Novel Selection Process

Abstract

ates to processes for preparing transformed plant cells or organisms by transforming a population of plant cells which comprises at least one marker protein having a direct or indirect toxic effect for the population, with at least one nucleic acid sequence to be inserted in combination with at least one compound, preferably a DNA construct, capable of reducing the expression, amount, activity and/or function of the marker protein, with the transformed plant cells having a growth advantage over nontransformed cells, due to the action of the compound.

Description

RELATED APPLICATIONS

[0001]This application is a divisional application of U.S. application Ser. No. 10/522,341 which is a national stage application (under 35 U.S.C. §371) of PCT/EP2003/007877 filed Jul. 18, 2003, which claims benefit of German application 102 34 287.3 filed Jul. 26, 2002. The entire content of each above-mentioned application is hereby incorporated by reference in its entirety.

SUBMISSION OF SEQUENCE LISTING

[0002]The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is Sequence_List_--12810_--00982_US. The size of the text file is 307 KB, and the text file was created on Jan. 31, 2010.

FIELD OF THE INVENTION

[0003]The present invention relates to processes for preparing transformed plant cells or organisms by transforming a population of plant cells which comprises at least one marker protein having a direct or indirect toxic effect for said population, with at least one nucleic acid sequence to be inserted in combination with at least one compound, preferably a DNA construct, capable of reducing the expression, amount, activity and/or function of the marker protein, with the transformed plant cells having a growth advantage over nontransformed cells, due to the action of said compound.

BACKGROUND OF THE INVENTION

[0004]Genetic material is successfully introduced usually only into a very limited number of target cells of a population. This necessitates the distinction and isolation of successfully transformed from nontransformed cells, a process which is referred to as selection. Traditionally, the selection is carried out by way of a "positive" selection, wherein the transformed cell is enabled to grow and to survive, whereas the untransformed cell is inhibited in its growth or destroyed (McCormick et al. (1986) Plant Cell Reports 5:81-84). A positive selection of this kind is usually implemented by genes which code for a resistance to a biocide (e.g. a herbicide such as phosphinothricin, glyphosate or bromoxynil, a metabolism inhibitor such as 2-deoxyglucose 6-phosphate (WO 98/45456) or an antibiotic such as tetracycline, ampicillin, kanamycin, G 418, neomycin, bleomycin or hygromycin). Such genes are also referred to as positive selection markers. The positive selection marker is coupled (physically or by means of cotransformation) to the nucleic acid sequence to be introduced into the cell genome and is then introduced into the cell. Subsequently, the cells are cultured on a medium under the appropriate selection pressure (for example in the presence of an appropriate antibiotic or herbicide), whereby the transformed cells, owing to the required resistance to said selection pressure, have a growth/survival advantage and can thus be selected. Positive selection markers which may be mentioned by way of example are: [0005]phosphinothricin acetyltransferases (PAT) (also: Bialophos® resistance; bar) acetylate the free amino group of the glutamine synthase inhibitor phosphinothricin (PPT) and thus achieve a detoxification (de Block et al. (1987) EMBO J 6:2513-2518; Vickers J E et al. (1996) Plant Mol Biol Reporter 14:363-368; Thompson C J et al. (1987) EMBO J 6:2519-2523). [0006]5-enolpyruvylshikimate 3-phosphate synthases (EPSPS) impart a resistance to the unselective herbicide Glyphosat® (N-(phosphonomethyl)glycine; Steinrucken H C et al. (1980) Biochem Biophys Res Commun 94:1207-1212; Levin J G and Sprinson D B (1964) J Biol Chem 239:1142-1150; Cole D J (1985) Mode of action of glyphosate; A literature analysis, p. 48-74. In: Grossbard E and Atkinson D (eds.) The herbicide glyphosate. Buttersworths, Boston.). Glyphosate-tolerant EPSPS variants for use as selection markers have been described (Padgette S R et al. (1996). New weed control opportunities: development of soybeans with a Roundup Ready® gene. In: Herbicide Resistant Crops (Duke S O, ed.), pp. 53-84. CRC Press, Boca Raton, Fla.; Saroha M K and Malik V S (1998) J Plant Biochemistry and Biotechnology 7:65-72; Padgette S R et al.(1995) Crop Science 35(5):1451-1461; U.S. Pat. No. 5,510,471; U.S. Pat. No. 5,776,760; U.S. Pat. No. 5,864,425; U.S. Pat. No. 5,633,435; U.S. Pat. No. 5,627,061; U.S. Pat. No. 5,463,175; EP-A 0 218 571). [0007]neomycin phosphotransferases constantly impart a resistance to aminoglycoside antibiotics such as neomycin, G418, hygromycin, paromomycin or kanamycin by reducing the inhibiting action thereof by means of a phosphorylation reaction (Beck et al. (1982) Gene 19:327-336). [0008]2-deoxyglucose 6-phosphate phosphatases impart a resistance to 2-deoxyglucose (EP-A 0 807 836; Randez-Gil et al. (1995) Yeast 11:1233-1240; Sanz et al. (1994) Yeast 10:1195-1202). [0009]acetolactate synthases impart a resistance to imidazolinone/sulfonylurea herbicides (e.g. imazzamox, imazapyr, imazaquin, imazethapyr, amidosulforon, azimsulfuron, chlorimuron ethyl, chlorsulfuron; Sathasivan K et al. (1990) Nucleic Acids Res 18(8):2188).

[0010]In addition, resistance genes to the antibiotics hygromycin (hygromycin phosphotransferases), chloramphenicol (chloramphenicol acetyltransferase), tetracycline, streptomycin, zeocine and ampicillin (β-lactamase gene; Datta N, Richmond M H.(1966) Biochem J 98(1):204-9) have been described.

[0011]Genes such as isopentenyl transferase (ipt) from Agrobacterium tumefaciens (strain:PO22) (GenBank Acc. No.: AB025109) may likewise be used as selection markers. The ipt gene is a key enzyme of cytokine biosynthesis. Its overexpression facilitates the regeneration of plants (e.g. selection on cytokine-free medium) (Ebinuma H et al. (2000) Proc Natl Acad Sci USA 94:2117-2121; Ebinuma H et al. (2000) Selection of Marker-free transgenic plants using the oncogenes rol A, B, C) of Agrobacterium as selectable markers, In Molecular Biology of Woody Plants. Kluwer Academic Publishers). The disadvantages here are, firstly, the fact that the selection disadvantage is based on usually subtle differences in cell proliferation and, secondly, the fact that the plant acquires unwanted properties (gall tumor formation) due to transformation with an oncogene.

[0012]EP-A 0 601 092 describes various other positive selection markers. Examples which may be mentioned are: β-glucuronidase (in connection with, for example, cytokinine glucuronide), mannose 6-phosphate isomerase (in connection with mannose), UDP-galactose 4-epimerase (in connection with galactose, for example).

[0013]Negative selection markers are used for selecting organisms in which marker sequences have been successfully deleted (Koprek T et al. (1999) Plant J 19(6):719-726). In the presence of a negative selection marker, the corresponding cell is destroyed or experiences a growth disadvantage. Negative selection involves, for example, the negative selection marker introduced into the plant converting a compound which otherwise has no action disadvantageous to the plant into a compound with a disadvantageous (i.e. toxic) action. Examples of negative selection markers include: thymidine kinase (TK), for example of Herpes simplex virus (Wigler et al. (1977) Cell 11:223), cellular adenine phosphoribosyl transferase (APRT) (Wigler et al. (1979) Proc Natl Acad Sci USA 76:1373), hypoxanthine phosphoribosyl transferase (HPRT) (Jolly et al. (1983) Proc Natl Acad Sci USA 80:477), diphtheria toxin A fragment (DT-A), the bacterial xanthine-guanine phosphoribosyl transferase (gpt; Besnard et al. (1987) Mol. Cell. Biol. 7:4139; Mzoz and Moolten (1993) Human Gene Therapy 4:589-595), the codA gene product coding for a cytosine deaminase (Gleave A P et al. (1999) Plant Mol Biol. 40(2):223-35; Perera R J et al. (1993) Plant Mol Biol 23(4): 793-799; Stougaard J; (1993) Plant J 3:755-761; EP-A1 595 873), the cytochrome P450 gene (Koprek et al. (1999) Plant J 16:719-726), genes coding for a haloalkane dehalogenase (Naested H (1999) Plant J 18:571-576), the iaaH gene (Sundaresan V et al. (1995) Genes & Development 9:1797-1810) or the tms2 gene (Fedoroff N V & Smith D L (1993) Plant J 3: 273-289). The negative selection markers are usually employed in combination with "prodrugs" or "pro-toxins", compounds which are converted into toxins by the activity of the selection marker.

[0014]5-Methylthioribose (MTR) kinase is an enzyme whose enzymic activity in plants, bacteria and protozoa, but not in mammals, has been described. The enzyme may convert an MTR analog (5-(triromethyl)thioribose) as a "subversive substrate" of the methionine salvage pathway via an unstable intermediate to give the toxic compound carbothionyl difluoride.

[0015]Said selection systems have various disadvantages. The introduced selection marker (e.g. resistance to antibiotics) is justified only during transformation and selection but is later a usually unnecessary and often also undesired protein product. This may be disadvantageous for reasons of consumer acceptance and/or approval as a food and/or feed product. Another disadvantage in this connection is the fact that the selection marker used for selection is usually genetically coupled to the nucleic acid sequence to be inserted into the genome and cannot be decoupled by segregation during propagation or crossing. Usually, deletion of the marker sequence is required, making additional steps necessary. In addition, biotechnological studies require in numerous cases multiple transformation with various gene constructs. Here, each transformation step requires a new selection marker unless the previously used marker is to be laboriously deleted first. This, however, necessitates a broad palette of well-functioning selection markers which are not available for most plant organisms.

SUMMARY OF THE INVENTION

[0016]Consequently, it was the object of the invention to provide novel selection processes for selecting transformed plant cells and organisms, which, if possible, no longer have the disadvantages of the available systems. This object is achieved by the present invention.

[0017]The invention firstly relates to a process for preparing transformed plant cells or organisms, which process comprises the following steps: [0018]a) transforming a population of plant cells, with the cells of said population containing at least one marker protein capable of causing directly or indirectly a toxic effect for said population, with at least one nucleic acid sequence to be inserted in combination with at least one compound capable of reducing the expression, amount, activity and/or function of at least one marker protein, and [0019]b) selecting transformed plant cells whose genome contains said nucleic acid sequence and which have a growth advantage over nontransformed cells, due to the action of said compound, from said population of plant cells, the selection being carried out under conditions under which the marker protein can exert its toxic effect on the nontransformed cells.

[0020]In a preferred embodiment, the marker protein is a protein capable of converting directly or indirectly a substance X which is nontoxic for said population of plant cells into a substance Y which is toxic for said population. In this case, the process of the invention preferably comprises the following steps: [0021]a) transforming the population of plant cells with at least one nucleic acid sequence to be inserted in combination with at least one compound capable of reducing the expression, amount, activity and/or function of at least one marker protein, and [0022]b) treating said population of plant cells with the substance X at a concentration which causes a toxic effect for nontransformed cells, due to the conversion by the marker protein, and [0023]c) selecting transformed plant cells whose genome contains said inserted nucleic acid sequence and which have a growth advantage over nontransformed cells, due to the action of said compound, from said population of plant cells, the selection being carried out under conditions under which the marker protein can exert its toxic effect on the nontransformed cells.

[0024]The nontoxic substance X is preferably a substance which does not naturally occur in plant cells or organisms or occurs naturally therein only at a concentration which can essentially not cause any toxic effect. In the scope of the process of the invention, preference is given to applying the nontoxic substance X exogenously, for example via the medium or the growth substrate.

[0025]The term "compound capable of reducing the expression, amount, activity and/or function of at least one marker protein" is to be understood broadly and generally means any compounds which cause, directly or indirectly, alone or in cooperation with other factors, a reduction in the amount of protein, amount of RNA, gene activity, protein activity or protein function of at least one marker protein. Said compounds are also referred to under the generic term "anti-marker protein" compounds. The term "anti-marker protein" compound includes in particular, but is not limited to, the nucleic acid sequences, ribonucleic acid sequences, double-stranded ribonucleic acid sequences, antisense ribonucleic acid sequences, expression cassettes, peptides, proteins or other factors used in the preferred embodiments within the scope of the process of the invention.

[0026]In a preferred embodiment, "anti-marker protein" compound means a DNA construct comprising [0027]a) at least one expression cassette suitable for expressing a ribonucleic acid sequence and/or, if appropriate, a protein, said nucleic acid sequence and/or protein being capable of reducing the expression, amount, activity and/or function of the marker protein, or [0028]b) at least one sequence which causes a partial or complete deletion or inversion of the sequence coding for said marker protein and thus enables the expression, amount, activity and/or function of the marker protein to be reduced, and also, if appropriate, further functional elements which facilitate and/or promote said deletion or inversion, or [0029]c) at least one sequence which causes an insertion into the sequence coding for said marker protein and thus enables the expression, amount, activity and/or function of the marker protein to be reduced, and also, if appropriate, further functional elements which facilitate and/or promote said insertion.

[0030]The process of the invention stops the negative-selective action of the marker protein. To this extent, an "anti-marker protein" compound acts directly (e.g. via inactivation by means of insertion into the gene coding for the marker protein) or indirectly (e.g. by means of the ribonucleic acid sequence expressed via the expression cassette and/or, where appropriate, of the protein translated therefrom) as a positive selection marker. Hence, the selection system of the invention is to be referred to as a "reverse selection system", since it "reverts" the negative-selective action of the marker protein.

[0031]The process of the invention means a drastic broadening of the repertoire of positive selection processes for selecting transformed plant cells.

[0032]Another advantage is the fact that in a particular, preferred embodiment (e.g. via the action of a double-stranded or antisense RNA), it is possible to implement the selection effect without expressing a foreign protein (see below).

[0033]It is also advantageous that the marker protein used indirectly for selection (e.g. the negative selection marker) is not coupled genetically to the nucleic acid sequence to be inserted into the genome. In contrast to the otherwise customary selection processes, the marker protein, if it is a transgene, may be removed by simple segregation in the course of subsequent propagation or crossing.

[0034]"Plant cell" means within the scope of the present invention any type of cell which has been derived from a plant organism or is present therein. In this context, the term includes by way of example protoplasts, callus or cell cultures, microspores, pollen, cells in the form of tissues such as leaves, meristem, flowers, embryos, roots, etc. Included are, in particular, all of those cells and cell populations which are suitable as target tissues for a transformation.

[0035]In this context, "plant organism" comprises any organism capable of photosynthesis and also the cells, tissues, parts or propagation material (such as seeds or fruits) derived therefrom. Included within the scope of the invention are all genera and species of higher and lower plants of the plant kingdom. Preference is given to annual, perennial, monocotyledonous and dicotyledonous plants and also gymnosperms.

[0036]"Plant" means within the scope of the invention all genera and species of higher and lower plants of the plant kingdom. The term includes the mature plants, seed, shoots and seedlings, and also parts, propagation material (for example tubers, seeds or fruits), plant organs, tissues, protoplasts, callus and other cultures, for example cell cultures, derived therefrom, and also any other types of groupings of plant cells to give functional or structural units. Mature plants means plants at any developmental stage beyond that of the seedling. Seedling means a young immature plant at an early developmental stage. "Plant" comprises all annual and perennial monocotyledonous and dicotyledonous plants and includes by way of example but not by limitation those of the genera Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solarium, Petunia, Digitalis, Majorana, Cichorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Zea, Avena, Hordeum, Secale, Triticum, Sorghum, Picea and Populus.

[0037]Preference is given to plants of the following plant families: Amaranthaceae, Asteraceae, Brassicaceae, Carophyllaceae, Chenopodiaceae, Compositae, Cruciferae, Cucurbitaceae, Labiatae, Leguminosae, Papilionoideae, Liliaceae, Linaceae, Malvaceae, Rosaceae, Rubiaceae, Saxifragaceae, Scrophulariaceae, Solanacea, Sterculiaceae, Tetragoniacea, Theaceae, Umbelliferae.

[0038]Preferred monocotyledonous plants are selected in particular from the monocotyledonous crop plants such as, for example, those in the family of Gramineae such as alfalfa, rice, corn, wheat or other cereal species such as barley, millet, rye, triticale or oats and also from sugar cane and all grass species.

[0039]Preferred dicotyledonous plants are selected in particular from the dicotyledonous crop plants such as, for example, [0040]Asteraceae, such as sunflower, tagetes or calendula and others, [0041]Compositae, in particular the genus Lactuca, very especially the species sativa (lettuce) and others, [0042]Cruciferae, especially the genus Brassica, very especially the species napus (oilseed rape), campestris (beet), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv Emperor (broccoli) and other cabbage species; and the genus Arabidopsis, very especially the species thaliana, and cress or canola and others, [0043]Cucurbitaceae, such as melon, pumpkin/squash or zucchini and others, [0044]Leguminosae, especially the genus Glycine, very especially the species max (soybean) and alfalfa, pea, bean plant or peanut, and others [0045]Rubiaceae, preferably the subclass Lamiidae, such as, for example, Coffea equenc or Coffea liberica (coffee bush) and others, [0046]Solanaceae, in particular the genus Lycopersicon, very especially the species esculentum (tomato), the genus Solanum, very especially the species tuberosum (potato) and melongena (eggplant), and the genus Capsicum, very especially the species annuum (pepper) and tobacco and others, [0047]Sterculiaceae, preferably the subclass Dilleniidae, such as, for example, Theobroma cacao (cacao tree) and others, [0048]Theaceae, preferably the subclass Dilleniidae, such as, for example, Camellia sinensis or Thea sinensis (tea shrub) and others, [0049]Umbelliferae, especially the genus Daucus (very especially the species carota (carrot)) and Apium (very especially the species graveolens dulce (celery)) and others,and linseed, cotton, hemp, flax, cucumber, spinach, carrot, sugar beet and the various tree, nut and grapevine species, in particular banana and kiwi.

[0050]Plant organisms for the purposes of the invention are furthermore other photosynthetically active capable organisms such as, for example, algae, cyanobacteria and mosses. Preferred algae are green algae such as, for example, algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particular preference is given to Synechocystis.

[0051]Particular preference is given to the group of plants, consisting of wheat, oats, millet, barley, rye, corn, rice, buckwheat, sorghum, triticale, spelt, linseed, sugar cane, oilseed rape, cress, Arabidopsis, cabbage species, soybean, alfalfa, pea, bean plants, peanut, potato, tobacco, tomato, eggplant, paprika, sunflower, tagetes, lettuce, calendula, melon, pumpkin and zucchini.

[0052]Most preference is given to [0053]a) plants suitable for producing oil, such as, for example, oilseed rape, sunflower, sesame, safflower (Carthamus tinctorius), olive tree, soybean, corn, peanut, ricinus, oil palm, wheat, cacao tree or various nut species such as, for example, walnut, coconut or almond. Among these, particular preference is in turn given to dicotyledonous plants, in particular oilseed rape, soybean and sunflower. [0054]b) plants suitable for producing starch, such as corn, wheat or potato, for example. [0055]c) plants which are utilized as food and/or feedstuff and/or as useful plants and in which a resistance to pathogens would be advantageous, such as barley, rye, rice, potato, cotton, flax or linseed, for example. [0056]d) plants which may be suitable for producing fine chemicals such as, for example, vitamins and/or carotenoids, such as oilseed rape, for example.

[0057]"Population of plant cells" means any group of plant cells, which may be subjected within the scope of the present invention to a transformation and from which transgenic plant cells transformed by the process of the invention may be obtained and isolated. In this context, said population may also be, for example, a plant tissue, organ or a cell culture, etc. Said population may comprise by way of example but not by limitation an isolated zygote, an isolated immature embryo, embryogenic callus, plant or else various flower tissues (both in vitro and in vivo).

[0058]"Genome" means the entirety of genetic information of a plant cell and comprises both genetic information of the nucleus and that of the plastids (e.g. chloroplasts) and mitochondria. However, genome preferably means the genetic information of the nucleus (for example of the nuclear chromosomes).

[0059]"Selection" means identifying and/or isolating successfully transformed plant cells from a population of nontransformed cells by using the process of the invention. This does not necessarily require that the selection be carried out directly with the transformed cells immediately after transformation. It is also possible to carry out the selection only at a later time, even with a later generation of the plant organisms (or cells, tissues, organs or propagation material derived therefrom) resulting from the transformation. Thus it is possible, for example, to transform Arabidopsis plants directly using, for example, the vacuum infiltration method (Clough S & Bent A (1998) Plant J 16(6):735-43; Bechtold N et al. (1993) CR Acad Sci Paris 1144(2):204-212), which subsequently produce transgenic seeds which may then be subjected to selection.

[0060]The fact that the nucleic acid sequence to be inserted is transformed "in combination with" the "anti-marker protein" compound (e.g. a DNA construct) is to be understood broadly and means that at least one nucleic acid sequence to be inserted and at least one "anti-marker protein" compound are functionally coupled to one another so that the presence of the "anti-marker protein" compound in the plant cell, and of the selection advantage related thereto, indicates the parallel presence of the inserted nucleic acid sequence as likely. The nucleic acid sequence to be inserted and the "anti-marker protein" compound (e.g. a DNA construct) here may be, preferably but not necessarily, part of a single nucleic acid construct (e.g. a transformation construct or transformation vector), i.e. be present physicochemically coupled via a covalent bond. However, they may also be jointly introduced separately, for example in the course of a cotransformation, and exert their function within the scope of the process of the invention also in this way. In the case of the "anti-marker protein compound" acting via expressing an RNA (e.g. an antisense RNA or double-stranded RNA) or being such an RNA, "in combination" may also include those embodiments in which said RNA and the RNA expressed by the nucleic acid sequence inserted into the genome form an RNA strand.

[0061]"Nontoxic substance X" generally means substances which, compared to their reaction product Y, under otherwise identical conditions, have a reduced, preferably an essentially lacking biological activity, preferably toxicity. In this context, the toxicity of substance Y is at least twice as high as that of substance X, preferably at least five times as high, particularly preferably at least ten times as high, very particularly preferably at least twenty times as high, most preferably at least one hundred times as high. "Identical conditions" here means that all conditions are kept the same, apart from the different substances X and Y. Accordingly, identical molar concentrations of X and Y are used, with the medium, temperature, type of organism and density of organism, etc. being the same. The substance X may be converted to the substance Y in various ways, for example by hydrolysis, deamination, hydrolysis, dephosphorylation, phosphorylation, oxidation or any other type of activation, metabolization or conversion. The substance X may be, by way of example but not by limitation, the inactive precursor or derivative of a plant growth regulator or herbicide.

[0062]"Toxicity" or "toxic effect" means a measurable, negative influence on the physiology of the plant or of the plant cell and may comprise here symptoms such as, for example, but not limited thereto, a reduced or disrupted growth, a reduced or disrupted rate of photosynthesis, a reduced or disrupted cell division, a reduced or disrupted regeneration of a complete plant from cell culture or callus, etc.

[0063]The plant cells successfully transformed by means of the process of the invention may, to put it differently, have a growth advantage or selection advantage over the nontransformed cells of the same starting population under the influence of the substance "X". Growth or selection advantage is to be understood here broadly and means, for example, the fact that said transformed plant cells are capable of forming shoots and/or can be regenerated to give complete plants, whereas the nontransformed cells can do this only with a marked delay, if at all.

[0064]The term of "marker protein" is to be understood broadly and generally means all of those proteins which are capable of [0065]i) exerting per se a toxic effect on the plant or plant cell, or [0066]ii) converting directly or indirectly a nontoxic substance X into a substance Y which is toxic for the plant or plant cell.

[0067]In this context, the marker protein may be a plant-intrinsic, endogenous gene or else a transgene from a different organism. Preferably, the marker protein itself has no essential function for the organism including the marker protein. If the marker protein per se exerts a toxic effect, then it will preferably be expressed, for example, under an inducible promoter rather than constitutively.

[0068]Preferably, however, the marker protein converts directly or indirectly a nontoxic substance X into a substance Y which is toxic for the plant or plant cell. Particularly preferred marker proteins are the "negative selection markers" as are used, for example, in the course of targeted deletions from the genome.

[0069]Examples of marker proteins which may be mentioned but which are not limiting are: [0070](a) cytosine deaminases (CodA or Cdase), with preference being given to using as the nontoxic substance X substances such as 5-fluorocytosine (5-FC). Cytosine deaminases catalyze the deamination of cytosine to give uracil (Kilstrup M et al. (1989) J Bacteriol 171:2124-2127; Anderson L et al. (1989) Arch Microbiol 152:115-118). Bacteria and fungi which have Cdase activity convert 5-FC to the toxic metabolite ("Y") 5-fluorouracil (5-FU) (Polak A & Scholer H J (1975) Chemotherapy (Basel) 21:113-130). 5-FC itself has low toxicity (Bennett J E, in Goodman and Gilman: the Pharmacological Basis of Therapeutics. 8^th ed., eds. Gilman A G et al. (Pergamon Press, New York) pp. 1165-1181). However, 5-FU has a highly cytotoxic effect, since it is subsequently metabolized to fluoro-UTP (FUTP) and fluoro-dUMP (FdUMP) and thus inhibits

[0071]RNA and DNA synthesis (Calabrisi P & Chabner B A in Goodman and Gilman: the Pharmacological Basis of Therapeutics. 8^th ed., eds. Gilman A G et al. (Pergamon Press, New York) pp. 1209-1263); Damon L E et al. (1989) Pharmac Ther 43:155-189).

[0072]Cells of higher plants and mammalian cells have no significant Cdase activity and cannot deaminase 5-FC (Polak A et al. (1976) Chemotherapy 22:137-153; Koechlin B A et al. (1966) Biochemical Pharmacology 15:434-446). In this respect, the Cdase is introduced as a transgene (e.g. in the form of a transgenic expression cassette) into plant organisms in the course of the process of the invention. Corresponding transgenic plant cells or organisms are then used as masterplants as starting material. Appropriate Cdase sequences, transgenic plant organisms and the process of carrying out negative selection processes using, for example, 5-FC as nontoxic substance X, are known to the skilled worker (WO 93/01281; U.S. Pat. No. 5,358,866; Gleave A P et al. (1999) Plant Mol Biol 40(2):223-35; Perera R J et al. (1993) Plant Mol Biol 23(4):793-799; Stougaard J (1993) Plant J 3:755-761); EP-A1 595 837; Mullen C A et al. (1992) Proc Natl Acad Sci USA 89(1):33-37; Kobayashi T et al. (1995) Jpn J Genet 70(3):409-422; Schlaman H R M & Hooykaas P F F (1997) Plant J 11:1377-1385; Xiaohui Wang H et al. (2001) Gene 272(1-2): 249-255; Koprek T et al. (1999) Plant J 19(6):719-726; Gleave A P et al. (1999) Plant Mol Biol 40(2):223-235; Gallego M E (1999) Plant Mol Biol 39(1):83-93; Salomon S & Puchta H (1998) EMBO J 17(20):6086-6095; Thykjaer T et al. (1997) Plant Mol Biol 35(4):523-530; Serino G (1997) Plant J 12(3):697-701; Risseeuw E (1997) Plant J 11(4):717-728; Blanc V et al. (1996) Biochimie 78(6):511-517; Corneille S et al. (2001) Plant J 27:171-178). Cytosine deaminases and the genes coding equence may be obtained from a multiplicity of organisms, preferably microorganisms such as, for example, the fungi Cryptococcus neoformans, Candida albicans, Torulopsis glabrata, Sporothrix schenckii, Aspergillus, Cladosporium and Phialophora (J E Bennett, Chapter 50: Antifungal Agents, in Goodman and Gilman's the Pharmacological Basis of Therapeutics 8^th ed., A. G. Gilman, ed., Pergamon Press, New York, 1990) and the bacteria E. coli and Salmonella typhimurium (Andersen L et al. (1989) Arch Microbiol 152:115-118). [0073]The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0074]Particular preference is given to sequences according to GenBank Acc. No: S56903, and to the modified codA sequences described in EP-A1 595 873, which make expression in eukaryotes possible. Preference is given here to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 2 or, preferably, 4, in particular the sequences according to SEQ ID NO: 1 or, preferably, 3. [0075](b) cytochrome P-450 enzymes, in particular the bacterial cytochrome P-450 SU1 gene product (CYP105A1) from Streptomyces griseolus (strain ATCC 11796), with preference being given to using as nontoxic substance X substances such as the pro sulfonylurea herbicide R7402 (2-methylethyl-2-3-dihydro-N-[(4,6-dimethoxypyrimidin-2-yl)aminocarbonyl]- -1,2-benzoisothiazole-7-sulfonamide 1,1-dioxide). Corresponding sequences and the process of carrying out negative selection processes using, for example, R7402 as nontoxic substance X are known to the skilled worker (O'Keefe D P et al. (1994) Plant Physiol 105:473-482; Tissier A F et al. (1999) Plant Cell 11:1841-1852; Koprek T et al. (1999) Plant J 19(6):719-726; O'Keefe D P (1991) Biochemistry 30(2):447-55). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0076]Particular preference is given to sequences according to GenBank Acc. No: M32238. Preference is further given to nucleic acid sequences coding for the polypeptide according to SEQ ID NO: 6, in particular the sequence according to SEQ ID NO: 5. [0077](c) indoleacetic acid hydrolases such as, for example, Agrobacterium tumefaciens, tms2 gene product, with preference being given to using as nontoxic substance X substances such as auxin amide compounds or naphthaleneacetamide (NAM) (with NAM being converted to naphthaleneacetic acid, a phytotoxic substance). Corresponding sequences and the process of carrying out negative selection processes using, for example, NAM as nontoxic substance X are known to the skilled worker (Fedoroff N V & Smith D L (1993) Plant J 3:273-289; Upadhyaya N M et al. (2000) Plant Mol Biol Rep 18:227-223; Depicker A G et al. (1988) Plant Cell rep 104:1067-1071; Karlin-Neumannn G A et al. (1991) Plant Cell 3:573-582; Sundaresan V et al. (1995) Gene Develop 9:1797-1810; Cecchini E et al. (1998) Mutat Res 401(1-2):199-206; Zubko E et al. (2000) Nat Biotechnol 18:442-445). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0078]Particular preference is given to sequences according to GenBank Acc. No: NC_--003308 (Protein_id=''NP_--536128.1), AE009419, AB016260 (Protein_id=''BAA87807.1) and NC002147. Preference is further given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 8 or 10, in particular the sequences according to SEQ ID NO: 7 or 9. [0079](d) haloalkane dehalogenases (dhlA gene product), for example from Xanthobacter autotropicus GJ10. The dehalogenase hydrolyzes dihaloalkanes such as 1,2-dichloroethane (DCE) to give halogenated alcohols and inorganic halides (Naested H et al. (1999) Plant J 18(5)571-576; Janssen D B et al. (1994) Annu Rev Microbiol 48: 163-191; Janssen D B (1989) J Bacteriol 171(12):6791-9). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0080]Particular preference is given to sequences according to GenBank Acc. No: M26950. Preference is further given to nucleic acid sequences coding for the polypeptide according to SEQ ID NO: 12, in particular the sequence according to SEQ ID NO: 11. [0081](e) thymidine kinases (TK), in particular viral TKs from viruses such as Herpes simplex virus, SV40, cytomegalovirus, Varicella zoster virus, in particular the TK of Herpes simplex virus type 1 (TK HSV-1), with preference being given to using as nontoxic substance X substances such as Acyclovir, Ganciclovir or 1,2-deoxy-2-fluoro-(β-D-arabinofuranosil-5-iodouracil (FIAU). Corresponding sequences and the process of carrying out negative selection processes using, for example, Acyclovir, Ganciclovir or FIAU as nontoxic substance X are known to the skilled worker (Czako M & Marton L (1994) Plant Physiol 104:1067-1071; Wigler M et al. (1977) Cell 11(1):223-232; McKnight S L et al. (1980) Nucl Acids Res 8(24):5949-5964; McKnight S L et al. (1980) Nucl Acids Res 8(24):5931-5948; Preston et al. (1981) J Virol 38(2):593-605; Wagner et al. (1981) Proc Natl Acad Sci USA 78(3):1441-1445; St. Clair et al.(1987) Antimicrob Agents Chemother 31(6):844-849). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0082]Particular preference is given to sequences according to GenBank Acc. No: J02224, V00470 and V00467. Preference is also given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 14 or 16, in particular the sequences according to SEQ ID NO: 13 or 15. [0083](f) guanine phosphoribosyl transferases, hypoxanthine phosphoribosyl transferases or xanthine guanine phosphoribosyl transferases, with preference being given to using as nontoxic substance X substances such as 6-thioxanthine or allopurinol. Preference is given to guanine phosphoribosyl transferases (gpt), for example from E. Coli (Besnard et al. (1987) Mol Cell Biol 7:4139; Mzoz and Moolten (1993) Human Gene Therapy 4:589-595; Ono et al. (1997) Hum Gene Ther 8(17):2043-55), hypoxanthine phosphoribosyl transferases (HPRT; Jolly et al. (1983) Proc Natl Acad Sci USA 80:477; Fonwick "The HGPRT System", pp. 333-373, M. Gottesman (ed.), Molecular Cell Genetics, John Wiley and Sons, New York, 1985), xanthine guanine phosphoribosyl transferases, for example from Toxoplasma gondii (Knoll L J et al.(1998) Mol Cell Biol 18(2):807-814; Donald R G et al. (1996) J Biol Chem 271(24):14010-14019). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0084]Particular preference is given to sequences according to GenBank Acc. No: U10247 (Toxoplasma gondii HXGPRT), M13422 (E. coli gpt) and X00221 (E. coli gpt). Preference is also given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 18, 20 or 22, in particular the sequences according to SEQ ID NO: 17, 19 or 21. [0085](g) purine nucleoside phosphorylases (PNP; DeoD gene product), for example from E. coli, with preference being given to using as nontoxic substance X substances such as 6-methylpurine deoxyribonucleoside. Corresponding sequences and the process of carrying out negative selection processes using, for example, 6-methylpurine deoxyribonucleoside as nontoxic substance X are known to the skilled worker (Sorscher E J et al. (1994) Gene Therapy 1:233-238). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0086]Particular preference is given to sequences according to GenBank Acc. No: M60917. Preference is also given to nucleic acid sequences coding for the polypeptide according to SEQ ID NO: 24, in particular the sequence according to SEQ ID NO: 23. [0087]h) phosphonate monoester hydrolases which convert inactive ester derivatives of the herbicide glyphosate (e.g. glycerylglyphosate) into the active form of the herbicide. Corresponding sequences and the process of carrying out negative selection processes using, for example, glycerylglyphosate are known to the skilled worker (U.S. Pat. No. 5,254,801; Dotson S B et al. (1996) Plant J 10(2):383-392; Dotson S B et al. (1996) J Biol Chem 271(42): 25754-25761). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0088]Particular preference is given to sequences according to GenBank Acc. No: U44852. Preference is also given to nucleic acid sequences coding for the polypeptide according to SEQ ID NO: 26, in particular the sequence according to SEQ ID NO: 25. [0089](i) aux-1 and, preferably, aux-2 gene products, for example of the Ti plasmids of Agrobacterium strains such as A. rhizogenes or A. tumefaciens (Beclin C et al. (1993) Transgenics Res 2:4855); Gaudin V, Jouanin L. (1995) Plant Mol Biol. 28(1):123-36. [0090]The activity of the two enzymes causes the plant cell to produce indoleacetamide (IAA). Aux-1 encodes an indoleacetamide synthase (IAMS) and converts tryptophan into indoleacetamide (VanOnckelen et al. (1986) FEBS Lett. 198: 357-360). Aux-2 encodes the enzyme indoleacetamide hydrolase (IAMH) and converts indoleacetamide, a substance without phytohormone activity, into the active auxin indoleacetic acid (Inze D et al. (1984) Mol Gen Genet 194:265-274; Tomashow et al. (1984) Proc Natl Acad Sci USA 81:5071-5075; Schroder et al. (1984) Eur J Biochem 138:387-391). The enzyme IAMH may also hydrolyze a number of indoleamide substrates such as, for example, naphthaleneacetamide, the latter being converted into the plant growth regulator naphthaleneacetic acid (NAA). The use of the IAMH gene as a negative selection marker is described, for example, in U.S. Pat. No. 5,180,873. Corresponding enzymes have also been described in A. rhizogenes, A. vitis (Canaday J et al. (1992) Mol Gen Genet 235:292-303) and Pseudomonas savastanoi (Yamada et al. (1985) Proc Natl Acad Sci USA 82:6522-6526). The use as a negative selection marker for destroying particular cell tissues (e.g. pollen; U.S. Pat. No. 5,426,041) or transgenic plants (U.S. Pat. No. 5,180,873) has been described. Corresponding sequences and the process of carrying out negative selection processes using, for example, naphthaleneacetamide are known to the skilled worker (see above). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0091]Particular preference is given to sequences according to the GenBank Acc. No: M61151, AF039169 and AB025110. Preference is also given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 28, 30, 32, 34 or 36, in particular the sequences according to SEQ ID NO: 27, 29, 31, 33 or 35. [0092](j) adenine phosphoribosyl transferases (APRT), with preference being given to using as nontoxic substance X substances such as 4-aminopyrazolopyrimidine. Corresponding sequences and the process of carrying out negative selection processes with use are known to the skilled worker (Wigler M et al. (1979) Proc Natl Acad Sci USA 76(3):1373-6; Taylor et al. "The APRT Systern", pp., 311-332, M. Gottesman (ed.), Molecular Cell Genetics, John Wiley and Sons, New York, 1985). [0093]k) methoxinine dehydrogenases, with preference being given to using as nontoxic substance X substances such as 2-amino-4-methoxybutanoic acid (methoxinine) which is converted into the toxic methoxyvinyl glycine (Margraff R et al. (1980) Experimentia 36: 846). [0094]l) rhizobitoxin synthases, with preference being given to using as nontoxic substance X substances such as 2-amino-4-methoxybutanoic acid (methoxinine) which is converted into the toxic 2-amino-4-[2-amino-3-hydroxypropyl]-trans-3-butanoic acid (rhizobitoxin) (Owens L D et al. (1973) Weed Science 21:63-66), [0095]m) 5-methylthioribose (MTR) kinases, with preference being given to using as nontoxic substance X substances such as 5-(trifluoromethyl)thioribose (MTR analog, "subversive substrate") which is converted, via an unstable intermediate, into the toxic substance (Y) carbothionyl difluoride. The MTR kinase is a key enzyme of the methionine salvage pathway. Corresponding enzyme activities have been described in plants, bacteria and protozoa but not in mammals. MTR kinases of various species have been identified owing to defined sequence motifs (Sekowska A et al. (2001) BMC Microbiol 1:15). Corresponding sequences and the process of carrying out negative selection processes using, for example, 5-(trifluoromethyl)thioribose are known to the skilled worker and readily obtainable from the appropriate sequence database (e.g. GenBank) (Sekowska A et al. (2001) BMC Microbiol 1:15; Cornell K A et al. (1996) 317:285-290). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0096]However, a plant MTR kinase has not yet been identified unambiguously and is provided within the scope of the process of the invention (SEQ ID NO: 39 and, respectively, 40). In addition, homologs from other plant species are provided, namely from corn (SEQ ID NO: 59 and, respectively, 60), oilseed rape (SEQ ID NO: 61, 63 and, respectively, 62, 64), rice (SEQ ID NO: 65 and, respectively, 66) and soybean (SEQ ID NO: 67 and, respectively, 68). [0097]Accordingly, the invention further relates to amino acid sequences encoding a plant 5-methylthioribose kinase, wherein said amino acid sequence contains at least one sequence selected from the group consisting of SEQ ID NO: 60, 62, 64, 66 or 68.

[0098]Accordingly, the invention further relates to nucleic acid sequences encoding a plant 5-methylthioribose kinase, wherein said nucleic acid sequence contains at least one sequence selected from the group consisting of SEQ ID NO: 59, 61, 63, 65 or 67. Even if said sequences are in parts only fragments of complete cDNAs, their length is nevertheless more than sufficient in order to ensure a use and functionality as antisense RNA or double-stranded RNA. Preference is given to using as marker protein a plant endogenous MTR kinase. Further endogenous plant MTR kinases may readily be identified by means of screening databases or gene libraries using conserved, MTK kinase-typical motifs. Said motifs may be derived from FIG. 9a-b, for example. Such motifs may comprise, by way of example but not by limitation, the following sequences:

TABLE-US-00001 [0098] E(V/I)GDGN(L/I)N(L/Y/F)V(F/Y), (SEQ ID NO: 72) preferably EVGDGNLN(Y/F)V(F/Y) (SEQ ID NO: 73) KQALPY(V/I)RC (SEQ ID NO: 74) SWPMT(R/K)ERAYF (SEQ ID NO: 75) PEVYHFDRT (SEQ ID NO: 76) GMRY(I/L)EPPHI (SEQ ID NO: 77) CRLTEQVVFSDPY (SEQ ID NO: 78) HGDLH(S/T)GS (SEQ ID NO: 79)

[0099]Further suitable motifs may be derived from FIG. 9a-b without difficulty. [0100]Particular preference is given to sequences according to GenBank Acc. No: AF212863 or AC079674 (Protein_ID=AAG51775.1). Preference is also given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 38 or 40, in particular the sequences according to SEQ ID NO: 37 or 39. [0101]n) alcohol dehydrogenases (Adh), in particular plant Adh-1 gene products, with preference being given to using as nontoxic substance X substances such as allyl alcohol which is converted in this manner into the toxic substance (Y) acrolein. Corresponding sequences and the process of carrying out negative selection processes using, for example, allyl alcohol are known to the skilled worker and readily obtainable from the appropriate sequence database (e.g. GenBank) (Wisman E et al. (1991) Mol Gen Genet 226(1-2):120-8; Jacobs M et al. (1988) Biochem Genet 26(1-2):105-22; Schwartz D. (1981) Environ Health Perspect 37:75-7). The sequences, materials and processes disclosed in the context of said publications are hereby explicitly referred to. [0102]Particular preference is given to sequences according to GenBank Acc. No: X77943, M12196, AF172282, X04049 or AF253472. Preference is also given to nucleic acid sequences coding for polypeptides according to SEQ ID NO: 42, 44, 46 or 48, in particular the sequences according to SEQ ID NO: 41, 43, 45 or 47. [0103](o) Further suitable negative selection markers are those sequences which exert per se a toxic action on plant cells, such as, for example, diphtheria toxin A, ribonucleases such as barnase and also ribosome-inhibiting proteins such as ricin. In this context, these proteins are preferably expressed in the plant cells inducibly rather than constitutively. The induction is preferably carried out chemically, it being possible, for example, to use the chemically inducible promoters mentioned below in order to ensure said chemically induced expression.

[0104]"Reduction" or "to reduce" is to be interpreted broadly in connection with a marker protein or with its amount, expression, activity and/or function and comprises the partial or essentially complete stopping or blocking, based on different cell-biological mechanisms, of the functionality of a marker protein in a plant cell, plant or a part, tissue, organ, cells or seeds derived therefrom.

[0105]A reduction for the purpose of the invention also comprises a reduction of the amount of a marker protein down to an essentially complete lack of said marker protein (i.e. a lack of detectability of marker protein activity or marker protein function or a lack of immunological detectability of said marker protein). In this context, expression of a particular marker protein (or of its amount, expression, activity and/or function) in a cell or an organism is reduced preferably by more than 50%, particularly preferably by more than 80%, very particularly preferably by more than 90%, most preferably by more than 98%. Reduction means in particular also the complete lack of the marker protein (or of its amount, expression, activity and/or function). In this context, activity and/or function mean preferably the property of the marker protein of exerting a toxic effect on the plant cell or the plant organism and, respectively, the ability to convert the substance X into the substance Y. The toxic effect caused by the marker protein is reduced preferably by more than 50%, particularly preferably by more than 80%, very particularly preferably by more than 90%, most preferably by more than 98%. "Reduction" includes of course within the scope of the present invention also a complete, 100% reduction or removal of the marker protein (or of its amount, expression, activity and/or function) (for example by deleting the marker protein gene from the genome).

[0106]The invention comprises various strategies for reducing the expression, amount, activity and/or function of the marker protein. The skilled worker appreciates the fact that a number of various methods are available in order to influence the expression, amount, activity and/or function of a marker protein in the desired way. Examples which may be mentioned but which are not limiting are: [0107]a) introducing at least one marker protein double-stranded ribonucleic acid sequence (MP-dsRNA) or an expression cassette or expression cassettes ensuring expression thereof. Included are those processes in which the MP-dsRNA is directed against a marker protein gene (i.e. genomic DNA sequences such as promoter sequences) or a marker protein gene transcript (i.e. mRNA sequences). [0108]b) introducing at least one marker protein antisense ribonucleic acid sequence (MP-antisenseRNA) or an expression cassette ensuring expression thereof. Included are those processes in which the MP-antisenseRNA is directed against a marker protein gene (i.e. genomic DNA sequences) or a marker protein gene transcript (i.e. RNA sequences). α-anomeric nucleic acid sequences are also included. [0109]c) introducing at least one MP-antisenseRNA combined with a ribozyme or an expression cassette ensuring expression thereof [0110]d) introducing at least one marker protein sense ribonucleic acid sequence (MP-senseRNA) for inducing a cosuppression or an expression cassette ensuring expression thereof [0111]e) introducing at least one DNA- or protein-binding factor against a marker protein gene, marker protein RNA or marker protein or an expression cassette ensuring expression thereof [0112]f) introducing at least one viral nucleic acid sequence causing degradation of the marker protein RNA or an expression cassette ensuring expression thereof [0113]g) introducing at least one construct for generating a functional loss (e.g. generation of stop codons, shifts in the reading frame etc.) on a marker protein gene, for example by generating an insertion, deletion, inversion or mutation in a marker protein gene. Preferably, knockout mutants may be generated by means of targeted insertion into said marker protein gene via homologous recombination or by introducing sequence-specific nucleases against marker protein gene sequences.

[0114]It is known to the skilled worker that it is also possible to use other processes within the scope of the present invention in order to reduce a marker protein or its activity or function. For example, it may also be advantageous, depending on the type of the marker protein used, to introduce a dominant-negative variant of a marker protein or an expression cassette ensuring expression thereof. In this context, any single one of these processes may cause a reduction in the expression, amount, activity and/or function of a marker protein. A combined application is also conceivable. Further methods are known to the skilled worker and may comprise hindering or stopping the processing of the marker protein, the transport of the marker protein or of its mRNA, the inhibition of ribosome attachment, the inhibition of RNA splicing, the induction of an enzyme degrading marker protein RNA and/or the inhibition of translational elongation or termination.

[0115]The embodiments below will describe by way of example the individual preferred processes: [0116]a) Introducing a double-stranded ribonucleic acid sequence of a marker protein (MP-dsRNA)

[0117]The process of gene regulation by means of double-stranded RNA ("double-stranded RNA interference"; dsRNAi) has been described many times for animal and plant organisms (e.g. Matzke M A et al. (2000) Plant Mol Biol 43:401-415; Fire A. Et al (1998) Nature 391:806-811; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364). The processes and methods described in the references indicated are hereby explicitly referred to. dsRNAi processes are based on the phenomenon that simultaneously introducing the complementary strand and contour strand of a gene transcript suppresses expression of the corresponding gene in a highly efficient manner. Preferably, the phenotype caused is very similar to that of a corresponding knockout mutant (Waterhouse P M et al. (1998) Proc Natl Acad Sci USA 95:13959-64). The dsRNAi process has proved to be particularly efficient and advantageous in reducing marker protein expression.

[0118]Double-stranded RNA molecule means within the scope of the invention preferably one or more ribonucleic acid sequences which, owing to complementary sequences, are theoretically (e.g. according to the base pair rules by Watson and Crick) and/or actually (e.g. owing to hybridization experiments in vitro and/or in vivo) capable of forming double-stranded RNA structures. The skilled worker is aware of the fact that the formation of double-stranded RNA structures represents a state of equilibrium. Preferably, the ratio of double-stranded molecules to corresponding dissociated forms is at least 1 to 10, preferably 1:1, particularly preferably 5:1, most preferably 10:1.

[0119]The invention therefore further relates to double-stranded RNA molecules (dsRNA-molecule) which, when introduced into a plant organism (or into a cell, tissue, organ or propagation material derived therefrom) cause the reduction of at least one marker protein. The double-stranded RNA molecule for reducing expression of a marker protein (MP-dsRNA) here preferably comprises [0120]a) a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least a part of the "sense" RNA transcript of a nucleic acid sequence coding for a marker protein, and [0121]b) an "antisense" RNA strand which is essentially, preferably fully, complementary to the RNA sense strand under a).

[0122]With respect to the dsRNA molecules, marker protein nucleic acid sequence preferably means a sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 or 47 or a functional equivalent thereof.

[0123]"Essentially identical" means that the dsRNA sequence may also have insertions, deletions and also individual point mutations in comparison with the marker protein target sequence and nevertheless causes an efficient reduction in expression. The homology (as defined hereinbelow) between the "sense" strand of an inhibitory dsRNA and at least one part of the "sense" RNA transcript of a nucleic acid sequence coding for a market protein (or between the "antisense" strand of the complementary strand of a nucleic acid sequence coding for a marker protein) is preferably at least 75%, preferably at least 80%, very particularly preferably at least 90%, most preferably 100%.

[0124]A 100% sequence identity between dsRNA and a marker protein gene transcript is not absolutely necessary in order to cause an efficient reduction in marker protein expression. Consequently, the process is advantageously tolerant toward sequence deviations as may be present due to genetic mutations, polymorphisms or evolutionary divergences. Thus it is possible, for example, using the dsRNA which has been generated starting from the marker protein sequence of the first organism, to suppress marker protein expression in a second organism. This is particularly advantageous when the marker protein used is a plant-intrinsic, endogenous marker protein (for example a 5-methylthioribose kinase or alcohol dehydrogenase). For this purpose, the dsRNA preferably includes sequence regions of marker protein gene transcripts which correspond to conserved regions. Said conserved regions may be readily derived from sequence comparisons.

[0125]The length of the subsection is at least 10 bases, preferably at least 25 bases, particularly preferably at least 50 bases, very particularly preferably at least 100 bases, most preferably at least 200 bases or at least 300 bases.

[0126]Alternatively, an "essentially identical" dsRNA may also be defined as a nucleic acid sequence capable of hybridizing with part of a marker protein gene transcript (e.g. in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50° C. or 70° C. for 12 to 16 h).

[0127]"Essentially complementary" means that the "antisense" RNA strand may also have insertions, deletions and also individual point mutations in comparison with the complement of this "sense" RNA strand. The homology between the "antisense" RNA strand and the complement of the "sense" RNA strand is preferably at least 80%, preferably at least 90%, very particularly preferably at least 95%, most preferably 100%.

[0128]"Part of the "sense" RNA transcript" of a nucleic acid sequence coding for a marker protein means fragments of an RNA or mRNA transcribed or transcribable from a nucleic acid sequence coding for a marker protein, preferably from a marker protein gene. In this context, the fragments have a sequence length of preferably at least 20 bases, preferably at least 50 bases, particularly preferably at least 100 bases, very particularly preferably at least 200 bases, most preferably at least 500 bases. The complete transcribable RNA or mRNA is also included. Included are also sequences such as those which may be transcribed under artificial conditions from regions of a marker protein gene which are otherwise, under natural conditions, not transcribed, such as promoter regions, for example.

[0129]The dsRNA may consist of one or more strands of polyribonucleotides. Naturally, in order to achieve the same purpose, it is also possible to introduce a plurality of individual dsRNA molecules which comprise in each case one of the above-defined ribonucleotide sequence sections into the cell or the organism. The double-stranded dsRNA structure may be formed starting from two complementary, separate RNA strands or, preferably, starting from a single, self-complementary RNA strand. In this case, the "sense" RNA strand and the "'antisense" RNA strand are preferably connected covalently to one another in the form of an inverted "repeat".

[0130]As described in WO 99/53050, for example, the dsRNA may also comprise a hairpin structure by connecting the "sense" and the "antisense" strands by a connecting sequence ("linker"; for example an intron). Preference is given to the self-complementary dsRNA structures, since they require only the expression of an RNA sequence and always comprise the complementary RNA strands in an equimolar ratio. The connecting sequence may is preferably an intron (e.g. an intron of the potato ST-LS1 gene; Vancanneyt G F et al. (1990) Mol Gen Genet 220(2):245-250).

[0131]The nucleic acid sequence coding for a dsRNA may include further elements such as, for example, transcription termination signals or polyadenylation signals.

[0132]Bringing together, if intended, the two strands of the dsRNA in a cell or plant may be achieved by way of example in the following way: [0133]a) transformation of the cell or plant with a vector comprising both expression cassettes, [0134]b) cotransformation of the cell or plant with two vectors, one of which comprises the expression cassettes containing the "sense" strand and the other one of which comprises the expression cassettes containing the "antisense" strand.

[0135]The formation of the RNA duplex may be initiated either outside or inside the cell.

[0136]The dsRNA may be synthesized either in vivo or in vitro. For this purpose, a DNA sequence coding for a dsRNA may be inserted into an expression cassette under the control of at least one genetic control element (such as a promoter, for example). A polyadenylation is not necessary and neither need any elements for initiating a translation be present. Preference is given to the expression cassette for the MP-dsRNA being present on the transformation construct or the transformation vector. For this purpose, the expression cassettes coding for the "antisense" strand and/or the "sense" strand of an MP-dsRNA or for the self-complementary strand of the dsRNA are preferably inserted into a transformation vector and introduced into the plant cell by using the processes described below. A stable insertion into the genome may be advantageous for the process of the invention but is not absolutely necessary. Since a dsRNA causes a long-term effect, transient expression is also sufficient in many cases. The dsRNA may also be part of the RNA to be expressed by the nucleic acid sequence to be inserted by fusing it, for example, to the 3'-untranslated part of said RNA.

[0137]The dsRNA may be introduced in an amount which makes possible at least one copy per cell. Higher amounts (e.g. at least 5, 10, 100, 500 or 1000 copies per cell) may, if appropriate, cause a more efficient reduction. [0138]b) Introducing an antisense ribonucleic acid sequence of a marker protein (MP-antisenseRNA)

[0139]Processes for reducing a particular protein by means of the "antisense" technique have been described multiple times, also in plants (Sheehy et al. (1988) Proc Natl Acad Sci USA 85: 8805-8809; U.S. Pat. No. 4,801,340; Mol J N et al. (1990) FEBS Lett 268(2):427-430). The antisense nucleic acid molecule hybridizes or binds to the cellular mRNA and/or genomic DNA coding for the marker protein to be reduced, thereby suppressing transcription and/or translation of said marker protein. The hybridization may be produced in a conventional manner via the formation of a stable duplex or, in the case of genomic DNA, by binding of the antisense nucleic acid molecule to the duplex of the genomic DNA via specific interaction in the large groove of the DNA helix.

[0140]An MP-antisenseRNA may be derived using the nucleic acid sequence coding for this marker protein, for example the nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 or 47 according to the base pair rules by Watson and Crick. The MP-antisenseRNA may be complementary to the entire transcribed mRNA of the marker protein, may be limited to the coding region or may consist only of an oligonucleotide which is complementary to a part of the coding or noncoding sequence of the mRNA. Thus, for example, the oligonucleotide may be complementary to the region comprising the translation start site for the marker protein. The MP-antisenseRNA may be, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length, but may also be longer and comprise at least 100, 200, 500, 1000, 2000 or 5000 nucleotides. MP-antisenseRNA are preferably expressed recombinantly in the target cell in the course of the process of the invention.

[0141]The MP-antisenseRNA may also be part of an RNA to be expressed by the nucleic acid sequence to be inserted by being fused, for example, to the 3'-untranslated part of said RNA.

[0142]The invention further relates to transgenic expression cassettes containing a nucleic acid sequence coding for at least part of a marker protein, with said nucleic acid sequence being functionally linked in antisense orientation to a promoter functional in plant organisms. Said expression cassettes may be part of a transformation construct or transformation vector or else may be introduced in the course of a cotransformation.

[0143]In a further preferred embodiment, expression of a marker protein may be inhibited by nucleotide sequences which are complementary to the regulatory region of a marker protein gene (e.g. a marker protein promoter and/or enhancer) and which form with the DNA double helix there triple-helical structures, thereby reducing transcription of the marker protein gene. Corresponding processes have been described (Helene C (1991) Anticancer Drug Res 6(6):569-84; Helene C et al. (1992) Ann NY Acad Sci 660:27-36; Maher L J (1992) Bioassays 14(12):807-815).

[0144]In a further embodiment, the MP-antisenseRNA may be an α-anomeric nucleic acid. Such α-anomeric nucleic acid molecules form with complementary RNA specific double-stranded hybrids in which, in contrast to the conventional (β-nucleic acids, the two strands are oriented parallel to one another (Gautier C et al. (1987) Nucleic Acids Res 15:6625-6641). [0145]c) Introducing an MP-antisenseRNA combined with a ribozyme

[0146]Advantageously, the above-described antisense strategy may be coupled to a ribozyme process. Catalytic RNA molecules or ribozymes may be adapted to any target RNA and cleave the phosphodiester backbone in specific positions, thereby functionally deactivating said target RNA (Tanner N K (1999) FEMS Microbiol Rev 23(3):257-275). In the process, the ribozyme is not modified itself but is capable of cleaving in an analogous manner further target RNA molecules, thereby acquiring the properties of an enzyme. The incorporation of ribozyme sequences into "antisense" RNAs imparts specifically to these "antisense" RNAs this enzyme-like, RNA-cleaving property and thus increases their efficiency in inactivating the target RNA. The preparation and use of appropriate ribozyme "antisense" RNA molecules have been described (inter alia in Haseloff et al. (1988) Nature 334: 585-591); Haselhoff and Gerlach (1988) Nature 334:585-591; Steinecke P et al. (1992) EMBO J 11(4):1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250(3):329-338).

