TOLL-LIKE RECEPTOR 5 LIGANDS AND METHODS OF USE

Abstract

immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence GAVQNRFNSAIT, or a modification thereof, and having toll-like receptor 5 (TLR5) binding. Methods of inducing an immune response are also provided.

Description

[0001]This application is based on, and claims the benefit of, U.S. Provisional Application No. 60/285,477, filed Apr. 20, 2001, and which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0003]Cancer is the second leading cause of death in the United States, accounting for one in every four deaths. This year, it is expected that over 1500 Americans will die of cancer each day and that a million new cases of cancer will be diagnosed. The most common treatments for cancer are surgery, radiation and chemotherapy. According to the American Cancer Society, immunotherapy can be considered as the "fourth modality" in the treatment of cancer. Immunotherapy is treatment that stimulates one's own immune system to fight cancer.

[0004]Cancer is a group of diseases characterized by uncontrolled growth of abnormal cells of the body. All types of cancer involve the malfunction of genes that control cell growth and division. Some of these genes become incorrectly regulated, resulting in over- or under-production of a particular protein, while others become mutated, resulting in unusual or abnormal proteins that alter normal cellular functions. These abnormal proteins, referred to as "tumor cell antigens," should be recognized and destroyed by an individual's immune system as "foreign" antigens.

[0005]However, the immune system of a cancer patient may ignore these tumor antigens and be unresponsive to the growing tumor. Using immunotherapy approaches, such as cancer vaccines and immune system modulators, an individual's immune system can be induced to mount a potent immune response against tumor cell antigens, resulting in elimination of cancer cells. A cancer vaccine can contain a tumor cell antigen that stimulates the immune system to recognize and destroy cells which display that antigen. Treating an individual with such a cancer vaccine can result in a humoral response, which involves producing antibodies that recognize and target tumor cells for destruction and a cellular response, which involves producing cytotoxic T cells that recognize and destroy tumor cells directly, or both responses. It can be desirable to obtain both a humoral and cellular immunity response during immunotherapy because both arms of immune response have been positively correlated with beneficial clinical responses. To help stimulate either or both humoral and cellular immune responses, a cancer vaccine can be combined with an adjuvant, which is a substance that stimulates a general immune response.

[0006]The potency of cancer vaccines is greatly enhanced by the use of adjuvants. The selection of an adjuvant for use with a particular vaccine can have a beneficial effect on the clinical outcome of vaccination. Some vaccines are ineffective in the absence of an adjuvant. Effectiveness of a vaccine may be particularly troublesome when the vaccine is produced from self antigens such as those required for cancer vaccines or other non-infectious disease vaccines. In view of the beneficial effects of adjuvants in vaccine formulations, it is surprising that only one type of adjuvant, aluminum-salt based adjuvants, are currently in wide use in United States-licensed vaccines.

[0007]Thus, there exists a need for more and improved immunological adjuvants. The present invention satisfies this need and provides related advantages as well.

SUMMARY OF THE INVENTION

[0008]The invention provides an immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence GAVQNRFNSAIT, or a modification thereof, and having toll-like receptor 5 (TLR5) binding. Methods of inducing an immune response are also provided.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009]FIG. 1 shows NF-κB activation and TNFα production in cells expressing CD4-TLR4 or CD4-TLR5.

[0010]FIG. 2 shows selective induction of TLR5-stimulated activation of NF-κB by P. aeruginosa and L. monocytogenes cultures compared to LPS and lipopeptide.

[0011]FIG. 3 shows the purification of a TRL5-stimulating activity from L. monocytogenes culture supernatant.

[0012]FIG. 4 shows the identification by mass spectrometry of flagellin as a TLR5-stimulating activity.

[0013]FIG. 5 shows that flagellin expression in bacteria reconstitutes TLR5-stimulating activity.

[0014]FIG. 6 shows systemic induction of IL-6 in wild type mice treated with purified flagellin.

[0015]FIG. 7 shows a comparison of flagellin amino acid sequences from 22 species of bacteria and a consensus sequence of amino acid residues conserved across species.

DETAILED DESCRIPTION OF THE INVENTION

[0016]The invention is directed to flagellin derived peptides that exhibit immunomodulatory activity and to methods of inducing an immune response through activation of toll-like receptor 5 (TLR5). The identification of active flagellin peptides and their corresponding receptor, TLR5, expands the available treatment methods for inducing an immune response. Moreover, the identification of active flagellin peptides and their cognate receptor allows the identification of immunomodulatory compounds.

[0017]In one embodiment, the invention is directed to immunomodulatory flagellin peptides that bind to TLR5 and induce a TLR5-mediated activity. The peptides can be used, for example, to effectively stimulate an immune response or ameliorate a pathological condition by administration of immunomodulatory flagellin peptides and combinations of such peptides with antigens and other immunomodulatory molecules. Full length flagellin polypeptides are also used in the methods of the invention to stimulate an immune response. An advantage of the immunomodulatory flagellin peptides of the invention is that they provide the specificity of flagellin together with the availability of rapid and efficient methods for recombinant and chemical synthesis of peptides. The immunomodulatory flagellin peptides of the invention can therefore be combined with numerous well known modes of administration for the treatment of a wide variety of pathological conditions.

[0018]In another embodiment, the invention provides a method of inducing an immune response in an individual by administering a vaccine containing an immunomodulatory flagellin peptide of the invention and an antigen. An immunomodulatory flagellin peptide of the invention functions to stimulate an innate immune response. The innate immune response involves the production of immunomodulatory molecules that beneficially promote the adaptive immune response. The adaptive immune response includes both humoral and cell-mediated immune responses to antigen. Thus, a flagellin peptide functions to boost either or both humoral and cell-mediated immune responses against the antigen. A boost in an immune response causes a general increase in immune system activity that can result in the destruction of foreign or pathologically aberrant cells that otherwise could have escaped the immune response.

[0019]As used herein, the term "flagellin" is intended to mean a flagellin polypeptide contained in a variety of Gram-positive or Gram-negative bacterial species. The nucleotide and amino acid sequences of flagellin from 22 bacterial species are depicted in FIG. 7. The nucleotide sequences encoding the listed flagellin polypeptides are publicly available in the NCBI Genbank database. The flagellin sequences from these and other species are intended to be encompassed by the term flagellin as used herein. Therefore, the sequence differences between species is included within the meaning of the term.

[0020]As used herein, the term "peptide" is intended to mean two or more amino acids covalently bonded together. The term "flagellin peptide" is intended to mean a peptide or fragment encoded by a portion of the nucleotide sequence or having a portion of the amino acid sequence which exhibits substantially the same sequence identity to the flagellin sequences as described above and identified in FIG. 7 and binds to toll-like receptor 5 (TLR5). For example, a flagellin peptide amino acid sequence is about 65% or greater in sequence identity to a portion of the S. Typhimurium1 sequence, GAVQNRFNSAIT, identified as SEQ ID NO:2, encoded by the nucleic acid sequence identified as SEQ ID NO:1. Therefore, flagellin peptides having amino acid substitutions that do not substantially alter TLR5 binding are included within the definition of a flagellin peptide. For example, flagellin peptides which contain one or more alanine substitutions and have substantially the same TLR5 binding activity as the flagellin peptide identified as SEQ ID NO:2 are included within the definition of a flagellin peptide. Exemplary flagellin peptides containing alanine substitutions and having substantially the same TLR5 binding activity as the flagellin peptide identified as SEQ ID NO:2 include, for example, GAVANRFNSAIT (SEQ ID NO:3) and GAVQNAFNSAIT (SEQ ID NO:4). Flagellin peptides consisting of greater than twelve amino acids and having TLR5 binding activity can similarly contain amino acid substitutions, so long as such substituted peptides retain substantially the same TLR5 binding activity. Examples of such flagellin peptides containing substitutions of various amino acid residues with alanine include ADTRDLGAVQNRFNSAIT (SEQ ID NO:37), VDARDLGAVQNRFNSAIT (SEQ ID NO:38) and VDTADLGAVQNRFNSAIT (SEQ ID NO:39). A flagellin peptide of the invention does not include a full length flagellin polypeptide. A flagellin peptide is intended to include molecules which contain, in whole or in part, non-amide linkages between amino acids, amino acid analogs and mimetics. Similarly, a flagellin peptide also includes cyclic peptides and other conformationally constrained structures. A flagellin peptide of the invention includes polypeptides having several hundred or more amino acid residues and can contain a heterologous amino acid sequence.

[0021]The term flagellin peptide specifically excludes fragments of flagellin described in Newton et al. Science, 244:70-72 (1989); Kuwajima, G., J. Bacteriol. 170:3305-3309 (1988); McSorley et al., J. Immunol. 164:986-993 (2000); and Samatey et al. J. Struct. Biol. 132:106-111 (2000).

[0022]As used herein, term "immunomodulatory flagellin peptide," is intended to mean a peptide or fragment having a portion of the amino acid sequence which exhibits substantially the same sequence identity to the flagellin sequences as described above and shown in FIG. 7 and binds to toll-like receptor 5 (TLR5). For example, an immunomodulatory flagellin peptide amino acid sequence is about 65% or greater in sequence identity to a portion of the S. Typhimurium1 sequence, GAVQNRFNSAIT, identified as SEQ ID NO:2, encoded by the nucleic acid sequence identified as SEQ ID NO:1. Therefore, immunomodulatory flagellin peptides having amino acid substitutions that do not substantially alter TLR5 binding are included within the definition of an immunomodulatory flagellin peptide. For example, immunomodulatory flagellin peptides which contain one or more alanine substitutions and have substantially the same TLR5 binding activity as the flagellin peptide identified as SEQ ID NO:2 are included within the definition of a flagellin peptide. Exemplary immunomodulatory flagellin peptides containing alanine substitutions and having substantially the same TLR5 binding activity as the flagellin peptide identified as SEQ ID NO:2 include, for example, GAVANRFNSAIT (SEQ ID NO:3) and GAVQNAFNSAIT (SEQ ID NO:4). Immunomodulatory flagellin peptides consisting of greater than twelve amino acids and having TLR5 binding activity can similarly contain amino acid substitutions, so long as such substituted peptides retain substantially the same TLR5 binding activity. Examples of such immunomodulatory flagellin peptides containing substitutions of various amino acid residues with alanine include ADTRDLGAVQNRFNSAIT (SEQ ID NO:37), VDARDLGAVQNRFNSAIT (SEQ ID NO:38) and VDTADLGAVQNRFNSAIT (SEQ ID NO:39). An immunomodulatory flagellin peptide of the invention does not include a full length flagellin polypeptide. An immunomodulatory flagellin peptide is intended to include molecules which contain, in whole or in part, non-amide linkages between amino acids, amino acid analogs and mimetics. Similarly, an immunomodulatory flagellin peptide also includes cyclic peptides and other conformationally constrained structures. An immunomodulatory flagellin peptide of the invention includes polypeptides having several hundred or more amino acid residues and can contain a heterologous amino acid sequence.

[0023]An immunomodulatory flagellin peptide, polypeptide or modification thereof, of the invention binds to toll-like receptor 5 (TLR5) and induces a TLR5-mediated response. It is understood that minor modifications can be made without destroying the TLR5 binding activity, TLR5-mediated response stimulating activity or immune response modulating activity of an flagellin peptide or polypeptide and that only a portion of the primary structure may be required in order to effect activity. Such modifications are included within the meaning of the terms flagellin polypeptide and flagellin peptide so long as TLR5 binding activity, TLR5 response stimulating or immune response stimulating activities are retained. Further, various molecules can be attached to flagellin polypeptides and peptides, including for example, other polypeptides, carbohydrates, nucleic acids or lipids. Such modifications are included within the definition of the term.

[0024]Minor modifications of flagellin polypeptide and peptides having at least about the same TLR5 binding activity, TLR5 response stimulating or immune response stimulating activity as the referenced polypeptide or peptide include, for example, conservative substitutions of naturally occurring amino acids and as well as structural alterations which incorporate non-naturally occurring amino acids, amino acid analogs and functional mimetics. For example, a Lysine (Lys) is considered to be a conservative substitution for the amino acid Arg. Similarly, a flagellin peptide containing mimetic structures having similar charge and spacial arrangements as reference amino acid residues would be considered a modification of the reference polypeptide or peptide so long as the peptide mimetic exhibits at least about the same activity as the reference peptide.

[0025]As used herein, the term "amino acid" is intended to mean both naturally occurring and non-naturally occurring amino acids as well as amino acid analogs and mimetics. Naturally occurring amino acids include the 20 (L)-amino acids utilized during protein biosynthesis as well as others such as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine, homocysteine, citrulline and ornithine, for example. Non-naturally occurring amino acids include, for example, (D)-amino acids, norleucine, norvaline, p-fluorophenylalanine, ethionine and the like. Amino acid analogs include modified forms of naturally and non-naturally occurring amino acids. Such modifications can include, for example, substitution or replacement of chemical groups and moieties on the amino acid or by derivitization of the amino acid. Amino acid mimetics include, for example, organic structures which exhibit functionally similar properties such as charge and charge spacing characteristic of the reference amino acid. For example, an organic structure which mimics Arginine (Arg or R) would have a positive charge moiety located in similar molecular space and having the same degree of mobility as the ε-amino group of the side chain of the naturally occurring Arg amino acid. Mimetics also include constrained structures so as to maintain optimal spacing and charge interactions of the amino acid or of the amino acid functional groups. Those skilled in the art know or can determine what structures constitute functionally equivalent amino acid analogs and amino acid mimetics.

[0026]Specific examples of amino acid analogs and mimetics can be found described in, for example, Roberts and Vellaccio, The Peptides: Analysis, Synthesis, Biology, Eds. Gross and Meinhofer, Vol. 5, p. 341, Academic Press, Inc., New York, N.Y. (1983), the entire volume of which is incorporated herein by reference. Other examples include peralkylated amino acids, particularly permethylated amino acids. See, for example, Combinatorial Chemistry, Eds. Wilson and Czarnik, Ch. 11, p. 235, John Wiley & Sons Inc., New York, N.Y. (1997), the entire book of which is incorporated herein by reference. Yet other examples include amino acids whose amide portion (and, therefore, the amide backbone of the resulting peptide) has been replaced, for example, by a sugar ring, steroid, benzodiazepine or carbo cycle. See, for instance, Burger's Medicinal Chemistry and Drug Discovery, Ed. Manfred E. Wolff, Ch. 15, pp. 619-620, John Wiley & Sons Inc., New York, N.Y. (1995), the entire book of which is incorporated herein by reference. Methods for synthesizing peptides, polypeptides, peptidomimetics and proteins are well known in the art (see, for example, U.S. Pat. No. 5,420,109; M. Bodanzsky, Principles of Peptide Synthesis (1st ed. & 2d rev. ed.), Springer-Verlag, New York, N.Y. (1984 & 1993), see Chapter 7; Stewart and Young, Solid Phase Peptide Synthesis, (2d ed.), Pierce Chemical Co., Rockford, Ill. (1984), each of which is incorporated herein by reference).

[0027]As used herein, the term "immune response" is intended to mean to a measurable or observable reaction to an antigen or immunomodulatory molecule mediated by one or more cells of the immune system. An immune response begins with an antigen or immunomodulatory molecule binding to an immune system cell and terminates with destruction of antigen and cells containing antigen or alteration in immune cell function. A reaction to an antigen or immunomodulatory molecule is mediated by many cell types, including a cell that initially binds to an antigen or immunomodulatory molecule and cells that participate in mediating an innate, humoral, cell-mediated immune response. An innate immune response involves binding of pathogen-associated molecular patterns (PAMPs) to cell surface receptors, such as toll-like receptors. Activation of toll-like receptors in response to PAMPs leads to the production of immunomodulatory molecules, such as cytokines and co-stimulatory molecules, that induce an immune response. A humoral response involves interaction of B cells with antigen and B cell differentiation into antibody-secreting cells. A cell-mediated response involves various subpopulations of T cells that recognize antigen presented on self-cells, including helper T cells that respond to antigen by producing cytokines and cytotoxic T cells that respond to antigen by developing into cytotoxic T lymphocytes, which mediate killing of altered self-cells. The term immune response includes measurable or observable reactions produced by any cell type that participates in the processes through which immune system cells are activated and antigen containing cells are destroyed. Such measurable reactions include, for example, production of immunomodulatory molecules, migration and proliferation.

[0028]An "immunomodulatory molecule" is a molecule that alters an immune response. An immunomodulatory molecule can be, for example, a compound, such as an organic chemical; a polypeptide, such as an antibody or cytokine; a nucleic acid, such as a DNA or RNA molecule; or any other type of molecule that alters an immune response. An immunomodulatory molecule can alter an immune response by directly or indirectly altering an activity of a cell that mediates an immune response. An immunomodulatory molecule can act directly on an immune system cell, for example, by binding to a cell surface receptor and stimulating or inhibiting proliferation, differentiation, or expression, secretion or receptor binding of immune system regulatory molecules such as co-stimulatory receptors and ligands, cytokines, and chemokines. Examples of naturally occurring molecules that act directly on immune system cells to alter an immune response include PAMPs, cytokines, chemokines and growth factors. Other examples of molecules that act directly on immune system cells to alter an immune response include molecules that alter receptor functions, such as antibodies to receptors, soluble cytokine receptors, receptor agonists and antagonists, molecules that alter the production of immunomodulatory molecules, such as inhibitors of converting enzymes and molecules involved in the intracellular transport and secretion of immunomodulatory molecules.

[0029]An immunomodulatory molecule can indirectly alter the activity of a particular immune system cell by altering the amount or activity of a molecule that regulates a cellular activity of the cell. For example, a cytokine, chemokine, or growth factor produced by an immune system cell, such as a macrophage, can stimulate or inhibit various cellular activities of B and T lymphocytes. Immune cell functions that can be stimulated or inhibited by an immunomodulatory molecule include, for example, immune cell activation, co-activation, proliferation, production of cytokines, cellular interactions and migration. An immunomodulatory molecule can therefore act on a variety of immune cell types and can alter a variety of cellular functions. An immunomodulatory flagellin peptide, polypeptide or modifications thereof used in the methods of the invention are examples of immunomodulatory molecules useful for inducing an immune response, for example, by binding to TLR5 and inducing a TLR5-mediated increase in macrophage production of TNFα, IL-1 and IL-6. The flagellin polypeptides, peptides and modifications thereof, are also useful for indirectly inducing an immune response because immunomodulatory molecules produced by a TLR5-expressing cell in response to flagellin will alter the activities of immune system cells that respond to the particular immunomodulatory molecules produced.

[0030]An immunomodulatory molecule can mediate an immune response that is specific for a target antigen or nonspecific. A specific immunomodulatory molecule alters an immune response to a particular target antigen. Examples of specific immunomodulatory molecules include monoclonal antibodies, including naked monoclonal antibodies, drug-, toxin- or radioactive compound-conjugated monoclonal antibodies, and ADCC targeting molecules. Such immunomodulatory molecules stimulate an immune response by binding to antigens and targeting cells for destruction. An immunomodulatory molecule can be used to suppress an immune response to an antigen. For example, a tolerogenizing molecule can be used to suppress an immune response to a self-antigen.

[0031]Nonspecific immunomodulatory molecules stimulate or inhibit the immune system in a general manner through various mechanisms that can include, for example, stimulating or suppressing cellular activities of immune system cells. Nonspecific immunomodulatory molecules useful for stimulating an immune responses include, for example, agents that stimulate immune cell proliferation, immune cell activation and production of cytokines and co-stimulatory molecules. Well known immunomodulatory molecules that stimulate an immune response are, for example, interleukins, interferons, levamisole and keyhole limpet hemocyanin. Nonspecific immunomodulatory molecules useful for suppressing immune responses include, for example, agents that inhibit cytokines synthesis or processing, specific cytokine receptor blocking reagents such as soluble receptors and receptor antagonists, and cytokines that down-regulate or inhibit the production of other immunomodulatory molecules. Well known immunomodulatory molecules for suppressing an immune response include, for example, cyclosporin, rapamycin, tacrolimus, azathioprine, cyclophosphamide and methotrexate.

[0032]Immunomodulatory molecules can be contained in a mixture of molecules, including a natural or man-made composition of molecules. Exemplary natural compositions of immunomodulatory compounds include, for example, those contained in an organism such as Bacille Calmette-Guerin (BCM) or Corynbacterium parvum. Exemplary man-made compositions of immunomodulatory molecules include, for example, QS-21, DETOX and incomplete Freund's adjuvant.

[0033]As used herein, the term "adjuvant" when used in reference to a vaccine, is intended to mean a substance that acts generally to accelerate, prolong, or enhance the quality of specific immune responses to a vaccine antigen. An adjuvant can advantageously reduce the number of immunizations or the amount of antigen required for protective immunization.

[0034]As used herein, the term "antigen-specific immune response" is intended to mean a reaction of one or more cells of the immune system to a particular antigen that is not substantially cross-reactive with other antigens.

[0035]As used herein, the term "antigen" is intended to mean a molecule which induces an immune response. An antigen can be a crude mixture of molecules, such as a cell, or one or more isolated molecules. Examples of crude antigens include attenuated organisms, inactivated organisms, viral particles and tumor cells. Examples of isolated antigens include a polypeptide, lipoprotein, glycoprotein, lipid, anti-idiotype antibody, toxoid, polysaccharide, capsular polysaccharide and nucleic acid. Such isolated antigens can be naturally occurring, recombinantly produced, or synthesized. Exemplary naturally occurring antigens include purified microbial macromolecules. Exemplary recombinantly produced antigens include cloned microbial and tumor cell antigens. Exemplary synthesized antigens include synthetic peptides and nucleic acids.

[0036]As used herein, the term "vaccine" is intended to mean a compound or formulation which, when administered to an individual, stimulates an immune response against an antigen. A vaccine is useful for preventing or ameliorating a pathological condition that will respond favorably to immune response modulation. A vaccine can contain isolated or crude antigen, and can contain one or more antigens. A vaccine can contain one or more adjuvants.

[0037]As used herein, the term "immunogenic amount" is intended to mean an amount of an immunomodulatory flagellin polypeptide, peptide or modifications thereof, or combinations thereof with one or more molecules, such as an antigen or other immunomodulatory molecule, required to effect an immune response. The dosage of an immunomodulatory flagellin polypeptide, peptide, or modifications thereof, independently or in combination with one or more molecules, will depend, for example, on the pathological condition to be treated, the weight and condition of the individual and previous or concurrent therapies. The appropriate amount considered to be an immunogenic dose for a particular application of the method can be determined by those skilled in the art, using the guidance provided herein. For example, the amount can be extrapolated from in vitro or in vivo assays as described below. Those skilled in the art will understand that the condition of the patient needs to be monitored through the course of therapy and that the amount of the composition that is administered can be adjusted according to patient response to therapy.

[0038]The term "pathologically aberrant cell" is intended to mean a cell that is altered from a normal physiological or cellular state. Such alteration can be due to changes in physiology or phenotype associated with a disease or abnormal condition of a mammalian cell or tissue. Pathologically aberrant cells include cells lacking normal control of cellular functions, such as growth, differentiation, and apoptosis, resulting in altered gene and protein expression. Cells that lack normal growth control proliferate in the absence of appropriate growth signals, resulting in damage in structure or function of surrounding tissues. Cells that lack normal differentiation undergo inappropriate phenotypic or physiological changes that do not normally characterize the cell type, resulting in damage in structure and function or surrounding tissues. Cells that lack normal apoptosis fail to undergo, or inappropriately undergo the process of cell death, resulting in damage in structure or function of surrounding tissues. Altered protein expression is an example of a phenotype change that renders such cells distinguishable from normal. For example, increased or decreased expression of a polypeptide normally expressed on a cell, expression of a mutated polypeptide and expression of a polypeptide not normally expressed on a cell are phenotypic changes that can alter a cell from normal. Examples of pathologically aberrant cells include tumor cells and degenerating cells.

[0039]As used herein, the term "pathological condition" is intended to mean a disease, abnormal condition or injury of a mammalian cell or tissue. Such pathological conditions include, for example, hyperproliferative and unregulated neoplastic cell growth, degenerative conditions, inflammatory diseases, autoimmune diseases and infectious diseases. Pathological conditions characterized by excessive or unregulated cell growth include, for example, hyperplasia, cancer, autoimmune disease and infectious disease. Hyperplastic and cancer cells proliferate in an unregulated manner, causing destruction of tissues and organs. Specific examples of hyperplasias include benign prostatic hyperplasia and endometrial hyperplasia. Specific examples of cancer include prostate, breast, ovary, lung, uterus, brain and skin cancers. Abnormal cellular growth can also result from infectious diseases in which foreign organisms cause excessive growth. For example, human papilloma viruses can cause abnormal growth of skin cells. The growth of cells infected by a pathogen is abnormal due to the alteration of the normal condition of a cell resulting from the presence of a foreign organism. Specific examples of infectious diseases include DNA and RNA viral diseases, bacterial diseases, parasitic diseases. Similarly, the growth of cells mediating autoimmune and inflammatory diseases are aberrantly regulated which results in, for example, the continued proliferation and activation of immune mechanisms with the destruction of tissues and organs. Specific examples of autoimmune diseases include, for example, rheumatoid arthritis and systemic lupus erythmatosis. Specific examples of degenerative disease include osteoarthritis and Alzheimer's disease.

[0040]By specific mention of the above categories of pathological conditions, those skilled in the art will understand that such terms include all classes and types of these pathological conditions. For example, the term cancer is intended to include all known cancers, whether characterized as malignant, benign, soft tissue or solid tumor. Similarly, the terms infectious diseases, degenerative diseases, autoimmune diseases and inflammatory diseases are intended to include all classes and types of these pathological conditions. Those skilled in the art will know the various classes and types of proliferative, infectious, autoimmune and inflammatory diseases.

[0041]As used herein the term "toll-like receptor 5" or "TLR5" is intended to mean a toll-like receptor 5 of any species, such as the murine and human polypeptides containing the amino acid sequences set forth as SEQ ID NOS:6 and 8, respectively, encoded by the nucleic acid sequence identified as SEQ ID NOS:5 and 7, respectively. A TLR5 is activated upon binding to flagellin, an immunomodulatory flagellin peptide, or modifications thereof, and other TLR5 agonists. Upon activation, a TLR5 induces a cellular response by transducing an intracellular signal that is propagated through a series of signaling molecules from the cell surface to the nucleus. For example, the intracellular domain of TLR5 recruits an adaptor protein, MyD88, which recruits the serine kinase IRAK. IRAK forms a complex with TRAF6, which then interacts with various molecules that participate in transducing the TLR signal. These molecules and other TRL5 signal transduction pathway components stimulate the activity of transcription factors, such as fos, jun and NF-κB, and the corresponding induction of gene products of fos-, jun- and NF-κB-regulated genes, such as, for example, TNFα, IL-1 and IL-6. The activities of signaling molecules that mediate the TLR5 signal, as well as molecules produced as a result of TLR5 activation are TLR5 activities that can be observed or measured. Therefore, a TLR5 activity includes binding to a flagellin polypeptide, immunomodulatory flagellin peptide, or a modification thereof, recuitment of intracellular signaling molecules, as well as downstream events resulting from TLR5 activation, such as transcription factor activation and production of immunomodulatory molecules. A TLR5 cellular response mediates an innate immune system response in an animal because cytokines released by TLR5-expressing cells regulate other immune system cells to promote an immune response in an animal. Therefore, as used herein the term "TLR5-mediated response" is intended to mean the ability of a flagellin polypeptide, immunomodulatory peptide or modification thereof to induce a TLR5-mediated cellular response. Exemplary TLR5-mediated cellular responses include activation of transcription factors such as fos, jun and NF-κB, production of cytokines such as IL-1, IL-6 and TNFα, and the stimulation of an immune response in an animal.

[0042]A TLR5 also encompasses polypeptides containing minor modifications of a native TLR5, and fragments of a full-length native TLR5, so long as the modified polypeptide or fragment retains one or more biological activities of a native TLR5, such as the abilities to stimulate NF-κB activity, stimulate the production of cytokines such as TNFα, IL-1, and IL-6 and stimulate an immune response in response to TLR5 binding to flagellin polypeptide, immunomodulatory peptide or modifications thereof. A modification of a TLR5 can include additions, deletions, or substitutions of amino acids, so long as a biological activity of a native TLR5 is retained. For example, a modification can serve to alter the stability or activity the polypeptide, or to facilitate its purification. Modifications of polypeptides as described above in reference to flagellin polypeptides and peptides are applicable to TLR5 polypeptides of the invention. A "fragment" of a TLR5 is intended to mean a portion of a TLR5 that retains at least about the same activity as a native TLR5.

[0043]As used herein, the term "TLR5 agonist" refers to a compound that selectively activates or increases normal signal transduction through TLR5. As used herein, the term "TLR5 antagonist" refers to a compound that selectively inhibits or decreases normal signal transduction through TLR5. A TLR5 agonist or antagonist can alter normal signal transduction through TLR5 indirectly, for example, by modifying or altering the native conformation of TLR5 or a TLR5 ligand. For therapeutic applications, a TLR5 agonist or antagonist has an EC50 of less than about 10^-7 M, such as less than 10^-8 M and less than 10^-9 M, although a TRL5 agonist with a higher EC50 can be therapeutically useful. As used herein, the term "TLR5 ligand" refers to a compound that binds a TLR5 polypeptide with high affinity. A TLR5 ligand can further be an agonist or antagonist of TLR5, as described above, or can be a compound having little or no effect on TLR5 signaling.

[0044]As used herein, the term "detectably labeled" refers to derivitization with, or conjugation to, a moiety that is detectable by an analytical or qualitative method. A detectable moiety can be, for example, a radioisotope, such as ¹⁴C, ¹³¹I, ³²P or ³H, fluorochrome, ferromagnetic substance, or luminescent substance.

