Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis and related proteins, peptides and compositions

Abstract

Immunostimulatory methods and systems for treating or preventing atherosclerosis and/or a condition associated thereto in an individual and related compounds and compositions.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is an application under section 371 of International Patent Application PCT/IB2011/054178 filed Sep. 22, 2011, which claims priority to U.S. provisional application Ser. No. 61/385,548, filed on Sep. 22, 2010, entitled "Immunomodulatory Methods and Systems for Treatment and/or Prevention of Atherosclerosis and Related Proteins, Peptides and Compositions", the disclosure of which is incorporated herein by reference in its entirety. This application is also a continuation-in-part of and claims priority to U.S. application Ser. No. 13/257,045, entitled "Immunomodulatory Methods--and Systems for Treatment and/or Prevention of Atherosclerosis and Related Proteins Peptides and Compositions" filed on Sep. 18, 2011, which is the US national phase of International application PCT/SE2010/050299 filed on Mar. 17, 2010 entitled "immunomodulatory Methods and Systems for Treatment and/or Prevention of Atherosclerosis and Related Proteins Peptides and Compositions", which on its turn claims priority to Swedish patent application Serial No. 0950161-0, filed on Mar. 17, 2009 entitled "Abrogation of T cell Response to Low Density Lipoprotein as a Treatment for Atherosclerosis", docket number 21042228, the disclosure of each of which is also incorporated herein by reference in its entirety.

FIELD

[0002] The present disclosure relates to immunomodulatory methods and systems that are particularly suitable for treatment and/or prevention of atherosclerosis and/or conditions associated thereto and related proteins, peptides and compositions.

BACKGROUND

[0003] Atherosclerosis is currently viewed as a chronic lipid-related and immune-mediated inflammatory disease of the arterial walls. Many immune components have been identified that participate in atherogenosis and pro-clinical studies have yielded promising results suggesting that immunomodulatory therapies targeting these components can reduce atherosclerosis.

SUMMARY

[0004] Provided herein, are methods and systems for inducing immunomodulatory responses in an individual. In several embodiments, the immunomodulatory responses induced by the methods and systems of the present disclosure are associated to a therapeutic or preventive effect related to atherosclerosis in the individual or a condition associated thereto.

[0005] According to a first aspect, a method and system to treat and/or prevent atherosclerosis in an individual is described. The method comprises: inhibiting in the individual a CD4⁺ T cell response to ApoB100, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said response. The system comprises one or more agents suitable to inhibit CD4⁺ T cell response to ApoB100 of the individual and one or more agents suitable to detect the reduced response in the individual.

[0006] According to a second aspect, a method and system to treat and/or prevent atherosclerosis in an individual is described. The method comprises: inhibiting in the individual, one or more T cell receptors associated to the CD4⁺ T cell response to ApoB100, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said receptor. More particularly, the method can comprise: inhibiting in the individual one or more T cell receptors comprising an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 4, an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 12, an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 14 and/or an alpha chain encoded at least in part by a DNA sequence highly homologous to the DNA sequence of TRAV4, TRAV 12 or TRAV 14. In addition or in the alternative, the method comprises: inhibiting in the individual, one or more T cell receptors comprising a beta chain encoded at least in part by the T cell receptor beta variable gene (TRBV) 30, a beta chain encoded at least in part by the T cell receptor beta variable gene (TRBV) 31, and/or a beta chain encoded at least in part by a DNA sequence highly homologous to the DNA sequence of TRBV 30 or TRBV 31. In particular the inhibiting can be performed by administering a therapeutically effective amount of a compound capable of inhibiting said receptors. The system can comprise one or more agents suitable to inhibit one or more of the T cell receptors associated to the CD4+ T cell response to ApoB100 in the individual and one or more agents suitable to detect the inhibition in the individual.

[0007] According to a third aspect, a method and system to treat and/or prevent atherosclerosis in an individual is described. The method comprises: immunizing the individual against one or more T cell receptors that are associated to CD4⁺ T cell response to ApoB100, the T cell receptors comprising alpha variable region and/or a beta variable region. The method can be performed in particular by administering to the individual one or more immunogenic fragments of the alpha and/or beta variable region of the T cell receptor, or an immunogenic portion thereof or a derivative thereof. More particularly, the method can comprise: administering to the individual at least one fragment of the alpha variable region encoded by TRAV 4, at least one fragment of the alpha variable region encoded by TRAV 12, at least one fragment of the alpha variable region encoded by TRAV 14, at least one fragment of the alpha variable region encoded by a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14, an immunogenic portion thereof and/or a derivative thereof. In addition or in the alternative, the method can comprise: administering to the individual a fragment of the beta variable region encoded by TRBV 30, a fragment of the beta variable region encoded by TRBV 31, a fragment of the beta variable region encoded by a DNA sequence highly homologous to TRVB30 or TRBV31, an immunogenic portion thereof and/or a derivative thereof. For example m certain embodiments, the method can comprise administering TCR TRBV31 peptide SEQ ID NO:1 or other TCR TRBV31 immunogenic fragments in particular from CDR2 variable region alone or in combination with anyone of the peptides of SEQ ID NO:61, SEQ ID NO:63 and SEQ ID NO:65 or an immunogenic portion thereof. In additional exemplary embodiments, the method can comprise immunizing the individual against a T cell receptor homologous to TRBV31, for example by administering the homologous (human) TCR TRBV30 or a TCR TRBV30 immunogenic fragment in particular from CDR2 variable region alone or in combination with anyone of the peptides of SEQ ID NO:61, SEQ ID NO:63 and SEQ ID NO:65. The system then can comprises one or more agents suitable to immunize the individual against such a T cell receptor of the individual and one or more agents suitable to detect the immunization in the individual. In particular, for example, in some embodiments the system can comprise one or more agents suitable to immunize the individual against T cell receptor beta variable 31 and/or at least one of T cell receptor alpha variable TRAV14. TRAV12 and TRAV4 of the individual and one or more agents suitable to defect the immunization in the individual.

[0008] According to a fourth aspect, a T cell receptor associated to CD4⁺ T cell response to ApoB100, or an immunogenic fragment thereof or a derivative thereof is described the T cell receptor for use as a medicament. The T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof. The T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31, a beta variable region encoded by a DNA sequence highly homologous to TRBV31 or TRBV30, an immunogenic fragment thereof or a derivative thereof.

[0009] According to a fifth aspect, a T cell receptor associated to CD4⁺ T cell response to ApoB100, or an immunogenic fragment thereof or a derivative thereof is described for use in the treatment of atherosclerosis. The T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12, an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof. The T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31, a beta variable region encoded by a DNA sequence highly homologous to TRVB31 or TRBV30, an immunogenic fragment thereof or a derivative thereof.

[0010] According to a sixth aspect, a T cell receptor highly homologous to a T cell receptor alpha variable TRAV 14, a T cell receptor alpha variable TRAV12 or a T cell receptor alpha variable TRAV4, is used in the treatment of atherosclerosis.

[0011] According to a seventh aspect, an antibody reactive to a T cell receptor associated to CD4⁺ T cell response to ApoB100, or a fragment thereof, or a derivative thereof is described for use as a medicament. The T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12, an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof. The T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31, a beta variable region encoded by a DNA sequence highly homologous to TRVB31 or TRBV30, an immunogenic fragment thereof or a derivative thereof,

[0012] According to an eighth aspect, an antibody reactive to T cell receptor homologous to TRAV14, TRAV12 and/or TRAV4, is described for use as a medicament.

[0013] According to a ninth aspect, en antibody reactive to a T cell receptor associated to CD4⁺ T cell response to ApoB100, or a fragment thereof or a derivative thereof is described for use in the treatment of atherosclerosis. The T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12, an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof. The T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31, a beta variable region encoded by a DNA sequence highly homologous to TRVB31 or TRBV30, an immunogenic fragment thereof or a derivative thereof.

[0014] According to an tenth aspect, an antibody for use in the treatment of atherosclerosis is described wherein the antibody reactive to a T cell receptor homologous to TRBV31, such as the homologous human TCR TRBV30, to a TCR TRBV30 immunogenic fragment, in particular from CDR2 variable region, and/or to a T cell receptor highly homologous to T cell receptor alpha variable TRAV14, TRAV12 and/or TRAV4 or a fragment thereof.

[0015] According to an eleventh aspect, a composition and in particular, a vaccine is described, the composition comprising at least one or more T cell receptor associated to CD4⁺ T cell response to ApoB100, an immunogenic fragment thereof, a derivative thereof or an antibody together with an adjuvant and/or excipient. In particular, the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12, an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof. The T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31. a beta, variable region encoded by a DNA sequence highly homologous to TRVB31 or TRBV30, an immunogenic fragment thereof or a derivative thereof. In several embodiments the adjuvant and/or excipients are pharmaceutical acceptable and the composition is pharmaceutical composition.

[0016] According to a twelfth aspect, a composition and in particular, a vaccine is described, the composition comprising at least one of the T cell receptor beta variable 31 (TCR TRBV31), at least one of T cell receptor alpha variable TRAV14, TRAV12 and/or TRAV4, an immunogenic fragment thereof, a derivative thereof or an antibody together with an adjuvant and/or excipient. In several embodiments the adjuvant and/or excipients are pharmaceutically acceptable and the composition is pharmaceutical composition.

[0017] According to a thirteenth aspect, a hybridoma from mice immunized with oxLDL and carrying human ApoB100 as a transgene (huB100t9) is described and in particular the hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on Jan. 22, 2009 with the accession number DSM ACC2986. Additional hybridomas also comprised in the scope of the present disclosure comprise hybridoma 15-2 and 45-1 herein described.

[0018] According to a fourteenth aspect, the hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deufsehe Sammlung von Mskro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on Jan. 22, 2009 with the accession number DSM ACC2986 is used to identify a compound inhibiting a CD4⁺ T cell response to ApoB100. The compound is identified by its capacity to prevent activation of 48-5 upon exposure to ApoB100 or a fragment thereof. In some embodiments, the compound is a fragment of a TCR alpha variable region or a TCR beta variable region herein described.

[0019] The methods and systems herein described can be used in connection with applications wherein inhibition of CD4⁺ T cell response to ApoB100, inhibition of T cell receptors of CD4⁺ T cells binding to ApoB100, and in particular, inhibition of CD4⁺ TRAV14, TRAV12 and/or TRAV4 binding to ApoB100 alone or in combination with inhibition of CD4⁺ TRVB31. and/or TRAVB30 binding to ApoB100 and/or a therapeutic or preventive effect for atherosclerosis in an individual is desired.

[0020] The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the present disclosure and together with the detailed description and examples sections, serve to explain the principles and implementations of the disclosure.

[0022] FIG. 1 shows diagrams illustrating results related to T cell recognition of native LDL and ApoB100 according to an embodiment herein described.

[0023] FIG. 2 shows diagrams illustrating results supporting an inverse correlation between oxidation of LDL and T cell activation according to an embodiment herein described.

[0024] FIG. 3 shows diagrams illustrating results supporting that in an embodiment herein described hybridoma responses are i-A^b restricted.

[0025] FIG. 4 shows a diagram illustrating results supporting that in an embodiment herein described hybridoma response is not dependent of CD1 and MHC-1 presentation.

[0026] FIG. 5 shows results of experiments supporting genotyping of the T cell Receptor (TCR) in an embodiment herein described.

[0027] FIG. 6 shows diagrams illustrating results related to TCR expression evaluated by F ACS in an embodiment herein described.

[0028] FIG. 7 shows a diagram illustrating results indicating plasma levels of cholesterol and triglycerides according to an embodiment herein described.

[0029] FIG. 8 shows diagrams illustrating results indicating antibody titers to oxLDL and LDL in an embodiment heroin described.

[0030] FIG. 9 shows a diagram and a photographic representation indicating that, in an embodiment herein described, TRBV31+cell-depletion reduces the T cell response to ApoB100.

[0031] FIG. 10 shows diagrams illustrating results indicating that, in an embodiment herein described immunization against TRBV31 induces blocking antibodies.

[0032] FIG. 11 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV31 reduces atherosclerosis.

[0033] FIG. 12 shows diagrams illustrating results related to T cell recognition of native LDL and ApoB100 according to an embodiment herein described.

[0034] FIG. 13 shows diagrams illustrating results related to T cell recognition of oxidized LDL and ApoB100 according to an embodiment herein described.

[0035] FIG. 14 shows diagrams illustrating results indicating that, in an embodiment herein described, antigen preparation are not toxic to the cells.

[0036] FIG. 15 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization with oxLDL or ApoB100 expands T cell populations that recognize native epitopes of LDL and induces antibodies to oxLDL, native LDL and ApoB100.

[0037] FIG. 16 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization is necessary for priming of T cells and detection of proliferation in vitro.

[0038] FIG. 17 shows diagrams illustrating results indicating that, in an embodiment herein described, TRBV31+T cells recognize ApoB100.

[0039] FIG. 18 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV31 reduces atherosclerosis.

[0040] FIG. 19 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV31 reduces inflammation in atherosclerotic lesions.

[0041] FIG. 20 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization with TRBV31 peptide or KLH do not influence ApoB100 or lipid levels in plasma.

[0042] FIG. 21 shows a diagram illustrating results from 3 mice carrying TCR TRBV31 and TRAV12 as transgenes. Spleen cells from such TCR transgenic mice (mouse #4, 31 and 33) or from control wild type mouse were cultured with human ApoB100 (10 μg/ml). After 72 h, (A) the supernatants were saved for IFN_v evaluation by ELISA, and (B) the cells were pulsed with 1 μCi (3 H-thymidine) for cell proliferation (analysis of DNA replication) as an indicator of T cell activation. Results are expressed as mean±SEM of the results of duplicate wells for each mouse. Data show that the TCR transgenic mice, but not control mice, respond vividly to ApoB100 antigen, by IFN.sub.γ secretion and by proliferation.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0043] Provided herein are methods and systems and related products and compositions for treating and/or preventing atherosclerosis or a condition associated thereto in individuals.

[0044] The term "treating" or "treatment" as used herein indicates any activity that, is part of a medical care for, or that deals with, a condition medically or surgically. The term "preventing" or "prevention" as used herein indicates any activity, which reduces the burden of mortality or morbidity from a condition in an individual. This takes place at primary, secondary and tertiary prevention levels, wherein: a) primary prevention avoids the development of a disease; b) secondary prevention activities are aimed at early disease treatment, thereby increasing opportunities for interventions to prevent progression of the disease and emergence of symptoms; and c) tertiary prevention reduces the negative impact of an already established disease by restoring function and reducing disease-related complications.

[0045] The term "condition" as used herein indicates as usually the physical status of the body of an individual (as a whole or of one or more of its parts) that does not conform to a physical status of the individual (as a whole or of one or more of its parts) that is associated with a state of complete physical, mental and possibly social well-being. Conditions herein described include but are not limited to disorders and diseases wherein the term "disorder" indicates a condition of the living individual that is associated to a functional abnormality of the body or of any of its parts, and the term "disease" indicates a condition of the living individual that impairs normal functioning of the body or of any of its parts and is typically manifested by distinguishing signs and symptoms. Exemplary conditions include but are not limited to injuries, disabilities, disorders (including mental and physical disorders), syndromes, infections, deviant behaviours of the individual and atypical variations of structure and functions of the body of an individual or parts thereof.

[0046] The wording "associated to" as used herein with reference to two items indicates a relation between the two items such that the occurrence of a first item is accompanied by the occurrence of the second item, which includes but is not limited to a cause-effect relation and sign/symptoms-disease relation.

[0047] The term "individuals" as used herein indicates a single biological organism such as higher animals and in particular vertebrates such as mammals and more particularly human beings.

[0048] Atherosclerosis is currently viewed as a chronic lipid-related and immune-mediated inflammatory disease of the arterial walls. Many immune components have been identified that participate in atherogenesis and pre-clinical studies have yielded promising results suggesting that immuno-modulatory therapies targeting these components can reduce atherosclerosis.

[0049] The term "atherosclerosis" as used herein indicates an inflammatory condition, and in particular a chronic inflammatory disease characterized by the accumulation of lipoproteins eliciting an inflammatory response in the intima of the arterial wail. The tunica intima (or just intima) is the innermost layer of an artery or vein. The intima is typically formed by one layer of endothelial cells and is supported by an internal elastic lamina. In the intima the endothelial cells are in direct contact with the blood flow. Adaptive immune responses engaging clonally expanded T cell populations contribute to this inflammatory process, as well as innate immune responses mounted by macrophages and other cells. Several lines of evidence point to components of the low density lipoprotein (LDL) particles as triggers of vascular inflammation.

[0050] The term "Low-density lipoprotein" or "LDL" as used herein indicates a type of lipoprotein that transports cholesterol and triglycerides from the liver to peripheral tissues. LDL is one of the five major groups of lipoproteins; these groups include chylomicrons, very low-density lipoprotein (VLDL), intermediate-density lipoprotein (IDL), low-density lipoprotein, and high-density lipoprotein (HDL). Like all lipoproteins, LDL enables fats and cholesterol to move within the water based solution of the blood stream. Typically a native LDL particle contains a single apolipoprotein B (apoB) molecule that circulates the fatty acids, keeping them soluble in the aqueous environment. The apoB on the LDL particle acts as a ligand for LDL receptors in various cells throughout the body. The protein occurs in the plasma in two main isoforms, ApoB48 and ApoB100. The first is synthesized exclusively by the small intestine, the second by the liver. The Apolipoprotein B-100 molecule has 4536 amino acid residues and a MW of about 514 kD. Additionally, LDL has typically a highly-hydrophohic core consisting of a polyunsaturated fatty acid known as linoleate and about 1500 esterified cholesterol molecules. This core is surrounded by a shell of phospholipids and unesterified cholesterol as well as a single copy of the ApoB100. LDL particles are approximately 22 nm in diameter and have a mass of about 3 million Daltons. Low-density lipoprotein receptors sit on the outer surface of many types of cells, where they pick up low-density lipoproteins circulating in the bloodstream and transport them into the cell. Once inside the cell, the low-density lipoprotein is broken down to release cholesterol. The cholesterol is then used by the cell, stored, or removed from the body. After low-density lipoprotein receptors drop off their cargo, they are recycled back to the cell surface to pick up more low-density lipoproteins. When LDL particles infiltrate the intima, they are prone to undergo oxidative modifications. Such changes likely include enzymatic attacks by myeloperoxidase and lipoxygenases as well as non-enzymatic oxidative reactions. As an initial result of oxidation, double-bonds of tatty acid residues in phospholipids, cholesterol esters and triglycerides are cleaved, generating reactive aldehydes and truncated lipids. Among the latter, modified phospholipids such as lysophosphatidylcholine and oxidized l-palmitoyl-2-arachidonyl-sn-glycero-3-phosphocholine (ox-PAPC) can activate endothelial cells, macrophages and BI-type B cells to initiate innate immune responses, including adhesion molecule expression, chemokine production, and secretion of natural antibodies. The protein moiety of LDL is also a target of oxidative modifications. They include formation of adducts of malondialdehyde (MDA), 4-hydroxynonenal and other molecular species on lysyl residues of apolipoprotein B-100 (ApoB 100). Antibodies are formed to MDA-lysine and other oxidatively generated epitopes of LDL particles (Ketelhuth, D. F., Tonini, G. C., Carvalho, M. D., Ramos, R. F., Boschcov, P., and Gidlund, M. (2008). Autoantibody response to chromatographic fractions from oxidised LDL in unstable angina patients and healthy controls. Scand J Immunol 68, 458-482), Such antibodies circulate in peripheral blood and can also be found in atherosclerotic lesions. In contrast to the natural antibodies to oxidized phospholipids produced by B 1 cells, anti-MDA-ApoB 100 antibodies are largely IgG molecules (Yia-Hertfuala, S., Palinski, W., Sutler, S. W., Picard, S., Steinberg, D., and Witetum, J. L. (1994). Rabbit and human atherosclerotic lesions contain IgG that recognizes epitopes of oxidized LDL. Arterfoscter Thrornb 14, 32-40.). This implies the involvement of T cell help to activate isotype switching in the B cell.

[0051] In several embodiments, the method for treating and/or preventing atherosclerosis in an individual herein described comprises. Inhibiting in the individual a CD4⁺ T cell response to ApoB100.

[0052] The term "T cells" as used herein indicates a group of white blood cells known as lymphocytes, which play a central role in cell-mediated immunity and can be distinguished from other lymphocyte types, such as B cells and natural killer cells by the presence of a special receptor on their cell surface called T cell receptors (TCR). The abbreviation T, in T cell, stands for thymus, since it is the principal organ in the development of the T cell T cells have been identified both in hyperehoiesteroiemic mice and among clones isolated from human atherosclerotic lesions, the molecular properties of the T cell epitopes are poorly understood due to the biochemical complexity of the LDL particle and the oxidative process. Antibodies are generally produced by plasma cells. which have matured from B lymphocytes in the presence of various cytokines produced by activated CD4⁺ T lymphocytes and by direct T lympbocyte-B lymphocyte interactions, CD4⁺ T lymphocytes are activated when they encounter an antigenic peptide with major histocompatibility complex class II antigen-presenting cells, such as B lymphocytes and macrophages. The recognition of major histocompatibility complex class II peptide complexes by T lymphocytes is therefore central to the development of immune responses and antibody production. The major histocompatibility complex class II molecules are highly polymorphic heterodimeric membrane glycoproteins composed of α and β chains. The function of major histocompatibility complex class II molecules is to bind short peptides derived mainly from extracellular proteins, in turn forming major histocompatibility complex class II peptide complexes that interact with appropriate T cell receptors of CD4+ T lymphocytes. At maturity, UHC molecules are anchored in the cell membrane, where they display short, polypeptides to T cells, via the T cell receptors (TCRs). All MHC molecules receive polypeptides from inside the cells they are part of and display them on the cell's exterior surface for recognition by T cells.

