Patent application title: PERIPHERAL GENE EXPRESSION BIOMARKERS FOR AUTISM
Inventors:
Daniel H. Geschwind (Santa Monica, CA, US)
Yuhei Nishimura (Torrance, CA, US)
Assignees:
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
IPC8 Class: AC12Q168FI
USPC Class:
506 9
Class name: Combinatorial chemistry technology: method, library, apparatus method of screening a library by measuring the ability to specifically bind a target molecule (e.g., antibody-antigen binding, receptor-ligand binding, etc.)
Publication date: 2013-08-15
Patent application number: 20130210650
Abstract:
The disclosed invention comprises methods and materials for screening
cells for genetic profiles associated with autism spectrum disorders. The
methods typically involve isolating a cell from an individual and then
observing the expression profile of one or more genes in the cell,
wherein certain expression patterns of the genes observed are associated
with autism spectrum disorders.Claims:
1. A kit comprising: a container; a primer composition contained within
said container, wherein the primer composition includes a polymerase
chain reaction (PCR) primer effective in the quantitative real time
analysis of the mRNA expression levels of one or more genes selected from
the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ
ID NO: 15, and SEQ ID NO: 16; and a pharmaceutically-acceptable buffer
composition.
2. The kit of claim 1, wherein the kit comprises a plurality of chain reaction (PCR) primers effective in the quantitative real time analysis of the mRNA expression levels of different genes selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16.
3. The kit of claim 1, further comprising a computer readable a memory storage element adapted to process and store data from one or more expression profiles.
4. The kit of claim 3, wherein the memory storage element organizes expression profile data into a format adapted for electronic comparisons with a library of expression profile data.
5. The kit of claim 2, wherein the plurality of chain reaction (PCR) primers are used to observe expression levels of at least two, three, or four of the different genes.
6. The kit of claim 5, wherein the at least two, three, or four of the different genes is selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16.
7. The kit of claim 6, wherein at least one of the at least two, three, or four of the different genes is selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16.
8. The kit of claim 1, wherein the primer composition is used to observe expression levels of at least one of the genes selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16.
9. The kit of claim 1 wherein at least two of the at least two, three, or four genes is selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16.
10. The kit of claim 1, wherein the primer is adapted to bind to mRNA expressed by a human leukocyte.
11. A method of identifying a test mammalian cell having a gene expression profile observed in individuals diagnosed with autism comprising: observing an expression profile of at least one gene selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16 in the test mammalian cell; wherein: an expression profile of a gene in the group that is at least two standard deviations from a mean expression profile of the gene in a control mammalian cell obtained from an individual not affected with autism identifies the test mammalian cell as having a gene expression profile observed in individuals diagnosed with autism; and the test mammalian cell is obtained from an individual where at least one evaluation is performed from a diagnostic procedure for autism.
12. The method of claim 11, wherein the at least one evaluation is selected from the group consisting of: (a) a Autism Diagnostic Interview (ADI-R), (b) an Autism Diagnostic Observation Schedule (ADOS), or (c) an IQ surrogate test based on Raven's Progressive Matrices.
13. The method of claim 11, wherein the at least one evaluation includes observations of restricted repetitive behaviors or speech delay.
14. The method of claim 11, wherein the at least one evaluation is performed prior to observing the expression profile of the at least one gene.
15. The method of claim 11, wherein the method is used in a diagnosis of autism.
16. The method of claim 11, wherein the method is performed on a plurality of individuals.
17. The method of claim 16, wherein expression profiles obtained from the plurality of individuals are segregated based upon a degree of standard deviation from a mean expression profile of the gene in a control mammalian cell obtained from an individual not affected with autism.
18. The method of claim 11, wherein the expression profiles of at least two, three, or four genes is observed.
19. The method of claim 11, wherein the test mammalian cell or the control mammalian cell is a leukocyte obtained from the peripheral blood.
20. The method of claim 11, wherein the test mammalian cell and the control mammalian cell are obtained from individuals who are related as siblings or as a parent and a child.
Description:
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application that claims the benefit under 35 U.S.C. §120 of U.S. patent application Ser. No. 12/467,115, filed May 15, 2009, which claims priority under Section 119(e) from U.S. Provisional Application Ser. No. 61/053,316, filed May 15, 2008, the contents of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The invention relates to methods and materials for observing gene expression profiles that are associated with conditions such as autism.
BACKGROUND OF THE INVENTION
[0004] Autism comprises a behaviorally defined spectrum of disorders characterized by impairment of social interaction, deficiency or abnormality of speech development, and limited activities and interest. To standardize the diagnosis of autism spectrum disorders (ASD), diagnostic criteria have been defined by the World Health Organization (International Classification of Diseases, 10th Revision (ICD-10), 1992) and the American Psychiatric Association (Diagnostic and Statistical Manual of Mental Disorders, 4th edition, Text Revision. Washington D.C., American Psychiatric Association, 2000 (DSM-IV)).
[0005] Genetic factors are significant determinants of autism spectrum disorders (see, e.g. Geschwind et al., (2007), Curr Opin Neurobiol, 17, 103-11). It has been shown that individuals with ASD carry chromosomal abnormality at a greater frequency than the general population (see, e.g. Veenstra-Vanderweele et al., (2004), Annu Rev Genomics Hum Genet, 5, 379-405; Vorstman et al., (2006), Mol Psychiatry, 11, 1, 18-28; Jacquemont et al. (2006), J Med Genet, 43, 843-9; Szatmari et al. (2007), Nat Genet, 39, 319-28; Sebat et al. (2007), Science, 316, 445-9). Maternally inherited duplication of 15q11-13 (dup15q) is the most common chromosomal abnormality in ASD. Over-expression of genes located in the duplicated region, including cytoplasmic FMR1 interacting protein 1 (CYFIP1), was shown in lymphoblastoid cell lines from ASD with dup15q (see, e.g. Nishimura et al. (2007), Hum Mol Genet, 16, 1682-98). A cryptic deletion at the boundary of the first exon and first intron of ataxin-2 binding protein-1 (A2BP1) was identified in a female with ASD, resulting reduced mRNA expression in the individual's lymphocytes (see, e.g. Martin et al. (2007), Am J Med Genet B Neuropsychiatr Genet). Loss of copy number of neurexin 1 (NRXN1) was identified in two females sibs with ASD but not in either parent (see, e.g. Szatmari et al. (2007), Nat Genet, 39, 319-28). Loss of copy number and decreased expression of SH3 and multiple ankyrin repeat domains 3 (SHANK3) were identified in four individuals with ASD (see, e.g. Jeffries et al., (2005), Am J Med Genet A, 137, 139-47; and Durand et al. (2007), Nat Genet, 39, 25-7). Recently, a common `C` allele in the promoter region of met proto-oncogene (MET) was shown to have strong association with ASD (see, e.g. Campbell et al., (2006), Proc Natl Acad Sci USA, 103, 16834-9). The `C` variant causes a twofold decrease in MET promoter activity. These findings suggest that dysregulation of gene expression due to variation in genomic sequence may affect susceptibility or cause ASD.
[0006] Transcriptome profiling using DNA microarray represents an efficient manner in which to uncover unanticipated relationship between gene expression alterations and neuropsychiatric diseases (see, e.g. Geschwind, D. H. (2003), Lancet Neurol, 2, 275-82; and Mirnics et al., (2006), Biol Psychiatry, 60, 163-76). Several studies have suggested that blood-derived cells can be used to identify candidate genes in neuropsychiatric diseases, including ASD. Hu et al. analyzed gene expression profiling of lymphoblastoid cells from monozygotic (MZ) twins discordant in severity of ASD (see, e.g. Hu et al., (2006), BMC Genomics, 7, 118). Several genes were differentially expressed between MZ twins, suggesting candidate genes for ASD may be differentially expressed in lymphoblastoid cells from individuals with ASD. We previously analyzed genome-wide expression profiles of lymphoblastoid cells from ASD with full mutation of FMR1 (FMR1-FM) or dup15q, each of which account for 1-2% of ASD cases in large series, and non-autistic controls (see, e.g. Nishimura et al. (2007), Hum Mol Genet, 16, 1682-98). The gene expression profiles clearly distinguished ASD from controls and separated individuals with ASD based on their genetic etiology. The expression profiles also revealed shared pathways between ASD with FMR1-FM and ASD with dup15q.
[0007] While progress in understanding genetic factors associated with autism spectrum disorders has been made, specific assays for constellations of genetic factors associated with autism spectrum disorders would be a significant benefit to medical personnel. Tests for genetic factors associated with autism spectrum disorders are valuable for the diagnosis of this syndrome, as well as useful for research on the genetic mechanisms involved in autism spectrum disorders. Moreover, while there is no known medical treatment for autism, success has been reported for early intervention with behavioral therapies. In this context, an assay would facilitate the early identification of the disease, one now typically diagnosed between ages three and five. Thus, there is a need for methods and materials that can be used to identify subjects having genetic polymorphisms associated with autism spectrum disorders.
SUMMARY OF THE INVENTION
[0008] Autism spectrum disorder is a heterogeneous condition and is likely to result from the combined effects of multiple, subtle genetic changes interacting with environmental factors. The disclosure provided herein shows that genome-wide expression profiling of lymphoblastoid cells from ASD subjects distinguishes different forms of ASD and reveals shared pathways. This disclosure identifies genes dysregulated in common among the idiopathic ASD as well as ASD with known genetic disorders. These results provide evidence that studies of gene expression in cells such as blood derived lymphoblastoid cells can be used for example in assays designed to identify and characterize specific polymorphisms associated with ASD.
[0009] The invention disclosed herein has a number of embodiments. One illustrative embodiment is a method of identifying a human cell having a gene expression profile associated with autism spectrum disorders comprising: observing an expression profile of at least one gene in the cell whose expression is shown to be dysregulated in autism spectrum disorders (e.g. one or more of the genes disclosed in the Tables below); wherein an expression profile of this gene that is at least two, three or four standard deviations from a mean expression profile of the gene in a control cell identifies the human cell as having a gene expression profile associated with autism spectrum disorders. Typically, such methods are used to facilitate the diagnosis of an autism spectrum disorder. For example, in certain embodiments of the invention, the cell examined by this method is obtained from an individual identified as being predisposed to and/or exhibiting a behavior associated with autism spectrum disorders, while the control cell is one obtained from an individual previously identified as not being predisposed to and/or exhibiting a behavior associated with autism spectrum disorders. In certain embodiments, the cell examined by this method and the control cell are obtained from individuals who are related as siblings or as a parent and a child. Typically one or more cells used in these methods are leukocytes obtained from the peripheral blood.
[0010] In illustrative methods for observing an expression profile of one or more genes, mRNA expression is observed, for example by using a using quantitative PCR (qPCR) technique. In certain embodiments of the invention, the expression profile of the genes in is observed using a microarray of polynucleotides. Alternatively, polypeptide expression is observed and quantified, for example by using an antibody specific for a polypeptide encoded by a gene whose expression is shown to be dysregulated in autism spectrum disorders (e.g. using an ELISA technique or the like). Alternatively, the expression profile of a gene is observed using a Southern blotting technique (e.g. to identify deletions and/or duplications in genomic sequences).
[0011] Embodiments of the invention include kits comprising, for example, a first container, a label on said container, and a composition contained within said container; wherein the composition includes polymerase chain reaction (PCR) primer effective in the quantitative real time analysis of the mRNA expression levels of one or more genes disclosed herein whose expression is shown to be dysregulated in autism spectrum disorders (e.g. one or more of the genes disclosed in the Tables below); the label on said container, or a package insert included in said container indicates that the composition can be used to observe expression levels of these genes in at least one type of human leukocyte; a second container comprising a pharmaceutically-acceptable buffer; and instructions for using the PCR primer to obtain an expression profile of the one or more genes. Optionally the kit comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 polymerase chain reaction (PCR) primers effective in the quantitative real time analysis of the mRNA expression levels of different genes disclosed in the Tables below.
[0012] In some embodiments of the invention, one can observe an expression profile of at least, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more genes whose expression is shown to be dysregulated in autism spectrum disorders (e.g. using microarray technologies). In certain embodiments of the invention, the method is performed on a plurality of individuals and the results are then categorized based upon similarities or differences in their gene expression profiles. Optionally, the expression profile(s) is observed and/or collected and/or stored using a computer system comprising a processor element and a memory storage element adapted to process and store data from one or more expression profiles (e.g. in a library of such profiles). In this context, certain embodiments of the invention comprise an electronically searchable library of profiles, wherein the profiles include an individual's gene expression data in combination with other diagnostic data, for example assessments of behavior associated with autism spectrum disorders.
[0013] Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 provides data showing that hierarchical clustering and principal component analysis differentiate individuals based on their etiology. ANOVA identified 293 probes with significantly different expression between autism with FMR1-FM (n=8), autism with dup(15q) (n=7) and control (n=15). The probes were subjected to hierarchical clustering and principal component analysis (PCA). A) Hierarchical clustering of the 30 individuals and genes. Each row represents an individual and each column represent one of the 293 probes. A pseudo-colored representation of the relative intensity was shown, such that a red color indicates high expression and green color low expression, with the scale shown below. Relative distance of each probe (horizontal axis) and individuals (vertical axis) are also demonstrated. B) Enlargement of the hierarchical clustering dendrogram of the sample in A). All 8 autism with FMR1-FM, 7 autism with dup(15q), and 15 controls correctly clustered within their etiological categories. The scale showed the Spearman rank correlation coefficient used to construct the dendrogram. C) PCA of the expression profile of the 293 probes from 30 individuals. Shown here were three principle components. Autism with FMR1-FM were depicted as red, autism with dup(15q) as green and control as blue. The individuals were clustered closely according to their genetic etiologies.
[0015] FIG. 2 shows differentially expressed probes identified by three different statistical methods, ANOVA, SAM and RankProd. Venn diagram showing the number of probes identified as differentially expressed between A) autism with FMR1-FM (n=8) and control (n=15) and B) autism with dup(15q) (n=7) and control (n=15). C) Overlap of the differentially expressed probes (genes) in autism with FMR1-FM and dup(15q).
[0016] FIG. 3 shows a confirmation of the differential gene expression by qRTPCR. Total RNA was extracted from lymphoblastoid cells with FMR1-FM, dup(15q) or control and qRTPCR were performed to confirm the differential expression identified by microarray analysis. A) Genes specifically dysregulated in autism with FMR1-FM or dup(15q). B) Genes commonly up-regulated in autism with FMR1-FM and dup(15q). C) Genes commonly down-regulated in autism with FMR1-FM and dup(15q). Results represent means±S.D. of each group. The mean of the value of control subjects was set as 1. P-value was calculated by Mann-Whitney U test using control (N=15) vs. autism with FMR1-FM (N=8) or autism with dup(15q) (N=7). *p<0.05, **p<0.01, ***p<0.001.
[0017] FIG. 4 shows that JAKMIP1 and GPR155 were commonly dysregulated by reduction of FMR1 and induction of CYFIP1. SH-SY5Y cells were stably transfected with i) vector expressing shRNA for control, ii) vector expressing shRNA for FMR1, iii) empty expression vector or iv) expression vector for CYFIP1. Total RNA was extracted from each and qRTPCR was performed to validate the effect of FMR1 and CYFIP1 on the expression of JAKMIP1 and GPR155. A) The expression of FMR1 was significantly reduced in SY5Y cells expressing shRNA for FMR1, whereas the expression of CYFIP1 was significantly induced in SY5Y cells over-expressing CYFIP1. B) The expression of JAKMIP1 was significantly reduced in SH-SY5Y cells expressing shRNA for FMR1 and over-expressing CYFIP1. The expression of GPR155 was significantly induced in SH-SY5Y cells expressing shRNA for FMR1 and over-expressing CYFIP1. Results represent means±S.D. of each group. The mean of the value of each control was set as 1. Significance was calculated by the Mann-Whitney U test using SH-SY5Y cells expressing shRNA for control (N=4) vs. shRNA for FMR1 (N=4) or empty expression vector (N=8) vs. expression vector for CYFIP1 (N=7). *P<0.05, **P<0.01.
[0018] FIG. 5 shows that the expression of JAKMIP1 protein was dependent on FMR1 and CYFIP1 in mouse cortex and SH-SY5Y cells. Proteins were extracted from the cortex of FMR1 WT or KO mice (A), or SH-SY5Y cells transfected with empty vector or CYFIP1 cDNA (B). Western blotting was performed to validate the effect of the reduction of FMR1 or induction of CYFIP1 on the expression of JAKMIP1 protein. The protein expression of JAKMIP1 was reduced in cortex of FMR1-KO mice (A) as well as SH-SY5Y cells transfected with shRNA for FMR1 and SH-SY5Y over-expressing CYFIP1 (B). Data shown in (A) and (B) were the representative of two independent experiments.
[0019] FIG. 6 shows that JAKMIP1 and GPR155 were dysregulated in the ASD proband in discordant male sib pairs. Total RNA was extracted from lymphoblastoid cells of 27 male sib pairs discordant for ASD and qRTPCR were performed to confirm the differential expression of JAKMIP1 and GPR155. Results represent means±S.D. of each group. The mean of the value of control subjects was set as 1. P-value was calculated by Wilcoxon rank-sum test using control (N=27) vs. ASD (N=27). *p<0.05]
[0020] FIG. 7 shows the molecular convergence of FMR1-FM, dup(15q) and idiopathic ASD. The mRNA expression profile in lymphoblastoid cells from autism with FMR1-FM or dup(15q) and control were compared using microarray analysis. 68 genes were dysregulated in both autism with FMR1-FM and dup(15q). Induction of CYFIP1 in dup(15q) is a potential molecular link between FMR1-FM and dup(15q). Among the dysregulated genes, JAKMIP1 and GPR155 were further analyzed to confirm the causal relationship between CYFIP1 and FMR1 expression and their expression in neural cells or tissue and to validate the dysregulation of these genes in lymphoblastoid cells from subjects with idiopathic ASD.
[0021] FIG. 8 shows gene networks associated with genes common to FMR1-FM and dup(15q). IPA was used to find significant networks related to the genes dysregulated in both autism with FMR1-FM and dup(15q). Three networks were identified that contained at least 10 genes. Principal functions associated with network A, B and C were cell cycle (P=5.2×10-8), cellular movement (P=1.3×10-8) and molecular transport (P=1.6×10-8), and cell-to-cell signaling and interaction (P=4.3×10-8), respectively. Genes shown in bold were among the genes commonly dysregulated in autism with FMR1-FM and dup(15q). The intensity of node color indicates the degree of up- (red) or down- (green) regulation.
[0022] FIG. 8 shows differentially expressed probes identified by microarray analysis. Venn diagram shows the number of probes differentially expressed in idiopathic ASD (N=15), ASD with FMR1-FM (N=6) and ASD with dup15q (N=7) compared with control (N=15). 124 probes, representing 92 genes were identified in common in all three forms of ASD.
[0023] FIG. 9 shows a confirmation of the differential gene expression by qPCR. Total RNA was extracted from lymphoblastoid cells from 36 male sib pairs discordant for idiopathic ASD. qPCR was performed to confirm the differential expression identified by microarray analysis. Bars indicate the mean of the values of each group. The mean of the value of control subjects was set as 0. P-value was calculated by Wilcoxon rank-sum test using control (N=39) and ASD (N=39). *P<0.05.
[0024] FIG. 10 shows gene networks associated with genes dysregulated in common among idiopathic ASD, ASD with FMR1-FM and ASD with dup15q. IPA was used to find significant networks related to the genes dysregulated in common among the three different forms of ASD. Four networks were identified that contained at least 10 genes. Principal functions associated with network A, B, C and D were cellular development, cancer, cellular development and cancer, respectively. Genes shown in bold were among the genes dysregulated in ASD.
[0025] FIG. 11 shows an embodiment of an illustrative computer system that can be used with embodiments of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0026] Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and/or parameters unless otherwise noted.
[0027] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. It must also be noted that as used herein and in the appended claims, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. All numbers recited in the specification and associated claims that refer to values that can be numerically characterized with a value other than a whole number (e.g. a number of standard deviations from a mean) are understood to be modified by the term "about".
[0028] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. Publications cited herein are cited for their disclosure prior to the filing date of the present application. Nothing here is to be construed as an admission that the inventors are not entitled to antedate the publications by virtue of an earlier priority date or prior date of invention. Further the actual publication dates may be different from those shown and require independent verification.
ILLUSTRATIVE EMBODIMENTS OF THE INVENTION
[0029] Autism is part of a spectrum of disorders including Asperger syndrome (AS) and other pervasive developmental disorders (PPD). The term "autism" is used herein according to its art accepted meaning and encompasses conditions of impaired social interaction and communication with restricted repetitive and stereotyped patterns of behavior, interests and activities present before the age of 3, to the extent that health may be impaired. AS is typically distinguished from other autistic disorders by a lack of a clinically significant delay in language development in the presence of the impaired social interaction and restricted repetitive behaviors, interests, and activities that characterize the autism-spectrum disorder (ASD). PPD-NOS (PPD, not otherwise specified) is typically used to categorize children who do not meet the strict criteria for autism but who come close, either by manifesting atypical autism or by nearly meeting the diagnostic criteria in two or three of the key areas.
[0030] In about 5 percent of autism cases, another disorder is also present (i.e. an autism-associated disorder). Nearly one-third of those with autism also show signs of epilepsy by adulthood. About 6 percent of those with autism also have tuberous sclerosis, a disorder that shares many symptoms with autism, including seizures that result from lesions, or cuts on the brain. About 25 percent of persons with autism also have some degree of mental retardation. About 2 percent of those with autism also have Fragile X syndrome, the most common inherited form of mental retardation.
[0031] The disclosure provided herein identifies genes that are observed to be Dysregulated in Autism Spectrum Disorders. In the instant disclosure, these genes are collectively referred to as "DASD genes" for purposes of convenience. Human DASD genes useful in embodiments of the invention are shown for example in Tables 1-6 below as well as the Tables found in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698 (the contents of which are incorporated by reference), disclosure which includes information such as the gene name, gene symbol, RefSeq number, and gene locus for these genes. Because the genes disclosed herein are known in the art and further because of the high level of skill possessed by artisans in this technical field, the information as disclosed herein and/or in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698 places artisans in possession of the polynucleotide and polypeptide sequences of these genes by providing them with the specific disclosure which allows them to retrieve this sequence information from library sources such as GenBank and/or UniProtKB/Swiss-Prot with only minimal effort. As is know in the art, GenBank® is the NIH genetic sequence database, an annotated collection of all publicly available DNA sequences; and UniProtKB/Swiss-Prot is a curated protein sequence database which provides a high level of annotation (e.g. technical references describing the features of these genes), a minimal level of redundancy and high level of integration with other databases. The DASD gene polynucleotide and polypeptide sequence information can be retrieved from GenBank and/or UniProtKB/Swiss-Prot library databases by, for example, querying these databases using the DASD disclosure information as provided herein and/or incorporated by reference into the instant specification (e.g. the gene name, gene symbol, gene RefSeq number, gene locus etc.).
[0032] As disclosed in detail below, this disclosure provides methods and materials that can be used in the diagnosis and treatment of autism spectrum disorders, and autism-associated disorders. In typical embodiments of the invention one observes an expression profile of at least one gene disclosed herein, wherein a dysregulated expression profile provides evidence of an autism spectrum disorder. Embodiments of invention can be used for example in the diagnosis of (including a predisposition to), and/or treatment of autism spectrum disorders such as Asperger syndrome, pervasive developmental disorder, mental retardation, speech delay, and other associated psychiatric and neurological phenomena.
[0033] The invention disclosed herein has a number of embodiments. One embodiment is a method of identifying a individual having a gene expression profile associated with autism spectrum disorders comprising: observing an expression profile of at least one DASD gene in a test cell (e.g. mRNA expression in a peripheral blood leukocyte obtained from an individual suspected of having an autism spectrum); wherein an expression profile of a DASD gene in the test cell that is at least two standard deviations from a mean expression of the DASD gene as observed in a control cell (e.g. a peripheral blood leukocyte obtained from a non-effected sibling) identifies the test cell as having a gene expression profile associated with autism spectrum disorders. In typical embodiments of the invention, the gene expression profile comprises data relating to the levels of mRNA expressed by a DASD gene in the cell. In embodiments of the invention, gene expression can be quantified using a comparison of expression in a test cell relative to a mean expression observed in a control cell. For example, in some embodiments of the invention, the expression of a DASD gene is identified as being associated with autism spectrum disorders when it is at least three, four or five standard deviations from the mean expression of the gene observed in a control cell. In related embodiments of the invention, the expression of a DASD gene is identified as being associated with autism spectrum disorders when the expression level is at least 20, 30, 40, 50, 60 or 70% above or below the expression level of that gene in a control cell.
[0034] Typically in such methods of observing an expression profile of a DASD gene, mRNA expression is observed, for example by using a using quantitative PCR (qPCR) technique. In certain embodiments of the invention, the expression profile of the DASD gene in the test cell is observed using a microarray of polynucleotides. Alternatively, DASD polypeptide expression is observed, for example by using an antibody specific for a polypeptide encoded by a DASD gene (e.g. using an ELISA technique or the like). Alternatively, the expression profile is observed using Southern blotting (e.g. to identify deletions in or duplications of DASD genomic sequences).
[0035] Autism spectrum disorder is a heterogeneous condition that appears to result from the combined effects of multiple, subtle genetic changes interacting with environmental factors. Consequently, in some embodiments of the invention, an expression profile of at least, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more DASD genes are observed in order to obtain a detailed profile of these multiple genetic changes and/or to stratify individuals into subsets of autism spectrum disorders (e.g. using microarray technologies). For example, in certain embodiments of the invention, the method is performed on a plurality of individuals and then segregated based upon similarities or differences in their gene expression profiles. Optionally, the expression profile(s) of the test mammalian cell is observed using a computer system comprising a processor element and a memory storage element adapted to process and store data from one or more expression profiles (e.g. in a library of such profiles). In this context, one embodiment of the invention comprises an electronically searchable library of profiles, wherein the profiles include individual's gene expression data in combination with other diagnostic data, for example assessments of whether the individual exhibits behavior associated with an autism spectrum disorder (e.g. behavioral test data such as that obtained in an Autism Diagnostic Interview (ADI-R)).
[0036] In typical embodiments of the invention, these methods are used to facilitate diagnosis of an autism spectrum disorder in an individual. In this context, a cell examined in the methods of the invention can be a leukocyte obtained from the peripheral blood of the individual. In certain embodiments of the invention, the test cell is obtained from an individual previously identified as exhibiting a behavior associated with autism spectrum disorders. In some embodiments of the invention, the test cell is obtained from an individual identified as having a family member previously identified as exhibiting a behavior associated with autism spectrum disorders. In typical embodiments, the control mammalian cell is obtained from an individual previously identified as not exhibiting a behavior associated with autism spectrum disorders. Embodiments of the invention include methods which perform a further diagnostic procedure for autism spectrum disorders on an individual identified as having a gene expression profile associated with autism spectrum disorders (e.g. a procedure following standard validating measures, such as the Autism Diagnostic Interview (ADI-R)). Optionally, the test mammalian cell and the control mammalian cell are obtained from individuals who are related as siblings or as a parent and a child.
[0037] Embodiments of the invention further include a kit comprising: a first container, a label on said container, and a composition contained within said container; wherein the composition includes polymerase chain reaction (PCR) primer effective in the quantitative real time analysis of the mRNA expression levels of one or more DASD genes, the label on said container, or a package insert included in said container indicates that the composition can be used to observe expression levels of one or more DASD genes in at least one type of human leukocyte; a second container comprising a pharmaceutically-acceptable buffer; and instructions for using the PCR primer to obtain an expression profile of the one or more DASD genes. Optionally the kit comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 polymerase chain reaction (PCR) primers effective in the quantitative real time analysis of the mRNA expression levels of different DASD genes.
[0038] In certain embodiments of the invention, a kit further comprises a computer readable a memory storage element adapted to process and store data from one or more expression profiles. In some of these embodiments, the memory storage element organizes expression profile data into a format adapted for electronic comparisons with a library of expression profile data.
[0039] Embodiments of the invention further comprise, for example, methods of assessing the response of a subject to a treatment of an autism spectrum disorder, or an autism-associated disorder (e.g. treatment comprising the administration of a therapeutic agent), the method comprising detecting altered DASD gene or polypeptide expression in a sample from the treated subject, the presence of the alteration being indicative of a response to the treatment.
[0040] As noted above, embodiments of the invention compare DASD gene expression in a test cell (e.g. a cell obtained from an individual suspected of having an autism spectrum disorder) with DASD gene expression in a normal cell (e.g. a cell obtained from an individual not having an autism spectrum disorder) in order to determine if the test cell exhibits altered DASD gene expression. In addition to using normal cells as a comparative sample for DASD expression, in certain situations one can also use a predetermined normative value such as a predetermined normal sequence, and/or level of DASD mRNA or polypeptide expression (see, e.g., Grever et al., J. Comp. Neurol. 1996 Dec. 9; 376(2):306-14 and U.S. Pat. No. 5,837,501) to evaluate levels of DASD expression in a given sample. The term "status" in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products. Typically, skilled artisans use a number of parameters to evaluate the condition or state of a gene and its products. These include, but are not limited to the level, sequence of and biological activity of expressed gene products (such as DASD mRNA, polynucleotides and polypeptides). In certain embodiments of the invention, the expression of a DASD gene product is characterized by observing how far the expression level of a DASD mRNA in a sample deviates from a mean expression level of that mRNA in control cells in order to obtain a statistical measure of precision. Standard deviation is a measure of the variability or dispersion of a data set, in this case, the levels of mRNA expression of selected genes. Standard deviation in this context allows determinations of how spread out a set of expression values is and how a given sample fits into such analyses. Illustrative statistical methods for determining such values can be found for example in Cui et al., Genome Biol. (2003) 4:210; Tusher et al., Proc. Natl Acad. Sci. USA (2001) 98:5116-5121; Jeffery et al., BMC Bioinformatics (2006) 7:359; and Breitling et al., FEBS Lett. (2004) 573:83-92, the contents of which are incorporated by reference.
[0041] As discussed in detail below, the status of a DASD gene can be analyzed by a number of techniques that are well known in the art. Typical protocols for evaluating the status of the DASD gene and gene products are found, for example in Ausubel et al. eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). The status of a DASD gene in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in DASD genomic sequences), Northern analysis and/or PCR analysis of DASD mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of DASD mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in expression levels of DASD proteins etc.). Detectable DASD polynucleotides include, for example, a DASD gene or fragment thereof, DASD mRNA, alternative splice variants, DASD mRNAs, and recombinant DNA or RNA molecules comprising a DASD polynucleotide.
[0042] By examining a biological sample obtained from an individual (e.g. a peripheral blood leukocyte) for evidence altered gene expression of one or more genes whose expression is dysregulated in individuals diagnosed with autism spectrum disorders, medical personnel can obtain information useful in the identification, treatment and/or management of these disorders. Typically, the methods comprise detecting in a sample from a subject the presence of altered DASD gene expression, the presence of the alteration being indicative of the presence of, or predisposition to autism, an autism spectrum disorder, or an autism-associated disorder. In this context, "altered gene expression" encompasses altered DASD mRNA and/or polypeptide levels; altered DASD polynucleotide and polypeptide sequences, altered DASD genomic DNA methylation patterns and the like, alterations that are typically absent in individuals not having an autism spectrum disorder. In such examinations, the status of one or more DASD polynucleotides and/or polypeptides in a biological sample of interest (e.g. a peripheral blood leukocyte obtained from an individual suspected of having an autism spectrum disorder) can be compared to a standard or control, for example, or to the status of the DASD polynucleotide(s) or polypeptide(s) in a corresponding normal sample (e.g. a peripheral blood leukocyte obtained from a non-effected sibling or another individual not having a autism spectrum disorder). An alteration in the status of DASD gene expression in the biological sample (as compared to a control or standardized sample and/or value) then provides evidence of an autism spectrum disorder.
[0043] As noted above, embodiments of invention provide methods that comprise for example observing the expression status of one or more DASD genes in a subject in order to obtain diagnostically and/or prognostically useful information. Such methods typically use a leukocyte obtained from a subject to assess the status of a DASD gene. The sample may be any biological sample derived from a subject, which contains nucleic acids or polypeptides. Examples of such samples include fluids, tissues, cell samples, organs, biopsies, etc. Most preferred samples are blood and other leukocyte containing tissues etc. Pre-natal diagnosis may also be performed by testing for example fetal cells or placental cells. Any biological sample from which DASD genes and/or the products of DASD genes can be isolated is suitable. The sample may be collected according to conventional techniques and used directly for diagnosis or stored. The sample may be treated prior to performing the method, in order to render or improve availability of nucleic acids and/or polypeptides for testing. Treatments include, for example, lysis (e.g., mechanical, physical, chemical, etc.), centrifugation, etc. Also, the nucleic acids and/or polypeptides may be pre-purified or enriched by conventional techniques, and/or reduced in complexity. Nucleic acids and polypeptides may also be treated with enzymes or other chemical or physical treatments to produce fragments thereof.
[0044] The isolation of biological samples from a subject which contain nucleic acids and/or polypeptides is well know in the art. For example, certain embodiments isolate leukocytes from the circulating blood in order to assess the status of DASD genes in these cells. In such embodiments, blood is typically collected from subjects into heparinized blood collection tubes by personnel trained in phlebotomy using sterile technique. The collected blood samples can be divided into aliquots and centrifuged, and the buffy coat layer can then be removed (this fraction contains the leukocytes). RNA can then be extracted using a commercial RNA purification kit (e.g. RNeasy; Qiagen, Valencia, Calif.). RNA quality can be determined, for example, with an A260/A280 ratio and capillary electrophoresis on an apparatus such as an Agilent 2100 Bioanalyzer automated analysis system (Agilent Technologies, Palo Alto, Calif.).
[0045] In typical embodiments of the invention, a sample is contacted with reagents such as probes, primers or ligands (e.g. antibodies) in order to assess the presence of altered gene expression of a DASD gene. Such methods may be performed by a wide variety of apparatuses used in the art, such as a plate, tube, well, glass, etc. In specific embodiments, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array or a specific ligand (e.g. antibody) array. The substrate may be solid or semi-solid substrate such as any support comprising glass, plastic, nylon, paper, metal, polymers and the like. The substrate may be of various forms and sizes, such as a chip, a slide, a membrane, a bead, a column, a gel, etc. The contacting may be made under any condition suitable for a complex to be formed between the reagent and the nucleic acids or polypeptides of the sample.
[0046] A wide variety of methods known in the art can be used to examine the expression of DASD polypeptides and polynucleotides in cells such as peripheral blood leukocytes. For example, certain embodiments of methods which examine DASD polynucleotides and polypeptides in such cells are analogous to those methods from well-established diagnostic assays known in the art such as those that observe the expression of biomarkers such as prostate specific antigen (PSA) polynucleotides and polypeptides. For example, just as PSA polynucleotides are used as probes (for example in Northern analysis, see, e.g., Sharief et al., Biochem. Mol. Biol. Int. 33(3):567-74(1994)) and primers (for example in PCR analysis, see, e.g., Okegawa et al., J. Urol. 163(4): 1189-1190 (2000)) to observe the presence and/or the level of PSA mRNAs in methods of monitoring PSA expression, the DASD polynucleotides identified herein can be utilized in the same way to observe DASD overexpression or underexpression or other alterations in these genes. Similarly, just as PSA polypeptides are used to generate antibodies specific for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods to monitor PSA protein expression (see, e.g., Stephan et al., Urology 55(4):560-3 (2000)) in prostate cells (see, e.g., Alanen et al., Pathol. Res. Pract. 192(3):233-7 (1996)), the DASD polypeptides described herein can be utilized to generate antibodies for use in detecting DASD expression in peripheral blood leukocytes and the like. Accordingly, the status of DASD gene products provides information useful for predicting a variety of factors including the presence of and/or susceptibility to autism spectrum disorders. As discussed in detail herein, the status of DASD gene products in patient samples can be analyzed by a variety protocols that are well known in the art including immunohistochemical analysis, the variety of Northern blotting techniques including in situ hybridization, RT-PCR analysis (e.g. quantitative RT-PCR), Western blot analysis, polynucleotide and polypeptide microarray analysis and the like.
