Detection Of Rho Proteins

Abstract

vides methods of detecting activated Rho GTPase proteins by contacting a solid support with a sample comprising an activated Rho GTPase protein. The solid support is linked to an activated Rho GTPase binding peptide. The activated Rho GTPase protein remains associated with the solid support during the detection.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001]This application claims priority to U.S. Provisional Application Ser. No. 60/695,844, filed Jul. 5, 2005 which is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[0002]The present invention is directed, in part, to methods of detecting activated Rho proteins.

BACKGROUND OF THE INVENTION

[0003]The Rho GTPases are a structurally and functionally distinct GTPase of the Ras superfamily (Wennerberg et al., 2005, J. Cell Sci., 118:843-846; Takai et al., 2001, Physiol. Rev., 81:153-208). They are involved in a diverse array of cellular functions, including the regulation of actin and tubulin dynamics, cell polarity, membrane transport pathways and transcription factor activities (Ridley et al., 1992, Cell, 70:389-399; Braga et al., 1997, J. Cell Biol., 137:1421-1431; and Coso et al., 1995, Cell, 81:1137-1146). However, some members of the family (e.g., RhoBTB1, RhoBTB2 and RhoH) do not appear to be functionally closely related to the classical members such as RhoA, Rac1 and Cdc42 (Aspenstrom et al., 2004, Biochem J., 377:327-337). It is therefore accepted by those of skill in this area that the Rho GTPase of the Ras superfamily GTPases are most clearly defined by sequence homology.

[0004]When all the GTPase domains of the 150+ mammalian Ras superfamily members are aligned and are sorted into a dendrogram based on the alignment, the 20 Rho proteins form one separate branch of the Ras superfamily tree (Wennerberg et al., 2005, J. Cell Sci., 118:843-846). The overall homology within the GTPase domain of the Rho proteins separate them from the other Ras superfamily members. The Rho proteins share between 40-95% homology within the GTPase and they are 30% or less homologous to other Ras superfamily GTPases. In addition, the Rho proteins have one motif that is unique to this GTPase of small GTPases. This motif is called the Rho insert domain and is located between the fifth β strand and the fourth α helix in the small GTPase domain (Zong et al., 2001, Mol. Cell Biol., 21:5287-5298).

[0005]Accordingly, a small G-protein is considered a Rho family protein if, when aligned with other Ras superfamily proteins, it falls into the Rho branch (e.g., the protein has at least 40% homology to the other Rho proteins) and contains a Rho insert domain.

[0006]The Rho GTPases are known to be involved in the progress of many pathogenic processes such as metastatic invasion, bacterial and viral infections and hypertension (Symons, 1995, Curr. Op. Biotech., 6:668-674; Chen et al., 1996, Science, 274:2115-2118; and Uehata et al., 1997, Nature, 389:990-994). Because of their multiple roles in both basic cellular functions and in pathogenic processes there is much interest in developing assays that allow researchers to analyse the activity of Rho GTPases in cells. There is furthermore, great interest in developing assays that are compatible with high throughput screening applications for drug discovery targeting Rho GTPases or the Rho GTPase transduction pathways and for assays compatible with diagnostic applications.

[0007]The cellular activities mediated by Rho GTPases are dependent upon the activation state of the GTPase. When GTP is bound to Rho GTPases they are in an active state and are able to bind to effectors and propagate the signal cascade leading to a particular cellular response. When GDP is bound to Rho GTPases the Rho protein is inactive (Takai et al., 2001, Physiol. Rev., 81:153-208). Several assays have been developed that monitor the activation state of Rho GTPases.

[0008]One assay, the Rho effector pull-down assay, was originally developed for RhoA GTPases by Ren et al. (1999, EMBO J., 18:578-585) and for Rac1/Cdc42 GTPases by Benard et al. (1999, J. Biol. Chem., 274:13198-13204) and is the classical and most widely used assay. The method involves capture of activated Rho GTPase proteins by effectors bound to beads, release of the GTPase protein from the beads, separation of the beads from the released GTPase protein, followed by SDS-PAGE and analysis of the GTPase protein by western blotting. The assay suffers from poor reproducibility due to the multiple manipulations required in the performance of the assay, and low sensitivity. It is also not suitable for high throughput applications (Teusch et al., 2006, Assay and Drug Devel., 4:133).

[0009]There are several cell-based assays that use fluorescent bio-probes to detect activated Rho GTPases (Pertz et al., 2004, J. Cell Sci., 117:1313-1318). Several versions of this type of assay rely on a reporter system to monitor in vivo Rho GTPase activation. These cell-based assays, therefore, do not monitor the actual endogenous levels of the GTPase (Itoh et al., 2002, Mol. Cell Biol., 22:6582-6591; Pertz et al., 2006, Nature, 440:1069-1072; and Vadim et al., 2000, Science, 290:333-337). Other versions of cell-based assays use effector domains linked directly to an environmental dye to monitor endogenous in vivo GTPase activation. Because the placing of the environmental dye on any particular probe requires extensive analysis and a particular effector may not be compatible with dye linkage, the usefulness of any particular effector cannot be predicted (Nalbant et al., 2004, Science, 305:1615-1619). Furthermore, because the use of direct effector detection in vivo results in a probe that most often recognizes more than one GTPase, specificity is an issue in these assays. A further issue with this type of assay is that introduction of exogenous effector will actually alter the levels of Rho GTPase activation, which creates a technically challenging assay method (Pertz et al., 2004, J. Cell Sci., 117:1313-1318).

[0010]The fluorescent biosensor probes have also been applied to in vitro assays although their sensitivity is fairly low. Furthermore, that the dyes respond to environmental changes poses issues to drug screening applications (Hahn et al., U.S. Pat. No. 6,951,947 B2).

[0011]An enzymatic based method to detect Rho activation has been reported (Chen et al., 2003, J. Biol. Chem., 278:2807). The assay utilizes GST-effector-GBD to affinity precipitate active GTP-Rho. GTP is eluted and converted to ATP in a coupled enzymatic assay. ATP is then measured by the firefly luciferase method. This assay is highly dependent on the GST pull-down assay and, thus, has most of the drawbacks associated with this assay. Furthermore, since a Rho-specific antibody is not involved in this method, the specificity of the assay is limited.

[0012]An automated cell-based Rho activation assay has also been reported (Teusch et al., 2006, Assay and Drug Devel., 4:133). This assay was developed to replace the GST pull-down assay due to its incompatibility for high throughput screening and poor reproducibility. It is based on the ability of Rho to regulate the actin cytoskeleton. Since actin cytoskeleton is regulated by multiple signal pathways, the specificity for this assay is very limited.

[0013]Thus, there is a need for a Rho GTPase activation assay that is simple, specific for a particular GTPase protein, reproducible, sensitive and amenable to high throughput screening applications. The present invention provides for this need as well as others.

SUMMARY OF THE INVENTION

[0014]The present invention is directed to methods for detecting an activated Rho GTPase protein by 1) contacting a solid support with a sample comprising an activated Rho GTPase protein, wherein the solid support is linked to an activated Rho GTPase binding peptide, and wherein the activated Rho GTPase in the sample binds the activated Rho GTPase binding peptide; and 2) detecting the activated Rho GTPase protein in the sample, wherein the activated Rho GTPase protein remains associated with the solid support during the detection. In some embodiments, the solid support is a microtiter plate or microarray.

[0015]In some embodiments, the sample comprises a cell lysate that comprises endogenous activated Rho GTPase protein. In some embodiments, the sample comprises less than 50 μg of total protein. In some embodiments, the cell lysate is prepared from less than 10⁵ cells. In some embodiments, the cell lysate has not been clarified. In some embodiments, the sample comprises exogenous GTP, GDP or GTPγS.

[0016]In some embodiments, prior to detecting the activated Rho GTPase protein in the sample, an Antigen Presenting Buffer is added. The Antigen Presenting Buffer comprises one or more compounds or treatments that can attenuate loss of the activated Rho GTPase protein from the solid support. In some embodiments, the Antigen Presenting Buffer comprises heat denaturation, urea treatment, glutaraldehyde, ethanol, or tricholoracetic acid, or any combination thereof. In some embodiments, the final concentration of trichloroacetic acid is about 0.5% to about 15% v/v.

[0017]In some embodiments, prior to detecting the activated Rho GTPase protein in the sample, a Binding Buffer is added. In some embodiments, the Binding Buffer comprises ficoll, dextran, or polyethylene glycol, or any combination thereof. In some embodiments, the polyethylene glycol is PEG 4000 or PEG 8000 at a final concentration of about 2% to about 40% v/v.

[0018]In some embodiments, the activated Rho GTPase protein is detected using an antibody specific for one or more activated Rho GTPase proteins.

[0019]In some embodiments, the activated Rho GTPase protein is a constitutively active mutant. In some embodiments, the activated Rho GTPase protein is RhoA, RhoB, RhoC, RhoD, Rnd1, Rnd2, Rnd3, Rif, RhoG, Rac1, Rac1b, Rac2, Rac3, Cdc42, TC10, TCL, Wrch-1, Wrch-2, RhoBTB1, or RhoBTB2.

[0020]In some embodiments, the activated Rho GTPase binding peptide binds to one or more activated Rho GTPase proteins with an affinity that is at least 2-fold higher for the activated versus inactive form of the Rho GTPase protein. In some embodiments, the activated Rho GTPase binding peptide is a Rhotekin, ROCK1, PAK1, POSH, WASP, or Dia1, or a mutant or multimer of the same. In some embodiments, the activated Rho GTPase binding peptide is linked to the solid support covalently or non-covalently. In some embodiments, the covalent linkage is a disulfide linkage and the non-covalent linkage is a GST linkage. In some embodiments, the activated Rho GTPase binding peptide is lyophilized.

[0021]In some embodiments, the methods further comprise quantitating the amount of activated Rho GTPase protein bound to the activated Rho GTPase binding peptide. In some embodiments, the amount of activated Rho GTPase protein is quantitated using an antibody specific for one or more Rho GTPase proteins.

[0022]In some embodiments, detection of the activated Rho GTPase protein is carried out by detecting an interaction between the activated Rho GTPase protein and the activated Rho GTPase binding peptide using absorbance, luminescence, or fluorescence.

[0023]In some embodiments, the methods further comprise contacting the sample with a test agent and determining whether the test agent modulates an interaction between the activated Rho GTPase protein and the activated Rho GTPase binding peptide.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024]FIG. 1A depicts a Coomassie stained SDS gel of recombinant effector-GBD peptides. FIG. 1B depicts DNA and amino acid sequences of wild type and modified Rhotekin-Cys-GBD. FIG. 1C depicts Western Blot analysis of modified Rhotekin-Cys selectively binding to activated RhoA.

[0025]FIG. 2A depicts RhoA signal detected by luminometry using ROCK plates to detect active RhoA. FIG. 2B depicts Rac1 signal deteced by absorbance at 490 nm using POSH plates to detect active Rac1. FIG. 2C depicts Cdc42 signal detected by absorbance at 490 nm using WASP plates to detect active Cdc42.

[0026]FIG. 3A depicts RhoA signal detected by luminometry using ROCK-GBD maleimide plates. FIG. 3B depicts Rac1 signal detected by absorbance at 490 nm using POSH-GBD maleimide plates.

[0027]FIG. 4 depicts Western blot with anti-RhoA antibody showing loss of G-LISA GTPase signal during antibody incubations.

[0028]FIG. 5A depicts luminescence detection showing development of Antigen Presenting Buffer for RhoA G-LISA (white bars show GDP signal, grey bars show GTPγS signal). FIG. 5B depicts Rac1 signal detected by absorbance at 490 nm showing TCA as Antigen Presenting Buffer in a Rac1:POSH G-LISA.

[0029]FIG. 6A depicts RhoA signal detected by absorbance at 490 nm showing stability of active RhoA in the presence of Binding Buffer (SS is serum starved samples--white bars; RhoA induced samples labeled Calpeptin--grey bars). FIG. 6B depicts active RhoA signal detected by absorbance at 490 nm showing enhanced signal for RhoA in the presence of Binding Buffer (SS is serum starved samples--white bars; RhoA induced samples labeled Calpeptin--grey bars). FIG. 6C depicts Rac1 signal detected by absorbance at 490 nm showing effect of Binding Buffer on Rac1 signal (SS is serum starved samples--white bars; Rac1 induced samples labeled EGF--grey bars).

[0030]FIG. 7A depicts a screening strategy and Western ranking of RhoA and RhoA,B,C monoclonal antibodies for the purpose of G-LISA development. FIG. 7B depicts raw data for monoclonal antibody G-LISA screen shown in FIG. 7A.

[0031]FIG. 8 depicts luminescence of RhoA G-LISA assay on ROCK maleimide plates using non-clarified cell lysates.

[0032]FIG. 9 depicts Rac1 signal detected by absorbance at 490 nm using non-covalent effector-GBD plates in a G-LISA assay.

[0033]FIG. 10 depicts titration of cell lysates in RhoA G-LISA as well as Western blot results of a GST-Rhotekin-RBD pull-down assay.

[0034]FIG. 11 depicts absorbance detection results of a titration of constitutively activated RhoA in G-LISA.

[0035]FIG. 12 depicts direct comparison of pull-down assay and G-LISA assay for Rac 1.

[0036]FIG. 13A depicts G-LISA analysis of in vivo activated Rac1 by epidermal growth factor (EGF). FIG. 13B depicts G-LISA analysis of in vivo activated Cdc42 by EGF. FIG. 13C depicts analysis of transfections with G-LISA assay.

[0037]FIG. 14 depicts extended shelf life studies on lyophilized effector-GBD plates.

[0038]FIG. 15 depicts POSH-GBD plate utilization in drug discovery applications.

DESCRIPTION OF EMBODIMENTS

[0039]The present invention provides a Rho GTPase activation assay that is simple, specific for a particular GTPase protein, reproducible, sensitive and amenable to high throughput screening applications that have numerous advantages over traditional pull-down assasys.

[0040]As used herein, the term "about" refers to a range of ±5% of the value that is being modified. For example, the phrase "about 10" means a range from 9.5 to 10.5.

[0041]As used herein, the term "fragment", when used in reference to a protein, refers to a peptide or polypeptide that is less than the whole. In some embodiments, the fragment comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, about 5 to about 100, about 5 to about 50, about 5 to about 25, about 100 to about 200, 5 to 100, 5 to 50, 5 to 25, 100 to 200, no more than 200, no more than 100, no more than 75, no more than 50, or no more than 25 amino acid residues. A "fragment" is also referred to as a "portion" of a protein.

[0042]As used herein, the term "sample" refers to a composition comprising a Rho GTPase protein (activated and/or inactivated) and/or a Rho GTPase binding peptide. Examples of samples include, but are not limited to, blood, cells, cell lysate, and the like. In some embodiments, the cell lysate is clarified or non-clarified. In some embodiments, the sample comprises exogenous GTP, GDP, or GTPγS.

[0043]As used herein, the term "clarified" refers to a sample being cleared, reduced, or filtered to remove non-soluble material that is produced upon lysing a cell. Any method can be used to clarify a cell lysate including, but not limited to, centrifugation, filtration, and the like.

[0044]As used herein, the phrase "Rho GTPase protein" (also referred to as "Rho sub-family protein") includes both active and inactive proteins. When GTP is bound to Rho GTPase proteins, they are in an active state and are able to bind to effectors and propagate the signal cascade leading to a particular cellular response. When GDP is bound to Rho GTPases the Rho protein is inactive. The methods of the present invention can be used to detect activated GTPase proteins. Rho GTPase proteins include, but are not limited to, RhoA (SEQ ID NO:1), RhoB (SEQ ID NO:2), RhoC (SEQ ID NO:3), RhoD (SEQ ID NO:4), Rnd3 (SEQ ID NO:5), Rnd1 (SEQ ID NO:6), Rnd2 (SEQ ID NO:7), Rif (SEQ ID NO:8), RhoG (SEQ ID NO:9), RhoH (SEQ ID NO:10), Rac1 (SEQ ID NO:11), Rac1b (SEQ ID NO:84), Rac2 (SEQ ID NO:12), Rac3 (SEQ ID NO:13), Cdc42 (SEQ ID NO:14), TC10 (SEQ ID NO:15), TCL (SEQ ID NO:16), Wrch-1 (SEQ ID NO:17), Wrch-2 (SEQ ID NO:18), RhoBTB1 (SEQ ID NO:19), and RhoBTB2 (SEQ ID NO:20), or any sub-group thereof.

[0045]A "Rho GTPase binding peptide" or an "activated Rho GTPase binding peptide" (also referred to as "Rho sub-family binding peptide") is a protein, or a fragment thereof, that is able to bind to an activated Rho GTPase protein. "Rho GTPase binding peptide" does not refer to GTP or an analog thereof A "Rho GTPase binding peptide" is also referred to herein as an "effector." One of skill in the art can identify a fragment of a Rho GTPase binding peptide that retains its ability to bind to an active Rho GTPase protein by routine experimentation. In some embodiments, the Rho GTPase binding peptide used in the methods provided herein binds to the Rho GTPase protein with at least 2-fold higher affinity for the GTP-bound state than the GDP-bound state of the Rho GTPase protein.

[0046]In some embodiments, the Rho GTPase binding peptide can comprise the entire sequence or a portion or fragment of the amino acid sequence of a small G-protein effector such as, for example, ROCK 1, ROCK 2, Citron, DGKθ, Kinectin, Dia1, Dia2, Dia3, PLC-ε, Protein kinase N, Rhophillin, Rhotekin, FHOD, p67Phox, PLC-β, POR-1, POSH, Sra-1, Synaptojanin-2, Ack1, Ack2, CEP1, CEP2, CEP3, CEP4, CEP5, CIP4, Coatamer α, Coatamer γ, MRCKα, MRCKβ, Pak4, Spec1, Spec2, WASP, N-WASP, IRSp53, IQGAP-1, IQGAP-2, MEKK1, MEKK4, MLK2, MLK3, p70 S6 Kinase, Pak1, Pak2, Pak3, Pak4, Pak5, Pak6, PI3K (p85 subunit), PIP5K, PLD-1, or any sub-group or combination thereof. In some embodiments, the Rho GTPase binding peptide is multimerized such that there is more than one unit of the ligand. For example, the Rho GTPase binding peptide can be dimerized or trimerized (3 copies). The Rho GTPase binding peptide can also have 4, 5, 6, 7, 8, 9, or 10 copies of the sequence of the protein that binds to the Rho GTPase protein.

[0047]A protein is considered a "Rho GTPase protein" if, when aligned with other Ras superfamily proteins, it falls into the Rho branch (e.g., the protein has at least 40% homology to the other Rho proteins) and contains a Rho insert domain. In some embodiments, a small G-protein is considered to be a Rho family protein if it has at least 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 40-99, 50-99, 60-99, 70-99, 80-99, 85-99, 90-99, or 95-99% homology to other Rho proteins, such as, but not limited to RhoA, RhoB, RhoC, RhoD, Rnd1, Rnd2, Rnd3, Rif, RhoG, Rac1, Rac1b, Rac2, Rac3, Cdc42, TC10, TCL, Wrch-1, Wrch-2, RhoBTB1, and/or RhoBTB2. Additionally, a protein is considered to have a Rho insert protein when using a method such as a conserved domain finder indicates that the protein comprises a Rho insert protein. A protein that is identified as having a Rho insert domain is considered to be a Rho GTPase protein. Any method or software can be used to determine if a protein comprises a Rho insert protein. As a non-limiting example, one can compare a protein to the conserved domain database using for example, "rpsblast" with the default settings, which can be found on the website of the National Center for Biotechnology Information, for example, at the world wide web address of ncbi"dot"nlm"dot"nih"dot"gov/Structure/cdd/wrpsb"dot"cgi. As used herein, for the purposes of an internet address the term "`dot`" means "." Examples of Rho GTPase proteins are provided herein and include but are not limited to, RhoA, RhoB, RhoC, RhoD, Rnd1, Rnd2, Rnd3, Rif, RhoG, Rac1, Rac1b, Rac2, Rac3, Cdc42, TC10, TCL, Wrch-1, Wrch-2, RhoBTB1, RhoBTB2, and the like.

[0048]Other methods and examples of identifying family members or homologs of proteins include, but are not limited to the following. A number of protein family databases are available for analysis or identification of homologous proteins, domains and motifs. Examples of databases include, but are not limited to, the Simple Modular Architecture Resource Tool (SMART), Protein families database of alignments and HMMs (Pfam), Human Protein Reference Database (HPRD), Online Mendelian Inheritance in Man (OMIM), Cancer Genome Anatomy Project (CGAP), and the Entrez Protein search databases. The SMART database is available at smart"dot"embl-heidelberg"dot"de/. The Pfam database can be accessed through the world wide web of the internet at, for example, sanger"dot"ac"dot"uk/Software/Pfam/search.shtml. OMIM, which is a database of human genetic mutations associated with disease, was developed, in part, for the National Center for Biotechnology Information (NCBI). OMIM can be accessed through the world wide web of the internet at, for example, ncbi"dot"nlm"dot"nih"dot"gov/Omim/. CGAP, which is an interdisciplinary program to establish the information and technological tools required to decipher the molecular anatomy of a cancer cell. CGAP can be accessed through the world wide web of the internet at, for example, ncbi"dot"nlm"dot"nih"dot"gov/ncicgap/. The Entrez Protein search database is available through the world wide web of the internet at ncbi"dot"nlm.nih"dot"gov/entrez/query"dot"fcgi?db=Protein. Some of these databases may contain complete or partial nucleotide or amino acid sequences. In recent years, hidden Markov models (HMMs) have become one of the key technologies used for detection of members of these families. The Pfam, TIGRFAMs and SMART databases use the profile-HMMs provided by the HMMER package. TIGRFAMs is a collection of manually curated protein families consisting of HMMs, multiple sequence alignments, commentary, Gene Ontology (GO) assignments, literature references and pointers to related TIGRFAMs, Pfam and InterPro models. TIGRFAMs contains models of full-length proteins and shorter regions at the levels of superfamilies, subfamilies and equivalogs. TIGRFAMs is available for searching or downloading through the world wide web of the internet at "tigr"dot"org/TIGRFAMs.

[0049]The portion of the amino acid sequence of a small G-protein effector can be a domain such as, for example, a Cdc42/Rac Interactive Binding (CRIB) domain, a Rho-binding domain (RhoBD), a Rho-interacting domain (RID), a Rho effector or protein kinase C-related kinase homology region 1 (HR-1), a tetratricopeptide repeat (TPR), or a Pleckstrin homology (PH) domain.

[0050]In some embodiments, the Rho GTPase binding peptide used in the methods of the present invention can comprise an effector, or domain thereof, for the RhoA GTPase protein. Examples include, but are not limited to, a RhoBD, an RID and an HR-1 domain. A consensus amino acid sequence of a RhoBD able to bind an activated RhoA GTPase protein is SEQ ID NO:21. A consensus amino acid sequence of an HR-1 domain able to bind an activated Rho GTPase protein is SEQ ID NO:22. A consensus amino acid sequence of an RID domain able to bind an activated Rho GTPase protein is SEQ ID NO:23. Examples of peptides containing a RhoBD that are effectors for the RhoA GTPase protein include, but are not limited to, Citron (SEQ ID NO:24), ROCK 1 (SEQ ID NO:25), and ROCK 2 (SEQ ID NO:26). Examples of peptides containing HR-1 domains that are effectors for the RhoA/B/C GTPase proteins include, but are not limited to, Protein kinase N 1 (SEQ ID NO:27), Protein kinase N 2 (SEQ ID NO:28), ROCK 1 (SEQ ID NO:25), ROCK 2 (SEQ ID NO:26), Rhophilin (SEQ ID NO:29), Rhotekin (SEQ ID NO:30), and Rhotekin 2 (SEQ ID NO:83). Examples of peptides containing RID domains that are effectors for the RhoA GTPase protein include, but are not limited to, ROCK 1 (SEQ ID NO:25) and ROCK 2 (SEQ ID NO:26). Examples of other peptides that are effectors for the RhoA GTPase protein include, but are not limited to, DGKθ (SEQ ID NO:31), kinectin (SEQ ID NO:32), Dia1 (SEQ ID NO:33), Dia2 (SEQ ID NO:34), MBS (SEQ ID NO:82), and PLC-ε (SEQ ID NO:35).

[0051]Examples of peptides that are effectors for the RhoB GTPase protein include, but are not limited to, Db1 (SEQ ID NO:93) and p76RBE (SEQ ID NO:94).

[0052]In some embodiments, the Rho GTPase binding peptide used in the method of the present invention can comprise an effector for the Rac small G protein. Examples of domains that act as effectors for the Rac small G protein include, but are not limited to, a TPR domain and a PH domain. A consensus amino acid sequence of a TPR domain able to bind an activated Rac small G protein is SEQ ID NO:36. A consensus amino acid sequence of a PH domain able to bind an activated Rac small G protein is SEQ ID NO:37. An example of a peptide containing a TPR domain that is an effector for the Rac small G protein includes, but is not limited to, p67Phox (SEQ ID NO:38). An example of a peptide containing a PH domain that is an effector for the Rac small G protein includes, but is not limited to, PLC-β (SEQ ID NO:39). Examples of other peptides that are Rac small G protein effectors include, but are not limited to, FHOD (SEQ ID NO:40), POR-1 (SEQ ID NO:41), POSH (SEQ ID NO:42), Sra-1 (SEQ ID NO:43), PP5 phosphatase (SEQ ID NO:85), Cinnamolyl-CoA reductase (SEQ ID NO:86), UNC-115 (SEQ ID NO:87), Wave (SEQ ID NO:88), Plexin B1 (SEQ ID NO:89), p35 (SEQ ID NO:90), Tre17 (SEQ ID NO:91), CID (SEQ ID NO:92), and Synaptojanin-2 (SEQ ID NO:44).

[0053]In some embodiments, the peptide used in the methods of the present invention can comprise a domain that is an effector for the Cdc42 small G protein. An example of a domain that can act as an effector for the Cdc42 small G protein includes, but is not limited to, a CRIB domain. A consensus amino acid sequence of a CRIB domain able to bind an activated Cdc42 small G protein is SEQ ID NO:45. Examples of peptides containing CRIB domains that are effectors for the Cdc42 small G protein include, but are not limited to, Ack1 (SEQ ID NO:46), Ack2 (SEQ ID NO:47), Pak4 (SEQ ID NO:48), WASP (SEQ ID NO:49), and N-WASP (SEQ ID NO:50). Examples of other peptides that are effectors for the Cdc42 small G protein include, but are not limited to, CEP1 (SEQ ID NO:51), CEP2 (SEQ ID NO:52), CEP3 (SEQ ID NO:53), CEP4 (SEQ ID NO:54), CEP5 (SEQ ID NO:55), CIP4 (SEQ ID NO:56), Coatamer α protein (SEQ ID NO:57), Coatamer γ protein (SEQ ID NO:58), Dia3 (SEQ ID NO:59), MRCKα (SEQ ID NO:60), MRCKβ (SEQ ID NO:61), Spec1 (SEQ ID NO:62), and Spec2 (SEQ ID NO:63).

[0054]In some embodiments, the GTPase binding peptide used in the methods of the present invention can comprise a domain that is an effector for both the Rac small G protein and the Cdc42 small G protein. An example of a domain that can act as a Rac small G protein and Cdc42 small G protein effector includes, but is not limited to, a CRIB domain. A consensus amino acid sequence of an CRIB domain able to bind an activated Rac small G protein or an activated Cdc42 small G protein is SEQ ID NO:45. Examples of peptides containing CRIB domains that are effectors for the Rac small G protein and the Cdc42 small G protein include, but are not limited to, MLK2 (SEQ ID NO:64), MLK3 (SEQ ID NO:65), Pak1 (SEQ ID NO:66), Pak2 (SEQ ID NO:67), Pak3 (SEQ ID NO:68), Pak5 (SEQ ID NO:69), Pak6 (SEQ ID NO:70), Tre17 (SEQ ID NO:91), and Par6 (SEQ ID NO:71). Examples of other peptides that are effectors for the Rac small G protein and the Cdc42 small G protein include, but are not limited to, IRSp53 (SEQ ID NO:72), IQGAP-1 (SEQ ID NO:73), IQGAP-2 (SEQ ID NO:74), MEKK1 (SEQ ID NO:75), MEKK4 (SEQ ID NO:76), p70 S6 kinase (SEQ ID NO:77), and PI3k, p85 subunit (SEQ ID NO: 78).

[0055]In some embodiments, the GTPase binding peptide used in the methods of the present invention can comprise a domain that is an effector for both the Rac small G protein and the RhoA small G protein. An example of a peptide that is an effector for the Rac small G protein and the RhoA small G protein includes, but is not limited to, PIP5K (SEQ ID NO:79).

[0056]In some embodiments, the GTPase binding peptide used in the methods of the present invention can comprise a domain that that is a binding protein for the active form of the Rac small G protein, the RhoA small G protein, and the Cdc42 small G protein. An example of this class of peptide includes, but is not limited to, PLD-1 (SEQ ID NO:80), Vav PH, DH, CRD domain (SEQ ID NO 81).

[0057]In some embodiments, the GTPase binding peptide used in the methods of the present invention can comprise a domain that that is a binding protein for the active form of the Rnd2 small G protein or TC10 small G protein. An example of this class of peptide includes, but is not limited to, PIST for TC10 (SEQ ID NO:95), Rapostlin for Rnd2 (SEQ ID NO:96) and Pragmin, for Rnd2 (SEQ ID NO:97).

[0058]In some embodiments, the Rho GTPase binding peptide or effector is modified such that all or a portion of the internal cysteine residues are mutated to non-cysteine residues. In some embodiments, the Rho GTPase binding peptide or effector is modified such that it comprises a C-terminal cysteine residue. In some embodiments, the Rho GTPase binding peptide comprises a combination of different effectors or fragments of proteins that can bind to a Rho GTPase protein.

[0059]It is understood in the art that the amino acid sequence of a peptide or protein need not be 100% identical to another peptide or protein in order for both proteins to be considered to have a common or conserved peptide domain or to be members of a conserved protein family. For example, for a short peptide domain (i.e., less than 50 amino acids), several proteins have been found to have a peptide domain known as the Cdc42/Rac Interactive Binding (CRIB) domain. The CRIB domain is a 14- to 16-amino acid sequence with eight conserved residues that was previously shown to be involved in the binding of signaling molecules to activated GTP-bound forms of Rac and Cdc42. The consensus CRIB domain is I-S-X-P-X(4)-F-X-H-X(2)-H-V-G, where the number in brackets represents the total number of variable (X) amino acid residues.

[0060]For larger peptide domains, such as peptides with 50 or more amino acids, when two or more proteins, peptides or domains are homologous, highly conserved, or closely related, the amino acid sequence of a given protein, peptide or domain can be at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of another peptide, protein, or a domain within a given protein.

[0061]In general, among sequences and subsequences of greater than 50 residues in length that are less than 50-60% different, the major features of the alignment are reproduced by a wide variety of algorithms. Thus, closely related sequences greater than 50 amino acids in length and protein homologs will share at least 40% amino acid identity, and in some embodiments will share at least between 40% and 50% amino acid identity, and in some embodiments will share at least between 50% and 60% amino acid identity, and in some embodiments will share at least between 60% and 70% amino acid identity, and in some embodiments will share at least between 70% and 80% amino acid identity, and in some embodiments will share at least between 80% and 90% amino acid identity, and in still other embodiments will share at least between 90% and 100% amino acid identity. The homology can be calculated using various publicly available software tools, such as those developed by NCBI (Bethesda, Md.) obtainable through the internet (ftp"dot"ncbi"dot"nlm"dot"nih"dot"gov/pub/). Exemplary tools include, but are not limited to, the BLAST system available through the world wide web of the internet at ncbi"dot"nlm"dot"nih"dot"gov, and the EMBOSS Pairwise Alignment Algorithms (BLOSUM62 matrix setting) and ClustalW alignments available through the world wide web of the internet at "dot"ebi"dot"ac"dot"uk/emboss/align/ and ebi"dot"ac"dot"uk/clustalw/, respectively.

[0062]In some embodiments, the present invention provides methods for detecting an activated Rho GTPase protein comprising contacting a solid support with a sample comprising an activated Rho GTPase protein. The solid support is linked to an activated Rho GTPase binding peptide. The activated Rho GTPase in the sample binds the activated Rho GTPase binding peptide. The activated Rho GTPase protein in the sample is detected. The activated Rho GTPase protein remains associated with nthe solid support during the detection. As a non-limiting example, the solid support is the well of a microtiter plate to which a Rho GTPase binding peptide is linked and a sample comprising an activated Rho GTPase protein is contacted with the microtiter plate. In this example, the Rho GTPase binding peptide and the activated Rho GTPase protein interact with one another either directly or indirectly through a complex and the remaining proteins or other components of the sample are washed away or removed leaving the activated Rho GTPase protein with the solid support for the detection step. Therefore, in this example, the Rho GTPase protein is considered to remain associated with the solid support. In contrast, in a standard pull-down assay using a bead, wherein a Rho GTPase binding peptide is linked to the bead and contacted with a sample comprising an activated Rho GTPase protein, the activated protein is eluted from the beads and separated from the beads before loading onto a gel or other type of separation medium (e.g., a column) or is separated from the solid support prior to detection. The Rho GTPase protein is then detected but it has been separated away from the solid support (e.g., a bead) and, therefore, in the standard pull-down assay the activated Rho GTPase protein does not remain associated with the solid support during the detecting step.

[0063]As used herein, when two proteins or components are referred to as being "bound to one another" this can mean that they are directly in contact with one another or are in a complex with one another but not in direct contact.

[0064]The solid support can be any surface to which a Rho GTPase binding peptide can bind. Examples include, but are not limited to, a microtiter plate, beads, discs, microarrays, slides, and the like. In some embodiments, the solid support includes a microtiter plate or microarray bu does not include a bead or a disc. In some embodiments, the solid support is activated or coated with an agent that will covalently attach a protein to the solid support, by for example, forming a disulfide bond. An example of such an agent is, but not limited to, malemide. The solid support can also be coated or modified in such a way that allows a protein to bind or bond with the solid support through a non-covalent interaction. For example, the solid support can comprise glutathione, which will bind to a protein comprising a GST moiety or the solid support can comprise a cations that allow a protein comprising a Histidine tag to bind to it. Other modifications can also be used including, but not limited to, avidin-biotin, HA-hemagluttin, and the like.

[0065]In some embodiments, the Rho GTPase binding peptide(s) used in the methods of the present invention are covalently attached to a maleimide activated plate. Maleimide activated plates are available commercially and are designed to immobilize biomolecules through available -SH moieties, usually from a cysteine residue. Examples of maleimide activated microplates include, but are not limited to, polystyrene microplates such as Costar's Sulfhydryl Binding Plates and Strips (Corning, Inc. Corning, N.Y.), Reacti-Bind® Maleimide Activated Plates (Pierce Biotechnology, Inc. Rockford, Ill.) and maleimide activated microwell plates-sulfhydryl-TRAP® (NoAb Biodiscoveries, Inc. Mississauga, Ontario, Canada).

[0066]In some embodiments, the effector peptide(s) used in the methods of the present invention can be attached to a solid support (e.g. microtiter plate or microarray) with a preactivated covalent surface molecule. Available commercially, the surfaces of these plates are highly specific for their coupling partners thus are used to immobilize biomolecules in a site-directed manner. Examples of these plates are, but not limited to, N-oxysuccinimide (DNA-BIND®) activated plate, Hydrazide (Carbo-BIND®) activated plate, Univer-BIND® plate (Corning, Inc. Corning N.Y.), Reacti-Bind NeutrAvidin coated plate, Reacti-Bind Streptavidin coated plate, Reacti-Bind anti-GFP coated plate, Reacti-Bind anti-GST coated plate (Pierce Biotechnology, Rockland, Ill.), Biotin-Trap®, GST-Trap®, Amine-Trap®, Sugar-Trap®, Streptavidin-Trap® plates (NoAb Biodiscoveries, Inc. Mississauga, Ontario, Canada), and the like.

[0067]In some embodiments, the effector peptide(s) used in the method of the present invention can be linked (e.g., attached) to a solid support (e.g. microtiter plate) that contains a medium to high binding surface that passively absorbs biomolecules through hydrophobic or ionic interactions. Examples of these plates include, but are not limited to, a series of EIA/RIA plates made by Corning, Inc, (Corning N.Y.) Pierce biotechnology, Inc (Rockland Ill.), and the like.

[0068]In some embodiments, the effector peptide(s) used in the method of the present invention can be linked to a microtiter plate that contains an aminated or carboxylated surface. Through these surfaces, covalent coupling is achieved using bifunctional crosslinkers that couple the amine or carboxyl group on the surface to a functional group, such as an amine, thiol or carboxyl group, on the peptide. These microplates include, but not limited to, the series of polystyrene or polypropylene plates made by Corning, Inc (Corning N.Y.).

[0069]In some embodiments, the effector peptide(s) used in the method of the present invention can be a plate that is formatted to hold a given reaction volume. Examples include, but are not limited to, 96-well plates, 384-well plates, 1536-well plates, and the like. In some embodiments, the effector peptide(s) of the present invention can be presented in a microarray format.

[0070]In some embodiments, the immobilized effector peptide used in the methods of the present invention were formulated to allow them to be lyophilized in the wells or microarray formats and to furthermore, maintain their ability to bind to activated Rho GTPase proteins upon rehydration.

[0071]In some embodiments, the immobilized peptide is a Rho GTPase protein which creates a target for an effector or effector-HRP conjugate. In this case, the format is designed to screen for ligands that inhibit or enhance the interaction between these two proteins. In this format, the assay can be used to discover ligands that are useful in drug discovery.

[0072]In some embodiments, the assay (method) comprises immobilizing (linking) an active Rho binding peptide or fragment thereof to wells of a microtiter plate. In some embodiments, the method comprises lyophilizing the bound protein in wells to create a highly stable and robust protein matrix; incubating the immobilized binding protein with activated Rho GTPase proteins from clarified or non-clarified cell lysates or from tissue samples or recombinant sources; and quantitating the amount of effector bound activated Rho GTPase protein using a Rho GTPase specific antibody.

[0073]The present method has numerous advantages over previous effector based methods for determining the activation state of Rho GTPase proteins and other small G-proteins. First, the assay can produce a stable lyophilized formulation of active Rho GTPase binding peptides attached to a microtiter well or microarray, thereby allowing the whole activation assay to be carried out in a single well format, eliminating the need for constant sample manipulations and consequently creating a far more robust assay. Second, in some embodiments, the method does not require pre-clarification of cell lysates containing activated Rho GTPase proteins, which allows easier handling of multiple samples and minimizes underestimates of Rho activation due to GAP activity. Third, this assay is more sensitive than current assays allowing the use of smaller amounts of cell lysate or total protein, which can be important in cases where minimal raw materials are available and in cases where high throughput assays are required.

[0074]In some embodiments, the invention provides methods for the high throughput screening of samples (e.g. biological (tissue, blood, and the like) or cell culture) for quantitation of their activated G-protein status. The invention also provides methods for the high throughput screening of compounds or biomolecules that inhibit or enhance or facilitate the interaction between a small G-protein and its effector protein. Examples of the methods include, but not limited to, compounds that inhibit or enhance the RhoA-Rho kinase interaction, RhoA-Dia interaction, RhoC-Rho kinase interaction, Rac1-Pak interaction, Cdc42-Pak interaction.

[0075]In some embodiments, the present invention relates to a solid support (e.g., a microtiter plate or microarray) ELISA based method for detecting activated Rho GTPase proteins. The method comprises, attaching an active Rho GTPase specific binding peptide to wells of a solid support (e.g., microtiter plate or microarray matrix), incubating the immobilized active Rho GTPase binding peptide with a sample (e.g., cell lysates) containing one or more activated Rho GTPase proteins and quantitation of the activated Rho GTPase protein using an antibody (e.g., non-specific or specific) for a particular Rho GTPase protein.

[0076]In some embodiments, the antibody used in the methods of the invention is a monoclonal, recombinant or polyclonal antibody for Rho GTPase proteins. These antibodies can be specific for one family member or for several family members. Examples of these antibodies include, but not limited to, mouse monoclonal anti RhoA antibody (Santa Cruz Biotechnology, Santa Cruz Calif.), mouse monoclonal anti pan-Rho antibody (BD Transduction Laborataries, San Diego Calif.), chicken polyclonal anti RhoA antibody (Genway, Inc. San Diego Calif.), mouse monoclonal anti-Rho A,B,C (Cytoskeleton Inc.), mouse anti-RhoA (Cytoskeleton Inc.), and the like.

[0077]In some embodiments, the antibody used in the method of the invention can be a monoclonal, recombinant or polyclonal primary antibody conjugated to an enzyme or detectable biomolecules. These detectable conjugated antibodies avoid the use of secondary antibody thus increasing the specificity of the reaction. Examples of the conjugated antibodies include, but not limited to, HRP-conjugated primary antibody, AP-conjugated primary antibody, biotin-conjugated primary antibody previously mixed with a streptavidin-HRP conjugate.

[0078]In some embodiments, the antibody used in the method of the invention can be a monoclonal, recombinant or polyclonal antibody to a specific effector of Rho GTPase proteins.

[0079]An "antibody specific for a particular Rho GTPase protein" refers to an antibody that is specific for only one Rho GTPase protein and will not react or detect a different Rho GTPase protein. In some embodiments, an antibody can be bi-specific, such that it can bind or detect two Rho different Rho GTPase proteins. In some embodiments, an antibody recognizes one or more Rho GTPase proteins. In some embodiments, a non-specific antibody is used that can detect and bind to more than two Rho GTPase proteins. The antibody can be specific for a particular Rho GTPase protein, but the antibody can also recognize in some embodiments only an activated form of the Rho GTPase protein, an inactive form of the Rho GTPase protein, or in some embodiments the antibody can recognize both active or inactive forms.

[0080]In some embodiments, the present invention provides a solid support (e.g., microtiter plate or microarray) ELISA based methods for detecting activated recombinant Rho GTPase proteins. The method can comprise linking a Rho GTPase specific binding peptide (e.g., an effector peptide) to wells of a microtiter plate or microarray matrix; incubating the immobilized effector peptide with one or more activated recombinant Rho GTPase proteins; and quantitation of the activated Rho GTPase protein using an antibody specific for a particular Rho GTPase protein.

[0081]In some embodiments, the Rho GTPase protein is a recombinant mutant form of the Rho GTPase and/or a constitutively active mutant. One of skill in the art can create constitutively active mutants of Rho GTPase proteins. In some embodiment, the effector protein or peptide can be incubated with the immobilized Rho GTPase protein and Rho GTPase effector interactions are quantitated using an effector specific antibody.

[0082]In some embodiments, the method comprises quantitating the amount of an active Rho GTPase protein.

[0083]As used herein, "an effector specific antibody" is an antibody that binds to only one effector and cannot detect or bind to a different effector.

[0084]In some embodiments, the cell lysate or sample is formulated in a solution containing a buffer component between pH 5-10, about pH 7.5, or a pH of about 6 to about 8, about 6 to about 9, about 7 to about 8, or about 7. In some embodiments, the sample comprising the effector peptide or the Rho protein can comprise a detergent component. The detergent component can be, for example, a non-ionic detergent such as, but not limited to, Triton X-100. The final concentration of the detergent can be, for example, about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.5, about 1 to about 2, about 1 to about 3, about 0.5 to about 1.5, about 0.75 to about 1.25, about 1 to about 5, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 1 to 2, 1 to 3, 0.5 to 1.5, 0.75 to 1.25, or 1 to 5%. In some embodiments, the cell lysate or sample comprises magnesium chloride. In some embodiments, the final concentartion of magnesium chloride can be, for example, from about 5 to about 80, about 10 to about 50, about 15 to about 25, about 20, 5 to 80, 10 to 50, 15 to 25, or 20 mM.

[0085]The sample or lysis buffer can also comprise a salt component. Examples of a salt component include, but are not limited to sodium chloride, potassium chloride, and the like. The final concentration of the salt component can be, for example, from about 10 to about 700, about 100 to about 500, 10 to 700, or 100 to 500, 100, 200, 300, 400, 500, about 100, about 200, about 300, about 400, about 500 mM.

[0086]In some embodiments, the amount of total protein in the sample or cell lysate is from about 1 to about 300, about 20 to about 50, about 1 to about 200, about 1 to about 100, about 1 to about 75, about 1 to about 50, about 1 to about 25, about 1 to about 10, about 20, about 50, less than 100, less than 75, less than 50, less than 25, less than 10, less than 300, or less than 200 μg.

[0087]In some embodiments, the sample comprises about 10³ to about 10⁶, 10³ to about 10⁵, 10³ to about 10⁴, 10⁴ to about 10⁵, less than 10⁶, less than 10⁵, or less than 10⁴ cells or a cell lysate prepared from the same number of cells as indicated herein.

[0088]The detection of an interaction (e.g., binding) between a Rho GTPase binding peptide and an Rho GTPase protein (e.g., activated or unactivated) can be carried out with any method or machine that one can use to detect such interactions. For example, the detection can use the detection of a change in absorbance, luminescence, fluorescence, combinations thereof, and the like.

[0089]In some embodiments of the invention, prior to detecting the activated Rho GTPase protein in the sample, an Antigen Presenting Buffer (APB) (also referred to as "antigen presenting enhancement") is added. The Antigen Presenting Buffer comprises one or more compounds or treatments that can attenuate loss of the activated Rho GTPase protein from the solid support. In some embodiments, the Antigen Presenting Buffer comprises heat denaturation; dry denaturation; urea treatment; crosslinkers such as SMCC and glutaraldehyde; ethanol or methanol; or tricholoracetic acid; or any combination or subgroup thereof. In some embodiments, loss of the activated Rho GTPase protein from the solid support is attenuated by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, or by at least 90%. In some embodiments, the final concentration of trichloroacetic acid is about 0.5% to about 15% v/v. In some embodiments, the final concentration of TCA is about 0.5% to about 10%, about 0.5% to about 7.5%, about 0.5% to about 5%, about 0.5% to about 4%, about 0.5% to about 3%, about 0.5% to about 2%, about 0.5% to about 1%, about 0.5%, or about 1%, less than 10%, less than 5%, less than 4%, less than 3%, or less than 2% v/v.

[0090]In some embodiments, prior to detecting the activated Rho GTPase protein in the sample, a Binding Buffer (also referred to as a "protein:protein interaction enhancer") is added. In some embodiments, the Binding Buffer increases the binding affinity of the Rho GTPase binding peptide and the Rho GTPase protein at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2-fold, 3-fold, or more than 3-fold than in the absence of the Binding Buffer. In some embodiments, the Binding Buffer comprises ficoll, dextran, or polyethylene glycol, or any combination or subgroup thereof. In some embodiments, the polyethylene glycol is PEG 4000 or PEG 8000 at a final concentration of about 2% to about 40% v/v. In some embodiments, the final concentration of the PEG is about 2% to about 40%, about 2% to about 30%, about 2% to about 25%, about 2% to about 20%, about 2% to about 10%, about 2% to about 5%, about 2%, about 10%, about 20%, about 30%, about 40%.

[0091]In some embodiments, the method further comprises quantitating the amount of activated Rho GTPase protein in the sample. The manner in which the amount of the protein is quantitated is not specific to the present method and any quantitation method can be used. Suitable methods include, but are not limited to, differences in absorbance, luminescence, or fluorescence.

[0092]In some embodiments, the method further comprises contacting the sample with a test agent and determining whether the test agent modulates binding of the activated Rho GTPase protein to the activated Rho GTPase binding peptide. In some embodiments, the test agent will increase the binding and in other embodiments the test agent will decrease the binding. A test agent can be any compound or composition such as a protein, peptide, small organic molecule, carbohydrate, and the like. If the test agent inhibits the binding the test agent is considered to be an inhibitor. The binding of the Rho GTPase protein and the Rho GTPase binding peptide can be compared in the absence and the presence of the test agent to determine if the test agent modulates the binding. The binding can be detected or quantitated by any method including those described herein.

[0093]In some embodiments, the present invention provides a method for detecting an activated Rho GTPase protein comprising contacting a solid support with a sample comprising an activated Rho GTPase protein, wherein a modified Rho GTPase binding peptide is linked to the solid support, and wherein the modified Rho GTPase binding peptide has a lower K_d (i.e., binds with a greater affinity) with the activated Rho GTPase protein than the unmodified Rho GTPase binding peptide has with the Rho GTPase protein; and detecting the activated Rho GTPase protein in the sample. In some embodiments, the modified Rho GTPase binding peptide is an oligomerized Rho GTPase binding peptide or a mutated Rho GTPase binding peptide. The modified peptide can be any peptide as described herein and known to one of skill in the art including, but not limited to, a modified Rhotekin, modified ROCK1, modified PAK1, modified POSH, or modified WASP.

[0094]In some embodiments, the present invention provides methods of detecting an activated Rho GTPase protein comprising contacting a microtiter plate or microarray with a sample comprising an activated Rho GTPase protein, wherein an activated Rho GTPase specific antibody is linked to the microtiter plate or microarray; and detecting the activated Rho GTPase protein in the sample.

[0095]In some embodiments, the present invention provides methods of identifying an activated Rho GTPase binding peptide comprising contacting a test agent with an activated Rho GTPase protein optionally in the presence of an Antigen Presenting Buffer; and detecting the binding of the Rho GTPase protein to the test agent, wherein the detection of binding indicates that the test agent is an activated Rho GTPase binding peptide.

[0096]In some embodiments, the present invention provides methods further comprising contacting a solid support with a sample comprising an activated Rho GTPase protein, wherein the solid support is linked to the test agent; and detecting the activated Rho GTPase protein in the sample.

[0097]In some embodiments, the present invention provides methods of determining whether an Antigen Presenting Buffer is beneficial to detect the binding of an activated Rho GTPase protein to an activated Rho GTPase binding peptide comprising contacting a solid support with a sample comprising the activated Rho GTPase protein, wherein a Rho GTPase binding peptide is linked to the solid support; and detecting the activated Rho GTPase protein in the sample at different time intervals, wherein a decrease in detection at different time intervals indicates that the Antigen Presenting Buffer is beneficial.

[0098]In some embodiments, the present invention provides methods of determining whether a test buffer is an Antigen Presenting Buffer comprising contacting a solid support with a test buffer and an activated Rho GTPase protein, wherein an activated Rho GTPase binding peptide is linked to the solid support; and detecting the binding of the activated Rho GTPase protein to the activated Rho GTPase binding peptide at different time intervals, wherein if no decrease in detection is observed in the presence of the test buffer as compared to the absence of the test buffer, then the test buffer is an Antigen Presenting Buffer that facilitates detection of binding of an activated Rho GTPase binding peptide with an activated Rho GTPase protein. If, in the absence of the test buffer, there is a decrease in detection wherease the presence of the test buffer prevents the decrease in the detection then the test buffer is an APB.

[0099]In some embodiments, the present invention provides compositions comprising a solid support; an Antigen Presenting Buffer; an activated Rho GTPase protein; and an activated Rho GTPase binding peptide or a modified Rho GTPase binding peptide.

[0100]In some embodiments, the present invention provides kits comprising a solid support and an activated Rho GTPase binding peptide, wherein the activated Rho GTPase binding peptide is optionally linked to the solid support; and optionally an Antigen Presenting Buffer. In some embodiments, the kit comprises a Rho GTPase binding peptide that is covalently linked to the solid support. In some embodiments, the kit further comprises a positive control, wherein the positive control comprises an activated Rho GTPase protein that can bind to the Rho GTPase binding peptide. In some embodiments, the kit comprises an Antigen Presenting Buffer that comprises trichloric acetic acid (TCA). In some embodiments, the kit comprises a Binding Buffer, such as dextran, ficoll, PEG, or combinations thereof.

[0101]In some embodiments, the kit comprises a Rho GTPase binding peptide that is Rhotekin, ROCK1, PAK1, POSH, or WASP. In some embodiments, the kit further comprises instructions for carrying out the detection of an activated Rho GTPase protein.

[0102]In some embodiments, the kit comprises an agent for detecting binding between the Rho GTPase binding peptide and an activated Rho GTPase protein, wherein the agent is luminescent, fluorescent, or radioactive. In some embodiments, the kit comprises a solid support that is a microtiter plate, microarray, or slide, wherein the solid support is optionally activated with malemide or otherwise activated or coated as described herein to facilitate the binding of the Rho GTPase binding peptide to the solid support.

[0103]In order that the invention disclosed herein may be more efficiently understood, examples are provided below. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting the invention in any manner. Throughout these examples, molecular cloning reactions, and other standard recombinant DNA techniques, were carried out according to methods described in Maniatis et al., Molecular Cloning--A Laboratory Manual, 2nd ed., Cold Spring Harbor Press (1989), using commercially available reagents, except where otherwise noted.

EXAMPLES

Example 1

Production of Effector-GBD Peptides for the G-LISA Assay

[0104]There are some sequence motifs that are shared between subgroups of Rho GTPase effectors, for example, the Cdc42/Rac-interacting binding (CRIB) motif is present in many, though not all Rac and Cdc42 binding proteins (Burbelo et al., 1995, J. Biol. Chem., 270:29071-29074) and has been found to be necessary but not sufficient for effector binding (Rudolph et al., 1998, J. Biol. Chem., 273:18067-18076). A further common Rho effector motif is the Rho effector homology (REM) found in PRK1 and PRK2 and the HR1 repeat motif which is found in effectors such as rhophilin and rhotekin (Flynn et al., 1998, J. Biol. Chem., 273:2698-2705). However, there are a large number of effectors that do not contain any of the currently identified GTPase-binding motifs. These include the POSH, PI3K and DAG effectors (Bishop et al., 2000, Biochem. J., 348:241-255). This type of protein is classified as a Rho effector purely on its functional ability to differentiate between the GTP (active) and GDP (inactive) bound forms of Rho GTPases (Tapon, 1998, EMBO J., 17:1395-1404; and Kobayashi et al., 1998, J. Biol. Chem., 273:291-295). It is therefore accepted by those skilled in the art that Rho effectors are currently defined by their functional ability to selectively recognize the GTP-bound (active) form of Rho GTPases over the inactive GDP form of the GTPase (Vetter et al., 2001, Science, 294:1299-1304; Blumenstein et al., 2004, J. Biol. Chem., 279:53419-53426; Martin et al., 1995, EMBO J., 14:1970-1978; Leung et al., 2005, Proc. Natl. Acad. Sci., 102:5685-5690; Bishop et al., 2000, Biochem. J., 348:241-255; and Fujisawa et al., 1998, J. Biol. Chem., 273:18943-18949).

[0105]The example provided herein has utilized six of the most extensively characterized Rho effectors, or more specifically Rho effector-GTPase Binding Domain (GBD) peptides. Table 1 details the effector and the specificity of the effector for activated Rho family proteins.

TABLE-US-00001 TABLE 1 Effector Recognition of Activated Rho Family Proteins Activated Rho family proteins Effector recognized by name effector-GBD References Rhotekin RhoA, RhoB, Reid, 1996, J. Biol. Chem., 271: 13556 RhoC ROCK1 RhoA, RhoB, Fujisawa, 1996, J. Biol. Chem., 271: 23022 RhoC, RhoE/ Riento, 2003, Mol. Cell. Biol., 23: 4219 Rnd3 PAK1 Rac1, Rac1b, Bagrodia, 1995, J. Biol. Chem., 270: 22731 Rac2, Rac3, Saras, 2004, J. Exp. Cell Res., 299: 356 Cdc42, Wrch1 POSH Rac1 Tapon, 1998, EMBO, 17: 1395 WASP Cdc42, TC10, Symons, 1996, Cell, 84: 723 TCL, Wrch2/ Abe, 2002, J. Cell. Sci., 116: 155 Chp Vignal, 2000, J. Biol. Chem., 275: 36457 Aronheim, 1998, Curr. Biol., 8: 1125 Dial RhoA, RhoC Watanabe, 1997, EMBO J., 16: 30444

Materials and Methods

[0106]Effector cDNA Cloning

[0107]For all of the effector proteins and effector GTPase Binding Domains (GBD) provided herein as examples, the full length mammalian cDNA has been previously described (see Table 2). Effector-GBD peptides have been cloned by PCR using the primers and cDNA sources indicated in Table 2. The nucleotide numbering in Table 2 corresponds to the Genbank submission numbering scheme. GTPase Binding Domains (GBDs) were selected based upon published data identifying active Rho binding domains of effectors (see Table 1).

TABLE-US-00002 TABLE 2 Effector Cloning Information Primers for cDNA cloning Nucleotides Effector Accession 5' primer included cDNA name number 3' primer (amino acid) source Rhotekin NM_009106 5' caggatccattctggaagatctgaacatgctg 19-267 Mouse (SEQ ID NO: 98) (7-89) 3' cagaattcgcccccaccagttttttcgag (SEQ ID NO: 99) ROCK1-1 NM_005406 5' accgaattcgaagctgagcaatatttctcg 2539-3070 Human (SEQ ID NO: 100) (847-1024) 3' accgaattctcaacattgtgtattagctttctttctata (SEQ ID NO: 101) Dial-1 NM_005219 5' caggatcctctgcatcatatggggatgat 187-780 Human (SEQ ID NO: 102) (63-260) 3' cagaattctcatagaatacaaagagcagaaag (SEQ ID NO: 103) PAK1 NM_002576 5' caggatccaaagagaaagagcggccagagat 202-453 Human (SEQ ID NO: 104) (68-151) 3' cagaattctcaacactcagctgacttatctgtaaagctc (SEQ ID NO: 105) POSH NM_020870 5' caggatccaagcaccccgacaccaagaag 871-1089 Human (SEQ ID NO: 106) (291-363) 3' cagaattcacccagtggtgcttatatggacc (SEQ ID NO: 107) WASP NM_000377 5' caggatccgacatccagaaccctgacatcacg 601-963 Human (SEQ ID NO: 108) (201-321) 3' cagaattctcaacatcgagatggcggtgggggcggc (SEQ ID NO: 109) *Cysteine codons are underlined

[0108]The sequences from the GenBank accession numbers from Table 2 and anywhere provided herein, are incorporated herein by reference in their entirety.

Modification of Effector-GBD DNA Sequences to Allow Directional Covalent Binding to Maleimide Activated Plates

[0109]In instances where effector-GBD peptides were linked covalently to maleimide plates (see later in this example and Table 3), the effector-GBD peptide DNA was modified to contain a single cysteine residue at the carboxy terminal Cysteine codons were engineered into the primer design for ROCK1, PAK1 and WASP (see Table 2, the cysteine codon in the 3' primers are underlined). In the case of POSH, advantage of the cystein codon (position 351) close to the carboxy terminal was taken.

[0110]The effector-GBD of rhotekin contains three internal cysteine residues (Table 2 and FIG. 1). To allow directional binding of rhotekin-GBD to maleimide plates the rhotekin-GBD was chemically synthesized (Entelechon GmbH, St. Veit-Weg 2, 93051 Regensburg, Germany), the three internal cysteins were removed and replaced with glutamic acid (aa#43), leucine (aa#49) and serine (aa#65) respectively. A cysteine codon was placed at the carboxy terminal of the modified rhotekin-GBD, immediately upstream of a stop codon. The design of the synthetic rhotekin-GBD sequence was carried out using Leto 1.0 gene optimization software which is based on a proprietary genetic algorithm (Entelechon GmbH, St. Veit-Weg 2, 93051 Regensburg, Germany). The sequence design allowed optimization of codon usage, homogenous GC content, mRNA secondary structure, codon and motif repeats and restriction sites. The synthetic Rhotekin-GBD DNA was supplied by Entelechon GmbH in a pUC18 cloning vector. The DNA was cleaved with restriction enzymes BamH1 and EcoR1 according to the manufacturers instructions (Promega Corp., Madison, Wis.) and the 273 by DNA fragment containing modified Rhotekin-GBD was cloned directly into the BamH1 and EcoR1 sites of the expression vector pGEX-4T, creating a Rhotekin-GBD domain fused to a Glutathione S Transferase tag at the amino terminal and containing a unique cysteine residue at the carboxy terminal. All molecular biology manipulations were carried out in accordance with general principles outlined in Molecular Cloning, A Laboratory Manual, 1998, Second edition, Cold Spring Harbor Laboratory Press. Ed. Sambrook et al.

Expression Plasmid Vector Backbones and Purification Tag

[0111]The example described herein utilizes the expression vectors pRSET-A (Invitrogen Corp., Grand Island, N.Y.) which contains an N-terminal Histidine tag (His-tag) and pGEX-4T (GE Healthcare (Pharmacia Inc.), Piscataway, N.J.) which contains an N-terminal GST-tag. A thrombin protease site between the GST-tagged constructs and effector-GBD peptide of interest allows removal of the GST tag by thrombin cleavage. Table 3 recites the vector used for cloning of each effector-GBD used in the examples. Table 3 also recites the tag used for effector-GBD peptide purification and the method used for linking peptide to microtiter plates. Details of microtiter plate coating is provided in Example 2.

TABLE-US-00003 TABLE 3 Effector Purification Tags and Plate Binding Tags Plasmid Vector Purificiation Plate Effector-GBD Backbone tag Peptide Linker for Plate Binding Chemistry ROCK1 pRSET-A Histidine Unique cystein engineered into Maleimide carboxy terminal of effector Rhotekin pGRX-4T GST GST tag at amino terminal Glutathione Rhotekin- pGEX-4T GST Unique cystein engineered into Maleimide Cys carboxy terminal of effector PAK1 pGEX-4T GST GST tag at amino terminal Glutathione POSH pRSET-A Histidine Naturally occuring cystein in Maleimide POSH protein WASP pRSET-A Histidine Unique cystein engineered into Maleimide carboxy terminal of effector Dia pGEX-4T GST GST tag at amino terminal Glutathione

Effector Protein Expression

[0112]Bacterial cultures (for example BL21 (DE3) or BL21) containing an expression construct (for example those plasmids described in Table 2) were grown in media (typically LB media) plus a suitable antibiotic (typically ampicillin at 50 μg/ml). Cultures were grown at 37° C. with shaking at 200 rpm until OD₆₀₀ reached approximately 0.6. To induce protein production, IPTG was added to 0.2 mM and shaking was continued at room temperature (typically for 12 hours). Prior to induction, a small sample of bacteria were collected (typically 1 ml) and stored at -20° C. After induction, a small sample of bacteria (typically 1 ml) were collected and stored at -20° C. The remainder of the culture was harvested by pelleting bacteria at 6,000 g. Bacterial pellets could be stored at -20° C. until processed. The 1 ml bacterial samples mentioned above were used to determine efficiency of recombinant protein induction by comparing recombinant protein levels in induced versus uninduced bacterial pellets. Typically this analysis is done by coomassie staining of proteins in an SDS-PAGE system.

Effector Protein Purification

[0113]Bacterial pellets were resuspended in lysis buffer (typically 20 ml per liter of culture). Lysis buffer for His tagged proteins was typically 50 mM Tris pH 7.5, 50 mM NaCl, 0.5 mM MgCl₂, and 5 mM imidazole. Lysis buffer for GST tagged proteins was typically 50 mM Tris pH 7.5, 150 mM NaCl, and 2 mM EDTA. Resuspended cells were passed through four layers of cheesecloth to remove debris and cells were lysed by passage through a microfluidizer (Model M-110L, Microfluidics). Lysates were clarified by a centrifugation step at 60,000 g.

[0114]Histidine tagged proteins were purified by immobilized metal-affinity chromatography (IMAC) (Bornhorst et al., 2000, Methods in Enzymology, 326:245-254). Briefly, lysates were incubated with metal chelated beads (typically nickel or cobalt beads at 1 ml of beads per liter of bacterial culture). The bead/lysate mixture was incubated for 30-60 minutes at 4° C. Beads were washed with wash buffer (50 mM Tris pH 7.5, 0.5 mM NaCl) containing imidazole concentrations ranging from 10 mM to 30 mM. Recombinant effector protein was eluted in 3-5 bead volumes of elution buffer (500 mM imidazole, 200 mM NaCl, 50 mM Tris pH 7.5, 1 mM MgCl₂) and stored at -70° C.

[0115]GST tagged proteins were purified by glutathione affinity chromatography (Smith, 2000, Methods in Enzymology, 326:254-270). Briefly, lysates were incubated with glutathione beads (typically 1 ml of beads per liter of bacterial culture) at 4° C. for 1 hour. The beads were then washed 3 times with an equal volume of lysis buffer and recombinant GST tagged effector protein was eluted with 3-5 bead volumes of elution buffer (lysis buffer plus 10 mM reduced glutathione) and stored at -70° C.

Thrombin Cleavage of GST Tagged Effector-GBD Peptides

[0116]The protocol followed the procedure outlined in Meth. Enz. 1995, 256:178. Briefly, GST-tagged protein bound to glutathione beads were washed 3 times in PBS plus 1% Triton X-100 and 3 times in 50 mM Tris pH 7.5, 150 mM NaCl, and 2.5 mM CaCl₂. The beads were finally resuspended in an equal volume of calcium buffer. Bovine alpha thrombin (Sigma) was added to the beads at 30 units per mg of protein. The cleavage was carried out for 2-5 hours at 4° C. with rotation. The beads were removed by centrifugation and the cleaved proteins were retained and stored at -70° C.

Pull-Down Assay

[0117]Modified GST rhotekin-GBD peptide was bound to glutathione beads and 20 ug of bead bound effector was added to 500 μl (250 μg) of clarified GTPγS or GDP loaded platelet extract (see Example 2 for lysate preparation). The mixture was incubated at 4° C. with rotation for 1 hour. The beads were then washed twice in wash buffer (50 mM Tris pH 7.5, 100 mM NaCl, and 30 mM MgCl₂), resuspended in 1 bead volume of SDS sample buffer (75 mM Tris pH 6.8, 2% SDS, 10% glycerol, 5% β-mercaptoethanol, and 2 mg/ml bromophenol blue) and subjected to SDS-PAGE (4-20% gradient). The proteins were transferred to PVDF membranes (Cat# IPVH304F0, Millipore, Bedford, Mass.) and a western blot was perfomed thereafter with anti-RhoA at 0.25 μg/ml (Cat# ARH01, Cytoskeleton Inc., Denver, Colo.), anti-Rac1 at 0.25 μg/ml (Cat# ARC01, Cytoskeleton Inc., Denver, Colo.), anti-Cdc42 at 1 μg/ml (Cat# ACD01, Cytoskeleton Inc., Denver, Colo.). The activated RhoA protein band was detected using primary antibody specifically recognizing RhoA protein and a goat anti-mouse secondary (Jackson Labs., Catalog #115-035-068). The assay was performed at least eight times.

Results

Effector-GBD Cloning

[0118]All effector-GBD cDNA sequences described in Table 2 were confirmed to match the published Genbank sequences. In addition, the presence of an engineered carboxy terminal cysteine codon was confirmed for ROCK1, PAK1 and WASP constructs.

[0119]FIG. 1B details the sequence of the synthetic rhotekin-Cys-GBD domain. Comparison of the synthetic and wild type rhotekin-RBD sequence confirmed that all three internal cystein reidues were removed from the synthetic construct and replaced with glutamic acid (aa#43), leucine (aa#49) and serine (aa#65). The presence of a carboxy terminal cysteine, that was introduced for the purpose of oriented binding to maleimide plates, was also confirmed by sequence analysis (FIG. 1B). cDNAs were cloned using restriction sites recited in Table 2 primers. DNA and amino acid sequence of wild type and modified Rhotekin-Cys-GBD. Amino acid residue changes between wild type and Cys mutant effector-GBD are shown bold and underlined.

Effector Expression and Purity

[0120]Typical effector-GBD peptide purities were in the range of 70-80% as determined by scanning densitometry of coomassie stained peptides separated by molecular weight on SDS-PAGE gels (FIG. 1A). Briefly, purified GBD domains of PAK1-GST (30 μg), ROCK1-His (10 μg), WASP-His (20 μg), POSH-His (20 μg), Rhotekin-Cys-no tag (GST tag cleaved with thrombin) (10 μg), Rhotekin wild type GBD-GST (20 μg) and Dia1-GST (15 μg) were loaded on a SDS-PAGE and the protein gel was stained with coomassie blue.

Confirmation of Effector-GBD Biological Activity

[0121]The ability of effector-GBD peptides to selectively bind to activated Rho proteins was determined for all effector-GBD peptides with either a GST pull-down (FIG. 1C for the modified Rhotekin-Cys and data not shown) or a G-LISA assay (data not shown and see Example 2). Briefly, 50 μg of purified Rhotekin-Cys GBD mutant beads were incubated with 500 μg GDP or GTPγS loaded platelet extract and the bead precipitated RhoA-GTP was subject to SDS-PAGE and Western blot analysis with anti-RhoA antibody.

Discussion

[0122]There are currently 21 members of the Rho family, as defined in Wennerberg et al, 2005, J. Cell Sci., 118:843-6 and Schnelzer et al., 2000, Oncogene, 19:3013-3020. These are RhoA, RhoB, RhoC, RhoD, Rnd3, Rnd1, Rnd2, Rif, RhoG, RhoH, Rac1, Rac1b, Rac2, Rac3, Cdc42, TC10, TCL, Wrch-1, Wrch-2, RhoBTB1 and RhoBTB2.

[0123]The combination of effector-GBD peptides used in this example are able to selectively bind to the active form of 13 out of 21 or 62% of all Rho family members (see Table 1). This includes the best characterized Rho proteins, namely RhoA, Rac1 and Cdc42 as indicated from PubMed citations (PubMed citations from 1996-2006; RhoA (2467), Rac1 (1931), Cdc42 (2455), RhoB (283), RhoC (117), RhoD (187), Rnd3 (23), Rnd1 (31), Rnd2 (15), Rif (searched as Rif small G-protein) (5), RhoG (83), RhoH (26), Rac2 (219), Rac3 (85), TC10 (70), TCL (searched as TCL small G-protein) (6), Wrch-1 (6), Wrch-2 (4), RhoBTB1 (4), RhoBTB2 (6), Rac1b (22)). Because any given effector will usually bind to more than one Rho GTPase, assay specificity for detection and quantitation of a particular endogenous Rho GTPase depends upon the combination of effector-GBD and a Rho GTPase specific antibody. Using the combination of effector and antibody to obtain Rho GTPase specificity provides this assay an advantage over other active Rho GTPase detection systems that use effector "specificity" only (Pertz et al., 2004, J. Cell Sci., 117:1313-1318).

[0124]The effectors here set forth will be referenced throughout the remaining examples, however, it is understood by those of skill in the area that the methods, assays and the like herein disclosed apply equally well to any Rho effector-GBD. This is particularly true when one considers that the definition of a Rho effector, as defined in Vetter et al., 2001, Science, 294:1299-1304, "Effectors for GTP-binding proteins are operationally defined as molecules interacting more tightly with the GTP-bound than with the GDP-bound form" is accepted by those of skill in the area as the practical definition of a Rho GTPase effector. It will also be understood that the embodiment of this invention is completely dependent upon the practical operational definition of Rho GTPase effectors.

Example 2

Utility of Covalently Linked Effector-GBD Plates in G-LISA Assays

[0125]There are many chemistries described in the art for linking a particular peptide to a microtiter plate or microarray (Dent et al., 1998, Bioconjugation, Macmillan Reference Ltd, Chapter 8:505-556). In the broadest terms, linkages can be classified into covalent and non-covalent formats. Both types of linkage are demonstrated herein (see non-covalent linkage, Example 7). The example described herein details a method of covalent linkage through maleimide activated plates.

[0126]Covalent linkage of peptides to microtiter plates through activated surface groups occurs when electrons are shared between atoms to generate chemical bonds. While the reactions forming such bonds are always theoretically reversible, the low probability of the reverse reaction occurring in practice results in products that can be thought of as permanent (Dent et al., Bioconjugation, Macmillan Reference Ltd, 1998, p. 218-342). The essentially irreversible nature of peptide linkage has the potential advantage of forming a very stable effector-GBD matrix that will not suffer from biomolecule loss, displacement or surface migration (Larsson et al., 1987, J. Immunol. Meth, 98:129135; Dent et al., 1998, Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences, Chapter 8, Other Categories of protein Coupling, p. 505-556). For this reason, it was decided to pursue a covalent linkage format (but see also non-covalent linkage in Example 7).

[0127]There are many types of covalent linkage plate chemistries available to link peptides to plates including, but not limited to, the N-oxysuccinimide (NOS) sufaces that covalently couple primary amine groups (Pierce Biotechnology Inc., Rockford, Ill.) and the Univer-BIND® plate that reacts with aliphatic carbon-hydrogen bonds (Corning, Inc., NY). The plate chemistry that is described in this example is the maleimide plate, these are available commercially and are designed to immobilize biomolecules through available -SH moieties, usually from a cysteine residue in the coupling peptide. Examples of maleimide activated microplates include, but are not limited to, polystyrene microplates such as Costar's Sulfhydryl Binding Plates and Strips (Corning, Inc. Corning, N.Y.), Reacti-Bind® Maleimide Activated Plates (Pierce Biotechnology, Inc. Rockford, Ill.) and maleimide activated microwell plates--sulfhydryl-TRAP® (NoAb Biodiscoveries, Inc. Mississauga, Ontario, Canada). Linkage through a cysteine residue provided the opportunity to engineer peptides that contained a single cysteine and that could, therefore, be oriented on the plate (see Example 1). Homogenous effector orientation is predicted to yield more reproducible plates with lower overall coefficients of variation (Dent et al., 1998, Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences, Chapter 8, Other Categories of protein Coupling, p. 505-556).

Materials and Methods

Covalent Attachment of Effector-GBD Peptides to Maleimide Plates

[0128]Effector-GBD peptide (ROCK1, POSH or WASP, see Table 2) was diluted in coating buffer (PBS pH 7.2, plus 1 mM EDTA) to a final concentration 0.05 mg/ml and 5 μg of peptide was added to the wells of maleimide plates (Corning Inc., Catalog #2510). Plates were incubated at 21° C. for 2 hours, washed twice in PBS pH 7.2. Plates were blocked for 1 hour at room temperature with milk (typically 0.1-5%, depending upon effector-GBD). After two washes with PBS (pH 7.2), Lyophilization Buffer was added to each well (5% sucrose and 1% dextran) and the plates were lyophilized and stored desiccated at 4° C.

Constitutively Active Recombinant Rho Proteins

[0129]A glutamine to leucine mutation in amino acid 63 of RhoA or amino acid 61 of Rac1 and Cdc42 results in a peptide that is unable to hydrolyse GTP and is therefore constitutively active (Xu et al., 1994, J. Biol. Chem., 269:23569-23574; and Nobes et al., 1994, Curr. Op. Gen. Dev., 4:77-81). The mutant proteins are commercially available as histidine taged peptides (Cytoskeleton Inc. Catalog #R6301 (constitutively active RhoA), R6101 (constitutively active Rac1) and C6101 (constitutively active Cdc42). Typically, constitutively active protein was diluted to 0.2 ng/μl in Cell Lysis buffer (50 mM Tris pH 7.5, 300 mM NaCl, 2% IGEPAL, 0.01% SDS, and 10 mM MgCl₂) and 1-5 ng of protein was used in a G-LISA assay.

Production of In Vitro Nucleotide Loaded Cell Lysates

[0130]Cell lysates can be loaded with either GTP, GTPγS or GDP and have been widely used as controls for the standard pull-down assays (Knaus et al., 1992, J. Biol. Chem., 267:23575-23582). Artificially loaded lysates also provided robust substrates for the development of a given G-LISA assay. Human platelet extract at 4 mg/ml in Cell Lysis Buffer (50 mM Tris pH 7.5, 300 mM NaCl, 2% IGEPAL, 0.01% SDS, and 10 mM MgCl₂) was clarified by centrifugation at 8,000 g, 4° C. for 3 minutes. EDTA was added to a final concentration of 15 mM. GTPγS, GTP or GDP, at 1 mM final concentration, were added to separate aliquots of clarified lysates. Each lysate was incubated for 15 minutes at room temperature to allow the exchange (loading) of nucleotide to Rho proteins. Loading reactions were stopped by the addition of 60 mM MgCl₂. Lysates were diluted to 0.5 mg/ml in Cell Lysis Buffer and used in G-LISA assays. Typically 7-15 μg of loaded platelet cell lysate was used for each G-LISA assay. Platelets loaded with GTP are referred to as labile GTP extracts throughout this example.

G-LISA Assays

[0131]Active Rho protein (typically 7-15 μg total cell lysate or 1-5 ng of constitutively active recombinant protein) were either added directly to the effector bound G-LISA plate (Rac1 and Cdc42 G-LISAs) or diluted with an equal volume of Binding Buffer (20% PEG 8000, Sigma, St. Louis, Mo.) prior to adding to effector bound plates (RhoA G-LISA). The reactions were incubated for 30 minutes at 4° C. on a microtiter titer plate shaker after which wells were washed once with 200 μl of PBST (PBS pH 7.2, 0.05% Tween-20) and immediately treated with 200 μl of Antigen Presenting Buffer (1% trichloroacetic acid (TCA)) for 2-5 minutes at room temperature. Wells were then washed three times with 200 μl each of PBST and primary antibody is added typically at 1 μg/ml (RhoA specific), 0.25 μg/ml (Rac1 specific), 1 μg/ml (Cdc42 specific) and incubated at room temperature for 45 minutes (incubation at 4° C. gave similar results). Wells are washed three times with 200 μl each of PBST and incubated with appropriate secondary antibody for 45 minutes at room temperature (incubation at 4° C. gave similar results). For RhoA and Rac1 reactions goat anti-mouse secondary at 2 μg/ml is used, for RhoA,B,C reactions donkey anti-chicken secondary at 0.5 μg/ml is used, for Cdc42 reactions goat anti-sheep secondary antibody is used at 0.5 μg/ml. After three washes each of 200 μl PBST the activated Rho proteins are detected using absorbance or luminescence detection as described below.

Measuring G-LISA Assays with Absorbance or Luminometry

[0132]Absorbance is measured at OD490 in a spectrophotometer (SpectraMax 250, Molecular Devices) after addition of 50 μl of OPD substrate (Sigma Catalog #P9187) for 15 minutes at 37° C. followed by addition of 50 μl of stop buffer (1M sulfuric acid). Luminescence was measured in a SpectroFluor Plus (Techan Inc.) after addition of 50 μl of lumigen reagent (Lumigen Inc., Catalog #PSA-100), typical settings were 100-150 gain and 10-100 ms integration.

Antibodies

[0133]Primary and secondary antibodies used for G-LISA assays in the example set forth and when stated, in other examples set forth are: anti-RhoA (Clone 384 or Part#GL01 in Cat#BK124, Cytoskeleton Inc., Denver, Colo.), anti-RhoA,B,C (clone 419 or Part#GL04 in Cat#BK120) anti-Rac1 (Part#GL06 in Catalog #BK122h, Cytoskeleton Inc., Denver, Colo.), anti-Cdc42 (Catalog #ACD02, Cytoskeleton Inc., Denver, Colo.), goat anti-mouse and donkey anti-sheep (Catalog #115-035-068 and 313-005-045, Jackson ImmunoResearch labs. Inc., West Grove, Pa.).

Results

Utility of Effector-GBD Maleimide Plates for Detection of Specific Rho GTPases

[0134]Published estimates of cellular levels of a given Rho GTPase typically fall into the 1×10^-4 ng per cell range (2003, J. Immunol., 170:5652-5657; and Quinn et al., 1993, J. Biol. Chem., 268:20983-20987). Further, based upon published data, one can assume approximately 2-10% of a particular Rho GTPase is typically activated in response to any particular stimulus (Ren et al., 1999, EMBO J., 18:578-585; Bernard et al., 1999, J. Biol. Chem., 274:13198-13204; and Werner et al., 2002, J. Cell Biol., 158:357-368). Further, based upon published data, a standard pull-down assay typically requires 1×10⁶ to 1×10⁷ cells or 300-800 μg of total cellular protein (Benard et al., 2002, Meth. Enz., 345:349-359; Ren et al., 2000, Meth. Enz., 325:265-272; and Werner et al., 2002, J. Cell Biol., 158:357-368), this amount of lysate is equivalent to approximately 100-1000 ng of a particular Rho protein (both active and inactive conformation combined). Therefore, assuming 2-10% activation of a particular Rho GTPase in response to a particular stimulus, one is looking at a signal for active Rho GTPase in the range of 2-100 ng for a standard pull-down assay.

[0135]Taking the above calculations into consideration, initial tests of the G-LISA using 5 ng of recombinant constitutively active Rho GTPases were performed. This amount of protein was considered to be close to the lower levels of detection for the pull-down assay and, because it was desirable to eventually use considerably less than 300-800 μg of cell lysate, the initial tests should be designed such that a fairly stringent level of detection could be obtained. Using the constitutively active forms of the Rho GTPases was a logical choice for initial tests as they present a clearly defined and easily interpretable system.

[0136]Rho effectors typically bind to more than one isotype of activated Rho protein (see Example 1, Table 1). For example, ROCK1 (and ROCK1-GBD) recognize the active form of RhoA, RhoB and RhoC and RhoE/Rnd3 (Fujisawa, 1996, J. Biol. Chem., 271:23022; and Riento et al., 2003, Mol. Cell. Biol., 23:4219). Specificity of a particular G-LISA assay is therefore dependent upon the choice of both effector and antibody. Thus, in the example of a ROCK1-GBD plate (FIG. 2A) RhoA specificity is imparted by the use of the ROCK-GBD plate in combination with a RhoA specific antibody (clone 384).

[0137]Referring to FIG. 2A, lysis buffer only (Blank), 5 ng of RhoA (63L), Cdc42 (61L) or Rac1 (61L) were subjected to a RhoA G-LISA assay as detailed in materials and methods, and RhoA signal was detected by luminometry as described in materials and methods. FIG. 2A shows that the ROCK1-GBD maleimide plate (ROCK plate) used in combination with a RhoA specific antibody (clone 384) gave a signal 6-fold above background (buffer only) with 5 ng of constitutively active RhoA. Constitutively active Cdc42 and Rac1 did not give a signal above background for this plate. It can therefore be concluded that the ROCK1-GBD plate is able to bind to active RhoA and that the RhoA antibody can specifically detect this level of protein above background. Antibody 384 is specific for RhoA, as demonstrated in FIG. 7A. The rhotekin-Cys effector-GBD was tested to selectively bind to RhoA. This modified effector-GBD gave a signal for constitutively active RhoA 6-fold above background (data not shown).

[0138]Referring to FIG. 2B, lysis buffer only (Blank), 5 ng of Rac1 (61L), or RhoA (63L) were subjected to a Rac1 G-LISA assay as detailed in materials and methods (Example 2), and Rac1 signal was detected by absorbance at 490 nm as described in materials and methods (Example 2). In a similar manner, FIG. 2B shows that a POSH bound maleimide plate (POSH plate) used in combination with a Rac1 specific antibody (GL06, Cat# BK122h) gave a signal 9-fold above background with 5 ng of constitutively active Rac1. As predicted, constitutively active RhoA gave a signal barely above background.

[0139]Referring to FIG. 2C, lysis buffer only (Blank), 5 ng of Cdc42 (61L) or Rac1 (61L) were subjected to a Cdc42 G-LISA assay as detailed in materials and methods (Example 2), and Cdc42 signal was detected by absorbance at 490 nm as described in materials and methods (Example 2). FIG. 2C shows that a WASP bound maleimide plate (WASP plate) used in combination with a Cdc42 specific antibody (Catalog #ACD02, Cytoskeleon Inc., Denver, Colo.) gave a signal 5-fold above background with 5 ng of constitutively active Cdc42. As predicted, constitutively active Rac1 did not give a signal above background.

[0140]In conclusion, the data in FIG. 2 establishes that the maleimide linked effector-GBD's retain the ability to recognize their target active Rho GTPase. Further, in combination with the appropriate antibody, low nanogram levels of the specific active Rho GTPase can be detected.

Utility of Effector-GBD Maleimide Plates for Discrimination Between Active and Inactive Rho GTPases

[0141]The G-LISA assays are not only required to detect signal from a particular activated Rho GTPase, they must also be able to distinguish between the active (GTP bound) and inactive (GDP bound) states of a particular Rho protein. The effector-GBD maleimide plates were tested using artificially loaded platelet extracts (see Materials and Methods for details). The artificially loaded extracts in this example have had their endogenous GTPases loaded in vitro with either GTPγS (a slowly hydrolysable GTP analog) or GDP. As the GTPγS is essentially non-hydrolysable the signal from activated samples is very stable. This is in contrast to a normal cell lysate in which the Rho GTPase would be succeptible to GTPase Activating Protein (GAP) enhanced GTP hydrolysis and consequent inactivation (Moon et al, 2003, Trends Cell Biol., 13:13-22). It is accepted by those of skill in the art that lysates containing endogenous Rho proteins artificially loaded in a fixed active state are useful in experiments where one requires robust activation of Rho (typically >10% activation) with limited involvement of Rho hydrolysis (Liseti et al., 2004, J. Biol. Chem., 279:5055).

[0142]Referring to FIG. 3A, lysis buffer only, 25 μl of GDP or GTPγS labeled platelet extracts (0.5 mg/ml) (or 15 μg) were mixed with same volume of Binding Buffer and subjected to a standard RhoA G-LISA assay. RhoA signal was detected by luminometry as described in materials and methods. ROCK-GBD maleimide plates were used. The results show that the binding properties of the ROCK plate allow clear differentiation between active RhoA (GTPγS) and inactive (GDP) RhoA, with active RhoA having a 7-fold higher signal than inactive RhoA in this assay.

[0143]Referring to FIG. 3B, 50 μl of lysis buffer only, GDP or GTPγS labeled platelet extracts (0.5 mg/ml) (or 15 μg) were subjected to a Rac1 G-LISA assay as detailed in the materials and methods. Rac1 signal was detected by absorbance at 490 nm as described in the materials and methods. POSH-GBD maleimide plates were used. The results show that the binding properties of the POSH plate allow clear differentiation between active Rac1 (GTPγS) and inactive (GDP) Rac1, with active Rac1 having a 30-fold higher signal than inactive Rac1 in this assay.

[0144]In conclusion, the data in FIG. 3 establishes that the maleimide linked effector-GBDs retain the ability to distinguish active from inactive forms of a particular Rho GTPase. Furthermore, the active Rho GTPase signal could be detected using luminometry (FIG. 2A) or absorbance (FIG. 2B) based methods.

Example 3

Development of Antigen Presenting Buffer for the G-LISA

[0145]Initial attempts to detect active Rho GTPases in the RhoA:ROCK and Rac1:POSH G-LISA assays were not successful because a signal that was significantly above background in either assays (FIGS. 5A (untreated) and 5B (no APB)) could not be obtained. An initial strategy was to develop an ELISA based assay by following a protocol essentially analogous to the original pull-down assays described by Benard et al. for the Rac1:PAK pull-down assay (1999, J. Biol. Chem., 274:13198-13204) and Ren et al. and Kranenburg at al. for the RhoA:Rhotekin pull-down assay (1999, EMBO J., 18:578; and 1999, Mol. Biol. Cell, 10:1851-1857, respectively). The same procedure has been used for pull-down assays using ROCK, Citron, Dia and WASP (Kimura et al., 2000, J. Biol. Chem., 275:17233-17236, and Edlund et al., 2002, Mol. Biol. Cell, 13:902-914). Briefly, maleimide plates were coated with effector, active Rho GTPases in standard pull-down lysis buffer (50 mM Tris, pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, 10 mM MgCl₂ for RhoA assays; 50 mM Tris, pH 7.5, 10 mM MgCl₂, 200 mM NaCl, 1% Nonidet P-40, 5% glycerol for Rac1 and Cdc42) was introduced into the wells and incubated for 1 hour at 4° C. with shaking (400 rpm), the wells were then washed with standard pull-down wash buffer (50 mM Tris, pH 7.2, 1% Triton X-100, 150 mM NaCl, 10 mM MgCl₂ for RhoA; 25 mM Tris, pH 7.6, 1 mM DTT, 30 mM MgCl₂, 40 mM NaCl, 1% Nonidet P-40 for Rac1) and the reactions were developed using Rho GTPase specific primary antibodies (Cat.# ARH01, Cytoskeleton Inc. for RhoA, Cat# ARC01, Cytoskeleton Inc. for Rac1) and anti-mouse or anti-rabbit secondary antibodies respectively (Jackson Labs). After 3 washes in TBST, the reactions were developed using absorbance or luminescence detection. Absorbance was measured at OD₄₉₀ in a spectrophotometer (SpectraMax 250, Molecular Devices) after addition of 50 μl of OPD substrate (Sigma Catalog #P9187) for 15 minutes at 37° C. followed by addition of 50 μl of stop buffer (1M sulfuric acid). Luminescence was measured in a SpectroFluor Plus (Techan Inc.) after addition of 50 μl of lumigen reagent (Lumigen Inc., Catalog #PSA-100), typical settings were 100-150 gain and 10-100 ms integration. It should be noted that a standard checkerboard titration for ELISA based antibody concentration optimizations (Crowther, 2001, Meth. Mol. Biol., 149:83-113) was used. In addition, the antibodies used in these G-LISA assays have been shown to work very well in pull-down assays (they are components in Cytoskeleton Pull-Down Assay Kits, Cat# BK034 (Cdc42), BK035 (Rac1) and BK036 (RhoA)). Extensive tests of various blockers, reaction buffers, temperature of incubations, and antibody dilution buffers were also performed. The failure of the G-LISA to work under the standard conditions that have been applied to all pull-down assays suggested that there are one or more fundamental differences between the two assay formats.