[0053] The term "T cell receptor or TCR" indicates a molecule found on the surface of T lymphocytes (or T cells) that is, in general, responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules. The TCR is a heterodimer consisting of an alpha and beta chain in 95% of T cells, whereas 5% of T cells have TCRs consisting of gamma and delta chains. Similar to immunoglobulins (Ig), each TCR chain is encoded by discrete gene segments that are joined by somatic recombination during development of the T cell. Functional alpha and beta chain genes are generated in the same way that complete immunoglobulin genes are created. For the α chain, a V.sub.α (TRAV) gene segment rearranges to a J.sub.α (TRAJ) gene segment to create a functional variable region exon. Transcription and splicing of the VJ.sub.α exon to C.sub.α (TRAC) generates the mRNA that is translated to yield the T-cell receptor α-chain protein. For the β chain, like the immunoglobulin heavy chain, the variable domain is encoded in three gene segments, V.sub.β (TRBV), D.sub.β (TRBD), and J.sub.β (TRBJ). Rearrangement of these gene segments generates a functional VDJ.sub.β Variable region exon that is transcribed and spliced to join to C.sub.β (TRBC) gene; the resulting mRNA is translated to yield the T-cell receptor β chain. The α and β chains pair soon after their biosynthesis to yield the α:β T-cell receptor heterodimer. Similar to immunoglobulins (Ig), this gene rearrangement process leads to diversification of the assembled genes through differences in the manner in which gene segments are joined in each cell undergoing its own unique rearrangement events.

[0054] Engagement of the TCR with antigen and MHC results in activation of its T lymphocyte through a series of biochemical events mediated by associated enzymes, co-receptors, and specialized accessory molecules. The variable domain of both the TCR α-chain and β-chain have three hypervariable or complementarity determining regions (CDRs), whereas the variable region of the β-chain has an additional area of hypervariability (HV4) that does not normally contact antigen and therefore is not considered to be a CDR. CDR3 is the main CDR responsible for recognizing processed antigen, although CDR1 of the alpha chain can also interact with the N-terminal part of the antigenic peptide, and CDR1 of the beta chain interacts with the C-terminal part of the peptide. CDR2 regions interact with the MHC molecule presenting the peptide. The signal from the T cell complex is enhanced by simultaneous binding of the MHC molecules by a specific co-receptor.

[0055] The term to "CD4⁺ T cells" as used herein indicates T cells, and in particular helper T cells and regulatory T cells, presenting a co-receptor CD4 on their surface. On helper T cells, the CD4 exclusively binds the class II MHC. The co-receptor not only ensures the specificity of the TCR for the correctly-presented antigen but also allows prolonged engagement between the antigen presenting cell and the T cell, thus enhancing the recruitment of essential molecules (e.g., Lck) inside the cell that are involved in the signaling of that activated T lymphocyte. For example, antigen binding to the T cell receptor (TCR) stimulates the secretion of IL-2 and several other cytokines, and the expression of IL-2 receptors (IL-2R).

[0056] In some embodiments, the CD4⁺ T cells are CD4⁺ T cells presenting a T cell receptor, wherein the TCR α-chain is encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, TRAV 12 or TRAV 14. Accordingly, in these embodiments, the T cell receptors are referred to as TCR alpha variable TRAV 4 (TCR TRAV 4), TCR alpha variable TRAV 12 (TCR TRAV 12), and TCR alpha variable TRAV 14 (TCR TRAV 14) respectively. The terms TRAV4, TRAV 12, and TRAV 14 are also herein used with reference to DNA sequences coding at least in part for TRAV 4, TRAV 14, TRAV 12, amino acid sequences encoded thereby, as well as portions or fragments as will be understood by a skilled person in view of the present disclosure.

[0057] In other embodiments, the CD4⁺ T cells are CD4⁺ T cells presenting a T cell receptor, wherein the TCR α-chain is encoded, at least partially, by a DNA sequences highly homologous to that of gene TRAV 4, TRAV 12 or TRAV 14.

[0058] In some embodiments, the CD4⁺ T cell is CD4⁺ T cell presenting a T cell receptor. Wherein the TCR β-chain is encoded, at least partially, by T cell receptor beta variable gene TRBV 30 or 31. Accordingly, in these embodiments, the T cell receptors are referred to as TCR beta variable TRBV 30 (TCR TRBV 30) and TCR beta variable TRBV 31 (TCR TRBV 31), respectively The terms TRBV 30, and TRBV 31 are also herein used with reference to DNA sequences coding at least in part for TRBV 30, and TRBV 30, amino acid sequences encoded thereby, as well as portions or fragments as will be understood by a skilled person in view of the present disclosure.

[0059] In other embodiments, the CD4⁺ T cells are CD4⁺ T cells presenting a T cell receptor, wherein the TCR α-chain is encoded, at least partially, by a DNA sequence highly homologous to that of TRBV 30 or TRBV31.

[0060] In some embodiments, the CD4⁺ T cell are CD4⁺ T cell presenting a T cell receptor, wherein the TCR α-chain is encoded, at least partially, by gene TRAV 4, 12 or 14 or a DNA sequences highly homologous to that of TRAV 4, TRAV 12 or TRAV 14, meanwhile, the TCR β-chain is encoded, at least partially, by gene TRBV 30 or 31 or a DNA sequence highly homologous to that of TRBV 30 or TRBV31.

[0061] The term "present" as used herein with reference to a compound or functional group indicates attachment performed to maintain the chemical and/or biological reactivity of the compound or functional group as attached- Accordingly, protein presented on a cell is able to perform under the appropriate conditions the one or more chemical and/or biological reactions that chemically and/or biologically characterize the protein.

[0062] The term "homologous" or "homology" as used herein with reference to nucleic acid or protein sequences is defined in terms of shared ancestry of the sequences. For example, two DNA sequence can have shared ancestry because of either a spectation event (orthologs) or a duplication event (paralogs). Homologous sequences as used herein are also biologically functional equivalents, with particular reference to the immunogenic properties of the reference sequence as will be understood by a skilled person. Homology among protein or DNA sequences can also be identified on the basis of sequence similarity. The terms "homology" and "similarity" and "identity" are often used interchangeably with reference to sequences,

[0063] Homologous sequences can be orthologous or paralogs depending on the similarities with respect to a reference sequence. Orthologs or orthologous sequences are sequences that can be identified by a vertical descent from a single common ancestor sequence. Paralogous sequences are sequences that can be identified as separated following a duplication event of a common ancestor.

[0064] Accordingly, the wording of a T cell receptor encoded by a "DNA sequence highly homologous" to an indicated first gene as used herein refers to a T cell receptor encoded by a DNA sequence of a second gene orthologous to the first gene, which can be identifiable by one skilled in the art.

[0065] In several embodiments, various database and other resources identifiable by one skilled in the art, including but not limited to the TreeFam (Tree families database, www.treefam.org), can be used to identify orthologs and paralogs of a reference sequences and, possibly, evolutionary history of gene families. For example, as defined in TreeFam at the time of filing of the present disclosure human orthologs of TRBV 31 gene is TRBV 30.

[0066] In several embodiments, homologs of the T cell receptors, fragments and portions herein described can be encoded by DNA sequences highly similar to an original encoding gene-sequence, as long as the original gene sequence is modified such that functional equivalent codons are formed to encode a same protein sequence. The term "functional equivalent codons", as well understood in the art, refer to groups of genetic condons that code for same amino acids (see the Codon Table below).

TABLE-US-00001 Codon Table Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA GAG Phenylananine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU

[0067] Several embodiments of the present disclosure relate, at least in past, to the results indicating that a CD4⁺ T cell response to ApoB100 contributes development of atherosclerosis and related conditions in an individual (see Examples 1-5 and 10).

[0068] Accordingly, in some embodiments, a method and system to treat and/or prevent atherosclerosis in an individual is described. The method comprises: inhibiting in the individual a CD4⁺ T cell response to Apo-B100, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said response.

[0069] In some embodiments, the compound inhibiting the CD4⁺ T cell response to ApoB100 can be a compound identified by its capacity to prevent activation of the hybridoma clone 48-5 upon exposure to ApoB100 or a fragment thereof. The hybridoma clone 48-5 has been deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftensirasse 7 B, 38124 Braunschweig, Germany, on Jan. 22, 2009 with the accession number DSM ACC2988 capacity to prevent activation of 48-5 upon exposure to ApoB100 or a fragment thereof.

[0070] In some embodiments, inhibiting the CD4⁺ T cell response to ApoB100 is performed by inhibiting one or more T cell receptors of the CD4⁺ T cell that are associated to said response. In particular, in some embodiments, inhibiting the CD4⁺ T cell response to ApoB100 is performed by inhibiting a T cell receptor comprising a TCR α-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, a TCR α-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 12, a TCR α-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 14 or a TCR α-chain encoded, at least partially, by a DNA sequence that is highly homologous to one of the genes TRAV 4, 12 and 14.

[0071] In some embodiments, inhibiting the CD4⁺ T cell response to ApoB100 is performed by inhibiting a T cell receptor comprising a TCR β-chain encoded, at least partially, by T cell receptor beta variable gene TRBV 30, a TCR β-chain encoded, at least partially, by T cell receptor beta variable gene TRBV 31, or a TCR β-chain encoded, at least partially, by a DNA sequence that is highly homologous to one of the genes TRBV 30 and TRBV31.

[0072] In some embodiments, inhibiting the CD4⁺ T cell response to ApoB100 is performed by inhibiting the T cell receptor, comprising a TCR a-chain and a TCR B-chain. In some of those embodiments, the TCR α-chain can be encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, 12 or 14 or a DNA sequence that is highly homologous to one of the genes TRAV 4, 12 and 14. in some of those embodiments, the TCR β-chain is encoded, at least partially, by T cell receptor beta variable gene TRBV 30 or 31, or a DNA sequence that is highly homologous to one of the genes TRBV 30 and 31.

[0073] Several aspects of the present disclosure relate, at least in part, to the results indicating that a ApoB100 responding CD4⁺ T cells express TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 31 (TCR TRBV 31) (see Examples 1.6).

[0074] In particular, in some embodiments a method to treat and/or prevent atherosclerosis in an individual comprises: inhibiting in the individual, one or more T cell receptor that is associated to the CD4⁺ T cell response to ApoB100, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said receptor,

[0075] In some embodiments, treatment and/or prevention of atherosclerosis and/or a condition associated thereto in an individual can be performed by administering a therapeutically effective amount of a compound inhibiting the binding of one or more T cell receptors to molecules composing apolipoprotein B-100 or fragments thereof. In particular, the T cell receptor comprises an alpha variable region and/or a beta variable region.

[0076] In some embodiments, the binding of one or more T cell receptor to molecules comprising apolipoprotein B-100 or fragments thereof is inhibited. In particular, in some embodiments, the one or more T cell receptor comprises an α-chain which is, at least partially, encoded by gene TRAV 4, TRAV 12 or TRAV 14 or a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14. In some embodiments, the one or more T cell receptor comprises a β-chain, which is, at least partially, encoded by gene TRBV 30 or TRBV 31 or by a DNA sequence highly homologous to TRBV31 or TRBV30. In some embodiments, the one or more T cell receptor comprises an α-chain which is, at least partially, encoded by the gene TRAV 4, TRAV 12 or TRAV 14 or a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14, and further comprises a β-chain, which is, at least partially, encoded by the gene TRBV 30 or TRBV 31 or a DNA sequence highly homologous to TRBV30 or TRBV31.

[0077] Several aspects of the present disclosure relate, at least in part, to the results indicating that depletion of CD4⁺ T cells presenting TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 31 (TCR TRBV 31), or inactivation of the TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 31 (TCR TRBV 31), protect against atherosclerosis (see Examples 7-9).

[0078] Accordingly, in some embodiments a method to treat and/or prevent atherosclerosis in an individual comprises: immunizing the individual against one or more T cell receptor that is associated to C4⁺ T cell response to ApoB100, in particular by administering to the individual the T cell receptor, or an immunogenic fragment thereof or a derivative thereof,

[0079] Antigen-specific immunomodulation by vaccination is an attractive approach to prevent or treat chronic inflammatory diseases. By mobilizing protective immune responses in an antigen-specific manner, side effects due to hampered host defense against infections are avoided. Therefore, antigen-specific suppression of pathologic autoimmunity is of interest in chronic inflammatory diseases such as atherosclerosis.

[0080] Antigen-specific immunoprotection can be achieved through several different mechanisms, such as production of protective antibodies, deletion or inactivation (energy) of pathogenic T cell clones, or induction of suppressive cellular immunity mediated by the family of regulatory T cells (Treg).

[0081] In some embodiments, immunization can be performed by immunogenic agent, (able to block antigen recognition by the T cell receptors, and/or serve as immunogens to block antigen recognition by the T cell receptors or other antibodies), which is specific for the target T cell receptor

[0082] In particular, in some embodiments, immunization can be performed by administering to the individual one or more fragments from the TCRα and/or TCRβ variable region, an immunogenic portion thereof, and/or a derivative thereof. In particular, in some embodiments, the one or more peptides from the TCRα and/or TCRβ variable region can be encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31 or a DNA sequence highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30, or TRBV 31. More particularly, in some embodiments, immunization can be performed by administering a fragment of the TCR TRBV 31, which includes part of the CDR2 variable region of the β chain of the TCR (amino acid residues 45-62, ATGGTLQQLFYSITVGQV--SEQ ID NO: 1) herein also indicated as TRBV 31 peptide.

[0083] In some embodiments, immunization can be performed by administering a fragment of the TCR V alpha 4, which includes an immunogenic portion of the variable region of the α chain of the TCR (peptide sequence SEQ ID NO: 63) herein also indicated as TRAV 4 peptide.

[0084] In some embodiments, immunization can be performed by administering a fragment of the TCR V alpha 12, which includes an immunogenic portion of the variable region of the α chain of the TCR (peptide sequence SEQ ID NO: 88) herein also indicated as TRAV 12 peptide.

[0085] In some embodiments, immunization can be performed by administering a fragment of the TCR V alpha 14, which includes an immunogenic portion of the variable region of the α chain of the TCR (peptide sequence SEQ ID NO: 89) herein also indicated as TRAV 14 peptide.

[0086] In some embodiments, immunization can be performed by administering to the individual multiple T cell receptor immunogenic fragments described above in combination.

[0087] The term "protein" or "polypeptide" as used herein indicates an organic polymer composed of two or more amino acid monomers and/or analogs thereof. The term "polypeptide" includes amino acid polymers of any length including full length proteins and peptides, as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called an oligopeptide. As used herein the term "amino acid", "amino acidic monomer", or "amino acid residue" refers to any of the twenty naturally occurring amino acids including synthetic amino acids with unnatural side chains and including both D and L optical isomers The term "amino acid analog" refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, isotope, or with a different functional group but is otherwise identical to its natural amino acid analog.

[0088] The term "fragment" as used herein indicates a portion of a polypeptide of any length. An immunogenic fragment of a T cell receptor, such as TCR TRAV 4 is accordingly a portion of TCR TRAV 4 that presents immunogenic properties, such as eliciting an immune response in an individual immunogenic fragments of the T cell receptors herein described also include any peptides however synthesized and possible derivatives thereof, immunogenicity of a peptide can be defined by the capability of the peptide to induce an immune response, including but not limited to humoral and cell-mediated immune responses. Immunogenicity, sometimes also known as the antigenicity, of a peptide can be also reflected by the ability of the peptide to combine specifically with the final products of the immune response (such as secreted antibodies and/or T cell receptors).

[0089] Various in vivo and in vitro techniques and methods for identifying immunogenic fragments and/or active parts/epitopes of a peptide are well known in the art. For example, immunogenicity of a peptide can be tested by examining whether the peptide induces antibody secretion in an specific antibody-producing cell line, such as B-cells or a hybrid cell line (hybridomas) generated by fusing a specific antibody-producing B cell with a myeloma (B cell cancer) cell.

[0090] Immunogenicity of a peptide can be tested by examining whether the peptide binds to a specific antibody through an affinity binding assay, such as an enzyme-linked immunosorbent assay (ELISA) or immunoprecipitation assay.

[0091] In addition, computer-based algorithms, such as Tepitope (Radhzzani et al 2000), Adept (Maksuytov et al 1993), antigenic index (Jameson et al 1988) and others can be used to identify the epitopes and/or immunologically active site of a peptide once the related sequence is known. More details on these in vitro methods can be found in the following publications: Chou P Y, Fasman G O, Adv Enzymol Relat Areas Mol Biol. 1978; 47; 45-148, Prediction of the secondary structure of proteins from their amino acid sequence; Margalit H, Spouge J L, Cornette J L, Cease K B, Delisi C, Berzofsky J A, J., Immunol. 1987 Apr. 1; 138(7):2213-20. Prediction of immunodominant helper T cell antigenic sites from the primary sequence; Jameson B A, Wolf H., Division of Biology, California institute of Technology, Pasadena, Calif. 91125, Comput Appl Biosci. 1988 March; 4(1); 181-6. The antigenic index; a novel algorithm for predicting antigenic determinants; Reyes V E, Lew R A, Lu S., Humphreys R E, Methods Enzymol. 1991; 202:22538. Prediction of alpha helices and T cell-presented sequences in proteins with algorithms based on strip-of-helix hydrophobicity index (SOHHI); Maksyutov A Z, Zagrebelnaya E S, Comput Appl BioscL 1093 June; 9(3): 291-7. ADEPT; a computer program for prediction of protein antigenic determinants; Pellequer J L, Wesfhof J Mol Graph. 1093 September; 11(3); 204-10, 1912, PREDITOP: a program for antigenicity prediction; Lu et al., Tibtech, vol. 9, July, 1991 pp. 238-242 Common Principles in Protein Folding and Antigen Protection; and Laura Raddrizzani and Juergen Hammer briefings in bioinformatics. vol I, no 2. 179-189. May 2000 Epitope scanning using virtual Matrix-based algorithms, the disclosure of each of which is incorporated by reference in its entirety.

[0092] In some embodiments, a T cell receptor as described herein can comprise more than one immunogenic fragments suitable for using in connection with the present method and system, including antigenic fragments from both of the TCR α and β variable regions. Particularly, in some embodiments, the immunogenic fragments of the T cell receptors are encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31 and/or highly homologous DNA sequences thereof.

[0093] The term "derivative" as used herein with reference to a first polypeptide (e.g., TCR TRAV 4 antigenic fragment), indicates a second polypeptide that is structurally related to the first polypeptide and is derivable from the first polypeptide by a modification that introduces a feature that is not present in the first polypeptide, while retaining functional properties of the first polypeptide. Accordingly, a derivative polypeptide of an antigenic fragment of TCR TRAV 4 (or other types of T cell receptors herein described) usually differs from the original polypeptide or portion thereof by modification of the amino acidic sequence that might, or might not be associated with an additional function not present in the original polypeptide or portion thereof. A derivative polypeptide of an immunogenic fragment of T cell receptors retains however immunogenic properties comparable to the ones described in connection with the T cell receptors or the immunogenic fragment thereof.

[0094] Amino acid sequence derivatives of the proteins, polypeptides and peptides of the present invention can be substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein that are not essential for function or immunogenic activity. Another common type of deletion variant is one tacking secretory signal sequences or signal sequences directing a protein to bind to a particular part of a cell. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide. This can include the insertion of an immunoreactive epitope or simply a single residue. Terminal additions, called fusion proteins, are discussed below.

[0095] Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and can be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties. Substitutions of this kind preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline: histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.

[0096] The term "biologically functional equivalent" is understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%; or more preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of amino acids that are identical or functionally equivalent to the amino acids of the peptide mlmetlcs provided the biological activity of the mimetic is maintained.

[0097] The following is an exemplary approach illustrating changing of the amino acids of a protein to create an equivalent, which possible comprise an improved, second-generation molecule. For example, certain amino acids can be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-antibody recognition sites of antibodies or T cell receptors, or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes can be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below.

[0098] In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyle & Doolittle, A simple method for displaying the hydropathic character of a protein J Mol Biol. 1982 May 5; 157(1):105-32). If is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[0099] It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity, U.S. Pat. No. 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As known in the art, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0): lysine (+3.0); aspartate (+3.0±1); glutamine (+3.0±1); seline (+0.3); asparagine (+0.2), glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0100] It is understood that an amino acid can be substituted for another having similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

[0101] As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that fake into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

[0102] In further embodiment, a T cell receptor associated to CD4⁺ T cell response to ApoB100, or an immunogenic fragment thereof or a derivative thereof are described.

[0103] In some embodiments, the T cell receptors herein described and/or fragments and/or derivative thereof can be used to identify agents, (e.g. a set of polypeptides or proteins) that are able to block antigen recognition by the T cell receptors, and/or serve as immunogens to block antigen recognition by the T cell receptors or other antibodies.

[0104] In some embodiments, the T cell receptors herein described and/or fragments and/or derivative thereof are described for use as a medicament, and in particular for use in the treatment of atherosclerosis.

[0105] More particularly, in some embodiments, the T cell receptors comprise an α chain encoded, at least partially, by gene TRAV 4, TRAV 12, TRAV 14 or by a DNA sequence highly homologous for TRAV 4, TRAV 12, TRAV 14. In some embodiments, the T cell receptors comprise a beta chain encoded, at least partially, by the gene TRBV 30, TRBV 31 or by a DNA sequence highly homologous to TRBV30 or TRBV31. In some embodiments, the T cell receptors comprise an α chain encoded, at least partially, by the gene TRAV 4, α chain encoded, at least partially, by TRAV 12, α chain encoded, at least partially, by TRAV 14 or a DNA sequence highly homologous, to TRAV 4, TRAV 12, TRAV 14 and further comprises a beta chain encoded, at least partially, by the gene TRBV 30, a beta chain encoded, at least partially, by the gene TRBV 31 or a beta chain encoded, at least partially, by a DNA sequence highly homologous to TRBV 30 or TRBV 31.

[0106] In some embodiments, the fragments of the T cell receptor are encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31 and/or by a DNA sequence highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30 or TRBV 31.

