METHOD FOR PRODUCTION OF RECOMBINANT HUMAN THROMBIN

Abstract

The present invention relates to a method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation (and claims the benefit of priority under 35 U.S.C. §120) of U.S. application Ser. No. 12/167,614, filed Jul. 3, 2008, which claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 60/948,207 (US) filed on Jul. 6, 2007, both of which are incorporated herein by reference in their entirety.

TECHNICAL FIELD

[0002] The present application relates to a method for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin.

BACKGROUND OF THE INVENTION

[0003] Thrombin is a key enzyme in the coagulation cascade. By thrombin mediated proteolytic digestion of fibrinogen into fibrin monomer, a cascade reaction leading to clot formation is started. Clot formation is the first step in wound healing. In addition thrombin is a chemo attractant to cells involved in wound healing, and, the fibrin network formed act as a scaffold for collagen-producing fibroblasts, increases phagocytosis, promotes angiogenesis and binds growth factors thus further supporting the healing process. The rate of clot formation is dependent on the concentration of thrombin and fibrinogen. Because of the important function in clot formation thrombin has been utilised in a number of products intended for haemostasis and/or as tissue sealants or "glues", both as stand-alone products (i.e. Thrombin-JMI) or in combination with fibrin or other compounds (i.e. Tisseel, Hemaseel, Crosseal). The potential fields of use are numerous; skin grafting, neuro surgery, cardiac surgery, toracic surgery, vascular surgery, oncologic surgery, plastic surgery, ophthalmologic surgery, orthopedic surgery, trauma surgery, head and neck surgery, gynecologic and urologic surgery, gastrointestinal surgery, dental surgery, drug delivery, tissue engineering and dental cavity haemostasis.

[0004] So far the thrombin in approved thrombin-containing products on the market is derived either from human or bovine plasma. Using plasma derived protein confers several disadvantages as limited availability and safety concerns such as risk for transmission of viruses and prions and the risk of triggering autoantibody formation (bovine products). Cases where antibody formation due to bovine thrombin exposure has lead to significant bleeding disorders are known.

[0005] In vivo thrombin is obtained from activation of prothrombin through the coagulation cascade. Activation through the coagulation cascade is dependent on the presence of a functional GLA-domain containing 8-10 glutamic residues converted to gamma-carboxyglutamate. In vitro, also incomplete gamma-carboxylated prothrombin can be converted to thrombin by the use of prothrombin activators such as ecarin. Ecarin, a snake venom derived from the Kenyan viper Echis carinatus is a procoagulant, a protease which cleaves human prothrombin between residues Arg₃₂₀-IIe₃₂₁ to generate meizothrombin. Further autocatalytic processing results in the formation of meizothrombin desF1 and then alpha-thrombin, which is the mature active form of thrombin.

[0006] An ideal commercial thrombin manufacturing process would use a recombinant thrombin precursor and a recombinant protease produced at high productivity without addition of animal-derived components. Further requirements would be robust performance, convenience and low cost.

[0007] A big obstacle for efficient recombinant human thrombin (rh-thrombin) has been to obtain high yields of prothrombin. Although extensive efforts have been spent, obtaining high yields of prothrombin under conditions suitable for production of biologicals has long remained a challenge. Yonemura et al. (J Biochem 135:577-582, 2004) have used recombinant GLA-domain-less prethrombin digested with recombinant ecarin to generate recombinant human thrombin. The productivity of prethrombin at process scale was 150-200 mg/L, which is a modest productivity for commercial scale production. Recombinant production of ecarin has also been described in WO 01/04146. In this publication generation of rh-thrombin is exemplified by conversion of recombinant prothrombin produced in COS cells by a recombinant ecarin produced from CHO cells. However, the exemplified methods are not suitable for large-scale production and animal-derived components are used.

[0008] Recombinant ecarin is produced as a prepro-protein that needs to be activated. Problems to efficiently activate the r-ecarin are described in both publications and the suggested activation procedures are far from optimal.

[0009] Thus there is a need for improved methods to obtain recombinant human thrombin. During our efforts to obtain improved productivity of gamma-carboxylated human prothrombin we made the surprising discovery that co-expression with gamma-glutamyl carboxylase (GGCX) vastly improved also the productivity of incompletely carboxylated prothrombin (see WO2005038019).

[0010] The present invention describes a process to efficiently produce human thrombin from recombinant prothrombin obtained by the expression method as described in WO2005038019. Recombinant carboxylated or incompletely carboxylated prothrombin combined with recombinant ecarin has not previously been used for manufacturing of recombinant thrombin. Further, the procedure for activating recombinant ecarin is new. The methods described would be suitable for large scale rh-thrombin manufacturing without the addition of animal-derived components.

SUMMARY OF THE INVENTION

[0011] According to a first aspect of the invention, a method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.

[0012] According to a another aspect, a pharmaceutical composition is provided comprising a recombinant thrombin according to said method, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants.

[0013] According to further aspect, an isolated DNA sequence is provided coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.

[0014] According to another aspect, a vector is provided comprising an isolated DNA sequence coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.

[0015] According to yet another aspect, a cell line is provided comprising a vector comprising an isolated DNA sequence coding for recombinant ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1. FII+GGCX construct (SEQ ID NO:1).

[0017] FIG. 2. Ecarin construct (SEQ ID NO:3).

[0018] FIG. 3. Example of a process outline for thrombin manufacturing.

[0019] FIGS. 4A-4C. Nucleotide sequence alignment of the nucleic acid sequence encoding recombinant ecarin (SEQ ID NO:2) used in the present invention and wild type ecarin nucleic acid sequence (SEQ ID NO:4).

[0020] FIG. 5. Amino acid sequence alignment of recombinant ecarin (encoded by SEQ ID NO:2) used in the present invention and wild type ecarin (both having the amino acid sequence of SEQ ID NO:5).

[0021] FIG. 6. Graph showing the activation of recombinant ecarin during cell death over time.

[0022] FIG. 7. Activation of recombinant ecarin in cell cultures over time, assayed by SDS-PAGE.

[0023] FIG. 8. Chromatogram from CIEX purification of rh-thrombin.

[0024] FIG. 9. Non-reduced SDS-PAGE analyses of fractions obtained by CIEX purification.

DETAILED DESCRIPTION OF THE INVENTION

[0025] The invention consists in one part of a cell line derived by stable transfection with a vector (FIG. 1) encoding human prothrombin (FII) associated by suitable control sequences and human gamma-glutamyl carboxylase (GGCX) associated by suitable control sequences. Control sequences should be chosen so that prothrombin expression is in excess of the GGCX expression by at least a factor of 10. The host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NS0, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S. The obtained prothrombin producing cell line is grown under culture conditions optimised for high yield of prothrombin disregarding gamma-carboxylation. Vitamin K may or may not be added to the growth medium.

[0026] It will be appreciated that the invention is not restricted to a particular prothrombin or gamma-glutamyl caboxylase or protein encoding sequence of one of these proteins to be co-expressed. Moreover, and in particular with respect to blood coagulation factors, numerous mutant forms of the proteins have been disclosed in the art. The present invention is equally applicable to prothrombin and gamma-glutamyl caboxylase mutant forms, including naturally occurring allelic variants, of the proteins as it is to wild-type sequence. In one embodiment the invention can be undertaking with any wild-type protein or one with at least 90%, preferably at least 95% sequence identity thereto. In another embodiment, sequences listed in Table 1 can be used.

TABLE-US-00001 TABLE 1 CDNA SPLICE GENE EMBL VARIANTS EMBL PROTEIN ACC# (PROTEIN) MUTATIONS ACC# Glutamate BC013979 2; BC013979; 1 SNP U65896 gamma AF253530 (EMBL# carboxylase U65896); 2 SNPs (OMIM# 137167) Prothrombin V00595 1; V00595 approx. 100 AF478696 SNP's (EMBL# AF478696)

[0027] Each of these proteins, including their nucleic acid and amino acid sequences, are well known. Table 2 identifies representative sequences of wild-type and mutant forms of the various proteins that can be used in the present invention.

[0028] The term "gamma-glutamyl carboxylase" or "GGCX", as used herein, refers to a vitamin K dependent enzyme that catalyses carboxylation of glutamic acid residues.

[0029] GGCX enzymes are widely distributed, and have been cloned from many different species such as the beluga whale Delphinapterus leucas, the toadfish Opsanus tau, chicken (Gallus gallus), hagfish (Myxine glutinosa), horseshoe crab (Limulus polyphemus), and the cone snail Conus textile (Begley et al., 2000, ibid; Bandyopadhyay et al. 2002, ibid). The carboxylase from conus snail is similar to bovine carboxylase and has been expressed in COS cells (Czerwiec et al. 2002, ibid). Additional proteins similar to GGCX can be found in insects and prokaryotes such as Anopheles gambiae, Drosophila melanogaster and Leptospira with NCBI accession numbers: gi 31217234, gi 21298685, gi 24216281, gi 24197548 and (Bandyopadhyay et al., 2002, ibid), respectively. The carboxylase enzyme displays remarkable evolutionary conservation. Several of the non-human enzymes have shown, or may be predicted to have, activity similar to that of the human GGCX we have used, and may therefore be used as an alternative to the human enzyme.

