Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION

Inventors:  Kaustuv Sanyal (Karnataka, IN)  Sreedevi Padmanabhan (Karnataka, IN)  Jitendra Thakur (Karnataka, IN)
Assignees:  Jawaharlal Nehru Centre For Advanced Scientific Research
IPC8 Class: AC12Q168FI
USPC Class: 435 615
Class name: Measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving nucleic acid involving bacterium, fungus, parasite or protozoan (e.g., detecting pathogen virulence factors, adhesions, toxins, etc.)
Publication date: 2011-06-30
Patent application number: 20110159512



Abstract:

The present invention relates to identification of centromeric sequences of Candida dubliniensis and localization of CdCse4p centromeric histone to the identified region. Also the present invention relates to distinguishing Candida dubliniensis from other members of genus Candida.

Claims:

1. A polynucleotide sequence consisting of SEQ ID NO 1, 2, 3, 4, 5, 6, 7 or 8.

2.-25. (canceled)

26. A set of polynucleotide primers comprising forward and reverse primers that hybridize to a centromeric region of Candida dubliniensis selected from the group consisting of Chromosome 1, Chromosome 2, Chromosome 3, Chromosome 4, Chromosome 5, Chromosome 6, Chromosome 7 and Chromosome R.

27. A set of 20 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric region of chromosome 1 of Candida dubliniensis.

28. A set of 20 primers according to claim 27 consisting of SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 as forward primers and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26 and 28 as corresponding reverse primers respectively.

29. A set of 14 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric region of chromosome 2 of Candida dubliniensis.

30. A set of 14 primers according to claim 29 consisting of SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 as forward primers and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 as corresponding reverse primers respectively.

31. A set of 10 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome 3 of Candida dubliniensis.

32. A set of 10 primers according to claim 31 consisting of SEQ ID NOS. 43, 45, 47, 49 and 51 as forward primers and SEQ ID NOS. 44, 46, 48, 50 and 52 as corresponding reverse primers respectively.

33. A set of 16 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome 4 of Candida dubliniensis.

34. A set of 16 primers according to claim 33 consisting of SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 as forward primers and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 as corresponding reverse primers respectively.

35. A set of 10 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome 5 of Candida dubliniensis.

36. A set of 10 primers according to claim 35 consisting of SEQ ID NOS. 69, 71, 73, 75 and 77 as forward primers and SEQ ID NOS. 70, 72, 74, 76 and 78 as corresponding reverse primers respectively.

37. A set of 16 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome 6 of Candida dubliniensis.

38. A set of 16 primers according to claim 37 consisting of SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 as forward primers and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 as corresponding reverse primers respectively.

39. A set of 18 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome 7 of Candida dubliniensis.

40. A set of 18 primers according to claim 39 consisting of SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 as forward primers and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 as corresponding reverse primers respectively.

41. A set of 14 primers as claimed in claim 26, wherein the forward and the reverse primers are used for amplification of centromeric regions of chromosome R of Candida dubliniensis.

42. A set of 14 primers according to claim 41 consisting of SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 as forward primers and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 as corresponding reverse primers respectively.

43. A process of identification of centromeric sequences of Candida dubliniensis, said method comprising steps of: a) identifying putative Cse4p binding region; and b) amplifying the putative Cse4p binding region to identify centromeric sequences of the Candida dubliniensis.

44. The process as claimed in claim 43, wherein the identification of putative Cse4p biding regions is carried out by sequence analysis and chromatin immunoprecipitation.

45. The process as claimed in claim 43, wherein the amplification of the putative Cse4p binding regions is carried out using any set of a forward primer selected from the group consisting of SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, respectively, for chromosome 1 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42, respectively, for chromosome 2 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 43, 45, 47, 49 and 51 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 44, 46, 48, 50 and 52, respectively, for chromosome 3 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68, respectively, for chromosome 4 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 69, 71, 73, 75 and 77 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 70, 72, 74, 76 and 78, respectively, for chromosome 5 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94, respectively, for chromosome 6 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112, respectively, for chromosome 7 of Candida dubliniensis and a forward primer selected from the group consisting of SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125, respectively, for chromosome R of Candida dubliniensis; or any combination of said primers thereof.

46. A method of distinguishing Candida dubliniensis from Candida albicans in a sample, said method comprising steps of a) isolating DNA from the organism in the sample; and b) amplifying the Cse4p binding regions with primers capable of amplifying said regions in the Candida dubliniensis to distinguish it from Candida albicans.

47. The method as claimed in claim 46, wherein the identification of putative Cse4p biding regions is carried out by sequence analysis and chromatin immunoprecipitation.

48. The method as claimed in claim 46, wherein the amplification of the putative Cse4p binding regions is carried out using any set of a forward primer selected from the group consisting of SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, respectively, for chromosome 1 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42, respectively, for chromosome 2 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 43, 45, 47, 49 and 51 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 44, 46, 48, 50 and 52, respectively, for chromosome 3 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68, respectively, for chromosome 4 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 69, 71, 73, 75 and 77 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 70, 72, 74, 76 and 78, respectively, for chromosome 5 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94, respectively, for chromosome 6 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112, respectively, for chromosome 7 of Candida dubliniensis and a forward primer selected from the group consisting of SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125, respectively, for chromosome R of Candida dubliniensis; or any combination of said primers thereof.

49. A kit for identification of Candida dubliniensis comprising a set of primers having SEQ ID NOS. 9 to 126.

50. The kit as claimed in claim 49, wherein the amplification of the putative Cse4p binding regions is carried out using any set of a forward primer selected from the group consisting of SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, respectively, for chromosome 1 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42, respectively, for chromosome 2 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 43, 45, 47, 49 and 51 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 44, 46, 48, 50 and 52, respectively, for chromosome 3 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68, respectively, for chromosome 4 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 69, 71, 73, 75 and 77 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 70, 72, 74, 76 and 78, respectively, for chromosome 5 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94, respectively, for chromosome 6 of Candida dubliniensis; a forward primer selected from the group consisting of SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112, respectively, for chromosome 7 of Candida dubliniensis and a forward primer selected from the group consisting of SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and its corresponding reverse primer selected from the group consisting of SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125, respectively, for chromosome R of Candida dubliniensis; or any combination of said primers thereof.

Description:

FIELD OF THE INVENTION

[0001] The present invention relates to identification of centromeric sequences of Candida dubliniensis and localization of CdCse4p centromeric histone to the identified region. Also the present invention relates to distinguishing Candida dubliniensis from other members of genus Candida.

BACKGROUND AND PRIOR ART OF THE INVENTION

[0002] Candida is a genus of yeasts. Many species of this genus are endosymbionts of animal hosts including humans. While usually living as commensals, some Candida species have the potential to cause disease. Clinically, the most significant member of the genus is Candida albicans, which can cause infections (called candidiasis or thrush) in humans and other animals, especially in immunocompromised patients. Many Candida species are members of gut flora in animals, including C. albicans in mammalian hosts, whereas others live as endosymbionts in insect hosts.

[0003] Among the other important members of this genus Candida dubliniensis is a significant pathogenic fungi. Candida dubliniensis is an organism often associated with AIDS patients but can be associated with immunocompetent patients as well. It is a germ cell-positive yeast of the genus Candida, similar to Candida albicans but it forms a different cluster upon DNA fingerprinting. It appears to be particularly adapted for the mouth but can be found at very low rates in other anatomical sites. Candida dubliniensis is found all around the world. The species was only described in 1995. It is thought to have been previously identified as Candida albicans. Retrospective studies support this, and have given an indication of the prevalence of C. dubliniensis as a pathogen.

[0004] This isolate is germ tube positive which accounts for its historic miss-identification as C. albicans. The most useful test for distinguishing C. dubliniensis from C. albicans is to culture at 42° C. Most C. albicans grows well at this temperature, but most C. dubliniensis do not. There are also significant differences in the chlamydiospores between C. albicans and C. dubliniensis although they are otherwise phenotypically very similar.

[0005] A study done in Europe of 2,589 isolates that were originally reported as C. albicans revealed that 52 of them (2.0%) were actually C. dubliniensis. Most of these isolates were from oral or faecal specimens from HIV positive patients, though one vaginal and two oral isolates were from healthy volunteers. Another study done in the United States, used 1,251 yeasts previously identified as C. albicans, it found 15 (1.2%) were really C. dubliniensis. Most of these samples were from immunocompromised individuals: AIDS, chemotherapy, or organ transplant patients. The yeast was most often recovered from respiratory, urine and stool specimens. The Memorial Sloan-Kettering Cancer Center also did several studies, both retrospective, and current. In all 974 germ-tube positive yeasts, 22 isolates (2.3%) from 16 patients were C. dubliniensis.

[0006] Molecular analysis show that C. dubliniensis is distinct from C. albicans by 13-15 nucleotides in the ribosomal RNA gene sequences. Early reports purported that C. dubliniensis was responsible for, fluconazole-resistant thrush but susceptibility studies reveal that its categorical distribution is similar to C. albicans with isolates ranging from susceptible to resistant.

[0007] Previous literature describes that Centromeric DNA sequences in the pathogenic yeast Candida albicans are all different and unique (Sanyal et al, 2004). The Cse4p-containing centromere regions of Candida albicans have unique and different DNA sequences on each of the eight chromosomes. However similar studies have not been carried out in C. dubliniensis.

[0008] Amongst the most prevalent methods of distinguishing C. dubliniensis from C. albicans are the compositions and methods for the detection and identification of species of Candida, in particular, to nucleic acid probes that specifically hybridize to the internal transcribed spacer 2 (ITS2) of the ribosomal DNA (rDNA) repeat region of Candida species (such as C. albicans and C. dubliniensis).

Another method of identification includes use of multiplex PCR which uses essentially three factors: (i) the elevated number of copies from the rRNA genes (about 100 copies per genome), (ii) the differences regarding the sizes of the ITS regions and (iii) the elevated variability of these region sequences among the different species of Candida. Thus, this technique is based on the amplification of DNA fragments specific of the internal transcribed spacer regions 1 (ITS-I) and 2 (ITS-2) by multiplex PCR. The methodology uses the combination of two universal primers and seven specific primers for each one of the Candida species studied, in a single PCR reaction, originating two fragments of different sizes for each species (European publication no: EP1888745). Most techniques used so far distinguish C. dubliniensis from other species by identification of rDNA or RNA sequences of the genome. The genome of C. dubliniensis has not been sequenced completely and the work to find out more information about its genome is in progress. However the present invention has been able to assign centromeric functions to the sequence identified and these centromeric sequences are further used to distinguish Candida dubliniensis from other members of the genus based on the localization of histone proteins CdCse4p.

[0009] Faithful chromosome segregation during mitosis and meiosis in eukaryotes is performed by a dynamic interaction between spindle microtubules and kinetochores. The kinetochore is a proteinaceous structure that forms on a specific DNA locus on each chromosome, termed as the centromere (CEN). Centromeres have been cloned and characterized in several organisms from yeasts to humans. Interestingly, there is no centromere-specific cis-acting DNA sequence that is conserved across species (1). However, centromeres in all eukaryotes studied to date assemble into specialized chromatin containing a histone H3 variant protein in the CENP-A/Cse4p family. Members of this family are called centromeric histones (CenH3s) and are regarded as possible epigenetic markers of CEN identity (1, 2). The Saccharomyces cerevisiae centromere, the most intensively studied budding yeast centromere, is a well defined, short 125 bp) region (hence called a "point" centromere), and consists of two conserved consensus sequences (Centromere DNA Elements; CDEs), CDEI (8 bp) and CDEIII (25 bp) separated by CDEII, a 78-86 by non-conserved AT-rich (>90%) "spacer"-sequence (3). CDEI is not absolutely necessary for mitotic centromere function (4). Retention of a portion of CDEII is essential for CEN activity, but changes in length or base composition of CDEII cause only partial inactivation (4, 5). The S. cerevisiae CenH3, ScCse4p, has been shown to bind to a single nucleosome containing the non-conserved CDEII and to flanking CDEI and CDEIII regions (6). CDEIII is absolutely essential: centromere function is completely inactivated by deletion of CDEIII, or even by single base substitutions in the central CCG sequence. Centromeres of most other eukaryotes, including the fission yeast Schizosaccharomyces pombe, are much longer and more complex than those of S. cerevisiae and are called "regional" centromeres (3). The centromeres of S. pombe are 40-110 kb in length, and organized into distinct classes of repeats which are further arranged into a large inverted repeat. The non-repetitive central region, also known as the central core (cc), contains a 4-7 kb non-homologous region that is not conserved in all three chromosomes (3). The CenH3 homolog in S. pombe, Cnp1p, binds to the central core and the inner repeats (7). However, the central domain alone cannot assemble centromere chromatin de novo, but requires the cis-acting dg/K repeat present at the outer repeat array to promote de novo centromere assembly (8, 9). Several experiments suggest that unlike in S. cerevisiae, no unique conserved sequence within S. pombe centromeres is sufficient for establishment and maintenance of centromere function, although flanking repeats play a crucial role in establishing heterochromatin that is important for centromere activity (10). Studies in a pathogenic budding yeast, Candida albicans, containing regional centromeres suggest that each of its eight chromosomes contains a different, 3-5 kb, non-conserved DNA sequence that assembles into Cse4p-rich centromeric chromatin (11, 12). C. albicans centromeres partly resemble those of S. pombe but lack any pericentric repeat that is common to all of its eight centromeres (12). Therefore, the mechanisms by which CenH3s confer centromere identity, are deposited at the right location, and are epigenetically propagated for several generations in C. albicans without any centromere-specific DNA sequence remain largely unknown.

OBJECTIVES OF THE INVENTION

[0010] The main objective of the present invention is to obtain a polynucleotide sequence. Another main objective of the present invention is to obtain sets of primers for amplification of the polynucleotide sequences of Candida dubliniensis.

[0011] Yet another main objective of the present invention is to obtain a process for identification of centromeric sequences of Candida dubliniensis

Still another main objective of the present invention is to obtain a method of distinguishing Candida dubliniensis from Candida albicans. Still another main objective of the present invention is to obtain a kit for identification of Candida dubliniensis.

STATEMENT OF THE INVENTION

[0012] Accordingly, the present invention relates to a polynucleotide sequence having SEQ ID NO 1, 2, 3, 4, 5, 6, 7 or 8; a set of 20 primers having SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 as forward primers and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26 and 28 as corresponding reverse primers respectively; a set of 14 primers having SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 as forward primers and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 as corresponding reverse primers respectively; a set of 10 primers having SEQ ID NOS. 43, 45, 47, 49 and 51 as forward primers and SEQ ID NOS. 44, 46, 48, 50 and 52 as corresponding reverse primers respectively; a set of 16 primers having SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 as forward primers and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 as corresponding reverse primers respectively; a set of 10 primers having SEQ ID NOS. 69, 71, 73, 75 and 77 as forward primers and SEQ ID NOS. 70, 72, 74, 76 and 78 as corresponding reverse primers respectively; a set of 16 primers haying SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 as forward primers and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 as corresponding reverse primers respectively; a set of 18 primers having SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 as forward primers and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 as corresponding reverse primers respectively; a set of 14 primers having SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 as forward primers and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 as corresponding reverse primers respectively; a process of identification of centromeric sequences of Candida dubliniensis, said method comprising steps of a) identifying putative Cse4p binding region and b) amplifying the putative Cse4p binding region to identify centromeric sequences of the Candida dubliniensis; a method of distinguishing Candida dubliniensis from Candida albicans in a sample, said method comprising steps of a) isolating DNA from the organism in the sample and b) amplifying the Cse4p binding regions with primers capable of amplifying said regions in the Candida dubliniensis to distinguish it from Candida albicans and a kit for identification of Candida dubliniensis comprising set of primers having SEQ ID NOS. 9 to 126.

BRIEF DESCRIPTION OF ACCOMPANYING SEQUENCE LISTINGS

[0013] SEQ ID NOS. 1, 2, 3, 4, 5, 6, 7 and 8: Centromeric polynucleotide sequences for Chromosome 1, 2, 3, 4, 5, 6, 7 and 8 of Candida dubliniensis.

[0014] SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27: Forward Primers for Chromosome 1 of Candida dubliniensis.

[0015] SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26 and 28: Reverse Primers for Chromosome 1 of Candida dubliniensis.

[0016] SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41: Forward Primers for Chromosome 2 of Candida dubliniensis.

[0017] SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42: Reverse Primers for Chromosome 2 of Candida dubliniensis.

[0018] SEQ ID NOS. 43, 45, 47, 49 and 51: Forward Primers for Chromosome 3 of Candida dubliniensis.

[0019] SEQ ID NOS. 44, 46, 48, 50 and 52: Reverse Primers for Chromosome 3 of Candida dubliniensis.

[0020] SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67: Forward Primers for Chromosome 4 of Candida dubliniensis.

[0021] SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68: Reverse Primers for Chromosome 4 of Candida dubliniensis.

[0022] SEQ ID NOS. 69, 71, 73, 75 and 77: Forward Primers for Chromosome 5 of Candida dubliniensis.

[0023] SEQ ID NOS. 70, 72, 74, 76 and 78: Reverse Primers for Chromosome 5 of Candida dubliniensis.

[0024] SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93: Forward Primers for Chromosome 6 of Candida dubliniensis.

[0025] SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94: Reverse Primers for Chromosome 6 of Candida dubliniensis.

[0026] SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111: Forward Primers for Chromosome 7 of Candida dubliniensis.

[0027] SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112: Reverse Primers for Chromosome 7 of Candida dubliniensis.

[0028] SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126: Forward Primers for Chromosome 8 of Candida dubliniensis.

[0029] SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125: Reverse Primers for Chromosome 8 of Candida dubliniensis.

BRIEF DESCRIPTION OF ACCOMPANYING FIGURES

[0030] FIG. 1: Orthologous Cse4p-rich centromere regions in C. albicans and C. dubliniensis.

[0031] FIG. 2: Localization of CdCse4p at the kinetochore of C. dubliniensis.

[0032] FIG. 3: Binding of two evolutionarily conserved key kinetochore proteins, CdCse4p (CENP-A homolog) and CdMif2p (CENP-C homolog) to the same regions of different C. dubliniensis chromosomes.

[0033] FIG. 4: Comparative analysis of CEN6 region of C. albicans and its orthologous region in C. dubliniensis showing genome rearrangement.

[0034] FIG. 5: The centromeric histone in C. dubliniensis, CdCse4p, belongs to the Cse4p/CENP-A family.

[0035] FIG. 6: Relative enrichment profiles of CdCse4p in various C. dubliniensis chromosomes.

[0036] FIG. 7: The CENP-C homolog in C. dubliniensis (CdMif2p) is co-localized with CdCse4p.

[0037] FIG. 8: Relative chromosomal positions of Cse4p-binding regions in C. albicans and C. dubliniensis.

[0038] FIG. 9: Conserved blocks in the pericentric regions of various chromosomes of C. dubliniensis and C. albicans.

