Shao, Beijing
Bin Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150120775 | ANSWERING RELATIONAL DATABASE QUERIES USING GRAPH EXPLORATION - Embodiments are directed to processing queries using schema graph traversal and to establishing a schema graph that allows queries to be answered by traversing graph nodes. In one scenario, a computer system receives a query which specifies relational tables and corresponding relationships that are to be retrieved from a relational database. The computer system accesses a schema graph that includes graph nodes representing relational tables, as well as edges that identify relationships between the relational tables. The graph nodes include relational data that was loaded from one storage area (e.g. a non-volatile storage area), and the schema graph is stored in a second storage area (e.g. a volatile storage area). The computer system then traverses the schema graph, beginning at a set of graph nodes and continuing along the edges to other graph nodes until the query has been satisfied, and then reports the results of the graph traversal. | 04-30-2015 |
Bing Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120310709 | COMPUTER-IMPLEMENTED METHOD AND APPARATUS FOR INTEGRATING HETEROGENEOUS BUSINESS PROCESSES - A computer-implemented method and apparatus for integrating heterogeneous business processes. In one embodiment, there is provided a computer-implemented method for integrating heterogeneous business processes, the method comprising: reading first process information of a first business process; obtaining from a unified process view second process information of a second business process; and integrating at least one part of the first process information and at least one part of the second process information into a third business process; wherein the first business process and the second business process are heterogeneous business processes. In another embodiment, there is provided a computer-implemented apparatus for integrating heterogeneous business processes. | 12-06-2012 |
20120316927 | COMPUTER-IMPLEMENTED METHOD AND APPARATUS FOR INTEGRATING HETEROGENEOUS BUSINESS PROCESSES - A computer-implemented method and apparatus for integrating heterogeneous business processes. In one embodiment, there is provided a computer-implemented method for integrating heterogeneous business processes, the method comprising: reading first process information of a first business process; obtaining from a unified process view second process information of a second business process; and integrating at least one part of the first process information and at least one part of the second process information into a third business process; wherein the first business process and the second business process are heterogeneous business processes. In another embodiment, there is provided a computer-implemented apparatus for integrating heterogeneous business processes. | 12-13-2012 |
20140122415 | GENERATION OF CUBE METADATA AND QUERY STATEMENT BASED ON AN ENHANCED STAR SCHEMA - A method for generating cube metadata based on an enhanced star schema includes extracting dimension references from a factless fact table in an enhanced star schema comprising a fact table, a plurality of dimension tables of the fact table and the factless fact table; constructing a hierarchy reference based on the dimension references; and generating cube metadata by combining the hierarchy reference with measures obtained from the fact table and a hierarchy obtained from the dimension tables in the enhanced star schema. | 05-01-2014 |
20140214592 | METHOD AND SYSTEM FOR ONLINE RECOMMENDATION - A technical solution for online recommendation. Determining, according to the first user's behaviors in the online decision process, which phase of the online decision process the first user is presented in, wherein the online decision process is divided into a plurality of phases depending on a decision conversion rate; selecting recommended items to be provided to the first user according to one or more second users' historical behavior records, wherein the one or more second users are users who are presented in one or more phases having a higher decision conversion rate than the determined phase. | 07-31-2014 |
Chen Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120020852 | ETHYLENE CRACKING FURNACE - An ethylene cracking furnace comprising a high pressure steam drum ( | 01-26-2012 |
20140199214 | Ethylene Cracking Furnace - The present disclosure provides an ethylene cracking furnace, comprising at least one radiant section provided with a bottom burner and/or a side burner, and at least one set of radiant coil arranged along a longitudinal direction of the radiant section. The radiant coil is an at least two-pass coil having an N−1 structure, wherein N is preferably a natural number from 2 to 8. A manifold is arranged at an inlet end of a downstream tube of said at least two-pass coil, and an outlet end of each upstream tube of said at least two-pass coil is connected to the manifold through a curved connector. The arrangement according to the present disclosure can effectively reduce the expansion differences between the upstream tubes and the downstream tubes, and therefore reduce the stress caused thereby. Consequently, bending of the radiant coil can be avoided, thereby extending the service life of the radiant coil. | 07-17-2014 |
20160045889 | Ethylene Cracking Furnace - The present disclosure provides an ethylene cracking furnace, comprising at least one radiant section provided with a bottom burner and/or a side burner, and at least one set of radiant coil arranged along a longitudinal direction of the radiant section. The radiant coil is an at least two-pass coil having an N−1 structure, wherein N is preferably a natural number from 2 to 8. A manifold is arranged at an inlet end of a downstream tube of said at least two-pass coil, and an outlet end of each upstream tube of said at least two-pass coil is connected to the manifold through a curved connector. The arrangement according to the present disclosure can effectively reduce the expansion differences between the upstream tubes and the downstream tubes, and therefore reduce the stress caused thereby. Consequently, bending of the radiant coil can be avoided, thereby extending the service life of the radiant coil. | 02-18-2016 |
Chunju Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120198539 | Service Access Method, System and Device Based on WLAN Access Authentication - The present application discloses a service access method based on the WLAN access authentication, which includes: in the process of performing the WLAN access authentication, a WLAN portal server transmits a first Cookie to a terminal, which has passed the WLAN access authentication; the terminal requests to access the service of the application system, and the service authentication center associated with the application system determines the terminal has passed the WLAN access authentication according to the first Cookie; the associated service authentication center obtains the identity token of the terminal through the first Cookie; the associated service authentication center transmits the obtained identity token of the terminal to the application system; and according to the identity token of the terminal, the application system provides the service access for the terminal. By the method, after the terminal passes the WLAN access authentication, it can access the service provided by several application systems without the service authentication, thus improving the user experience and reducing the system overhead of the application system. | 08-02-2012 |
Genze Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120148589 | HUMAN CANCER-RELATED GENE, ITS ENCODED PRODUCTS AND APPLICATIONS - The invention discloses a human cancer-related gene, LAPTM4B, its encoded products and their applications thereof. This human cancer-related gene provided by this invention comprises one of the following nucleotide sequences: (1) SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 6, or SEQ ID No: 8 in the sequence listings; (2) SEQ ID No: 4, SEQ ID No: 5, or SEQ ID No: 7 in the sequence listings which are proteins encoded by the polynucleotides in sequences of SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 and SEQ ID No: 6. (3) Applications of the polynucleotides and polypeptides in the listings in diagnosis and treatments of cancer. This invention enables the developments of new cancer diagnostic markers and new anti-cancer medicines. It would create a significant impact on human society. | 06-14-2012 |