[0146]Without being bound to any particular theory, one possible reason for failure of the G-LISA approach under standard pull-down conditions could be the fact that very low concentrations of effector bound to the plate were used--this is discussed in the next Example (Use of Binding Buffer in the G-LISA). It was also possible that antibodies capable of recognizing a signal in the western blot analysis of pull-down assays are not able to recognize the Rho GTPase in the G-LISA format--this possibility is discussed in Example 5 (Development of Optimized Antibodies for the G-LISA Assays). A further possibility, and the subject of the Example disclosed herein, was that the G-LISA effector:GTPase complex is lost during the incubation processes of the G-LISA assay.

[0147]The pull-down assay captures active Rho GTPases with effector-bound beads or discs and, after a wash step, the active Rho GTPase must be eluted from beads in order to be analysed by western blot detection (Benard et al., 1999, J. Biol. Chem., 274:13198-13204; Ren et al., 1999, EMBO J., 18:578; Kranenburg at al., 1999, Mol. Biol. Cell, 10:1851-1857; and Sun et al., 2006, Microcirculation, 13:237-247). A major difference between the Rho GTPase pull-down assays and the G-LISA assay, is the fact that the G-LISA assay is dependent upon the Rho GTPase being associated with the solid support matrix to which the effector is bound, such as, but not limited to a microtiter plate, throughout the assay. One aim of the experiments in the Example disclosed herein was to a) determine if there was any dissociation of GTPase from the solid matrix throughout the G-LISA, and b) determine ways to prevent loss of the Rho GTPase, if necessary, and, thus, obtain quantitative results for Rho GTPase activation.

Materials and Methods

Western Analysis of G-LISA Rho GTPase Effector Binding

[0148]Constitutively active RhoA GTPase protein (R63) and GTP loaded platelet extract capable of GTP hydrolysis was used to examine dissociation of effector:GTPase over time. The G-LISA assay was perfomed as follows: R63 protein (10 ng per assay) or GTP loaded platele extract (25 μg) were incubated with ROCK-GBD effector bound to maleimide plates, incubations were at 4° C. for 30 minutes with shaking at 400 rpm. The reaction was washed twice with 200 μl TBST to remove unbound Rho GTPase. At this point, samples from several wells were eluted with SDS buffer (5% SDS, 63 mM Tris pH 6.8, 5% mercaptoethanol, 10% glycerol) and pooled for later western analysis. The remaining reactions were incubated for 45 minutes in primary anti-RhoA antibody (clone 384) at room temperature with shaking 400 rpm. After 3 washes in TBST, samples from several wells were eluted as above in SDS buffer and saved for later analysis. The remaining reactions were incubated for 45 minutes in secondary anti-chicken antibody at room temperature with shaking 400 rpm. After 3 washes in TBST, samples from several wells were eluted as above in SDS buffer and saved for later analysis. Western analysis was performed using the anti-RhoA mouse monoclonal antibody.

RhoA Antigen Presenting Buffer Tests

[0149]Platelet cell lysates loaded with GTPγS or GDP nucleotides (10 μg total cell lysate per assay) were diluted with an equal volume of Binding Buffer (20% PEG 8000, Sigma, St. Louis, Mo.) prior to adding to ROCK effector bound plates. The reactions were incubated for 30 minutes at 4° C. on a microtiter titer plate shaker after which wells were washed once with 200 μl of PBST (PBS pH 7.2, 0.05% Tween-20) and immediately treated with one of the following chemical/physical treatments: microwaving for 3 minutes in the presence of 200 μl PBS; microwaving for 3 minutes dry; microwaving for 3 minutes in the presence of 200 μl of 8M urea; 200 μl methanol for 2 minutes; 200 μl ethanol for 2 minutes; 200 μl of 0.5% SDS for 2 minutes, 200 μl of 10% trichloroacetic acid (TCA) for 2 minutes at room temperature. Wells were then washed three times with 200 μl each of PBST and RhoA primary antibody (B384) was added at 1 μg/ml and incubated at room temperature for 45 minutes. Wells were washed three times with 200 μl each of PBST and incubated with anti-mouse secondary antibody (Jackson Labs) for 45 minutes at room temperature. After three washes each of 200 μl PBST, the activated Rho proteins were detected using luminescence detection. Luminescence was measured in a SpectroFluor Plus (Techan Inc.) after addition of 50 μl of lumigen reagent (Lumigen Inc., Catalog #PSA-100).

Test of TCA Benefit in Rac1 G-LISA

[0150]Constitutively active recombinant Rac1 (5 ng) in cell lysis buffer, or cell lysis buffer alone, were added directly to a POSH effector-bound G-LISA plate. The reactions were incubated for 30 minutes at 4° C. on a microtiter titer plate shaker after which wells were washed once with 200 μl of PBST (PBS pH 7.2, 0.05% Tween-20) and immediately treated with 200 μl of Antigen Presenting Buffer (1% trichloroacetic acid (TCA)) for 2-5 minutes at room temperature. Wells were then washed three times with 200 μL each of PBST and primary Rac1 antibody was added at 1 μg/ml and incubated at room temperature for 45 minutes. Wells were washed three times with 200 μl each of PBST and incubated with anti-mouse secondary antibody for 45 minutes at room temperature. After three washes each of 200 μl PBST, the activated Rho proteins were detected using absorbance detection. Absorbance was measured at OD₄₉₀ in a spectrophotometer (SpectraMax 250, Molecular Devices) after addition of 50 μl of OPD substrate (Sigma Catalog #P9187) for 15 minutes at 37° C. followed by addition of 50 μl of stop buffer (1M sulfuric acid).

Results

[0151]In order to examine dissociation of GTPase from effector in a system permitting GTP hydrolysis 25 μl of GTP labeled platelet extract (2 mg/ml) was subjected to a standard RhoA G-LISA in a ROCK coated maleimide plate. The bound activated RhoA was eluted with SDS buffer at different stages of G-LISA assay. The bound RhoA was eluted with SDS buffer at different stages of G-LISA assay (after a 30 minute incubation in a ROCK plate (Lane 1), after a 45 minute primary antibody incubation (Lane 2), after a 90 minute secondary antibody incubation (Lane 3)). The eluted Rho was then subjected to SDS-PAGE and Western blot with anti-RhoA antibody. To examine dissociation of GTPase from effector in a system that did not permit GTP hydrolysis 10 ng of RhoA (63L) was subjected to a standard RhoA G-LISA. The bound RhoA (63L) was eluted with SDS buffer at different stages of G-LISA assay (after a 30 minute incubation in a ROCK plate (Lane 4), after a 45 minute primary antibody incubation (Lane 5), after a 90 minute secondary antibody incubation (Lane 6)). The eluted Rho was then subjected to SDS-PAGE and Western blot with anti-RhoA antibody. The top and bottom figures are identical except for the length of exposure of the developing film. The shorter exposure allows a more quantitative look at the 63L signal while the longer exposure is better for viewing the loss of sugnal in the endogenous RhoA samples. The 63L recombinant constitutively active RhoA protein runs higher than endogenous RhoA due to the presence of a His tag on 63L.

[0152]The results in FIG. 4 show the active RhoA signal from a hydrolysis deficient mutant RhoA protein (L63) is reduced by 10% after the primary antibody incubation (FIG. 4, compare Lanes 4 and 5) and by 40% at the end of the secondary antibody incubation (FIG. 4, compare Lanes 4 and 6). The reduction in signal in the GTP loaded RhoA samples is 60% after the primary antibody incubation (FIG. 4, compare Lanes 1 and 2) and >90% after the secondary antibody incubation (FIG. 4, compare Lanes 1 and 3). The enhanced loss of signal in the GTP samples is likely due to hydrolysis of the GTPase during the course of the assay (Benard et al., 2002, Meth. Enz., 345:349-359). In this regard, the signal loss over time is also significantly higher in platelet extracts loaded with GTP than in platelets loaded with non-hydrolysable GTPgS samples (data not shown). Taken together the data strongly supports that RhoA signal loss in this assay is due to both simple dissociation and dissociation due to deactivation of the RhoA by GTP hydrolysis. In this regard, an attempt to slow down dissociation by carrying out the antibody incubations at 4° C. and keeping all buffers at 4° C. did not improve the signal to noise of the assays (data not shown).

[0153]It was concluded that it was necessary to develop assay conditions that prevented, or minimized, loss of GTPase from the reaction.

[0154]Several physical (heat denaturation) and/or chemical treatments for antigen complex stability were evaluated. Crosslinkers such as gluteraldehyde, protein precipitation reagents such as methanol and ethanol and trichloroacetic acid (TCA), chaotrophs such as urea, and denaturants such as sodium dodecyl sulfate (SDS) were chosed for the initial studies.

[0155]Referring to FIG. 5A, lysis buffer only (untreated), 15 μg of GDP- or GTPγS-labeled platelet extracts were subjected to a RhoA G-LISA assay. After extract incubation, the plate was treated with MW+PBS, MW/Dry, MW/8 M urea, methanol, ethanol, 0.5% SDS, 10% TCA or no treatment followed by antibody incubation and luminescence detection. MW=5 minute microwave treatment. White bars show GDP signal, grey bars show GTPγS signal. Referring to FIG. 5B, lysis buffer only (Blank) or 5 ng of Rac1 (61L) were subjected to Rac1 G-LISA assay as described in the materials and methods except that the assays were performed either with or without Antigen Presenting Buffer treatment (1% TCA or No APB respectively) Rac1 signal was detected by absorbance at 490 nm as described in the materials and methods.

[0156]It was discovered that several chemical and/or physical treatments such as the combination of microwaving (heat denaturation) in the presence of 8M urea dramatically improved the detection of active RhoA proteins in G-LISA assays (MW+UREA 8M, FIG. 5A). Microwaving in PBS gave a greatly increased signal for GTPγS binding. The high cv values, however, were a problem with this method (MW+PBS, FIG. 5A). Microwaving in the absence of buffer gave poor differentiation between GTPγS and GDP samples (MW+DRY, FIG. 5A). Of the other treatments tested, glutaraldehyde (data not shown) and ethanol gave a consistently positive signal for active RhoA above background (FIG. 5A). Treatment with methanol or 0.5% SDS did not give any significant signal for active RhoA above background. The treatment of the plate with 200 μl of 10% TCA for 2 minutes at room temperature yielded signal for GTPγS RhoA that was approximately 8-fold higher than the GDP RhoA signal (10% TCA, FIG. 5A).

[0157]Upon further studies, it was found that out of several acid conditions tested, including acetic acid (data not shown), treatment of the effector:GTPase complex (after washing) with 1% TCA for 2 minutes at room temperature was a suitable choice of Antigen Presenting Buffer treatment for RhoA:ROCK and Rac1:POSH G-LISA assays. The benefit of the Antigen Presenting Buffer in the Rac1:POSH G-LISA is demonstrated in FIG. 5B. A 2 minute incubation in Antigen Presenting Buffer results in a signal from constitutively active Rac1 (5 ng) that is 7-fold above background. Omitting the Antigen Presenting Buffer results in an assay that cannot detect active Rac1 above background (Cell Lysis Buffer alone).

Discussion

[0158]Loss of signal during antibody incubations was found to occur in all G-LISA formats tested, however the degree of loss varied according to effector:GTPase pair analysed. For example, RhoA:ROCK, Rac1:POSH, Rac1:PAK1 (FIG. 9), lost >80% of signal in the absence of TCA while Rho-Dia1 only lost approximately 50% and Cdc42:WASP lost only 20% signal (data not shown). Rho effector-GBD peptides can significantly slow down the intrinsic rate of GTP hydrolysis for Rho proteins but do not prevent this process (Leonard et al., 1997, Biochem., 36:1173-1180; and Bernard et al., 1999, J. Biol. Chem., 274:13198-13204). Hence, the degree to which GTPase dissociation occurs will depend upon, amongst other things, the affinity of a particular effector for its active GTPase target and the ability of the effector to prevent GTP hydrolysis of its GTPase target.

[0159]A further factor predicted to enhance loss of Rho GTPase signal is a high intrinsic rate of hydrolysis of the GTPase. In this regard, Ras GTPases have a much slower intrinsic rate of GTP hydrolysis than Rho GTPases (Neal et al., 1989, J. Biol. Chem., 261:10963; and Self et al., 1995, Meth. Enz., 256:67-76). Hence, loss of signal due to hydrolysis is unlikely to be as much of an issue with a Ras based G-LISA assay. For example, published affinities for Rac1:PAK and Ras:Raf1 are both approximately 20 nM. Therefore, it would be predicted, despite the similar effector affinities, that the Ras assay will be far less dependent upon Antigen Presenting Buffer than the Rac1:PAK assay that clearly benefit from this step (FIG. 9).

[0160]Several chemical and physical treatments were tested for their ability to attenuate loss of Rho GTPase. While many of the treatments, for example 8M urea combined with heat treatment gave enhanced signal, it was discovered that 1% (60 mM) TCA treatment of the complex for 2 minutes at room temperature appeared to be a suitable method of complex stabilization.

[0161]TCA treatment was tested with a wide range of effector:GTPase combinations including, RhoA:rhotekin, RhoA:Dia1, RhoA:ROCK, Rac1:PAK and Rac1:POSH. The TCA treatment enhanced signals in all cases tested. Some G-LISAs such as RhoA:ROCK and Rac1:POSH (FIGS. 5A and 5B) showed a great benefit for TCA Antigen Presenting Buffer while others, such as RhoA:Dia1, gave enhanced RhoA signal with TCA treatment (data not shown). The benefit of Antigen Presenting Buffer was also found to apply to G-LISA assays employing the PAK-GST and rhotekin-GST non-covalent plates (see FIG. 9 and data not shown). This suggests that Rho GTPase loss is not likely to be influenced by a particular plate chemistry and, thus, appears to be a general feature of the G-LISA assay format.

[0162]The discoveries herein predict that attenuation of Rho GTPase loss from the G-LISA solid support by treatment with Antigen Presenting Buffer or the like is an important parameter in the development of any particular Rho G-LISA assay. In this regard, that dissociation is time dependent can also be utilized in the general developmental scheme of any effector:Rho G-LISA assay. For example, that dissociation was markedly greater after 90 minutes incubation (40% for constitutively active RhoA and 90% for wild type RhoA) than after 45 minutes (10% and 60% respectively) might suggest a scheme where one uses an HRP conjugated primary antibody or the like to minimize assay time. This scheme could possibly aleviate or make redundant the presence of Antigen Presenting Buffer. Thus, one skilled in the art could effectively utilize the information herein disclosed towards the design of any Rho G-LISA assay.

Example 4

Use of Binding Buffer in the G-LISA

[0163]As mentioned in the previous Example, the G-LISA assay did not work when simply adapting the pull-down assay to an ELISA type system. The low levels of both effector (<1 μg) and protein lysates (6-15 μg total lysates) were reasoned herein to possibly be below the critical concentration required for effector:GTPase binding. Accordingly, inclusion of a compound or reagent capable of enhancing protein:protein interactions may push the binding equilibrium in favor of effector:GTPase complex formation. Therefore, the effect of protein:protein interaction enhancers, such as polyethyethylene glycol and the like, were examined in the G-LISA reaction (Kozer et al., 2004, J. Mol. Biol., 336:763-740; and Ingham, 1990, Meth. Enz., 182:301-306).

Materials and Methods

Preparation of Activated Cell Lysates

[0164]Swiss 3T3 cells were grown in DMEM media supplemented with 10% fetal calf serum until 50% confluent. They were then serum starved for 24 hours prior to treatment with 100 μg/ml calpeptin for 30 minutes to activate RhoA, as described in detail in Example 8. HeLa cells were treated with EGF for 2 minutes to activate Rac1, as described in detail in Example 8.

Results

[0165]In the example set forth, the effect of adding increasing amounts of PEG8000 to RhoA and Rac1 G-LISAs was assessed. In the case of RhoA, increasing amounts of PEG (from zero to 10% final concentration) was found to enhance the active RhoA signal obtained from calpeptin treated Swiss 3T3 cells by over an order of magnitude (FIG. 6B, 0% PEG compared to 10% PEG).

[0166]Referring to FIG. 6A, 25 μl of serum starved or Calpeptin treated (RhoA activated) Swiss 3T3 cell lysates (0.5 mg/ml) were incubated in a room temperature water bath for 0, 10 or 30 min either in the presence (+) or absence (-) of Binding Buffer (10% PEG 8000, final concentration). Samples were then subject to a standard RhoA G-LISA assay in ROCK maleimide plates, quantitated by reading absorbance at 490 nm. SS is serum starved samples (white bars), RhoA induced samples labeled Calpeptin (grey bars). Referring to FIG. 6B, 25 μl of serum starved or Calpeptin treated (RhoA activated) Swiss 3T3 cell lysates (0.5 mg/ml) were diluted with an equal volume of 0%, 5%, 10%, 15% or 20% PEG 8000 and immediately subjected to a standard RhoA G-LISA assay in ROCK maleimide plates, samples were quantitated by reading absorbance at 490 nm. SS is serum starved samples (white bars), RhoA induced samples labeled Calpeptin (grey bars). Referring to FIG. 6C, 25 μl of serum starved or EGF treated (Rac1 activated) Hela cell lysates (1 mg/ml) were diluted with an equal volume of 0%, 5%, 10%, 15% or 20% PEG 8000 and immediately subjected to a standard Rac1 G-LISA assay in POSH maleimide plates. Samples were quantitated by reading absorbance at 490 nm. SS is serum starved samples (white bars), Rac1 induced samples labeled EGF (grey bars). In all cases, AU=Absorbance Units and all readings had buffer only background subtracted.

[0167]Rho proteins are very unstable in lysates due to the presence of a large number of GTPase Activating Proteins (GAPs) that act to rapidly hydrolyse Rho proteins (Moon et al., 2003, Trends Cell Biol., 13:13-22). It might therefore be considered likely by one skilled in the art that addition of a protein:protein interaction enhancer to a lysate containing active Rho proteins would be more likely to enhance rapid GTP hydrolysis, by enhancing Rho:GAP interactions, than to enhance Rho:effector interactions (Ren et al., 1999, EMBO J., 18:578). Surprisingly, it was found herein that addition of PEG and the like had an insignificant effect upon RhoA signal after 10 minutes at room temperature (FIG. 6A, +/-10 minutes) and resulted in only a minor loss of RhoA signal after 30 minutes at room temperature (FIG. 6A, +/-30 minutes). The gradual reduction in active RhoA signal over time in FIG. 6A is the result of RhoA inactivation due to GTP hydrolysis (Benard et al., 1999, J. Biol. Chem., 274:13198-13204). Thus, in the RhoA G-LISA, the inclusion of a PEG "Binding Buffer" step was beneficial in producing a highly robust signal from activated RhoA. The benefit of the RhoA G-LISA assay (using a His-ROCK1 plate) for PEG Binding Buffer has been confirmed in several different cell lines, for example 3T3 cells, HeLa cells, Jurkat cells and MDCK cells (data not shown).

[0168]In the case of Rac1 increasing amounts of PEG in the G-LISA assay (from zero to 10% final concentration) was found to correlate with a decrease in active Rac1 signal (FIG. 6C). Thus, in this case, PEG appears to be having a negative effect upon the G-LISA signal. It is hypothesised that this is due to enhanced hydrolysis of GTP on active Rac1 due to increased concentrations of Rac GAP proteins. In this regard, it has been reported that Rac1 has a higher intrinsic rate of GTP hydrolysis and a higher affinity towards GAPs than RhoA (Liget et al., 2004, J. Biol. Chem., 279:5055).

Discussion

[0169]The degree to which the inclusion of PEG Binding Buffer or the like will improve or inhibit any given G-LISA assay is likely to depend upon a complex mixture of parameters. These include, the effect of Binding Buffer on GAP activated GTP hydrolysis of a particular Rho protein, the binding constant of a particular effector-GBD for a particular active Rho protein and the amount of effector bound per well.

Example 5

Development of Optimized Antibodies for the G-LISA Assays

[0170]As mentioned in the previous example, initial attempts to achieve a differential signal between activated and non-activated Rho GTPase proteins in a G-LISA assay did not yield positive results. It was previously determined by western blot analysis of proteins eluted from pooled wells of a G-LISA plate, that the effector-GBD plates could capture constitutively active Rho GTPases (see FIG. 4). This promted the development of a screening strategy for the production of G-LISA optimized monoclonal antibodies. The example below describes the development of a RhoA specific antibody (clone 384) and a Rho A,B,C specific antibody (clone 419).

Materials and Methods

[0171]RhoA and RhoA,B,C specific antibodies were developed as follows: a Rho peptide (CDEHTRRELAKMKQEPVKPEEGRD; SEQ ID NO:110) was synthesized (Bachem Inc., King of Prussia, Pa.) and congugated to KLH using an Imject Kit (Pierce, Rockford, Ill. 61105; Catalog #0077610) according to the manufacturer's instructions. Efficiency of KLH-peptide conjugation was determined using Ellman's reagent to measure free cysteins (Sigma, St. Louis, Mo., Catalog #D8130) according to the manufacturer's instructions. Six week old mice (BALB/c) were immunized with 50 μg of KHL-conjugated peptide. Subsequent injections were performed approximately 10-15 days apart. After testing bleeds with a standard ELISA assay and western blot assay against recombinant RhoA (Catalog #RH01, Cytoskeleton Inc., Denver, Colo.), a candidate mouse was selected and given a final boost intravenously in saline solution. The mouse was sacrificed 3 days later. Spleen cells were fused to myeloma cells and hybridomas were selected by ELISA assays against RhoA and RhoC peptides, western blots against RhoA, RhoB, RhoC peptides and platelet extracts and in G-LISA assays. Platelet lysates loaded with GDP or GTPγS were used in the G-LISA screen (method descibed in Example 2). An increase in GTPγS loaded Rho signal over GDP loaded Rho indicated that the antibody may be useful in a G-LISA assay. Clones and purified antibodies were produced by standard procedures outlined in Harlow and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.

[0172]Secondary antibody, goat anti-mouse was obtained from Jackson Immunoresearch Labs., West Grove, Pa. (Catalog #115-035-068).

Results

[0173]Hybridomas were screened in three separate assays, a standard ELISA assay, a standard western blot assay and a Rho G-LISA assay. Results are outlined below and in FIGS. 7A and 7B. Referring to FIG. 7A, standardized dilutions (1:500) of each antibody (clones 248, 362, 384, 419, 465, 505, 591, 603, 621, 660, 733, 942, 957, 977, 979, 1019, 1157, 1164, 1281, and 1324) were analysed by western blotting. Samples of recombinant Rho A, B and C (50 ng each) and 20 μg of platelet extracts were used as samples for analysis of antibody specificity and relative sensitivity (Western Ranking). Goat anti-mouse secondary antibody was used at 1:10,000 dilution. Blots were developed using chemilluminescence detection (Pierce west Dura). The strongest signals from platelet extracts was ranked #1, the lowest was ranked 10^th, N=no signal under conditions used. Standard absorbance ELISA plates were coated with recombinant RhoA or RhoC and the antibodies above were tested in a standard absorbanced based assay against both antigens as described in Antibodies: A Laboratory Manual, Ed. Harlow and Lane, Cold Spring Harbor Press, 1988, Chapter 6:174-194. Antibodies with the strongest ELISA signal for RhoA were ranked highest. For G-LISA assays the antibodies were used in a standard RhoA G-LISA assay to detect signals from 12.5 μg of GDP- or GTPγS-loaded platelet extracts on ROCK maleimide plates. All antibodies were tested at the 1:500 dilution only, anti-mouse secondary antibody was used at 1 μg/ml final concentration. Those antibodies giving the highest ratio of GTPγS to GDP were ranked highest. Referring to FIG. 7B, the raw data generated as described in FIG. 7A is shown.

[0174]Clones 362 and 621 gave the strongest ELISA signal and clone 1157 gave the weakest. Antibody specificity could also be determined from this screen, for example clones 362 and 621 reacted strongly in both RhoA and RhoC ELISAs while clones 384 and 465 where RhoA specific.

[0175]The western blot screen used RhoA, RhoB and RhoC recombinant proteins and a platelet extract as potential targets for the antibody panel. Clones in FIG. 7A were ranked based upon the RhoA or RhoA,B,C signal generated from platelet extract. For example, clone 979 gave the strongest signal (densitometry) while clones 248, 362, 384, 465, 660, 733, 942, 977, 1019, 1281 and 1324 did not give a detectable signal in platelet extract. All clones (except clone 1157) gave signal with one or more recombinant Rho protein in the western blot analysis and this data was used to determine Rho specificity (FIG. 7A).

[0176]The G-LISA assay compared Rho signal from GDP-loaded (inactive Rho) and GTPγS-loaded (active Rho) samples. Clones were ranked according to the ratio of GTPγS to GDP signal where high ratios were considered to be more promising antibodies and so received a correspondinly high ranking. Thus, as detailed in FIG. 7A, clone 384 ranked first in the G-LISA assay with a GTPγS to GDP ratio of 50 while clone 1164 ranked twentieth with a ratio of 0.7.

Discussion

[0177]During the course of this development it was discovered that strong reactivity in either western blots or ELISA assays were not predictive of an antibody that would work well in a G-LISA assay (FIGS. 7A and 7B). For example, the two top performing antibodies in a G-LISA screen of 20 hybridomas (clones 384 and 419 respectively), ranked only 6^th and 8^th out of 20 in the ELISA assay. It is particularly noteworthy that antibodies predicted to work well for pull-down assays, i.e. those ranking highly in the western screen, did not generally work well in G-LISA assays. Indeed the top performing antibody from the G-LISA screen (clone 384) gave no detectable signal in the western blot screen using platelet extracts (FIG. 7A). Similarly, the antibody ranking highest in the ELISA assay (clones 362 and 621) performed very poorly in the G-LISA assay, ranking 16^th and 18^th out of 20 (FIG. 7A).

Example 6

Use of Non-Clarified Lysates in the G-LISA Assay

[0178]In order for the G-LISA assays to be user-friendly in high throughput applications, one would like to eliminate the requirement for a clarification step as this is highly cumbersome and not compatible with HTS formats. In the case of the pull-down assay, a clarification step is necessary because cellular debris cannot be eliminated in the wash steps (beads and debris will pellet together). Also in the pull-down assay, addition of SDS gel loading buffer for SDS-PAGE results in a highly viscous sample (due to DNA release) causing poor sample handling and poor western quantitation. A microtiter plate-based assay such as the G-LISA should not suffer from these drawbacks and one should be able to remove cellular debris with a simple wash step.

[0179]Referring to FIG. 8, 25 μl of serum starved or Calpeptin treated (RhoA activated) cell lysates (0.5 mg/ml) were either used directly (Non-Clar samples) or clarified for 5 minutes at 8,000 rpm, 4° C. (Clar. Samples). Lysates were immediately subjected to a standard RhoA G-LISA assay on ROCK maleimide plates. Samples were quantitated by reading luminescence as described in the materials and methods. ALU=Arbitrary Light Units. All readings had buffer only background subtracted.

Results

[0180]Calpeptin treated and serum starved cell lysates from Swiss 3T3 cells were prepared as outlined in the materials and methods (Example 8). Half of each lysate was clarified while the other half remained unclarified. All four samples were analysed simultaneously in a RhoA G-LISA assay (as outlined in Example 2). The results in FIG. 8 clearly demonstrate that non-clarified lysates generate activation signals comparable to clarfied lysates.

Discussion

[0181]The requirement for a clarification step is an integral component of the pull-down assay protocol (Ren. et al., 1999, EMBO J., 18:578-585; Benard. et al., 1999, J. Biol. Chem., 274:13198-13204; Leung et al., 2005, Proc. Natl. Acad. Sci. USA, 102:15207-15212; Kimura et al., 2000, J. Biol. Chem., 275:17233-17236; Kranenburg et al., 1999, Mol. Biol. Cell, 6:1851-1857; Vouret-Craviari et al., 2002, J. Cell Sci., 115:2475-2484; and Subauste et al., 2000, J. Biol. Chem., 275:9725-9733). Attempting to perform the pull-down assay without clarification results in the accumulation of non-specific cellular debris such as cell nuclei and associated proteins. As cellular debris and/or associated proteins cannot be separated from the effector:GTPase complex in this assay, there is a likelihood that samples will be contaminated with inactive GTPase. Further, attempting to omit the clarification step in a pull-down assay will result in the production of a highly viscous material upon addition of SDS sample loading buffer prior to SDS-PAGE and western analysis. The high viscocity is due to lysis of cell nuclei and release of nucleic acids. This results in uneven loading of the SDS-PAGE and consequently highly variable western quantitations. One could reduce viscocity by, for example, DNAse treatment or shear force, however increased manipulatons would further complicate the assay and increase the likelihood of variablity between samples. Yet further, the necessary inclusion of a clarification step in the pull-down assay results in an extra processing step at a point where the GTPase is highly sensitive to GTP hydrolysis (i.e. prior to effector addition). Rho GTPases such as Rac and Cdc42 GTPases that have a high intrinsic rate of hydrolysis are particularly susceptible to this potential problem (Ligeti et al., 2004, J. Biol. Chem., 279:5055).

[0182]The ability to eliminate the clarification step in the G-LISA assay is therefore a non-trivial and important improvement over the pull-down assay. It reduces the sample processing time at a point where the GTPase is most sensitive to deactivation by GTP hydrolysis thereby increasing the assay reproducibility. In this regard, the pull-down assays are known by those in the art to have high cv values (40-60% in our hands, data not shown). Elimination of clarification also allows simple sample processing, compatible with high throughput assays such as would be used for diagnostic or drug discovery applications. The pull-down assay is not suited to these applications.

Example 7

Non-Covalent Attachment of Effector-GBDs to Glutathione Plates

[0183]As disclosed throughout these examples, one method of linking effector-GBD peptides to plates was through covalent attachment. Use of non-covalent attachment was also investigated. The example herein describes the use of glutathione S transferase tagged effector-GBD peptides linked to glutathione plates.

Materials and Methods

Non-Covalent Attachment of Effector-GBD to Glutathione Plates

[0184]PAK-GBD-GST peptide was diluted in coating buffer (PBS; 140 mM sodium chloride, 2.7 mM potassium chloride, 10 mM sodium phosphate (dibasic), 1.76 mM potassium phosphate (monobasic) pH 7.2) to a final concentration 0.02 mg/ml and 50 μl (1.0 ng) of protein was added per well to GST-Trap Glutathione coated plates (NoAb Biodiscoveries, Ontario, Canada). Plates were incubated at room temperature for 1 hour. Plates were washed twice in PBS and blocked by addition of 0.1% BSA in PBS pH 7.2 for 1 hour at room temperature.

[0185]Referring to FIG. 9, PAK-GBD-GST peptide was coated to glutathione plates (NoAb Biodiscoveries) as outlined above. GDP, GTPγS and constitutively active Rac1L61 were assayed using the standard Rac1 G-LISA assay described above (Example 2). Rac1 signal was detected by absorbance at 490 nm as described in materials and methods (Example 2). All readings had buffer only background subtracted

Results

[0186]Constitutively active Rac1, GTPγS- or GDP-loaded platelets were assayed in a G-LISA format (as detailed in Example 2) using PAK-GBD-GST linked plates. The results in FIG. 11 show that the non-covalent G-LISA format is able to identify constitutively active Rac1 above background (buffer only). The constitutively active Rac1 signal is 8-fold above background which is comparable to the signal generated from POSH effector bound covalently to maleimide plates (FIG. 2B, Example 2). The non-covalent PAK-GST assay can differentiate between active and inactive Rac1 protein (FIG. 9, GTPγS (active) and GDP inactive) loaded platelet extract). Although quite sensitive (8-fold activation) the assay is not as robust as the POSH linked maleimide plate G-LISA (30-fold, FIG. 3B, Example 2). The non-covalent PAK-GST assay did not give a signal above background in the absence of Antigen Presenting Buffer (FIG. 9, GTPγS with no Antigen Presenting Buffer).

Discussion

[0187]This example demonstrates the utility of a non-covalent plate format for development of G-LISA assays. It can be seen that by following the G-LISA development protocol, one obtains a good signal with the PAK-GST effector linked to glutathione plates (FIG. 9). Interestingly, for this assay, use of Antigen Presenting Buffer (APB) was beneficial for obtaining active Rac1 signal (FIG. 9, GTPγS plus ABP compared to minus APB).

[0188]The example describes the use of GST:glutathione linkage, the GTPγS signal generated from the PAK-GST glutathione plate was less than the GTPγS signal generated from a POSH maleimide plate (FIG. 3B) and a PAK maleimide plate (data not shown). For this reason, and the fact that covalent plates generally bind proteins more stably, the covalent maleimide plate format was pursued. However, it has been shown herein that GST:glutathione plates can work well in G-LISAs and it is anticipated that other non-covalent linkages such as polyhistidine:nickel, polyhistidine:cobalt, biotin:streptavidin, biotin:avidin and the like could also be used. Optimization of each plate format could follow the methodologies outlined throughout these examples.

Example 8

Detection Limits and Validation of the G-LISA Assays

[0189]All published estimates of the activation (or deactivation) levels of Rho GTPases in cells or tissue samples currently use data generated from standard Rho GTPase pull-down assays (Benard et al., 2002, Meth. Enz., 345:349-359; and Ren et al., 2000, Meth. Enz., 325:265-272). As this assay is clearly established and accepted as the gold standard of quantitation in the field, it was desired to validate the G-LISA by demonstrating that the G-LISA produced activation estimates comparable to those in the pull-down. Thus, it was desired to establish that, while the advantages of the G-LISA assays over the Rho GTPase pull-down assay include greatly enhance the speed, better reproducibility, increased sample throughput, simpler sample handling and smaller sample size, the actual quantitation of active Rho GTPases are comparable in both assays.

Materials and Methods

[0190]Production of Activated RhoA Cell Lysates by Induction with Calpeptin

[0191]HeLa cells were seeded in DMEM (Gibco. Cat. #10313-021) with 10% FBS. Cells were grown to 50-70% confluency and subsequently serum starved for 24 hours. The cells were then treated with calpeptin (100 ng/μl) for 30 minutes. The cells were harvested in lysis buffer and the lysate protein concentrations were equalized to 4 mg/ml with lysis buffer. The lysates were then diluted accordingly and subjected to a RhoA GLISA assay.

Production of Activated Rac1 and Cdc42 Cell Lysates by Induction with EGF

[0192]Hela cells were seeded in DMEM (Gibco. Cat. #10313-021) with 10% FBS. Cells were grown to 50-70% confluency and subsequently serum starved for 24 hours. The cells were then treated with 10 ng/ml epidermal growth factor (EGF) (Sigma. Cat. # E9644) for 2 minutes and harvested in lysis buffer. The lysate concentrations from both serum starved and EGF treated plates were equalized to 1 mg/ml with lysis buffer. The lysates were then subjected to RAC1 or Cdc42 G-LISA assays.

Pull-Down Assays

[0193]Assays were performed according to Ren et al. Modified GST rhotekin-GBD peptide was bound to glutathione beads and 20 μg of bead bound effector was added to 500 μl (250 μg) of clarified GTPγS- or GDP-loaded platelet extract (see Example 2 for lysate preparation). The mixture was incubated at 4° C. with rotation for 1 hour. The beads were then washed twice in wash buffer (50 mM Tris pH 7.5, 100 mM NaCl, 30 mM MgCl₂) and subjected to SDS-PAGE (4-20% gradient) and western blot procedures. The activated RhoA protein band was detected using primary antibody specifically recognizing RhoA protein and a goat anti-mouse secondary (Jackson Labs., Catalog #115-035-068). The assay was performed at least four times.

[0194]Referring to FIG. 10, 25 μl of serum starved or Calpeptin treated (RhoA activated) Hela cell lysate at concentration of 4, 2, 1, 0.5, 0.25, 0.12, 0.06 mg/ml were mixed with same volume of Binding Buffer and subjected to RhoA G-LISA assay followed by absorbance detection. 500 ng of the same lysates were also subjected to GST-Rhotekin-RBD pull-down assay and followed by western blot with anti-RhoA antibody. All readings had buffer only background subtracted.

[0195]Referring to FIG. 11, 25 μl of lysis buffer only (0), 0.01, 0.04, 0.1, 0.2, 0.4, 0.8, 1, 2 ng of RhoA (63L) were mixed with same volume of Binding Buffer and subjected to RhoA G-LISA assay and followed by absorbance detection. All readings had buffer only background subtracted.

[0196]Referring to FIG. 12, PAK coated GST plates were prepared as outlined in the materials and methods (Example 7). PAK coated glutathione beads were from Cytoskeleton Inc. (Cat. # PAK02). Various amounts of total cell lysates (actual amounts indicated below bar chart and western blot) from serum starved 3T3 cells (SS) or EGF treated 3T3 cells (to activate Rac1) were assayed by either a standard Rac1 G-LISA assay, as described in Example 2, or by a standard PAK-GST bead pull-down assay as described by Benard et al. (J. Biol. Chem., 1999, 274:13198-13204). G-LISA assays were quantitated by absorbance readings at 490 nm as previously described. Rac1 pull-downs were quantitated by densitometry of western blot chemilluminescent signals. Chemilluminescent detection reagent was Supersignal West Dura Extended Duration Substarte (Pierce). The anti-Rac1 antibody used for the pull-down is sold by Cytoskeleton Inc. in their commercial kit for Rac1 pull-down assays (BK035). The figure shows that the detection limit of the Rac1:PAK G-LISA is about 18- to 30-fold lower than that of the Rac1:PAK pull-down assay.

[0197]Referring to FIG. 13A, 50 μl of lysis buffer only, serum starved or EGF treated Hela cell lysate (0.5 mg/ml) were subjected to Rac1 G-LISA assay and followed by absorbance detection. Referring to FIG. 13B, 50 μl of serum starved or EGF treated Hela cell lysate (0.5 mg/ml) were subjected to Cdc42 G-LISA assay as described previously and quantitated by luminometry as previously described. A Cdc42 pull-down assay was carried out in parallel using 500 μg of the same lysates. The antibody used in this assay was identical to the one used in the G-LISA (Cat# ACD01, Cytoskeleton Inc.). Fold activation was quantitated by densiometry of film developed by chemilluminescence. Referring to FIG. 13C, Hela cells were transfected with either 5 μg of vector, p115RhoGEF or p190RhoGAP with lipofectamine. 16 hours after transfection, cells were lysed in cell lysis buffer. 25 μl of lysis buffer only, vector, p115RhoGEF, vector, p190RhoGAP transfected cells (1 mg/ml) were then subjected to RhoA G-LISA assay and quantitated by absorbance detection. A Rho pull-down assay was carried out in parallel using 500 μg of the same lysates, fold activation (for p115RhoGEF) or fold inhibition (for p190 GAP) were quantitated by densiometry of film developed by chemilluminescence.

Results

Limits of Detection of RhoA G-LISA

[0198]In this example, the limits of G-LISA detection of active RhoA by absorbance based measurements have been determined in two ways. First, the limit of detection of endogenous active (calpeptin induced) RhoA in cell lysates was determined. Second, the limit of detection of pure recombinant constitutively active RhoA was determined

[0199]RhoA activation was induced in serum starved HeLa cells by treatment with calpeptin for 30 minutes (Schoenwaelder et al., 1999, J. Biol. Chem., 274:14359-14367). A standard pull-down assay using 500 μg of each lysate (1 mg/ml lysate concentration) was performed (inset in FIG. 10). Densitometric quantitation of the western blot results showed that RhoA (Calpeptin lane in FIG. 4 inset) had been activated by approximately 2-fold above the serum starved lysate (SS lane in FIG. 10 inset). As expected, this result is in good agreement with published data (Schoenwaelder et al., 2000, Current Biol., 10:1523-1526).

[0200]In a parallel G-LISA assay, the serum starved and calpeptin lysates were serially diluted to give protein concentrations of 4, 2, 1, 0.5, 0.25 and 0.125 mg/ml respectively and 25 μl of lysates were tested in a RhoA G-LISA. Lysate concentrations ranging from 0.25 mg/ml to 2 mg/ml (6.25 μg and 50 μg of total cell lysate respectively) gave approximately 2-fold activation of the calpeptin treated samples when compared to serum starved samples (FIG. 10, fold activation is given above calpeptin titration curve). Thus, for protein concentrations as low as 0.25 mg/ml or a total of 6.25 μg of cell lysate, the RhoA G-LISA results agreed very well with published data and with those of the pull-down assay shown in this example.

[0201]At protein concentrations between 0.5-2 mg/ml (typically the concentration of cell lysates) the cv ranged from 11-8%. Even at protein amounts as low as 6.25 μg total cell lysates, the cv value of 16% is acceptable. At lower protein concentrations (0.125 mg/ml or 3.1 μg total cell lysate) the cv values became too high to give meaningful results (>50%) in the RhoA assay, while at the highest protein concentration of 4 mg/ml (100 μg lysates) the cv values were 11%, however, the activation level was slightly below 2-fold (1.7-fold). The reduced fold activation at 4 mg/ml is most likely due to the fact that the active RhoA reading is approaching the saturation point of the absorbance assay (2.5 absorbance units). Interestingly, FIG. 12 shows that the Rac1:POSH assay can detect activated Rac1 from as little as 3 μg of total cell lysates with a cv value of 12%.

[0202]To determine the limit of G-LISA absorbance detection for recombinant constitutively active RhoA, protein amounts of 0.01, 0.04, 0.1, 0.2, 0.4, 0.8, 1.0, 2.0 and 4.0 ng were added to eight wells each of a ROCK-GBD maleimide plate. The samples were taken through a RhoA G-LISA assay and OD₄₉₀ readings were plotted against protein concentration. The results in FIG. 11 show that the linear range for the absorbance G-LISA is 0.1 ng (cv=6%) to 2 ng (cv=6%). The signal for recombinant constitutively active RhoA appears to begin to be saturated at protein amounts above 4 ng.

[0203]To further compare the G-LISA assay with the pull-down assay, the two assays in parallel using the same cell lysates were carried out. HeLa cells were stimulated with epidermal growth factor (EGF) as described in the materials and methods section. It is well documented that EGF transiently activates Rac1, with activation in the range of 2- to 5-fold above unstimulated cells (Kurokawa et al., 2004, Mol. Biol. Cell, 15:100). PAK-GST effector was used in both types of assay and both assays were carried out according to standard methods described in Examples 2 and 3 respectively. It can be seen from FIG. 12 that approximately 2-fold activation from the G-LISA using total lysates protein of 3 μg-12.5 μg was detected while the pull-down assay could detect signal (about 2.5-fold activation) in a 100 μg sample but not in 50 μg of total cell lysates. Thus, the limit of detection in the pull-down assay appears to be about 18-30 times higher than that obtainable with the G-LISA. It is also worth noting that the inventors in this application are highly skilled in the art of pull-down assays and have been responsible for developing a commercial product using this technology. Thus, the head to head comparison of the pull-down and the G-LISA show that both assays give comparable quantitations of Rho activation (about 2-fold), the results clearly establish the G-LISA as the superior assay. The advantages of the G-LISA are not restricted to superior sensitivity, although this is a major advancement, the G-LISA is also faster (<3 h compared to >10 h), requires much smaller sample size and is amenable to HTS applications.

Rac1 and Cdc42 G-LISA Assay Quantitations Compared to Pull-Down Quantitations of Active Rho GTPases

[0204]To further examine the utility of the G-LISA for in vivo activation of Rho GTPases we compared pull-down data with the G-LISA assay in well-documented examples of Rac1 and Cdc42 activation.

[0205]EGF has been shown to activate Rac1 2- to 5-fold above serum starved levels in several cell lines (Kurokawa et al., 2004, Mol. Biol. Cell, 15:100). FIG. 13A shows the results of a comparison between a pull-down assay, using 500 μg of cell lysate and a Rac1 G-LISA using 25 μg of cell lysate. Densitometric quantitation of the pull-down assay western blot indicated a 4-fold activation of Rac1. The Rac1 G-LISA performed in parallel agreed with this fold activation, giving a result of 4-fold above serum starved cell lysate (FIG. 13A).

[0206]It is well documented in the literature that EGF can activate Cdc42 by 2- to 3-fold above serum starved Cdc42 levels (Kurokawa et al., 2004, Mol. Biol. Cell, 15:100). FIG. 13B shows the results of a comparison between a pull-down assay, using 500 μg of cell lysate and a Cdc42 G-LISA using 25 μg of cell lysate. Densitometric quantitation of the pull-down assay western blot indicated a 2-fold activation of Cdc42. The Cdc42 G-LISA performed in parallel agreed with this fold activation, giving a result of 2.2-fold above serum starved cell lysate (FIG. 13B).

[0207]Transfection of foreign DNA into cell cultures and subsequent observation of the effects of protein expression on Rho GTPase activation is a common tool in cell and molecular biology (Klooster et al., 2006, J. Cell Biol., 1172:759-769; and Cheng et al., 2004, J. Biol. Chem., 279:12786-12793). The ability of the G-LISA to detect endogenous Rho GTPase activation upon transfection of HeLa cells with a Rho GTP Exchange Factor p115RhoGEF or Rho deactivation upon transfection of HeLa cells with a GTPase Activating Protein p150 RhoGAP (Wells et al., 2001, J. Biol. Chem., 276:28897-28905; and Arthur et al., 2001, Mol. Biol. Cell, 12:2711-2720) was therefore assessed.

[0208]The results in FIG. 13C demonstrate that the G-LISA can faithfully detect both an increase (p115RhoGEF) or a decrease (p150RhoGAP) in Rho GTPase activation in the transfection experiments. Furthermore the quantitation of active Rho GTPAse relative to vector only samples is consistent between the pull-down and the G-LISA assay.

Discussion

[0209]The results disclosed in Example 3 demonstrate that activation levels obtained from a given Rho GTPase are highly comparable between the pull-down assay and the G-LISA assay. Both assays were compared for quantitation of calpeptin activation of RhoA (FIG. 10), EGF activation of Rac1 (FIG. 13A) and EGF activation of Cdc42 (FIG. 13B) in serum starved HeLa cells. In all cases, the activation of Rho GTPases was similar between the two assays (typically 2- to 4-fold activation) and agreed with published data (Kazuo et al., 2004, Mol. Biol. Cell, 15:1003-1010). Rho activation and deactivation in cell lines transfected with p115RhoGEF (activator) or p190RhoGAP (deactivator) (FIG. 13C) was also compared. Results again showed pull-down and G-LISA assays to be comparable as far as fold activation measurements. Several different cell lines (e.g. Swiss 3T3, Jurkats, MDCK cells) have been analysed in these assays and in all cases the G-LISA quantitations agreed with published pull-down assay estimates (data not shown).

[0210]The results shown in FIGS. 10-13 clearly demonstrate that the utility of the G-LISA assays lies in quantitating RhoA activation from small amounts of sample. Thus, the linear range of this assay is approximately 6.25-50 μg of cell lysate (FIG. 10). This corresponds to an estimated 0.04-1.7 ng active RhoA (see example 2, Results section for rationale). The linear range of the pure recombinant constitutively active RhoA was found to be 0.1-2 ng (FIG. 11) which supports the estimates from the cell lysate samples. It should also be noted that the assays described in this example are for absorbance based G-LISAs. In this regard, luminometry based G-LISA assays are more sensitive than absorbance based versions which increase the sensitivity of the assay to below 0.04 ng (data not shown).

[0211]In contrast to the G-LISA, it is generally accepted that the quantitation of endogenous activated Rho GTPase's in a standard pull-down assay typically requires 1×10⁶ to 1×10⁷ cells or 300-800 μg of total cellular protein (Benard et al., 2002, Meth. Enz., 345:349-359; and Ren et al., 2000, Meth. Enz., 325:265-272). It is further recognized in the literature that this amount of lysate can be prohibitive for experiments where sample is limiting (Gottig et al., 2006, Eur. J. Immunol., 36:180-189). In this regard, a PAK-GST pull-down assay was directly compared with a PAK-GST G-LISA assay (FIG. 12). The results show that the G-LISA is about 18- to 30-fold more sensitive than the pull-down assay.

[0212]Instances requiring the use of small amounts of lysate include analysis of primary cell lines. A further instance would include the processing of high throughput samples cultured in small growth chambers, for example 12 well plates (typically 4×10⁵ cells), 24 well plates (typically 2×10⁵ cells) or 96 well plates (typically 3×10⁴ cells). The G-LISA can detect active RhoA signal from as little as 6 μg of total cell lysate equivalent to 2×10⁴ cells, thus making this assay amenable to the study of Rho GTPase activation even in instances where limiting amounts of sample are available such as in primary cell lines, clinical samples and high throughput applications.

Example 9

Stabilization of Effector-GBD Plates by Lyophilization

[0213]Stabilization of effector-GBD peptides confers an advantage to this assay format by creating plates that can be stored desiccated at 4° C. for extended periods of time. Referring to FIG. 14, lyophilzed ROCK-RBD coated microtiter plate were kept at 4° C. and >10% humidity for indicated time points. The activity of the plate was tested by a standard RhoA G-LISA with serum starved or Calpeptin treated cell lysates. In particular, plates were coated with effector-GBD as described in Example 2. After the block and wash step, 50 μl of lyophilization buffer (5% sucrose, 1% dextran in PBS pH 7.2) was added to each well. Plates were frozen to -70° C. and lyophilized using the following procedure:

[0214]Stabilize lyophilizer shelf temperature to -40° C. for 5 minutes;

[0215]Initiate vacuum to achieve<100 mtorr;

[0216]Vacuate for 4 hours at -26° C.;

[0217]Vacate for 4 hours at -10° C.;

[0218]Vacuate for 4 hours at 0° C.; and

[0219]Vacuate for 4 hours at 30° C.

Plates were then removed from the lyophilizer and packaged in containers containing a desiccant bag. Plates were stored at 4° C. and less than 10% humidity. Plates were analysed in a standard Rho:ROCK G-LISA using L63 constitutively active RhoA (5 ng per well) at the time intervals shown in FIG. 14. The % activity of each plate was plotted with reference to the plate assayed at time zero (100% activity). It was found that the plates remained very stable over at least 120 days under these conditions. Plates that were allowed to get damp lost activity after 1-2 hours (data not shown).

Discussion

[0220]Formulating a stable G-LISA plate has many advantages, including ease of storage and handling in HTS formats. As this assay is also presented in a kit format, the lyophilization of the plate contents allows shipping in the absence of dry ice and the like.

Example 10

Application of G-LISA Assay to Drug Discovery

[0221]It is well documented in the literature that Rho family proteins and their effector proteins are involved in a variety of human disease including cancer and renal disease (Fiordalisi et al., 2006, Canc. Res., 66:3153-3161; Fritz et al., 2006, Curr. Cancer Drug Targ., 1: 1-14; and Wakino et al., 2005, Drug Newa Perspect., 18:639-643). It would therefore be valuable to create a screen capable of identifying direct Rho GTPase modulators and compounds directly modulating the interaction of Rho GTPases with effectors. The application of the G-LISA technology has therefore been extended herein to include such screens.

[0222]Referring to FIG. 15, lysis buffer only (Blank) or 5 ng of Rac1 (61L) was subjected to a standard Rac1:POSH G-LISA. PAK-GST was included in the reaction at the lysates incubation stage of the assay. The PAK peptide should be a competitive inhibitor for POSH binding to Rac1 GTPase and thereby lower the G-LISA signal. ROCK-GST was included in some reactions a negative control "inhibitor". The molar values of the PAK- and ROCK-GST peptides are given in μM. As predicted the PAK peptide was a more efficient competitor of Rac1:POSH reactions (IC₅₀ of 0.1 μM compared to 8 μM).

Results

[0223]The example shown in FIG. 15 depicts G-LISA data from 5 ng of constitutively active Rac1 (61L) bound to a POSH-GBD maleimide plate. The G-LISA was performed as described previously except that the reaction was carried out in the presence or absence of PAK-GBD-GST which should act as a competitive inhibitor of Rac1:POSH binding. PAK-GBD-GST was added to the reaction at 0 μM to 10 μM. FIG. 15 shows that the IC₅₀ for PAK is approximately 0.1 μM. The RhoA effector ROCK-GBD was also tested in the assay. The IC₅₀ for this peptide was approximately 80 times higher than for PAK (8 μM). This example serves to demonstrate the utility of the G-LISA assays in drug discovery.

Discussion

[0224]This example describes the application of the G-LISA to drug discovery. The assay format uses purified constitutively active Rho GTPases and purified effector-GBD peptides, it is therefore a well defined system that will generate results of immediate mechanistic relevance. It should be noted that the G-LISA assays are also amenable to the identification of compounds that modulate the activity of endogenous Rho GTPases. This assay (or kit) format would be carried out as follows: cells would be grown in a suitable HTS compatible vessel such as a 96 well plate, cells would be treated with a library of compounds (serum starving of cells prior to treatment is optional), cells would be lysed in 25 μl of lysis buffer (protein quantitation at this point is optional) and transferred to a G-LISA plate either in the presence or absence of 20% PEG 8000. Plates are incubated at 4° C. for 30 minutes then washed at room temperature and treated with Antigen Presenting Buffer for 2-5 minutes. Plates are washed and Rho GTPase in the wells is quantitated. Quantitation can be with a Rho-specific antibody or by some other means. HTS methodology can also employ robotics systems commonly used with microtiter plates or microarrays.

