167] This experiment demonstrates clearly, however, the biocompatibility of nonyl acetate solvent, because non-adapted cells of S. cerevisiae are already able to grow on a fermentation medium in the presence of said solvent. For an optimal production of stilbenoids, however, the strain likely needs to be further evolved on said solvent.

Example 12

Adaptation of Microorganisms to the Presence of Solvents

[0168] The present example describes a procedure to rapidly improve the resistance of microorganisms towards non-biocompatible toxic solvents a.

[0169] Cells of a microorganism are subjected to a train of batch fermentations in a fermentor containing a suitable defined medium. The working volume is 1 L and the gas flow rate is set at 1.5 l/m, the temperature and pH is controlled at a desired setting suitable to the organism. The first fermentation contains a suitable carbon source, preferably in the range of 50 g/l to 100 g/l, and stirring rate is kept low to prevent mixing of the medium- and solvent phase, as illustrated in FIG. 5A in which a fermentor vessel is shown containing the two separated phases (aqueous) and (solvent) agitated by a stirrer below 200 rpm. At the onset of carbon-source consumption, a mixture of solvents is added. The mixture contains 10 ml of solvent (now referred to as "extractant") that is a good extractant for the desired product, but non-biocompatible with the cells, and 40 ml of a biocompatible solvent (now referred to as "biocompatible solvent") that is a poor extractant for the desired product. After depletion of the carbon source the strain is harvested and used for a next fermentation. The next fermentation is performed with said harvested strain using similar fermentation conditions as to the previous one, but now with addition of a mixture of 50 ml extractant and 100 ml biocompatible solvent. In case the cells are able to grow in the presence of said solvent mixture, the strain is harvested after carbon source depletion and used for a next fermentation. The next fermentation is performed with said harvested strain, using similar conditions as to the previous one, but now the stirring rate is increased to 1000 rpm halfway through the consumption of the carbon source, causing mixing of the solvent phase with the medium phase as illustrated in FIG. 5B. In case the cells remain able to grow when the phases are mixed, the strain is harvested and used for a next fermentation. The next fermentation is then performed with said harvested strain using similar conditions as to the previous one, but now with addition of a mixture of 100 ml extractant and 100 ml biocompatible solvent. In case the increase of the extractant to 100 ml causes the arrest of cell growth, indicated by a halt in carbon source consumption, the amount of biocompatible solvent can be increased to, for instance to 200 ml, in order to further obscure the toxic effect of extractant. If necessary the amount of biocompatible solvent can even be increased further up to the point that cells can grow in the presence of the solvent mixture. In case cells are indeed able to grow in the presence of said solvent mixture at high stirring rate, the strain is harvested and stored in a solution of 15% glycerol at -80° C.

[0170] In case that the polarity of said solvent mixture is too low to capture sufficient amounts of desired polar products, a further train of fermentations can be initiated to adapt the cells to grow in the presence of solely the more polar and thus more toxic solvent extractant. The cells obtained from the previously described adaptation rounds are taken as starting point because the presence of the solvent mixture should possibly have already evoked adaptation of cells to solvents. For that, the glycerol stocks cells of the cultures described in the previous example is used to inoculate a fermentor, containing the same medium as described in the previous example with a suitable carbon source in the range of 50- to 100 g/l. The cells are allowed to fully consume the carbon source at a stirring speed of 1000 rpm with average dissolved oxygen content of above 70% of saturated air. At the onset of carbon source consumption, the stirring rate is turned down to 300 rpm, after which slowly 100 ml of extractant is added.

[0171] Upon addition of extractant, consumption of carbon source is arrested, the dissolved oxygen content increases to almost 99% of saturated air, O₂-consumption and CO₂ production halts, all indicating that the proliferation of cells arrested. However after a long lag-phase, the CO₂ signal slowly increases, dissolved oxygen slowly decreases, indicating that cells start to grow, and consumption of carbon source commences again.

[0172] To further improve said strain in terms of reducing the length of the lag-phase and growth rate, a 25 ml aliquot of the exponentional growing strain as described above is used to inoculate a fermentor, containing a similar medium as described previously. However, the medium now contains 100 ml of extractant from the very beginning of the fermentation. In addition, the stirrer speed is instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of the carbon source commences after a shorter lag-phase than before. To further improve said strain in terms of both length of lag-phase and growth rate, another adaption round follows with a 50 ml aliquot of the exponentional growing adapted-strain, in the presence of 100 ml of extractant and with the stirring rate instantly set at 800 rpm. The number of adaptation rounds is repeated until a satisfactory reduction of lag-phase, and sufficiently high growth-rates are reached.

Example 13

Determination of Intracellular and Extracellular Levels of Stilbenoids in Shakeflask Cultures of FS06112, in the Presence of the Solvent Octyl Acetate

[0173] A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/l glycerol, 1.5 g/l yeast extract, 3 g/l K₂HPO₄, 6.8 g/l Na₂HPO₄, 0.5 g/l NaCl, 1 g/l NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β-thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent octyl acetate was added to one shakeflask that is now referred to as FS06112-solvent; the shakeflask culture without solvent will be referred to as FS06112-control. After an incubation period of approximately 24 hours, 2.5 g/l glycerol was consumed in both the FS06112-solvent and -control culture and both the medium and solvent phases were analyzed for the presence of resveratrol.

[0174] For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper methyl decanoate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00008 Solvent: Coumaric acid Resveratrol Cinnamic acid Pinosylvin octyl acetate (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) FS06112-solvent Upper phase (0.1 L) -- 3.03; 100 -- -- Lower phase (1 L) -- 0.0; 0.0 -- -- Total produced in 1 L -- 0.30; 100 -- -- FS06112-control Supernatant -- 0.85 -- --

The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium to which 10 ml of octyl acetate was added at the onset of induction of resveratrol production. Both FS06112-solvent- and FS06112-control cultivation consumed 2.5 g/l of glycerol within 24 hrs.

[0175] In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. The solvent was able to capture 100% of the stilbenoid resveratrol, but the total amount of resveratrol produced was lower than the FS06112-control cultivation.

Example 14

Construction E. Coli Strain FS06112, Containing the "TAL"-Phenylpropanoid Pathway with Inducible Promoters

[0176] I) Construction of a bacterial vector for expression of TAL in Escherichia coli.

[0177] An ammonia lyase from Rhodobacter capsulatus, which was codon-optimized for use in S. cerevisiae, was used as the basis for the construction of a bacterial vector for expression of TAL in Escherichia coli. The coding sequence of tyrosine ammonia lyase (TAL) from Rhodobacter capsulatus (Kyndt et al., 2002; SEQ ID NO: 73 (nucleotide) and 74 (amino acid)) was codon optimized for expression in S. cerevisiae using the online service back translation tool at www.entelechon.com, yielding sequence SEQ ID NO: 75, which again expresses SEQ ID NO: 74. Oligos for the synthetic gene assembly were constructed at MWG Biotech and the synthetic gene was assembled by PCR using a slightly modified method protocol of from Martin et al. (2003). The amplified synthetic TAL gene was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1-digested pESC-URA vector. The resulting plasmid, pESC-URA-TAL, contained the gene encoding for TAL under the control of the divergent GAL1/GAL10 promoter. The sequence was verified by sequencing of two different clones of pESC-URA-TAL. The gene encoding tyrosine ammonia lyase (TAL) was reamplified by PCR from the yeast plasmid pESC-URA-TAL described in using the forward primer 5'-CCG CTCGAG CGG ATG ACC CTG CAA TCT CAA ACA GCT AAA G-3' SEQ ID NO: 76 and the reverse primer 5'-GC GGATCC TTA AGC AGG TGG ATC GGC AGC T-3' SEQ ID NO: 77 with 5' overhangs containing the restriction sites XhoI and BamHI, respectively. The introduction of restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a pET-16b vector (Novagen), digested with XhoI and BamHI to yield pET16b-TAL. The pET-16b vector contained both the gene for ampicillin resistance and the T7 promoter. Hence, above procedure resulted in a vector that contained the gene encoding TAL under the control of the T7 promoter. The sequence of the gene encoding TAL was verified by sequencing of one clone of pET16b-TAL.

II) Construction of a Bacterial Vector for Expression of 4CL and VST in Escherichia Coli.

[0178] The gene encoding 4-Coumarate-CoA ligase (4CL1) was reamplified by PCR from the yeast plasmid pESC-TRP-4CL1-VST1 using the forward primer 5'-TG CCATGG CA ATGGCGCCAC AAGAACAAGC AGTTT-3' SEQ ID NO: 78 and the reverse primer 5'-GC GGATCC CCT TCA CAA TCC ATT TGC TAG TTT TGCC-3' SEQ ID NO: 79 with 5' overhangs containing the restriction sites NcoI and BamHI, respectively. The introduction of restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a pET16b vector (Novagen) digested with NcoI and BamHI. The resulting plasmid, pET16b-4CL1, contained the gene encoding for 4CL1 under the control of the T7 promoter. Both the T7 promoter and the gene encoding 4CL1 were reamplified as one fragment by PCR from the plasmid pET16b-4CL1 using the forward primer (A) 5'-GACAAGCTTGCGGCC AGA TCT CGA TCC CGC GAA ATT AAT ACG-3' SEQ ID NO: 80 and the reverse primer (B) 5'-TGCTCGAGTGCGGCC TCA CAA TCC ATT TGC TAG TTT TGCC-3' SEQ ID NO: 81. The 4CL1 gene was inserted into a pET26b-VST1 vector (Novagen) digested with Not1 using the In-Fusion® PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pET26b-VST1-4CL1. The resulting plasmid, pET26b-VST1-4CL1, contained the two genes 4CL1 and VST1 that each are under control of an individual T7 promoter. The sequences of the genes, promoters and terminator were verified by sequencing of four clones of pET26b-VST1-4CL1.

[0179] The gene encoding grape resveratrol synthase (VST1) was reamplified by PCR from the yeast plasmid pESC-TRP-4CL1-VST1, using the forward primer 5'-CGC CATATG ATG GCA TCC GTA GAG GAG TTC AGA A-3' SEQ ID NO: 82 and the reverse primer 5'-CC GGATCC TCA TTA GTT AGT GAC AGT TGG AAC AGA GT-3' SEQ ID NO: 83. The VST1 gene was inserted into a pET26b vector (Novagen) digested with Nde1 and BamH1 using the In-Fusion® PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pET26b-VST1. The pET26b vector contained both the gene for kanamycin resistance and the T7 promoter. Hence, above procedure resulted in a vector that contained the gene encoding VST1 under the control of the T7 promoter. Cloning between the Nde1 and Bamh1 restriction sites enabled the removal of N-terminal pET26b pelB secretion signal sequence, which would otherwise enable targeting of the expressed protein to the E. coli periplasmic space. An extra VST1 copy was cloned into a third vector encoding chloramphenicol resistance by reamplifying VST1 gene by PCR from the yeast plasmid pESCTRP-4CL1-VST1, using the forward primer 5'-AAGGAGATATACATATG ATG GCA TCC GTA GAG GAG TTC AGA A-3' SEQ ID NO: 84 and the reverse primer 5'-CTTTACCAGACTC GAG TCA TTA GTT AGT GAC AGT TGG AAC AGA GT-3' SEQ ID NO: 85. The VST1 gene was inserted into a pACYCDuet-1 vector (Novagen) digested with Nde1 and Xho1 using the In-Fusion® PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pACYCDuet-VST1.

III) Expression of the Pathway to Resveratrol in Escherichia Coli, using TAL, 4CL and VST.

[0180] The transformation of the bacterial cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). The E. coli strain BL21 (DE3) (Novagen) was co-transformed with the three vectors pET16b-TAL, pET26b-VST-4CL, and pACYCDuet-VST1. Transformants were selected on Luria-Bertani (LB) medium with 50 mg/l ampicillin, 50 mg/l kanamycin and 50 mg/l chloramphenicol. This resulted in a strain harboring three plasmids pET16b-TAL, pET26b-VST-4CL, and pACYCDuet-VST1 with the full "TAL"-resveratrol pathway and double VST1 copies (FS06111). It was originally thought, before extraction procedures had been optimized, that an extra copy of VST1 gene was needed on a third plasmid for efficient expression of the resveratrol pathway. However, after optimization of extraction procedures, it was demonstrated that a strain harbouring only the two plasmids pET16-TAL and pET26-4CL1-VST1, performed as well as the three-plasmid strain with the extra VST1 copy (FS06111). The strain expressing the resveratrol pathway with two plasmids (FS06112), therefore, was obtained by restreaking FS06111 on LB agar plates, containing only 50 mg/l ampicillin and 50 mg/l kanamycin, but lacking chloramphenicol; with no selection pressure from chloramphenicol, the third plasmid was eventually lost.

Example 15

Determination of Intracellular and Extracellular Levels of Stilbenoids in Shakeflask Cultures of FS06112, in the Presence of the Solvent Methyl-Decanoate

[0181] A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/l glycerol, 1.5 g/l yeast extract, 3 g/l K₂HPO₄, 6.8 g/l Na₂HPO₄, 0.5 g/l NaCl, 1 g/l NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β-thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent methyl decanoate was added to one shakeflask that is now referred to as FS06112-solvent; the shakeflask culture without solvent will be referred to as FS06112-control. After an incubation period of approximately 48 hours, the glycerol was depleted and the medium and solvent phases were analyzed for the presence of resveratrol.

[0182] For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper methyl decanoate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00009 Solvent: Coumaric acid Resveratrol Cinnamic acid Pinosylvin methyl decanoate (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) FS06112-solvent Upper phase (0.1 L) -- 8.79; 100 -- -- Lower phase (1 L) -- 0.0; 0.0 -- -- Total produced in 1 L -- 0.88; 100 -- -- FS06112-control Supernatant -- 1.08 -- --

[0183] The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium that to which 10 ml of methyl-decanoate was added at the onset of induction of resveratrol production. The FS06112-solvent cultivation consumed the glycerol within 48 hrs, which was only slightly longer than the 30 hours in which the FS06112-control cultivation consumed the glycerol.

[0184] In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. In addition, in the chromatogram of the upper-solvent phase of the FS06112-solvent cultivation a small peak could be observed with a retention time and UV-spectrum that resembled those of cis-resveratrol. Most likely, a small fraction of the produced trans-resveratrol was converted into cis-resveratrol, which could be an effect of the presence of the solvent. The solvent was able to capture 100% of the stilbenoid resveratrol, and the total amount of resveratrol produced was slightly lower than the FS06112-control cultivation. However, the small peak that allegedly represented cis-resveratrol was approximately 25% of the area of the trans-resveratrol peak, which implied that the total resveratrol content produced in the FS06112-solvent cultivation could be equal or even slightly higher than in the FS06112-control cultivation.

Example 16

Determination of Intracellular and Extracellular Levels of Stilbenoids in Shakeflask Cultures of FS06112, in the Presence of the Solvent Undecanone

[0185] A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/l glycerol, 1.5 g/l yeast extract, 3 g/l K₂HPO₄, 6.8 g/l Na₂HPO₄, 0.5 g/l NaCl, 1 g/l NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β-thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent undecanone was added to one shakeflask that is now referred to as FS06112-solvent; the shakeflask culture without solvent will be referred to as FS06112-control. After an incubation period of approximately 48 hours, the glycerol was depleted and the medium and solvent phases were analyzed for the presence of resveratrol.

[0186] For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper undecanone phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

TABLE-US-00010 Solvent: Coumaric acid Resveratrol Cinnamic acid Pinosylvin Undecanone (mg/l; % total) (mg/l; % total) (mg/l; % total) (mg/l; % total) FS06112-solvent Upper phase (0.1 L) -- 8.82; 100 -- -- Lower phase (1 L) -- 0.0; 0.0 -- -- Total produced in 1 L -- 0.88; 100 -- -- FS06112-control Supernatant -- 1.08 -- --

The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium that to which 10 ml of undecanone was added at the onset of induction of resveratrol production. The FS06112-solvent cultivation consumed the glycerol within 48 hrs, which was only slightly longer than the 30 hours in which the FS06112-control cultivation consumed the glycerol.

[0187] In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. In addition, the determination of the resveratrol content in the solvent phase was sometimes complicated by a considerable shift in retention time of the resveratrol peak. Most likely the high concentration of undecanone in the sample interfered with the a-polar interactions between the resveratrol molecule and the stationary phase. Apparently undecanone interfered more intensively with the analysis than all the other solvents used in the previous examples because no drastic retention times shifts have been observed with said other solvents. Still it was possible to render a quantitative analysis and to establish that undecanone was able to capture 100% of the stilbenoid resveratrol, and that the total amount of resveratrol produced was slightly lower than the FS06112-control cultivation. However, with the uncertainty of the retention time shift and its effect on the peak shape the total resveratrol content produced in the FS06112-solvent cultivation could be considered at least equal to that of the FS06112-control cultivation.