[0030] Table 2 identifies representative sequences of predicted proteins homologous to human GGXC (sorted after species origin) that can be used in the present invention.

TABLE-US-00002 TABLE 2 Data base accession Species #/ID Homo sapiens (man) NM_000821.2 HUMGLUCARB HUMHGCA BC004422 HSU65896 AF253530.1 Papio hamadryas (red baboon) AC116665.1 Delphinapterus leucas (white whale) AF278713 Bos taurus (bovine) NM_174066.2 BOVCARBOXG BOVBGCA Ovis aries (domestic sheep) AF312035 Rattus norvegicus (brown rat) NM_031756.1 AF065387 Mus musculus (mouse) NM_019802.1 AF087938 Opsanus tau (bony fishes) AF278714.1 Conus textile (molluscs) AY0044904.1 AF382823.2 Conus imperialis (molluscs) AF448234.1 Conus episcopatus (molluscs) AF448233.1 Conus omaria (molluscs) AF448235.1 Drosophila melanogaster (fruit fly) NM_079161.2 Anopheles gambiae (mosquito) XM_316389.1 Secale cereale (monocots) SCE314767 Triticum aestivum (common wheat) AF280606.1 Triticum urartu (monocots) AY245579.1 Hordeum vulgare (barley) BLYHORDCA Leptospira interrogans (spirochetes) AE011514.1 Streptomyces coelicolor (high GC Gram+ SCO939109 bacteria) SCO939124 AF425987.1 Streptomyces lividans (high GC Gram+ bacteria) SLU22894 Streptomyces viginiae (high GC Gram+ bacteria) SVSNBDE Micrococcus luteus (high GC Gram+ bacteria) MLSPCOPER Chlamydomonas reinhardtii (green algae) AF479588.1 Dictyostelium discoideum (slime mold) AC115612.2 Coturnix coturnix (birds) AF364329.1 Bradyrhizobium japonicum (α-protoebacteria) AP005937.1 Rhodobacter sphaeroides (α-proteobacteria) RSY14197 Sinorhizobium meliloti (α-proteobacteria) RME603647 AF119834 Mesorhizobium loti (α-proteobacteria) AP003014.2 Chromobacterium violaceum (β-proteobacteria) AE016910.1 AE016918.1 Pseudomonas aeruginosa (γ-proteobacteria) AE004613.1 AF165882 Xanthomonas axonopodis(γ-proteobacteria) AE011706.1 Human herpesvirus 8 KSU52064 KSU75698 AF305694 AF360120 AF192756

[0031] Each of the above-identified GGCX proteins and GGCX proteins from other species can be used as the carboxylase enzyme in the present invention.

[0032] A second part of the invention is a cell line stably transfected with a polynucleotide encoding ecarin and associated control elements (FIG. 2). The ecarin encoding sequence may be optimised for expression in mammalian cells, but is not limited to such sequences. In one embodiment of the invention the sequence according to SEQ ID NO 2 or a homologue thereof is used to express ecarin. A homologue of

[0033] SEQ ID NO 2 coding for ecarin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 2. The host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NS0, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S.

[0034] In one embodiment prothrombin and ecarin are produced from cells originating from the same parent cell line. This cell line origin may be, but is not limited to, Chinese Hamster Ovary cells (CHO) including derivatives and NSO (myeloma BALB/c mouse) including derivatives. The purpose of using the same cell line background is to facilitate purification and evaluation of purity of the thrombin product.

[0035] In another embodiment ecarin and prothrombin are produced from different host cell line; i.e. CHO and NSO, respectively.

[0036] In one aspect of the invention use of recombinant ecarin is preferred as this facilitates detection of non-thrombin product derived components during the thrombin generation process and in the final thrombin product. In a second aspect recombinant ecarin is preferred due to reduced risk for exposure to allergenic or toxic components that may be present in ecarin derived from snake venom. In a third aspect ecarin from snake venom is not preferred due to batch variation and limited batch size of ecarin preparations.

[0037] The crude prothrombin and the crude ecarin are mixed and incubated under conditions that allow formation of thrombin, such as described in Example 3. Generated thrombin is then purified by methods described in Example 4 or by other methods known by persons skilled in the art. Alternatively prothrombin and/or ecarin can first be purified by methods known in the art and then mixed to obtain thrombin. Thrombin is then purified from non-product components.

[0038] An example of a suitable thrombin manufacturing process is outlined in FIG. 3.

[0039] A method is provided for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof. The recombinant ecarin can be expressed and secreted by a cell containing the gene comprising the nucleotide sequence SEQ ID NO 2 or a homologue thereof in CHO-S cells, which ecarin has an amino acid sequence equal to that of wild type ecarin.

[0040] In the above method the recombinant protrombin is subjected to recombinant ecarin, which recombinant ecarin can be isolated in active form after extra-cellular expression by CHO-S cells, said cells being left to apoptosis/necrosis for a time sufficient to activate said ecarin, whereupon a human recombinant thrombin is isolated.

[0041] The recombinant prothrombin can be produced by a cell-line comprising a prothrombin expressing gene having a nucleotide sequence comprising the sequence SEQ. ID. NO. 1 or an homologue thereof. A homologue of SEQ ID NO 1 coding for prothrombin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 1. The recombinant prothrombin can be a mixture of fully carboxylated prothrombin and incompletely carboxylated prothrombin. In one embodiment, the recombinant prothrombin is a fully carboxylated prothrombin and in another embodiment, the recombinant prothrombin is an incompletely carboxylated prothrombin.

[0042] A further aspect of the invention relates to the recombinant thrombin obtained by the method according to the invention. A pharmaceutical composition can be designed comprising the recombinant thrombin obtained be the method according to the invention, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants. The pharmaceutical composition can be in an applicable form.

[0043] In one embodiment thrombin produced by the described method can be used in the manufacturing of tissue sealants ("glues") in combination with other proteins, i.e. fibrin originating from recombinant cells, transgenic animals or human plasma. In another embodiment thrombin produced by the described method can be used as a stand-alone product, freeze dried as single active component or in combination with a non-protein matrix, or, in solution as single active component or in combination with other active components.

[0044] Suitable mix-in components would be, but is not limited to, collagen, chitin, degradable polymers, cellulose, recombinant coagulation factors and fibrinogen from transgenic or recombinant sources.

[0045] The potential fields of use for the tissue sealants ("glues") are numerous; skin grafting, neuro surgery, cardiac surgery, toracic surgery, vascular surgery, oncologic surgery, plastic surgery, ophthalmologic surgery, orthopedic surgery, trauma surgery, head and neck surgery, gynecologic and urologic surgery, gastrointestinal surgery, dental surgery, drug delivery, tissue engineering and dental cavity haemostasis.

[0046] A further aspect of the invention relates to a method for obtaining coagulation by administering a therapeutically effective amount of a recombinant human thrombin obtained using the method according to the invention to a patient.

[0047] Another aspect of the present invention is an isolated DNA sequence according SEQ ID NO 2 or homologues thereof coding for a recombinant ecarin. A homologue of SEQ ID NO 2 coding for ecarin may have at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to the sequence SEQ ID NO 2. SEQ ID NO 2 is a designed sequence that has been optimised for optimal expression. The sequence is particularly suited for expression in mammalian cell systems.

[0048] According to another aspect a vector comprising SEQ ID NO 2 or a homologue thereof is provided. Said vector can be designed to overexpress SEQ ID NO 2 or a homologue thereof and is operably linked to expression control sequences permitting expression of ecarin encoded by SEQ ID NO 2 or a homologue thereof. According to a third aspect a host cell comprising said vector is provided that is capable of expressing ecarin encoded by SEQ ID NO 2 or a homologue thereof. This host cell is preferably a eukaryotic cell. Typical host cells include, but are not limited to insect cells, yeast cells, and mammalian cells. Mammalian cells are particularly preferred. Suitable mammalian cells lines include, but are not limited to, CHO, HEK, NSO, 293, Per C.6, BHK and COS cells, and derivatives thereof. In one embodiment the host cell is the mammalian cell line CHO-S.

[0049] According to another embodiment of the present invention a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 2 or a homologue thereof and obtained by the method described in Example 2.

[0050] The sequence identity between two sequences can be determined by pair-wise computer alignment analysis, using programs such as, BestFit, PILEUP, Gap or FrameAlign. The preferred alignment tool is BestFit. In practise, when searching for similar/identical sequences to the query search, from within a sequence database, it is generally necessary to perform an initial identification of similar sequences using suitable algorithms such as Blast, Blast2, NCBI Blast2, WashU Blast2, FastA, or Fasta3, and a scoring matrix such as Blosum 62. Such algorithms endeavour to closely approximate the "gold-standard" alignment algorithm of Smith-Waterman. Thus, the preferred software/search engine program for use in assessing similarity, i.e., how two primary polypeptide sequences line up is Smith-Waterman. Identity refers to direct matches, similarity allows for conservative substitutions.

Experimental Section

[0051] The invention will be further described by means of the following examples which shall not be interpreted as limiting the scope of the appended claims.