BRIEF DESCRIPTION OF ACCOMPANYING TABLES

[0039] Table 1: Comparison of the amino acid sequence homology of the ORFs flanking the CEN regions in C. albicans and C. dubliniensis

[0040] Table 2: List of PCR Primers used for ChIP assays.

[0041] Table 2B: List of PCR primers used for Cse4 complementation experiments

[0042] Table 3: Sequence coordinates of the Cse4p- binding and the pericentric regions in all the chromosomes of C. albicans and C. dubliniensis

[0043] Table 4: List of strains

[0044] Table 5: Comparison of mutation rates in Cse4p-binding and other genomic noncoding regions in C. albicans and C. dubliniensis.

[0045] Table 6: Homology between the repeats in the pericentric region of C. albicans and C. dubliniensis

DETAILED DESCRIPTION OF THE INVENTION

[0046] The present invention relates to a polynucleotide sequence having SEQ ID NO 1, 2, 3, 4, 5, 6, 7 or 8. The present invention also relates to a set of 20 primers having SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 as forward primers and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26 and 28 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric region of chromosome 1 of Candida dubliniensis. The present invention also relates to a set of 14 primers having SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 as forward primers and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric region of chromosome 2 of Candida dubliniensis. The present invention also relates to a set of 10 primers having. SEQ ID NOS. 43, 45, 47, 49 and 51 as forward primers and SEQ ID NOS. 44, 46, 48, 50 and 52 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 3 of Candida dubliniensis. The present invention also relates to a set of 16 primers having SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 as forward primers and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 4 of Candida dubliniensis. The present invention also relates to a set of 10 primers having SEQ ID NOS. 69, 71, 73, 75 and 77 as forward primers and SEQ ID NOS. 70, 72, 74, 76 and 78 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 5 of Candida dubliniensis. The present invention also relates to a set of 16 primers having SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 as forward primers and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 6 of Candida dubliniensis. The present invention also relates to a set of 18 primers having SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 as forward primers and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 7 of Candida dubliniensis. The present invention also relates to a set of 14 primers having SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 as forward primers and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 as corresponding reverse primers respectively. In another embodiment of the present invention, the forward and the reverse primers are used for amplification of centromeric regions of chromosome 8 of Candida dubliniensis. The present invention also relates to a process of identification of centromeric sequences of Candida dubliniensis, said method comprising steps of: [0047] a) identifying putative Cse4p binding region; and [0048] b) amplifying the putative Cse4p binding region to identify centromeric sequences of the Candida dubliniensis. In another embodiment of the present invention, the identification of putative Cse4p biding regions is carried out by sequence analysis and chromatin immunoprecipitation. In yet another embodiment of the present invention the amplification of the putative Cse4p binding regions is carried out using any set of forward primer and its corresponding reverse primer selected from a group comprising SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 respectively, for chromosome 1 of Candida dubliniensis; SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 respectively, for chromosome 2 of Candida dubliniensis; SEQ ID NOS. 43, 45, 47, 49 and 51 and SEQ ID NOS. 44, 46, 48, 50 and 52 respectively, for chromosome 3 of Candida dubliniensis; SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 respectively, for chromosome 4 of Candida dubliniensis; SEQ ID NOS. 69, 71, 73, 75 and 77 and SEQ ID NOS. 70, 72, 74, 76 and 78 respectively, for chromosome 5 of Candida dubliniensis; SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 respectively, for chromosome 6 of Candida dubliniensis; SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 respectively, for chromosome 7 of Candida dubliniensis and SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 respectively, for chromosome 8 of Candida dubliniensis or any combination of said primers thereof. The present invention also relates to a method of distinguishing Candida dubliniensis from Candida albicans in a sample, said method comprising steps of [0049] a) isolating DNA from the organism in the sample; and [0050] b) amplifying the Cse4p binding regions with primers capable of amplifying said regions in the Candida dubliniensis to distinguish it from Candida albicans. In another embodiment of the present invention, the identification of putative Cse4p biding regions is carried out by sequence analysis and chromatin immunoprecipitation. In yet another embodiment of the present invention, the amplification of the putative Cse4p binding regions is carried out using any set of forward primer and its corresponding reverse primer selected from a group comprising SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 respectively, for chromosome 1 of Candida dubliniensis; SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 respectively, for chromosome 2 of Candida dubliniensis; SEQ ID NOS. 43, 45, 47, 49 and 51 and SEQ ID NOS. 44, 46, 48, 50 and 52 respectively, for chromosome 3 of Candida dubliniensis; SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 respectively, for chromosome 4 of Candida dubliniensis; SEQ ID NOS. 69, 71, 73, 75 and 77 and SEQ ID NOS. 70, 72, 74, 76 and 78 respectively, for chromosome 5 of Candida dubliniensis; SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 respectively, for chromosome 6 of Candida dubliniensis; SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 respectively, for chromosome 7 of Candida dubliniensis and SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 respectively, for chromosome 8 of Candida dubliniensis or any combination of said primers thereof. The present invention also relates to a kit for identification of Candida dubliniensis comprising set of primers having SEQ ID NOS. 9 to 126. In another embodiment of the present invention, the amplification of the putative Cse4p binding regions is carried out using any set of forward primer and its corresponding reverse primer selected from a group comprising SEQ ID NOS. 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27 and SEQ ID NOS. 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 respectively, for chromosome 1 of Candida dubliniensis; SEQ ID NOS. 29, 31, 33, 35, 37, 39 and 41 and SEQ ID NOS. 30, 32, 34, 36, 38, 40 and 42 respectively, for chromosome 2 of Candida dubliniensis; SEQ ID NOS. 43, 45, 47, 49 and 51 and SEQ ID NOS. 44, 46, 48, 50 and 52 respectively, for chromosome 3 of Candida dubliniensis; SEQ ID NOS. 53, 55, 57, 59, 61, 63, 65 and 67 and SEQ ID NOS. 54, 56, 58, 60, 62, 64, 66 and 68 respectively, for chromosome 4 of Candida dubliniensis; SEQ ID NOS. 69, 71, 73, 75 and 77 and SEQ ID NOS. 70, 72, 74, 76 and 78 respectively, for chromosome 5 of Candida dubliniensis; SEQ ID NOS. 79, 81, 83, 85, 87, 89, 91 and 93 and SEQ ID NOS. 80, 82, 84, 86, 88, 90, 92 and 94 respectively, for chromosome 6 of Candida dubliniensis; SEQ ID NOS. 95, 97, 99, 101, 103, 105, 107, 109 and 111 and SEQ ID NOS. 96, 98, 100, 102, 104, 106, 108, 110 and 112 respectively, for chromosome 7 of Candida dubliniensis and SEQ ID NOS. 114, 116, 118, 120, 122, 123 and 126 and SEQ ID NOS. 113, 115, 117, 119, 121, 124 and 125 respectively, for chromosome 8 of Candida dubliniensis or any combination of said primers thereof.

[0051] The Cse4p-containing centromere regions of Candida albicans have unique and different DNA sequences on each of the eight chromosomes. In closely related yeast, Candida dubliniensis, the centromeric histone, CdCse4p, has been identified and it is shown to be localized at the kinetochore. The putative centromeric regions, orthologous to the C. albicans centromeres, in each of the eight C. dubliniensis chromosomes have been identified by bioinformatics analysis. Chromatin immunoprecipitation followed by polymerase chain reaction using a specific set of primers confirmed that these regions bind CdCse4p in vivo. As in C. albicans, the CdCse4p-associated core centromeric regions are 3-5 kb in length, and show no sequence similarity to one another. Comparative sequence analysis suggests that the Cse4p-rich centromere DNA sequences in these two species have diverged faster than other orthologous intergenic regions, and even faster than our best estimated "neutral" mutation rate. However, the location of the centromere and the relative position of Cse4p-rich centromeric chromatin in the orthologous regions with respect to adjacent open reading frames are conserved in both species, suggesting that centromere identity is not solely determined by DNA sequence. Unlike known point and regional centromeres of other organisms, centromeres in C. albicans and C. dubliniensis have no common centromere-specific sequence motifs or repeats except some of the chromosome-specific pericentric repeats that are found to be similar in these two species. The centromeres of these two Candida species are thus of an intermediate type between point and regional centromeres.

Several lines of evidence suggest that primary DNA sequence may not be the only determinant of CEN identity in regional centromeres. A recent study on several independent clinical isolates of C. albicans reveals that, despite having no centromere specific DNA sequence motifs or repeats common to all of its eight centromeres, centromere sequences remain conserved and their relative chromosomal positions are maintained (12). As a first step toward understanding the importance of cis-acting CEN DNA sequences in centromere function in C. albicans, centromeres of a closely related pathogenic yeast, Candida dubliniensis, which was identified as a less pathogenic independent species in 1995 were identified and characterized. It was thought that CEN DNA comparisons between related Candida species might uncover properties that were not evident from inter-chromosomal comparisons of C. albicans CEN sequences alone. Moreover, functional characterization of centromeres of these two related Candida species may be helpful in understanding the evolution of centromeres. Several studies indicate that both CEN DNA and its associated proteins in animals and plants are rapidly evolving, although the relative position of the centromere is maintained for a long time. The identification and characterization of Cse4p-rich centromere sequences of each of the eight chromosomes of C. dubliniensis was carried out. Comparative genomic analysis of CEN DNA sequences of C. albicans and C. dubliniensis reveals no detectable conservation among Cse4p-associated CEN sequences. Nonetheless, the lengths of Cse4p-enriched DNAs assembled as specialized centromeric chromatin and their relative locations in orthologous regions have been maintained for millions of years. A genome wide analysis also revealed that centromeres are probably the most rapidly evolving genomic loci in C. albicans and C. dubliniensis. Candida dubliniensis has a total of 8 chromosomes. Chromosomes 1 to 7 are identified based on their respective sizes. The chromosome number 8 has an extensive number of R-DNA repeat sequences. Hence this chromosome is also referred to as Chromosome R.

[0052] The invention is further elaborated with the help of following examples. However, these examples should not be construed to limit the scope of the invention.

EXAMPLE 1

Synteny of Centromere-Adjacent Genes Is Maintained In C. albicans And C. dubliniensis

[0053] C. albicans and C. dubliniensis diverged about 20 million years ago from a common ancestor (12). Gene synteny (collinearity) is maintained almost throughout the genome in these two organisms. Therefore, potential orthologous CEN regions in C. dubliniensis were examined by identifying open reading frames (ORFs) of C. dubliniensis with homology to CEN-proximal ORFs of C. albicans. C. dubliniensis homologs of C. albicans ORFs that are adjacent to centromere regions were identified by BLAST analysis of the C. dubliniensis genome database available at the Wellcome Trust Sanger Institute website.

Result

[0054] The homology of amino acid sequences coded by CEN-adjacent genes in C. albicans and C. dubliniensis ranges from 81% to 99%, as shown in Table 1 below.

TABLE-US-00001 TABLE 1 C. albicans C. dubliniensis Amino C. albicans Amino Amino acid Chr ORF C. dubliniensis Chromosomal acid Chromosomal acid homology No. No. ORF No. coordinates length coordinates length Orientation (%) 1 4438 Cd36_06830 1580117-1581640 507 1611890-1613440 516 Direct 88 4440 Cd36_06810 1559352-1561871 839 1591631-1594162 843 Direct 91 2 1601 Cd36_23540 1923194-1924363 389 1938439-1939608 389 Direct 99 1604 Cd36_23560 1934775-1931570 916 1947203-1949623 806 Reverse 84 3 2812 Cd36_83930 828667-827105 503 871879-873366 495 Reverse 84 6923 Cd36_83920 820347-821378 343 865253-866083 276 Direct 90 4 3818 Cd36_44310 1010148-1009312 278 1036396-1037226 276 Reverse 88 3821 Cd36_44290 1000558-999371 395 1025948-1027126 392 Reverse 81 5 3160 Cd36_51930 467208-466702 168 493689-494072 127 Reverse 95 4216 Cd36_51940 473741-474247 168 500592-500975 127 Direct 94 6 1096 Cd36_64780 965934-968573 879 934029-936683 884 Direct 84 2124 Cd36_65100 982460-981390 353 1016599-1017672 357 Reverse 87 7 6522 Cd36_71800 431903-430173 586 439178-440899 573 Reverse 94 6524 Cd36_71780 423631-422459 390 424821-425993 390 Reverse 99 R 597 Cd36_33630 1759087-1757405 560 1722610-1724292 560 Reverse 97 600 Cd36_33620 1748818-1745649 1056 1710255-1713449 1064 Reverse 90

The synteny of these genes is maintained in all chromosomes except chromosome 6. FIG. 1 shows orthologous Cse4p-rich centromere regions in C. albicans and C. dubliniensis. Based on BLAST analysis, the putative homologs of C. albicans CEN-adjacent ORFs in C. dubliniensis have been identified. Chromosome numbers are shown on the left (R through 7). The top line for each chromosome denotes C. albicans centromere regions and the bottom line corresponds to the orthologous regions in C. dubliniensis. The dotted and crossed boxes correspond to Cse4p-binding regions in C. albicans and C. dubliniensis respectively. Only one homolog is shown for each chromosome of C. albicans and C. dubliniensis. ORFs and the direction of transcription of corresponding ORFs are shown by open arrows. Only those ORFs which have homologs in both C. albicans and C. dubliniensis are shown. The number on the top of each arrow corresponds to the C. albicans assembly 19 ORF numbers (for example, Orf19.600 has been shown as 600). The length of CEN-containing intergenic regions of C. albicans and orthologous regions in C. dubliniensis are shown. This analysis was done based on Assembly 20 of Candida albicans Genome Database and the present version (16 May, 2007) of the Candida dubliniensis Genome database. C. albicans CEN6 is flanked by Orf19.1097 and Orf19.2124. Since there is no Orf19.1097 homolog in C. dubliniensis, the C. dubliniensis homolog of Orf19.1096, the gene adjacent to Orf19.1097 in C. albicans were identified. The distance between Orf19.1096 and Orf19.2124 is 12.8 kb in C. albicans as opposed to 80 kb in C. dubliniensis. A systematic analysis of this 80 kb region of C. dubliniensis reveals that two paracentric inversions followed by an insertion between Orf19.1096 homolog and its downstream region occurred in C. dubliniensis at the left arm of the orthologous pericentric region as compared to C. albicans. FIG. 4 shows comparative analysis of CEN6 region of C. albicans and its orthologous region in C. dubliniensis showing genome rearrangement. Chromosomal maps of the chromosome 6 of C. albicans and C. dubliniensis where the red dots represent the CEN regions. Black arrows along with the ORF numbers show the gene arrangement and the direction of transcription. Two paracentric inversions in C. dubliniensis are marked in shaded red and grey boxes. The direction of the shaded boxes (gradation of colors) represents the inversions that have occurred in C. dubliniensis when compared to C. albicans. The green arrows show the breakpoints where the inversions have occurred. The blue region in C. dubliniensis shows the region of insertions of ORFs from other chromosomes. The yellow regions are unaltered. The orange arrow shows the Orf19.1097 in C. albicans and the orange star in the C. dubliniensis map shows that there is a premature termination codon in the Orf19.1097 homolog of C. albicans in C. dubliniensis. Brown bar indicates Cse4p-binding region.

EXAMPLE 2

The Centromeric Histone Protein of C. dubliniensis (CdCse4p) Is Localized At the Kinetochore

[0055] CenH3 proteins in the Cse4p/CENP-A family have been shown to be uniquely associated with centromeres in all organisms studied to date (1). Using CaCse4p as the query in a BLAST analysis against the C. dubliniensis genome, the centromeric histone of C. dubliniensis, CdCse4p were identified.

Identification of CdCse4p And CdMif2p

[0056] The C. dubliniensis Cse4p was identified by a BLAST search with C. albicans Cse4p (CaCse4p) as the query sequence against the C. dubliniensis genome sequence database. This sequence analysis revealed three protein sequences with high homology to CaCse4p; two are the C. dubliniensis putative histone H3 proteins (Chr RCd36--32350; Chr1-Cd36--04010) and the other CdCse4p (Chr 3-Cd36--80790). The CdCSE4 gene encodes a putative 212 aa-long protein with 100% identity in the C terminal histone fold domain of CaCse4p. A pair wise comparison of the CaCse4p and CdCse4p sequences revealed that they share 97% identity and 1.4% similarity over a 212 aa overlap as shown in FIG. 5.

[0057] Using CaMif2p as the query sequence in the BLAST search against the C. dubliniensis genome database, a single hit was retrieved, which was identified as the CENP-C homolog (Cd36--63360) in C. dubliniensis showing 77% identity and 5% similarity in 516 aa overlap with CaMif2p. FIG. 7 shows the CENP-C homolog in C. dubliniensis (CdMif2p) is co-localized with CdCse4p. (A) Sequence alignment of CaMif2p and CdMif2p showing the conserved CENP-C block (red box) (B) Localization of CdMif2p at various stages of cell cycle in C. dubliniensis. (C) ChIP enrichment profiles of CdMif2p on chromosomes 1 and 3 in the strain CDM1 by determining the intensities of (+Ab) minus (-Ab) signals divided by the total DNA signals and are normalized to a value of 1 for the same obtained using primers for a non-centromeric locus (CdLEU2). The CdMIF2 gene codes for a putative 520 aa-long protein with a conserved CENP-C box required for centromere targeting (11) that is identical in C. albicans and C. dubliniensis as shown in FIG. 5. This histone is found to be highly similar (97% identity over 211 aa) to CaCse4p. CdCse4p codes for a 212-aa-long predicted protein with a C-terminal (aa residues 110-212) histone-fold domain (HFD). The HFD of Cse4p in C. albicans and C. dubliniensis is identical as shown in FIG. 5. FIG. 5 shows the centromeric histone in C. dubliniensis, CdCse4p, belongs to the Cse4p/CENP-A family. A) Phylogenetic tree of the Cse4 protein sequences in yeasts in the radiation format using neighbor-joining method of Molecular Evolutionary Genetics Analysis version 3.1 (MEGA) software showing Cse4 proteins in C. albicans and C. dubliniensis are highly related. Ca-Candida albicans, Cd-Candida dubliniensis, Db-Debaryomyces hansenii, Pa-Pichia angusta, Kl-Kluyveromyces lactis, Cn-Cryptococcus neoformans, Sp-Schizosaccharomyces pombe, Af-Aspergillus fumigatus, Nc-Neurospora crassa, YI-Yarrowia lipolytica, Ag-Ashbya gossypii, Sc-Saccharomyces cerevisiae, Cg-Candida glabrata. B) Pairwise comparison of Cse4p in C. albicans and C. dubliniensis showing homologies in N-terminal region and C-terminal histone fold domain.