[0047] Exemplary embodiments of the invention include methods for identifying a cell that overexpresses or underexpresses DASD polynucleotides and/or polypeptides. One such embodiment of the invention is an assay that quantifies the expression of the DASD gene in a cell by detecting the absence/presence and/or relative levels of DASD mRNA concentrations in the cell. Methods for the evaluation of particular mRNAs in cells are well known and include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled DASD riboprobes, Northern blot and related techniques) and various nucleic acid amplification assays (such as qPCR using complementary primers specific for DASD, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
[0048] Embodiments of the invention include methods for detecting a DASD mRNA in a biological sample by generating cDNA in the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using an DASD polynucleotides as sense and antisense primers to amplify DASD cDNAs therein; and detecting the presence of the amplified DASD cDNA. One exemplary PCR method that can be used in embodiments of the invention is a real-time quantitative PCR (qPCR) assay. Such real-time assays provide a large dynamic range of detection and a highly sensitive methods for determining the amount of DNA template of interest. When qPCR follows a reverse transcription reaction, it can be used to quantify RNA templates as well. In addition, qPCR makes quantification of DNA and RNA much more precise and reproducible because it relies on the analysis of PCR kinetics rather than endpoint measurements. Illustrative qPCR assays are disclosed for example in U.S. Patent Application Nos. 2006/0008809; 2003/0219788; 2006/0051787; and 2006/0099620, the contents of which are incorporated by reference.
[0049] Some embodiments of the invention can use next-generation sequencing technologies for the expression profiling of DASD genes, for example those that are commercially available from vendors such as APPLIED BIOSYSTEMS and ILLUMINA. Typically in these embodiments, one can count the number of copies of each DASD gene that is expressed in order to provide assays that quantify the expression levels of all mRNA molecules in a cell. Because such methods are based on sequencing and not hybridization, they can provide an unbiased, probe-less measurement of all mRNA molecules in a sample. Illustrative aspects of such technologies are disclosed for example in U.S. Patent No. 20080262747, the contents of which are incorporated by reference.
[0050] Another embodiment of the invention is a method of detecting DASD genes having altered copy numbers (i.e. genes having a copy numbers that is above or below the number of copies observed in cells obtained from normal individuals) and/or another chromosomal rearrangement in a biological sample by isolating genomic DNA from the sample; amplifying the isolated genomic DNA using DASD polynucleotides as sense and antisense primers; and detecting the presence of the altered DASD gene. Any number of appropriate sense and antisense probe combinations can be designed from the nucleotide sequence provided for the DASD and used for this purpose.
[0051] The invention also provides assays for detecting the presence of a DASD protein in a tissue or other biological sample and the like. Methods for detecting a DASD-related protein are also well known and include, for example, immunoprecipitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA and the like. For example, a method of detecting the presence of a DASD-related protein in a biological sample comprises first contacting the sample with a DASD antibody, a DASD-reactive fragment thereof, or a recombinant protein containing an antigen binding region of a DASD antibody; and then detecting the binding of DASD-related protein in the sample. Optionally, DASD polypeptide expression is measured in a tissue microarray.
[0052] In another embodiment of the invention, one can evaluate the status DASD nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules. These perturbations can include insertions, deletions, substitutions, duplications and the like in the coding and regulatory regions of the DASD gene. Such evaluations are useful because perturbations in the nucleotide and amino acid sequences are observed in a large number of proteins associated with a growth dysregulated phenotype (see, e.g., Marrogi et al., 1999, J. Cutan. Pathol. 26(8):369-378). For example, a mutation in the sequence of an DASD 5' or 3' regulatory enhancer and/or promoter sequence may provide evidence of dysregulated expression. Such assays therefore have diagnostic and predictive value where a mutation in DASD is indicative of dysregulated expression.
[0053] A wide variety of assays for observing perturbations in nucleotide and amino acid sequences are well known in the art. For example, the size and structure of nucleic acid or amino acid sequences of DASD gene products are observed by the Northern, Southern, Western, PCR and DNA sequencing protocols discussed herein. In addition, other methods for observing perturbations in nucleotide and amino acid sequences such as single strand conformation polymorphism analysis are well known in the art (see, e.g., U.S. Pat. Nos. 5,382,510 and 5,952,170, the contents of which are incorporated by reference).
[0054] The mutation in a DASD gene may be a single base substitution mutation resulting in an amino acid substitution, a single base substitution mutation resulting in a translational stop, an insertion mutation, a deletion mutation, or a gene rearrangement. The mutation may be located in an intron, an exon of the gene, or a promotor or other regulatory region which affects the expression of the gene. Screening for mutated nucleic acids can be accomplished by direct sequencing of nucleic acids. Nucleic acid sequences can be determined through a number of different techniques which are well known to those skilled in the art, for example by chemical or enzymatic methods. The enzymatic methods rely on the ability of DNA polymerase to extend a primer, hybridized to the template to be sequenced, until a chain-terminating nucleotide is incorporated. The most common methods utilize dideoxynucleotides. Primers may be labelled with radioactive or fluorescent labels. Various DNA polymerases are available including Klenow fragment, AMV reverse transcriptase, Thermus aquaticus DNA polymerase, and modified T7 polymerase.
[0055] Ligase chain reaction (LCR) is yet another method of screening for mutated nucleic acids. LCR can be carried out in accordance with known techniques and is especially useful to amplify, and thereby detect, single nucleotide differences between two DNA samples. In general, the reaction is carried out with two pairs of oligonucleotide probes: one pair binds to one strand of the sequence to be detected; the other pair binds to the other strand of the sequence to be detected. The reaction is carried out by, first, denaturing (e.g., separating) the strands of the sequence to be detected, then reacting the strands with the two pairs of oligonucleotide probes in the presence of a heat stable ligase so that each pair of oligonucleotide probes hybridize to target DNA and, if there is perfect complementarity at their junction, adjacent probes are ligated together. The hybridized molecules are then separated under denaturation conditions. The process is cyclically repeated until the sequence has been amplified to the desired degree. Detection may then be carried out in a manner like that described above with respect to PCR.
[0056] Southern hybridization is also an effective method of identifying differences in sequences. Hybridization conditions, such as salt concentration and temperature can be adjusted for the sequence to be screened. Southern blotting and hybridizations protocols are described in Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscience), pages 2.9.1-2.9.10. Probes can be labelled for hybridization with random oligomers (primarily 9-mers) and the Klenow fragment of DNA polymerase. Very high specific activity probe can be obtained using commercially available kits such as the Ready-To-Go DNA Labelling Beads (Pharmacia Biotech), following the manufacturer's protocol. Briefly, 25 ng of DNA (probe) is labelled with 32P-dCTP in a 15 minute incubation at 37° C. Labelled probe is then purified over a ChromaSpin (Clontech) nucleic acid purification column.
[0057] Determinations of the presence of the polymorphic form of a DASD protein can also be carried out, for example, by isoelectric focusing, protein sizing, or immunoassay. In an immunoassay, an antibody that selectively binds to the mutated protein can be utilized (for example, an antibody that selectively binds to the mutated form of DASD encoded protein). Such methods for isoelectric focusing and immunoassay are well known in the art. For example, changes resulting in amino acid substitutions, where the substituted amino acid has a different charge than the original amino acid, can be detected by isoelectric focusing. Isoelectric focusing of the polypeptide through a gel having an ampholine gradient at high voltages separates proteins by their pI. The pH gradient gel can be compared to a simultaneously run gel containing the wild-type protein. Protein sizing techniques such as protein electrophoresis and sizing chromatography can also be used to detect changes in the size of the product.
[0058] As an alternative to isoelectric focusing or protein sizing, the step of determining the presence of the mutated polypeptides in a sample may be carried out by an antibody assay with an antibody which selectively binds to the mutated polypeptides (i.e., an antibody which binds to the mutated polypeptides but exhibits essentially no binding to the wild-type polypeptide without the polymorphism in the same binding conditions). Antibodies used to selectively bind the products of the mutated genes can be produced by any suitable technique. For example, monoclonal antibodies may be produced in a hybridoma cell line according to the techniques of Kohler and Milstein, Nature, 265, 495 (1975), which is hereby incorporated by reference. A hybridoma is an immortalized cell line which is capable of secreting a specific monoclonal antibody. The mutated products of genes which are associated with autism may be obtained from a human patient, purified, and used as the immunogen for the production of monoclonal or polyclonal antibodies. Purified polypeptides may be produced by recombinant means to express a biologically active isoform, or even an immunogenic fragment thereof may be used as an immunogen. Monoclonal Fab fragments may be produced in Escherichia coli from the known sequences by recombinant techniques known to those skilled in the art.
[0059] Additionally, one can examine the methylation status of the DASD gene in a biological sample. Aberrant demethylation and/or hypermethylation of CpG islands in gene 5' regulatory regions frequently occurs in immortalized and transformed cells, and can result in altered expression of various genes. For example, promoter hypermethylation of the pi-class glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al., Am. J. Pathol. 155(6): 1985-1992 (1999)). A variety of assays for examining methylation status of a gene are well known in the art. For example, one can utilize, in Southern hybridization approaches, methylation-sensitive restriction enzymes which cannot cleave sequences that contain methylated CpG sites to assess the methylation status of CpG islands. In addition, MSP (methylation specific PCR) can rapidly profile the methylation status of all the CpG sites present in a CpG island of a given gene. This procedure involves initial modification of DNA by sodium bisulfite (which will convert all unmethylated cytosines to uracil) followed by amplification using primers specific for methylated versus unmethylated DNA. Protocols involving methylation interference can also be found for example in Current Protocols In Molecular Biology, Unit 12, Frederick M. Ausubel et al. eds., 1995.
[0060] Embodiments of the invention include compositions that can be used for example in various methods disclosed herein. Compositions useful in the methods disclosed herein typically include for example one or more DASD nucleic acid molecules designed for use as a probe such as a PCR primer in a method used to monitor DASD mRNAs or genomic sequences in a cell. Optionally, the probe or primer has 8, 9, 19, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides that are complementary to a DASD mRNA. In certain embodiments, the probe or primer comprises 5-25 heterologous polynucleotide sequences (e.g. to facilitate cloning). Typically, the probe or primer will hybridize to the DASD mRNA under "stringent conditions" i.e. those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50° C.; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.; or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC (sodium chloride/sodium. citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1×SSC containing EDTA at 55° C.
[0061] Specifically contemplated nucleic acid related embodiments of the invention disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules, as well as nucleic acid molecules based on an alternative backbone, or including alternative bases, whether derived from natural sources or synthesized, and include molecules capable of inhibiting the RNA or protein expression of DASD. For example, antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, that specifically bind DNA or RNA in a base pair-dependent manner. Compositions of the invention include one or more antibodies that bind DASD and which can be used as a probe to monitor DASD polypeptide expression in a cell. A skilled artisan can readily prepare these polynucleotide and polypeptide compounds using the DASD polynucleotides and polynucleotide sequences and associated information that is disclosed herein.
[0062] For use in the methods described above, kits are also provided by the invention. Such kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method. For example, one of the container means may comprise a probe that is or can be detectably labeled. Such probe may be an antibody or polynucleotide specific for DASD protein or DASD gene or message, respectively. Where the kit utilizes nucleic acid hybridization to detect the target nucleic acid, the kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
[0063] The kits of the invention have a number of embodiments. A typical embodiment is a kit comprising a container, a label on the container, and a composition contained within the container; wherein the composition includes: (1) a polynucleotide that hybridizes to a complement of the DASD polynucleotide and/or (2) an antibody that binds the DASD polypeptide, the label on the container indicates that the composition can be used to evaluate the expression level of the DASD gene product in at least one type of mammalian cell (e.g. a human peripheral blood leukocyte), and instructions for using the DASD polynucleotide or antibody for evaluating the presence of DASD RNA, DNA or protein in at least one type of mammalian cell.
[0064] Autism is a heterogeneous condition and is likely to result from the combined effects of multiple, genetic changes including copy number variations and single nucleotide polymorphisms, interacting with environmental factors (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; and Muhle et al., (2004) Pediatrics, 113, e472-486). Classifications such as a computer based hierarchy of autistic patients based on genotypic and phenotypic information is one effective way to identify more homogeneous subgroups and hasten the identification of genes underlying autism (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; and Muhle et al., (2004) Pediatrics, 113, e472-486). About 3% of autistic children have either FMR1-FM or dup(15q), thus comprising more homogeneous populations with a single major genetic etiology for their autism.
[0065] In this context, embodiments of the invention further provides methods of obtaining a gene expression profile associated with autism spectrum disorders and methods of generating a database, or collection, of such profiles. The methods generally involve observing a gene expression profile associated with autism spectrum disorders, storing the data on a computer readable medium (CRM), and linking the data with at least one additional data point such as an individual identifying code and/or familial genetic information and/or the presence or absence of other phenomena (e.g. behavioral phenomena) associated with autism spectrum disorders such as Asperger syndrome, pervasive developmental disorder, mental retardation, speech delay, and other associated psychiatric and neurological phenomena. The profile having this information is then recorded on a CRM.
[0066] Computer related embodiments of the invention disclosed herein can be performed for example, using one of the many computer systems known in the art. For example, embodiments of the invention can include a searchable database library comprising a plurality of cell profiles recorded on a computer readable medium, each of the profiles comprising further information such as identifying codes and/or familial relationships and/or gene expression and/or behavioral phenomena associated with autism spectrum disorders. In this context, one can then use this library of gene expression and behavioral data to, for example, classify and/or examine etiological subsets of autism as well as to explore the pathophysiology of this condition. In one embodiment of the invention, data obtained from a new test sample is compared to data in such a library in order to, for example, find similar comparative profiles in the library from which diagnostic and/or prognostic information can be inferred. FIG. 11 illustrates an exemplary generalized computer system 202 that can be used to implement elements the present invention. The computer 202 typically comprises a general purpose hardware processor 204A and/or a special purpose hardware processor 204B (hereinafter alternatively collectively referred to as processor 204) and a memory 206, such as random access memory (RAM). The computer 202 may be coupled to other devices, including input/output (I/O) devices such as a keyboard 214, a mouse device 216 and a printer 228.
[0067] In one embodiment, the computer 202 operates by the general purpose processor 204A performing instructions defined by the computer program 210 under control of an operating system 208. The computer program 210 and/or the operating system 208 may be stored in the memory 206 and may interface with the user and/or other devices to accept input and commands and, based on such input and commands and the instructions defined by the computer program 210 and operating system 208 to provide output and results. Output/results may be presented on the display 222 or provided to another device for presentation or further processing or action. In one embodiment, the display 222 comprises a liquid crystal display (LCD) having a plurality of separately addressable liquid crystals. Each liquid crystal of the display 222 changes to an opaque or translucent state to form a part of the image on the display in response to the data or information generated by the processor 204 from the application of the instructions of the computer program 210 and/or operating system 208 to the input and commands. The image may be provided through a graphical user interface (GUI) module 218A. Although the GUI module 218A is depicted as a separate module, the instructions performing the GUI functions can be resident or distributed in the operating system 208, the computer program 210, or implemented with special purpose memory and processors.
[0068] Some or all of the operations performed by the computer 202 according to the computer program 210 instructions may be implemented in a special purpose processor 204B. In this embodiment, some or all of the computer program 210 instructions may be implemented via firmware instructions stored in a read only memory (ROM), a programmable read only memory (PROM) or flash memory in within the special purpose processor 204B or in memory 206. The special purpose processor 204B may also be hardwired through circuit design to perform some or all of the operations to implement the present invention. Further, the special purpose processor 204B may be a hybrid processor, which includes dedicated circuitry for performing a subset of functions, and other circuits for performing more general functions such as responding to computer program instructions. In one embodiment, the special purpose processor is an application specific integrated circuit (ASIC).
[0069] The computer 202 may also implement a compiler 212 which allows an application program 210 written in a programming language such as COBOL, C++, FORTRAN, or other language to be translated into processor 204 readable code. After completion, the application or computer program 210 accesses and manipulates data accepted from I/O devices and stored in the memory 206 of the computer 202 using the relationships and logic that was generated using the compiler 212. The computer 202 also optionally comprises an external communication device such as a modem, satellite link, Ethernet card, or other device for accepting input from and providing output to other computers.
[0070] In one embodiment, instructions implementing the operating system 208, the computer program 210, and the compiler 212 are tangibly embodied in a computer-readable medium, e.g., data storage device 220, which could include one or more fixed or removable data storage devices, such as a zip drive, floppy disc drive 224, hard drive, CD-ROM drive, tape drive, etc. Further, the operating system 208 and the computer program 210 are comprised of computer program instructions which, when accessed, read and executed by the computer 202, causes the computer 202 to perform the steps necessary to implement and/or use the present invention or to load the program of instructions into a memory, thus creating a special purpose data structure causing the computer to operate as a specially programmed computer executing the method steps described herein. Computer program 210 and/or operating instructions may also be tangibly embodied in memory 206 and/or data communications devices 230, thereby making a computer program product or article of manufacture according to the invention. As such, the terms "article of manufacture," "program storage device" and "computer program product" as used herein are intended to encompass a computer program accessible from any computer readable device or media.
[0071] Of course, those skilled in the art will recognize that any combination of the above components, or any number of different components, peripherals, and other devices, may be used with the computer 202. Although the term "user computer" is referred to herein, it is understood that a user computer 102 may include portable devices such as medication infusion pumps, analyte sensing apparatuses, cellphones, notebook computers, pocket computers, or any other device with suitable processing, communication, and input/output capability.
[0072] Yet another embodiment of this invention comprises a method of screening for a compound that modulates DASD protein expression comprising the steps of contacting a cell that expresses an endogenous or exogenous DASD protein with one or more compounds and then determining if the one or more compounds modulates DASD protein expression in the cell (e.g. by qPCR techniques practiced on the cell in the presence and absence of the one or more compounds). Another embodiment of this invention comprises a method of screening for a compound that interacts with an DASD protein comprising the steps of contacting one or more compounds with the DASD protein, and then determining if a compound interacts with the DASD protein (e.g. by binding techniques that separating compounds that interact with the DASD protein from compounds that do not). This embodiment of the invention can be used for example to screen chemical libraries for compounds which modulate, e.g., inhibit, antagonize, or agonize or mimic, the expression of a DASD as measured by one of the assays disclosed herein. The chemical libraries can be peptide libraries, peptidomimetic libraries, chemically synthesized libraries, recombinant, e.g., phage display libraries, and in vitro translation-based libraries, other non-peptide synthetic organic libraries. Exemplary libraries are commercially available from several sources (e.g. e, Tripos/PanLabs, ChemDesign, Pharmacopoeia). Typical peptide libraries and screening methods that can be used to identify compounds that modulate the expression of and/or interact with DASD protein sequences are disclosed for example in U.S. Pat. Nos. 5,723,286 and 5,733,731, the contents of which are incorporated by reference.
[0073] Various aspects of the invention are further described and illustrated by way of the examples that follow, none of which are intended to limit the scope of the invention. Certain disclosure in the examples below can be found in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated by reference. In addition, certain methods and materials used in embodiments of the invention can be those found for example n U.S. Patent Application Nos. 2002/0155450; 2006/0141519; 2007/0134664; and 2009/0011414, the contents of which are incorporated by reference.
EXAMPLES
Example 1
Genome-Wide Expression Profiling of Lymphoblastoid Cell Lines Distinguishes Different Forms of Autism and Reveals Shared Pathways
[0074] Autism is a heterogeneous condition that is likely to result from the combined effects of multiple genetic factors interacting with environmental factors. Given its complexity, the study of autism associated with Mendelian single gene disorders or known chromosomal etiologies provides an important perspective. We used microarray analysis to compare the mRNA expression profile in lymphoblastoid cells from males with autism due to a Fragile X mutation (FMR1-FM), or a 15q11-q13 duplication (dup(15q)), and non-autistic controls. We were able to clearly distinguish autism from controls and separate individuals with autism based on their genetic etiology. Sixty-eight genes were dysregulated in common between autism with FMR1-FM and dup(15q). We identified a potential molecular link between FMR1-FM and dup(15q), the cytoplasmic FMR1 interacting protein 1 (CYFIP1), which was up-regulated in dup(15q) patients. We were able to confirm this link in vitro by showing common regulation of two other dysregulated genes, JAKMIP1 and GPR155, downstream of FMR1 and CYFIP1. We also confirmed the reduction of the JAKMIP1 protein in FMR1 knock out mice, demonstrating in vivo relevance. Finally, we showed independent confirmation of roles for JAKMIP1 and GPR155 in autism spectrum disorders (ASD) by showing their differential expression in male sib pairs discordant for idiopathic ASD. These results provide evidence that blood-derived lymphoblastoid cells gene expression is likely to be useful for identifying etiological subsets of autism and to explore its pathophysiology.
[0075] It has become increasingly clear that genetic factors are significant determinants of autism pathophysiology (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; Muhle et al., (2004) Pediatrics, 113, e472-486). Although, multiple genetic approaches have been undertaken to identify loci or genes for autism spectrum disorders (ASD) (1-18), identification of causal genes has been hampered by genetic and phenotypic heterogeneity. Thus, it seems reasonable to accelerate the gene discovery process by using combinations of experimental approaches, such as the study of "single gene" or more simple causes, such as chromosomal copy number imbalances, whose phenotypes include ASD (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; Muhle et al., (2004) Pediatrics, 113, e472-486). One such disorder is fragile X syndrome (FXS) (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; Muhle et al., (2004) Pediatrics, 113, e472-486; and Brown et al. (1986) Am. J. Med. Genet., 23, 341-352), which is caused by an expansion of the trinucleotide repetitive sequence (CGG)n in the promoter region of the fragile X mental retardation 1 (FMR1) gene located at Xq27.3 (see. e.g. Verkerk et al. (1991) Cell, 65, 905-914). This mutation causes a significant deficit of the FMR1 protein (FMRP) and a phenotype including cognitive impairment and other behavioral abnormalities that overlap with ASD. The prevalence of ASD among FXS cases has been estimated at 15-33% (see, e.g. Rogers et al. (2001) J. Dev. Behav. Pediatr., 22, 409-417; and Goodlin-Jones et al. (2004) J. Dev. Behav. Pediatr., 25, 392-398) and approximately 1% to 2% of those with autism and no obvious physical features of FXS are found to have FMR1-FM (see, e.g. Brown et al. (1986) Am. J. Med. Genet., 23, 341-352; and Bailey et al. (1996) J. Child. Psychol. Psychiatry, 37, 89-126).
[0076] Another disorder that causes ASD is a maternally inherited duplication of 15q11-q13 (dup(15q)) (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; Muhle et al., (2004) Pediatrics, 113, e472-486; and Sutcliffe et al. (2003) J. Am. Acad. Child. Adolesc. Psychiatry, 42, 253-256). Multiple repeat elements within the region mediate a variety of rearrangements, including interstitial duplications, interstitial triplications, and supernumerary isodicentric marker chromosomes (see, e.g. Wang et al. (2004) Am. J. Hum. Genet., 75, 267-281). Dup(15q) occurs with an estimated frequency of 1:600 in children with developmental delay (see, e.g. Thomas et al. (2003) Am. J. Med. Genet. A, 120, 596-598) and is the most common copy number variation causing ASD (see, e.g. Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; and Sutcliffe et al. (2003) J. Am. Acad. Child. Adolesc. Psychiatry, 42, 253-256). Over-expression of ubiquitin protein ligase E3A (UBE3A) and/or ATPase Class V type 10A (ATP10A) could represent a major underlying molecular factor for autism (see, e.g. Herzing et al. (2002) Hum. Mol. Genet., 11, 1707-1718; and Herzing et al. (2001) Am. J. Hum. Genet., 68, 1501-1505). However, autism is not a universal finding in maternal uniparental disomy of the 15q11-q13 region, a condition in which UBE3A and ATP10A are over-expressed (see, e.g. Sutcliffe et al. (2003) J. Am. Acad. Child. Adolesc. Psychiatry, 42, 253-256). These results suggest that dysregulation of non-imprinted genes in the duplicated region and/or throughout the whole genome may contribute to the autistic phenotype observed in dup(15q). Therefore, we reasoned that the identification of genes whose expression is dysregulated by both FMR1-FM and dup(15q) may provide genes relevant to ASD, since the two genetic abnormalities represent cases where single mutations, either a trinucleotide repeat or copy number variation (see, e.g. Sebat et al. (2004) Science, 305, 525-528), cause ASD. We also wanted to examine, as a proof of principle, whether lymphoblast gene expression profiles identified by microarrays can differentiate between these single mutation "simple" causes of autism and controls. If this were the case, this would provide a basis for further study using this technique in idiopathic autism, where more multigenic inheritance and environmental influences may be at play (see, e.g. Folstein et al., (2001) Nat. Rev. Genet., 2, 943-955; Belmonte et al., (2004) Mol. Psychiatry, 9, 646-663; Veenstra-Vanderweele et al., (2004) Annu Rev Genomics Hum Genet, 5, 379-405; Muhle et al., (2004) Pediatrics, 113, e472-486).
[0077] Recently, several studies have suggested that lymphoblastoid cells can be used to detect biologically plausible correlations between candidate genes and neuropsychiatric diseases, including Rett syndrome (see e.g. Horike et al. (2005) Nat. Genet., 37, 31-40), nonspecific X-linked mental retardation (see, e.g. Meloni et al. (2002) Nat. Genet., 30, 436-44), bipolar disorder (see, e.g. Iwamoto et al. (2004) Mol. Psychiatry, 9, 406-416), FXS (see e.g. Brown et al. (2001) Cell, 107, 477-87) and dup(15q) (see, e.g. Baron et al. (2006) Hum. Mol. Genet, 15, 853-869). In the present study, we investigated whether gene expression profiles of lymphoblastoid cells could be used (i) to differentiate autistic subjects who were ascertained and diagnosed as having ASD in the Autism Genetic Resource Exchange (AGRE) (see, e.g. Geschwind et al. (2001) Am. J. Hum. Genet., 69, 463-466) repository into etiological categories (FMR1-FM and dup(15q)) and (ii) to identify common genes and pathways that might be relevant to autism across these two distinct forms. Here, we demonstrate that the gene expression profile was able to clearly distinguish individuals based on their etiology. We also identified 68 genes commonly dysregulated in autism with FMR1-FM and dup(15q). Interestingly, we identified a molecular connection between FMR1-FM and dup(15q), CYFIP1, which was significantly induced in dup(15q) and is known to antagonize certain aspects of FMRP function (see, e.g. Schenck et al. (2003) Neuron, 38, 887-98). We further demonstrated that the expression of janus kinase and microtubule interacting protein 1 (JAKMIP1) and G protein-coupled receptor 155 (GPR155) were commonly dysregulated by either reduction of FMR1 or induction of CYFIP1 in vitro. The expression of JAKMIP1 was also dysregulated in the brain of the FMR1 knock-out mouse. Finally, we were able to show that JAKMIP1 and GPR155 were dysregulated in males with autism spectrum disorders (ASD), relative to their non-affected siblings, providing independent confirmation suggesting that these genes are associated with ASD.
Results
Hierarchical Clustering and Principal Component Analysis Distinguish Individuals Based on Genetic Etiology
[0078] We analyzed the whole-genome mRNA expression profile in lymphoblastoid cells from 15 autistic males (8 autistic males with FMR1-FM and 7 autistic males with dup(15q)) and 15 non-autistic control males from AGRE (see supplemental table S1 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference) using Agilent Whole Genome Human Microarrays. Overall, out of 41,000 probes analyzed, 31,044 probes, representing 23,822 genes, were expressed in the lymphoblastoid cells. To find genes that were differentially expressed across the three subject groups, the expression profile of the lymphoblastoid cells was subjected to Analysis of Variance (ANOVA) (see, e.g. Cui et al. (2003) Genome Biol., 4, 210). ANOVA identified 293 probes (277 genes) below a defined false discovery rate (FDR) threshold of 5% (see supplemental table S2 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). It has been shown that the expression of FMR1 is decreased in lymphoblastoid cells with FMR1-FM (see, e.g. Sutcliffe et al. (1992) Hum. Mol. Genet., 1, 397-400) and that the expression of UBE3A is increased in lymphoblastoid cells with dup(15q) (see, e.g. Herzing et al. (2002) Hum. Mol. Genet., 11, 1707-1718). Concordant with these reports, FMR1 and UBE3A were among the 293 differentially expressed probes, providing independent controls for the microarray analysis.
[0079] As shown in FIGS. 1A and B, hierarchical clustering using the 293 probes clearly classified individuals based on their genotype. The 293 probes were also subjected to principal component analysis (PCA). As shown in FIG. 1C, 3 dominant PCA components that contained 70% of the variance in the data matrix clearly separated individuals based on genetic etiology. In this plot, the first principal component axis accounted for 56% of the variance in the data set and clearly separated autism with FMR1-FM and dup(15q) from controls, whereas the second principal component (PC2) accounted for 10% of the variance and segregated autism with FMR1-FM from autism with dup(15q). The top 10 genes contributing to PC2 include FMR1, UBE3A, CYFIP1, non-imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2), and hect domain and RLD 2 (HERC2). The latter four genes are all located within the 15q11-q13 region. These results suggest that the selective reduction of FMR1 and the selective induction of the four genes located in 15q11-q13 differentiated autism with FMR1-FM from autism with dup(15q). These data provide a critical proof of principle that the gene expression profile of lymphoblastoid cells could be used to subgroup subjects with autism based on their genetic etiologies when the etiologies are due to a single mutation or copy number variation.
Microarray Analyses Revealed the Significant Overlap of FMR1-FM and Dup(15q)
[0080] To identify the set of the most robustly differentially expressed genes in each group, we identified genes found using three different statistical methods, ANOVA, Significant Analysis of Microarray (SAM) (see, e.g. Tusher et al. (2001) Proc. Natl. Acad. Sci. USA, 98, 5116-5121) and Rank Product Analysis (RankProd) (see, e.g. Breitling et al. (2004) FEBS Lett., 573, 83-92). SAM is a modified t-test statistic, whereas RankProd is a non-parametric statistic that detects items that are consistently highly ranked in a number of lists. SAM identified 5139 probes and 1281 probes as significant (FDR<5%) in autism with FMR1-FM and dup(15q), respectively (FIGS. 2A and B). RankProd identified 2281 probes and 1444 probes as significant (FDR<5%) in autism with FMR1-FM and dup(15q), respectively (FIGS. 2A and B). The combination of ANOVA, SAM and RankProd identified 146 probes (120 genes) in autism with FMR1-FM and 97 probes (80 genes) in autism with dup(15q) (FIG. 2C). Eighty-three probes representing 68 genes were dysregulated in both autism with FMR1-FM and dup(15q) (see Table 1 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). This degree of overlap was highly significant (hypergeometric probability, P=1.2×10-153). Fifty-two genes and 12 genes were selectively dysregulated in either autism with FMR1-FM and autism with dup(15q), respectively (see Table 2 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference).
qRTPCR Confirmed the Differential Expression Identified by the Microarray Analysis
[0081] To validate the differential expression identified by microarray analysis using independent methods, we performed quantitative real-time PCR analysis (qRTPCR) of 19 genes chosen as a cross section using the same samples used in the microarray analysis. qRTPCR confirmed that 17 of the 19 genes were differentially expressed as expected by the microarray analysis (FIG. 3, A-C). There was an overall highly significant correlation between microarray and qRTPCR results (Pearson correlation, r=0.57, P<0.0001).
[0082] CYFIP1 was one of the genes selectively induced in autism with dup(15q). Because CYFIP1 is known to antagonize FMRP (see, e.g. Schenck et al. (2003) Neuron, 38, 887-98), we reasoned that the induction of CYFIP1 in dup(15q) might explain some of the significant overlap between autism with FMR1-FM and dup(15q). JAKMIP1, also known as Marlin-1, was significantly induced in autism with FMR1-FM and had a positive trend in autism with dup(15q) (P=0.062), suggesting that JAKMIP1 could represent a commonly dysregulated pathway. In fact, RankProd identified JAKMIP1 as a significantly up-regulated gene in dup(15q) by microarray analysis. This gene is a particularly biologically important candidate, given its putative role in GABAB receptor expression (see, e.g. Couve et al. (2004) J. Biol. Chem., 279, 13934-13943) and the microtubule network (see, e.g. Steindler et al. (2004) J. Biol. Chem., 279, 43168-43177).
Functional Annotation Revealed Pathway Dysregulation
[0083] In an attempt to uncover the common functional meanings among the differentially expressed genes, we classified genes into gene ontology groups using DAVID (see, e.g. Dennis et al. (2003) Genome Biol., 4, P3). Table 3 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference, shows the top 3 clusters identified by DAVID using the 68 genes dysregulated in autism with FMR1-FM and dup(15q), or the 52 genes selectively dysregulated in autism with FMR1-FM. The number of genes selectively dysregulated in autism with dup(15q) was too small to analyze using the functional annotation clustering.
[0084] Genes related to cell communication (P=7.6×10-6) and signal transduction (P=2.2×10-5) were most significantly enriched in the 68 genes commonly dysregulated in autism with FMR1-FM and dup(15q). Genes related to immune response (P=3.7×10-3) and defense response (P=7.3×10-3) were also enriched in this gene set. Genes related to chaperone (P=2.6×10-2) and protein folding (P=3.2×10-2) were enriched in the 52 genes selectively dysregulated in autism with FMR1-FM. Genes related to RNA binding (P=1.2×10-2) and mRNA metabolism (P=2.1×10-2) were also enriched in this gene set, consistent with the FMRP protein's function as RNA binding protein important in regulatory translation (see, e.g. Bagni et al. (2005) Nat. Rev. Neurosci., 6, 376-387). Chaperones and folding proteins are commonly found to operate co-translationally, providing a potential link with FMRP function.
[0085] To provide a more refined functional classification of genes, we used Ingenuity Pathway Analysis (IPA) (see, e.g. Ingenuity Pathway Analysis. (http://www.ingenuity.com/)), a powerful tool for investigating the biological pathways represented by the genes commonly dysregulated in autism with FMR1-FM and dup(15q). IPA uses known protein-protein and gene-gene interactions that have been culled into a curated database and associates the list of differentially expressed genes with biological networks. IPA identified three statistically significant networks, each containing at least ten genes (see Table 4 and supplemental FIG. 1) in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). Principal functions associated with these networks were cell cycle (P=5.2×10-8), cellular movement (P=1.3×10-8) and cell-to-cell signaling and interaction (P=4.3×10-8). The "cell-to-cell signaling and interaction" was consistent with "cell communication" and "signal transduction" categories identified by the DAVID. The identification of the "molecular transport" pathway containing JAKMIP1 was particularly salient, given this gene's known role in GABAR trafficking within neurons. There were also other important genes in this pathway, including PSCD3, an ADP-ribosylation factor of unknown CNS function and ACTN1, a cytoskeletal anchoring protein. Based on this analysis, it is plausible that JAKMIP1 may act along with these genes in the segregation of signaling complexes involved in neural transmission.
Effect of Down-Regulation of FMR1 and Up-Regulation of CYFIP1 in a Neuronal Cell on the Expression of the Dysregulated Genes Identified in Lymphoblastoid Cells
[0086] Although we identified dysregulated genes in autism with FMR1-FM and dup(15q) using lymphoblastoid cells, we were interested in whether the expression of these genes would also be dependent on FMR1 and CYFIP1 in neuronal cells. To examine the effect of FMR1 and CYFIP1 in neuronal cells, we used the well characterized human neuronal cell line SH-SY5Y (see, e.g. Millar et al. (2005) Science, 310, 1187-1191). FMR1 and CYFIP1 dependence in SH-SY5Y cells were assessed using short hairpin RNA (shRNA) to reduce the expression of FMR1 and a plasmid expression vector to induce the expression of CYFIP1, respectively. As shown in FIG. 4A, the expression of FMR1 was reduced to about 60% of its normal level in SH-SY5Y cells stably expressing FMR1 shRNAs, whereas the expression of CYFIP1 was significantly induced (11-fold) in SH-SY5Y cells stably transfected with the CYFIP1 plasmid.
[0087] We were able to further demonstrate the effect of down-regulation of FMR1 and up-regulation of CYFIP1 on the expression of two key downstream genes (FIG. 4B). In SH-SY5Y cells transfected with FMR1 shRNA, the expression of JAKMIP1 and GPR155 were significantly reduced and induced, respectively. In SH-SY5Y cells over-expressing CYFIP1, the expression of JAKMIP1 and GPR155 were also reduced and induced, respectively. These findings demonstrated that the expression of JAKMIP1 and GPR155 were also dependent on FMR1 and CYFIP1 in SH-SY5Y cells and that reduction of FMR1 and induction of CYFIP1 can share common downstream effects on the expression of JAKMIP1 and GPR155.