[0188] In this specification, unless expressly otherwise indicated, the word `or` is used in the sense of an operator that returns a true value when either or both of the stated conditions is met, as opposed to the operator `exclusive or` which requires that only one of the conditions is met. The word `comprising` is used in the sense of `including` rather than in to mean `consisting of`. All prior teachings acknowledged above are hereby incorporated by reference. No acknowledgement of any prior published document herein should be taken to be an admission or representation that the teaching thereof was common general knowledge in Australia or elsewhere at the date hereof.

REFERENCES

[0189] Abe, I., Watanabe, T. and Noguchi, H. (2004). Enzymatic Formation of Long-chain Polyketide Pyrones by Plant Type III Polyketide Synthases. Phytochemistry, 65, 2447-2453

[0190] Cochrane F C, Davin L B, Lewis N G. The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry. 2004:65:1557-64.

[0191] Ehlting J, Buttner D, Wang Q, Douglas C J, Somssich I E, Kombrink E. Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant J. 1999:19:9-20.

[0192] Guerra O G, Rubio I G, da Silva Filho C G, Bertoni R A, Dos Santos Govea R C, Vicente E J. (2006). A novel system of genetic transformation allows multiple integrations of a desired gene in Saccharomyces cerevisiae chromosomes. J Microbiol Methods. 67, 437-45.

[0193] Hain, R., Reif, H. J., Krause, E., Langebartels, R., Kindl, H., Vornam, B., Wiese, W., Schmelzer, E., Schreier, P. H., Stocker, R. H. and Stenzel, K. (1993). Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361, 153-156.

[0194] Hamberger B, Hahlbrock K. The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc Natl Acad Sci USA. 2004:101:2209-14.

[0195] Kaneko, M., Ohnishi, Y. and Horinouchi, S. Cinnamate:Coenzyme (2003). A ligase from the Filamentous Bacteria Streptomyces coelicolor A3(2), J. Bact. 185, 20-27.

[0196] Kyndt J A, Meyer T E, Cusanovich M A, Van Beeumen J J. (2002). Characterization of a bacterial tyrosine ammonia lyase, a biosynthetic enzyme for the photoactive yellow protein. FEBS Lett. 512, 240-244.

[0197] Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D. and Keasling, J. D. (2003). Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology 21, 796-802.

[0198] Morita, H., Noguchi, H., Schroder, J. and Abe, I. (2001). Novel polyketides synthesized with a higher plant stilbene synthase. Eur. J. Biochem. 268, 3759-3766.

[0199] Mumberg D, Muller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995:156:119-22.

[0200] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.

[0201] Samappito, S., Page, J. E., Schmidt, J., De-Eknamkul, W. and Kutchan, T. M. (2003). Aromatic and pyrone polyketides synthesized by a stilbene synthase from Rheum tataricum. Phytochemistry 62, 313-323.

[0202] Sikorski R S, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989:122:19-27.

[0203] Stark D et al, 2003, Biotechnology and Bioengineering; August 20, 83(4): 376-75.

[0204] Tilburn J, Scazzocchio C, Taylor G G, Zabicky-Zissman J H, Lockington R A, Davies R W. (1983). Transformation by integration in Aspergillus nidulans. Gene. 26, 205-21.

[0205] Verduyn C, Postma E, Scheffers W A, Van Dijken J P. (1992). Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 8, 501-517.

Sequence CWU 1

1

85125DNASaccharomyces cerevisiae 1gtattctata tccacgcctg caaac 25245DNASaccharomyces cerevisiae 2agtacataca gggaacgtcc ctacaggaac gcaaacttaa gctac 45350DNASaccharomyces cerevisiae 3gcatacaatc aactatctca tatacaatgc cgtttggaat agacaacacc 50428DNASaccharomyces cerevisiae 4gcttccgcat tacaaataaa gtcttcaa 28542DNASaccharomyces cerevisiae 5ggacgttccc tgtatgtact agggggatcg aagaaatgat gg 42625DNASaccharomyces cerevisiae 6gagcaatgaa cccaataacg aaatc 25725DNASaccharomyces cerevisiae 7cttgacgttc gttcgactga tgagc 25826DNASaccharomyces cerevisiae 8tgtatatgag atagttgatt gtatgc 26940DNAArabidopsis thaliana 9gcgaattctt atgacgacac aagatgtgat agtcaatgat 401042DNAArabidopsis thaliana 10gcactagtat cctagttcat taatccattt gctagtcttg ct 421132DNAAspergillus nidulans 11cggaattcat acgcggtttt ttggggtagt ca 321232DNAAspergillus nidulans 12cgcccgggta tgccacctac agccattgcg aa 321332DNAAspergillus nidulans 13gcggatccat agggcgctta cacagtacac ga 321448DNAAspergillus nidulans 14cggagagggc gcgcccgtgg cggccgcgga tccacttaac gttactga 481548DNAAspergillus nidulans 15gcggccgcca cgggcgcgcc ctctccggcg gtagtgatgt ctgctcaa 481632DNAAspergillus nidulans 16cgaagcttta taattccctt gtatctctac ac 321732DNAArabidopsis thaliana 17cggcgcgcat aatggacctc ctcttgctgg ag 321838DNAArabidopsis thaliana 18gggcggccgc ttattaacag ttccttggtt tcataacg 381956DNAAspergillus fumigatus 19cgtgtacaat attaattaac gagagcgatc gcaataaccg tattaccgcc tttgag 562032DNAAspergillus fumigatus 20cgacatgtat tcccgggaag atctcatggt ca 322135DNAArabidopsis thaliana 21gcggagaggg cgcgatggcg ccacaagaac aagca 352239DNAArabidopsis thaliana 22tggatccgcg gccgctcaca atccatttgc tagttttgc 392332DNAVitis vinifera 23cggcgcgcat aatggcatcc gtagaggagt tc 322436DNAVitis vinifera 24gggcggccgc ttatcattag ttagtgacag ttggaa 36251671DNAArabidopsis thaliana 25atgacgacac aagatgtgat agtcaatgat cagaatgatc agaaacagtg tagtaatgac 60gtcattttcc gatcgagatt gcctgatata tacatcccta accacctccc actccacgac 120tacatcttcg aaaatatctc agagttcgcc gctaagccat gcttgatcaa cggtcccacc 180ggcgaagtat acacctacgc cgatgtccac gtaacatctc ggaaactcgc cgccggtctt 240cataacctcg gcgtgaagca acacgacgtt gtaatgatcc tcctcccgaa ctctcctgaa 300gtagtcctca ctttccttgc cgcctccttc atcggcgcaa tcaccacctc cgcgaacccg 360ttcttcactc cggcggagat ttctaaacaa gccaaagcct ccgcggcgaa actcatcgtc 420actcaatccc gttacgtcga taaaatcaag aacctccaaa acgacggcgt tttgatcgtc 480accaccgact ccgacgccat ccccgaaaac tgcctccgtt tctccgagtt aactcagtcc 540gaagaaccac gagtggactc aataccggag aagatttcgc cagaagacgt cgtggcgctt 600cctttctcat ccggcacgac gggtctcccc aaaggagtga tgctaacaca caaaggtcta 660gtcacgagcg tggcgcagca agtcgacggc gagaatccga atctttactt caacagagac 720gacgtgatcc tctgtgtctt gcctatgttc catatatacg ctctcaactc catcatgctc 780tgtagtctca gagttggtgc cacgatcttg ataatgccta agttcgaaat cactctcttg 840ttagagcaga tacaaaggtg taaagtcacg gtggctatgg tcgtgccacc gatcgtttta 900gctatcgcga agtcgccgga gacggagaag tatgatctga gctcggttag gatggttaag 960tctggagcag ctcctcttgg taaggagctt gaagatgcta ttagtgctaa gtttcctaac 1020gccaagcttg gtcagggcta tgggatgaca gaagcaggtc cggtgctagc aatgtcgtta 1080gggtttgcta aagagccgtt tccagtgaag tcaggagcat gtggtacggt ggtgaggaac 1140gccgagatga agatacttga tccagacaca ggagattctt tgcctaggaa caaacccggc 1200gaaatatgca tccgtggcaa ccaaatcatg aaaggctatc tcaatgaccc cttggccacg 1260gcatcgacga tcgataaaga tggttggctt cacactggag acgtcggatt tatcgatgat 1320gacgacgagc ttttcattgt ggatagattg aaagaactca tcaagtacaa aggatttcaa 1380gtggctccag ctgagctaga gtctctcctc ataggtcatc cagaaatcaa tgatgttgct 1440gtcgtcgcca tgaaggaaga agatgctggt gaggttcctg ttgcgtttgt ggtgagatcg 1500aaagattcaa atatatccga agatgaaatc aagcaattcg tgtcaaaaca ggttgtgttt 1560tataagagaa tcaacaaagt gttcttcact gactctattc ctaaagctcc atcagggaag 1620atattgagga aggatctaag agcaagacta gcaaatggat taatgaacta g 1671262154DNAArtificial SequenceSynthetic A.thaliana gene, codon optimised for S.cerevisiae expression 26atggaccaaa ttgaagcaat gctatgcggt ggtggtgaaa agaccaaggt ggccgtaacg 60acaaaaactc ttgcagatcc tttgaattgg ggtctggcag ctgaccagat gaaaggtagc 120catctggatg aagttaagaa gatggttgag gaatacagaa gaccagtcgt aaatctaggc 180ggcgagacat tgacgatagg acaggtagct gctatttcga ccgttggcgg ttcagtgaag 240gtagaacttg cagaaacaag tagagccgga gttaaggctt catcagattg ggtcatggaa 300agtatgaaca agggcacaga ttcctatggc gttaccacag gctttggtgc tacctctcat 360agaagaacta aaaatggcac tgctttgcaa acagaactga tcagattcct taacgccggt 420attttcggta atacaaagga aacttgccat acattacccc aatcggcaac aagagctgct 480atgcttgtta gggtgaacac tttgttgcaa ggttactctg gaataaggtt tgaaattctt 540gaggccatca cttcactatt gaaccacaac atttctcctt cgttgccctt aagaggaaca 600ataactgcca gcggtgattt ggttcccctt tcatatatcg caggcttatt aacgggaaga 660cctaattcaa aggccactgg tccagacgga gaatccttaa ccgctaagga agcatttgag 720aaagctggta tttcaactgg tttctttgat ttgcaaccca aggaaggttt agccctggtg 780aatggcaccg ctgtcggcag cggtatggca tccatggtgt tgtttgaagc taacgtacaa 840gcagttttgg ccgaagtttt gtccgcaatt tttgccgaag tcatgagtgg aaaacctgag 900tttactgatc acttgaccca caggttaaaa catcacccag gacaaattga agcagcagct 960atcatggagc acattttgga cggctctagc tacatgaagt tagcccagaa ggttcatgaa 1020atggaccctt tgcaaaaacc caaacaagat agatatgctt taaggacatc cccacaatgg 1080cttggccctc aaattgaagt aattagacaa gctacaaagt ctatagaaag agagatcaac 1140tctgttaacg ataatccact tattgatgtg tcgaggaata aggcaataca tggaggcaat 1200ttccagggta cacccatagg agtcagtatg gataatacca ggcttgccat agccgcaatt 1260ggcaaattaa tgtttgccca attttctgaa ttggtcaatg acttctacaa taacggtttg 1320ccttcgaatc tgaccgcatc ttctaaccct agtcttgatt atggtttcaa aggtgctgag 1380atagcaatgg caagctattg ttcagagctg caatatctag ccaacccagt aacctctcat 1440gtacaatcag ccgaacaaca caatcaggat gttaattctt tgggcctgat ttcatcaaga 1500aaaacaagcg aggccgttga tatccttaaa ttaatgtcca caacattttt agtgggtata 1560tgccaggccg tagatttgag acacttggaa gagaatttga gacagacagt gaaaaatacc 1620gtatcacagg ttgcaaaaaa ggttctaact acaggtatca atggtgaatt gcacccatca 1680agattctgtg aaaaagattt attaaaagtt gtagatagag aacaagtatt tacttacgtt 1740gacgatccat gtagcgctac ttatccattg atgcagagat tgagacaagt tattgtagat 1800cacgctttat ccaatggtga aactgagaaa aatgccgtta cttcaatatt ccaaaagata 1860ggtgcctttg aagaagaact gaaggcagtt ttaccaaagg aagtcgaagc tgctagagcc 1920gcatacggaa atggtactgc ccctatacca aatagaatca aagagtgtag gtcgtaccct 1980ttgtacagat tcgttagaga agagttggga accaaattac taactggtga aaaagtcgtt 2040agcccaggtg aagaatttga caaggtattc acagctatgt gcgagggaaa gttgatagat 2100ccacttatgg attgcttgaa agagtggaat ggtgcaccta ttccaatctg ctaa 21542735DNAEscherichia coli 27cactaaaggg cggccgcatg gaccaaattg aagca 352838DNAEscherichia coli 28aattaagagc tcagatcttt agcagattgg aataggtg 38291518DNAArtificial SequenceSynthetic A.thaliana gene, codon optimised for S.cerevisiae expression 29atggatttgt tattgctgga aaagtcactt attgctgtat ttgtggcagt tattctagcc 60acggttattt ctaaattaag aggtaagaaa ctaaaactac ctcctggtcc catccccata 120ccaatttttg gtaattggtt gcaagtgggc gatgatttga atcacagaaa tttggtagac 180tatgctaaga agttcggtga ccttttcttg cttagaatgg gtcaaaggaa tttggtagtg 240gttagctcac ctgatttgac taaggaggtc ttattaacgc aaggcgttga gtttggctcc 300agaactagaa atgttgtgtt tgatattttc actggtaaag gtcaagatat ggtttttaca 360gtttacggtg agcactggag aaaaatgaga agaatcatga ccgtaccatt ctttactaac 420aaggttgttc aacaaaatag agaaggttgg gagtttgagg cagcttccgt agtggaagac 480gtaaagaaaa atccagattc ggccacaaag ggtatagtac taagaaaaag actacaattg 540atgatgtaca acaatatgtt cagaattatg tttgacagaa gatttgaaag tgaagatgac 600cctttgttcc tgagacttaa ggctttgaat ggtgaaagat cgagattggc tcaaagtttc 660gaatataatt acggtgactt tattccaatc ttaagaccat ttttgagagg ctatttgaaa 720atttgccaag acgtcaagga taggaggatc gctcttttca agaagtactt tgtggacgag 780agaaagcaaa tagcttcttc caagcccaca ggttcggaag gtttaaaatg tgcaattgat 840catattttag aagctgaaca aaaaggtgaa attaacgaag ataatgtttt gtacattgta 900gaaaatatca atgtggctgc aatagaaaca accttatggt caatagaatg gggtattgct 960gaattggtga atcacccaga aatacaatct aaactgagaa acgagctaga taccgtttta 1020ggtccaggtg tccaagttac agaacctgat ttgcataagt taccctactt gcaagctgtg 1080gttaaagaaa ccttgagatt gagaatggct attcctcttc tagttcctca tatgaaccta 1140catgatgcta aactggccgg ttatgatatt ccagcagaaa gtaagatttt agtaaatgca 1200tggtggttgg ccaacaatcc aaacagttgg aaaaagcctg aagaattcag acctgaaaga 1260ttcttcgaag aggaatctca tgttgaagcc aacggaaatg acttcagata tgtacctttt 1320ggcgttggca gaagatcgtg tccaggaata atactagcct taccaatatt gggtatcaca 1380attggtagga tggttcaaaa ttttgagttg ctaccaccac ccggacaatc gaaagtcgat 1440acttcagaga aaggaggaca attctcattg catattttga atcattccat tatagtcatg 1500aaacccagaa attgttaa 15183040DNAEscherichia coli 30atttccgaag aagacctcga gatggatttg ttattgctgg 403155DNAEscherichia coli 31agtagatgga gtagatggag tagatggagt agatggacaa tttctgggtt tcatg 55322136DNAArtificial SequenceSynthetic A.thaliana gene, codon optimised for S.cerevisiae expression 32atgtccagta gctcttcctc ctcaacctcg atgatcgact taatggctgc tattataaaa 60ggagaaccag ttatagttag tgaccctgct aacgcaagcg cttacgaatc cgttgcagcc 120gagttgtcaa gtatgcttat agaaaataga cagtttgcta tgattgtaac gaccagcatc 180gccgttttaa ttggttgcat cgtgatgttg gtgtggagga ggagcggttc gggcaattca 240aagagggttg aaccactaaa gccattagtt atcaaaccta gagaagagga aattgacgat 300ggaaggaaga aagtcactat attcttcggc acccaaacag gtacagctga aggttttgct 360aaggctctag gagaagaagc aaaagctaga tatgaaaaga cgagattcaa aattgtcgat 420ctggatgact atgccgccga tgatgacgaa tacgaagaaa aattgaagaa agaagatgtc 480gcatttttct tccttgccac ctacggcgac ggtgaaccaa cagataatgc cgcaaggttt 540tacaagtggt ttactgaagg taatgacaga ggagaatggc tgaagaattt gaaatatggt 600gtgttcggcc ttggtaacag acagtacgag cattttaata aggtcgctaa ggttgtagat 660gatatacttg ttgaacaagg tgctcaaagg ttagtgcagg tgggcttggg tgacgatgat 720caatgtattg aagatgactt tactgcttgg agagaagcct tgtggcctga attagatact 780atccttagag aagaaggtga cactgctgtt gctaccccct acactgcagc agtcctagaa 840tatagagtct caatccatga ttcagaagac gccaaattca atgatattaa catggccaac 900ggtaacggtt acaccgtttt tgacgcacaa catccataca aagctaatgt tgctgttaaa 960agggaacttc acaccccaga aagtgacagg tcatgtatac atttggaatt tgatatcgct 1020ggtagtggtt tgacttacga aacaggtgac catgtcggag tactttgcga taatttgtca 1080gaaactgttg atgaagcttt gaggttattg gatatgtcac cagatactta cttctcattg 1140catgcagaaa aagaagacgg aactccaata tcaagctcgc ttccccctcc attccctccc 1200tgtaacttaa gaacagccct aactagatat gcttgtttac tgtcttctcc aaagaaaagt 1260gctttggttg cattggcagc ccacgcatcc gatcctaccg aagctgagag attaaagcat 1320ttggcttcac cagccggtaa agatgaatac agtaagtggg tagtggagag ccaaagatcg 1380cttttagaag tgatggctga gtttccaagt gctaaacctc ctctgggtgt atttttcgct 1440ggtgtggccc caagattgca gcctagattt tattccatat cctcatctcc aaaaattgcc 1500gaaaccagaa ttcacgtgac atgtgctctg gtctacgaaa agatgccaac aggtaggatt 1560cacaagggtg tctgttctac ctggatgaaa aatgctgtac cctatgaaaa atccgaaaat 1620tgttctagtg caccaatttt cgtaagacaa tctaatttca agttaccaag cgattctaaa 1680gtacccatta ttatgatcgg tccaggtact ggtttggccc cattcagagg cttcttgcaa 1740gaaagattgg ctttagtgga gagtggagtt gaattgggtc cttcagtttt attctttggt 1800tgtagaaaca gaagaatgga ctttatctac gaagaagaat tgcagagatt tgttgaaagt 1860ggtgcattgg ccgaattgag tgttgcattc agcagggaag gtccaaccaa agaatacgtt 1920caacacaaga tgatggacaa ggcttctgat atctggaata tgatttccca aggtgcttat 1980ttgtatgttt gtggtgacgc taaaggaatg gctagagatg ttcatagatc actgcataca 2040atcgcacaag aacaaggtag catggattca acaaaagcag agggctttgt aaagaatctt 2100cagacaagcg gtagatatct gagagatgta tggtaa 21363352DNAEscherichia coli 33ccatctactc catctactcc atctactcca tctactagga ggagcggttc gg 523444DNAEscherichia coli 34atcttagcta gccgcggtac cttaccatac atctctcaga tatc 44351182DNAArtificial SequenceSynthetic V.vinifera gene, codon optimised for S.cerevisiae expression 35atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc aaccatattg 60gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc tgattactat 120ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa tagaatttgt 180gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt agaggaacat 240ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat cataacagcc 300gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg gggacaacca 360aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat gccaggtgct 420gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt tatgttgtat 480catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt ggcagaaaat 540aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac tttcagaggt 600ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga tggatcttcc 660gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt tcaattagtt 720tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa cttgagagaa 780gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga aaacatcgaa 840aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc attgttttgg 900attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact aaacttagag 960aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat gagctctgcc 1020tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga aaaagccaca 1080accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt aacaattgag 1140acagtggtgt tacactctgt tccaactgtc actaactaat ga 11823634DNAEscherichia coli 36ccggatcctc atggcatccg tcgaagagtt cagg 343738DNAEscherichia coli 37cgctcgagtt ttagttagta actgtgggaa cgctatgc 383840DNAEscherichia coli 38gcgaattctt atgacgacac aagatgtgat agtcaatgat 403941DNAEscherichia coli 39gcactagtat cctagttcat taatccattt gctagtcttg c 414010157DNAVitis vinifera 40tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctactg gcgcgtggag 840taaaaaggtt tggatcagga tttgcgcctt tggatgaggc actttccaga gcggtggtag 900atctttcgaa caggccgtac gcagttgtcg aacttggttt gcaaagggag aaagtaggag 960atctctcttg cgagatgatc ccgcattttc ttgaaagctt tgcagaggct agcagaatta 1020ccctccacgt tgattgtctg cgaggcaaga atgatcatca ccgtagtgag agtgcgttca 1080aggctcttgc ggttgccata agagaagcca cctcgcccaa tggtaccaac gatgttccct 1140ccaccaaagg tgttcttatg tagtgacacc gattatttaa agctgcagca tacgatatat 1200atacatgtgt atatatgtat acctatgaat gtcagtaagt atgtatacga acagtatgat 1260actgaagatg acaaggtaat gcatcattct atacgtgtca ttctgaacga ggcgcgcttt 1320ccttttttct ttttgctttt tctttttttt tctcttgaac tcgacggatc tatgcggtgt 1380gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920gatcggtgcg ggcctcttcg ctattacgcc agctgaattg gagcgacctc atgctatacc 1980tgagaaagca acctgaccta caggaaagag ttactcaaga ataagaattt tcgttttaaa 2040acctaagagt cactttaaaa tttgtataca cttatttttt ttataactta tttaataata 2100aaaatcataa atcataagaa attcgcttat ttagaagtgt caacaacgta tctaccaacg 2160atttgaccct tttccatctt ttcgtaaatt tctggcaagg tagacaagcc gacaaccttg 2220attggagact tgaccaaacc tctggcgaag aattgttaat taagagctca gatcttatcg 2280tcgtcatcct tgtaatccat cgatactagt ctagttcatt aatccatttg ctagtcttgc 2340tcttagatcc ttcctcaata tcttccctga tggagcttta ggaatagagt cagtgaagaa 2400cactttgttg attctcttat aaaacacaac ctgttttgac acgaattgct tgatttcatc 2460ttcggatata tttgaatctt tcgatctcac cacaaacgca acaggaacct caccagcatc 2520ttcttccttc atggcgacga cagcaacatc attgatttct ggatgaccta tgaggagaga 2580ctctagctca gctggagcca cttgaaatcc tttgtacttg atgagttctt tcaatctatc 2640cacaatgaaa agctcgtcgt catcatcgat aaatccgacg tctccagtgt gaagccaacc 2700atctttatcg atcgtcgatg ccgtggccaa ggggtcattg agatagcctt tcatgatttg 2760gttgccacgg atgcatattt cgccgggttt gttcctaggc aaagaatctc ctgtgtctgg 2820atcaagtatc ttcatctcgg cgttcctcac caccgtacca catgctcctg