EXAMPLE 3

The Centromeric Histone Protein of C. dubliniensis (CdCse4p) Can Functionally Compliment Histone Protein of C. albicans (CaCse4p)

[0058] In order to examine whether CdCse4p can functionally complement CaCse4p, CdCSE4 from its native promoter (pAB1CdCSE4) cloned in an ARS2/HIS1 plasmid (pAB1) in a C. albicans strain (CAKS3b) carrying the only full length copy of CaCSE4 under control of the PCK1 promoter was expressed.

Complementation Assay

[0059] To examine whether CdCse4p can complement CaCse4p function, a C. albicans strain was constructed, where the first allele of CaCSE4 was disrupted using URA-blaster cassette followed by recycling of URA3 marker, and the second allele was placed under control of the PCK1 promoter. To disrupt the first CaCSE4 allele, a 4.9 kb URA-blaster-based CaCSE4 deletion cassette was released from pDC3 (Sanyal & Carbon, 2002) as Sa/I-SacI fragment and transformed BWP17 selecting for uridine prototrophy. The correct integrant (CAKS1b) was selected by Southern analysis. Thereafter, Ura-strain, obtained by intrachromosomal recombination between hisG repeats resulting in the loss of URA3 marker, was selected on medium containing 5-fluoroorotic acid (5-FOA). The correct revertant (CAKS2b) was identified by PCR analysis. To place the wild type CSE4 allele under regulation of the PCK1 promoter in CAKS2b, pPCK1-CSE4 was linearized (Sanyal & Carbon, 2002) by. EcoRV and used it to transform strain CAKS2b, selecting transformants for uridine prototrophy. The desired integrant (CAKS3b) carrying the only full-length copy of CSE4 under control of the PCK1 promoter was identified by PCR analysis. CAKS3b can grow on succinate medium (where the PCK1 promoter is induced) but is unable to grow on glucose medium (where PCK1 promoter is repressed) as shown in FIG. 2A. To test whether CdCse4p can complement CaCse4p function, both CdCSE4 and CaCSE4 genes were cloned in an ARS2/HIS1 plasmid, pAB1 (Baum et al., 2006). A 2.14-kb fragment carrying CdCSE4 (CdChr3 coordinates 170543-172683) and a 2.13-kb fragment carrying CaCSE4 (CaChr3 coordinates 172252-174384) genes along with their respective promoters and terminators were amplified using FCdCSE4/RCdCSE4 and FCaCSE4/RCaCSE4 primer pairs, respectively, as listed in Table 2 below.

TABLE-US-00002 TABLE 2 Primer Sequence Chromosomal locations For CdCEN1 CdCEN1-1(F) AAGCCCTTTGGATGTTGACTACGC 1593208-1593231 CdCEN1-2(R) CCATCGACAGGGCCCATGTG 1593417-1593398 CdCEN1-3(F) TATGATTATACCCCAATCCA 1595086-1595105 CdCEN1-4(R) AGGATCAGTTACCAATGTTG 1595287-1595268 CdCEN1-3'(F) CAACAATCAACAATTTCTGCTCCTCATG 1596131-1596158 CdCEN1-4'(R) AAGTGGGTATCACCTTATTCGCAAATGA 1596368-1596341 CdCEN1-5(F) CCTTTTTAAACGTGACACGCTCAAA 1597063-1597087 CdCEN1-6(R) GGAAAAGTTGCGTGAGGAAATGGA 1597302-1597279 CdCEN1-5'(F) CGGGTGCATCTAAGAAGGGTTTTA 1598062-1598085 CdCEN1-6'(R) CAATATAACCTTGCACCCGTCAAATACG 1598347-1598320 CdCEN1-7(F) GTTGCAGTGCATTGTACGAGGTAAGCTC 1599081-1599108 CdCEN1-8''(R) TGCAACTGATCCGAGACAACTTCAAAC 1599271-1599245 CdCEN1-7'(F) GATCGCAAGCGAAGCACGAAATGAC 1600481-1600505 CdCEN1-8'(R) CAATGTCTGTTCGACCACCATTCCC 1600721-1600697 CdCEN1-9(F) AGAGCGAGCACCTGGTATTCCCAAG 1601290-1601314 CdCEN1-10(R) CACCCAAAGCCCAGCTTAAATTCC 1601509-1601486 CdCEN1-9'(F) TTTCAATTTAGCTGACTCCTTACCCTGG 1602167-1602194 CdCEN1-10'(R) TTTTCGGTGATTTTGCCAAGAAGTTC 1602410-1602385 CdCEN1-11(F) CAGCATTCATCCGGGTAAAGTGTTG 1603320-1603344 CdCEN1-12(R) CAACGGATCCAAGGTCACCACATAG 1603543-1603519 Control (Non centromeric locus in chromosome 7) CdLeu2-1(F) AACTATCACAGTCTTGCCTGGTGA 119386-119409 CdLeu2-2(R) ACAGCACCAGTGCCCCATTT 119618-119637 For CdCEN2 CdCEN2-1(F) CGCGGTCCAAGAAGATAATC 1940515-1940534 CdCEN2-2(R) CATCATGGGATGTAATTGCT 1940649-1940668 CdCEN2-3(F) AGTGTAAGTCTTCGGGATAC 1942509-1942528 CdCEN2-4(R) GTGAGCGAATAGAATAATTG 1942685-1942704 CdCEN2-5(F) AGCTACATCTATTTTCAATGCACTC 1944606-1944630 CdCEN2-6(R) AATTGCTCTGAAACAGCCAG 1944877-1944896 CdCEN2-7(F) TATACCCCCGAATTAACAAGTGCGC 1943700-1943724 CdCEN2-8(R) CAGTGCAGGTGCTTTCGTTTACCAG 1943847-1943871 CdCEN2-9(F) CATCAGTTCAATTGATGGGGTTGTTCTG 1945542-1945569 CdCEN2-10(R) AAACTGGCATAGCTTTTTGCATTATTGCC 1945736-1945764 CdCEN2-11(F) ATTTCGAGAGGACTTGGTTCGTGC 1946646-1946669 CdCEN2-12(R) CCGTACCCAAATAAAACTCCCAGC 1946844-1946867 CdCEN2-15(F) TACAAAGCGGGTGATAAGGA 1947305-1947054 CdCEN2-16(R) GGCGCAAAAGGAAATAGC 1947234-1947217 For CdCEN3 CdCEN3-1(F) ACACTGTCTTGTCTTGTGTCTGAAGTCG 865133-865160 CdCEN3-2(R) TTCTCTGTGTGTGGGCCCTCAGTAC 865293-865317 CdCEN3-3(F) TCATCCATCATATCACAAATCCTACTG 867274-867300 CdCEN3-4(R) GTTATTTTGAAAGTTGGGGAGAGGG 867456-867480 CdCEN3-5(F) CCTACGACATGAACACATCAAACTACTC 869090-869117 CdCEN3-6(R) TGCTTTTGTTGAAAACTTGCGAAAC 869243-869267 CdCEN3-7(F) AGGCTAGTCGGTGGTTAACGGTTGTGTG 870638-870665 CdCEN3-8(R) GACTCGGAATAAACACCATCGCCGATGC 870856-870883 CdCEN3-9(F) GGTCCAATTAGAATCGGGTCGTTCCATG 872528-872555 CdCEN3-10(R) CGTCATCCCTTCTATCTCTAACGTG 872683-872707 For CdCEN4 CdCEN4-1(F) ATCATATCATGCAGCCCAACTCCG 1028245-1028268 CdCEN4-2(R) CGGACGTAGTGAAACGATTGTTGG 1028410-1028433 CdCEN4-3(F) ACAATTCCCAGTAAACCATTATAAAAG 1029835-1029861 CdCEN4-4(R) CATTCATAATCTGATTTGTAGGCTC 1029965-1029989 CdCEN4-3'(F) TGCTAAACGACCCCCTCAAAA 1030554-1030574 CdCEN4-4'(R) GTACGACGATCATCAGCAACCAA 1030776-1030798 CdCEN4-5(F) AATTAATTCGGATAGTTGGGGGAGACCG 1032446-1032473 CdCEN4-6(R) ATTGAGCTGCTCACTTCACTGCCAC 1032619-1032643 CdCEN4-5'(F) GCAGCGTTCTTGTGACCGTGAG 1033199-1033220 CdCEN4-6'(R) TTGAATTGGACAGGGGCTTAGG 1033477-1033498 CdCEN4-7(F) TGTGGTGGAGGGTCATCCATTTGTTGGTTG 1034406-1034435 CdCEN4-8(R) GGCGACCCTCATGCACCCTACCAAATAAA 1034609-1034637 CdCEN4-7'(F) AAGTACGGATGGTTGTTA 1035010-1035028 CdCEN4-8'(R) TAGTCATTCTGCCATCTCTTAT 1035231-1035252 CdCEN4-9(F) CCATGAACAAAAGGTTAGGTGGTGCTCC 1036158-1036185 CdCEN4-10(R) GGGGAGTTGAATGGTGTGGTGTTAC 1036367-1036391 For CdCEN5 CdCEN5-7(F) TCCAGCGTCAGACATTTTTCCAGT 494058-494081 CdCEN5-8(R) TGCCCCGCGGTTGACAGT 494213-494230 CdCEN5-1(F) TGGCCTCTCCCTTACAAAATTTGCCC 495324-495349 CdCEN5-2(R) GGGAGATGAGGGGTGATTGAGGTAATAG 495504-495531 CdCEN5-3(F) GCTCCAGTACCAACGAAAACGACTTC 496907-496932 CdCEN5-4(R) GCATTTGAAAACTGCCAATGTAGTC 497035-497059 CdCEN5-5(F) GCTGGGATAGTTTAGAGGCAGACTGTG 498944-498971 CdCEN5-6(R) CCTCAATCACCCCTCATCTCCCTAC 499130-499155 CdCEN5-9(F) AAGGGCAAGGAACAAGTCACAAGT 500673-500696 CdCEN5-10(R) TATCAGCGCCGGTTTTAGCAC 500941-500961 For CdCEN6 CdCEN6-15(F) GTGCCAACTTTCTCCTGAT 1002806-1002824 CdCEN6-16(R) AGCGATTATTAAGTCTATGTGG 1002985-1002964 CdCEN6-13(F) GAAGCAGCGACCCAACAGATAA 1003044-1003065 CdCEN6-14(R) TTGAGCGAAATTGGGTAGAGTC 1003262-1003283 CdCEN6-5(F) TGTCCATTCCCCAAACTTCATACGGACCAC 1004039-1004068 CdCEN6-6(R) GAATGCTGGAAGGACTTGAGAAATG 1004175-1004199 CdCEN6-5'(F) GAAACCAATAACAAGGAAAGAGTA 1005046-1005069 CdCEN6-6'(R) CAATGGGAAAAAGAAATCAGTAG 1005313-1005335 CdCEN6-7(F) GACGAGAGCATGTACTCAACTACGTGTC 1006472-1006499 CdCEN6-8(R) GAATCTTGATTGAAATGCGAGGAAC 1006668-1006692 CdCEN6-9(F) CATCCAATAACATTGATTTACTACTTTTAG 1008985-1009014 CdCEN6-10(R) TTTTTTTTTCTCAAAGATTTAGCAG 1009115-1009139 CdCEN6-9'(F) TGTACGATCAACCCAGAGTGC 1009504-1009524 CdCEN6-10'(R) ACATGCCATTACCAACAACAGTC 1009749-1009771 CdCEN6-3(F) TAGCTGTATTAAAAAATTCTGGCCGCATA 1015917-1015945 CdCEN6-4(R) TCTGACAAAAAACCTCGTATGACCC 1016066-1016042 For CdCEN7 CdCEN7-1(F) CTAGAGCTATGTTGTGACAGTCCACC 427615-427640 CdCEN7-2(R) CTTCTGGAATTGAGCCAATCCCTAG 427777-427801 CdCEN7-3(F) CTAGCTATTCAAGCATCCGTAGGCAGTC 429103-429130 CdCEN7-4(R) CCCATACCCGGGTGGTGTAGTATAA 429228-429252 CdCEN7-5(F) GTAGGCGCTACATATGAACTTCGTGC 436328-436354 CdCEN7-6(R) AGATAATGTCTGAATGTCATTCGGG 436479-436504 CdCEN7-9'(F) TCCAATGGGTGCTAAGATGAA 434047-434068 CdCEN7-10'(R) TCCCGCCTGATTTTTGAA 434292-434310 CDCEN7-7(F) TTATTTGATAGCCTAATTTCACCTGATG 438005-438031 CdCEN7-8(R) ATTAACTGACTTTGAACCAGCAATG 438205-438230 CdCEN7-9(F) AACGGTCACCTGATGAATAGAGTGGC 432732-432758 CdCEN7-10(R) GACTGAAGCGTCCATACTTGGGATC 432956-432981 CdCEN7-11(F) CCCAGAAGTATCCACTAGGGAACTTG 435240-435268 CdCEN7-12(R) TTGTTCTGGTCAATGGTACAGCAAC 435365-435390 CdCEN7-13(F) CACGCAACTAGAATGGCATGAATATATG 439500-439527 CdCEN7-14(R) AGATCCGGTGTCTGTCTTATTGCTC 439630-439654 CdCEN7-15(F) CCTGCGTTGTAATCATTTGTTGTC 440443-440466 CdCEN7-16(R) TTACTCCGCCTTTGATCCCTATTT 440640-440617 For CdCENR CdCENR-1(R) ATTAAGGAGCTTCGTGAGGCTGTCG 1723671-1723647 CdCENR-2(F) CATTTCCTTCAAAGGCACCGGGATG 1723429-1723453 CdCENR-3(R) ACGTTGCTTACTGGTGGCTATGCGG 1721710-1721686 CdCENR-4(F) AAGCTTTTATTGCGGTGAACTGGGG 1721461-1721485 CdCENR-5(R) ACATATAATAGCCTACCACACGCCTTGC 1719373-1719346 CdCENR-6(F) TGACATTGTGGAAAGTTAATCGCGG 1719202-1719226 CdCENR-7(R) TGAAATTGGAGACTAAGTGTTGCATTCG 1717531-1717504 CdCENR-8(F) ACAGTTTCCACACAACTCAGCAAGACA 1717330-1717356 CdCENR-9(R) TTTGCCGGGATAAGCTTTTATTGCG 1715642-1715618 CdCENR-10(F) TTTCAGGACACCAGAAGATGGCCAC 1715409-1715433 CdCENR-9'(F) CCCCCGCCGTGAAAAACA 1713200-1713217 CdCENR-10'(R) CTACAAACGCCACACCCGAAACT 1713426-1713404 CdCENR-11(R) ACCTCAACATCGACACAGTCGCACC 1712709-1712185 CdCENR-12(F) AGCAGAAACCTCGATGTTTGAGCCG 1712487-1712511

TABLE-US-00003 TABLE 2B Primer Sequence FCaCse4 RCaCse4 TGCTCTAGACCAAAATCCCTCTTTCTGTATTTG FCdCse4 CCCGAGCTCCAAGTGTATTTTTCATCTTTGGTAG RCdCse4 CCCAAGCTTCTATTTTGCCACCAAAACCCATCTT

These amplified CdCSE4 and CaCSE4 sequences were digested with SacI/HindIII and SacI/XbaI, respectively, and cloned into corresponding sites of pAB1 to get pAB1CdCSE4 and pAB1CdCSE4. Subsequently CAKS3b was transformed with pAB1, pAB1CaCSE4 or pAB1CdCSE4 and transformants were selected for histidine prototrophy on succinate medium followed by streaking on succinate as well as glucose containing media.

Result

[0060] The ability of the strain CAKS3b carrying pAB1CdCSE4 to grow as good as the same strain carrying a control plasmid pAB1CaCSE4 on glucose medium (where endogenous CaCSE4 expression is suppressed) suggests that CdCse4p can complement CaCse4p function and hence codes for the centromeric histone in C. dubliniensis (FIG. 2B).

[0061] FIG. 2 shows localization of CdCse4p at the kinetochore of C. dubliniensis. (A) The C. albicans strain CAKS3b was streaked on media containing succinate and glucose and incubated at 30° C. for 3 days. (B) CAKS3b is transformed with pAB1, pAB1CaCSE4 or pAB1CdCSE4. These transformants were streaked on plates containing complete media lacking histidine with succinate or glucose as the carbon source. (C) C. dubliniensis strain Cd36 was grown in YPD and fixed. Fixed cells were stained with DAPI (a-d), anti-Ca/CdCse4p (e-h) and anti-tubulin (i-l) antibodies. The intense red dot-like CdCse4p signals were observed in unbudded (e) and at different stages of budded cells (f-h). Corresponding spindle structures are shown by co-immunostaining with anti-tubulin antibodies (i-l). Arrows indicate the position of spindle pole bodies in large-budded cells at anaphase. (Bar=10 μm).

EXAMPLE 4

Subcellular Localization of CdCse4p In C. dubliniensis

[0062] The subcellular localization of CdCse4p in C. dubliniensis strain Cd36 was further examined by indirect immunofluorescence.

Indirect Immunofluorescence

[0063] Intracellular CdCse4p or CdMif2p were visualized by indirect immunofluorescence microscopy as described previously. Asynchronously grown cells of Cd36 or CDM1 were fixed with 37% formaldehyde at room temperature for an hour. Antibodies were diluted as follows: 1:30 for anti-α-tubulin (YOL1/34) (Abcam); 1:500 for affinity purified rabbit anti-Ca/CdCse4p and rabbit anti-Protein A (Sigma); 1:500 for Alexa fluor 488 goat anti-rat IgG (Invitrogen) and 1:500 for Alexa fluor 568 goat anti-rabbit IgG (Invitrogen). The positions of nuclei of the cells were determined by staining with 4', 6-diamidino-2-phenylindole (DAPI) as described previously. Cells were examined at 100× magnification on a confocal laser scanning microscope (LSM 510 META, Carl Zeiss). Using LSM 5 Image Examiner, digital images were captured. Images were processed by Adobe PhotoShop software.

Result

[0064] Indirect immunofluorescence microscopy using affinity purified polyclonal anti-Ca/CdCse4p antibodies (against aa1-18 of CaCse4p/CdCse4p) revealed bright dot-like signals in all cells. The dots always co-localized with nuclei stained with DAPI (FIG. 2C). Each bright dot-like signal represents a cluster of 16 centromeres. Unbudded G1 cells exhibited one dot per cell, while large-budded cells at later stages of the cell cycle exhibited two dots that co-segregated with the DAPI-stained nuclei in daughter cells (FIG. 2C). The localization patterns of CdCse4p appear to be identical to those of CaCse4p in C. albicans at corresponding stages of the cell cycle. Co-immunostaining of fixed Cd36 cells with anti-tubulin and anti-CdCse4p antibodies showed that CdCse4p signals are localized close to the spindle pole bodies, analogous to typical localization patterns of kinetochore proteins in S. cerevisiae and C. albicans (FIG. 2C). Together, these results strongly suggest that CdCse4p is the authentic centromeric histone of C. dubliniensis.