[0045]As used herein the term "ADCC targeting molecule" is intended to mean an antigen binding protein containing a Fc receptor binding domain capable of inducing antibody-dependent cell cytotoxicity (ADCC). An ADCC targeting molecule can also contain other domains that augment induction of ADCC. The flagellin polypeptides and peptides, immunomodulatory peptides, and modifications described herein, can be domains of an ADCC targeting molecule that augment induction of ADCC. The ADCC targeting molecule can include multiple valencies for either or both the antigen binding domain or the Fc receptor binding domain. Additionally, an ADCC targeting molecule also can have multiple different antigen binding domains combined with a single or multiple copies of an Fc receptor binding domain or combined with different Fc receptor binding domains. The antigen binding domain or domains can be derived from essentially any molecule that has selective or specific binding activity to a target antigen so long as it can be fused or attached to one or more Fc receptor binding domains while still maintaining antigen binding activity. The Fc receptor binding domain can be derived from an antibody constant region of, for example, the IgG class, including subclasses IgG1, IgG3 and IgG4. Such Fc receptor binding domains can be used in their native form or the amino acid sequence can be modified so as to enhance or optimize the Fc receptor binding or ADCC activity. Moreover, the Fc receptor binding domains can be derived from constant regions which recognize either stimulatory or inhibitory Fc receptors. The Fc receptor binding domain is located within the hinge region of an antibody constant region where the cognate receptors bound by this domain include, for example, the Fc RI, Fc RIIA and Fc RIII. Therefore, ADCC targeting molecules include, for example, antibodies selective for a target antigen and functional variants thereof as well as fusion proteins and chemical conjugates containing both an antigen binding domain and a Fc receptor binding domain in functionally active forms. ADCC targeting molecules and the use of ADCC targeting molecules in the treatment of disease are described in detail in U.S. patent application Ser. No. 09/618,176, which is incorporated herein by reference.

[0046]The term "about" when used in reference to a particular activity or measurement is intended to refer to the referenced activity or measurement as being within a range values encompassing the referenced value and within accepted standards of a credible assay within the art, or within accepted statistical variance of a credible assay within the art.

[0047]As used herein, the term "substantially" or "substantially the same" when used in reference to an amino acid sequence is intended to mean that the amino acid sequence shows a considerable degree, amount or extent of sequence identity when compared to the reference sequence. Such considerable degree, amount or extent of identity is further considered to be significant and meaningful and therefore exhibit characteristics which are definitively recognizable or known as being derived from or related to flagellin. For example, an amino acid sequence which is substantially the same amino acid sequence as an flagellin peptide, including fragments thereof, refers to a sequence which exhibits characteristics that are definitively known or recognizable as being sufficiently related to flagellin so as to fall within the classification of flagellin sequences as defined above. Minor modifications thereof are included so long as they are recognizable as an flagellin sequence as defined above.

[0048]As used herein, the term "individual" is intended to mean any animal in which an immune response can be induced by a flagellin polypeptide, peptide or modifications thereof including a human, non-human primate, cow, pig, chicken, rabbit, ferret, rat or mouse.

[0049]An immunomodulatory flagellin polypeptide, peptide or modifications thereof can be used to induce an immune response in an individual having a pathological condition, promoting the individual's own immune system to function more effectively and thereby ameliorate the pathological condition. An individual's immune system may not recognize cancer cells and other types of pathologically aberrant cells as foreign because the particular antigens are not different enough from those of normal cells to cause an immune reaction. In addition, the immune system may recognize cancer cells, but induce a response insufficient to destroy the cancer. By stimulating an innate immune response, immunomodulatory flagellin peptide, polypeptide or modification thereof, promote humoral and cell-mediated responses to antigens on foreign cells or pathologically aberrant cells, such as cancer cells. Administered independently or in combination with an antigen, such as a tumor antigen, a flagellin polypeptide, peptide or modification thereof, can be used to boost the immune system's recognition of cancer cells and other pathologically aberrant cells, and target such cells for destruction.

[0050]Flagellin is a pathogen-associated molecular pattern (PAMP) recognized by toll-like receptor 5 (TRL5). Toll-like receptor 5 is a member of a family of at least 10 receptors involved in mediated the innate immune response. Toll-like receptors recognize PAMPs that distinguish infectious agents from self and mediating the production of immunomodulatory molecules, such as cytokines, necessary for the development of effective adaptive immunity (Aderem, A. and Ulevitch, R. J. Nature 406:782-787 (2000) and Brightbill, H. D., Immunology 101: 1-10 (2000)). Members of the toll-like receptor family recognize a variety of antigen types and can discriminate between pathogens. For example, TLR2 recognizes various fungal, Gram-positive, and mycobacterial components, TLR4 recognizes the Gram-negative product lipopolysaccharide (LPS), and TLR9 recognizes nucleic acids such as CpG repeats in bacterial DNA. TLR5 has now been identified as a receptor for bacterial flagellin.

[0051]Flagellin induces an innate immune response by binding to and activating TLR5. Activation of TLR5 by binding to flagellin induces the production of immunomodulatory molecules, such as cytokines and co-stimulatory molecules, by a TLR5-expressing cell. For example, activation of TLR5 in macrophages results in the expression of the cytokines TNFα, IL-1 and IL-6. These cytokines directly and indirectly alter the activities of immune system cells that participate in both humoral (TH2) and cell-mediated (TH1) adaptive immune responses. In this manner, an immunomodulatory flagellin peptide, polypeptide or modification thereof, acts as an adjuvant to stimulate a general immune response.

[0052]Altering the balance of TH1- versus TH2-associated cytokines can be used to favorably alter an immune response to treat certain diseases. For example, in the use of cancer vaccines, it can be favorable to induce both TH1 and TH2 responses (Herlyn and Birebent, Ann. Med., 31:66-78, (1999)). Different sets of cytokines orchestrate TH1 and TH2 immune responses. For example, TH1 immune responses are associated with the cytokines IL-2, IFN-γ, and TNFα while TH2 immune responses are associated with the cytokines IL-4, IL-5, IL-6 and IL-10. TLR5 stimulates the production of cytokines associated with both TH1- and TH2-associated cytokines. For example, TNFα is associated with the stimulation of a TH1 type immune response (Ahlers, J D et al. J. Immunol, 158:3947-58 (1997)), and IL-6 is associated with the stimulation of a TH2 type response (Steidler, L. et al. Infect. Immun., 66:3183-9, (1998)). Therefore, an immunomodulatory flagellin peptide, polypeptide or modification thereof, can be used to advantageously elicit TH1 and TH2 type immune responses.

[0053]An immunomodulatory flagellin peptide, polypeptide or modification thereof can also be used to generally alter the particular cytokines involved in an immune response in an individual. Alterations from normal levels of cytokines are observed in many disease states. For this reason, it can be desirable to increase or decrease the amounts or activities of specific cytokines involved in particular pathological conditions. The cytokines produced in response to TLR5 activation can both stimulate and down-regulate the production of other cytokines. Therefore, an immunomodulatory flagellin peptide, polypeptide or modification thereof, or combination of a flagellin molecule with an immunomodulatory molecule or antigen can be used to alter levels of cytokines associated with a pathological condition. For example, an immunomodulatory flagellin peptide can increase TLR5-expressing macrophage production of TNFα, IL-1 and IL-6. TNFα and IL-1 generally function as pro-inflammatory cytokines. IL-6 generally functions as an anti-inflammatory cytokine and induces a variety of anti-inflammatory activities in immune system cells. For example, IL-6 stimulates the production of many anti-inflammatory anti-proteases. Those skilled in the art will be able to determine if a pathological condition in an individual could be ameliorated by inducing TLR5-stimulated cytokine production and will be able to determine appropriate combinations of flagellin and immunomodulatory molecules suitable for inducing a beneficial immune response.

[0054]The invention provides an immunomodulatory flagellin peptide comprising at least about 10 amino acids of substantially the amino acid sequence GAVQNRFNSAIT (SEQ ID NO:2), or a modification thereof, that binds to toll-like receptor 5 (TLR5).

[0055]The flagellin peptide identified by SEQ ID NO:2 is a peptide of S. Typhimurium1 flagellin which is encoded by the nucleic acid sequence identified by SEQ ID NO:1. A flagellin peptide of the invention also includes peptides from other bacterial species, such as H. Pylori (SEQ ID NO:12), V. Cholera (SEQ ID NO:13), S. marcesens (SEQ ID NO:20), S. flexneri (SEQ ID NO:22), T. Pallidum (SEQ ID NO:23 or SEQ ID NO:24), L. pneumophila (SEQ ID NO:25), B burgdorferei (SEQ ID NO:26), C. difficile (SEQ ID NO:28), R. meliloti (SEQ ID NO:29), A. tumefaciens (SEQ ID NO:30), R. lupini (SEQ ID NO:31), B. clarridgeiae (SEQ ID NO:33), P. Mirabilis (SEQ ID NO:16), B. subtilus (SEQ ID NO:27), L. monocytogenes (SEQ ID NO:32), P. aeruginosa (SEQ ID NO:14) and E. coli (SEQ ID NO:21), which contain amino acid sequences having 21-71% identity over the 12 amino acid sequence of SEQ ID NO:2. A flagellin peptide of the invention also includes flagellin peptides from other bacterial species, including peptides contained within the flagellin amino acid sequences shown FIG. 7. Thus, a flagellin peptide of the invention can have greater than about 65% identity, such as greater than about 75%, greater than about 85%, greater than about 95%, greater than about 98% identity with the peptide identified by SEQ ID NO:2.

[0056]A flagellin peptide of the invention is derived from a conserved region of a flagellin polypeptide. Conserved regions of flagellin are well known in the art and have been described, for example, in Mimori-Kiyosue, et al., J. Mol. Viol. 270:222-237, (1997). Whereas T cell receptors which mediate the adaptive immune response recognize random portions of antigen amino acid sequences, toll-like receptors recognize conserved portions of antigen amino acid sequences. Therefore, the flagellin peptides of the invention and immunomodulatory flagellin peptides used in the methods of the invention contain amino acid sequences derived from conserved regions of flagellin.

[0057]A flagellin peptide of the invention excludes a portion of flagellin described in Newton et al. (supra, 1989), which consists of an S. meunchen flagellin fragment containing a deletion of amino acids 207-223, portions of E. coli (strain K12) flagellin described in Kuwaijima et al. (supra, 1998), which consist of E. coli flagellin fragments containing deletions of amino acids 239-254, 259-278, 237-262, 194-379, 201-318, 218-326, 211-347, 210-299, 245-301, and 220-299, a portion of flagellin described in Samatey et al. (supra, 2000), which consists of an S. typhimurium flagellin fragment lacking 52 N-terminal amino acid residues and lacking 44 C-terminal amino acid residues, and portions of flagellin described in McSorley et al. (supra, 2000) which consist of S. typhimurium flagellin fragments having the following amino acid sequences: RSDLGAVQNRFNSAI (SEQ ID NO:40), DLGAVQNRFNSAITN (SEQ ID NO:41), GAVQNRFNSAITNLG (SEQ ID NO:42) AND VQNRFNSAITNLGNT (SEQ ID NO:43).

[0058]An immunomodulatory flagellin peptide of the invention can contain a heterologous amino acid sequence that imparts structural or functional characteristics onto the flagellin peptide. For example, chimeric flagellin peptides or modifications can be used to impart a targeting function. Targeting of a flagellin peptide or modification to a particular site, such as a mucosal surface for example, confers additional therapeutic advantage of inducing an immune response at a site of pathological condition or a site favored for inducing an antigen-specific immune response, for example by a vaccine. Further, chimeric flagellin peptides can include a sequence that facilitates detection, purification or enhances immunomodulatory activity of the flagellin peptide. A flagellin peptide can be contained, for example, in an ADCC targeting molecule used to treat a pathological condition. A flagellin peptide can augment the effectiveness of an ADCC targeting molecule by, for example, stimulating an innate immune response through TLR5, such as the induction of cytokines such as TNFα, IL-1 and IL-6. Similarly, a flagellin peptide can contain amino acid sequences of a variety of antigen polypeptides, such as those described above in reference to antigens contained in vaccines used in the methods of the invention. A chimeric flagellin peptide containing amino acid sequences of an antigen or containing an antigenic molecule such as a carbohydrate, nucleic acid, or lipid, can be used analogously to a vaccine, as described above, as well as in a vaccine formulation, to induce an immune response in an individual. As such, a chimeric flagellin peptide can be a vaccine that induces both innate and adaptive immune system responses.

[0059]An immunomodulatory flagellin peptide of the invention can be prepared by a variety of methods well-known in the art, for example, by recombinant expression systems described below, and biochemical purification methods described below, as well as by synthetic methods well known in the art. Methods for recombinant expression and purification of polypeptides in various host organisms are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1992) and in Ansubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1998), both of which are incorporated herein by reference. Similarly, flagellin peptide modifications can be generated using recombinant mutagenesis, such as site directed mutagenesis and PCR mutagenesis, and expression of the flagellin peptide modification. Numerous methods of constructing, modifying, expressing and purifying peptides are known to those skilled in the art. A specific example of a method for purifying flagellin is described below in Example III. The choice of recombinant methods, expression and purification systems will be known by those skilled in the art and will depend on the user and the particular application for the immunomodulatory flagellin peptide or modification thereof.

[0060]A flagellin peptide of the invention induces an innate immune response in an individual by binding to an stimulating TLR5. Therefore, the invention provides methods for inducing an immune response in an individual having a pathological condition that can be ameliorated by immune system activity. The methods involve administering an immunomodulatory flagellin peptide or modification thereof to induce an immune response, administering a combination of an immunomodulatory flagellin peptide and an antigen to induce an antigen-specific immune response, and administering a combination of an immunomodulatory flagellin peptide and an immunomodulatory molecule to modulate an immune response. The selection of a particular method for inducing an immune response will depend on the particular pathological condition to be ameliorated or prevented in an individual. As described herein, the methods are applicable to a wide variety of pathological conditions. Those skilled in the art will be able to determine if an immune response can be beneficially modulated by administering an immunomodulatory flagellin peptide or combination thereof with an antigen or immunomodulatory molecule.

[0061]The invention provides method of inducing an antigen-specific immune response in an individual. The method involves administering to an individual an immunogenic amount of a vaccine, comprising an antigen and an immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence of SEQ ID NO:2, or a modification thereof.

[0062]As an adjuvant in a vaccine formulation, the immunomodulatory flagellin peptides of the invention can contribute to the effectiveness of the vaccine by, for example, enhancing the immunogenicity of weaker antigens such as highly purified or recombinant antigens, reducing the amount of antigen required for an immune response, reducing the frequency of immunization required to provide protective immunity, improve the efficacy of vaccines in individuals with reduced or weakened immune responses, such as newborns, the aged, and immunocompromised individuals, and enhance the immunity at a target tissue, such as mucosal immunity, or promote cell-mediated or humoral immunity by eliciting a particular cytokine profile. An immunomodulatory flagellin peptide, polypeptide or modification thereof induces an innate immune response through activation of TLR5. The innate immune response increases the immune response to an antigen by stimulating the adaptive immune response. Therefore, a combination of an immunomodulatory flagellin peptide, polypeptide or modification thereof with one or more antigens provides an effective vaccine for inducing an immune response in an individual.

[0063]The methods of the invention for inducing an antigen-specific immune response can be used to treat individuals having a variety of pathological conditions. For example, cancer vaccines have been used effectively for treating melanoma and breast cancers. Vaccines have been used for treatment of inflammatory diseases such as asthma (Scanga C. B and Le Gros, G., Drugs 59(6), 1217-1221 (2000)), infectious diseases of pathogenic bacteria such as H. pylori, pathogenic viruses such as human papilloma virus and HIV (Sutton P. and Lee, A, Aliment Pharmacol. 14:1107-1118 (2000)), protozoa, autoimmune diseases such as diabetes (von Herrath and Whitton, Ann. Med. 32:285-292 (2000)) and degenerative diseases such as Alzheimer's disease (Youngkin, S. G., Nat. Med., 7(1):18-19 (2001)). Therefore, a vaccine used in the methods of the invention for inducing an antigen-specific immune response can be administered to an individual for treatment of a variety of pathological conditions, including proliferative disease, infectious disease, inflammatory disease and degenerative disease.

[0064]A variety of antigens can be used in combination with an immunomodulatory flagellin peptide of the invention for preparing a vaccine. Microorganisms such as viruses, bacteria and parasites contain substances that are not normally present in the body. These substances can be used as antigens to produce an immune response to destroy both the antigen and cells containing the antigen, such as a bacterial cell or cancer cell.

[0065]For example, isolated or crude antigens of microbial pathogens can be used in vaccines to treat infectious disease; isolated or crude tumor cell antigens can be used in vaccines to treat cancer; isolated or crude antigens known to be associated with a pathologically aberrant cell can be used to treat a variety of diseases in which it is beneficial to target particular cells for destruction.

[0066]A variety of substances can be used as antigens in a vaccine compound or formulation. For example, attenuated and inactivated viral and bacterial pathogens, purified macromolecules, polysaccharides, toxoids, recombinant antigens, organisms containing a foreign gene from a pathogen, synthetic peptides, polynucleic acids, antibodies and tumor cells can be used to prepare a vaccine useful for treating a pathological condition. Therefore, an immunomodulatory flagellin peptide of the invention can be combined with a wide variety of antigens to produce a vaccine useful for inducing an immune response in an individual. Those skilled in the art will be able to select an antigen appropriate for treating a particular pathological condition and will know how to determine whether a crude or isolated antigen is favored in a particular vaccine formulation.

[0067]An isolated antigen can be prepared using a variety of methods well known in the art. A gene encoding any immunogenic polypeptide can be isolated and cloned, for example, in bacterial, yeast, insect, reptile or mammalian cells using recombinant methods well known in the art and described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1992) and in Ansubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1998). A number of genes encoding surface antigens from viral, bacterial and protozoan pathogens have been successfully cloned, expressed and used as antigens for vaccine development. For example, the major surface antigen of hepatitis B virus, HbsAg, the β subunit of choleratoxin, the enterotoxin of E. coli, the circumsporozoite protein of the malaria parasite, and a glycoprotein membrane antigen from Epstein-Barr virus, as well as tumor cell antigens, have been expressed in various well known vector/host systems, purified and used in vaccines. An immunomodulatory flagellin peptide, polypeptide or modification thereof induces an innate immune response through TLR5 that can beneficially enhance an immune response to a recombinant antigen.

[0068]A pathologically aberrant cell to be used in a vaccine can be obtained from any source such as one or more individuals having a pathological condition or ex vivo or in vitro cultured cells obtained from one or more such individuals, including a specific individual to be treated with the resulting vaccine.

[0069]Those skilled in the art will be able to determine if a vaccine compound or formulation induces an innate, humoral, cell-mediated, or any combination of these types of immune response, as methods for characterizing these immune responses are well known in the art. For example, the ability of a vaccine compound or formulation to induce an innate immune response through TLR5 can be determined using methods described herein as well as other methods. Such methods for detecting an innate immune response can be generally performed within hours of vaccine administration. The ability of a vaccine compound or formulation to induce a humoral response can be determined by measuring the titer of antigen-specific antibodies in an animal primed with the vaccine and boosted with the antigen, or determining the presence of antibodies cross-reactive with an antigen by ELISA, Western blotting or other well-known methods. Cell-mediated immune responses can be determined, for example, by measuring cytotoxic T cell response to antigen using a variety of methods well known in the art. Methods of detecting humoral and cell-medicated immune responses can be generally performed days or weeks after vaccine administration.

[0070]A combination of an antigen or immunomodulatory molecule and an immunomodulatory flagellin peptide, polypeptide or modification thereof, can be tested in a variety of preclinical toxicological and safety studies well known in the art. For example, such a combination can be evaluated in an animal model in which the antigen has been found to be immunogenic and that can be reproducibly immunized by the same route proposed for human clinical testing. A combination of an antigen or immunomodulatory molecule and an immunomodulatory flagellin peptide or modification thereof can be tested, for example, by an approach set forth by the Center for Biologics Evaluation and Research/Food and Drug Administration and National Institute of Allergy and Infectious Diseases (Goldenthal, K L et al. AID Res Hum Retroviruses, 9:545-9 (1993)).

[0071]Those skilled in the art will know how to determine for a particular combination of antigen or immunomodulatory molecule and immunomodulatory flagellin polypeptide modification thereof, the appropriate antigen payload, route of immunization, volume of dose, purity of antigen, and vaccination regimen useful to treat a particular pathological condition in a particular animal species.

[0072]The invention provides a method of inducing a TLR5-mediated response. The method involves administering to a TLR5-containing cell an effective amount of an immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence of SEQ ID NO:2, or a modification thereof.

[0073]A TLR5-mediated response can be assessed in a cell or animal because TLR5 stimulates cellular activities that stimulate the immune response that occurs in an animal. For example, flagellin binding to TLR5 induces cellular events such as an increase in the amount or activity of cytokines, such as TNFα, IL-1 and IL-6. These cytokines in turn regulate the activities of immune system cells. Therefore a TLR5-mediated response can be determined by examining an immune responses in an animal and by observing particular immune system cell activities. Determination of immune responses in an animal is discussed below. Determination of immune system cell activities can be performed, for example, by observing or measuring the amount of activity of immunomodulatory molecules produced by specific types of immune cells. Cytokine production by macrophages is an exemplary immune cell activity that can be conveniently measured using methods well known in the art and those described herein. A biological activity of a cytokine can also be assessed using methods well known in the art. TNFα activities include, for example, inducing the production of IL-1 and IL-6, activation of neutrophils and endothelial cells in inflammation, inducing acute phase reactants in liver, inducing fever. IL-1 activities include, for example, activating of endothelial cells in inflammation and coagulation, inducing acute phage reactants in liver, inducing fever and stimulating T cell proliferation. IL-6 activities include, for example, stimulating proliferation of mature B cells and inducing their final maturation into antibody-producing plasma cells, inducing IL-2 receptor expression, inducing acute phase reactants in liver, and co-stimulation of thymocytes in vitro. A regulatory effect of IL-6 is inhibition of TNFα production, providing negative feedback for limiting the acute inflammatory response (Feghali, C. A. and Wright, T. M., Frontiers in Bioscience, 2, d12-26 (1997) provides a summary of cytokine activities).

[0074]The invention provides a method of inducing an immune response in an individual having a pathological condition. The method involves administering to said individual an immunogenic amount of an immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence of SEQ ID NO:2, or a modification thereof.

[0075]As described above, an immunomodulatory flagellin peptide can be used to beneficially boost a general immune response in an individual having a pathological condition by stimulating an innate immune response. An increased immune response can ameliorate a pathological condition as well as prevent a pathological condition in a healthy individual, or individual not having a pathological condition. Therefore, an immunomodulatory flagellin peptide can be administered prophylactically to an individual not having a pathological condition, if desired.

[0076]The invention provides another method of modulating an immune response in an individual having a pathological condition. The method involves administering to the individual a combination of an immunogenic amount of an immunomodulatory flagellin peptide having at least about 10 amino acids of substantially the amino acid sequence of SEQ ID NO:2, or a modification thereof, and another immunomodulatory molecule.

[0077]As described above, a combination of an immunomodulatory flagellin peptide with another immunomodulatory molecule can be used to advantageously induce or modulate an immune response. An immune response can be induced by combining an immunomodulatory flagellin peptide with another immunomodulatory molecule that induces an immune response in a general manner, such as an adjuvant, or can be combined with an immunomodulatory molecule that induces a particular alteration in an immune cell activity. Such immunomodulatory molecules are described herein.

[0078]Modulating an immune response is useful for promoting a more effective or more normal immune response in an individual having a pathological condition. As described above, alterations in normal cytokine levels are associated with various pathological conditions. An immunomodulatory flagellin peptide or combination with another immunomodulatory molecule can be used to modulate cytokine levels in an individual by inducing the production of immunomodulatory molecules, such as cytokines including TNFα, IL-1, and IL-6 through TLR5, and inducing the production of suppression of the same or different immunomodulatory molecules through the activity of the administered immunomodulatory molecule. Therefore, the immunomodulatory flagellin peptides of the invention can be combined with immunomodulatory molecules that alter an immune response by stimulating or inhibiting the cellular functions of immune system cells.

[0079]A variety of immunomodulatory molecules can be used in combination with an immunomodulatory flagellin peptide or modification thereof of the invention to alter an immune response in an individual. The type of alteration desired will determine the type of immunomodulatory molecule selected to be combined with an immunomodulatory flagellin peptide. For example, to promote an innate immune response, a immunomodulatory flagellin peptide can be combined with another immunomodulatory molecule that promotes an innate immune response, such as a PAMP or conserved region known or suspected of inducing an innate immune response. A variety of PAMPs are known to stimulate the activities of different members of the toll-like family of receptors. Such PAMPs can be combined to stimulate a particular combination of toll-like receptors that induce a beneficial cytokine profile. For example, PAMPs can be combined to stimulate a cytokine profile that induces a TH1 or TH2 immune response.

[0080]Other types of immunomodulatory molecules that promote humoral or cell-mediated immune responses can be combined with a flagellin molecule of the invention. For example, cytokines can be administered to alter the balance of TH1 and TH2 immune responses. Those skilled in the art will know how to determine the appropriate cytokines useful for obtaining a beneficial alteration in immune response for a particular pathological condition.

[0081]Immunomodulatory molecules that target antigens and cells displaying antigens for destruction can be combined with a flagellin molecule of the invention. For example, the effectiveness of monoclonal antibodies and ADCC targeting molecules that recognize a particular antigen on an unwanted cell, such as a pathologically aberrant cell can be increased when administered with a flagellin molecule of the invention. Immunomodulatory molecules that stimulate or suppress cellular activities such as proliferation, migration, activation, interaction and differentiation can be combined with a flagellin molecule of the invention. For example, IL-2 can be used to stimulate proliferation of immune system cells, certain interferons can be used to interfere with the rapid growth of cancer cells or to interfere with angiogenesis, and ganulocyte-colony stimulating factor can be used to increase production of certain types of immune system cells and blood cells. A variety of immunostimulating and immunossupressing molecules and modalities are well known in the art and can be used in combination with a flagellin polypeptide, peptide or modification thereof, of the invention. A flagellin molecule of the invention increases the beneficial effect of an immunomodulatory molecule by inducing TLR5-mediated production of immunomodulatory molecules that function in concert with a selected immunomodulatory molecule to produce a desired cytokine profile or cellular activity, or prime the adaptive immune response to respond to the selected immunomodulatory molecule.

[0082]The methods of the invention for using immunomodulatory flagellin peptides to induce an immune response are also applicable to a flagellin polypeptide, or a modification thereof. Accordingly, the invention provides a method of inducing an immune response in an individual, including a human, having a pathological condition. The method involves administering to the individual an immunogenic amount of an immunomodulatory flagellin polypeptide, or modification thereof, when the flagellin polypeptide induces an immune response.

[0083]An immunomodulatory flagellin peptide of the invention binds to TLR5 and stimulates a TLR5 activity. The ability of an immunomodulatory flagellin peptide or modification thereof to bind to TLR5 or stimulate a TLR5 activity can be determined using methods known in the art. Methods of determining specific binding interactions of flagellin peptides and modifications thereof with TLR5 can be determined using well known methods in the art such as methods of trapping ligand-receptor complexes using chemical cross-linking, and competitive inhibition of reagents specific for TLR5 such as specific flagellin peptides or modifications, antibodies or other TLR-5 specific reagents.

[0084]Methods of determining TLR5 functional activities in response to an immunomodulatory flagellin peptide or modification thereof include methods described herein, in Examples I through IV, as well as methods known in the art. A variety of methods well known in the art can be used for determining transcription factor activities. For example, fos, jun, and NF-κB activation in response to TLR5 binding to a flagellin molecule can be detected by electrophoretic mobility shift assays well known in the art that detect NF-κB binding to specific polynucleic acid sequences, and promoter-reporter nucleic acid constructs such that, for example, β-lactamase, luciferase, green fluorescent protein or β-galactosidase will be expressed in response to contacting a TLR5 with a flagellin polypeptide, peptide or equivalent thereof. For example, a luciferase reporter plasmid in which luciferase protein expression is driven by one or more NF-κB binding sites can be transfected into a cell, as described in Examples I-IV. Activation of NF-κB results in activation of luciferase reporter expression, resulting in production of luciferase enzyme able to catalyze the generation of a molecule that can be detected by colorimetric, fluorescence, chemiluminescence or radiometric assay.

[0085]An amount or activity of a polypeptide, including a cytokine such as TNFα, IL-1 or IL-6, can be a read-out for activation of a TLR5 in response to binding an immunomodulatory flagellin peptide or modification thereof. A variety of methods well known in the art can be used to measure cytokine amounts, such as, for example, flow cytometry methods, immunoassays such as ELISA and RIA, and cytokine RNA protection assays. Commercially available cytokine assay kits, such as ELISA assay formats, can be conveniently used to determine the amount of a variety of cytokines in a sample. Those skilled in the art will determine the particular cytokines to be measured when assessing an immune response in a cell or animal. For example, to determine whether a particular response is characterized as a TH1 or TH2 immune response, those skilled in the art will be able to select appropriate cytokines within the TH1 and TH2 categories, which are well known in the art.

[0086]A sample used for determining a TLR5-mediated response or immune response can include, for example, a fluid or tissue obtained from an animal, a cell obtained from an animal fluid or tissue, cultured cells including in vitro and ex vivo cultured cells, and lysates or fractions thereof and cultured cells that express TLR5.

[0087]An immune response in an animal is determined by the collective responses of the cells of the immune system. An immune response can be detected by observing various indicators of immune response in an animal. Such indicators include, for example, visible signs of inflammation of tissues, such as swelling, production of antibodies, such as levels of IgA, IgG and IgM in blood and levels of IgA in saliva, alterations in immune cell numbers, such as increased or decreased proliferation of particular immune cells, and in immune cell activities, such as production of immunomodulatory molecules and second messenger molecules. For example, an immune response to a particular antigen can be observed in a animal using methods well known in the art such as delayed hypersensitivity skin tests. An immune response can be determined by the presence of antibodies cross reactive with an antigen, such as by ELISA and Western blotting, lymphocyte activation tests employing mitogen or antigen stimulation, mixed lymphocyte culture tests, assays for human T and B lymphocytes, flow cytometry and cell sorting to characterize populations of immune system cells obtained from an individual, soluble antigen uptake by macrophages, and tests of neutrophil functions (Stites et al. Basic and Clinical Immunology, 4^th edition, Lange Medical Publications, Los Altos, Calif. (1982)). An immune response can also be assessed by examining amounts or activities of immune system mediators, such as cytokines and chemokines, in cells collected from fluids or tissues of animals. A variety of methods are well known in the art for qualitative and quantitative measurement of cytokine amount and bioassay of cytokine activity.