EXAMPLE 1

High Yield Production of Recombinant Human Prothrombin in CHO Cells

[0052] The P1E2 cell line containing the construct PN32 shown in FIG. 1 having the nucleotide sequence SEQ ID NO: 1, was grown in a fermentor according to the method described in WO2005038019, using a protein and animal component free growth medium in order to produce prothrombin for use in thrombin manufacturing. The cells were grown either by batch or perfusion culture methods (Table 1) and the amount of prothrombin produced was measured by an ecarin assay. This ecarin assay was performed essentially as the Chromogenix assay (Molndal, Sweden) using purified plasma-derived human prothrombin (Haematologic Technologies Inc., Vermont, USA) as standard.

TABLE-US-00003 TABLE 1 Examples of yield of prothrombin in experimental fermentor runs Culture method & Viable cells Prothrombin Experiment ID time (million cells/mL) mg/L CC2LC (272-8) Batch, 238 h 5.9 281 CC2LD (272-8) Batch, 238 h 6.2 276 326-11B Perfusion, 259 h 18 722

[0053] The fermentor experiments showed that both batch and perfusion culture methods can be used to produce prothrombin suitable for production of recombinant thrombin (Table 1). The share of fully carboxylated prothrombin obtained in these fermentor runs was about 55-87%, the rest being incompletely carboxylated prothrombin.

EXAMPLE 2

Production of Recombinant Ecarin in CHO Cells

[0054] An ecarin encoding sequence having the nucleotide sequence SEQ ID NO: 2 optimised for expression in mammalian cells was synthesized and cloned into the Invitrogen vector pCDNA 3.1+(FIG. 2). An alignment of the nucleotide sequence of the recombinant ecarin used in the present invention to the sequence of wild type ecarin (GI:717090) is seen in FIG. 4. As can be seen in FIG. 5 this recombinant ecarin is 100% homologous to the amino acid sequence for wild type ecarin. This construct, AZ ecarin (SEQ ID NO. 3), was used to stably transfect CHO-S cells (Invitrogen). Ecarin is secreted by the host cell to the extra-cellular space, and in order to screen for ecarin producing clones, culture supernatant samples were removed and mixed with recombinant human prothrombin (rhFII) to a final concentration of 1 mg rhFII/L in assay buffer (50 mM Tris-HCl, pH 7.4 containing 0.1% BSA). This mix was incubated 20-40 minutes at 37° C. The thrombin generated by the action of ecarin present in the sample was then detected by adding a 1-2 mM solution of the chromogenic thrombin substrate S-2238 (Chromogenix, Molndal). Colour development was monitored and stopped when suitable using 20% acetic acid. To estimate the activity of the recombinant ecarin produced, snake venom derived ecarin with a declared activity was purchased from Sigma and used as standard. The best producing cell line obtained produced up to 7000 U ecarin per litre culture in lab scale shaker cultures grown in animal component free medium.

Activation of Recombinant Ecarin

[0055] The above method produces the recombinant ecarin as a pro protein Thus, activation by removal of the pro-part is necessary for optimal activity. To our surprise, we found that activation was most conveniently obtained by continued incubation of the culture for at least 7 days after the death of the ecarin producing cells (FIG. 6). The culture medium used was CD-CHO supplemented with HT-supplement, non-essential amino acids and Glutamax I (as recommended by Invitrogen for CHO-S), and growth conditions were shaker bottles at 37° C. in an atmosphere containing 5% carbon dioxide. Culture samples were assayed for activity as described above. As can be seen from FIG. 6, the activity of recombinant ecarin increased during the activation period.

[0056] Samples from culture supernatants were also separated by SDS-PAGE and blotted to nitrocellulose mebranes. Labelling of the membrane was performed with polyclonal rabbit serum directed towards the mature part of ecarin expressed as inclusion bodies in E. coli. "M" indicates the molecular weight marker and numbers refer to day of sample collection. As can be seen from FIG. 7 the recombinant ecarin remains stable for more than a week after the death of the cells. Activation of ecarin may also take place at lower temperatures, for instance as low as room temperature, but will then require longer times for activation. Ecarin will remain stable for severable months in room temperature in the presence of dead host cells. The activity will increase gradually until it levels out. A decrease in activity has not been observed except in the presence of bacterial infections or high temperatures. Efforts to use trypsin for activation of ecarin were made, but were not successful.

EXAMPLE 3

Conversion of Prothrombin to Thrombin by Ecarin

[0057] The ecarin protease converts prothrombin to meizothrombin, an intermediate form of thrombin that has thrombin catalytic activity. Further processing into thrombin is achieved by auto-catalyses. To determine the estimated amount of ecarin culture needed for converting prothrombin into thrombin, we performed a series of test digests. Different amounts of ecarin-containing culture supernatants as obtained in Example 2, were mixed with 1 mg/ml prothrombin (as obtained in example 1) in PBS buffer (Cambrex). Incubation of the mixtures was done at 37° C. for 1-3 hours. Samples were then analysed by SDS-PAGE to identify the amount of recombinant ecarin needed for complete conversion of prothrombin into thrombin. By this procedure we found that the recombinant ecarin was very potent; one litre of ecarin culture supernatant at 7000 U/L is capable of complete conversion of 64 grams of prothrombin into thrombin in less than 3 hours at 37° C. Normally recombinantly produced prothrombin has to be purified in order to separate fully-carboxylated prothrombin from the incompletely carboxylated prothrombin. However this is not necessary for the present invention as the recombinant ecarin is able to efficiently activate both the fully carboxylated and the incompletely carboxylated prothrombins.

EXAMPLE 4

Purification of Thrombin

[0058] Thrombin obtained by the procedure described in example 3 was purified by cation-exchange chromatography (CIEX) using AKTA-FPLC (GE Healthcare) and an SP-Sepharose HP column (GE Healthcare) equilibrated with 25 mM sodium-phosphate buffer, pH 6.5. Ecarin-digested prothrombin prepared as in example 3 was adjusted to pH 6.2 and a conductivity of approximately 8 mS/cm. Thrombin was eluted with a 1M sodium chloride gradient in column equilibration buffer over 20 column volumes (FIG. 8). Selected fractions were analysed by SDS-PAGE (FIG. 9). Thrombin activity was confirmed by incubation with the chromogenic thrombin substrate S-2238 (Chromogenix, Molndal).

EXAMPLE 5

Analyses of rh-thrombin Obtained

[0059] To further analyse the obtained thrombin, kinetic parameters were determined using the chromogenic thrombin substrate S-2366 (Chromogenix). Activity was estimated by titration with hirudin. The rh-thrombin was for all parameters; Activity, K_kat and V_max, similar to plasma-derived human a-thrombin from Haematologic Technologies Inc. (Vermont, USA).

[0060] Purified thrombin was also subjected to N-terminal sequencing: Reduced thrombin heavy and light polypeptide chains were separated by SDS-PAGE and blotted to Immobilon P membrane (Millipor). The excised bands were sequenced by the Edman degradation method. Heavy chain N-terminal first five amino acids were confirmed to be IVEGS, and the light chain five N-terminal amino acids were TFGS as expected.

[0061] Below are the sequences for SEQ ID NOS. 3, 2, and 1:

