Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees


Zhenguo

Zhenguo Chen, Shenzhen CN

Patent application numberDescriptionPublished
20090144730SOFTWARE DEPLOYMENT METHOD AND SYSTEM, SOFTWARE DEPLOYMENT SERVER AND USER SERVER - A software deployment method creates and provides an installation parameter file for each computer to be deployed according to a software deployment task. The installation parameter file of each computer to be deployed is used to guide a network installation of software on the computer. A corresponding software deployment system, a software deployment server, and a software deployment user server are also provided. The installation parameter files are generated collectively according to the software deployment tasks, so that the computer equipment is guided by the installation parameter file to install the software automatically. Therefore, the software deployment on the computers in batches is more convenient. Moreover, as the installation parameter file corresponds to each computer to be deployed, the software type and the parameter configuration of each computer to be deployed can be adjusted flexibly, which facilitates the customization of the software.06-04-2009

Zhenguo Li, Mudanjiang CN

Patent application numberDescriptionPublished
20130172233Extract for Preventing of Treating Thrombotic Diseases - An extract for preventing or treating thrombotic diseases, particularly, an extract of at least one of leeches and earthworms having a molecular weight of no more than 5,800 daltons is provided, wherein the extract includes 15% to 38% amino acid, 40% to 60% saccharide and 0.3% to 1% hypoxanthine. Processes for preparation, pharmaceutical compositions and uses thereof are also provided. Compared to conventional arts, the extract has safety greatly improved and drug actions maintained and even improved.07-04-2013

Zhenguo Li, Heilongjiang Province CN

Patent application numberDescriptionPublished
20080206352Extract for Preventing or Treating Thrombotic Diseases - An extract for preventing or treating thrombotic disease, particularly, an extract of leech and/or earthworm with molecular weight of not more than 5800 Dalton, and processes for preparation, pharmaceutical compositions and uses thereof. The extract of the present invention has improved significantly safety without any reducing in pharmaceutical activities or the therapeutical effects as compared to existing products.08-28-2008

Zhenguo Liu, Flanders, NJ US

Patent application numberDescriptionPublished
20100209641METHOD TO MAKE SINGLE-LAYER PET BOTTLES WITH HIGH BARRIER AND IMPROVED CLARITY - The present invention comprises a blend of polyester and a partially aromatic polyamide with an ionic compatibilizer and a cobalt salt. This blend can be processed into a container that has both active and passive oxygen barrier and carbon dioxide barrier properties at an improved color and clarity than containers known in the art. The partially aromatic polyamide is preferably meta-xylylene adipamide. The ionic compatibilizer is preferably 5-sodiumsulfoisophthalic acid or 5-zinesulfoisophthalic acid, or their dialkyl esters such as the dimethyl ester (SIM) and glycol ester (SIPEG). The cobalt salt is selected form the class of cobalt acetate, cobalt carbonate, cobalt chloride, cobalt hydroxide, cobalt naphthenate, cobalt oleate, cobalt linoleate, cobalt octoate, cobalt stearate, cobalt nitrate, cobalt phosphate, cobalt sulfate, cobalt (ethylene glycolate), or mixtures of two or more of these. The partially aromatic polyamide is present in a range from about 1 to about 10 wt. % of said composition. The ionic compatibilizer is present in a range from about 0.1 to about 2.0 mol-% of said composition. The cobalt salt is present in a range from about 20 to about 500 ppm of said composition.08-19-2010
20100316538Polymeric Trap with Adsorbent - A method of adhering a particulate material, such as a hydrocarbon adsorbent material and/or a catalytic material, to a plastic surface, and products comprising the adhered material are disclosed.12-16-2010
20110000127SINGLE LAYER FUEL TANK - A single layer fuel tank includes a polyamide component, an impact modifier, and a binding filler. The polyamide component has a polyamide selected from the group of polyamide 6, polyamide 6/6, polyamide 6/66, and combinations thereof. The polyamide component also includes up to 5 parts by weight of polyamide oligomers per 100 parts by weight of the polyamide component. The impact modifier is an organic copolymer and is present in an amount of up to 30 parts by weight per 100 parts by weight of the fuel tank. The binding filler is not covalently bonded to the polyamide and includes at least one of a silica and a cyclodextrin. In addition, the binding filler is present in an amount of up to 10 parts by weight per 100 parts by weight of the fuel tank.01-06-2011
20160002453Inner Liner For A Pneumatic Tire Assembly - A polyamide composition comprises a polyamide, an anhydride-functional copolymer reactive with the polyamide, and a poly (ethylene-co-methacrylic acid) ionomer. A pneumatic tire assembly includes an inner liner which is formed from the poly-amide composition. The inner liner comprises the reaction product of the polyamide and the anhydride-functional copolymer, as well as the (ethylene-co-methacrylic acid) ionomer.01-07-2016

