Patent application title: Antimicrobial protein derived from podoviriedae bacteriophage specific to staphylococcus aureus
Inventors:
Seongjun Yoon (Seoul, KR)
Yunjaie Choi (Seoul, KR)
Seyung Lee (Pyeongtaek-Si, KR)
Jeesoo Son (Seoul, KR)
Sooyoun Jun (Seoul, KR)
Sanghyeon Kang (Seoul, KR)
Assignees:
INTRON BIOTECHNOLOGY, INC.
IPC8 Class: AA61K3816FI
USPC Class:
424780
Class name: Drug, bio-affecting and body treating compositions extract or material containing or obtained from a micro-organism as active ingredient (e.g., bacteria, protozoa, etc.)
Publication date: 2010-08-12
Patent application number: 20100203180
Claims:
1. An antimicrobial protein having killing activity specific to
Staphylococcus aureus represented by the amino acid sequence represented
by SEQ. ID. NO: 3.
2. The antimicrobial protein according to claim 1, wherein the antimicrobial protein is originated from the Podoviridae bacteriophage (Accession No: KCTC 11154BP).
3. A gene encoding the antimicrobial protein of claim 1.
4. The gene according to claim 3, wherein the gene has the nucleotide sequence represented by SEQ. ID. NO: 2.
5. An E. coli transformant (Accession No: KCTC 11152BP) for the production of an antimicrobial protein overexpressing the gene of claim 3.
6. An E. coli transformant (Accession No: KCTC 11152BP) for the production of an antimicrobial protein overexpressing the gene of claim 4.
7. A pharmaceutical composition for the prevention and treatment of the disease caused by Staphylococcus aureus, containing the antimicrobial protein of claim 1 as an active ingredient.
8. A pharmaceutical composition for the prevention and treatment of the disease caused by Staphylococcus aureus, containing the antimicrobial protein of claim 2 as an active ingredient.
9. The pharmaceutical composition according to claim 7, wherein the disease caused by Staphylococcus aureus is selected from the group consisting of mastitis, acute dermatitis, sepsis, pyogenic disease, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis and enteritis.
10. The pharmaceutical composition according to claim 8, wherein the disease caused by Staphylococcus aureus is selected from the group consisting of mastitis, acute dermatitis, sepsis, pyogenic disease, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis and enteritis.
11. An antibiotic containing the antimicrobial protein of claim 1 as an active ingredient.
12. An antibiotic containing the antimicrobial protein of claim 2 as an active ingredient.
13. A disinfectant containing the antimicrobial protein of claim 1 as an active ingredient.
14. A disinfectant containing the antimicrobial protein of claim 2 as an active ingredient.
Description:
TECHNICAL FIELD
[0001]The present invention relates to a novel antimicrobial protein derived from Podoviridae bacteriophage having killing activity (lytic activity, antimicrobial activity) specific to Staphylococcus aureus.
BACKGROUND ART
[0002]Bacteriophage is a kind of virus-like microorganism infecting bacteria and generally called `phage` in short. Bacteriophage is an organism having a simple structure wherein a central genetic material composed of nucleic acid is covered by a protein envelope. The nucleic acid is single stranded or double stranded DNA or RNA. To survive, bacteriophage needs a host bacterium and every bacterium has a specific partner bacteriophage. When bacteriophage invades into a host bacterium, it multiplicates itself and then induces expressions of enzymes involved in the decomposition of cell wall of the host bacterium. The enzymes destroy cell wall by attacking the peptidoglycan layer which is responsible for rigidity and mechanical strength of cell wall.
[0003]Bacteriophage was first found by Twort, an English bacteriologist, in 1915 during his research on the phenomenon that micrococcus colony is decomposed turning transparent by something. And in 1917, a French bacteriologist d'Herelle found out that there was something that decomposes Shigella disentriae in filtrate of feces of a patient with dysentery, and he continued to study to identify the material, leading to the finding of bacteriophage which means "eating bacteria". Since then, bacteriophages against Shigella dysenteriae, Salmonella typhi, and Vibrio cholerae were further identified. Since penicillin was found by Flemming in 1950, antibiotics have been widely used and the study on bacteriophage continued only in some East European countries and it became out of concern in many other countries. However, since 2000, multidrug-resistant pathogenic bacteria resulted from over-use and/or mis-use of antibiotics have been frequently reported. Because of potential as an alternative for the conventional antibiotics, bacteriophage became in the spotlight again and the studies on bacteriophage are actively undergoing led by advanced countries.
[0004]Even though antibiotics (or antibacterial agents) are still major therapeutic agents for the treatment of various infectious diseases, it has been a serious problem since 1980s that the excessive use of such antibiotics generates numbers of multi-drug resistant strains. In 1986, Staphylococcus aureus having resistance against vancomycin, which is so called `the drug of last resort`, and other multi-drug resistant strains were found, giving a great shock to those in medical field. Vancomycin resistant enterococci (VRE) were first reported in France in 1986 and first separated in USA in 1988. Since then, the cases of VRE infection have been increased every year with high frequency, everywhere including Europe, USA, Singapore, Japan, Australia, Korea, etc, making the VRE as a causal agent of nosocomial infections. In Korea, VRE was first isolated in 1992. As for Staphylococcus aureus, vancomycin-resistant Staphylococcus aureus (VRSA) was first found in the early 1990s and was first found in Korea in June, 1996.
[0005]Therefore, it is an urgent request to develop a novel antibiotic to treat the infectious diseases caused by bacteria resistant against conventional antibiotics and further to lead national health and medical techniques. Again, it is urgently required to develop an alternative antibiotic to solve the problems of multi-drug resistant bacteria along with the abuse or misuse of the conventional antibiotics and the bio-accumulation of antibiotics. To solve the problem of such resistant bacteria, an alternative antibiotic has to be developed by a completely and fundamentally different method.
[0006]The present inventors isolated novel bacteriophage capable of killing specifically Staphylococcus aureus, and deposited the bacteriophage at Korean Agricultural Culture Collection, National Institute of Agricultural Biotechnology on Jun. 14, 2006 (Accession No: KACC 97001P) and at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11153BP). The related matters have been applied for a patent (Korean Patent Application No. 2006-55461). The present inventors continued the study and as a result isolated another effective bacteriophage, and then deposited the isolated bacteriophage at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11154BP).
[0007]Even if the said two bacteriophages are effective in prevention and treatment of infectious disease caused by Staphylococcus aureus, they still have a few disadvantages. Direct application of bacteriophage, which means the bacteriophage itself is directly used, raises vague aversion, leading to the limitation in use. In addition, to obtain bacteriophage for direct use massively, it is important and necessary to culture host pathogenic bacteria, indicating that there is a high chance of exposure of a worker on pathogenic bacteria. So, a very strict pathogenic bacteria regulation is required. Accordingly it is required to develop a novel substance having characteristics of bacteriophage and capable of killing Staphylococcus aureus in safer way and facilitating wider application.
[0008]The present inventors applied for a patent describing a novel antibacterial protein originated from the bacteriophage capable of killing specifically Staphylococcus aureus based on the genetic information thereon (Korean Patent Application No. 2006-73562). It was demonstrated that lytic protein had same lytic effect as that of an endogenous lytic protein in a host when it is extracellularly treated and has a broader bactericidal activity compared to the corresponding bacteriophage itself.
[0009]However, like bacteriophage, such antimicrobial proteins take different bacteria as their targets and are different in their antimicrobial spectrum. Thus, it is required to obtain in variety of antimicrobial proteins.
[0010]As described hereinbefore, lytic protein (antibacterial protein) derived from bacteriophage is a protein that destroys cell wall of a host bacterium when the bacteriophage comes out of the host bacterium. Such lytic protein derived from bacteriophage is generally called lysin. The lytic protein, lysin, is composed of N-terminal catalytic domain and C-terminal binding domain and these two domains are linked by a short linker. Lysin can have two different catalytic domains, which is a rare case, though. C-terminal binding domain is conjugated with cell wall of target bacteria. The catalytic regions of lysin are conserved when they are in the same class according to Linne's hierarchical classification system but binding domains are different. Such variability of binding domain makes difference in bacteriolytic effect among lytic proteins.
[0011]So, preparing an additional lytic protein as described in this invention paves the way to cope with more Staphylococcus aureus and a cocktail of those lytic proteins is expected to bring broader antimicrobial effect, compared with a single lytic protein.
DISCLOSURE
Technical Problem
[0012]The present inventors completed this invention by providing a novel antimicrobial protein having killing activity specific to Staphylococcus aureus, and further by confirming that this novel antimicrobial protein specific to Staphylococcus aureus can be effectively used for the prevention and treatment of disease caused by Staphylococcus aureus.
[0013]Therefore, it is an object of the present invention to provide a novel antimicrobial protein having killing activity specific to Staphylococcus aureus, the causing agent of infectious disease in human and animals.
[0014]It is another object of the present invention to provide a pharmaceutical composition for the prevention and treatment of infectious disease caused by Staphylococcus aureus containing the antimicrobial protein as an active ingredient.
[0015]It is a further object of the present invention to provide an antibiotic containing the antimicrobial protein as an active ingredient.
[0016]It is also an object of the present invention to provide a disinfectant containing the antimicrobial protein as an active ingredient.
Technical Solution
[0017]The present invention provides an antimicrobial protein having killing activity specific to Staphylococcus aureus and having the amino acid sequence represented by SEQ. ID. NO: 3, and a gene encoding the same.
[0018]In this description, the term `antimicrobial activity` includes the activities resulted from lysis action and/or other antimicrobial mechanisms.
[0019]Staphylococcus aureus is a causing agent of skin infection and food poisoning. It was reported that Staphylococcus aureus isolated in Korea had resistance against methicillin as high as 73% at average, which is the top level in the world. That means 73% of Staphylococcus aureus cannot be killed by methicillin and this bacterium is highly antibiotic resistant.
[0020]Staphylococcus aureus is the number one pathogenic bacterium to cause infectious mastitis in cattle. Staphylococcus aureus is found in 90% of the total dairy cows in USA and the dairy cow infected by this pathogenic bacterium in total dairy cows is estimated to be 10%. Staphylococcus aureus is a causing agent of acute dermatitis in human, and this acute dermatitis can be suddenly developed into sepsis taking a patient's life. Staphylococcus aureus is also a causing agent of pyogenic disease, sweat odor and food poisoning.
