Patent application title: COMPOSITIONS AND METHODS OF USING CRMP-1 AND ITS FRAGMENTS FOR TREATING CANCER
Inventors:
Harn-Jing Terng (Banciao City, TW)
Yi-Jen Lee (Keelung City, TW)
Woan-Jen Lee (Yonghe City, TW)
Assignees:
ADVPHARMA, INC.
IPC8 Class: AA61K3816FI
USPC Class:
514 12
Class name: Designated organic active ingredient containing (doai) peptide containing (e.g., protein, peptones, fibrinogen, etc.) doai 25 or more peptide repeating units in known peptide chain structure
Publication date: 2010-07-01
Patent application number: 20100168028
Claims:
1. An isolated polypeptide, which is a fragment of CRMP-1 protein that
comprises the amino acid sequence of SEQ ID NO: 1, wherein the isolated
polypeptide has no longer than 500 amino acid residues in length and is
active in inhibiting the proliferation, metastasis, and/or invasion of a
cancer cell.
2. An isolated polypeptide according to claim 1, comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 17, 19, 21, 23, 25, and 39-43.
3. The isolated polypeptide of claim 2, wherein the polypeptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 17 and 39.
4. An isolated polypeptide according to claim 1, the amino acid sequence of which is selected from the group consisting of SEQ ID NOs: 15, 17, 19, 21, 23, 25, and 39-43.
5. An isolated polypeptide according to claim 1, the amino acid sequence of which is selected from the group consisting of SEQ ID NOs: 17 and 39.
6. An isolated polypeptide according to claim 1, which is encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 18, 20, 22, 24, 26 and 33-38.
7. An isolated polypeptide according to claim 1, which is encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 18 and 34.
8. A method of making the isolated polypeptide of claim 1, comprising the step of:(a) constructing a recombinant vector comprising:(i) at least one regulatory element; and(ii) a nucleic acid insert encoding the isolated polypeptide, comprising the nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 18, 20, 22, 24, 26, 33, 34, 35, 36, 37, and 38, linked in translation frame to the at least one regulatory element;wherein the vector does not fully encode SEQ ID NO:1, and wherein the isolated polypeptide has no longer than 500 amino acid residues in length and is active in inhibiting the proliferation, metastasis, and/or invasion of a cancer cell; and(b) transfecting a host cell with the recombinant vector from step (a); and(c) inducing the expression of the nucleic acid insert in the host cell to obtain the isolated polypeptide.
9. A fusion protein consisting of:(a) a protein transduction domain (PTD); and(b) an isolated polypeptide according to claim 1, operably linked to the PTD.
10. A fusion protein consisting of:(a) a protein transduction domain (PTD); and(b) an isolated polypeptide according to claim 3, operably linked to the PTD.
11. A fusion protein consisting of:(a) a protein transduction domain (PTD); and(b) an isolated polypeptide according to claim 5, operably linked to the PTD.
12. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 1 and a pharmaceutically acceptable carrier.
13. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 2 and a pharmaceutically acceptable carrier.
14. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 3 and a pharmaceutically acceptable carrier.
15. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 4 and a pharmaceutically acceptable carrier.
16. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 5 and a pharmaceutically acceptable carrier.
17. A composition comprising a therapeutically effective amount of an isolated polypeptide according to claim 6 and a pharmaceutically acceptable carrier.
18. A method of inhibiting the proliferation, metastasis, and/or invasion of a cancer cell in a patient in need thereof, comprising the step of administering an effective amount of the composition of claim 12.
19. A method of inhibiting the proliferation, metastasis, and/or invasion of a cancer cell in a patient in need thereof, comprising the step of administering an effective amount of the composition of claim 14.
20. A method of inhibiting the proliferation, metastasis, and/or invasion of a cancer cell in a patient in need thereof, comprising the step of administering an effective amount of the composition of claim 16.
Description:
PRIORITY CLAIM
[0001]This application is a Divisional of U.S. application Ser. No. 12/076,722, filed Mar. 21, 2008, which status is allowed and claims the priority of U.S. Provisional Application Ser. No. 60/907,189, filed on Mar. 23, 2007, all of which are herein incorporated by reference in their entireties.
BACKGROUND OF THE INVENTION
[0002]The present invention relates to active fragments of collapsin response mediator protein-1 (CRMP-1), methods for treating cancer with active fragments of hCRMP-1, and methods for inhibiting the proliferation of cancer using CRMP-1 and active fragments of CRMP-1.
[0003]Collapsin response mediator protein-1 (CRMP-1), also named as dihydropyrimidinase related protein-1 (DRP-1), is a 62 kDa phosphoprotein. CRMP-1 was originally discovered in the brain tissue and thought to be a brain specific protein involved in the collapsin-induced growth cone collapse during neural development. Torres et al., DNA Res., 5(6): 393-395 (1998).
[0004]Collapsin response mediator proteins (CRMPs) belong to a family of phosphoproteins, which mediate semaphorin/collapsin-induced growth cone collapse and are believed to be involved in both axonal guidance and neuronal differentiation. CRMPs are expressed mainly in the nervous system, especially during embryogenesis. Immunocytochemical studies have shown that CRMPs are distributed in the lamellipodia and filopodia of the growth cone, the shaft of axons, and the neuronal cell body. Their expression and phosphorylation are spatially and temporally regulated during development although their molecular mechanisms of action are yet to be clearly.
[0005]The members of CRMPs bear the sequence homology to UNC-33, a nematode protein, whose absence produces aberrant elongation of axons and uncoordinated movement in the worm Caenorhabditis elegans. Li et al., Genetics, 132(3): 675-689 (1992). CRMP family members have a 50%-70% amino acid sequence homology. Five members of the CRMP gene family (crmp-1, crmp-2, crmp-3, crmp-4, and crmp-5), encoding closely related 60-66 kDa proteins, have been independently cloned by various laboratories. Each CRMP is believed to have a unique function. The members of the CRMP family have been referred to as CRMP (collapsin response mediator protein), TOAD-64 (turned on after division of a 64 kD protein), Ulip (UNC-33 like phosphoprotein), DRP (dihydropyrimidinase related protein) and TUC (TOAD/Ulip/CRMP). Nonetheless, the most frequently used name in medical literature is CRMP.
[0006]Transcription of the CRMP gene is differentially regulated. Inagaki et al., Histochem. Cell Biol., 113:37-41 (2000); Matsuo et al., J. Biol. Chem., 275(22): 16560-16568 (2000); Quach et al., Gene, 242(1-2): 175-182 (2000). Mouse CRMP-1, CRMP-4 and CRMP-5 are mainly expressed in the fetal brain and not in the brain of the adult mice. On the other hand, CRMP-2 and CRMP-3 are expressed in the brain of both the fetal and the adult mice. However, in the adult mice, CRMP-3 is localized in the cerebellum. In PC-12 cells, after induction of neuronal differentiation by nerve growth factor (NGF), CRMP-4 was strongly up-regulated, whereas CRMP-1 and CRMP-2 only increased slightly and CRMP-3 was down-regulated. Byk et al., Eur. J. Biochem. 254: 14-24 (1998). At this time, only the promoter of human CRMP-4 has been isolated and analyzed. Matsuo et al., J. Biol. Chem., 275(22): 16560-16568 (2000). No studies of the regulatory elements of other members of the CRMP family have been conducted.
[0007]Recent works reported that the level of expression of the gene encoding human CRMP-1 (hereinafter "hCRMP-1 gene") inversely affects cancer invasion and metastasis, (i.e., the higher the level of expression, the lower the incidence of cancer invasion and metastasis) and thus characterized the human CRMP-1 gene as an invasion-suppression gene. The following studies found that low-expression patients of hCRMP-1 had more advanced diseases and lymph node metastases, while high-expression patients of hCRMP-1 had a significantly longer disease-free and overall survival period. Shih et al., J. Natl. Cancer Inst., 93(18): 1392-1400 (2001); Chu et al., Am. J. Respir. Cell Mol. Biol., 17: 353-360 (1997); and Shih et al., Clinical & Exper. Metastasis, 20: 69-76 (2003).
[0008]However, the reports cited above only examined the biological activities of full-length hCRMP-1 protein; the effect of fragments of hCRMP-1 was unknown and the active portions of the full-length protein had not been identified. Further, the prior art only reported the effect of CRMP-1 on metastasis and invasion; any effect on cell proliferation had not been identified.
[0009]In accordance with the present invention, certain active fragments have now been discovered and are advantageous in that they can be produced much more easily than the full-length CRMP-1 and in larger quantities, yet still retain all or most of the original biological activities against tumor cells. This would make commercial production more economically and technically feasible.
[0010]In addition, it is surprising that certain active fragments achieve better and broader antiproliferative effect on cancer cells than the full-length CRMP-1. For example, CN3, as discussed herein, shows certain improved results over full-length hCRMP-1. Other fragments also exhibit better selectivity in antiproliferative effect on cancer cells than the full-length CRMP-1. For example, the CN5 and CN7 fragments showed good selectivity in inhibiting growth of lung cancer cells while not affecting the growth of normal cells. Such selectivity was not observed when using the full-length CRMP-1. In addition, where the full-length CRMP-1 protein showed suppression of growth of normal cells, certain fragments such as CN5 showed no such side effect, further illustrating that these fragments have advantages over the prior art. There has thus been a long-felt and unfulfilled need in the art to identify active fragments of CRMP-1 so as to allow the large-scale production of protein fragments having the same or better activity as the full-length protein.
[0011]Additionally, there has been a need to identify additional agents that act on cell proliferation. As discussed above, it was previously believed that full-length CRMP-1 did not inhibit cell proliferation based on studies in lung cancer cells; however, it has now been determined that full-length CRMP-1 inhibits proliferation in prostate cancer, colon cancer, and breast cancer. It has also been determined that, despite prior studies, full-length CRMP-1 inhibits lung cancer cells to a lesser extent. For example, using poorly differenciated human lung adenocarcinoma cells established from a patient, Shih et al. observed no antiproliferative activity of full-length CRMP-1, see J. Natl. Cancer Inst., 93(18): 1392-1400 (2001). In contrast, our experiments showed full-length CRMP-1 has antiproliferative activity towards the human lung large-cell carcinoma cells H460.
SUMMARY OF INVENTION
[0012]An aspect of the invention includes an active fragment of CRMP-1 comprising an amino acid sequence chosen from SEQ ID NO: 15, 17, 19, 21, 23, 25, and 39-43, wherein the fragment inhibits the proliferation, metastasis, and/or invasion of cancer and further wherein the active fragment is from 109 to 500 amino acids in length. In certain embodiments, the active fragment comprises SEQ ID NO: 17. In additional embodiments, the fragment is a fusion protein further comprising a TAT sequence.
[0013]In yet other embodiments, the active fragment comprises an amino acid sequence chosen from sequences at least 95% identical to SEQ ID NO: 15, 17, 19, 21, 23, 25, and 39-43 wherein the active fragment inhibits the proliferation, metastasis, and/or invasion of cancer and further wherein the active fragment is from 109 to 500 amino acids in length.
[0014]Another embodiment of the invention further includes a nucleic acid sequence encoding an active fragment of CRMP-1 comprising a sequence chosen from SEQ ID NO: 16, 18, 20, 22, 24, 26, 33, 34, 35, 36, 37, and 38, wherein the active fragment inhibits the proliferation, metastasis, and/or invasion of cancer and further wherein the nucleic acid sequence is from 327 to 1500 nucleic acids in length. In certain embodiments, the nucleic acid sequence comprises SEQ ID NO: 18. In other embodiments, the nucleic acid sequence encodes a fusion protein of the active fragment of CRMP-1 and a TAT sequence.
[0015]In other embodiments, the invention includes a nucleic acid sequence encoding an active fragment of CRMP-1 comprising a nucleic acid sequence chosen from sequences at least 95% identical to SEQ ID NO: 16, 18, 20, 22, 24, 26, 33, 34, 35, 36, 37, and 38, wherein the active fragment inhibits the proliferation, metastasis, and/or invasion of cancer and further wherein the nucleic acid sequence is from 327 to 1440 nucleic acids in length.
[0016]One embodiment of the invention further comprises a method for treating cancer comprising administering the active fragment of CRMP-1 of claim 1 to a patient in need thereof and allowing the active fragment of CRMP-1 to inhibit the proliferation, metastasis, and/or invasion of the cancer cells.
[0017]In yet another embodiment, the active fragment of CRMP-1 is administered substantially concurrently with a chemotherapeutic agent and wherein the active fragment of CRMP-1 further enhances the effectiveness of the chemotherapeutic agent, such as, but not limited to, paclitaxel.
[0018]In a further embodiment, the invention includes a method of inhibiting the proliferation of cancer comprising administering CRMP-1 to a patient in need thereof and allowing the CRMP-1 to inhibit proliferation of the cancer cell.
[0019]Additionally, one embodiment of the invention includes a vector for expression of an active fragment of CRMP-1 comprising: [0020](a) at least one regulatory element and [0021](b) an encoding portion consisting essentially of a nucleic acid sequence encoding an active fragment of CRMP-1 comprising a sequence chosen from SEQ ID NO: 16, 18, 20, 22, 24, 26, 33, 34, 35, 36, 37, and 38, wherein the active fragment inhibits the proliferation, metastasis, and/or invasion of cancer and further wherein the encoding portion of the vector is from 327 to 1440 nucleic acids in length. Variants of the active fragments of CRMP-1 may also be utilized in the vector.
[0022]In certain embodiments the vector is a viral vector, and in other embodiments it is chosen from an astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, or togavirus viral vector. In other embodiments, at least one regulatory element is a tissue-specific regulatory element.
DESCRIPTION OF THE FIGURES
[0023]FIG. 1 shows the amino acid sequence of human CRMP-1 (SEQ ID NO: 1).
[0024]FIG. 2 shows the nucleic acid sequence of the gene encoding human CRMP-1 (SEQ ID NO: 2, GenBank Accession No. D78012, NCBI). This sequence is a cDNA sequence.
[0025]FIG. 3 shows the nucleic acid sequence (SEQ ID NO: 3) of a forward primer used in PCR to amplify hCRMP-1.
[0026]FIG. 4 shows the nucleic acid sequence (SEQ ID NO: 4) of a reverse primer used in PCR to amplify hCRMP-1.
[0027]FIG. 5 shows the nucleic acid sequence (SEQ ID NO: 5) of a primer used for construction of the CN1 DNA fragment of hCRMP-1.
[0028]FIG. 6 shows the nucleic acid sequence (SEQ ID NO: 6) of a primer used for construction of the CN3 DNA fragment of hCRMP-1.
[0029]FIG. 7 shows the nucleic acid sequence (SEQ ID NO: 7) of a primer used for construction of the CN4 DNA fragment corresponding to CN4 domain of hCRMP-1.
[0030]FIG. 8 shows the nucleic acid sequence (SEQ ID NO: 8) of a reverse primer used for construction of the CN1, CN3, and CN4 DNA fragments of hCRMP-1.
[0031]FIG. 9 shows the nucleic acid sequence (SEQ ID NO: 9) of a forward primer used for construction of the CN5 DNA fragment of hCRMP-1.
[0032]FIG. 10 shows the nucleic acid sequence (SEQ ID NO: 10) of a forward primer used for construction of the CN6 DNA fragment of hCRMP-1.
[0033]FIG. 11 shows the nucleic acid sequence (SEQ ID NO: 11) of a forward primer used for construction of the CN7 DNA fragment of hCRMP-1.
[0034]FIG. 12 shows the nucleic acid sequence (SEQ ID NO: 12) of a reverse primer used for construction of the CN5 DNA fragment of hCRMP-1.
[0035]FIG. 13 shows the nucleic acid sequence (SEQ ID NO: 13) of a reverse primer used for construction of the CN6 DNA fragment of hCRMP-1.
[0036]FIG. 14 shows the nucleic acid sequence (SEQ ID NO: 14) of a reverse primer used for construction of the CN7 DNA fragment of hCRMP-1.
[0037]FIG. 15 shows the amino acid sequence (SEQ ID NO: 15) of the CN1 domain of hCRMP-1.
[0038]FIG. 16 shows the nucleic acid sequence (SEQ ID NO: 16) used to construct the CN1 domain of hCRMP-1.
[0039]FIGS. 17A-B shows the amino acid sequence (SEQ ID NO: 17 and 39) of the CN3 domain of hCRMP-1, with and without a N-terminal methionine, respectively.
[0040]FIG. 18 shows the nucleic acid sequence (SEQ ID NO: 18) used to construct the CN3 domain of hCRMP-1.
[0041]FIGS. 19A-B shows the amino acid sequence (SEQ ID NO: 19 and 40) of the CN4 domain of hCRMP-1, with and without a N-terminal methionine, respectively.
[0042]FIG. 20 shows the nucleic acid sequence (SEQ ID NO: 20) used to construct the CN4 domain of hCRMP-1.
[0043]FIGS. 21A-B shows the amino acid sequence (SEQ ID NO: 21 and 41) of the CN5 domain of hCRMP-1, with and without both a N-terminal methionine and a C-terminal His tag, respectively.