EXAMPLE 5

Centromeric Chromatin On Various C. dubliniensis Chromosomes Is Restricted To A 3-5 kb Region

[0065] Standard chromatin immunoprecipitation (ChIP) assays with anti-Ca/CdCse4p antibodies to assay for enrichment of CdCse4p on putative CEN regions (orthologous to C. albicans CENs) in C. dubliniensis strain Cd36.

Chromatin Immunoprecipitation (ChIP) Assay And Sequence Analysis

[0066] Chromatin immunoprecipitation (ChIP) by anti-CdCse4 antibodies followed by PCR analysis was done as described previously (9, 11). This suggests that the predicted centromeric regions of all chromosomes of C. dubliniensis are enriched in centromeric specific histone (CdCse4p) binding. Asynchronously grown culture of Cd36 was crosslinked with formaldehyde and sonicated to get chromatin fragments of an average size of 300-500 bp. The fragments were Immunoprecipitated with anti-Ca/CdCse4p antibodies and checked by PCR. PCR reaction was set up using 10 pmol of both forward and reverse primers (MWG Biotech & Ocimum Biosolutions), 5 μl of 10× Taq buffer (Sigma), 5 μl of 2.5 mM dNTPs mix, 2 μl of DNA template and 0.3 μl of Taq polymerase (Sigma) in 50 μl reaction volume. PCR amplification was carried out using PCR machine (BIORAD) with the following conditions: 1 min at 94° C. (denaturation), 30 s at 45° C. -55° C. (annealing temperature is variable with the primers used) and 1 min at 72° C. (extension). A final extension of 4 min was given at 72° C. PCR with total DNA (1:10 dilution) and ±antibody ChIP DNA fractions were performed using 1/25 th of the template. The boundaries of the CEN regions on each chromosome of C. dubliniensis were mapped using semi-quantitative ChIP-PCR in strain Cd36. Sequence-specific PCR primers were designed at approximately 1 kb sequence intervals that spans the putative CEN region of each chromosome of C. dubliniensis (Table 2 above). CdLEU2 PCR primers were used as an internal control in all PCR reactions. PCR amplification was performed and the PCR products were resolved on 1.5% agarose gels and band intensities were quantified using Quantity One 1-D Analysis Software (BioRad). Enrichment values equal (+Ab) minus (-Ab) signals divided by the total DNA signal and were normalized to a value of 1 for LEU2. The PCR primers used in this study are listed in Table 2 above. Similarly, a ChIP assay to determine occupancy of TAP tagged CdMif2p was performed using the strain CDM1 with anti-Protein A antibodies. All other conditions were identical as it was described above for CdCse4p ChIP antibodies.

Result

[0067] The immunoprecipitated DNA sample was analyzed by PCR using a specific set of primers designed from the putative CEN sequences (Table 2 above). These regions are, indeed, found to be associated with CdCse4p as shown in FIG. 3. This ChIP-PCR analysis precisely localized the boundaries of CdCse4p-binding to a 3-5 kb region on each chromosome (FIG. 3).

[0068] FIG. 3 shows two evolutionarily conserved key kinetochore proteins, CdCse4p (CENP-A homolog) and CdMif2p (CENP-C homolog) bind to the same regions of different C. dubliniensis chromosomes. Standard ChIP assays were performed on strains Cd36 and CDM1 (CdMif2-TAP-tagged strain) using anti-Ca/CdCse4p or anti-Protein A antibodies and analyzed with specific primers corresponding to putative centromere regions of C. dubliniensis to PCR amplify DNA fragments (150 to 300 bp) located at specific intervals as indicated (Table 2 above). Graphs showing relative enrichment of CdCse4p (blue lines) and CdMif2p (red lines) that mark the boundaries of centromeric chromatin in various C. dubliniensis chromosomes. PCR was performed on total, immunoprecipitated (+Ab), and beads only control (-Ab) ChIP DNA fractions (see Supporting FIGS. 6 and 7). The coordinates of primer locations are based on the present version (16 May, 2007) of the Candida dubliniensis genome database. The coordinates are listed in Table 3 below. Enrichment values are calculated by determining the intensities of (+Ab) minus (-Ab) signals divided by the total DNA signals and are normalized to a value of 1 for the same obtained using primers for a noricentromeric locus (CdLEU2) and plotted. The chromosomal coordinates are marked along X-axis while the enrichment values are marked along

[0069] Y-axis. Black arrows show the location and arrowheads indicate the direction of transcription.

TABLE-US-00004 TABLE 3 Chr C. albicans C. dubliniensis No. Regions coordinates coordinates R Region from left ORF 1748819-1750873 1713450-1716138 Cse4 binding region 1750874-1755348 1716139-1720954 Region from right ORF 1755349-1757404 1720955-1722609 1 Region from left ORF 1561872-1564187 1594163-1596130 Cse4 binding region 1564188-1567117 1596131-1600697 Region from right ORF 1567118-1580116 1600698-1611889 2 Region from left ORF 1924364-1928514 1939609-1943699 Cse4 binding region 1928515-1931474 1943700-1946867 Region from right ORF 1931475-1931569 1946868-1947202 3 Region from left ORF 821379-823848 866084-867273 Cse4 binding region 823849-826997 867274-870883 Region from right ORF 826998-827104 870884-871878 4 Region from left ORF 1000559-1002628 1027127-1029834 Cse4 binding region 1002629-1006266 1029835-1034637 Region from right ORF 1006267-1009311 1034638-1036395 5 Region from left ORF 467209-469044 494073-495323 Cse4 binding region 469045-472074 495324-499155 Region from right ORF 472075-473740 499156-500591 6 Region from left ORF 975879-976872 993828-1003043 Cse4 binding region 976873-980625 1003044-1006692 Region from right ORF 980626-981389 1006693-1009568 7 Region from left ORF 423632-426037 425994-435239 Cse4 binding region 426038-428938 435240-438230 Region from right ORF 428939-430172 438231-439177

However, as mentioned earlier, the homologs of two genes adjacent to the CEN6 region in C. albicans are 80 kb apart in chromosome 6 of C. dubliniensis due to chromosome rearrangement (FIG. 4). Since other CEN regions of C. dubliniensis are present in ORF-free regions that are greater than 3 kb, first all the intergenic regions, 3 kb or longer were identified, to find CEN6 in this 80 kb region. The ChIP-PCR analysis using specific primers from such regions delimited Cse4p-binding to a 3.6 kb region that is adjacent to the C. albicans Orf19.2124 homolog in C. dubliniensis (FIG. 3 and FIG. 6; not all ChIP data are shown). FIG. 6 shows relative enrichment profiles of CdCse4p in various C. dubliniensis chromosomes. CdCse4p-associated chromosome regions were enriched by ChIP using anti-Ca/CdCse4p antibodies. Specific primers corresponding to putative centromere regions of C. dubliniensis were used to PCR amplify DNA fragments (150 to 300 bp) located at specific intervals as indicated (Table 2). PCR was performed on total, immunoprecipitated (+Ab), and beads only control (-Ab) DNA fractions. Reverse images of ethidium bromide stained PCR products resolved on 1.5% agarose gels are aligned with respect to their chromosomal map position of each CEN region. The coordinates of primer locations are based on the present version (16 May, 2007) of the Candida dubliniensis genome database. Enrichment values are calculated by determining the intensities of (+Ab) minus (-Ab) signals divided by the total DNA signals and are normalized to a value of 1 for the same obtained using primers for a non-centromeric locus (CdLEU2). The intensity of each band was determined by using Quantity One 1-D Analysis Software (Bio-Rad, USA). Panels show the CdCse4p enrichment profiles on C. dubliniensis chromosomes at corresponding regions as indicated. Black arrows and grey arrows correspond to complete and incomplete ORFs, respectively, and indicate the direction of transcription. Thus, CdCse4p-rich CEN regions- and determined the boundaries of centromeric chromatin in all eight chromosomes in C. dubliniensis were successfully identified. It was also found that the relative distance of Cse4p-rich centromeric chromatin from orthologous neighboring ORFs is similar in both species in most cases (FIG. 1).

EXAMPLE 6

The Evolutionarily Conserved Kinetochore Protein CENP-C Homolog In C. dubliniensis, CdMif2p Binds Preferentially To CdCse4p-associated DNA

[0070] Proteins in the CENP-C family are shown to be associated with kinetochores in a large number of species. Using CaMif2p as the query sequence, the CENP-C homolog (CdMif2p) in C. dubliniensis was identified.

Homology Detection And Mutation Rate Measurement

[0071] For homology detection, Sigma (version 1.1.3) and DIALIGN (version 2.2.1), to align ORF-free DNA sequences were used. Default parameters were used for both programs, but Sigma was given an auxiliary file of intergenic sequences from which to estimate a background model. Orthologous genes were aligned (at amino-acid level) with T-Coffee. Instances of the following seven codons where the first two positions were conserved in both species were examined: GTn (valine), TCn (serine), CCn (proline), ACn (threonine), GCn (alanine), CGn (arginine), GGn (glycine) (n=any nucleotide). Third position mutations here do not change the amino acid. (Leucine was ignored because of a variant codon in these species). A naive count of mutation rates in the third position yields 0.27. Taken into consideration genome-wide bias for each codon, an upper-bound mutation rate of 0.42 was obtained.

For this analysis Sigma (version 1.1.3) (4) and DIALIGN 2 (5), to align ORF-free centromeric and other intergenic sequences were used. Default parameters were used for both programs, but Sigma was given an auxiliary file of intergenic sequence from which to estimate a background model. For protein-coding sequence, WU-BLAST 2.0 (tblastn) querying each annotated coding region of C. albicans against the chromosome sequences of C. dubliniensis was run. Parameters used were "filter=seg matrix=blosum62 hspsepQmax=1000 hspsepSmax=2000". Hits with a summed P-value of 1e-30 or less were identified as potential orthologs. Criteria for ortholog assignment were sequence similarity and synteny (requiring at least two common syntenous immediate neighbors out of four). This led to 2653 high-confidence predictions. These orthologous genes were aligned (at amino-acid level) with T-Coffee (6). Then the following seven amino acids were considered, when conserved, and coded by the indicated codons, in both species: GTn (valine), TCn (serine), CCn (proline), ACn (threonine), GCn (alanine), CGn (arginine), GGn (glycine) (n=any nucleotide). Other synonymous codons, if any, were ignored. Leucine was ignored because of a variant codon, CTG, that codes for serine in these species. A naive count of mutation rates in the third position yields 0.27. This was improved on by considering the genome-wide bias for each codon, as follows: let the third-position conservation probability be q. Then if a third position nucleotide in C. albicans is b, in C. dubliniensis it stays b with probability q, and mutates with probability (1-q). If it mutates, it was assumed that the probability of the new nucleotide is drawn from the known codon bias. For each amino acid A, the individual mutation rate, P(b2/b1,A) for third-position codon changing from b1 in C. albicans to b2 in C. dubliniensis was measured (the results are mathematically identical for evolution from a common ancestor), and solved for q; the weighted average of q for all amino acids and all pairs of observed third-position nucleotides b1 and b2 were then taken This works out to q=0.58, giving a mutation rate of 0.42. (Technically, this mutation rate is a slight overestimate, because a mutated b2 from a distribution was drawn that includes b1; but it is a credible upper bound.)

Results

[0072] CdMif2p shows 77% identity and 5% similarity in 516 aa overlap. The CdMif2p codes for a 520-aa-long predicted protein in which the CENP-C box (aa residues 275-297) is 100% identical in C. albicans and C. dubliniensis. FIG. 7 shows the CENP-C homolog in C. dubliniensis (CdMif2p) is co-localized with CdCse4p. (A) Sequence alignment of CaMif2p and CdMif2p showing the conserved CENP-C block (red box) (B) Localization of CdMif2p at various stages of cell cycle in C. dubliniensis. (C) ChIP enrichment profiles of CdMif2p on chromosomes 1 and 3 in the strain CDM1 by determining the intensities of (+Ab) minus (-Ab) signals divided by the total DNA signals and are normalized to a value of 1 for the same obtained using primers for a non-centromeric locus (CdLEU2).

EXAMPLE 7

Construction of CDM1 Carrying C-terminally TAP-tagged CdMIF2

[0073] A strain (CDM1) to express CdMif2p with a C-terminal tandem affinity purification (TAP) tag from its native promoter in the background of one wild-type copy of CdMIF2 was constructed.

[0074] Strains, media and transformation procedures. The Candida dubliniensis and C. albicans strains used in this study are listed in Table 4.

TABLE-US-00005 TABLE 4 Yeast strains Genotype Source Candida dubliniensis Cd36 Clinical isolate 10 CdUM4B ura3D1::FRT/ura3D2::FRT 8 CdM1 ura3D1::FRT/ura3D2::FRT This study MIF2/MIF2-TAP (URA3) Candida albicans BWP17 Δura3::imm434/Δura3::imm434 11 Δhis1::hisG/Δhis1::hisG Δarg4::hisG/ Δarg4::hisG CAKS1b Δura3::imm434/Δura3::imm434 This study Δhis1::hisG/Δhis1::hisG Δarg4::hisG/ Δarg4::hisG CSE4/ cse4::hisG:URA:hisG CAKS2b Δura3::imm434/Δura3::imm434 This study Δhis1::hisG/Δhis1::hisG Δarg4::hisG/ Δarg4::hisG CSE4/cse4::hisG CAKS3b Δura3::imm434/Δura3::imm434 This study Δhis1::hisG/Δhis1::hisG Δarg4::hisG/ Δarg4::hisG cse4::PCK1pr- CSE4(URA3)/cse4::hisG

These strains were grown yeast extract/peptone/dextrose (YPD), yeast extract/peptone/succinate (YPS), or supplemented synthetic/dextrose (SD) minimal media at 30° C. as described. C. albicans and C. dubliniensis cells were transformed by standard techniques.

[0075] CdMIF2 downstream sequence (from +1634 to +2198 with respect to the start codon of CdMIF2) was PCR amplified with primer pair CdM3 (CGG GGT ACC GAT TGC AAG AAG TAC TAC ATA AGA GAG) and CdM4 (GCC CGA GCT CGC AGG TAA AAT TGT TCT TGA GGA GCC G) thereby introducing KpnI and SacI restriction sites (underlined). The resulting PCR amplified fragment was digested with KpnI and SacI and cloned into corresponding sites of pUC19 to generate pCDM1. TAP cassette along with CaURA3 gene was released from plasmid pPK335 (7) as BamHI-KpnI fragment and cloned into corresponding sites of pCDM1 to generate pCDM2. Subsequently CdMIF2 RF sequence from +1090 to +1548 was PCR amplified using primer pair CdM1 (ACG CGT CGA CCC CCC ACT GAT TAC GAT TAT GAA TCT GAT CC) and CdM2 (CAT GCC ATG GCC CAA TTC GTA TCG ATT TCT TCT GGT TIC) and cloned into pCDM2 as NcoI-SalI fragment to get pCDM3. Finally, a 2 kb amplicon was PCR amplified by the primer pair CdM1 and CdM4 using pCDM3 as the template. This PCR fragment was used to transform CdUM4B strain (8). The correct Ura+ transformant (CDM1) was identified by PCR analysis.

Result

[0076] The subcellular localization patterns using polyclonal anti-Protein A antibodies in C. dubliniensis strain (CDM1) at various stages of cell cycle is very similar to those observed for CdCse4p (FIG. 7). Binding of TAP tagged CdMif2p in the strain CDM1 was analyzed by standard ChIP assays using anti-Protein A antibodies This experiment suggests that CdMif2p binds to the same 3 kb CdCse4p-rich region of two different chromosomes (Chromosome 1 and 3) in C. dubliniensis. Binding of two different evolutionarily conserved kinetochore proteins CdCse4p and CdMif2p at the same regions strongly implies that these regions are centromeric. (FIG. 3 and FIG. 7).

EXAMPLE 8

Comparative Sequence Analysis Between C. albicans And C. dubliniensis Reveals That Cse4p-rich Centromere Regions Are the Most Rapidly Evolving Loci of the Chromosome

[0077] Pairwise alignment of CdCse4p-rich sequences on different chromosomes with one another reveals no homology. To compare orthologous CEN regions of C. albicans

TABLE-US-00006 Cse4p- Cse4p-binding binding (shuffled) Pericentric Intergenic Total bases 26836 26836 40280 593782 Aligned 12440 11650 27684 530847 (DIALIGN2) (46%) (43%) (68%) (89%) Mutated 7624 7201 10229 154473 (DIALIGN2) (61%) (62%) (36%) (29%) Aligned 0 0 15015 334363 (Sigma) (37%) (56%) Mutated 0 0 3323 57548 (Sigma) (22%) (17%)

and C. dubliniensis, pairwise alignments using Sigma and DIALIGN2 were performed. These programs assemble global alignments from significant gapless local alignments. Sigma detects no homology in Cse4p-binding regions. DIALIGN2, with default parameters, reports a little homology; but when nonorthologous sequence were compared, (namely, CEN sequences from non-matching chromosomes), it reports almost identical results (Table 5).

Table 5

[0078] In other words, it finds no homology beyond what it would with the "null hypothesis" of unrelated sequence. Similar results were obtained with other sequence alignment programs. It is concluded that there is no significant homology in the orthologous Cse4p-containing CEN regions in C. albicans and C. dubliniensis, even though the CEN regions are flanked by orthologous, syntenous ORFs. However, neighboring (pericentric) ORF-free regions, located between the Cse4pbinding regions and CEN-adjacent ORFs, do exhibit a higher degree of homology compared to Cse4p-rich regions. Mutation rates were counted only in aligned blocks (ignoring insertions and deletions); DIALIGN2 aligns 68% of these regions, with a mutation rate of 36%, while Sigma aligns 38% of the regions, with a mutation rate of 22% in aligned regions. Much of the conservation occurs towards the outer ends of these regions, that is, near the bounding ORFs.

To estimate a "neutral" DNA mutation rate, 2,653 putative gene orthologs of C. albicans in C. dubliniensis were identified. For homology detection, Sigma (version 1.1.3) and DIALIGN (version 2.2.1), to align ORF-free DNA sequences were used. Default parameters were used for both programs, but Sigma was given an auxiliary file of intergenic sequences from which to estimate a background model. Orthologous genes were aligned (at amino-acid level) with T-Coffee. Instances of the following seven codons where the first two positions were conserved in both species were examined: GTn (valine), TCn (serine), CCn (proline), ACn (threonine), GCn (alanine), CGn (arginine), GGn (glycine) (n=any nucleotide). Third position mutations here do not change the amino acid. (Leucine was ignored because of a variant codon in these species). A naive count of mutation rates in the third position yields 0.27. Taken into consideration genome-wide bias for each codon, an upper-bound mutation rate of 0.42 was obtained.