[0088]The methods of the invention for inducing an immune response can be used to treat any animal species having an immune response upon treatment with flagellin polypeptide, peptide, or modification thereof, and for which a stimulation of an immune response is desired. Such animals include avian species such as chicken, and mammalian species such as rodent, canine, feline, bovine, porcine and human subjects. Methods for using adjuvants with vaccines and vaccinating animals are well known in the art and are routinely used in laboratory animals. Those skilled in the art will be able to determine if a particular animal species has a flagellin-stimulated TLR5-mediated innate immune response.

[0089]A vaccine to be used in the methods of the invention for inducing an immune response can be administered as a solution or suspension together with a pharmaceutically acceptable medium. Such a pharmaceutically acceptable medium can be, for example, water, phosphate buffered saline, normal saline or other physiologically buffered saline, or other solvent or vehicle such as glycol, glycerol, and oil such as olive oil or an injectable organic ester. A pharmaceutically acceptable medium can also contain liposomes or micelles, and can contain immunostimulating complexes prepared by mixing polypeptide or peptide antigens with detergent and a glycoside, such as Quil A. Further methods for preparing and administering an immunomodulatory flagellin polypeptide or peptide, or modification in a pharmaceutically acceptable medium are presented below, in reference to compounds that induce a TLR-mediated response.

[0090]The immunomodulatory flagellin polypeptides, peptides and modifications thereof used in the methods of the invention can be administered by a variety of routes to stimulate an immune response. For example, these immunomodulatory molecules can be delivered intranasally, subcutaneously, intradermally, intralymphatically, intramuscularly, intratumorally, orally, intravesically, intraperitoneally and intracerebrally. Oral administration is convenient and relatively safe. Oral vaccination protocols can be useful for inducing the state of immunological tolerance which normally occurs in response to most soluble antigens and the proteolytic degradation of antigen preparations in the digestive tract. Nasal delivery routes may be useful for inducing both mucosal and systemic immune responses. A variety of devices are under development for convenient and effective delivery of formulations to the nasal cavity and pulmonary tissues. Those skilled in the art will know how to select appropriate delivery routes for particular formulations of flagellin polypeptides, peptides and modifications thereof.

[0091]The invention provides a screening composition consisting of an immunomodulatory flagellin peptide comprising at least about 10 amino acids of substantially the amino acid sequence GAVQNRFNSAIT (SEQ ID NO:2), or a modification thereof, and having toll-like receptor 5 (TLR5) binding, and a TLR5. The composition is useful for identifying agonists, antagonists and ligands for TLR5. The characteristics of an immunomodulatory flagellin peptide comprising at least about 10 amino acids of substantially the amino acid sequence GAVQNRFNSAIT (SEQ ID NO:2), or a modification thereof, and having toll-like receptor 5 (TLR5) binding, and preparation of a flagellin peptide are described herein. Similarly, the characteristics of a TLR5 polypeptide and modifications thereof that have a TLR5 activity, and methods for preparing a TLR5 polypeptide to be used in the methods of the invention are described herein. Chimeric TLR5s, such as the CD4-TLR5 described herein in Example I, are included in the screening compositions of the invention.

[0092]The screening composition of the invention includes, for example, cells, cell extracts and artificial signaling systems that contain a TLR5 polypeptide or modification thereof. The cell compositions of the invention include any cell in which TLR5 can couple to a signal transduction pathway to produce a detectable signal in response to an agonist, such as flagellin or a flagellin peptide. Such cells include insect cells such as Drosophila cells, yeast cells such as S. cerevisiae, prokaryotic cells such as E. coli, amphibian cells such as Xenopus oocytes, and vertebrate cells such as mammalian primary cells, such as macrophages. Primary cells such as macrophages and other lymphocytes can be conveniently isolated from blood using methods well known in the art. Cells obtained from transgenic animals, such as transgenic mice that have been engineered by known methods of express recombinant TLR5 or TLR5 signal transduction components are also included in the screening compositions of the invention. Cell lines prepared from any of theses cell types, such as S2, CHO, NIH-3T3, 293 and HeLa cells are also included in a screening composition of the invention.

[0093]The screening compositions of the invention can include crude or partially purified lysates or extracts of the cell compositions of the invention, and reconstituted signaling systems. Artificial signaling systems include, for example, natural or artificial lipid bilayers, such as a liposome or micelle, which promote an active conformation of a TLR5. The compositions can further contain cellular fractions or isolated components necessary for producing and detecting the desired predetermined signal.

[0094]The invention provides a method of screening for a TLR5 ligand, agonist or antagonist. The method involves, (a) contacting a TLR5 with a candidate compound in the presence of a flagellin polypeptide or immunomodulatory flagellin peptide under conditions wherein binding of the flagellin polypeptide or immunomodulatory flagellin peptide to the TLR5 produces a predetermined signal; (b) determining the production of the predetermined signal in the presence of the candidate compound; and (c) comparing the predetermined signal in the presence of the candidate compound with a predetermined signal in the absence of the candidate compound, wherein a difference between the predetermined signals in the presence and absence of the candidate compound indicates that the compound is a TLR5 ligand, agonist or antagonist.

[0095]TLR5 can produce a variety of predetermined signals useful in the methods of the invention for identifying a TLR5 ligand, agonist or antagonist. TLR5 has an extracellular domain that participates in ligand recognition and intracellular domain that contain a conserved region called the Toll/IL-1R homology (TIR) domain that, upon activation, recruits an adaptor protein, MyD88. Through an amino terminal death domain, MyD88 recruits the serine kinase IRAK to propagate a pro-inflammatory signal through binding to TRAF6, which then binds to other molecules that participate in the TLR5 signaling cascade. Immunomodulatory flagellin peptides and modifications binding to TLR5 induces signal transduction events which result in, for example, stimulating NF-κB activity and inducing production of gene products of NF-κB-regulated genes, such as TNFα, IL-1 and IL-6, as well as stimulating AP-1 transcription factors fos and jun. Therefore, a predetermined signal can include a signal produced by an immunomodulatory flagellin polypeptide or peptide or modification binding to TLR5, a signal produced by a TLR5 intracellular signal transduction even, such as kinase or phosphatase activity or protein-protein interactions, by activation of fos, jun or NF-κB, and by an amount or activity of a fos-, jun- or NF-κB-regulated gene or gene product, such as TNFα, IL-1 and IL-6.

[0096]A variety of low- and high-throughput assays suitable for detecting selective binding interactions between a receptor and a ligand are known in the art. Both direct and competitive assays can be performed, including, for example, fluorescence correlation spectroscopy (FCS) and scintillation proximity assays (SAP) reviewed in Major, J. Receptor and Signal Transduction Res. 15:595-607 (1995); and in Sterrer et al., J. Receptor and Signal Transduction Res. 17:511-520 (1997)). Other assays for detecting binding interactions include, for example, ELISA assays, FACS analysis, and affinity separation methods. Such assays can involve labeling a TLR5 ligand, such as flagellin or a flagellin peptide, with a detectable moiety such as a radiolabel, fluorochrome, ferromagnetic substance, or luminescent substance. A detectably labeled flagellin polypeptide or peptide can be prepared using methods well known in the art. Receptor binding assays, including high-throughput automated binding assays, and methods of determining binding affinity from such assays, are well known in the art, and any suitable direct or competitive binding assay can be used. Exemplary high-throughput receptor binding assays are described, for example, in Mellentin-Micelotti et al., Anal. Biochem. 272:P182-190 (1999); Zuck et al., Proc. Natl. Acad. Sci. USA 96:11122-11127 (1999); and Zhang et al., Anal. Biochem. 268; 134-142 (1999).

[0097]A variety of methods well known in the art can be used to detect activation of transcription factors, such as NF-κB, in low- or high-throughput formats. The methods described herein and in the Examples can be adapted to formats suitable for candidate compound screening.

[0098]A variety of low- and high-throughput assays suitable for detecting amounts and activities of polypeptides such as cytokines are known in the art. Methods for detecting polypeptides, include, for example, flow cytometric measurements as described herein, immunodetection methods such as radioimmune assay (RIA), ELISA, immunoprecipitation and Western blotting. Assay of the activity of a cytokine include function bioassays and detection of amounts of polypeptides regulated by a particular cytokine. Those skilled in the art can determine an appropriate method for detecting an activity of a particular cytokine.

[0099]Suitable conditions under which TLR5 produces a predetermined signal in response to a flagellin polypeptide, peptide or modification can be determined by those skilled in the art, and will depend on the particular predetermined signal selected. Exemplary conditions for determining the production of a predetermined signal are provided herein in Examples I-IV. Any known or predicted TLR5-mediated cellular event, such as elicitation of second messengers, induction of gene expression or altered cellular proliferation, differentiation or viability can be a predetermined signal that is an indication of activation of signal transduction through TLR5.

[0100]Assays for detecting a predetermined signal produced by binding of flagellin or flagellin peptide to TLR5 can be performed, for example, with whole cells that express TLR5, membrane fractions, or artificial systems, as described herein, or with isolated TLR5 polypeptide, either in solution, in an artificial membrane, or bound to a solid support.

[0101]A method of identifying TLR5 agonists and antagonists can be performed either in the presence of a predetermined concentration of a known TLR5 agonist, such as flagellin, flagellin peptide, or modifications thereof, or in the absence of agonist. The agonist can be added either prior to, simultaneously with, or after, addition of the test compound. When present, the agonist concentration is preferably within 10-fold of its EC50 under the assay conditions to allow the identification of a compound that competes with a known agonist for signaling through TLR5, or indirectly augments signaling through the receptor. Likewise, a compound that reduces binding between a known agonist and its receptor, or indirectly decreases signaling through the receptor, can also be identified.

[0102]The method of screening to identify a ligand, agonist or antagonist of TLR5 involve testing a candidate compound. A candidate compound can be any substance, molecule, compound, mixture of molecules or compounds, or any other composition. The candidate compounds can be small molecules or macromolecules, such as biological polymers, including proteins, polysaccharides and nucleic acids. Sources of candidate compounds which can be screened for a ligand, agonist or antagonist of TLR5 include, for example, libraries of small molecules, peptides and polypeptides.

[0103]Additionally, candidate compounds can be preselected based on a variety of criteria. For example, suitable candidate compounds can be selected as having known ligand, agonist or antagonist activity. Alternatively, candidate compounds can be selected randomly. Candidate compounds can be administered to the reaction system at a single concentration or, alternatively, at a range of concentrations to determine, for example, an EC50 or IC50 of a candidate compound.

[0104]The method of screening for TLR5 ligands, agonists or antagonists can involve groups or libraries of compounds. Methods for preparing large libraries of compounds, including simple or complex organic molecules, carbohydrates, peptides, peptidomimetics, polypeptides, nucleic acids, antibodies, and the like, are well known in the art. Libraries containing large numbers of natural and synthetic compounds can be obtained from commercial sources.

[0105]The number of different candidate compounds to examine using the methods of the invention will depend on the application of the method. It is generally understood that the larger the number of candidate compounds, the greater the likelihood of identifying a compound having the desired activity in a screening assay. Large numbers of compounds can be processed in a high-throughput automated format.

[0106]The TLR5 agonists, antagonists and ligands identified using the methods and compositions described herein, are potential therapeutic compounds that can be administered to an individual, such as a human or other mammal, in an effective amount to increase or decrease signaling through TLR5, for example, to alter an immune response or treat a TLR5-associated condition. Such compounds can be used analogously to immunomodulatory compounds useful for augmenting and altering an immune response, as described above. For example, a compound can be used to induce a general immune response and to induce a specific immune response in the presence of an antigen and to alter the level of a particular cytokine in an individual having a pathological condition.

[0107]The TLR5 agonists and antagonists, immunomodulatory flagellin peptides, polypeptides and modifications thereof, are useful for ameliorating, or reducing the severity of a pathological condition. Reduction in severity includes, for example, an arrest or decrease in clinical symptoms, physiological indicators, biochemical markers or metabolic indicators of disease. Those skilled in the art will know, or will be able to determine the appropriate clinical symptoms, physiological indicators, biochemical markers or metabolic indicators to observe for a particular pathological condition. To prevent a disease means to preclude the occurrence of a disease or restoring a diseased individual to their state of health prior to disease.

[0108]In addition to applications described herein for agonists and antagonists, a TLR5 ligand can be used, for example, to specifically target a diagnostic moiety to cells and tissues that express TLR5, such as monocytes, immature dendritic cells, epithelial cells, and other cells involved in an immune response. Thus, a TLR5 ligand can be labeled with a detectable moiety, such as a radiolabel, fluorochrome, ferromagnetic substance, or luminescent substance, and used to detect normal or abnormal expression of TLR5 polypeptide in an isolated sample or in vivo diagnostic imaging procedures.

[0109]A heterologous amino acid sequence can be advantageously used to provide a tag for detection or purification or to impart an activity to a reference polypeptide or peptide, such as an enzyme activity, biological activity, an immunological activity or stability. An immunomodulatory flagellin peptide, polypeptide or modification thereof, or TLR5 polypeptide can contain a heterologous amino acid sequence, or amino acid sequence not present in the native amino acid sequence of a reference polypeptide or peptide and not represented by a modification of a reference polypeptide or peptide. A heterologous amino acid sequence can be of any size in relation to the reference amino acid sequence. A TLR5 polypeptide containing the heterologous sequence of CD4 is a specific example of such a modification and is described further in Example I. The described CD4-TLR5 chimera is identified by the amino acid sequence of SEQ ID NO:10, encoded by the nucleic acid sequence of SEQ ID NO:9. A chimeric TLR5 can be prepared using cloning methods well known in the art. For example, a chimeric polypeptide can be produced by amplifying by PCR a nucleotide sequence encoding a portion of a selected polypeptide using sequence specific primers. Primers useful for amplifying a TLR5 include, for example, huTLR5-A6: TTAAAGTGGTACCAGTTCTCCCTTTTCATTGT ATGCACT (SEQ ID NO:35) and huTLR5DNS: CGGGATCCCGTTAGGAG ATGGTTGCTACAGTTTGC (SEQ ID NO:36). A portion of a TLR5 nucleotide sequence, such as a sequence amplified using such primers can be fused to a nucleotide sequence encoding a heterologous amino acid sequence. A variety of methods for generating nucleic acid sequences encoding chimeric polypeptides are well known to those skilled in the art.

[0110]The polypeptides and peptides described herein, including immunomodulatory flagellin peptides, flagellin polypeptide, TLR5 polypeptides and fragments thereof can be prepared using a variety of protein expression systems well known in the art, including prokaryotic and eukaryotic expression systems. Prokaryotic expression systems are advantageous due to their ease in manipulation, low complexity growth media, low cost of growth media, rapid growth rates and relatively high yields. Well known prokaryotic expression systems include, for example, E. coli bacterial expression systems based on bacteriophage T7 RNA polymerase, the trc promoter, the araB promoter and bacillus expression. Eukaryotic expression systems are advantageous because expressed polypeptides can contain eukaryotic post-translational modifications such as O-linked glycosylation, phosphorylation and acetylation and can have improved protein folding. Well known eukaryotic expression systems include, for example, expression in yeast, such as Pichia pastoris and Pichia methanolica, expression in insect systems such as the Drosophila S2 system and baculovirus expression systems and expression in mammalian cells using adenoviral vectors and cytomegalovirus promoter-containing vectors.

[0111]An immunomodulatory flagellin peptide, polypeptide, TLR5 or fragments thereof can be purified using a variety of methods of protein purification well known in the art. Biochemical purification can include, for example, steps such as solubilization of the polypeptide or peptide-expressing cell, isolation of the desired subcellular fractions, chromatography, such as ion exchange, size, or affinity-based chromatographies, electrophoresis, and immunoaffinity procedures. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology Vol. 182, (Academic Press, (1990)). An exemplary method for purifying a flagellin peptide is provided in Example III. The methods and conditions for biochemical purification of a polypeptide of the invention can be chosen by those skilled in the art, and the purification monitored, for example, by staining SDS-PAGE gels containing protein samples, by immunodetection methods such as Western blotting and ELISA, and by functional assay of immunogenic activity of flagellin or a TLR5 activity of TLR5.

[0112]An immunomodulatory flagellin peptide, polypeptide, TLR5 or fragments thereof can be modified, for example, to increase polypeptide stability, alter an activity, facilitate detection or purification, or render the enzyme better suited for a particular application, such as by altering substrate specificity. Computer programs known in the art can be used to determine which amino acid residues of a immunomodulatory flagellin peptide, flagellin polypeptide or TLR5 can be modified as described above without abolishing a corresponding activity (see, for example, Eroshkin et al., Comput. Appl. Biosci. 9:491-497 (1993)). In addition, structural and sequence information can be used to determine the amino acid residues important for activity. For example, a comparisons of flagellin amino acid sequences, such as that shown in FIG. 7 can provide guidance in determining amino acid residues that can be altered without abolishing flagellin or flagellin peptide activity by indicating amino acid residues that are conserved across species. Conserved regions of flagellin are well known in the art and have been described, for example, in Mimori-Kiyosue, et al., J. Mol. Viol. 270:222-237, (1997). A crystal structure of flagellin can also provide guidance for making flagellin modifications (Samatey et al. Nature, 410:331-337 (2001)). Similarly, amino acid sequence comparisons between the disclosed murine TLR5, TLR5s of other species, and other toll-like receptor family members can provide guidance for determining amino acid residues important for activity.

[0113]An isolated TLR5 is a TLR5 removed from one or more components with which it is naturally associated. Therefore, an isolated TLR5 can be a cell lysate, cell fraction, such as a membrane fraction, or a purified. TLR5 polypeptide. An isolated TLR5 can include a liposome or other compound or matrix that stabilizes or promotes an active conformation of the receptor.

[0114]For treating or reducing the severity of a pathological condition a TLR5 agonist or antagonist, immunomodulatory flagellin peptide, polypeptide or modification thereof, including a vaccine, can be formulated and administered in a manner and in an amount appropriate for the condition to be treated; the weight, gender, age and health of the individual; the biochemical nature, bioactivity, bioavailability and side effects of the particular compound; and in a manner compatible with concurrent treatment regimens. An appropriate amount and formulation for a particular therapeutic application in humans can be extrapolated based on the activity of the compound in recognized animal models of the particular disorder.

[0115]Animal models of aberrantly proliferative diseases can be used to assess a formulation of compound, including a vaccine or adjuvant containing an immunomodulatory flagellin peptide, polypeptide or modification thereof, for an amount sufficient to induce an immune response or ameliorate disease symptoms. Animal models of such pathological conditions well known in the art which are reliable predictors of treatments in human individuals for include, for example, animal models for tumor growth and metastasis, infectious diseases and autoimmune disease.

[0116]There are numerous animal tumor models predictive of therapeutic treatment which are well known in the art. These models generally include the inoculation or implantation of a laboratory animal with heterologous tumor cells followed by simultaneous or subsequent administration of a therapeutic treatment. The efficacy of the treatment is determined by measuring the extent of tumor growth or metastasis. Measurement of clinical or physiological indicators can alternatively or additionally be assessed as an indicator of treatment efficacy. Exemplary animal tumor models can be found described in, for example, Brugge et al., Origins of Human Cancer, Cold Spring Harbor Laboratory Press, Plain View, N.Y., (1991).

[0117]Similarly, animal models predictive for infectious disease also follow a similar approach. Briefly, laboratory animals are inoculated with an infectious agent and the progression of the infection is monitored by, for example, clinical symptoms, growth culture of the agent from an infected tissue sample or biopsy in the presence or absence of the therapeutic treatment. The reduction in severity of the diagnostic indicator is indicative of the efficacy of the treatment. A variety of animal models for infectious diseases are well known to those skilled in the art.

[0118]One animal model predictive for autoimmune diseases is Experimental allergic encephalomyelitis (EAE), also called experimental autoimmune encephalomyelitis. Although originally characterized as a model for neurological autoimmune disease such as human multiple sclerosis, the use of this model to predict treatments of other autoimmune diseases has been widely accepted. EAE is induced in susceptible animals by active immunization with myelin basic protein (MPB) or by passive transfer of MBP-specific T helper lymphocytes. Progression of the disease is characterized by chronic relapsing paralysis and central nervous system demyelination, which can be monitored by observation or by immunological determinants such as delayed-type hypersensitivity (DTH; a measure of cell mediated immunity) response to the immunogen. Efficacy of a therapeutic treatment is compared to progression of the disease in the absence of treatment. A reduction in severity of EAE symptoms or immunological determinants in treated animals is indicative of the efficacy of the therapeutic treatment. For a review of autoimmune disease models see, for example, Urban et al., Cell, 54:577-592 (1988); Brostoff et al., Immunol. Ser. 59:203-218 (1993) and U.S. Pat. Nos. 5,614,192 and 5,612,035.

[0119]A growing number of human diseases have been classified as autoimmune and include, for example, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, psoriasis, systemic lupus erythmatosis, autoimmune thyroiditis, Graves' disease, inflammatory bowel disease, autoimmune uveoretinitis, polymyositis and diabetes. Animal models for many of these have been developed and can be employed analogously as the EAE model described above predictive assessment of therapeutic treatments using the compounds, vaccines and adjuvants in the methods of the invention.

[0120]Other reliable and predictive animal models are well known in the art and similarly can be used to assess a compound formulation, including vaccine and adjuvant formulations containing an immunomodulatory flagellin peptide, polypeptide or modification thereof.

[0121]The total amount of a compound including an immunomodulatory flagellin peptide, polypeptide or modification thereof, that modulates a TLR5-mediated immune response can be administered as a single dose or by infusion over a relatively short period of time, or can be administered in multiple doses administered over a more prolonged period of time. Additionally, a compound can be administered in a slow-release matrix, which can be implanted for systemic delivery at or near the site of the target tissue.

[0122]A compound that modulates a TLR5-mediated immune response can be administered to an individual using a variety of methods known in the art including, for example, intravenously, intramuscularly, subcutaneously, intraorbitally, intracapsularly, intraperitoneally, intracisternally, intra-articularly, intracerebrally, orally, intravaginally, rectally, topically, intranasally, or transdermally.

[0123]A compound that modulates a TLR5-mediated immune response can be administered to a subject as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier. The choice of pharmaceutically acceptable carrier depends on the route of administration of the compound and on its particular physical and chemical characteristics. Pharmaceutically acceptable carriers are well known in the art and include sterile aqueous solvents such as physiologically buffered saline, and other solvents or vehicles such as glycols, glycerol, oils such as olive oil and injectable organic esters. A pharmaceutically acceptable carrier can further contain physiologically acceptable compounds that stabilize the compound, increase its solubility, or increase its absorption. Such physiologically acceptable compounds include carbohydrates such as glucose, sucrose or dextrans; antioxidants, such as ascorbic acid or glutathione; chelating agents; and low molecular weight proteins. As described above in reference to vaccines, such routes of administration are also applicable to administration of an immunomodulatory flagellin peptide, polypeptide or modification thereof.

[0124]In addition, a formulation of a compound that modulates a TLR5-mediated immune response can be incorporated into biodegradable polymers allowing for sustained release of the compound, the polymers being implanted in the vicinity of where drug delivery is desired, for example, at the site of a tumor or implanted so that the compound is released systemically over time. Osmotic minipumps also can be used to provide controlled delivery of specific concentrations of a compound through cannulae to the site of interest, such as directly into a tumor growth or other site of a pathology involving a perturbation state. The biodegradable polymers and their use are described, for example, in detail in Brem et al., J. Neurosurg. 74:441-446 (1991). These methods, in addition to those described above in reference to vaccines, are applicable to administering an immunomodulatory flagellin peptide, polypeptide or modification thereof to induce an immune response.

[0125]The methods of treating a pathological condition additionally can be practiced in conjunction with other therapies. For example, for treating cancer, the methods of the invention can be practiced prior to, during, or subsequent to conventional cancer treatments such as surgery, chemotherapy, including administration of cytokines and growth factors, radiation or other methods known in the art. Similarly, for treating pathological conditions which include infectious disease, the methods of the invention can be practiced prior to, during, or subsequent to conventional treatments, such as antibiotic administration, against infectious agents or other methods known in the art. Treatment of pathological conditions of autoimmune disorders also can be accomplished by combining the methods of the invention for inducing an immune response with conventional treatments for the particular autoimmune diseases. Conventional treatments include, for example, chemotherapy, steroid therapy, insulin and other growth factor and cytokine therapy, passive immunity and inhibitors of T cell receptor binding. The methods of the invention can be administered in conjunction with these or other methods known in the art and at various times prior, during or subsequent to initiation of conventional treatments. For a description of treatments for pathological conditions characterized by aberrant cell growth see, for example, The Merck Manual, Sixteenth Ed, (Berkow, R., Editor) Rahway, N.J., 1992.

[0126]As described above, administration of a compound, immunomodulatory flagellin peptide, flagellin polypeptide or modification thereof can be, for example, simultaneous with or delivered in alternative administrations with the conventional therapy, including multiple administrations. Simultaneous administration can be, for example, together in the same formulation or in different formulations delivered at about the same time or immediately in sequence. Alternating administrations can be, for example, delivering an immunomodulatory flagellin peptide or polypeptide formulation and a conventional therapeutic treatment in temporally separate administrations. As described previously, the temporally separate administrations of a compound, immunomodulatory flagellin peptide, polypeptide or modification thereof, and conventional therapy can similarly use different modes of delivery and routes.

[0127]The invention provides a method of using a signal produced in response to flagellin binding to TLR5 to detect bacterial contamination in a sample. The method can be used to detect picogram amounts of flagellin in a sample.

[0128]Food-born diseases resulting from the presence of harmful bacteria account for 325,000 hospitalizations and 5,000 deaths each year in the United States (National Institutes of Health, Foodborne Diseases NIAID Fact Sheet). The U.S. Centers for Disease Control and Prevention (CDC) estimates that 1.4 million people in the United States are infected each year with Salmonella. Other bacterial pathogens that cause pathological conditions characterized by symptoms ranging from intestinal discomfort to severe dehydration, bloody diarrhea and even death, include enterohemorrhagic E. coli, such as strains designated O157:H7 and O26:H11, Campylobacter strains such as C. jejuni, and Shigella strains such as S. flexneri.

[0129]All of these bacterial strains are flagellated, and therefore express flagellin polypeptides. For example, the amino acid sequences of flagellins from Salmonella, E. coli, Campylobacter, Shigella strains are shown in FIG. 7. The methods of the invention for detecting flagellin polypeptides contained in samples suspected of bacterial contamination can be applied to quality assurance protocols for preparation of foods and numerous other applications.

[0130]The invention also provides a bioassay for detecting bacterial contamination in a sample. The method involves, (a) contacting the sample with a TLR5 under conditions wherein binding of a flagellin polypeptide or fragment thereof in the sample to the TLR5 produces a predetermined signal, (b) determining the production of the predetermined signal in the presence and absence of the sample, and (c) comparing the predetermined signal in the presence of the sample with a predetermined signal in the absence of the sample, wherein a difference between the predetermined signals in the presence and absence of the sample indicates that the sample contains flagellin.

[0131]The methods of the invention for detecting bacterial contamination are based on the finding disclosed herein that flagellin is a ligand for TLR5. Therefore, a flagellin molecule in a sample can bind to a TLR5 and elicit the production of a predetermined signal. A predetermined signal produced by TLR5 in a particular assay system is compared in the presence and absence of a sample known or suspected of containing a bacterial contaminant. A sample known to be free of flagellin can be used as a negative control, while a sample containing a known concentration of flagellin, flagella or bacteria having flagella can be used as a positive control.

[0132]A sample to be tested for the presence of flagellin can be any material that is suspected of being contaminated with a gram-positive or gram-negative flagellated bacterium. For example, the method for determining the presence of flagellin can be performed using a sample of a biological fluid, cell, tissue, organ or portion thereof, such as a sample of a tissue to be used for preparing a product, a product for human or animal consumption, such as a food or pharmaceutical preparation, and a product for external application or administration by any route to an animal.

[0133]A variety of predetermined signals produced by a TLR5, as discussed above and in the Examples herein, can be used to detect the binding and activation of a TLR5 by a flagellin molecule present in a sample. A variety of methods known in the art, including those described herein can be used to detect a predetermined signal produced by a TLR5.

[0134]It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also included within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.

Example I

Constitutively Active TLR5 Activates NF-κB and TNFα Production

[0135]This example shows activation of NF-κB and TNFα production in CHO cells in response to constitutively active TLR5.

[0136]To determine if TLR5 activates NF-κB and TNFα production, the activity of a constitutively active form of TLR5 was examined in CHO cells. Constitutively active forms of TLR4 and TLR5 were generated by fusing the extracellular domain of CD4 to the transmembrane and TIR domain of TLR4 or TLR5 (Medzihitov, R. et al. Nature 388, 394-7 (1997); Ozinsky, A. et al., Proc. Natl. Acad. Sci. 97, 13766-13881 (2000)). CD4-TLR5 was constructed by fusing the murine CD4 extracellular domain (amino acids 1-391) to the putative transmembrane and cytoplasmic domains of human TLR5 (amino acids 639-859) and cloning into pEF6-TOPO (pEF6-mCD4-hTLR5). These chimeras, referred to as CD4-TLR4 and CD4-TLR5 were expressed in CHO cells.