[0044]FIG. 22 shows the nucleic acid sequence (SEQ ID NO: 22) used to construct the CN5 domain of hCRMP-1.
[0045]FIGS. 23A-B shows the amino acid sequence (SEQ ID NO: 23 and 42) of the CN6 domain of hCRMP-1, with and without both a N-terminal methionine and a C-terminal His tag, respectively.
[0046]FIG. 24 shows the nucleic acid sequence (SEQ ID NO: 24) used to construct the CN6 domain of hCRMP-1.
[0047]FIGS. 25A-B shows the amino acid sequence (SEQ ID NO: 25 and 43) of the CN7 domain of hCRMP-1, with and without both a N-terminal methionine and a C-terminal His tag, respectively.
[0048]FIG. 26 shows the nucleic acid sequence (SEQ ID NO: 26) used to construct the CN7 domain of hCRMP-1.
[0049]FIG. 27 shows the nucleic acid sequence (SEQ ID NO: 27) of a forward primer for heterologous expression of hCRMP-1 in E. coli.
[0050]FIG. 28 shows the nucleic acid sequence (SEQ ID NO: 28) of a reverse primer for heterologous expression of hCRMP-1 in E. coli.
[0051]FIG. 29 shows the nucleic acid sequence (SEQ ID NO: 29) of a forward primer for heterologous expression of the CN3 domain of hCRMP-1 in E. coli.
[0052]FIG. 30 shows the nucleic acid sequence (SEQ ID NO: 30) of a reverse primer for heterologous expression of the CN3 domain of hCRMP-1 in E. coli.
[0053]FIG. 31 shows the nucleic acid sequence (SEQ ID NO: 31) of a nucleotide fragment used for construction of expression plasmid pETAT.
[0054]FIG. 32 shows the nucleic acid sequence (SEQ ID NO: 32) of a nucleotide fragment used for construction of expression plasmid pETAT.
[0055]FIG. 33 shows the nucleic acid sequence (SEQ ID NO: 33) encoding the CN1 domain of hCRMP-1.
[0056]FIG. 34 shows the nucleic acid sequence (SEQ ID NO: 34) encoding the CN3 domain of hCRMP-1.
[0057]FIG. 35 shows the nucleic acid sequence (SEQ ID NO: 35) encoding the CN4 domain of hCRMP-1.
[0058]FIG. 36 shows the nucleic acid sequence (SEQ ID NO: 36) encoding the CN5 domain of hCRMP-1.
[0059]FIG. 37 shows the nucleic acid sequence (SEQ ID NO: 37) encoding the CN6 domain of hCRMP-1.
[0060]FIG. 38 shows the nucleic acid sequence (SEQ ID NO: 38) encoding the CN7 domain of hCRMP-1.
DETAILED DESCRIPTION OF THE INVENTION
I. Active Fragments of CRMP-1
[0061]One aspect of the present invention includes active fragments of CRMP-1 with no more than 500 amino acids, which have retained and in some instances even exceeded the activity of the full-length CRMP-1 protein. These fragments have been named CN1, CN3, CN4, CN5, CN6, and CN7. The active fragments of the invention inhibit proliferation, metastasis, and invasion of cancer. While not limited to activity in the certain cell types, the following activities have been shown.
TABLE-US-00001 TABLE 1 REPRESENTATIVE ACTIVE FRAGMENTS Relationship Activity/ Fragment SEQ ID to full-length Tissue Type Name FIGS. NOS. hCRMP-1* Demonstrated CN1 FIG. 15 SEQ ID 1-480 of some inhibition to lung cancer NO: 15 SEQ ID NO: 1 cells CN3 FIG. 17A-B SEQ ID 208-480 of colon cancer cell CC-M1 and NOS: 17 SEQ ID NO: 1 DLD-1; lung cancer cell H520; and 39 prostate cancer cells PC-3 and DU145; breast cancer cell MCF-7 CN4 FIG. 19A-B SEQ ID 315-480 of some inhibition to lung cancer NOS: 19 SEQ ID NO: 1 cells and 40 CN5 FIG. 21A-B SEQ ID 154-262 of lung cancer cell H520, with no NOS: 21 SEQ ID NO: 1 observed side effect to normal and 41 cell; colon cancer cells CC-M1 and DLD-1; breast cancer cell MCF-7 CN6 FIG. 23A-B SEQ ID 205-320 of prostate cancer cell DU145; NOS: 23 SEQ ID NO: 1 breast cancer cell MCF-7; colon and 42 cancer cell CC-M1 and some inhibition to colon cancer cell DLD-1 CN7 FIG. 25A-B SEQ ID 458-572 of lung cancer cell H520, with no NOS: 25 SEQ ID NO: 1 side effect to normal cells; breast and 43 cancer cell MCF-7; prostate cancer cell DU145; colon cancer cell DLD-1 *Certain figures and sequences contain an N-terminal methionine, or both an N-terminal methionine and a C-terminal His tag, that are not present in the native sequence and reference positions exclude these additional elements.
[0062]Active fragments of the invention also include sequences with addition, deletion, or substitution mutations when compared to the sequence identified in the table above. Such active fragments may be at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequences specifically identified in this application (as shown in FIGS. 15, 17, 19, 21, 23, and 25).
[0063]Variants of active fragments also include conservative substitutions, which are substitutions of amino acids of the same category, such as substitutions of amino acids with non-charged side-chains (such as asparagine, glutamine, serine, threonine and tyrosine), of amino acids with basic side-chains (such as lysine, arginine and histidine), of amino acids with acid side-chains (such as aspartic acid and glutamic acid), and of amino acids with apolar side-chains (such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan and cysteine). Additionally, variants include substitution of natural amino acids with unnatural amino acids or pseudo amino acids, in positions such that these modifications do not significantly impair the biological activity of the active fragments.
[0064]In certain embodiments the active fragments are 480, 273, 166, 116, 115, 109 amino acids or shorter. In other embodiments, the active fragments are from 100 to 500, 125 to 475, 150 to 450, 175 to 425, 200 to 400, 225 to 375, 250 to 350, 260 to 340, or 275 to 325 amino acids long. In yet other embodiments the fragments are 500, 475, 450, 425, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, or 125 amino acids or shorter.
[0065]Such variants may be prepared recombinantly or may be derived from CRMP-1 variants from other species. Thus, the CRMP-1 of the invention may be of human origin, or from non-human primates, rat, or mice species.
[0066]Some CRMP-1 fragments contain one additional methionine (represented as symbol "M" in amino acid sequence listings) in the expression construct in order to build an "open reading frame" and can be expressed as protein in mammalian cells or in prokaryote cell (e.g. E. coli). In some embodiments of the invention, methionine residues may be added to the beginning of each fragment; in other embodiments, they may be removed. It is specifically envisioned as an embodiment of the invention that each sequence described or shown herein with a methionine residue may be constructed without one; likewise each sequence shown without this element may be constructed with it.
[0067]In other embodiments, fusion proteins can be prepared to increase the effectiveness or stability of the active fragments of the invention. For example, the active fragments of the invention can be fused to a transcriptional activator of transcription (TAT) sequence. TAT is an 86-amino acid protein involved in the replication of human immunodeficiency virus type-1 (HIV-1). Studies have shown that the TAT protein has a unique potential to enter cells in culture when added exogenously, see Harada et al., Breast Cancer, Vol. 13(1): 16-26 (2006). The TAT peptide has been used extensively for directing the intracellular delivery of macromolecules for treatment. A variety of TAT-fusion proteins have been described which link the TAT coding sequence to the protein coding sequence of interest, see Albarran et al., Protein Engineering, Design & Selection, Vol. 18(3): 147-152 (2005). Conjugation of the active fragments, such as CN3, to the TAT sequence may improve translocation of the fragments into the cancer cells and, hence, increase the efficacy of the active fragments. It is specifically envisioned as an embodiment of the invention that each sequence described or shown herein with a TAT-fusion may be constructed without this element; likewise each sequence shown without a TAT-fusion may be constructed with it.
[0068]In another embodiment, a His tag may be affixed to the fragment using recombinant technologies to aid in protein purification. In one embodiment, the His tag may have 4, 5, 6, 7, 8, 9, or 10 His residues. It is specifically envisioned as an embodiment of the invention that each sequence described or shown herein with a His tag may be constructed without one; likewise each sequence shown without this element may be constructed with it.
II. Nucleic Acid Sequences Encoding the Active Fragments of CRMP-1
[0069]The invention also includes isolated nucleic acids encoding the hCRMP-1 active fragments of CRMP-1 CN1, CN3, CN4, CN5, CN6, and CN7); such nucleic acids have no more than 1500 bases. Representative sequences encoding these fragments are identified in the following table. As is common in the art, the nucleic acids were amplified using PCR primers, therefore, in certain embodiments additional non-coding primer sequences are included in the invention on the 3' and/or 5' end, as shown in the table as well. In other embodiments, the nucleic acids exactly encode the fragments without any N-terminal methionine or C-terminal His tag. Additionally, owing to the degeneracy of the genetic code, additional sequences are contemplated that encode the same amino acid sequences. As discussed above, regarding the amino acid sequences, it is specifically envisioned as an embodiment of the invention that each sequence described or shown herein encoding a methionine, TAT fusion, and/or His tag may be constructed without one; likewise each sequence shown without these elements may be constructed with them.
TABLE-US-00002 TABLE 2 NUCLEIC ACIDS ENCODING ACTIVE FRAGMENTS Exactly Encoding Containing Additional Fragment Without Non-Coding Non-Coding Primer, Added Primer Sequences on N-terminal Methionine** Fragment 3' and/or 5' End* or C-terminal His Tag Name FIG. SEQ ID NO FIG. SEQ ID NO CN1 FIG. 16 SEQ ID NO: 16 FIG. 33 SEQ ID NO: 33 CN3 FIG. 18 SEQ ID NO: 18 FIG. 34 SEQ ID NO: 34 CN4 FIG. 20 SEQ ID NO: 20 FIG. 35 SEQ ID NO: 35 CN5 FIG. 22 SEQ ID NO: 22 FIG. 36 SEQ ID NO: 36 CN6 FIG. 24 SEQ ID NO: 24 FIG. 37 SEQ ID NO: 37 CN7 FIG. 26 SEQ ID NO: 26 FIG. 38 SEQ ID NO: 38 *Certain of these sequences also contain an additional ATG encoding for methionine that is not present in the corresponding portion of the CRMP-1 full-length sequence, or an additional methionine encoding ATG and a His tag encoding portion. **For FIG. 33 and SEQ ID NO: 33 an ATG encoding methionine is included because the N-terminus of CN1 corresponds to the N-terminus of the CRMP-1 full-length protein.
[0070]The various nucleotide or peptide sequences of the invention may be of artificial or non-artificial origin. They may be DNA or RNA sequences, obtained by screening sequence banks by means of probes developed on the basis of the original sequences. Banks of this type may be prepared by conventional techniques of molecular biology known to a person skilled in the art.
[0071]The nucleotide sequences according to the invention may also be prepared by chemical synthesis or alternatively by mixed methods, including the chemical or enzymatic modification of sequences obtained by screening bands. These nucleotide sequences permit the production of nucleotide probes that are capable of hybridizing strongly and specifically with a sequence of nucleic acids, of a genomic DNA or a messenger RNA encoding a peptide according to the invention, or an active fragment thereof.
[0072]Nucleic acids encoding the active fragments of the invention also include sequences with addition, deletion, or substitution mutations when compared to the sequences identified in the table above, such nucleic acid sequences may be sequences at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequences identified in this application (as shown in FIGS. 16, 18, 20, 22, 24, and 26).
[0073]Such variants may be prepared recombinantly or may be derived from CRMP-1 variants from other species. Thus, the CRMP-1 of the invention may be of human origin, or from non-human primates, rat, or mice species.
[0074]Additionally, sequences hybridizing with sequences shown in FIGS. 16, 18, 20, 22, 24, and 26, or their complementary sequences under stringent conditions are included in this invention. Stringent conditions include, for example, 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.2×SSC/0.1% SDS at 42° C. (see Ausubel, et al (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, stringent conditions may, for example, include 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. (see Ausubel, et al (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, N.Y.). Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point for the specific sequence at a defined ionic strength and pH. Stringent hybridization may, for example, be in 5×SSC and 50% formamide at 42° C. and washing in a wash buffer consisting of 0.1×SSC at 65° C. Washes for stringent hybridization may for example be of at least 15 minutes, 30 minutes, 45 minutes, 60 minutes, 75 minutes, 90 minutes, 105 minutes or 120 minutes.
[0075]In certain embodiments, the active fragments are 1440, 819, 498, 348, 345, 327 nucleic acids or shorter. In other embodiments, the active fragments are from 300 to 1500, 375 to 1425, 450 to 1350, 525 to 1275, 600 to 1200, 675 to 1125, 750 to 1050, 780 to 1020, 825 to 975, 300 to 900, 325 to 500, 375 to 525, or 300 to 400 nucleic acids long. In yet other embodiments the fragments are 1500, 1425, 1350, 1275, 1125, 1050, 755, 900, 825, 750, 675, 600, 525, 450, or 375 nucleic acids or shorter.
III. Methods of Using the Active Fragments of CRMP-1
[0076]A. Method of Treatment
[0077]The active fragments of the invention may be used in a method for treating cancer comprising administering at least one active fragment of CRMP-1 to a patient in need thereof and allowing the active fragment(s) to inhibit the proliferation, metastasis, and/or invasion of the cancer cells. The proliferation inhibition effect of certain CRMP-1 fragments was shown in colon, breast, lung, and prostate cancer cell lines. Specifically, at least one fragment demonstrated activity in each of the cell line.
[0078]The result indicates that the hCRMP-1 fragments are highly selective and could be applied as therapeutic agents with the expectation of low side effects. Additionally, certain cell fragments show better and broader inhibition effects to cancer cell growth than the full-length CRMP-1. Thus, while it is expected that the fragments will inhibit multiple types of cancer in different tissue types, it has presently been demonstrated that cancers of the colon, breast, lung, and prostate can be inhibited by at least one fragment of the invention. More specifically, at least one fragment inhibits lung adenocarcinoma, lung squamous cell carcinoma, lung large-cell carcinoma, prostate adenocarcinoma, prostate carcinoma, colon adenocarcinoma, and breast ductal carcinoma.
[0079]In certain embodiments, the patient is a mammal, and in other embodiments human. Veterinary treatment methods are also contemplated and include farm animals, such as horses, cows, pigs, family pets, such as dogs or cats, and other animals including non-human primates, rats, and mice.
[0080]Yet further, the present invention concerns the use of a combination of active CRMP-1 fragments with at least one chemotherapeutic agent. Administration of these active fragments substantially concurrently enhances the effectiveness of the chemotherapeutic agent(s). This may, in some embodiments, advantageously increase the chemosensitivity of cancer cells and thus allow for lower doses of these chemotherapeutic agents. This can also substantially reduce unwanted and problematic side effects.
[0081]Chemotherapeutic agents include COX-2 inhibitors such as caffeic acid phenethyl ester (CAPE), cell cycle-specific antibiotics such as Adriamycin® (doxorubicin), and cell cycle G2 phase-specific drugs such as paclitaxel. Alternative chemotherapeutic agents include alkylating agents such as cisplatin, carboplatin, cyclophosphamide, and oxaliplatin; anti-metabolites such as azathioprine, 5-fluorouracil; plant alkaloids and terpenoids such as vinca alkaloids and podophyllotoxin; and type I and II topoisomerase inhibitors such as camptothecins, etoposide, and teniposide. Additionally, mixtures of these agents may be used.
[0082]Substantially concurrently includes administration of the fragments prior to, concurrently with, or subsequent to the administration of a chemotherapy agent. It includes treatments that are 1 minute apart, 2 minutes apart, 3 minutes apart, 4 minutes apart, 5 minutes apart, 10 minutes apart, 20 minutes apart, 30 minutes apart, 1 hour apart, 2 hours apart, 1 day apart, 2 days apart, or are included in the same treatment cycle.
[0083]B. Formulation and Routes of Administration
[0084]One embodiment of the present invention relates to a pharmaceutical composition comprising at least one active fragment of CRMP-1 and at least one pharmaceutically acceptable carrier.
[0085]Depending on the particular cancer to be treated, administration of pharmaceutical compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Topical administration would be particularly advantageous for treatment of skin cancers. Alternatively, administration will be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
[0086]In certain embodiments, pharmaceutical formulations will include active fragment(s) of CRMP-1 in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or the like. Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent nonspecific binding, extend half-life, etc. The CRMP-1 fragment and an additional anticancer drug may be administered separately or in combination as a single composition. Thus, the formulations may be provided as a single formulation or as a multicomponent kit. Methods of formulation are well known in the art and are disclosed, for example, in Remington's Pharmaceutical Sciences, Gennaro, ed., Mack Publishing Co., Easton Pa., 1990, which is incorporated herein by reference.
[0087]Where clinical application of a composition is contemplated, it will be necessary to prepare the pharmaceutical composition appropriate for the intended application. Generally this will entail preparing a pharmaceutical composition that is essentially free of impurities that could be harmful to humans or animals. One also will generally desire to employ appropriate salts and buffers to render the pharmaceutical composition stable and allow for uptake by target cells.