[0021]The present inventors have endeavored to kill Staphylococcus aureus selectively. The inventors isolated Staphylococcus aureus from pathogen and a novel Podoviridae bacteriophage that is able to kill the isolated Staphylococcus aureus selectively. This novel bacteriophage having killing activity specific to Staphylococcus aureus, isolated by the inventors, was named `SAP-2` and deposited at Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11154BP).
[0022]The present inventors completed this invention by providing a novel antimicrobial protein capable of killing Staphylococcus aureus specifically based on the genetic information of the Staphylococcus aureus specific bacteriophage SAP-2 (Accession No: KCTC 11154BP) and by confirming that the Staphylococcus aureus specific antimicrobial protein can be efficiently used for the prevention and treatment of disease caused by Staphylococcus aureus.
[0023]The present inventors found out a gene encoding an antimicrobial protein from the genome of the bacteriophage SAP-2, with which the inventors produced and purified an antimicrobial protein utilizing molecular biological and biotechnological techniques. The antimicrobial protein has the amino acid sequence represented by SEQ. ID. NO: 3 and the gene encoding the protein has the nucleotide sequence represented by SEQ. ID. NO: 2.
[0024]The present invention also provides an E. coli transformant (Accession No: KCTC 11152BP) for the production of an antimicrobial protein capable of killing Staphylococcus aureus specifically.
[0025]The present inventors constructed an E. coli transformant overexpressing the antimicrobial protein (SEQ. ID. NO: 3) and named it `pBAD::lysinM`, which was deposited at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11152BP). The said E. coli transformant contains a protein having excellent antimicrobial activity. Therefore, the product obtained by culturing the transformant can be effectively used for the prevention and treatment of infectious disease caused by Staphylococcus aureus.
[0026]The present invention also provides a pharmaceutical composition for the prevention and treatment of infectious disease caused by Staphylococcus aureus containing the antimicrobial protein originated from the bacteriophage SAP-2 as an active ingredient.
[0027]The term `treatment` herein indicates (i) the prevention of the infectious disease caused by Staphylococcus aureus; (ii) the suppression of the infectious disease caused by Staphylococcus aureus; and (iii) the relief of the infectious disease caused by Staphylococcus aureus.
[0028]As explained hereinbefore, the antimicrobial protein included in the pharmaceutical composition of the present invention has killing activity specific to Staphylococcus aureus. Thus, the pharmaceutical composition of the present invention can be used for the treatment of various diseases caused by Staphylococcus aureus such as mastitis, acute dermatitis, sepsis, pyogenic disease, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis and enteritis. According to a preferred embodiment of the present invention, everyday spray of the antimicrobial protein solution of the invention on the lesion of dairy cow with mastitis could significantly reduce the symptoms of mastitis, suggesting that the antimicrobial protein of the invention is effective in the treatment of mastitis.
[0029]The pharmaceutical composition of the present invention can additionally include a pharmaceutically acceptable carrier, which is exemplified by lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but not always limited thereto. The pharmaceutical composition of the present invention can also include a lubricant, a wetting agent, a sweetener, a flavor, an emulsifier, a suspending agent, and a preservative, in addition to the above ingredients.
[0030]The pharmaceutical composition of the present invention can be applied or sprayed on the lesion, and administered orally or parenterally (for example, intravenous, intramuscular, hypodermic, local or peritoneal injection).
[0031]The effective dosage of the pharmaceutical composition of the present invention varies from the formulation, administration pathway, age, weight and gender of animal or human with a disease caused by Staphylococcus aureus, severity of a disease, diet, administration frequency and pathway, excretion and sensitivity. In general, the dosage can be determined by an experienced doctor with consideration of the goal of the treatment or preventive effect. In general, the pharmaceutical composition of the invention contains the antimicrobial protein at the concentration of 0.0001-10% (w/v), preferably 0.001-1% (w/v), and more preferably 0.1% (w/v).
[0032]The pharmaceutical composition of the present invention can be formulated as a unit dose medicine or as a medicine in multidose vehicle by mixing with a pharmaceutically acceptable carrier and/or excipient by the method well known to those in the art. The pharmaceutical formulation can be selected from a group consisting of ointments, solutions, suspensions or emulsions, extracts, powders, granules, tablets or capsules and additionally includes a dispersing agent or a stabilizing agent.
[0033]In another preferred embodiment of the present invention, the present invention provides an antibiotic comprising the antimicrobial protein originated from the bacteriophage SAP-2 as an active ingredient.
[0034]The term `antibiotic` is used herein as a general term for antiseptics, bactericidal agents and antibacterial agents.
[0035]Staphylococcus aureus is frequently found in cosmetics along with Bacillus subtilis, E. coli and Pseudomonas aeruginosa. Cosmetics use oil or water as a major ingredient, to which glycerin and sorbitol, which are carbon sources of a microorganism, and amino acid derivatives and a protein which are nitrogen sources of a microorganism, are added, suggesting that there are enough nutrition and ingredients to attract microorganisms including bacteria. In addition, the term of use of the cosmetics is comparatively long, indicating that it is in high risk of contamination by a microorganism. To prevent color changes or odor changes caused by the contamination of a microorganism, an antibacterial agent is necessarily added to cosmetics for a long shelf-life.
[0036]A synthetic antiseptic such as parabens is widely used as an additive for cosmetics, but it is potentially dangerous. Particularly, since its accumulation in breast cancer cells was detected, it has been recognized that the accumulation of such synthetic antiseptic via cosmetics might be very harmful. The American Academy of Dermatology's Committee listed the synthetic antiseptic as the number two allergen causing skin trouble. Recently what worries us is that cosmetics for children also includes such artificial synthetic antiseptic, suggesting that children are exposed on such harmful antiseptic longer and much, raising the risk seriously. Therefore, it is sincerely requested to develop a natural antiseptic.
[0037]The antimicrobial protein originated from the bacteriophage SAP-2 of the present invention is characterized by its high specificity to Staphylococcus aureus, compared with other conventional antibiotics. That is, the antimicrobial protein originated from the bacteriophage can selectively kill Staphylococcus aureus only without killing useful bacteria, suggesting that it is a highly valuable antibiotic that has fewer side effects. The antimicrobial protein of the present invention is effective against wider variety of Staphylococcus aureus than the bacteriophage itself where the protein is derived (that is, the antimicrobial protein has broad activity spectrum).
[0038]The bacteriophage SAP-2 originated antimicrobial protein-based antibiotics, unlike the conventional antibiotics, do not induce resistance so that their life cycles are comparatively long. Most conventional antibiotics are gradually limited in use because of the increasing resistance. On the other hand, the antibiotic containing the antimicrobial protein of the invention as an active ingredient can solve the problem of the antibiotic-resistance and thus has longer life cycling. Therefore, the antibiotic containing the antimicrobial protein of the invention as an active ingredient that is able to kill Staphylococcus aureus selectively can be effectively used as a novel antibiotic with excellent antibacterial, bactericidal and antiseptic effects.
[0039]In another preferred embodiment of the present invention, the present invention provides a disinfectant comprising the antimicrobial protein originated from the bacteriophage SAP-2 as an active ingredient.
[0040]The distribution of bacteria isolated from nosocomial infection has been changed over time. According to a report of NNIS (National Nosocomial Infection Surveillance System), USA, Gram-positive bacteria particularly Staphylococcus aureus have been increasing in number among those isolated bacteria since late 1980s, and this phenomenon is consistent with that in Korea. According to a report made in Korea, the dominant distribution is E. coli, Pseudomonas aeruginosa, coagulase negative Staphylococcus and Staphylococcus aureus follow in that order. But, the isolation of Staphylococcus aureus is increasing gradually. Korean Society for Nosocomial Infection Control (KSNIC) reported in 1996 that Staphylococcus aureus took 17.2% of total isolated pathogenic microorganisms and Pseudomonas aeruginosa (13.8%) and E. coli (12.3%) followed. And, 78.8% of the total Staphylococcus aureus isolated were confirmed to have resistance against antibiotics.
[0041]Based on the above finding, the disinfectant containing the antimicrobial protein originated from the bacteriophage SAP-2 of the present invention that is able to kill specifically Staphylococcus aureus can be effectively used as a disinfectant specifically for hospitals and public health. It is also available as a general life disinfectant, a food and kitchen disinfectant, and a stall disinfectant. Moreover, the disinfectant of the invention does not use bacteriophage itself (microorganism), but use protein, which people can accept for food and cooking without aversion to it.
Advantageous Effect
[0042]As explained hereinbefore, the antimicrobial protein originated from the bacteriophage SAP-2 of the present invention can selectively kill Staphylococcus aureus, so that it can be widely used as a preventive and therapeutic agent for infectious disease caused by Staphylococcus aureus, as an antibiotic, as an antibacterial agent for cosmetics, as a natural antiseptic, and as a multi-purpose disinfectant.
DESCRIPTION OF DRAWINGS
[0043]The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:
[0044]FIG. 1 is a photograph showing the result of plaque assay for detection of a bacteriophage specific to Staphylococcus aureus.
[0045]FIG. 2 is a schematic diagram illustrating the isolation procedure of the bacteriophage having killing activity specific to Staphylococcus aureus.
[0046]FIG. 3 is an electron microphotograph showing the Staphylococcus aureus specific bacteriophage isolated through plaque assay.
[0047]FIG. 4 is a photograph showing the characteristics of the genome extracted from bacteriophage. Lane g: genome treated with nothing; Lane D: genome treated with DNase; Lane R: genome treated with RNase A; Lane MB: genome treated with mung bean nuclease; and Lane M: molecular size marker.
[0048]FIG. 5 is a photograph showing the digestion pattern of the genome extracted from bacteriophage by restriction enzymes. Lane M1: molecular size marker; Lane 1: digestion pattern by Sal; Lane 2: digestion pattern by Nde; Lane 3: digestion pattern by Mbo I; Lane 4: digestion pattern by Dra; Lane 5: digestion pattern by BamHI; Lane 6: digestion pattern by Acc I; Lane 7: gDNA of bacteriophage SAP-2; and Lane M2: molecular size marker.
[0049]FIG. 6 is a schematic diagram illustrating the construction procedure of the genomic library of the bacteriophage.
[0050]FIG. 7 is a photograph showing the result of protein electrophoresis with the expressed antimicrobial protein. Lane M: protein size marker (198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, and 9 kDa, from the top); and Lanes 1: cell lysate containing expressed antimicrobial protein. `*` indicates the location of over-expressed antimicrobial protein.