Patent applications by Zhenguo Liu, Flanders, NJ US

Zhenguo Liu US

Patent application numberDescriptionPublished
20100113626OPAQUE CONTAINERS CONTAINING COLORED RECYCLED POLYESTER - The present invention relates to a composition comprising a colored recycled polyethylene terephthalate (RPET) and an opacifying material. The composition can further comprise a virgin polyethylene terephthalate (PET), a high gas barrier or an oxygen scavenging compound. Suitable opacifying material, suitable high gas barrier polymer and suitable oxygen scavenging compound are disclosed herein. Other embodiments of the present invention include articles produced from these compositions and processes for producing these compositions.05-06-2010

Zhenguo Liu, Greer, SC US

Patent application numberDescriptionPublished
20090030115Colored oxygen scavenging polymers - The present invention relates to a melt blend of a base polymer, an oxidizable organic polymer, a transition metal salt catalyst and a colorant that does not completely deactivate the catalyzed oxidation. A preferred colorant, yields in an article made from the polymer melt blend a Catalyst Deactivation Factor (CDF) of less than about 0.25, preferably less than 0.15, more preferably less than 0.1, and most preferred less than 0.05. The present invention also comprises a colored monolayer article having the described CDF, such as a film, thermoformed tray, or blow molded container, that has active oxygen scavenging properties. The colorant, after melt blending a base polymer, an oxidizable organic polymer, a transition metal catalyst, does not increase the binding energy of the transition metal catalyst ion by more than 1 eV.01-29-2009

Patent applications by Zhenguo Liu, Greer, SC US

Zhenguo Liu, Shanghai CN

Patent application numberDescriptionPublished
20160060452COMPOSITION OF REINFORCED POLYALKYLENE TEREPHTHALATE, PREPARATION AND USE THEREOF - A composition comprises polyalkylene terephthalate and terpolymer of alkylene diol, isophthalic acid and terephthalic acid, and polyalkylene terephthalate reinforcing fiber. The composition may be used to form an article, alone or with other thermoplastic material, at lower processing temperature, with higher melt flowability. The article formed is characterized with lower warpage and improved mechanical properties. The article may be useful for automotive, electrical, household, construction, and industrial applications. A method of preparing such thermoplastic polyester is also disclosed.03-03-2016

Zhenguo Liu, Yantai, Shandong CN

Patent application numberDescriptionPublished
20160068472METHOD FOR PREPARING DIAMINO-DICYCLOHEXYL METHANE - Disclosed is a method for preparing diamino-dicyclohexyl methane (H03-10-2016