[0088]In a further embodiment of the present invention, the active fragments may be used with a time-release means such as, for example, liposomes and polysaccharides for effecting continual dosing of said fragments. Time-release formulations generally include a monolithic delivery device comprising biocompatible solutions, gels, pastes, and putties in a matrix, in which the composition is entrapped or dissolved. Release from such a timed-release composition occurs by diffusion through the matrix and/or erosion of the matrix. A reservoir system, where the pharmaceutical composition diffuses through a membrane, may also be used.
[0089]In certain embodiments, ex vivo therapies also are contemplated. Ex vivo therapies involve the removal, from a patient, of target cells. The cells are treated outside the patient's body and then returned. One example of ex vivo therapy would involve a variation of autologous bone marrow transplant. Many times, ABMT fails because some cancer cells are present in the withdrawn bone marrow, and return of the bone marrow to the treated patient results in repopulation of the patient with cancer cells. In one embodiment, however, the withdrawn bone marrow cells could be treated while outside the patient with a viral particle that targets and kills the cancer cell. Once the bone marrow cells are "purged," they can be reintroduced into the patient. Such an embodiment would be beneficial for cancers of the blood.
[0090]C. Dosage Amount and Frequency
[0091]Physicians skilled in the art would be able to dose the active fragments of the invention, as well as any contemplated combination therapy, designing both dosage amounts and dosage frequency.
[0092]The effective amount refers to an amount of the composition that is capable of producing a medically desirable result in a treated subject. Take tumor treatment as an example, compared to an untreated subject, the desirable result comprises the inhibition of proliferation, metastasis, and/or invasion, and may decrease of tumor mass, growth rate, metastasis, alleviation of symptoms, extension of life, and/or improvement of life quality. The exact dosage for administration depends on the types, extent or symptom of the disease, as well as the health conditions, age, sex, weight, or drug toleration of the subject to be administered. The amount for administration also varies with the extent, severity, and type of tumor. One skilled in the art can decide the suitable dosage for administration according the foregoing or other factors.
[0093]The treatments may include various "unit doses." Unit dose is defined as containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. Also of import is the subject to be treated, in particular, the state of the subject and the protection desired. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time.
[0094]Generally, compositions of the present invention are administered to a patient at a dose ranging from about 1 μg/kg to about 20 mg/kg, about 1 μg/kg to about 10 mg/kg, about 1 μg/kg to about 1 mg/kg, about 10 μg/kg to about 100 μg/kg, about 1.0 μg/kg to about 1 mg/kg, about 100 μg/kg to about 1 mg/kg, about 100 μg/kg to about 10 mg/kg, or about 200 μg/kg to about 1 mg/kg. For example, compositions of the present invention can be administered at a dose ranging from about 80 μg to about 1600 mg, about 80 μg to about 800 mg, about 80 μg to about 80 mg, about 800 μg to about 8 mg, about 800 μg to about 80 mg, about 8 mg to about 80 mg, about 8 mg to about 800 mg, or about 16 mg to about 80 mg. In another example, compositions of the present invention can be administered at a dose ranging from about 50 μg to about 1000 mg, about 50 μg to about 500 mg, about 50 μg to about 50 mg, about 500 μg to about 5 mg, about 500 μg to about 50 mg, about 5 mg to about 50 mg, or about 5 mg to about 500 mg, or about 10 mg to about 50 mg.
IV. Methods of Using the Nucleic Acid Sequences Encoding the Active Fragments of CRMP-1
[0095]One aspect of the present invention relates to an expression vector that can be a "plasmid," which includes a circular double stranded DNA into which additional DNA segments can be introduced.
[0096]The expression vectors of the present invention comprise a polynucleotide encoding active fragments of CRMP-1. The expression vectors also include one or more regulatory sequences operably linked to the polynucleotide being expressed. These regulatory sequences are selected based on the type of host cell used. It will be appreciated by those skilled in the art that the design of the expression vector depends on such factors as the choice of the host cells and the desired expression levels.
[0097]In one embodiment, the expression vector contains tissue-specific regulatory elements. Examples of suitable tissue-specific promoters include the liver-specific albumin promoter, lymphoid-specific promoters, promoters of T cell receptors and immunoglobulins, neuron-specific promoters (e.g., the neurofilament promoter), pancreas-specific promoters, mammary gland-specific promoters (e.g., milk whey promoter), and tumor specific promoters.
[0098]In another embodiment, the expression vector contains a regulatable expression system. Systems suitable for this invention include, but are not limited to, the Tet-on/off system (Gossen et al., Science 268: 1766-1769 (1995); Kistner et al., Proc. Natl. Acad. Sci. USA. 93: 10933-10938 (1996)), the Ecdysone system (No et al., Proc. Natl. Acad. Sci. USA. 93: 3346-3351 (1996)), the Progesterone-system (Wang et al., Proc. Natl. Acad. Sci. USA. 93: 8180-8184 (1994); Wang et al., Nat. Biotech. 15: 239-243 (1997)), and the Rapamycin system (Magari et al., J. Clin. Invest. 100: 2865-2872 (1997); Ye et al., Science 283: 88-91 (1999)).
[0099]Several specific vectors are further contemplated as embodiments of this invention. In one embodiment, the expression vector is a viral vector. Examples of the viral vectors include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated viral (AAV), herpes viral, or alphavirus vectors. The viral vectors can also be astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, or togavirus viral vectors.
[0100]In certain embodiments, an ATG may be added to the nucleic acids encoding active fragment to ensure proper reading frame and proper expression.
V. Methods of Inhibiting Proliferation Using Full-length or Substantially Full-length CRMP-1
[0101]It has now surprisingly been discovered that full-length CRMP-1 inhibits proliferation of cancer cells, when it was previously shown not to have this effect in lung cancer cells. Previously, it was believed that CRMP-1 inhibited cancer only by inhibiting invasion and metastasis. Specifically, recent work reported that the expression of CRMP-1 inhibits invasion and metastasis of lung cancer cells (Shih et al., J. Natl. Cancer Inst. 93(18): 1392-1400 (2001)). Further, the prior art suggested that CRMP-1 did not inhibit cell proliferation. In fact, Shih et al. determined that hCRMP-1 did not affect the proliferation of cancer cells in a panel of poorly differentiated adenocarcinoma lung cancer cell lines established from a patient.
[0102]It is therefore surprising to disclose that the full-length hCRMP-1 inhibits cancer cell proliferation, as well as the invasive activity and metastasis, in two prostate cancer cell lines (PC-3 and DU145), colon cancer cell line CC-M1, breast cancer cell line MCF-7, and human lung large-cell carcinoma cell H460.
[0103]Therefore, in one aspect of this invention, full-length or substantially full-length CRMP-1 is used to inhibit proliferation of cancer. In another embodiment, CRMP-1 is used to inhibit proliferation of lung cancer, including human squamous lung cancer, adenocarcinoma carcinoma, and large-cell carcinoma; prostate cancer, including adenocarcinoma and carcinoma, colon cancer, including adenocarcinoma, and breast cancer, including ductal carcinoma. Investigating the growth characteristics of malignant cells overexpressing hCRMP-1.
[0104]It will be recognized that the above discussion regarding amino acid and nucleic acid variants, methods of treatment, formulation and routes of administration, dosage amount and frequency and nucleic acid expression apply equally to methods of using full-length or substantially full-length CRMP-1 as to the fragments discussed above, with the exception that it is intent of the invention to focus on inhibiting proliferation with full-length or substantially full-length CRMP-1, whereas the inventive methods of using the fragments encompass proliferation, metastasis, and/or invasion.
DEFINITIONS
[0105]The term "activity", as used herein, refers to any biological property of CRMP-1 and its fragments. The activity may, for example, be inhibiting proliferation, metastasis, and/or invasion in response to treatment. Such activity may be determined by standard assays in the art for proliferation, metastasis, and/or invasion.
[0106]As used herein the term "cell proliferation": is defined as the reproduction or multiplication of cells.
[0107]As used herein the term "effective amount" is defined as an amount of the agent that will inhibit proliferation, metastasis, and/or invasion of the cancer. For example, it may decrease, reduce, inhibit or otherwise abrogate the growth of a cancer cell, induce apoptosis, inhibit angiogenesis of a tumor cell, inhibit metastasis, or induce cytotoxicity in cells. Thus, an effective amount is an amount sufficient to detectably and repeatedly ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. More rigorous definitions may apply, including elimination, eradication or cure of disease.
[0108]The term "gene" as used herein, refers to a polymer in which nucleotides encoding the amino acids constituting a polypeptide (e.g., enzyme) are joined into a linear structure with directionality. The "gene" may be single-stranded (e.g., RNA) or double-stranded (e.g., DNA). DNA may be, for example, cDNA which is enzymatically prepared from a transcribed RNA (mRNA), genomic DNA from chromosomes, or chemically synthesized DNA.
[0109]"Homology" is generally determined using a sequence-analysis software package (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Similar amino acid sequences are aligned, in order to obtain the maximum degree of homology (i.e., identity or similarity, as defined above). For this purpose, it may be necessary to introduce gaps into the sequence artificially. Once the optimal alignment has been produced, the degree of homology is established by recording all of the positions for which the amino acids of the two compared sequences are identical, in relation to the total number of positions.
[0110]"Invasiveness" is the degree to which an organism such as cancer cell is able to spread through the body from one region such as the original site of tumor.
[0111]An "isolated," "purified," "substantially isolated," or "substantially pure" molecule (such as a polypeptide or polynucleotide) is one that has been manipulated to exist in a higher concentration than in nature. For example, a subject protein is isolated, purified, substantially isolated, or substantially purified when at least 50%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of non-subject-protein materials with which it is associated in nature have been removed. As used herein, an "isolated," "purified," "substantially isolated," or "substantially purified" molecule includes recombinant molecules.
[0112]"Metastasis" is the process by which cancer spreads from the place at which it first arose as a primary tumor to distant locations in the body. Metastasis depends on the cancer cells acquiring two separate abilities--increased motility and invasiveness. Cells that metastasize are basically of the same kind as those in the original tumor. If a cancer arises in the lung and metastasizes to the liver, the cancer cells in the liver are lung cancer cells. However, the cells have acquired increased motility and the ability to invade another organ.
[0113]The term "nucleic acid sequence", as used herein, refers to a DNA, cDNA or RNA molecule, either as a separate fragment or as part of a larger polynucleotide construct.
[0114]The terms "patient," "subject," "individual," and "host" are used interchangeably herein to refer to a living animal, including a human and a non-human animal. The subject may, for example, be an organism possessing immune cells capable of responding to antigenic stimulation, and stimulatory and inhibitory signal transduction through cell surface receptor binding. The subject may be a mammal, such as a human or non-human mammal, for example, farm animals, such as horses, cows, pigs, family pets, such as dogs or cats, and other animals including non-human primates, rats, and mice. The term "subject" does not preclude individuals that are entirely normal with respect to a disease, or normal in all respects.
[0115]The expression vector can be a "plasmid," which includes a circular double stranded DNA into which additional DNA segments can be introduced. Other forms of vectors include expression vectors and gene delivery vectors.
[0116]In general, the term "protein" refers to any polymer of two or more individual amino acids (whether or not naturally occurring) linked via peptide bonds, as occur when the carboxyl carbon atom of the carboxylic acid group bonded to the α-carbon of one amino acid (or amino acid residue) becomes covalently bound to the amino nitrogen atom of the amino group bonded to the α-carbon of an adjacent amino acid. These peptide bond linkages, and the atoms comprising them (i.e., α-carbon atoms, carboxyl carbon atoms (and their substituent oxygen atoms), and amino nitrogen atoms (and their substituent hydrogen atoms)) form the "polypeptide backbone" of the protein. In addition, as used herein, the term "protein" is understood to include the terms "polypeptide" and "peptide" (which, at times, may be used interchangeably herein). Similarly, protein fragments, analogs, derivatives, and variants are may be referred to herein as "proteins," and shall be deemed to be a "protein" unless otherwise indicated. The term "fragment" of a protein refers to a polypeptide comprising fewer than all of the amino acid residues of the protein. As may be appreciated, a "fragment" of a protein may be a form of the protein truncated at the amino terminus, the carboxy terminus, and/or internally (such as by natural splicing), and may also be variant and/or derivative. A "domain" of a protein is also a fragment, and comprises the amino acid residues of the protein required to confer biochemical activity corresponding to naturally occurring protein.
[0117]"Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
[0118]The term "stringent conditions", as used herein, is the "stringency" which occurs within a range from about Tm-5° C. (5° C. below the melting temperature (Tm) of the probe) to about 20° C. to 25° C. below Tm. As will be understood by those of skill in the art, the stringency of hybridization may be altered in order to identify or detect identical or related polynucleotide sequences. Stringent conditions include, for example, 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.2×SSC/0.1% SDS at 42° C. (see Ausubel, et al (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, stringent conditions may, for example, include 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. (see Ausubel, et al (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
[0119]The term "treatment" refers to a therapeutic or preventative measure. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
[0120]The term "variant" refers to proteins, peptides, nucleic acids, and fragments thereof that differ from the original CRMP-1, fragments of CRMP-1, and nucleic acid encoding CRMP-1 and fragments of CRMP-1 by one or more substitutions, deletions, and/or insertions. In some embodiments, these modifications generally do not substantially change (e.g., reduce or enhance) the original biological function. However, in other instances, a variant of CRMP-1 fragment can reduce or enhance the biological activities of the original fragment, while still being useful in the invention.
[0121]Polypeptide variants include those conservative substitutions, which are substitutions of amino acids of the same category, such as substitutions of amino acids with non-charged side-chains (such as asparagine, glutamine, serine, threonine and tyrosine), of amino acids with basic side-chains (such as lysine, arginine and histidine), of amino acids with acid side-chains (such as aspartic acid and glutamic acid), and of amino acids with apolar side-chains (such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan and cysteine). Additionally, variants include substitution of natural amino acids with unnatural amino acids or pseudo amino acids, in positions such that these modifications do not significantly impair the biological activity of the hCRMP-1 or active fragments thereof.
[0122]The term "vector", as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors"). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
EXAMPLES
Example 1
Construction of Expression Plasmid pNCRMP1
[0123]A) Preparation of cDNA from Human Lung Adenocarcinoma Cell Line CL1-0
[0124]Total RNA was extracted from 1×107 human lung adenocarcinoma cells, CL1-0, using the phenol-based method (TRIzol reagent, Texas, USA). The cDNA was reverse transcribed from 0.005 mg total RNA and by using SuperScript II Reverse Transcriptase (Invitrogen, USA) according to the protocol from manufacturer.
[0125]B) Amplification of hCRMP-1 Gene Fragment
[0126]The amino acid sequences and cDNA sequence of hCRMP1 is listed in SEQ ID NO: 1 and 2, respectively. A 1.8 kb DNA fragment containing nucleotides from +142 to +1866 of human collapsin response mediator protein-1 (hCRMP-1) gene (GenBank Accession No. D78012, NCBI) was obtained by PCR amplification using two primers:
[0127](1) NeocF, as forward primer, 5'-GATTCTCGAGGGGG CCATGTCGTACCAGGGCAAG-3' (SEQ ID NO:3, position +142 to +168, with an additional, artificial XhoI site (italic) at the 5'-end); and
[0128](2) NeocR, as reverse primer, 5'-GTCTAGATCAgtgatggtggtggtgatg ACCGAGGCTGGTGATG-3' (SEQ ID NO:4, sequence complementary to position +1866 to +1851, with an additional, artificial XbaI site (italic), 6×His tag (SEQ ID NO: 44) (lowercase), and the stop-codon (bold) at the 5'-end).
[0129]C) Construction of pNCRMP1 Expression Plasmid
[0130]The amplified product was purified from PCR mixture, digested with XhoI and XbaI restriction endonucleases, and inserted into the linear pCI-neo Mammalian Expression Vector (Promega, USA) restricted with XhoI and XbaI enzymes. This construct was designated as pNCRMP1. The translated amino acid sequence of the inserted fragment showed 100% homology to the published sequence (Hamajima et al., Gene 180: 157-163 (1996)), but with one single nucleotide polymorphism (SNP; refSNP ID: rs12331). The pCI-neo Mammalian Expression Vector is a selectable vector for studying constitutive expression of cloned gene in mammalian cells.
Example 2
Construction of a Series of Expression Plasmid Containing Partial hCRMP-1 Gene Fragment
[0131]Six partial DNA fragments of hCRMP1 gene obtained by PCR amplification using pNCRMP1 as DNA template and inserted into the commercial available pCI-neo Mammalian Expression Vector (Promega, USA). They were named as pNCN1, pNCN3, pNCN4, pNCN5, pNCN6, and pNCN7, respectively. Related information for the amplification of partial hCRMP-1 gene fragments were listed in Tables 3-5, including the primer pairs, nucleotide sequence of each primer, and the coverage of amino acid sequence range of individual partial fragment of hCRMP-1 gene. Table 5 provides both the amino acid sequences and the cDNA sequences of CRMP-1 fragments constructed. Some CRMP-1 fragments contain one additional methionine (represented as symbol "M" in amino acid sequence listings) in the expression construct in order to build an "open reading frame" and can be expressed as protein in mammalian cells or in prokaryote cell (e.g. E. coli).