Guangsheng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130011864 | PHOTOLUMINESCENT NANOPARTICLE, PREPARATION, AND APPLICATION THEREOF - Luminescent nanoparticles, preparation, and application thereof are disclosed. The luminescent nanoparticle consists of matrix, which is a macromolecular compound containing carboxyl group, and a rare-earth luminescent dye dispersed in the matrix. The preparation method of the luminescent nanoparticle comprises: dissolving the rare-earth complex luminescent dye and the macromolecular compound in organic solvent miscible with water, adding the solution into water, and forming the luminescent nanoparticle by coprecipitation-selfassembly process. The prepared luminescent nanoparticle has excellent long-wave excitational luminescent properties and good stability, and can be used in coupling the surface carboxyl group of a biomolecule. The biological probes based on such luminescent nanoparticles have wide application prospects on the aspects of high-sensitivity luminescent immunoassay, biological imaging and the like. | 01-10-2013 |
Gui Hua Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090038029 | Method to alleviate abiotic stress in plants - Plants can be modified to resist abiotic stress by effecting expression of PAP activity. | 02-05-2009 |
Hong Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140162261 | DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment. | 06-12-2014 |
Hua Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150248395 | DATA DISPLAY TECHNIQUE FOR AGGREGATE DISPLAY OF RELATED DATA - According to an aspect of the present disclosure, there is provided a system, a method, and/or a computer program product for data display, comprising: acquiring raw data content; determining a first set of data entries to be aggregately displayed from the raw data content; and in response to a request for an aggregate display, aggregately displaying the first set of data entries. | 09-03-2015 |
Jiafeng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140307668 | DATA TRANSMISSION METHOD, BASE STATION, AND USER EQUIPMENT - Embodiments of the present invention provide a data transmission method. The method includes: obtaining a slot format of a F-DPCH used for a UE; receiving an ACK message that is sent by a base station on an AICH; determining an F-DPCH frame offset τ | 10-16-2014 |
20150245269 | Method for Uplink Softer Handover, User Equipment, and Base Station - Embodiments of the present invention provide a method for an uplink softer handover and a user equipment. The method includes: detecting signal quality or signal strength of an intra-frequency neighboring cell; if there is an intra-frequency neighboring cell whose signal quality or signal strength meets a first threshold, reporting, through a physical control channel or by using scheduling information, related information of the intra-frequency neighboring cell that meets the first threshold to a base station to which a user equipment belongs. | 08-27-2015 |
Jianlei Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140351935 | METHOD, APPARATUS AND VIRTUAL MACHINE FOR DETECTING MALICIOUS PROGRAM - A method, an apparatus and a virtual machine for detecting a malicious program(s) are disclosed. The method comprises: setting a virtual memory ( | 11-27-2014 |
Jin Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100122589 | METHOD AND REAGENT TUBE FOR REDUCING REAGENT USAGE - The present invention provides a method for reducing reagent usage, comprising the steps of providing a retainer, at least one group of loopholes being provided on the sidewalls of said retainer; providing a colorimetric glass, adapted to be inserted into said retainer, for receiving the first reagent to be observed through said loopholes; providing a cap, for capping the colorimetric glass and the retainer into a whole, after the colorimetric glass being inserted into the retainer. The present invention mainly uses a reagent tube with a retainer having a new structure, a colorimetric glass and a cap, storing the first reagent only in the colorimetric glass, and the volume of the colorimetric glass is far less than that of the current reagent tube, thus the usage of the reagents can be reduced effectively. After comparison with experiments, in the method, the usage of the first reagent or second reagent is reduced separately by in amount of 70% to 90% or by in amount of 60% to 75%, and thus reducing the detecting cost effectively and economic burden to the detector. | 05-20-2010 |
Jingbo Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20160115285 | POLYETHYLENE COMPOSITIONS AND FILMS FORMED THEREFROM - A polyethylene composition comprising an ethylene/α-olefin copolymerized linear low density polyethylene, wherein the polyethylene composition has a Mw of from 100,000 g/mol to 200,000 g/mol, a Mw/Mn of from 4.0 to 9.0, a Mz/Mw of from 4.0 to 7.0, and a Mz+1/Mw of from 4.5 to 13.5, is provided. A film formed of the polyethylene composition is also provided. | 04-28-2016 |
Jinhua Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120271166 | METHOD AND DEVICE FOR DETECTING ELASTICITY OF VISCOUS ELASTIC MEDIUM - A method for nondestructively detecting an elasticity of a viscoelastic medium and a device for nondestructively detecting an elasticity of a viscoelastic medium are provided. The method comprises steps of: a) driving an ultrasonic transducer probe with a low-frequency vibration by a vibrator so as to produce an elastic wave to be propagated in the viscoelastic medium, transmitting an ultrasonic wave to the viscoelastic medium by the ultrasonic transducer probe, and collecting an ultrasonic echo returned from the viscoelastic medium; b) selecting an effective ultrasonic echo from the ultrasonic echo according to a duration of the low-frequency vibration and physical parameters of the viscoelastic medium; c) calculating a propagation velocity of the elastic wave in the viscoelastic medium according to the effective ultrasonic echo; and d) calculating the elasticity of the viscoelastic medium according to the propagation velocity of the elastic wave. | 10-25-2012 |
Jin Y. Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110137710 | METHOD AND APPARATUS FOR OUTLET LOCATION SELECTION USING THE MARKET REGION PARTITION AND MARGINAL INCREMENT ASSIGNMENT ALGORITHM - A system and method of determining at least one location for a retail outlet in a region are described. The system and method use clustering technology for partitioning the region into a fixed number of sub-regions. Then, the system and method compute marginal increments from input data for each sub-region. The system and method choose a sub-region having a maximal marginal increment for a location of a first retail outlet. | 06-09-2011 |
Jin Yan Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110188404 | METHOD AND APPARATUS FOR OPTIMAL SERVICE CHANNEL RECONFIGURATION BASED ON MULTI-AGENT SIMULATION - A method, and system employing the method, for service channel reconfiguration at a service outlet includes generating service transaction data of a service outlet, generating queue management system (QMS) data of the service outlet, and generating cost and profit data for the service outlet. Data is extracted from the service transaction data and the QMS data relating to specified parameters including customer experience data, and customer demand data. The service transaction data and the QMS data is integrated with the cost and profit data providing a unified objective function. Stochastic service processes and customer behavior data are modeled. The unified objective function is evaluated using the stochastic service processes and customer behavior data model, and the service channel function of the service outlet is reconfigured using the unified objective function. | 08-04-2011 |
20140214349 | ESTIMATING CONDITION OF BATTERY, RELATED SYSTEM AND VEHICLE - An apparatus for estimating a condition of a battery includes a mode identifying unit configured to identify a usage mode of the battery during a period of time and its corresponding attenuation curve, according to recorded data on battery usage, stored usage modes of the battery and attenuation curves corresponding to the various usage modes, the attenuation curve representing a change of a fully charged capacity of the battery with battery usage; and a condition estimating unit configured to calculate battery degradation according to the recorded data, the identified usage mode and its corresponding attenuation curve, the degradation representing a quantity of the fully charged capacity of the battery that is reduced over the battery usage. The condition of the battery is estimated so as to rationally judge the residual value of the battery in operation. | 07-31-2014 |
Jiyang Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140043311 | Liquid Crystal Display Driving Circuit, Driving Method Thereof And Liquid Crystal Display - Embodiments of the present disclosure provide a liquid crystal display driving circuit, a driving method thereof and a liquid crystal display, and relate to a field of display technique. The liquid crystal display driving circuit comprises a timing control circuit and at least two source driving circuits, and further comprises a polarity inversion circuit; the timing control circuit is configured to transmit a polarity inversion signal to the polarity inversion circuit; the polarity inversion circuit is configured to convert the polarity inversion signal into a first polarity inversion signal and a second polarity inversion signal which are output to the at least two source driving circuits, respectively, so that voltages of source signals driven by the at least two source driving circuits have opposite polarities with each other; wherein a phase of the first polarity inversion signal is different from that of the second polarity inversion signal. | 02-13-2014 |