[0051]FIG. 8 is a set of photographs showing the results of the investigation of lytic activity against three strains of Staphylococcus aureus clinically isolated. Staphylococcus aureus used for the above three experiments was all different kinds and the clear plaque was generated by bacteriolytic activity of the lytic protein of the present invention.
[0052]FIG. 9 illustrates the bacteriolytic activity of each lytic protein against Staphylococcus aureus, more precisely against 5 kinds of Staphylococcus aureus isolated from dairy cows with mastitis and 3 kinds of Staphylococcus aureus isolated from human. Phage: treated with bacteriophage SAP-2; and Lysin: treated with the bacteriophage SAP-2 originated antimicrobial protein.
[0053]FIG. 10 is an electrophoresis photograph illustrating the purified antimicrobial protein. Lane M: protein size marker (from the top, 198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, and 9 kDa); Lane 1: lysate before purification; and Lane 2: protein sample after purification. The dark stained band indicates the location of the over-expressed antimicrobial protein.
MODE FOR INVENTION
[0054]Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.
[0055]However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
Example 1
Isolation of Staphylococcus Aureus and Bacteriophage Having Killing Activity Specific to Staphylococcus Aureus
<1-1> Isolation of Staphylococcus Aureus
[0056]Bacteriophages generally live together with bacteria in natural system. To isolate the bacteriophage specifically infecting Staphylococcus aureus, samples were collected from everywhere where the inventors expected Staphylococcus aureus lives. To investigate the samples where Staphylococcus aureus really exists, the Baird-Parker agar medium, a Staphylococcus aureus selection medium, was used.
[0057]Particularly, the present inventors selected bovine mastitis as a target disease to isolate Staphylococcus aureus, the target microorganism. Mastitis is one of the most representative diseases caused by Staphylococcus aureus. Samples were taken from milk of a dairy cow with mastitis and Staphylococcus aureus was isolated therefrom using the Baird-Parker agar medium, a Staphylococcus aureus selection medium. The isolated Staphylococcus aureus was identified as Staphylococcus aureus by biochemical analysis including Gram staining method, catalase test and analysis with Vitek of bioMeriuex. The results are shown in Table 1.
TABLE-US-00001 TABLE 1 Vitek ID 200000-0 (A1-18) catalase + Coagulase+ Type Gram positive identification card (GPI) Condition Final Time 5 hours Organism Staphylococcus aureus PB + BAC - OPT + HCS + 6NC + 10B + 40B - ESC - ARG - URE - TZR + NOV - DEX + LAC + MAN + RAF - SAL - SOR - SUC + TRE + ARA - PYR + PUL - INU - MEL - MLZ - CEL - RIB - XYL - CAT + BH/CO+
<1-2> Isolation of the Staphylococcus Aureus Specific Bacteriophage
[0058]To isolate the Staphylococcus aureus specific bacteriophage, samples expected to contain the bacteriophage were cultured together with Staphylococcus aureus. The culture broth was centrifuged, filtered and then cultured again with Staphylococcus aureus, the bait for the isolation of the bacteriophage, and then lysis of Staphylococcus aureus was investigated by plaque assay.
[0059]Particularly, to isolate the bacteriophage having killing activity specific to Staphylococcus aureus, samples were collected from soil and straw in a cowshed and sewage where the bacteriophage was expected to be. These samples were co-cultured with the previously isolated Staphylococcus aureus in example <1-1> at 37° C. for 3-4 hours. After cultivation, the culture broth was centrifuged for 20 minutes at 8,000 rpm. The supernatant was filtered with a 0.45 μm filter. With resultant filtrate, the Staphylococcus aureus specific bacteriophage was isolated by plaque assay (FIG. 1). The method used for isolation of the Staphylococcus aureus specific bacteriophage is shown in the schematic diagram of FIG. 2.
[0060]To observe the morphology of the obtained bacteriophage, CsCl density gradient (density: 1.15 g/ml, 1.45 g/ml, 1.50 g/ml and 1.70 g/ml) centrifugation (38,000 rpm, 22 hours, 4° C.) was performed, leading to the purification of the bacteriophage. The purified bacteriophage was loaded in a cupper grid, followed by negative staining with 2% uranyl acetate and drying. The morphology was observed under electron microscope. As a result, the isolated bacteriophage was confirmed to be the one belonging to φ29-like virus genus, Podoviridae family according to the morphological classification method (FIG. 3). The size of the bacteriophage was approximately 36.4 nm and named bacteriophage SAP-2.
Example 2
Genetic Characteristics of the Staphylococcus Aureus Specific Bacteriophage SAP-2 Isolated
[0061]The genome of the isolated bacteriophage SAP-2 was analyzed. To do so, the genome of the bacteriophage SAP-2 was first extracted by the conventional method and its genetic characteristics were examined. Particularly, 50 ml of Staphylococcus aureus culture broth (OD600=1) and 1 ml of filtered bacteriophage suspension at the concentration of 1×108 pfu/ml were added into 200 ml of TSB (Tryptic Soy Broth) medium (casein digest, 17 g/l; soybean digest, 3 g/l; dextrose, 2.5 g/l; NaCl, 5 g/l; dipotassium phosphate, 2.5 g/l) in a 1 l flask, followed by shaking-culture at 37° C. for 34 hours. Then, lysis of Staphylococcus aureus was observed. After confirming lysis, the culture broth was filtered with a 0.45 μm filter. To eliminate DNA and RNA of Staphylococcus aureus remaining in the filtered culture broth, DNase and RNase (200 U each) were added to 10 ml of the filtered culture broth, which stood at 37° C. for 30 minutes. To inactivate the enzymes (DNase and RNase) therein, 500 ml of 0.5 M ethylenediaminetetraacetic acid (EDTA) was added thereto, which stood for 10 minutes. Next, to destroy outer wall of bacteriophage, 100 μl of proteinase K (20 mg/ml) and 500 μl of 10% sodium dodecyl sulfate (SDS) were added thereto, followed by incubation at 65° C. for 1 hour. After one hour incubation, 10 ml of phenol:chloroform:isoamylalcohol mixture (25:24:1) was added thereto and mixed well. The mixture was centrifuged at 18,000 rpm to separate layers. Upper layer was recovered, to which two times the volume of 100% cold alcohol was added, followed by extraction of pure genome. To investigate whether the genome extracted from bacteriophage was DNA or RNA, DNase I (10 U/μl) and RNase A (10 μg/μl) were added respectively, followed by incubation at 37° C. for 1 hour. The genome was also treated with mung bean nuclease (45 U/μl) for 15 minutes at room temperature to determine whether it was a single stranded DNA or a double-stranded DNA, in case it would be confirmed to be DNA. Electrophoresis was performed with those treated samples using 0.8% agarose gel and fragmentation pattern by each enzyme was investigated. As a result, the obtained genome was sensitive to DNase I (FIG. 4). The sensitivity to DNase I indicated that the genome was DNA and the non-sensitivity to mung bean nuclease indicated that the genome was a double stranded DNA. Therefore, it was confirmed that the genome of the bacteriophage was a double stranded DNA.
[0062]The genome extracted from the isolated bacteriophage was a genomic DNA (gDNA). To analyze the gene sequence of the gDNA, the genome was treated with different restriction enzymes and fragmentation patterns by different enzymes were observed (FIG. 5). Nde I was considered to be most appropriate for the construction of gDNA library. Thus, GDNA library was constructed by the conventional method using Nde I-treated DNA fragments. The method for the construction of gDNA library is shown in FIG. 6. Direct sequencing of gDNA of bacteriophage SAP-2 was performed to identify the whole nucleotide sequence of bacteriophage genome.
[0063]Particularly, DNA fragments were obtained by treating the gDNA of bacteriophage SAP-2 with Nde I according to the conventional method. Vector fragments were also prepared by treating the modified pGEM T-easy vector (Promega) with Nde I. The pGEM T-easy vector was the vector designed for TA-cloning. So, the vector could not be used as it was. Instead, T-overhang of the end of the vector was eliminated by the conventional method known to those in the art and then blunt-ended ligation was carried out, resulting in a circular modified vector. The DNA fragments and the vector fragments derived from the modified vector were ligated using T4 ligase. The resultant recombinant plasmid having the DNA fragment of bacteriophage SAP-2 was introduced into E coli Top 10F' via electroporation, a kind of electro-transformation. The transformant transformed with the recombinant plasmid was selected on the agar plate medium containing ampicillin supplemented with X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) and isopropyl β-D-1-thiogalacto-pyranoside (IPTG) by using Blue-White colony selection. The selected single colony was inoculated into the medium containing ampicillin, followed by shaking-culture for overnight. Plasmids were extracted from the culture cells above using a plasmid purification kit (Intron). The extracted plasmids were electrophoresed using 0.8% agarose gel to confirm the size. Based on the size, recombinant plasmids were selected.
[0064]The numbers of selected plasmids were 3 in total and thus the numbers of clones obtained were also 3. The clones were cultured again and plasmids were extracted from the culture cells by the same manner as described above and the nucleotide sequences of the extracted plasmids were analyzed. Direct nucleotide sequencing of the gDNA of bacteriophage SAP-2 was also performed. Sequences of primers used herein are shown in Table 2.