TABLE-US-00003 TABLE 3 PCR AMPLIFICATION-RELATED INFORMATION FOR CONSTRUCTION OF EXPRESSION PLASMIDS Plasmid ID Forward primer Reverse primer pNCN1 CN1-F CNR pNCN3 CN3-F CNR pNCN4 CN4-F CNR pNCN5 CN5-F CN5-R pNCN6 CN6-F CN6-R pNCN7 CN7-F CN7-R
[0132]An additional start-codon sequence (ATG, shaded) was designed in forward primers, such as CN3-F, CN4-F, CN5-F, CN6-F, and CN7-F, in order to have the right translational start for gene reading frame during expression in mammalian cells (Table 4). Three forward primers, CN1-F, CN3-F, and CN4-F, have an additional, artificial XhoI (italic) site at the 5'-end, while the CNR reverse primer has an additional and artificial XbaI (italic) site and the stop-codon (bold) at the 5'-end. The other three forward primers, CN5-F, CN6-F, and CN7-F, have an additional and artificial SalI (italic) site at the 5'-end, while the reverse primers, CN5-R, CN6-R, and CN7-R, have an artificial NotI (italic) site, 6×His tag (SEQ ID NO: 44) (lowercase) and the stop-codon (bold) at the 5'-end.
[0133]The amplified DNA fragments for construction of pNCN1, pNCN3, and pNCN4 plasmid were first digested with restriction endonucleases XhoI and XbaI, respectively, while construction of other plasmids, such as pNCN5, pNCN6, and pNCN7, was with restriction endonucleases SalI and NotI. The restricted DNA fragments were ligated into pCI-neo vector predigested with the respective restriction enzymes.
TABLE-US-00004 TABLE 4 SEQUENCE LIST OF AMPLIFICATION PRIMERS Reference sequence: GenBank Accession No. D78012, NCBI Primer ID Sequence (5'-3') SEQ ID NO CN1-F ACTCGAGGCCATGTCGTACCAGGGCAAGAAG 5 CN3-F CTCGAGACCATGGAACAAAAGCGGATCCTGG 6 CN4-F CTCGAGACC GACTACTTGACCTCCCTAC 7 CNR TTCTAGACTACTGGTACAGGTGCTCCGGG 8 CN5-F GAATACTCATACTCTTCCGGATCCGTCGACGCCACC 9 GTGCTGGTGCAGGACAAAGG CN6-F GAATACTCATACTCTTCCGGATCCGTCGACGCCACC 10 ATGATAGCTCAGGAACAAAAG CN7-F GAATACTCATACTCTTCCGGATCCGTCGACGCCACC 11 ATGAACATCAACGTCAACAAGG CN5-R CAGCGGCCGCTCAgtggtggtgatggtggtgGTCGGCTGCA 12 CTCTTGCTC CN6-R TAGCGGCCGCTCAgtgatgatggtgatgatgTAGGGAGGTC 13 AAGTAGTCG CN7-R TAGCGGCCGCTCAgtgatgatggtgatgatgACCGAGGCTG 14 GTGATGTTGG
TABLE-US-00005 TABLE 5 AMINO ACID SEQUENCES OF PARTIAL DOMAINS CORRESPONDING THE AMPLIFIED DNA FRAGMENT OF HCRMP-1 ID of Partial Sequence range domain Plasmid ID covered* SEQ ID NO (AA, cDNA) CN1 pNCN1 1 to 480 15, 16 CN3 pNCN3 208 to 480 17, 18 CN4 pNCN4 315 to 480 19, 20 CN5 pNCN5 154 to 262 21, 22 CN6 pNCN6 205 to 320 23, 24 CN7 pNCN7 458 to 572 25, 26 *Sequence positions were based on the published sequence GenBank Accession No. BAA11190.
Example 3
Antiproliferative Effect on Mammalian Cells Transfected with Expression Plasmids, pNCRMP1, pNCN3, pNCN4, pNCN5, pNCN6, and pNCN7
[0134]A) Materials and Methods
[0135]1. Cell Lines and Cultivation Conditions
[0136]All cell lines were purchased from Food Industry Research and Development Institute (FIRDI), Hsinshu, Taiwan. They were originated from different tissues or organs, including: [0137](1) human lung cancer cells: adenocarcinoma A549 (BCRC60074), squamous cell carcinoma H520 (BCRC60124), and large-cell carcinoma H460 (CCRC600373), [0138](2) human prostate cancer cell: adenocarcinoma PC-3 (CCRC60112) and carcinoma DU145 (CCRC60348) isolated from metastatic brain site; [0139](3) human colon cancer cells: adenocarcinoma SW 480 (CCRC60249), CC-M1 (BCRC60448), and DLD-1 (CCRC60132); [0140](4) human breast cancer cells: ductal carcinoma BT-474 (CCRC 60359), MCF-7 (CCRC60436), and ZR-75-1 (CCRC60055); [0141](5) Chinese hamster lung cell V79-4 (BCRC60183), and [0142](6) human prostate normal cell PZ-HPV-7 (CCRC60136).
[0143]The cultivation of cell lines was as described as the instruction provided by Food Industry Research and Development Institute (FIRDI), while 10% fetal bovine serum (JRH Biosciences, USA) was supplemented as final concentration, if necessary. The human prostate normal cell line PZ-HPV-7 was maintained in Keratinocyte-SFM medium (Life Technologies, Inc., US).
[0144]2. Transient Transfection
[0145]Mammalian cells were seeded to 6-well plate (Corning Inc., USA) with a cell density of 2˜8×105 and incubated at 37° C. for overnight prior to transfection. Each cell line was respectively transfected with the pCI-neo Mammalian Expression Vector (as control plasmid; Promega, USA) or with the hCRMP-1-related expression plasmid by using Lipofectamine® Reagent (Invitrogen, #18324-020). A series of expression plasmid containing full-length or partial gene fragment of hCRMP-1, were pNCRMP1, pNCN1, pNCN3, pNCN4, pNCN5, pNCN6, and pNCN7, whose constructions were described in Example 1 and Example 2.
[0146]The nomenclature of transfected cell line was according to the cell line and expression plasmid and characterized as "cell line/expression plasmid." Quantitation of viable cells after transfection was performed by using hemocytometer after 5-days incubation at 37° C. (R. Ian Freshney: Culture of Animal Cells, A Manual of Basic Technique, Chapter 20, pp. 309-312, WILEY-LISS, Canada (2000)).
[0147]The antiproliferative effect (in percentage) of each cell line transfected with individual expression plasmid was normalized with the same cell line transfected with control plasmid as follows:
Antiproliferative effect=100%×(1-(number of cells transfected with expression plasmid/number of cells transfected with control plasmid))
[0148]B) Results
[0149]The full-length hCRMP-1 was expected to constitutively overexpress in the indicated cell line transfected with pNCRMP1 plasmid. The transfection of a series of expression plasmid in indicated cells, including pNCN1, pNCN3, pNCN4, pNCN5, pNCN6, and pNCN7, represented to have overexpressed corresponding to the partial domain of hCRMP-1, named as CN1, CN3, CN4, CN5, CN6, and CN7 domain, respectively. Table 6 represents the antiproliferative effect on cancer cells transfected with different expression plasmid.
TABLE-US-00006 TABLE 6 ANTI-PROLIFERATION EFFECT (IN PERCENTAGE, %) OF INDIVIDUAL CELL LINE AFTER TRANSIENT TRANSFECTION OF EXPRESSION PLASMID Lung Cells Prostate Cells Epithelium Epithelium Colon Breast Cancer Cells Cells Cancer Cells Cells Adenocarcinoma Cells Carcinoma Cells Plasmid A549 H460 H520 V79-4 PC-3 DU145 PZ-HPV-7 CC-M1 DLD-1 SW480 BT474 MCF-7 ZR-75-1 pNCRMP1 -36 19 0 81 56 57 48 94 39 ND 1 72 26 pNCN1 -33 3 15 ND ND2 ND -44 ND ND ND ND ND ND pNCN3 -6 6 22 85 54 52 30 93 52 6 -97 75 17 pNCN4 10 -5 31 ND -3 7 14 ND ND ND ND ND ND pNCN5 -26 ND 34 -7 -3 -45 -17 40 25 0 -31 25 -13 pNCN6 -17 ND 2 -8 -4 46 50 29 14 -14 ND 43 -5 pNCN7 -10 ND 44 -5 11 28 -34 8 19 0 -43 33 -15 ND: no determination
[0150]1. Antiproliferative Effect on Prostate Cells after Transient Transfection
[0151]The growth of both prostate cancer cell lines (PC-3 and DU145) transfected with pNCRMP1 or pNCN3 showed to be significantly, above 50%, inhibited. The proliferation of the transfected cells, DU145/pNCN6 and DU145/pNCN7, was inhibited up to 46% and 28%, respectively. It indicates that the overexpression of full-length hCRMP-1 protein or its partial domains, such as CN3, CN6, and CN7, in prostate cancer cells could effectively suppress cell growth. Specifically, the overexpressed CN3 domain in the human prostate cancer cell lines, such as PC-3 and DU145, showed to have around 20% more selectivity on antiproliferative ability than in the CN3-overexpressing human prostate normal cell line PZ-HPV-7. The CN7-overexpressing DU145 cells achieved better, with 28% selectivity of inhibition than the CN3-overexpressing cells, though the CN7 domain resulted in overall lower antiproliferative effect. The advantage of using CN3 or CN7 domain as treatment agent for tumor suppression will expectedly reduce side effects regarding the selectivity.
[0152]2. Antiproliferative Effect on Lung Cancer Cells after Transient Transfection
[0153]The proliferation of the human squamous lung cancer cells (H520) was inhibited ranging from 15% to 44% after transient transfection with expression plasmid pNCN1, pNCN3, pNCN4, pNCN5, and pNCN7, respectively. The antiproliferative effect on the transfectant H520/pNCN7 was the most significant than the on other H520 transfectants. The introduction of pNCN5 or pNCN7 plasmid into the H520 cells showed furthermore a better selectivity, 34% and 44%, respectively, since the cell growth of Chinese hamster lung transfectant cell, V79-4/pNCN5 and V79-4/pNCN7, was not affected. The application of high selective agents for administering gives the advantage to reduce side effects or bring the synergetic or additional effect by combinational approach without additional toxic effect on normal cells.
[0154]The antiproliferative effect on the other lung cancer cells, such as adenocarcinoma carcinoma cells (A549) and large-cell carcinoma cells (H460), after transient transfection with expression plasmid was varying. Only the transfectant A549/pNCN4 showed the slightly inhibited proliferation, but not the transfectant with other expression plasmids. Around 19% and 6% reduction of proliferation ability of large-cell carcinoma cells (H460) was measured for the transfectants with pNCRMP1 and pNCN3, respectively.
[0155]3. Antiproliferative Effect on Colon Cancer Cells after Transient Transfection
[0156]The cell growth of three colon cancer cell lines, CC-M1, DLD-1, and SW480, after individual transient transfection with pNCRMP1, pNCN3, pNCN5, pNCN6, and pNCN7, were studied. The relative antiproliferative effect on colon cancer cells was obtained after normalization with the effect on the same cell line transfected with control plasmid pCI-neo. The best inhibition on cancer cell growth, over 90%, was observed on the transfected cells, CC-M1/pNCRMP1 and CC-M1/pNCN3. The anti-proliferation effect on other CC-M1 transfectants, such as CC-M1/pNCN5 and CC-M1/pNCN6, achieved to 40% and 29%, respectively.
[0157]The cell growth of all colon cancer cell DLD-1 transfectants was more or less inhibited ranging from 14% to 52%, while the transfectant DLD-1/pNCN3 was the most affected. No effect on cell growth of the colon cancer cells SW480 could be observed.
[0158]4. Antiproliferative Effect on Breast Cancer Cells after Transient Transfection
[0159]Three breast cancer cell lines, BT-474, MCF-7, and ZR-75-1, were applied for transient transfection with pNCRMP1, pNCN3, pNCN5, pNCN6, and pNCN7. The measurement of living MCF-7 cells after transfection with pNCRMP1 and pNCN3 showed that the cell growth was significantly, over 70%, inhibited. The introduction of other expression plasmids, pNCN6, pNCN7, and pNCN5, resulted in the growth inhibition of MCF-7 cells with descending ratio ranging from 43% to 25%.
[0160]The proliferation of ZR-75-1 was slightly, 26% and 17%, affected after transient transfection with pNCRMP1 and pNCN3, respectively, but not with the other expression plasmids. No effect on cell growth of the breast cancer cell lines BT-474 could be observed.
Example 4
Focus Formation Assay of Cancer Cells Transfected with Expression Plasmid, pNCRMP1, pNCN3, pNCN5, pNCN6, and pNCN7
[0161]A) Material and Methods
[0162]The human lung squamous carcinoma cell line H520 and two human prostate cancer cell lines, PC-3 and DU145, were transfected with pNCRMP1, pNCN3, pNCN5, pNCN6, and pNCN7, while transfection of the same cells with pCI-neo vector served as control studies, respectively. The procedures for transient transfection were the same as described in Example 3.
[0163]The focus formation assay of transfected cells was performed as described as published by Bartholomeusz et al. (Cancer Research 65(18): 8406-8413 (2005)) with modifications. The cells after transfection process were incubated in fresh culture medium at 37° C. for 2-5 days, divided in a 1:3-1:6 dilution into 6-well plate and followed with incubation for 3 weeks in selected medium containing 0.5-0.9 mg antibiotic G418 per ml. Colonies were finally counted by the staining method with crystal violet (R. Ian Freshney, WILEY-LISS, Protocol 15.3; pages 235-236 (2000)).
[0164]The relative reduction of focus formation ability (in percentage) of each cell line transfected with expression plasmid was obtained after normalization with the same cell line transfected with control plasmid (pCI-neo vector) using the following formula:
Relative reduction of focus formation ability=100%×(1-(colony number of cells transfected with expression plasmid/colony number of cells transfected with control plasmid))
[0165]B) Results
[0166]The change of colony formation ability of the human cancer cells, in which hCRMP-1 or its partial domain was overexpressed, was further studied. Table 7 shows the relative inhibition ratio on colony formation of the human lung squamous carcinoma cells H520 and two human prostate cancer cell lines PC-3 and DU145 after respective transfection of hCRMP-1 gene-related expression plasmid. The full-length hCRMP-1 protein or its partial proteins, CN3, CN5, CN6, and CN7, was constitutively overexpressed in the transfected cells.
[0167]1. Change of Colony Formation Ability of Prostate Cancer Cells after Transfection
[0168]More than 50% reduction of the colony formation ability of the transfectants, such as DU145/pNCRMP1, DU145/pNCN3, and DU145/pNCN6, was achieved. The best inhibition effect, up to 67%, could be observed for the DU145/pNCN3 transfectant. In other words, the constitutive overexpressed CN3 domain drastically eliminated the colony forming ability of the prostate cancer cell line DU145. The DU145/pNCN7 transfectant showed to have loss of around 25% colony formation ability, while the DU145/pNCN5 transfectant did not show any change.
[0169]Around 30% reduction of colony formation ability was observed for PC-3/pNCRMP1 transfectant. The colony formation ability of other PC-3 transfectants, such as PC-3/pNCN3, PC-3/pNCN5, and PC-3/pNCN7, showed to be slightly (13-15%) affected.
[0170]2. Change of Colony Formation Ability of Lung Cancer Cells after Transfection
[0171]Around 30% of the colony formation ability of the H520/pNCN5 transfectant was restrained. It indicates that the overexpressed CN5 partial domain specifically cause the transformation of the human lung squamous carcinoma cells H520, but not the full-length hCRMP-1 protein or other partial domains, CN3 and CN7, in this study.
TABLE-US-00007 TABLE 7 RELATIVE INHIBITION EFFECT ON COLONY FORMATION (IN PERCENTAGE, %) OF INDIVIDUAL CANCER CELL TRANSFECTANT Prostate Cancer Lung Cancer Cells Cells Plasmid H520 PC-3 DU145 pNCRMP1 2 32 50 pNCN3 -31 15 67 pNCN5 30 13 4 pNCN6 ND ND 52 pNCN7 -33 13 26 ND: Not determination
Example 5
Anchorage-Independent Assay of Cancer Cells Transfected with Expression Plasmids pNCRMP1, pNCN1, pNCN3, and pNCN4
[0172]A) Material and Methods
[0173]The human lung cancer cell lines A549, H460, and H520 were transfected with the pCI-neo vector (as control) and four hCRMP-1 gene-related expression plasmids, pNCRMP1, pNCN1, pNCN3, and pNCN4, respectively. The transient transfection methods were the same as described in Example 3.