[0225]Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference (including, but not limited to, journal articles, U.S. and non-U.S. patents, patent application publications, international patent application publications, gene bank accession numbers, and the like) cited in the present application is incorporated herein by reference in its entirety.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 114 <210> SEQ ID NO 1 <211> LENGTH: 193 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 Met Ala Ala Ile Arg Lys Lys Leu Val Ile Val Gly Asp Gly Ala Cys 1 5 10 15 Gly Lys Thr Cys Leu Leu Ile Val Phe Ser Lys Asp Gln Phe Pro Glu 20 25 30 Val Tyr Val Pro Thr Val Phe Glu Asn Tyr Val Ala Asp Ile Glu Val 35 40 45 Asp Gly Lys Gln Val Glu Leu Ala Leu Trp Asp Thr Ala Gly Gln Glu 50 55 60 Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Asp Thr Asp Val Ile 65 70 75 80 Leu Met Cys Phe Ser Ile Asp Ser Pro Asp Ser Leu Glu Asn Ile Pro 85 90 95 Glu Lys Trp Thr Pro Glu Val Lys His Phe Cys Pro Asn Val Pro Ile 100 105 110 Ile Leu Val Gly Asn Lys Lys Asp Leu Arg Asn Asp Glu His Thr Arg 115 120 125 Arg Glu Leu Ala Lys Met Lys Gln Glu Pro Val Lys Pro Glu Glu Gly 130 135 140 Arg Asp Met Ala Asn Arg Ile Gly Ala Phe Gly Tyr Met Glu Cys Ser 145 150 155 160 Ala Lys Thr Lys Asp Gly Val Arg Glu Val Phe Glu Met Ala Thr Arg 165 170 175 Ala Ala Leu Gln Ala Arg Arg Gly Lys Lys Lys Ser Gly Cys Leu Val 180 185 190 Leu <210> SEQ ID NO 2 <211> LENGTH: 196 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 Met Ala Ala Ile Arg Lys Lys Leu Val Val Val Gly Asp Gly Ala Cys 1 5 10 15 Gly Lys Thr Cys Leu Leu Ile Val Phe Ser Lys Asp Glu Phe Pro Glu 20 25 30 Val Tyr Val Pro Thr Val Phe Glu Asn Tyr Val Ala Asp Ile Glu Val 35 40 45 Asp Gly Lys Gln Val Glu Leu Ala Leu Trp Asp Thr Ala Gly Gln Glu 50 55 60 Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Asp Thr Asp Val Ile 65 70 75 80 Leu Met Cys Phe Ser Val Asp Ser Pro Asp Ser Leu Glu Asn Ile Pro 85 90 95 Glu Lys Trp Val Pro Glu Val Lys His Phe Cys Pro Asn Val Pro Ile 100 105 110 Ile Leu Val Ala Asn Lys Lys Asp Leu Arg Ser Asp Glu His Val Arg 115 120 125 Thr Glu Leu Ala Arg Met Lys Gln Glu Pro Val Arg Thr Asp Asp Gly 130 135 140 Arg Ala Met Ala Val Arg Ile Gln Ala Tyr Asp Tyr Leu Glu Cys Ser 145 150 155 160 Ala Lys Thr Lys Glu Gly Val Arg Glu Val Phe Glu Thr Ala Thr Arg 165 170 175 Ala Ala Leu Gln Lys Arg Tyr Gly Ser Gln Asn Gly Cys Ile Asn Cys 180 185 190 Cys Lys Val Leu 195 <210> SEQ ID NO 3 <211> LENGTH: 193 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 Met Ala Ala Ile Arg Lys Lys Leu Val Ile Val Gly Asp Gly Ala Cys 1 5 10 15 Gly Lys Thr Cys Leu Leu Ile Val Phe Ser Lys Asp Gln Phe Pro Glu 20 25 30 Val Tyr Val Pro Thr Val Phe Glu Asn Tyr Ile Ala Asp Ile Glu Val 35 40 45 Asp Gly Lys Gln Val Glu Leu Ala Leu Trp Asp Thr Ala Gly Gln Glu 50 55 60 Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Asp Thr Asp Val Ile 65 70 75 80 Leu Met Cys Phe Ser Ile Asp Ser Pro Asp Ser Leu Glu Asn Ile Pro 85 90 95 Glu Lys Trp Thr Pro Glu Val Lys His Phe Cys Pro Asn Val Pro Ile 100 105 110 Ile Leu Val Gly Asn Lys Lys Asp Leu Arg Gln Asp Glu His Thr Arg 115 120 125 Arg Glu Leu Ala Lys Met Lys Gln Glu Pro Val Arg Ser Glu Glu Gly 130 135 140 Arg Asp Met Ala Asn Arg Ile Ser Ala Phe Gly Tyr Leu Glu Cys Ser 145 150 155 160 Ala Lys Thr Lys Glu Gly Val Arg Glu Val Phe Glu Met Ala Thr Arg 165 170 175 Ala Gly Leu Gln Val Arg Lys Asn Lys Arg Arg Arg Gly Cys Pro Ile 180 185 190 Leu <210> SEQ ID NO 4 <211> LENGTH: 210 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 4 Met Thr Ala Ala Gln Ala Ala Gly Glu Glu Ala Pro Pro Gly Val Arg 1 5 10 15 Ser Val Lys Val Val Leu Val Gly Asp Gly Gly Cys Gly Lys Thr Ser 20 25 30 Leu Leu Met Val Phe Ala Asp Gly Ala Phe Pro Glu Ser Tyr Thr Pro 35 40 45 Thr Val Phe Glu Arg Tyr Met Val Asn Leu Gln Val Lys Gly Lys Pro 50 55 60 Val His Leu His Ile Trp Asp Thr Ala Gly Gln Asp Asp Tyr Asp Arg 65 70 75 80 Leu Arg Pro Leu Phe Tyr Pro Asp Ala Ser Val Leu Leu Leu Cys Phe 85 90 95 Asp Val Thr Ser Pro Asn Ser Phe Asp Asn Ile Phe Asn Arg Trp Tyr 100 105 110 Pro Glu Val Asn His Phe Cys Lys Lys Val Pro Ile Ile Val Val Gly 115 120 125 Cys Lys Thr Asp Leu Arg Lys Asp Lys Ser Leu Val Asn Lys Leu Arg 130 135 140 Arg Asn Gly Leu Glu Pro Val Thr Tyr His Arg Gly Gln Glu Met Ala 145 150 155 160 Arg Ser Val Gly Ala Val Ala Tyr Leu Glu Cys Ser Ala Arg Leu His 165 170 175 Asp Asn Val His Ala Val Phe Gln Glu Ala Ala Glu Val Ala Leu Ser 180 185 190 Ser Arg Gly Arg Asn Phe Trp Arg Arg Ile Thr Gln Gly Phe Cys Val 195 200 205 Val Thr 210 <210> SEQ ID NO 5 <211> LENGTH: 244 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 5 Met Lys Glu Arg Arg Ala Ser Gln Lys Leu Ser Ser Lys Ser Ile Met 1 5 10 15 Asp Pro Asn Gln Asn Val Lys Cys Lys Ile Val Val Val Gly Asp Ser 20 25 30 Gln Cys Gly Lys Thr Ala Leu Leu His Val Phe Ala Lys Asp Cys Phe 35 40 45 Pro Glu Asn Tyr Val Pro Thr Val Phe Glu Asn Tyr Thr Ala Ser Phe 50 55 60 Glu Ile Asp Thr Gln Arg Ile Glu Leu Ser Leu Trp Asp Thr Ser Gly 65 70 75 80 Ser Pro Tyr Tyr Asp Asn Val Arg Pro Leu Ser Tyr Pro Asp Ser Asp 85 90 95 Ala Val Leu Ile Cys Phe Asp Ile Ser Arg Pro Glu Thr Leu Asp Ser 100 105 110 Val Leu Lys Lys Trp Lys Gly Glu Ile Gln Glu Phe Cys Pro Asn Thr 115 120 125 Lys Met Leu Leu Val Gly Cys Lys Ser Asp Leu Arg Thr Asp Val Ser 130 135 140 Thr Leu Val Glu Leu Ser Asn His Arg Gln Thr Pro Val Ser Tyr Asp 145 150 155 160 Gln Gly Ala Asn Met Ala Lys Gln Ile Gly Ala Ala Thr Tyr Ile Glu 165 170 175 Cys Ser Ala Leu Gln Ser Glu Asn Ser Val Arg Asp Ile Phe His Val 180 185 190 Ala Thr Leu Ala Cys Val Asn Lys Thr Asn Lys Asn Val Lys Arg Asn 195 200 205 Lys Ser Gln Arg Ala Thr Lys Arg Ile Ser His Met Pro Ser Arg Pro 210 215 220 Glu Leu Ser Ala Val Ala Thr Asp Leu Arg Lys Asp Lys Ala Lys Ser 225 230 235 240 Cys Thr Val Met <210> SEQ ID NO 6 <211> LENGTH: 232 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 6 Met Lys Glu Arg Arg Ala Pro Gln Pro Val Val Ala Arg Cys Lys Leu 1 5 10 15 Val Leu Val Gly Asp Val Gln Cys Gly Lys Thr Ala Met Leu Gln Val 20 25 30 Leu Ala Lys Asp Cys Tyr Pro Glu Thr Tyr Val Pro Thr Val Phe Glu 35 40 45 Asn Tyr Thr Ala Cys Leu Glu Thr Glu Glu Gln Arg Val Glu Leu Ser 50 55 60 Leu Trp Asp Thr Ser Gly Ser Pro Tyr Tyr Asp Asn Val Arg Pro Leu 65 70 75 80 Cys Tyr Ser Asp Ser Asp Ala Val Leu Leu Cys Phe Asp Ile Ser Arg 85 90 95 Pro Glu Thr Val Asp Ser Ala Leu Lys Lys Trp Arg Thr Glu Ile Leu 100 105 110 Asp Tyr Cys Pro Ser Thr Arg Val Leu Leu Ile Gly Cys Lys Thr Asp 115 120 125 Leu Arg Thr Asp Leu Ser Thr Leu Met Glu Leu Ser His Gln Lys Gln 130 135 140 Ala Pro Ile Ser Tyr Glu Gln Gly Cys Ala Ile Ala Lys Gln Leu Gly 145 150 155 160 Ala Glu Ile Tyr Leu Glu Gly Ser Ala Phe Thr Ser Glu Lys Ser Ile 165 170 175 His Ser Ile Phe Arg Thr Ala Ser Met Leu Cys Leu Asn Lys Pro Ser 180 185 190 Pro Leu Pro Gln Lys Ser Pro Val Arg Ser Leu Ser Lys Arg Leu Leu 195 200 205 His Leu Pro Ser Arg Ser Glu Leu Ile Ser Ser Thr Phe Lys Lys Glu 210 215 220 Lys Ala Lys Ser Cys Ser Ile Met 225 230 <210> SEQ ID NO 7 <211> LENGTH: 227 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 7 Met Glu Gly Gln Ser Gly Arg Cys Lys Ile Val Val Val Gly Asp Ala 1 5 10 15 Glu Cys Gly Lys Thr Ala Leu Leu Gln Val Phe Ala Lys Asp Ala Tyr 20 25 30 Pro Gly Ser Tyr Val Pro Thr Val Phe Glu Asn Tyr Thr Ala Ser Phe 35 40 45 Glu Ile Asp Lys Arg Arg Ile Glu Leu Asn Met Trp Asp Thr Ser Gly 50 55 60 Ser Ser Tyr Tyr Asp Asn Val Arg Pro Leu Ala Tyr Pro Asp Ser Asp 65 70 75 80 Ala Val Leu Ile Cys Phe Asp Ile Ser Arg Pro Glu Thr Leu Asp Ser 85 90 95 Val Leu Lys Lys Trp Gln Gly Glu Thr Gln Glu Phe Cys Pro Asn Ala 100 105 110 Lys Val Val Leu Val Gly Cys Lys Leu Asp Met Arg Thr Asp Leu Ala 115 120 125 Thr Leu Arg Glu Leu Ser Lys Gln Arg Leu Ile Pro Val Thr His Glu 130 135 140 Gln Gly Thr Val Leu Ala Lys Gln Val Gly Ala Val Ser Tyr Val Glu 145 150 155 160 Cys Ser Ser Arg Ser Ser Glu Arg Ser Val Arg Asp Val Phe His Val 165 170 175 Ala Thr Val Ala Ser Leu Gly Arg Gly His Arg Gln Leu Arg Arg Thr 180 185 190 Asp Ser Arg Arg Gly Met Gln Arg Ser Ala Gln Leu Ser Gly Arg Pro 195 200 205 Asp Arg Gly Asn Glu Gly Glu Ile His Lys Asp Arg Ala Lys Ser Cys 210 215 220 Asn Leu Met 225 <210> SEQ ID NO 8 <211> LENGTH: 211 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 8 Met Asp Ala Pro Gly Ala Leu Ala Gln Thr Ala Ala Pro Gly Pro Gly 1 5 10 15 Arg Lys Glu Leu Lys Ile Val Ile Val Gly Asp Gly Gly Cys Gly Lys 20 25 30 Thr Ser Leu Leu Met Val Tyr Ser Gln Gly Ser Phe Pro Glu His Tyr 35 40 45 Ala Pro Ser Val Phe Glu Lys Tyr Thr Ala Ser Val Thr Val Gly Ser 50 55 60 Lys Glu Val Thr Leu Asn Leu Tyr Asp Thr Ala Gly Gln Glu Asp Tyr 65 70 75 80 Asp Arg Leu Arg Pro Leu Ser Tyr Gln Asn Thr His Leu Val Leu Ile 85 90 95 Cys Tyr Asp Val Met Asn Pro Thr Ser Tyr Asp Asn Val Leu Ile Lys 100 105 110 Trp Phe Pro Glu Val Thr His Phe Cys Arg Gly Ile Pro Met Val Leu 115 120 125 Ile Gly Cys Lys Thr Asp Leu Arg Lys Asp Lys Glu Gln Leu Arg Lys 130 135 140 Leu Arg Ala Ala Gln Leu Glu Pro Ile Thr Tyr Met Gln Gly Leu Ser 145 150 155 160 Ala Cys Glu Gln Ile Arg Ala Ala Leu Tyr Leu Glu Cys Ser Ala Lys 165 170 175 Phe Arg Glu Asn Val Glu Asp Val Phe Arg Glu Ala Ala Lys Val Ala 180 185 190 Leu Ser Ala Leu Lys Lys Ala Gln Arg Gln Lys Lys Arg Arg Leu Cys 195 200 205 Leu Leu Leu 210 <210> SEQ ID NO 9 <211> LENGTH: 191 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 9 Met Gln Ser Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Cys Tyr Thr Thr Asn Ala Phe Pro Lys Glu Tyr 20 25 30 Ile Pro Thr Val Phe Asp Asn Tyr Ser Ala Gln Ser Ala Val Asp Gly 35 40 45 Arg Thr Val Asn Leu Asn Leu Trp Asp Thr Ala Gly Gln Glu Glu Tyr 50 55 60 Asp Arg Leu Arg Thr Leu Ser Tyr Pro Gln Thr Asn Val Phe Val Ile 65 70 75 80 Cys Phe Ser Ile Ala Ser Pro Pro Ser Tyr Glu Asn Val Arg His Lys 85 90 95 Trp His Pro Glu Val Cys His His Cys Pro Asp Val Pro Ile Leu Leu 100 105 110 Val Gly Thr Lys Lys Asp Leu Arg Ala Gln Pro Asp Thr Leu Arg Arg 115 120 125 Leu Lys Glu Gln Gly Gln Ala Pro Ile Thr Pro Gln Gln Gly Gln Ala 130 135 140 Leu Ala Lys Gln Ile His Ala Val Arg Tyr Leu Glu Cys Ser Ala Leu 145 150 155 160 Gln Gln Asp Gly Val Lys Glu Val Phe Ala Glu Ala Val Arg Ala Val 165 170 175 Leu Asn Pro Thr Pro Ile Lys Arg Gly Arg Ser Cys Ile Leu Leu 180 185 190 <210> SEQ ID NO 10 <211> LENGTH: 191 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 10 Met Leu Ser Ser Ile Lys Cys Val Leu Val Gly Asp Ser Ala Val Gly 1 5 10 15 Lys Thr Ser Leu Leu Val Arg Phe Thr Ser Glu Thr Phe Pro Glu Ala 20 25 30 Tyr Lys Pro Thr Val Tyr Glu Asn Thr Gly Val Asp Val Phe Met Asp 35 40 45 Gly Ile Gln Ile Ser Leu Gly Leu Trp Asp Thr Ala Gly Asn Asp Ala 50 55 60 Phe Arg Ser Ile Arg Pro Leu Ser Tyr Gln Gln Ala Asp Val Val Leu 65 70 75 80 Met Cys Tyr Ser Val Ala Asn His Asn Ser Phe Leu Asn Leu Lys Asn 85 90 95 Lys Trp Ile Gly Glu Ile Arg Ser Asn Leu Pro Cys Thr Pro Val Leu 100 105 110 Val Val Ala Thr Gln Thr Asp Gln Arg Glu Met Gly Pro His Arg Ala 115 120 125 Ser Cys Val Asn Ala Met Glu Gly Lys Lys Leu Ala Gln Asp Val Arg 130 135 140 Ala Lys Gly Tyr Leu Glu Cys Ser Ala Leu Ser Asn Arg Gly Val Gln 145 150 155 160 Gln Val Phe Glu Cys Ala Val Arg Thr Ala Val Asn Gln Ala Arg Arg 165 170 175 Arg Asn Arg Arg Arg Leu Phe Ser Ile Asn Glu Cys Lys Ile Phe 180 185 190 <210> SEQ ID NO 11 <211> LENGTH: 192 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 11 Met Gln Ala Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Ser Tyr Thr Thr Asn Ala Phe Pro Gly Glu Tyr 20 25 30 Ile Pro Thr Val Phe Asp Asn Tyr Ser Ala Asn Val Met Val Asp Gly 35 40 45 Lys Pro Val Asn Leu Gly Leu Trp Asp Thr Ala Gly Gln Glu Asp Tyr 50 55 60 Asp Arg Leu Arg Pro Leu Ser Tyr Pro Gln Thr Asp Val Phe Leu Ile 65 70 75 80 Cys Phe Ser Leu Val Ser Pro Ala Ser Phe Glu Asn Val Arg Ala Lys 85 90 95 Trp Tyr Pro Glu Val Arg His His Cys Pro Asn Thr Pro Ile Ile Leu 100 105 110 Val Gly Thr Lys Leu Asp Leu Arg Asp Asp Lys Asp Thr Ile Glu Lys 115 120 125 Leu Lys Glu Lys Lys Leu Thr Pro Ile Thr Tyr Pro Gln Gly Leu Ala 130 135 140 Met Ala Lys Glu Ile Gly Ala Val Lys Tyr Leu Glu Cys Ser Ala Leu 145 150 155 160 Thr Gln Arg Gly Leu Lys Thr Val Phe Asp Glu Ala Ile Arg Ala Val 165 170 175 Leu Cys Pro Pro Pro Val Lys Lys Arg Lys Arg Lys Cys Leu Leu Leu 180 185 190 <210> SEQ ID NO 12 <211> LENGTH: 192 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 12 Met Gln Ala Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Ser Tyr Thr Thr Asn Ala Phe Pro Gly Glu Tyr 20 25 30 Ile Pro Thr Val Phe Asp Asn Tyr Ser Ala Asn Val Met Val Asp Ser 35 40 45 Lys Pro Val Asn Leu Gly Leu Trp Asp Thr Ala Gly Gln Glu Asp Tyr 50 55 60 Asp Arg Leu Arg Pro Leu Ser Tyr Pro Gln Thr Asp Val Phe Leu Ile 65 70 75 80 Cys Phe Ser Leu Val Ser Pro Ala Ser Tyr Glu Asn Val Arg Ala Lys 85 90 95 Trp Phe Pro Glu Val Arg His His Cys Pro Ser Thr Pro Ile Ile Leu 100 105 110 Val Gly Thr Lys Leu Asp Leu Arg Asp Asp Lys Asp Thr Ile Glu Lys 115 120 125 Leu Lys Glu Lys Lys Leu Ala Pro Ile Thr Tyr Pro Gln Gly Leu Ala 130 135 140 Leu Ala Lys Glu Ile Asp Ser Val Lys Tyr Leu Glu Cys Ser Ala Leu 145 150 155 160 Thr Gln Arg Gly Leu Lys Thr Val Phe Asp Glu Ala Ile Arg Ala Val 165 170 175 Leu Cys Pro Gln Pro Thr Arg Gln Gln Lys Arg Ala Cys Ser Leu Leu 180 185 190 <210> SEQ ID NO 13 <211> LENGTH: 192 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 13 Met Gln Ala Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Ser Tyr Thr Thr Asn Ala Phe Pro Gly Glu Tyr 20 25 30 Ile Pro Thr Val Phe Asp Asn Tyr Ser Ala Asn Val Met Val Asp Gly 35 40 45 Lys Pro Val Asn Leu Gly Leu Trp Asp Thr Ala Gly Gln Glu Asp Tyr 50 55 60 Asp Arg Leu Arg Pro Leu Ser Tyr Pro Gln Thr Asp Val Phe Leu Ile 65 70 75 80 Cys Phe Ser Leu Val Ser Pro Ala Ser Phe Glu Asn Val Arg Ala Lys 85 90 95 Trp Tyr Pro Glu Val Arg His His Cys Pro His Thr Pro Ile Leu Leu 100 105 110 Val Gly Thr Lys Leu Asp Leu Arg Asp Asp Lys Asp Thr Ile Glu Arg 115 120 125 Leu Arg Asp Lys Lys Leu Ala Pro Ile Thr Tyr Pro Gln Gly Leu Ala 130 135 140 Met Ala Arg Glu Ile Gly Ser Val Lys Tyr Leu Glu Cys Ser Ala Leu 145 150 155 160 Thr Gln Arg Gly Leu Lys Thr Val Phe Asp Glu Ala Ile Arg Ala Val 165 170 175 Leu Cys Pro Pro Pro Val Lys Lys Pro Gly Lys Lys Cys Thr Val Phe 180 185 190 <210> SEQ ID NO 14 <211> LENGTH: 191 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 14 Met Gln Thr Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Ser Tyr Thr Thr Asn Lys Phe Pro Ser Glu Tyr 20 25 30 Val Pro Thr Val Phe Asp Asn Tyr Ala Val Thr Val Met Ile Gly Gly 35 40 45 Glu Pro Tyr Thr Leu Gly Leu Phe Asp Thr Ala Gly Gln Glu Asp Tyr 50 55 60 Asp Arg Leu Arg Pro Leu Ser Tyr Pro Gln Thr Asp Val Phe Leu Val 65 70 75 80 Cys Phe Ser Val Val Ser Pro Ser Ser Phe Glu Asn Val Lys Glu Lys 85 90 95 Trp Val Pro Glu Ile Thr His His Cys Pro Lys Thr Pro Phe Leu Leu 100 105 110 Val Gly Thr Gln Ile Asp Leu Arg Asp Asp Pro Ser Thr Ile Glu Lys 115 120 125 Leu Ala Lys Asn Lys Gln Lys Pro Ile Thr Pro Glu Thr Ala Glu Lys 130 135 140 Leu Ala Arg Asp Leu Lys Ala Val Lys Tyr Val Glu Cys Ser Ala Leu 145 150 155 160 Thr Gln Lys Gly Leu Lys Asn Val Phe Asp Glu Ala Ile Leu Ala Ala 165 170 175 Leu Glu Pro Pro Glu Pro Lys Lys Ser Arg Arg Cys Val Leu Leu 180 185 190 <210> SEQ ID NO 15 <211> LENGTH: 205 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 15 Met Ala His Gly Pro Gly Ala Leu Met Leu Lys Cys Val Val Val Gly 1 5 10 15 Asp Gly Ala Val Gly Lys Thr Cys Leu Leu Met Ser Tyr Ala Asn Asp 20 25 30 Ala Phe Pro Glu Glu Tyr Val Pro Thr Val Phe Asp His Tyr Ala Val 35 40 45 Ser Val Thr Val Gly Gly Lys Gln Tyr Leu Leu Gly Leu Tyr Asp Thr 50 55 60 Ala Gly Gln Glu Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Met 65 70 75 80 Thr Asp Val Phe Leu Ile Cys Phe Ser Val Val Asn Pro Ala Ser Phe 85 90 95 Gln Asn Val Lys Glu Glu Trp Val Pro Glu Leu Lys Glu Tyr Ala Pro 100 105 110 Asn Val Pro Phe Leu Leu Ile Gly Thr Gln Ile Asp Leu Arg Asp Asp 115 120 125 Pro Lys Thr Leu Ala Arg Leu Asn Asp Met Lys Glu Lys Pro Ile Cys 130 135 140 Val Glu Gln Gly Gln Lys Leu Ala Lys Glu Ile Gly Ala Cys Cys Tyr 145 150 155 160 Val Glu Cys Ser Ala Leu Thr Gln Lys Gly Leu Lys Thr Val Phe Asp 165 170 175 Glu Ala Ile Ile Ala Ile Leu Thr Pro Lys Lys His Thr Val Lys Lys 180 185 190 Arg Ile Gly Ser Arg Cys Ile Asn Cys Cys Leu Ile Thr 195 200 205 <210> SEQ ID NO 16 <211> LENGTH: 214 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 16 Met Asn Cys Lys Glu Gly Thr Asp Ser Ser Cys Gly Cys Arg Gly Asn 1 5 10 15 Asp Glu Lys Lys Met Leu Lys Cys Val Val Val Gly Asp Gly Ala Val 20 25 30 Gly Lys Thr Cys Leu Leu Met Ser Tyr Ala Asn Asp Ala Phe Pro Glu 35 40 45 Glu Tyr Val Pro Thr Val Phe Asp His Tyr Ala Val Thr Val Thr Val 50 55 60 Gly Gly Lys Gln His Leu Leu Gly Leu Tyr Asp Thr Ala Gly Gln Glu 65 70 75 80 Asp Tyr Asn Gln Leu Arg Pro Leu Ser Tyr Pro Asn Thr Asp Val Phe 85 90 95 Leu Ile Cys Phe Ser Val Val Asn Pro Ala Ser Tyr His Asn Val Gln 100 105 110 Glu Glu Trp Val Pro Glu Leu Lys Asp Cys Met Pro His Val Pro Tyr 115 120 125 Val Leu Ile Gly Thr Gln Ile Asp Leu Arg Asp Asp Pro Lys Thr Leu 130 135 140 Ala Arg Leu Leu Tyr Met Lys Glu Lys Pro Leu Thr Tyr Glu His Gly 145 150 155 160 Val Lys Leu Ala Lys Ala Ile Gly Ala Gln Cys Tyr Leu Glu Cys Ser 165 170 175 Ala Leu Thr Gln Lys Gly Leu Lys Ala Val Phe Asp Glu Ala Ile Leu 180 185 190 Thr Ile Phe His Pro Lys Lys Lys Lys Lys Arg Cys Ser Glu Gly His 195 200 205 Ser Cys Cys Ser Ile Ile 210 <210> SEQ ID NO 17 <211> LENGTH: 258 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17 Met Pro Pro Gln Gln Gly Asp Pro Ala Phe Pro Asp Arg Cys Glu Ala 1 5 10 15 Pro Pro Val Pro Pro Arg Arg Glu Arg Gly Gly Arg Gly Gly Arg Gly 20 25 30 Pro Gly Glu Pro Gly Gly Arg Gly Arg Ala Gly Gly Ala Glu Gly Arg 35 40 45 Gly Val Lys Cys Val Leu Val Gly Asp Gly Ala Val Gly Lys Thr Ser 50 55 60 Leu Val Val Ser Tyr Thr Thr Asn Gly Tyr Pro Thr Glu Tyr Ile Pro 65 70 75 80 Thr Ala Phe Asp Asn Phe Ser Ala Val Val Ser Val Asp Gly Arg Pro 85 90 95 Val Arg Leu Gln Leu Cys Asp Thr Ala Gly Gln Asp Glu Phe Asp Lys 100 105 110 Leu Arg Pro Leu Cys Tyr Thr Asn Thr Asp Ile Phe Leu Leu Cys Phe 115 120 125 Ser Val Val Ser Pro Ser Ser Phe Gln Asn Val Ser Glu Lys Trp Val 130 135 140 Pro Glu Ile Arg Cys His Cys Pro Lys Ala Pro Ile Ile Leu Val Gly 145 150 155 160 Thr Gln Ser Asp Leu Arg Glu Asp Val Lys Val Leu Ile Glu Leu Asp 165 170 175 Lys Cys Lys Glu Lys Pro Val Pro Glu Glu Ala Ala Lys Leu Cys Ala 180 185 190 Glu Glu Ile Lys Ala Ala Ser Tyr Ile Glu Cys Ser Ala Leu Thr Gln 195 200 205 Lys Asn Leu Lys Glu Val Phe Asp Ala Ala Ile Val Ala Gly Ile Gln 210 215 220 Tyr Ser Asp Thr Gln Gln Gln Pro Lys Lys Ser Lys Ser Arg Thr Pro 225 230 235 240 Asp Lys Met Lys Asn Leu Ser Lys Ser Trp Trp Lys Lys Tyr Cys Cys 245 250 255 Phe Val <210> SEQ ID NO 18 <211> LENGTH: 236 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 18 Met Pro Pro Arg Glu Leu Ser Glu Ala Glu Pro Pro Pro Leu Arg Ala 1 5 10 15 Pro Thr Pro Pro Pro Arg Arg Arg Ser Ala Pro Pro Glu Leu Gly Ile 20 25 30 Lys Cys Val Leu Val Gly Asp Gly Ala Val Gly Lys Ser Ser Leu Ile 35 40 45 Val Ser Tyr Thr Cys Asn Gly Tyr Pro Ala Arg Tyr Arg Pro Thr Ala 50 55 60 Leu Asp Thr Phe Ser Val Gln Val Leu Val Asp Gly Ala Pro Val Arg 65 70 75 80 Ile Glu Leu Trp Asp Thr Ala Gly Gln Glu Asp Phe Asp Arg Leu Arg 85 90 95 Ser Leu Cys Tyr Pro Asp Thr Asp Val Phe Leu Ala Cys Phe Ser Val 100 105 110 Val Gln Pro Ser Ser Phe Gln Asn Ile Thr Glu Lys Trp Leu Pro Glu 115 120 125 Ile Arg Thr His Asn Pro Gln Ala Pro Val Leu Leu Val Gly Thr Gln 130 135 140 Ala Asp Leu Arg Asp Asp Val Asn Val Leu Ile Gln Leu Asp Gln Gly 145 150 155 160 Gly Arg Glu Gly Pro Val Pro Gln Pro Gln Ala Gln Gly Leu Ala Glu 165 170 175 Arg Ile Arg Ala Cys Cys Tyr Leu Glu Cys Ser Ala Leu Thr Gln Lys 180 185 190 Asn Leu Lys Glu Val Phe Asp Ser Ala Ile Leu Ser Ala Ile Glu His 195 200 205 Lys Ala Arg Leu Glu Lys Lys Leu Asn Ala Lys Gly Val Arg Thr Leu 210 215 220 Ser Arg Cys Arg Trp Lys Lys Phe Phe Cys Phe Val 225 230 235 <210> SEQ ID NO 19 <211> LENGTH: 696 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 19 Met Asp Ala Asp Met Asp Tyr Glu Arg Pro Asn Val Glu Thr Ile Lys 1 5 10 15 Cys Val Val Val Gly Asp Asn Ala Val Gly Lys Thr Arg Leu Ile Cys 20 25 30 Ala Arg Ala Cys Asn Thr Thr Leu Thr Gln Tyr Gln Leu Leu Ala Thr 35 40 45 His Val Pro Thr Val Trp Ala Ile Asp Gln Tyr Arg Val Cys Gln Glu 50 55 60 Val Leu Glu Arg Ser Arg Asp Val Val Asp Glu Val Ser Val Ser Leu 65 70 75 80 Arg Leu Trp Asp Thr Phe Gly Asp His His Lys Asp Arg Arg Phe Ala 85 90 95 Tyr Gly Arg Ser Asp Val Val Val Leu Cys Phe Ser Ile Ala Asn Pro 100 105 110 Asn Ser Leu Asn His Val Lys Ser Met Trp Tyr Pro Glu Ile Lys His 115 120 125 Phe Cys Pro Arg Thr Pro Val Ile Leu Val Gly Cys Gln Leu Asp Leu 130 135 140 Arg Tyr Ala Asp Leu Glu Ala Val Asn Arg Ala Arg Arg Pro Leu Ala 145 150 155 160 Arg Pro Ile Lys Arg Gly Asp Ile Leu Pro Pro Glu Lys Gly Arg Glu 165 170 175 Val Ala Lys Glu Leu Gly Leu Pro Tyr Tyr Glu Thr Ser Val Phe Asp 180 185 190 Gln Phe Gly Ile Lys Asp Val Phe Asp Asn Ala Ile Arg Ala Ala Leu 195 200 205 Ile Ser Arg Arg His Leu Gln Phe Trp Lys Ser His Leu Lys Lys Val 210 215 220 Gln Lys Pro Leu Leu Gln Ala Pro Phe Leu Pro Pro Lys Ala Pro Pro 225 230 235 240 Pro Val Ile Lys Ile Pro Glu Cys Pro Ser Met Gly Thr Asn Glu Ala 245 250 255 Ala Cys Leu Leu Asp Asn Pro Leu Cys Ala Asp Val Leu Phe Ile Leu 260 265 270 Gln Asp Gln Glu His Ile Phe Ala His Arg Ile Tyr Leu Ala Thr Ser 275 280 285 Ser Ser Lys Phe Tyr Asp Leu Phe Leu Met Glu Cys Glu Glu Ser Pro 290 295 300 Asn Gly Ser Glu Gly Ala Cys Glu Lys Glu Lys Gln Ser Arg Asp Phe 305 310 315 320 Gln Gly Arg Ile Leu Ser Val Asp Pro Glu Glu Glu Arg Glu Glu Gly 325 330 335 Pro Pro Arg Ile Pro Gln Ala Asp Gln Trp Lys Ser Ser Asn Lys Ser 340 345 350 Leu Val Glu Ala Leu Gly Leu Glu Ala Glu Gly Ala Val Pro Glu Thr 355 360 365 Gln Thr Leu Thr Gly Trp Ser Lys Gly Phe Ile Gly Met His Arg Glu 370 375 380 Met Gln Val Asn Pro Ile Ser Lys Arg Met Gly Pro Met Thr Val Val 385 390 395 400 Arg Met Asp Ala Ser Val Gln Pro Gly Pro Phe Arg Thr Leu Leu Gln 405 410 415 Phe Leu Tyr Thr Gly Gln Leu Asp Glu Lys Glu Lys Asp Leu Val Gly 420 425 430 Leu Ala Gln Ile Ala Glu Val Leu Glu Met Phe Asp Leu Arg Met Met 435 440 445 Val Glu Asn Ile Met Asn Lys Glu Ala Phe Met Asn Gln Glu Ile Thr 450 455 460 Lys Ala Phe His Val Arg Lys Ala Asn Arg Ile Lys Glu Cys Leu Ser 465 470 475 480 Lys Gly Thr Phe Ser Asp Val Thr Phe Lys Leu Asp Asp Gly Ala Ile 485 490 495 Ser Ala His Lys Pro Leu Leu Ile Cys Ser Cys Glu Trp Met Ala Ala 500 505 510 Met Phe Gly Gly Ser Phe Val Glu Ser Ala Asn Ser Glu Val Tyr Leu 515 520 525 Pro Asn Ile Asn Lys Ile Ser Met Gln Ala Val Leu Asp Tyr Leu Tyr 530 535 540 Thr Lys Gln Leu Ser Pro Asn Leu Asp Leu Asp Pro Leu Glu Leu Ile 545 550 555 560 Ala Leu Ala Asn Arg Phe Cys Leu Pro His Leu Val Ala Leu Ala Glu 565 570 575 Gln His Ala Val Gln Glu Leu Thr Lys Ala Ala Thr Ser Gly Val Gly 580 585 590 Ile Asp Gly Glu Val Leu Ser Tyr Leu Glu Leu Ala Gln Phe His Asn 595 600 605 Ala His Gln Leu Ala Ala Trp Cys Leu His His Ile Cys Thr Asn Tyr 610 615 620 Asn Ser Val Cys Ser Lys Phe Arg Lys Glu Ile Lys Ser Lys Ser Ala 625 630 635 640 Asp Asn Gln Glu Tyr Phe Glu Arg His Arg Trp Pro Pro Val Trp Tyr 645 650 655 Leu Lys Glu Glu Asp His Tyr Gln Arg Val Lys Arg Glu Arg Glu Lys 660 665 670 Glu Asp Ile Ala Leu Asn Lys His Arg Ser Arg Arg Lys Trp Cys Phe 675 680 685 Trp Asn Ser Ser Pro Ala Val Ala 690 695 <210> SEQ ID NO 20 <211> LENGTH: 727 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 20 Met Asp Ser Asp Met Asp Tyr Glu Arg Pro Asn Val Glu Thr Ile Lys 1 5 10 15 Cys Val Val Val Gly Asp Asn Ala Val Gly Lys Thr Arg Leu Ile Cys 20 25 30 Ala Arg Ala Cys Asn Ala Thr Leu Thr Gln Tyr Gln Leu Leu Ala Thr 35 40 45 His Val Pro Thr Val Trp Ala Ile Asp Gln Tyr Arg Val Cys Gln Glu 50 55 60 Val Leu Glu Arg Ser Arg Asp Val Val Asp Asp Val Ser Val Ser Leu 65 70 75 80 Arg Leu Trp Asp Thr Phe Gly Asp His His Lys Asp Arg Arg Phe Ala 85 90 95 Tyr Gly Arg Ser Asp Val Val Val Leu Cys Phe Ser Ile Ala Asn Pro 100 105 110 Asn Ser Leu His His Val Lys Thr Met Trp Tyr Pro Glu Ile Lys His 115 120 125 Phe Cys Pro Arg Ala Pro Val Ile Leu Val Gly Cys Gln Leu Asp Leu 130 135 140 Arg Tyr Ala Asp Leu Glu Ala Val Asn Arg Ala Arg Arg Pro Leu Ala 145 150 155 160 Arg Pro Ile Lys Pro Asn Glu Ile Leu Pro Pro Glu Lys Gly Arg Glu 165 170 175 Val Ala Lys Glu Leu Gly Ile Pro Tyr Tyr Glu Thr Ser Val Val Ala 180 185 190 Gln Phe Gly Ile Lys Asp Val Phe Asp Asn Ala Ile Arg Ala Ala Leu 195 200 205 Ile Ser Arg Arg His Leu Gln Phe Trp Lys Ser His Leu Arg Asn Val 210 215 220 Gln Arg Pro Leu Leu Gln Ala Pro Phe Leu Pro Pro Lys Pro Pro Pro 225 230 235 240 Pro Ile Ile Val Val Pro Asp Pro Pro Ser Ser Ser Glu Glu Gly Pro 245 250 255 Ala His Leu Leu Glu Asp Pro Leu Cys Ala Asp Val Ile Leu Val Leu 260 265 270 Gln Glu Arg Val Arg Ile Phe Ala His Lys Ile Tyr Leu Ser Thr Ser 275 280 285 Ser Ser Lys Phe Tyr Asp Leu Phe Leu Met Asp Leu Ser Glu Gly Glu 290 295 300 Leu Gly Gly Pro Ser Glu Pro Gly Gly Thr His Pro Glu Asp His Gln 305 310 315 320 Gly His Ser Asp Gln His His His His His His His His His Gly Arg 325 330 335 Asp Phe Leu Leu Arg Ala Ala Ser Phe Asp Val Cys Glu Ser Val Asp 340 345 350 Glu Ala Gly Gly Ser Gly Pro Ala Gly Leu Arg Ala Ser Thr Ser Asp 355 360 365 Gly Ile Leu Arg Gly Asn Gly Thr Gly Tyr Leu Pro Gly Arg Gly Arg 370 375 380 Val Leu Ser Ser Trp Ser Arg Ala Phe Val Ser Ile Gln Glu Glu Met 385 390 395 400 Ala Glu Asp Pro Leu Thr Tyr Lys Ser Arg Leu Met Val Val Val Lys 405 410 415 Met Asp Ser Ser Ile Gln Pro Gly Pro Phe Arg Ala Val Leu Lys Tyr 420 425 430 Leu Tyr Thr Gly Glu Leu Asp Glu Asn Glu Arg Asp Leu Met His Ile 435 440 445 Ala His Ile Ala Glu Leu Leu Glu Val Phe Asp Leu Arg Met Met Val 450 455 460 Ala Asn Ile Leu Asn Asn Glu Ala Phe Met Asn Gln Glu Ile Thr Lys 465 470 475 480 Ala Phe His Val Arg Arg Thr Asn Arg Val Lys Glu Cys Leu Ala Lys 485 490 495 Gly Thr Phe Ser Asp Val Thr Phe Ile Leu Asp Asp Gly Thr Ile Ser 500 505 510 Ala His Lys Pro Leu Leu Ile Ser Ser Cys Asp Trp Met Ala Ala Met 515 520 525 Phe Gly Gly Pro Phe Val Glu Ser Ser Thr Arg Glu Val Val Phe Pro 530 535 540 Tyr Thr Ser Lys Ser Cys Met Arg Ala Val Leu Glu Tyr Leu Tyr Thr 545 550 555 560 Gly Met Phe Thr Ser Ser Pro Asp Leu Asp Asp Met Lys Leu Ile Ile 565 570 575 Leu Ala Asn Arg Leu Cys Leu Pro His Leu Val Ala Leu Thr Glu Gln 580 585 590 Tyr Thr Val Thr Gly Leu Met Glu Ala Thr Gln Met Met Val Asp Ile 595 600 605 Asp Gly Asp Val Leu Val Phe Leu Glu Leu Ala Gln Phe His Cys Ala 610 615 620 Tyr Gln Leu Ala Asp Trp Cys Leu His His Ile Cys Thr Asn Tyr Asn 625 630 635 640 Asn Val Cys Arg Lys Phe Pro Arg Asp Met Lys Ala Met Ser Pro Glu 645 650 655 Asn Gln Glu Tyr Phe Glu Lys His Arg Trp Pro Pro Val Trp Tyr Leu 660 665 670 Lys Glu Glu Asp His Tyr Gln Arg Ala Arg Lys Glu Arg Glu Lys Glu 675 680 685 Asp Tyr Leu His Leu Lys Arg Gln Pro Lys Arg Arg Trp Leu Phe Trp 690 695 700 Asn Ser Pro Ser Ser Pro Ser Ser Ser Ala Ala Ser Ser Ser Ser Pro 705 710 715 720 Ser Ser Ser Ser Ala Val Val 725 <210> SEQ ID NO 21 <211> LENGTH: 17 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (4), (10)..(13), (15) <223> OTHER INFORMATION: Xaa is any amino acid residue <400> SEQUENCE: 21 Thr Glu Arg Xaa Leu Lys Thr Gln Ala Xaa Xaa Xaa Xaa Ala Xaa Ile 1 5 10 15 Leu <210> SEQ ID NO 22 <211> LENGTH: 64 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (2)..(4), (7), (9)..(11), (13), (19), (21), (22), (25)..(32), (34), (37), (38), (40), (42), (45), (48), (50), (51), (53), (54), (57), (61) <223> OTHER INFORMATION: Xaa is any amino acid <400> SEQUENCE: 22 Leu Xaa Xaa Xaa Leu Asp Xaa Glu Xaa Xaa Xaa Phe Xaa Gly Ala Glu 1 5 10 15 Leu Leu Xaa Leu Xaa Xaa Glu Lys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Glu Xaa Gln Arg Xaa Xaa Asp Xaa Glu Xaa Leu Lys Xaa Arg Asn Xaa 35 40 45 Glu Xaa Xaa Val Xaa Xaa Leu Lys Xaa Gln Leu Glu Xaa Leu Lys Lys 50 55 60 <210> SEQ ID NO 23 <211> LENGTH: 63 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (2)..(4), (7)..(13), (15)..(19), (21), (24)..28), (30)..(35), (37)..(44), (46)..(53), (55)..(62) <223> OTHER INFORMATION: Xaa is any amino acid <400> SEQUENCE: 23 Leu Xaa Xaa Xaa Leu Glu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Thr Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Val Xaa Glu Leu Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gln Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Thr 50 55 60 <210> SEQ ID NO 24 <211> LENGTH: 2027 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 24 Met Leu Lys Phe Lys Tyr Gly Ala Arg Asn Pro Leu Asp Ala Gly Ala 1 5 10 15 Ala Glu Pro Ile Ala Ser Arg Ala Ser Arg Leu Asn Leu Phe Phe Gln 20 25 30 Gly Lys Pro Pro Phe Met Thr Gln Gln Gln Met Ser Pro Leu Ser Arg 35 40 45 Glu Gly Ile Leu Asp Ala Leu Phe Val Leu Phe Glu Glu Cys Ser Gln 50 55 60 Pro Ala Leu Met Lys Ile Lys His Val Ser Asn Phe Val Arg Lys Tyr 65 70 75 80 Ser Asp Thr Ile Ala Glu Leu Gln Glu Leu Gln Pro Ser Ala Lys Asp 85 90 95 Phe Glu Val Arg Ser Leu Val Gly Cys Gly His Phe Ala Glu Val Gln 100 105 110 Val Val Arg Glu Lys Ala Thr Gly Asp Ile Tyr Ala Met Lys Val Met 115 120 125 Lys Lys Lys Ala Leu Leu Ala Gln Glu Gln Val Ser Phe Phe Glu Glu 130 135 140 Glu Arg Asn Ile Leu Ser Arg Ser Thr Ser Pro Trp Ile Pro Gln Leu 145 150 155 160 Gln Tyr Ala Phe Gln Asp Lys Asn His Leu Tyr Leu Val Met Glu Tyr 165 170 175 Gln Pro Gly Gly Asp Leu Leu Ser Leu Leu Asn Arg Tyr Glu Asp Gln 180 185 190 Leu Asp Glu Asn Leu Ile Gln Phe Tyr Leu Ala Glu Leu Ile Leu Ala 195 200 205 Val His Ser Val His Leu Met Gly Tyr Val His Arg Asp Ile Lys Pro 210 215 220 Glu Asn Ile Leu Val Asp Arg Thr Gly His Ile Lys Leu Val Asp Phe 225 230 235 240 Gly Ser Ala Ala Lys Met Asn Ser Asn Lys Met Val Asn Ala Lys Leu 245 250 255 Pro Ile Gly Thr Pro Asp Tyr Met Ala Pro Glu Val Leu Thr Val Met 260 265 270 Asn Gly Asp Gly Lys Gly Thr Tyr Gly Leu Asp Cys Asp Trp Trp Ser 275 280 285 Val Gly Val Ile Ala Tyr Glu Met Ile Tyr Gly Arg Ser Pro Phe Ala 290 295 300 Glu Gly Thr Ser Ala Arg Thr Phe Asn Asn Ile Met Asn Phe Gln Arg 305 310 315 320 Phe Leu Lys Phe Pro Asp Asp Pro Lys Val Ser Ser Asp Phe Leu Asp 325 330 335 Leu Ile Gln Ser Leu Leu Cys Gly Gln Lys Glu Arg Leu Lys Phe Glu 340 345 350 Gly Leu Cys Cys His Pro Phe Phe Ser Lys Ile Asp Trp Asn Asn Ile 355 360 365 Arg Asn Ser Pro Pro Pro Phe Val Pro Thr Leu Lys Ser Asp Asp Asp 370 375 380 Thr Ser Asn Phe Asp Glu Pro Glu Lys Asn Ser Trp Val Ser Ser Ser 385 390 395 400 Pro Cys Gln Leu Ser Pro Ser Gly Phe Ser Gly Glu Glu Leu Pro Phe 405 410 415 Val Gly Phe Ser Tyr Ser Lys Ala Leu Gly Ile Leu Gly Arg Ser Glu 420 425 430 Ser Val Val Ser Gly Leu Asp Ser Pro Ala Lys Thr Ser Ser Met Glu 435 440 445 Lys Lys Leu Leu Ile Lys Ser Lys Glu Leu Gln Asp Ser Gln Asp Lys 450 455 460 Cys His Lys Met Glu Gln Glu Met Thr Arg Leu His Arg Arg Val Ser 465 470 475 480 Glu Val Glu Ala Val Leu Ser Gln Lys Glu Val Glu Leu Lys Ala Ser 485 490 495 Glu Thr Gln Arg Ser Leu Leu Glu Gln Asp Leu Ala Thr Tyr Ile Thr 500 505 510 Glu Cys Ser Ser Leu Lys Arg Ser Leu Glu Gln Ala Arg Met Glu Val 515 520 525 Ser Gln Glu Asp Asp Lys Ala Leu Gln Leu Leu His Asp Ile Arg Glu 530 535 540 Gln Ser Arg Lys Leu Gln Glu Ile Lys Glu Gln Glu Tyr Gln Ala Gln 545 550 555 560 Val Glu Glu Met Arg Leu Met Met Asn Gln Leu Glu Glu Asp Leu Val 565 570 575 Ser Ala Arg Arg Arg Ser Asp Leu Tyr Glu Ser Glu Leu Arg Glu Ser 580 585 590 Arg Leu Ala Ala Glu Glu Phe Lys Arg Lys Ala Thr Glu Cys Gln His 595 600 605 Lys Leu Leu Lys Ala Lys Asp Gln Gly Lys Pro Glu Val Gly Glu Tyr 610 615 620 Ala Lys Leu Glu Lys Ile Asn Ala Glu Gln Gln Leu Lys Ile Gln Glu 625 630 635 640 Leu Gln Glu Lys Leu Glu Lys Ala Val Lys Ala Ser Thr Glu Ala Thr 645 650 655 Glu Leu Leu Gln Asn Ile Arg Gln Ala Lys Glu Arg Ala Glu Arg Glu 660 665 670 Leu Glu Lys Leu Gln Asn Arg Glu Asp Ser Ser Glu Gly Ile Arg Lys 675 680 685 Lys Leu Val Glu Ala Glu Glu Leu Glu Glu Lys His Arg Glu Ala Gln 690 695 700 Val Ser Ala Gln His Leu Glu Val His Leu Lys Gln Lys Glu Gln His 705 710 715 720 Tyr Glu Glu Lys Ile Lys Val Leu Asp Asn Gln Ile Lys Lys Asp Leu 725 730 735 Ala Asp Lys Glu Thr Leu Glu Asn Met Met Gln Arg His Glu Glu Glu 740 745 750 Ala His Glu Lys Gly Lys Ile Leu Ser Glu Gln Lys Ala Met Ile Asn 755 760 765 Ala Met Asp Ser Lys Ile Arg Ser Leu Glu Gln Arg Ile Val Glu Leu 770 775 780 Ser Glu Ala Asn Lys Leu Ala Ala Asn Ser Ser Leu Phe Thr Gln Arg 785 790 795 800 Asn Met Lys Ala Gln Glu Glu Met Ile Ser Glu Leu Arg Gln Gln Lys 805 810 815 Phe Tyr Leu Glu Thr Gln Ala Gly Lys Leu Glu Ala Gln Asn Arg Lys 820 825 830 Leu Glu Glu Gln Leu Glu Lys Ile Ser His Gln Asp His Ser Asp Lys 835 840 845 Asn Arg Leu Leu Glu Leu Glu Thr Arg Leu Arg Glu Val Ser Leu Glu 850 855 860 His Glu Glu Gln Lys Leu Glu Leu Lys Arg Gln Leu Thr Glu Leu Gln 865 870 875 880 Leu Ser Leu Gln Glu Arg Glu Ser Gln Leu Thr Ala Leu Gln Ala Ala 885 890 895 Arg Ala Ala Leu Glu Ser Gln Leu Arg Gln Ala Lys Thr Glu Leu Glu 900 905 910 Glu Thr Thr Ala Glu Ala Glu Glu Glu Ile Gln Ala Leu Thr Ala His 915 920 925 Arg Asp Glu Ile Gln Arg Lys Phe Asp Ala Leu Arg Asn Ser Cys Thr 930 935 940 Val Ile Thr Asp Leu Glu Glu Gln Leu Asn Gln Leu Thr Glu Asp Asn 945 950 955 960 Ala Glu Leu Asn Asn Gln Asn Phe Tyr Leu Ser Lys Gln Leu Asp Glu 965 970 975 Ala Ser Gly Ala Asn Asp Glu Ile Val Gln Leu Arg Ser Glu Val Asp 980 985 990 His Leu Arg Arg Glu Ile Thr Glu Arg Glu Met Gln Leu Thr Ser Gln 995 1000 1005 Lys Gln Thr Met Glu Ala Leu Lys Thr Thr Cys Thr Met Leu Glu Glu 1010 1015 1020 Gln Val Met Asp Leu Glu Ala Leu Asn Asp Glu Leu Leu Glu Lys Glu 1025 1030 1035 1040 Arg Gln Trp Glu Ala Trp Arg Ser Val Leu Gly Asp Glu Lys Ser Gln 1045 1050 1055 Phe Glu Cys Arg Val Arg Glu Leu Gln Arg Met Leu Asp Thr Glu Lys 1060 1065 1070 Gln Ser Arg Ala Arg Ala Asp Gln Arg Ile Thr Glu Ser Arg Gln Val 1075 1080 1085 Val Glu Leu Ala Val Lys Glu His Lys Ala Glu Ile Leu Ala Leu Gln 1090 1095 1100 Gln Ala Leu Lys Glu Gln Lys Leu Lys Ala Glu Ser Leu Ser Asp Lys 1105 1110 1115 1120 Leu Asn Asp Leu Glu Lys Lys His Ala Met Leu Glu Met Asn Ala Arg 1125 1130 1135 Ser Leu Gln Gln Lys Leu Glu Thr Glu Arg Glu Leu Lys Gln Arg Leu 1140 1145 1150 Leu Glu Glu Gln Ala Lys Leu Gln Gln Gln Met Asp Leu Gln Lys Asn 1155 1160 1165 His Ile Phe Arg Leu Thr Gln Gly Leu Gln Glu Ala Leu Asp Arg Ala 1170 1175 1180 Asp Leu Leu Lys Thr Glu Arg Ser Asp Leu Glu Tyr Gln Leu Glu Asn 1185 1190 1195 1200 Ile Gln Val Leu Tyr Ser His Glu Lys Val Lys Met Glu Gly Thr Ile 1205 1210 1215 Ser Gln Gln Thr Lys Leu Ile Asp Phe Leu Gln Ala Lys Met Asp Gln 1220 1225 1230 Pro Ala Lys Lys Lys Lys Gly Leu Phe Ser Arg Arg Lys Glu Asp Pro 1235 1240 1245 Ala Leu Pro Thr Gln Val Pro Leu Gln Tyr Asn Glu Leu Lys Leu Ala 1250 1255 1260 Leu Glu Lys Glu Lys Ala Arg Cys Ala Glu Leu Glu Glu Ala Leu Gln 1265 1270 1275 1280 Lys Thr Arg Ile Glu Leu Arg Ser Ala Arg Glu Glu Ala Ala His Arg 1285 1290 1295 Lys Ala Thr Asp His Pro His Pro Ser Thr Pro Ala Thr Ala Arg Gln 1300 1305 1310 Gln Ile Ala Met Ser Ala Ile Val Arg Ser Pro Glu His Gln Pro Ser 1315 1320 1325 Ala Met Ser Leu Leu Ala Pro Pro Ser Ser Arg Arg Lys Glu Ser Ser 1330 1335 1340 Thr Pro Glu Glu Phe Ser Arg Arg Leu Lys Glu Arg Met His His Asn 1345 1350 1355 1360 Ile Pro His Arg Phe Asn Val Gly Leu Asn Met Arg Ala Thr Lys Cys 1365 1370 1375 Ala Val Cys Leu Asp Thr Val His Phe Gly Arg Gln Ala Ser Lys Cys 1380 1385 1390 Leu Glu Cys Gln Val Met Cys His Pro Lys Cys Ser Thr Cys Leu Pro 1395 1400 1405 Ala Thr Cys Gly Leu Pro Ala Glu Tyr Ala Thr His Phe Thr Glu Ala 1410 1415 1420 Phe Cys Arg Asp Lys Met Asn Ser Pro Gly Leu Gln Thr Lys Glu Pro 1425 1430 1435 1440 Ser Ser Ser Leu His Leu Glu Gly Trp Met Lys Val Pro Arg Asn Asn 1445 1450 1455 Lys Arg Gly Gln Gln Gly Trp Asp Arg Lys Tyr Ile Val Leu Glu Gly 1460 1465 1470 Ser Lys Val Leu Ile Tyr Asp Asn Glu Ala Arg Glu Ala Gly Gln Arg 1475 1480 1485 Pro Val Glu Glu Phe Glu Leu Cys Leu Pro Asp Gly Asp Val Ser Ile 1490 1495 1500 His Gly Ala Val Gly Ala Ser Glu Leu Ala Asn Thr Ala Lys Ala Asp 1505 1510 1515 1520 Val Pro Tyr Ile Leu Lys Met Glu Ser His Pro His Thr Thr Cys Trp 1525 1530 1535 Pro Gly Arg Thr Leu Tyr Leu Leu Ala Pro Ser Phe Pro Asp Lys Gln 1540 1545 1550 Arg Trp Val Thr Ala Leu Glu Ser Val Val Ala Gly Gly Arg Val Ser 1555 1560 1565 Arg Glu Lys Ala Glu Ala Asp Ala Lys Leu Leu Gly Asn Ser Leu Leu 1570 1575 1580 Lys Leu Glu Gly Asp Asp Arg Leu Asp Met Asn Cys Thr Leu Pro Phe 1585 1590 1595 1600 Ser Asp Gln Val Val Leu Val Gly Thr Glu Glu Gly Leu Tyr Ala Leu 1605 1610 1615 Asn Val Leu Lys Asn Ser Leu Thr His Val Pro Gly Ile Gly Ala Val 1620 1625 1630 Phe Gln Ile Tyr Ile Ile Lys Asp Leu Glu Lys Leu Met Ile Ala Gly 1635 1640 1645 Glu Glu Arg Ala Leu Cys Leu Val Asp Val Lys Lys Val Lys Gln Ser 1650 1655 1660 Leu Ala Gln Ser His Leu Pro Ala Gln Pro Asp Ile Ser Pro Asn Ile 1665 1670 1675 1680 Phe Glu Ala Val Lys Gly Cys His Leu Phe Gly Ala Gly Lys Ile Glu 1685 1690 1695 Asn Gly Leu Cys Ile Cys Ala Ala Met Pro Ser Lys Val Val Ile Leu 1700 1705 1710 Arg Tyr Asn Glu Asn Leu Ser Lys Tyr Cys Ile Arg Lys Glu Ile Glu 1715 1720 1725 Thr Ser Glu Pro Cys Ser Cys Ile His Phe Thr Asn Tyr Ser Ile Leu 1730 1735 1740 Ile Gly Thr Asn Lys Phe Tyr Glu Ile Asp Met Lys Gln Tyr Thr Leu 1745 1750 1755 1760 Glu Glu Phe Leu Asp Lys Asn Asp His Ser Leu Ala Pro Ala Val Phe 1765 1770 1775 Ala Ala Ser Ser Asn Ser Phe Pro Val Ser Ile Val Gln Val Asn Ser 1780 1785 1790 Ala Gly Gln Arg Glu Glu Tyr Leu Leu Cys Phe His Glu Phe Gly Val 1795 1800 1805 Phe Val Asp Ser Tyr Gly Arg Arg Ser Arg Thr Asp Asp Leu Lys Trp 1810 1815 1820 Ser Arg Leu Pro Leu Ala Phe Ala Tyr Arg Glu Pro Tyr Leu Phe Val 1825 1830 1835 1840 Thr His Phe Asn Ser Leu Glu Val Ile Glu Ile Gln Ala Arg Ser Ser 1845 1850 1855 Ala Gly Thr Pro Ala Arg Ala Tyr Leu Asp Ile Pro Asn Pro Arg Tyr 1860 1865 1870 Leu Gly Pro Ala Ile Ser Ser Gly Ala Ile Tyr Leu Ala Ser Ser Tyr 1875 1880 1885 Gln Asp Lys Leu Arg Val Ile Cys Cys Lys Gly Asn Leu Val Lys Glu 1890 1895 1900 Ser Gly Thr Glu His His Arg Gly Pro Ser Thr Ser Arg Lys Ser Ser 1905 1910 1915 1920 Pro Asn Lys Arg Gly Pro Pro Thr Tyr Asn Glu His Ile Thr Lys Arg 1925 1930 1935 Val Ala Ser Ser Pro Ala Pro Pro Glu Gly Pro Ser His Pro Arg Glu 1940 1945 1950 Pro Ser Thr Pro His Arg Tyr Arg Glu Gly Arg Thr Glu Leu Arg Arg 1955 1960 1965 Asp Lys Ser Pro Gly Arg Pro Leu Glu Arg Glu Lys Ser Pro Gly Arg 1970 1975 1980 Met Leu Ser Thr Arg Arg Glu Arg Ser Pro Gly Arg Leu Phe Glu Asp 1985 1990 1995 2000 Ser Ser Arg Gly Arg Leu Pro Ala Gly Ala Val Arg Thr Pro Leu Ser 2005 2010 2015 Gln Val Asn Lys Val Trp Asp Gln Ser Ser Val 2020 2025 <210> SEQ ID NO 25 <211> LENGTH: 1354 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 25 Met Ser Thr Gly Asp Ser Phe Glu Thr Arg Phe Glu Lys Met Asp Asn 1 5 10 15 Leu Leu Arg Asp Pro Lys Ser Glu Val Asn Ser Asp Cys Leu Leu Asp 20 25 30 Gly Leu Asp Ala Leu Val Tyr Asp Leu Asp Phe Pro Ala Leu Arg Lys 35 40 45 Asn Lys Asn Ile Asp Asn Phe Leu Ser Arg Tyr Lys Asp Thr Ile Asn 50 55 60 Lys Ile Arg Asp Leu Arg Met Lys Ala Glu Asp Tyr Glu Val Val Lys 65 70 75 80 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 85 90 95 Ser Thr Arg Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 100 105 110 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 115 120 125 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 130 135 140 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 145 150 155 160 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Arg 165 170 175 Phe Tyr Thr Ala Glu Val Val Leu Ala Leu Asp Ala Ile His Ser Met 180 185 190 Gly Phe Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 195 200 205 Ser Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asn 210 215 220 Lys Glu Gly Met Val Arg Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 225 230 235 240 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Tyr Tyr Gly 245 250 255 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 260 265 270 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 275 280 285 Lys Ile Met Asn His Lys Asn Ser Leu Thr Phe Pro Asp Asp Asn Asp 290 295 300 Ile Ser Lys Glu Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 305 310 315 320 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Lys Arg His Leu 325 330 335 Phe Phe Lys Asn Asp Gln Trp Ala Trp Glu Thr Leu Arg Asp Thr Val 340 345 350 Ala Pro Val Val Pro Asp Leu Ser Ser Asp Ile Asp Thr Ser Asn Phe 355 360 365 Asp Asp Leu Glu Glu Asp Lys Gly Glu Glu Glu Thr Phe Pro Ile Pro 370 375 380 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Val Gly Phe Thr Tyr Tyr 385 390 395 400 Ser Asn Arg Arg Tyr Leu Ser Ser Ala Asn Pro Asn Asp Asn Arg Thr 405 410 415 Ser Ser Asn Ala Asp Lys Ser Leu Gln Glu Ser Leu Gln Lys Thr Ile 420 425 430 Tyr Lys Leu Glu Glu Gln Leu His Asn Glu Met Gln Leu Lys Asp Glu 435 440 445 Met Glu Gln Lys Cys Arg Thr Ser Asn Ile Lys Leu Asp Lys Ile Met 450 455 460 Lys Glu Leu Asp Glu Glu Gly Asn Gln Arg Arg Asn Leu Glu Ser Thr 465 470 475 480 Val Ser Gln Ile Glu Lys Glu Lys Met Leu Leu Gln His Arg Ile Asn 485 490 495 Glu Tyr Gln Arg Lys Ala Glu Gln Glu Asn Glu Lys Arg Arg Asn Val 500 505 510 Glu Asn Glu Val Ser Thr Leu Lys Asp Gln Leu Glu Asp Leu Lys Lys 515 520 525 Val Ser Gln Asn Ser Gln Leu Ala Asn Glu Lys Leu Ser Gln Leu Gln 530 535 540 Lys Gln Leu Glu Glu Ala Asn Asp Leu Leu Arg Thr Glu Ser Asp Thr 545 550 555 560 Ala Val Arg Leu Arg Lys Ser His Thr Glu Met Ser Lys Ser Ile Ser 565 570 575 Gln Leu Glu Ser Leu Asn Arg Glu Leu Gln Glu Arg Asn Arg Ile Leu 580 585 590 Glu Asn Ser Lys Ser Gln Thr Asp Lys Asp Tyr Tyr Gln Leu Gln Ala 595 600 605 Ile Leu Glu Ala Glu Arg Arg Asp Arg Gly His Asp Ser Glu Met Ile 610 615 620 Gly Asp Leu Gln Ala Arg Ile Thr Ser Leu Gln Glu Glu Val Lys His 625 630 635 640 Leu Lys His Asn Leu Glu Lys Val Glu Gly Glu Arg Lys Glu Ala Gln 645 650 655 Asp Met Leu Asn His Ser Glu Lys Glu Lys Asn Asn Leu Glu Ile Asp 660 665 670 Leu Asn Tyr Lys Leu Lys Ser Leu Gln Gln Arg Leu Glu Gln Glu Val 675 680 685 Asn Glu His Lys Val Thr Lys Ala Arg Leu Thr Asp Lys His Gln Ser 690 695 700 Ile Glu Glu Ala Lys Ser Val Ala Met Cys Glu Met Glu Lys Lys Leu 705 710 715 720 Lys Glu Glu Arg Glu Ala Arg Glu Lys Ala Glu Asn Arg Val Val Gln 725 730 735 Ile Glu Lys Gln Cys Ser Met Leu Asp Val Asp Leu Lys Gln Ser Gln 740 745 750 Gln Lys Leu Glu His Leu Thr Gly Asn Lys Glu Arg Met Glu Asp Glu 755 760 765 Val Lys Asn Leu Thr Leu Gln Leu Glu Gln Glu Ser Asn Lys Arg Leu 770 775 780 Leu Leu Gln Asn Glu Leu Lys Thr Gln Ala Phe Glu Ala Asp Asn Leu 785 790 795 800 Lys Gly Leu Glu Lys Gln Met Lys Gln Glu Ile Asn Thr Leu Leu Glu 805 810 815 Ala Lys Arg Leu Leu Glu Phe Glu Leu Ala Gln Leu Thr Lys Gln Tyr 820 825 830 Arg Gly Asn Glu Gly Gln Met Arg Glu Leu Gln Asp Gln Leu Glu Ala 835 840 845 Glu Gln Tyr Phe Ser Thr Leu Tyr Lys Thr Gln Val Lys Glu Leu Lys 850 855 860 Glu Glu Ile Glu Glu Lys Asn Arg Glu Asn Leu Lys Lys Ile Gln Glu 865 870 875 880 Leu Gln Asn Glu Lys Glu Thr Leu Ala Thr Gln Leu Asp Leu Ala Glu 885 890 895 Thr Lys Ala Glu Ser Glu Gln Leu Ala Arg Gly Leu Leu Glu Glu Gln 900 905 910 Tyr Phe Glu Leu Thr Gln Glu Ser Lys Lys Ala Ala Ser Arg Asn Arg 915 920 925 Gln Glu Ile Thr Asp Lys Asp His Thr Val Ser Arg Leu Glu Glu Ala 930 935 940 Asn Ser Met Leu Thr Lys Asp Ile Glu Ile Leu Arg Arg Glu Asn Glu 945 950 955 960 Glu Leu Thr Glu Lys Met Lys Lys Ala Glu Glu Glu Tyr Lys Leu Glu 965 970 975 Lys Glu Glu Glu Ile Ser Asn Leu Lys Ala Ala Phe Glu Lys Asn Ile 980 985 990 Asn Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu Ala Glu 995 1000 1005 Ile Met Asn Arg Lys Asp Phe Lys Ile Asp Arg Lys Lys Ala Asn Thr 1010 1015 1020 Gln Asp Leu Arg Lys Lys Glu Lys Glu Asn Arg Lys Leu Gln Leu Glu 1025 1030 1035 1040 Leu Asn Gln Glu Arg Glu Lys Phe Asn Gln Met Val Val Lys His Gln 1045 1050 1055 Lys Glu Leu Asn Asp Met Gln Ala Gln Leu Val Glu Glu Cys Ala His 1060 1065 1070 Arg Asn Glu Leu Gln Met Gln Leu Ala Ser Lys Glu Ser Asp Ile Glu 1075 1080 1085 Gln Leu Arg Ala Lys Leu Leu Asp Leu Ser Asp Ser Thr Ser Val Ala 1090 1095 1100 Ser Phe Pro Ser Ala Asp Glu Thr Asp Gly Asn Leu Pro Glu Ser Arg 1105 1110 1115 1120 Ile Glu Gly Trp Leu Ser Val Pro Asn Arg Gly Asn Ile Lys Arg Tyr 1125 1130 1135 Gly Trp Lys Lys Gln Tyr Val Val Val Ser Ser Lys Lys Ile Leu Phe 1140 1145 1150 Tyr Asn Asp Glu Gln Asp Lys Glu Gln Ser Asn Pro Ser Met Val Leu 1155 1160 1165 Asp Ile Asp Lys Leu Phe His Val Arg Pro Val Thr Gln Gly Asp Val 1170 1175 1180 Tyr Arg Ala Glu Thr Glu Glu Ile Pro Lys Ile Phe Gln Ile Leu Tyr 1185 1190 1195 1200 Ala Asn Glu Gly Glu Cys Arg Lys Asp Val Glu Met Glu Pro Val Gln 1205 1210 1215 Gln Ala Glu Lys Thr Asn Phe Gln Asn His Lys Gly His Glu Phe Ile 1220 1225 1230 Pro Thr Leu Tyr His Phe Pro Ala Asn Cys Asp Ala Cys Ala Lys Pro 1235 1240 1245 Leu Trp His Val Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys 1250 1255 1260 His Val Lys Cys His Arg Asp His Leu Asp Lys Lys Glu Asp Leu Ile 1265 1270 1275 1280 Cys Pro Cys Lys Val Ser Tyr Asp Val Thr Ser Ala Arg Asp Met Leu 1285 1290 1295 Leu Leu Ala Cys Ser Gln Asp Glu Gln Lys Lys Trp Val Thr His Leu 1300 1305 1310 Val Lys Lys Ile Pro Lys Asn Pro Pro Ser Gly Phe Val Arg Ala Ser 1315 1320 1325 Pro Arg Thr Leu Ser Thr Arg Ser Thr Ala Asn Gln Ser Phe Arg Lys 1330 1335 1340 Val Val Lys Asn Thr Ser Gly Lys Thr Ser 1345 1350 <210> SEQ ID NO 26 <211> LENGTH: 1388 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 26 Met Ser Arg Pro Pro Pro Thr Gly Lys Met Pro Gly Ala Pro Glu Thr 1 5 10 15 Ala Pro Gly Asp Gly Ala Gly Ala Ser Arg Gln Arg Lys Leu Glu Ala 20 25 30 Leu Ile Arg Asp Pro Arg Ser Pro Ile Asn Val Glu Ser Leu Leu Asp 35 40 45 Gly Leu Asn Ser Leu Val Leu Asp Leu Asp Phe Pro Ala Leu Arg Lys 50 55 60 Asn Lys Asn Ile Asp Asn Phe Leu Asn Arg Tyr Glu Lys Ile Val Lys 65 70 75 80 Lys Ile Arg Gly Leu Gln Met Lys Ala Glu Asp Tyr Asp Val Val Lys 85 90 95 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 100 105 110 Ala Ser Gln Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 115 120 125 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 130 135 140 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 145 150 155 160 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 165 170 175 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Lys 180 185 190 Phe Tyr Thr Ala Glu Val Val Leu Ala Leu Asp Ala Ile His Ser Met 195 200 205 Gly Leu Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 210 215 220 His Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asp 225 230 235 240 Glu Thr Gly Met Val His Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 245 250 255 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Phe Tyr Gly 260 265 270 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 275 280 285 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 290 295 300 Lys Ile Met Asp His Lys Asn Ser Leu Cys Phe Pro Glu Asp Ala Glu 305 310 315 320 Ile Ser Lys His Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 325 330 335 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Arg Gln His Pro 340 345 350 Phe Phe Lys Asn Asp Gln Trp His Trp Asp Asn Ile Arg Glu Thr Ala 355 360 365 Ala Pro Val Val Pro Glu Leu Ser Ser Asp Ile Asp Ser Ser Asn Phe 370 375 380 Asp Asp Ile Glu Asp Asp Lys Gly Asp Val Glu Thr Phe Pro Ile Pro 385 390 395 400 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Ile Gly Phe Thr Tyr Tyr 405 410 415 Arg Glu Asn Leu Leu Leu Ser Asp Ser Pro Ser Cys Arg Glu Thr Asp 420 425 430 Ser Ile Gln Ser Arg Lys Asn Glu Glu Ser Gln Glu Ile Gln Lys Lys 435 440 445 Leu Tyr Thr Leu Glu Glu His Leu Ser Asn Glu Met Gln Ala Lys Glu 450 455 460 Glu Leu Glu Gln Lys Cys Lys Ser Val Asn Thr Arg Leu Glu Lys Thr 465 470 475 480 Ala Lys Glu Leu Glu Glu Glu Ile Thr Leu Arg Lys Ser Val Glu Ser 485 490 495 Ala Leu Arg Gln Leu Glu Arg Glu Lys Ala Leu Leu Gln His Lys Asn 500 505 510 Ala Glu Tyr Gln Arg Lys Ala Asp His Glu Ala Asp Lys Lys Arg Asn 515 520 525 Leu Glu Asn Asp Val Asn Ser Leu Lys Asp Gln Leu Glu Asp Leu Lys 530 535 540 Lys Arg Asn Gln Asn Ser Gln Ile Ser Thr Glu Lys Val Asn Gln Leu 545 550 555 560 Gln Arg Gln Leu Asp Glu Thr Asn Ala Leu Leu Arg Thr Glu Ser Asp 565 570 575 Thr Ala Ala Arg Leu Arg Lys Thr Gln Ala Glu Ser Ser Lys Gln Ile 580 585 590 Gln Gln Leu Glu Ser Asn Asn Arg Asp Leu Gln Asp Lys Asn Cys Leu 595 600 605 Leu Glu Thr Ala Lys Leu Lys Leu Glu Lys Glu Phe Ile Asn Leu Gln 610 615 620 Ser Ala Leu Glu Ser Glu Arg Arg Asp Arg Thr His Gly Ser Glu Ile 625 630 635 640 Ile Asn Asp Leu Gln Gly Arg Ile Cys Gly Leu Glu Glu Asp Leu Lys 645 650 655 Asn Gly Lys Ile Leu Leu Ala Lys Val Glu Leu Glu Lys Arg Gln Leu 660 665 670 Gln Glu Arg Phe Thr Asp Leu Glu Lys Glu Lys Ser Asn Met Glu Ile 675 680 685 Asp Met Thr Tyr Gln Leu Lys Val Ile Gln Gln Ser Leu Glu Gln Glu 690 695 700 Glu Ala Glu His Lys Ala Thr Lys Ala Arg Leu Ala Asp Lys Asn Lys 705 710 715 720 Ile Tyr Glu Ser Ile Glu Glu Ala Lys Ser Glu Ala Met Lys Glu Met 725 730 735 Glu Lys Lys Leu Leu Glu Glu Arg Thr Leu Lys Gln Lys Val Glu Asn 740 745 750 Leu Leu Leu Glu Ala Glu Lys Arg Cys Ser Leu Leu Asp Cys Asp Leu 755 760 765 Lys Gln Ser Gln Gln Lys Ile Asn Glu Leu Leu Lys Gln Lys Asp Val 770 775 780 Leu Asn Glu Asp Val Arg Asn Leu Thr Leu Lys Ile Glu Gln Glu Thr 785 790 795 800 Gln Lys Arg Cys Leu Thr Gln Asn Asp Leu Lys Met Gln Thr Gln Gln 805 810 815 Val Asn Thr Leu Lys Met Ser Glu Lys Gln Leu Lys Gln Glu Asn Asn 820 825 830 His Leu Met Glu Met Lys Met Asn Leu Glu Lys Gln Asn Ala Glu Leu 835 840 845 Arg Lys Glu Arg Gln Asp Ala Asp Gly Gln Met Lys Glu Leu Gln Asp 850 855 860 Gln Leu Glu Ala Glu Gln Tyr Phe Ser Thr Leu Tyr Lys Thr Gln Val 865 870 875 880 Arg Glu Leu Lys Glu Glu Cys Glu Glu Lys Thr Lys Leu Gly Lys Glu 885 890 895 Leu Gln Gln Lys Lys Gln Glu Leu Gln Asp Glu Arg Asp Ser Leu Ala 900 905 910 Ala Gln Leu Glu Ile Thr Leu Thr Lys Ala Asp Ser Glu Gln Leu Ala 915 920 925 Arg Ser Ile Ala Glu Glu Gln Tyr Ser Asp Leu Glu Lys Glu Lys Ile 930 935 940 Met Lys Glu Leu Glu Ile Lys Glu Met Met Ala Arg His Lys Gln Glu 945 950 955 960 Leu Thr Glu Lys Asp Ala Thr Ile Ala Ser Leu Glu Glu Thr Asn Arg 965 970 975 Thr Leu Thr Ser Asp Val Ala Asn Leu Ala Asn Glu Lys Glu Glu Leu 980 985 990 Asn Asn Lys Leu Lys Asp Val Gln Glu Gln Leu Ser Arg Leu Lys Asp 995 1000 1005 Glu Glu Ile Ser Ala Ala Ala Ile Lys Ala Gln Phe Glu Lys Gln Leu 1010 1015 1020 Leu Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu Ala Glu 1025 1030 1035 1040 Ile Met Asn Arg Lys Glu Pro Val Lys Arg Gly Asn Asp Thr Asp Val 1045 1050 1055 Arg Arg Lys Glu Lys Glu Asn Arg Lys Leu His Met Glu Leu Lys Ser 1060 1065 1070 Glu Arg Glu Lys Leu Thr Gln Gln Met Ile Lys Tyr Gln Lys Glu Leu 1075 1080 1085 Asn Glu Met Gln Ala Gln Ile Ala Glu Glu Ser Gln Ile Arg Ile Glu 1090 1095 1100 Leu Gln Met Thr Leu Asp Ser Lys Asp Ser Asp Ile Glu Gln Leu Arg 1105 1110 1115 1120 Ser Gln Leu Gln Ala Leu His Ile Gly Leu Asp Ser Ser Ser Ile Gly 1125 1130 1135 Ser Gly Pro Gly Asp Ala Glu Ala Asp Asp Gly Phe Pro Glu Ser Arg 1140 1145 1150 Leu Glu Gly Trp Leu Ser Leu Pro Val Arg Asn Asn Thr Lys Lys Phe 1155 1160 1165 Gly Trp Val Lys Lys Tyr Val Ile Val Ser Ser Lys Lys Ile Leu Phe 1170 1175 1180 Tyr Asp Ser Glu Gln Asp Lys Glu Gln Ser Asn Pro Tyr Met Val Leu 1185 1190 1195 1200 Asp Ile Asp Lys Leu Phe His Val Arg Pro Val Thr Gln Thr Asp Val 1205 1210 1215 Tyr Arg Ala Asp Ala Lys Glu Ile Pro Arg Ile Phe Gln Ile Leu Tyr 1220 1225 1230 Ala Asn Glu Gly Glu Ser Lys Lys Glu Gln Glu Phe Pro Val Glu Pro 1235 1240 1245 Val Gly Glu Lys Ser Asn Tyr Ile Cys His Lys Gly His Glu Phe Ile 1250 1255 1260 Pro Thr Leu Tyr His Phe Pro Thr Asn Cys Glu Ala Cys Met Lys Pro 1265 1270 1275 1280 Leu Trp His Met Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys 1285 1290 1295 His Ile Lys Cys His Lys Asp His Met Asp Lys Lys Glu Glu Ile Ile 1300 1305 1310 Ala Pro Cys Lys Val Tyr Tyr Asp Ile Ser Thr Ala Lys Asn Leu Leu 1315 1320 1325 Leu Leu Ala Asn Ser Thr Glu Glu Gln Gln Lys Trp Val Ser Arg Leu 1330 1335 1340 Val Lys Lys Ile Pro Lys Lys Pro Pro Ala Pro Asp Pro Phe Ala Arg 1345 1350 1355 1360 Ser Ser Pro Arg Thr Ser Met Lys Ile Gln Gln Asn Gln Ser Ile Arg 1365 1370 1375 Arg Pro Ser Arg Gln Leu Ala Pro Asn Lys Pro Ser 1380 1385 <210> SEQ ID NO 27 <211> LENGTH: 948 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 27 Met Ala Glu Ala Asn Asn Pro Ser Glu Gln Glu Leu Glu Ser Glu Pro 1 5 10 15 Arg Ser Trp Ser Leu Leu Glu Gln Leu Gly Leu Ala Gly Ala Asp Leu 20 25 30 Ala Ala Pro Gly Val Gln Gln Gln Leu Glu Leu Glu Arg Glu Arg Leu 35 40 45 Arg Arg Glu Ile Arg Lys Glu Leu Lys Leu Lys Glu Gly Ala Glu Asn 50 55 60 Leu Arg Arg Ala Thr Thr Asp Leu Gly Arg Ser Leu Gly Pro Val Glu 65 70 75 80 Leu Leu Leu Arg Gly Ser Ser Arg Arg Leu Asp Leu Leu His Gln Gln 85 90 95 Leu Gln Glu Leu His Ala His Val Val Leu Pro Asp Pro Ala Ala Thr 100 105 110 His Asp Gly Pro Gln Ser Pro Gly Ala Gly Gly Pro Thr Cys Ser Ala 115 120 125 Thr Asn Leu Ser Arg Val Ala Gly Leu Glu Lys Gln Leu Ala Ile Glu 130 135 140 Leu Lys Val Lys Gln Gly Ala Glu Asn Met Ile Gln Thr Tyr Ser Asn 145 150 155 160 Gly Ser Thr Lys Asp Arg Lys Leu Leu Leu Thr Ala Gln Gln Met Leu 165 170 175 Gln Asp Ser Lys Thr Lys Ile Asp Ile Ile Arg Met Gln Leu Arg Arg 180 185 190 Ala Leu Gln Ala Gly Gln Leu Glu Asn Gln Ala Ala Pro Asp Asp Thr 195 200 205 Gln Gly Ser Pro Asp Leu Gly Ala Val Glu Leu Arg Ile Glu Glu Leu 210 215 220 Arg His His Phe Arg Val Glu His Ala Val Ala Glu Gly Ala Lys Asn 225 230 235 240 Val Leu Arg Leu Leu Ser Ala Ala Lys Ala Pro Asp Arg Lys Ala Val 245 250 255 Ser Glu Ala Gln Glu Lys Leu Thr Glu Ser Asn Gln Lys Leu Gly Leu 260 265 270 Leu Arg Glu Ala Leu Glu Arg Arg Leu Gly Glu Leu Pro Ala Asp His 275 280 285 Pro Lys Gly Arg Leu Leu Arg Glu Glu Leu Ala Ala Ala Ser Ser Ala 290 295 300 Ala Phe Ser Thr Arg Leu Ala Gly Pro Phe Pro Ala Thr His Tyr Ser 305 310 315 320 Thr Leu Cys Lys Pro Ala Pro Leu Thr Gly Thr Leu Glu Val Arg Val 325 330 335 Val Gly Cys Arg Asp Leu Pro Glu Thr Ile Pro Trp Asn Pro Thr Pro 340 345 350 Ser Met Gly Gly Pro Gly Thr Pro Asp Ser Arg Pro Pro Phe Leu Ser 355 360 365 Arg Pro Ala Arg Gly Leu Tyr Ser Arg Ser Gly Ser Leu Ser Gly Arg 370 375 380 Ser Ser Leu Lys Ala Glu Ala Glu Asn Thr Ser Glu Val Ser Thr Val 385 390 395 400 Leu Lys Leu Asp Asn Thr Val Val Gly Gln Thr Ser Trp Lys Pro Cys 405 410 415 Gly Pro Asn Ala Trp Asp Gln Ser Phe Thr Leu Glu Leu Glu Arg Ala 420 425 430 Arg Glu Leu Glu Leu Ala Val Phe Trp Arg Asp Gln Arg Gly Leu Cys 435 440 445 Ala Leu Lys Phe Leu Lys Leu Glu Asp Phe Leu Asp Asn Glu Arg His 450 455 460 Glu Val Gln Leu Asp Met Glu Pro Gln Gly Cys Leu Val Ala Glu Val 465 470 475 480 Thr Phe Arg Asn Pro Val Ile Glu Arg Ile Pro Arg Leu Arg Arg Gln 485 490 495 Lys Lys Ile Phe Ser Lys Gln Gln Gly Lys Ala Phe Gln Arg Ala Arg 500 505 510 Gln Met Asn Ile Asp Val Ala Thr Trp Val Arg Leu Leu Arg Arg Leu 515 520 525 Ile Pro Asn Ala Thr Gly Thr Gly Thr Phe Ser Pro Gly Ala Ser Pro 530 535 540 Gly Ser Glu Ala Arg Thr Thr Gly Asp Ile Ser Val Glu Lys Leu Asn 545 550 555 560 Leu Gly Thr Asp Ser Asp Ser Ser Pro Gln Lys Ser Ser Arg Asp Pro 565 570 575 Pro Ser Ser Pro Ser Ser Leu Ser Ser Pro Ile Gln Glu Ser Thr Ala 580 585 590 Pro Glu Leu Pro Ser Glu Thr Gln Glu Thr Pro Gly Pro Ala Leu Cys 595 600 605 Ser Pro Leu Arg Lys Ser Pro Leu Thr Leu Glu Asp Phe Lys Phe Leu 610 615 620 Ala Val Leu Gly Arg Gly His Phe Gly Lys Val Leu Leu Ser Glu Phe 625 630 635 640 Arg Pro Ser Gly Glu Leu Phe Ala Ile Lys Ala Leu Lys Lys Gly Asp 645 650 655 Ile Val Ala Arg Asp Glu Val Glu Ser Leu Met Cys Glu Lys Arg Ile 660 665 670 Leu Ala Ala Val Thr Ser Ala Gly His Pro Phe Leu Val Asn Leu Phe 675 680 685 Gly Cys Phe Gln Thr Pro Glu His Val Cys Phe Val Met Glu Tyr Ser 690 695 700 Ala Gly Gly Asp Leu Met Leu His Ile His Ser Asp Val Phe Ser Glu 705 710 715 720 Pro Arg Ala Ile Phe Tyr Ser Ala Cys Val Val Leu Gly Leu Gln Phe 725 730 735 Leu His Glu His Lys Ile Val Tyr Arg Asp Leu Lys Leu Asp Asn Leu 740 745 750 Leu Leu Asp Thr Glu Gly Tyr Val Lys Ile Ala Asp Phe Gly Leu Cys 755 760 765 Lys Glu Gly Met Gly Tyr Gly Asp Arg Thr Ser Thr Phe Cys Gly Thr 770 775 780 Pro Glu Phe Leu Ala Pro Glu Val Leu Thr Asp Thr Ser Tyr Thr Arg 785 790 795 800 Ala Val Asp Trp Trp Gly Leu Gly Val Leu Leu Tyr Glu Met Leu Val 805 810 815 Gly Glu Ser Pro Phe Pro Gly Asp Asp Glu Glu Glu Val Phe Asp Ser 820 825 830 Ile Val Asn Asp Glu Val Arg Tyr Pro Arg Phe Leu Ser Ala Glu Ala 835 840 845 Ile Gly Ile Met Arg Arg Leu Leu Arg Arg Asn Pro Glu Arg Arg Leu 850 855 860 Gly Ser Ser Glu Arg Asp Ala Glu Asp Val Lys Lys Gln Pro Phe Phe 865 870 875 880 Arg Thr Leu Gly Trp Glu Ala Leu Leu Ala Arg Arg Leu Pro Pro Pro 885 890 895 Phe Val Pro Thr Leu Ser Gly Arg Thr Asp Val Ser Asn Phe Asp Glu 900 905 910 Glu Phe Thr Gly Glu Ala Pro Thr Leu Ser Pro Pro Arg Asp Ala Arg 915 920 925 Pro Leu Thr Ala Ala Glu Gln Ala Ala Phe Leu Asp Phe Asp Phe Val 930 935 940 Ala Gly Gly Cys 945 <210> SEQ ID NO 28 <211> LENGTH: 984 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 28 Met Ala Ser Asn Pro Glu Arg Gly Glu Ile Leu Leu Thr Glu Leu Gln 1 5 10 15 Gly Asp Ser Arg Ser Leu Pro Phe Ser Glu Asn Val Ser Ala Val Gln 20 25 30 Lys Leu Asp Phe Ser Asp Thr Met Val Gln Gln Lys Leu Asp Asp Ile 35 40 45 Lys Asp Arg Ile Lys Arg Glu Ile Arg Lys Glu Leu Lys Ile Lys Glu 50 55 60 Gly Ala Glu Asn Leu Arg Lys Val Thr Thr Asp Lys Lys Ser Leu Ala 65 70 75 80 Tyr Val Asp Asn Ile Leu Lys Lys Ser Asn Lys Lys Leu Glu Glu Leu 85 90 95 His His Lys Leu Gln Glu Leu Asn Ala His Ile Val Val Ser Asp Pro 100 105 110 Glu Asp Ile Thr Asp Cys Pro Arg Thr Pro Asp Thr Pro Asn Asn Asp 115 120 125 Pro Arg Cys Ser Thr Ser Asn Asn Arg Leu Lys Ala Leu Gln Lys Gln 130 135 140 Leu Asp Ile Glu Leu Lys Val Lys Gln Gly Ala Glu Asn Met Ile Gln 145 150 155 160 Met Tyr Ser Asn Gly Ser Ser Lys Asp Arg Lys Leu His Gly Thr Ala 165 170 175 Gln Gln Leu Leu Gln Asp Ser Lys Thr Lys Ile Glu Val Ile Arg Met 180 185 190 Gln Ile Leu Gln Ala Val Gln Thr Asn Glu Leu Ala Phe Asp Asn Ala 195 200 205 Lys Pro Val Ile Ser Pro Leu Glu Leu Arg Met Glu Glu Leu Arg His 210 215 220 His Phe Arg Ile Glu Phe Ala Val Ala Glu Gly Ala Lys Asn Val Met 225 230 235 240 Lys Leu Leu Gly Ser Gly Lys Val Thr Asp Arg Lys Ala Leu Ser Glu 245 250 255 Ala Gln Ala Arg Phe Asn Glu Ser Ser Gln Lys Leu Asp Leu Leu Lys 260 265 270 Tyr Ser Leu Glu Gln Arg Leu Asn Glu Val Pro Lys Asn His Pro Lys 275 280 285 Ser Arg Ile Ile Ile Glu Glu Leu Ser Leu Val Ala Ala Ser Pro Thr 290 295 300 Leu Ser Pro Arg Gln Ser Met Ile Ser Thr Gln Asn Gln Tyr Ser Thr 305 310 315 320 Leu Ser Lys Pro Ala Ala Leu Thr Gly Thr Leu Glu Val Arg Leu Met 325 330 335 Gly Cys Gln Asp Ile Leu Glu Asn Val Pro Gly Arg Ser Lys Ala Thr 340 345 350 Ser Val Ala Leu Pro Gly Trp Ser Pro Ser Glu Thr Arg Ser Ser Phe 355 360 365 Met Ser Arg Thr Ser Lys Ser Lys Ser Gly Ser Ser Arg Asn Leu Leu 370 375 380 Lys Thr Asp Asp Leu Ser Asn Asp Val Cys Ala Val Leu Lys Leu Asp 385 390 395 400 Asn Thr Val Val Gly Gln Thr Ser Trp Lys Pro Ile Ser Asn Gln Ser 405 410 415 Trp Asp Gln Lys Phe Thr Leu Glu Leu Asp Arg Ser Arg Glu Leu Glu 420 425 430 Ile Ser Val Tyr Trp Arg Asp Trp Arg Ser Leu Cys Ala Val Lys Phe 435 440 445 Leu Arg Leu Glu Asp Phe Leu Asp Asn Gln Arg His Gly Met Cys Leu 450 455 460 Tyr Leu Glu Pro Gln Gly Thr Leu Phe Ala Glu Val Thr Phe Phe Asn 465 470 475 480 Pro Val Ile Glu Arg Arg Pro Lys Leu Gln Arg Gln Lys Lys Ile Phe 485 490 495 Ser Lys Gln Gln Gly Lys Thr Phe Leu Arg Ala Pro Gln Met Asn Ile 500 505 510 Asn Ile Ala Thr Trp Gly Arg Leu Val Arg Arg Ala Ile Pro Thr Val 515 520 525 Asn His Ser Gly Thr Phe Ser Pro Gln Ala Pro Val Pro Thr Thr Val 530 535 540 Pro Val Val Asp Val Arg Ile Pro Gln Leu Ala Pro Pro Ala Ser Asp 545 550 555 560 Ser Thr Val Thr Lys Leu Asp Phe Asp Leu Glu Pro Glu Pro Pro Pro 565 570 575 Ala Pro Pro Arg Ala Ser Ser Leu Gly Glu Ile Asp Glu Ser Ser Glu 580 585 590 Leu Arg Val Leu Asp Ile Pro Gly Gln Asp Ser Glu Thr Val Phe Asp 595 600 605 Ile Gln Asn Asp Arg Asn Ser Ile Leu Pro Lys Ser Gln Ser Glu Tyr 610 615 620 Lys Pro Asp Thr Pro Gln Ser Gly Leu Glu Tyr Ser Gly Ile Gln Glu 625 630 635 640 Leu Glu Asp Arg Arg Ser Gln Gln Arg Phe Gln Phe Asn Leu Gln Asp 645 650 655 Phe Arg Cys Cys Ala Val Leu Gly Arg Gly His Phe Gly Lys Val Leu 660 665 670 Leu Ala Glu Tyr Lys Asn Thr Asn Glu Met Phe Ala Ile Lys Ala Leu 675 680 685 Lys Lys Gly Asp Ile Val Ala Arg Asp Glu Val Asp Ser Leu Met Cys 690 695 700 Glu Lys Arg Ile Phe Glu Thr Val Asn Ser Val Arg His Pro Phe Leu 705 710 715 720 Val Asn Leu Phe Ala Cys Phe Gln Thr Lys Glu His Val Cys Phe Val 725 730 735 Met Glu Tyr Ala Ala Gly Gly Asp Leu Met Met His Ile His Thr Asp 740 745 750 Val Phe Ser Glu Pro Arg Ala Val Phe Tyr Ala Ala Cys Val Val Leu 755 760 765 Gly Leu Gln Tyr Leu His Glu His Lys Ile Val Tyr Arg Asp Leu Lys 770 775 780 Leu Asp Asn Leu Leu Leu Asp Thr Glu Gly Phe Val Lys Ile Ala Asp 785 790 795 800 Phe Gly Leu Cys Lys Glu Gly Met Gly Tyr Gly Asp Arg Thr Ser Thr 805 810 815 Phe Cys Gly Thr Pro Glu Phe Leu Ala Pro Glu Val Leu Thr Glu Thr 820 825 830 Ser Tyr Thr Arg Ala Val Asp Trp Trp Gly Leu Gly Val Leu Ile Tyr 835 840 845 Glu Met Leu Val Gly Glu Ser Pro Phe Pro Gly Asp Asp Glu Glu Glu 850 855 860 Val Phe Asp Ser Ile Val Asn Asp Glu Val Arg Tyr Pro Arg Phe Leu 865 870 875 880 Ser Thr Glu Ala Ile Ser Ile Met Arg Arg Leu Leu Arg Arg Asn Pro 885 890 895 Glu Arg Arg Leu Gly Ala Ser Glu Lys Asp Ala Glu Asp Val Lys Lys 900 905 910 His Pro Phe Phe Arg Leu Ile Asp Trp Ser Ala Leu Met Asp Lys Lys 915 920 925 Val Lys Pro Pro Phe Ile Pro Thr Ile Arg Gly Arg Glu Asp Val Ser 930 935 940 Asn Phe Asp Asp Glu Phe Thr Ser Glu Ala Pro Ile Leu Thr Pro Pro 945 950 955 960 Arg Glu Pro Arg Ile Leu Ser Glu Glu Glu Gln Glu Met Phe Arg Asp 965 970 975 Phe Asp Tyr Ile Ala Asp Trp Cys 980 <210> SEQ ID NO 29 <211> LENGTH: 686 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 29 Met Thr Asp Ala Leu Leu Pro Ala Ala Pro Gln Pro Leu Glu Lys Lys 1 5 10 15 Asn Asp Gly Tyr Phe Arg Lys Gly Cys Asn Pro Leu Ala Gln Thr Gly 20 25 30 Arg Ser Lys Leu Gln Asn Gln Arg Ala Ala Leu Asn Gln Gln Ile Leu 35 40 45 Lys Ala Val Arg Met Arg Thr Gly Ala Glu Asn Leu Leu Lys Val Ala 50 55 60 Thr Asn Ser Lys Val Arg Glu Gln Val Arg Leu Glu Leu Ser Phe Val 65 70 75 80 Asn Ser Asp Leu Gln Met Leu Lys Glu Glu Leu Glu Gly Leu Asn Ile 85 90 95 Ser Val Gly Val Tyr Gln Asn Thr Glu Glu Ala Phe Thr Ile Pro Leu 100 105 110 Ile Pro Leu Gly Leu Lys Glu Thr Lys Asp Val Asp Phe Ala Val Val 115 120 125 Leu Lys Asp Phe Ile Leu Glu His Tyr Ser Glu Asp Gly Tyr Leu Tyr 130 135 140 Glu Asp Glu Ile Ala Asp Leu Met Asp Leu Arg Gln Ala Cys Arg Thr 145 150 155 160 Pro Ser Arg Asp Glu Ala Gly Val Glu Leu Leu Met Thr Tyr Phe Ile 165 170 175 Gln Leu Gly Phe Val Glu Ser Arg Phe Phe Pro Pro Thr Arg Gln Met 180 185 190 Gly Leu Leu Phe Thr Trp Tyr Asp Ser Leu Thr Gly Val Pro Val Ser 195 200 205 Gln Gln Asn Leu Leu Leu Glu Lys Ala Ser Val Leu Phe Asn Thr Gly 210 215 220 Ala Leu Tyr Thr Gln Ile Gly Thr Arg Cys Asp Arg Gln Thr Gln Ala 225 230 235 240 Gly Leu Glu Ser Ala Ile Asp Ala Phe Gln Arg Ala Ala Gly Val Leu 245 250 255 Asn Tyr Leu Lys Asp Thr Phe Thr His Thr Pro Ser Tyr Asp Met Ser 260 265 270 Pro Ala Met Leu Ser Val Leu Val Lys Met Met Leu Ala Gln Ala Gln 275 280 285 Glu Ser Val Phe Glu Lys Ile Ser Leu Pro Gly Ile Arg Asn Glu Phe 290 295 300 Phe Met Leu Val Lys Val Ala Gln Glu Ala Ala Lys Val Gly Glu Val 305 310 315 320 Tyr Gln Gln Leu His Ala Ala Met Ser Gln Ala Pro Val Lys Glu Asn 325 330 335 Ile Pro Tyr Ser Trp Ala Ser Leu Ala Cys Val Lys Ala His His Tyr 340 345 350 Ala Ala Leu Ala His Tyr Phe Thr Ala Ile Leu Leu Ile Asp His Gln 355 360 365 Val Lys Pro Gly Thr Asp Leu Asp His Gln Glu Lys Cys Leu Ser Gln 370 375 380 Leu Tyr Asp His Met Pro Glu Gly Leu Thr Pro Leu Ala Thr Leu Lys 385 390 395 400 Asn Asp Gln Gln Arg Arg Gln Leu Gly Lys Ser His Leu Arg Arg Ala 405 410 415 Met Ala His His Glu Glu Ser Val Arg Glu Ala Ser Leu Cys Lys Lys 420 425 430 Leu Arg Ser Ile Glu Val Leu Gln Lys Val Leu Cys Ala Ala Gln Glu 435 440 445 Arg Ser Arg Leu Thr Tyr Ala Gln His Gln Glu Glu Asp Asp Leu Leu 450 455 460 Asn Leu Ile Asp Ala Pro Ser Val Val Ala Lys Thr Glu Gln Glu Val 465 470 475 480 Asp Ile Ile Leu Pro Gln Phe Ser Lys Leu Thr Val Thr Asp Phe Phe 485 490 495 Gln Lys Leu Gly Pro Leu Ser Val Phe Ser Ala Asn Lys Arg Trp Thr 500 505 510 Pro Pro Arg Ser Ile Arg Phe Thr Ala Glu Glu Gly Asp Leu Gly Phe 515 520 525 Thr Leu Arg Gly Asn Ala Pro Val Gln Val His Phe Leu Asp Pro Tyr 530 535 540 Cys Ser Ala Ser Val Ala Gly Ala Arg Glu Gly Asp Tyr Ile Val Ser 545 550 555 560 Ile Gln Leu Val Asp Cys Lys Trp Leu Thr Leu Ser Glu Val Met Lys 565 570 575 Leu Leu Lys Ser Phe Gly Glu Asp Glu Ile Glu Met Lys Val Val Ser 580 585 590 Leu Leu Asp Ser Thr Ser Ser Met His Asn Lys Ser Ala Thr Tyr Ser 595 600 605 Val Gly Met Gln Lys Thr Tyr Ser Met Ile Cys Leu Ala Ile Asp Asp 610 615 620 Asp Asp Lys Thr Asp Lys Thr Lys Lys Ile Ser Lys Lys Leu Ser Phe 625 630 635 640 Leu Ser Trp Gly Thr Asn Lys Asn Arg Gln Lys Ser Ala Ser Thr Leu 645 650 655 Cys Leu Pro Ser Val Gly Ala Ala Arg Pro Gln Val Lys Lys Lys Leu 660 665 670 Pro Ser Pro Phe Ser Leu Leu Asn Ser Asp Ser Ser Trp Tyr 675 680 685 <210> SEQ ID NO 30 <211> LENGTH: 550 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 30 Met Gln Asp Arg Leu His Ile Leu Glu Asp Leu Asn Met Leu Tyr Ile 1 5 10 15 Arg Gln Met Ala Leu Ser Leu Glu Asp Thr Glu Leu Gln Arg Lys Leu 20 25 30 Asp His Glu Ile Arg Met Arg Glu Gly Ala Cys Lys Leu Leu Ala Ala 35 40 45 Cys Ser Gln Arg Glu Gln Ala Leu Glu Ala Thr Lys Ser Leu Leu Val 50 55 60 Cys Asn Ser Arg Ile Leu Ser Tyr Met Gly Glu Leu Gln Arg Arg Lys 65 70 75 80 Glu Ala Gln Val Leu Gly Lys Thr Ser Arg Arg Pro Ser Asp Ser Gly 85 90 95 Pro Pro Ala Glu Arg Ser Pro Cys Arg Gly Arg Val Cys Ile Ser Asp 100 105 110 Leu Arg Ile Pro Leu Met Trp Lys Asp Thr Glu Tyr Phe Lys Asn Lys 115 120 125 Gly Asp Leu His Arg Trp Ala Val Phe Leu Leu Leu Gln Leu Gly Glu 130 135 140 His Ile Gln Asp Thr Glu Met Ile Leu Val Asp Arg Thr Leu Thr Asp 145 150 155 160 Ile Ser Phe Gln Ser Asn Val Leu Phe Ala Glu Ala Gly Pro Asp Phe 165 170 175 Glu Leu Arg Leu Glu Leu Tyr Gly Ala Cys Val Glu Glu Glu Gly Ala 180 185 190 Leu Thr Gly Gly Pro Lys Arg Leu Ala Thr Lys Leu Ser Ser Ser Leu 195 200 205 Gly Arg Ser Ser Gly Arg Arg Val Arg Ala Ser Leu Asp Ser Ala Gly 210 215 220 Gly Ser Gly Ser Ser Pro Ile Leu Leu Pro Thr Pro Val Val Gly Gly 225 230 235 240 Pro Arg Tyr His Leu Leu Ala His Thr Thr Leu Thr Leu Ala Ala Val 245 250 255 Gln Asp Gly Phe Arg Thr His Asp Leu Thr Leu Ala Ser His Glu Glu 260 265 270 Asn Pro Ala Trp Leu Pro Leu Tyr Gly Ser Val Cys Cys Arg Leu Ala 275 280 285 Ala Gln Pro Leu Cys Met Thr Gln Pro Thr Ala Ser Gly Thr Leu Arg 290 295 300 Val Gln Gln Ala Gly Glu Met Gln Asn Trp Ala Gln Val His Gly Val 305 310 315 320 Leu Lys Gly Thr Asn Leu Phe Cys Tyr Arg Gln Pro Glu Asp Ala Asp 325 330 335 Thr Gly Glu Glu Pro Leu Leu Thr Ile Ala Val Asn Lys Glu Thr Arg 340 345 350 Val Arg Ala Gly Glu Leu Asp Gln Ala Leu Gly Arg Pro Phe Thr Leu 355 360 365 Ser Ile Ser Asn Gln Tyr Gly Asp Asp Glu Val Thr His Thr Leu Gln 370 375 380 Thr Glu Ser Arg Glu Ala Leu Gln Ser Trp Met Glu Ala Leu Trp Gln 385 390 395 400 Leu Phe Phe Asp Met Ser Gln Trp Lys Gln Cys Cys Asp Glu Ile Met 405 410 415 Lys Ile Glu Thr Pro Ala Pro Arg Lys Pro Pro Gln Ala Leu Ala Lys 420 425 430 Gln Gly Ser Leu Tyr His Glu Met Ala Ile Glu Pro Leu Asp Asp Ile 435 440 445 Ala Ala Val Thr Asp Ile Leu Thr Gln Arg Glu Gly Ala Arg Leu Glu 450 455 460 Thr Pro Pro Pro Trp Leu Ala Met Phe Thr Asp Gln Pro Ala Leu Pro 465 470 475 480 Asn Pro Cys Ser Pro Ala Ser Val Ala Pro Ala Pro Asp Trp Thr His 485 490 495 Pro Leu Pro Trp Gly Arg Pro Arg Thr Phe Ser Leu Asp Ala Val Pro 500 505 510 Pro Asp His Ser Pro Arg Ala Arg Ser Val Ala Pro Leu Pro Pro Gln 515 520 525 Arg Ser Pro Arg Thr Arg Gly Leu Cys Ser Lys Gly Gln Pro Arg Thr 530 535 540 Trp Leu Gln Ser Pro Val 545 550 <210> SEQ ID NO 31 <211> LENGTH: 942 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 31 Met Ala Ala Ala Ala Glu Pro Gly Ala Arg Ala Trp Leu Gly Gly Gly 1 5 10 15 Ser Pro Arg Pro Gly Ser Pro Ala Cys Ser Pro Val Leu Gly Ser Gly 20 25 30 Gly Arg Ala Arg Pro Gly Pro Gly Pro Gly Pro Gly Pro Glu Arg Ala 35 40 45 Gly Val Arg Ala Pro Gly Pro Ala Ala Ala Pro Gly His Ser Phe Arg 