20150054723 | Data Transmission Device, Data Transmission Method and Display Device - The present invention relates to a data transmission device, a data transmission method, and a display device using the data transmission device. The data transmission device comprises a multichannel V-By-One interface module, which comprises a receiving end, a transmitting end, and a buffer module arranged between the receiving end and the transmitting end. The receiving end transmits a plurality of control signals for a plurality of channels to the buffer module. The buffer module transmits one low-level control signal to the transmitting end when all the received control signals are at a low level. After receiving the one low-level control signal, the transmitting end simultaneously transmits output data corresponding to the respective channels, realizing time synchronization of all the output data, thus avoiding abnormal display of images, enhancing display quality of the images, and finally achieving the effect of optimizing and improving user experience. | 02-26-2015 |
20150279301 | DEVICE AND METHOD FOR ADJUSTING GAMMA VOLTAGE - The present invention provides a device and a method for adjusting Gamma voltage. The device for adjusting Gamma voltage comprises a Gamma voltage generating unit used for generating a plurality of Gamma voltages, the Gamma voltage generating unit comprising a plurality of output terminals for outputting the plurality of Gamma voltages; and a plurality of output units, output terminals of each of which are connected to output terminals of a corresponding Gamma voltage generating circuit among a plurality of Gamma voltage generating circuits of the display panel to be adjusted in one-to-one correspondence, the plurality of output units being used for outputting the plurality of Gamma voltages to output terminals of the Gamma voltage generating circuits. | 10-01-2015 |
Junhua Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130135809 | TERMINAL APPARATUS - The embodiment of the invention provides a hinge device and a folded apparatus having such hinge device. The hinge device comprises a hinge bracket, a first axis, and a second axis provided being parallel with each other and supported rotatablely by the hinge bracket, the first axis is connected to a first body of an apparatus, and the second axis is connected to a second body of the apparatus, the first body can rotate from 0 degree to 360 degree and/or from 360 degree to 0 degree with respect to the second body by being brought by the first axis and the second axis, wherein, when the first body rotates from 0 degree to a predetermined angle and/or from the predetermined angle to 0 degree with respect to the second body, the first axis rotates and the second axis rests, and wherein, when the first body rotates from the predetermined angle to 360 degree and/or from 360 degree to the predetermined angle with respect to the second body, the second axis rotates and the first axis rests. | 05-30-2013 |
Ke Feng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20160063376 | OBTAINING USER TRAITS - A method for obtaining user traits. In response to a first kind of data of a target user not being sufficient to obtain a trait of the target user, a second kind of data of the target user is collected, where the first kind of data and the second kind of data are different kinds of data. Based on the second kind of data, one or more reference users similar to the target user are determined. Based on the first kind of data of the reference users, the trait of the target user is determined. | 03-03-2016 |
Lei Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110124766 | METHOD OF ULTRAVIOLET LIGHT ASSISTED SURFACE MODIFICATION AN PRODUCT HAVING A SURFACE FORMED BY THIS METHOD - The present invention relates to a UV irradiation assisted method of surface modification, which comprises: introducing a functional group L onto the surface of a polymer material P through the photochemical reaction of a photosensitive group X under UV irradiation, wherein the photosensitive group X comprises at least one xanthone unit. | 05-26-2011 |
20120018912 | METHOD OF PREPARING NANO-DISPERSED HIGH-ALL-TRANS-CAROTENOID MICROCAPSULES - A method of preparing nano-dispersed high-all-trans-carotenoid microcapsules is provided, comprising: preparing 10-20% carotenoid suspension by milling the high-all trans-carotenoid crystals with dichloromethane until the particle size thereof is in the range of 2-5 μm, then supplying the suspension together with preheated dichloromethane of another pass into a dissolving tank to obtain a solution of 0.5-2%; delivering the solution together with ethanol or isopropanol into a crystallization device having high gravity rotating packed bed simultaneously and continuously, and then into a wiped-film evaporator for desolvation until the solid content is 10-20%, then a transparent alcohol dispersion of carotenoid is obtained; mashing the alcohol dispersion together with an aqueous solution containing an antioxidant and protective colloid and spray drying to obtain nano-dispersed high-all-trans-carotenoid microcapsules. As the crystals are nano-dispersed and the content of trans-isomer is more than 90%, the carotenoid microcapsules of present inventions exhibit high bioavailability. | 01-26-2012 |
Li Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130232432 | PORTABLE CONSOLE, WORKSTATION AND RADIOGRAPHY SYSTEM - A portable console communicates with a workstation of a radiography apparatus to allow a user to control the radiography apparatus via the portable console, the portable console comprising a user interface representing module configured to provide a user operation interface whereby the user inputs a user request, and configured to present a result returned from the workstation to the user, and a user interface service logical module configured to perform a protocol encapsulation and conversion on the user request according to a predefined communication protocol, to send the user request to the workstation, to receive the result returned from the workstation, and to perform a protocol conversion on the received result before sending the result to the user interface representing module. | 09-05-2013 |
Libai Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120071695 | Synthetic Method of 5,5-Dimethyl-2,4-Adipaldehyde-0,0-Boron Difluoride - This invention, which involves synthetic method of 5, 5- dimethyl-2, 4-adipaldehyde-0, 0-Boron difluoride, belongs to the field of organic synthesis. Synthetic method of 5, 5-dimethyl-2, 4-adipaldehyde-0, 0-Boron difluoride is to react pinacolone and boron trifluoride diethyl ether at low temperature, and then add aqueous alkaline solution in after treatment to extract product from ether, after that, separate fluid, condense organic phase and final product is obtained. Yield of this method is 2 to 3 times higher than that in literature, and apart from that, mild reaction condition, simple procedures, easy operation, and low cost make it easy for industrial production. The product can be used directly in next step reaction without any special purification. | 03-22-2012 |
Liming Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20160117493 | WORKING METHOD OF SMART KEY DEVICE - A working method of a smart key device, in which it includes: power on the smart key device; the smart key device reads Bluetooth module parameters, and determines whether the Bluetooth module parameters are read successfully, if the parameters are read successfully, switch the Bluetooth module to connection state, and execute a next step; if the parameters are not read successfully, execute the next step directly; the smart key device determines whether working voltage is lower than a preset value, if yes, prompt low voltage state, and the device is turned off after a first preset time; if no, the device tests working voltage and waits for an interrupt trigger signal; when the device receives the interrupt trigger signal, enter corresponding interruption according to the interrupt trigger signal, after execute corresponding interrupt processing, exit corresponding interruption and continue to test the working voltage. The present invention can unify interfaces of mobile devices, so as to make mobile payment safer and more convenient. | 04-28-2016 |
Mingchao Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130010790 | DYNAMIC UPDATING OF A LABEL SWITCHED PATH - A request to add or remove a leaf node to a multicast group in a Point-to-Multipoint Label Switched Path is detected, and the leaf node can select a pre-configured tunnel in accordance with the requested multicast group. The leaf node encapsulates the received request and transmits it through the selected pre-configured tunnel. A root node for the multicast group receives the request through the tunnel and can identify the leaf node responsible for transmitting the message by the tunnel header. The root can determine if a Point-to-Multipoint Label Switched Path exists for the request multicast group and can update the membership of the multicast group by adding or removing the leaf node to the multicast group. | 01-10-2013 |