The Expression of JAKMIP1 Protein was Dependent on FMR1 and CYFIP1
[0088] Then, we validated the effect of FMR1 or CYFIP1 on the protein expression of JAKMIP1 in the central nervous system (CNS). We examined the expression of the JAKMIP1 protein in the cortex of FMR1 knock-out (KO) and wild-type (WT) mice and SH-SY5Y cells transfected with the CYFIP1 over-expression plasmid. The expression of JAKMIP1 protein was reduced in cortex of FMR1 KO mice (FIG. 5A) and SH-SY5Y cells over-expressing CYFIP1 (FIG. 5B). These findings confirmed the in vitro findings that the expression of JAKMIP1 was dependent on FMR1 in mouse brain, suggesting that at least some of the changes observed in lymphoblastoid cells reflect similar changes in the CNS.
The Expression of JAKMIP1 and GPR155 were Significantly Different Between 27 Male Sib Pairs Discordant for Idiopathic ASD
[0089] To determine the potential generalizability of these findings to idiopathic autism, we examined whether the expression of JAKMIP1 and GPR155 were also dysregulated in lymphoblastoid cells from idiopathic ASD cases. We selected 27 male sib pairs discordant for ASD from AGRE (see supplemental table S1 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). The 27 males with ASD did not have FMR1-FM or dup(15q) and had surrogate IQ markers (Raven's progressive matrices)>70. As shown in FIG. 6, the expression of JAKMIP1 and GPR155 were significantly dysregulated in the 27 males with ASD compared to their sibs without ASD. These results show that the dysregulation of JAKMIP1 and GPR155 are associated with ASD. The lack of general intellectual disability in this ASD group also shows that these dysregulation are not simply due to a non-specific cognitive impairment or intellectual disability observed in FXS and dup(15q). However, both in vitro (SH-SY5Y cells) and in vivo (brain) CNS tissues, the direction of JAKMIP1 and GPR155 regulation were opposite to that observed in lymphoblastoid cells. The differences may reflect many facts, including immortalization or alternative regulatory signaling pathways in different tissues. However, these data are consistent between FMR1-FM and dup(15q) and indicate that expression of JAKMIP1 and GPR155 are regulated by both FMR1 and CYFIP1 levels, albeit differently between neural tissues and lymphoblastoid cells, providing potential common signaling pathways dysregulated in ASD.
[0090] In this study, we performed global mRNA expression profiling from males with autism carrying either FMR1-FM or dup(15q) and control males. We found that these autistic individuals can be differentiated based on their genetic etiologies by lymphoblast gene expression profiles. Interestingly, this analysis also revealed a common gene expression signature across these two distinct genetic conditions leading to ASD that was significantly different from control profiles. We used the intersection of three different statistical tests to identify the most robustly differentially expressed genes (see, e.g. Cui et al. (2003) Genome Biol., 4, 210; Tusher et al. (2001) Proc. Natl. Acad. Sci. USA, 98, 5116-5121; and Breitling et al. (2004) FEBS Lett., 573, 83-92). The qRTPCR data confirmed this gene selection strategy.
Gene Expression Profiles of Lymphoblastoid Cells Carrying the FMR1-FM
[0091] We identified 120 genes differentially expressed in FMR1-FM carriers compared with controls. Among these genes, NR3C1 and VIM were previously identified as target RNAs of FMRP (see, e.g. Miyashiro et al. (2003) Neuron, 37, 417-431), although the mRNA expression changes of these genes in FMR1-FM have not been reported.
[0092] Brown et al (see, e.g. Brown et al. (2001) Cell, 107, 477-87) previously identified 144 genes as differentially expressed in lymphoblasts with FMR1-FM using pooled fragile X lymphoblastoid cells and pooled normal lymphoblastoid cells. Because there was no overlap except for FMR1 between these 144 genes and the 120 genes identified here with our most stringent analyses using ANOVA, SAM and RankProd, we used the larger gene list identified by either SAM and/or RankProd to compare with the 144 genes identified by Brown et al. We found that 13 genes were shared in these gene lists, including iduronate 2-sulfatase (IDS), hairy and enhancer of split 1 (HES1) and immunoglobulin superfamily, member 3 (IGSF3) as up-regulated genes and CDK2-associated protein 2 (CDK2AP2), ubiquitin specific peptidase 8 (USP8), MAX-like protein X (MLX), ribosomal protein S5 (RPS5), C-terminal binding protein 1 (CTBP1), spleen tyrosine kinase (SYK), F-box protein 6 (FBXO6), mitogen-activated protein kinase kinase kinase 11 (MAP3K11), sorting nexin 15 (SNX15) and CD44 antigen (CD44) as down-regulated genes. Although these genes have not been reported as associated with FMR1 or autism, HES1 was associated with attention-deficit hyperactive disorder (ADHD) (see, e.g. Brookes et al. (2006) Mol. Psychiatry, 10, 934-953), which is a symptom frequently seen in FXS (50) and overlapping with ASD (see, e.g. Todd, R. D. (2001) Child Adolesc. Psychiatr. Clin. N. Am., 10, 209-24). The relatively low overlap between the two gene lists could be due to the difference of clinical features of individuals (autism vs. not specific for autism), experimental design (each individual vs. pooled), microarray platforms (Agilent vs. Affymetrix) and the statistical analysis used to find the differential expression between groups. The initial study (see, e.g. Brown et al. (2001) Cell, 107, 477-87) whose primary aim was to find FMRP ligand mRNPs was relatively underpowered to detect overall differences in gene expression and our study used very conservative statistical criteria. However, this core set of genes provides an interesting gene list for further investigation.
Gene Expression Profiles of Lymphoblastoid Cells with Dup(15q)
[0093] We identified 80 genes differentially expressed in dup(15q) carriers compared with controls. Among these genes, 4 genes located in 15q11-q13 (the region of duplication) UBE3A, CYFIP1, NIPA2, and GOLGA8F were all induced. It is important to note that 5 other genes located in the duplicated region, tubulin gamma complex associated protein 5 (TUBGCP5), HERC2, HERC2 pseudogene 2 (HERC2P2), NIPA1, and ATP10A and were also identified as up-regulated genes by at least one of the three different statistical analyses (see supplemental table S3 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). Four other genes in the duplicated region, gamma-aminobutyric acid A receptor (GABR) beta 3 (GABRB3), GABR alpha 5 (GABRA5), GABR gamma 3 (GABRG3), oculocutaneous albinism II (OCA2) and necdin homolog (NDN), were not expressed at detectable levels in the lymphoblastoid cells. It is important to emphasize that the 15q11-q13 region is subject to paternal imprinting. Three paternally imprinted genes, makorin ring finger protein 3 (MKRN3), MAGE-like 2 (MAGEL2) and SNRPN upstream reading frame (SNURF)-small nuclear ribonucleoprotein polypeptide N (SNRPN) were expressed in the lymphoblasts, but showed no significant changes relative to controls. This data is consistent with the fact that the duplicated region was maternally derived in all 7 cases analyzed in this study. So, overall, these findings suggest that the genes located in the duplicated region were globally upregulated except for the paternally imprinted genes. Global up-regulation due to gene-dosage has also been reported in Down syndrome (see, e.g. Tang et al. (2004) Ann. Neurol., 56, 808-814; and Mao et al. (2003) Genomics, 81, 457-467).
[0094] Baron et al (see, e.g. Baron et al. (2006) Hum. Mol. Genet, 15, 853-869) identified 81 known genes as differentially expressed in lymphoblastoid cells with dup(15q) (7 individuals) compared to controls (8 individuals) using the Affymetrix platform. They identified upregulation of UBE3A, NIPA1, NIPA2 and HERC2, consistent with our results. We used the gene list identified by SAM and/or RankProd to compare with the 81 genes identified by Baron et al and identified 11 other genes shared in the two gene lists, a significant overlap (the hypergeometric probability is 0.001). These genes were abhydrolase domain containing 6 (ABHD6), potassium channel, subfamily K, member 1 (KCNK1), hypothetical protein KIAA1147, and zinc finger, DHHC domain containing 14 (ZDHCC14) as up-regulated and Rho GTPase activating protein 25 (ARHGAP25), clone LOC387882, leukotriene B4 12-hydroxydehydrogenase (LTB4DH), clone MGC27165, PFTAIRE protein kinase 1 (PFTK1), zinc finger protein 43 (ZNF43) and ring finger protein 41 (RNF41) as down-regulated. The relationships between these genes and autism remain unknown. Again, as is the case of FMR1-FM, these genes represent a set of independently replicated genes between two studies.
Significant Overlap of Dysregulated Genes in Autism with FMR1-FM and Dup(15q)
[0095] We identified 68 genes that were dysregulated in both autism with FMR1-FM and dup(15q), a very significant result (hypergeometric probability of this overlap is 1.2×10-153). However, we can not formally exclude the possibility that some of the 68 common dysregulated genes might be related to common pathways between FMR-FM and dup(15q) unrelated to ASD. Microarray analysis using lymphoblastoid cells with FMR1-FM or dup(15q), but without ASD is needed to exclude the possibility, as was done in Tuberous Sclerosis cases with and without autism (see, e.g. Tang et al. (2004) Ann. Neurol., 56, 808-814).
[0096] We found that the expression of CYFIP1 was significantly induced in autism with dup(15q). CYFIP1 protein has been shown to antagonize FMRP in the eye and nervous system of Drosophila (see, e.g. Schenck et al. (2003) Neuron, 38, 887-98). In FXS, the absence of FMRP, a binding partner to CYFIP1, results in excess free CYFIP1 protein. Similarly, excess free CYFIP1 protein may be the outcome of dup(15q). Thus, antagonization of FMRP by over-expression of CYFIP1 protein, and/or alternate actions of excess CYFIP1 protein may be common mechanistic links between FMR1-FM and dup(15q).
Effect of FMR1 and CYFIP1 on the Commonly Dysregulated Genes in SH-SY5Y and Mouse Brain
[0097] We validated the effect of down-regulation of FMR1 in SH-SY5Y cells and mouse brain and up-regulation of CYFIP1 in SH-SY5Y cells on the expression of the commonly dysregulated genes identified in patient lymphoblastoid cells. We demonstrated that the expression of JAKIMIP1 and GPR155 were dysregulated by reduction of FMR1 and induction of CYFIP1 in SH-SY5Y cells. JAKMIP1 protein was also dysregulated by knock-out of FMR1 in mouse brain. Interestingly, the direction of changes observed in both of these genes is opposite in neural tissues (SH-SY5Y cells and brain) and lymphoblastoid cells. Such differences between brain and blood cells have been previously observed in other signaling pathways (see, e.g. Iwamoto et al. (2004) Mol. Psychiatry, 9, 406-416; and Middleton et al. (2005) Am. J. Med. Genet. B Neuropsychiatr. Genet., 136, 12-25). It is likely that it is not the precise direction observed in lymphoblastoid cells that is most important, but the common dysregulation of JAKMIP1 and GPR155, downstream of these single gene defects and which is observed in idiopathic ASD.
[0098] JAKMIP1 is associated with janus kinases (see, e.g. Steindler et al. (2004) J. Biol. Chem., 279, 43168-43177), microtubules (see, e.g. Steindler et al. (2004) J. Biol. Chem., 279, 43168-43177) and GABRB receptors (see, e.g. Couve et al. (2004) J. Biol. Chem., 279, 13934-13943). The expression levels of JAKMIP1 affect the intracellular levels of the GABRB receptor (see, e.g. Couve et al. (2004) J. Biol. Chem., 279, 13934-13943). Because the GABRB receptor could interact with the metabotropic glutamate receptor 1 (mGluR1) and increase the glutamate sensitivity of mGluR1 (see, e.g. Tabata et al. (2004) Proc. Natl. Acad. Sci. USA, 101, 16952-16957), JAKMIP1 might affect mGluR1 signaling through GABRB receptors. It is important to note that mGluR signaling is exaggerated in FMR1 knock-out mouse (see, e.g. Bear et al. (2004) Trends. Neurosci., 27, 370-377) and that glutamergic and GABAergic system have been reported to be abnormal in autism (see, e.g. Polleux et al. (2004) Ment. Retard. Dev. Disabil. Res. Rev., 10, 303-317). JAKMIP1 is highly expressed throughout the mouse brain, especially in hippocampus where GABRB receptors and mGluR1 are also highly expressed (see, e.g. Allen Brain Atlas. (http://www.brain-map.org/)). Although the function of GPR155 is unknown, it is highly expressed in the limbic system in mouse brain (see, e.g. Allen Brain Atlas. (http://www.brain-map.org/)), suggesting that GPR155 might have functions relevant to the limbic system.
[0099] It is also interesting to consider how the reduction of FMR1 and the induction of CYFIP1 might regulate the expression of JAKMIP1 and GPR155. G-quadruplex motifs in RNA have been shown to play significant roles in FMRP binding (see, e.g. Darnell et al. (2001) Cell, 107, 489-99). Using QGRS mapper (see, e.g. Kikin et al. (2006) Nucleic Acids Res., 34, W676-682), we found that human and mouse JAKMIP1 each had two of the G-quadruplex (G2N2-4G2N2-4G2N2-4G2) and that human and mouse GPR155 had five and one of the G-quadruplex, respectively. FMRP can also bind target RNAs through non-coding RNAs (see, e.g. Zalfa et al. (2003) Cell, 112, 317-327) or microRNAs (see, e.g. Jin et al. (2004) Nat. Cell. Biol., 6, 1048-1053). Using miRBase (see, e.g. Griffiths-Jones et al. (2006) Nucleic Acids Res., 34, D140-144), we found putative microRNA binding sites in human and mouse JAKIMIP1 and GPR155. Further studies are required to clarify the functional importance of JAKMIP1 and GPR155 in autism and the mechanism of regulation of these genes by FMR1 and CYFIP1. In this regard, the potential link with neuronal transmission is intriguing.
The Expression of JAKMIP1 and GPR155 were Also Dysregulated in 27 Males with Idiopathic ASD
[0100] The findings in autism with FMR1-FM and dup(15q) suggest that JAKMIP1 and GPR155 may be involved more generally in idiopathic ASD, since their dysregulation is observed in neural cells and brain. We tested whether dysregulation of these genes were more generalizable in an independent sample consisting of idiopathic ASD cases. To attempt to reduce the heterogeneity of idiopathic ASD and extend these findings beyond those with mental retardation or intellectual disability, we used an IQ surrogate based on Raven's Progressive Matrices, which is highly correlated with IQ defined by other measures (see, e.g. Mottron, L. (2004) J. Autism Dev. Disord., 34, 19-27). We selected 27 ASD males with an IQ score over 70. These data demonstrated that the expression of JAKMIP1 and GPR155 are significantly dysregulated in lymphoblastoid cells from idiopathic ASD compared to controls. These results based on independent data on lymphoblastoid cell gene expression from ASD subjects with FMR1-FM, or dup(15q), as well as idiopathic ASD suggest that JAKMIP1 and GPR155 may be useful as biomarkers for ASD.
[0101] The mechanism for the opposite regulation of JAKMIP1 and GPR155 in lymphoblastoid cells and neural cells remain to be elucidated. There are several previous reports of genes showing the opposite expression between lymphoblastoid cells and brains in neuropsychiatric disease. One example is inositol monophosphatase 2 (IMPA2) that has been identified as a plausible locus for bipolar disorder (see, e.g. Yoshikawa et al. (1997) Mol. Psychiatry, 2, 393-397; Nothen et al. (1999) Mol. Psychiatry, 4, 76-84; and Lin et al. (2005) Am. J. Hum. Genet., 77, 545-555). The expression of IMPA2 was reduced and induced in lymphoblastoid cells and brains, respectively, in patients with patients with bipolar disorder (see, e.g. Yoon et al. (2001) Mol. Psychiatry, 6, 678-683). A genetic association between IMPA2 promoter polymorphism and bipolar disorder has been confirmed (see, e.g. Sjoholt et al. (2004) Mol. Psychiatry, 9, 621-629; and Ohnishi et al. (2007) Neuropsychopharmacology). In this regard, it is notable that GPR155 is located on 2q31.1, 300 kb from D2S2188, which has shown strong linkage to autism in studies by two independent groups (see, e.g. IMGSAC (2001) Am. J. Hum. Genet., 69, 570-581; and Romano et al. (2005) Psychiatr. Genet., 15, 149-150). Association analysis for GPR155 and JAKMIP1 are ongoing using the large AGRE cohort. These data provide the first identification and independent validation of the potential roles of JAKMIP1 and GPR155 dysregulation in ASD. Further work is needed to understand the functional consequences of these changes in the developing brain, and to assess the general utility of these and other genes as potential biomarkers.
Materials and Methods
[0102] Individuals and Lymphoblastoid Cells Analyzed in this Study
[0103] We have analyzed individuals diagnosed with ASD using standard validated measures, including the Autism Diagnostic Interview (ADI-R) (see, e.g. Lord et al. (1994) J. Autism Dev. Disord., 24, 659-685) and Autism Diagnostic Observation Schedule (ADOS) (see, e.g. Lord et al. (2001) Am. J. Med. Genet., 105, 36-38). Eight males with FMR1-FM and 3 males with dup(15q) were drawn from AGRE (see, e.g. Geschwind et al. (2001) Am. J. Hum. Genet., 69, 463-466) (http://www.agre.org/). An additional 4 males with dup(15q) were obtained from NIGMS Human Genetic Cell Repository. 27 males without autism, FMR1-FM and dup(15q) were drawn from the AGRE for controls. In addition, another 27 males with idiopathic ASD who had unaffected male siblings were chosen from AGRE for a comparison sample (see supplemental table S1 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference). Surrogate IQ scores (using the Raven Progressive Matrices) were available. FMR1-FM and dup(15q) were examined by PCR and fluorescence in situ hybridization, respectively. The 15q11-q13 duplicated region in the 7 males analyzed in this study were all maternally derived. We also used 14 other individuals from AGRE for common reference (pool) in microarray analysis. Lymphoblastoid cell lines (human Epstein-Barr virus transformed lymphocytes) from these individuals were available from AGRE and NIGMS cell repositories.
[0104] The lymphoblastoid cells of the subjects were grown in RPMI 1640 medium with 2 mM L-glutamine and 25 mM HEPES (Invitrogen, Carlsbad, Calif., USA), 10% fetal bovine serum, 1× Antibiotic-Antimycotic solution (Invitrogen, Carlsbad, Calif., USA) at 37° C. in a humidified 5% CO2 Chamber. Cells were grown to a density of 6×105/ml. Special attention was given to maintain all the cell lines in the same conditions to minimize environmental variation.
Microarray Experiment
[0105] A total of 9×106 of lymphoblastoid cells were seeded out in a T-75 flask in 30 ml of fresh medium. After 24 hours, total RNA was extracted from the cells using RNeasy Mini Kit with DNase treatment (Qiagen, Valencia, Calif., USA) according to manufacturer's protocol. The RNA quantity and quality was measured by ND-100 (Nanodrop, Wilmington, Del., USA) and 2100 Bioanalyzer (Agilent, Santa Clara, Calif., USA), respectively.
[0106] Target preparation was performed using Low RNA Input Fluorescent Linear Amplification Kit (Agilent, Santa Clara, Calif., USA) according to the manufacturer's protocol. We extracted total RNA from lymphoblastoid cells from each individual and made target and labeled it with Cy5 fluorescence. We also made reference target by using pooled total RNA from the 14 individuals for reference and labeled it with Cy3 fluorescence. The generated targets were mixed and subjected to hybridization to the Whole Human Genome Array G4112A (Agilent, Santa Clara, Calif., USA) according to the manufacturer's protocol. Scanning of the microarrays were done by DNA microarray scanner (Agilent, Santa Clara, Calif., USA).
[0107] Scanner output image files were normalized and filtered by using Feature Extraction Software v8.5 (Agilent, Santa Clara, Calif., USA). Normalization was performed so that overall intensity ratio of Cy5 to Cy3 was equal to one. Probes with signal to noise ratio >2.7 in both Cy3 and Cy5 in at least 14 of 15 controls were used for further analysis.
Statistical Analysis of Microarray Data
[0108] ANOVA was performed by MeV3.1 (see, e.g. Saeed et al. (2003) Biotechniques, 34, 374-378). P value was calculated based on 1000 permutation. Hierarchical clustering using Spearman's rank correlation with average linkage clustering were performed by MeV3.1 Principal component analysis was performed by GeneSpring GX7.3 (Agilent, Santa Clara, Calif., USA). SAM (see, e.g. Tusher et al. (2001) Proc. Natl. Acad. Sci. USA, 98, 5116-5121) and RankProd (see, e.g. Breitling et al. (2004) FEBS Lett., 573, 83-92) were performed using Bioconductor (see, e.g. Gentleman et al. (2004) Genome Biol., 5, R80) packages Siggene and RankProd, respectively. 100 and 1000 permutation were performed for cross-validation in SAM and RankProd, respectively. We used three different statistical tests to conservatively identify the most robustly differentially expressed genes. Numerous feature selection methods have been applied to the identification of differentially expressed genes in microarray data (see, e.g. Jeffery et al. (2006) BMC Bioinformatics, 7, 359). The genes commonly identified by ANOVA, SAM and RankProd are likely to be differentially expressed, given the relative robustness of these statistical approaches (see, e.g. Cui et al. (2003) Genome Biol., 4, 210; Tusher et al. (2001) Proc. Natl. Acad. Sci. USA, 98, 5116-5121; Breitling et al. (2004) FEBS Lett., 573, 83-92; and Jeffery et al. (2006) BMC Bioinformatics, 7, 359). Functional Annotation Clustering was performed by DAVID (see, e.g. Dennis et al. (2003) Genome Biol., 4, P3) with medium classification stringency. The clustering algorithm is based on the hypothesis that similar annotations should have similar gene members. The Functional Annotation Clustering uses two different statistics to measure the degree of the common genes between two annotations and to classify the groups with similar annotations. The Group Enrichment Score is the geometric mean (in -log scale) of a member's p-values in a corresponding annotation cluster. IPA was used to find significant pathways related to the genes commonly dysregulated in autism with FMR1-FM and dup(15q). The Ingenuity Pathway Knowledge Base builds gene networks based upon known protein and gene interactions (see, e.g. Ingenuity Pathway Analysis, e.g. by searching "www.ingenuity.com"). IPA determines a statistical score for each network according to the probability of the network given the gene list. The Ingenuity Pathway Knowledge Base provides pathways with biological function based upon the scientific literature. The significance value associated with Functions and Pathways measures how likely it is that genes from the dataset file participate in that biological function. The significance was expressed as a p-value, which is calculated using the right-tailed Fisher's Exact Test.
Quantitative Real Time PCR Analysis (qRTPCR)
[0109] Total RNAs was used to make cDNA by SuperScript III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, Calif., USA). qRTPCR was done by ABI Prism 7900 using Platinum SYBR Green qPCR SuperMix UDG with ROX (Invitrogen, Carlsbad, Calif., USA). Thermal cycling consisted on an initial step at 50° C. for 2 min followed by another step at 95° C. for 2 min and 50 cycles of 95° C. for 15 sec and 60° C. for 30 sec. qRTPCR was performed for 16 genes. The primers used in this study are shown in Supplementary table S4 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference. TaqMan probe (Hs00327005_m1, Applied Biosystems, Foster City, Calif., USA) was used to measure JAKMIP1 expression in lymphoblastoid cells. Data was normalized by the quantity of hypoxanthine phosphoribosyltransferase 1 (HPRT1). HPRT1 was selected rather than beta-actin, glyceraldehyde-3-phosphate dehydrogenase or other possible internal controls because it was shown to be most stable RNA species from the lymphoblastoid cell lines. This allowed us to account for the variability in the initial template concentration as well as the conversion efficiency of the reverse transcription reaction.
Transfection of shRNA
[0110] To construct retrovirus vectors expressing shRNAs, oligonucleotides encoding stem-loop shRNAs for FMR1 (see supplementary table S4 in Nishimura et al., Human Molecular Genetics 2007 16(14): 1682-1698, the contents of which are incorporated herein by reference) and negative control were ligated into the BamHI and EcoRI site of the pSIREN-RetroQ (BD Clontech, Mountain View, Calif., USA). PT67 cells (BD Clontech, Mountain View, Calif., USA) were transfected for retrovirus production. A total of 6×106 of SH-SY5Y cells were seeded out in a T-75 flask in 20 ml of fresh medium of DMEM (Invitrogen, Carlsbad, Calif., USA) with 10% FBS. After 1 day, SH-SY5Y cells were infected with retroviruses in the presence of 5 μg/ml of polybrene. After 2 days, the SH-SY5Y cells were treated with 10 μg/ml of puromycin (Sigma, St. Louis, Mo., USA). Cells that survived after 4 weeks were collected and this population of cells was used for further experiments. Total RNA were extracted from the cells using RNeasy Mini Kit with DNase treatment (Qiagen, Valencia, Calif., USA) according to the manufacturer's protocol. We compared SH-SY5Y cells expressing FMR1 shRNA (n=4) and SH-SY5Y cells expressing shRNAs for negative control (n=4) to examine the effect of reduction of FMR1 on the expression of JAKMIP1 and GPR155.
Transfection of CYFIP1
[0111] The human CYFIP1 coding region (aa 1-1254) obtained by PCR using IMAGE clone 10625411 (ATCC, Manassas, Va., USA) was subcloned into the EcoRV and NotI sites of the plasmid vector pIRES-neo3 (BD Clontech, Mountain View, Calif., USA). The sequence of the construct was confirmed by automated DNA sequencing.
A total of 6×106 of SH-SY5Y cells were seeded out in a T-75 flask in 20 ml of fresh medium of DMEM (Invitrogen, Carlsbad, Calif., USA) with 10% FBS. After 1 day, SH-SY5Y cells were transfected with 120 ul of lipofectamine 2000 (Invitrogen, Carlsbad, Calif., USA) diluted with 3 ml of OptiMEM (Invitrogen, Carlsbad, Calif., USA) and 24 g of plasmid (pIRES-CYFIP1 or pIRES) diluted with 3 ml of OptiMEM (Invitrogen, Carlsbad, Calif., USA). After 5 min at room temperature, they were combined and incubated for 20 min. The reaction mixture was added with 16 ml of DMEM with 10% FBS. The cell culture medium was replaced by this solution. After 2 days, the SH-SY5Y cells were treated with 500 μg/ml of G418 (Invitrogen, Carlsbad, Calif., USA). Cells that survived after 3 weeks were collected and this population of cells was used for further experiments. Total RNA was extracted from the cells using RNeasy Mini Kit with DNase treatment (Qiagen, Valencia, Calif., USA) according to the manufacturer's protocol. We compared SH-SY5Y cells stably transfected with expression vector for CYFIP1 (n=7) and SH-SY5Y cells transfected with empty expression vector (n=8) to examine the effect of induction of CYFIP1 on the expression of JAKMIP1 and GPR155. Protein was also extracted using Cellytic M (Sigma, St. Louis, Mo., USA) with proteinase inhibitors (Sigma, St. Louis, Mo., USA) according to the manufacturer's protocol.
Animals and Tissue Collection
[0112] Wild-type (WT) and FMR1 KO mice were raised at the Emory University animal facility and treated in accordance with National Institute of Health regulations and under approval of the Emory University Institutional Animal Care and Use Committee. WT and FMR1 KO littermates were produced by breeding heterozygous females with FMR1 KO males in congenic background of C57BL/6. The genotype of each animal was confirmed by PCR. For tissue collection, cortex were dissected, followed by protein isolation using Cellytic M (Sigma, St. Louis, Mo., USA) with proteinase inhibitors (Sigma, St. Louis, Mo., USA) according to the manufacturer's protocol.
Immunoblot Analysis
[0113] The proteins extracted from SH-SY5Y cells or cortex of FMR1 WT and KO mice were subjected to SDS-PAGE using NuPAGE Novex 4-20% Bis-Tris gel and MOPS buffer (Invitrogen, Carlsbad, Calif., USA) according to the manufacturer's protocol. After electrophoresis, gels were electroblotted onto PVDF membranes (Millipore, Bedford, Mass., USA). After electroblotting, membranes were blocked in SuperBlock blocking buffer (Pierce Biotechnology, Rockford, Ill., USA). Membranes were probed in the blocking solution at 4° C. overnight with the following antibodies: FMRP (Chemicon, Temecula, Calif., USA), CYFIP1 (Upstate, Temecula, Calif., USA), JAKMIP1 (see, e.g. Steindler et al. (2004) J. Biol. Chem., 279, 43168-43177) or GAPDH. Membranes were washed 3× in PBS supplemented with 0.05% Tween 20 (PBS-T) and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody in the blocking solution for 1 hour at room temperature. Membranes were again washed 3× in PBS-T, developed with SuperSignal West Pico Chemiluminescent (Pierce Biotechnology, Rockford, Ill., USA). Membranes were stripped by Restore Western Blot Stripping Buffer (Pierce Biotechnology, Rockford, Ill., USA) and used for different antibodies.
Example 2
Genome-Wide Expression Profiling of Lymphoblastoid Cell Lines Reveals Genes Dysregulated in Autism Spectrum Disorder
[0114] Autism spectrum disorder (ASD) is a heterogeneous condition and is likely to result from the combined effects of multiple, subtle genetic changes interacting with environmental factors. We hypothesize that there are genes whose expression are deregulated in ASD. We believe that a subset of these genes can be identified through the whole genome expression profiling in lymphoblastoid cells from individuals with autism and control. Although lymphoblastoid cells are not neuronal cells, recent studies suggest that lymphoblastoid cells can be useful to detect biologically plausible correlations between candidate genes and disease in various neuropsychiatric disorders. Our first study using lymphoblastoid cells from ASD subjects with known genetic disorders showed that genome-wide expression profiling of the lymphoblastoid cell lines distinguishes different forms of ASD and reveals shared pathways. Here, we analyzed genome-wide expression profiling of lymphoblastoid cell lines from 15 male sib pairs discordant for idiopathic ASD. We identified genes dysregulated in common among the idiopathic ASD and ASD with known genetic disorders. These results provide evidence that blood derived lymphoblastoid cell gene expression is likely to be useful for identifying susceptibility genes for ASD.
[0115] We previously reported that gene expression profiling of lymphoblastoid cell lines could identify different and shared pathways in cases of autism spectrum disorder (ASD) with known genetic causes (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). The analysis revealed shared pathways between ASD with full mutation of FMR1 (FMR1-FM) or maternal duplication of 15q11-q13 (dup15q), each of which account for 1-2% of ASD cases in large series. Here, we analyzed genome-wide expression profiling of lymphoblastoid cell lines from 15 male sib pairs discordant for idiopathic ASD. We identified 95 genes dysregulated in common among the idiopathic ASD, ASD with FMR1-FM and ASD with dup15q. We also identified 19 genes whose expression levels were extremely different in one of the 15 affected males compared to the mean of the 15 male sib pairs. We were able to confirm the differential expression of JAKMIP1, STEAP1, SLC16A6 and VIM between 39 male sib pairs discordant for ASD by quantitative PCR analysis. These results provide evidence that blood derived lymphoblastoid cell gene expression is likely to be useful for identifying susceptibility genes for ASD.
[0116] In this study, we analyzed the genome-wide expression profiles of lymphoblastoid cells from 15 male sib pairs discordant for idiopathic ASD. ASD is heterogeneous condition that is likely to result from the combined effects of multiple genetic factors (see, e.g. Abrahams et al. 2008. Nat Rev Genet 9(5):341-55; Geschwind D H. 2008a. Nature 454(7206):838-9; Geschwind D H. 2008b. Cell 135(3):391-5; and Geschwind et al. 2007. Curr Opin Neurobiol 17(1):103-11). Recent technological developments, such as array-based comparative genomic hybridization (array-CGH), revealed strong association of de novo copy number variation (CNV) with ASD (see, e.g. Sebat et al. 2007. Science 316(5823):445-9). However, each de novo CNV was individually rare in the population of patients (see, e.g. Christian et al. 2008. Biol Psychiatry 63(12):1111-7; Glessner et al. 2009. Nature; Marshall et al. 2008. Am J Hum Genet 82(2):477-88; Sebat et al. 2007. Science 316(5823):445-9; and Szatmari et al. 2007. Nat Genet 39(3):319-28), suggesting that genes located within the CNV would be differentially expressed only in a subset of ASD. Although these genes may not be involved in ASD in the general population, it is highly likely that they can provide essential information with regard to biological pathways and genetic networks involved in the etiology of ASD. In this study, we focused our attention on (i) genes that were dysregulated in common among idiopathic ASD, ASD with FMR1-FM and ASD with dup15q and (ii) genes whose expression levels were extremely different in a subset of the 15 affected males compared to the mean of the 15 male sib pairs discordant for idiopathic ASD. Here, we demonstrate 92 genes dysregulated in common among the three different forms of ASD and 19 genes whose expression levels were extremely different (over 4 SD from the mean) in one of the 15 affected males. We were able to confirm the differential expression of janus kinase and microtubule interacting protein 1 (JAKMIP1), six transmembrane epithelial antigen of the prostate 1 (STEAP1), solute carrier family 16 member 6 (SLC16A6) and vimentin (VIM) between 39 male sib pairs discordant for idiopathic ASD by using quantitative PCR analysis (qPCR). These results suggest that genome-wide expression profiling of lymphoblastoid cells is an efficient strategy to identify susceptibility genes for ASD.
Materials and Methods
[0117] Individuals and Lymphoblastoid Cells Analyzed in this Study
[0118] We have analyzed individuals diagnosed with ASD using standard validated measures, including the Autism Diagnostic Interview (ADI-R) (see, e.g. Lord et al. 1994. J Autism Dev Disord 24(5):659-85) and Autism Diagnostic Observation Schedule (ADOS) (see, e.g. Lord et al. 2001. Am J Med Genet 105(1):36-8), and controls (Table 3). All individuals were drawn from AGRE (see, e.g. Geschwind et al. 2001. Am J Hum Genet 69(2):463-6) (http://www.agre.org/). Lymphoblastoid cell lines (human Epstein-Barr virus transformed lymphocytes) from these individuals were available from AGRE. The lymphoblastoid cells of the subjects were grown as described previously (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98).
Microarray Experiments
[0119] Microarray experiments were performed as described previously (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). Scanner output image files from set 1 and 2 were normalized and filtered using Feature Extraction Software v8.5 (Agilent, Santa Clara, Calif., USA). Normalization was performed so that overall intensity ratio of Cy5 to Cy3 was equal to one.
Statistical Analysis of Microarray Data
[0120] To identify differentially expressed genes between groups, we analyzed the probes that met following criteria in both Cy3 and Cy5 in at least 13 of the 15 affected males. These criteria were i) signal was not saturated, ii) signal was uniform, iii) signal-to-noise ratio was over 2.6. The expression profile of these probes were subjected to EDGE (see, e.g. Leek et al. 2006. Bioinformatics 22(4):507-8) with 100 permutations for cross-validation. To identify differentially expressed genes (4 SD from the mean), we performed statistical analysis as described in (see, e.g. Coppola et al. 2008. Ann Neurol 64(1):92-6).
qPCR Analysis
[0121] One microgram of total RNA was used to make cDNA by iScript cDNA Synthesis Kit (BioRad, Hercules, Calif., USA). The qPCR was performed as described previously (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). The primers used in this study were JAKMIP1F; 5'-GGGGAAGCATGTCGAAGAAA-3' (SEQ ID NO: 1), JAKMIP1R; 5'-GGCCTTGAGCTCCGAAATGT-3' 3' (SEQ ID NO: 2), STEAP1F; 5'-3', STEAP1R; 5'-3', SLC16A6F; 5'-GGAGCCTTTGGGGGTTTATT-3' 3' (SEQ ID NO: 3), SLC16A6R; 5'-CCATCCTCCATCAGGCACTT-3' 3' (SEQ ID NO: 4), VIMF; 5'-AGCCGAAAACACCCTGCAATC-3' 3' (SEQ ID NO: 5), and VIMR; 5'-CTGGATTTCCTCTTCGTGGAGTT-3' 3' (SEQ ID NO: 6).