50 55 60 Lys Val Thr Leu Thr Lys Pro Thr Phe Cys His Leu Cys Ser Asp Phe 65 70 75 80 Ile Trp Gly Leu Ala Gly Phe Leu Cys Asp Val Cys Asn Phe Met Ser 85 90 95 His Glu Lys Cys Leu Lys His Val Arg Ile Pro Cys Thr Ser Val Ala 100 105 110 Pro Ser Leu Val Arg Val Pro Val Ala His Cys Phe Gly Pro Arg Gly 115 120 125 Leu His Lys Arg Lys Phe Cys Ala Val Cys Arg Lys Val Leu Glu Ala 130 135 140 Pro Ala Leu His Cys Glu Val Cys Glu Leu His Leu His Pro Asp Cys 145 150 155 160 Val Pro Phe Ala Cys Ser Asp Cys Arg Gln Cys His Gln Asp Gly His 165 170 175 Gln Asp His Asp Thr His His His His Trp Arg Glu Gly Asn Leu Pro 180 185 190 Ser Gly Ala Arg Cys Glu Val Cys Arg Lys Thr Cys Gly Ser Ser Asp 195 200 205 Val Leu Ala Gly Val Arg Cys Glu Trp Cys Gly Val Gln Ala His Ser 210 215 220 Leu Cys Ser Ala Ala Leu Ala Pro Glu Cys Gly Phe Gly Arg Leu Arg 225 230 235 240 Ser Leu Val Leu Pro Pro Ala Cys Val Arg Leu Leu Pro Gly Gly Phe 245 250 255 Ser Lys Thr Gln Ser Phe Arg Ile Val Glu Ala Ala Glu Pro Gly Glu 260 265 270 Gly Gly Asp Gly Ala Asp Gly Ser Ala Ala Val Gly Pro Gly Arg Glu 275 280 285 Thr Gln Ala Thr Pro Glu Ser Gly Lys Gln Thr Leu Lys Ile Phe Asp 290 295 300 Gly Asp Asp Ala Val Arg Arg Ser Gln Phe Arg Leu Val Thr Val Ser 305 310 315 320 Arg Leu Ala Gly Ala Glu Glu Val Leu Glu Ala Ala Leu Arg Ala His 325 330 335 His Ile Pro Glu Asp Pro Gly His Leu Glu Leu Cys Arg Leu Pro Pro 340 345 350 Ser Ser Gln Ala Cys Asp Ala Trp Ala Gly Gly Lys Ala Gly Ser Ala 355 360 365 Val Ile Ser Glu Glu Gly Arg Ser Pro Gly Ser Gly Glu Ala Thr Pro 370 375 380 Glu Ala Trp Val Ile Arg Ala Leu Pro Arg Ala Gln Glu Val Leu Lys 385 390 395 400 Ile Tyr Pro Gly Trp Leu Lys Val Gly Val Ala Tyr Val Ser Val Arg 405 410 415 Val Thr Pro Lys Ser Thr Ala Arg Ser Val Val Leu Glu Val Leu Pro 420 425 430 Leu Leu Gly Arg Gln Ala Glu Ser Pro Glu Ser Phe Gln Leu Val Glu 435 440 445 Val Ala Met Gly Cys Arg His Val Gln Arg Thr Met Leu Met Asp Glu 450 455 460 Gln Pro Leu Leu Asp Arg Leu Gln Asp Ile Arg Gln Met Ser Val Arg 465 470 475 480 Gln Val Ser Gln Thr Arg Phe Tyr Val Ala Glu Ser Arg Asp Val Ala 485 490 495 Pro His Val Ser Leu Phe Val Gly Gly Leu Pro Pro Gly Leu Ser Pro 500 505 510 Glu Glu Tyr Ser Ser Leu Leu His Glu Ala Gly Ala Thr Lys Ala Thr 515 520 525 Val Val Ser Val Ser His Ile Tyr Ser Ser Gln Gly Ala Val Val Leu 530 535 540 Asp Val Ala Cys Phe Ala Glu Ala Glu Arg Leu Tyr Met Leu Leu Lys 545 550 555 560 Asp Met Ala Val Arg Gly Arg Leu Leu Thr Ala Leu Val Leu Pro Asp 565 570 575 Leu Leu His Ala Lys Leu Pro Pro Asp Ser Cys Pro Leu Leu Val Phe 580 585 590 Val Asn Pro Lys Ser Gly Gly Leu Lys Gly Arg Asp Leu Leu Cys Ser 595 600 605 Phe Arg Lys Leu Leu Asn Pro His Gln Val Phe Asp Leu Thr Asn Gly 610 615 620 Gly Pro Leu Pro Gly Leu His Leu Phe Ser Gln Val Pro Cys Phe Arg 625 630 635 640 Val Leu Val Cys Gly Gly Asp Gly Thr Val Gly Trp Val Leu Gly Ala 645 650 655 Leu Glu Glu Thr Arg Tyr Arg Leu Ala Cys Pro Glu Pro Ser Val Ala 660 665 670 Ile Leu Pro Leu Gly Thr Gly Asn Asp Leu Gly Arg Val Leu Arg Trp 675 680 685 Gly Ala Gly Tyr Ser Gly Glu Asp Pro Phe Ser Val Leu Leu Ser Val 690 695 700 Asp Glu Ala Asp Ala Val Leu Met Asp Arg Trp Thr Ile Leu Leu Asp 705 710 715 720 Ala His Glu Ala Gly Ser Ala Glu Asn Asp Thr Ala Asp Ala Glu Pro 725 730 735 Pro Lys Ile Val Gln Met Ser Asn Tyr Cys Gly Ile Gly Ile Asp Ala 740 745 750 Glu Leu Ser Leu Asp Phe His Gln Ala Arg Glu Glu Glu Pro Gly Lys 755 760 765 Phe Thr Ser Arg Leu His Asn Lys Gly Val Tyr Val Arg Val Gly Leu 770 775 780 Gln Lys Ile Ser His Ser Arg Ser Leu His Lys Gln Ile Arg Leu Gln 785 790 795 800 Val Glu Arg Gln Glu Val Glu Leu Pro Ser Ile Glu Gly Leu Ile Phe 805 810 815 Ile Asn Ile Pro Ser Trp Gly Ser Gly Ala Asp Leu Trp Gly Ser Asp 820 825 830 Ser Asp Thr Arg Phe Glu Lys Pro Arg Met Asp Asp Gly Leu Leu Glu 835 840 845 Val Val Gly Val Thr Gly Val Val His Met Gly Gln Val Gln Gly Gly 850 855 860 Leu Arg Ser Gly Ile Arg Ile Ala Gln Gly Ser Tyr Phe Arg Val Thr 865 870 875 880 Leu Leu Lys Ala Thr Pro Val Gln Val Asp Gly Glu Pro Trp Val Gln 885 890 895 Ala Pro Gly His Met Ile Ile Ser Ala Ala Gly Pro Lys Val His Met 900 905 910 Leu Arg Lys Ala Lys Gln Lys Pro Arg Arg Ala Gly Thr Thr Arg Asp 915 920 925 Ala Arg Ala Asp Ala Ala Pro Ala Pro Glu Ser Asp Pro Arg 930 935 940 <210> SEQ ID NO 32 <211> LENGTH: 1357 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 32 Met Glu Phe Tyr Glu Ser Ala Tyr Phe Ile Val Leu Ile Pro Ser Ile 1 5 10 15 Val Ile Thr Val Ile Phe Leu Phe Phe Trp Leu Phe Met Lys Glu Thr 20 25 30 Leu Tyr Asp Glu Val Leu Ala Lys Gln Lys Arg Glu Gln Lys Leu Ile 35 40 45 Pro Thr Lys Thr Asp Lys Lys Lys Ala Glu Lys Lys Lys Asn Lys Lys 50 55 60 Lys Glu Ile Gln Asn Gly Asn Leu His Glu Ser Asp Ser Glu Ser Val 65 70 75 80 Pro Arg Asp Phe Lys Leu Ser Asp Ala Leu Ala Val Glu Asp Asp Gln 85 90 95 Val Ala Pro Val Pro Leu Asn Val Val Glu Thr Ser Ser Ser Val Arg 100 105 110 Glu Arg Lys Lys Lys Glu Lys Lys Gln Lys Pro Val Leu Glu Glu Gln 115 120 125 Val Ile Lys Glu Ser Asp Ala Ser Lys Ile Pro Gly Lys Lys Val Glu 130 135 140 Pro Val Pro Val Thr Lys Gln Pro Thr Pro Pro Ser Glu Ala Ala Ala 145 150 155 160 Ser Lys Lys Lys Pro Gly Gln Lys Lys Ser Lys Asn Gly Ser Asp Asp 165 170 175 Gln Asp Lys Lys Val Glu Thr Leu Met Val Pro Ser Lys Arg Gln Glu 180 185 190 Ala Leu Pro Leu His Gln Glu Thr Lys Gln Glu Ser Gly Ser Gly Lys 195 200 205 Lys Lys Ala Ser Ser Lys Lys Gln Lys Thr Glu Asn Val Phe Val Asp 210 215 220 Glu Pro Leu Ile His Ala Thr Thr Tyr Ile Pro Leu Met Asp Asn Ala 225 230 235 240 Asp Ser Ser Pro Val Val Asp Lys Arg Glu Val Ile Asp Leu Leu Lys 245 250 255 Pro Asp Gln Val Glu Gly Ile Gln Lys Ser Gly Thr Lys Lys Leu Lys 260 265 270 Thr Glu Thr Asp Lys Glu Asn Ala Glu Val Lys Phe Lys Asp Phe Leu 275 280 285 Leu Ser Leu Lys Thr Met Met Phe Ser Glu Asp Glu Ala Leu Cys Val 290 295 300 Val Asp Leu Leu Lys Glu Lys Ser Gly Val Ile Gln Asp Ala Leu Lys 305 310 315 320 Lys Ser Ser Lys Gly Glu Leu Thr Thr Leu Ile His Gln Leu Gln Glu 325 330 335 Lys Asp Lys Leu Leu Ala Ala Val Lys Glu Asp Ala Ala Ala Thr Lys 340 345 350 Asp Arg Cys Lys Gln Leu Thr Gln Glu Met Met Thr Glu Lys Glu Arg 355 360 365 Ser Asn Val Val Ile Thr Arg Met Lys Asp Arg Ile Gly Thr Leu Glu 370 375 380 Lys Glu His Asn Val Phe Gln Asn Lys Ile His Val Ser Tyr Gln Glu 385 390 395 400 Thr Gln Gln Met Gln Met Lys Phe Gln Gln Val Arg Glu Gln Met Glu 405 410 415 Ala Glu Ile Ala His Leu Lys Gln Glu Asn Gly Ile Leu Arg Asp Ala 420 425 430 Val Ser Asn Thr Thr Asn Gln Leu Glu Ser Lys Gln Ser Ala Glu Leu 435 440 445 Asn Lys Leu Arg Gln Asp Tyr Ala Arg Leu Val Asn Glu Leu Thr Glu 450 455 460 Lys Thr Gly Lys Leu Gln Gln Glu Glu Val Gln Lys Lys Asn Ala Glu 465 470 475 480 Gln Ala Ala Thr Gln Leu Lys Val Gln Leu Gln Glu Ala Glu Arg Arg 485 490 495 Trp Glu Glu Val Gln Ser Tyr Ile Arg Lys Arg Thr Ala Glu His Glu 500 505 510 Ala Ala Gln Gln Asp Leu Gln Ser Lys Phe Val Ala Lys Glu Asn Glu 515 520 525 Val Gln Ser Leu His Ser Lys Leu Thr Asp Thr Leu Val Ser Lys Gln 530 535 540 Gln Leu Glu Gln Arg Leu Met Gln Leu Met Glu Ser Glu Gln Lys Arg 545 550 555 560 Val Asn Lys Glu Glu Ser Leu Gln Met Gln Val Gln Asp Ile Leu Glu 565 570 575 Gln Asn Glu Ala Leu Lys Ala Gln Ile Gln Gln Phe His Ser Gln Ile 580 585 590 Ala Ala Gln Thr Ser Ala Ser Val Leu Ala Glu Glu Leu His Lys Val 595 600 605 Ile Ala Glu Lys Asp Lys Gln Ile Lys Gln Thr Glu Asp Ser Leu Ala 610 615 620 Ser Glu Arg Asp Arg Leu Thr Ser Lys Glu Glu Glu Leu Lys Asp Ile 625 630 635 640 Gln Asn Met Asn Phe Leu Leu Lys Ala Glu Val Gln Lys Leu Gln Ala 645 650 655 Leu Ala Asn Glu Gln Ala Ala Ala Ala His Glu Leu Glu Lys Met Gln 660 665 670 Gln Ser Val Tyr Val Lys Asp Asp Lys Ile Arg Leu Leu Glu Glu Gln 675 680 685 Leu Gln His Glu Ile Ser Asn Lys Met Glu Glu Phe Lys Ile Leu Asn 690 695 700 Asp Gln Asn Lys Ala Leu Lys Ser Glu Val Gln Lys Leu Gln Thr Leu 705 710 715 720 Val Ser Glu Gln Pro Asn Lys Asp Val Val Glu Gln Met Glu Lys Cys 725 730 735 Ile Gln Glu Lys Asp Glu Lys Leu Lys Thr Val Glu Glu Leu Leu Glu 740 745 750 Thr Gly Leu Ile Gln Val Ala Thr Lys Glu Glu Glu Leu Asn Ala Ile 755 760 765 Arg Thr Glu Asn Ser Ser Leu Thr Lys Glu Val Gln Asp Leu Lys Ala 770 775 780 Lys Gln Asn Asp Gln Val Ser Phe Ala Ser Leu Val Glu Glu Leu Lys 785 790 795 800 Lys Val Ile His Glu Lys Asp Gly Lys Ile Lys Ser Val Glu Glu Leu 805 810 815 Leu Glu Ala Glu Leu Leu Lys Val Ala Asn Lys Glu Lys Thr Val Gln 820 825 830 Asp Leu Lys Gln Glu Ile Lys Ala Leu Lys Glu Glu Ile Gly Asn Val 835 840 845 Gln Leu Glu Lys Ala Gln Gln Leu Ser Ile Thr Ser Lys Val Gln Glu 850 855 860 Leu Gln Asn Leu Leu Lys Gly Lys Glu Glu Gln Met Asn Thr Met Lys 865 870 875 880 Ala Val Leu Glu Glu Lys Glu Lys Asp Leu Ala Asn Thr Gly Lys Trp 885 890 895 Leu Gln Asp Leu Gln Glu Glu Asn Glu Ser Leu Lys Ala His Val Gln 900 905 910 Glu Val Ala Gln His Asn Leu Lys Glu Ala Ser Ser Ala Ser Gln Phe 915 920 925 Glu Glu Leu Glu Ile Val Leu Lys Glu Lys Glu Asn Glu Leu Lys Arg 930 935 940 Leu Glu Ala Met Leu Lys Glu Arg Glu Ser Asp Leu Ser Ser Lys Thr 945 950 955 960 Gln Leu Leu Gln Asp Val Gln Asp Glu Asn Lys Leu Phe Lys Ser Gln 965 970 975 Ile Glu Gln Leu Lys Gln Gln Asn Tyr Gln Gln Ala Ser Ser Phe Pro 980 985 990 Pro His Glu Glu Leu Leu Lys Val Ile Ser Glu Arg Glu Lys Glu Ile 995 1000 1005 Ser Gly Leu Trp Asn Glu Leu Asp Ser Leu Lys Asp Ala Val Glu His 1010 1015 1020 Gln Arg Lys Lys Asn Asn Asp Leu Arg Glu Lys Asn Trp Glu Ala Met 1025 1030 1035 1040 Glu Ala Leu Ala Ser Thr Glu Lys Met Leu Gln Asp Lys Val Asn Lys 1045 1050 1055 Thr Ser Lys Glu Arg Gln Gln Gln Val Glu Ala Val Glu Leu Glu Ala 1060 1065 1070 Lys Glu Val Leu Lys Lys Leu Phe Pro Lys Val Ser Val Pro Ser Asn 1075 1080 1085 Leu Ser Tyr Gly Glu Trp Leu His Gly Phe Glu Lys Lys Ala Lys Glu 1090 1095 1100 Cys Met Ala Gly Thr Ser Gly Ser Glu Glu Val Lys Val Leu Glu His 1105 1110 1115 1120 Lys Leu Lys Glu Ala Asp Glu Met His Thr Leu Leu Gln Leu Glu Cys 1125 1130 1135 Glu Lys Tyr Lys Ser Val Leu Ala Glu Thr Glu Gly Ile Leu Gln Lys 1140 1145 1150 Leu Gln Arg Ser Val Glu Gln Glu Glu Asn Lys Trp Lys Val Lys Val 1155 1160 1165 Asp Glu Ser His Lys Thr Ile Lys Gln Met Gln Ser Ser Phe Thr Ser 1170 1175 1180 Ser Glu Gln Glu Leu Glu Arg Leu Arg Ser Glu Asn Lys Asp Ile Glu 1185 1190 1195 1200 Asn Leu Arg Arg Glu Arg Glu His Leu Glu Met Glu Leu Glu Lys Ala 1205 1210 1215 Glu Met Glu Arg Ser Thr Tyr Val Thr Glu Val Arg Glu Leu Lys Asp 1220 1225 1230 Leu Leu Thr Glu Leu Gln Lys Lys Leu Asp Asp Ser Tyr Ser Glu Ala 1235 1240 1245 Val Arg Gln Asn Glu Glu Leu Asn Leu Leu Lys Ala Gln Leu Asn Glu 1250 1255 1260 Thr Leu Thr Lys Leu Arg Thr Glu Gln Asn Glu Arg Gln Lys Val Ala 1265 1270 1275 1280 Gly Asp Leu His Lys Ala Gln Gln Ser Leu Glu Leu Ile Gln Ser Lys 1285 1290 1295 Ile Val Lys Ala Ala Gly Asp Thr Thr Val Ile Glu Asn Ser Asp Val 1300 1305 1310 Ser Pro Glu Thr Glu Ser Ser Glu Lys Glu Thr Met Ser Val Ser Leu 1315 1320 1325 Asn Gln Thr Val Thr Gln Leu Gln Gln Leu Leu Gln Ala Val Asn Gln 1330 1335 1340 Gln Leu Thr Lys Glu Lys Glu His Tyr Gln Val Leu Glu 1345 1350 1355 <210> SEQ ID NO 33 <211> LENGTH: 1248 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 33 Met Glu Pro Pro Gly Gly Ser Leu Gly Pro Gly Arg Gly Thr Arg Asp 1 5 10 15 Lys Lys Lys Gly Arg Ser Pro Asp Glu Leu Pro Ser Ala Gly Gly Asp 20 25 30 Gly Gly Lys Ser Lys Lys Phe Leu Glu Arg Phe Thr Ser Met Arg Ile 35 40 45 Lys Lys Glu Lys Glu Lys Pro Asn Ser Ala His Arg Asn Ser Ser Ala 50 55 60 Ser Tyr Gly Asp Asp Pro Thr Ala Gln Ser Leu Gln Asp Val Ser Asp 65 70 75 80 Glu Gln Val Leu Val Leu Phe Glu Gln Met Leu Leu Asp Met Asn Leu 85 90 95 Asn Glu Glu Lys Gln Gln Pro Leu Arg Glu Lys Asp Ile Ile Ile Lys 100 105 110 Arg Glu Met Val Ser Gln Tyr Leu Tyr Thr Ser Lys Ala Gly Met Ser 115 120 125 Gln Lys Glu Ser Ser Lys Ser Ala Met Met Tyr Ile Gln Glu Leu Arg 130 135 140 Ser Gly Leu Arg Asp Met Pro Leu Leu Ser Cys Leu Glu Ser Leu Arg 145 150 155 160 Val Ser Leu Asn Asn Asn Pro Val Ser Trp Val Gln Thr Phe Gly Ala 165 170 175 Glu Gly Leu Ala Ser Leu Leu Asp Ile Leu Lys Arg Leu His Asp Glu 180 185 190 Lys Glu Glu Thr Ala Gly Ser Tyr Asp Ser Arg Asn Lys His Glu Ile 195 200 205 Ile Arg Cys Leu Lys Ala Phe Met Asn Asn Lys Phe Gly Ile Lys Thr 210 215 220 Met Leu Glu Thr Glu Glu Gly Ile Leu Leu Leu Val Arg Ala Met Asp 225 230 235 240 Pro Ala Val Pro Asn Met Met Ile Asp Ala Ala Lys Leu Leu Ser Ala 245 250 255 Leu Cys Ile Leu Pro Gln Pro Glu Asp Met Asn Glu Arg Val Leu Glu 260 265 270 Ala Met Thr Glu Arg Ala Glu Met Asp Glu Val Glu Arg Phe Gln Pro 275 280 285 Leu Leu Asp Gly Leu Lys Ser Gly Thr Thr Ile Ala Leu Lys Val Gly 290 295 300 Cys Leu Gln Leu Ile Asn Ala Leu Ile Thr Pro Ala Glu Glu Leu Asp 305 310 315 320 Phe Arg Val His Ile Arg Ser Glu Leu Met Arg Leu Gly Leu His Gln 325 330 335 Val Leu Gln Asp Leu Arg Glu Ile Glu Asn Glu Asp Met Arg Val Gln 340 345 350 Leu Asn Val Phe Asp Glu Gln Gly Glu Glu Asp Ser Tyr Asp Leu Lys 355 360 365 Gly Arg Leu Asp Asp Ile Arg Met Glu Met Asp Asp Phe Asn Glu Val 370 375 380 Phe Gln Ile Leu Leu Asn Thr Val Lys Asp Ser Lys Ala Glu Pro His 385 390 395 400 Phe Leu Ser Ile Leu Gln His Leu Leu Leu Val Arg Asn Asp Tyr Glu 405 410 415 Ala Arg Pro Gln Tyr Tyr Lys Leu Ile Glu Glu Cys Ile Ser Gln Ile 420 425 430 Val Leu His Lys Asn Gly Ala Asp Pro Asp Phe Lys Cys Arg His Leu 435 440 445 Gln Ile Glu Ile Glu Gly Leu Ile Asp Gln Met Ile Asp Lys Thr Lys 450 455 460 Val Glu Lys Ser Glu Ala Lys Ala Ala Glu Leu Glu Lys Lys Leu Asp 465 470 475 480 Ser Glu Leu Thr Ala Arg His Glu Leu Gln Val Glu Met Lys Lys Met 485 490 495 Glu Ser Asp Phe Glu Gln Lys Leu Gln Asp Leu Gln Gly Glu Lys Asp 500 505 510 Ala Leu His Ser Glu Lys Gln Gln Ile Ala Thr Glu Lys Gln Asp Leu 515 520 525 Glu Ala Glu Val Ser Gln Leu Thr Gly Glu Val Ala Lys Leu Thr Lys 530 535 540 Glu Leu Glu Asp Ala Lys Lys Glu Met Ala Ser Leu Ser Ala Ala Ala 545 550 555 560 Ile Thr Val Pro Pro Ser Val Pro Ser Arg Ala Pro Val Pro Pro Ala 565 570 575 Pro Pro Leu Pro Gly Asp Ser Gly Thr Ile Ile Pro Pro Pro Pro Ala 580 585 590 Pro Gly Asp Ser Thr Thr Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro 595 600 605 Pro Pro Pro Leu Pro Gly Gly Thr Ala Ile Ser Pro Pro Pro Pro Leu 610 615 620 Ser Gly Asp Ala Thr Ile Pro Pro Pro Pro Pro Leu Pro Glu Gly Val 625 630 635 640 Gly Ile Pro Ser Pro Ser Ser Leu Pro Gly Gly Thr Ala Ile Pro Pro 645 650 655 Pro Pro Pro Leu Pro Gly Ser Ala Arg Ile Pro Pro Pro Pro Pro Pro 660 665 670 Leu Pro Gly Ser Ala Gly Ile Pro Pro Pro Pro Pro Pro Leu Pro Gly 675 680 685 Glu Ala Gly Met Pro Pro Pro Pro Pro Pro Leu Pro Gly Gly Pro Gly 690 695 700 Ile Pro Pro Pro Pro Pro Phe Pro Gly Gly Pro Gly Ile Pro Pro Pro 705 710 715 720 Pro Pro Gly Met Gly Met Pro Pro Pro Pro Pro Phe Gly Phe Gly Val 725 730 735 Pro Ala Ala Pro Val Leu Pro Phe Gly Leu Thr Pro Lys Lys Leu Tyr 740 745 750 Lys Pro Glu Val Gln Leu Arg Arg Pro Asn Trp Ser Lys Leu Val Ala 755 760 765 Glu Asp Leu Ser Gln Asp Cys Phe Trp Thr Lys Val Lys Glu Asp Arg 770 775 780 Phe Glu Asn Asn Glu Leu Phe Ala Lys Leu Thr Leu Thr Phe Ser Ala 785 790 795 800 Gln Thr Lys Thr Lys Lys Asp Gln Glu Gly Gly Glu Glu Lys Lys Ser 805 810 815 Val Gln Lys Lys Lys Val Lys Glu Leu Lys Val Leu Asp Ser Lys Thr 820 825 830 Ala Gln Asn Leu Ser Ile Phe Leu Gly Ser Phe Arg Met Pro Tyr Gln 835 840 845 Glu Ile Lys Asn Val Ile Leu Glu Val Asn Glu Ala Val Leu Thr Glu 850 855 860 Ser Met Ile Gln Asn Leu Ile Lys Gln Met Pro Glu Pro Glu Gln Leu 865 870 875 880 Lys Met Leu Ser Glu Leu Lys Asp Glu Tyr Asp Asp Leu Ala Glu Ser 885 890 895 Glu Gln Phe Gly Val Val Met Gly Thr Val Pro Arg Leu Arg Pro Arg 900 905 910 Leu Asn Ala Ile Leu Phe Lys Leu Gln Phe Ser Glu Gln Val Glu Asn 915 920 925 Ile Lys Pro Glu Ile Val Ser Val Thr Ala Ala Cys Glu Glu Leu Arg 930 935 940 Lys Ser Glu Ser Phe Ser Asn Leu Leu Glu Ile Thr Leu Leu Val Gly 945 950 955 960 Asn Tyr Met Asn Ala Gly Ser Arg Asn Ala Gly Ala Phe Gly Phe Asn 965 970 975 Ile Ser Phe Leu Cys Lys Leu Arg Asp Thr Lys Ser Thr Asp Gln Lys 980 985 990 Met Thr Leu Leu His Phe Leu Ala Glu Leu Cys Glu Asn Asp Tyr Pro 995 1000 1005 Asp Val Leu Lys Phe Pro Asp Glu Leu Ala His Val Glu Lys Ala Ser 1010 1015 1020 Arg Val Ser Ala Glu Asn Leu Gln Lys Asn Leu Asp Gln Met Lys Lys 1025 1030 1035 1040 Gln Ile Ser Asp Val Glu Arg Asp Val Gln Asn Phe Pro Ala Ala Thr 1045 1050 1055 Asp Glu Lys Asp Lys Phe Val Glu Lys Met Thr Ser Phe Val Lys Asp 1060 1065 1070 Ala Gln Glu Gln Tyr Asn Lys Leu Arg Met Met His Ser Asn Met Glu 1075 1080 1085 Thr Leu Tyr Lys Glu Leu Gly Glu Tyr Phe Leu Phe Asp Pro Lys Lys 1090 1095 1100 Leu Ser Val Glu Glu Phe Phe Met Asp Leu His Asn Phe Arg Asn Met 1105 1110 1115 1120 Phe Leu Gln Ala Val Lys Glu Asn Gln Lys Arg Arg Glu Thr Glu Glu 1125 1130 1135 Lys Met Arg Arg Ala Lys Leu Ala Lys Glu Lys Ala Glu Lys Glu Arg 1140 1145 1150 Leu Glu Lys Gln Gln Lys Arg Glu Gln Leu Ile Asp Met Asn Ala Glu 1155 1160 1165 Gly Asp Glu Thr Gly Val Met Asp Ser Leu Leu Glu Ala Leu Gln Ser 1170 1175 1180 Gly Ala Ala Phe Arg Arg Lys Arg Gly Pro Arg Gln Ala Asn Arg Lys 1185 1190 1195 1200 Ala Gly Cys Ala Val Thr Ser Leu Leu Ala Ser Glu Leu Thr Lys Asp 1205 1210 1215 Asp Ala Met Ala Ala Val Pro Ala Lys Val Ser Lys Asn Ser Glu Thr 1220 1225 1230 Phe Pro Thr Ile Leu Glu Glu Ala Lys Glu Leu Val Gly Arg Ala Ser 1235 1240 1245 <210> SEQ ID NO 34 <211> LENGTH: 1101 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 34 Met Glu Gln Pro Gly Ala Ala Ala Ser Gly Ala Gly Gly Gly Ser Glu 1 5 10 15 Glu Pro Gly Gly Gly Arg Ser Asn Lys Arg Ser Ala Gly Asn Arg Ala 20 25 30 Ala Asn Glu Glu Glu Thr Lys Asn Lys Pro Lys Leu Asn Ile Gln Ile 35 40 45 Lys Thr Leu Ala Asp Asp Val Arg Asp Arg Ile Thr Ser Phe Arg Lys 50 55 60 Ser Thr Val Lys Lys Glu Lys Pro Leu Ile Gln His Pro Ile Asp Ser 65 70 75 80 Gln Val Ala Met Ser Glu Phe Pro Ala Ala Gln Pro Leu Tyr Asp Glu 85 90 95 Arg Ser Leu Asn Leu Ser Glu Lys Glu Val Leu Asp Leu Phe Glu Lys 100 105 110 Met Met Glu Asp Met Asn Leu Asn Glu Glu Lys Lys Ala Pro Leu Arg 115 120 125 Asn Lys Asp Phe Thr Thr Lys Arg Glu Met Val Val Gln Tyr Ile Ser 130 135 140 Ala Thr Ala Lys Ser Gly Gly Leu Lys Asn Ser Lys His Glu Cys Thr 145 150 155 160 Leu Ser Ser Gln Glu Tyr Val His Glu Leu Arg Ser Gly Ile Ser Asp 165 170 175 Glu Lys Leu Leu Asn Cys Leu Glu Ser Leu Arg Val Ser Leu Thr Ser 180 185 190 Asn Pro Val Ser Trp Val Asn Asn Phe Gly His Glu Gly Leu Gly Leu 195 200 205 Leu Leu Asp Glu Leu Glu Lys Leu Leu Asp Lys Lys Gln Gln Glu Asn 210 215 220 Ile Asp Lys Lys Asn Gln Tyr Lys Leu Ile Gln Cys Leu Lys Ala Phe 225 230 235 240 Met Asn Asn Lys Phe Gly Leu Gln Arg Ile Leu Gly Asp Glu Arg Ser 245 250 255 Leu Leu Leu Leu Ala Arg Ala Ile Asp Pro Lys Gln Pro Asn Met Met 260 265 270 Thr Glu Ile Val Lys Ile Leu Ser Ala Ile Cys Ile Val Gly Glu Glu 275 280 285 Asn Ile Leu Asp Lys Leu Leu Gly Ala Ile Thr Thr Ala Ala Glu Arg 290 295 300 Asn Asn Arg Glu Arg Phe Ser Pro Ile Val Glu Gly Leu Glu Asn Gln 305 310 315 320 Glu Ala Leu Gln Leu Gln Val Ala Cys Met Gln Phe Ile Asn Ala Leu 325 330 335 Val Thr Ser Pro Tyr Glu Leu Asp Phe Arg Ile His Leu Arg Asn Glu 340 345 350 Phe Leu Arg Ser Gly Leu Lys Thr Met Leu Pro Asp Leu Lys Glu Lys 355 360 365 Glu Asn Asp Glu Leu Asp Ile Gln Leu Lys Val Phe Asp Glu Asn Lys 370 375 380 Glu Asp Asp Leu Thr Glu Leu Ser His Arg Leu Asn Asp Ile Arg Ala 385 390 395 400 Glu Met Asp Asp Met Asn Glu Val Tyr His Leu Leu Tyr Asn Met Leu 405 410 415 Lys Asp Thr Ala Ala Glu Asn Tyr Phe Leu Ser Ile Leu Gln His Phe 420 425 430 Leu Leu Ile Arg Asn Asp Tyr Tyr Ile Arg Pro Gln Tyr Tyr Lys Ile 435 440 445 Ile Glu Glu Cys Val Ser Gln Ile Val Leu His Cys Ser Gly Met Asp 450 455 460 Pro Asp Phe Lys Tyr Arg Gln Arg Leu Asp Ile Asp Leu Thr His Leu 465 470 475 480 Ile Asp Ser Cys Val Asn Lys Ala Lys Val Glu Glu Ser Glu Gln Lys 485 490 495 Ala Ala Glu Phe Ser Lys Lys Phe Asp Glu Glu Phe Thr Ala Arg Gln 500 505 510 Glu Ala Gln Ala Glu Leu Gln Lys Arg Asp Glu Lys Ile Lys Glu Leu 515 520 525 Glu Ala Glu Ile Gln Gln Leu Arg Thr Gln Ala Gln Val Leu Ser Ser 530 535 540 Ser Ser Gly Ile Pro Gly Pro Pro Ala Ala Pro Pro Leu Pro Gly Val 545 550 555 560 Gly Pro Pro Pro Pro Pro Pro Ala Pro Pro Leu Pro Gly Gly Ala Pro 565 570 575 Leu Pro Pro Pro Pro Pro Pro Leu Pro Gly Met Met Gly Ile Pro Pro 580 585 590 Pro Pro Pro Pro Pro Leu Leu Phe Gly Gly Pro Pro Pro Pro Pro Pro 595 600 605 Leu Gly Gly Val Pro Pro Pro Pro Gly Ile Ser Leu Asn Leu Pro Tyr 610 615 620 Gly Met Lys Gln Lys Lys Met Tyr Lys Pro Glu Val Ser Met Lys Arg 625 630 635 640 Ile Asn Trp Ser Lys Ile Glu Pro Thr Glu Leu Ser Glu Asn Cys Phe 645 650 655 Trp Leu Arg Val Lys Glu Asp Lys Phe Glu Asn Pro Asp Leu Phe Ala 660 665 670 Lys Leu Ala Leu Asn Phe Ala Thr Gln Ile Lys Val Gln Lys Asn Ala 675 680 685 Glu Ala Leu Glu Glu Lys Lys Thr Gly Pro Thr Lys Lys Lys Val Lys 690 695 700 Glu Leu Arg Ile Leu Asp Pro Lys Thr Ala Gln Asn Leu Ser Ile Phe 705 710 715 720 Leu Gly Ser Tyr Arg Met Pro Tyr Glu Asp Ile Arg Asn Val Ile Leu 725 730 735 Glu Val Asn Glu Asp Met Leu Ser Glu Ala Leu Ile Gln Asn Leu Val 740 745 750 Lys His Leu Pro Glu Gln Lys Ile Leu Asn Glu Leu Ala Glu Leu Lys 755 760 765 Asn Glu Tyr Asp Asp Leu Cys Glu Pro Glu Gln Phe Gly Val Val Met 770 775 780 Ser Ser Val Lys Met Leu Gln Pro Arg Leu Ser Ser Ile Leu Phe Lys 785 790 795 800 Leu Thr Phe Glu Glu His Ile Asn Asn Ile Lys Pro Ser Ile Ile Ala 805 810 815 Val Thr Leu Ala Cys Glu Glu Leu Lys Lys Ser Glu Ser Phe Asn Arg 820 825 830 Leu Leu Glu Leu Val Leu Leu Val Gly Asn Tyr Met Asn Ser Gly Ser 835 840 845 Arg Asn Ala Gln Ser Leu Gly Phe Lys Ile Asn Phe Leu Cys Lys Ile 850 855 860 Arg Asp Thr Lys Ser Ala Asp Gln Lys Thr Thr Leu Leu His Phe Ile 865 870 875 880 Ala Asp Ile Cys Glu Glu Lys Tyr Arg Asp Ile Leu Lys Phe Pro Glu 885 890 895 Glu Leu Glu His Val Glu Ser Ala Ser Lys Val Ser Ala Gln Ile Leu 900 905 910 Lys Ser Asn Leu Ala Ser Met Glu Gln Gln Ile Val His Leu Glu Arg 915 920 925 Asp Ile Lys Lys Phe Pro Gln Ala Glu Asn Gln His Asp Lys Phe Val 930 935 940 Glu Lys Met Thr Ser Phe Thr Lys Thr Ala Arg Glu Gln Tyr Glu Lys 945 950 955 960 Leu Ser Thr Met His Asn Asn Met Met Lys Leu Tyr Glu Asn Leu Gly 965 970 975 Glu Tyr Phe Ile Phe Asp Ser Lys Thr Val Ser Ile Glu Glu Phe Phe 980 985 990 Gly Asp Leu Asn Asn Phe Arg Thr Leu Phe Leu Glu Ala Val Arg Glu 995 1000 1005 Asn Asn Lys Arg Arg Glu Met Glu Glu Lys Thr Arg Arg Ala Lys Leu 1010 1015 1020 Ala Lys Glu Lys Ala Glu Gln Glu Lys Leu Glu Arg Gln Lys Lys Lys 1025 1030 1035 1040 Lys Gln Leu Ile Asp Ile Asn Lys Glu Gly Asp Glu Thr Gly Val Met 1045 1050 1055 Asp Asn Leu Leu Glu Ala Leu Gln Ser Gly Ala Ala Phe Arg Asp Arg 1060 1065 1070 Arg Lys Arg Ile Pro Arg Asn Pro Asp Asn Arg Arg Val Pro Leu Glu 1075 1080 1085 Arg Ser Arg Ser Arg His Asn Gly Ala Ile Ser Ser Lys 1090 1095 1100 <210> SEQ ID NO 35 <211> LENGTH: 2303 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 35 Met Thr Ser Glu Glu Met Thr Ala Ser Val Leu Ile Pro Val Thr Gln 1 5 10 15 Arg Lys Val Val Ser Ala Gln Ser Ala Ala Asp Glu Ser Ser Glu Lys 20 25 30 Val Ser Asp Ile Asn Ile Ser Lys Ala His Thr Val Arg Arg Ser Gly 35 40 45 Glu Thr Ser His Thr Ile Ser Gln Leu Asn Lys Leu Lys Glu Glu Pro 50 55 60 Ser Gly Ser Asn Leu Pro Lys Ile Leu Ser Ile Ala Arg Glu Lys Ile 65 70 75 80 Val Ser Asp Glu Asn Ser Asn Glu Lys Cys Trp Glu Lys Ile Met Pro 85 90 95 Asp Ser Ala Lys Asn Leu Asn Ile Asn Cys Asn Asn Ile Leu Arg Asn 100 105 110 His Gln His Gly Leu Pro Gln Arg Gln Phe Tyr Glu Met Tyr Asn Ser 115 120 125 Val Ala Glu Glu Asp Leu Cys Leu Glu Thr Gly Ile Pro Ser Pro Leu 130 135 140 Glu Arg Lys Val Phe Pro Gly Ile Gln Leu Glu Leu Asp Arg Pro Ser 145 150 155 160 Met Gly Ile Ser Pro Leu Gly Asn Gln Ser Val Ile Ile Glu Thr Gly 165 170 175 Arg Ala His Pro Asp Ser Arg Arg Ala Val Phe His Phe His Tyr Glu 180 185 190 Val Asp Arg Arg Met Ser Asp Thr Phe Cys Thr Leu Ser Glu Asn Leu 195 200 205 Ile Leu Asp Asp Cys Gly Asn Cys Val Pro Leu Pro Gly Gly Glu Glu 210 215 220 Lys Gln Lys Lys Asn Tyr Val Ala Tyr Thr Cys Lys Leu Met Glu Leu 225 230 235 240 Ala Lys Asn Cys Asp Asn Lys Asn Glu Gln Leu Gln Cys Asp His Cys 245 250 255 Asp Thr Leu Asn Asp Lys Tyr Phe Cys Phe Glu Gly Ser Cys Glu Lys 260 265 270 Val Asp Met Val Tyr Ser Gly Asp Ser Phe Cys Arg Lys Asp Phe Thr 275 280 285 Asp Ser Gln Ala Ala Lys Thr Phe Leu Ser His Phe Glu Asp Phe Pro 290 295 300 Asp Asn Cys Asp Asp Val Glu Glu Asp Ala Phe Lys Ser Lys Lys Glu 305 310 315 320 Arg Ser Thr Leu Leu Val Arg Arg Phe Cys Lys Asn Asp Arg Glu Val 325 330 335 Lys Lys Ser Val Tyr Thr Gly Thr Arg Ala Ile Val Arg Thr Leu Pro 340 345 350 Ser Gly His Ile Gly Leu Thr Ala Trp Ser Tyr Ile Asp Gln Lys Arg 355 360 365 Asn Gly Pro Leu Leu Pro Cys Gly Arg Val Met Glu Pro Pro Ser Thr 370 375 380 Val Glu Ile Arg Gln Asp Gly Ser Gln Arg Leu Ser Glu Ala Gln Trp 385 390 395 400 Tyr Pro Ile Tyr Asn Ala Val Arg Arg Glu Glu Thr Glu Asn Thr Val 405 410 415 Gly Ser Leu Leu His Phe Leu Thr Lys Leu Pro Ala Ser Glu Thr Ala 420 425 430 His Gly Arg Ile Ser Val Gly Pro Cys Leu Lys Gln Cys Val Arg Asp 435 440 445 Thr Val Cys Glu Tyr Arg Ala Thr Leu Gln Arg Thr Ser Ile Ser Gln 450 455 460 Tyr Ile Thr Gly Ser Leu Leu Glu Ala Thr Thr Ser Leu Gly Ala Arg 465 470 475 480 Ser Gly Leu Leu Ser Thr Phe Gly Gly Ser Thr Gly Arg Met Met Leu 485 490 495 Lys Glu Arg Gln Pro Gly Pro Ser Val Ala Asn Ser Asn Ala Leu Pro 500 505 510 Ser Ser Ser Ala Gly Ile Ser Lys Glu Leu Ile Asp Leu Gln Pro Leu 515 520 525 Ile Gln Phe Pro Glu Glu Val Ala Ser Ile Leu Met Glu Gln Glu Gln 530 535 540 Thr Ile Tyr Arg Arg Val Leu Pro Val Asp Tyr Leu Cys Phe Leu Thr 545 550 555 560 Arg Asp Leu Gly Thr Pro Glu Cys Gln Ser Ser Leu Pro Cys Leu Lys 565 570 575 Ala Ser Ile Ser Ala Ser Ile Leu Thr Thr Gln Asn Gly Glu His Asn 580 585 590 Ala Leu Glu Asp Leu Val Met Arg Phe Asn Glu Val Ser Ser Trp Val 595 600 605 Thr Trp Leu Ile Leu Thr Ala Gly Ser Met Glu Glu Lys Arg Glu Val 610 615 620 Phe Ser Tyr Leu Val His Val Ala Lys Cys Cys Trp Asn Met Gly Asn 625 630 635 640 Tyr Asn Ala Val Met Glu Phe Leu Ala Gly Leu Arg Ser Arg Lys Val 645 650 655 Leu Lys Met Trp Gln Phe Met Asp Gln Ser Asp Ile Glu Thr Met Arg 660 665 670 Ser Leu Lys Asp Ala Met Ala Gln His Glu Ser Ser Cys Glu Tyr Arg 675 680 685 Lys Val Val Thr Arg Ala Leu His Ile Pro Gly Cys Lys Val Val Pro 690 695 700 Phe Cys Gly Val Phe Leu Lys Glu Leu Cys Glu Val Leu Asp Gly Ala 705 710 715 720 Ser Gly Leu Met Lys Leu Cys Pro Arg Tyr Asn Ser Gln Glu Glu Thr 725 730 735 Leu Glu Phe Val Ala Asp Tyr Ser Gly Gln Asp Asn Phe Leu Gln Arg 740 745 750 Val Gly Gln Asn Gly Leu Lys Asn Ser Glu Lys Glu Ser Thr Val Asn 755 760 765 Ser Ile Phe Gln Val Ile Arg Ser Cys Asn Arg Ser Leu Glu Thr Asp 770 775 780 Glu Glu Asp Ser Pro Ser Glu Gly Asn Ser Ser Arg Lys Ser Ser Leu 785 790 795 800 Lys Asp Lys Ser Arg Trp Gln Phe Ile Ile Gly Asp Leu Leu Asp Ser 805 810 815 Asp Asn Asp Ile Phe Glu Gln Ser Lys Glu Tyr Asp Ser His Gly Ser 820 825 830 Glu Asp Ser Gln Lys Ala Phe Asp His Gly Thr Glu Leu Ile Pro Trp 835 840 845 Tyr Val Leu Ser Ile Gln Ala Asp Val His Gln Phe Leu Leu Gln Gly 850 855 860 Ala Thr Val Ile His Tyr Asp Gln Asp Thr His Leu Ser Ala Arg Cys 865 870 875 880 Phe Leu Gln Leu Gln Pro Asp Asn Ser Thr Leu Thr Trp Val Lys Pro 885 890 895 Thr Thr Ala Ser Pro Ala Ser Ser Lys Ala Lys Leu Gly Val Leu Asn 900 905 910 Asn Thr Ala Glu Pro Gly Lys Phe Pro Leu Leu Gly Asn Ala Gly Leu 915 920 925 Ser Ser Leu Thr Glu Gly Val Leu Asp Leu Phe Ala Val Lys Ala Val 930 935 940 Tyr Met Gly His Pro Gly Ile Asp Ile His Thr Val Cys Val Gln Asn 945 950 955 960 Lys Leu Gly Ser Met Phe Leu Ser Glu Thr Gly Val Thr Leu Leu Tyr 965 970 975 Gly Leu Gln Thr Thr Asp Asn Arg Leu Leu His Phe Val Ala Pro Lys 980 985 990 His Thr Ala Lys Met Leu Phe Ser Gly Leu Leu Glu Leu Thr Arg Ala 995 1000 1005 Val Arg Lys Met Arg Lys Phe Pro Asp Gln Arg Gln Gln Trp Leu Arg 1010 1015 1020 Lys Gln Tyr Val Ser Leu Tyr Gln Glu Asp Gly Arg Tyr Glu Gly Pro 1025 1030 1035 1040 Thr Leu Ala His Ala Val Glu Leu Phe Gly Gly Arg Arg Trp Ser Ala 1045 1050 1055 Arg Asn Pro Ser Pro Gly Thr Ser Ala Lys Asn Ala Glu Lys Pro Asn 1060 1065 1070 Met Gln Arg Asn Asn Thr Leu Gly Ile Ser Thr Thr Lys Lys Lys Lys 1075 1080 1085 Lys Ile Leu Met Arg Gly Glu Ser Gly Glu Val Thr Asp Asp Glu Met 1090 1095 1100 Ala Thr Arg Lys Ala Lys Met His Lys Glu Cys Arg Ser Arg Ser Gly 1105 1110 1115 1120 Ser Asp Pro Gln Asp Ile Asn Glu Gln Glu Glu Ser Glu Val Asn Ala 1125 1130 1135 Ile Ala Asn Pro Pro Asn Pro Leu Pro Ser Arg Arg Ala His Ser Leu 1140 1145 1150 Thr Thr Ala Gly Ser Pro Asn Leu Ala Ala Gly Thr Ser Ser Pro Ile 1155 1160 1165 Arg Pro Val Ser Ser Pro Val Leu Ser Ser Ser Asn Lys Ser Pro Ser 1170 1175 1180 Ser Ala Trp Ser Ser Ser Ser Trp His Gly Arg Ile Lys Gly Gly Met 1185 1190 1195 1200 Lys Gly Phe Gln Ser Phe Met Val Ser Asp Ser Asn Met Ser Phe Val 1205 1210 1215 Glu Phe Val Glu Leu Phe Lys Ser Phe Ser Val Arg Ser Arg Lys Asp 1220 1225 1230 Leu Lys Asp Leu Phe Asp Val Tyr Ala Val Pro Cys Asn Arg Ser Gly 1235 1240 1245 Ser Glu Ser Ala Pro Leu Tyr Thr Asn Leu Thr Ile Asp Glu Asn Thr 1250 1255 1260 Ser Asp Leu Gln Pro Asp Leu Asp Leu Leu Thr Arg Asn Val Ser Asp 1265 1270 1275 1280 Leu Gly Leu Phe Ile Lys Ser Lys Gln Gln Leu Ser Asp Asn Gln Arg 1285 1290 1295 Gln Ile Ser Asp Ala Ile Ala Ala Ala Ser Ile Val Thr Asn Gly Thr 1300 1305 1310 Gly Ile Glu Ser Thr Ser Leu Gly Ile Phe Gly Val Gly Ile Leu Gln 1315 1320 1325 Leu Asn Asp Phe Leu Val Asn Cys Gln Gly Glu His Cys Thr Tyr Asp 1330 1335 1340 Glu Ile Leu Ser Ile Ile Gln Lys Phe Glu Pro Ser Ile Ser Met Cys 1345 1350 1355 1360 His Gln Gly Leu Met Ser Phe Glu Gly Phe Ala Arg Phe Leu Met Asp 1365 1370 1375 Lys Glu Asn Phe Ala Ser Lys Asn Asp Glu Ser Gln Glu Asn Ile Lys 1380 1385 1390 Glu Leu Gln Leu Pro Leu Ser Tyr Tyr Tyr Ile Glu Ser Ser His Asn 1395 1400 1405 Thr Tyr Leu Thr Gly His Gln Leu Lys Gly Glu Ser Ser Val Glu Leu 1410 1415 1420 Tyr Ser Gln Val Leu Leu Gln Gly Cys Arg Ser Val Glu Leu Asp Cys 1425 1430 1435 1440 Trp Asp Gly Asp Asp Gly Met Pro Ile Ile Tyr His Gly His Thr Pro 1445 1450 1455 Thr Thr Lys Ile Pro Phe Lys Glu Val Val Glu Ala Ile Asp Arg Ser 1460 1465 1470 Ala Phe Ile Asn Ser Asp Leu Pro Ile Ile Ile Ser Ile Glu Asn His 1475 1480 1485 Cys Ser Leu Pro Gln Gln Arg Lys Met Ala Glu Ile Phe Lys Thr Val 1490 1495 1500 Phe Gly Glu Lys Leu Val Thr Lys Phe Leu Phe Glu Thr Asp Phe Ser 1505 1510 1515 1520 Asp Asp Pro Met Leu Pro Ser Pro Asp Gln Leu Arg Lys Lys Val Leu 1525 1530 1535 Leu Lys Asn Lys Lys Leu Lys Ala His Gln Thr Pro Val Asp Ile Leu 1540 1545 1550 Lys Gln Lys Ala His Gln Leu Ala Ser Met Gln Val Gln Ala Tyr Asn 1555 1560 1565 Gly Gly Asn Ala Asn Pro Arg Pro Ala Asn Asn Glu Glu Glu Glu Asp 1570 1575 1580 Glu Glu Asp Glu Tyr Asp Tyr Asp Tyr Glu Ser Leu Ser Asp Asp Asn 1585 1590 1595 1600 Ile Leu Glu Asp Arg Pro Glu Asn Lys Ser Cys Asn Asp Lys Leu Gln 1605 1610 1615 Phe Glu Tyr Asn Glu Glu Ile Pro Lys Arg Ile Lys Lys Ala Asp Asn 1620 1625 1630 Ser Ala Cys Asn Lys Gly Lys Val Tyr Asp Met Glu Leu Gly Glu Glu 1635 1640 1645 Phe Tyr Leu Asp Gln Asn Lys Lys Glu Ser Arg Gln Ile Ala Pro Glu 1650 1655 1660 Leu Ser Asp Leu Val Ile Tyr Arg Gln Ala Val Lys Phe Pro Gly Leu 1665 1670 1675 1680 Ser Thr Leu Asn Ala Ser Gly Ser Ser Arg Gly Lys Glu Arg Lys Ser 1685 1690 1695 Arg Lys Ser Ile Phe Gly Asn Asn Pro Gly Arg Met Ser Pro Gly Glu 1700 1705 1710 Thr Ala Ser Phe Asn Lys Thr Ser Gly Lys Ser Ser Cys Glu Gly Ile 1715 1720 1725 Arg Gln Thr Trp Glu Glu Ser Ser Ser Pro Leu Asn Pro Thr Thr Ser 1730 1735 1740 Leu Ser Ala Ile Ile Arg Thr Pro Lys Cys Tyr His Ile Ser Ser Leu 1745 1750 1755 1760 Asn Glu Asn Ala Ala Lys Arg Leu Cys Arg Arg Tyr Ser Gln Lys Leu 1765 1770 1775 Ile Gln His Thr Ala Cys Gln Leu Leu Arg Thr Tyr Pro Ala Ala Thr 1780 1785 1790 Arg Ile Asp Ser Ser Asn Pro Asn Pro Leu Met Phe Trp Leu His Gly 1795 1800 1805 Ile Gln Leu Val Ala Leu Asn Tyr Gln Thr Asp Asp Leu Pro Leu His 1810 1815 1820 Leu Asn Ala Ala Met Phe Glu Ala Asn Gly Gly Cys Gly Tyr Val Leu 1825 1830 1835 1840 Lys Pro Pro Val Leu Trp Asp Lys Asn Cys Pro Met Tyr Gln Lys Phe 1845 1850 1855 Ser Pro Leu Glu Arg Asp Leu Asp Ser Met Asp Pro Ala Val Tyr Ser 1860 1865 1870 Leu Thr Ile Val Ser Gly Gln Asn Val Cys Pro Ser Asn Ser Met Gly 1875 1880 1885 Ser Pro Cys Ile Glu Val Asp Val Leu Gly Met Pro Leu Asp Ser Cys 1890 1895 1900 His Phe Arg Thr Lys Pro Ile His Arg Asn Thr Leu Asn Pro Met Trp 1905 1910 1915 1920 Asn Glu Gln Phe Leu Phe Arg Val His Phe Glu Asp Leu Val Phe Leu 1925 1930 1935 Arg Phe Ala Val Val Glu Asn Asn Ser Ser Ala Val Thr Ala Gln Arg 1940 1945 1950 Ile Ile Pro Leu Lys Ala Leu Lys Arg Gly Tyr Arg His Leu Gln Leu 1955 1960 1965 Arg Asn Leu His Asn Glu Val Leu Glu Ile Ser Ser Leu Phe Ile Asn 1970 1975 1980 Ser Arg Arg Met Glu Glu Asn Ser Ser Gly Asn Thr Met Ser Ala Ser 1985 1990 1995 2000 Ser Met Phe Asn Thr Glu Glu Arg Lys Cys Leu Gln Thr His Arg Val 2005 2010 2015 Thr Val His Gly Val Pro Gly Pro Glu Pro Phe Thr Val Phe Thr Ile 2020 2025 2030 Asn Gly Gly Thr Lys Ala Lys Gln Leu Leu Gln Gln Ile Leu Thr Asn 2035 2040 2045 Glu Gln Asp Ile Lys Pro Val Thr Thr Asp Tyr Phe Leu Met Glu Glu 2050 2055 2060 Lys Tyr Phe Ile Ser Lys Glu Lys Asn Glu Cys Arg Lys Gln Pro Phe 2065 2070 2075 2080 Gln Arg Ala Ile Gly Pro Glu Glu Glu Ile Met Gln Ile Leu Ser Ser 2085 2090 2095 Trp Phe Pro Glu Glu Gly Tyr Met Gly Arg Ile Val Leu Lys Thr Gln 2100 2105 2110 Gln Glu Asn Leu Glu Glu Lys Asn Ile Val Gln Asp Asp Lys Glu Val 2115 2120 2125 Ile Leu Ser Ser Glu Glu Glu Ser Phe Phe Val Gln Val His Asp Val 2130 2135 2140 Ser Pro Glu Gln Pro Arg Thr Val Ile Lys Ala Pro Arg Val Ser Thr 2145 2150 2155 2160 Ala Gln Asp Val Ile Gln Gln Thr Leu Cys Lys Ala Lys Tyr Ser Tyr 2165 2170 2175 Ser Ile Leu Ser Asn Pro Asn Pro Ser Asp Tyr Val Leu Leu Glu Glu 2180 2185 2190 Val Val Lys Asp Thr Thr Asn Lys Lys Thr Thr Thr Pro Lys Ser Ser 2195 2200 2205 Gln Arg Val Leu Leu Asp Gln Glu Cys Val Phe Gln Ala Gln Ser Lys 2210 2215 2220 Trp Lys Gly Ala Gly Lys Phe Ile Leu Lys Leu Lys Glu Gln Val Gln 2225 2230 2235 2240 Ala Ser Arg Glu Asp Lys Lys Lys Gly Ile Ser Phe Ala Ser Glu Leu 2245 2250 2255 Lys Lys Leu Thr Lys Ser Thr Lys Gln Pro Arg Gly Leu Thr Ser Pro 2260 2265 2270 Ser Gln Leu Leu Thr Ser Glu Ser Ile Gln Thr Lys Glu Glu Lys Pro 2275 2280 2285 Val Gly Gly Leu Ser Pro Val Thr Gln Trp Ile Thr Asp Ser Asp 2290 2295 2300 <210> SEQ ID NO 36 <211> LENGTH: 31 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (2), (3), (5), (6), (10), (11), (13)..(17), (19), (20), (24), (25), (27), (28) <223> OTHER INFORMATION: Xaa is any amino acid <400> SEQUENCE: 36 Ala Xaa Xaa Tyr Xaa Xaa Ile Leu Gly Xaa Xaa Tyr Xaa Xaa Xaa Xaa 1 5 10 15 Xaa Tyr Xaa Xaa Ala Ile Leu Xaa Xaa Phe Xaa Xaa Ala Ile Leu 20 25 30 <210> SEQ ID NO 37 <211> LENGTH: 86 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(4), (6), (8)..(15), (17), (18), (20)..(22), (24)..(27), (29)..(44), (46)..(62), (64)..(81), (83)..(85) <223> OTHER INFORMATION: Xaa is any amino acid <400> SEQUENCE: 37 Xaa Xaa Xaa Xaa Gly Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Trp 1 5 10 15 Xaa Xaa Arg Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 80 Xaa Glu Xaa Xaa Xaa Trp 85 <210> SEQ ID NO 38 <211> LENGTH: 526 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 38 Met Ser Leu Val Glu Ala Ile Ser Leu Trp Asn Glu Gly Val Leu Ala 1 5 10 15 Ala Asp Lys Lys Asp Trp Lys Gly Ala Leu Asp Ala Phe Ser Ala Val 20 25 30 Gln Asp Pro His Ser Arg Ile Cys Phe Asn Ile Gly Cys Met Tyr Thr 35 40 45 Ile Leu Lys Asn Met Thr Glu Ala Glu Lys Ala Phe Thr Arg Ser Ile 50 55 60 Asn Arg Asp Lys His Leu Ala Val Ala Tyr Phe Gln Arg Gly Met Leu 65 70 75 80 Tyr Tyr Gln Thr Glu Lys Tyr Asp Leu Ala Ile Lys Asp Leu Lys Glu 85 90 95 Ala Leu Ile Gln Leu Arg Gly Asn Gln Leu Ile Asp Tyr Lys Ile Leu 100 105 110 Gly Leu Gln Phe Lys Leu Phe Ala Cys Glu Val Leu Tyr Asn Ile Ala 115 120 125 Phe Met Tyr Ala Lys Lys Glu Glu Trp Lys Lys Ala Glu Glu Gln Leu 130 135 140 Ala Leu Ala Thr Ser Met Lys Ser Glu Pro Arg His Ser Lys Ile Asp 145 150 155 160 Lys Ala Met Glu Cys Val Trp Lys Gln Lys Leu Tyr Glu Pro Val Val 165 170 175 Ile Pro Val Gly Lys Leu Phe Arg Pro Asn Glu Arg Gln Val Ala Gln 180 185 190 Leu Ala Lys Lys Asp Tyr Leu Gly Lys Ala Thr Val Val Ala Ser Val 195 200 205 Val Asp Gln Asp Ser Phe Ser Gly Phe Ala Pro Leu Gln Pro Gln Ala 210 215 220 Ala Glu Pro Pro Pro Arg Pro Lys Thr Pro Glu Ile Phe Arg Ala Leu 225 230 235 240 Glu Gly Glu Ala His Arg Val Leu Phe Gly Phe Val Pro Glu Thr Lys 245 250 255 Glu Glu Leu Gln Val Met Pro Gly Asn Ile Val Phe Val Leu Lys Lys 260 265 270 Gly Asn Asp Asn Trp Ala Thr Val Met Phe Asn Gly Gln Lys Gly Leu 275 280 285 Val Pro Cys Asn Tyr Leu Glu Pro Val Glu Leu Arg Ile His Pro Gln 290 295 300 Gln Gln Pro Gln Glu Glu Ser Ser Pro Gln Ser Asp Ile Pro Ala Pro 305 310 315 320 Pro Ser Ser Lys Ala Pro Gly Arg Pro Gln Leu Ser Pro Gly Gln Lys 325 330 335 Gln Lys Glu Glu Pro Lys Glu Val Lys Leu Ser Val Pro Met Pro Tyr 340 345 350 Thr Leu Lys Val His Tyr Lys Tyr Thr Val Val Met Lys Thr Gln Pro 355 360 365 Gly Leu Pro Tyr Ser Gln Val Arg Asp Met Val Ser Lys Lys Leu Glu 370 375 380 Leu Arg Leu Glu His Thr Lys Leu Ser Tyr Arg Pro Arg Asp Ser Asn 385 390 395 400 Glu Leu Val Pro Leu Ser Glu Asp Ser Met Lys Asp Ala Trp Gly Gln 405 410 415 Val Lys Asn Tyr Cys Leu Thr Leu Trp Cys Glu Asn Thr Val Gly Asp 420 425 430 Gln Gly Phe Pro Asp Glu Pro Lys Glu Ser Glu Lys Ala Asp Ala Asn 435 440 445 Asn Gln Thr Thr Glu Pro Gln Leu Lys Lys Gly Ser Gln Val Glu Ala 450 455 460 Leu Phe Ser Tyr Glu Ala Thr Gln Pro Glu Asp Leu Glu Phe Gln Glu 465 470 475 480 Gly Asp Ile Ile Leu Val Leu Ser Lys Val Asn Glu Glu Trp Leu Glu 485 490 495 Gly Glu Cys Lys Gly Lys Val Gly Ile Phe Pro Lys Val Phe Val Glu 500 505 510 Asp Cys Ala Thr Thr Asp Leu Glu Ser Thr Arg Arg Glu Val 515 520 525 <210> SEQ ID NO 39 <211> LENGTH: 1216 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 39 Met Ala Gly Ala Gln Pro Gly Val His Ala Leu Gln Leu Lys Pro Val 1 5 10 15 Cys Val Ser Asp Ser Leu Lys Lys Gly Thr Lys Phe Val Lys Trp Asp 20 25 30 Asp Asp Ser Thr Ile Val Thr Pro Ile Ile Leu Arg Thr Asp Pro Gln 35 40 45 Gly Phe Phe Phe Tyr Trp Thr Asp Gln Asn Lys Glu Thr Glu Leu Leu 50 55 60 Asp Leu Ser Leu Val Lys Asp Ala Arg Cys Gly Arg His Ala Lys Ala 65 70 75 80 Pro Lys Asp Pro Lys Leu Arg Glu Leu Leu Asp Val Gly Asn Ile Gly 85 90 95 Arg Leu Glu Gln Arg Met Ile Thr Val Val Tyr Gly Pro Asp Leu Val 100 105 110 Asn Ile Ser His Leu Asn Leu Val Ala Phe Gln Glu Glu Val Ala Lys 115 120 125 Glu Trp Thr Asn Glu Val Phe Ser Leu Ala Thr Asn Leu Leu Ala Gln 130 135 140 Asn Met Ser Arg Asp Ala Phe Leu Glu Lys Ala Tyr Thr Lys Leu Lys 145 150 155 160 Leu Gln Val Thr Pro Glu Gly Arg Ile Pro Leu Lys Asn Ile Tyr Arg 165 170 175 Leu Phe Ser Ala Asp Arg Lys Arg Val Glu Thr Ala Leu Glu Ala Cys 180 185 190 Ser Leu Pro Ser Ser Arg Asn Asp Ser Ile Pro Gln Glu Asp Phe Thr 195 200 205 Pro Glu Val Tyr Arg Val Phe Leu Asn Asn Leu Cys Pro Arg Pro Glu 210 215 220 Ile Asp Asn Ile Phe Ser Glu Phe Gly Ala Lys Ser Lys Pro Tyr Leu 225 230 235 240 Thr Val Asp Gln Met Met Asp Phe Ile Asn Leu Lys Gln Arg Asp Pro 245 250 255 Arg Leu Asn Glu Ile Leu Tyr Pro Pro Leu Lys Gln Glu Gln Val Gln 260 265 270 Val Leu Ile Glu Lys Tyr Glu Pro Asn Asn Ser Leu Ala Arg Lys Gly 275 280 285 Gln Ile Ser Val Asp Gly Phe Met Arg Tyr Leu Ser Gly Glu Glu Asn 290 295 300 Gly Val Val Ser Pro Glu Lys Leu Asp Leu Asn Glu Asp Met Ser Gln 305 310 315 320 Pro Leu Ser His Tyr Phe Ile Asn Ser Ser His Asn Thr Tyr Leu Thr 325 330 335 Ala Gly Gln Leu Ala Gly Asn Ser Ser Val Glu Met Tyr Arg Gln Val 340 345 350 Leu Leu Ser Gly Cys Arg Cys Val Glu Leu Asp Cys Trp Lys Gly Arg 355 360 365 Thr Ala Glu Glu Glu Pro Val Ile Thr His Gly Phe Thr Met Thr Thr 370 375 380 Glu Ile Ser Phe Lys Glu Val Ile Glu Ala Ile Ala Glu Cys Ala Phe 385 390 395 400 Lys Thr Ser Pro Phe Pro Ile Leu Leu Ser Phe Glu Asn His Val Asp 405 410 415 Ser Pro Lys Gln Gln Ala Lys Met Ala Glu Tyr Cys Arg Leu Ile Phe 420 425 430 Gly Asp Ala Leu Leu Met Glu Pro Leu Glu Lys Tyr Pro Leu Glu Ser 435 440 445 Gly Val Pro Leu Pro Ser Pro Met Asp Leu Met Tyr Lys Ile Leu Val 450 455 460 Lys Asn Lys Lys Lys Ser His Lys Ser Ser Glu Gly Ser Gly Lys Lys 465 470 475 480 Lys Leu Ser Glu Gln Ala Ser Asn Thr Tyr Ser Asp Ser Ser Ser Met 485 490 495 Phe Glu Pro Ser Ser Pro Gly Ala Gly Glu Ala Asp Thr Glu Ser Asp 500 505 510 Asp Asp Asp Asp Asp Asp Asp Cys Lys Lys Ser Ser Met Asp Glu Gly 515 520 525 Thr Ala Gly Ser Glu Ala Met Ala Thr Glu Glu Met Ser Asn Leu Val 530 535 540 Asn Tyr Ile Gln Pro Val Lys Phe Glu Ser Phe Glu Ile Ser Lys Lys 545 550 555 560 Arg Asn Lys Ser Phe Glu Met Ser Ser Phe Val Glu Thr Lys Gly Leu 565 570 575 Glu Gln Leu Thr Lys Ser Pro Val Glu Phe Val Glu Tyr Asn Lys Met 580 585 590 Gln Leu Ser Arg Ile Tyr Pro Lys Gly Thr Arg Val Asp Ser Ser Asn 595 600 605 Tyr Met Pro Gln Leu Phe Trp Asn Ala Gly Cys Gln Met Val Ala Leu 610 615 620 Asn Phe Gln Thr Met Asp Leu Ala Met Gln Ile Asn Met Gly Met Tyr 625 630 635 640 Glu Tyr Asn Gly Lys Ser Gly Tyr Arg Leu Lys Pro Glu Phe Met Arg 645 650 655 Arg Pro Asp Lys His Phe Asp Pro Phe Thr Glu Gly Ile Val Asp Gly 660 665 670 Ile Val Ala Asn Thr Leu Ser Val Lys Ile Ile Ser Gly Gln Phe Leu 675 680 685 Ser Asp Lys Lys Val Gly Thr Tyr Val Glu Val Asp Met Phe Gly Leu 690 695 700 Pro Val Asp Thr Arg Arg Lys Ala Phe Lys Thr Lys Thr Ser Gln Gly 705 710 715 720 Asn Ala Val Asn Pro Val Trp Glu Glu Glu Pro Ile Val Phe Lys Lys 725 730 735 Val Val Leu Pro Thr Leu Ala Cys Leu Arg Ile Ala Val Tyr Glu Glu 740 745 750 Gly Gly Lys Phe Ile Gly His Arg Ile Leu Pro Val Gln Ala Ile Arg 755 760 765 Pro Gly Tyr His Tyr Ile Cys Leu Arg Asn Glu Arg Asn Gln Pro Leu 770 775 780 Thr Leu Pro Ala Val Phe Val Tyr Ile Glu Val Lys Asp Tyr Val Pro 785 790 795 800 Asp Thr Tyr Ala Asp Val Ile Glu Ala Leu Ser Asn Pro Ile Arg Tyr 805 810 815 Val Asn Leu Met Glu Gln Arg Ala Lys Gln Leu Ala Ala Leu Thr Leu 820 825 830 Glu Asp Glu Glu Glu Val Lys Lys Glu Ala Asp Pro Gly Glu Thr Pro 835 840 845 Ser Glu Ala Pro Ser Glu Ala Arg Thr Thr Pro Ala Glu Asn Gly Val 850 855 860 Asn His Thr Thr Thr Leu Thr Pro Lys Pro Pro Ser Gln Ala Leu His 865 870 875 880 Ser Gln Pro Ala Pro Gly Ser Val Lys Ala Pro Ala Lys Thr Glu Asp 885 890 895 Leu Ile Gln Ser Val Leu Thr Glu Val Glu Ala Gln Thr Ile Glu Glu 900 905 910 Leu Lys Gln Gln Lys Ser Phe Val Lys Leu Gln Lys Lys His Tyr Lys 915 920 925 Glu Met Lys Asp Leu Val Lys Arg His His Lys Lys Thr Thr Asp Leu 930 935 940 Ile Lys Glu His Thr Thr Lys Tyr Asn Glu Ile Gln Asn Asp Tyr Leu 945 950 955 960 Arg Arg Arg Ala Ala Leu Glu Lys Ser Ala Lys Lys Asp Ser Lys Lys 965 970 975 Lys Ser Glu Pro Ser Ser Pro Asp His Gly Ser Ser Thr Ile Glu Gln 980 985 990 Asp Leu Ala Ala Leu Asp Ala Glu Met Thr Gln Lys Leu Ile Asp Leu 995 1000 1005 Lys Asp Lys Gln Gln Gln Gln Leu Leu Asn Leu Arg Gln Glu Gln Tyr 1010 1015 1020 Tyr Ser Glu Lys Tyr Gln Lys Arg Glu His Ile Lys Leu Leu Ile Gln 1025 1030 1035 1040 Lys Leu Thr Asp Val Ala Glu Glu Cys Gln Asn Asn Gln Leu Lys Lys 1045 1050 1055 Leu Lys Glu Ile Cys Glu Lys Glu Lys Lys Glu Leu Lys Lys Lys Met 1060 1065 1070 Asp Lys Lys Arg Gln Glu Lys Ile Thr Glu Ala Lys Ser Lys Asp Lys 1075 1080 1085 Ser Gln Met Glu Glu Glu Lys Thr Glu Met Ile Arg Ser Tyr Ile Gln 1090 1095 1100 Glu Val Val Gln Tyr Ile Lys Arg Leu Glu Glu Ala Gln Ser Lys Arg 1105 1110 1115 1120 Gln Glu Lys Leu Val Glu Lys His Lys Glu Ile Arg Gln Gln Ile Leu 1125 1130 1135 Asp Glu Lys Pro Lys Leu Gln Val Glu Leu Glu Gln Glu Tyr Gln Asp 1140 1145 1150 Lys Phe Lys Arg Leu Pro Leu Glu Ile Leu Glu Phe Val Gln Glu Ala 1155 1160 1165 Met Lys Gly Lys Ile Ser Glu Asp Ser Asn His Gly Ser Ala Pro Leu 1170 1175 1180 Ser Leu Ser Ser Asp Pro Gly Lys Val Asn His Lys Thr Pro Ser Ser 1185 1190 1195 1200 Glu Glu Leu Gly Gly Asp Ile Pro Gly Lys Glu Phe Asp Thr Pro Leu 1205 1210 1215 <210> SEQ ID NO 40 <211> LENGTH: 1164 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 40 Met Ala Gly Gly Glu Asp Arg Gly Asp Gly Glu Pro Val Ser Val Val 1 5 10 15 Thr Val Arg Val Gln Tyr Leu Glu Asp Thr Asp Pro Phe Ala Cys Ala 20 25 30 Asn Phe Pro Glu Pro Arg Arg Ala Pro Thr Cys Ser Leu Asp Gly Ala 35 40 45 Leu Pro Leu Gly Ala Gln Ile Pro Ala Val His Arg Leu Leu Gly Ala 50 55 60 Pro Leu Lys Leu Glu Asp Cys Ala Leu Gln Val Ser Pro Ser Gly Tyr 65 70 75 80 Tyr Leu Asp Thr Glu Leu Ser Leu Glu Glu Gln Arg Glu Met Leu Glu 85 90 95 Gly Phe Tyr Glu Glu Ile Ser Lys Gly Arg Lys Pro Thr Leu Ile Leu 100 105 110 Arg Thr Gln Leu Ser Val Arg Val Asn Ala Ile Leu Glu Lys Leu Tyr 115 120 125 Ser Ser Ser Gly Pro Glu Leu Arg Arg Ser Leu Phe Ser Leu Lys Gln 130 135 140 Ile Phe Gln Glu Asp Lys Asp Leu Val Pro Glu Phe Val His Ser Glu 145 150 155 160 Gly Leu Ser Cys Leu Ile Arg Val Gly Ala Ala Ala Asp His Asn Tyr 165 170 175 Gln Ser Tyr Ile Leu Arg Ala Leu Gly Gln Leu Met Leu Phe Val Asp 180 185 190 Gly Met Leu Gly Val Val Ala His Ser Asp Thr Ile Gln Trp Leu Tyr 195 200 205 Thr Leu Cys Ala Ser Leu Ser Arg Leu Val Val Lys Thr Ala Leu Lys 210 215 220 Leu Leu Leu Val Phe Val Glu Tyr Ser Glu Asn Asn Ala Pro Leu Phe 225 230 235 240 Ile Arg Ala Val Asn Ser Val Ala Thr Thr Thr Gly Ala Pro Pro Trp 245 250 255 Ala Asn Leu Val Ser Ile Leu Glu Glu Lys Asn Gly Ala Asp Pro Glu 260 265 270 Leu Leu Val Tyr Thr Val Thr Leu Ile Asn Lys Thr Leu Ala Ala Leu 275 280 285 Pro Asp Gln Asp Ser Phe Tyr Asp Val Thr Asp Ala Leu Glu Gln Gln 290 295 300 Gly Met Asp Thr Leu Val Gln Arg His Leu Gly Thr Ala Gly Thr Asp 305 310 315 320 Val Asp Leu Arg Thr Gln Leu Val Leu Tyr Glu Asn Ala Leu Lys Leu 325 330 335 Glu Asp Gly Asp Ile Glu Glu Ala Pro Gly Ala Gly Gly Arg Arg Glu 340 345 350 Arg Arg Lys Pro Ser Ser Glu Glu Gly Lys Arg Ser Arg Arg Ser Leu 355 360 365 Glu Gly Gly Gly Cys Pro Ala Arg Ala Pro Glu Pro Gly Pro Thr Gly 370 375 380 Pro Ala Ser Pro Val Gly Pro Thr Ser Ser Thr Gly Pro Ala Leu Leu 385 390 395 400 Thr Gly Pro Ala Ser Ser Pro Val Gly Pro Pro Ser Gly Leu Gln Ala 405 410 415 Ser Val Asn Leu Phe Pro Thr Ile Ser Val Ala Pro Ser Ala Asp Thr 420 425 430 Ser Ser Glu Arg Ser Ile Tyr Lys Ala Arg Phe Leu Glu Asn Val Ala 435 440 445 Ala Ala Glu Thr Glu Lys Gln Val Ala Leu Ala Gln Gly Arg Ala Glu 450 455 460 Thr Leu Ala Gly Ala Met Pro Asn Glu Ala Gly Gly His Pro Asp Ala 465 470 475 480 Arg Gln Leu Trp Asp Ser Pro Glu Thr Ala Pro Ala Ala Arg Thr Pro 485 490 495 Gln Ser Pro Ala Pro Cys Val Leu Leu Arg Ala Gln Arg Ser Leu Ala 500 505 510 Pro Glu Pro Lys Glu Pro Leu Ile Pro Ala Ser Pro Lys Ala Glu Pro 515 520 525 Ile Trp Glu Leu Pro Thr Arg Ala Pro Arg Leu Ser Ile Gly Asp Leu 530 535 540 Asp Phe Ser Asp Leu Gly Glu Asp Glu Asp Gln Asp Met Leu Asn Val 545 550 555 560 Glu Ser Val Glu Ala Gly Lys Asp Ile Pro Ala Pro Ser Pro Pro Leu 565 570 575 Pro Leu Leu Ser Gly Val Pro Pro Pro Pro Pro Leu Pro Pro Pro Pro 580 585 590 Pro Ile Lys Gly Pro Phe Pro Pro Pro Pro Pro Leu Pro Leu Ala Ala 595 600 605 Pro Leu Pro His Ser Val Pro Asp Ser Ser Ala Leu Pro Thr Lys Arg 610 615 620 Lys Thr Val Lys Leu Phe Trp Arg Asp Val Lys Leu Ala Gly Gly His 625 630 635 640 Gly Val Ser Ala Ser Arg Phe Gly Pro Cys Ala Thr Leu Trp Ala Ser 645 650 655 Leu Asp Pro Val Ser Val Asp Thr Ala Arg Leu Glu His Leu Phe Glu 660 665 670 Ser Arg Ala Lys Glu Val Leu Pro Ser Lys Lys Ala Gly Glu Gly Arg 675 680 685 Arg Thr Met Thr Thr Val Leu Asp Pro Lys Arg Thr Asn Ala Ile Asn 690 695 700 Ile Gly Leu Thr Thr Leu Pro Pro Val His Val Ile Lys Ala Ala Leu 705 710 715 720 Leu Asn Phe Asp Glu Phe Ala Val Ser Lys Asp Gly Ile Glu Lys Leu 725 730 735 Leu Thr Met Met Pro Thr Glu Glu Glu Arg Gln Lys Ile Glu Gly Ala 740 745 750 Gln Leu Ala Asn Pro Asp Ile Pro Leu Gly Pro Ala Glu Asn Phe Leu 755 760 765 Met Thr Leu Ala Ser Ile Gly Gly Leu Ala Ala Arg Leu Gln Leu Trp 770 775 780 Ala Phe Lys Leu Asp Tyr Asp Ser Met Glu Arg Glu Ile Ala Glu Pro 785 790 795 800 Leu Phe Asp Leu Lys Val Gly Met Glu Gln Leu Val Gln Asn Ala Thr 805 810 815 Phe Arg Cys Ile Leu Ala Thr Leu Leu Ala Val Gly Asn Phe Leu Asn 820 825 830 Gly Ser Gln Ser Ser Gly Phe Glu Leu Ser Tyr Leu Glu Lys Val Ser 835 840 845 Asp Val Lys Asp Thr Val Arg Arg Gln Ser Leu Leu His His Leu Cys 850 855 860 Ser Leu Val Leu Gln Thr Arg Pro Glu Ser Ser Asp Leu Tyr Ser Glu 865 870 875 880 Ile Pro Ala Leu Thr Arg Cys Ala Lys Val Asp Phe Glu Gln Leu Thr 885 890 895 Glu Asn Leu Gly Gln Leu Glu Arg Arg Ser Arg Ala Ala Glu Glu Ser 900 905 910 Leu Arg Ser Leu Ala Lys His Glu Leu Ala Pro Ala Leu Arg Ala Arg 915 920 925 Leu Thr His Phe Leu Asp Gln Cys Ala Arg Arg Val Ala Met Leu Arg 930 935 940 Ile Val His Arg Arg Val Cys Asn Arg Phe His Ala Phe Leu Leu Tyr 945 950 955 960 Leu Gly Tyr Thr Pro Gln Ala Ala Arg Glu Val Arg Ile Met Gln Phe 965 970 975 Cys His Thr Leu Arg Glu Phe Ala Leu Glu Tyr Arg Thr Cys Arg Glu 980 985 990 Arg Val Leu Gln Gln Gln Gln Lys Gln Ala Thr Tyr Arg Glu Arg Asn 995 1000 1005 Lys Thr Arg Gly Arg Met Ile Thr Glu Thr Glu Lys Phe Ser Gly Val 1010 1015 1020 Ala Gly Glu Ala Pro Ser Asn Pro Ser Val Pro Val Ala Val Ser Ser 1025 1030 1035 1040 Gly Pro Gly Arg Gly Asp Ala Asp Ser His Ala Ser Met Lys Ser Leu 1045 1050 1055 Leu Thr Ser Arg Leu Glu Asp Thr Thr His Asn Arg Arg Ser Arg Gly 1060 1065 1070 Met Val Gln Ser Ser Ser Pro Ile Met Pro Thr Val Gly Pro Ser Thr 1075 1080 1085 Ala Ser Pro Glu Glu Pro Pro Gly Ser Ser Leu Pro Ser Asp Thr Ser 1090 1095 1100 Asp Glu Ile Met Asp Leu Leu Val Gln Ser Val Thr Lys Ser Ser Pro 1105 1110 1115 1120 Arg Ala Leu Ala Ala Arg Glu Arg Lys Arg Ser Arg Gly Asn Arg Lys 1125 1130 1135 Ser Leu Arg Arg Thr Leu Lys Ser Gly Leu Gly Asp Asp Leu Val Gln 1140 1145 1150 Ala Leu Gly Leu Ser Lys Gly Pro Gly Leu Glu Val 1155 1160 <210> SEQ ID NO 41 <211> LENGTH: 341 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 41 Met Thr Asp Gly Ile Leu Gly Lys Ala Ala Thr Met Glu Ile Pro Ile 1 5 10 15 His Gly Asn Gly Glu Ala Arg Gln Leu Pro Glu Asp Asp Gly Leu Glu 20 25 30 Gln Asp Leu Gln Gln Val Met Val Ser Gly Pro Asn Leu Asn Glu Thr 35 40 45 Ser Ile Val Ser Gly Gly Tyr Gly Gly Ser Gly Asp Gly Leu Ile Pro 50 55 60 Thr Gly Ser Gly Arg His Pro Ser His Ser Thr Thr Pro Ser Gly Pro 65 70 75 80 Gly Asp Glu Val Ala Arg Gly Ile Ala Gly Glu Lys Phe Asp Ile Val 85 90 95 Lys Lys Trp Gly Ile Asn Thr Tyr Lys Cys Thr Lys Gln Leu Leu Ser 100 105 110 Glu Arg Phe Gly Arg Gly Ser Arg Thr Val Asp Leu Glu Leu Glu Leu 115 120 125 Gln Ile Glu Leu Leu Arg Glu Thr Lys Arg Lys Tyr Glu Ser Val Leu 130 135 140 Gln Leu Gly Arg Ala Leu Thr Ala His Leu Tyr Ser Leu Leu Gln Thr 145 150 155 160 Gln His Ala Leu Gly Asp Ala Phe Ala Asp Leu Ser Gln Lys Ser Pro 165 170 175 Glu Leu Gln Glu Glu Phe Gly Tyr Asn Ala Glu Thr Gln Lys Leu Leu 180 185 190 Cys Lys Asn Gly Glu Thr Leu Leu Gly Ala Val Asn Phe Phe Val Ser 195 200 205 Ser Ile Asn Thr Leu Val Thr Lys Thr Met Glu Asp Thr Leu Met Thr 210 215 220 Val Lys Gln Tyr Glu Ala Ala Arg Leu Glu Tyr Asp Ala Tyr Arg Thr 225 230 235 240 Asp Leu Glu Glu Leu Ser Leu Gly Pro Arg Asp Ala Gly Thr Arg Gly 245 250 255 Arg Leu Glu Ser Ala Gln Ala Thr Phe Gln Ala His Arg Asp Lys Tyr 260 265 270 Glu Lys Leu Arg Gly Asp Val Ala Ile Lys Leu Lys Phe Leu Glu Glu 275 280 285 Asn Lys Ile Lys Val Met His Lys Gln Leu Leu Leu Phe His Asn Ala 290 295 300 Val Ser Ala Tyr Phe Ala Gly Asn Gln Lys Gln Leu Glu Gln Thr Leu 305 310 315 320 Gln Gln Phe Asn Ile Lys Leu Arg Pro Pro Gly Ala Glu Lys Pro Ser 325 330 335 Trp Leu Glu Glu Gln 340 <210> SEQ ID NO 42 <211> LENGTH: 888 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 42 Met Asp Glu Ser Ala Leu Leu Asp Leu Leu Glu Cys Pro Val Cys Leu 1 5 10 15 Glu Arg Leu Asp Ala Ser Ala Lys Val Leu Pro Cys Gln His Thr Phe 20 25 30 Cys Lys Arg Cys Leu Leu Gly Ile Val Gly Ser Arg Asn Glu Leu Arg 35 40 45 Cys Pro Glu Cys Arg Thr Leu Val Gly Ser Gly Val Glu Glu Leu Pro 50 55 60 Ser Asn Ile Leu Leu Val Arg Leu Leu Asp Gly Ile Lys Gln Arg Pro 65 70 75 80 Trp Lys Pro Gly Pro Gly Gly Gly Ser Gly Thr Asn Cys Thr Asn Ala 85 90 95 Leu Arg Ser Gln Ser Ser Thr Val Ala Asn Cys Ser Ser Lys Asp Leu 100 105 110 Gln Ser Ser Gln Gly Gly Gln Gln Pro Arg Val Gln Ser Trp Ser Pro 115 120 125 Pro Val Arg Gly Ile Pro Gln Leu Pro Cys Ala Lys Ala Leu Tyr Asn 130 135 140 Tyr Glu Gly Lys Glu Pro Gly Asp Leu Lys Phe Ser Lys Gly Asp Ile 145 150 155 160 Ile Ile Leu Arg Arg Gln Val Asp Glu Asn Trp Tyr His Gly Glu Val 165 170 175 Asn Gly Ile His Gly Phe Phe Pro Thr Asn Phe Val Gln Ile Ile Lys 180 185 190 Pro Leu Pro Gln Pro Pro Pro Gln Cys Lys Ala Leu Tyr Asp Phe Glu 195 200 205 Val Lys Asp Lys Glu Ala Asp Lys Asp Cys Leu Pro Phe Ala Lys Asp 210 215 220 Asp Val Leu Thr Val Ile Arg Arg Val Asp Glu Asn Trp Ala Glu Gly 225 230 235 240 Met Leu Ala Asp Lys Ile Gly Ile Phe Pro Ile Ser Tyr Val Glu Phe 245 250 255 Asn Ser Ala Ala Lys Gln Leu Ile Glu Trp Asp Lys Pro Pro Val Pro 260 265 270 Gly Val Asp Ala Gly Glu Cys Ser Ser Ala Ala Ala Gln Ser Ser Thr 275 280 285 Ala Pro Lys His Ser Asp Thr Lys Lys Asn Thr Lys Lys Arg His Ser 290 295 300 Phe Thr Ser Leu Thr Met Ala Asn Lys Ser Ser Gln Ala Ser Gln Asn 305 310 315 320 Arg His Ser Met Glu Ile Ser Pro Pro Val Leu Ile Ser Ser Ser Asn 325 330 335 Pro Thr Ala Ala Ala Arg Ile Ser Glu Leu Ser Gly Leu Ser Cys Ser 340 345 350 Ala Pro Ser Gln Val His Ile Ser Thr Thr Gly Leu Ile Val Thr Pro 355 360 365 Pro Pro Ser Ser Pro Val Thr Thr Gly Pro Ser Phe Thr Phe Pro Ser 370 375 380 Asp Val Pro Tyr Gln Ala Ala Leu Gly Thr Leu Asn Pro Pro Leu Pro 385 390 395 400 Pro Pro Pro Leu Leu Ala Ala Thr Val Leu Ala Ser Thr Pro Pro Gly 405 410 415 Ala Thr Ala Ala Ala Ala Ala Ala Gly Met Gly Pro Arg Pro Met Ala 420 425 430 Gly Ser Thr Asp Gln Ile Ala His Leu Arg Pro Gln Thr Arg Pro Ser 435 440 445 Val Tyr Val Ala Ile Tyr Pro Tyr Thr Pro Arg Lys Glu Asp Glu Leu 450 455 460 Glu Leu Arg Lys Gly Glu Met Phe Leu Val Phe Glu Arg Cys Gln Asp 465 470 475 480 Gly Trp Phe Lys Gly Thr Ser Met His Thr Ser Lys Ile Gly Val Phe 485 490 495 Pro Gly Asn Tyr Val Ala Pro Val Thr Arg Ala Val Thr Asn Ala Ser 500 505 510 Gln Ala Lys Val Pro Met Ser Thr Ala Gly Gln Thr Ser Arg Gly Val 515 520 525 Thr Met Val Ser Pro Ser Thr Ala Gly Gly Pro Ala Gln Lys Leu Gln 530 535 540 Gly Asn Gly Val Ala Gly Ser Pro Ser Val Val Pro Ala Ala Val Val 545 550 555 560 Ser Ala Ala His Ile Gln Thr Ser Pro Gln Ala Lys Val Leu Leu His 565 570 575 Met Thr Gly Gln Met Thr Val Asn Gln Ala Arg Asn Ala Val Arg Thr 580 585 590 Val Ala Ala His Asn Gln Glu Arg Pro Thr Ala Ala Val Thr Pro Ile 595 600 605 Gln Val Gln Asn Ala Ala Gly Leu Ser Pro Ala Ser Val Gly Leu Ser 610 615 620 His His Ser Leu Ala Ser Pro Gln Pro Ala Pro Leu Met Pro Gly Ser 625 630 635 640 Ala Thr His Thr Ala Ala Ile Ser Ile Ser Arg Ala Ser Ala Pro Leu 645 650 655 Ala Cys Ala Ala Ala Ala Pro Leu Thr Ser Pro Ser Ile Thr Ser Ala 660 665 670 Ser Leu Glu Ala Glu Pro Ser Gly Arg Ile Val Thr Val Leu Pro Gly 675 680 685 Leu Pro Thr Ser Pro Asp Ser Ala Ser Ser Ala Cys Gly Asn Ser Ser 690 695 700 Ala Thr Lys Pro Asp Lys Asp Ser Lys Lys Glu Lys Lys Gly Leu Leu 705 710 715 720 Lys Leu Leu Ser Gly Ala Ser Thr Lys Arg Lys Pro Arg Val Ser Pro 725 730 735 Pro Ala Ser Pro Thr Leu Glu Val Glu Leu Gly Ser Ala Glu Leu Pro 740 745 750 Leu Gln Gly Ala Val Gly Pro Glu Leu Pro Pro Gly Gly Gly His Gly 755 760 765 Arg Ala Gly Ser Cys Pro Val Asp Gly Asp Gly Pro Val Thr Thr Ala 770 775 780 Val Ala Gly Ala Ala Leu Ala Gln Asp Ala Phe His Arg Lys Ala Ser 785 790 795 800 Ser Leu Asp Ser Ala Val Pro Ile Ala Pro Pro Pro Arg Gln Ala Cys 805 810 815 Ser Ser Leu Gly Pro Val Leu Asn Glu Ser Arg Pro Val Val Cys Glu 820 825 830 Arg His Arg Val Val Val Ser Tyr Pro Pro Gln Ser Glu Ala Glu Leu 835 840 845 Glu Leu Lys Glu Gly Asp Ile Val Phe Val His Lys Lys Arg Glu Asp 850 855 860 Gly Trp Phe Lys Gly Thr Leu Gln Arg Asn Gly Lys Thr Gly Leu Phe 865 870 875 880 Pro Gly Ser Phe Val Glu Asn Ile 885 <210> SEQ ID NO 43 <211> LENGTH: 1253 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 43 Met Ala Ala Gln Val Thr Leu Glu Asp Ala Leu Ser Asn Val Asp Leu 1 5 10 15 Leu Glu Glu Leu Pro Leu Pro Asp Gln Gln Pro Cys Ile Glu Pro Pro 20 25 30 Pro Ser Ser Leu Leu Tyr Gln Pro Asn Phe Asn Thr Asn Phe Glu Asp 35 40 45 Arg Asn Ala Phe Val Thr Gly Ile Ala Arg Tyr Ile Glu Gln Ala Thr 50 55 60 Val His Ser Ser Met Asn Glu Met Leu Glu Glu Gly Gln Glu Tyr Ala 65 70 75 80 Val Met Leu Tyr Thr Trp Arg Ser Cys Ser Arg Ala Ile Pro Gln Val 85 90 95 Lys Cys Asn Glu Gln Pro Asn Arg Val Glu Ile Tyr Glu Lys Thr Val 100 105 110 Glu Val Leu Glu Pro Glu Val Thr Lys Leu Met Asn Phe Met Tyr Phe 115 120 125 Gln Arg Asn Ala Ile Glu Arg Phe Cys Gly Glu Val Arg Arg Leu Cys 130 135 140 His Ala Glu Arg Arg Lys Asp Phe Val Ser Glu Ala Tyr Leu Ile Thr 145 150 155 160 Leu Gly Lys Phe Ile Asn Met Phe Ala Val Leu Asp Glu Leu Lys Asn 165 170 175 Met Lys Cys Ser Val Lys Asn Asp His Ser Ala Tyr Lys Arg Ala Ala 180 185 190 Gln Phe Leu Arg Lys Met Ala Asp Pro Gln Ser Ile Gln Glu Ser Gln 195 200 205 Asn Leu Ser Met Phe Leu Ala Asn His Asn Lys Ile Thr Gln Ser Leu 210 215 220 Gln Gln Gln Leu Glu Val Ile Ser Gly Tyr Glu Glu Leu Leu Ala Asp 225 230 235 240 Ile Val Asn Leu Cys Val Asp Tyr Tyr Glu Asn Arg Met Tyr Leu Thr 245 250 255 Pro Ser Glu Lys His Met Leu Leu Lys Val Met Gly Phe Gly Leu Tyr 260 265 270 Leu Met Asp Gly Ser Val Ser Asn Ile Tyr Lys Leu Asp Ala Lys Lys 275 280 285 Arg Ile Asn Leu Ser Lys Ile Asp Lys Tyr Phe Lys Gln Leu Gln Val 290 295 300 Val Pro Leu Phe Gly Asp Met Gln Ile Glu Leu Ala Arg Tyr Ile Lys 305 310 315 320 Thr Ser Ala His Tyr Glu Glu Asn Lys Ser Arg Trp Thr Cys Thr Ser 325 330 335 Ser Gly Ser Ser Pro Gln Tyr Asn Ile Cys Glu Gln Met Ile Gln Ile 340 345 350 Arg Glu Asp His Met Arg Phe Ile Ser Glu Leu Ala Arg Tyr Ser Asn 355 360 365 Ser Glu Val Val Thr Gly Ser Gly Arg Gln Glu Ala Gln Lys Thr Asp 370 375 380 Ala Glu Tyr Arg Lys Leu Phe Asp Leu Ala Leu Gln Gly Leu Gln Leu 385 390 395 400 Leu Ser Gln Trp Ser Ala His Val Met Glu Val Tyr Ser Trp Lys Leu 405 410 415 Val His Pro Thr Asp Lys Tyr Ser Asn Lys Asp Cys Pro Asp Ser Ala 420 425 430 Glu Glu Tyr Glu Arg Ala Thr Arg Tyr Asn Tyr Thr Ser Glu Glu Lys 435 440 445 Phe Ala Leu Val Glu Val Ile Ala Met Ile Lys Gly Leu Gln Val Leu 450 455 460 Met Gly Arg Met Glu Ser Val Phe Asn His Ala Ile Arg His Thr Val 465 470 475 480 Tyr Ala Ala Leu Gln Asp Phe Ser Gln Val Thr Leu Arg Glu Pro Leu 485 490 495 Arg Gln Ala Ile Lys Lys Lys Lys Asn Val Ile Gln Ser Val Leu Gln 500 505 510 Ala Ile Arg Lys Thr Val Cys Asp Trp Glu Thr Gly His Glu Pro Phe 515 520 525 Asn Asp Pro Ala Leu Arg Gly Glu Lys Asp Pro Lys Ser Gly Phe Asp 530 535 540 Ile Lys Val Pro Arg Arg Ala Val Gly Pro Ser Ser Thr Gln Leu Tyr 545 550 555 560 Met Val Arg Thr Met Leu Glu Ser Leu Ile Ala Asp Lys Ser Gly Ser 565 570 575 Lys Lys Thr Leu Arg Ser Ser Leu Glu Gly Pro Thr Ile Leu Asp Ile 580 585 590 Glu Lys Phe His Arg Glu Ser Phe Phe Tyr Thr His Leu Ile Asn Phe 595 600 605 Ser Glu Thr Leu Gln Gln Cys Cys Asp Leu Ser Gln Leu Trp Phe Arg 610 615 620 Glu Phe Phe Leu Glu Leu Thr Met Gly Arg Arg Ile Gln Phe Pro Ile 625 630 635 640 Glu Met Ser Met Pro Trp Ile Leu Thr Asp His Ile Leu Glu Thr Lys 645 650 655 Glu Ala Ser Met Met Glu Tyr Val Leu Tyr Ser Leu Asp Leu Tyr Asn 660 665 670 Asp Ser Ala His Tyr Ala Leu Thr Arg Phe Asn Lys Gln Phe Leu Tyr 675 680 685 Asp Glu Ile Glu Ala Glu Val Asn Leu Cys Phe Asp Gln Phe Val Tyr 690 695 700 Lys Leu Ala Asp Gln Ile Phe Ala Tyr Tyr Lys Val Met Ala Gly Ser 705 710 715 720 Leu Leu Leu Asp Lys Arg Leu Arg Ser Glu Cys Lys Asn Gln Gly Ala 725 730 735 Thr Ile His Leu Pro Pro Ser Asn Arg Tyr Glu Thr Leu Leu Lys Gln 740 745 750 Arg His Val Gln Leu Leu Gly Arg Ser Ile Asp Leu Asn Arg Leu Ile 755 760 765 Thr Gln Arg Val Ser Ala Ala Met Tyr Lys Ser Leu Glu Leu Ala Ile 770 775 780 Gly Arg Phe Glu Ser Glu Asp Leu Thr Ser Ile Val Glu Leu Asp Gly 785 790 795 800 Leu Leu Glu Ile Asn Arg Met Thr His Lys Leu Leu Ser Arg Tyr Leu 805 810 815 Thr Leu Asp Gly Phe Asp Ala Met Phe Arg Glu Ala Asn His Asn Val 820 825 830 Ser Ala Pro Tyr Gly Arg Ile Thr Leu His Val Phe Trp Glu Leu Asn 835 840 845 Tyr Asp Phe Leu Pro Asn Tyr Cys Tyr Asn Gly Ser Thr Asn Arg Phe 850 855 860 Val Arg Thr Val Leu Pro Phe Ser Gln Glu Phe Gln Arg Asp Lys Gln 865 870 875 880 Pro Asn Ala Gln Pro Gln Tyr Leu His Gly Ser Lys Ala Leu Asn Leu 885 890 895 Ala Tyr Ser Ser Ile Tyr Gly Ser Tyr Arg Asn Phe Val Gly Pro Pro 900 905 910 His Phe Gln Val Ile Cys Arg Leu Leu Gly Tyr Gln Gly Ile Ala Val 915 920 925 Val Met Glu Glu Leu Leu Lys Val Val Lys Ser Leu Leu Gln Gly Thr 930 935 940 Ile Leu Gln Tyr Val Lys Thr Leu Met Glu Val Met Pro Lys Ile Cys 945 950 955 960 Arg Leu Pro Arg His Glu Tyr Gly Ser Pro Gly Ile Leu Glu Phe Phe 965 970 975 His His Gln Leu Lys Asp Ile Val Glu Tyr Ala Glu Leu Lys Thr Val 980 985 990 Cys Phe Gln Asn Leu Arg Glu Val Gly Asn Ala Ile Leu Phe Cys Leu 995 1000 1005 Leu Ile Glu Gln Ser Leu Ser Leu Glu Glu Val Cys Asp Leu Leu His 1010 1015 1020 Ala Ala Pro Phe Gln Asn Ile Leu Pro Arg Val His Val Lys Glu Gly 1025 1030 1035 1040 Glu Arg Leu Asp Ala Lys Met Lys Arg Leu Glu Ser Lys Tyr Ala Pro 1045 1050 1055 Leu His Leu Val Pro Leu Ile Glu Arg Leu Gly Thr Pro Gln Gln Ile 1060 1065 1070 Ala Ile Ala Arg Glu Gly Asp Leu Leu Thr Lys Glu Arg Leu Cys Cys 1075 1080 1085 Gly Leu Ser Met Phe Glu Val Ile Leu Thr Arg Ile Arg Ser Phe Leu 1090 1095 1100 Asp Asp Pro Ile Trp Arg Gly Pro Leu Pro Ser Asn Gly Val Met His 1105 1110 1115 1120 Val Asp Glu Cys Val Glu Phe His Arg Leu Trp Ser Ala Met Gln Phe 1125 1130 1135 Val Tyr Cys Ile Pro Val Gly Thr His Glu Phe Thr Val Glu Gln Cys 1140 1145 1150 Phe Gly Asp Gly Leu His Trp Ala Gly Cys Met Ile Ile Val Leu Leu 1155 1160 1165 Gly Gln Gln Arg Arg Phe Ala Val Leu Asp Phe Cys Tyr His Leu Leu 1170 1175 1180 Lys Val Gln Lys His Asp Gly Lys Asp Glu Ile Ile Lys Asn Val Pro 1185 1190 1195 1200 Leu Lys Lys Met Val Glu Arg Ile Arg Lys Phe Gln Ile Leu Asn Asp 1205 1210 1215 Glu Ile Ile Thr Ile Leu Asp Lys Tyr Leu Lys Ser Gly Asp Gly Glu 1220 1225 1230 Gly Thr Pro Val Glu His Val Arg Cys Phe Gln Pro Pro Ile His Gln 1235 1240 1245 Ser Leu Ala Ser Ser 1250 <210> SEQ ID NO 44 <211> LENGTH: 1496 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 44 Met Ala Leu Ser Lys Gly Leu Arg Leu Leu Gly Arg Leu Gly Ala Glu 1 5 10 15 Gly Asp Cys Ser Val Leu Leu Glu Ala Arg Gly Arg Asp Asp Cys Leu 20 25 30 Leu Phe Glu Ala Gly Thr Val Ala Thr Leu Ala Pro Glu Glu Lys Glu 35 40 45 Val Ile Lys Gly Gln Tyr Gly Lys Leu Thr Asp Ala Tyr Gly Cys Leu 50 55 60 Gly Glu Leu Arg Leu Lys Ser Gly Gly Thr Ser Leu Ser Phe Leu Val 65 70 75 80 Leu Val Thr Gly Cys Thr Ser Val Gly Arg Ile Pro Asp Ala Glu Ile 85 90 95 Tyr Lys Ile Thr Ala Thr Asp Phe Tyr Pro Leu Gln Glu Glu Ala Lys 100 105 110 Glu Glu Glu Arg Leu Ile Ala Leu Lys Lys Ile Leu Ser Ser Gly Val 115 120 125 Phe Tyr Phe Ser Trp Pro Asn Asp Gly Ser Arg Phe Asp Leu Thr Val 130 135 140 Arg Thr Gln Lys Gln Gly Asp Asp Ser Ser Glu Trp Gly Asn Ser Phe 145 150 155 160 Phe Trp Asn Gln Leu Leu His Val Pro Leu Arg Gln His Gln Val Ser 165 170 175 Cys Cys Asp Trp Leu Leu Lys Ile Ile Cys Gly Val Val Thr Ile Arg 180 185 190 Thr Val Tyr Ala Ser His Lys Gln Ala Lys Ala Cys Leu Val Ser Arg 195 200 205 Val Ser Cys Glu Arg Thr Gly Thr Arg Phe His Thr Arg Gly Val Asn 210 215 220 Asp Asp Gly His Val Ser Asn Phe Val Glu Thr Glu Gln Met Ile Tyr 225 230 235 240 Met Asp Asp Gly Val Ser Ser Phe Val Gln Ile Arg Gly Ser Val Pro 245 250 255 Leu Phe Trp Glu Gln Pro Gly Leu Gln Val Gly Ser His His Leu Arg 260 265 270 Leu His Arg Gly Leu Glu Ala Asn Ala Pro Ala Phe Asp Arg His Met 275 280 285 Val Leu Leu Lys Glu Gln Tyr Gly Gln Gln Val Val Val Asn Leu Leu 290 295 300 Gly Ser Arg Gly Gly Glu Glu Val Leu Asn Arg Ala Phe Lys Lys Leu 305 310 315 320 Leu Trp Ala Ser Cys His Ala Gly Asp Thr Pro Met Ile Asn Phe Asp 325 330 335 Phe His Gln Phe Ala Lys Gly Gly Lys Leu Glu Lys Leu Glu Thr Leu 340 345 350 Leu Arg Pro Gln Leu Lys Leu His Trp Glu Asp Phe Asp Val Phe Thr 355 360 365 Lys Gly Glu Asn Val Ser Pro Arg Phe Gln Lys Gly Thr Leu Arg Met 370 375 380 Asn Cys Leu Asp Cys Leu Asp Arg Thr Asn Thr Val Gln Ser Phe Ile 385 390 395 400 Ala Leu Glu Val Leu His Leu Gln Leu Lys Thr Leu Gly Leu Ser Ser 405 410 415 Lys Pro Ile Val Asp Arg Phe Val Glu Ser Phe Lys Ala Met Trp Ser 420 425 430 Leu Asn Gly His Ser Leu Ser Lys Val Phe Thr Gly Ser Arg Ala Leu 435 440 445 Glu Gly Lys Ala Lys Val Gly Lys Leu Lys Asp Gly Ala Arg Ser Met 450 455 460 Ser Arg Thr Ile Gln Ser Asn Phe Phe Asp Gly Val Lys Gln Glu Ala 465 470 475 480 Ile Lys Leu Leu Leu Val Gly Asp Val Tyr Gly Glu Glu Val Ala Asp 485 490 495 Lys Gly Gly Met Leu Leu Asp Ser Thr Ala Leu Leu Val Thr Pro Arg 500 505 510 Ile Leu Lys Ala Met Thr Glu Arg Gln Ser Glu Phe Thr Asn Phe Lys 515 520 525 Arg Ile Arg Ile Ala Met Gly Thr Trp Asn Val Asn Gly Gly Lys Gln 530 535 540 Phe Arg Ser Asn Val Leu Arg Thr Ala Glu Leu Thr Asp Trp Leu Leu 545 550 555 560 Asp Ser Pro Gln Leu Ser Gly Ala Thr Asp Ser Gln Asp Asp Ser Ser 565 570 575 Pro Ala Asp Ile Phe Ala Val Gly Phe Glu Glu Met Val Glu Leu Ser 580 585 590 Ala Gly Asn Ile Val Asn Ala Ser Thr Thr Asn Lys Lys Met Trp Gly 595 600 605 Glu Gln Leu Gln Lys Ala Ile Ser Arg Ser His Arg Tyr Ile Leu Leu 610 615 620 Thr Ser Ala Gln Leu Val Gly Val Cys Leu Tyr Ile Phe Val Arg Pro 625 630 635 640 Tyr His Val Pro Phe Ile Arg Asp Val Ala Ile Asp Thr Val Lys Thr 645 650 655 Gly Met Gly Gly Lys Ala Gly Asn Lys Gly Ala Val Gly Ile Arg Phe 660 665 670 Gln Phe His Ser Thr Ser Phe Cys Phe Ile Cys Ser His Leu Thr Ala 675 680 685 Gly Gln Ser Gln Val Lys Glu Arg Asn Glu Asp Tyr Lys Glu Ile Thr 690 695 700 Gln Lys Leu Cys Phe Pro Met Gly Arg Asn Val Phe Ser His Asp Tyr 705 710 715 720 Val Phe Trp Cys Gly Asp Phe Asn Tyr Arg Ile Asp Leu Thr Tyr Glu 725 730 735 Glu Val Phe Tyr Phe Val Lys Arg Gln Asp Trp Lys Lys Leu Leu Glu 740 745 750 Phe Asp Gln Leu Gln Leu Gln Lys Ser Ser Gly Lys Ile Phe Lys Asp 755 760 765 Phe His Glu Gly Ala Ile Asn Phe Gly Pro Thr Tyr Lys Tyr Asp Val 770 775 780 Gly Ser Ala Ala Tyr Asp Thr Ser Asp Lys Cys Arg Thr Pro Ala Trp 785 790 795 800 Thr Asp Arg Val Leu Trp Trp Arg Lys Lys His Pro Phe Asp Lys Thr 805 810 815 Ala Gly Glu Leu Asn Leu Leu Asp Ser Asp Leu Asp Val Asp Thr Lys 820 825 830 Val Arg His Thr Trp Ser Pro Gly Ala Leu Gln Tyr Tyr Gly Arg Ala 835 840 845 Glu Leu Gln Ala Ser Asp His Arg Pro Val Leu Ala Ile Val Glu Val 850 855 860 Glu Val Gln Glu Val Asp Val Gly Ala Arg Glu Arg Val Phe Gln Glu 865 870 875 880 Val Ser Ser Phe Gln Gly Pro Leu Asp Ala Thr Val Val Val Asn Leu 885 890 895 Gln Ser Pro Thr Leu Glu Glu Lys Asn Glu Phe Pro Glu Asp Leu Arg 900 905 910 Thr Glu Leu Met Gln Thr Leu Gly Ser Tyr Gly Thr Ile Val Leu Val 915 920 925 Arg Ile Asn Gln Gly Gln Met Leu Val Thr Phe Ala Asp Ser His Ser 930 935 940 Ala Leu Ser Val Leu Asp Val Asp Gly Met Lys Val Lys Gly Arg Ala 945 950 955 960 Val Lys Ile Arg Pro Lys Thr Lys Asp Trp Leu Lys Gly Leu Arg Glu 965 970 975 Glu Ile Ile Arg Lys Arg Asp Ser Met Ala Pro Val Ser Pro Thr Ala 980 985 990 Asn Ser Cys Leu Leu Glu Glu Asn Phe Asp Phe Thr Ser Leu Asp Tyr 995 1000 1005 Glu Ser Glu Gly Asp Ile Leu Glu Asp Asp Glu Asp Tyr Leu Val Asp 1010 1015 1020 Glu Phe Asn Gln Pro Gly Val Ser Asp Ser Glu Leu Gly Gly Asp Asp 1025 1030 1035 1040 Leu Ser Asp Val Pro Gly Pro Thr Ala Leu Ala Pro Pro Ser Lys Ser 1045 1050 1055 Pro Ala Leu Thr Lys Lys Lys Gln His Pro Thr Tyr Lys Asp Asp Ala 1060 1065 1070 Asp Leu Val Glu Leu Lys Arg Glu Leu Glu Ala Val Gly Glu Phe Arg 1075 1080 1085 His Arg Ser Pro Ser Arg Ser Leu Ser Val Pro Asn Arg Pro Arg Pro 1090 1095 1100 Pro Gln Pro Pro Gln Arg Pro Pro Pro Pro Thr Gly Leu Met Val Lys 1105 1110 1115 1120 Lys Ser Ala Ser Asp Ala Ser Ile Ser Ser Gly Thr His Gly Gln Tyr 1125 1130 1135 Ser Ile Leu Gln Thr Ala Arg Leu Leu Pro Gly Ala Pro Gln Gln Pro 1140 1145 1150 Pro Lys Ala Arg Thr Gly Ile Ser Lys Pro Tyr Asn Val Lys Gln Ile 1155 1160 1165 Lys Thr Thr Asn Ala Gln Glu Ala Glu Ala Ala Ile Arg Cys Leu Leu 1170 1175 1180 Glu Ala Arg Gly Gly Ala Ser Glu Glu Ala Leu Ser Ala Val Ala Pro 1185 1190 1195 1200 Arg Asp Leu Glu Ala Ser Ser Glu Pro Glu Pro Thr Pro Gly Ala Ala 1205 1210 1215 Lys Pro Glu Thr Pro Gln Ala Pro Pro Leu Leu Pro Arg Arg Pro Pro 1220 1225 1230 Pro Arg Val Pro Ala Ile Lys Lys Pro Thr Leu Arg Arg Thr Gly Lys 1235 1240 1245 Pro Leu Ser Pro Glu Glu Gln Phe Glu Gln Gln Thr Val His Phe Thr 1250 1255 1260 Ile Gly Pro Pro Glu Thr Ser Val Glu Ala Pro Pro Val Val Thr Ala 1265 1270 1275 1280 Pro Arg Val Pro Pro Val Pro Lys Pro Arg Thr