20140328158 | PROTECTION GROUP SWITCHING FOR CIRCUIT EMULATION - A secondary edge node is coupled between the packet network and a non-packet network and is adapted to function as follows when a failure associated with the primary edge node or circuitry coupled thereto occurs. First, the secondary edge node may detect a failure associated with the primary edge node, which is associated with a primary media access control (MAC) address that is used to direct the packet traffic from the first edge node to the primary edge node. Upon detecting the failure, the secondary edge node may send a switch request message including a secondary media access control address that is associated with the secondary edge node to the first edge node. Sending the switch request message indicates that the first edge node should start sending traffic for the first session to the secondary edge node using the secondary media access control address. | 11-06-2014 |
20140330920 | DISCOVERING FORWARDING INFORMATION FOR LOCAL REPAIR - The present invention discloses a method of obtaining forwarding information in a network node device ( | 11-06-2014 |
20150163130 | METHOD ENABLING FAST SWITCHING BETWEEN MULTICAST TREES - Presented are a system and method of detecting a multicast tree link failure and performing a fast switch from the failed multicast tree communication path to a secondary multicast tree communication path. The methods are suitable for leaf nodes in a multiprotocol label switching network. The method generates a count of communication path failure detection packets and a count of communication path failure detection packets plus other packets and compares the counts to determine the status of the link. The system includes two counter components and a comparison component. | 06-11-2015 |
Ningsheng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090305975 | Use of Trap Protein Per se as an Active Ingredient for the Manufacture of a Medicament for the Treatment of Staphylococcus Aureus Infection - Disclosed herein is the use of TRAP per se as an active ingredient for the manufacture of a medicament for the treatment of | 12-10-2009 |
Peng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20080288691 | METHOD AND APPARATUS OF LOCK TRANSACTIONS PROCESSING IN SINGLE OR MULTI-CORE PROCESSOR - The present invention relates to a method and apparatus of lock transactions processing in a single or multi-core processor. An embodiment of the present invention is a processor with one or more processing cores, an address arbitrator, where one or more processing cores are configured to submit a lock transaction request to the address arbitrator corresponding to a specific instruction in response to the execution of the specific instruction. The lock transaction request includes a lock variable address asserted on an address bus. The processor further includes a lock controller for performing lock transaction processing in response to the lock transaction request, and notifying processing result to the processing core from which the lock transaction request was sent. The processor further includes a switching device, coupled to the address arbitrator and the lock controller, for identifying the lock transaction request and notifying the lock transaction request to the lock controller. | 11-20-2008 |
20090193424 | METHOD OF PROCESSING INSTRUCTIONS IN PIPELINE-BASED PROCESSOR AND CORRESPONDING PROCESSOR - The present invention discloses a method of processing instructions in a pipeline-based central processing unit, wherein the pipeline is partitioned into base pipeline stages and enhanced pipeline stages according to functions, the base pipeline stages being activated all the while, and the enhanced pipeline stages being activated or shutdown according to requirements for performance of a workload. The present invention further discloses a method of processing instructions in a pipeline-based central processing unit, wherein the pipeline is partitioned into base pipeline stages and enhanced pipeline stages according to functions, each pipeline stage being partitioned into a base module and at least one enhanced module, the base module being activated all the while, and the enhanced module being activated or shutdown according to requirements for performance of a workload. | 07-30-2009 |
20090248984 | METHOD AND DEVICE FOR PERFORMING COPY-ON-WRITE IN A PROCESSOR - There are disclosed a method and device for performing Copy-on-Write in a processor. The processor comprises: processor cores, L | 10-01-2009 |
20120210106 | METHOD OF PROCESSING INSTRUCTIONS IN PIPELINE-BASED PROCESSOR - The present invention discloses a method of processing instructions in a pipeline-based central processing unit, wherein the pipeline is partitioned into base pipeline stages and enhanced pipeline stages according to functions, the base pipeline stages being activated all the while, and the enhanced pipeline stages being activated or shutdown according to requirements for performance of a workload. The present invention further discloses a method of processing instructions in a pipeline-based central processing unit, wherein the pipeline is partitioned into base pipeline stages and enhanced pipeline stages according to functions, each pipeline stage being partitioned into a base module and at least one enhanced module, the base module being activated all the while, and the enhanced module being activated or shutdown according to requirements for performance of a workload. | 08-16-2012 |
Qun Shao, Beijing CN
Rongguang Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120195895 | Fusion Protein of an Anti-CD20 Antibody Fab Fragment and Lidamycin, a Method for Preparing the Same, and the Use Thereof - The present invention relates to an anticancer drug, an energized fusion protein Anti-CD20(Fab)-LDM of lidamycin, a gene encoding the same; and further relates to a method for construction of the energized fusion protein in a genetic engineering manner and the use of the energized fusion protein. The applicant provides an anti-tumor drug with a good targeting ability by providing the energized fusion protein. | 08-02-2012 |
Rui Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140053959 | HEAT TREATMENT PROCESS OF HIGH-MG ER-MICROALLOYED ALUMINUM ALLOY COLD-ROLLED PLATES RESISTANT TO INTERGRANULAR CORROSION - A heat treatment process of high-Mg Er-containing aluminum alloy cold-rolled plates resistant to intergranular corrosion is disclosed, which belongs to the field of non-ferrous metals. The mass percentage of each component of high-Mg Er-containing aluminum alloy heat-rolled plates is, respectively, 5.8%-6.8% of Mg, 0.4%-0.8% of Mn, 0.15%-0.25% of Er, 0.15%-0.25% of Zr, the unavoidable impurities content being less than 4%, the balance being Al. The alloy hot-rolled plates are cold-rolled until the final cold deformation being 75%-90% after the intermediate annealing; the aluminum alloy cold-rolled plates undergo a stabilization annealing at the annealing temperature of 235° C. to 245° C. for 3.5-4 hours, and then is cooled in air to room temperature. This process significantly improves the resistance to intergranular corrosion while it does not reduce the strength of the alloy significantly. | 02-27-2014 |
Suying Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20160038547 | LACTOBACILLUS PLANTARUM CAPSULE FOR POULTRY AND USE THEREOF - The present invention relates to a | 02-11-2016 |
Wei Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090018025 | Testing Method of Nucleic Acid Binding Protein Based on Biochip - A testing method of nucleic acid binding protein based on biochip, comprises the following steps: 1. puts a plurality of groups solution including nucleic acid captured probes into biological sample including a plurality of nucleic acid binding protein to be test, and thus forming nucleic acid captured probe-nucleic acid binding protein complexes; such nucleic acid captured probe includes at least a segment of binding sequence which can bind with aimed nucleic acid binding protein; 2. separates such nucleic acid captured probe-nucleic acid binding protein complexes, then recoveries nucleic acid captured probes; 3. hybridizes the nucleic acid captured probes according to step 2 with a plurality of single strand blotting probes on biochip substrate; the sequence of such blotting probe compensates with such nucleic acid captured probe or one of its strand; 4. detects the result of hybridization. | 01-15-2009 |