Identification of Loci Associated with ASD
[0122] We used SLEP (see, e.g. Konneker et al. 2008. Am J Med Genet B Neuropsychiatr Genet 147B(6):671-5) to identify loci associated with ASD. SLEP is a searchable archive of findings from psychiatric genetics. The database was queried by gene name in Table 1 using expansion of 5 Mb for genome-wide linkage studies and 5 Kb for genome-wide association studies. We also used Autism Chromosomal Rearrangement Database to identify de novo or overlapping CNVs involving genes identified in this study.
Results
[0123] Microarray Analysis Identified 95 Genes Dysregulated in Idiopathic ASD, ASD with FMR1-FM and ASD with dup15q
[0124] We analyzed the whole-genome mRNA expression profiles in lymphoblastoid cells from 15 male sib pairs discordant for idiopathic ASD (Table 3) in the Autism Genetic Resource Exchange (AGRE) (see, e.g. Geschwind et al. 2001. Am J Hum Genet 69(2):463-6) using Agilent Whole Human Genome Array. Overall, of 41,000 probes analyzed, 25497 probes, representing 13893 genes, were expressed in the lymphoblastoid cells. To find the genes that were differentially expressed between the 15 male sib pairs discordant for idiopathic ASD, the expression profile was subjected to Extraction of Differential Gene Expression (EDGE) (see, e.g. Leek et al. 2006. Bioinformatics 22(4):507-8). EDGE uses newly developed statistical methodology including Optimal Discovery Procedure and shows substantial improvements over five leading methodologies (see, e.g. Leek et al. 2006. Bioinformatics 22(4):507-8). EDGE identified 579 probes below P-value of 5% (FIG. 8). However, none of the probes had false discovery rate (FDR) under 50%, suggesting genetic heterogeneity of these 15 male sib pairs. We previously analyzed genome-wide expression profile of lymphoblastoid cell lines from 6 males with ASD and FMR1-FM and 7 males with ASD and dup15q (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). These males comprise two homogeneous subsets of ASD. We reanalyzed the expression profile using EDGE and identified 4033 and 2196 probes dysregulated (FDR<5%) in ASD with FMR1-FM and ASD with dup15q, respectively (FIG. 8). 1065 probes, representing 752 genes, were dysregulated in both ASD with FMR1-FM and dup15q. Consistent with the previous analysis (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98), this overlap was highly significant (hypergeometric probability, P=1.8×10-317). We compared the 579 probes dysregulated in idiopathic ASD with probes dysregulated in ASD with FMR1-FM and/or ASD with dup15q. As shown in FIG. 8, 208 and 171 probes were also dysregulated in ASD with FMR1-FM and ASD with dup15q, respectively. Hypergeometric probability for these overlap were P=3.4×10-33 (idiopathic ASD and ASD with FMR1-FM) and P=3.0×10-49 (idiopathic ASD and ASD with dup15q), suggesting these overlap were also significant. 124 probes representing 95 genes were dysregulated in common among the three different forms of all ASD (FIG. 8 and Table 1). Among the 95 genes, 32 genes were located within the autism loci previously identified by genetic analysis (Table 1) (see, e.g. Alarcon et al. 2002. Am J Hum Genet 70(1):60-71 Epub 2001 Dec. 6; Alarcon et al. 2005. Mol Psychiatry 10(8):747-57; Allen-Brady et al. 2008. Mol Psychiatry; Auranen et al. 2002. Am J Hum Genet 71(4):777-90 Epub 2002 Aug. 21; Barrett et al. 1999. Am J Med Genet 88(6):609-15; Buxbaum et al. 2001. Am J Hum Genet 68(6):1514-20; Cantor et al. 2005. Am J Hum Genet 76(6):1050-6; Duvall et al. 2007. Am J Psychiatry 164(4):656-62; IMGSAC. 2001. Am J Hum Genet 69(3):570-81; Liu et al. 2001. Am J Hum Genet 69(2):327-40 Epub 2001 Jul. 10; Marshall et al. 2008. Am J Hum Genet 82(2):477-88; Schellenberg et al. 2006. Mol Psychiatry 11(11):1049-60, 979; Sebat et al. 2007. Science 316(5823):445-9; Szatmari et al. 2007. Nat Genet 39(3):319-28; Trikalinos et al. 2006. Mol Psychiatry 11(1):29-36; and Yonan et al. 2003. Am J Hum Genet 73(4):886-97 Epub 2003 Sep. 17).
[0125] To provide functional classification of the 95 genes, we used Ingenuity Pathway Analysis (IPA). IPA identified four statistically significant networks, each containing at least 10 genes (Table 4 and FIG. 3). Principal functions associated with these networks were cellular development and cancer (Table 4).
Microarray Analysis Also Identified 19 Genes Whose Expression Levels were Extremely Different in One of the 15 Affected Males
[0126] We then focused our attention on genes that were differentially expressed (over 4 SD from the mean of 15 male sib pairs) in a subset of the 15 affected males. We identified 19 genes, each of which was differentially expressed (1.7-15 fold change) in only one of the 15 male sib pairs (Table 2). Interestingly, 2 of the 19 genes, GABA A receptor α4 (GABRA4) and oligodendrocyte myelin glycoprotein (OMG) have been reported to have significant association with ASD (see, e.g. Ma et al. 2005. Am J Hum Genet 77(3):377-88; and Martin et al. 2007b. Neurosci Res 59(4):426-30). GABRA4, nicotinate phosphoribosyltransferase domain containing 1 (NAPRT1) and vimentin (VIM) were also located within CNVs that occurred de novo or overlapped in ASD (see, e.g. Kakinuma et al. 2007. Am J Med Genet B Neuropsychiatr Genet; and Weidmer-Mikhail et al. 1998. J Intellect Disabil Res 42 (Pt 1):8-12).
qPCR Confirmed the Differential Expression of JAKMIP1, STEAP1, SLC16A6 and VIM Between 39 Male Sib Pairs Discordant for Idiopathic ASD
[0127] To validate the differential expression identified by microarray analysis using independent methods, we performed quantitative PCR analysis (qPCR) of JAKMIP1, STEAP1, SLC16A6 and VIM using lymphoblastoid cell lines from 39 male sib pairs discordant for idiopathic ASD (Table 3). The 39 male sib pairs included the 15 male sib pairs analyzed in the microarray study. JAKMIP1 was selected because we previously demonstrated that the expression of JAKMIP1 was significantly different between 27 male sib pairs discordant for idiopathic ASD (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). STEAP1, SLC16A6 and VIM were selected because the microarray analysis identified the dysregulation of these genes by multiple probes (Table 1 and 2). To attempt to reduce the heterogeneity of idiopathic ASD, we used an IQ surrogate based on Raven's Progressive Matrices. The 39 affected males had an IQ score of more than 70 (Table 3). As shown in FIG. 9, qPCR confirmed the dysregulation of JAKMIP1, STEAP1, and SLC16A6 as expected by the microarray analysis. qPCR also confirmed the reduction of VIM in one affected male as expected in the microarray analysis (6-fold reduction). The expression of VIM was significantly different between the 39 male sib pairs discordant for idiopathic ASD.
[0128] In this study, we performed global mRNA expression profiling of lymphoblastoid cell line from 15 male sib pairs discordant for idiopathic ASD. We focused our attention on (i) genes that were dysregulated in common among idiopathic ASD, ASD with FMR1-FM and ASD with dup15q and (ii) genes whose expression were extremely different (4 standard deviation from the mean of the 15 male sib pairs) in a subset of the 15 affected males.
[0129] Genes Dysregulated in Idiopathic ASD, ASD with FMR1-FM and ASD with Dup15q
[0130] We first tried to identify genes that were differentially expressed between the 15 male sib pairs discordant for idiopathic ASD. 579 probes were differentially expressed between the 15 male sib pairs. However, none of the 579 probes had FDR fewer than 50%, suggesting genetic heterogeneity of the 15 male sib pairs. It may also reflect that ASD can result from many different genetic defects. Given the complexity of ASD, the study of ASD associated with Mendelian single gene disorders or known chromosomal etiologies provides an important perspective (see, e.g. Belmonte et al 2006. Nat Neurosci 9(10):1221-5; and Geschwind et al. 2007. Curr Opin Neurobiol 17(1):103-11). Previously, we analyzed genome-wide expression profiles of lymphoblastoid cells from ASD with FMR1-FM or dup15q and identified shared pathways between these ASD (see, e.g. Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98). We hypothesized that there might be genes dysregulated in common among idiopathic ASD, ASD with FMR1-FM and ASD with dup15q. Comparing the expression profiles, we identified 95 genes that were dysregulated in common among the idiopathic ASD, ASD with FMR1-FM and ASD with dup15q. qPCR analysis confirmed the differential expression of JAKMIP1, STEAP1 and SLC16A6 between 36 male sib pairs discordant for idiopathic ASD.
[0131] JAKMIP1 is associated with Janus kinases (see, e.g. Steindler et al. 2004. J Biol Chem 279(41):43168-77), microtubules (see, e.g. Steindler et al. 2004. J Biol Chem 279(41):43168-77) and GABRB receptors (see, e.g. Couve et al. 2004. J Biol Chem 279(14):13934-43). Because GABRB receptors could interact with the metabotropic receptor 1 (mGluR1) and increase the glutamate sensitivity of mGluR1 (Tabata, et al., 2004), JAKMIP1 might affect mGluR1 signaling through GABRB receptors. GABAergic and glutamergic signaling have been reported to be dysregulated in ASD (Belmonte and Bourgeron, 2006). Two individuals with ASD were reported to have CNVs containing JAKMIP1 (see, e.g. Sebat et al. 2007. Science 316(5823):445-9; and Szatmari et al. 2007. Nat Genet 39(3):319-28), suggesting dysregulation of JAKMIP1 may be involved in the etiology of ASD.
[0132] Although the function of STEAP1 is currently unknown, other members of STEAP family are not only ferrireductase but also cupric reductase that stimulate cellular uptake of both iron and copper (see, e.g. Ohgami et al. 2006. Blood 108(4):1388-94). Epitope-tagged STEAP1 expressed in HEK293-T cells partially colocalized with transferrin (Tf) and Tf receptor, suggesting STEAP1 might modulate iron-transport through Tf/Tf receptor (see, e.g. Ohgami et al. 2006. Blood 108(4):1388-94). It is important to note that levels of Tf and ceruloplasmin (copper-binding protein) in the serum were significantly reduced in children with ASD as compared to their developmentally normal siblings (see, e.g. Chauhan et al. 2004. Life Sci 75(21):2539-49). These findings suggest that STEAP1 may be related to the pathophysiology of ASD. It was shown that a SNP (rs4015735) could be a regulatory variant in expression of STEAP1 and optimal for investigations in case-control studies (see, e.g. Ge et al. 2005. Genome Res 15(11):1584-91). Genetic association studies between the STEAP1 polymorphism and high-functioning ASD might be worth doing.
[0133] SLC16A6 is a putative monocarboxylate transporter although the function has not been characterized. The expression of SLC16A6 was reduced by IL-13 in human monocyte (see, e.g. Scotton et al. 2005. J Immunol 174(2):834-45). Elevation of IL-13 levels was reported in children with ASD (see, e.g. Molloy et al. 2006. J Neuroimmunol 172(1-2):198-205). Interestingly, we identified IL-13 receptor α1 (IL13RA1) as an up-regulated gene in idiopathic ASD, ASD with FMR1-FM, ASD with dup15q (Table 1). It is also important to note that SLC16A6 is located within regions that were identified as an autism locus by genetic analyses (see, e.g. Alarcon et al. 2005. Mol Psychiatry 10(8):747-57). These findings suggest that IL-13 signaling involving SLC16A6 might be dysregulated in ASD.
Genes Extremely Dysregulated in One of the 15 Affected Males
[0134] It has been shown that individuals with ASD carry chromosomal abnormality at a greater frequency than the general population (see, e.g. Christian et al. 2008. Biol Psychiatry 63(12):1111-7; Glessner et al. 2009. Nature; Jacquemont et al. 2006. J Med Genet 43(11):843-9; Marshall et al. 2008. Am J Hum Genet 82(2):477-88; Sebat et al. 2007. Science 316(5823):445-9; Szatmari et al. 2007. Nat Genet 39(3):319-28; Veenstra-Vanderweele et al. 2004. Annu Rev Genomics Hum Genet 5:379-405; and Vorstman et al. 2006. Mol Psychiatry 11(1):1, 18-28). Many studies find rates of detected abnormalities in 5-10% of affected individuals (see, e.g. Veenstra-Vanderweele et al. 2004. Annu Rev Genomics Hum Genet 5:379-405; and Vorstman et al. 2006. Mol Psychiatry 11(1):1, 18-28). These abnormalities include unbalanced translocation, inversions, rings, and interstitial or terminal deletions and duplications (see, e.g. Vorstman et al. 2006. Mol Psychiatry 11(1):1, 18-28). The most frequent finding in ASD is dup15q (see, e.g. Szatmari et al. 2007. Nat Genet 39(3):319-28; Veenstra-Vanderweele et al. 2004. Annu Rev Genomics Hum Genet 5:379-405; and Vorstman et al. 2006. Mol Psychiatry 11(1):1, 18-28). Deletions of 2q37 and 22q13.3 have also been reported more than one occasion (see, e.g. Vorstman et al. 2006. Mol Psychiatry 11(1):1, 18-28). These chromosomal abnormalities can influence gene dosage and expression (see, e.g. Feuk et al. 2006. Hum Mol Genet 15 Spec No 1:R57-66). However, many chromosomal abnormalities are individually rare in the population with ASD. We hypothesized that genes whose expression levels were extremely different from the means of all individuals might be related to chromosomal abnormalities associated with ASD and that the differential expression might be detected in only one or a few affected males in the 15 male sib pairs. In this study, we identified 19 genes whose expression levels were extremely different in one of the 15 affected males. These genes included VIM, OMG, and GABRA4.
[0135] It has been reported that VIM is regulated by FMR1 (see, e.g. Miyashiro et al. 2003. Neuron 37(3):417-31; and Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98) and TSC1/2 (see, e.g. Hengstschlager et al. 2004. Cancer Lett 210(2):219-26) that are causative genes for Fragile X syndrome and Tuberous sclerosis, respectively. Clinical phenotypes of these syndromes include ASD, suggesting VIM may be involved in the etiology of ASD. qPCR analysis confirmed the large reduction of VIM in one of the 15 affected male as expected in the microarray analysis. The mechanism of the 6-fold reduction of VIM is unknown. VIM has also been involved in CNVs that occurred in ASD (Sahoo et al. ASHG2006, #822). Interestingly, qPCR analysis also demonstrated that the expression of VIM was significantly different between the 39 male sib pairs discordant for idiopathic ASD.
[0136] Both OMG and GABRA4 have been reported to have significant association with ASD (see, e.g. Ma et al. 2005. Am J Hum Genet 77(3):377-88; and Martin et al. 2007b. Neurosci Res 59(4):426-30). An association between a subgroup of French patients with ASD and an allele of a non-synonymous SNP (rs11080149) in OMG were reported (see, e.g. Martin et al. 2007b. Neurosci Res 59(4):426-30). The SNP consisted in a G to A transition at position 62 from the start codon, changing a glycine to an aspartic acid. The amino acid change may modulate the precise localization or maturation of OMG (see, e.g. Martin et al. 2007b. Neurosci Res 59(4):426-30). The mechanism and meaning of the over-expression of OMG in ASD remain to be studied. rs1912960 in GABRA4 was also reported to have significant allelic and genotypic association with ASD (see, e.g. Ma et al. 2005. Am J Hum Genet 77(3):377-88). Recently, an autism case with duplication of GABRA4 gene was reported (see, e.g. Kakinuma et al. 2007. Am J Med Genet B Neuropsychiatr Genet). Dysregulation of GABRA4 may be relevant to etiology of ASD.
[0137] Recently, Zhang et al surveyed expression profile of X-linked genes in lymphoblastoid cells from 43 males with X-linked mental retardation (XLMR) (see, e.g. Zhang et al. 2007. Genome Res 17(5):641-8). They identified 15 candidate genes including proteolipid protein 2 (PLP2). These genes were dysregulated only in one or two patients among the 47 males with XLMR. However, they identified a functional PLP2 promoter polymorphism enriched in patients with XLMR using large cohort (see, e.g. Zhang et al. 2007. Genome Res 17(5):641-8). These findings suggest that there might be regulatory polymorphisms in the 19 genes enriched in patients with ASD.
[0138] CNV may also be the cause of the dysregulation of these 19 genes identified in this study. It has been shown that CNV can alter mRNA expression (see, e.g. Durand et al. 2007. Nat Genet 39(1):25-7; Jeffries et al. 2005. Am J Med Genet A 137(2):139-47; Nishimura et al. 2007. Hum Mol Genet 16(14):1682-98; and Stranger et al. 2007. Science 315(5813):848-53) and de novo CNV strongly associated with ASD (see, e.g. Sebat et al. 2007. Science 316(5823):445-9). Further study is needed to analyze CNV of the 19 genes in individuals identified in this study and in large cohort.
[0139] In conclusion, this study provides evidences that genome-wide expression profiling of lymphoblastoid cells is useful to identify susceptibility genes for ASD.
TABLES
TABLE-US-00001
[0140] TABLE 1 Genes dysregulated in common among idiopathic ASD, ASD with FMR1-FM and ASD with dup15q Probe Symbol Gene Name Gene Name Locus Idio/C FM/C Dup/C A_24_P342591 RERE arginine-glutamic arginine-glutamic -0.06 -0.16 -0.14 acid dipeptide (RE) acid dipeptide repeats (RE) repeats A_23_P257365 GFI1 growth factor growth factor -0.12 -0.17 -0.22 independent 1 independent 1 A_32_P150300 LOC100131646 LOC100131646 LOC100131646 -0.06 -0.16 -0.16 A_24_P128163 ADAMTS4 ADAM ADAM -0.07 -0.12 -0.16 metallopeptidase metallopeptidase with with thrombospondin thrombospondin type 1 motif, 4 type 1 motif, 4 A_23_P114929 BRP44 brain protein 44 brain protein 44 -0.07 -0.17 -0.20 A_24_P234196 RRM2 ribonucleotide ribonucleotide -0.09 -0.19 -0.28 reductase M2 reductase M2 polypeptide polypeptide A_23_P120153 RNF149 ring finger protein ring finger protein -0.06 -0.20 -0.15 149 149 A_23_P209995 IL1RN interleukin 1 interleukin 1 0.05 0.14 0.06 receptor antagonist receptor antagonist A_23_P360079 NAP5 Nck-associated Nck-associated -0.19 -0.29 -0.28 protein 5 protein 5 A_24_P484965 LOC730124 LOC730124 LOC730124 0.04 0.09 0.07 A_24_P208452 BBS5 Bardet-Biedl Bardet-Biedl 0.07 0.19 0.21 Buxbaum syndrome 5 syndrome 5 2001 A_23_P17130 MGC13057 -0.09 -0.25 -0.38 A_23_P131676 CXCR7 chemokine (C--X--C chemokine (C--X--C 0.16 0.43 0.66 Sebat motif) receptor 7 motif) receptor 7 2007 A_23_P259362 NPCDR1 nasopharyngeal nasopharyngeal 0.02 0.06 0.06 carcinoma, down- carcinoma, down- regulated 1 regulated 1 A_23_P253250 GCET2 germinal center germinal center 0.13 0.61 0.51 Allen- expressed transcript 2 expressed Brady transcript 2 2008 A_24_P182947 GCET2 germinal center germinal center 0.14 0.59 0.61 Allen- expressed transcript 2 expressed Brady transcript 2 2008 A_23_P253317 GPR171 G protein-coupled G protein-coupled -0.13 -0.24 -0.35 Alarcon receptor 171 receptor 171 2005 A_23_P351215 SKIL SKI-like SKI-like -0.10 -0.24 -0.15 Alarcon 2005, Allen- Brady 2008 A_23_P58036 MCCC1 methylcrotonoyl- methylcrotonoyl- 0.05 0.08 0.14 Allen- Coenzyme A Coenzyme A Brady carboxylase 1 carboxylase 1 2008 (alpha) (alpha) A_23_P144274 JAKMIP1 janus kinase and janus kinase and 0.29 1.00 0.61 microtubule microtubule interacting protein 1 interacting protein 1 A_23_P18465 RFC1 replication factor C replication factor C -0.05 -0.10 -0.09 (activator 1) 1, (activator 1) 1, 145 kDa 145 kDa A_32_P165477 SLC7A11 solute carrier family solute carrier -0.08 -0.23 -0.17 Schellenberg 7 member 11 family 7 member 2006 11 A_23_P121885 ROPN1L ropporin 1-like ropporin 1-like 0.07 0.12 0.10 Marshall 2008 A_32_P154342 SLCO4C1 solute carrier solute carrier -0.14 -0.33 -0.53 organic anion organic anion transporter family, transporter family, member 4C1 member 4C1 A_24_P409042 CDC42SE2 CDC42 small CDC42 small -0.07 -0.13 -0.09 effector 2 effector 2 A_23_P310972 PCDHGB1 protocadherin protocadherin 0.03 0.05 0.05 gamma subfamily gamma subfamily B, 1 B, 1 A_23_P7503 TIMD4 T-cell T-cell -0.29 -0.53 -0.57 immunoglobulin immunoglobulin and mucin domain and mucin domain containing 4 containing 4 A_32_P356316 HLA-DOA major major 0.10 0.28 0.25 histocompatibility histocompatibility complex, class II, complex, class II, DO alpha DO alpha A_24_P288836 HLA-DPB2 major major 0.09 0.24 0.21 histocompatibility histocompatibility complex, class II, complex, class II, DP beta 2 DP beta 2 A_23_P42353 ETV7 ets variant gene 7 ets variant gene 7 0.10 0.26 0.39 A_24_P334640 PAQR8 progestin and progestin and 0.07 0.21 0.18 adipoQ receptor adipoQ receptor family member VIII family member VIII A_23_P255952 MYO6 myosin VI myosin VI -0.13 -0.40 -0.26 A_23_P350451 PRDM1 PR domain PR domain -0.15 -0.34 -0.17 containing 1, with containing 1, with ZNF domain ZNF domain A_23_P93442 SASH1 SAM and SH3 SAM and SH3 -0.17 -0.62 -0.73 domain containing 1 domain containing 1 A_24_P135841 LRP11 low density low density -0.13 -0.36 -0.30 lipoprotein lipoprotein receptor-related receptor-related protein 11 protein 11 A_23_P111593 PSCD3 pleckstrin pleckstrin 0.09 0.21 0.34 homology, Sec7 and homology, Sec7 coiled-coil domains 3 and coiled-coil domains 3 A_23_P252145 C1GALT1 core 1 synthase core 1 synthase -0.07 -0.21 -0.22 A_23_P31453 STEAP1 six transmembrane six transmembrane -0.26 -0.73 -0.46 Barrett epithelial antigen of epithelial antigen 1999 the prostate 1 of the prostate 1 A_24_P406334 STEAP1 six transmembrane six transmembrane -0.21 -0.58 -0.38 Barrett epithelial antigen of epithelial antigen 1999 the prostate 1 of the prostate 1 A_32_P69149 STEAP1 six transmembrane six transmembrane -0.24 -0.65 -0.46 Barrett epithelial antigen of epithelial antigen 1999 the prostate 1 of the prostate 1 A_23_P95130 SLC37A3 solute carrier family solute carrier 0.08 0.17 0.12 Alarcon 37 member 3 family 37 member 3 2002, Trikalinos 2005, Arkin 2008 A_24_P274831 GIMAP7 GTPase, IMAP GTPase, IMAP 0.27 0.53 0.48 Alarcon family member 7 family member 7 2002, Trikalinos 2005, Arkin 2008 A_23_P427023 GIMAP1 GTPase, IMAP GTPase, IMAP 0.20 0.42 0.43 Alarcon family member 1 family member 1 2002, Trikalinos 2005, Arkin 2008 A_24_P92624 GIMAP5 GTPase, IMAP GTPase, IMAP 0.11 0.20 0.29 Alarcon family member 5 family member 5 2002, Trikalinos 2005, Arkin 2008 A_23_P31810 CEBPD CCAAT/enhancer CCAAT/enhancer -0.17 -0.38 -0.39 binding protein binding protein (C/EBP), delta (C/EBP), delta A_23_P112135 TRAM1 translocation translocation -0.09 -0.24 -0.21 associated associated membrane protein 1 membrane protein 1 A_23_P146990 WWP1 WW domain WW domain -0.04 -0.07 -0.07 containing E3 containing E3 ubiquitin protein ubiquitin protein ligase 1 ligase 1 A_32_P176675 FAM92A1 family with family with 0.09 0.13 0.20 sequence similarity sequence similarity 92, member A1 92, member A1 A_23_P168951 ZHX2 zinc fingers and zinc fingers and -0.08 -0.15 -0.10 Yonan homeoboxes 2 homeoboxes 2 2003 A_23_P111978 KCNK9 potassium channel, potassium channel, -0.06 -0.17 -0.14 subfamily K, subfamily K, member 9 member 9 A_23_P94552 TMEM2 transmembrane transmembrane -0.20 -0.59 -0.56 protein 2 protein 2 A_24_P84419 VAV2 vav 2 oncogene vav 2 oncogene 0.04 0.08 0.09 IMGSAC 2001, Auranen 2002 A_23_P217120 EHMT1 euchromatic euchromatic -0.05 -0.16 -0.19 IMGSAC histone-lysine N- histone-lysine N- 2001, methyltransferase 1 methyltransferase 1 Auranen 2002 A_24_P374834 OTUD1 OTU domain OTU domain -0.13 -0.23 -0.30 containing 1 containing 1 A_32_P60459 OTUD1 OTU domain OTU domain -0.13 -0.29 -0.24 containing 1 containing 1 A_23_P52207 BAMBI BMP and activin BMP and activin -0.38 -0.67 -0.51 membrane-bound membrane-bound inhibitor homolog inhibitor homolog A_23_P86623 ENTPD7 ectonucleoside ectonucleoside -0.04 -0.13 -0.13 triphosphate triphosphate diphosphohydrolase 7 diphosphohydrolase 7 A_23_P158570 ACADSB acyl-Coenzyme A acyl-Coenzyme A 0.04 0.18 0.15 dehydrogenase, dehydrogenase, short/branched short/branched chain chain A_24_P189516 ACADSB acyl-Coenzyme A acyl-Coenzyme A 0.06 0.12 0.10 dehydrogenase, dehydrogenase, short/branched short/branched chain chain A_32_P215002 CD44 CD44 molecule CD44 molecule 0.09 0.11 0.19 Trikalinos 2005, Szatmari 2007, Duvall 2007 A_24_P13083 TSPAN18 tetraspanin 18 tetraspanin 18 0.06 0.10 0.09 Duvall 2007 A_23_P2143 SPCS2 signal peptidase signal peptidase -0.06 -0.14 -0.09 Duvall complex subunit 2 complex subunit 2 2007 homolog homolog A_23_P150768 SLCO2B1 solute carrier solute carrier -0.16 -0.32 -0.40 Duvall organic anion organic anion 2007 transporter family, transporter family, member 2B1 member 2B1 A_23_P1775 DPAGT1 dolichyl-phosphate dolichyl-phosphate -0.03 -0.06 -0.08 Duvall N-acetylglucosamine- N-acetylglucosamine- 2007 phosphotransferase 1 phosphotransferase 1 A_24_P241183 CLEC2D C-type lectin C-type lectin -0.14 -0.28 -0.36 domain family 2, domain family 2, member D member D A_24_P52921 BCAT1 branched chain branched chain 0.10 0.19 0.24 aminotransferase 1, aminotransferase cytosolic 1, cytosolic A_23_P306507 KRAS v-Ki-ras2 Kirsten v-Ki-ras2 Kirsten -0.13 -0.22 -0.20 rat sarcoma viral rat sarcoma viral oncogene homolog oncogene homolog A_32_P2452 TMTC1 transmembrane and transmembrane -0.22 -0.68 -0.52 tetratricopeptide and repeat containing 1 tetratricopeptide repeat containing 1 A_24_P98914 PFKM phosphofructokinase, phosphofructokinase, 0.03 0.10 0.08 muscle muscle A_24_P832426 B3GALTL beta 1,3- beta 1,3- -0.13 -0.25 -0.18 Barrett galactosyltransferase- galactosyltransferase- 1999 like like A_23_P428738 ANG angiogenin, angiogenin, -0.13 -0.18 -0.23 ribonuclease, RNase ribonuclease, A family, 5 RNase A family, 5 A_23_P151586 TM9SF1 transmembrane 9 transmembrane 9 -0.04 -0.15 -0.10 superfamily superfamily member 1 member 1 A_23_P65518 DACT1 dapper, antagonist dapper, antagonist -0.26 -0.42 -0.50 of beta-catenin, of beta-catenin, homolog 1 homolog 1 A_23_P348936 CTAGE5 CTAGE family, CTAGE family, -0.06 -0.11 -0.13 member 5 member 5 A_23_P88381 NUMB numb homolog numb homolog -0.07 -0.12 -0.10 A_23_P163306 CGNL1 cingulin-like 1 cingulin-like 1 -0.13 -0.31 -0.26 A_23_P65779 STRA6 stimulated by stimulated by 0.04 0.05 0.11 Szatmari retinoic acid gene 6 retinoic acid gene 2007,
homolog 6 homolog Marshall 2008 A_23_P129128 TARSL2 threonyl-tRNA threonyl-tRNA -0.11 -0.19 -0.11 synthetase-like 2 synthetase-like 2 A_23_P129556 IL4R interleukin 4 interleukin 4 0.10 0.19 0.20 receptor receptor A_24_P227927 IL21R interleukin 21 interleukin 21 0.06 0.21 0.17 receptor receptor A_23_P206822 XPO6 exportin 6 exportin 6 0.04 0.07 0.07 A_23_P3681 NETO2 neuropilin (NRP) neuropilin (NRP) -0.06 -0.14 -0.12 and tolloid (TLL)- and tolloid (TLL)- like 2 like 2 A_23_P14946 MBTPS1 membrane-bound membrane-bound -0.06 -0.15 -0.13 transcription factor transcription factor peptidase, site 1 peptidase, site 1 A_23_P14948 MBTPS1 membrane-bound membrane-bound -0.05 -0.18 -0.15 transcription factor transcription factor peptidase, site 1 peptidase, site 1 A_23_P4294 ZNF232 zinc finger protein zinc finger protein 0.05 0.14 0.08 Duvall 232 232 2007 A_24_P188218 MYL4 myosin, light chain myosin, light chain -0.13 -0.26 -0.23 Cantor 4, alkali; atrial, 4, alkali; atrial, 2005, embryonic embryonic Duvall 2007 A_23 P89455 SLC35B1 solute carrier family solute carrier -0.04 -0.10 -0.10 Cantor 35, member B1 family 35, member 2005, B1 Duvall 2007 A_32_P217346 APPBP2 amyloid beta amyloid beta 0.04 0.05 0.15 Alarcon precursor protein precursor protein 2005, binding protein 2 binding protein 2 Cantor 2005, Duvall 2007 A_23_P152791 SLC16A6 solute carrier family solute carrier -0.06 -0.22 -0.26 Alarcon 16, member 6 family 16, member 6 2005 A_24_P731648 SLC16A6 solute carrier family solute carrier -0.07 -0.24 -0.23 Alarcon 16, member 6 family 16, member 6 2005 A_23_P412577 ANKRD29 ankyrin repeat ankyrin repeat -0.12 -0.25 -0.32 domain 29 domain 29 A_23_P66948 FAM59A family with family with -0.20 -0.49 -0.43 sequence similarity sequence similarity 59, member A 59, member A A_23_P433063 ATCAY ataxia, cerebellar, ataxia, cerebellar, 0.03 0.05 0.06 Schellenberg Cayman type Cayman type 2006 A_23_P50426 KANK2 KN motif and KN motif and -0.09 -0.23 -0.21 Liu ankyrin repeat ankyrin repeat 2001 domains 2 domains 2 A_24_P93887 MED29 mediator complex mediator complex 0.03 0.09 0.07 Liu subunit 29 subunit 29 2001 A_23_P166100 TXNDC13 thioredoxin domain thioredoxin -0.09 -0.21 -0.22 containing 13 domain containing 13 A_23_P17316 NKAIN4 Na+/K+ Na+/K+ 0.05 0.05 0.11 Marshall transporting transporting 2008 ATPase interacting 4 ATPase interacting 4 A_24_P339869 ZNF295 zinc finger protein zinc finger protein 0.05 0.11 0.09 295 295 A_24_P267686 LOC729314 LOC729314 LOC729314 0.04 0.05 0.10 A_24_P387514 LRP5L low density low density 0.05 0.16 0.08 lipoprotein lipoprotein receptor-related receptor-related protein 5-like protein 5-like A_24_P945283 DLG3 discs, large discs, large -0.16 -0.30 -0.47 homolog 3 homolog 3 A_23_P137196 IL13RA1 interleukin 13 interleukin 13 0.11 0.20 0.26 receptor, alpha 1 receptor, alpha 1 A_24_P280113 IL13RA1 interleukin 13 interleukin 13 0.29 0.51 0.61 receptor, alpha 1 receptor, alpha 1 A_23_P213085 unknown -0.07 -0.16 -0.18 A_24_P152775 unknown 0.03 0.05 0.10 A_24_P221285 unknown -0.09 -0.19 -0.30 A_24_P238118 unknown 0.03 0.07 0.08 A_24_P384979 unknown 0.05 0.10 0.17 A_24_P479510 unknown -0.13 -0.21 -0.26 A_24_P493100 unknown -0.04 -0.11 -0.15 A_24_P521662 unknown 0.04 0.09 0.11 A_24_P63397 unknown 0.03 0.13 0.10 A_24_P68079 unknown -0.09 -0.27 -0.18 A_24_P925310 unknown 0.05 0.07 0.11 A_32_P102383 unknown 0.04 0.07 0.21 A_32_P103815 unknown -0.09 -0.15 -0.18 A_32_P137826 unknown -0.20 -0.32 -0.45 A_32_P163894 unknown 0.05 0.15 0.21 A_32_P232682 unknown -0.10 -0.16 -0.17 A_32_P34696 unknown 0.06 0.12 0.11 A_32_P45309 unknown 0.04 0.14 0.13 A_32_P69333 unknown -0.12 -0.39 -0.27 A_32_P72758 unknown -0.14 -0.42 -0.58 A_32_P9924 unknown 0.04 0.09 0.06 aidio/CNT was log2 (mean value of control (N = 15)/mean value of idiopathic ASD (N = 15)). bFM/CNT was log2 (mean value of ASD with FMR1FM (N = 6)/mean value of idiopathic ASD (N = 15)). cdup/CNT was log2 (mean value of ASD with dup15q (N = 7)/mean value of idiopathic ASD (N = 15)). dAutism loci identified by other genetic studies were shown with references.
TABLE-US-00002 TABLE 2 Genes extremely dysregulated in one of the 15 affected males Probe Symbol Gene Name Locus Change Individual Reference A_23_P149529 TACSTD2 tumor-associated calcium 1p32-p31 2.1 AU1038302 signal transducer 2 A_24_P222147 C1orf131 chromosome 1 open reading 1q42.2 1.0 AU055105 frame 131 A_24_P169234 ZAP70 zeta-chain associated 2q12 1.2 AU055105 protein kinase 70 kDa A_23_P79518 IL1B interleukin 1, beta 2q14 2.4 AU0943301 A_32_P204137 GABRA4 GABA A receptor, alpha 4 4p12 2.2 AU016803 Kakinuma 2008 A_23_P122443 HIST1H1C histone 1, H1c 6p21.3 -2.4 AU0943301 A_24_P280628 VPS13B vacuolar protein sorting 8q22.2 -1.1 AU1215304 13B A_23_P258312 NAPRT1 nicotinate 8q24.3 -3.1 AU0943301 Weidmer- phosphoribosyltransferase Mikhail domain containing 1 1998 A_32_P395992 DEC1 deleted in esophageal 9q32 2.3 AU0943301 cancer 1 A_23_P161190 VIM vimentin 10p13 -2.6 AU0943301 Sahoo et. al ASHG 2006 A_23_P161194 VIM vimentin 10p13 -2.6 AU0943301 Newman et al ASHG 2006 A_23_P151046 KLRC1 killer cell lectin-like 12p13 2.1 AU081205 receptor subfamily C, member 1 A_24_P409126 FNDC3A fibronectin type III domain 13q14.2 1.8 AU055105 containing 3A A_23_P48530 INSM2 insulinoma-associated 2 14q13.2 1.0 AU055105 A_23_P65629 KCNK10 potassium channel, 14q31 0.8 AU055105 subfamily K, member 10 A_23_P55286 OMG oligodendrocyte myelin 17q11.2 2.0 AU016803 glycoprotein A_23_P119353 RASIP1 Ras interacting protein 1 19q13.33 3.9 AU1165302 A_23_P21120 MED14 mediator complex subunit Xp11.4-p11.2 1.1 AU016803 14 A_23_P432352 CXorf61 chromosome X open Xq23 1.7 AU016803 reading frame 61 A_23_P73677 RHOXF2 Rhox homeobox family, Xq24 1.4 AU1157301 member 2 A_23_P352494 RHOXF2 Rhox homeobox family, Xq24 1.4 AU1157301 member 2 aChange was the value of log2 (intensity of the proband/mean value of the 15 male sib pairs).