[0147]In this way, it is possible to use ribozymes (e.g. hammerhead ribozymes; Haselhoff and Gerlach (1988) Nature 334:585-591) in order to catalytically cleave the mRNA of a marker protein to be reduced and thus prevent translation. The ribozyme technique may increase the efficiency of an antisense strategy. Processes for expressing ribozymes in order to reduce particular proteins have been described in (EP 0 291 533, EP 0 321 201, EP 0 360 257). Ribozyme expression has likewise been described in plant cells (Steinecke P et al. (1992) EMBO J 11(4):1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250(3):329-338). Suitable target sequences and ribozymes may be determined, for example, as described in "Steinecke P, Ribozymes, Methods in Cell Biology 50, Galbraith et al. eds, Academic Press, Inc. (1995), pp. 449-460", by calculating the secondary structures of ribozyme RNA and target RNA and by the interaction thereof (Bayley C C et al. (1992) Plant Mol Biol. 18(2):353-361; Lloyd A M and Davis R W et al. (1994) Mol Gen Genet. 242(6):653-657). It is possible, for example, to construct derivatives of the Tetrahymena L-19 IVS RNA which have regions complementary to the mRNA of the marker protein to be suppressed (see also U.S. Pat. No. 4,987,071 and U.S. Pat. No. 5,116,742). Alternatively, such ribozymes may also be identified via a selection process from a library of various ribozymes (Bartel D and Szostak J W (1993) Science 261:1411-1418). [0148]d) Introducing a sense ribonucleic acid sequence of a marker protein (MP-senseRNA) for inducing a cosuppression

[0149]Expression of a marker protein ribonucleic acid sequence (or a part thereof) in sense orientation may result in a cosuppression of the corresponding marker protein gene. Expression of sense RNA with homology to an endogenous marker protein gene may reduce or switch off expression of the latter, as has been described similarly for antisense approaches (Jorgensen et al. (1996) Plant Mol Biol 31(5):957-973; Goring et al. (1991) Proc Natl Acad Sci USA 88:1770-1774; Smith et al. (1990) Mol Gen Genet 224:447-481; Napoli et al. (1990) Plant Cell 2:279-289; Van der Krol et al. (1990) Plant Cell 2:291-99). In this context, the introduced construct may represent completely or only partially the homologous gene to be reduced. The possibility of translation is not required. The application of this technique to plants has been described (e.g. Napoli et al. (1990) Plant Cell 2:279-289; in U.S. Pat. No. 5,034,323.

[0150]The cosuppression is preferably carried out using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for a marker protein, for example the nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 or 47.

[0151]The MP-senseRNA is preferably chosen in such a way that a translation of the marker protein or a part thereof cannot occur. For this purpose, for example, the 5'-untranslated or 3'-untranslated region may be chosen or else the ATG start codon may be deleted or mutated. [0152]e) Introducing DNA- or protein-binding factors against marker protein genes, marker protein RNAs or proteins

[0153]Marker protein expression may also be reduced using specific DNA-binding factors, for example factors of the zinc finger transcription factor type. These factors attach to the genomic sequence of the endogenous target gene, preferably in the regulatory regions, and cause a reduction in expression. Appropriate processes for preparing corresponding factors have been described (Dreier B et al. (2001) J Biol Chem 276(31):29466-78; Dreier B et al. (2000) J Mol Biol 303(4):489-502; Beerli R R et al. (2000) Proc Natl Acad Sci USA 97 (4):1495-1500; Beerli R R et al. (2000) J Biol Chem 275(42):32617-32627; Segal D J and Barbas C F 3^rd. (2000) Curr Opin Chem Biol 4(1):34-39; Kang J S and Kim J S (2000) J Biol Chem 275(12):8742-8748; Beerli R R et al. (1998) Proc Natl Acad Sci USA 95(25):14628-14633; Kim J S et al. (1997) Proc Natl Acad Sci USA 94(8):3616-3620; Klug A (1999) J Mol Biol 293(2):215-218; Tsai S Y et al. (1998) Adv Drug Deliv Rev 30(1-3):23-31; Mapp A K et al. (2000) Proc Natl Acad Sci USA 97(8):3930-3935; Sharrocks A D et al. (1997) Int J Biochem Cell Biol 29(12):1371-1387; Zhang L et al. (2000) J Biol Chem 275(43):33850-33860).

[0154]These factors may be selected using any segment of a marker protein gene. This section is preferably in the region of the promoter region. However, for gene suppression, it may also be in the region of the coding exons or introns.

[0155]It is also possible to introduce factors which inhibit the marker protein itself into a cell. These protein-binding factors may be, for example, aptamers (Famulok M and Mayer G (1999) Curr Top Microbiol Immunol 243:123-36) or antibodies or antibody fragments or single-chain antibodies. Obtaining these factors has been described (Owen M et al. (1992) Biotechnology (N Y) 10(7):790-794; Franken E et al. (1997) Curr Opin Biotechnol 8(4):411-416; Whitelam (1996) Trend Plant Sci 1:286-272). [0156]f) Introducing viral nucleic acid sequences and expression constructs causing the degradation of marker protein RNA

[0157]Marker protein expression may also be effectively implemented by inducing the specific degradation of marker protein RNA by the plant with the aid of a viral expression system (Amplikon; Angell S M et al. (1999) Plant J 20(3):357-362). These systems, also referred to as "VIGS" (viral induced gene silencing), introduce nucleic acid sequences with homology to the transcript of a marker protein to be reduced into the plant by means of viral vectors. Transcription is then switched off, presumably mediated by plant defence mechanisms against viruses. Appropriate techniques and processes have been described (Ratcliff F et al. (2001) Plant J 25(2):237-45; Fagard M and Vaucheret H (2000) Plant Mol Biol 43(2-3):285-93; Anandalakshmi R et al. (1998) Proc Natl Acad Sci USA 95(22):13079-84; Ruiz M T (1998) Plant Cell 10(6):937-46).

[0158]VIGS-mediated reduction is preferably implemented using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for a marker protein, for example the nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 or 47. [0159]g) Introducing constructs for generating a functional loss or a functional reduction of marker protein genes

[0160]The skilled worker knows numerous possible processes of how to modify genomic sequences in a targeted manner. These include, in particular, processes such as the generation of knockout mutants by means of targeted homologous recombination, for example by generating stop codons, shifts in the reading frame etc. (Hohn B and Puchta H (1999) Proc Natl Acad Sci USA 96:8321-8323) or the targeted deletion or inversion of sequences by means of, for example, sequence-specific recombinases or nucleases (see below).

[0161]In a preferred embodiment, the marker protein gene is inactivated by introducing a sequence-specific recombinase. Thus it is possible, for example, for the marker protein gene to include recognition sequences for sequence-specific recombinases or to be flanked by such sequences, and introducing the recombinase then deletes or inverts particular sequences of the marker protein gene, thus leading to inactivation of the marker protein gene. A corresponding procedure is depicted diagrammatically in FIG. 1.

[0162]Appropriate processes for deletion/inversion of sequences by means of sequence-specific recombinase systems are known to the skilled worker. Examples which may be mentioned are the Cre/lox system of bacteriophage P1 (Dale E C and Ow D W (1991) Proc Natl Acad Sci USA 88:10558-10562; Russell S H et al. (1992) Mol Gen Genet 234:49-59; Osborne B I et al. (1995) Plant J 7:687-701), the yeast FLP/FRT system (Kilby N J et al. (1995) Plant J 8:637-652; Lyznik L A et al. (1996) Nucl Acids Res 24:3784-3789), the Gin recombinase of the Mu phage, the E. coli Pin recombinase and the R/RS system of the pSR1 plasmids (Onouchi H et al.(1995) Mol Gen Genet 247:653-660; Sugita Ket al. (2000) Plant J. 22:461-469). In these systems, the recombinase (for example Cre or FLP) interacts specifically with its particular recombination sequences (34 by lox-Sequenz and, respectively, 47 by FRT sequence). Preference is given to the bacteriophage P1 Cre/lox and the yeast FLP/FRT systems. The FLP/FRT and cre/lox recombinase systems have already been applied in plant systems (Odell et al. (1990) Mol Gen Genet 223:369-378). Preference is given to introducing the recombinase by means of recombinant expression starting from an expression cassette included on a DNA construct.

[0163]The activity or amount of the marker protein may also be reduced by a targeted deletion in the marker protein gene, for example by sequence-specific induction of DNA double-strand breaks at a recognition sequence for specific induction of DNA double-strand breaks in or close to the nucleic acid sequence coding for a marker protein. In its simplest embodiment (cf. FIG. 2, A and B) an enzyme is to this end introduced with the transformation construct, which generates at least one double-strand break in such a way that the resulting illegitimate recombination or deletion causes a reduction in the activity or amount of marker protein, for example by inducing a shift in the reading frame or deletion of essential sequences.

[0164]The efficiency of this approach may be increased by the sequence coding for the marker protein being flanked by sequences (A and, respectively, A') which have a sufficient length and homology to one another in order to recombine with one another as a consequence of the induced double-strand break and thus to cause, due to an intramolecular homologous recombination, a deletion of the sequence coding for the marker protein. FIG. 3 depicts diagrammatically a corresponding procedure in an exemplary embodiment of this variant.

[0165]The amount, function and/or activity of the marker protein may also be reduced by a targeted insertion of nucleic acid sequences (for example of the nucleic acid sequence to be inserted within the scope of the process of the invention) into the sequence coding for a marker protein (e.g. by means of intermolecular homologous recombination). This embodiment of the process of the invention is particularly advantageous and preferred, since, in addition to the general advantages of the process of the invention, it makes it moreover also possible to insert the nucleic acid sequence to be inserted into the plant genome in a reproducible, predictable, location-specific manner. This avoids the positional effects which otherwise occur in the course of a random, location-unspecific insertion (and which may manifest themselves, for example, in the form of different levels of expression of the transgene or in unintended inactivation of endogenous genes). Preference is given to using as an "anti-marker protein" compound in the course of this embodiment a DNA construct which comprises at least part of the sequence of a marker protein gene or neighbouring sequences and which can thus specifically recombine with said sequences in the target cell so that a deletion, addition or substitution of at least one nucleotide alters the marker protein gene in such a way that the functionality of said marker protein gene is reduced or completely removed. The alteration may also affect the regulatory elents (e.g. the promoter) of the marker protein gene so that the coding sequence remains unaltered, but expression (transcription and/or translation) does not occur and is reduced. In conventional homologous recombination, the sequence to be inserted is flanked at its 5' and/or 3' end by further nucleic acid sequences (A' and, respectively, B') which have a sufficient length and homology to corresponding sequences of the marker protein gene (A and, respectively, B) for making homologous recombination possible. The length is usually in a range from several hundred bases to several kilobases (Thomas K R and Capecchi M R (1987) Cell 51:503; Strepp et al. (1998) Proc Natl Acad Sci USA 95(8):4368-4373). The homologous recombination is carried out by transforming the plant cell containing the recombination construct by using the process described below and selecting successfully recombined clones based on the subsequently inactivated marker protein. Although homologous recombination is a relatively rare event in plant organisms, a selection pressure may be avoided by recombination into the marker protein gene, allowing a selection of the recombined cells and sufficient efficiency of the process. FIG. 4 diagrammatically depicts a corresponding procedure in an exemplary embodiment of this variant.

[0166]In an advantageous embodiment of the invention, however, insertion into the marker protein gene is facilitated by means of further functional elements. The term is to be understood as being comprehensive and means the use of sequences or of transcripts or polypeptides derived therefrom which are capable of increasing the efficiency of the specific integration into a marker protein gene. Various processes are available to the skilled worker for this purpose. However, preference is given to implementing the insertion by inducing a sequence-specific double-strand break in or close to the marker protein gene.

[0167]In a preferred embodiment of the invention, the marker protein is inactivated (i.e. the amount, expression, activity or function is reduced) by integrating a DNA sequence into a marker protein gene, with the process preferably comprising the following steps: [0168]i) introducing an insertion construct and at least one enzyme suitable for inducing DNA double-strand breaks at a recognition sequence for targeted induction of DNA double-strand breaks in or close to the marker protein gene, and [0169]ii) inducing DNA double-strand breaks at the recognition sequences for targeted induction of DNA double-strand breaks in or close to the marker protein gene, and [0170]iii) inserting the insertion construct into the marker protein gene, with the functionality of the marker protein gene and, preferably, the functionality of the recognition sequence for targeted induction of DNA double-strand breaks is inactivated so that the enzyme suitable for induction of DNA double-strand breaks can no longer cut said recognition sequence, and [0171]iv) selecting plants or plant cells in which the insertion construct has been inserted into the marker protein gene.

[0172]The insertion construct, preferably, comprises the nucleic acid sequence to be inserted into the genome but may also be used separately therefrom.

[0173]"Enzyme suitable for inducing DNA double-strand breaks at the recognition sequence for targeted induction of DNA double-strand breaks" ("DSBI enzyme" for "double-strand-break inducing enzyme" hereinbelow) means generally all those enzymes which are capable of generating sequence-specifically double-strand breaks in double-stranded DNA. Examples which may be mentioned but which are not limiting are: [0174]1. Restriction endonucleases, preferably type II restriction endonucleases, particularly preferably Homing endonucleases as described in detail hereinbelow. [0175]2. Artificial nucleases as described in detail hereinbelow, such as, for example, chimeric nucleases, mutated restriction or Homing endonucleases or RNA protein particles derived from group II mobile introns.

[0176]Both natural and artificially prepared DSBI enzymes are suitable. Preference is given to all of those DSBI enzymes whose recognition sequence is known and which can either be equence in the form of their proteins (for example by purification) or be expressed using their nucleic acid sequence.

[0177]Preference is given to selecting the DSBI enzyme, with the knowledge of its specific recognition sequence, in such a way that it possesses, apart from the target recognition sequence, no further functional recognition regions in the genome of the target plant. Very particular preference is therefore given to Homing endonucleases (overview: Belfort M and Roberts R J (1997) Nucleic Acids Res 25:3379-3388; Jasin M (1996) Trends Genet 12:224-228; Internet: REBASE--The Restriction Enzyme Database; Roberts R J and Macelis D (2001) Nucl Acids Res 29: 268-269). The latter fulfill said requirement, owing to their long recognition sequences. The sequences coding for Homing endonucleases of this kind may be isolated, for example, from the Chlamydomonas chromoplast genome (Turmel M et al. (1993) J Mol Biol 232:446-467). Suitable Homing endonucleases are listed under the abovementioned internet address. Examples of Homing endonucleases which may be mentioned are those like F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-CeuI, I-CeuAIIP, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-CsmI, I-CvuI, I-CvuAIP, I-DdiII, I-DirI, I-DmoI, I-HspNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PpbIP, I-PpoI, I-SPBetaIP, I-ScaI, I-SceI, I-SceII, I-SceIII , I-SceIV, I-SceV, I-SceVI, I-SceVII, I-SexIP, I-SneIP, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp68031, I-SthPhiJP, I-SthPhiST3P, I-SthPhiS3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPA1P, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-PspI, PI-Rma43812IP, PI-SPBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII. Preference is given here to those Homing endonucleases whose gene sequences are already known, such as, for example, F-SceI, I-CeuI, I-ChuI, I-DmoI, I-CpaI, I-CpaII, I-CreI, I-CsmI, F-TevI, F-TevII, I-TevI, I-TevII, I-Anil, I-CvuI, I-LlaI, I-NanI, I-MsoI, I-NitI, I-NjaI, I-PakI, I-PorI, I-PpoI, I-ScaI, I-Ssp6803I, PI-PkoI, PI-PkoII, PI-PspI, PI-TfuI, PI-TliI.

[0178]Very particular preference is given to [0179]I-CeuI (Cote M J and Turmel M (1995) Curr Genet 27:177-183.; Gauthier A et al. (1991) Curr Genet 19:43-47; Marshall (1991) Gene 104:241-245; GenBank Acc. No.: 217234 nucleotides 5102 to 5758), [0180]I-ChuI (Cote V et al.(1993) Gene 129:69-76; GenBank Acc. No.: L06107, nucleotides 419 to 1075), [0181]I-CmoeI (Drouin M et al. (2000) Nucl Acids Res 28:4566-4572), [0182]I-CpaI from Chlamydomonas pallidostigmatica (GenBank Acc. No.: L36830, nucleotides 357 to 815; Turmel M et al. (1995) Nucleic Acids Res 23:2519-2525; Turmel, M et al. (1995) Mol Biol Evol 12:533-545) [0183]I-CpaII (Turmel M et al. (1995) Mol Biol Evol 12:533-545; GenBank Acc. No.: L39865, nucleotides 719 to 1423), [0184]I-CreI (Wang J et al. (1997) Nucleic Acids Res 25: 3767-3776; Durrenberger, F and Rochaix J D (1991) EMBO J 10:3495-3501; GenBank Acc. No.: X01977, nucleotides 571 to 1062), [0185]I-CsmI (Ma D P et al. (1992) Plant Mol Biol 18:1001-1004) [0186]I-NanI (Elde M et al. (1999) Eur J Biochem. 259:281-288; GenBank Acc. No.: X78280, nucleotides 418 to 1155), [0187]I-NitI (GenBank Acc. No.: X78277, nucleotides 426 to 1163), [0188]I-NjaI (GenBank Acc. No.: X78279, nucleotides 416 to 1153), [0189]I-PpoI (Muscarella D E and Vogt V M (1989) Cell 56:443-454; Lin J and Vogt V M (1998) Mol Cell Biol 18:5809-5817; GenBank Acc. No.: M38131, nucleotides 86 to 577), [0190]I-PspI (GenBank Acc. No.: U00707, nucleotides 1839 to 3449), [0191]I-ScaI (Monteilhet C et al. (2000) Nucleic Acids Res 28: 1245-1251; GenBank Acc. No.: X95974, nucleotides 55 to 465) [0192]I-SceI (WO 96/14408; U.S. Pat. No. 5,962,327, therein Seq ID NO: 1), [0193]Endo SceI (Kawasaki et al. (1991) J Biol Chem 266:5342-5347, identical to F-SceI; GenBank Acc. No.: M63839, nucleotides 159 to 1589), [0194]I-SceII (Sarguiel B et al. (1990) Nucleic Acids Res 18:5659-5665), [0195]I-SceIII (Sarguiel B et al. (1991) Mol Gen Genet. 255:340-341), [0196]I-Ssp68031 (GenBank Acc. No.: D64003, nucleotides 35372 to 35824), [0197]I-TevI (Chu et al. (1990) Proc Natl Acad Sci USA 87:3574-3578; Bell-Pedersen et al. (1990) Nucleic Acids Res18:3763-3770; GenBank Acc. No.: AF158101, nucleotides 144431 to 143694), [0198]I-TevII (Bell-Pedersen et al. (1990) Nucleic Acids Res 18:3763-3770; GenBank Acc. No.: AF158101, nucleotides 45612 to 44836), [0199]I-TevIII (Eddy et al. (1991) Genes Dev. 5:1032-1041).

[0200]Very particular preference is given to commercially available Homing endonucleases such as I-CeuI, I-SceI, I-PpoI, PI-PspI or PI-SceI. Most preference is given to I-SceI and I-PpoI. While the gene coding for I-PpoI may be utilized in its natural form, the gene coding for I-SceI possesses an editing site. Since, in contrast to yeast mitochondria, the appropriate editing is not carried out in higher plants, an artificial sequence encoding the I-SceI protein must be used for heterologous expression of this enzyme (U.S. Pat. No. 5,866,361).

[0201]The enzymes may be purified from their source organisms in the manner familiar to the skilled worker and/or the nucleic acid sequence encoding said enzymes may be cloned. The sequences of various enzymes have been deposited with GenBank (see above).

[0202]Artificial DSBI enzymes which may be mentioned by way of example are chimeric nucleases which are composed of an unspecific nuclease domain and a sequence-specific DNA-binding domain (e.g. consisting of zinc fingers) (Smith J et al. (2000) Nucl Acids Res 28(17):3361-3369; Bibikova M et al. (2001) Mol Cell Biol. 21:289-297). Thus, for example, the catalytic domain of the restriction endonuclease FokI has been fused to zinc finger-binding domains, thereby defining the specificity of the endonuclease (Chandrasegaran S & Smith J (1999) Biol Chem 380:841-848; Kim Y G & Chandrasegaran S (1994) Proc Natl Acad Sci USA 91:883-887; Kim Y G et al. (1996) Proc Natl Acad Sci USA 93:1156-1160). The described technique has also been used previously for imparting a predefined specificity to the catalytic domain of the yeast Ho endonuclease by fusing said domain to the zinc finger domain of transcription factors (Nahon E & Raveh D (1998) Nucl Acids Res 26:1233-1239). It is possible, using suitable mutation and selection processes, to adapt existing Homing endonucleases to any desired recognition sequence.

[0203]As mentioned, zinc finger proteins are particularly suitable as DNA-binding domains within chimeric nucleases. These DNA-binding zinc finger domains may be adapted to any DNA sequence. Appropriate processes for preparing corresponding zinc finger domains have been described and are known to the skilled worker (Beerli R R et al. (2000) Proc Natl Acad Sci 97(4):1495-1500; Beerli R R et al.(2000) J Biol Chem 275(42):32617-32627; Segal D J and Barbas C F 3^rd. (2000) Curr Opin Chem Biol 4(1):34-39; Kang J S and Kim J S (2000) J Biol Chem 275(12):8742-8748; Beerli R R et al. (1998) Proc Natl Acad Sci USA 95(25):14628-14633; Kim J S et al. (1997) Proc Natl Acad Sci USA 94(8):3616-3620; Klug A (1999) J Mol Biol 293(2):215-218; Tsai S Y et al. (1998) Adv Drug Deliv Rev 30(1-3):23-31; Mapp A K et al. (2000) Proc Natl Acad Sci USA 97(8):3930-3935; Sharrocks A D et al. (1997) Int J Biochem Cell Biol 29(12):1371-1387; Zhang L et al. (2000) J Biol Chem 275(43):33850-33860). Processes for preparing and selecting zinc finger DNA-binding domains with high sequence specificity have been described (WO 96/06166, WO 98/53059, WO 98/53057). Fusing a DNA-binding domain obtained in this way to the catalytic domain of an endonuclease (such as, for example, the FokI or Ho endonuclease) enables chimeric nucleases to be prepared which have any desired specificity and which may be used as DSBI enzymes advantageously within the scope of the present invention.

[0204]Artificial DSBI enzymes with altered sequence specificity may also be generated by mutating already known restriction endonucleases or Homing endonucleases, using methods familiar to the skilled worker. Besides the mutagenesis of Homing endonucleases, the mutagenesis of maturases is of particular interest for the purpose of obtaining an altered substrate specificity. Maturases frequently share many features with Homing endonucleases and, if appropriate, can be converted into nucleases by carrying out few mutations. This has been shown, for example, for the maturase in the bakers' yeast bi2 intron. Only two mutations in the maturase-encoding open reading frame (ORF) sufficed to impart to this enzyme a Homing-endonuclease activity (Szczepanek & Lazowska (1996) EMBO J 15:3758-3767).

[0205]Further artificial nucleases may be generated with the aid of mobile group II introns and the proteins encoded by them, or parts of these proteins. Mobile group II introns, together with the proteins encoded by them, form RNA-protein particles which are capable of recognizing and cutting DNA in a sequence-specific manner. In this context, the sequence specificity can be adapted to the requirements by mutating particular regions of the intron (see below) (WO 97/10362).

[0206]Preference is given to expressing the DSBI enzyme as a fusion protein with a nuclear localization sequence (NLS). This NLS sequence enables facilitated transport into the nucleus and increases the efficiency of the recombination system. Various NLS sequences are known to the skilled worker and described, inter alia, in Jicks G R and Raikhel N V (1995) Annu. Rev. Cell Biol. 11:155-188. For example, the NLS sequence of the SV40 large antigen is preferred for plant organisms. Very particular preference is given to the following NLS sequences:

TABLE-US-00002 NLS1: N-Pro-Lys-Thr-Lys-Arg-Lys-Val-C (SEQ ID NO: 80) NLS2: N-Pro-Lys-Lys-Lys-Arg-Lys-Val-C (SEQ ID NO: 81)

[0207]Owing to the small size of many DSBI enzymes (such as, for example, the Homing endonucleases), an NLS sequence is not absolutely necessary, however. These enzymes are able to pass through the nuclear pores also without this assistance.

[0208]"Recognition sequence for targeted induction of DNA double-strand breaks" means in general those sequences which allow recognition and cleavage by the DSBI enzyme under the conditions in the eukaryotic cell or organism used in this case. In this context, mention is made, by way of example but not by limitation, in table 1 below of the recognition sequences for the particular DSBI enzymes listed.

TABLE-US-00003 TABLE 1 Recognition sequences and source organisms of DSBI enzymes ("{circumflex over ( )}" indicates the cleavage site of the DSBI enzyme within a recognition sequence) SEQ DSBI Source ID enzyme organism Recognition sequence NO: CRE Bacteriophage 5'-AACTCTCATCGCTTCGGATAACTTCCTGTTATCCGAA 82 P1 ACATATCACTCACTTTGGTGATTTCACCGTAACTGTCTAT GATTAATG-3' FLP Saccharomyces 5'-GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGT 83 cerevisiae ATAGGAACTTC-3' R pSR1 5'-CGAGATCATATCACTGTGGACGTTGATGAAAGAATAC 84 plasmids GTTATTCTTTCATCAAATCGT P- Drosophila 5'-CTAGATGAAATAACATAAGGTGG 85 element transposase AniI Aspergillus 5'-TTGAGGAGGTT{circumflex over ( )}TCTCTGTAAATAANNNNNNNNNNNN 86 nidulans NNN 3'-AACTCCTCCAAAGAGACATTTATTNNNNNNNNNNNNN 87 NN{circumflex over ( )} DdiI Dictyostelium 5'-TTTTTTGGTCATCCAGAAGTATAT 88 discoideumAX3 3'-AAAAAACCAG{circumflex over ( )}TAGGTCTTCATATA 89 CvuI Chlorella 5'-CTGGGTTCAAAACGTCGTGA{circumflex over ( )}GACAGTTTGG 90 vulgaris 3'-GACCCAAGTTTTGCAG{circumflex over ( )}CACTCTGTCAAACC 91 CsmI Chlamydomonas 5'-GTACTAGCATGGGGTCAAATGTCTTTCTGG 92 smithii CmoeI Chlamydomonas 5'-TCGTAGCAGCT{circumflex over ( )}CACGGTT 93 moewusii 3'-AGCATCG{circumflex over ( )}TCCAGTGCCAA 94 CreI Chlamydomonas 5'-CTGGGTTCAAAACGTCGTGA{circumflex over ( )}GACAGTTTGG 95 reinhardtii 3'-GACCCAAGTTTTGCAG{circumflex over ( )}CACTCTGTCAAACC 96 ChuI Chlamydomonas 5'-GAAGGTTTGGCACCTCG{circumflex over ( )}ATGTCGGCTCATC 97 humicola 3'-CTTCCAAACCGTG{circumflex over ( )}GAGCTACAGCCGACTAG 98 CpaI Chlamydomonas 5'-CGATCCTAAGGTAGCGAA{circumflex over ( )}ATTCA 99 pallidostigmatica 3'-GCTAGGATTCCATC{circumflex over ( )}CCTTTAAGT 100 CpaII Chlamydomonas 5'-CCCGGCTAACTC{circumflex over ( )}TGTGCCAG 101 pallidostigmatica 3'-GGGCCGAT{circumflex over ( )}TGAGACACGGTC 102 CeuI Chlamydomonas 5'-CGTAACTATAACGGTCCTAA{circumflex over ( )}GGTAGCGAA 103 eugametos 3'-GCATTCATATTGCCAG{circumflex over ( )}GATTCCATCGCTT 104 DmoI Desulfurococcus 5'-ATGCCTTGCCGGGTAA{circumflex over ( )}GTTCCGGCGCGCAT 105 mobilis 3'-TACGGAACGGCC{circumflex over ( )}CATTCAAGGCCGCGCGTA 106 I-SceI S. cerevisiae 5'-AGTTACGCTAGGGATAA{circumflex over ( )}CAGGGTAATATAG 107 3'-TCAATGCGATCCC{circumflex over ( )}TATTGTCCCATTATATC 108 5'-TAGGGATAA{circumflex over ( )}CAGGGTAAT 109 3'-ATCCC{circumflex over ( )}TATTGTCCCATTA ("Core" 110 sequence) I-SceII S. cerevisiae 5'-TTTTGATTCTTTGGTCACCC{circumflex over ( )}TGAAGTATA 111 3'-AAAACTAAGAAACCAG{circumflex over ( )}TGGGACTTCATAT 112 I-SceIII S. cerevisiae 5'-ATTGGAGGTTTTGGTAAC{circumflex over ( )}TATTTATTACC 113 3'-TAACCTCCAAAACC{circumflex over ( )}ATTGATAAATAATGG 114 I-SceIV S. cerevisiae 5'-TCTTTTCTCTTGATTA{circumflex over ( )}GCCCTAATCTACG 115 3'-AGAAAAGAGAAC{circumflex over ( )}TAATCGGGATTAGATGC 116 I-SceV S. cerevisiae 5'-AATAATTTTCT{circumflex over ( )}TCTTAGTAATGCC 117 3'-TTATTAAAAGAAGAATCATTA{circumflex over ( )}CGG 118 I-SceVI S. cerevisiae 5'-GTTATTTAATG{circumflex over ( )}TTTTAGTAGTTGG 119 3'-CAATAAATTACAAAATCATCA{circumflex over ( )}ACC 120 I-SceVII S. cerevisiae 5'-TGTCACATTGAGGTGCACTAGTTATTAC 121 PI-SceI S. cerevisiae 5'-ATCTATGTCGGGTGC{circumflex over ( )}GGAGAAAGAGGTAAT 122 3'-TAGATACAGCC{circumflex over ( )}CACGCCTCTTTCTCCATTA 123 F-SceI S. cerevisiae 5'-GATGCTGTAGGC{circumflex over ( )}ATAGGCTTGGTT 124 3'-CTACGACA{circumflex over ( )}TCCGTATCCGAACCAA 125 F-SceII S. cerevisiae 5'-CTTTCCGCAACA{circumflex over ( )}GTAAAATT 126 3'-GAAAGGCG{circumflex over ( )}TTGTCATTTTAA 127 HmuI Bacillus 5'-AGTAATGAGCCTAACGCTCAGCAA 128 subtilis 3'-TCATTACTCGGATTGC{circumflex over ( )}GAGTCGTT 129 bacteriophage SPO1 HmuII Bacillus 5'-AGTAATGAGCCTAACGCTCAACAANNNNNNNNNNNNN 130 subtilis NNNNNNNNNNNNNNNNNNNNNNNNNN bacteriophage SP82 LlaI Lactococcus 5'-CACATCCATAAC{circumflex over ( )}CATATCATTTTT 131 lactis 3'-GTGTAGGTATTGGTATAGTAA{circumflex over ( )}AAA 132 MsoI Monomastix 5'-CTGGGTTCAAAACGTCGTGA{circumflex over ( )}GACAGTTTGG 133 species 3'-GACCCAAGTTTTGCAG{circumflex over ( )}CACTCTGTCAAACC 134 I-NanI Naegleria 5'-AAGTCTGGTGCCA{circumflex over ( )}GCACCCGC 135 andersoni 3'-TTCAGACC{circumflex over ( )}ACGGTCGTGGGCG 136 NitI Naegleria 5'-AAGTCTGGTGCCA{circumflex over ( )}GCACCCGC 137 italica 3'-TTCAGACC{circumflex over ( )}ACGGTCGTGGGCG 138 I-NjaI Naegleria 5'-AAGTCTGGTGCCA{circumflex over ( )}GCACCCGC 139 jamiesoni 3'-TTCAGACC{circumflex over ( )}ACGGTCGTGGGCG 140 I-PakI Pseudendoclonium 5'-CTGGGTTCAAAACGTCGTGA{circumflex over ( )}GACAGTTTGG 141 akinetum 3'-GACCCAAGTTTTGCAG{circumflex over ( )}CACTCTGTCAAACC 142 I-PorI Pyrobaculum 5'-GCGAGCCCGTAAGGGT{circumflex over ( )}GTGTACGGG 143 organotrophum 3'-CGCTCGGGCATT{circumflex over ( )}CCCACACATGCCC 144 PpoI Physarum 5'-TAACTATGACTCTCTTAA{circumflex over ( )}GGTAGCCAAAT 145 polycephalum 3'-ATTGATACTGAGAG{circumflex over ( )}AATTCCATCGGTTTA 146 ScaI Saccharomyces 5'-TGTCACATTGAGGTGCACT{circumflex over ( )}AGTTATTAC 147 capensis 3'-ACAGTGTAACTCCAC{circumflex over ( )}GTGATCAATAATG 148 I- Synechocystis 5'-GTCGGGCT{circumflex over ( )}CATAACCCGAA 149 Ssp6803I species 3'-CAGCCCGAGTA{circumflex over ( )}TTGGGCTT 150 PI-PfuI Pyrococcus 5'-GAAGATGGGAGGAGGG{circumflex over ( )}ACCGGACTCAACTT 151 furiosus Vc1 3'-CTTCTACCCTCC{circumflex over ( )}TCCCTGGCCTGAGTTGAA 152 PI-PfuII Pyrococcus 5'-ACGAATCCATGTGGAGA{circumflex over ( )}AGAGCCTCTATA 153 furiosus Vc1 3'-TGCTTAGGTACAC{circumflex over ( )}CTCTTCTCGGAGATAT 154 PI-PkoI Pyrococcus 5'-GATTTTAGAT{circumflex over ( )}CCCTGTACC 155 kodakaraensis 3'-CTAAAA{circumflex over ( )}TCTAGGGACATGG 156 KOD1 PI-PkoII Pyrococcus 5'-CAGTACTACG{circumflex over ( )}GTTAC 157 kodakaraensis 3'-GTCATG{circumflex over ( )}ATGCCAATG 158 KOD1 PI-PspI Pyrococcus 5'-AAAATCCTGGCAAACAGCTATTAT{circumflex over ( )}GGGTAT 159 sp. 3'-TTTTAGGACCGTTTGTCGAT{circumflex over ( )}AATACCCATA 160 PI-TfuI Thermococcus 5'-TAGATTTTAGGT{circumflex over ( )}CGCTATATCCTTCC 161 fumicolans 3'-ATCTAAAA{circumflex over ( )}TCCAGCGATATAGGAAGG 162 ST557 PI-TfuII Thermococcus 5'-TAYGCNGAYACN{circumflex over ( )}GACGGYTTYT 163 fumicolans 3'-ATRCGNCT{circumflex over ( )}RTGNCTGCCRAARA 164 ST557 PI-ThyI Thermococcus 5'-TAYGCNGAYACNGACGG{circumflex over ( )}YTTYT 165 hydrothermalis 3'-ATRCGNCT{circumflex over ( )}RTGNCTGCCRAARA 166 PI-TliI Thermococcus 5'-TAYGCNGAYACNGACGG{circumflex over ( )}YTTYT 167 litoralis 3'-ATRCGNCTRTGNC{circumflex over ( )}TGCCRAARA 168 PI-TliII Thermococcus 5'-AAATTGCTTGCAAACAGCTATTACGGCTAT 169 litoralis TevI Bacteriophage 5'-AGTGGTATCAAC{circumflex over ( )}GCTCAGTAGATG 170 T4 3'-TCACCATAGT{circumflex over ( )}TGCGAGTCATCTAC 171 TevII Bacteriophage 5'-GCTTATGAGTATGAAGTGAACACGT{circumflex over ( )}TATTC 172 T4 3'-CGAATACTCATACTTCACTTGTG{circumflex over ( )}CAATAAG 173 F-TevI Bacteriophage 5'-GAAACACAAGA{circumflex over ( )}AATGTTTAGTAAANNNNNNNNNNNN 174 T4 NN 3'-CTTTGTGTTCTTTACAAATCATTTNNNNNNNNNNNNN 175 N{circumflex over ( )} F-TevII Bacteriophage 5'-TTTAATCCTCGCTTC{circumflex over ( )}AGATATGGCAACTG 176 T4 3'-AAATTAGGAGCGA{circumflex over ( )}AGTCTATACCGTTGAC 177

[0209]Relatively small deviations (degenerations) of the recognition sequence which nevertheless make possible recognition and cleavage by the particular DSBI enzyme are also included here. Such deviations, also in connection with different basic conditions such as, for example, calcium or magnesium concentration, have been described (Argast G M et al. (1998) J Mol Biol 280:345-353). Core sequences of these recognition sequences are also included. It is known that the inner portions of the recognition sequences also suffice for an induced double-strand break and that the outer portions are not necessarily relevant but may contribute to determining the cleavage efficiency. Thus, for example, an 18 bp core sequence can be defined for I-SceI.

[0210]Said DSBI recognition sequences may be localized in various positions in or close to a marker protein gene and, for example when the marker protein used is a transgene, may already be incorporated when constructing the marker protein expression cassette. Various possible localizations are illustrated by way of example in FIGS. 2-A, 2-B, 3 and 5 and in the descriptions thereof.

[0211]In a further advantageous embodiment, the insertion sequence comprises at least one homology sequence A which has a sufficient length and a sufficient homology to a sequence A' in the marker protein gene in order to ensure homologous recombination between A and A'. The insertion sequence is preferably flanked by two sequences A and B which have a sufficient length and a sufficient homology to a sequence A' and, respectively, B' in the marker protein gene in order to ensure homologous recombination between A and A' and, respectively, B and B'.

[0212]"Sufficient length" means, with respect to the homology sequences A, A' and B, B', preferably sequences with a length of at least 100 base pairs, preferably at least 250 base pairs, particularly preferably at least 500 base pairs, very particularly preferably at least 1000 base pairs, most preferably of at least 2500 base pairs.

[0213]"Sufficient homology" means, with respect to the homology sequences, preferably sequences whose homology to one another is at least 70%, preferably 80%, preferentially at least 90%, particularly preferably at least 95%, very particularly preferably at least 99%, most preferably 100%, over a length of at least 20 base pairs, preferably at least 50 base pairs, particularly preferably at least 100 base pairs, very particularly preferably at least 250 base pairs, most preferably at least 500 base pairs.

[0214]Homology between two nucleic acids means the identity of the nucleic acid sequence over in each case the entire sequence length, which identity is calculated by way of comparison with the aid of the GAP program algorithm (Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA), setting the following parameters: [0215]Gap Weight: 12 Length Weight: 4 [0216]Average Match 2,912 Average Mismatch:-2,003

[0217]In a further preferred embodiment, the recombination efficiency is increased by a combination with processes which promote homologous recombination. Such systems have been described and comprise, by way of example, expression of proteins such as RecA or treatment with PARP inhibitors. It has been demonstrated that the intrachromosomal homologous recombination in tobacco plants can be increased by using PARP inhibitors (Puchta H et al. (1995) Plant J 7:203-210). The use of these inhibitors can further increase the rate of homologous recombination in the recombinant constructs, after inducing the sequence-specific DNA double-strand break, and thus the efficiency of the deletion of the transgene sequences. Various PARP inhibitors may be used here. Preference is given to including inhibitors such as 3-amino benzamide, 8-hydroxy-2-methylquinazolin-4-one (NU1025), 1,11b-dihydro-[2H]benzopyrano[4,3,2-de]isoquinolin-3-one (GPI 6150), 5-aminoisoquinolinone, 3,4-dihydro-5-[4-(1-piperidinyl)butoxy]-1(2H)-isoquinolinone or the substances described in WO 00/26192, WO 00/29384, WO 00/32579, WO 00/64878, WO 00/68206, WO 00/67734, WO 01/23386 and WO 01/23390.

[0218]Further suitable methods are the introduction of nonsense mutations into endogenous marker protein genes, for example by means of introducing RNA/DNA oligonucleotides into the plant (Zhu et al. (2000) Nat Biotechnol 18(5):555-558). Point mutations may also be generated by means of DNA-RNA hybrids which are also known as "chimeraplasty" (Cole-Strauss et al. (1999) Nucl Acids Res 27(5):1323-1330; Kmiec (1999) Gene therapy American Scientist 87(3):240-247).

[0219]The methods of dsRNAi, cosuppression by means of sense

[0220]RNA and VIGS (virus induced gene silencing) are also referred to as post-transcriptional gene silencing (PTGS). PTGS processes are particularly advantageous because the demands on the homology between the marker protein gene to be reduced and the transgenically expressed sense or dsRNA nucleic acid sequence are lower than, for example, in the case of a traditional antisense approach. Thus it is possible, using the marker protein nucleic acid sequences from one species, to effectively reduce also expression of homologous marker protein proteins in other species, without it being absolutely necessary to isolate and to elucidate the structure of the marker protein homologues occurring there. Considerably less labor is therefore required.

[0221]"Introduction" comprises within the scope of the invention any processes which are suitable for introducing an "anti-marker protein" compound, directly or indirectly, into a plant or a cell, compartment, tissue, organ or seeds of said plant or generating said compound there. The introduction may result in a transient presence of an "anti-marker protein" compound (for example a dsRNA or a recombinase) or else in a permanent (stable) presence.

[0222]According to the different nature of the approaches described above, the "anti-marker protein" compound may exert its function directly (for example by way of insertion into an endogenous marker protein gene). However, said function may also be exerted indirectly after transcription into an RNA (for example in antisense approaches) or after transcription and translation into a protein (for example in the case of recombinases or DSBI enzymes). The invention comprises both directly and indirectly acting "anti-marker protein" compounds.

[0223]Introducing comprises, for example, processes such as transfection, transduction or transformation.

[0224]"Anti-marker protein" compounds thus comprises, for example, also expression cassettes capable of implementing expression (i.e. transcription and, if appropriate, translation) of, for example, an MP-dsRNA, an MP-antisenseRNA, a sequence-specific recombinase or a DSBI enzyme in a plant cell.

[0225]"Expression cassette" means within the scope of the present invention generally those constructions in which a nucleic acid sequence to be expressed is functionally linked to at least one genetic control sequence, preferably a promoter sequence. Expression cassettes preferably consist of double-stranded DNA and may have a linear or circular structure.

[0226]A functional linkage means, for example, the sequential arrangement of a promoter with a nucleic acid sequence to be transcribed (for example coding for an MP-dsRNA or a DSBI enzyme) and, if appropriate, further regulatory elements such as, for example, a terminator and/or polyadenylation signals in such a way that each of the regulatory elements can fulfill its function during transcription of the nucleic acid sequence, depending on the arrangement of the nucleic acid sequences. In this context, function can mean, for example, the control of expression, i.e. transcription and/or translation, of the nucleic acid sequence (e.g. coding for an MP-dsRNA or a DSBI enzyme). In this context, control comprises, for example, initiating, increasing, controlling or suppressing the expression, i.e. transcription and, if appropriate, translation. This does not necessarily require a direct linkage in the chemical sense. Genetic control sequences such as, for example, enhancer sequences, may exert their function on the target sequence also from positions further afar or even from different DNA molecules. Preference is given to arrangements in which the nucleic acid sequence to be transcribed is positioned downstream of the sequence acting as promoter so that both sequences are covalently connected to one another. The distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is here preferably less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.

[0227]The skilled worker knows various ways of obtaining any of the expression cassettes of the invention. An expression cassette of the invention is prepared, for example, preferably by direct fusion of a nucleic acid sequence acting as promoter to a nucleotide sequence to be expressed (e.g. coding for an MP-dsRNA or a DSBI enzyme). A functional linkage may be produced by means of common recombination and cloning techniques, as are described, for example, in Maniatis T, Fritsch E F and Sambrook J (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and in Silhavy T J et al. (1984) Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and in Ausubel F M et al. (1987) Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience.

[0228]The expression cassettes of the invention preferably comprise a promoter 5' upstream of the particular nucleic acid sequence to be expressed transgenically and a terminator sequence as an additional genetic control sequence 3' downstream and also, if appropriate, further customary regulatory elements, in each case functionally linked to the nucleic acid sequence to be expressed transgenically.

[0229]The term "genetic control sequences" is to be understood broadly and means all those sequences which have an influence on the making or function of the expression cassette of the invention. For example, genetic control sequences ensure transcription and, if appropriate, translation in prokaryotic or eukaryotic organisms. Genetic control sequences are described, for example, in "Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)" or "Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnolgy, CRC Press, Boca Raton, Fla., eds.: Glick and Thompson, Chapter 7, 89-108" and in the references quoted there.

[0230]Genetic control sequences comprise, in particular in plants, functional promoters. Preferred promoters suitable for the expression cassettes are in principle any promoters capable of controlling expression of genes, in particular foreign genes, in plants.

[0231]Plant-specific promoters or promoters functional in plants or in a plant cell means in principle any promoter capable of controlling expression of genes, in particular foreign genes, in at least one plant or one part, cell, tissue, culture of a plant. In this context, expression may be, for example, constitutive, inducible or development-dependent. Preference is given to:

a) Constitutive Promoters

[0232]"Constitutive" promoters means those promoters which ensure expression in numerous, preferably all, tissues over a relatively large period of plant development, preferably at all points in time of plant development (Benfey et al. (1989) EMBO J 8:2195-2202). Preference is given in particular to using a plant promoter or a promoter which is derived from a plant virus. Particular preference is given to the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21:285-294; Odell et al. (1985) Nature 313:810-812; Shewmaker et al. (1985) Virology 140:281-288; Gardner et al. (1986) Plant Mol Biol 6:221-228) or the 19S CaMV promoter (U.S. Pat. No. 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8:2195-2202) and also to the promoter of the Arabidopsis thaliana nitrilase-1 gene (GenBank Acc. No.: Y07648, nucleotides 2456 (alternatively 2861) to 4308 or alternatively 4340 or 4344. (e.g. by 2456 to 4340). [0233]Another suitable constitutive promoter is the rubisco small subunit (SSU) promoter (U.S. Pat. No. 4,962,028), the leguminB promoter (GenBank Acc. No.: X03677), the promoter of the Agrobacterium nopaline synthase, the TR dual promoter, the Agrobacterium OCS (octopine synthase) promoter, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29:637-649), the ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18:675-689; Bruce et al. (1989) Proc Natl Acad Sci USA 86:9692-9696), the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), and further promoters of genes whose constitutive expression in plants is known to the skilled worker.

b) Tissue-Specific Promoters

[0233] [0234]Preference is given to promoters with specificities for the anthers, ovaries, flowers, leaves, stems, roots or seeds. Seed-specific promoters comprise, for example, the promoter of phaseolin (U.S. Pat. No. 5,504,200; Bustos M M et al. (1989) Plant Cell 1(9):839-53), of the 2S albumin (Joseffson L G et al. (1987) J Biol Chem 262:12196-12201), of legumin (Shirsat A et al. (1989) Mol Gen Genet 215(2): 326-331), of USP (unknown seed protein; Baumlein H et al. (1991) Mol Gen Genet 225(3):459-67), of napin (U.S. Pat. No. 5,608,152; Stalberg K et al. (1996) L Planta 199:515-519), of the sucrose-binding protein (WO 00/26388), of legumin B4 (LeB4; Baumlein H et al. (1991) Mol Gen Genet 225: 121-128; Baeumlein et al. (1992) Plant Journal 2(2):233-9; Fiedler U et al. (1995) Biotechnology (NY) 13(10):1090f), of oleosin (WO 98/45461) or of Bce4 (WO 91/13980). Further suitable seed-specific promoters are those of the genes coding for the high molecular weight glutenin (HMWG), gliadin, branching enzyme, ADP glucose pyrophosphatase (AGPase) or starch synthase. Preference is further given to promoters which allow seed-specific expression in sequence edons such as corn, barley, wheat, rye, rice, etc. promoters which may be employed advantageously are the promoter of the lpt2 or lpt1 gene (WO 95/15389, WO 95/23230) and the promoters described in WO 99/16890 (hordein, glutelin, oryzin, prolamin, gliadin, zein, kasirin or secalin promoters). Further seed-specific promoters are described in WO 89/03887. [0235]Tuber-, storage-root- or root-specific promoters comprise, for example, the class I patatin promoter (B33) or the promoter of the potato cathepsin D inhibitor. [0236]Leaf-specific promoters comprise, for example, the promoter of the potato cytosolic FBPase (WO 97/05900), the SSU promoter (small subunit) of rubisco (ribulose-1,5-bisphosphate carboxylase) or the potato ST-LSI promoter (Stockhaus et al. (1989) EMBO J 8:2445-2451). [0237]Flower-specific promoters comprise, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593). [0238]Anther-specific promoters comprise, for example, the 5126 promoter (U.S. Pat. No. 5,689,049, U.S. Pat. No. 5,689,051), the glob-l promoter and the γ-zein promoter.

c) Chemically Inducible Promoters

[0238] [0239]Chemically inducible promoters allow expression control as a function of an exogenous stimulus (review article: Gatz et al. (1997) Ann Rev Plant Physiol Plant Mol Biol 48:89-108). Examples which may be mentioned are: the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22:361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP-A 0 388 186), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J 2:397-404), an abscisic acid-inducible promoter (EP 0 335 528) and an ethanol- or cyclohexanone-inducible promoter (WO 93/21334). Also suitable is the promoter of the glutathione S-transferase isoform II gene (GST-II-27), which may be activated by exogenously applied safeners such as, for example, N,N-diallyl-2,2-dichloroacetamide (WO 93/01294) and which is functional in numerous tissues of both sequence edons and dicotyledones.

[0240]Particular preference is given to constitutive or inducible promoters.

[0241]Preference is further given to plastid-specific promoters for targeted expression in the plastids. Suitable promoters are described, for example, in WO 98/55595 or WO 97/06250. promoters which may be mentioned here are the rpo B promoter element, the atoB promoter element, the clpP promoter element (see also WO 99/46394) and the 16SrDNA promoter element. Viral promoters are also suitable (WO 95/16783).

[0242]Targeted expression in plastids may also be achieved by using, for example, a bacterial or bacteriophage promoter, introducing the resulting expression cassette into the plastid DNA and then expressing expression by means of a fusion protein of a bacterial or bacteriophage polymerase and a plastid transit peptide. U.S. Pat. No. 5,925,806 describes an appropriate process.

[0243]Genetic control sequences further comprise also the 5'-untranslated regions, introns or noncoding 3' region of genes, such as, for example, the actin-1 intron, or the Adhl-S introns 1, 2 and 6 (general overview: The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994)). These sequences have been shown to be able to play a significant functions in the regulation of gene expression. Thus it has been demonstrated that 5'-untranslated sequences may increase transient expression of heterologous genes. They may further promote tissue specificity (Rouster J et al. (1998) Plant J. 15:435-440). As an example of translation enhancers, mention may be made of the 5' leader sequence of the tobacco mosaic virus (Gallie et al. (1987) Nucl Acids Res 15:8693-8711).

[0244]Polyadenylation signals suitable as control sequences are in particular polyadenylation signals of plant genes and also Agrobacterium tumefaciens T-DNA polyadenylation signals. Examples of particularly suitable terminator sequences are the OCS (octopine synthase) terminator and the NOS (nopaline synthase) terminator (Depicker A et al (1982) J Mol Appl Genet 1:561-573) and also the terminators of soybean actin, RUBISCO or alpha-amylase from wheat (Baulcombe D C et al (1987) Mol Gen Genet 209:33-40).

[0245]Advantageously, the expression cassette may contain one or more "enhancer sequences" functionally linked to the promoter, which make increased transgenic expression of the nucleic acid sequence possible.

[0246]Genetic control sequences further means sequences coding for fusion proteins consisting of a signal peptide sequence. The expression of a target gene is possible in any desired cell compartment, such as, for example, the endomembrane system, the vacuole and the chloroplasts. Desired glycosylation reactions, in particular foldings, and the like are possible by utilizing the secretory pathway. Secretion of the target protein to the cell surface or secretion into the culture medium, for example when using suspension-cultured cells or protoplasts, is also possible. The target sequences required for this may both be taken into account in individual vector variations and be introduced into the vector together with the target gene to be cloned by using a suitable cloning strategy. Target sequences which may be used are both endogenous, if present, and heterologous sequences. Additional heterologous sequences which are preferred for functional linkage but not limited thereto are further targeting sequences for ensuring subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochrondrion, in the endoplasmic reticulum (ER), in the nucleus, in elaioplasts or other compartments; and also translation enhancers such as the 5' leader sequence from tobacco mosaic virus (Gallie et al. (1987) Nucl Acids Res 15: 8693-8711) and the like. The process of transporting proteins which are per se not located in the plastids specifically into said plastids has been described (Klosgen R B and Weil J H (1991) Mol Gen Genet 225(2):297-304; Van Breusegem F et al. (1998) Plant Mol Biol 38(3):491-496).

[0247]Control sequences are furthermore understood to be those which make possible a homologous recombination or insertion into the genome of a host organism or allow the removal from the genome. Methods such as the cre/lox technique allow the expression cassette to be removed tissue-specifically, possibly inducibly from the genome of the host organism (Sauer B. Methods. 1998; 14(4):381-92). Here, particular flanking sequences are attached to the target gene (lox sequences), which make subsequent removal by means of the cre recombinase possible.

[0248]Preferably, the expression cassette, consisting of a linkage of the promoter to the nucleic acid sequence to be transcribed, may have been integrated into a vector and may be transferred into the plant cell or organism, for example, by transformation, according to any of the processes described below.

[0249]"Transgenic" means preferably, for example with respect to a transgenic expression cassette, a transgenic expression vector, a transgenic organism or to processes for transgenic expression of nucleic acids, all constructions brought about by genetic engineering methods or processes using said constructions, in which either [0250]a) the nucleic acid sequence to be expressed, or [0251]b) the promoter functionally linked to the nucleic acid sequence to be expressed according to a), or [0252]c) (a) and (b)are not located in their natural, genetic environment (i.e. at their natural chromosomal locus) or have been modified by genetic engineering methods, the modification possibly being, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. Natural genetic environment means the natural chromosomal locus in the source organism or the presence in a genomic library.

[0253]"Transgenic" means, with respect to expression ("transgenic expression"), preferably all expressions achieved using a transgenic expression cassette, transgenic expression vector or transgenic organism, according to the definitions indicated above.

[0254]The DNA constructs employed within the scope of the process of the invention and the vectors derived therefrom may contain further functional elements. The term functional element is to be understood broadly and means all of those elements which influence the preparation, propagation or function of the DNA constructs or of vectors or organisms derived therefrom. Examples which may be mentioned without being limited thereto are:

[0255]1. Selection markers

[0256]Selection markers comprise, for example, those nucleic acid or protein sequences whose expression gives to a cell, tissue or organism an advantage (positive selection marker) or disadvantage (negative selection marker) over cells which do not express said nucleic acid or protein. Positive selection markers act, for example, by detoxifying a substance acting on the cell in an inhibitory manner (e.g. resistance to antibiotics/herbicides) or by forming a substance which enables the plant to regenerate better or grow more under the chosen conditions (for example nutritive markers, hormone-producing markers such as ipt; see below). Another type of positive selection marker comprises mutated proteins or RNAs which are not sensitive to a selective agent (e.g. 16S rRNA mutants which are insensitive to spectinomycin). Negative selection markers act, for example, by catalyzing the formation of a toxic substance in the transformed cells (e.g. the codA gene).

[0257]Positive Selection Markers:

[0258]In order to further increase the efficiency, the DNA constructs may comprise additional positive selection markers. In a preferred embodiment, the process of the invention may thus be carried out in the form of a dual selection in which a sequence coding for a resistance to at least one toxin, antibiotic or herbicide is introduced together with the nucleic acid sequence to be inserted and selection is carried out additionally by using the toxin, antibiotic or herbicide.