20120228386 | MICRODEVICES CONTAINING PHOTORECOGNIZABLE CODING PATTERNS AND METHODS OF USING AND PRODUCING THE SAME - This invention relates generally to the field of moiety or molecule analysis, isolation, detection and manipulation and library synthesis. In particular, the invention provides a microdevice, which microdevice comprises: a) a substrate; and b) a photorecognizable coding pattern on said substrate. Preferably, the microdevice does not comprise an anodized metal surface layer. Methods and kits for isolating, detecting and manipulating moieties, and synthesizing libraries using the microdevices are also provided. The invention further provides two-dimensional optical encoders and uses thereof. In certain embodiments, the invention provides a microdevice, which microdevice comprises: a) a magnetizable substance; and b) a photorecognizable coding pattern, wherein said microdevice has a preferential axis of magnetization. Systems and methods for isolating, detecting and manipulating moieties and synthesizing libraries using the microdevices are also provided. | 09-13-2012 |
Wenlong Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120127206 | MULTI-TOUCH INTERFACE GESTURES FOR KEYBOARD AND/OR MOUSE INPUTS - A mouse-and-keyboard based user interface is updated based on gestures made on a touch screen that is displaying the mouse-and-keyboard based user interface. The user interface update process includes the steps of receiving one or more touch events in response to a gesture made on the touch screen, translating the touch events to a mouse-and-keyboard based command, transmitting the mouse-and-keyboard based command to an operating system, and receiving an updated display in response thereto. | 05-24-2012 |
20140320421 | VIRTUAL TOUCHPAD WITH TWO-MODE BUTTONS FOR REMOTE DESKTOP CLIENT - Left- and right-click buttons of a virtual touchpad each have two modes, a “click” mode and an “on/off” mode. In “click” mode, touching a finger to the left- or right-click button triggers a mouse button down event while releasing a finger from the button triggers a mouse button up event. In “on/off” mode, the left- and right-click buttons each have two states, “on” and “off.” If the current state of the left- or right-click button is “off,” then touching the button triggers the mouse button down event, while releasing the button changes the state of the button to “on” but does not trigger any mouse events. Conversely, if the current state of the left- or right-click button is “on,” then touching the button does not trigger any mouse events, but releasing the button thereafter changes the state of the button to “off” and triggers the mouse button up event. | 10-30-2014 |
20150089381 | EYE TRACKING IN REMOTE DESKTOP CLIENT - A remote desktop client application on a client device receives screen data from a remote desktop on a remote server and displays a portion of the remote desktop, a mode icon, and direction icons. In a first mode, the remote desktop client detects a direction icon being selected by the user's eye movements and locally scrolls the remote desktop to display another portion of the remote desktop. The remote desktop switches to a second mode after detecting the mode icon being selected based on the user's eye movements. In the second mode, the remote desktop client detecting a direction icon being selected by the user's eye movements and sends a scrolling command to remotely scroll in the remote desktop. The remote desktop client receives updated screen data of the remote desktop from the remote server and displays the other portion of the remote desktop based on the updated screen data. | 03-26-2015 |
20150135126 | AUTOMATED TOUCH SCREEN ZOOM - Systems and techniques are described for automated zoom and selection of content on a touch screen device. A described technique includes receiving a first touch input contacting a touch screen display of a user device at a first position in a user interface presented at a first magnification, while continuing to receive the first touch input determining that a duration of the first touch input has exceeded a predetermined threshold duration, and increasing, based on determining that the duration of the first touch input has exceeded than the predetermined threshold duration, the magnification of the user interface to a second magnification, and performing an action based on the first touch input. | 05-14-2015 |
20150163281 | MOVING OBJECTS OF A REMOTE DESKTOP IN UNSTABLE NETWORK ENVIRONMENTS - A computer implemented method is configured to remotely access a desktop hosted by a server system. The method displays a local view of a remote desktop hosted by a server system based on information received from the server system where the remote desktop includes a first object. The method then detects user input indicating a request to move the first object. In response to the request, the method generates a second object to represent the first object. The second object is generated to correspond to the visual appearance of the object. The method then presents the second object on the local view of the remote desktop. The second object may overlay the first object. The second object is then moved to a destination on the local view of the desktop according to the request. Once the move has concluded, the method transmits the destination to the server system. | 06-11-2015 |
20150302621 | CONCEALING SENSITIVE INFORMATION ON A DISPLAY - An example method is provided for a computing device, coupled to a first display and a second display, to conceal sensitive information on a display. The method may comprise in response to detecting sensitive information in a desktop shown on the first display, generating a replacement image that conceals the detected sensitive information in the desktop and sending the replacement image to the second display for display. Otherwise, a mirror image of the desktop shown on the first display may be sent to the second display for display. | 10-22-2015 |
Xiang Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130275742 | TERMINAL AND SWITCHING METHOD - Terminals and switching methods are provided. The terminal includes: a first component ( | 10-17-2013 |
20130331957 | Information Control Method and Electronic Device - The invention discloses an information control method and an electronic device. The information control method is applied to a first electronic device, and the first electronic device is connected with a second electronic device. The method includes: detecting feature information of the first electronic device according to a connection relation between the first electronic device and the second electronic device; and controlling the first electronic device according to the feature information. | 12-12-2013 |
20140146248 | DISPLAY MODULE AND ELECTRONIC TERMINAL - The present invention provides a display module ( | 05-29-2014 |
20140160069 | Electronic Apparatus And Electronic System - The present invention provides an electronic apparatus and an electronic system. The electronic apparatus includes: at least one programmable electric conductive unit configured to switch a good conductor mode and a normal conductor mode according to a control signal when it contacts with a second electronic apparatus so as to transmit predetermined information to the second electronic apparatus contacting with the electronic apparatus; a control unit configured generate the control signal having a predetermined frequency; and a feedback information receiving unit configured to receive feedback information transmitted by the second electronic apparatus, the feedback information being transmitted in response to the reception of the predetermined information. | 06-12-2014 |
20150070322 | METHOD FOR IDENTIFYING INPUT INFORMATION, APPARATUS FOR IDENTIFYING INPUT INFORMATION AND ELECTRONIC DEVICE - A method for identifying input information, an apparatus for identifying input information and an electronic device are provided. The method for identifying input information is applied to an electronic device. The electronic device includes a first panel and a second panel, and further includes a collimated light generator arranged on the first panel and two or more optical detection devices arranged on the first panel. In the method, firstly an information input operation is acquired; then a variation of shadow of the information input operation blocking collimated light beams generated by the collimated light generator is acquired via the optical detection device; and the input information corresponding to the information input operation is acquired according to the variation of shadow. | 03-12-2015 |
20150077343 | INPUT DEVICE AND ELECTRONIC DEVICE HAVING THE SAME - An input device is provided in the present application. The input device includes a first panel and a second panel, the first panel is provided with multiple grooves; the second panel is located under the first panel or fused to a bottom of the first panel, and includes a sensing unit configured to sense a key. In the input device, each of the grooves is arranged to correspond to one key area, and a key command may be input by performing a touch key operation on a corresponding sensing unit under the groove. Compared with the conventional input device, in the input device of the present application, the input of the key command may be realized without key caps and scissor-shaped structures for supporting the key caps, thereby shortening the key travel and reducing the thickness of the input device. | 03-19-2015 |