[0174]The anchorage-independent assay used in this study was performed as described by Freshney (Culture of Animal Cells, A Manual of Basic Technique, Chapter 20, pp. 200-202, WILEY-LISS, Canada (2000)) with following modifications. These transfected cells were incubated in refreshed and selected medium containing antibiotic G418 with the concentration of 0.5-0.9 mg/ml for 2-5 days at 37° C., and following with suspension in soft-agars with a density of 4,000-6,000 cells per well. The mixture of cell/soft-argarose was plated on of 24-well plate underlay with agarose for 4-8 weeks. Colonies grown in soft-agarose were observed using reversed microscope and counted, only when the diameter of colony was greater than 0.05 mm. The anchorage-independent assay for each transfectant was carried out in triplicate.
[0175]The relative inhibition effect on colony growth in soft-agarose due to overexpression of hCRMP-1 or its truncated forms was calculated as follows:
Relative inhibition effect=100%×(1-(colonies derived from cells transfected with expression plasmid/colonies derived from transfected cells with control plasmid))
[0176]B) Results
[0177]Anchorage-independent growth in semi-solid agarose is one of the characteristics of transforming ability for transformed cells. The ability of suspended colony formation in soft-agarose system of three human lung cancer cell types after individual transfection with pNCRMP1, pNCN1, pNCN3, and pNCN4 plasmid, as well as the pCI-neo (as control plasmid), was studied.
[0178]The ability of suspended colony formation in soft-agarose of all three types of human lung cancer cell lines was considerably inhibited with the range from around 50% to 100% (Table 8). Both human large-cell carcinoma transfectants, H460/pNCN3 and H460/pNCN4, which had higher expression level of CN3 and CN4 domain, respectively, seemed to loss the ability to grow under the anchorage independent conditions. This ability of other two H460 transfectants, H460/pNCRMP1 and H460/pNCN1, was also inhibited up to 75%.
[0179]The most effective inhibition (over 80%) on the anchorage independence of human lung adenocarcinoma cells A549 was also due to transfection with pNCN4 plasmid. These results indicate that the CN4 partial domain plays the critical role for inhibition of colony formation in soft-agarose, especially for the adenocarcinoma and large-cell carcinoma type, but not squamous type.
[0180]As shown in Table 8, four (4) H520 transfected cell lines had lost almost half of the ability for anchorage-independent growth.
TABLE-US-00008 TABLE 8 RELATIVE INHIBITION OF COLONIES GROWTH (IN PERCENTAGE, %) IN SOFT-AGAROSE Lung Cancer Plasmids A549 H460 H520 pNCRMP1 62 75 46 pNCN1 68 75 61 pNCN3 75 100 58 pNCN4 82 100 54
Example 6
Improvement of Chemosensitivity of Cancer Cells Using Combinational Approach
[0181]A) Material and Methods
[0182]1. Selection of Stable Transfectants with Overexpressed hCRMP-1 or its Partial Domains
[0183]Three human cancer cell lines, including lung cancer cell line H520 and two human prostate cancer cell lines (PC-3 and DU145) were applied for selection of stable transfectants. Four expression plasmids, including pNCRMP1, pNCN1, pNCN3, and pNCN4, and the pCI-neo vector (as control plasmid) were used for transfection, respectively. The general cultivation condition and transfection procedures were the same as described in Example 3. The transfected cells were further cultivated under the same conditions as their parental cell lines and selected with 0.6-1 mg antibiotic G418 per ml (Kao et al., Oncogene 16: 546-554 (1998); Xiaolin et al, Cancer Research 65: 9762-9770 (2005)).
[0184]2. Treatment of Stable Transfectants with Chemical Agents
[0185]Three agents, including caffeic acid phenethyl ester (CAPE; Sigma, US), Adriamycin® (doxorubicin) (Pharmacia & Upjohn S.P.A. Milan, Italy), and paclitaxel (Taxol; Bristol-Myers Squibb Co., Wallingford, Conn.), were dissolved in DMSO (dimethyl sulfoxide; Sigma) for preparation of stock solution, respectively. A serial dilution was prepared with DPBS buffer for chemosensitivity tests. The human lung squamous carcinoma stable transfectants H520 were treated with both CAPE and Adriamycin® (doxorubicin) for four different concentrations, e.g. 0.05, 0.01, 0.002, and 0.0004 mM, while the administering of paclitaxel was performed at different concentrations, e.g. 1000, 200, 40, and 8 nM. Both types of prostate stable transfectants were only treated with paclitaxel for eight concentrations ranging from 0.1 mM to 1.28 nM with 1/5 dilution each step.
[0186]3. Cytotoxicity (Chemosensitivity) Assays
[0187]MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma, Inc.) assay (Monks et al., J. Natl. Cancer Inst. 83:757-766 (1991); Paull et al, J. Natl. Cancer Inst. 81:1088-1092 (1989)) was applied for studying the cytotoxic effect of indicated agent. The absorbance was measured both at 545 nm and at 690 nm (served as reference) using the 96-well spectrophotometer reader (Emax, Molecular Device Inc., California, US) (Chen et al., Yi Xue Za Zhi (Taipei) 46:7-16 (1990)). The relative growth inhibition was calculated as follows:
Relative growth inhibition=100%×(1-(OD.sub.545nm(Treated cells)-OD.sub.690nm(Treated cells))/(OD.sub.545nm(untreated cells)-OD.sub.690nm(untreated cells)))
[0188]The 50% inhibition concentration (IC50) was determined after graphical plotting of spectrophotometric measurements and interpolation by EXCEL software.
[0189]B) Results
[0190]Chemosensitivity of stable transfectants, with respect to three agents, caffeic acid phenethyl ester (CAPE), Adriamycin® (doxorubicin), and paclitaxel, were studied, which represents a COX-2 inhibitor, a cell cycle-specific antibiotic, and a cell cycle G2 phase-specific drug, respectively. Table 9 shows the concentration of 50% inhibition (IC50) of cell growth.
[0191]Stable transfectants were obtained after selection with prolong in antibiotic G418-containing media. The human lung squamous carcinoma H520 stable transfectant included H520/pCI-neo/1 (as control), H520/pNCRMP1/1, H520/pNCN1/1, H520/pNCN3/1, and H520/pNCN4/1. The prostate PC-3 stable transfectants were PC-3/pCI-neo/11-1 (as control), PC-3/pNCRMP1/1304, and PC-3/pNCN3/15-5.
[0192]1. Chemosensitivity of Stable Transfectants to Paclitaxel
[0193]The best improvement, up to 400-fold, of chemosensitivity could be observed on the prostate stable transfectant DU145/pNCRMP1/2 treated with paclitaxel. It is of great advantage to use sub-therapeutic concentrations of antineoplastic agent, which is much less toxic to normal cells.
[0194]None of stable prostate cancer cell DU145/pNCN3 derived from single colony could survive during the following extended antibiotic G418 selection. Those transient transfected cells with overexpressed CN3 domain were countable for growth inhibition assay, but could not be maintained for prolonged cultivation due to possible destruction of certain cellular functions. Therefore, the combinational treatment approach could not be performed for CN3-overexpressing stable DU145 cells.
[0195]No effect on chemosensitivity of both prostate stable transfectants, PC-3/pNCRMP1/1304 and PC-3/pNCN3/15-5, could be observed.
[0196]The combination of over-expression of CN3 or CN4 protein in the stable transfectants of the human lung squamous carcinoma H520 resulted in the increase of sensitivity to paclitaxel at least 4-fold.
TABLE-US-00009 TABLE 9 THE IC50 (μM) OF OF CHEMICAL AGENTS FOR CANCER CELLS AFTER TREATMENT WITH STABLE TRANSFECTANTS Adriamycin ® Transfectant CAPE (doxorubicin) paclitaxel H520/pCI-neo/1 >50 0.74 0.031 H520/pNCRMP1/1 17 <0.4 0.012 H520/pNCN1/1 23 <0.4 0.012 H520/pNCN3/1 29 <0.4 <0.008 H520/pNCN4/1 27 0.5 <0.008 PZ-HPV-7 ND ND 6.53 DU145/pCI-neo/7 ND ND 8 DU145/pNCRMP1/2 ND ND 0.02 ND: Not determined
[0197]2. Chemosensitivity of Stable Transfectants to Adriamycin®(Doxorubicin)
[0198]The chemosensitivity of stable transfectants of the human lung squamous carcinoma H520 showed at least a 2-fold increase to Adriamycin® (doxorubicin) after treatment with the full-length CMRP-1 or the CN3, CN4 fragment.
[0199]3. Chemosensitivity of Stable Transfectants to CAPE
[0200]The stable transfectant H520/pNCRMP1/1 showed at least a 3-fold increase in the chemosensitivity to CAPE after treatment with the full-length CMRP-1 or the CN3, CN4 fragment, while other stable transfectants were around 2-fold more sensitive.
[0201]These data suggest that the therapeutic effect of chemotherapeutic agents, including caffeic acid phenethyl ester (CAPE), Adriamycin® (doxorubicin), and paclitaxel, could be improved by the introduction of hCRMP-1 gene-related expression plasmid before or during the chemotherapy.
[0202]C) Additional Experiment on Improvement of Chemosensitivity of Cancer Cells Using Transient Transfectants
[0203]1. Materials and Methods
[0204]Six human cancer cell lines, including human colon cancer cell lines Caco-2, CC-M1, DLD-1; human prostate cancer cell lines DU145, PC-3; and human breast cancer cell line MCF-7, were tested in an experiment on improvement of chemosensitivity. Two expression plasmids, pNCRMP1 and pNCN3, and the pCI-neo vector (control plasmid), were used for transfection, respectively. The general cultivation conditions and transfection procedures were the same as described in Example 3.
[0205]Treatment of transient transfected cell lines using chemical agent was immediately performed as follows, and quantification of viable cells was performed by counting using hemocytometer after 3-days incubation at 37° C.: [0206](1) Three types of transient transfected human colorectal cancer cells were treated with 5-fluorouracil; [0207](2) The transient transfected human prostate cancer cell line DU145 was treated with Adriamycin® (doxorubicin), cyclophosphamide and etoposide; [0208](3) The transient transfected human prostate cancer cell line PC3 was treated with cyclophosphamide, etoposide, and paclitaxel; and, [0209](4) The transient transfected human breast cancer cell line MCF-7 was treated with Adriamycin® (doxorubicin) and paclitaxel.
[0210]2. Results
[0211]Table 10 shows the concentration of 50% inhibition (IC50) of cell growth. Both transient transfectants, MCF-7/pNCRMP1 and MCF-7/pNCN3, became much more chemosensitive to Adriamycin® (doxorubicin). The values of IC50 indicate that the combination approach can improve therapeutic effectiveness of Adriamycin® (doxorubicin) up to 20-fold when the MCF-7 cell is transfected with pNCRMP1 and 6-fold with pNCN3.
[0212]The therapeutic effectiveness of paclitaxel can be improved up to 8-fold when the PC-3 cell is transient transfected with pNCN3 to paclitaxel. In contrast, as disclosed above, when using stable transfectant PC-3/pNCRMP1/1304 and PC-3/pNCN3/15-5 for treatment study, no improvement on therapeutic effectiveness of paclitaxel was observed.
[0213]When using 5-fluorouracil together with transient transfected colorectal cell lines, no improvement of chemosensitivity was observed (data not shown).
TABLE-US-00010 TABLE 10 THE IC50 (μM) OF CHEMICAL AGENTS FOR CANCER CELLS AFTER TREATMENT WITH TRANSIENT TRANSFECTANTS Agents* Adriamycin ® Cyclo- Transfectant (doxorubicin) phosphamide Etoposide Paclitaxel DU145/pCIneo 0.073 >100 0.46 ND DU145/ 0.079 >100 0.71 ND pNCRMP1 DU145/pNCN3 0.06 >100 0.71 ND PC-3/pCIneo ND >100 64 0.087 PC-3/pNCRMP1 ND >100 33 0.069 PC-3/pNCN3 ND 55 >100 0.01 MCF-7/pCIneo 2.13 ND ND <0.001 MCF-7/ 0.1 ND ND <0.001 pNCRMP1 MCF-7/pNCN3 0.32 ND ND 0.044 ND: No determination *Concentrations of agent: Adriamycin ® (doxorubicin) (in μM): 10, 1, 0.1, and 0.01 Cyclophosphamide and Etoposide (in μM): 100, 10, 0.1 and 0.01 Paclitaxel (in nM): 1000, 100, 10, and 1
Example 7
Plasmid Construction for Heterologous Expression of hCRMP-1 and its Domain (CN3) in Escherichia coli
[0214]A) Plasmid Construction for Heterologous Expression of hCRMP-1 in Escherichia coli
[0215]A 1716 bp-DNA fragment containing nucleotides from +151 to +1866 of human collapsin response mediator protein-1 (hCRMP-1) gene (GenBank Accession No. D78012) was obtained by PCR amplification using two primers:
[0216](1) 2F, as forward primer, 5'-ATTGAAAGCTTATGTCGTACCAGGGCA-3' (SEQ ID NO: 27, position+151 to +166, with an additional, artificial HindIII site (italic) at the 5'-end); and
[0217](2) 2R, as reverse primer, 5'-ATATCCTCGAGACCGAGGCTGGTGATG-3' (SEQ ID NO: 28, sequence complementary to position+1866 to +1851, with an additional, artificial XhoI site (italic) at the 5'-end).
[0218]The amplified product was purified from PCR mixture using agarose gel elution and phenol/isopropanol extraction, digested with restriction endonucleases, HindIII and XhoI, and inserted into the HindIII/XhoI site of the pET-22b(+) plasmid (Novagen, USA). This construct was designated as pET22bCRMP1 and contains hCRMP-1 gene for coding the full-length protein with 572 amino acids (GenBank Accession No. BAA11190, NCBI). This pET system is widely used for the cloning and expression of recombinant proteins in E. coli under control of strong bacteriophage T7 transcription. The pET-22b(+) plasmid used in our study contains additional fragment encoding for 39 amino acids as signal peptide before the subcloned gene fragment.
[0219]B) Plasmid Construction for Heterologous Expression of CN3 Domain in Escherichia coli
[0220]An 820 bp-DNA fragment containing nucleotides from +772 to +1591 of human collapsin response mediator protein-1 (hCRMP-1) gene (GenBank Accession No. D78012, NCBI) was obtained by PCR amplification using two primers:
[0221](1) CN3 PF, as forward primer, 5'-AGCAAGCTTGAACAAAAGCGGATCCTG-3' (SEQ ID NO: 29, position+772 to +789, with an additional, artificial HindIII site (italic) at the 5'-end); and
[0222](2) CNPR, as reverse primer, 5'-TAACTCGAGCTGGTACAGGTGCTCC-3' (SEQ ID NO: 30, sequence complementary to position+1591 to +1575, with an additional, artificial XhoI site (italic) at the 5'-end).
[0223]The amplified product was purified from PCR mixture using agarose gel elution and phenol/isopropanol extraction, digested with restriction endonucleases, HindIII and XhoI, and inserted into the HindIII/XhoI site of the pET-22b(+) plasmid (Novagen, USA). This construct was designated as pE22bCN3 and contains the coding region of amino acids from 208 to 480 of full-length hCRMP-1 (GenBank Accession No. BAA11190, NCBI).
Example 8
Production of Recombinant hCRMP-1 (rhCRMP-1) and its Partial Domain e-rCN3
[0224]A) Inducible Expression of Recombinant hCRMP-1 and its Partial Domain CN3 in Escherichia coli
[0225]Two expression plasmids, pET22bCRMP1 and pE22bCN3, were transformed into Escherichia coli strain BL21(DE3) according to Maniatis, et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, (1989)), respectively. The transformant WJ4-1 (E. coli BL21(DE3)/pET22bCRMP1) and WJ60-2 (E. coli BL21(DE3)/pE22bCN3) with the highest production at the expected molecular weights for hCRMP-1 and e-rCN3, were selected by using SDS-PAGE electrophoretic analysis, respectively.
[0226]B) Induction of Recombinant Protein Expression
[0227]Both transformants were enriched by cultivation in 100 ml LB medium, supplemented with 0.05 mg/ml ampicillin, at 37° C. The induction of heterologous expression of recombinant proteins was initiated by addition of 0.4-1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG; MDBio Inc., Taiwan) and the following incubation at 37° C. for 3 h, when the cell density was approximately 0.4-0.6 at 600 nm.
[0228]C) Isolation and Purification of E. coli Recombinant Protein rhCRMP-1 and e-rCN3
[0229]Cell pellets were harvested by centrifugation, resuspended in PBS buffer and disrupted with glass beads by vortexing for 30 second with 1 min. interval on ice for 15 times. Inclusion bodies were recovered after centrifugation and then resuspended in Buffer B (8M urea, 100 mM Na2HPO4, 10 mM Tris, pH8) for solubilizing the recombinant proteins. The purification of both recombinant proteins was performed by using the His-Bind resin (Ni-NTA His•Bind® Resin, Novagen, USA) and eluted with 50 to 400 mM imidazole elution buffer (8M urea, 100 mM Na2HPO4, 100 mM NaCl, pH8) according to Novagen User Protocol. The presence of recombinant proteins was confirmed by SDS-PAGE and the amino acid sequencing.