acttcactgg 2880aaacggctct ttagcaaacc ctaacgacat tgctagcacc ggacctgctt ctgtcatccc 2940atagccctga ccaagcttgg cgttaggaaa cttagcacta atagcatctt caagctcctt 3000accaagagga gctgctccag acttaaccat cctaaccgag ctcagatcat acttctccgt 3060ctccggcgac ttcgcgatag ctaaaacgat cggtggcacg accatagcca ccgtgacttt 3120acacctttgt atctgctcta acaagagagt gatttcgaac ttaggcatta tcaagatcgt 3180ggcaccaact ctgagactac agagcatgat ggagttgaga gcgtatatat ggaacatagg 3240caagacacag aggatcacgt cgtctctgtt gaagtaaaga ttcggattct cgccgtcgac 3300ttgctgcgcc acgctcgtga ctagaccttt gtgtgttagc atcactcctt tggggagacc 3360cgtcgtgccg gatgagaaag gaagcgccac gacgtcttct ggcgaaatct tctccggtat 3420tgagtccact cgtggttctt cggactgagt taactcggag aaacggaggc agttttcggg 3480gatggcgtcg gagtcggtgg tgacgatcaa aacgccgtcg ttttggaggt tcttgatttt 3540atcgacgtaa cgggattgag tgacgatgag tttcgccgcg gaggctttgg cttgtttaga 3600aatctccgcc ggagtgaaga acgggttcgc ggaggtggtg attgcgccga tgaaggaggc 3660ggcaaggaaa gtgaggacta cttcaggaga gttcgggagg aggatcatta caacgtcgtg 3720ttgcttcacg ccgaggttat gaagaccggc ggcgagtttc cgagatgtta cgtggacatc 3780ggcgtaggtg tatacttcgc cggtgggacc gttgatcaag catggcttag cggcgaactc 3840tgagatattt tcgaagatgt agtcgtggag tgggaggtgg ttagggatgt atatatcagg 3900caatctcgat cggaaaatga cgtcattact acactgtttc tgatcattct gatcattgac 3960tatcacatct tgtgtcgtca tgaattctct agaatccgtc gaaactaagt tctggtgttt 4020taaaactaaa aaaaagacta actataaaag tagaatttaa gaagtttaag aaatagattt 4080acagaattac aatcaatacc taccgtcttt atatacttat tagtcaagta ggggaataat 4140ttcagggaac tggtttcaac cttttttttc agctttttcc aaatcagaga gagcagaagg 4200taatagaagg tgtaagaaaa tgagatagat acatgcgtgg gtcaattgcc ttgtgtcatc 4260atttactcca ggcaggttgc atcactccat tgaggttgtg cccgtttttt gcctgtttgt 4320gcccctgttc tctgtagttg cgctaagaga atggacctat gaactgatgg ttggtgaaga 4380aaacaatatt ttggtgctgg gattcttttt ttttctggat gccagcttaa aaagcgggct 4440ccattatatt tagtggatgc caggaataaa ctgttcaccc agacacctac gatgttatat 4500attctgtgta acccgccccc tattttgggc atgtacgggt tacagcagaa ttaaaaggct 4560aattttttga ctaaataaag ttaggaaaat cactactatt aattatttac gtattctttg 4620aaatggcgag tattgataat gataaactga gctcggaaga gcgcccaata cgcaaaccgc 4680ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga 4740aagcgggcag tgagcgcaac gcaattaatg tgagttacct cactcattag gcaccccagg 4800ctttacactt tatgcttccg gctcctatgt tgtgtggaat tgtgagcgga taacaatttc 4860acacaggaaa cagctatgac catgattacg ccaagcgcgc aattaaccct cactaaaggg 4920aacaaaagct ggagctcata gcttcaaaat gtttctactc cttttttact cttccagatt 4980ttctcggact ccgcgcatcg ccgtaccact tcaaaacacc caagcacagc atactaaatt 5040tcccctcttt cttcctctag ggtgtcgtta attacccgta ctaaaggttt ggaaaagaaa 5100aaagagaccg cctcgtttct ttttcttcgt cgaaaaaggc aataaaaatt tttatcacgt 5160ttctttttct tgaaaatttt ttttttgatt tttttctctt tcgatgacct cccattgata 5220tttaagttaa taaacggtct tcaatttctc aagtttcagt ttcatttttc ttgttctatt 5280acaacttttt ttacttcttg ctcattagaa agaaagcata gcaatctaat ctaagttttc 5340tagaggatcc atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc 5400aaccatattg gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc 5460tgattactat ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa 5520tagaatttgt gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt 5580agaggaacat ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat 5640cataacagcc gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg 5700gggacaacca aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat 5760gccaggtgct gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt 5820tatgttgtat catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt 5880ggcagaaaat aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac 5940tttcagaggt ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga 6000tggatcttcc gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt 6060tcaattagtt tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa 6120cttgagagaa gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga 6180aaacatcgaa aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc 6240attgttttgg attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact 6300aaacttagag aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat 6360gagctctgcc tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga 6420aaaagccaca accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt 6480aacaattgag acagtggtgt tacactctgt tccaactgtc actaactaat gactcgagta 6540agcttggtac cgcggctagc taagatccgc tctaaccgaa aaggaaggag ttagacaacc 6600tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa cgttatttat 6660atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa 6720aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat gaatcggcca 6780acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 6840gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6900gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6960ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 7020cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 7080ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 7140taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 7200ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 7260ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 7320aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 7380tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 7440agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 7500ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 7560tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 7620tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 7680cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7740aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7800atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 7860cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 7920tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 7980atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 8040taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 8100tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 8160gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 8220cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 8280cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 8340gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 8400aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 8460accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 8520ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 8580gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 8640aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 8700taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaac gaagcatctg 8760tgcttcattt tgtagaacaa aaatgcaacg cgagagcgct aatttttcaa acaaagaatc 8820tgagctgcat ttttacagaa cagaaatgca acgcgaaagc gctattttac caacgaagaa 8880tctgtgcttc atttttgtaa aacaaaaatg caacgcgaga gcgctaattt ttcaaacaaa 8940gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca 9000aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct atttttctaa 9060caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata 9120actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc 9180ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg 9240tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat 9300actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg 9360gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt 9420ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag taatactaga 9480gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga 9540tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa 9600tgtttgtgga agcggtattc gcaatatttt agtagctcgt tacagtccgg tgcgtttttg 9660gttttttgaa agtgcgtctt cagagcgctt ttggttttca aaagcgctct gaagttccta 9720tactttctag agaataggaa cttcggaata ggaacttcaa agcgtttccg aaaacgagcg 9780cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc gcacctatat 9840ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt gtttatgctt 9900aaatgcgtac ttatatgcgt ctatttatgt aggatgaaag gtagtctagt acctcctgtg 9960atattatccc attccatgcg gggtatcgta tgcttccttc agcactaccc tttagctgtt 10020ctatatgctg ccactcctca attggattag tctcatcctt caatgctatc atttcctttg 10080atattggatc atctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 10140cacgaggccc tttcgtc 101574140DNAArabidopsis thaliana 41atttccgaag aagacctcga gatggatttg ttattgctgg 404255DNAArabidopsis thaliana 42agtagatgga gtagatggag tagatggagt agatggacaa tttctgggtt tcatg 554352DNAArabidopsis thaliana 43ccatctactc catctactcc atctactcca tctactagga ggagcggttc gg 524444DNAArabidopsis thaliana 44atcttagcta gccgcggtac cttaccatac atctctcaga tatc 444512214DNAArtificial SequenceSynthetic sequence derived from two A.thaliana genes 45tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 1860ttcgctatta cgccagctga attggagcga cctcatgcta tacctgagaa agcaacctga 1920cctacaggaa agagttactc aagaataaga attttcgttt taaaacctaa gagtcacttt 1980aaaatttgta tacacttatt ttttttataa cttatttaat aataaaaatc ataaatcata 2040agaaattcgc ttatttagaa gtgtcaacaa cgtatctacc aacgatttga cccttttcca 2100tcttttcgta aatttctggc aaggtagaca agccgacaac cttgattgga gacttgacca 2160aacctctggc gaagaattgt taattaagag ctcagatctt tagcagattg gaataggtgc 2220accattccac tctttcaagc aatccataag tggatctatc aactttccct cgcacatagc 2280tgtgaatacc ttgtcaaatt cttcacctgg gctaacgact ttttcaccag ttagtaattt 2340ggttcccaac tcttctctaa cgaatctgta caaagggtac gacctacact ctttgattct 2400atttggtata ggggcagtac catttccgta tgcggctcta gcagcttcga cttcctttgg 2460taaaactgcc ttcagttctt cttcaaaggc acctatcttt tggaatattg aagtaacggc 2520atttttctca gtttcaccat tggataaagc gtgatctaca ataacttgtc tcaatctctg 2580catcaatgga taagtagcgc tacatggatc gtcaacgtaa gtaaatactt gttctctatc 2640tacaactttt aataaatctt tttcacagaa tcttgatggg tgcaattcac cattgatacc 2700tgtagttaga accttttttg caacctgtga tacggtattt ttcactgtct gtctcaaatt 2760ctcttccaag tgtctcaaat ctacggcctg gcatataccc actaaaaatg ttgtggacat 2820taatttaagg atatcaacgg cctcgcttgt ttttcttgat gaaatcaggc ccaaagaatt 2880aacatcctga ttgtgttgtt cggctgattg tacatgagag gttactgggt tggctagata 2940ttgcagctct gaacaatagc ttgccattgc tatctcagca cctttgaaac cataatcaag 3000actagggtta gaagatgcgg tcagattcga aggcaaaccg ttattgtaga agtcattgac 3060caattcagaa aattgggcaa acattaattt gccaattgcg gctatggcaa gcctggtatt 3120atccatactg actcctatgg gtgtaccctg gaaattgcct ccatgtattg ccttattcct 3180cgacacatca ataagtggat tatcgttaac agagttgatc tctctttcta tagactttgt 3240agcttgtcta attacttcaa tttgagggcc aagccattgt ggggatgtcc ttaaagcata 3300tctatcttgt ttgggttttt gcaaagggtc catttcatga accttctggg ctaacttcat 3360gtagctagag ccgtccaaaa tgtgctccat gatagctgct gcttcaattt gtcctgggtg 3420atgttttaac ctgtgggtca agtgatcagt aaactcaggt tttccactca tgacttcggc 3480aaaaattgcg gacaaaactt cggccaaaac tgcttgtacg ttagcttcaa acaacaccat 3540ggatgccata ccgctgccga cagcggtgcc attcaccagg gctaaacctt ccttgggttg 3600caaatcaaag aaaccagttg aaataccagc tttctcaaat gcttccttag cggttaagga 3660ttctccgtct ggaccagtgg cctttgaatt aggtcttccc gttaataagc ctgcgatata 3720tgaaagggga accaaatcac cgctggcagt tattgttcct cttaagggca acgaaggaga 3780aatgttgtgg ttcaatagtg aagtgatggc ctcaagaatt tcaaacctta ttccagagta 3840accttgcaac aaagtgttca ccctaacaag catagcagct cttgttgccg attggggtaa 3900tgtatggcaa gtttcctttg tattaccgaa aataccggcg ttaaggaatc tgatcagttc 3960tgtttgcaaa gcagtgccat ttttagttct tctatgagag gtagcaccaa agcctgtggt 4020aacgccatag gaatctgtgc ccttgttcat actttccatg acccaatctg atgaagcctt 4080aactccggct ctacttgttt ctgcaagttc taccttcact gaaccgccaa cggtcgaaat 4140agcagctacc tgtcctatcg tcaatgtctc gccgcctaga tttacgactg gtcttctgta 4200ttcctcaacc atcttcttaa cttcatccag atggctacct ttcatctggt cagctgccag 4260accccaattc aaaggatctg caagagtttt tgtcgttacg gccaccttgg tcttttcacc 4320accaccgcat agcattgctt caatttggtc catgcggccg ccctttagtg agggttgaat 4380tcgaattttc aaaaattctt actttttttt tggatggacg caaagaagtt taataatcat 4440attacatggc attaccacca tatacatatc catatacata tccatatcta atcttactta 4500tatgttgtgg aaatgtaaag agccccatta tcttagccta aaaaaacctt ctctttggaa 4560ctttcagtaa tacgcttaac tgctcattgc tatattgaag tacggattag aagccgccga 4620gcgggtgaca gccctccgaa ggaagactct cctccgtgcg tcctcgtctt caccggtcgc 4680gttcctgaaa cgcagatgtg cctcgcgccg cactgctccg aacaataaag attctacaat 4740actagctttt atggttatga agaggaaaaa ttggcagtaa cctggcccca caaaccttca 4800aatgaacgaa tcaaattaac aaccatagga tgataatgcg attagttttt tagccttatt 4860tctggggtaa ttaatcagcg aagcgatgat ttttgatcta ttaacagata tataaatgca 4920aaaactgcat aaccacttta actaatactt tcaacatttt cggtttgtat tacttcttat 4980tcaaatgtaa taaaagtatc aacaaaaaat tgttaatata cctctatact ttaacgtcaa 5040ggagaaaaaa ccccggatcc gtaatacgac tcactatagg gcccgggcgt cgacatggaa 5100cagaagttga tttccgaaga agacctcgag atggatttgt tattgctgga aaagtcactt 5160attgctgtat ttgtggcagt tattctagcc acggttattt ctaaattaag aggtaagaaa 5220ctaaaactac ctcctggtcc catccccata ccaatttttg gtaattggtt gcaagtgggc 5280gatgatttga atcacagaaa tttggtagac tatgctaaga agttcggtga ccttttcttg 5340cttagaatgg gtcaaaggaa tttggtagtg gttagctcac ctgatttgac taaggaggtc 5400ttattaacgc aaggcgttga gtttggctcc agaactagaa atgttgtgtt tgatattttc 5460actggtaaag gtcaagatat ggtttttaca gtttacggtg agcactggag aaaaatgaga 5520agaatcatga ccgtaccatt ctttactaac aaggttgttc aacaaaatag agaaggttgg 5580gagtttgagg cagcttccgt agtggaagac gtaaagaaaa atccagattc ggccacaaag 5640ggtatagtac taagaaaaag actacaattg atgatgtaca acaatatgtt cagaattatg 5700tttgacagaa gatttgaaag tgaagatgac cctttgttcc tgagacttaa ggctttgaat 5760ggtgaaagat cgagattggc tcaaagtttc gaatataatt acggtgactt tattccaatc 5820ttaagaccat ttttgagagg ctatttgaaa atttgccaag acgtcaagga taggaggatc 5880gctcttttca agaagtactt tgtggacgag agaaagcaaa tagcttcttc caagcccaca 5940ggttcggaag gtttaaaatg tgcaattgat catattttag aagctgaaca aaaaggtgaa 6000attaacgaag ataatgtttt gtacattgta gaaaatatca atgtggctgc aatagaaaca 6060accttatggt caatagaatg gggtattgct gaattggtga atcacccaga aatacaatct 6120aaactgagaa acgagctaga taccgtttta ggtccaggtg tccaagttac agaacctgat 6180ttgcataagt taccctactt gcaagctgtg gttaaagaaa ccttgagatt gagaatggct 6240attcctcttc tagttcctca tatgaaccta catgatgcta aactggccgg ttatgatatt 6300ccagcagaaa gtaagatttt agtaaatgca tggtggttgg ccaacaatcc aaacagttgg 6360aaaaagcctg aagaattcag acctgaaaga ttcttcgaag aggaatctca tgttgaagcc 6420aacggaaatg acttcagata tgtacctttt ggcgttggca gaagatcgtg tccaggaata 6480atactagcct taccaatatt gggtatcaca attggtagga tggttcaaaa ttttgagttg 6540ctaccaccac ccggacaatc gaaagtcgat acttcagaga aaggaggaca attctcattg 6600catattttga atcattccat tatagtcatg aaacccagaa attgtccatc tactccatct 6660actccatcta ctccatctac taggaggagc ggttcgggca attcaaagag ggttgaacca 6720ctaaagccat tagttatcaa acctagagaa gaggaaattg acgatggaag gaagaaagtc 6780actatattct tcggcaccca aacaggtaca gctgaaggtt ttgctaaggc tctaggagaa 6840gaagcaaaag ctagatatga aaagacgaga ttcaaaattg tcgatctgga tgactatgcc 6900gccgatgatg acgaatacga agaaaaattg aagaaagaag atgtcgcatt tttcttcctt 6960gccacctacg gcgacggtga accaacagat aatgccgcaa ggttttacaa gtggtttact 7020gaaggtaatg acagaggaga atggctgaag aatttgaaat atggtgtgtt cggccttggt 7080aacagacagt acgagcattt taataaggtc gctaaggttg tagatgatat acttgttgaa 7140caaggtgctc aaaggttagt gcaggtgggc ttgggtgacg atgatcaatg tattgaagat 7200gactttactg cttggagaga agccttgtgg cctgaattag atactatcct tagagaagaa 7260ggtgacactg ctgttgctac cccctacact gcagcagtcc

tagaatatag agtctcaatc 7320catgattcag aagacgccaa attcaatgat attaacatgg ccaacggtaa cggttacacc 7380gtttttgacg cacaacatcc atacaaagct aatgttgctg ttaaaaggga acttcacacc 7440ccagaaagtg acaggtcatg tatacatttg gaatttgata tcgctggtag tggtttgact 7500tacgaaacag gtgaccatgt cggagtactt tgcgataatt tgtcagaaac tgttgatgaa 7560gctttgaggt tattggatat gtcaccagat acttacttct cattgcatgc agaaaaagaa 7620gacggaactc caatatcaag ctcgcttccc cctccattcc ctccctgtaa cttaagaaca 7680gccctaacta gatatgcttg tttactgtct tctccaaaga aaagtgcttt ggttgcattg 7740gcagcccacg catccgatcc taccgaagct gagagattaa agcatttggc ttcaccagcc 7800ggtaaagatg aatacagtaa gtgggtagtg gagagccaaa gatcgctttt agaagtgatg 7860gctgagtttc caagtgctaa acctcctctg ggtgtatttt tcgctggtgt ggccccaaga 7920ttgcagccta gattttattc catatcctca tctccaaaaa ttgccgaaac cagaattcac 7980gtgacatgtg ctctggtcta cgaaaagatg ccaacaggta ggattcacaa gggtgtctgt 8040tctacctgga tgaaaaatgc tgtaccctat gaaaaatccg aaaattgttc tagtgcacca 8100attttcgtaa gacaatctaa tttcaagtta ccaagcgatt ctaaagtacc cattattatg 8160atcggtccag gtactggttt ggccccattc agaggcttct tgcaagaaag attggcttta 8220gtggagagtg gagttgaatt gggtccttca gttttattct ttggttgtag aaacagaaga 8280atggacttta tctacgaaga agaattgcag agatttgttg aaagtggtgc attggccgaa 8340ttgagtgttg cattcagcag ggaaggtcca accaaagaat acgttcaaca caagatgatg 8400gacaaggctt ctgatatctg gaatatgatt tcccaaggtg cttatttgta tgtttgtggt 8460gacgctaaag gaatggctag agatgttcat agatcactgc atacaatcgc acaagaacaa 8520ggtagcatgg attcaacaaa agcagagggc tttgtaaaga atcttcagac aagcggtaga 8580tatctgagag atgtatggta aggtaccgcg gctagctaag atccgctcta accgaaaagg 8640aaggagttag acaacctgaa gtctaggtcc ctatttattt ttttatagtt atgttagtat 8700taagaacgtt atttatattt caaatttttc ttttttttct gtacagacgc gtgtacgcat 8760gtaacattat actgaaaacc ttgcttgaga aggttttggg acgctcgaag atccagctgc 8820attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt 8880cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 8940caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 9000caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 9060ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 9120cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 9180ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 9240tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 9300gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 9360ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 9420ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 9480gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 9540aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 9600tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 9660ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat 9720tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct 9780aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta 9840tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 9900ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac 9960gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa 10020gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 10080taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 10140tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 10200ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 10260tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 10320ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 10380tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata 10440ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 10500aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 10560actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 10620aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 10680tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg 10740aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac 10800ctgaacgaag catctgtgct tcattttgta gaacaaaaat gcaacgcgag agcgctaatt 10860tttcaaacaa agaatctgag ctgcattttt acagaacaga aatgcaacgc gaaagcgcta 10920ttttaccaac gaagaatctg tgcttcattt ttgtaaaaca aaaatgcaac gcgagagcgc 10980taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc aacgcgagag 11040cgctatttta ccaacaaaga atctatactt cttttttgtt ctacaaaaat gcatcccgag 11100agcgctattt ttctaacaaa gcatcttaga ttactttttt tctcctttgt gcgctctata 11160atgcagtctc ttgataactt tttgcactgt aggtccgtta aggttagaag aaggctactt 11220tggtgtctat tttctcttcc ataaaaaaag cctgactcca cttcccgcgt ttactgatta 11280ctagcgaagc tgcgggtgca ttttttcaag ataaaggcat ccccgattat attctatacc 11340gatgtggatt gcgcatactt tgtgaacaga aagtgatagc gttgatgatt cttcattggt 11400cagaaaatta tgaacggttt cttctatttt gtctctatat actacgtata ggaaatgttt 11460acattttcgt attgttttcg attcactcta tgaatagttc ttactacaat ttttttgtct 11520aaagagtaat actagagata aacataaaaa atgtagaggt cgagtttaga tgcaagttca 11580aggagcgaaa ggtggatggg taggttatat agggatatag cacagagata tatagcaaag 11640agatactttt gagcaatgtt tgtggaagcg gtattcgcaa tattttagta gctcgttaca 11700gtccggtgcg tttttggttt tttgaaagtg cgtcttcaga gcgcttttgg ttttcaaaag 11760cgctctgaag ttcctatact ttctagagaa taggaacttc ggaataggaa cttcaaagcg 11820tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg cgcacataca gctcactgtt 11880cacgtcgcac ctatatctgc gtgttgcctg tatatatata tacatgagaa gaacggcata 11940gtgcgtgttt atgcttaaat gcgtacttat atgcgtctat ttatgtagga tgaaaggtag 12000tctagtacct cctgtgatat tatcccattc catgcggggt atcgtatgct tccttcagca 12060ctacccttta gctgttctat atgctgccac tcctcaattg gattagtctc atccttcaat 12120gctatcattt cctttgatat tggatcatac taagaaacca ttattatcat gacattaacc 12180tataaaaata ggcgtatcac gaggcccttt cgtc 122144641DNASaccharomyces cerevisiae 46gcgagctcag tttatcatta tcaatactcg ccatttcaaa g 414746DNASaccharomyces cerevisiae 47cgtctagaat ccgtcgaaac taagttctgg tgttttaaaa ctaaaa 464844DNASaccharomyces cerevisiae 48gcgagctcat agcttcaaaa tgtttctact ccttttttac tctt 444945DNASaccharomyces cerevisiae 49cgtctagaaa acttagatta gattgctatg ctttctttct aatga 455050DNASaccharomyces cerevisiae 50ttgcgtattg ggcgctcttc cgagctcagt ttatcattat caatactcgc 505135DNASaccharomyces cerevisiae 51atggatcctc tagaatccgt cgaaactaag ttctg 355241DNASaccharomyces cerevisiae 52atgaattctc tagaaaactt agattagatt gctatgcttt c 415344DNASaccharomyces cerevisiae 53tgataatgat aaactgagct cggaagagcg cccaatacgc aaac 445441DNASaccharomyces cerevisiae 54atgaattctc tagaaaactt agattagatt gctatgcttt c 415535DNASaccharomyces cerevisiae 55atggatcctc tagaatccgt cgaaactaag ttctg 35561373DNAArtificial SequenceConstruct based on S.cerevisiae promotors 56atgaattctc tagaaaactt agattagatt gctatgcttt ctttctaatg agcaagaagt 60aaaaaaagtt gtaatagaac aagaaaaatg aaactgaaac ttgagaaatt gaagaccgtt 120tattaactta aatatcaatg ggaggtcatc gaaagagaaa aaaatcaaaa aaaaaatttt 180caagaaaaag aaacgtgata aaaattttta ttgccttttt cgacgaagaa aaagaaacga 240ggcggtctct tttttctttt ccaaaccttt agtacgggta attaacgaca ccctagagga 300agaaagaggg gaaatttagt atgctgtgct tgggtgtttt gaagtggtac ggcgatgcgc 360ggagtccgag aaaatctgga agagtaaaaa aggagtagaa acattttgaa gctatgagct 420ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc 480tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga gccggaagca 540taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt gcgttgcgct 600cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 660gcgcggggag aggcggtttg cgtattgggc gctcttccga gctcagttta tcattatcaa 720tactcgccat ttcaaagaat acgtaaataa ttaatagtag tgattttcct aactttattt 780agtcaaaaaa ttagcctttt aattctgctg taacccgtac atgcccaaaa tagggggcgg 840gttacacaga atatataaca tcgtaggtgt ctgggtgaac agtttattcc tggcatccac 900taaatataat ggagcccgct ttttaagctg gcatccagaa aaaaaaagaa tcccagcacc 960aaaatattgt tttcttcacc aaccatcagt tcataggtcc attctcttag cgcaactaca 1020gagaacaggg gcacaaacag gcaaaaaacg ggcacaacct caatggagtg atgcaacctg 1080cctggagtaa atgatgacac aaggcaattg acccacgcat gtatctatct cattttctta 1140caccttctat taccttctgc tctctctgat ttggaaaaag ctgaaaaaaa aggttgaaac 1200cagttccctg aaattattcc cctacttgac taataagtat ataaagacgg taggtattga 1260ttgtaattct gtaaatctat ttcttaaact tcttaaattc tacttttata gttagtcttt 1320tttttagttt taaaacacca gaacttagtt tcgacggatt ctagaggatc cat 13735735DNASaccharomyces cerevisiae 57atgaattctc tagaatccgt cgaaactaag ttctg 355848DNASaccharomyces cerevisiae 58atggatcctc tagaaaactt agattagatt gctatgcttt ctttctaa 485910157DNAArtificial SequenceSynthetic construct based on S.cerevisiae promoter 59tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctactg gcgcgtggag 840taaaaaggtt tggatcagga tttgcgcctt tggatgaggc actttccaga gcggtggtag 900atctttcgaa caggccgtac gcagttgtcg aacttggttt gcaaagggag aaagtaggag 960atctctcttg cgagatgatc ccgcattttc ttgaaagctt tgcagaggct agcagaatta 1020ccctccacgt tgattgtctg cgaggcaaga atgatcatca ccgtagtgag agtgcgttca 1080aggctcttgc ggttgccata agagaagcca cctcgcccaa tggtaccaac gatgttccct 1140ccaccaaagg tgttcttatg tagtgacacc gattatttaa agctgcagca tacgatatat 1200atacatgtgt atatatgtat acctatgaat gtcagtaagt atgtatacga acagtatgat 1260actgaagatg acaaggtaat gcatcattct atacgtgtca ttctgaacga ggcgcgcttt 1320ccttttttct ttttgctttt tctttttttt tctcttgaac tcgacggatc tatgcggtgt 1380gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920gatcggtgcg ggcctcttcg ctattacgcc agctgaattg gagcgacctc atgctatacc 1980tgagaaagca acctgaccta caggaaagag ttactcaaga ataagaattt tcgttttaaa 2040acctaagagt cactttaaaa tttgtataca cttatttttt ttataactta tttaataata 2100aaaatcataa atcataagaa attcgcttat ttagaagtgt caacaacgta tctaccaacg 2160atttgaccct tttccatctt ttcgtaaatt tctggcaagg tagacaagcc gacaaccttg 2220attggagact tgaccaaacc tctggcgaag aattgttaat taagagctca gatcttatcg 2280tcgtcatcct tgtaatccat cgatactagt ctagttcatt aatccatttg ctagtcttgc 2340tcttagatcc ttcctcaata tcttccctga tggagcttta ggaatagagt cagtgaagaa 2400cactttgttg attctcttat aaaacacaac ctgttttgac acgaattgct tgatttcatc 2460ttcggatata tttgaatctt tcgatctcac cacaaacgca acaggaacct caccagcatc 2520ttcttccttc atggcgacga cagcaacatc attgatttct ggatgaccta tgaggagaga 2580ctctagctca gctggagcca cttgaaatcc tttgtacttg atgagttctt tcaatctatc 2640cacaatgaaa agctcgtcgt catcatcgat aaatccgacg tctccagtgt gaagccaacc 2700atctttatcg atcgtcgatg ccgtggccaa ggggtcattg agatagcctt tcatgatttg 2760gttgccacgg atgcatattt cgccgggttt gttcctaggc aaagaatctc ctgtgtctgg 2820atcaagtatc ttcatctcgg cgttcctcac caccgtacca catgctcctg acttcactgg 2880aaacggctct ttagcaaacc ctaacgacat tgctagcacc ggacctgctt ctgtcatccc 2940atagccctga ccaagcttgg cgttaggaaa cttagcacta atagcatctt caagctcctt 3000accaagagga gctgctccag acttaaccat cctaaccgag ctcagatcat acttctccgt 3060ctccggcgac ttcgcgatag ctaaaacgat cggtggcacg accatagcca ccgtgacttt 3120acacctttgt atctgctcta acaagagagt gatttcgaac ttaggcatta tcaagatcgt 3180ggcaccaact ctgagactac agagcatgat ggagttgaga gcgtatatat ggaacatagg 3240caagacacag aggatcacgt cgtctctgtt gaagtaaaga ttcggattct cgccgtcgac 3300ttgctgcgcc acgctcgtga ctagaccttt gtgtgttagc atcactcctt tggggagacc 3360cgtcgtgccg gatgagaaag gaagcgccac gacgtcttct ggcgaaatct tctccggtat 3420tgagtccact cgtggttctt cggactgagt taactcggag aaacggaggc agttttcggg 3480gatggcgtcg gagtcggtgg tgacgatcaa aacgccgtcg ttttggaggt tcttgatttt 3540atcgacgtaa cgggattgag tgacgatgag tttcgccgcg gaggctttgg cttgtttaga 3600aatctccgcc ggagtgaaga acgggttcgc ggaggtggtg attgcgccga tgaaggaggc 3660ggcaaggaaa gtgaggacta cttcaggaga gttcgggagg aggatcatta caacgtcgtg 3720ttgcttcacg ccgaggttat gaagaccggc ggcgagtttc cgagatgtta cgtggacatc 3780ggcgtaggtg tatacttcgc cggtgggacc gttgatcaag catggcttag cggcgaactc 3840tgagatattt tcgaagatgt agtcgtggag tgggaggtgg ttagggatgt atatatcagg 3900caatctcgat cggaaaatga cgtcattact acactgtttc tgatcattct gatcattgac 3960tatcacatct tgtgtcgtca tgaattctct agaatccgtc gaaactaagt tctggtgttt 4020taaaactaaa aaaaagacta actataaaag tagaatttaa gaagtttaag aaatagattt 4080acagaattac aatcaatacc taccgtcttt atatacttat tagtcaagta ggggaataat 4140ttcagggaac tggtttcaac cttttttttc agctttttcc aaatcagaga gagcagaagg 4200taatagaagg tgtaagaaaa tgagatagat acatgcgtgg gtcaattgcc ttgtgtcatc 4260atttactcca ggcaggttgc atcactccat tgaggttgtg cccgtttttt gcctgtttgt 4320gcccctgttc tctgtagttg cgctaagaga atggacctat gaactgatgg ttggtgaaga 4380aaacaatatt ttggtgctgg gattcttttt ttttctggat gccagcttaa aaagcgggct 4440ccattatatt tagtggatgc caggaataaa ctgttcaccc agacacctac gatgttatat 4500attctgtgta acccgccccc tattttgggc atgtacgggt tacagcagaa ttaaaaggct 4560aattttttga ctaaataaag ttaggaaaat cactactatt aattatttac gtattctttg 4620aaatggcgag tattgataat gataaactga gctcggaaga gcgcccaata cgcaaaccgc 4680ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga 4740aagcgggcag tgagcgcaac gcaattaatg tgagttacct cactcattag gcaccccagg 4800ctttacactt tatgcttccg gctcctatgt tgtgtggaat tgtgagcgga taacaatttc 4860acacaggaaa cagctatgac catgattacg ccaagcgcgc aattaaccct cactaaaggg 4920aacaaaagct ggagctcata gcttcaaaat gtttctactc cttttttact cttccagatt 4980ttctcggact ccgcgcatcg ccgtaccact tcaaaacacc caagcacagc atactaaatt 5040tcccctcttt cttcctctag ggtgtcgtta attacccgta ctaaaggttt ggaaaagaaa 5100aaagagaccg cctcgtttct ttttcttcgt cgaaaaaggc aataaaaatt tttatcacgt 5160ttctttttct tgaaaatttt ttttttgatt tttttctctt tcgatgacct cccattgata 5220tttaagttaa taaacggtct tcaatttctc aagtttcagt ttcatttttc ttgttctatt 5280acaacttttt ttacttcttg ctcattagaa agaaagcata gcaatctaat ctaagttttc 5340tagaggatcc atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc 5400aaccatattg gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc 5460tgattactat ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa 5520tagaatttgt gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt 5580agaggaacat ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat 5640cataacagcc gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg 5700gggacaacca aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat 5760gccaggtgct gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt 5820tatgttgtat catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt 5880ggcagaaaat aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac 5940tttcagaggt ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga 6000tggatcttcc gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt 6060tcaattagtt tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa 6120cttgagagaa gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga 6180aaacatcgaa aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc 6240attgttttgg attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact 6300aaacttagag aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat 6360gagctctgcc tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga 6420aaaagccaca accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt 6480aacaattgag acagtggtgt tacactctgt tccaactgtc actaactaat gactcgagta 6540agcttggtac cgcggctagc taagatccgc tctaaccgaa aaggaaggag ttagacaacc 6600tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa cgttatttat 6660atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa 6720aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat gaatcggcca 6780acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 6840gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6900gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6960ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 7020cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 7080ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 7140taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 7200ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 7260ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 7320aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 7380tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 7440agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc

7500ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 7560tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 7620tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 7680cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7740aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7800atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 7860cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 7920tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 7980atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 8040taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 8100tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 8160gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 8220cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 8280cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 8340gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 8400aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 8460accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 8520ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 8580gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 8640aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 8700taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaac gaagcatctg 8760tgcttcattt tgtagaacaa aaatgcaacg cgagagcgct aatttttcaa acaaagaatc 8820tgagctgcat ttttacagaa cagaaatgca acgcgaaagc gctattttac caacgaagaa 8880tctgtgcttc atttttgtaa aacaaaaatg caacgcgaga gcgctaattt ttcaaacaaa 8940gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca 9000aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct atttttctaa 9060caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata 9120actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc 9180ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg 9240tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat 9300actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg 9360gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt 9420ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag taatactaga 9480gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga 9540tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa 9600tgtttgtgga agcggtattc gcaatatttt agtagctcgt tacagtccgg tgcgtttttg 9660gttttttgaa agtgcgtctt cagagcgctt ttggttttca aaagcgctct gaagttccta 9720tactttctag agaataggaa cttcggaata ggaacttcaa agcgtttccg aaaacgagcg 9780cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc gcacctatat 9840ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt gtttatgctt 9900aaatgcgtac ttatatgcgt ctatttatgt aggatgaaag gtagtctagt acctcctgtg 9960atattatccc attccatgcg gggtatcgta tgcttccttc agcactaccc tttagctgtt 10020ctatatgctg ccactcctca attggattag tctcatcctt caatgctatc atttcctttg 10080atattggatc atctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 10140cacgaggccc tttcgtc 101576028DNAArtificial SequenceSynthetic primer 60tcgacggatc tatgcggtgt gaaatacc 286128DNAArtificial SequenceSynthetic primer 61actctcagta caatctgctc tgatgccg 286248DNAArtificial SequenceSynthetic primer 62agagcagatt gtactgagag tcatcagagc agattgtact gagagtgc 486347DNAArtificial SequenceSynthetic primer 63cacaccgcat agatccgtcg aggattttgc cgatttcggc ctattgg 476410265DNAArtificial SequenceSynthetic construct vector 64tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtca 180tcagagcaga ttgtactgag agtgcaccat accacagctt ttcaattcaa ttcatcattt 240tttttttatt cttttttttg atttcggttt ctttgaaatt tttttgattc ggtaatctcc 300gaacagaagg aagaacgaag gaaggagcac agacttagat tggtatatat acgcatatgt 360agtgttgaag aaacatgaaa ttgcccagta ttcttaaccc aactgcacag aacaaaaacc 420tgcaggaaac gaagataaat catgtcgaaa gctacatata aggaacgtgc tgctactcat 480cctagtcctg ttgctgccaa gctatttaat atcatgcacg aaaagcaaac aaacttgtgt 540gcttcattgg atgttcgtac caccaaggaa ttactggagt tagttgaagc attaggtccc 600aaaatttgtt tactaaaaac acatgtggat atcttgactg atttttccat ggagggcaca 660gttaagccgc taaaggcatt atccgccaag tacaattttt tactcttcga agacagaaaa 720tttgctgaca ttggtaatac agtcaaattg cagtactctg cgggtgtata cagaatagca 780gaatgggcag acattacgaa tgcacacggt gtggtgggcc caggtattgt tagcggtttg 840aagcaggcgg cagaagaagt aacaaaggaa cctagaggcc ttttgatgtt agcagaattg 900tcatgcaagg gctccctatc tactggagaa tatactaagg gtactgttga cattgcgaag 960agcgacaaag attttgttat cggctttatt gctcaaagag acatgggtgg aagagatgaa 1020ggttacgatt ggttgattat gacacccggt gtgggtttag atgacaaggg agacgcattg 1080ggtcaacagt atagaaccgt ggatgatgtg gtctctacag gatctgacat tattattgtt 1140ggaagaggac tatttgcaaa gggaagggat gctaaggtag agggtgaacg ttacagaaaa 1200gcaggctggg aagcatattt gagaagatgc ggccagcaaa actaaaaaac tgtattataa 1260gtaaatgcat gtatactaaa ctcacaaatt agagcttcaa tttaattata tcagttatta 1320ccctatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggaaatt 1380gtaaacgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt 1440aaccaatagg ccgaaatcgg caaaatcctc gacggatcta tgcggtgtga aataccgcac 1500agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1560tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1620tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1680agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1740gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1800aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1860cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1920gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1980gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 2040cctcttcgct attacgccag ctgaattgga gcgacctcat gctatacctg agaaagcaac 2100ctgacctaca ggaaagagtt actcaagaat aagaattttc gttttaaaac ctaagagtca 2160ctttaaaatt tgtatacact tatttttttt ataacttatt taataataaa aatcataaat 2220cataagaaat tcgcttattt agaagtgtca acaacgtatc taccaacgat ttgacccttt 2280tccatctttt cgtaaatttc tggcaaggta gacaagccga caaccttgat tggagacttg 2340accaaacctc tggcgaagaa ttgttaatta agagctcaga tcttatcgtc gtcatccttg 2400taatccatcg atactagtct agttcattaa tccatttgct agtcttgctc ttagatcctt 2460cctcaatatc ttccctgatg gagctttagg aatagagtca gtgaagaaca ctttgttgat 2520tctcttataa aacacaacct gttttgacac gaattgcttg atttcatctt cggatatatt 2580tgaatctttc gatctcacca caaacgcaac aggaacctca ccagcatctt cttccttcat 2640ggcgacgaca gcaacatcat tgatttctgg atgacctatg aggagagact ctagctcagc 2700tggagccact tgaaatcctt tgtacttgat gagttctttc aatctatcca caatgaaaag 2760ctcgtcgtca tcatcgataa atccgacgtc tccagtgtga agccaaccat ctttatcgat 2820cgtcgatgcc gtggccaagg ggtcattgag atagcctttc atgatttggt tgccacggat 2880gcatatttcg ccgggtttgt tcctaggcaa agaatctcct gtgtctggat caagtatctt 2940catctcggcg ttcctcacca ccgtaccaca tgctcctgac ttcactggaa acggctcttt 3000agcaaaccct aacgacattg ctagcaccgg acctgcttct gtcatcccat agccctgacc 3060aagcttggcg ttaggaaact tagcactaat agcatcttca agctccttac caagaggagc 3120tgctccagac ttaaccatcc taaccgagct cagatcatac ttctccgtct ccggcgactt 3180cgcgatagct aaaacgatcg gtggcacgac catagccacc gtgactttac acctttgtat 3240ctgctctaac aagagagtga tttcgaactt aggcattatc aagatcgtgg caccaactct 3300gagactacag agcatgatgg agttgagagc gtatatatgg aacataggca agacacagag 3360gatcacgtcg tctctgttga agtaaagatt cggattctcg ccgtcgactt gctgcgccac 3420gctcgtgact agacctttgt gtgttagcat cactcctttg gggagacccg tcgtgccgga 3480tgagaaagga agcgccacga cgtcttctgg cgaaatcttc tccggtattg agtccactcg 3540tggttcttcg gactgagtta actcggagaa acggaggcag ttttcgggga tggcgtcgga 3600gtcggtggtg acgatcaaaa cgccgtcgtt ttggaggttc ttgattttat cgacgtaacg 3660ggattgagtg acgatgagtt tcgccgcgga ggctttggct tgtttagaaa tctccgccgg 3720agtgaagaac gggttcgcgg aggtggtgat tgcgccgatg aaggaggcgg caaggaaagt 3780gaggactact tcaggagagt tcgggaggag gatcattaca acgtcgtgtt gcttcacgcc 3840gaggttatga agaccggcgg cgagtttccg agatgttacg tggacatcgg cgtaggtgta 3900tacttcgccg gtgggaccgt tgatcaagca tggcttagcg gcgaactctg agatattttc 3960gaagatgtag tcgtggagtg ggaggtggtt agggatgtat atatcaggca atctcgatcg 4020gaaaatgacg tcattactac actgtttctg atcattctga tcattgacta tcacatcttg 4080tgtcgtcatg aattctctag aatccgtcga aactaagttc tggtgtttta aaactaaaaa 4140aaagactaac tataaaagta gaatttaaga agtttaagaa atagatttac agaattacaa 4200tcaataccta ccgtctttat atacttatta gtcaagtagg ggaataattt cagggaactg 4260gtttcaacct tttttttcag ctttttccaa atcagagaga gcagaaggta atagaaggtg 4320taagaaaatg agatagatac atgcgtgggt caattgcctt gtgtcatcat ttactccagg 4380caggttgcat cactccattg aggttgtgcc cgttttttgc ctgtttgtgc ccctgttctc 4440tgtagttgcg ctaagagaat ggacctatga actgatggtt ggtgaagaaa acaatatttt 4500ggtgctggga ttcttttttt ttctggatgc cagcttaaaa agcgggctcc attatattta 4560gtggatgcca ggaataaact gttcacccag acacctacga tgttatatat tctgtgtaac 4620ccgcccccta ttttgggcat gtacgggtta cagcagaatt aaaaggctaa ttttttgact 4680aaataaagtt aggaaaatca ctactattaa ttatttacgt attctttgaa atggcgagta 4740ttgataatga taaactgagc tcggaagagc gcccaatacg caaaccgcct ctccccgcgc 4800gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg 4860agcgcaacgc aattaatgtg agttacctca ctcattaggc accccaggct ttacacttta 4920tgcttccggc tcctatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca 4980gctatgacca tgattacgcc aagcgcgcaa ttaaccctca ctaaagggaa caaaagctgg 5040agctcatagc ttcaaaatgt ttctactcct tttttactct tccagatttt ctcggactcc 5100gcgcatcgcc gtaccacttc aaaacaccca agcacagcat actaaatttc ccctctttct 5160tcctctaggg tgtcgttaat tacccgtact aaaggtttgg aaaagaaaaa agagaccgcc 5220tcgtttcttt ttcttcgtcg aaaaaggcaa taaaaatttt tatcacgttt ctttttcttg 5280aaaatttttt ttttgatttt tttctctttc gatgacctcc cattgatatt taagttaata 5340aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 5400acttcttgct cattagaaag aaagcatagc aatctaatct aagttttcta gaggatccat 5460ggcatccgta gaggagttca gaaatgcaca gagggcaaaa ggtccagcaa ccatattggc 5520tattggaaca gccacccctg atcactgtgt ttatcaatct gattacgctg attactattt 5580cagagtaact aaaagtgaac atatgacaga acttaagaaa aagtttaata gaatttgtga 5640taaatctatg ataaagaaaa gatacataca tctaactgaa gaaatgttag aggaacatcc 5700aaatataggt gcatatatgg caccatcttt gaatattaga caagaaatca taacagccga 5760ggtacctaga ctaggtagag acgcagcctt gaaagcttta aaggaatggg gacaaccaaa 5820atctaagatt acacatttgg ttttctgtac aacttccggt gtcgaaatgc caggtgctga 5880ttataaacta gcaaacctat tgggattaga gacctctgtt agaagagtta tgttgtatca 5940tcaaggttgt tacgccggag gtacagtgct tagaactgct aaggatttgg cagaaaataa 6000cgccggtgct agggttttag tcgtctgcag tgaaatcact gtcgtaactt tcagaggtcc 6060atcagaagat gctctagaca gtttggtcgg acaagcattg tttggcgatg gatcttccgc 6120cgtaattgta ggcagcgatc ctgatgtgtc cattgaaaga ccactatttc aattagtttc 6180tgctgctcaa acttttattc caaattccgc cggtgccata gcaggaaact tgagagaagt 6240tggtttgact tttcatttgt ggcctaatgt cccaacctta atttcagaaa acatcgaaaa 6300atgcttaact caagcctttg acccattggg cataagcgac tggaactcat tgttttggat 6360tgctcatcca ggtggtccag caattttaga cgcagtggag gcaaaactaa acttagagaa 6420gaaaaagttg gaagctacaa gacacgttct atcagagtat ggcaacatga gctctgcctg 6480cgttttattc attctagatg agatgaggaa gaagtcttta aagggtgaaa aagccacaac 6540cggagaaggt ttagattggg gtgttctatt tggtttcggt cctggcttaa caattgagac 6600agtggtgtta cactctgttc caactgtcac taactaatga ctcgagtaag cttggtaccg 6660cggctagcta agatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt 6720ccctatttat ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt 6780tctttttttt ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga 6840gaaggttttg ggacgctcga agatccagct gcattaatga atcggccaac gcgcggggag 6900aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 6960cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 7020atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 7080taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 7140aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 7200tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 7260gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 7320cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 7380cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 7440atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 7500tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 7560ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 7620acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 7680aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 7740aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 7800tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 7860cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 7920catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 7980ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 8040aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 8100ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 8160caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 8220attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 8280agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 8340actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 8400ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 8460ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 8520gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 8580atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 8640cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 8700gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 8760gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 8820ggttccgcgc acatttcccc gaaaagtgcc acctgaacga agcatctgtg cttcattttg 8880tagaacaaaa atgcaacgcg agagcgctaa tttttcaaac aaagaatctg agctgcattt 8940ttacagaaca gaaatgcaac gcgaaagcgc tattttacca acgaagaatc tgtgcttcat 9000ttttgtaaaa caaaaatgca acgcgagagc gctaattttt caaacaaaga atctgagctg 9060catttttaca gaacagaaat gcaacgcgag agcgctattt taccaacaaa gaatctatac 9120ttcttttttg ttctacaaaa atgcatcccg agagcgctat ttttctaaca aagcatctta 9180gattactttt tttctccttt gtgcgctcta taatgcagtc tcttgataac tttttgcact 9240gtaggtccgt taaggttaga agaaggctac tttggtgtct attttctctt ccataaaaaa 9300agcctgactc cacttcccgc gtttactgat tactagcgaa gctgcgggtg cattttttca 9360agataaaggc atccccgatt atattctata ccgatgtgga ttgcgcatac tttgtgaaca 9420gaaagtgata gcgttgatga ttcttcattg gtcagaaaat tatgaacggt ttcttctatt 9480ttgtctctat atactacgta taggaaatgt ttacattttc gtattgtttt cgattcactc 9540tatgaatagt tcttactaca atttttttgt ctaaagagta atactagaga taaacataaa 9600aaatgtagag gtcgagttta gatgcaagtt caaggagcga aaggtggatg ggtaggttat 9660atagggatat agcacagaga tatatagcaa agagatactt ttgagcaatg tttgtggaag 9720cggtattcgc aatattttag tagctcgtta cagtccggtg cgtttttggt tttttgaaag 9780tgcgtcttca gagcgctttt ggttttcaaa agcgctctga agttcctata ctttctagag 9840aataggaact tcggaatagg aacttcaaag cgtttccgaa aacgagcgct tccgaaaatg 9900caacgcgagc tgcgcacata cagctcactg ttcacgtcgc acctatatct gcgtgttgcc 9960tgtatatata tatacatgag aagaacggca tagtgcgtgt ttatgcttaa atgcgtactt 10020atatgcgtct atttatgtag gatgaaaggt agtctagtac ctcctgtgat attatcccat 10080tccatgcggg gtatcgtatg cttccttcag cactaccctt tagctgttct atatgctgcc 10140actcctcaat tggattagtc tcatccttca atgctatcat ttcctttgat attggatcat 10200ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt 10260tcgtc 102656550DNASaccharomyces cerevisiae 65ttccagcaat aacaaatcca ttttgtatct agaaaactta gattagattg 506650DNASaccharomyces cerevisiae 66cattgcttca atttggtcca ttttgtatct agaatccgtc gaaactaagt 506712806DNAArtificial SequenceSynthetic vector construct 67tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa ggagaaaata ccgcatcagg

aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 1860ttcgctatta cgccagctga attggagcga cctcatgcta tacctgagaa agcaacctga 1920cctacaggaa agagttactc aagaataaga attttcgttt taaaacctaa gagtcacttt 1980aaaatttgta tacacttatt ttttttataa cttatttaat aataaaaatc ataaatcata 2040agaaattcgc ttatttagaa gtgtcaacaa cgtatctacc aacgatttga cccttttcca 2100tcttttcgta aatttctggc aaggtagaca agccgacaac cttgattgga gacttgacca 2160aacctctggc gaagaattgt taattaagag ctcagatctt tagcagattg gaataggtgc 2220accattccac tctttcaagc aatccataag tggatctatc aactttccct cgcacatagc 2280tgtgaatacc ttgtcaaatt cttcacctgg gctaacgact ttttcaccag ttagtaattt 2340ggttcccaac tcttctctaa cgaatctgta caaagggtac gacctacact ctttgattct 2400atttggtata ggggcagtac catttccgta tgcggctcta gcagcttcga cttcctttgg 2460taaaactgcc ttcagttctt cttcaaaggc acctatcttt tggaatattg aagtaacggc 2520atttttctca gtttcaccat tggataaagc gtgatctaca ataacttgtc tcaatctctg 2580catcaatgga taagtagcgc tacatggatc gtcaacgtaa gtaaatactt gttctctatc 2640tacaactttt aataaatctt tttcacagaa tcttgatggg tgcaattcac cattgatacc 2700tgtagttaga accttttttg caacctgtga tacggtattt ttcactgtct gtctcaaatt 2760ctcttccaag tgtctcaaat ctacggcctg gcatataccc actaaaaatg ttgtggacat 2820taatttaagg atatcaacgg cctcgcttgt ttttcttgat gaaatcaggc ccaaagaatt 2880aacatcctga ttgtgttgtt cggctgattg tacatgagag gttactgggt tggctagata 2940ttgcagctct gaacaatagc ttgccattgc tatctcagca cctttgaaac cataatcaag 3000actagggtta gaagatgcgg tcagattcga aggcaaaccg ttattgtaga agtcattgac 3060caattcagaa aattgggcaa acattaattt gccaattgcg gctatggcaa gcctggtatt 3120atccatactg actcctatgg gtgtaccctg gaaattgcct ccatgtattg ccttattcct 3180cgacacatca ataagtggat tatcgttaac agagttgatc tctctttcta tagactttgt 3240agcttgtcta attacttcaa tttgagggcc aagccattgt ggggatgtcc ttaaagcata 3300tctatcttgt ttgggttttt gcaaagggtc catttcatga accttctggg ctaacttcat 3360gtagctagag ccgtccaaaa tgtgctccat gatagctgct gcttcaattt gtcctgggtg 3420atgttttaac ctgtgggtca agtgatcagt aaactcaggt tttccactca tgacttcggc 3480aaaaattgcg gacaaaactt cggccaaaac tgcttgtacg ttagcttcaa acaacaccat 3540ggatgccata ccgctgccga cagcggtgcc attcaccagg gctaaacctt ccttgggttg 3600caaatcaaag aaaccagttg aaataccagc tttctcaaat gcttccttag cggttaagga 3660ttctccgtct ggaccagtgg cctttgaatt aggtcttccc gttaataagc ctgcgatata 3720tgaaagggga accaaatcac cgctggcagt tattgttcct cttaagggca acgaaggaga 3780aatgttgtgg ttcaatagtg aagtgatggc ctcaagaatt tcaaacctta ttccagagta 3840accttgcaac aaagtgttca ccctaacaag catagcagct cttgttgccg attggggtaa 3900tgtatggcaa gtttcctttg tattaccgaa aataccggcg ttaaggaatc tgatcagttc 3960tgtttgcaaa gcagtgccat ttttagttct tctatgagag gtagcaccaa agcctgtggt 4020aacgccatag gaatctgtgc ccttgttcat actttccatg acccaatctg atgaagcctt 4080aactccggct ctacttgttt ctgcaagttc taccttcact gaaccgccaa cggtcgaaat 4140agcagctacc tgtcctatcg tcaatgtctc gccgcctaga tttacgactg gtcttctgta 4200ttcctcaacc atcttcttaa cttcatccag atggctacct ttcatctggt cagctgccag 4260accccaattc aaaggatctg caagagtttt tgtcgttacg gccaccttgg tcttttcacc 4320accaccgcat agcattgctt caatttggtc cattttgtat ctagaatccg tcgaaactaa 4380gttctggtgt tttaaaacta aaaaaaagac taactataaa agtagaattt aagaagttta 4440agaaatagat ttacagaatt acaatcaata cctaccgtct ttatatactt attagtcaag 4500taggggaata atttcaggga actggtttca accttttttt tcagcttttt ccaaatcaga 4560gagagcagaa ggtaatagaa ggtgtaagaa aatgagatag atacatgcgt gggtcaattg 4620ccttgtgtca tcatttactc caggcaggtt gcatcactcc attgaggttg tgcccgtttt 4680ttgcctgttt gtgcccctgt tctctgtagt tgcgctaaga gaatggacct atgaactgat 4740ggttggtgaa gaaaacaata ttttggtgct gggattcttt ttttttctgg atgccagctt 4800aaaaagcggg ctccattata tttagtggat gccaggaata aactgttcac ccagacacct 4860acgatgttat atattctgtg taacccgccc cctattttgg gcatgtacgg gttacagcag 4920aattaaaagg ctaatttttt gactaaataa agttaggaaa atcactacta ttaattattt 4980acgtattctt tgaaatggcg agtattgata atgataaact gagctcggaa gagcgcccaa 5040tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt 5100ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttac ctcactcatt 5160aggcacccca ggctttacac tttatgcttc cggctcctat gttgtgtgga attgtgagcg 5220gataacaatt tcacacagga aacagctatg accatgatta cgccaagcgc gcaattaacc 5280ctcactaaag ggaacaaaag ctggagctca tagcttcaaa atgtttctac tcctttttta 5340ctcttccaga ttttctcgga ctccgcgcat cgccgtacca cttcaaaaca cccaagcaca 5400gcatactaaa tttcccctct ttcttcctct agggtgtcgt taattacccg tactaaaggt 5460ttggaaaaga aaaaagagac cgcctcgttt ctttttcttc gtcgaaaaag gcaataaaaa 5520tttttatcac gtttcttttt cttgaaaatt ttttttttga tttttttctc tttcgatgac 5580ctcccattga tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt 5640tcttgttcta ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta 5700atctaagttt tctagataca aaatggattt gttattgctg gaaaagtcac ttattgctgt 5760atttgtggca gttattctag ccacggttat ttctaaatta agaggtaaga aactaaaact 5820acctcctggt cccatcccca taccaatttt tggtaattgg ttgcaagtgg gcgatgattt 5880gaatcacaga aatttggtag actatgctaa gaagttcggt gaccttttct tgcttagaat 5940gggtcaaagg aatttggtag tggttagctc acctgatttg actaaggagg tcttattaac 6000gcaaggcgtt gagtttggct ccagaactag aaatgttgtg tttgatattt tcactggtaa 6060aggtcaagat atggttttta cagtttacgg tgagcactgg agaaaaatga gaagaatcat 6120gaccgtacca ttctttacta acaaggttgt tcaacaaaat agagaaggtt gggagtttga 6180ggcagcttcc gtagtggaag acgtaaagaa aaatccagat tcggccacaa agggtatagt 6240actaagaaaa agactacaat tgatgatgta caacaatatg ttcagaatta tgtttgacag 6300aagatttgaa agtgaagatg accctttgtt cctgagactt aaggctttga atggtgaaag 6360atcgagattg gctcaaagtt tcgaatataa ttacggtgac tttattccaa tcttaagacc 6420atttttgaga ggctatttga aaatttgcca agacgtcaag gataggagga tcgctctttt 6480caagaagtac tttgtggacg agagaaagca aatagcttct tccaagccca caggttcgga 6540aggtttaaaa tgtgcaattg atcatatttt agaagctgaa caaaaaggtg aaattaacga 6600agataatgtt ttgtacattg tagaaaatat caatgtggct gcaatagaaa caaccttatg 6660gtcaatagaa tggggtattg ctgaattggt gaatcaccca gaaatacaat ctaaactgag 6720aaacgagcta gataccgttt taggtccagg tgtccaagtt acagaacctg atttgcataa 6780gttaccctac ttgcaagctg tggttaaaga aaccttgaga ttgagaatgg ctattcctct 6840tctagttcct catatgaacc tacatgatgc taaactggcc ggttatgata ttccagcaga 6900aagtaagatt ttagtaaatg catggtggtt ggccaacaat ccaaacagtt ggaaaaagcc 6960tgaagaattc agacctgaaa gattcttcga agaggaatct catgttgaag ccaacggaaa 7020tgacttcaga tatgtacctt ttggcgttgg cagaagatcg tgtccaggaa taatactagc 7080cttaccaata ttgggtatca caattggtag gatggttcaa aattttgagt tgctaccacc 7140acccggacaa tcgaaagtcg atacttcaga gaaaggagga caattctcat tgcatatttt 7200gaatcattcc attatagtca tgaaacccag aaattgtcca tctactccat ctactccatc 7260tactccatct actaggagga gcggttcggg caattcaaag agggttgaac cactaaagcc 7320attagttatc aaacctagag aagaggaaat tgacgatgga aggaagaaag tcactatatt 7380cttcggcacc caaacaggta cagctgaagg ttttgctaag gctctaggag aagaagcaaa 7440agctagatat gaaaagacga gattcaaaat tgtcgatctg gatgactatg ccgccgatga 7500tgacgaatac gaagaaaaat tgaagaaaga agatgtcgca tttttcttcc ttgccaccta 7560cggcgacggt gaaccaacag ataatgccgc aaggttttac aagtggttta ctgaaggtaa 7620tgacagagga gaatggctga agaatttgaa atatggtgtg ttcggccttg gtaacagaca 7680gtacgagcat tttaataagg tcgctaaggt tgtagatgat atacttgttg aacaaggtgc 7740tcaaaggtta gtgcaggtgg gcttgggtga cgatgatcaa tgtattgaag atgactttac 7800tgcttggaga gaagccttgt ggcctgaatt agatactatc cttagagaag aaggtgacac 7860tgctgttgct accccctaca ctgcagcagt cctagaatat agagtctcaa tccatgattc 7920agaagacgcc aaattcaatg atattaacat ggccaacggt aacggttaca ccgtttttga 7980cgcacaacat ccatacaaag ctaatgttgc tgttaaaagg gaacttcaca ccccagaaag 8040tgacaggtca tgtatacatt tggaatttga tatcgctggt agtggtttga cttacgaaac 8100aggtgaccat gtcggagtac tttgcgataa tttgtcagaa actgttgatg aagctttgag 8160gttattggat atgtcaccag atacttactt ctcattgcat gcagaaaaag aagacggaac 8220tccaatatca agctcgcttc cccctccatt ccctccctgt aacttaagaa cagccctaac 8280tagatatgct tgtttactgt cttctccaaa gaaaagtgct ttggttgcat tggcagccca 8340cgcatccgat cctaccgaag ctgagagatt aaagcatttg gcttcaccag ccggtaaaga 8400tgaatacagt aagtgggtag tggagagcca aagatcgctt ttagaagtga tggctgagtt 8460tccaagtgct aaacctcctc tgggtgtatt tttcgctggt gtggccccaa gattgcagcc 8520tagattttat tccatatcct catctccaaa aattgccgaa accagaattc acgtgacatg 8580tgctctggtc tacgaaaaga tgccaacagg taggattcac aagggtgtct gttctacctg 8640gatgaaaaat gctgtaccct atgaaaaatc cgaaaattgt tctagtgcac caattttcgt 8700aagacaatct aatttcaagt taccaagcga ttctaaagta cccattatta tgatcggtcc 8760aggtactggt ttggccccat tcagaggctt cttgcaagaa agattggctt tagtggagag 8820tggagttgaa ttgggtcctt cagttttatt ctttggttgt agaaacagaa gaatggactt 8880tatctacgaa gaagaattgc agagatttgt tgaaagtggt gcattggccg aattgagtgt 8940tgcattcagc agggaaggtc caaccaaaga atacgttcaa cacaagatga tggacaaggc 9000ttctgatatc tggaatatga tttcccaagg tgcttatttg tatgtttgtg gtgacgctaa 9060aggaatggct agagatgttc atagatcact gcatacaatc gcacaagaac aaggtagcat 9120ggattcaaca aaagcagagg gctttgtaaa gaatcttcag acaagcggta gatatctgag 9180agatgtatgg taaggtaccg cggctagcta agatccgctc taaccgaaaa ggaaggagtt 9240agacaacctg aagtctaggt ccctatttat ttttttatag ttatgttagt attaagaacg 9300ttatttatat ttcaaatttt tctttttttt ctgtacagac gcgtgtacgc atgtaacatt 9360atactgaaaa ccttgcttga gaaggttttg ggacgctcga agatccagct gcattaatga 9420atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 9480actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 9540gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 9600cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 9660ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 9720ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 9780ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 9840agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 9900cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 9960aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 10020gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 10080agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 10140ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 10200cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 10260tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 10320aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 10380tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 10440atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 10500cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 10560gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 10620gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 10680tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 10740tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 10800tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 10860aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 10920atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 10980tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 11040catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 11100aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 11160tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 11220gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 11280tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 11340tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgaacga 11400agcatctgtg cttcattttg tagaacaaaa atgcaacgcg agagcgctaa tttttcaaac 11460aaagaatctg agctgcattt ttacagaaca gaaatgcaac gcgaaagcgc tattttacca 11520acgaagaatc tgtgcttcat ttttgtaaaa caaaaatgca acgcgagagc gctaattttt 11580caaacaaaga atctgagctg catttttaca gaacagaaat gcaacgcgag agcgctattt 11640taccaacaaa gaatctatac ttcttttttg ttctacaaaa atgcatcccg agagcgctat 11700ttttctaaca aagcatctta gattactttt tttctccttt gtgcgctcta taatgcagtc 11760tcttgataac tttttgcact gtaggtccgt taaggttaga agaaggctac tttggtgtct 11820attttctctt ccataaaaaa agcctgactc cacttcccgc gtttactgat tactagcgaa 11880gctgcgggtg cattttttca agataaaggc atccccgatt atattctata ccgatgtgga 11940ttgcgcatac tttgtgaaca gaaagtgata gcgttgatga ttcttcattg gtcagaaaat 12000tatgaacggt ttcttctatt ttgtctctat atactacgta taggaaatgt ttacattttc 12060gtattgtttt cgattcactc tatgaatagt tcttactaca atttttttgt ctaaagagta 12120atactagaga taaacataaa aaatgtagag gtcgagttta gatgcaagtt caaggagcga 12180aaggtggatg ggtaggttat atagggatat agcacagaga tatatagcaa agagatactt 12240ttgagcaatg tttgtggaag cggtattcgc aatattttag tagctcgtta cagtccggtg 12300cgtttttggt tttttgaaag tgcgtcttca gagcgctttt ggttttcaaa agcgctctga 12360agttcctata ctttctagag aataggaact tcggaatagg aacttcaaag cgtttccgaa 12420aacgagcgct tccgaaaatg caacgcgagc tgcgcacata cagctcactg ttcacgtcgc 12480acctatatct gcgtgttgcc tgtatatata tatacatgag aagaacggca tagtgcgtgt 12540ttatgcttaa atgcgtactt atatgcgtct atttatgtag gatgaaaggt agtctagtac 12600ctcctgtgat attatcccat tccatgcggg gtatcgtatg cttccttcag cactaccctt 12660tagctgttct atatgctgcc actcctcaat tggattagtc tcatccttca atgctatcat 12720ttcctttgat attggatcat actaagaaac cattattatc atgacattaa cctataaaaa 12780taggcgtatc acgaggccct ttcgtc 128066818DNAArtificial SequenceSynthetic primer 68tgaaataccg cacagatg 186918DNAArtificial SequenceSynthetic primer 69ctctcagtac aatctgct 187038DNAArtificial SequenceSynthetic primer 70agcagattgt actgagagga gcttggtgag cgctagga 387140DNAArtificial SequenceSynthetic primer 71catctgtgcg gtatttcacg gtattttctc cttacgcatc 407212824DNAArtificial SequenceSynthetic vector construct 72tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg gagcttggtg agcgctagga gtcactgcca 180ggtatcgttt gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt 240tctttttcta ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa 300tgattttcat tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca 360ttatcacata atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta 420aaaaatgagc aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag 480cgtattacaa atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg 540atagagcact cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa 600tcgcaagtga ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg 660gccaagcatt ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac 720catcacacca ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctaggg 780gccgtgcgtg gagtaaaaag gtttggatca ggatttgcgc ctttggatga ggcactttcc 840agagcggtgg tagatctttc gaacaggccg tacgcagttg tcgaacttgg tttgcaaagg 900gagaaagtag gagatctctc ttgcgagatg atcccgcatt ttcttgaaag ctttgcagag 960gctagcagaa ttaccctcca cgttgattgt ctgcgaggca agaatgatca tcaccgtagt 1020gagagtgcgt tcaaggctct tgcggttgcc ataagagaag ccacctcgcc caatggtacc 1080aacgatgttc cctccaccaa aggtgttctt atgtagtgac accgattatt taaagctgca 1140gcatacgata tatatacatg tgtatatatg tatacctatg aatgtcagta agtatgtata 1200cgaacagtat gatactgaag atgacaaggt aatgcatcat tctatacgtg tcattctgaa 1260cgaggcgcgc tttccttttt tctttttgct ttttcttttt ttttctcttg aactcgacgg 1320atctatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgaa attgtaaacg 1380ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat 1440aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg 1500ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc 1560gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt 1620tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag 1680cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg 1740gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc 1800ttaatgcgcc gctacagggc gcgtccattc gccattcagg ctgcgcaact gttgggaagg 1860gcgatcggtg cgggcctctt cgctattacg ccagctgaat tggagcgacc tcatgctata 1920cctgagaaag caacctgacc tacaggaaag agttactcaa gaataagaat tttcgtttta 1980aaacctaaga gtcactttaa aatttgtata cacttatttt ttttataact tatttaataa 2040taaaaatcat aaatcataag aaattcgctt atttagaagt gtcaacaacg tatctaccaa 2100cgatttgacc cttttccatc ttttcgtaaa tttctggcaa ggtagacaag ccgacaacct 2160tgattggaga cttgaccaaa cctctggcga agaattgtta attaagagct cagatcttta 2220gcagattgga ataggtgcac cattccactc tttcaagcaa tccataagtg gatctatcaa 2280ctttccctcg cacatagctg tgaatacctt gtcaaattct tcacctgggc taacgacttt 2340ttcaccagtt agtaatttgg ttcccaactc ttctctaacg aatctgtaca aagggtacga 2400cctacactct ttgattctat ttggtatagg ggcagtacca tttccgtatg cggctctagc 2460agcttcgact tcctttggta aaactgcctt cagttcttct tcaaaggcac ctatcttttg 2520gaatattgaa gtaacggcat ttttctcagt ttcaccattg gataaagcgt gatctacaat 2580aacttgtctc aatctctgca tcaatggata agtagcgcta catggatcgt caacgtaagt 2640aaatacttgt tctctatcta caacttttaa taaatctttt tcacagaatc ttgatgggtg 2700caattcacca ttgatacctg tagttagaac cttttttgca acctgtgata cggtattttt 2760cactgtctgt ctcaaattct cttccaagtg tctcaaatct acggcctggc atatacccac 2820taaaaatgtt gtggacatta atttaaggat atcaacggcc tcgcttgttt ttcttgatga 2880aatcaggccc aaagaattaa catcctgatt gtgttgttcg gctgattgta catgagaggt 2940tactgggttg gctagatatt gcagctctga acaatagctt gccattgcta tctcagcacc 3000tttgaaacca taatcaagac tagggttaga agatgcggtc agattcgaag gcaaaccgtt 3060attgtagaag tcattgacca attcagaaaa ttgggcaaac attaatttgc caattgcggc 3120tatggcaagc