TABLE-US-00004 SEQ ID NO. 3 gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagc- cagtat ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggctt- gaccg acaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgt- tgacatt gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgtt- acataactta cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccata- gtaa cgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa- gtgtat catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgac- cttat gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtac- atcaatggg cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggca- ccaaaat caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtggga- ggt ctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcact- ataggg agacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtggaatt- ctgca gatatccaccatgatccagatcctgctggtgatcatctgcctggccgtgttcccctaccagggctgctccatca- tcctggg cagcggcaacgtgaacgactacgaggtggtgtacccccagaaggtgaccgccctgcccaagggcgccgtgcagc agcccgagcagaaatacgaggacgccatgcagtacgagttcgaggtgaagggcgagcccgtggtgctgcacctg gagaagaacaaggagctgttcagcgaggactacagcgagacccactacagcagcgacgacagggagatcacc accaaccccagcgtggaggaccactgctactaccacggccggatccagaacgacgccgagagcaccgccagca tcagcgcctgtaatggcctgaagggccacttcaagctgagaggcgagacctacttcatcgagcccctgaagatc- ccc gacagcgaggcccacgccgtgtacaagtacgagaacatcgagaacgaggacgaggcccctaagatgtgtggcgt gacccaggacaactgggagagcgacgagcccatcaagaaaaccctgggcctgatcgtgcccccccacgagaga aagttcgagaagaagttcatcgaactggtggtcgtggtggaccacagcatggtgaccaagtacaacaacgacag- ca ccgccatcaggacctggatctacgagatgctgaacaccgtgaacgagatctacctgcccttcaacatcagagtg- gcc ctggtgggcctggagttctggtgtaacggcgacctgatcaacgtgaccagcaccgccgacgacaccctgcacag- ctt cggcgagtggagagccagcgacctgctgaaccggaagagacacgatcacgcccagctgctgaccaatgtgaccc tggaccactccaccctgggcatcaccttcgtgtacggcatgtgtaagagcgaccggagcgtggagctgatcctg- gact acagcaacatcaccttcaacatggcctacatcatcgcccacgagatgggccacagcctgggcatgctgcacgac- ac caagttctgtacctgtggcgccaagccctgtatcatgttcggcaaggagagcatccctccccctaaggagttca- gcag ctgctcctacgaccagtacaataagtacctgctgaagtacaaccccaagtgtatcctggacccccccctgagaa- agg acatcgccagccctgccgtgtgtggcaatgagatctgggaggagggcgaggagtgtgactgtggcagcccagcc- g actgtagaaacccctgctgtgatgccgccacctgtaagctgaagcctggcgccgagtgtggcaacggcgagtgc- tgt gacaagtgtaagatccggaaggccggcaccgagtgtagacccgccagggacgattgtgacgtggccgagcactg- t accggccagagcgccgagtgccccagaaacgagttccagaggaacggccagccttgcctgaacaacagcggct actgctacaacggcgactgccccatcatgctgaaccagtgtatcgccctgttcagccccagcgccaccgtggcc- cag gacagctgcttccagagaaacctgcagggcagctactacggctactgtaccaaggagatcggctactacggaaa- g aggttcccctgtgcccctcaggacgtgaagtgtggcaggctgtactgcctggacaactccttcaagaaaaacat- gagg tgtaagaacgactacagctacgccgacgagaacaagggcatcgtggagcccggcaccaagtgtgaggacggca aagtgtgtatcaaccggaagtgtgtggacgtgaacaccgcctactgatgagcggccgctcgagtctagagggcc- cgt ttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgcctt- ccttgaccct ggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcatt- ctattctg gggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgg gctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgca- tta agcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgc- tttctt cccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgat- ttagtgcttt acggcactcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt- tcgc cctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctc- ggtctattct tttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgc- gaattaattc tgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgca- tctc aattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaa- tt agtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccg- cccc atggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtga- ggaggcttt tttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacagg- atgagg atcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggct- atgact gggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttcttttt- gtcaa gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcg- tt ccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggca- gga tctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgc- ttgatcc ggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttg- tc gatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcat- g cccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgctt- ttctg gattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgct- gaaga gcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgcct- tctatcg ccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatc- acga gatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgat- cctccag cgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaag- caatagc atcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatc- ttatcatgtctgt ataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgct- cacaattcc acacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattg- cgtt gcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcgggga- gag gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcga- gcggtatc agctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaag gccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgag- ca tcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg- ga agctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaag- cgtggcg ctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacga- acccccc gttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc- actgg cagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcct- aac tacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttgg- tagctc ttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaa- aagg atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattt- tggtcatg agattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatata- tgagtaaa cttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccata- gttgcctgac tccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagac- cca cgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaac- tt tatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgc- aacgttgtt gccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatc- aaggcga

gttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagtt- ggccgca gtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt- gactggtgagt actcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataat- accgc gccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttac- cgctg ttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttc- tgggtgagc aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcc- t ttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaa- ataaacaaat aggggttccgcgcacatttccccgaaaagtgccacctgacgtc// SEQ ID NO. 2 atgatccagatcctgctggtgatcatctgcctggccgtgttcccctaccagggctgctccatcatcctgggcag- cggcaa cgtgaacgactacgaggtggtgtacccccagaaggtgaccgccctgcccaagggcgccgtgcagcagcccgagc- agaaat acgaggacgccatgcagtacgagttcgaggtgaagggcgagcccgtggtgctgcacctggagaagaacaaggag- ctgttc agcgaggactacagcgagacccactacagcagcgacgacagggagatcaccaccaaccccagcgtggaggacca- ctgcta ctaccacggccggatccagaacgacgccgagagcaccgccagcatcagcgcctgtaatggcctgaagggccact- tcaagc tgagaggcgagacctacttcatcgagcccctgaagatccccgacagcgaggcccacgccgtgtacaagtacgag- aacatc gagaacgaggacgaggcccctaagatgtgtggcgtgacccaggacaactgggagagcgacgagcccatcaagaa- aaccct gggcctgatcgtgcccccccacgagagaaagttcgagaagaagttcatcgaactggtggtcgtggtggaccaca- gcatgg tgaccaagtacaacaacgacagcaccgccatcaggacctggatctacgagatgctgaacaccgtgaacgagatc- tacctg cccttcaacatcagagtggccctggtgggcctggagttctggtgtaacggcgacctgatcaacgtgaccagcac- cgccga cgacaccctgcacagcttcggcgagtggagagccagcgacctgctgaaccggaagagacacgatcacgcccagc- tgctga ccaatgtgaccctggaccactccaccctgggcatcaccttcgtgtacggcatgtgtaagagcgaccggagcgtg- gagctg atcctggactacagcaacatcaccttcaacatggcctacatcatcgcccacgagatgggccacagcctgggcat- gctgca cgacaccaagttctgtacctgtggcgccaagccctgtatcatgttcggcaaggagagcatccctccccctaagg- agttca gcagctgctcctacgaccagtacaataagtacctgctgaagtacaaccccaagtgtatcctggacccccccctg- agaaag gacatcgccagccctgccgtgtgtggcaatgagatctgggaggagggcgaggagtgtgactgtggcagcccagc- cgactg tagaaacccctgctgtgatgccgccacctgtaagctgaagcctggcgccgagtgtggcaacggcgagtgctgtg- acaagt gtaagatccggaaggccggcaccgagtgtagacccgccagggacgattgtgacgtggccgagcactgtaccggc- cagagc gccgagtgccccagaaacgagttccagaggaacggccagccttgcctgaacaacagcggctactgctacaacgg- cgactg ccccatcatgctgaaccagtgtatcgccctgttcagccccagcgccaccgtggcccaggacagctgcttccaga- gaaacc tgcagggcagctactacggctactgtaccaaggagatcggctactacggaaagaggttcccctgtgcccctcag- gacgtg aagtgtggcaggctgtactgcctggacaactccttcaagaaaaacatgaggtgtaagaacgactacagctacgc- cgacga gaacaagggcatcgtggagcccggcaccaagtgtgaggacggcaaagtgtgtatcaaccggaagtgtgtggacg- tgaaca ccgcctactga SEQ ID NO. 1 gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagc- cagtat ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggctt- gaccg acaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgt- tgacatt gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgtt- acataactta cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccata- gtaa cgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaa- gtgtat catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgac- cttat gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtac- atcaatggg cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggca- ccaaaat caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtggga- ggt ctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcact- ataggg agacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtggaatt- gccctt attcctcagtgacccaggagctgacacactatggcgcacgtccgaggcttgcagctgcctggctgcctggccct- ggct gccctgtgtagccttgtgcacagccagcatgtgttcctggctcctcagcaagcacggtcgctgctccagcgggt- ccggc gagccaacaccttcttggaggaggtgcgcaagggcaacctggagcgagagtgcgtggaggagacgtgcagctac gaggaggccttcgaggctctggagtcctccacggctacggatgtgttctgggccaagtacacagcttgtgagac- agc gaggacgcctcgagataagcttgctgcatgtctggaaggtaactgtgctgagggtctgggtacgaactaccgag- ggc atgtgaacatcacccggtcaggcattgagtgccagctatggaggagtcgctacccacataagcctgaaatcaac- tcc actacccatcctggggccgacctacaggagaatttctgccgcaaccccgacagcagcaccacgggaccctggtg- ct acactacagaccccaccgtgaggaggcaggaatgcagcatccctgtctgtggccaggatcaagtcactgtagcg- at gactccacgctccgaaggctccagtgtgaatctgtcacctccattggagcagtgtgtccctgatcgggggcagc- agta ccaggggcgcctggcggtgaccacacatgggctcccctgcctggcctgggccagcgcacaggccaaggccctga gcaagcaccaggacttcaactcagctgtgcagctggtggagaacttctgccgcaacccagacggggatgaggag- g gcgtgtggtgctatgtggccgggaagcctggcgactttgggtactgcgacctcaactattgtgaggaggccgtg- gagg aggagacaggagatgggctggatgaggactcagacagggccatcgaagggcgtaccgccaccagtgagtacca gactttcttcaatccgaggacctttggctcgggagaggcagactgtgggctgcgacctctgttcgagaagaagt- cgctg gaggacaaaaccgaaagagagctcctggaatcctacatcgacgggcgcattgtggagggctcggatgcagagat- c ggcatgtcaccttggcaggtgatgcttttccggaagagtccccaggagctgctgtgtggggccagcctcatcag- tgacc gctgggtcctcaccgccgcccactgcctcctgtacccgccctgggacaagaacttcaccgagaatgaccttctg- gtgc gcattggcaagcactcccgcaccaggtacgagcgaaacattgaaaagatatccatgttggaaaagatctacatc- ca ccccaggcaagcactggcgggagaacctggaccgggacattgccctgatgaagctgaagaagcctgttgccttc- agtg actacattcaccctgtgtgtctgcccgacagggagacggcagccagcttgctccaggctggatacaaggggcgg- gtg acaggctggggcaacctgaaggagacgtggacagccaacgttggtaaggggcagcccagtgtcctgcaggtggt- g aacctgcccattgtggagcggccggtctgcaaggactccacccggatccgcatcactgacaacatgttctgtgc- tggtt acaagcctgatgaagggaaacgaggggatgcctgtgaaggtgacagtgggggaccctttgtcatgaagagcccc- tt taacaaccgctggtatcaaatgggcatcgtctcatggggtgaaggctgtgaccgggatgggaaatatggcttct- acac acatgtgttccgcctgaagaagtggatacagaaggtcattgatcagtttggagagtagaagggcaattctgcag- atatc cagcacagtggcggccgctcgagtctagagggcccgtttaaacccgctgatcagcctcgactgtgccttctagt- tgcca gccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat- aaaatgag gaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaaggggga- ggat tgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctgggg- ct ctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgacc- gct acacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttcc- ccgtcaagct ctaaatcgggggctccctttagggttccgatttagtgctttacggcaccttcgaccccaaaaaacttgattagg- gctgtgg aatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaa- ttag tcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtc- ag caaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccat- ggctg actaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggct- tttttggag gcctaggcttttgcaaaaagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacga- ctcacta tagggagacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggtg- gaatt gccctttccgcagagcaatggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaa- ga caaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatt- tgtc