[0107] According to the sixth and seventh aspects of the present disclosure, an antibody reactive to a T cell receptor associated to CD4⁺ T cell response to ApoB100, or a fragment thereof, or a derivative thereof is described.

[0108] In some embodiments, antibody reactive to a T cell receptor associated to CD4⁺T cell response to ApoB100 herein described, or a fragment thereof, or a derivative thereof, is described for use as a medicament, and in particular for use in the treatment of atherosclerosis.

[0109] The term "antibody" as used herein refers to a protein of the kind that is produced by activated B cells after stimulation by an antigen and can bind specifically to the antigen promoting an immune response in biological systems. Full antibodies typically consist of four subunits including two heavy chains and two light chains The term antibody includes natural and synthetic antibodies, including but not limited to monoclonal antibodies, polyclonal antibodies or fragments thereof. Exemplary antibodies include IgA, IgD. IgG1, IgG2, IgG3, IgM and the like. Exemplary fragments include Fab PV, Fab' F(ab')2 and the like. A monoclonal antibody is an antibody that specifically binds to and is thereby defined as complementary to a single particular spatial and polar organization of another biomolecule which is termed an "epitope". In some forms, monoclonal antibodies can also have the same structure. A polyclonal antibody refers to a mixture of different monoclonal antibodies. In some forms, polyclonal antibodies can be a mixture of monoclonal antibodies where at least two of the monoclonal antibodies binding to a different antigenic epitope. The different antigenic epitopes can be on the same target, different targets, or a combination. Antibodies can be prepared by techniques that are well known in the art such as, immunization of a host and collection of sera (polyclonal) or by preparing continuous hybridoma cell lines and collecting the secreted protein (monoclonal).

[0110] In some embodiments, proteins (including antibodies), peptides and/or agents for inhibiting T cells response herein described are comprised in a composition together with suitable adjuvant and/or excipients.

[0111] The term adjuvant as used herein indicates a pharmacological or immunological agent that modify the effect of other agents (e.g., drugs, vaccines) while having few if any direct effects when given by themselves. They are often included in vaccines to enhance the recipient's immune response to a supplied antigen while keeping the injected foreign material at a minimum. Types of adjuvants include: Immunologic adjuvant that stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect in itself.

[0112] The term excipients as used herein indicates an inactive substance used as a carrier for the active ingredients of a medication. Exemplary excipients can also be used to bulk up formulations that contain very potent active ingredients, to allow for convenient and accurate dosage. In addition to their use in the single-dosage quantify, excipients can be used in the manufacturing process to aid in the handling of the active substance concerned. Depending on the route of administration, and form of medication, different excipients can be used that are identifiable by a skilled person.

[0113] In some embodiments, the compositions comprises selected (immunogenic) peptide fragments of T cell receptors and possibly toxins/toxoids: tetanus toxin, diphtheria toxoid, B subunit of cholera toxin, as well as BSA, HAS, rHSA, KLH, ovalbumin. Particularly, in some embodiments, the selected peptide fragments of the T cell receptors are encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31 or a DNA highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31.

[0114] In some embodiments, the adjuvants and excipients are pharmaceutically acceptable and the resulting composition is a pharmaceutical composition. In some of those embodiments, the pharmaceutical composition is a vaccine.

[0115] As disclosed herein, agents for inhibiting the CD4⁺ T cell response to ApoB100 and/or binding of the TCR receptor herein described with ApoB100, can be provided as a part of systems to treat and/or prevent. The systems can be provided in the form of arrays or kits of parts.

[0116] In a kit of parts, the agents and other reagents to perform an assay to defect the inhibiting and/or immunizing can be comprised in the kit independently. The agents can be included in one or more compositions, and each agent can be in a composition together with a suitable vehicle.

[0117] The terms "detect" or "detection" as used herein indicates the determination of the existence, presence or fact of a target in a limited portion of space, including but not limited to a sample, a reaction mixture, a molecular complex and a substrate. The "detect" or "detection" as used herein can comprise determination of chemical and/or biological properties of the target, including but not limited to ability to interact, and in particular bind, other compounds, ability to activate another compound and additional properties identifiable by a skilled person upon reading of the present disclosure. The detection can be quantitative or qualitative. A detection is "quantitative" when it refers, relates to, or involves the measurement of quantity or amount of the target or signal (also referred as quantitation), which includes hut is not limited to any analysis designed to determine the amounts or proportions of the target or signal. A detection is "qualitative" when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified.

[0118] Additional components can include labeled molecules and in particular, labeled polynucleotides, labeled antibodies, labels, microfluidic chip, reference standards, and additional components identifiable by a skilled person upon reading of the present disclosure. The terms "label" and "labeled molecule" as used herein as a component of a complex or molecule referring to a molecule capable of detection, including but not limited to radioactive isotopes, fluorophores, chemiluminescent dyes, chromophores, enzymes, enzymes substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, nanoparticles, metal sols, ligands (such as biotin, avidin, streptavidin or haptens) and the like. The term "fluorophore" refers to a substance or a portion thereof which is capable of exhibiting fluorescence in a detectable image. As a consequence, the wording "labeling signal" as used herein indicates the signal emitted from the label that allows detection of the label, including but not limited to radioactivity, fluorescence, chemiluminescence, production of a compound in outcome of an enzymatic reaction and the like.

[0119] In some embodiments, detection of the inhibiting and/or immunizing can be carried either via fluorescent based readouts, in which the labeled antibody is labeled with fluorophore, which includes, but not exhaustively, small molecular dyes, protein chromophores, quantum dots, and gold nanoparticles. Additional techniques are identifiable by a skilled person upon reading of the present disclosure and will not be further discussed in detail.

[0120] In particular, the components of the kit can be provided, with suitable instructions and other necessary reagents, in order to perform the methods here described. The kit will normally contain the compositions in separate containers, instructions, for example written or audio instructions, on paper or electronic support such as tapes or CD-ROMs, for carrying out the assay, will usually be included in the kit. The kit can also contain, depending on the particular method used, other packaged reagents and materials (i.e. wash buffers and the like).

[0121] In particular, in some embodiments, disclosed are pharmaceutical compositions which contain at least one agent as herein described, in combination with one or more compatible and pharmaceutically acceptable vehicles, and in particular with pharmaceutically acceptable diluents or excipients. In those pharmaceutical compositions the agent can be administered as an active ingredient for treatment or prevention of a condition in an individual.

[0122] In some embodiments, use of a hybridoma from mice immunized with oxLDL and carrying human ApoB100 as a transgene (huB100t9) is described to identify suitable agents for inhibition of CD4+ T cell response to ApoB100. In particular, the hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on Jan. 22, 2009 with the accession number DSM ACC2988 and related uses and systems.

[0123] Further details concerning the implementation of the hybridomas, agents, compositions, methods herein described including systems for performance of the methods which can be in the form of kit of parts as well as related compositions including agents and other reagents together with suitable earner, agent or auxiliary agent of the compositions, and generally manufacturing and packaging of the kit, can be identified by the person skilled in the art upon reading of the present disclosure.

EXAMPLES

[0124] The methods and systems herein described are further illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting.

[0125] In particular, the following examples illustrate exemplary methods and systems are based on the inhibition of CD4⁺ T cell response to ApoB100 by immunization performed with a specific peptide from TCR TRVB31. A person skilled in the art will appreciate the applicability of the features described in detail for immunization performed with a different peptide from TCR TRVB31 or for other methods and systems for inhibiting CD4⁺ T cell response to ApoB100 and in particular CD4⁺ T cell presenting TCR TRVB31 according to the present disclosure.

[0126] In the following examples values are expressed as mean±standard error of the mean (SEM) unless otherwise indicated. Non-parametric Mann-Whitney U test was used for pairwise comparisons. Differences between groups were considered significant with P below 0.05.

[0127] Methods and materials for performing the following examples are summarized below.

[0128] MHC restriction assay. To evaluate MHO class II restriction, we incubated 10⁵ hybridoma cells with different concentrations of ApoB100 in the presence of 4×10⁵ irradiated (1.6 Gy) APCs from syngeneic (C57BL/6;I-Ab) or allogeneic (BALB/c; I-Ad) donors, in a separate experiment, 10⁵ hybridoma cells were incubated with ApoB100 in the presence of 4×105 irradiated (1.6 Gy) ARC from syngeneic donors in the presence or absence of blocking antibodies to MHC class II (BD). In both experiments, T cell activation was defined by increases in IL-2 concentration in the supernatant.

[0129] Lipoprotein preparations. LDL (d=1.019-1.063 g/ml) was isolated by ultracentrifugation from pooled plasma of healthy donors, as previously described (Havel et al., 1955). 2 mM benzamidine, 0.5 mM PMSF, and 0.1 U/ml aprofinin were added immediately after the plasma was prepared. After isolation, LDL was dialyzed extensively against PBS. 1 mM EDTA was added to an aliquot of LDL to generate unmodified LDL. Using the same procedure, recombinant LDL was prepared from plasma of huB100tg×L dlr-/- mice. Highly oxidized LDL was obtained by incubating 1 ml of LDL (1 mg/ml protein content, determined by Bradford assay' Bio-Rad Laboratories) in the presence of 20 μM CuSO₄ for 18 h at 37° C.; different degrees of oxidation were obtained by incubating LDL with 20 μM CuSO₄ for 1, 2, 4, or 8 h. The extent of oxidation was evaluated by TBARS, as previously described (Puhl et al., 1994).

[0130] Preparation of soluble ApoB100. ApoB100 was isolated by using a modification of previously described methods (Steele and Reynolds, 1979; Wessei and Ragge, 1984). In brief, 0.4 ml methanol. 0.1 ml chloroform, and 0.3 ml wafer were added to 0.1 ml of LDL (1 mg/ml); the suspension was then vortexed and centrifuged at 9,000 g for 1 min. The upper phase was removed and 0.3 ml of methanol added to the lower phase and interphase with precipitated protein, which was mixed again and cenfrifuged at 9,000 g for 2 min to pellet the protein. To obtain soluble and pure ApoB100, the protein pellet was resuspended in a minimum volume of 10% SDS (Bio-Rad Laboratories) until it solubilized. These preparations first were filtered on a PD-to column (GE Healthcare) to remove excess SDS. They were then purified on a Superdex-200 size-exclusion column (0.5 ml/min, in Tris-HCl, pH 7.4). ApoB100 preparations were greater than 90% pure, as evaluated in a second injection into a Superdex-200 column (GE Healthcare) and analyzed on SOS-PAGE. Finally, protein concentration was determined by Bradford assay (Bio-Rad Laboratories).

[0131] Flow cytometric analysis of TCR V domain expression: Commercially available anti-mouse TCR-Vα and TCR-Vβ mAb (BD) were used to detect TCR-Vα and TCR-Vβ. They were combined with anti-CD3-Pacific Blue and anti-CD4-APC to stain T cell hybridomas. Splenocytes from unimmunized mice were used as positive controls for all antibodies. The cells were analyzed on a CyAn ADP flow cytometer (Dako).

[0132] In vitro proliferation assay. Splenocytes from immunized mice were isolated and resuspended. In 96-well plates, 5×10⁵ splenocytes were incubated in duplicate with different antigens, as described in the figure legends, in 200 μl of serum-free medium, 1:100 BD ITS+Premix (BD), 1 mg/ml BSA (Sigma-Aldrich), 10 mmol/liter Hepes (Invitrogen), 1 mmol/l Na pyruvate(Invitrogen), 1 mmol/l nonessential amino acids (Sigma-Aldrich), and 50 μg/ml gentamycin sulfate (Sigma-Aldrich) for 72 h, at 37+ C. in a humid 5% CO₂ atmosphere. One microcurie [3H]thymidine (Sigma-Aldrich) was added after 80 h and DNA replication was measured with a scintillation counter (Wallac). Results are expressed as stimulation index=(s-c)/c, where s is the cpm of the sample with antigen and c is the cpm of the sample without antigen,

[0133] Vβ+ T Cell Depletion by fluorescence activated cell sorting. Splenocytes were isolated from huApoB100tg-Ldlr-/- mice that were immunized with 100 μg ApoB100. 30 million splenocytes were stained with anti-TRBV31 or anti-TRBV19 (BD). TRBV19 was used as a control for the sort, because none of the hybridomas that recognized ApoB100 expressed this TCR. Two clones that expressed the TRBV19/TRAV13.2 TCR (98.7 and 97.3) did not recognize LDL or ApoB100 (Table S1). After staining, the cells were sorted on a MoFlo Cytomation cell sorter (Cytomation BioInstruments) to deplete positive events. Negative cells were collected and used in the proliferation assay in response to ApoB100.

[0134] Plasma analyses. The titers of specific antibodies to TRBV31 peptide, LDL, oxLDL and ApoB100 were measured by ELISA in brief, 50 μl of the different antigens (10 μg/ml in PBS pH 7.4) was added to 96-well ELISA plates and incubated overnight at 4° C. Coated plates were washed with PBS and blocked with 1% gelatin (Invitrogen) in PBS for 1 h at room temperature. Next, plates were washed and incubated for two additional hours with mouse plasma, diluted in TBS/gelatin 0.1%. After washing, total IgG levels were measured using enzyme-conjugated anti-mouse antibodies (BD). The plates were washed, and colorimetric reactions were developed using TMB (BD). The absorbance was measured using a microplate reader (VersaMax; MDS Analytical Devices). Plasma cholesterol and triglycerides were measured using enzymatic colorimetric kits (Randox Laboratory, Ltd.) according to the manufacturer's protocol. ApoB100 levels were measured by commercial ELISA following the manufacturer's instructions (ALerCHEK, Inc.).

[0135] Lipoprotein lipid profiles. Plasma cholesterol lipoprotein profiles were determined using a modification of the method of Okazaki et al. (1981). In brief, plasma samples (50 μl) from mice immunized with TRBV31-peptide or KLH were fractionated using an HR10/30 Superose 6 column (GE Healthcare) and a Discovery BIO GPG-500 as precolumn (5 cm×7.8 i.d.; Supelco; Sigma-Aldrich) coupled to Prominence UFLC system (Shimadzu) and equilibrated with Tris-buffered saline, pH 7.4. Fractions of 200 ul were collected using Foxy Jr. fraction collector (Teledyne Isco, Inc.) and total cholesterol was determined in each fraction using enzymatic colorimetric kit (Randox Laboratory, Ltd.).

[0136] Tissue processing immunohistochemistry and lesion analysis. Blood from sacrificed mice was collected by cardiac puncture and vascular perfusion performed with sterile RNase-free PBS. Abdominal aorta, one third of the spleen, and draining LNs were dissected and snap-frozen for later RNA Isolation. Hearts and aortic arch were dissected and preserved for immunohistochemistry and lesion analysis. Lesion analysis was performed as described (Nicoletti et al., 1898). In brief, hearts were serially sectioned from the proximal 1 mm of the aortic root on a cryostat Hematoxylin- and Oil red O-stained sections were used to evaluate lesion size. Lesion size was determined by measuring 8 hematoxylin- and Oil Red O-stained sections, collected at every 100 μm over a 1 mm segment of the over a 1 mm segment of the aortic roof. For each section, images were captured with a DM-LB2 microscope (Leica) equipped with a 20×/09 objective and a DC300 camera (Leica), and the surface areas of the lesion(s) and of the entire vessel were measured. Primary antibodies to CD3, CD68, and I-Ab (all rat anti-mouse from SD) were applied to acetone-fixed cryosections followed by defection with the ABC alkaline phosphatase kit (Vector Laboratories). En face lipid accumulation was determined in the aortic arch from immunized mice using Sudan IV staining. In brief, dissected arches were fixed in 4% neutral buffered formalin. Samples were then cut longitudinally, splayed, pinned, and subjected to Sudan IV staining (red color), images were captured using a DC480 camera connected to a MZ6 stereo microscope (both from Leica). The additive area of all the plaques in a given aortic arch was calculated as a percent of the total surface area of the arch (not including branching vessels). Quantitation of plaques was performed using Image J software (NIB). Immunohistochemical data were obtained using Qwin computerized analysis (Leica) of stained sections.

[0137] RNA isolation, cDNA Synthesis, and Real-Time PCR. RNA was isolated from the indicated tissues or cells using the RNeasy kit (QIAGEN). Total RNA was analyzed on a BioAnalyzer (Agilent Technologies). Reverse transcription was performed with Superscript-II and random hexamers (both from Invitrogen) and amplified by real time-PCR using Assay-on-demand primers and probes for Ccl2, Cc15, CD3, and hypoxanthine guanidine ribonucleosyl transferase (HPRT) (Applied Biosystems) in an ABI 7700 Sequence Detector (Applied Biosystems). For the TRBV31 expression analysis, the primers used in the genotyplng (Table 2) were combined with a probe designed based on the nucleotide sequences of the constant region of TCR β chain (5'-TCCACCCAAGGTCT-3', SEQ ID NO:74). The probe was designed using ABI Primer Express software (Applied Biosystems) and it was synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached at the 5' end (Applied Biosystems). Data were analyzed on the basis of the relative expression method with the formula 2-.sup.ΔΔCT, where ΔΔCT=ΔCT (sample)-ΔCT (calibrator-mean CT values of all samples within each group), and ΔCT is the CT of the housekeeping gene (HPRT) subtracted from the CT of the target gene. For TR8V31, values of the mean±SEM of TRBV31 expression/CD3 expression are shown.

[0138] Antibody-mediated blocking of TRBV31+ Cell Responses to LDL in vitro. Total IgG plasma antibodies from KLH- or TRBV31-immunfeed mice were affinity-purified using a protein G column (GE Healthcare). 10,000 hybridoma cells (clone 48-5) were cultured with 20 μg/ml LDL in the presence of 4×10⁴ irradiated APCs. To block hybridoma activation, various antibodies were added at the beginning of culture at the concentrations indicated in the figure and were present throughout the culture. After 24 h of incubation, IL-2 was measured in the supernatant.

[0139] Statistical analysis. Values are expressed as mean±SEM unless otherwise indicated. The nonparametric Mann-Whitney U test was used for pairwise comparisons and the Kruskal-Wallis test for multiple comparisons. Correlations were calculated using the Spearman test. Differences between groups were considered significant at P values below 0.05.

Example 1

Generation and Testing of Native Human LDL ApoB100 by T Cell Hybridomas

[0140] For these experiments HuB100tg mice (mice carrying human ApoB100 as a transgene) were used to characterize the T cell response to oxLDL. These mice express human full-30 length ApoB100 in the liver as well as gut and display a humanized lipoprotein profile.

Immunization

[0141] For the generation of T cell hybridomas 7-week old male human ApoB 100 transgenic mice, huB100tg (C57BL/6. 129-Apobtm2sgy, DNX Transgenics, Princeton, USA) were used.

[0142] These mice carry the full-length human APOB gene in which codon 2153 has been changed from a leucine to a glutamine to prevent formation of ApoB48, allowing production of ApoB100 only (Boren, J., Lee, L, Zhu, W., Arnold, K., Taylor, S., and Innerarity, T. L. (1998). Identification of the low density lipoprotein receptor-binding site in apolipoprotein B100 and the modulation of its binding activity by the carboxyl terminus in familial defective apo-B100. J Clin Invest 101, 1084-1093, Linton, M. F., Farese, R V., Jr, Chiesa, G., Grass, D. S., Chin, P., Hammer, R E., Hobbs, H. H., and Young, S. G, (1993). Transgenic mice expressing high plasma concentrations of human apolipoprotein B100 and lipoprotein(a). J Clin Invest 92,3029-3037; Yao, Z. M., Blackball, B. D., Johnson, O. F., Taylor, S. M., Haubold, K. W., and McCarthy, B. J. (1992). Elimination of apolipoprotein B48 formation in rat hepatoma cell lines transfected with mutant human apolipoprotein B cDNA constructs. J Biol Chem 267,1176-1182.).

[0143] The mice were first immunized subcutaneously (s.c.) with 50 μg of copper oxidized human LDL (oxLDL) mixed with complete Freund's adjuvant (CPA) and after 2 weeks the mice were boosted with 50 μg oxLDL mixed with incomplete Freund's adjuvant (IFA). Oxidized human LDL (oxLDL) was prepared as follows; LDL (d=1.019-1.063 g/ml) was isolated by ultracenfrifugation from pooled plasma of healthy donors as described by Havel et al. (Havel, R J., Eder, H. A., and Sragdon, J. H. 1955). The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J Clin Invest 34, 1345-1353). After isolation, LDL was extensively dialyzed against PBS. 1 mM EDT A was added to an aliquot of LDL to be used as unmodified LDL. Highly oxidized LDL was obtained by incubating 1 ml of LDL (1 mg/mL protein content, determined by Bradford, Biorad, USA) in the presence of 20 μM CUS04 for 18 h, at 37° C.

T Cell Hybridoma Generation

[0144] After the primary immunization of oxLDL and the booster injection as described above lymph-node (LN) cells were collected and fused with thymoma cells to generate hybridomas as follows:

[0145] T cell hybridomas were generated by polyethylene glycol-induced fusion of 5×10⁷ lymph node cells (LN) with 3×10⁷ BW5147 thymoma cells as described by Kappler et at. (Kappler, J. W., Skidmore, B., White, J., and Marrack, P. (1981). Antigen-inducible, H-2-restricted, interleukin-2-producing T cell hybridomas Lack of independent antigen and H-2 recognition, J Exp Med 153, 1198-1214). Briefly, LN cells from the immunized mice were stimulated with 3 ng/ml oxLDL during 3 days before fusion. After fusion, 1×10⁶ thymocytes were added as feeder cells and the cell suspensions were plated in 98 well plates and incubated at 37° C., 7.5% CO₂. Hypoxanthine-aminopterin-thymidine (HAT) was added to the medium after 24 hours of incubation to select successfully fused cells. Among 268 growing hybridoma cultures, 117 were found to express CD3 and CD4. 23 HAT-resistant monoclonal hybridomas were then cloned by limiting dilution and screened for their reactivity against native LDL copper oxLDL, and purified unmodified ApoB100.