TABLE-US-00002 TABLE 2 Primer Nucleotide sequence T7 TAATACGACTCACTATAGGGCGA promoter SP6 GTATTCTATAGTGTCACCTAAAT promoter 1 CGTAATGCTTCAAAATGTTC 2 GAGCAATGTTAGTTGATTACTCATT 3 CCATTTAAAAAATAATCATCACGTT 4 TGCAATTCATATATTAGATGATAA 5 TATGCTTTATATGGAGGTTGATAAC 6 AATTAGTGTACCGTCACCTAAAGA 7 TGCAACACCATCGTGATGTA 8 GTTGTTGAACATCGCAACAG 9 CAAAATCTGATAAAAACGTCAT 10 GACGTGATGAGGATTATTAT 11 ATAAATTCTCTTTCTTTTTCCTCAAATTCAAATCTCGCTAAT GT 12 CATACGTGGATAATTACGTTTCAACATTAATTCCTCATTT 13 ATCAAATTCATTTAAAATTTTCTTTCT 14 AATGTCACCTATGTTTAATGCAGA 15 AGTTCATCATTTAAGAATTGAACAACAGAACT 16 TTTGTTGCTCTAATGATGTAATACGTTGTTCTAATATAACAG 17 TCACTTGCAATAATACCACTTTCTAAT 18 GTCAAGTATCATTTTAATACAATTT 19 TCATTATACATTACGTGACGCTTA 20 AGCTTCTCTTTCTTTTTTCCATCTA 21 GAACTTCATTGTATTTAGCGCTGTTG 22 TGAATCTTCATATGGTCGACCTGCAG 23 ATTTAATAGTTTTGCACAAGTACCAA 24 CAAACTAACCCATCTGATAAACAAAC 25 AACCTAATGGCTATTGGTTCCAACCA 26 GGTAACAGTTCAGTTAATTCACAT 27 GGTGCCATAATTTATTATTCCTCC 28 TTAATCGTACCTAATTTAATATCAC 29 AACGTAAATCGTTATTACTTGCAATG 30 CGTTACAACACCCGGAGAATATTA 31 CCAAATGTCCAAGATTTTGAATAA 32 TTTAAAATGTACAGGTACGTATAC 33 TTGAATTTAACGAATATAATTTGGC 34 ATATTATCATGATTGCACATAACTG 35 GTAAAAGGTTATGGACGTTTTAAT 36 AATTTTTATGACTATATAAAATCATT 37 ACAAAAAACATTTAACAACACGTAT 38 AAATAAAATACAAAACATAATCAAT
[0065]The nucleotide sequence of the total genome of the bacteriophage SAP-2 obtained by the above two methods was represented by SEQ. ID. NO: 1. The total number of nucleotides forming the genome of bacteriophage SAP-2 was 17938.
[0066]Homology of the said bacteriophage genome with the collected sequence records of bacteriophage genomes was investigated by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) on Web, referring to analyzed and reported bacteriophage nucleotide sequence. As a result, the nucleotide sequence of the genome of bacteriophage SAP-2 showed 86.0% homology with Staphylococcus aureus phage phi P68, 81.8% with 44AHJD and 49.2% with bacteriophage 66. These three bacteriophages were all bacteriolytic Podoviridae bacteriophages specifically infecting Staphylococcus aureus. The size of phi P68 genome is 18,227 bp, the size of 44AHJD genome is 16,784 bp and the size of bacteriohphage 66 genome is 18,119 bp. To understand genetic functions of each gene, open reading frame (ORF) was analyzed by NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and Vector NTI ContigExpress (INFORMAX) program, based on the gene sequence of phi P68. Referring to the paper published in FEMS Microbiology Letters (Complete nucleotide sequence and molecular characterization of two lytic Staphylococcus aureus phages: 44AHJD and P68, 2003, 219: 275-283), ORF homology was compared. The results are shown in Table 3.
TABLE-US-00003 TABLE 3 Putative No. of translation amino ORF Frame Start End initiation sites acids Size (Da) PI function 1 +1 343 645 caaaacaaggaggt 100 11550.89 3.9169 Unknown aacaaa 2 +3 660 896 ttagaaaggaatgat 78 9306.71 6.2418 Unknown ataat 3 +3 900 1268 aattaaagaggaga 122 14292.12 5.301 single stranded aataaa DNA binding protein 4 +1 1318 1497 attttatgaggtgcta 59 7141.18 7.4913 Unknown aaca 5 +3 1500 1913 ttaaggagatataaa 137 16088.36 4.7637 Unknown aatg 6 +1 1906 2073 atacgggaaagtaat 55 6369.95 6.3126 Unknown agacc 7 +1 2101 2559 gctttatatggaggtt 152 18423.76 9.9897 Unknown gata 8 +3 2718 3854 caaatagaattagttg 378 45857.7 5.9219 Encapsidation atga protein 9 +3 3888 6157 aagattatgggattac 761 90383.05 5.4283 DNA ttga polymerase 10 -2 7706 6270 acgattctgaaaaga 478 52080.48 9.4347 Unknown gtgat 11 -1 8020 7991 agagagggggtata 140 16345.35 8.1902 Holin aaa 12 -2 9869 8106 ctatttttta 587 68346.17 6.2139 Tail protein tggaggtaaa a 13 -1 11371 10838 taaataagaggtgta 177 20359.5 5.3719 Unknown aaca 14 -2 12185 11436 acataaaaaatagga 249 28653.85 6.8931 Amidase gtgtt 15 -3 14159 14140 tggtaaaggtggaaa 647 74574.47 5.5835 Minor attat structural protein 16 -2 13910 14154 agatgaaagtagtga 259 30037.53 5.2211 lower collar tttaa protein 17 -1 15652 14903 ttaatgtagtggttgg 249 28571.06 4.3332 upper collar tgaa protein 18 -3 17126 15900 acgtagaggaggaa 408 46804.98 5.5568 major head taataa protein 19 -3 17315 17133 atttagattaggagg 60 6955.51 4.1365 Unknown aaaat 20 -3 17663 17325 atattttggaggtgtc 112 12991.9 3.6313 Unknown acaa
Example 3
Cloning of the Gene Encoding the Lytic Protein and Construction of Expression Plasmid
[0067]From the gene sequencing and ORF analysis performed in Example 2, the present inventors identified ORF of amidase which seemed to be much likely lytic protein. Domain of amidase gene was thoroughly examined. As a result, CHAP (cysteine, histidine-dependent amidohydrolases/peptidases) region and SH3--5 region were analyzed. CHAP region is the region frequently found in peptidoglycan amidase that plays a role in cell lysis by breaking peptidoglycan layer of bacteria, which has L-muramoyl-L-alanine amidase activity and D-alanyl-glycyl endopeptidase activity. SH3--5 region is the cell wall targeting domain which binds to a specific region of bacterial cell wall to make the lytic protein break peptidoglycan layer fast and easy.
[0068]The gene encoding the lytic protein in bacteriophage SAP-2 genome is 750 bp and the lytic protein expressed thereby is composed of 250 amino acids. The gene encoding the lytic protein is represented by SEQ. ID. NO: 2 and the lytic protein has the amino acid sequence represented by SEQ. ID. NO: 3.
[0069]The present inventors constructed an expression plasmid for the expression of the said lytic protein. The gene corresponding to amidase was cloned into pBAD-TOPO vector (Invitrogen) by using Nco I and Not I restriction enzyme sites. First, enterokinase cleavage site in pBAD-TOPO vector was eliminated before cloning, in which Not I restriction enzyme site was inserted, followed by cloning. The constructed expression plasmid for the expression of the said lytic protein is named pBAD::IysinM. E. coli Origami (DE3) (Novagen) was transformed with the expression plasmid, leading to the construction of the production host of lytic protein. The constructed production host was deposited at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11152BP).
Example 4
Over-Expression of Antimicrobial Protein
[0070]The antimicrobial protein was over-expressed using the E. coli transformant constructed in Example 3. The expression system based on pBAD-TOPO vector is the L-arabinose-mediated induction system, which is favorable in the expression of toxic protein (referred to the instruction of the manufacturer under the title of "pBAD expression system" and the instruction 25-0257 published in 2004).
[0071]The over-expression inducing process is described in detail hereinafter. The constructed plasmid contains ampicillin resistant gene and the production host itself has tetracyclin resistant gene. So, the production host of lytic protein is inoculated in 5 ml of LB medium (trypton, 10 g/L; yeast extract, 5 g/L; NaCl, 10 g/L) containing ampicillin and tetracyclin, followed by shaking-culture at 37° C. for overnight. 100 μl of the culture broth was re-inoculated in 10 ml of fresh LB medium containing ampicillin and tetracyclin, followed by shaking-culture at 37° C. When OD600 of the culture broth reached 0.5, L-arabinose was added (final conc.: 0.2%) thereto to induce the expression of the antimicrobial protein. Then, the culture temperature was adjusted to 23° C., followed by low temperature culture for 12 hours. Then, 1 ml of the cell culture broth was taken and centrifuged at 8,000 rpm for 5 minutes to obtain cell pellet. The cells were lysed by resuspending of the cell pellet in 100 μl of 1% SDS solution. 12 μl of the cell lysate was taken for electrophoresis. 3 μl of 5×sample loading buffer was added to the cell lysate and mixed well. The gel loading sample was boiled for 5 minutes. Electrophoresis was performed with the sample by the conventional method to confirm over-expression of the antimicrobial protein. The results are shown in FIG. 7.
Example 5
Lytic Activity of the Expressed Antimicrobial Protein
[0072]To investigate lytic activity of the expressed antimicrobial protein, 100 ml of the culture broth of the E. coli transformant (KCTC 11152BP) was centrifuged at 8,000 rpm for 5 minutes and the resultant cell pellet was recovered. The cells were resuspended in 1 ml of 80 mM Tris-HCl (pH 4.0) buffer. The cells in this cell suspension were disrupted by sonication as follows; sonication was performed for 20 seconds to disrupt cells and stopped to take a break for 5 seconds, which was repeated for 20 minutes. The obtained whole cell lysate was centrifuged again (10,000×g, 5 minutes) to obtain supernatant. Using the supernatant, antimicrobial activity of the expressed antimicrobial protein was examined. The bacteria used for the investigation of lytic activity were three kinds of Staphylococcus aureus, clinically isolated from milk of daily cattle of farms in Gyunggi-do and Gangwon-do, Korea by the present inventors.
[0073]1 ml of Staphylococcus aureus culture broth (OD600=1 in TSA medium) was spread on agar plate and dried. 5 μl of the supernatant obtained after centrifugation of the cell lysate was dropped onto the dried medium above, followed by incubation in a 37° C. incubator for overnight. Then, the lytic activity was investigated. As shown in FIG. 8, transparent plaque was observed, indicating bacteriolytic activity of the said antimicrobial protein.
[0074]Bacteriolytic activity of the antimicrobial protein was compared with that of bacteriophage SAP-2, the mother bacteriophage of the antimicrobial protein above. Each bacterium was cultured by the same manner as described above, which was spread on plate medium, to which 5 μl of bacteriophage SAP-2 suspension and the antimicrobial protein solution (supernatant obtained from centrifugation using cell lysate in earlier experiment), followed by culture at 37° C. for overnight. Then, bacteriolytic activity of the bacteriophage and the protein was investigated. The results are shown in FIG. 9. In this experiment, 5 kinds of Staphylococcus aureus isolated from cow and 3 kinds of Staphylococcus aureus isolated from human were used. As a result, the spectrum of bacteriolytic activity of the lytic protein was broader than that of the bacteriophage itself. Therefore, the antimicrobial protein of the present invention was confirmed to have broader spectrum of bacteriolytic activity than the bacteriophage itself.