[0137]For determining NF-κB activity in response to TLR5, CHO cells were transiently transfected with expression vectors for CD4-TLR4, CD4-TLR5, or empty expression vector (control) together with an NF-κB luciferase reporter. NF-κB-induced luciferase activity was measured. CHO cells (CHO-K1) were obtained from ATCC (no. CRL.-9618) and grown in Ham's F-12 medium supplemented with 10% FBS, L-glutamine, penicillin, and streptomycin. CHO cells were transfected by electroporation as described previously (Underhill, D. M. et al., Nature, 401, 811-5 (1999)), with 1 μg of the indicated TLR expression vector, 1 μg of ELAM-firefly luciferase, 0.1 μg of TK-renilla luciferase (Promega). Cells were plated on 96-well plates at 100,000 cells/well, and incubated overnight at 37° C., 5% CO₂. Firefly and renilla luciferase activities were measured using the Dual Luciferase Assay System (Promega, Madison, Wis.). Luciferase activity is expressed as a ratio of NF-κB-dependent ELAM-firefly luciferase activity divided by control thymidine kinase-renilla luciferase activity (relative luciferase units).

[0138]For determining TNFα production in response to TLR5, RAW-TTIO Macrophage cells were transfected with a CD4-TLR5 expression vector, and the production of TNFα was measured by flow cytometry, as described previously (Ozinsky, A. et al. Proc. Natl. Acad. Sci. 97, 13766-13771 (2000)). Transfections were performed by electroporation using 10 μg of pEF6-mCD4-hTLR5, and 18 hours later the cells were incubated with 5 μg/ml of brefeldin A for 4 hours to accumulate intracellular pools of newly synthesized TNFα. Cells were fixed, permeabilized, stained for the expression of CD4 (anti-CD4-FITC, Pharmingen) and TNFα (anti-murine TNFα-PE, Pharmingen), and analyzed on a FACscan (Beckton-Dickenson). FACS data were analyzed with WinMDI (Joseph Trotter, Scripps Research Institute, La Jolla, Calif.). Cells were gated to exclude dead cells and for expression of CD4.

[0139]FIG. 1 shows that expression of CD4-TLR5 induced NF-κB activation-mediated luciferase production in CHO cells (FIG. 1a) and TNFα production in mouse macrophages (FIG. 1 b). In FIG. 1b, the dotted line indicates TNFα produced in cells not expressing CD4-TLR5, and the solid line indicates TNFα produced in cells expressing CD4-TLR5.

[0140]Thus, homo-oligomerization of the TLR5 signaling domain induces a cellular signal characterized by the induction of NF-κB activity and production of TNFα.

Example II

Bacterial Culture Supernatants Contain TLR5-Stimulating Activity

[0141]This Example shows that bacterial culture supernatants contain TLR5-stimulating activity.

[0142]CHO cells expressing human TLR5 and luciferase-linked reporter were used to screen for PAMPs recognized by the receptor. PAMPS tested included LPS, lipopeptide, yeast, and extracts from E. coli, Pseudomonas, and Listeria. CHO cells were transiently transfected with TLR2, TLR5, or empty expression vectors together with a NF-κB luciferase reporter. The cells were treated with 100 ng/ml LPS, 100 ng/ml lipopeptide, 10⁷ yeast particles/ml, or untreated (control), and luciferase activity was measured. The cells were treated with 67 μg/ml of supernatant from the indicated saturated bacterial cultures, or LB alone (control), and the luciferase activity was measured. Data are representative of 3 independent experiments.

[0143]Human TLR5 and TLR2 were generated by PCR from cDNA derived from human peripheral blood mononuclear cells and cloned into pEF6-TOPO (Invitrogen) (pEF6-hTLR5 and pEF6-hTLR2). Murine TLR5 was generated by PCR using cDNA derived from RAW-TTlO cells and cloned into pEF6 (pEF6-mTLR5).

[0144]For luciferase assays, CHO cells were transfected by electroporation as described above, with 1 μg of the indicated TLR expression vector, 1 μg of ELAM-firefly luciferase, 0.1 μg of TK-renilla luciferase (Promega, Madison, Wis.). The medium was replaced with medium containing the stimuli at the indicated concentration/dilution. Bacterial lipopeptide and PAM₃CSK₄, were obtained from Roche, LPS (Salmonella minnesota R595) was from List, and yeast particles (zymosan) were from Molecular Probes (Eugene, Oreg.). Cells were stimulated for 5 hours at 37° C., and firefly and renilla luciferase activities were measured using the Dual Luciferase Assay System (Promega).

[0145]For preparation of bacterial supernatants, bacteria were grown either in Luria broth (LB) (Escherichia coli TOP 10 (Invitrogen), Salmonella minnesota (ATCC#49284), mutant Salmonella typhimurium (TH4778 fliB- fliC+), TH2795 (fliB- fliC-), (Dr. Kelly Hughes, University of Washington), or grown in trypticase soy broth (TSB) (Listeria monocytogenes (10403, gift of Dr. Daniel Portnoy, UCSF), Listeria innocua (ATCC#33090), Bacillus subtilis, and Pseudomonas aeruginosa (Susan R. Swanzy, University of Washington)). Bacteria were grown to saturation (about 16 hours, 37° C. with vigorous aeration). The bacterial culture supernatants were centrifuged for 30 minutes at 2000×g, filtered (0.2 μM), and stored at 4° C. prior to use. For flaA transfections, E. coli TOP10 containing pTrcHis2-flaA or pTrcHis2-flaArev were selected from bacterial plates and grown to OD₆₀₀ of 0.6 in LB with 100 μg/ml ampicillin and 1% w/v glucose. The bacteria were centrifuged for 30 minutes at 2000×g, and split into two LB cultures, one containing 100 μg/ml ampicillin and 1% w/v glucose (to repress flaA) and the other containing 100 μg/ml ampicillin and 1 mM IPTG (to induce flaA). Samples were taken at 4 hours after induction, centrifuged 5 min at 10,000×g, and the supernatants stored at 4° C. before use.

[0146]TLR5 did not respond to any of the PAMPs known to stimulate TLR pathways, such as LPS, lipopeptide, yeast cell wall, or peptidoglycan, while CHO cells transfected with TLR2 were stimulated by lipopeptide, yeast cell wall, and peptidoglycan (FIG. 2a). However, TLR5-stimulating activity was detected in culture supernatants of a variety of Gram-positive and Gram-negative bacteria (FIG. 2B). The TLR5-stimulating activity of Gram-positive bacteria was not enhanced by co-expression of CD14. Interestingly, the TOP10 strain of E. coli had very little TLR5 activity (FIG. 2B), and was used in subsequent reconstitution experiments (see below). Experiments using murine TLR5 yielded similar results.

[0147]Thus, the activity of TLR5 was stimulated by a component of bacterial culture supernatants, but not by PAMPs known to stimulate other toll like receptor family members.

Example III

Purification of TLR5-Stimulating Activity from L. monocytogenes Culture Supernatant

[0148]This Example shows the purification of TLR5-simulating activity from L. monocytogenes culture supernatant.

[0149]The biological activity recognized by TLR5 was determined to be TCA precipitable, phenol soluble, and sensitive to proteinase K and trypsin digestion. To identify the bacterial components that stimulate TLR5, the supernatant from a saturated L. monocytogenes culture was concentrated, fractionated by reverse-phase chromatography, and each fraction was assessed for TLR5-stimulating activity in CHO cells (FIG. 3a).

[0150]For assessing the TLR-stimulating activity of FPLC fractions, CHO cells were transfected as described in Example I with the addition of 0.1 μg of pNeo/Tak (Underhill et al., Nature 401, 811-5 (1999)), and stable populations of cells expressing the indicated TLR with the luciferase reporters were selected in 100 μg/ml G418. These cells were plated on 96-well plates at 100,000 cells/well and incubated overnight.

[0151]For the purification of the TLR5-stimulating activity, saturated L. monocytogenes culture (200 ml of TSB) was centrifuged, and the supernatant was enriched for molecules larger than 30 kDa by ultrafiltration (Ultrafree-15 filter unit with Biomax-30 membrane, Millipore). The buffer was changed to 100 mM Tris pH 7.5, and the volume was adjusted to 5 ml. The sample was loaded onto a HR5/10 reverse-phase chromatography column (AP Biotech) and run at 0.3 ml/min. Reverse-phase chromatography was performed with the indicated elution profile using the following buffers: (A) initial buffer, 0.1% TFA in water, (B) final buffer, 0.1% TFA in acetonitrile. Fractions were collected at 3-minute intervals. FPLC fractions (50 μl) were separated on a 10% SDS-PAGE gel.

[0152]As shown in FIG. 3a, CHO cells expressing an NF-κB luciferase reporter and TLR5 were stimulated with reverse-phase FPLC fractions, and TLR5-mediated NF-κB luciferase activity was measured. The fraction numbers correspond to 3 minute fractions of reverse-phase FPLC eluted with a non-linear gradient of buffer B as shown. Fraction number "N" is control LB growth medium and "P" is the L. monocytogenes culture supernatant prior to chromatography. Fractions containing background activity (1), low activity (2) and high activity (3) as indicated in FIG. 3a were analyzed by SDS-PAGE and silver stain. Silver staining was performed according to established methods. Two bands with apparent molecular masses of 30-34 kDa were clearly enriched in the fraction containing the highest level of TLR5-stimulating activity (FIG. 3B, Lane 3). Proteins eluted from regions A, B, and C of the SDS-PAGE gel, as indicated in FIG. 3B were assayed for TLR5-mediated NF-κB activation in CHO cells. In FIG. 3c, "Listeria" indicates L. monocytogenes culture supernatant. One of these bands, (FIG. 3B, band A), was trypsin-treated, subject to microcapillary HPLC-tandem mass spectrometry, and identified by comparison of peptide tandem mass spectra to sequences in a non redundant protein database using the computer program, SEQUEST27 (FIG. 4a). TLR5-stimulating activity was not recovered from any other section of the gel.

[0153]Thus, a TLR5-stimulating activity was purified from culture supernatants from L. monocytogenes.

Example IV

Flagellin is a TLR5 Stimulus

[0154]This example shows that flagellin is a TLR5 stimulus purified from culture supernatants from L. monocytogenes.

[0155]As described above, a TLR5-stimulating activity was purified from L. monocytogenes culture supernatants using HPLC. The isolated polypeptide of band A in FIG. 3B was trypsinized and identified by microcapillary HPLC-tandem mass spectrometry. Peaks corresponding to L. monocytogenes flagellin peptides are indicated in FIG. 4a. Five sequences were identified (FIG. 4a) that correspond to flagellin, the product of the flaA gene of L. monocytogenes (Genbank Q02551). The location of these sequences within the protein is indicated in FIG. 4B. Band B of FIG. 3B also is flagellin, which migrates as a doublet of approximately 30 kDa on SDS-PAGE (FIG. 3B).

[0156]For analysis, bands A and B were excised from SDS-PAGE gels, dehydrated with acetonitrile, dried under reduced vacuum, and trypsin (12.5 ng/μL) was infused into the gel. The gel slice was allowed to incubate on ice for 45 min in the presence of trypsin and then excess trypsin removed and replaced with 50 mM ammonium bicarbonate and the gel slice incubated overnight at 37° C. Peptides were extracted by 3 washes with 5% acetic acid in 50% aqueous acetonitrile. The extractions were pooled and concentrated by vacuum centrifugation. The peptides were injected onto a C18 peptide trap cartridge (Michrom BioResources, Inc. Auburn, Calif.), desalted, and then injected onto a 75 μm (internal diameter)×10 cm micro-capillary HPLC column (Magic C18; 5-μm packing; 100 A pore size; Michrom BioResources, Inc. Auburn, Calif.). The sample injection was made using a FAMAS autosampler (LCPackings, San Francisco, Calif.) coupled with an Agilent HP1100 Pump. Peptides were separated by a linear gradient of acetonitrile, and subjected to collision induced dissociation using an electrospray ionization-ion trap mass spectrometer (ESI-ITMS; ThermoQuest, San Jose, Calif.) in data-dependent mode with dynamic exclusion (Goodlett, et al. Anal. Chem. 72, 1112-1118 (2000)). Protein identification was accomplished by use of the SEQUEST computer program (Eng et al. J. Am. Soc. Mass. Spectrom. 5, 976-989 (1994)).

[0157]CHO cells expressing an NF-κB luciferase reporter and TLR5 or TLR2 were stimulated with 100 μl/ml Listeria supernatant or 33 μg/ml purified Salmonella flagellin. Flagellin was purified from Salmonella typhimurium (TH4778 fliB- fliC+) by the procedure of Ibrahim et al., J. Clin. Microbiol. 22, 1040-1044 (1985). As shown in FIG. 4c, flagellin stimulated TLR5-expressing CHO cells, but not TLR2-expressing CHO cells. The mean and standard deviation of quadruplicate samples are indicated. CHO cells were transfected as described in above Examples with the addition of 0.1 μg of pNeo/Tak, and stable populations of cells expressing the indicated TLR with the luciferase reporters were selected in 100 μg/ml G418. These cells were plated on 96-well plates at 100,000 cells/well, incubated overnight, and processed in luciferase assays as described above.

[0158]The observation that flagellin is the TLR5 ligand also is supported by the finding that the flagellated bacteria, L. monocytogenes and P. aeruginosa, stimulate TLR5, while the TOP10 strain of E. coli, that has lost its flagella, does not (FIG. 2B).

Similarly, TLR5-stimulating activity was found in B. subtilis, L. innocua, S. typhimurium and S. minnesota, all flagellated bacteria, while non-flagellated bacteria such as H. influenza, did not activate TLR5.

[0159]Thus, the TLR5-stimulating activity purified from L. monocytogenes culture supernatants was identified as flagellin by tandem mass spectrometry.

Example V

Flagellin Expression in Bacteria Reconstitutes TLR5-Stimulating Activity

[0160]This Example shows that flagellin expression in bacteria reconstitutes TLR-stimulating activity, and deletion of flagellin genes abrogates. TLR5-stimulating activity.

[0161]To confirm that flagellin is the sole TLR5 ligand in bacteria, E. coli (TOPlO) that secrete little TLR5 activity (FIG. 2B) were transformed with the cDNA of L. monocytogenes flagellin (flaA) under the control of an inducible promoter. TLR-expressing CHO cells were stimulated for 5 hours with E. coli culture supernatants (67 μl/ml) in which expression of L. monocytogenes flagellin was induced or repressed. In the control sample, CHO cells were stimulated with supernatants from induced E. coli containing the L. monocytogenes flagellin gene cloned in the reverse orientation. Supernatants of E. coli that were induced to express L. monocytogenes flaA contained substantial TLR5-stimulating activity (FIG. 5a), whereas supernatants from E. coli in which expression was repressed, or from E. coli expressing flaA in the reverse orientation, contained little TLR5 activity in CHO cells expressing an NF-κB luciferase reporter and TLR5 (FIG. 5A) or TLR2 (FIG. 5B). CHO cells expressing an NF-κB luciferase reporter and TLR5 (c) or TLR2 (d) were stimulated for 5 hours with culture supernatants (100 μl/ml) from S. typhimurium lacking one copy of flagellin (FliB- FliC+) or both copies of flagellin (FliB+ FliC+). Control is stimulation with LB medium. The mean and standard deviation of quadruplicate samples are indicated.

[0162]CHO cells were transfected with TLR2 and TLR5 expression plasmids as described above with the addition of 0.1 μg of pNeo/Tak, and stable populations of cells expressing the indicated TLR with the luciferase reporters were selected in 100 μg/ml G418. These cells were plated on 96-well plates at 100,000 cells/well, incubated overnight, and processed in luciferase assays as described above.

[0163]L. monocytogenes flagellin is not recognized by TLR2, since supernatants from E. coli expressing flaA did not show enhanced TLR2-dependent stimulation of CHO cells relative to supernatants from E. coli with repressed flaA expression (FIG. 5B). In addition to the experiments that demonstrate reconstitution of TLR5-stimulating activity by the expression of flagellin, a bacterium from which flagellin had been deleted was tested. It was observed that TLR5-stimulating activity was abrogated in the flagellin deleted strain. S. typhimurium possess two genes for flagellin, fliB and fliC (Fujita, J., J. Gen Microbiol. 76, 127-34 (1973)). Culture supernatants of fliB- fliC+S. typhimurium contained TLR5-stimulating activity, while culture supernatants from S. typhimurium lacking both flagellins (fliB- fliC-) expressed no TLR5-stimulating activity (FIG. 5c). The lack of both flagellin genes had no effect on TLR2-stimulating activity (FIG. 5d). The observed TLR2-stimulating activity found in S. typhimurium supernatants most likely was due to bacterial lipoproteins (Underhill, et al. Nature 401, 811-5 (1999); Brightbill et al., Science 285, 732-6 (1999)). These results indicate that flagellin is the sole TLR5-stimulating activity present in S. typhimurium culture supernatant.

[0164]Thus, TLR5-stimulating activity was elicited by introducing the flagellin gene into a non-flagellated bacterium, and abrogated by deleting the flagellin genes from a flagellated bacterium.

Example VI

Flagellin-Induced System IL-6 Production in Mice

[0165]This example shows that TLR signaling is required for the in vivo immune response to flagellin.

[0166]To determine if TLR signaling is required for the in vivo immune response to flagellin, wild type mice and mice lacking a component of the TLR5 signal transduction pathway, MyD88, were injected with flagellin and systemic IL-6 production was monitored. MyD88 is an adaptor protein required for TLR5-mediated signal transduction (Aderem A. and Ulevitch, R. J., Nature 406:782-787, (2000); Brightbill, H. D. and Modlin. R. L., Immunology 101:1-10, (2000)).

[0167]MyD88.sup.-/- mice (129/SvJ×C57B1/6 background) were backcrossed for three generations with C57B1/6 mice (Adachi, O. et al. Immunity, 9:143-150 (1998)). Mice from the F₃ generation (MyD88.sup.-/-, n=5) and littermate controls (MyD88.sup.+/+, n=5) were injected i.p. with 30 μg purified flagellin in 0.5 cc of saline. Blood was sampled at 0, 1, 2, 4 and 8 hours after injection, and IL-6 levels were determined by ELISA (Duoset, R&D Systems, Minneapolis, Minn.).

[0168]FIG. 6 shows that flagellin induced systemic IL-6 within 2 h in wile type mice. By contrast, mice deficient in MyD88 were completely unresponsive to flagellin.

[0169]Therefore, flagellin stimulates TLR5-mediated responses in vivo.

[0170]Throughout this application various publications have been referenced. The disclosures of these publications in their entireties are hereby incorporated by reference in this application in order to more fully describe the state of the art to which this invention pertains.

[0171]Although the invention has been described with reference to the disclosed embodiments, those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative of the invention. It should be understood that various modifications can be made without departing from the spirit of the invention.

Sequence CWU 1

43136DNASalmonella typhimurium flagellin 1ggtgcggtac agaaccgttt caactccgct attacc 36212PRTSalmonella typhimurium flagellin 2Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile Thr1 5 10312PRTArtificial Sequencesynthetic construct 3Gly Ala Val Ala Asn Arg Phe Asn Ser Ala Ile Thr1 5 10412PRTArtificial Sequencesynthetic construct 4Gly Ala Val Gln Asn Ala Phe Asn Ser Ala Ile Thr1 5 1054286DNAMus musculusCDS(999)...(3575) 5ttgaaatctc acagcccggt tggttgcagt gacccacttc gttgaacata ttcttcctaa 60tcctagtact ttcaatttgc tctattccct ggtgtctatg catttaaatc gactatgggg 120ccattcttcc ttgaaccacc acagaagaca ttagctctct gggatccttg ttaatttttt 180ctcctcttac atagcaccta cgcttggaac atatgccaga cacatctgtg agacacccct 240tgccgctgca gctcatggat ggatgctgag ttcccccacg caccacactt cagcaggtgg 300gtgtatttct gcttcacatt atactcccac acggccatgc atgtcaggca tggagcaggc 360tcataaccca cttaattaag gtgatcatat cagatccttt atcaagatgc atagagtgct 420cagtgcctgt actatgatct cggatctttg ggagatgggc tagatagagt ctgggacaga 480atacagcaga gaaaccgata tgtttattgt ccgatcatca gctaagcttc tgggagctag 540gaatggggct ccttggatga acagaagtaa aaatgcctcg tctttatgac tttcaacttc 600cctcagcagg tctggaatgg gtgaacaaac actgcctgcg tgggtgataa atagcctctt 660tttgctgctt gtttgctgct tttatggttc tgggagggaa cctagaacct agcacatgct 720agacaagtcc tctagcactg agctatctcc ccagcttgga tgaaatatct gtaaagtact 780ggtgcccgtg tgtaaaatat gcaccattaa gtgttcaaga agaaaagact gggcatttct 840gttccaccaa gacaagaaga atctgccagc agaatgtttg cgcagtcatt tgagcaaagg 900ggtccaaggg acagtaccct ccagtgctgg ggacccatgt gccgagcctc aggctgtgat 960gtggtgttgt ttttaattct ctcttttccc ataggatc atg gca tgt caa ctt gac 1016 Met Ala Cys Gln Leu Asp 1 5ttg ctc ata ggt gtg atc ttc atg gcc agc ccc gtg ttg gta ata tct 1064Leu Leu Ile Gly Val Ile Phe Met Ala Ser Pro Val Leu Val Ile Ser 10 15 20ccc tgt tct tca gac ggc agg ata gcc ttt ttc cga ggc tgt aac ctc 1112Pro Cys Ser Ser Asp Gly Arg Ile Ala Phe Phe Arg Gly Cys Asn Leu 25 30 35acc cag att ccc tgg atc ctc aat act acc act gag agg ctc ctg ctc 1160Thr Gln Ile Pro Trp Ile Leu Asn Thr Thr Thr Glu Arg Leu Leu Leu 40 45 50agc ttc aac tat atc agt atg gtg gtt gcc aca tca ttt cca ctc ctg 1208Ser Phe Asn Tyr Ile Ser Met Val Val Ala Thr Ser Phe Pro Leu Leu55 60 65 70gag cgg ctc cag ttg ctg gag ctg ggg acc cag tat gct aac ttg acc 1256Glu Arg Leu Gln Leu Leu Glu Leu Gly Thr Gln Tyr Ala Asn Leu Thr 75 80 85att ggt cca ggg gct ttc aga aac ctg ccc aat ctt agg atc ttg gac 1304Ile Gly Pro Gly Ala Phe Arg Asn Leu Pro Asn Leu Arg Ile Leu Asp 90 95 100ttg ggc caa agc cag atc gaa gtc ttg aat cga gat gcc ttt caa ggt 1352Leu Gly Gln Ser Gln Ile Glu Val Leu Asn Arg Asp Ala Phe Gln Gly 105 110 115ctg ccc cat ctc ttg gaa ctt cgg ctg ttt tcc tgt gga ctc tcc agt 1400Leu Pro His Leu Leu Glu Leu Arg Leu Phe Ser Cys Gly Leu Ser Ser 120 125 130gct gtg tta agt gac ggt tac ttc aga aat cta tat tca tta gct cgc 1448Ala Val Leu Ser Asp Gly Tyr Phe Arg Asn Leu Tyr Ser Leu Ala Arg135 140 145 150tta gac cta tct ggc aac cag att cac agc ctc cgc ctc cat tct tca 1496Leu Asp Leu Ser Gly Asn Gln Ile His Ser Leu Arg Leu His Ser Ser 155 160 165ttc cgg gaa ctg aat tcc tta agc gac gta aat ttt gct ttc aac caa 1544Phe Arg Glu Leu Asn Ser Leu Ser Asp Val Asn Phe Ala Phe Asn Gln 170 175 180ata ttc act ata tgt gaa gat gaa ctc gag cct ctg cag ggc aaa aca 1592Ile Phe Thr Ile Cys Glu Asp Glu Leu Glu Pro Leu Gln Gly Lys Thr 185 190 195ctg tct ttc ttt ggc ctc aaa tta act aag ctg ttc agc aga gtc tct 1640Leu Ser Phe Phe Gly Leu Lys Leu Thr Lys Leu Phe Ser Arg Val Ser 200 205 210gtg ggc tgg gag aca tgc agg aac ccc ttc aga ggc gtg agg cta gaa 1688Val Gly Trp Glu Thr Cys Arg Asn Pro Phe Arg Gly Val Arg Leu Glu215 220 225 230act cta gat ctt tct gaa aat ggc tgg acg gtg gac atc aca agg aac 1736Thr Leu Asp Leu Ser Glu Asn Gly Trp Thr Val Asp Ile Thr Arg Asn 235 240 245ttc agc aac atc atc cag gga agc cag att tcc tct ttg att ctt aaa 1784Phe Ser Asn Ile Ile Gln Gly Ser Gln Ile Ser Ser Leu Ile Leu Lys 250 255 260cac cac atc atg ggt cct ggc ttt ggc ttc cag aac atc aga gat cct 1832His His Ile Met Gly Pro Gly Phe Gly Phe Gln Asn Ile Arg Asp Pro 265 270 275gac cag agc aca ttt gcc agc ctg gcc aga agt tcg gtg ctg caa ctg 1880Asp Gln Ser Thr Phe Ala Ser Leu Ala Arg Ser Ser Val Leu Gln Leu 280 285 290gac ctt tcg cac ggc ttt atc ttc tcc ttg aat cct cga ctg ttt ggg 1928Asp Leu Ser His Gly Phe Ile Phe Ser Leu Asn Pro Arg Leu Phe Gly295 300 305 310aca ctg aag gat ttg aag atg ctg aac ctt gcc ttc aac aag ata aac 1976Thr Leu Lys Asp Leu Lys Met Leu Asn Leu Ala Phe Asn Lys Ile Asn 315 320 325aag att gga gag aat gcc ttt tat ggg ctt gac agc ctc cag gtt ctc 2024Lys Ile Gly Glu Asn Ala Phe Tyr Gly Leu Asp Ser Leu Gln Val Leu 330 335 340aat cta tcc tat aat ctt ttg ggg gaa ctc tat aat tcc aac ttc tat 2072Asn Leu Ser Tyr Asn Leu Leu Gly Glu Leu Tyr Asn Ser Asn Phe Tyr 345 350 355ggg ctt cct aga gta gcc tac gtt gac ctt caa agg aac cac att ggg 2120Gly Leu Pro Arg Val Ala Tyr Val Asp Leu Gln Arg Asn His Ile Gly 360 365 370atc att caa gac caa aca ttc aga tta tta aaa acg tta caa acc tta 2168Ile Ile Gln Asp Gln Thr Phe Arg Leu Leu Lys Thr Leu Gln Thr Leu375 380 385 390gat ctc cgt gac aat gct ctt aag gcc att ggt ttt att cca agc ata 2216Asp Leu Arg Asp Asn Ala Leu Lys Ala Ile Gly Phe Ile Pro Ser Ile 395 400 405cag atg gtc ctc ctg gga ggc aat aag ctg gtc cat ttg cca cac atc 2264Gln Met Val Leu Leu Gly Gly Asn Lys Leu Val His Leu Pro His Ile 410 415 420cac ttt act gcc aac ttc cta gag tta tct gaa aac agg cta gaa aac 2312His Phe Thr Ala Asn Phe Leu Glu Leu Ser Glu Asn Arg Leu Glu Asn 425 430 435ctg tcc gac ctc tac ttc ctc ctg cga gtc ccc cag ctc cag ttt ctc 2360Leu Ser Asp Leu Tyr Phe Leu Leu Arg Val Pro Gln Leu Gln Phe Leu 440 445 450atc ttg aat cag aat cgc ctt tcg tca tgc aag gca gcc cac act ccc 2408Ile Leu Asn Gln Asn Arg Leu Ser Ser Cys Lys Ala Ala His Thr Pro455 460 465 470tcg gag aac cca agc tta gaa cag ctt ttc ctt aca gag aat atg ctg 2456Ser Glu Asn Pro Ser Leu Glu Gln Leu Phe Leu Thr Glu Asn Met Leu 475 480 485cag ctg gcc tgg gag acc ggc ctc tgt tgg gat gtt ttt caa ggc ctt 2504Gln Leu Ala Trp Glu Thr Gly Leu Cys Trp Asp Val Phe Gln Gly Leu 490 495 500tcc cgc ctc cag att ctt tac ctg agt aat aac tac ctt aat ttc ctt 2552Ser Arg Leu Gln Ile Leu Tyr Leu Ser Asn Asn Tyr Leu Asn Phe Leu 505 510 515cca cct ggg ata ttt aac gac ctg gtt gca tta cgg atg ctt agt ctt 2600Pro Pro Gly Ile Phe Asn Asp Leu Val Ala Leu Arg Met Leu Ser Leu 520 525 530agt gct aac aag ctg acc gtg ctc tct ccg ggc agt tta cct gct aat 2648Ser Ala Asn Lys Leu Thr Val Leu Ser Pro Gly Ser Leu Pro Ala Asn535 540 545 550tta gag att ctc gac ata tct aga aat cag ctt ttg tgt cct gac cct 2696Leu Glu Ile Leu Asp Ile Ser Arg Asn Gln Leu Leu Cys Pro Asp Pro 555 560 565gct ttg ttt tct tcg ctt cgt gtt ttg gac ata act cat aac gag ttc 2744Ala Leu Phe Ser Ser Leu Arg Val Leu Asp Ile Thr His Asn Glu Phe 570 575 580gtc tgc aac tgt gaa ctt agc act ttt atc tcc tgg ctc aac caa acc 2792Val Cys Asn Cys Glu Leu Ser Thr Phe Ile Ser Trp Leu Asn Gln Thr 585 590 595aac gtc acc ctg ttc ggc tct cct gca gac gtg tat tgc atg tac cct 2840Asn Val Thr Leu Phe Gly Ser Pro Ala Asp Val Tyr Cys Met Tyr Pro 600 605 610aac tca ctg cta ggg ggc tcc ctc tac aac ata tcc acc gaa gac tgc 2888Asn Ser Leu Leu Gly Gly Ser Leu Tyr Asn Ile Ser Thr Glu Asp Cys615 620 625 630gat gaa gag gaa gcc atg cgg tcc cta aag ttt tcc ctt ttc atc ctg 2936Asp Glu Glu Glu Ala Met Arg Ser Leu Lys Phe Ser Leu Phe Ile Leu 635 640 645tgc acg gtc act ttg act cta ttc ctc gtc atc acc ctt gta gtc ata 2984Cys Thr Val Thr Leu Thr Leu Phe Leu Val Ile Thr Leu Val Val Ile 650 655 660aag ttc cgg gga atc tgt ttc ctg tgc tat aag acc atc cag aag ctg 3032Lys Phe Arg Gly Ile Cys Phe Leu Cys Tyr Lys Thr Ile Gln Lys Leu 665 670 675gtg ttc aag gac aag gtc tgg agt ttg gaa cct ggt gca tat aga tat 3080Val Phe Lys Asp Lys Val Trp Ser Leu Glu Pro Gly Ala Tyr Arg Tyr 680 685 690gat gcc tac ttc tgc ttc agc agc aaa gac ttt gaa tgg gca cag aat 3128Asp Ala Tyr Phe Cys Phe Ser Ser Lys Asp Phe Glu Trp Ala Gln Asn695 700 705 710gct ttg ctc aaa cac ctg gat gct cac tac agt tcc cga aac agg ctc 3176Ala Leu Leu Lys His Leu Asp Ala His Tyr Ser Ser Arg Asn Arg Leu 715 720 725agg cta tgc ttt gaa gaa aga gac ttc att ccg ggg gaa aac cat atc 3224Arg Leu Cys Phe Glu Glu Arg Asp Phe Ile Pro Gly Glu Asn His Ile 730 735 740tcc aac atc cag gcg gct gtc tgg ggc agc agg aag acg gtg tgt cta 3272Ser Asn Ile Gln Ala Ala Val Trp Gly Ser Arg Lys Thr Val Cys Leu 745 750 755gtg agc aga cac ttc ctg aag gat ggt tgg tgc ctg gag gcc ttc agg 3320Val Ser Arg His Phe Leu Lys Asp Gly Trp Cys Leu Glu Ala Phe Arg 760 765 770tat gcc cag agc cgg agt ctg tct gac ctc aag agc att ctc atc gtg 3368Tyr Ala Gln Ser Arg Ser Leu Ser Asp Leu Lys Ser Ile Leu Ile Val775 780 785 790gtg gtg gtg gga tcg ctg tcc cag tat cag ctg atg aga cat gag acc 3416Val Val Val Gly Ser Leu Ser Gln Tyr Gln Leu Met Arg His Glu Thr 795 800 805atc aga ggg ttt ctg caa aag caa cag tac ttg agg tgg cct gaa gac 3464Ile Arg Gly Phe Leu Gln Lys Gln Gln Tyr Leu Arg Trp Pro Glu Asp 810 815 820ctc cag gat gtt ggc tgg ttt ctc gat aaa ctc tcc gga tgc att cta 3512Leu Gln Asp Val Gly Trp Phe Leu Asp Lys Leu Ser Gly Cys Ile Leu 825 830 835aag gaa gaa aaa gga aag aaa aga agc agt tcc atc cag ttg cga acc 3560Lys Glu Glu Lys Gly Lys Lys Arg Ser Ser Ser Ile Gln Leu Arg Thr 840 845 850ata gca acc att tcc tagcaggagc gcctcctagc agaagtgcaa gcatcgtaga 3615Ile Ala Thr Ile Ser855taactctcca cgctttatcc gcacagccgc tgggggtcct tccctggagt catttttctg 3675acaatgaaaa caacaccaat ctcttgattt ttcatgtcaa cagggagctt tgtcttcact 3735gttttccaaa tggaaagtaa gaggtccaga aagctgcctc taagggctct cacctgccat 3795tgatgtcctt tcaggcccaa tgacatggtt tccctccatc ctattgcgta ctgtctgcta 3855cccaggtggc aagagcacct tgggagaagt tacaggcagc ttcatgcttt ctgtgctgtt 3915cagttcaaaa gcaggtgcct tgagaatcct gaattcaagc actctgtaga acatggacag 3975acaagatggg tccttctctg gccataggca tgagggccag ttgctgagga ctgctctcac 4035tacacctaag tgcacaagtg ataagaagtt ggacagatag acagatagca gcagtcccat 4095tgctgtagcc agaatgcact tatttcctgt tctgaccctg caggcccagc ttttggggac 4155cacagccatg ttctgcacgg gacctctcaa cctggcattc atgccctttc acgacttagc 4215accggcctgc ccttctttct tccccacaac tatacaagag ctgttgcaac cactgaaaaa 4275aaaaaaaaaa a 42866859PRTMus musculus 6Met Ala Cys Gln Leu Asp Leu Leu Ile Gly Val Ile Phe Met Ala Ser1 5 10 15Pro Val Leu Val Ile Ser Pro Cys Ser Ser Asp Gly Arg Ile Ala Phe 20 25 30Phe Arg Gly Cys Asn Leu Thr Gln Ile Pro Trp Ile Leu Asn Thr Thr 35 40 45Thr Glu Arg Leu Leu Leu Ser Phe Asn Tyr Ile Ser Met Val Val Ala 50 55 60Thr Ser Phe Pro Leu Leu Glu Arg Leu Gln Leu Leu Glu Leu Gly Thr65 70 75 80Gln Tyr Ala Asn Leu Thr Ile Gly Pro Gly Ala Phe Arg Asn Leu Pro 85 90 95Asn Leu Arg Ile Leu Asp Leu Gly Gln Ser Gln Ile Glu Val Leu Asn 100 105 110Arg Asp Ala Phe Gln Gly Leu Pro His Leu Leu Glu Leu Arg Leu Phe 115 120 125Ser Cys Gly Leu Ser Ser Ala Val Leu Ser Asp Gly Tyr Phe Arg Asn 130 135 140Leu Tyr Ser Leu Ala Arg Leu Asp Leu Ser Gly Asn Gln Ile His Ser145 150 155 160Leu Arg Leu His Ser Ser Phe Arg Glu Leu Asn Ser Leu Ser Asp Val 165 170 175Asn Phe Ala Phe Asn Gln Ile Phe Thr Ile Cys Glu Asp Glu Leu Glu 180 185 190Pro Leu Gln Gly Lys Thr Leu Ser Phe Phe Gly Leu Lys Leu Thr Lys 195 200 205Leu Phe Ser Arg Val Ser Val Gly Trp Glu Thr Cys Arg Asn Pro Phe 210 215 220Arg Gly Val Arg Leu Glu Thr Leu Asp Leu Ser Glu Asn Gly Trp Thr225 230 235 240Val Asp Ile Thr Arg Asn Phe Ser Asn Ile Ile Gln Gly Ser Gln Ile 245 250 255Ser Ser Leu Ile Leu Lys His His Ile Met Gly Pro Gly Phe Gly Phe 260 265 270Gln Asn Ile Arg Asp Pro Asp Gln Ser Thr Phe Ala Ser Leu Ala Arg 275 280 285Ser Ser Val Leu Gln Leu Asp Leu Ser His Gly Phe Ile Phe Ser Leu 290 295 300Asn Pro Arg Leu Phe Gly Thr Leu Lys Asp Leu Lys Met Leu Asn Leu305 310 315 320Ala Phe Asn Lys Ile Asn Lys Ile Gly Glu Asn Ala Phe Tyr Gly Leu 325 330 335Asp Ser Leu Gln Val Leu Asn Leu Ser Tyr Asn Leu Leu Gly Glu Leu 340 345 350Tyr Asn Ser Asn Phe Tyr Gly Leu Pro Arg Val Ala Tyr Val Asp Leu 355 360 365Gln Arg Asn His Ile Gly Ile Ile Gln Asp Gln Thr Phe Arg Leu Leu 370 375 380Lys Thr Leu Gln Thr Leu Asp Leu Arg Asp Asn Ala Leu Lys Ala Ile385 390 395 400Gly Phe Ile Pro Ser Ile Gln Met Val Leu Leu Gly Gly Asn Lys Leu 405 410 415Val His Leu Pro His Ile His Phe Thr Ala Asn Phe Leu Glu Leu Ser 420 425 430Glu Asn Arg Leu Glu Asn Leu Ser Asp Leu Tyr Phe Leu Leu Arg Val 435 440 445Pro Gln Leu Gln Phe Leu Ile Leu Asn Gln Asn Arg Leu Ser Ser Cys 450 455 460Lys Ala Ala His Thr Pro Ser Glu Asn Pro Ser Leu Glu Gln Leu Phe465 470 475 480Leu Thr Glu Asn Met Leu Gln Leu Ala Trp Glu Thr Gly Leu Cys Trp 485 490 495Asp Val Phe Gln Gly Leu Ser Arg Leu Gln Ile Leu Tyr Leu Ser Asn 500 505 510Asn Tyr Leu Asn Phe Leu Pro Pro Gly Ile Phe Asn Asp Leu Val Ala 515 520 525Leu Arg Met Leu Ser Leu Ser Ala Asn Lys Leu Thr Val Leu Ser Pro 530 535 540Gly Ser Leu Pro Ala Asn Leu Glu Ile Leu Asp Ile Ser Arg Asn Gln545 550 555 560Leu Leu Cys Pro Asp Pro Ala Leu Phe Ser Ser Leu Arg Val Leu Asp 565 570 575Ile Thr His Asn Glu Phe Val Cys Asn Cys Glu Leu Ser Thr Phe Ile 580 585 590Ser Trp Leu Asn Gln Thr Asn Val Thr Leu Phe Gly Ser Pro Ala Asp 595 600 605Val Tyr Cys Met Tyr Pro Asn Ser Leu Leu Gly Gly Ser Leu Tyr Asn 610 615 620Ile Ser Thr Glu Asp Cys Asp Glu Glu Glu Ala Met Arg Ser Leu Lys625 630 635 640Phe Ser Leu Phe Ile Leu Cys Thr Val Thr Leu Thr Leu Phe Leu Val 645 650 655Ile Thr Leu Val Val Ile Lys Phe Arg Gly Ile Cys Phe Leu Cys Tyr 660 665 670Lys Thr Ile Gln Lys Leu Val Phe Lys Asp Lys Val Trp Ser Leu Glu 675 680 685Pro Gly Ala Tyr Arg Tyr Asp Ala Tyr Phe Cys Phe Ser Ser Lys Asp 690 695 700Phe Glu Trp Ala Gln Asn Ala Leu Leu Lys His Leu Asp Ala His Tyr705 710 715 720Ser Ser Arg Asn