Screening for Positive Clones

[0146] The 23 HAT-resistant monoclonal hybridomas were assessed for activation by their IL-2 production (antigen binding to the T cell receptor (TCR) stimulates the secretion of IL-2) after exposure to the putative antigen (native LDL, copper oxLDL, and purified unmodified ApoB100) in the presence of syngeneic, irradiated antigen-presenting cells (APC). Such cells fake up and process antigens, leading to presentation of antigenic peptides bound to MHO molecules. Syngeneic APC, i.e. APC from mice that carry the same MHC as the T cells are needed in order to prevent activation of T cells recognizing foreign MHC molecules as antigen. T cell reactivity was determined in 98 well plate assays with 1×10⁵ T hybridoma cells and 4×10⁵ irradiated (1.6 Gy) APCs with the different antigens. LDL and oxLDL were prepared as discussed in Example 1. ApoB100 was obtained as previously described by Wessel et at. (Wessel, D., and Rugge, U.1. (1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids Anal Biochem 138, 141-143) with minor modifications Briefly, to 0.1 ml of LDL (1 mg/mL) 0.4 ml of methanol, 0.1 ml of chloroform, and 0.3 ml of wafer were added; the suspension was then mixed vigorously and cenfrifuged at 9000×g for 1 min. The upper phase was removed and 0.3 ml of methanol added to the lower phase and interphase with precipitated protein, which was again vigorously mixed and centrifuged at 9000×g for 2 min to pellet the protein, in order to obtain soluble and highly pure ApoB100, the protein pelleted was resuspended in a minimum volume of 10% SDS (Bio-Rad Laboratories, Hercules, Calif., USA) solution until complete solubilization. These ApoB100 preparations were then subjected to a first filtration using a PD-10 column (GE Healthcare, previously Amersham Biosciences, Uppsala, Sweden) to remove excess of SOS and subsequent purification using size-exciusion column Superdex-200 (0.8 mL/mL) in Tris-HCl pH 7.4). The first peak containing ApoB100 was collected and the extra peaks containing contaminant protein from the LDL purification procedure were discarded. ApoB100 preparations showed over 90% purity when evaluated in a second injection to Superdex-200 column (GE Healthcare, Uppsala, Sweden). Finally, protein concentration was determined using Bradford assay (Bio-Rad Laboratories, Hercules, Calif., USA).

[0147] APCs were prepared by meshing spleens on nylon filters (100 μm) followed by lysis of red blood cells and washing, Concavalin A (ConA) was used as a positive control. Cells were cultured for 24 hours, at 37° C., 7.5% CO2, in Dulbeceo's modified Eagle's medium (DMEM) supplemented with 5% fetal calf serum (PCS), interieukin 2 (IL-2) was measured by ELISA (R&D Systems, Abingdon, United Kingdom) in the supernatant of cultures and used as a read-out for T cell activation. The results can be seen in FIG. 1A wherein 1×10⁵ hybridoma cells of each of the twenty three HAT-resistant monoclonal hybridomas were incubated with 4×10⁵ irradiated APCs together with 40 μg/mL of LDL oxLDL, or ApoB100. Medium was used as negative control.

[0148] Remarkably, from all 23 tested monoclonal T cell hybridomas, 11 responded to native human LDL and ApoB100 but none to oxidized LDL.

TCR Genotyping by Polymerase Chain Reaction (PCR)

[0149] The eleven clones that could respond to native LDL and ApoB100 were genotyped by PCR. Total RNA was prepared from 1×10⁷ hybridoma cells from each of the 11 hybridoma clones with RNeasy mini kit (Qiagen, Valencia, Calif., USA) and reversely transcribed info cDNA using Superscript II (Invitrogen, Carlsbad, Calif., USA) with random hexanucleotide primers (pdN6) in the presence of RNasin (Lite Technologies, Cergy Pontoise, France), The cDNA produced was amplified using appropriate Vα family specific 5' primers (Table 1) together with a constant-region Cα 3' primer, or relevant Vβ, family-specific 5' primers (Table 2) together with a constant-region Cβ3, 3' primer.

TABLE-US-00002 TABLE 1 Primers for genotyping of the TRAV α-chain family Primer sequence SEQ ID NO 1 TRAV01 5' TGGATGGTTTGAAGGACAGTG 3' 2 2 TRAV02 5' CTGTTTA TCTCTGCTGACCGG 3' 3 3 TRAV03-3 5' ACGAAGGACAAGGATTCACTGT 3' 4 4 TRAV04 5' CTGGAGGACTCAGGCACTTACT 3' 5 5 TRAV06 5' GGTACCCGACTCTTTTCTGGT 3' 6 6 TRAV06D-4 5' ACCCTTTCAGAAGATGACTTCC 3' 7 7 TRAV06D-5 5' TTT AAAGTCCCAAAGGCCAA 3' 8 8 TRAV06-6 5' TCCTGAAAGTCA TTACGGCTG 3' 9 9 TRAV06-7 5' AGAGCCTCAAGGGACAAAGAG 3' 10 10 TRAV07-3 5' AGACTCCCAGCCCAGTGACT 3' 11 11 TRAV07-5 5' ACA TCAGAGAGCCGCAACC 3' 12 12 TRAV080-1 5' CCCTGCCCAGCT AA TCTT AA T 3' 13 13 TRAV09-3 5' CTGCAGCTGAGATGCAAGTATT 3' 14 14 TRAV090-1 5' TCCTATGGTGGATCCATTTACC 3' 15 15 TRAV10 5' TGGACAGAAAACAGAGCCAA 3' 16 16 TRAV11 5' CAGGCAAAGGTCTTGTGTCC 3' 17 17 TRAV12-1 5' ACGCCACTCTCCAT AAGAGCA 3' 18 18 TRAV13-1 5' GCTCTTTGCACATTTCCTCC 3' 19 19 TRAV14-1 5' TGCAGTTATGAGGACAGCACTT 3' 20 20 TRAV14-3 5' CTGCAGTTATGAGAACAGTGCTT 3' 21 21 TRAV15-1/0V6-1 5' CCAGACGATTCGGGAAAGTA 3' 22 22 TRAV16 5' TTCCATCGGACTCATCATCAC 3' 23 23 TRAV17 5' AACCTGAAGAAA TCCCCAGC 3' 24 24 TRAV19 5' GGAAGACGGAAGATTCACAGTT 3' 25 25 TRAV20 5' ACGCTCCT AA TAGACATTCGCT 3' 26 26 TRAV21 5' GTTCCTCTTCAGGGTCCAGA 3' 27 27 TRAC 5' CACCAGCAGGTTCTGGGTTC 3' 28

TABLE-US-00003 TABLE 2 Primers for genotyping of the TRBV TCR β-chain family Primer sequence SEQ ID NO 1 TRBV01 5' ACACGGGTCACTGATACGGA 3' 29 2 TRBV02 5' ATGGACAA TCAGACTGCCTCA 3' 30 3 TRBV03 5' TCACTCTGAAAA TCCAACCCA 3' 31 4 TRBV04 5' T AAACGAAACAGTTCCAAGGC 3' 32 5 TRBV05 5' ACGGTGCCCAGTCGTTTTA T 3' 33 6 TRBV12-1 5' GGATTCCTACCCAGCAGATTC 3' 34 7 TRBV12-2 5' AGA T AAAGGAAACCTGCCCAG 3' 35 8 TRBV13-1 5' CCAGAACAACGCAAGAAGACT 3' 36 9 TRBV13-2 5' GGCT ACCCCCTCTCAGACAT 3' 37 10 TRBV13-3 5' TGGCTTCCCTTTCTCAGACA 3' 38 11 TRBV14 5' GCGACACAGCCACCT ATCTC 3' 39 12 TRBV15 5' CGCAGCAAGTCTCTTATGGAA 3' 40 13 TRBV16 5' AT AGATGATTCAGGGA TGCCC 3' 41 14 TRBV17 5' TGAGAAGTTCCAA TCCAGTCG 3' 42 15 TRBV19 5' GAAGGCT ATGATGCGTCTCG 3' 43 16 TRBV20 5' TTCCCATCAGTCATCCCAAC 3' 44 17 TRBV21 5' AAAA TGCCCTGCT AAGAAACC 3' 45 18 TRBV23 5' CAGCCTGGGAA TCAGAACG 3' 46 19 TRBV24 5' GCA TCCTGGAAA TCCTATCCT 3' 47 20 TRBV26 5' AGTGTCCTTCAAACTCACCTT 3' 48 21 TRBV29 5' AAAGGATACAGGGTCTCACGG 3' 49 22 TRBV30 5' GGACAAGTTTCCAA TCAGCCG 3' 50 23 TRBV31 5' TTCATCCT AAGCACGGAGAAG 3' 51 24 TRBC1 5' TGCAA TCTCTGCTTTTGATGGCTC 3' 52

[0150] The nomenclature by the international immunogenetics information system (IMGT) was used for the designation of TCR-V chain usage of T cells. All TGR-V chain sequences were extracted from the MGT database (http://imgt.cines.frl)) (Lefranc, M. P., Pommie, C., Ruiz, M., Giudicelli, V., Foulquier, E., Truong, L, Thouvenin-Contet, V., and Lefranc, G. (2003). MGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Oev Comp Immunol 27, 55-77). For correspondence between old and new nomenclatures see http://imgt.cines.fr/textes/IMGTrepertoire/LocusGenes/#J. The mastermix for PCR reactions contained 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2. 1 mM dNTP and 0.2 U/ml Tag polymerase (Invifrogen, Carlsbad, Calif., USA). All primers were added to a final concentration of 0.2 μM. The reactions were carried out for 35 cycles using 94° C. (40 sec) for denaturation, 58° C. (40 sec) for annealing and 72° C. (1 min) for polymerization. The PCR products were analyzed on a 1.5% agarose gel and visualized by gel red staining.

[0151] Based on TCR genotyping, three different subgroups were identified from the eleven clones that could respond to native LOL and ApoB100, and representative data from each subgroup (15-2,45-1 and 43-5) are shown together with a non-responding clone 20 (97-3). As can be seen in FIGS. 1B-E there was a clear dose-response for hybridoma clones from each subgroup to the unmodified ApoB100 protein. A characterization of the hybridoma clones with regard to TCR type is given In Table 3 below.

[0152] In order to make sure that the responsiveness was not dependent on a human-specific modification of the protein, LOL and ApoB100 were also isolated from huB10ta×Ldlr.sup.-/- mice and tested against the hybridomas. These mice produce LDL containing human ApoB100. However, these particles lack posttranslational modifications that occur only in humans and that could hypothetically elicit immune reactions.

[0153] In FIGS. 1B-E 1×10⁵ hybridoma cells were incubated with 4×10⁵ irradiated APCs with different concentrations of (a) human ApoB100 purified from human LOL, and (x) transgenic human ApoB100, obtained from huB100^tg×Ldlr.sup.-/- mice, in both experiments, IL-2 secretion was used as readout of activation. From the graph it is seen that this recombinant human ApoB100 was also recognized by the T cell hybridoma subgroups 15-2,45-1 and 48-5. Therefore, native LDL and human ApoB100 contains the T cell epitope(s) recognized by these T cells.

Example 2

T Cells from Mice Immunized with LDL or oxLDL Recognize Native ApoB100

[0154] Having previously established that atherosclerotic lesions contain oligoclonal T cells and now finding that hybridomas generated from mice immunized with oxLDL can recognize native ApoB100 of LDL. It was questioned whether such autoimmune responses can occur in polyclonal T cell populations. This hypothesis was tested by immunization of huB100^tf × Ldlr.sup.-/- mice with LDL or oxLDL (highly oxidized), followed by an in vitro challenge of spleen cells from these mice with oxLDL or native ApoB100. These mice lack the LDL-receptor that is responsible for eliminating LDL from the circulation. When fed a fatty diet, they develop hypercholesterolemia and atherosclerosis. Immune responses to LDL is increased, in this disease condition, making it suitable for analysis of such responses.

[0155] Spleen cells from huB100^tg×Ldlr.sup.-/- mice immunized with LDL or oxLDL were isolated and cell suspensions prepared, in 96 well plates, 5×10⁵ spleen cells were incubated in duplicate with different antigens, as described below, in 200 μL of serum-free medium, 1:100 BD ITS+ Premix (BD Biosciences, Franklin Lakes, N.J., USA), 1 mg/ml. BSA (Sigma-Aldrich, St. Louis, Mo., USA), 10 mmol/L HEPES (Gibco Invitrogen, Carlsbad, Calif., 25 USA), 1 mmol/L Na pyruvate (Gibco Invitrogen, Carlsbad, Calif., USA), 1 mmol/L nonessential amino acids (Sigma-Aldrich, St. Louis, Mo., USA), and 50 μg/mL gentamycin sulfate (Sigma-Aldrich, St. Louis, Mo., USA) for 72 hours, at 37° C. In a humid 5% CO2 atmosphere,. Fifty microliters of H3-Thymidine (Sigma-Aldrich, St. Louis, Mo., USA, 1 μCi in serum-free medium) was added and after 18 h of incubation T cell proliferation was evaluated with a scintillation counter (Wallac, Turku, Finland),

[0156] In FIG. 2(A) 5×10⁵ spleen cells, from huB100^tg ×Ldlr.sup.-/- mice s.c. immunized with LDL or oxLDL, were challenged in vitro with 20 μg/mL of human oxLDL or native human ApoB100. Values are expressed as mean±SEM of the stimulation index obtained from the H3-Thymidine incorporation. Again, native ApoB100 gave the highest response, whereas oxLDL did not trigger activation (FIG. 2A). Furthermore, this data shows that immunization with either native LDL or oxLDL results in expansion of a T cell population that recognizes native--but not oxidized-epitopes of the LDL particle.

EXAMPLE 3

Oxidation of LDL Results in Decreased Recognition of the T Cell Epitopes

[0157] If was further analyzed the relationship between oxidation and antigenicity of LDL particles by exposing T cell hybridomas to a range of LDL particles that had been oxidized by copper for varying lengths of time, resulting in different degrees of oxidation. Highly oxidized LDL was obtained by incubating 1 mL of LDL (1 mg/mL protein content, determined by Bradford, Biorad, USA) in the presence of 20 μM CuSO4 for 18 h, at 37° C.; different degrees of oxidation were obtained by incubation of LDL with 20 μM CuSO₄ for 1, 2, 4 or 8 hours. The degree of oxidation was evaluated by TBARS as previously described (Puhl, R. Waeg, G., and Esterbauer, H. (1994). Methods to determine oxidation of low-density lipoproteins, Methods Enzymol 233, 425-441) (FIG. 28).

[0158] Spleen calls from huB100^tg×Ldlr-/- mice immunized with LDL or oxLDL were isolated and cell suspensions prepared as described in Example 2 above. 1.0×10⁵ hybridoma cells from the cell suspensions were incubated for 24 hours with 4×10⁵ irradiated APCs together with 40 μg/ml of native LDL or oxLDL that had been incubated with 20 μM CuSO₄ for 1, 2, 4, 8 or 18 hours. After 24 hours incubation IL-2 secretion was evaluated in the supernatant of cultured cells (FIG. 2C=15-2 clone; FIG. 2D=48-5 clone; FIG. 2E=45-1 clone; FIG. 2F--97-3 negative control done).

[0159] Surprisingly, there was an inverse relationship between the degree of oxidation and amplitude of activation for all of the T cell hybridomas (FIG. 2C-f). Thus, native LDL gave the highest IL-2 response, whereas heavily oxidized LDL (i.e. LDL that had been oxidized for 18 hours) did not trigger any activation at all. Effects of oxLDL on cell viability after incubations was tested and showed no significant difference between groups (data not shown). These data suggest that the T cell response to epitopes in LDL is gradually diminished upon oxidation.

[0160] It was further analyzed the relationship between oxidation and the antigenicity of LDL particles by exposing T cell hybridomas to LDL particles that were oxidized by copper for various times, resulting in a range of oxidation (FIG. 12, E-G). For all T cell hybridomas, there was an inverse relationship between the degree of oxidation and the amplitude of activation (FIG. 12, E-G, and FIG. 13A). Thus, native LDL induced the strongest IL-2 response, whereas heavily oxidized LDL did not trigger activation.

[0161] In another set of experiments, LDL was modified by MDA adduct formation. MDA is formed during lipid peroxidation and reacts with free amino groups in ApoB100 to generate MDA-lysine and other modified residues (Fogelman at at., 1980, Haberland et al., 1938, Bamberg et al., 1974).

[0162] Therefore, it can be considered as a chemically defined oxidative modification of LDL. MDA modification reduced T cell recognition of LDL proportionally to the extent of MDA exposure of the lipoprotein particles, similar to the finding for copper oxidized LDL (FIG. 13A). Of note, a dose dependent response could be detected against MBA modified LDL particles at any given concentration but its amplitude was inversely proportional to the extent of modification of the particles (FIG. 13, A and B). Similar findings were made for copper-oxidized LDL (FIG. 13B).

[0163] To exclude an antigen-independent, detrimental effect of oxLDL on T cell activation, Applicants examined its effect on T cells activated by ApoB100, native LDL, OVA, or the polyclonal T cell mitogen, Concanavalin A. The T cell hybridoma recognizing native LDL and ApoB100 was less activated when increasing concentrations of oxLDL were added to the culture, but showed unchanged activation levels when coincubated with Concanavalin A (FIG. 13C). Unchanged activation of T cells was also seen when using cells from OT-II mice that carry a transgenic TCR recognizing OVA and are therefore activated by OVA in the context of MHC class II (FIGS. 13A and C). T cell viability was unaffected by oxLDL at the concentrations that were used in this study (FIG. 14). Collectively, these data suggest that T cell recognition of LDL is gradually extinguished by LDL oxidation.

Example 4

The Cellular Immune Response to Native ApoB100 is Preserved in Polyclonal T Cell Populations

[0164] Having established that atherosclerotic lesions contain oligoclonal T cells (Paulsson et al., 2000) and observing that hybridomas from mice that are immunized with oxLDL recognize native ApoB100, if was asked whether such autoimmune responses occur in polyclonal T cell populations. This hypothesis was tested in hu100^tg×Ldlr.sup.-/- mice, which develop significant hypercholesterolemia with high plasma levels of LDL containing human ApoB100, even on a chow diet. These mice were immunized with oxLDL or native ApoB100, followed by in vitro challenge of splenocytes from these mice with oxLDL or native ApoB100 As before, native ApoB100 elicited the highest proliferative T cell response, whereas highly oxidized LDL did not trigger activation, as registered by OVA synthesis. This activation pattern was similar in oxLDL- and ApoB100-immunized mice (FIG. 15). In contrast, antibody responses were detected against oxLDL, native LDL, and ApoB100 (FIG. 15B). Consequently, T cell responses to native ApoB100 can help B cells produce antibodies to a variety of epitopes on oxidized as well as native LDL epitopes, T cell responses to native ApoB100 were not detectable in spleen cell preparations from nonimmunized mice, possibly because of limited sensitivity of the assay, thus expansion of autoreactive T cell clones by immunization with ApoB100 was necessary to detect a response (FIG. 18) Similar to the findings in huB100^tg×Ldlr.sup.-/- mice, immunization of Apoe-/- mice with native murine LDL elicited a T cell response to the native LDL particles, indicating that such responses were not limited to the huB100^tg model.

Example 5

T Cell Responses to Native LDL and ApoB100 Depend on Specific MHO Class II Molecules

[0165] Since purified ApoB100 was able to induce activation of the CD4+ T cell hybridomas obtained from the immunized mice, it was hypothesized that the epitopes would be peptides presented by the MHC class II complex; in the case of the present mice, the 1-A^b haplotype. For evaluation of MHC class II restriction, 1×10⁵ hybridoma cells were incubated with 4×10⁵ irradiated APCs, taken from mice that are either syngeneic donors (C57BU6; I-A^b) I.e. I-A^b haplogypes, or from mice of a different genotype (BALB/c; I-A^d), 5 i.e. I-A^d haplotypes, together with different concentrations of human ApoB100. In parallel, hybridoma cells were challenged with ApoB100 in the presence of irradiated APCs of the I-A^b haplotype, together with anti-MHC class II blocking antibody. After 24 hours incubation IL-2 secretion was evaluated in the supernatant of cultured cells. A=15-2 clone; B=48-5 clone; C=45-1 clone; D=97-3 negative control clone.

[0166] It can be seen in FIG. 3 that when a blocking antibody against mouse 1-A^b was added, there was a clear suppression of T cell activation for all clones. Mismatched IA^d expressing APCs from BALB/c mice could not present ApoB100 to antigen-specific T cell hybridomas. Therefore, recognition of ApoB100 protein by antigen specific T cells requires that antigenic protein components are presented by syngeneic MHC class II molecules.

[0167] To test if lipid antigens bound to or possibly co-purified with ApoB100 were involved, T cell responses to ApoB100 presented by APCs carrying I-A^b but lacking CDId, an MHC-like molecule that presents lipid antigens to T cells, were assessed. However, lack of CDId on APCs did not impair the T cell response (FIG. 4). Similarly, APCs from I-A^b mice lacking MHC class I molecules were able to present ApoB100 antigens to I cell hybridomas (FIG. 4). These results'show that ApoB 100 antigen is recognized by MHC class II restricted CD4+ T cells. Together, the experiments described in this example indicate that cellular immune responses to ApoB100 are mounted by T cells of the CD4+ type and require antigen presentation involving MHC class II molecules on APC carrying the same MHC type as the responding T cells. Such a scenario is characteristic of classical presentation to T cells of peptide antigens taken up from the extracellular space.