REFERENCES CITED IN TABLES 1 AND 2
[0141] Alarcon et al. 2002. Am J Hum Genet 70(1):60-71 Epub 2001 Dec. 6.
[0142] Alarcon et al. 2005. Mol Psychiatry 10(8):747-57.
[0143] Allen-Brady et al. Feb. 19, 2008. Mol Psychiatry.
[0144] Auranen et al. 2002. Am J Hum Genet 71(4):777-90 Epub 2002 Aug. 21.
[0145] Barrett et al. 1999. Am J Med Genet 88(6):609-15.
[0146] Buxbaum et al. 2001. Am J Hum Genet 68(6):1514-20.
[0147] Cantor et al. 2005. Am J Hum Genet 76(6):1050-6.
[0148] Duvall et al. 2007. Am J Psychiatry 164(4):656-62.
[0149] Kakinuma et al. 2007. Am J Med Genet B Neuropsychiatr Genet.
[0150] Liu et al. 2001. Am J Hum Genet 69(2):327-40 Epub 2001 Jul. 10.
[0151] Marshall et al. 2008. Am J Hum Genet 82(2):477-88.
[0152] Schellenberg et al. 2006. Mol Psychiatry 11(11):1049-60, 979.
[0153] Sebat et al. 2007. Science 316(5823):445-9.
[0154] Szatmari et al. 2007. Nat Genet 39(3):319-28.
[0155] Trikalinos et al. 2006. Mol Psychiatry 11(1):29-36.
[0156] Weidmer-Mikhail et al. 1998. J Intellect Disabil Res 42 (Pt 1):8-12.
[0157] Yonan et al. 2003. Am J Hum Genet 73(4):886-97 Epub 2003 Sep. 17.
TABLE-US-00003
[0157] TABLE 3 Individuals analyzed in this study Individual Code family ID group ADIR ADOS Raven IQ analysis AU016703 AU0167 CNT microarray, qPCR AU016704 AU0167 idiopathic BroadSpectrum Spectrum 100 microarray, ASD qPCR AU016803 AU0168 idiopathic Autism Autism 94 microarray, ASD qPCR AU016804 AU0168 CNT microarray, qPCR AU055103 AU0551 CNT microarray, qPCR AU055105 AU0551 idiopathic NQA Spectrum 108 microarray, ASD qPCR AU060003 AU0600 CNT microarray, qPCR AU060004 AU0600 idiopathic Autism 100 microarray, ASD qPCR AU081205 AU0812 idiopathic Autism not Spectrum 128 microarray, ASD or Autism qPCR AU081206 AU0812 CNT microarray, qPCR AU0943301 AU0943 idiopathic Autism Spectrum 110 microarray, ASD qPCR AU0943303 AU0943 CNT microarray, qPCR AU0995302 AU0995 CNT microarray, qPCR AU0995303 AU0995 idiopathic Autism Spectrum 105 microarray, ASD qPCR AU1038302 AU1038 idiopathic Autism Spectrum 95 microarray, ASD qPCR AU1038304 AU1038 CNT microarray, qPCR AU1086301 AU1086 CNT microarray, qPCR AU1086303 AU1086 idiopathic Autism Autism 110 microarray, ASD qPCR AU1157301 AU1157 idiopathic Autism Autism 119 microarray, ASD qPCR AU1157302 AU1157 CNT microarray, qPCR AU1165302 AU1165 idiopathic Autism Autism 110 microarray, ASD qPCR AU1165303 AU1165 CNT microarray, qPCR AU1165304 AU1165 idiopathic Autism Autism 114 microarray, ASD qPCR AU1165305 AU1165 CNT microarray, qPCR AU1215303 AU1215 CNT microarray, qPCR AU1215304 AU1215 idiopathic Autism Spectrum 119 microarray, ASD qPCR AU1327302 AU1327 idiopathic Autism Autism 104 microarray, ASD qPCR AU1327303 AU1327 CNT microarray, qPCR AU1348302 AU1348 CNT microarray, qPCR AU1348303 AU1348 idiopathic Autism Autism 107 microarray, ASD qPCR AU0081302 AU0081 CNT qPCR AU0081303 AU0081 idiopathic Autism Autism 85 qPCR ASD AU008403 AU0084 idiopathic Autism Autism 94 qPCR ASD AU008405 AU0084 CNT qPCR AU016804 AU0168 CNT qPCR AU016805 AU0168 idiopathic Autism Autism 100 qPCR ASD AU028904 AU0289 CNT qPCR AU028905 AU0289 idiopathic Autism Autism 110 qPCR ASD AU065603 AU0656 CNT qPCR AU065604 AU0656 idiopathic Autism Autism 94 qPCR ASD AU0901301 AU0901 CNT qPCR AU0901302 AU0901 idiopathic Autism Autism 125 qPCR ASD AU1007301 AU1007 CNT qPCR AU1007302 AU1007 idiopathic Autism Autism 119 qPCR ASD AU1054301 AU1054 idiopathic Autism Autism 90 qPCR ASD AU1054303 AU1054 CNT qPCR AU1056301 AU1056 idiopathic Autism Autism 100 qPCR ASD AU1056303 AU1056 CNT qPCR AU1073301 AU1073 idiopathic Autism Autism 103 qPCR ASD AU1073303 AU1073 CNT qPCR AU1193301 AU1193 CNT qPCR AU1193302 AU1193 idiopathic Autism Autism 100 qPCR ASD AU1234301 AU1234 CNT qPCR AU1234302 AU1234 idiopathic Autism Autism 93 qPCR ASD AU1325301 AU1325 idiopathic Autism Autism 100 qPCR ASD AU1325302 AU1325 CNT qPCR AU1327303 AU1327 CNT qPCR AU1327304 AU1327 idiopathic Autism Autism 114 qPCR ASD AU1338303 AU1338 CNT qPCR AU1338304 AU1338 idiopathic Autism Autism 110 qPCR ASD AU1344302 AU1344 Idiopathic Autism Autism 128 qPCR ASD AU1344303 AU1344 CNT qPCR AU1346302 AU1346 idiopathic Autism Autism 125 qPCR ASD AU1346304 AU1346 CNT qPCR AU1412301 AU1412 idiopathic Autism Autism 131 qPCR ASD AU1412302 AU1412 CNT qPCR AU1424303 AU1424 CNT qPCR AU1424304 AU1424 idiopathic Autism Autism 103 qPCR ASD AU1466301 AU1466 CNT qPCR AU1466302 AU1466 idiopathic Autism Autism 94 qPCR ASD AU1549303 AU1549 idiopathic Autism Autism 125 qPCR ASD AU1549304 AU1549 CNT qPCR AU1562301 AU1562 CNT qPCR AU1562303 AU1562 idiopathic Autism Autism 122 qPCR ASD AU1601302 AU1601 idiopathic Autism Autism 114 qPCR ASD AU1601303 AU1601 CNT qPCR AU1610304 AU1610 CNT qPCR AU1610306 AU1610 idiopathic Autism Autism 90 qPCR ASD AU039304 AU0393 ASD with Autism microarray FMR1FM AU039305 AU0393 ASD with Autism microarray FMR1FM AU046703 AU0467 ASD with Autism microarray FMR1FM AU046706 AU0467 ASD with Autism microarray FMR1FM AU066703 AU0667 ASD with Autism microarray FMR1FM AU066704 AU0667 ASD with Autism microarray FMR1FM 01-19- ASD with not Autism Autism microarray dup15q 03-43- ASD with Autism Autism microarray dup15q 02-7- ASD with Autism Autism microarray dup15q 98-19- ASD with Autism microarray dup15q AU006504 AU0065 ASD with Autism microarray dup15q AU010603 AU0106 ASD with Autism Spectrum microarray dup15q AU010604 AU0106 ASD with Autism Autism microarray dup15q
TABLE-US-00004 TABLE 4 Gene networks identified by IPA using the 92 genes dysregulated in ASD Genes in network Top functions Actin, ADAMTS4, ALOX5AP, ANG, CLEC2D, Cellular CTSS, CXCL11, dihydrotestosterone, Development ETV7, GLUL, GUSB, HLA-DOA, HLA-DQB1, Inflammatory HLX, IFNG, IL13, IL13RA1, IL13RA2, Disease IL4R, PTEN, RARA, RNF111, SKIL, SLC16A6, Hematological SMURF2, STRA6, TGFB1, TGFBR1, System Development and Function TIMD4, TPM3, TRAM1, TYK2, UBE2D1, WWP1, XPO6 ANKRD29, ASNS, AZU1, BAMBI, BCAT1, BRP44, Cancer, CD70, DUSP5, DUSP16, EGF, FSTL1, GAS1, GFI1, GFI1B, GZMK, IL15, IL21R, Cell Death, MYC, MYL4, MYO6, NR3C1, PFKM, PLAGL1, PRDM1, RERE, RRM2, RRM2B, Cell Cycle SASH1, SOD2, STAT5B, TCF3, TERT, TP53, TYK2, ZFP36L1 ABCC5, AKR1C14, ALOX5AP, beta-estradiol, Cell Cycle, CCDC80, CCDC92, CEBPD, CLEC11A, CXADR, CXCL11, CXCR7, DBN1, DLG3, DUSP5, Cellular FLII, GCET2, GDA, IHPK2, IL1RN, Development, KRAS, MBTPS1, MED18, MED20, MED29, MMD, Hematological NBL1, NFkB, PCOLCE, PDGF BB, System Development and Function PRDX4, PSCD3, SLC35B1, SPCS2, TLR9, VAV2 ACADSB, AGT, ANKRD25, CDC42, CDC25C, Cell Cycle, CDH3, CDKN2A, CLU, DPAGT1, EHMT1, ENTPD7, ERBB2, ERRFI1, GIMAP1, GTP, Histone Cancer, h3, HRAS, hydrogen peroxide, ITSN2, JAK1, JAKMIP1, LRP11, MCCC1, NUMB, Cell phosphate, RALBP1, RALGDS, Morphology RASGRF2, RASSF5, RFC1, RIN1, SLC7A11, SUZ12, TYK2, ZHX2
TABLE-US-00005 TABLE 5 ILLUSTRATIVE HUMAN DASD POLYNUCLEOTIDE SEQUENCES RETREIVED FROM GENBANK LIBRARY DATABASE USING THE DISCLOSURE IN TABLES 1-4 JAKMIP (SEQ ID NO: 7) GGGGGCTGCGCTCGCTACGTCCGCTGCTGCTGCCCGGCTCGGGCCTGAGCGCCGAGCAGGATCCCAAGTGATG GTGGTTTCCTCGGAGGGCGAGCTGAGTACTGCGCGACTGGTTAGCACGGTGGAGCTGGTAGCCACGCCTGCTG GCTGGCGTGCGTGAACAGGTGTGGACCGCAGGATCTCAGCACTCTGACCCAAGGGGAAGCATGTCGAAGAAAG GCCGGAGCAAGGGCGAGAAGCCCGAGATGGAGACGGACGCGGTGCAGATGGCCAACGAGGAGCTGCGGGCCAA GCTGACCAGCATTCAGATCGAGTTCCAGCAGGAAAAAAGCAAGGTGGGCAAACTGCGCGAGCGGCTGCAGGAG GCGAAGCTGGAGCGCGAGCAGGAGCAGCGACGGCACACGGCCTACATTTCGGAGCTCAAGGCCAAGCTGCATG AGGAGAAGACCAAGGAGCTGCAGGCGCTGCGCGAGGGGCTCATCCGGCAGCACGAGCAGGAGGCGGCGCGCAC CGCCAAGATCAAGGAGGGCGAGCTGCAGCGGCTACAGGCCACGCTGAACGTGCTGCGCGACGGCGCGGCCGAC AAGGTCAAGACGGCGCTGCTGACCGAGGCGCGCGAGGAGGCGCGCAGGGCCTTCGATGGAGAGCGCCTGCGGC TGCAGCAGGAGATCCTGGAGCTCAAGGCAGCGCGCAATCAGGCAGAGGAGGCGCTCAGTAACTGCATGCAGGC CGACAAGACCAAGGCAGCCGACCTGCGTGCCGCCTACCAGGCGCACCAAGACGAGGTGCACCGCATCAAGCGC GAGTGCGAGCGCGACATCCGCAGGCTGATGGATGAGATCAAAGGGAAAGACCGTGTGATTCTGGCCTTGGAGA AGGAACTTGGCGTGCAGGCTGGGCAGACCCAGAAGCTGCTTCTGCAGAAAGAGGCTTTGGATGAGCAGCTGGT TCAGGTCAAGGAGGCCGAGCGGCACCACAGTAGTCCAAAGAGAGAGCTCCCGCCCGGGATCGGGGACATGGTG GAGCTCATGGGCGTCCAGGATCAACATATGGACGAGCGAGATGTGAGGCGATTTCAACTAAAAATTGCTGAAC TGAATTCAGTGATACGGAAGCTGGAAGACAGAAATACGCTGTTGGCAGATGAGAGGAATGAACTGCTGAAACG CTCACGAGAGACCGAGGTTCAGCTGAAGCCCCTGGTGGAGAAGAACAAGCGGATGAACAAGAAGAATGAGGAT CTGTTGCAGAGTATCCAGAGGATGGAGGAGAAAATCAAGAACCTCACGCGGGAAAACGTGGAAATGAAAGAAA AGCTGTCAGCGCAGGCGTCTCTGAAGCGGCATACCTCCTTGAATGACCTCAGCCTGACGAGGGATGAGCAGGA GATCGAGTTCCTGAGGCTGCAGGTGCTGGAGCAGCAGCACGTCATTGACGACCTCTCACTGGAGAGAGAACGG CTGTTGCGCTCCAAAAGGCATCGAGGGAAAAGTCTGAAACCGCCCAAGAAGCATGTTGTGGAGACATTTTTTG GATTTGATGAGGAGTCTGTGGACTCAGAAACGTTGTCCGAAACATCCTACAACACAGACAGGACAGACAGGAC CCCAGCCACGCCCGAAGAAGACTTGGACGATGCCACAGCCCGAGAGGAGGCTGACCTGCGCTTCTGCCAGCTG ACCCGGGAGTACCAGGCCCTGCAACGCGCCTACGCCCTGCTCCAGGAGCAGGTGGGAGGCACGCTGGACGCTG AGAGGGAGGCCCGGACTCGGGAGCAGCTACAAGCTGATCTGCTGAGGTGTCAGGCCAAAATCGAAGATTTGGA GAAGTTACTGGTTGAGAAGGGACAGGATTCCAAGTGGGTTGAAGAGAAGCAGCTGCTCATCAGAACAAACCAA GACTTGCTGGAAAAGATTTACAGACTGGAAATGGAAGAGAACCAGCTGAAGAATGAAATGCAAGACGCCAAGG ATCAGAACGAGCTGTTAGAATTCAGAGTGCTAGAACTCGAAGTAAGAGACTCTATCTGTTGTAAACTCTCAAA CGGAGCAGACATTCTCTTTGAACCCAAACTGAAATTCATGTAAAGCTCTCAGATGTTTTCAAGCATGTGTAAA GGGGACATGTTATAGTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTAAATCTGTATGTTCAGAATAATTTCAC TGCCTTAATGTGTTCTGGAGAGCGTGCTCACCCAAGTCTATGGACATGTACCAGAGCTAATATATTTATTGCC TATGGCTTGTTTTGCACTTAATAAAATAATTTGTTTTTACAAAAAAA STEAP (SEQ ID NO: 8) GCGGACGCGGGGCGCCAGCAGGTGGCGCTGGACGCGCAACGGACAAGGAGGCGGGGCCTGCAGCTGGCTTGGA GGCTCCGCGCTCTGGAGGCTCAGGCGCCGCGTGGGGCCCGCACCTCTGGGCAGCAGCGGCAGCCGAGACTCAC GGTCAAGCTAAGGCGAAGAGTGGGTGGCTGAAGCCATACTATTTTATAGAATTAATGGAAAGCAGAAAAGACA TCACAAACCAAGAAGAACTTTGGAAAATGAAGCCTAGGAGAAATTTAGAAGAAGACGATTATTTGCATAAGGA CACGGGAGAGACCAGCATGCTAAAAAGACCTGTGCTTTTGCATTTGCACCAAACAGCCCATGCTGATGAATTT GACTGCCCTTCAGAACTTCAGCACACACAGGAACTCTTTCCACAGTGGCACTTGCCAATTAAAATAGCTGCTA TTATAGCATCTCTGACTTTTCTTTACACTCTTCTGAGGGAAGTAATTCACCCTTTAGCAACTTCCCATCAACA ATATTTTTATAAAATTCCAATCCTGGTCATCAACAAAGTCTTGCCAATGGTTTCCATCACTCTCTTGGCATTG GTTTACCTGCCAGGTGTGATAGCAGCAATTGTCCAACTTCATAATGGAACCAAGTATAAGAAGTTTCCACATT GGTTGGATAAGTGGATGTTAACAAGAAAGCAGTTTGGGCTTCTCAGTTTCTTTTTTGCTGTACTGCATGCAAT TTATAGTCTGTCTTACCCAATGAGGCGATCCTACAGATACAAGTTGCTAAACTGGGCATATCAACAGGTCCAA CAAAATAAAGAAGATGCCTGGATTGAGCATGATGTTTGGAGAATGGAGATTTATGTGTCTCTGGGAATTGTGG GATTGGCAATACTGGCTCTGTTGGCTGTGACATCTATTCCATCTGTGAGTGACTCTTTGACATGGAGAGAATT TCACTATATTCAGAGCAAGCTAGGAATTGTTTCCCTTCTACTGGGCACAATACACGCATTGATTTTTGCCTGG AATAAGTGGATAGATATAAAACAATTTGTATGGTATACACCTCCAACTTTTATGATAGCTGTTTTCCTTCCAA TTGTTGTCCTGATATTTAAAAGCATACTATTCCTGCCATGCTTGAGGAAGAAGATACTGAAGATTAGACATGG TTGGGAAGACGTCACCAAAATTAACAAAACTGAGATATGTTCCCAGTTGTAGAATTACTGTTTACACACATTT TTGTTCAATATTGATATATTTTATCACCAACATTTCAAGTTTGTATTTGTTAATAAAATGATTATTCAAGGAA AAAAAA NAPRT (SEQ ID NO: 9) GCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTG CTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGT TCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCG CTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGAT CCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCC TCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCT GCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAG AAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCT ACCTGGGCGGCTTCGACAGCAGCAGCAACGTGCTAGCGGGCCAGCTGCGAGGTGTGCCGGTGGCCGGGACCCT GGCCCACTCCTTCGTCACTTCCTTTTCAGGCAGCGAGGTGCCCCCTGACCCGATGTTGGCGCCAGCAGCTGGT GAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGG GGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCA GGGCCTCCTGGACACCTACAGCGTGTGGAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGA GAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCA AGGTCTTCCGAGCTGCTGCAGCCCAGTTCCAGGTGCCCTGGCTGGAGTCAGTCCTCATCGTAGTCAGCAACAA CATTGACGAGGAGGCGCTGGCCCGACTGGCCCAGGAGGGCAGTGAGGTGAATGTCATTGGCATTGGCACCAGT GTGGTCACCTGCCCCCAACAGCCTTCCCTGGGTGGCGTCTATAAGCTGGTGGCCGTGGGGGGCCAGCCACGAA TGAAGCTGACCGAGGACCCCGAGAAGCAGACGTTGCCTGGGAGCAAGGCTGCTTTCCGGCTCCTGGGCTCTGA CGGGTCTCCACTCATGGACATGCTGCAGTTAGCAGAAGAGCCAGTGCCACAGGCTGGGCAGGAGCTGAGGGTG TGGCCTCCAGGGGCCCAGGAGCCCTGCACCGTGAGGCCAGCCCAGGTGGAGCCACTACTGCGGCTCTGCCTCC AGCAGGGACAGCTGTGTGAGCCGCTCCCATCCCTGGCAGAGTCTAGAGCCTTGGCCCAGCTGTCCCTGAGCCG ACTCAGCCCTGAGCACAGGCGGCTGCGGAGCCCTGCACAGTACCAGGTGGTGCTGTCCGAGAGGCTGCAGGCC CTGGTGAACAGTCTGTGTGCGGGGCAGTCCCCCTGAGACTCGGAGCGGGGCTGACTGGAAACAACACGAATCA CTCACTTTTCCCCACAAAAAA GABRA (SEQ ID NO: 10) GGGCTGGCTGAGCGCGGGCGAGTGTGAGCGCGAGTGTGCGCACGCCGCGGGAGCCTCTCTGCCCTCTCCTCGC ACCCTGCTCAGGGCATCTGAAGAGCCTGGAAACGTGAACAGGCTTGAAGTATGGCATGTTGCAAAGATGGTTT CTGCCAAGAAGGTACCCGCGATCGCTCTGTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGC GGTTTGTTTAAACGAATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATC CTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGAAGTGAAAA CTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATACACAATGGATGTGTTCTTCAG GCAGACATGGATTGACAAAAGATTAAAATATGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTA ACGAAAGTGTGGACCCCTGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA ATAAGCTTTTTAGAATTATGAGAAATGGTACTATTTTATACACAATGAGACTCACCATAAGTGCGGAGTGTCC CATGAGATTGGTGGATTTTCCCATGGATGGTCATGCATGCCCTTTGAAATTCGGGAGTTATGCCTATCCAAAG AGTGAGATGATCTATACCTGGACAAAAGGTCCTGAGAAATCAGTTGAAGTTCCGAAGGAGTCTTCCAGCTTAG TTCAATATGATTTGATTGGGCAAACCGTATCAAGTGAAACCATCAAATCAATTACGGGTGAATATATTGTTAT GACGGTTTACTTCCACCTCAGACGGAAGATGGGTTATTTTATGATTCAGACCTATATTCCGTGCATTATGACA GTGATTCTTTCTCAAGTTTCATTTTGGATAAATAAAGAATCAGTTCCCGCTAGGACTGTATTTGGAATAACAA CTGTCCTCACCATGACCACACTAAGCATCAGTGCACGACATTCTTTGCCCAAAGTGTCCTATGCTACCGCCAT GGACTGGTTCATAGCTGTCTGCTTTGCTTTTGTATTTTCGGCCCTTATCGAGTTTGCTGCTGTCAACTATTTC ACCAATATTCAAATGGAAAAAGCCAAAAGGAAGACATCAAAGCCCCCTCAGGAAGTTCCCGCTGCTCCAGTGC AGAGAGAGAAGCATCCTGAAGCCCCTCTGCAGAATACAAATGCCAATTTGAACATGAGAAAAAGAACAAATGC TTTGGTTCACTCTGAATCTGATGTTGGCAACAGAACTGAGGTGGGAAACCATTCAAGCAAATCTTCCACAGTT GTTCAAGAATCTTCTAAAGGCACACCTCGGTCTTACTTAGCTTCCAGTCCAAACCCATTCAGCCGTGCAAATG CAGCTGAAACCATATCTGCAGCAAGAGCACTTCCATCTGCTTCTCCTACTTCTATCCGAACTGGATATATGCC TCGAAAGGCTTCAGTTGGATCTGCTTCTACTCGTCACGTGTTTGGATCAAGACTGCAGAGGATAAAGACCACA GTTAATACCATAGGGGCTACTGGGAAGTTGTCAGCTACTCCTCCTCCATCGGCTCCACCACCTTCTGGATCTG GCACAAGTAAAATAGACAAATATGCCCGTATTCTCTTTCCAGTCACATTTGGGGCATTTAACATGGTTTATTG GGTTGTTTATTTATCTAAGGACACTATGGAGAAATCAGAAAGTCTAATGTAATTTCGTTGCTATAGTAGTTTG CTAAAAGATGATGAAAATGCAGAATGTCTTTTTAAATGTTTTTAAATATAAACAAATATTCTTTACTAAAATA AAAACTCTGTGTAATTTTTCCATTTAAAGATATAAGCCAGTTATTGGGAGAGTTAATTAATTCCTGAGTGAAA AAGTGAACTATGTTTTTTTTCAGAAAAATTATTTTAAAAGAACTCAGCATTCAGTTAGATAGAATACACACCA TCCTGGAAAGTTGGGATAAGAGAAATAGAGCTATTAGAGACAAGTGGCGCATATTTTTTCATTGATATTTGAA AACAGACTATGACATTTTAAAAATCTGCCCTATGAGTATCAACCTGCCACCCTAAATTTCCCAGTGGCACTAC CCTTAACCAGAATTGTTTATTAGATGTCATATGCAGTGACCTTTGGTGATCTTCTTAGGAACTTCAAGAAAAG GAATTTTCCTGTTAAATTAAACATTGGCAAAAGGAAATGGAATAGTATAAACACTGATCAATAGAGTAAAATA TCTGCTGCATAAAAAACTAAGACAAAGACCAGAGGAAATATCTTCCCTTTCTTATGTTGGCTAAACAGTACTT AACAGTTGACTTGAAATTTTGTTCTCTGAGCCAAAGTTTAACTCATTGTATGAATTCTTTTTCATGGTAGTTC ATTCAGTTATGTGTTTATTTACTACATAGTTATTCAGAGCCTACTGTGTTCCAGGAACTATGCTAGAAACTGT CTCTCTAGGAAAGCTCTTGCACCTTTATCTACAATATTACTTAAAAAGTAGAACAGTCAATGCATGCCAAAGA ACCATAAACTAGCAGAGGACATTGCATTCTTTAGTGAAGGACATTTATTTAGAGTCTGACAACATATTCAAAA TATTTTTCAGCCTCTACTGATAGTGGATAACAAATATATTTGTTCACATAACCACTTTGATGTCAGTACAACT TCAGCAATTGGTTTTCAAAATAGATGAGAATATGGTACAGATTGTTCTATAAGTGAAAAGCATTATGTACTTG AAAGTAAAAATCAGGGCAATATAAGACTTAATAGATTAACTGTCGCAAATTTGATCAGAGTCACAGAGTAGAA TTTGATCAGAATCACAGAATCATCAGACATAGGAACTGAGCACAGGCTTTTTCAGGTGCTTTCCCCAAGATAG ATCTAGATATTAGCTAGTGAAATGCTAAATTTTGAAGAGTTTTGTGTCCGTAGTTCTGTAATTCTGGGCAGTC ATCATGTTGGTTTTTTTGGGAGTTTTTTTAAGGTTTAATAACTAAGGGGAATATTTTAAAATTAAGAGAGCAG CAAATGAAAGGAGTAAAGAAAAAAATAGCTGTCGGGTAGGATGCCACTGACTCTGCTATGTGATTTATCAGGG TTTTCATCTACTGACTTCTTTCTCATTAGGTAGGCTTAACAACTTACTTGAGAATTTTGCAACTGTCTATGCA GCTGAATCTAAGTATGGTTTTTTGTCATATTGCCTCTAGATTTTCTTCTGTGCTTCTCTCTATCTGCTCTGGA ATGGATGAGTGAATGTGTTCTGGGTGTTTTAGGGAACATATTGATAGAAATGACCACCTTGCAGACAAAATCT CTCTCTCTCTTTTTGTTTTTATAGAAAAGAAGTGATAGTAGTTAATTGGCATCGATTTTTCAGATATTGCACT ACCTTATAATGGTTGTTTTTGATACCTGAAAATTGTGCAAATGCCAAATATTAATTGTAAGTCATATCTGAGA AATCATTCTTGGCTGTCTTTCTAGGTATTCCATAGAATCAACACATTTTAAGGCTGAAAGATACTGTCGAAAT CACCCAGTCCCAACCCCCCAATTTAAAATTGATTCTAGTAAAATTAGGTCCAGTAACACCTGTATATATGTAT ATATTTAATAAAGAGTACTTGTACAAAAAAGCTTATCATAAATTATTTCATGAATGTGAATAGATTTCTGGCC TTGAGGACGATGTTTGGAAATATGGTTGGAAGCACAATTCATTCGCTACTAGTTATTCAGAGCGTACTTTGTT CCAGGAACTATGCTGGAAACTGATAGTTCACTATTCTGATGAAAAGGCTGGTTTTGTTGTTGTTGTTGTTGTT GTTGTTGTTGTTTTTGGTGAGGAACTCTTACTCTTTGCTAATCTATTGGCCTATCTTAAGAAATAATTATTTG GTTATTCATTGGCTTCCTTTAAAAAAAAGTGTTCTTCTACAAATCTTACAGAGTGTAAAGAGATAAAAAGAAA TGATTTTTTTTCTTACCTTTACATATGAAGGTTTAAAAATACATCATGTGGCCAAAGAATGAGAAAGGACAGA ATTAACCAAGGATTCTTAATTGTTAATTTGAAGAACACATTAACCAGAAAGCTTAAACATTATTATTAAAATA AATTATTTCATTTGCACACAATGATAATAATGATGATAATAATAATAATAATAATAATAATAATAATAATAAT AATAATATGTTGTTTGCTTTCCTTAACTGAATTTCATCAAATTCATTCAGTGATTTTTATTTTGGTCATTATT TCTATCTTCCCAATAACCCAGAGGTACATCAAGTAAAAACACTTTTGCAAAGAGCCAGTCACTTTTCCCTCTT AGAAAATCTCAGAAGAATGATTAGGGGCACCCAAAGTTCTGGTTATCTATGAATAATAATGAATAATTTTGGC TGAGAATGGTACCTTTATATAACTCTTTTAAAGATGAAATTCAGAATAATTTTATTCAGGACCTAGTATCTGC AGTCCATGTTGGCCACTAACTGCTACATAATTACTTTCAATTTCCTCCAGGCATGACTAGGTATAAACATATA TTTACATGATTAATCCACATTTTAAAATGACTTGCACTTGTGCATATACATAGTACTTTGAATAATGTATATT TTAAATTGGACCTCACAAATCTTGTATTAAAGTAGGTAGAGAGTAGAGTCACACTTTTTTTGATGAAATGAGT CACAGAGAAGTTACATGACAAAGATAAAATCACAGGGTTGGAAAGAACTTTGAAAGGTCATTTTTCAATAATC TCACCTTAAAAGTGACCCCTTTTCAAACAAAGCATAAACAATTTATTTGTGGCTTATTTTACCCATGAGCTGG CCAATACTTCCTGGCCTAGAAAAATATCTCCACTCTCCCCATTCCTGTTCTTAATGGTCTTCTCTTCTCAATT TGTAAATATTCTCCAGTAAAAGACACCAGGTGTGGAGATGGGTCACTTAATTTCAAGTTCTGAGTGTCTTGTG GTTTTAAACAAGTCTCTTAACCTCTCTAAGACTGATTCCTCATTTATAACAGGGAGGAGGTGGATTATGTAAT ATCTAAGAGCTTTTCAGTTTTAATACTCTCTGATTCTCATAGTAAATACAAGCATACTCTTGTAAGAAAAACA CTGAATACTTTGAACCACAAATAAGTGTTTATGGACAAAAATTTAGTTCTACTGCTTGATTACTTTAAGTTCA TTGCTTGCTTCAAACTAAGGTTTCCCTACCTTCAAAAATATATATAACATCTCTCCATTTAGATAAAGTATAT TCTTCCCCAGGGAAGACTGTATTCTTTAAAGACAGTAGAATATTGGCTATTTCTCTTTTCTGGGATTTCCTGG GCTTTTATTCACTAAATGGGCTCCTGCCCAGTTTGGGTACTGTGCTGATTTTTAGATATACAGAGATAAAAAT AGCCCCTTTCCTTGCAGGTAGTCACAGTCCGGAAGAGATGATAGATGCATAGACAAAAAATTATGGGATGTAA CTAATGCTTCAGTAGAATACAGCAGGGCCAAAACTAGAGTGATACTCATCTCAGGCACAAATATATATGGGGA CATCAAAACTTCAATAATCAAGATACCTAATATTTAAGTGAATATTTTTAAAACTCAAAATTAATGCAAAAGA TTTATGATGAACAGAATATACAAATTTTAAATAAATTAATAGAATCAGTAGTAATAATATTTTCTTCTGCCTC AGGCTCCAAAATTGCTCAGCATAGCACTGATCTAGATAGAGGTGGATAAAAGATCCACATAACTTAATTACAT TGTTGAAGGAGAGGAACAAGAGTGATAGCAGAGAAGGTTTCACAGATATAATCTTAAGCTAAATTTTATAGAA TGATTTGGAGTTCTTATAGCCTCCATTCCCACTTCCACAAACAAACAAAAAAATGAAAGCGCAATTTTATCAG CACCTGAGGCAGGAGAAGAGATGAGGATGTGGAAAGTCAAGGGGAACTCTTACTACAAATTCTTAGTTCTGTG TTTGGAGGTAAGGGTGAATGCAGGGAAGTGAGAGTTGTTGATGTTGGAAAGACCTAAAGAGCCTGGATTAGGA AGAGTTTTGTGTAAATTACTGAAGGAATGGAATTTGATCAGGATTAGTGGCAATTTATTAAAAATCTTGAAGA ATAATACGATGAAAACTAACATCCTTATTTTTCTGTTTTAGAGAAAGCACCTGATTATTGTGTGAACTATGGT TTGGAGGGCCACAAATCTAGAGGTAGTGGAACAGTTGAGATCTCTTATTTTTTCTTTCCTGTCTTAAACTTTG CCTTCTATTCCTTTTTTCTTTTTTTGACCGCAATGACTTCATTGTCATTTGTAAAAGTGATACATGACTGTTA AAGATAGACATTGTAGAAACTTAAAAACAATCTCAAAATTCTACCACCCAGAAATCAGAAATATTTTGTATTT GGATATGTTTGTCTAGAAGAGTAGATTGCTTGATTAAAAGACAGAGTTTTATAAATGTAGAAGCCAATATGAC ATACATGCTGCCATTAAATAATAAAAAATTAAATTGACTTTTATCTCAAGATAAGATTAAAATTGGAGGGTAA AACTGAAGAAATTGTTGAAATTTGGATGGTGCTTCTTTAAAGCAAGAGATTTAGAGAGTCAGAGCTTTTTATC CCAGGTTTCAATCTTTATTTCAGGAAAATTTTCTGCAATTTTGTCTAAGTTAATTTTTTTTTTTTAAGAAATG CCAATTATGTCAAATCCCTTTTGTCTCTATACAATAGTCCCCAACTGTTTTGGCAACAGGCACGGGTGAGGGT GGGGGAATGGTTTTCAGATGAAATTGTTCCATCTCAGATCATCAGGCATTAGTCGATTCTCATAAGGAGCGGA CAACCTTGCATGCCCTCCTATGAGAATCTAATGCCGCCGCTAATCTGACAGGAGGCAGAGCTCAGGCGATAAT GCTCAATGGGTGCCACTCACCTCCTGTTGTGCTGCCCAATTCCTAACAGGTCATGGATAAGTACTGGTCAGTG GCCCAGGGGTTGGGGACCACTGCTCTGTAACTATTTACAGTATTCTTTGTAACTACTTTGGTATCTTTAAAAT TTTCTTTAACTTTTGTCAACCATAACCCTAGTGAGTTTTCAGTTGTGATTATTCTATTTTGTAACTTCCAATG TACTTTTCAACTTCATAATGGTTAATTTTGTTTTCCATTGCTTTCTTGGTCACTGTCATTTCATTTTTCTTCT CTTTCTCTATTTTTACCATTGCTTTATTGAAATATCTTCTTTGAGCTTCTCATGTTTCTCTATTAATGAGATC ATGTCTATAATATTTTTTGAGACTACAGAGACCTATTTATATAAACTCTTCCTCTATTTCTTGAAAAAGTTTT TATCTGGCGTGAGCTTCATCTGCTTTTTCATTGAGGTTTTATCTCCCTTGCCTATTTTTGGGGCTGGTTTCTT TCTATTAATCACTGAGCAGAGCCAGCTATTTACTGAACTACAGTGTGGGAAGTGGTGGGAGGGTGAGTCAGAT CAGCCCACAGAAGCTATTTAAATTTCAGGTTTCAAGCCCACCTCCCCAAAACCGTTTTATGTGTTTTTTCTTC TGCCCAGGCACCATATTTTTATATCTATTTTTGACATTTGGGCGGCCTATGTAGTTCACAGTGTAAAACTCTC TGTTTTACTTTCTTTATGTTATTGCTAGTGATTATTGCTTGTAGTCCCACCCCCTTCCCCACATTAGCCTTAG TATTCTATATTATTCAGCAAGCTTGTTCACAACTCTCAAATATAGTCTATCAGAATTTTTATCTTTACCTCTA CATTCCACTATTCGGAAGTATATAGTAAAATCGTATGAAGACAGATTTTGTCTTTTTCTTGCCTGTTTACACT CTATCTTACAGAGGTTTCAAACAAACCATCTTTGTTTGAAACATCGCAGGATAATGATACTTATTGAAATCTA CATCCTGCCCAAGATATATGCCAGTCAATTTCCTTTCTCCTATTAGTGCAAATGGCTACCTACTTAAAAGCTG CTGACTATAGTTTGTCATAATTACTTGTTAATTACAGATATGGTTTTCATTTTTTTTTCTCAATTTTTCATTA TGTTATTTTTGGAGACTGTCTTAGGTGGGGAGTGAATTATAAATATTTTTATTTCACCACCTTTAACTGAGTC ACCATATGTTATTTGCACTTCCAATAGACCAGGGATTGACCAGAGTATCTTTTACTGATATGACCACCAGAGC TACATGGCTTTTACCTTCTGTATATCAGATGTCACTGGAATCAAGCATTAAACCTAGATTAAATCTGGATTAA ACCAGCTGTATGGCACCTTAGAAAATTGAGAAGGACTAGGAAGCTGATAGAAAGAACTCCTGTATAAAAAATA AATTCTTTTTACATTTTCCTTGGTAGTATTTCTGCAAGCTTCTTTAGTTTCTATAGGGGAATCCCAGAGTTTT CCTCTGAGATTGCTTCCCTTTCCTTTGTATTTTCATTTTTCCCTCTTGGGCTTTACTTTTCAGTCGTGTATTT CTATCCCAATGTTAATTTATTACACTGTTTATATTTTCCTGTCCTTCAATTCATCAGTAGATTAGTGAAGTAC TTATTCCTTTAATTATAAGTATAAACGTTTTTAATTTCTTTTTGGATAACGATACATTTAATGGAAAATTTTT AAATGCTATGGTTTCTTAATAGCTTTTCTCTACCACTAATTACTTCCGTTAAAAAAAAAAGAAATACCCATGC GTAATATAAAAGAAATTTTGAATAAAATGTTATCCTTTCCTTTTACTAGAGACAAACATCTCCACTTCAAAAT GGAAAAATGGAACTATGCAAAGGAAATTTACGATATTCAAGAGTATGATATTATCACTGAACCGATTAATTTA ATTGAAAATACTAACCTGCAAAAAAGAATTACACAAATGTATTTGAAATGTCATCAGATACCTCAAGCTATGA CAGAGTTGATTATGTTACACAAGTAGTAAAGGATAAATTAAATATATTCTATATTAACACTAAGATTTAAAAC TAATTATAGTCTTCTTTAATTTTTCTACTGTATACATTTCATCTAGTTTTCAGTAAAACAAACTTTTCATTAC TTTTACTTATCCCATGCAAATCTAGTTGCTATAAGATATAACCTAATTTGGAAATACCTCCCTGTAATACATT GGAATTTTGGTGTGAGTGTGTGTGATCAGAGAGGATAAACAAATGGTGTCAGCAAAATAGAATGTAAAATATG GAGATAATGTGGATTTACACAATTTGATAAAAATTCTCCCTTGAATTTTGCAGATCATATATGAATATCATCA TGTGAAGTGCAATTAGGATTTTTTCATATATTAATACATATACATCATCTCTTTAATAAAATATTTTGCTGAA CTCGTTTAATATTTCTCATGTCTCATATTTCATATTTTCTCATATGTCTCATATTTTATATTTTCTCATATGT GTCTCATTTTTATTATTACTATAGTATCCATTAAAGGAGACTGGCAAATACCTGAACAAAGTTATGTTGTTGG CAATATAAGATATTACCAATTGCATAATATTATTTCCAAAGGCAAATTAATATGCAAACTATAGATTTCCATG GGTATCTATACAAATTATTACTTGAAGTCCATAGAAAACAGCTTCCTTAGAGGGAAGTAAAAGAAGCTCTGAT AACAGACAATGTATAGCATTTCAGTTAAAGTTTGATTGACATATTTTTTTCTCAGTCTTTTATACTTGTGAAT TATAGTCTACATTTTGTCTTTACAGATGTTGCTAACACAGTGCAGCATGTTGGCTTGTCATTTTACTGATTAT GTATATTGTCTCCTAGTTCAAGTATACAGTAAATCAGAGCTTTCATTTTTCAAGGGGCAGAAAAATAATTGTT GGTTGATAAGGTAAGGTTATATGATTTTGAGGGAGCTTCATTGTAAATTGAATGAGAATCCGGTTTTCATGCA AAGGTGTATCTATGCGATAATACTTTGAATGTCTGTAGTTTGAAATAGAAGGTTAATTTTTTCCACTGGCTTA TCCTTAATGAAGGAAATCCCCTGATAATTACTTTGATTCTGAAAATGTTGAAAACTCCAGAAGAAATAAAGCT TTTCTTTGATTTCTCAGCTGAAGTGTTGTACAAACTGAGGAATATGAAGTCCATTCCCTTCTTTCTTCTCTTG AATAATTTTAAAATTGTTTGTTTAGTTGTACAATTGAAAATATTCCTTATTATAGAAGTAAAAAAACAATAAT GCATATTTCCTCATATCATAAAAACTAAATTTGTTATCATCTGAGCTTCAATATTCTTGCTCAATTAGAATAG TAAATATAAAGTGTGATATTTATAACAGTTCAAGGTTTGATAGGAGATAGAGGTGTTTTGATTTTATGGGAAA ATTACTTCCTCAAGAACACATTTCTTGAGGTTTTAGTAATCACATTTGACTCCCTGAAATTGGCAATTTTATT CAATGTAGGAATATTATCATGGTATATTATAGTGAGGAGCACATAGTCATTATTATTTTGTTTTTGCAAATTT ATTTTGAAAAAAAGGAGCATTATCAAATATTGGTTTACTATTTTAAAGTAATTCATCAGGAAATGATTTTTTA AACACTGTCCCTTTAAGTAAATGTCCCTTGCTTTTCAAAGCTCAACTTATTACTTATGGTAATAGAGTTACTT TGCTTCTTAAAACAAAGTTTATACTAGAGCATAGCATTGTAGAATTATTCAGGTCTCAATTTCTCACTGGAAA ATGAGTCTTTAAAATAGTAAGGATTTAAATTTCTATAAAATTTAATCACAGATACTTATATTTTAAGATAAAT GTGTTGGAGCTAAACTCTGGAATTATTAAAATATAAAACATTATATCCCTCTAATGTATTTTTTCTATTTAAA TTTAAAACAATAAACATAAATATCTTTGGAAA GCET (SEQ ID NO: 11) CCACGCGTCCGGTGGTAAAGGGACGGAGGGGAAGCCCTGAGAGGACTGAGAGGATGGGAAATTCTCTGCTGAG