Arg Leu Arg Leu Cys Phe Glu Glu Arg Asp Phe Ile 725 730 735Pro Gly Glu Asn His Ile Ser Asn Ile Gln Ala Ala Val Trp Gly Ser 740 745 750Arg Lys Thr Val Cys Leu Val Ser Arg His Phe Leu Lys Asp Gly Trp 755 760 765Cys Leu Glu Ala Phe Arg Tyr Ala Gln Ser Arg Ser Leu Ser Asp Leu 770 775 780Lys Ser Ile Leu Ile Val Val Val Val Gly Ser Leu Ser Gln Tyr Gln785 790 795 800Leu Met Arg His Glu Thr Ile Arg Gly Phe Leu Gln Lys Gln Gln Tyr 805 810 815Leu Arg Trp Pro Glu Asp Leu Gln Asp Val Gly Trp Phe Leu Asp Lys 820 825 830Leu Ser Gly Cys Ile Leu Lys Glu Glu Lys Gly Lys Lys Arg Ser Ser 835 840 845Ser Ile Gln Leu Arg Thr Ile Ala Thr Ile Ser 850 85573431DNAHomo sapiensCDS(704)...(3277) 7ggcttatagg gctcgagcgg ccgcccgggc aggtatagaa ttcagcggcc gctgaattct 60agggttttca ggagcccgag cgagggcgcc gcttttgcgt ccgggaggag ccaaccgtgg 120cgcaggcggc gcggggaggc gtcccagagt ctcactctgc cgcccaggct ggactgcagt 180gacacaatct cggctgactg caaccactgc ctccagggtt caagcgattc tcttgcctca 240gcctcccaag tagctgggat tacagattga tgttcatgtt cctggcacta ctacaagatt 300catactcctg atgctactga caacgtggct tctccacagt caccaaacca gggatgctat 360actggacttc cctactctca tctgctccag ccccctgacc ttatagttgc ccagctttcc 420tggcaattga ctttgcccat caatacacag gatttagcat ccagggaaga tgtcggagcc 480tcagatgtta attttctaat tgagaatgtt ggcgctgtcc gaacctggag acagaaaaac 540aaaaagtcct ttctcctgat tcaccaaaaa ataaaatact gactaccatc actgtgatga 600gattcctata gtctcaggaa ctgaagtctt taaacaacca gggaccctct gcccctagaa 660taagaacata ctagaagtcc cttctgctag gacaacgagg atc atg gga gac cac 715 Met Gly Asp His 1ctg gac ctt ctc cta gga gtg gtg ctc atg gcc ggt cct gtg ttt gga 763Leu Asp Leu Leu Leu Gly Val Val Leu Met Ala Gly Pro Val Phe Gly5 10 15 20att cct tcc tgc tcc ttt gat ggc cga ata gcc ttt tat cgt ttc tgc 811Ile Pro Ser Cys Ser Phe Asp Gly Arg Ile Ala Phe Tyr Arg Phe Cys 25 30 35aac ctc acc cag gtc ccc cag gtc ctc aac acc act gag agg ctc ctg 859Asn Leu Thr Gln Val Pro Gln Val Leu Asn Thr Thr Glu Arg Leu Leu 40 45 50ctg agc ttc aac tat atc agg aca gtc act gct tca tcc ttc ccc ttt 907Leu Ser Phe Asn Tyr Ile Arg Thr Val Thr Ala Ser Ser Phe Pro Phe 55 60 65ctg gaa cag ctg cag ctg ctg gag ctc ggg agc cag tat acc ccc ttg 955Leu Glu Gln Leu Gln Leu Leu Glu Leu Gly Ser Gln Tyr Thr Pro Leu 70 75 80act att gac aag gag gcc ttc aga aac ctg ccc aac ctt aga atc ttg 1003Thr Ile Asp Lys Glu Ala Phe Arg Asn Leu Pro Asn Leu Arg Ile Leu85 90 95 100gac ctg gga agt agt aag ata tac ttc ttg cat cca gat gct ttt cag 1051Asp Leu Gly Ser Ser Lys Ile Tyr Phe Leu His Pro Asp Ala Phe Gln 105 110 115gga ctg ttc cat ctg ttt gaa ctt aga ctg tat ttc tgt ggt ctc tct 1099Gly Leu Phe His Leu Phe Glu Leu Arg Leu Tyr Phe Cys Gly Leu Ser 120 125 130gat gct gta ttg aaa gat ggt tat ttc aga aat tta aag gct tta act 1147Asp Ala Val Leu Lys Asp Gly Tyr Phe Arg Asn Leu Lys Ala Leu Thr 135 140 145cgc ttg gat cta tcc aaa aat cag att cgt agc ctt tac ctt cat cct 1195Arg Leu Asp Leu Ser Lys Asn Gln Ile Arg Ser Leu Tyr Leu His Pro 150 155 160tca ttt ggg aag ttg aat tcc tta aag tcc ata gat ttt tcc tcc aac 1243Ser Phe Gly Lys Leu Asn Ser Leu Lys Ser Ile Asp Phe Ser Ser Asn165 170 175 180caa ata ttc ctt gta tgt gaa cat gag ctc gag ccc cta caa ggg aaa 1291Gln Ile Phe Leu Val Cys Glu His Glu Leu Glu Pro Leu Gln Gly Lys 185 190 195acg ctc tcc ttt ttt agc ctc gca gct aat agc ttg tat agc aga gtc 1339Thr Leu Ser Phe Phe Ser Leu Ala Ala Asn Ser Leu Tyr Ser Arg Val 200 205 210tca gtg gac tgg gga aaa tgt atg aac cca ttc aga aac atg gtg ctg 1387Ser Val Asp Trp Gly Lys Cys Met Asn Pro Phe Arg Asn Met Val Leu 215 220 225gag ata gta gat gtt tct gga aat ggc tgg aca gtg gac atc aca gga 1435Glu Ile Val Asp Val Ser Gly Asn Gly Trp Thr Val Asp Ile Thr Gly 230 235 240aac ttt agc aat gcc atc agc aaa agc cag gcc ttc tct ttg att ctt 1483Asn Phe Ser Asn Ala Ile Ser Lys Ser Gln Ala Phe Ser Leu Ile Leu245 250 255 260gcc cac cac atc atg ggt gcc ggg ttt ggc ttc cat aac atc aaa gat 1531Ala His His Ile Met Gly Ala Gly Phe Gly Phe His Asn Ile Lys Asp 265 270 275cct gac cag aac aca ttt gct ggc ctg gcc aga agt tca gtg aga cac 1579Pro Asp Gln Asn Thr Phe Ala Gly Leu Ala Arg Ser Ser Val Arg His 280 285 290ctg gac ctt tca cat ggg ttt gtc ttc tcc ctg aac tca cga gtc ttt 1627Leu Asp Leu Ser His Gly Phe Val Phe Ser Leu Asn Ser Arg Val Phe 295 300 305gag aca ctc aag gat ttg aag gtt ctg aac ctt gcc tac aac aag ata 1675Glu Thr Leu Lys Asp Leu Lys Val Leu Asn Leu Ala Tyr Asn Lys Ile 310 315 320aat aag att gca gat gaa gca ttt tac gga ctt gac aac ctc caa gtt 1723Asn Lys Ile Ala Asp Glu Ala Phe Tyr Gly Leu Asp Asn Leu Gln Val325 330 335 340ctc aat ttg tca tat aac ctt ctg ggg gaa ctt tgc agt tcg aat ttc 1771Leu Asn Leu Ser Tyr Asn Leu Leu Gly Glu Leu Cys Ser Ser Asn Phe 345 350 355tat gga cta cct aag gta gcc tac att gat ttg caa aag aat cac att 1819Tyr Gly Leu Pro Lys Val Ala Tyr Ile Asp Leu Gln Lys Asn His Ile 360 365 370gca ata att caa gac caa aca ttc aaa ttc ctg gaa aaa tta cag acc 1867Ala Ile Ile Gln Asp Gln Thr Phe Lys Phe Leu Glu Lys Leu Gln Thr 375 380 385ttg gat ctc cga gac aat gct ctt aca acc att cat ttt att cca agc 1915Leu Asp Leu Arg Asp Asn Ala Leu Thr Thr Ile His Phe Ile Pro Ser 390 395 400ata ccc gat atc ttc ttg agt ggc aat aaa cta gtg act ttg cca aag 1963Ile Pro Asp Ile Phe Leu Ser Gly Asn Lys Leu Val Thr Leu Pro Lys405 410 415 420atc aac ctt aca gcg aac ctc atc cac tta tca gaa aac agg cta gaa 2011Ile Asn Leu Thr Ala Asn Leu Ile His Leu Ser Glu Asn Arg Leu Glu 425 430 435aat cta gat att ctc tac ttt ctc cta cgg gta cct cat ctc cag att 2059Asn Leu Asp Ile Leu Tyr Phe Leu Leu Arg Val Pro His Leu Gln Ile 440 445 450ctc att tta aat caa aat cgc ttc tcc tcc tgt agt gga gat caa acc 2107Leu Ile Leu Asn Gln Asn Arg Phe Ser Ser Cys Ser Gly Asp Gln Thr 455 460 465cct tca gag aat ccc agc tta gaa cag ctt ttc ctt gga gaa aat atg 2155Pro Ser Glu Asn Pro Ser Leu Glu Gln Leu Phe Leu Gly Glu Asn Met 470 475 480ttg caa ctt gcc tgg gaa act gag ctc tgt tgg gat gtt ttt gag gga 2203Leu Gln Leu Ala Trp Glu Thr Glu Leu Cys Trp Asp Val Phe Glu Gly485 490 495 500ctt tct cat ctt caa gtt ctg tat ttg aat cat aac tat ctt aat tcc 2251Leu Ser His Leu Gln Val Leu Tyr Leu Asn His Asn Tyr Leu Asn Ser 505 510 515ctt cca cca gga gta ttt agc cat ctg act gca tta agg gga cta agc 2299Leu Pro Pro Gly Val Phe Ser His Leu Thr Ala Leu Arg Gly Leu Ser 520 525 530ctc aac tcc aac agg ctg aca gtt ctt tct cac aat gat tta cct gct 2347Leu Asn Ser Asn Arg Leu Thr Val Leu Ser His Asn Asp Leu Pro Ala 535 540 545aat tta gag atc ctg gac ata tcc agg aac cag ctc cta gct cct aat 2395Asn Leu Glu Ile Leu Asp Ile Ser Arg Asn Gln Leu Leu Ala Pro Asn 550 555 560cct gat gta ttt gta tca ctt agt gtc ttg gat ata act cat aac aag 2443Pro Asp Val Phe Val Ser Leu Ser Val Leu Asp Ile Thr His Asn Lys565 570 575 580ttc att tgt gaa tgt gaa ctt agc act ttt atc aat tgg ctt aat cac 2491Phe Ile Cys Glu Cys Glu Leu Ser Thr Phe Ile Asn Trp Leu Asn His 585 590 595acc aat gtc act ata gct ggg cct cct gca gac ata tat tgt gtg tac 2539Thr Asn Val Thr Ile Ala Gly Pro Pro Ala Asp Ile Tyr Cys Val Tyr 600 605 610cct gac tcg ctc tct ggg gtt tcc ctc ttc tct ctt tcc acg gaa ggt 2587Pro Asp Ser Leu Ser Gly Val Ser Leu Phe Ser Leu Ser Thr Glu Gly 615 620 625tgt gat gaa gag gaa gtc tta aag tcc cta aag ttc tcc ctt ttc att 2635Cys Asp Glu Glu Glu Val Leu Lys Ser Leu Lys Phe Ser Leu Phe Ile 630 635 640gta tgc act gtc act ctg act ctg ttc ctc atg acc atc ctc aca gtc 2683Val Cys Thr Val Thr Leu Thr Leu Phe Leu Met Thr Ile Leu Thr Val645 650 655 660aca aag ttc cgg ggc ttc tgt ttt atc tgt tat aag aca gcc cag aga 2731Thr Lys Phe Arg Gly Phe Cys Phe Ile Cys Tyr Lys Thr Ala Gln Arg 665 670 675ctg gtg ttc aag gac cat ccc cag ggc aca gaa cct gat atg tac aaa 2779Leu Val Phe Lys Asp His Pro Gln Gly Thr Glu Pro Asp Met Tyr Lys 680 685 690tat gat gcc tat ttg tgc ttc agc agc aaa gac ttc aca tgg gtg cag 2827Tyr Asp Ala Tyr Leu Cys Phe Ser Ser Lys Asp Phe Thr Trp Val Gln 695 700 705aat gct ttg ctc aaa cac ctg gac act caa tac agt gac caa aac aga 2875Asn Ala Leu Leu Lys His Leu Asp Thr Gln Tyr Ser Asp Gln Asn Arg 710 715 720ttc aac ctg tgc ttt gaa gaa aga gac ttt gtc cca gga gaa aac cgc 2923Phe Asn Leu Cys Phe Glu Glu Arg Asp Phe Val Pro Gly Glu Asn Arg725 730 735 740att gcc aat atc cag gat gcc atc tgg aac agt aga aag atc gtt tgt 2971Ile Ala Asn Ile Gln Asp Ala Ile Trp Asn Ser Arg Lys Ile Val Cys 745 750 755ctt gtg agc aga cac ttc ctt aga gat ggc tgg tgc ctt gaa gcc ttc 3019Leu Val Ser Arg His Phe Leu Arg Asp Gly Trp Cys Leu Glu Ala Phe 760 765 770agt tat gcc cag ggc agg tgc tta tct gac ctt aac agt gct ctc atc 3067Ser Tyr Ala Gln Gly Arg Cys Leu Ser Asp Leu Asn Ser Ala Leu Ile 775 780 785atg gtg gtg gtt ggg tcc ttg tcc cag tac cag ttg atg aaa cat caa 3115Met Val Val Val Gly Ser Leu Ser Gln Tyr Gln Leu Met Lys His Gln 790 795 800tcc atc aga ggc ttt gta cag aaa cag cag tat ttg agg tgg cct gag 3163Ser Ile Arg Gly Phe Val Gln Lys Gln Gln Tyr Leu Arg Trp Pro Glu805 810 815 820gat ctc cag gat gtt ggc tgg ttt ctt cat aaa ctc tct caa cag ata 3211Asp Leu Gln Asp Val Gly Trp Phe Leu His Lys Leu Ser Gln Gln Ile 825 830 835cta aag aaa gaa aaa gaa aag aag aaa gac aat aac att ccg ttg caa 3259Leu Lys Lys Glu Lys Glu Lys Lys Lys Asp Asn Asn Ile Pro Leu Gln 840 845 850act gta gca acc atc tcc taatcaaagg agcaatttcc aacttatctc 3307Thr Val Ala Thr Ile Ser 855aagccacaaa taactcttca ctttgtattt gcaccaagtt atcattttgg ggtcctctct 3367ggaggttttt tttttctttt tgctactatg aaaacaacat aaatctctca attttcgtat 3427caaa 34318858PRTHomo sapiens 8Met Gly Asp His Leu Asp Leu Leu Leu Gly Val Val Leu Met Ala Gly1 5 10 15Pro Val Phe Gly Ile Pro Ser Cys Ser Phe Asp Gly Arg Ile Ala Phe 20 25 30Tyr Arg Phe Cys Asn Leu Thr Gln Val Pro Gln Val Leu Asn Thr Thr 35 40 45Glu Arg Leu Leu Leu Ser Phe Asn Tyr Ile Arg Thr Val Thr Ala Ser 50 55 60Ser Phe Pro Phe Leu Glu Gln Leu Gln Leu Leu Glu Leu Gly Ser Gln65 70 75 80Tyr Thr Pro Leu Thr Ile Asp Lys Glu Ala Phe Arg Asn Leu Pro Asn 85 90 95Leu Arg Ile Leu Asp Leu Gly Ser Ser Lys Ile Tyr Phe Leu His Pro 100 105 110Asp Ala Phe Gln Gly Leu Phe His Leu Phe Glu Leu Arg Leu Tyr Phe 115 120 125Cys Gly Leu Ser Asp Ala Val Leu Lys Asp Gly Tyr Phe Arg Asn Leu 130 135 140Lys Ala Leu Thr Arg Leu Asp Leu Ser Lys Asn Gln Ile Arg Ser Leu145 150 155 160Tyr Leu His Pro Ser Phe Gly Lys Leu Asn Ser Leu Lys Ser Ile Asp 165 170 175Phe Ser Ser Asn Gln Ile Phe Leu Val Cys Glu His Glu Leu Glu Pro 180 185 190Leu Gln Gly Lys Thr Leu Ser Phe Phe Ser Leu Ala Ala Asn Ser Leu 195 200 205Tyr Ser Arg Val Ser Val Asp Trp Gly Lys Cys Met Asn Pro Phe Arg 210 215 220Asn Met Val Leu Glu Ile Val Asp Val Ser Gly Asn Gly Trp Thr Val225 230 235 240Asp Ile Thr Gly Asn Phe Ser Asn Ala Ile Ser Lys Ser Gln Ala Phe 245 250 255Ser Leu Ile Leu Ala His His Ile Met Gly Ala Gly Phe Gly Phe His 260 265 270Asn Ile Lys Asp Pro Asp Gln Asn Thr Phe Ala Gly Leu Ala Arg Ser 275 280 285Ser Val Arg His Leu Asp Leu Ser His Gly Phe Val Phe Ser Leu Asn 290 295 300Ser Arg Val Phe Glu Thr Leu Lys Asp Leu Lys Val Leu Asn Leu Ala305 310 315 320Tyr Asn Lys Ile Asn Lys Ile Ala Asp Glu Ala Phe Tyr Gly Leu Asp 325 330 335Asn Leu Gln Val Leu Asn Leu Ser Tyr Asn Leu Leu Gly Glu Leu Cys 340 345 350Ser Ser Asn Phe Tyr Gly Leu Pro Lys Val Ala Tyr Ile Asp Leu Gln 355 360 365Lys Asn His Ile Ala Ile Ile Gln Asp Gln Thr Phe Lys Phe Leu Glu 370 375 380Lys Leu Gln Thr Leu Asp Leu Arg Asp Asn Ala Leu Thr Thr Ile His385 390 395 400Phe Ile Pro Ser Ile Pro Asp Ile Phe Leu Ser Gly Asn Lys Leu Val 405 410 415Thr Leu Pro Lys Ile Asn Leu Thr Ala Asn Leu Ile His Leu Ser Glu 420 425 430Asn Arg Leu Glu Asn Leu Asp Ile Leu Tyr Phe Leu Leu Arg Val Pro 435 440 445His Leu Gln Ile Leu Ile Leu Asn Gln Asn Arg Phe Ser Ser Cys Ser 450 455 460Gly Asp Gln Thr Pro Ser Glu Asn Pro Ser Leu Glu Gln Leu Phe Leu465 470 475 480Gly Glu Asn Met Leu Gln Leu Ala Trp Glu Thr Glu Leu Cys Trp Asp 485 490 495Val Phe Glu Gly Leu Ser His Leu Gln Val Leu Tyr Leu Asn His Asn 500 505 510Tyr Leu Asn Ser Leu Pro Pro Gly Val Phe Ser His Leu Thr Ala Leu 515 520 525Arg Gly Leu Ser Leu Asn Ser Asn Arg Leu Thr Val Leu Ser His Asn 530 535 540Asp Leu Pro Ala Asn Leu Glu Ile Leu Asp Ile Ser Arg Asn Gln Leu545 550 555 560Leu Ala Pro Asn Pro Asp Val Phe Val Ser Leu Ser Val Leu Asp Ile 565 570 575Thr His Asn Lys Phe Ile Cys Glu Cys Glu Leu Ser Thr Phe Ile Asn 580 585 590Trp Leu Asn His Thr Asn Val Thr Ile Ala Gly Pro Pro Ala Asp Ile 595 600 605Tyr Cys Val Tyr Pro Asp Ser Leu Ser Gly Val Ser Leu Phe Ser Leu 610 615 620Ser Thr Glu Gly Cys Asp Glu Glu Glu Val Leu Lys Ser Leu Lys Phe625 630 635 640Ser Leu Phe Ile Val Cys Thr Val Thr Leu Thr Leu Phe Leu Met Thr 645 650 655Ile Leu Thr Val Thr Lys Phe Arg Gly Phe Cys Phe Ile Cys Tyr Lys 660 665 670Thr Ala Gln Arg Leu Val Phe Lys Asp His Pro Gln Gly Thr Glu Pro 675 680 685Asp Met Tyr Lys Tyr Asp Ala Tyr Leu Cys Phe Ser Ser Lys Asp Phe 690 695 700Thr Trp Val Gln Asn Ala Leu Leu Lys His Leu Asp Thr Gln Tyr Ser705 710 715 720Asp Gln Asn Arg Phe Asn Leu Cys Phe Glu Glu Arg Asp Phe Val Pro 725 730 735Gly Glu Asn Arg Ile Ala Asn Ile Gln Asp Ala Ile Trp Asn Ser Arg 740 745 750Lys Ile Val Cys Leu Val Ser Arg His Phe Leu Arg Asp Gly Trp Cys 755 760 765Leu Glu Ala Phe Ser Tyr Ala Gln Gly Arg Cys Leu Ser Asp Leu Asn 770 775 780Ser Ala Leu Ile Met Val Val Val Gly Ser Leu Ser Gln Tyr Gln

Leu785 790 795 800Met Lys His Gln Ser Ile Arg Gly Phe Val Gln Lys Gln Gln Tyr Leu 805 810 815Arg Trp Pro Glu Asp Leu Gln Asp Val Gly Trp Phe Leu His Lys Leu 820 825 830Ser Gln Gln Ile Leu Lys Lys Glu Lys Glu Lys Lys Lys Asp Asn Asn 835 840 845Ile Pro Leu Gln Thr Val Ala Thr Ile Ser 850 85591839DNAHomo sapiensCDS(1)...(1839) 9atg tgc cga gcc atc tct ctt agg cgc ttg ctg ctg ctg ctg ctg cag 48Met Cys Arg Ala Ile Ser Leu Arg Arg Leu Leu Leu Leu Leu Leu Gln1 5 10 15ctg tca caa ctc cta gct gtc act caa ggg aag acg ctg gtg ctg ggg 96Leu Ser Gln Leu Leu Ala Val Thr Gln Gly Lys Thr Leu Val Leu Gly 20 25 30aag gaa ggg gaa tca gca gaa ctg ccc tgc gag agt tcc cag aag aag 144Lys Glu Gly Glu Ser Ala Glu Leu Pro Cys Glu Ser Ser Gln Lys Lys 35 40 45atc aca gtc ttc acc tgg aag ttc tct gac cag agg aag att ctg ggg 192Ile Thr Val Phe Thr Trp Lys Phe Ser Asp Gln Arg Lys Ile Leu Gly 50 55 60cag cat ggc aaa ggt gta tta att aga gga ggt tcg cct tcg cag ttt 240Gln His Gly Lys Gly Val Leu Ile Arg Gly Gly Ser Pro Ser Gln Phe65 70 75 80gat cgt ttt gat tcc aaa aaa ggg gca tgg gag aaa gga tcg ttt cct 288Asp Arg Phe Asp Ser Lys Lys Gly Ala Trp Glu Lys Gly Ser Phe Pro 85 90 95ctc atc atc aat aaa ctt aag atg gaa gac tct cag act tat atc tgt 336Leu Ile Ile Asn Lys Leu Lys Met Glu Asp Ser Gln Thr Tyr Ile Cys 100 105 110gag ctg gag aac agg aaa gag gag gtg gag ttg tgg gtg ttc aaa gtg 384Glu Leu Glu Asn Arg Lys Glu Glu Val Glu Leu Trp Val Phe Lys Val 115 120 125acc ttc agt ccg ggt acc agc ctg ttg caa ggg cag agc ctg acc ctg 432Thr Phe Ser Pro Gly Thr Ser Leu Leu Gln Gly Gln Ser Leu Thr Leu 130 135 140acc ttg gat agc aac tct aag gtc tct aac ccc ttg aca gag tgc aaa 480Thr Leu Asp Ser Asn Ser Lys Val Ser Asn Pro Leu Thr Glu Cys Lys145 150 155 160cac aaa aag ggt aaa gtt gtc agt ggt tcc aaa gtt ctc tcc atg tcc 528His Lys Lys Gly Lys Val Val Ser Gly Ser Lys Val Leu Ser Met Ser 165 170 175aac cta agg gtt cag gac agc gac ttc tgg aac tgc acc gtg acc ctg 576Asn Leu Arg Val Gln Asp Ser Asp Phe Trp Asn Cys Thr Val Thr Leu 180 185 190gac cag aaa aag aac tgg ttc ggc atg aca ctc tca gtg ctg ggt ttt 624Asp Gln Lys Lys Asn Trp Phe Gly Met Thr Leu Ser Val Leu Gly Phe 195 200 205cag agc aca gct atc acg gcc tat aag agt gag gga gag tca gcg gag 672Gln Ser Thr Ala Ile Thr Ala Tyr Lys Ser Glu Gly Glu Ser Ala Glu 210 215 220ttc tcc ttc cca ctc aac ttt gca gag gaa aac ggg tgg gga gag ctg 720Phe Ser Phe Pro Leu Asn Phe Ala Glu Glu Asn Gly Trp Gly Glu Leu225 230 235 240atg tgg aag gca gag aag gat tct ttc ttc cag ccc tgg atc tcc ttc 768Met Trp Lys Ala Glu Lys Asp Ser Phe Phe Gln Pro Trp Ile Ser Phe 245 250 255tcc ata aag aac aaa gag gtg tcc gta caa aag tcc acc aaa gac ctc 816Ser Ile Lys Asn Lys Glu Val Ser Val Gln Lys Ser Thr Lys Asp Leu 260 265 270aag ctc cag ctg aag gaa acg ctc cca ctc acc ctc aag ata ccc cag 864Lys Leu Gln Leu Lys Glu Thr Leu Pro Leu Thr Leu Lys Ile Pro Gln 275 280 285gtc tcg ctt cag ttt gct ggt tct ggc aac ctg act ctg act ctg gac 912Val Ser Leu Gln Phe Ala Gly Ser Gly Asn Leu Thr Leu Thr Leu Asp 290 295 300aaa ggg aca ctg cat cag gaa gtg aac ctg gtg gtg atg aaa gtg gct 960Lys Gly Thr Leu His Gln Glu Val Asn Leu Val Val Met Lys Val Ala305 310 315 320cag ctc aac aat act ttg acc tgt gag gtg atg gga cct acc tct ccc 1008Gln Leu Asn Asn Thr Leu Thr Cys Glu Val Met Gly Pro Thr Ser Pro 325 330 335aag atg aga ctg acc ctg aag cag gag aac cag gag gcc agg gtc tct 1056Lys Met Arg Leu Thr Leu Lys Gln Glu Asn Gln Glu Ala Arg Val Ser 340 345 350gag gag cag aaa gta gtt caa gtg gtg gcc cct gag aca ggg ctg tgg 1104Glu Glu Gln Lys Val Val Gln Val Val Ala Pro Glu Thr Gly Leu Trp 355 360 365cag tgt cta ctg agt gaa ggt gat aag gtc aag atg gac tcc agg atc 1152Gln Cys Leu Leu Ser Glu Gly Asp Lys Val Lys Met Asp Ser Arg Ile 370 375 380cag gtt tta tcc aga ggg gtg tac cag ttc tcc ctt ttc att gta tgc 1200Gln Val Leu Ser Arg Gly Val Tyr Gln Phe Ser Leu Phe Ile Val Cys385 390 395 400act gtc act ctg act ctg ttc ctc atg acc atc ctc aca gtc aca aag 1248Thr Val Thr Leu Thr Leu Phe Leu Met Thr Ile Leu Thr Val Thr Lys 405 410 415ttc cgg ggc ttc tgt ttt atc tgt tat aag aca gcc cag aga ctg gtg 1296Phe Arg Gly Phe Cys Phe Ile Cys Tyr Lys Thr Ala Gln Arg Leu Val 420 425 430ttc aag gac cat ccc cag ggc aca gaa cct gat atg tac aaa tat gat 1344Phe Lys Asp His Pro Gln Gly Thr Glu Pro Asp Met Tyr Lys Tyr Asp 435 440 445gcc tat ttg tgc ttc agc agc aaa gac ttc aca tgg gtg cag aat gct 1392Ala Tyr Leu Cys Phe Ser Ser Lys Asp Phe Thr Trp Val Gln Asn Ala 450 455 460ttg ctc aaa cac ctg gac act caa tac agt gac caa aac aga ttc aac 1440Leu Leu Lys His Leu Asp Thr Gln Tyr Ser Asp Gln Asn Arg Phe Asn465 470 475 480ctg tgc ttt gaa gaa aga gac ttt gtc cca gga gaa aac cgc att gcc 1488Leu Cys Phe Glu Glu Arg Asp Phe Val Pro Gly Glu Asn Arg Ile Ala 485 490 495aat atc cag gat gcc atc tgg aac agt aga aag atc gtt tgt ctt gtg 1536Asn Ile Gln Asp Ala Ile Trp Asn Ser Arg Lys Ile Val Cys Leu Val 500 505 510agc aga cac ttc ctt aga gat ggc tgg tgc ctt gaa gcc ttc agt tat 1584Ser Arg His Phe Leu Arg Asp Gly Trp Cys Leu Glu Ala Phe Ser Tyr 515 520 525gcc cag ggc agg tgc tta tct gac ctt aac agt gct ctc atc atg gtg 1632Ala Gln Gly Arg Cys Leu Ser Asp Leu Asn Ser Ala Leu Ile Met Val 530 535 540gtg gtt ggg tcc ttg tcc cag tac cag ttg atg aaa cat caa tcc atc 1680Val Val Gly Ser Leu Ser Gln Tyr Gln Leu Met Lys His Gln Ser Ile545 550 555 560aga ggc ttt gta cag aaa cag cag tat ttg agg tgg cct gag gat ctc 1728Arg Gly Phe Val Gln Lys Gln Gln Tyr Leu Arg Trp Pro Glu Asp Leu 565 570 575cag gat gtt ggc tgg ttt ctt cat aaa ctc tct caa cag ata cta aag 1776Gln Asp Val Gly Trp Phe Leu His Lys Leu Ser Gln Gln Ile Leu Lys 580 585 590aaa gaa aaa gaa aag aag aaa gac aat aac att ccg ttg caa act gta 1824Lys Glu Lys Glu Lys Lys Lys Asp Asn Asn Ile Pro Leu Gln Thr Val 595 600 605gca acc atc tcc taa 1839Ala Thr Ile Ser * 61010612PRTHomo sapiens 10Met Cys Arg Ala Ile Ser Leu Arg Arg Leu Leu Leu Leu Leu Leu Gln1 5 10 15Leu Ser Gln Leu Leu Ala Val Thr Gln Gly Lys Thr Leu Val Leu Gly 20 25 30Lys Glu Gly Glu Ser Ala Glu Leu Pro Cys Glu Ser Ser Gln Lys Lys 35 40 45Ile Thr Val Phe Thr Trp Lys Phe Ser Asp Gln Arg Lys Ile Leu Gly 50 55 60Gln His Gly Lys Gly Val Leu Ile Arg Gly Gly Ser Pro Ser Gln Phe65 70 75 80Asp Arg Phe Asp Ser Lys Lys Gly Ala Trp Glu Lys Gly Ser Phe Pro 85 90 95Leu Ile Ile Asn Lys Leu Lys Met Glu Asp Ser Gln Thr Tyr Ile Cys 100 105 110Glu Leu Glu Asn Arg Lys Glu Glu Val Glu Leu Trp Val Phe Lys Val 115 120 125Thr Phe Ser Pro Gly Thr Ser Leu Leu Gln Gly Gln Ser Leu Thr Leu 130 135 140Thr Leu Asp Ser Asn Ser Lys Val Ser Asn Pro Leu Thr Glu Cys Lys145 150 155 160His Lys Lys Gly Lys Val Val Ser Gly Ser Lys Val Leu Ser Met Ser 165 170 175Asn Leu Arg Val Gln Asp Ser Asp Phe Trp Asn Cys Thr Val Thr Leu 180 185 190Asp Gln Lys Lys Asn Trp Phe Gly Met Thr Leu Ser Val Leu Gly Phe 195 200 205Gln Ser Thr Ala Ile Thr Ala Tyr Lys Ser Glu Gly Glu Ser Ala Glu 210 215 220Phe Ser Phe Pro Leu Asn Phe Ala Glu Glu Asn Gly Trp Gly Glu Leu225 230 235 240Met Trp Lys Ala Glu Lys Asp Ser Phe Phe Gln Pro Trp Ile Ser Phe 245 250 255Ser Ile Lys Asn Lys Glu Val Ser Val Gln Lys Ser Thr Lys Asp Leu 260 265 270Lys Leu Gln Leu Lys Glu Thr Leu Pro Leu Thr Leu Lys Ile Pro Gln 275 280 285Val Ser Leu Gln Phe Ala Gly Ser Gly Asn Leu Thr Leu Thr Leu Asp 290 295 300Lys Gly Thr Leu His Gln Glu Val Asn Leu Val Val Met Lys Val Ala305 310 315 320Gln Leu Asn Asn Thr Leu Thr Cys Glu Val Met Gly Pro Thr Ser Pro 325 330 335Lys Met Arg Leu Thr Leu Lys Gln Glu Asn Gln Glu Ala Arg Val Ser 340 345 350Glu Glu Gln Lys Val Val Gln Val Val Ala Pro Glu Thr Gly Leu Trp 355 360 365Gln Cys Leu Leu Ser Glu Gly Asp Lys Val Lys Met Asp Ser Arg Ile 370 375 380Gln Val Leu Ser Arg Gly Val Tyr Gln Phe Ser Leu Phe Ile Val Cys385 390 395 400Thr Val Thr Leu Thr Leu Phe Leu Met Thr Ile Leu Thr Val Thr Lys 405 410 415Phe Arg Gly Phe Cys Phe Ile Cys Tyr Lys Thr Ala Gln Arg Leu Val 420 425 430Phe Lys Asp His Pro Gln Gly Thr Glu Pro Asp Met Tyr Lys Tyr Asp 435 440 445Ala Tyr Leu Cys Phe Ser Ser Lys Asp Phe Thr Trp Val Gln Asn Ala 450 455 460Leu Leu Lys His Leu Asp Thr Gln Tyr Ser Asp Gln Asn Arg Phe Asn465 470 475 480Leu Cys Phe Glu Glu Arg Asp Phe Val Pro Gly Glu Asn Arg Ile Ala 485 490 495Asn Ile Gln Asp Ala Ile Trp Asn Ser Arg Lys Ile Val Cys Leu Val 500 505 510Ser Arg His Phe Leu Arg Asp Gly Trp Cys Leu Glu Ala Phe Ser Tyr 515 520 525Ala Gln Gly Arg Cys Leu Ser Asp Leu Asn Ser Ala Leu Ile Met Val 530 535 540Val Val Gly Ser Leu Ser Gln Tyr Gln Leu Met Lys His Gln Ser Ile545 550 555 560Arg Gly Phe Val Gln Lys Gln Gln Tyr Leu Arg Trp Pro Glu Asp Leu 565 570 575Gln Asp Val Gly Trp Phe Leu His Lys Leu Ser Gln Gln Ile Leu Lys 580 585 590Lys Glu Lys Glu Lys Lys Lys Asp Asn Asn Ile Pro Leu Gln Thr Val 595 600 605Ala Thr Ile Ser 61011572PRTC. jejuni 11Met Gly Phe Arg Ile Asn Thr Asn Val Ala Ala Leu Asn Ala Lys Ala1 5 10 15Asn Ala Asp Leu Asn Ser Lys Ser Leu Asp Ala Ser Leu Ser Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Ala Asp Asp Ala Ser Gly Met 35 40 45Ala Ile Ala Asp Thr Leu Arg Ser Gln Ala Asn Thr Leu Gly Gln Ala 50 55 60Ile Ser Asn Gly Asn Asp Ala Ile Gly Ile Leu Gln Thr Ala Asp Lys65 70 75 80Ala Met Asp Glu Gln Leu Lys Ile Leu Asp Thr Ile Lys Thr Lys Ala 85 90 95Thr Gln Ala Ala Gln Asp Gly Gln Ser Leu Lys Thr Arg Thr Met Leu 100 105 110Gln Ala Asp Ile Asn Arg Leu Met Glu Glu Leu Asp Asn Ile Ala Asn 115 120 125Thr Thr Ser Phe Asn Gly Lys Gln Leu Leu Ser Gly Asn Phe Ile Asn 130 135 140Gln Glu Phe Gln Ile Gly Ala Ser Ser Asn Gln Thr Val Lys Ala Thr145 150 155 160Ile Gly Ala Thr Gln Ser Ser Lys Ile Gly Leu Thr Arg Phe Glu Thr 165 170 175Gly Gly Arg Ile Ser Thr Ser Gly Glu Val Gln Phe Thr Leu Lys Asn 180 185 190Tyr Asn Gly Ile Asp Asp Phe Gln Phe Gln Lys Val Val Ile Ser Thr 195 200 205Ser Val Gly Thr Gly Leu Gly Ala Leu Ala Asp Glu Ile Asn Lys Asn 210 215 220Ala Asp Lys Thr Gly Val Arg Ala Thr Phe Thr Val Glu Thr Arg Gly225 230 235 240Ile Ala Ala Val Arg Ala Gly Ala Thr Ser Asp Thr Phe Ala Ile Asn 245 250 255Gly Val Lys Ile Gly Lys Val Asp Tyr Lys Asp Gly Asp Ala Asn Gly 260 265 270Ala Leu Val Ala Ala Ile Asn Ser Val Lys Asp Thr Thr Gly Val Glu 275 280 285Ala Ser Ile Asp Ala Asn Gly Gln Leu Leu Leu Thr Ser Arg Glu Gly 290 295 300Arg Gly Ile Lys Ile Asp Gly Asn Ile Gly Gly Gly Ala Phe Ile Asn305 310 315 320Ala Asp Met Lys Glu Asn Tyr Gly Arg Leu Ser Leu Val Lys Asn Asp 325 330 335Gly Lys Asp Ile Leu Ile Ser Gly Ser Asn Leu Ser Ser Ala Gly Phe 340 345 350Gly Ala Thr Gln Phe Ile Ser Gln Ala Ser Val Ser Leu Arg Glu Ser 355 360 365Lys Gly Gln Ile Asp Ala Asn Ile Ala Asp Ala Met Gly Phe Gly Ser 370 375 380Ala Asn Lys Gly Val Val Leu Gly Gly Tyr Ser Ser Val Ser Ala Tyr385 390 395 400Met Ser Ser Ala Gly Ser Gly Phe Ser Ser Gly Ser Gly Tyr Ser Val 405 410 415Gly Ser Gly Lys Asn Tyr Ser Thr Gly Phe Ala Asn Ala Ile Ala Ile 420 425 430Ser Ala Ala Ser Gln Leu Ser Thr Val Tyr Asn Val Ser Ala Gly Ser 435 440 445Gly Phe Ser Ser Gly Ser Thr Leu Ser Gln Phe Ala Thr Met Lys Thr 450 455 460Thr Ala Phe Gly Val Lys Asp Glu Thr Ala Gly Val Thr Thr Leu Lys465 470 475 480Gly Ala Met Ala Val Met Asp Ile Ala Glu Thr Ala Thr Thr Asn Leu 485 490 495Asp Gln Ile Arg Ala Asp Ile Gly Ser Val Gln Asn Gln Val Thr Ser 500 505 510Thr Ile Asn Asn Ile Thr Val Thr Gln Val Asn Val Lys Ala Ala Glu 515 520 525Ser Gln Ile Arg Asp Val Asp Phe Ala Ala Glu Ser Ala Asn Tyr Ser 530 535 540Lys Ala Asn Ile Leu Ala Gln Ser Gly Ser Tyr Ala Met Ala Gln Ala545 550 555 560Asn Ser Val His Gln Asn Val Leu Arg Leu Leu Gln 565 57012510PRTH. pylori 12Met Ala Phe Gln Val Asn Thr Asn Ile Asn Ala Met Asn Ala His Val1 5 10 15Gln Ser Ala Leu Thr Gln Asn Ala Leu Lys Thr Ser Leu Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Lys Ala Ala Asp Asp Ala Ser Gly Met 35 40 45Thr Val Ala Asp Ser Leu Arg Ser Gln Ala Ser Ser Leu Gly Gln Ala 50 55 60Ile Ala Asn Thr Asn Asp Gly Met Gly Ile Ile Gln Val Ala Asp Lys65 70 75 80Ala Met Asp Glu Gln Leu Lys Ile Leu Asp Thr Val Lys Val Lys Ala 85 90 95Thr Gln Ala Ala Gln Asp Gly Gln Thr Thr Glu Ser Arg Lys Ala Ile 100 105 110Gln Ser Asp Ile Val Arg Leu Ile Gln Gly Leu Asp Asn Ile Gly Asn 115 120 125Thr Thr Thr Tyr Asn Gly Gln Ala Leu Leu Ser Gly Gln Phe Thr Asn 130 135 140Lys Glu Phe Gln Val Gly Ala Tyr Ser Asn Gln Ser Ile Lys Ala Ser145 150 155 160Ile Gly Ser Thr Thr Ser Asp Lys Ile Gly Gln Val Arg Ile Ala Thr 165 170 175Gly Ala Leu Ile Thr Ala Ser Gly Asp Ile Ser Leu Thr Phe Lys Gln 180 185 190Val Asp Gly Val Asn Asp Val Thr Leu Glu Ser Val Lys Val Ser Ser 195 200 205Ser Ala Gly Thr Gly Ile Gly Val Leu Ala Glu Val Ile Asn Lys Asn 210 215 220Ser Asn Arg Thr Gly

Val Lys Ala Tyr Ala Ser Val Ile Thr Thr Ser225 230 235 240Asp Val Ala Val Gln Ser Gly Ser Leu Ser Asn Leu Thr Leu Asn Gly 245 250 255Ile His Leu Gly Asn Ile Ala Asp Ile Lys Lys Asn Asp Ser Asp Gly 260 265 270Arg Leu Val Ala Ala Ile Asn Ala Val Thr Ser Glu Thr Gly Val Glu 275 280 285Ala Tyr Thr Asp Gln Lys Gly Arg Leu Asn Leu Arg Ser Ile Asp Gly 290 295 300Arg Gly Ile Glu Ile Lys Thr Asp Ser Val Ser Asn Gly Pro Ser Ala305 310 315 320Leu Thr Met Val Asn Gly Gly Gln Asp Leu Thr Lys Gly Ser Thr Asn 325 330 335Tyr Gly Arg Leu Ser Leu Thr Arg Leu Asp Ala Lys Ser Ile Asn Val 340 345 350Val Ser Ala Ser Asp Ser Gln His Leu Gly Phe Thr Ala Ile Gly Phe 355 360 365Gly Glu Ser Gln Val Ala Glu Thr Thr Val Asn Leu Arg Asp Val Thr 370 375 380Gly Asn Phe Asn Ala Asn Val Lys Ser Ala Ser Gly Ala Asn Tyr Asn385 390 395 400Ala Val Ile Ala Ser Gly Asn Gln Ser Leu Gly Ser Gly Val Thr Thr 405 410 415Leu Arg Gly Ala Met Val Val Ile Asp Ile Ala Glu Ser Ala Met Lys 420 425 430Met Leu Asp Lys Val Arg Ser Asp Leu Gly Ser Val Gln Asn Gln Met 435 440 445Ile Ser Thr Val Asn Asn Ile Ser Ile Thr Gln Val Asn Val Lys Ala 450 455 460Ala Glu Ser Gln Ile Arg Asp Val Asp Phe Ala Glu Glu Ser Ala Asn465 470 475 480Phe Asn Lys Asn Asn Ile Leu Ala Gln Ser Gly Ser Tyr Ala Met Ser 485 490 495Gln Ala Asn Thr Val Gln Gln Asn Ile Leu Arg Leu Leu Thr 500 505 51013379PRTV. cholerae 13Met Thr Ile Asn Val Asn Thr Asn Val Ser Ala Met Thr Ala Gln Arg1 5 10 15Tyr Leu Thr Lys Ala Thr Gly Glu Leu Asn Thr Ser Met Glu Arg Leu 20 25 30Ser Ser Gly Asn Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Leu 35 40 45Gln Ile Ser Asn Arg Leu Thr Ala Gln Ser Arg Gly Leu Asp Val Ala 50 55 60Met Arg Asn Ala Asn Asp Gly Ile Ser Ile Ala Gln Thr Ala Glu Gly65 70 75 80Ala Met Asn Glu Ser Thr Ser Ile Leu Gln Arg Met Arg Asp Leu Ala 85 90 95Leu Gln Ser Ala Asn Gly Thr Asn Ser Ala Ser Glu Arg Gln Ala Leu 100 105 110Asn Glu Glu Ser Val Ala Leu Gln Asp Glu Leu Asn Arg Ile Ala Glu 115 120 125Thr Thr Ser Phe Gly Gly Arg Lys Leu Leu Asn Gly Ser Phe Gly Glu 130 135 140Ala Ser Phe Gln Ile Gly Ser Ser Ser Gly Glu Ala Ile Ile Met Gly145 150 155 160Leu Thr Ser Val Arg Ala Asp Asp Phe Arg Met Gly Gly Gln Ser Phe 165 170 175Ile Ala Glu Gln Pro Lys Thr Lys Glu Trp Gly Val Pro Pro Thr Ala 180 185 190Arg Asp Leu Lys Phe Glu Phe Thr Lys Lys Asp Gly Glu Ala Val Val 195 200 205Leu Asp Ile Ile Ala Lys Asp Gly Asp Asp Ile Glu Glu Leu Ala Thr 210 215 220Tyr Ile Asn Gly Gln Thr Asp Leu Phe Lys Ala Ser Val Asp Gln Glu225 230 235 240Gly Lys Leu Gln Ile Phe Val Ala Glu Pro Asn Ile Glu Gly Asn Phe 245 250 255Asn Ile Ser Gly Gly Leu Ala Thr Glu Leu Gly Leu Asn Gly Gly Pro 260 265 270Gly Val Lys Thr Thr Val Gln Asp Ile Asp Ile Thr Ser Val Gly Gly 275 280 285Ser Gln Asn Ala Val Gly Ile Ile Asp Ala Ala Leu Lys Tyr Val Asp 290 295 300Ser Gln Arg Ala Asp Leu Gly Ala Lys Gln Asn Arg Leu Ser His Ser305 310 315 320Ile Ser Asn Leu Ser Asn Ile Gln Glu Asn Val Glu Ala Ser Lys Ser 325 330 335Arg Ile Lys Asp Thr Asp Phe Ala Lys Glu Thr Thr Gln Leu Thr Lys 340 345 350Ser Gln Ile Leu Gln Gln Ala Gly Thr Ser Ile Leu Ala Gln Ala Lys 355 360 365Gln Leu Pro Asn Ser Ala Ile Ser Leu Leu Gln 370 37514394PRTP. aeruginosa 14Met Ala Leu Thr Val Asn Thr Asn Ile Ala Ser Leu Asn Thr Gln Arg1 5 10 15Asn Leu Asn Asn Ser Ser Ala Ser Leu Asn Thr Ser Leu Gln Arg Leu 20 25 30Ser Thr Gly Ser Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Leu 35 40 45Gln Ile Ala Asn Arg Leu Thr Ser Gln Val Asn Gly Leu Asn Val Ala 50 55 60Thr Lys Asn Ala Asn Asp Gly Ile Ser Leu Ala Gln Thr Ala Glu Gly65 70 75 80Ala Leu Gln Gln Ser Thr Asn Ile Leu Gln Arg Met Arg Asp Leu Ser 85 90 95Leu Gln Ser Ala Asn Gly Ser Asn Ser Asp Ser Glu Arg Thr Ala Leu 100 105 110Asn Gly Glu Ala Lys Gln Leu Gln Lys Glu Leu Asp Arg Ile Ser Asn 115 120 125Thr Thr Thr Phe Gly Gly Arg Lys Leu Leu Asp Gly Ser Phe Gly Val 130 135 140Ala Ser Phe Gln Val Gly Ser Ala Ala Asn Glu Ile Ile Ser Val Gly145 150 155 160Ile Asp Glu Met Ser Ala Glu Ser Leu Asn Gly Thr Tyr Phe Lys Ala 165 170 175Asp Gly Gly Gly Ala Val Thr Ala Ala Thr Ala Ser Gly Thr Val Asp 180 185 190Ile Ala Ile Gly Ile Thr Gly Gly Ser Ala Val Asn Val Lys Val Asp 195 200 205Met Lys Gly Asn Glu Thr Ala Glu Gln Ala Ala Ala Lys Ile Ala Ala 210 215 220Ala Val Asn Asp Ala Asn Val Gly Ile Gly Ala Phe Ser Asp Gly Asp225 230 235 240Thr Ile Ser Tyr Val Ser Lys Ala Gly Lys Asp Gly Ser Gly Ala Ile 245 250 255Thr Ser Ala Val Ser Gly Val Val Ile Ala Asp Thr Gly Ser Thr Gly 260 265 270Val Gly Thr Ala Ala Gly Val Ala Pro Ser Ala Thr Ala Phe Ala Lys 275 280 285Thr Asn Asp Thr Val Ala Lys Ile Asp Ile Ser Thr Ala Lys Ala Leu 290 295 300Ser Arg Arg Ala Gly Asp Arg Thr Thr Ala Ile Lys Gln Ile Asp Ala305 310 315 320Ser Val Pro Thr Ser Val Ala Val Gln Asn Arg Phe Asp Asn Thr Ile 325 330 335Asn Asn Leu Lys Asn Ile Gly Glu Asn Val Ser Ala Ala Arg Gly Arg 340 345 350Ile Glu Asp Thr Asp Phe Ala Ala Glu Thr Ala Asn Leu Thr Lys Asn 355 360 365Gln Val Leu Gln Gln Ala Gly Thr Ala Ile Leu Ala Gln Ala Asn Gln 370 375 380Leu Pro Gln Ser Val Leu Ser Leu Leu Arg385 39015170PRTR. sphaeroides 15Met Thr Thr Ile Asn Thr Asn Ile Gly Ala Ile Ala Ala Gln Ala Asn1 5 10 15Met Thr Lys Val Asn Asp Gln Phe Asn Thr Ala Met Thr Arg Leu Ser 20 25 30Thr Gly Leu Arg Ile Asn Ala Ala Lys Asp Asp Ala Ala Gly Met Ala 35 40 45Ile Gly Glu Lys Met Thr Ala Gln Val Met Gly Leu Asn Gln Ala Ile 50 55 60Arg Asn Ala Gln Asp Gly Lys Asn Leu Val Asp Thr Thr Glu Gly Ala65 70 75 80His Val Glu Val Ser Ser Met Leu Gln Arg Leu Arg Glu Leu Ala Val 85 90 95Gln Ser Ser Asn Asp Thr Asn Thr Ala Ala Asp Arg Gly Ser Leu Ala 100 105 110Ala Glu Gly Lys Gln Leu Ile Ala Glu Ile Asn Arg Val Ala Glu Ser 115 120 125Thr Thr Phe Asn Gly Met Lys Val Leu Asp Gly Ser Phe Thr Gly Lys 130 135 140Gln Leu Gln Ile Gly Ala Asp Ser Gly Gln Thr Met Ala Ile Asn Val145 150 155 160Asp Ser Ala Ala Ala Thr Asp Ile Gly Ala 165 17016365PRTP. mirabilis1 16Met Ala Gln Val Ile Asn Thr Asn Tyr Leu Ser Leu Val Thr Gln Asn1 5 10 15Asn Leu Asn Lys Ser Gln Gly Thr Leu Gly Ser Ala Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ser Asn Val Asn Gly Leu Thr Gln Ala 50 55 60Ser Arg Asn Ala Asn Asp Gly Ile Ser Ile Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Asn Glu Ile Asn Asn Asn Leu Gln Arg Ile Arg Glu Leu Thr 85 90 95Val Gln Ala Lys Asn Gly Thr Asn Ser Asn Ser Asp Ile Thr Ser Ile 100 105 110Gln Asn Glu Val Lys Asn Val Leu Asp Glu Ile Asn Arg Ile Ser Glu 115 120 125Gln Thr Gln Phe Asn Gly Val Lys Val Leu Ser Gly Glu Lys Ser Glu 130 135 140Met Val Ile Gln Val Gly Thr Asn Asp Asn Glu Thr Ile Lys Phe Asn145 150 155 160Leu Asp Lys Val Asp Asn Asp Thr Leu Gly Val Ala Ser Asp Lys Leu 165 170 175Phe Asp Thr Lys Thr Glu Lys Lys Gly Val Thr Ala Ala Gly Ala Gly 180 185 190Val Thr Asp Ala Lys Lys Ile Asn Ala Ala Ala Thr Leu Asp Met Met 195 200 205Val Ser Leu Val Lys Glu Phe Asn Leu Asp Gly Lys Pro Val Thr Asp 210 215 220Lys Phe Ile Val Thr Lys Gly Gly Lys Asp Tyr Val Ala Thr Lys Ser225 230 235 240Asp Phe Glu Leu Asp Ala Thr Gly Thr Lys Leu Gly Leu Lys Ala Ser 245 250 255Ala Thr Thr Glu Phe Lys Val Asp Ala Gly Lys Asp Val Lys Thr Leu 260 265 270Asn Val Lys Asp Asp Ala Leu Ala Thr Leu Asp Lys Ala Ile Asn Thr 275 280 285Ile Asp Glu Ser Arg Ser Lys Leu Gly Ala Ile Gln Asn Arg Phe Glu 290 295 300Ser Thr Ile Asn Asn Leu Asn Asn Thr Val Asn Asn Leu Ser Ala Ser305 310 315 320Arg Ser Arg Ile Leu Asp Ala Asp Tyr Ala Thr Glu Val Ser Asn Met 325 330 335Ser Arg Gly Gln Ile Leu Gln Gln Ala Gly Thr Ser Val Leu Ala Gln 340 345 350Ala Asn Gln Val Pro Gln Thr Val Leu Ser Leu Leu Arg 355 360 36517367PRTP. mirabilis2 17Met Ala Gln Val Ile Asn Thr Asn Tyr Leu Ser Leu Val Thr Gln Asn1 5 10 15Asn Leu Asn Arg Ser Gln Ser Ala Leu Gly Asn Ala Ile Glu Arg Leu 20 25 30Ser Ser Gly Met Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ser Asn Ile Asn Gly Leu Thr Gln Ala 50 55 60Ser Arg Asn Ala Asn Asp Gly Ile Ser Val Ser Gln Thr Thr Glu Gly65 70 75 80Ala Leu Asn Glu Ile Asn Asn Asn Leu Gln Arg Ile Arg Glu Leu Thr 85 90 95Val Gln Ala Lys Asn Gly Thr Asn Ser Asn Ser Asp Ile Asn Ser Ile 100 105 110Gln Asn Glu Val Asn Gln Arg Leu Asp Glu Ile Asn Arg Val Ser Glu 115 120 125Gln Thr Gln Phe Asn Gly Val Lys Val Leu Ser Gly Glu Lys Ser Lys 130 135 140Met Thr Ile Gln Val Gly Thr Asn Asp Asn Glu Val Ile Glu Phe Asn145 150 155 160Leu Asp Lys Ile Asp Asn Asp Thr Leu Gly Val Ala Ser Asp Lys Leu 165 170 175Phe Asp Ala Lys Thr Glu Lys Lys Gly Val Thr Ala Ala Gly Asp Ala 180 185 190Ile Asp Ala Asn Ala Leu Gly Ile Ser Gly Ser Lys Lys Tyr Val Thr 195 200 205Gly Ile Ser Val Lys Glu Tyr Lys Val Asp Gly Lys Val Ser Ser Asp 210 215 220Lys Val Val Leu Asn Asp Gly Ser Asp Asp Tyr Ile Val Ser Lys Ser225 230 235 240Asp Phe Thr Leu Lys Ser Gly Thr Thr Thr Gly Glu Val Glu Phe Thr 245 250 255Gly Ser Lys Thr Thr Lys Phe Thr Ala Asp Ala Gly Lys Asp Val Lys 260 265 270Val Leu Asn Val Lys Asp Asp Ala Leu Ala Thr Leu Asp Asn Ala Ile 275 280 285Ser Lys Val Asp Glu Ser Arg Ser Lys Leu Gly Ala Ile Gln Asn Arg 290 295 300Phe Gln Ser Thr Ile Asn Asn Leu Asn Asn Thr Val Asn Asn Leu Ser305 310 315 320Ala Ser Arg Ser Arg Ile Leu Asp Ala Asp Tyr Ala Thr Glu Val Ser 325 330 335Asn Met Ser Lys Asn Gln Ile Leu Gln Gln Ala Gly Thr Ala Val Leu 340 345 350Ala Gln Ala Asn Gln Val Pro Gln Thr Val Leu Ser Leu Leu Arg 355 360 36518506PRTS. typhimurium2 18Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Leu Thr Gln Asn1 5 10 15Asn Leu Asn Lys Ser Gln Ser Ala Leu Gly Thr Ala Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ala Asn Ile Lys Gly Leu Thr Gln Ala 50 55 60Ser Arg Asn Ala Asn Asp Gly Ile Ser Ile Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Asn Glu Ile Asn Asn Asn Leu Gln Arg Val Arg Glu Leu Ala 85 90 95Val Gln Ser Ala Asn Ser Thr Asn Ser Gln Ser Asp Leu Asp Ser Ile 100 105 110Gln Ala Glu Ile Thr Gln Arg Leu Asn Glu Ile Asp Arg Val Ser Gly 115 120 125Gln Thr Gln Phe Asn Gly Val Lys Val Leu Ala Gln Asp Asn Thr Leu 130 135 140Thr Ile Gln Val Gly Ala Asn Asp Gly Glu Thr Ile Asp Ile Asp Leu145 150 155 160Lys Gln Ile Asn Ser Gln Thr Leu Gly Leu Asp Ser Leu Asn Val Gln 165 170 175Lys Ala Tyr Asp Val Lys Asp Thr Ala Val Thr Thr Lys Ala Tyr Ala 180 185 190Asn Asn Gly Thr Thr Leu Asp Val Ser Gly Leu Asp Asp Ala Ala Ile 195 200 205Lys Ala Ala Thr Gly Gly Thr Asn Gly Thr Ala Ser Val Thr Gly Gly 210 215 220Ala Val Lys Phe Asp Ala Asp Asn Asn Lys Tyr Phe Val Thr Ile Gly225 230 235 240Gly Phe Thr Gly Ala Asp Ala Ala Lys Asn Gly Asp Tyr Glu Val Asn 245 250 255Val Ala Thr Asp Gly Thr Val Thr Leu Ala Ala Gly Ala Thr Lys Thr 260 265 270Thr Met Pro Ala Gly Ala Thr Thr Lys Thr Glu Val Gln Glu Leu Lys 275 280 285Asp Thr Pro Ala Val Val Ser Ala Asp Ala Lys Asn Ala Leu Ile Ala 290 295 300Gly Gly Val Asp Ala Thr Asp Ala Asn Gly Ala Glu Leu Val Lys Met305 310 315 320Ser Tyr Thr Asp Lys Asn Gly Lys Thr Ile Glu Gly Gly Tyr Ala Leu 325 330 335Lys Ala Gly Asp Lys Tyr Tyr Ala Ala Asp Tyr Asp Glu Ala Thr Gly 340 345 350Ala Ile Lys Ala Lys Thr Thr Ser Tyr Thr Ala Ala Asp Gly Thr Thr 355 360 365Lys Thr Ala Ala Asn Gln Leu Gly Gly Val Asp Gly Lys Thr Glu Val 370 375 380Val Thr Ile Asp Gly Lys Thr Tyr Asn Ala Ser Lys Ala Ala Gly His385 390 395 400Asp Phe Lys Ala Gln Pro Glu Leu Ala Glu Ala Ala Ala Lys Thr Thr 405 410 415Glu Asn Pro Leu Gln Lys Ile Asp Ala Ala Leu Ala Gln Val Asp Ala 420 425 430Leu Arg Ser Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile 435 440 445Thr Asn Leu Gly Asn Thr Val Asn Asn Leu Ser Glu Ala Arg Ser Arg 450 455 460Ile Glu Asp Ser Asp Tyr Ala Thr Glu Val Ser Asn Met Ser Arg Ala465 470 475 480Gln Ile Leu Gln Gln Ala Gly Thr Ser Val Leu Ala Gln Ala Asn Gln 485 490 495Val Pro Gln Asn Val

Leu Ser Leu Leu Arg 500 50519490PRTS. typhimurium1 19Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Leu Thr Gln Asn1 5 10 15Asn Leu Asn Lys Ser Gln Ser Ala Leu Gly Thr Ala Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ala Asn Ile Lys Gly Leu Thr Gln Ala 50 55 60Ser Arg Asn Ala Asn Asp Gly Ile Ser Ile Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Asn Glu Ile Asn Asn Asn Leu Gln Arg Val Arg Glu Leu Ala 85 90 95Val Gln Ser Ala Asn Ser Thr Asn Ser Gln Ser Asp Leu Asp Ser Ile 100 105 110Gln Ala Glu Ile Thr Gln Arg Leu Asn Glu Ile Asp Arg Val Asn Gly 115 120 125Gln Thr Gln Phe Ser Gly Val Lys Val Leu Ala Gln Asp Asn Thr Leu 130 135 140Thr Ile Gln Val Gly Ala Asn Asp Gly Glu Thr Ile Asp Ile Asp Leu145 150 155 160Lys Gln Ile Asn Ser Gln Thr Leu Gly Leu Asp Thr Leu Asn Val Gln 165 170 175Gln Lys Tyr Lys Val Ser Asp Thr Ala Ala Thr Val Thr Gly Tyr Ala 180 185 190Asp Thr Thr Ile Ala Leu Asp Asn Ser Thr Phe Lys Ala Ser Ala Thr 195 200 205Gly Leu Gly Gly Thr Asp Glu Lys Ile Asp Gly Asp Leu Lys Phe Asp 210 215 220Asp Thr Thr Gly Lys Tyr Tyr Ala Lys Val Thr Val Thr Gly Gly Thr225 230 235 240Gly Lys Asp Gly Tyr Tyr Glu Val Ser Val Asp Lys Thr Asn Gly Glu 245 250 255Val Thr Leu Ala Ala Val Thr Pro Ala Thr Val Thr Thr Ala Thr Ala 260 265 270Leu Ser Gly Lys Met Tyr Ser Ala Asn Pro Asp Ser Asp Ile Ala Lys 275 280 285Ala Ala Leu Thr Ala Ala Gly Val Thr Gly Thr Ala Ser Val Val Lys 290 295 300Met Ser Tyr Thr Asp Asn Asn Gly Lys Thr Ile Asp Gly Gly Leu Ala305 310 315 320Val Lys Val Gly Asp Asp Tyr Tyr Ser Ala Thr Gln Asp Lys Asp Gly 325 330 335Ser Ile Ser Ile Asp Thr Thr Lys Tyr Thr Ala Asp Asn Gly Thr Ser 340 345 350Lys Thr Ala Leu Asn Lys Leu Gly Gly Ala Asp Gly Lys Thr Glu Val 355 360 365Val Thr Ile Asp Gly Lys Thr Tyr Asn Ala Ser Lys Ala Ala Gly His 370 375 380Asp Phe Lys Ala Glu Pro Glu Leu Ala Glu Gln Ala Ala Lys Thr Thr385 390 395 400Glu Asn Pro Leu Gln Lys Ile Asp Ala Ala Leu Ala Gln Val Asp Thr 405 410 415Leu Arg Ser Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile 420 425 430Thr Asn Leu Gly Asn Thr Val Asn Asn Leu Ser Ser Ala Arg Ser Arg 435 440 445Ile Glu Asp Ser Asp Tyr Ala Thr Glu Val Ser Asn Met Ser Arg Ala 450 455 460Gln Ile Leu Gln Gln Ala Gly Thr Ser Val Leu Ala Gln Ala Asn Gln465 470 475 480Val Pro Gln Asn Val Leu Ser Leu Leu Arg 485 49020351PRTS. marcesens 20Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Met Ala Gln Asn1 5 10 15Asn Leu Asn Lys Ser Gln Ser Ser Leu Gly Thr Ala Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ser Asn Arg Phe Thr Ala Asn Ile Lys Gly Leu Thr Gln Ala 50 55 60Ser Arg Asn Ala Asn Asp Gly Ile Ser Leu Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Asn Glu Val Asn Asp Asn Leu Gln Asn Ile Arg Arg Leu Thr 85 90 95Val Gln Ala Gln Asn Gly Ser Asn Ser Thr Ser Asp Leu Lys Ser Ile 100 105 110Gln Asp Glu Ile Thr Gln Arg Leu Ser Glu Ile Asn Arg Ile Ser Glu 115 120 125Gln Thr Asp Phe Asn Gly Val Lys Val Leu Ser Ser Asp Gln Lys Leu 130 135 140Thr Ile Gln Val Gly Ala Asn Asp Gly Glu Thr Thr Asp Ile Asp Leu145 150 155 160Lys Lys Ile Asp Ala Lys Gln Leu Gly Met Asp Thr Phe Asp Val Thr 165 170 175Thr Lys Ser Ala Lys Ala Gly Ala Glu Ile Ala Thr Gly Thr Lys Ile 180 185 190Thr Val Asp Ser Asp Ala Thr Lys Gln Ala Asp Ala Asp Val Thr Gly 195 200 205Leu Ala Lys Gly Gln Thr Leu Val Ser Gly Thr Asp Ala Asp Gly Lys 210 215 220Ser Ala Tyr Phe Ile Ala Thr Lys Asp Asp Ala Thr Gly Asp Val Ala225 230 235 240Tyr Thr Lys Ala Lys Val Ala Asp Asp Gly Lys Val Thr Asp Ser Gly 245 250 255Thr Asp Ala Gly Val Lys Asn Pro Leu Ala Thr Leu Asp Lys Ala Leu 260 265 270Ala Gln Val Asp Gly Leu Arg Ser Ser Leu Gly Ala Val Gln Asn Arg 275 280 285Phe Asp Ser Val Ile Asn Asn Leu Asn Ser Thr Val Asn Asn Leu Ser 290 295 300Ala Ser Gln Ser Arg Ile Gln Asp Ala Asp Tyr Ala Thr Glu Val Ser305 310 315 320Asn Met Ser Arg Ala Asn Ile Leu Gln Gln Ala Gly Thr Ser Val Leu 325 330 335Ala Gln Ala Asn Gln Ser Thr Gln Asn Val Leu Ser Leu Leu Arg 340 345 35021554PRTE. coli 21Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Ile Thr Gln Asn1 5 10 15Asn Ile Asn Lys Asn Gln Ser Ala Leu Ser Ser Ser Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ser Asn Ile Lys Gly Leu Thr Gln Ala 50 55 60Ala Arg Asn Ala Asn Asp Gly Ile Ser Val Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Ser Glu Ile Asn Asn Asn Leu Gln Arg Ile Arg Glu Leu Thr 85 90 95Val Gln Ala Thr Thr Gly Thr Asn Ser Asp Ser Asp Leu Asp Ser Ile 100 105 110Gln Asp Glu Ile Lys Ser Arg Leu Asp Glu Ile Asp Arg Val Ser Gly 115 120 125Gln Thr Gln Phe Asn Gly Val Asn Val Leu Ser Lys Asp Gly Ser Met 130 135 140Lys Ile Gln Val Gly Ala Asn Asp Gly Glu Thr Ile Thr Ile Asp Leu145 150 155 160Lys Lys Ile Asp Ser Asp Thr Leu Asn Leu Ala Gly Phe Asn Val Asn 165 170 175Gly Glu Gly Glu Thr Ala Asn Thr Ala Ala Thr Leu Lys Asp Met Val 180 185 190Gly Leu Lys Leu Asp Asn Thr Gly Val Thr Thr Ala Gly Val Asn Arg 195 200 205Tyr Ile Ala Asp Lys Ala Val Ala Ser Ser Thr Asp Ile Leu Asn Ala 210 215 220Val Ala Gly Val Asp Gly Ser Lys Val Ser Thr Glu Ala Asp Val Gly225 230 235 240Phe Gly Ala Ala Ala Pro Gly Thr Pro Val Glu Tyr Thr Tyr His Lys 245 250 255Asp Thr Asn Thr Tyr Thr Ala Ser Ala Ser Val Asp Ala Thr Gln Leu 260 265 270Ala Ala Phe Leu Asn Pro Glu Ala Gly Gly Thr Thr Ala Ala Thr Val 275 280 285Ser Ile Gly Asn Gly Thr Thr Ala Gln Glu Gln Lys Val Ile Ile Ala 290 295 300Lys Asp Gly Ser Leu Thr Ala Ala Asp Asp Gly Ala Ala Leu Tyr Leu305 310 315 320Asp Asp Thr Gly Asn Leu Ser Lys Thr Asn Ala Gly Thr Asp Thr Gln 325 330 335Ala Lys Leu Ser Asp Leu Met Ala Asn Asn Ala Asn Ala Lys Thr Val 340 345 350Ile Thr Thr Asp Lys Gly Thr Phe Thr Ala Asn Thr Thr Lys Phe Asp 355 360 365Gly Val Asp Ile Ser Val Asp Ala Ser Thr Phe Ala Asn Ala Val Lys 370 375 380Asn Glu Thr Tyr Thr Ala Thr Val Gly Val Thr Leu Pro Ala Thr Tyr385 390 395 400Thr Val Asn Asn Gly Thr Ala Ala Ser Ala Tyr Leu Val Asp Gly Lys 405 410 415Val Ser Lys Thr Pro Ala Glu Tyr Phe Ala Gln Ala Asp Gly Thr Ile 420 425 430Thr Ser Gly Glu Asn Ala Ala Thr Ser Lys Ala Ile Tyr Val Ser Ala 435 440 445Asn Gly Asn Leu Thr Thr Asn Thr Thr Ser Glu Ser Glu Ala Thr Thr 450 455 460Asn Pro Leu Ala Ala Leu Asp Asp Ala Ile Ala Ser Ile Asp Lys Phe465 470 475 480Arg Ser Ser Leu Gly Ala Ile Gln Asn Arg Leu Asp Ser Ala Val Thr 485 490 495Asn Leu Asn Asn Thr Thr Thr Asn Leu Ser Glu Ala Gln Ser Arg Ile 500 505 510Gln Asp Ala Asp Tyr Ala Thr Glu Val Ser Asn Met Ser Lys Ala Gln 515 520 525Ile Ile Gln Gln Ala Gly Asn Ser Val Leu Ala Lys Ala Asn Gln Val 530 535 540Pro Gln Gln Val Leu Ser Leu Gln Gln Gly545 55022550PRTS. flexneri 22Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Ile Thr Gln Asn1 5 10 15Asn Ile Asn Lys Asn Gln Ser Ala Leu Ser Ser Ser Ile Glu Arg Leu 20 25 30Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln 35 40 45Ala Ile Ala Asn Arg Phe Thr Ser Asn Ile Lys Gly Leu Thr Gln Ala 50 55 60Ala Arg Asn Ala Asn Asp Gly Ile Ser Val Ala Gln Thr Thr Glu Gly65 70 75 80Ala Leu Ser Glu Ile Asn Asn Asn Leu Gln Arg Ile Arg Glu Leu Thr 85 90 95Val Gln Ala Ser Thr Gly Thr Asn Ser Asp Ser Asp Leu Asp Ser Ile 100 105 110Gln Asp Glu Ile Lys Ser Arg Leu Asp Glu Ile Asp Arg Val Ser Gly 115 120 125Gln Thr Gln Phe Asn Gly Val Asn Val Leu Ala Lys Asp Gly Ser Met 130 135 140Lys Ile Gln Val Gly Ala Asn Asp Gly Gln Thr Ile Thr Ile Asp Leu145 150 155 160Lys Lys Ile Asp Ser Asp Thr Leu Gly Leu Asn Gly Phe Asn Val Asn 165 170 175Gly Gly Gly Ala Val Ala Asn Thr Ala Ala Ser Lys Ala Asp Leu Val 180 185 190Ala Ala Asn Ala Thr Val Val Gly Asn Lys Tyr Thr Val Ser Ala Gly 195 200 205Tyr Asp Ala Ala Lys Ala Ser Asp Leu Leu Ala Gly Val Ser Asp Gly 210 215 220Asp Thr Val Gln Ala Thr Ile Asn Asn Gly Phe Gly Thr Ala Ala Ser225 230 235 240Ala Thr Asn Tyr Lys Tyr Asp Ser Ala Ser Lys Ser Tyr Ser Phe Asp 245 250 255Thr Thr Thr Ala Ser Ala Ala Asp Val Gln Lys Tyr Leu Thr Pro Gly 260 265 270Val Gly Asp Thr Ala Lys Gly Thr Ile Thr Ile Asp Gly Ser Ala Gln 275 280 285Asp Val Gln Ile Ser Ser Asp Gly Lys Ile Thr Ala Ser Asn Gly Asp 290 295 300Lys Leu Tyr Ile Asp Thr Thr Gly Arg Leu Thr Lys Asn Gly Ser Gly305 310 315 320Ala Ser Leu Thr Glu Ala Ser Leu Ser Thr Leu Ala Ala Asn Asn Thr 325 330 335Lys Ala Thr Thr Ile Asp Ile Gly Gly Thr Ser Ile Ser Phe Thr Gly 340 345 350Asn Ser Thr Thr Pro Asp Thr Ile Thr Tyr Ser Val Thr Gly Ala Lys 355 360 365Val Asp Gln Ala Ala Phe Asp Lys Ala Val Ser Thr Ser Gly Asn Asn 370 375 380Val Asp Phe Thr Thr Ala Gly Tyr Ser Val Asn Gly Thr Thr Gly Ala385 390 395 400Val Thr Lys Gly Val Asp Ser Val Tyr Val Asp Asn Asn Glu Ala Leu 405 410 415Thr Thr Ser Asp Thr Val Asp Phe Tyr Leu Gln Asp Asp Gly Ser Val 420 425 430Thr Asn Gly Ser Gly Lys Ala Val Tyr Lys Asp Ala Asp Gly Lys Leu 435 440 445Thr Thr Asp Ala Glu Thr Lys Ala Ala Thr Thr Ala Asp Pro Leu Lys 450 455 460Ala Leu Asp Glu Ala Ile Ser Ser Ile Asp Lys Phe Arg Ser Ser Leu465 470 475 480Gly Ala Val Gln Asn Arg Leu Asp Ser Ala Val Thr Asn Leu Asn Asn 485 490 495Thr Thr Thr Asn Leu Ser Glu Ala Gln Ser Arg Ile Gln Asp Ala Asp 500 505 510Tyr Ala Thr Glu Val Ser Asn Met Ser Lys Ala Gln Ile Ile Gln Gln 515 520 525Ala Gly Asn Ser Val Leu Ala Lys Ala Asn Gln Val Pro Gln Gln Val 530 535 540Leu Ser Leu Leu Gln Gly545 55023286PRTT. pallidumA 23Met Ile Ile Asn His Asn Met Ser Ala Met Phe Ala Gln Arg Thr Leu1 5 10 15Gly His Thr Asn Val Gln Val Gly Lys Gly Ile Glu Lys Leu Ser Ser 20 25 30Gly Tyr Arg Ile Asn Arg Ala Gly Asp Asp Ala Ser Gly Leu Ala Val 35 40 45Ser Glu Lys Met Arg Ser Gln Ile Arg Gly Leu Asn Gln Ala Ser Thr 50 55 60Asn Ala Ser Asn Gly Val Asn Phe Ile Gln Val Thr Glu Ala Tyr Leu65 70 75 80Gln Glu Thr Thr Asp Ile Met Gln Arg Ile Arg Glu Leu Ala Ile Gln 85 90 95Ala Ala Asn Gly Ile Tyr Ser Ala Glu Asp Arg Met Gln Ile Gln Val 100 105 110Glu Val Ser Gln Leu Val Ala Glu Val Asp Arg Ile Ala Ser Ser Ala 115 120 125Gln Phe Asn Gly Met Asn Leu Leu Thr Gly Arg Phe Ser Arg Thr Glu 130 135 140Gly Glu Asn Val Ile Gly Gly Ser Met Trp Phe His Ile Gly Ala Asn145 150 155 160Met Asp Gln Arg Met Arg Val Tyr Ile Gly Thr Met Thr Ala Val Ala 165 170 175Leu Gly Val Arg Asn Gly Val Asp Glu Ser Ile Met Ser Ile Glu Thr 180 185 190Ala Asp Ser Ala Asn Lys Ser Ile Gly Thr Ile Asp Ala Ala Leu Lys 195 200 205Arg Ile Asn Lys Gln Arg Ala Asp Leu Gly Gly Tyr Gln Asn Arg Met 210 215 220Glu Tyr Thr Val Val Gly Leu Asp Ile Ala Ala Glu Asn Leu Gln Ala225 230 235 240Ala Glu Ser Arg Ile Arg Asp Ala Asn Ile Ala Lys Gln Met Val Glu 245 250 255Tyr Thr Lys Asn Gln Val Leu Thr Gln Ser Gly Thr Ala Met Leu Ala 260 265 270Gln Ala Asn Thr Ser Ala Gln Ser Ile Leu Ser Ile Leu Arg 275 280 28524286PRTT. pallidumB 24Met Ile Ile Asn His Asn Met Ser Ala Met Phe Ala Gln Arg Thr Leu1 5 10 15Gly Asn Thr Asn Leu Ser Val Gln Lys Asn Met Glu Lys Leu Ser Ser 20 25 30Gly Leu Arg Ile Asn Arg Ala Gly Asp Asp Ala Ser Gly Leu Ala Val 35 40 45Ser Glu Lys Met Arg Ser Gln Ile Arg Gly Leu Asn Gln Ala Ser Thr 50 55 60Asn Ala Gln Asn Gly Ile Ser Phe Ile Gln Val Ala Glu Ser Tyr Leu65 70 75 80Gln Glu Thr Thr Asp Val Ile Gln Arg Ile Arg Glu Leu Ser Val Gln 85 90 95Ser Ala Asn Gly Ile Tyr Ser Ala Glu Asp Arg Met Tyr Ile Gln Val 100 105 110Glu Val Ser Gln Leu Val Ala Glu Ile Asp Arg Ile Ala Ser His Ala 115 120 125Gln Phe Asn Gly Met Asn Met Leu Thr Gly Arg Phe Ala Arg Glu Thr 130 135 140Gly Glu Asn Thr Val Thr Ala Ser Met Trp Phe His Ile Gly Ala Asn145 150 155 160Met Asp Gln Arg Thr Arg Ala Tyr Ile Gly Thr Met Thr Ala Ala Ala 165 170 175Leu Gly Val Arg Asp Val Gly Asp Glu Ser Ile Leu Asn Ile Asp Asp 180 185 190Pro Glu Lys Ala Asn Arg Ala Ile Gly Thr Leu Asp Glu Ala Ile Lys 195 200 205Lys Ile Asn Lys Gln Arg Ala Asp Leu Gly Ala Tyr Gln Asn Arg Leu 210

215 220Glu Tyr Thr Val Ile Gly Val Asn Val Ala Ala Glu Asn Leu Gln Ala225 230 235 240Ala Glu Ser Arg Ile Arg Asp Val Asp Met Ala Lys Glu Met Val Asp 245 250 255Tyr Thr Lys Asn Gln Ile Leu Val Gln Ser Gly Thr Ala Met Leu Ala 260 265 270Gln Ala Asn Gln Ala Thr Gln Ser Val Leu Ser Leu Leu Arg 275 280 28525283PRTL. pneumophila 25Met Ile Ile Asn His Asn Leu Ser Ala Val Asn Ala His Arg Ser Leu1 5 10 15Lys Phe Asn Glu Leu Ala Val Asp Lys Thr Met Lys Ala Leu Ser Ser 20 25 30Gly Met Arg Ile Asn Ser Ala Ala Asp Asp Ala Ser Gly Leu Ala Val 35 40 45Ser Glu Lys Leu Arg Thr Gln Val Asn Gly Leu Arg Gln Ala Glu Arg 50 55 60Asn Thr Glu Asp Gly Met Ser Phe Ile Gln Thr Ala Glu Gly Phe Leu65 70 75 80Glu Gln Thr Ser Asn Ile Ile Gln Arg Ile Arg Val Leu Ala Ile Gln 85 90 95Thr Ser Asn Gly Ile Tyr Ser Asn Glu Asp Arg Gln Leu Val Gln Val 100 105 110Glu Val Ser Ala Leu Val Asp Glu Val Asp Arg Ile Ala Ser Gln Ala 115 120 125Glu Phe Asn Lys Phe Lys Leu Phe Glu Gly Gln Phe Ala Arg Gly Ser 130 135 140Arg Val Ala Ser Met Trp Phe His Met Gly Pro Asn Gln Asn Gln Arg145 150 155 160Glu Arg Phe Tyr Ile Gly Thr Met Thr Ser Lys Ala Leu Lys Leu Val 165 170 175Lys Ala Asp Gly Arg Pro Ile Ala Ile Ser Ser Pro Gly Glu Ala Asn 180 185 190Asp Val Ile Gly Leu Ala Asp Ala Ala Leu Thr Lys Ile Met Lys Gln 195 200 205Arg Ala Asp Met Gly Ala Tyr Tyr Asn Arg Leu Glu Tyr Thr Ala Lys 210 215 220Gly Leu Met Gly Ala Tyr Glu Asn Met Gln Ala Ser Glu Ser Arg Ile225 230 235 240Arg Asp Ala Asp Met Ala Glu Glu Val Val Ser Leu Thr Thr Lys Gln 245 250 255Ile Leu Val Gln Ser Gly Thr Ala Met Leu Ala Arg Ala Asn Met Lys 260 265 270Pro Asn Ser Val Leu Lys Leu Leu Gln His Ile 275 28026336PRTB. burgdorferei 26Met Ile Ile Asn His Asn Thr Ser Ala Ile Asn Ala Ser Arg Asn Asn1 5 10 15Gly Ile Asn Ala Ala Asn Leu Ser Lys Thr Gln Glu Lys Leu Ser Ser 20 25 30Gly Tyr Arg Ile Asn Arg Ala Ser Asp Asp Ala Ala Gly Met Gly Val 35 40 45Ser Gly Lys Ile Asn Ala Gln Ile Arg Gly Leu Ser Gln Ala Ser Arg 50 55 60Asn Thr Ser Lys Ala Ile Asn Phe Ile Gln Thr Thr Glu Gly Asn Leu65 70 75 80Asn Glu Val Glu Lys Val Leu Val Arg Met Lys Glu Leu Ala Val Gln 85 90 95Ser Gly Asn Gly Thr Tyr Ser Asp Ala Asp Arg Gly Ser Ile Gln Ile 100 105 110Glu Ile Glu Gln Leu Thr Asp Glu Ile Asn Arg Ile Ala Asp Gln Ala 115 120 125Gln Tyr Asn Gln Met His Met Leu Ser Asn Lys Ser Ala Ser Gln Asn 130 135 140Val Arg Thr Ala Glu Glu Leu Gly Met Gln Pro Ala Lys Ile Asn Thr145 150 155 160Pro Ala Ser Leu Ser Gly Ser Gln Ala Ser Trp Thr Leu Arg Val His 165 170 175Val Gly Ala Asn Gln Asp Glu Ala Ile Ala Val Asn Ile Tyr Ala Ala 180 185 190Asn Val Ala Asn Leu Phe Ser Gly Glu Gly Ala Gln Ala Ala Gln Thr 195 200 205Ala Pro Val Gln Glu Gly Ala Gln Gln Glu Gly Ala Gln Gln Pro Ala 210 215 220Pro Val Thr Ala Pro Ser Gln Gly Gly Val Asn Ser Pro Val Asn Val225 230 235 240Thr Thr Thr Val Asp Ala Asn Thr Ser Leu Ala Lys Ile Glu Asn Ala 245 250 255Ile Arg Met Ile Ser Asp Gln Arg Ala Asn Leu Gly Ala Phe Gln Asn 260 265 270Arg Leu Glu Ser Ile Lys Asp Ser Thr Glu Tyr Ala Ile Glu Asn Leu 275 280 285Lys Ala Ser Tyr Ala Gln Ile Lys Asp Ala Thr Met Thr Asp Glu Val 290 295 300Val Ala Ala Thr Thr Asn Ser Ile Leu Thr Gln Ser Ala Met Ala Met305 310 315 320Ile Ala Gln Ala Asn Gln Val Pro Gln Tyr Val Leu Ser Leu Leu Arg 325 330 33527304PRTB. subtilus 27Met Arg Ile Asn His Asn Ile Ala Ala Leu Asn Thr Leu Asn Arg Leu1 5 10 15Ser Ser Asn Asn Ser Ala Ser Gln Lys Asn Met Glu Lys Leu Ser Ser 20 25 30Gly Leu Arg Ile Asn Arg Ala Gly Asp Asp Ala Ala Gly Leu Ala Ile 35 40 45Ser Glu Lys Met Arg Gly Gln Ile Arg Gly Leu Glu Met Ala Ser Lys 50 55 60Asn Ser Gln Asp Gly Ile Ser Leu Ile Gln Thr Ala Glu Gly Ala Leu65 70 75 80Thr Glu Thr His Ala Ile Leu Gln Arg Val Arg Glu Leu Val Val Gln 85 90 95Ala Gly Asn Thr Gly Thr Gln Asp Lys Ala Thr Asp Leu Gln Ser Ile 100 105 110Gln Asp Glu Ile Ser Ala Leu Thr Asp Glu Ile Asp Gly Ile Ser Asn 115 120 125Arg Thr Glu Phe Asn Gly Lys Lys Leu Leu Asp Gly Thr Tyr Lys Val 130 135 140Asp Thr Ala Thr Pro Ala Asn Gln Lys Asn Leu Val Phe Gln Ile Gly145 150 155 160Ala Asn Ala Thr Gln Gln Ile Ser Val Asn Ile Glu Asp Met Gly Ala 165 170 175Asp Ala Leu Gly Ile Lys Glu Ala Asp Gly Ser Ile Ala Ala Leu His 180 185 190Ser Val Asn Asp Leu Asp Val Thr Lys Phe Ala Asp Asn Ala Ala Asp 195 200 205Thr Ala Asp Ile Gly Phe Asp Ala Gln Leu Lys Val Val Asp Glu Ala 210 215 220Ile Asn Gln Val Ser Ser Gln Arg Ala Lys Leu Gly Ala Val Gln Asn225 230 235 240Arg Leu Glu His Thr Ile Asn Asn Leu Ser Ala Ser Gly Glu Asn Leu 245 250 255Thr Ala Ala Glu Ser Arg Ile Arg Asp Val Asp Met Ala Lys Glu Met 260 265 270Ser Glu Phe Thr Lys Asn Asn Ile Leu Ser Gln Ala Ser Gln Ala Met 275 280 285Leu Ala Gln Ala Asn Gln Gln Pro Gln Asn Val Leu Gln Leu Leu Arg 290 295 30028281PRTC. difficile 28Met Arg Val Asn Thr Asn Val Ser Ala Leu Ile Ala Asn Asn Gln Met1 5 10 15Gly Arg Asn Val Ser Gly Gln Ser Lys Ser Met Glu Lys Leu Ser Ser 20 25 30Gly Leu Arg Ile Lys Arg Ala Ala Asp Asp Ala Ala Gly Leu Ala Ile 35 40 45Ser Glu Lys Met Arg Ala Gln Leu Lys Gly Leu Asp Gln Ala Gly Arg 50 55 60Asn Val Gln Asp Gly Ile Ser Val Val Gln Thr Ala Glu Gly Ala Leu65 70 75 80Glu Glu Thr Gly Asn Ile Leu Thr Arg Met Arg Thr Leu Ala Val Gln 85 90 95Ala Ser Asn Glu Thr Asn Ser Lys Asp Glu Arg Ala Lys Ile Ala Gly 100 105 110Glu Met Glu Gln Leu Arg Ser Glu Val Asp Arg Ile Ala Asp Ser Thr 115 120 125Lys Phe Asn Gly Glu Asn Leu Leu Ser Ser Asp Lys Lys Ile Ala Leu 130 135 140Gln Val Gly Ala Glu Ala Val Ser Asn Asn Val Ile Glu Val Ser Leu145 150 155 160Ile Asn Thr Lys Gly Val Leu Thr Thr Arg Asn Val Asn Ser Ala Asn 165 170 175Ile Asp Ala Met Ser Val Ser Gly Ser Ile Gly Thr Glu Ala Ala Ser 180 185 190Lys Met Ile Val Asn Leu Asp Ser Ser Leu Ala Asp Ile Asn Ser Ala 195 200 205Arg Ala Leu Leu Gly Ala Gln Gln Asn Arg Leu Glu Ser Thr Gln Asn 210 215 220Asn Leu Asn Asn Thr Val Glu Asn Val Thr Ala Ala Glu Ser Arg Ile225 230 235 240Arg Asp Thr Asp Val Ala Ser Glu Met Val Asn Leu Ser Lys Met Asn 245 250 255Ile Leu Val Gln Ala Ser Gln Ser Met Leu Ser Gln Ala Asn Gln Gln 260 265 270Pro Gln Gly Val Leu Gln Leu Leu Gly 275 28029394PRTR. meliloti 29Met Thr Ser Ile Leu Thr Asn Asn Ser Ala Met Ala Ala Leu Ser Thr1 5 10 15Leu Arg Ser Ile Ser Ser Ser Met Glu Asp Thr Gln Ser Arg Ile Ser 20 25 30Ser Gly Leu Arg Val Gly Ser Ala Ser Asp Asn Ala Ala Tyr Trp Ser 35 40 45Ile Ala Thr Thr Met Arg Ser Asp Asn Gln Ala Leu Ser Ala Val Gln 50 55 60Asp Ala Leu Gly Leu Gly Ala Ala Lys Val Asp Thr Ala Tyr Ser Gly65 70 75 80Met Glu Ser Ala Ile Glu Val Val Lys Glu Ile Lys Ala Lys Leu Val 85 90 95Ala Ala Thr Glu Asp Gly Val Asp Lys Ala Lys Ile Gln Glu Glu Ile 100 105 110Thr Gln Leu Lys Asp Gln Leu Thr Ser Ile Ala Glu Ala Ala Ser Phe 115 120 125Ser Gly Glu Asn Trp Leu Gln Ala Asp Leu Ser Gly Gly Pro Val Thr 130 135 140Lys Ser Val Val Gly Gly Phe Val Arg Asp Ser Ser Gly Ala Val Ser145 150 155 160Val Lys Lys Val Asp Tyr Ser Leu Asn Thr Asp Thr Val Leu Phe Asp 165 170 175Thr Thr Gly Asn Thr Gly Ile Leu Asp Lys Val Tyr Asn Val Ser Gln 180 185 190Ala Ser Val Thr Leu Pro Val Asn Val Asn Gly Thr Thr Ser Glu Tyr 195 200 205Thr Val Gly Ala Tyr Asn Val Asp Asp Leu Ile Asp Ala Ser Ala Thr 210 215 220Phe Asp Gly Asp Tyr Ala Asn Val Gly Ala Gly Ala Leu Ala Gly Asp225 230 235 240Tyr Val Lys Val Gln Gly Ser Trp Val Lys Ala Val Asp Val Ala Ala 245 250 255Thr Gly Gln Glu Val Val Tyr Asp Asp Gly Thr Thr Lys Trp Gly Val 260 265 270Asp Thr Thr Val Thr Gly Ala Pro Ala Thr Asn Val Ala Ala Pro Ala 275 280 285Ser Ile Ala Thr Ile Asp Ile Thr Ile Ala Ala Gln Ala Gly Asn Leu 290 295 300Asp Ala Leu Ile Ala Gly Val Asp Glu Ala Leu Thr Asp Met Thr Ser305 310 315 320Ala Ala Ala Ser Leu Gly Ser Ile Ser Ser Arg Ile Asp Leu Gln Ser 325 330 335Asp Phe Val Asn Lys Leu Ser Asp Ser Ile Asp Ser Gly Val Gly Arg 340 345 350Leu Val Asp Ala Asp Met Asn Glu Glu Ser Thr Arg Leu Lys Ala Leu 355 360 365Gln Thr Gln Gln Gln Leu Ala Ile Gln Ala Leu Ser Ile Ala Asn Ser 370 375 380Asp Ser Gln Asn Val Leu Ser Leu Phe Arg385 39030306PRTA. tumefaciens 30Met Ala Ser Ile Leu Thr Asn Asn Asn Ala Met Ala Ala Leu Ser Thr1 5 10 15Leu Arg Ser Ile Ala Ser Asp Leu Ser Thr Thr Gln Asp Arg Ile Ser 20 25 30Ser Gly Leu Lys Val Gly Ser Ala Ser Asp Asn Ala Ala Tyr Trp Ser 35 40 45Ile Ala Thr Thr Met Arg Ser Asp Asn Lys Ala Leu Gly Ala Val Ser 50 55 60Asp Ala Leu Gly Met Gly Ala Ala Lys Val Asp Thr Ala Ser Ala Gly65 70 75 80Met Asp Ala Ala Ile Lys Val Val Thr Asp Ile Lys Ala Lys Val Val 85 90 95Ala Ala Lys Glu Gln Gly Val Asp Lys Thr Lys Val Gln Glu Glu Val 100 105 110Ser Gln Leu Leu Asp Gln Leu Lys Ser Ile Gly Thr Ser Ala Ser Phe 115 120 125Asn Gly Glu Asn Trp Leu Val Ser Ser Ala Asn Ala Thr Lys Thr Val 130 135 140Val Ser Gly Phe Val Arg Asp Ala Gly Gly Thr Val Ser Val Lys Thr145 150 155 160Thr Asp Tyr Ala Leu Asp Ala Asn Ser Met Leu Tyr Thr Glu Gly Thr 165 170 175Pro Gly Thr Ile Asp Ala Asn Ser Gly Ile Leu Asn Ala Thr Gly Ala 180 185 190Thr Thr Thr Val Gly Ala Lys Thr Tyr Thr Gln Ile Ser Val Leu Asp 195 200 205Met Asn Val Gly Thr Asp Asp Leu Asp Asn Ala Leu Tyr Ser Val Glu 210 215 220Thr Ala Leu Thr Lys Met Thr Ser Ala Gly Ala Lys Leu Gly Ser Leu225 230 235 240Ser Ala Arg Ile Asp Leu Gln Ser Gly Phe Ala Asp Lys Leu Ser Asp 245 250 255Thr Ile Glu Lys Gly Val Gly Arg Leu Val Asp Ala Asp Met Asn Glu 260 265 270Glu Ser Thr Lys Leu Lys Ala Leu Gln Thr Gln Gln Gln Leu Ala Ile 275 280 285Gln Ala Leu Ser Ile Ala Asn Ser Asp Ser Gln Asn Ile Leu Ser Leu 290 295 300Phe Arg30531410PRTR. lupini 31Met Ala Ser Val Leu Thr Asn Ile Asn Ala Met Ser Ala Leu Gln Thr1 5 10 15Leu Arg Ser Ile Ser Ser Asn Met Glu Asp Thr Gln Ser Arg Ile Ser 20 25 30Ser Gly Met Arg Val Gly Ser Ala Ser Asp Asn Ala Ala Tyr Trp Ser 35 40 45Ile Ala Thr Thr Met Arg Ser Asp Asn Ala Ser Leu Ser Ala Val Gln 50 55 60Asp Ala Ile Gly Leu Gly Ala Ala Lys Val Asp Thr Ala Ser Ala Gly65 70 75 80Met Asp Ala Val Ile Asp Val Val Lys Gln Ile Lys Asn Lys Leu Val 85 90 95Thr Ala Gln Glu Ser Ser Ala Asp Lys Thr Lys Ile Gln Gly Glu Val 100 105 110Lys Gln Leu Gln Glu Gln Leu Lys Gly Ile Val Asp Ser Ala Ser Phe 115 120 125Ser Gly Glu Asn Trp Leu Lys Gly Asp Leu Ser Thr Thr Thr Thr Lys 130 135 140Ser Val Val Gly Ser Phe Val Arg Glu Gly Gly Thr Val Ser Val Lys145 150 155 160Thr Ile Asp Tyr Ala Leu Asn Ala Ser Lys Val Leu Val Asp Thr Arg 165 170 175Ala Thr Gly Thr Lys Thr Gly Ile Leu Asp Thr Ala Tyr Thr Gly Leu 180 185 190Asn Ala Asn Thr Val Thr Val Asp Ile Asn Lys Gly Gly Val Ile Thr 195 200 205Gln Ala Ser Val Arg Ala Tyr Ser Thr Asp Glu Met Leu Ser Leu Gly 210 215 220Ala Lys Val Asp Gly Ala Asn Ser Asn Val Ala Val Gly Gly Gly Ser225 230 235 240Ala Phe Val Lys Val Asp Gly Ser Trp Val Lys Gly Ser Val Asp Ala 245 250 255Ala Ala Ser Ile Thr Ala Ser Thr Pro Val Ala Gly Lys Phe Ala Ala 260 265 270Ala Tyr Thr Ala Ala Glu Ala Gly Thr Ala Ala Ala Ala Gly Asp Ala 275 280 285Ile Ile Val Asp Glu Thr Asn Ser Gly Ala Gly Ala Val Asn Leu Thr 290 295 300Gln Ser Val Leu Thr Met Asp Val Ser Ser Met Ser Ser Thr Asp Val305 310 315 320Gly Ser Tyr Leu Thr Gly Val Glu Lys Ala Leu Thr Ser Leu Thr Ser 325 330 335Ala Gly Ala Glu Leu Gly Ser Ile Lys Gln Arg Ile Asp Leu Gln Val 340 345 350Asp Phe Ala Ser Lys Leu Gly Asp Ala Leu Ala Lys Gly Ile Gly Arg 355 360 365Leu Val Asp Ala Asp Met Asn Glu Glu Ser Thr Lys Leu Lys Ala Leu 370 375 380Gln Thr Gln Gln Gln Leu Ala Ile Gln Ser Leu Ser Ile Ala Asn Ser385 390 395 400Asp Ser Gln Asn Ile Leu Ser Leu Phe Arg 405 41032287PRTL. monocytogenes 32Met Lys Val Asn Thr Asn Ile Ile Ser Leu Lys Thr Gln Glu Tyr Leu1 5 10 15Arg Lys Asn Asn Glu Gly Met Thr Gln Ala Gln Glu Arg Leu Ala Ser 20 25 30Gly Lys Arg Ile Asn Ser Ser Leu Asp Asp Ala Ala Gly Leu Ala Val 35 40 45Val Thr Arg Met Asn Val Lys Ser Thr Gly Leu Asp Ala Ala Ser Lys 50 55 60Asn Ser Ser Met Gly Ile Asp Leu Leu Gln Thr Ala Asp Ser Ala Leu65 70

75 80Ser Ser Met Ser Ser Ile Leu Gln Arg Met Arg Gln Leu Ala Val Gln 85 90 95Ser Ser Asn Gly Ser Phe Ser Asp Glu Asp Arg Lys Gln Tyr Thr Ala 100 105 110Glu Phe Gly Ser Leu Ile Lys Glu Leu Asp His Val Ala Asp Thr Thr 115 120 125Asn Tyr Asn Asn Ile Lys Leu Leu Asp Gln Thr Ala Thr Gly Ala Ala 130 135 140Thr Gln Val Ser Ile Gln Ala Ser Asp Lys Ala Asn Asp Leu Ile Asn145 150 155 160Ile Asp Leu Phe Asn Ala Lys Gly Leu Ser Ala Gly Thr Ile Thr Leu 165 170 175Gly Ser Gly Ser Thr Val Ala Gly Tyr Ser Ala Leu Ser Val Ala Asp 180 185 190Ala Asp Ser Ser Gln Glu Ala Thr Glu Ala Ile Asp Glu Leu Ile Asn 195 200 205Asn Ile Ser Asn Gly Arg Ala Leu Leu Gly Ala Gly Met Ser Arg Leu 210 215 220Ser Tyr Asn Val Ser Asn Val Asn Asn Gln Ser Ile Ala Thr Lys Ala225 230 235 240Ser Ala Ser Ser Ile Glu Asp Ala Asp Met Ala Ala Glu Met Ser Glu 245 250 255Met Thr Lys Tyr Lys Ile Leu Thr Gln Thr Ser Ile Ser Met Leu Ser 260 265 270Gln Ala Asn Gln Thr Pro Gln Met Leu Thr Gln Leu Ile Asn Ser 275 280 28533399PRTB. clarridgeiae 33Met Gly Thr Ser Leu Leu Thr Asn Lys Ser Ala Met Thr Ala Leu Gln1 5 10 15Thr Leu Arg Ser Ile Asp Ala Asn Leu Asp Arg Ser Lys Asp Arg Val 20 25 30Ser Thr Gly Leu Arg Ile Ser Asn Ala Ser Glu Asn Thr Ala Tyr Trp 35 40 45Ser Ile Ser Ser Met Met Arg His Asp Ser Asn Thr Met Ser Ala Ile 50 55 60Val Asp Ala Ile Asn Leu Gly Lys Glu Gln Val Gly Ile Ala Asp Thr65 70 75 80Ala Ile Gly Leu Thr Lys Glu Ala Leu Asp Asp Ile Gln Lys Ser Met 85 90 95Val Ser Ala Arg Glu Lys Gly Ser Asp Asp Ile Ala Lys Ile Gln Asp 100 105 110Ser Ile Ile Gly Asn Met Lys Asn Ile Ser Asn Ala Val Gln Ser Ala 115 120 125Ser Phe Gly Gly Lys Asn Ile Leu Ser Asn Gly Gly Gln Thr Val Gly 130 135 140Met Ala Ala Gly Tyr Arg Arg Glu Gly Thr Ala Val Tyr Val Asp Met145 150 155 160Ile Asp Val Gly Gly Ser Glu Leu Asn Phe Gly Thr Ile Gly Ser Asp 165 170 175Gly Thr Ile Asp Met Ser Gln Gly Val Leu Gly Gly Ile Phe Gly Thr 180 185 190Ser Lys Gly Asp Glu Gly Glu Asp Val Val Gly Lys Gly Ile Gly Ala 195 200 205Phe Ser Ala Ala His Ala Thr Tyr Lys Gly Leu Glu Asp Thr Leu Arg 210 215 220Asn Ala Glu Ala Asp Leu Ala Lys Ala Ile Ala Lys Tyr Gly Glu Ser225 230 235 240Pro Glu Asp Glu Pro Gly Lys Ala Ile Ile Glu Lys Ala Lys Gln Ala 245 250 255Val Glu Thr Ala Lys Thr Gly Leu Lys Asp Gly Gln Glu Ala Tyr Asn 260 265 270Lys Ala Lys Gly Glu Phe Gln Thr Val Leu Asp Gly Met Thr Leu Ala 275 280 285Asp Phe Thr Glu Leu Lys Gly Leu Gly Glu Leu His Ser Asp Ile Gln 290 295 300Arg Met Ile Met Thr Ser Val Gln Asn Thr Val Arg Asp Ala Val Asn305 310 315 320Val Thr Leu Thr Ala Gly Ser Lys Ile Gly Ala Ala Val Asn Leu Val 325 330 335Asn Ile Gln Leu Asn Phe Val Lys Lys Leu Leu Asp Asn Val Glu Val 340 345 350Gly Ile Gly Ala Leu Val Asp Ala Asp Met Asn Ala Glu Ser Ala Lys 355 360 365Leu Ala Ala Leu Gln Val Gln Gln Gln Leu Gly Ile Gln Ala Leu Ser 370 375 380Ile Ala Asn Gln Gly Ser Gln Asn Ile Leu Ala Leu Phe Arg Asn385 390 39534181PRTArtificial Sequenceconsensus sequence 34Met Ile Asn Thr Asn Val Ala Leu Ala Gln Asn Leu Lys Gln Leu Ser1 5 10 15Leu Glu Arg Leu Ser Ser Gly Leu Arg Ile Asn Ser Ala Asp Asp Ala 20 25 30Ala Gly Met Ala Ile Ala Arg Leu Ser Gln Val Arg Gly Leu Gln Ala 35 40 45Thr Arg Asn Ala Asn Asp Gly Ile Ser Ile Leu Gln Thr Ala Glu Gly 50 55 60Ala Leu Glu Ile Leu Gln Arg Ile Arg Asp Leu Val Gln Ala Asn Gly65 70 75 80Thr Gln Ser Asp Arg Ile Gln Glu Ile Gln Leu Met Glu Glu Ile Asp 85 90 95Arg Ile Ala Thr Phe Asn Gly Met Lys Leu Leu Gly Gln Ile Gly Val 100 105 110Ile Val Ile Gly Leu Leu Met Met Ile Asp Ala Met Leu Arg Ala Leu 115 120 125Gly Ala Val Gln Asn Arg Val Asp Ile Asn Leu Glu Asn Leu Ala Ala 130 135 140Ser Arg Ile Asp Ala Asp Ala Glu Val Thr Asn Leu Ser Lys Gln Ile145 150 155 160Leu Gln Gln Gly Ser Ile Leu Ala Gln Ala Asn Gln Pro Gln Asn Val 165 170 175Leu Ser Leu Leu Arg 1803539DNAArtificial Sequenceprimer 35ttaaagtggt accagttctc ccttttcatt gtatgcact 393635DNAArtificial Sequenceprimer 36cgggatcccg ttaggagatg gttgctacag tttgc 353718PRTArtificial Sequencesynthetic construct 37Ala Asp Thr Arg Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala1 5 10 15Ile Thr3818PRTArtificial Sequencesynthetic construct 38Val Asp Ala Arg Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala1 5 10 15Ile Thr3918PRTArtificial Sequencesynthetic construct 39Val Asp Thr Ala Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala1 5 10 15Ile Thr4015PRTArtificial Sequencesynthetic construct 40Arg Ser Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile1 5 10 154115PRTArtificial Sequencesynthetic construct 41Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile Thr Asn1 5 10 154215PRTArtificial Sequencesynthetic construct 42Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile Thr Asn Leu Gly1 5 10 154315PRTArtificial Sequencesynthetic construct 43Val Gln Asn Arg Phe Asn Ser Ala Ile Thr Asn Leu Gly Asn Thr1 5 10 15

Claims

1-35. (canceled)

36. A method of inducing an antigen-specific immune response in an individual,said method comprising administering to said individual an immunogenic amount of an immunogenic composition, said immunogenic composition comprising an antigen and a flagellin peptide that stimulates TLR5 which peptide consists of the conserved regions of a naturally occurring flagellin protein or a TLR5 stimulatory portion of said conserved regions, wherein said conserved regions are defined as sequences that align with consensus sequence SEQ ID NO:34.

37. The method of claim 36, wherein said antigen and said flagellin peptide form a chimeric polypeptide.

38. The method of claim 36, wherein said antigen is coupled to the flagellin peptide.

39. The method of claim 36, wherein said antigen is selected from the group consisting of polypeptides, polysaccharides, pathologically aberrant cells and bacteria.

40. The method of claim 36, wherein said flagellin peptide further comprises an ADCC targeting molecule.

41. A flagellin peptide that stimulates TLR5, which peptide consists of the conserved regions of a naturally occurring flagellin protein or a TLR5 stimulatory portion of said conserved regions, wherein said conserved regions are defined as sequences that align with consensus sequence SEQ ID NO:34; and wherein said peptide coupled to an antigen or to a heterologous moiety.

42. The method of claim 41, wherein said heterologous moiety is an antibody-dependent cell cytotoxicity (ADCC) targeting moiety.

43. The peptide of claim 41, wherein the heterologous moiety is a targeting moiety or facilitates detection, facilitates purification, or enhances immunostimulation activity of TLR5.

44. The peptide of claim 41, wherein the heterologous moiety is a cytokine.

45. The peptide of claim 44, wherein the cytokine is TNFα, IL-1 or IL-6.

46. The peptide of claim 41, wherein the heterologous moiety is an antigen.

47. The method of claim 46, wherein the antigen is selected from the group consisting of polypeptides, polysaccharides, pathologically aberrant cells and bacteria.

48. A method of stimulating a TLR5 dependent immune response in an individual having a pathological condition which method comprises administering to said individual an effective amount of the peptide of claim 41.

49. A method of stimulating a TLR5-dependent immune response in an individual having a pathological condition,said method comprising administering to said individual a combination of the peptide of claim 41 along with an additional immunomodulatory molecule.

50. The method of claim 49, wherein said additional immunomodulatory molecule is an antibody, cytokine or growth factor.

51. A method of stimulating a TLR5-dependent immune response in an individual having a pathological condition,said method comprising administering to said individual a combination of the peptide of claim 42 along with an additional immunomodulatory molecule.

52. The method of claim 49, wherein said pathological condition is selected from the group consisting of proliferative disease, autoimmune disease, infectious disease and inflammatory disease.

Images