Example 6

T Cells Reactive to Native LDL and ApoB100 Express TRBV31

[0168] The TCR of T cell hybridomas were characterized on the mRNA level using RT-PCR amplification of rearranged variable domains. RNA isolation and cDNA synthesis was performed as mentioned in Example 1

[0169] The cDNA produced was amplified using appropriate Vβ family-specific 5' primers (Table 2) together with a constant-region Cβ 3' primer, or relevant Vα family-specific 5' primers (Table 1) together with a constant-region Cα 3' primer. The design of ail primers was based on previously published sequences (Lefranc, M. P., Pomrnie, C., Ruiz, M., Giudicelli, V., Foulquler. E., Truong, L., Thouvenin-Contet V., and Lefranc, G. (2003). IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol 27, 55-77). The mastermix for PCR reactions contained 10 mM Tris-HCl, 50 mM KCl, 1.5 my MgC1₂, 1 mM dNTP and 0.2 U/ml Taq polymerase (Invitrogen). All primers were added to a final concentration of 0.2 μM. The reactions were carried out for 35 cycles using 94° C. (40 seconds) for denaturation, 56° C. (40 seconds) for annealing and 72° C. (1 minute) for polymerization. The PCR products were analyzed on a 1.5% agarose gel and visualized by ethidium bromide staining.

[0170] Real time-PCR was carried out using assay-on-demand primers and probes for CD3 and hypoxanthine guanidine ribonucleosyl transferase (HPRT) (Applied Biosystems, Foster City, Calif., USA) in an ABI 7700 Sequence Detector (Applied Biosystems, Foster City, Calif., USA).

[0171] For quantitative TRBV31 expression analysis, genotyping primers were used in combination with a probe that was designed based on the nucleotide sequences of the constant region of TCR β chain (5'-TCCACCCAAGGTCT-3'-SEQ ID NO:53). The probe was designed using ABI Primer Express software (Applied Biosysfems. Foster City, Calif., USA) and it was synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached at the 5' end (Applied Biosystems, Foster City, Calif., USA). Data was analyzed on the basis of the relative expression method with the formula 2-ΔΔCT, where ΔΔCT=ΔCT (sample)-ΔCT (calibrator=average CT values of ail samples within each group), and ΔCT is the CT of the housekeeping gene (HPRT) subtracted from the CT of the target gene (Giulietti, A, Overbergh, L, Valckx, D., Decallonne, B., Bouillon, R., and Mathieu, C. (2001). An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods (San Diego, Calif. 25, 386-401). The results are summarized in Table 3.

TABLE-US-00004 TABLE 3 Flow cytometry Anti- Anti- Anti- Resulting PCR TRAV14 TRAV12 TRAV31 phenotype 15-2 TRAV14, 3 TRAV31 and Negative -- Positive TRAV3/ and 20 12.1 TRBV31 45-1 TRAV4 TRAV31 -- -- Positive TRAV4/ and 20 and 12.1 TRBV31 48-5 TRAV12, TRAV31 -- Negative Positive TRAV13/ 13 and 20 and 12.1 TRBV31

[0172] The fusion-partner thymoma BW5147 used to generate the hybridoma cells (see Example 1) expressed the rearranged TRAV20 and TRBVI2.1 variable chains and all hybrid om as were also expressing these chains at the mRNA level (Tables 1, 2 and 3 and FIG. 5). All T cell hybridomas specific for native human LDL and ApoB100 uniformly expressed the TCR TRBV31 (T cells carrying the T cell receptor beta variable 3-1)and no other Vβ family was identified among them, in contrast, the usage of Vα chains among the reactive hybridomas included different families; TRAV3, 4 and 13 for 15-2, 45-1 and 48-5 respectively (Table 3). For the non-reactive hybridomas, Vβ as well as Vα TCR variable chains were expressed in a non-restricted fashion, and did not include TRBV31 (data not shown). In each one of the LDL-responsive hybridomas, surface expression of the TRBV31 T cell receptor chain was confirmed by flow cytometry analysis (Table 3 and FIG. 6). All commercially available anti-mouse TCR-Vrx Vα and TCR-Vβ monoclonal antibodies (mAb, SD PharMingen. San Diego, Calif., USA) were used to stain the TCR-Vα and TCR-Vβ on the selected T cell hybridomas. The TCR-V mAbs were conjugated to PE, FITC or biotin/streptavidin-Cy5, in combination with these antibodies, anti-CD3-Pacific Blue and anti-CD4-APC were used. Spleen cells from nonimmunized mice were used as positive controls for all antibodies. The cells were analyzed on a CyAn® ADP flow cytometer (Dako, Glostrup, Denmark).

Example 7

Depletion of TRBV31⁺ T cells Reduces the Proliferative Response to ApoB100

[0173] To directly test the overall importance of the TRBV31 variable chain for the recognition of ApoB100, mice were immunized and boosted with ApoB100 followed by in vitro depletion of TRBV31+T cells from spleen. HuBI00^tg×Ldlr.sup.-/- mice were immunized and boosted s.c, with ApoB100. Spleen cells were harvested and followed by in vitro depletion of TRBV31+or TRBVI9+ T cells from spleen by Fluorescence-Activated Cell Sorting (FACS). 60×10⁶ spleen cells were split in 2 and stained separately with anti-TRBV31 end anti-TRBV19 (PharMingen, San Diego, Calif., USA) respectively, TRBV19 was used as a control for the sorting procedure since none of the hybridomas recognizing ApoB100 presented TRBV19 usage. Of note, the clones 96.7 and 97.3, expressing, the TRBVT91TRAV13.2 chains with no recognition of LDL or ApoB100, did show reactivity to HDL (data not shown). After staining the cells they were sorted in a MoFlo Cytomation cell sorter (Cytomation Bioinstruments, Freiburg, Germany) for the depletion of positive events. Negative cells were then collected and used in the proliferation assay against ApoB100.

[0174] Thereafter 5×10⁵ TRBV31+/TRBV19- or TRBV19+/TRBV31- spleen cells were challenged in vitro with different concentrations of human ApoB 100. Stimulation index was obtained by H3-thymidne incorporation as described in Example 2. The depletion of TRBV31+T cells from spleen led to a significant reduction in the response to the ApoB 100 antigen upon in vitro challenge, which was not observed when T cells expressing the variable chain, TRBV19, were depleted from the spleenocyte population (FIG. 7). Therefore, a significant proportion of the cellular immune response to ApoB 100 in this model is carried out by TRBV31+ T cells.

Example 8

Immunization Against TRBV31 Peptide Inhibits T Cell Recognition of ApoB100

[0175] To inhibit T cell responses to LDL protein. Applicants synthesized a peptide from TRBV31 including its COR2 domain, fused if to KLH carrier protein, and used the preparation for immunization of huB100^tg×Ldlr.sup.-/- mice. This treatment induced the production of antibodies specific for the TRBV31 sequence (FIG. 17B). Circulating IgG antibodies from immunized mice bound to LDL-reactive TRBV31+ hybridomas (FIG. 17C), but not to nonreactive TRBV31 negative hybridomas (FIG. 17D), and the addition of IgG from TRBV31 peptide-immunized mice inhibited T cell hybridoma activation in response to ApoB100 (FIG. 17E). Thus, immunization of huB100tg×Ldlr.sup.-/- mice with TRBV31 peptide induced the production of blocking antibodies that prevented TCR TRBV31 from recognizing LDL protein. We observed significantly reduced levels of TRBV31 mRNA in aorta and spleen at sacrifice (FIG.17F), possibly because antibodies binding to their TCR interfered with the expansion of TRBV31+T cells.

Example 9

Immunization Against TRBV31+TCR Protects Against Atherosclerosis

[0176] To determine the impact on atherosclerosis of the ApoB 100-reactive TRBV31+T cell population, huB100^tg×Ldlr.sup.-/--mice were immunized with a peptide derived from TCR TRBV31. In these experiments, eleven week-old male huB100^tg×Ldlr.sup.-/--mice (C57BL16, 129_Apob.sup.tm2sGY Ldlr.sup.tm1Her (Skalen, K., Gustafsson, M., Rydberg, E. K., Hulten, L. M., Wiklund, 0., Innerahty, T. L., and Boren, J. (2002). Subendothelial retention of atherogenic lipoproteins in early atherosclerosis. Nature 417, 750-754) kindly provided by Jan Boren, Goteborg University) were used. These mice have an elevated serum 30 cholesterol level of 200-400 mg/dl and they have very high levels (>2,000 mg/dl) when fed a high fat diet. The mice were immunized s.c. with 100 μg of TRBV31 peptide. This TRBV31 peptide includes part of the CDR2 variable region of the β chain of the TCR (amino acid residues 45-62, "ATGGTLQQLFYSITVGQV"--SEQ ID NO: 1). The peptide is synthesized and conjugated to keyhole limpet hemocyanin (KLH) by Anaspec, San Jose, Calif., USA).

[0177] KLH is a natural protein isolated from the marine mollusc keyhole limpet and is an immunogenic carrier protein that. In vivo, increases antigenic immune responses to haptens and other weak antigens such as idiotype proteins. The TRBV31 peptide-KLH conjugate was emulsified with complete Freund's adjuvant, and the mice were boosted 4 weeks later with the same antigen emulsified with IFA. A control group of mice was immunized s.c, with 100 μg of KLH using the same protocol as for the peptide. The mice were kept on high fat diet (0.15% cholesterol) starting 5 days after the immunization until sacrifice 10 weeks later with CO₂. In addition, irradiated spleen cells from mice on C578L16 background were used as antigen presenting cell (ARC) in the hybridoma experiments. All experiments were approved by the local ethics committee.

[0178] Subcutaneous immunization with this TRBV31 peptide, representing part of the CDR2 domain and fused to a carrier protein, in Freund's adjuvant induced the production of antibodies to TCR TRBV3 (FIG. 8A-D). The titers of specific antibodies to TRBV31 were measured by ELISA. Briefly, 50 μL of the TRBV31 peptide (5 μg/mL in PBS pH 7.4) were added to 96 well ELISA plates and incubated overnight at 4° C. Coated plates were washed with PBS and thereafter blocked with 1% Gelatin (Gibco invitrogen, Carlsbad, Calif., USA) in PBS for 1 hour, at room temperature. Next, plates were washed and followed by 2 more hours of incubation with mouse plasma diluted in tris buffer saline (TBS)/gelatine 0.1%. After washing, total IgG, and IgG isotypes were detected using enzyme-conjugated anti-mouse antibodies (BD Biosciences, Franklin Lakes, N.J., USA). The plates were washed and the colour reaction developed using TMB substrate reagent (SD Biosciences, Franklin Lakes, N.J., USA). The absorbance was measured using a micropiafe reader (VersaMax, Molecular Devices, Sunnyvale, Calif., USA). FIG. 8A shows IgG antibody titers to TRBV31 peptide measured by ELISA. This data demonstrates that immunization induced high-titer antibodies to the peptide derived from TRBV31.

[0179] Affinity purified circulating IgG antibodies from immunized mice stained LDL-reactive TRBV31+hybridomas (48-5 clone) (FIG. 8B), indicating that these IgG antibodies bound to TCR of such cells. Total IgG plasma antibodies from KLH or TRBV31 immunized mice were affinity purified using a protein-G column (GE healthcare, Uppsala, Sweden). 1×10⁴ hybridoma cells (clone 48-5) were cultured with 40 μg/ml of ApoB 100 in the presence of 4×10⁴ irradiated APCs. For the blocking of hybridoma activation, the different antibodies (KLH IgG or TRBV31 IgG) were added at the beginning of culture, at the concentrations 0.1, 1, 10 and 100 μg/ml, as indicated in FIG. 8C and were present throughout. After 24 h of incubation, IL-2 was measured in the supernatant. In FIG. 8C it can be seen that IgG from TRBV31-peptide immunized mice inhibited activation of T cell hybridoma (clone 48-5) in response to ApoB 100. Thus, immunization led to production of antibodies that prevented TCR TRBV31 recognition of antigen. The Hybridoma clone 48-5 has been deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und zellkulturen GmbH, Inboffenstraβe 7 8, 38124 Braunschweig, Germany, on Jan. 22, 2009 with the accession number QSM ACC2986.

[0180] Finally, the role of TRBV31⁺ T cells in atherosclerosis was tested in experiments with HuB100^tg×Ldlf.sup./-/ mice. These animals were immunized with the TRBV31-peptide conjugated to KLH carrier protein, followed by a single booster injection; atherosclerotic lesions were analyzed 10 weeks after immunization. Mice that were immunized with KLH only were used as control.

[0181] During the examination of the role of TRBV31+ T cells in atherosclerosis. HuB10^tg×Ldlr.sup.-/- mice, which develop spontaneous atherosclerosis, were immunized against TRBV31. This led to a 65% reduction in lesion size in the aortic root compared with control mice that were immunized with carrier protein (FIG. 18A). Lesion size was uniformly reduced in cross sections of the proximal aorta of TRBV31-immunized mice, without any detectable change in lesion distribution (FIG. 18A). Lesions were also analyzed after Sudan IV staining of lipid lesion area in en face preparations of the aortic arch (FIG. 18B),

[0182] Here, TRBV31 immunization led to a 57% reduction in lesion area. Plasma cholesterol, triglycerides, ApoB100 levels, and lipoprotein profiles were unchanged (FIG. 20), as well as antibody titers to LDL and oxLDL. immunohistoehemistry of the lesions showed that macrophage levels were reduced by 50% (FIG. 19A), whereas no significant effect was registered on T cell infiltration (FIG. 19C). We observed substantially reduced inflammation. accompanied by decreased expression of MHC class II protein I-A (FIG. 20B). Furthermore, aortic mRNA for the chemokine, CCL2 (monocyte chemoattractant protein-1) was significantly reduced in peptide immunized mice, whereas CCL5 (RANTES) mRNA was unchanged (FIG. 19, D and E). In summary, abrogation of TCR TRBV31 recognition of native ApoB100 reduces vascular inflammation and inhibits the development of atherosclerosis.

[0183] After sacrifice, blood from mice was collected through cardiac puncture. This was followed by vascular perfusion with sterile RNase-free PBS. Thoracic aorta and heart were dissected and saved for lesion analysis. Two thirds of the spleen was saved for cell experiments and one third snap-frozen for later RNA isolation. Draining lymph nodes from the inguinal region and also the abdominal aorta were snap-frozen and saved for RNA isolation. Lesion analysis was performed as described previously (Nicoletti, A., Kaveri, S., Caligiuri, G., Bariety, J., and Hansson, G. K. (1998). Immunoglobulin treatment reduces atherosclerosis in apo E knockout mice. J Clin invest 102, 910-918). Briefly, hearts were subjected to serial cryostat sections from the proximal 1 mm of the aortic root. Hematoxylin/oil red O-stained sections were used for lesion size evaluation using Image J software (NiH, Bethesda, Md., USA). In FIG. 9A the mean lesion size was determined after measuring 8 sections collected at every 100 μm over a 1-mm segment of the aortic root. FIG. 9B shows images captured for each section and the surface areas of the lesion(s) and of the entire vessel were measured, the fraction area lesion (%) is the ratio between the cross-section area occupied by lesion and the total vessel cross-section area.

[0184] If can be seen that immunization with the TRBV31-peptide led to a dramatic and highly significant 70% reduction of lesion size in the aortic root as compared to control mice immunized with KLH carrier protein alone (P<0.01).

[0185] This effect was paralleled by induction of anti-TRBV31 antibodies but did not affect antibody titers to oxLDL, plasma cholesterol or triglyceride levels (FIGS. 10 and 11).

[0186] Plasma cholesterol and triglycerides were evaluated by enzymatic colorimetric specific kits (Randox Lab. Ltd. Crumin, UK) according to the manufacturer's protocol.

[0187] TCR TRBV31 mRNA was quantified by real time-PCR in aorta of both immunized groups as follows: RNA Isolation and cDNA synthesis was performed as previously mentioned (see above). Real time-PCR was carried out using assay-on-demand primers and probes for CDS and hypoxanthine guanidine ribonucleosyl transferase (HPRT) (Applied Biosystems, Foster City, Calif., USA) in an ABI 7700 Sequence Detector (Applied Biosystems, Foster City, Calif., USA). For TRBV31 expression analysis, the genotyping primers were used in combination with a probe that was designed based on the nucleotide sequences of the constant region of TCR 13 chain (5'-TCCACCCAAGGTGT-3--SSQ ID NO:74). The probe was designed using ABI Primer Express software (Applied Biosystems, Foster City, Calif., USA) and it was synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached at the 5' end (Applied Biosystems, Foster City, Calif., USA). Data was analyzed on the basis of the relative expression method with the formula 2ΔΔCT, where ΔΔCT=ΔCT (sample)-ΔCT (calibrator=average CT values of all samples within each group), and ΔCT is the CT of the housekeeping gene (HPRT) subtracted from the CT of the target gene (Giulietti et al., 2001).

[0188] TCR TRBV31 mRNA was present in the aorta of immunized as well as control mice (FIG. 10D), confirming that this population of T cells was not eliminated but prevented from recognizing their cognate antigen. In conclusion, abrogation of TCR TRBV31 recognition of native ApoB100 protein inhibits atherosclerosis.

[0189] It is evident that oxLDL particles trigger a strong immune response (for example, see Palinski, W., Yla-HerttuaSa, S., Rosenfeld, M. E., Butler, S. W., Socher, S. A., Parthasarathy, S., Curtlss, L. K., and Witzfum. J, L. (1990). Antisera and monoclonal antibodies specific for epitopes generated during oxidative modification of low density lipoprotein. Arteriosclerosis 10, 325-335 and Zhou X et al, Arterioscler Thromb Vase Biol 21: 108-114, 2001). Since T-cell dependent antibodies are formed to aldehyde adduets on ApoB100 and exposure of APC-T cell cultures to oxLDL can elicit CD4+ T cell activation, if has been assumed that T cells recognize epitopes on ApoB100 induced by oxidation of the native apolipoprotein. Instead, the present invention shows that T cells from oxLDL immunized mice preferentially recognize motifs on native LDL. These epitopes are components of the native ApoB100 protein and their immunoreactivity is extinguished rather than increased by oxidative modification of the LDL particle.

[0190] The cellular immune response to LDL identified in the present study was mounted by CD4+ T cells and exhibited MHC class II restriction. This and the fact that purified ApoB100 protein elicited an identical response as the intact LDL particle strongly suggest that intracellular processing of ApoB100 in the antigen-presenting cell generated oligopeptide epitopes that were recognized by the T cells as peptide-MHC complexes. The fact that I-A^b was required for the T cell response and could not be substituted by another MHC class II molecule, I-A^d, further supports the notion that specific oligopeptides bound to MHC constitute the ligand with which clonotypic TCR could interact.

[0191] Since APC have such a high capacity to present ApoB 100 epitopes, there is a significant risk for autoimmune reactions to LDL. Systemic reactions of this kind could obviously be detrimental since LDL is present throughout the circulatory system and in all organs. It was previously assumed that all ApoB100 reactive T cell clones were deleted in the thymus during early life, i.e. autoimmunity is avoided by central tolerance. The current data rule out this possibility, it was clearly demonstrated that LDL reactive T cells were present in huApoB100^tg×Ldlr.sup.-/- mice. In line with these findings, it has been suggested that the immune system can not be tolerized at all toward many peripheral antigens, and that the existence of autoreactive T cells per se can not pose an autoimmune danger in the healthy individual. Consequently, ApoB100-reactive T lymphocytes are most likely part of the peripheral cell repertoire.

[0192] If autoreactivity is not completely eliminated by central tolerance in early life, autoimmune reactions must be avoided by peripheral tolerance mechanisms. They depend on active inhibition of autoreactivity, e.g. by cells secretins immunoregulatory cytokines such as M2 macrophages and regulatory T cells. Furthermore, proteins synthesized in the liver have been reported to preferentially induce tolerogenic immunity. Since ApoB100 is produced in the liver, it can escape autoimmune attack under normal circumstances. However, accumulation in the artery wall under conditions that favor activation of Th1 effector cells can lead to break of tolerance and induction of immune reactions to ApoB 100 components.

[0193] The present data pinpoint CD4+ T cells carrying TCR TRBV31 and recognizing native ApoB100 protein of LDL as proatherogenic contributors to the disease process. However, they do not rule out the involvement of other antigens and immune cells. Thus, it cannot be ruled out that certain types of LDL modifications induce autoimmune reactions towards the particle. The oxidative changes induced in the particle in vim may differ from those induced by metal ions such as copper. Furthermore, the hybridoma strategy provides detailed information on a small subset of cells and certain reactivities may not have been represented in the hybridoma repertoire analyzed. Finally, the present strategy focused on antigens presented by professional APC through the endocytic, MHC class II restricted pathway to CD4+ T cells. Additional important contributions to LDL immunoreactivity can arise from NKT cells recognizing lipid antigens presented via CD1, CD8+ T cells recognizing MHC class I restricted antigens and B cells.

[0194] Immunization of atherosclerosis-prone huApoB100^tg×Ldlr.sup.-/- mice against TOR TRBV31 provided important insights into the immunopathology of atherosclerosis. Antibodies isolated from hyperimmune sera blocked activation of T cells in response to ApoB100, and elimination of TCR TRBV31+cells by flow cytometry blunted T cell responses to ApoB100 in spleen cell cultures. However, antibodies induced by the present immunization strategy blocked antigen recognition by TCR TRBV31+cells but did net eliminate them from aorta.

[0195] The induction of blocking anti-TRBV31 antibodies was associated with a 70% reduction of atherosclerosis in huApoB100^tg×Ldlr.sup.-/- mice. The magnitude of reduction is even better than that achieved by immunization with LDL preparations in similar models Urban, R. G., Chicz, R. M., and Strominger, J. L. (1994). Selective release of some invariant chain-derived peptides from HLA-DR 1 molecules at endosomal pH. J Exp Med 180, 751-755; Freigangs S., Horkko, S., Miller, E., Witztum, J. L., and Palinski, W. (1998). Immunization of LDL receptor-deficient mice with homologous malondialdehyde-modified and native LDL reduces progression of atherosclerosis by mechanisms other than induction of high titers of antibodies to oxidative neoepitopes. Arterioscler Thromb Vase Biol 18, 1972-1982) and therefore strongly suggests that a subset of T cells recognizing ApoB100 epitopes play a major role in the development of atherosclerosis. Since TCR TRBV31 did not disappear from the aorta after immunization, blocking their recognition of MHC-antigen complexes can suffice to inhibit the disease process.

[0196] The use of the huApoB100^tg×Ldlr.sup.-/- model permitted the use of well defined human LDL preparations for dissecting the cellular autoimmune response in atherosclerosis.

[0197] According to the above examples T cell recognition of oxLDL, T cell hybridomas from mice immunized with oxLDL were created, which mice were carrying human ApoB100 as a transgene (huB100t9). These mice produce high levels of ApoB100 and are also expected to be tolerant to native human LDL.

[0198] Hence the experiments exemplified in the above examples show that to great-surprise, T cell responses against native LDL and purified ApoB100 in such mice carrying T cell hybridomas from mice immunized with oxLDL and carrying human ApoB100 as a transgene (huB100t9) were registered, whereas oxidation of LDL blunted these responses. The responding T cells were MHC class II restricted CD4+ cells and expressed a T cell receptor (TCR) containing a variable 13 domain of the TRBV31 type. Elimination of TRBV31+T cells attenuated the cellular immune response to ApoB100, and immunization of hypercholesterolemia mice against a peptide derived from TCR TRBV31 inhibited the development of atherosclerosis.

[0199] These results strongly suggest that autoimmune T cells recognizing protein epitopes from native LDL promote atherosclerosis.

Example 10

Inhibition of T Cell Response to Native Low Density Lipoprotein and Related effect on Atherosclerosis

[0200] Additional data and experiments illustrating inhibition of T cell response to native LDL and related effect on atherosclerosis are shown in the paper from Hermansson et al. entitled "Inhibition of T cell response to native low-density lipoprotein reduces atherosclerosis" in J Exp Med 2010 207:1081-1093, Published May 3, 2010. doi:10.1084/jem 20092243 enclosed as Appendix A of U.S. provisional application, Ser. No. 61/385,548, which forms integral part of the present disclosure and is incorporated herein by reference in its entirety.

[0201] A skilled person, based on the experiments of Appendix A will be able to identify further immunizing agents, e.g. inhibiting proteins or fragments and/or derivatives thereof, suitable to inhibit T cell response and/or provide a therapeutic effect on atherosclerosis in view of the present disclosure.

[0202] In particular, the assays and experiments described in in the present disclosure and more particularly in the Appendix A of U.S. provisional application, Ser. No. 61/385,548, provide exemplary ways to test the function of agents such as peptides/fragments and antibodies, or derivatives thereof.

Example 11

Sequences of TRBV31 TRAV14, TRAV 12 and/or TRAV4

[0203] The TCR beta variable 31 and TCR alpha variable 14, 12 and 4 from hybridomas 15-2, 48-5 and 45-1 were sequenced and the sequence are indicated in Table 4 below.

TABLE-US-00005 TCR SEQ ID V beta 31 Gene ATGCTGTACTCTCTCCTTGCCTTTCTCCT SEQ ID NO: 53 hybridomas 45 sequence GGGCATGTTCTTGGGTGTTAGTGCTCAGA CTATCCATCAATGGCCAGTTGCCGAGATC AAGGCTGTGGGCAGCCCACTGTCTCTGGG GTGTACCATAAAGGGGAAATCAAGCCCTA ACCTCTACTGGTACTGGCAGGCCACAGGA GGCACCCTCCAGCAACTCTTCTACTCTAT TACTGTTGGCCAGGTAGAGTCGGTGGTGC AACTGAACCTCTCAGCTTCCAGGCCGAAG GACGACCAATTCATCCTAAGCACGGAGAA GCTGCTTCTCAGCCACTCTGGCTTCTACC TCTGTGCCTGGAGTCTAGGCAGCCAGAGA GTCTTCTTTGGTAAAGGAACCAGACTCAC AGTTGTAGAGGATCTGAGAAATGTGACTC CACCAAGGTCTCCTTGTTTGAGCCATCAA AAGCAGAGATTGCAAACAAACAAAAGGCT ACCCTCGTGTGCTTGGCCAGGGGCTTCTT CCCTGACCACGTGGAGCTGAGCTGGTGGG TGAATGGCAAGGAGGTCCACAGTGGGGTC AGCACGGACCTCAGGCCTACAAGGAGAGC AATTATAGCTACTGCCTGAGCAGCCGCCT GGAGGTCTCTGCTACCTTCTGGCACAATC CTCGCAACCACTTCCGCTGCCAAGTGCAG TTCCATGGGCTTTCAGAGGAGGACAAGTG GCCAGAGGGCTCACCCAAACCTGTCACAC AGAACATCAGTGCAGAGGCCTGGGGCCGA GCAGACTGTGGGATTACCTCAGCATCCTA TCAACAAGGGGTCTTGTCTGCCACCATCC TCTATGAGATCCTGCTAGGGAAAGCCACC CTGTATGCTGTGCTTGTCAGTACACTGGT GGTGATGGCTATGGTCAAAAGAAAGAATT CATGA Protein The amino acid sequence is the SEQ ID NO: 54 sequence one identifiable by a skilled person as derivable by SEQ ID NO: 53 by applying the genetic code as shown in the Genetic Code Table. Protein MLYSLLAFLLGMFLGVSAQTIHQWPVAEI SEQ ID NO: 55 sequence KAVGSPLSLGCTIKGKSSPNLYWYWQATG GTLQQLFYSITVGQVESVVQLNLSASRPK DDQFILSTEKLLLSHSGFYLCAWSLGSQR VFFGKGTRLTVVEDLRNVTPPKVSLFEPS KAEIANKQKATLVCLARGFFPDHVELSWW VNGKEVHSGVSTDPQAYKESNYSYCLSSR LRVSATFWHNPRNHFRCQVQFHGLSEEDK WPEGSPKPVTQNISAEAWGRADCGITSAS YQQGVLSATILYEILLGKATLYAVLVSTL VVMAMVKRKNS V beta 31 Gene ATGCTGTACTCTCTCCTTGCCTTTCTCCT SEQ ID NO: 56 hybridomas 15 sequence GGGCATGTTCTTGGGTGTTAGTGCTCAGA CTATCCATCAATGGCCAGTTGCCGAGATC AAGGCTGTGGGCAGCCCACTGTCTCTGGG GTGTACCATAAAGGGGAAATCAAGCCCTA ACCTCTACTGGTACTGGCAGGCCACAGGA GGCACCCTCCAGCAACTCTTCTACTCTAT TACTGTTGGCCAGGTAGAGTCGGTGGTGC AACTGAACCTCTCAGCTTCCAGGCCGAAG GACGACCAATTCATCCTAAGCACGGAGAA GCTGCTTCTCAGCCACTCTGGTTCTACCT CTGTGCCTGGAGTCTAACTGGGGGGAATA GTCAAAACACCTTGTACTTTGGTGCGGGC ACCGACTATCGGTGCTAGAGGATCTGAGA AATGTGACTCCACCCAAGGTCTCCTTGTT TGAGCCATCAAAAGCAGAGATTGCAAACA AACAAAAGGCTACCTCGTGTGCTTGGCCA GGGGCTTCTTCCCTGACCACGTGGAGCTG AGCTGGTGGGTGAATGGCAAGGAGGTCCA CAGTGGGGTCAGCACGGACCCTCAGGCCT ACAAGGAGAGCAATTATAGCTACTGCCTG AGCAGCCGCCTGAGGGTCTCTGCTACCTT CTGGCACAATCCTCGAAACCACTTCCGCT GCCAAGTGCAGTTCCATGGGCTTTCAGAG GAGGACAAGTGGCCAGAGGGCTCACCCAA ACCTGTCACACAGAACATCAGTGCAGAGG CCTGGGGCCGAGCAGACTGTGGAATCACT TCAGCATCCTATCATCAGGGGGTTCTGTC TGCAACCATCCTCTAGAGATCCTACTGGG GAAGGCCACCCTATATGCTGTGCTGGTCA GTGGCCTGGTGCTGATGGCCATGGTCAAG AAAAAAATTCCTGA Protein The amino acid sequence is the SEQ ID NO: 57 sequence one identifiable by a skilled person as derivable by SEQ ID NO: 57 by applying the genetic code as shown in the Genetic Code Table. Protein MLYSLLAFLLGMFLGVSAQTIHQWPVAEI SEQ ID NO: 58 sequence KAVGSPLSLGCTIKGKSSPNLYWYWQATG GTLQQLFYSITVGQVESVVQLNLSASRPK DDQFILSTEKLLLSHSGFYLCAWSLTGGN SQNTLYFGAGTRLSVLEDLRNVTPPKVSL FEPSKAEIANKQKATLVCLARGFFPDHVE LSWWVNGKEVHSGVSTDPQAYKESNYSYC LSSRLRVSATFWHNPRNHFRCQVQFHGLS EEDKWPEGSPKPVTQNISAEAWGRADCGI TSASYHQGVLSATILYEILLGKATLYAVL VSGLVLMAMVKRKNS V beta 31 Gene ATGCTGTACTCTCTCCTTGCCTTTCTCCT SEQ ID NO: 59 hybridomas 48 sequence GGGCATGTTCTTGGGTGTTAGTGCTCAGA AAGGCTGTGGGCAGCCCACTGTCTCTGGG GTGTACCATAAAGGGGAAATCAAGCCCTA ACCTCTACTGGTACTGGCAGGCCACAGGA GGCACCCTCCAGCAACTCTTCTACTCTAT TACTGTTGGCCAGGTAGAGTCGGTGGTGC AACTGAACCTCTCAGCTTCCAGGCCGAAG GACGACCAATTCATCCTAAGCACGGAGAA GCTGCTTCTCAGCCACTCTGGCTTCTACC TCTGTGCCTGGAGTCTAGAAGGTGAACAG TACTTCGGTCCCGGCACCAGGCTCACGGT TTTAGAGGATCTGAGAAATGTGACTCCAC CCAAGCTCTCCTTGTTTGAGCCATCAAAA GCAGAGATTGCAAACAAACAAAAGGCTAC CCTCGTGTGCTTGGCCAGGGGCTTCTTCC CTGACCACGTGGAGCTGAGCTGGTGGGTG AATGGCAAGGAGGTCCACAGTGGGGTCAG CACGGACCCTCAGGCCTACAAGGAGAGCA ATTATAGCTACTGCCTGAGCAGCCGCCTG AGGGTCTCTGCTACCTTCTGGCACAATCC TCGAAACCACTTCCGCTGCCAAGTGCAGT TCCATGGGCTTTCAGAGGAGGACAAGTGG CCAGAGGGCTCACCCAAACCTGTCACACA GAACATCAGTGCAGAGGCCTGGGGCCGAG CAGACTGTGGAATCACTTCAGCATCCATC ATCAGGGGGTTCTGTCTGCAACCATCCTC TATGAGATCCTACTGGGGAAGGCCACCCT ATATGCTGTGCTGGTCAGTGGCCTGGTGC TGATGGCCATGGTCAAGAAAAAAAATTCC TGA Protein The amino acid sequence is the sequence one identifiable by a skilled person as derivable by SEQ ID No: 59 by applying the genetic code as shown in the Genetic Code Table. V alpha 14 Gene ATGGACAAGATCCTGACAGCATCGTTTTT SEQ ID NO: 61 hybridomas 15 sequence ACTCCTAGGCCTTCACCTAGCTGGGGTGA ATGGCCAGCAGAAGGAGAAACATGACCAG CAGCAGGTGAGACAAAGTCCCCAATCTCT GACAGTCTGGGAAGGAGGAACCACAGTTC TGACCTGCAGTTATGAGGACAGCACTTTT AACTACTTCCCATGGTACCAACAGTTCCC TGGGGAAGGCCCTGCACTTCTGATATCCA TACTTTCAGTGTCCGATAAAAAGCAAGAT GGACGATTCACAACCTTCTTCAATAAAAG GGAGAAAAAGCTCTCCTTGCACATCATAG ACTCTCAGCCTGGAGACTCAGCCACCTAC TTCTGTGCAGCAAGTGTGGGTGCCAAGCT CACATTCGGAGGGGGAACAAGGTTAACGG TCAGACCCGACATCCAGAACCCAGAACCT GCTGTGTACCAGTTAAAAGATCCTCGGTC TCAGGACAGCACCCTCTGCCTGTTCACCG ACTTTGACTCCCAAATCAATGTGCCGAAA ACCATGGAATCTGGAACGTTCATCACTGA CAAAACTGTGCTGGACATGAAAGCTATGG ATTCCAAGAGCAATGGGGCCATTGCCTGG AGCAACCAGACAAGCTTCACCTGCCAAGA TATCTTCAAAGAGACCAACGCCACCTACC CCAGTTCAGACGTTCCCTGTGATGCCACG TTGACTGAGAAAGCTTTGAAACAGATATG AACCTAAACTTTCAAAACCTGTCAGTTAT GGGACTCCGAATCCTCCTGCTGAAAGTAG CCGGATTTAACCTGCTCATGACGCTGAGG CTGTGGTCCTGA Protein The amino acid sequence is the sequence one identifiable by a skilled person as derivable by SEQ ID NO: 62 by applying the genetic code as shown in the Genetic Code Table Protein MDKILTASFLLLGLHLAGVNGQQKEKHDQ SEQ ID NO: 63 sequence QQVRQSPQSLTVWEGGTTVLTCSYEDSTF NYFPWYQQFPGEGPALLISILSVSDKKED GRFTTFFNKREKKLSLHIIDSQPGDSATY FCAASVGAKLTFGGGTRLTVPDIQNPEPA VYQLKDPRSQDSTLCLFTDFDSQINVPKT MESGTFITDKTVLDMKAMDSKSNGAIAWS NQTSFTCQDIFKETNATYPSSDVPCDATL TEKSFETDMNLNFQNLSVMGLRILLLKVA GFNLLMTLRLWS V alpha 12 Gene ATGCGTCCTGTCACCTCCTCAGTTCTCGT SEQ ID NO: 64 hybridomas 48 sequence GCTCCTCCTAATGCTCAGAAGGAGCAATG GAGACTCAGTGACCCAGACAGAAGGCCTG GTCACTCTCACCGAGGGGTTGCCTGTGAT GCTGAACTGCACCTATCAGACTGCTTACT CAACTTTCCTTTTCTGGTATGTGCAACAT CTCAATGAAGCCCCTAAACTACTCCTGAA GAGCTCCACAGACAACAAGAGGACCGAGC ACCAAGGGTTCCACGCCACTCTCCATAAG AGCAGCAGCTCCTTCCATCTGCAGAAGTC CTCAGCGCAGCTGTCAGACTCTGCCCTGT ACTACTGTGCTCTGAGTGATCAAGGAGGG TCTGCGAAGCTCATCTTTGGGGAGGGGAC AAAGCTGACAGTGAGCTCATACATCCAGA ACCCAGAACCTGCTGTGTACCAGTTAAAA GATCCTCGGTCTCAGGACAGCACCCTCTG CCTGTTCACCGACTTTGACTCCCAAATCA ATGTGCCGAAAACCATGGAATCTGGAACG TTCATCACTGACAAAACTGTGCTGGACAT GAAAGCTATGGATTCCAAGAGCAATGGGG CCATTGCCTGGAGCAACCAGACAAGCTTC ACCTGCCAAGATATCTTCAAAGAGACCAA CGCCACCTACCCCAGTTCAGACGTTCCCT GTGATGCCACGTTGACCGAGAAAAGCTTT GAAACAGATATGAACCTAAACTTTCAAAA CGTGTCAGTTATGGGACTCCGAATCCTCC TGCTGAAAGTAGCGGATTTAACCTGCTCA TGACGCTGAGGCTGTGGTCCTGA Protein The amino acid sequence is the sequence one identifiable by a skilled person as derivable by SEQ ID NO: 65 by applying the genetic code as shown in the Genetic Code Table Protein MRPVTSSVLVLLLMLRRSNGDSVTQTEGL SEQ ID NO: 66 sequence VTLTEGLPVMLNCTYQYAYSTFLFWYVQH LNEAPKLLLKSSTDNKRTEHQGFHATLHK SSSSFHLQKSSAQLSDSALYYCALSDQGG SAKLIFGEGTKLTVSSYIQNPEPAVYQLK DPRSQDSTLCLFTDFDSQINVPKTMESGT FITDKTVLDMKAMDSKSNGAIAWSNQTSF TCQDIFKETNATYPSSDVPCDATLTEKSF ETDMNLNFQNLSVMGLRILLLKVAGFNLL MTLRLWS V alpha 4 Gene ATGCAGAGGAACCTGGGAGCTGTGCTGGG SEQ ID NO: 67 hybridomas 45 sequence GATTCTGTGGGTGCAGATTTGCTGGGTGA GAGGAGATCAGGTGGAGCAGAGTCCTTCA GCCCTGAGCCTCCACGAGGGAACCGGTTC TGCTCTGAGATGCAATTTTACGACCACCA TGAGGGCTGTGCAGTGGTTCCAACAGAAT TCCAGGGGCAGCCTCATCAATCTGTTCTA CTTGGCTTCAGGAACAAAGGAGAATGGGA GGTTAAAGTCAACATTCAATTCTAAGGAG

AGCTACAGCACCCTGCACATCAGGGATGC CCAGCTGGAGGACTCAGGCACTTACTTCT GTGCTGCCGTAATGAATACAGAAGGTGCA GATAGACTCACCTTTGGGAAAGGAACTCA GCTGATCATCCAGCCCTACATCCAGAACC CAGAACCTGCTGTGTACCAGTTAAAAGAT CCTCGGTCTCAGGACAGCACCCTCTGCCT GTTCACCGACTTTGACTCCCAAATCAATG TGCCGAAAACCATGGAATCTGGAACGTTC ATCACTGACAAAACTGTGCTGGACATGAA AGCTATGGATTCCAAGAGCAATGGGGCCA TTGCCTGGAGCAACCAGACAAGCTTCACC TGCCAAGATATCTTCAAAGAGACCAACGC CACCTACCCCAGTTCAGACGTTCCCTGTG ATGCCACGTTGACTGAGAAAAGCTTTGAA ACAGATATGAACCTAAACTTTCAAAACCT GTCAGTTATGGGACTCCGAATCCTCCTGC TGAAAGTAGCCGGATTTAACCTGCTCATG ACGCTGAGGCTGTGGTCCTGA Protein The amino acid sequence is the SEQ ID NO: 68 sequence one identifiable by a skilled person as derivable by SEQ ID NO: 67 by applying the genetic code as shown in the Genetic Code Table Protein MQRNLVAGLGILWVQICWVRGDQVEQSPS SEQ ID NO: 69 sequence ALSLHEGTGSALRCNFTTTMRAVQWFQQN SRGSLINLFYLASGTKENGRLKSTFNSKE SYSTLHIRDAQLEDSGTYFCAAVMNTEGA DRLTFGKGTQLIIQPYIQNPEPAVYQLKD PRSQDSTLCLFTDFDSQINVPKTMESGTF ITDKTVLDMKAMDSKSNGAIAWSNQTSFT CQDIFKETNATYPSSDVPCDATLTEKSFE TDMNLMFQNLSVMGLRILLLKVAGFNLLM TLRLWS

[0204] Expressing of the above TRAV and TRBV sequences on reactive hybridomas clones are reported in Table 3 above. The cDNA from reactive clones was amplified by PRC using appropriate Vβ-specific 5' primers with a constant region Cβ 3' primer, or relevant Vα-specific 5' primers with a constant region Cα3' primer (Tables 1 and 2).

[0205] Sequences of the TRBV30 are also identifiable by a skilled person and comprise for example the sequences listed in Table 5 below.

TABLE-US-00006 SEQ TCR Sequence ID NO TRBV30 Protein SVLLYQKPNRDICQSGTSLKIQCVA 70 Fragment Sequence DSQV TRBV30 Protein VSMFWYQQFQEQSLMLMATANEG 71 Fragment Sequence TRBV30 Protein SEATYESGFTKDKFPISRP 72 Fragment Sequence TRBV30 Protein NLTFSTLTVNNARPGDSSIYFCSSR 73 Fragment Sequence

[0206] Further data concerning the above sequences can be found in FIGS. 1-8 of the present application and of PCT/SE2010/050299 herein incorporated by reference in its entirety.

[0207] A skilled person will be able to identify further immunizing agents, e.g. inhibiting proteins or fragments and/or derivatives thereof, suitable to inhibit T cell response and/or provide a therapeutic effect on atherosclerosis in view of the present disclosure. In particular, further agents will be identifiable using one of the hybridomas as herein described in detail for TRBV31, TRAV 4, TRAV 12 and TRAV 14.

Example 12

Spleen Cell from TCR Transgenic (TRBV31⁺TBAV12⁺) Mice React to Human ApoB100

[0208] DNA encoding TCR chains were subcloned into expression vectors and used to create transgenic mice (Hoist, J. et al., Nat Protoc, 1, 408, 2008). Stimulation of spleen cells from: TCR trangenic mice demonstrates that T cells carrying the TCR TRBV31 vividly respond to human ApoB100.

[0209] Herein reported are the exemplary experiments carried out with TRBV31+TRAV12+ cells

[0210] Spleen cells from 3 TCR transgenic mice (mouse #4, 31 and 33) or from control wild type mouse were cultured with human ApoB100 (10 ug/ml). After 72 h, the supernatants were saved for IFNγ evaluation by ELISA, and the remaining cultures were pulsed with 1 μCi (3H-thymidine) for proliferation determination. Results are shown in FIG. 21, wherein the results are expressed as mean±SEM of the results of duplicate wells for each mouse.

[0211] In particular, in FIG. 21A, it is shown that TRBV31⁺ TRAV12⁺ cells secrete high levels of the pro-inflammatory cytokine IFNγ upon the recognition of its cognate antigen human ApoB100. In accordance with the results illustrated in FIG. 21A, in FIG. 21B, these cells are shown to also present high rates of proliferation.

[0212] The fact that the transgenic T cell receptor, carried in the germ line of the transgenic mice, shows this reactivity, confirms that the T cell receptor recognizes human LDL protein. In particular, the transgenic mouse data illustrated herein confirm that TRVBV31/TRAV12 is specific for ApoB100 protein of LDL.

[0213] A skilled person will be able to identify further effects of the compounds herein described and in particular with reference to TRBV31, TRAV 4, TRAV 12 and TRAV 14 and additional compound described in the hybridomas in connection with inhibition of T cell response and/or provide a therapeutic effect on atherosclerosis in view of the present disclosure.

[0214] In summary, in several embodiments, T cell responses against modified LDL were investigated by immunizing mice with oxLDL. T cell hybridomas were established from such mice and analyzed for their reactivity towards oxidized and native forms of LDL. None of the reactive clones responded to oxidized LDL but only to native LDL and purified apolipoprotein B-100. Responding hybridomas were CD3+4+8-, restricted by MHC class II antigen I-Ab, and expressed one single T cell receptor variable (V) beta chain (TRBV31) in combination with different V alpha chains, immunization of huApoB100t9×Ldlr.sup.-/- mice against TRBV31 reduced atherosclerosis, in parallel with the development of anti-TRBV3 antibodies that blocked T cell recognition of ApoB100.

[0215] The examples set forth above are provided to give those of ordinary skill in the art a complete disclosure and description of how to make and use the embodiments of the compositions, peptides, proteins, methods and systems of the disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure. Modifications of the above-described modes for carrying out the disclosure that are obvious to persons of skill in the art are intended to be within the scope of the following claims. All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the disclosure pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually. Further, the paper copy of the sequence listing submitted herewith and the corresponding computer readable form are both incorporated herein by reference in their entireties.

[0216] The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background, Summary, Detailed Description, and Examples is hereby incorporated herein by reference. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually. However, if any inconsistency arises between a cited reference and the present disclosure, the present disclosure takes precedence.

[0217] The terms and expressions which have been employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but if is recognized that various modifications are possible within the scope of the disclosure claimed. Thus, it should be understood that although the disclosure has been specifically disclosed by preferred embodiments, exemplary embodiments and optional features, modification and variation of the concepts herein disclosed can be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this disclosure as defined by the appended claims.

[0218] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. The term "plurality" includes two or more referents unless the content clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains,

[0219] When a Markush group or other grouping is used herein, all individual members of the group and all combinations and possible subcombinations of the group are intended to be individually included in the disclosure. Every combination of components or materials described or exemplified herein can be used to practice the disclosure, unless otherwise stated. One of ordinary skill in the art will appreciate that methods, device elements, and materials other than those specifically exemplified can be employed in the practice of the disclosure without resort to undue experimentation. All art-known functional equivalents, of any such methods, device elements, and materials are intended to be included in this disclosure; Whenever a range is given in the specification, for example, a temperature range, a frequency range, a time range, or a composition range, all intermediate ranges and all subranges, as well as, all individual values included in the ranges given are intended to be included in the disclosure. Anyone or more individual members of a range or group disclosed herein can be excluded from a claim of this disclosure. The disclosure illustratively described herein suitably can be practiced in the absence of any element, or elements, limitation or limitations which is not specifically disclosed herein.

[0220] A number of embodiments of the disclosure have been described. The specific embodiments provided herein are examples of useful embodiments of the disclosure and it will be apparent to one skilled in the art that the disclosure can be carried out using a large number of variations of the devices, device components, methods steps set forth in the present description. As will be obvious to one of skill in the art, methods and devices useful for the present methods can include a large number of optional composition and processing elements and steps.

Sequence CWU 1

1

74118PRTArtificial sequenceSynthetic peptide 1Ala Thr Gly Gly Thr Leu Gln Gln Leu Phe Tyr Ser Ile Thr Val Gly 1 5 10 15 Gln Val 221DNAArtificial sequenceSynthetic polynucleotide 2tggatggttt gaaggacagt g 21321DNAArtificial sequenceSynthetic polynucleotide 3ctgtttatct ctgctgaccg g 21422DNAArtificial sequenceSynthetic polynucleotide 4acgaaggaca aggattcact gt 22522DNAArtificial sequenceSynthetic polynucleotide 5ctggaggact caggcactta ct 22621DNAArtificial sequenceSynthetic polynucleotide 6ggtacccgac tcttttctgg t 21722DNAArtificial sequenceSynthetic polynucleotide 7accctttcag aagatgactt cc 22820DNAArtificial sequenceSynthetic polynucleotide 8tttaaagtcc caaaggccaa 20921DNAArtificial sequenceSynthetic polynucleotide 9tcctgaaagt cattacggct g 211021DNAArtificial sequenceSynthetic polynucleotide 10agagcctcaa gggacaaaga g 211120DNAArtificial sequenceSynthetic polynucleotide 11agactcccag cccagtgact 201219DNAArtificial sequenceSynthetic polynucleotide 12acatcagaga gccgcaacc 191321DNAArtificial sequenceSynthetic polynucleotide 13ccctgcccag ctaatcttaa t 211422DNAArtificial sequenceSynthetic polynucleotide 14ctgcagctga gatgcaagta tt 221522DNAArtificial sequenceSynthetic polynucleotide 15tcctatggtg gatccattta cc 221620DNAArtificial sequenceSynthetic polynucleotide 16tggacagaaa acagagccaa 201720DNAArtificial sequenceSynthetic polynucleotide 17caggcaaagg tcttgtgtcc 201821DNAArtificial sequenceSynthetic polynucleotide 18acgccactct ccataagagc a 211920DNAArtificial sequenceSynthetic polynucleotide 19gctctttgca catttcctcc 202022DNAArtificial sequenceSynthetic polynucleotide 20tgcagttatg aggacagcac tt 222123DNAArtificial sequenceSynthetic polynucleotide 21ctgcagttat gagaacagtg ctt 232220DNAArtificial sequenceSynthetic polynucleotide 22ccagacgatt cgggaaagta 202321DNAArtificial sequenceSynthetic polynucleotide 23ttccatcgga ctcatcatca c 212420DNAArtificial sequenceSynthetic polynucleotide 24aacctgaaga aatccccagc 202522DNAArtificial sequenceSynthetic polynucleotide 25ggaagacgga agattcacag tt 222622DNAArtificial sequenceSynthetic polynucleotide 26acgctcctaa tagacattcg ct 222720DNAArtificial sequenceSynthetic polynucleotide 27gttcctcttc agggtccaga 202820DNAArtificial sequenceSynthetic polynucleotide 28caccagcagg ttctgggttc 202920DNAArtificial sequenceSynthetic polynucleotide 29acacgggtca ctgatacgga 203021DNAArtificial sequenceSynthetic polynucleotide 30atggacaatc agactgcctc a 213121DNAArtificial sequenceSynthetic polynucleotide 31tcactctgaa aatccaaccc a 213221DNAArtificial sequenceSynthetic polynucleotide 32taaacgaaac agttccaagg c 213320DNAArtificial sequenceSynthetic polynucleotide 33acggtgccca gtcgttttat 203421DNAArtificial sequenceSynthetic polynucleotide 34ggattcctac ccagcagatt c 213521DNAArtificial sequenceSynthetic polynucleotide 35agataaagga aacctgccca g 213621DNAArtificial sequenceSynthetic polynucleotide 36ccagaacaac gcaagaagac t 213720DNAArtificial sequenceSynthetic polynucleotide 37ggctaccccc tctcagacat 203820DNAArtificial sequenceSynthetic polynucleotide 38tggcttccct ttctcagaca 203920DNAArtificial sequenceSynthetic polynucleotide 39gcgacacagc cacctatctc 204021DNAArtificial sequenceSynthetic polynucleotide 40cgcagcaagt ctcttatgga a 214121DNAArtificial sequenceSynthetic polynucleotide 41atagatgatt cagggatgcc c 214221DNAArtificial sequenceSynthetic polynucleotide 42tgagaagttc caatccagtc g 214320DNAArtificial sequenceSynthetic polynucleotide 43gaaggctatg atgcgtctcg 204420DNAArtificial sequenceSynthetic polynucleotide 44ttcccatcag tcatcccaac 204521DNAArtificial sequenceSynthetic polynucleotide 45aaaatgccct gctaagaaac c 214619DNAArtificial sequenceSynthetic polynucleotide 46cagcctggga atcagaacg 194721DNAArtificial sequenceSynthetic polynucleotide 47gcatcctgga aatcctatcc t 214821DNAArtificial sequenceSynthetic polynucleotide 48agtgtccttc aaactcacct t 214921DNAArtificial sequenceSynthetic polynucleotide 49aaaggataca gggtctcacg g 215021DNAArtificial sequenceSynthetic polynucleotide 50ggacaagttt ccaatcagcc g 215121DNAArtificial sequenceSynthetic polynucleotide 51ttcatcctaa gcacggagaa g 215224DNAArtificial sequenceSynthetic polynucleotide 52tgcaatctct gcttttgatg gctc 2453906DNAmouseCDS(1)..(906)Sequence coding for V beta 31 from hybridomas 45 53atg ctg tac tct ctc ctt gcc ttt ctc ctg ggc atg ttc ttg ggt gtt 48Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 agt gct cag act atc cat caa tgg cca gtt gcc gag atc aag gct gtg 96Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 ggc agc cca ctg tct ctg ggg tgt acc ata aag ggg aaa tca agc cct 144Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 aac ctc tac tgg tac tgg cag gcc aca gga ggc acc ctc cag caa ctc 192Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 ttc tac tct att act gtt ggc cag gta gag tcg gtg gtg caa ctg aac 240Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 ctc tca gct tcc agg ccg aag gac gac caa ttc atc cta agc acg gag 288Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 aag ctg ctt ctc agc cac tct ggc ttc tac ctc tgt gcc tgg agt cta 336Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 ggc agc cag aga gtc ttc ttt ggt aaa gga acc aga ctc aca gtt gta 384Gly Ser Gln Arg Val Phe Phe Gly Lys Gly Thr Arg Leu Thr Val Val 115 120 125 gag gat ctg aga aat gtg act cca ccc aag gtc tcc ttg ttt gag cca 432Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro 130 135 140 tca aaa gca gag att gca aac aaa caa aag gct acc ctc gtg tgc ttg 480Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu 145 150 155 160 gcc agg ggc ttc ttc cct gac cac gtg gag ctg agc tgg tgg gtg aat 528Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 165 170 175 ggc aag gag gtc cac agt ggg gtc agc acg gac cct cag gcc tac aag 576Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys 180 185 190 gag agc aat tat agc tac tgc ctg agc agc cgc ctg agg gtc tct gct 624Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala 195 200 205 acc ttc tgg cac aat cct cgc aac cac ttc cgc tgc caa gtg cag ttc 672Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe 210 215 220 cat ggg ctt tca gag gag gac aag tgg cca gag ggc tca ccc aaa cct 720His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro 225 230 235 240 gtc aca cag aac atc agt gca gag gcc tgg ggc cga gca gac tgt ggg 768Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 245 250 255 att acc tca gca tcc tat caa caa ggg gtc ttg tct gcc acc atc ctc 816Ile Thr Ser Ala Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu 260 265 270 tat gag atc ctg cta ggg aaa gcc acc ctg tat gct gtg ctt gtc agt 864Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser 275 280 285 aca ctg gtg gtg atg gct atg gtc aaa aga aag aat tca tga 906Thr Leu Val Val Met Ala Met Val Lys Arg Lys Asn Ser 290 295 300 54301PRTmouse 54Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 Gly Ser Gln Arg Val Phe Phe Gly Lys Gly Thr Arg Leu Thr Val Val 115 120 125 Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro 130 135 140 Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu 145 150 155 160 Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 165 170 175 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys 180 185 190 Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala 195 200 205 Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe 210 215 220 His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro 225 230 235 240 Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 245 250 255 Ile Thr Ser Ala Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu 260 265 270 Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser 275 280 285 Thr Leu Val Val Met Ala Met Val Lys Arg Lys Asn Ser 290 295 300 55301PRTmouse 55Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 Gly Ser Gln Arg Val Phe Phe Gly Lys Gly Thr Arg Leu Thr Val Val 115 120 125 Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro 130 135 140 Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu 145 150 155 160 Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 165 170 175 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys 180 185 190 Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala 195 200 205 Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe 210 215 220 His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro 225 230 235 240 Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 245 250 255 Ile Thr Ser Ala Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu 260 265 270 Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser 275 280 285 Thr Leu Val Val Met Ala Met Val Lys Arg Lys Asn Ser 290 295 300 56918DNAmouseCDS(1)..(918)Sequence coding for V beta 31from hybridomas 15 56atg ctg tac tct ctc ctt gcc ttt ctc ctg ggc atg ttc ttg ggt gtt 48Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 agt gct cag act atc cat caa tgg cca gtt gcc gag atc aag gct gtg 96Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 ggc agc cca ctg tct ctg ggg tgt acc ata aag ggg aaa tca agc cct 144Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 aac ctc tac tgg tac tgg cag gcc aca gga ggc acc ctc cag caa ctc 192Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 ttc tac tct att act gtt ggc cag gta gag tcg gtg gtg caa ctg aac 240Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 ctc tca gct tcc agg ccg aag gac gac caa ttc atc cta agc acg gag 288Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 aag ctg ctt ctc agc cac tct ggc ttc tac ctc tgt gcc tgg agt cta 336Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 act ggg ggg aat agt caa aac acc ttg tac ttt ggt gcg ggc acc cga

384Thr Gly Gly Asn Ser Gln Asn Thr Leu Tyr Phe Gly Ala Gly Thr Arg 115 120 125 cta tcg gtg cta gag gat ctg aga aat gtg act cca ccc aag gtc tcc 432Leu Ser Val Leu Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser 130 135 140 ttg ttt gag cca tca aaa gca gag att gca aac aaa caa aag gct acc 480Leu Phe Glu Pro Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr 145 150 155 160 ctc gtg tgc ttg gcc agg ggc ttc ttc cct gac cac gtg gag ctg agc 528Leu Val Cys Leu Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser 165 170 175 tgg tgg gtg aat ggc aag gag gtc cac agt ggg gtc agc acg gac cct 576Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro 180 185 190 cag gcc tac aag gag agc aat tat agc tac tgc ctg agc agc cgc ctg 624Gln Ala Tyr Lys Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu 195 200 205 agg gtc tct gct acc ttc tgg cac aat cct cga aac cac ttc cgc tgc 672Arg Val Ser Ala Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys 210 215 220 caa gtg cag ttc cat ggg ctt tca gag gag gac aag tgg cca gag ggc 720Gln Val Gln Phe His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly 225 230 235 240 tca ccc aaa cct gtc aca cag aac atc agt gca gag gcc tgg ggc cga 768Ser Pro Lys Pro Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg 245 250 255 gca gac tgt gga atc act tca gca tcc tat cat cag ggg gtt ctg tct 816Ala Asp Cys Gly Ile Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser 260 265 270 gca acc atc ctc tat gag atc cta ctg ggg aag gcc acc cta tat gct 864Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 275 280 285 gtg ctg gtc agt ggc ctg gtg ctg atg gcc atg gtc aag aga aaa aat 912Val Leu Val Ser Gly Leu Val Leu Met Ala Met Val Lys Arg Lys Asn 290 295 300 tcc tga 918Ser 305 57305PRTmouse 57Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 Thr Gly Gly Asn Ser Gln Asn Thr Leu Tyr Phe Gly Ala Gly Thr Arg 115 120 125 Leu Ser Val Leu Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser 130 135 140 Leu Phe Glu Pro Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr 145 150 155 160 Leu Val Cys Leu Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser 165 170 175 Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro 180 185 190 Gln Ala Tyr Lys Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu 195 200 205 Arg Val Ser Ala Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys 210 215 220 Gln Val Gln Phe His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly 225 230 235 240 Ser Pro Lys Pro Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg 245 250 255 Ala Asp Cys Gly Ile Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser 260 265 270 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 275 280 285 Val Leu Val Ser Gly Leu Val Leu Met Ala Met Val Lys Arg Lys Asn 290 295 300 Ser 305 58305PRTmouse 58Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 Thr Gly Gly Asn Ser Gln Asn Thr Leu Tyr Phe Gly Ala Gly Thr Arg 115 120 125 Leu Ser Val Leu Glu Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser 130 135 140 Leu Phe Glu Pro Ser Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr 145 150 155 160 Leu Val Cys Leu Ala Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser 165 170 175 Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro 180 185 190 Gln Ala Tyr Lys Glu Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu 195 200 205 Arg Val Ser Ala Thr Phe Trp His Asn Pro Arg Asn His Phe Arg Cys 210 215 220 Gln Val Gln Phe His Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly 225 230 235 240 Ser Pro Lys Pro Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg 245 250 255 Ala Asp Cys Gly Ile Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser 260 265 270 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 275 280 285 Val Leu Val Ser Gly Leu Val Leu Met Ala Met Val Lys Arg Lys Asn 290 295 300 Ser 305 59903DNAArtificial sequenceSynthetic polynucleotide 59atg ctg tac tct ctc ctt gcc ttt ctc ctg ggc atg ttc ttg ggt gtt 48Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 agt gct cag act atc cat caa tgg cca gtt gcc gag atc aag gct gtg 96Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 ggc agc cca ctg tct ctg ggg tgt acc ata aag ggg aaa tca agc cct 144Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 aac ctc tac tgg tac tgg cag gcc aca gga ggc acc ctc cag caa ctc 192Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 ttc tac tct att act gtt ggc cag gta gag tcg gtg gtg caa ctg aac 240Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 ctc tca gct tcc agg ccg aag gac gac caa ttc atc cta agc acg gag 288Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 aag ctg ctt ctc agc cac tct ggc ttc tac ctc tgt gcc tgg agt cta 336Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 gaa ggt gaa cag tac ttc ggt ccc ggc acc agg ctc acg gtt tta gag 384Glu Gly Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Leu Glu 115 120 125 gat ctg aga aat gtg act cca ccc aag gtc tcc ttg ttt gag cca tca 432Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro Ser 130 135 140 aaa gca gag att gca aac aaa caa aag gct acc ctc gtg tgc ttg gcc 480Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu Ala 145 150 155 160 agg ggc ttc ttc cct gac cac gtg gag ctg agc tgg tgg gtg aat ggc 528Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn Gly 165 170 175 aag gag gtc cac agt ggg gtc agc acg gac cct cag gcc tac aag gag 576Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys Glu 180 185 190 agc aat tat agc tac tgc ctg agc agc cgc ctg agg gtc tct gct acc 624Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr 195 200 205 ttc tgg cac aat cct cga aac cac ttc cgc tgc caa gtg cag ttc cat 672Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe His 210 215 220 ggg ctt tca gag gag gac aag tgg cca gag ggc tca ccc aaa cct gtc 720Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro Val 225 230 235 240 aca cag aac atc agt gca gag gcc tgg ggc cga gca gac tgt gga atc 768Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Ile 245 250 255 act tca gca tcc tat cat cag ggg gtt ctg tct gca acc atc ctc tat 816Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr 260 265 270 gag atc cta ctg ggg aag gcc acc cta tat gct gtg ctg gtc agt ggc 864Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Gly 275 280 285 ctg gtg ctg atg gcc atg gtc aag aaa aaa aat tcc tga 903Leu Val Leu Met Ala Met Val Lys Lys Lys Asn Ser 290 295 300 60300PRTArtificial sequenceSynthetic Construct 60Met Leu Tyr Ser Leu Leu Ala Phe Leu Leu Gly Met Phe Leu Gly Val 1 5 10 15 Ser Ala Gln Thr Ile His Gln Trp Pro Val Ala Glu Ile Lys Ala Val 20 25 30 Gly Ser Pro Leu Ser Leu Gly Cys Thr Ile Lys Gly Lys Ser Ser Pro 35 40 45 Asn Leu Tyr Trp Tyr Trp Gln Ala Thr Gly Gly Thr Leu Gln Gln Leu 50 55 60 Phe Tyr Ser Ile Thr Val Gly Gln Val Glu Ser Val Val Gln Leu Asn 65 70 75 80 Leu Ser Ala Ser Arg Pro Lys Asp Asp Gln Phe Ile Leu Ser Thr Glu 85 90 95 Lys Leu Leu Leu Ser His Ser Gly Phe Tyr Leu Cys Ala Trp Ser Leu 100 105 110 Glu Gly Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Leu Glu 115 120 125 Asp Leu Arg Asn Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro Ser 130 135 140 Lys Ala Glu Ile Ala Asn Lys Gln Lys Ala Thr Leu Val Cys Leu Ala 145 150 155 160 Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn Gly 165 170 175 Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys Glu 180 185 190 Ser Asn Tyr Ser Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr 195 200 205 Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe His 210 215 220 Gly Leu Ser Glu Glu Asp Lys Trp Pro Glu Gly Ser Pro Lys Pro Val 225 230 235 240 Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Ile 245 250 255 Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr 260 265 270 Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Gly 275 280 285 Leu Val Leu Met Ala Met Val Lys Lys Lys Asn Ser 290 295 300 61825DNAmouseCDS(1)..(825)Sequence coding for V alpha 14 from hybridomas 15 61atg gac aag atc ctg aca gca tcg ttt tta ctc cta ggc ctt cac cta 48Met Asp Lys Ile Leu Thr Ala Ser Phe Leu Leu Leu Gly Leu His Leu 1 5 10 15 gct ggg gtg aat ggc cag cag aag gag aaa cat gac cag cag cag gtg 96Ala Gly Val Asn Gly Gln Gln Lys Glu Lys His Asp Gln Gln Gln Val 20 25 30 aga caa agt ccc caa tct ctg aca gtc tgg gaa gga gga acc aca gtt 144Arg Gln Ser Pro Gln Ser Leu Thr Val Trp Glu Gly Gly Thr Thr Val 35 40 45 ctg acc tgc agt tat gag gac agc act ttt aac tac ttc cca tgg tac 192Leu Thr Cys Ser Tyr Glu Asp Ser Thr Phe Asn Tyr Phe Pro Trp Tyr 50 55 60 caa cag ttc cct ggg gaa ggc cct gca ctt ctg ata tcc ata ctt tca 240Gln Gln Phe Pro Gly Glu Gly Pro Ala Leu Leu Ile Ser Ile Leu Ser 65 70 75 80 gtg tcc gat aaa aag gaa gat gga cga ttc aca acc ttc ttc aat aaa 288Val Ser Asp Lys Lys Glu Asp Gly Arg Phe Thr Thr Phe Phe Asn Lys 85 90 95 agg gag aaa aag ctc tcc ttg cac atc ata gac tct cag cct gga gac 336Arg Glu Lys Lys Leu Ser Leu His Ile Ile Asp Ser Gln Pro Gly Asp 100 105 110 tca gcc acc tac ttc tgt gca gca agt gtg ggt gcc aag ctc aca ttc 384Ser Ala Thr Tyr Phe Cys Ala Ala Ser Val Gly Ala Lys Leu Thr Phe 115 120 125 gga ggg gga aca agg tta acg gtc aga ccc gac atc cag aac cca gaa 432Gly Gly Gly Thr Arg Leu Thr Val Arg Pro Asp Ile Gln Asn Pro Glu 130 135 140 cct gct gtg tac cag tta aaa gat cct cgg tct cag gac agc acc ctc 480Pro Ala Val Tyr Gln Leu Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu 145 150 155 160 tgc ctg ttc acc gac ttt gac tcc caa atc aat gtg ccg aaa acc atg 528Cys Leu Phe Thr Asp Phe Asp Ser Gln Ile Asn Val Pro Lys Thr Met 165 170 175 gaa tct gga acg ttc atc act gac aaa act gtg ctg gac atg aaa gct 576Glu Ser Gly Thr Phe Ile Thr Asp Lys Thr Val Leu Asp Met Lys Ala 180 185 190 atg gat tcc aag agc aat ggg gcc att gcc tgg agc aac cag aca agc 624Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser 195 200 205 ttc acc tgc caa gat atc ttc aaa gag acc aac gcc acc tac ccc agt 672Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser 210 215 220 tca gac gtt ccc tgt gat gcc acg ttg act gag aaa agc ttt gaa aca 720Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr 225 230 235 240 gat atg aac cta aac ttt caa aac ctg tca gtt atg gga ctc cga atc 768Asp Met Asn Leu Asn Phe Gln Asn Leu Ser Val Met Gly Leu Arg Ile 245 250 255 ctc ctg ctg aaa gta gcc gga ttt aac ctg ctc atg acg ctg agg ctg 816Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu 260 265 270 tgg tcc tga 825Trp Ser 62274PRTmouse 62Met Asp Lys Ile Leu Thr Ala Ser Phe Leu Leu Leu Gly