[0230]The elutes containing expected e-rCN3 protein were pooled, dialyzed against 50 mM Tris-HCl buffer (pH8) to remove urea. The precipitate appearing in the dialyzing solution, which contained e-rCN3 protein, was recovered after centrifugation and resuspended in 100 mM Tris-NaOH buffer (pH 12) with desired concentration.
Example 9
Cytotoxic Effect of Recombinant e-rCN3 Protein
[0231]The growth inhibition effect of recombinant e-rCN3 protein was studied with five human cell lines, including the human colon cancer cell line CC-M1, the human breast cancer cell line MCF-7, two human prostate cancer cell lines PC-3 and DU145, and the human prostate epithelium cell line PZ-HPV-7. The e-rCN3 was dissolved in the pH12 Tris-buffer after prepared in diluted cultivation media, as indicated in Example 8, which showed no cytotoxic effect on the testing cell lines. The cytotoxicity assay were performed using MTT method as described by Monks et al. (J. National Cancer Institute 83:757-767 (1991)) or using cell counting-based Hemocytometer method (R. Ian Freshney, WILEY-LISS: 186, 309-312 (2000)) as described in Example 3 and Example 9. Five micromolar (μM) e-rCN3 was applied twice on three prostate cell lines for 6 hours with an interval of 16 hours, while the human colon cancer cell and breast cancer cells were treated with three cycles.
[0232]The treatment with 5 μM e-rCN3 achieved over 60% growth inhibition effect on the human colon cell CC-M1 and breast cancer cell MCF-7, while the growth of high-metastatic human prostate cancer cell PC-3 cells was inhibited with approximately 40%. Specifically, no growth inhibition effect on the human prostate epithelium cell line PZ-HPV-7 could be observed after treatment at the same treatment concentrations. It indicates that the cytotoxic effect of e-rCN3 is highly selective and could be applied as therapeutic agent with the expectation of low side effects.
Example 10
Plasmid Construction for Heterologous Expression of CN3 Domain Containing TAT Sequence (E-rTCN3 Fusion Protein)
[0233]Protein transduction domains (PTDs) or cell penetrating peptides (CPPs) were first identified while investigating the spontaneous cell entry of HIV transactivator (TAT) protein. TAT protein is involved in the replication of human immunodeficiency virus type I (HIV-1) and able to cross the plasma membrane (Vi{grave over (v)}es et al., Journal of Biological Chemistry, 272:16010-16017 (1997)). Recent works showed that the conjugation of proteins, peptides, and antisense nucleotides to these PTDs could improve the delivery efficacy into the cells (Lindsay, Current Opinion in Pharmacology, 2:587-594 (2002)). PTDs are short peptide sequences and the highly cationic 11-amino acid fragment (YGRKKRRQRRR) (SEQ ID NO: 45) of TAT protein has been one of the most well-studied translocating peptides (Albarran et al., Protein Engineering Design & Selection, 18: 147-152 (2005)).
[0234]An additional translocating peptide of TAT protein fused to CN3 protein at the N-terminal was our strategy to improve the cellular uptake during the in vitro-treatment study and to increase the efficacy of antiproliferation of cancer cells.
[0235]A) Construction of Expression Plasmid pETAT
[0236]Two oligonucleotides, 5T1 and 3T1R, were mixed at an equal molar ratio, incubated at 94° C. for 5 min, 72° C. for 30 sec, 60° C. for 10 min, and then cooled to room temperature (Arakawa et al., BMC Biotechnology, 1:7 (2001)). The annealed short nucleotide fragment was inserted into the Nde I/BamH I site of the pET-22b(+) plasmid (Novagen, USA). This construct was designated as pETAT.
[0237]The sequences information of two oligonucleotides are:
(1) 5T1 (SEQ ID NO: 31): 5'-TATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGG-3' (the bold text denotes the coding sequence for transduction domain of HIV TAT protein with a length of 11 amino acids) and(2) 3T1R (SEQ ID NO: 32): 5'-GATCCCGACGACGCTGACGACGTTTTTTACGACCGTACA-3' (the bold text denotes the complementary sequence to the oligonucleotide 5T1).
[0238]B) Plasmid Construction for Heterologous Expression of E-rTCN3 in Escherichia coli
[0239]The plasmid pE22bCN3 (Example 7) containing the 850 bp-DNA fragment encoding for the CN3 domain was digested with two restriction endonucleases, Hind III and Xho I, and isolated using agarose gel elution and phenol/isopropanol extraction. This purified 850 bp-DNA fragment was then inserted into the Hind III/Xho I-site of the pETAT plasmid and resulted in the expression plasmid pETAT-CN3.
Example 11
Production of e-rTCN3 Fusion Protein
[0240]The expression plasmid pETAT-CN3 was transformed into Escherichia coli strain BL21(DE3). The transformant WJ72-3 (E. coli BL21(DE3)/pETAT-CN3) with the highest production yield at the expected molecular weight (33 kDa) for the fusion protein e-rTCN3 was selected by using SDS-PAGE electrophoretic analysis.
[0241]Conditions for cultivation of transformant WJ72-3 and the following induction of over-expression of recombinant e-rTCN3 fusion protein were the same as previously described in Example 8.
[0242]The isolation of over-expressed recombinant e-rTCN3 fusion protein was started with preparation of inclusion body fraction (Chang et al., Protein Engineering, 15:437-441 (2002)) with modifications. The harvested pellet of E. coli transformants was dissolved in the same lysis buffer without lysozyme and disrupted with glass beads by vortexing. The procedures for denaturing and renaturing of e-rTCN3 fusion protein were followed as described by Chang et al. (Biochemical and Biophysical Research Communications, 340:1134-1138 (2006)) with modifications. All of refolding buffers did not contain Cd2+ and Mn2+ ions. The pH value for the final refolding buffer was ranging from 9 to 10. The e-rTCN3 protein containing solution was finally concentrated using Amicon Ultra (Millipore, USA) centrifugal filters with a molecular weight cut-off of 10 kDa according to the instructions provided by manufacture.
Example 12
Cytotoxic Effect of Recombinant e-rTCN3 Protein
[0243]The growth inhibition effect of recombinant e-rTCN3 protein was studied with two human cell lines, human colon cancer cell line CC-M1 and human breast cancer cell line MCF-7. Cell counting-based method using hemocytometer (as described in Example 3) was applied to determine the effect of e-rTCN3 protein on cell proliferation.
[0244]The e-rTCN3 protein used for proliferation study was isolated and prepared as described in Example 11.
[0245]Two cancer cell lines, CC-M1 and MCF-7, were treated with culture medium containing five micromolar (μM) of recombinant e-rTCN3 protein (treatment medium) at 37° C. for 24 hours, refreshed with new prepared treatment medium and followed with another incubation for 24 hours.
[0246]The treatment of recombinant e-rTCN3 protein at the concentration of five-micromolar on the human breast cancer cell line MCF-7 resulted in over 60% growth inhibition, while 40% was resulted for the human colon cancer cell line CC-M1. The recombinant e-rTCN3 protein possessed anti-proliferation effect on cancer cells, specifically, colon cancer cells and breast cancer cells, and it could potentially work as therapeutic agent.
[0247]Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification, including claims, are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters are approximations and may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.
[0248]Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
[0249]While the invention has been described by way of example and in terms of certain embodiments, it is to be understood that the invention is not limited thereto. To the contrary, it is intended to cover various modifications and similar arrangements (as would be apparent to those skilled in the art). Therefore, the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements.
[0250]The specification is most thoroughly understood in light of the teachings of the references cited within the specification. The embodiments within the specification provide an illustration of embodiments of the invention and should not be construed to limit the scope of the invention. The skilled artisan readily recognizes that many other embodiments are encompassed by the invention. All publications and patents cited in this disclosure are incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. The citation of any references herein is not an admission that such references are prior art to the present invention.
Sequence CWU
1
451572PRTHomo sapiens 1Met Ser Tyr Gln Gly Lys Lys Ser Ile Pro His Ile Thr
Ser Asp Arg1 5 10 15Leu
Leu Ile Lys Gly Gly Arg Ile Ile Asn Asp Asp Gln Ser Leu Tyr 20
25 30Ala Asp Val Tyr Leu Glu Asp Gly
Leu Ile Lys Gln Ile Gly Glu Asn 35 40
45Leu Ile Val Pro Gly Gly Val Lys Thr Ile Glu Ala Asn Gly Arg Met
50 55 60Val Ile Pro Gly Gly Ile Asp Val
Asn Thr Tyr Leu Gln Lys Pro Ser65 70 75
80Gln Gly Met Thr Ala Ala Asp Asp Phe Phe Gln Gly Thr
Arg Ala Ala 85 90 95Leu
Val Gly Gly Thr Thr Met Ile Ile Asp His Val Val Pro Glu Pro
100 105 110Gly Ser Ser Leu Leu Thr Ser
Phe Glu Lys Trp His Glu Ala Ala Asp 115 120
125Thr Lys Ser Cys Cys Asp Tyr Ser Leu His Val Asp Ile Thr Ser
Trp 130 135 140Tyr Asp Gly Val Arg Glu
Glu Leu Glu Val Leu Val Gln Asp Lys Gly145 150
155 160Val Asn Ser Phe Gln Val Tyr Met Ala Tyr Lys
Asp Val Tyr Gln Met 165 170
175Ser Asp Ser Gln Leu Tyr Glu Ala Phe Thr Phe Leu Lys Gly Leu Gly
180 185 190Ala Val Ile Leu Val His
Ala Glu Asn Gly Asp Leu Ile Ala Gln Glu 195 200
205Gln Lys Arg Ile Leu Glu Met Gly Ile Thr Gly Pro Glu Gly
His Ala 210 215 220Leu Ser Arg Pro Glu
Glu Leu Glu Ala Glu Ala Val Phe Arg Ala Ile225 230
235 240Thr Ile Ala Gly Arg Ile Asn Cys Pro Val
Tyr Ile Thr Lys Val Met 245 250
255Ser Lys Ser Ala Ala Asp Ile Ile Ala Leu Ala Arg Lys Lys Gly Pro
260 265 270Leu Val Phe Gly Glu
Pro Ile Ala Ala Ser Leu Gly Thr Asp Gly Thr 275
280 285His Tyr Trp Ser Lys Asn Trp Ala Lys Ala Ala Ala
Phe Val Thr Ser 290 295 300Pro Pro Leu
Ser Pro Asp Pro Thr Thr Pro Asp Tyr Leu Thr Ser Leu305
310 315 320Leu Ala Cys Gly Asp Leu Gln
Val Thr Gly Ser Gly His Cys Pro Tyr 325
330 335Ser Thr Ala Gln Lys Ala Val Gly Lys Asp Asn Phe
Thr Leu Ile Pro 340 345 350Glu
Gly Val Asn Gly Ile Glu Glu Arg Met Thr Val Val Trp Asp Lys 355
360 365Ala Val Ala Thr Gly Lys Met Asp Glu
Asn Gln Phe Val Ala Val Thr 370 375
380Ser Thr Asn Ala Ala Lys Ile Phe Asn Leu Tyr Pro Arg Lys Gly Arg385
390 395 400Ile Ala Val Gly
Ser Asp Ala Asp Val Val Ile Trp Asp Pro Asp Lys 405
410 415Leu Lys Thr Ile Thr Ala Lys Ser His Lys
Ser Ala Val Glu Tyr Asn 420 425
430Ile Phe Glu Gly Met Glu Cys His Gly Ser Pro Leu Val Val Ile Ser
435 440 445Gln Gly Lys Ile Val Phe Glu
Asp Gly Asn Ile Asn Val Asn Lys Gly 450 455
460Met Gly Arg Phe Ile Pro Arg Lys Ala Phe Pro Glu His Leu Tyr
Gln465 470 475 480Arg Val
Lys Ile Arg Asn Lys Val Phe Gly Leu Gln Gly Val Ser Arg
485 490 495Gly Met Tyr Asp Gly Pro Val
Tyr Glu Val Pro Ala Thr Pro Lys Tyr 500 505
510Ala Thr Pro Ala Pro Ser Ala Lys Ser Ser Pro Ser Lys His
Gln Pro 515 520 525Pro Pro Ile Arg
Asn Leu His Gln Ser Asn Phe Ser Leu Ser Gly Ala 530
535 540Gln Ile Asp Asp Asn Asn Pro Arg Arg Thr Gly His
Arg Ile Val Ala545 550 555
560Pro Pro Gly Gly Arg Ser Asn Ile Thr Ser Leu Gly 565
57022842DNAHomo sapiens 2gtgggcatcc acgggcgccg agcctccgtc
cgtgtctcta tccctcccgg gcctttgtca 60gcgcgcccgc tgggagcggg gccgagagcg
ccggttccag tcagacagcc ccgcaggtca 120gcggccgggc cgagggcgcc agagggggcc
atgtcgtacc agggcaagaa gagcatcccg 180cacatcacga gtgaccgact cctcatcaaa
ggtggacgga tcatcaacga tgaccaatcc 240ctttatgctg acgtctacct ggaggatgga
cttatcaaac aaataggaga gaacttaatc 300gttcctggtg gagtgaagac cattgaagcc
aacgggcgga tggttattcc cggaggtatt 360gatgtcaaca cgtacctgca gaagccctcc
caggggatga ctgcggctga tgacttcttc 420caagggacca gggcggcact ggtgggcggg
accacgatga tcattgacca tgttgttcct 480gaacctgggt ccagcctact gacctctttc
gagaagtggc acgaagcagc tgacaccaaa 540tcctgctgtg attactccct ccacgtggac
atcacaagct ggtacgatgg cgttcgggag 600gagctggagg tgctggtgca ggacaaaggc
gtcaattcct tccaagtcta catggcctat 660aaggatgtct accaaatgtc cgacagccag