Example 6
Separation and Purification of the Expressed Antimicrobial Protein
[0075]500 ml of the culture broth of the transformant (KCTC 11152BP) cultivated in LB medium was centrifuged at 8,000 rpm for 5 minutes to obtain cell precipitate. The precipitate was suspended in 6 ml of 80 mM Tris-HCl buffer (pH 4.0). The cells in the suspension were disrupted by sonication by the same manner as described in Example 5. The cell lysate was centrifuged at 8,000 for 5 minutes to remove cell debris. Ammonium sulfate precipitation (30% (w/v)) was performed with the resultant supernatant to concentrate the expressed antimicrobial protein. More precisely, ammonium sulfate was added at the final concentration of 30% (w/v) and the resultant solution was left in ice for 15 minutes to precipitate the expressed protein. 15 minutes later, the solution was centrifuged at 10,000×g for 15 minutes to recover the precipitate. The precipitate was dissolved in 2 ml of adsorption buffer (25 mM sodium phosphate, pH 5.8) for chromatography. To remove the excessive ammonium sulfate, the prepared protein solution was dialyzed against adsorption buffer at 4° C. for overnight by replacing the adsorption buffer with a fresh buffer from time to time. Upon completion of dialysis, the protein solution was centrifuged at 10,000×g for 25 minutes to remove insoluble substances. The protein solution was then filtered with 0.2 μm filter, followed by cation-exchange chromatography. At that time, HiTrap SPFF (GE Healthcare) was used as the cation-exchange resin. The column was equilibrated with the adsorption buffer before sample loading. Then, the sample containing the antimicrobial protein was loaded onto the column, followed by washing with 100 ml of the adsorption buffer. In this condition, other proteins originated from E. coli did not adhere to the matrix of column. The antimicrobial protein was eluted by using 25 mM of sodium phosphate solution (pH 5.8) containing potassium chloride at different concentrations from 0.2 to 0.8 M. To remove potassium chloride used for the elution of the antimicrobial protein, the eluent fraction containing the antimicrobial protein was dialyzed against 25 mM of sodium phosphate solution (pH 5.8) at 4° C. for overnight by replacing the sodium phosphate solution with fresh sodium phosphate solution from time to time. The dialysate was concentrated through performing dialysis of protein solution against polyethyleneglycol 20,000. The results are shown in FIG. 10.
Example 7
An Example of the Application of the Staphylococcus Aureus Specific Antimicrobial Protein for the Prevention of Infectious Disease Caused by Staphylococcus Aureus
[0076]100 μl of the supernatant obtained from centrifugation of the cell lysate containing the antimicrobial protein prepared in Example 5 was added into a 9 ml of nutrient broth (beef extract 3 g/l, peptone 5 g/l). 100 μl of the purified antimicrobial protein prepared in Example 6 was added into another 9 ml of nutrient broth. A control medium was prepared without addition of the supernatant containing the antimicrobial protein and the purified antimicrobial protein. Staphylococcus aureus suspension was added into each medium at a starting optical density at 600 nm (OD600) of 0.5, followed by investigation of the growth of Staphylococcus aureus. As shown in Table 4, in the medium not treated with the supernatant containing the antimicrobial protein and the purified antimicrobial protein, Staphylococcus aureus was growing so well (30 minutes later: OD600=0.8). On the other hand, in the mediums treated with the supernatant containing the antimicrobial protein or the purified antimicrobial protein, Staphylococcus aureus was not grown at all (10 minutes later: OD600=0.1, 60 minutes later: OD600=0.05). From the above results, it was confirmed that the supernatant obtained from centrifugation of the cell lysate prepared in Example 5 or the purified antimicrobial protein prepared in Example 6 was very effective in the prevention of the infection of Staphylococcus aureus.
TABLE-US-00004 TABLE 4 Staphylococcus aureus killing activity (OD600) Starting optical 10 minutes of 60 minutes of density culture culture Control (non-treated) 0.5 0.6 0.8 Experimental group 1 0.5 0.12 0.08 (Example 5) Experimental group 2 0.5 0.1 0.05 (Example 6)
Example 8
An Example of the Application of the Staphylococcus Aureus Specific Antimicrobial Protein for the Treatment of Infectious Disease Caused by Staphylococcus Aureus
[0077]15 dairy cows with mastitis caused by Staphylococcus aureus were selected to investigate the effect of the antimicrobial protein obtained in Example 6 on the treatment of mastitis. The cows were divided into three groups (5 cows per group). 10 ml of the antimicrobial protein solution prepared by diluting (100 33 ) the concentrate of Example 6 with 50 mM sodium phosphate solution (pH 6.5) was sprayed on the lesion of dairy cows of first group every day and 10 ml of 50 mM sodium phosphate solution (pH 6.5) without the antimicrobial protein was sprayed on the second group every day with same manner, particularly on the infected regions. In addition, 10 ml of PBS was sprayed on the third group every day with same manner. The spray was continued for 10 days. After 10 days of such treatment, the population of Staphylococcus aureus in the milk obtained from the cows with mastitis was investigated. As shown in Table 5, significant treatment effect was observed in the group sprayed with the antimicrobial protein solution. From the result, it was confirmed that the antimicrobial protein obtained in Example 6 was very effective in the treatment of infectious disease caused by Staphylococcus aureus.
TABLE-US-00005 TABLE 5 Treatment effect on disease caused by Staphylococcus aureus infection (number of Staphylococcus aureus) Before treatment After treatment Control (PBS) 1.6 × 104 cfu/ml 1.7 × 104 cfu/ml Experimental group (100X 1.7 × 104 cfu/ml 1.3 × 102 cfu/ml diluted antimicrobial protein concentrate of Example 6) Comparative group (sodium 1.5 × 104 cfu/ml 1.6 × 104 cfu/ml phosphate solution)
[0078]Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.
Sequence CWU
1
3117938DNAPodoviridae bacteriophage 1taaatataat cggaaaaagt ttttgtaaat
ttacacctcc ccaccgttta aaataaacga 60ttatacaaat caaaacttat aaattaactt
atcatttcta aactaaactt ataaaaaatg 120ttcacctact ttcccaactt atctaaccta
ttacatattc attaattaca aaatatatac 180atctattgac ttttatccaa aattatgatt
tgaaattaaa atctagtttc ttctattaaa 240tagtagtttt aaattattta aactttttta
cgatatttta ttgacaaaac atttaaacat 300ttgctatact aagtatgtaa tcaaaacaag
gaggtaacaa aaatgattaa tgttgataat 360gcaccatcag aaaaaggtca agcatatact
gaaatgttgc aattattcaa taaactgatt 420caatggaatc cagcatatac gtttgataac
gcaattaact tagtatctgc ttgtcaacaa 480ctattattaa actataacag ttctgttgtt
caattcttaa atgatgaact caacaacgaa 540actaagccag aatctatttt agcttatatt
gctggtgacg atgcaatcga acagtggaat 600atgcacaaag gtttttatga aacgtataat
gtttacgtat tttagaaagg aatgatataa 660tgaaagctga tgacattata actttacgtg
ttaaaggtta tatattccat tacttagatg 720aatcaaatga atacattgaa gaatttatac
cacttcacga gtatcattta actaaaacac 780aagcaataga attattacct aacacatgta
cactattatc aactacacgc aaaacgaaaa 840aaatccaagt atattacaat gatttactac
aaatttcaat taaagaggag aaataaaaaa 900tgacaaacgt aaaagaaatt ttatcaagac
accaaaatac aacagcgaga tttgaatttg 960aggaaaaaga aagagaattt ataaaactat