[0259]Appropriate proteins and sequences of positive selection markers and also selection processes are familiar to the skilled worker. The selection marker imparts to the successfully transformed cells a resistance to a biocide (e.g. a herbicide such as phosphinothricin, glyphosate or bromoxynil), a metabolism inhibitor such as 2-deoxyglucose 6-phosphate (WO 98/45456) or an antibiotic such as, for example, tetracycline, ampicillin, kanamycin, G 418, neomycin, bleomycin or hygromycin. Selection markers which may be mentioned by way of example are: [0260]phosphinothricin acetyltransferases (PAT) which acetylate the free amino group of the glutamine synthase inhibitor phosphinothricin (PPT) and thus detoxify PPT (de Block et al. (1987) EMBO J 6:2513-2518) (also referred to as Bialophos® resistance gene (bar)). Corresponding sequences are known to the skilled worker (from Streptomyces hygroscopicus GenBank Acc. No.: X17220 and X05822, from Streptomyces viridochromogenes GenBank Acc. No.: M 22827 and X65195; U.S. Pat. No. 5,489,520). Furthermore, synthetic genes have been described for expression in plastids. A synthetic PAT gene is described in Becker et al. (1994) Plant J 5:299-307. The genes impart a resistance to the herbicide Bialaphos or glufosinate and are frequently used markers in transgenic plants (Vickers J E et al. (1996) Plant Mol Miol Reporter 14:363-368; Thompson C J et al. (1987) EMBO J 6:2519-2523). [0261]5-enolpyruvylshikimate 3-phosphate synthases (EPSPS) which impart a resistance to glyphosate (N-(phosphonomethyl)glycine). The molecular target of the unselective herbicide glyphosate is 5-enolpyruvyl-3-phosphoshikimate synthase (EPSPS). This enzyme has a key function in the biosynthesis of aromatic amino acids in microbes and plants but not in mammals (Steinrucken H C et al. (1980) Biochem Biophys Res Commun 94:1207-1212; Levin J G and. Sprinson D B (1964) J Biol Chem 239:1142-1150; Cole D J (1985) Mode of action of glyphosate a literature analysis, p. 48-74. In: Grossbard E and Atkinson D (eds.). The herbicide glyphosate. Buttersworths, Boston.). Preference is given to using glyphosate-tolerant EPSPS variants as selection markers (Padgette S R et al. (1996). New weed control opportunities: development of soybeans with a Roundup Ready® gene. In: Herbicide Resistant Crops (Duke, S. O., ed.), pp. 53-84. CRC Press, Boca Raton, Fla.; Saroha M K and Malik V S (1998) J Plant Biochemistry and Biotechnology 7:65-72). The EPSPS gene of Agrobacterium sp. strain CP4 has a natural tolerance for glyphosate, which can be transferred to appropriate transgenic plants. The CP4 EPSPS gene was cloned from Agrobacterium sp. strain CP4 (Padgette S R et al. (1995) Crop Science 35(5):1451-1461). Sequences of EPSPS enzymes which are glyphosate-tolerant have been described (inter alia in U.S. Pat. No. 5,510,471; U.S. Pat. No. 5,776,760; U.S. Pat. No. 5,864,425; U.S. Pat. No. 5,633,435; U.S. Pat. No. 5,627;061; U.S. Pat. No. 5,463,175; EP 0 218 571). Further sequences are described under GenBank Acc. No: X63374 or M10947. [0262]Glyphosat®-degrading enzymes (gox gene; glyphosate oxidoreductase). GOX (for example Achromobacter sp. glyphosate oxidoreductase) catalyzes the cleavage of a C--N bond in glyphosate which is thus converted to aminomethylphosphonic acid (AMPA) and glyoxylate. GOX can thereby impart a resistance to glyphosate (Padgette S R et al. (1996) J Nutr 126(3):702-16; Shah D et al. (1986) Science 233:478-481). [0263]The deh gene encodes a dehalogenase which inactivates Dalapon® (GenBank Acc. No.: AX022822, AX022820 and WO 99/27116) [0264]The bxn genes encode bromoxynil-degrading nitrilase enzymes (Genbank Acc. No: E01313 and J03196). [0265]Neomycin phosphotransferases impart a resistance to antibiotics (aminoglycosides) such as neomycin, G418, hygromycin, paromomycin or kanamycin by reducing the inhibiting action of said antibiotics by means of a phosphorylation reaction. Particular preference is given to the nptII gene. Sequences can be obtained from GenBank (AF080390; AF080389). Moreover, the gene is already part of numerous expression vectors and can be isolated therefrom using processes familiar to the skilled worker (AF234316; AF234315; AF234314). The NPTII gene encodes an aminoglycoside 3'-O-phosphotransferase from E. coli, Tn5 (GenBank Acc. No: U00004 position 1401-2300; Beck et al. (1982) Gene 19 327-336). [0266]The DOG^R1 gene was isolated from the yeast Saccharomyces cerevisiae (EP-A 0 807 836) and encodes a 2-deoxyglucose 6-phosphate phosphatase which imparts a resistance to 2-DOG (Randez-Gil et al. (1995) Yeast 11:1233-1240; Sanz et al. (1994) Yeast 10:1195-1202, GenBank Acc. No.: NC001140; position 194799-194056). [0267]Acetolactate synthases which impart a resistance to imidazolinone/sulfonylurea herbicides (GenBank Acc. No.: X51514; Sathasivan K et al. (1990) Nucleic Acids Res. 18(8):2188); AB049823; AF094326; X07645; X07644; A19547; A19546; A19545; 105376; 105373; AL133315) [0268]Hygromycin phosphotransferases (e.g. GenBank Acc. No.: X74325) which impart a resistance to the antibiotic hygromycin. The gene is part of numerous expression vectors and may be isolated therefrom using processes familiar to the skilled worker (such as, for example, polymerase chain reaction) (GenBank Acc. No.: AF294981; AF234301; AF234300; AF234299; AF234298; AF354046; AF354045). [0269]Genes of resistance to [0270]a) Chloramphenicol (chloramphenicol acetyltransferase), [0271]b) tetracycline (inter alia GenBank Acc. No.: X65876; X51366). Moreover, the gene is already part of numerous expression vectors and may be isolated therefrom using processes familiar to the skilled worker (such as, for example, polymerase chain reaction) [0272]Streptomycin (inter alia GenBank Acc. No.: AJ278607). [0273]d) Zeocin, the corresponding resistance gene is part of numerous cloning vectors (e.g. GenBank Acc. No.: L36849) and may be isolated therefrom using processes familiar to the skilled worker (such as, for example, polymerase chain reaction). [0274]e) Ampicillin (β-lactamase gene; Datta N, Richmond M H (1966) Biochem J 98(1):204-9; Heffron F et al (1975) J. Bacteriol 122: 250-256; Bolivar F et al. (1977) Gene 2:95-114). The sequence is part of numerous cloning vectors and may be isolated therefrom using processes familiar to the skilled worker (such as, for example, polymerase chain reaction).

[0275]Genes such as isopentenyl transferase from Agrobacterium tumefaciens (strain: PO22) (Genbank Acc. No.: AB025109) may also be used as selection markers. The ipt gene is a key enzyme of cytokinin biosynthesis. Its overexpression facilitates the regeneration of plants (e.g. selection on cytokinin-free medium). The process for utilizing the ipt gene has been described (Ebinuma H et al. (2000) Proc Natl Acad Sci USA 94:2117-2121; Ebinuma H et al. (2000) Selection of Marker-free transgenic plants using the oncogenes (ipt, rol A, B, C) of Agrobacterium as selectable markers, In Molecular Biology of Woody Plants. Kluwer Academic Publishers).

[0276]Various other positive selection markers which impart to the transformed plants a growth advantage over untransformed plants and also processes for their use are described, inter alia, in EP-A 0 601 092. Examples which may be mentioned are β-glucuronidase (in connection with cytokinin glucuronide, for example), mannose 6-phosphate isomerase (in connection with mannose), UDP-galactose 4-epimerase (in connection with galactose, for example).

[0277]For a selection marker functional in plastids, particular preference is given to those which impart a resistance to spectinomycin, streptomycin, kanamycin, lincomycin, gentamycin, hygromycin, methotrexat, bleomycin, phleomycin, blasticidin, sulfonamide, phosphinothricin, chlorsulfuron, bromoxymil, glyphosate, 2,4-datrazine, 4-methyltryptophan, nitrate, S-aminoethyl-L-cysteine, lysine/threonine, aminoethyl-cysteine or betainealdehyde. Particular preference is given to the genes aadA, nptII, BADH, FLARE-S (a fusion of aadA and GFP, described in Khan M S & Maliga P (1999) Nature Biotech 17:910-915). Especially suitable is the aadA gene (Svab Z and Maliga P (1993) Proc Natl Acad Sci USA 90:913-917). Modified 16S rDNA and also betainealdehyde dehydrogenase (BADH) from spinach have also been described (Daniell H et al. (2001) Trends Plant Science 6:237-239; Daniell H et al. (2001) Curr Genet 39:109-116; WO 01/64023; WO 01/64024; WO 01/64850). Lethal agents such as, for example, glyphosate may also be utilized in connection with correspondingly detoxifying or resistance enzymes (WO 01/81605).

[0278]The concentrations of the antibiotics, herbicides, biocides or toxins, which are used in each case for selection, must be adapted to the particular test conditions or organisms. Examples which may be mentioned for plants are kanamycin (Km) 50 mg/L, hygromycin B 40 mg/L, phosphinothricin (Ppt) 6 mg/L, spectinomycin (Spec) 500 mg/L.

[0279]2. Reporter genes

[0280]Reporter genes code for readily quantifiable proteins and thus ensure, via intrinsic color or enzyme activity, an evaluation of the transformation efficiency and of the location or time of expression. In this context, very particular preference is given to genes coding for reporter proteins (see also Schenborn E, Groskreutz D (1999) Mol Biotechnol 13(1):29-44) such as [0281]green fluorescence protein (GFP) (Chui W L et al. (1996) Curr Biol 6:325-330; Leffel S M et al. (1997) Biotechniques 23(5):912-8; Sheen et al. (1995) Plant J 8(5):777-784; Haseloff et al. (1997) Proc Natl Acad Sci USA 94(6): 2122-2127; Reichel et al. (1996) Proc Natl Acad Sci USA 93(12):5888-5893; Tian et al. (1997) Plant Cell Rep 16:267-271; WO 97/41228) [0282]chloramphenicol transferase [0283]luciferase (Millar et al. (1992) Plant Mol Biol Rep 10: 324-414; Ow et al. (1986) Science 234:856-859); allows bioluminescence detection [0284]β-galactosidase (encodes an enzyme for which various chromogenic substrates are available) [0285]β-glucuronidase (GUS) (Jefferson et al. (1987) EMBO J 6: 3901-3907) or the uidA gene (encode enzymes for which various chromogenic substrates are available) [0286]R-locus gene product which regulates production of anthocyanin pigments (red color) in plant tissue and thus makes possible a direct analysis of the promoter activity without addition of additional auxiliary substances or chromogenic substrates (Dellaporta et al. (1988) In: Chromosome Structure and Function: Impact of New Concepts, 18^th Stadler Genetics Symposium, 11:263-282) [0287]tyrosinase (Katz et al. (1983) J Gen Microbiol 129:2703-2714), enzyme which oxidizes tyrosine to give DOPA and dopaquinone which consequently form the readily detectable melanine. [0288]aequorin (Prasher et al. (1985) Biochem Biophys Res Commun 126(3):1259-1268), may be used in calcium-sensitive bioluminescence detection.

[0289]3. Origins of replication which ensure propagation of the expression cassettes or vectors of the invention, for example in E. coli. Examples which may be mentioned are ORI (origin of DNA replication), the pBR322 on or the P15A on (Sambrook et al.: Molecular Cloning. A Laboratory Manual, 2^nded. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

[0290]4. Elements, for example border sequences, which enable agrobacteria-mediated transfer into plant cells for transfer and integration into the plant genome, such as, for example, the right or left border of T-DNA or the vir region.

[0291]5. Multiple cloning regions (MCS) allow and facilitate the insertion of one or more nucleic acid sequences.

[0292]Nucleic acid sequences (e.g. expression cassettes) may be introduced into a plant organism or cells, tissues, organs, parts or seeds thereof by advantageously using vectors which contain said sequences. Vectors may be, by way of example, plasmids, cosmids, phages, viruses or else agrobacteria. The sequences may be inserted into the vector (preferably a plasmid vector) via suitable restriction cleavage sites. The resulting vector may first be introduced into E. coli and amplified. Correctly transformed E. coli are selected, grown and the recombinant vector is obtained using methods familiar to the skilled worker. Restriction analysis and sequencing may serve to check the cloning step. Preference is given to those vectors which make possible a stable integration into the host genome.

[0293]The preparation of a transformed organism (or a transformed cell or tissue) requires that the corresponding DNA (e.g. the transformation vector) or RNA is introduced into the corresponding host cell. For this process which is referred to as transformation (or transduction or transfection), a multiplicity of methods and vectors are available (Keown et al. (1990) Methods in Enzymology 185:527-537; Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Fla.), Chapter 6/7, pp. 71-119 (1993); White F F (1993) Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Editors: Kung and Wu R, Academic Press, 15-38; Jenes B et al. (1993) Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, editors: Kung and R. Wu, Academic Press, pp. 128-143; Potrykus (1991) Annu Rev Plant Physiol Plant Molec Biol 42:205-225; Halford N G, Shewry P R (2000) Br Med Bull 56(1):62-73).

[0294]For example, the DNA or RNA may be introduced directly by microinjection (WO 92/09696, WO 94/00583, EP-A 0 331 083, EP-A 0 175 966) or by bombardment with DNA or RNA-coded microparticles (biolistic processes using the gene gun "particle bombardment"; U.S. Pat. No. 5,100,792; EP-A 0 444 882; EP-A 0 434 616; Fromm M E et al. (1990) Bio/Technology 8(9):833-9; Gordon-Kamm et al. (1990) Plant Cell 2:603). The cell may also be permeabilized chemically, for example with polyethylene glycol, so as to enable the DNA to reach the cell by means of diffusion. The DNA may also take place by means of protoplast fusion to other DNA-containing units such as minicells, cells, lysosomes or liposomes (Freeman et al. (1984) Plant Cell Physiol. 29:1353ff; U.S. Pat. No. 4,536,475). Electroporation is another suitable method for introducing DNA, in which the cells are permeabilized reversibly by an electric impulse (EP-A 290 395, WO 87/06614). Further processes comprise the calciumphosphate-mediated transformation, DEAE-dextran-mediated transformation, the incubation of dry embryos in DNA-containing solution or other methods of direct introduction of DNA (DE 4 005 152, WO 90/12096, U.S. Pat. No. 4,684,611). Appropriate processes have been described (e.g. in Bilang et al. (1991) Gene 100:247-250; Scheid et al. (1991) Mol Gen Genet 228:104-112; Guerche et al. (1987) Plant Science 52:111-116; Neuhause et al. (1987) Theor Appl Genet 75:30-36; Klein et al. (1987) Nature 327:70-73; Howell et al. (1980) Science 208:1265; Horsch et al. (1985) Science 227:1229-1231; DeBlock et al. (1989) Plant Physiology 91:694-701; Methods for Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic Press Inc. (1988); and Methods in Plant Molecular Biology (Schuler and Zielinski, eds.) Academic Press Inc. (1989)). Physical methods of introducing DNA into plant cells have been reviewed by Oard (1991) Biotech Adv 9:1-11.

[0295]In the case of these "direct" transformation methods, no particular requirements are made on the plasmid used. It is possible to use simple plasmids such as those of the pUC series, pBR322, M13mp series, pACYC184 etc.

[0296]Besides these "direct" transformation techniques, transformation may also be carried out by bacterial infection by means of Agrobacterium (e.g. EP 0 116 718), viral infection by means of viral vectors (EP 0 067 553; U.S. Pat. No. 4,407,956; WO 95/34668; WO 93/03161) or by means of pollen (EP 0 270 356; WO 85/01856; U.S. Pat. No. 4,684,611).

[0297]Transformation is preferably carried out by means of agrobacteria which contain disarmed Ti-plasmid vectors, using the latters' natural ability to transfer genes to plants (EP-A 0 270 355; EP-A 0 116 718). Agrobacterium transformation is widespread for transforming dicotyledones, but is also increasingly applied to sequence edons (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell Rep 7:379-384; Zhang et al. (1988) Theor Appl Genet 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962; Peng et al. (1991) International Rice Research Institute, Manila, Philippines 563-574; Cao et al. (1992) Plant Cell Rep 11:585-591; Li et al. (1993) Plant Cell Rep 12:250-255; Rathore et al. (1993) Plant Mol Biol 21:871-884; Fromm et al. (1990) Bio/Technology 8:833-839; Gordon-Kamm et al. (1990) Plant Cell 2:603-618; D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant Mol Biol 18:189-200; Koziel et al. (1993) Biotechnology 11:194-200; Vasil I K (1994) Plant Mol Biol 25:925-937; Weeks et al. (1993) Plant Physiol 102:1077-1084; Somers et al. (1992) Bio/Technology 10:1589-1594; WO 92/14828; Hiei et al. (1994) Plant J 6:271-282).

[0298]The strains most often used for agrobacterial transformation, Agrobacterium tumefaciens or Agrobacterium rhizogenes, contain a plasmid (Ti and Ri plasmids, respectively), which is transferred to the plant after agrobacterial infection. Part of this plasmid, called T-DNA (transferred DNA), is integrated into the genome of the plant cell. Alternatively, Agrobacterium may also transfer binary vectors (mini Ti plasmids) to plants and integrate them into the genome of said plants.

[0299]The application of Agrobacterium tumefaciens to the transformation of plants, using tissue culture explants, has been described (inter alia, Horsch R B et al. (1985) Science 225:1229ff; Fraley et al. (1983) Proc Natl Acad Sci USA 80: 4803-4807; Bevans et al. (1983) Nature 304:184-187). Many Agrobacterium tumefaciens strains are capable of transferring genetic material, such as, for example, the strains EHA101[pEHA101], EHA105[pEHA105], LBA4404[pAL4404], C58C1[pMP90] and C58C1[pGV2260] (Hood et al. (1993) Transgenic Res 2:208-218; Hoekema et al. (1983) Nature 303:179-181; Koncz and Schell (1986) Gen Genet 204:383-396; Deblaere et al. (1985) Nucl Acids Res 13: 4777-4788).

[0300]When using agrobacteria, the expression cassette must be integrated into special plasmids, either a shuttle or intermediate vector or a binary vector. When using a Ti or Ri plasmid for transformation, then at least the right border, but usually the right and left borders of the Ti or Ri plasmid T-DNA are connected as a flanking region to the expression cassette to be introduced. Preference is given to using binary vectors. Binary vectors may replicate both in E. coli and in agrobacteria and contain the components required for transfer into a plant system. They normally contain a selection marker gene for selection of transformed plants (e.g. the nptII gene which imparts a resistance to kanamycin) and a linker or polylinker flanked by the right and left T-DNA border sequences. They contain moreover, outside the T-DNA border sequence, also a selection marker which enables transformed E. coli and/or agrobacteria to be selected (e.g. the nptIII gene which imparts a resistance to kanamycin). Corresponding vectors may be transformed directly into Agrobacterium (Holsters et al. (1978) Mol Gen Genet 163:181-187).

[0301]Binary vectors are based, for example, on "broad host range" plasmids such as pRK252 (Bevan et al. (1984) Nucl Acid Res 12,8711-8720) and pTJS75 (Watson et al. (1985) EMBO J 4(2):277-284). A large group of the binary vectors used is derived from pBIN19 (Bevan et al. (1984) Nucl Acid Res 12:8711-8720). Hajdukiewicz et al. developed a binary vector (pPZP) which is smaller and more efficient than the previously customary vectors (Hajdukiewicz et al. (1994) Plant Mol Biol 25:989-994). Improved and particularly preferred binary vector systems for Agrobacterium-mediated transformation are described in WO 02/00900.

[0302]The agrobacteria transformed with a vector of this kind may then be used in the known manner for transforming plants, in particular crop plants such as, for example, oilseed rape, for example by bathing wounded leaves or leaf sections in an agrobacterial solution and subsequently culturing them in suitable media. The transformation of plants by agrobacteria has been described (White F F, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38; Jenes B et al. (1993) Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, pp. 128-143; Potrykus (1991) Annu Rev Plant Physiol Plant Molec Biol 42:205-225). Transgenic plants may be regenerated in the known manner from the transformed cells of the wounded leaves or leaf sections.

[0303]Different explants, cell plants, tissues, organs, embryos, seeds, microspores or other unicellular or multicellular cellular structures derived from a plant organism may be used for transformation. Transformation processes adjusted to the particular explants, cultures or tissues are known to the skilled worker. Examples which may be mentioned are: shoot internodes (Fry J et al. (1987) Plant Cell Rep. 6:321-325), hypocotyls (Radke S E et al. (1988) Theor Appl Genet 75:685-694; Schroder M et al. (1994) Physiologia Plant 92: 37-46; Stefanov I et al. (1994) Plant Sci. 95:175-186; Weier et al. (1997) Fett/Lipid 99:160-165), cotyledonous petioles (Meloney M M et al. (1989) Plant Cell Rep 8:238-242; Weier D et al. (1998) Molecular Breeding 4:39-46), microspores and proembryos (Pechnan (1989) Plant Cell Rep. 8:387-390) and flower stalks (Boulter M E et al. (1990) Plant Sci 70:91-99; Guerche P et al. (1987) Mol Gen Genet 206:382-386). In the case of a direct gene transfer, mesophyll protoplasts (Chapel P J & Glimelius K (1990) Plant Cell Rep 9: 105-108; Golz et al. (1990) Plant Mol Biol 15:475-483) or else hypocotyl protoplasts (Bergmann P & Glimelius K (1993) Physiologia Plant 88:604-611) and microspores (Chen J L et al. (1994) Theor Appl Genet 88:187-192; Jonesvilleneuve E et al. (1995) Plant Cell Tissue and Organ Cult 40:97-100) and shoot sections (Seki M et al. (1991) Plant Mol Biol 17:259-263) may be employed successfully.

[0304]Stably transformed cells, i.e. those which contain the introduced DNA integrated into the DNA of the host cell, may be selected from untransformed cells by using the selection process of the invention. The plants obtained may be grown and crossed in the usual way. Preferably, two or more generations should be cultured in order to ensure that the genomic integration is stable and can be inherited.

[0305]As soon as a transformed plant cell has been prepared, it is possible to obtain a complete plant by using processes known to the skilled worker. This involves, for example, starting from callus cultures, individual cells (e.g. protoplasts) or leaf disks (Vasil et al. (1984) Cell Culture and Somatic Cell Genetics of Plants, Vol I, II and III, Laboratory Procedures and Their Applications, Academic Press; Weissbach and Weissbach (1989) Methods for Plant Molecular Biology, Academic Press). It is possible to induce from these still undifferentiated callus cell masses the formation of shoot and root in the known manner. The seedlings obtained may be planted out and grown. Appropriate processes have been described (Fennell et al. (1992) Plant Cell Rep. 11: 567-570; Stoeger et al. (1995) Plant Cell Rep. 14:273-278; Jahne et al. (1994) Theor Appl Genet 89:525-533).

[0306]The efficacy of expressing the transgenically expressed nucleic acids may be determined, for example, in vitro by shoot-meristem propagation using any of the selection methods described above. Moreover, changes in the type and level of expression of a target gene and the effect on the phenotype of the plant may be tested in greenhouse experiments using test plants.

[0307]The process of the invention is preferably used within the framework of plant biotechnology for generating plants having advantageous properties. The "nucleic acid sequence to be inserted" into the genome of the plant cell or the plant organism preferably comprises at least one expression cassette, said expression cassette being able to express, under the control of a promoter functional in plant cells or plant organisms, an RNA and/or a protein which do not cause reduction of the expression, amount, activity and/or function of a marker protein but, particularly preferably, impart to the plant genetically altered in this way an advantageous phenotype. Numerous genes and proteins which may be used for achieving an advantageous phenotype, for example for the increase in quality of foodstuff or for producing particular chemicals or pharmaceuticals (Dunwell J M (2000) J Exp Bot 51 Spec No: 487-96) are known to the skilled worker.

[0308]Thus it is possible to improve the suitability of the plants or the seeds thereof as foodstuff or feedstuff, for sequence by altering the compositions and/or the content of metabolites, in particular proteins, oils, vitamins and/or starch. It is also possible to increase the growth rate, yield or resistance to biotic or abiotic stress factors. Advantageous effects may be achieved both by transgenic expression of nucleic acids or proteins and by targeted reduction of the expression of endogenous genes, with respect to the phenotype of the transgenic plant. The advantageous effects which may be achieved in the transgenic plant comprise, for example: [0309]increased resistance to pathogens (biotic stress) [0310]increased resistance to environmental factors such as heat, cold, frost, drought, UV light, oxidative stress, wetness, salt, etc. (abiotic stress) [0311]increased yield [0312]improved quality, for example increased nutritional value, increased storability

[0313]The invention further relates to the use of the transgenic plants prepared according to the process of the invention and of the cells, cell cultures, plants or propagation material such as seeds or fruits derived from said plants, for preparing foodstuff or feedstuff, pharmaceuticals or fine chemicals such as, for example, enzymes, vitamins, amino acids, sugars, fatty acids, natural and synthetic flavorings, aroma substances and colorants. Particular preference is given to the production of triacylglycerides, lipids, oils, fatty acids, starch, tocopherols and tocotrienols and also carotenoids. Genetically modified plants of the invention, which may be consumed by humans and animals may also be used as foodstuff or feedstuff, for example, directly or after preparation known per se.

[0314]As already mentioned above, the process of the invention comprises in a particularly advantageous embodiment, in a process step downstream of the selection, the deletion of the sequence coding for the marker protein (e.g. mediated by recombinase or as described in WO03/004659) or the elimination by crossing and/or segregation of said sequences. (It is obvious to the skilled worker that, for this purpose, the nucleic acid sequence integrated into the genome and the sequence coding for the marker protein should have a separate chromosomal locus in the transformed cells. This, however, is the case in the majority of the resulting plants, merely for reasons of statistics). This procedure is particularly advantageous if the marker protein is a transgene which otherwise does not occur in the plant to be transformed. Although the resulting plant may still possibly contain the compound for reducing the expression, amount, activity and/or function of the marker protein, said compound would have no longer any "counterpart" in the form of said marker protein, and thus would have no effect. This is particularly the case if the marker protein is derived from a non-plant organism and/or is synthetic (for example the codA protein). It is, however, also possible to use plant marker proteins from other plant species, which otherwise do not occur in the cell to be transformed (i.e. if not introduced as transgene). Said marker proteins are referred to as "nonendogenous" marker proteins within the scope of the present invention.

[0315]Very particularly advantageously, the compound for reducing the expression, amount, activity and/or function of the marker protein is an RNA. After deletion or elimination by crossing/segregation, the resulting transgenic plant would have no longer any unnecessary (and, if appropriate, undesired) foreign protein. The sole foreign protein would be possibly the protein resulting from the nucleic acid sequence inserted into the genome. For reasons of product approval, this embodiment is particularly advantageous. As described above, said RNA may be an antisense RNA or, particularly preferably, a double-stranded RNA. It may be expressed separately from the RNA coding for the target protein but also, possibly, on the same strand as the latter.

[0316]In summary, the particularly advantageous embodiment comprises the following features:

[0317]A process for preparing transformed plant cells or organisms, which comprises the following steps: [0318]a) transforming a population of plant cells which comprises at least one non-endogenous (preferably non-plant) marker protein capable of converting directly or indirectly a substance X which is nontoxic for said population of plant cells into a substance Y which is toxic for said population, with at least one nucleic acid sequence to be inserted in combination with at least one nucleic acid sequence coding for a ribonucleic acid sequence capable of reducing the expression, amount, activity and/or function of said marker protein, and [0319]b) treating said population of plant cells with the substance X at a concentration which causes a toxic effect for nontransformed cells, due to the conversion by the marker protein, and [0320]c) selecting transformed plant cells (and/or populations of plant cells, such as plant tissues or plants) whose genome contains said nucleic acid sequence and which have a growth advantage over nontransformed cells, due to the action of said compound, from said population of plant cells, the selection being carried out under conditions under which the marker protein can exert its toxic effect on the nontransformed cells, and [0321]d) regenerating fertile plants, and [0322]e) eliminating by crossing the nucleic acid sequence coding for the marker protein and isolating fertile plants whose genome contains said nucleic acid sequence but does not contain any longer the sequence coding for the marker protein.

[0323]Sequences [0324]SEQ ID NO: 1 Nucleic acid sequence coding for E. coli cytosine deaminase (codA) [0325]SEQ ID NO: 2 amino acid sequence coding for E. coli cytosine deaminase (codA) [0326]SEQ ID NO: 3 Nucleic acid sequence coding for E. coli cytosine deaminase (codA), with modified start codon (GTG/ATG) for expression in eukaryotes [0327]SEQ ID NO: 4 Amino acid sequence coding for E. coli cytosine deaminase (codA), with modified start codon (GTG/ATG) for expression in eukaryotes [0328]SEQ ID NO: 5 Nucleic acid sequence coding for Streptomyces griseolus cytochrome P450-SU1 (suaC) [0329]SEQ ID NO: 6 Amino acid sequence coding for Streptomyces griseolus cytochrome P450-SU1 (suaC) [0330]SEQ ID NO: 7 Nucleic acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (tms2) [0331]SEQ ID NO: 8 Amino acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (tms2) [0332]SEQ ID NO: 9 Nucleic acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (tms2) [0333]SEQ ID NO: 10 Amino acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (tms2) [0334]SEQ ID NO: 11 Nucleic acid sequence coding for Xanthobacter autotrophicus haloalkane dehalogenase (dhlA) [0335]SEQ ID NO: 12 Amino acid sequence coding for Xanthobacter autotrophicus haloalkane dehalogenase (dhlA) [0336]SEQ ID NO: 13 Nucleic acid sequence coding for Herpes simplex Virus 1 thymidine kinase [0337]SEQ ID NO: 14 Amino acid sequence coding for Herpes simplex Virus 1 thymidine kinase [0338]SEQ ID NO: 15 Nucleic acid sequence coding for Herpes simplex Virus 1 thymidine kinase [0339]SEQ ID NO: 16 Amino acid sequence coding for Herpes simplex Virus 1 thymidine kinase [0340]SEQ ID NO: 17 Nucleic acid sequence coding for Toxoplasma gondii hypoxanthine-xanthine-guanine phosphoribosyl transferase [0341]SEQ ID NO: 18 Amino acid sequence coding for Toxoplasma gondii hypoxanthine-xanthine-guanine phosphoribosyl transferase [0342]SEQ ID NO: 19 Nucleic acid sequence coding for E. coli xanthine-guanine phosphoribosyl transferase [0343]SEQ ID NO: 20 Amino acid sequence coding for E. coli xanthine-guanine phosphoribosyl transferase [0344]SEQ ID NO: 21 Nucleic acid sequence coding for E. coli xanthine-guanine phosphoribosyl transferase [0345]SEQ ID NO: 22 Amino acid sequence coding for E. coli xanthine-guanine phosphoribosyl transferase [0346]SEQ ID NO: 23 Nucleic acid sequence coding for E. coli purine nucleoside phosphorylase (deoD) [0347]SEQ ID NO: 24 Nucleic acid sequence coding for E. coli purine nucleoside phosphorylase (deoD) [0348]SEQ ID NO: 25 Nucleic acid sequence coding for Burkholderia caryophylli phosphonate monoester hydrolase (pehA) [0349]SEQ ID NO: 26 Amino acid sequence coding for Burkholderia caryophylli phosphonate monoester hydrolase (pehA) [0350]SEQ ID NO: 27 Nucleic acid sequence coding for Agrobacterium rhizogenes tryptophan oxygenase (aux1) [0351]SEQ ID NO: 28 Amino acid sequence coding for Agrobacterium rhizogenes tryptophan oxygenase (aux1) [0352]SEQ ID NO: 29 Nucleic acid sequence coding for Agrobacterium rhi-zogenes indoleacetamide hydrolase (aux2) [0353]SEQ ID NO: 30 Amino acid sequence coding for Agrobacterium rhizogenes indoleacetamide hydrolase (aux2) [0354]SEQ ID NO: 31 Nucleic acid sequence coding for Agrobacterium tumefaciens tryptophan oxygenase (aux1) [0355]SEQ ID NO: 32 Amino acid sequence coding for Agrobacterium tumefaciens tryptophan oxygenase (aux1) [0356]SEQ ID NO: 33 Nucleic acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (aux2) [0357]SEQ ID NO: 34 Amino acid sequence coding for Agrobacterium tumefaciens indoleacetamide hydrolase (aux2) [0358]SEQ ID NO: 35 Nucleic acid sequence coding for Agrobacterium vitis indoleacetamide hydrolase (aux2) [0359]SEQ ID NO: 36 Amino acid sequence coding for Agrobacterium vitis indoleacetamide hydrolase (aux2) [0360]SEQ ID NO: 37 Nucleic acid sequence coding for Arabidopsis thaliana 5-methylthioribose kinase (mtrK) [0361]SEQ ID NO: 38 Amino acid sequence coding for Arabidopsis thaliana 5-methylthioribose kinase (mtrK) [0362]SEQ ID NO: 39 Nucleic acid sequence coding for Klebsiella pneumoniae 5-methylthioribose kinase (mtrK) [0363]SEQ ID NO: 40 Amino acid sequence coding for Klebsiella pneumoniae 5-methylthioribose kinase (mtrK) [0364]SEQ ID NO: 41 Nucleic acid sequence coding for Arabidopsis thaliana alcohol dehydrogenase (adh) [0365]SEQ ID NO: 42 Amino acid sequence coding for Arabidopsis thaliana alcohol dehydrogenase (adh) [0366]SEQ ID NO: 43 Nucleic acid sequence coding for Hordeum vulgare (barley) alcohol dehydrogenase (adh) [0367]SEQ ID NO: 44 Amino acid sequence coding for Hordeum vulgare (barley) alcohol dehydrogenase (adh) [0368]SEQ ID NO: 45 Nucleic acid sequence coding for Oryza sativa (rice) alcohol dehydrogenase (adh) [0369]SEQ ID NO: 46 Amino acid sequence coding for Oryza sativa (rice) alcohol dehydrogenase (adh) [0370]SEQ ID NO: 47 Nucleic acid sequence coding for Zea mays (corn) alcohol dehydrogenase (adh) [0371]SEQ ID NO: 48 Amino acid sequence coding for Zea mays (corn) alcohol dehydrogenase (adh) [0372]SEQ ID NO: 49 Nucleic acid sequence coding for a sense RNA fragment of E. coli cytosine deaminase (codARNAi-sense) [0373]SEQ ID NO: 50 Oligonucleotide primer codA5'HindIII 5'-AAGCTTGGCTAACAGTGTCGAATAACG-3' [0374]SEQ ID NO: 51 Oligonucleotide primer codA3'SalI 5'-GTCGACGACAAAATCCCTTCCTGAGG-3' [0375]SEQ ID NO: 52 Nucleic acid sequence coding for an antisense RNA fragment of E. coli cytosine deaminase (codARNAi-anti) [0376]SEQ ID NO: 53 Oligonucleotide primer codA5'EcoRI 5'-GAATTCGGCTAACAGTGTCGAATAACG-3' [0377]SEQ ID NO: 54 Oligonucleotide primer codA3'BamHI 5'-GGATCCGACAAAATCCCTTCCTGAGG-3' [0378]SEQ ID NO: 55 Vector construct pBluKS-nitP-STLS1-35S-T [0379]SEQ ID NO: 56 Expression vector pSUN-1 [0380]SEQ ID NO: 57 Transgenic expression vector pSUN-1-codA-RNAi [0381]SEQ ID NO: 58 Transgenic expression vector pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT [0382]SEQ ID NO: 59 Nucleic acid sequence coding for 5-methylthioribose kinase (mtrK) from corn (Zea mays); fragment [0383]SEQ ID NO: 60 Amino acid sequence coding for 5-methylthioribose kinase (mtrK) from corn (Zea mays); fragment [0384]SEQ ID NO: 61 Nucleic acid sequence coding for 5-methylthioribose kinase (mtrK) from oilseed rape (Brassica napus), fragment [0385]SEQ ID NO: 62 Amino acid sequence coding for 5-methylthioribose kinase (mtrK) from oilseed rape (Brassica napus), fragment [0386]SEQ ID NO: 63 Nucleic acid sequence coding for 5-methylthioribose kinase (mtrK) from oilseed rape (Brassica napus), fragment [0387]SEQ ID NO: 64 Amino acid sequence coding for 5-methylthioribose kinase (mtrK) from oilseed rape (Brassica napus), fragment [0388]SEQ ID NO: 65 Nucleic acid sequence coding for 5-methylthioribose kinase (mtrK) from rice (Oryza sativa), fragment [0389]SEQ ID NO: 66 Amino acid sequence coding for 5-methylthioribose kinase (mtrK) from rice (Oryza sativa), fragment [0390]SEQ ID NO: 67 Nucleic acid sequence coding for 5-methylthioribose kinase (mtrK) from soybean (Glycine max), fragment [0391]SEQ ID NO: 68 Amino acid sequence coding for 5-methylthioribose kinase (mtrK) from soybean (Glycine max), fragment [0392]SEQ ID NO: 69 Oligonucleotide primer codA5'C-term 5'-CGTGAATACGGCGTGGAGTCG-3' [0393]SEQ ID NO: 70 Oligonucleotide primer codA3'C-term 5'-CGGCAGGATAATCAGGTTGG-3' [0394]SEQ ID NO: 71 Oligonucleotide primer 35sT 5' primer 5'-GTCAACGTAACCAACCCTGC-3'

BRIEF DESCRIPTION OF THE DRAWINGS

[0395]FIG. 1: Inactivation of the marker protein gene by means of introducing a recombinase

[0396]P: promoter

[0397]MP: Sequence coding for a marker protein

[0398]R1/R2: Recombinase recognition sequences

[0399]R: Recombinase or sequence coding for recombinase.

[0400]In a preferred embodiment, the marker protein gene is inactivated by introducing a sequence-specific recombinase. Preference is given to its expressing the recombinase, as depicted here, starting from an expression cassette.

[0401]The marker protein gene is flanked by recognition sequences for sequence-specific recombinases, with sequences of said marker protein gene being deleted by introducing said recombinase and thus said marker protein gene being inactivated.

[0402]FIG. 2-A: Inactivation of the marker protein gene by the action of a sequence-specific nuclease

[0403]P: promoter

[0404]DS: Recognition sequence for targeted induction of

[0405]DNA double-strand breaks

[0406]MP-DS-MP': Sequence coding for a marker protein, comprising a DS

[0407]nDS: Inactivated DS

[0408]E: Sequence-specific enzyme for targeted induction of DNA double-strand breaks

[0409]The marker protein gene may be established by a targeted mutation or deletion in the marker protein gene, for example by sequence-specific induction of DNA double-strand breaks at a recognition sequence for targeted induction of DNA double-strand breaks in or close to the marker protein gene (P-MP). The double-strand break may occur in the coding region or else the noncoding (such as, for example, the promoter) region, induces an illegitimate recombination (nonhomologous DNA-end joining) and thus, for example, a shift in the reading frame of said marker protein.

[0410]FIG. 2-B: Inactivation of the marker protein gene by the action of a sequence-specific nuclease

[0411]P: promoter

[0412]DS: Recognition sequence for targeted induction of DNA double-strand breaks

[0413]MP: Sequence coding for a marker protein

[0414]nDS: Inactivated DS

[0415]E: Sequence-specific enzyme for targeted induction of DNA double-strand breaks

[0416]The marker protein gene may be established by a targeted deletion by sequence-specific induction of more than one sequence-specific DNA double-strand break in or close to said marker protein gene. The double-strand breaks may occur in the coding region or else the noncoding (such as, for example, the promoter) region and induce a deletion in the marker protein gene. The marker protein gene is preferably flanked by DS sequences and is completely deleted by the action of enzyme E.

[0417]FIG. 3: Inactivation of the marker protein gene by inducing an intramolecular homologous recombination, due to the action of a sequence-specific nuclease

[0418]A/A': Sequences with a sufficient length and homology to one another, in order to recombine with one another as a consequence of the induced double-strand break

[0419]P: promoter

[0420]DS: Recognition sequence for targeted induction of DNA double-strand breaks

[0421]MP: Sequence coding for a marker protein

[0422]E: Sequence-specific enzyme for targeted induction of DNA double-strand breaks

[0423]The marker protein gene may be inactivated by a deletion by means of intramolecular homologous recombination. Said homologous recombination may be initiated by sequence-specific induction of DNA double-strand breaks at a recognition sequence for targeted induction of DNA double-strand breaks in or close to the marker protein gene. The homologous recombination occurs between the sequences A and A' which have a sufficient length and homology to one another in order to recombine with one another as a consequence of the induced double-strand break. The recombination causes a deletion of essential sequences of the marker protein gene.

[0424]FIG. 4: Inactivation of the marker protein gene by intermolecular homologous recombination

[0425]A/A': Sequences with a sufficient length and homology to one another in order to recombine with one another

[0426]B/B': Sequences with a sufficient length and homology to one another in order to recombine with one another

[0427]P: promoter

[0428]I: nucleic acid sequence/gene of interest to be inserted

[0429]MP: Sequence coding for a marker protein

[0430]The marker protein gene (P-MP) may also be inactivated by a targeted insertion into the marker protein gene, for example by means of intermolecular homologous recombination. In this context, the region to be inserted is flanked on its 5' and 3' ends by nucleic acid sequences (A' and B', respectively), which have a sufficient length and homology to corresponding flanking sequences of the marker protein (A and B, respectively) in order to make possible a homologous recombination between A and A' and B and B'. The recombination causes a deletion of essential sequences of the marker protein gene.

[0431]FIG. 5: Inactivation of the marker protein gene by intermolecular homologous recombination due to the action of a sequence-specific nuclease

[0432]A/A': Sequences with a sufficient length and homology to one another in order to recombine with one another

[0433]B/B': Sequences with a sufficient length and homology to one another in order to recombine with one another

[0434]P: promoter

[0435]I: nucleic acid sequence/gene of interest to be inserted

[0436]MP: Sequence coding for a marker protein

[0437]DS: Recognition sequence for targeted induction of DNA double-strand breaks

[0438]E: Sequence-specific enzyme for targeted induction of DNA double-strand breaks

[0439]The marker protein gene may also be inactivated by a targeted insertion into the marker protein gene, for example by means of intermolecular homologous recombination. The homologous recombination may be initiated by sequence-specific induction of DNA double-strand breaks at a recognition sequence for targeted induction of DNA double-strand breaks in or close to the marker protein gene. In this context, the region to be inserted is flanked at its 5' and 3' ends by nucleic acid sequences (A' and B', respectively) which have a sufficient length and homology to corresponding flanking sequences of the marker protein gene (A and B, respectively) in order to make possible a homologous recombination between A and A' and B and B'. The recombination causes a deletion of essential sequences of the marker protein gene.

[0440]FIG. 6: Vector map for pBluKS-nitP-STLS1-35S-T (SEQ ID NO: 55)

[0441]NitP: promoter of the A. thaliana nitrilaseI gene (GenBank Acc. No.: Y07648.2, Hillebrand et al. (1996) Gene 170:197-200)

[0442]STLS-1 intron: intron of the potato ST-LS1 gene (Vancanneyt G F et al. (1990) Mol Gen Genet 220(2):245-250).

[0443]35S-Term: Terminator of the 35S CaMV gene (cauliflower mosaic virus; Franck et al. (1980) Cell 21:285-294).

[0444]Cleavage sites of relevant restriction endonucleases are indicated with their particular cleavage position.

[0445]FIG. 7: Vector map for the transgenic expression vector pSUN-1-codA-RNAi (SEQ ID NO: 57)

[0446]NitP: promoter of the A. thaliana nitrilaseI gene (GenBank Acc. No.: Y07648.2, Hillebrand et al. (1996) Gene 170:197-200)

[0447]STLS-1 intron: intron of the potato ST-LS1 gene (Vancanneyt G F et al. (1990) Mol Gen Genet 220(2):245-250).

[0448]35S-Term: Terminator of the 35S CaMV gene (cauliflower mosaic virus; Franck et al. (1980) Cell 21:285-294).

[0449]codA-sense: Nucleic acid sequence coding for a sense RNA fragment of E. coli cytosine deaminase (codARNAi-sense; SEQ ID NO: 49)

[0450]codA-anti: Nucleic acid sequence coding for an antisense RNA fragment of E. coli cytosine deaminase (codARNAi-anti; SEQ ID NO: 52)

[0451]LB/RB: Left and, respectively, right boundaries of Agrobacterium T-DNA

[0452]Cleavage sites of relevant restriction endonucleases are indicated with their particular cleavage position. Further elements represent customary elements of a binary Agrobacterium vector (aadA; ColE1; repA)

[0453]FIG. 8: Vector map for the transgenic expression vector pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT (SEQ ID NO: 58)

[0454]NitP: promoter of the A. thaliana nitrilaseI gene (GenBank Acc. No.: Y07648.2, Hillebrand et al. (1996) Gene 170:197-200)

[0455]STLS-1 intron: intron of the potato ST-LS1 gene (Vancanneyt G F et al. (1990) Mol Gen Genet 220(2):245-250).

[0456]35S-Term: Terminator of the 35S CaMV gene (cauliflower mosaic virus; Franck et al. (1980) Cell 21:285-294).

[0457]codA-sense: Nucleic acid sequence coding for a sense RNA fragment of E. coli cytosine deaminase (codARNAi-sense; SEQ ID NO: 49)

[0458]codA-anti: Nucleic acid sequence coding for an antisense RNA fragment of E. coli cytosine deaminase (codARNAi-anti; SEQ ID NO: 52)

[0459]Left border/right border: Left and, respectively, right boundaries of Agrobacterium T-DNA

[0460]Cleavage sites of relevant restriction endonucleases are indicated with their particular cleavage position. Further elements represent customary elements of a binary Agrobacterium vector (aadA; ColE1; repA)

[0461]FIG. 9a-b: Sequence comparison of various 5-methylthioribose (MTR) kinases from various organisms, in particular plant organisms. Sequences from Klebsiella pneumoniae (SEQ ID NO: 40), Clostridium tetani (SEQ ID NO: 178), Arabidopsis thaliana (A. thaliana) (SEQ ID NO: 38), oilseed rape (Brassica napus) (SEQ ID NO: 64), soybean (Soy-1) (SEQ ID NO: 68), rice (Oryza sativa-1) (SEQ ID NO: 66), corn (Zea mays) (SEQ ID NO: 60), and also the consensus sequence (Consensus) (SEQ ID NO: 179) are shown. Homologous regions can be readily deduced from the consensus sequence.

DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

General Methods

[0462]The chemical synthesis of oligonucleotides may be carried out, for example, in the known manner by using the phosphoamide method (Voet, Voet, 2^nd Edition, Wiley Press New York, pages 896-897). The cloning steps carried out within the scope of the present invention, such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, propagation of phages and sequence analysis of recombinant DNA, are carried out as described in Sambrook et al. (1989) Cold Spring Harbor Laboratory Press; ISBN 0-87969-309-6. The sequencing of recombinant DNA molecules was carried out using a laser fluorescence DNA sequencer from ABI, according to the method of Sanger (Sanger et al. (1977) Proc Natl Acad Sci USA 74:5463-5467).

Example 1

Preparation of codA Fragments

[0463]First, a truncated nucleic acid variant of the codA gene, modified by the addition of recognition sequences of the restriction enzymes HindIII and SalI, is prepared using the PCR technique. For this purpose, part of the codA gene (GeneBank Acc. No.: 556903; SEQ ID NO: 1) is amplified from the E. coli source organism by means of the polymerase chain reaction (PCR) using a sense-specific primer (codA5'HindIII; SEQ ID NO: 50) and an antisense-specific primer (codA3'SalI; SEQ ID NO: 51).

TABLE-US-00004 codA5'HindIII: 5'-AAGCTTGGCTAACAGTGTCGAATAACG-3' (SEQ ID NO: 50) codA3'SalI: 5'-GTCGACGACAAAATCCCTTCCTGAGG-3' (SEQ ID NO: 51)

[0464]The PCR was carried out in 50 μl reaction mixture which contained: [0465]2 μl (200 ng) of E. coli genomic DNA [0466]0.2 mM dATP, dTTP, dGTP, dCTP [0467]1.5 mM Mg(OAc)₂ [0468]5 μg of bovine serum albumin [0469]40 pmol of "codA5'HindIII" primer [0470]40 pmol of "codA3'SalI" primer [0471]15 μl of 3.3× rTth DNA Polymerase XLPuffer (PE Applied Biosystems) [0472]5U of rTth DNA Polymerase XL (PE Applied Biosystems)

[0473]The PCR is carried out under the following cycle conditions: [0474]Step 1: 5 minutes 94° C. (denaturation) [0475]Step 2: 3 seconds 94° C. [0476]Step 3: 1 minute 60° C. (annealing) [0477]Step 4: 2 minutes 72° C. (elongation) [0478]30 repeats of steps 2 to 4 [0479]Step 5: 10 minutes 72° C. (post elongation) [0480]Step 6: 4° C. (waiting loop)

[0481]The amplicon (codARNAi-sense; SEQ ID NO: 49) is cloned using standard methods into the PCR cloning vector pGEM-T (Promega). The identity of the amplicon generated is confirmed by sequencing using the M13F (-40) primer.

[0482]Another truncated fragment of the codA gene, modified by the addition of recognition sequences of the restriction enzymes EcoRI and BamHI, is amplified using a sense-specific primer (codA5'EcoRI; SEQ ID NO: 53) and an antisense-specific primer (codA3'BamHI; SEQ ID NO: 54).

TABLE-US-00005 codA5'EcoRI: 5'-GAATTCGGCTAACAGTGTCGAATAACG-3' (SEQ ID NO: 53) codA3'BamHI: 5'-GGATCCGACAAAATCCCTTCCTGAGG-3' (SEQ ID NO: 54)

[0483]The PCR was carried out in 50 μl reaction mixture which contained: [0484]2 μl (200 ng) of E. coli genomic DNA [0485]0.2 mM dATP, dTTP, dGTP, dCTP [0486]1.5 mM Mg(OAc)₂ [0487]5 μg of bovine serum albumin [0488]40 pmol of "codA5'EcoRI" primer [0489]40 pmol of "codA3'BamHI" primer [0490]15 μl of 3.3× rTth DNA Polymerase XLPuffer (PE Applied Biosystems) [0491]5U of rTth DNA Polymerase XL (PE Applied Biosystems)

[0492]The PCR is carried out under the following cycle conditions: [0493]Step 1: 5 minutes 94° C. (denaturation) [0494]Step 2: 3 seconds 94° C. [0495]Step 3: 1 minute 60° C. (annealing) [0496]Step 4: 2 minutes 72° C. (elongation) [0497]30 repeats of steps 2 to 4 [0498]Step 5: 10 minutes 72° C. (post elongation) [0499]Step 6: 4° C. (waiting loop)

[0500]The amplicon (codARNAi-anti; SEQ ID NO: 52) is cloned using standard methods into the PCR cloning vector pGEM-T (Promega). The identity of the amplicon generated is confirmed by sequencing using the M13F (-40) primer.

Example 2

Preparation of the Transgenic Expression Vector for Expressing a codA Double-Stranded RNA

[0501]The codA fragments generated in example 1 are used for preparing a DNA construct suitable for expressing a double-stranded codA RNA (pSUN-codA-RNAi). The construct is suitable for reducing the steady-state RNA level of the codA gene in transgenic plants and, as a result therefrom, suppressing codA gene expression by using the double-strand RNA interference (dsRNAi) technique. For this purpose, the codA RNAi cassette is first constructed in the plasmid pBluKS-nitP-STLS1-35S-T and then, in a further cloning step, completely transferred to the pSUN-1 plasmid.

[0502]The vector pBluKS-nitP-STLS1-35S-T (SEQ ID NO: 55) is a derivative of pBluescript KS (Stratagene) and contains the promoter of the A. thaliana nitrilaseI gene (GenBank Acc. No.: Y07648.2, nucleotides 2456 to 4340, Hillebrand et al. (1996) Gene 170:197-200), the STLS-1 intron (Vancanneyt G F et al. (1990) Mol Gen Genet 220(2):245-250), restriction cleavage sites flanking the intron on its 5' and 3' sides and enabling DNA fragments to be inserted in a directed manner, and the terminator of the 35S CaMV gene (cauliflower mosaic virus; Franck et al. (1980) Cell 21:285-294). Using these restriction cleavage sites (HindIII, SalI, EcoRI, BamHI), the fragments codARNAi-sense (SEQ ID NO: 49) and codARNAi-anti (SEQ ID NO: 52) are inserted into said vector, thereby producing the finished codA RNAi cassette.

[0503]For this purpose, the codA sense fragment (codARNAi-sense SEQ ID NO: 49) is first excised from the pGEM-T vector, using the enzymes HindIII and SalI, isolated and ligated into the pBluKS-nitP-STLS1-35S-T vector under standard conditions. This vector had previously been cleaved using the restriction enzymes HindIII and SalI. Correspondingly positive clones are identified by analytical restriction digest and sequencing.

[0504]The vector obtained (pBluKS-nitP-codAsense-STLS1-35S-T) is digested using the restriction enzymes BamHI and EcoRI. The codA-anti fragment (codARNAi-anti; SEQ ID NO: 52) is excised from the corresponding pGEM-T vector, using BamHI and EcoRI, isolated and ligated into the cut vector under standard conditions. Correspondingly positive clones which contain the complete codA-RNAi cassette (pBluKS-nitP-codAsense-STLS1-codAanti-35S-T) are identified by analytical restriction digest and sequencing.

[0505]The codA-RNAi cassette is transferred into the pSUN-1 vector (SEQ ID NO: 56) by using the SacI and KpnI restriction cleavage sites flanking the cassette. The resulting vector pSUN1-codA-RNAi (see FIG. 7; SEQ ID NO: 57) is used for transforming transgenic A. thaliana plants which express an active codA gene (see below). The plant expression vector pSUN-1 is particularly suitable within the scope of the process of the invention, since it does not contain any other positive selection marker.

[0506]The resulting vector, pSUN1-codA-RNAi, enables an artificial codA-dsRNA variant consisting of two identical nucleic acid elements which are separated by an intron and inverted to one another to be constitutively expressed. Transcription of this artificial codA-dsRNA variant results in the formation of a double-stranded RNA molecule, owing to the complementarity of the inverted nucleic acid elements. The presence of this molecule induces the suppression of codA gene expression (accummulation of RNA) by means of double-strand RNA interference.

Example 4

Preparation of Transgenic Arabidopsis thaliana Plants

[0507]Transgenic Arabidopsis thaliana plants which express transgenically the E. coli codA gene as a marker protein ("A. thaliana-[codA]"), were prepared as described (Kirik et al. (2000) EMBO J 19(20):5562-6).

[0508]The A. thaliana-[codA] plants are transformed with an Agrobacterium tumefaciens strain (GV3101 [pMP90]) on the basis of a modified vacuum infiltration method (Clough S & Bent A (1998) Plant J 16(6):735-43; Bechtold N et al. (1993) CR Acad Sci Paris 1144(2):204-212). The Agrobacterium tumefaciens cells used have previously been transformed with the DNA construct described (pSUN1-codA-RNAi). In this way, double transgenic A. thaliana-[codA] plants are generated which express an artificial codA double-stranded RNA under the control of the constitutive nitrilaseI promoter. Expression of the codA gene is suppressed as a consequence of the dsRNAi effect induced by the presence of this artificial codA-dsRNA. Said double transgenic plants may be identified owing to their regained ability to grow in the presence of 5-fluorocytosine in the culture medium.

[0509]Seeds of primary transformants are selected on the basis of the regained ability to grow in the presence of 5-fluorocytosine. For this purpose, the T1 seeds of the primary transformants are laid out on selection medium containing 200 μg/ml 5-fluorocytosine. These selection plates are incubated under long-day conditions (16 h of light, 21° C./8 h of darkness, 18° C.). Seedlings which develop normally in the presence of 5-fluorocytosine are separated after 7 days and transferred to new selection plates. These plates are incubated for another 14 under unchanged conditions. The resistant seedlings are then transplanted into soil and cultured under short-day conditions (8 h of light, 21° C./16 h of darkness, 18° C.). After 14 days, the young plants are transferred to the greenhouse and cultured under short-day conditions.

Example 5

Preparation of a Plant Transformation Vector Containing an Expression Cassette for Expressing a Double-Stranded codA RNA and a Plant Selection Marker

[0510]A plant selection marker consisting of a mutated variant of the A. thaliana Als gene, coding for the acetolactate synthase under the control of the promoter of the A. thaliana actin-2 gene (Meagher R B & Williamson R E (1994) The plant cytoskeleton.

In The Plant Cytoskeleton (Meyerowitz, E. & Somerville, C., eds), pp. 1049-1084. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), and the octopine synthase terminator (GIELEN J et al. (1984) EMBO J 3:835-846) is inserted into pSUN1-codA-RNAi (see FIG. 7; SEQ ID NO: 57) (At.Act.-2-At.Als-R-ocsT).

[0511]For this purpose, the pSUN1-codA-RNAi vector is first linearized using the restriction enzyme Pvu II. Subsequently, a linear DNA fragment with blunt ends, coding for a mutated variant of the acetolactate synthase (Als-R gene), is ligated into said linearized vector under standard conditions. Prior to ligation, this DNA fragment has been digested with the restriction enzyme KpnI and the protruding ends have been converted into blunt ends by treatment with Pwo DNA polymerase (Roche) according to the manufacturer's instructions. This mutated variant of the A. thaliana Als gene cannot be inhibited by herbicides of the imidazolinone type. By expressing this mutated A.tAls-R gene, the plants obtain the ability to grow in the presence of the herbicide Pursuit®. Correspondingly positive clones (pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT; SEQ ID NO: 57) are identified by analytical restriction digest and sequencing.

[0512]The vector obtained enables an artificial codA RNA variant (consisting of two identical nucleic acid elements which are separated by an intron and inverted to one another) and a mutated variant of the A. thaliana Als gene to be expressed constitutively. Transcription of this artificial codA RNA variant results in the formation of a double-stranded RNA molecule, owing to the complementarity of the inverted nucleic acid elements. The presence of this molecule induces the suppression of codA gene expression (accummulation of RNA) by means of double-strand RNA interference. Expression of the Als-R gene imparts to the plants the ability to grow in the presence of herbicides of the imidazolinone type.

Example 6

Preparation of Transgenic Arabidopsis thaliana Plants

[0513]Transgenic Arabidopsis thaliana plants expressing the E. coli codA gene as a marker protein ("A. thaliana-[codA]") were prepared as described (Kirik et al. (2000) EMBO J 19(20):5562-6).

[0514]The A. thaliana-[codA] plants are transformed with an Agrobacterium tumefaciens strain (GV3101 [pMP90]) on the basis of a modified vacuum infiltration method (Clough S & Bent A (1998) Plant J 16(6):735-43; Bechtold N et al. (1993) CR Acad Sci Paris 1144(2):204-212). The Agrobacterium tumefaciens cells used have previously been transformed with the DNA construct described (pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT; SEQ ID NO: 57). In this way, double transgenic A. thaliana-[codA] plants are generated which additionally express an artificial codA double-stranded RNA and a herbicide-insensitive variant of the Als gene (Als-R) under the control of the constitutive nitrilaseI promoter (A. thaliana-[codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT]). Expression of the codA gene is suppressed as a consequence of the dsRNAi effect induced by the presence of this artificial codA-dsRNA. These double transgenic plants may be identified owing to their regained ability to grow in the presence of 5-fluorocytosine in the culture medium. In addition, positively transformed plants can be selected owing to their ability to grow in the presence of the herbicide Pursuit in the culture medium.

[0515]For the purpose of selection, the T1 seeds of primary transformants are therefore laid out on selection medium containing 100 μg/ml 5-fluorocytosine. These selection plates are incubated under long-day conditions (16 h of light, 21° C./8 h of darkness, 18° C.). Seedlings which develop normally in the presence of 5-fluorocytosine are separated after 28 days and transferred to new selection plates. These plates are incubated for another 14 days under unchanged conditions. The resistant seedlings are then transplanted into soil and cultured under short-day conditions (8 h of light, 21° C./16 h of darkness, 18° C.). After a further 14 days, the young plants are transferred to the greenhouse and cultured under short-day conditions.

[0516]In addition, seeds of the primary transformants, owing to their ability to grow in the presence of the herbicide Pursuit®, may be selected. It is furthermore possible to carry out dual selection using the herbicide Pursuit® and 5-fluorocytosine. For this purpose, the T1 seeds of primary transformants are laid out on selection medium containing the herbicide Pursuit® at a concentration of 100 nM (in the case of dual selection, 100 μg/ml 5-fluorocytosine is likewise present). These selection plates are incubated under long-day conditions (16 h of light, 21° C./8 h of darkness, 18° C.)

[0517]Seedlings which develop normally in the presence of Pursuit® (Pursuit® and 5-fluorocytosine) are separated after 28 days and transferred to new selection plates. These plates are incubated under unchanged conditions for another 14 days. The resistant seedlings are then transplanted into soil and cultured under short-day conditions (8 h of light, 21° C./16 h of darkness, 18° C.). After 14 days, the young plants are transferred to the greenhouse and cultured under short-day conditions.