ctctatgaag cctttacctt ccttaagggc 720ctgggagctg tgatcttggt ccatgcagaa
aatggagatt tgatagctca ggaacaaaag 780cggatcctgg agatgggcat cacgggtccc
gagggccatg ccctgagcag acctgaagag 840ctggaggccg aggcggtgtt ccgggccatc
accattgcgg gccggatcaa ctgccctgtg 900tacatcacca aggtcatgag caagagtgca
gccgacatca tcgctctggc caggaagaaa 960gggcccctag tttttggaga gcccattgcc
gccagcctgg ggaccgatgg cacccattac 1020tggagcaaga actgggccaa ggctgcggcg
ttcgtgactt cccctcccct gagcccggac 1080cctaccacgc ccgactactt gacctcccta
ctggcctgtg gggacttgca ggtcacaggc 1140agcggccact gtccctacag cactgcccag
aaggcggtgg gcaaggacaa ctttaccctg 1200atccccgagg gtgtcaacgg gatagaggag
cggatgaccg tcgtctggga caaggcggtg 1260gctactggca aaatggatga gaaccagttt
gtcgctgtca ccagcaccaa tgcagccaag 1320atctttaacc tgtacccaag gaaagggcgg
attgccgtgg gctcggatgc cgacgtggtc 1380atctgggacc ccgacaagtt gaagaccata
acagccaaaa gtcacaagtc ggcggtggag 1440tacaacatct tcgagggtat ggagtgccac
ggctccccac tagtggtcat cagccagggc 1500aagatcgtct ttgaagacgg aaacatcaac
gtcaacaagg gcatgggccg cttcattccg 1560cggaaggcgt tcccggagca cctgtaccag
cgcgtcaaaa tcaggaataa ggtttttgga 1620ttgcaagggg tttccagggg catgtatgac
ggtcctgtgt acgaggtacc agctacaccc 1680aaatatgcaa ctcccgctcc ttcagccaaa
tcttcgcctt ctaaacacca gcccccaccc 1740atcagaaacc tccaccagtc caacttcagc
ttatcaggtg cccagataga tgacaacaat 1800cccaggcgca ccggccaccg catcgtggcg
ccccctggtg gccgctccaa catcaccagc 1860ctcggttgaa cgtggatgcg cggaggagct
agcctgaagg attctgggaa tcatgtccat 1920cccttttcct gtcagtgttt ttgaaaccca
cagttttagt tggtgctgat ggagggaggg 1980ggaagtcgaa ggatgctctt tcccttttct
gtttaggaag aagtggtact agtgtggtgt 2040gtttgcttgg aaattccttg ccccacagtt
gtgttcatgc tgaatccacc tcggagcatg 2100gtgttttcat tcccccttcc tagtgaacca
caggttttag cattgtcttg ttctgtccct 2160tccacttcta actccactgg ctccatgatt
ctctgagtgg tggttccttt gcaccctgta 2220gatgttctag gatagttgat gcatgttact
aaattacgta tgcaagtctg tgagtgcgtc 2280tgaggggaca tcgccaagga ctgactgaga
cacgatgccg agacctcaag ccctgagggg 2340cagtcccaaa acccttacag tgaagatgtt
tactcattgc ccccacctct ggtccacact 2400agaaagaagc tcgccccacc tccacctgtg
agatccgtga attctcggaa tggcagggga 2460agccttgcac taggttgcag agaagcatcc
tccacatcct gtgtcagaaa ccctggtctc 2520cgtggcactt gtaactcacc gtgctgtctt
ctggtctgtg tgtgttcttc aagccagctc 2580taggcttcag gccgagccag gttcacactc
agaaagatgt ctccccatcc ccattcgggg 2640ctgacgatgg ggggctgatg gctgcccctg
cgtggcctga gtcctggtcc ctctgaggca 2700gttgacgggg cagtcagatt tttaaagttt
tgtacaaagt tttcctttgt aatcactccc 2760atttttactt aacaaccaac ttgttgtggc
tcttatttct gaattcaaag cttgtgaaaa 2820aataaaagaa aatgaactgc cc
2842334DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 3gattctcgag ggggccatgt
cgtaccaggg caag 34444DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4gtctagatca gtgatggtgg tggtgatgac cgaggctggt gatg
44531DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 5actcgaggcc atgtcgtacc agggcaagaa g
31631DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6ctcgagacca tggaacaaaa gcggatcctg g
31731DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 7ctcgagacca tggactactt gacctcccta c
31829DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8ttctagacta ctggtacagg
tgctccggg 29959DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9gaatactcat actcttccgg atccgtcgac gccaccatgg tgctggtgca ggacaaagg
591057DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 10gaatactcat actcttccgg atccgtcgac gccaccatga tagctcagga
acaaaag 571158DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 11gaatactcat actcttccgg atccgtcgac
gccaccatga acatcaacgt caacaagg 581250DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12cagcggccgc tcagtggtgg tgatggtggt ggtcggctgc actcttgctc
501350DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 13tagcggccgc tcagtgatga tggtgatgat gtagggaggt caagtagtcg
501451DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14tagcggccgc tcagtgatga tggtgatgat gaccgaggct
ggtgatgttg g 5115480PRTHomo sapiens 15Met Ser Tyr Gln Gly
Lys Lys Ser Ile Pro His Ile Thr Ser Asp Arg1 5
10 15Leu Leu Ile Lys Gly Gly Arg Ile Ile Asn Asp
Asp Gln Ser Leu Tyr 20 25
30Ala Asp Val Tyr Leu Glu Asp Gly Leu Ile Lys Gln Ile Gly Glu Asn
35 40 45Leu Ile Val Pro Gly Gly Val Lys
Thr Ile Glu Ala Asn Gly Arg Met 50 55
60Val Ile Pro Gly Gly Ile Asp Val Asn Thr Tyr Leu Gln Lys Pro Ser65
70 75 80Gln Gly Met Thr Ala
Ala Asp Asp Phe Phe Gln Gly Thr Arg Ala Ala 85
90 95Leu Val Gly Gly Thr Thr Met Ile Ile Asp His
Val Val Pro Glu Pro 100 105
110Gly Ser Ser Leu Leu Thr Ser Phe Glu Lys Trp His Glu Ala Ala Asp
115 120 125Thr Lys Ser Cys Cys Asp Tyr
Ser Leu His Val Asp Ile Thr Ser Trp 130 135
140Tyr Asp Gly Val Arg Glu Glu Leu Glu Val Leu Val Gln Asp Lys
Gly145 150 155 160Val Asn
Ser Phe Gln Val Tyr Met Ala Tyr Lys Asp Val Tyr Gln Met
165 170 175Ser Asp Ser Gln Leu Tyr Glu
Ala Phe Thr Phe Leu Lys Gly Leu Gly 180 185
190Ala Val Ile Leu Val His Ala Glu Asn Gly Asp Leu Ile Ala
Gln Glu 195 200 205Gln Lys Arg Ile
Leu Glu Met Gly Ile Thr Gly Pro Glu Gly His Ala 210
215 220Leu Ser Arg Pro Glu Glu Leu Glu Ala Glu Ala Val
Phe Arg Ala Ile225 230 235
240Thr Ile Ala Gly Arg Ile Asn Cys Pro Val Tyr Ile Thr Lys Val Met
245 250 255Ser Lys Ser Ala Ala
Asp Ile Ile Ala Leu Ala Arg Lys Lys Gly Pro 260
265 270Leu Val Phe Gly Glu Pro Ile Ala Ala Ser Leu Gly
Thr Asp Gly Thr 275 280 285His Tyr
Trp Ser Lys Asn Trp Ala Lys Ala Ala Ala Phe Val Thr Ser 290
295 300Pro Pro Leu Ser Pro Asp Pro Thr Thr Pro Asp
Tyr Leu Thr Ser Leu305 310 315
320Leu Ala Cys Gly Asp Leu Gln Val Thr Gly Ser Gly His Cys Pro Tyr
325 330 335Ser Thr Ala Gln
Lys Ala Val Gly Lys Asp Asn Phe Thr Leu Ile Pro 340
345 350Glu Gly Val Asn Gly Ile Glu Glu Arg Met Thr
Val Val Trp Asp Lys 355 360 365Ala
Val Ala Thr Gly Lys Met Asp Glu Asn Gln Phe Val Ala Val Thr 370
375 380Ser Thr Asn Ala Ala Lys Ile Phe Asn Leu
Tyr Pro Arg Lys Gly Arg385 390 395
400Ile Ala Val Gly Ser Asp Ala Asp Val Val Ile Trp Asp Pro Asp
Lys 405 410 415Leu Lys Thr
Ile Thr Ala Lys Ser His Lys Ser Ala Val Glu Tyr Asn 420
425 430Ile Phe Glu Gly Met Glu Cys His Gly Ser
Pro Leu Val Val Ile Ser 435 440
445Gln Gly Lys Ile Val Phe Glu Asp Gly Asn Ile Asn Val Asn Lys Gly 450
455 460Met Gly Arg Phe Ile Pro Arg Lys
Ala Phe Pro Glu His Leu Tyr Gln465 470
475 480161460DNAHomo sapiens 16actcgaggcc atgtcgtacc
agggcaagaa gagcatcccg cacatcacga gtgaccgact 60cctcatcaaa ggtggacgga
tcatcaacga tgaccaatcc ctttatgctg acgtctacct 120ggaggatgga cttatcaaac
aaataggaga gaacttaatc gttcctggtg gagtgaagac 180cattgaagcc aacgggcgga
tggttattcc cggaggtatt gatgtcaaca cgtacctgca 240gaagccctcc caggggatga
ctgcggctga tgacttcttc caagggacca gggcggcact 300ggtgggcggg accacgatga
tcattgacca tgttgttcct gaacctgggt ccagcctact 360gacctctttc gagaagtggc
acgaagcagc tgacaccaaa tcctgctgtg attactccct 420ccacgtggac atcacaagct
ggtacgatgg cgttcgggag gagctggagg tgctggtgca 480ggacaaaggc gtcaattcct
tccaagtcta catggcctat aaggatgtct accaaatgtc 540cgacagccag ctctatgaag
cctttacctt ccttaagggc ctgggagctg tgatcttggt 600ccatgcagaa aatggagatt
tgatagctca ggaacaaaag cggatcctgg agatgggcat 660cacgggtccc gagggccatg
ccctgagcag acctgaagag ctggaggccg aggcggtgtt 720ccgggccatc accattgcgg
gccggatcaa ctgccctgtg tacatcacca aggtcatgag 780caagagtgca gccgacatca
tcgctctggc caggaagaaa gggcccctag tttttggaga 840gcccattgcc gccagcctgg
ggaccgatgg cacccattac tggagcaaga actgggccaa 900ggctgcggcg ttcgtgactt
cccctcccct gagcccggac cctaccacgc ccgactactt 960gacctcccta ctggcctgtg
gggacttgca ggtcacaggc agcggccact gtccctacag 1020cactgcccag aaggcggtgg
gcaaggacaa ctttaccctg atccccgagg gtgtcaacgg 1080gatagaggag cggatgacgg
tcgtctggga caaggcggtg gctactggca aaatggatga 1140gaaccagttt gtcgctgtca
ccagcaccaa tgcagccaag atctttaacc tgtacccaag 1200gaaagggcgg attgccgtgg
gctcggatgc cgacgtggtc atctgggacc ccgacaagtt 1260gaagaccata acagccaaaa
gtcacaagtc ggcggtggag tacaacatct tcgagggtat 1320ggagtgccac ggctccccac
tagtggtcat cagccagggc aagatcgtct ttgaagacgg 1380aaacatcaac gtcaacaagg
gcatgggccg cttcattccg cggaaggcgt tcccggagca 1440cctgtaccag tagtctagaa
146017274PRTHomo sapiens
17Met Glu Gln Lys Arg Ile Leu Glu Met Gly Ile Thr Gly Pro Glu Gly1
5 10 15His Ala Leu Ser Arg Pro
Glu Glu Leu Glu Ala Glu Ala Val Phe Arg 20 25
30Ala Ile Thr Ile Ala Gly Arg Ile Asn Cys Pro Val Tyr
Ile Thr Lys 35 40 45Val Met Ser
Lys Ser Ala Ala Asp Ile Ile Ala Leu Ala Arg Lys Lys 50
55 60Gly Pro Leu Val Phe Gly Glu Pro Ile Ala Ala Ser
Leu Gly Thr Asp65 70 75
80Gly Thr His Tyr Trp Ser Lys Asn Trp Ala Lys Ala Ala Ala Phe Val
85 90 95Thr Ser Pro Pro Leu Ser
Pro Asp Pro Thr Thr Pro Asp Tyr Leu Thr 100
105 110Ser Leu Leu Ala Cys Gly Asp Leu Gln Val Thr Gly
Ser Gly His Cys 115 120 125Pro Tyr
Ser Thr Ala Gln Lys Ala Val Gly Lys Asp Asn Phe Thr Leu 130
135 140Ile Pro Glu Gly Val Asn Gly Ile Glu Glu Arg
Met Thr Val Val Trp145 150 155
160Asp Lys Ala Val Ala Thr Gly Lys Met Asp Glu Asn Gln Phe Val Ala
165 170 175Val Thr Ser Thr
Asn Ala Ala Lys Ile Phe Asn Leu Tyr Pro Arg Lys 180
185 190Gly Arg Ile Ala Val Gly Ser Asp Ala Asp Val
Val Ile Trp Asp Pro 195 200 205Asp
Lys Leu Lys Thr Ile Thr Ala Lys Ser His Lys Ser Ala Val Glu 210
215 220Tyr Asn Ile Phe Glu Gly Met Glu Cys His
Gly Ser Pro Leu Val Val225 230 235
240Ile Ser Gln Gly Lys Ile Val Phe Glu Asp Gly Asn Ile Asn Val
Asn 245 250 255Lys Gly Met
Gly Arg Phe Ile Pro Arg Lys Ala Phe Pro Glu His Leu 260
265 270Tyr Gln18841DNAHomo sapiens 18ctcgagacca
tggaacaaaa gcggatcctg gagatgggca tcacgggtcc cgagggccat 60gccctgagca
gacctgaaga gctggaggcc gaggcggtgt tccgggccat caccattgcg 120ggccggatca
actgccctgt gtacatcacc aaggtcatga gcaagagtgc agccgacatc 180atcgctctgg
ccaggaagaa agggccccta gtttttggag agcccattgc cgccagcctg 240gggaccgatg
gcacccatta ctggagcaag aactgggcca aggctgcggc gttcgtgact 300tcccctcccc
tgagcccgga ccctaccacg cccgactact tgacctccct actggcctgt 360ggggacttgc
aggtcacagg cagcggccac tgtccctaca gcactgccca gaaggcggtg 420ggcaaggaca
actttaccct gatccccgag ggtgtcaacg ggatagagga gcggatgacg 480gtcgtctggg
acaaggcggt ggctactggc aaaatggatg agaaccagtt tgtcgctgtc 540accagcacca
atgcagccaa gatctttaac ctgtacccaa ggaaagggcg gattgccgtg 600ggctcggatg
ccgacgtggt catctgggac cccgacaagt tgaagaccat aacagccaaa 660agtcacaagt
cggcggtgga gtacaacatc ttcgagggta tggagtgcca cggctcccca 720ctagtggtca
tcagccaggg caagatcgtc tttgaagacg gaaacatcaa cgtcaacaag 780ggcatgggcc
gcttcattcc gcggaaggcg ttcccggagc acctgtacca gtagtctaga 840a
84119167PRTHomo
sapiens 19Met Asp Tyr Leu Thr Ser Leu Leu Ala Cys Gly Asp Leu Gln Val
Thr1 5 10 15Gly Ser Gly
His Cys Pro Tyr Ser Thr Ala Gln Lys Ala Val Gly Lys 20
25 30Asp Asn Phe Thr Leu Ile Pro Glu Gly Val
Asn Gly Ile Glu Glu Arg 35 40
45Met Thr Val Val Trp Asp Lys Ala Val Ala Thr Gly Lys Met Asp Glu 50
55 60Asn Gln Phe Val Ala Val Thr Ser Thr
Asn Ala Ala Lys Ile Phe Asn65 70 75
80Leu Tyr Pro Arg Lys Gly Arg Ile Ala Val Gly Ser Asp Ala
Asp Val 85 90 95Val Ile
Trp Asp Pro Asp Lys Leu Lys Thr Ile Thr Ala Lys Ser His 100
105 110Lys Ser Ala Val Glu Tyr Asn Ile Phe
Glu Gly Met Glu Cys His Gly 115 120
125Ser Pro Leu Val Val Ile Ser Gln Gly Lys Ile Val Phe Glu Asp Gly
130 135 140Asn Ile Asn Val Asn Lys Gly
Met Gly Arg Phe Ile Pro Arg Lys Ala145 150
155 160Phe Pro Glu His Leu Tyr Gln
16520520DNAHomo sapiens 20ctcgagacca tggactactt gacctcccta ctggcctgtg
gggacttgca ggtcacaggc 60agcggccact gtccctacag cactgcccag aaggcggtgg
gcaaggacaa ctttaccctg 120atccccgagg gtgtcaacgg gatagaggag cggatgacgg
tcgtctggga caaggcggtg 180gctactggca aaatggatga gaaccagttt gtcgctgtca
ccagcaccaa tgcagccaag 240atctttaacc tgtacccaag gaaagggcgg attgccgtgg
gctcggatgc cgacgtggtc 300atctgggacc ccgacaagtt gaagaccata acagccaaaa
gtcacaagtc ggcggtggag 360tacaacatct tcgagggtat ggagtgccac ggctccccac
tagtggtcat cagccagggc 420aagatcgtct ttgaagacgg aaacatcaac gtcaacaagg
gcatgggccg cttcattccg 480cggaaggcgt tcccggagca cctgtaccag tagtctagaa
52021116PRTHomo sapiens 21Met Val Leu Val Gln Asp
Lys Gly Val Asn Ser Phe Gln Val Tyr Met1 5
10 15Ala Tyr Lys Asp Val Tyr Gln Met Ser Asp Ser Gln
Leu Tyr Glu Ala 20 25 30Phe
Thr Phe Leu Lys Gly Leu Gly Ala Val Ile Leu Val His Ala Glu 35
40 45Asn Gly Asp Leu Ile Ala Gln Glu Gln
Lys Arg Ile Leu Glu Met Gly 50 55
60Ile Thr Gly Pro Glu Gly His Ala Leu Ser Arg Pro Glu Glu Leu Glu65
70 75 80Ala Glu Ala Val Phe
Arg Ala Ile Thr Ile Ala Gly Arg Ile Asn Cys 85
90 95Pro Val Tyr Ile Thr Lys Val Met Ser Lys Ser
Ala Ala Asp His His 100 105