cagttggcggaggctggtgaccctgctgaatcgaccaacggaccctgcaagcttagctgtctttcgttttcttt- ttgggttctt gatggtgctagacattccccaggagcgggggctcagctctctggaccggaaataccttgatgggctggatgtgt- gccg cttccccttgctggatgccctacgcccactgccacttgactggatgtatcttgtctacaccatcatgtttctgg- gggcactgg gcatgatgctgggcctgtgctaccggataagctgtgtgttattcctgctgccatactggtatgtgtttctcctg- gacaagac atcatggaacaaccactcctatctgtatgggttgttggcctttcagctaacattcatggatgcaaaccactact- ggtctgtg gacggtctgctgaatgcccataggaggaatgcccacgtgcccctttggaactatgcagtgctccgtggccagat- cttca ttgtgtacttcattgcgggtgtgaaaaagctggatgcagactgggttgaaggctattccatggaatatttgtcc- cggcact ggctcttcagtcccttcaaactgctgttgtctgaggagctgactagcctgctggtcgtgcactggggtgggctg- ctgcttga cctctcagctggtttcctgctcttttttgatgtctcaagatccattggcctgttctttgtgtcctacttccact- gcatgaattcccag cttttcagcattggtatgttctcctacgtcatgctggccagcagccctctcttctgctcccctgagtggcctcg- gaagctggt gtcctactgcccccgaaggttgcaacaactgttgcccctcaaggcagcccctcagcccagtgtttcctgtgtgt- ataaga ggagccggggcaaaagtggccagaagccagggctgcgccatcagctgggagctgccttcaccctgctctacctc- ct ggagcagctattcctgccctattctcattttctcacccagggctataacaactggacaaatgggctgtatggct- attcctgg gacatgatggtgcactcccgctcccaccagcacgtgaagatcacctaccgtgatggccgcactggcgaactggg- cta ccttaaccctggggtatttacacagagtcggcgatggaaggatcatgcagacatgctgaagcaatatgccactt- gcct gagccgcctgcttcccaagtataatgtcactgagccccagatctactttgatatttgggtctccatcaatgacc- gcttcca gcagaggatttttgaccctcgtgtggacatcgtgcaggccgcttggtcaccctttcagcgcacatcctgggtgc- aacca ctcttgatggacctgtctccctggagggccaagttacaggaaatcaagagcagcctagacaaccacactgaggt- ggt cttcattgcagatttccctggactgcacttggagaattttgtgagtgaagacctgggcaacactagcatccagc- tgctgc agggggaagtgactgtggagcttgtggcagaacagaagaaccagactcttcgagagggagaaaaaatgcagttg- c ctgctggtgagtaccataaggtgtatacgacatcacctagcccttcttgctacatgtacgtctatgtcaacact- acagagc ttgcactggagcaagacctggcatatctgcaagaattaaaggaaaaggtggagaatggaagtgaaacagggcct- ct acccccagagctgcagcctctgttggaaggggaagtaaaagggggccctgagccaacacctctggttcagacct- ttc ttagacgccaacaaaggctccaggagattgaacgccggcgaaatactcctttccatgagcgattcttccgcttc- ttgttg cgaaagctctatgtctttcgccgcagcttcctgatgacttgtatctcacttcgaaatctgatattaggccgtcc- ttccctgga gcagctggcccaggaggtgacttatgcaaacttgagaccctttgaggcagttggagaactgaatccctcaaaca- cgg attcttcacattctaatcctcctgagtcaaatcctgatcctgtccactcagagttctgaagggggccagatgtt- ggaaggg caattcgagtctagagggcccgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaata- gtggactct tgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcg- gcctattggtt aaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaa- gtcccc aggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccag- gc tccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcc- cat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagagg- ccgaggcc gcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctccc- gggagc ttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgc- acgcag gttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgcc- gccgt gttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgc- aggac gaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagc- ggg aagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaag- tatcc atcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaaca- tcgc atcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggct- cg cgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgat- gc ctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcgg- accgct atcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtg- ctttac ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctg- gggttcga aatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgg- gctt cggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccacc- ccaac ttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttc- actgcattct agttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggc- gtaatcatgg tcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtg- taaagc ctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacc- tgtcgtg ccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgc- tcact gactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccac- agaa tcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggc- gaaa cccgacaggactataaagataccaggcgtttccccctggaagaccctcgtgcgctctcctgttccgaccctgcc- gctta ccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagt- tcggtgta ggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaact- atcgt cttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgag- gt atgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatc- tgcgct ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcgg- tttttt tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctg- acgctc agtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcctttta- aattaaa aatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgag- gcacctat ctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagg- gcttacca tctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagcc- agc cggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaag- ctaga gtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtc- gtttggtat ggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggtta- gctcct tcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataat- tctcttact gtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcg- gcgaccg agttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattgg- aaaa cgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacc- caactg atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagg- gaat aagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttatt- gtctcatgag cggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac- ctgac gtc//