Phe Gln Pro Gly Lys 1285 1290 1295 Ala Ala Glu Arg Pro Ser His Arg Lys Pro Ala Ser Asp Glu Ala Pro 1300 1305 1310 Pro Gly Ala Gly Ala Ser Val Pro Pro Pro Leu Glu Ala Pro Pro Leu 1315 1320 1325 Val Pro Lys Val Pro Pro Arg Arg Lys Lys Ser Ala Pro Ala Ala Phe 1330 1335 1340 His Leu Gln Val Leu Gln Ser Asn Ser Gln Leu Leu Gln Gly Leu Thr 1345 1350 1355 1360 Tyr Asn Ser Ser Asp Ser Pro Ser Gly His Pro Pro Ala Ala Gly Thr 1365 1370 1375 Val Phe Pro Gln Gly Asp Phe Leu Ser Thr Ser Ser Ala Thr Ser Pro 1380 1385 1390 Asp Ser Asp Gly Thr Lys Ala Met Lys Pro Glu Ala Ala Pro Leu Leu 1395 1400 1405 Gly Asp Tyr Gln Asp Pro Phe Trp Asn Leu Leu His His Pro Lys Leu 1410 1415 1420 Leu Asn Asn Thr Trp Leu Ser Lys Ser Ser Asp Pro Leu Asp Ser Gly 1425 1430 1435 1440 Thr Arg Ser Pro Lys Arg Asp Pro Ile Asp Pro Val Ser Ala Gly Ala 1445 1450 1455 Ser Ala Ala Lys Ala Glu Leu Pro Pro Asp His Glu His Lys Thr Leu 1460 1465 1470 Gly His Trp Val Thr Ile Ser Asp Gln Glu Lys Arg Thr Ala Leu Gln 1475 1480 1485 Val Phe Asp Pro Leu Ala Lys Thr 1490 1495 <210> SEQ ID NO 45 <211> LENGTH: 12 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (3), (5), (7), (9) <223> OTHER INFORMATION: Xaa is any amino acid <400> SEQUENCE: 45 Ile Ser Xaa Pro Xaa Phe Xaa His Xaa His Val Gly 1 5 10 <210> SEQ ID NO 46 <211> LENGTH: 1038 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 46 Met Gln Pro Glu Glu Gly Thr Gly Trp Leu Leu Glu Leu Leu Ser Glu 1 5 10 15 Val Gln Leu Gln Gln Tyr Phe Leu Arg Leu Arg Asp Asp Leu Asn Val 20 25 30 Thr Arg Leu Ser His Phe Glu Tyr Val Lys Asn Glu Asp Leu Glu Lys 35 40 45 Ile Gly Met Gly Arg Pro Gly Gln Arg Arg Leu Trp Glu Ala Val Lys 50 55 60 Arg Arg Lys Ala Leu Cys Lys Arg Lys Ser Trp Met Ser Lys Val Phe 65 70 75 80 Ser Gly Lys Arg Leu Glu Ala Glu Phe Pro Pro His His Ser Gln Ser 85 90 95 Thr Phe Arg Lys Thr Ser Pro Ala Pro Gly Gly Pro Ala Gly Glu Gly 100 105 110 Pro Leu Gln Ser Leu Thr Cys Leu Ile Gly Glu Lys Asp Leu Arg Leu 115 120 125 Leu Glu Lys Leu Gly Asp Gly Ser Phe Gly Val Val Arg Arg Gly Glu 130 135 140 Trp Asp Ala Pro Ser Gly Lys Thr Val Ser Val Ala Val Lys Cys Leu 145 150 155 160 Lys Pro Asp Val Leu Ser Gln Pro Glu Ala Met Asp Asp Phe Ile Arg 165 170 175 Glu Val Asn Ala Met His Ser Leu Asp His Arg Asn Leu Ile Arg Leu 180 185 190 Tyr Gly Val Val Leu Thr Pro Pro Met Lys Met Val Thr Glu Leu Ala 195 200 205 Pro Leu Gly Ser Leu Leu Asp Arg Leu Arg Lys His Gln Gly His Phe 210 215 220 Leu Leu Gly Thr Leu Ser Arg Tyr Ala Val Gln Val Ala Glu Gly Met 225 230 235 240 Gly Tyr Leu Glu Ser Lys Arg Phe Ile His Arg Asp Leu Ala Ala Arg 245 250 255 Asn Leu Leu Leu Ala Thr Arg Asp Leu Val Lys Ile Gly Asp Phe Gly 260 265 270 Leu Met Arg Ala Leu Pro Gln Asn Asp Asp His Tyr Val Met Gln Glu 275 280 285 His Arg Lys Val Pro Phe Ala Trp Cys Ala Pro Glu Ser Leu Lys Thr 290 295 300 Arg Thr Phe Ser His Ala Ser Asp Thr Trp Met Phe Gly Val Thr Leu 305 310 315 320 Trp Glu Met Phe Thr Tyr Gly Gln Glu Pro Trp Ile Gly Leu Asn Gly 325 330 335 Ser Gln Ile Leu His Lys Ile Asp Lys Glu Gly Glu Arg Leu Pro Arg 340 345 350 Pro Glu Asp Cys Pro Gln Asp Ile Tyr Asn Val Met Val Gln Cys Trp 355 360 365 Ala His Lys Pro Glu Asp Arg Pro Thr Phe Val Ala Leu Arg Asp Phe 370 375 380 Leu Leu Glu Ala Gln Pro Thr Asp Met Arg Ala Leu Gln Asp Phe Glu 385 390 395 400 Glu Pro Asp Lys Leu His Ile Gln Met Asn Asp Val Ile Thr Val Ile 405 410 415 Glu Gly Arg Ala Glu Asn Tyr Trp Trp Arg Gly Gln Asn Thr Arg Thr 420 425 430 Leu Cys Val Gly Pro Phe Pro Arg Asn Val Val Thr Ser Val Ala Gly 435 440 445 Leu Ser Ala Gln Asp Ile Ser Gln Pro Leu Gln Asn Ser Phe Ile His 450 455 460 Thr Gly His Gly Asp Ser Asp Pro Arg His Cys Trp Gly Phe Pro Asp 465 470 475 480 Arg Ile Asp Glu Leu Tyr Leu Gly Asn Pro Met Asp Pro Pro Asp Leu 485 490 495 Leu Ser Val Glu Leu Ser Thr Ser Arg Pro Pro Gln His Leu Gly Gly 500 505 510 Val Lys Lys Pro Thr Tyr Asp Pro Val Ser Glu Asp Gln Asp Pro Leu 515 520 525 Ser Ser Asp Phe Lys Arg Leu Gly Leu Arg Lys Pro Gly Leu Pro Arg 530 535 540 Gly Leu Trp Leu Ala Lys Pro Ser Ala Arg Val Pro Gly Thr Lys Ala 545 550 555 560 Ser Arg Gly Ser Gly Ala Glu Val Thr Leu Ile Asp Phe Gly Glu Glu 565 570 575 Pro Val Val Pro Ala Leu Arg Pro Cys Ala Pro Ser Leu Ala Gln Leu 580 585 590 Ala Met Asp Ala Cys Ser Leu Leu Asp Glu Thr Pro Pro Gln Ser Pro 595 600 605 Thr Arg Ala Leu Pro Arg Pro Leu His Pro Thr Pro Val Val Asp Trp 610 615 620 Asp Ala Arg Pro Leu Pro Pro Pro Pro Ala Tyr Asp Asp Val Ala Gln 625 630 635 640 Asp Glu Asp Asp Phe Glu Ile Cys Ser Ile Asn Ser Thr Leu Val Gly 645 650 655 Ala Gly Val Pro Ala Gly Pro Ser Gln Gly Gln Thr Asn Tyr Ala Phe 660 665 670 Val Pro Glu Gln Ala Arg Pro Pro Pro Pro Leu Glu Asp Asn Leu Phe 675 680 685 Leu Pro Pro Gln Gly Gly Gly Lys Pro Pro Ser Ser Ala Gln Thr Ala 690 695 700 Glu Ile Phe Gln Ala Leu Gln Gln Glu Cys Met Arg Gln Leu Gln Ala 705 710 715 720 Pro Ala Gly Ser Pro Ala Pro Ser Pro Ser Pro Gly Gly Asp Asp Lys 725 730 735 Pro Gln Val Pro Pro Arg Val Pro Ile Pro Pro Arg Pro Thr Arg Pro 740 745 750 His Val Gln Leu Ser Pro Ala Pro Pro Gly Glu Glu Glu Thr Ser Gln 755 760 765 Trp Pro Gly Pro Ala Ser Pro Pro Arg Val Pro Pro Arg Glu Pro Leu 770 775 780 Ser Pro Gln Gly Ser Arg Thr Pro Ser Pro Leu Val Pro Pro Gly Ser 785 790 795 800 Ser Pro Leu Pro Pro Arg Leu Ser Ser Ser Pro Gly Lys Thr Met Pro 805 810 815 Thr Thr Gln Ser Phe Ala Ser Asp Pro Lys Tyr Ala Thr Pro Gln Val 820 825 830 Ile Gln Ala Pro Gly Pro Arg Ala Gly Pro Cys Ile Leu Pro Ile Val 835 840 845 Arg Asp Gly Lys Lys Val Ser Ser Thr His Tyr Tyr Leu Leu Pro Glu 850 855 860 Arg Pro Ser Tyr Leu Glu Arg Tyr Gln Arg Phe Leu Arg Glu Ala Gln 865 870 875 880 Ser Pro Glu Glu Pro Thr Pro Leu Pro Val Pro Leu Leu Leu Pro Pro 885 890 895 Pro Ser Thr Pro Ala Pro Ala Ala Pro Thr Ala Thr Val Arg Pro Met 900 905 910 Pro Gln Ala Ala Leu Asp Pro Lys Ala Asn Phe Ser Thr Asn Asn Ser 915 920 925 Asn Pro Gly Ala Arg Pro Pro Pro Pro Arg Ala Thr Ala Arg Leu Pro 930 935 940 Gln Arg Gly Cys Pro Gly Asp Gly Pro Glu Ala Gly Arg Pro Ala Asp 945 950 955 960 Lys Ile Gln Met Ala Met Val His Gly Val Thr Thr Glu Glu Cys Gln 965 970 975 Ala Ala Leu Gln Cys His Gly Trp Ser Val Gln Arg Ala Ala Gln Tyr 980 985 990 Leu Lys Val Glu Gln Leu Phe Gly Leu Gly Leu Arg Pro Arg Gly Glu 995 1000 1005 Cys His Lys Val Leu Glu Met Phe Asp Trp Asn Leu Glu Gln Ala Gly 1010 1015 1020 Cys His Leu Leu Gly Ser Trp Gly Pro Ala His His Lys Arg 1025 1030 1035 <210> SEQ ID NO 47 <211> LENGTH: 747 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 47 Met Gln Pro Glu Glu Gly Thr Gly Trp Leu Leu Glu Leu Leu Ser Glu 1 5 10 15 Val Gln Leu Gln Gln Tyr Phe Leu Arg Leu Arg Asp Asp Leu Asn Val 20 25 30 Thr Arg Leu Ser His Phe Glu Tyr Val Lys Asn Glu Asp Leu Glu Lys 35 40 45 Ile Gly Met Gly Arg Pro Gly Gln Arg Arg Leu Trp Glu Ala Val Lys 50 55 60 Arg Arg Lys Ala Met Cys Lys Arg Lys Ser Trp Met Ser Lys Val Phe 65 70 75 80 Ser Gly Lys Arg Leu Glu Ala Glu Phe Pro Pro His His Ser Gln Ser 85 90 95 Thr Phe Arg Lys Thr Ser Pro Thr Pro Gly Gly Ser Ala Gly Glu Gly 100 105 110 Ser Leu Gln Ser Leu Thr Cys Leu Ile Gly Glu Lys Asp Leu His Leu 115 120 125 Phe Glu Lys Leu Gly Asp Gly Ser Phe Gly Val Val Arg Arg Gly Glu 130 135 140 Trp Asp Ala Pro Ser Gly Lys Thr Val Ser Val Ala Val Lys Cys Leu 145 150 155 160 Lys Pro Asp Val Leu Ser Gln Pro Glu Ala Met Asp Asp Phe Ile Arg 165 170 175 Glu Val Asn Ala Met His Ser Leu Asp His Arg Asn Leu Ile Arg Leu 180 185 190 Tyr Gly Val Val Leu Thr Pro Pro Met Lys Met Val Thr Glu Leu Ala 195 200 205 Pro Leu Gly Ser Leu Leu Asp Arg Leu Arg Lys His Gln Gly His Phe 210 215 220 Leu Leu Gly Thr Leu Ser Arg Tyr Ala Val Gln Val Ala Glu Gly Met 225 230 235 240 Gly Tyr Leu Glu Ala Lys Arg Phe Ile His Arg Asp Leu Ala Ala Arg 245 250 255 Asn Leu Leu Leu Ala Thr Arg Asp Leu Val Lys Ile Gly Asp Phe Gly 260 265 270 Leu Met Arg Ala Leu Pro Gln Asn Asp Asp His Tyr Val Met Gln Glu 275 280 285 His Arg Lys Val Pro Phe Ala Trp Cys Ala Pro Glu Ser Leu Lys Thr 290 295 300 Arg Thr Phe Ser His Ala Ser Asp Thr Trp Met Phe Gly Val Thr Leu 305 310 315 320 Trp Glu Met Phe Thr Tyr Gly Gln Glu Pro Trp Ile Gly Leu Asn Gly 325 330 335 Ser Gln Ile Leu His Lys Ile Asp Lys Glu Gly Glu Arg Leu Pro Arg 340 345 350 Pro Glu Asp Cys Pro Gln Asp Ile Tyr Asn Val Met Val Gln Cys Trp 355 360 365 Ala His Lys Pro Glu Asp Arg Pro Thr Phe Val Ala Leu Arg Asp Phe 370 375 380 Leu Leu Glu Ala Gln Pro Thr Asp Met Arg Ala Leu Gln Asp Phe Glu 385 390 395 400 Glu Pro Asp Lys Leu His Ile Gln Met Asn Asp Val Ile Thr Val Ile 405 410 415 Glu Gly Arg Ala Glu Asn Tyr Trp Trp Arg Gly Gln Asn Thr Arg Thr 420 425 430 Leu Cys Val Gly Pro Phe Pro Arg Asn Val Val Thr Ser Val Ala Gly 435 440 445 Leu Ser Ala Gln Asp Ile Ser Gln Pro Leu Gln Asn Ser Phe Ile His 450 455 460 Thr Gly His Gly Asp Ser Asp Pro Arg His Cys Trp Gly Phe Pro Asp 465 470 475 480 Lys Ile Asp Glu Leu Tyr Leu Gly Asn Pro Met Asp Pro Pro Asp Leu 485 490 495 Leu Ser Val Glu Leu Ser Thr Ser Arg Pro Thr Gln His Leu Gly Arg 500 505 510 Val Lys Arg Glu Pro Pro Pro Arg Pro Pro Gln Pro Ala Ile Phe Thr 515 520 525 Gln Lys Pro Thr Tyr Asp Pro Val Ser Glu Asp Gln Asp Pro Leu Ser 530 535 540 Ser Asp Phe Lys Lys Leu Gly Leu Arg Lys Pro Gly Leu Pro Arg Gly 545 550 555 560 Leu Trp Leu Ala Lys Pro Ser Ala Arg Val Pro Gly Thr Lys Ala Gly 565 570 575 Arg Gly Gly Gly Glu Val Thr Leu Ile Asp Phe Gly Glu Glu Pro Val 580 585 590 Val Pro Ala Pro Arg Pro Cys Ala Pro Ser Leu Ala Gln Leu Ala Met 595 600 605 Asp Ala Cys Ser Leu Leu Asp Lys Thr Pro Pro Gln Ser Pro Thr Arg 610 615 620 Ala Leu Pro Arg Pro Leu His Pro Thr Pro Val Val Asp Trp Asp Ala 625 630 635 640 Arg Pro Leu Pro Pro Pro Pro Ala Tyr Asp Asp Val Ala Gln Asp Glu 645 650 655 Asp Asp Phe Glu Val Cys Ser Ile Asn Ser Thr Leu Val Gly Ala Gly 660 665 670 Val Ser Ala Glu Pro Ser Gln Gly Glu Thr Asn Tyr Ala Phe Val Pro 675 680 685 Glu Pro Ala Arg Leu Leu Pro Pro Ala Gly Gly Gln Pro Val Pro Pro 690 695 700 Thr Pro Glu Trp Gly Gln Ala Thr Gln Leu Gly Pro Asn Arg Arg Asp 705 710 715 720 Leu Pro Gly Ala Ala Ala Gly Met His Ala Ala Ala Thr Gly Pro Ala 725 730 735 Trp Leu Ser Gly Pro Leu Thr Gln Pro Trp Gly 740 745 <210> SEQ ID NO 48 <211> LENGTH: 591 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 48 Met Phe Gly Lys Arg Lys Lys Arg Val Glu Ile Ser Ala Pro Ser Asn 1 5 10 15 Phe Glu His Arg Val His Thr Gly Phe Asp Gln His Glu Gln Lys Phe 20 25 30 Thr Gly Leu Pro Arg Gln Trp Gln Ser Leu Ile Glu Glu Ser Ala Arg 35 40 45 Arg Pro Lys Pro Leu Val Asp Pro Ala Cys Ile Thr Ser Ile Gln Pro 50 55 60 Gly Ala Pro Lys Thr Ile Val Arg Gly Ser Lys Gly Ala Lys Asp Gly 65 70 75 80 Ala Leu Thr Leu Leu Leu Asp Glu Phe Glu Asn Met Ser Val Thr Arg 85 90 95 Ser Asn Ser Leu Arg Arg Asp Ser Pro Pro Pro Pro Ala Arg Ala Arg 100 105 110 Gln Glu Asn Gly Met Pro Glu Glu Pro Ala Thr Thr Ala Arg Gly Gly 115 120 125 Pro Gly Lys Ala Gly Ser Arg Gly Arg Phe Ala Gly His Ser Glu Ala 130 135 140 Gly Gly Gly Ser Gly Asp Arg Arg Arg Ala Gly Pro Glu Lys Arg Pro 145 150 155 160 Lys Ser Ser Arg Glu Gly Ser Gly Gly Pro Gln Glu Ser Ser Arg Asp 165 170 175 Lys Arg Pro Leu Ser Gly Pro Asp Val Gly Thr Pro Gln Pro Ala Gly 180 185 190 Leu Ala Ser Gly Ala Lys Leu Ala Ala Gly Arg Pro Phe Asn Thr Tyr 195 200 205 Pro Arg Ala Asp Thr Asp His Pro Ser Arg Gly Ala Gln Gly Glu Pro 210 215 220 His Asp Val Ala Pro Asn Gly Pro Ser Ala Gly Gly Leu Ala Ile Pro 225 230 235 240 Gln Ser Ser Ser Ser Ser Ser Arg Pro Pro Thr Arg Ala Arg Gly Ala 245 250 255 Pro Ser Pro Gly Val Leu Gly Pro His Ala Ser Glu Pro Gln Leu Ala 260 265 270 Pro Pro Ala Cys Thr Pro Ala Ala Pro Ala Val Pro Gly Pro Pro Gly 275 280 285 Pro Arg Ser Pro Gln Arg Glu Pro Gln Arg Val Ser His Glu Gln Phe 290 295 300 Arg Ala Ala Leu Gln Leu Val Val Asp Pro Gly Asp Pro Arg Ser Tyr 305 310 315 320 Leu Asp Asn Phe Ile Lys Ile Gly Glu Gly Ser Thr Gly Ile Val Cys 325 330 335 Ile Ala Thr Val Arg Ser Ser Gly Lys Leu Val Ala Val Lys Lys Met 340 345 350 Asp Leu Arg Lys Gln Gln Arg Arg Glu Leu Leu Phe Asn Glu Val Val 355 360 365 Ile Met Arg Asp Tyr Gln His Glu Asn Val Val Glu Met Tyr Asn Ser 370 375 380 Tyr Leu Val Gly Asp Glu Leu Trp Val Val Met Glu Phe Leu Glu Gly 385 390 395 400 Gly Ala Leu Thr Asp Ile Val Thr His Thr Arg Met Asn Glu Glu Gln 405 410 415 Ile Ala Ala Val Cys Leu Ala Val Leu Gln Ala Leu Ser Val Leu His 420 425 430 Ala Gln Gly Val Ile His Arg Asp Ile Lys Ser Asp Ser Ile Leu Leu 435 440 445 Thr His Asp Gly Arg Val Lys Leu Ser Asp Phe Gly Phe Cys Ala Gln 450 455 460 Val Ser Lys Glu Val Pro Arg Arg Lys Ser Leu Val Gly Thr Pro Tyr 465 470 475 480 Trp Met Ala Pro Glu Leu Ile Ser Arg Leu Pro Tyr Gly Pro Glu Val 485 490 495 Asp Ile Trp Ser Leu Gly Ile Met Val Ile Glu Met Val Asp Gly Glu 500 505 510 Pro Pro Tyr Phe Asn Glu Pro Pro Leu Lys Ala Met Lys Met Ile Arg 515 520 525 Asp Asn Leu Pro Pro Arg Leu Lys Asn Leu His Lys Val Ser Pro Ser 530 535 540 Leu Lys Gly Phe Leu Asp Arg Leu Leu Val Arg Asp Pro Ala Gln Arg 545 550 555 560 Ala Thr Ala Ala Glu Leu Leu Lys His Pro Phe Leu Ala Lys Ala Gly 565 570 575 Pro Pro Ala Ser Ile Val Pro Leu Met Arg Gln Asn Arg Thr Arg 580 585 590 <210> SEQ ID NO 49 <211> LENGTH: 502 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 49 Met Ser Gly Gly Pro Met Gly Gly Arg Pro Gly Gly Arg Gly Ala Pro 1 5 10 15 Ala Val Gln Gln Asn Ile Pro Ser Thr Leu Leu Gln Asp His Glu Asn 20 25 30 Gln Arg Leu Phe Glu Met Leu Gly Arg Lys Cys Leu Thr Leu Ala Thr 35 40 45 Ala Val Val Gln Leu Tyr Leu Ala Leu Pro Pro Gly Ala Glu His Trp 50 55 60 Thr Lys Glu His Cys Gly Ala Val Cys Phe Val Lys Asp Asn Pro Gln 65 70 75 80 Lys Ser Tyr Phe Ile Arg Leu Tyr Gly Leu Gln Ala Gly Arg Leu Leu 85 90 95 Trp Glu Gln Glu Leu Tyr Ser Gln Leu Val Tyr Ser Thr Pro Thr Pro 100 105 110 Phe Phe His Thr Phe Ala Gly Asp Asp Cys Gln Ala Gly Leu Asn Phe 115 120 125 Ala Asp Glu Asp Glu Ala Gln Ala Phe Arg Ala Leu Val Gln Glu Lys 130 135 140 Ile Gln Lys Arg Asn Gln Arg Gln Ser Gly Asp Arg Arg Gln Leu Pro 145 150 155 160 Pro Pro Pro Thr Pro Ala Asn Glu Glu Arg Arg Gly Gly Leu Pro Pro 165 170 175 Leu Pro Leu His Pro Gly Gly Asp Gln Gly Gly Pro Pro Val Gly Pro 180 185 190 Leu Ser Leu Gly Leu Ala Thr Val Asp Ile Gln Asn Pro Asp Ile Thr 195 200 205 Ser Ser Arg Tyr Arg Gly Leu Pro Ala Pro Gly Pro Ser Pro Ala Asp 210 215 220 Lys Lys Arg Ser Gly Lys Lys Lys Ile Ser Lys Ala Asp Ile Gly Ala 225 230 235 240 Pro Ser Gly Phe Lys His Val Ser His Val Gly Trp Asp Pro Gln Asn 245 250 255 Gly Phe Asp Val Asn Asn Leu Asp Pro Asp Leu Arg Ser Leu Phe Ser 260 265 270 Arg Ala Gly Ile Ser Glu Ala Gln Leu Thr Asp Ala Glu Thr Ser Lys 275 280 285 Leu Ile Tyr Asp Phe Ile Glu Asp Gln Gly Gly Leu Glu Ala Val Arg 290 295 300 Gln Glu Met Arg Arg Gln Glu Pro Leu Pro Pro Pro Pro Pro Pro Ser 305 310 315 320 Arg Gly Gly Asn Gln Leu Pro Arg Pro Pro Ile Val Gly Gly Asn Lys 325 330 335 Gly Arg Ser Gly Pro Leu Pro Pro Val Pro Leu Gly Ile Ala Pro Pro 340 345 350 Pro Pro Thr Pro Arg Gly Pro Pro Pro Pro Gly Arg Gly Gly Pro Pro 355 360 365 Pro Pro Pro Pro Pro Ala Thr Gly Arg Ser Gly Pro Leu Pro Pro Pro 370 375 380 Pro Pro Gly Ala Gly Gly Pro Pro Met Pro Pro Pro Pro Pro Pro Pro 385 390 395 400 Pro Pro Pro Pro Ser Ser Gly Asn Gly Pro Ala Pro Pro Pro Leu Pro 405 410 415 Pro Ala Leu Val Pro Ala Gly Gly Leu Ala Pro Gly Gly Gly Arg Gly 420 425 430 Ala Leu Leu Asp Gln Ile Arg Gln Gly Ile Gln Leu Asn Lys Thr Pro 435 440 445 Gly Ala Pro Glu Ser Ser Ala Leu Gln Pro Pro Pro Gln Ser Ser Glu 450 455 460 Gly Leu Val Gly Ala Leu Met His Val Met Gln Lys Arg Ser Arg Ala 465 470 475 480 Ile His Ser Ser Asp Glu Gly Glu Asp Gln Ala Gly Asp Glu Asp Glu 485 490 495 Asp Asp Glu Trp Asp Asp 500 <210> SEQ ID NO 50 <211> LENGTH: 505 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 50 Met Ser Ser Val Gln Gln Gln Pro Pro Pro Pro Arg Arg Val Thr Asn 1 5 10 15 Val Gly Ser Leu Leu Leu Thr Pro Gln Glu Asn Glu Ser Leu Phe Thr 20 25 30 Phe Leu Gly Lys Lys Cys Val Thr Met Ser Ser Ala Val Val Gln Leu 35 40 45 Tyr Ala Ala Asp Arg Asn Cys Met Trp Ser Lys Lys Cys Ser Gly Val 50 55 60 Ala Cys Leu Val Lys Asp Asn Pro Gln Arg Ser Tyr Phe Leu Arg Ile 65 70 75 80 Phe Asp Ile Lys Asp Gly Lys Leu Leu Trp Glu Gln Glu Leu Tyr Asn 85 90 95 Asn Phe Val Tyr Asn Ser Pro Arg Gly Tyr Phe His Thr Phe Ala Gly 100 105 110 Asp Thr Cys Gln Val Ala Leu Asn Phe Ala Asn Glu Glu Glu Ala Lys 115 120 125 Lys Phe Arg Lys Ala Val Thr Asp Leu Leu Gly Arg Arg Gln Arg Lys 130 135 140 Ser Glu Lys Arg Arg Asp Pro Pro Asn Gly Pro Asn Leu Pro Met Ala 145 150 155 160 Thr Val Asp Ile Lys Asn Pro Glu Ile Thr Thr Asn Arg Phe Tyr Gly 165 170 175 Pro Gln Val Asn Asn Ile Ser His Thr Lys Glu Lys Lys Lys Gly Lys 180 185 190 Ala Lys Lys Lys Arg Leu Thr Lys Ala Asp Ile Gly Thr Pro Ser Asn 195 200 205 Phe Gln His Ile Gly His Val Gly Trp Asp Pro Asn Thr Gly Phe Asp 210 215 220 Leu Asn Asn Leu Asp Pro Glu Leu Lys Asn Leu Phe Asp Met Cys Gly 225 230 235 240 Ile Ser Glu Ala Gln Leu Lys Asp Arg Glu Thr Ser Lys Val Ile Tyr 245 250 255 Asp Phe Ile Glu Lys Thr Gly Gly Val Glu Ala Val Lys Asn Glu Leu 260 265 270 Arg Arg Gln Ala Pro Pro Pro Pro Pro Pro Ser Arg Gly Gly Pro Pro 275 280 285 Pro Pro Pro Pro Pro Pro His Asn Ser Gly Pro Pro Pro Pro Pro Ala 290 295 300 Arg Gly Arg Gly Ala Pro Pro Pro Pro Pro Ser Arg Ala Pro Thr Ala 305 310 315 320 Ala Pro Pro Pro Pro Pro Pro Ser Arg Pro Ser Val Ala Val Pro Pro 325 330 335 Pro Pro Pro Asn Arg Met Tyr Pro Pro Pro Pro Pro Ala Leu Pro Ser 340 345 350 Ser Ala Pro Ser Gly Pro Pro Pro Pro Pro Pro Ser Val Leu Gly Val 355 360 365 Gly Pro Val Ala Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro Gly 370 375 380 Pro Pro Pro Pro Pro Gly Leu Pro Ser Asp Gly Asp His Gln Val Pro 385 390 395 400 Thr Thr Ala Gly Asn Lys Ala Ala Leu Leu Asp Gln Ile Arg Glu Gly 405 410 415 Ala Gln Leu Lys Lys Val Glu Gln Asn Ser Arg Pro Val Ser Cys Ser 420 425 430 Gly Arg Asp Ala Leu Leu Asp Gln Ile Arg Gln Gly Ile Gln Leu Lys 435 440 445 Ser Val Ala Asp Gly Gln Glu Ser Thr Pro Pro Thr Pro Ala Pro Thr 450 455 460 Ser Gly Ile Val Gly Ala Leu Met Glu Val Met Gln Lys Arg Ser Lys 465 470 475 480 Ala Ile His Ser Ser Asp Glu Asp Glu Asp Glu Asp Asp Glu Glu Asp 485 490 495 Phe Glu Asp Asp Asp Glu Trp Glu Asp 500 505 <210> SEQ ID NO 51 <211> LENGTH: 391 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 51 Met Pro Gly Pro Gln Gly Gly Arg Gly Ala Ala Thr Met Ser Leu Gly 1 5 10 15 Lys Leu Ser Pro Val Gly Trp Val Ser Ser Ser Gln Gly Lys Arg Arg 20 25 30 Leu Thr Ala Asp Met Ile Ser His Pro Leu Gly Asp Phe Arg His Thr 35 40 45 Met His Val Gly Arg Gly Gly Asp Val Phe Gly Asp Thr Ser Phe Leu 50 55 60 Ser Asn His Gly Gly Ser Ser Gly Ser Thr His Arg Ser Pro Arg Ser 65 70 75 80 Phe Leu Ala Lys Lys Leu Gln Leu Val Arg Arg Val Gly Ala Pro Pro 85 90 95 Arg Arg Met Ala Ser Pro Pro Ala Pro Ser Pro Ala Pro Pro Ala Ile 100 105 110 Ser Pro Ile Ile Lys Asn Ala Ile Ser Leu Pro Gln Leu Asn Gln Ala 115 120 125 Ala Tyr Asp Ser Leu Val Val Gly Lys Leu Ser Phe Asp Ser Ser Pro 130 135 140 Thr Ser Ser Thr Asp Gly His Ser Ser Tyr Gly Leu Asp Ser Gly Phe 145 150 155 160 Cys Thr Ile Ser Arg Leu Pro Arg Ser Glu Lys Pro His Asp Arg Asp 165 170 175 Arg Asp Gly Ser Phe Pro Ser Glu Pro Gly Leu Arg Arg Ser Asp Ser 180 185 190 Leu Leu Ser Phe Arg Leu Asp Leu Asp Leu Gly Pro Ser Leu Leu Ser 195 200 205 Glu Leu Leu Gly Val Met Ser Leu Pro Glu Ala Pro Ala Ala Glu Thr 210 215 220 Pro Ala Pro Ala Ala Asn Pro Pro Ala Pro Thr Ala Asn Pro Thr Gly 225 230 235 240 Pro Ala Ala Asn Pro Pro Ala Thr Thr Ala Asn Pro Pro Ala Pro Ala 245 250 255 Ala Asn Pro Ser Ala Pro Ala Ala Thr Pro Thr Gly Pro Ala Ala Asn 260 265 270 Pro Pro Ala Pro Ala Ala Ser Ser Thr Pro His Gly His Cys Pro Asn 275 280 285 Gly Val Thr Ala Gly Leu Gly Pro Val Ala Glu Val Lys Ser Ser Pro 290 295 300 Val Gly Gly Gly Pro Arg Gly Pro Ala Gly Pro Ala Leu Gly Arg His 305 310 315 320 Trp Gly Ala Gly Trp Asp Gly Gly His His Tyr Pro Glu Met Asp Ala 325 330 335 Arg Gln Glu Arg Val Glu Val Leu Pro Gln Ala Arg Ala Ser Trp Glu 340 345 350 Ser Leu Asp Glu Glu Trp Arg Ala Pro Gln Ala Gly Ser Arg Thr Pro 355 360 365 Val Pro Ser Thr Val Gln Ala Asn Thr Phe Glu Phe Ala Asp Ala Glu 370 375 380 Glu Asp Asp Glu Val Lys Val 385 390 <210> SEQ ID NO 52 <211> LENGTH: 210 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 52 Met Ser Thr Lys Val Pro Ile Tyr Leu Lys Arg Gly Ser Arg Lys Gly 1 5 10 15 Lys Lys Glu Lys Leu Arg Asp Leu Leu Ser Ser Asp Met Ile Ser Pro 20 25 30 Pro Leu Gly Asp Phe Arg His Thr Ile His Ile Gly Ser Gly Gly Gly 35 40 45 Ser Asp Met Phe Gly Asp Ile Ser Phe Leu Gln Gly Lys Phe His Leu 50 55 60 Leu Pro Gly Thr Met Val Glu Gly Pro Glu Glu Asp Gly Thr Phe Asp 65 70 75 80 Leu Pro Phe Gln Phe Thr Arg Thr Ala Thr Val Cys Gly Arg Glu Leu 85 90 95 Pro Asp Gly Pro Ser Pro Leu Leu Lys Asn Ala Ile Ser Leu Pro Val 100 105 110 Ile Gly Gly Pro Gln Ala Leu Thr Leu Pro Thr Ala Gln Ala Pro Pro 115 120 125 Lys Pro Pro Arg Leu His Leu Glu Thr Pro Gln Pro Ser Pro Gln Glu 130 135 140 Gly Gly Ser Val Asp Ile Trp Arg Ile Pro Glu Thr Gly Ser Pro Asn 145 150 155 160 Ser Gly Leu Thr Pro Glu Ser Gly Ala Glu Glu Pro Phe Leu Ser Asn 165 170 175 Ala Ser Ser Leu Leu Ser Leu His Val Asp Leu Gly Pro Ser Ile Leu 180 185 190 Asp Asp Val Leu Gln Ile Met Asp Gln Asp Leu Asp Ser Met Gln Ile 195 200 205 Pro Thr 210 <210> SEQ ID NO 53 <211> LENGTH: 254 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 53 Met Pro Ala Lys Thr Pro Ile Tyr Leu Lys Ala Ala Asn Asn Lys Lys 1 5 10 15 Gly Lys Lys Phe Lys Leu Arg Asp Ile Leu Ser Pro Asp Met Ile Ser 20 25 30 Pro Pro Leu Gly Asp Phe Arg His Thr Ile His Ile Gly Lys Glu Gly 35 40 45 Gln His Asp Val Phe Gly Asp Ile Ser Phe Leu Gln Gly Asn Tyr Glu 50 55 60 Leu Leu Pro Gly Asn Gln Glu Lys Ala His Leu Gly Gln Phe Pro Gly 65 70 75 80 His Asn Glu Phe Phe Arg Ala Asn Ser Thr Ser Asp Ser Val Phe Thr 85 90 95 Glu Thr Pro Ser Pro Val Leu Lys Asn Ala Ile Ser Leu Pro Thr Ile 100 105 110 Gly Gly Ser Gln Ala Leu Met Leu Pro Leu Leu Ser Pro Val Thr Phe 115 120 125 Asn Ser Lys Gln Glu Ser Phe Gly Pro Ala Lys Leu Pro Arg Leu Ser 130 135 140 Cys Glu Pro Val Met Glu Glu Lys Ala Gln Glu Lys Ser Ser Leu Leu 145 150 155 160 Glu Asn Gly Thr Val His Gln Gly Asp Thr Ser Trp Gly Ser Ser Gly 165 170 175 Ser Ala Ser Gln Ser Ser Gln Gly Arg Asp Ser His Ser Ser Ser Leu 180 185 190 Ser Glu Gln Tyr Pro Asp Trp Pro Ala Glu Asp Met Phe Asp His Pro 195 200 205 Thr Pro Cys Glu Leu Ile Lys Gly Lys Thr Lys Ser Glu Glu Ser Leu 210 215 220 Ser Asp Leu Thr Gly Ser Leu Leu Ser Leu Gln Leu Asp Leu Gly Pro 225 230 235 240 Ser Leu Leu Asp Glu Val Leu Asn Val Met Asp Lys Asn Lys 245 250 <210> SEQ ID NO 54 <211> LENGTH: 356 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 54 Met Pro Ile Leu Lys Gln Leu Val Ser Ser Ser Val His Ser Lys Arg 1 5 10 15 Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly 20 25 30 Asp Phe Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly 35 40 45 Asp Thr Ser Phe Leu Asn Ser Lys Ala Gly Glu Pro Asp Gly Glu Ser 50 55 60 Leu Asp Glu Gln Pro Ser Ser Ser Ser Ser Lys Arg Ser Leu Leu Ser 65 70 75 80 Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Glu 85 90 95 Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe 100 105 110 Val Lys Asn Ala Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala 115 120 125 Glu Lys Gly Thr Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Val 130 135 140 Lys Lys Ala Asn Asp Gly Glu Gly Gly Asp Glu Glu Ala Gly Thr Glu 145 150 155 160 Glu Ala Val Pro Arg Arg Asn Gly Ala Ala Gly Pro His Ser Pro Asp 165 170 175 Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu Thr Asp Leu Pro Val 180 185 190 Val Pro Lys Ala Thr Tyr Gly Leu Lys His Ala Glu Ser Ile Met Ser 195 200 205 Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly Asp Val Leu Ser Ile 210 215 220 Met Asp Lys Glu Glu Trp Asp Pro Glu Glu Gly Glu Gly Gly Tyr His 225 230 235 240 Gly Asp Glu Gly Ala Ala Gly Thr Ile Thr Gln Ala Pro Pro Tyr Ala 245 250 255 Val Ala Ala Pro Pro Leu Ala Arg Gln Glu Gly Lys Ala Gly Pro Asp 260 265 270 Leu Pro Ser Leu Pro Ser His Ala Leu Glu Asp Glu Gly Trp Ala Ala 275 280 285 Ala Ala Pro Ser Pro Gly Ser Ala Arg Ser Met Gly Ser His Thr Thr 290 295 300 Arg Asp Ser Ser Ser Leu Ser Ser Cys Thr Ser Gly Ile Leu Glu Glu 305 310 315 320 Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Ala Arg Ala Ala Val Ser 325 330 335 Arg Gln Pro Asp Lys Glu Phe Ser Phe Met Asp Glu Glu Glu Glu Asp 340 345 350 Glu Ile Arg Val 355 <210> SEQ ID NO 55 <211> LENGTH: 148 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 55 Met Pro Val Leu Lys Gln Leu Gly Pro Ala Gln Pro Lys Lys Arg Pro 1 5 10 15 Asp Arg Gly Ala Leu Ser Ile Ser Ala Pro Leu Gly Asp Phe Arg His 20 25 30 Thr Leu His Val Gly Arg Gly Gly Asp Ala Phe Gly Asp Thr Ser Phe 35 40 45 Leu Ser Arg His Gly Gly Gly Pro Pro Pro Glu Pro Arg Ala Pro Pro 50 55 60 Ala Gly Ala Pro Arg Ser Pro Pro Pro Pro Ala Val Pro Gln Ser Ala 65 70 75 80 Ala Pro Ser Pro Ala Asp Pro Leu Leu Ser Phe His Leu Asp Leu Gly 85 90 95 Pro Ser Met Leu Asp Ala Val Leu Gly Val Met Asp Ala Ala Arg Pro 100 105 110 Glu Ala Ala Ala Ala Lys Pro Asp Ala Glu Pro Arg Pro Gly Thr Gln 115 120 125 Pro Pro Gln Ala Arg Cys Arg Pro Asn Ala Asp Leu Glu Leu Asn Asp 130 135 140 Val Ile Gly Leu 145 <210> SEQ ID NO 56 <211> LENGTH: 545 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 56 Met Asp Trp Gly Thr Glu Leu Trp Asp Gln Phe Glu Val Leu Glu Arg 1 5 10 15 His Thr Gln Trp Gly Leu Asp Leu Leu Asp Arg Tyr Val Lys Phe Val 20 25 30 Lys Glu Arg Thr Glu Val Glu Gln Ala Tyr Ala Lys Gln Leu Arg Ser 35 40 45 Leu Val Lys Lys Tyr Leu Pro Lys Arg Pro Ala Lys Asp Asp Pro Glu 50 55 60 Ser Lys Phe Ser Gln Gln Gln Ser Phe Val Gln Ile Leu Gln Glu Val 65 70 75 80 Asn Asp Phe Ala Gly Gln Arg Glu Leu Val Ala Glu Asn Leu Ser Val 85 90 95 Arg Val Cys Leu Glu Leu Thr Lys Tyr Ser Gln Glu Met Lys Gln Glu 100 105 110 Arg Lys Met His Phe Gln Glu Gly Arg Arg Ala Gln Gln Gln Leu Glu 115 120 125 Asn Gly Phe Lys Gln Leu Glu Asn Ser Lys Arg Lys Phe Glu Arg Asp 130 135 140 Cys Arg Glu Ala Glu Lys Ala Ala Gln Thr Ala Glu Arg Leu Asp Gln 145 150 155 160 Asp Ile Asn Ala Thr Lys Ala Asp Val Glu Lys Ala Lys Gln Gln Ala 165 170 175 His Leu Arg Ser His Met Ala Glu Glu Ser Lys Asn Glu Tyr Ala Ala 180 185 190 Gln Leu Gln Arg Phe Asn Arg Asp Gln Ala His Phe Tyr Phe Ser Gln 195 200 205 Met Pro Gln Ile Phe Asp Lys Leu Gln Asp Met Asp Glu Arg Arg Ala 210 215 220 Thr Arg Leu Gly Ala Gly Tyr Gly Leu Leu Ser Glu Ala Glu Leu Glu 225 230 235 240 Val Val Pro Ile Ile Ala Lys Cys Leu Glu Gly Met Lys Val Ala Ala 245 250 255 Asn Ala Val Asp Pro Lys Asn Asp Ser His Val Leu Ile Glu Leu His 260 265 270 Lys Ser Gly Phe Ala Arg Pro Gly Asp Val Glu Phe Glu Asp Phe Ser 275 280 285 Gln Pro Met Asn Arg Ala Pro Ser Asp Ser Ser Leu Gly Thr Pro Ser 290 295 300 Asp Gly Arg Pro Glu Leu Arg Gly Pro Gly Arg Ser Arg Thr Lys Arg 305 310 315 320 Trp Pro Phe Gly Lys Lys Asn Lys Thr Val Val Thr Glu Asp Phe Ser 325 330 335 His Leu Pro Pro Glu Gln Gln Arg Lys Arg Leu Gln Gln Gln Leu Glu 340 345 350 Glu Arg Ser Arg Glu Leu Gln Lys Glu Val Asp Gln Arg Glu Ala Leu 355 360 365 Lys Lys Met Lys Asp Val Tyr Glu Lys Thr Pro Gln Met Gly Asp Pro 370 375 380 Ala Ser Leu Glu Pro Gln Ile Ala Glu Thr Leu Ser Asn Ile Glu Arg 385 390 395 400 Leu Lys Leu Glu Val Gln Lys Tyr Glu Ala Trp Leu Ala Glu Ala Glu 405 410 415 Ser Arg Val Leu Ser Asn Arg Gly Asp Ser Leu Ser Arg His Ala Arg 420 425 430 Pro Pro Asp Pro Pro Ala Ser Ala Pro Pro Asp Ser Ser Ser Asn Ser 435 440 445 Ala Ser Gln Asp Thr Lys Glu Ser Ser Glu Glu Pro Pro Ser Glu Glu 450 455 460 Ser Gln Asp Thr Pro Ile Tyr Thr Glu Phe Asp Glu Asp Phe Glu Glu 465 470 475 480 Glu Pro Thr Ser Pro Ile Gly His Cys Val Ala Ile Tyr His Phe Glu 485 490 495 Gly Ser Ser Glu Gly Thr Ile Ser Met Ala Glu Gly Glu Asp Leu Ser 500 505 510 Leu Met Glu Glu Asp Lys Gly Asp Gly Trp Thr Arg Val Arg Arg Lys 515 520 525 Glu Gly Gly Glu Gly Tyr Val Pro Thr Ser Tyr Leu Arg Val Thr Leu 530 535 540 Asn 545 <210> SEQ ID NO 57 <211> LENGTH: 1224 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 57 Met Leu Thr Lys Phe Glu Thr Lys Ser Ala Arg Val Lys Gly Leu Ser 1 5 10 15 Phe His Pro Lys Arg Pro Trp Ile Leu Thr Ser Leu His Asn Gly Val 20 25 30 Ile Gln Leu Trp Asp Tyr Arg Met Cys Thr Leu Ile Asp Lys Phe Asp 35 40 45 Glu His Asp Gly Pro Val Arg Gly Ile Asp Phe His Lys Gln Gln Pro 50 55 60 Leu Phe Val Ser Gly Gly Asp Asp Tyr Lys Ile Lys Val Trp Asn Tyr 65 70 75 80 Lys Leu Arg Arg Cys Leu Phe Thr Leu Leu Gly His Leu Asp Tyr Ile 85 90 95 Arg Thr Thr Phe Phe His His Glu Tyr Pro Trp Ile Leu Ser Ala Ser 100 105 110 Asp Asp Gln Thr Ile Arg Val Trp Asn Trp Gln Ser Arg Thr Cys Val 115 120 125 Cys Val Leu Thr Gly His Asn His Tyr Val Met Cys Ala Gln Phe His 130 135 140 Pro Thr Glu Asp Leu Val Val Ser Ala Ser Leu Asp Gln Thr Val Arg 145 150 155 160 Val Trp Asp Ile Ser Gly Leu Arg Lys Lys Asn Leu Ser Pro Gly Ala 165 170 175 Val Glu Ser Asp Val Arg Gly Ile Thr Gly Val Asp Leu Phe Gly Thr 180 185 190 Thr Asp Ala Val Val Lys His Val Leu Glu Gly His Asp Arg Gly Val 195 200 205 Asn Trp Ala Ala Phe His Pro Thr Met Pro Leu Ile Val Ser Gly Ala 210 215 220 Asp Asp Arg Gln Val Lys Ile Trp Arg Met Asn Glu Ser Lys Ala Trp 225 230 235 240 Glu Val Asp Thr Cys Arg Gly His Tyr Asn Asn Val Ser Cys Ala Val 245 250 255 Phe His Pro Arg Gln Glu Leu Ile Leu Ser Asn Ser Glu Asp Lys Ser 260 265 270 Ile Arg Val Trp Asp Met Ser Lys Arg Thr Gly Val Gln Thr Phe Arg 275 280 285 Arg Asp His Asp Arg Phe Trp Val Leu Ala Ala His Pro Asn Leu Asn 290 295 300 Leu Phe Ala Ala Gly His Asp Gly Gly Met Ile Val Phe Lys Leu Glu 305 310 315 320 Arg Glu Arg Pro Ala Tyr Ala Val His Gly Asn Met Leu His Tyr Val 325 330 335 Lys Asp Arg Phe Leu Arg Gln Leu Asp Phe Asn Ser Ser Lys Asp Val 340 345 350 Ala Val Met Gln Leu Arg Ser Gly Ser Lys Phe Pro Val Phe Asn Met 355 360 365 Ser Tyr Asn Pro Ala Glu Asn Ala Val Leu Leu Cys Thr Arg Ala Ser 370 375 380 Asn Leu Glu Asn Ser Thr Tyr Asp Leu Tyr Thr Ile Pro Lys Asp Ala 385 390 395 400 Asp Ser Gln Asn Pro Asp Ala Pro Glu Gly Lys Arg Ser Ser Gly Leu 405 410 415 Thr Ala Val Trp Val Ala Arg Asn Arg Phe Ala Val Leu Asp Arg Met 420 425 430 His Ser Leu Leu Ile Lys Asn Leu Lys Asn Glu Ile Thr Lys Lys Val 435 440 445 Gln Val Pro Asn Cys Asp Glu Ile Phe Tyr Ala Gly Thr Gly Asn Leu 450 455 460 Leu Leu Arg Asp Ala Asp Ser Ile Thr Leu Phe Asp Val Gln Gln Lys 465 470 475 480 Arg Thr Leu Ala Ser Val Lys Ile Ser Lys Val Lys Tyr Val Ile Trp 485 490 495 Ser Ala Asp Met Ser His Val Ala Leu Leu Ala Lys His Ala Ile Val 500 505 510 Ile Cys Asn Arg Lys Leu Asp Ala Leu Cys Asn Ile His Glu Asn Ile 515 520 525 Arg Val Lys Ser Gly Ala Trp Asp Glu Ser Gly Val Phe Ile Tyr Thr 530 535 540 Thr Ser Asn His Ile Lys Tyr Ala Val Thr Thr Gly Asp His Gly Ile 545 550 555 560 Ile Arg Thr Leu Asp Leu Pro Ile Tyr Val Thr Arg Val Lys Gly Asn 565 570 575 Asn Val Tyr Cys Leu Asp Arg Glu Cys Arg Pro Arg Val Leu Thr Ile 580 585 590 Asp Pro Thr Glu Phe Lys Phe Lys Leu Ala Leu Ile Asn Arg Lys Tyr 595 600 605 Asp Glu Val Leu His Met Val Arg Asn Ala Lys Leu Val Gly Gln Ser 610 615 620 Ile Ile Ala Tyr Leu Gln Lys Lys Gly Tyr Pro Glu Val Ala Leu His 625 630 635 640 Phe Val Lys Asp Glu Lys Thr Arg Phe Ser Leu Ala Leu Glu Cys Gly 645 650 655 Asn Ile Glu Ile Ala Leu Glu Ala Ala Lys Ala Leu Asp Asp Lys Asn 660 665 670 Cys Trp Glu Lys Leu Gly Glu Val Ala Leu Leu Gln Gly Asn His Gln 675 680 685 Ile Val Glu Met Cys Tyr Gln Arg Thr Lys Asn Phe Asp Lys Val Ser 690 695 700 Phe Leu Tyr Leu Ile Thr Gly Asn Leu Glu Lys Leu Arg Lys Met Met 705 710 715 720 Lys Ile Ala Glu Ile Arg Lys Asp Met Ser Gly His Tyr Gln Asn Ala 725 730 735 Leu Tyr Leu Gly Asp Val Ser Glu Arg Val Arg Ile Leu Lys Asn Cys 740 745 750 Gly Gln Lys Ser Leu Ala Tyr Leu Thr Ala Ala Thr His Gly Leu Asp 755 760 765 Glu Glu Ala Glu Ser Leu Lys Glu Thr Phe Asp Pro Glu Lys Glu Thr 770 775 780 Ile Pro Asp Ile Asp Pro Asn Ala Lys Leu Leu Gln Pro Pro Ala Pro 785 790 795 800 Ile Met Pro Leu Asp Thr Asn Trp Pro Leu Leu Thr Val Ser Lys Gly 805 810 815 Phe Phe Glu Gly Thr Ile Ala Ser Lys Gly Lys Gly Gly Ala Leu Ala 820 825 830 Ala Asp Ile Asp Ile Asp Thr Val Gly Thr Glu Gly Trp Gly Glu Asp 835 840 845 Ala Glu Leu Gln Leu Asp Glu Asp Gly Phe Val Glu Ala Thr Glu Gly 850 855 860 Leu Gly Asp Asp Ala Leu Gly Lys Gly Gln Glu Glu Gly Gly Gly Trp 865 870 875 880 Asp Val Glu Glu Asp Leu Glu Leu Pro Pro Glu Leu Asp Ile Ser Pro 885 890 895 Gly Ala Ala Gly Gly Ala Glu Asp Gly Phe Phe Val Pro Pro Thr Lys 900 905 910 Gly Thr Ser Pro Thr Gln Ile Trp Cys Asn Asn Ser Gln Leu Pro Val 915 920 925 Asp His Ile Leu Ala Gly Ser Phe Glu Thr Ala Met Arg Leu Leu His 930 935 940 Asp Gln Val Gly Val Ile Gln Phe Gly Pro Tyr Lys Gln Leu Phe Leu 945 950 955 960 Gln Thr Tyr Ala Arg Gly Arg Thr Thr Tyr Gln Ala Leu Pro Cys Leu 965 970 975 Pro Ser Met Tyr Gly Tyr Pro Asn Arg Asn Trp Lys Asp Ala Gly Leu 980 985 990 Lys Asn Gly Val Pro Ala Val Gly Leu Lys Leu Asn Asp Leu Ile Gln 995 1000 1005 Arg Leu Gln Leu Cys Tyr Gln Leu Thr Thr Val Gly Lys Phe Glu Glu 1010 1015 1020 Ala Val Glu Lys Phe Arg Ser Ile Leu Leu Ser Val Pro Leu Leu Val 1025 1030 1035 1040 Val Asp Asn Lys Gln Glu Ile Ala Glu Ala Gln Gln Leu Ile Thr Ile 1045 1050 1055 Cys Arg Glu Tyr Ile Val Gly Leu Ser Val Glu Thr Glu Arg Lys Lys 1060 1065 1070 Leu Pro Lys Glu Thr Leu Glu Gln Gln Lys Arg Ile Cys Glu Met Ala 1075 1080 1085 Ala Tyr Phe Thr His Ser Asn Leu Gln Pro Val His Met Ile Leu Val 1090 1095 1100 Leu Arg Thr Ala Leu Asn Leu Phe Phe Lys Leu Lys Asn Phe Lys Thr 1105 1110 1115 1120 Ala Ala Thr Phe Ala Arg Arg Leu Leu Glu Leu Gly Pro Lys Pro Glu 1125 1130 1135 Val Ala Gln Gln Thr Arg Lys Ile Leu Ser Ala Cys Glu Lys Asn Pro 1140 1145 1150 Thr Asp Ala Tyr Gln Leu Asn Tyr Asp Met His Asn Pro Phe Asp Ile 1155 1160 1165 Cys Ala Ala Ser Tyr Arg Pro Ile Tyr Arg Gly Lys Pro Val Glu Lys 1170 1175 1180 Cys Pro Leu Ser Gly Ala Cys Tyr Ser Pro Glu Phe Lys Gly Gln Ile 1185 1190 1195 1200 Cys Arg Val Thr Thr Val Thr Glu Ile Gly Lys Asp Val Ile Gly Leu 1205 1210 1215 Arg Ile Ser Pro Leu Gln Phe Arg 1220 <210> SEQ ID NO 58 <211> LENGTH: 874 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 58 Met Leu Lys Lys Phe Asp Lys Lys Asp Glu Glu Ser Gly Gly Gly Ser 1 5 10 15 Asn Pro Phe Gln His Leu Glu Lys Ser Ala Val Leu Gln Glu Ala Arg 20 25 30 Val Phe Asn Glu Thr Pro Ile Asn Pro Arg Lys Cys Ala His Ile Leu 35 40 45 Thr Lys Ile Leu Tyr Leu Ile Asn Gln Gly Glu His Leu Gly Thr Thr 50 55 60 Glu Ala Thr Glu Ala Phe Phe Ala Met Thr Lys Leu Phe Gln Ser Asn 65 70 75 80 Asp Pro Thr Leu Arg Arg Met Cys Tyr Leu Thr Ile Lys Glu Met Ser 85 90 95 Cys Ile Ala Glu Asp Val Ile Ile Val Thr Ser Ser Leu Thr Lys Asp 100 105 110 Met Thr Gly Lys Glu Asp Asn Tyr Arg Gly Pro Ala Val Arg Ala Leu 115 120 125 Cys Gln Ile Thr Asp Ser Thr Met Leu Gln Ala Ile Glu Arg Tyr Met 130 135 140 Lys Gln Ala Ile Val Asp Lys Val Pro Ser Val Ser Ser Ser Ala Leu 145 150 155 160 Val Ser Ser Leu His Leu Leu Lys Cys Ser Phe Asp Val Val Lys Arg 165 170 175 Trp Val Asn Glu Ala Gln Glu Ala Ala Ser Ser Asp Asn Ile Met Val 180 185 190 Gln Tyr His Ala Leu Gly Leu Leu Tyr His Val Arg Lys Asn Asp Arg 195 200 205 Leu Ala Val Asn Lys Met Ile Ser Lys Val Thr Arg His Gly Leu Lys 210 215 220 Ser Pro Phe Ala Tyr Cys Met Met Ile Arg Val Ala Ser Lys Gln Leu 225 230 235 240 Glu Glu Glu Asp Gly Ser Arg Asp Ser Pro Leu Phe Asp Phe Ile Glu 245 250 255 Ser Cys Leu Arg Asn Lys His Glu Met Val Val Tyr Glu Ala Ala Ser 260 265 270 Ala Ile Val Asn Leu Pro Gly Cys Ser Ala Lys Glu Leu Ala Pro Ala 275 280 285 Val Ser Val Leu Gln Leu Phe Cys Ser Ser Pro Lys Ala Ala Leu Arg 290 295 300 Tyr Ala Ala Val Arg Thr Leu Asn Lys Val Ala Met Lys His Pro Ser 305 310 315 320 Ala Val Thr Ala Cys Asn Leu Asp Leu Glu Asn Leu Val Thr Asp Ser 325 330 335 Asn Arg Ser Ile Ala Thr Leu Ala Ile Thr Thr Leu Leu Lys Thr Gly 340 345 350 Ser Glu Ser Ser Ile Asp Arg Leu Met Lys Gln Ile Ser Ser Phe Met 355 360 365 Ser Glu Ile Ser Asp Glu Phe Lys Val Val Val Val Gln Ala Ile Ser 370 375 380 Ala Leu Cys Gln Lys Tyr Pro Arg Lys His Ala Val Leu Met Asn Phe 385 390 395 400 Leu Phe Thr Met Leu Arg Glu Glu Gly Gly Phe Glu Tyr Lys Arg Ala 405 410 415 Ile Val Asp Cys Ile Ile Ser Ile Ile Glu Glu Asn Ser Glu Ser Lys 420 425 430 Glu Thr Gly Leu Ser His Leu Cys Glu Phe Ile Glu Asp Cys Glu Phe 435 440 445 Thr Val Leu Ala Thr Arg Ile Leu His Leu Leu Gly Gln Glu Gly Pro 450 455 460 Lys Thr Thr Asn Pro Ser Lys Tyr Ile Arg Phe Ile Tyr Asn Arg Val 465 470 475 480 Val Leu Glu His Glu Glu Val Arg Ala Gly Ala Val Ser Ala Leu Ala 485 490 495 Lys Phe Gly Ala Gln Asn Glu Glu Met Leu Pro Ser Ile Leu Val Leu 500 505 510 Leu Lys Arg Cys Val Met Asp Asp Asp Asn Glu Val Arg Asp Arg Ala 515 520 525 Thr Phe Tyr Leu Asn Val Leu Glu Gln Lys Gln Lys Ala Leu Asn Ala 530 535 540 Gly Tyr Ile Leu Asn Gly Leu Thr Val Ser Ile Pro Gly Leu Glu Arg 545 550 555 560 Ala Leu Gln Gln Tyr Thr Leu Glu Pro Ser Glu Lys Pro Phe Asp Leu 565 570 575 Lys Ser Val Pro Leu Ala Thr Ala Pro Met Ala Glu Gln Arg Thr Glu 580 585 590 Ser Thr Pro Ile Thr Ala Val Lys Gln Pro Glu Lys Val Ala Ala Thr 595 600 605 Arg Gln Glu Ile Phe Gln Glu Gln Leu Ala Ala Val Pro Glu Phe Arg 610 615 620 Gly Leu Gly Pro Leu Phe Lys Ser Ser Pro Glu Pro Val Ala Leu Thr 625 630 635 640 Glu Ser Glu Thr Glu Tyr Val Ile Arg Cys Thr Lys His Thr Phe Thr 645 650 655 Asn His Met Val Phe Gln Phe Asp Cys Thr Asn Thr Leu Asn Asp Gln 660 665 670 Thr Leu Glu Asn Val Thr Val Gln Met Glu Pro Thr Glu Ala Tyr Glu 675 680 685 Val Leu Cys Tyr Val Pro Ala Arg Ser Leu Pro Tyr Asn Gln Pro Gly 690 695 700 Thr Cys Tyr Thr Leu Val Ala Leu Pro Lys Glu Asp Pro Thr Ala Val 705 710 715 720 Ala Cys Thr Phe Ser Cys Met Met Lys Phe Thr Val Lys Asp Cys Asp 725 730 735 Pro Thr Thr Gly Glu Thr Asp Asp Glu Gly Tyr Glu Asp Glu Tyr Val 740 745 750 Leu Glu Asp Leu Glu Val Thr Val Ala Asp His Ile Gln Lys Val Met 755 760 765 Lys Leu Asn Phe Glu Ala Ala Trp Asp Glu Val Gly Asp Glu Phe Glu 770 775 780 Lys Glu Glu Thr Phe Thr Leu Ser Thr Ile Lys Thr Leu Glu Glu Ala 785 790 795 800 Val Gly Asn Ile Val Lys Phe Leu Gly Met His Pro Cys Glu Arg Ser 805 810 815 Asp Lys Val Pro Asp Asn Lys Asn Thr His Thr Leu Leu Leu Ala Gly 820 825 830 Val Phe Arg Gly Gly His Asp Ile Leu Val Arg Ser Arg Leu Leu Leu 835 840 845 Leu Asp Thr Val Thr Met Gln Val Thr Ala Arg Ser Leu Glu Glu Leu 850 855 860 Pro Val Asp Ile Ile Leu Ala Ser Val Gly 865 870 <210> SEQ ID NO 59 <211> LENGTH: 849 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 59 Met Ser Glu Glu Arg Ser Leu Ser Leu Leu Ala Lys Ala Val Asp Pro 1 5 10 15 Arg His Pro Asn Met Met Thr Asp Val Val Lys Leu Leu Ser Ala Val 20 25 30 Cys Ile Val Gly Glu Glu Ser Ile Leu Glu Glu Val Leu Glu Ala Leu 35 40 45 Thr Ser Ala Gly Glu Glu Lys Lys Ile Asp Arg Phe Phe Cys Ile Val 50 55 60 Glu Gly Leu Arg His Asn Ser Val Gln Leu Gln Val Ala Cys Met Gln 65 70 75 80 Leu Ile Asn Ala Leu Val Thr Ser Pro Asp Asp Leu Asp Phe Arg Leu 85 90 95 His Ile Arg Asn Glu Phe Met Arg Cys Gly Leu Lys Glu Ile Leu Pro 100 105 110 Asn Leu Lys Cys Ile Lys Asn Asp Gly Leu Asp Ile Gln Leu Lys Val 115 120 125 Phe Asp Glu His Lys Glu Glu Asp Leu Phe Glu Leu Ser His Arg Leu 130 135 140 Glu Asp Ile Arg Ala Glu Leu Asp Glu Ala Tyr Asp Val Tyr Asn Met 145 150 155 160 Val Trp Ser Thr Val Lys Glu Thr Arg Ala Glu Gly Tyr Phe Ile Ser 165 170 175 Ile Leu Gln His Leu Leu Leu Ile Arg Asn Asp Tyr Phe Ile Arg Gln 180 185 190 Gln Tyr Phe Lys Leu Ile Asp Glu Cys Val Ser Gln Ile Val Leu His 195 200 205 Arg Asp Gly Met Asp Pro Asp Phe Thr Tyr Arg Lys Arg Leu Asp Leu 210 215 220 Asp Leu Thr Gln Phe Val Asp Ile Cys Ile Asp Gln Ala Lys Leu Glu 225 230 235 240 Glu Phe Glu Glu Lys Ala Ser Glu Leu Tyr Lys Lys Phe Glu Lys Glu 245 250 255 Phe Thr Asp His Gln Glu Thr Gln Ala Glu Leu Gln Lys Lys Glu Ala 260 265 270 Lys Ile Asn Glu Leu Gln Ala Glu Leu Gln Ala Phe Lys Ser Gln Phe 275 280 285 Gly Ala Leu Pro Ala Asp Cys Asn Ile Pro Leu Pro Pro Ser Lys Glu 290 295 300 Gly Gly Thr Gly His Ser Ala Leu Pro Pro Pro Pro Pro Leu Pro Ser 305 310 315 320 Gly Gly Gly Val Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro Leu 325 330 335 Pro Gly Met Arg Met Pro Phe Ser Gly Pro Val Pro Pro Pro Pro Pro 340 345 350 Leu Gly Phe Leu Gly Gly Gln Asn Ser Pro Pro Leu Pro Ile Leu Pro 355 360 365 Phe Gly Leu Lys Pro Lys Lys Glu Phe Lys Pro Glu Ile Ser Met Arg 370 375 380 Arg Leu Asn Trp Leu Lys Ile Arg Pro His Glu Met Thr Glu Asn Cys 385 390 395 400 Phe Trp Ile Lys Val Asn Glu Asn Lys Tyr Glu Asn Val Asp Leu Leu 405 410 415 Cys Lys Leu Glu Asn Thr Phe Cys Cys Gln Gln Lys Glu Arg Arg Glu 420 425 430 Glu Glu Asp Ile Glu Glu Lys Lys Ser Ile Lys Lys Lys Ile Lys Glu 435 440 445 Leu Lys Phe Leu Asp Ser Lys Ile Ala Gln Asn Leu Ser Ile Phe Leu 450 455 460 Ser Ser Phe Arg Val Pro Tyr Glu Glu Ile Arg Met Met Ile Leu Glu 465 470 475 480 Val Asp Glu Thr Arg Leu Ala Glu Ser Met Ile Gln Asn Leu Ile Lys 485 490 495 His Leu Pro Asp Gln Glu Gln Leu Asn Ser Leu Ser Gln Phe Lys Ser 500 505 510 Glu Tyr Ser Asn Leu Cys Glu Pro Glu Gln Phe Val Val Val Met Ser 515 520 525 Asn Val Lys Arg Leu Arg Pro Arg Leu Ser Ala Ile Leu Phe Lys Leu 530 535 540 Gln Phe Glu Glu Gln Val Asn Asn Ile Lys Pro Asp Ile Met Ala Val 545 550 555 560 Ser Thr Ala Cys Glu Glu Ile Lys Lys Ser Lys Ser Phe Ser Lys Leu 565 570 575 Leu Glu Leu Val Leu Leu Met Gly Asn Tyr Met Asn Ala Gly Ser Arg 580 585 590 Asn Ala Gln Thr Phe Gly Phe Asn Leu Ser Ser Leu Cys Lys Leu Lys 595 600 605 Asp Thr Lys Ser Ala Asp Gln Lys Thr Thr Leu Leu His Phe Leu Val 610 615 620 Glu Ile Cys Glu Glu Lys Tyr Pro Asp Ile Leu Asn Phe Val Asp Asp 625 630 635 640 Leu Glu Pro Leu Asp Lys Ala Ser Lys Val Ser Val Glu Thr Leu Glu 645 650 655 Lys Asn Leu Arg Gln Met Gly Arg Gln Leu Gln Gln Leu Glu Lys Glu 660 665 670 Leu Glu Thr Phe Pro Pro Pro Glu Asp Leu His Asp Lys Phe Val Thr 675 680 685 Lys Met Ser Arg Phe Val Ile Ser Ala Lys Glu Gln Tyr Glu Thr Leu 690 695 700 Ser Lys Leu His Glu Asn Met Glu Lys Leu Tyr Gln Ser Ile Ile Gly 705 710 715 720 Tyr Tyr Ala Ile Asp Val Lys Lys Val Ser Val Glu Asp Phe Leu Thr 725 730 735 Asp Leu Asn Asn Phe Arg Thr Thr Phe Met Gln Ala Ile Lys Glu Asn 740 745 750 Ile Lys Lys Arg Glu Ala Glu Glu Lys Glu Lys Arg Val Arg Ile Ala 755 760 765 Lys Glu Leu Ala Glu Arg Glu Arg Leu Glu Arg Gln Gln Lys Lys Lys 770 775 780 Arg Leu Leu Glu Met Lys Thr Glu Gly Asp Glu Thr Gly Val Met Asp 785 790 795 800 Asn Leu Leu Glu Ala Leu Gln Ser Gly Ala Ala Phe Arg Asp Arg Arg 805 810 815 Lys Arg Thr Pro Met Pro Lys Asp Val Arg Gln Ser Leu Ser Pro Met 820 825 830 Ser Gln Arg Pro Val Leu Lys Val Cys Asn His Gly Asn Lys Pro Tyr 835 840 845 Leu <210> SEQ ID NO 60 <211> LENGTH: 1638 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 60 Met Ser Gly Glu Val Arg Leu Arg Gln Leu Glu Gln Phe Ile Leu Asp 1 5 10 15 Gly Pro Ala Gln Thr Asn Gly Gln Cys Phe Ser Val Glu Thr Leu Leu 20 25 30 Asp Ile Leu Ile Cys Leu Tyr Asp Glu Cys Asn Asn Ser Pro Leu Arg 35 40 45 Arg Glu Lys Asn Ile Leu Glu Tyr Leu Glu Trp Ala Lys Pro Phe Thr 50 55 60 Ser Lys Val Lys Gln Met Arg Leu His Arg Glu Asp Phe Glu Ile Leu 65 70 75 80 Lys Val Ile Gly Arg Gly Ala Phe Gly Glu Val Ala Val Val Lys Leu 85 90 95 Lys Asn Ala Asp Lys Val Phe Ala Met Lys Ile Leu Asn Lys Trp Glu 100 105 110 Met Leu Lys Arg Ala Glu Thr Ala Cys Phe Arg Glu Glu Arg Asp Val 115 120 125 Leu Val Asn Gly Asp Asn Lys Trp Ile Thr Thr Leu His Tyr Ala Phe 130 135 140 Gln Asp Asp Asn Asn Leu Tyr Leu Val Met Asp Tyr Tyr Val Gly Gly 145 150 155 160 Asp Leu Leu Thr Leu Leu Ser Lys Phe Glu Asp Arg Leu Pro Glu Asp 165 170 175 Met Ala Arg Phe Tyr Leu Ala Glu Met Val Ile Ala Ile Asp Ser Val 180 185 190 His Gln Leu His Tyr Val His Arg Asp Ile Lys Pro Asp Asn Ile Leu 195 200 205 Met Asp Met Asn Gly His Ile Arg Leu Ala Asp Phe Gly Ser Cys Leu 210 215 220 Lys Leu Met Glu Asp Gly Thr Val Gln Ser Ser Val Ala Val Gly Thr 225 230 235 240 Pro Asp Tyr Ile Ser Pro Glu Ile Leu Gln Ala Met Glu Asp Gly Lys 245 250 255 Gly Arg Tyr Gly Pro Glu Cys Asp Trp Trp Ser Leu Gly Val Cys Met 260 265 270 Tyr Glu Met Leu Tyr Gly Glu Thr Pro Phe Tyr Ala Glu Ser Leu Val 275 280 285 Glu Thr Tyr Gly Lys Ile Met Asn His Lys Glu Arg Phe Gln Phe Pro 290 295 300 Ala Gln Val Thr Asp Val Ser Glu Asn Ala Lys Asp Leu Ile Arg Arg 305 310 315 320 Leu Ile Cys Ser Arg Glu His Arg Leu Gly Gln Asn Gly Ile Glu Asp 325 330 335 Phe Lys Lys His Pro Phe Phe Ser Gly Ile Asp Trp Asp Asn Ile Arg 340 345 350 Asn Cys Glu Ala Pro Tyr Ile Pro Glu Val Ser Ser Pro Thr Asp Thr 355 360 365 Ser Asn Phe Asp Val Asp Asp Asp Cys Leu Lys Asn Ser Glu Thr Met 370 375 380 Pro Pro Pro Thr His Thr Ala Phe Ser Gly His His Leu Pro Phe Val 385 390 395 400 Gly Phe Thr Tyr Thr Ser Ser Cys Val Leu Ser Asp Arg Ser Cys Leu 405 410 415 Arg Val Thr Ala Gly Pro Thr Ser Leu Asp Leu Asp Val Asn Val Gln 420 425 430 Arg Thr Leu Asp Asn Asn Leu Ala Thr Glu Ala Tyr Glu Arg Arg Ile 435 440 445 Lys Arg Leu Glu Gln Glu Lys Leu Glu Leu Ser Arg Lys Leu Gln Glu 450 455 460 Ser Thr Gln Thr Val Gln Ala Leu Gln Tyr Ser Thr Val Asp Gly Pro 465 470 475 480 Leu Thr Ala Ser Lys Asp Leu Glu Ile Lys Asn Leu Lys Glu Glu Ile 485 490 495 Glu Lys Leu Arg Lys Gln Val Thr Glu Ser Ser His Leu Glu Gln Gln 500 505 510 Leu Glu Glu Ala Asn Ala Val Arg Gln Glu Leu Asp Asp Ala Phe Arg 515 520 525 Gln Ile Lys Ala Tyr Glu Lys Gln Ile Lys Thr Leu Gln Gln Glu Arg 530 535 540 Glu Asp Leu Asn Lys Leu Glu Val His Thr Glu Ala Leu Ala Ala Glu 545 550 555 560 Ala Ser Lys Asp Arg Lys Leu Arg Glu Gln Ser Glu His Tyr Ser Lys 565 570 575 Gln Leu Glu Asn Glu Leu Glu Gly Leu Lys Gln Lys Gln Ile Ser Tyr 580 585 590 Ser Pro Gly Val Cys Ser Ile Glu His Gln Gln Glu Ile Thr Lys Leu 595 600 605 Lys Thr Asp Leu Glu Lys Lys Ser Ile Phe Tyr Glu Glu Glu Leu Ser 610 615 620 Lys Arg Glu Gly Ile His Ala Asn Glu Ile Lys Asn Leu Lys Lys Glu 625 630 635 640 Leu His Asp Ser Glu Gly Gln Gln Leu Ala Leu Asn Lys Glu Ile Met 645 650 655 Ile Leu Lys Asp Lys Leu Glu Lys Thr Arg Arg Glu Ser Gln Ser Glu 660 665 670 Arg Glu Glu Phe Glu Ser Glu Phe Lys Gln Gln Tyr Glu Arg Glu Lys 675 680 685 Val Leu Leu Thr Glu Glu Asn Lys Lys Leu Thr Ser Glu Leu Asp Lys 690 695 700 Leu Thr Thr Leu Tyr Glu Asn Leu Ser Ile His Asn Gln Gln Leu Glu 705 710 715 720 Glu Glu Val Lys Asp Leu Ala Asp Lys Lys Glu Ser Val Ala His Trp 725 730 735 Glu Ala Gln Ile Thr Glu Ile Ile Gln Trp Val Ser Asp Glu Lys Asp 740 745 750 Ala Arg Gly Tyr Leu Gln Ala Leu Ala Ser Lys Met Thr Glu Glu Leu 755 760 765 Glu Ala Leu Arg Asn Ser Ser Leu Gly Thr Arg Ala Thr Asp Met Pro 770 775 780 Trp Lys Met Arg Arg Phe Ala Lys Leu Asp Met Ser Ala Arg Leu Glu 785 790 795 800 Leu Gln Ser Ala Leu Asp Ala Glu Ile Arg Ala Lys Gln Ala Ile Gln 805 810 815 Glu Glu Leu Asn Lys Val Lys Ala Ser Asn Ile Ile Thr Glu Cys Lys 820 825 830 Leu Lys Asp Ser Glu Lys Lys Asn Leu Glu Leu Leu Ser Glu Ile Glu 835 840 845 Gln Leu Ile Lys Asp Thr Glu Glu Leu Arg Ser Glu Lys Gly Ile Glu 850 855 860 His Gln Asp Ser Gln His Ser Phe Leu Ala Phe Leu Asn Thr Pro Thr 865 870 875 880 Asp Ala Leu Asp Gln Phe Glu Thr Val Asp Ser Thr Pro Leu Ser Val 885 890 895 His Thr Pro Thr Leu Arg Lys Lys Gly Cys Pro Gly Ser Thr Gly Phe 900 905 910 Pro Pro Lys Arg Lys Thr His Gln Phe Phe Val Lys Ser Phe Thr Thr 915 920 925 Pro Thr Lys Cys His Gln Cys Thr Ser Leu Met Val Gly Leu Ile Arg 930 935 940 Gln Gly Cys Ser Cys Glu Val Cys Gly Phe Ser Cys His Ile Thr Cys 945 950 955 960 Val Asn Lys Ala Pro Thr Thr Cys Pro Val Pro Pro Glu Gln Thr Lys 965 970 975 Gly Pro Leu Gly Ile Asp Pro Gln Lys Gly Ile Gly Thr Ala Tyr Glu 980 985 990 Gly His Val Arg Ile Pro Lys Pro Ala Gly Val Lys Lys Gly Trp Gln 995 1000 1005 Arg Ala Leu Ala Ile Val Cys Asp Phe Lys Leu Phe Leu Tyr Asp 1010 1015 1020 Ile Ala Glu Gly Lys Ala Ser Gln Pro Ser Val Val Ile Ser Gln 1025 1030 1035 Val Ile Asp Met Arg Asp Glu Glu Phe Ser Val Ser Ser Val Leu 1040 1045 1050 Ala Ser Asp Val Ile His Ala Ser Arg Lys Asp Ile Pro Cys Ile 1055 1060 1065 Phe Arg Val Thr Ala Ser Gln Leu Ser Ala Ser Asn Asn Lys Cys 1070 1075 1080 Ser Ile Leu Met Leu Ala Asp Thr Glu Asn Glu Lys Asn Lys Trp 1085 1090 1095 Val Gly Val Leu Ser Glu Leu His Lys Ile Leu Lys Lys Asn Lys 1100 1105 1110 Phe Arg Asp Arg Ser Val Tyr Val Pro Lys Glu Ala Tyr Asp Ser 1115 1120 1125 Thr Leu Pro Leu Ile Lys Thr Thr Gln Ala Ala Ala Ile Ile Asp 1130 1135 1140 His Glu Arg Ile Ala Leu Gly Asn Glu Glu Gly Leu Phe Val Val 1145 1150 1155 His Val Thr Lys Asp Glu Ile Ile Arg Val Gly Asp Asn Lys Lys 1160 1165 1170 Ile His Gln Ile Glu Leu Ile Pro Asn Asp Gln Leu Val Ala Val 1175 1180 1185 Ile Ser Gly Arg Asn Arg His Val Arg Leu Phe Pro Met Ser Ala 1190 1195 1200 Leu Asp Gly Arg Glu Thr Asp Phe Tyr Lys Leu Ser Glu Thr Lys 1205 1210 1215 Gly Cys Gln Thr Val Thr Ser Gly Lys Val Arg His Gly Ala Leu 1220 1225 1230 Thr Cys Leu Cys Val Ala Met Lys Arg Gln Val Leu Cys Tyr Glu 1235 1240 1245 Leu Phe Gln Ser Lys Thr Arg His Arg Lys Phe Lys Glu Ile Gln 1250 1255 1260 Val Pro Tyr Asn Val Gln Trp Met Ala Ile Phe Ser Glu Gln Leu 1265 1270 1275 Cys Val Gly Phe Gln Ser Gly Phe Leu Arg Tyr Pro Leu Asn Gly 1280 1285 1290 Glu Gly Asn Pro Tyr Ser Met Leu His Ser Asn Asp His Thr Leu 1295 1300 1305 Ser Phe Ile Ala His Gln Pro Met Asp Ala Ile Cys Ala Val Glu 1310 1315 1320 Ile Ser Ser Lys Glu Tyr Leu Leu Cys Phe Asn Ser Ile Gly Ile 1325 1330 1335 Tyr Thr Asp Cys Gln Gly Arg Arg Ser Arg Gln Gln Glu Leu Met 1340 1345 1350 Trp Pro Ala Asn Pro Ser Ser Cys Cys Tyr Asn Ala Pro Tyr Leu 1355 1360 1365 Ser Val Tyr Ser Glu Asn Ala Val Asp Ile Phe Asp Val Asn Ser 1370 1375 1380 Met Glu Trp Ile Gln Thr Leu Pro Leu Lys Lys Val Arg Pro Leu 1385 1390 1395 Asn Asn Glu Gly Ser Leu Asn Leu Leu Gly Leu Glu Thr Ile Arg 1400 1405 1410 Leu Ile Tyr Phe Lys Asn Lys Met Ala Glu Gly Asp Glu Leu Val 1415 1420 1425 Val Pro Glu Thr Ser Asp Asn Ser Arg Lys Gln Met Val Arg Asn 1430 1435 1440 Ile Asn Asn Lys Arg Arg Tyr Ser Phe Arg Val Pro Glu Glu Glu 1445 1450 1455 Arg Met Gln Gln Arg Arg Glu Met Leu Arg Asp Pro Glu Met Arg 1460 1465 1470 Asn Lys Leu Ile Ser Asn Pro Thr Asn Phe Asn His Ile Ala His 1475 1480 1485 Met Gly Pro Gly Asp Gly Ile Gln Ile Leu Lys Asp Leu Pro Met 1490 1495 1500 Asn Pro Arg Pro Gln Glu Ser Arg Thr Val Phe Ser Gly Ser Val 1505 1510 1515 Ser Ile Pro Ser Ile Thr Lys Ser Arg Pro Glu Pro Gly Arg Ser 1520 1525 1530 Met Ser Ala Ser Ser Gly Leu Ser Ala Arg Ser Ser Ala Gln Asn 1535 1540 1545 Gly Ser Ala Leu Lys Arg Glu Phe Ser Gly Gly Ser Tyr Ser Ala 1550 1555 1560 Lys Arg Gln Pro Met Pro Ser Pro Ser Glu Gly Ser Leu Ser Ser 1565 1570 1575 Gly Gly Met Asp Gln Gly Ser Asp Ala Pro Ala Arg Asp Phe Asp 1580 1585 1590 Gly Glu Asp Ser Asp Ser Pro Arg His Ser Thr Ala Ser Asn Ser 1595 1600 1605 Ser Asn Leu Ser Ser Pro Pro Ser Pro Ala Ser Pro Arg Lys Thr 1610 1615 1620 Lys Ser Leu Ser Leu Glu Ser Thr Asp Arg Gly Ser Trp Asp Pro 1625 1630 1635 <210> SEQ ID NO 61 <211> LENGTH: 1711 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 61 Met Ser Ala Lys Val Arg Leu Lys Lys Leu Glu Gln Leu Leu Leu Asp 1 5 10 15 Gly Pro Trp Arg Asn Glu Ser Ala Leu Ser Val Glu Thr Leu Leu Asp 20 25 30 Val Leu Val Cys Leu Tyr Thr Glu Cys Ser His Ser Ala Leu Arg Arg 35 40 45 Asp Lys Tyr Val Ala Glu Phe Leu Glu Trp Ala Lys Pro Phe Thr Gln 50 55 60 Leu Val Lys Glu Met Gln Leu His Arg Glu Asp Phe Glu Ile Ile Lys 65 70 75 80 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Ala Val Val Lys Met Lys 85 90 95 Asn Thr Glu Arg Ile Tyr Ala Met Lys Ile Leu Asn Lys Trp Glu Met 100 105 110 Leu Lys Arg Ala Glu Thr Ala Cys Phe Arg Glu Glu Arg Asp Val Leu 115 120 125 Val Asn Gly Asp Cys Gln Trp Ile Thr Ala Leu His Tyr Ala Phe Gln 130 135 140 Asp Glu Asn His Leu Tyr Leu Val Met Asp Tyr Tyr Val Gly Gly Asp 145 150 155 160 Leu Leu Thr Leu Leu Ser Lys Phe Glu Asp Lys Leu Pro Glu Asp Met 165 170 175 Ala Arg Phe Tyr Ile Gly Glu Met Val Leu Ala Ile Asp Ser Ile His 180 185 190 Gln Leu His Tyr Val His Arg Asp Ile Lys Pro Asp Asn Val Leu Leu 195 200 205 Asp Val Asn Gly His Ile Arg Leu Ala Asp Phe Gly Ser Cys Leu Lys 210 215 220 Met Asn Asp Asp Gly Thr Val Gln Ser Ser Val Ala Val Gly Thr Pro 225 230 235 240 Asp Tyr Ile Ser Pro Glu Ile Leu Gln Ala Met Glu Asp Gly Met Gly 245 250 255 Lys Tyr Gly Pro Glu Cys Asp Trp Trp Ser Leu Gly Val Cys Met Tyr 260 265 270 Glu Met Leu Tyr Gly Glu Thr Pro Phe Tyr Ala Glu Ser Leu Val Glu 275 280 285 Thr Tyr Gly Lys Ile Met Asn His Glu Glu Arg Phe Gln Phe Pro Ser 290 295 300 His Val Thr Asp Val Ser Glu Glu Ala Lys Asp Leu Ile Gln Arg Leu 305 310 315 320 Ile Cys Ser Arg Glu Arg Arg Leu Gly Gln Asn Gly Ile Glu Asp Phe 325 330 335 Lys Lys His Ala Phe Phe Glu Gly Leu Asn Trp Glu Asn Ile Arg Asn 340 345 350 Leu Glu Ala Pro Tyr Ile Pro Asp Val Ser Ser Pro Ser Asp Thr Ser 355 360 365 Asn Phe Asp Val Asp Asp Asp Val Leu Arg Asn Thr Glu Ile Leu Pro 370 375 380 Pro Gly Ser His Thr Gly Phe Ser Gly Leu His Leu Pro Phe Ile Gly 385 390 395 400 Phe Thr Phe Thr Thr Glu Ser Cys Phe Ser Asp Arg Gly Ser Leu Lys 405 410 415 Ser Ile Met Gln Ser Asn Thr Leu Thr Lys Asp Glu Asp Val Gln Arg 420 425 430 Asp Leu Glu His Ser Leu Gln Met Glu Ala Tyr Glu Arg Arg Ile Arg 435 440 445 Arg Leu Glu Gln Glu Lys Leu Glu Leu Ser Arg Lys Leu Gln Glu Ser 450 455 460 Thr Gln Thr Val Gln Ser Leu His Gly Ser Ser Arg Ala Leu Ser Asn 465 470 475 480 Ser Asn Arg Asp Lys Glu Ile Lys Lys Leu Asn Glu Glu Ile Glu Arg 485 490 495 Leu Lys Asn Lys Ile Ala Asp Ser Asn Arg Leu Glu Arg Gln Leu Glu 500 505 510 Asp Thr Val Ala Leu Arg Gln Glu Arg Glu Asp Ser Thr Gln Arg Leu 515 520 525 Arg Gly Leu Glu Lys Gln His Arg Val Val Arg Gln Glu Lys Glu Glu 530 535 540 Leu His Lys Gln Leu Val Glu Ala Ser Glu Arg Leu Lys Ser Gln Ala 545 550 555 560 Lys Glu Leu Lys Asp Ala His Gln Gln Arg Lys Leu Ala Leu Gln Glu 565 570 575 Phe Ser Glu Leu Asn Glu Arg Met Ala Glu Leu Arg Ala Gln Lys Gln 580 585 590 Lys Val Ser Arg Gln Leu Arg Asp Lys Glu Glu Glu Met Glu Val Ala 595 600 605 Thr Gln Lys Val Asp Ala Met Arg Gln Glu Met Arg Arg Ala Glu Lys 610 615 620 Leu Arg Lys Glu Leu Glu Ala Gln Leu Asp Asp Ala Val Ala Glu Ala 625 630 635 640 Ser Lys Glu Arg Lys Leu Arg Glu His Ser Glu Asn Phe Cys Lys Gln 645 650 655 Met Glu Ser Glu Leu Glu Ala Leu Lys Val Lys Gln Gly Gly Arg Gly 660 665 670 Ala Gly Ala Thr Leu Glu His Gln Gln Glu Ile Ser Lys Ile Lys Ser 675 680 685 Glu Leu Glu Lys Lys Val Leu Phe Tyr Glu Glu Glu Leu Val Arg Arg 690 695 700 Glu Ala Ser His Val Leu Glu Val Lys Asn Val Lys Lys Glu Val His 705 710 715 720 Asp Ser Glu Ser His Gln Leu Ala Leu Gln Lys Glu Ile Leu Met Leu 725 730 735 Lys Asp Lys Leu Glu Lys Ser Lys Arg Glu Arg His Asn Glu Met Glu 740 745 750 Glu Ala Val Gly Thr Ile Lys Asp Lys Tyr Glu Arg Glu Arg Ala Met 755 760 765 Leu Phe Asp Glu Asn Lys Lys Leu Thr Ala Glu Asn Glu Lys Leu Cys 770 775 780 Ser Phe Val Asp Lys Leu Thr Ala Gln Asn Arg Gln Leu Glu Asp Glu 785 790 795 800 Leu Gln Asp Leu Ala Ala Lys Lys Glu Ser Val Ala His Trp Glu Ala 805 810 815 Gln Ile Ala Glu Ile Ile Gln Trp Val Ser Asp Glu Lys Asp Ala Arg 820 825 830 Gly Tyr Leu Gln Ala Leu Ala Ser Lys Met Thr Glu Glu Leu Glu Ala 835 840 845 Leu Arg Ser Ser Ser Leu Gly Ser Arg Thr Leu Asp Pro Leu Trp Lys 850 855 860 Val Arg Arg Ser Gln Lys Leu Asp Met Ser Ala Arg Leu Glu Leu Gln 865 870 875 880 Ser Ala Leu Glu Ala Glu Ile Arg Ala Lys Gln Leu Val Gln Glu Glu 885 890 895 Leu Arg Lys Val Lys Asp Ala Asn Leu Thr Leu Glu Ser Lys Leu Lys 900 905 910 Asp Ser Glu Ala Lys Asn Arg Glu Leu Leu Glu Glu Met Glu Ile Leu 915 920 925 Lys Lys Lys Met Glu Glu Lys Phe Arg Ala Asp Thr Gly Leu Lys Leu 930 935 940 Pro Asp Phe Gln Asp Ser Ile Phe Glu Tyr Phe Asn Thr Ala Pro Leu 945 950 955 960 Ala His Asp Leu Thr Phe Arg Thr Ser Ser Ala Ser Glu Gln Glu Thr 965 970 975 Gln Ala Pro Lys Pro Glu Ala Ser Pro Ser Met Ser Val Ala Ala Ser 980 985 990 Glu Gln Gln Glu Asp Met Ala Arg Pro Pro Gln Arg Pro Ser Ala Val 995 1000 1005 Pro Leu Pro Thr Thr Gln Ala Leu Ala Leu Ala Gly Pro Lys Pro 1010 1015 1020 Lys Ala His Gln Phe Ser Ile Lys Ser Phe Ser Ser Pro Thr Gln 1025 1030 1035 Cys Ser His Cys Thr Ser Leu Met Val Gly Leu Ile Arg Gln Gly 1040 1045 1050 Tyr Ala Cys Glu Val Cys Ser Phe Ala Cys His Val Ser Cys Lys 1055 1060 1065 Asp Gly Ala Pro Gln Val Cys Pro Ile Pro Pro Glu Gln Ser Lys 1070 1075 1080 Arg Pro Leu Gly Val Asp Val Gln Arg Gly Ile Gly Thr Ala Tyr 1085 1090 1095 Lys Gly His Val Lys Val Pro Lys Pro Thr Gly Val Lys Lys Gly 1100 1105 1110 Trp Gln Arg Ala Tyr Ala Val Val Cys Glu Cys Lys Leu Phe Leu 1115 1120 1125 Tyr Asp Leu Pro Glu Gly Lys Ser Thr Gln Pro Gly Val Ile Ala 1130 1135 1140 Ser Gln Val Leu Asp Leu Arg Asp Asp Glu Phe Ser Val Ser Ser 1145 1150 1155 Val Leu Ala Ser Asp Val Ile His Ala Thr Arg Arg Asp Ile Pro 1160 1165 1170 Cys Ile Phe Arg Val Thr Ala Ser Leu Leu Gly Ala Pro Ser Lys 1175 1180 1185 Thr Ser Ser Leu Leu Ile Leu Thr Glu Asn Glu Asn Glu Lys Arg 1190 1195 1200 Lys Trp Val Gly Ile Leu Glu Gly Leu Gln Ser Ile Leu His Lys 1205 1210 1215 Asn Arg Leu Arg Asn Gln Val Val His Val Pro Leu Glu Ala Tyr 1220 1225 1230 Asp Ser Ser Leu Pro Leu Ile Lys Ala Ile Leu Thr Ala Ala Ile 1235 1240 1245 Val Asp Ala Asp Arg Ile Ala Val Gly Leu Glu Glu Gly Leu Tyr 1250 1255 1260 Val Ile Glu Val Thr Arg Asp Val Ile Val Arg Ala Ala Asp Cys 1265 1270 1275 Lys Lys Val His Gln Ile Glu Leu Ala Pro Arg Glu Lys Ile Val 1280 1285 1290 Ile Leu Leu Cys Gly Arg Asn His His Val His Leu Tyr Pro Trp 1295 1300 1305 Ser Ser Leu Asp Gly Ala Glu Gly Ser Phe Asp Ile Lys Leu Pro 1310 1315 1320 Glu Thr Lys Gly Cys Gln Leu Met Ala Thr Ala Thr Leu Lys Arg 1325 1330 1335 Asn Ser Gly Thr Cys Leu Phe Val Ala Val Lys Arg Leu Ile Leu 1340 1345 1350 Cys Tyr Glu Ile Gln Arg Thr Lys Pro Phe His Arg Lys Phe Asn 1355 1360 1365 Glu Ile Val Ala Pro Gly Ser Val Gln Cys Leu Ala Val Leu Arg 1370 1375 1380 Asp Arg Leu Cys Val Gly Tyr Pro Ser Gly Phe Cys Leu Leu Ser 1385 1390 1395 Ile Gln Gly Asp Gly Gln Pro Leu Asn Leu Val Asn Pro Asn Asp 1400 1405 1410 Pro Ser Leu Ala Phe Leu Ser Gln Gln Ser Phe Asp Ala Leu Cys 1415 1420 1425 Ala Val Glu Leu Glu Ser Glu Glu Tyr Leu Leu Cys Phe Ser His 1430 1435 1440 Met Gly Leu Tyr Val Asp Pro Gln Gly Arg Arg Ala Arg Ala Gln 1445 1450 1455 Glu Leu Met Trp Pro Ala Ala Pro Val Ala Cys Ser Cys Ser Pro 1460 1465 1470 Thr His Val Thr Val Tyr Ser Glu Tyr Gly Val Asp Val Phe Asp 1475 1480 1485 Val Arg Thr Met Glu Trp Val Gln Thr Ile Gly Leu Arg Arg Ile 1490 1495 1500 Arg Pro Leu Asn Ser Glu Gly Thr Leu Asn Leu Leu Asn Cys Glu 1505 1510 1515 Pro Pro Arg Leu Ile Tyr Phe Lys Ser Lys Phe Ser Gly Ala Val 1520 1525 1530 Leu Asn Val Pro Asp Thr Ser Asp Asn Ser Lys Lys Gln Met Leu 1535 1540 1545 Arg Thr Arg Ser Lys Arg Arg Phe Val Phe Lys Val Pro Glu Glu 1550 1555 1560 Glu Arg Leu Gln Gln Arg Arg Glu Met Leu Arg Asp Pro Glu Leu 1565 1570 1575 Arg Ser Lys Met Ile Ser Asn Pro Thr Asn Phe Asn His Val Ala 1580 1585 1590 His Met Gly Pro Gly Asp Gly Met Gln Val Leu Met Asp Leu Pro 1595 1600 1605 Leu Ser Ala Val Pro Pro Ser Gln Glu Glu Arg Pro Gly Pro Ala 1610 1615 1620 Pro Thr Asn Leu Ala Arg Gln Pro Pro Ser Arg Asn Lys Pro Tyr 1625 1630 1635 Ile Ser Trp Pro Ser Ser Gly Gly Ser Glu Pro Ser Val Thr Val 1640 1645 1650 Pro Leu Arg Ser Met Ser Asp Pro Asp Gln Asp Phe Asp Lys Glu 1655 1660 1665 Pro Asp Ser Asp Ser Thr Lys His Ser Thr Pro Ser Asn Ser Ser 1670 1675 1680 Asn Pro Ser Gly Pro Pro Ser Pro Asn Ser Pro His Arg Ser Gln 1685 1690 1695 Leu Pro Leu Glu Gly Leu Glu Gln Pro Ala Cys Asp Thr 1700 1705 1710 <210> SEQ ID NO 62 <211> LENGTH: 79 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 62 Met Ser Glu Phe Trp His Lys Leu Gly Cys Cys Val Val Glu Lys Pro 1 5 10 15 Gln Pro Lys Lys Lys Arg Arg Arg Ile Asp Arg Thr Met Ile Gly Glu 20 25 30 Pro Met Asn Phe Val His Leu Thr His Ile Gly Ser Gly Glu Met Gly 35 40 45 Ala Gly Asp Gly Leu Ala Met Thr Gly Ala Val Gln Glu Gln Met Arg 50 55 60 Ser Lys Gly Asn Arg Asp Arg Pro Trp Ser Asn Ser Arg Gly Leu 65 70 75 <210> SEQ ID NO 63 <211> LENGTH: 84 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 63 Met Ser Glu Phe Trp Leu Cys Phe Asn Cys Cys Ile Ala Glu Gln Pro 1 5 10 15 Gln Pro Lys Arg Arg Arg Arg Ile Asp Arg Ser Met Ile Gly Glu Pro 20 25 30 Thr Asn Phe Val His Thr Ala His Val Gly Ser Gly Asp Leu Phe Ser 35 40 45 Gly Met Asn Ser Val Ser Ser Ile Gln Asn Gln Met Gln Ser Lys Gly 50 55 60 Gly Tyr Gly Gly Gly Met Pro Ala Asn Val Gln Met Gln Leu Val Asp 65 70 75 80 Thr Lys Ala Gly <210> SEQ ID NO 64 <211> LENGTH: 954 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 64 Met Glu Glu Glu Glu Gly Ala Val Ala Lys Glu Trp Gly Thr Thr Pro 1 5 10 15 Ala Gly Pro Val Trp Thr Ala Val Phe Asp Tyr Glu Ala Ala Gly Asp 20 25 30 Glu Glu Leu Thr Leu Arg Arg Gly Asp Arg Val Gln Val Leu Ser Gln 35 40 45 Asp Cys Ala Val Ser Gly Asp Glu Gly Trp Trp Thr Gly Gln Leu Pro 50 55 60 Ser Gly Arg Val Gly Val Phe Pro Ser Asn Tyr Val Ala Pro Gly Ala 65 70 75 80 Pro Ala Ala Pro Ala Gly Leu Gln Leu Pro Gln Glu Ile Pro Phe His 85 90 95 Glu Leu Gln Leu Glu Glu Ile Ile Gly Val Gly Gly Phe Gly Lys Val 100 105 110 Tyr Arg Ala Leu Trp Arg Gly Glu Glu Val Ala Val Lys Ala Ala Arg 115 120 125 Leu Asp Pro Glu Lys Asp Pro Ala Val Thr Ala Glu Gln Val Cys Gln 130 135 140 Glu Ala Arg Leu Phe Gly Ala Leu Gln His Pro Asn Ile Ile Ala Leu 145 150 155 160 Arg Gly Ala Cys Leu Asn Pro Pro His Leu Cys Leu Val Met Glu Tyr 165 170 175 Ala Arg Gly Gly Ala Leu Ser Arg Val Leu Ala Gly Arg Arg Val Pro 180 185 190 Pro His Val Leu Val Asn Trp Ala Val Gln Val Ala Arg Gly Met Asn 195 200 205 Tyr Leu His Asn Asp Ala Pro Val Pro Ile Ile His Arg Asp Leu Lys 210 215 220 Ser Ile Asn Ile Leu Ile Leu Glu Ala Ile Glu Asn His Asn Leu Ala 225 230 235 240 Asp Thr Val Leu Lys Ile Thr Asp Phe Gly Leu Ala Arg Glu Trp His 245 250 255 Lys Thr Thr Lys Met Ser Ala Ala Gly Thr Tyr Ala Trp Met Ala Pro 260 265 270 Glu Val Ile Arg Leu Ser Leu Phe Ser Lys Ser Ser Asp Val Trp Ser 275 280 285 Phe Gly Val Leu Leu Trp Glu Leu Leu Thr Gly Glu Val Pro Tyr Arg 290 295 300 Glu Ile Asp Ala Leu Ala Val Ala Tyr Gly Val Ala Met Asn Lys Leu 305 310 315 320 Thr Leu Pro Ile Pro Ser Thr Cys Pro Glu Pro Phe Ala Arg Leu Leu 325 330 335 Glu Glu Cys Trp Asp Pro Asp Pro His Gly Arg Pro Asp Phe Gly Ser 340 345 350 Ile Leu Lys Arg Leu Glu Val Ile Glu Gln Ser Ala Leu Phe Gln Met 355 360 365 Pro Leu Glu Ser Phe His Ser Leu Gln Glu Asp Trp Lys Leu Glu Ile 370 375 380 Gln His Met Phe Asp Asp Leu Arg Thr Lys Glu Lys Glu Leu Arg Ser 385 390 395 400 Arg Glu Glu Glu Leu Leu Arg Ala Ala Gln Glu Gln Arg Phe Gln Glu 405 410 415 Glu Gln Leu Arg Arg Arg Glu Gln Glu Leu Ala Glu Arg Glu Met Asp 420 425 430 Ile Val Glu Arg Glu Leu His Leu Leu Met Cys Gln Leu Ser Gln Glu 435 440 445 Lys Pro Arg Val Arg Lys Arg Lys Gly Asn Phe Lys Arg Ser Arg Leu 450 455 460 Leu Lys Leu Arg Glu Gly Gly Ser His Ile Ser Leu Pro Ser Gly Phe 465 470 475 480 Glu His Lys Ile Thr Val Gln Ala Ser Pro Thr Leu Asp Lys Arg Lys 485 490 495 Gly Ser Asp Gly Ala Ser Pro Pro Ala Ser Pro Ser Ile Ile Pro Arg 500 505 510 Leu Arg Ala Ile Arg Leu Thr Pro Val Asp Cys Gly Gly Ser Ser Ser 515 520 525 Gly Ser Ser Ser Gly Gly Ser Gly Thr Trp Ser Arg Gly Gly Pro Pro 530 535 540 Lys Lys Glu Glu Leu Val Gly Gly Lys Lys Lys Gly Arg Thr Trp Gly 545 550 555 560 Pro Ser Ser Thr Leu Gln Lys Glu Arg Val Gly Gly Glu Glu Arg Leu 565 570 575 Lys Gly Leu Gly Glu Gly Ser Lys Gln Trp Ser Ser Ser Ala Pro Asn 580 585 590 Leu Gly Lys Ser Pro Lys His Thr Pro Ile Ala Pro Gly Phe Ala Ser 595 600 605 Leu Asn Glu Met Glu Glu Phe Ala Glu Ala Glu Asp Gly Gly Ser Ser 610 615 620 Val Pro Pro Ser Pro Tyr Ser Thr Pro Ser Tyr Leu Ser Val Pro Leu 625 630 635 640 Pro Ala Glu Pro Ser Pro Gly Ala Arg Ala Pro Trp Glu Pro Thr Pro 645 650 655 Ser Ala Pro Pro Ala Arg Trp Gly His Gly Ala Arg Arg Arg Cys Asp 660 665 670 Leu Ala Leu Leu Gly Cys Ala Thr Leu Leu Gly Ala Val Gly Leu Gly 675 680 685 Ala Asp Val Ala Glu Ala Arg Ala Ala Asp Gly Glu Glu Gln Arg Arg 690 695 700 Trp Leu Asp Gly Leu Phe Phe Pro Arg Ala Gly Arg Phe Pro Arg Gly 705 710 715 720 Leu Ser Pro Pro Ala Arg Pro His Gly Arg Arg Glu Asp Val Gly Pro 725 730 735 Gly Leu Gly Leu Ala Pro Ser Ala Thr Leu Val Ser Leu Ser Ser Val 740 745 750 Ser Asp Cys Asn Ser Thr Arg Ser Leu Leu Arg Ser Asp Ser Asp Glu 755 760 765 Ala Ala Pro Ala Ala Pro Ser Pro Pro Pro Ser Pro Pro Ala Pro Thr 770 775 780 Pro Thr Pro Ser Pro Ser Thr Asn Pro Leu Val Asp Leu Glu Leu Glu 785 790 795 800 Ser Phe Lys Lys Asp Pro Arg Gln Ser Leu Thr Pro Thr His Val Thr 805 810 815 Ala Ala Cys Ala Val Ser Arg Gly His Arg Arg Thr Pro Ser Asp Gly 820 825 830 Ala Leu Gly Gln Arg Gly Pro Pro Glu Pro Ala Gly His Gly Pro Gly 835 840 845 Pro Arg Asp Leu Leu Asp Phe Pro Arg Leu Pro Asp Pro Gln Ala Leu 850 855 860 Phe Pro Ala Arg Arg Arg Pro Pro Glu Phe Pro Gly Arg Pro Thr Thr 865 870 875 880 Leu Thr Phe Ala Pro Arg Pro Arg Pro Ala Ala Ser Arg Pro Arg Leu 885 890 895 Asp Pro Trp Lys Leu Val Ser Phe Gly Arg Thr Leu Thr Ile Ser Pro 900 905 910 Pro Ser Arg Pro Asp Thr Pro Glu Ser Pro Gly Pro Pro Ser Val Gln 915 920 925 Pro Thr Leu Leu Asp Met Asp Met Glu Gly Gln Asn Gln Asp Ser Thr 930 935 940 Val Pro Leu Cys Gly Ala His Gly Ser His 945 950 <210> SEQ ID NO 65 <211> LENGTH: 847 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 65 Met Glu Pro Leu Lys Ser Leu Phe Leu Lys Ser Pro Leu Gly Ser Trp 1 5 10 15 Asn Gly Ser Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly Arg Pro 20 25 30 Glu Gly Ser Pro Lys Ala Ala Gly Tyr Ala Asn Pro Val Trp Thr Ala 35 40 45 Leu Phe Asp Tyr Glu Pro Ser Gly Gln Asp Glu Leu Ala Leu Arg Lys 50 55 60 Gly Asp Arg Val Glu Val Leu Ser Arg Asp Ala Ala Ile Ser Gly Asp 65 70 75 80 Glu Gly Trp Trp Ala Gly Gln Val Gly Gly Gln Val Gly Ile Phe Pro 85 90 95 Ser Asn Tyr Val Ser Arg Gly Gly Gly Pro Pro Pro Cys Glu Val Ala 100 105 110 Ser Phe Gln Glu Leu Arg Leu Glu Glu Val Ile Gly Ile Gly Gly Phe 115 120 125 Gly Lys Val Tyr Arg Gly Ser Trp Arg Gly Glu Leu Val Ala Val Lys 130 135 140 Ala Ala Arg Gln Asp Pro Asp Glu Asp Ile Ser Val Thr Ala Glu Ser 145 150 155 160 Val Arg Gln Glu Ala Arg Leu Phe Ala Met Leu Ala His Pro Asn Ile 165 170 175 Ile Ala Leu Lys Ala Val Cys Leu Glu Glu Pro Asn Leu Cys Leu Val 180 185 190 Met Glu Tyr Ala Ala Gly Gly Pro Leu Ser Arg Ala Leu Ala Gly Arg 195 200 205 Arg Val Pro Pro His Val Leu Val Asn Trp Ala Val Gln Ile Ala Arg 210 215 220 Gly Met His Tyr Leu His Cys Glu Ala Leu Val Pro Val Ile His Arg 225 230 235 240 Asp Leu Lys Ser Asn Asn Ile Leu Leu Leu Gln Pro Ile Glu Ser Asp 245 250 255 Asp Met Glu His Lys Thr Leu Lys Ile Thr Asp Phe Gly Leu Ala Arg 260 265 270 Glu Trp His Lys Thr Thr Gln Met Ser Ala Ala Gly Thr Tyr Ala Trp 275 280 285 Met Ala Pro Glu Val Ile Lys Ala Ser Thr Phe Ser Lys Gly Ser Asp 290 295 300 Val Trp Ser Phe Gly Val Leu Leu Trp Glu Leu Leu Thr Gly Glu Val 305 310 315 320 Pro Tyr Arg Gly Ile Asp Cys Leu Ala Val Ala Tyr Gly Val Ala Val 325 330 335 Asn Lys Leu Thr Leu Pro Ile Pro Ser Thr Cys Pro Glu Pro Phe Ala 340 345 350 Gln Leu Met Ala Asp Cys Trp Ala Gln Asp Pro His Arg Arg Pro Asp 355 360 365 Phe Ala Ser Ile Leu Gln Gln Leu Glu Ala Leu Glu Ala Gln Val Leu 370 375 380 Arg Glu Met Pro Arg Asp Ser Phe His Ser Met Gln Glu Gly Trp Lys 385 390 395 400 Arg Glu Ile Gln Gly Leu Phe Asp Glu Leu Arg Ala Lys Glu Lys Glu 405 410 415 Leu Leu Ser Arg Glu Glu Glu Leu Thr Arg Ala Ala Arg Glu Gln Arg 420 425 430 Ser Gln Ala Glu Gln Leu Arg Arg Arg Glu His Leu Leu Ala Gln Trp 435 440 445 Glu Leu Glu Val Phe Glu Arg Glu Leu Thr Leu Leu Leu Gln Gln Val 450 455 460 Asp Arg Glu Arg Pro His Val Arg Arg Arg Arg Gly Thr Phe Lys Arg 465 470 475 480 Ser Lys Leu Arg Ala Arg Asp Gly Gly Glu Arg Ile Ser Met Pro Leu 485 490 495 Asp Phe Lys His Arg Ile Thr Val Gln Ala Ser Pro Gly Leu Asp Arg 500 505 510 Arg Arg Asn Val Phe Glu Val Gly Pro Gly Asp Ser Pro Thr Phe Pro 515 520 525 Arg Phe Arg Ala Ile Gln Leu Glu Pro Ala Glu Pro Gly Gln Ala Trp 530 535 540 Gly Arg Gln Ser Pro Arg Arg Leu Glu Asp Ser Ser Asn Gly Glu Arg 545 550 555 560 Arg Ala Cys Trp Ala Trp Gly Pro Ser Ser Pro Lys Pro Gly Glu Ala 565 570 575 Gln Asn Gly Arg Arg Arg Ser Arg Met Asp Glu Ala Thr Trp Tyr Leu 580 585 590 Asp Ser Asp Asp Ser Ser Pro Leu Gly Ser Pro Ser Thr Pro Pro Ala 595 600 605 Leu Asn Gly Asn Pro Pro Arg Pro Ser Leu Glu Pro Glu Glu Pro Lys 610 615 620 Arg Pro Val Pro Ala Glu Arg Gly Ser Ser Ser Gly Thr Pro Lys Leu 625 630 635 640 Ile Gln Arg Ala Leu Leu Arg Gly Thr Ala Leu Leu Ala Ser Leu Gly 645 650 655 Leu Gly Arg Asp Leu Gln Pro Pro Gly Gly Pro Gly Arg Glu Arg Gly 660 665 670 Glu Ser Pro Thr Thr Pro Pro Thr Pro Thr Pro Ala Pro Cys Pro Thr 675 680 685 Glu Pro Pro Pro Ser Pro Leu Ile Cys Phe Ser Leu Lys Thr Pro Asp 690 695 700 Ser Pro Pro Thr Pro Ala Pro Leu Leu Leu Asp Leu Gly Ile Pro Val 705 710 715 720 Gly Gln Arg Ser Ala Lys Ser Pro Arg Arg Glu Glu Glu Pro Arg Gly 725 730 735 Gly Thr Val Ser Pro Pro Pro Gly Thr Ser Arg Ser Ala Pro Gly Thr 740 745 750 Pro Gly Thr Pro Arg Ser Pro Pro Leu Gly Leu Ile Ser Arg Pro Arg 755 760 765 Pro Ser Pro Leu Arg Ser Arg Ile Asp Pro Trp Ser Phe Val Ser Ala 770 775 780 Gly Pro Arg Pro Ser Pro Leu Pro Ser Pro Gln Pro Ala Pro Arg Arg 785 790 795 800 Ala Pro Trp Thr Leu Phe Pro Asp Ser Asp Pro Phe Trp Asp Ser Pro 805 810 815 Pro Ala Asn Pro Phe Gln Gly Gly Pro Gln Asp Cys Arg Ala Gln Thr 820 825 830 Lys Asp Met Gly Ala Gln Ala Pro Trp Val Pro Glu Ala Gly Pro 835 840 845 <210> SEQ ID NO 66 <211> LENGTH: 545 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 66 Met Ser Asn Asn Gly Leu Asp Ile Gln Asp Lys Pro Pro Ala Pro Pro 1 5 10 15 Met Arg Asn Thr Ser Thr Met Ile Gly Ala Gly Ser Lys Asp Ala Gly 20 25 30 Thr Leu Asn His Gly Ser Lys Pro Leu Pro Pro Asn Pro Glu Glu Lys 35 40 45 Lys Lys Lys Asp Arg Phe Tyr Arg Ser Ile Leu Pro Gly Asp Lys Thr 50 55 60 Asn Lys Lys Lys Glu Lys Glu Arg Pro Glu Ile Ser Leu Pro Ser Asp 65 70 75 80 Phe Glu His Thr Ile His Val Gly Phe Asp Ala Val Thr Gly Glu Phe 85 90 95 Thr Gly Met Pro Glu Gln Trp Ala Arg Leu Leu Gln Thr Ser Asn Ile 100 105 110 Thr Lys Ser Glu Gln Lys Lys Asn Pro Gln Ala Val Leu Asp Val Leu 115 120 125 Glu Phe Tyr Asn Ser Lys Lys Thr Ser Asn Ser Gln Lys Tyr Met Ser 130 135 140 Phe Thr Asp Lys Ser Ala Glu Asp Tyr Asn Ser Ser Asn Ala Leu Asn 145 150 155 160 Val Lys Ala Val Ser Glu Thr Pro Ala Val Pro Pro Val Ser Glu Asp 165 170 175 Glu Asp Asp Asp Asp Asp Asp Ala Thr Pro Pro Pro Val Ile Ala Pro 180 185 190 Arg Pro Glu His Thr Lys Ser Val Tyr Thr Arg Ser Val Ile Glu Pro 195 200 205 Leu Pro Val Thr Pro Thr Arg Asp Val Ala Thr Ser Pro Ile Ser Pro 210 215 220 Thr Glu Asn Asn Thr Thr Pro Pro Asp Ala Leu Thr Arg Asn Thr Glu 225 230 235 240 Lys Gln Lys Lys Lys Pro Lys Met Ser Asp Glu Glu Ile Leu Glu Lys 245 250 255 Leu Arg Ser Ile Val Ser Val Gly Asp Pro Lys Lys Lys Tyr Thr Arg 260 265 270 Phe Glu Lys Ile Gly Gln Gly Ala Ser Gly Thr Val Tyr Thr Ala Met 275 280 285 Asp Val Ala Thr Gly Gln Glu Val Ala Ile Lys Gln Met Asn Leu Gln 290 295 300 Gln Gln Pro Lys Lys Glu Leu Ile Ile Asn Glu Ile Leu Val Met Arg 305 310 315 320 Glu Asn Lys Asn Pro Asn Ile Val Asn Tyr Leu Asp Ser Tyr Leu Val 325 330 335 Gly Asp Glu Leu Trp Val Val Met Glu Tyr Leu Ala Gly Gly Ser Leu 340 345 350 Thr Asp Val Val Thr Glu Thr Cys Met Asp Glu Gly Gln Ile Ala Ala 355 360 365 Val Cys Arg Glu Cys Leu Gln Ala Leu Glu Phe Leu His Ser Asn Gln 370 375 380 Val Ile His Arg Asp Ile Lys Ser Asp Asn Ile Leu Leu Gly Met Asp 385 390 395 400 Gly Ser Val Lys Leu Thr Asp Phe Gly Phe Cys Ala Gln Ile Thr Pro 405 410 415 Glu Gln Ser Lys Arg Ser Thr Met Val Gly Thr Pro Tyr Trp Met Ala 420 425 430 Pro Glu Val Val Thr Arg Lys Ala Tyr Gly Pro Lys Val Asp Ile Trp 435 440 445 Ser Leu Gly Ile Met Ala Ile Glu Met Ile Glu Gly Glu Pro Pro Tyr 450 455 460 Leu Asn Glu Asn Pro Leu Arg Ala Leu Tyr Leu Ile Ala Thr Asn Gly 465 470 475 480 Thr Pro Glu Leu Gln Asn Pro Glu Lys Leu Ser Ala Ile Phe Arg Asp 485 490 495 Phe Leu Asn Arg Cys Leu Glu Met Asp Val Glu Lys Arg Gly Ser Ala 500 505 510 Lys Glu Leu Leu Gln His Gln Phe Leu Lys Ile Ala Lys Pro Leu Ser 515 520 525 Ser Leu Thr Pro Leu Ile Ala Ala Ala Lys Glu Ala Thr Lys Asn Asn 530 535 540 His 545 <210> SEQ ID NO 67 <211> LENGTH: 524 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 67 Met Ser Asp Asn Gly Glu Leu Glu Asp Lys Pro Pro Ala Pro Pro Val 1 5 10 15 Arg Met Ser Ser Thr Ile Phe Ser Thr Gly Gly Lys Asp Pro Leu Ser 20 25 30 Ala Asn His Ser Leu Lys Pro Leu Pro Ser Val Pro Glu Glu Lys Lys 35 40 45 Pro Arg His Lys Ile Ile Ser Ile Phe Ser Gly Thr Glu Lys Gly Ser 50 55 60 Lys Lys Lys Glu Lys Glu Arg Pro Glu Ile Ser Pro Pro Ser Asp Phe 65 70 75 80 Glu His Thr Ile His Val Gly Phe Asp Ala Val Thr Gly Glu Phe Thr 85 90 95 Gly Met Pro Glu Gln Trp Ala Arg Leu Leu Gln Thr Ser Asn Ile Thr 100 105 110 Lys Leu Glu Gln Lys Lys Asn Pro Gln Ala Val Leu Asp Val Leu Lys 115 120 125 Phe Tyr Asp Ser Asn Thr Val Lys Gln Lys Tyr Leu Ser Phe Thr Pro 130 135 140 Pro Glu Lys Asp Gly Phe Pro Ser Gly Thr Pro Ala Leu Asn Ala Lys 145 150 155 160 Gly Thr Glu Ala Pro Ala Val Val Thr Glu Glu Glu Asp Asp Asp Glu 165 170 175 Glu Thr Ala Pro Pro Val Ile Ala Pro Arg Pro Asp His Thr Lys Ser 180 185 190 Ile Tyr Thr Arg Ser Val Ile Asp Pro Val Pro Ala Pro Val Gly Asp 195 200 205 Ser His Val Asp Gly Ala Ala Lys Ser Leu Asp Lys Gln Lys Lys Lys 210 215 220 Thr Lys Met Thr Asp Glu Glu Ile Met Glu Lys Leu Arg Thr Ile Val 225 230 235 240 Ser Ile Gly Asp Pro Lys Lys Lys Tyr Thr Arg Tyr Glu Lys Ile Gly 245 250 255 Gln Gly Ala Ser Gly Thr Val Phe Thr Ala Thr Asp Val Ala Leu Gly 260 265 270 Gln Glu Val Ala Ile Lys Gln Ile Asn Leu Gln Lys Gln Pro Lys Lys 275 280 285 Glu Leu Ile Ile Asn Glu Ile Leu Val Met Lys Glu Leu Lys Asn Pro 290 295 300 Asn Ile Val Asn Phe Leu Asp Ser Tyr Leu Val Gly Asp Glu Leu Phe 305 310 315 320 Val Val Met Glu Tyr Leu Ala Gly Gly Ser Leu Thr Asp Val Val Thr 325 330 335 Glu Thr Cys Met Asp Glu Ala Gln Ile Ala Ala Val Cys Arg Glu Cys 340 345 350 Leu Gln Ala Leu Glu Phe Leu His Ala Asn Gln Val Ile His Arg Asp 355 360 365 Ile Lys Ser Asp Asn Val Leu Leu Gly Met Glu Gly Ser Val Lys Leu 370 375 380 Thr Asp Phe Gly Phe Cys Ala Gln Ile Thr Pro Glu Gln Ser Lys Arg 385 390 395 400 Ser Thr Met Val Gly Thr Pro Tyr Trp Met Ala Pro Glu Val Val Thr 405 410 415 Arg Lys Ala Tyr Gly Pro Lys Val Asp Ile Trp Ser Leu Gly Ile Met 420 425 430 Ala Ile Glu Met Val Glu Gly Glu Pro Pro Tyr Leu Asn Glu Asn Pro 435 440 445 Leu Arg Ala Leu Tyr Leu Ile Ala Thr Asn Gly Thr Pro Glu Leu Gln 450 455 460 Asn Pro Glu Lys Leu Ser Pro Ile Phe Arg Asp Phe Leu Asn Arg Cys 465 470 475 480 Leu Glu Met Asp Val Glu Lys Arg Gly Ser Ala Lys Glu Leu Leu Gln 485 490 495 His Pro Phe Leu Lys Leu Ala Lys Pro Leu Ser Ser Leu Thr Pro Leu 500 505 510 Ile Met Ala Ala Lys Glu Ala Met Lys Ser Asn Arg 515 520 <210> SEQ ID NO 68 <211> LENGTH: 544 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 68 Met Ser Asp Gly Leu Asp Asn Glu Glu Lys Pro Pro Ala Pro Pro Leu 1 5 10 15 Arg Met Asn Ser Asn Asn Arg Asp Ser Ser Ala Leu Asn His Ser Ser 20 25 30 Lys Pro Leu Pro Met Ala Pro Glu Glu Lys Asn Lys Lys Ala Arg Leu 35 40 45 Arg Ser Ile Phe Pro Gly Gly Gly Asp Lys Thr Asn Lys Lys Lys Glu 50 55 60 Lys Glu Arg Pro Glu Ile Ser Leu Pro Ser Asp Phe Glu His Thr Ile 65 70 75 80 His Val Gly Phe Asp Ala Val Thr Gly Glu Phe Thr Gly Ile Pro Glu 85 90 95 Gln Trp Ala Arg Leu Leu Gln Thr Ser Asn Ile Thr Lys Leu Glu Gln 100 105 110 Lys Lys Asn Pro Gln Ala Val Leu Asp Val Leu Lys Phe Tyr Asp Ser 115 120 125 Lys Glu Thr Val Asn Asn Gln Lys Tyr Met Ser Phe Thr Ser Gly Asp 130 135 140 Lys Ser Ala His Gly Tyr Ile Ala Ala His Pro Ser Ser Thr Lys Thr 145 150 155 160 Ala Ser Glu Pro Pro Leu Ala Pro Pro Val Ser Glu Glu Glu Asp Glu 165 170 175 Glu Glu Glu Glu Glu Glu Asp Glu Asn Glu Pro Pro Pro Val Ile Ala 180 185 190 Pro Arg Pro Glu His Thr Lys Ser Ile Tyr Thr Arg Ser Val Val Glu 195 200 205 Ser Ile Ala Ser Pro Ala Val Pro Asn Lys Glu Val Thr Pro Pro Ser 210 215 220 Ala Glu Asn Ala Asn Ser Ser Thr Leu Tyr Arg Asn Thr Asp Arg Gln 225 230 235 240 Arg Lys Lys Ser Lys Met Thr Asp Glu Glu Ile Leu Glu Lys Leu Arg 245 250 255 Ser Ile Val Ser Val Gly Asp Pro Lys Lys Lys Tyr Thr Arg Phe Glu 260 265 270 Lys Ile Gly Gln Gly Ala Ser Gly Thr Val Tyr Thr Ala Leu Asp Ile 275 280 285 Ala Thr Gly Gln Glu Val Ala Ile Lys Gln Met Asn Leu Gln Gln Gln 290 295 300 Pro Lys Lys Glu Leu Ile Ile Asn Glu Ile Leu Val Met Arg Glu Asn 305 310 315 320 Lys Asn Pro Asn Ile Val Asn Tyr Leu Asp Ser Tyr Leu Val Gly Asp 325 330 335 Glu Leu Trp Val Val Met Glu Tyr Leu Ala Gly Gly Ser Leu Thr Asp 340 345 350 Val Val Thr Glu Thr Cys Met Asp Glu Gly Gln Ile Ala Ala Val Cys 355 360 365 Arg Glu Cys Leu Gln Ala Leu Asp Phe Leu His Ser Asn Gln Val Ile 370 375 380 His Arg Asp Ile Lys Ser Asp Asn Ile Leu Leu Gly Met Asp Gly Ser 385 390 395 400 Val Lys Leu Thr Asp Phe Gly Phe Cys Ala Gln Ile Thr Pro Glu Gln 405 410 415 Ser Lys Arg Ser Thr Met Val Gly Thr Pro Tyr Trp Met Ala Pro Glu 420 425 430 Val Val Thr Arg Lys Ala Tyr Gly Pro Lys Val Asp Ile Trp Ser Leu 435 440 445 Gly Ile Met Ala Ile Glu Met Val Glu Gly Glu Pro Pro Tyr Leu Asn 450 455 460 Glu Asn Pro Leu Arg Ala Leu Tyr Leu Ile Ala Thr Asn Gly Thr Pro 465 470 475 480 Glu Leu Gln Asn Pro Glu Arg Leu Ser Ala Val Phe Arg Asp Phe Leu 485 490 495 Asn Arg Cys Leu Glu Met Asp Val Asp Arg Arg Gly Ser Ala Lys Glu 500 505 510 Leu Leu Gln His Pro Phe Leu Lys Leu Ala Lys Pro Leu Ser Ser Leu 515 520 525 Thr Pro Leu Ile Ile Ala Ala Lys Glu Ala Ile Lys Asn Ser Ser Arg 530 535 540 <210> SEQ ID NO 69 <211> LENGTH: 719 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 69 Met Phe Gly Lys Lys Lys Lys Lys Ile Glu Ile Ser Gly Pro Ser Asn 1 5 10 15 Phe Glu His Arg Val His Thr Gly Phe Asp Pro Gln Glu Gln Lys Phe 20 25 30 Thr Gly Leu Pro Gln Gln Trp His Ser Leu Leu Ala Asp Thr Ala Asn 35 40 45 Arg Pro Lys Pro Met Val Asp Pro Ser Cys Ile Thr Pro Ile Gln Leu 50 55 60 Ala Pro Met Lys Thr Ile Val Arg Gly Asn Lys Pro Cys Lys Glu Thr 65 70 75 80 Ser Ile Asn Gly Leu Leu Glu Asp Phe Asp Asn Ile Ser Val Thr Arg 85 90 95 Ser Asn Ser Leu Arg Lys Glu Ser Pro Pro Thr Pro Asp Gln Gly Ala 100 105 110 Ser Ser His Gly Pro Gly His Ala Glu Glu Asn Gly Phe Ile Thr Phe 115 120 125 Ser Gln Tyr Ser Ser Glu Ser Asp Thr Thr Ala Asp Tyr Thr Thr Glu 130 135 140 Lys Tyr Arg Glu Lys Ser Leu Tyr Gly Asp Asp Leu Asp Pro Tyr Tyr 145 150 155 160 Arg Gly Ser His Ala Ala Lys Gln Asn Gly His Val Met Lys Met Lys 165 170 175 His Gly Glu Ala Tyr Tyr Ser Glu Val Lys Pro Leu Lys Ser Asp Phe 180 185 190 Ala Arg Phe Ser Ala Asp Tyr His Ser His Leu Asp Ser Leu Ser Lys 195 200 205 Pro Ser Glu Tyr Ser Asp Leu Lys Trp Glu Tyr Gln Arg Ala Ser Ser 210 215 220 Ser Ser Pro Leu Asp Tyr Ser Phe Gln Phe Thr Pro Ser Arg Thr Ala 225 230 235 240 Gly Thr Ser Gly Cys Ser Lys Glu Ser Leu Ala Tyr Ser Glu Ser Glu 245 250 255 Trp Gly Pro Ser Leu Asp Asp Tyr Asp Arg Arg Pro Lys Ser Ser Tyr 260 265 270 Leu Asn Gln Thr Ser Pro Gln Pro Thr Met Arg Gln Arg Ser Arg Ser 275 280 285 Gly Ser Gly Leu Gln Glu Pro Met Met Pro Phe Gly Ala Ser Ala Phe 290 295 300 Lys Thr His Pro Gln Gly His Ser Tyr Asn Ser Tyr Thr Tyr Pro Arg 305 310 315 320 Leu Ser Glu Pro Thr Met Cys Ile Pro Lys Val Asp Tyr Asp Arg Ala 325 330 335 Gln Met Val Leu Ser Pro Pro Leu Ser Gly Ser Asp Thr Tyr Pro Arg 340 345 350 Gly Pro Ala Lys Leu Pro Gln Ser Gln Ser Lys Ser Gly Tyr Ser Ser 355 360 365 Ser Ser His Gln Tyr Pro Ser Gly Tyr His Lys Ala Thr Leu Tyr His 370 375 380 His Pro Ser Leu Gln Ser Ser Ser Gln Tyr Ile Ser Thr Ala Ser Tyr 385 390 395 400 Leu Ser Ser Leu Ser Leu Ser Ser Ser Thr Tyr Pro Pro Pro Ser Trp 405 410 415 Gly Ser Ser Ser Asp Gln Gln Pro Ser Arg Val Ser His Glu Gln Phe 420 425 430 Arg Ala Ala Leu Gln Leu Val Val Ser Pro Gly Asp Pro Arg Glu Tyr 435 440 445 Leu Ala Asn Phe Ile Lys Ile Gly Glu Gly Ser Thr Gly Ile Val Cys 450 455 460 Ile Ala Thr Glu Lys His Thr Gly Lys Gln Val Ala Val Lys Lys Met 465 470 475 480 Asp Leu Arg Lys Gln Gln Arg Arg Glu Leu Leu Phe Asn Glu Val Val 485 490 495 Ile Met Arg Asp Tyr His His Asp Asn Val Val Asp Met Tyr Ser Ser 500 505 510 Tyr Leu Val Gly Asp Glu Leu Trp Val Val Met Glu Phe Leu Glu Gly 515 520 525 Gly Ala Leu Thr Asp Ile Val Thr His Thr Arg Met Asn Glu Glu Gln 530 535 540 Ile Ala Thr Val Cys Leu Ser Val Leu Arg Ala Leu Ser Tyr Leu His 545 550 555 560 Asn Gln Gly Val Ile His Arg Asp Ile Lys Ser Asp Ser Ile Leu Leu 565 570 575 Thr Ser Asp Gly Arg Ile Lys Leu Ser Asp Phe Gly Phe Cys Ala Gln 580 585 590 Val Ser Lys Glu Val Pro Lys Arg Lys Ser Leu Val Gly Thr Pro Tyr 595 600 605 Trp Met Ala Pro Glu Val Ile Ser Arg Leu Pro Tyr Gly Thr Glu Val 610 615 620 Asp Ile Trp Ser Leu Gly Ile Met Val Ile Glu Met Ile Asp Gly Glu 625 630 635 640 Pro Pro Tyr Phe Asn Glu Pro Pro Leu Gln Ala Met Arg Arg Ile Arg 645 650 655 Asp Ser Leu Pro Pro Arg Val Lys Asp Leu His Lys Val Ser Ser Val 660 665 670 Leu Arg Gly Phe Leu Asp Leu Met Leu Val Arg Glu Pro Ser Gln Arg 675 680 685 Ala Thr Ala Gln Glu Leu Leu Gly His Pro Phe Leu Lys Leu Ala Gly 690 695 700 Pro Pro Ser Cys Ile Val Pro Leu Met Arg Gln Tyr Arg His His 705 710 715 <210> SEQ ID NO 70 <211> LENGTH: 681 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 70 Met Phe Arg Lys Lys Lys Lys Lys Arg Pro Glu Ile Ser Ala Pro Gln 1 5 10 15 Asn Phe Gln His Arg Val His Thr Ser Phe Asp Pro Lys Glu Gly Lys 20 25 30 Phe Val Gly Leu Pro Pro Gln Trp Gln Asn Ile Leu Asp Thr Leu Arg 35 40 45 Arg Pro Lys Pro Val Val Asp Pro Ser Arg Ile Thr Arg Val Gln Leu 50 55 60 Gln Pro Met Lys Thr Val Val Arg Gly Ser Ala Met Pro Val Asp Gly 65 70 75 80 Tyr Ile Ser Gly Leu Leu Asn Asp Ile Gln Lys Leu Ser Val Ile Ser 85 90 95 Ser Asn Thr Leu Arg Gly Arg Ser Pro Thr Ser Arg Arg Arg Ala Gln 100 105 110 Ser Leu Gly Leu Leu Gly Asp Glu His Trp Ala Thr Asp Pro Asp Met 115 120 125 Tyr Leu Gln Ser Pro Gln Ser Glu Arg Thr Asp Pro His Gly Leu Tyr 130 135 140 Leu Ser Cys Asn Gly Gly Thr Pro Ala Gly His Lys Gln Met Pro Trp 145 150 155 160 Pro Glu Pro Gln Ser Pro Arg Val Leu Pro Asn Gly Leu Ala Ala Lys 165 170 175 Ala Gln Ser Leu Gly Pro Ala Glu Phe Gln Gly Ala Ser Gln Arg Cys 180 185 190 Leu Gln Leu Gly Ala Cys Leu Gln Ser Ser Pro Pro Gly Ala Ser Pro 195 200 205 Pro Thr Gly Thr Asn Arg His Gly Met Lys Ala Ala Lys His Gly Ser 210 215 220 Glu Glu Ala Arg Pro Gln Ser Cys Leu Val Gly Ser Ala Thr Gly Arg 225 230 235 240 Pro Gly Gly Glu Gly Ser Pro Ser Pro Lys Thr Arg Glu Ser Ser Leu 245 250 255 Lys Arg Arg Leu Phe Arg Ser Met Phe Leu Ser Thr Ala Ala Thr Ala 260 265 270 Pro Pro Ser Ser Ser Lys Pro Gly Pro Pro Pro Gln Ser Lys Pro Asn 275 280 285 Ser Ser Phe Arg Pro Pro Gln Lys Asp Asn Pro Pro Ser Leu Val Ala 290 295 300 Lys Ala Gln Ser Leu Pro Ser Asp Gln Pro Val Gly Thr Phe Ser Pro 305 310 315 320 Leu Thr Thr Ser Asp Thr Ser Ser Pro Gln Lys Ser Leu Arg Thr Ala 325 330 335 Pro Ala Thr Gly Gln Leu Pro Gly Arg Ser Ser Pro Ala Gly Ser Pro 340 345 350 Arg Thr Trp His Ala Gln Ile Ser Thr Ser Asn Leu Tyr Leu Pro Gln 355 360 365 Asp Pro Thr Val Ala Lys Gly Ala Leu Ala Gly Glu Asp Thr Gly Val 370 375 380 Val Thr His Glu Gln Phe Lys Ala Ala Leu Arg Met Val Val Asp Gln 385 390 395 400 Gly Asp Pro Arg Leu Leu Leu Asp Ser Tyr Val Lys Ile Gly Glu Gly 405 410 415 Ser Thr Gly Ile Val Cys Leu Ala Arg Glu Lys His Ser Gly Arg Gln 420 425 430 Val Ala Val Lys Met Met Asp Leu Arg Lys Gln Gln Arg Arg Glu Leu 435 440 445 Leu Phe Asn Glu Val Val Ile Met Arg Asp Tyr Gln His Phe Asn Val 450 455 460 Val Glu Met Tyr Lys Ser Tyr Leu Val Gly Glu Glu Leu Trp Val Leu 465 470 475 480 Met Glu Phe Leu Gln Gly Gly Ala Leu Thr Asp Ile Val Ser Gln Val 485 490 495 Arg Leu Asn Glu Glu Gln Ile Ala Thr Val Cys Glu Ala Val Leu Gln 500 505 510 Ala Leu Ala Tyr Leu His Ala Gln Gly Val Ile His Arg Asp Ile Lys 515 520 525 Ser Asp Ser Ile Leu Leu Thr Leu Asp Gly Arg Val Lys Leu Ser Asp 530 535 540 Phe Gly Phe Cys Ala Gln Ile Ser Lys Asp Val Pro Lys Arg Lys Ser 545 550 555 560 Leu Val Gly Thr Pro Tyr Trp Met Ala Pro Glu Val Ile Ser Arg Ser 565 570 575 Leu Tyr Ala Thr Glu Val Asp Ile Trp Ser Leu Gly Ile Met Val Ile 580 585 590 Glu Met Val Asp Gly Glu Pro Pro Tyr Phe Ser Asp Ser Pro Val Gln 595 600 605 Ala Met Lys Arg Leu Arg Asp Ser Pro Pro Pro Lys Leu Lys Asn Ser 610 615 620 His Lys Val Ser Pro Val Leu Arg Asp Phe Leu Glu Arg Met Leu Val 625 630 635 640 Arg Asp Pro Gln Glu Arg Ala Thr Ala Gln Glu Leu Leu Asp His Pro 645 650 655 Phe Leu Leu Gln Thr Gly Leu Pro Glu Cys Leu Val Pro Leu Ile Gln 660 665 670 Leu Tyr Arg Lys Gln Thr Ser Thr Cys 675 680 <210> SEQ ID NO 71 <211> LENGTH: 346 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 71 Met Ala Arg Pro Gln Arg Thr Pro Ala Arg Ser Pro Asp Ser Ile Val 1 5 10 15 Glu Val Lys Ser Lys Phe Asp Ala Glu Phe Arg Arg Phe Ala Leu Pro 20 25 30 Arg Ala Ser Val Ser Gly Phe Gln Glu Phe Ser Arg Leu Leu Arg Ala 35 40 45 Val His Gln Ile Pro Gly Leu Asp Val Leu Leu Gly Tyr Thr Asp Ala 50 55 60 His Gly Asp Leu Leu Pro Leu Thr Asn Asp Asp Ser Leu His Arg Ala 65 70 75 80 Leu Ala Ser Gly Pro Pro Pro Leu Arg Leu Leu Val Gln Lys Arg Ala 85 90 95 Glu Ala Asp Ser Ser Gly Leu Ala Phe Ala Ser Asn Ser Leu Gln Arg 100 105 110 Arg Lys Lys Gly Leu Leu Leu Arg Pro Val Ala Pro Leu Arg Thr Arg 115 120 125 Pro Pro Leu Leu Ile Ser Leu Pro Gln Asp Phe Arg Gln Val Ser Ser 130 135 140 Val Ile Asp Val Asp Leu Leu Pro Glu Thr His Arg Arg Val Arg Leu 145 150 155 160 His Lys His Gly Ser Asp Arg Pro Leu Gly Phe Tyr Ile Arg Asp Gly 165 170 175 Met Ser Val Arg Val Ala Pro Gln Gly Leu Glu Arg Val Pro Gly Ile 180 185 190 Phe Ile Ser Arg Leu Val Arg Gly Gly Leu Ala Glu Ser Thr Gly Leu 195 200 205 Leu Ala Val Ser Asp Glu Ile Leu Glu Val Asn Gly Ile Glu Val Ala 210 215 220 Gly Lys Thr Leu Asp Gln Val Thr Asp Met Met Val Ala Asn Ser His 225 230 235 240 Asn Leu Ile Val Thr Val Lys Pro Ala Asn Gln Arg Asn Asn Val Val 245 250 255 Arg Gly Ala Ser Gly Arg Leu Thr Gly Pro Pro Ser Ala Gly Pro Gly 260 265 270 Pro Ala Glu Pro Asp Ser Asp Asp Asp Ser Ser Asp Leu Val Ile Glu 275 280 285 Asn Arg Gln Pro Pro Ser Ser Asn Gly Leu Ser Gln Gly Pro Pro Cys 290 295 300 Trp Asp Leu His Pro Gly Cys Arg His Pro Gly Thr Arg Ser Ser Leu 305 310 315 320 Pro Ser Leu Asp Asp Gln Glu Gln Ala Ser Ser Gly Trp Gly Ser Arg 325 330 335 Ile Arg Gly Asp Gly Ser Gly Phe Ser Leu 340 345 <210> SEQ ID NO 72 <211> LENGTH: 552 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 72 Met Ser Leu Ser Arg Ser Glu Glu Met His Arg Leu Thr Glu Asn Val 1 5 10 15 Tyr Lys Thr Ile Met Glu Gln Phe Asn Pro Ser Leu Arg Asn Phe Ile 20 25 30 Ala Met Gly Lys Asn Tyr Glu Lys Ala Leu Ala Gly Val Thr Tyr Ala 35 40 45 Ala Lys Gly Tyr Phe Asp Ala Leu Val Lys Met Gly Glu Leu Ala Ser 50 55 60 Glu Ser Gln Gly Ser Lys Glu Leu Gly Asp Val Leu Phe Gln Met Ala 65 70 75 80 Glu Val His Arg Gln Ile Gln Asn Gln Leu Glu Glu Met Leu Lys Ser 85 90 95 Phe His Asn Glu Leu Leu Thr Gln Leu Glu Gln Lys Val Glu Leu Asp 100 105 110 Ser Arg Tyr Leu Ser Ala Ala Leu Lys Lys Tyr Gln Thr Glu Gln Arg 115 120 125 Ser Lys Gly Asp Ala Leu Asp Lys Cys Gln Ala Glu Leu Lys Lys Leu 130 135 140 Arg Lys Lys Ser Gln Gly Ser Lys Asn Pro Gln Lys Tyr Ser Asp Lys 145 150 155 160 Glu Leu Gln Tyr Ile Asp Ala Ile Ser Asn Lys Gln Gly Glu Leu Glu 165 170 175 Asn Tyr Val Ser Asp Gly Tyr Lys Thr Ala Leu Thr Glu Glu Arg Arg 180 185 190 Arg Phe Cys Phe Leu Val Glu Lys Gln Cys Ala Val Ala Lys Asn Ser 195 200 205 Ala Ala Tyr His Ser Lys Gly Lys Glu Leu Leu Ala Gln Lys Leu Pro 210 215 220 Leu Trp Gln Gln Ala Cys Ala Asp Pro Ser Lys Ile Pro Glu Arg Ala 225 230 235 240 Val Gln Leu Met Gln Gln Val Ala Ser Asn Gly Ala Thr Leu Pro Ser 245 250 255 Ala Leu Ser Ala Ser Lys Ser Asn Leu Val Ile Ser Asp Pro Ile Pro 260 265 270 Gly Ala Lys Pro Leu Pro Val Pro Pro Glu Leu Ala Pro Phe Val Gly 275 280 285 Arg Met Ser Ala Gln Glu Ser Thr Pro Ile Met Asn Gly Val Thr Gly 290 295 300 Pro Asp Gly Glu Asp Tyr Ser Pro Trp Ala Asp Arg Lys Ala Ala Gln 305 310 315 320 Pro Lys Ser Leu Ser Pro Pro Gln Ser Gln Ser Lys Leu Ser Asp Ser 325 330 335 Tyr Ser Asn Thr Leu Pro Val Arg Lys Ser Val Thr Pro Lys Asn Ser 340 345 350 Tyr Ala Thr Thr Glu Asn Lys Thr Leu Pro Arg Ser Ser Ser Met Ala 355 360 365 Ala Gly Leu Glu Arg Asn Gly Arg Met Arg Val Lys Ala Ile Phe Ser 370 375 380 His Ala Ala Gly Asp Asn Ser Thr Leu Leu Ser Phe Lys Glu Gly Asp 385 390 395 400 Leu Ile Thr Leu Leu Val Pro Glu Ala Arg Asp Gly Trp His Tyr Gly 405 410 415 Glu Ser Glu Lys Thr Lys Met Arg Gly Trp Phe Pro Phe Ser Tyr Thr 420 425 430 Arg Val Leu Asp Ser Asp Gly Ser Asp Arg Leu His Met Ser Leu Gln 435 440 445 Gln Gly Lys Ser Ser Ser Thr Gly Asn Leu Leu Asp Lys Asp Asp Leu 450 455 460 Ala Ile Pro Pro Pro Asp Tyr Gly Ala Ala Ser Arg Ala Phe Pro Ala 465 470 475 480 Gln Thr Ala Ser Gly Phe Lys Gln Arg Pro Tyr Ser Val Ala Val Pro 485 490 495 Ala Phe Ser Gln Gly Leu Asp Asp Tyr Gly Ala Arg Ser Met Ser Arg 500 505 510 Asn Pro Phe Ala His Val Gln Leu Lys Pro Thr Val Thr Asn Asp Arg 515 520 525 Cys Asp Leu Ser Ala Gln Gly Pro Glu Gly Arg Glu His Gly Asp Gly 530 535 540 Ser Ala Arg Thr Leu Ala Gly Arg 545 550 <210> SEQ ID NO 73 <211> LENGTH: 1657 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 73 Met Ser Ala Ala Asp Glu Val Asp Gly Leu Gly Val Ala Arg Pro His 1 5 10 15 Tyr Gly Ser Val Leu Asp Asn Glu Arg Leu Thr Ala Glu Glu Met Asp 20 25 30 Glu Arg Arg Arg Gln Asn Val Ala Tyr Glu Tyr Leu Cys His Leu Glu 35 40 45 Glu Ala Lys Arg Trp Met Glu Ala Cys Leu Gly Glu Asp Leu Pro Pro 50 55 60 Thr Thr Glu Leu Glu Glu Gly Leu Arg Asn Gly Val Tyr Leu Ala Lys 65 70 75 80 Leu Gly Asn Phe Phe Ser Pro Lys Val Val Ser Leu Lys Lys Ile Tyr 85 90 95 Asp Arg Glu Gln Thr Arg Tyr Lys Ala Thr Gly Leu His Phe Arg His 100 105 110 Thr Asp Asn Val Ile Gln Trp Leu Asn Ala Met Asp Glu Ile Gly Leu 115 120 125 Pro Lys Ile Phe Tyr Pro Glu Thr Thr Asp Ile Tyr Asp Arg Lys Asn 130 135 140 Met Pro Arg Cys Ile Tyr Cys Ile His Ala Leu Ser Leu Tyr Leu Phe 145 150 155 160 Lys Leu Gly Leu Ala Pro Gln Ile Gln Asp Leu Tyr Gly Lys Val Asp 165 170 175 Phe Thr Glu Glu Glu Ile Asn Asn Met Lys Thr Glu Leu Glu Lys Tyr 180 185 190 Gly Ile Gln Met Pro Ala Phe Ser Lys Ile Gly Gly Ile Leu Ala Asn 195 200 205 Glu Leu Ser Val Asp Glu Ala Ala Leu His Ala Ala Val Ile Ala Ile 210 215 220 Asn Glu Ala Ile Asp Arg Arg Ile Pro Ala Asp Thr Phe Ala Ala Leu 225 230 235 240 Lys Asn Pro Asn Ala Met Leu Val Asn Leu Glu Glu Pro Leu Ala Ser 245 250 255 Thr Tyr Gln Asp Ile Leu Tyr Gln Ala Lys Gln Asp Lys Met Thr Asn 260 265 270 Ala Lys Asn Arg Thr Glu Asn Ser Glu Arg Glu Arg Asp Val Tyr Glu 275 280 285 Glu Leu Leu Thr Gln Ala Glu Ile Gln Gly Asn Ile Asn Lys Val Asn 290 295 300 Thr Phe Ser Ala Leu Ala Asn Ile Asp Leu Ala Leu Glu Gln Gly Asp 305 310 315 320 Ala Leu Ala Leu Phe Arg Ala Leu Gln Ser Pro Ala Leu Gly Leu Arg 325 330 335 Gly Leu Gln Gln Gln Asn Ser Asp Trp Tyr Leu Lys Gln Leu Leu Ser 340 345 350 Asp Lys Gln Gln Lys Arg Gln Ser Gly Gln Thr Asp Pro Leu Gln Lys 355 360 365 Glu Glu Leu Gln Ser Gly Val Asp Ala Ala Asn Ser Ala Ala Gln Gln 370 375 380 Tyr Gln Arg Arg Leu Ala Ala Val Ala Leu Ile Asn Ala Ala Ile Gln 385 390 395 400 Lys Gly Val Ala Glu Lys Thr Val Leu Glu Leu Met Asn Pro Glu Ala 405 410 415 Gln Leu Pro Gln Val Tyr Pro Phe Ala Ala Asp Leu Tyr Gln Lys Glu 420 425 430 Leu Ala Thr Leu Gln Arg Gln Ser Pro Glu His Asn Leu Thr His Pro 435 440 445 Glu Leu Ser Val Ala Val Glu Met Leu Ser Ser Val Ala Leu Ile Asn 450 455 460 Arg Ala Leu Glu Ser Gly Asp Val Asn Thr Val Trp Lys Gln Leu Ser 465 470 475 480 Ser Ser Val Thr Gly Leu Thr Asn Ile Glu Glu Glu Asn Cys Gln Arg 485 490 495 Tyr Leu Asp Glu Leu Met Lys Leu Lys Ala Gln Ala His Ala Glu Asn 500 505 510 Asn Glu Phe Ile Thr Trp Asn Asp Ile Gln Ala Cys Val Asp His Val 515 520 525 Asn Leu Val Val Gln Glu Glu His Glu Arg Ile Leu Ala Ile Gly Leu 530 535 540 Ile Asn Glu Ala Leu Asp Glu Gly Asp Ala Gln Lys Thr Leu Gln Ala 545 550 555 560 Leu Gln Ile Pro Ala Ala Lys Leu Glu Gly Val Leu Ala Glu Val Ala 565 570 575 Gln His Tyr Gln Asp Thr Leu Ile Arg Ala Lys Arg Glu Lys Ala Gln 580 585 590 Glu Ile Gln Asp Glu Ser Ala Val Leu Trp Leu Asp Glu Ile Gln Gly 595 600 605 Gly Ile Trp Gln Ser Asn Lys Asp Thr Gln Glu Ala Gln Lys Phe Ala 610 615 620 Leu Gly Ile Phe Ala Ile Asn Glu Ala Val Glu Ser Gly Asp Val Gly 625 630 635 640 Lys Thr Leu Ser Ala Leu Arg Ser Pro Asp Val Gly Leu Tyr Gly Val 645 650 655 Ile Pro Glu Cys Gly Glu Thr Tyr His Ser Asp Leu Ala Glu Ala Lys 660 665 670 Lys Lys Lys Leu Ala Val Gly Asp Asn Asn Ser Lys Trp Val Lys His 675 680 685 Trp Val Lys Gly Gly Tyr Tyr Tyr Tyr His Asn Leu Glu Thr Gln Glu 690 695 700 Gly Gly Trp Asp Glu Pro Pro Asn Phe Val Gln Asn Ser Met Gln Leu 705 710 715 720 Ser Arg Glu Glu Ile Gln Ser Ser Ile Ser Gly Val Thr Ala Ala Tyr 725 730 735 Asn Arg Glu Gln Leu Trp Leu Ala Asn Glu Gly Leu Ile Thr Arg Leu 740 745 750 Gln Ala Arg Cys Arg Gly Tyr Leu Val Arg Gln Glu Phe Arg Ser Arg 755 760 765 Met Asn Phe Leu Lys Lys Gln Ile Pro Ala Ile Thr Cys Ile Gln Ser 770 775 780 Gln Trp Arg Gly Tyr Lys Gln Lys Lys Ala Tyr Gln Asp Arg Leu Ala 785 790 795 800 Tyr Leu Arg Ser His Lys Asp Glu Val Val Lys Ile Gln Ser Leu Ala 805 810 815 Arg Met His Gln Ala Arg Lys Arg Tyr Arg Asp Arg Leu Gln Tyr Phe 820 825 830 Arg Asp His Ile Asn Asp Ile Ile Lys Ile Gln Ala Phe Ile Arg Ala 835 840 845 Asn Lys Ala Arg Asp Asp Tyr Lys Thr Leu Ile Asn Ala Glu Asp Pro 850 855 860 Pro Met Val Val Val Arg Lys Phe Val His Leu Leu Asp Gln Ser Asp 865 870 875 880 Gln Asp Phe Gln Glu Glu Leu Asp Leu Met Lys Met Arg Glu Glu Val 885 890 895 Ile Thr Leu Ile Arg Ser Asn Gln Gln Leu Glu Asn Asp Leu Asn Leu 900 905 910 Met Asp Ile Lys Ile Gly Leu Leu Val Lys Asn Lys Ile Thr Leu Gln 915 920 925 Asp Val Val Ser His Ser Lys Lys Leu Thr Lys Lys Asn Lys Glu Gln 930 935 940 Leu Ser Asp Met Met Met Ile Asn Lys Gln Lys Gly Gly Leu Lys Ala 945 950 955 960 Leu Ser Lys Glu Lys Arg Glu Lys Leu Glu Ala Tyr Gln His Leu Phe 965 970 975 Tyr Leu Leu Gln Thr Asn Pro Thr Tyr Leu Ala Lys Leu Ile Phe Gln 980 985 990 Met Pro Gln Asn Lys Ser Thr Lys Phe Met Asp Ser Val Ile Phe Thr 995 1000 1005 Leu Tyr Asn Tyr Ala Ser Asn Gln Arg Glu Glu Tyr Leu Leu Leu 1010 1015 1020 Arg Leu Phe Lys Thr Ala Leu Gln Glu Glu Ile Lys Ser Lys Val 1025 1030 1035 Asp Gln Ile Gln Glu Ile Val Thr Gly Asn Pro Thr Val Ile Lys 1040 1045 1050 Met Val Val Ser Phe Asn Arg Gly Ala Arg Gly Gln Asn Ala Leu 1055 1060 1065 Arg Gln Ile Leu Ala Pro Val Val Lys Glu Ile Met Asp Asp Lys 1070 1075 1080 Ser Leu Asn Ile Lys Thr Asp Pro Val Asp Ile Tyr Lys Ser Trp 1085 1090 1095 Val Asn Gln Met Glu Ser Gln Thr Gly Glu Ala Ser Lys Leu Pro 1100 1105 1110 Tyr Asp Val Thr Pro Glu Gln Ala Leu Ala His Glu Glu Val Lys 1115 1120 1125 Thr Arg Leu Asp Ser Ser Ile Arg Asn Met Arg Ala Val Thr Asp 1130 1135 1140 Lys Phe Leu Ser Ala Ile Val Ser Ser Val Asp Lys Ile Pro Tyr 1145 1150 1155 Gly Met Arg Phe Ile Ala Lys Val Leu Lys Asp Ser Leu His Glu 1160 1165 1170 Lys Phe Pro Asp Ala Gly Glu Asp Glu Leu Leu Lys Ile Ile Gly 1175 1180 1185 Asn Leu Leu Tyr Tyr Arg Tyr Met Asn Pro Ala Ile Val Ala Pro 1190 1195 1200 Asp Ala Phe Asp Ile Ile Asp Leu Ser Ala Gly Gly Gln Leu Thr 1205 1210 1215 Thr Asp Gln Arg Arg Asn Leu Gly Ser Ile Ala Lys Met Leu Gln 1220 1225 1230 His Ala Ala Ser Asn Lys Met Phe Leu Gly Asp Asn Ala His Leu 1235 1240 1245 Ser Ile Ile Asn Glu Tyr Leu Ser Gln Ser Tyr Gln Lys Phe Arg 1250 1255 1260 Arg Phe Phe Gln Thr Ala Cys Asp Val Pro Glu Leu Gln Asp Lys 1265 1270 1275 Phe Asn Val Asp Glu Tyr Ser Asp Leu Val Thr Leu Thr Lys Pro 1280 1285 1290 Val Ile Tyr Ile Ser Ile Gly Glu Ile Ile Asn Thr His Thr Leu 1295 1300 1305 Leu Leu Asp His Gln Asp Ala Ile Ala Pro Glu His Asn Asp Pro 1310 1315 1320 Ile His Glu Leu Leu Asp Asp Leu Gly Glu Val Pro Thr Ile Glu 1325 1330 1335 Ser Leu Ile Gly Glu Ser Ser Gly Asn Leu Asn Asp Pro Asn Lys 1340 1345 1350 Glu Ala Leu Ala Lys Thr Glu Val Ser Leu Thr Leu Thr Asn Lys 1355 1360 1365 Phe Asp Val Pro Gly Asp Glu Asn Ala Glu Met Asp Ala Arg Thr 1370 1375 1380 Ile Leu Leu Asn Thr Lys Arg Leu Ile Val Asp Val Ile Arg Phe 1385 1390 1395 Gln Pro Gly Glu Thr Leu Thr Glu Ile Leu Glu Thr Pro Ala Thr 1400 1405 1410 Ser Glu Gln Glu Ala Glu His Gln Arg Ala Met Gln Arg Arg Ala 1415 1420 1425 Ile Arg Asp Ala Lys Thr Pro Asp Lys Met Lys Lys Ser Lys Ser 1430 1435 1440 Val Lys Glu Asp Ser Asn Leu Thr Leu Gln Glu Lys Lys Glu Lys 1445 1450 1455 Ile Gln Thr Gly Leu Lys Lys Leu Thr Glu Leu Gly Thr Val Asp 1460 1465 1470 Pro Lys Asn Lys Tyr Gln Glu Leu Ile Asn Asp Ile Ala Arg Asp 1475 1480 1485 Ile Arg Asn Gln Arg Arg Tyr Arg Gln Arg Arg Lys Ala Glu Leu 1490 1495 1500 Val Lys Leu Gln Gln Thr Tyr Ala Ala Leu Asn Ser Lys Ala Thr 1505 1510 1515 Phe Tyr Gly Glu Gln Val Asp Tyr Tyr Lys Ser Tyr Ile Lys Thr 1520 1525 1530 Cys Leu Asp Asn Leu Ala Ser Lys Gly Lys Val Ser Lys Lys Pro 1535 1540 1545 Arg Glu Met Lys Gly Lys Lys Ser Lys Lys Ile Ser Leu Lys Tyr 1550 1555 1560 Thr Ala Ala Arg Leu His Glu Lys Gly Val Leu Leu Glu Ile Glu 1565 1570 1575 Asp Leu Gln Val Asn Gln Phe Lys Asn Val Ile Phe Glu Ile Ser 1580 1585 1590 Pro Thr Glu Glu Val Gly Asp Phe Glu Val Lys Ala Lys Phe Met 1595 1600 1605 Gly Val Gln Met Glu Thr Phe Met Leu His Tyr Gln Asp Leu Leu 1610 1615 1620 Gln Leu Gln Tyr Glu Gly Val Ala Val Met Lys Leu Phe Asp Arg 1625 1630 1635 Ala Lys Val Asn Val Asn Leu Leu Ile Phe Leu Leu Asn Lys Lys 1640 1645 1650 Phe Tyr Gly Lys 1655 <210> SEQ ID NO 74 <211> LENGTH: 1575 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 74 Met Pro His Glu Glu Leu Pro Ser Leu Gln Arg Pro Arg Tyr Gly Ser 1 5 10 15 Ile Val Asp Asp Glu Arg Leu Ser Ala Glu Glu Met Asp Glu Arg Arg 20 25 30 Arg Gln Asn Ile Ala Tyr Glu Tyr Leu Cys His Leu Glu Glu Ala Lys 35 40 45 Arg Trp Met Glu Val Cys Leu Val Glu Glu Leu Pro Pro Thr Thr Glu 50 55 60 Leu Glu Glu Gly Leu Arg Asn Gly Val Tyr Leu Ala Lys Leu Ala Lys 65 70 75 80 Phe Phe Ala Pro Lys Met Val Ser Glu Lys Lys Ile Tyr Asp Val Glu 85 90 95 Gln Thr Arg Tyr Lys Lys Ser Gly Leu His Phe Arg His Thr Asp Asn 100 105 110 Thr Val Gln Trp Leu Arg Ala Met Glu Ser Ile Gly Leu Pro Lys Ile 115 120 125 Phe Tyr Pro Glu Thr Thr Asp Val Tyr Asp Arg Lys Asn Ile Pro Arg 130 135 140 Met Ile Tyr Cys Ile His Ala Leu Ser Leu Tyr Leu Phe Lys Leu Gly 145 150 155 160 Ile Ala Pro Gln Ile Gln Asp Leu Leu Gly Lys Val Asp Phe Thr Glu 165 170 175 Glu Glu Ile Ser Asn Met Arg Lys Glu Leu Glu Lys Tyr Gly Ile Gln 180 185 190 Met Pro Ser Phe Ser Lys Ile Gly Gly Ile Leu Ala Asn Glu Leu Ser 195 200 205 Val Asp Glu Ala Ala Leu His Ala Ala Val Ile Ala Ile Asn Glu Ala 210 215 220 Val Glu Lys Gly Ile Ala Glu Gln Thr Val Val Thr Leu Arg Asn Pro 225 230 235 240 Asn Ala Val Leu Thr Leu Val Asp Asp Asn Leu Ala Pro Glu Tyr Gln 245 250 255 Lys Glu Leu Trp Asp Ala Lys Lys Lys Lys Glu Glu Asn Ala Arg Leu 260 265 270 Lys Asn Ser Cys Ile Ser Glu Glu Glu Arg Asp Ala Tyr Glu Glu Leu 275 280 285 Leu Thr Gln Ala Glu Ile Gln Gly Asn Ile Asn Lys Val Asn Arg Gln 290 295 300 Ala Ala Val Asp His Ile Asn Ala Val Ile Pro Glu Gly Asp Pro Glu 305 310 315 320 Asn Thr Leu Leu Ala Leu Lys Lys Pro Glu Ala Gln Leu Pro Ala Val 325 330 335 Tyr Pro Phe Ala Ala Ala Met Tyr Gln Asn Glu Leu Phe Asn Leu Gln 340 345 350 Lys Gln Asn Thr Met Asn Tyr Leu Ala His Glu Glu Leu Leu Ile Ala 355 360 365 Val Glu Met Leu Ser Ala Val Ala Leu Leu Asn Gln Ala Leu Glu Ser 370 375 380 Asn Asp Leu Val Ser Val Gln Asn Gln Leu Arg Ser Pro Ala Ile Gly 385 390 395 400 Leu Asn Asn Leu Asp Lys Ala Tyr Val Glu Arg Tyr Ala Asn Thr Leu 405 410 415 Leu Ser Val Lys Leu Glu Val Leu Ser Gln Gly Gln Asp Asn Leu Ser 420 425 430 Trp Asn Glu Ile Gln Asn Cys Ile Asp Met Val Asn Ala Gln Ile Gln 435 440 445 Glu Glu Asn Asp Arg Val Val Ala Val Gly Tyr Ile Asn Glu Ala Ile 450 455 460 Asp Glu Gly Asn Pro Leu Arg Thr Leu Glu Thr Leu Leu Leu Pro Thr 465 470 475 480 Ala Asn Ile Ser Asp Val Asp Pro Ala His Ala Gln His Tyr Gln Asp 485 490 495 Val Leu Tyr His Ala Lys Ser Gln Lys Leu Gly Asp Ser Glu Ser Val 500 505 510 Ser Lys Val Leu Trp Leu Asp Glu Ile Gln Gln Ala Val Asp Glu Ala 515 520 525 Asn Val Asp Glu Asp Arg Ala Lys Gln Trp Val Thr Leu Val Val Asp 530 535 540 Val Asn Gln Cys Leu Glu Gly Lys Lys Ser Ser Asp Ile Leu Ser Val 545 550 555 560 Leu Lys Ser Ser Thr Ser Asn Ala Asn Asp Ile Ile Pro Glu Cys Ala 565 570 575 Asp Lys Tyr Tyr Asp Ala Leu Val Lys Ala Lys Glu Leu Lys Ser Glu 580 585 590 Arg Val Ser Ser Asp Gly Ser Trp Leu Lys Leu Asn Leu His Lys Lys 595 600 605 Tyr Asp Tyr Tyr Tyr Asn Thr Asp Ser Lys Glu Ser Ser Trp Val Thr 610 615 620 Pro Glu Ser Cys Phe Tyr Lys Glu Ser Trp Leu Thr Gly Lys Glu Ile 625 630 635 640 Glu Asp Ile Ile Glu Glu Val Thr Val Gly Tyr Ile Arg Glu Asn Ile 645 650 655 Trp Ser Ala Ser Glu Glu Leu Leu Leu Arg Phe Gln Ala Thr Ser Ser 660 665 670 Gly Pro Ile Leu Arg Glu Glu Phe Glu Ala Arg Lys Ser Phe Leu His 675 680 685 Glu Gln Glu Glu Asn Val Val Lys Ile Gln Ala Phe Trp Lys Gly Tyr 690 695 700 Lys Gln Arg Lys Glu Tyr Met His Arg Arg Gln Thr Phe Ile Asp Asn 705 710 715 720 Thr Asp Ser Val Val Lys Ile Gln Ser Trp Phe Arg Met Ala Thr Ala 725 730 735 Arg Lys Ser Tyr Leu Ser Arg Leu Gln Tyr Phe Arg Asp His Asn Asn 740 745 750 Glu Ile Val Lys Ile Gln Ser Leu Leu Arg Ala Asn Lys Ala Arg Asp 755 760 765 Asp Tyr Lys Thr Leu Val Gly Ser Glu Asn Pro Pro Leu Thr Val Ile 770 775 780 Arg Lys Phe Val Tyr Leu Leu Asp Gln Ser Asp Leu Asp Phe Gln Glu 785 790 795 800 Glu Leu Glu Val Ala Arg Leu Arg Glu Glu Val Val Thr Lys Ile Arg 805 810 815 Ala Asn Gln Gln Leu Glu Lys Asp Leu Asn Leu Met Asp Ile Lys Ile 820 825 830 Gly Leu Leu Val Lys Asn Arg Ile Thr Leu Glu Asp Val Ile Ser His 835 840 845 Ser Lys Lys Leu Asn Lys Lys Lys Gly Gly Glu Met Glu Ile Leu Asn 850 855 860 Asn Thr Asp Asn Gln Gly Ile Lys Ser Leu Ser Lys Glu Arg Arg Lys 865 870 875 880 Thr Leu Glu Thr Tyr Gln Gln Leu Phe Tyr Leu Leu Gln Thr Asn Pro 885 890 895 Leu Tyr Leu Ala Lys Leu Ile Phe Gln Met Pro Gln Asn Lys Ser Thr 900 905 910 Lys Phe Met Asp Thr Val Ile Phe Thr Leu Tyr Asn Tyr Ala Ser Asn 915 920 925 Gln Arg Glu Glu Tyr Leu Leu Leu Lys Leu Phe Lys Thr Ala Leu Glu 930 935 940 Glu Glu Ile Lys Ser Lys Val Asp Gln Val Gln Asp Ile Val Thr Gly 945 950 955 960 Asn Pro Thr Val Ile Lys Met Val Val Ser Phe Asn Arg Gly Ala Arg 965 970 975 Gly Gln Asn Thr Leu Arg Gln Leu Leu Ala Pro Val Val Lys Glu Ile 980 985 990 Ile Asp Asp Lys Ser Leu Ile Ile Asn Thr Asn Pro Val Glu Val Tyr 995 1000 1005 Lys Ala Trp Val Asn Gln Leu Glu Thr Gln Thr Gly Glu Ala Ser 1010 1015 1020 Lys Leu Pro Tyr Asp Val Thr Thr Glu Gln Ala Leu Thr Tyr Pro 1025 1030 1035 Glu Val Lys Asn Lys Leu Glu Ala Ser Ile Glu Asn Leu Arg Arg 1040 1045 1050 Val Thr Asp Lys Val Leu Asn Ser Ile Ile Ser Ser Leu Asp Leu 1055 1060 1065 Leu Pro Tyr Gly Leu Arg Tyr Ile Ala Lys Val Leu Lys Asn Ser 1070 1075 1080 Ile His Glu Lys Phe Pro Asp Ala Thr Glu Asp Glu Leu Leu Lys 1085 1090 1095 Ile Val Gly Asn Leu Leu Tyr Tyr Arg Tyr Met Asn Pro Ala Ile 1100 1105 1110 Val Ala Pro Asp Gly Phe Asp Ile Ile Asp Met Thr Ala Gly Gly 1115 1120 1125 Gln Ile Asn Ser Asp Gln Arg Arg Asn Leu Gly Ser Val Ala Lys 1130 1135 1140 Val Leu Gln His Ala Ala Ser Asn Lys Leu Phe Glu Gly Glu Asn 1145 1150 1155 Glu His Leu Ser Ser Met Asn Asn Tyr Leu Ser Glu Thr Tyr Gln 1160 1165 1170 Glu Phe Arg Lys Tyr Phe Lys Glu Ala Cys Asn Val Pro Glu Pro 1175 1180 1185 Glu Glu Lys Phe Asn Met Asp Lys Tyr Thr Asp Leu Val Thr Val 1190 1195 1200 Ser Lys Pro Val Ile Tyr Ile Ser Ile Glu Glu Ile Ile Ser Thr 1205 1210 1215 His Ser Leu Leu Leu Glu His Gln Asp Ala Ile Ala Pro Glu Lys 1220 1225 1230 Asn Asp Leu Leu Ser Glu Leu Leu Gly Ser Leu Gly Glu Val Pro 1235 1240 1245 Thr Val Glu Ser Phe Leu Gly Glu Gly Ala Val Asp Pro Asn Asp 1250 1255 1260 Pro Asn Lys Ala Asn Thr Leu Ser Gln Leu Ser Lys Thr Glu Ile 1265 1270 1275 Ser Leu Val Leu Thr Ser Lys Tyr Asp Ile Glu Asp Gly Glu Ala 1280 1285 1290 Ile Asp Ser Arg Ser Leu Met Ile Lys Thr Lys Lys Leu Ile Ile 1295 1300 1305 Asp Val Ile Arg Asn Gln Pro Gly Asn Thr Leu Thr Glu Ile Leu 1310 1315 1320 Glu Thr Pro Ala Thr Ala Gln Gln Glu Val Asp His Ala Thr Asp 1325 1330 1335 Met Val Ser Arg Ala Met Ile Asp Ser Arg Thr Pro Glu Glu Met 1340 1345 1350 Lys His Ser Gln Ser Met Ile Glu Asp Ala Gln Leu Pro Leu Glu 1355 1360 1365 Gln Lys Lys Arg Lys Ile Gln Arg Asn Leu Arg Thr Leu Glu Gln 1370 1375 1380 Thr Gly His Val Ser Ser Glu Asn Lys Tyr Gln Asp Ile Leu Asn 1385 1390 1395 Glu Ile Ala Lys Asp Ile Arg Asn Gln Arg Ile Tyr Arg Lys Leu 1400 1405 1410 Arg Lys Ala Glu Leu Ala Lys Leu Gln Gln Thr Leu Asn Ala Leu 1415 1420 1425 Asn Lys Lys Ala Ala Phe Tyr Glu Glu Gln Ile Asn Tyr Tyr Asp 1430 1435 1440 Thr Tyr Ile Lys Thr Cys Leu Asp Asn Leu Lys Arg Lys Asn Thr 1445 1450 1455 Arg Arg Ser Ile Lys Leu Asp Gly Lys Gly Glu Pro Lys Gly Ala 1460 1465 1470 Lys Arg Ala Lys Pro Val Lys Tyr Thr Ala Ala Lys Leu His Glu 1475 1480 1485 Lys Gly Val Leu Leu Asp Ile Asp Asp Leu Gln Thr Asn Gln Phe 1490 1495 1500 Lys Asn Val Thr Phe Asp Ile Ile Ala Thr Glu Asp Val Gly Ile 1505 1510 1515 Phe Asp Val Arg Ser Lys Phe Leu Gly Val Glu Met Glu Lys Val 1520 1525 1530 Gln Leu Asn Ile Gln Asp Leu Leu Gln Met Gln Tyr Glu Gly Val 1535 1540 1545 Ala Val Met Lys Met Phe Asp Lys Val Lys Val Asn Val Asn Leu 1550 1555 1560 Leu Ile Tyr Leu Leu Asn Lys Lys Phe Tyr Gly Lys 1565 1570 1575 <210> SEQ ID NO 75 <211> LENGTH: 1646 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 75 Met Gly Ser Gln Ala Leu Gln Glu Trp Gly Gln Arg Glu Pro Gly Arg 1 5 10 15 Trp Pro Asp Pro Ala Gly Lys Lys Asp Val Arg Arg Glu Ala Ser Asp 20 25 30 Ser Gly Arg Ala Gly Thr Trp Pro Arg Thr Ala Lys Glu Lys Leu Lys 35 40 45 Ile Asp Gly Asp Thr Arg Leu Pro Ser Ser Pro Gln Arg Phe Leu Arg 50 55 60 Gly Cys Gly Asp Leu His Gln Lys Pro Lys Leu Glu Leu Ile Leu Ser 65 70 75 80 Phe Gly Arg Cys Asn Ser Pro Pro Ala Ser Ser Ala Val Pro Gly Arg 85 90 95 Asp Cys Arg Glu Glu Ala Ala Gln Arg Cys Arg Gln Gly Ser Ser Cys 100 105 110 Arg Arg Cys Gly Arg Asp Tyr Leu Ala Ala Arg Arg Gly Pro Ser Glu 115 120 125 Cys Ser Pro Arg Glu Lys Met Ala Ala Ala Ala Gly Asn Arg Ala Ser 130 135 140 Ser Ser Gly Phe Pro Gly Ala Arg Ala Thr Ser Pro Glu Ala Gly Gly 145 150 155 160 Gly Gly Gly Ala Leu Lys Ala Ser Ser Ala Pro Ala Ala Ala Ala Gly 165 170 175 Leu Leu Arg Glu Ala Gly Ser Gly Gly Arg Glu Arg Ala Asp Trp Arg 180 185 190 Arg Arg Gln Leu Arg Lys Val Arg Ser Val Glu Leu Asp Gln Leu Pro 195 200 205 Glu Gln Pro Leu Phe Leu Ala Ala Ser Pro Pro Ala Ser Ser Thr Ser 210 215 220 Pro Ser Pro Glu Pro Ala Asp Ala Ala Gly Ser Gly Thr Gly Phe Gln 225 230 235 240 Pro Val Ala Val Pro Pro Pro His Gly Ala Ala Ser Arg Gly Gly Ala 245 250 255 His Leu Thr Glu Ser Val Ala Ala Pro Asp Ser Gly Ala Ser Ser Pro 260 265 270 Ala Ala Ala Glu Pro Gly Glu Lys Arg Ala Pro Ala Ala Glu Pro Ser 275 280 285 Pro Ala Ala Ala Pro Ala Gly Arg Glu Met Glu Asn Lys Glu Thr Leu 290 295 300 Lys Gly Leu His Lys Met Asp Asp Arg Pro Glu Glu Arg Met Ile Arg 305 310 315 320 Glu Lys Leu Lys Ala Thr Cys Met Pro Ala Trp Lys His Glu Trp Leu 325 330 335 Glu Arg Arg Asn Arg Arg Gly Pro Val Val Val Lys Pro Ile Pro Val 340 345 350 Lys Gly Asp Gly Ser Glu Met Asn His Leu Ala Ala Glu Ser Pro Gly 355 360 365 Glu Val Gln Ala Ser Ala Ala Ser Pro Ala Ser Lys Gly Arg Arg Ser 370 375 380 Pro Ser Pro Gly Asn Ser Pro Ser Gly Arg Thr Val Lys Ser Glu Ser 385 390 395 400 Pro Gly Val Arg Arg Lys Arg Val Ser Pro Val Pro Phe Gln Ser Gly 405 410 415 Arg Ile Thr Pro Pro Arg Arg Ala Pro Ser Pro Asp Gly Phe Ser Pro 420 425 430 Tyr Ser Pro Glu Glu Thr Asn Arg Arg Val Asn Lys Val Met Arg Ala 435 440 445 Arg Leu Tyr Leu Leu Gln Gln Ile Gly Pro Asn Ser Phe Leu Ile Gly 450 455 460 Gly Asp Ser Pro Asp Asn Lys Tyr Arg Val Phe Ile Gly Pro Gln Asn 465 470 475 480 Cys Ser Cys Ala Arg Gly Thr Phe Cys Ile His Leu Leu Phe Val Met 485 490 495 Leu Arg Val Phe Gln Leu Glu Pro Ser Asp Pro Met Leu Trp Arg Lys 500 505 510 Thr Leu Lys Asn Phe Glu Val Glu Ser Leu Phe Gln Lys Tyr His Ser 515 520 525 Arg Arg Ser Ser Arg Ile Lys Ala Pro Ser Arg Asn Thr Ile Gln Lys 530 535 540 Phe Val Ser Arg Met Ser Asn Ser His Thr Leu Ser Ser Ser Ser Thr 545 550 555 560 Ser Thr Ser Ser Ser Glu Asn Ser Ile Lys Asp Glu Glu Glu Gln Met 565 570 575 Cys Pro Ile Cys Leu Leu Gly Met Leu Asp Glu Glu Ser Leu Thr Val 580 585 590 Cys Glu Asp Gly Cys Arg Asn Lys Leu His His His Cys Met Ser Ile 595 600 605 Trp Ala Glu Glu Cys Arg Arg Asn Arg Glu Pro Leu Ile Cys Pro Leu 610 615 620 Cys Arg Ser Lys Trp Arg Ser His Asp Phe Tyr Ser His Glu Leu Ser 625 630 635 640 Ser Pro Val Asp Ser Pro Ser Ser Leu Arg Ala Ala Gln Gln Gln Thr 645 650 655 Val Gln Gln Gln Pro Leu Ala Gly Ser Arg Arg Asn Gln Glu Ser Asn 660 665 670 Phe Asn Leu Thr His Tyr Gly Thr Gln Gln Ile Pro Pro Ala Tyr Lys 675 680 685 Asp Leu Ala Glu Pro Trp Ile Gln Val Phe Gly Met Glu Leu Val Gly 690 695 700 Cys Leu Phe Ser Arg Asn Trp Asn Val Arg Glu Met Ala Leu Arg Arg 705 710 715 720 Leu Ser His Asp Val Ser Gly Ala Leu Leu Leu Ala Asn Gly Glu Ser 725 730 735 Thr Gly Asn Ser Gly Gly Ser Ser Gly Ser Ser Pro Ser Gly Gly Ala 740 745 750 Thr Ser Gly Ser Ser Gln Thr Ser Ile Ser Gly Asp Val Val Glu Ala 755 760 765 Cys Cys Ser Val Leu Ser Met Val Cys Ala Asp Pro Val Tyr Lys Val 770 775 780 Tyr Val Ala Ala Leu Lys Thr Leu Arg Ala Met Leu Val Tyr Thr Pro 785 790 795 800 Cys His Ser Leu Ala Glu Arg Ile Lys Leu Gln Arg Leu Leu Gln Pro 805 810 815 Val Val Asp Thr Ile Leu Val Lys Cys Ala Asp Ala Asn Ser Arg Thr 820 825 830 Ser Gln Leu Ser Ile Ser Thr Leu Leu Glu Leu Cys Lys Gly Gln Ala 835 840 845 Gly Glu Leu Ala Val Gly Arg Glu Ile Leu Lys Ala Gly Ser Ile Gly 850 855 860 Ile Gly Gly Val Asp Tyr Val Leu Asn Cys Ile Leu Gly Asn Gln Thr 865 870 875 880 Glu Ser Asn Asn Trp Gln Glu Leu Leu Gly Arg Leu Cys Leu Ile Asp 885 890 895 Arg Leu Leu Leu Glu Phe Pro Ala Glu Phe Tyr Pro His Ile Val Ser 900 905 910 Thr Asp Val Ser Gln Ala Glu Pro Val Glu Ile Arg Tyr Lys Lys Leu 915 920 925 Leu Ser Leu Leu Thr Phe Ala Leu Gln Ser Ile Asp Asn Ser His Ser 930 935 940 Met Val Gly Lys Leu Ser Arg Arg Ile Tyr Leu Ser Ser Ala Arg Met 945 950 955 960 Val Thr Thr Val Pro His Val Phe Ser Lys Leu Leu Glu Met Leu Ser 965 970 975 Val Ser Ser Ser Thr His Phe Thr Arg Met Arg Arg Arg Leu Met Ala 980 985 990 Ile Ala Asp Glu Val Glu Ile Ala Glu Ala Ile Gln Leu Gly Val Glu 995 1000 1005 Asp Thr Leu Asp Gly Gln Gln Asp Ser Phe Leu Gln Ala Ser Val 1010 1015 1020 Pro Asn Asn Tyr Leu Glu Thr Thr Glu Asn Ser Ser Pro Glu Cys 1025 1030 1035 Thr Val His Leu Glu Lys Thr Gly Lys Gly Leu Cys Ala Thr Lys 1040 1045 1050 Leu Ser Ala Ser Ser Glu Asp Ile Ser Glu Arg Leu Ala Ser Ile 1055 1060 1065 Ser Val Gly Pro Ser Ser Ser Thr Thr Thr Thr Thr Thr Thr Thr 1070 1075 1080 Glu Gln Pro Lys Pro Met Val Gln Thr Lys Gly Arg Pro His Ser 1085 1090 1095 Gln Cys Leu Asn Ser Ser Pro Leu Ser His His Ser Gln Leu Met 1100 1105 1110 Phe Pro Ala Leu Ser Thr Pro Ser Ser Ser Thr Pro Ser Val Pro 1115 1120 1125 Ala Gly Thr Ala Thr Asp Val Ser Lys His Arg Leu Gln Gly Phe 1130 1135 1140 Ile Pro Cys Arg Ile Pro Ser Ala Ser Pro Gln Thr Gln Arg Lys 1145 1150 1155 Phe Ser Leu Gln Phe His Arg Asn Cys Pro Glu Asn Lys Asp Ser 1160 1165 1170 Asp Lys Leu Ser Pro Val Phe Thr Gln Ser Arg Pro Leu Pro Ser 1175 1180 1185 Ser Asn Ile His Arg Pro Lys Pro Ser Arg Pro Thr Pro Gly Asn 1190 1195 1200 Thr Ser Lys Gln Gly Asp Pro Ser Lys Asn Ser Met Thr Leu Asp 1205 1210 1215 Leu Asn Ser Ser Ser Lys Cys Asp Asp Ser Phe Gly Cys Ser Ser 1220 1225 1230 Asn Ser Ser Asn Ala Val Ile Pro Ser Asp Glu Thr Val Phe Thr 1235 1240 1245 Pro Val Glu Glu Lys Cys Arg Leu Asp Val Asn Thr Glu Leu Asn 1250 1255 1260 Ser Ser Ile Glu Asp Leu Leu Glu Ala Ser Met Pro Ser Ser Asp 1265 1270 1275 Thr Thr Val Thr Phe Lys Ser Glu Val Ala Val Leu Ser Pro Glu 1280 1285 1290 Lys Ala Glu Asn Asp Asp Thr Tyr Lys Asp Asp Val Asn His Asn 1295 1300 1305 Gln Lys Cys Lys Glu Lys Met Glu Ala Glu Glu Glu Glu Ala Leu 1310 1315 1320 Ala Ile Ala Met Ala Met Ser Ala Ser Gln Asp Ala Leu Pro Ile 1325 1330 1335 Val Pro Gln Leu Gln Val Glu Asn Gly Glu Asp Ile Ile Ile Ile 1340 1345 1350 Gln Gln Asp Thr Pro Glu Thr Leu Pro Gly His Thr Lys Ala Lys 1355 1360 1365 Gln Pro Tyr Arg Glu Asp Thr Glu Trp Leu Lys Gly Gln Gln Ile 1370 1375 1380 Gly Leu Gly Ala Phe Ser Ser Cys Tyr Gln Ala Gln Asp Val Gly 1385 1390 1395 Thr Gly Thr Leu Met Ala Val Lys Gln Val Thr Tyr Val Arg Asn 1400 1405 1410 Thr Ser Ser Glu Gln Glu Glu Val Val Glu Ala Leu Arg Glu Glu 1415 1420 1425 Ile Arg Met Met Ser His Leu Asn His Pro Asn Ile Ile Arg Met 1430 1435 1440 Leu Gly Ala Thr Cys Glu Lys Ser Asn Tyr Asn Leu Phe Ile Glu 1445 1450 1455 Trp Met Ala Gly Gly Ser Val Ala His Leu Leu Ser Lys Tyr Gly 1460 1465 1470 Ala Phe Lys Glu Ser Val Val Ile Asn Tyr Thr Glu Gln Leu Leu 1475 1480 1485 Arg Gly Leu Ser Tyr Leu His Glu Asn Gln Ile Ile His Arg Asp 1490 1495 1500 Val Lys Gly Ala Asn Leu Leu Ile Asp Ser Thr Gly Gln Arg Leu 1505 1510 1515 Arg Ile Ala Asp Phe Gly Ala Ala Ala Arg Leu Ala Ser Lys Gly 1520 1525 1530 Thr Gly Ala Gly Glu Phe Gln Gly Gln Leu Leu Gly Thr Ile Ala 1535 1540 1545 Phe Met Ala Pro Glu Val Leu Arg Gly Gln Gln Tyr Gly Arg Ser 1550 1555 1560 Cys Asp Val Trp Ser Val Gly Cys Ala Ile Ile Glu Met Ala Cys 1565 1570 1575 Ala Lys Pro Pro Trp Asn Ala Glu Lys His Ser Asn His Leu Ala 1580 1585 1590 Leu Ile Phe Lys Ile Ala Ser Ala Thr Thr Ala Pro Ser Ile Pro 1595 1600 1605 Ser His Leu Ser Pro Gly Leu Arg Asp Val Ala Leu Arg Cys Leu 1610 1615 1620 Glu Leu Gln Pro Gln Asp Arg Pro Pro Ser Arg Glu Leu Leu Lys 1625 1630 1635 His Pro Val Phe Arg Thr Thr Trp 1640 1645 <210> SEQ ID NO 76 <211> LENGTH: 1608 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 76 Met Arg Glu Ala Ala Ala Ala Leu Val Pro Pro Pro Ala Phe Ala Val 1 5 10 15 Thr Pro Ala Ala Ala Met Glu Glu Pro Pro Pro Pro Pro Pro Pro Pro 20 25 30 Pro Pro Pro Pro Glu Pro Glu Thr Glu Ser Glu Pro Glu Cys Cys Leu 35 40 45 Ala Ala Arg Gln Glu Gly Thr Leu Gly Asp Ser Ala Cys Lys Ser Pro 50 55 60 Glu Ser Asp Leu Glu Asp Phe Ser Asp Glu Thr Asn Thr Glu Asn Leu 65 70 75 80 Tyr Gly Thr Ser Pro Pro Ser Thr Pro Arg Gln Met Lys Arg Met Ser 85 90 95 Thr Lys His Gln Arg Asn Asn Val Gly Arg Pro Ala Ser Arg Ser Asn 100 105 110 Leu Lys Glu Lys Met Asn Ala Pro Asn Gln Pro Pro His Lys Asp Thr 115 120 125 Gly Lys Thr Val Glu Asn Val Glu Glu Tyr Ser Tyr Lys Gln Glu Lys 130 135 140 Lys Ile Arg Ala Ala Leu Arg Thr Thr Glu Arg Asp His Lys Lys Asn 145 150 155 160 Val Gln Cys Ser Phe Met Leu Asp Ser Val Gly Gly Ser Leu Pro Lys 165 170 175 Lys Ser Ile Pro Asp Val Asp Leu Asn Lys Pro Tyr Leu Ser Leu Gly 180 185 190 Cys Ser Asn Ala Lys Leu Pro Val Ser Val Pro Met Pro Ile Ala Arg 195 200 205 Pro Ala Arg Gln Thr Ser Arg Thr Asp Cys Pro Ala Asp Arg Leu Lys 210 215 220 Phe Phe Glu Thr Leu Arg Leu Leu Leu Lys Leu Thr Ser Val Ser Lys 225 230 235 240 Lys Lys Asp Arg Glu Gln Arg Gly Gln Glu Asn Thr Ser Gly Phe Trp 245 250 255 Leu Asn Arg Ser Asn Glu Leu Ile Trp Leu Glu Leu Gln Ala Trp His 260 265 270 Ala Gly Arg Thr Ile Asn Asp Gln Asp Phe Phe Leu Tyr Thr Ala Arg 275 280 285 Gln Ala Ile Pro Asp Ile Ile Asn Glu Ile Leu Thr Phe Lys Val Asp 290 295 300 Tyr Gly Ser Phe Ala Phe Val Arg Asp Arg Ala Gly Phe Asn Gly Thr 305 310 315 320 Ser Val Glu Gly Gln Cys Lys Ala Thr Pro Gly Thr Lys Ile Val Gly 325 330 335 Tyr Ser Thr His His Glu His Leu Gln Arg Gln Arg Val Ser Phe Glu 340 345 350 Gln Val Lys Arg Ile Met Glu Leu Leu Glu Tyr Ile Glu Ala Leu Tyr 355 360 365 Pro Ser Leu Gln Ala Leu Gln Lys Asp Tyr Glu Lys Tyr Ala Ala Lys 370 375 380 Asp Phe Gln Asp Arg Val Gln Ala Leu Cys Leu Trp Leu Asn Ile Thr 385 390 395 400 Lys Asp Leu Asn Gln Lys Leu Arg Ile Met Gly Thr Val Leu Gly Ile 405 410 415 Lys Asn Leu Ser Asp Ile Gly Trp Pro Val Phe Glu Ile Pro Ser Pro 420 425 430 Arg Pro Ser Lys Gly Asn Glu Pro Glu Tyr Glu Gly Asp Asp Thr Glu 435 440 445 Gly Glu Leu Lys Glu Leu Glu Ser Ser Thr Asp Glu Ser Glu Glu Glu 450 455 460 Gln Ile Ser Asp Pro Arg Val Pro Glu Ile Arg Gln Pro Ile Asp Asn 465 470 475 480 Ser Phe Asp Ile Gln Ser Arg Asp Cys Ile Ser Lys Lys Leu Glu Arg 485 490 495 Leu Glu Ser Glu Asp Asp Ser Leu Gly Trp Gly Ala Pro Asp Trp Ser 500 505 510 Thr Glu Ala Gly Phe Ser Arg His Cys Leu Thr Ser Ile Tyr Arg Pro 515 520 525 Phe Val Asp Lys Ala Leu Lys Gln Met Gly Leu Arg Lys Leu Ile Leu 530 535 540 Arg Leu His Lys Leu Met Asp Gly Ser Leu Gln Arg Ala Arg Ile Ala 545 550 555 560 Leu Val Lys Asn Asp Arg Pro Val Glu Phe Ser Glu Phe Pro Asp Pro 565 570 575 Met Trp Gly Ser Asp Tyr Val Gln Leu Ser Arg Thr Pro Pro Ser Ser 580 585 590 Glu Glu Lys Cys Ser Ala Val Ser Trp Glu Glu Leu Lys Ala Met Asp 595 600 605 Leu Pro Ser Phe Glu Pro Ala Phe Leu Val Leu Cys Arg Val Leu Leu 610 615 620 Asn Val Ile His Glu Cys Leu Lys Leu Arg Leu Glu Gln Arg Pro Ala 625 630 635 640 Gly Glu Pro Ser Leu Leu Ser Ile Lys Gln Leu Val Arg Glu Cys Lys 645 650 655 Glu Val Leu Lys Gly Gly Leu Leu Met Lys Gln Tyr Tyr Gln Phe Met 660 665 670 Leu Gln Glu Val Leu Glu Asp Leu Glu Lys Pro Asp Cys Asn Ile Asp 675 680 685 Ala Phe Glu Glu Asp Leu His Lys Met Leu Met Val Tyr Phe Asp Tyr 690 695 700 Met Arg Ser Trp Ile Gln Met Leu Gln Gln Leu Pro Gln Ala Ser His 705 710 715 720 Ser Leu Lys Asn Leu Leu Glu Glu Glu Trp Asn Phe Thr Lys Glu Ile 725 730 735 Thr His Tyr Ile Arg Gly Gly Glu Ala Gln Ala Gly Lys Leu Phe Cys 740 745 750 Asp Ile Ala Gly Met Leu Leu Lys Ser Thr Gly Ser Phe Leu Glu Phe 755 760 765 Gly Leu Gln Glu Ser Cys Ala Glu Phe Trp Thr Ser Ala Asp Asp Ser 770 775 780 Ser Ala Ser Asp Glu Ile Arg Arg Ser Val Ile Glu Ile Ser Arg Ala 785 790 795 800 Leu Lys Glu Leu Phe His Glu Ala Arg Glu Arg Ala Ser Lys Ala Leu 805 810 815 Gly Phe Ala Lys Met Leu Arg Lys Asp Leu Glu Ile Ala Ala Glu Phe 820 825 830 Arg Leu Ser Ala Pro Val Arg Asp Leu Leu Asp Val Leu Lys Ser Lys 835 840 845 Gln Tyr Val Lys Val Gln Ile Pro Gly Leu Glu Asn Leu Gln Met Phe 850 855 860 Val Pro Asp Thr Leu Ala Glu Glu Lys Ser Ile Ile Leu Gln Leu Leu 865 870 875 880 Asn Ala Ala Ala Gly Lys Asp Cys Ser Lys Asp Ser Asp Asp Val Leu 885 890 895 Ile Asp Ala Tyr Leu Leu Leu Thr Lys His Gly Asp Arg Ala Arg Asp 900 905 910 Ser Glu Asp Ser Trp Gly Thr Trp Glu Ala Gln Pro Val Lys Val Val 915 920 925 Pro Gln Val Glu Thr Val Asp Thr Leu Arg Ser Met Gln Val Asp Asn 930 935 940 Leu Leu Leu Val Val Met Gln Ser Ala His Leu Thr Ile Gln Arg Lys 945 950 955 960 Ala Phe Gln Gln Ser Ile Glu Gly Leu Met Thr Leu Cys Gln Glu Gln 965 970 975 Thr Ser Ser Gln Pro Val Ile Ala Lys Ala Leu Gln Gln Leu Lys Asn 980 985 990 Asp Ala Leu Glu Leu Cys Asn Arg Ile Ser Asn Ala Ile Asp Arg Val 995 1000 1005 Asp His Met Phe Thr Ser Glu Phe Asp Ala Glu Val Asp Glu Ser 1010 1015 1020 Glu Ser Val Thr Leu Gln Gln Tyr Tyr Arg Glu Ala Met Ile Gln 1025 1030 1035 Gly Tyr Asn Phe Gly Phe Glu Tyr His Lys Glu Val Val Arg Leu 1040 1045 1050 Met Ser Gly Glu Phe Arg Gln Lys Ile Gly Asp Lys Tyr Ile Ser 1055 1060 1065 Phe Ala Arg Lys Trp Met Asn Tyr Val Leu Thr Lys Cys Glu Ser 1070 1075 1080 Gly Arg Gly Thr Arg Pro Arg Trp Ala Thr Gln Gly Phe Asp Phe 1085 1090 1095 Leu Gln Ala Ile Glu Pro Ala Phe Ile Ser Ala Leu Pro Glu Asp 1100 1105 1110 Asp Phe Leu Ser Leu Gln Ala Leu Met Asn Glu Cys Ile Gly His 1115 1120 1125 Val Ile Gly Lys Pro His Ser Pro Val Thr Gly Leu Tyr Leu Ala 1130 1135 1140 Ile His Arg Asn Ser Pro Arg Pro Met Lys Val Pro Arg Cys His 1145 1150 1155 Ser Asp Pro Pro Asn Pro His Leu Ile Ile Pro Thr Pro Glu Gly 1160 1165 1170 Phe Ser Thr Arg Ser Met Pro Ser Asp Ala Arg Ser His Gly Ser 1175 1180 1185 Pro Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Val Ala Ala Ser 1190 1195 1200 Arg Pro Ser Pro Ser Gly Gly Asp Ser Val Leu Pro Lys Ser Ile 1205 1210 1215 Ser Ser Ala His Asp Thr Arg Gly Ser Ser Val Pro Glu Asn Asp 1220 1225 1230 Arg Leu Ala Ser Ile Ala Ala Glu Leu Gln Phe Arg Ser Leu Ser 1235 1240 1245 Arg His Ser Ser Pro Thr Glu Glu Arg Asp Glu Pro Ala Tyr Pro 1250 1255 1260 Arg Gly Asp Ser Ser Gly Ser Thr Arg Arg Ser Trp Glu Leu Arg 1265 1270 1275 Thr Leu Ile Ser Gln Ser Lys Asp Thr Ala Ser Lys Leu Gly Pro 1280 1285 1290 Ile Glu Ala Ile Gln Lys Ser Val Arg Leu Phe Glu Glu Lys Arg 1295 1300 1305 Tyr Arg Glu Met Arg Arg Lys Asn Ile Ile Gly Gln Val Cys Asp 1310 1315 1320 Thr Pro Lys Ser Tyr Asp Asn Val Met His Val Gly Leu Arg Lys 1325 1330 1335 Val Thr Phe Lys Trp Gln Arg Gly Asn Lys Ile Gly Glu Gly Gln 1340 1345 1350 Tyr Gly Lys Val Tyr Thr Cys Ile Ser Val Asp Thr Gly Glu Leu 1355 1360 1365 Met Ala Met Lys Glu Ile Arg Phe Gln Pro Asn Asp His Lys Thr 1370 1375 1380 Ile Lys Glu Thr Ala Asp Glu Leu Lys Ile Phe Glu Gly Ile Lys 1385 1390 1395 His Pro Asn Leu Val Arg Tyr Phe Gly Val Glu Leu His Arg Glu 1400 1405 1410 Glu Met Tyr Ile Phe Met Glu Tyr Cys Asp Glu Gly Thr Leu Glu 1415 1420 1425 Glu Val Ser Arg Leu Gly Leu Gln Glu His Val Ile Arg Leu Tyr 1430 1435 1440 Ser Lys Gln Ile Thr Ile Ala Ile Asn Val Leu His Glu His Gly 1445 1450 1455 Ile Val His Arg Asp Ile Lys Gly Ala Asn Ile Phe Leu Thr Ser 1460 1465 1470 Ser Gly Leu Ile Lys Leu Gly Asp Phe Gly Cys Ser Val Lys Leu 1475 1480 1485 Lys Asn Asn Ala Gln Thr Met Pro Gly Glu Val Asn Ser Thr Leu 1490 1495 1500 Gly Thr Ala Ala Tyr Met Ala Pro Glu Val Ile Thr Arg Ala Lys 1505 1510 1515 Gly Glu Gly His Gly Arg Ala Ala Asp Ile Trp Ser Leu Gly Cys 1520 1525 1530 Val Val Ile Glu Met Val Thr Gly Lys Arg Pro Trp His Glu Tyr 1535 1540 1545 Glu His Asn Phe Gln Ile Met Tyr Lys Val Gly Met Gly His Lys 1550 1555 1560 Pro Pro Ile Pro Glu Arg Leu Ser Pro Glu Gly Lys Asp Phe Leu 1565 1570 1575 Ser His Cys Leu Glu Ser Asp Pro Lys Met Arg Trp Thr Ala Ser 1580 1585 1590 Gln Leu Leu Asp His Ser Phe Val Lys Val Cys Thr Asp Glu Glu 1595 1600 1605 <210> SEQ ID NO 77 <211> LENGTH: 525 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 77 Met Arg Arg Arg Arg Arg Arg Asp Gly Phe Tyr Pro Ala Pro Asp Phe 1 5 10 15 Arg Asp Arg Glu Ala Glu Asp Met Ala Gly Val Phe Asp Ile Asp Leu 20 25 30 Asp Gln Pro Glu Asp Ala Gly Ser Glu Asp Glu Leu Glu Glu Gly Gly 35 40 45 Gln Leu Asn Glu Ser Met Asp His Gly Gly Val Gly Pro Tyr Glu Leu 50 55 60 Gly Met Glu His Cys Glu Lys Phe Glu Ile Ser Glu Thr Ser Val Asn 65 70 75 80 Arg Gly Pro Glu Lys Ile Arg Pro Glu Cys Phe Glu Leu Leu Arg Val 85 90 95 Leu Gly Lys Gly Gly Tyr Gly Lys Val Phe Gln Val Arg Lys Val Thr 100 105 110 Gly Ala Asn Thr Gly Lys Ile Phe Ala Met Lys Val Leu Lys Lys Ala 115 120 125 Met Ile Val Arg Asn Ala Lys Asp Thr Ala His Thr Lys Ala Glu Arg 130 135 140 Asn Ile Leu Glu Glu Val Lys His Pro Phe Ile Val Asp Leu Ile Tyr 145 150 155 160 Ala Phe Gln Thr Gly Gly Lys Leu Tyr Leu Ile Leu Glu Tyr Leu Ser 165 170 175 Gly Gly Glu Leu Phe Met Gln Leu Glu Arg Glu Gly Ile Phe Met Glu 180 185 190 Asp Thr Ala Cys Phe Tyr Leu Ala Glu Ile Ser Met Ala Leu Gly His 195 200 205 Leu His Gln Lys Gly Ile Ile Tyr Arg Asp Leu Lys Pro Glu Asn Ile 210 215 220 Met Leu Asn His Gln Gly His Val Lys Leu Thr Asp Phe Gly Leu Cys 225 230 235 240 Lys Glu Ser Ile His Asp Gly Thr Val Thr His Thr Phe Cys Gly Thr 245 250 255 Ile Glu Tyr Met Ala Pro Glu Ile Leu Met Arg Ser Gly His Asn Arg 260 265 270 Ala Val Asp Trp Trp Ser Leu Gly Ala Leu Met Tyr Asp Met Leu Thr 275 280 285 Gly Ala Pro Pro Phe Thr Gly Glu Asn Arg Lys Lys Thr Ile Asp Lys 290 295 300 Ile Leu Lys Cys Lys Leu Asn Leu Pro Pro Tyr Leu Thr Gln Glu Ala 305 310 315 320 Arg Asp Leu Leu Lys Lys Leu Leu Lys Arg Asn Ala Ala Ser Arg Leu 325 330 335 Gly Ala Gly Pro Gly Asp Ala Gly Glu Val Gln Ala His Pro Phe Phe 340 345 350 Arg His Ile Asn Trp Glu Glu Leu Leu Ala Arg Lys Val Glu Pro Pro 355 360 365 Phe Lys Pro Leu Leu Gln Ser Glu Glu Asp Val Ser Gln Phe Asp Ser 370 375 380 Lys Phe Thr Arg Gln Thr Pro Val Asp Ser Pro Asp Asp Ser Thr Leu 385 390 395 400 Ser Glu Ser Ala Asn Gln Val Phe Leu Gly Phe Thr Tyr Val Ala Pro 405 410 415 Ser Val Leu Glu Ser Val Lys Glu Lys Phe Ser Phe Glu Pro Lys Ile 420 425 430 Arg Ser Pro Arg Arg Phe Ile Gly Ser Pro Arg Thr Pro Val Ser Pro 435 440 445 Val Lys Phe Ser Pro Gly Asp Phe Trp Gly Arg Gly Ala Ser Ala Ser 450 455 460 Thr Ala Asn Pro Gln Thr Pro Val Glu Tyr Pro Met Glu Thr Ser Gly 465 470 475 480 Ile Glu Gln Met Asp Val Thr Met Ser Gly Glu Ala Ser Ala Pro Leu 485 490 495 Pro Ile Arg Gln Pro Asn Ser Gly Pro Tyr Lys Lys Gln Ala Phe Pro 500 505 510 Met Ile Ser Lys Arg Pro Glu His Leu Arg Met Asn Leu 515 520 525 <210> SEQ ID NO 78 <211> LENGTH: 724 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 78 Met Ser Ala Glu Gly Tyr Gln Tyr Arg Ala Leu Tyr Asp Tyr Lys Lys 1 5 10 15 Glu Arg Glu Glu Asp Ile Asp Leu His Leu Gly Asp Ile Leu Thr Val 20 25 30 Asn Lys Gly Ser Leu Val Ala Leu Gly Phe Ser Asp Gly Gln Glu Ala 35 40 45 Arg Pro Glu Glu Ile Gly Trp Leu Asn Gly Tyr Asn Glu Thr Thr Gly 50 55 60 Glu Arg Gly Asp Phe Pro Gly Thr Tyr Val Glu Tyr Ile Gly Arg Lys 65 70 75 80 Lys Ile Ser Pro Pro Thr Pro Lys Pro Arg Pro Pro Arg Pro Leu Pro 85 90 95 Val Ala Pro Gly Ser Ser Lys Thr Glu Ala Asp Val Glu Gln Gln Ala 100 105 110 Leu Thr Leu Pro Asp Leu Ala Glu Gln Phe Ala Pro Pro Asp Ile Ala 115 120 125 Pro Pro Leu Leu Ile Lys Leu Val Glu Ala Ile Glu Lys Lys Gly Leu 130 135 140 Glu Cys Ser Thr Leu Tyr Arg Thr Gln Ser Ser Ser Asn Leu Ala Glu 145 150 155 160 Leu Arg Gln Leu Leu Asp Cys Asp Thr Pro Ser Val Asp Leu Glu Met 165 170 175 Ile Asp Val His Val Leu Ala Asp Ala Phe Lys Arg Tyr Leu Leu Asp 180 185 190 Leu Pro Asn Pro Val Ile Pro Ala Ala Val Tyr Ser Glu Met Ile Ser 195 200 205 Leu Ala Pro Glu Val Gln Ser Ser Glu Glu Tyr Ile Gln Leu Leu Lys 210 215 220 Lys Leu Ile Arg Ser Pro Ser Ile Pro His Gln Tyr Trp Leu Thr Leu 225 230 235 240 Gln Tyr Leu Leu Lys His Phe Phe Lys Leu Ser Gln Thr Ser Ser Lys 245 250 255 Asn Leu Leu Asn Ala Arg Val Leu Ser Glu Ile Phe Ser Pro Met Leu 260 265 270 Phe Arg Phe Ser Ala Ala Ser Ser Asp Asn Thr Glu Asn Leu Ile Lys 275 280 285 Val Ile Glu Ile Leu Ile Ser Thr Glu Trp Asn Glu Arg Gln Pro Ala 290 295 300 Pro Ala Leu Pro Pro Lys Pro Pro Lys Pro Thr Thr Val Ala Asn Asn 305 310 315 320 Gly Met Asn Asn Asn Met Ser Leu Gln Asp Ala Glu Trp Tyr Trp Gly 325 330 335 Asp Ile Ser Arg Glu Glu Val Asn Glu Lys Leu Arg Asp Thr Ala Asp 340 345 350 Gly Thr Phe Leu Val Arg Asp Ala Ser Thr Lys Met His Gly Asp Tyr 355 360 365 Thr Leu Thr Leu Arg Lys Gly Gly Asn Asn Lys Leu Ile Lys Ile Phe 370 375 380 His Arg Asp Gly Lys Tyr Gly Phe Ser Asp Pro Leu Thr Phe Ser Ser 385 390 395 400 Val Val Glu Leu Ile Asn His Tyr Arg Asn Glu Ser Leu Ala Gln Tyr 405 410 415 Asn Pro Lys Leu Asp Val Lys Leu Leu Tyr Pro Val Ser Lys Tyr Gln 420 425 430 Gln Asp Gln Val Val Lys Glu Asp Asn Ile Glu Ala Val Gly Lys Lys 435 440 445 Leu His Glu Tyr Asn Thr Gln Phe Gln Glu Lys Ser Arg Glu Tyr Asp 450 455 460 Arg Leu Tyr Glu Glu Tyr Thr Arg Thr Ser Gln Glu Ile Gln Met Lys 465 470 475 480 Arg Thr Ala Ile Glu Ala Phe Asn Glu Thr Ile Lys Ile Phe Glu Glu 485 490 495 Gln Cys Gln Thr Gln Glu Arg Tyr Ser Lys Glu Tyr Ile Glu Lys Phe 500 505 510 Lys Arg Glu Gly Asn Glu Lys Glu Ile Gln Arg Ile Met His Asn Tyr 515 520 525 Asp Lys Leu Lys Ser Arg Ile Ser Glu Ile Ile Asp Ser Arg Arg Arg 530 535 540 Leu Glu Glu Asp Leu Lys Lys Gln Ala Ala Glu Tyr Arg Glu Ile Asp 545 550 555 560 Lys Arg Met Asn Ser Ile Lys Pro Asp Leu Ile Gln Leu Arg Lys Thr 565 570 575 Arg Asp Gln Tyr Leu Met Trp Leu Thr Gln Lys Gly Val Arg Gln Lys 580 585 590 Lys Leu Asn Glu Trp Leu Gly Asn Glu Asn Thr Glu Asp Gln Tyr Ser 595 600 605 Leu Val Glu Asp Asp Glu Asp Leu Pro His His Asp Glu Lys Thr Trp 610 615 620 Asn Val Gly Ser Ser Asn Arg Asn Lys Ala Glu Asn Leu Leu Arg Gly 625 630 635 640 Lys Arg Asp Gly Thr Phe Leu Val Arg Glu Ser Ser Lys Gln Gly Cys 645 650 655 Tyr Ala Cys Ser Val Val Val Asp Gly Glu Val Lys His Cys Val Ile 660 665 670 Asn Lys Thr Ala Thr Gly Tyr Gly Phe Ala Glu Pro Tyr Asn Leu Tyr 675 680 685 Ser Ser Leu Lys Glu Leu Val Leu His Tyr Gln His Thr Ser Leu Val 690 695 700 Gln His Asn Asp Ser Leu Asn Val Thr Leu Ala Tyr Pro Val Tyr Ala 705 710 715 720 Gln Gln Arg Arg <210> SEQ ID NO 79 <211> LENGTH: 2098 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 79 Met Ala Thr Asp Asp Lys Thr Ser Pro Thr Leu Asp Ser Ala Asn Asp 1 5 10 15 Leu Pro Arg Ser Pro Thr Ser Pro Ser His Leu Thr His Phe Lys Pro 20 25 30 Leu Thr Pro Asp Gln Asp Glu Pro Pro Phe Lys Ser Ala Tyr Ser Ser 35 40 45 Phe Val Asn Leu Phe Arg Phe Asn Lys Glu Arg Ala Glu Gly Gly Gln 50 55 60 Gly Glu Gln Gln Pro Leu Ser Gly Ser Trp Thr Ser Pro Gln Leu Pro 65 70 75 80 Ser Arg Thr Gln Ser Val Arg Ser Pro Thr Pro Tyr Lys Lys Gln Leu 85 90 95 Asn Glu Glu Leu Gln Arg Arg Ser Ser Ala Leu Asp Thr Arg Arg Lys 100 105 110 Ala Glu Pro Thr Phe Gly Gly His Asp Pro Arg Thr Ala Val Gln Leu 115 120 125 Arg Ser Leu Ser Thr Val Leu Lys Arg Leu Lys Glu Ile Met Glu Gly 130 135 140 Lys Ser Gln Asp Ser Asp Leu Lys Gln Tyr Trp Met Pro Asp Ser Gln 145 150 155 160 Cys Lys Glu Cys Tyr Asp Cys Ser Glu Lys Phe Thr Thr Phe Arg Arg 165 170 175 Arg His His Cys Arg Leu Cys Gly Gln Ile Phe Cys Ser Arg Cys Cys 180 185 190 Asn Gln Glu Ile Pro Gly Lys Phe Met Gly Tyr Thr Gly Asp Leu Arg 195 200 205 Ala Cys Thr Tyr Cys Arg Lys Ile Ala Leu Ser Tyr Ala His Ser Thr 210 215 220 Asp Ser Asn Ser Ile Gly Glu Asp Leu Asn Ala Leu Ser Asp Ser Ala 225 230 235 240 Cys Ser Val Ser Val Leu Asp Pro Ser Glu Pro Arg Thr Pro Val Gly 245 250 255 Ser Arg Lys Ala Ser Arg Asn Ile Phe Leu Glu Asp Asp Leu Ala Trp 260 265 270 Gln Ser Leu Ile His Pro Asp Ser Ser Asn Thr Pro Leu Ser Thr Arg 275 280 285 Leu Val Ser Val Gln Glu Asp Ala Gly Lys Ser Pro Ala Arg Asn Arg 290 295 300 Ser Ala Ser Ile Thr Asn Leu Ser Leu Asp Arg Ser Gly Ser Pro Met 305 310 315 320 Val Pro Ser Tyr Glu Thr Ser Val Ser Pro Gln Ala Asn Arg Thr Tyr 325 330 335 Val Arg Thr Glu Thr Thr Glu Asp Glu Arg Lys Ile Leu Leu Asp Ser 340 345 350 Val Gln Leu Lys Asp Leu Trp Lys Lys Ile Cys His His Ser Ser Gly 355 360 365 Met Glu Phe Gln Asp His Arg Tyr Trp Leu Arg Thr His Pro Asn Cys 370 375 380 Ile Val Gly Lys Glu Leu Val Asn Trp Leu Ile Arg Asn Gly His Ile 385 390 395 400 Ala Thr Arg Ala Gln Ala Ile Ala Ile Gly Gln Ala Met Val Asp Gly 405 410 415 Arg Trp Leu Asp Cys Val Ser His His Asp Gln Leu Phe Arg Asp Glu 420 425 430 Tyr Ala Leu Tyr Arg Pro Leu Gln Ser Thr Glu Phe Ser Glu Thr Pro 435 440 445 Ser Pro Asp Ser Asp Ser Val Asn Ser Val Glu Gly His Ser Glu Pro 450 455 460 Ser Trp Phe Lys Asp Ile Lys Phe Asp Asp Ser Asp Thr Glu Gln Ile 465 470 475 480 Ala Glu Glu Gly Asp Asp Asn Leu Ala Asn Ser Ala Ser Pro Ser Lys 485 490 495 Arg Thr Ser Val Ser Ser Phe Gln Ser Thr Val Asp Ser Asp Ser Ala 500 505 510 Ala Ser Ile Ser Leu Asn Val Glu Leu Asp Asn Val Asn Phe His Ile 515 520 525 Lys Lys Pro Ser Lys Tyr Pro His Val Pro Pro His Pro Ala Asp Gln 530 535 540 Lys Glu Tyr Leu Ile Ser Asp Thr Gly Gly Gln Gln Leu Ser Ile Ser 545 550 555 560 Asp Ala Phe Ile Lys Glu Ser Leu Phe Asn Arg Arg Val Glu Glu Lys 565 570 575 Ser Lys Glu Leu Pro Phe Thr Pro Leu Gly Trp His His Asn Asn Leu 580 585 590 Glu Leu Leu Arg Glu Glu Asn Gly Glu Lys Gln Ala Met Glu Arg Leu 595 600 605 Leu Ser Ala Asn His Asn His Met Met Ala Leu Leu Gln Gln Leu Leu 610 615 620 His Ser Asp Ser Leu Ser Ser Ser Trp Arg Asp Ile Ile Val Ser Leu 625 630 635 640 Val Cys Gln Val Val Gln Thr Val Arg Pro Asp Val Lys Asn Gln Asp 645 650 655 Asp Asp Met Asp Ile Arg Gln Phe Val His Ile Lys Lys Ile Pro Gly 660 665 670 Gly Lys Lys Phe Asp Ser Val Val Val Asn Gly Phe Val Cys Thr Lys 675 680 685 Asn Ile Ala His Lys Lys Met Asn Ser Cys Ile Lys Asn Pro Lys Ile 690 695 700 Leu Leu Leu Lys Cys Ser Ile Glu Tyr Leu Tyr Arg Glu Glu Thr Lys 705 710 715 720 Phe Thr Cys Ile Asp Pro Ile Val Leu Gln Glu Arg Glu Phe Leu Lys 725 730 735 Asn Tyr Val Gln Arg Ile Val Asp Val Arg Pro Thr Leu Val Leu Val 740 745 750 Glu Lys Thr Val Ser Arg Ile Ala Gln Asp Met Leu Leu Glu His Gly 755 760 765 Ile Thr Leu Val Ile Asn Val Lys Ser Gln Val Leu Glu Arg Ile Ser 770 775 780 Arg Met Thr Gln Gly Asp Leu Val Met Ser Met Asp Gln Leu Leu Thr 785 790 795 800 Lys Pro His Leu Gly Thr Cys His Lys Phe Tyr Met Gln Ile Phe Gln 805 810 815 Leu Pro Asn Glu Gln Thr Lys Thr Leu Met Phe Phe Glu Gly Cys Pro 820 825 830 Gln His Leu Gly Cys Thr Ile Lys Leu Arg Gly Gly Ser Asp Tyr Glu 835 840 845 Leu Ala Arg Val Lys Glu Ile Leu Ile Phe Met Ile Cys Val Ala Tyr 850 855 860 His Ser Gln Leu Glu Ile Ser Phe Leu Met Asp Glu Phe Ala Met Pro 865 870 875 880 Pro Thr Leu Met Gln Asn Pro Ser Phe His Ser Leu Ile Glu Gly Arg 885 890 895 Gly His Glu Gly Ala Val Gln Glu Gln Tyr Gly Gly Gly Ser Ile Pro 900 905 910 Trp Asp Pro Asp Ile Pro Pro Glu Ser Leu Pro Cys Asp Asp Ser Ser 915 920 925 Leu Leu Glu Ser Arg Ile Val Phe Glu Lys Gly Glu Gln Glu Asn Lys 930 935 940 Asn Leu Pro Gln Ala Val Ala Ser Val Lys His Gln Glu His Ser Thr 945 950 955 960 Thr Ala Cys Pro Ala Gly Leu Pro Cys Ala Phe Phe Ala Pro Val Pro 965 970 975 Glu Ser Leu Leu Pro Leu Pro Val Asp Asp Gln Gln Asp Ala Leu Gly 980 985 990 Ser Glu Leu Pro Glu Ser Leu Gln Gln Thr Val Val Leu Gln Asp Pro 995 1000 1005 Lys Ser Gln Ile Arg Ala Phe Arg Asp Pro Leu Gln Asp Asp Thr 1010 1015 1020 Gly Leu Tyr Val Thr Glu Glu Val Thr Ser Ser Glu Asp Lys Arg 1025 1030 1035 Lys Thr Tyr Ser Leu Ala Phe Lys Gln Glu Leu Lys Asp Val Ile 1040 1045 1050 Leu Cys Ile Ser Pro Val Ile Thr Phe Arg Glu Pro Phe Leu Leu 1055 1060 1065 Thr Glu Lys Gly Met Arg Cys Ser Thr Arg Asp Tyr Phe Ala Glu 1070 1075 1080 Gln Val Tyr Trp Ser Pro Leu Leu Asn Lys Glu Phe Lys Glu Met 1085 1090 1095 Glu Asn Arg Arg Lys Lys Gln Leu Leu Arg Asp Leu Ser Gly Leu 1100 1105 1110 Gln Gly Met Asn Gly Ser Ile Gln Ala Lys Ser Ile Gln Val Leu 1115 1120 1125 Pro Ser His Glu Leu Val Ser Thr Arg Ile Ala Glu His Leu Gly 1130 1135 1140 Asp Ser Gln Ser Leu Gly Arg Met Leu Ala Asp Tyr Arg Ala Arg 1145 1150 1155 Gly Gly Arg Ile Gln Pro Lys Asn Ser Asp Pro Phe Ala His Ser 1160 1165 1170 Lys Asp Ala Ser Ser Thr Ser Ser Gly Lys Ser Gly Ser Lys Asn 1175 1180 1185 Glu Gly Asp Glu Glu Arg Gly Leu Ile Leu Ser Asp Ala Val Trp 1190 1195 1200 Ser Thr Lys Val Asp Cys Leu Asn Pro Ile Asn His Gln Arg Leu 1205 1210 1215 Cys Val Leu Phe Ser Ser Ser Ser Ala Gln Ser Ser Asn Ala Pro 1220 1225 1230 Ser Ala Cys Val Ser Pro Trp Ile Val Thr Met Glu Phe Tyr Gly 1235 1240 1245 Lys Asn Asp Leu Thr Leu Gly Ile Phe Leu Glu Arg Tyr Cys Phe 1250 1255 1260 Arg Pro Ser Tyr Gln Cys Pro Ser Met Phe Cys Asp Thr Pro Met 1265 1270 1275 Val His His Ile Arg Arg Phe Val His Gly Gln Gly Cys Val Gln 1280 1285 1290 Ile Ile Leu Lys Glu Leu Asp Ser Pro Val Pro Gly Tyr Gln His 1295 1300 1305 Thr Ile Leu Thr Tyr Ser Trp Cys Arg Ile Cys Lys Gln Val Thr 1310 1315 1320 Pro Val Val Ala Leu Ser Asn Glu Ser Trp Ser Met Ser Phe Ala 1325 1330 1335 Lys Tyr Leu Glu Leu Arg Phe Tyr Gly His Gln Tyr Thr Arg Arg 1340 1345 1350 Ala Asn Ala Glu Pro Cys Gly His Ser Ile His His Asp Tyr His 1355 1360 1365 Gln Tyr Phe Ser Tyr Asn Gln Met Val Ala Ser Phe Ser Tyr Ser 1370 1375 1380 Pro Ile Arg Leu Leu Glu Val Cys Val Pro Leu Pro Lys Ile Phe 1385 1390 1395 Ile Lys Arg Gln Ala Pro Leu Lys Val Ser Leu Leu Gln Asp Leu 1400 1405 1410 Lys Asp Phe Phe Gln Lys Val Ser Gln Val Tyr Val Ala Ile Asp 1415 1420 1425 Glu Arg Leu Ala Ser Leu Lys Thr Asp Thr Phe Ser Lys Thr Arg 1430 1435 1440 Glu Glu Lys Met Glu Asp Ile Phe Ala Gln Lys Glu Met Glu Glu 1445 1450 1455 Gly Glu Phe Lys Asn Trp Ile Glu Lys Met Gln Ala Arg Leu Met 1460 1465 1470 Ser Ser Ser Val Asp Thr Pro Gln Gln Leu Gln Ser Val Phe Glu 1475 1480 1485 Ser Leu Ile Ala Lys Lys Gln Ser Leu Cys Glu Val Leu Gln Ala 1490 1495 1500 Trp Asn Asn Arg Leu Gln Asp Leu Phe Gln Gln Glu Lys Gly Arg 1505 1510 1515 Lys Arg Pro Ser Val Pro Pro Ser Pro Gly Arg Leu Arg Gln Gly 1520 1525 1530 Glu Glu Ser Lys Ile Ser Ala Met Asp Ala Ser Pro Arg Asn Ile 1535 1540 1545 Ser Pro Gly Leu Gln Asn Gly Glu Lys Glu Asp Arg Phe Leu Thr 1550 1555 1560 Thr Leu Ser Ser Gln Ser Ser Thr Ser Ser Thr His Leu Gln Leu 1565 1570 1575 Pro Thr Pro Pro Glu Val Met Ser Glu Gln Ser Val Gly Gly Pro 1580 1585 1590 Pro Glu Leu Asp Thr Ala Ser Ser Ser Glu Asp Val Phe Asp Gly 1595 1600 1605 His Leu Leu Gly Ser Thr Asp Ser Gln Val Lys Glu Lys Ser Thr 1610 1615 1620 Met Lys Ala Ile Phe Ala Asn Leu Leu Pro Gly Asn Ser Tyr Asn 1625 1630 1635 Pro Ile Pro Phe Pro Phe Asp Pro Asp Lys His Tyr Leu Met Tyr 1640 1645 1650 Glu His Glu Arg Val Pro Ile Ala Val Cys Glu Lys Glu Pro Ser 1655 1660 1665 Ser Ile Ile Ala Phe Ala Leu Ser Cys Lys Glu Tyr Arg Asn Ala 1670 1675 1680 Leu Glu Glu Leu Ser Lys Ala Thr Gln Trp Asn Ser Ala Glu Glu 1685 1690 1695 Gly Leu Pro Thr Asn Ser Thr Ser Asp Ser Arg Pro Lys Ser Ser 1700 1705 1710 Ser Pro Ile Arg Leu Pro Glu Met Ser Gly Gly Gln Thr Asn Arg 1715 1720 1725 Thr Thr Glu Thr Glu Pro Gln Pro Thr Lys Lys Ala Ser Gly Met 1730 1735 1740 Leu Ser Phe Phe Arg Gly Thr Ala Gly Lys Ser Pro Asp Leu Ser 1745 1750 1755 Ser Gln Lys Arg Glu Thr Leu Arg Gly Ala Asp Ser Ala Tyr Tyr 1760 1765 1770 Gln Val Gly Gln Thr Gly Lys Glu Gly Thr Glu Asn Gln Gly Val 1775 1780 1785 Glu Pro Gln Asp Glu Val Asp Gly Gly Asp Thr Gln Lys Lys Gln 1790 1795 1800 Leu Ile Asn Pro His Val Glu Leu Gln Phe Ser Asp Ala Asn Ala 1805 1810 1815 Lys Phe Tyr Cys Arg Leu Tyr Tyr Ala Gly Glu Phe His Lys Met 1820 1825 1830 Arg Glu Val Ile Leu Asp Ser Ser Glu Glu Asp Phe Ile Arg Ser 1835 1840 1845 Leu Ser His Ser Ser Pro Trp Gln Ala Arg Gly Gly Lys Ser Gly 1850 1855 1860 Ala Ala Phe Tyr Ala Thr Glu Asp Asp Arg Phe Ile Leu Lys Gln 1865 1870 1875 Met Pro Arg Leu Glu Val Gln Ser Phe Leu Asp Phe Ala Pro His 1880 1885 1890 Tyr Phe Asn Tyr Ile Thr Asn Ala Val Gln Gln Lys Arg Pro Thr 1895 1900 1905 Ala Leu Ala Lys Ile Leu Gly Val Tyr Arg Ile Gly Tyr Lys Asn 1910 1915 1920 Ser Gln Asn Asn Thr Glu Lys Lys Leu Asp Leu Leu Val Met Glu 1925 1930 1935 Asn Leu Phe Tyr Gly Arg Lys Met Ala Gln Val Phe Asp Leu Lys 1940 1945 1950 Gly Ser Leu Arg Asn Arg Asn Val Lys Thr Asp Thr Gly Lys Glu 1955 1960 1965 Ser Cys Asp Val Val Leu Leu Asp Glu Asn Leu Leu Lys Met Val 1970 1975 1980 Arg Asp Asn Pro Leu Tyr Ile Arg Ser His Ser Lys Ala Val Leu 1985 1990 1995 Arg Thr Ser Ile His Ser Asp Ser His Phe Leu Ser Ser His Leu 2000 2005 2010 Ile Ile Asp Tyr Ser Leu Leu Val Gly Arg Asp Asp Thr Ser Asn 2015 2020 2025 Glu Leu Val Val Gly Ile Ile Asp Tyr Ile Arg Thr Phe Thr Trp 2030 2035 2040 Asp Lys Lys Leu Glu Met Val Val Lys Ser Thr Gly Ile Leu Gly 2045 2050 2055 Gly Gln Gly Lys Met Pro Thr Val Val Ser Pro Glu Leu Tyr Arg 2060 2065 2070 Thr Arg Phe Cys Glu Ala Met Asp Lys Tyr Phe Leu Met Val Pro 2075 2080 2085 Asp His Trp Thr Gly Leu Gly Leu Asn Cys 2090 2095 <210> SEQ ID NO 80 <211> LENGTH: 1074 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 80 Met Ser Leu Lys Asn Glu Pro Arg Val Asn Thr Ser Ala Leu Gln Lys 1 5 10 15 Ile Ala Ala Asp Met Ser Asn Ile Ile Glu Asn Leu Asp Thr Arg Glu 20 25 30 Leu His Phe Glu Gly Glu Glu Val Asp Tyr Asp Val Ser Pro Ser Asp 35 40 45 Pro Lys Ile Gln Glu Val Tyr Ile Pro Phe Ser Ala Ile Tyr Asn Thr 50 55 60 Gln Gly Phe Lys Glu Pro Asn Ile Gln Thr Tyr Leu Ser Gly Cys Pro 65 70 75 80 Ile Lys Ala Gln Val Leu Glu Val Glu Arg Phe Thr Ser Thr Thr Arg 85 90 95 Val Pro Ser Ile Asn Leu Tyr Thr Ile Glu Leu Thr His Gly Glu Phe 100 105 110 Lys Trp Gln Val Lys Arg Lys Phe Lys His Phe Gln Glu Phe His Arg 115 120 125 Glu Leu Leu Lys Tyr Lys Ala Phe Ile Arg Ile Pro Ile Pro Thr Arg 130 135 140 Arg His Thr Phe Arg Arg Gln Asn Val Arg Glu Glu Pro Arg Glu Met 145 150 155 160 Pro Ser Leu Pro Arg Ser Ser Glu Asn Met Ile Arg Glu Glu Gln Phe 165 170 175 Leu Gly Arg Arg Lys Gln Leu Glu Asp Tyr Leu Thr Lys Ile Leu Lys 180 185 190 Met Pro Met Tyr Arg Asn Tyr His Ala Thr Thr Glu Phe Leu Asp Ile 195 200 205 Ser Gln Leu Ser Phe Ile His Asp Leu Gly Pro Lys Gly Ile Glu Gly 210 215 220 Met Ile Met Lys Arg Ser Gly Gly His Arg Ile Pro Gly Leu Asn Cys 225 230 235 240 Cys Gly Gln Gly Arg Ala Cys Tyr Arg Trp Ser Lys Arg Trp Leu Ile 245 250 255 Val Lys Asp Ser Phe Leu Leu Tyr Met Lys Pro Asp Ser Gly Ala Ile 260 265 270 Ala Phe Val Leu Leu Val Asp Lys Glu Phe Lys Ile Lys Val Gly Lys 275 280 285 Lys Glu Thr Glu Thr Lys Tyr Gly Ile Arg Ile Asp Asn Leu Ser Arg 290 295 300 Thr Leu Ile Leu Lys Cys Asn Ser Tyr Arg His Ala Arg Trp Trp Gly 305 310 315 320 Gly Ala Ile Glu Glu Phe Ile Gln Lys His Gly Thr Asn Phe Leu Lys 325 330 335 Asp His Arg Phe Gly Ser Tyr Ala Ala Ile Gln Glu Asn Ala Leu Ala 340 345 350 Lys Trp Tyr Val Asn Ala Lys Gly Tyr Phe Glu Asp Val Ala Asn Ala 355 360 365 Met Glu Glu Ala Asn Glu Glu Ile Phe Ile Thr Asp Trp Trp Leu Ser 370 375 380 Pro Glu Ile Phe Leu Lys Arg Pro Val Val Glu Gly Asn Arg Trp Arg 385 390 395 400 Leu Asp Cys Ile Leu Lys Arg Lys Ala Gln Gln Gly Val Arg Ile Phe 405 410 415 Ile Met Leu Tyr Lys Glu Val Glu Leu Ala Leu Gly Ile Asn Ser Glu 420 425 430 Tyr Thr Lys Arg Thr Leu Met Arg Leu His Pro Asn Ile Lys Val Met 435 440 445 Arg His Pro Asp His Val Ser Ser Thr Val Tyr Leu Trp Ala His His 450 455 460 Glu Lys Leu Val Ile Ile Asp Gln Ser Val Ala Phe Val Gly Gly Ile 465 470 475 480 Asp Leu Ala Tyr Gly Arg Trp Asp Asp Asn Glu His Arg Leu Thr Asp 485 490 495 Val Gly Ser Val Lys Arg Val Thr Ser Gly Pro Ser Leu Gly Ser Leu 500 505 510 Pro Pro Ala Ala Met Glu Ser Met Glu Ser Leu Arg Leu Lys Asp Lys 515 520 525 Asn Glu Pro Val Gln Asn Leu Pro Ile Gln Lys Ser Ile Asp Asp Val 530 535 540 Asp Ser Lys Leu Lys Gly Ile Gly Lys Pro Arg Lys Phe Ser Lys Phe 545 550 555 560 Ser Leu Tyr Lys Gln Leu His Arg His His Leu His Asp Ala Asp Ser 565 570 575 Ile Ser Ser Ile Asp Ser Thr Ser Ser Tyr Phe Asn His Tyr Arg Ser 580 585 590 His His Asn Leu Ile His Gly Leu Lys Pro His Phe Lys Leu Phe His 595 600 605 Pro Ser Ser Glu Ser Glu Gln Gly Leu Thr Arg Pro His Ala Asp Thr 610 615 620 Gly Ser Ile Arg Ser Leu Gln Thr Gly Val Gly Glu Leu His Gly Glu 625 630 635 640 Thr Arg Phe Trp His Gly Lys Asp Tyr Cys Asn Phe Val Phe Lys Asp 645 650 655 Trp Val Gln Leu Asp Lys Pro Phe Ala Asp Phe Ile Asp Arg Tyr Ser 660 665 670 Thr Pro Arg Met Pro Trp His Asp Ile Ala Ser Ala Val His Gly Lys 675 680 685 Ala Ala Arg Asp Val Ala Arg His Phe Ile Gln Arg Trp Asn Phe Thr 690 695 700 Lys Ile Met Lys Ser Lys Tyr Arg Ser Leu Ser Tyr Pro Phe Leu Leu 705 710 715 720 Pro Lys Ser Gln Thr Thr Ala His Glu Leu Arg Tyr Gln Val Pro Gly 725 730 735 Ser Val His Ala Asn Val Gln Leu Leu Arg Ser Ala Ala Asp Trp Ser 740 745 750 Ala Gly Ile Lys Tyr His Glu Glu Ser Ile His Ala Ala Tyr Val His 755 760 765 Val Ile Glu Asn Ser Arg His Tyr Ile Tyr Ile Glu Asn Gln Phe Phe 770 775 780 Ile Ser Cys Ala Asp Asp Lys Val Val Phe Asn Lys Ile Gly Asp Ala 785 790 795 800 Ile Ala Gln Arg Ile Leu Lys Ala His Arg Glu Asn Gln Lys Tyr Arg 805 810 815 Val Tyr Val Val Ile Pro Leu Leu Pro Gly Phe Glu Gly Asp Ile Ser 820 825 830 Thr Gly Gly Gly Asn Ala Leu Gln Ala Ile Met His Phe Asn Tyr Arg 835 840 845 Thr Met Cys Arg Gly Glu Asn Ser Ile Leu Gly Gln Leu Lys Ala Glu 850 855 860 Leu Gly Asn Gln Trp Ile Asn Tyr Ile Ser Phe Cys Gly Leu Arg Thr 865 870 875 880 His Ala Glu Leu Glu Gly Asn Leu Val Thr Glu Leu Ile Tyr Val His 885 890 895 Ser Lys Leu Leu Ile Ala Asp Asp Asn Thr Val Ile Ile Gly Ser Ala 900 905 910 Asn Ile Asn Asp Arg Ser Met Leu Gly Lys Arg Asp Ser Glu Met Ala 915 920 925 Val Ile Val Gln Asp Thr Glu Thr Val Pro Ser Val Met Asp Gly Lys 930 935 940 Glu Tyr Gln Ala Gly Arg Phe Ala Arg Gly Leu Arg Leu Gln Cys Phe 945 950 955 960 Arg Val Val Leu Gly Tyr Leu Asp Asp Pro Ser Glu Asp Ile Gln Asp 965 970 975 Pro Val Ser Asp Lys Phe Phe Lys Glu Val Trp Val Ser Thr Ala Ala 980 985 990 Arg Asn Ala Thr Ile Tyr Asp Lys Val Phe Arg Cys Leu Pro Asn Asp 995 1000 1005 Glu Val His Asn Leu Ile Gln Leu Arg Asp Phe Ile Asn Lys Pro 1010 1015 1020 Val Leu Ala Lys Glu Asp Pro Ile Arg Ala Glu Glu Glu Leu Lys 1025 1030 1035 Lys Ile Arg Gly Phe Leu Val Gln Phe Pro Phe Tyr Phe Leu Ser 1040 1045 1050 Glu Glu Ser Leu Leu Pro Ser Val Gly Thr Lys Glu Ala Ile Val 1055 1060 1065 Pro Met Glu Val Trp Thr 1070 <210> SEQ ID NO 81 <211> LENGTH: 845 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 81 Met Glu Leu Trp Arg Gln Cys Thr His Trp Leu Ile Gln Cys Arg Val 1 5 10 15 Leu Pro Pro Ser His Arg Val Thr Trp Asp Gly Ala Gln Val Cys Glu 20 25 30 Leu Ala Gln Ala Leu Arg Asp Gly Val Leu Leu Cys Gln Leu Leu Asn 35 40 45 Asn Leu Leu Pro His Ala Ile Asn Leu Arg Glu Val Asn Leu Arg Pro 50 55 60 Gln Met Ser Gln Phe Leu Cys Leu Lys Asn Ile Arg Thr Phe Leu Ser 65 70 75 80 Thr Cys Cys Glu Lys Phe Gly Leu Lys Arg Ser Glu Leu Phe Glu Ala 85 90 95 Phe Asp Leu Phe Asp Val Gln Asp Phe Gly Lys Val Ile Tyr Thr Leu 100 105 110 Ser Ala Leu Ser Trp Thr Pro Ile Ala Gln Asn Arg Gly Ile Met Pro 115 120 125 Phe Pro Thr Glu Glu Glu Ser Val Gly Asp Glu Asp Ile Tyr Ser Gly 130 135 140 Leu Ser Asp Gln Ile Asp Asp Thr Val Glu Glu Asp Glu Asp Leu Tyr 145 150 155 160 Asp Cys Val Glu Asn Glu Glu Ala Glu Gly Asp Glu Ile Tyr Glu Asp 165 170 175 Leu Met Arg Ser Glu Pro Val Ser Met Pro Pro Lys Met Thr Glu Tyr 180 185 190 Asp Lys Arg Cys Cys Cys Leu Arg Glu Ile Gln Gln Thr Glu Glu Lys 195 200 205 Tyr Thr Asp Thr Leu Gly Ser Ile Gln Gln His Phe Leu Lys Pro Leu 210 215 220 Gln Arg Phe Leu Lys Pro Gln Asp Ile Glu Ile Ile Phe Ile Asn Ile 225 230 235 240 Glu Asp Leu Leu Arg Val His Thr His Phe Leu Lys Glu Met Lys Glu 245 250 255 Ala Leu Gly Thr Pro Gly Ala Ala Asn Leu Tyr Gln Val Phe Ile Lys 260 265 270 Tyr Lys Glu Arg Phe Leu Val Tyr Gly Arg Tyr Cys Ser Gln Val Glu 275 280 285 Ser Ala Ser Lys His Leu Asp Arg Val Ala Ala Ala Arg Glu Asp Val 290 295 300 Gln Met Lys Leu Glu Glu Cys Ser Gln Arg Ala Asn Asn Gly Arg Phe 305 310 315 320 Thr Leu Arg Asp Leu Leu Met Val Pro Met Gln Arg Val Leu Lys Tyr 325 330 335 His Leu Leu Leu Gln Glu Leu Val Lys His Thr Gln Glu Ala Met Glu 340 345 350 Lys Glu Asn Leu Arg Leu Ala Leu Asp Ala Met Arg Asp Leu Ala Gln 355 360 365 Cys Val Asn Glu Val Lys Arg Asp Asn Glu Thr Leu Arg Gln Ile Thr 370 375 380 Asn Phe Gln Leu Ser Ile Glu Asn Leu Asp Gln Ser Leu Ala His Tyr 385 390 395 400 Gly Arg Pro Lys Ile Asp Gly Glu Leu Lys Ile Thr Ser Val Glu Arg 405 410 415 Arg Ser Lys Met Asp Arg Tyr Ala Phe Leu Leu Asp Lys Ala Leu Leu 420 425 430 Ile Cys Lys Arg Arg Gly Asp Ser Tyr Asp Leu Lys Asp Phe Val Asn 435 440 445 Leu His Ser Phe Gln Val Arg Asp Asp Ser Ser Gly Asp Arg Asp Asn 450 455 460 Lys Lys Trp Ser His Met Phe Leu Leu Ile Glu Asp Gln Gly Ala Gln 465 470 475 480 Gly Tyr Glu Leu Phe Phe Lys Thr Arg Glu Leu Lys Lys Lys Trp Met 485 490 495 Glu Gln Phe Glu Met Ala Ile Ser Asn Ile Tyr Pro Glu Asn Ala Thr 500 505 510 Ala Asn Gly His Asp Phe Gln Met Phe Ser Phe Glu Glu Thr Thr Ser 515 520 525 Cys Lys Ala Cys Gln Met Leu Leu Arg Gly Thr Phe Tyr Gln Gly Tyr 530 535 540 Arg Cys His Arg Cys Arg Ala Ser Ala His Lys Glu Cys Leu Gly Arg 545 550 555 560 Val Pro Pro Cys Gly Arg His Gly Gln Asp Phe Pro Gly Thr Met Lys 565 570 575 Lys Asp Lys Leu His Arg Arg Ala Gln Asp Lys Lys Arg Asn Glu Leu 580 585 590 Gly Leu Pro Lys Met Glu Val Phe Gln Glu Tyr Tyr Gly Leu Pro Pro 595 600 605 Pro Pro Gly Ala Ile Gly Pro Phe Leu Arg Leu Asn Pro Gly Asp Ile 610 615 620 Val Glu Leu Thr Lys Ala Glu Ala Glu Gln Asn Trp Trp Glu Gly Arg 625 630 635 640 Asn Thr Ser Thr Asn Glu Ile Gly Trp Phe Pro Cys Asn Arg Val Lys 645 650 655 Pro Tyr Val His Gly Pro Pro Gln Asp Leu Ser Val His Leu Trp Tyr 660 665 670 Ala Gly Pro Met Glu Arg Ala Gly Ala Glu Ser Ile Leu Ala Asn Arg 675 680 685 Ser Asp Gly Thr Phe Leu Val Arg Gln Arg Val Lys Asp Ala Ala Glu 690 695 700 Phe Ala Ile Ser Ile Lys Tyr Asn Val Glu Val Lys His Ile Lys Ile 705 710 715 720 Met Thr Ala Glu Gly Leu Tyr Arg Ile Thr Glu Lys Lys Ala Phe Arg 725 730 735 Gly Leu Thr Glu Leu Val Glu Phe Tyr Gln Gln Asn Ser Leu Lys Asp 740 745 750 Cys Phe Lys Ser Leu Asp Thr Thr Leu Gln Phe Pro Phe Lys Glu Pro 755 760 765 Glu Lys Arg Thr Ile Ser Arg Pro Ala Val Gly Ser Thr Lys Tyr Phe 770 775 780 Gly Thr Ala Lys Ala Arg Tyr Asp Phe Cys Ala Arg Asp Arg Ser Glu 785 790 795 800 Leu Ser Leu Lys Glu Gly Asp Ile Ile Lys Ile Leu Asn Lys Lys Gly 805 810 815 Gln Gln Gly Trp Trp Arg Gly Glu Ile Tyr Gly Arg Val Gly Trp Phe 820 825 830 Pro Ala Asn Tyr Val Glu Glu Asp Tyr Ser Glu Tyr Cys 835 840 845 <210> SEQ ID NO 82 <211> LENGTH: 93 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 82 Gly Ser Gly Ser Ala Ser Pro Arg Lys Ser Thr Val Ile Ser Ser Pro 1 5 10 15 Phe Asp Pro Lys His Val Thr His Val Gly Phe Asn Tyr Asp Thr Gly 20 25 30 Glu Phe Thr Gly Met Pro Thr Glu Trp Gln Ala Leu Leu Lys Val Ser 35 40 45 Gly Ile Thr Lys Ser Glu Gln Val Gln His Pro Gln Ala Val Leu Asp 50 55 60 Ala Met Ala Phe Tyr Ser Gln Ser Lys Lys Tyr Leu Glu Glu Gly Ala 65 70 75 80 Lys Pro Pro Phe Pro Arg Glu Ser Thr Glu Lys Pro Leu 85 90 <210> SEQ ID NO 83 <211> LENGTH: 609 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 83 Met Glu Gly Pro Ser Leu Arg Gly Pro Ala Leu Arg Leu Ala Gly Leu 1 5 10 15 Pro Thr Gln Gln Asp Cys Asn Ile Gln Glu Lys Ile Asp Leu Glu Ile 20 25 30 Arg Met Arg Glu Gly Ile Trp Lys Leu Leu Ser Leu Ser Thr Gln Lys 35 40 45 Asp Gln Val Leu His Ala Val Lys Asn Leu Met Val Cys Asn Ala Arg 50 55 60 Leu Met Ala Tyr Thr Ser Glu Leu Gln Lys Leu Glu Glu Gln Ile Ala 65 70 75 80 Asn Gln Thr Gly Arg Cys Asp Val Lys Phe Glu Ser Lys Glu Arg Thr 85 90 95 Ala Cys Lys Gly Lys Ile Ala Ile Ser Asp Ile Arg Ile Pro Leu Met 100 105 110 Trp Lys Asp Ser Asp His Phe Ser Asn Lys Glu Arg Ser Arg Arg Tyr 115 120 125 Ala Ile Phe Cys Leu Phe Lys Met Gly Ala Asn Val Phe Asp Thr Asp 130 135 140 Val Val Asn Val Asp Lys Thr Ile Thr Asp Ile Cys Phe Glu Asn Val 145 150 155 160 Thr Ile Phe Asn Glu Ala Gly Pro Asp Phe Gln Ile Lys Val Glu Val 165 170 175 Tyr Ser Cys Cys Thr Glu Glu Ser Ser Ile Thr Asn Thr Pro Lys Lys 180 185 190 Leu Ala Lys Lys Leu Lys Thr Ser Ile Ser Lys Ala Thr Gly Lys Lys 195 200 205 Ile Ser Ser Val Leu Gln Glu Glu Asp Asp Glu Met Cys Leu Leu Leu 210 215 220 Ser Ser Ala Val Phe Gly Val Lys Tyr Asn Leu Leu Ala His Thr Thr 225 230 235 240 Leu Thr Leu Glu Ser Ala Glu Asp Ser Phe Lys Thr His Asn Leu Ser 245 250 255 Ile Asn Gly Asn Glu Glu Ser Ser Phe Trp Leu Pro Leu Tyr Gly Asn 260 265 270 Met Cys Cys Arg Leu Val Ala Gln Pro Ala Cys Met Ala Glu Asp Ala 275 280 285 Phe Ala Gly Phe Leu Asn Gln Gln Gln Met Val Glu Gly Leu Ile Ser 290 295 300 Trp Arg Arg Leu Tyr Cys Val Leu Arg Gly Gly Lys Leu Tyr Cys Phe 305 310 315 320 Tyr Ser Pro Glu Glu Ile Glu Ala Lys Val Glu Pro Ala Leu Val Val 325 330 335 Pro Ile Asn Lys Glu Thr Arg Ile Arg Ala Met Asp Lys Asp Ala Lys 340 345 350 Lys Arg Ile His Asn Phe Ser Val Ile Asn Pro Val Pro Gly Gln Ala 355 360 365 Ile Thr Gln Ile Phe Ala Val Asp Asn Arg Glu Asp Leu Gln Lys Trp 370 375 380 Met Glu Ala Phe Trp Gln His Phe Phe Asp Leu Ser Gln Trp Lys His 385 390 395 400 Cys Cys Glu Glu Leu Met Lys Ile Glu Ile Met Ser Pro Arg Lys Pro 405 410 415 Pro Leu Phe Leu Thr Lys Glu Ala Thr Ser Val Tyr His Asp Met Ser 420 425 430 Ile Asp Ser Pro Met Lys Leu Glu Ser Leu Thr Asp Ile Ile Gln Lys 435 440 445 Lys Ile Glu Glu Thr Asn Gly Gln Phe Leu Ile Gly Gln His Glu Glu 450 455 460 Ser Leu Pro Pro Pro Trp Ala Thr Leu Phe Asp Gly Asn His Gln Met 465 470 475 480 Val Ile Gln Lys Lys Val Leu Tyr Pro Ala Ser Glu Pro Leu His Asp 485 490 495 Glu Lys Gly Lys Lys Arg Gln Ala Pro Leu Pro Pro Ser Asp Lys Leu 500 505 510 Pro Phe Ser Leu Lys Ser Gln Ser Asn Thr Asp Gln Leu Val Lys Asp 515 520 525 Asn Trp Gly Lys Thr Ser Val Ser Gln Thr Ser Ser Leu Asp Thr Lys 530 535 540 Leu Ser Thr Leu Met His His Leu Gln Lys Pro Met Ala Ala Pro Arg 545 550 555 560 Lys Leu Leu Pro Ala Arg Arg Asn Arg Leu Ser Asp Gly Glu His Thr 565 570 575 Asp Thr Lys Thr Asn Phe Glu Ala Lys Pro Val Pro Ala Pro Arg Gln 580 585 590 Lys Ser Ile Lys Asp Ile Leu Asp Pro Arg Ser Trp Leu Gln Ala Gln 595 600 605 Val <210> SEQ ID NO 84 <211> LENGTH: 211 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 84 Met Gln Ala Ile Lys Cys Val Val Val Gly Asp Gly Ala Val Gly Lys 1 5 10 15 Thr Cys Leu Leu Ile Ser Tyr Thr Thr Asn Ala Phe Pro Gly Glu Tyr 20 25 30 Ile Pro Thr Val Phe Asp Asn Tyr Ser Ala Asn Val Met Val Asp Gly 35 40 45 Lys Pro Val Asn Leu Gly Leu Trp Asp Thr Ala Gly Gln Glu Asp Tyr 50 55 60 Asp Arg Leu Arg Pro Leu Ser Tyr Pro Gln Thr Val Gly Glu Thr Tyr 65 70 75 80 Gly Lys Asp Ile Thr Ser Arg Gly Lys Asp Lys Pro Ile Ala Asp Val 85 90 95 Phe Leu Ile Cys Phe Ser Leu Val Ser Pro Ala Ser Phe Glu Asn Val 100 105 110 Arg Ala Lys Trp Tyr Pro Glu Val Arg His His Cys Pro Asn Thr Pro 115 120 125 Ile Ile Leu Val Gly Thr Lys Leu Asp Leu Arg Asp Asp Lys Asp Thr 130 135 140 Ile Glu Lys Leu Lys Glu Lys Lys Leu Thr Pro Ile Thr Tyr Pro Gln 145 150 155 160 Gly Leu Ala Met Ala Lys Glu Ile Gly Ala Val Lys Tyr Leu Glu Cys 165 170 175 Ser Ala Leu Thr Gln Arg Gly Leu Lys Thr Val Phe Asp Glu Ala Ile 180 185 190 Arg Ala Val Leu Cys Pro Pro Pro Val Lys Lys Arg Lys Arg Lys Cys 195 200 205 Leu Leu Leu 210 <210> SEQ ID NO 85 <211> LENGTH: 499 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 85 Met Ala Met Ala Glu Gly Glu Arg Thr Glu Cys Ala Glu Pro Pro Arg 1 5 10 15 Asp Glu Pro Pro Ala Asp Gly Ala Leu Lys Arg Ala Glu Glu Leu Lys 20 25 30 Thr Gln Ala Asn Asp Tyr Phe Lys Ala Lys Asp Tyr Glu Asn Ala Ile 35 40 45 Lys Phe Tyr Ser Gln Ala Ile Glu Leu Asn Pro Ser Asn Ala Ile Tyr 50 55 60 Tyr Gly Asn Arg Ser Leu Ala Tyr Leu Arg Thr Glu Cys Tyr Gly Tyr 65 70 75 80 Ala Leu Gly Asp Ala Thr Arg Ala Ile Glu Leu Asp Lys Lys Tyr Ile 85 90 95 Lys Gly Tyr Tyr Arg Arg Ala Ala Ser Asn Met Ala Leu Gly Lys Phe 100 105 110 Arg Ala Ala Leu Arg Asp Tyr Glu Thr Val Val Lys Val Lys Pro His 115 120 125 Asp Lys Asp Ala Lys Met Lys Tyr Gln Glu Cys Asn Lys Ile Val Lys 130 135 140 Gln Lys Ala Phe Glu Arg Ala Ile Ala Gly Asp Glu His Lys Arg Ser 145 150 155 160 Val Val Asp Ser Leu Asp Ile Glu Ser Met Thr Ile Glu Asp Glu Tyr 165 170 175 Ser Gly Pro Lys Leu Glu Asp Gly Lys Val Thr Ile Ser Phe Met Lys 180 185 190 Glu Leu Met Gln Trp Tyr Lys Asp Gln Lys Lys Leu His Arg Lys Cys 195 200 205 Ala Tyr Gln Ile Leu Val Gln Val Lys Glu Val Leu Ser Lys Leu Ser 210 215 220 Thr Leu Val Glu Thr Thr Leu Lys Glu Thr Glu Lys Ile Thr Val Cys 225 230 235 240 Gly Asp Thr His Gly Gln Phe Tyr Asp Leu Leu Asn Ile Phe Glu Leu 245 250 255 Asn Gly Leu Pro Ser Glu Thr Asn Pro Tyr Ile Phe Asn Gly Asp Phe 260 265 270 Val Asp Arg Gly Ser Phe Ser Val Glu Val Ile Leu Thr Leu Phe Gly 275 280 285 Phe Lys Leu Leu Tyr Pro Asp His Phe His Leu Leu Arg Gly Asn His 290 295 300 Glu Thr Asp Asn Met Asn Gln Ile Tyr Gly Phe Glu Gly Glu Val Lys 305 310 315 320 Ala Lys Tyr Thr Ala Gln Met Tyr Glu Leu Phe Ser Glu Val Phe Glu 325 330 335 Trp Leu Pro Leu Ala Gln Cys Ile Asn Gly Lys Val Leu Ile Met His 340 345 350 Gly Gly Leu Phe Ser Glu Asp Gly Val Thr Leu Asp Asp Ile Arg Lys 355 360 365 Ile Glu Arg Asn Arg Gln Pro Pro Asp Ser Gly Pro Met Cys Asp Leu 370 375 380 Leu Trp Ser Asp Pro Gln Pro Gln Asn Gly Arg Ser Ile Ser Lys Arg 385 390 395 400 Gly Val Ser Cys Gln Phe Gly Pro Asp Val Thr Lys Ala Phe Leu Glu 405 410 415 Glu Asn Asn Leu Asp Tyr Ile Ile Arg Ser His Glu Val Lys Ala Glu 420 425 430 Gly Tyr Glu Val Ala His Gly Gly Arg Cys Val Thr Val Phe Ser Ala 435 440 445 Pro Asn Tyr Cys Asp Gln Met Gly Asn Lys Ala Ser Tyr Ile His Leu 450 455 460 Gln Gly Ser Asp Leu Arg Pro Gln Phe His Gln Phe Thr Ala Val Pro 465 470 475 480 His Pro Asn Val Lys Pro Met Ala Tyr Ala Asn Thr Leu Leu Gln Leu 485 490 495 Gly Met Met <210> SEQ ID NO 86 <211> LENGTH: 344 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 86 Met Pro Val Asp Val Ala Ser Pro Ala Gly Lys Thr Val Cys Val Thr 1 5 10 15 Gly Ala Gly Gly Tyr Ile Ala Ser Trp Ile Val Lys Ile Leu Leu Glu 20 25 30 Arg Gly Tyr Thr Val Lys Gly Thr Val Arg Asn Pro Asp Asp Pro Lys 35 40 45 Asn Thr His Leu Arg Glu Leu Glu Gly Gly Lys Glu Arg Leu Ile Leu 50 55 60 Cys Lys Ala Asp Leu Gln Asp Tyr Glu Ala Leu Lys Ala Ala Ile Asp 65 70 75 80 Gly Cys Asp Gly Val Phe His Thr Ala Ser Pro Val Thr Asp Asp Pro 85 90 95 Glu Gln Met Val Glu Pro Ala Val Asn Gly Ala Lys Phe Val Ile Asn 100 105 110 Ala Ala Ala Glu Ala Lys Val Lys Arg Val Val Ile Thr Ser Ser Ile 115 120 125 Gly Ala Val Tyr Met Asp Pro Asn Arg Asp Pro Glu Ala Val Val Asp 130 135 140 Glu Ser Cys Trp Ser Asp Leu Asp Phe Cys Lys Asn Thr Lys Asn Trp 145 150 155 160 Tyr Cys Tyr Gly Lys Met Val Ala Glu Gln Ala Ala Trp Glu Thr Ala 165 170 175 Lys Glu Lys Gly Val Asp Leu Val Val Leu Asn Pro Val Leu Val Leu 180 185 190 Gly Pro Pro Leu Gln Pro Thr Ile Asn Ala Ser Leu Tyr His Val Leu 195 200 205 Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Leu Thr Gln Ala 210 215 220 Tyr Val Asp Val Arg Asp Val Ala Leu Ala His Val Leu Val Tyr Glu 225 230 235 240 Ala Pro Ser Ala Ser Gly Arg Tyr Leu Leu Ala Glu Ser Ala Arg His 245 250 255 Arg Gly Glu Val Val Glu Ile Leu Ala Lys Leu Phe Pro Glu Tyr Pro 260 265 270 Leu Pro Thr Lys Cys Lys Asp Glu Lys Asn Pro Arg Ala Lys Pro Tyr 275 280 285 Lys Phe Thr Asn Gln Lys Ile Lys Asp Leu Gly Leu Glu Phe Thr Ser 290 295 300 Thr Lys Gln Ser Leu Tyr Asp Thr Val Lys Ser Leu Gln Glu Lys Gly 305 310 315 320 His Leu Ala Pro Pro Pro Pro Pro Pro Ser Ala Ser Gln Glu Ser Val 325 330 335 Glu Asn Gly Ile Lys Ile Gly Ser 340 <210> SEQ ID NO 87 <211> LENGTH: 784 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 87 Met Tyr Ile Leu Ile Tyr Ile Ser Ile Pro Lys His Pro Gln Thr Asp 1 5 10 15 Lys Thr Arg Pro Ile Tyr Pro Ser Thr Leu Gly Thr Glu Leu Arg Thr 20 25 30 Glu Leu Gly Lys Thr Gly Gln Gly Lys Gln Lys Ile Tyr Cys Ala Lys 35 40 45 Cys Thr Lys Lys Cys Ser Gly Glu Val Leu Arg Val Ala Asp Asn His 50 55 60 Phe His Lys Ala Cys Phe Gln Cys Cys Gln Cys Lys Lys Ser Leu Ala 65 70 75 80 Thr Gly Gly Phe Phe Thr Lys Asp Asn Ala Tyr Tyr Cys Ile Pro Asp 85 90 95 Tyr Gln Arg Leu Tyr Gly Thr Lys Cys Ala Asn Cys Gln Gln Tyr Val 100 105 110 Glu Gly Glu Val Val Ser Thr Met Gly Lys Thr Tyr His Gln Lys Cys 115 120 125 Phe Thr Cys Ser Lys Cys Lys Gln Pro Phe Lys Ser Gly Ser Lys Val 130 135 140 Thr Asn Thr Gly Lys Glu Val Leu Cys Glu Gln Cys Val Thr Gly Ala 145 150 155 160 Pro Val Ser Pro Ser Arg Gln Ala Thr Gly Gly Gly Val Ser Ser Pro 165 170 175 Ala Pro Pro Ala Glu Ser Pro Thr Arg Ala Thr Ala His Gln Gln His 180 185 190 Gly Ser Val Ile Ser His Lys Ala His Leu Lys Glu Asp Tyr Asp Pro 195 200 205 Asn Asp Cys Ala Gly Cys Gly Glu Leu Leu Lys Glu Gly Gln Ala Leu 210 215 220 Val Ala Leu Asp Arg Gln Trp His Val Ser Cys Phe Arg Cys Lys Ala 225 230 235 240 Cys Gln Ala Val Leu Asn Gly Glu Tyr Met Gly Lys Asp Ala Val Pro 245 250 255 Tyr Cys Glu Lys Cys Tyr Gln Lys Gly Phe Gly Val Lys Cys Ala Tyr 260 265 270 Cys Ser Arg Phe Ile Ser Gly Lys Val Leu Gln Ala Gly Asp Asn His 275 280 285 His Phe His Pro Thr Cys Ala Arg Cys Thr Lys Cys Gly Asp Pro Phe 290 295 300 Gly Asp Gly Glu Glu Met Tyr Leu Gln Gly Ser Ala Ile Trp His Pro 305 310 315 320 Arg Cys Gly Pro Gly Pro Ser Glu Ser Gly Ile Ile Leu Asn Gly Gly 325 330 335 Gly Gly Thr Ser Ser Val Val Gly Gly Ala Ser Asn Gly Asn Phe Thr 340 345 350 Asp Thr Glu Cys Asp Arg Met Ser Ser Ser Ala Leu Ser Glu Met Tyr 355 360 365 Ile Arg Ser Arg Thr Pro Ser Phe Asn Gly Ser Leu Tyr Ser Ser Ser 370 375 380 Arg Lys His Tyr Arg Thr Val Ser Pro Gly Leu Ile Leu Arg Glu Tyr 385 390 395 400 Gly Arg Pro Asn Ala Glu Asp Ile Ser Arg Ile Tyr Thr Tyr Ser Tyr 405 410 415 Leu Thr Asp Ala Pro His Tyr Leu Arg Lys Pro Ile Asp Pro Tyr Asp 420 425 430 Lys Thr Pro Leu Ser Pro His Phe His Arg Pro Ser Ser Tyr Ala Thr 435 440 445 Thr Ala Ser Asn Ala Gly Ser Val Ala Gly Ser Arg Pro Pro Ser Arg 450 455 460 Pro His Ser Arg Thr Arg Ser Ala Met Lys Val Leu Val Asp Ala Ile 465 470 475 480 Arg Ser Glu Thr Pro Arg Pro Lys Ser Pro Gly Met Asn Asn Glu Glu 485 490 495 Pro Ile Glu Leu Ser His Tyr Pro Ala Ala Lys Lys Pro Pro Pro Gly 500 505 510 Glu Gln Pro Lys Ile Glu Arg Asp Asp Phe Pro Ala Pro Pro Tyr Pro 515 520 525 Tyr Thr Asp Pro Glu Arg Arg Arg Arg Tyr Ser Asp Thr Tyr Lys Gly 530 535 540 Val Pro Ala Ser Asp Asp Glu Asp Glu Asn Val Glu Asn Gly Lys Pro 545 550 555 560 Asn Gly Lys Val Lys Asn Gly Glu Glu Gln Gln Arg Leu Gln Arg Glu 565 570 575 Ala Glu Gln Leu Glu Lys Leu Asn Ser Gly Ile Gly Ser Ala Ile Ala 580 585 590 Lys Asp Leu Lys Glu His Ala Lys Tyr Arg Lys Trp Lys Gln Asn Asn 595 600 605 Leu Asp Pro Arg Asn Ala Ser Arg Thr Pro Ser Ala Ser Lys Glu Pro 610 615 620 Leu Tyr Lys Leu Arg Tyr Glu Ser Pro Ile Gly Ala Ser Pro Ser Arg 625 630 635 640 Asn Leu Asp His Gln Lys Pro Phe Tyr Glu Asp Glu Met Phe Asp Arg 645 650 655 Ser Thr Ser Tyr Arg Gly Ser Leu Gly Lys Ser Leu Gly Asn Ala Pro 660 665 670 Ser Tyr Asn Ala Ile His Ser Tyr Arg Ser Pro Pro Lys Pro Gly Tyr 675 680 685 Gly Phe Lys Thr Thr Thr Leu Pro Tyr Ile Arg Asn Gly Phe Ser Ser 690 695 700 Asp Phe Ser Tyr Gly Gly Leu Gly Asp Lys Thr His Ser Thr Asp Leu 705 710 715 720 Ser Cys Gly Lys Ser Glu Ala Ser Val Asp Ser Ile Thr Glu Gly Asp 725 730 735 Arg Arg Ala Leu Met Gly Gly Asp Leu Pro Ala Ser Ser Thr Tyr Ser 740 745 750 Gly Ala Leu Ser Tyr His Tyr Pro Gln Ala Gly Leu Ile Arg Arg Ser 755 760 765 Leu Pro Asn Met Ser His Ser Ile Ile Ser Cys Ala Asn Ala Lys Leu 770 775 780 <210> SEQ ID NO 88 <211> LENGTH: 559 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 88 Met Pro Leu Val Lys Arg Asn Ile Asp Pro Arg His Leu Cys His Thr 1 5 10 15 Ala Leu Pro Arg Gly Ile Lys Asn Glu Leu Glu Cys Val Thr Asn Ile 20 25 30 Ser Leu Ala Asn Ile Ile Arg Gln Leu Ser Ser Leu Ser Lys Tyr Ala 35 40 45 Glu Asp Ile Phe Gly Glu Leu Phe Asn Glu Ala His Ser Phe Ser Phe 50 55 60 Arg Val Asn Ser Leu Gln Glu Arg Val Asp Arg Leu Ser Val Ser Val 65 70 75 80 Thr Gln Leu Asp Pro Lys Glu Glu Glu Leu Ser Leu Gln Asp Ile Thr 85 90 95 Met Arg Lys Ala Phe Arg Ser Ser Thr Ile Gln Asp Gln Gln Leu Phe 100 105 110 Asp Arg Lys Thr Leu Pro Ile Pro Leu Gln Glu Thr Tyr Asp Val Cys 115 120 125 Glu Gln Pro Pro Pro Leu Asn Ile Leu Thr Pro Tyr Arg Asp Asp Gly 130 135 140 Lys Glu Gly Leu Lys Phe Tyr Thr Asn Pro Ser Tyr Phe Phe Asp Leu 145 150 155 160 Trp Lys Glu Lys Met Leu Gln Asp Thr Glu Asp Lys Arg Lys Glu Lys 165 170 175 Arg Lys Gln Lys Gln Lys Asn Leu Asp Arg Pro His Glu Pro Glu Lys 180 185 190 Val Pro Arg Ala Pro His Asp Arg Arg Arg Glu Trp Gln Lys Leu Ala 195 200 205 Gln Gly Pro Glu Leu Ala Glu Asp Asp Ala Asn Leu Leu His Lys His 210 215 220 Ile Glu Val Ala Asn Gly Pro Ala Ser His Phe Glu Thr Arg Pro Gln 225 230 235 240 Thr Tyr Val Asp His Met Asp Gly Ser Tyr Ser Leu Ser Ala Leu Pro 245 250 255 Phe Ser Gln Met Ser Glu Leu Leu Thr Arg Ala Glu Glu Arg Val Leu 260 265 270 Val Arg Pro His Glu Pro Pro Pro Pro Pro Pro Met His Gly Ala Gly 275 280 285 Asp Ala Lys Pro Ile Pro Thr Cys Ile Ser Ser Ala Thr Gly Leu Ile 290 295 300 Glu Asn Arg Pro Gln Ser Pro Ala Thr Gly Arg Thr Pro Val Phe Val 305 310 315 320 Ser Pro Thr Pro Pro Pro Pro Pro Pro Pro Leu Pro Ser Ala Leu Ser 325 330 335 Thr Ser Ser Leu Arg Ala Ser Met Thr Ser Thr Pro Pro Pro Pro Val 340 345 350 Pro Pro Pro Pro Pro Pro Pro Ala Thr Ala Leu Gln Ala Pro Ala Val 355 360 365 Pro Pro Pro Pro Ala Pro Leu Gln Ile Ala Pro Gly Val Leu His Pro 370 375 380 Ala Pro Pro Pro Ile Ala Pro Pro Leu Val Gln Pro Ser Pro Pro Val 385 390 395 400 Ala Arg Ala Ala Pro Val Cys Glu Thr Val Pro Val His Pro Leu Pro 405 410 415 Gln Gly Glu Val Gln Gly Leu Pro Pro Pro Pro Pro Pro Pro Pro Leu 420 425 430 Pro Pro Pro Gly Ile Arg Pro Ser Ser Pro Val Thr Val Thr Ala Leu 435 440 445 Ala His Pro Pro Ser Gly Leu His Pro Thr Pro Ser Thr Ala Pro Gly 450 455 460 Pro His Val Pro Leu Met Pro Pro Ser Pro Pro Ser Gln Val Ile Pro 465 470 475 480 Ala Ser Glu Pro Lys Arg His Pro Ser Thr Leu Pro Val Ile Ser Asp 485 490 495 Ala Arg Ser Val Leu Leu Glu Ala Ile Arg Lys Gly Ile Gln Leu Arg 500 505 510 Lys Val Glu Glu Gln Arg Glu Gln Glu Ala Lys His Glu Arg Ile Glu 515 520 525 Asn Asp Val Ala Thr Ile Leu Ser Arg Arg Ile Ala Val Glu Tyr Ser 530 535 540 Asp Ser Glu Asp Asp Ser Glu Phe Asp Glu Val Asp Trp Leu Glu 545 550 555 <210> SEQ ID NO 89 <211> LENGTH: 2135 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 89 Met Pro Ala Leu Gly Pro Ala Leu Leu Gln Ala Leu Trp Ala Gly Trp 1 5 10 15 Val Leu Thr Leu Gln Pro Leu Pro Pro Thr Ala Phe Thr Pro Asn Gly 20 25 30 Thr Tyr Leu Gln His Leu Ala Arg Asp Pro Thr Ser Gly Thr Leu Tyr 35 40 45 Leu Gly Ala Thr Asn Phe Leu Phe Gln Leu Ser Pro Gly Leu Gln Leu 50 55 60 Glu Ala Thr Val Ser Thr Gly Pro Val Leu Asp Ser Arg Asp Cys Leu 65 70 75 80 Pro Pro Val Met Pro Asp Glu Cys Pro Gln Ala Gln Pro Thr Asn Asn 85 90 95 Pro Asn Gln Leu Leu Leu Val Ser Pro Gly Ala Leu Val Val Cys Gly 100 105 110 Ser Val His Gln Gly Val Cys Glu Gln Arg Arg Leu Gly Gln Leu Glu 115 120 125 Gln Leu Leu Leu Arg Pro Glu Arg Pro Gly Asp Thr Gln Tyr Val Ala 130 135 140 Ala Asn Asp Pro Ala Val Ser Thr Val Gly Leu Val Ala Gln Gly Leu 145 150 155 160 Ala Gly Glu Pro Leu Leu Phe Val Gly Arg Gly Tyr Thr Ser Arg Gly 165 170 175 Val Gly Gly Gly Ile Pro Pro Ile Thr Thr Arg Ala Leu Trp Pro Pro 180 185 190 Asp Pro Gln Ala Ala Phe Ser Tyr Glu Glu Thr Ala Lys Leu Ala Val 195 200 205 Gly Arg Leu Ser Glu Tyr Ser His His Phe Val Ser Ala Phe Ala Arg 210 215 220 Gly Ala Ser Ala Tyr Phe Leu Phe Leu Arg Arg Asp Leu Gln Ala Gln 225 230 235 240 Ser Arg Ala Phe Arg Ala Tyr Val Ser Arg Val Cys Leu Arg Asp Gln 245 250 255 His Tyr Tyr Ser Tyr Val Glu Leu Pro Leu Ala Cys Glu Gly Gly Arg 260 265 270 Tyr Gly Leu Ile Gln Ala Ala Ala Val Ala Thr Ser Arg Glu Val Ala 275 280 285 His Gly Glu Val Leu Phe Ala Ala Phe Ser Ser Ala Ala Pro Pro Thr 290 295 300 Val Gly Arg Pro Pro Ser Ala Ala Ala Gly Ala Ser Gly Ala Ser Ala 305 310 315 320 Leu Cys Ala Phe Pro Leu Asp Glu Val Asp Arg Leu Ala Asn Arg Thr 325 330 335 Arg Asp Ala Cys Tyr Thr Arg Glu Gly Arg Ala Glu Asp Gly Thr Glu 340 345 350 Val Ala Tyr Ile Glu Tyr Asp Val Asn Ser Asp Cys Ala Gln Leu Pro 355 360 365 Val Asp Thr Leu Asp Ala Tyr Pro Cys Gly Ser Asp His Thr Pro Ser 370 375 380 Pro Met Ala Ser Arg Val Pro Leu Glu Ala Thr Pro Ile Leu Glu Trp 385 390 395 400 Pro Gly Ile Gln Leu Thr Ala Val Ala Val Thr Met Glu Asp Gly His 405 410 415 Thr Ile Ala Phe Leu Gly Asp Ser Gln Gly Gln Leu His Arg Val Tyr 420 425 430 Leu Gly Pro Gly Ser Asp Gly His Pro Tyr Ser Thr Gln Ser Ile Gln 435 440 445 Gln Gly Ser Ala Val Ser Arg Asp Leu Thr Phe Asp Gly Thr Phe Glu 450 455 460 His Leu Tyr Val Met Thr Gln Ser Thr Leu Leu Lys Val Pro Val Ala 465 470 475 480 Ser Cys Ala Gln His Leu Asp Cys Ala Ser Cys Leu Ala His Arg Asp 485 490 495 Pro Tyr Cys Gly Trp Cys Val Leu Leu Gly Arg Cys Ser Arg Arg Ser 500 505 510 Glu Cys Ser Arg Gly Gln Gly Pro Glu Gln Trp Leu Trp Ser Phe Gln 515 520 525 Pro Glu Leu Gly Cys Leu Gln Val Ala Ala Met Ser Pro Ala Asn Ile 530 535 540 Ser Arg Glu Glu Thr Arg Glu Val Phe Leu Ser Val Pro Asp Leu Pro 545 550 555 560 Pro Leu Trp Pro Gly Glu Ser Tyr Ser Cys His Phe Gly Glu His Gln 565 570 575 Ser Pro Ala Leu Leu Thr Gly Ser Gly Val Met Cys Pro Ser Pro Asp 580 585 590 Pro Ser Glu Ala Pro Val Leu Pro Arg Gly Ala Asp Tyr Val Ser Val 595 600 605 Ser Val Glu Leu Arg Phe Gly Ala Val Val Ile Ala Lys Thr Ser Leu 610 615 620 Ser Phe Tyr Asp Cys Val Ala Val Thr Glu Leu Arg Pro Ser Ala Gln 625 630 635 640 Cys Gln Ala Cys Val Ser Ser Arg Trp Gly Cys Asn Trp Cys Val Trp 645 650 655 Gln His Leu Cys Thr His Lys Ala Ser Cys Asp Ala Gly Pro Met Val 660 665 670 Ala Ser His Gln Ser Pro Leu Val Ser Pro Asp Pro Pro Ala Arg Gly 675 680 685 Gly Pro Ser Pro Ser Pro Pro Thr Ala Pro Lys Ala Leu Ala Thr Pro 690 695 700 Ala Pro Asp Thr Leu Pro Val Glu Pro Gly Ala Pro Ser Thr Ala Thr 705 710 715 720 Ala Ser Asp Ile Ser Pro Gly Ala Ser Pro Ser Leu Leu Ser Pro Trp 725 730 735 Gly Pro Trp Ala Gly Ser Gly Ser Ile Ser Ser Pro Gly Ser Thr Gly 740 745 750 Ser Pro Leu His Glu Glu Pro Ser Pro Pro Ser Pro Gln Asn Gly Pro 755 760 765 Gly Thr Ala Val Pro Ala Pro Thr Asp Phe Arg Pro Ser Ala Thr Pro 770 775 780 Glu Asp Leu Leu Ala Ser Pro Leu Ser Pro Ser Glu Val Ala Ala Val 785 790 795 800 Pro Pro Ala Asp Pro Gly Pro Glu Ala Leu His Pro Thr Val Pro Leu 805 810 815 Asp Leu Pro Pro Ala Thr Val Pro Ala Thr Thr Phe Pro Gly Ala Met 820 825 830 Gly Ser Val Lys Pro Ala Leu Asp Trp Leu Thr Arg Glu Gly Gly Glu 835 840 845 Leu Pro Glu Ala Asp Glu Trp Thr Gly Gly Asp Ala Pro Ala Phe Ser 850 855 860 Thr Ser Thr Leu Leu Ser Gly Asp Gly Asp Ser Ala Glu Leu Glu Gly 865 870 875 880 Pro Pro Ala Pro Leu Ile Leu Pro Ser Ser Leu Asp Tyr Gln Tyr Asp 885 890 895 Thr Pro Gly Leu Trp Glu Leu Glu Glu Ala Thr Leu Gly Ala Ser Ser 900 905 910 Cys Pro Cys Val Glu Ser Val Gln Gly Ser Thr Leu Met Pro Val His 915 920 925 Val Glu Arg Glu Ile Arg Leu Leu Gly Arg Asn Leu His Leu Phe Gln 930 935 940 Asp Gly Pro Gly Asp Asn Glu Cys Val Met Glu Leu Glu Gly Leu Glu 945 950 955 960 Val Val Val Glu Ala Arg Val Glu Cys Glu Pro Pro Pro Asp Thr Gln 965 970 975 Cys His Val Thr Cys Gln Gln His Gln Leu Ser Tyr Glu Ala Leu Gln 980 985 990 Pro Glu Leu Arg Val Gly Leu Phe Leu Arg Arg Ala Gly Arg Leu Arg 995 1000 1005 Val Asp Ser Ala Glu Gly Leu His Val Val Leu Tyr Asp Cys Ser 1010 1015 1020 Val Gly His Gly Asp Cys Ser Arg Cys Gln Thr Ala Met Pro Gln 1025 1030 1035 Tyr Gly Cys Val Trp Cys Glu Gly Glu Arg Pro Arg Cys Val Thr 1040 1045 1050 Arg Glu Ala Cys Gly Glu Ala Glu Ala Val Ala Thr Gln Cys Pro 1055 1060 1065 Ala Pro Leu Ile His Ser Val Glu Pro Leu Thr Gly Pro Val Asp 1070 1075 1080 Gly Gly Thr Arg Val Thr Ile Arg Gly Ser Asn Leu Gly Gln His 1085 1090 1095 Val Gln Asp Val Leu Gly Met Val Thr Val Ala Gly Val Pro Cys 1100 1105 1110 Ala Val Asp Ala Gln Glu Tyr Glu Val Ser Ser Ser Leu Val Cys 1115 1120 1125 Ile Thr Gly Ala Ser Gly Glu Glu Val Ala Gly Ala Thr Ala Val 1130 1135 1140 Glu Val Pro Gly Arg Gly Arg Gly Val Ser Glu His Asp Phe Ala 1145 1150 1155 Tyr Gln Asp Pro Lys Val His Ser Ile Phe Pro Ala Arg Gly Pro 1160 1165 1170 Arg Ala Gly Gly Thr Arg Leu Thr Leu Asn Gly Ser Lys Leu Leu 1175 1180 1185 Thr Gly Arg Leu Glu Asp Ile Arg Val Val Val Gly Asp Gln Pro 1190 1195 1200 Cys His Leu Leu Pro Glu Gln Gln Ser Glu Gln Leu Arg Cys Glu 1205 1210 1215 Thr Ser Pro Arg Pro Thr Pro Ala Thr Leu Pro Val Ala Val Trp 1220 1225 1230 Phe Gly Ala Thr Glu Arg Arg Leu Gln Arg Gly Gln Phe Lys Tyr 1235 1240 1245 Thr Leu Asp Pro Asn Ile Thr Ser Ala Gly Pro Thr Lys Ser Phe 1250 1255 1260 Leu Ser Gly Gly Arg Glu Ile Cys Val Arg Gly Gln Asn Leu Asp 1265 1270 1275 Val Val Gln Thr Pro Arg Ile Arg Val Thr Val Val Ser Arg Met 1280 1285 1290 Leu Gln Pro Ser Gln Gly Leu Gly Arg Arg Arg Arg Val Val Pro 1295 1300 1305 Glu Thr Ala Cys Ser Leu Gly Pro Ser Cys Ser Ser Gln Gln Phe 1310 1315 1320 Glu Glu Pro Cys His Val Asn Ser Ser Gln Leu Ile Thr Cys Arg 1325 1330 1335 Thr Pro Ala Leu Pro Gly Leu Pro Glu Asp Pro Trp Val Arg Val 1340 1345 1350 Glu Phe Ile Leu Asp Asn Leu Val Phe Asp Phe Ala Thr Leu Asn 1355 1360 1365 Pro Thr Pro Phe Ser Tyr Glu Ala Asp Pro Thr Leu Gln Pro Leu 1370 1375 1380 Asn Pro Glu Asp Pro Thr Met Pro Phe Arg His Lys Pro Gly Ser 1385 1390 1395 Val Phe Ser Val Glu Gly Glu Asn Leu Asp Leu Ala Met Ser Lys 1400 1405 1410 Glu Glu Val Val Ala Met Ile Gly Asp Gly Pro Cys Val Val Lys 1415 1420 1425 Thr Leu Thr Arg His His Leu Tyr Cys Glu Pro Pro Val Glu Gln 1430 1435 1440 Pro Leu Pro Arg His His Ala Leu Arg Glu Ala Pro Asp Ser Leu 1445 1450 1455 Pro Glu Phe Thr Val Gln Met Gly Asn Leu Arg Phe Ser Leu Gly 1460 1465 1470 His Val Gln Tyr Asp Gly Glu Ser Pro Gly Ala Phe Pro Val Ala 1475 1480 1485 Ala Gln Val Gly Leu Gly Val Gly Thr Ser Leu Leu Ala Leu Gly 1490 1495 1500 Val Ile Ile Ile Val Leu Met Tyr Arg Arg Lys Ser Lys Gln Ala 1505 1510 1515 Leu Arg Asp Tyr Lys Lys Val Gln Ile Gln Leu Glu Asn Leu Glu 1520 1525 1530 Ser Ser Val Arg Asp Arg Cys Lys Lys Glu Phe Thr Asp Leu Met 1535 1540 1545 Thr Glu Met Thr Asp Leu Thr Ser Asp Leu Leu Gly Ser Gly Ile 1550 1555 1560 Pro Phe Leu Asp Tyr Lys Val Tyr Ala Glu Arg Ile Phe Phe Pro 1565 1570 1575 Gly His Arg Glu Ser Pro Leu His Arg Asp Leu Gly Val Pro Glu 1580 1585 1590 Ser Arg Arg Pro Thr Val Glu Gln Gly Leu Gly Gln Leu Ser Asn 1595 1600 1605 Leu Leu Asn Ser Lys Leu Phe Leu Thr Lys Phe Ile His Thr Leu 1610 1615 1620 Glu Ser Gln Arg Thr Phe Ser Ala Arg Asp Arg Ala Tyr Val Ala 1625 1630 1635 Ser Leu Leu Thr Val Ala Leu His Gly Lys Leu Glu Tyr Phe Thr 1640 1645 1650 Asp Ile Leu Arg Thr Leu Leu Ser Asp Leu Val Ala Gln Tyr Val 1655 1660 1665 Ala Lys Asn Pro Lys Leu Met Leu Arg Arg Thr Glu Thr Val Val 1670 1675 1680 Glu Lys Leu Leu Thr Asn Trp Met Ser Ile Cys Leu Tyr Thr Phe 1685 1690 1695 Val Arg Asp Ser Val Gly Glu Pro Leu Tyr Met Leu Phe Arg Gly 1700 1705 1710 Ile Lys His Gln Val Asp Lys Gly Pro Val Asp Ser Val Thr Gly 1715 1720 1725 Lys Ala Lys Tyr Thr Leu Asn Asp Asn Arg Leu Leu Arg Glu Asp 1730 1735 1740 Val Glu Tyr Arg Pro Leu Thr Leu Asn Ala Leu Leu Ala Val Gly 1745 1750 1755 Pro Gly Ala Gly Glu Ala Gln Gly Val Pro Val Lys Val Leu Asp 1760 1765 1770 Cys Asp Thr Ile Ser Gln Ala Lys Glu Lys Met Leu Asp Gln Leu 1775 1780 1785 Tyr Lys Gly Val Pro Leu Thr Gln Arg Pro Asp Pro Arg Thr Leu 1790 1795 1800 Asp Val Glu Trp Arg Ser Gly Val Ala Gly His Leu Ile Leu Ser 1805 1810 1815 Asp Glu Asp Val Thr Ser Glu Val Gln Gly Leu Trp Arg Arg Leu 1820 1825 1830 Asn Thr Leu Gln His Tyr Lys Val Pro Asp Gly Ala Thr Val Ala 1835 1840 1845 Leu Val Pro Cys Leu Thr Lys His Val Leu Arg Glu Asn Gln Asp 1850 1855 1860 Tyr Val Pro Gly Glu Arg Thr Pro Met Leu Glu Asp Val Asp Glu 1865 1870 1875 Gly Gly Ile Arg Pro Trp His Leu Val Lys Pro Ser Asp Glu Pro 1880 1885 1890 Glu Pro Pro Arg Pro Arg Arg Gly Ser Leu Arg Gly Gly Glu Arg 1895 1900 1905 Glu Arg Ala Lys Ala Ile Pro Glu Ile Tyr Leu Thr Arg Leu Leu 1910 1915 1920 Ser Met Lys Gly Thr Leu Gln Lys Phe Val Asp Asp Leu Phe Gln 1925 1930 1935 Val Ile Leu Ser Thr Ser Arg Pro Val Pro Leu Ala Val Lys Tyr 1940 1945 1950 Phe Phe Asp Leu Leu Asp Glu Gln Ala Gln Gln His Gly Ile Ser 1955 1960 1965 Asp Gln Asp Thr Ile His Ile Trp Lys Thr Asn Ser Leu Pro Leu 1970 1975 1980 Arg Phe Trp Ile Asn Ile Ile Lys Asn Pro Gln Phe Val Phe Asp 1985 1990 1995 Val Gln Thr Ser Asp Asn Met Asp Ala Val Leu Leu Val Ile Ala 2000 2005 2010 Gln Thr Phe Met Asp Ala Cys Thr Leu Ala Asp His Lys Leu Gly 2015 2020 2025 Arg Asp Ser Pro Ile Asn Lys Leu Leu Tyr Ala Arg Asp Ile Pro 2030 2035 2040 Arg Tyr Lys Arg Met Val Glu Arg Tyr Tyr Ala Asp Ile Arg Gln 2045 2050 2055 Thr Val Pro Ala Ser Asp Gln Glu Met Asn Ser Val Leu Ala Glu 2060 2065 2070 Leu Ser Trp Asn Tyr Ser Gly Asp Leu Gly Ala Arg Val Ala Leu 2075 2080 2085 His Glu Leu Tyr Lys Tyr Ile Asn Lys Tyr Tyr Asp Gln Ile Ile 2090 2095 2100 Thr Ala Leu Glu Glu Asp Gly Thr Ala Gln Lys Met Gln Leu Gly 2105 2110 2115 Tyr Arg Leu Gln Gln Ile Ala Ala Ala Val Glu Asn Lys Val Thr 2120 2125 2130 Asp Leu 2135 <210> SEQ ID NO 90 <211> LENGTH: 307 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 90 Met Gly Thr Val Leu Ser Leu Ser Pro Ser Tyr Arg Lys Ala Thr Leu 1 5 10 15 Phe Glu Asp Gly Ala Ala Thr Val Gly His Tyr Thr Ala Val Gln Asn 20 25 30 Ser Lys Asn Ala Lys Asp Lys Asn Leu Lys Arg His Ser Ile Ile Ser 35 40 45 Val Leu Pro Trp Lys Arg Ile Val Ala Val Ser Ala Lys Lys Lys Asn 50 55 60 Ser Lys Lys Val Gln Pro Asn Ser Ser Tyr Gln Asn Asn Ile Thr His 65 70 75 80 Leu Asn Asn Glu Asn Leu Lys Lys Ser Leu Ser Cys Ala Asn Leu Ser 85 90 95 Thr Phe Ala Gln Pro Pro Pro Ala Gln Pro Pro Ala Pro Pro Ala Ser 100 105 110 Gln Leu Ser Gly Ser Gln Thr Gly Gly Ser Ser Ser Val Lys Lys Ala 115 120 125 Pro His Pro Ala Val Thr Ser Ala Gly Thr Pro Lys Arg Val Ile Val 130 135 140 Gln Ala Ser Thr Ser Glu Leu Leu Arg Cys Leu Gly Glu Phe Leu Cys 145 150 155 160 Arg Arg Cys Tyr Arg Leu Lys His Leu Ser Pro Thr Asp Pro Val Leu 165 170 175 Trp Leu Arg Ser Val Asp Arg Ser Leu Leu Leu Gln Gly Trp Gln Asp 180 185 190 Gln Gly Phe Ile Thr Pro Ala Asn Val Val Phe Leu Tyr Met Leu Cys 195 200 205 Arg Asp Val Ile Ser Ser Glu Val Gly Ser Asp His Glu Leu Gln Ala 210 215 220 Val Leu Leu Thr Cys Leu Tyr Leu Ser Tyr Ser Tyr Met Gly Asn Glu 225 230 235 240 Ile Ser Tyr Pro Leu Lys Pro Phe Leu Val Glu Ser Cys Lys Glu Ala 245 250 255 Phe Trp Asp Arg Cys Leu Ser Val Ile Asn Leu Met Ser Ser Lys Met 260 265 270 Leu Gln Ile Asn Ala Asp Pro His Tyr Phe Thr Gln Val Phe Ser Asp 275 280 285 Leu Lys Asn Glu Ser Gly Gln Glu Asp Lys Lys Arg Leu Leu Leu Gly 290 295 300 Leu Asp Arg 305 <210> SEQ ID NO 91 <211> LENGTH: 1406 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 91 Met Asp Met Val Glu Asn Ala Asp Ser Leu Gln Ala Gln Glu Arg Lys 1 5 10 15 Asp Ile Leu Met Lys Tyr Asp Lys Gly His Arg Ala Gly Leu Pro Glu 20 25 30 Asp Lys Gly Pro Glu Pro Val Gly Ile Asn Ser Ser Ile Asp Arg Phe 35 40 45 Gly Ile Leu His Glu Thr Glu Leu Pro Pro Val Thr Ala Arg Glu Ala 50 55 60 Lys Lys Ile Arg Arg Glu Met Thr Arg Thr Ser Lys Trp Met Glu Met 65 70 75 80 Leu Gly Glu Trp Glu Thr Tyr Lys His Ser Ser Lys Leu Ile Asp Arg 85 90 95 Val Tyr Lys Gly Ile Pro Met Asn Ile Arg Gly Pro Val Trp Ser Val 100 105 110 Leu Leu Asn Ile Gln Glu Ile Lys Leu Lys Asn Pro Gly Arg Tyr Gln 115 120 125 Ile Met Lys Glu Arg Gly Lys Arg Ser Ser Glu His Ile His His Ile 130 135 140 Asp Leu Asp Val Arg Thr Thr Leu Arg Asn His Val Phe Phe Arg Asp 145 150 155 160 Arg Tyr Gly Ala Lys Gln Arg Glu Leu Phe Tyr Ile Leu Leu Ala Tyr 165 170 175 Ser Glu Tyr Asn Pro Glu Val Gly Tyr Cys Arg Asp Leu Ser His Ile 180 185 190 Thr Ala Leu Phe Leu Leu Tyr Leu Pro Glu Glu Asp Ala Phe Trp Ala 195 200 205 Leu Val Gln Leu Leu Ala Ser Glu Arg His Ser Leu Pro Gly Phe His 210 215 220 Ser Pro Asn Gly Gly Thr Val Gln Gly Leu Gln Asp Gln Gln Glu His 225 230 235 240 Val Val Pro Lys Ser Gln Pro Lys Thr Met Trp His Gln Asp Lys Glu 245 250 255 Gly Leu Cys Gly Gln Cys Ala Ser Leu Gly Cys Leu Leu Arg Asn Leu 260 265 270 Ile Asp Gly Ile Ser Leu Gly Leu Thr Leu Arg Leu Trp Asp Val Tyr 275 280 285 Leu Val Glu Gly Glu Gln Val Leu Met Pro Ile Thr Ser Ile Ala Leu 290 295 300 Lys Val Gln Gln Lys Arg Leu Met Lys Thr Ser Arg Cys Gly Leu Trp 305 310 315 320 Ala Arg Leu Arg Asn Gln Phe Phe Asp Thr Trp Ala Met Asn Asp Asp 325 330 335 Thr Val Leu Lys His Leu Arg Ala Ser Thr Lys Lys Leu Thr Arg Lys 340 345 350 Gln Gly Asp Leu Pro Pro Pro Ala Lys Arg Glu Gln Gly Ser Leu Ala 355 360 365 Pro Arg Pro Val Pro Ala Ser Arg Gly Gly Lys Thr Leu Cys Lys Gly 370 375 380 Tyr Arg Gln Ala Pro Pro Gly Pro Pro Ala Gln Phe Gln Arg Pro Ile 385 390 395 400 Cys Ser Ala Ser Pro Pro Trp Ala Ser Arg Phe Ser Thr Pro Cys Pro 405 410 415 Gly Gly Ala Val Arg Glu Asp Thr Tyr Pro Val Gly Thr Gln Gly Val 420 425 430 Pro Ser Leu Ala Leu Ala Gln Gly Gly Pro Gln Gly Ser Trp Arg Phe 435 440 445 Leu Glu Trp Lys Ser Met Pro Arg Leu Pro Thr Asp Leu Asp Ile Gly 450 455 460 Gly Pro Trp Phe Pro His Tyr Asp Phe Glu Trp Ser Cys Trp Val Arg 465 470 475 480 Ala Ile Ser Gln Glu Asp Gln Leu Ala Thr Cys Trp Gln Ala Glu His 485 490 495 Cys Gly Glu Val His Asn Lys Asp Met Ser Trp Pro Glu Glu Met Ser 500 505 510 Phe Thr Ala Asn Ser Ser Lys Ile Asp Arg Gln Lys Val Pro Thr Glu 515 520 525 Lys Gly Ala Thr Gly Leu Ser Asn Leu Gly Asn Thr Cys Phe Met Asn 530 535 540 Ser Ser Ile Gln Cys Val Ser Asn Thr Gln Pro Leu Thr Gln Tyr Phe 545 550 555 560 Ile Ser Gly Arg His Leu Tyr Glu Leu Asn Arg Thr Asn Pro Ile Gly 565 570 575 Met Lys Gly His Met Ala Lys Cys Tyr Gly Asp Leu Val Gln Glu Leu 580 585 590 Trp Ser Gly Thr Gln Lys Ser Val Ala Pro Leu Lys Leu Arg Arg Thr 595 600 605 Ile Ala Lys Tyr Ala Pro Lys Phe Asp Gly Phe Gln Gln Gln Asp Ser 610 615 620 Gln Glu Leu Leu Ala Phe Leu Leu Asp Gly Leu His Glu Asp Leu Asn 625 630 635 640 Arg Val His Glu Lys Pro Tyr Val Glu Leu Lys Asp Ser Asp Gly Arg 645 650 655 Pro Asp Trp Glu Val Ala Ala Glu Ala Trp Asp Asn His Leu Arg Arg 660 665 670 Asn Arg Ser Ile Ile Val Asp Leu Phe His Gly Gln Leu Arg Ser Gln 675 680 685 Val Lys Cys Lys Thr Cys Gly His Ile Ser Val Arg Phe Asp Pro Phe 690 695 700 Asn Phe Leu Ser Leu Pro Leu Pro Met Asp Ser Tyr Met Asp Leu Glu 705 710 715 720 Ile Thr Val Ile Lys Leu Asp Gly Thr Thr Pro Val Arg Tyr Gly Leu 725 730 735 Arg Leu Asn Met Asp Glu Lys Tyr Thr Gly Leu Lys Lys Gln Leu Arg 740 745 750 Asp Leu Cys Gly Leu Asn Ser Glu Gln Ile Leu Leu Ala Glu Val His 755 760 765 Asp Ser Asn Ile Lys Asn Phe Pro Gln Asp Asn Gln Lys Val Gln Leu 770 775 780 Ser Val Ser Gly Phe Leu Cys Ala Phe Glu Ile Pro Val Pro Ser Ser 785 790 795 800 Pro Ile Ser Ala Ser Ser Pro Thr Gln Ile Asp Phe Ser Ser Ser Pro 805 810 815 Ser Thr Asn Gly Met Phe Thr Leu Thr Thr Asn Gly Asp Leu Pro Lys 820 825 830 Pro Ile Phe Ile Pro Asn Gly Met Pro Asn Thr Val Val Pro Cys Gly 835 840 845 Thr Glu Lys Asn Phe Thr Asn Gly Met Val Asn Gly His Met Pro Ser 850 855 860 Leu Pro Asp Ser Pro Phe Thr Gly Tyr Ile Ile Ala Val His Arg Lys 865 870 875 880 Met Met Arg Thr Glu Leu Tyr Phe Leu Ser Pro Gln Glu Asn Arg Pro 885 890 895 Ser Leu Phe Gly Met Pro Leu Ile Val Pro Cys Thr Val His Thr Arg 900 905 910 Lys Lys Asp Leu Tyr Asp Ala Val Trp Ile Gln Val Ser Trp Leu Ala 915 920 925 Arg Pro Leu Pro Pro Gln Glu Ala Ser Ile His Ala Gln Asp Arg Asp 930 935 940 Asn Cys Met Gly Tyr Gln Tyr Pro Phe Thr Leu Arg Val Val Gln Lys 945 950 955 960 Asp Gly Asn Ser Cys Ala Trp Cys Pro Gln Tyr Arg Phe Cys Arg Gly 965 970 975 Cys Lys Ile Asp Cys Gly Glu Asp Arg Ala Phe Ile Gly Asn Ala Tyr 980 985 990 Ile Ala Val Asp Trp His Pro Thr Ala Leu His Leu Arg Tyr Gln Thr 995 1000 1005 Ser Gln Glu Arg Val Val Asp Lys His Glu Ser Val Glu Gln Ser 1010 1015 1020 Arg Arg Ala Gln Ala Glu Pro Ile Asn Leu Asp Ser Cys Leu Arg 1025 1030 1035 Ala Phe Thr Ser Glu Glu Glu Leu Gly Glu Ser Glu Met Tyr Tyr 1040 1045 1050 Cys Ser Lys Cys Lys Thr His Cys Leu Ala Thr Lys Lys Leu Asp 1055 1060 1065 Leu Trp Arg Leu Pro Pro Phe Leu Ile Ile His Leu Lys Arg Phe 1070 1075 1080 Gln Phe Val Asn Asp Gln Trp Ile Lys Ser Gln Lys Ile Val Arg 1085 1090 1095 Phe Leu Arg Glu Ser Phe Asp Pro Ser Ala Phe Leu Val Pro Arg 1100 1105 1110 Asp Pro Ala Leu Cys Gln His Lys Pro Leu Thr Pro Gln Gly Asp 1115 1120 1125 Glu Leu Ser Lys Pro Arg Ile Leu Ala Arg Glu Val Lys Lys Val 1130 1135 1140 Asp Ala Gln Ser Ser Ala Gly Lys Glu Asp Met Leu Leu Ser Lys 1145 1150 1155 Ser Pro Ser Ser Leu Ser Ala Asn Ile Ser Ser Ser Pro Lys Gly 1160 1165 1170 Ser Pro Ser Ser Ser Arg Lys Ser Gly Thr Ser Cys Pro Ser Ser 1175 1180 1185 Lys Asn Ser Ser Pro Asn Ser Ser Pro Arg Thr Leu Gly Arg Ser 1190 1195 1200 Lys Gly Arg Leu Arg Leu Pro Gln Ile Gly Ser Lys Asn Lys Pro 1205 1210 1215 Ser Ser Ser Lys Lys Asn Leu Asp Ala Ser Lys Glu Asn Gly Ala 1220 1225 1230 Gly Gln Ile Cys Glu Leu Ala Asp Ala Leu Ser Arg Gly His Met 1235 1240 1245 Arg Gly Gly Ser Gln Pro Glu Leu Val Thr Pro Gln Asp His Glu 1250 1255 1260 Val Ala Leu Ala Asn Gly Phe Leu Tyr Glu His Glu Ala Cys Gly 1265 1270 1275 Asn Gly Cys Gly Asp Gly Tyr Ser Asn Gly Gln Leu Gly Asn His 1280 1285 1290 Ser Glu Glu Asp Ser Thr Asp Asp Gln Arg Glu Asp Thr His Ile 1295 1300 1305 Lys Pro Ile Tyr Asn Leu Tyr Ala Ile Ser Cys His Ser Gly Ile 1310 1315 1320 Leu Ser Gly Gly His Tyr Ile Thr Tyr Ala Lys Asn Pro Asn Cys 1325 1330 1335 Lys Trp Tyr Cys Tyr Asn Asp Ser Ser Cys Glu Glu Leu His Pro 1340 1345 1350 Asp Glu Ile Asp Thr Asp Ser Ala Tyr Ile Leu Phe Tyr Glu Gln 1355 1360 1365 Gln Gly Ile Asp Tyr Ala Gln Phe Leu Pro Lys Ile Asp Gly Lys 1370 1375 1380 Lys Met Ala Asp Thr Ser Ser Thr Asp Glu Asp Ser Glu Ser Asp 1385 1390 1395 Tyr Glu Lys Tyr Ser Met Leu Gln 1400 1405 <210> SEQ ID NO 92 <211> LENGTH: 141 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 92 Met Ala Gly Glu Glu Ile Asn Glu Asp Tyr Pro Val Glu Ile His Glu 1 5 10 15 Tyr Leu Ser Ala Phe Glu Asn Ser Ile Gly Ala Val Asp Glu Met Leu 20 25 30 Lys Thr Met Met Ser Val Ser Arg Asn Glu Leu Leu Gln Lys Leu Asp 35 40 45 Pro Leu Glu Gln Ala Lys Val Asp Leu Val Ser Ala Tyr Thr Leu Asn 50 55 60 Ser Met Phe Trp Val Tyr Leu Ala Thr Gln Gly Val Asn Pro Lys Glu 65 70 75 80 His Pro Val Lys Gln Glu Leu Glu Arg Ile Arg Val Tyr Met Asn Arg 85 90 95 Val Lys Glu Ile Thr Asp Lys Lys Lys Ala Gly Lys Leu Asp Arg Gly 100 105 110 Ala Ala Ser Arg Phe Val Lys Asn Ala Leu Trp Glu Pro Lys Ser Lys 115 120 125 Asn Ala Ser Lys Val Ala Asn Lys Gly Lys Ser Lys Ser 130 135 140 <210> SEQ ID NO 93 <211> LENGTH: 521 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 93 Met Glu Ala Asn Trp Thr Ala Phe Leu Phe Gln Ala His Glu Ala Ser 1 5 10 15 His His Gln Gln Gln Ala Ala Gln Asn Ser Leu Leu Pro Leu Leu Ser 20 25 30 Ser Ala Val Glu Pro Pro Asp Gln Lys Pro Leu Leu Pro Ile Pro Ile 35 40 45 Thr Gln Lys Pro Gln Gly Ala Pro Glu Thr Leu Lys Asp Ala Ile Gly 50 55 60 Ile Lys Lys Glu Lys Pro Lys Thr Ser Phe Val Cys Thr Tyr Cys Ser 65 70 75 80 Lys Ala Phe Arg Asp Ser Tyr His Leu Arg Arg His Glu Ser Cys His 85 90 95 Thr Gly Ile Lys Leu Val Ser Arg Pro Lys Lys Thr Pro Thr Thr Val 100 105 110 Val Pro Leu Ile Ser Thr Ile Ala Gly Asp Ser Ser Arg Thr Ser Leu 115 120 125 Val Ser Thr Ile Ala Gly Ile Leu Ser Thr Val Thr Thr Ser Ser Ser 130 135 140 Gly Thr Asn Pro Ser Ser Ser Ala Ser Thr Thr Ala Met Pro Val Thr 145 150 155 160 Gln Ser Val Lys Lys Pro Ser Lys Pro Val Lys Lys Asn His Ala Cys 165 170 175 Glu Met Cys Gly Lys Ala Phe Arg Asp Val Tyr His Leu Asn Arg His 180 185 190 Lys Leu Ser His Ser Asp Glu Lys Pro Phe Glu Cys Pro Ile Cys Asn 195 200 205 Gln Arg Phe Lys Arg Lys Asp Arg Met Thr Tyr His Val Arg Ser His 210 215 220 Glu Gly Gly Ile Thr Lys Pro Tyr Thr Cys Ser Val Cys Gly Lys Gly 225 230 235 240 Phe Ser Arg Pro Asp His Leu Ser Cys His Val Lys His Val His Ser 245 250 255 Thr Glu Arg Pro Phe Lys Cys Gln Thr Cys Thr Ala Ala Phe Ala Thr 260 265 270 Lys Asp Arg Leu Arg Thr His Met Val Arg His Glu Gly Lys Val Ser 275 280 285 Cys Asn Ile Cys Gly Lys Leu Leu Ser Ala Ala Tyr Ile Thr Ser His 290 295 300 Leu Lys Thr His Gly Gln Ser Gln Ser Ile Asn Cys Asn Thr Cys Lys 305 310 315 320 Gln Gly Ile Ser Lys Thr Cys Met Ser Glu Glu Thr Ser Asn Gln Lys 325 330 335 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 340 345 350 Gln Gln His Val Thr Ser Trp Pro Gly Lys Gln Val Glu Thr Leu Arg 355 360 365 Leu Trp Glu Glu Ala Val Lys Ala Arg Lys Lys Glu Ala Ala Asn Leu 370 375 380 Cys Gln Thr Ser Thr Ala Ala Thr Thr Pro Val Thr Leu Thr Thr Pro 385 390 395 400 Phe Ser Ile Thr Ser Ser Val Ser Ser Gly Thr Met Ser Asn Pro Val 405 410 415 Thr Val Ala Ala Ala Met Ser Met Arg Ser Pro Val Asn Val Ser Ser 420 425 430 Ala Val Asn Ile Thr Ser Pro Met Asn Ile Gly His Pro Val Thr Ile 435 440 445 Thr Ser Pro Leu Ser Met Thr Ser Pro Leu Thr Leu Thr Thr Pro Val 450 455 460 Asn Leu Pro Thr Pro Val Thr Ala Pro Val Asn Ile Ala His Pro Val 465 470 475 480 Thr Ile Thr Ser Pro Met Asn Leu Pro Thr Pro Met Thr Leu Ala Ala 485 490 495 Pro Leu Asn Ile Ala Met Arg Pro Val Glu Ser Met Pro Phe Leu Pro 500 505 510 Gln Ala Leu Pro Thr Ser Pro Pro Trp 515 520 <210> SEQ ID NO 94 <211> LENGTH: 686 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 94 Met Thr Asp Ala Leu Leu Pro Ala Ala Pro Gln Pro Leu Glu Lys Lys 1 5 10 15 Asn Asp Gly Tyr Phe Arg Lys Gly Cys Asn Pro Leu Ala Gln Thr Gly 20 25 30 Arg Ser Lys Leu Gln Asn Gln Arg Ala Ala Leu Asn Gln Gln Ile Leu 35 40 45 Lys Ala Val Arg Met Arg Thr Gly Ala Glu Asn Leu Leu Lys Val Ala 50 55 60 Thr Asn Ser Lys Val Arg Glu Gln Val Arg Leu Glu Leu Ser Phe Val 65 70 75 80 Asn Ser Asp Leu Gln Met Leu Lys Glu Glu Leu Glu Gly Leu Asn Ile 85 90 95 Ser Val Gly Val Tyr Gln Asn Thr Glu Glu Ala Phe Thr Ile Pro Leu 100 105 110 Ile Pro Leu Gly Leu Lys Glu Thr Lys Asp Val Asp Phe Ala Val Val 115 120 125 Leu Lys Asp Phe Ile Leu Glu His Tyr Ser Glu Asp Gly Tyr Leu Tyr 130 135 140 Glu Asp Glu Ile Ala Asp Leu Met Asp Leu Arg Gln Ala Cys Arg Thr 145 150 155 160 Pro Ser Arg Asp Glu Ala Gly Val Glu Leu Leu Met Thr Tyr Phe Ile 165 170 175 Gln Leu Gly Phe Val Glu Ser Arg Phe Phe Pro Pro Thr Arg Gln Met 180 185 190 Gly Leu Leu Phe Thr Trp Tyr Asp Ser Leu Thr Gly Val Pro Val Ser 195 200 205 Gln Gln Asn Leu Leu Leu Glu Lys Ala Ser Val Leu Phe Asn Thr Gly 210 215 220 Ala Leu Tyr Thr Gln Ile Gly Thr Arg Cys Asp Arg Gln Thr Gln Ala 225 230 235 240 Gly Leu Glu Ser Ala Ile Asp Ala Phe Gln Arg Ala Ala Gly Val Leu 245 250 255 Asn Tyr Leu Lys Asp Thr Phe Thr His Thr Pro Ser Tyr Asp Met Ser 260 265 270 Pro Ala Met Leu Ser Val Leu Val Lys Met Met Leu Ala Gln Ala Gln 275 280 285 Glu Ser Val Phe Glu Lys Ile Ser Leu Pro Gly Ile Arg Asn Glu Phe 290 295 300 Phe Met Leu Val Lys Val Ala Gln Glu Ala Ala Lys Val Gly Glu Val 305 310 315 320 Tyr Gln Gln Leu His Ala Ala Met Ser Gln Ala Pro Val Lys Glu Asn 325 330 335 Ile Pro Tyr Ser Trp Ala Ser Leu Ala Cys Val Lys Ala His His Tyr 340 345 350 Ala Ala Leu Ala His Tyr Phe Thr Ala Ile Leu Leu Ile Asp His Gln 355 360 365 Val Lys Pro Gly Thr Asp Leu Asp His Gln Glu Lys Cys Leu Ser Gln 370 375 380 Leu Tyr Asp His Met Pro Glu Gly Leu Thr Pro Leu Ala Thr Leu Lys 385 390 395 400 Asn Asp Gln Gln Arg Arg Gln Leu Gly Lys Ser His Leu Arg Arg Ala 405 410 415 Met Ala His His Glu Glu Ser Val Arg Glu Ala Ser Leu Cys Lys Lys 420 425 430 Leu Arg Ser Ile Glu Val Leu Gln Lys Val Leu Cys Ala Ala Gln Glu 435 440 445 Arg Ser Arg Leu Thr Tyr Ala Gln His Gln Glu Glu Asp Asp Leu Leu 450 455 460 Asn Leu Ile Asp Ala Pro Ser Val Val Ala Lys Thr Glu Gln Glu Val 465 470 475 480 Asp Ile Ile Leu Pro Gln Phe Ser Lys Leu Thr Val Thr Asp Phe Phe 485 490 495 Gln Lys Leu Gly Pro Leu Ser Val Phe Ser Ala Asn Lys Arg Trp Thr 500 505 510 Pro Pro Arg Ser Ile Arg Phe Thr Ala Glu Glu Gly Asp Leu Gly Phe 515 520 525 Thr Leu Arg Gly Asn Ala Pro Val Gln Val His Phe Leu Asp Pro Tyr 530 535 540 Cys Ser Ala Ser Val Ala Gly Ala Arg Glu Gly Asp Tyr Ile Val Ser 545 550 555 560 Ile Gln Leu Val Asp Cys Lys Trp Leu Thr Leu Ser Glu Val Met Lys 565 570 575 Leu Leu Lys Ser Phe Gly Glu Asp Glu Ile Glu Met Lys Val Val Ser 580 585 590 Leu Leu Asp Ser Thr Ser Ser Met His Asn Lys Ser Ala Thr Tyr Ser 595 600 605 Val Gly Met Gln Lys Thr Tyr Ser Met Ile Cys Leu Ala Ile Asp Asp 610 615 620 Asp Asp Lys Thr Asp Lys Thr Lys Lys Ile Ser Lys Lys Leu Ser Phe 625 630 635 640 Leu Ser Trp Gly Thr Asn Lys Asn Arg Gln Lys Ser Ala Ser Thr Leu 645 650 655 Cys Leu Pro Ser Val Gly Ala Ala Arg Pro Gln Val Lys Lys Lys Leu 660 665 670 Pro Ser Pro Phe Ser Leu Leu Asn Ser Asp Ser Ser Trp Tyr 675 680 685 <210> SEQ ID NO 95 <211> LENGTH: 462 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 95 Met Ser Ala Gly Gly Pro Cys Pro Ala Ala Ala Gly Gly Gly Pro Gly 1 5 10 15 Gly Ala Ser Cys Ser Val Gly Ala Pro Gly Gly Val Ser Met Phe Arg 20 25 30 Trp Leu Glu Val Leu Glu Lys Glu Phe Asp Lys Ala Phe Val Asp Val 35 40 45 Asp Leu Leu Leu Gly Glu Ile Asp Pro Asp Gln Ala Asp Ile Thr Tyr 50 55 60 Glu Gly Arg Gln Lys Met Thr Ser Leu Ser Ser Cys Phe Ala Gln Leu 65 70 75 80 Cys His Lys Ala Gln Ser Val Ser Gln Ile Asn His Lys Leu Glu Ala 85 90 95 Gln Leu Val Asp Leu Lys Ser Glu Leu Thr Glu Thr Gln Ala Glu Lys 100 105 110 Val Val Leu Glu Lys Glu Val His Asp Gln Leu Leu Gln Leu His Ser 115 120 125 Ile Gln Leu Gln Leu His Ala Lys Thr Gly Gln Ser Ala Asp Ser Gly 130 135 140 Thr Ile Lys Ala Lys Leu Ser Gly Pro Ser Val Glu Glu Leu Glu Arg 145 150 155 160 Glu Leu Glu Ala Asn Lys Lys Glu Lys Met Lys Glu Ala Gln Leu Glu 165 170 175 Ala Glu Val Lys Leu Leu Arg Lys Glu Asn Glu Ala Leu Arg Arg His 180 185 190 Ile Ala Val Leu Gln Ala Glu Val Tyr Gly Ala Arg Leu Ala Ala Lys 195 200 205 Tyr Leu Asp Lys Glu Leu Ala Gly Arg Val Gln Gln Ile Gln Leu Leu 210 215 220 Gly Arg Asp Met Lys Gly Pro Ala His Asp Lys Leu Trp Asn Gln Leu 225 230 235 240 Glu Ala Glu Ile His Leu His Arg His Lys Thr Val Ile Arg Ala Cys 245 250 255 Arg Gly Arg Asn Asp Leu Lys Arg Pro Met Gln Ala Pro Pro Gly His 260 265 270 Asp Gln Asp Ser Leu Lys Lys Ser Gln Gly Val Gly Pro Ile Arg Lys 275 280 285 Val Leu Leu Leu Lys Glu Asp His Glu Gly Leu Gly Ile Ser Ile Thr 290 295 300 Gly Gly Lys Glu His Gly Val Pro Ile Leu Ile Ser Glu Ile His Pro 305 310 315 320 Gly Gln Pro Ala Asp Arg Cys Gly Gly Leu His Val Gly Asp Ala Ile 325 330 335 Leu Ala Val Asn Gly Val Asn Leu Arg Asp Thr Lys His Lys Glu Ala 340 345 350 Val Thr Ile Leu Ser Gln Gln Arg Gly Glu Ile Glu Phe Glu Val Val 355 360 365 Tyr Val Ala Pro Glu Val Asp Ser Asp Asp Glu Asn Val Glu Tyr Glu 370 375 380 Asp Glu Ser Gly His Arg Tyr Arg Leu Tyr Leu Asp Glu Leu Glu Gly 385 390 395 400 Gly Gly Asn Pro Gly Ala Ser Cys Lys Asp Thr Ser Gly Glu Ile Lys 405 410 415 Val Leu Gln Gly Phe Asn Lys Lys Ala Val Thr Asp Thr His Glu Asn 420 425 430 Gly Asp Leu Gly Thr Ala Ser Glu Thr Pro Leu Asp Asp Gly Ala Ser 435 440 445 Lys Leu Asp Asp Leu His Thr Leu Tyr His Lys Lys Ser Tyr 450 455 460 <210> SEQ ID NO 96 <211> LENGTH: 617 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 96 Met Ser Trp Gly Thr Glu Leu Trp Asp Gln Phe Asp Asn Leu Glu Lys 1 5 10 15 His Thr Gln Trp Gly Ile Asp Ile Leu Glu Lys Tyr Ile Lys Phe Val 20 25 30 Lys Glu Arg Thr Glu Ile Glu Leu Ser Tyr Ala Lys Gln Leu Arg Asn 35 40 45 Leu Ser Lys Lys Tyr Gln Pro Lys Lys Asn Ser Lys Glu Glu Glu Glu 50 55 60 Tyr Lys Tyr Thr Ser Cys Lys Ala Phe Ile Ser Asn Leu Asn Glu Met 65 70 75 80 Asn Asp Tyr Ala Gly Gln His Glu Val Ile Ser Glu Asn Met Ala Ser 85 90 95 Gln Ile Ile Val Asp Leu Ala Arg Tyr Val Gln Glu Leu Lys Gln Glu 100 105 110 Arg Lys Ser Asn Phe His Asp Gly Arg Lys Ala Gln Gln His Ile Glu 115 120 125 Thr Cys Trp Lys Gln Leu Glu Ser Ser Lys Arg Arg Phe Glu Arg Asp 130 135 140 Cys Lys Glu Ala Asp Arg Ala Gln Gln Tyr Phe Glu Lys Met Asp Ala 145 150 155 160 Asp Ile Asn Val Thr Lys Ala Asp Val Glu Lys Ala Arg Gln Gln Ala 165 170 175 Gln Ile Arg His Gln Met Ala Glu Asp Ser Lys Ala Asp Tyr Ser Ser 180 185 190 Ile Leu Gln Lys Phe Asn His Glu Gln His Glu Tyr Tyr His Thr His 195 200 205 Ile Pro Asn Ile Phe Gln Lys Ile Gln Glu Met Glu Glu Arg Arg Ile 210 215 220 Val Arg Met Gly Glu Ser Met Lys Thr Tyr Ala Glu Val Asp Arg Gln 225 230 235 240 Val Ile Pro Ile Ile Gly Lys Cys Leu Asp Gly Ile Val Lys Ala Ala 245 250 255 Glu Ser Ile Asp Gln Lys Asn Asp Ser Gln Leu Val Ile Glu Ala Tyr 260 265 270 Lys Ser Gly Phe Glu Pro Pro Gly Asp Ile Glu Phe Glu Asp Tyr Thr 275 280 285 Gln Pro Met Lys Arg Thr Val Ser Asp Asn Ser Leu Ser Asn Ser Arg 290 295 300 Gly Glu Gly Lys Pro Asp Leu Lys Phe Gly Gly Lys Ser Lys Gly Lys 305 310 315 320 Leu Trp Pro Phe Ile Lys Lys Asn Lys Leu Met Ser Leu Leu Thr Ser 325 330 335 Pro His Gln Pro Pro Pro Pro Pro Pro Ala Ser Ala Ser Pro Ser Ala 340 345 350 Val Pro Asn Gly Pro Gln Ser Pro Lys Gln Gln Lys Glu Pro Leu Ser 355 360 365 His Arg Phe Asn Glu Phe Met Thr Ser Lys Pro Lys Ile His Cys Phe 370 375 380 Arg Ser Leu Lys Arg Gly Leu Ser Leu Lys Leu Gly Ala Thr Pro Glu 385 390 395 400 Asp Phe Ser Asn Leu Pro Pro Glu Gln Arg Arg Lys Lys Leu Gln Gln 405 410 415 Lys Val Asp Glu Leu Asn Lys Glu Ile Gln Lys Glu Met Asp Gln Arg 420 425 430 Asp Ala Ile Thr Lys Met Lys Asp Val Tyr Leu Lys Asn Pro Gln Met 435 440 445 Gly Asp Pro Ala Ser Leu Asp His Lys Leu Ala Glu Val Ser Gln Asn 450 455 460 Ile Glu Lys Leu Arg Val Glu Thr Gln Lys Phe Glu Ala Trp Leu Ala 465 470 475 480 Glu Val Glu Gly Arg Leu Pro Ala Arg Ser Glu Gln Ala Arg Arg Gln 485 490 495 Ser Gly Leu Tyr Asp Ser Gln Asn Pro Pro Thr Val Asn Asn Cys Ala 500 505 510 Gln Asp Arg Glu Ser Pro Asp Gly Ser Tyr Thr Glu Glu Gln Ser Gln 515 520 525 Glu Ser Glu Met Lys Val Leu Ala Thr Asp Phe Asp Asp Glu Phe Asp 530 535 540 Asp Glu Glu Pro Leu Pro Ala Ile Gly Thr Cys Lys Ala Leu Tyr Thr 545 550 555 560 Phe Glu Gly Gln Asn Glu Gly Thr Ile Ser Val Val Glu Gly Glu Thr 565 570 575 Leu Tyr Val Ile Glu Glu Asp Lys Gly Asp Gly Trp Thr Arg Ile Arg 580 585 590 Arg Asn Glu Asp Glu Glu Gly Tyr Val Pro Thr Ser Tyr Val Glu Val 595 600 605 Cys Leu Asp Lys Asn Ala Lys Asp Ser 610 615 <210> SEQ ID NO 97 <211> LENGTH: 1402 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 97 Met His Gln Thr Leu Cys Leu Asn Pro Glu Ser Leu Lys Met Ser Ala 1 5 10 15 Cys Ser Asp Phe Val Glu His Ile Trp Lys Pro Gly Ser Cys Lys Asn 20 25 30 Cys Phe Cys Leu Arg Ser Asp His Gln Leu Val Ala Gly Pro Pro Gln 35 40 45 Pro Arg Ala Gly Ser Leu Pro Pro Pro Pro Arg Leu Pro Pro Arg Pro 50 55 60 Glu Asn Cys Arg Leu Glu Asp Glu Gly Val Asn Ser Ser Pro Tyr Ser 65 70 75 80 Lys Pro Thr Ile Ala Val Lys Pro Thr Met Met Ser Ser Glu Ala Ser 85 90 95 Asp Val Trp Thr Glu Ala Asn Leu Ser Ala Glu Val Ser Gln Val Ile 100 105 110 Trp Arg Arg Ala Pro Gly Lys Leu Pro Leu Pro Lys Gln Glu Asp Ala 115 120 125 Pro Val Val Tyr Leu Gly Ser Phe Arg Gly Val Gln Lys Pro Ala Gly 130 135 140 Pro Ser Thr Ser Pro Asp Gly Asn Ser Arg Cys Pro Pro Ala Tyr Thr 145 150 155 160 Met Val Gly Leu His Asn Leu Glu Pro Arg Gly Glu Arg Asn Ile Ala 165 170 175 Phe His Pro Val Ser Phe Pro Glu Glu Lys Ala Val His Lys Glu Lys 180 185 190 Pro Ser Phe Pro Tyr Gln Asp Arg Pro Ser Thr Gln Glu Ser Phe Arg 195 200 205 Gln Lys Leu Ala Ala Phe Ala Gly Thr Thr Ser Gly Cys His Gln Gly 210 215 220 Pro Gly Pro Leu Arg Glu Ser Leu Pro Ser Glu Asp Asp Ser Asp Gln 225 230 235 240 Arg Cys Ser Pro Ser Gly Asp Ser Glu Gly Gly Glu Tyr Cys Ser Ile 245 250 255 Leu Asp Cys Cys Pro Gly Ser Pro Val Ala Lys Ala Ala Ser Gln Thr 260 265 270 Ala Gly Ser Arg Gly Arg His Gly Gly Arg Asp Cys Ser Pro Thr Cys 275 280 285 Trp Glu Gln Gly Lys Cys Ser Gly Pro Ala Glu Gln Glu Lys Arg Gly 290 295 300 Pro Ser Phe Pro Lys Glu Cys Cys Ser Gln Gly Pro Thr Ala His Pro 305 310 315 320 Ser Cys Leu Gly Pro Lys Lys Leu Ser Leu Thr Ser Glu Ala Ala Ile 325 330 335 Ser Ser Asp Gly Leu Ser Cys Gly Ser Gly Ser Gly Ser Gly Ala Ser 340 345 350 Ser Pro Phe Val Pro His Leu Glu Ser Asp Tyr Cys Ser Leu Met Lys 355 360 365 Glu Pro Ala Pro Glu Lys Gln Gln Asp Pro Gly Cys Pro Gly Val Thr 370 375 380 Pro Ser Arg Cys Leu Gly Leu Thr Gly Glu Pro Gln Pro Pro Ala His 385 390 395 400 Pro Arg Glu Ala Thr Gln Pro Glu Pro Ile Tyr Ala Glu Ser Thr Lys 405 410 415 Arg Lys Lys Ala Ala Pro Val Pro Ser Lys Ser Gln Ala Lys Ile Glu 420 425 430 His Ala Ala Ala Ala Gln Gly Gln Gly Gln Val Cys Thr Gly Asn Ala 435 440 445 Trp Ala Gln Lys Ala Ala Ser Gly Trp Gly Arg Asp Ser Pro Asp Pro 450 455 460 Thr Pro Gln Val Ser Ala Thr Ile Thr Val Met Ala Ala His Pro Glu 465 470 475 480 Glu Asp His Arg Thr Ile Tyr Leu Ser Ser Pro Asp Ser Ala Val Gly 485 490 495 Val Gln Trp Pro Arg Gly Pro Val Ser Gln Asn Ser Glu Val Gly Glu 500 505 510 Glu Glu Thr Ser Ala Gly Gln Gly Leu Ser Ser Arg Glu Ser His Ala 515 520 525 His Ser Ala Ser Glu Ser Lys Pro Lys Glu Arg Pro Ala Ile Pro Pro 530 535 540 Lys Leu Ser Lys Ser Ser Pro Val Gly Ser Pro Val Ser Pro Ser Ala 545 550 555 560 Gly Gly Pro Pro Val Ser Pro Leu Ala Asp Leu Ser Asp Gly Ser Ser 565 570 575 Gly Gly Ser Ser Ile Gly Pro Gln Pro Pro Ser Gln Gly Pro Ala Asp 580 585 590 Pro Ala Pro Ser Cys Arg Thr Asn Gly Val Ala Ile Ser Asp Pro Ser 595 600 605 Arg Cys Pro Gln Pro Ala Ala Ser Ser Ala Ser Glu Gln Arg Arg Pro 610 615 620 Arg Phe Gln Ala Gly Thr Trp Ser Arg Gln Cys Arg Ile Glu Glu Glu 625 630 635 640 Glu Glu Val Glu Gln Glu Leu Leu Ser His Ser Trp Gly Arg Glu Thr 645 650 655 Lys Asn Gly Pro Thr Asp His Ser Asn Ser Thr Thr Trp His Arg Leu 660 665 670 His Pro Thr Asp Gly Ser Ser Gly Gln Asn Ser Lys Val Gly Thr Gly 675 680 685 Met Ser Lys Ser Ala Ser Phe Ala Phe Glu Phe Pro Lys Asp Arg Ser 690 695 700 Gly Ile Glu Thr Phe Ser Pro Pro Pro Pro Pro Pro Lys Ser Arg His 705 710 715 720 Leu Leu Lys Met Asn Lys Ser Ser Ser Asp Leu Glu Lys Val Ser Gln 725 730 735 Gly Ser Ala Glu Ser Leu Ser Pro Ser Phe Arg Gly Val His Val Ser 740 745 750 Phe Thr Thr Gly Ser Thr Asp Ser Leu Ala Ser Asp Ser Arg Thr Cys 755 760 765 Ser Asp Gly Gly Pro Ser Ser Glu Leu Ala His Ser Pro Thr Asn Ser 770 775 780 Gly Lys Lys Leu Phe Ala Pro Val Pro Phe Pro Ser Gly Ser Thr Glu 785 790 795 800 Asp Val Ser Pro Ser Gly Pro Gln Gln Pro Pro Pro Leu Pro Gln Lys 805 810 815 Lys Ile Val Ser Arg Ala Ala Ser Ser Pro Asp Gly Phe Phe Trp Thr 820 825 830 Gln Gly Ser Pro Lys Pro Gly Thr Ala Ser Pro Lys Leu Asn Leu Ser 835 840 845 His Ser Glu Thr Asn Val His Asp Glu Ser His Phe Ser Tyr Ser Leu 850 855 860 Ser Pro Gly Asn Arg His His Pro Val Phe Ser Ser Ser Asp Pro Leu 865 870 875 880 Glu Lys Ala Phe Lys Gly Ser Gly His Trp Leu Pro Ala Ala Gly Leu 885 890 895 Ala Gly Asn Arg Gly Gly Cys Gly Ser Pro Gly Leu Gln Cys Lys Gly 900 905 910 Ala Pro Ser Ala Ser Ser Ser Gln Leu Ser Val Ser Ser Gln Ala Ser 915 920 925 Thr Gly Ser Thr Gln Leu Gln Leu His Gly Leu Leu Ser Asn Ile Ser 930 935 940 Ser Lys Glu Gly Thr Tyr Ala Lys Leu Gly Gly Leu Tyr Thr Gln Ser 945 950 955 960 Leu Ala Arg Leu Val Ala Lys Cys Glu Asp Leu Phe Met Gly Gly Gln 965 970 975 Lys Lys Glu Leu His Phe Asn Glu Asn Asn Trp Ser Leu Phe Lys Leu 980 985 990 Thr Cys Asn Lys Pro Cys Cys Asp Ser Gly Asp Ala Ile Tyr Tyr Cys 995 1000 1005 Ala Thr Cys Ser Glu Asp Pro Gly Ser Thr Tyr Ala Val Lys Ile 1010 1015 1020 Cys Lys Ala Pro Glu Pro Lys Thr Val Ser Tyr Cys Ser Pro Ser 1025 1030 1035 Val Pro Val His Phe Asn Ile Gln Gln Asp Cys Gly His Phe Val 1040 1045 1050 Ala Ser Val Pro Ser Ser Met Leu Ser Ser Pro Asp Ala Pro Lys 1055 1060 1065 Asp Pro Val Pro Ala Leu Pro Thr His Pro Pro Ala Gln Glu Gln 1070 1075 1080 Asp Cys Val Val Val Ile Thr Arg Glu Val Pro His Gln Thr Ala 1085 1090 1095 Ser Asp Phe Val Arg Asp Ser Ala Ala Ser His Gln Ala Glu Pro 1100 1105 1110 Glu Ala Tyr Glu Arg Arg Val Cys Phe Leu Leu Leu Gln Leu Cys 1115 1120 1125 Asn Gly Leu Glu His Leu Lys Glu His Gly Ile Ile His Arg Asp 1130 1135 1140 Leu Cys Leu Glu Asn Leu Leu Leu Val His Cys Thr Leu Gln Ala 1145 1150 1155 Gly Pro Gly Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Ala Ala 1160 1165 1170 Ala Pro Pro Cys Ser Ser Ala Ala Pro Pro Ala Gly Gly Thr Leu 1175 1180 1185 Ser Pro Ala Ala Gly Pro Ala Ser Pro Glu Gly Pro Arg Glu Lys 1190 1195 1200 Gln Leu Pro Arg Leu Ile Ile Ser Asn Phe Leu Lys Ala Lys Gln 1205 1210 1215 Lys Pro Gly Gly Thr Pro Asn Leu Gln Gln Lys Lys Ser Gln Ala 1220 1225 1230 Arg Leu Ala Pro Glu Ile Val Ser Ala Ser Gln Tyr Arg Lys Phe 1235 1240 1245 Asp Glu Phe Gln Thr Gly Ile Leu Ile Tyr Glu Leu Leu His Gln 1250 1255 1260 Pro Asn Pro Phe Glu Val Arg Ala Gln Leu Arg Glu Arg Asp Tyr 1265 1270 1275 Arg Gln Glu Asp Leu Pro Pro Leu Pro Ala Leu Ser Leu Tyr Ser 1280 1285 1290 Pro Gly Leu Gln Gln Leu Ala His Leu Leu Leu Glu Ala Asp Pro 1295 1300 1305 Ile Lys Arg Ile Arg Ile Gly Glu Ala Lys Arg Val Leu Gln Cys 1310 1315 1320 Leu Leu Trp Gly Pro Arg Arg Glu Leu Val Gln Gln Pro Gly Thr 1325 1330 1335 Ser Glu Glu Ala Leu Cys Gly Thr Leu His Asn Trp Ile Asp Met 1340 1345 1350 Lys Arg Ala Leu Met Met Met Lys Phe Ala Glu Lys Ala Val Asp 1355 1360 1365 Arg Arg Arg Gly Val Glu Leu Glu Asp Trp Leu Cys Cys Gln Tyr 1370 1375 1380 Leu Ala Ser Ala Glu Pro Gly Ala Leu Leu Gln Ser Leu Lys Leu 1385 1390 1395 Leu Gln Leu Leu 1400 <210> SEQ ID NO 98 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Mus musculus <400> SEQUENCE: 98 caggatccat tctggaagat ctgaacatgc tg 32 <210> SEQ ID NO 99 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Mus musculus <400> SEQUENCE: 99 cagaattcgc ccccaccagt tttttcgag 29 <210> SEQ ID NO 100 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 100 accgaattcg aagctgagca atatttctcg 30 <210> SEQ ID NO 101 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 101 accgaattct caacattgtg tattagcttt ctttctata 39 <210> SEQ ID NO 102 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 102 caggatcctc tgcatcatat ggggatgat 29 <210> SEQ ID NO 103 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 103 cagaattctc atagaataca aagagcagaa ag 32 <210> SEQ ID NO 104 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 104 caggatccaa agagaaagag cggccagaga t 31 <210> SEQ ID NO 105 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 105 cagaattctc aacactcagc tgacttatct gtaaagctc 39 <210> SEQ ID NO 106 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 106 caggatccaa gcaccccgac accaagaag 29 <210> SEQ ID NO 107 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 107 cagaattcac ccagtggtgc ttatatggac c 31 <210> SEQ ID NO 108 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 108 caggatccga catccagaac cctgacatca cg 32 <210> SEQ ID NO 109 <211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 109 cagaattctc aacatcgaga tggcggtggg ggcggc 36 <210> SEQ ID NO 110 <211> LENGTH: 24 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 110 Cys Asp Glu His Thr Arg Arg Glu Leu Ala Lys Met Lys Gln Glu Pro 1 5 10 15 Val Lys Pro Glu Glu Gly Arg Asp 20 <210> SEQ ID NO 111 <211> LENGTH: 261 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 111 atcctggagg acctcaatat gctctacatc cggcagatgg cactcagcct ggaggacaca 60 gacctgcaga ggaaactaga tcatgagatc cggatgaggg atggggcctg caagctgctg 120 gcagcctgct cccagcgaga gcaggctctg gaagccacca agagcctgct ggtgtgcaac 180 agccgtattc tcagctacat gggtgagctg cagcggcgaa aggaggccca ggtgctggag 240 aagacaggca ggcgaccttc g 261 <210> SEQ ID NO 112 <211> LENGTH: 87 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 112 Ile Leu Glu Asp Leu Asn Met Leu Tyr Ile Arg Gln Met Ala Leu Ser 1 5 10 15 Leu Glu Asp Thr Glu Leu Gln Arg Lys Leu Asp His Glu Ile Arg Met 20 25 30 Arg Asp Gly Ala Cys Lys Leu Leu Ala Ala Cys Ser Gln Arg Glu Gln 35 40 45 Ala Leu Glu Ala Thr Lys Ser Leu Leu Val Cys Asn Ser Arg Ile Leu 50 55 60 Ser Tyr Met Gly Glu Leu Gln Arg Arg Lys Glu Ala Gln Val Leu Glu 65 70 75 80 Lys Thr Gly Arg Arg Pro Ser 85 <210> SEQ ID NO 113 <211> LENGTH: 261 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 113 attctggaag atctgaacat gctgtacatt cggcagatgg cgctgtcttt agaagatacg 60 gaacttcaac gtaaattaga tcatgaaatc cgcatgcgtg atggtgccga aaaactcctg 120 gccgcgttgt cccagagaga acaggcactg gaagcaacca aatcattgct ggtgtcgaat 180 agccgtatcc tgagttatat gggcgaactt cagcgccgca aagaagcaca agttctcgaa 240 aaaactggtg ggggctgcta a 261 <210> SEQ ID NO 114 <211> LENGTH: 87 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 114 Ile Leu Glu Asp Leu Asn Met Leu Tyr Ile Arg Gln Met Ala Leu Ser 1 5 10 15 Leu Glu Asp Thr Glu Leu Gln Arg Lys Leu Asp His Glu Ile Arg Met 20 25 30 Arg Asp Gly Ala Glu Lys Leu Leu Ala Ala Leu Ser Gln Arg Glu Gln 35 40 45 Ala Leu Glu Ala Thr Lys Ser Leu Leu Val Ser Asn Ser Arg Ile Leu 50 55 60 Ser Tyr Met Gly Glu Leu Gln Arg Arg Lys Glu Ala Gln Val Leu Glu 65 70 75 80 Lys Thr Gly Arg Arg Cys Ser 85

Claims

1. A method for detecting an activated Rho GTPase protein comprising:contacting a solid support with a sample comprising an activated Rho GTPase protein, wherein the solid support is linked to an activated Rho GTPase binding peptide, and wherein the activated Rho GTPase in the sample binds the activated Rho GTPase binding peptide;attenuating Rho GTPase protein loss from the solid support by one of the following:adding methanol, ethanol, sodium dodecyl sulfate, or urea;heat denaturation; orheat denaturation in the presence of urea; anddetecting the activated Rho GTPase protein in the sample, wherein the activated Rho GTPase protein remains associated with the solid support during the detection;wherein prior to detecting the activated Rho GTPase protein in the sample, a Binding Buffer is added when the Rho GTPase binding peptide is ROCK1 or ROCK2.

2. The method of claim 1 wherein the sample comprises a cell lysate comprising endogenous activated Rho GTPase protein.

3. The method of claim 2 wherein the sample comprises less than 50 μg of total protein.

4. The method of claim 2 wherein the cell lysate is prepared from less than 10.sup.5 cells.

5. The method of claim 2 wherein the cell lysate has not been clarified.

6-8. (canceled)

9. The method of claim 1 wherein prior to detecting the activated Rho GTPase protein in the sample, a Binding Buffer is added.

10. The method of claim 9 wherein the Binding Buffer comprises ficoll, dextran, or polyethylene glycol, or any combination thereof.

11. The method of claim 10 wherein the polyethylene glycol is PEG 4000 or PEG 8000 at a final concentration of about 2% to about 40% v/v.

12. The method of claim 1 wherein the activated Rho GTPase protein is detected using an antibody specific for one or more activated Rho GTPase proteins.

13. (canceled)

14. The method of claim 1 wherein the sample comprises exogenous GTP, GDP or GTPγS.

15. The method of claim 1 wherein the activated Rho GTPase protein is RhoA, RhoB, RhoC, RhoD, Rnd1, Rnd2, Rnd3, Rif, RhoG, Rac1, Rac1b, Rac2, Rac3, Cdc42, TC10, TCL, Wrch-1, Wrch-2, RhoBTB1, or RhoBTB2.

16. (canceled)

17. The method of claim 1 wherein the activated Rho GTPase binding peptide is a Rhotekin, ROCK1, PAK1, POSH, WASP, or Dia1, or a mutant or multimer of the same.

18-19. (canceled)

20. The method of claim 1 wherein the activated Rho GTPase binding peptide is lyophilized.

21. The method of claim 1 wherein the solid support is a microtiter plate or microarray.

22. The method of claim 1 further comprising quantitating the amount of activated Rho GTPase protein bound to the activated Rho GTPase binding peptide.

23. (canceled)

24. The method of claim 1 wherein detection of the activated Rho GTPase protein is carried out by detecting an interaction between the activated Rho GTPase protein and the activated Rho GTPase binding peptide using absorbance, luminescence, or fluorescence.

25. (canceled)

26. A kit comprising:a solid support;an activated Rho GTPase binding peptide optionally linked to the solid support; andan Antigen Presenting Buffer.

27. The kit of claim 26 wherein the solid support is a microtiter plate or microarray.

28. The kit of claim 26 wherein the activated Rho GTPase binding peptide is a Rhotekin, ROCK1, PAK1, POSH, WASP, or Dia1.

29. The kit of claim 26 wherein the activated Rho GTPase binding peptide is an RBD domain.

30. The kit of claim 26 wherein the Antigen Presenting Buffer is urea, ethanol, methanol, or tricholoracetic acid.

31. The kit of claim 26 further comprising a positive control comprising an activated Rho GTPase protein that can bind to the Rho GTPase binding peptide.

32. The kit of claim 26 further comprising a Binding Buffer.

33. The kit of claim 32 wherein the Binding Buffer comprises ficoll, dextran, or polyethylene glycol, or any combination thereof.

34. The kit of claim 26 further comprising instructions.

35. The kit of claim 26 further comprising an agent for detecting binding between the Rho GTPase binding peptide and an activated Rho GTPase protein.

Images