AGAAAACAGGCGGCAGCAGAACACTCAAGAGATGCCTTGGAATGTGAGAATGCAAAGCCCCAAACAGAGAACA TCCAGATGCTGGGATCACCATATCGCTGAAGGGTGTTTCTGCCTTCCATGGAAAAAAATACTCATTTTTGAAA AGAGGCAAGATTCCCAAAACGAAAATGAAAGAATGTCATCTACTCCCATCCAGGACAATGTTGACCAGACCTA CTCAGAGGAGCTGTGCTATACCCTCATCAATCATCGGGTTCTCTGTACAAGGCCATCAGGGAACTCTGCTGAA GAGTACTATGAGAATGTTCCCTGCAAAGCTGAGAGACCCAGAGAGTCCTTGGGAGGAACTGAGACTGAGTATT CACTTCTACATATGCCTTCTACAGACCCCAGGCATGCCCGATCCCCAGAAGATGAATATGAACTTCTCATGCC TCACAGAATCTCCTCTCACTTTCTGCAACAGCCACGTCCACTTATGGCCCCTTCTGAGACTCAGTTTTCCCAT TTATAGTGAAGTGGCTGGACTAGCATTTGTTTAGCACCAACAAATAAAAGGTGGGATGGGGGATCTGCCTGAA GCAGGGATGGGACACAAAGTCCCTCCAGCTTATCTCCCACAACAACCCTTTCCCTGCAGAGCATGGTTTGTAT ACCACAAGCCCTCTTAGCACGCAAAAGCCAAAATCTAAAGATCAACCATTTATCCTGAACAACACCATTTGAG AAAGAGGTAACCATCTTTGGTTCTACATGGTTTGGAGAGTATAGTGGTAGGAGGGGCTCCCTGATTCCCCTAA AGCTATGCACACCACAAGGGGCTCTGCTCTTCTGTCTGGGATCTTCTTATAAAGTGTTCCCATGATCATTCTC TAAAGTCACGAGGAAGCTTTACTCATCATACTAAGTGTGCCCAAGGGGGAGTTCACTCATTACTGTGACCTTC CAGCTCAGTCCCCACCCATGGGAGCCTGTGTTGCTCCTCTCACTCCATGTGTCTAAGTCATGTCTTTTACATA GTGTCCTTTGACCTGTTGGCCCCCATGGTCTGGTTAGTTATGTGAGTTGAATCAAGAGGCTCTAGGCCAGATG TTTACATAATTTTAACCTATATGATTTTATTTTTAACTTTGTATTTCTCCCTAGAAATCTTAATAAGACAATT ATGCCATCAGACAATGTTAAGAAGAACGATCCTTGGAGATCCCGTAATCCCACTACCCTTCTTTGGCTCAGAG AGGATAATTTGCCTAATGATACATTAAAGTTAGTGGCAAAACTTAATTTGGAGCCTGATTTCCTACTGACTTC CAATTTAGTGCTCCCCCAGTATGCTAAATAGAAAGCCCTCTGCAATATATTAAATGTATACTAAATGTATATA TTTAATAATGTCATGTATAAAATATGAATAAAATGTCCACATAGGAAATTAACACATAAA TIMD (SEQ ID NO: 12) ATAAGAGGTTGGGCTTTGGATAGATAGACAGACTCCTGGGTCCGGTCAACCGTCAAAATGTCCAAAGAACCTC TCATTCTCTGGCTGATGATTGAGTTTTGGTGGCTTTACCTGACACCAGTCACTTCAGAGACTGTTGTGACGGA GGTTTTGGGTCACCGGGTGACTTTGCCCTGTCTGTACTCATCCTGGTCTCACAACAGCAACAGCATGTGCTGG GGGAAAGACCAGTGCCCCTACTCCGGTTGCAAGGAGGCGCTCATCCGCACTGATGGAATGAGGGTGACCTCAA GAAAGTCAGCAAAATATAGACTTCAGGGGACTATCCCGAGAGGTGATGTCTCCTTGACCATCTTAAACCCCAG TGAAAGTGACAGCGGTGTGTACTGCTGCCGCATAGAAGTGCCTGGCTGGTTCAACGATGTAAAGATAAACGTG CGCCTGAATCTACAGAGAGCCTCAACAACCACGCACAGAACAGCAACCACCACCACACGCAGAACAACAACAA CAAGCCCCACCACCACCCGACAAATGACAACAACCCCAGCTGCACTTCCAACAACAGTCGTGACCACACCCGA TCTCACAACCGGAACACCACTCCAGATGACAACCATTGCCGTCTTCACAACAGCAAACACGTGCCTTTCACTA ACCCCAAGCACCCTTCCGGAGGAAGCCACAGGTCTTCTGACTCCCGAGCCTTCTAAGGAAGGGCCCATCCTCA CTGCAGAATCAGAAACTGTCCTCCCCAGTGATTCCTGGAGTAGTGCTGAGTCTACTTCTGCTGACACTGTCCT GCTGACATCCAAAGAGTCCAAAGTTTGGGATCTCCCATCAACATCCCACGTGTCAATGTGGAAAACGAGTGAT TCTGTGTCTTCTCCTCAGCCTGGAGCATCTGATACAGCAGTTCCTGAGCAGAACAAAACAACAAAAACAGGAC AGATGGATGGAATACCCATGTCAATGAAGAATGAAATGCCCATCTCCCAACTACTGATGATCATCGCCCCCTC CTTGGGATTTGTGCTCTTCGCATTGTTTGTGGCGTTTCTCCTGAGAGGGAAACTCATGGAAACCTATTGTTCG CAGAAACACACAAGGCTAGACTACATTGGAGATAGTAAAAATGTCCTCAATGACGTGCAGCATGGAAGGGAAG ACGAAGACGGCCTTTTTACCCTCTAACAACGCAGTAGCATGTTAGATTGAGGATGGGGGCATGACACTCCAGT GTCAAAATAAGTCTTAGTAGATTTCCTTGTTTCATAAAAAAGACTCACTTAAAAAAAAA BAMBI (SEQ ID NO: 13) TTTACGGCGCGGAGCCGGAGAGACCTGGGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGG AGACCCTACTCTCTTCGCTGAGAACGGCCGCTAGCGGGGACTGAAGGCCGGGAGCCCACTCCCGACCCGGGGC TAGCGTGCGTCCCTAGAGTCGAGCGGGGCAAGGGAGCCAGTGGCCGCCGACGGGGGACCGGGAAACTTTTCTG GGCTCCTGGGCGCGCCCTGTAGCCGCGCTCCATGCTCCGGCAGCGGCCCGAAACCCAGCCCCGCCGCTGACGG CGCCCGCCGCTCCGGGCAGGGCCCATGCCCTGCGCGCTCCGGGGGTCGTAGGCTGCCGCCGAGCCGGGGCTCC GGAAGCCGGCGGGGGCGCCGCGGCCGTGCGGGGCGTCAATGGATCGCCACTCCAGCTACATCTTCATCTGGCT GCAGCTGGAGCTCTGCGCCATGGCCGTGCTGCTCACCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCAC TGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACT CAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGC CCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTG CACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAA ACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCC CATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGG CTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGGACACCATTCCAAAAAGGGGC AGGTTGCAAAGTTAGACTTGGAATGCATGGTGCCGGTCAGTGGGCACGAGAACTGCTGTCTGACCTGTGATAA AATGAGACAAGCAGACCTCAGCAACGATAAGATCCTCTCGCTTGTTCACTGGGGCATGTACAGTGGGCACGGG AAGCTGGAATTCGTATGACGGAGTCTTATCTGAACTACACTTACTGAACAGCTTGAAGGCCTTTTGAGTTCTG CTGGACAGGAGCACTTTATCTGAAGACAAACTCATTTAATCATCTTTGAGAGACAAAATGACCTCTGCAAACA GAATCTTGGATATTTCTTCTGAAGGATTATTTGCACAGACTTAAATACAGTTAAATGTGTTATTTGCTTTTAA AATTATAAAAAGCAAAGAGAAGACTTTGTACACACTGTCACCAGGGTTATTTGCATCCAAGGGAGCTGGAATT GAGTACCTAAATAAACAAAAATGTGCCCTATGTAAGCTTCTACATCTTGATTTATTGTAAAGATTTAAAAGAA ATATATATATTTTGTCTGAAATTTAATAGTGTCTTTCATAAATTTAACTGGGAAACGTGAGACAGTACATGTT AATTATACAAATGGCCATTTGCTGTTAATAATTTGTTCTCAACTCTAGGATGTGGCTTGGTTTTTTTTTTTCT CTTTTCTTTTTTAAACAAGACCAAGATCTTGCTTATTCTTCCATGAAAAAA SASH (SEQ ID NO: 14) ACGGCCATGGAGGACGCGGGAGCAGCTGGCCCGGGGCCGGAGCCTGAGCCCGAGCCCGAGCCGGAGCCCGAGC CCGCGCCGGAGCCGGAACCGGAGCCCAAGCCGGGTGCTGGCACATCCGAGGCGTTCTCCCGACTCTGGACCGA CGTGATGGGTATCCTGGACGGTTCACTGGGAAACATCGATGACCTGGCGCAGCAGTATGCAGATTATTACAAC ACCTGTTTCTCCGACGTGTGCGAGAGGATGGAGGAGCTGCGGAAACGGCGGGTTTCCCAGGACCTGGAAGTGG AGAAACCCGATGCTAGCCCCACGTCACTTCAGCTGCGGTCCCAGATCGAAGAGTCGCTTGGCTTCTGTAGCGC CGTGTCAACCCCAGAAGTGGAAAGAAAGAACCCTCTTCATAAATCAAACTCAGAAGACAGCTCTGTAGGAAAA GGAGACTGGAAGAAGAAAAATAAGTATTTCTGGCAGAACTTCCGAAAGAACCAGAAAGGAATAATGAGACAGA CTTCAAAAGGAGAAGACGTTGGTTATGTTGCCAGTGAAATAACGATGAGCGATGAGGAGCGGATTCAGCTAAT GATGATGGTCAAAGAAAAGATGATCACAATTGAGGAAGCACTTGCTAGGCTCAAGGAATACGAGGCCCAGCAC CGGCAGTCGGCTGCCCTGGACCCTGCTGACTGGCCAGATGGTTCTTACCCAACGTTTGATGGCTCATCAAACT GCAATTCAAGAGAACAATCGGATGATGAGACTGAGGAGTCGGTGAAGTTTAAGAGGTTACACAAGCTGGTAAA CTCCACTCGCAGAGTCAGAAAGAAACTAATTAGGGTGGAAGAAATGAAAAAACCCAGCACTGAAGGTGGGGAG GAGCACGTGTTTGAGAATTCGCCGGTCCTGGATGAACGGTCCGCCCTCTACTCTGGCGTGCACAAGAAGCCCC TTTTCTTTGATGGCTCTCCTGAGAAACCTCCCGAAGATGACTCAGACTCTCTCACCACGTCTCCATCCTCCAG CAGCCTGGACACCTGGGGGGCTGGCCGGAAGTTGGTCAAAACCTTCAGCAAAGGAGAGAGCCGGGGCCTGATT AAGCCCCCCAAGAAGATGGGGACATTCTTCTCCTACCCAGAAGAAGAAAAGGCCCAGAAAGTGTCCCGCTCCC TCACCGAGGGGGAGATGAAGAAGGGTCTCGGGTCCCTAAGCCACGGGAGAACCTGCAGTTTTGGAGGATTTGA CTTGACGAATCGCTCTCTGCACGTTGGCAGTAATAATTCTGACCCAATGGGTAAAGAAGGAGACTTTGTGTAC AAAGAAGTCATCAAATCACCTACTGCCTCTCGCATCTCTCTTGGGAAAAAGGTGAAATCAGTGAAAGAGACGA TGAGAAAGAGAATGTCTAAAAAATACAGCAGCTCTGTCTCTGAGCAGGACTCGGGCCTTGATGGAATGCCTGG CTCCCCTCCGCCTTCACAGCCCGACCCCGAACACTTGGACAAGCCCAAGCTCAAGGCCGGGGGTTCTGTAGAA AGTCTTCGCAGTTCTCTCAGTGGGCAGAGCTCCATGAGCGGTCAAACAGTGAGCACCACTGATTCCTCAACCA GCAACCGGGAAAGCGTCAAGTCGGAAGATGGGGATGACGAAGAGCCGCCTTACCGAGGCCCGTTCTGCGGGCG TGCCAGGGTGCACACCGACTTCACCCCCAGTCCCTATGACACAGACTCACTCAAGCTCAAGAAAGGAGATATC ATCGATATAATCAGCAAGCCACCCATGGGGACCTGGATGGGCCTGCTGAACAACAAAGTCGGCACGTTCAAGT TCATCTACGTGGACGTGCTCAGTGAAGACGAGGAGAAACCCAAACGCCCCACCAGGAGGCGTCGGAAAGGACG ACCACCCCAGCCCAAGTCTGTGGAGGATCTCCTGGATCGGATTAACCTAAAAGAGCACATGCCCACTTTCCTG TTCAATGGATATGAAGATTTGGACACCTTTAAGCTGCTGGAGGAGGAAGACTTGGATGAGTTAAATATCAGGG ACCCGGAACACAGAGCTGTTCTCTTGACAGCAGTGGAGCTGTTACAAGAGTATGACAGTAACAGCGACCAGTC AGGATCCCAGGAGAAGCTGCTCGTTGACAGCCAGGGCCTGAGTGGATGCTCACCCCGAGACTCAGGATGCTAC GAAAGCAGTGAGAACCTGGAAAACGGCAAGACTCGGAAAGCTAGCCTCCTATCTGCCAAGTCATCCACCGAGC CCAGCTTGAAGTCTTTTAGCAGAAACCAGTTGGGCAATTACCCAACATTGCCTTTAATGAAATCAGGGGATGC ACTGAAGCAGGGACAGGAGGAGGGCAGGCTGGGTGGTGGCCTTGCCCCAGACACGTCCAAGAGCTGTGACCCA CCTGGTGTGACTGGTTTGAATAAAAACCGAAGAAGCCTCCCAGTTTCCATCTGCCGGAGCTGTGAGACCCTGG AGGGCCCCCAGACTGTGGACACTTGGCCCCGATCCCATTCCCTGGATGACCTTCAAGTGGAGCCTGGTGCTGA GCAAGACGTGCCTACCGAGGTGACAGAACCGCCCCCTCAGATTGTACCTGAAGTGCCACAGAAGACGACCGCC TCTTCCACGAAGGCCCAGCCCCTGGAGCGAGACTCTGCTGTCGACAATGCATTGCTACTGACCCAAAGCAAGA GATTTTCTGAACCTCAGAAATTGACAACTAAGAAACTGGAGGGCTCAATCGCAGCCTCTGGTCGCGGCCTGTC ACCCCCTCAGTGTTTGCCCAGAAACTATGATGCTCAGCCTCCTGGAGCTAAACACGGTTTAGCAAGGACGCCT CTGGAGGGCCACAGAAAAGGACACGAGTTTGAAGGAACACACCATCCCCTGGGCACCAAAGAAGGGGTAGATG CTGAGCAGAGAATGCAGCCCAAAATTCCATCACAGCCTCCACCTGTTCCTGCCAAAAAGAGCAGAGAACGCCT TGCTAACGGACTCCACCCTGTTCCCATGGGCCCCAGTGGGGCCCTCCCCAGTCCCGATGCGCCATGCCTGCCA GTGAAAAGGGGCAGCCCCGCCAGCCCCACCAGCCCTAGCGACTGTCCCCCAGCACTGGCTCCCAGGCCTCTCT CAGGGCAGGCGCCTGGCAGCCCACCAAGCACAAGGCCGCCCCCCTGGCTCTCAGAGCTCCCCGAGAACACAAG CCTCCAGGAGCACGGTGTGAAGCTGGGCCCGGCTTTGACCAGGAAGGTCTCCTGTGCCCGGGGAGTGGATCTA GAAACGCTCACTGAAAACAAGCTGCACGCTGAAGGCATCGATCTCACGGAGGAGCCGTATTCTGATAAGCATG GCCGCTGTGGGATTCCTGAAGCCCTGGTGCAGAGATACGCAGAGGACTTGGATCAGCCCGAGCGGGACGTCGC CGCCAACATGGACCAGATCCGGGTGAAGCAGCTTCGGAAGCAGCACCGCATGGCGATTCCAAGTGGTGGACTC ACGGAAATCTGCCGAAAGCCCGTCTCTCCTGGGTGCATTTCGTCTGTGTCAGATTGGCTCATTTCCATCGGTC TGCCCATGTACGCCGGCACCCTCTCCACCGCGGGCTTCAGCACACTGAGCCAAGTGCCTTCTCTGTCTCACAC TTGCCTTCAGGAGGCCGGCATCACAGAGGAGAGACACATAAGAAAGCTCCTATCTGCAGCCAGACTCTTCAAA CTGCCGCCAGGCCCTGAGGCCATGTAGCCAGGCCCGGAATGGGCCTCTCTGGACAAGAGCCACCCTTTCACTG TGCATATGATGCTGATGCAATTCCTCCATCATCTCTGGACGTGCAGACCAGATCCAGAAGAAAGGCCTGGCGT GTGGCCAAACAGCGTGAAACCTTGGCACAGGACTGAGGATCCTCTCCTCCAGAAAAGCCCCCTCGAGGAAATA AATTAGTGCGGTTCTCTTTGACCTCCAAAGACAAGACAAGCACTTATTTTTATTTTCAGAAGACAAAAGAACC AAGATGCCAACTGGCTGCGAATGCTCTATCTCCAGTCTGTCTCTGTGTACTGGTAGAGGCTGGGAGGAGTAGG GGGCAGCCTGTTCCATTTCTGATAGTGCCCTTGCTCTTCTGTCTGTCATCTTGCAGGATGCCCGAGGGCCAGA TGGGCTTAGCTAGGCCAAAGTAACAGACTCAAGAGTTATTGTACATTACTGACCACGCTCATTTGTTCAAAAG TTAGAACATCTGGCTGCACCAGGAAAAAAAAAAAAAAAAAGTCCTGTTCTTCTTTAGATAAACAAGAGACATT TTCATAATTGCTTTCTAGCAATCAGCTTTTATTTGCCTTAATATAAGCTTTTAAGCAGTTATCTAACTAGTGT CCACAACCCTGTAACCATACTTCCACATCTTCAGCTTAGGCAGACATCGAACCTCTCTGGGATGTTTCCAGCA AAAGTGAGCTTTTCTAATCGTCTCATTGTAACATGGCTTATTTTGTAGAGGTATTCATCAGCCACACACTTCA TGTTGGTTTTTGGTTTTTAAGCTAACTACAAATCTAGTAAAAAGCTATCTGAAATTCACAAATATCATGTGTG TGCGTGCGTGCGTGCGCGTGTGTGTCTGTATTCATAGTGACTGCTTTTGGTTTTAACCAGTTTAGTATCGTTA CTGTGTGGATCGTCGCGCTGCAGTATTGACTTGGAATCCTGACCATGTCCATCCCAAAATTCAGTCCTCAGTT AACGGATCATGTTTGCAAAAGGTCACTGTGAGGCTGCATATTTCAGAAAGATGTCCTTAATAAGGGAAGTCAT GTATAAGATGTTTTCTAAAAGACTTTTCAGTATTACAACTAATACTATTATTATCCTTCTTTTTTTATTTAGA TAATTCTTTTAATTTAAACAAAGGTTCACTATGGAACCAGACAAATCTCATTAGCCATGTGTTAAGTATTTGC TACTTTAAATTGTTTTACAACTGATTTCAGCACATTCTATCCTTTTTTTTTTTTGAAATGGAGTTTCGCTCTT GTCACCCAGGCTGGAGTGCAATGGCACGATCTTGGCTCACTGCAACCTCAGTCTCCCAGGTTCAAGTGATTCT CCTGCCTTAGCCTCCCGAGTAGCTGGGATTATAGGCACCCACCACCACGCCCAGCTAATTTTTGTATTATTAG TAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCAACTCCTGACCTCAGGTGGTCCACCCGCC TCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCACCTGGCCTCTGTCCTCTTTTAGTCTAGTGT CTGGTTTTCTAGCAAACAGTAAATTTAAACAAGTAAACTATTATGGTTTCCATTGCTTACAAAATGATTTTCC TTTACATTCTTATCATGAACACTATTTTAAGCATCAAATGCAATCATCTAAAATATAAAGGTCAATCATTTAT AATAGAAACACCTTGACCACAAGCCCTTGATTGAACATTTTATAATATTTCATCTACTTATTAAAACAAATAA TTTCCCTTGGGTTGGAGGGGAAGTGATTTCATAAATTAATTAGAAAGCCATCTTTAGCATATTGCTTATGTCT GGATCCATGTTTCTGAGGAAAAAGACATTCTCAGGTGATGTATTTTTTTCATGCATTAGTATGCATTTTTAAA AAATAATGCATGTTTCTTTAATAATTAATTTTCATCTTCTATAAGATGCCATGTGAAGAAGTTGTGGAAATGT AGAATAAAAAGCTAAAGCTGCCAAATTTCTGTTGAACTCTTAAAAACAGCTCATGTTTGTTTGTCCTCTCGGG TTGTGGCCTAGCCTATTTGCAATGTAATGAAGCTGCAGGGTTCTTGTATAGCTAAAGCGTTCAATGCATTTCA CGTGCTGTGGTGGATGTGGGTGCTGTAGACAGGCTTCTTCTCTTCCTGCTCTCAAAATACCTCGGCTTGACAT TTGGACAGATCCTGTCATTGTTTAAGCTGAGCAAAAAACCACACAAAAGTTGTGTAAGAGATGAGATAACAAA GGAGCGAGAGAAATCTCATGTGAATTTCCAAGTTTTAATTCGTTCTCCATGAAGGATTTTCATTTCAGTGAAA GTCGCAGCAGAAGAGGGAACTTTCTGGAGTTTTTGAGAATGCCAAACCACATTTTTATCACACTTCTTTGGAA ATCAATGCCTTTGCATAGAAAATCAAATTCAGGGACCACAAAGAATTTTCAGTGGGAATGTCTAGTCTGAGGG GTCTGAGGTTGTTTTTACTTTATTGTGTTGTTTAAATATTTTAAAAATATCTTTAGCGTTTGGTCTTTTTTTT TTCTGTAAACATTTAATTTGGTCTGAGAAAAGCTGAATGTTTGGGTGTGACGTTTGACTGAGGTGGATTGGGG CTGCCTGTGGACATTAGTGAACAGGTGGTAGGCTTCAGGAATATCCAGTTTTAATCAGTTGCATTTGGTACAG AATTTTGAGTAATGGTGAAAATTGTTGTCTTTGGAAAGCACAAAAGAAACCTGGAAAGGCAGTTCGGCTCAGG TAGCTACACATAACATTGTGTATGATTTTCACTTCAAAGCTGTCTGGAAGGAAATGCAGTCAGCTCCAGCTAG TACTATTTATGTACCCAGATAACTAAGATATTGTTTCATGGCCTTGCCTTAGTCAGAGGCCCTTTTCTCTGTC CTGAACCCCCAGGTATGGGTGAAATTGGAAATTACTAATCTATTGGAAATCAGTTCCTGACATAGTAAAGTTT GCTTTCATAACTGCAGCAAAAAAGGTCAACTTGCCAAGTCACTGCTGCCATGTGTGTACTGTATTATTTTCAG AAAAAAATATAATAGTCTGAGTCCAAGTTATCTTGATTTAAAATTGATAGAGAAAAGAAACTGTCGAGCAAGT TATATAACAACTAACAACATTGCACTTTCTGTATATGAAATCAATATTTAAATAACTTATTTTTCTCCATTGC TGTTCTTAAAAACATTGTAAGTAGCTGTAATATACCAGTACCAATATGTTCTTGCAATTGCTTCAGCCCAAGA AAGCTGTGTATTGTTTTAAAAATTGTAAAAATTATTGTGATGATTCATTTAGCATAAAGAGAGGTGGACGGAA GGGTTTTCCTATGTATCAAAACTTGTCTATAATTATGTCATCTATGTACCTAGAAAAAAGTAAATAAATTTCT TCAGTTGAATATG DACT (SEQ ID NO: 15) GGCGGTCGCGCGCAGGACTCGAGGGCTTCTAGCCACCGTCCCCGCCAGCGCCGCGCCCCGCCACAGGGCGGCA TGAGCCCACCCGCGGCCGCAGCCCTAGCGCCCTGCTCCTCCGCCTGGGCGGCCCGGCTGCGGTGACGGCTCTC GCTGCCCGACTGGGGGCCATGAAGCCGAGTCCGGCCGGGACGGCGAAGGAGCTGGAGCCTCCGGCGCCGGCCC GAGGCGAGCAGCGCACGGCGGAGCCCGAGGGGCGCTGGCGGGAGAAGGGCGAGGCAGACACCGAGCGGCAGCG CACCCGGGAGCGGCAGGAGGCCACGCTGGCCGGGCTGGCGGAGCTGGAGTACCTGCGCCAGCGCCAAGAGCTG CTGGTCAGGGGCGCCCTGCGCGGCGCCGGGGGTGCGGGAGCCGCTGCGCCCCGCGCTGGGGAGCTACTGGGGG AGGCGGCGCAGCGCAGTCGCCTGGAGGAGAAGTTCTTGGAGGAGAACATCTTGCTGCTAAGAAAGCAATTGAA CTGTTTGAGGCGAAGAGATGCTGGTTTGTTGAATCAGTTGCAAGAGCTTGACAAGCAGATAAGTGACCTGAGA CTGGATGTAGAAAAGACATCTGAAGAGCACCTGGAGACAGACAGTCGGCCTAGCTCAGGGTTTTATGAGCTGA GTGATGGGGCTTCAGGATCCCTTTCCAATTCCTCTAACTCGGTGTTCAGTGAGTGTTTATCCAGTTGTCATTC CAGCACCTGCTTTTGCAGCCCCTTGGAGGCGACCTTGAGTCTCTCAGATGGTTGCCCCAAATCTGCAGATCTC ATAGGATTGTTGGAATATAAAGAAGGCCACTGTGAAGACCAGGCCTCAGGGGCAGTTTGCCGTTCCCTCTCCA CACCACAATTTAATTCCCTTGATGTCATTGCAGATGTGAATCCCAAGTACCAGTGTGATCTGGTGTCTAAAAA CGGGAATGATGTATATCGCTATCCCAGTCCACTTCATGCTGTGGCTGTGCAGAGCCCAATGTTTCTCCTTTGT CTGACGGGCAACCCTCTGAGGGAAGAGGACAGGCTTGGAAACCATGCCAGTGACATTTGCGGTGGATCTGAGC TAGATGCCGTCAAAACAGACAGTTCCTTACCGTCCCCAAGCAGTCTGTGGTCTGCTTCCCATCCTTCATCCAG CAAGAAAATGGATGGCTACATTCTGAGCCTGGTCCAGAAAAAAACACACCCTGTAAGGACCAACAAACCAAGA ACCAGCGTGAACGCTGACCCCACGAAAGGGCTTCTGAGGAACGGGAGCGTTTGTGTCAGAGCCCCGGGCGGTG TCTCACAGGGCAACAGTGTGAACCTTAAGAATTCGAAACAGGCGTGTCTGCCCTCTGGCGGGATACCTTCTCT GAACAATGGGACATTCTCCCCACCGAAGCAGTGGTCGAAAGAATCAAAGGCCGAACAAGCCGAAAGCAAGAGG GTGCCCCTGCCAGAGGGCTGCCCCTCAGGCGCTGCCTCCGACCTTCAGAGTAAGCACCTGCCAAAAACGGCCA AGCCAGCCTCGCAAGAACATGCTCGGTGTTCCGCCATTGGGACAGGGGAGTCCCCTAAGGAAAGCGCTCAGCT CTCAGGGGCCTCTCCAAAAGAGAGTCCTAGCAGAGGCCCTGCCCCGCCGCAGGAGAACAAAGTTGTACAGCCC CTGAAAAAGATGTCACAGAAAAACAGCCTGCAGGGCGTCCCCCCGGCCACTCCTCCCCTGCTGTCTACAGCTT TCCCCGTGGAAGAGAGGCCTGCCTTGGATTTCAAGAGCGAGGGCTCTTCCCAAAGCCTGGAGGAAGCGCACCT GGTCAAGGCCCAGTTTATCCCGGGGCAGCAGCCCAGTGTCAGGCTCCACCGGGGCCACAGGAACATGGGCGTC GTGAAGAACTCCAGCCTGAAGCACCGCGGCCCAGCCCTCCAGGGGCTGGAGAACGGCTTGCCCACCGTCAGGG AGAAAACGCGGGCCGGGAGCAAGAAGTGTCGCTTCCCAGATGACTTGGATACAAATAAGAAACTCAAGAAAGC CTCCTCCAAGGGGAGGAAGAGTGGGGGCGGGCCCGAGGCTGGTGTTCCCGGCAGGCCCGCGGGCGGGGGCCAC AGGGCGGGGAGCAGGGCGCATGGCCACGGACGGGAGGCGGTGGTGGCCAAACCTAAGCACAAGCGAACTGACT ACCGGCGGTGGAAGTCCTCGGCCGAGATTTCCTACGAAGAGGCCCTGAGGAGGGCCCGGCGCGGTCGCCGGGA GAATGTGGGGCTGTACCCCGCGCCTGTGCCTCTGCCCTACGCCAGCCCCTACGCCTACGTGGCTAGCGACTCC GAGTACTCGGCCGAGTGCGAGTCCCTGTTCCACTCCACCGTGGTGGACACCAGTGAGGACGAGCAGAGCAATT ACACCACCAACTGCTTCGGGGACAGCGAGTCGAGTGTGAGCGAGGGCGAGTTCGTGGGGGAGAGCACAACCAC CAGCGACTCTGAAGAAAGCGGGGGCTTAATTTGGTCCCAGTTTGTCCAGACTCTGCCCATTCAAACGGTAACG GCCCCAGACCTTCACAACCACCCCGCAAAAACCTTTGTCAAAATTAAGGCCTCACATAACCTCAAGAAGAAGA TCCTCCGCTTTCGGTCTGGCTCTTTGAAACTGATGACGACGGTTTGAGTGACATCATTGGTGTAGAAAGTTTG TGTGTTTTTTTTTCTTCTCCCTAGTTGCCAAAATTAAAAAGGTGGTGTTTTCATTTTTGTATAATACTTTAAT GGAATGCTTTTTAAAAAAATATAAAACCAAGGTAAATTATTGTTTCATCTTCACGTATGGATGCTAGTGCCTT TAATGGAAGGTAAAGAATGTTTTGCTAGTTAGAAGTACATATTGAGGTTTTAATGGTGGTGATAGTGAGTTTT GTGGCACCAGCTGTTTTTTATTTTAAACTTTCTGAGCATCCGGCAAGGTACAGGTTTTGATGTTCAAGTTTTA TTGGGATAAGATCTTTTGATCCCAAGGTCAGGTGGATGGAATTTTTGGATTTATATTTGTTCCTTGAGTCTTC AGGGCAGTGTCTCCATGAGGGTTTTCCTGTTGAGGGGCACCACATACAATAGTGTGAAGTAGGTATGAGGGGC AGTCATTGTATTCTATAGTTTTTTTATGTAGTCTACATTTCTCAGATGTATCCCCATTCGGTTTTATTCTCAG AACTGTTACTAGACTCATGACTTGGAGGCCAAACCTTAAATCCAGAGATAGCAGCCTCGATAGGGACCTTAAA AGGATTCACAAAAACTTTTGCCACACTTGGTGCCTAGGCCCTGTTCCTAATAACCCCTTCTAGGGCCGTTTAT CCAACATTTAGATGCCTTCTTTTCCCTCCCTAATTTGTAGCCAGTCCAACCTTTCATTCCTTGGAGGATTTAG TTTTGGGATAAAATTTTGGTCCTTGGGCACAGAGACATTCACTATTAATGAAGTAACCCTTGGGCATGACTCC AATCCCAGAATTGCTCACTGAGCGCTATGCCACCGAAGCGTTGACCTGAACATATTAGTGCAATCCAGTCCAG ATTGGACCTTTGATCCTATGTGGAAGGGCTGTTTTTTAAGAAAAAATTTTTGGTAAACAGTATTGTGTAAAAT TGCTTTTTGTATACCAATATATGCATGTTTTGTGCATGAGTAGTACTTGTGTTGATACTCCTGTTGATGTTAA ATTACTATATAATATAAACAGTATGTGTTTTTATATATCATTGTGTAAATTTAATATAACATATGCAGTAATA AACCATTTGTTTTACTGCTGTTAAGTTTGTTATTTGGGTATAAAACCAGATGTTTACACCTGTAAAAAAAAAA AAAAAAAA DLG (SEQ ID NO: 16) GTGGAATCCGGCGTGGGCTGGGGGGTCCGAGCCGCGGGGGGCAGTGCCATGCACAAGCACCAGCACTGCTGTA AGTGCCCTGAGTGCTATGAGGTGACCCGCCTGGCCGCCCTGCGGCGCCTCGAGCCTCCGGGCTACGGCGACTG GCAAGTCCCCGACCCTTACGGGCCAGGTGGGGGCAACGGCGCCAGCGCGGGTTATGGGGGCTACAGCTCGCAG ACCTTGCCCTCGCAGGCGGGGGCCACCCCCACCCCTCGCACCAAGGCCAAGCTCATCCCCACCGGCCGGGATG TGGGGCCGGTGCCTCCTAAGCCAGTCCCGGGCAAGAGCACCCCCAAACTCAACGGCAGCGGCCCCAGCTGGTG GCCAGAGTGCACCTGTACCAACCGGGACTGGTATGAGCAGGTGAATGGCAGTGATGGCATGTTCAAATATGAG GAAATCGTACTTGAGAGGGGCAACTCTGGCCTGGGCTTCAGTATCGCAGGTGGCATCGACAATCCCCATGTCC CTGATGACCCTGGCATCTTTATTACCAAGATTATCCCTGGTGGAGCAGCTGCCATGGATGGGAGGCTGGGGGT GAATGACTGTGTGCTGCGGGTGAATGAGGTGGACGTGTCGGAGGTGGTACACAGCCGGGCGGTGGAGGCGCTG AAGGAGGCAGGCCCTGTGGTGCGATTGGTGGTGCGGAGGCGACAGCCTCCACCCGAGACCATCATGGAGGTCA ACCTGCTCAAAGGGCCCAAAGGCCTGGGTTTCAGCATTGCTGGGGGTATTGGCAACCAGCACATCCCAGGAGA CAACAGCATCTACATCACCAAGATCATTGAGGGGGGTGCTGCTCAGAAGGATGGACGCCTACAGATTGGGGAC CGGCTGCTGGCGGTGAACAACACCAATCTGCAGGATGTGAGGCACGAGGAAGCTGTGGCCTCACTGAAGAACA CATCTGATATGGTGTATTTGAAGGTGGCCAAGCCAGGCAGCCTCCACCTCAACGACATGTACGCTCCCCCTGA CTACGCCAGCACTTTTACTGCCTTGGCTGACAACCACATAAGCCATAATTCCAGCCTGGGTTATCTCGGGGCT GTGGAGAGCAAGGTCAGCTACCCTGCTCCTCCTCAGGTTCCCCCCACCCGCTACTCTCCTATTCCCAGGCACA TGCTGGCTGAGGAGGACTTCACCAGAGAGCCTCGCAAGATCATCCTGCACAAAGGCTCCACAGGCCTGGGCTT CAACATCGTAGGAGGAGAGGATGGAGAAGGCATTTTTGTCTCCTTCATCCTGGCAGGAGGCCCAGCTGACCTG AGTGGGGAGCTGCGCAGGGGAGACCGGATCTTATCGGTGAATGGAGTGAATCTGAGGAATGCAACTCATGAGC AGGCTGCAGCTGCTCTGAAACGGGCCGGCCAGTCAGTCACCATTGTGGCCCAGTACAGACCTGAAGAATACAG
TCGCTTTGAATCGAAGATACATGACTTACGAGAACAAATGATGAACAGCAGCATGAGCTCTGGGTCTGGGTCC CTCCGAACAAGTGAAAAGAGGTCCTTGTATGTCAGGGCCCTGTTTGATTATGATCGGACTCGGGACAGCTGCC TGCCAAGCCAGGGGCTCAGCTTCTCTTATGGTGACATTCTGCATGTCATTAATGCCTCTGATGATGAGTGGTG GCAGGCAAGGCTGGTGACCCCACACGGAGAAAGTGAGCAGATCGGTGTGATCCCCAGTAAGAAGAGGGTGGAA AAGAAAGAAAGAGCTCGATTGAAAACTGTGAAGTTCCATGCCAGGACGGGGATGATTGAGTCTAACAGGGACT TCCCGGGGTTAAGTGACGATTATTATGGAGCAAAGAACCTGAAAGGACAAGAGGATGCTATTTTGTCATATGA GCCAGTGACACGGCAAGAAATTCACTATGCAAGGCCTGTGATCATCCTGGGCCCAATGAAGGACCGAGTCAAT GATGACCTGATCTCCGAATTTCCACATAAATTTGGATCCTGTGTGCCACATACTACCCGGCCTCGACGTGATA ATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATGGAGAAAGATATTCAGGACAACAA GTTCATCGAGGCGGGCCAATTTAATGATAACCTCTATGGGACCAGCATCCAGTCAGTGCGGGCAGTTGCAGAG AGGGGCAAGCACTGCATCTTAGATGTTTCCGGCAATGCTATCAAGAGACTGCAGCAAGCACAACTTTACCCCA TTGCCATTTTCATCAAGCCCAAGTCCATTGAAGCCCTTATGGAAATGAACCGAAGGCAGACATATGAACAAGC AAATAAGATCTATGACAAAGCCATGAAACTGGAGCAGGAATTTGGAGAGTACTTTACAGCCATTGTACAGGGT GACTCACTGGAAGAGATTTATAACAAAATCAAACAAATCATTGAGGACCAGTCTGGGCACTACATTTGGGTCC CATCCCCTGAAAAACTCTGAAGAATCCCCTCCAACCATTCTCTTGTGAACAGAAGAAATCAAGTCCCTCTTCC CTCCTCCCTCTTCATTCCTGTCCCCATG
[0158] The present invention is not to be limited in scope by the embodiments disclosed herein, which are intended as single illustrations of individual aspects of the invention, and any that are functionally equivalent are within the scope of the invention. Various modifications to the models and methods of the invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and teachings, and are similarly intended to fall within the scope of the invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.