[0079] The genes with T-Coffee were aligned, and the synonymous mutation rates using seven codons that are "fully degenerate" in the third position was measured (the first two bases determine the coded amino acid). A naive count of the third-position mutation rate yields 27%. Correcting for genome-wide codon biases yields 42%, an upper-boundary estimate for the "neutral" rate of DNA mutation between these two yeasts (see Materials and Methods). This rate corresponds to a pairwise conservation , rate ("proximity") q=0.58, or a proximity to a common ancestor of 0.76. Tests on synthetic DNA sequence (as reported in 21) suggest that Sigma would easily align such sequence; therefore, it appears that CaCse4p-binding sequences (but not pericentric regions) have diverged faster than expected from the neutral point-mutation rate in these yeasts.

309 homologous intergenic regions were also identified in these species that were between 1000 and 5000 by long (comparable in length with the Cse4p-binding regions). These regions were aligned with Sigma and DIALIGN2, and measured mutation rates in aligned regions only (ignoring insertions and deletions). Sigma aligned 56% of the input intergenic sequence, with a mutation rate of 17%; DIALIGN2 aligned 89% of the input sequence, with a mutation rate of 29%. This rate is less than our estimated neutral mutation rate of 42%, suggesting constraints on the evolution of intergenic DNA sequences. Although pericentric regions evolve slower than the neutral rate determined above, they have a smaller fraction of conserved blocks and a greater mutation rate than intergenic sequences. Interestingly, despite the rapid divergence of CEN DNA sequences, the relative position of the CEN on each chromosome is conserved in all cases. FIG. 8 shows relative chromosomal positions of Cse4p-binding regions in C. albicans and C. dubliniensis. Red oval shows Cse4p-binding region.

[0080] The relative location of the Cse4p-rich centromeric chromatin in the ORF-free region is also similar in both species (FIG. 7). Although no homology was found among Cse4p-binding regions in matching chromosomes, some of the ORF-free pericentric regions in matching chromosomes have repeated segments, both within the same species and across the two species (FIG. 9).

FIG. 9 shows conserved blocks in the pericentric regions of various chromosomes of C. dubliniensis and C. albicans. The cyan dotted blocks represent the Cse4p-binding regions. DNA sequence stretches of various chromosomes having significant similarities (ClustalW scores above 80) are shown by colored arrows as indicated. The numbers on each chromosome represent their coordinates in respective genome database. The direction of the arrows represents the orientation of repeats. A BLAST search was done to identify the repeats flanking the CEN region against the C. dubliniensis genome database with C. albicans CEN flanking repeats as the query sequences (10). The inverted repeats were observed in the chromosomes R, 1 and 5 of C. albicans and C. dubliniensis (Table 6). The LTRs such as epsilon, zeta, episemon) are also shown.

TABLE-US-00007 TABLE 6 % homology Chr Coordinates in between the inverted No. Repeat C. dubliniensis repeats.sup. R IRR 1720958-1721270 (D) 100 IRR 1716158-1715822 (R) 1 IR1 1595932-1595989 (D) 96 IR1 1602853-1602907 (R) 5 IR5 493690-494369 (D) 99 IR5 500277-500974 (R)

These results strongly suggest that factors other than Cse4pbinding DNA sequences determine centromere identity in these species. The role of pericentric regions in determining centromere identity remains unclear.

Result

[0081] Thus, the core CdCse4p-rich centromeric DNA sequences of all eight chromosomes of C. dubliniensis. Two important evolutionarily conserved kinetochore proteins, CdCse4p and CdMif2p are shown to be bound to these regions. Each of these CEN regions has unique and different DNA sequence composition without any strong sequence motifs or centromere-specific repeats that are common to all the eight centromeres, and has A-T content similar to that of the overall genome. In these respects they are remarkably similar to CEN regions of C. albicans (11, 12). Though genes flanking corresponding CENs in these species are syntenous, the Cse4p-binding regions show no significant sequence homology. They appear to have diverged faster than other intergenic sequence of similar length, and even faster than our best estimated neutral mutation rate for ORFs.

A study, based on computational analysis of centromere DNA sequences and kinetochore proteins of several organisms, indicates that point centromeres have probably derived from regional centromeres and appeared only once during evolution. The core Cse4p-rich regions of C. albicans and C. dubliniensis are intermediate in length between the point S. cerevisiae-like centromeres and the regional S. pombe centromeres. The characteristic features of point and regional yeast centromeres are the presence of consensus DNA sequence elements and repeats, respectively, organized around a nonhomologous core CenH3-rich region (CDEII and central core of S. cerevisiae and S. pombe, respectively). Both C. albicans and C. dubliniensis centromeres lack such conserved elements or repeats around their non-conserved core centromere regions. Based on these features, it is proposed that these Candida species possess centromeres of an "intermediate" type between point and regional centromeres. On rare occasions, functional neocentromeres form at non-native loci in some organisms. However, neocentromere activation occurs only when the native centromere locus becomes non-functional. Therefore, native centromere sequences may have components that cause them to be preferred in forming functional centromeres. Despite sequence divergence, the location of the Cse4p-rich regions in orthologous regions of C. albicans and C. dubliniensis has been maintained for millions of years. Homology was also observed in orthologous pericentric regions in a pair-wise chromosome-specific analysis in these two species. Moreover, several short stretches of DNA sequences are found to be common in pericentric regions of some, but not all, C. albicans and C. dubliniensis chromosomes. Both in budding and fission yeasts, pericentric regions contain conserved elements that are important for CEN function. In the absence of any highly specific sequence motifs or repeats in these regions, it is possible that specific histone modifications at more conserved pericentric regions facilitate the formation of a specialized three-dimensional common structural scaffold that favors centromere formation in these Candida species. It is an enigma that, despite their conserved function and conserved neighboring orthologous regions, core centromeres evolve so rapidly in these closely related species. Satellite repeats, that constitute most of the Arabidopsis and Orzya centromeres, have been shown to be evolving rapidly. However, because of their repetitive nature, these plant centromeres are subject to several events such as mutation, recombination, deletion and translocation that may contribute to rapid change in centromere sequence. In the absence of any such highly repetitive sequences at core centromere regions of C. albicans and C. dubliniensis, such accelerated evolution is particularly striking. It is important to mention that a very recent report based on comparison of chromosome III of three closely related species of Saccharomyces paradoxus suggests that centromere seems to be the fastest evolving part in the chromosome. One possible mechanism for rapid evolution is error-prone replication of CEN DNA followed by inefficient repair. In fact, pausing of replication forks at the centromeres has been reported in S. cerevisiae. If a similar situation exists in C. albicans and C. dubliniensis, it is possible that core CEN regions are replicated by error-prone DNA polymerases, a situation similar to translesion DNA synthesis. Several studies reveal that centromeres function in a highly species-specific manner. Henikoff and colleagues proposed that rapid evolution of centromeric DNA and associated proteins may act as a driving force of speciation (1). The consequence of the rapid change in centromere sequence that was observed in these two closely related Candida species may contribute to generation of functional incompatibility of centromeres to facilitate speciation. To understand the mechanisms of centromere formation in the absence of specific DNA sequence cues, it will be important to identify more genetic and epigenetic factors that may contribute to the formation of specialized centromeric chromatin architecture.

LIST OF SUPPORTING REFERENCES

[0082] 1. Thompson J-D, Higgins D-G, Gibson T-J (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673-4680.

[0083] 2. Kumar S, Tamura K, Nei M (2004) MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5:150-163.

[0084] 3. Gouet P, Courcelle E, Stuart D-I, Metoz F (1999) ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics 15:305-308.

[0085] 4. Siddharthan R (2006) Sigma: multiple alignment of weakly-conserved non-coding DNA sequence. BMC Bioinformatics 7:143.

[0086] 5. Morgenstern B (1999) DIALIGN2: improvement of the segment-to-segment approach to multiple sequence alignment. Bioinformatics 15:211-218.

[0087] 6. Notredame C, Higgins D, Heringa J (2000) T-Coffee: A novel method for sequence alignments. J Mol Biol 302:205-217.

[0088] 7. Corvey C et al. (2005) Carbon Source-dependent assembly of the Snf1p kinase complex in Candida albicans. J Biol Chem 280:25323-25330.

[0089] 8. Staib P, Moran G-P, Sullivan D-J, Coleman D-C, Morschhauser J (2001) Isogenic strain construction and gene targeting in Candida dubliniensis. J Bacteriol 183:2859-2865.

[0090] 9. Sanyal K, Baum M, Carbon J (2004) Centromeric DNA sequences in the pathogenic yeast Candida albicans are all different and unique. Proc Natl Acad Sci U S A 101:11374-11379.

[0091] 10. Sullivan D-J, Westemeng T-J, Haynes K-A, Bennett D-E, Coleman D-C (1995) Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141:1507-1521.

[0092] 11. Wilson R-B, Davis D & Mitchell A-P (1999) Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181:1868-1874.

[0093] 12. Mishra P-K, Baum M, Carbon J (2007) Centromere size and position in Candida albicans are evolutionarily conserved independent of DNA sequence heterogeneity. Mol Genet Genomics 278:455-465.