Zhenguo Ma, Beijing CN

Patent application numberDescriptionPublished
20130294545METHOD AND APPARATUS FOR ELIMINATING DIRECT CURRENT OFFSET - The present invention provides a method and an apparatus for eliminating direct current offset. The method comprises the steps of: calculating Euclidean distances between every two demodulation symbols of a plurality of demodulation symbols based on Quadrature Phase Shift Keying (QPSK) modulation; determining four sets from the plurality of demodulation symbols in accordance with the Euclidean distances between the demodulation symbols, each set corresponding to a modulation direction for the QPSK modulation; performing Euclidean distance weighted summation on the determined four sets respectively, and selecting a demodulation symbol with the minimum weighted summation value from each set as a rough estimation point for the QPSK modulation, so as to obtain four rough estimation points; re-determining four sets from the plurality of demodulation symbols in accordance with the Euclidean distances between the demodulation symbols and the rough estimation points; performing Euclidean distance weighted summation on the re-determined four sets respectively, and selecting a demodulation symbol with the minimum weighted summation value from each set as a precise estimation point; and performing direct current offset calculation and compensation in accordance with the precise estimation points. The present invention can improve the demodulation performance of a system.11-07-2013

Zhenguo Sun, Suzhou CN

Patent application numberDescriptionPublished
20110001546SUB-THRESHOLD CMOS TEMPERATURE DETECTOR - A CMOS temperature detection circuit includes a start-up circuit for generating a start-up voltage (VN), and a proportional to absolute temperature (PTAT) current generator coupled to the start-up circuit for generating a PTAT current. The start-up voltage turns on the PTAT current generator, and the PTAT current generator uses the sub-threshold characteristics of CMOS to generate the PTAT current. A PTAT voltage generator coupled to the PTAT current generator receives the PTAT current and generates a PTAT voltage and an inverse PTAT voltage (VBE). A comparator circuit coupled to the voltage generator compares the inverse PTAT voltage to first and second alarm limits, which are defined using the generated PTAT voltage, and generates an alarm signal based on the comparison results.01-06-2011

Zhenguo Wang, Tianjin CN

Patent application numberDescriptionPublished
20150359900CONJUGATES OF WATER SOLUBLE POLYMER-AMINO ACID OLIGOPEPTIDE-DRUG, PREPARATION METHOD AND USE THEREOF - A conjugate of water soluble polymer-amino acid oligopeptide-drug of Formula (I) below and a pharmaceutical composition comprising the conjugate are provided. In the conjugate, P is a water soluble polymer; X is a linking group, wherein the linking group links P and A12-17-2015

Zhenguo Wang, Beijing CN

Patent application numberDescriptionPublished
20160082117LOW MOLECULAR WEIGHT POLYETHYLENE GLYCOL DRUG CONJUGATES HAVING IMPROVED DRUG BIOLOGICAL ACTIVITY - Provided are polyethylene glycol drug conjugates of general formula (I), (II) or (III) and pharmaceutical compositions and a use thereof. The conjugates are formed by combining low molecular weight polyethylene glycol with 2-4 drug molecules. The conjugates can interact with receptor dimers or polymers, thereby improving the in vivo distribution of the drug, changing the oil and water distribution coefficient, enhancing the pharmacological activity, reducing the blood-brain barrier permeability of the drug, and improving the bioavailability of the drug.03-24-2016
20160095934DASATINIB AND NONLINEAR CONFIGURATION POLYETHYLENE GLYCOL CONJUGATE - A dasatinib and nonlinear configuration polyethylene glycol conjugate represented by formula I, wherein core is the core structure of a nonlinear configuration of polyethylene glycol, selected from a residue of pentaerythritol, methylglucoside, sucrose, diethylene glycol, propanediol, glycerol or polyglycerol removaed the hydrogen atom from the hydroxyl group; P is a polyethylene glycol residue with a number-average molecular weight of 300-60000 Da; X is selected from single bond, —CH04-07-2016