Example 7

Analysis of the Double Transgenic A. thaliana Plants Selected using 5-fluorocytosine and/or Pursuit (A. thaliana-[codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT])

[0518]Integration of the T-DNA region of the vector used for transformation, pSUN1-codA-RNAi-A.tAls-R, into the genomic DNA of the starting plant (A. thaliana-[codA]) and the loss of codA-specific mRNA in these transgenic plants (A. thaliana-[codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT]) can be detected by applying Southern analyses and PCR techniques or Northern analyses.

[0519]In order to carry out said analyses, total RNA and DNA are isolated from leaf tissue of the transgenic plants and suitable controls (using the RNeasy Maxi Kit (RNA) and Dneasy Plant Maxi Kit (genomic DNA), respectively, according to the manufacturer's information by Qiagen).

In the PCR analyses, the genomic DNA may be used directly as a basis (template) for the PCR. Total RNA is transcribed to cDNA prior to the PCR. The cDNA synthesis is carried out using the reverse transcriptase Superscript II (Invitrogen) according to the manufacturer's information.

Example 8

Detection of the Reduction in the Steady-State Amount of codA RNA in the Positively Selected Double Transgenic Plants (A. thaliana [codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT]) in Comparison with the Starting Plants (A. thaliana [codA]) used for Transformation, by Means of cDNA Synthesis with Subsequent PCR Amplification

[0520]PCR amplification of the codA-specific cDNA: The cDNA of the codA gene (ACCESSION S56903) may be amplified using a sense-specific primer (codA5'C-term SEQ ID NO: 69) and an antisense-specific primer (codA3' C-term SEQ ID NO: 70). The PCR conditions to be chosen are as follows:

The PCR was carried out in 50 μl reaction mixture which contained: [0521]2 μl (200 ng) of cDNA from A. thaliana-[codA] or A. thaliana [codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT] plants [0522]0.2 mM dATP, dTTP, dGTP, dCTP [0523]1.5 mM Mg(OAc)₂ [0524]5 μg of bovine serum albumin [0525]40 pmol of codA5'C-term SEQ ID NO: 69 [0526]40 pmol of codA3'C-term SEQ ID NO: 70 [0527]15 μl of 3.3× rTth DNA Polymerase XLPuffer (PE Applied Biosystems) [0528]5U of rTth DNA Polymerase XL (PE Applied Biosystems)

[0529]The PCR was carried out under the following cycle conditions: [0530]Step 1: 5 minutes 94° C. (denaturation) [0531]Step 2: 3 seconds 94° C. [0532]Step 3: 1 minute 56° C. (annealing) [0533]Step 4: 2 minutes 72° C. (elongation) [0534]30 repeats of steps 2 to 4 [0535]Step 5: 10 minutes 72° C. (post elongation) [0536]Step 6: 4° C. (waiting loop)

[0537]In the positively selected plants, the steady-state amount of the mRNA of the codA gene and the amount of CODA protein resulting therefrom is reduced so much that a quantitative conversion of 5-fluorocytosine to 5-fluorouracil can no longer occur. Consequently, these plants (in contrast to the untransformed plants) can grow in the presence of 5-fluorocytosine. Thus it is demonstrated that transgenic plants can be identified owing to the applied principle of preventing expression of a negative selection marker.

Example 9

Detection of the DNA Coding for codA-RNAi by using Genomic DNA of the Positively Selected Double Transgenic Plants (A. thaliana [codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT])

[0538]The codA-RNAi transgene may be amplified using a codA-specific primer (e.g. codA5'HindIII SEQ ID NO: 50) and a 35S terminator-specific primer (35sT 5' Primer SEQ ID NO: 71). Using this primer combination, it is possible to detect specifically only the DNA coding for the codA RNAi construct, since the codA gene which was already present in the starting plants (A. thaliana [codA]) used for transformation is flanked by the nos terminator.

[0539]The PCR conditions to be chosen are as follows: The PCR was carried out in a 50 μl reaction mixture which contains: [0540]2 μl (200 ng) of genomic DNA from the A. thaliana [codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT] plants [0541]0.2 mM dATP, dTTP, dGTP, dCTP [0542]1.5 mM Mg(OAc)₂ [0543]5 μg of bovine serum albumin [0544]40 pmol of codA-specific sense primer (SEQ ID NO: 50, 53 or 69) [0545]40 pmol of 35sT 5' primer SEQ ID NO: 71 [0546]15 μl of 3.3× rTth DNA Polymerase XLPuffer (PE Applied Biosystems) [0547]5U of rTth DNA Polymerase XL (PE Applied Biosystems)

[0548]The PCR was carried out under the following cycle conditions: [0549]Step 1: 5 minutes 94° C. (denaturation) [0550]Step 2: 3 seconds 94° C. [0551]Step 3: 1 minute 56° C. (annealing) [0552]Step 4: 2 minutes 72° C. (elongation) [0553]30 repeats of steps 2 to 4 [0554]Step 5: 10 minutes 72° C. (post elongation) [0555]Step 6: 4° C. (waiting loop)

[0556]In this way, it is possible to detect in the positively selected plants integration of the codA-RNAi DNA construct into the chromosomal DNA of the starting plants used for transformation. Thus it is demonstrated that transgenic plants can be identified owing to the applied principle of preventing expression of a negative selection marker.

Example 10

Detection of the Reduction in the Steady-State Amount of codA RNA in the Positively Selected Double Transgenic Plants (A. thaliana [codA]-[codA-RNAi-At.Act.-2-At.Als-R-ocsT]) in Comparison with the Starting Plants (A. thaliana [codA]) used for Transformation, by Northern Analysis

Gel-Electrophoretic RNA Fractionation:

[0557]For each RNA agarose gel, 3 g of agar are dissolved in 150 ml of H₂O (f.c. 1.5% (w/v)) in a microwave oven and cooled to 60° C. The addition of 20 ml of 10× MEN (0.2 M MOPS, 50 mM sodium acetate, 10 mM EDTA) and 30 ml of formaldehyde (f.c. 2.2 M) causes further cooling so that the well-mixed solution must be poured speedily. Formaldehyde prevents the formation of secondary structures in the RNA, and therefore the rate of migration is approximately proportional to the molecular weight (LEHRBACH H et al. (1977) Biochem J 16: 4743-4751). The RNA samples are denatured, prior to application to the gel, in the following mixture: 20 μl of RNA (1-2 μg/μl), 5 μl of 10× MEN buffer, 6 μl of formaldehyde, 20 μl of formamide.

[0558]The mixture is mixed and incubated at 65° C. for 10 minutes. 1/10 volume of sample buffer and 1 μl of ethidium bromide (10 mg/ml) are added and the sample is then applied. Gel electrophoresis is carried out in horizontal gels in 1× MEN at 120 V for two to three hours. After electrophoresis, the gel is photographed under UV light with the aid of a ruler for subsequent determination of the fragment length. This is followed by blotting the RNA to a nylon membrane according to the information in: SAMBROOK J et al. Molecular cloning: A laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press, 1989.

Radioactive Labeling of DNA Fragments and Northern Hybridization

[0559]The codA cDNA fragment (codARNAi-sense SEQ ID No: 49) can be labeled using, for example, the High Prime kit sold by Roche Diagnostics. The High Prime kit is based on the "random primed" method for DNA labeling originally described by Feinberg and Vogelstein. Labeling is carried out by denaturing approx. 25 ng of DNA in 9-11 μl of H₂O at 95° C. for 10 min. After a short incubation on ice, 4 μl of High Prime solution (contains a random primer mixture, 4 units of Klenow polymerase and 0.125 mM dATP, dTTP and dGTP each in a reaction buffer containing 50% glycerol) and 3-5 μl of [α32P]dCTP (30-50 μCi) are added. The reaction mixture is incubated at 37° C. for at least 10 min and the unincorporated dCTP is then separated from the now radiolabeled DNA by means of gel filtration via a Sephadex G-50 column. The fragment is subsequently denatured at 95° C. for 10 min and kept on ice until used. The following hybridization and preincubation buffers are used: [0560]Hypo Hybond [0561]250 mM sodium phosphate buffer pH 7.2 [0562]1 mM EDTA [0563]7% SDS (g/v) [0564]250 mM NaCl [0565]10 μg/ml ssDNA [0566]5% polyethylene glycol (PEG) 6000 [0567]40% formamide

[0568]The hybridization temperature when using Hypo Hybond is 42° C. and the duration of hybridization is 16-24 h. The RNA filters are washed using three different solutions: 2×SSC (300 mM NaCl; 30 mM sodium citrate)+0.1% SDS, 1×SSC+0.1% SDS and 0.1×SSC+0.1% SDS. The duration and intensity of washing depend on the strength of the activity bond. After washing, the filters are sealed in plastic foil and an X-ray film (X-OMat, Kodak) is exposed overnight at -70° C. The signal strength on the X-ray films is a measure of the amount of codA mRNA molecules in the total RNA bound on the membranes. Thus it is possible to detect the reduction in codA mRNA in the positively selected plants compared to the starting plants used for transformation.

[0569]In the positively selected plants, the steady-state amount of the mRNA of the codA gene and the amount of CODA protein produced resulting therefrom is reduced so much that a quantitative conversion of 5-fluorocytosine to 5-fluorouracil can no longer occur. Consequently, these plants (in contrast to the untransformed plants) can grow in the presence of 5-fluorocytosine. Thus it is demonstrated that transgenic plants can be identified owing to the applied principle of preventing expression of a negative selection marker.

Example 11

Summary of the Results of "Negative-Negative" Selection

[0570]Transformation of the codA-transgenic Arabidopsis plants with the codA-dsRNA construct (pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT; SEQ ID NO: 57) results in a significantly increased number of double transgenic plants into whose genome the RNAi construct has been successfully integrated, in the case of both single selection (with 5-fluorocytosine alone) and dual selection (Pursuit® and 5-fluorocytosine) (in each case in comparison with untransformed plants). The analysis by means of PCR (see above) confirms the double transgenic state for the majority of the plants generated in this way. This successfully demonstrates the practicability of the present invention, i.e. the usability of repression of a negative marker for positive selection (more or less a "negative-negative" selection).

Sequence CWU 1

17911284DNAEscherichia coliCDS(1)..(1281)coding for cytosine deaminase (codA) 1gtg tcg aat aac gct tta caa aca att att aac gcc cgg tta cca ggc 48Val Ser Asn Asn Ala Leu Gln Thr Ile Ile Asn Ala Arg Leu Pro Gly1 5 10 15gaa gag ggg ctg tgg cag att cat ctg cag gac gga aaa atc agc gcc 96Glu Glu Gly Leu Trp Gln Ile His Leu Gln Asp Gly Lys Ile Ser Ala 20 25 30att gat gcg caa tcc ggc gtg atg ccc ata act gaa aac agc ctg gat 144Ile Asp Ala Gln Ser Gly Val Met Pro Ile Thr Glu Asn Ser Leu Asp 35 40 45gcc gaa caa ggt tta gtt ata ccg ccg ttt gtg gag cca cat att cac 192Ala Glu Gln Gly Leu Val Ile Pro Pro Phe Val Glu Pro His Ile His 50 55 60ctg gac acc acg caa acc gcc gga caa ccg aac tgg aat cag tcc ggc 240Leu Asp Thr Thr Gln Thr Ala Gly Gln Pro Asn Trp Asn Gln Ser Gly65 70 75 80acg ctg ttt gaa ggc att gaa cgc tgg gcc gag cgc aaa gcg tta tta 288Thr Leu Phe Glu Gly Ile Glu Arg Trp Ala Glu Arg Lys Ala Leu Leu 85 90 95acc cat gac gat gtg aaa caa cgc gca tgg caa acg ctg aaa tgg cag 336Thr His Asp Asp Val Lys Gln Arg Ala Trp Gln Thr Leu Lys Trp Gln 100 105 110att gcc aac ggc att cag cat gtg cgt acc cat gtc gat gtt tcg gat 384Ile Ala Asn Gly Ile Gln His Val Arg Thr His Val Asp Val Ser Asp 115 120 125gca acg cta act gcg ctg aaa gca atg ctg gaa gtg aag cag gaa gtc 432Ala Thr Leu Thr Ala Leu Lys Ala Met Leu Glu Val Lys Gln Glu Val 130 135 140gcg ccg tgg att gat ctg caa atc gtc gcc ttc cct cag gaa ggg att 480Ala Pro Trp Ile Asp Leu Gln Ile Val Ala Phe Pro Gln Glu Gly Ile145 150 155 160ttg tcg tat ccc aac ggt gaa gcg ttg ctg gaa gag gcg tta cgc tta 528Leu Ser Tyr Pro Asn Gly Glu Ala Leu Leu Glu Glu Ala Leu Arg Leu 165 170 175ggg gca gat gta gtg ggg gcg att ccg cat ttt gaa ttt acc cgt gaa 576Gly Ala Asp Val Val Gly Ala Ile Pro His Phe Glu Phe Thr Arg Glu 180 185 190tac ggc gtg gag tcg ctg cat aaa acc ttc gcc ctg gcg caa aaa tac 624Tyr Gly Val Glu Ser Leu His Lys Thr Phe Ala Leu Ala Gln Lys Tyr 195 200 205gac cgt ctc atc gac gtt cac tgt gat gag atc gat gac gag cag tcg 672Asp Arg Leu Ile Asp Val His Cys Asp Glu Ile Asp Asp Glu Gln Ser 210 215 220cgc ttt gtc gaa acc gtt gct gcc ctg gcg cac cat gaa ggc atg ggc 720Arg Phe Val Glu Thr Val Ala Ala Leu Ala His His Glu Gly Met Gly225 230 235 240gcg cga gtc acc gcc agc cac acc acg gca atg cac tcc tat aac ggg 768Ala Arg Val Thr Ala Ser His Thr Thr Ala Met His Ser Tyr Asn Gly 245 250 255gcg tat acc tca cgc ctg ttc cgc ttg ctg aaa atg tcc ggt att aac 816Ala Tyr Thr Ser Arg Leu Phe Arg Leu Leu Lys Met Ser Gly Ile Asn 260 265 270ttt gtc gcc aac ccg ctg gtc aat att cat ctg caa gga cgt ttc gat 864Phe Val Ala Asn Pro Leu Val Asn Ile His Leu Gln Gly Arg Phe Asp 275 280 285acg tat cca aaa cgt cgc ggc atc acg cgc gtt aaa gag atg ctg gag 912Thr Tyr Pro Lys Arg Arg Gly Ile Thr Arg Val Lys Glu Met Leu Glu 290 295 300tcc ggc att aac gtc tgc ttt ggt cac gat gat gtc ttc gat ccg tgg 960Ser Gly Ile Asn Val Cys Phe Gly His Asp Asp Val Phe Asp Pro Trp305 310 315 320tat ccg ctg gga acg gcg aat atg ctg caa gtg ctg cat atg ggg ctg 1008Tyr Pro Leu Gly Thr Ala Asn Met Leu Gln Val Leu His Met Gly Leu 325 330 335cat gtt tgc cag ttg atg ggc tac ggg cag att aac gat ggc ctg aat 1056His Val Cys Gln Leu Met Gly Tyr Gly Gln Ile Asn Asp Gly Leu Asn 340 345 350tta atc acc cac cac agc gca agg acg ttg aat ttg cag gat tac ggc 1104Leu Ile Thr His His Ser Ala Arg Thr Leu Asn Leu Gln Asp Tyr Gly 355 360 365att gcc gcc gga aac agc gcc aac ctg att atc ctg ccg gct gaa aat 1152Ile Ala Ala Gly Asn Ser Ala Asn Leu Ile Ile Leu Pro Ala Glu Asn 370 375 380ggg ttt gat gcg ctg cgc cgt cag gtt ccg gta cgt tat tcg gta cgt 1200Gly Phe Asp Ala Leu Arg Arg Gln Val Pro Val Arg Tyr Ser Val Arg385 390 395 400ggc ggc aag gtg att gcc agc aca caa ccg gca caa acc acc gta tat 1248Gly Gly Lys Val Ile Ala Ser Thr Gln Pro Ala Gln Thr Thr Val Tyr 405 410 415ctg gag cag cca gaa gcc atc gat tac aaa cgt tga 1284Leu Glu Gln Pro Glu Ala Ile Asp Tyr Lys Arg 420 4252427PRTEscherichia coli 2Val Ser Asn Asn Ala Leu Gln Thr Ile Ile Asn Ala Arg Leu Pro Gly1 5 10 15Glu Glu Gly Leu Trp Gln Ile His Leu Gln Asp Gly Lys Ile Ser Ala 20 25 30Ile Asp Ala Gln Ser Gly Val Met Pro Ile Thr Glu Asn Ser Leu Asp 35 40 45Ala Glu Gln Gly Leu Val Ile Pro Pro Phe Val Glu Pro His Ile His 50 55 60Leu Asp Thr Thr Gln Thr Ala Gly Gln Pro Asn Trp Asn Gln Ser Gly65 70 75 80Thr Leu Phe Glu Gly Ile Glu Arg Trp Ala Glu Arg Lys Ala Leu Leu 85 90 95Thr His Asp Asp Val Lys Gln Arg Ala Trp Gln Thr Leu Lys Trp Gln 100 105 110Ile Ala Asn Gly Ile Gln His Val Arg Thr His Val Asp Val Ser Asp 115 120 125Ala Thr Leu Thr Ala Leu Lys Ala Met Leu Glu Val Lys Gln Glu Val 130 135 140Ala Pro Trp Ile Asp Leu Gln Ile Val Ala Phe Pro Gln Glu Gly Ile145 150 155 160Leu Ser Tyr Pro Asn Gly Glu Ala Leu Leu Glu Glu Ala Leu Arg Leu 165 170 175Gly Ala Asp Val Val Gly Ala Ile Pro His Phe Glu Phe Thr Arg Glu 180 185 190Tyr Gly Val Glu Ser Leu His Lys Thr Phe Ala Leu Ala Gln Lys Tyr 195 200 205Asp Arg Leu Ile Asp Val His Cys Asp Glu Ile Asp Asp Glu Gln Ser 210 215 220Arg Phe Val Glu Thr Val Ala Ala Leu Ala His His Glu Gly Met Gly225 230 235 240Ala Arg Val Thr Ala Ser His Thr Thr Ala Met His Ser Tyr Asn Gly 245 250 255Ala Tyr Thr Ser Arg Leu Phe Arg Leu Leu Lys Met Ser Gly Ile Asn 260 265 270Phe Val Ala Asn Pro Leu Val Asn Ile His Leu Gln Gly Arg Phe Asp 275 280 285Thr Tyr Pro Lys Arg Arg Gly Ile Thr Arg Val Lys Glu Met Leu Glu 290 295 300Ser Gly Ile Asn Val Cys Phe Gly His Asp Asp Val Phe Asp Pro Trp305 310 315 320Tyr Pro Leu Gly Thr Ala Asn Met Leu Gln Val Leu His Met Gly Leu 325 330 335His Val Cys Gln Leu Met Gly Tyr Gly Gln Ile Asn Asp Gly Leu Asn 340 345 350Leu Ile Thr His His Ser Ala Arg Thr Leu Asn Leu Gln Asp Tyr Gly 355 360 365Ile Ala Ala Gly Asn Ser Ala Asn Leu Ile Ile Leu Pro Ala Glu Asn 370 375 380Gly Phe Asp Ala Leu Arg Arg Gln Val Pro Val Arg Tyr Ser Val Arg385 390 395 400Gly Gly Lys Val Ile Ala Ser Thr Gln Pro Ala Gln Thr Thr Val Tyr 405 410 415Leu Glu Gln Pro Glu Ala Ile Asp Tyr Lys Arg 420 42531284DNAArtificial sequenceDescription of the artificial sequence coding for cytosine deaminase (codA) 3atg tcg aat aac gct tta caa aca att att aac gcc cgg tta cca ggc 48Met Ser Asn Asn Ala Leu Gln Thr Ile Ile Asn Ala Arg Leu Pro Gly1 5 10 15gaa gag ggg ctg tgg cag att cat ctg cag gac gga aaa atc agc gcc 96Glu Glu Gly Leu Trp Gln Ile His Leu Gln Asp Gly Lys Ile Ser Ala 20 25 30att gat gcg caa tcc ggc gtg atg ccc ata act gaa aac agc ctg gat 144Ile Asp Ala Gln Ser Gly Val Met Pro Ile Thr Glu Asn Ser Leu Asp 35 40 45gcc gaa caa ggt tta gtt ata ccg ccg ttt gtg gag cca cat att cac 192Ala Glu Gln Gly Leu Val Ile Pro Pro Phe Val Glu Pro His Ile His 50 55 60ctg gac acc acg caa acc gcc gga caa ccg aac tgg aat cag tcc ggc 240Leu Asp Thr Thr Gln Thr Ala Gly Gln Pro Asn Trp Asn Gln Ser Gly65 70 75 80acg ctg ttt gaa ggc att gaa cgc tgg gcc gag cgc aaa gcg tta tta 288Thr Leu Phe Glu Gly Ile Glu Arg Trp Ala Glu Arg Lys Ala Leu Leu 85 90 95acc cat gac gat gtg aaa caa cgc gca tgg caa acg ctg aaa tgg cag 336Thr His Asp Asp Val Lys Gln Arg Ala Trp Gln Thr Leu Lys Trp Gln 100 105 110att gcc aac ggc att cag cat gtg cgt acc cat gtc gat gtt tcg gat 384Ile Ala Asn Gly Ile Gln His Val Arg Thr His Val Asp Val Ser Asp 115 120 125gca acg cta act gcg ctg aaa gca atg ctg gaa gtg aag cag gaa gtc 432Ala Thr Leu Thr Ala Leu Lys Ala Met Leu Glu Val Lys Gln Glu Val 130 135 140gcg ccg tgg att gat ctg caa atc gtc gcc ttc cct cag gaa ggg att 480Ala Pro Trp Ile Asp Leu Gln Ile Val Ala Phe Pro Gln Glu Gly Ile145 150 155 160ttg tcg tat ccc aac ggt gaa gcg ttg ctg gaa gag gcg tta cgc tta 528Leu Ser Tyr Pro Asn Gly Glu Ala Leu Leu Glu Glu Ala Leu Arg Leu 165 170 175ggg gca gat gta gtg ggg gcg att ccg cat ttt gaa ttt acc cgt gaa 576Gly Ala Asp Val Val Gly Ala Ile Pro His Phe Glu Phe Thr Arg Glu 180 185 190tac ggc gtg gag tcg ctg cat aaa acc ttc gcc ctg gcg caa aaa tac 624Tyr Gly Val Glu Ser Leu His Lys Thr Phe Ala Leu Ala Gln Lys Tyr 195 200 205gac cgt ctc atc gac gtt cac tgt gat gag atc gat gac gag cag tcg 672Asp Arg Leu Ile Asp Val His Cys Asp Glu Ile Asp Asp Glu Gln Ser 210 215 220cgc ttt gtc gaa acc gtt gct gcc ctg gcg cac cat gaa ggc atg ggc 720Arg Phe Val Glu Thr Val Ala Ala Leu Ala His His Glu Gly Met Gly225 230 235 240gcg cga gtc acc gcc agc cac acc acg gca atg cac tcc tat aac ggg 768Ala Arg Val Thr Ala Ser His Thr Thr Ala Met His Ser Tyr Asn Gly 245 250 255gcg tat acc tca cgc ctg ttc cgc ttg ctg aaa atg tcc ggt att aac 816Ala Tyr Thr Ser Arg Leu Phe Arg Leu Leu Lys Met Ser Gly Ile Asn 260 265 270ttt gtc gcc aac ccg ctg gtc aat att cat ctg caa gga cgt ttc gat 864Phe Val Ala Asn Pro Leu Val Asn Ile His Leu Gln Gly Arg Phe Asp 275 280 285acg tat cca aaa cgt cgc ggc atc acg cgc gtt aaa gag atg ctg gag 912Thr Tyr Pro Lys Arg Arg Gly Ile Thr Arg Val Lys Glu Met Leu Glu 290 295 300tcc ggc att aac gtc tgc ttt ggt cac gat gat gtc ttc gat ccg tgg 960Ser Gly Ile Asn Val Cys Phe Gly His Asp Asp Val Phe Asp Pro Trp305 310 315 320tat ccg ctg gga acg gcg aat atg ctg caa gtg ctg cat atg ggg ctg 1008Tyr Pro Leu Gly Thr Ala Asn Met Leu Gln Val Leu His Met Gly Leu 325 330 335cat gtt tgc cag ttg atg ggc tac ggg cag att aac gat ggc ctg aat 1056His Val Cys Gln Leu Met Gly Tyr Gly Gln Ile Asn Asp Gly Leu Asn 340 345 350tta atc acc cac cac agc gca agg acg ttg aat ttg cag gat tac ggc 1104Leu Ile Thr His His Ser Ala Arg Thr Leu Asn Leu Gln Asp Tyr Gly 355 360 365att gcc gcc gga aac agc gcc aac ctg att atc ctg ccg gct gaa aat 1152Ile Ala Ala Gly Asn Ser Ala Asn Leu Ile Ile Leu Pro Ala Glu Asn 370 375 380ggg ttt gat gcg ctg cgc cgt cag gtt ccg gta cgt tat tcg gta cgt 1200Gly Phe Asp Ala Leu Arg Arg Gln Val Pro Val Arg Tyr Ser Val Arg385 390 395 400ggc ggc aag gtg att gcc agc aca caa ccg gca caa acc acc gta tat 1248Gly Gly Lys Val Ile Ala Ser Thr Gln Pro Ala Gln Thr Thr Val Tyr 405 410 415ctg gag cag cca gaa gcc atc gat tac aaa cgt tga 1284Leu Glu Gln Pro Glu Ala Ile Asp Tyr Lys Arg 420 4254427PRTArtificial sequenceDescription of the artificial sequence coding for cytosine deaminase (codA) 4Met Ser Asn Asn Ala Leu Gln Thr Ile Ile Asn Ala Arg Leu Pro Gly1 5 10 15Glu Glu Gly Leu Trp Gln Ile His Leu Gln Asp Gly Lys Ile Ser Ala 20 25 30Ile Asp Ala Gln Ser Gly Val Met Pro Ile Thr Glu Asn Ser Leu Asp 35 40 45Ala Glu Gln Gly Leu Val Ile Pro Pro Phe Val Glu Pro His Ile His 50 55 60Leu Asp Thr Thr Gln Thr Ala Gly Gln Pro Asn Trp Asn Gln Ser Gly65 70 75 80Thr Leu Phe Glu Gly Ile Glu Arg Trp Ala Glu Arg Lys Ala Leu Leu 85 90 95Thr His Asp Asp Val Lys Gln Arg Ala Trp Gln Thr Leu Lys Trp Gln 100 105 110Ile Ala Asn Gly Ile Gln His Val Arg Thr His Val Asp Val Ser Asp 115 120 125Ala Thr Leu Thr Ala Leu Lys Ala Met Leu Glu Val Lys Gln Glu Val 130 135 140Ala Pro Trp Ile Asp Leu Gln Ile Val Ala Phe Pro Gln Glu Gly Ile145 150 155 160Leu Ser Tyr Pro Asn Gly Glu Ala Leu Leu Glu Glu Ala Leu Arg Leu 165 170 175Gly Ala Asp Val Val Gly Ala Ile Pro His Phe Glu Phe Thr Arg Glu 180 185 190Tyr Gly Val Glu Ser Leu His Lys Thr Phe Ala Leu Ala Gln Lys Tyr 195 200 205Asp Arg Leu Ile Asp Val His Cys Asp Glu Ile Asp Asp Glu Gln Ser 210 215 220Arg Phe Val Glu Thr Val Ala Ala Leu Ala His His Glu Gly Met Gly225 230 235 240Ala Arg Val Thr Ala Ser His Thr Thr Ala Met His Ser Tyr Asn Gly 245 250 255Ala Tyr Thr Ser Arg Leu Phe Arg Leu Leu Lys Met Ser Gly Ile Asn 260 265 270Phe Val Ala Asn Pro Leu Val Asn Ile His Leu Gln Gly Arg Phe Asp 275 280 285Thr Tyr Pro Lys Arg Arg Gly Ile Thr Arg Val Lys Glu Met Leu Glu 290 295 300Ser Gly Ile Asn Val Cys Phe Gly His Asp Asp Val Phe Asp Pro Trp305 310 315 320Tyr Pro Leu Gly Thr Ala Asn Met Leu Gln Val Leu His Met Gly Leu 325 330 335His Val Cys Gln Leu Met Gly Tyr Gly Gln Ile Asn Asp Gly Leu Asn 340 345 350Leu Ile Thr His His Ser Ala Arg Thr Leu Asn Leu Gln Asp Tyr Gly 355 360 365Ile Ala Ala Gly Asn Ser Ala Asn Leu Ile Ile Leu Pro Ala Glu Asn 370 375 380Gly Phe Asp Ala Leu Arg Arg Gln Val Pro Val Arg Tyr Ser Val Arg385 390 395 400Gly Gly Lys Val Ile Ala Ser Thr Gln Pro Ala Gln Thr Thr Val Tyr 405 410 415Leu Glu Gln Pro Glu Ala Ile Asp Tyr Lys Arg 420 42551221DNAStreptomyces griseolusCDS(1)..(1218)coding for cytochrome P450-Su1 (suaC) 5atg acc gat acc gcc acg acg ccc cag acc acg gac gca ccc gcc ttc 48Met Thr Asp Thr Ala Thr Thr Pro Gln Thr Thr Asp Ala Pro Ala Phe1 5 10 15ccg agc aac cgg agc tgt ccc tac cag tta ccg gac ggc tac gcc cag 96Pro Ser Asn Arg Ser Cys Pro Tyr Gln Leu Pro Asp Gly Tyr Ala Gln 20 25 30ctc cgg gac acc ccc ggc ccc ctg cac cgg gtg acg ctc tac gac ggc 144Leu Arg Asp Thr Pro Gly Pro Leu His Arg Val Thr Leu Tyr Asp Gly 35 40 45cgt cag gcg tgg gtg gtg acc aag cac gag gcc gcg cgc aaa ctg ctc 192Arg Gln Ala Trp Val Val Thr Lys His Glu Ala Ala Arg Lys Leu Leu 50 55 60ggc gac ccc cgg ctg tcc tcc aac cgg acg gac gac aac ttc ccc gcc 240Gly Asp Pro Arg Leu Ser Ser Asn Arg Thr Asp Asp Asn Phe Pro Ala65 70 75 80acg tca ccg cgc ttc gag gcc gtc cgg gag agc ccg cag gcg ttc atc 288Thr Ser Pro Arg Phe Glu Ala Val Arg Glu Ser Pro Gln Ala Phe Ile 85 90 95ggc ctg gac ccg ccc gag cac ggc acc cgg cgg cgg atg acg atc agc 336Gly Leu Asp Pro Pro Glu His Gly Thr Arg Arg Arg Met Thr Ile Ser 100 105 110gag ttc acc gtc aag cgg atc aag ggc

atg cgc ccc gag gtc gag gag 384Glu Phe Thr Val Lys Arg Ile Lys Gly Met Arg Pro Glu Val Glu Glu 115 120 125gtg gtg cac ggc ttc ctc gac gag atg ctg gcc gcc ggc ccg acc gcc 432Val Val His Gly Phe Leu Asp Glu Met Leu Ala Ala Gly Pro Thr Ala 130 135 140gac ctg gtc agt cag ttc gcg ctg ccg gtg ccc tcc atg gtg atc tgc 480Asp Leu Val Ser Gln Phe Ala Leu Pro Val Pro Ser Met Val Ile Cys145 150 155 160cga ctc ctc ggc gtg ccc tac gcc gac cac gag ttc ttc cag gac gcg 528Arg Leu Leu Gly Val Pro Tyr Ala Asp His Glu Phe Phe Gln Asp Ala 165 170 175agc aag cgg ctg gtg cag tcc acg gac gcg cag agc gcg ctc acc gcg 576Ser Lys Arg Leu Val Gln Ser Thr Asp Ala Gln Ser Ala Leu Thr Ala 180 185 190cgg aac gac ctc gcg ggt tac ctg gac ggc ctc atc acc cag ttc cag 624Arg Asn Asp Leu Ala Gly Tyr Leu Asp Gly Leu Ile Thr Gln Phe Gln 195 200 205acc gaa ccg ggc gcg ggc ctg gtg ggc gct ctg gtc gcc gac cag ctg 672Thr Glu Pro Gly Ala Gly Leu Val Gly Ala Leu Val Ala Asp Gln Leu 210 215 220gcc aac ggc gag atc gac cgt gag gaa ctg atc tcc acc gcg atg ctg 720Ala Asn Gly Glu Ile Asp Arg Glu Glu Leu Ile Ser Thr Ala Met Leu225 230 235 240ctc ctc atc gcc ggc cac gag acc acg gcc tcg atg acc tcc ctc agc 768Leu Leu Ile Ala Gly His Glu Thr Thr Ala Ser Met Thr Ser Leu Ser 245 250 255gtg atc acc ctg ctg gac cac ccc gag cag tac gcc gcc ctg cgc gcc 816Val Ile Thr Leu Leu Asp His Pro Glu Gln Tyr Ala Ala Leu Arg Ala 260 265 270gac cgc agc ctc gtg ccc ggc gcg gtg gag gaa ctg ctc cgc tac ctc 864Asp Arg Ser Leu Val Pro Gly Ala Val Glu Glu Leu Leu Arg Tyr Leu 275 280 285gcc atc gcc gac atc gcg ggc ggc cgc gtc gcc acg gcg gac atc gag 912Ala Ile Ala Asp Ile Ala Gly Gly Arg Val Ala Thr Ala Asp Ile Glu 290 295 300gtc gag ggg cac ctc atc cgg gcc ggc gag ggc gtg atc gtc gtc aac 960Val Glu Gly His Leu Ile Arg Ala Gly Glu Gly Val Ile Val Val Asn305 310 315 320tcg ata gcc aac cgg gac ggc acg gtg tac gag gac ccg gac gcc ctc 1008Ser Ile Ala Asn Arg Asp Gly Thr Val Tyr Glu Asp Pro Asp Ala Leu 325 330 335gac atc cac cgc tcc gcg cgc cac cac ctc gcc ttc ggc ttc ggc gtg 1056Asp Ile His Arg Ser Ala Arg His His Leu Ala Phe Gly Phe Gly Val 340 345 350cac cag tgc ctg ggc cag aac ctc gcc cgg ctg gag ctg gag gtc atc 1104His Gln Cys Leu Gly Gln Asn Leu Ala Arg Leu Glu Leu Glu Val Ile 355 360 365ctc aac gcc ctc atg gac cgc gtc ccg acg ctg cga ctg gcc gtc ccc 1152Leu Asn Ala Leu Met Asp Arg Val Pro Thr Leu Arg Leu Ala Val Pro 370 375 380gtc gag cag ttg gtg ctg cgg ccg ggt acg acg atc cag ggc gtc aac 1200Val Glu Gln Leu Val Leu Arg Pro Gly Thr Thr Ile Gln Gly Val Asn385 390 395 400gaa ctc ccg gtc acc tgg tga 1221Glu Leu Pro Val Thr Trp 4056406PRTStreptomyces griseolus 6Met Thr Asp Thr Ala Thr Thr Pro Gln Thr Thr Asp Ala Pro Ala Phe1 5 10 15Pro Ser Asn Arg Ser Cys Pro Tyr Gln Leu Pro Asp Gly Tyr Ala Gln 20 25 30Leu Arg Asp Thr Pro Gly Pro Leu His Arg Val Thr Leu Tyr Asp Gly 35 40 45Arg Gln Ala Trp Val Val Thr Lys His Glu Ala Ala Arg Lys Leu Leu 50 55 60Gly Asp Pro Arg Leu Ser Ser Asn Arg Thr Asp Asp Asn Phe Pro Ala65 70 75 80Thr Ser Pro Arg Phe Glu Ala Val Arg Glu Ser Pro Gln Ala Phe Ile 85 90 95Gly Leu Asp Pro Pro Glu His Gly Thr Arg Arg Arg Met Thr Ile Ser 100 105 110Glu Phe Thr Val Lys Arg Ile Lys Gly Met Arg Pro Glu Val Glu Glu 115 120 125Val Val His Gly Phe Leu Asp Glu Met Leu Ala Ala Gly Pro Thr Ala 130 135 140Asp Leu Val Ser Gln Phe Ala Leu Pro Val Pro Ser Met Val Ile Cys145 150 155 160Arg Leu Leu Gly Val Pro Tyr Ala Asp His Glu Phe Phe Gln Asp Ala 165 170 175Ser Lys Arg Leu Val Gln Ser Thr Asp Ala Gln Ser Ala Leu Thr Ala 180 185 190Arg Asn Asp Leu Ala Gly Tyr Leu Asp Gly Leu Ile Thr Gln Phe Gln 195 200 205Thr Glu Pro Gly Ala Gly Leu Val Gly Ala Leu Val Ala Asp Gln Leu 210 215 220Ala Asn Gly Glu Ile Asp Arg Glu Glu Leu Ile Ser Thr Ala Met Leu225 230 235 240Leu Leu Ile Ala Gly His Glu Thr Thr Ala Ser Met Thr Ser Leu Ser 245 250 255Val Ile Thr Leu Leu Asp His Pro Glu Gln Tyr Ala Ala Leu Arg Ala 260 265 270Asp Arg Ser Leu Val Pro Gly Ala Val Glu Glu Leu Leu Arg Tyr Leu 275 280 285Ala Ile Ala Asp Ile Ala Gly Gly Arg Val Ala Thr Ala Asp Ile Glu 290 295 300Val Glu Gly His Leu Ile Arg Ala Gly Glu Gly Val Ile Val Val Asn305 310 315 320Ser Ile Ala Asn Arg Asp Gly Thr Val Tyr Glu Asp Pro Asp Ala Leu 325 330 335Asp Ile His Arg Ser Ala Arg His His Leu Ala Phe Gly Phe Gly Val 340 345 350His Gln Cys Leu Gly Gln Asn Leu Ala Arg Leu Glu Leu Glu Val Ile 355 360 365Leu Asn Ala Leu Met Asp Arg Val Pro Thr Leu Arg Leu Ala Val Pro 370 375 380Val Glu Gln Leu Val Leu Arg Pro Gly Thr Thr Ile Gln Gly Val Asn385 390 395 400Glu Leu Pro Val Thr Trp 40571404DNAAgrobacterium tumefaciensCDS(1)..(1401)coding for indoleacetamide hydrolase (tms2) 7atg gtg ccc att acc tcg tta gca caa acc cta gaa cgc ctg aga cgg 48Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15aaa gac tac tcc tgc tta gaa cta gta gaa act ctg ata gcg cgt tgc 96Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30caa gct gca aaa cca tta aat gcc ctt ctg gct aca gac tgg gat ggc 144Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45ttg cgg cga agc gcc aaa aaa att gat cgt cat gga aac gcc gga tta 192Leu Arg Arg Ser Ala Lys Lys Ile Asp Arg His Gly Asn Ala Gly Leu 50 55 60ggt ctt tgc ggc att cca ctc tgt ttt aag gcg aac atc gcg acc ggc 240Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80ata ttt cct aca agc gct gct act ccg gcg ctg ata aac cac ttg cca 288Ile Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90 95aag ata cca tcc cgc gtc gca gaa aga ctt ttt tca gct gga gca ctg 336Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110ccg ggt gcc tcg gga aac atg cat gag tta tcg ttt gga att acg agc 384Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125aac aac tat gcc acc ggt gcg gtg cgg aac ccg tgg aat cca agt ctg 432Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140ata cca gga ggc tca agc ggt ggt gtg gct gct gcg gtg gca agc cga 480Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160ttg atg tta ggc ggc ata ggc acc gat acc ggt gca tct gtt cgc cta 528Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175ccc gca gcc ctg tgt ggc gta gta gga ttt cga ccg acg ctt gct cga 576Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Ala Arg 180 185 190tat cca aga gat cgg ata ata ccg gtc agc ccc acc cgg gac acc gcc 624Tyr Pro Arg Asp Arg Ile Ile Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205gga atc ata gcg cag tgc gta gcc gat gtt ata atc ctc gac cag gtg 672Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220att tcc gga cgg tcg gcg aaa att tca ccc atg ccg ctg aag ggg ctt 720Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240cgg atc ggc ctc ccc act acc tac ttt tac gat gac ctt gat gct gat 768Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255gtg gcc ttc gca gct gaa acg acg att cgc ttg cta gcc aac aga ggc 816Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270gta acc ttt gtt gaa gcc gac atc ccc cac cta gag gaa ctg aat agt 864Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285ggg gca agt ttg cca att gcg ctt tac gaa ttt cca cac gct cta aaa 912Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300aag tat ctc gac gat ttt gtg gga aca gtt tct ttt tct gac gtt atc 960Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320aaa gga att cgt agc ccc gat gta gcg aac att gtc agt gcg caa att 1008Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335gat ggg cat caa att tcc aac gat gaa tat gaa ctg gcg cgt caa tcc 1056Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350ttc agg cca agg ctc cag gcc act tat cgg aat tac ttc aga ctc tat 1104Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365cag tta gat gca atc ctt ttc cca act gca ccc tta gcg gcc aaa gcc 1152Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380ata ggt cag gag tcg tca gtc atc cac aat ggc tca atg atg aac act 1200Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Met Asn Thr385 390 395 400ttc aag atc tac gtg cga aat gtg gac cca agc agc aac gca ggc cta 1248Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415cct ggg ttg agc ctt cct gcc tgc ctt aca cct gat cgc ttg cct gtt 1296Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430gga atg gaa att gat gga tta gcg ggg tca gac cac cgt ctg tta gca 1344Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445atc ggg gca gca tta gaa aaa gcc ata aat ttt cct tcc ttt ccc gat 1392Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Pro Ser Phe Pro Asp 450 455 460gct ttt aat tag 1404Ala Phe Asn4658467PRTAgrobacterium tumefaciens 8Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45Leu Arg Arg Ser Ala Lys Lys Ile Asp Arg His Gly Asn Ala Gly Leu 50 55 60Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80Ile Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90 95Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Ala Arg 180 185 190Tyr Pro Arg Asp Arg Ile Ile Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Met Asn Thr385 390 395 400Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Pro Ser Phe Pro Asp 450 455 460Ala Phe Asn46591404DNAAgrobacterium tumefaciensCDS(1)..(1401)coding for indoleacetamide hydrolase (tms2) 9atg gtg ccc att acc tcg tta gca caa acc cta gaa cgc ctg aga cgg 48Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15aaa gac tac tcc tgc tta gaa cta gta gaa act ctg ata gcg cgt tgc 96Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30caa gct gca aaa cca tta aat gcc ctt ctg gct aca gac tgg gat ggc 144Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45ttg cgg cga agc gcc aaa aaa att gat cgt cat gga aac gcc gga tta 192Leu Arg Arg Ser Ala Lys Lys Ile Asp Arg His Gly Asn Ala Gly Leu 50 55 60ggt ctt tgc ggc att cca ctc tgt ttt aag gcg aac atc gcg acc ggc 240Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80ata ttt cct aca agc gct gct act ccg gcg ctg ata aac cac ttg cca 288Ile Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90 95aag ata cca tcc cgc gtc gca gaa aga ctt ttt tca gct gga gca ctg 336Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110ccg ggt gcc tcg gga aac atg cat gag tta tcg ttt gga att acg agc 384Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125aac aac tat gcc acc ggt gcg gtg cgg aac ccg tgg aat cca agt ctg 432Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140ata cca gga ggc tca agc ggt ggt gtg gct gct gcg gtg gca agc cga 480Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160ttg atg tta ggc ggc ata ggc acc gat acc ggt gca tct gtt cgc cta 528Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175ccc gca gcc ctg tgt ggc gta gta gga ttt cga ccg acg ctt gct cga 576Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Ala Arg 180 185 190tat cca aga gat cgg ata ata ccg gtc agc ccc acc cgg gac acc gcc 624Tyr Pro Arg Asp Arg Ile Ile Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205gga atc ata gcg cag tgc gta gcc gat gtt ata atc ctc gat

cag gtg 672Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220att tcc gga cgg tcg gcg aaa att tca ccc atg ccg ctg aag ggg ctt 720Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240cgg atc ggc ctc ccc act acc tac ttt tac gat gac ctt gat gct gat 768Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255gtg gcc ttc gca gct gaa acg acg att cgc ttg cta gcc aac aga ggc 816Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270gta acc ttt gtt gaa gcc gac atc ccc cac cta gag gaa ctg aat agt 864Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285ggg gca agt ttg cca att gcg ctt tac gaa ttt cca cac gct cta aaa 912Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300aag tat ctc gac gat ttt gtg gga aca gtt tct ttt tct gac gtt atc 960Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320aaa gga att cgt agc ccc gat gta gcg aac att gtc agt gcg caa att 1008Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335gat ggg cat caa att tcc aac gat gaa tat gaa ctg gcg cgt caa tcc 1056Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350ttc agg cca agg ctc cag gcc act tat cgg aat tac ttc aga ctc tat 1104Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365cag tta gat gca atc ctt ttc cca act gca ccc tta gcg gcc aaa gcc 1152Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380ata ggt cag gag tcg tca gtc atc cac aat ggc tca atg ata aac act 1200Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Ile Asn Thr385 390 395 400ttc aag atc tac gtg cga aat gtg gac cca agc agc aac gca ggc cta 1248Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415cct ggg ttg agc ctt cct gcc tgc ctt aca cct gat cgc ttg cct gtt 1296Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430gga atg gaa att gac gga tta gcg ggg tca gac cac cgt ctg tta gca 1344Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445atc ggg gca gca tta gaa aaa gcc ata aat ttt cct tcc ttt ccc gat 1392Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Pro Ser Phe Pro Asp 450 455 460gct ttt aat tag 1404Ala Phe Asn46510467PRTAgrobacterium tumefaciens 10Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45Leu Arg Arg Ser Ala Lys Lys Ile Asp Arg His Gly Asn Ala Gly Leu 50 55 60Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80Ile Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90 95Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Ala Arg 180 185 190Tyr Pro Arg Asp Arg Ile Ile Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Ile Asn Thr385 390 395 400Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Pro Ser Phe Pro Asp 450 455 460Ala Phe Asn46511609DNAXanthobacter autotrophicusCDS(1)..(603)coding for haloalkane dehalogenase 11atg tca acg ttt ttt gaa ccg gag aac gga atg aaa caa aac gcc aaa 48Met Ser Thr Phe Phe Glu Pro Glu Asn Gly Met Lys Gln Asn Ala Lys1 5 10 15acc gaa cga atc ctg gat gtc gcg ctc gaa ttg ctt gag aca gag ggt 96Thr Glu Arg Ile Leu Asp Val Ala Leu Glu Leu Leu Glu Thr Glu Gly 20 25 30gag ttt ggt ttg acg atg agg cag gtg gca acg caa gcg gac atg tcc 144Glu Phe Gly Leu Thr Met Arg Gln Val Ala Thr Gln Ala Asp Met Ser 35 40 45ctg agc aac gtt cag tac tat ttc aag tcc gag gac ctg ctc ctc gtg 192Leu Ser Asn Val Gln Tyr Tyr Phe Lys Ser Glu Asp Leu Leu Leu Val 50 55 60gcc atg gca gac cgt tac ttt caa cgg tgc ctg aca acc atg gct gag 240Ala Met Ala Asp Arg Tyr Phe Gln Arg Cys Leu Thr Thr Met Ala Glu65 70 75 80cat ccg ccc tta tcg gca ggg cgt gat caa cac gcc cag tta aga gcg 288His Pro Pro Leu Ser Ala Gly Arg Asp Gln His Ala Gln Leu Arg Ala 85 90 95ttg tta cga gaa ctg ctc ggt cat ggt ctt gag att tcc gag atg tgt 336Leu Leu Arg Glu Leu Leu Gly His Gly Leu Glu Ile Ser Glu Met Cys 100 105 110cga ata ttc agg gag tac tgg gca atc gcc acc cgt aat gaa act gtt 384Arg Ile Phe Arg Glu Tyr Trp Ala Ile Ala Thr Arg Asn Glu Thr Val 115 120 125cac ggc tat ctc aag tcg tac tat cgg gat ctc gcc gaa gtg atg gct 432His Gly Tyr Leu Lys Ser Tyr Tyr Arg Asp Leu Ala Glu Val Met Ala 130 135 140gag aag ctt gcg cca ctg gcc agc agc gaa aag gcg ctg gcc gtg gcc 480Glu Lys Leu Ala Pro Leu Ala Ser Ser Glu Lys Ala Leu Ala Val Ala145 150 155 160gta tct ttg gtt att cct tat gtt gag ggg tat tcg gta acg gcc att 528Val Ser Leu Val Ile Pro Tyr Val Glu Gly Tyr Ser Val Thr Ala Ile 165 170 175gca atg ccc gaa tcc att gat acg att tcc gag acg ctg acc aat gtg 576Ala Met Pro Glu Ser Ile Asp Thr Ile Ser Glu Thr Leu Thr Asn Val 180 185 190gtg ttg gag cag ctt cgc atc agc aat tcatga 609Val Leu Glu Gln Leu Arg Ile Ser Asn 195 20012201PRTXanthobacter autotrophicus 12Met Ser Thr Phe Phe Glu Pro Glu Asn Gly Met Lys Gln Asn Ala Lys1 5 10 15Thr Glu Arg Ile Leu Asp Val Ala Leu Glu Leu Leu Glu Thr Glu Gly 20 25 30Glu Phe Gly Leu Thr Met Arg Gln Val Ala Thr Gln Ala Asp Met Ser 35 40 45Leu Ser Asn Val Gln Tyr Tyr Phe Lys Ser Glu Asp Leu Leu Leu Val 50 55 60Ala Met Ala Asp Arg Tyr Phe Gln Arg Cys Leu Thr Thr Met Ala Glu65 70 75 80His Pro Pro Leu Ser Ala Gly Arg Asp Gln His Ala Gln Leu Arg Ala85 90 95Leu Leu Arg Glu Leu Leu Gly His Gly Leu Glu Ile Ser Glu Met Cys100 105 110Arg Ile Phe Arg Glu Tyr Trp Ala Ile Ala Thr Arg Asn Glu Thr Val115 120 125His Gly Tyr Leu Lys Ser Tyr Tyr Arg Asp Leu Ala Glu Val Met Ala130 135 140Glu Lys Leu Ala Pro Leu Ala Ser Ser Glu Lys Ala Leu Ala Val Ala145 150 155 160Val Ser Leu Val Ile Pro Tyr Val Glu Gly Tyr Ser Val Thr Ala Ile165 170 175Ala Met Pro Glu Ser Ile Asp Thr Ile Ser Glu Thr Leu Thr Asn Val180 185 190Val Leu Glu Gln Leu Arg Ile Ser Asn195 200131131DNAHerpes simplex virus 1CDS(1)..(1128)coding for thymidine kinase (TK) 13atg gct tcg tac ccc tgc cat caa cac gcg tct gcg ttc gac cag gct 48Met Ala Ser Tyr Pro Cys His Gln His Ala Ser Ala Phe Asp Gln Ala1 5 10 15gcg cgt tct cgc ggc cat agc aac cga cgt acg gcg ttg cgc cct cgc 96Ala Arg Ser Arg Gly His Ser Asn Arg Arg Thr Ala Leu Arg Pro Arg 20 25 30cgg cag caa gaa gcc acg gaa gtc cgc ctg gag cag aaa atg ccc acg 144Arg Gln Gln Glu Ala Thr Glu Val Arg Leu Glu Gln Lys Met Pro Thr 35 40 45cta ctg cgg gtt tat ata gac ggt cct cac ggg atg ggg aaa acc acc 192Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr 50 55 60acc acg caa ctg ctg gtg gcc ctg ggt tcg cgc gac gat atc gtc tac 240Thr Thr Gln Leu Leu Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr65 70 75 80gta ccc gag ccg atg act tac tgg cag gtg ctg ggg gct tcc gag aca 288Val Pro Glu Pro Met Thr Tyr Trp Gln Val Leu Gly Ala Ser Glu Thr 85 90 95atc gcg aac atc tac acc aca caa cac cgc ctc gac cag ggt gag ata 336Ile Ala Asn Ile Tyr Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile 100 105 110tcg gcc ggg gac gcg gcg gtg gta atg aca agc gcc cag ata aca atg 384Ser Ala Gly Asp Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met 115 120 125ggc atg cct tat gcc gtg acc gac gcc gtt ctg gct cct cat gtc ggg 432Gly Met Pro Tyr Ala Val Thr Asp Ala Val Leu Ala Pro His Val Gly 130 135 140ggg gag gct ggg agt tca cat gcc ccg ccc ccg gcc ctc acc ctc atc 480Gly Glu Ala Gly Ser Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile145 150 155 160ttc gac cgc cat ccc atc gcc gcc ctc ctg tgc tac ccg gcc gcg cga 528Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg 165 170 175tac ctt atg ggc agc atg acc ccc cag gcc gtg ctg gcg ttc gtg gcc 576Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala 180 185 190ctc atc ccg ccg acc ttg ccc ggc aca aac atc gtg ttg ggg gcc ctt 624Leu Ile Pro Pro Thr Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu 195 200 205ccg gag gac aga cac atc gac cgc ctg gcc aaa cgc cag cgc ccc ggc 672Pro Glu Asp Arg His Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly 210 215 220gag cgg ctt gac ctg gct atg ctg gcc gcg att cgc cgc gtt tac ggg 720Glu Arg Leu Asp Leu Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly225 230 235 240ctg ctt gcc aat acg gtg cgg tat ctg cag ggc ggc ggg tcg tgg tgg 768Leu Leu Ala Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Trp 245 250 255gag gat tgg gga cag ctt tcg ggg acg gcc gtg ccg ccc cag ggt gcc 816Glu Asp Trp Gly Gln Leu Ser Gly Thr Ala Val Pro Pro Gln Gly Ala 260 265 270gag ccc cag agc aac gcg ggc cca cga ccc cat atc ggg gac acg tta 864Glu Pro Gln Ser Asn Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu 275 280 285ttt acc ctg ttt cgg gcc ccc gag ttg ctg gcc ccc aac ggc gac ctg 912Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu 290 295 300tat aac gtg ttt gcc tgg gcc ttg gac gtc ttg gcc aaa cgc ctc cgt 960Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg305 310 315 320ccc atg cac gtc ttt atc ctg gat tac gac caa tcg ccc gcc ggc tgc 1008Pro Met His Val Phe Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys 325 330 335cgg gac gcc ctg ctg caa ctt acc tcc ggg atg gtc cag acc cac gtc 1056Arg Asp Ala Leu Leu Gln Leu Thr Ser Gly Met Val Gln Thr His Val 340 345 350acc acc cca ggc tcc ata ccg acg atc tgc gac ctg gcg cgc acg ttt 1104Thr Thr Pro Gly Ser Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe 355 360 365gcc cgg gag atg ggg gag gct aac tga 1131Ala Arg Glu Met Gly Glu Ala Asn 370 37514376PRTHerpes simplex virus 1 14Met Ala Ser Tyr Pro Cys His Gln His Ala Ser Ala Phe Asp Gln Ala1 5 10 15Ala Arg Ser Arg Gly His Ser Asn Arg Arg Thr Ala Leu Arg Pro Arg 20 25 30Arg Gln Gln Glu Ala Thr Glu Val Arg Leu Glu Gln Lys Met Pro Thr 35 40 45Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr 50 55 60Thr Thr Gln Leu Leu Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr65 70 75 80Val Pro Glu Pro Met Thr Tyr Trp Gln Val Leu Gly Ala Ser Glu Thr 85 90 95Ile Ala Asn Ile Tyr Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile 100 105 110Ser Ala Gly Asp Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met 115 120 125Gly Met Pro Tyr Ala Val Thr Asp Ala Val Leu Ala Pro His Val Gly 130 135 140Gly Glu Ala Gly Ser Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile145 150 155 160Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg 165 170 175Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala 180 185 190Leu Ile Pro Pro Thr Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu 195 200 205Pro Glu Asp Arg His Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly 210 215 220Glu Arg Leu Asp Leu Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly225 230 235 240Leu Leu Ala Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Trp 245 250 255Glu Asp Trp Gly Gln Leu Ser Gly Thr Ala Val Pro Pro Gln Gly Ala 260 265 270Glu Pro Gln Ser Asn Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu 275 280 285Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu 290 295 300Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg305 310 315 320Pro Met His Val Phe Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys 325 330 335Arg Asp Ala Leu Leu Gln Leu Thr Ser Gly Met Val Gln Thr His Val 340 345 350Thr Thr Pro Gly Ser Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe 355 360 365Ala Arg Glu Met Gly Glu Ala Asn 370 375151131DNAHerpes simplex virus 1CDS(1)..(1128)coding for thymidine kinase (TK) 15atg gct tcg tac ccc tgc cat caa cac gcg tct gcg ttc gac cag gct 48Met Ala Ser Tyr Pro Cys His Gln His Ala Ser Ala Phe Asp Gln Ala1 5 10 15gcg cgt tct cgc ggc cat agc aac cga cgt acg gcg ttg cgc cct cgc 96Ala Arg Ser Arg Gly His Ser Asn Arg Arg Thr Ala

Leu Arg Pro Arg 20 25 30cgg cag caa gaa gcc acg gaa gtc cgc ctg gag cag aaa atg ccc acg 144Arg Gln Gln Glu Ala Thr Glu Val Arg Leu Glu Gln Lys Met Pro Thr 35 40 45cta ctg cgg gtt tat ata gac ggt cct cac ggg atg ggg aaa acc acc 192Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr 50 55 60acc acg caa ctg ctg gtg gcc ctg ggt tcg cgc gac gat atc gtc tac 240Thr Thr Gln Leu Leu Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr65 70 75 80gta ccc gag ccg atg act tac tgg cag gtg ctg ggg gct tcc gag aca 288Val Pro Glu Pro Met Thr Tyr Trp Gln Val Leu Gly Ala Ser Glu Thr 85 90 95atc gcg aac atc tac acc aca caa cac cgc ctc gac cag ggt gag ata 336Ile Ala Asn Ile Tyr Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile 100 105 110tcg gcc ggg gac gcg gcg gtg gta atg aca agc gcc cag ata aca atg 384Ser Ala Gly Asp Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met 115 120 125ggc atg cct tat gcc gtg acc gac gcc gtt ctg gct cct cat gtc ggg 432Gly Met Pro Tyr Ala Val Thr Asp Ala Val Leu Ala Pro His Val Gly 130 135 140ggg gag gct ggg agt tca cat gcc ccg ccc ccg gcc ctc acc ctc atc 480Gly Glu Ala Gly Ser Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile145 150 155 160ttc gac cgc cat ccc atc gcc gcc ctc ctg tgc tac ccg gcc gcg cga 528Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg 165 170 175tac ctt atg ggc agc atg acc ccc cag gcc gtg ctg gcg ttc gtg gcc 576Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala 180 185 190ctc atc ccg ccg acc ttg ccc ggc aca aac atc gtg ttg ggg gcc ctt 624Leu Ile Pro Pro Thr Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu 195 200 205ccg gag gac aga cac atc gac cgc ctg gcc aaa cgc cag cgc ccc ggc 672Pro Glu Asp Arg His Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly 210 215 220gag cgg ctt gac ctg gct atg ctg gcc gcg att cgc cgc gtt tac ggg 720Glu Arg Leu Asp Leu Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly225 230 235 240ctg ctt gcc aat acg gtg cgg tat ctg cag ggc ggc ggg tcg tgg tgg 768Leu Leu Ala Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Trp 245 250 255gag gat tgg gga cag ctt tcg ggg acg gcc gtg ccg ccc cag ggt gcc 816Glu Asp Trp Gly Gln Leu Ser Gly Thr Ala Val Pro Pro Gln Gly Ala 260 265 270gag ccc cag agc aac gcg ggc cca cga ccc cat atc ggg gac acg tta 864Glu Pro Gln Ser Asn Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu 275 280 285ttt acc ctg ttt cgg gcc ccc gag ttg ctg gcc ccc aac ggc gac ctg 912Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu 290 295 300tat aac gtg ttt gcc tgg gcc ttg gac gtc ttg gcc aaa cgc ctc cgt 960Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg305 310 315 320ccc atg cac gtc ttt atc ctg gat tac gac caa tcg ccc gcc ggc tgc 1008Pro Met His Val Phe Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys 325 330 335cgg gac gcc ctg ctg caa ctt acc tcc ggg atg gtc cag acc cac gtc 1056Arg Asp Ala Leu Leu Gln Leu Thr Ser Gly Met Val Gln Thr His Val 340 345 350acc acc cca ggc tcc ata ccg acg atc tgc gac ctg gcg cgc acg ttt 1104Thr Thr Pro Gly Ser Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe 355 360 365gcc cgg gag atg ggg gag gct aac tga 1131Ala Arg Glu Met Gly Glu Ala Asn 370 37516376PRTHerpes simplex virus 1 16Met Ala Ser Tyr Pro Cys His Gln His Ala Ser Ala Phe Asp Gln Ala1 5 10 15Ala Arg Ser Arg Gly His Ser Asn Arg Arg Thr Ala Leu Arg Pro Arg 20 25 30Arg Gln Gln Glu Ala Thr Glu Val Arg Leu Glu Gln Lys Met Pro Thr 35 40 45Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr 50 55 60Thr Thr Gln Leu Leu Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr65 70 75 80Val Pro Glu Pro Met Thr Tyr Trp Gln Val Leu Gly Ala Ser Glu Thr 85 90 95Ile Ala Asn Ile Tyr Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile 100 105 110Ser Ala Gly Asp Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met 115 120 125Gly Met Pro Tyr Ala Val Thr Asp Ala Val Leu Ala Pro His Val Gly 130 135 140Gly Glu Ala Gly Ser Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile145 150 155 160Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg 165 170 175Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala 180 185 190Leu Ile Pro Pro Thr Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu 195 200 205Pro Glu Asp Arg His Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly 210 215 220Glu Arg Leu Asp Leu Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly225 230 235 240Leu Leu Ala Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Trp 245 250 255Glu Asp Trp Gly Gln Leu Ser Gly Thr Ala Val Pro Pro Gln Gly Ala 260 265 270Glu Pro Gln Ser Asn Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu 275 280 285Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu 290 295 300Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg305 310 315 320Pro Met His Val Phe Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys 325 330 335Arg Asp Ala Leu Leu Gln Leu Thr Ser Gly Met Val Gln Thr His Val 340 345 350Thr Thr Pro Gly Ser Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe 355 360 365Ala Arg Glu Met Gly Glu Ala Asn 370 37517840DNAToxoplasma gondiiCDS(1)..(837)coding for hypoxanthine-xanthine-guanine phosphoribosyl transferase (HXGPRTase) 17atg gcg tcc aaa ccc att gaa gaa tcc cgg tcg caa aaa cgg agt gcc 48Met Ala Ser Lys Pro Ile Glu Glu Ser Arg Ser Gln Lys Arg Ser Ala1 5 10 15ttc tca gac atc ttc tgt tgt tgc act cct aat gaa ggg gct atc gtg 96Phe Ser Asp Ile Phe Cys Cys Cys Thr Pro Asn Glu Gly Ala Ile Val 20 25 30ccc agt gac cca atg gtc tcc acc agt gct cca gca cgc acc agt gct 144Pro Ser Asp Pro Met Val Ser Thr Ser Ala Pro Ala Arg Thr Ser Ala 35 40 45cca gcg cgc tcc agt gca ctt caa gac tac ggc aag ggc aag ggc cgt 192Pro Ala Arg Ser Ser Ala Leu Gln Asp Tyr Gly Lys Gly Lys Gly Arg 50 55 60att gag ccc atg tat atc ccc gac aac acc ttc tac aac gct gat gac 240Ile Glu Pro Met Tyr Ile Pro Asp Asn Thr Phe Tyr Asn Ala Asp Asp65 70 75 80ttt ctt gtg ccc ccc cac tgc aag ccc tac att gac aaa atc ctc ctc 288Phe Leu Val Pro Pro His Cys Lys Pro Tyr Ile Asp Lys Ile Leu Leu 85 90 95cct ggt gga ttg gtc aag gac aga gtt gag aag ttg gcg tat gac atc 336Pro Gly Gly Leu Val Lys Asp Arg Val Glu Lys Leu Ala Tyr Asp Ile 100 105 110cac aga act tac ttc ggc gag gag ttg cac atc att tgc atc ctg aaa 384His Arg Thr Tyr Phe Gly Glu Glu Leu His Ile Ile Cys Ile Leu Lys 115 120 125ggc tct cgc ggc ttc ttc aac ctt ctg atc gac tac ctt gcc acc ata 432Gly Ser Arg Gly Phe Phe Asn Leu Leu Ile Asp Tyr Leu Ala Thr Ile 130 135 140cag aag tac agt ggt cgt gag tcc agc gtg ccc ccc ttc ttc gag cac 480Gln Lys Tyr Ser Gly Arg Glu Ser Ser Val Pro Pro Phe Phe Glu His145 150 155 160tat gtc cgc ctg aag tcc tac cag aac gac aac agc aca ggc cag ctc 528Tyr Val Arg Leu Lys Ser Tyr Gln Asn Asp Asn Ser Thr Gly Gln Leu 165 170 175acc gtc ttg agc gac gac ttg tca atc ttt cgc gac aag cac gtt ctg 576Thr Val Leu Ser Asp Asp Leu Ser Ile Phe Arg Asp Lys His Val Leu 180 185 190att gtt gag gac atc gtc gac acc ggt ttc acc ctc acc gag ttc ggt 624Ile Val Glu Asp Ile Val Asp Thr Gly Phe Thr Leu Thr Glu Phe Gly 195 200 205gag cgc ctg aaa gcc gtc ggt ccc aag tcg atg aga atc gcc acc ctc 672Glu Arg Leu Lys Ala Val Gly Pro Lys Ser Met Arg Ile Ala Thr Leu 210 215 220gtc gag aag cgc aca gat cgc tcc aac agc ttg aag ggc gac ttc gtc 720Val Glu Lys Arg Thr Asp Arg Ser Asn Ser Leu Lys Gly Asp Phe Val225 230 235 240ggc ttc agc att gaa gac gtc tgg atc gtt ggt tgc tgc tac gac ttc 768Gly Phe Ser Ile Glu Asp Val Trp Ile Val Gly Cys Cys Tyr Asp Phe 245 250 255aac gag atg ttc cgc gac ttc gac cac gtc gcc gtc ctg agc gac gcc 816Asn Glu Met Phe Arg Asp Phe Asp His Val Ala Val Leu Ser Asp Ala 260 265 270gct cgc aaa aag ttc gag aag taa 840Ala Arg Lys Lys Phe Glu Lys 27518279PRTToxoplasma gondii 18Met Ala Ser Lys Pro Ile Glu Glu Ser Arg Ser Gln Lys Arg Ser Ala1 5 10 15Phe Ser Asp Ile Phe Cys Cys Cys Thr Pro Asn Glu Gly Ala Ile Val 20 25 30Pro Ser Asp Pro Met Val Ser Thr Ser Ala Pro Ala Arg Thr Ser Ala 35 40 45Pro Ala Arg Ser Ser Ala Leu Gln Asp Tyr Gly Lys Gly Lys Gly Arg 50 55 60Ile Glu Pro Met Tyr Ile Pro Asp Asn Thr Phe Tyr Asn Ala Asp Asp65 70 75 80Phe Leu Val Pro Pro His Cys Lys Pro Tyr Ile Asp Lys Ile Leu Leu 85 90 95Pro Gly Gly Leu Val Lys Asp Arg Val Glu Lys Leu Ala Tyr Asp Ile 100 105 110His Arg Thr Tyr Phe Gly Glu Glu Leu His Ile Ile Cys Ile Leu Lys 115 120 125Gly Ser Arg Gly Phe Phe Asn Leu Leu Ile Asp Tyr Leu Ala Thr Ile 130 135 140Gln Lys Tyr Ser Gly Arg Glu Ser Ser Val Pro Pro Phe Phe Glu His145 150 155 160Tyr Val Arg Leu Lys Ser Tyr Gln Asn Asp Asn Ser Thr Gly Gln Leu 165 170 175Thr Val Leu Ser Asp Asp Leu Ser Ile Phe Arg Asp Lys His Val Leu 180 185 190Ile Val Glu Asp Ile Val Asp Thr Gly Phe Thr Leu Thr Glu Phe Gly 195 200 205Glu Arg Leu Lys Ala Val Gly Pro Lys Ser Met Arg Ile Ala Thr Leu 210 215 220Val Glu Lys Arg Thr Asp Arg Ser Asn Ser Leu Lys Gly Asp Phe Val225 230 235 240Gly Phe Ser Ile Glu Asp Val Trp Ile Val Gly Cys Cys Tyr Asp Phe 245 250 255Asn Glu Met Phe Arg Asp Phe Asp His Val Ala Val Leu Ser Asp Ala 260 265 270Ala Arg Lys Lys Phe Glu Lys 27519459DNAEscherichia coliCDS(1)..(456)coding for xanthine-guanine phosphoribosyl transferase (gpt) 19atg agc gaa aaa tac atc gtc acc tgg gac atg ttg cag atc cat gca 48Met Ser Glu Lys Tyr Ile Val Thr Trp Asp Met Leu Gln Ile His Ala1 5 10 15cgt aaa ctc gca agc cga ctg atg cct tct gaa caa tgg aaa ggc att 96Arg Lys Leu Ala Ser Arg Leu Met Pro Ser Glu Gln Trp Lys Gly Ile 20 25 30att gcc gta agc cgt ggc ggt ctg gta ccg ggt gcg tta ctg gcg cgt 144Ile Ala Val Ser Arg Gly Gly Leu Val Pro Gly Ala Leu Leu Ala Arg 35 40 45gaa ctg ggt att cgt cat gtc gat acc gtt tgt att tcc agc tac gat 192Glu Leu Gly Ile Arg His Val Asp Thr Val Cys Ile Ser Ser Tyr Asp 50 55 60cac gac aac cag cgc gag ctt aaa gtg ctg aaa cgc gca gaa ggc gat 240His Asp Asn Gln Arg Glu Leu Lys Val Leu Lys Arg Ala Glu Gly Asp65 70 75 80ggc gaa ggc ttc atc gtt att gat gac ctg gtg gat acc ggt ggt act 288Gly Glu Gly Phe Ile Val Ile Asp Asp Leu Val Asp Thr Gly Gly Thr 85 90 95gcg gtt gcg att cgt gaa atg tat cca aaa gcg cac ttt gtc acc atc 336Ala Val Ala Ile Arg Glu Met Tyr Pro Lys Ala His Phe Val Thr Ile 100 105 110ttc gca aaa ccg gct ggt cgt ccg ctg gtt gat gac tat gtt gtt gat 384Phe Ala Lys Pro Ala Gly Arg Pro Leu Val Asp Asp Tyr Val Val Asp 115 120 125atc ccg caa gat acc tgg att gaa cag ccg tgg gat atg ggc gtc gta 432Ile Pro Gln Asp Thr Trp Ile Glu Gln Pro Trp Asp Met Gly Val Val 130 135 140ttc gtc ccg cca atc tcc ggt cgc taa 459Phe Val Pro Pro Ile Ser Gly Arg145 15020152PRTEscherichia coli 20Met Ser Glu Lys Tyr Ile Val Thr Trp Asp Met Leu Gln Ile His Ala1 5 10 15Arg Lys Leu Ala Ser Arg Leu Met Pro Ser Glu Gln Trp Lys Gly Ile 20 25 30Ile Ala Val Ser Arg Gly Gly Leu Val Pro Gly Ala Leu Leu Ala Arg 35 40 45Glu Leu Gly Ile Arg His Val Asp Thr Val Cys Ile Ser Ser Tyr Asp 50 55 60His Asp Asn Gln Arg Glu Leu Lys Val Leu Lys Arg Ala Glu Gly Asp65 70 75 80Gly Glu Gly Phe Ile Val Ile Asp Asp Leu Val Asp Thr Gly Gly Thr 85 90 95Ala Val Ala Ile Arg Glu Met Tyr Pro Lys Ala His Phe Val Thr Ile 100 105 110Phe Ala Lys Pro Ala Gly Arg Pro Leu Val Asp Asp Tyr Val Val Asp 115 120 125Ile Pro Gln Asp Thr Trp Ile Glu Gln Pro Trp Asp Met Gly Val Val 130 135 140Phe Val Pro Pro Ile Ser Gly Arg145 15021459DNAEscherichia coliCDS(1)..(456)coding for xanthine-guanine phosphoribosyl transferase (gpt) 21atg agc gaa aaa tac atc gtc acc tgg gac atg ttg cag atc cat gca 48Met Ser Glu Lys Tyr Ile Val Thr Trp Asp Met Leu Gln Ile His Ala1 5 10 15cgt aaa ctc gca agc cga ctg atg cct tct gaa caa tgg aaa ggc att 96Arg Lys Leu Ala Ser Arg Leu Met Pro Ser Glu Gln Trp Lys Gly Ile 20 25 30att gcc gta agc cgt ggc ggt ctg gta ccg ggt gcg tta ctg gcg cgt 144Ile Ala Val Ser Arg Gly Gly Leu Val Pro Gly Ala Leu Leu Ala Arg 35 40 45gaa ctg ggt att cgt cat gtc gat acc gtt tgt att tcc agc tac gat 192Glu Leu Gly Ile Arg His Val Asp Thr Val Cys Ile Ser Ser Tyr Asp 50 55 60cac gac aac cag cgc gag ctt aaa gtg ctg aaa cgc gca gaa ggc gat 240His Asp Asn Gln Arg Glu Leu Lys Val Leu Lys Arg Ala Glu Gly Asp65 70 75 80ggc gaa ggc ttc atc gtt att gat gac ctg gtg gat acc ggt ggt act 288Gly Glu Gly Phe Ile Val Ile Asp Asp Leu Val Asp Thr Gly Gly Thr 85 90 95gcg gtt gcg att cgt gaa atg tat cca aaa gcg cac ttt gtc acc atc 336Ala Val Ala Ile Arg Glu Met Tyr Pro Lys Ala His Phe Val Thr Ile 100 105 110ttc gca aaa ccg gct ggt cgt ccg ctg gtt gat gac tat gtt gtt gat 384Phe Ala Lys Pro Ala Gly Arg Pro Leu Val Asp Asp Tyr Val Val Asp 115 120 125atc ccg caa gat acc tgg att gaa cag ccg tgg gat atg ggc gtc gta 432Ile Pro Gln Asp Thr Trp Ile Glu Gln Pro Trp Asp Met Gly Val Val 130 135 140ttc gtc ccg cca atc tcc ggt cgc taa 459Phe Val Pro Pro Ile Ser Gly Arg145 15022152PRTEscherichia coli 22Met Ser Glu Lys Tyr Ile Val Thr Trp Asp Met Leu Gln Ile His Ala1 5 10 15Arg Lys Leu Ala Ser Arg Leu Met Pro Ser Glu Gln Trp Lys Gly Ile 20 25 30Ile Ala Val Ser Arg Gly Gly Leu Val Pro Gly Ala Leu Leu Ala Arg 35 40 45Glu Leu Gly Ile Arg His Val Asp Thr Val Cys Ile Ser Ser Tyr Asp 50 55 60His Asp Asn Gln Arg Glu Leu Lys Val Leu Lys Arg Ala Glu Gly Asp65 70 75 80Gly Glu Gly Phe Ile Val Ile Asp Asp Leu Val Asp Thr Gly Gly Thr

85 90 95Ala Val Ala Ile Arg Glu Met Tyr Pro Lys Ala His Phe Val Thr Ile 100 105 110Phe Ala Lys Pro Ala Gly Arg Pro Leu Val Asp Asp Tyr Val Val Asp 115 120 125Ile Pro Gln Asp Thr Trp Ile Glu Gln Pro Trp Asp Met Gly Val Val 130 135 140Phe Val Pro Pro Ile Ser Gly Arg145 15023720DNAEscherichia coliCDS(1)..(717)coding for purine nucleoside phosphorylase (deoD) 23atg gct acc cca cac att aat gca gaa atg ggc gat ttc gct gac gta 48Met Ala Thr Pro His Ile Asn Ala Glu Met Gly Asp Phe Ala Asp Val1 5 10 15gtt ttg atg cca ggc gac ccg ctg cgt gcg aag tat att gct gaa act 96Val Leu Met Pro Gly Asp Pro Leu Arg Ala Lys Tyr Ile Ala Glu Thr 20 25 30ttc ctt gaa gat gcc cgt gaa gtg aac aac gtt cgc ggt atg ctg ggc 144Phe Leu Glu Asp Ala Arg Glu Val Asn Asn Val Arg Gly Met Leu Gly 35 40 45ttc acc ggt act tac aaa ggc cgc aaa att tcc gta atg ggt cac ggt 192Phe Thr Gly Thr Tyr Lys Gly Arg Lys Ile Ser Val Met Gly His Gly 50 55 60atg ggt atc ccg tcc tgc tcc atc tac acc aaa gaa ctg atc acc gat 240Met Gly Ile Pro Ser Cys Ser Ile Tyr Thr Lys Glu Leu Ile Thr Asp65 70 75 80ttc ggc gtg aag aaa att atc cgc gtg ggt tcc tgt ggc gca gtt ctg 288Phe Gly Val Lys Lys Ile Ile Arg Val Gly Ser Cys Gly Ala Val Leu 85 90 95ccg cac gta aaa ctg cgc gac gtc gtt atc ggt atg ggt gcc tgc acc 336Pro His Val Lys Leu Arg Asp Val Val Ile Gly Met Gly Ala Cys Thr 100 105 110gat tcc aaa gtt aac cgc atc cgt ttt aaa gac cat gac ttt gcc gct 384Asp Ser Lys Val Asn Arg Ile Arg Phe Lys Asp His Asp Phe Ala Ala 115 120 125atc gct gac ttc gac atg gtg cgt aac gca gta gat gca gct aaa gca 432Ile Ala Asp Phe Asp Met Val Arg Asn Ala Val Asp Ala Ala Lys Ala 130 135 140ctg ggt att gat gct cgc gtg ggt aac ctg ttc tcc gct gac ctg ttc 480Leu Gly Ile Asp Ala Arg Val Gly Asn Leu Phe Ser Ala Asp Leu Phe145 150 155 160tac tct ccg gac ggc gaa atg ttc gac gtg atg gaa aaa tac ggc att 528Tyr Ser Pro Asp Gly Glu Met Phe Asp Val Met Glu Lys Tyr Gly Ile 165 170 175ctc ggc gtg gaa atg gaa gcg gct ggt atc tac ggc gtc gct gca gaa 576Leu Gly Val Glu Met Glu Ala Ala Gly Ile Tyr Gly Val Ala Ala Glu 180 185 190ttt ggc gcg aaa gcc ctg acc atc tgc acc gta tct gac cac atc cgc 624Phe Gly Ala Lys Ala Leu Thr Ile Cys Thr Val Ser Asp His Ile Arg 195 200 205act cac gag cag acc act gcc gct gag cgt cag act acc ttc aac gac 672Thr His Glu Gln Thr Thr Ala Ala Glu Arg Gln Thr Thr Phe Asn Asp 210 215 220atg atc aaa atc gca ctg gaa tcc gtt ctg ctg ggc gat aaa gag taa 720Met Ile Lys Ile Ala Leu Glu Ser Val Leu Leu Gly Asp Lys Glu225 230 23524239PRTEscherichia coli 24Met Ala Thr Pro His Ile Asn Ala Glu Met Gly Asp Phe Ala Asp Val1 5 10 15Val Leu Met Pro Gly Asp Pro Leu Arg Ala Lys Tyr Ile Ala Glu Thr 20 25 30Phe Leu Glu Asp Ala Arg Glu Val Asn Asn Val Arg Gly Met Leu Gly 35 40 45Phe Thr Gly Thr Tyr Lys Gly Arg Lys Ile Ser Val Met Gly His Gly 50 55 60Met Gly Ile Pro Ser Cys Ser Ile Tyr Thr Lys Glu Leu Ile Thr Asp65 70 75 80Phe Gly Val Lys Lys Ile Ile Arg Val Gly Ser Cys Gly Ala Val Leu 85 90 95Pro His Val Lys Leu Arg Asp Val Val Ile Gly Met Gly Ala Cys Thr 100 105 110Asp Ser Lys Val Asn Arg Ile Arg Phe Lys Asp His Asp Phe Ala Ala 115 120 125Ile Ala Asp Phe Asp Met Val Arg Asn Ala Val Asp Ala Ala Lys Ala 130 135 140Leu Gly Ile Asp Ala Arg Val Gly Asn Leu Phe Ser Ala Asp Leu Phe145 150 155 160Tyr Ser Pro Asp Gly Glu Met Phe Asp Val Met Glu Lys Tyr Gly Ile 165 170 175Leu Gly Val Glu Met Glu Ala Ala Gly Ile Tyr Gly Val Ala Ala Glu 180 185 190Phe Gly Ala Lys Ala Leu Thr Ile Cys Thr Val Ser Asp His Ile Arg 195 200 205Thr His Glu Gln Thr Thr Ala Ala Glu Arg Gln Thr Thr Phe Asn Asp 210 215 220Met Ile Lys Ile Ala Leu Glu Ser Val Leu Leu Gly Asp Lys Glu225 230 235251545DNABurkholderia caryophylliCDS(1)..(1542)coding for phosphonate monoester hydrolase (pehA) 25atg acc aga aaa aat gtc ctg ctt atc gtc gtt gat caa tgg cga gca 48Met Thr Arg Lys Asn Val Leu Leu Ile Val Val Asp Gln Trp Arg Ala1 5 10 15gat ttt atc cct cac ctg atg cgg gcg gag ggg cgc gaa cct ttc ctt 96Asp Phe Ile Pro His Leu Met Arg Ala Glu Gly Arg Glu Pro Phe Leu 20 25 30aaa act ccc aat ctt gat cgt ctt tgc cgg gaa ggc ttg acc ttc cgc 144Lys Thr Pro Asn Leu Asp Arg Leu Cys Arg Glu Gly Leu Thr Phe Arg 35 40 45aat cat gtc acg acg tgc gtg ccg tgt ggt ccg gca agg gca agc ctg 192Asn His Val Thr Thr Cys Val Pro Cys Gly Pro Ala Arg Ala Ser Leu 50 55 60ctg acg ggc ctc tac ctg atg aac cac cgg gcg gtg cag aac act gtt 240Leu Thr Gly Leu Tyr Leu Met Asn His Arg Ala Val Gln Asn Thr Val65 70 75 80ccg ctt gac cag cgc cat cta aac ctt ggc aag gcc ctg cgc gcc att 288Pro Leu Asp Gln Arg His Leu Asn Leu Gly Lys Ala Leu Arg Ala Ile 85 90 95ggc tac gat ccc gcg ctc att ggt tac acc acc acg aca cct gat ccg 336Gly Tyr Asp Pro Ala Leu Ile Gly Tyr Thr Thr Thr Thr Pro Asp Pro 100 105 110cgc aca acc tct gca agg gat ccg cgt ttc acg gtc ctg ggc gac atc 384Arg Thr Thr Ser Ala Arg Asp Pro Arg Phe Thr Val Leu Gly Asp Ile 115 120 125atg gac ggc ttt cgt tcg gtc ggc gca ttc gag ccc aat atg gag ggg 432Met Asp Gly Phe Arg Ser Val Gly Ala Phe Glu Pro Asn Met Glu Gly 130 135 140tat ttt ggc tgg gtg gcg cag aac ggc ttc gaa ctg cca gag aac cgc 480Tyr Phe Gly Trp Val Ala Gln Asn Gly Phe Glu Leu Pro Glu Asn Arg145 150 155 160gaa gat atc tgg ctg ccg gaa ggt gaa cat tcc gtt ccc ggt gct acc 528Glu Asp Ile Trp Leu Pro Glu Gly Glu His Ser Val Pro Gly Ala Thr 165 170 175gac aaa ccg tcg cgc att ccg aag gaa ttt tcg gat tcg aca ttc ttc 576Asp Lys Pro Ser Arg Ile Pro Lys Glu Phe Ser Asp Ser Thr Phe Phe 180 185 190acg gag cgc gcc ctg aca tat ctg aag ggc agg gac ggc aag cct ttc 624Thr Glu Arg Ala Leu Thr Tyr Leu Lys Gly Arg Asp Gly Lys Pro Phe 195 200 205ttc ctg cat ctt ggc tat tat cgc ccg cat ccg cct ttc gta gcc tcc 672Phe Leu His Leu Gly Tyr Tyr Arg Pro His Pro Pro Phe Val Ala Ser 210 215 220gcg ccc tac cat gcg atg tac aaa gcc gaa gat atg cct gcg cct ata 720Ala Pro Tyr His Ala Met Tyr Lys Ala Glu Asp Met Pro Ala Pro Ile225 230 235 240cgt gcg gag aat ccg gat gcc gaa gcg gca cag cat ccg ctc atg aag 768Arg Ala Glu Asn Pro Asp Ala Glu Ala Ala Gln His Pro Leu Met Lys 245 250 255cac tat atc gac cac atc aga cgc ggc tcg ttc ttc cat ggc gcg gaa 816His Tyr Ile Asp His Ile Arg Arg Gly Ser Phe Phe His Gly Ala Glu 260 265 270ggc tcg gga gca acg ctt gat gaa ggc gaa att cgc cag atg cgc gct 864Gly Ser Gly Ala Thr Leu Asp Glu Gly Glu Ile Arg Gln Met Arg Ala 275 280 285aca tat tgc gga ctg atc acc gag atc gac gat tgt ctg ggg agg gtc 912Thr Tyr Cys Gly Leu Ile Thr Glu Ile Asp Asp Cys Leu Gly Arg Val 290 295 300ttt gcc tat ctc gat gaa acc ggt cag tgg gac gac acg ctg att atc 960Phe Ala Tyr Leu Asp Glu Thr Gly Gln Trp Asp Asp Thr Leu Ile Ile305 310 315 320ttc acg agc gat cat ggc gaa caa ctg ggc gat cat cac ctg ctc ggc 1008Phe Thr Ser Asp His Gly Glu Gln Leu Gly Asp His His Leu Leu Gly 325 330 335aag atc ggt tac aat gcc gaa agc ttc cgt att ccc ttg gtc ata aag 1056Lys Ile Gly Tyr Asn Ala Glu Ser Phe Arg Ile Pro Leu Val Ile Lys 340 345 350gat gcg gga cag aac cgg cac gcc ggc cag atc gaa gaa ggc ttc tcc 1104Asp Ala Gly Gln Asn Arg His Ala Gly Gln Ile Glu Glu Gly Phe Ser 355 360 365gaa agc atc gac gtc atg ccg acc atc ctc gaa tgg ctg ggc ggg gaa 1152Glu Ser Ile Asp Val Met Pro Thr Ile Leu Glu Trp Leu Gly Gly Glu 370 375 380acg cct cgc gcc tgc gac ggc cgt tcg ctg ttg ccg ttt ctg gct gag 1200Thr Pro Arg Ala Cys Asp Gly Arg Ser Leu Leu Pro Phe Leu Ala Glu385 390 395 400gga aag ccc tcc gac tgg cgc acg gaa cta cat tac gag ttc gat ttt 1248Gly Lys Pro Ser Asp Trp Arg Thr Glu Leu His Tyr Glu Phe Asp Phe 405 410 415cgc gat gtc ttc tac gat cag ccg cag aac tcg gtc cag ctt tcc cag 1296Arg Asp Val Phe Tyr Asp Gln Pro Gln Asn Ser Val Gln Leu Ser Gln 420 425 430gat gat tgc agc ctc tgt gtg atc gag gac gaa aac tac aag tac gtg 1344Asp Asp Cys Ser Leu Cys Val Ile Glu Asp Glu Asn Tyr Lys Tyr Val 435 440 445cat ttt gcc gcc ctg ccg ccg ctg ttc ttc gat ctg aag gca gac ccg 1392His Phe Ala Ala Leu Pro Pro Leu Phe Phe Asp Leu Lys Ala Asp Pro 450 455 460cat gaa ttc agc aat ctg gct ggc gat cct gct tat gcg gcc ctc gtt 1440His Glu Phe Ser Asn Leu Ala Gly Asp Pro Ala Tyr Ala Ala Leu Val465 470 475 480cgt gac tat gcc cag aag gca ttg tcg tgg cga ctg tct cat gcc gac 1488Arg Asp Tyr Ala Gln Lys Ala Leu Ser Trp Arg Leu Ser His Ala Asp 485 490 495cgg aca ctc acc cat tac aga tcc agc ccg caa ggg ctg aca acg cgc 1536Arg Thr Leu Thr His Tyr Arg Ser Ser Pro Gln Gly Leu Thr Thr Arg 500 505 510aac cat tga 1545Asn His 26514PRTBurkholderia caryophylli 26Met Thr Arg Lys Asn Val Leu Leu Ile Val Val Asp Gln Trp Arg Ala1 5 10 15Asp Phe Ile Pro His Leu Met Arg Ala Glu Gly Arg Glu Pro Phe Leu 20 25 30Lys Thr Pro Asn Leu Asp Arg Leu Cys Arg Glu Gly Leu Thr Phe Arg 35 40 45Asn His Val Thr Thr Cys Val Pro Cys Gly Pro Ala Arg Ala Ser Leu 50 55 60Leu Thr Gly Leu Tyr Leu Met Asn His Arg Ala Val Gln Asn Thr Val65 70 75 80Pro Leu Asp Gln Arg His Leu Asn Leu Gly Lys Ala Leu Arg Ala Ile 85 90 95Gly Tyr Asp Pro Ala Leu Ile Gly Tyr Thr Thr Thr Thr Pro Asp Pro 100 105 110Arg Thr Thr Ser Ala Arg Asp Pro Arg Phe Thr Val Leu Gly Asp Ile 115 120 125Met Asp Gly Phe Arg Ser Val Gly Ala Phe Glu Pro Asn Met Glu Gly 130 135 140Tyr Phe Gly Trp Val Ala Gln Asn Gly Phe Glu Leu Pro Glu Asn Arg145 150 155 160Glu Asp Ile Trp Leu Pro Glu Gly Glu His Ser Val Pro Gly Ala Thr 165 170 175Asp Lys Pro Ser Arg Ile Pro Lys Glu Phe Ser Asp Ser Thr Phe Phe 180 185 190Thr Glu Arg Ala Leu Thr Tyr Leu Lys Gly Arg Asp Gly Lys Pro Phe 195 200 205Phe Leu His Leu Gly Tyr Tyr Arg Pro His Pro Pro Phe Val Ala Ser 210 215 220Ala Pro Tyr His Ala Met Tyr Lys Ala Glu Asp Met Pro Ala Pro Ile225 230 235 240Arg Ala Glu Asn Pro Asp Ala Glu Ala Ala Gln His Pro Leu Met Lys 245 250 255His Tyr Ile Asp His Ile Arg Arg Gly Ser Phe Phe His Gly Ala Glu 260 265 270Gly Ser Gly Ala Thr Leu Asp Glu Gly Glu Ile Arg Gln Met Arg Ala 275 280 285Thr Tyr Cys Gly Leu Ile Thr Glu Ile Asp Asp Cys Leu Gly Arg Val 290 295 300Phe Ala Tyr Leu Asp Glu Thr Gly Gln Trp Asp Asp Thr Leu Ile Ile305 310 315 320Phe Thr Ser Asp His Gly Glu Gln Leu Gly Asp His His Leu Leu Gly 325 330 335Lys Ile Gly Tyr Asn Ala Glu Ser Phe Arg Ile Pro Leu Val Ile Lys 340 345 350Asp Ala Gly Gln Asn Arg His Ala Gly Gln Ile Glu Glu Gly Phe Ser 355 360 365Glu Ser Ile Asp Val Met Pro Thr Ile Leu Glu Trp Leu Gly Gly Glu 370 375 380Thr Pro Arg Ala Cys Asp Gly Arg Ser Leu Leu Pro Phe Leu Ala Glu385 390 395 400Gly Lys Pro Ser Asp Trp Arg Thr Glu Leu His Tyr Glu Phe Asp Phe 405 410 415Arg Asp Val Phe Tyr Asp Gln Pro Gln Asn Ser Val Gln Leu Ser Gln 420 425 430Asp Asp Cys Ser Leu Cys Val Ile Glu Asp Glu Asn Tyr Lys Tyr Val 435 440 445His Phe Ala Ala Leu Pro Pro Leu Phe Phe Asp Leu Lys Ala Asp Pro 450 455 460His Glu Phe Ser Asn Leu Ala Gly Asp Pro Ala Tyr Ala Ala Leu Val465 470 475 480Arg Asp Tyr Ala Gln Lys Ala Leu Ser Trp Arg Leu Ser His Ala Asp 485 490 495Arg Thr Leu Thr His Tyr Arg Ser Ser Pro Gln Gly Leu Thr Thr Arg 500 505 510Asn His 272250DNAAgrobacterium rhizogenesCDS(1)..(2247)coding for tryptophan oxygenase (aux1) 27atg gct gga tcc tcc ttc aca ttg cca tca act ggc tca gcg ccc ctt 48Met Ala Gly Ser Ser Phe Thr Leu Pro Ser Thr Gly Ser Ala Pro Leu1 5 10 15gat atg atg ctt atc gat gat tca gat ctg ctg caa ttg ggt ctc cag 96Asp Met Met Leu Ile Asp Asp Ser Asp Leu Leu Gln Leu Gly Leu Gln 20 25 30cag gta ttc tcg aag cgg tac aca gag aca ccg cag tca cgc tac aaa 144Gln Val Phe Ser Lys Arg Tyr Thr Glu Thr Pro Gln Ser Arg Tyr Lys 35 40 45ctg acc agg agg gct tct cca gac gtc tca tct ggc gaa ggc aat gtg 192Leu Thr Arg Arg Ala Ser Pro Asp Val Ser Ser Gly Glu Gly Asn Val 50 55 60cat gcc ctt gcg ttc ata tat gtc aac gct gag acg ttg cag atg atc 240His Ala Leu Ala Phe Ile Tyr Val Asn Ala Glu Thr Leu Gln Met Ile65 70 75 80aaa aac gct cga tcg cta acc gaa gcg aac ggc gtc aaa gat ctt gtc 288Lys Asn Ala Arg Ser Leu Thr Glu Ala Asn Gly Val Lys Asp Leu Val 85 90 95gcc atc gac gtt ccg cca ttt cga aac gac ttc tca aga gcg cta ctc 336Ala Ile Asp Val Pro Pro Phe Arg Asn Asp Phe Ser Arg Ala Leu Leu 100 105 110ctt caa gtg atc aac ttg ttg gga aac aac cga aat gcc gat gac gat 384Leu Gln Val Ile Asn Leu Leu Gly Asn Asn Arg Asn Ala Asp Asp Asp 115 120 125ctt agt cac ttc ata gca gtt gct ctc cca aac agc gcc cgc tct aag 432Leu Ser His Phe Ile Ala Val Ala Leu Pro Asn Ser Ala Arg Ser Lys 130 135 140atc cta acc acg gca ccg ttc gaa gga agc ttg tca gaa aac ttc agg 480Ile Leu Thr Thr Ala Pro Phe Glu Gly Ser Leu Ser Glu Asn Phe Arg145 150 155 160ggg ttc ccg atc act cgt gaa gga aat gtg gca tgt gaa gtg cta gcc 528Gly Phe Pro Ile Thr Arg Glu Gly Asn Val Ala Cys Glu Val Leu Ala 165 170 175tat ggg aat aac ttg atg ccc aag gcc tgc tcc gat tcc ttt cca acc 576Tyr Gly Asn Asn Leu Met Pro Lys Ala Cys Ser Asp Ser Phe Pro Thr 180 185 190gtg gat ctt ctt tat gac tat ggc aag ttc ttc gag agt tgc gcg gcc 624Val Asp Leu Leu Tyr Asp Tyr Gly Lys Phe Phe Glu Ser Cys Ala Ala 195 200 205gat gga cgt atc ggt tat ttt cct gaa ggc gtt acg aaa cct aaa gtg 672Asp Gly Arg Ile Gly Tyr Phe Pro Glu Gly Val Thr Lys Pro Lys Val 210 215 220gct ata att ggc gca ggc ttt tcc ggg ctc gtt gca gcg agc gaa cta 720Ala Ile Ile Gly Ala Gly Phe Ser Gly Leu Val Ala Ala Ser Glu Leu225 230 235 240ctt cat gca ggg gta gac gat gtt acg gtg tat gag gcg agt gat cgg 768Leu His Ala Gly Val Asp Asp Val Thr Val

Tyr Glu Ala Ser Asp Arg 245 250 255ctt gga gga aag cta tgg tca cac gga ttt aag agt gct cca aat gtg 816Leu Gly Gly Lys Leu Trp Ser His Gly Phe Lys Ser Ala Pro Asn Val 260 265 270ata gcc gag atg ggg gcc atg cgt ttt ccg cga agt gaa tca tgc ttg 864Ile Ala Glu Met Gly Ala Met Arg Phe Pro Arg Ser Glu Ser Cys Leu 275 280 285ttc ttc tat ctc aaa aag cac gga ctg gac tcc gtt ggt ctg ttc ccg 912Phe Phe Tyr Leu Lys Lys His Gly Leu Asp Ser Val Gly Leu Phe Pro 290 295 300aat ccg gga agt gtc gat acc gca ttg ttc tac agg ggc cgt caa tat 960Asn Pro Gly Ser Val Asp Thr Ala Leu Phe Tyr Arg Gly Arg Gln Tyr305 310 315 320atc tgg aaa gcg gga gag gag cca ccg gag ctg ttt cgt cgt gtg cac 1008Ile Trp Lys Ala Gly Glu Glu Pro Pro Glu Leu Phe Arg Arg Val His 325 330 335cat gga tgg cgc gca ttt ttg caa gat ggc tat ctc cat gat gga gtc 1056His Gly Trp Arg Ala Phe Leu Gln Asp Gly Tyr Leu His Asp Gly Val 340 345 350atg ttg gcg tca ccg tta gca att gtt gac gcc ttg aat tta ggg cat 1104Met Leu Ala Ser Pro Leu Ala Ile Val Asp Ala Leu Asn Leu Gly His 355 360 365cta cag cag gcg cat ggc ttc tgg caa tct tgg ctc aca tat ttt gag 1152Leu Gln Gln Ala His Gly Phe Trp Gln Ser Trp Leu Thr Tyr Phe Glu 370 375 380cga gag tct ttc tct tct ggc atc gaa aaa atg ttc ttg ggc aat cat 1200Arg Glu Ser Phe Ser Ser Gly Ile Glu Lys Met Phe Leu Gly Asn His385 390 395 400cct ccg ggg ggt gaa caa tgg aat tcc cta gat gac ttg gat ctt ttc 1248Pro Pro Gly Gly Glu Gln Trp Asn Ser Leu Asp Asp Leu Asp Leu Phe 405 410 415aaa gcg ctg ggt att gga tcc ggc gga ttc ggc cct gta ttt gaa agt 1296Lys Ala Leu Gly Ile Gly Ser Gly Gly Phe Gly Pro Val Phe Glu Ser 420 425 430ggg ttt atc gag atc ctt cgc tta gtc gtc aac ggg tat gag gat aac 1344Gly Phe Ile Glu Ile Leu Arg Leu Val Val Asn Gly Tyr Glu Asp Asn 435 440 445gtg cgg ctg agt tac gaa gga att tct gag ctg cct cat agg atc gcc 1392Val Arg Leu Ser Tyr Glu Gly Ile Ser Glu Leu Pro His Arg Ile Ala 450 455 460tca cag gta att aac ggc aga tct att cgc gag cgt aca att cac gtt 1440Ser Gln Val Ile Asn Gly Arg Ser Ile Arg Glu Arg Thr Ile His Val465 470 475 480caa gtc gag cag att gat aga gag gag gat aaa ata aat atc aag atc 1488Gln Val Glu Gln Ile Asp Arg Glu Glu Asp Lys Ile Asn Ile Lys Ile 485 490 495aaa gga gga aag gtt gag gtc tat gat cga gta ctg gtt aca tcc ggg 1536Lys Gly Gly Lys Val Glu Val Tyr Asp Arg Val Leu Val Thr Ser Gly 500 505 510ttt gcg aac atc gaa atg cgc cat ctc ctg aca tca agc aac gca ttc 1584Phe Ala Asn Ile Glu Met Arg His Leu Leu Thr Ser Ser Asn Ala Phe 515 520 525ttc cat gca gat gta agc cat gca ata ggg aac agt cat atg act ggt 1632Phe His Ala Asp Val Ser His Ala Ile Gly Asn Ser His Met Thr Gly 530 535 540gcg tca aaa ctg ttc ttg ctg act aac gaa aaa ttc tgg cta caa cat 1680Ala Ser Lys Leu Phe Leu Leu Thr Asn Glu Lys Phe Trp Leu Gln His545 550 555 560cat ttg cca tcg tgc ata ctc acc acc ggc gtt gca aag gca gtt tat 1728His Leu Pro Ser Cys Ile Leu Thr Thr Gly Val Ala Lys Ala Val Tyr 565 570 575tgc tta gac tat gat ccg cga gat cca agc ggc aaa gga ctg gtg ttg 1776Cys Leu Asp Tyr Asp Pro Arg Asp Pro Ser Gly Lys Gly Leu Val Leu 580 585 590ata agc tat act tgg gag gat gac tca cat aag ctc cta gcc gtc ccc 1824Ile Ser Tyr Thr Trp Glu Asp Asp Ser His Lys Leu Leu Ala Val Pro 595 600 605gac aaa aga gaa agg ttc gca tcg ctg cag cgc gat att ggg agg gca 1872Asp Lys Arg Glu Arg Phe Ala Ser Leu Gln Arg Asp Ile Gly Arg Ala 610 615 620ttc cca gat ttt gcc aag cac cta act cct gca gac ggg aac tat gat 1920Phe Pro Asp Phe Ala Lys His Leu Thr Pro Ala Asp Gly Asn Tyr Asp625 630 635 640gat aat atc gtt caa cat gat tgg ctg act gat ccc cac gct ggc gga 1968Asp Asn Ile Val Gln His Asp Trp Leu Thr Asp Pro His Ala Gly Gly 645 650 655gcg ttt aaa ctg aac cgc aga ggc aac gac gta tat tca gaa agg ctt 2016Ala Phe Lys Leu Asn Arg Arg Gly Asn Asp Val Tyr Ser Glu Arg Leu 660 665 670ttc ttt cag ccc ttt gac gta atg cat ccc gcg gac gat aag gga ctt 2064Phe Phe Gln Pro Phe Asp Val Met His Pro Ala Asp Asp Lys Gly Leu 675 680 685tac ttg gcc ggt tgt agc tgt tcc ttc acc gga ggg tgg gtt cat ggt 2112Tyr Leu Ala Gly Cys Ser Cys Ser Phe Thr Gly Gly Trp Val His Gly 690 695 700gcc att cag acc gca tgc aac gct acg tgt gcg atc att tat ggt tcc 2160Ala Ile Gln Thr Ala Cys Asn Ala Thr Cys Ala Ile Ile Tyr Gly Ser705 710 715 720gga cac ctg caa gag cta atc cac tgg cga cac ctc aaa gaa ggt aat 2208Gly His Leu Gln Glu Leu Ile His Trp Arg His Leu Lys Glu Gly Asn 725 730 735cca ctg gcg cac gct tgg aag cgg tat agg tat caa gcg tga 2250Pro Leu Ala His Ala Trp Lys Arg Tyr Arg Tyr Gln Ala 740 74528749PRTAgrobacterium rhizogenes 28Met Ala Gly Ser Ser Phe Thr Leu Pro Ser Thr Gly Ser Ala Pro Leu1 5 10 15Asp Met Met Leu Ile Asp Asp Ser Asp Leu Leu Gln Leu Gly Leu Gln 20 25 30Gln Val Phe Ser Lys Arg Tyr Thr Glu Thr Pro Gln Ser Arg Tyr Lys 35 40 45Leu Thr Arg Arg Ala Ser Pro Asp Val Ser Ser Gly Glu Gly Asn Val 50 55 60His Ala Leu Ala Phe Ile Tyr Val Asn Ala Glu Thr Leu Gln Met Ile65 70 75 80Lys Asn Ala Arg Ser Leu Thr Glu Ala Asn Gly Val Lys Asp Leu Val 85 90 95Ala Ile Asp Val Pro Pro Phe Arg Asn Asp Phe Ser Arg Ala Leu Leu 100 105 110Leu Gln Val Ile Asn Leu Leu Gly Asn Asn Arg Asn Ala Asp Asp Asp 115 120 125Leu Ser His Phe Ile Ala Val Ala Leu Pro Asn Ser Ala Arg Ser Lys 130 135 140Ile Leu Thr Thr Ala Pro Phe Glu Gly Ser Leu Ser Glu Asn Phe Arg145 150 155 160Gly Phe Pro Ile Thr Arg Glu Gly Asn Val Ala Cys Glu Val Leu Ala 165 170 175Tyr Gly Asn Asn Leu Met Pro Lys Ala Cys Ser Asp Ser Phe Pro Thr 180 185 190Val Asp Leu Leu Tyr Asp Tyr Gly Lys Phe Phe Glu Ser Cys Ala Ala 195 200 205Asp Gly Arg Ile Gly Tyr Phe Pro Glu Gly Val Thr Lys Pro Lys Val 210 215 220Ala Ile Ile Gly Ala Gly Phe Ser Gly Leu Val Ala Ala Ser Glu Leu225 230 235 240Leu His Ala Gly Val Asp Asp Val Thr Val Tyr Glu Ala Ser Asp Arg 245 250 255Leu Gly Gly Lys Leu Trp Ser His Gly Phe Lys Ser Ala Pro Asn Val 260 265 270Ile Ala Glu Met Gly Ala Met Arg Phe Pro Arg Ser Glu Ser Cys Leu 275 280 285Phe Phe Tyr Leu Lys Lys His Gly Leu Asp Ser Val Gly Leu Phe Pro 290 295 300Asn Pro Gly Ser Val Asp Thr Ala Leu Phe Tyr Arg Gly Arg Gln Tyr305 310 315 320Ile Trp Lys Ala Gly Glu Glu Pro Pro Glu Leu Phe Arg Arg Val His 325 330 335His Gly Trp Arg Ala Phe Leu Gln Asp Gly Tyr Leu His Asp Gly Val 340 345 350Met Leu Ala Ser Pro Leu Ala Ile Val Asp Ala Leu Asn Leu Gly His 355 360 365Leu Gln Gln Ala His Gly Phe Trp Gln Ser Trp Leu Thr Tyr Phe Glu 370 375 380Arg Glu Ser Phe Ser Ser Gly Ile Glu Lys Met Phe Leu Gly Asn His385 390 395 400Pro Pro Gly Gly Glu Gln Trp Asn Ser Leu Asp Asp Leu Asp Leu Phe 405 410 415Lys Ala Leu Gly Ile Gly Ser Gly Gly Phe Gly Pro Val Phe Glu Ser 420 425 430Gly Phe Ile Glu Ile Leu Arg Leu Val Val Asn Gly Tyr Glu Asp Asn 435 440 445Val Arg Leu Ser Tyr Glu Gly Ile Ser Glu Leu Pro His Arg Ile Ala 450 455 460Ser Gln Val Ile Asn Gly Arg Ser Ile Arg Glu Arg Thr Ile His Val465 470 475 480Gln Val Glu Gln Ile Asp Arg Glu Glu Asp Lys Ile Asn Ile Lys Ile 485 490 495Lys Gly Gly Lys Val Glu Val Tyr Asp Arg Val Leu Val Thr Ser Gly 500 505 510Phe Ala Asn Ile Glu Met Arg His Leu Leu Thr Ser Ser Asn Ala Phe 515 520 525Phe His Ala Asp Val Ser His Ala Ile Gly Asn Ser His Met Thr Gly 530 535 540Ala Ser Lys Leu Phe Leu Leu Thr Asn Glu Lys Phe Trp Leu Gln His545 550 555 560His Leu Pro Ser Cys Ile Leu Thr Thr Gly Val Ala Lys Ala Val Tyr 565 570 575Cys Leu Asp Tyr Asp Pro Arg Asp Pro Ser Gly Lys Gly Leu Val Leu 580 585 590Ile Ser Tyr Thr Trp Glu Asp Asp Ser His Lys Leu Leu Ala Val Pro 595 600 605Asp Lys Arg Glu Arg Phe Ala Ser Leu Gln Arg Asp Ile Gly Arg Ala 610 615 620Phe Pro Asp Phe Ala Lys His Leu Thr Pro Ala Asp Gly Asn Tyr Asp625 630 635 640Asp Asn Ile Val Gln His Asp Trp Leu Thr Asp Pro His Ala Gly Gly 645 650 655Ala Phe Lys Leu Asn Arg Arg Gly Asn Asp Val Tyr Ser Glu Arg Leu 660 665 670Phe Phe Gln Pro Phe Asp Val Met His Pro Ala Asp Asp Lys Gly Leu 675 680 685Tyr Leu Ala Gly Cys Ser Cys Ser Phe Thr Gly Gly Trp Val His Gly 690 695 700Ala Ile Gln Thr Ala Cys Asn Ala Thr Cys Ala Ile Ile Tyr Gly Ser705 710 715 720Gly His Leu Gln Glu Leu Ile His Trp Arg His Leu Lys Glu Gly Asn 725 730 735Pro Leu Ala His Ala Trp Lys Arg Tyr Arg Tyr Gln Ala 740 745291401DNAAgrobacterium rhizogenesCDS(1)..(1398)coding for indoleacetamide hydrolase 29atg gtg acc ctc tcc tcg atc acc gag acg ctt aaa tgt ctc agg gaa 48Met Val Thr Leu Ser Ser Ile Thr Glu Thr Leu Lys Cys Leu Arg Glu1 5 10 15aga aaa tac tcg tgc ttt gag tta atc gaa acg ata ata gcc cgc tgt 96Arg Lys Tyr Ser Cys Phe Glu Leu Ile Glu Thr Ile Ile Ala Arg Cys 20 25 30gaa gca gca aga tcc tta aac gcc ttt ctg gaa acc gac tgg gcg cac 144Glu Ala Ala Arg Ser Leu Asn Ala Phe Leu Glu Thr Asp Trp Ala His 35 40 45cta cgg tgg act gcc agc aaa atc gat caa cac gga ggt gcc ggt gtt 192Leu Arg Trp Thr Ala Ser Lys Ile Asp Gln His Gly Gly Ala Gly Val 50 55 60ggc cta gct ggc gtt ccc cta tgc ttt aaa gcg aat att gcg aca ggc 240Gly Leu Ala Gly Val Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80agg ttc gcc gcg acc gct ggt acg cca ggc tta cag aac cac aaa ccc 288Arg Phe Ala Ala Thr Ala Gly Thr Pro Gly Leu Gln Asn His Lys Pro 85 90 95aag acg cct gcc gga gtt gca cga caa ctt ctc gcg gct ggg gca ctg 336Lys Thr Pro Ala Gly Val Ala Arg Gln Leu Leu Ala Ala Gly Ala Leu 100 105 110cct ggc gct tcg gga aac atg cac gaa ttg tct ttt ggg atc acg agc 384Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125aac aac ttc gcc aca ggc gcc gta cga aac ccg tgg aac cct agt ctc 432Asn Asn Phe Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140atc cca ggg gga tca agt ggg ggt gtg gcc gcc gcg gtg gcc ggc cga 480Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Gly Arg145 150 155 160ttg atg ctg ggc ggc gtc gga act gac acg gga gcg tcg gtc cgt tta 528Leu Met Leu Gly Gly Val Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175ccg gcc gcc ttg tgc ggc gtg gtg ggg ttt cgt cct acc gtg ggg cga 576Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Val Gly Arg 180 185 190tat cca acg gac gga ata gtt ccg gta agc ccc acc cgg gac acc cct 624Tyr Pro Thr Asp Gly Ile Val Pro Val Ser Pro Thr Arg Asp Thr Pro 195 200 205ggc gtt atc gca cag aat gtt ccg gac gtg att ctt ctt gac ggt atc 672Gly Val Ile Ala Gln Asn Val Pro Asp Val Ile Leu Leu Asp Gly Ile 210 215 220att tgc ggg aga ccg ccg gtt aat caa acg gtc cgc ctg aag ggg ctg 720Ile Cys Gly Arg Pro Pro Val Asn Gln Thr Val Arg Leu Lys Gly Leu225 230 235 240cgt ata ggc ttg cca acc gct tac ttt tac aac gac ctg gag ccc gat 768Arg Ile Gly Leu Pro Thr Ala Tyr Phe Tyr Asn Asp Leu Glu Pro Asp 245 250 255gtc gcc tta gca gcc gag acg att atc aga gtt ctg gca cgc aaa gat 816Val Ala Leu Ala Ala Glu Thr Ile Ile Arg Val Leu Ala Arg Lys Asp 260 265 270gtt act ttt gtt gaa gca gat att cct gat tta gcg cat cac aat gaa 864Val Thr Phe Val Glu Ala Asp Ile Pro Asp Leu Ala His His Asn Glu 275 280 285ggg gtc agc ttt ccg act gcc atc tac gaa ttt ccg ttg tcc ctt gaa 912Gly Val Ser Phe Pro Thr Ala Ile Tyr Glu Phe Pro Leu Ser Leu Glu 290 295 300cat tat att cag aac ttc gta gag ggt gtt tcc ttt tct gag gtt gtc 960His Tyr Ile Gln Asn Phe Val Glu Gly Val Ser Phe Ser Glu Val Val305 310 315 320aga gcg att cgc agt ccg gat gtt gca agt att ctc aat gca caa ctc 1008Arg Ala Ile Arg Ser Pro Asp Val Ala Ser Ile Leu Asn Ala Gln Leu 325 330 335tcg gat aat ctt att tcc aaa agc gag tat tgt ctg gcg cga cgt ttt 1056Ser Asp Asn Leu Ile Ser Lys Ser Glu Tyr Cys Leu Ala Arg Arg Phe 340 345 350ttc aga ccg aga ctc caa gcg gcc tac cac agt tac ttc aag gcg cat 1104Phe Arg Pro Arg Leu Gln Ala Ala Tyr His Ser Tyr Phe Lys Ala His 355 360 365cag cta gat gca att ctt ttc cca aca gct ccg ttg aca gcc aag cca 1152Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Thr Ala Lys Pro 370 375 380att ggc cat gat cta tcg gtg att cac aat ggc tca atg acc gat acc 1200Ile Gly His Asp Leu Ser Val Ile His Asn Gly Ser Met Thr Asp Thr385 390 395 400ttt aaa atc ttc gtg cgg aat gta gat ccc agc agt aat gcg ggc ctg 1248Phe Lys Ile Phe Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415ccg ggc cta agt ctt ccc gtt tct ctt agt tcc aac ggt ctg cct att 1296Pro Gly Leu Ser Leu Pro Val Ser Leu Ser Ser Asn Gly Leu Pro Ile 420 425 430ggc atg gaa atc gat ggc tct gca agc tcg gat gaa cgt ctg tta gca 1344Gly Met Glu Ile Asp Gly Ser Ala Ser Ser Asp Glu Arg Leu Leu Ala 435 440 445att gga cta gcg ata gaa gaa gca ata gac ttt agg cat cgt ccg act 1392Ile Gly Leu Ala Ile Glu Glu Ala Ile Asp Phe Arg His Arg Pro Thr 450 455 460ctg tcg taa 1401Leu Ser46530466PRTAgrobacterium rhizogenes 30Met Val Thr Leu Ser Ser Ile Thr Glu Thr Leu Lys Cys Leu Arg Glu1 5 10 15Arg Lys Tyr Ser Cys Phe Glu Leu Ile Glu Thr Ile Ile Ala Arg Cys 20 25 30Glu Ala Ala Arg Ser Leu Asn Ala Phe Leu Glu Thr Asp Trp Ala His 35 40 45Leu Arg Trp Thr Ala Ser Lys Ile Asp Gln His Gly Gly Ala Gly Val 50 55 60Gly Leu Ala Gly Val Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80Arg Phe Ala Ala Thr Ala Gly Thr Pro Gly Leu Gln Asn His Lys Pro 85 90 95Lys Thr Pro Ala Gly Val Ala Arg Gln Leu Leu Ala Ala Gly Ala Leu 100 105 110Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125Asn Asn Phe Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala

Ala Val Ala Gly Arg145 150 155 160Leu Met Leu Gly Gly Val Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Val Gly Arg 180 185 190Tyr Pro Thr Asp Gly Ile Val Pro Val Ser Pro Thr Arg Asp Thr Pro 195 200 205Gly Val Ile Ala Gln Asn Val Pro Asp Val Ile Leu Leu Asp Gly Ile 210 215 220Ile Cys Gly Arg Pro Pro Val Asn Gln Thr Val Arg Leu Lys Gly Leu225 230 235 240Arg Ile Gly Leu Pro Thr Ala Tyr Phe Tyr Asn Asp Leu Glu Pro Asp 245 250 255Val Ala Leu Ala Ala Glu Thr Ile Ile Arg Val Leu Ala Arg Lys Asp 260 265 270Val Thr Phe Val Glu Ala Asp Ile Pro Asp Leu Ala His His Asn Glu 275 280 285Gly Val Ser Phe Pro Thr Ala Ile Tyr Glu Phe Pro Leu Ser Leu Glu 290 295 300His Tyr Ile Gln Asn Phe Val Glu Gly Val Ser Phe Ser Glu Val Val305 310 315 320Arg Ala Ile Arg Ser Pro Asp Val Ala Ser Ile Leu Asn Ala Gln Leu 325 330 335Ser Asp Asn Leu Ile Ser Lys Ser Glu Tyr Cys Leu Ala Arg Arg Phe 340 345 350Phe Arg Pro Arg Leu Gln Ala Ala Tyr His Ser Tyr Phe Lys Ala His 355 360 365Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Thr Ala Lys Pro 370 375 380Ile Gly His Asp Leu Ser Val Ile His Asn Gly Ser Met Thr Asp Thr385 390 395 400Phe Lys Ile Phe Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415Pro Gly Leu Ser Leu Pro Val Ser Leu Ser Ser Asn Gly Leu Pro Ile 420 425 430Gly Met Glu Ile Asp Gly Ser Ala Ser Ser Asp Glu Arg Leu Leu Ala 435 440 445Ile Gly Leu Ala Ile Glu Glu Ala Ile Asp Phe Arg His Arg Pro Thr 450 455 460Leu Ser465312268DNAAgrobacterium tumefaciensCDS(1)..(2265)coding for tryptophan monooxygenase 31atg tca gct tca cct ctc ctt gat aac cag tgc gat cat ttc tct acc 48Met Ser Ala Ser Pro Leu Leu Asp Asn Gln Cys Asp His Phe Ser Thr1 5 10 15aaa atg gtg gat ctg ata atg gtc gat aag gct gat gaa ttg gac cgc 96Lys Met Val Asp Leu Ile Met Val Asp Lys Ala Asp Glu Leu Asp Arg 20 25 30agg gtt tcc gat gcc ttc tca gaa cgt gaa gct tct agg gga agg agg 144Arg Val Ser Asp Ala Phe Ser Glu Arg Glu Ala Ser Arg Gly Arg Arg 35 40 45att act caa atc tcc ggc gag tgc agc gct ggg tta gct tgc aaa agg 192Ile Thr Gln Ile Ser Gly Glu Cys Ser Ala Gly Leu Ala Cys Lys Arg 50 55 60ctg gcc gac ggt cgc ttt ccc gag atc tca act ggt gag aag gta gca 240Leu Ala Asp Gly Arg Phe Pro Glu Ile Ser Thr Gly Glu Lys Val Ala65 70 75 80gcc ctc tcc gct tac atc tat gtt ggc aag gaa att ctg ggg cgg ata 288Ala Leu Ser Ala Tyr Ile Tyr Val Gly Lys Glu Ile Leu Gly Arg Ile 85 90 95ctt gaa tcg gaa cct tgg gcg cga gca aga gtg agt ggt ctc gtt gcc 336Leu Glu Ser Glu Pro Trp Ala Arg Ala Arg Val Ser Gly Leu Val Ala 100 105 110atc gac ctt gca cca ttt tgt atg gat ttc tcc gaa gca caa ctt ctc 384Ile Asp Leu Ala Pro Phe Cys Met Asp Phe Ser Glu Ala Gln Leu Leu 115 120 125caa acc ctg ttt ttg ctg agc ggt aaa aga tgt gca tcc agc gat ctt 432Gln Thr Leu Phe Leu Leu Ser Gly Lys Arg Cys Ala Ser Ser Asp Leu 130 135 140agt cat ttc gtg gcc att tca atc tct aag act gcc cgc tcc cga acc 480Ser His Phe Val Ala Ile Ser Ile Ser Lys Thr Ala Arg Ser Arg Thr145 150 155 160ctg caa atg ccg ccg tac gag aaa ggc acg acg aaa cgc gtt acc ggg 528Leu Gln Met Pro Pro Tyr Glu Lys Gly Thr Thr Lys Arg Val Thr Gly 165 170 175ttt acc ctg acc ctt gaa gag gcc gta cca ttt gac atg gta gct tat 576Phe Thr Leu Thr Leu Glu Glu Ala Val Pro Phe Asp Met Val Ala Tyr 180 185 190ggt cga aac ctg atg ctg aag gct tcg gca ggt tcc ttt cca aca att 624Gly Arg Asn Leu Met Leu Lys Ala Ser Ala Gly Ser Phe Pro Thr Ile 195 200 205gac ttg ctc tat gac tac aga tcg ttt ttt gac caa tgt tcc gat att 672Asp Leu Leu Tyr Asp Tyr Arg Ser Phe Phe Asp Gln Cys Ser Asp Ile 210 215 220gga cgg atc ggc ttc ttt ccg gaa gat gtt cct aag ccg aaa gtg gcg 720Gly Arg Ile Gly Phe Phe Pro Glu Asp Val Pro Lys Pro Lys Val Ala225 230 235 240atc att ggc gct ggc att tcc gga ctc gtg gta gca agc gaa ctg ctt 768Ile Ile Gly Ala Gly Ile Ser Gly Leu Val Val Ala Ser Glu Leu Leu 245 250 255cat gct ggt gta gac gat gtt aca ata tat gaa gca agt gat cgg gtt 816His Ala Gly Val Asp Asp Val Thr Ile Tyr Glu Ala Ser Asp Arg Val 260 265 270gga ggc aag ctt tgg tca cat gct ttc aag gat gct ccc agc gtg gtg 864Gly Gly Lys Leu Trp Ser His Ala Phe Lys Asp Ala Pro Ser Val Val 275 280 285gcc gaa atg ggg gcg atg cga ttt cct cct gct gca tcg tgc ttg ttt 912Ala Glu Met Gly Ala Met Arg Phe Pro Pro Ala Ala Ser Cys Leu Phe 290 295 300ttc ttc ctc gag cgg tac ggc ctg tct tcg atg agg ccg ttc cca aat 960Phe Phe Leu Glu Arg Tyr Gly Leu Ser Ser Met Arg Pro Phe Pro Asn305 310 315 320ccc ggc aca gtc gac act aac ttg gtc tac caa ggc ctc cga tac gtg 1008Pro Gly Thr Val Asp Thr Asn Leu Val Tyr Gln Gly Leu Arg Tyr Val 325 330 335tgg aaa gcc ggg cag cag cca ccg aag ctg ttc cat cgc gtt tac agc 1056Trp Lys Ala Gly Gln Gln Pro Pro Lys Leu Phe His Arg Val Tyr Ser 340 345 350ggt tgg cgt gcg ttc ttg agg gac ggt ttc cat gag gga gat att gtg 1104Gly Trp Arg Ala Phe Leu Arg Asp Gly Phe His Glu Gly Asp Ile Val 355 360 365ttg gct tcg cct gtt gtt att act caa gcc ttg aaa tca gga gac att 1152Leu Ala Ser Pro Val Val Ile Thr Gln Ala Leu Lys Ser Gly Asp Ile 370 375 380agg cgg gct cat gac tcc tgg caa act tgg ctg aac cgt ttc ggg agg 1200Arg Arg Ala His Asp Ser Trp Gln Thr Trp Leu Asn Arg Phe Gly Arg385 390 395 400gag tcc ttc tct tca gcg ata gag agg atc ttt ctg ggc acg cat cct 1248Glu Ser Phe Ser Ser Ala Ile Glu Arg Ile Phe Leu Gly Thr His Pro 405 410 415cct ggt ggt gaa aca tgg agt ttc cct cat gat tgg gac cta ttc aag 1296Pro Gly Gly Glu Thr Trp Ser Phe Pro His Asp Trp Asp Leu Phe Lys 420 425 430cta atg gga ata gga tct ggc ggg ttt ggt cca gtt ttt gaa agc ggg 1344Leu Met Gly Ile Gly Ser Gly Gly Phe Gly Pro Val Phe Glu Ser Gly 435 440 445ttt att gag atc ctt cgc ttg gtc ata aac gga tat gaa gaa aat cag 1392Phe Ile Glu Ile Leu Arg Leu Val Ile Asn Gly Tyr Glu Glu Asn Gln 450 455 460cgg atg tgc tct gaa gga atc tca gaa ctt cca cgt cga ata gcc tct 1440Arg Met Cys Ser Glu Gly Ile Ser Glu Leu Pro Arg Arg Ile Ala Ser465 470 475 480caa gtg gtt aac ggt gtg tct gta agc cag cgt ata cgc cat gtt caa 1488Gln Val Val Asn Gly Val Ser Val Ser Gln Arg Ile Arg His Val Gln 485 490 495gtc agg gcg att gag aag gaa aag aca aaa ata aag ata agg ctt aag 1536Val Arg Ala Ile Glu Lys Glu Lys Thr Lys Ile Lys Ile Arg Leu Lys 500 505 510agc ggg ata tct gaa ctt tat gat aag gtg gtg gtt aca tct gga ctc 1584Ser Gly Ile Ser Glu Leu Tyr Asp Lys Val Val Val Thr Ser Gly Leu 515 520 525gca aat atc caa ctc agg cat tgt ctg aca tgc gat acc acc att ttt 1632Ala Asn Ile Gln Leu Arg His Cys Leu Thr Cys Asp Thr Thr Ile Phe 530 535 540cgt gca cca gtg aac caa gcg gtt gat aac agc cat atg aca ggc tcg 1680Arg Ala Pro Val Asn Gln Ala Val Asp Asn Ser His Met Thr Gly Ser545 550 555 560tca aaa ctc ttt ctg ctg act gaa cga aaa ttt tgg tta gac cat atc 1728Ser Lys Leu Phe Leu Leu Thr Glu Arg Lys Phe Trp Leu Asp His Ile 565 570 575ctc ccg tcc tgt gtc ctc atg gac ggg atc gca aaa gca gtg tac tgc 1776Leu Pro Ser Cys Val Leu Met Asp Gly Ile Ala Lys Ala Val Tyr Cys 580 585 590ttg gac tat gag ccg cag gat ccg aat ggt aaa ggt ctg gtg ccc ccc 1824Leu Asp Tyr Glu Pro Gln Asp Pro Asn Gly Lys Gly Leu Val Pro Pro 595 600 605act tat aca tgg gag gac gac tcc cac aag ctg ttg gcg gtt ccc gac 1872Thr Tyr Thr Trp Glu Asp Asp Ser His Lys Leu Leu Ala Val Pro Asp 610 615 620aaa aaa gag cga ttc tgt ctg ctg cgg gac gca att tcg aga tct ttc 1920Lys Lys Glu Arg Phe Cys Leu Leu Arg Asp Ala Ile Ser Arg Ser Phe625 630 635 640ccg gcg ttt gcc cag cat cta gtt cct gcc tgc gct gat tac gac caa 1968Pro Ala Phe Ala Gln His Leu Val Pro Ala Cys Ala Asp Tyr Asp Gln 645 650 655aat gtt gtt caa cat gat tgg ctt aca gac gag aat gcc ggg gga gct 2016Asn Val Val Gln His Asp Trp Leu Thr Asp Glu Asn Ala Gly Gly Ala 660 665 670ttc aaa ctc aac cgg cgt ggc gag gat ttt tat tct gaa gaa ctt ttc 2064Phe Lys Leu Asn Arg Arg Gly Glu Asp Phe Tyr Ser Glu Glu Leu Phe 675 680 685ttt caa gcg ctg gac atg cct aat gat acc gga gtt tac ttg gcg ggt 2112Phe Gln Ala Leu Asp Met Pro Asn Asp Thr Gly Val Tyr Leu Ala Gly 690 695 700tgc agt tgt tcc ttc acc ggt gga tgg gtg gag ggc gct att cag acc 2160Cys Ser Cys Ser Phe Thr Gly Gly Trp Val Glu Gly Ala Ile Gln Thr705 710 715 720gcg tgt aac gcc gtc tgt gca att atc cac aat tgt gga ggt att ttg 2208Ala Cys Asn Ala Val Cys Ala Ile Ile His Asn Cys Gly Gly Ile Leu 725 730 735gca aag gac aat cct ctc gaa cac tct tgg aag aga tat aac tac cgc 2256Ala Lys Asp Asn Pro Leu Glu His Ser Trp Lys Arg Tyr Asn Tyr Arg 740 745 750aat aga aat taa 2268Asn Arg Asn 75532755PRTAgrobacterium tumefaciens 32Met Ser Ala Ser Pro Leu Leu Asp Asn Gln Cys Asp His Phe Ser Thr1 5 10 15Lys Met Val Asp Leu Ile Met Val Asp Lys Ala Asp Glu Leu Asp Arg 20 25 30Arg Val Ser Asp Ala Phe Ser Glu Arg Glu Ala Ser Arg Gly Arg Arg 35 40 45Ile Thr Gln Ile Ser Gly Glu Cys Ser Ala Gly Leu Ala Cys Lys Arg 50 55 60Leu Ala Asp Gly Arg Phe Pro Glu Ile Ser Thr Gly Glu Lys Val Ala65 70 75 80Ala Leu Ser Ala Tyr Ile Tyr Val Gly Lys Glu Ile Leu Gly Arg Ile 85 90 95Leu Glu Ser Glu Pro Trp Ala Arg Ala Arg Val Ser Gly Leu Val Ala 100 105 110Ile Asp Leu Ala Pro Phe Cys Met Asp Phe Ser Glu Ala Gln Leu Leu 115 120 125Gln Thr Leu Phe Leu Leu Ser Gly Lys Arg Cys Ala Ser Ser Asp Leu 130 135 140Ser His Phe Val Ala Ile Ser Ile Ser Lys Thr Ala Arg Ser Arg Thr145 150 155 160Leu Gln Met Pro Pro Tyr Glu Lys Gly Thr Thr Lys Arg Val Thr Gly 165 170 175Phe Thr Leu Thr Leu Glu Glu Ala Val Pro Phe Asp Met Val Ala Tyr 180 185 190Gly Arg Asn Leu Met Leu Lys Ala Ser Ala Gly Ser Phe Pro Thr Ile 195 200 205Asp Leu Leu Tyr Asp Tyr Arg Ser Phe Phe Asp Gln Cys Ser Asp Ile 210 215 220Gly Arg Ile Gly Phe Phe Pro Glu Asp Val Pro Lys Pro Lys Val Ala225 230 235 240Ile Ile Gly Ala Gly Ile Ser Gly Leu Val Val Ala Ser Glu Leu Leu 245 250 255His Ala Gly Val Asp Asp Val Thr Ile Tyr Glu Ala Ser Asp Arg Val 260 265 270Gly Gly Lys Leu Trp Ser His Ala Phe Lys Asp Ala Pro Ser Val Val 275 280 285Ala Glu Met Gly Ala Met Arg Phe Pro Pro Ala Ala Ser Cys Leu Phe 290 295 300Phe Phe Leu Glu Arg Tyr Gly Leu Ser Ser Met Arg Pro Phe Pro Asn305 310 315 320Pro Gly Thr Val Asp Thr Asn Leu Val Tyr Gln Gly Leu Arg Tyr Val 325 330 335Trp Lys Ala Gly Gln Gln Pro Pro Lys Leu Phe His Arg Val Tyr Ser 340 345 350Gly Trp Arg Ala Phe Leu Arg Asp Gly Phe His Glu Gly Asp Ile Val 355 360 365Leu Ala Ser Pro Val Val Ile Thr Gln Ala Leu Lys Ser Gly Asp Ile 370 375 380Arg Arg Ala His Asp Ser Trp Gln Thr Trp Leu Asn Arg Phe Gly Arg385 390 395 400Glu Ser Phe Ser Ser Ala Ile Glu Arg Ile Phe Leu Gly Thr His Pro 405 410 415Pro Gly Gly Glu Thr Trp Ser Phe Pro His Asp Trp Asp Leu Phe Lys 420 425 430Leu Met Gly Ile Gly Ser Gly Gly Phe Gly Pro Val Phe Glu Ser Gly 435 440 445Phe Ile Glu Ile Leu Arg Leu Val Ile Asn Gly Tyr Glu Glu Asn Gln 450 455 460Arg Met Cys Ser Glu Gly Ile Ser Glu Leu Pro Arg Arg Ile Ala Ser465 470 475 480Gln Val Val Asn Gly Val Ser Val Ser Gln Arg Ile Arg His Val Gln 485 490 495Val Arg Ala Ile Glu Lys Glu Lys Thr Lys Ile Lys Ile Arg Leu Lys 500 505 510Ser Gly Ile Ser Glu Leu Tyr Asp Lys Val Val Val Thr Ser Gly Leu 515 520 525Ala Asn Ile Gln Leu Arg His Cys Leu Thr Cys Asp Thr Thr Ile Phe 530 535 540Arg Ala Pro Val Asn Gln Ala Val Asp Asn Ser His Met Thr Gly Ser545 550 555 560Ser Lys Leu Phe Leu Leu Thr Glu Arg Lys Phe Trp Leu Asp His Ile 565 570 575Leu Pro Ser Cys Val Leu Met Asp Gly Ile Ala Lys Ala Val Tyr Cys 580 585 590Leu Asp Tyr Glu Pro Gln Asp Pro Asn Gly Lys Gly Leu Val Pro Pro 595 600 605Thr Tyr Thr Trp Glu Asp Asp Ser His Lys Leu Leu Ala Val Pro Asp 610 615 620Lys Lys Glu Arg Phe Cys Leu Leu Arg Asp Ala Ile Ser Arg Ser Phe625 630 635 640Pro Ala Phe Ala Gln His Leu Val Pro Ala Cys Ala Asp Tyr Asp Gln 645 650 655Asn Val Val Gln His Asp Trp Leu Thr Asp Glu Asn Ala Gly Gly Ala 660 665 670Phe Lys Leu Asn Arg Arg Gly Glu Asp Phe Tyr Ser Glu Glu Leu Phe 675 680 685Phe Gln Ala Leu Asp Met Pro Asn Asp Thr Gly Val Tyr Leu Ala Gly 690 695 700Cys Ser Cys Ser Phe Thr Gly Gly Trp Val Glu Gly Ala Ile Gln Thr705 710 715 720Ala Cys Asn Ala Val Cys Ala Ile Ile His Asn Cys Gly Gly Ile Leu 725 730 735Ala Lys Asp Asn Pro Leu Glu His Ser Trp Lys Arg Tyr Asn Tyr Arg 740 745 750Asn Arg Asn 755331404DNAAgrobacterium tumefaciensCDS(1)..(1401)coding for indoleacetamide hydrolase 33atg gtg ccc att acc tcg tta gca caa acc cta gaa cgc ctg aga cgg 48Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15aaa gac tac tcc tgc tta gaa cta gta gaa act ctg ata gcg cgt tgc 96Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30caa gct gca aaa cca tta aat gcc ctt ctg gct aca gac tgg gat ggc 144Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45ttg cgg cga agc gcc aaa aaa aat gat cgt cat gga aac gcc gga tta 192Leu Arg Arg Ser Ala Lys Lys Asn Asp Arg His Gly Asn Ala Gly Leu 50 55 60ggt ctt tgc ggc att cca ctc tgt ttt aag gcg aac atc gcg acc ggc 240Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80gta ttt cct aca agc gct gct act ccg gcg ctg ata aac cac ttg cca 288Val Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90

95aag ata cca tcc cgc gtc gca gaa aga ctt ttt tca gct gga gca ctg 336Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110ccg ggt gcc tcg gga aac atg cat gag tta tcg ttt gga att acg agc 384Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125aac aac tat gcc acc ggt gcg gtg cgg aac ccg tgg aat cca agt ctg 432Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140ata cca ggg ggt tca agc ggt ggt gtg gct gct gcg gtg gca agc cga 480Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160ttg atg tta ggc ggc ata ggc acg gat acc ggt gca tct gtt cgc cta 528Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175ccg gca gcc ctg tgt ggc gta gta gga ttt cga ccg acg ctt ggt cga 576Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Gly Arg 180 185 190tat cca aga gat cgg ata ata ccg ttc agc ccc acc cgg gac acc gcc 624Tyr Pro Arg Asp Arg Ile Ile Pro Phe Ser Pro Thr Arg Asp Thr Ala 195 200 205gga atc ata gcg cag tgc gta gcc gat gtt ata atc ctc gac cag gtg 672Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220att tcc gga cgg tcg gcg aaa att tca ccc atg ccg ctg aag ggg ctt 720Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240cgg atc ggc ctc ccc act acc tac ttt tac gat gac ctt gat gct gat 768Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255gtg gcc ttc gca gct gaa acg acg att cgc ttg cta gcc aac aga ggc 816Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270gta acc ttt gtt gaa gcc gac atc ccc cac cta gag gaa ttg aac agt 864Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285ggg gca agt ttg cca att gcg ctt tac gaa ttt cca cac gct cta aaa 912Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300aag tat ctc gac gat ttt gtg gga aca gtt tct ttt tct gac gtt atc 960Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320aaa gga att cgt agc ccc gat gta gcg aac att gtc agt gcg caa att 1008Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335gat ggg cat caa att tcc aac gat gaa tat gaa ctg gcg cgt caa tcc 1056Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350ttc agg cca agg ctc cag gcc act tat cgg aat tac ttc aga ctc tat 1104Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365cag tta gat gca atc ctt ttc cca act gca ccc tta gcg gcc aaa gcc 1152Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380ata ggt cag gag tcg tca gtc atc cac aat ggc tca atg atg aac act 1200Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Met Asn Thr385 390 395 400ttc aag atc tac gtg cga aat gtg gac cca agc agc aac gca ggc cta 1248Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415cct ggg ttg agc ctt cct gcc tgc ctt aca cct gat cgc ttg cct gtt 1296Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430gga atg gaa att gat gga tta gcg ggg tca gac cac cgt ctg tta gca 1344Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445atc ggg gca gca tta gaa aaa gct ata aat ttt tct tcc ttt ccc gat 1392Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Ser Ser Phe Pro Asp 450 455 460gct ttt aat tag 1404Ala Phe Asn46534467PRTAgrobacterium tumefaciens 34Met Val Pro Ile Thr Ser Leu Ala Gln Thr Leu Glu Arg Leu Arg Arg1 5 10 15Lys Asp Tyr Ser Cys Leu Glu Leu Val Glu Thr Leu Ile Ala Arg Cys 20 25 30Gln Ala Ala Lys Pro Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Gly 35 40 45Leu Arg Arg Ser Ala Lys Lys Asn Asp Arg His Gly Asn Ala Gly Leu 50 55 60Gly Leu Cys Gly Ile Pro Leu Cys Phe Lys Ala Asn Ile Ala Thr Gly65 70 75 80Val Phe Pro Thr Ser Ala Ala Thr Pro Ala Leu Ile Asn His Leu Pro 85 90 95Lys Ile Pro Ser Arg Val Ala Glu Arg Leu Phe Ser Ala Gly Ala Leu 100 105 110Pro Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125Asn Asn Tyr Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175Pro Ala Ala Leu Cys Gly Val Val Gly Phe Arg Pro Thr Leu Gly Arg 180 185 190Tyr Pro Arg Asp Arg Ile Ile Pro Phe Ser Pro Thr Arg Asp Thr Ala 195 200 205Gly Ile Ile Ala Gln Cys Val Ala Asp Val Ile Ile Leu Asp Gln Val 210 215 220Ile Ser Gly Arg Ser Ala Lys Ile Ser Pro Met Pro Leu Lys Gly Leu225 230 235 240Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255Val Ala Phe Ala Ala Glu Thr Thr Ile Arg Leu Leu Ala Asn Arg Gly 260 265 270Val Thr Phe Val Glu Ala Asp Ile Pro His Leu Glu Glu Leu Asn Ser 275 280 285Gly Ala Ser Leu Pro Ile Ala Leu Tyr Glu Phe Pro His Ala Leu Lys 290 295 300Lys Tyr Leu Asp Asp Phe Val Gly Thr Val Ser Phe Ser Asp Val Ile305 310 315 320Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Val Ser Ala Gln Ile 325 330 335Asp Gly His Gln Ile Ser Asn Asp Glu Tyr Glu Leu Ala Arg Gln Ser 340 345 350Phe Arg Pro Arg Leu Gln Ala Thr Tyr Arg Asn Tyr Phe Arg Leu Tyr 355 360 365Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Ala Ala Lys Ala 370 375 380Ile Gly Gln Glu Ser Ser Val Ile His Asn Gly Ser Met Met Asn Thr385 390 395 400Phe Lys Ile Tyr Val Arg Asn Val Asp Pro Ser Ser Asn Ala Gly Leu 405 410 415Pro Gly Leu Ser Leu Pro Ala Cys Leu Thr Pro Asp Arg Leu Pro Val 420 425 430Gly Met Glu Ile Asp Gly Leu Ala Gly Ser Asp His Arg Leu Leu Ala 435 440 445Ile Gly Ala Ala Leu Glu Lys Ala Ile Asn Phe Ser Ser Phe Pro Asp 450 455 460Ala Phe Asn465351419DNAAgrobacterium vitisCDS(1)..(1416)coding for indoleacetamide hydrolase 35atg gtg acc cta ggt tca atc aag gaa acc ctg gaa tgt ctc agg ctg 48Met Val Thr Leu Gly Ser Ile Lys Glu Thr Leu Glu Cys Leu Arg Leu1 5 10 15aaa aaa tac tcc tgt tcc gaa ctg gct gaa acc ata ata gcc cgt tgc 96Lys Lys Tyr Ser Cys Ser Glu Leu Ala Glu Thr Ile Ile Ala Arg Cys 20 25 30gaa gcc gcg aaa tct ctc aat gct ctt ctg gcg act gac tgg gat tac 144Glu Ala Ala Lys Ser Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Tyr 35 40 45ctg cgg cgt aat gcc aag aaa gta gat gaa gat gga agc gcc ggc gag 192Leu Arg Arg Asn Ala Lys Lys Val Asp Glu Asp Gly Ser Ala Gly Glu 50 55 60ggt ctt gcc ggc atc ccg ctg tgt tct aaa gcg aac att gca aca ggc 240Gly Leu Ala Gly Ile Pro Leu Cys Ser Lys Ala Asn Ile Ala Thr Gly65 70 75 80ata ttc cca gca agc gcg gcc acg ccg gcg ctt gat gaa cat tta cct 288Ile Phe Pro Ala Ser Ala Ala Thr Pro Ala Leu Asp Glu His Leu Pro 85 90 95aca aca cca gcc ggc gtc cgt aaa ccg ctt cta gac gct ggg gca ctg 336Thr Thr Pro Ala Gly Val Arg Lys Pro Leu Leu Asp Ala Gly Ala Leu 100 105 110ata ggc gct tcg gga aac atg cat gag tta tcg ttt ggc att acc agt 384Ile Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125aac aac cac gcc act ggt gcg gtg aga aac ccc tgg aat ccc agc tta 432Asn Asn His Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140ata cca gga ggc tcg agc ggc ggc gtg gct gct gct gta gca tca cgg 480Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160tta atg ctc ggc gga att ggc acc gac acg ggg gct tcg gtc cgc cta 528Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175cct gca tcc cta tgt ggc gta gtg gga ttc cgc ccg acg atc ggc aga 576Pro Ala Ser Leu Cys Gly Val Val Gly Phe Arg Pro Thr Ile Gly Arg 180 185 190tat cct gga gac cga att gtg ccg gtt agc ccc acc cgc gat aca gcc 624Tyr Pro Gly Asp Arg Ile Val Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205gga att atc gca cag agc gtt cct gat gtg ata ctc ctt gac caa atc 672Gly Ile Ile Ala Gln Ser Val Pro Asp Val Ile Leu Leu Asp Gln Ile 210 215 220att tgc ggg aag ctc acg acc cac caa cct gta ccc ctg gag gga tta 720Ile Cys Gly Lys Leu Thr Thr His Gln Pro Val Pro Leu Glu Gly Leu225 230 235 240cgt atc ggc ttg cca acc act tac ttt tac gat gac ctt gat gct gat 768Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255gtg gcc ttc gca gct gaa aac ctt atc acg ctg ctg gcc agc aag ggt 816Val Ala Phe Ala Ala Glu Asn Leu Ile Thr Leu Leu Ala Ser Lys Gly 260 265 270gta acc ttt gtt aag gcc gag att cca gat ctg cag cgt ctg aac atc 864Val Thr Phe Val Lys Ala Glu Ile Pro Asp Leu Gln Arg Leu Asn Ile 275 280 285ggg gtt agc ttt cct att gcc ctg tac gag ttt ccg ttc gcc cta caa 912Gly Val Ser Phe Pro Ile Ala Leu Tyr Glu Phe Pro Phe Ala Leu Gln 290 295 300aag tat atc gat gac ttt gtg aag gat gtg tct ttt tct gac gtc atc 960Lys Tyr Ile Asp Asp Phe Val Lys Asp Val Ser Phe Ser Asp Val Ile305 310 315 320aaa gga att cgt agc cct gat gta gcc aac att gcc aat gct caa att 1008Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Ala Asn Ala Gln Ile 325 330 335gat gga cat caa att tcc aaa gct tca tat gaa ctg gcg cga caa tct 1056Asp Gly His Gln Ile Ser Lys Ala Ser Tyr Glu Leu Ala Arg Gln Ser 340 345 350ttc aga cca aag ctg caa gcc gcc tac cat gat tac ttc aag ctg cac 1104Phe Arg Pro Lys Leu Gln Ala Ala Tyr His Asp Tyr Phe Lys Leu His 355 360 365cag cta gac gcg atc ctt ttc ccg aca gct ccc ctg aca gcc aaa ccg 1152Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Thr Ala Lys Pro 370 375 380atc ggc caa gat tta tcg gtg atg cac aat ggc gta atg gcc gac acg 1200Ile Gly Gln Asp Leu Ser Val Met His Asn Gly Val Met Ala Asp Thr385 390 395 400ttt aaa atc ttc gtg cga aat gtg gat ccg ggg agc aac gca ggc ctg 1248Phe Lys Ile Phe Val Arg Asn Val Asp Pro Gly Ser Asn Ala Gly Leu 405 410 415cca gga tta agc ctt ccc gtt tct ctt act tca aag ggt ttg cct att 1296Pro Gly Leu Ser Leu Pro Val Ser Leu Thr Ser Lys Gly Leu Pro Ile 420 425 430gga atg gaa atc gat gga tta gcg ggc atg gac gac cgt ttg cta gca 1344Gly Met Glu Ile Asp Gly Leu Ala Gly Met Asp Asp Arg Leu Leu Ala 435 440 445atc gga gcg gca cta gag gaa gcg ata gct ttt cat aat tta cct gac 1392Ile Gly Ala Ala Leu Glu Glu Ala Ile Ala Phe His Asn Leu Pro Asp 450 455 460ttc ccg aaa gtc gag aca aac tac tga 1419Phe Pro Lys Val Glu Thr Asn Tyr465 47036472PRTAgrobacterium vitis 36Met Val Thr Leu Gly Ser Ile Lys Glu Thr Leu Glu Cys Leu Arg Leu1 5 10 15Lys Lys Tyr Ser Cys Ser Glu Leu Ala Glu Thr Ile Ile Ala Arg Cys 20 25 30Glu Ala Ala Lys Ser Leu Asn Ala Leu Leu Ala Thr Asp Trp Asp Tyr 35 40 45Leu Arg Arg Asn Ala Lys Lys Val Asp Glu Asp Gly Ser Ala Gly Glu 50 55 60Gly Leu Ala Gly Ile Pro Leu Cys Ser Lys Ala Asn Ile Ala Thr Gly65 70 75 80Ile Phe Pro Ala Ser Ala Ala Thr Pro Ala Leu Asp Glu His Leu Pro 85 90 95Thr Thr Pro Ala Gly Val Arg Lys Pro Leu Leu Asp Ala Gly Ala Leu 100 105 110Ile Gly Ala Ser Gly Asn Met His Glu Leu Ser Phe Gly Ile Thr Ser 115 120 125Asn Asn His Ala Thr Gly Ala Val Arg Asn Pro Trp Asn Pro Ser Leu 130 135 140Ile Pro Gly Gly Ser Ser Gly Gly Val Ala Ala Ala Val Ala Ser Arg145 150 155 160Leu Met Leu Gly Gly Ile Gly Thr Asp Thr Gly Ala Ser Val Arg Leu 165 170 175Pro Ala Ser Leu Cys Gly Val Val Gly Phe Arg Pro Thr Ile Gly Arg 180 185 190Tyr Pro Gly Asp Arg Ile Val Pro Val Ser Pro Thr Arg Asp Thr Ala 195 200 205Gly Ile Ile Ala Gln Ser Val Pro Asp Val Ile Leu Leu Asp Gln Ile 210 215 220Ile Cys Gly Lys Leu Thr Thr His Gln Pro Val Pro Leu Glu Gly Leu225 230 235 240Arg Ile Gly Leu Pro Thr Thr Tyr Phe Tyr Asp Asp Leu Asp Ala Asp 245 250 255Val Ala Phe Ala Ala Glu Asn Leu Ile Thr Leu Leu Ala Ser Lys Gly 260 265 270Val Thr Phe Val Lys Ala Glu Ile Pro Asp Leu Gln Arg Leu Asn Ile 275 280 285Gly Val Ser Phe Pro Ile Ala Leu Tyr Glu Phe Pro Phe Ala Leu Gln 290 295 300Lys Tyr Ile Asp Asp Phe Val Lys Asp Val Ser Phe Ser Asp Val Ile305 310 315 320Lys Gly Ile Arg Ser Pro Asp Val Ala Asn Ile Ala Asn Ala Gln Ile 325 330 335Asp Gly His Gln Ile Ser Lys Ala Ser Tyr Glu Leu Ala Arg Gln Ser 340 345 350Phe Arg Pro Lys Leu Gln Ala Ala Tyr His Asp Tyr Phe Lys Leu His 355 360 365Gln Leu Asp Ala Ile Leu Phe Pro Thr Ala Pro Leu Thr Ala Lys Pro 370 375 380Ile Gly Gln Asp Leu Ser Val Met His Asn Gly Val Met Ala Asp Thr385 390 395 400Phe Lys Ile Phe Val Arg Asn Val Asp Pro Gly Ser Asn Ala Gly Leu 405 410 415Pro Gly Leu Ser Leu Pro Val Ser Leu Thr Ser Lys Gly Leu Pro Ile 420 425 430Gly Met Glu Ile Asp Gly Leu Ala Gly Met Asp Asp Arg Leu Leu Ala 435 440 445Ile Gly Ala Ala Leu Glu Glu Ala Ile Ala Phe His Asn Leu Pro Asp 450 455 460Phe Pro Lys Val Glu Thr Asn Tyr465 470371263DNAArabidopsis thalianaCDS(1)..(1260)coding for 5-methylthioribose kinase 37atg tct ttt gag gag ttt acg ccg tta aac gag aag tct ctt gta gac 48Met Ser Phe Glu Glu Phe Thr Pro Leu Asn Glu Lys Ser Leu Val Asp1 5 10 15tac atc aag tca aca cct gct ctc tct tcc aag atc gga gcc gac aag 96Tyr Ile Lys Ser Thr Pro Ala Leu Ser Ser Lys Ile Gly Ala Asp Lys 20 25 30tcc gat gat gat ttg gtt atc aaa gaa gtt gga gat ggc aat ctc aat 144Ser Asp Asp Asp Leu Val Ile Lys Glu Val Gly Asp Gly Asn Leu Asn 35 40 45ttc gtt ttc atc gtt gtt gga tcc tct ggt tct ctt gtc atc aaa cag 192Phe Val Phe Ile Val Val Gly Ser Ser Gly Ser Leu Val Ile Lys Gln 50 55 60gct ctt cca tat att cgc tgt atc ggt gaa tca tgg cca atg acg aaa 240Ala Leu Pro Tyr Ile Arg Cys Ile Gly Glu Ser Trp Pro Met Thr Lys65 70 75 80gaa aga gct tat ttt gaa gca aca act ttg aga aag cat gga aat tta 288Glu Arg Ala Tyr Phe Glu Ala Thr Thr Leu Arg

Lys His Gly Asn Leu 85 90 95tca cct gat cat gtt cct gaa gtc tac cat ttt gac aga aca atg gcg 336Ser Pro Asp His Val Pro Glu Val Tyr His Phe Asp Arg Thr Met Ala 100 105 110ttg att gga atg aga tac ctt gag cct cct cat atc att ctc cgc aaa 384Leu Ile Gly Met Arg Tyr Leu Glu Pro Pro His Ile Ile Leu Arg Lys 115 120 125gga ctc att gct ggg att gag tat cct ttc ctc gca gac cac atg tct 432Gly Leu Ile Ala Gly Ile Glu Tyr Pro Phe Leu Ala Asp His Met Ser 130 135 140gat tac atg gcg aag act ctc ttc ttc act tct ctc ctc tat cac gat 480Asp Tyr Met Ala Lys Thr Leu Phe Phe Thr Ser Leu Leu Tyr His Asp145 150 155 160acc aca gag cac aga aga gca gta acc gaa ttt tgt ggt aat gtg gag 528Thr Thr Glu His Arg Arg Ala Val Thr Glu Phe Cys Gly Asn Val Glu 165 170 175tta tgc cga tta acg gag caa gtt gtg ttt tcg gac cca tat aga gtt 576Leu Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp Pro Tyr Arg Val 180 185 190tcc aca ttt aat cgt tgg act tca cct tat ctt gat gat gat gct aag 624Ser Thr Phe Asn Arg Trp Thr Ser Pro Tyr Leu Asp Asp Asp Ala Lys 195 200 205gct gtg cgc gaa gac agt gcc ttg aag ctc gaa atc gca gag cta aaa 672Ala Val Arg Glu Asp Ser Ala Leu Lys Leu Glu Ile Ala Glu Leu Lys 210 215 220tcg atg ttc tgt gaa aga gct caa gct tta ata cat ggt gat ctt cat 720Ser Met Phe Cys Glu Arg Ala Gln Ala Leu Ile His Gly Asp Leu His225 230 235 240act ggt tct gtc atg gtt act caa gat tca acg caa gtt ata gat cca 768Thr Gly Ser Val Met Val Thr Gln Asp Ser Thr Gln Val Ile Asp Pro 245 250 255gag ttt tcg ttc tat gga ccg atg ggt ttc gat att ggc gct tat ctt 816Glu Phe Ser Phe Tyr Gly Pro Met Gly Phe Asp Ile Gly Ala Tyr Leu 260 265 270ggt aac ttg ata cta gct ttc ttt gca caa gat gga cac gcc act cag 864Gly Asn Leu Ile Leu Ala Phe Phe Ala Gln Asp Gly His Ala Thr Gln 275 280 285gaa aat gat cga aaa gaa tac aag cag tgg atc ttg aga acc att gag 912Glu Asn Asp Arg Lys Glu Tyr Lys Gln Trp Ile Leu Arg Thr Ile Glu 290 295 300caa act tgg aat ttg ttt aac aaa agg ttc att gcg cta tgg gat caa 960Gln Thr Trp Asn Leu Phe Asn Lys Arg Phe Ile Ala Leu Trp Asp Gln305 310 315 320aac aaa gat gga cca ggc gaa gca tac ctt gca gat atc tat aac aat 1008Asn Lys Asp Gly Pro Gly Glu Ala Tyr Leu Ala Asp Ile Tyr Asn Asn 325 330 335acc gag gtt ttg aag ttt gtt caa gaa aac tac atg agg aat ttg ttg 1056Thr Glu Val Leu Lys Phe Val Gln Glu Asn Tyr Met Arg Asn Leu Leu 340 345 350cat gac tca ctc gga ttc ggc gct gca aag atg att agg aga att gtg 1104His Asp Ser Leu Gly Phe Gly Ala Ala Lys Met Ile Arg Arg Ile Val 355 360 365gga gtg gca cat gtt gag gac ttt gaa tca atc gaa gaa gat aag cga 1152Gly Val Ala His Val Glu Asp Phe Glu Ser Ile Glu Glu Asp Lys Arg 370 375 380aga gct att tgc gag aga agt gca ctc gag ttt gcg aag atg ctt ctc 1200Arg Ala Ile Cys Glu Arg Ser Ala Leu Glu Phe Ala Lys Met Leu Leu385 390 395 400aag gaa agg aga aag ttt aag agt atc ggt gaa gtt gtt tca gca att 1248Lys Glu Arg Arg Lys Phe Lys Ser Ile Gly Glu Val Val Ser Ala Ile 405 410 415caa caa caa agc taa 1263Gln Gln Gln Ser 42038420PRTArabidopsis thaliana 38Met Ser Phe Glu Glu Phe Thr Pro Leu Asn Glu Lys Ser Leu Val Asp1 5 10 15Tyr Ile Lys Ser Thr Pro Ala Leu Ser Ser Lys Ile Gly Ala Asp Lys 20 25 30Ser Asp Asp Asp Leu Val Ile Lys Glu Val Gly Asp Gly Asn Leu Asn 35 40 45Phe Val Phe Ile Val Val Gly Ser Ser Gly Ser Leu Val Ile Lys Gln 50 55 60Ala Leu Pro Tyr Ile Arg Cys Ile Gly Glu Ser Trp Pro Met Thr Lys65 70 75 80Glu Arg Ala Tyr Phe Glu Ala Thr Thr Leu Arg Lys His Gly Asn Leu 85 90 95Ser Pro Asp His Val Pro Glu Val Tyr His Phe Asp Arg Thr Met Ala 100 105 110Leu Ile Gly Met Arg Tyr Leu Glu Pro Pro His Ile Ile Leu Arg Lys 115 120 125Gly Leu Ile Ala Gly Ile Glu Tyr Pro Phe Leu Ala Asp His Met Ser 130 135 140Asp Tyr Met Ala Lys Thr Leu Phe Phe Thr Ser Leu Leu Tyr His Asp145 150 155 160Thr Thr Glu His Arg Arg Ala Val Thr Glu Phe Cys Gly Asn Val Glu 165 170 175Leu Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp Pro Tyr Arg Val 180 185 190Ser Thr Phe Asn Arg Trp Thr Ser Pro Tyr Leu Asp Asp Asp Ala Lys 195 200 205Ala Val Arg Glu Asp Ser Ala Leu Lys Leu Glu Ile Ala Glu Leu Lys 210 215 220Ser Met Phe Cys Glu Arg Ala Gln Ala Leu Ile His Gly Asp Leu His225 230 235 240Thr Gly Ser Val Met Val Thr Gln Asp Ser Thr Gln Val Ile Asp Pro 245 250 255Glu Phe Ser Phe Tyr Gly Pro Met Gly Phe Asp Ile Gly Ala Tyr Leu 260 265 270Gly Asn Leu Ile Leu Ala Phe Phe Ala Gln Asp Gly His Ala Thr Gln 275 280 285Glu Asn Asp Arg Lys Glu Tyr Lys Gln Trp Ile Leu Arg Thr Ile Glu 290 295 300Gln Thr Trp Asn Leu Phe Asn Lys Arg Phe Ile Ala Leu Trp Asp Gln305 310 315 320Asn Lys Asp Gly Pro Gly Glu Ala Tyr Leu Ala Asp Ile Tyr Asn Asn 325 330 335Thr Glu Val Leu Lys Phe Val Gln Glu Asn Tyr Met Arg Asn Leu Leu 340 345 350His Asp Ser Leu Gly Phe Gly Ala Ala Lys Met Ile Arg Arg Ile Val 355 360 365Gly Val Ala His Val Glu Asp Phe Glu Ser Ile Glu Glu Asp Lys Arg 370 375 380Arg Ala Ile Cys Glu Arg Ser Ala Leu Glu Phe Ala Lys Met Leu Leu385 390 395 400Lys Glu Arg Arg Lys Phe Lys Ser Ile Gly Glu Val Val Ser Ala Ile 405 410 415Gln Gln Gln Ser 420391200DNAKlebsiella pneumoniaeCDS(1)..(1197)coding for 5-methylthioribose kinase 39atg tcg caa tac cat acc ttc acc gcc cac gat gcc gtg gct tac gcg 48Met Ser Gln Tyr His Thr Phe Thr Ala His Asp Ala Val Ala Tyr Ala1 5 10 15caa cag ttc gcc ggc atc gac aac cca tct gag ctg gtc agc gcg cag 96Gln Gln Phe Ala Gly Ile Asp Asn Pro Ser Glu Leu Val Ser Ala Gln 20 25 30gaa gtg ggc gat ggc aac ctc aat ctg gtg ttt aaa gtg ttc gat cgt 144Glu Val Gly Asp Gly Asn Leu Asn Leu Val Phe Lys Val Phe Asp Arg 35 40 45cag ggc gtc agc cgg gcg atc gtc aaa cag gcc ctg ccc tac gtg cgc 192Gln Gly Val Ser Arg Ala Ile Val Lys Gln Ala Leu Pro Tyr Val Arg 50 55 60tgc gtc ggc gaa tcc tgg ccg ctg acc ctc gac cgc gcc cgt ctc gaa 240Cys Val Gly Glu Ser Trp Pro Leu Thr Leu Asp Arg Ala Arg Leu Glu65 70 75 80gcg cag acc ctg gtc gcc cac tat cag cac agc ccg cag cac acg gta 288Ala Gln Thr Leu Val Ala His Tyr Gln His Ser Pro Gln His Thr Val 85 90 95aaa atc cat cac ttt gat ccc gag ctg gcg gtg atg gtg atg gaa gat 336Lys Ile His His Phe Asp Pro Glu Leu Ala Val Met Val Met Glu Asp 100 105 110ctt tcc gac cac cgc atc tgg cgc gga gag ctt atc gct aac gtc tac 384Leu Ser Asp His Arg Ile Trp Arg Gly Glu Leu Ile Ala Asn Val Tyr 115 120 125tat ccc cag gcg gcc cgc cag ctt ggc gac tat ctg gcg cag gtg ttg 432Tyr Pro Gln Ala Ala Arg Gln Leu Gly Asp Tyr Leu Ala Gln Val Leu 130 135 140ttc cac acc agc gat ttc tac ctc cat ccc cac gag aaa aag gcg cag 480Phe His Thr Ser Asp Phe Tyr Leu His Pro His Glu Lys Lys Ala Gln145 150 155 160gtg gcg cag ttt att aac ccg gcg atg tgc gag atc acc gag gat ctg 528Val Ala Gln Phe Ile Asn Pro Ala Met Cys Glu Ile Thr Glu Asp Leu 165 170 175ttc ttt aac gac ccg tat cag atc cac gag cgc aat aac tac ccg gcg 576Phe Phe Asn Asp Pro Tyr Gln Ile His Glu Arg Asn Asn Tyr Pro Ala 180 185 190gag ctg gag gcc gat gtc gcc gcc ctg cgc gac gac gcc cag ctt aag 624Glu Leu Glu Ala Asp Val Ala Ala Leu Arg Asp Asp Ala Gln Leu Lys 195 200 205ctg gcg gtg gcg gcg ctg aag cac cgt ttc ttt gcc cat gcg gaa gcg 672Leu Ala Val Ala Ala Leu Lys His Arg Phe Phe Ala His Ala Glu Ala 210 215 220ctg ctg cac ggc gat atc cac agc ggg tcg atc ttc gtt gcc gaa ggt 720Leu Leu His Gly Asp Ile His Ser Gly Ser Ile Phe Val Ala Glu Gly225 230 235 240agc ctg aag gcc atc gac gcc gag ttc ggc tac ttc ggc ccc atc ggc 768Ser Leu Lys Ala Ile Asp Ala Glu Phe Gly Tyr Phe Gly Pro Ile Gly 245 250 255ttc gat atc ggc acc gcc atc ggc aac ctg ctg ctg aac tac tgc ggc 816Phe Asp Ile Gly Thr Ala Ile Gly Asn Leu Leu Leu Asn Tyr Cys Gly 260 265 270ctg ccg ggc cag ctc ggc att cgc gat gcc gcc gcc gcg cgc gag cag 864Leu Pro Gly Gln Leu Gly Ile Arg Asp Ala Ala Ala Ala Arg Glu Gln 275 280 285cgg ctg aac gac atc cac cag ctg tgg acc acc ttc gcc gag cgc ttc 912Arg Leu Asn Asp Ile His Gln Leu Trp Thr Thr Phe Ala Glu Arg Phe 290 295 300cag gcg ctg gcg gcg gag aaa acc cgc gac gcg gcg ctg gct tac ccc 960Gln Ala Leu Ala Ala Glu Lys Thr Arg Asp Ala Ala Leu Ala Tyr Pro305 310 315 320ggc tac gcc tcc gcc ttt ctg aag aaa gtc tgg gcg gac gcg gtc ggc 1008Gly Tyr Ala Ser Ala Phe Leu Lys Lys Val Trp Ala Asp Ala Val Gly 325 330 335ttc tgc ggc agc gaa ctg atc cgc cgc agc gtc gga ctg tcg cac gtc 1056Phe Cys Gly Ser Glu Leu Ile Arg Arg Ser Val Gly Leu Ser His Val 340 345 350gcg gat atc gac act atc cag gac gac gcc atg cgt cat gag tgc ctg 1104Ala Asp Ile Asp Thr Ile Gln Asp Asp Ala Met Arg His Glu Cys Leu 355 360 365cgc cac gcc att acc ctg ggc aga gcg ctg atc gtg ctg gcc gag cgt 1152Arg His Ala Ile Thr Leu Gly Arg Ala Leu Ile Val Leu Ala Glu Arg 370 375 380atc gac agc gtc gac gag ctg ctg gcg cgg gta cgc cag tac agc tga 1200Ile Asp Ser Val Asp Glu Leu Leu Ala Arg Val Arg Gln Tyr Ser385 390 39540399PRTKlebsiella pneumoniae 40Met Ser Gln Tyr His Thr Phe Thr Ala His Asp Ala Val Ala Tyr Ala1 5 10 15Gln Gln Phe Ala Gly Ile Asp Asn Pro Ser Glu Leu Val Ser Ala Gln 20 25 30Glu Val Gly Asp Gly Asn Leu Asn Leu Val Phe Lys Val Phe Asp Arg 35 40 45Gln Gly Val Ser Arg Ala Ile Val Lys Gln Ala Leu Pro Tyr Val Arg 50 55 60Cys Val Gly Glu Ser Trp Pro Leu Thr Leu Asp Arg Ala Arg Leu Glu65 70 75 80Ala Gln Thr Leu Val Ala His Tyr Gln His Ser Pro Gln His Thr Val 85 90 95Lys Ile His His Phe Asp Pro Glu Leu Ala Val Met Val Met Glu Asp 100 105 110Leu Ser Asp His Arg Ile Trp Arg Gly Glu Leu Ile Ala Asn Val Tyr 115 120 125Tyr Pro Gln Ala Ala Arg Gln Leu Gly Asp Tyr Leu Ala Gln Val Leu 130 135 140Phe His Thr Ser Asp Phe Tyr Leu His Pro His Glu Lys Lys Ala Gln145 150 155 160Val Ala Gln Phe Ile Asn Pro Ala Met Cys Glu Ile Thr Glu Asp Leu 165 170 175Phe Phe Asn Asp Pro Tyr Gln Ile His Glu Arg Asn Asn Tyr Pro Ala 180 185 190Glu Leu Glu Ala Asp Val Ala Ala Leu Arg Asp Asp Ala Gln Leu Lys 195 200 205Leu Ala Val Ala Ala Leu Lys His Arg Phe Phe Ala His Ala Glu Ala 210 215 220Leu Leu His Gly Asp Ile His Ser Gly Ser Ile Phe Val Ala Glu Gly225 230 235 240Ser Leu Lys Ala Ile Asp Ala Glu Phe Gly Tyr Phe Gly Pro Ile Gly 245 250 255Phe Asp Ile Gly Thr Ala Ile Gly Asn Leu Leu Leu Asn Tyr Cys Gly 260 265 270Leu Pro Gly Gln Leu Gly Ile Arg Asp Ala Ala Ala Ala Arg Glu Gln 275 280 285Arg Leu Asn Asp Ile His Gln Leu Trp Thr Thr Phe Ala Glu Arg Phe 290 295 300Gln Ala Leu Ala Ala Glu Lys Thr Arg Asp Ala Ala Leu Ala Tyr Pro305 310 315 320Gly Tyr Ala Ser Ala Phe Leu Lys Lys Val Trp Ala Asp Ala Val Gly 325 330 335Phe Cys Gly Ser Glu Leu Ile Arg Arg Ser Val Gly Leu Ser His Val 340 345 350Ala Asp Ile Asp Thr Ile Gln Asp Asp Ala Met Arg His Glu Cys Leu 355 360 365Arg His Ala Ile Thr Leu Gly Arg Ala Leu Ile Val Leu Ala Glu Arg 370 375 380Ile Asp Ser Val Asp Glu Leu Leu Ala Arg Val Arg Gln Tyr Ser385 390 395411140DNAArabidopsis thalianaCDS(1)..(1137)coding for alcohol dehydrogenase 41atg tct acc acc gga cag att att cga tgc aaa gct gct gtg gca tgg 48Met Ser Thr Thr Gly Gln Ile Ile Arg Cys Lys Ala Ala Val Ala Trp1 5 10 15gaa gcc gga aag cca ctg gtg atc gag gaa gtg gag gtt gct cca ccg 96Glu Ala Gly Lys Pro Leu Val Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30cag aaa cac gaa gtt cgt atc aag att ctc ttc act tct ctc tgt cac 144Gln Lys His Glu Val Arg Ile Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45acc gat gtt tac ttc tgg gaa gct aag gga caa aca ccg ttg ttt cca 192Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Leu Phe Pro 50 55 60cgt atc ttc ggc cat gaa gct gga ggg att gtt gag agt gtt gga gaa 240Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80gga gtg act gat ctt cag cca gga gat cat gtg ttg ccg atc ttt acc 288Gly Val Thr Asp Leu Gln Pro Gly Asp His Val Leu Pro Ile Phe Thr 85 90 95gga gaa tgt gga gat tgt cgt cat tgc cag tcg gag gaa tca aac atg 336Gly Glu Cys Gly Asp Cys Arg His Cys Gln Ser Glu Glu Ser Asn Met 100 105 110tgt gat ctt ctc agg atc aac aca gag cga gga ggt atg att cac gat 384Cys Asp Leu Leu Arg Ile Asn Thr Glu Arg Gly Gly Met Ile His Asp 115 120 125ggt gaa tct aga ttc tcc att aat ggc aaa cca atc tac cat ttc ctt 432Gly Glu Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Leu 130 135 140ggg acg tcc acg ttc agt gag tac act gtg gtt cac tct ggt cag gtc 480Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Val His Ser Gly Gln Val145 150 155 160gct aag atc aat ccg gat gct cct ctt gac aag gtc tgt att gtc agt 528Ala Lys Ile Asn Pro Asp Ala Pro Leu Asp Lys Val Cys Ile Val Ser 165 170 175tgt ggt ttg tct act ggg tta gga gca act ttg aat gtg gct aaa ccc 576Cys Gly Leu Ser Thr Gly Leu Gly Ala Thr Leu Asn Val Ala Lys Pro 180 185 190aag aaa ggt caa agt gtt gcc att ttt ggt ctt ggt gct gtt ggt tta 624Lys Lys Gly Gln Ser Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205ggc gct gca gaa ggt gct aga atc gct ggt gct tct agg atc atc ggt 672Gly Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220gtt gat ttt aac tct aaa aga ttc gac caa gct aag gaa ttc ggt gtg 720Val Asp Phe Asn Ser Lys Arg Phe Asp Gln Ala Lys Glu Phe Gly Val225 230 235 240acc gag tgt gtg aac ccg aaa gac cat gac aag cca att caa cag gtg 768Thr Glu Cys Val Asn Pro Lys Asp His Asp Lys Pro Ile Gln Gln Val 245 250 255atc gct gag atg acg gat ggt ggg gtg gac agg agt gtg gaa tgc acc 816Ile Ala Glu Met Thr Asp Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270gga agc gtt cag gcc atg

att caa gca ttt gaa tgt gtc cac gat ggc 864Gly Ser Val Gln Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285tgg ggt gtt gca gtg ctg gtg ggt gtg cca agc aaa gac gat gcc ttc 912Trp Gly Val Ala Val Leu Val Gly Val Pro Ser Lys Asp Asp Ala Phe 290 295 300aag act cat ccg atg aat ttc ttg aat gag agg act ctt aag ggt act 960Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320ttc ttc ggg aac tac aaa ccc aaa act gac att ccc ggg gtt gtg gaa 1008Phe Phe Gly Asn Tyr Lys Pro Lys Thr Asp Ile Pro Gly Val Val Glu 325 330 335aag tac atg aac aag gag ctg gag ctt gag aaa ttc atc act cac aca 1056Lys Tyr Met Asn Lys Glu Leu Glu Leu Glu Lys Phe Ile Thr His Thr 340 345 350gtg cca ttc tcg gaa atc aac aag gcc ttt gat tac atg ctg aag gga 1104Val Pro Phe Ser Glu Ile Asn Lys Ala Phe Asp Tyr Met Leu Lys Gly 355 360 365gag agt att cgt tgc atc atc acc atg ggt gct tga 1140Glu Ser Ile Arg Cys Ile Ile Thr Met Gly Ala 370 37542379PRTArabidopsis thaliana 42Met Ser Thr Thr Gly Gln Ile Ile Arg Cys Lys Ala Ala Val Ala Trp1 5 10 15Glu Ala Gly Lys Pro Leu Val Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30Gln Lys His Glu Val Arg Ile Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Leu Phe Pro 50 55 60Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80Gly Val Thr Asp Leu Gln Pro Gly Asp His Val Leu Pro Ile Phe Thr 85 90 95Gly Glu Cys Gly Asp Cys Arg His Cys Gln Ser Glu Glu Ser Asn Met 100 105 110Cys Asp Leu Leu Arg Ile Asn Thr Glu Arg Gly Gly Met Ile His Asp 115 120 125Gly Glu Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Leu 130 135 140Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Val His Ser Gly Gln Val145 150 155 160Ala Lys Ile Asn Pro Asp Ala Pro Leu Asp Lys Val Cys Ile Val Ser 165 170 175Cys Gly Leu Ser Thr Gly Leu Gly Ala Thr Leu Asn Val Ala Lys Pro 180 185 190Lys Lys Gly Gln Ser Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205Gly Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220Val Asp Phe Asn Ser Lys Arg Phe Asp Gln Ala Lys Glu Phe Gly Val225 230 235 240Thr Glu Cys Val Asn Pro Lys Asp His Asp Lys Pro Ile Gln Gln Val 245 250 255Ile Ala Glu Met Thr Asp Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270Gly Ser Val Gln Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285Trp Gly Val Ala Val Leu Val Gly Val Pro Ser Lys Asp Asp Ala Phe 290 295 300Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320Phe Phe Gly Asn Tyr Lys Pro Lys Thr Asp Ile Pro Gly Val Val Glu 325 330 335Lys Tyr Met Asn Lys Glu Leu Glu Leu Glu Lys Phe Ile Thr His Thr 340 345 350Val Pro Phe Ser Glu Ile Asn Lys Ala Phe Asp Tyr Met Leu Lys Gly 355 360 365Glu Ser Ile Arg Cys Ile Ile Thr Met Gly Ala 370 375431140DNAHordeum vulgareCDS(1)..(1137)coding for alcohol dehydrogenase 43atg gcg acg gcc ggc aag gtg atc aag tgc aaa gcc gcg gtg gcg tgg 48Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15gag gcc ggg aag ccg ctg acc atg gag gag gtg gag gtg gcg ccg ccg 96Glu Ala Gly Lys Pro Leu Thr Met Glu Glu Val Glu Val Ala Pro Pro 20 25 30cag gcc atg gag gtg cgc gtc aag atc ctc ttc acc tcc ctc tgc cac 144Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45acc gac gtc tac ttc tgg gag gcc aag ggg cag acc ccc atg ttc cct 192Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Met Phe Pro 50 55 60cgg atc ttc ggc cat gaa gct gga ggc ata gtg gag agt gtt gga gag 240Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80ggc gtg act gat gtt gcc cct ggt gac cac gtc ctc cct gtg ttc act 288Gly Val Thr Asp Val Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95ggg gag tgt aag gaa tgc cca cat tgc aag tct gcg gag agc aac atg 336Gly Glu Cys Lys Glu Cys Pro His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110tgt gat ctg ctc agg atc aac acc gac aga ggt gtg atg atc ggg gat 384Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125ggc aag tcg cgc ttc tct att ggc ggc aag ccg att tac cat ttc gta 432Gly Lys Ser Arg Phe Ser Ile Gly Gly Lys Pro Ile Tyr His Phe Val 130 135 140ggg act tcc acc ttc agt gag tac act gtc atg cat gtc ggt tgt gtt 480Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160gcc aag atc aac cct gag gct ccc ctt gat aaa gtc tgt gtt ctt agc 528Ala Lys Ile Asn Pro Glu Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175tgt ggt att tgc act ggt ctt ggc gcg tca att aat gtt gca aaa cca 576Cys Gly Ile Cys Thr Gly Leu Gly Ala Ser Ile Asn Val Ala Lys Pro 180 185 190cca aag ggt tcc aca gtg gcg ata ttt ggg cta gga gct gtt ggc ctt 624Pro Lys Gly Ser Thr Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205gct gct gca gaa ggt gca agg att gca ggt gca tca agg atc att ggt 672Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220gtt gac ctg aac gcc agc aga ttt gaa gag gct agg aag ttt ggc tgc 720Val Asp Leu Asn Ala Ser Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240acg gaa ttt gtg aac ccg aaa gat cac acc aag cca gtt cag cag gtg 768Thr Glu Phe Val Asn Pro Lys Asp His Thr Lys Pro Val Gln Gln Val 245 250 255ctc gct gac atg aca aat ggc gga gtt gac cgc agt gtt gag tgc act 816Leu Ala Asp Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270ggc aac gtc aat gct atg ata caa gca ttt gaa tgt gtt cat gat ggc 864Gly Asn Val Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285tgg ggt gta gct gtg ctg gtg ggt gtg cca cac aag gac gct gaa ttc 912Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295 300aag acc cac ccg atg aac ttc ctg aat gag agg acc ctg aag ggc acc 960Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320ttc ttc ggt aac ttc aag ccg cgc act gac ctg ccc aat gtc gtg gag 1008Phe Phe Gly Asn Phe Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335atg tac atg aag aag gag ctg gag gtg gag aag ttc atc aca cac agc 1056Met Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350gtg ccg ttc tcg gag ata aac aag gcc ttc gac ctt atg gcg aag ggg 1104Val Pro Phe Ser Glu Ile Asn Lys Ala Phe Asp Leu Met Ala Lys Gly 355 360 365gag ggc atc cgt tgc atc atc cgc atg gac aac tag 1140Glu Gly Ile Arg Cys Ile Ile Arg Met Asp Asn 370 37544379PRTHordeum vulgare 44Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15Glu Ala Gly Lys Pro Leu Thr Met Glu Glu Val Glu Val Ala Pro Pro 20 25 30Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Met Phe Pro 50 55 60Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80Gly Val Thr Asp Val Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95Gly Glu Cys Lys Glu Cys Pro His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125Gly Lys Ser Arg Phe Ser Ile Gly Gly Lys Pro Ile Tyr His Phe Val 130 135 140Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160Ala Lys Ile Asn Pro Glu Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175Cys Gly Ile Cys Thr Gly Leu Gly Ala Ser Ile Asn Val Ala Lys Pro 180 185 190Pro Lys Gly Ser Thr Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220Val Asp Leu Asn Ala Ser Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240Thr Glu Phe Val Asn Pro Lys Asp His Thr Lys Pro Val Gln Gln Val 245 250 255Leu Ala Asp Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270Gly Asn Val Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295 300Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320Phe Phe Gly Asn Phe Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335Met Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350Val Pro Phe Ser Glu Ile Asn Lys Ala Phe Asp Leu Met Ala Lys Gly 355 360 365Glu Gly Ile Arg Cys Ile Ile Arg Met Asp Asn 370 375451140DNAOryza sativaCDS(1)..(1137)coding for alcohol dehydrogenase 45atg gcg acc gca ggg aag gtg atc aag tgc aaa gcg gcg gtg gca tgg 48Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15gag gcc gcg aag ccg ctg gtg atc gag gag gtg gag gtg gcg ccg ccg 96Glu Ala Ala Lys Pro Leu Val Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30cag gcc atg gag gtg cgc gtc aag atc ctc ttc acc tcg ctc tgc cac 144Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45acc gac gtc tac ttc tgg gag gcc aag gga cag act ccc gtg ttc cct 192Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Val Phe Pro 50 55 60cgg atc ttc ggc cat gaa gct gga ggt att gtg gag agt gtt gga gag 240Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80ggt gtg act gat ctt gcc cct ggt gac cat gtt ctc cct gtg ttc act 288Gly Val Thr Asp Leu Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95ggg gag tgc aag gag tgt gcc cac tgc aag tca gca gag agc aac atg 336Gly Glu Cys Lys Glu Cys Ala His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110tgt gat ctg ctc agg atc aac act gac agg ggt gtg atg att ggt gat 384Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125ggc aaa tca cgc ttt tcc atc aac ggg aag ccc att tac cat ttc gtc 432Gly Lys Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Val 130 135 140ggg act tcg acc ttc agc gag tac act gtc atg cat gtt ggt tgc gtt 480Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160gcg aag atc aac ccg gca gct cca ctt gat aaa gtt tgc gtt ctt agc 528Ala Lys Ile Asn Pro Ala Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175tgt ggt att tct act ggt ctt ggt gct aca atc aat gtg gca aag cca 576Cys Gly Ile Ser Thr Gly Leu Gly Ala Thr Ile Asn Val Ala Lys Pro 180 185 190cca aag ggt tcg acg gtg gcg ata ttt ggt cta gga gct gta ggc ctt 624Pro Lys Gly Ser Thr Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205gct gcc gca gaa ggt gca agg att gca gga gcg tca agg atc att ggc 672Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220att gac ctg aac gcc aac aga ttt gaa gaa gct agg aaa ttt ggt tgc 720Ile Asp Leu Asn Ala Asn Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240act gaa ttt gtg aac cca aag gac cat gac aag cca gtt cag cag gta 768Thr Glu Phe Val Asn Pro Lys Asp His Asp Lys Pro Val Gln Gln Val 245 250 255ctt gct gag atg acc aat ggc gga gtt gac cgc agc gtt gaa tgc act 816Leu Ala Glu Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270ggc aac atc aac gcc atg atc caa gca ttt gaa tgt gtt cat gat ggc 864Gly Asn Ile Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285tgg ggt gtt gct gtt ttg gtc ggc gtg cca cac aag gac gcc gag ttc 912Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295 300aag acc cac ccg atg aac ttc ctg aac gag agg act ctc aag gga acc 960Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320ttc ttc ggc aac tac aag cca cgc acc gat ctg ccc aac gtc gtc gag 1008Phe Phe Gly Asn Tyr Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335ctc tac atg aag aag gag ctg gag gtg gag aag ttc atc aca cac agc 1056Leu Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350gtg ccg ttc tcg gag atc aac acg gcg ttc gac ctg atg cac aag ggc 1104Val Pro Phe Ser Glu Ile Asn Thr Ala Phe Asp Leu Met His Lys Gly 355 360 365gag ggc atc cgc tgc atc atc cgc atg gag aac tga 1140Glu Gly Ile Arg Cys Ile Ile Arg Met Glu Asn 370 37546379PRTOryza sativa 46Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15Glu Ala Ala Lys Pro Leu Val Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Val Phe Pro 50 55 60Arg Ile Phe Gly His Glu Ala Gly Gly Ile Val Glu Ser Val Gly Glu65 70 75 80Gly Val Thr Asp Leu Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95Gly Glu Cys Lys Glu Cys Ala His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125Gly Lys Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Val 130 135 140Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160Ala Lys Ile Asn Pro Ala Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175Cys Gly Ile Ser Thr Gly Leu Gly Ala Thr Ile Asn Val Ala Lys Pro 180 185 190Pro Lys Gly Ser Thr Val Ala Ile Phe Gly Leu Gly Ala Val Gly Leu 195 200 205Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220Ile Asp Leu Asn Ala Asn Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240Thr Glu Phe Val Asn Pro Lys Asp His Asp Lys Pro Val Gln Gln Val 245 250 255Leu Ala Glu Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270Gly Asn Ile Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295

300Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320Phe Phe Gly Asn Tyr Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335Leu Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350Val Pro Phe Ser Glu Ile Asn Thr Ala Phe Asp Leu Met His Lys Gly 355 360 365Glu Gly Ile Arg Cys Ile Ile Arg Met Glu Asn 370 375471140DNAZea maysCDS(1)..(1137)coding for alcohol dehydrogenase 47atg gcg acc gcg ggg aag gtg atc aag tgc aaa gct gcg gtg gca tgg 48Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15gag gcc ggc aag cca ctg tcg atc gag gag gtg gag gta gcg cct ccg 96Glu Ala Gly Lys Pro Leu Ser Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30cag gcc atg gag gtg cgc gtc aag atc ctc ttc acc tcg ctc tgc cac 144Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45acc gac gtc tac ttc tgg gag gcc aag ggg cag act ccc gtg ttc cct 192Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Val Phe Pro 50 55 60cgg atc ttt ggc cat gag gct gga ggt atc ata gag agt gtt gga gag 240Arg Ile Phe Gly His Glu Ala Gly Gly Ile Ile Glu Ser Val Gly Glu65 70 75 80ggt gtg act gac gta gct ccg ggc gac cat gtc ctt cct gtg ttc act 288Gly Val Thr Asp Val Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95ggg gag tgc aag gag tgc gcc cac tgc aag tcg gca gag agc aac atg 336Gly Glu Cys Lys Glu Cys Ala His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110tgt gat ttg ctc agg atc aac act gac cgc ggt gtg atg att ggc gat 384Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125ggc aag tcg cgg ttt tca atc aat ggg aag cct atc tac cac ttt gtt 432Gly Lys Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Val 130 135 140ggg act tcc acc ttc agc gag tac acc gtc atg cat gtc ggt tgt gtt 480Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160gca aag atc aac cct cag gct ccc ctt gat aaa gtt tgc gtc ctt agc 528Ala Lys Ile Asn Pro Gln Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175tgt ggt att tct act ggt ctt ggt gca tca att aat gtt gca aaa cct 576Cys Gly Ile Ser Thr Gly Leu Gly Ala Ser Ile Asn Val Ala Lys Pro 180 185 190ccg aag ggt tcg aca gtg gct gtt ttc ggt tta gga gcc gtt ggt ctt 624Pro Lys Gly Ser Thr Val Ala Val Phe Gly Leu Gly Ala Val Gly Leu 195 200 205gcc gct gca gaa ggt gca agg att gct gga gcg tca agg atc att ggt 672Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220gtc gac ctg aac ccc agc aga ttc gaa gaa gct agg aag ttc ggt tgc 720Val Asp Leu Asn Pro Ser Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240act gaa ttt gtg aac cca aaa gac cac aac aag ccg gtg cag gag gta 768Thr Glu Phe Val Asn Pro Lys Asp His Asn Lys Pro Val Gln Glu Val 245 250 255ctt gct gag atg acc aac gga ggg gtc gac cgc agc gtg gaa tgc act 816Leu Ala Glu Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270ggc aac atc aat gct atg atc caa gct ttc gaa tgt gtt cat gat ggc 864Gly Asn Ile Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285tgg ggt gtt gcc gtg ctg gtg ggt gtg ccg cat aag gac gct gag ttc 912Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295 300aag acc cac ccg atg aac ttc ctg aac gaa agg acc ctg aag ggg acc 960Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320ttc ttt ggc aac tat aag cca cgc act gat ctg cca aat gtg gtg gag 1008Phe Phe Gly Asn Tyr Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335ctg tac atg aaa aag gag ctg gag gtg gag aag ttc atc acg cac agc 1056Leu Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350gtc ccg ttc gcg gag atc aac aag gcg ttc aac ctg atg gcc aag ggg 1104Val Pro Phe Ala Glu Ile Asn Lys Ala Phe Asn Leu Met Ala Lys Gly 355 360 365gag ggc atc cgc tgc atc atc cgc atg gag aac tag 1140Glu Gly Ile Arg Cys Ile Ile Arg Met Glu Asn 370 37548379PRTZea mays 48Met Ala Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Ala Trp1 5 10 15Glu Ala Gly Lys Pro Leu Ser Ile Glu Glu Val Glu Val Ala Pro Pro 20 25 30Gln Ala Met Glu Val Arg Val Lys Ile Leu Phe Thr Ser Leu Cys His 35 40 45Thr Asp Val Tyr Phe Trp Glu Ala Lys Gly Gln Thr Pro Val Phe Pro 50 55 60Arg Ile Phe Gly His Glu Ala Gly Gly Ile Ile Glu Ser Val Gly Glu65 70 75 80Gly Val Thr Asp Val Ala Pro Gly Asp His Val Leu Pro Val Phe Thr 85 90 95Gly Glu Cys Lys Glu Cys Ala His Cys Lys Ser Ala Glu Ser Asn Met 100 105 110Cys Asp Leu Leu Arg Ile Asn Thr Asp Arg Gly Val Met Ile Gly Asp 115 120 125Gly Lys Ser Arg Phe Ser Ile Asn Gly Lys Pro Ile Tyr His Phe Val 130 135 140Gly Thr Ser Thr Phe Ser Glu Tyr Thr Val Met His Val Gly Cys Val145 150 155 160Ala Lys Ile Asn Pro Gln Ala Pro Leu Asp Lys Val Cys Val Leu Ser 165 170 175Cys Gly Ile Ser Thr Gly Leu Gly Ala Ser Ile Asn Val Ala Lys Pro 180 185 190Pro Lys Gly Ser Thr Val Ala Val Phe Gly Leu Gly Ala Val Gly Leu 195 200 205Ala Ala Ala Glu Gly Ala Arg Ile Ala Gly Ala Ser Arg Ile Ile Gly 210 215 220Val Asp Leu Asn Pro Ser Arg Phe Glu Glu Ala Arg Lys Phe Gly Cys225 230 235 240Thr Glu Phe Val Asn Pro Lys Asp His Asn Lys Pro Val Gln Glu Val 245 250 255Leu Ala Glu Met Thr Asn Gly Gly Val Asp Arg Ser Val Glu Cys Thr 260 265 270Gly Asn Ile Asn Ala Met Ile Gln Ala Phe Glu Cys Val His Asp Gly 275 280 285Trp Gly Val Ala Val Leu Val Gly Val Pro His Lys Asp Ala Glu Phe 290 295 300Lys Thr His Pro Met Asn Phe Leu Asn Glu Arg Thr Leu Lys Gly Thr305 310 315 320Phe Phe Gly Asn Tyr Lys Pro Arg Thr Asp Leu Pro Asn Val Val Glu 325 330 335Leu Tyr Met Lys Lys Glu Leu Glu Val Glu Lys Phe Ile Thr His Ser 340 345 350Val Pro Phe Ala Glu Ile Asn Lys Ala Phe Asn Leu Met Ala Lys Gly 355 360 365Glu Gly Ile Arg Cys Ile Ile Arg Met Glu Asn 370 37549505DNAArtificial sequenceDescription of the artificial sequence coding for sense RNA-fragment of E.coli codA gene 49aagcttggct aacagtgtcg aataacgctt tacaaacaat tattaacgcc cggttaccag 60gcgaagaggg gctgtggcag attcatctgc aggacggaaa aatcagcgcc attgatgcgc 120aatccggcgt gatgcccata actgaaaaca gcctggatgc cgaacaaggt ttagttatac 180cgccgtttgt ggagccacat attcacctgg acaccacgca aaccgccgga caaccgaact 240ggaatcagtc cggcacgctg tttgaaggca ttgaacgctg ggccgagcgc aaagcgttat 300taacccatga cgatgtgaaa caacgcgcat ggcaaacgct gaaatggcag attgccaacg 360gcattcagca tgtgcgtacc catgtcgatg tttcggatgc aacgctaact gcgctgaaag 420caatgctgga agtgaagcag gaagtcgcgc cgtggattga tctgcaaatc gtcgccttcc 480ctcaggaagg gattttgtcg tcgac 5055027DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 50aagcttggct aacagtgtcg aataacg 275126DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 51gtcgacgaca aaatcccttc ctgagg 2652505DNAArtificial sequenceDescription of the artificial sequence coding for antisense RNA-fragment of E.coli codA gene 52gaattcggct aacagtgtcg aataacgctt tacaaacaat tattaacgcc cggttaccag 60gcgaagaggg gctgtggcag attcatctgc aggacggaaa aatcagcgcc attgatgcgc 120aatccggcgt gatgcccata actgaaaaca gcctggatgc cgaacaaggt ttagttatac 180cgccgtttgt ggagccacat attcacctgg acaccacgca aaccgccgga caaccgaact 240ggaatcagtc cggcacgctg tttgaaggca ttgaacgctg ggccgagcgc aaagcgttat 300taacccatga cgatgtgaaa caacgcgcat ggcaaacgct gaaatggcag attgccaacg 360gcattcagca tgtgcgtacc catgtcgatg tttcggatgc aacgctaact gcgctgaaag 420caatgctgga agtgaagcag gaagtcgcgc cgtggattga tctgcaaatc gtcgccttcc 480ctcaggaagg gattttgtcg gatcc 5055327DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 53gaattcggct aacagtgtcg aataacg 275426DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 54ggatccgaca aaatcccttc ctgagg 26555674DNAArtificial sequenceDescription of the artificial sequence vector construct pBluKS-nitP-STLS1-35S-T 55ccagcttttg ttccctttag tgagggttaa tttcgagctt ggcgtaatca tggtcatagc 60tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 120taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 180cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 240gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 300tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 360tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 420ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 480agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 540accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 600ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 660gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 720ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 780gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 840taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 900tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 960gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 1020cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 1080agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 1140cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 1200cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 1260ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 1320taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 1380tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 1440ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 1500atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 1560gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 1620tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 1680cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 1740taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 1800ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 1860ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 1920cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 1980ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 2040gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 2100gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 2160aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgcg ccctgtagcg 2220gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg 2280ccctagcgcc cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc 2340cccgtcaagc tctaaatcgg gggctccctt tagggttccg atttagtgct ttacggcacc 2400tcgaccccaa aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga 2460cggtttttcg ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa 2520ctggaacaac actcaaccct atctcggtct attcttttga tttataaggg attttgccga 2580tttcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca 2640aaatattaac gcttacaatt tccattcgcc attcaggctg cgcaactgtt gggaagggcg 2700atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 2760attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga 2820attgtaatac gactcactat agggcgaatt ggagctcgtc gagaccagat gttttacact 2880tgaccgtaaa tgagcacccg aagaaaccgg tcacattcat ttcgaaggtg gagaaagcgg 2940aagatgactc aaacaagtaa tcggttgtga ttcgtcagtt catgtcactc ctatgaagga 3000gtcaagttca aaatgttatg ttgagtttca aacttttatg ctaaactttt tttctttatt 3060ttcgttaata atggaagaga accaattctc ttgtatctaa agattatcca tctatcatcc 3120aatttgagtg ttcaattctg gatgttgtgt taccctacat tctacaacca tgtagccaat 3180tattatgaat ctggctttga tttcagttgt gttcttttct tttttttctt tgcatatttg 3240catttagaat gtttaataat taagttactg tatttccaca tacattagtt ccaagaatat 3300acatatatta atttattttt cttaaaaatg ttttggaatg actaatattg acaacgaaaa 3360tagaagctat gctaaaccat tacgtatatg tgacttcaca tgttgttgtt ttacattccc 3420tatatatatg gatggctgtc acaatcagaa acgtgatcga aaaaagacaa acagtgtttg 3480cataaaaaga ctatttcgtt tcattgacaa tttgtgttta tttgtaaaga aaagtggcaa 3540agtggaattt gagttcctgc aagtaagaaa gatgaaataa aagacttgag tgtgtgtttt 3600tttcttttat ctgaaagctg caatgaaata ttcctaccaa gcccgtttga ttattaattg 3660gggtttggtt ttcttgatgc gaactaattg gttatataag aaactataca atccatgtta 3720attcaaaaat tttgatttct cttgtaggaa tatgatttac tatatgagac tttcttttcg 3780ccaataatag taaatccaaa gatatttgac cggaccaaaa cacattgatc tattttttag 3840tttatttaat ccagtttctc tgagataatt cattaaggaa aacttagtat taacccatcc 3900taagattaaa taggagccaa actcacattt caaatattaa ataacataaa atggatttaa 3960aaaatctata cgtcaaattt tatttatgac atttcttatt taaatttata tttaatgaaa 4020tacagctaag acaaaccaaa aaaaaaatac tttctaagtg gtccaaaaca tcaattccgt 4080tcaatattat taggtagaat cgtacgacca aaaaaaggta ggttaatacg aattagaaac 4140atatctataa catagtatat attattacct attatgagga atcaaaatgc atcaaatatg 4200gatttaagga atccataaaa gaataaattc tacgggaaaa aaaatggaat aaattctttt 4260aagtttttta tttgtttttt atttggtagt tctccatttt gttttatttc gtttggattt 4320attgtgtcca aatactttgt aaaccaccgt tgtaattctt aaacggggtt ttcacttctt 4380ttttatattc agacataaag catcggctgg tttaatcaat caatagattt tatttttctt 4440ctcaattatt agtaggtttg atgtgaactt tacaaaaaaa acaaaaacaa atcaatgcag 4500agaaaagaaa ccacgtgggc tagtcccacc ttgtttcatt tccaccacag gttcgatctt 4560cgttaccgtc tccaatagga aaataaacgt gaccacaaaa aaaaaacaaa aaaaagtcta 4620tatattgctt ctctcaagtc tctgagtgtc atgaaccaaa gtaaaaaaca aagactcgac 4680ctgcaggcat gcaagcttat cgtcgactac gtaagtttct gcttctacct ttgatatata 4740tataataatt atcattaatt agtagtaata taatatttca aatatttttt tcaaaataaa 4800agaatgtagt atatagcaat tgcttttctg tagtttataa gtgtgtatat tttaatttat 4860aacttttcta atatatgacc aaaatttgtt gatgtgcagg tatcaccgga tccatcgaat 4920tcggtacgct gaaatcacca gtctctctct acaaatctat ctctctctat tttctccata 4980aataatgtgt gagtagtttc ccgataaggg gaanttaggg ttcttatagg gtttcgctca 5040tgtgttgagc atataagaaa cccttagtat gtatttgtat ttgtaaaata cttctatcaa 5100taaaatttct aattcctaaa accaaaatcc agtactaaaa tccagatctc ctaaagtccc 5160tatagatctt tgtcgtgaat ataaaccaga cacgagacga ctaaacctgg agcccagacg 5220ccgttcgaag ctagaagtac cgcttaggca ggaggccgtt agggaaaaga tgctaaggca 5280gggttggtta cgttgactcc cccgtaggtt tggtttaaat atgatgaagt ggacggaagg 5340aaggaggaag acaaggaagg ataaggttgc aggccctgtg caaggtaaga agatggaaat 5400ttgatagagg tacgctacta tacttatact atacgctaag ggaatgcttg tatttatacc 5460ctataccccc taataacccc ttatcaattt aagaaataat ccgcataagc ccccgcttaa 5520aaattggtat cagagccatg aataggtcta tgaccaaaac tcaagaggat aaaacctcac 5580caaaatacga aagagttctt aactctaaag ataaaagatc tttcaagatc aaaactagtt 5640ccctcacacc ggtgacgggg atcgcgatgg gtac 5674566046DNAArtificial sequenceDescription of the artificial sequence binary vector pSUN1 56ttccatggac atacaaatgg acgaacggat aaaccttttc acgccctttt aaatatccga 60ttattctaat aaacgctctt ttctcttagg tttacccgcc aatatatcct gtcaaacact 120gatagtttaa actgaaggcg ggaaacgaca atcagatcta gtaggaaaca gctatgacca 180tgattacgcc aagcttgcat gcctgcaggt cgactctaga ctagtggatc cgatatcgcc 240cgggctcgag gtaccgagct cgaattcact ggccgtcgtt ttacaacgac tcagctgctt 300ggtaataatt gtcattagat tgtttttatg catagatgca ctcgaaatca gccaatttta 360gacaagtatc aaacggatgt taattcagta cattaaagac gtccgcaatg tgttattaag 420ttgtctaagc gtcaatttgt ttacaccaca atatatcctg ccaccagcca gccaacagct 480ccccgaccgg cagctcggca caaaatcacc acgcgttacc accacgccgg ccggccgcat 540ggtgttgacc gtgttcgccg gcattgccga gttcgagcgt tccctaatca tcgaccgcac 600ccggagcggg cgcgaggccg ccaaggcccg aggcgtgaag tttggccccc gccctaccct 660caccccggca cagatcgcgc acgcccgcga gctgatcgac caggaaggcc gcaccgtgaa 720agaggcggct gcactgcttg gcgtgcatcg ctcgaccctg

taccgcgcac ttgagcgcag 780cgaggaagtg acgcccaccg aggccaggcg gcgcggtgcc ttccgtgagg acgcattgac 840cgaggccgac gccctggcgg ccgccgagaa tgaacgccaa gaggaacaag catgaaaccg 900caccaggacg gccaggacga accgtttttc attaccgaag agatcgaggc ggagatgatc 960gcggccgggt acgtgttcga gccgcccgcg cacgtctcaa ccgtgcggct gcatgaaatc 1020ctggccggtt tgtctgatgc caagctggcg gcctggccgg ccagcttggc cgctgaagaa 1080accgagcgcc gccgtctaaa aaggtgatgt gtatttgagt aaaacagctt gcgtcatgcg 1140gtcgctgcgt atatgatgcg atgagtaaat aaacaaatac gcaaggggaa cgcatgaagg 1200ttatcgctgt acttaaccag aaaggcgggt caggcaagac gaccatcgca acccatctag 1260cccgcgccct gcaactcgcc ggggccgatg ttctgttagt cgattccgat ccccagggca 1320gtgcccgcga ttgggcggcc gtgcgggaag atcaaccgct aaccgttgtc ggcatcgacc 1380gcccgacgat tgaccgcgac gtgaaggcca tcggccggcg cgacttcgta gtgatcgacg 1440gagcgcccca ggcggcggac ttggctgtgt ccgcgatcaa ggcagccgac ttcgtgctga 1500ttccggtgca gccaagccct tacgacatat gggccaccgc cgacctggtg gagctggtta 1560agcagcgcat tgaggtcacg gatggaaggc tacaagcggc ctttgtcgtg tcgcgggcga 1620tcaaaggcac gcgcatcggc ggtgaggttg ccgaggcgct ggccgggtac gagctgccca 1680ttcttgagtc ccgtatcacg cagcgcgtga gctacccagg cactgccgcc gccggcacaa 1740ccgttcttga atcagaaccc gagggcgacg ctgcccgcga ggtccaggcg ctggccgctg 1800aaattaaatc aaaactcatt tgagttaatg aggtaaagag aaaatgagca aaagcacaaa 1860cacgctaagt gccggccgtc cgagcgcacg cagcagcaag gctgcaacgt tggccagcct 1920ggcagacacg ccagccatga agcgggtcaa ctttcagttg ccggcggagg atcacaccaa 1980gctgaagatg tacgcggtac gccaaggcaa gaccattacc gagctgctat ctgaatacat 2040cgcgcagcta ccagagtaaa tgagcaaatg aataaatgag tagatgaatt ttagcggcta 2100aaggaggcgg catggaaaat caagaacaac caggcaccga cgccgtggaa tgccccatgt 2160gtggaggaac gggcggttgg ccaggcgtaa gcggctgggt tgtctgccgg ccctgcaatg 2220gcactggaac ccccaagccc gaggaatcgg cgtgagcggt cgcaaaccat ccggcccggt 2280acaaatcggc gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg cgcaggccgc 2340ccagcggcaa cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag cggccgctga 2400tcgaatccgc aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga ttaggaagcc 2460gcccaagggc gacgagcaac cagatttttt cgttccgatg ctctatgacg tgggcacccg 2520cgatagtcgc agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg accgacgagc 2580tggcgaggtg atccgctacg agcttccaga cgggcacgta gaggtttccg cagggccggc 2640cggcatggcc agtgtgtggg attacgacct ggtactgatg gcggtttccc atctaaccga 2700atccatgaac cgataccggg aagggaaggg agacaagccc ggccgcgtgt tccgtccaca 2760cgttgcggac gtactcaagt tctgccggcg agccgatggc ggaaagcaga aagacgacct 2820ggtagaaacc tgcattcggt taaacaccac gcacgttgcc atgcagcgta cgaagaaggc 2880caagaacggc cgcctggtga cggtatccga gggtgaagcc ttgattagcc gctacaagat 2940cgtaaagagc gaaaccgggc ggccggagta catcgagatc gagctagctg attggatgta 3000ccgcgagatc acagaaggca agaacccgga cgtgctgacg gttcaccccg attacttttt 3060gatcgatccc ggcatcggcc gttttctcta ccgcctggca cgccgcgccg caggcaaggc 3120agaagccaga tggttgttca agacgatcta cgaacgcagt ggcagcgccg gagagttcaa 3180gaagttctgt ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg agtacgattt 3240gaaggaggag gcggggcagg ctggcccgat cctagtcatg cgctaccgca acctgatcga 3300gggcgaagca tccgccggtt cctaatgtac ggagcagatg ctagggcaaa ttgccctagc 3360aggggaaaaa ggtcgaaaag gtctctttcc tgtggatagc acgtacattg ggaacccaaa 3420gccgtacatt gggaaccgga acccgtacat tgggaaccca aagccgtaca ttgggaaccg 3480gtcacacatg taagtgactg atataaaaga gaaaaaaggc gatttttccg cctaaaactc 3540tttaaaactt attaaaactc ttaaaacccg cctggcctgt gcataactgt ctggccagcg 3600cacagccgaa gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc 3660cgcttcgcgt cggcctatcg cggccgctgg ccgctcaaaa atggctggcc tacggccagg 3720caatctacca gggcgcggac aagccgcgcc gtcgccactc gaccgccggc gcccacatca 3780aggcaccctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 3840cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 3900cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 3960gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat 4020gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc 4080ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 4140ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 4200agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 4260taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 4320cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 4380tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 4440gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 4500gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 4560tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 4620gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 4680cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 4740aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 4800tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 4860ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgca 4920tgatatatct cccaatttgt gtagggctta ttatgcacgc ttaaaaataa taaaagcaga 4980cttgacctga tagtttggct gtgagcaatt atgtgcttag tgcatctaac gcttgagtta 5040agccgcgccg cgaagcggcg tcggcttgaa cgaatttcta gctagacatt atttgccgac 5100taccttggtg atctcgcctt tcacgtagtg gacaaattct tccaactgat ctgcgcgcga 5160ggccaagcga tcttcttctt gtccaagata agcctgtcta gcttcaagta tgacgggctg 5220atactgggcc ggcaggcgct ccattgccca gtcggcagcg acatccttcg gcgcgatttt 5280gccggttact gcgctgtacc aaatgcggga caacgtaagc actacatttc gctcatcgcc 5340agcccagtcg ggcggcgagt tccatagcgt taaggtttca tttagcgcct caaatagatc 5400ctgttcagga accggatcaa agagttcctc cgccgctgga cctaccaagg caacgctatg 5460ttctcttgct tttgtcagca agatagccag atcaatgtcg atcgtggctg gctcgaagat 5520acctgcaaga atgtcattgc gctgccattc tccaaattgc agttcgcgct tagctggata 5580acgccacgga atgatgtcgt cgtgcacaac aatggtgact tctacagcgc ggagaatctc 5640gctctctcca ggggaagccg aagtttccaa aaggtcgttg atcaaagctc gccgcgttgt 5700ttcatcaagc cttacggtca ccgtaaccag caaatcaata tcactgtgtg gcttcaggcc 5760gccatccact gcggagccgt acaaatgtac ggccagcaac gtcggttcga gatggcgctc 5820gatgacgcca actacctctg atagttgagt cgatacttcg gcgatcaccg cttcccccat 5880gatgtttaac tttgttttag ggcgactgcc ctgctgcgta acatcgttgc tgctccataa 5940catcaaacat cgacccacgg cgtaacgcgc ttgctgcttg gatgcccgag gcatagactg 6000taccccaaaa aaacagtcat aacaagccat gaaaaccgcc actgcg 6046579838DNAArtificial sequenceDescription of the artificial sequence Transgenic expression vector for codA dsRNA pSUN1-codA-RNAi 57cgaattcact ggccgtcgtt ttacaacgac tcagctgctt ggtaataatt gtcattagat 60tgtttttatg catagatgca ctcgaaatca gccaatttta gacaagtatc aaacggatgt 120taattcagta cattaaagac gtccgcaatg tgttattaag ttgtctaagc gtcaatttgt 180ttacaccaca atatatcctg ccaccagcca gccaacagct ccccgaccgg cagctcggca 240caaaatcacc acgcgttacc accacgccgg ccggccgcat ggtgttgacc gtgttcgccg 300gcattgccga gttcgagcgt tccctaatca tcgaccgcac ccggagcggg cgcgaggccg 360ccaaggcccg aggcgtgaag tttggccccc gccctaccct caccccggca cagatcgcgc 420acgcccgcga gctgatcgac caggaaggcc gcaccgtgaa agaggcggct gcactgcttg 480gcgtgcatcg ctcgaccctg taccgcgcac ttgagcgcag cgaggaagtg acgcccaccg 540aggccaggcg gcgcggtgcc ttccgtgagg acgcattgac cgaggccgac gccctggcgg 600ccgccgagaa tgaacgccaa gaggaacaag catgaaaccg caccaggacg gccaggacga 660accgtttttc attaccgaag agatcgaggc ggagatgatc gcggccgggt acgtgttcga 720gccgcccgcg cacgtctcaa ccgtgcggct gcatgaaatc ctggccggtt tgtctgatgc 780caagctggcg gcctggccgg ccagcttggc cgctgaagaa accgagcgcc gccgtctaaa 840aaggtgatgt gtatttgagt aaaacagctt gcgtcatgcg gtcgctgcgt atatgatgcg 900atgagtaaat aaacaaatac gcaaggggaa cgcatgaagg ttatcgctgt acttaaccag 960aaaggcgggt caggcaagac gaccatcgca acccatctag cccgcgccct gcaactcgcc 1020ggggccgatg ttctgttagt cgattccgat ccccagggca gtgcccgcga ttgggcggcc 1080gtgcgggaag atcaaccgct aaccgttgtc ggcatcgacc gcccgacgat tgaccgcgac 1140gtgaaggcca tcggccggcg cgacttcgta gtgatcgacg gagcgcccca ggcggcggac 1200ttggctgtgt ccgcgatcaa ggcagccgac ttcgtgctga ttccggtgca gccaagccct 1260tacgacatat gggccaccgc cgacctggtg gagctggtta agcagcgcat tgaggtcacg 1320gatggaaggc tacaagcggc ctttgtcgtg tcgcgggcga tcaaaggcac gcgcatcggc 1380ggtgaggttg ccgaggcgct ggccgggtac gagctgccca ttcttgagtc ccgtatcacg 1440cagcgcgtga gctacccagg cactgccgcc gccggcacaa ccgttcttga atcagaaccc 1500gagggcgacg ctgcccgcga ggtccaggcg ctggccgctg aaattaaatc aaaactcatt 1560tgagttaatg aggtaaagag aaaatgagca aaagcacaaa cacgctaagt gccggccgtc 1620cgagcgcacg cagcagcaag gctgcaacgt tggccagcct ggcagacacg ccagccatga 1680agcgggtcaa ctttcagttg ccggcggagg atcacaccaa gctgaagatg tacgcggtac 1740gccaaggcaa gaccattacc gagctgctat ctgaatacat cgcgcagcta ccagagtaaa 1800tgagcaaatg aataaatgag tagatgaatt ttagcggcta aaggaggcgg catggaaaat 1860caagaacaac caggcaccga cgccgtggaa tgccccatgt gtggaggaac gggcggttgg 1920ccaggcgtaa gcggctgggt tgtctgccgg ccctgcaatg gcactggaac ccccaagccc 1980gaggaatcgg cgtgagcggt cgcaaaccat ccggcccggt acaaatcggc gcggcgctgg 2040gtgatgacct ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa cgcatcgagg 2100cagaagcacg ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc aaagaatccc 2160ggcaaccgcc ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc gacgagcaac 2220cagatttttt cgttccgatg ctctatgacg tgggcacccg cgatagtcgc agcatcatgg 2280acgtggccgt tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg atccgctacg 2340agcttccaga cgggcacgta gaggtttccg cagggccggc cggcatggcc agtgtgtggg 2400attacgacct ggtactgatg gcggtttccc atctaaccga atccatgaac cgataccggg 2460aagggaaggg agacaagccc ggccgcgtgt tccgtccaca cgttgcggac gtactcaagt 2520tctgccggcg agccgatggc ggaaagcaga aagacgacct ggtagaaacc tgcattcggt 2580taaacaccac gcacgttgcc atgcagcgta cgaagaaggc caagaacggc cgcctggtga 2640cggtatccga gggtgaagcc ttgattagcc gctacaagat cgtaaagagc gaaaccgggc 2700ggccggagta catcgagatc gagctagctg attggatgta ccgcgagatc acagaaggca 2760agaacccgga cgtgctgacg gttcaccccg attacttttt gatcgatccc ggcatcggcc 2820gttttctcta ccgcctggca cgccgcgccg caggcaaggc agaagccaga tggttgttca 2880agacgatcta cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt ttcaccgtgc 2940gcaagctgat cgggtcaaat gacctgccgg agtacgattt gaaggaggag gcggggcagg 3000ctggcccgat cctagtcatg cgctaccgca acctgatcga gggcgaagca tccgccggtt 3060cctaatgtac ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa ggtcgaaaag 3120gtctctttcc tgtggatagc acgtacattg ggaacccaaa gccgtacatt gggaaccgga 3180acccgtacat tgggaaccca aagccgtaca ttgggaaccg gtcacacatg taagtgactg 3240atataaaaga gaaaaaaggc gatttttccg cctaaaactc tttaaaactt attaaaactc 3300ttaaaacccg cctggcctgt gcataactgt ctggccagcg cacagccgaa gagctgcaaa 3360aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt cggcctatcg 3420cggccgctgg ccgctcaaaa atggctggcc tacggccagg caatctacca gggcgcggac 3480aagccgcgcc gtcgccactc gaccgccggc gcccacatca aggcaccctg cctcgcgcgt 3540ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt 3600ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg 3660tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact 3720atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca 3780gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc 3840tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 3900tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 3960ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 4020agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 4080accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 4140ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 4200gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 4260ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 4320gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 4380taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 4440tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 4500gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 4560cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 4620agtggaacga aaactcacgt taagggattt tggtcatgca tgatatatct cccaatttgt 4680gtagggctta ttatgcacgc ttaaaaataa taaaagcaga cttgacctga tagtttggct 4740gtgagcaatt atgtgcttag tgcatctaac gcttgagtta agccgcgccg cgaagcggcg 4800tcggcttgaa cgaatttcta gctagacatt atttgccgac taccttggtg atctcgcctt 4860tcacgtagtg gacaaattct tccaactgat ctgcgcgcga ggccaagcga tcttcttctt 4920gtccaagata agcctgtcta gcttcaagta tgacgggctg atactgggcc ggcaggcgct 4980ccattgccca gtcggcagcg acatccttcg gcgcgatttt gccggttact gcgctgtacc 5040aaatgcggga caacgtaagc actacatttc gctcatcgcc agcccagtcg ggcggcgagt 5100tccatagcgt taaggtttca tttagcgcct caaatagatc ctgttcagga accggatcaa 5160agagttcctc cgccgctgga cctaccaagg caacgctatg ttctcttgct tttgtcagca 5220agatagccag atcaatgtcg atcgtggctg gctcgaagat acctgcaaga atgtcattgc 5280gctgccattc tccaaattgc agttcgcgct tagctggata acgccacgga atgatgtcgt 5340cgtgcacaac aatggtgact tctacagcgc ggagaatctc gctctctcca ggggaagccg 5400aagtttccaa aaggtcgttg atcaaagctc gccgcgttgt ttcatcaagc cttacggtca 5460ccgtaaccag caaatcaata tcactgtgtg gcttcaggcc gccatccact gcggagccgt 5520acaaatgtac ggccagcaac gtcggttcga gatggcgctc gatgacgcca actacctctg 5580atagttgagt cgatacttcg gcgatcaccg cttcccccat gatgtttaac tttgttttag 5640ggcgactgcc ctgctgcgta acatcgttgc tgctccataa catcaaacat cgacccacgg 5700cgtaacgcgc ttgctgcttg gatgcccgag gcatagactg taccccaaaa aaacagtcat 5760aacaagccat gaaaaccgcc actgcgttcc atggacatac aaatggacga acggataaac 5820cttttcacgc ccttttaaat atccgattat tctaataaac gctcttttct cttaggttta 5880cccgccaata tatcctgtca aacactgata gtttaaactg aaggcgggaa acgacaatca 5940gatctagtag gaaacagcta tgaccatgat tacgccaagc ttgcatgcct gcaggtcgac 6000tctagactag tggatccgat atcgcccggg ctcgaggtac ccatcgcgat ccccgtcacc 6060ggtgtgaggg aactagtttt gatcttgaaa gatcttttat ctttagagtt aagaactctt 6120tcgtattttg gtgaggtttt atcctcttga gttttggtca tagacctatt catggctctg 6180ataccaattt ttaagcgggg gcttatgcgg attatttctt aaattgataa ggggttatta 6240gggggtatag ggtataaata caagcattcc cttagcgtat agtataagta tagtagcgta 6300cctctatcaa atttccatct tcttaccttg cacagggcct gcaaccttat ccttccttgt 6360cttcctcctt ccttccgtcc acttcatcat atttaaacca aacctacggg ggagtcaacg 6420taaccaaccc tgccttagca tcttttccct aacggcctcc tgcctaagcg gtacttctag 6480cttcgaacgg cgtctgggct ccaggtttag tcgtctcgtg tctggtttat attcacgaca 6540aagatctata gggactttag gagatctgga ttttagtact ggattttggt tttaggaatt 6600agaaatttta ttgatagaag tattttacaa atacaaatac atactaaggg tttcttatat 6660gctcaacaca tgagcgaaac cctataagaa ccctaanttc cccttatcgg gaaactactc 6720acacattatt tatggagaaa atagagagag atagatttgt agagagagac tggtgatttc 6780agcgtaccga attcggctaa cagtgtcgaa taacgcttta caaacaatta ttaacgcccg 6840gttaccaggc gaagaggggc tgtggcagat tcatctgcag gacggaaaaa tcagcgccat 6900tgatgcgcaa tccggcgtga tgcccataac tgaaaacagc ctggatgccg aacaaggttt 6960agttataccg ccgtttgtgg agccacatat tcacctggac accacgcaaa ccgccggaca 7020accgaactgg aatcagtccg gcacgctgtt tgaaggcatt gaacgctggg ccgagcgcaa 7080agcgttatta acccatgacg atgtgaaaca acgcgcatgg caaacgctga aatggcagat 7140tgccaacggc attcagcatg tgcgtaccca tgtcgatgtt tcggatgcaa cgctaactgc 7200gctgaaagca atgctggaag tgaagcagga agtcgcgccg tggattgatc tgcaaatcgt 7260cgccttccct caggaaggga ttttgtcgga tccggtgata cctgcacatc aacaaatttt 7320ggtcatatat tagaaaagtt ataaattaaa atatacacac ttataaacta cagaaaagca 7380attgctatat actacattct tttattttga aaaaaatatt tgaaatatta tattactact 7440aattaatgat aattattata tatatatcaa aggtagaagc agaaacttac gtagtcgacg 7500acaaaatccc ttcctgaggg aaggcgacga tttgcagatc aatccacggc gcgacttcct 7560gcttcacttc cagcattgct ttcagcgcag ttagcgttgc atccgaaaca tcgacatggg 7620tacgcacatg ctgaatgccg ttggcaatct gccatttcag cgtttgccat gcgcgttgtt 7680tcacatcgtc atgggttaat aacgctttgc gctcggccca gcgttcaatg ccttcaaaca 7740gcgtgccgga ctgattccag ttcggttgtc cggcggtttg cgtggtgtcc aggtgaatat 7800gtggctccac aaacggcggt ataactaaac cttgttcggc atccaggctg ttttcagtta 7860tgggcatcac gccggattgc gcatcaatgg cgctgatttt tccgtcctgc agatgaatct 7920gccacagccc ctcttcgcct ggtaaccggg cgttaataat tgtttgtaaa gcgttattcg 7980acactgttag ccaagcttgc atgcctgcag gtcgagtctt tgttttttac tttggttcat 8040gacactcaga gacttgagag aagcaatata tagacttttt tttgtttttt ttttgtggtc 8100acgtttattt tcctattgga gacggtaacg aagatcgaac ctgtggtgga aatgaaacaa 8160ggtgggacta gcccacgtgg tttcttttct ctgcattgat ttgtttttgt tttttttgta 8220aagttcacat caaacctact aataattgag aagaaaaata aaatctattg attgattaaa 8280ccagccgatg ctttatgtct gaatataaaa aagaagtgaa aaccccgttt aagaattaca 8340acggtggttt acaaagtatt tggacacaat aaatccaaac gaaataaaac aaaatggaga 8400actaccaaat aaaaaacaaa taaaaaactt aaaagaattt attccatttt ttttcccgta 8460gaatttattc ttttatggat tccttaaatc catatttgat gcattttgat tcctcataat 8520aggtaataat atatactatg ttatagatat gtttctaatt cgtattaacc tacctttttt 8580tggtcgtacg attctaccta ataatattga acggaattga tgttttggac cacttagaaa 8640gtattttttt tttggtttgt cttagctgta tttcattaaa tataaattta aataagaaat 8700gtcataaata aaatttgacg tatagatttt ttaaatccat tttatgttat ttaatatttg 8760aaatgtgagt ttggctccta tttaatctta ggatgggtta atactaagtt ttccttaatg 8820aattatctca gagaaactgg attaaataaa ctaaaaaata gatcaatgtg ttttggtccg 8880gtcaaatatc tttggattta ctattattgg cgaaaagaaa gtctcatata gtaaatcata 8940ttcctacaag agaaatcaaa atttttgaat taacatggat tgtatagttt cttatataac 9000caattagttc gcatcaagaa aaccaaaccc caattaataa tcaaacgggc ttggtaggaa 9060tatttcattg cagctttcag ataaaagaaa aaaacacaca ctcaagtctt ttatttcatc 9120tttcttactt gcaggaactc aaattccact ttgccacttt tctttacaaa taaacacaaa 9180ttgtcaatga aacgaaatag tctttttatg caaacactgt ttgtcttttt tcgatcacgt 9240ttctgattgt gacagccatc catatatata gggaatgtaa aacaacaaca tgtgaagtca 9300catatacgta atggtttagc atagcttcta ttttcgttgt caatattagt cattccaaaa 9360catttttaag aaaaataaat taatatatgt atattcttgg aactaatgta tgtggaaata 9420cagtaactta attattaaac attctaaatg caaatatgca aagaaaaaaa agaaaagaac 9480acaactgaaa tcaaagccag attcataata attggctaca tggttgtaga atgtagggta 9540acacaacatc cagaattgaa cactcaaatt ggatgataga tggataatct ttagatacaa 9600gagaattggt tctcttccat tattaacgaa aataaagaaa aaaagtttag

cataaaagtt 9660tgaaactcaa cataacattt tgaacttgac tccttcatag gagtgacatg aactgacgaa 9720tcacaaccga ttacttgttt gagtcatctt ccgctttctc caccttcgaa atgaatgtga 9780ccggtttctt cgggtgctca tttacggtca agtgtaaaac atctggtctc gacgagct 98385814184DNAArtificial sequenceDescription of the artificial sequence Expression vector pSUN1-codA-RNAi-At.Act.-2-At.Als-R-ocsT 58ctgcttggta ataattgtca ttagattgtt tttatgcata gatgcactcg aaatcagcca 60attttagaca agtatcaaac ggatgttaat tcagtacatt aaagacgtcc gcaatgtgtt 120attaagttgt ctaagcgtca atttgtttac accacaatat atcctgccac cagccagcca 180acagctcccc gaccggcagc tcggcacaaa atcaccacgc gttaccacca cgccggccgg 240ccgcatggtg ttgaccgtgt tcgccggcat tgccgagttc gagcgttccc taatcatcga 300ccgcacccgg agcgggcgcg aggccgccaa ggcccgaggc gtgaagtttg gcccccgccc 360taccctcacc ccggcacaga tcgcgcacgc ccgcgagctg atcgaccagg aaggccgcac 420cgtgaaagag gcggctgcac tgcttggcgt gcatcgctcg accctgtacc gcgcacttga 480gcgcagcgag gaagtgacgc ccaccgaggc caggcggcgc ggtgccttcc gtgaggacgc 540attgaccgag gccgacgccc tggcggccgc cgagaatgaa cgccaagagg aacaagcatg 600aaaccgcacc aggacggcca ggacgaaccg tttttcatta ccgaagagat cgaggcggag 660atgatcgcgg ccgggtacgt gttcgagccg cccgcgcacg tctcaaccgt gcggctgcat 720gaaatcctgg ccggtttgtc tgatgccaag ctggcggcct ggccggccag cttggccgct 780gaagaaaccg agcgccgccg tctaaaaagg tgatgtgtat ttgagtaaaa cagcttgcgt 840catgcggtcg ctgcgtatat gatgcgatga gtaaataaac aaatacgcaa ggggaacgca 900tgaaggttat cgctgtactt aaccagaaag gcgggtcagg caagacgacc atcgcaaccc 960atctagcccg cgccctgcaa ctcgccgggg ccgatgttct gttagtcgat tccgatcccc 1020agggcagtgc ccgcgattgg gcggccgtgc gggaagatca accgctaacc gttgtcggca 1080tcgaccgccc gacgattgac cgcgacgtga aggccatcgg ccggcgcgac ttcgtagtga 1140tcgacggagc gccccaggcg gcggacttgg ctgtgtccgc gatcaaggca gccgacttcg 1200tgctgattcc ggtgcagcca agcccttacg acatatgggc caccgccgac ctggtggagc 1260tggttaagca gcgcattgag gtcacggatg gaaggctaca agcggccttt gtcgtgtcgc 1320gggcgatcaa aggcacgcgc atcggcggtg aggttgccga ggcgctggcc gggtacgagc 1380tgcccattct tgagtcccgt atcacgcagc gcgtgagcta cccaggcact gccgccgccg 1440gcacaaccgt tcttgaatca gaacccgagg gcgacgctgc ccgcgaggtc caggcgctgg 1500ccgctgaaat taaatcaaaa ctcatttgag ttaatgaggt aaagagaaaa tgagcaaaag 1560cacaaacacg ctaagtgccg gccgtccgag cgcacgcagc agcaaggctg caacgttggc 1620cagcctggca gacacgccag ccatgaagcg ggtcaacttt cagttgccgg cggaggatca 1680caccaagctg aagatgtacg cggtacgcca aggcaagacc attaccgagc tgctatctga 1740atacatcgcg cagctaccag agtaaatgag caaatgaata aatgagtaga tgaattttag 1800cggctaaagg aggcggcatg gaaaatcaag aacaaccagg caccgacgcc gtggaatgcc 1860ccatgtgtgg aggaacgggc ggttggccag gcgtaagcgg ctgggttgtc tgccggccct 1920gcaatggcac tggaaccccc aagcccgagg aatcggcgtg agcggtcgca aaccatccgg 1980cccggtacaa atcggcgcgg cgctgggtga tgacctggtg gagaagttga aggccgcgca 2040ggccgcccag cggcaacgca tcgaggcaga agcacgcccc ggtgaatcgt ggcaagcggc 2100cgctgatcga atccgcaaag aatcccggca accgccggca gccggtgcgc cgtcgattag 2160gaagccgccc aagggcgacg agcaaccaga ttttttcgtt ccgatgctct atgacgtggg 2220cacccgcgat agtcgcagca tcatggacgt ggccgttttc cgtctgtcga agcgtgaccg 2280acgagctggc gaggtgatcc gctacgagct tccagacggg cacgtagagg tttccgcagg 2340gccggccggc atggccagtg tgtgggatta cgacctggta ctgatggcgg tttcccatct 2400aaccgaatcc atgaaccgat accgggaagg gaagggagac aagcccggcc gcgtgttccg 2460tccacacgtt gcggacgtac tcaagttctg ccggcgagcc gatggcggaa agcagaaaga 2520cgacctggta gaaacctgca ttcggttaaa caccacgcac gttgccatgc agcgtacgaa 2580gaaggccaag aacggccgcc tggtgacggt atccgagggt gaagccttga ttagccgcta 2640caagatcgta aagagcgaaa ccgggcggcc ggagtacatc gagatcgagc tagctgattg 2700gatgtaccgc gagatcacag aaggcaagaa cccggacgtg ctgacggttc accccgatta 2760ctttttgatc gatcccggca tcggccgttt tctctaccgc ctggcacgcc gcgccgcagg 2820caaggcagaa gccagatggt tgttcaagac gatctacgaa cgcagtggca gcgccggaga 2880gttcaagaag ttctgtttca ccgtgcgcaa gctgatcggg tcaaatgacc tgccggagta 2940cgatttgaag gaggaggcgg ggcaggctgg cccgatccta gtcatgcgct accgcaacct 3000gatcgagggc gaagcatccg ccggttccta atgtacggag cagatgctag ggcaaattgc 3060cctagcaggg gaaaaaggtc gaaaaggtct ctttcctgtg gatagcacgt acattgggaa 3120cccaaagccg tacattggga accggaaccc gtacattggg aacccaaagc cgtacattgg 3180gaaccggtca cacatgtaag tgactgatat aaaagagaaa aaaggcgatt tttccgccta 3240aaactcttta aaacttatta aaactcttaa aacccgcctg gcctgtgcat aactgtctgg 3300ccagcgcaca gccgaagagc tgcaaaaagc gcctaccctt cggtcgctgc gctccctacg 3360ccccgccgct tcgcgtcggc ctatcgcggc cgctggccgc tcaaaaatgg ctggcctacg 3420gccaggcaat ctaccagggc gcggacaagc cgcgccgtcg ccactcgacc gccggcgccc 3480acatcaaggc accctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc 3540agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc 3600agggcgcgtc agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg 3660atagcggagt gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca 3720ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc 3780ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc 3840agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa 3900catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 3960tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 4020gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 4080ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 4140cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 4200caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 4260ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 4320taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 4380taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac 4440cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 4500tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 4560gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 4620catgcatgat atatctccca atttgtgtag ggcttattat gcacgcttaa aaataataaa 4680agcagacttg acctgatagt ttggctgtga gcaattatgt gcttagtgca tctaacgctt 4740gagttaagcc gcgccgcgaa gcggcgtcgg cttgaacgaa tttctagcta gacattattt 4800gccgactacc ttggtgatct cgcctttcac gtagtggaca aattcttcca actgatctgc 4860gcgcgaggcc aagcgatctt cttcttgtcc aagataagcc tgtctagctt caagtatgac 4920gggctgatac tgggccggca ggcgctccat tgcccagtcg gcagcgacat ccttcggcgc 4980gattttgccg gttactgcgc tgtaccaaat gcgggacaac gtaagcacta catttcgctc 5040atcgccagcc cagtcgggcg gcgagttcca tagcgttaag gtttcattta gcgcctcaaa 5100tagatcctgt tcaggaaccg gatcaaagag ttcctccgcc gctggaccta ccaaggcaac 5160gctatgttct cttgcttttg tcagcaagat agccagatca atgtcgatcg tggctggctc 5220gaagatacct gcaagaatgt cattgcgctg ccattctcca aattgcagtt cgcgcttagc 5280tggataacgc cacggaatga tgtcgtcgtg cacaacaatg gtgacttcta cagcgcggag 5340aatctcgctc tctccagggg aagccgaagt ttccaaaagg tcgttgatca aagctcgccg 5400cgttgtttca tcaagcctta cggtcaccgt aaccagcaaa tcaatatcac tgtgtggctt 5460caggccgcca tccactgcgg agccgtacaa atgtacggcc agcaacgtcg gttcgagatg 5520gcgctcgatg acgccaacta cctctgatag ttgagtcgat acttcggcga tcaccgcttc 5580ccccatgatg tttaactttg ttttagggcg actgccctgc tgcgtaacat cgttgctgct 5640ccataacatc aaacatcgac ccacggcgta acgcgcttgc tgcttggatg cccgaggcat 5700agactgtacc ccaaaaaaac agtcataaca agccatgaaa accgccactg cgttccatgg 5760acatacaaat ggacgaacgg ataaaccttt tcacgccctt ttaaatatcc gattattcta 5820ataaacgctc ttttctctta ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt 5880aaactgaagg cgggaaacga caatcagatc tagtaggaaa cagctatgac catgattacg 5940ccaagcttgc atgcctgcag gtcgactcta gactagtgga tccgatatcg cccgggctcg 6000aggtacccat cgcgatcccc gtcaccggtg tgagggaact agttttgatc ttgaaagatc 6060ttttatcttt agagttaaga actctttcgt attttggtga ggttttatcc tcttgagttt 6120tggtcataga cctattcatg gctctgatac caatttttaa gcgggggctt atgcggatta 6180tttcttaaat tgataagggg ttattagggg gtatagggta taaatacaag cattccctta 6240gcgtatagta taagtatagt agcgtacctc tatcaaattt ccatcttctt accttgcaca 6300gggcctgcaa ccttatcctt ccttgtcttc ctccttcctt ccgtccactt catcatattt 6360aaaccaaacc tacgggggag tcaacgtaac caaccctgcc ttagcatctt ttccctaacg 6420gcctcctgcc taagcggtac ttctagcttc gaacggcgtc tgggctccag gtttagtcgt 6480ctcgtgtctg gtttatattc acgacaaaga tctataggga ctttaggaga tctggatttt 6540agtactggat tttggtttta ggaattagaa attttattga tagaagtatt ttacaaatac 6600aaatacatac taagggtttc ttatatgctc aacacatgag cgaaacccta taagaaccct 6660aatttccctt atcgggaaac tactcacaca ttatttatgg agaaaataga gagagataga 6720tttgtagaga gagactggtg atttcagcgt accgaattcg attttcggct aacagtgtcg 6780aataacgctt tacaaacaat tattaacgcc cggttaccag gcgaagaggg gctgtggcag 6840attcatctgc aggacggaaa aatcagcgcc attgatgcgc aatccggcgt gatgcccata 6900actgaaaaca gcctggatgc cgaacaaggt ttagttatac cgccgtttgt ggagccacat 6960attcacctgg acaccacgca aaccgccgga caaccgaact ggaatcagtc cggcacgctg 7020tttgaaggca ttgaacgctg ggccgagcgc aaagcgttat taacccatga cgatgtgaaa 7080caacgcgcat ggcaaacgct gaaatggcag attgccaacg gcattcagca tgtgcgtacc 7140catgtcgatg tttcggatgc aacgctaact gcgctgaaag caatgctgga agtgaagcag 7200gaagtcgcgc cgtggattga tctgcaaatc gtcgccttcc ctcaggaagg gattttgtcg 7260gatccggtga tacctgcaca tcaacaaatt ttggtcatat attagaaaag ttataaatta 7320aaatatacac acttataaac tacagaaaag caattgctat atactacatt cttttatttt 7380gaaaaaaata tttgaaatat tatattacta ctaattaatg ataattatta tatatatatc 7440aaaggtagaa gcagaaactt acgtagtcga cgacaaaatc ccgtcctgag ggaaggcgac 7500gatttgcaga tcaatccacg gcgcgacttc ctgcttcact tccagcattg ctttcagcgc 7560agttagcgtt gcatccgaaa catcgacatg ggtacgcaca tgctgaatgc cgttggcaat 7620ctgccatttc agcgtttgcc atgcgcgttg tttcacatcg tcatgggtta ataacgcttt 7680gcgctcggcc cagcgttcaa tgccttcaaa cagcgtgccg gactgattcc agttcggttg 7740tccggcggtt tgcgtggtgt ccaggtgaat atgtggctcc acaaacggcg gtataactaa 7800accttgttcg gcatccaggc tgttttcagt tatgggcatc acgccggatt gcgcatcaat 7860ggcgctgatt tttccgtcct gcagatgaat ctgccacagc ccctcttcgc ctggtaaccg 7920ggcgttaata attgtttgta aagcgttatt cgacactgtt agccaagctt gcatgcctgc 7980aggtcgactc tagaggatcc ccgatccact cgagtctttg ttttttactt tggttcatga 8040cactcagaga cttgagagaa gcaatatata gacttttttt tgtttttttt ttgtggtcac 8100gtttattttc ctattggaga cggtaacgaa gatcgaacct gtggtggaaa tgaaacmagg 8160tgggactagc ccacgtggtt tcttttctct gcattgattt gtttttgttt tttytgtaaa 8220gttcacatca aacctactaa taattgagaa gaaaaataaa atctattgat tgattaaacc 8280agccgatgct ttatgtctga atataaaaaa gaagtgaaaa ccccgtttaa gaattacaac 8340ggtggtttac aaagtatttg gacacaataa atccaaacga aataaaacaa aatggagaac 8400taccaaataa aaaacaaata aaaaacttaa aagaatttat tccatttttt ttcccgtaga 8460atttattctt ttatggattc cttaaatcca tatttgatgc attttgattc ctcataatag 8520gtaataatat atactatgtt atagatatgt ttctaattcg tattaaccta cctttttttg 8580gtcgtacgat tctacctaat aatattgaac ggaattgatg ttttggacca cttagaaagt 8640attttttttt tggtttgtct tagctgtatt tcattaaata taaatttaaa taagaaatgt 8700cataaataaa atttgacgta tagatttttt aaatccattt tatgttattt aatatttgaa 8760atgtgagttt ggctcctatt taatcttagg atgggttaat actaagtttt ccttaatgaa 8820ttatctcaga gaaactggat taaataaact aaaaaataga tcaatgtgtt ttggtccggt 8880caaatatctt tggatttact attattggcg aaaagaaagt ctcatatagt aaatcatatt 8940cctacaagag aaatcaaaat ttttgaatta acatggattg tatagtttct tatataacca 9000attagttcgc atcaagaaaa ccaaacccca attaataatc aaacgggctt ggtaggaata 9060tttcattgca gctttcagat aaaagaaaaa aacacacact caagtctttt atttcatctt 9120tcttacttgc aggaactcaa attccacttt gccacttttc tttacaaata aacacaaatt 9180gtcaatgaaa cgaaatagtc tttttatgca aacactgttt gtcttttttc gatcacgttt 9240ctgattgtga cagccatcca tatatatagg gaatgtaaaa caacaacatg tgaagtcaca 9300tatacgtaat ggtttagcat agcttctatt ttcgttgtca atattagtca ttccaaaaca 9360tttttaagaa aaataaatta atatatgtat attcttggaa ctaatgtatg tggaaataca 9420gtaacttaat tattaaacat tctaaatgca aatatgcaaa gaaaaaaaag aaaagaacac 9480aactgaaatc aaagccagat tcataataat tggctacatg gttgtagaat gtagggtaac 9540acaacatcca gaattgaaca ctcaaattgg atgatagatg gataatcttt agatacaaga 9600gaattggttc tcttccatta ttaacgaaaa taaagaaaaa aagtttagca taaaagtttg 9660aaactcaaca taacattttg aacttgactc cttcatagga gtgacatgaa ctgacgaatc 9720acaaccgatt acttgtttga gtcatcttcc gctttctcca ccttcgaaat gaatgtgacc 9780ggtttcttcg ggtgctcatt tacggtcaag tgtaaaacat ctggtctcga gtaatgtcca 9840accgaatcga agtacaactt agctcttgct acatcaccaa gatcttgatg ggggatcggg 9900taccgagctc gaattcactg gccgtcgttt tacaacgact cagcacgcgt tggtttcgac 9960aaaatttaga acgaacttaa ttatgatctc aaatacattg atacatatct catctagatc 10020taggttatca ttatgtaaga aagttttgac gaatatggca cgacaaaatg gctagactcg 10080atgtaattgg tatctcaact caacattata cttataccaa acattagtta gacaaaattt 10140aaacaactat tttttatgta tgcaagagtc agcatatgta taattgattc agaatcgttt 10200tgacgagttc ggatgtagta gtagccatta tttaatgtac atactaatcg tgaatagtga 10260atatgatgaa acattgtatc ttattgtata aatatccata aacacatcat gaaagacact 10320ttctttcacg gtctgaatta attatgatac aattctaata gaaaacgaat taaattacgt 10380tgaattgtat gaaatctaat tgaacaagcc aaccacgacg acgactaacg ttgcctggat 10440tgactcggtt taagttaacc actaaaaaaa cggagctgtc atgtaacacg cggatcgagc 10500aggtcacagt catgaagcca tcaaagcaaa agaactaatc caagggctga gatgattaat 10560tagtttaaaa attagttaac acgagggaaa aggctgtctg acagccaggt cacgttatct 10620ttacctgtgg tcgaaatgat tcgtgtctgt cgattttaat tatttttttg aaaggccgaa 10680aataaagttg taagagataa acccgcctat ataaattcat atattttcct ctccgctttg 10740aattgtctcg ttgtcctcct cactttcatc agccgttttg aatctccggc gacttgacag 10800agaagaacaa ggaagaagac taagagagaa agtaagagat aatccaggag attcattctc 10860cgttttgaat cttcctcaat ctcatcttct tccgctcttt ctttccaagg taataggaac 10920tttctggatc tactttattt gctggatctc gatcttgttt tctcaatttc cttgagatct 10980ggaattcgtt taatttggat ctgtgaacct ccactaaatc ttttggtttt actagaatcg 11040atctaagttg accgatcagt tagctcgatt atagctacca gaatttggct tgaccttgat 11100ggagagatcc atgttcatgt tacctgggaa atgatttgta tatgtgaatt gaaatctgaa 11160ctgttgaagt tagattgaat ctgaacactg tcaatgttag attgaatctg aacactgttt 11220aaggttagat gaagtttgtg tatagattct tcgaaacttt aggatttgta gtgtcgtacg 11280ttgaacagaa agctatttct gattcaatca gggtttattt gactgtattg aactcttttt 11340gtgtgtttgc agctcataaa aaaaacgcga acctgcaggc atggcggcgg caacaacaac 11400aacaacaaca tcttcttcga tctccttctc caccaaacca tctccttcct cctccaaatc 11460accattacca atctccagat tctccctccc attctcccta aaccccaaca aatcatcctc 11520ctcctcccgc cgccgcggta tcaaatccag ctctccctcc tccatctccg ccgtgctcaa 11580cacaaccacc aatgtcacaa ccactccctc tccaaccaaa cctaccaaac ccgaaacatt 11640catctcccga ttcgctccag atcaaccccg caaaggcgct gatatcctcg tcgaagcttt 11700agaacgtcaa ggcgtagaaa ccgtattcgc ttaccctgga ggtgcatcaa tggagattca 11760ccaagcctta acccgctctt cctcaatccg taacgtcctt cctcgtcacg aacaaggagg 11820tgtattcgca gcagaaggat acgctcgatc ctcaggtaaa ccaggtatct gtatagccac 11880ttcaggtccc ggagctacaa atctcgttag cggattagcc gatgcgttgt tagatagtgt 11940tcctcttgta gcaatcacag gacaagtccc tcgtcgtatg attggtacag atgcgtttca 12000agagactccg attgttgagg taacgcgttc gattacgaag cataactatc ttgtgatgga 12060tgttgaagat atccctagga ttattgagga agctttcttt ttagctactt ctggtagacc 12120tggacctgtt ttggttgatg ttcctaaaga tattcaacaa cagcttgcga ttcctaattg 12180ggaacaggct atgagattac ctggttatat gtctaggatg cctaaacctc cggaagattc 12240tcatttggag cagattgtta ggttgatttc tgagtctaag aagcctgtgt tgtatgttgg 12300tggtggttgt ttgaattcta gcgatgaatt gggtaggttt gttgagctta cggggatccc 12360tgttgcgagt acgttgatgg ggctgggatc ttatccttgt gatgatgagt tgtcgttaca 12420tatgcttgga atgcatggga ctgtgtatgc aaattacgct gtggagcata gtgatttgtt 12480gttggcgttt ggggtaaggt ttgatgatcg tgtcacgggt aagcttgagg cttttgctag 12540tagggctaag attgttcata ttgatattga ctcggctgag attgggaaga ataagactcc 12600tcatgtgtct gtgtgtggtg atgttaagct ggctttgcaa gggatgaata aggttcttga 12660gaaccgagcg gaggagctta agcttgattt tggagtttgg aggaatgagt tgaacgtaca 12720gaaacagaag tttccgttga gctttaagac gtttggggaa gctattcctc cacagtatgc 12780gattaaggtc cttgatgagt tgactgatgg aaaagccata ataagtactg gtgtcgggca 12840acatcaaatg tgggcggcgc agttctacaa ttacaagaaa ccaaggcagt ggctatcatc 12900aggaggcctt ggagctatgg gatttggact tcctgctgcg attggagcgt ctgttgctaa 12960ccctgatgcg atagttgtgg atattgacgg agatggaagc tttataatga atgtgcaaga 13020gctagccact attcgtgtag agaatcttcc agtgaaggta cttttattaa acaaccagca 13080tcttggcatg gttatgcaat gggaagatcg gttctacaaa gctaaccgag ctcacacatt 13140tctcggggat ccggctcagg aggacgagat attcccgaac atgttgctgt ttgcagcagc 13200ttgcgggatt ccagcggcga gggtgacaaa gaaagcagat ctccgagaag ctattcagac 13260aatgctggat acaccaggac cttacctgtt ggatgtgatt tgtccgcacc aagaacatgt 13320gttgccgatg atcccgaatg gtggcacttt caacgatgtc ataacggaag gagatggccg 13380gattaaatac tgagagatga aaccggcctg gccggcccgg agtggggagg cacgatggcc 13440gctttggtcg atcgacggga tcgatcctgc tttaatgaga tatgcgagac gcctatgatc 13500gcatgatatt tgctttcaat tctgttgtgc acgttgtaaa aaacctgagc atgtgtagct 13560cagatcctta ccgccggttt cggttcattc taatgaatat atcacccgtt actatcgtat 13620ttttatgaat aatattctcc gttcaattta ctgattgtac cctactactt atatgtacaa 13680tattaaaatg aaaacaatat attgtgctga ataggtttat agcgacatct atgatagagc 13740gccacaataa caaacaattg cgttttatta ttacaaatcc aattttaaaa aaagcggcag 13800aaccggtcaa acctaaaaga ctgattacat aaatcttatt caaatttcaa aaggccccag 13860gggctagtat ctacgacaca ccgagcggcg aactaataac gttcactgaa gggaactccg 13920gttccccgcc ggcgcgcatg ggtgagattc cttgaagttg agtattggcc gtccgctcta 13980ccgaaagtta cgggcaccat tcaacccggt ccagcacggc ggccgggtaa ccgacttgct 14040gccccgagaa ttatgcagca tttttttggt gtatgtgggc cccaaatgaa gtgcaggtca 14100aaccttgaca gtgacgacaa atcgttgggc gggtccaggg cgaattttgc gacaacatgt 14160cgaggctcag caggatgggc ccag 14184591011DNAZea maysCDS(1)..(981)coding for 5-methylthioribose kinase 59gca cga gca ctc ctc tcc tct cct ctc gcc ggc gca tcg ccc gac tgt 48Ala Arg Ala Leu Leu Ser Ser Pro Leu Ala Gly Ala Ser Pro Asp Cys1 5 10 15cag tca gcc tca gcc atg gcc gcg gag gag gag cag ggc ttc cgc ccg 96Gln Ser Ala Ser Ala Met Ala Ala Glu Glu Glu Gln Gly Phe Arg Pro 20 25 30ctg gac gag tcg tcc ctg ctc gcc tac atc aag gcc acg ccg gcg ctc 144Leu Asp Glu Ser Ser Leu Leu Ala Tyr Ile Lys Ala Thr Pro Ala Leu

35 40 45gcc tcc cgc ctc ggc ggc ggt ggc agt cta gac tcc atc gag atc aag 192Ala Ser Arg Leu Gly Gly Gly Gly Ser Leu Asp Ser Ile Glu Ile Lys 50 55 60gag gtc ggc gac ggc aac ctc aac ttc gtc tac atc gtg cag tcc gag 240Glu Val Gly Asp Gly Asn Leu Asn Phe Val Tyr Ile Val Gln Ser Glu65 70 75 80gcc ggc gcc atc gtc gtc aag cag gcg ctc ccg tac gtg cgc tgc gtg 288Ala Gly Ala Ile Val Val Lys Gln Ala Leu Pro Tyr Val Arg Cys Val 85 90 95ggg gat tcg tgg ccc atg acg cgg gag cgc gcc tac ttc gag gcc tcc 336Gly Asp Ser Trp Pro Met Thr Arg Glu Arg Ala Tyr Phe Glu Ala Ser 100 105 110acg ctg cgg gag cac ggc cgc ctg tgc ccg gag cac acc ccc gag gtg 384Thr Leu Arg Glu His Gly Arg Leu Cys Pro Glu His Thr Pro Glu Val 115 120 125tac cac ttc gac cgg acc ttg tcg ctg atg ggg atg cgc tac atc gag 432Tyr His Phe Asp Arg Thr Leu Ser Leu Met Gly Met Arg Tyr Ile Glu 130 135 140ccc ccg cac atc atc ctc cgc aag ggc ctc gtc gcc ggt gtc gag tac 480Pro Pro His Ile Ile Leu Arg Lys Gly Leu Val Ala Gly Val Glu Tyr145 150 155 160ccg ctg ctc gcc gac cac atg tcc gat tac atg gcc aag acg ctc ttc 528Pro Leu Leu Ala Asp His Met Ser Asp Tyr Met Ala Lys Thr Leu Phe 165 170 175ttc acc tcc ctc ctc tat aac aat acc acg gat cat aag aac gga gtt 576Phe Thr Ser Leu Leu Tyr Asn Asn Thr Thr Asp His Lys Asn Gly Val 180 185 190gct aag tac tct gcg aac gtg gag atg tgt agg ctc acg gag caa gtt 624Ala Lys Tyr Ser Ala Asn Val Glu Met Cys Arg Leu Thr Glu Gln Val 195 200 205gtg ttc tcg gac cca tac cgt gtt tcc aaa ttt aat cgg tgg acc tcg 672Val Phe Ser Asp Pro Tyr Arg Val Ser Lys Phe Asn Arg Trp Thr Ser 210 215 220cct tat ctc gac aaa gat gct gag gca gtt cgc gag gat gat gag ctc 720Pro Tyr Leu Asp Lys Asp Ala Glu Ala Val Arg Glu Asp Asp Glu Leu225 230 235 240aag ttg gaa gta gct ggg ctg aaa tcg atg ttt atc gag aga gct caa 768Lys Leu Glu Val Ala Gly Leu Lys Ser Met Phe Ile Glu Arg Ala Gln 245 250 255gct ctg att cat gga gat ctc cac act ggt tct atc atg gtg acc gaa 816Ala Leu Ile His Gly Asp Leu His Thr Gly Ser Ile Met Val Thr Glu 260 265 270gtt caa ctc aag tca ttg atc cag aat ttg ggt tct atg ggg cca atg 864Val Gln Leu Lys Ser Leu Ile Gln Asn Leu Gly Ser Met Gly Pro Met 275 280 285ggg ttt gat att ggg agc ctt cct tgg aaa cct gat ttt ggg cat act 912Gly Phe Asp Ile Gly Ser Leu Pro Trp Lys Pro Asp Phe Gly His Thr 290 295 300atg cac aga atg ggc atg ctg atc aag cga atg atc gta agg ctt aca 960Met His Arg Met Gly Met Leu Ile Lys Arg Met Ile Val Arg Leu Thr305 310 315 320aga atg gat ctt gaa gac aat tgaagagtcg tggaatttgt tccacaaaaa 1011Arg Met Asp Leu Glu Asp Asn 32560327PRTZea mays 60Ala Arg Ala Leu Leu Ser Ser Pro Leu Ala Gly Ala Ser Pro Asp Cys1 5 10 15Gln Ser Ala Ser Ala Met Ala Ala Glu Glu Glu Gln Gly Phe Arg Pro 20 25 30Leu Asp Glu Ser Ser Leu Leu Ala Tyr Ile Lys Ala Thr Pro Ala Leu 35 40 45Ala Ser Arg Leu Gly Gly Gly Gly Ser Leu Asp Ser Ile Glu Ile Lys 50 55 60Glu Val Gly Asp Gly Asn Leu Asn Phe Val Tyr Ile Val Gln Ser Glu65 70 75 80Ala Gly Ala Ile Val Val Lys Gln Ala Leu Pro Tyr Val Arg Cys Val 85 90 95Gly Asp Ser Trp Pro Met Thr Arg Glu Arg Ala Tyr Phe Glu Ala Ser 100 105 110Thr Leu Arg Glu His Gly Arg Leu Cys Pro Glu His Thr Pro Glu Val 115 120 125Tyr His Phe Asp Arg Thr Leu Ser Leu Met Gly Met Arg Tyr Ile Glu 130 135 140Pro Pro His Ile Ile Leu Arg Lys Gly Leu Val Ala Gly Val Glu Tyr145 150 155 160Pro Leu Leu Ala Asp His Met Ser Asp Tyr Met Ala Lys Thr Leu Phe 165 170 175Phe Thr Ser Leu Leu Tyr Asn Asn Thr Thr Asp His Lys Asn Gly Val 180 185 190Ala Lys Tyr Ser Ala Asn Val Glu Met Cys Arg Leu Thr Glu Gln Val 195 200 205Val Phe Ser Asp Pro Tyr Arg Val Ser Lys Phe Asn Arg Trp Thr Ser 210 215 220Pro Tyr Leu Asp Lys Asp Ala Glu Ala Val Arg Glu Asp Asp Glu Leu225 230 235 240Lys Leu Glu Val Ala Gly Leu Lys Ser Met Phe Ile Glu Arg Ala Gln 245 250 255Ala Leu Ile His Gly Asp Leu His Thr Gly Ser Ile Met Val Thr Glu 260 265 270Val Gln Leu Lys Ser Leu Ile Gln Asn Leu Gly Ser Met Gly Pro Met 275 280 285Gly Phe Asp Ile Gly Ser Leu Pro Trp Lys Pro Asp Phe Gly His Thr 290 295 300Met His Arg Met Gly Met Leu Ile Lys Arg Met Ile Val Arg Leu Thr305 310 315 320Arg Met Asp Leu Glu Asp Asn 32561471DNABrassica napusCDS(2)..(469)coding for 5-methylthioribose kinase 61a ttt ccg ggt cga cga ttt cgt ggc aat ctc aac ttc gtt ttc atc gtc 49 Phe Pro Gly Arg Arg Phe Arg Gly Asn Leu Asn Phe Val Phe Ile Val 1 5 10 15atc gga tcc act ggc tca ctc gtc atc aaa cag gcg ctt ccg tat ata 97Ile Gly Ser Thr Gly Ser Leu Val Ile Lys Gln Ala Leu Pro Tyr Ile 20 25 30cgt tgt att ggg gag tct tgg cca atg acg aaa gaa aga gct tac ttt 145Arg Cys Ile Gly Glu Ser Trp Pro Met Thr Lys Glu Arg Ala Tyr Phe 35 40 45gaa gct aca act ctg aga aag cac gga gct ttg tct cct gat cat gtt 193Glu Ala Thr Thr Leu Arg Lys His Gly Ala Leu Ser Pro Asp His Val 50 55 60cct gaa gtc tac cat ttt gac agg acc atg gct ttg att gga atg agg 241Pro Glu Val Tyr His Phe Asp Arg Thr Met Ala Leu Ile Gly Met Arg65 70 75 80tat ctg gag cct cct cac atc atc ctc cgc aaa gga ctc gtt gct gga 289Tyr Leu Glu Pro Pro His Ile Ile Leu Arg Lys Gly Leu Val Ala Gly 85 90 95atc cag tac cct ttc ctt gca gaa cac atg gct gat tac atg gcc aaa 337Ile Gln Tyr Pro Phe Leu Ala Glu His Met Ala Asp Tyr Met Ala Lys 100 105 110acc ctc ttc ttc act tcg ctc ctc tat cat gat acc aca gag cac aaa 385Thr Leu Phe Phe Thr Ser Leu Leu Tyr His Asp Thr Thr Glu His Lys 115 120 125aga gca gta acc gag ttt tgt ggt aat gtg gag tta tgc cgg tta acg 433Arg Ala Val Thr Glu Phe Cys Gly Asn Val Glu Leu Cys Arg Leu Thr 130 135 140gag caa gta gtg ttc tct gac ccg tat aga gtt tct ag 471Glu Gln Val Val Phe Ser Asp Pro Tyr Arg Val Ser145 150 15562156PRTBrassica napus 62Phe Pro Gly Arg Arg Phe Arg Gly Asn Leu Asn Phe Val Phe Ile Val1 5 10 15Ile Gly Ser Thr Gly Ser Leu Val Ile Lys Gln Ala Leu Pro Tyr Ile 20 25 30Arg Cys Ile Gly Glu Ser Trp Pro Met Thr Lys Glu Arg Ala Tyr Phe 35 40 45Glu Ala Thr Thr Leu Arg Lys His Gly Ala Leu Ser Pro Asp His Val 50 55 60Pro Glu Val Tyr His Phe Asp Arg Thr Met Ala Leu Ile Gly Met Arg65 70 75 80Tyr Leu Glu Pro Pro His Ile Ile Leu Arg Lys Gly Leu Val Ala Gly 85 90 95Ile Gln Tyr Pro Phe Leu Ala Glu His Met Ala Asp Tyr Met Ala Lys 100 105 110Thr Leu Phe Phe Thr Ser Leu Leu Tyr His Asp Thr Thr Glu His Lys 115 120 125Arg Ala Val Thr Glu Phe Cys Gly Asn Val Glu Leu Cys Arg Leu Thr 130 135 140Glu Gln Val Val Phe Ser Asp Pro Tyr Arg Val Ser145 150 15563415DNABrassica napusCDS(3)..(413)coding for 5-methylthioribose kinase 63gg gtc gac gat ttc gtg ctg aga gca aaa gag atg tcg ttc gat gag 47 Val Asp Asp Phe Val Leu Arg Ala Lys Glu Met Ser Phe Asp Glu 1 5 10 15ttc aag ccg ttg aac gag aaa tct cta gta gag tac ata aag gca acg 95Phe Lys Pro Leu Asn Glu Lys Ser Leu Val Glu Tyr Ile Lys Ala Thr 20 25 30cct gcc ctc tcc tcc agg ctc gga gac aag tac gat gat ctg gtc atc 143Pro Ala Leu Ser Ser Arg Leu Gly Asp Lys Tyr Asp Asp Leu Val Ile 35 40 45aag gaa gtt gga gat ggc aat ctc aac ttc gtt ttc atc gtt gtc gga 191Lys Glu Val Gly Asp Gly Asn Leu Asn Phe Val Phe Ile Val Val Gly 50 55 60tcc act ggc tca ctc gtc atc aaa cag gcg ctt ccg tat ata cgt tgt 239Ser Thr Gly Ser Leu Val Ile Lys Gln Ala Leu Pro Tyr Ile Arg Cys 65 70 75att gga gaa tca tgg cca atg acg aaa gaa aga gct tac ttt gaa gca 287Ile Gly Glu Ser Trp Pro Met Thr Lys Glu Arg Ala Tyr Phe Glu Ala80 85 90 95aca act ctg aga aag cac ggt ggt ttg tct ccg gat cat gtt cct gaa 335Thr Thr Leu Arg Lys His Gly Gly Leu Ser Pro Asp His Val Pro Glu 100 105 110gtc tac cat ttt gac aga acc atg gct ttg att gga atg aga tac ctc 383Val Tyr His Phe Asp Arg Thr Met Ala Leu Ile Gly Met Arg Tyr Leu 115 120 125gag cct cct cac atc atc ctc cgc aaa gga ct 415Glu Pro Pro His Ile Ile Leu Arg Lys Gly 130 13564137PRTBrassica napus 64Val Asp Asp Phe Val Leu Arg Ala Lys Glu Met Ser Phe Asp Glu Phe1 5 10 15Lys Pro Leu Asn Glu Lys Ser Leu Val Glu Tyr Ile Lys Ala Thr Pro 20 25 30Ala Leu Ser Ser Arg Leu Gly Asp Lys Tyr Asp Asp Leu Val Ile Lys 35 40 45Glu Val Gly Asp Gly Asn Leu Asn Phe Val Phe Ile Val Val Gly Ser 50 55 60Thr Gly Ser Leu Val Ile Lys Gln Ala Leu Pro Tyr Ile Arg Cys Ile65 70 75 80Gly Glu Ser Trp Pro Met Thr Lys Glu Arg Ala Tyr Phe Glu Ala Thr 85 90 95Thr Leu Arg Lys His Gly Gly Leu Ser Pro Asp His Val Pro Glu Val 100 105 110Tyr His Phe Asp Arg Thr Met Ala Leu Ile Gly Met Arg Tyr Leu Glu 115 120 125Pro Pro His Ile Ile Leu Arg Lys Gly 130 13565424DNAOryza sativaCDS(3)..(422)coding for 5-methylthioribose kinase 65cc ctt ctc tac aac tcc acc act gat cac aag aaa gga gtt gct cag 47 Leu Leu Tyr Asn Ser Thr Thr Asp His Lys Lys Gly Val Ala Gln 1 5 10 15tac tgc gat aat gtg gag atg tgt agg ctc aca gag caa gtc gtg ttc 95Tyr Cys Asp Asn Val Glu Met Cys Arg Leu Thr Glu Gln Val Val Phe 20 25 30tca gac cca tac atg ctc gcc aaa tac aat cgt tgc aca tca ccc ttc 143Ser Asp Pro Tyr Met Leu Ala Lys Tyr Asn Arg Cys Thr Ser Pro Phe 35 40 45cta gat aat gat gct gca gcg gtt cga gag gat gct gag ctt aaa ttg 191Leu Asp Asn Asp Ala Ala Ala Val Arg Glu Asp Ala Glu Leu Lys Leu 50 55 60gag att gct gaa ttg aaa tca atg ttt att gag aga gca cag gct ctt 239Glu Ile Ala Glu Leu Lys Ser Met Phe Ile Glu Arg Ala Gln Ala Leu 65 70 75ctt cat gga gat ctc cac act ggt tcc atc atg gtg aca cca gat tct 287Leu His Gly Asp Leu His Thr Gly Ser Ile Met Val Thr Pro Asp Ser80 85 90 95act caa gtg att gat cca gaa ttt gct ttc tat ggc cca atg ggt tac 335Thr Gln Val Ile Asp Pro Glu Phe Ala Phe Tyr Gly Pro Met Gly Tyr 100 105 110gac att ggg gcc ttc ctg ggg aac ttg att ttg gca tat ttt tca caa 383Asp Ile Gly Ala Phe Leu Gly Asn Leu Ile Leu Ala Tyr Phe Ser Gln 115 120 125gat gga cac gct gat caa gca aat gat cgt aag gct tac aa 424Asp Gly His Ala Asp Gln Ala Asn Asp Arg Lys Ala Tyr 130 135 14066140PRTOryza sativa 66Leu Leu Tyr Asn Ser Thr Thr Asp His Lys Lys Gly Val Ala Gln Tyr1 5 10 15Cys Asp Asn Val Glu Met Cys Arg Leu Thr Glu Gln Val Val Phe Ser 20 25 30Asp Pro Tyr Met Leu Ala Lys Tyr Asn Arg Cys Thr Ser Pro Phe Leu 35 40 45Asp Asn Asp Ala Ala Ala Val Arg Glu Asp Ala Glu Leu Lys Leu Glu 50 55 60Ile Ala Glu Leu Lys Ser Met Phe Ile Glu Arg Ala Gln Ala Leu Leu65 70 75 80His Gly Asp Leu His Thr Gly Ser Ile Met Val Thr Pro Asp Ser Thr 85 90 95Gln Val Ile Asp Pro Glu Phe Ala Phe Tyr Gly Pro Met Gly Tyr Asp 100 105 110Ile Gly Ala Phe Leu Gly Asn Leu Ile Leu Ala Tyr Phe Ser Gln Asp 115 120 125Gly His Ala Asp Gln Ala Asn Asp Arg Lys Ala Tyr 130 135 14067404DNAGlycine maxCDS(3)..(404)coding for 5-methylthioribose kinase 67ta atc ccc gaa cat gtt cct gaa gtg tat cac ttt gac cgt acc atg 47 Ile Pro Glu His Val Pro Glu Val Tyr His Phe Asp Arg Thr Met 1 5 10 15tct ttg atc ggt atg cgt tac ttg gag ccc cca cat ata atc ctc ata 95Ser Leu Ile Gly Met Arg Tyr Leu Glu Pro Pro His Ile Ile Leu Ile 20 25 30aaa ggg ttg att gct ggg att gag tac cct ttt ttg gct gaa cac atg 143Lys Gly Leu Ile Ala Gly Ile Glu Tyr Pro Phe Leu Ala Glu His Met 35 40 45gct gat ttc atg gcg aag aca ctc ttc ttc acg tct ctg ctt ttc cgt 191Ala Asp Phe Met Ala Lys Thr Leu Phe Phe Thr Ser Leu Leu Phe Arg 50 55 60tcc act gct gac cac aaa cgg gac gtt gcc gaa ttt tgt ggg aat gtg 239Ser Thr Ala Asp His Lys Arg Asp Val Ala Glu Phe Cys Gly Asn Val 65 70 75gag tta tgc agg ctc act gaa cag gtc gtt ttc tct gac cct tat aaa 287Glu Leu Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp Pro Tyr Lys80 85 90 95gtt tct caa tat aat cgt tgg act tcc ccc tat ctt gat cgt gat gct 335Val Ser Gln Tyr Asn Arg Trp Thr Ser Pro Tyr Leu Asp Arg Asp Ala 100 105 110gag gct gtt cgg gaa gac aat ctg ctg aag ctt gaa gtt gct gag ctg 383Glu Ala Val Arg Glu Asp Asn Leu Leu Lys Leu Glu Val Ala Glu Leu 115 120 125aaa tcc aag ttc att gag agc 404Lys Ser Lys Phe Ile Glu Ser 13068134PRTGlycine max 68Ile Pro Glu His Val Pro Glu Val Tyr His Phe Asp Arg Thr Met Ser1 5 10 15Leu Ile Gly Met Arg Tyr Leu Glu Pro Pro His Ile Ile Leu Ile Lys 20 25 30Gly Leu Ile Ala Gly Ile Glu Tyr Pro Phe Leu Ala Glu His Met Ala 35 40 45Asp Phe Met Ala Lys Thr Leu Phe Phe Thr Ser Leu Leu Phe Arg Ser 50 55 60Thr Ala Asp His Lys Arg Asp Val Ala Glu Phe Cys Gly Asn Val Glu65 70 75 80Leu Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp Pro Tyr Lys Val 85 90 95Ser Gln Tyr Asn Arg Trp Thr Ser Pro Tyr Leu Asp Arg Asp Ala Glu 100 105 110Ala Val Arg Glu Asp Asn Leu Leu Lys Leu Glu Val Ala Glu Leu Lys 115 120 125Ser Lys Phe Ile Glu Ser 1306921DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 69cgtgaatacg gcgtggagtc g 217020DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 70cggcaggata atcaggttgg 207120DNAArtificial sequenceDescription of the artificial sequence oligonucleotide primer 71gtcaacgtaa ccaaccctgc 207211PRTArtificial sequenceSequence motif 72Glu Xaa Gly Asp Gly Asn Xaa Asn Xaa Val Xaa1 5 107311PRTArtificial sequenceSequence motif 73Glu Val Gly Asp Gly Asn Leu Asn Xaa Val Xaa1 5 10749PRTArtificial sequenceSequence motif 74Lys Gln Ala Leu Pro Tyr Xaa Arg Cys1 57511PRTArtificial sequenceSequence motif 75Ser Trp Pro Met Thr Xaa Glu Arg Ala Tyr Phe1 5 10769PRTArtificial sequenceSequence motif 76Pro Glu Val Tyr His

Phe Asp Arg Thr1 57710PRTArtificial sequenceSequence motif 77Gly Met Arg Tyr Xaa Glu Pro Pro His Ile1 5 107813PRTArtificial sequenceSequence motif 78Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp Pro Tyr1 5 10798PRTArtificial sequenceSequence motif 79His Gly Asp Leu His Xaa Gly Ser1 5807PRTArtificial sequenceNuclear localization sequence NLS1 80Pro Lys Thr Lys Arg Lys Val1 5817PRTArtificial sequenceNuclear localization sequence NLS2 81Pro Lys Lys Lys Arg Lys Val1 58285DNAArtificial sequenceRecognition sequence for DSBI enzyme CRE 82aactctcatc gcttcggata acttcctgtt atccgaaaca tatcactcac tttggtgatt 60tcaccgtaac tgtctatgat taatg 858348DNAArtificial sequenceRecognition sequence for DSBI enzyme FLP 83gaagttccta ttccgaagtt cctattctct agaaagtata ggaacttc 488458DNAArtificial sequenceRecognition sequence for DSBI enzyme R 84cgagatcata tcactgtgga cgttgatgaa agaatacgtt attctttcat caaatcgt 588523DNAArtificial sequenceRecognition sequence for DSBI enzyme P-element transposase 85ctagatgaaa taacataagg tgg 238639DNAArtificial sequenceRecognition sequence for DSBI enzyme I-AniI 86ttgaggaggt ttctctgtaa ataannnnnn nnnnnnnnn 398739DNAArtificial sequenceRecognition sequence for DSBI enzyme I-AniI 87aactcctcca aagagacatt tattnnnnnn nnnnnnnnn 398824DNAArtificial sequenceRecognition sequence for DSBI enzyme I-DdiI 88ttttttggtc atccagaagt atat 248924DNAArtificial sequenceRecognition sequence for DSBI enzyme I-DdiI 89aaaaaaccag taggtcttca tata 249030DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CvuI 90ctgggttcaa aacgtcgtga gacagtttgg 309130DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CvuI 91gacccaagtt ttgcagcact ctgtcaaacc 309230DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CsmI 92gtactagcat ggggtcaaat gtctttctgg 309318DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CmoeI 93tcgtagcagc tcacggtt 189418DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CmoeI 94agcatcgtcg agtgccaa 189530DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CreI 95ctgggttcaa aacgtcgtga gacagtttgg 309630DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CreI 96gacccaagtt ttgcagcact ctgtcaaacc 309730DNAArtificial sequenceRecognition sequence for DSBI enzyme I-ChuI 97gaaggtttgg cacctcgatg tcggctcatc 309830DNAArtificial sequenceRecognition sequence for DSBI enzyme I-ChuI 98cttccaaacc gtggagctac agccgagtag 309923DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CpaI 99cgatcctaag gtagcgaaat tca 2310023DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CpaI 100gctaggattc catcgcttta agt 2310120DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CpaII 101cccggctaac tctgtgccag 2010220DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CpaII 102gggccgattg agacacggtc 2010329DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CeuI 103cgtaactata acggtcctaa ggtagcgaa 2910429DNAArtificial sequenceRecognition sequence for DSBI enzyme I-CeuI 104gcattgatat tgccaggatt ccatcgctt 2910530DNAArtificial sequenceRecognition sequence for DSBI enzyme I-DmoI 105atgccttgcc gggtaagttc cggcgcgcat 3010630DNAArtificial sequenceRecognition sequence for DSBI enzyme I-DmoI 106tacggaacgg cccattcaag gccgcgcgta 3010730DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceI 107agttacgcta gggataacag ggtaatatag 3010830DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceI 108tcaatgcgat ccctattgtc ccattatatc 3010918DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceI 109tagggataac agggtaat 1811018DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceI 110atccctattg tcccatta 1811129DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceII 111ttttgattct ttggtcaccc tgaagtata 2911229DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceII 112aaaactaaga aaccagtggg acttcatat 2911329DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceIII 113attggaggtt ttggtaacta tttattacc 2911429DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceIII 114taacctccaa aaccattgat aaataatgg 2911529DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceIV 115tcttttctct tgattagccc taatctacg 2911629DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceIV 116agaaaagaga actaatcggg attagatgc 2911724DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceV 117aataattttc ttcttagtaa tgcc 2411824DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceV 118ttattaaaag aagaatcatt acgg 2411924DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceVI 119gttatttaat gttttagtag ttgg 2412024DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceVI 120caataaatta caaaatcatc aacc 2412128DNAArtificial sequenceRecognition sequence for DSBI enzyme I-SceVII 121tgtcacattg aggtgcacta gttattac 2812230DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-SceI 122atctatgtcg ggtgcggaga aagaggtaat 3012330DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-SceI 123tagatacagc ccacgcctct ttctccatta 3012424DNAArtificial sequenceRecognition sequence for DSBI enzyme F-SceI 124gatgctgtag gcataggctt ggtt 2412524DNAArtificial sequenceRecognition sequence for DSBI enzyme F-SceI 125ctacgacatc cgtatccgaa ccaa 2412620DNAArtificial sequenceRecognition sequence for DSBI enzyme F-SceII 126ctttccgcaa cagtaaaatt 2012720DNAArtificial sequenceRecognition sequence for DSBI enzyme F-SceII 127gaaaggcgtt gtcattttaa 2012824DNAArtificial sequenceRecognition sequence for DSBI enzyme I-HmuI 128agtaatgagc ctaacgctca gcaa 2412924DNAArtificial sequenceRecognition sequence for DSBI enzyme I-HmuI 129tcattactcg gattgcgagt cgtt 2413063DNAArtificial sequenceRecognition sequence for DSBI enzyme I-HmuII 130agtaatgagc ctaacgctca acaannnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnn 6313124DNAArtificial sequenceRecognition sequence for DSBI enzyme I-LlaI 131cacatccata accatatcat tttt 2413224DNAArtificial sequenceRecognition sequence for DSBI enzyme I-LlaI 132gtgtaggtat tggtatagta aaaa 2413330DNAArtificial sequenceRecognition sequence for DSBI enzyme I-MsoI 133ctgggttcaa aacgtcgtga gacagtttgg 3013430DNAArtificial sequenceRecognition sequence for DSBI enzyme I-MsoI 134gacccaagtt ttgcagcact ctgtcaaacc 3013521DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NanI 135aagtctggtg ccagcacccg c 2113621DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NanI 136ttcagaccac ggtcgtgggc g 2113721DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NitI 137aagtctggtg ccagcacccg c 2113821DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NitI 138ttcagaccac ggtcgtgggc g 2113921DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NjaI 139aagtctggtg ccagcacccg c 2114021DNAArtificial sequenceRecognition sequence for DSBI enzyme I-NjaI 140ttcagaccac ggtcgtgggc g 2114130DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PakI 141ctgggttcaa aacgtcgtga gacagtttgg 3014230DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PakI 142gacccaagtt ttgcagcact ctgtcaaacc 3014325DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PorI 143gcgagcccgt aagggtgtgt acggg 2514425DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PorI 144cgctcgggca ttcccacaca tgccc 2514529DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PpoI 145taactatgac tctcttaagg tagccaaat 2914629DNAArtificial sequenceRecognition sequence for DSBI enzyme I-PpoI 146attgatactg agagaattcc atcggttta 2914728DNAArtificial sequenceRecognition sequence for DSBI enzyme I-ScaI 147tgtcacattg aggtgcacta gttattac 2814828DNAArtificial sequenceRecognition sequence for DSBI enzyme I-ScaI 148acagtgtaac tccacgtgat caataatg 2814919DNAArtificial sequenceRecognition sequence for DSBI enzyme I-Ssp6803I 149gtcgggctca taacccgaa 1915019DNAArtificial sequenceRecognition sequence for DSBI enzyme I-Ssp6803I 150cagcccgagt attgggctt 1915130DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PfuI 151gaagatggga ggagggaccg gactcaactt 3015230DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PfuI 152cttctaccct cctccctggc ctgagttgaa 3015329DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PfuII 153acgaatccat gtggagaaga gcctctata 2915429DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PfuII 154tgcttaggta cacctcttct cggagatat 2915519DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PkoI 155gattttagat ccctgtacc 1915619DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PkoI 156ctaaaatcta gggacatgg 1915715DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PkoII 157cagtactacg gttac 1515815DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PkoII 158gtcatgatgc caatg 1515930DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PspI 159aaaatcctgg caaacagcta ttatgggtat 3016030DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-PspI 160ttttaggacc gtttgtcgat aatacccata 3016126DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TfuI 161tagattttag gtcgctatat ccttcc 2616226DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TfuI 162atctaaaatc cagcgatata ggaagg 2616322DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TfuII 163taygcngaya cngacggytt yt 2216422DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TfuII 164atrcgnctrt gnctgccraa ra 2216522DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-ThyI 165taygcngaya cngacggytt yt 2216622DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-ThyI 166atrcgnctrt gnctgccraa ra 2216722DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TliI 167taygcngaya cngacggytt yt 2216822DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TliI 168atrcgnctrt gnctgccraa ra 2216930DNAArtificial sequenceRecognition sequence for DSBI enzyme PI-TliII 169aaattgcttg caaacagcta ttacggctat 3017024DNAArtificial sequenceRecognition sequence for DSBI enzyme I-TevI 170agtggtatca acgctcagta gatg 2417124DNAArtificial sequenceRecognition sequence for DSBI enzyme I-TevI 171tcaccatagt tgcgagtcat ctac 2417230DNAArtificial sequenceRecognition sequence for DSBI enzyme I-TevII 172gcttatgagt atgaagtgaa cacgttattc 3017330DNAArtificial sequenceRecognition sequence for DSBI enzyme I-TevII 173cgaatactca tacttcactt gtgcaataag 3017438DNAArtificial sequenceRecognition sequence for DSBI enzyme F-TevI 174gaaacacaag aaatgtttag taaannnnnn nnnnnnnn 3817538DNAArtificial sequenceRecognition sequence for DSBI enzyme F-TevI 175ctttgtgttc tttacaaatc atttnnnnnn nnnnnnnn 3817629DNAArtificial sequenceRecognition sequence for DSBI enzyme F-TevII 176tttaatcctc gcttcagata tggcaactg 2917729DNAArtificial sequenceRecognition sequence for DSBI enzyme F-TevII 177aaattaggag cgaagtctat accgttgac 29178403PRTClostridium tetani 178Met Ser Arg Phe Asp Ser His Phe Arg Met Glu Thr Glu Asp Ala Ile1 5 10 15Leu Tyr Ala Lys Glu Lys Leu Gly Ile Phe Asp Glu His Ala Lys Leu 20 25 30Gln Ala Glu Glu Ile Gly Asp Gly Asn Ile Asn Tyr Val Phe Lys Val 35 40 45Trp Asp Val Asn Thr Lys Lys Ser Val Ile Ile Lys His Ala Asp Ile 50 55 60Phe Leu Arg Ser Ser Gly Arg Glu Leu Asp Val Asp Arg Asn Arg Ile65 70 75 80Glu Ala Glu Val Leu Met Leu Gln Gly Ile Leu Ala Pro Gly Leu Val 85 90 95Pro Lys Val Tyr Lys Tyr Asp Ser Val Met Cys Asn Leu Ser Met Glu 100 105 110Asp Ile Ser Asp His Arg Asn Leu Arg Lys Glu Leu Leu Lys Arg Asn 115 120 125Thr Phe Pro Ser Phe Ala Glu His Ile Thr Thr Phe Ile Val Asp Thr 130 135 140Leu Leu Pro Thr Thr Asp Leu Val Met Asp Ser Gly Glu Lys Lys Asp145 150 155 160Asn Val Lys Lys Tyr Ile Asn Lys Asp Leu Cys Lys Ile Ser Glu Asp 165 170 175Leu Val Phe Thr Glu Pro Phe Ile Asp Tyr Lys Ser Arg Asn Thr Val 180 185 190Leu Glu Glu Asn Ile Glu Phe Val Lys Arg Gln Leu Tyr Glu Asp Lys 195 200 205Glu Leu Ile Leu Glu Ala Gly Lys Leu Lys Asn Asn Phe Met Asn Asn 210 215 220Ser Gln Ala Leu Ile His Gly Asp Leu His Ser Gly Ser Ile Phe Val225 230 235 240Asn Glu Glu Ser Thr Lys Ile Leu Asp Pro Glu Phe Ala Phe Tyr Gly 245 250 255Pro Ile Gly Tyr Asp Leu Gly Asn Val Ile Gly Asn Leu Phe Phe Ala 260 265 270Trp Ala Asn Ala Tyr Val Thr Glu Asp Gly Lys Glu Val Glu Glu Phe 275 280 285Thr Ile Trp Ile Glu Lys Thr Ile Glu Asn Ile Leu Glu Leu Phe Lys 290 295 300Glu Lys Phe Ile Lys Lys Tyr Lys Glu Ile Val Thr Asp Val Met Ala305 310 315 320Lys Glu Glu Tyr Tyr Met Asn Trp Tyr Leu His Ser Ile Leu Ser Asp 325 330 335Thr Ala Gly Gln Val Gly Leu Glu Ile Ile Arg Arg Val Val Gly Asp 340 345 350Ser Lys Val Leu Asp Ile Thr Ser Ile Thr Asp Ile Asn Lys Arg Val 355 360 365Lys Ala Glu Arg Ile Leu Ile Leu Ser Ala Lys Thr Phe Ile Lys Asn 370 375 380Arg His Lys Ile Lys Thr Gly Lys Arg Tyr Val Glu Ile Phe Asn Ser385 390 395 400Asn Met Tyr179197PRTUnknownConsensus sequence 179Leu Val Ala Lys Leu Gly Asp Leu Glu Val Gly Asp Gly Asn Leu Asn1 5 10 15Phe Val Phe Val Gly Leu Val Ile Lys Gln Ala Leu Pro Tyr Ile Arg 20 25 30Cys Ile Gly Glu Ser Trp Pro Met Thr Glu Arg Ala Glu Ala Thr Leu 35 40 45His Gly Leu Ser Pro Asp His Val Pro Glu Val Tyr His Phe Asp Arg 50 55

60Thr Met Ala Leu Ile Gly Met Arg Tyr Leu Glu Pro Pro His Ile Ile65 70 75 80Leu Arg Lys Gly Leu Ile Ala Ile Tyr Pro Ala Asp His Met Asp Tyr 85 90 95Met Ala Thr Leu Phe Thr Ser Leu Leu Tyr Thr Asp His Lys Val Ala 100 105 110Phe Asn Val Glu Leu Cys Arg Leu Thr Glu Gln Val Val Phe Ser Asp 115 120 125Pro Tyr Val Ser Phe Asn Arg Thr Ser Pro Tyr Leu Asp Asp Ala Ala 130 135 140Val Arg Glu Asp Leu Lys Leu Glu Val Ala Leu Lys Ser Phe Ile Glu145 150 155 160Ala Gln Ala Leu Ile His Gly Asp Leu His Thr Gly Ser Ile Val Ser 165 170 175Ile Asp Glu Phe Ala Phe Tyr Gly Pro Met Gly Phe Asp Ile Gly Ile 180 185 190Gly Asn Leu Ala Tyr 195

Claims

1-10. (canceled)

11. An amino acid sequence coding for a plant 5-methylthioribose kinase, wherein said amino acid sequence comprises at least one sequence selected from the group consisting of SEQ ID NO; 60, 62, 64, 66, and 68.

12. A nucleic acid sequence coding for a plant 5-methylthioribose kinase, wherein said nucleic acid sequence comprises at least one sequence selected from the group consisting of SEQ ID NO: 59, 61, 63, 65, and 67.

13. A double-stranded RNA molecule, comprisinga) a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least a part of the "sense" RNA transcript of a nucleic acid sequence coding for a marker protein, andb) an "antisense" RNA strand which is essentially complementary to the RNA sense strand under a).

14. The double-stranded RNA molecule as claimed in claim 13, wherein the marker protein is selected from the group consisting ofa) a cytosine deaminase which converts directly or indirectly a 5-fluorocytosine;b) a cytochrome P-450 enzyme which converts directly or indirectly a proherbicide;c) an indoleacetic acid hydrolase which converts directly or indirectly an auxin amide compound or a naphthaleneacetamide;d) a haloalkane dehalogenase which converts directly or indirectly a dihaloalkane;e) a thymidine kinase which converts directly or indirectly Acyclovir, Ganciclovir, or 1,2-deoxy-2-fluoro-.beta.-D-arabinofuranosil-5-iodouracil;f) a guanine phosphoribosyl transferase, a hypoxanthine phosphoribosyl transferase, or a xanthine guanine phosphoribosyl transferase which converts directly or indirectly a 6-thioxanthine or an allopurinol;g) a purine nucleoside phosphorylase which converts directly or indirectly a 6-methylpurine deoxyribonucleoside;h) a phosphonate monoester hydrolase which converts directly or indirectly a glycerylglyphosate;i) an indoleacetamide synthase and an indoleacetamide hydrolase which convert directly or indirectly an indolacetamide;j) an indoleacetamide hydrolase which converts directly or indirectly a naphthaleneacetamide;k) an adenine phosphoribosyl transferase which converts directly or indirectly a 4-aminopyrazolopyrimidine;l) a methoxinine dehydrogenase or a rhizobitoxin synthase which converts directly or indirectly a 2-amino-4-methoxybutanoic acid;m) a 5-methylthioribose kinase which converts directly or indirectly a 5-(trifluoromethyl)thioribose; andn) an alcohol dehydrogenase which converts directly or indirectly an allyl alcohol.

15. The double-stranded RNA molecule as claimed in claim 13, wherein the "sense" RNA strand and the "antisense" RNA strand are covalently linked to one another in the form of an inverted repeat.

16. A transgenic expression cassette, comprising a nucleic acid sequence which codes for a double-stranded RNA molecule as claimed in claim 13 and which is functionally linked to a promoter functional in plant organisms.

17. A transgenic vector, comprising a transgenic expression cassette as claimed in claim 16.

18. A transgenic plant organism, comprisinga) a double-stranded RNA molecule as claimed in claim 13,b) a transgenic expression cassette comprising said double-stranded RNA molecule which is functionally linked to a promoter functional in plant organisms, orc) a transgenic vector comprising said transgenic expression cassette.

19. The transgenic plant organism as claimed in claim 18, selected from the group of plants consisting of wheat, oats, millet, barley, rye, corn, rice, buckwheat, sorghum, triticale, spelt, linseed, sugar cane, oilseed rape, cress, arabidopsis, cabbage species, soybean, alfalfa, pea, bean plants, peanut, potato, tobacco, tomato, eggplant, paprika, sunflower, tagetes, lettuce, calendula, melon, pumpkin, and zucchini.

20. A tissue, an organ, a part, a cell, a cell culture or propagation material, derived from a transgenic plant organism as claimed in claim 18.

21. A double-stranded RNA molecule, comprisinga) a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least a part of the "sense" RNA transcript of a nucleic acid sequence coding for a marker protein, andb) an "antisense" RNA strand which is fully complementary to the RNA sense strand under a).

22. The double-stranded RNA molecule as claimed in claim 13, wherein the marker protein comprisesa) a polypeptide encoded by a sequence described by the GenBank accession number S56903, M32238, N0003308, AE009419, AB016260, N0002147, M26950, J02224, V00470, V00467, U10247, M13422, X00221, M60917, U44852, M61151, AF039169, AB025110, AF212863, AC079674, X77943, M12196, AF172282, X04049, or AF253472; orb) a polypeptide comprising the sequence according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48.

23. The double-stranded RNA molecule as claimed in claim 21, wherein the "sense" RNA strand and the "antisense" RNA strand are covalently linked to one another in the form of an inverted repeat.

24. The double-stranded RNA molecule as claimed in claim 21, wherein the marker protein is selected from the group consisting ofa) a cytosine deaminase which converts directly or indirectly a 5-fluorocytosine;b) a cytochrome P-450 enzyme which converts directly or indirectly a proherbicide;c) an indoleacetic acid hydrolase which converts directly or indirectly an auxin amide compound or a naphthaleneacetamide;d) a haloalkane dehalogenase which converts directly or indirectly a dihaloalkane;e) a thymidine kinase which converts directly or indirectly Acyclovir, Ganciclovir, or 1,2-deoxy-2-fluoro-.beta.-D-arabinofuranosil-5-iodouracil;f) a guanine phosphoribosyl transferase, a hypoxanthine phosphoribosyl transferase, or a xanthine guanine phosphoribosyl transferase which converts directly or indirectly a 6-thioxanthine or an allopurinol;g) a purine nucleoside phosphorylase which converts directly or indirectly a 6-methylpurine deoxyribonucleoside;h) a phosphonate monoester hydrolase which converts directly or indirectly a glycerylglyphosate;i) an indoleacetamide synthase and an indoleacetamide hydrolase which convert directly or indirectly an indolacetamide;j) an indoleacetamide hydrolase which converts directly or indirectly a naphthaleneacetamide;k) an adenine phosphoribosyl transferase which converts directly or indirectly a 4-aminopyrazolopyrimidine;l) a methoxinine dehydrogenase or a rhizobitoxin synthase which converts directly or indirectly a 2-amino-4-methoxybutanoic acid;m) a 5-methylthioribose kinase which converts directly or indirectly a 5-(trifluoromethyl)thioribose; andn) an alcohol dehydrogenase which converts directly or indirectly an allyl alcohol.

25. The double-stranded RNA molecule as claimed in claim 21, wherein the marker protein comprisesa) a polypeptide encoded by a sequence described by the GenBank accession number S56903, M32238, N0003308, AE009419, AB016260, N0002147, M26950, J02224, V00470, V00467, U10247, M13422, X00221, M60917, U44852, M61151, AF039169, AB025110, AF212863, AC079674, X77943, M12196, AF172282, X04049, or AF253472; orb) a polypeptide comprising the sequence according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48