20150116238 | INFORMATION INTERACTION METHOD AND ELECTRONIC DEVICE - An information interaction method and an electronic device are provided. The method is applicable in a first electronic device. The first electronic device includes a first interaction unit and a second interaction unit, where the first interaction unit includes a first display unit. The method includes receiving device information of a second electronic device via the second interaction unit when the second interaction unit is in a working state; processing the device information of the second electronic device; and sending a procedure of the processing to the first interaction unit via the second interaction unit for displaying via the first display unit. When the second interaction unit is in a working state, the second interaction unit receives device information of the second electronic device, and the connection with the second electronic device may be achieved without inputting information manually, therefore the connection process is simple. | 04-30-2015 |
20150116241 | DATA DISPLAY METHOD AND ELECTRONIC DEVICE THEREOF - A data display method and an electronic device thereof are provided by the invention to address the technical problem in the prior art of the low security for displaying data due to the indistinguishable data display of the electronic device. The method is applied in an electronic device. The electronic device comprises a display unit and a touch unit. The electronic device is able to communicate data with an electronic accessory and there are public data and private data corresponding to the electronic accessory. The method comprises steps of verifying the electronic accessory when the electronic accessory has been attached on the surface of the touch unit; controlling the display unit to display both the public data and the private data if the verification is successful; and controlling the display unit to display only the public data if the verification is not successful. | 04-30-2015 |
Xianjie Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140086379 | DRIVING CIRCUIT, SHIFTING REGISTER, GATE DRIVER, ARRAY SUBSTRATE AND DISPLAY DEVICE - The disclosure relates to the field of liquid crystal display, and provides a driving circuit, a shifting register, a gate driver, an array substrate and a display device. The driving circuit comprises a pull-up module, a first pull-down module, a second pull-down module, a pull-up driving module, a pull-down driving module and a resetting module, wherein the first pull-down module outputs a switching-off signal to the output terminal according to a signal input from the clock retarding signal input terminal and a signal at a pull-down node; a second pull-down module, when the signal input from the signal input terminal is at a low level, outputs a switching-off signal to the pull-up node and the output terminal according to a signal input from a clock signal input terminal; wherein when the signal input from the signal input terminal is at a high level, the signal input from the clock retarding signal input terminal is also at a high level, and the signal input from the clock signal input terminal and that input from the clock retarding signal input terminal are opposite in phase. The driving circuit according to the disclosure can effectively remove the defect of the threshold voltage drifting due to the gate being applied to a bias voltage stress, and can also decrease the noise of the output voltage. | 03-27-2014 |
20140104152 | SHIFT REGISTER, GATE DRIVING APPARATUS OF LIQUID CRYSTAL DISPLAY AND LIQUID CRYSTAL DISPLAY - Embodiments of the present applicant provide a shift register which comprises a pulling-up module for connecting electrically a clock signal inputting terminal with a control signal outputting terminal under a control of a signal received from a control signal inputting terminal; a resetting module for resetting a pulling-up node and the control signal outputting terminal under a control of a signal received from a reset signal inputting terminal; a pulling-down module for connecting electrically the control signal outputting terminal with a low voltage signal inputting terminal under controls of the signal received from the clock signal inputting terminal and a signal at the pulling-up node, wherein the pulling-up node is a connection point where the pulling-up module, the resetting module and the pulling-down module are connected together. | 04-17-2014 |
20140119490 | SHIFT REGISTER, METHOD FOR DRIVING THE SAME, AND ARRAY SUBSTRATE - The disclosure relates to a shift register, a method for driving the same, an array substrate and a display apparatus, for reducing the wiring space as required by the shift register. The shift register comprising a control unit and a plurality of output sub-units, wherein the control unit comprises a plurality of output terminals which output gate line control signals sequentially according to the control timing sequence during a first preset time period, and output the gate line control signals sequentially according to the control timing sequence during a second preset time period in an order opposite to or identical to an order in which the gate line control signals are output during the first preset time period; each of the output sub-units is connected to a corresponding output terminal of the control unit, and divides the gate line control signal output from the connected output terminal into at least a first gate line control signal and a second gate line control signal, and outputs the first gate line control signal and the second gate line control signal respectively. | 05-01-2014 |
20140126684 | SHIFT REGISTER, GATE DRIVING CIRCUIT AND DISPLAY APPARATUS - The present disclosure relates to a field of liquid crystal display, and discloses a shift register, a gate driving circuit and a display apparatus, wherein the shift register comprises a precharging module, a pulling-up module, a pulling-down driving module, a pulling-down module and a resetting module, each shift register may perform a bi-directional scanning, that is, it may scan not only forward but also backward, so that a cost for producing the liquid crystal display including the shift registers is reduced, and a manufacturing efficiency is increased. | 05-08-2014 |
20140168048 | SHIFT REGISTER UNIT, SHIFT REGISTER AND SCANNING METHOD THEREOF, AND DISPLAY DEVICE - A shift register unit, a shift register and the scanning method thereof, and a display device are disclosed. Bidirectional scanning can be achieved while the number of the switches used in the shift register could be reduced, and the spaces are saved. Furthermore, the problem of large coupled noise voltage is solved, and the performance of the shift register is improved. The circuit comprises: a second switch connected with a first switch; a fourth switch connected with a third switch; a fifth switch connected with a sixth switch; a first input and a eighth switch connected with a seventh switch; a output end and a ninth switch connected with the eighth switch; an eleventh, a twelfth, and a thirteenth switch connected with a tenth switch; a fourteenth switch connected with the thirteenth switch; a fifteenth switch connected with the fourteenth switch; a capacitor positioned between a first node and a second nodes. | 06-19-2014 |
20140176410 | GATE DRIVING CIRCUIT, DISPLAY MODULE AND DISPLAY DEVICE - Provided are a gate driving circuit, a display module and a display device belonging to the field of display technique and being designed for solving the problem of high power consumption of the display module in the prior art. The gate driving circuit is used for driving gates of TFTs corresponding to gate lines connected thereto, and includes at least two stages of shift registers connected in cascade, wherein each stage of shift register includes a first output terminal and a second output terminal, the first output terminal is connected to an enable signal input terminal of a next stage of shift register so as to output a next stage enable signal to the next stage of shift register, and the second output terminal is connected to a corresponding gate line so as to apply a gate driving signal on the gates of TFTs through the corresponding gate line. | 06-26-2014 |
20150055041 | DISPLAY PANEL AND ENCAPSULATION METHOD THEREOF, AND LIQUID CRYSTAL DISPLAY DEVICE - A display panel and an encapsulation method thereof, and a liquid crystal display device are provided. The display panel comprises an array substrate and a color filter substrate, the array substrate and the color filter substrate are connected together via a sealant component, the array substrate comprises a display region and a peripheral region surrounding the display region, the sealant component comprises insulating sealant and conductive sealant and is disposed in the peripheral region of the array substrate, a gate electrode driving GOA circuit is disposed in the peripheral region of the array substrate, and the gate electrode driving GOA circuit and the conductive sealant are not located on the same side of the peripheral region of the display region. | 02-26-2015 |