cagaattagt tgaaaaatac ggtattaaaa 1020aagagtatat cgttagagca ttattcacaa
acaaagaatc aaaattcggt gtacagggtg 1080ttatcgtcac tgacgactat aatgtaaact
taccgaacca cttaacagag ttaattaaag 1140aaatgagatc agacgaggac gttgttaaca
ttatcaatgc tggtgaagtg caatttacaa 1200tttatgaata tgaaaacaaa aaaggtcaaa
aaggttactc aatcaacttt ggtcaagtat 1260cattttaata caatttcata ggggatattt
atcccctatt ttatgaggtg ctaaacaatg 1320gaaaaaatat acactgccgt attattatac
aatgtatcaa ttaatgaaac atatgaacat 1380gaaattgaac aattcgaaaa aataaataaa
gttaaggtaa tatatagtta ttttgacgca 1440aacttttaca aaaaaggtgc atataatttt
ggtgtaaaat acattaagga gatataaaaa 1500tgaatattac aacaacatta aacacaaaaa
aattaattaa ttatatttta gataatagag 1560attgttttat gaataaaata acaaaattta
catcactaag tggaaaatgt gttgtttttg 1620ttagatacgg tgaaatttct attgaatact
atgatagtga tacaaaaaac aataatgatt 1680tatttacttt agacattgac gttgatatta
ataaacatgt ctttaattgt cttaaagttt 1740attatataga acatacagaa gatataaaca
taatatataa aaaaggtgta tacatggggt 1800gtactattga tgatgtatta tcatattttg
aaaaaccatt agaaagtgat attactatta 1860tttaccaagg caaagttatt tatgaatacg
ggaaagtaat agaccatgaa taacctacta 1920gatattatta ttgttttcct tttagcattt
ttaattacac ttgtaatact tatgacaatg 1980tatatacgtg tgtcatttgg tgttttattt
actacattta ttatattcta cattatcttt 2040ttattggttg tatatgcttt atatggaggt
tgataacatt ggtttagaca tacgtctgaa 2100atggatagat ggaaaaaaga aagagaagct
agaaaagaaa gagaagaaaa aaaatataaa 2160aatgatttta gcggtatcaa ttttaaattt
gacgataaag atttacaaga ggcttatatt 2220gacgcatgga aacatttttc acatttacca
catttaccaa aagaaaaaaa tgtatctcat 2280gcaaacgctg tttcattagt tcgtggtaaa
cgacataaaa aattaaatca tatactagaa 2340atatataacc gtaatgataa taataacaaa
aatgcaaaaa tgcataaata tgcattatat 2400aatttacacg ccgaaaaaaa taaatcttca
cttacaaaat atattaaaga aattgataac 2460ttattttttg aaataggaaa atcagataga
ccaaaaacaa caatagatga tatcaatgtt 2520aggtataact ttttatatta tgcaacattt
gaagaataac tttaatactg taaatgacat 2580tataaactat tacaaggagc aaaaacatgg
tgaaacaaaa tcgtttagac atggtaagag 2640attatcaaaa tgcggtcaat catgtaagga
aaaaaatacc agaaaactat aatcaaatag 2700aattagttga tgaactcatg aatgatgata
tagactatta tatatctatt tcaaaccgtt 2760ctgacggaaa atcgttcaac tatgtttcat
tttttattta tttagctatt aaacttgata 2820taaaatttac tttattatca cgtcattata
cattacgtga cgcttaccgt gattttattg 2880aggaaatcat agataaaaac ccactattca
aatctaagcg tgtcactttc agaagcgcta 2940gagattattt agctattatc tatcaagata
aagaaattgg cgtgattaca gatttgaata 3000gcgctactga tttaaaatat cattctaact
ttttaaaaca ctaccctatt attatatatg 3060atgaattctt agcgcttgaa gatgactatt
taattgatga gtgggacaag ttaaaaacaa 3120tttatgaatc aatcgaccgt aaccatggta
atgttgatta tattggtttt cctaaaatgt 3180ttttactagg taatgctgtc aacttttcaa
gtcctatatt atccaattta aatatttata 3240atttattaca aaaacataaa atgaatacat
caagacttta caaaaacatt tttttagaaa 3300tgcgtcgaaa cgattacgtc aatgagaggc
gtaatacacg tgcgtttaat tcaaatgatg 3360acgctatgac aactggcgag tttgaattta
acgaatataa tttggcagat gataatttaa 3420gaaatcatat caaccaaaac ggtgattttt
tctatattaa aactgacgat aaatatataa 3480aaattatgta taatgttgat acatttaatg
ctaacatcat tgtaatacct tatacaaaac 3540aatatgagtt ttgcactaaa atcaaagata
tcgatgacaa tgttatttat ctaagagaag 3600atatgtttta taaagaaaac atggaacgat
attactacaa tccaagtaat ttacattttg 3660acaatgctta ttcaaaaaat tacgtggttg
ataatgatag atatttatat ttagatatga 3720ataaaattat aaaatttcat ataaaaaatg
aaatgaagaa aaatattaac gaatttgaaa 3780gaaaagaaaa gatatacgaa gataactata
tagaaaatac aaagaagtat ttaatgaaac 3840aatacggctt ataaaaggtg tgtaagatta
tgggattact tgagtgtatg caatatcata 3900aaaatcaacg taaaatgata ttgtactggg
atattgaaac attatcgtac aataaaataa 3960acggacgcaa taaaccaaca ttatataaaa
acgtaacgta ttctgttgcg attggttggt 4020ataatggtta cgaaattgat gttgaagtat
tccccagttt tgaagccttt tatgatgatt 4080ttttcaagta tgtttatcgc cgggatacaa
tcacaaaatc aaaaacaaat attatcatga 4140ttgcacataa ctgtaataaa tacgataatc
attttttact taaagacacc atgcgttatt 4200ttgataatat tacacgcgaa aatgtatatt
taaaatctgc agaagaaaat gaacatacaa 4260taaaaattca agaggctact attttagcca
aaaatcaaaa tgtgatttta gaaaaacgtg 4320ttaaatcttc aatcaattta gatttaacga
tgtttttaaa tggttttaaa tttaatatca 4380ttgataactt tatgaaaacc aatacatcaa
tagcaacatt aggaaaaaag ctacttgacg 4440ggggttattt aacagaaaac caacttaaaa
cagattttaa ttatacaatt tttgataaag 4500ataacgatat gtcagatagt gaagcttatg
actatgctgt taagtgtttt gataatctta 4560catctgaaca attaacctac attcataatg
acgtgattat attaggtatg tgccatattc 4620attatagtga catttttcca aattttgact
ataacaaatt aacattctca ctaaatatca 4680tggaatctta tttgaataat gaaatgactc
gttttcagtt actcaatcaa tatcaagata 4740ttaaaatatc ttatacacat tatcattttc
atgatatgaa tttttatgac tatataaaat 4800cattttatcg tggtggttta aatatgtata
ataccaaata tatcaataaa cttattgatg 4860aaccttgttt ttctatagac atcaattcga
gttatcctta cgtgatgtat catgagaaaa 4920ttccaacatg gttatacttt tatgagcatt
actcaaaacc aacattaatc cctacttttt 4980tagatgatga taattatttt tcattatata
agattgataa agaggtattt aacgatgagg 5040tattaattaa aatcaaatca cgcgtactac
gtcagatgat tgttaaatac tacaataatg 5100ataacgatta cgttaatatc aatacaaaca
cattaagaat gatacaagac attacgggta 5160ttgattgcac gcatatacgt gttaattcgt
ttgttgtata tgaatgtgaa tactttcacg 5220cacgagatat tatatttcaa aactatttta
ttaaaacaca aggtaaatta aagaataaaa 5280tcaatatgac aacaccttac gactatcaca
ttacagatga aattaacgaa cacccctact 5340caaatgaaga agttatgtta tcaaaagtcg
ttttaaatgg tttatatggt atacctgctt 5400tacgttcaca ctttaattta tttcgtttag
atgaaaacaa cgaattgtat aacatcatta 5460acggatacaa aaacacggaa cgtaatattt
tattctctac atttgtcaca tcacgttcat 5520tgtataactt attagtacct ttccaatact
taacggaaag tgaaattgac gacaatttta 5580tttattgcga cactgatagt ttgtatatga
aatcagttgt aaagccctta ttgaacccca 5640gtttattcga ccctatatca ttaggcaaat
gggatattga aaacgaacag atagataaga 5700tgtttgtact gaatcataaa aaatatgctt
atgaagtgaa tggaaagatt aaaattgcgt 5760ctgctggtat accgaaaaac gccaaaaata
caagcgtcga ttttgaaacc tttgtacgtg 5820aacaattttt tgacggtgca attatagaaa
acaataaaag tatctataat aatcaaggta 5880cgatatcaat ttatccgtca aaaacagaaa
ttgtttgtgg taatgtatat gatgaatatt 5940ttactgatga acttaattta aaacgtgaat
ttatcttaaa agacgctaga gaaaattttg 6000accatagtca atttgatgat attctttata
ttgaaagtga tattggttca ttttcactca 6060atgacttatt tccatttgaa cgttcagtac
ataacaaatc tgatttgcat atattaaaac 6120aacaacatga tgacatcaaa aaaggcaact
gttaaaataa cagtcgcctt ttctttgaga 6180taacatgaaa aatgtgtacg aaaattgatt
atgttttgta ttttatttac tagcattact 6240agcatgtgtt cattatagca taaatcttta
tgcaatacca ctaaagaata caatattatc 6300acctgcgttt tctggtacac cgttaatgag
tgtatacaat aatacacgtg acggtgcaac 6360gtatggtggt acattatagt ttgcgactaa
gaatgaacca tcgtcaaaca cagcaacaac 6420tacacccgtg tgaccgatac catatatgct
tgcttgtaag tatggcggtt tactagagaa 6480gccgtaacca acggtaggaa tatgtgttgt
tttagcccct aattttttat aaacatacca 6540cacacgttga ccgtttgtta cttgtccatc
atcagttggt tgtctttttc catgtaattg 6600tgacatatac gcccatgtta attctgtaca
ctgaccagca ttaccagttt gagggaatat 6660gttacccggt ttgtataaat attctttttt
gaataaaggt acaccaattg cttttttata 6720tttttctggt aattggtcat acgtccagtt
accacctatc acacgaccac tttttccgtt 6780tggtttcaca gatttacctc taatcgcatt
atgctcacca tcgtcatcag tagggtttga 6840acttccaccg tcatctattt gcacactatc
aatgagcttt tttaatgagt cgagtagtcc 6900aatcgtcatt ttaatatgat acgtgttgtt
aaatgttttt tgtagtgtaa aataatcatt 6960actaaaaaat ttatcactac caatactatg
cacgtcccat tgtaatgcgt cttgaacttt 7020ttttaataat tcttgcatgg cttgttttgc
taaagcgagc agtgaactac cactgtcacc 7080actactacca ctgtcagacg aatcactagg
tgaaccacct ttaccgtcta atttaccacc 7140ccatgctaaa atagtatttg caccgtctaa
aaaaggatta ccatagtttt gtactttatt 7200atatgacgct ttcaaaccta ggggataata
tgccgcccaa gtagctgcag ccgttaatgg 7260gatataagca cgtccaaccg taccagcttt