Sequence CWU 1

12614567DNACandida dubliniensis 1acaacaatca acaatttctg ctcctcatgc cattacattt acagatagtc atactacaag 60cctgtcaacc ccatatgaaa aaaaaacttc ttacaaacca gttcacgttg caactggcac 120aactccagca aacataaaca tcccctaaaa aaaagcctac atacatttta aacgcttgac 180attctcctgc tcaacaaatt caaaagttag ctcatttgcg aataaggtga tacccactta 240ataaaaacgt acaccttcgg caataaattc ttcttgctta tactcgcctt ttcttaatca 300gggagatcac ttacatacca caataaacac caagctcttc caaactaaac aaagcaatct 360cgaaactgac ctctttcttt caataactaa taaacgattt ggaataccca caaagtcaca 420aattatacag caaaacctcc tacaaaatca atgatatcaa catttcaaac aggaacaaaa 480gaaaatcgtt tgtatcaatt gattctcttc ctaatacaaa ctaaacacct tgtaattagt 540tcttataacc aagaataact aaacaataca aaagctacca aatattatca cgtgaccaaa 600gctaaatgtc ctatctatcc cccctccgaa atcacataaa tctgaacaga tcaggcaaca 660catgacacct aagttagact tgcaagtagt aatatcggcc aaccatttgg tacttcacac 720agcaccaaac taaaacagac tatatgtgaa cgctctacat ttcttacctt tcatgaacac 780gtcaatccaa ggaatagaat caacattcca cttatgctat gaaacttgac tcttaaaata 840ctatcacttc ccccttacct catgtataca agaagcctta aaaacactat ttctttttca 900caaatgctgc aatcaactag aattgctaat accccttttt aaacgtgaca cgctcaaaca 960tacccaccta taaacatcac ataaaaatga aacagcattc actaaagcaa ccataaaacc 1020gaacacactc ataacttaac taatacactt ccttcatcaa aacactcaat tgctaaaaaa 1080gaaccaacta atgaaattga ctcaaaacaa aaactaatca gaccgattct ttagataaat 1140cttagaatgt ccatttcctc acgcaacttt tccatactcc ttgacaatta ttctagtacc 1200agtacttcgg catgaagaag tctctgatgg tccccggacg tcaactgcaa aaacaaggaa 1260agtcgcctaa atcttgtaaa gcgctcaact ctttacgaca actcatctct tcgacaagat 1320caaaagaaac gaaaacaacg aaaaccagta atgctttgcc tatcaataca gaaaaacaaa 1380cgtcactgtt tcaacaaaag ccacagtcta aaagccttaa atgaacctat tgtgcgttgc 1440aatttcttta ccattctttc cttgtcttcc taccaaccag tgttaaacca tgcctgtctc 1500aaaacctcat ttttgaagca tcttctatag taagactctc ctgtttcaca ctaattagct 1560agacaaaagt tacactttac ttctttatgt atactctgtt gatcagcttc ccattatggt 1620gattttcaga aaaaaagcga tatataataa ttttttaaac tttcacaata aaagaaatat 1680tgttttgaca tcacttcaat taaattggct tctagcttta aagttcctca gcttgtagta 1740aataccctgc tgttgcctat cactacttaa ttcagtcaca ttcctaaagg catttcaata 1800caacatcatt ccaaagctaa aactataata aactactact ctacaagcgg acggacttgc 1860tcgggtcaac agctcaaata aattccacaa gtaatagtat agcatgacaa acatattcat 1920gaacaccaga atcgggtgca tctaagaagg gttttacttt aatcatagtt ttttagatgc 1980agcaattggt atcaaggatg tatattggaa ttcaatatac cataagaatt agaccgaaaa 2040aactacagtt tgactttact cgacacttgc gtatattttc ttagaatatt cagtttgcac 2100aacaatttaa ttatcaaagc aggattcgtg ctgactatag gtgataaacc ctactgaggt 2160caggaaagct aacaagtttt tcctactatc cgtatttgac gggtgcaagg ttatattgta 2220aaactggtat aacaaaagtg gccctatcag tattgttaat atttagtttg gcaatggtta 2280acatagttgt atttattgta ttttgattgg gtcaatcgaa acgaacatat gagatgcttc 2340atttgctttg ctcaacaagt aatcatttca ctgcttaatg cagtatttga ttctatttta 2400aagaattggg cccgcagagc tgccaaactt agtttacgtc tgtaaaagat tatgtgttga 2460tttgtatgct agtgtttagg ctcgttgact tttccacata aatactatat tagttcttag 2520tcattatagc agtcacacag tatcgcattg cgatcttctc ctttcttttg attgtgttga 2580tgatatgcag aagcttaaaa aactaaatat tcttatcacc cttgtgttga tgcgaagaca 2640ataattcata ttacttttat agttgggatt tgcaatctca taaacacttt tgattcaagt 2700taaagaggta atgaagtaag agtctgacta ttggagtagg gaaatggttt tgctgtattt 2760ggctatattg tttcagttct aacatgagcg tattgatagc agtgtatttg tgatatagga 2820gactctaggt gccattttgt gcttgtttat gtagagaatt actgatgatt gtgtgagggc 2880atatagatgc actttattga gaatcgatgt tgagaataaa gtaaagtttg ggtagcatta 2940tcttgttaaa agttgcagtg cattgtacga ggtaagctcc aatgatgatc tggcgaggtt 3000tatagatatt gctcaagtct gcttgtgtca ggaatgcttc gttttgttgg gatatgattt 3060ccaatgattc tgagcctggt gcagttgggc aacctaaatg aattgatgga ggtgggtttg 3120aagttgtctc ggatcagttg caagcgatta tttagagatg ccggttatcg tttggtaaaa 3180gtaagacatg attaacacgg tatgaattga tagcttgtgt aatgcttgta tcgtggaaaa 3240aaaatgggag gtgaatgagt tttaacaaag tctttgtaat ttataaagtt gaagttcact 3300gttttatatg tttactgttt tgagactgtt ggaaggtagg ggatacgtta ttgggattta 3360gtttttggtc tcgccatagt tgttattgtt gttgtcagtt tagtggatgc ttcaaaactg 3420gaaggactag attgtttggt tttgattgag ttctctttgt gggtactgta ggtttgctat 3480tgatgatgat tatagaacaa gattttttga caaagagtca aggatgtctt attagtgtac 3540aagagacgta gtcaggtcaa ggttgattga ttgtagttag gattgctata ttgtattgtt 3600agaatatttt tttgtccagt tgaaagtgag cactcattgt gatcgattga atagcttata 3660tttgaaaagg atttgaagac taggactgtt ctgccgagat gattgtgtgt gagagaatat 3720ggaaggggcg ctgattaaca agtaggctga aaaactatat gttgttgtta gtattggtgg 3780ggatgaaaga ggaatgaaaa cttcaatacg tggtctcctt cgacgtcaga cgacatgaga 3840tagagtcagt ggtatatgca aaattgagga aggtttgcca agttaaatag tatatgaaga 3900tgtttgactg ataatctttc tacagataca aaggtttagt gtcatgattc atgtagatgg 3960gatatattta tcattgcctc aaagtggatt atcctagtgt gtttgcattt gaagaaatgg 4020aattagagtt tcttaccagt gggaagtaga aaaagcactt actagatgag acaatttgcg 4080ctttacttga gtttatagag ttatgagtgc attgcgtgaa tgaatgtcat tgaaatagtc 4140actcggttgt tggcaattat tggttactat gtgtttttcc gatggcagag ttatagtggt 4200attgtatgaa tgattcaaat ctgtcacgta gtcatgtcaa catggaggga gggttcccca 4260gacagattga atctgaccgt tagataatat agtaacttag gcttaaccta ttttatattg 4320gtttagacaa caagaatttg cagaatatat tgatcgcaag cgaagcacga aatgacgctt 4380agatgtctaa ctaattcccc cattcgttgg gagatttgct acataaatag aatagctgca 4440cttcccttta ctattatata cttattggat agggtctagc tggttttaga ggacaatgcg 4500aagtgacaat tcaatttctg gttgctatat tcaattggtg agctatagag cgtatttgag 4560agataag 456723168DNACandida dubliniensis 2ttataccccc gaattaacaa gtgcgcccct cctcccataa gtcgtcattg caacataaat 60gtatgtcttg tctcaaaaca tttcctcttc ctgttcagcc gtaaaatcct aaatccacat 120tcttatgaga gcctgactat tcatcaatct ggtaaacgaa agcacctgca ctgactacct 180aaatatactc actctagtca tcataatcaa atacaggact tctcaacatt gacctacaca 240aactacaaaa cctgttacag gataccagag attgcgttaa aaactcttgc cacattccac 300aattctaaac ttccgaattt ttagctttcc attgtatcaa gttacaatct taatttcacc 360cacttgaagt actttaaaat tatacctatt ttgagttcag caattcctta ggatgaaact 420ttggttgata gtcttgaaat caaatatagt atctatagta tcaatgcctt gaacaaaaag 480gtatcagacc atctggcaaa accaccattc ttcgcccaaa gagtttgctt ctcatccaac 540tttattgcca aactatcttt atacgctcag aagcaattaa agctattaaa ctagtggagc 600accaatcatt tcattactcg actatgtggt aactgaataa tatcactcgg tacttagtaa 660cattgactac tgtacactgc attctcccgg aaaacatatt tcaaggtatt cgatctatat 720gttttatggg aaaaaatttc cttaagtttg tctttcctgt tcaatgtacc aagaacaaca 780ttaaattaat tctacctgtt ctgaaatgtg ggagccactc aaagtcagga cctagcttag 840ttagatgttc tatgtctaaa tcgaagaagt atgtaaacaa gcttctgctg gagacttatt 900tttcaaaagc tacatctatt ttcaatgcac tccgagactg attagaataa ctacattcat 960ccggatacac cttggcgtat actcaaaacg tcaaacggtt tgtaacattt agcagttaaa 1020ggttgatcct ccaaacagca gaatgcaaat acatcatatg taagcgctaa attttttatt 1080caagtggata aagtatattg atgttgttct gagaactaca atgtttagtt tgcaattaag 1140tgagttaggt ttctatttgt atatgtttga gtatgctgct ggctgtttca gagcaattca 1200gagacttaga atactatata caactacact tcttgtctct ccccatgcca gtgaatatct 1260gtatcaaagg gttacataat atgcatcctt ctacctatgc atctggtgga tactttgggt 1320tattcataca atttcagtat gaaaaaatgc atttgtatta ttacctcaat tagcttcaca 1380gccagtaatc aagtcctcta taggcgtaac acaagatttc ggtattactg gcgatattct 1440gttgaatagc tgcagacaaa cctttgatct gttttgtagg atggacagga aaagtatgtg 1500tcaattggtc atctaccaat tatttccatt tcatggtaag gtgatgtgcc agtgcgaatt 1560tgttaaggca ggtaatctaa ctggttggta gatttctatg tccaggagaa acatgtgtaa 1620tacttggtgc aactggagag ctagtacatc ggaggaaatt gcttgttgac tctccaaatg 1680tgtaccaact ttaagtaggt agcgatttac atttcattct tatttgttct attctttaga 1740agagaagaaa ttctatgatt cggcagtaca atataacgaa agaggttgat tatgtctact 1800tacaattatt catatgattt ttgagtattt gagacttcga tttcatcagt tcaattgatg 1860gggttgttct ggcgcaacac aaattaagga aacgtatgtc tgattccttt ttgcttagaa 1920ttcaattcca tgccagccta tactattctt cgaggcagtg ttacctcttg ggtaatttta 1980agaatattat gtattggggt ttggtttcac attttgtagg atagtttcaa tctatttggc 2040aataatgcaa aaagctatgc cagtttagtc ttgtcttgat ctgttaacag actatcttgt 2100agtattggtt ggattaacta ggttgagttt ttggggttgg aagtaattca agaagcaagt 2160gttgattgta actagttttc tgatttatgt ttgaaacctc aaggcaccag tatgtaattg 2220tggaatatga attcaagctt tagcttggtt agtgagctga gttatagtct atttattcag 2280aattgtggta cgaacctttg tattttgtaa tttatccccg agtgcagcta gtgttgttta 2340attttgatat agttgtagct gaagttggca tactgaggtt tagcatttat agagaaggtt 2400gttgatattg tgagaaggtt gaagtattta gtgcagatat tatttgtatt tttgatggtt 2460tagtaactta gtggtgttgc ttatatttgg attgttaatt ggaaatgaaa cggtcgtgaa 2520ggcaggtgta tactaggttt tgaagaattg catatttcca ggggactttg tcactaatat 2580tctatgatgt gtaccttggt ggtatgtggt gttttacgtt gagtcgagtg taaactttgg 2640tagccagtga tatcagagtt aatggtttcc atatttaggt ttgttactcc aagttgctat 2700cattatagtg tataagatca tagctcggga ttatgagggc tgttttgaaa ttaggtatga 2760ataagaggca agagactaaa gaatatggca agttgcgagg gtatcaagct ggtttagaga 2820cggttatttt atcaggaatt taatttttgg tgtggtaggt ggatgaacaa tgtggttagg 2880gaaccgaaaa aatttgaaga ataatgaaat ttttagttgt tattagaatg gtacaagaga 2940tataagaatt tcgagaggac ttggttcgtg ctgggattgt ttccttgatg aggatacagg 3000tgtgactcgt atttttgtgg agggtttggg atattaatcg aaggtcgttg catattagaa 3060gggcggaatt ataaaaaagg ttgaaggaat gtgaaaacag agcttgtata aaaatgtatt 3120ggagcgggaa atgcactatt gaagtgctgg gagttttatt tgggtacg 316833610DNACandida dubliniensis 3ttcatccatc atatcacaaa tcctactgct aatatcagct caatatatca aatagtcccg 60tgggttccac ataattaagc agatagcttg ggcacttatc atcataacat gcgtatatct 120gtatatcaag cgacaacttg gatcctgaac gacacggttt ctgcaacttt tttaaaccct 180ttcccctctc cccaactttc aaaataacta aatacagtgc cagtaacaag ataaaactat 240cctatatagc acatcttact taaattctct tccttctctc agaacccacc atactcacaa 300gcttcttaaa aaactgagtc ctcctcaata gcactagaac actctaaaca tctgctcccc 360tagattgatg ttgaactatc aatactaata ccaatacaat tcaaaaccat acttccaaat 420taacaacttt tcctctttcg tcttccatat cttacatgtc gtaattcctc tcttaccgga 480cttatgatca acctattact aaaggaaaga cactactgta gagttcctgt caaacgctct 540aagctcacct tcggcaataa ctacgaacca ctccagttga aaactatagc aaatcaagac 600aggtaagtgc taaataaata caatagaaat atcaaaacct ctacattggc caatttactc 660tcaaaagctg ccgaaccaca acacatccac aaacaaactt ttctgagtaa tcttaaacca 720ttcctctcta agcaaccgtc tcccataaac ttcaccttaa ccataattca ttatttcatc 780cattcgaaac acctattcca atatcggaag aggagaagtt caccgagcta ccaatttgag 840caaatataaa ccaacttaaa gatccattgc tcctgataaa ccaaacctta tgcgctaaga 900catttcattt tacccaaagc cattagcatc aaccaaaagc taacatatct gccaaaactt 960gatccggtaa atcatccata tactctaagt cgaaaccaac gtttaattga acttatcttc 1020ccaacaattt ggcgaggatg gtttaaaatt ctcaacgcaa catgcattat tcttctaatt 1080gaaaactcat tatccaaaca ctaaataacc tcaaaagaag tgataatact tatcataatg 1140aaccctcata ccaacaacct ctaaccaaaa tcacaacaac tccacaaatc cttttataac 1200tttttcccca tcaaaaacaa agccaaaaat accgtgatac taaatcacat taatagaaca 1260aaacatgcct tcattccact attttcaaac tagaagactc tcatctacaa aaattgtgct 1320acactgagaa ctaccatttg cttgtcgcct atattatcaa ttcaagtact tccaccaaac 1380catcatggcc acatccaccc acattggtta caaactaacc attaaaacaa actaaatcaa 1440aacataacta ttataacaaa taatagcact actagatcgt gagtagcagc acagattatt 1500ctacaacaag ttctcgctat gaatgtgcta atttctcagt acacctacca tcacaacata 1560atctactcct ttaagtctaa gaacacctac tgcaagccat tacattaaac ataatttcaa 1620gacaaaaatt gacgcagaaa ttgttgtcaa ctcttctgga aaaacaaccc ttctgaaacc 1680aataataagc aatagtatac actacttcta caagctgttt ataatcctgg aaacagatag 1740ttaaatagaa gcgaggcatt actgattaga tactgcctga gaagattcca aaccacccga 1800caactactac taatttccct acgacatgaa cacatcaaac tactcgccca ccaatgttta 1860agtagtctaa tatataaacc ttataattgg taattctttg atgctaacca agaagcttgc 1920aatcagaaaa ggaaggaaag aaattaatct tttcaaacta cagcagcctc gtttcgcaag 1980ttttcaacaa aagcatagca ttactctctt taggtattga acgtttcagt gaagaatatc 2040tatttatata cgttttggtt tgtaaagcga gttcacagca taagcctcta catactctgt 2100atatgattat attaatgcat tattttgaag tatttaccag aagtttggct attctatatg 2160tgtgctttag aggtagctcg tttgatttga acattgtggt tgcactgaaa accaaagttt 2220gtgtaagttt tgtcagttaa atcttcttct taggttttct attgatatat gtagtagtaa 2280aaattgtaaa ctgatgccat tactgattaa tcaacagtgc aattcaaatt taatagagta 2340gtccagttta ggatatttca agttgtagct gctcagcata tggctttgtt gtcctgaatc 2400aattcttctt ggtataggga ttagcttact gacaaagatt aatgtaggtg agaggagacg 2460gtttgcttaa atgagatact aaaatattaa actattgatt tacacagatt atttttatag 2520ttagtagtcc tatgcacaaa agtacttgaa ttggatgagg gaccaccgtt gaaaagcaaa 2580ttgataatgc gaattgtagt gatttgtatt ggtcaattga tgcaccagta caatagtgaa 2640cttggaattt atcttttaca aactattatt gtagctagtt aacaaagtaa tttaattgcg 2700agatagtctc cgagtatttg ggtaatgtat tatttcaacc cttgactata tccaatggtc 2760tggttatgtt acggttattg tttacggtag acgaaattaa cttgtggagc accttaagag 2820ttgaggcttt ttttatggtt gtgaggactt agaggaatca ctagaagcga tagctttaag 2880gcaatgatgc aatcatagaa cagtttgcta aactgtagaa ggtagctggt tgtgttcatg 2940tggtttgtga taaaggttcc atcggttaaa acgtttttcc ttgttgttgg cattttgtgc 3000ataattatgg aagagtaata actccacgct gttgatccca ctgtatactg aaacgtaggt 3060tttccagagg caaatgattt gctagttttg aatgtattgt gaggttcaaa atgaaattgc 3120tgagacgttg tatcaagctc atttcaagtt gtagtaatga attgaacatt ctacaagtat 3180caagagacgt tggttctatt ggagatatac taatgtaata tttaggtctg tttgagcgtg 3240attgtggtaa tgactgacta tcctcagatg gtgagagaag tttttcactt ggttgcagtt 3300caaataaggt tttcacactg gcagggctgg tagaaattgt taggtatgac cgaattactt 3360ttttgaggct agtcggtggt taacggttgt gtgctttatt tgattttgac aggcttgata 3420cgattgcttc ttatgttggc gtgagcatgt gccacggtat cagttgttca tagaggttag 3480tagagacgat gatgcttatt aattttaaga tacgtgagtt ttctgatgtt tgcgctgtct 3540gttgtcggtt tatgtatgct gaatcatata ataattttaa ttggcatcgg cgatggtgtt 3600tattccgagt 361044804DNACandida dubliniensis 4cacaattccc agtaaaccat tataaaagga aaagctttca accaactccc tgcaaatgta 60aacctaaagc acagagctct attctttaaa atccaatcct tagccacaca acatgtaagt 120tggcttacta ggagcctaca aatcagatta tgaatgtagc aaacatactt aattatgctt 180cagaaaagat acacccatgg acttgaaaac attatctcaa atacacctca agtcagacaa 240tacaaaactt atagctgttg catactgcaa taggtaagaa catgaaaaca atagagttta 300catcaatctc attttcgaat cagccaaact tcaaaaatat aaactattcc taatcaatat 360acttcacctc attcattatt gcgcaactca cgaaaacatc taccattact actacttgga 420acaatgaaac aattgcaaaa cgagccttta catataaaga agaataaccc aggtgcgtac 480attgttgaaa tgaatcgggt tcaactaaaa ttgaccacta ccgggaccaa acattaaacc 540acgaattaaa gcatgcactg aatgcaaaca ccattaaaaa tgtctactgt taagtgatta 600cattttcgtg tgttttctac agacgaacgc aattctacaa tgctaatcaa agctgtagtt 660agactagtta agtcctctat atgatttaaa gacactgcgc tttctttata gcctattaat 720tgctaaacga ccccctcaaa atgctttcta agaagatgct ttggctattc gattttacta 780aactacgtat cctgttcctg cagtctaaca gggcattgtg aatttgcaac aaagttttca 840attcgttttc ctgatgccaa tcatcactta taattaggtt tcacgtgcta cagttatgct 900tctttcagat gttggtacag cctcaggtca atcggttttg gtttggttgc tgatgatcgt 960cgtacgtagt atcgagataa tcctaagtaa catcaaaaaa tacattgccg tatggtagca 1020atgtagctgt tccagacacc tagtaaatga ttaaagcttg cgtttcttaa caaagaaaac 1080tgagtttgtc gtcgtcgaat gcaggcaagt atggggatta gtgctttaga gctaaggagt 1140tgaacgtgtc tttccaactt gtccaacaac gtattcagtc agcttaagct ttttgttcat 1200gcattagagt tttgattatt ctggtatttc ttactagggt ccaccttcgt aaagtgatac 1260ttgcttgaaa gtttctacat aaatattaat tgcaagtatt agtttgaaat tgagcaaccg 1320gtggttcgag gagattgtcg gttgaaatgg gaaattagta tatttgagta agtttgctag 1380ctggattact gtttccaaca actagtaggg ttcatttgaa cttatactat agaagtgttt 1440ttgcgaataa gttcttgatt gggacagatt aaaatatttg tgcataatta aaagagtttt 1500aataagttac ttaataaagc tatactcgta ctagagacat tcctttagtc acgcctcaga 1560gctagaaaat ttaagctgcg ttggctttgc ttctgataag caacgtttag tcaattcatt 1620ggaagatgta gtagggtgta tcaaatattg agaaattttg gattgtcttt tacggaagaa 1680aaggttcttt aaactttgat tgggggagca ttagaatttg agcatttata gttgaagctt 1740tcttttccaa gtgtatacta cattttcttc tttaattgga ttatcttaga taaaggaaat 1800tacgtaagat gtaaagttta taggaattaa agtgacattt gcatggtatg aatatgatta 1860atgacaaatt gtattatgga ggtggtggag taatgggtgt acggtattat cgtttatttg 1920aaaatgactt ggtcgcctgg ttttcgacga agactggaag atacggagaa ttggttaata 1980gtgttgacca ttggtgatgc agcaatagag ttccaagtga gttattgatt aatcgatgct 2040atctattttg gcggtgaatt gacaggaatt tctttttttt ttaattacta catgcatatt 2100tctcgtgtga ttttcagatt ctcagttact agtttaggaa gaaaattcaa taaagagtca 2160tcttttctac tgcaaaatat gtatggagcc ggttcgaaat tagtatttct attactataa 2220atagaaaaaa tatgcaatta tcctccccta aatttccttt tttggattct ttatcccttg 2280aaacctttgc ctaggtcgac aactctaggt cgaagtggta ctacttcctc gcactagaga 2340attgaactcg gccccatctc ttcggcttct catttcaagt cttaataatt tatactcaat 2400aaaacaaaca actacatata aaatcaaact ttatataaaa taataagaac aattcattca 2460tttaatctcc ttcgtttttc tgacttgtta gtatatgata agtttctctt gccagaagat 2520aaatgtttca aatctttctt aagtacaagg tacgttatat aaatatcatt gaactggctt 2580ttttcgtata gctttcgtct tttaatatca gcaattaatt cggatagttg ggggagaccg 2640ttctccatat catcgagttt ctcaaagtta tctgcactta ttcttgatat attcagcgta 2700ttctgacttg ttgaagctgt tgtattatga cttgttgagg ctgttgtatt gtcaattgct 2760aaagctgttg tattgtgatg tggaggtggc agtgaagtga gcagctcaat taaaataggt 2820tataaatctt tcaaaagatg catatttgtt aagaaaactt tggatatcat tttcagtatt 2880tctggattga ataaaatatg ctgcaagtct tttattatca ggtcatgaat agccttttgt 2940cgctgcttgt cttcaaaaac tacaatttgt tttaatttca gagccacatt ttggcaactt 3000ctgtaaattg gatccaacat tgaattgatt atttcaacta ttggagtttg ttgttgtatt 3060gaagtcctca attcttcaac caattttttg cttagccgac tattatggta gtagctattt 3120gaaaaatcat ggttatggtg ataaatccaa tcagcaaacc actgttcccc tttatgtttc 3180tgctgaacta tgatttttgc tggacagttt attttttatg gattcttttc tgtttctttt 3240ttttcacagc aaatacattg ttgatattgt tttcattcgc ggcttcactt tgattttgtt 3300gatggtttaa acttgtttga gtataggaat caccacggtt gcagtggtat tcctcgtatt 3360ccacagcagc gttcttgtga ccgtgagaaa ccttaggcta ctttatgtga tatgacacat 3420taattatgat caaatcatta acttaaactc atctcattga atacaaaacc tctataaaca