20150092134 | ARRAY SUBSTRATE, LIQUID CRYSTAL DISPLAY PANEL AND DISPLAY DEVICE - An array substrate, a LCD panel and a display device are disclosed. The array substrate includes: a substrate, a plurality of pixels disposed on the substrate and defined by a plurality of gate lines and a plurality of data lines. A common electrode and a pixel electrode are disposed in each pixel region. Two pixels at adjacent rows in a same column form a pixel set. A first gate line and a second gate line are disposed between the two pixels of the pixel set. The data line is disposed on the same side of the two pixels. A first switch transistor and a third switch transistor are disposed in one pixel region of the pixel set and at least a second switch transistor is disposed in the other pixel region. | 04-02-2015 |
20150129882 | ARRAY SUBSTRATE AND METHOD FOR MANUFACTURING THE SAME, AND DISPLAY DEVICE - The invention relates to an array substrate for a display device and to a method for manufacturing an array substrate comprising a thin-film transistor (“TFT”). An array substrate according to an embodiment of the invention comprises a source electrode, a gate electrode and a drain electrode, wherein the gate electrode is located on a first metal layer, the source electrode and the drain electrode are located on a second metal layer, and in the case that dislocation occurs between the first metal layer and the second metal layer, the area of the overlapping region between the source electrode and the gate electrode keeps constant. | 05-14-2015 |
20150277226 | MANUFACTURING METHOD OF MASK PLATE FOR SHIELDING DURING SEALANT-CURING - A manufacturing method of a mask plate for shielding during sealant-curing includes: forming a negative photoresist light-shielding material layer on a transparent substrate; with a color-filter mask plate set, exposing the substrate formed with the negative photoresist light-shielding material layer; developing the substrate after exposing to form the pattern of the mask plate. The method does not require separate fabrication of a mask plate, thereby significantly reducing the manufacturing costs of the mask plate for shielding during sealant-curing. | 10-01-2015 |
20150318053 | GATE DRIVING CIRCUIT, ARRAY SUBSTRATE AND DISPLAY DEVICE - The present disclosure discloses a gate driving circuit including multi-stage shift registers, and an output side switch element which is controlled by the second clock signal to be turned on or off. The output side switch element is located between an input terminal and an output terminal of each stage shift register. An output terminal of the (N+2)-th stage shift register is coupled to a reset terminal of the N-th stage shift register. | 11-05-2015 |
20150325158 | DISPLAY PANEL AND DISPLAY DEVICE - A display panel and a display device comprising a pixel area (A) and a peripheral wiring area, wherein detection switches are arranged between the pixel area (A) and the peripheral wiring area, the detection switches correspond to gate lines ( | 11-12-2015 |
20150340385 | CAPACITOR FOR TFT ARRAY SUBSTRATE AND METHOD OF MANUFACTURING THE SAME, AND DEVICES ASSOCIATED WITH THE SAME - The present invention discloses a capacitor for a TFT array substrate and a method of manufacturing the same, and the present invention further discloses a shift register, a gate driver, an array substrate and a display device using the capacitor. The TFT array substrate comprises a TFT gate layer, a gate insulation layer, a first ITO layer, a TFT active layer, a TFT source-drain layer, a passivation layer and a second ITO layer formed sequentially on a glass substrate, and the capacitor is consisted of the first ITO layer, the passivation layer and the second ITO layer. In addition, the second ITO layer is connected with the TFT gate layer in a region where the capacitor is located, thereby forming two capacitors connected in parallel; or, the first ITO layer is connected with the TFT gate layer in the region where the capacitor is located, thereby also forming two capacitors connected in parallel. With the present invention, a space occupied by the capacitor for the TFT array substrate is reduced, and a size of the shift register is reduced, so as to be suitable for a narrow frame design. | 11-26-2015 |
20150348507 | CIRCUIT AND DISPLAY DEVICE - A circuit arranged in a gate drive area on a display panel comprises control lines. Each control line is connected with multiple gate lines, and the gate lines connected with each control line are distributed at intervals on the display panel. A switch-on level can be provided sequentially to the control lines in a preset time interval when the display panel is being shut down. The circuit mitigates or otherwise eliminates a shutdown afterimage phenomenon and also avoids delivery of a relatively large instantaneous current generated at shutdown. | 12-03-2015 |
20150371716 | SHIFT REGISTER UNITS, GATE DRIVER CIRCUITS AND DISPLAY DEVICES - The present disclosure provides a bi-directional scanning gate driver and its shift register unit. The shift register unit comprises a shift trigger signal/reset signal input terminal (1), a reset signal/shift trigger signal input terminal (2), the first clock terminal (6) and an output terminal (8). The shift trigger signal/reset signal input terminal (1) and the reset signal/shift trigger signal input terminal (2) are coupled to one of the shift trigger signal and the reset signal. When it is switched between the forward shift and the reverse shift, the signals coupled to the shift trigger signal/reset signal input terminal (1) and the reset signal/shift trigger signal input terminal (2) are exchanged. The first clock terminal (6) is coupled to a clock signal for providing a driving level to the output terminal (8). The circuit of such a shift register unit is constituted of at least four transistors and one capacitor. The structure of the circuit of the present disclosure is simple and may solve the technical problem of coupling noise voltage generated by the clock signal. | 12-24-2015 |
20160027396 | GATE DRIVING CIRCUIT, DISPLAY DEVICE AND DRIVING METHOD - A gate driving circuit, a display device, and a driving method are disclosed in the present invention. The gate driving circuit comprises: a plurality of cascaded shift register units and a control unit, wherein every two adjacent shift register units constitute a shift register set and are connected to two gate lines through the control unit, and wherein the control unit controls the shift register units of the shift register set to supply drive signals to the two gate lines, respectively. Embodiments of the present invention improve a configuration of the circuit on the basis of original shift registers, thereby achieving compensation of charge rations between different frames and effectively alleviating phenomena of apparent bright/dark lines such as the vertical lines of the existing products. | 01-28-2016 |
20160049128 | SHIFT REGISTER UNIT AND DRIVING METHOD THEREFOR, SHIFT REGISTER, DISPLAY DEVICE - There is provided a shift register unit and driving method for the shift register unit, a shift register and a display device. The shift register unit comprises a first capacitor (C | 02-18-2016 |
20160093264 | SHIFT REGISTER UNIT AND GATE DRIVE APPARATUS - A shift register unit and a gate drive apparatus are disclosed. The shift register unit comprises a pre-charge module configured to provide a voltage of a first voltage source to a first node under the control of an input signal from the signal input terminal, the first node being an output node of the pre-charge module; a pull-up module, and configured to provide a clock signal from a first clock signal terminal to a signal output terminal under the control of a voltage of the first node; a reset module configured to provide a voltage of a second voltage source to the first node under the control of an input signal from a reset signal terminal; and a pull-down module configured to maintain the first node and the signal output terminal at a low level during non-operating time of the shift register unit. | 03-31-2016 |
Xiaoting Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140244272 | CONTROL METHOD AND ELECTRONIC DEVICE - The present invention discloses a control method and an electronic device, which are capable of solving the technical problem in the prior art that it is not rapid enough when controlling a voice recognition engine to enter an operating state. The control method is applied in an electronic device which comprises a voice recognition engine and comprises or is connected to a microphone, wherein the method comprises: acquiring first airflow information collected by the microphone; determining whether the first airflow information satisfies a first preset condition; and controlling the voice recognition engine to enter a second state when the first airflow information satisfies the first preset condition. | 08-28-2014 |
20150074598 | INFORMATION PROCESSING METHODS AND ELECTRONIC DEVICES - The present invention discloses an information processing method and an electronic device, the method applied in the electronic device, the electronic device having a display screen and at least a first operation mode and a second operation mode different from the first operation mode, the method comprising: when the electronic device is in the first operation mode, displaying a first image in a first size on a first display area of the display screen, and detecting whether a first operation of switching an operation mode of the electronic device from the first operation mode to the second operation mode is obtained; when the first operation is obtained, switching the operation mode of the electronic device from the first operation mode to the second operation mode in response to the first operation, and displaying a second image on the display screen; the display screen has a first display area in the second operation mode and a second display area in the second operation mode, first sub display content in the second operation mode is displayed, and second sub display content in the second operation mode is displayed. | 03-12-2015 |
Xiao Yin Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100000320 | METHOD AND APPARATUS FOR QUANTITATIVELY DETECTING UNBALANCED STATE AND METHOD FOR DETECTING CLAMPING STATE OF A WORKPIECE - A method and an apparatus for quantitatively detecting the unbalanced state of a rotating shaft and a clamping state of a workpiece clamped to a shaft are disclosed by solving with a nonlinear multivariable method a Lagrange kinematics equation to determine from acquired position, velocity, acceleration and torque signals of the rotating shaft an unbalanced amplitude variable and an unbalanced angle variable of the rotating shaft, optionally both with and without a workpiece. The motor driving the shaft is energized with a combined S-shaped and sinusoidal velocity profile with a position profile component, a velocity profile component, and an acceleration profile component. The components are selected such that the motor speed during the accelerating and decelerating stages does not change abruptly. | 01-07-2010 |
Xueyan Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140250042 | System and Method for Improving the Flight Safety - The present invention relates to a system for improving the flight safety, comprising: a prediction component which predicts behaviors of an aircraft; and an indication component which indicates adjustment of an operation of the aircraft to reduce the possibility of occurrence of abnormal flying behaviors. | 09-04-2014 |
Ya Fei Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100287265 | METHOD AND DEVICE FOR RESTORING AT LEAST ONE SETTING - A method and devices for restoring at least one setting are provided, the client device receives a code generated by a management device based on a time value and a parameter value that uniquely identifies the client device; the client device determines whether the code is valid; and if the code is valid the client device restores the at least one setting of the client device. It provides a convenient way to restore at least one setting of a client device. | 11-11-2010 |
Yiming Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100034851 | AIDS Vaccine Based on Replicative Vaccinia Virus Vector - Replicative live-vector vaccine against AIDS expressing antigen of human immunodeficiency virus (HIV) and its application are provided. Said vaccine is constructed on the basis of replicative vaccinia virus, such as vaccinia virus TianTan strain. The replicative live-vector vaccine of present invention is capable of inducing high level humoral and cell immunoresponse against HIV. The vector for constructing said vaccine, and immunization procedure using said vaccine are also provided. | 02-11-2010 |
20110195084 | Anti-HIV Vaccine Constructed Based on Amino Acid Mutations in Attenuated Live EIAV Vaccine - Provided are antigenic polypeptides of HIV envelope glycoproteins which are constructed based on amino acid mutation of attenuated live vaccine of Equine Infectious Anemia Virus, DNA constructions and recombinant virus vectors comprising polynucleotides encoding said polypeptides, antibodies against said polypeptides as well as uses thereof in preventing and treating HIV infection. Said antigenic polypeptides and vaccines can induce high titer neutralization antibodies against HIV in organism. | 08-11-2011 |
20150132332 | Anti-HIV Vaccine Constructed Based on Amino Acid Mutations in Attenuated Live EIAV Vaccine - Provided are antigenic polypeptides of HIV envelope glycoproteins which are constructed based on amino acid mutation of attenuated live vaccine of Equine Infectious Anemia Virus, DNA constructions and recombinant virus vectors comprising polynucleotides encoding said polypeptides, antibodies against said polypeptides as well as uses thereof in preventing and treating HIV infection. Said antigenic polypeptides and vaccines can induce high titer neutralization antibodies against HIV in organism. | 05-14-2015 |
Yin-Liang Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110157115 | METHOD OF CORRECTING BRIGHTNESS OF ELECTRONIC DISPLAY - The present invention discloses a method of brightness correction for the electronic display, which consists of the following steps: take pictures of the electronic display; get the characteristic values of all the light-emitting components in the pictures; calculate the correction values of each light-emitting component with the characteristic values; correct the brightness of the display with the correction values. The present invention reduces the time cost of measuring the actual brightness values of the light-emitting components, and improves the efficiency of correcting the brightness uniformity of the electronic display. | 06-30-2011 |
Yongbo Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150338577 | Polarization Rotator-Splitter/Combiner Based On Silicon Rib-Type Waveguides - Various embodiments of an integrated polarization rotator-splitter/combiner apparatus are described. An integrated polarization rotator-splitter apparatus may include an input waveguide section, a polarization rotator section, a polarization splitter section and an outgoing waveguide section, which can also be reversely connected as a polarization rotator-combiner. | 11-26-2015 |
20150378185 | Silicon-Based Rib-Waveguide Modulator And Fabrication Method Thereof - Various structures of an electro-optic device and fabrication methods thereof are described. A fabrication method is provided to fabricate an electro-optic device which may include a silicon-based rib-waveguide modulator which includes a first top silicon layer, having a first doped region that is at least partially doped with dopants of a first conducting type, a second top silicon layer, having a second doped region that is at least partially doped with dopants of a second conducting type, and a thin dielectric gate layer disposed between the first top silicon layer and the second top silicon layer. The second doped region may be at least in part directly over the first doped region. The modulator may also include a rib waveguide formed on the second top silicon layer, a first electric contact formed on the first top silicon layer, and a second electric contact formed on the second top silicon layer. | 12-31-2015 |
20160041340 | Optical Coupler Having Anchored Cantilever Structure With Multi-Stage Inverse Taper Core Waveguide And Fabrication Method Thereof - An optical coupler structure may include a substrate, a waveguide section and an anchored cantilever section. The substrate may include a main body and a sub-pillar structure formed on the main body. The waveguide section may be disposed on the substrate, and may include a core waveguide of a first material surrounded by a cladding layer of a second material. The anchored cantilever section may be disposed on the sub-pillar structure on the substrate, which may be configured to support the cantilever section and separate the cantilever section from the main body of the substrate. The anchored cantilever section may include a multi-stage inverse taper core waveguide and a cladding layer, of the second material, which surrounds the multi-stage inverse taper core waveguide. | 02-11-2016 |
Zhicai Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140001090 | PROCESS FOR HYDROTREATING HEAVY RAW OILS | 01-02-2014 |
Zhufeng Shao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120082526 | SPINDLE HEAD STRUCTURE ROTATABLE IN A/B AXES - A spindle head structure rotatable in A/B axes is provided, comprising: a spindle support, an intermediate support, a base support, an upper telescopic strut and a lower telescopic strut. The spindle support may be adapted to be fixed with a spindle. The intermediate support may be connected with the spindle support via two coaxial upper revolute pairs. The base support may be connected with the intermediate support via two coaxial lower revolute pairs. The upper telescopic strut may be connected between the spindle support and the intermediate support. And the lower telescopic strut may be connected between the intermediate support and the base support. | 04-05-2012 |