Zhenguo Wang, Fort Lee, NJ US

Patent application numberDescriptionPublished
20130027712OPTICAL IMAGING METHOD AND OPTICAL IMAGING APPARATUS - An optical imaging method is provided that can realize, at low cost, the extension of the imaging depth range. An optical imaging apparatus 01-31-2013
20130242309OPTICAL IMAGING METHOD AND OPTICAL IMAGING APPARTUS - An optical imaging method in an embodiment includes: a scanning step to scan each of a plurality of A-lines of an object with a signal light while alternately changing the phase difference between the signal light and a reference light to two preset phase differences; a detection step to detect the interference light of the signal light passing through the A-line and the reference light; and an imaging step to generate a complex interference spectrum based on the detection results of the interference lights corresponding to the plurality of A-lines sequentially obtained in the detection step according to the scanning, and form, based on the complex interference spectrum, the tomographic image along the arrangement of the plurality of A-lines in which a complex conjugate artifact is substantially removed.09-19-2013
20140125988OPTICAL IMAGING APPARATUS, OPTICAL IMAGING METHOD, APPARATUS FOR SETTING CHARACTERISTICS OF A LIGHT SOURCE, AND METHOD FOR SETTING CHARACTERISTICS OF A LIGHT SOURCE - An embodiment provides a method for setting the characteristics of the light to be output from a light source unit for optical coherence tomography, using a computer. This method is performed by using relation information in which a representative wavelength, a wavelength range including said representative wavelength, and the light loss amount due to absorption by a medium are related to each other. This method includes the following steps: setting each value of a first parameter and a second parameter among the representative wavelength, the wavelength range, and the light loss amount; acquiring a value of a third parameter among the representative wavelength, the wavelength range, and the light loss amount other than said first parameter and said second parameter based on the set two values and said relation information; and outputting a value of said acquired third parameter.05-08-2014
20140204386IMAGE MEASURING METHOD AND IMAGE MEASURING APPARATUS - [Problem] Image artifacts caused by noises in clock signals are suppressed.07-24-2014
20150015845OPTICAL COHERENCE TOMOGRAPHY WITH DYNAMIC FOCUS SWEEPING AND WINDOWED AVERAGING - During scan capture with an OCT imaging system, the focal plane position can be simultaneously shifted over at least a portion of an image range. As a result, a plurality of image frames respectively corresponding to various focal plane positions is acquired. The image frames can be combined to generate a composite image having suitable resolution throughout the image range, including regions associated with weak-intensity or low-reflectance features. Further, windowed averaging can be performed prior to generation of the composite image so that the composite image incorporates weights given to image data in focus.01-15-2015
20150204651DETECTION OF MISSAMPLED INTERFEROGRAMS IN FREQUENCY DOMAIN OCT WITH A K-CLOCK - Optical coherence tomography light sources can be non-linear and attempts to linearize them can lead to asynchrony between the light source and A-line scans and missampling in the scans causing signal noise. Accordingly, a system and methods are provided herein to detect missampling by obtaining a plurality of interferograms; providing at least two wavenumber reference signals at different wavenumbers, wherein the wavenumber reference signals comprise attenuated or enhanced portions of each of the plurality of interferograms; aligning each of the plurality of interferograms according to one of the at least two wavenumber reference signals; and for each of the plurality of interferograms, identifying an interferogram as missampled if another of the at least two reference signals does not align with a corresponding reference signal in a statistically significant number of the plurality of interferograms. An optical element, for example, an optical notch, may be used to generate the reference signals.07-23-2015

Patent applications by Zhenguo Wang, Fort Lee, NJ US

Zhenguo Xu, Xi'An CN

Patent application numberDescriptionPublished
20140066141Terminal Device and Molds of Button Shell and Inner Shell of Terminal Device - Embodiments of the present invention disclose a terminal device and molds of a button shell and an inner shell of the terminal device, which can be applied to the technical field of electronic devices. According to the embodiment of the present invention, the button shell and the inner shell can be connected without using an intermediate medium, and the button shell and the inner shell are fixedly connected by sliding between a slide rail on the button shell and a sliding slot on the inner shell, so that materials of the terminal device are saved, and an assembly process of the button shell and the inner shell of the terminal device can be simplified.03-06-2014

Zhenguo Zhao, Beijing CN

Patent application numberDescriptionPublished
20140162261DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.06-12-2014
Website © 2016 Advameg, Inc.