3480agtatatact ttgtaaaaac tcgtttgtgc ccttgatatt gaatcataaa tccaagttgg 3540ctggaaaatg tacatctcac taacaattta tctatctgta attgttgaag tggaaaacta 3600gtttagatca taccataact tcaagtaaat gcaaattaat agccctaagc ccctgtccaa 3660ttcaagttaa atgatccact caacagccct aataataaga tttcatggat aatgaacatg 3720ccactcgcta ttcaatcctc aaaataaaaa cccactttag catcaagcaa tttgagcaat 3780aacatccgac agaaattgtc aaatagaagt acaccatttt tgaattatta taactcacca 3840aattgcaatt ccaaaagttt gacacctact ggtcaaacaa aaatcaataa ctcatctata 3900ttagttagtt agtaagcaca gttttttaaa aacaagggta ttaatcatac atatcatgac 3960ttaaagtatc tgtaatccca gtagcagtaa ctatttgatt gatttatgat ggaaactgat 4020ggattgatga acgaatggtg aaagaagaag gagaaagaag tggtggtgag aggaaaataa 4080ttgaggtcac gccagcctgg catttatcat tatgaagaag aaaaaggaca gagcaaggga 4140tgaaagatat tttggaggta agcaaaatgt aaacaaaaaa atgtaaacaa aaggagtaca 4200acatgcagaa ttcttatgct caaatatgca tgttatcgcc attggcaatt ttctgtcaat 4260tcaccgccaa aatagatagc atctgattaa tcaagaggaa cgattttgtt tatgtttgat 4320ttttactttg atgagaggtc aggcagttat ttgatgccat gtatacttgg caacttcttg 4380caggttatca ttttatggat attaatggtt tatatgtaat tcattttcac gtcgtttaaa 4440agtagagctt ttagagggtt ttctactgtg ttgtattttg tgagaattgt atactcaaag 4500aatccacaat tccatgactt gttggataat ttgtaaaaat atataaatgt atgtattgag 4560acattgttac tatgtggtgg agggtcatcc atttgttggt tggaaaactg tttttcagtt 4620aggtctttct ttggttttgt ttgtcggtag tccgtcattc ttgggttaat gatgacaaga 4680cttttcccta gatgttcttc tctgagagtt tgaaatgggt ggattcggtt gggctggcta 4740agtttggagt ggattattta gaaacgagag ttttgtttat ttggtagggt gcatgagggt 4800cgcc 480453833DNACandida dubliniensis 5atggcctctc ccttacaaaa tttgccccag ctgatactat tgagtcacac atcacactcg 60tttgctaaac cgaccatttg aatcctagct tctcgtgtac aagtattcat caaacatatc 120tttgcttctt ttcacttcgt ctcaaaaaag atacaccttt gaaacactcc cgaagcttca 180gctattacct caatcacccc tcatctccct acctctttat tcgcataata tctgttttat 240tacctctcta tcccagcaat accatagtat ttcttgcacc ctattttaac tactcgcaga 300caaccgagtt tacatcaata tgctaaacat tcctctgcca cacctcacac cacaaacttc 360atgtcttcca tagtcatgcc tctaaactat cccagcgatg acaacaacat cttgccatca 420acaattgctc caaagaaaaa cgatactatg tagtatcgcg aaaacaaaaa acacgatgaa 480gcactcttgt agaatcagcc gtcactacgt taccacgcta acccattcca atcaagtgaa 540cattaaacta actatactgt ggatgaaata atgtattttg caccaccatt tcccattcct 600cacacataca aactgatttg cactaagtga atattgcaac cttccaaaaa tttgttactt 660acaatcttct gatttctccc tgaagtcctc ctcaagctga ctcaactctg tttaggtact 720tcgaacctat acaatatgta aataacagta cagagaaacg tgtctatcta aaagttcttg 780cgtaaattaa aacaaattca ttttgactat tgtcagtgcc agcaacaaca tattgtaaaa 840atcataagtt aatcacgagt taccatacta tttagttgac aagttccttt attccgagaa 900cattgctgac ataaagaaat gcctatagca tccgttttca taccgcaacg acacctcgaa 960ttttactcat ttgttatagc atattctctt ttgcactatc aatcaatttt caaccgatac 1020ctcaaaatac tgctaataac agattgaaga caatttgatc acaccatcat tttgtcccga 1080gaatttgaaa aagaatataa ttatcaactt accaattcta gtcctgtcat ttcaaagtac 1140caaacaaaga atagcagcac aaagaataag cataaatttg acattgtctc acaaggcaat 1200tgcaccaaaa atcaaataac gaactgcaag agtactccca tatcaaatct gtaaccgaat 1260catcaggatt tattagaact acccgatgca attacactaa caaatagaat tctttcctga 1320ctcaaaactt atacactacg aagctgtgag acttctcaca gaatctcaaa ttttagtact 1380tttctccaaa agtttttaca caatagaaac aaaatatact caatttatca aaaaatagct 1440tatataaact tttttctaat tcaatttttt ccatttacca tgacacaatc tatattgtct 1500ctattcaaga aaccacactt aaatacaaac atcatcatgt atcttctgcg tagaatagac 1560gcattcatgt tgaacataac atgagctcca gtaccaacga aaacgacttc ctcattatct 1620taacaacatt ttaccttaac agttaaaaac ttaaacaaaa taaatatcaa actaatgcat 1680ggtacaaact cctgtattaa acatggtttc tcgactacat tggcagtttt caaatgcaga 1740agtgtaaagg gagtcgtaag cttcttgagt aatcatttgg acaaacaaag ccaccgctaa 1800tatcacgtct acacatatga cagggagctt ctaacaagca cactctcccg agccatacta 1860ggggccatta gataaacgta tacacacagt gcatttactt aagcaacggt taaatctcat 1920ttcaagaaga tatgcttggg taggtcagat acattttctg acagagtaga tttcaattct 1980tcccaggatc cgatcgacat aaattcgatt tctcagtgtt tgattgcaat ccattatcca 2040agaacttatt ttattgacta acccttttct ctcaggaata tgtgcgttaa catatataga 2100ttgccctgat tattgacttt aataacttga acaagaatgc cttacttatc atttgatgat 2160attatactgc aatcattagt cctaaaccca tgaaagtttt attgaaaata gagcttgtcc 2220ctgcaatctg gttaagtctt ctatttatag agtcgtgata actctgaggc tattataatg 2280tgttacataa ttttgatcca atttaatgat tctacttggg actaattgga ataaagattg 2340tttggtgaat ctggaatagc atttcacttc aagtaaatta gagaatattt ggaatagttc 2400tctggtagtc ttaataattg tagacaagca atctgagaac attaaatggt agtagcagaa 2460ctaactaact tttgaagaaa atcacgttcc cgagctgctc tttggatgta aggcgaaagc 2520caggttacgt acatggtatc cacattctaa atggaaaatg agtgactaca aggaaattca 2580attcataaga tcattcgcag atactattac gatattggtt tctgtattga cgagctgaca 2640acgcgtggaa agtttttcat catgctggct tgtaggtgtc gttgaatctg caaatctaaa 2700cgtgtggaac agcaggaaat acaaaattgg ttttagttgc attgtatatt ttaatatgaa 2760ttgtatggtg atcccgttta gagtagtacg aaagtttttg aagacctgtt atgtgttcat 2820ccagttgtct ataggctcac ttttgttctc atgttggatg gtggtctctc aagtcgctca 2880ttaaaggcat atatgtatga taattggttc cacaaggcag ctgaaacact taacaaaaca 2940ccttctttac acaagtgagt tacttacgta aggtaggagt ttgtagtaat ctagtttgta 3000tagcttttgg tgtatttgca tagatctcga ggagaggctt ctcactagaa catgttgtca 3060gtggagcaat ctgttaggtg tttaaatttt ttgcagtgga gtaagttctt attactatct 3120ttacggtgag gttgtataaa tcacctttcg gcttagcaga acctaatcgc catgcttgtc 3180cttaatatat gtgttgatgt ggtattacgt gtgcatatca gtgtaaggat agatatttgc 3240gtgtagttta gaaggtgtaa gaggtcacat tttgcataat atcaagttgt gtttagtgtt 3300tgggatgatt ttgttggagg tagaagcata tttgaagagt gcagtattaa gcttagattt 3360aaaatttgtg tttatgaggc ggatttgagt ttcatagatt ccaagggccc gttggattgt 3420tgtaataatt ggttgtgggt tttatttgta tctcgttaat tgggcgtgaa gaatatggtt 3480ttgagctgct ctatggatga atcagtagga ggtgtttggg cgataactga tttatttggt 3540tgtagatgga aaaggcaatt ataattatcg gtatgtcgtt ttctttggag caattgttga 3600tggtaagatg ttgttgtcat cgctgggata gtttagaggc atgactgtgg aagacatgaa 3660gattgtggtg tgaggtgtgg cagaggaatg tttagcatat tgatgtaaac tcgtttgtca 3720gcgagtagtt aaaatagggt gcaagaaata ctatggtatt gctgggatag agaggtaata 3780aaacagatat tatgcaaata aaaagaggta gggagatgag gggtgattga ggt 383363649DNACandida dubliniensis 6agaagcagcg acccaacaga taataatgta agtaatcctt ttcaatcaaa tacaaataac 60caccgaaaca attgtcagca aatagaattt taaaaaaatg aatctcaaat actgacaata 120acctctccct ctcaaatact accaactccg tactcttcaa ttgcactgta actattacat 180caaaacaacc aaatcacagc atcaaactct tgatatattg actctaccca atttcgctca 240aatgacagac caagctatat tgttgcagcc attcatatca acattatttt taaccagctg 300tgtctctcac ctctctaatc tcattccact aaaccgacta gctgcaaaac tcacctcgtc 360cacaaaaaac ccatatcttc cctaccttag caaatcatcc cagaagtgat cacctctttc 420tccagaaata gactggttga caatacgaca taaagtcaaa aaactgaaca aatcatcata 480cttgtttata atatcaacta cgttccctaa caaattactt ttaaaacatc cattcaatgc 540gaaggcaaag ttagtattgt cagtaataat tattccacaa gtacagcgct aagctgagcc 600atgtgttagc ttcgaaattg atacaaaatt tactaaaact acaaaagcca acaaccgtaa 660caaaatcagc taagttatgt ctaaaattac cgtgatatgt tcctctttta aaaatatcgg 720aatattacat ttctgaaaag tttaaaaatt caaaaagaag ggcttcacct aatactttca 780agtacatgtg atagatctca ttacaaaata aaagactcat tcctttcaat caagccaatg 840accatcttat acttcaacaa accactctac gctctattct aaaaatatgt cttgcaagta 900ccccgagtac tctaaaccag tagaaacgtt ttttgaagtt acactgtaac cacttcgaca 960cctcgatcca ctagaaattt aatttccaag ttagagtgtc cattccccaa acttcatacg 1020gaccacgtag atcctagaca ttagtttaca aaaattgctg gcagatatca tctcaaacca 1080tataaaccta cccgtttact atagacacta taacattctc tctatatctg tgcatttctc 1140aagtccttcc agcattccca gaacctcata tatcaaaaat atacaacaca tcgttggcaa 1200aagtaccaac tacctattca attagctcag tctttcttaa ctacgacact agatggcact 1260agtcaaacac atgcttcaaa ttcaaataac tgcaatatct acaattcttc taaaaatgaa 1320cgagcatgtt accattgatg gtcactttaa agtgcttttc attacaatac acaactttca 1380agacaggcat aaaatacggg ggtccttttt gcaaatgcct gaacatatat ctatcctcct 1440acaccacctt ctaaccccct tgtacaaaca ttacttaatt tagaacacca tcatgccagc 1500aaccattcac caattcgccc tagatacgct tgtttcaaaa gctgcccttc cgatcattta 1560ctacattcaa caaccccaca agggacaaat aacagcaact gaattttttt gctgcagttc 1620atagtaaccc cggttaattg atcttgtagc aaaactacac aatgattctt tccaaatcgg 1680gctcataaca agctcttcac tatcagtcag ttctttaaaa gtaagtattc gcaggcataa 1740tactagctct catcattaat tctgaagcca tagcattagt tcttttcaac accgcgttat 1800gaaatgctcc aatctttaaa tcctttttac caactgtcca cctactccaa ccactagcac 1860taactgcaat cttcggatgt gttggatttt taaatactat agaaacaaat tttagagagt 1920aaggtcaagt cacagattgg aataacatca attctccaaa attttttaag atacaatgac 1980aaacagaacg taaaactagc attgaaacca ataacaagga aagagtatat aaaacatgtt 2040tagcgatgca tactagagat aatatataga cttgttgatt tcataagtca ctgaatctat 2100ctttcattat tatttttcta gtgtaaatag tttctttact attgaggata gtcaaatgat 2160aaatgctttg catgagagat tggatttgaa catatattac aaaagatgtt cctcttctgt 2220tacctttttg acagatattt aaagcctttc gatgatagtt aaataaaaga ctactgattt 2280ctttttccca ttgcttaatt tatatcaatt tttcgaagtt gattatcgca accaggatcc 2340tgtgatgtct tgagacttct actacatgta tttatgattg ttgattttaa agtagtgaag 2400gcatatgctg tttgtgtgtc ggagtgctca gtgaattaag tttctttagg ttattggtca 2460ttccaaaaga ttgactagtt tgtgtacttg atggtgtttc tcattgtaat tgaattcctg 2520catttttcta ttttatggag atattatgtt tgggatttag aatacgcatg gtaacactag 2580agtgtgacat ttgaaagagc acaggtgatt attgagattt caaagggtgt cgagcatgat 2640gtaacaggaa tcagattatg actgtattat tatttagtaa tggtcgtttt gaagggtgtg 2700gttgattggg gagacacttt tggtgactat gaaagcacaa tagttgttgc gagttgtctt 2760taggtgtaca ttactcggct ttggattatt ggagatatag gtaatctttt taattgaagg 2820tgctagaagt ctgaatgttt cattatgctt tgagaagtga tcatcatttg attcgcttta 2880gtctgacttc tggtgtatgc tgaacttgca ttgatttgaa tttgttactc tgtagtttat 2940gggcaaaatg ttagtttgag aggcaggtca gaaactggat tgagcaagga ggatttaagg 3000acaaagttga taaaattaga ataggcataa ccgtaaaatg aaggttatat aaacatacat 3060tgtttatgtg gttggtgaga gtgtcttgat tagtttagtc gactcggtcc tgattcgagc 3120aggaatgaga tctataatgc taagctggct ttagcggttc ccttgctttg aaggcagaaa 3180atgagccaag tttggttaga tgaatgtagg cacactttca agtatttgca tttttgaagt 3240ttatgtgagc acggtgtttt caaaagtggc atgatttgtt ggcttatcca acgaagatga 3300gatatcaaag gaacataatt gtatatcatt cagaagataa aagaaataag tgacgtttaa 3360atgatttaaa taaattggag aggaagaatt tgatattcac taaggtaagc gagatagaat 3420tggaaagatg acgagagcat gtactcaact acgtgtcgta cgactctagc taatcatgat 3480aaggaagtat taaaaagcta tgatcatgtc aagattgcaa atctaagcaa agtagcataa 3540agccagtctg tctcatctgt gattttaagg gtaaatttca ttggcagtaa tgatctgcca 3600tacctaatga atttgtcatc atttggttcc tcgcatttca atcaagatt 364972992DNACandida dubliniensis 7cccagaagta tccactaggg aacttgcatc ataaccccat tccccagcct cccaacaaag 60aatatcacca tcattaaatt caatagtaga agcagtcaac agctaatttg attccgaaaa 120actcaggttg ctgtaccatt gaccagaaca attgcgaact gtcttgcaac ctctcaagca 180atcaaaactg acacaactga aagcacaata agcatttttc agtcctaaca caacatcctt 240acagaacgaa ttgattgtaa gtctggtaac acttttaata atatctagac aacaacaaat 300ctagttttac taaccttggc tacaactcta tgcataacac actcctcagt aataaaaatt 360actctatatc atctgtacat gtgagcctac atcaaatcga atattggatg ataaaaacac 420aaaccttctt ttcagaaaaa cagccaccac caaactcttt gaaagcagat aaaaacgaaa 480taaacaaaaa atcaagctgc tatacaagta aggcgtagac ggcattactt tcatgatccc 540taacaagctc catcctaaag ctatgatgtg tcaagatctc caaatgtaag caaatcactc 600ttagcgtgca tttaacaaag ccattcacaa tccaacttcc tctctagtct atatacaccc 660aattgtacaa caagttgtag tcacaagcct aagctatatt aactcattca tgatattatt 720cctgccaaga gtggactcca ctattaacgt atagggtgac cccattcaac agcttctagc 780aaaactatgc acttcagtct ttacttaatt ggacttccat cttgatacat tgcttctctc 840ttgcctctgc gaaacacatg tttatcaaaa ttggaacttg gctaaaccaa cctcatcata 900tattaataac ctcaaacaat gaaactgatt ccacccgaaa tattacatac tgcacaacag 960caaccaaatt atcatgcacc actatctaca aaaacatttg ttcacctcaa taaacccatt 1020gattctgaat gactaatcat tgcgtattaa taacaacacc ttgaatatat tagcgtccta 1080tgatttaagt aggcgctaca tatgaacttc gtgccaggcc tattctaatg ctattacctg 1140tatatatttc catactgcaa atactgactt ggagtatacc tttcatcatg tacagtgaac 1200tctctcaaac atccgtatat gatttaatta atccaagaac cccgaatgac attcagacat 1260tatctccaac taaaatatac cgggattcct aaagaatttt tttcctgaaa tacactagaa 1320ttccccgtta gctagtacaa ttcttcaaaa aaaaattcta ttccacatga actttgccag 1380ataccatcta actcttaaac attcctcccc atctcatatg catgaccacc aaccagttcc 1440actgcttcca atagcgaggg cggggagagg gcaaagccca agattacatt agatttttta 1500tgtagatctt aatattctag catgtctcag cattacaaat tcattggaac tgcaaatcac 1560ctgttcacaa accgatacgt taaagtaatc gataatatat ccttatacta cttttttttc 1620cagtctattt caaagcacag taggcatcca agtgctatat cacaacctct gcttaataga 1680ctgtgcacga tatattgtgg agctagctgg agaggtgagg ctagcagtat gtgactttgt 1740ttctatttta ctttcatagg gaaatcaata cgtactaaaa tttacctttg ctaccatgtc 1800taatatctgg tgagcaggaa gtaatcggct tcatatatta aattgtaaga cgattatgca 1860tacgatgctc ccatagtttt ttattgcatt gatattcctt gtaaataatg gtgtcacaat 1920tgtccaaata aataaaaaga gaacaatagt ttcagtacat ttgctgtctc ttcaaaacaa 1980tgtataatgt ctctgctttg ctaaattgaa aaactggtaa tggaccaaca gttatgagct 2040gctatttaaa attgcaaata ttcaatcaaa atgcttgcgg aatagaacgg tgactctgaa 2100atttttgtta ttggtttcaa ctatctctta gctaatatca ggagaagttg agttaattct 2160ttagaatagc attgatgagg tggcatccaa gcgataggtt attctaggtt ctattaagat 2220tggttagttt tgaagtatat gatgtcactg tctttaatct acagttcttc cagtttgtgc 2280cttatgttca cgaaaaggaa gagattctta ggtagagtga taaataattg gtactataga 2340atataaacac tactttagga gattgagatt tcttattgta tgtgagaaac tttcttagca 2400gaatcaaagt atggttgtat acgtaatatg atttcaaatt cagagaaaat aatgtgggta 2460tgctcgtgaa catttataat tgtaggcttg cacaggaatc ataggaattg tggttgtatt 2520gatttagaac agttatgatt acttttatga tagctggtgg ttttaggaga taaaatacgt 2580agggtatttt ttggtcttgt gtggtgtcga aggtattgaa aacttgtatg gtaggaattt 2640atatatgagg tgttgcaatt ggtggatgtt gtgtgtgagg cgtaaaatta aagataaaca 2700gtagtatgag atattgcaag attggtgctc gattgtcagg gttgatgtga tggcactgat 2760tacaattatt tgatagccta atttcacctg atggtactac agatcgatat aagttttggt 2820taattttatg ttgtttttgt atgaaacgtt tagcaaatgg ccctttaaat ggtagagcat 2880gggctaagtt cttttgtggt aaaatgtgtt tttgaaattg gatgtacatt atttgttaga 2940catgatcata cagaatcatt tacaagcatt gctggttcaa agtcagttaa ta 299284816DNACandida dubliniensis 8atgctaccaa aacatgagaa ccacagcagg tctggtgttt attccacagt gacttgggtg 60tccacagtat gtcttccgca acaacagaat cttttcgctg ccacagacgg aggcaccatc 120accacaagcg ttatgccaga gcagcacaag gagtcattgc cacgcattga ccagcaacaa 180gtaagcgtcg ggaacaacct ccaaaccaac ccgcaacttc aacaaaagtg aaactaagct 240tgctgtatct cttctaaccg agtcagtcaa ccaacgaaat tgaacctatc aaagcacttg 300cagcacacat tataaactgc aggattcttg gtcatatgtc ttgggatctc tagagatctg 360gtttgcaaac gtaactaact tcaaaatgat ctaatcaaat cgctgacatc ctgaatgtca 420aagcacaaaa acaacactat tttaattcaa atagtttgca actacttcta atgttgcata 480cacaaacaac accgaaaaga cccatccgct cctgacaaat cttcaaattg acctaccaat 540tcttcgctcg aacaaaagat tgggaaatgc atcaatcctt gaatcaaacc agagagtgag 600atcctgtatt tctatttaca tttccatcta ttctcaaaac acgaaagcgt tatctgcgta 660attgcaatca ttctaattag gttatggaat atagaaaatc catttccaaa aagatagtct 720tttataaaca agaaactcct gaatattcaa ctataactca ataccaccga tagcatataa 780atctgacaat acagcatagc aatgaatctc tacaacacta atgtacgact atttcccaca 840ttctattctg catagtccat gactgaaaca taacaagccc accatcaatt gggacgacca 900ccaattccat ttcaatacac acaaaccgtg tttctaacca gatatctcgt ctcctataaa 960catggacttc tcttcaccct taaccaaaca aagcgaagaa agtacattaa cacttgtact 1020gctaagttca agcatagcct ctgctcttac caatacaagt tctaccaact tagattaata 1080ccagaagcgt atctgtaacc tcatttagaa taatatttcc ttatactcat tcttaacttt 1140tccaaacttt cacaaaccaa gtctaaacaa tcaatctgac caccactacc aacagtttcc 1200acacaactca gcaagacacg tattgtcaat atcatactta tatcctctgt tacttcacaa 1260tcatccaaaa agctctatca aacaatagcc acctccccta taattacaac tcaaggtcat 1320acacctttag aaacctaatt caaatagcta ttggtatcaa cagaccgaat gcaacactta 1380gtctccaatt tcactacgga ttctcagaat ccatgcctaa tcgaatatct attctgggtg 1440caccaaacac cctttgtcta ctaacagaac ttgttttagt ctctgaatag ggagttacag 1500ttctaaatca acaactaaca cttgctgtat actcgatcta catgaagata ctcttgtgcc 1560aattctgctt aataacactc tctaaaagac gaaccttagg aaaattccca agtagacata 1620acacagttac agaactaact caacgaaact ctatacatca cagccagtaa tgtgactcag 1680tgatcaataa aattcactta cttgcaaaca aaccaatggc ttcctgagtc aaatcaccat 1740ctgagatgca aagcgtaatt ttggaaatag ctctcttttg cccatgtggc aataaatatt 1800acgctacggc tgcaatccat cgtccctaca gtacacaccc aaagtaaagc cattgcacta 1860cacaattcta gatgatatgc aaaacggatc caaataatat aaattctaca ctattctaat 1920aaacataatc caaaagagtt ctcgttaaaa tgcatttagc ggtagtacaa gatgcagtaa 1980ctacaataaa tttgtcattg gttctctcaa cgatcgctat tctaatgaga atatgattca 2040tagccagaaa gggtttgcag agacaacttt tcctaccact caatcccaat ttctctctag 2100aagctactct ttgatttttg ggtcaatcac agtacttaca ttcacaaagg caatggaaca 2160tgttccttta gatcggtccg cattcaacca attggagctt tgactgatta cagaaccggt 2220cgattgtggt ggatatttgg gttgcaatgt gctctttcta agaatcatcc taattgctct 2280atcctcgtag tatactcgga tggttcaatg tacaatgaaa gcacgtcgga ttttgacaac 2340tttaggatca accagtagaa tgtaagttca atgttgcacg aatgaacggt ttgctgtttt 2400agatagacct gttagggtac tgtacattta cattgtaaaa gacaatcaaa aggctacgat 2460gacaagatcg tgtaggcaac ctgctctttt gaaatgcgtt ttgtaataac tactactagc 2520ttatactgtt gatacaactg tttagcatac actagtaatt gaagttttcg gacacctata 2580taattatata tttgatgatc tgcatccacg atttgtttgc actatacaat tggtgctatt 2640ttgtatcaat tcaaccacta attagtaaga tataacaaac gaattggctg ccaaatttac 2700aaatctctga ttttttggtt tcccgtacct gcagctatag ctattgaagc ttcagttttc 2760atcttcttaa gagctggttc tacataaatt agcttaaagg ttgacaaaaa tagattatgg 2820ttatatggtt aaaggttgac aaaaatagat tatggttata tggttaccaa ctatgacgtt 2880taggcgttat tctttctggt ggtttataat agaaggtaag tcgattatga gcgaaattaa 2940tatgtgtaga gtatctgcca gttttatact taacagttag tggcttatgt tgatgctagt 3000caactaatgc ctactttgta taccttcatc aatatataga tgtttagatt aatcaatttt