Sequence CWU 1

5110139DNAArtificial SequenceSynthetic construct 1gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattgccc 960ttattcctca gtgacccagg agctgacaca ctatggcgca cgtccgaggc ttgcagctgc 1020ctggctgcct ggccctggct gccctgtgta gccttgtgca cagccagcat gtgttcctgg 1080ctcctcagca agcacggtcg ctgctccagc gggtccggcg agccaacacc ttcttggagg 1140aggtgcgcaa gggcaacctg gagcgagagt gcgtggagga gacgtgcagc tacgaggagg 1200ccttcgaggc tctggagtcc tccacggcta cggatgtgtt ctgggccaag tacacagctt 1260gtgagacagc gaggacgcct cgagataagc ttgctgcatg tctggaaggt aactgtgctg 1320agggtctggg tacgaactac cgagggcatg tgaacatcac ccggtcaggc attgagtgcc 1380agctatggag gagtcgctac ccacataagc ctgaaatcaa ctccactacc catcctgggg 1440ccgacctaca ggagaatttc tgccgcaacc ccgacagcag caccacggga ccctggtgct 1500acactacaga ccccaccgtg aggaggcagg aatgcagcat ccctgtctgt ggccaggatc 1560aagtcactgt agcgatgact ccacgctccg aaggctccag tgtgaatctg tcacctccat 1620tggagcagtg tgtccctgat cgggggcagc agtaccaggg gcgcctggcg gtgaccacac 1680atgggctccc ctgcctggcc tgggccagcg cacaggccaa ggccctgagc aagcaccagg 1740acttcaactc agctgtgcag ctggtggaga acttctgccg caacccagac ggggatgagg 1800agggcgtgtg gtgctatgtg gccgggaagc ctggcgactt tgggtactgc gacctcaact 1860attgtgagga ggccgtggag gaggagacag gagatgggct ggatgaggac tcagacaggg 1920ccatcgaagg gcgtaccgcc accagtgagt accagacttt cttcaatccg aggacctttg 1980gctcgggaga ggcagactgt gggctgcgac ctctgttcga gaagaagtcg ctggaggaca 2040aaaccgaaag agagctcctg gaatcctaca tcgacgggcg cattgtggag ggctcggatg 2100cagagatcgg catgtcacct tggcaggtga tgcttttccg gaagagtccc caggagctgc 2160tgtgtggggc cagcctcatc agtgaccgct gggtcctcac cgccgcccac tgcctcctgt 2220acccgccctg ggacaagaac ttcaccgaga atgaccttct ggtgcgcatt ggcaagcact 2280cccgcaccag gtacgagcga aacattgaaa agatatccat gttggaaaag atctacatcc 2340accccaggta caactggcgg gagaacctgg accgggacat tgccctgatg aagctgaaga 2400agcctgttgc cttcagtgac tacattcacc ctgtgtgtct gcccgacagg gagacggcag 2460ccagcttgct ccaggctgga tacaaggggc gggtgacagg ctggggcaac ctgaaggaga 2520cgtggacagc caacgttggt aaggggcagc ccagtgtcct gcaggtggtg aacctgccca 2580ttgtggagcg gccggtctgc aaggactcca cccggatccg catcactgac aacatgttct 2640gtgctggtta caagcctgat gaagggaaac gaggggatgc ctgtgaaggt gacagtgggg 2700gaccctttgt catgaagagc ccctttaaca accgctggta tcaaatgggc atcgtctcat 2760ggggtgaagg ctgtgaccgg gatgggaaat atggcttcta cacacatgtg ttccgcctga 2820agaagtggat acagaaggtc attgatcagt ttggagagta gaagggcaat tctgcagata 2880tccagcacag tggcggccgc tcgagtctag agggcccgtt taaacccgct gatcagcctc 2940gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 3000cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 3060tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 3120ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt ctgaggcgga 3180aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg cattaagcgc 3240ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 3300tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 3360aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcaccttc gaccccaaaa 3420aacttgatta gggctgtgga atgtgtgtca gttagggtgt ggaaagtccc caggctcccc 3480agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccaggt gtggaaagtc 3540cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccat 3600agtcccgccc ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc 3660gccccatggc tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga 3720gctattccag aagtagtgag gaggcttttt tggaggccta ggcttttgca aaaagctctc 3780tggctaacta gagaacccac tgcttactgg cttatcgaaa ttaatacgac tcactatagg 3840gagacccaag ctggctagcg tttaaactta agcttggtac cgagctcgga tccactagtc 3900cagtgtggtg gaattgccct ttccgcagag caatggcggt gtctgccggg tccgcgcgga 3960cctcgcccag ctcagataaa gtacagaaag acaaggctga actgatctca gggcccaggc 4020aggacagccg aatagggaaa ctcttgggtt ttgagtggac agatttgtcc agttggcgga 4080ggctggtgac cctgctgaat cgaccaacgg accctgcaag cttagctgtc tttcgttttc 4140tttttgggtt cttgatggtg ctagacattc cccaggagcg ggggctcagc tctctggacc 4200ggaaatacct tgatgggctg gatgtgtgcc gcttcccctt gctggatgcc ctacgcccac 4260tgccacttga ctggatgtat cttgtctaca ccatcatgtt tctgggggca ctgggcatga 4320tgctgggcct gtgctaccgg ataagctgtg tgttattcct gctgccatac tggtatgtgt 4380ttctcctgga caagacatca tggaacaacc actcctatct gtatgggttg ttggcctttc 4440agctaacatt catggatgca aaccactact ggtctgtgga cggtctgctg aatgcccata 4500ggaggaatgc ccacgtgccc ctttggaact atgcagtgct ccgtggccag atcttcattg 4560tgtacttcat tgcgggtgtg aaaaagctgg atgcagactg ggttgaaggc tattccatgg 4620aatatttgtc ccggcactgg ctcttcagtc ccttcaaact gctgttgtct gaggagctga 4680ctagcctgct ggtcgtgcac tggggtgggc tgctgcttga cctctcagct ggtttcctgc 4740tcttttttga tgtctcaaga tccattggcc tgttctttgt gtcctacttc cactgcatga 4800attcccagct tttcagcatt ggtatgttct cctacgtcat gctggccagc agccctctct 4860tctgctcccc tgagtggcct cggaagctgg tgtcctactg cccccgaagg ttgcaacaac 4920tgttgcccct caaggcagcc cctcagccca gtgtttcctg tgtgtataag aggagccggg 4980gcaaaagtgg ccagaagcca gggctgcgcc atcagctggg agctgccttc accctgctct 5040acctcctgga gcagctattc ctgccctatt ctcattttct cacccagggc tataacaact 5100ggacaaatgg gctgtatggc tattcctggg acatgatggt gcactcccgc tcccaccagc 5160acgtgaagat cacctaccgt gatggccgca ctggcgaact gggctacctt aaccctgggg 5220tatttacaca gagtcggcga tggaaggatc atgcagacat gctgaagcaa tatgccactt 5280gcctgagccg cctgcttccc aagtataatg tcactgagcc ccagatctac tttgatattt 5340gggtctccat caatgaccgc ttccagcaga ggatttttga ccctcgtgtg gacatcgtgc 5400aggccgcttg gtcacccttt cagcgcacat cctgggtgca accactcttg atggacctgt 5460ctccctggag ggccaagtta caggaaatca agagcagcct agacaaccac actgaggtgg 5520tcttcattgc agatttccct ggactgcact tggagaattt tgtgagtgaa gacctgggca 5580acactagcat ccagctgctg cagggggaag tgactgtgga gcttgtggca gaacagaaga 5640accagactct tcgagaggga gaaaaaatgc agttgcctgc tggtgagtac cataaggtgt 5700atacgacatc acctagccct tcttgctaca tgtacgtcta tgtcaacact acagagcttg 5760cactggagca agacctggca tatctgcaag aattaaagga aaaggtggag aatggaagtg 5820aaacagggcc tctaccccca gagctgcagc ctctgttgga aggggaagta aaagggggcc 5880ctgagccaac acctctggtt cagacctttc ttagacgcca acaaaggctc caggagattg 5940aacgccggcg aaatactcct ttccatgagc gattcttccg cttcttgttg cgaaagctct 6000atgtctttcg ccgcagcttc ctgatgactt gtatctcact tcgaaatctg atattaggcc 6060gtccttccct ggagcagctg gcccaggagg tgacttatgc aaacttgaga ccctttgagg 6120cagttggaga actgaatccc tcaaacacgg attcttcaca ttctaatcct cctgagtcaa 6180atcctgatcc tgtccactca gagttctgaa gggggccaga tgttggaagg gcaattcgag 6240tctagagggc ccgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt 6300taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg tctattcttt 6360tgatttataa gggattttgc cgatttcggc ctattggtta aaaaatgagc tgatttaaca 6420aaaatttaac gcgaattaat tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca 6480ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccaggtgt 6540ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca 6600gcaaccatag tcccgcccct aactccgccc atcccgcccc taactccgcc cagttccgcc 6660cattctccgc cccatggctg actaattttt tttatttatg cagaggccga ggccgcctct 6720gcctctgagc tattccagaa gtagtgagga ggcttttttg gaggcctagg cttttgcaaa 6780aagctcccgg gagcttgtat atccattttc ggatctgatc aagagacagg atgaggatcg 6840tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg 6900ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg 6960ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat 7020gaactgcagg acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca 7080gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg 7140gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat 7200gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa 7260catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg 7320gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg 7380cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg 7440gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat 7500caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac 7560cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc 7620cttcttgacg agttcttctg agcgggactc tggggttcga aatgaccgac caagcgacgc 7680ccaacctgcc atcacgagat ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg 7740gaatcgtttt ccgggacgcc ggctggatga tcctccagcg cggggatctc atgctggagt 7800tcttcgccca ccccaacttg tttattgcag cttataatgg ttacaaataa agcaatagca 7860tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac 7920tcatcaatgt atcttatcat gtctgtatac cgtcgacctc tagctagagc ttggcgtaat 7980catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 8040gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 8100ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 8160gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 8220tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 8280cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 8340gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 8400gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 8460gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 8520ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 8580atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 8640tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 8700ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 8760gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 8820ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 8880ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggttttttt gtttgcaagc 8940agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 9000ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 9060ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 9120atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 9180tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 9240gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 9300ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 9360caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 9420cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 9480cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 9540cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 9600agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 9660tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 9720agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 9780atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 9840ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 9900cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 9960caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 10020attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt 10080agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtc 1013921851DNAArtificial SequenceSynthetically generated oligonucleotide 2atgatccaga tcctgctggt gatcatctgc ctggccgtgt tcccctacca gggctgctcc 60atcatcctgg gcagcggcaa cgtgaacgac tacgaggtgg tgtaccccca gaaggtgacc 120gccctgccca agggcgccgt gcagcagccc gagcagaaat acgaggacgc catgcagtac 180gagttcgagg tgaagggcga gcccgtggtg ctgcacctgg agaagaacaa ggagctgttc 240agcgaggact acagcgagac ccactacagc agcgacgaca gggagatcac caccaacccc 300agcgtggagg accactgcta ctaccacggc cggatccaga acgacgccga gagcaccgcc 360agcatcagcg cctgtaatgg cctgaagggc cacttcaagc tgagaggcga gacctacttc 420atcgagcccc tgaagatccc cgacagcgag gcccacgccg tgtacaagta cgagaacatc 480gagaacgagg acgaggcccc taagatgtgt ggcgtgaccc aggacaactg ggagagcgac 540gagcccatca agaaaaccct gggcctgatc gtgccccccc acgagagaaa gttcgagaag 600aagttcatcg aactggtggt cgtggtggac cacagcatgg tgaccaagta caacaacgac 660agcaccgcca tcaggacctg gatctacgag atgctgaaca ccgtgaacga gatctacctg 720cccttcaaca tcagagtggc cctggtgggc ctggagttct ggtgtaacgg cgacctgatc 780aacgtgacca gcaccgccga cgacaccctg cacagcttcg gcgagtggag agccagcgac 840ctgctgaacc ggaagagaca cgatcacgcc cagctgctga ccaatgtgac cctggaccac 900tccaccctgg gcatcacctt cgtgtacggc atgtgtaaga gcgaccggag cgtggagctg 960atcctggact acagcaacat caccttcaac atggcctaca tcatcgccca cgagatgggc 1020cacagcctgg gcatgctgca cgacaccaag ttctgtacct gtggcgccaa gccctgtatc 1080atgttcggca aggagagcat ccctccccct aaggagttca gcagctgctc ctacgaccag 1140tacaataagt acctgctgaa gtacaacccc aagtgtatcc tggacccccc cctgagaaag 1200gacatcgcca gccctgccgt gtgtggcaat gagatctggg aggagggcga ggagtgtgac 1260tgtggcagcc cagccgactg tagaaacccc tgctgtgatg ccgccacctg taagctgaag 1320cctggcgccg agtgtggcaa cggcgagtgc tgtgacaagt gtaagatccg gaaggccggc 1380accgagtgta gacccgccag ggacgattgt gacgtggccg agcactgtac cggccagagc 1440gccgagtgcc ccagaaacga gttccagagg aacggccagc cttgcctgaa caacagcggc 1500tactgctaca acggcgactg ccccatcatg ctgaaccagt gtatcgccct gttcagcccc 1560agcgccaccg tggcccagga cagctgcttc cagagaaacc tgcagggcag ctactacggc 1620tactgtacca aggagatcgg ctactacgga aagaggttcc cctgtgcccc tcaggacgtg 1680aagtgtggca ggctgtactg cctggacaac tccttcaaga aaaacatgag gtgtaagaac 1740gactacagct acgccgacga gaacaagggc atcgtggagc ccggcaccaa gtgtgaggac 1800ggcaaagtgt gtatcaaccg gaagtgtgtg gacgtgaaca ccgcctactg a 185137280DNAArtificial SequenceSynthetic construct 3gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattctgc 960agatatccac catgatccag atcctgctgg tgatcatctg cctggccgtg ttcccctacc 1020agggctgctc catcatcctg ggcagcggca acgtgaacga ctacgaggtg gtgtaccccc 1080agaaggtgac cgccctgccc aagggcgccg tgcagcagcc cgagcagaaa tacgaggacg 1140ccatgcagta cgagttcgag gtgaagggcg agcccgtggt gctgcacctg gagaagaaca 1200aggagctgtt cagcgaggac tacagcgaga cccactacag cagcgacgac agggagatca 1260ccaccaaccc cagcgtggag gaccactgct actaccacgg ccggatccag aacgacgccg 1320agagcaccgc cagcatcagc gcctgtaatg gcctgaaggg ccacttcaag ctgagaggcg 1380agacctactt catcgagccc ctgaagatcc ccgacagcga ggcccacgcc gtgtacaagt 1440acgagaacat cgagaacgag gacgaggccc ctaagatgtg tggcgtgacc caggacaact 1500gggagagcga cgagcccatc aagaaaaccc tgggcctgat cgtgcccccc cacgagagaa 1560agttcgagaa gaagttcatc gaactggtgg tcgtggtgga ccacagcatg gtgaccaagt 1620acaacaacga cagcaccgcc atcaggacct ggatctacga gatgctgaac accgtgaacg 1680agatctacct gcccttcaac atcagagtgg ccctggtggg cctggagttc tggtgtaacg 1740gcgacctgat caacgtgacc agcaccgccg acgacaccct gcacagcttc ggcgagtgga 1800gagccagcga cctgctgaac cggaagagac acgatcacgc ccagctgctg accaatgtga 1860ccctggacca ctccaccctg ggcatcacct tcgtgtacgg catgtgtaag agcgaccgga 1920gcgtggagct gatcctggac tacagcaaca tcaccttcaa catggcctac atcatcgccc 1980acgagatggg ccacagcctg ggcatgctgc acgacaccaa gttctgtacc tgtggcgcca 2040agccctgtat catgttcggc aaggagagca tccctccccc taaggagttc agcagctgct 2100cctacgacca gtacaataag tacctgctga agtacaaccc caagtgtatc ctggaccccc 2160ccctgagaaa ggacatcgcc agccctgccg tgtgtggcaa tgagatctgg gaggagggcg 2220aggagtgtga ctgtggcagc ccagccgact gtagaaaccc ctgctgtgat gccgccacct 2280gtaagctgaa gcctggcgcc gagtgtggca acggcgagtg ctgtgacaag tgtaagatcc 2340ggaaggccgg caccgagtgt agacccgcca gggacgattg tgacgtggcc gagcactgta 2400ccggccagag cgccgagtgc cccagaaacg agttccagag gaacggccag ccttgcctga 2460acaacagcgg ctactgctac aacggcgact gccccatcat gctgaaccag tgtatcgccc 2520tgttcagccc cagcgccacc gtggcccagg acagctgctt ccagagaaac ctgcagggca 2580gctactacgg ctactgtacc aaggagatcg gctactacgg aaagaggttc ccctgtgccc 2640ctcaggacgt gaagtgtggc aggctgtact gcctggacaa ctccttcaag aaaaacatga 2700ggtgtaagaa cgactacagc tacgccgacg agaacaaggg catcgtggag cccggcacca 2760agtgtgagga cggcaaagtg tgtatcaacc ggaagtgtgt ggacgtgaac accgcctact 2820gatgagcggc cgctcgagtc tagagggccc gtttaaaccc gctgatcagc ctcgactgtg 2880ccttctagtt gccagccatc tgttgtttgc ccctcccccg

tgccttcctt gaccctggaa 2940ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 3000aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 3060gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 3120agctggggct ctagggggta tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt 3180gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc 3240gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 3300ggcatccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat 3360tagggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg 3420ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct 3480atctcggtct attcttttga tttataaggg attttgggga tttcggccta ttggttaaaa 3540aatgagctga tttaacaaaa atttaacgcg aattaattct gtggaatgtg tgtcagttag 3600ggtgtggaaa gtccccaggc tccccaggca ggcagaagta tgcaaagcat gcatctcaat 3660tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc 3720atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 3780actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca 3840gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg cttttttgga 3900ggcctaggct tttgcaaaaa gctcccggga gcttgtatat ccattttcgg atctgatcaa 3960gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc aggttctccg 4020gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat cggctgctct 4080gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt caagaccgac 4140ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg gctggccacg 4200acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg aagcgggaag ggactggctg 4260ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc tgccgagaaa 4320gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc tacctgccca 4380ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga agccggtctt 4440gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga actgttcgcc 4500aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc 4560ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg tggccggctg 4620ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc tgaagagctt 4680ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc cgattcgcag 4740cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg gggttcgaaa 4800tgaccgacca agcgacgccc aacctgccat cacgagattt cgattccacc gccgccttct 4860atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc ctccagcgcg 4920gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct tataatggtt 4980acaaataaag caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta 5040gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgtataccg tcgacctcta 5100gctagagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca 5160caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag 5220tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt 5280cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc 5340gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 5400tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 5460agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 5520cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 5580ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 5640tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 5700gaagcgtggc gctttctcaa tgctcacgct gtaggtatct cagttcggtg taggtcgttc 5760gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 5820gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 5880ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 5940ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 6000ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 6060gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 6120ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 6180tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 6240ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 6300gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 6360tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 6420cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 6480ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 6540gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 6600caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 6660gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 6720ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 6780tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 6840caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 6900tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 6960cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 7020ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 7080aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 7140tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 7200gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 7260gaaaagtgcc acctgacgtc 728041848DNAEchis carinatus 4atgatccaga ttctcttggt aattatatgc ttagcagttt ttccatatca aggttgctct 60ataatcctgg gatctgggaa tgttaatgat tatgaagtag tgtatccaca aaaagtcact 120gcattgccca aaggagcagt tcagcagcct gagcaaaagt atgaagatgc catgcaatat 180gaatttgaag tgaagggaga gccagtggtc cttcacctag aaaaaaataa agaacttttt 240tcagaagatt acagtgagac tcattattcg tctgatgaca gagaaattac aacaaaccct 300tcagttgagg atcactgcta ttatcatgga cggatccaga atgatgctga gtcaactgca 360agcatcagtg catgcaatgg tttgaaagga catttcaagc ttcgagggga gacgtacttt 420attgaaccct tgaagattcc cgacagtgaa gcccatgcag tctacaaata tgaaaacata 480gaaaatgagg atgaagcccc caaaatgtgt ggggtaaccc aggataattg ggaatcagat 540gaacccatca aaaagacttt ggggttaatt gttcctcctc atgaacgaaa atttgagaaa 600aaattcattg agcttgtcgt agttgtggac cacagtatgg tcacaaaata caacaatgat 660tcaactgcta taagaacatg gatatatgaa atgctcaaca ctgtaaatga gatatactta 720cctttcaata ttcgtgtagc actggttggc ctagaatttt ggtgcaatgg agacttgatt 780aacgtgacat ccacagcaga tgatactttg cactcatttg gagaatggag agcatcagat 840ttgctgaatc gaaaaagaca tgatcatgct cagttactca cgaacgtgac actggatcat 900tccactcttg gaatcacgtt cgtatatggc atgtgcaaat cagatcgttc tgtagaactt 960attctggatt acagcaacat aacttttaat atggcatata taatagccca tgagatgggt 1020catagtctgg gcatgttaca tgacacaaaa ttctgtactt gtggggctaa accatgcatt 1080atgtttggca aagaaagcat tccaccgccc aaagaattca gcagttgtag ttatgaccag 1140tataacaagt atcttcttaa atataaccca aaatgcattc ttgattcacc tttgagaaaa 1200gatattgctt cacctgcagt ttgtggaaat gaaatttggg aggaaggaga agaatgtgat 1260tgtggttctc ctgcagattg tcgaaatcca tgctgtgatg ctgcaacatg taaactgaaa 1320ccaggggcag aatgtggaaa tggagagtgt tgtgacaagt gcaagattag gaaagcagga 1380acagaatgcc ggccagcaag ggatgactgt gatgtcgctg aacactgcac tggccaatct 1440gctgagtgtc ccagaaatga gttccaaagg aatggacaac catgccttaa caactcgggt 1500tattgctaca atggggattg ccccatcatg ttaaaccaat gtattgctct ctttagtcca 1560agtgcaactg tggctcaaga ttcatgtttt cagaggaact tgcaaggcag ttactatggc 1620tactgcacaa aggaaattgg ttactatggt aaaaggtttc catgtgcacc acaagatgta 1680aaatgtggca gattatactg cttagataat tcattcaaaa aaaatatgcg ttgcaagaac 1740gactattcat acgcggatga aaataaggga atagttgaac ctggaacaaa atgtgaagat 1800ggaaaggtct gcatcaacag gaagtgtgtt gatgtgaata cagcctac 18485616PRTKenyan Echis carinatusecarin derived from Kenyan Echis carinatus 5Met Ile Gln Ile Leu Leu Val Ile Ile Cys Leu Ala Val Phe Pro Tyr1 5 10 15Gln Gly Cys Ser Ile Ile Leu Gly Ser Gly Asn Val Asn Asp Tyr Glu 20 25 30Val Val Tyr Pro Gln Lys Val Thr Ala Leu Pro Lys Gly Ala Val Gln 35 40 45Gln Pro Glu Gln Lys Tyr Glu Asp Ala Met Gln Tyr Glu Phe Glu Val 50 55 60Lys Gly Glu Pro Val Val Leu His Leu Glu Lys Asn Lys Glu Leu Phe65 70 75 80Ser Glu Asp Tyr Ser Glu Thr His Tyr Ser Ser Asp Asp Arg Glu Ile 85 90 95Thr Thr Asn Pro Ser Val Glu Asp His Cys Tyr Tyr His Gly Arg Ile 100 105 110Gln Asn Asp Ala Glu Ser Thr Ala Ser Ile Ser Ala Cys Asn Gly Leu 115 120 125Lys Gly His Phe Lys Leu Arg Gly Glu Thr Tyr Phe Ile Glu Pro Leu 130 135 140Lys Ile Pro Asp Ser Glu Ala His Ala Val Tyr Lys Tyr Glu Asn Ile145 150 155 160Glu Asn Glu Asp Glu Ala Pro Lys Met Cys Gly Val Thr Gln Asp Asn 165 170 175Trp Glu Ser Asp Glu Pro Ile Lys Lys Thr Leu Gly Leu Ile Val Pro 180 185 190Pro His Glu Arg Lys Phe Glu Lys Lys Phe Ile Glu Leu Val Val Val 195 200 205Val Asp His Ser Met Val Thr Lys Tyr Asn Asn Asp Ser Thr Ala Ile 210 215 220Arg Thr Trp Ile Tyr Glu Met Leu Asn Thr Val Asn Glu Ile Tyr Leu225 230 235 240Pro Phe Asn Ile Arg Val Ala Leu Val Gly Leu Glu Phe Trp Cys Asn 245 250 255Gly Asp Leu Ile Asn Val Thr Ser Thr Ala Asp Asp Thr Leu His Ser 260 265 270Phe Gly Glu Trp Arg Ala Ser Asp Leu Leu Asn Arg Lys Arg His Asp 275 280 285His Ala Gln Leu Leu Thr Asn Val Thr Leu Asp His Ser Thr Leu Gly 290 295 300Ile Thr Phe Val Tyr Gly Met Cys Lys Ser Asp Arg Ser Val Glu Leu305 310 315 320Ile Leu Asp Tyr Ser Asn Ile Thr Phe Asn Met Ala Tyr Ile Ile Ala 325 330 335His Glu Met Gly His Ser Leu Gly Met Leu His Asp Thr Lys Phe Cys 340 345 350Thr Cys Gly Ala Lys Pro Cys Ile Met Phe Gly Lys Glu Ser Ile Pro 355 360 365Pro Pro Lys Glu Phe Ser Ser Cys Ser Tyr Asp Gln Tyr Asn Lys Tyr 370 375 380Leu Leu Lys Tyr Asn Pro Lys Cys Ile Leu Asp Pro Pro Leu Arg Lys385 390 395 400Asp Ile Ala Ser Pro Ala Val Cys Gly Asn Glu Ile Trp Glu Glu Gly 405 410 415Glu Glu Cys Asp Cys Gly Ser Pro Ala Asp Cys Arg Asn Pro Cys Cys 420 425 430Asp Ala Ala Thr Cys Lys Leu Lys Pro Gly Ala Glu Cys Gly Asn Gly 435 440 445Glu Cys Cys Asp Lys Cys Lys Ile Arg Lys Ala Gly Thr Glu Cys Arg 450 455 460Pro Ala Arg Asp Asp Cys Asp Val Ala Glu His Cys Thr Gly Gln Ser465 470 475 480Ala Glu Cys Pro Arg Asn Glu Phe Gln Arg Asn Gly Gln Pro Cys Leu 485 490 495Asn Asn Ser Gly Tyr Cys Tyr Asn Gly Asp Cys Pro Ile Met Leu Asn 500 505 510Gln Cys Ile Ala Leu Phe Ser Pro Ser Ala Thr Val Ala Gln Asp Ser 515 520 525Cys Phe Gln Arg Asn Leu Gln Gly Ser Tyr Tyr Gly Tyr Cys Thr Lys 530 535 540Glu Ile Gly Tyr Tyr Gly Lys Arg Phe Pro Cys Ala Pro Gln Asp Val545 550 555 560Lys Cys Gly Arg Leu Tyr Cys Leu Asp Asn Ser Phe Lys Lys Asn Met 565 570 575Arg Cys Lys Asn Asp Tyr Ser Tyr Ala Asp Glu Asn Lys Gly Ile Val 580 585 590Glu Pro Gly Thr Lys Cys Glu Asp Gly Lys Val Cys Ile Asn Arg Lys 595 600 605Cys Val Asp Val Asn Thr Ala Tyr 610 615

Claims

1. A method for producing recombinant human thrombin from recombinant prothrombin using recombinant ecarin having the sequence SEQ ID NO 2 or a homologue thereof.

2. A method according to claim 1, wherein the recombinant ecarin is being expressed and secreted by a cell containing the gene comprising the nucleotide sequence SEQ ID NO 2 or a homologue thereof in CHO-S cells, which ecarin has an amino acid sequence equal to that of wild type ecarin.

3. A method according to claim 1 or 2, wherein recombinant protrombin is subjected to recombinant ecarin, which recombinant ecarin was isolated in active form after extra-cellular expression by CHO-S cells, said cells being left to apoptosis/necrosis for a time sufficient to activate said ecarin, whereupon a human recombinant thrombin is isolated.

4. A method according to any of the preceding claims, wherein the recombinant prothrombin is produced by a cell-line comprising a prothrombin expressing gene having a nucleotide sequence comprising the sequence SEQ. ID. NO. 1.

5. A method according to any of the preceding claims, wherein the recombinant prothrombin is a mixture of fully carboxylated prothrombin and incompletely carboxylated prothrombin.

6. A method according to any of the preceding claims, wherein the recombinant prothrombin is a fully carboxylated prothrombin.

7. A method according to any of the preceding claims, wherein the recombinant prothrombin is an incompletely carboxylated prothrombin.

8. A recombinant thrombin obtained by the method according to any of the preceding claims.

9. A pharmaceutical composition comprising a recombinant thrombin according to claim 8, in combination with pharmaceutically acceptable carriers, vehicles and/or adjuvants.

10. A pharmaceutical composition according to claim 9, wherein the composition is in an applicable form.

11. An isolated DNA sequence encoding ecarin according to SEQ ID NO 2 or a homologue thereof, having at least 80% identity to SEQ ID NO 2.

12. An isolated DNA according claim 11, wherein the homologue has an identity of at least 90% to SEQ ID NO 2.

13. A vector comprising the isolated DNA sequence of any of the claims 11 to 12.

14. An amino acid sequence encoded by SEQ ID NO 2 or a homologue thereof.

15. A host cell comprising the vector of claim 13.

16. A host cell according to claim 15, wherein the host cell is a mammalian cell.