Sequence CWU
1
1
16120DNAArtificial SequencePrimer 1ggggaagcat gtcgaagaaa
20220DNAArtificial SequencePrimer
2ggccttgagc tccgaaatgt
20320DNAArtificial SequencePrimer 3ggagcctttg ggggtttatt
20420DNAArtificial SequencePrimer
4ccatcctcca tcaggcactt
20521DNAArtificial SequencePrimer 5agccgaaaac accctgcaat c
21623DNAArtificial SequencePrimer
6ctggatttcc tcttcgtgga gtt
2372310DNAHomo sapiens 7gggggctgcg ctcgctacgt ccgctgctgc tgcccggctc
gggcctgagc gccgagcagg 60atcccaagtg atggtggttt cctcggaggg cgagctgagt
actgcgcgac tggttagcac 120ggtggagctg gtagccacgc ctgctggctg gcgtgcgtga
acaggtgtgg accgcaggat 180ctcagcactc tgacccaagg ggaagcatgt cgaagaaagg
ccggagcaag ggcgagaagc 240ccgagatgga gacggacgcg gtgcagatgg ccaacgagga
gctgcgggcc aagctgacca 300gcattcagat cgagttccag caggaaaaaa gcaaggtggg
caaactgcgc gagcggctgc 360aggaggcgaa gctggagcgc gagcaggagc agcgacggca
cacggcctac atttcggagc 420tcaaggccaa gctgcatgag gagaagacca aggagctgca
ggcgctgcgc gaggggctca 480tccggcagca cgagcaggag gcggcgcgca ccgccaagat
caaggagggc gagctgcagc 540ggctacaggc cacgctgaac gtgctgcgcg acggcgcggc
cgacaaggtc aagacggcgc 600tgctgaccga ggcgcgcgag gaggcgcgca gggccttcga
tggagagcgc ctgcggctgc 660agcaggagat cctggagctc aaggcagcgc gcaatcaggc
agaggaggcg ctcagtaact 720gcatgcaggc cgacaagacc aaggcagccg acctgcgtgc
cgcctaccag gcgcaccaag 780acgaggtgca ccgcatcaag cgcgagtgcg agcgcgacat
ccgcaggctg atggatgaga 840tcaaagggaa agaccgtgtg attctggcct tggagaagga
acttggcgtg caggctgggc 900agacccagaa gctgcttctg cagaaagagg ctttggatga
gcagctggtt caggtcaagg 960aggccgagcg gcaccacagt agtccaaaga gagagctccc
gcccgggatc ggggacatgg 1020tggagctcat gggcgtccag gatcaacata tggacgagcg
agatgtgagg cgatttcaac 1080taaaaattgc tgaactgaat tcagtgatac ggaagctgga
agacagaaat acgctgttgg 1140cagatgagag gaatgaactg ctgaaacgct cacgagagac
cgaggttcag ctgaagcccc 1200tggtggagaa gaacaagcgg atgaacaaga agaatgagga
tctgttgcag agtatccaga 1260ggatggagga gaaaatcaag aacctcacgc gggaaaacgt
ggaaatgaaa gaaaagctgt 1320cagcgcaggc gtctctgaag cggcatacct ccttgaatga
cctcagcctg acgagggatg 1380agcaggagat cgagttcctg aggctgcagg tgctggagca
gcagcacgtc attgacgacc 1440tctcactgga gagagaacgg ctgttgcgct ccaaaaggca
tcgagggaaa agtctgaaac 1500cgcccaagaa gcatgttgtg gagacatttt ttggatttga
tgaggagtct gtggactcag 1560aaacgttgtc cgaaacatcc tacaacacag acaggacaga
caggacccca gccacgcccg 1620aagaagactt ggacgatgcc acagcccgag aggaggctga
cctgcgcttc tgccagctga 1680cccgggagta ccaggccctg caacgcgcct acgccctgct
ccaggagcag gtgggaggca 1740cgctggacgc tgagagggag gcccggactc gggagcagct
acaagctgat ctgctgaggt 1800gtcaggccaa aatcgaagat ttggagaagt tactggttga
gaagggacag gattccaagt 1860gggttgaaga gaagcagctg ctcatcagaa caaaccaaga
cttgctggaa aagatttaca 1920gactggaaat ggaagagaac cagctgaaga atgaaatgca
agacgccaag gatcagaacg 1980agctgttaga attcagagtg ctagaactcg aagtaagaga
ctctatctgt tgtaaactct 2040caaacggagc agacattctc tttgaaccca aactgaaatt
catgtaaagc tctcagatgt 2100tttcaagcat gtgtaaaggg gacatgttat agtttctttc
tttctttctt tctttttttt 2160tttaaatctg tatgttcaga ataatttcac tgccttaatg
tgttctggag agcgtgctca 2220cccaagtcta tggacatgta ccagagctaa tatatttatt
gcctatggct tgttttgcac 2280ttaataaaat aatttgtttt tacaaaaaaa
231081320DNAHomo sapiens 8gcggacgcgg ggcgccagca
ggtggcgctg gacgcgcaac ggacaaggag gcggggcctg 60cagctggctt ggaggctccg
cgctctggag gctcaggcgc cgcgtggggc ccgcacctct 120gggcagcagc ggcagccgag
actcacggtc aagctaaggc gaagagtggg tggctgaagc 180catactattt tatagaatta
atggaaagca gaaaagacat cacaaaccaa gaagaacttt 240ggaaaatgaa gcctaggaga
aatttagaag aagacgatta tttgcataag gacacgggag 300agaccagcat gctaaaaaga
cctgtgcttt tgcatttgca ccaaacagcc catgctgatg 360aatttgactg cccttcagaa
cttcagcaca cacaggaact ctttccacag tggcacttgc 420caattaaaat agctgctatt
atagcatctc tgacttttct ttacactctt ctgagggaag 480taattcaccc tttagcaact
tcccatcaac aatattttta taaaattcca atcctggtca 540tcaacaaagt cttgccaatg
gtttccatca ctctcttggc attggtttac ctgccaggtg 600tgatagcagc aattgtccaa
cttcataatg gaaccaagta taagaagttt ccacattggt 660tggataagtg gatgttaaca
agaaagcagt ttgggcttct cagtttcttt tttgctgtac 720tgcatgcaat ttatagtctg
tcttacccaa tgaggcgatc ctacagatac aagttgctaa 780actgggcata tcaacaggtc
caacaaaata aagaagatgc ctggattgag catgatgttt 840ggagaatgga gatttatgtg
tctctgggaa ttgtgggatt ggcaatactg gctctgttgg 900ctgtgacatc tattccatct
gtgagtgact ctttgacatg gagagaattt cactatattc 960agagcaagct aggaattgtt
tcccttctac tgggcacaat acacgcattg atttttgcct 1020ggaataagtg gatagatata
aaacaatttg tatggtatac acctccaact tttatgatag 1080ctgttttcct tccaattgtt
gtcctgatat ttaaaagcat actattcctg ccatgcttga 1140ggaagaagat actgaagatt
agacatggtt gggaagacgt caccaaaatt aacaaaactg 1200agatatgttc ccagttgtag
aattactgtt tacacacatt tttgttcaat attgatatat 1260tttatcacca acatttcaag
tttgtatttg ttaataaaat gattattcaa ggaaaaaaaa 132091700DNAHomo sapiens
9gcggagtccg gacgtcggga gcaggatggc ggcggagcag gaccccgagg cgcgcgcggc
60ggcgcggccg ctgctcactg acctctacca ggccaccatg gcgttgggct attggcgcgc
120gggccgggcg cgggacgccg ccgagttcga gctcttcttc cgccgctgcc cgttcggcgg
180cgccttcgcc ttggccgccg gcttgcgcga ctgtgtgcgc ttcctgcgcg ccttccgcct
240gcgggacgcc gacgtgcagt tcctggcctc ggtgctgccc ccagacacgg atcctgcgtt
300cttcgagcac cttcgggccc tcgactgctc cgaggtgacg gtgcgagccc tgcccgaggg
360ctccctcgcc ttccccggag tgccgctcct gcaggtgtcc gggccgctcc tggtggtgca
420gctgctggag acaccgctgc tctgcctggt cagctacgcc agcctggtgg ccaccaacgc
480agcgcggctt cgcttgatcg cagggccaga gaagcggctg ctagagatgg gcctgaggcg
540ggctcagggc cccgatgggg gcctgacagc ctccacctac agctacctgg gcggcttcga
600cagcagcagc aacgtgctag cgggccagct gcgaggtgtg ccggtggccg ggaccctggc
660ccactccttc gtcacttcct tttcaggcag cgaggtgccc cctgacccga tgttggcgcc
720agcagctggt gagggccctg gggtggacct ggcggccaaa gcccaggtgt ggctggagca
780ggtgtgtgcc cacctggggc tgggggtgca ggagccgcat ccaggcgagc gggcagcctt
840tgtggcctat gccttggctt ttccccgggc cttccagggc ctcctggaca cctacagcgt
900gtggaggagt ggtctcccca acttcctagc agtcgccctg gccctgggag agctgggcta
960ccgggcagtg ggcgtgaggc tggacagtgg tgacctgcta cagcaggctc aggagatccg
1020caaggtcttc cgagctgctg cagcccagtt ccaggtgccc tggctggagt cagtcctcat
1080cgtagtcagc aacaacattg acgaggaggc gctggcccga ctggcccagg agggcagtga
1140ggtgaatgtc attggcattg gcaccagtgt ggtcacctgc ccccaacagc cttccctggg
1200tggcgtctat aagctggtgg ccgtgggggg ccagccacga atgaagctga ccgaggaccc
1260cgagaagcag acgttgcctg ggagcaaggc tgctttccgg ctcctgggct ctgacgggtc
1320tccactcatg gacatgctgc agttagcaga agagccagtg ccacaggctg ggcaggagct
1380gagggtgtgg cctccagggg cccaggagcc ctgcaccgtg aggccagccc aggtggagcc
1440actactgcgg ctctgcctcc agcagggaca gctgtgtgag ccgctcccat ccctggcaga
1500gtctagagcc ttggcccagc tgtccctgag ccgactcagc cctgagcaca ggcggctgcg
1560gagccctgca cagtaccagg tggtgctgtc cgagaggctg caggccctgg tgaacagtct
1620gtgtgcgggg cagtccccct gagactcgga gcggggctga ctggaaacaa cacgaatcac
1680tcacttttcc ccacaaaaaa
17001011130DNAHomo sapiens 10gggctggctg agcgcgggcg agtgtgagcg cgagtgtgcg
cacgccgcgg gagcctctct 60gccctctcct cgcaccctgc tcagggcatc tgaagagcct
ggaaacgtga acaggcttga 120agtatggcat gttgcaaaga tggtttctgc caagaaggta
cccgcgatcg ctctgtccgc 180cggggtcagt ttcgccctcc tgcgcttcct gtgcctggcg
gtttgtttaa acgaatcccc 240aggacagaac caaaaggagg agaaattgtg cacagaaaat
ttcacccgca tcctggacag 300tttgctcgat ggttatgaca acaggctgcg tcctggattt
gggggtcctg ttacagaagt 360gaaaactgac atatatgtca ccagctttgg acctgtttct
gatgttgaaa tggaatacac 420aatggatgtg ttcttcaggc agacatggat tgacaaaaga
ttaaaatatg acggccccat 480tgaaattttg agattgaaca atatgatggt aacgaaagtg
tggacccctg atactttctt 540caggaatgga aagaaatctg tctcacataa tatgacagct
ccaaataagc tttttagaat 600tatgagaaat ggtactattt tatacacaat gagactcacc
ataagtgcgg agtgtcccat 660gagattggtg gattttccca tggatggtca tgcatgccct
ttgaaattcg ggagttatgc 720ctatccaaag agtgagatga tctatacctg gacaaaaggt
cctgagaaat cagttgaagt 780tccgaaggag tcttccagct tagttcaata tgatttgatt
gggcaaaccg tatcaagtga 840aaccatcaaa tcaattacgg gtgaatatat tgttatgacg
gtttacttcc acctcagacg 900gaagatgggt tattttatga ttcagaccta tattccgtgc
attatgacag tgattctttc 960tcaagtttca ttttggataa ataaagaatc agttcccgct
aggactgtat ttggaataac 1020aactgtcctc accatgacca cactaagcat cagtgcacga
cattctttgc ccaaagtgtc 1080ctatgctacc gccatggact ggttcatagc tgtctgcttt
gcttttgtat tttcggccct 1140tatcgagttt gctgctgtca actatttcac caatattcaa
atggaaaaag ccaaaaggaa 1200gacatcaaag ccccctcagg aagttcccgc tgctccagtg
cagagagaga agcatcctga 1260agcccctctg cagaatacaa atgccaattt gaacatgaga
aaaagaacaa atgctttggt 1320tcactctgaa tctgatgttg gcaacagaac tgaggtggga
aaccattcaa gcaaatcttc 1380cacagttgtt caagaatctt ctaaaggcac acctcggtct
tacttagctt ccagtccaaa 1440cccattcagc cgtgcaaatg cagctgaaac catatctgca
gcaagagcac ttccatctgc 1500ttctcctact tctatccgaa ctggatatat gcctcgaaag
gcttcagttg gatctgcttc 1560tactcgtcac gtgtttggat caagactgca gaggataaag
accacagtta ataccatagg 1620ggctactggg aagttgtcag ctactcctcc tccatcggct
ccaccacctt ctggatctgg 1680cacaagtaaa atagacaaat atgcccgtat tctctttcca
gtcacatttg gggcatttaa 1740catggtttat tgggttgttt atttatctaa ggacactatg
gagaaatcag aaagtctaat 1800gtaatttcgt tgctatagta gtttgctaaa agatgatgaa
aatgcagaat gtctttttaa 1860atgtttttaa atataaacaa atattcttta ctaaaataaa
aactctgtgt aatttttcca 1920tttaaagata taagccagtt attgggagag ttaattaatt
cctgagtgaa aaagtgaact 1980atgttttttt tcagaaaaat tattttaaaa gaactcagca
ttcagttaga tagaatacac 2040accatcctgg aaagttggga taagagaaat agagctatta
gagacaagtg gcgcatattt 2100tttcattgat atttgaaaac agactatgac attttaaaaa
tctgccctat gagtatcaac 2160ctgccaccct aaatttccca gtggcactac ccttaaccag
aattgtttat tagatgtcat 2220atgcagtgac ctttggtgat cttcttagga acttcaagaa
aaggaatttt cctgttaaat 2280taaacattgg caaaaggaaa tggaatagta taaacactga
tcaatagagt aaaatatctg 2340ctgcataaaa aactaagaca aagaccagag gaaatatctt
ccctttctta tgttggctaa 2400acagtactta acagttgact tgaaattttg ttctctgagc
caaagtttaa ctcattgtat 2460gaattctttt tcatggtagt tcattcagtt atgtgtttat
ttactacata gttattcaga 2520gcctactgtg ttccaggaac tatgctagaa actgtctctc
taggaaagct cttgcacctt 2580tatctacaat attacttaaa aagtagaaca gtcaatgcat
gccaaagaac cataaactag 2640cagaggacat tgcattcttt agtgaaggac atttatttag
agtctgacaa catattcaaa 2700atatttttca gcctctactg atagtggata acaaatatat
ttgttcacat aaccactttg 2760atgtcagtac aacttcagca attggttttc aaaatagatg
agaatatggt acagattgtt 2820ctataagtga aaagcattat gtacttgaaa gtaaaaatca
gggcaatata agacttaata 2880gattaactgt cgcaaatttg atcagagtca cagagtagaa
tttgatcaga atcacagaat 2940catcagacat aggaactgag cacaggcttt ttcaggtgct
ttccccaaga tagatctaga 3000tattagctag tgaaatgcta aattttgaag agttttgtgt
ccgtagttct gtaattctgg 3060gcagtcatca tgttggtttt tttgggagtt tttttaaggt
ttaataacta aggggaatat 3120tttaaaatta agagagcagc aaatgaaagg agtaaagaaa
aaaatagctg tcgggtagga 3180tgccactgac tctgctatgt gatttatcag ggttttcatc
tactgacttc tttctcatta 3240ggtaggctta acaacttact tgagaatttt gcaactgtct
atgcagctga atctaagtat 3300ggttttttgt catattgcct ctagattttc ttctgtgctt
ctctctatct gctctggaat 3360ggatgagtga atgtgttctg ggtgttttag ggaacatatt
gatagaaatg accaccttgc 3420agacaaaatc tctctctctc tttttgtttt tatagaaaag
aagtgatagt agttaattgg 3480catcgatttt tcagatattg cactacctta taatggttgt
ttttgatacc tgaaaattgt 3540gcaaatgcca aatattaatt gtaagtcata tctgagaaat
cattcttggc tgtctttcta 3600ggtattccat agaatcaaca cattttaagg ctgaaagata
ctgtcgaaat cacccagtcc 3660caacccccca atttaaaatt gattctagta aaattaggtc
cagtaacacc tgtatatatg 3720tatatattta ataaagagta cttgtacaaa aaagcttatc
ataaattatt tcatgaatgt 3780gaatagattt ctggccttga ggacgatgtt tggaaatatg
gttggaagca caattcattc 3840gctactagtt attcagagcg tactttgttc caggaactat
gctggaaact gatagttcac 3900tattctgatg aaaaggctgg ttttgttgtt gttgttgttg
ttgttgttgt tgtttttggt 3960gaggaactct tactctttgc taatctattg gcctatctta
agaaataatt atttggttat 4020tcattggctt cctttaaaaa aaagtgttct tctacaaatc
ttacagagtg taaagagata 4080aaaagaaatg attttttttc ttacctttac atatgaaggt
ttaaaaatac atcatgtggc 4140caaagaatga gaaaggacag aattaaccaa ggattcttaa
ttgttaattt gaagaacaca 4200ttaaccagaa agcttaaaca ttattattaa aataaattat
ttcatttgca cacaatgata 4260ataatgatga taataataat aataataata ataataataa
taataataat aatatgttgt 4320ttgctttcct taactgaatt tcatcaaatt cattcagtga
tttttatttt ggtcattatt 4380tctatcttcc caataaccca gaggtacatc aagtaaaaac
acttttgcaa agagccagtc 4440acttttccct cttagaaaat ctcagaagaa tgattagggg
cacccaaagt tctggttatc 4500tatgaataat aatgaataat tttggctgag aatggtacct
ttatataact cttttaaaga 4560tgaaattcag aataatttta ttcaggacct agtatctgca
gtccatgttg gccactaact 4620gctacataat tactttcaat ttcctccagg catgactagg
tataaacata tatttacatg 4680attaatccac attttaaaat gacttgcact tgtgcatata
catagtactt tgaataatgt 4740atattttaaa ttggacctca caaatcttgt attaaagtag
gtagagagta gagtcacact 4800ttttttgatg aaatgagtca cagagaagtt acatgacaaa
gataaaatca cagggttgga 4860aagaactttg aaaggtcatt tttcaataat ctcaccttaa
aagtgacccc ttttcaaaca 4920aagcataaac aatttatttg tggcttattt tacccatgag
ctggccaata cttcctggcc 4980tagaaaaata tctccactct ccccattcct gttcttaatg
gtcttctctt ctcaatttgt 5040aaatattctc cagtaaaaga caccaggtgt ggagatgggt
cacttaattt caagttctga 5100gtgtcttgtg gttttaaaca agtctcttaa cctctctaag
actgattcct catttataac 5160agggaggagg tggattatgt aatatctaag agcttttcag
ttttaatact ctctgattct 5220catagtaaat acaagcatac tcttgtaaga aaaacactga
atactttgaa ccacaaataa 5280gtgtttatgg acaaaaattt agttctactg cttgattact
ttaagttcat tgcttgcttc 5340aaactaaggt ttccctacct tcaaaaatat atataacatc
tctccattta gataaagtat 5400attcttcccc agggaagact gtattcttta aagacagtag
aatattggct atttctcttt 5460tctgggattt cctgggcttt tattcactaa atgggctcct
gcccagtttg ggtactgtgc 5520tgatttttag atatacagag ataaaaatag cccctttcct
tgcaggtagt cacagtccgg 5580aagagatgat agatgcatag acaaaaaatt atgggatgta
actaatgctt cagtagaata 5640cagcagggcc aaaactagag tgatactcat ctcaggcaca
aatatatatg gggacatcaa 5700aacttcaata atcaagatac ctaatattta agtgaatatt
tttaaaactc aaaattaatg 5760caaaagattt atgatgaaca gaatatacaa attttaaata
aattaataga atcagtagta 5820ataatatttt cttctgcctc aggctccaaa attgctcagc
atagcactga tctagataga 5880ggtggataaa agatccacat aacttaatta cattgttgaa
ggagaggaac aagagtgata 5940gcagagaagg tttcacagat ataatcttaa gctaaatttt
atagaatgat ttggagttct 6000tatagcctcc attcccactt ccacaaacaa acaaaaaaat
gaaagcgcaa ttttatcagc 6060acctgaggca ggagaagaga tgaggatgtg gaaagtcaag
gggaactctt actacaaatt 6120cttagttctg tgtttggagg taagggtgaa tgcagggaag
tgagagttgt tgatgttgga 6180aagacctaaa gagcctggat taggaagagt tttgtgtaaa
ttactgaagg aatggaattt 6240gatcaggatt agtggcaatt tattaaaaat cttgaagaat
aatacgatga aaactaacat 6300ccttattttt ctgttttaga gaaagcacct gattattgtg
tgaactatgg tttggagggc 6360cacaaatcta gaggtagtgg aacagttgag atctcttatt
ttttctttcc tgtcttaaac 6420tttgccttct attccttttt tctttttttg accgcaatga
cttcattgtc atttgtaaaa 6480gtgatacatg actgttaaag atagacattg tagaaactta
aaaacaatct caaaattcta 6540ccacccagaa atcagaaata ttttgtattt ggatatgttt
gtctagaaga gtagattgct 6600tgattaaaag acagagtttt ataaatgtag aagccaatat
gacatacatg ctgccattaa 6660ataataaaaa attaaattga cttttatctc aagataagat
taaaattgga gggtaaaact 6720gaagaaattg ttgaaatttg gatggtgctt ctttaaagca
agagatttag agagtcagag 6780ctttttatcc caggtttcaa tctttatttc aggaaaattt
tctgcaattt tgtctaagtt 6840aatttttttt ttttaagaaa tgccaattat gtcaaatccc
ttttgtctct atacaatagt 6900ccccaactgt tttggcaaca ggcacgggtg agggtggggg
aatggttttc agatgaaatt 6960gttccatctc agatcatcag gcattagtcg attctcataa
ggagcggaca accttgcatg 7020ccctcctatg agaatctaat gccgccgcta atctgacagg
aggcagagct caggcgataa 7080tgctcaatgg gtgccactca cctcctgttg tgctgcccaa
ttcctaacag gtcatggata 7140agtactggtc agtggcccag gggttgggga ccactgctct
gtaactattt acagtattct 7200ttgtaactac tttggtatct ttaaaatttt ctttaacttt
tgtcaaccat aaccctagtg 7260agttttcagt tgtgattatt ctattttgta acttccaatg
tacttttcaa cttcataatg 7320gttaattttg ttttccattg ctttcttggt cactgtcatt
tcatttttct tctctttctc 7380tatttttacc attgctttat tgaaatatct tctttgagct
tctcatgttt ctctattaat 7440gagatcatgt ctataatatt ttttgagact acagagacct
atttatataa actcttcctc 7500tatttcttga aaaagttttt atctggcgtg agcttcatct
gctttttcat tgaggtttta 7560tctcccttgc ctatttttgg ggctggtttc tttctattaa
tcactgagca gagccagcta 7620tttactgaac tacagtgtgg gaagtggtgg gagggtgagt
cagatcagcc cacagaagct 7680atttaaattt caggtttcaa gcccacctcc ccaaaaccgt
tttatgtgtt ttttcttctg 7740cccaggcacc atatttttat atctattttt gacatttggg
cggcctatgt agttcacagt 7800gtaaaactct ctgttttact ttctttatgt tattgctagt
gattattgct tgtagtccca 7860cccccttccc cacattagcc ttagtattct atattattca
gcaagcttgt tcacaactct 7920caaatatagt ctatcagaat ttttatcttt acctctacat
tccactattc ggaagtatat 7980agtaaaatcg tatgaagaca gattttgtct ttttcttgcc
tgtttacact ctatcttaca 8040gaggtttcaa acaaaccatc tttgtttgaa acatcgcagg
ataatgatac ttattgaaat 8100ctacatcctg cccaagatat atgccagtca atttcctttc
tcctattagt gcaaatggct 8160acctacttaa aagctgctga ctatagtttg tcatcaatta
cttgttaatt acagatatgg 8220ttttcatttt tttttctcaa tttttcatta tgttattttt
ggagactgtc ttaggtgggg 8280agtgaattat aaatattttt atttcaccac ctttaactga
gtcaccatat gttatttgca 8340cttccaatag accagggatt gaccagagta tcttttactg
atatgaccac cagagctaca 8400tggcttttac cttctgtata tcagatgtca ctggaatcaa
gcattaaacc tagattaaat 8460ctggattaaa ccagctgtat ggcaccttag aaaattgaga
aggactagga agctgataga 8520aagaactcct gtataaaaaa taaattcttt ttacattttc
cttggtagta tttctgcaag 8580cttctttagt ttctataggg gaatcccaga gttttcctct
gagattgctt ccctttcctt 8640tgtattttca tttttccctc ttgggcttta cttttcagtc
gtgtatttct atcccaatgt 8700taatttatta cactgtttat attttcctgt ccttcaattc
atcagtagat tagtgaagta 8760cttattcctt taattataag tataaacgtt tttaatttct
ttttggataa cgatacattt 8820aatggaaaat ttttaaatgc tatggtttct taatagcttt
tctctaccac taattacttc 8880cgttaaaaaa aaaaagaaat acccatgcgt aatataaaag
aaattttgaa taaaatgtta 8940tcctttcctt ttactagaga caaacatctc cacttcaaaa
tggaaaaatg gaactatgca 9000aaggaaattt acgatattca agagtatgat attatcactg
aaccgattaa tttaattgaa 9060aatactaacc tgcaaaaaag aattacacaa atgtatttga
aatgtcatca gatacctcaa 9120gctatgacag agttgattat gttacacaag tagtaaagga
taaattaaat atattctata 9180ttaacactaa gatttaaaac taattatagt cttctttaat
ttttctactg tatacatttc 9240atctagtttt cagtaaaaca aacttttcat tacttttact
tatcccatgc aaatctagtt 9300gctataagat ataacctaat ttggaaatac ctccctgtaa
tacattggaa ttttggtgtg 9360agtgtgtgtg atcagagagg ataaacaaat ggtgtcagca
aaatagaatg taaaatatgg 9420agataatgtg gatttacaca atttgataaa aattctccct
tgaattttgc agatcatata 9480tgaatatcat catgtgaagt gcaattagga ttttttcata
tattaataca tatacatcat 9540ctctttaata aaatattttg ctgaactcgt ttaatatttc
tcatgtctca tatttcatat 9600tttctcatat gtctcatatt ttatattttc tcatatgtgt
ctcattttta ttattactat 9660agtatccatt aaaggagact ggcaaatacc tgaacaaagt
tatgttgttg gcaatataag 9720atattaccaa ttgcataata ttatttccaa aggcaaatta
atatgcaaac tatagatttc 9780catgggtatc tatacaaatt attacttgaa gtccatagaa
aacagcttcc ttagagggaa 9840gtaaaagaag ctctgataac agacaatgta tagcatttca
gttaaagttt gattgacata 9900tttttttctc agtcttttat acttgtgaat tatagtctac
attttgtctt tacagatgtt 9960gctaacacag tgcagcatgt tggcttgtca ttttactgat
tatgtatatt gtctcctagt 10020tcaagtatac agtaaatcag agctttcatt tttcaagggg
cagaaaaata attgttggtt 10080gataaggtaa ggttatatga ttttgaggga gcttcattgt
aaattgaatg agaatccggt 10140tttcatgcaa aggtgtatct atgcgataat actttgaatg
tctgtagttt gaaatagaag 10200gttaattttt tccactggct tatccttaat gaaggaaatc
ccctgataat tactttgatt 10260ctgaaaatgt tgaaaactcc agaagaaata aagcttttct
ttgatttctc agctgaagtg 10320ttgtacaaac tgaggaatat gaagtccatt cccttctttc
ttctcttgaa taattttaaa 10380attgtttgtt tagttgtaca attgaaaata ttccttatta
tagaagtaaa aaaacaataa 10440tgcatatttc ctcatatcat aaaaactaaa tttgttatca
tctgagcttc aatattcttg 10500ctcaattaga atagtaaata taaagtgtga tatttataac
agttcaaggt ttgataggag 10560atagaggtgt tttgatttta tgggaaaatt acttcctcaa
gaacacattt cttgaggttt 10620tagtaatcac atttgactcc ctgaaattgg caattttatt
caatgtagga atattatcat 10680ggtatattat agtgaggagc acatagtcat tattattttg
tttttgcaaa tttattttga 10740aaaaaaggag cattatcaaa tattggttta ctattttaaa
gtaattcatc aggaaatgat 10800tttttaaaca ctgtcccttt aagtaaatgt cccttgcttt
tcaaagctca acttattact 10860tatggtaata gagttacttt gcttcttaaa acaaagttta
tactagagca tagcattgta 10920gaattattca ggtctcaatt tctcactgga aaatgagtct
ttaaaatagt aaggatttaa 10980atttctataa aatttaatca cagatactta tattttaaga
taaatgtgtt ggagctaaac 11040tctggaatta ttaaaatata aaacattata tccctctaat
gtattttttc tatttaaatt 11100taaaacaata aacataaata tctttggaaa
11130111520DNAHomo sapiens 11ccacgcgtcc ggtggtaaag
ggacggaggg gaagccctga gaggactgag aggatgggaa 60attctctgct gagagaaaac
aggcggcagc agaacactca agagatgcct tggaatgtga 120gaatgcaaag ccccaaacag
agaacatcca gatgctggga tcaccatatc gctgaagggt 180gtttctgcct tccatggaaa
aaaatactca tttttgaaaa gaggcaagat tcccaaaacg 240aaaatgaaag aatgtcatct
actcccatcc aggacaatgt tgaccagacc tactcagagg 300agctgtgcta taccctcatc
aatcatcggg ttctctgtac aaggccatca gggaactctg 360ctgaagagta ctatgagaat
gttccctgca aagctgagag acccagagag tccttgggag 420gaactgagac tgagtattca
cttctacata tgccttctac agaccccagg catgcccgat 480ccccagaaga tgaatatgaa
cttctcatgc ctcacagaat ctcctctcac tttctgcaac 540agccacgtcc acttatggcc
ccttctgaga ctcagttttc ccatttatag tgaagtggct 600ggactagcat ttgtttagca
ccaacaaata aaaggtggga tgggggatct gcctgaagca 660gggatgggac acaaagtccc
tccagcttat ctcccacaac aaccctttcc ctgcagagca 720tggtttgtat accacaagcc