ctggtattat ccatactgac tcctatgggt gtaccctgga aattgcctcc 3180atgtattgcc ttattcctcg acacatcaat aagtggatta tcgttaacag agttgatctc 3240tctttctata gactttgtag cttgtctaat tacttcaatt tgagggccaa gccattgtgg 3300ggatgtcctt aaagcatatc tatcttgttt gggtttttgc aaagggtcca tttcatgaac 3360cttctgggct aacttcatgt agctagagcc gtccaaaatg tgctccatga tagctgctgc 3420ttcaatttgt cctgggtgat gttttaacct gtgggtcaag tgatcagtaa actcaggttt 3480tccactcatg acttcggcaa aaattgcgga caaaacttcg gccaaaactg cttgtacgtt 3540agcttcaaac aacaccatgg atgccatacc gctgccgaca gcggtgccat tcaccagggc 3600taaaccttcc ttgggttgca aatcaaagaa accagttgaa ataccagctt tctcaaatgc 3660ttccttagcg gttaaggatt ctccgtctgg accagtggcc tttgaattag gtcttcccgt 3720taataagcct gcgatatatg aaaggggaac caaatcaccg ctggcagtta ttgttcctct 3780taagggcaac gaaggagaaa tgttgtggtt caatagtgaa gtgatggcct caagaatttc 3840aaaccttatt ccagagtaac cttgcaacaa agtgttcacc ctaacaagca tagcagctct 3900tgttgccgat tggggtaatg tatggcaagt ttcctttgta ttaccgaaaa taccggcgtt 3960aaggaatctg atcagttctg tttgcaaagc agtgccattt ttagttcttc tatgagaggt 4020agcaccaaag cctgtggtaa cgccatagga atctgtgccc ttgttcatac tttccatgac 4080ccaatctgat gaagccttaa ctccggctct acttgtttct gcaagttcta ccttcactga 4140accgccaacg gtcgaaatag cagctacctg tcctatcgtc aatgtctcgc cgcctagatt 4200tacgactggt cttctgtatt cctcaaccat cttcttaact tcatccagat ggctaccttt 4260catctggtca gctgccagac cccaattcaa aggatctgca agagtttttg tcgttacggc 4320caccttggtc ttttcaccac caccgcatag cattgcttca atttggtcca ttttgtatct 4380agaatccgtc gaaactaagt tctggtgttt taaaactaaa aaaaagacta actataaaag 4440tagaatttaa gaagtttaag aaatagattt acagaattac aatcaatacc taccgtcttt 4500atatacttat tagtcaagta ggggaataat ttcagggaac tggtttcaac cttttttttc 4560agctttttcc aaatcagaga gagcagaagg taatagaagg tgtaagaaaa tgagatagat 4620acatgcgtgg gtcaattgcc ttgtgtcatc atttactcca ggcaggttgc atcactccat 4680tgaggttgtg cccgtttttt gcctgtttgt gcccctgttc tctgtagttg cgctaagaga 4740atggacctat gaactgatgg ttggtgaaga aaacaatatt ttggtgctgg gattcttttt 4800ttttctggat gccagcttaa aaagcgggct ccattatatt tagtggatgc caggaataaa 4860ctgttcaccc agacacctac gatgttatat attctgtgta acccgccccc tattttgggc 4920atgtacgggt tacagcagaa ttaaaaggct aattttttga ctaaataaag ttaggaaaat 4980cactactatt aattatttac gtattctttg aaatggcgag tattgataat gataaactga 5040gctcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 5100gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 5160tgagttacct cactcattag gcaccccagg ctttacactt tatgcttccg gctcctatgt 5220tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg 5280ccaagcgcgc aattaaccct cactaaaggg aacaaaagct ggagctcata gcttcaaaat 5340gtttctactc cttttttact cttccagatt ttctcggact ccgcgcatcg ccgtaccact 5400tcaaaacacc caagcacagc atactaaatt tcccctcttt cttcctctag ggtgtcgtta 5460attacccgta ctaaaggttt ggaaaagaaa aaagagaccg cctcgtttct ttttcttcgt 5520cgaaaaaggc aataaaaatt tttatcacgt ttctttttct tgaaaatttt ttttttgatt 5580tttttctctt tcgatgacct cccattgata tttaagttaa taaacggtct tcaatttctc 5640aagtttcagt ttcatttttc ttgttctatt acaacttttt ttacttcttg ctcattagaa 5700agaaagcata gcaatctaat ctaagttttc tagatacaaa atggatttgt tattgctgga 5760aaagtcactt attgctgtat ttgtggcagt tattctagcc acggttattt ctaaattaag 5820aggtaagaaa ctaaaactac ctcctggtcc catccccata ccaatttttg gtaattggtt 5880gcaagtgggc gatgatttga atcacagaaa tttggtagac tatgctaaga agttcggtga 5940ccttttcttg cttagaatgg gtcaaaggaa tttggtagtg gttagctcac ctgatttgac 6000taaggaggtc ttattaacgc aaggcgttga gtttggctcc agaactagaa atgttgtgtt 6060tgatattttc actggtaaag gtcaagatat ggtttttaca gtttacggtg agcactggag 6120aaaaatgaga agaatcatga ccgtaccatt ctttactaac aaggttgttc aacaaaatag 6180agaaggttgg gagtttgagg cagcttccgt agtggaagac gtaaagaaaa atccagattc 6240ggccacaaag ggtatagtac taagaaaaag actacaattg atgatgtaca acaatatgtt 6300cagaattatg tttgacagaa gatttgaaag tgaagatgac cctttgttcc tgagacttaa 6360ggctttgaat ggtgaaagat cgagattggc tcaaagtttc gaatataatt acggtgactt 6420tattccaatc ttaagaccat ttttgagagg ctatttgaaa atttgccaag acgtcaagga 6480taggaggatc gctcttttca agaagtactt tgtggacgag agaaagcaaa tagcttcttc 6540caagcccaca ggttcggaag gtttaaaatg tgcaattgat catattttag aagctgaaca 6600aaaaggtgaa attaacgaag ataatgtttt gtacattgta gaaaatatca atgtggctgc 6660aatagaaaca accttatggt caatagaatg gggtattgct gaattggtga atcacccaga 6720aatacaatct aaactgagaa acgagctaga taccgtttta ggtccaggtg tccaagttac 6780agaacctgat ttgcataagt taccctactt gcaagctgtg gttaaagaaa ccttgagatt 6840gagaatggct attcctcttc tagttcctca tatgaaccta catgatgcta aactggccgg 6900ttatgatatt ccagcagaaa gtaagatttt agtaaatgca tggtggttgg ccaacaatcc 6960aaacagttgg aaaaagcctg aagaattcag acctgaaaga ttcttcgaag aggaatctca 7020tgttgaagcc aacggaaatg acttcagata tgtacctttt ggcgttggca gaagatcgtg 7080tccaggaata atactagcct taccaatatt gggtatcaca attggtagga tggttcaaaa 7140ttttgagttg ctaccaccac ccggacaatc gaaagtcgat acttcagaga aaggaggaca 7200attctcattg catattttga atcattccat tatagtcatg aaacccagaa attgtccatc 7260tactccatct actccatcta ctccatctac taggaggagc ggttcgggca attcaaagag 7320ggttgaacca ctaaagccat tagttatcaa acctagagaa gaggaaattg acgatggaag 7380gaagaaagtc actatattct tcggcaccca aacaggtaca gctgaaggtt ttgctaaggc 7440tctaggagaa gaagcaaaag ctagatatga aaagacgaga ttcaaaattg tcgatctgga 7500tgactatgcc gccgatgatg acgaatacga agaaaaattg aagaaagaag atgtcgcatt 7560tttcttcctt gccacctacg gcgacggtga accaacagat aatgccgcaa ggttttacaa 7620gtggtttact gaaggtaatg acagaggaga atggctgaag aatttgaaat atggtgtgtt 7680cggccttggt aacagacagt acgagcattt taataaggtc gctaaggttg tagatgatat 7740acttgttgaa caaggtgctc aaaggttagt gcaggtgggc ttgggtgacg atgatcaatg 7800tattgaagat gactttactg cttggagaga agccttgtgg cctgaattag atactatcct 7860tagagaagaa ggtgacactg ctgttgctac cccctacact gcagcagtcc tagaatatag 7920agtctcaatc catgattcag aagacgccaa attcaatgat attaacatgg ccaacggtaa 7980cggttacacc gtttttgacg cacaacatcc atacaaagct aatgttgctg ttaaaaggga 8040acttcacacc ccagaaagtg acaggtcatg tatacatttg gaatttgata tcgctggtag 8100tggtttgact tacgaaacag gtgaccatgt cggagtactt tgcgataatt tgtcagaaac 8160tgttgatgaa gctttgaggt tattggatat gtcaccagat acttacttct cattgcatgc 8220agaaaaagaa gacggaactc caatatcaag ctcgcttccc cctccattcc ctccctgtaa 8280cttaagaaca gccctaacta gatatgcttg tttactgtct tctccaaaga aaagtgcttt 8340ggttgcattg gcagcccacg catccgatcc taccgaagct gagagattaa agcatttggc 8400ttcaccagcc ggtaaagatg aatacagtaa gtgggtagtg gagagccaaa gatcgctttt 8460agaagtgatg gctgagtttc caagtgctaa acctcctctg ggtgtatttt tcgctggtgt 8520ggccccaaga ttgcagccta gattttattc catatcctca tctccaaaaa ttgccgaaac 8580cagaattcac gtgacatgtg ctctggtcta cgaaaagatg ccaacaggta ggattcacaa 8640gggtgtctgt tctacctgga tgaaaaatgc tgtaccctat gaaaaatccg aaaattgttc 8700tagtgcacca attttcgtaa gacaatctaa tttcaagtta ccaagcgatt ctaaagtacc 8760cattattatg atcggtccag gtactggttt ggccccattc agaggcttct tgcaagaaag 8820attggcttta gtggagagtg gagttgaatt gggtccttca gttttattct ttggttgtag 8880aaacagaaga atggacttta tctacgaaga agaattgcag agatttgttg aaagtggtgc 8940attggccgaa ttgagtgttg cattcagcag ggaaggtcca accaaagaat acgttcaaca 9000caagatgatg gacaaggctt ctgatatctg gaatatgatt tcccaaggtg cttatttgta 9060tgtttgtggt gacgctaaag gaatggctag agatgttcat agatcactgc atacaatcgc 9120acaagaacaa ggtagcatgg attcaacaaa agcagagggc tttgtaaaga atcttcagac 9180aagcggtaga tatctgagag atgtatggta aggtaccgcg gctagctaag atccgctcta 9240accgaaaagg aaggagttag acaacctgaa gtctaggtcc ctatttattt ttttatagtt 9300atgttagtat taagaacgtt atttatattt caaatttttc ttttttttct gtacagacgc 9360gtgtacgcat gtaacattat actgaaaacc ttgcttgaga aggttttggg acgctcgaag 9420atccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 9480tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 9540tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 9600aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 9660tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 9720tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 9780cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 9840agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 9900tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 9960aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 10020ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 10080cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 10140accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 10200ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 10260ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 10320gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 10380aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 10440gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 10500gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 10560cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 10620gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 10680gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 10740ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 10800tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 10860ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 10920cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 10980accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 11040cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 11100tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 11160cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 11220acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 11280atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 11340tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 11400aaagtgccac ctgaacgaag catctgtgct tcattttgta gaacaaaaat gcaacgcgag 11460agcgctaatt tttcaaacaa agaatctgag ctgcattttt acagaacaga aatgcaacgc 11520gaaagcgcta ttttaccaac gaagaatctg tgcttcattt ttgtaaaaca aaaatgcaac 11580gcgagagcgc taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc 11640aacgcgagag cgctatttta ccaacaaaga atctatactt cttttttgtt ctacaaaaat 11700gcatcccgag agcgctattt ttctaacaaa gcatcttaga ttactttttt tctcctttgt 11760gcgctctata atgcagtctc ttgataactt tttgcactgt aggtccgtta aggttagaag 11820aaggctactt tggtgtctat tttctcttcc ataaaaaaag cctgactcca cttcccgcgt 11880ttactgatta ctagcgaagc tgcgggtgca ttttttcaag ataaaggcat ccccgattat 11940attctatacc gatgtggatt gcgcatactt tgtgaacaga aagtgatagc gttgatgatt 12000cttcattggt cagaaaatta tgaacggttt cttctatttt gtctctatat actacgtata 12060ggaaatgttt acattttcgt attgttttcg attcactcta tgaatagttc ttactacaat 12120ttttttgtct aaagagtaat actagagata aacataaaaa atgtagaggt cgagtttaga 12180tgcaagttca aggagcgaaa ggtggatggg taggttatat agggatatag cacagagata 12240tatagcaaag agatactttt gagcaatgtt tgtggaagcg gtattcgcaa tattttagta 12300gctcgttaca gtccggtgcg tttttggttt tttgaaagtg cgtcttcaga gcgcttttgg 12360ttttcaaaag cgctctgaag ttcctatact ttctagagaa taggaacttc ggaataggaa 12420cttcaaagcg tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg cgcacataca 12480gctcactgtt cacgtcgcac ctatatctgc gtgttgcctg tatatatata tacatgagaa 12540gaacggcata gtgcgtgttt atgcttaaat gcgtacttat atgcgtctat ttatgtagga 12600tgaaaggtag tctagtacct cctgtgatat tatcccattc catgcggggt atcgtatgct 12660tccttcagca ctacccttta gctgttctat atgctgccac tcctcaattg gattagtctc 12720atccttcaat gctatcattt cctttgatat tggatcatac taagaaacca ttattatcat 12780gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtc 12824731596DNARhodobacter capsulatus 73atgaccctgc agtcacagac ggccaaggac tgcctcgcgc tggacggggc gctgacactt 60gtccaatgcg aggccatcgc gacacatcgc agccggattt cggtgacccc cgcgctgcgc 120gagcgctgcg cgcgggccca tgcccggctt gagcacgcca tcgccgagca gcgccacatt 180tacggcatca ccaccggctt cggcccgctg gcgaaccgtc tgatcggggc cgatcagggg 240gcggagctgc agcagaacct gatctatcat ctggccaccg gcgtcgggcc gaaactgagc 300tgggccgagg cgcgggcgtt gatgctggcg cggctcaact cgatcctgca aggcgcgtcg 360ggggcctcgc cggagacgat cgaccggatc gttgcggtgc tcaatgcggg gtttgccccc 420gaggttccgg cgcagggaac ggtgggcgcc tcgggcgatc tgaccccgct tgcgcatatg 480gtgctggcgc tgcagggacg ggggcggatg atcgacccct cgggccgcgt gcaggaggcc 540ggggcggtga tggatcggct ctgcggcggt ccgctgacgc tggcggcccg tgacgggctg 600gcgctggtga atggcacctc ggcgatgacc gcgattgcgg ccctgaccgg ggtcgaggcg 660gcgcgggcga tcgacgccgc gcttcggcac agcgcggtcc tgatggaggt cttgtccggt 720catgccgaag cctggcatcc ggctttcgca gagctgcgcc cgcatccggg gcagctgcgg 780gcgaccgagc ggctggcgca ggcgctggat ggggcggggc gggtctgtcg gaccctgacc 840gcggcgcggc ggctgaccgc cgcggatctg cggcccgaag atcatccggc gcaggatgcc 900tacagtctgc gcgtggtgcc gcaactggtc ggcgcggtct gggacacgct ggactggcac 960gatcgtgtcg tcacctgcga gctcaattcc gtcaccgaca atccgatctt tcccgagggc 1020tgcgcggtgc ccgccctgca cggcggcaat ttcatgggcg tgcatgtcgc ccttgcctcc 1080gatgcgctga acgcggcgct ggtgacgctg gcgggcctgg tcgagcgtca gatcgcccgg 1140ctgaccgacg aaaagctgaa caagggcctg cccgccttcc tgcacggggg gcaggcgggg 1200ctgcaatcgg gcttcatggg ggcgcaggtc acggcgacgg cgcttctggc ggaaatgcgg 1260gcgaatgcca cgccggtttc ggtgcagtcg ctgtcgacca atggcgccaa tcaggatgtg 1320gtctcgatgg gaacgattgc cgcgcggagg gcgcgggcgc agctgctgcc cctgtcgcag 1380atccaggcga tcctggcgct tgcccttgcc caggcgatgg atctgcttga cgaccccgag 1440gggcaggccg gatggtcgct tacggcgcgg gatctgcggg accggatccg ggcggtctcg 1500cccgggcttc gcgccgacag accgcttgcc gggcatatcg aagcggtggc acagggtctg 1560cgtcatccct ccgccgccgc cgatcccccg gcatga 159674531PRTRhodobacter capsulatus 74Met Thr Leu Gln Ser Gln Thr Ala Lys Asp Cys Leu Ala Leu Asp Gly 1 5 10 15 Ala Leu Thr Leu Val Gln Cys Glu Ala Ile Ala Thr His Arg Ser Arg 20 25 30 Ile Ser Val Thr Pro Ala Leu Arg Glu Arg Cys Ala Arg Ala His Ala 35 40 45 Arg Leu Glu His Ala Ile Ala Glu Gln Arg His Ile Tyr Gly Ile Thr 50 55 60 Thr Gly Phe Gly Pro Leu Ala Asn Arg Leu Ile Gly Ala Asp Gln Gly 65 70 75 80 Ala Glu Leu Gln Gln Asn Leu Ile Tyr His Leu Ala Thr Gly Val Gly 85 90 95 Pro Lys Leu Ser Trp Ala Glu Ala Arg Ala Leu Met Leu Ala Arg Leu 100 105 110 Asn Ser Ile Leu Gln Gly Ala Ser Gly Ala Ser Pro Glu Thr Ile Asp 115 120 125 Arg Ile Val Ala Val Leu Asn Ala Gly Phe Ala Pro Glu Val Pro Ala 130 135 140 Gln Gly Thr Val Gly Ala Ser Gly Asp Leu Thr Pro Leu Ala His Met 145 150 155 160 Val Leu Ala Leu Gln Gly Arg Gly Arg Met Ile Asp Pro Ser Gly Arg 165 170 175 Val Gln Glu Ala Gly Ala Val Met Asp Arg Leu Cys Gly Gly Pro Leu 180 185 190 Thr Leu Ala Ala Arg Asp Gly Leu Ala Leu Val Asn Gly Thr Ser Ala 195 200 205 Met Thr Ala Ile Ala Ala Leu Thr Gly Val Glu Ala Ala Arg Ala Ile 210 215 220 Asp Ala Ala Leu Arg His Ser Ala Val Leu Met Glu Val Leu Ser Gly 225 230 235 240 His Ala Glu Ala Trp His Pro Ala Phe Ala Glu Leu Arg Pro His Pro 245 250 255 Gly Gln Leu Arg Ala Thr Glu Arg Leu Ala Gln Ala Leu Asp Gly Ala 260 265 270 Gly Arg Val Cys Arg Thr Leu Thr Ala Ala Arg Arg Leu Thr Ala Ala 275 280 285 Asp Leu Arg Pro Glu Asp His Pro Ala Gln Asp Ala Tyr Ser Leu Arg 290 295 300 Val Val Pro Gln Leu Val Gly Ala Val Trp Asp Thr Leu Asp Trp His 305 310 315 320 Asp Arg Val Val Thr Cys Glu Leu Asn Ser Val Thr Asp Asn Pro Ile 325 330 335 Phe Pro Glu Gly Cys Ala Val Pro Ala Leu His Gly Gly Asn Phe Met 340 345 350 Gly Val His Val Ala Leu Ala Ser Asp Ala Leu Asn Ala Ala Leu Val 355 360 365 Thr Leu Ala Gly Leu Val Glu Arg Gln Ile Ala Arg Leu Thr Asp Glu 370 375 380 Lys Leu Asn Lys Gly Leu Pro Ala Phe Leu His Gly Gly Gln Ala Gly 385 390 395 400 Leu Gln Ser Gly Phe Met Gly Ala Gln Val Thr Ala Thr Ala Leu Leu 405 410 415 Ala Glu Met Arg Ala Asn Ala Thr Pro Val Ser Val Gln Ser Leu Ser 420 425 430 Thr Asn Gly Ala Asn Gln Asp Val Val Ser Met Gly Thr Ile Ala Ala 435 440 445 Arg Arg Ala Arg Ala Gln Leu Leu Pro Leu Ser Gln Ile Gln Ala Ile 450 455 460 Leu Ala Leu Ala Leu Ala Gln Ala Met Asp Leu Leu Asp Asp Pro Glu 465 470 475 480 Gly Gln Ala Gly Trp Ser Leu Thr Ala Arg Asp Leu Arg Asp Arg Ile 485 490 495 Arg Ala Val Ser Pro Gly Leu Arg Ala Asp Arg Pro Leu Ala Gly His 500 505 510 Ile Glu Ala Val Ala Gln Gly Leu Arg His Pro Ser Ala Ala Ala Asp 515 520 525 Pro Pro Ala 530 751596DNAArtificial SequenceSynthetic R.capsulatus gene, codon optimised for S.cerevisiae 75atgaccctgc aatctcaaac agctaaagat tgtttggctt tggatggtgc cttgacatta 60gttcaatgcg aagcgatagc aacccataga agtagaatct ctgtaacacc