3060gtttgacatt gtggaaagtt aatcgcgggt atataagaat ttgatagtgt gatgtttttg 3120acaggcttat caaatgagag cgagttttgt attttattaa atcgccaggt ttttagcaat 3180gtttctgtaa aacgactttt cttattggca aggcgtgtgg taggctatta tatgttatct 3240gaacatagca tagctaaagt ggttgttgcc atacatgaaa taaggttatt tgcaataagc 3300tggaattttt gttcgaatta gaactggtac tggtataatg agatgacaat agtcatggaa 3360aaatcagatt gctggtttgg ttggtagatt tgtttagtta tacggttact gaagttgtaa 3420gaattagtag tttctaaaag gcaagagtat cggtagaaaa ttatggtgat agtactatag 3480tcttatatta ggctttaatt ttcagatata tgagaaagat gtttggtctg ataattccta 3540tgtacattta ttaatctatt ctacaggaag gggtcaattt ttctctttgg gttgagattc 3600ttattctaaa ggcgcaaaat tttagaaggg ttatcacttt gcattttggc tgggactcca 3660ggaatgcatt ggaacaatct gagtaagctg ccttttgtat gtggaaatga attgcgttgg 3720gtaaagataa ttttaatgca gtttttcttg aataacggta cagagtgttt gaataaattt 3780ttagtagttt gcagattcac gtagtgtgct tgccccacag cggcctcgtt tagttgctgt 3840ttggcttggg ttgttgtttt ctgctttaaa ttatgtaatg taattggtat gggactggtg 3900gtgagacccc aaaatgaaag tgattaatag actatgctag ttcgtattcc caaaatatat 3960gcatgaagag ttccagtttt ggacattttg caatgggtga atttatatag cagtcttaac 4020agacctccaa tgaatattgg gttaagatat tagttgtatt agtaaatctt gtgaggaaat 4080agtgattaag ttttagtatt tggcagttat tctatttgcg agtgctacgt agctcattct 4140ttgatttgtt ggtgggtatt gatctggatg ttgtgggtgg ctggtggtgc ttcaatgcga 4200ggaatggtaa ggctttgtta attttgaaga ttgagttatt taatgtgctt gcacgtcttt 4260taaattaatt ggattagatt gggaaagaag ttctttgtta atagtccttg atattttagt 4320tgtaatggta tattgattaa cttccttaac ttttggaatt gtgaagaagt taaagcgttt 4380ttctcgttgg taaatgagtc attgttggat tgatatggtc caggttttta aggtgcgtaa 4440gttatcggga tttcctcagt caaaatatgc ttgtgttttt atatccggat tctgagacat 4500gcttcagtgt atagatgtac aacgtaaaag tgggagttca ctgagcatga catgttgcag 4560gaatggtaaa cccttgttaa ttaaccgttg gtgttgaagt tgccggttgg tttggaggtt 4620gttcccgacg cttacttgtt gatggtcaat gcgtggcaat gactccttgt gctgctctgg 4680cataacgctt gtggtgatgg tgccaacgtc tgtggcagcg aaaagattct gttgttgcgg 4740aagacatact gtggacaccc aagtcactgt ggaataaaca ccagacctgc tgtggttctc 4800atgttttggt agcagg 4816924DNACandida dubliniensis 9aagccctttg gatgttgact acgc 241020DNACandida dubliniensis 10ccatcgacag ggcccatgtg 201120DNACandida dubliniensis 11tatgattata ccccaatcca 201220DNACandida dubliniensis 12aggatcagtt accaatgttg 201328DNACandida dubliniensis 13caacaatcaa caatttctgc tcctcatg 281428DNACandida dubliniensis 14aagtgggtat caccttattc gcaaatga 281525DNACandida dubliniensis 15cctttttaaa cgtgacacgc tcaaa 251624DNACandida dubliniensis 16ggaaaagttg cgtgaggaaa tgga 241724DNACandida dubliniensis 17cgggtgcatc taagaagggt ttta 241828DNACandida dubliniensis 18caatataacc ttgcacccgt caaatacg 281928DNACandida dubliniensis 19gttgcagtgc attgtacgag gtaagctc 282027DNACandida dubliniensis 20tgcaactgat ccgagacaac ttcaaac 272125DNACandida dubliniensis 21gatcgcaagc gaagcacgaa atgac 252225DNACandida dubliniensis 22caatgtctgt tcgaccacca ttccc 252325DNACandida dubliniensis 23agagcgagca cctggtattc ccaag 252424DNACandida dubliniensis 24cacccaaagc ccagcttaaa ttcc 242528DNACandida dubliniensis 25tttcaattta gctgactcct taccctgg 282626DNACandida dubliniensis 26ttttcggtga ttttgccaag aagttc 262725DNACandida dubliniensis 27cagcattcat ccgggtaaag tgttg 252825DNACandida dubliniensis 28caacggatcc aaggtcacca catag 252920DNACandida dubliniensis 29cgcggtccaa gaagataatc 203020DNACandida dubliniensis 30catcatggga tgtaattgct 203120DNACandida dubliniensis 31agtgtaagtc ttcgggatac 203220DNACandida dubliniensis 32gtgagcgaat agaataattg 203325DNACandida dubliniensis 33agctacatct attttcaatg cactc 253420DNACandida dubliniensis 34aattgctctg aaacagccag 203525DNACandida dubliniensis 35tatacccccg aattaacaag tgcgc 253625DNACandida dubliniensis 36cagtgcaggt gctttcgttt accag 253728DNACandida dubliniensis 37catcagttca attgatgggg ttgttctg 283829DNACandida dubliniensis 38aaactggcat agctttttgc attattgcc 293924DNACandida dubliniensis 39atttcgagag gacttggttc gtgc 244024DNACandida dubliniensis 40ccgtacccaa ataaaactcc cagc 244120DNACandida dubliniensis 41tacaaagcgg gtgataagga 204218DNACandida dubliniensis 42ggcgcaaaag gaaatagc 184328DNACandida dubliniensis 43acactgtctt gtcttgtgtc tgaagtcg 284425DNACandida dubliniensis 44ttctctgtgt gtgggccctc agtac 254527DNACandida dubliniensis 45tcatccatca tatcacaaat cctactg 274625DNACandida dubliniensis 46gttattttga aagttgggga gaggg 254728DNACandida dubliniensis 47cctacgacat gaacacatca aactactc 284825DNACandida dubliniensis 48tgcttttgtt gaaaacttgc gaaac 254928DNACandida dubliniensis 49aggctagtcg gtggttaacg gttgtgtg 285028DNACandida dubliniensis 50gactcggaat aaacaccatc gccgatgc 285128DNACandida dubliniensis 51ggtccaatta gaatcgggtc gttccatg 285225DNACandida dubliniensis 52cgtcatccct tctatctcta acgtg 255324DNACandida dubliniensis 53atcatatcat gcagcccaac tccg 245424DNACandida dubliniensis 54cggacgtagt gaaacgattg ttgg 245527DNACandida dubliniensis 55acaattccca gtaaaccatt ataaaag 275625DNACandida dubliniensis 56cattcataat ctgatttgta ggctc 255721DNACandida dubliniensis 57tgctaaacga ccccctcaaa a 215823DNACandida dubliniensis 58gtacgacgat catcagcaac caa 235928DNACandida dubliniensis 59aattaattcg gatagttggg ggagaccg 286025DNACandida dubliniensis 60attgagctgc tcacttcact gccac 256122DNACandida dubliniensis 61gcagcgttct tgtgaccgtg ag 226222DNACandida dubliniensis 62ttgaattgga caggggctta gg 226330DNACandida dubliniensis 63tgtggtggag ggtcatccat ttgttggttg 306429DNACandida dubliniensis 64ggcgaccctc atgcacccta ccaaataaa 296518DNACandida dubliniensis 65aagtacggat ggttgtta 186622DNACandida dubliniensis 66tagtcattct gccatctctt at 226728DNACandida dubliniensis 67ccatgaacaa aaggttaggt ggtgctcc 286825DNACandida dubliniensis 68ggggagttga atggtgtggt gttac 256924DNACandida dubliniensis 69tccagcgtca gacatttttc cagt 247018DNACandida dubliniensis 70tgccccgcgg ttgacagt 187126DNACandida dubliniensis 71tggcctctcc cttacaaaat ttgccc 267228DNACandida dubliniensis 72gggagatgag gggtgattga ggtaatag 287326DNACandida dubliniensis 73gctccagtac caacgaaaac gacttc 267425DNACandida dubliniensis 74gcatttgaaa actgccaatg tagtc 257527DNACandida dubliniensis 75gctgggatag tttagaggca gactgtg 277625DNACandida dubliniensis 76cctcaatcac ccctcatctc cctac 257724DNACandida dubliniensis 77aagggcaagg aacaagtcac aagt 247821DNACandida dubliniensis 78tatcagcgcc ggttttagca c 217919DNACandida dubliniensis 79gtgccaactt tctcctgat 198022DNACandida dubliniensis 80agcgattatt aagtctatgt gg 228122DNACandida dubliniensis 81gaagcagcga cccaacagat aa 228222DNACandida dubliniensis 82ttgagcgaaa ttgggtagag tc 228330DNACandida dubliniensis 83tgtccattcc ccaaacttca tacggaccac 308425DNACandida dubliniensis 84gaatgctgga aggacttgag aaatg 258524DNACandida dubliniensis 85gaaaccaata acaaggaaag agta 248623DNACandida dubliniensis 86caatgggaaa aagaaatcag tag 238728DNACandida dubliniensis 87gacgagagca tgtactcaac tacgtgtc 288825DNACandida dubliniensis 88gaatcttgat tgaaatgcga ggaac 258930DNACandida dubliniensis 89catccaataa cattgattta ctacttttag 309025DNACandida dubliniensis 90tttttttttc tcaaagattt agcag 259121DNACandida dubliniensis 91tgtacgatca acccagagtg c 219223DNACandida dubliniensis 92acatgccatt accaacaaca gtc 239329DNACandida dubliniensis 93tagctgtatt aaaaaattct ggccgcata 299425DNACandida dubliniensis 94tctgacaaaa aacctcgtat gaccc 259526DNACandida dubliniensis 95ctagagctat gttgtgacag tccacc 269625DNACandida dubliniensis 96cttctggaat tgagccaatc cctag 259728DNACandida dubliniensis 97ctagctattc aagcatccgt aggcagtc 289825DNACandida dubliniensis 98cccatacccg ggtggtgtag tataa 259926DNACandida dubliniensis 99gtaggcgcta catatgaact tcgtgc 2610025DNACandida dubliniensis 100agataatgtc tgaatgtcat tcggg 2510121DNACandida dubliniensis 101tccaatgggt gctaagatga a 2110218DNACandida dubliniensis 102tcccgcctga tttttgaa 1810328DNACandida dubliniensis 103ttatttgata gcctaatttc acctgatg 2810425DNACandida dubliniensis 104attaactgac tttgaaccag caatg 2510526DNACandida dubliniensis 105aacggtcacc tgatgaatag agtggc 2610625DNACandida dubliniensis 106gactgaagcg tccatacttg ggatc 2510726DNACandida dubliniensis 107cccagaagta tccactaggg aacttg 2610825DNACandida dubliniensis 108ttgttctggt caatggtaca gcaac 2510928DNACandida dubliniensis 109cacgcaacta gaatggcatg aatatatg 2811025DNACandida dubliniensis 110agatccggtg tctgtcttat tgctc 2511124DNACandida dubliniensis 111cctgcgttgt aatcatttgt tgtc 2411224DNACandida dubliniensis 112ttactccgcc tttgatccct attt 2411325DNACandida dubliniensis 113attaaggagc ttcgtgaggc tgtcg 2511425DNACandida dubliniensis 114catttccttc aaaggcaccg ggatg 2511525DNACandida dubliniensis 115acgttgctta ctggtggcta tgcgg 2511625DNACandida dubliniensis 116aagcttttat tgcggtgaac tgggg 2511728DNACandida dubliniensis 117acatataata gcctaccaca cgccttgc 2811825DNACandida dubliniensis 118tgacattgtg gaaagttaat cgcgg 2511928DNACandida dubliniensis 119tgaaattgga gactaagtgt tgcattcg 2812027DNACandida dubliniensis 120acagtttcca cacaactcag caagaca 2712125DNACandida dubliniensis 121tttgccggga taagctttta ttgcg 2512225DNACandida dubliniensis 122tttcaggaca ccagaagatg gccac 2512318DNACandida dubliniensis 123cccccgccgt gaaaaaca 1812423DNACandida dubliniensis 124ctacaaacgc cacacccgaa act 2312525DNACandida dubliniensis 125acctcaacat cgacacagtc gcacc 2512625DNACandida dubliniensis 126agcagaaacc tcgatgtttg agccg 25


Patent applications by Jawaharlal Nehru Centre For Advanced Scientific Research

Patent applications in class Involving bacterium, fungus, parasite or protozoan (e.g., detecting pathogen virulence factors, adhesions, toxins, etc.)

Patent applications in all subclasses Involving bacterium, fungus, parasite or protozoan (e.g., detecting pathogen virulence factors, adhesions, toxins, etc.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
People who visited this patent also read:
Patent application numberTitle
20120180931Thermoforming Web Accumulator and Method
20120180929ULTRASONIC WELDING SYSTEM AND METHOD FOR FORMING A WELD JOINT UTILIZING THE ULTRASONIC WELDING SYSTEM
20120180927METHOD FOR MANUFACTURING THE BODY OF BABY CARRIERS, CARRYCOTS AND THE LIKE
20120180926Composite Cord and Method of Making and Support Structure and Tire Containing Same
20120180924Flat-Running Device for an Automobile, Mounted Assembly Including Same and Related Mounting/Removal Method
Images included with this patent application:
POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and imagePOLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and image
POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and imagePOLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and image
POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and imagePOLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and image
POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and imagePOLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and image
POLYNUCLEOTIDE SEQUENCES OF CANDIDA DUBLINIENSIS AND PROBES FOR DETECTION diagram and image
Similar patent applications:
DateTitle
2009-07-09Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis
2009-02-05Novel polypeptide, polynucleotide encoding the polypeptide and use the polypeptide and polynucleotide
2008-11-06Polynucleotide encoding a novel trp channel family member, ltrpc3, and splice variants thereof
2009-06-11Ns5a nucleotide sequence variation as a marker for interferon response
2008-09-04Method of determining the nucleotide sequence of oligonucleotides and dna molecules
New patent applications in this class:
DateTitle
2022-05-05Assays for fungal infection
2019-05-16Methods for diagnosis of bacterial and viral infections
2019-05-16Using the full repertoire of genetic information from bacterial genomes and plasmids for improved genetic resistance tests
2019-05-16Compositions and methods for genomic integration of nucleic acids into exogenous landing pads
2018-01-25Labile linkers for biomarker detection
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Marshall Medoff
2Anthony P. Burgard
3Mark J. Burk
4Robin E. Osterhout
5Rangarajan Sampath
Website © 2025 Advameg, Inc.