ctcttagcac gcaaaagcca aaatctaaag atcaaccatt 780tatcctgaac aacaccattt
gagaaagagg taaccatctt tggttctaca tggtttggag 840agtatagtgg taggaggggc
tccctgattc ccctaaagct atgcacacca caaggggctc 900tgctcttctg tctgggatct
tcttataaag tgttcccatg atcattctct aaagtcacga 960ggaagcttta ctcatcatac
taagtgtgcc caagggggag ttcactcatt actgtgacct 1020tccagctcag tccccaccca
tgggagcctg tgttgctcct ctcactccat gtgtctaagt 1080catgtctttt acatagtgtc
ctttgacctg ttggccccca tggtctggtt agttatgtga 1140gttgaatcaa gaggctctag
gccagatgtt tacataattt taacctatat gattttattt 1200ttaactttgt atttctccct
agaaatctta ataagacaat tatgccatca gacaatgtta 1260agaagaacga tccttggaga
tcccgtaatc ccactaccct tctttggctc agagaggata 1320atttgcctaa tgatacatta
aagttagtgg caaaacttaa tttggagcct gatttcctac 1380tgacttccaa tttagtgctc
ccccagtatg ctaaatagaa agccctctgc aatatattaa 1440atgtatacta aatgtatata
tttaataatg tcatgtataa aatatgaata aaatgtccac 1500ataggaaatt aacacataaa
1520121300DNAHomo sapiens
12ataagaggtt gggctttgga tagatagaca gactcctggg tccggtcaac cgtcaaaatg
60tccaaagaac ctctcattct ctggctgatg attgagtttt ggtggcttta cctgacacca
120gtcacttcag agactgttgt gacggaggtt ttgggtcacc gggtgacttt gccctgtctg
180tactcatcct ggtctcacaa cagcaacagc atgtgctggg ggaaagacca gtgcccctac
240tccggttgca aggaggcgct catccgcact gatggaatga gggtgacctc aagaaagtca
300gcaaaatata gacttcaggg gactatcccg agaggtgatg tctccttgac catcttaaac
360cccagtgaaa gtgacagcgg tgtgtactgc tgccgcatag aagtgcctgg ctggttcaac
420gatgtaaaga taaacgtgcg cctgaatcta cagagagcct caacaaccac gcacagaaca
480gcaaccacca ccacacgcag aacaacaaca acaagcccca ccaccacccg acaaatgaca
540acaaccccag ctgcacttcc aacaacagtc gtgaccacac ccgatctcac aaccggaaca
600ccactccaga tgacaaccat tgccgtcttc acaacagcaa acacgtgcct ttcactaacc
660ccaagcaccc ttccggagga agccacaggt cttctgactc ccgagccttc taaggaaggg
720cccatcctca ctgcagaatc agaaactgtc ctccccagtg attcctggag tagtgctgag
780tctacttctg ctgacactgt cctgctgaca tccaaagagt ccaaagtttg ggatctccca
840tcaacatccc acgtgtcaat gtggaaaacg agtgattctg tgtcttctcc tcagcctgga
900gcatctgata cagcagttcc tgagcagaac aaaacaacaa aaacaggaca gatggatgga
960atacccatgt caatgaagaa tgaaatgccc atctcccaac tactgatgat catcgccccc
1020tccttgggat ttgtgctctt cgcattgttt gtggcgtttc tcctgagagg gaaactcatg
1080gaaacctatt gttcgcagaa acacacaagg ctagactaca ttggagatag taaaaatgtc
1140ctcaatgacg tgcagcatgg aagggaagac gaagacggcc tttttaccct ctaacaacgc
1200agtagcatgt tagattgagg atgggggcat gacactccag tgtcaaaata agtcttagta
1260gatttccttg tttcataaaa aagactcact taaaaaaaaa
1300131730DNAHomo sapiens 13tttacggcgc ggagccggag agacctgggc tggcgcgggc
gggagctgcg gcggataccc 60ttgcgtgctg tggagaccct actctcttcg ctgagaacgg
ccgctagcgg ggactgaagg 120ccgggagccc actcccgacc cggggctagc gtgcgtccct
agagtcgagc ggggcaaggg 180agccagtggc cgccgacggg ggaccgggaa acttttctgg
gctcctgggc gcgccctgta 240gccgcgctcc atgctccggc agcggcccga aacccagccc
cgccgctgac ggcgcccgcc 300gctccgggca gggcccatgc cctgcgcgct ccgggggtcg
taggctgccg ccgagccggg 360gctccggaag ccggcggggg cgccgcggcc gtgcggggcg
tcaatggatc gccactccag 420ctacatcttc atctggctgc agctggagct ctgcgccatg
gccgtgctgc tcaccaaagg 480tgaaattcga tgctactgtg atgctgccca ctgtgtagcc
actggttata tgtgtaaatc 540tgagctcagc gcctgcttct ctagacttct tgatcctcag
aactcaaatt ccccactcac 600ccatggctgc ctggactctc ttgcaagcac gacagacatc
tgccaagcca aacaggcccg 660aaaccactct ggcaccacca tacccacatt ggaatgctgt
catgaagaca tgtgcaatta 720cagagggctg cacgatgttc tctctcctcc caggggtgag
gcctcaggac aaggaaacag 780gtatcagcat gatggtagca gaaaccttat caccaaggtg
caggagctga cttcttccaa 840agagttgtgg ttccgggcag cggtcattgc cgtgcccatt
gctggagggc tgattttagt 900gttgcttatt atgttggccc tgaggatgct tcgaagtgaa
aataagaggc tgcaggatca 960gcggcaacag atgctctccc gtttgcacta cagctttcac
ggacaccatt ccaaaaaggg 1020gcaggttgca aagttagact tggaatgcat ggtgccggtc
agtgggcacg agaactgctg 1080tctgacctgt gataaaatga gacaagcaga cctcagcaac
gataagatcc tctcgcttgt 1140tcactggggc atgtacagtg ggcacgggaa gctggaattc
gtatgacgga gtcttatctg 1200aactacactt actgaacagc ttgaaggcct tttgagttct
gctggacagg agcactttat 1260ctgaagacaa actcatttaa tcatctttga gagacaaaat
gacctctgca aacagaatct 1320tggatatttc ttctgaagga ttatttgcac agacttaaat
acagttaaat gtgttatttg 1380cttttaaaat tataaaaagc aaagagaaga ctttgtacac
actgtcacca gggttatttg 1440catccaaggg agctggaatt gagtacctaa ataaacaaaa
atgtgcccta tgtaagcttc 1500tacatcttga tttattgtaa agatttaaaa gaaatatata
tattttgtct gaaatttaat 1560agtgtctttc ataaatttaa ctgggaaacg tgagacagta
catgttaatt atacaaatgg 1620ccatttgctg ttaataattt gttctcaact ctaggatgtg
gcttggtttt tttttttctc 1680ttttcttttt taaacaagac caagatcttg cttattcttc
catgaaaaaa 1730147240DNAHomo sapiens 14acggccatgg aggacgcggg
agcagctggc ccggggccgg agcctgagcc cgagcccgag 60ccggagcccg agcccgcgcc
ggagccggaa ccggagccca agccgggtgc tggcacatcc 120gaggcgttct cccgactctg
gaccgacgtg atgggtatcc tggacggttc actgggaaac 180atcgatgacc tggcgcagca
gtatgcagat tattacaaca cctgtttctc cgacgtgtgc 240gagaggatgg aggagctgcg
gaaacggcgg gtttcccagg acctggaagt ggagaaaccc 300gatgctagcc ccacgtcact
tcagctgcgg tcccagatcg aagagtcgct tggcttctgt 360agcgccgtgt caaccccaga
agtggaaaga aagaaccctc ttcataaatc aaactcagaa 420gacagctctg taggaaaagg
agactggaag aagaaaaata agtatttctg gcagaacttc 480cgaaagaacc agaaaggaat
aatgagacag acttcaaaag gagaagacgt tggttatgtt 540gccagtgaaa taacgatgag
cgatgaggag cggattcagc taatgatgat ggtcaaagaa 600aagatgatca caattgagga
agcacttgct aggctcaagg aatacgaggc ccagcaccgg 660cagtcggctg ccctggaccc
tgctgactgg ccagatggtt cttacccaac gtttgatggc 720tcatcaaact gcaattcaag
agaacaatcg gatgatgaga ctgaggagtc ggtgaagttt 780aagaggttac acaagctggt
aaactccact cgcagagtca gaaagaaact aattagggtg 840gaagaaatga aaaaacccag
cactgaaggt ggggaggagc acgtgtttga gaattcgccg 900gtcctggatg aacggtccgc
cctctactct ggcgtgcaca agaagcccct tttctttgat 960ggctctcctg agaaacctcc
cgaagatgac tcagactctc tcaccacgtc tccatcctcc 1020agcagcctgg acacctgggg
ggctggccgg aagttggtca aaaccttcag caaaggagag 1080agccggggcc tgattaagcc
ccccaagaag atggggacat tcttctccta cccagaagaa 1140gaaaaggccc agaaagtgtc
ccgctccctc accgaggggg agatgaagaa gggtctcggg 1200tccctaagcc acgggagaac
ctgcagtttt ggaggatttg acttgacgaa tcgctctctg 1260cacgttggca gtaataattc
tgacccaatg ggtaaagaag gagactttgt gtacaaagaa 1320gtcatcaaat cacctactgc
ctctcgcatc tctcttggga aaaaggtgaa atcagtgaaa 1380gagacgatga gaaagagaat
gtctaaaaaa tacagcagct ctgtctctga gcaggactcg 1440ggccttgatg gaatgcctgg
ctcccctccg ccttcacagc ccgaccccga acacttggac 1500aagcccaagc tcaaggccgg
gggttctgta gaaagtcttc gcagttctct cagtgggcag 1560agctccatga gcggtcaaac
agtgagcacc actgattcct caaccagcaa ccgggaaagc 1620gtcaagtcgg aagatgggga
tgacgaagag ccgccttacc gaggcccgtt ctgcgggcgt 1680gccagggtgc acaccgactt
cacccccagt ccctatgaca cagactcact caagctcaag 1740aaaggagata tcatcgatat
aatcagcaag ccacccatgg ggacctggat gggcctgctg 1800aacaacaaag tcggcacgtt
caagttcatc tacgtggacg tgctcagtga agacgaggag 1860aaacccaaac gccccaccag
gaggcgtcgg aaaggacgac caccccagcc caagtctgtg 1920gaggatctcc tggatcggat
taacctaaaa gagcacatgc ccactttcct gttcaatgga 1980tatgaagatt tggacacctt
taagctgctg gaggaggaag acttggatga gttaaatatc 2040agggacccgg aacacagagc
tgttctcttg acagcagtgg agctgttaca agagtatgac 2100agtaacagcg accagtcagg
atcccaggag aagctgctcg ttgacagcca gggcctgagt 2160ggatgctcac cccgagactc
aggatgctac gaaagcagtg agaacctgga aaacggcaag 2220actcggaaag ctagcctcct
atctgccaag tcatccaccg agcccagctt gaagtctttt 2280agcagaaacc agttgggcaa
ttacccaaca ttgcctttaa tgaaatcagg ggatgcactg 2340aagcagggac aggaggaggg
caggctgggt ggtggccttg ccccagacac gtccaagagc 2400tgtgacccac ctggtgtgac
tggtttgaat aaaaaccgaa gaagcctccc agtttccatc 2460tgccggagct gtgagaccct
ggagggcccc cagactgtgg acacttggcc ccgatcccat 2520tccctggatg accttcaagt
ggagcctggt gctgagcaag acgtgcctac cgaggtgaca 2580gaaccgcccc ctcagattgt
acctgaagtg ccacagaaga cgaccgcctc ttccacgaag 2640gcccagcccc tggagcgaga
ctctgctgtc gacaatgcat tgctactgac ccaaagcaag 2700agattttctg aacctcagaa
attgacaact aagaaactgg agggctcaat cgcagcctct 2760ggtcgcggcc tgtcaccccc
tcagtgtttg cccagaaact atgatgctca gcctcctgga 2820gctaaacacg gtttagcaag
gacgcctctg gagggccaca gaaaaggaca cgagtttgaa 2880ggaacacacc atcccctggg
caccaaagaa ggggtagatg ctgagcagag aatgcagccc 2940aaaattccat cacagcctcc
acctgttcct gccaaaaaga gcagagaacg ccttgctaac 3000ggactccacc ctgttcccat
gggccccagt ggggccctcc ccagtcccga tgcgccatgc 3060ctgccagtga aaaggggcag
ccccgccagc cccaccagcc ctagcgactg tcccccagca 3120ctggctccca ggcctctctc
agggcaggcg cctggcagcc caccaagcac aaggccgccc 3180ccctggctct cagagctccc
cgagaacaca agcctccagg agcacggtgt gaagctgggc 3240ccggctttga ccaggaaggt
ctcctgtgcc cggggagtgg atctagaaac gctcactgaa 3300aacaagctgc acgctgaagg
catcgatctc acggaggagc cgtattctga taagcatggc 3360cgctgtggga ttcctgaagc
cctggtgcag agatacgcag aggacttgga tcagcccgag 3420cgggacgtcg ccgccaacat
ggaccagatc cgggtgaagc agcttcggaa gcagcaccgc 3480atggcgattc caagtggtgg
actcacggaa atctgccgaa agcccgtctc tcctgggtgc 3540atttcgtctg tgtcagattg
gctcatttcc atcggtctgc ccatgtacgc cggcaccctc 3600tccaccgcgg gcttcagcac
actgagccaa gtgccttctc tgtctcacac ttgccttcag 3660gaggccggca tcacagagga
gagacacata agaaagctcc tatctgcagc cagactcttc 3720aaactgccgc caggccctga
ggccatgtag ccaggcccgg aatgggcctc tctggacaag 3780agccaccctt tcactgtgca
tatgatgctg atgcaattcc tccatcatct ctggacgtgc 3840agaccagatc cagaagaaag
gcctggcgtg tggccaaaca gcgtgaaacc ttggcacagg 3900actgaggatc ctctcctcca
gaaaagcccc ctcgaggaaa taaattagtg cggttctctt 3960tgacctccaa agacaagaca
agcacttatt tttattttca gaagacaaaa gaaccaagat 4020gccaactggc tgcgaatgct
ctatctccag tctgtctctg tgtactggta gaggctggga 4080ggagtagggg gcagcctgtt
ccatttctga tagtgccctt gctcttctgt ctgtcatctt 4140gcaggatgcc cgagggccag
atgggcttag ctaggccaaa gtaacagact caagagttat 4200tgtacattac tgaccacgct
catttgttca aaagttagaa catctggctg caccaggaaa 4260aaaaaaaaaa aaaagtcctg
ttcttcttta gataaacaag agacattttc ataattgctt 4320tctagcaatc agcttttatt
tgccttaata taagctttta agcagttatc taactagtgt 4380ccacaaccct gtaaccatac
ttccacatct tcagcttagg cagacatcga acctctctgg 4440gatgtttcca gcaaaagtga
gcttttctaa tcgtctcatt gtaacatggc ttattttgta 4500gaggtattca tcagccacac
acttcatgtt ggtttttggt ttttaagcta actacaaatc 4560tagtaaaaag ctatctgaaa
ttcacaaata tcatgtgtgt gcgtgcgtgc gtgcgcgtgt 4620gtgtctgtat tcatagtgac
tgcttttggt tttaaccagt ttagtatcgt tactgtgtgg 4680atcgtcgcgc tgcagtattg
acttggaatc ctgaccatgt ccatcccaaa attcagtcct 4740cagttaacgg atcatgtttg
caaaaggtca ctgtgaggct gcatatttca gaaagatgtc 4800cttaataagg gaagtcatgt
ataagatgtt ttctaaaaga cttttcagta ttacaactaa 4860tactattatt atccttcttt
ttttatttag ataattcttt taatttaaac aaaggttcac 4920tatggaacca gacaaatctc
attagccatg tgttaagtat ttgctacttt aaattgtttt 4980acaactgatt tcagcacatt
ctatcctttt ttttttttga aatggagttt cgctcttgtc 5040acccaggctg gagtgcaatg
gcacgatctt ggctcactgc aacctcagtc tcccaggttc 5100aagtgattct cctgccttag
cctcccgagt agctgggatt ataggcaccc accaccacgc 5160ccagctaatt tttgtattat
tagtagagac agggtttcac catgttggcc aggctggtct 5220caaactcaac tcctgacctc
aggtggtcca cccgcctcag cctcccaaag tgctgggatt 5280acaggtgtga gccaccgcac
ctggcctctg tcctctttta gtctagtgtc tggttttcta 5340gcaaacagta aatttaaaca
agtaaactat tatggtttcc attgcttaca aaatgatttt 5400cctttacatt cttatcatga
acactatttt aagcatcaaa tgcaatcatc taaaatataa 5460aggtcaatca tttataatag
aaacaccttg accacaagcc cttgattgaa cattttataa 5520tatttcatct acttattaaa
acaaataatt tcccttgggt tggaggggaa gtgatttcat 5580aaattaatta gaaagccatc
tttagcatat tgcttatgtc tggatccatg tttctgagga 5640aaaagacatt ctcaggtgat
gtattttttt catgcattag tatgcatttt taaaaaataa 5700tgcatgtttc tttaataatt
aattttcatc ttctataaga tgccatgtga agaagttgtg 5760gaaatgtaga ataaaaagct
aaagctgcca aatttctgtt gaactcttaa aaacagctca 5820tgtttgtttg tcctctcggg
ttgtggccta gcctatttgc aatgtaatga agctgcaggg 5880ttcttgtata gctaaagcgt
tcaatgcatt tcacgtgctg tggtggatgt gggtgctgta 5940gacaggcttc ttctcttcct
gctctcaaaa tacctcggct tgacatttgg acagatcctg 6000tcattgttta agctgagcaa
aaaaccacac aaaagttgtg taagagatga gataacaaag 6060gagcgagaga aatctcatgt
gaatttccaa gttttaattc gttctccatg aaggattttc 6120atttcagtga aagtcgcagc
agaagaggga actttctgga gtttttgaga atgccaaacc 6180acatttttat cacacttctt
tggaaatcaa tgcctttgca tagaaaatca aattcaggga 6240ccacaaagaa ttttcagtgg
gaatgtctag tctgaggggt ctgaggttgt ttttacttta 6300ttgtgttgtt taaatatttt
aaaaatatct ttagcgtttg gtcttttttt tttctgtaaa 6360catttaattt ggtctgagaa
aagctgaatg tttgggtgtg acgtttgact gaggtggatt 6420ggggctgcct gtggacatta
gtgaacaggt ggtaggcttc aggaatatcc agttttaatc 6480agttgcattt ggtacagaat
tttgagtaat ggtgaaaatt gttgtctttg gaaagcacaa 6540aagaaacctg gaaaggcagt
tcggctcagg tagctacaca taacattgtg tatgattttc 6600acttcaaagc tgtctggaag
gaaatgcagt cagctccagc tagtactatt tatgtaccca 6660gataactaag atattgtttc
atggccttgc cttagtcaga ggcccttttc tctgtcctga 6720acccccaggt atgggtgaaa
ttggaaatta ctaatctatt ggaaatcagt tcctgacata 6780gtaaagtttg ctttcataac
tgcagcaaaa aaggtcaact tgccaagtca ctgctgccat 6840gtgtgtactg tattattttc
agaaaaaaat ataatagtct gagtccaagt tatcttgatt 6900taaaattgat agagaaaaga
aactgtcgag caagttatat aacaactaac aacattgcac 6960tttctgtata tgaaatcaat
atttaaataa cttatttttc tccattgctg ttcttaaaaa 7020cattgtaagt agctgtaata
taccagtacc aatatgttct tgcaattgct tcagcccaag 7080aaagctgtgt attgttttaa
aaattgtaaa aattattgtg atgattcatt tagcataaag 7140agaggtggac ggaagggttt
tcctatgtat caaaacttgt ctataattat gtcatctatg 7200tacctagaaa aaagtaaata
aatttcttca gttgaatatg 7240153877DNAHomo sapiens
15ggcggtcgcg cgcaggactc gagggcttct agccaccgtc cccgccagcg ccgcgccccg
60ccacagggcg gcatgagccc acccgcggcc gcagccctag cgccctgctc ctccgcctgg
120gcggcccggc tgcggtgacg gctctcgctg cccgactggg ggccatgaag ccgagtccgg
180ccgggacggc gaaggagctg gagcctccgg cgccggcccg aggcgagcag cgcacggcgg
240agcccgaggg gcgctggcgg gagaagggcg aggcagacac cgagcggcag cgcacccggg
300agcggcagga ggccacgctg gccgggctgg cggagctgga gtacctgcgc cagcgccaag
360agctgctggt caggggcgcc ctgcgcggcg ccgggggtgc gggagccgct gcgccccgcg
420ctggggagct actgggggag gcggcgcagc gcagtcgcct ggaggagaag ttcttggagg
480agaacatctt gctgctaaga aagcaattga actgtttgag gcgaagagat gctggtttgt
540tgaatcagtt gcaagagctt gacaagcaga taagtgacct gagactggat gtagaaaaga
600catctgaaga gcacctggag acagacagtc ggcctagctc agggttttat gagctgagtg
660atggggcttc aggatccctt tccaattcct ctaactcggt gttcagtgag tgtttatcca
720gttgtcattc cagcacctgc ttttgcagcc ccttggaggc gaccttgagt ctctcagatg
780gttgccccaa atctgcagat ctcataggat tgttggaata taaagaaggc cactgtgaag
840accaggcctc aggggcagtt tgccgttccc tctccacacc acaatttaat tcccttgatg
900tcattgcaga tgtgaatccc aagtaccagt gtgatctggt gtctaaaaac gggaatgatg
960tatatcgcta tcccagtcca cttcatgctg tggctgtgca gagcccaatg tttctccttt
1020gtctgacggg caaccctctg agggaagagg acaggcttgg aaaccatgcc agtgacattt
1080gcggtggatc tgagctagat gccgtcaaaa cagacagttc cttaccgtcc ccaagcagtc
1140tgtggtctgc ttcccatcct tcatccagca agaaaatgga tggctacatt ctgagcctgg
1200tccagaaaaa aacacaccct gtaaggacca acaaaccaag aaccagcgtg aacgctgacc
1260ccacgaaagg gcttctgagg aacgggagcg tttgtgtcag agccccgggc ggtgtctcac
1320agggcaacag tgtgaacctt aagaattcga aacaggcgtg tctgccctct ggcgggatac
1380cttctctgaa caatgggaca ttctccccac cgaagcagtg gtcgaaagaa tcaaaggccg
1440aacaagccga aagcaagagg gtgcccctgc cagagggctg cccctcaggc gctgcctccg
1500accttcagag taagcacctg ccaaaaacgg ccaagccagc ctcgcaagaa catgctcggt
1560gttccgccat tgggacaggg gagtccccta aggaaagcgc tcagctctca ggggcctctc
1620caaaagagag tcctagcaga ggccctgccc cgccgcagga gaacaaagtt gtacagcccc
1680tgaaaaagat gtcacagaaa aacagcctgc agggcgtccc cccggccact cctcccctgc
1740tgtctacagc tttccccgtg gaagagaggc ctgccttgga tttcaagagc gagggctctt
1800cccaaagcct ggaggaagcg cacctggtca aggcccagtt tatcccgggg cagcagccca
1860gtgtcaggct ccaccggggc cacaggaaca tgggcgtcgt gaagaactcc agcctgaagc
1920accgcggccc agccctccag gggctggaga acggcttgcc caccgtcagg gagaaaacgc
1980gggccgggag caagaagtgt cgcttcccag atgacttgga tacaaataag aaactcaaga
2040aagcctcctc caaggggagg aagagtgggg gcgggcccga ggctggtgtt cccggcaggc
2100ccgcgggcgg gggccacagg gcggggagca gggcgcatgg ccacggacgg gaggcggtgg
2160tggccaaacc taagcacaag cgaactgact accggcggtg gaagtcctcg gccgagattt
2220cctacgaaga ggccctgagg agggcccggc gcggtcgccg ggagaatgtg gggctgtacc
2280ccgcgcctgt gcctctgccc tacgccagcc cctacgccta cgtggctagc gactccgagt
2340actcggccga gtgcgagtcc ctgttccact ccaccgtggt ggacaccagt gaggacgagc
2400agagcaatta caccaccaac tgcttcgggg acagcgagtc gagtgtgagc gagggcgagt
2460tcgtggggga gagcacaacc accagcgact ctgaagaaag cgggggctta atttggtccc
2520agtttgtcca gactctgccc attcaaacgg taacggcccc agaccttcac aaccaccccg
2580caaaaacctt tgtcaaaatt aaggcctcac ataacctcaa gaagaagatc ctccgctttc
2640ggtctggctc tttgaaactg atgacgacgg tttgagtgac atcattggtg tagaaagttt
2700gtgtgttttt ttttcttctc cctagttgcc aaaattaaaa aggtggtgtt ttcatttttg
2760tataatactt taatggaatg ctttttaaaa aaatataaaa ccaaggtaaa ttattgtttc
2820atcttcacgt atggatgcta gtgcctttaa tggaaggtaa agaatgtttt gctagttaga
2880agtacatatt gaggttttaa tggtggtgat agtgagtttt gtggcaccag ctgtttttta
2940ttttaaactt tctgagcatc cggcaaggta caggttttga tgttcaagtt ttattgggat
3000aagatctttt gatcccaagg tcaggtggat ggaatttttg gatttatatt tgttccttga
3060gtcttcaggg cagtgtctcc atgagggttt tcctgttgag gggcaccaca tacaatagtg
3120tgaagtaggt atgaggggca gtcattgtat tctatagttt ttttatgtag tctacatttc
3180tcagatgtat ccccattcgg ttttattctc agaactgtta ctagactcat gacttggagg
3240ccaaacctta aatccagaga tagcagcctc gatagggacc ttaaaaggat tcacaaaaac
3300ttttgccaca cttggtgcct aggccctgtt cctaataacc ccttctaggg ccgtttatcc
3360aacatttaga tgccttcttt tccctcccta atttgtagcc agtccaacct ttcattcctt
3420ggaggattta gttttgggat aaaattttgg tccttgggca cagagacatt cactattaat
3480gaagtaaccc ttgggcatga ctccaatccc agaattgctc actgagcgct atgccaccga
3540agcgttgacc tgaacatatt agtgcaatcc agtccagatt ggacctttga tcctatgtgg
3600aagggctgtt ttttaagaaa aaatttttgg taaacagtat tgtgtaaaat tgctttttgt
3660ataccaatat atgcatgttt tgtgcatgag tagtacttgt gttgatactc ctgttgatgt
3720taaattacta tataatataa acagtatgtg tttttatata tcattgtgta aatttaatat
3780aacatatgca gtaataaacc atttgtttta ctgctgttaa gtttgttatt tgggtataaa
3840accagatgtt tacacctgta aaaaaaaaaa aaaaaaa
3877162583DNAHomo sapiens 16gtggaatccg gcgtgggctg gggggtccga gccgcggggg
gcagtgccat gcacaagcac 60cagcactgct gtaagtgccc tgagtgctat gaggtgaccc
gcctggccgc cctgcggcgc 120ctcgagcctc cgggctacgg cgactggcaa gtccccgacc
cttacgggcc aggtgggggc 180aacggcgcca gcgcgggtta tgggggctac agctcgcaga
ccttgccctc gcaggcgggg 240gccaccccca cccctcgcac caaggccaag ctcatcccca
ccggccggga tgtggggccg 300gtgcctccta agccagtccc gggcaagagc acccccaaac
tcaacggcag cggccccagc 360tggtggccag agtgcacctg taccaaccgg gactggtatg
agcaggtgaa tggcagtgat 420ggcatgttca aatatgagga aatcgtactt gagaggggca
actctggcct gggcttcagt 480atcgcaggtg gcatcgacaa tccccatgtc cctgatgacc
ctggcatctt tattaccaag 540attatccctg gtggagcagc tgccatggat gggaggctgg
gggtgaatga ctgtgtgctg 600cgggtgaatg aggtggacgt gtcggaggtg gtacacagcc
gggcggtgga ggcgctgaag 660gaggcaggcc ctgtggtgcg attggtggtg cggaggcgac
agcctccacc cgagaccatc 720atggaggtca acctgctcaa agggcccaaa ggcctgggtt
tcagcattgc tgggggtatt 780ggcaaccagc acatcccagg agacaacagc atctacatca
ccaagatcat tgaggggggt 840gctgctcaga aggatggacg cctacagatt ggggaccggc
tgctggcggt gaacaacacc 900aatctgcagg atgtgaggca cgaggaagct gtggcctcac
tgaagaacac atctgatatg 960gtgtatttga aggtggccaa gccaggcagc ctccacctca
acgacatgta cgctccccct 1020gactacgcca gcacttttac tgccttggct gacaaccaca
taagccataa ttccagcctg 1080ggttatctcg gggctgtgga gagcaaggtc agctaccctg
ctcctcctca ggttcccccc 1140acccgctact ctcctattcc caggcacatg ctggctgagg
aggacttcac cagagagcct 1200cgcaagatca tcctgcacaa aggctccaca ggcctgggct
tcaacatcgt aggaggagag 1260gatggagaag gcatttttgt ctccttcatc ctggcaggag
gcccagctga cctgagtggg 1320gagctgcgca ggggagaccg gatcttatcg gtgaatggag
tgaatctgag gaatgcaact 1380catgagcagg ctgcagctgc tctgaaacgg gccggccagt
cagtcaccat tgtggcccag 1440tacagacctg aagaatacag tcgctttgaa tcgaagatac
atgacttacg agaacaaatg 1500atgaacagca gcatgagctc tgggtctggg tccctccgaa
caagtgaaaa gaggtccttg 1560tatgtcaggg ccctgtttga ttatgatcgg actcgggaca
gctgcctgcc aagccagggg 1620ctcagcttct cttatggtga cattctgcat gtcattaatg
cctctgatga tgagtggtgg 1680caggcaaggc tggtgacccc acacggagaa agtgagcaga
tcggtgtgat ccccagtaag 1740aagagggtgg aaaagaaaga aagagctcga ttgaaaactg
tgaagttcca tgccaggacg 1800gggatgattg agtctaacag ggacttcccg gggttaagtg
acgattatta tggagcaaag 1860aacctgaaag gacaagagga tgctattttg tcatatgagc
cagtgacacg gcaagaaatt 1920cactatgcaa ggcctgtgat catcctgggc ccaatgaagg
accgagtcaa tgatgacctg 1980atctccgaat ttccacataa atttggatcc tgtgtgccac
atactacccg gcctcgacgt 2040gataatgagg tggatggaca agactaccac tttgtggtgt
cccgagaaca aatggagaaa 2100gatattcagg acaacaagtt catcgaggcg ggccaattta
atgataacct ctatgggacc 2160agcatccagt cagtgcgggc agttgcagag aggggcaagc
actgcatctt agatgtttcc 2220ggcaatgcta tcaagagact gcagcaagca caactttacc
ccattgccat tttcatcaag 2280cccaagtcca ttgaagccct tatggaaatg aaccgaaggc
agacatatga acaagcaaat 2340aagatctatg acaaagccat gaaactggag caggaatttg
gagagtactt tacagccatt 2400gtacagggtg actcactgga agagatttat aacaaaatca
aacaaatcat tgaggaccag 2460tctgggcact acatttgggt cccatcccct gaaaaactct
gaagaatccc ctccaaccat 2520tctcttgtga acagaagaaa tcaagtccct cttccctcct
ccctcttcat tcctgtcccc 2580atg
2583
User Contributions:
Comment about this patent or add new information about this topic: