Method for Prevention and Treatment of Salmonella Infection

Abstract

The present invention relates to a composition comprising bacteriophage SP-1, the bacteriophage capable of destroying Salmonella once being infected in Salmonella, as an active ingredient, and a method for prevention and treatment of Salmonella infection using the same. Bacteriophage SP-1, the active ingredient of the composition of the present invention, characteristically has the killing activity to Salmonella and has the genome represented by SEQ. ID. NO: 1.

Description

FIELD

[0001] The present invention relates to a composition applicable for prevention or treatment of Salmonella infection comprising bacteriophage that is capable of destroying Salmonella once infected to Salmonella as an active ingredient and a method for prevention and treatment of Salmonella infection by using the said composition. That is, the present invention relates to a composition used for the purpose of prevention or treatment of Salmonella infection and a method for prevention and treatment of Salmonella infection using the same.

BACKGROUND

[0002] Salmonella is similar to E. coli in the aspects of morphology or physiology but is categorized in an independent genus for the convenience in clinical use by the proposal of K. Kauffmann et al. Salmonella has been isolated from enteritis and gastroenteritis patients and from animals with diverse diseases since Salmonella choleraesuis was first isolated from a pig died of hog cholera by Salmon and Smith in 1885. Salmonella has also been isolated from health animals such as chicken, cow, pig, goat, dog, and cat and from our environment.

[0003] More than 2,000 serotypes of Salmonella have been reported so far and it can be largely divided into two groups, one of which is the group that has host specificity and the other of which is the group that does not have host specificity. Salmonella is a genus of rod-shaped, Gram-negative and non-spore-forming It is a parasite living in a variety of animals.

[0004] Salmonella infectious disease is developed in different forms. Enteritis is the most general form of Salmonella infection. Once infected with Salmonella, such symptoms as rough skin, anorexia, conjunctivitis, depression, pale feces, spleen enlargement, and even death are observed.

[0005] Various drugs have been used for the treatment of Salmonella infection. However, those drugs known so far cannot lead complete cure. So, it is more important to prevent the infection than to treat it.

[0006] Damage in livestock industry caused by Salmonella infection is rather huge. Therefore, it is an urgent request to develop a method for prevention and effective treatment of Salmonella infection.

[0007] The utilization of bacteriophage is now highly drawing our attention as an effective way of treating bacterial disease. In particular, our interests in bacteriophage grow with the preference of nature-friendly method. Bacteriophage is an extremely small microorganism infecting bacteria, which is generally called phage in short. Bacteriophage is an obligate intracellular parasite that multiplis inside bacteria by making use of some or all of the host biosynthetic machinery. Upon completion of the multiplication, offspring bacteriophages are coming out of the host cell with destroying the host bacteria. The infection of bacteriophage in bacteria is very unique and specific, so only specific bacteria can be infected with a specific bacteriophage. That is, there is a limitation in bacteria that can be infected with bacteriophage. Thus, bacteriophage can only kill specific target bacteria without effecting on any other bacteria.

[0008] Bacteriophage was first found in 1915 when English bacteriologist Twort was studying on the phenomenon that micrococcus colony was being melted clearly by some reasons. And also, French bacteriologist d'Herelle noticed that Shigella disentriae was melted by something in filtrate of dysentery patient's feces and afterwards he separated bacteriophage independently by the following study and named it bacteriophage which meant `eating bacteria`. Since then, bacteriophages corresponding to different pathogenic bacteria including Shigella, Salmonella and Vibrio cholerae have been continuously reported.

[0009] Owing to its capability of killing bacteria, bacteriophage has been in the center of our interest to fight with bacterial infection and studies followed thereon. However, since Flemming found out penicillin, antibiotics have been supplied and the study on bacteriophage has been limited in some east European countries and old Soviet Union. It was not until 2000 that the conventional antibiotics demonstrated their problems in use because of increasing antibiotic-resistant bacteria. So, once again, bacteriophage draws out attention as an alternative anti-bacterial agent that can take the place of the conventional antibiotics.

[0010] Therefore, the present inventors tried to develop a composition for prevention or treatment of Salmonella infection by using bacteriophage that can destroy Salmonella selectively and further tried to establish a method for prevention and treatment of Salmonella infection using the same. At last, the inventors isolated a proper bacteriophage from the nature and secured the gene sequence of its genome for the distinguishment from other bacteriophages. Then, the present inventors succeeded in developing a composition comprising the said bacteriophage as an active ingredient and further completed this invention by confirming that the said composition of the invention can be effectively used for prevention and treatment of Salmonella infection.

DISCLOSURE

Technical Problem

[0011] It is an object of the present invention to provide a novel bacteriophage capable of killing Salmonella selectively.

[0012] It is another object of the present invention to provide a composition usable for prevention of Salmonella infection comprising the said bacteriophage as an active ingredient which is capable of killing Salmonella selectively by infecting Salmonella and to provide a method for prevention of Salmonella infection using the same.

[0013] It is also an object of the present invention to provide a composition usable for treatment of Salmonella infection comprising the said bacteriophage as an active ingredient which is capable of killing Salmonella selectively by infecting Salmonella and to provide a method for treatment of Salmonella infection using the same.

[0014] It is further an object of the present invention to provide a disinfectant for treatment of Salmonella using the said composition.

[0015] It is also an object of the present invention to provide a drinking water additive using the said composition.

[0016] It is also an object of the present invention to provide a feed additive using the said composition.

Technical Solution

[0017] The present invention provides a composition comprising bacteriophage as an active ingredient which is capable of destroying Salmonella by infecting Salmonella, and a method for prevention and treatment of Salmonella infection by using the said composition.

[0018] Bacteriophage used as the active ingredient in the composition of the present invention is bacteriophage SP-1 having DNA represented by SEQ. ID. NO: 1 as its genome. Bacteriophage SP-1 was isolated by the present inventors and deposited at Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology on Jul. 30, 2010 (Accession No: KCTC 11737BP).

[0019] The present invention also provides a disinfectant, a drinking water additive, and a feed additive that can be used for prevention or treatment of Salmonella infection.

[0020] Bacteriophage SP-1 included in the composition of the present invention is able to kill Salmonella effectively, so that it can have a preventive and/or treating effect on diverse infectious diseases caused by Salmonella. Therefore, the composition of the present invention can be used for the purpose of prevention and treatment of disease caused by Salmonella.

[0021] The pharmaceutical composition of the present invention can be used for prevention and treatment of salmonellosis, the representative disease caused by Salmonella including enteritis, Bacteremia, Fowl typhoid, Pullorum disease, and cholera. The term "salmonellosis" in this invention generally indicates all the symptoms caused by Salmonella infection including fever, headache, diarrhea, vomiting, etc. The term "treat" or "treatment" in this description indicates (i) to suppress disease caused by Salmonella; and (ii) to relieve disease symptoms caused by Salmonella.

[0022] The representative Salmonella targeted by this invention is exemplified by Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Pullorum, Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Dubulin, and Salmonella Durby, but not always limited thereto.

[0023] The composition of the present invention can include pharmaceutically acceptable carriers such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but not always limited thereto. The composition of the present invention can additionally include lubricants, wetting agents, sweetening agents, flavors, emulsifiers, suspensions and preservatives.

[0024] The composition of the present invention contains bacteriophage SP-1 as an active ingredient. At this time, the bacteriophage SP-1 is included at the concentration of 1×10¹ pfu/mL-1×10³⁰ pfu/mL or 1×10¹ pfu/g-1×10³⁰ pfu/g, and more preferably at the concentration of 1×10⁴ pfu/mL-1×10¹⁵ pfu/mL or 1×10⁴ pfu/g-1×10¹⁵ pfu/g.

[0025] The composition of the present invention can be formulated by the method that can be performed by those in the art by using a pharmaceutically acceptable carrier and/or excipient in the form of unit dose or in multi-dose containers. The formulation can be in the form of solution, suspension, or emulsion in oil or water-soluble medium, extract, powder, granule, tablet or capsule. At this time, a dispersing agent or a stabilizer can be additionally included.

[0026] The composition of the present invention can be produced in the form of a disinfectant, a drinking water additive, and a feed additive, but not always limited thereto.

Advantageous Effect

[0027] The composition of the present invention and the method for prevention and treatment of Salmonella infection using the same have an advantage of high specificity against Salmonella, compared with other conventional chemical compositions and methods using thereof. That is, this composition does not have any effect on other useful resident flora and can be used only for the purpose of prevention and treatment of Salmonella infection. Thus, side effects are hardly accompanied. In general, when other chemicals such as the conventional antibiotics are used, general resident bacteria are also targeted and destroyed, resulting in the decrease of immunity in animals and bringing other side effects. In the meantime, the present invention provides an advantage of nature-friendly effect by using the composition containing natural bacteriophage as an active ingredient.

DESCRIPTION OF DRAWINGS

[0028] The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:

[0029] FIG. 1 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Enteritidis.

[0030] FIG. 2 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Gallinarum.

[0031] FIG. 3 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Pullorum.

[0032] FIG. 4 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Typhimurium.

[0033] FIG. 5 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Choleraesuis.

[0034] FIG. 6 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Dubulin.

[0035] FIG. 7 is a photograph showing the result of killing activity test with bacteriophage SP-1 to Salmonella Durby.

[0036] FIG. 8 is a graph illustrating the result of chick test. "Number" of Y axis indicates the number of dead chicks. "Control" indicates those chicks administered with Salmonella Gallinarum alone. "SP-1" indicates those chicks treated with bacteriophage SP-1 of the present invention and "Gentamycin" indicates those chicks treated with gentamycin.

MODE FOR INVENTION

[0037] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

[0038] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

Example 1

Isolation of Bacteriophage that can Destroy Salmonella

[0039] Bacteriophage that can destroy Salmonella was isolated from the nature or from animal samples. In the bacteriophage isolation, Salmonella Enteritidis was used as the representative Salmonella. This Salmonella Enteritidis (SE51) was isolated previously by the present inventors and then identified as Salmonella Enteritidis by the inventors.

[0040] Collected samples were loaded in TSB (Tryptic Soy Broth) medium (casein digest, 17 g/L; soybean digest, 3 g/L; dextrose, 2.5 g/L; NaCl, 5 g/L; dipotassium phosphate, 2.5 g/L) inoculated with Salmonella Enteritidis (1/1000), followed by shaking culture for 3-4 hours at 37° C. Upon completion of the culture, centrifugation was performed at 8,000 rpm for 20 minutes and the supernatant was recovered. Salmonella was inoculated in the recovered supernatant (1/1000), followed by shaking culture for 3-4 hours at 37° C. This procedure was repeated 5 times in total in order to increase bacteriophage titer if bacteriophage was included in the sample. After repeating the process 5 times, the culture solution proceeded to centrifugation at 8,000 rpm for 20 minutes. Then, the supernatant was filtered using 0.45 nm filter. The obtained filtrate was investigated by using general spot assay to see whether bacteriophage that could kill Salmonella was included.

[0041] Spot assay was performed as follows. Salmonella was inoculated in TSB medium (1/1000), followed by shaking culture at 37° C. overnight. Then, 3 mL of the obtained Salmonella culture solution (OD₆₀₀: 2.0) was spread on TSA (Tryptic Soy Agar) plate medium (casein digest, 15 g/L; soybean digest, 5 g/L; NaCl, 5 g/L; agar, 15 g/L). The plate medium stayed on clean bench for about 30 minutes to let the spread solution is dried. After drying, 10 nl of the prepared filtrate was loaded on the plate medium whereon Salmonella was spread, which was dried as it is for 30 minutes. After drying, the plate medium was standing cultured at 37° C. for a day. It was then investigated whether the clear zone was formed on the spot where the filtrate was loaded. If the clear zone was formed thereon, it suggested that bacteriophage that could kill Salmonella was included therein. According to this procedure, the filtrate containing bacteriophage that could destroy Salmonella could be obtained.

[0042] Pure bacteriophage was isolated from the filtrate confirmed to contain the bacteriophage capable of killing Salmonella. The isolation of pure bacteriophage was performed by plaque assay. More precisely, one of plaques formed from plaque assay was recovered by using a sterilized tip, which was then added to Salmonella culture solution, followed by culture for 4-5 hours. Upon completion of the culture, centrifugation was performed at 8,000 for 20 minutes to obtain supernatant. Salmonella culture solution was added to the obtained supernatant at the ratio of 1:50, followed by further culture for 4-5 hours. To increase the number of bacteriophage, this procedure was repeated at least 5 times and then centrifugation was performed at 8,000 for 20 minutes to obtain supernatant. Plaque assay was performed with the supernatant. Generally, pure bacteriophage separation cannot be accomplished simply by performing the above procedure once. Thus, the previous steps were repeated again using one of plaques formed from plaque assay. After repeating the procedure at least 5 times, the solution comprising pure bacteriophage was obtained. The repetition of this pure bacteriophage separation processes was not finished until the sizes and shapes of plaques were all similar. Pure bacteriophage separation was confirmed at last by observing under electron microscope. If pure bacteriophage was not confirmed, the above processes were repeated again.

[0043] The preparation of bacteriophage suspension was performed as follows. Salmonella culture solution was added to the solution comprising pure bacteriophage at the ratio of 1:50, followed by culture for 4-5 hours. Upon completion of the culture, centrifugation was performed at 8,000 rpm for 20 minutes to obtain supernatant. To obtain enough amount of bacteriophage, the said process was repeated 5 times in total. The final supernatant was filtered with 0.45 μm filter, followed by precipitation by using polyethylene glycol (PEG). Particularly, PEG and NaCl were added to 100 mL of the filtrate (10% PEG 8000/0.5 M NaCl), which stood at room temperature for 2-3 hours. Then, centrifugation was performed at 8,000 rpm for 30 minutes to obtain bacteriophage precipitate. The obtained bacteriophage precipitate was suspended in 5 mL of buffer (10 mM Tris-HCl, 10 mM MgSO₄, 0.1% Gelatin, pH 8.0). This suspension was called bacteriophage suspension or bacteriophage solution.

[0044] At last, purified pure bacteriophage was obtained and this bacteriophage was named bacteriophage SP-1, which was then deposited at Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology on Jul. 30, 2010 (Accession No: KCTC 11737BP).

Example 2

Extraction of Bacteriophage SP-1 Genome and Sequencing Thereof

[0045] Bacteriophage SP-1 genome was extracted as follows using the bacteriophage suspension obtained in Example 1. To eliminate Salmonella DNA and RNA which might be included in the suspension, DNase I and RNase A were added to 10 mL of the bacteriophage suspension (200 U each), which stood at 37° C. for 30 minutes. 30 minutes later, to neutralize DNase I and RNase A activity, 500 μL of 0.5 M ethylenediaminetetraacetic acid (EDTA) was added, which stood for 10 minutes. The solution stood at 65° C. for another 10 minutes, then 100 μL of proteinase K (20 mg/mL) was added, followed by reaction at 37° C. for 20 minutes to break the outer wall of the bacteriophage. Then, 500 μL of 10% sodium dodecyl sulfate (SDS) solution was added thereto, followed by reaction at 65° C. for one hour. One hour later, 10 μL of the mixed solution comprising phenol:chloroform:isoamylalcohol at the concentration ratio of 25:24:1 was added thereto and the solution was well mixed. Centrifugation was performed at 13,000 rpm for 15 minutes to separate layers, among which the upper most layer was obtained. Isopropyl alcohol was added to the obtained layer at the volume ratio of 1.5, followed by centrifugation at 13,000 rpm for 10 minutes to precipitate genome. The precipitate was recovered, to which 70% ethanol was added, flowed by centrifugation at 13,000 rpm for 10 minutes. The washed precipitate was collected and vacuum-dried, which was then dissolved in 100 μL of water.

[0046] Sequencing was performed with the obtained genome as follows. Particularly, gene fragments were obtained by digesting gDNA, the bacteriophage SP-1 genome, with Hpa II according to the conventional method. Linear vector fragment which would be used for the insertion of the gene fragments was also prepared by treating pBluescript II SK(+) phagemid vector (Stratagene) with Cla I. The prepared gene fragments and the vector fragment were ligated by using T4 ligase according to the conventional method. The resultant recombinant vector containing the bacteriophage SP-1 gene fragment was introduced into Top 10F' (Invitrogen), a kind of E. coli, by eletroporation (electro-transformation). The transformant was selected on agar plate medium containing X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside), IPTG (isopropyl β-D-1-thiogalactopyranoside) and ampicillin by the conventional Blue-White colony selection method. The selected single colony was inoculated on the culture medium supplemented with ampicillin, followed by shaking culture for overnight. Plasmid was extracted from the cultured cells by using plasmid purification kit (iNtRON Biotechnology, Korea). The extracted plasmid proceeded to electrophoresis using 0.8% agarose gel to measure the size. Finally the recombinant plasmid was obtained. The clone containing the obtained plasmid was cultured again and then plasmid was extracted from the cultured cells again. Sequencing with the extracted plasmid was performed by using M13 forward primer and M13 reverse primer which have been generally used. The sequence of each primer is as follows.

TABLE-US-00001 TABLE 1 Primer Sequence M13 forward primer GTCGTGACTGGGAAAACCCTGGCG SEQ. ID. NO: 2 M13 reverse primer TCCTGTGTGAAATTGTTATCCGCT SEQ. ID. NO: 3

[0047] Partial gene sequences of the bacteriophage SP-1 genome were identified by the above method, based on which total gene sequencing was performed according to the conventional method. The identified bacteriophage SP-1 gene sequence was represented by SEQ. ID. NO: 1.

[0048] Based on the gene sequence of bacteriophage SP-1, similarity to those sequences of the conventional bacteriophages was investigated by using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). As a result, the nucleotide sequence of bacteriophage SP-1 had high similarity to those of bacteriophage SS3e (GenBank Accession No. AY730274) and Salmonella phage SETP3 (GenBank Accession No. EF177456). Particularly, the nucleotide sequence of the bacteriophage SP-1 genome was closer to the nucleotide sequence of the bacteriophage SS3e. However, the size of the bacteriophage SP-1 genome was 43285 bp, while the size of the bacteriophage SS3e genome was 40794 bp, suggesting that the bacteriophage SP-1 genome was larger. The additional nucleotides in the bacteriophage SP-1 showed high similarity to some of the Salmonella phage SETP3 genome sequence. Among the additional nucleotides in the bacteriophage SP-1, two open reading frames (ORF) were identified.

[0049] These ORFs had no similarity to ORFs of the bacteriophage SS3e genome. Instead, they demonstrated similarity to those of the Salmonella phage SETP3 genome. However, while those ORFs were similar to the ORF like sequence in the Salmonella phage SETP3, one of them showed higher similarity to the ORF found in the E. coli phage Klindl genome (GenBank Accession No. GU196279.1).

[0050] The above results indicate that the genome of the bacteriophage SP-1 shows combined characteristics of both bacteriophage SS3e and Salmonella phage SETP3. Moreover, it could be assumed that other additional characteristics could be included except the said combined characteristics. Therefore, it can be concluded that the bacteriophage SP-1 is a novel bacteriophage which is completely different from any of the conventional bacteriophages.

Example 3

Killing Activity of Bacteriophage SP-1 to Various Salmonella Bacteria

[0051] Various Salmonella bacteria were used to investigate killing activity of the selected bacteriophage SP-1. For the investigation, clear zone formation was first observed by spot assay by the same manner as described in Example 1. Salmonella bacteria used for this assay were Salmonella Enteritidis (SE51), Salmonella Gallinarum (SG36), Salmonella Pullorum (SP-11), Salmonella Typhimurium (ST2), Salmonella Choleraesuis (ATCC 9120), Salmonella Dubulin (BA584), and Salmonella Durby. Salmonella Choleraesuis (ATCC 9120) was the standard strain, and Salmonella Dubulin (BA584) and Salmonella Durby were the isolates distributed from National Veterinary Research & Quarantine Service Korea. Salmonella Enteritidis (SE51), Salmonella Gallinarum (SG36), Salmonella Pullorum (SP-11), and Salmonella Typhimurium (ST2) were the isolates isolated and identified by the inventors. The results of the related experiments are shown in FIG. 1-FIG. 7. As shown in FIG. 1-FIG. 7, the bacteriophage SP-1 was confirmed to have Salmonella killing activity against various Salmonella bacteria. In addition, killing activity of the bacteriophage SP-1 to Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Streptococcus agalactiae, Streptococcus mitis, Streptococcus uberis and Pseudomonas aeruginosa was further investigated. As a result, it was confirmed that the bacteriophage SP-1 did not have killing activity against those bacteria.

[0052] From the above results, it was confirmed that the bacteriophage SP-1 can be used as an active ingredient of the composition formulated for the purpose of prevention and treatment of Salmonella infection.

Example 4

Application Example of Bacteriophage SP-1 for Prevention of Salmonella Infection

[0053] 100 μL of bacteriophage SP-1 suspension (1×10⁸ pfu/mL) was loaded to 7 tubes each containing 9 mL of TSB medium. Another 7 tubes containing 9 mL of TSB medium alone were also prepared. One of those 7 tubes containing medium and bacteriophage suspension and one of those 7 tubes containing medium alone are paired for one experimental group. To the prepared 7 experimental groups were added Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Pullorum, Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Dubulin, and Salmonella Durby culture solution (OD₆₀₀: 0.5), respectively. After Salmonella bacteria were added to those tubes, they were all transferred to 37° C. incubator, followed by shaking culture, during which the growth of Salmonella was observed. As shown in Table 2, the growth of Salmonella was suppressed in the tubes containing bacteriophage SP-1 suspension in every experimental group. In the meantime, the growth of Salmonella was not inhibited in the bacteriophage free tubes.

TABLE-US-00002 TABLE 2 Suppression of Salmonella growth OD₆₀₀ Culture culture culture 0 min. 15 min. 60 min Salmonella Bacteriophage- 0.5 0.7 1.5 Enteritidis Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.65 1.4 Gallinarum Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.8 1.6 Pullorum Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.75 1.5 Typhimurium Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.65 1.3 Choleraesuis Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.7 1.35 Dubulin Bacteriophage+ 0.5 0.1 0.05 Salmonella Bacteriophage- 0.5 0.7 1.5 Durby Bacteriophage+ 0.5 0.1 0.05

[0054] The above results indicate that the bacteriophage SP-1 of the present invention not only suppresses the growth of various Salmonella bacteria but also even destroys them, so that it can be used as an active ingredient for the composition formulated for the purpose of prevention of Salmonella infection.

Example 5

Treatment Example 1 of Salmonella Infectious Disease Using Bacteriophage SP-1

[0055] 4 chicks at 2 days of age were administered with 1×10⁷ cfu of Salmonella Enteritidis to induce infection forcefully (animal 1-1, animal 1-2, animal 1-3, animal 1-4). Another 4 chicks at 2 days of age were administered with 1×10⁷ cfu of Salmonella Choleraesuis to induce infection forcefully (animal 2-1, animal 2-2, animal 2-3, animal 2-4). Animal 1-1, animal 1-2, animal 2-1, and animal 2-2 were forced to eat the feed containing bacteriophage SP-1 (mixed at the concentration of 1×10⁹ pfu/g feed), while animal 1-3, animal 1-4, animal 2-3, and animal 2-4 were given with bacteriophage free feed. 2 days later, the numbers of Salmonella bacteria in feces and caecum contents were counted. To avoid contamination by other bacteria, Salmonella selective medium (Rambach agar plate; Merck) was used for the counting. As a result, in those animals fed with bacteriophage SP-1 mixed feed, at least 1000 times less Salmonella was detected in feces, compared with that in the control. In caecum contents, at least 200 times less Salmonella was detected in those animals fed with bacteriophage SP-1 mixed feed.

[0056] From the above results, it was confirmed that the bacteriophage SP-1 of the present invention was very effective in treating Salmonella infection.

Example 6

Treatment Example 2 of Salmonella Infectious Disease Using Bacteriophage SP-1

[0057] In this example, it was investigated how much bacteriophage SP-1 could reduce the death of chicks infected with Salmonella. Salmonella Gallinarum, which was the pathogen of fowl typhoid, was used for the experiment. 10 broiler chickens at 2 days of age were grouped as one, and three groups were prepared in total. All the groups were orally administered with Salmonella Gallinarum suspension (1×10⁷ cfu). 10 hours after the administration, the experimental group chicks were orally administered with bacteriophage SP-1 suspension (1×10⁹ pfu). Bacteriophage SP-1 suspension was additionally administered orally twice at 24 hours interval after the first administration. The positive control group was prepared by administering the antibiotics, gentamycin (5 mg/kg), to the animals via muscular injection 10 hours after the Salmonella Gallinarum administration. The gentamycin injection was also repeated twice. The remaining one group was prepared as the negative control which was not treated with anything. As shown in FIG. 8, the lifespan of the animal treated with bacteriophage SP-1 suspension was significantly extended, compared with that of the negative control. Even if complete cure might not be achieved, significant treatment effect of bacteriophage SP-1, which was shown as significantly extended lifespan, was not in doubt, considering that, unlike the natural infection, excessive amount of bacteria was forcefully administered directly to the animal to cause infectious disease at a severe level.

[0058] From the above results, it was confirmed that the bacteriophage SP-1 of the present invention was very effective in treating Salmonella infection.

Example 7

Preparation of Feed Additive and Feed

[0059] Feed additive containing bacteriophage SP-1 at the concentration of 1×10⁹ pfu/g was prepared with bacteriophage SP-1 suspension. The preparation method was as follows. Bacteriophage SP-1 suspension was evenly sprayed on maltodextran at the proper weight ratio, which was then vacuum-dried at room temperature, followed by pulverization into fine powders. Silica was added thereto at the weight ratio of 5% and the mixture was well mixed. For the drying process, either reduced pressure drying, drying at elevated temperature, or freeze drying can be used. For the control, bacteriophage free feed additive was also prepared by spraying buffer which was used for the preparation of bacteriophage suspension instead of bacteriophage suspension.

[0060] The above two feed additives were mixed with feed for pig respectively at the weight ratio of 1:1,000. As a result, two different kinds of feeds for pig were prepared. Another two different feed additives were also prepared by the same manner as described above, which were mixed with feed for poultry farming respectively at the weight ratio of 1:1,000. As a result, two different feeds for poultry farming were prepared.

Example 8

Preparation of Drinking Water Additive and Disinfectant

[0061] Drinking water additive and disinfectant are prepared by the same method because both are formulated in the same form and have only difference in their use. Drinking water additive (or disinfectant) containing bacteriophage SP-1 at the concentration of 1×10⁹ pfu/mL was prepared. The method of preparation of drinking water additive (or disinfectant) is as follows. Bacteriophage SP-1 was added to the buffer which was generally used for the preparation of bacteriophage suspension at the concentration of 1×10⁹ pfu/mL and well mixed. For the control, the buffer itself was used as the bacteriophage free drinking water additive (or disinfectant).

[0062] The prepared two different drinking water additives (or disinfectants) were diluted with water at the ratio of 1:1,000, resulting in the final drinking water additive or disinfectant.

Example 9

Investigation of Feeding Efficacy on Pig Farming

[0063] Improvement of feeding efficacy on pig farming was investigated by using the feeds, drinking water and disinfectants prepared in Examples 7 & 8. In particular, this investigation was performed by observing death rate. 30 piglets were divided into three groups (10 piglets/group) (group A: supplied with bacteriophage by the feeds; group B: supplied with bacteriophage by the drinking water; group C: treated with the disinfectants containing bacteriophage). The investigation was performed for 4 weeks. Each group was divided into two subgroups of 5 piglets. Those subgroups were either treated with bacteriophage SP-1 (subgroup (1)) or not treated with bacteriophage SP-1 (subgroup (2)). The test piglets were 20 days old. Each group piglets were raised in an isolated cage separated from each other at regular intervals. Each subgroup was sorted and marked as shown in Table 3.

TABLE-US-00003 TABLE 3 Subgroup sorting and marking in feeding efficacy test on pig farming Subgroup sorting and marking Bacteriophage SP-1+ Bacteriophage SP-1- Feed A-(1) A-(2) Drinking water B-(1) B-(2) Disinfectant C-(1) C-(2)

[0064] The piglets were supplied with the feeds prepared in Example 7 and the drinking water prepared in Example 8 according to the conventional method as shown in Table 3. Disinfection was performed with the conventional disinfectant and the disinfectant of the present invention by taking turns, three times a week. The day when the disinfectant of the present invention was sprayed on, the conventional disinfectant was not used. The results are shown in Table 4.

TABLE-US-00004 TABLE 4 Group Death Rate (%) A-(1) 0 A-(2) 20 B-(1) 0 B-(2) 40 C-(1) 0 C-(2) 20

[0065] From the above results, it was confirmed that the feeds, drinking water and disinfectants prepared according to the present invention could help to reduce death rate in pig farming Therefore, it was concluded that the composition of the present invention was effective in the improvement of feeding efficacy on pig farming.

Example 10

Investigation of Feeding Efficacy on Chicken Farming

[0066] Salmonella is also an important pathogen of chicken disease. So, the effect of the composition of the present invention on chicken farming was also investigated. Improvement of feeding efficacy on chicken farming was investigated by using the feeds, drinking water and disinfectants for chicken farming prepared in Examples 7 & 8. In particular, this investigation was performed by observing death rate. 60 chicks at 2 days of age were divided into three groups (20 chicks/group) (group A: supplied with bacteriophage by the feeds; group B: supplied with bacteriophage by the drinking water; group C: treated with the disinfectants containing bacteriophage). The investigation was performed for 4 weeks. Each group was divided into two subgroups of 10 chicks. Those subgroups were either treated with bacteriophage SP-1 (subgroup [1]) or not treated with bacteriophage SP-1 (subgroup [2]). The chicks were isolated group by group and raised. Each subgroup was sorted and marked as shown in Table 5.

TABLE-US-00005 TABLE 5 Subgroup sorting and marking in feeding efficacy test on chicken farming Subgroup sorting and marking Bacteriophage SP-1+ Bacteriophage SP-1- Feed A-[1] A-[2] Drinking water B-[1] B-[2] Disinfectant C-[1] C-[2]

[0067] The chicks were supplied with the feeds for chicken farming prepared in Example 7 and the drinking water for chicken farming prepared in Example 8 according to the conventional method as shown in Table 5. Disinfection was performed with the conventional disinfectant and the disinfectant of the present invention by taking turns, three times a week. The day when the disinfectant of the present invention was sprayed on, the conventional disinfectant was not used. The results are shown in Table 6.

TABLE-US-00006 TABLE 6 Group Death Rate (%) A-[1] 0 A-[2] 20 B-[1] 0 B-[2] 30 C-[1] 0 C-[2] 30

[0068] From the above results, it was confirmed that the feeds, drinking water and disinfectants prepared according to the present invention could help to reduce death rate in chicken farming Therefore, it was concluded that the composition of the present invention was effective in the improvement of feeding efficacy on chicken farming.

[0069] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Sequence CWU 1

3143285DNAUnknownSP-1 bacteriophage 1aactcgaact gtgcggctgc gccgttgtcg ttagtaatgg tgaacgtgtc gataagttta 60agtggcgcgg caccgtcata agcagataca tcaaccgatg caaacgggcg ggcactaaaa 120ttagtcgtga agtcggaacc gctaggcggc gcctgtaaga tttcctgatt caagccgatg 180aacgggaatg aaccggtcac cattgcgtta acagcctgtt cgatagtgaa cccggtaaac 240tcgacaccac gggttacgat gtatgaatcc gggtttccgc atttaccttt caaccatgtg 300aggattgaat aggtcttaca caagttaccg gtttccagtt tatctgcgat acgcaaatct 360gcctggacgt cggattcggc ggtaagggta tgctggatgc ccgcaccggt tacgaccgta 420gccgttactg cggtaacgag gaaagcttta tcgttattac cggacaaacc atcgaattgc 480accaggtcgc ctacttcaac gccatcggtt acaaagctac cggaggcccg tgtgaaagtt 540ttcgctaccg ggtcaaccgt aatgccgatt gccgatgcgg tggaacctgc tacccatgaa 600ctggtcattg caccggctaa cagctcgtcc tggcttgtcg cgcttagttc gatagcgtat 660tcaccagtta cctgacggtt accggtacgg atggatgatg tttcgcggct gccgtccagc 720tcgttagaga tgagggcgtc gcgcgttacg gcggggatgc cacctgtgtt gcggagtggc 780tgccataccg ggttagccgg cgtcacaccc ggtgttgtct caagtacgta aaattgcgcg 840gtcatcgcgc ctttgtatgg ttgtaacgcc attatctaat cctcgctgta aaggctatga 900aattaattga gagaggcctc ttcgcccatc cattctcaac aataagagga ccgaggctta 960ctgattgtac ctcagcacag atttcgttac gactaaaaca gttaccggcg gcgaaggcgg 1020cgtttagctt atcagctaat cggttaatag gagcgctacc caaggccgac ccgacgttaa 1080tgtctacctg ataaacaccc gcccgttgtt cagtccaaaa caagtcggct tgttctgtat 1140cagacaacag catataactc gcgatataag gtgcgtctgt agacgtcggc gcatcgatgt 1200tctctaatgc gaccttgatg tcgttgtcca tgccgaacgt caccagcgcc gtgtcgaatg 1260ctttcgttaa gtcctcaaaa tatgttgcca ttatttcacc ttagaggctt cttcatttaa 1320tagttgctgg aacctgctaa cgttaactct aacgaatcct tgcggggcct gttgagacca 1380accgtactcc agacgttgcg catacggcaa attgttagta agggtgaagg tgtgccagtc 1440agcagcattt agaacgaaac ttgtaacttt accggttgct gtgttgccgg atttatcagt 1500agcgtccgta gttccttcgg cgggggtgct tcctgaagcc atccagttca tacgaaatcg 1560cccggtatct acgggactcg ctttgataat cgcagaaaac aactttatag aaacctgacg 1620aattaccttt tcaggattct tcttagcctt ttccacgaac ttggacacat caagcgcaaa 1680actcattttc tcacctgaat aaagtatgcc acaacgtcat cgttaaccat cttcttctca 1740atagcaacta cagaccattg ttcaccgcta aaccgaacct tgtcatccat ctttggcact 1800acgctgtaat ccgctttaac catcatgtcc ccggcctgaa tggtggtccc gtttacaaca 1860ccggcattaa caggtacagg aaccgcttta agagggagta cgacgtcagg cccccacacg 1920tactccccta aaacagggtc ccaatgtttt ttggcctttg cgcaccaaag ttaccgtgct 1980gccgtatttt ggtagtaggc gagtacctac gccttgcatc cgtttactaa aagcggtgcc 2040cattacacac cctccagtct tgagatgacc agcaatgcgg atggagctac accccaggaa 2100gtaaccgttg ccgcttgtgg gtacagtcca ccgaagttag aaccggcggc gtcgcgcata 2160atctttaccg taaaagtttg cccggctgcg gcattcacaa caacacgaga ttcaatagga 2220acagtaacat cggtgctagc cagcttagcg acggcgggtg aaccgaattg agcgccggcc 2280agcagaaccc gcgacaggag gatagaggtc ccgctcgccc cagtccgccc ggcctgtaac 2340ttaacacgga tggcatagtt acccgcggca ttaaaacgta actacacccg acgcgttaat 2400cattaccggg tcagcgcttg ttttctgtgc cccaccaaag gctacggtta atgctgtacc 2460tgtggtggtc ggtgcctgaa tatctgtaga cgacgcgcgg aggacctcta cttccttagc 2520cccgtacagc atagaatccg ccatctgagt ggtaacttcg cgcaactttt ccggtgtaat 2580tagcccggac tggttatcag ggaagtttgc cccaattaag gcgaatattt ccgatttagt 2640cttagccatg tttagcccct aaaaacatta aaggagtagg cattattgct accgcataag 2700agaggtcgta gcgcatcatc ggctgccgtg atgcttactg tgccgcctga gtagccattc 2760ttaaagtagg acaccgttac tgcaccctca acccgttcgg tctgaacctc tcgcccgtct 2820gtagaccctc gaacgtcggt accagcgcca tactcgaccg cggccattac ctgagcttga 2880ataactaacg atggaattac attggatggc tgggggaacc cgtgtaaagt aacaccggtt 2940cgagggaatg ccagtgcctg gtttgcggat acgcgacgac cgcacatctg agactcaaaa 3000aggccaacat ataccgcgcc attacggaga gaggcctccg ctgcgatgtc atcttctggc 3060agctcaagac cgtacttaga ggccatggac ctcgcgtctt ccaggctgac gtaagagtca 3120gcattcggga tgccttgacc ggtttccacg ataagcggca taaattattc ctctacgctt 3180ttgcggcgac gacgctgctt aggttctccg ccgccgttgt aatgcggttc ttcggccact 3240ggctgatttt cgattaatgc ttccgggttc gcttcttcgc gcatcgggac taactgcccg 3300tcaacctcga ccacaccttt gtattgttcc cgtactacgt aattatctgt catgtctaat 3360ccttaaagcg gcccggaggc cgcatgtatt taacttactg tcactacagt actatctgaa 3420atgatattac cgtagccgtc gtgcgctacg actttgtaag taccggaatc cgccaccgag 3480gagttggcct tagtgtaagt caaagcggtt gcaccagcga tagcgttatt atccttatac 3540cattgaacgg ttttagggtc catgccgtcg gcgagtccca cggtcagtgt gatagcctga 3600ccagtggtta ccgcggtagt atcattgaga ccggtagaga aacgcaacgg cattacgttt 3660tccatatcaa tctcaacctg cccatcctgc ggactatcat cagacacacc aacaatacgg 3720cgtttaatta catcaaccat ttttatcctc ctcaggatac agtaccagcg tttttaagag 3780cggttagcag attagtaacg gcagtgcgca atgaagtcac atctgtacgc aacttattgt 3840agttggtaac cagtgcatcg aactcttctt tcgtaggagc agccgcggcg gcggccccac 3900tacccgcgct aatcgccggt ggtgccgcta cagtagcaga ttttttaacc cctccgattg 3960ccgttgtggt ggcggcgggg atatcgaact ccgcgttaac caggctgcgg ggtagccctt 4020tacctgtctt tgacattata ttgcctccgt ataaatgaaa agagggaccg aagtccctca 4080agagtatacc ctacgtttaa gcaccgacgc cagttaccag gaacgcaatc ggtacgtgct 4140tacggtcaac tacacggttc cagttggtag cgttagccag gtcttgccag ctagcggagc 4200gggcgatagt ctcagtaccg ttgccggtga ttacggcgct ggtgaagctg taaccaaacg 4260gatgcagcaa ccacgtttta cgcgtccata ggggtttcaa cgccgccgcc gttagcgcga 4320gatgcttcac gctcgtattc caacggcatc tcaggattgc cttcgccata accgatagcg 4380ccctggccga agatgacgga gatgaacttg cggctgcgca ccctggccta ctacggtcat 4440gctgtcatcg acgataacac ggtagccctg gtaggtggcg aacatggtgt tgttctcagc 4500gtcacggatg aagtcgataa gctgagcttt acgcgcctgc gcatatacga agctgtgcat 4560cgcgatagca ccgagaacct caccaccatt acccatcaat gcgtcaccca tagtctgggt 4620agcgtcaatg aatgcacctg cgtcgaagcc tgaagttgca gaaacgtcga ccaccatgtc 4680gttctgcttg tgatatgcat cagtagcgga tacgttgtcg ttgtacagac cgagggcggt 4740agcaatcaga cgacgctggg cctggcgctg ccagaagtta tccaggcggg aggctacgga 4800ctgcaatgga ttctggctag tcagttcgac agtcaggtct gcctggccga aaccttcgtt 4860cagatacgca acgcgggcca tcatttcacc ggtctgaata gcgcgcgggg tagcaatatc 4920ctgatacaca tcgttcgaat agttaggttc gatagaggta tcgatggctt tccagaacgg 4980caggttagcg atgttagacg ggccgcgggc aatctcggca gcatacggag ttggagtcaa 5040aattccggag ttgaaaaacg cggttttctc taccgggtct tccgtcatat aggacgccag 5100tacagggata ttgccagtta cgatgttgcc aatagtggta attgccatta tttatttcct 5160cagggcttta agttgccgtt caaattcggc agggttagat ttatagagag ccaatcgctc 5220gctttcactc atgtctttaa acgctggtgc ggccccgccg cctttattcc cggaagcccc 5280gccaccggaa gctgcatttg ctttaatcaa atgtgaaaaa gctttatgtt cgcgcaggta 5340tttgcggaat tgctcagggt cggtagtaac aacattgcca tccgcaccca tgaatttagt 5400cactacgtct tcgccttcaa actcggtctt aacgaacggt gccaggattt ctaccgcttc 5460tggggtgata aaatcaccag cgaaagaacc taaaacagcc ttacgttcgc taccaagaat 5520acgcgccgct aaagatgcgt aacgctcttc tttctctttc agtacaggtt catactgact 5580acgaatcgtc ttttcaaatt cgtccatttt accggcggcc ttcaaggctt cctggtgggc 5640gcgttgccgt tcttcttcgg cttctttagc ccggcgcgca gcttcctttt tctcgttaag 5700gagcgcttct tgattcgcct taagcccggc cacttctttc tcaatcagtg cccgcacttc 5760ttcggctgtg tacatttttg gtgcgtcacc cgcacccaga tttatcttcc accccggctt 5820cttcatgaag cgggtaacgt aaaaaacgat tcatagtcaa tatgtcccct ggactttagg 5880acaccgggcc acccggtgtt tctgtaacaa gaataaatta ttccacttac taaggcaact 5940attccagaat attccttatg tactcctgca accggaatac tttcaggcgc aattgccgtg 6000tgcactcggc gttctgtacg tcgacggcca ggtcttcatc ggcatcacta cttggtagca 6060ccattttgca cgggggctgc atcaacgtcg tatccgggga tggaattagc attctcagtg 6120gcgcgtcgtt tgattgacac ccgttcagaa ggaaactcgc agacagtacg gccaggacgg 6180ataacatatt tgatgacttc atgggtgata gcctccgaat tttctttgcc ttccgattcg 6240gcggaggcgg ccttagtatc attctgctgc tgccgttgtg ttttcttcgt cagctcagct 6300tgtgccttct tttgttgctg tgaaacgaga ttggcgcggc cttctaccca cccgcttctg 6360tagttgtact ggccgtataa ccacaaggag aggataccgg ctgccgtggc taccgcggtt 6420actttccaat tcatagtatc ccctttcttt atacgctaag cccgacgaag tcgggcgtta 6480atctcgtata tctgtaaaca tcatacggcg aatcttagct aaatactgaa agcaatatag 6540ctcggccctt ccgaatgcgt tcgcggttac gctagggcgt tgtgacgccc gcttcacgcg 6600acccgcaccg cggtacgctg aaagcgtagt tagcgtagca tttaaaataa tagaaatcta 6660ctttttgaat aaagtattcc tgaatttaca ttggtaagga ataactggaa taatcgctgg 6720taaaattaag gccccgtcaa ggggcctttc gttacttagg ttctgagacc ttagccgctt 6780tgctaaccac cgacacaccg tcggcatcta ctgccttgac gaaatattct ccggggtctt 6840taacggttag ttccccttca acgtaaggaa cgtttattac ctctttacca tctttaaacc 6900attgcaaatc gtagggcgct ttaccgcctt ttacaactac ggttaatttt gcagaaccgt 6960ctttcagctc tacatctgcc ggttgcagat cgaagtacac atctcccgca ccatccagat 7020acggtacttc gtacaggatg ccgtctgaga ttgtggtcag tccggtctta tccgcaaacg 7080gcatttcatc taccgactcg ccgagaacag attcgtcttt aatataaaca acgccttcac 7140ccgcaccaga cacacgtgcg tactgcacta ctcgacgtga cggcacatct ttaactttga 7200aaaagcccat ctttattcct ctttcagata atcggcaaca cgtttatcga gctccgccat 7260ctctttaaga gttaacgggc gcccgaatcc gtctaccgat attacacgaa attcttccgg 7320tgttatccca ctattacgaa aaatcttacc ccttacgggg ccaagtgctt cgtcctggaa 7380ccacgccggt tgttgtttaa ggaattcgta gtagctcgtg tccgcgctta cctgctgacc 7440tccatctgca cccctggccg cccgttttgc acccttatcc aggaagtcga attctggact 7500tattaccggt gctgtgctcg accgacagtt aggatgcgct ggcggtagcg gacctttacc 7560tatttcgtat tgcatagaat cccgcgaccg acaaacggct gaggttctgg agtcaagggt 7620agatacccac tcgtatttcg tgatgatgtc gccgttctga gcgtaaacct gttgccgtgc 7680ttcgttggat acgtgcgcca gcgctgtccg gataacggtt gcagcgttac gctcggagat 7740atcggccaga ccaccgggcc cgacaacgtt cttaactatc cgacgtgtgg tcatcccctg 7800tacgaaccca gatttaacgc ccataacaag gcgatttacc tcggtttgcc gccagccgct 7860cattagagaa acaaaatcaa ctggcttttc gcttagttca agaggcgcga aagttgcggc 7920ggcccatact tgttcggcgg ccggtgttac gaaattagcg ttaacgttgg tcgacagggt 7980ttttacgttc cagttaactt catagtctga aagctcacgg gcatcggcca gtagcttctc 8040ataccaccca gacgtaatcc cgttcagcgc ttgctcaagt tcccgcagca tggtggtaag 8100tctcgccgcc gttctgctgt catcaccaaa caacaacacc tgccgcttaa cctcatcgcg 8160catctgcttg atgaatggcg ccaggtcttt cacctctccg gatgcggtgc gttgtaacca 8220tacctggtgg cttattaatg atgtaagtaa gctcatagat aaaccctgtg atgctaaagt 8280taatagcata ctataagaaa acccatccca aggctatggg cgaccctaat tagtagaaca 8340acttaatcat agttctaaag ttaactagaa gtatttgacg aatactatat ctaggtggta 8400gtattcattc aatacttcaa aaaggagata gaaacatgaa atcgcaaaca ctagaatttc 8460cctatgggga tataactttc accccgagaa ggtgagctga acctgacggt attagtgaag 8520cagatgaata agtggcgtga agaaaatggg atgggtgtga aaaacctatc gcagctgtta 8580tctaccgagc aagccaggtc gttcgcgcgt gtgtgctgtg aggaattagg gatagaaagc 8640gcgtggcgtg tggttagagg gaaaaacgcg gcaacatacg catgtctaca tatggctata 8700tgggttgcgg agcaatattc tgactattac cacttcctcg ttatagaccg tttcttaact 8760caacggcagg tagaactccg taacattggt gctgttagtt ttgtagaact taatgccgcc 8820gttagccgga tgattgagcg tacggagggt aggattgggc gtatcggtca cttcatacat 8880gtggcgaatg cgataaaaga gtctatagat atccgtgaag taaccggttt tgatacttgg 8940gactctcagg acgccaaaac taatcaatta cggagtgata ttcaaaaggc tatggtgacg 9000ttgttggata tggaagcagt caactcatgg gatgagctga aagagacgat accgcgggtt 9060gtgcgtaaat gcgcggctaa tatccgctaa aactaaggcc ccgtaatggg gcctttttct 9120ttactcctgt tgttgttgtg ccgcttgcgg aatctccccc gctacctgag taacagcacc 9180cgacggcaaa ggtgcatctt caatagcgtt cagaatatcc tcgtcggtcc agtcagtcac 9240ccccgcctta cgcaacgcag cgtaataagc agtggcgggc agtaatccgg cattaatgtc 9300tgccatccac gcagccctgt cctgtgctgt cataggttgc aggaagaaat ccatgttaag 9360ctggaactcg acttcagaat cttctggctt acccaacatc atagcaaccc atcgtaaagc 9420atcggtatac gcctgactta cgttacgagc gattgtggcc ataacggatg tatcggcgcc 9480gcgttggatg cgcgcggatt ctgcggtaat ttgctgagat ggtgtaataa gttgggcacc 9540aatctggata gcctgctgtt ctttgtccag catattctgg cgggccaggt tgttttcgcc 9600cgcctgaata agttgagcgc taccaccata accaaggtta tgcccgcacc gactgccaaa 9660tttgatgccg ttggggttgg cttccttgaa cgactgtggt gtaaggttat ccccggggta 9720gataaacagc gtaggctggc caactacaaa acttgattcc tcgttatcag cactgttccg 9780gtagtgcccg atattaagct cggccaatgg caacaaagga gcgtcgtcaa tggtggcgtc 9840gttattggta gctccgataa aggtaaacgg aattacgcca cgtaacgact cccctaaatc 9900tgggtaaatc tccacaacct cttcctgagc tccgccttcc gcatcgaaac ggaacagtcg 9960ctgacgataa ttaccatcgg tgtcaatgtc cagcacgcgg tactgctcgc cgtatttagt 10020ttcgaactcg tttccaggtt cgtggtactc ccatgtctca cgcagcacaa ccatagttac 10080ccggtttaca gaacctacgc gcgtgagtcg ccagttaacg atattctcgg tagtgtagaa 10140agcgattgta gggttaagca agcccgcatt ttgttcggca gcggtggccg cggctgtttc 10200cggagcatca acaagaagac caccacgacc tactgagtca atctccatga gtgtatcttg 10260cgcgtgctgt attaggccta caccagaccc atctgcattt ttaagcaggt attccagctc 10320cttcggaata ttgatttctg gttctttgcg catgacgcta ccgaccattc ccgacagcgt 10380tcgccgggtg aagttgtaga cgataccccc ggcctcgtat tctgcctgac gcgcttcgcc 10440gtatgcttta tctggttcat taaggccgac gttgcgtaag tagccaacca ggtctccagc 10500aagcgcatgg cgcaccttct gccatttcgg cgcgtagtgc agccattcgc ggtgcttggt 10560ttttacgcca gaaccctggc cgtttgctgt taacatttaa taatcctctt aaagtgcaaa 10620agtaaccggg atatgggaaa caggtttaac caacggcatt tcgtaggcga tagggtatcc 10680tgtcgcgtcg ttctggtggt cgttgccgct tgtcttatcc ggtataccgt ttttatcgta 10740agcctgttgc tccaggcaac gtgctgtaac cgggcaagcc tgctcgttga ccattaatct 10800accagactcc agcgctttat tcaccgatgc tacacggtct ttaaccgcag ggttaactga 10860tttcgcacgt atctcgaaac ccgcgttctg taattgggca atatctgacg tactggcatc 10920agtcgattta cggttcttgc cgctggcatc cggatacatg acgatgtggt ggccctgtcg 10980cccccatcgc tcggtaattt ccctgaccac atccggggtg tcgaacatat ccaccagctc 11040ggctaccgcg tgccagacat actcacgctg aacgtatacg gtgctagcca tatgcccgac 11100gttgaagtcc tgaccgatgt acagcgtctc tccaggttgt atagtctccc gactgctgtt 11160cttacgtcgg tcgtaagcat aatacacgct gccggatgtc aggttgacaa attcgccgtc 11220gatgtaggca tcaattaact ggcctggata cgtatcccgc aacgactgca cataatcttc 11280cggtagaaag ggattggatg ttgtcgaggc ctgaatcatt tcatagcctg gtttcttttt 11340tacagcccat ctgtcgtgca caaaacggaa gccttctggc gtcgtaaata ccgaaactgt 11400attagcgggc ttcggggtaa ttggacgata tgtacgcggc aactgacggt tacgggcgat 11460aactttgttc caggcgtgct cggcgtggtc tttatttaac gtgtccaact cgtcgatttt 11520tgcgcggaac gattcgtagc caacaattcg tgctggatta tccaatgtgc gaaggacaaa 11580atcctcgaat tgcccgaatt gcccggatga ggtataaatg atgttgtcgg atttattata 11640cttgtagcga ataccccaat cagacaactt ctcttccata cgcggagcga ggataaggcg 11700caccaggtcg tatgtcggtt catacatggc gataagtgaa tcactaccgc cctccatgct 11760gtcgagtagg gcggaattgc acatgacctc tgatttacct gtgccgaagc ccgcaacgaa 11820ggccgggaac ttacaatgca gattaaggaa cgcgccttgc ggttccgtag ctgtgatatc 11880aacgttcacc ggacaccacc tttaatagtt acttcgctaa ttggttcgtc gcgcgcttct 11940tccacaacag ttttattaag ccccagtttc gccgcggcaa acgtagcgga tatcccggct 12000gcaccggtct cagtgaaata cgcctcttcc agggcttgtg ccgtctcata tgcttcggcg 12060aatgcaggaa cctctcggag ccatagcttg ataatcggga tggttacgcc gatgtgtaat 12120gcgaagcggg ccagcgacgg cggtttgtcc tggataagcg ggcgttcgtc gcctttagac 12180gtgggtacga gttcccatga cgcgcggtcg aagaacctga ttaactcgtc gcaatagtcc 12240ggatcccata gttcggcgga atgtctggat gactgataca ggctttgttt accacgcggg 12300cgtttacggc gacggtttgc actaaccgct tcttcgtgcg cggcggccac tacttcggcg 12360tcaggctgtt ttaatttgag tttcatgcaa tcctctctta aatgcgtatg accatcatag 12420cgcatcagac gccccctgag cgtctattaa ggattgtaca ggggaatgaa ggcctgtgta 12480cagaaaagcc cgcagaagcg ggcttgtgtc agttatatag gccgtgtcgt agtgctcttc 12540taccatcgcc gccgtaatgg tcgttagctg cggcgataac ccaggcgttc gggatgatta 12600gcaatctcat ttgaaaaacc acagcaggat gccggccgct cctgatacac ccaagcctaa 12660aaacataggc caccacagat atcagggaag actgttaaac acagtcggtt gttttattag 12720cgcactgaga aaggcaaacc aaaacatcag gtcgccagtg gcatcggtag ccttcaaaat 12780ctcaatcatt ctccactctc ctctttataa acccaccatt tacctacggc ttcccatcgc 12840cacccgcgac tatgtatggc ttcgaaccta cgaccaaata ctgtttcccc gtaccacatg 12900acaaatagct tcaccgcggc accagcacca gctttatgag cattcaaacg gcgatacgct 12960agtgacatcc tcgtaagact taccgcctca acaaatggcc aaagaaacaa aatccacatc 13020aggtacatag caccggcaag cagtaatgtt gtgaatccta tacccatgag gatgagaaaa 13080ctatccatca cccctccagc ttcatacggt cgttgcgcga taatccacgt ttcgtgtaga 13140tgaccggtga cgttttcgta tgggtcatca gtcggttgtt atagatgaca tgttgctcgc 13200attttgtgtc atggcggtac ttggacaatg tcatctcatt aagtcccgtc tcccggcacg 13260tatcagccag cgtgccgtgg gtctctatta gttttgggat actagtaatc attcctgttc 13320gctctccttc tcaagtcgtt ccagcagcat cttgtatgct tctaactgga attcttcgtt 13380cattgacagg cccagcttac ttacagactc caaatacgtg atgcgttggc gcaacgtttc 13440tttgcatact cgtttcatcg tttaatcgcc cccgcactta acacactgtc cgcacatatc 13500tttaggattg ttaacaaaat cgtgctcgca cttattcagg tcataacggt tgataagctc 13560ccggcgatac tcattaaggt agtcaagcgc agcctggtgt gcctcgattt gcgcgtctac 13620tgcttcaatc ttaaacctgc cgttggcggc ttctaccatc atcttttcat attcgttgtt 13680agtcatttct tcttacccca cattcgattg agatacttgt tcttgtccgg tcctgggaaa 13740ctgttacgtt taatcagttc ctcgcgtgtc gggaagggcg tgttacttac cttaccgccc 13800accttaaacg ttaccgttac ttgcccgttg tcgctcattc ctgcacctcc catccgagta 13860catttacgcc gtcatagtaa tgtgaggtgc gctccagctc ggcggcggct tcggcctttt 13920tttcgctgag ataaacatca agaacgtaag tgtccccgtc gtgatgccat cccggatacg 13980atatatactt tcatttttgt tctcctgcat aagctgcttt cagtgtctgc atcgcggcga 14040accagaacgc atccgctgga atccgtgtac ttaggttatt aacggcaatg cgtgccatca 14100gttgtgcgtc tttgaatgct tcggtgtcca gtagcggttt gcaatggtaa aaaactttat 14160cgctttgtaa gttcatcttc tctactccgt tctcgttgtc gatgaactaa atataatagg 14220gttaatgtta ctagtcaact attatttctg aatacagata aaaaaaaatc ccggtaaggg 14280tcagttaccg ggataaagga gctagaggga tgaataagca ggagcgacac cagtatctta 14340ggaatgctcc tatgtgtcaa cctactttgc ttcgcggccg atggcttccg cctgttgcca 14400cggcataccg tcgaatagcg caacacgacc cgcggcacgc cgacgcaatc caaggagtga 14460tttgccgttc tgataatgga actgagatag cttattccgc agtgtggcaa cgtcgccctt 14520acgcagggcc tgccctgttc cggtagaagc cgcaatcaca ccggcgccag cgttatacac 14580caggtcgcac atcgcatcga actgtgactg attgagcgac ggatgcgcta cagcgtctac 14640cgcagctacg gccttagcca tatccttgtg cagcagcaga agaccctgtc cctcggtaat 14700cttctggcct tctttcacat ctgcgccgta gtggccatag ccgatagtaa gtacttctca 14760ctcttcgttg ccttgtacgc ggttccgcgg aaaccttcga acgcggcggt gaatttgatg 14820ccgttgttac taatgtttcg gtttgacata catcctccgg tatttgtagt agcgagcgcc 14880tttcacgcaa atgtgacgca ccgatttaag cgcgaatata gcgacgagag tcgtaattat 14940gaacggtgga atggcaccgg taaagagatg ggcgagacct ccggcggcgg tcaccaccga 15000cgccatgtac agcaggcggc cgaaaagacc

gtcttcaacc cagtcggcgt agatattaat 15060taacgaggtg gcgatgatgg caaccaggca aatgacgcca attgatgagt tgagcatgtt 15120atctccccca cggtaactta aagttgctga gggatgagtc agcagcttcg aataacttaa 15180gccagaacat acctaccccg aaaggaacca ggtactgacc ctcagactgt gataatttca 15240tagtaactta taatgatggg ggatgcgtac actgcacaac aggcggaagc ggtgagatgg 15300cacaatcgca accatggcga aatagcctca cgcttcttaa tctgagatac ggcacccccg 15360gcgaggcccg ccacactaag ccaaaggtat ttatcgtcca caataaaaaa tctccgaaag 15420ttggtttatc cttcggagat tagcatttat acgacaattt tagtaacaga taattcggat 15480ttatcctagt cgatgtgtta tcacgcttcc atcggtacca gggtcaaacc tcttcgcaac 15540ctctaccgct tccgttgccg tcgcgcccat gaacatggct gtaagtgcat acggagcccc 15600ggagcctacg gcagcagcgt tacctgcaat tggtataacc gagcttaacg gtgcgtccca 15660cgccctacag aattctaccg cgaaaatacg gttatcctct ttaacaaaca ccagcgccga 15720aaagtcgaag tcgtagtgct taggcgtcag tatctcatca tcggcaacca acaacatacc 15780caccccggcg tccccggata cccctataac aaagtggtcg ttctcgtaaa tcttggtatc 15840cgtgtggtat ttgtaattgc cggtgacaca ggtatcacag gccatggttt tgccgtcgaa 15900agctatcgta gtcatataaa ttacctgaac gtataaagtc gaatagatgg cttgtgcggg 15960atttcggaat acccacgttt acgccacagt ttgtacagtt taaccgccat atgcgccctt 16020gcctggctac tgaactcccc caggtttacc actttcttcc cgtcgtaaga gtgcgcacgc 16080cacagacctt tgcctacaca atacttaggc tggtgcaccc cagggatgcg cggatacacg 16140tccggcatct cattaactgg ctttgcgcgc ggtttaggtt tacgcttaac cttttcttta 16200acgcgagtaa ccttctttgt taccgccgat gaaggaggtg ccaggttgat gccggcgtgt 16260ttcagtatat cggttgcgag actcatttct ccccctgctt agataaccgt ttcagtgtgc 16320aaataccgcg tacctgagcg tcaacaggac gctctacgaa agttaacggc gcgttctccg 16380cagcgcgtgc ggctacctgg cacgcctcta acgtataaaa cgtttctgtt ccggcaagtt 16440gtagctgacc cgcggataca acccatatga aaagtatact tgtcatttga ttatcctgta 16500cttaactata tcccagttgt tgttatcaat cccccaccgg tagtcctggg ctgcgccgac 16560ggctatagag ccattgcgga attcaacctc aacctcacaa tcgctaggca ccgggcacgc 16620cttacgtcct ggattttcta tccaaccatc gtacagctca tgttgtgggt tcaatactgc 16680cccgcattta gtacactgtt ttaagtcgct actccacaga accaaacggt agtagtgctc 16740acattcttcg cgtttagtca ctcggtaaaa gtcggcattc ataagttcga tagtatcccg 16800tagttcctta accttatcta cctcccggcg taacctgtct ttcagcatgc gtatgtcgcc 16860gtctttacgg gcgaggtgtt gttgtaagtt atggatgatt tgtttgctgt cagaatcatg 16920gcctatgtag gcgtcgataa ttgcgttctc ctcgtccgag taccctgagc ggcctgttat 16980cgaccggtct atgctcatct tgtgtatttc tgctacaacg tcgaacttat tttgcgcgct 17040gacgtagttg gtcaatcagg tattcaaata cttcgtcttt gctactcatc tccacactcc 17100tcgcatacga tagctttcag gtccccgtca caaactacat cttctccggc gcaccatata 17160tacactgcat cttccaggct aatatcctcg tacattcctc ccgcccctct cgtttcgata 17220cagtaatagt acactattat gtttggttat gccaatacta ttttacgatt aatttatccc 17280gacgcaccgt aagataacgg ggtttcttcg catgagcacg ccaccactca acacgggcgt 17340agatgccctg aagcgatgtt actttgccgt gtctgatttc tccgttccgc ccggtccagg 17400ttacaaggtc atttggtttc attcgttagt ctccgttatc gattcgatga aggtcatgag 17460ttccttgtaa caagcatccc acctcatagc cgctgcttca ttactcctcg tcgtcgaccc 17520tgattgtata ggacatatcc gccgatgcat cgtctatacc gtccaccagt tccatcagat 17580atacagcctg ttgtttagta atcattgttg cgtatcctgc aacaagttgc gttgattgtt 17640acatttcgtg aaatagaaaa atattaacaa aaatggtacg ctgctactca gcagcgtaag 17700tcactcagta aaatcctaaa ctactgttac aagcttcctg cggttccgat aacagcgccc 17760aggtgcggcc ccgccaccac gataccccag gaactatcca cccatcatca tcggcgtccg 17820gatgcggccc cggggaccac taaaacccta gccataaacg gcaacctcct ttaagacccg 17880agaatcaccg gcgcggactc tttagaatct tttgccgtgg ggttatttac agggaggtcc 17940ctgccccatt agagtgcctt tattctcgtc cctcgtcagg taagcgcttg ccgcaaggca 18000agtgcgttaa tccctgagta gtagactaag aatctttcgg catttcagtt acgttgccgt 18060tgtccagtgt tgtgccttta ttcttattac ttggtaacta aagggcaggc cttaagcctg 18120cccactaatc gttacatttt tacggttgcg aatttacggc acatcaagga attcagatac 18180ttaagagata tgctgccgat gagaatatag ctcgcccagg gcagttcaga tactaaggaa 18240gggaagttac tgagttttaa gtttgcgggt ttcagtaagc cttaacgcgt atccgcttgg 18300ggcggacccg ctaagctctc acaaggtgaa acagaaactt aagtaacttg aagttacaag 18360agacaactta caacgaaaaa aatgaaaatg tcaataggtg tgtttatagt tgatttccca 18420ttatgccgtg ggtatacttg ctttactaac tgagatggag gatttgagaa tgacacagaa 18480tgaagtagct gagcttattg gggttacccg ccgcacgctg aataactggt taagagacgg 18540caagttcccg gattgttgtg tccggattat gggtcgccgg atgccgggta cgtttgaccg 18600ggagaaagtg gaagcgtgga ttagggagaa tgtaaagtga ccgatttcca gaaaagggta 18660ttcagaactg tagtcgcgct tacgcgtaaa aaagggtcgt gtagtgttct tgacttgcgc 18720cgcgcttatt ttcagtacta tagttcctct ctcatcgaga ggtcgctgga agttttggtt 18780agagacggag cagttaaaag taaggccgga aaatattcgg cagtagctga agttaaaggc 18840tcccaggcga ccccagaaga ccttgaataa aagaaaagcc ccaacgcgcg aacgtcaggg 18900ccttaaacac tataaagaaa aagtaaatga aaacaggcca tttaccatac tcatggccgc 18960gacccactcc ccgtgaggaa cgcgctgaca ttaacgttta caccacgacg tccggcacct 19020gggatgagtt tgtcgaactt atgcagccgc ttaaacgttc gcgccggaac cccaagacag 19080accccggcta cattaccgcc gcttgtaccg ccacggtaag ctctaccggt aaagaagccg 19140ccgaaggtat gttctatcgc tgcaatgcgt ctgttacgtc ttcatccctg gcctatgccg 19200acgtggacag cgcgacgccg gaagagttcg caaccgactg tgagatggtg cgcgagtcac 19260gttacgcaat gatgctctac accacggcat cccacaccga agaagcgccg cgctaccgcg 19320tcgttatgcc tgtacgcact ccggtaaccg gtggcgacat catccgcatc cggtacggcc 19380tgttggcaca cttccttaaa ggtcgtgacg tggatagcgc cgggttcacc ctgtcgcagc 19440ctatgtaccg cccgccggta ggaagccagg tcatcgtgtc tgaaagtagc cgcatgatta 19500cggcgagcaa gcttatggag gaagttcctg aaattaacgt taccggtgct tctgattata 19560aagttccgga gggtgaacaa tccgaattaa ccgacctgtt tgaagagttc gcttttgaat 19620tcggcggacg tatgaccgac cgcggcctgc aaatgcccgc cacgccggag cacgccgccc 19680aatacactac cggcgaacct aagcaggacg acttcctgtt ctgttggccg cgcgacggct 19740tcgagcgacc caacgttacc ctgtaccacg ataccgacct ggtagctacg ggcgggatga 19800agcctggcgg acgggatatg tgggcttacg cttgtgcggc caccggctta ccttttgacc 19860gtgtggaggt ggcgcttggg tgggcggagg gggtcacttg cgacgaagaa gacctggacg 19920acgaagaacc accagcacca caagcggact tcatcgtcga gggctatatg ccgtctaatt 19980gcatttggga tatcgtcggt gaatccggga cgtataaatc gttctacaca ctcggcatga 20040tgtatatcag cgccgccggg tatcggttcg cgggggcaga cacccgtaaa gcccatcatt 20100tctatattga tggtgagggt ggggagttca cgcacacccg tatcgctgcg ttggccgcta 20160aatacggcga tgaaggtatg cgatatatgc atgtgcttga cgctggtgaa ttcgcggata 20220cgaagaaact ggtgcgtaaa atgcgccaga tagcgggcag tgaacctgtc gggatggtcg 20280ctttcgacac tcttaaccag accttcggga actggataga caagttcaat gagaactcag 20340ccggacagga cggtatgggc cgtgtcgtgg ctatgctcaa agaagtgcgc gacggtacta 20400aaggcgctgt aggcgttgtc caccacaccc cgaaaggtgg aagtaaggcg cgtggaagtg 20460gtgcgctgta tgccggtgtc gatgtggaac taacgcttgt ccgcgctacc gagaaacaaa 20520taaacgttgc gcacaccaag aacaaaaacg gtatgcagca gaaaacaata ggcatggtgc 20580ttgaaccagt acagtttcgc gaggccccgc cgccgaaaga gttccaggcg gtagaattcg 20640ctgggggtga gggatacggg gagatagtca acctcgacct tccggagccg cataaagctc 20700tcgtacttat gccgtggggc ttccagccgt tcgaaacgga cgaggaaaaa gagcgaaacg 20760aaggattgga tggtaaaggt aaagattccg taaaggatac ggttaaacgg tctaaagacg 20820cttcggcccg tgagtcggtt atgtccgctc tcgaggattt acagcaagcc gatgatacgg 20880gacgagggtt cacacaacgg caaatagtcg cgagagctgg agaccacagt atcacaaacc 20940tggtgcttga gaagatgcta cgcgagggtg aattgattct tggttgcgac gaaaacggtg 21000aagttgtaac gaatacttac aggttgccga tgggtataga cgaccgtaag cgaccgaaga 21060accggtatga acctaacgac aacataaaga caacagaagg ggatttagag taaaaagaaa 21120ggggccatca ggcccctgta tcaccaaagc ttaaccatcg agggtcaaca ccgagagcat 21180cggcaatgtg gaagatttta aaacagtcta ccttacacac ccggccggtt gccaggtggg 21240taatcaggct ttgggatacg ccagctttga aagcaagctc agtttgaccc atgccggatt 21300tctttacggc ggcgctctat gcgagcgcct agctcagatt gctgcatatg tttactcctt 21360agttagatat gcagtaatag tacagtaata aaatacacga cgcaatttac gaaaaagttc 21420ttgcataaat aatagagtac gattatagtc tttatcacca actaaacagg agaagaaata 21480atgttagacc aattcttaaa aattacttga acgtttcgta gtcgcccatg aactgattgc 21540tgcgaatagt gtgaaacaga cgtctaacaa atccgtaagc gaaatgactg ttgacgtctc 21600cgttgccggt gtcgagacag ttaaaaaaga actggctaaa gcactggaag aagtcgagaa 21660agcaaaagaa attccggtcg aaggtgagga catcgtcgac actaaaccgg cagaagagga 21720gaaaccaaaa cgtaagccgc gtaaggcaaa agtagaggaa ccagtacaag aagagaagga 21780agaaattgat taccaatctc ttcgcgacca gattcaggct atcgacgatg caattaacga 21840aggccctagt gatgctgcgt gcgatgattc cgatgaactg ctggaagagt tcaccggtaa 21900gaaaatgaag attgccgcga ttaaagacga agaccttgct gaatacctgg aacgtctgac 21960agcaatcaag aacaagtatt tcgaagaaga ataactactt aacttatggt gccttcgcgt 22020aagagggcac ataactgagg gtaaagaaat gatcttagac atcagcatta aatgtgaaaa 22080cttagcggtt tctactgtac gtggtggctt atacgtagac attaaaaacg cagaattagc 22140ataaaacgtc ccggtagaag atataggccg tcacgtgtcg cagattaagc gcacgacttt 22200cgccaagcct tacttttatg tctttgagtc gatgcatgga tgggctatgc attgcgagca 22260taagacaaga catttaattg accagtggga gaacagagca tgactgataa atggtggctt 22320aatttgcgca gcggcgacaa agtttacacc gtcggcgacc gcagaaagaa cagcggtgta 22380gctactgtgc tacaaaacgg caaaaagtac atacacattg cgcatgaagc tcgggcgctc 22440cgcgtgaata aatcgtctgg taggcttgag gattacccga aaacattaat atacaaaagt 22500gaaaagcatc acatggtcgc tgttgacgca agacgtcagt tcgcgggaat gctgcaacag 22560ttaagcgact tacatcgcga tgattctttc attcccacag aagaacagtt acaggcctta 22620aacttatatt tggagagttt acgatgattc taaaagaacg cggcggcaat aacgatgttc 22680acgccttact gtcgccgtca ggtgctaaaa aatggctgtc atgcgctgca tcactggcct 22740gtgaaaaaga tattcctaac acgtcaggta aagctgcggt attaggcaca gctatgcaca 22800ccatagcgga gatgcacctt aacgcctata tacgcggcac tgcactgccg ttagaacgtg 22860aagtcggcgc ttatgttctg gatgaaggta aaggccagat taaggcgcta atcagcccga 22920tgaaaggcgc ggtactgatt acggcgggca tgattgagca agtgcgcaag tacaccgact 22980actgcaaacc gattattgat gtagcgactt acgccaagct ggaaatgcgc gtcaatctta 23040ctgaggtatt gcatccaggg tacatccata gccctgacgg acggcaagaa gaactacaga 23100cattcggaac ggctgacctt gtcgccattc aggaactggc taacaccaac gagcacatgc 23160tcattattgg cgacctgaaa acaggacggc atcgtgtcga agcgaaagaa aacaaacagc 23220ttatgcttta cgctcttggt gtttatcgcc gactcaagag acgttatagc ataacaactg 23280ttcgtctggt catattccag ccgtatgctg gcggcgcgtc ggaatgggac atttcggttg 23340aaggtctgga actgttcgct aagttcgcgc agaaacgcgc ggtagctgcg cttgacgcgt 23400atcggcgtgg taagaaaaac cttaaaccat cagacttcaa gccgtcggtc gacggctgtc 23460agtggtgtcg gttctccgaa cagtgcgccg cgcgtacaaa aaccgttaac tctgtactgg 23520cggaagaact ggaggacgac tttgcgctgg aacttacacc cggagcaact cgtagctgag 23580tatgagaagt tgccactgct gcgccagcac atcgacaagg tcgagaaagc gatggctgcc 23640gcgttgcatt ccggtaagaa agtgccgggg tacaagctgg ttgaaggccg cccgggtaat 23700cgtgcgtgga aagataccga tgcgctgctg gaaacgctat cacattttga gttgggcgct 23760gaaatgcttc ataaagaagt actaatgacc ccgaccgagg ccgagaagca gcacaaaggt 23820tctgagctat gggcggcgct ggagaaacac gtaacccgta agccaggagc gccgtgtgtg 23880acaacggtcg aagacaaacg gccagaatgg aaaaatgtta ctgaagacga tttagaggcc 23940ttgacatctt aatcgtactc tattatatta ctaatcactg accgggcagc tccccggata 24000aactctaaaa cgcgagaaaa ctaaaatggg aattaaactt aatcttcgta aagtacaaac 24060cgcatggctg aacgtattcg aacgcgctaa agaccgtgaa aataatgacg gttccgttac 24120taaaggtacg tataacggta cttttatcct gactccggaa cacccacaaa ttgaagagct 24180tcgcgatacg gtattcgcag tagtgtcgga agcattggga gaggccgccg ctgagaaatg 24240gatgaagcag aacttacggc gaaggtaagc acatggacaa gtgcgctgtg cgcgacatcg 24300ctgagcgcga taatccgttc gaagacttcc cggaaggttt ttacttccag gccaagaaca 24360agcaacaacc attaatcctg acttcggtta agggtgaaaa gcaggtagaa cctgacttca 24420atattgatgg tgagcagatt gaaggtgagc aggtatatag cggttgtgtg gctaatatct 24480caatcgaaat ctggttctcc gagcaatata aagttttagg cgcaaaacta aacggcatca 24540aatttgccgg tgaagggaag gcattcggtg gttccgcggt ttctgccagt gtcgacgacc 24600tggaagatga tgaagacgaa acaccgcgtc gcgaacgccg ccgtaaccgt taatatattt 24660tcttttcaat taaggcggct tcggtcgcct tttctataag ggtcaaataa atgaatctgc 24720tttatctcga tactgaaaca ttttcagaag ccgatttaaa aaaagtcggt tcctatgctt 24780acgccgaaca tccgactacc gaaattgtta tctgcaccta cgctttcgat gaaggccctg 24840tgcaagtatg ggacgccacc gacggcagcg atatgccgcg tgatttgcgt cgggcgatgc 24900taaagctgca aaaaccagac agcaatctca aactggtagg ccaaaacttc cttatgttcg 24960accgaccagt tattaagcat tgctggggat tcgaactcct ggtagaaaac attatagaca 25020ctatgatagt cgcgttccga catgccctcc cgggttcact ggccgcgctg tgtgaggttt 25080taaacattga cgcaagcatg gctaaggata aacgtggtaa ggcgctgata cagcgattca 25140gtaagcctac gcccaagaac tataagattc gacgttatac tgccgatacc cacccaaaag 25200agtgggcaga atttattgca tacgcaaaaa gcgacattac gtccatgcgt gaagtgtata 25260agaaaatgcc taagtggggg aattctgagt tcgaagaccg cgtgctgcac ttagaccagg 25320tgattaatga ccgaggattt aaggttgatg tggcattggc ggaagcagcg attgaagcag 25380tcacgcgcca taaagaagag ttacaggaag aagcccaacg taaatatggc ggttcactaa 25440ccggcaaaga cttcttgcct attttacagg agctagcgcc agcgcaccgc atacacaacg 25500cacagaagtc aacactaaac gatttgctgg cggatgagga tttaccggac gacgcccgca 25560ctattatcga gatgcgtctc ggggctgctt ctaccgcatc gacgaaatac gcgccgttgc 25620tgttaggccg ttcttcagat gaccgccgcc gtggttgcct gcaatacgga ggagcgaagc 25680gaacattgcg gtgggcgggg aaaggttttc agccgcaaaa cctggcgcgc gggtattatc 25740acgacgatga actggatagg ggtattgccg cgttacttaa aggccgtgca caccgccgtt 25800ttgatgtggc caagctaaca gcgtctaccg tccgaagctg cattatcccg gaagccgggc 25860gtaagtttgt tgttgcggat tactctaacg tcgaaggccg tgggcttgca tggctggcgg 25920gcgaagaaac cgcgcttgat acgttccgcg ccgggctgga tatttactgc gtaaccgcag 25980gtaagatgtt tggcatggac cccgacgata tcaagaaaga acgtaaagac ttacgccaga 26040taggtaaggc ttgccttcac cgtcataccc aagttttgac cgattggtgg atttaaggat 26100attatggcgg ttacatcagc atataaagta tggaatggcg aaaaatgggt gaatacaaaa 26160ggcacgcacc ttatggggtg gaaaccggta ataaatgtgg acggggttct aatgaccgaa 26220gaccacaaaa tcttgacgca ttcctggaag gcggcaaagc aactcgtttc aaacaaatat 26280atgatgggcc tcgccctggg gagaggtggg gacgcctggt tatcctacgt gagctaccaa 26340aacgacaagg ccaaagacca actactcgtc caatgtgatt gcggagagat gccggggcgg 26400gtctattatg acaatgtccg agcgggtaaa accactcaat gcaacatctg cgcccttgaa 26460gcaacaaaaa aatatcgtaa aaaatatttc tgctacgaag acgcaatgcc ggatgatgcg 26520cacagaacgc gattgctcaa ccggttgtcc gcggcaatcg tgcggacaac aagccccgga 26580aacaagagtt acaaaaacta tggggctagg ggtatcacgg tatttgacca gtggagggcc 26640gataaaaggt cgtttcttag atatgttcaa actttggaag gctgggatga cccaaacctc 26700gaaatggacc gaatcgacac agacggtaac tacgagcctg gcaacattcg gtttgtcagc 26760cgttctgaaa actgccgtaa cagacgtcga atacctgagc ttcaacgaaa gtatgatgca 26820gccgttgccc gcattgctga gcttgaacgg gaaattaacc tactgcgagc cagtttacga 26880cctgattgat gtggaagacg gcaaccgttt tcttatagcc tcagactcgg gctttcttgt 26940ggcgcataac tgcgaactgg gcctcggcta cgagggaggt gtcggagcgt tcgttacgtt 27000tgctaaaaac ctgggtcttg accttattga gatggcaaaa acaatggacg ggactttccc 27060cgaccacatc tgggctgcta ctgcacgtgg gtatgagtgg gcgcgtatcc aggaagccaa 27120gagaccaccg catcccggtg aaaaggatga caggccgtcg tatatacttg acaagaaagt 27180atggcgcaca tgtgacgcga tcaagcgtat gtggcgtgag tcacaccctg aaacagtagc 27240gttctggcgc gaccttaaag acggaatttt agccgctgtt cgtaatcctg gtcgtgaatt 27300ttgggctggg gcacacttgc gccggaatgg tgaaagggct atccgcatat ggcgtaccgt 27360agaatttgat tcgtcgggca ggaaggttcc tggctggtgg ttgtgtatgg agttgccgtc 27420aggccgtatc ctatcgtatc cgggaatcgg cgttagtgtg acaaaggaaa cagacgaaga 27480cggacggata aacaccaatg taagaattaa gtaccagggt gagaaccagt taacacggca 27540atggaccacc ctgtacacac acggcggaga aggcttgtga aaacattgtt caggcgttgt 27600gccgtgactt attggcctat gcgatgctta atgtagaagc cggtgggtat ccaatagttc 27660tttctgttca cgatgaactg gtatgcgaga ctccggatac atcagattac acggtagctg 27720aactggaaaa actaatgtgt gcattgccag aatgggctga tggttttcct cttgtagcgg 27780aaggtgcgga gttaaaacgg tatgctaagt aaactgatta tttattattt cagggaagaa 27840gactgtcgaa tctgtccgcg ctgtggggtt aagcacacga aacgtgaggg gtgcaataga 27900tgagtacgcc tgagggccgc gtccagaaat atgcaaaaga gcgattcgag gccctggggg 27960gcctcgtacg caaattgtcg tacgaaaata gagtgggcgc tcctgacctg ctggtgattc 28020tccccggtgg catcatctgg ttcgtcgagg tgaagaaaga cgaaaacacg aagccagacc 28080cgcaccagtt gcgcgagcac gagaggatgc gtaaacgcgg cgcaaatgtt tttgttgttg 28140ggtcgaagaa acaggttgat aaattaatag aacactatta tatttagtta acaccaaaca 28200gaaataaggg aattgagaaa tgaaatatga atatgaccgc aaaccagcac gtgacatcgt 28260accaggcgat atgattttca acgttaaaac ccgccagccg gttgccgttg atactgtgtt 28320cgtcgagtca aacggtaaac tggttatcga agatgtaact ggcaatgtta cagcgttcgg 28380gcgtaaagag ctggtgctgg tgctgaaatg agtaaattca atagaagacc cgatattgag 28440aaggcgaaac gtcttcttaa ctatgacccc gaaacaggta tatttacacg aaaagtaagc 28500ataaaaggga gaaatgcggg ggaggtagcc ggagggccga acgacaaagg atacatagtt 28560attacagtct ccggtgtaag aataaaagcc caccatctgg catgggcttt cgtctacggg 28620gaataccaca atggtgagct tgaccataaa gaccgtaaca gggccaataa cgccataaat 28680aatataaggc ccgcaacaag gagccagcag attcagaacc gcgactgctc atcgcataac 28740actagcggcg cgataggggt ttaccaaata ccatctggca ggtggcggcg ccagaatagg 28800cgtcaataac aaatacatcc accttggcta ttttgacact atagaggaag cgtcgcgcgt 28860ataccaaaga gctgcggaaa tatacttcgg ggagttcaag gcatgagtaa gtttaggcgc 28920agggaatacc agaaaataat gacgtcgttt atgctacagc acccacgttg caatatatgg 28980tgcggtatgg gtggcggcaa gacctcgtcg acaatgtggg tgcttagccg cctgttccgt 29040aatgggcaac ttaatgacga cgaccgagtg ttaattctgg cccctttacg tgttgcgtca 29100ggtacgtggc cagcagaaca agagaaatgg aacttcccgt gtctgagtgt agtagatgca 29160actggttctg agaagcgacg catcgcggcg ctggagtcag acgctaacgt ggtttgcaca 29220aattacgaag ttatagaatg gcttattgac tactacggca aagacgactg gccttttacc 29280gttatcgttg ccgatgagag cacgaaactg aaatctttcc gcagccgttc aggcggtagc 29340aagcgggcaa aggcgcttag taaggtggcg ttcggtaaag ttaagcgttt cattaacctg 29400accggtacac catcaccaaa cggcctcaaa gacttgtggg gtcagaactg gttcatcgac 29460gcgggtgaac gccttgggtc ttcatacacg gcctttaccg atagatggtt taactcggta 29520cagaaaggca aatctgcgat ggcgcgggag taccatgctc gcccaggcgc ggataacgag 29580attcaccaga agatgaagga tatcagcctt accattgatg ccgccgagtg gttcggttgt 29640gaagcaccgg ttattgtacc ggttgagatt gacctgccga agaaagcgcg tcaagcctac 29700atcgatatgg aggagaagtt attcgcggaa ctggagagcg gagaagttga agcggctaac 29760gccgccgcta aaacggctaa gtgcttgcag attgcttccg gtgccgtgta tgtgtcgggg 29820ccggatggtg aagcaacgaa agactgggag aaagtgcacg acgcgaaact cgatgcgtta 29880gagtccattg tcgaggagtt gcagggtgcg ccgctgctgg tggcctatca gttcaagcac 29940gaacttgagc gcattcttag gcgattcccc caggcgcagg cgtttgcgaa aggtgctaag 30000ggtaataagc agatggaatc ttggaaccgc ggggaaatcg agattttgtg cgtgcaccct 30060gcatcggcgg gccatggttt gaatttacag

gacggcgggc atcatctggc gtttatttcg 30120caaggctgga acctggagca ctatttgcag gttgtcgagc gtataggtcc tgtacgccag 30180aaacaggctg gccacgagcg tccagtgttc ctgtatcaca tagtcgctaa agacacgctg 30240gatgaggtcg ttgccgcgcg tacggacgag aaaaaatctg tccaggaaga gttgcttaat 30300tatatgaaga gacgaggtaa gagatgaata atgagtttga tatcgacgct tgcaacgaat 30360tgataaaaga cgccattaat tcccgcgagc aacttctagc tatgcaatta aagcgagaaa 30420taaaacgtat cagggaactc gaagaagagg ttttacggct acggcagcaa agagacgctg 30480ctaacgcgca acttgactgg ctactagaac aacaggaagt tgacaaagag aggggcgcta 30540aatgaaatac tcaattggtg cgaaatgctt tttaataggc tacggattgg ctgcggtcgc 30600tttacttatc gctgctgtgg ttctgttatc ataaattaag gccccttacg gggcctttac 30660tatttatgcc aaagttaatc ttgtatagct tccatcggcc cgcttaacta acgctttaag 30720gctatcgccc tccagataca gtgatataga cccgttatcc ctgacagcgt tgtctggtag 30780ggcggacatc gctaccggta tctcaacagc acgataatcg cccctattta tttttaatga 30840cacggcatcg ggcaagctgc ccgaaatagc tgtgacttct gtccacgctg aaccagaacc 30900tgggccgccg tttatgtggg agtacacgga accactatca agggtctttg acagtttatg 30960tatccgtaac cgaagcgccg cagaatcatt attgaaactg tttatgcgag agttaccaag 31020accttcctcc atcaaattgg ctacgttaat ccttgagggg tctacgaagc cggttatacc 31080acttaccgtg gagttaggcg cgtctatcgt caacccctgt ccactagtgg agcgtatgcc 31140taccaaacga agaccgttca cacggcaggc cccggagatg tagatctgat tcgctggaaa 31200atctttagta tttgtgtcga ttatagcaat attagtgaat accgtttcgt gagtaagaag 31260atatgcaccc gaaccagcgc aatcctcgac ggttatgtta gagacataca gacctttccc 31320atccatgccg aaacctacgc ccaaagaacc cctaaccagt agattgtcga tcaaatggtt 31380tagggggagc atatgtaccg ggtattgaga atacgggaaa tcccccgggc ggtcatcttc 31440tgggttcatg tcggtatctg cgcctaaatc gaagccgtcc catacagggt atagcaccgc 31500cgaatcccgg aattgcaggt tgtagttacg agaggtcgta gaacctaccg tgccttgcca 31560tgttttaaca ccactttcgc cggcgcgata cgaggtaaac ccgatgaccc cgccatcgcg 31620cgcgaaaccg ccattgtttc gtaagaattg agcgctactt accgaaccgt aacttgtgcg 31680cccgccaata acatagttac ccttgcccca atcgccgctc aggttttcaa aggtaattac 31740gccatctttt ccgccgctcg ggttgtcagc gtctaccatc ttacagaaat ggcatccgcg 31800gaacaggaaa cacgccataa gaccactcgc ccggtgaacc tcgacgcctg tacattcccg 31860aatttccagg gtagaagata tgctttgccc tttagcttcc ggagggagaa gggattctat 31920accaggaaac ttggcgtaat cgtttaccgt cggctggtat ccatctgttt tagactgttt 31980aagtgtggcc acgattgccg cggggtcggt tatccactga ttatcgtcgg tccacggttt 32040taatcaccca cggcgttgta gcactctcca taaagggggc tattacaatg gaacctttac 32100ctaattgcgt aaataccagg tttccgtcgc cgataaactt cgctttacag tcgatggtca 32160gggtcttccc gctgaagtta acggtctcgt tattactgaa agtgtaatcg cggtcgataa 32220gaacgctatc aacggcggca tccgccaatt gttgtaacgt agtaaagtcg gacagcttaa 32280cggagtattt aaatttctta tccgcttccg cgcgaaaggt aatatctccg aacgcgaccc 32340aagcggaatc cgaaatgccg cctgtcgtaa gaggtgtcga cgccgcaggg ataactttcg 32400gcagggggcc acgccatgcg taatagttac cgtccccgcc atcttctttc ggccaaagaa 32460ccgctttatc cgcgtcgttt acgccgagag tacccccggt cgtaaagtta aaagatgccg 32520gggagaaacc agcatcacgt aagactgcgg gaagcgtctt ctgcgtctgc ccggttacct 32580ggttagtggc gtagtcgata tccgcaccac cagctacacc gccttgttta ccggtgatca 32640cctcggcttc gaaaatctgg tgttttttag ctatttgtaa atcattaagt gacaatacat 32700caccgcaacc gctggacata tggctatcct cttagttaaa accgttatcg aatccgctgg 32760agaacgcacg accgaaagga ggcacgttgt caaacttata gaaatccttg tcatagttaa 32820acccggttat tttgactgtt ctgtcatcgc cagggtctac cgtagaaaca agaatcatct 32880gagcattatg ccttgcttcg ttgccgaatg aaaattcagt tttcaaagcg ctattaccag 32940tgtaaatggc ttcttgcggc acagacgtca taattacttg tcggtcatgt gcgccaggga 33000caacacgaac actttggact ccgccatcac gtaacttcag aaccaaataa tggtcatctc 33060cggatgtgaa cttaaccggc tgggatagct ctacggtaag accgttaacc gcggttacgt 33120agccgtcgta agtagacata cgcgaaccct taaccacact aacggcacga ttcggaaggg 33180caaaaatacc ctcttcagtg gcggtaaacg acaccgaaat tttctttaaa atgttcttct 33240ggtggcgacg gtttgccgcc cagaaagcct gcttatagtt gcggattcct tttgagtcgt 33300aagtctccgt tttaaggccc ccggtttcgg gtatggttat agtctctttg acgttcgtct 33360tagggtctat gtacgagaat ttaaggctgt caaaaacctg agaatcgtta aatgttctgg 33420tccacttttc agaagtaccg gccttgcttc ggtgggtgaa caccatctcg gggcccatgc 33480gagggcgctc aaaatcgaga aggatatccg ccccacgccg atatggggtg cagaatatgg 33540cgtctgctat agtactaact atgtcctgca tggtggtttt atagtcatca aacgtgtagc 33600aaaattcccc cgcctgtttg tcaccgaaat acgcttcgac ctcgttctgc acggcaagta 33660acttatccat gttgcgtacc gtcaggttta aaccacccac gtccgggtca cgtgccaggc 33720ggatgagaga ttgcacggcc tgggtattgg gagtcatcgt atcctcaaaa acgccattac 33780caaggtattt gtataccatt tcagtagcaa tcatacgcaa ctgcggttgc ttaacttctg 33840cagcacgcgg tgtctgcttg cgcatcgagt gtacagtagt tctgttgccg tagtgcggag 33900tgttatcgcg tgtttgcccg tacaagttaa cgtacgttat ctcatcaact acagacccct 33960cgaaattaaa gtcgaggtct gtcacccttc tggcgcgcac ccgcaccctc gacacaaccg 34020gcaggtcggc gtaaatagtg acaccgttgt agtctggggt tcgcccggac acggttcctt 34080gtgcagtgta tatcggccca taaggggtgc tattttcatc aagcagctgg tactgtatct 34140ccgcggtaac cgacgctagt gttttagatt tgccgttgtc tttatacata ccattggcgg 34200cggcgatatt ggcaactatg cgctcaacct cggtacggtt tattgacacc caatcggtta 34260aggttttctc gtatgtgtta tccggttgca gcgacgcctc tccgtcacct cgaaaaaatg 34320aacctggtct tatttcttgc caccgaccga taaggccgcc aggtacaata aatgtaattg 34380tcccttcgga tacgcttaac acttggtacc cacccccgga aaggtcaaca tctgtatttg 34440tccacgctga caccaacgaa aacgtgtcat taggcaccaa cactccagaa aaatccgaac 34500cacctgttgg gtcatatatt gtgccaatgt tcccggacaa agacgggtac ccggacatgt 34560aagagaaaga aatacccagg ccgttgggag ctttaagaac cacgccatct acttcgttag 34620attctacggt aatgtacagg ccctgctcta tagggtcgcc gaccatgacc tggggtgccg 34680atgtgttatt gggcgatgta tatggtgagt acacggcaac cgacgtgcct gttatgtctg 34740atacgcgggt gtccccgtca gttatacctt cagggtgtat gtctaggtaa ccacgcccgg 34800cgtcgtaata gccgtactct acaattttac cagcggcgtt aaacacctta taagtagaca 34860taaggttatt tgggatagtt tgcaccgttc cgcagatgtc gtagctgcgc tcgtatgggc 34920gggccttgtt gttacggtcg gtgagactgt tgttcgggga atccgcctgc gagttcgcaa 34980ggttagattg acgccccttt cactgatggt gataatagtt tcgctagcgg tttaaggata 35040acgctaaaaa tcttcattac gcctttaatg gcaccaccac cggcagattc cacaatgtgg 35100aaagtcgcgt tttctttcag tgcttcgaag tcttctgtta cgtcgttatc ttctccgatt 35160tcgtcaatga aaacacgcac cggcaccccg tccggaacat ggttcacgac gaagttcatc 35220ggattatcgc gataacgttt aacgtcaaac gtgccgtctt cgttgcgggt atagtggatt 35280actagcgcca aaattcaatc tccgaataag tatctttaag gtcttccaga ctatccagtc 35340taacctgtct ggacgccagc tcacagtggc ttaccattcc ttcgtaatat accccagcat 35400gccacactat tcgcccccta tgtttcactc ctagtagaac cgcgtcaaaa ttctgcggtg 35460tgaccgctcg taccagacct ttcggattag agtggccatc gtcgaaggcg gcgcctattg 35520ccgttgggct tgttacatcg aacatcggtg tcgataaccc cgcgtccgcg cgaacgttgc 35580ggacgtgatg ccagcaatta cggcggcgaa agtcatacgg caagccagtg taatcattaa 35640tattcacgat gtcagtatcc cgcgaagtaa gggaatctct tccggtgtca tcagaatccc 35700tgttgcccgt tggttaagca tcggcgtacc ggtttccgct gtgaatacgc ccttttcttg 35760cgtgagtgtt tgtaactcgt acaccaccgg accgtcgcat gggtatgtca ggtcggtact 35820tacataacgg cggaagatga atttaggtaa ctccttatta tcatagggga tgcggtccat 35880ttcctcgtct agtatgttaa gcacatccgg cagcgaaaag gatgcggtct ggtccatatc 35940gttattgttg gccgcgttct tggcctccat tggcgtacct tcgaatgtca cgacctcccc 36000ggtctcaaga gtagctgtta aatcgtcagc cccgcgcaca agtaaccacc gtttcgagag 36060aagtggatgg tatatctcaa gagttataaa gtccatctca ccatcgggat tagacgctag 36120tttacgtcgg tatgctgctt ctactgattc ctgactcatt gcatagggtc ccagattcgg 36180gggaatgtag tctgatacac tccgtatgtt ttaagaaatt cgcccaggca atcaccatag 36240cacccgtaca aatcgggtag gttctggttc aggcaagcat tgttggtttc ctggaatggt 36300gatttctcgg cggtggccgt gaaggtgatt acccaattct ttccgtcatc tgtggactcg 36360ttccacgtgg atgttaacgt tacctggtaa tcctcaatac cctgacccaa gtcgtgcttc 36420atccagaaac tggacgcacc accgtctacc ttttccatga aactgaggaa tgcctgccgc 36480cccaacggcg atacgaccag ggtaacgtta atcggaaaca cgtcaaaata ggtgtcgcgt 36540ccctggcgaa ccccgccacc ggccaggtct acccgccaca cgttgttacc gcgggtcatc 36600gagtagcctt tcgatactat aggcctcaaa gaggccggga aatggtaatc gctcatatca 36660atatcctggt tggccgcgtg tagcgcgacg tgacttagaa atggcgctgt tactatcttg 36720taacgctgaa cttacggttt cactgattat aatacgtaaa cgaccttcgt catcgcgttc 36780tgttgcagcc gaatcaattc ttccagtggt gttgttcacg atagtaacat tatctccacc 36840ggatttagcg ccattctcgc ccataatctg tcgcatctgc tccgccgttc ggacacggga 36900ggcgttggca ggcataatca cttctggttt accgcgttcg gcaatagtag acatctggcc 36960tgcggccagg ttgccgccct gctcgcgcgc ggagcgaatc ttacccacgt tggcgagacc 37020tgcggctacg gcagcagcag cagcaactgg cgctaaaaat ggccctacta ctgggatggc 37080cgccgttgat ttatacgctt ctactgctga cgtgtacgta gcgattgtcg cctgtgcgat 37140ggcaaatgct ttatatgccg ttgatgcttc ccctaacgcg gaccctatgt tgctcgccat 37200attgccgaaa gccgcgccgg tcgccttcgc tcggtcaagg gagtaagatt catccatggc 37260gcttaacgtt tgttggtaag tttcttcggc aatcaaaccc tgcgcatgaa aatcgttaag 37320tttttgtagc ttgacctcgt actgccggtc taattccgca aattctcctt cagcaagggc 37380ctgcatctga gcgacatacg catccgcgga gaactgtttt tccaggcgct ctttctcgcg 37440tttatctaac tcagcctggc gggccgtatc cgcctcgagc ataatctgcg tcttagcggt 37500ttcgtattgc tggtcactaa ggagacggtt gctgtagaac tcctgtagct tagtaagttg 37560ctcttcttgg ttagcttgta tcttctggaa tacgtcgtcg ttaaggtgga ttgactgata 37620atagaaatcc tcagcggctt tcttctgacg ttcgaatgcg tcgacggatt tcttagcagc 37680attgtccgcg gaatcgccta cagaaccgtt gtctttaccc gacactttaa acttaccaag 37740accctcggcc ttggccgctt ctttatcgat gtcgtaagcc gcgcgcttca atgcgataag 37800gtcttcctga gcttctacct gttcacggaa acttttacgt gtcaggtcag tcacagctct 37860ttgggtatcc atagcaagcg ctaactggaa gttaaggttc ttggcctcga ccaccgactc 37920accgggggtc agcgccgcct ttaccagacg accggcgtct tgtgcgccct taaccatatc 37980ttcaaaaaac cgctccatcg ccgtgaattc ctgggcgata aagtccaggg cgtccgccgc 38040ggattcggct atcgtagaag cggtttcttc tccgctcccg gtgatgcttt cgctggtata 38100gttccaagcg gagtttaaag cgtttagggc gtctccaacc atcccgaagg cggcgtcgaa 38160tgaggcctct atagcacctc cgacttcgga cgccatatca ccccacatct tcatctcagc 38220gacaaactca cctgacgcta cccgagaatt tatctcctgt atcaggtcat caacatagcg 38280taaaggttcc gccagtgacc ctacatctat actagtggca agggtcatct tcaactgaga 38340ccatgagtct tctgcgctag caatagcgcc attgagcgtg ttcgcctggt ctgccatagc 38400gcccgcgaag ttcacgttac ctatgttaag aagatactgc tcgatatcgg cggcattttt 38460cttaactaca gtggttgttc cctggaaggt gaattcgata tccttttggt tctgcttggc 38520cttgataccg aattctttca gacgttcgaa ttcaaatgta ctcgcatccg ccaccgcttc 38580aatcatctgg ctaaggtctt tacccatcgc cgacgcggta ttgccgtaag agcggagcgc 38640ttcttccgat ggagttaggc ctagagctac cagcttacgg aatccttcga ccgcttgctc 38700aagtccgtaa ggggtgtcgc gggcgaagtc ctgtaagata ctcagggcct gctttgcgcc 38760ttgcgtgctt cctgttagtg ttttcaggct ggcggacatc ttgtcgagtt gccgttgtga 38820ctcgactagt tcctgcgccg ccttataggc tgtagcggct acaacggcgg ccaggccggt 38880gacagcggcg cccgcaactt ttgcggattt agagaggtta tcaagacggt ctgatgtggc 38940cttcgcgcct tgttcggtta cctttactac taagctagct acatcagcca tcgtttctac 39000cctcaaaaat ggcgtctaag cccatgataa tttcagattc aaacatccct atattctgac 39060ctgaaatagc gctatacgcc actaaatctg accaactaag ttgctctctt gggtatagct 39120ttacgccgtc gtcatcaacg cggcgggtga atttaacatc acgatacttc tcaaaagtgg 39180tgagtagttc aggggggcat tcaggcccgg cgtcctgcgt tgtttcttcc gcgtcttcta 39240ttacccccat agcgataagc gcggctttgt gcccgtcggc tatactgtca aacttgcgcc 39300tttcgtggcg ggttatgaag ttccaacggg cgaactgaaa caacgcgtct acttttcctg 39360caattggcgc aactgctcat ggtggaatac gactacatgt tctgccaggc gcttatattg 39420ggcgagaaga gtctcaagat tttccttagt gaactcgtca tcaagactcc agccattcac 39480caatttcgag ggccaattgc cggtttaggt ctcccgccgc gtcttccatt tttaaattgt 39540attctgagaa gtctttttgc tcttcgcatt tatcccgaag cggttttaat ttacctaccg 39600ccgctcggta cgccagggtg aaggcccgca tagctttaac cgcaacatca gcctcaggag 39660agacaacgtt caaccattcc cctgaatctg taccatcttt taaaggaatc ggcatacgcg 39720cgccttttct cggcttctgc ttcgtagtaa aaatcgctaa gtttcatagt aatacccttt 39780ggttagtcgg ttactggttg gtagttgcgc caggcgggaa ccacccgctt ttccggtgcg 39840accgtaggcg ccaaataaga ataacaaaat agcttgcata accgttaata gtggcctatt 39900atccttacgt caactaaaca atatgaggtt aagaacatga ggcgtttcta tcggtgttat 39960cgcgtttatc tatttcatcc cgttcctggt agccttactg cgtaatcata aagctaaatt 40020aggaatcttt gtatgcaatc ttctacttgg gtggattctt ctgccgtggg taggcgctct 40080catctgggcc tgtaactcta acgttaatgg taaataatct ggcttaatta aaattacatt 40140attagaatca gatttgtctt aaacaatcag gggaaataag catggtcact cgcaaaataa 40200cagatgaaca gttgcagcaa gagctaaacg ctggtctcgg cccgaccgaa atagccaaaa 40260agtacaacat gtcccgccgt aatgttcagc ttagttctgc gcgtctggca aagaaaggag 40320ttggtcacgg gcgtgacgta agccacctgg tgccggatgg gtataagatt aagggtacgt 40380cgtcactggt ggatgagttc ggcaatacga aacttcagtg ggttaagact gacgccgacg 40440ccgagcgtca ggtcgagttg atgcgagccg taatagatgg gatgaagtcc gatattacgc 40500cagtttcttc ggtccctcgg cctaaaaagc gactaaacga aaagttgcta aatctttaca 40560cggtttctga cttccattta ggtatgttgg cctgggcgga tgagagtggc gacgactggg 40620atatgaagat tgcagaagac ctgttctcga gatggttcga cgcggcgttt caaaagcgct 40680gatgcggtgt gggtgttatt aacctattag gggactttgc gcattttgac agccttgatg 40740ccgttacgcc tgccagtggc catgtactgg acgcggacac gcgttaccag aaactggtgc 40800gctacatgat tcgtatggtc aggcgcgtgg ttaatatggc gcttgttaag cataaaaatg 40860ttcatctcct aattgtgcaa ggaaaccatg acgagtcagg catgatttgg ttggctgaaa 40920tgtttaacac tctttacgat aatgaacctc gtgtttttgt agatacatcg gctgatgtct 40980acaagatggt ccaacacggt aagacgaccc ttttctttca ccatgggcat aaggcgagat 41040tcgatgctat cgaaccggtt atgatcgcca agttccgtaa ggcgttcgga gagagcgttt 41100acagttacgc ccatgtgggc caccttcacc atcagaagat tgtggaaagc cgtaacatga 41160ttgttgaaca acaccgcact ctcgcggcga aagatgctta cgcatcacgt ggtggatgga 41220tgtcaggccg cagcgcgaat gttattactt acagtgccga atacggcgaa gtcgcgcgtt 41280taactatttc accggagatg ctgggatgac taacaaatac aatcgcacaa tgacaaatac 41340tgacggagat agcattacct gtgatgtgta cgacgttctg agggcatttg atatccgcga 41400cccagcgcta cagcatgcgt tgaagaaact gttgtgcatg ggcttgcggg ggcacaagga 41460cacaggaacc gacttagcag aagcaattga aagtctggag aagttacgga aataccgtag 41520taatattgat gagtgaggca tgatttggtt ggctgaaatg tttaacactc tttacgataa 41580tgaacctcgt gtttttgtag atacatcggc tgatgtctac aagatggtcc aacacggtaa 41640gacgaccctt ttctttcacc atgggcataa ggcgagattc gatgctatcg aaccggttat 41700gatcgccaag ttccgtaagg cgttcggaga gagcgtttac agttacgccc atgtgggtca 41760ccttcaccat cagaagattg tggaaagccg taacatgatt gttgaacaac accgcactct 41820cgcggcgaaa gatgcttacg catcacgtgg tggatggatg tcaggccgca gcgcgaatgt 41880tattacttac agtgccgaat acggcgaagt cgcgcgttta actatttcac cggagatgct 41940gggatgacta acaaatacaa tcgcacaatg acaaatactg acggagatag tattacctgt 42000gatgtgtacg acgttctgag ggcatttgac atccgcgacc cggcgctaca gcatgcgttg 42060aagaaactgt tgtgcatggg cttgcggggg cacaaggaca caggaaccga cttagcagaa 42120gcaattgaaa gtctggagaa gttacggaaa taccgtagta atattgatga gtgagaaaaa 42180ggcccctttc ggggcctttt ttttatcgtc acaataaaga atctgatttg aacgataagc 42240atgttcgaag ttaaatataa ccataccaac aagaggagat gaaaccatga acgaattaat 42300gaatgttagt gaagcacaaa ccatgtccag ccgtgagatt gcggaactga caggtaagga 42360gcataaaaat gttctggctg atatccgcaa aatgttgtct gagattcaat cggctgaaaa 42420gtcagccgat tacaaagaca gcaaggggcg cacgtataaa atgcttcttt tggataaaga 42480ggaaacgtta attctgattt cagggtacag catcaaaatg cgcgctgcca tcatccgccg 42540ttggcaggaa ctggagtcac aagcgagcaa accatcctta ccggtgccca agacaatggg 42600ggaggcttta aggttggctg cggacttgtg ggaggagaaa gaacgccttg cgcttgagaa 42660caaggaaatg gcaccaaaag ctgatgtcta cgaccgcatc atcgacagaa ataacttgta 42720caacgcgacg caggtggctc agaagttcgg ccaatctgcc gtgtggatga ataaacaact 42780tgaacaattt ggcgtataca atcgctccgt aaaacgcggt cgtgtcttcc agcaatggtt 42840tgtggataaa ggctacggca tcatgaggga aacagaaact gggcattcac aggctatgtt 42900cttcgctgaa ggagagatgt gggttattgg taagttaacc gaagaaggct tgatttaaaa 42960ctaaggcccc tttcggggcc tttttcttag gcgtacttaa tgcgctgaat aacaattgaa 43020gactggaact ggttaccggt tgcctgtccc tcaagagaaa gggtaataga ctcagggccg 43080ccgatttcag gagttgcgga cgtcagtgaa gcacgcttga gtgtaaagct catagcgcca 43140tccggaccat caagaaccga agatacctcc atttctgttt cattccagga atttattcaa 43200caacgtcagg tcgtacagtt tacccgccaa cgagaaggta ttagcggcgc gaccgcgctc 43260aacaaatgcc acgctgttat tcccc 43285224DNAUnknownSP-1 bacteriophage 2gtcgtgactg ggaaaaccct ggcg 24324DNAUnknownSP-1 bacteriophage 3tcctgtgtga aattgttatc cgct 24

Claims

1. A composition for prevention and treatment of Salmonella infection, comprising: bacteriophage SP-1 harboring the genome represented by SEQ. ID. NO: 1 as an active ingredient.

2. The composition for prevention and treatment of Salmonella infection according to claim 1, wherein the bacteriophage SP-1 has Accession No. KCTC 11737BP.

3. The composition for prevention and treatment of Salmonella infection according to claim 1, wherein the composition is a feed additive, drinking water additive, or disinfectant.

4. The composition for prevention and treatment of Salmonella infection according to claim 1, wherein the Salmonella is Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Pullorum, Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Dublin, or Salmonella Durby.

5. A method for prevention or treatment of Salmonella infection, comprising the step of administering the composition of claim 1 to a subject animal.

6. The method for prevention or treatment of Salmonella infection according to claim 5, wherein the bacteriophage SP-1 has Accession No. KCTC 11737BP.

7. The method for prevention or treatment of Salmonella infection according to claim 5, wherein the composition is administered to the subject animal in the form of a feed additive, drinking water additive, or disinfectant.

8. The method for prevention or treatment of Salmonella infection according to claim 5, wherein the Salmonella is Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Pullorum, Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Dublin, or Salmonella Durby.

Images