agccctacgt 120gagagatgtg ctagagcaca tgctaggtta gaacatgcaa tagccgaaca gcgacacata 180tatgggataa cgacaggctt cgggccactt gctaacaggc tgatcggagc agaccagggt 240gctgaattac aacagaacct tatctaccat ttggcaaccg gagttggccc caaattatca 300tgggccgaag ccagagcttt aatgctcgct cgtttgaata gtatactaca aggtgcttct 360ggtgctagcc ctgaaacaat tgataggatc gttgcagtct taaatgccgg atttgccccg 420gaagtcccag cccaaggaac cgttggtgct tcgggtgact taactccgtt agcacacatg 480gtattagcat tgcaaggcag aggtcgtatg attgatcctt cagggagagt tcaagaagcc 540ggcgctgtca tggataggtt gtgtggaggc cctttaacat tggctgccag agatggcctc 600gccttagtaa atggtacatc tgccatgaca gctattgccg cattgaccgg tgtggaggct 660gcaagagcga ttgatgcagc gcttagacat tccgcagtct tgatggaggt cctgtcaggg 720catgctgagg cttggcaccc tgcctttgcg gaattgcgtc cgcatccagg acaattacgc 780gccactgaga ggttagctca agcattggac ggcgcaggta gagtctgccg gactcttaca 840gccgctaggc gtctaactgc agctgatctg agaccagaag atcatccagc tcaagatgca 900tattcacttc gagtagttcc tcagctggtt ggtgccgtat gggatacgtt ggattggcac 960gacagggttg tgacttgcga acttaactcc gtgaccgaca atccaatttt ccccgagggt 1020tgtgcggttc cagcactaca cggtggaaac tttatgggcg tacatgtggc actagcttct 1080gacgctttaa atgcagcgtt ggttacatta gctggtctag ttgaaaggca gattgcaaga 1140cttactgatg agaagttgaa taagggtttg cctgcttttt tgcatggagg ccaagcaggt 1200ttacaatcag gtttcatggg agctcaggtt actgctactg ctttgctagc ggaaatgaga 1260gctaacgcga ctcccgtgtc cgttcaaagc ctcagcacca atggtgcaaa tcaagacgtg 1320gtaagtatgg gtacgattgc cgcgagacga gcaagagctc aacttttacc tctgtctcaa 1380atccaagcga ttttggcact ggctcttgca caagccatgg atctcctaga cgatcctgaa 1440ggacaagccg gttggtcctt aacggcaaga gatttaagag accgtatacg ggctgtcagt 1500ccagggttgc gcgcagatag accactagcg ggtcatattg aagctgtggc tcaaggtcta 1560agacacccct cggcagctgc cgatccacct gcttaa 15967640DNARhodobacter capsulatus 76ccgctcgagc ggatgaccct gcaatctcaa acagctaaag 407730DNARhodobacter capsulatus 77gcggatcctt aagcaggtgg atcggcagct 307835DNAArabidopsis thaliana 78tgccatggca atggcgccac aagaacaagc agttt 357936DNAArabidopsis thaliana 79gcggatcccc ttcacaatcc atttgctagt tttgcc 368042DNAArabidopsis thaliana 80gacaagcttg cggccagatc tcgatcccgc gaaattaata cg 428140DNAArabidopsis thaliana 81tgctcgagtg cggcctcaca atccatttgc tagttttgcc 408234DNAVitis vinifera 82cgccatatga tggcatccgt agaggagttc agaa 348335DNAVitis vinifera 83ccggatcctc attagttagt gacagttgga acaga 358442DNAArtificial SequenceSynthetic primer 84aaggagatat acatatgatg gcatccgtag aggagttcag aa 428545DNAArtificial SequenceSynthetic primer 85ctttaccaga ctcgagtcat tagttagtga cagttggaac agagt 45

Claims

1. A method for producing an extraction solvent tolerant microorganism strain producing a metabolite comprising: (a) cultivating a starting micro-organism in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which said metabolite accumulates, said second phase comprising a first solvent component to which the micro-organism is more tolerant and a first concentration of a second solvent component to which the micro-organism is less tolerant, (b) recovering progeny micro-organism from said cultivation (a), and (c) culturing said progeny micro-organism in a said multi-phase system in which the concentration of said second solvent component is increased above said first concentration.

Images