Leu His Leu 1 5 10 15 Ala Gly Val Asn Gly Gln Gln Lys Glu Lys His Asp Gln Gln Gln Val 20 25 30 Arg Gln Ser Pro Gln Ser Leu Thr Val Trp Glu Gly Gly Thr Thr Val 35 40 45 Leu Thr Cys Ser Tyr Glu Asp Ser Thr Phe Asn Tyr Phe Pro Trp Tyr 50 55 60 Gln Gln Phe Pro Gly Glu Gly Pro Ala Leu Leu Ile Ser Ile Leu Ser 65 70 75 80 Val Ser Asp Lys Lys Glu Asp Gly Arg Phe Thr Thr Phe Phe Asn Lys 85 90 95 Arg Glu Lys Lys Leu Ser Leu His Ile Ile Asp Ser Gln Pro Gly Asp 100 105 110 Ser Ala Thr Tyr Phe Cys Ala Ala Ser Val Gly Ala Lys Leu Thr Phe 115 120 125 Gly Gly Gly Thr Arg Leu Thr Val Arg Pro Asp Ile Gln Asn Pro Glu 130 135 140 Pro Ala Val Tyr Gln Leu Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu 145 150 155 160 Cys Leu Phe Thr Asp Phe Asp Ser Gln Ile Asn Val Pro Lys Thr Met 165 170 175 Glu Ser Gly Thr Phe Ile Thr Asp Lys Thr Val Leu Asp Met Lys Ala 180 185 190 Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser 195 200 205 Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser 210 215 220 Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr 225 230 235 240 Asp Met Asn Leu Asn Phe Gln Asn Leu Ser Val Met Gly Leu Arg Ile 245 250 255 Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu 260 265 270 Trp Ser 63274PRTmouse 63Met Asp Lys Ile Leu Thr Ala Ser Phe Leu Leu Leu Gly Leu His Leu 1 5 10 15 Ala Gly Val Asn Gly Gln Gln Lys Glu Lys His Asp Gln Gln Gln Val 20 25 30 Arg Gln Ser Pro Gln Ser Leu Thr Val Trp Glu Gly Gly Thr Thr Val 35 40 45 Leu Thr Cys Ser Tyr Glu Asp Ser Thr Phe Asn Tyr Phe Pro Trp Tyr 50 55 60 Gln Gln Phe Pro Gly Glu Gly Pro Ala Leu Leu Ile Ser Ile Leu Ser 65 70 75 80 Val Ser Asp Lys Lys Glu Asp Gly Arg Phe Thr Thr Phe Phe Asn Lys 85 90 95 Arg Glu Lys Lys Leu Ser Leu His Ile Ile Asp Ser Gln Pro Gly Asp 100 105 110 Ser Ala Thr Tyr Phe Cys Ala Ala Ser Val Gly Ala Lys Leu Thr Phe 115 120 125 Gly Gly Gly Thr Arg Leu Thr Val Arg Pro Asp Ile Gln Asn Pro Glu 130 135 140 Pro Ala Val Tyr Gln Leu Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu 145 150 155 160 Cys Leu Phe Thr Asp Phe Asp Ser Gln Ile Asn Val Pro Lys Thr Met 165 170 175 Glu Ser Gly Thr Phe Ile Thr Asp Lys Thr Val Leu Asp Met Lys Ala 180 185 190 Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser 195 200 205 Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser 210 215 220 Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr 225 230 235 240 Asp Met Asn Leu Asn Phe Gln Asn Leu Ser Val Met Gly Leu Arg Ile 245 250 255 Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu 260 265 270 Trp Ser 64807DNAmouseCDS(1)..(807)Sequence coding for V alpha 12 from hybridomas 48 64atg cgt cct gtc acc tcc tca gtt ctc gtg ctc ctc cta atg ctc aga 48Met Arg Pro Val Thr Ser Ser Val Leu Val Leu Leu Leu Met Leu Arg 1 5 10 15 agg agc aat gga gac tca gtg acc cag aca gaa ggc ctg gtc act ctc 96Arg Ser Asn Gly Asp Ser Val Thr Gln Thr Glu Gly Leu Val Thr Leu 20 25 30 acc gag ggg ttg cct gtg atg ctg aac tgc acc tat cag act gct tac 144Thr Glu Gly Leu Pro Val Met Leu Asn Cys Thr Tyr Gln Thr Ala Tyr 35 40 45 tca act ttc ctt ttc tgg tat gtg caa cat ctc aat gaa gcc cct aaa 192Ser Thr Phe Leu Phe Trp Tyr Val Gln His Leu Asn Glu Ala Pro Lys 50 55 60 cta ctc ctg aag agc tcc aca gac aac aag agg acc gag cac caa ggg 240Leu Leu Leu Lys Ser Ser Thr Asp Asn Lys Arg Thr Glu His Gln Gly 65 70 75 80 ttc cac gcc act ctc cat aag agc agc agc tcc ttc cat ctg cag aag 288Phe His Ala Thr Leu His Lys Ser Ser Ser Ser Phe His Leu Gln Lys 85 90 95 tcc tca gcg cag ctg tca gac tct gcc ctg tac tac tgt gct ctg agt 336Ser Ser Ala Gln Leu Ser Asp Ser Ala Leu Tyr Tyr Cys Ala Leu Ser 100 105 110 gat caa gga ggg tct gcg aag ctc atc ttt ggg gag ggg aca aag ctg 384Asp Gln Gly Gly Ser Ala Lys Leu Ile Phe Gly Glu Gly Thr Lys Leu 115 120 125 aca gtg agc tca tac atc cag aac cca gaa cct gct gtg tac cag tta 432Thr Val Ser Ser Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu 130 135 140 aaa gat cct cgg tct cag gac agc acc ctc tgc ctg ttc acc gac ttt 480Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe 145 150 155 160 gac tcc caa atc aat gtg ccg aaa acc atg gaa tct gga acg ttc atc 528Asp Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile 165 170 175 act gac aaa act gtg ctg gac atg aaa gct atg gat tcc aag agc aat 576Thr Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn 180 185 190 ggg gcc att gcc tgg agc aac cag aca agc ttc acc tgc caa gat atc 624Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile 195 200 205 ttc aaa gag acc aac gcc acc tac ccc agt tca gac gtt ccc tgt gat 672Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp 210 215 220 gcc acg ttg acc gag aaa agc ttt gaa aca gat atg aac cta aac ttt 720Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe 225 230 235 240 caa aac ctg tca gtt atg gga ctc cga atc ctc ctg ctg aaa gta gcg 768Gln Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala 245 250 255 gga ttt aac ctg ctc atg acg ctg agg ctg tgg tcc tga 807Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 65268PRTmouse 65Met Arg Pro Val Thr Ser Ser Val Leu Val Leu Leu Leu Met Leu Arg 1 5 10 15 Arg Ser Asn Gly Asp Ser Val Thr Gln Thr Glu Gly Leu Val Thr Leu 20 25 30 Thr Glu Gly Leu Pro Val Met Leu Asn Cys Thr Tyr Gln Thr Ala Tyr 35 40 45 Ser Thr Phe Leu Phe Trp Tyr Val Gln His Leu Asn Glu Ala Pro Lys 50 55 60 Leu Leu Leu Lys Ser Ser Thr Asp Asn Lys Arg Thr Glu His Gln Gly 65 70 75 80 Phe His Ala Thr Leu His Lys Ser Ser Ser Ser Phe His Leu Gln Lys 85 90 95 Ser Ser Ala Gln Leu Ser Asp Ser Ala Leu Tyr Tyr Cys Ala Leu Ser 100 105 110 Asp Gln Gly Gly Ser Ala Lys Leu Ile Phe Gly Glu Gly Thr Lys Leu 115 120 125 Thr Val Ser Ser Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu 130 135 140 Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe 145 150 155 160 Asp Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile 165 170 175 Thr Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn 180 185 190 Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile 195 200 205 Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp 210 215 220 Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe 225 230 235 240 Gln Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala 245 250 255 Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 66268PRTmouse 66Met Arg Pro Val Thr Ser Ser Val Leu Val Leu Leu Leu Met Leu Arg 1 5 10 15 Arg Ser Asn Gly Asp Ser Val Thr Gln Thr Glu Gly Leu Val Thr Leu 20 25 30 Thr Glu Gly Leu Pro Val Met Leu Asn Cys Thr Tyr Gln Thr Ala Tyr 35 40 45 Ser Thr Phe Leu Phe Trp Tyr Val Gln His Leu Asn Glu Ala Pro Lys 50 55 60 Leu Leu Leu Lys Ser Ser Thr Asp Asn Lys Arg Thr Glu His Gln Gly 65 70 75 80 Phe His Ala Thr Leu His Lys Ser Ser Ser Ser Phe His Leu Gln Lys 85 90 95 Ser Ser Ala Gln Leu Ser Asp Ser Ala Leu Tyr Tyr Cys Ala Leu Ser 100 105 110 Asp Gln Gly Gly Ser Ala Lys Leu Ile Phe Gly Glu Gly Thr Lys Leu 115 120 125 Thr Val Ser Ser Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu 130 135 140 Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe 145 150 155 160 Asp Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile 165 170 175 Thr Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn 180 185 190 Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile 195 200 205 Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp 210 215 220 Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe 225 230 235 240 Gln Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala 245 250 255 Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 67804DNAmouseCDS(1)..(804)Sequence coding for V alpha 4 from hybridomas 45 67atg cag agg aac ctg gga gct gtg ctg ggg att ctg tgg gtg cag att 48Met Gln Arg Asn Leu Gly Ala Val Leu Gly Ile Leu Trp Val Gln Ile 1 5 10 15 tgc tgg gtg aga gga gat cag gtg gag cag agt cct tca gcc ctg agc 96Cys Trp Val Arg Gly Asp Gln Val Glu Gln Ser Pro Ser Ala Leu Ser 20 25 30 ctc cac gag gga acc ggt tct gct ctg aga tgc aat ttt acg acc acc 144Leu His Glu Gly Thr Gly Ser Ala Leu Arg Cys Asn Phe Thr Thr Thr 35 40 45 atg agg gct gtg cag tgg ttc caa cag aat tcc agg ggc agc ctc atc 192Met Arg Ala Val Gln Trp Phe Gln Gln Asn Ser Arg Gly Ser Leu Ile 50 55 60 aat ctg ttc tac ttg gct tca gga aca aag gag aat ggg agg tta aag 240Asn Leu Phe Tyr Leu Ala Ser Gly Thr Lys Glu Asn Gly Arg Leu Lys 65 70 75 80 tca aca ttc aat tct aag gag agc tac agc acc ctg cac atc agg gat 288Ser Thr Phe Asn Ser Lys Glu Ser Tyr Ser Thr Leu His Ile Arg Asp 85 90 95 gcc cag ctg gag gac tca ggc act tac ttc tgt gct gcc gta atg aat 336Ala Gln Leu Glu Asp Ser Gly Thr Tyr Phe Cys Ala Ala Val Met Asn 100 105 110 aca gaa ggt gca gat aga ctc acc ttt ggg aaa gga act cag ctg atc 384Thr Glu Gly Ala Asp Arg Leu Thr Phe Gly Lys Gly Thr Gln Leu Ile 115 120 125 atc cag ccc tac atc cag aac cca gaa cct gct gtg tac cag tta aaa 432Ile Gln Pro Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys 130 135 140 gat cct cgg tct cag gac agc acc ctc tgc ctg ttc acc gac ttt gac 480Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp 145 150 155 160 tcc caa atc aat gtg ccg aaa acc atg gaa tct gga acg ttc atc act 528Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr 165 170 175 gac aaa act gtg ctg gac atg aaa gct atg gat tcc aag agc aat ggg 576Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly 180 185 190 gcc att gcc tgg agc aac cag aca agc ttc acc tgc caa gat atc ttc 624Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe 195 200 205 aaa gag acc aac gcc acc tac ccc agt tca gac gtt ccc tgt gat gcc 672Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala 210 215 220 acg ttg act gag aaa agc ttt gaa aca gat atg aac cta aac ttt caa 720Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln 225 230 235 240 aac ctg tca gtt atg gga ctc cga atc ctc ctg ctg aaa gta gcc gga 768Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly 245 250 255 ttt aac ctg ctc atg acg ctg agg ctg tgg tcc tga 804Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 68267PRTmouse 68Met Gln Arg Asn Leu Gly Ala Val Leu Gly Ile Leu Trp Val Gln Ile 1 5 10 15 Cys Trp Val Arg Gly Asp Gln Val Glu Gln Ser Pro Ser Ala Leu Ser 20 25 30 Leu His Glu Gly Thr Gly Ser Ala Leu Arg Cys Asn Phe Thr Thr Thr 35 40 45 Met Arg Ala Val Gln Trp Phe Gln Gln Asn Ser Arg Gly Ser Leu Ile 50 55 60 Asn Leu Phe Tyr Leu Ala Ser Gly Thr Lys Glu Asn Gly Arg Leu Lys 65 70 75 80 Ser Thr Phe Asn Ser Lys Glu Ser Tyr Ser Thr Leu His Ile Arg Asp 85 90 95 Ala Gln Leu Glu Asp Ser Gly Thr Tyr Phe Cys Ala Ala Val Met Asn 100 105 110 Thr Glu Gly Ala Asp Arg Leu Thr Phe Gly Lys Gly Thr Gln Leu Ile 115 120 125 Ile Gln Pro Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys 130 135 140 Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp 145 150 155 160 Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr 165 170 175 Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly 180 185 190 Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe 195 200 205 Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala 210 215 220 Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln 225 230 235 240 Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly 245 250 255 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260

265 69267PRTmouse 69Met Gln Arg Asn Leu Gly Ala Val Leu Gly Ile Leu Trp Val Gln Ile 1 5 10 15 Cys Trp Val Arg Gly Asp Gln Val Glu Gln Ser Pro Ser Ala Leu Ser 20 25 30 Leu His Glu Gly Thr Gly Ser Ala Leu Arg Cys Asn Phe Thr Thr Thr 35 40 45 Met Arg Ala Val Gln Trp Phe Gln Gln Asn Ser Arg Gly Ser Leu Ile 50 55 60 Asn Leu Phe Tyr Leu Ala Ser Gly Thr Lys Glu Asn Gly Arg Leu Lys 65 70 75 80 Ser Thr Phe Asn Ser Lys Glu Ser Tyr Ser Thr Leu His Ile Arg Asp 85 90 95 Ala Gln Leu Glu Asp Ser Gly Thr Tyr Phe Cys Ala Ala Val Met Asn 100 105 110 Thr Glu Gly Ala Asp Arg Leu Thr Phe Gly Lys Gly Thr Gln Leu Ile 115 120 125 Ile Gln Pro Tyr Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys 130 135 140 Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp 145 150 155 160 Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr 165 170 175 Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly 180 185 190 Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe 195 200 205 Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala 210 215 220 Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln 225 230 235 240 Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly 245 250 255 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 7029PRThuman 70Ser Val Leu Leu Tyr Gln Lys Pro Asn Arg Asp Ile Cys Gln Ser Gly 1 5 10 15 Thr Ser Leu Lys Ile Gln Cys Val Ala Asp Ser Gln Val 20 25 7123PRThuman 71Val Ser Met Phe Trp Tyr Gln Gln Phe Gln Glu Gln Ser Leu Met Leu 1 5 10 15 Met Ala Thr Ala Asn Glu Gly 20 7219PRThuman 72Ser Glu Ala Thr Tyr Glu Ser Gly Phe Thr Lys Asp Lys Phe Pro Ile 1 5 10 15 Ser Arg Pro 7325PRThuman 73Asn Leu Thr Phe Ser Thr Leu Thr Val Asn Asn Ala Arg Pro Gly Asp 1 5 10 15 Ser Ser Ile Tyr Phe Cys Ser Ser Arg 20 25 7414DNAArtificial SequenceSynthetic polynucleotide 74tccacccaag gtct 14

Claims

1.-6. (canceled)

7. A method to treat and/or reduce the risk of atherosclerosis in an individual, the method comprising: immunizing the individual against one or more T cell receptors, the one or more T cell receptors comprising one or more a chains encoded by TRAV14, TRAV12, TRAV4 and/or a DNA sequence having at least 70% identity to TRAV14, TRAV12 or TRAV4 and/or one or more β chains encoded by TRBV 30, TRBV 31 and/or a DNA sequence having at least 70% identity to TRBV 30 or TRBV 31, wherein as a result of the immunizing, an immune response to the one or more T cell receptors is induced in the individual, thereby treating and/or reducing the risk of atherosclerosis in the individual.

8. The method of claim 7, wherein the immunizing is performed by administering to the individual an immunogenic fragment of CDR2 variable region of TCR TRBV 31, an immunogenic fragment of CDR2 variable region of TCR TRBV30, an immunogenic fragment of TCR TRAV14, an immunogenic fragment of TCR TRAV12 and/or, an immunogenic fragment of TCR TRAV4.

9. The method of claim 7, wherein the immunizing is performed by administering to the individual a peptide having at least 70% identity to sequence SEQ ID NO:1, SEQ ID NO:56, SEQ ID NO:58, or a combination thereof.

10. The method of claim 7, wherein the immunizing is performed by administering to the individual a protein having at least 70% identify to sequence SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, or a combination thereof.

11. (canceled)

12. A vaccine for treatment and/or reduction of the risk of atherosclerosis, the vaccine comprising an immunogenic agent for a T cell receptor comprising an α chain encoded by TRAV 14, an α chain encoded by TRAV 12, an α chain encoded by TRAV4, and/or an α chain encoded by a DNA sequence having at least 70% identity to TRAV 14, TRAV 12 or TRAV 4.

13. The vaccine of claim 12, wherein the T cell receptor further comprises a β chain encoded by TRBV 30, a β chain encoded by TRBV 31, and/or a β chain encoded by a DNA sequence having at least 70% identity to a peptide encoded by TRBV 30 or TRBV 31.

14. The vaccine of claim 13, wherein the agent is a peptide having at least 70% identity to a peptide encoded by TCR TRVB 31.

15. The vaccine of claim 14, wherein the agent is a peptide having at least 70% identity to sequence SEQ ID NO:1, SEQ ID NO:56 or SEQ ID NO:58 or a fragment thereof or a derivative thereof.

16. The vaccine of claim 13, wherein the agent is a peptide having at least 70% identity to TCR TRVB30.

17. The vaccine of claim 12, wherein the T cell receptor comprises an α chain encoded by TRAV 14 and the agent is a peptide having at least 70% identity to a protein encoded by TCR TRAV 14 (SEQ ID NO:63).

18. The vaccine of claim 17, wherein the agent is a protein having at least 70% identity to sequence SEQ ID NO:63.

19. The vaccine of claim 12, wherein the T cell receptor comprises an α chain encoded by TRAV 12 and the agent is a peptide having at least 70% identity to a protein encoded by TCR TRAV 12.

20. The vaccine of claim 19, wherein the agent is a protein having at least 70% identity to sequence SEQ ID NO:66.

21. The vaccine of claim 12, wherein the T cell receptor comprises an α chain encoded by TRAV4 and the agent is a peptide having at least 70% identity to a protein encoded by TCR TRAV4 (SEQ ID NO:69).

22. The vaccine of claim 21, wherein the agent is a protein having at least 70% identity to sequence SEQ ID NO:69.

23.-42. (canceled)

Images