catgttttta gcaaaatctg cattaccttt 7320tctttgtacg ttttgaggta caaagtgaac
gatgttacct gcgtcatacc aagacggttg 7380tcctgcttgt tttgattgtg atacaagctt
tctagctaca aatttagcgt ctgttaaata 7440atcgccttgt gcagaagtat gatttaacca
acctaaacct gcactgtatc cttcgttttt 7500ttcatataca gcaattagcg taggtgaaac
tcctatcgat ttaactgcat ttagaacttg 7560tctgatttta ctttcattac cacctaacca
aacattaaaa cgtccataac cttttacttt 7620aggcactaac tggtctatcg ttaatccaaa
gtcatcatta atataagaat gtgtaaattt 7680atctatcttc tcttggtcgt tcatctttat
cactcttttc agaatcgttt ttaattactc 7740ttaatttatc tttaatttgt tctggcacta
atacatccat ctctgcacaa ttttctacaa 7800tagataaacc ctcattagca atataataga
aaatcgtaat cataagtaga ccacctttta 7860attgtaaaat ttggtcaatg atatttgcta
gaataataat acagaatatg agtaattttt 7920tagcgaaacc tctcattgat ttttttgacc
atagattatt atttttaatg gcttttgaaa 7980tacctgtaat aatatcaaca aacattaata
taaataaaaa atatagtaat tttaaatctc 8040ctgcatatat aaacatgtga aacacttctg
tatctgtaaa cctgaatttt acttcattca 8100tttttatacc ccctctctaa atttattatt
taatggattt tgtaacatag ggttacctga 8160accatcatta tgccaaaatc tcacaccaga
ttccaaaata gcttttaatt gttccattaa 8220catagggtca atgtcacgta ttgtatacgt
acctgtacat tttaaatagt tgcatatagt 8280catactgtta attggttcaa taaatgtatt
atagtcattt acttcaaaac caaacaacat 8340ataatatttt tgtaaaaatg taatttcttt
aggtgacggt acactaattt tcattgttaa 8400accgttaatg ctatttgcga tttggaaagc
gttccccatt tctgactctg tcactgatgg 8460tggttgtaag gctaaatctt tatattctgc
ttgttgttgt ttgtagaaat tatattcttc 8520attaaactta ccaaataaag cagttggact
taaattactt gctacactta cagcgtcata 8580aaaacgtgat tttgggtcac tgccatttaa
tacattatct atacgacttg tgattaattg 8640actttctgca ttacgctgtc tattggcttg
ttgtgattgc cctaaaatac cgttattgat 8700taaaattggt acttgtgcaa aactattaaa
tgttatattt gtatttaaga atgaacctgt 8760atcaattaat atatctttat tttttgcaag
tatcggtcta tcattttcag cactgttata 8820atctactgga taaactcgca cttcattatg
ataaccaatg atggattttg tacgtaactt 8880aacacctgtt ttttgtgaaa tcttaccagc
gtctagtaac atagtattac cattccagtc 8940ataaaaatca atcgtcatgt actcattacg
tatcatatgg tcgcactcgt cttttttaga 9000caacatcatc tcttgaagct ttgtgaaact
taatgataaa tcgtttaaac tccattcttt 9060tgattttcca ccttgtttta acgtctttaa
tccagtaatt ttttcacttg tcttaacgtc 9120ctctaaatct tttgtattaa tagaatcttt
aggtaacatt tgaacctttt gaaagttttg 9180tgtaatccat ggataggcac tcattttatc
cataaagtta ataaagtcac catattccat 9240aacgtataag ttgactggtg atgtgatatt
gtcatatatt gtacctttag acgtatctaa 9300gtttggctct tttttagtac caaatttctt
tgataaatca gcacttgact ggaataacac 9360taaattttcc aaaaactgtt gcatttggtt
atacacatag tttttatttg atacttttaa 9420cacatcatca ttgttacgta acattggtaa
catatagtta tacgtgcgtt ttgataagtg 9480ttgacgttca atattaacgt ttgagagttg
ttctaataca ttaccttgtg tatacgtcat 9540aatagtatca atcacaaaat atattttaac
cacaacatca ttcacatatt cgatttgatt 9600cacaaacgca taataacgtc tgtcctcaaa
atctgataaa aacgtcatgt agttaatccc 9660ttgtgcgtca tgccactgca tatcaacatt
gatttccatt ctatcacgta taaaattata 9720cggttgtttg gaatagtcta atgatttaaa
atgacgtcca tttaaaaaat aatcatcacg 9780ttcttgatta ctattaaaat gaatcgtatt
ttgataatca gtaaacggtg tgttatagaa 9840aaatttaaaa tttgttaatt ttctcatttt
tacctccata aaaaatagtc gtataaatta 9900tttatacgac tattataaca tttttattca
atgatttgtg tatctattgc aaaactttta 9960ttaccatttg aaagctcact atcactataa
tttgatgtaa caaaatgtaa ttcattatta 10020aagtttaaat ataatcttgt attaatcatt
ttcgaatcaa tcgcacattg tgtgtagtga 10080tgtgtagatt ttaagtttgc gttaatcgta
cctaatttaa tatcaccgtt tttcttaatg 10140ccttttaata ccccttttaa ttgtatggtt
ttaacaccat taattgttaa aatacgatat 10200tgcggtgcag gatatccaac gttgctatca
cttgcaataa taccactttc taatgtaata 10260tcttgccacc ctgtatcatt cacagttgtt
ttattttcat taattgtatt taaaatttct 10320attttatcat tagttattat agcagttaaa
ttgttaatac tttgtgtatt attacctaca 10380ctttcttttg tagctataat atcttgttta
tttttttcaa tatcttcttc attttttgtg 10440tttttatcat ctaatatatg aattgcagat
tcatgattac ttagtttatt tgtatgttct 10500gattgaacat ctgataaatt ttttattttt
ttatcttgtt gcacattatc ttctttaata 10560ttaataatgt ctgtagcgtt ttgagaaata
ttatttttat ttgtagcgat atcattttta 10620tttttattaa tgtcttttgt gttcgtatta
attttactta ataattcatc tttaaaggtt 10680aacttataat aatcctcatc acgtcttata
taaatgttac cgtcctttgt agtaattaag 10740tcatttgctt ctactaaatt atcatttaat
ttatctacag agtcaatgtt gcgcaaactt 10800ccttaaaatc caacaaccat tggttaaacc
ttttatttta atgttttcca actaattcaa 10860agaaaaattc tattttatca ttagttttta
tagcagttaa attgttaata ctttgtgtat 10920tattacctac actttctttt gtagctataa
tatcttgttt atttttttca atatcttctt 10980cattttttgt gtttttatca tctaatatat
gaattgcaga ttcatgatta cttagtttat 11040ttgtatgttc tgattgaaca tctgataaat
tttttatttt tttatcttgt tgcacattat 11100cttctttaat attaataatg tctgtagcgt
tttgagaaat attattttta tttgtagcga 11160tatcattttt atttttattt atgtcttttg
tgttcgtatt aattttactt aataattcat 11220ctttaaaggt taacttataa taatcctcat
cacgtcttat ataaatgtta ccgtcctttg 11280tagtaattaa gtcatttgct tctactaaat
tatcatttaa tttatctaca gagtcaatgt 11340tgcgcaaact tcttacaatt ctatcagcca
ttgtttacac ctcttattta tatcgtttcc 11400aactaaattc aaagaaaaat cctaaaatac
ccattatgag aacacccccc aaggtacacc 11460aatactatat gcattacctg tttttccgtt
ccattgtcta actggtaaat aataacgagt 11520tccttgccag ttataaccaa tccaaactaa
cccatctgat aaacaaactt cgtcatatgg 11580tgtatagccg tttggttgga accaatagcc
attaggttca cttaatttag gactacagac 11640acgtgcaaat attggtaaaa aaccacatgt
aaatgttgcc ttttcgtttc tataatatgt 11700gccgtattgg ttttgtttcc aattattagt
tagttgaata ttttgttcta atactttact 11760ttcactgttt gagaattttg ggcgaataaa
atgtgtcaca ccgtcataat aatgtgttct 11820aattgttgct ttttcccaac catcatatcc
accattcaac cagttttgtt ctaaacatgt 11880ataataatca agatttccac ttgttacaca
ttggatatgt ccatattgag aatttgtgta 11940tactgcaaca tcacctaatt gaggtttaaa
gctcgatgta ttttcataca ccgttgctaa 12000acctttaaag tcattattaa ttgcgtcttt
agcattaccc cacatacgca ctttaccgtc 12060agtaatataa tagatataag caacagctaa
gtccatacat tgaaaaccat atgcaccatc 12120aaagtcaaca ccaacacctt catgtttata
tatccaatct ttagcttgtt gttgtgattt 12180catttataac actcctattt tttatgtttt
gctacccatt catattcacg atgttttgta 12240tcagcgttca cattactgaa aaactcttta
tattctgata tgttagcttc taatgtttgt 12300ctcacttctc caactgcgtt accacttgac
acacgtaacc atgcaccaac acgttttatt 12360tcttccggtg cgtctttgaa taattccatt
tggttgcctg taatataata ttctccgggt 12420gttgtaacgt aagctatcca attattatat
ttacttgctt ctaaatattc ttgatatggt 12480gcgtctgttt tgattgttgt ccataaacca
taatcccatt ttaacgtgaa tacatctagc 12540gtcataccac gcataacttt taccatttta
cgaccagttg aaaaacgtgt taattcttga 12600acagtaccta atgtttgtgt tgtagggtat
acattaatga aacaaccagc gtcaataatt 12660tttttacttc catttgtagg catgttttta
agcttttctg ccgtactacc gtcaatataa 12720taaaatccag cttgcgttaa gtcatttaag
tcgtcgatat ggtcaggtat agataatgca 12780cgaccgtcat cttttgttaa tttataattt
tgagaacctc ttgcacgtaa tgcttcaaaa 12840tgttcatatt ctccaagttg gaagaaaccg
tataagttat ggaatcgttt accaccaccg 12900ccattagtca ttgcaagtaa taacgattta
cgttttgttt ttgggtttgt ataaatacaa 12960ataccctcag gctctttaaa attatcacgt
gggaagttaa ttccgtcttg gtaagataac 13020ttaaacgggt aatcgtataa cttttgacca
gttgttaatg aatctttgcc aatttgcaca 13080tgtgaattaa ctgaactgtt accacttaac
cagtacaaat catcaccatc aacagcaata 13140ccttgcatcc aacgtgcatc gttattttct
gaattatcaa ttgtcatttc tttttctaca 13200ttatcaatat gatttttaac atcagctctt
gaacgtacct gtatcgtacc atcaccgaaa 13260cgtaatacga gtttgtcatt tgcttcatca
attaacggtg taaaagaatg tttgtttaaa 13320agtgactgtg gtgtataatc tgttaaccct
ttggcttctt ctaaatctaa tacatagtta 13380tctttatatg ctacttgcaa cagttttgca
acaccatcgt gatgtaacca tattttcatt 13440tccccgtttg attgtctttc taatccgatt
gttgtaccgt gaccaccttg tacaatacgc 13500atactagaaa ttaaatcacc actaggcgtt
aatttattaa tccaaaatcc ctcaggtgtt 13560tgtgagtcgg attgtgttga gtacatttga