110His His His His 11522397DNAHomo sapiens 22gaatactcat actcttccgg
atccgtcgac gccaccatgg tgctggtgca ggacaaaggc 60gtcaattcct tccaagtcta
catggcctat aaggatgtct accaaatgtc cgacagccag 120ctctatgaag cctttacctt
ccttaagggc ctgggagctg tgatcttggt ccatgcagaa 180aatggagatt tgatagctca
ggaacaaaag cggatcctgg agatgggcat cacgggtccc 240gagggccatg ccctgagcag
acctgaagag ctggaggccg aggcggtgtt ccgggccatc 300accattgcgg gccggatcaa
ctgccctgtg tacatcacca aggtcatgag caagagtgca 360gccgaccacc accatcacca
ccactgagcg gccgctg 39723123PRTHomo sapiens
23Met Ile Ala Gln Glu Gln Lys Arg Ile Leu Glu Met Gly Ile Thr Gly1
5 10 15Pro Glu Gly His Ala Leu
Ser Arg Pro Glu Glu Leu Glu Ala Glu Ala 20 25
30Val Phe Arg Ala Ile Thr Ile Ala Gly Arg Ile Asn Cys
Pro Val Tyr 35 40 45Ile Thr Lys
Val Met Ser Lys Ser Ala Ala Asp Ile Ile Ala Leu Ala 50
55 60Arg Lys Lys Gly Pro Leu Val Phe Gly Glu Pro Ile
Ala Ala Ser Leu65 70 75
80Gly Thr Asp Gly Thr His Tyr Trp Ser Lys Asn Trp Ala Lys Ala Ala
85 90 95Ala Phe Val Thr Ser Pro
Pro Leu Ser Pro Asp Pro Thr Thr Pro Asp 100
105 110Tyr Leu Thr Ser Leu His His His His His His
115 12024418DNAHomo sapiens 24gaatactcat actcttccgg
atccgtcgac gccaccatga tagctcagga acaaaagcgg 60atcctggaga tgggcatcac
gggtcccgag ggccatgccc tgagcagacc tgaagagctg 120gaggccgagg cggtgttccg
ggccatcacc attgcgggcc ggatcaactg ccctgtgtac 180atcaccaagg tcatgagcaa
gagtgcagcc gacatcatcg ctctggccag gaagaaaggg 240cccctagttt ttggagagcc
cattgccgcc agcctgggga ccgatggcac ccattactgg 300agcaagaact gggccaaggc
tgcggcgttc gtgacttccc ctcccctgag cccggaccct 360accacgcccg actacttgac
ctccctacat catcaccatc atcactgagc ggccgcta 41825122PRTHomo sapiens
25Met Asn Ile Asn Val Asn Lys Gly Met Gly Arg Phe Ile Pro Arg Lys1
5 10 15Ala Phe Pro Glu His Leu
Tyr Gln Arg Val Lys Ile Arg Asn Lys Val 20 25
30Phe Gly Leu Gln Gly Val Ser Arg Gly Met Tyr Asp Gly
Pro Val Tyr 35 40 45Glu Val Pro
Ala Thr Pro Lys Tyr Ala Thr Pro Ala Pro Ser Ala Lys 50
55 60Ser Ser Pro Ser Lys His Gln Pro Pro Pro Ile Arg
Asn Leu His Gln65 70 75
80Ser Asn Phe Ser Leu Ser Gly Ala Gln Ile Asp Asp Asn Asn Pro Arg
85 90 95Arg Thr Gly His Arg Ile
Val Ala Pro Pro Gly Gly Arg Ser Asn Ile 100
105 110Thr Ser Leu Gly His His His His His His 115
12026415DNAHomo sapiens 26gaatactcat actcttccgg
atccgtcgac gccaccatga acatcaacgt caacaagggc 60atgggccgct tcattccgcg
gaaggcgttc ccggagcacc tgtaccagcg cgtcaaaatc 120aggaataagg tttttggatt
gcaaggggtt tccaggggca tgtatgacgg tcctgtgtac 180gaggtaccag ctacacccaa
atatgcaact cccgctcctt cagccaaatc ttcgccttct 240aaacaccagc ccccacccat
cagaaacctc caccagtcca acttcagctt atcaggtgcc 300cagatagatg acaacaatcc
caggcgcacc ggccaccgca tcgtggcgcc ccctggtggc 360cgctccaaca tcaccagcct
cggtcatcat caccatcatc actgagcggc cgcta 4152727DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27attgaaagct tatgtcgtac cagggca
272827DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 28atatcctcga gaccgaggct ggtgatg
272927DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29agcaagcttg aacaaaagcg gatcctg
273025DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 30taactcgagc tggtacaggt gctcc
253137DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 31tatgtacggt
cgtaaaaaac gtcgtcagcg tcgtcgg
373239DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32gatcccgacg acgctgacga cgttttttac gaccgtaca
39331440DNAHomo sapiens 33atgtcgtacc agggcaagaa
gagcatcccg cacatcacga gtgaccgact cctcatcaaa 60ggtggacgga tcatcaacga
tgaccaatcc ctttatgctg acgtctacct ggaggatgga 120cttatcaaac aaataggaga
gaacttaatc gttcctggtg gagtgaagac cattgaagcc 180aacgggcgga tggttattcc
cggaggtatt gatgtcaaca cgtacctgca gaagccctcc 240caggggatga ctgcggctga
tgacttcttc caagggacca gggcggcact ggtgggcggg 300accacgatga tcattgacca
tgttgttcct gaacctgggt ccagcctact gacctctttc 360gagaagtggc acgaagcagc
tgacaccaaa tcctgctgtg attactccct ccacgtggac 420atcacaagct ggtacgatgg
cgttcgggag gagctggagg tgctggtgca ggacaaaggc 480gtcaattcct tccaagtcta
catggcctat aaggatgtct accaaatgtc cgacagccag 540ctctatgaag cctttacctt
ccttaagggc ctgggagctg tgatcttggt ccatgcagaa 600aatggagatt tgatagctca
ggaacaaaag cggatcctgg agatgggcat cacgggtccc 660gagggccatg ccctgagcag
acctgaagag ctggaggccg aggcggtgtt ccgggccatc 720accattgcgg gccggatcaa
ctgccctgtg tacatcacca aggtcatgag caagagtgca 780gccgacatca tcgctctggc
caggaagaaa gggcccctag tttttggaga gcccattgcc 840gccagcctgg ggaccgatgg
cacccattac tggagcaaga actgggccaa ggctgcggcg 900ttcgtgactt cccctcccct
gagcccggac cctaccacgc ccgactactt gacctcccta 960ctggcctgtg gggacttgca
ggtcacaggc agcggccact gtccctacag cactgcccag 1020aaggcggtgg gcaaggacaa
ctttaccctg atccccgagg gtgtcaacgg gatagaggag 1080cggatgacgg tcgtctggga
caaggcggtg gctactggca aaatggatga gaaccagttt 1140gtcgctgtca ccagcaccaa
tgcagccaag atctttaacc tgtacccaag gaaagggcgg 1200attgccgtgg gctcggatgc
cgacgtggtc atctgggacc ccgacaagtt gaagaccata 1260acagccaaaa gtcacaagtc
ggcggtggag tacaacatct tcgagggtat ggagtgccac 1320ggctccccac tagtggtcat
cagccagggc aagatcgtct ttgaagacgg aaacatcaac 1380gtcaacaagg gcatgggccg
cttcattccg cggaaggcgt tcccggagca cctgtaccag 144034819DNAHomo sapiens
34gaacaaaagc ggatcctgga gatgggcatc acgggtcccg agggccatgc cctgagcaga
60cctgaagagc tggaggccga ggcggtgttc cgggccatca ccattgcggg ccggatcaac
120tgccctgtgt acatcaccaa ggtcatgagc aagagtgcag ccgacatcat cgctctggcc
180aggaagaaag ggcccctagt ttttggagag cccattgccg ccagcctggg gaccgatggc
240acccattact ggagcaagaa ctgggccaag gctgcggcgt tcgtgacttc ccctcccctg
300agcccggacc ctaccacgcc cgactacttg acctccctac tggcctgtgg ggacttgcag
360gtcacaggca gcggccactg tccctacagc actgcccaga aggcggtggg caaggacaac
420tttaccctga tccccgaggg tgtcaacggg atagaggagc ggatgacggt cgtctgggac
480aaggcggtgg ctactggcaa aatggatgag aaccagtttg tcgctgtcac cagcaccaat
540gcagccaaga tctttaacct gtacccaagg aaagggcgga ttgccgtggg ctcggatgcc
600gacgtggtca tctgggaccc cgacaagttg aagaccataa cagccaaaag tcacaagtcg
660gcggtggagt acaacatctt cgagggtatg gagtgccacg gctccccact agtggtcatc
720agccagggca agatcgtctt tgaagacgga aacatcaacg tcaacaaggg catgggccgc
780ttcattccgc ggaaggcgtt cccggagcac ctgtaccag
81935498DNAHomo sapiens 35gactacttga cctccctact ggcctgtggg gacttgcagg
tcacaggcag cggccactgt 60ccctacagca ctgcccagaa ggcggtgggc aaggacaact
ttaccctgat ccccgagggt 120gtcaacggga tagaggagcg gatgacggtc gtctgggaca
aggcggtggc tactggcaaa 180atggatgaga accagtttgt cgctgtcacc agcaccaatg
cagccaagat ctttaacctg 240tacccaagga aagggcggat tgccgtgggc tcggatgccg
acgtggtcat ctgggacccc 300gacaagttga agaccataac agccaaaagt cacaagtcgg
cggtggagta caacatcttc 360gagggtatgg agtgccacgg ctccccacta gtggtcatca
gccagggcaa gatcgtcttt 420gaagacggaa acatcaacgt caacaagggc atgggccgct
tcattccgcg gaaggcgttc 480ccggagcacc tgtaccag
49836327DNAHomo sapiens 36gtgctggtgc aggacaaagg
cgtcaattcc ttccaagtct acatggccta taaggatgtc 60taccaaatgt ccgacagcca
gctctatgaa gcctttacct tccttaaggg cctgggagct 120gtgatcttgg tccatgcaga
aaatggagat ttgatagctc aggaacaaaa gcggatcctg 180gagatgggca tcacgggtcc
cgagggccat gccctgagca gacctgaaga gctggaggcc 240gaggcggtgt tccgggccat
caccattgcg ggccggatca actgccctgt gtacatcacc 300aaggtcatga gcaagagtgc
agccgac 32737348DNAHomo sapiens
37atagctcagg aacaaaagcg gatcctggag atgggcatca cgggtcccga gggccatgcc
60ctgagcagac ctgaagagct ggaggccgag gcggtgttcc gggccatcac cattgcgggc
120cggatcaact gccctgtgta catcaccaag gtcatgagca agagtgcagc cgacatcatc
180gctctggcca ggaagaaagg gcccctagtt tttggagagc ccattgccgc cagcctgggg
240accgatggca cccattactg gagcaagaac tgggccaagg ctgcggcgtt cgtgacttcc
300cctcccctga gcccggaccc taccacgccc gactacttga cctcccta
34838345DNAHomo sapiens 38aacatcaacg tcaacaaggg catgggccgc ttcattccgc
ggaaggcgtt cccggagcac 60ctgtaccagc gcgtcaaaat caggaataag gtttttggat
tgcaaggggt ttccaggggc 120atgtatgacg gtcctgtgta cgaggtacca gctacaccca
aatatgcaac tcccgctcct 180tcagccaaat cttcgccttc taaacaccag cccccaccca
tcagaaacct ccaccagtcc 240aacttcagct tatcaggtgc ccagatagat gacaacaatc
ccaggcgcac cggccaccgc 300atcgtggcgc cccctggtgg ccgctccaac atcaccagcc
tcggt 34539273PRTHomo sapiens 39Glu Gln Lys Arg Ile
Leu Glu Met Gly Ile Thr Gly Pro Glu Gly His1 5
10 15Ala Leu Ser Arg Pro Glu Glu Leu Glu Ala Glu
Ala Val Phe Arg Ala 20 25
30Ile Thr Ile Ala Gly Arg Ile Asn Cys Pro Val Tyr Ile Thr Lys Val
35 40 45Met Ser Lys Ser Ala Ala Asp Ile
Ile Ala Leu Ala Arg Lys Lys Gly 50 55
60Pro Leu Val Phe Gly Glu Pro Ile Ala Ala Ser Leu Gly Thr Asp Gly65
70 75 80Thr His Tyr Trp Ser
Lys Asn Trp Ala Lys Ala Ala Ala Phe Val Thr 85
90 95Ser Pro Pro Leu Ser Pro Asp Pro Thr Thr Pro
Asp Tyr Leu Thr Ser 100 105
110Leu Leu Ala Cys Gly Asp Leu Gln Val Thr Gly Ser Gly His Cys Pro
115 120 125Tyr Ser Thr Ala Gln Lys Ala
Val Gly Lys Asp Asn Phe Thr Leu Ile 130 135
140Pro Glu Gly Val Asn Gly Ile Glu Glu Arg Met Thr Val Val Trp
Asp145 150 155 160Lys Ala
Val Ala Thr Gly Lys Met Asp Glu Asn Gln Phe Val Ala Val
165 170 175Thr Ser Thr Asn Ala Ala Lys
Ile Phe Asn Leu Tyr Pro Arg Lys Gly 180 185
190Arg Ile Ala Val Gly Ser Asp Ala Asp Val Val Ile Trp Asp
Pro Asp 195 200 205Lys Leu Lys Thr
Ile Thr Ala Lys Ser His Lys Ser Ala Val Glu Tyr 210
215 220Asn Ile Phe Glu Gly Met Glu Cys His Gly Ser Pro
Leu Val Val Ile225 230 235
240Ser Gln Gly Lys Ile Val Phe Glu Asp Gly Asn Ile Asn Val Asn Lys
245 250 255Gly Met Gly Arg Phe
Ile Pro Arg Lys Ala Phe Pro Glu His Leu Tyr 260
265 270Gln 40166PRTHomo sapiens 40Asp Tyr Leu Thr Ser
Leu Leu Ala Cys Gly Asp Leu Gln Val Thr Gly1 5
10 15Ser Gly His Cys Pro Tyr Ser Thr Ala Gln Lys
Ala Val Gly Lys Asp 20 25
30Asn Phe Thr Leu Ile Pro Glu Gly Val Asn Gly Ile Glu Glu Arg Met
35 40 45Thr Val Val Trp Asp Lys Ala Val
Ala Thr Gly Lys Met Asp Glu Asn 50 55
60Gln Phe Val Ala Val Thr Ser Thr Asn Ala Ala Lys Ile Phe Asn Leu65
70 75 80Tyr Pro Arg Lys Gly
Arg Ile Ala Val Gly Ser Asp Ala Asp Val Val 85
90 95Ile Trp Asp Pro Asp Lys Leu Lys Thr Ile Thr
Ala Lys Ser His Lys 100 105
110Ser Ala Val Glu Tyr Asn Ile Phe Glu Gly Met Glu Cys His Gly Ser
115 120 125Pro Leu Val Val Ile Ser Gln
Gly Lys Ile Val Phe Glu Asp Gly Asn 130 135
140Ile Asn Val Asn Lys Gly Met Gly Arg Phe Ile Pro Arg Lys Ala
Phe145 150 155 160Pro Glu
His Leu Tyr Gln 16541109PRTHomo sapiens 41Val Leu Val Gln
Asp Lys Gly Val Asn Ser Phe Gln Val Tyr Met Ala1 5
10 15Tyr Lys Asp Val Tyr Gln Met Ser Asp Ser
Gln Leu Tyr Glu Ala Phe 20 25
30Thr Phe Leu Lys Gly Leu Gly Ala Val Ile Leu Val His Ala Glu Asn
35 40 45Gly Asp Leu Ile Ala Gln Glu Gln
Lys Arg Ile Leu Glu Met Gly Ile 50 55
60Thr Gly Pro Glu Gly His Ala Leu Ser Arg Pro Glu Glu Leu Glu Ala65
70 75 80Glu Ala Val Phe Arg
Ala Ile Thr Ile Ala Gly Arg Ile Asn Cys Pro 85
90 95Val Tyr Ile Thr Lys Val Met Ser Lys Ser Ala
Ala Asp 100 10542116PRTHomo sapiens 42Ile Ala
Gln Glu Gln Lys Arg Ile Leu Glu Met Gly Ile Thr Gly Pro1 5
10 15Glu Gly His Ala Leu Ser Arg Pro
Glu Glu Leu Glu Ala Glu Ala Val 20 25
30Phe Arg Ala Ile Thr Ile Ala Gly Arg Ile Asn Cys Pro Val Tyr
Ile 35 40 45Thr Lys Val Met Ser
Lys Ser Ala Ala Asp Ile Ile Ala Leu Ala Arg 50 55
60Lys Lys Gly Pro Leu Val Phe Gly Glu Pro Ile Ala Ala Ser
Leu Gly65 70 75 80Thr
Asp Gly Thr His Tyr Trp Ser Lys Asn Trp Ala Lys Ala Ala Ala
85 90 95Phe Val Thr Ser Pro Pro Leu
Ser Pro Asp Pro Thr Thr Pro Asp Tyr 100 105
110Leu Thr Ser Leu 11543115PRTHomo sapiens 43Asn Ile
Asn Val Asn Lys Gly Met Gly Arg Phe Ile Pro Arg Lys Ala1 5
10 15Phe Pro Glu His Leu Tyr Gln Arg
Val Lys Ile Arg Asn Lys Val Phe 20 25
30Gly Leu Gln Gly Val Ser Arg Gly Met Tyr Asp Gly Pro Val Tyr
Glu 35 40 45Val Pro Ala Thr Pro
Lys Tyr Ala Thr Pro Ala Pro Ser Ala Lys Ser 50 55
60Ser Pro Ser Lys His Gln Pro Pro Pro Ile Arg Asn Leu His
Gln Ser65 70 75 80Asn
Phe Ser Leu Ser Gly Ala Gln Ile Asp Asp Asn Asn Pro Arg Arg
85 90 95Thr Gly His Arg Ile Val Ala
Pro Pro Gly Gly Arg Ser Asn Ile Thr 100 105
110Ser Leu Gly 115446PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag 44His
His His His His His1 54511PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 45Tyr Gly Arg Lys Lys Arg
Arg Gln Arg Arg Arg1 5 10
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20140074947 | AUTOMATED E-MAIL SCREENING TO VERIFY RECIPIENTS OF AN OUTGOING E-MAIL MESSAGE |
20140074946 | EMBEDDED COMMUNICATION IN MESSAGE BASED TRANSPORTS |
20140074945 | Electronic Communication Warning and Modification |
20140074944 | Establishing A Communication Event |
20140074943 | Electronic Communication Warning and Modification |