ttcgtttctt tatcaatatt aatagattgg 13620ttcacagcgt tacgaatacc cccaaagccc
attacaaact taggttcaag ctcatttaat 13680tcgaacccat taacaaaacg gttaatgtct
ttaattaagt ctttaacttc tgctttaaaa 13740tcattcattt gtttcatttc agcaacttta
aataatgcaa atgcagatgt aagaccggca 13800ctatatttag taaattcatc atgaataatg
ttatctatcg taccatcatt taaccaacct 13860ctaaataatt ctttagcttg gtctgggaat
gctttcatta agtcgtccca atttttgaaa 13920cgttttttta actcatcgtc atagtcccaa
atacgatgtg ctaatacttc aatgagcttt 13980gataatcttg aaatataatc ataatatgat
tttgaattgg tattataatc tgctctatca 14040tcgtaaaacg gtgtataacg ttctctcgtt
ttatatattt cgtctaaaaa tggacgaatg 14100tcgtcaaaat atttaaaatc gttttcatta
tatgccataa ttttccacct ttaccaaatt 14160tgtaaaaaac atttttttat caaattcatt
taaaattttc tttcttaaat cgtatacttt 14220atcaatatta tcaattaaat actgttttga
aaattgtgtg cctttcgcat tacctttttg 14280attttgatta cgttttacgt tttgattact
ttcgttactt gatttattca cagttttacc 14340gttatcaatc gtgttattgt ctgcaaattt
taacgttgtt ttatctacat caatgttaac 14400ctcgctttgt ggtaatgaca cataagcatt
tctgttcgct gtcataccag ttgaattgtc 14460taaagatgta gcattttgat ttgatgtttc
atctgtgttg tttgttgtat cttcattatg 14520ttctgtaaaa ccttgtgatt gtagatattt
ttcaacttca cttgatgaat aaacaacatt 14580caaataatcc tcatgtgtga tacatacagt
aatcacttgc ataccaaatg cctcaactgt 14640ttgtctgtta atctctctat ctaaaaaatg
aatcgtaaat gattttttaa aaagtaagtc 14700tgataaatct tctttcaatg aaaaaccttt
aaatactttt tcattaacga tagctaaaac 14760atctttatcg aatttcaaca ttttttgcat
aaattgaaaa tcatcatcat aaaacgttaa 14820tttattatca tttacaaatt cattgaaacc
ttttttaata agctcagatt taataaaatc 14880gtataaagtc attgtatatc tagccattta
aatcactact ttcatctttt aaaagtgtgt 14940caaccattga tattttagac gttgtttcat
catcgtaata cggtttaata tctaaaccat 15000agcgtttaga taaaaacgtg attggttcac
gaccttttaa ataaatatta ctatttgatg 15060ttgtaaaacc acgattactt ttagcttctt
catctgatac accactttct ttatcaacag 15120ctaaagagtt aatacctaaa tagttactta
attcactaat cttattttga tactctcttt 15180tcatctcagt taaagcagga atcacactat
tacttgttaa atcaataatg tcatcttctg 15240cattaaacat aggtgacatt ttaacaaatg
gtgcaccgtt atatatttct gatacaagtt 15300gattaattga ctcgtcatta atttctgatt
taaatacctt gctaaatttc gcttgcataa 15360tcaatgaaaa tcgagataaa acaacttcag
ctaattcatc ggtatagtgt tcaatgattt 15420caatatcact attatactgt ataggtttat
tttgcataac aacaaagtta ccactcatac 15480aattatcgta tagcttatga atttgtagac
actcatcagg aattaaatag tcaggtacaa 15540taaaataaat atcttctttt gttaatcgtt
tttgaaattg gaaattaaag tttgatgaaa 15600aatttggtgc ttgattaaaa taggtattat
ttacataacc aagtatcata atttgtttat 15660ttctagcttc accaaccact acattaatat
tttgccttaa tgcagactct aactgtataa 15720aatctatacc aaccgtatca cgattggtat
agtttataag taggggtaaa aattccaaat 15780aacgattaaa cataagacgt ttaaatctgt
tgcgatgttc aacaactctt ttgttgattt 15840cttttgataa ttcaacgttt aaacctcttt
tatcgttgtt catatttacg ctccttttat 15900tctgttgctt cttcctctag ttttggtgtt
acatcttggt cagtaattaa tattttatta 15960aagaatggac taatagcctt gaatgaataa
taatgaatcc agtgtgtgac ctcatcaaat 16020tcaccattat agaatggttg ttttaacata
cctttggtat aacgtttgta tttaattgca 16080ttaatatcta aaataaatgc gtataaatct
gattttggtt taatttcttc aatgttacca 16140gtaaactctt taagtttaga aacatcataa
gtaaatactg caccaactgg aattgtgtca 16200ccaatttgcg actgataatc accgtaagca
cgtaagaaat caattgtctc ttgattttgt 16260aatttaaatt cttttgttac tttaaacaca
ccacctaaat catcaaaact tataacatgg 16320tctgtaaaat caataccagc gatttggaat
gtgttagcaa tttttgtatc taataggtaa 16380gattttaaag aatctgttgt taaaataaca
atatctttta acttagatac agttgtatat 16440tgaccaattg caccaccaga agcacggtga
acttcattgt atttagcgct gttgttttgt 16500aagtttaaaa ttgcttcaaa tactttgctt
gctaaatctt cttttgatgt tgttttacgt 16560acgtttgact ctgataattg atttaatgag
taatcaacta acattgctcg catttctttt 16620tcttctaata cattaatatc agaaattttc
tttttatata cacctaatgc gtaatttgtt 16680gcgtctgcta atgtttggaa attgaaacgt
gtatcattat tgtttaatgt gaatttttgt 16740ttcttcacaa taccactacc atataactta
gtagccatac gtggataatt acgtttcaac 16800attaattcct cattttttga taaatccata
ttaattggta ctgtatccat aatgacatat 16860tcttcactat attgaccaat aaagtcttgt
tctttagcta accaattaaa acggttacct 16920aaagcaatat caattaataa tgtctcgtta
atcttaggga ataaatattt atttacaaat 16980gtttcaaaca ttgtattatt gttatcccat
ttatcaccaa atgtccaaga ttttgaataa 17040tcatggttaa aatcttgtaa tgccgacttt
gcagattttg ctactaaaag agctgtttcg 17100ttttttgtac ttgctggtgc cataatttat
tattcctcct ctacgtctcc gctaaaagtt 17160tgttttgaaa gtgaatggat ttgtacaccg
tactcatctt cacttttgtt tacatctatt 17220gacatatttt catttaattc agtacgttta
tttaaacgtg aatcttcata tgatgtcccc 17280atcatagaac gcatgttatt gccttcatac
atattatttt cctcctaatc taaatctaac 17340ttgtcaacta attcttcatc tgaatagtct
ttatcttctt tgtcagcatt tgttacatct 17400ggttgtgttt gttgtggttg ttgaatttgt
gatgataaaa aagtagtcat ttgttgctct 17460aatgatgtaa tacgttgttc taatataaca
gggtcgaatt ttgaactatc ttcatctgtt 17520atagtaggtt ctaatttatt cttattttct
tcttcaattg tttctactgt tttatcttca 17580gtaggttctt cagttggttc ttcagttggt
tcttcagttg gttctttgtc gtctggtttt 17640acgatttcct caaattctgt cattgtgaca
cctccaaaat attttataac taattatatc 17700atagaatatt taaataagta aattaaattt
attaaaaagc gtgaacatag ttttcaataa 17760aagtaaatag atgtatatat tttgtaatta
atgaatatgt aataggttag ataagttgga 17820aaagtaggtg aacatttttt ataagtttag
tttagaaatg ataagttaat ttataagttt 17880tgatttgtat aatcgtttat tttaaacggt
ggggaggtgt aaatttacaa aaactttt 179382750DNAAntimicrobial
genegene(1)..(750)Antimicrobial Protein 2atgaaatcac aacaacaagc taaagattgg
atatataaac atgaaggtgt tggtgttgac 60tttgatggtg catatggttt tcaatgtatg
gacttagctg ttgcttatat ctattatatt 120actgacggta aagtgcgtat gtggggtaat
gctaaagacg caattaataa tgactttaaa 180ggtttagcaa cggtgtatga aaatacatcg
agctttaaac ctcaattagg tgatgttgca 240gtatacacaa attctcaata tggacatatc
caatgtgtaa caagtggaaa tcttgattat 300tatacatgtt tagaacaaaa ctggttgaat
ggtggatatg atggttggga aaaagcaaca 360attagaacac attattatga cggtgtgaca
cattttattc gcccaaaatt ctcaaacagt 420gaaagtaaag tattagaaca aaatattcaa
ctaactaata attggaaaca aaaccaatac 480ggcacatatt atagaaacga aaaggcaaca
tttacatgtg gttttttacc aatatttgca 540cgtgtctgta gtcctaaatt aagtgaacct
aatggctatt ggttccaacc aaacggctat 600acaccatatg acgaagtttg tttatcagat
gggttagttt ggattggtta taactggcaa 660ggaactcgtt attatttacc agttagacaa
tggaacggaa aaacaggtaa tgcatatagt 720attggtgtac cttggggggt gttctcataa
7503249PRTAntimicrobial Protein 3Met
Lys Ser Gln Gln Gln Ala Lys Asp Trp Ile Tyr Lys His Glu Gly1
5 10 15Val Gly Val Asp Phe Asp Gly
Ala Tyr Gly Phe Gln Cys Met Asp Leu 20 25
30Ala Val Ala Tyr Ile Tyr Tyr Ile Thr Asp Gly Lys Val Arg
Met Trp 35 40 45Gly Asn Ala Lys
Asp Ala Ile Asn Asn Asp Phe Lys Gly Leu Ala Thr 50 55
60Val Tyr Glu Asn Thr Ser Ser Phe Lys Pro Gln Leu Gly
Asp Val Ala65 70 75
80Val Tyr Thr Asn Ser Gln Tyr Gly His Ile Gln Cys Val Thr Ser Gly
85 90 95Asn Leu Asp Tyr Tyr Thr
Cys Leu Glu Gln Asn Trp Leu Asn Gly Gly 100
105 110Tyr Asp Gly Trp Glu Lys Ala Thr Ile Arg Thr His
Tyr Tyr Asp Gly 115 120 125Val Thr
His Phe Ile Arg Pro Lys Phe Ser Asn Ser Glu Ser Lys Val 130
135 140Leu Glu Gln Asn Ile Gln Leu Thr Asn Asn Trp
Lys Gln Asn Gln Tyr145 150 155
160Gly Thr Tyr Tyr Arg Asn Glu Lys Ala Thr Phe Thr Cys Gly Phe Leu
165 170 175Pro Ile Phe Ala
Arg Val Cys Ser Pro Lys Leu Ser Glu Pro Asn Gly 180
185 190Tyr Trp Phe Gln Pro Asn Gly Tyr Thr Pro Tyr
Asp Glu Val Cys Leu 195 200 205Ser
Asp Gly Leu Val Trp Ile Gly Tyr Asn Trp Gln Gly Thr Arg Tyr 210
215 220Tyr Leu Pro Val Arg Gln Trp Asn Gly Lys
Thr Gly Asn Ala Tyr Ser225 230 235
240Ile Gly Val Pro Trp Gly Val Phe Ser 245
User Contributions:
Comment about this patent or add new information about this topic: